Production Of Polyhydroxyalkanoates With A Defined Composition From An Unrelated Carbon Source

Abstract

Cells and methods for producing polyhydroxyalkanoates. The cells comprise one or more recombinant genes selected from an R-specific enoyl-CoA hydratase gene, a PHA polymerase gene, a thioesterase gene, and an acyl-CoA-synthetase gene. The cells further have one or more genes functionally deleted. The functionally deleted genes include such genes as an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase, and a 3-ketoacyl-CoA thiolase gene. The recombinant cells are capable of using producing polyhydroxyalkanoates with a high proportion of monomers having the same carbon length from non-lipid substrates, such as carbohydrates.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 USC .sctn.119(e) to U.S. Provisional Patent Application 61/699,044 filed Sep. 10, 2012, the entirety of which is incorporated herein by reference.

FIELD OF THE INVENTION

[0003] The present invention is directed to cells and methods for producing polyhydroxyalkanoates having a defined monomeric composition at a high yield from an unrelated carbon source.

BACKGROUND

[0004] Polyhydroxyalkanoates (PHA) are a class of microbially synthesized polyesters that are produced in large quantities as a form of carbon and energy storage. Natural PHA possesses structural properties that make it attractive as a renewable plastic for select applications. However, most naturally produced PHA contains random monomeric sequences, as the organism adds whatever monomers are present in large enough quantities to the PHA polymer. Such PHA polymers with random monomeric sequences are often not desirable for specific commercial applications. By changing the identity and/or percentage of co-monomers, the structural properties of PHA can be engineered with varying degrees of crystallinity and elasticity (Khanna and Srivastava, 2005).

[0005] A wide range of hydroxy-acids have been incorporated as monomers into PHA chains when fed to PHA accumulating organisms (Meng et al., 2012; Steinbuchel and Valentin, 1995; Zhou et al., 2011). However, this strategy requires an external source of each monomer or monomer precursor (e.g., fatty acids), and low-cost sources of such monomers or monomer precursors are not currently available. For this reason, current PHA research is focused on engineering metabolic pathways to produce monomers from unrelated carbon sources such as glucose (Li et al., 2010; Theodorou et al., 2012).

[0006] Medium-chain-length PHA (mcl-PHA), which consists of fatty acids containing six or more carbons, is an attractive polymer, desired for novel applications in medical devices, cosmetics, and tissue engineering (Chen and Wu, 2005). Bacteria that naturally produce mcl-PHA incorporate monomers derived from either fatty acid biosynthesis or degradation (.beta.-oxidation) pathways. Efforts to enhance production of mcl-PHA have used metabolic engineering to enhance these pathways. See, e.g., U.S. Pat. No. 5,480,794 to Peoples et al., U.S. Pat. No. 6,593,116 to Huisman et al., U.S. Pat. No. 6,759,219 to Hein et al., U.S. Pat. No. 6,913,911 to Huisman et al., U.S. Pat. No. 7,786,355 Aguin et al., U.S. Pat. No. 7,968,325 to Hein et al., and other references cited herein. However, production of mcl-PHA at high yields from an unrelated carbon source has not been achieved.

[0007] Methods and tools for making PHA having a specific monomeric composition, such as mcl-PHA, at a high yield using abundant, inexpensive, and renewable precursors, such as glucose, are needed.

SUMMARY OF THE INVENTION

[0008] A specific version of the present invention uses an engineered metabolic pathway for converting glucose into medium-chain-length (mcl)-PHA composed primarily of 3-hydroxydodecanoate monomers. This pathway combines fatty acid biosynthesis, an acyl-ACP thioesterase to generate desired C.sub.12 and C.sub.14 fatty acids, .beta.-oxidation for conversion of fatty acids to (R)-3-hydroxyacyl-CoAs, and a PHA polymerase. Expressing an acyl-CoA synthetase, deleting enzymes involved in .beta.-oxidation under aerobic conditions (e.g., fadR, fadA, fadB, fadI, and/or fadJ), and overexpressing an acyl-ACP thioesterase (BTE), an enoyl-CoA hydratase (phaJ3), and mcl-PHA polymerase (phaC2) in a microorganism such as E. coli enables production polyhydroxydodecanoate from glucose under aerobic conditions at yields over 15% cell dry weight (CDW). This is the highest reported production of mcl-PHA of a defined composition from an unrelated carbon source.

[0009] The invention provides recombinant cells and methods for producing polyhydroxyalkanoates.

[0010] A version of a recombinant cell of the present invention comprises one or more recombinant genes selected from the group consisting of an R-specific enoyl-CoA hydratase gene, a PHA polymerase gene, a thioesterase gene, and an acyl-CoA-synthetase gene, wherein a gene product from a gene selected from the group consisting of an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase, and a 3-ketoacyl-CoA thiolase gene is functionally deleted, and wherein the recombinant cell is capable of producing polyhydroxyalkanoate.

[0011] The recombinant cell may be a microbial cell, such as a bacterial cell.

[0012] In some versions, the enoyl-CoA hydratase gene is selected from the group consisting of fadB and fadJ.

[0013] In some versions, the 3-hydroxyacyl-CoA dehydrogenase gene is selected from the group consisting of fadB and fadJ.

[0014] In some versions, the 3-ketoacyl-CoA thiolase gene is selected from the group consisting of fadA and fadI.

[0015] In some versions, the gene products of fadA and fadI; fadB and fadJ; or fadA, fadI, fadB and fadJ are functionally deleted.

[0016] In some versions, the gene product of fadR is functionally deleted.

[0017] In some versions, gene products of fadA and fadI; fad R, fadA, and fadI; fadB and fadJ; fad R, fadB, and fadJ; fadA, fadB, fadI, and fadJ; or fad R, fadA, fadB, fadI, and fadJ are functionally deleted.

[0018] In some versions, the enoyl-CoA hydratase gene is a phaJ gene.

[0019] In some versions, the PHA polymerase gene is a phaC gene.

[0020] In some versions, the enoyl-CoA hydratase gene is phaJ3 and the PHA polymerase gene is phaC2.

[0021] In some versions, the thioesterase gene is Umbellularia californica thioesterase or a homolog thereof.

[0022] In some versions, the acyl-CoA-synthetase gene is PP.sub.--0763 from P. putida.

[0023] In some versions, the cell further comprises a recombinant phasin gene.

[0024] In some versions, the recombinant cell comprises each of a recombinant R-specific enoyl-CoA hydratase gene, a recombinant PHA polymerase gene, a recombinant thioesterase gene, and a recombinant acyl-CoA-synthetase gene, wherein the recombinant cell is capable of producing polyhydroxyalkanoate from carbohydrate in a medium devoid of a fatty acid source.

[0025] A version of a method of the present invention comprises culturing a recombinant cell as described herein.

[0026] Some versions comprise culturing the recombinant cell in aerobic conditions.

[0027] Some versions comprise culturing the recombinant cell in a medium comprising a carbohydrate and substantially devoid of a fatty acid source.

[0028] In some versions, the culturing produces polyhydroxyalkanoate to at least about 7.5% cell dry weight.

[0029] In some versions, the culturing produces polyhydroxyalkanoate comprised of hydroxyalkanoate monomers, wherein greater than about 50% of the hydroxyalkanoate monomers comprise hydrocarbon chains comprising same number of carbons.

[0030] The objects and advantages of the invention will appear more fully from the following detailed description of the preferred embodiment of the invention made in conjunction with the accompanying drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIG. 1 depicts a schematic of a metabolic pathway for mcl-PHA biosynthesis in E. coli. A carbon source (i.e., glucose) is catabolized to acetyl-CoA which enters fatty acid biosynthesis for production of fatty acyl-ACPs. C.sub.12 and C.sub.14 acyl-ACPs are substrates for the thioesterase, BTE, which catalyzes FFA formation. An acyl-CoA synthetase (e.g., FadD) activates the FFAs for degradation via a partially intact .beta.-oxidation cycle generating enoyl-CoAs which PhaJ hydrates to produce mcl-PHA monomers for polymerization by PhaC. The resulting monomer composition is therefore identical to that of the FFA pool generated by the thioesterase. FadR represses expression of .beta.-oxidation genes in the absence of acyl-CoAs.

[0032] FIG. 2 A shows the metabolism of exogenously fed dodecanoic acid after 24 and 48 h of shake flask cultivation as a percent of the initial fatty acid concentration by a library of E. coli .beta.-oxidation knock-out strains harboring the specific fad deletion(s) indicated on the horizontal axis (e.g., K12=E. coli K-12 MG1655; R=E. coli K-12 MG1655 .DELTA.fadR; etc.). Data for both saturated (C.sub.12:0) and total C.sub.12 (including unsaturated and hydroxy) species are presented.

[0033] FIG. 2B shows the metabolism of endogenously synthesized fatty acids in strains with plasmid-based expression of BTE after 48 h of cultivation by a library of E. coli .beta.-oxidation knock-out strains harboring the specific fad deletion(s) indicated on the horizontal axis (e.g., K12=E. coli K-12 MG1655; R=E. coli K-12 MG1655 .DELTA.fadR; etc.). Data for both saturated (C.sub.12:0) and total C.sub.12 (including unsaturated and hydroxy) species are presented.

[0034] FIG. 3 shows a comparison of the effect of a fadR deletion with fadD overexpression via a chromosomal fusion of the trc promoter (.PHI.(P.sub.trc-fadD)) on exogenous dodecanoic acid metabolism in E. coli over a 24 h period. Data is presented as a percent of the initial fatty acid concentration.

[0035] FIG. 4A shows the titer of PHA as a percentage of dry cell weight (CDW) for mcl-PHA produced in E. coli in the presence of exogenously fed dodecanoic acid or endogenously produced FFA. Strain .DELTA.fadRABIJ was cultured in the presence of dodecanoic acid while SA01 (expressing BTE) was capable of endogenous FFA production in glucose minimal media. CDW was determined by quantifying 3-hydroxy fatty acid methyl esters from a PHA extraction. See Table 5 for individual CDW and PHA titer values

[0036] FIG. 4B shows the titer of fatty acids in E. coli producing mcl-PHA in the presence of exogenously fed dodecanoic acid or endogenously produced FFA. Strain .DELTA.fadRABIJ was cultured in the presence of dodecanoic acid while SA01 (expressing BTE) was capable of endogenous FFA production in glucose minimal media. The titer of fatty acids was determined by quantifying fatty acid methyl esters (FAME) from a total lipid extraction.

[0037] FIG. 5A shows results from .sup.1H NMR of purified C.sub.12-C.sub.14 mcl-PHA.

[0038] FIG. 5B shows results from .sup.13C NMR of purified C.sub.12-C.sub.14 mcl-PHA.

[0039] FIG. 6 shows PHA content in phasin-expressing E. coli strains relative to base strains. The concentration of 3-OH-fatty acid methyl esters derived from SA01 E. coli strains comprising various plasmids is presented relative to the concentration in SA01 E. coli strains comprising the pDA-JAC and pBTrck plasmids. pMSB6 and pBTrck are medium and low copy vectors, respectively, harboring IPTG inducible TRC promoters operably linked to no genes. Vector pDA-JAC is a variant of pMSB6 harboring phaJ, acs, and phaC under the control of the TRC promoter. Vector pPhaF is a variant of pBTrck harboring gene PP.sub.--5007 (UniProtKB database), which encodes a putative phasin having homology to phaF. Vector pPhal is a variant of pBTrck harboring gene PP.sub.--5008 (UniProtKB database), which encodes a putative phasin having homology to phal. Note: E. coli SA01 produces small amounts of hydroxylated C14 fatty acids (components of lipid A) that are also picked up in the PHA extraction/derivatization. The data show that expression of phasins in engineered mcl-PHA-producing E. coli increases PHA content relative to base strains.

DETAILED DESCRIPTION OF THE INVENTION

[0040] The following abbreviations are used herein: [0041] (mcl)-PHA--(medium-chain-length)-polyhydroxyalkanoate; [0042] Acyl-carrier protein--ACP; [0043] BTE--California Bay Laurel (Umbellularia californica) Thioesterase; [0044] CDW--Cell Dry Weight; [0045] CoA--Coenzyme A; [0046] DO.sub.2--Dissolved oxygen; [0047] EC--Enzyme Commission [0048] ECGSC--Escherichia coli Genetic Stock Center--Yale University; [0049] FAME--Fatty Acid Methyl Ester; [0050] GC/MS--Gas Chromatography Mass Spectrometry; [0051] LB--Lysogeny Broth; [0052] PBS--Phosphate Buffered Saline; and [0053] PCR--Polymerase Chain Reaction.

[0054] The present invention is directed to cells and methods for producing polyhydroxyalkanoates having a defined monomeric composition at a high yield from an unrelated carbon source. The invention involves genetically modifying cells to feed carbon substrates having a defined carbon length into the early steps of the .beta.-oxidation pathway and then diverting the substrates toward polyhydroxyalkanoate synthesis by shutting down or reducing the efficiency of downstream steps in the .beta.-oxidation pathway.

[0055] One aspect of the invention is a recombinant (i.e., genetically modified) cell that is capable of producing polyhydroxyalkanoate. The cell of the present invention may be any type of cell that is capable of producing polyhydroxyalkanoate, either naturally or by virtue of genetic engineering. Examples of suitable cells include but are not limited to bacterial cells, yeast cells, fungal cells, insect cells, mammalian cells, and plant cells. Examples of suitable bacterial cells include gram-positive bacteria such as strains of Bacillus, (e.g., B. brevis or B. subtilis), Pseudomonas, or Streptomyces, or gram-negative bacteria, such as strains of E. coli or Aeromonas hydrophila. Particularly desirable cells for expression in this regard include bacteria that do not produce lipopolysaccharide and are endotoxin free. Examples of suitable yeast cells include strains of Saccharomyces, such as S. cerevisiae; Schizosaccharomyces; Kluyveromyces; Pichia, such as P. pastoris or P. methlanolica; Hansenula, such as H. Polymorpha; Yarrowia; or Candida. Examples of suitable filamentous fungal cells include strains of Aspergillus, e.g., A. oryzae, A. niger, or A. nidulans; Fusarium or Trichoderma. Examples of suitable insect cells include a Lepidoptora cell line, such as Spodoptera frugiperda (Sf9 or Sf21) or Trichoplusioa ni cells ("HIGH FIVE"-brand insect cells, Invitrogen, Carlsbad, Calif.) (U.S. Pat. No. 5,077,214). Examples of suitable mammalian cells include Chinese hamster ovary (CHO) cell lines, e.g., CHO-K1 (ATCC CCL-61); green monkey cell lines, e.g., COS-1 (ATCC CRL-1650) and COS-7 (ATCC CRL-1651); mouse cells, e.g., NS/O; baby hamster kidney (BHK) cell lines, e.g., ATCC CRL-1632 or ATCC CCL-10; and human cells, e.g., HEK 293 (ATCC CRL-1573). Examples of suitable plant cells include those of oilseed crops, including rapeseed, canola, sunflower, soybean, cottonseed, and safflower plants, and cells from other plants such as Arabidopsis thaliana. Some of the foregoing cell types are capable of naturally producing polyhydroxyalkanoate, such as certain microorganisms. The other cell types are capable of producing polyhydroxyalkanoate by being genetically modified to express a PHA synthase or other enzymes. See, e.g., U.S. Pat. No. 5,480,794 to Peoples et al. and Zhang et al. Applied and Environmental Microbiology, 2006, 72(1):536-543, which are incorporated by reference in their entirety. Preferred cells are microorganisms, such as E. coli.

[0056] The recombinant cell of the invention preferably has one or more genes in the f3-oxidation pathway functionally deleted to inhibit consumption of substrates for polyhydroxyalkanoate production. "Functional deletion" or its grammatical equivalents refers to any modification to a microorganism that ablates, reduces, inhibits, or otherwise disrupts production of a gene product, renders the gene product non-functional, or otherwise reduces or ablates the gene product's activity. "Gene product" refers to a protein or polypeptide encoded and produced by a particular gene. In some versions of the invention, functionally deleting a gene product or homolog thereof means that the gene is mutated to an extent that corresponding gene product is not produced at all.

[0057] One of ordinary skill in the art will appreciate that there are many well-known ways to functionally delete a gene product. For example, functional deletion can be accomplished by introducing one or more genetic modifications. As used herein, "genetic modifications" refer to any differences in the nucleic acid composition of a cell, whether in the cell's native chromosome or in endogenous or exogenous non-chromosomal plasmids harbored within the cell. Examples of genetic modifications that may result in a functionally deleted gene product include but are not limited to mutations, partial or complete deletions, insertions, or other variations to a coding sequence or a sequence controlling the transcription or translation of a coding sequence; placing a coding sequence under the control of a less active promoter; and expressing ribozymes or antisense sequences that target the mRNA of the gene of interest, etc. In some versions, a gene or coding sequence can be replaced with a selection marker or screenable marker. Various methods for introducing the genetic modifications described above are well known in the art and include homologous recombination, among other mechanisms. See, e.g., Green et al., Molecular Cloning: A laboratory manual, 4.sup.th ed., Cold Spring Harbor Laboratory Press (2012) and Sambrook et al., Molecular Cloning: A Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Laboratory Press (2001). Various other genetic modifications that functionally delete a gene product are described in the examples below. Functional deletion can also be accomplished by inhibiting the activity of the gene product, for example, by chemically inhibiting a gene product with a small-molecule inhibitor, by expressing a protein that interferes with the activity of the gene product, or by other means.

[0058] In certain versions of the invention, the functionally deleted gene product may have less than about 95%, less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 1%, or about 0% of the activity of the non-functionally deleted gene product.

[0059] In certain versions of the invention, a cell with a functionally deleted gene product may have less than about 95%, less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 1%, or about 0% of the activity of the gene product compared to a cell with the non-functionally deleted gene product.

[0060] In certain versions of the invention, the functionally deleted gene product may be expressed at an amount less than about 95%, less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 1%, or about 0% of the amount of the non-functionally deleted gene product.

[0061] In certain versions of the invention, the functionally deleted gene product may result from a genetic modification in which at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, or more nonsynonymous substitutions are present in the gene or coding sequence of the gene product.

[0062] In certain versions of the invention, the functionally deleted gene product may result from a genetic modification in which at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, or more bases are inserted in the gene or coding sequence of the gene product.

[0063] In certain versions of the invention, the functionally deleted gene product may result from a genetic modification in which at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the gene product's gene or coding sequence is deleted or mutated.

[0064] In certain versions of the invention, the functionally deleted gene product may result from a genetic modification in which at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of a promoter driving expression of the gene product is deleted or mutated.

[0065] In certain versions of the invention, the functionally deleted gene product may result from a genetic modification in which at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of an enhancer controlling transcription of the gene product's gene is deleted or mutated.

[0066] In certain versions of the invention, the functionally deleted gene product may result from a genetic modification in which at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of a sequence controlling translation of gene product's mRNA is deleted or mutated.

[0067] In certain versions of the invention, the decreased activity or expression of the functionally deleted gene product is determined with respect to the activity or expression of the gene product in its unaltered state as found in nature. In certain versions of the invention, the decreased activity or expression of the functionally deleted gene product is determined with respect to the activity or expression of the gene product in its form in a corresponding cell. In certain versions, the genetic modifications giving rise to a functionally deleted gene product are determined with respect to the gene in its unaltered state as found in nature. In certain versions, the genetic modifications giving rise to a functionally deleted gene product are determined with respect to the gene in its form in a corresponding cell. As used herein, "corresponding cell" refers to a cell of the same species having the same or substantially same genetic and proteomic composition as a cell of the invention, with the exception of genetic and proteomic differences resulting from the manipulations described herein for the cells of the invention.

[0068] In some versions of the invention, a gene product of an enoyl-CoA hydratase gene in the recombinant cell is functionally deleted. Enoyl-CoA hydratases include enzymes classified under Enzyme Commission (EC) number 4.2.1.17. Enoyl-CoA hydratases catalyze the conversion of trans-2(or 3)-enoyl-CoA to (3S)-3-hydroxyacyl-CoA in the .beta.-oxidation pathway. The term "enoyl-CoA hydratase" used herein without an indication of stereospecificity refers to the enzymes under EC 4.2.1.17 that produce (3S)-3-hydroxyacyl-CoA. These enzymes are distinct from the enzymes that produce (3R)-3-hydroxyacyl-CoA and are designated under EC 4.2.1.119, which are referred to herein as "R-specific enoyl-CoA hydratases." See below. Examples of enoyl-CoA hydratase genes in bacteria include fadB (SEQ ID NO:1 (coding sequence) and SEQ ID NO:2 (protein); GenBank NC.sub.--000913.2 at 4026805-4028994 (complement)) and fadJ (SEQ ID NO:3 (coding sequence) and SEQ ID NO:3 (protein); GenBank NC.sub.--000913.2 at 2455037-2457181 (complement)). Examples of enoyl-CoA hydratase genes in yeast include FOX2 (GenBank NC.sub.--001143 at 454352-457054 (complement)) or the enzyme encoded by Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/) entry number NCU06488. An example of enoyl-CoA hydratase genes in filamentous fungal cells includes the enzyme encoded by KEGG entry number AN5916.2. An example of an enoyl-CoA hydratase gene in insect cells is Mfe2 (GenBank NM.sub.--132881.2). Examples of enoyl-CoA hydratase genes in mammalian cells include ECHS1 (GenBank NM.sub.--004092.3), EHHADH (GenBank NM.sub.--001966.3), and HADHA (GenBank NM.sub.--000182.4). Examples of enoyl-CoA hydratase genes in plants include MFP2 (GenBank NM.sub.--111566.3) and AIM1 (GenBank NM.sub.--119045.4). Homologs of the above-mentioned enoyl-CoA hydratase genes suitable for use in the present invention can be determined by many known methods, one of which is described below. In preferred versions of the invention, the enoyl-CoA hydratase gene product that is functionally deleted has a sequence comprising SEQ ID NO:2 or a sequence homologous thereto, SEQ ID NO:4 or a sequence homologous thereto, or SEQ ID NO:2 and SEQ ID NO:4 or sequences homologous thereto.

[0069] In some versions of the invention, a gene product of a 3-hydroxyacyl-CoA dehydrogenase gene in the recombinant cell is functionally deleted. 3-Hydroxyacyl-CoA dehydrogenases include enzymes classified under EC number 1.1.1.35. 3-Hydroxyacyl-CoA dehydrogenases catalyze the conversion of (3S)-3-hydroxyacyl-CoA to 3-ketoacyl CoA in the .beta.-oxidation pathway. Examples of 3-hydroxyacyl-CoA dehydrogenase genes in bacteria include fadB (SEQ ID NO:1 (coding sequence) and SEQ ID NO:2 (protein); GenBank NC.sub.--000913.2 at 4026805-4028994 (complement)) and fadJ (SEQ ID NO:3 (coding sequence) and SEQ ID NO:4 (protein); GenBank NC.sub.--000913.2 at 2455037-2457181 (complement)). An example of a 3-hydroxyacyl-CoA dehydrogenase gene in yeast includes FOX2 (GenBank NC.sub.--001143 at 454352-457054 (complement)). An example of a 3-hydroxyacyl-CoA dehydrogenase gene in filamentous fungal cells includes the enzyme encoded by KEGG entry number AN7238.2. An example of a 3-hydroxyacyl-CoA dehydrogenase gene in insect cells is Mfe2 (GenBank NM.sub.--132881.2). Examples of 3-hydroxyacyl-CoA dehydrogenase genes in mammalian cells include EHHADH (GenBank NM.sub.--001966.3), HSD17B10 (GenBank NG.sub.--008153.1), HADH (GenBank NM.sub.--001184705.2), and HSD17B4 (GenBank NG.sub.--008182.1). Examples of 3-hydroxyacyl-CoA dehydrogenase genes in plants include MFP2 (GenBank NM.sub.--111566.3) and AIM1 (GenBank NM.sub.--119045.4). Homologs of the above-mentioned 3-hydroxyacyl-CoA dehydrogenase genes suitable for use in the present invention can be determined by many known methods, one of which is described below. In preferred versions of the invention, the 3-hydroxyacyl-CoA dehydrogenase gene product that is functionally deleted has a sequence comprising SEQ ID NO:2 or a sequence homologous thereto, SEQ ID NO:4 or a sequence homologous thereto, or SEQ ID NO:2 and SEQ ID NO:4 or sequences homologous thereto.

[0070] In some versions of the invention, a gene product of a 3-ketoacyl-CoA thiolase gene in the recombinant cell is functionally deleted. 3-Ketoacyl-CoA thiolases include enzymes classified under EC number 2.3.1.16. 3-Ketoacyl-CoA thiolases catalyze the conversion of 3-ketoacyl CoA to acetyl-CoA and a shortened acyl-CoA species in the .beta.-oxidation pathway. Examples of 3-ketoacyl-CoA thiolase genes in bacteria include fadA (SEQ ID NO:5 (coding sequence) and SEQ ID NO:6 (protein); GenBank NC.sub.--000913.2 at 4025632-4026795 (complement)) and fadI (SEQ ID NO:7 (coding sequence) and SEQ ID NO:8 (protein); GenBank NC.sub.--000913.2 at 2457181-2458491 (complement)). An example of a 3-ketoacyl-CoA thiolase gene in yeast includes FOX3 (GenBank NM.sub.--001179508.1). Examples of 3-ketoacyl-CoA thiolase genes in filamentous fungal cells include the enzymes encoded by KEGG entry numbers AN5646.2 and AN5698.2. An example of a 3-ketoacyl-CoA thiolase gene in insect cells is gene yip2 (GenBank NM.sub.--078804.3). Examples of 3-ketoacyl-CoA thiolase genes in mammalian cells include ACAA1 (GenBank NR.sub.--024024.1), ACAA2 (GenBank NM.sub.--006111.2), and HADHB (GenBank NG.sub.--007294.1). Examples of 3-ketoacyl-CoA thiolase genes in plants include PKT4 (GenBank NM.sub.--100351.4), PKT3 (GenBank NM.sub.--128874.3), and PKT2 (GenBank NM.sub.--180826.3). Homologs of the above-mentioned 3-ketoacyl-CoA thiolase genes suitable for use in the present invention can be determined by many known methods, one of which is described below. In preferred versions of the invention, 3-ketoacyl-CoA thiolase gene product that is functionally deleted has a sequence comprising SEQ ID NO:6 or a sequence homologous thereto, SEQ ID NO:8 or a sequence homologous thereto, or SEQ ID NO:6 and SEQ ID NO:8 or sequences homologous thereto.

[0071] Production of polyhydroxyalkanoates can be enhanced when the .beta.-oxidation pathway is maximally shut down at a particular step. When a cell has more than one enzyme catalyzing a step in the .beta.-oxidation pathway, i.e., enoyl-CoA hydration, (3S)-hydroxyacyl-CoA dehydrogenation, or ketoacyl-CoA thiolation, it is preferred that more than one enzyme catalyzing that step is functionally deleted. It is more preferred that all enzymes catalyzing that step are functionally deleted. In the case of bacteria, for example, it is preferred that products of both fadA and fadI, both fadB, and fadJ, or all of fadA, fadB, fadI, and fadJ are functionally deleted.

[0072] In some versions of the invention, one or more factors that regulate expression of .beta.-oxidation genes in the cells are functionally deleted. It is thought that such a modification to the cells helps to enhance entry of carbon substrates into the .beta.-oxidation pathway for synthesis of polyhydroxyalkanoates. In preferred bacterial cells such as Escherichia coli, this is accomplished by functionally deleting the product of fadR (SEQ ID NO:9 (coding sequence) and SEQ ID NO:10 (protein); GenBank NC.sub.--000913.2 at 1234161-1234880). FadR encodes a transcription factor (fadR) that coordinately regulates the machinery required for .beta.-oxidation and the expression of a key enzyme in fatty acid biosynthesis. FadR works as a repressor that controls transcription of the whole fad regulon, including fadA, fadB, fadD, fadE, fadI, and fadJ. Binding of fadR is inhibited by fatty acyl-CoA compounds, which de-represses expression of the genes in the fad regulon. Functional deletion of fadR thereby upregulates such genes as fadD and fadE to enhance entry of carbon substrates through the initial steps of the .beta.-oxidation pathway (see FIG. 1). Regulatory proteins that control expression of .beta.-oxidation genes in cells of other organisms are known in the art. The genes encoding these proteins can be similarly functionally deleted to enhance entry of carbon substrates through the initial steps of the .beta.-oxidation pathway for synthesis of polyhydroxyalkanoates. In preferred versions of the invention, the regulatory protein that is functionally deleted has a sequence comprising SEQ ID NO:10 or a sequence homologous thereto.

[0073] In a preferred bacterial cell of the invention, the cell comprises a functional deletion of fadR gene product in addition to functional deletion of products of fadA, fadI, fadB, fadJ, fadA and fadI, fadB and fadJ, or fadA, fadB, fadI, and fadJ so that flux through the initial steps .beta.-oxidation pathway is enhanced but flux through the downstream steps (i.e., enoyl-CoA hydration, (3S)-hydroxyacyl-CoA dehydrogenation, and/or ketoacyl-CoA thiolation) is not.

[0074] In various versions of the invention, the cell is genetically modified to comprise a recombinant gene. In most cases, the recombinant gene is configured to be expressed or overexpressed in the cell. If a cell endogenously comprises a particular gene, the gene may be modified to exchange or optimize promoters, exchange or optimize enhancers, or exchange or optimize any other genetic element to result in increased expression of the gene. Alternatively, one or more additional copies of the gene or coding sequence thereof may be introduced to the cell for enhanced expression of the gene product. If a cell does not endogenously comprise a particular gene, the gene or coding sequence thereof may be introduced to the cell for expression of the gene product. The gene or coding sequence may be incorporated into the genome of the cell or may be contained on an extra-chromosomal plasmid. The gene or coding sequence may be introduced to the cell individually or may be included on an operon. Techniques for genetic manipulation are described in further detail below.

[0075] In some versions of the invention, the cells are genetically modified to express or overexpress a recombinant acyl-CoA synthetase gene. This is thought to constitute a mechanism of modifying cells to enhance entry of carbon substrates into the .beta.-oxidation pathway. Suitable acyl-CoA synthetases include enzymes classified under the EC 6.2.1.-, such as EC 6.2.1.3. Acyl-CoA synthetases catalyze the conversion of free fatty acids, coenzyme A, and ATP to fatty acyl CoAs plus AMP (Black et al. 1992, J. Biol. Chem. 267:25513-25520). Examples of suitable genes for acyl CoA synthetases include fadD (SEQ ID NO:11 (coding sequence) and SEQ ID NO:12 (protein); GenBank NC.sub.--000913.2 at 1886085-1887770 (complement)) from E. coli (Black et al. 1992, J. Biol. Chem. 267:25513-25520), alkK from Pseudomonas oleovorans (GenBank AJ245436.1 at 13182-14822) (van Beilen et al. 1992, Molecular Microbiology 6:3121-3136), Pfacsl from Plasmodium falciparum (GenBank AF007828.2) (Matesanz et al. 1999, J. Mol. Biol. 291:59-70), and PP.sub.--0763 (KEGG) from P. putida (SEQ ID NO:13 (coding sequence) and SEQ ID NO:14 (protein)), described herein. Methods and materials for identification of other suitable acyl-CoA synthetases are described in U.S. Pat. No. 7,786,355. Homologs of the above-mentioned acyl-CoA synthetase genes suitable for use in the present invention can be determined by many known methods, one of which is described below. In preferred versions of the invention, the cells express or overexpress an acyl-CoA synthetase gene product that has a sequence comprising SEQ ID NO:12 or a sequence homologous thereto, SEQ ID NO:14 or a sequence homologous thereto, or SEQ ID NO:12 and SEQ ID NO:14 or sequences homologous thereto.

[0076] In some versions of the invention, the cells are genetically modified to express or overexpress a recombinant R-specific enoyl-CoA hydratase gene. R-specific enoyl-CoA hydratase genes include enzymes classified under EC 4.2.1.119. R-specific enoyl-CoA hydratase genes catalyze the conversion of trans-2(or 3)-enoyl-CoA to (3R)-3-hydroxyacyl-CoA. As described above, the term "R-specific enoyl-CoA hydratase," refers only to enzymes which produce (3R)-3-hydroxyacyl-CoA and are distinct from the enzymes referred to herein as "enoyl-CoA hydratase," which produce (3S)-3-hydroxyacyl-CoA and are classified under EC 4.2.1.17. Examples of suitable R-specific enoyl-CoA hydratases include any of the various phaJ genes in such microorganisms as Aeromonas spp., including A. caviae, Pseudomonas aeruginosa, Ralstonia eutropha, among others. See the following Examples for methods for amplifying PHA genes phaJ1-4, the sequences of which can be readily obtained using methods known in the art. Homologs of the above-mentioned R-specific enoyl-CoA hydratase genes suitable for the use in the present invention can be determined by many known methods, one of which is described below.

[0077] In some versions of the invention, the cells are genetically modified to express or overexpress a recombinant PHA polymerase gene. PHA polymerase genes include enzymes classified under EC 2.3.1.-. PHA polymerase genes catalyze the conversion of (3R)-3-hydroxyacyl-CoA monomers into polyhydroxyalkanoate polymers. Examples of suitable PHA polymerases include any of the various phaC or phbC genes in such microorganisms as Pseudomonas aeruginosa, among others. See the following Examples for methods for amplifying PHA genes phaC1-2, the sequences of which can be readily obtained using methods known in the art. See also U.S. Pat. No. 5,250,430 and Tsuge et al. 2003, International Journal of Biological Macromolecules. 31:195-205. Homologs of the above-mentioned PHA polymerase genes suitable for the use in the present invention can be determined by many known methods, one of which is described below.

[0078] For high production of mcl-PHA containing high yields of C.sub.12 monomer units, it is preferred that the cell expresses or overexpresses a combination of phaJ3 (SEQ ID NO:15 (coding sequence) and SEQ ID NO:16 (protein)) and phaC2 (SEQ ID NO:17 (coding sequence) and SEQ ID NO:18 (protein)), as this combination unexpectedly results in a high PHA content with a high C.sub.12 composition. See, e.g., the examples, particularly at Table 2. Accordingly, cells in preferred versions of the invention express or overexpress gene products having a sequence comprising SEQ ID NO:16 or a sequence homologous thereto, SEQ ID NO:18 or a sequence homologous thereto, or SEQ ID NO:16 and SEQ ID NO:18 or sequences homologous thereto.

[0079] In some versions of the invention, the cells are genetically modified to express or overexpress a recombinant thioesterase gene. Thioesterases include enzymes classified into EC 3.1.2.1 through EC 3.1.2.27 based on their activities on different substrates, with many remaining unclassified (EC 3.1.2.-). Thioesterases hydrolyze thioester bonds between acyl chains and CoA or on acyl chains and ACP. These enzymes terminate fatty acid synthesis by removing the CoA or ACP from the acyl chain.

[0080] Expression or overexpression of a recombinant thioesterase gene can be used to engineer to produce a homogeneous population of fatty acid products to feed into the .beta.-oxidation and polyhydroxyalkanoate synthesis pathways, and thereby produce polyhydroxyalkanoates having a defined side chain length. To engineer a cell for the production of a homogeneous population of fatty acid products, one or more thioesterases with a specificity for a particular carbon chain length or chain lengths can be expressed. For example, any of the thioesterases shown in the following table can be expressed individually or in combination to increase production of fatty acid products having specific chain lengths.

TABLE-US-00001 Thioesterases. Gen Bank Preferential Accession Source product Number Organism Gene produced AAC73596 E. coli tesA without C.sub.8-C.sub.18 leader sequence Q41635; Umbellularia fatB C.sub.12:0 V17097; californica M94159 Q39513 Cuphea fatB2 C.sub.8:0-C.sub.10:0 hookeriana AAC49269 Cuphea fatB3 C.sub.14:0-C.sub.16:0 hookeriana Q39473 Cinnamonum fatB C.sub.14:0 camphorum CAA85388 Arabidopsis fatB[M141T]* C.sub.16:1 thaliana NP 189147; Arabidopsis fatA C.sub.18:1 NP 193041 thaliana CAC39106 Bradyrhiizobium fatA C.sub.18:1 japonicum AAC72883 Cuphea fatA C.sub.18:1 hookeriana *Mayer et al., BMC Plant Biology 7: 1-11, 2007.

[0081] Other thioesterases that can be expressed or overexpressed in the cell include any of the many acyl-acyl carrier protein thioesterases from Streptococcus pyogenes, including any having GenBank Accession Numbers AAZ51384.1, AAX71858.1, AAT86926.1, YP.sub.--280213.1, YP.sub.--060109.1, YP.sub.--006932842.1, YP.sub.--005411534.1, AFC68003.1, AFC66139.1, YP.sub.--006071945.1, YP.sub.--600436.1, AEQ24391.1 and ABF37868.1; a palmitoyl-acyl carrier protein thioesterase from Ricinus communis, such as those having GenBank Accession Numbers EEF47013.1, XP.sub.--002515564.1, EEF51750.1, XP.sub.--002511148.1, and EEF36100.1; a myristoyl-acyl carrier protein thioesterase from Ricinus communis, such as those having GenBank Accession Numbers EEF44689.1 and XP.sub.--002517525.1; an oleoyl-acyl carrier protein thioesterase from Ricinus communis, such as those having GenBank Accession Numbers EEF29646.1 and XP.sub.--002532744.1; an acyl-acyl carrier protein thioesterase from Ricinus communis, such as that having GenBank Accession Number ABV54795.1; an acyl-acyl carrier protein thioesterase from Jatropha curcus, such as that described in Zhang, X. et al. (2011) Metab. Eng. 13, 713-722; an FabD from Streptomyces avermitilis, such as that having GenBank Accession Number NP.sub.--826965.1; a FadM acyl-CoA thioesterase from E. coli, such as that having GenBank Accession Number NP.sub.--414977.1; a TesB thioesterase II (acyl-CoA thioesterase), such as those having GenBank Accession Numbers ZP.sub.--12508749.1, EGT66607.1, ZP.sub.--03035215.1, and EDV65664.1; and a fatB-type thioesterase specific for C18:1 and C18:0 derived from Madhuca latifolia, such as that having the GenBank Accession Number AY835985. These and additional suitable thioesterases that can be expressed or overexpressed in the cell are described in U.S. 2011/0165637 to Pfleger et al.; Lu, X. et al. (2008) Metab. Eng. 10, 333-339; Liu, T. et al. (2010) Metab. Eng. 12, 378-386; Steen, E. J. et al. (2010) Nature 463, 559-562; Lennen, R. M. et al. (2010) Biotechnol. Bioeng. 106, 193-202; Lennen, R. M. et al. (2011) Appl. Environ. Microbiol. 77, 8114-8128; Youngquist, J. T. et al. (2012) Biotechnol. Bioeng. 109, 1518-1527; Jeon, E. et al. (2011) Enzyme Microb. Technol. 49, 44-51; Li, M. et al. (2012) Metab. Eng. 14, 380-387; Zhang, X. et al. (2012) Biotechnol. Prog. 28, 60-65; Zhang, X. et al. (2011) Metab. Eng. 13, 713-722; Liu, H. et al. (2012) Microb. Cell Fact. 11, 41; Yu, X. et al. (2011) Proc. Natl. Acad. Sci. U.S.A. 108, 18643-18648; Dellomonaco, C. et al. (2011) Nature 476, 355-359; Zhang, F. et al. (2012) Nat. Biotechnol. 30, 354-359; and Lennen et al. (2012) Trends in Biotechnology 30(12), 659-667. Yet other suitable thioesterases can be found in the ThYme: Thioester-active Enzymes database at http://www.enzyme.chirc.iastate.edu/. Homologs of the thioesterases described herein suitable for the use in the present invention can be determined by many known methods, one of which is described below.

[0082] In some versions, one or more endogenous thioesterases having a specificity for carbon chain lengths other than the desired product's carbon chain length can be functionally deleted. For example, C10 fatty acid products can be produced by attenuating a thioesterase specific for C18 (for example, accession numbers AAC73596 and POADA1), and expressing a thioesterase specific for C10 (for example, accession number Q39513). This results in a relatively homogeneous population of fatty acid products that have a carbon chain length of 10. In another example, C14 fatty acid products can be produced by attenuating endogenous thioesterases that produce non-C14 fatty acids and expressing the thioesterase with accession number Q39473, which uses C14-acyl carrier protein (ACP) as a substrate. In yet another example, C12 fatty acid products can be produced by expressing thioesterases that use C12-ACP as a substrate (for example, accession number Q41635) and attenuating thioesterases that produce non-C12 fatty acids.

[0083] In a preferred version of the invention, the cell comprises a gene expressing a codon-optimized thioesterase derived from California Bay Laurel (Umbellularia californica) thioesterase (BTE) having the following nucleic acid coding sequence (SEQ ID NO:19) and amino acid sequence (SEQ ID NO:20):

TABLE-US-00002 cccgggagga ggattataaa atg act cta gag tgg aaa ccg aaa cca aaa ctg 53 Met Thr Leu Glu Trp Lys Pro Lys Pro Lys Leu 1 5 10 cct caa ctg ctg gat gat cac ttc ggt ctg cac ggt ctg gtg ttt cgt 101 Pro Gln Leu Leu Asp Asp His Phe Gly Leu His Gly Leu Val Phe Arg 15 20 25 cgt act ttc gca att cgt tct tat gaa gtg ggt cca gat cgt tct acc 149 Arg Thr Phe Ala Ile Arg Ser Tyr Glu Val Gly Pro Asp Arg Ser Thr 30 35 40 tcc atc ctg gcc gtc atg aac cac atg cag gaa gcc acc ctg aat cac 197 Ser Ile Leu Ala Val Met Asn His Met Gln Glu Ala Thr Leu Asn His 45 50 55 gcg aaa tct gtt ggt atc ctg ggt gat ggt ttc ggc act act ctg gaa 245 Ala Lys Ser Val Gly Ile Leu Gly Asp Gly Phe Gly Thr Thr Leu Glu 60 65 70 75 atg tct aaa cgt gac ctg atg tgg gta gtg cgt cgc acc cac gta gca 293 Met Ser Lys Arg Asp Leu Met Trp Val Val Arg Arg Thr His Val Ala 80 85 90 gta gag cgc tac cct act tgg ggt gac act gtg gaa gtc gag tgt tgg 341 Val Glu Arg Tyr Pro Thr Trp Gly Asp Thr Val Glu Val Glu Cys Trp 95 100 105 att ggc gcg tcc ggt aac aat ggt atg cgt cgc gat ttt ctg gtc cgt 389 Ile Gly Ala Ser Gly Asn Asn Gly Met Arg Arg Asp Phe Leu Val Arg 110 115 120 gac tgt aaa acg ggc gaa atc ctg acg cgt tgc acc tcc ctg agc gtt 437 Asp Cys Lys Thr Gly Glu Ile Leu Thr Arg Cys Thr Ser Leu Ser Val 125 130 135 ctg atg aac acc cgc act cgt cgc ctg tct acc atc ccg gac gaa gtg 485 Leu Met Asn Thr Arg Thr Arg Arg Leu Ser Thr Ile Pro Asp Glu Val 140 145 150 155 cgc ggt gag atc ggt cct gct ttc atc gat aac gtg gca gtt aaa gac 533 Arg Gly Glu Ile Gly Pro Ala Phe Ile Asp Asn Val Ala Val Lys Asp 160 165 170 gac gaa atc aag aaa ctg caa aaa ctg aac gac tcc acc gcg gac tac 581 Asp Glu Ile Lys Lys Leu Gln Lys Leu Asn Asp Ser Thr Ala Asp Tyr 175 180 185 atc cag ggc ggt ctg act ccg cgc tgg aac gac ctg gat gtt aat cag 629 Ile Gln Gly Gly Leu Thr Pro Arg Trp Asn Asp Leu Asp Val Asn Gln 190 195 200 cat gtg aac aac ctg aaa tac gtt gct tgg gtc ttc gag act gtg ccg 677 His Val Asn Asn Leu Lys Tyr Val Ala Trp Val Phe Glu Thr Val Pro 205 210 215 gac agc att ttc gaa agc cat cac att tcc tct ttt act ctg gag tac 725 Asp Ser Ile Phe Glu Ser His His Ile Ser Ser Phe Thr Leu Glu Tyr 220 225 230 235 cgt cgc gaa tgt act cgc gac tcc gtt ctg cgc agc ctg acc acc gta 773 Arg Arg Glu Cys Thr Arg Asp Ser Val Leu Arg Ser Leu Thr Thr Val 240 245 250 agc ggc ggt tct agc gag gca ggt ctg gtc tgc gac cat ctg ctg caa 821 Ser Gly Gly Ser Ser Glu Ala Gly Leu Val Cys Asp His Leu Leu Gln 255 260 265 ctg gaa ggc ggc tcc gaa gtc ctg cgt gcg cgt acg gag tgg cgt cca 869 Leu Glu Gly Gly Ser Glu Val Leu Arg Ala Arg Thr Glu Trp Arg Pro 270 275 280 aag ctg acg gat tct ttc cgc ggc atc tcc gta att ccg gcg gaa cct 917 Lys Leu Thr Asp Ser Phe Arg Gly Ile Ser Val Ile Pro Ala Glu Pro 285 290 295

[0084] See, e.g., U.S. 2011/0165637 to Pfleger et al. Expression of BTE in the cell generates fatty acid substrates in the cell suitable for production of mcl-PHAs. Cells in preferred versions of the invention express or overexpress a gene product having a sequence comprising SEQ ID NO:20 or a sequence homologous thereto.

[0085] In some versions of the invention, the cells are genetically modified to express or overexpress a recombinant phasein gene. Examples of suitable phasins include the phasins from Pseudomonas putida KT2440 annotated as "Polyhydroxyalkanoate granule-associated proteins" on the UniProKB database (http://www.uniprot.org/) with locus tags of PP.sub.--5008 (SEQ ID NO:21 (coding sequence) and SEQ ID NO:22 (protein)) and PP.sub.--5007 (SEQ ID NO:23 (coding sequence) and SEQ ID NO:24 (protein)). These phasins have a high degree of homology to other phasin genes phal and phaF, respectively. Homologs of the above-mentioned phasin genes suitable for the use in the present invention can be determined by many known methods, one of which is described below. Cells in preferred versions of the invention express or overexpress gene products having a sequence comprising SEQ ID NO:22 or a sequence homologous thereto, SEQ ID NO:24 or a sequence homologous thereto, or SEQ ID NO:22 and SEQ ID NO:24 or sequences homologous thereto.

[0086] Polyhydroxyalkanoates can be produced with the cells described herein by culturing the cells in the presence of a carbon source. The carbon source preferably includes a carbohydrate or non-lipid based carbon source, such as a fermentable sugar, a short-chain organic acid, an amino acid, or other organic molecules. Examples of suitable fermentable sugars include adonitol, arabinose, arabitol, ascorbic acid, chitin, cellubiose, dulcitol, erythrulose, fructose, fucose, galactose, glucose, gluconate, inositol, lactose, lactulose, lyxose, maltitol, maltose, maltotriose, mannitol, mannose, melezitose, melibiose, palatinose, pentaerythritol, raffinose, rhamnose, ribose, sorbitol, sorbose, starch, sucrose, trehalose, xylitol, xylose, and hydrates thereof. Examples of short-chain organic acids include acetate, propionate, lactate, pyruvate, levulinate, and succinate. Examples of amino acids include histidine, alanine, isoleucine, arginine, leucine, asparagine, lysine, aspartic acid, methionine, cysteine, phenylalanine, glutamic acid, threonine, glutamine, tryptophan, glycine, valine, ornithine, proline, serine, and tyrosine.

[0087] The carbon sources may also include an exogenous supply of fatty acids. However, in the preferred version of the invention, the culturing is performed in a medium substantially devoid of a fatty acid source, such as free fatty acids or fatty-acid containing lipids, and/or exogenous lipids in general. In various versions of the invention, the growth medium preferably includes no more than about 1 g L.sup.-1 free fatty acid or salt thereof, no more than about 0.5 g L.sup.-1 free fatty acid or salt thereof, no more than about 0.25 g L.sup.-1 free fatty acid or salt thereof, no more than about 0.1 g L.sup.-1 free fatty acid or salt thereof, no more than about 0.05 g L.sup.-1 free fatty acid or salt thereof, no more than about 0.01 g L.sup.-1 free fatty acid or salt thereof, no more than about 0.005 g L.sup.-1 free fatty acid or salt thereof, or no more than about 0.001 g L.sup.-1 free fatty acid or salt thereof.

[0088] In a preferred version of the invention, the culturing is performed in aerobic conditions. To maintain such aerobic conditions, it is preferred that the DO.sub.2 content of the medium does not decrease below about 35% saturation, about 40% saturation, or about 50% saturation (Becker et al., 1997; Tseng et al., 1996).

[0089] In various versions of the invention, the culturing is performed until the cell reaches an amount of polyhydroxyalkanoate of at least about 7.5% cell dry weight, at least about 10% cell dry weight, at least about 15% cell dry weight, at least about 20% cell dry weight, at least about 25% cell dry weight, at least about 30% cell dry weight, at least about 35% cell dry weight, at least about 40% cell dry weight, at least about 45% cell dry weight, at least about 50% cell dry weight, at least about 55% cell dry weight, at least about 60% cell dry weight, at least about 65% cell dry weight, at least about 70% cell dry weight, or at least about 75% cell dry weight. Accordingly the cells of the invention are capable of producing an amount of polyhydroxyalkanoate of at least about 7.5% cell dry weight, at least about 10% cell dry weight, at least about 15% cell dry weight, at least about 20% cell dry weight, at least about 25% cell dry weight, at least about 30% cell dry weight, at least about 35% cell dry weight, at least about 40% cell dry weight, at least about 45% cell dry weight, at least about 50% cell dry weight, at least about 55% cell dry weight, at least about 60% cell dry weight, at least about 65% cell dry weight, at least about 70% cell dry weight, or at least about 75% cell dry weight.

[0090] In preferred versions of the invention, the cell produces polyhydroxyalkanoate comprised of hydroxyalkanoate monomers, wherein a large proportion of the hydroxyalkanoate monomers comprise hydrocarbon chains comprising the same number of carbons. The number of carbons may be 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 18 carbons. In various versions, greater than about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, or about 85% of the hydroxyalkanoate monomers comprise hydrocarbon chains comprising same number of carbons. The cell preferably produces such polyhydroxyalkanoate in the absence of exogenously supplied fatty acids.

[0091] The cells of the invention may be genetically altered to functionally delete, express, or overexpress homologs of any of the specific genes or gene products explicitly described herein. Proteins and/or protein sequences are "homologous" when they are derived, naturally or artificially, from a common ancestral protein or protein sequence. Similarly, nucleic acids and/or nucleic acid sequences are homologous when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Nucleic acid or gene product (amino acid) sequences of any known gene, including the genes or gene products described herein, can be determined by searching any sequence databases known the art using the gene name or accession number as a search term. Common sequence databases include GenBank (http://wwwncbi.nim.nih.gov/genbank/), ExPASy (http://expasy.org/), KEGG (www.genome.jp/kegg/), among others. Homology is generally inferred from sequence similarity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of similarity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence similarity (e.g., identity) over 50, 100, 150 or more residues (nucleotides or amino acids) is routinely used to establish homology (e.g., over the full length of the two sequences to be compared). Higher levels of sequence similarity (e.g., identity), e.g., 30%, 35% 40%, 45% 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, can also be used to establish homology. Accordingly, homologs of the genes or gene products described herein include genes or gene products having at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to the genes or gene products described herein. Methods for determining sequence similarity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available. The homologous proteins should demonstrate comparable activities and, if an enzyme, participate in the same or analogous pathways. "Orthologs" are genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same or similar function in the course of evolution. As used herein "orthologs" are included in the term "homologs".

[0092] For sequence comparison and homology determination, one sequence typically acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence based on the designated program parameters. A typical reference sequence of the invention is a nucleic acid or amino acid sequence corresponding to acsA or other genes or products described herein.

[0093] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2008)).

[0094] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity for purposes of defining homologs is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0095] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001. The above-described techniques are useful in identifying homologous sequences for use in the methods described herein.

[0096] The terms "identical" or "percent identity", in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described above (or other algorithms available to persons of skill) or by visual inspection.

[0097] The phrase "substantially identical" in the context of two nucleic acids or polypeptides refers to two or more sequences or subsequences that have at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90, about 95%, about 98%, or about 99% or more nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. Such "substantially identical" sequences are typically considered to be "homologous", without reference to actual ancestry. Preferably, the "substantial identity" exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably, the sequences are substantially identical over at least about 150 residues, at least about 250 residues, or over the full length of the two sequences to be compared.

[0098] Terms used herein pertaining to genetic manipulation are defined as follows.

[0099] Accession numbers: The accession numbers throughout this description are derived from the NCBI database (National Center for Biotechnology Information, i.e., "GenBank"), maintained by the National Institute of Health, USA, or the KEGG (Kyoto Encyclopedia of Genes and Genomics) database, maintained by the Kyoto Encyclopedia of Genes and Genomics and sponsored in part by the University of Tokyo.

[0100] Deletion: The removal of one or more nucleotides from a nucleic acid molecule or one or more amino acids from a protein, the regions on either side being joined together.

[0101] Derived: When used with reference to a nucleic acid or protein, "derived" means that the nucleic acid or polypeptide is isolated from a described source or is at least 70%, 80%, 90%, 95%, 99%, or more identical to a nucleic acid or polypeptide included in the described source.

[0102] Endogenous: As used herein with reference to a nucleic acid molecule and a particular cell, "endogenous" refers to a nucleic acid sequence or polypeptide that is in the cell and was not introduced into the cell using recombinant engineering techniques. For example, an endogenous gene is a gene that was present in a cell when the cell was originally isolated from nature.

[0103] Exogenous: As used herein with reference to a nucleic acid molecule or polypeptide in a particular cell, "exogenous" refers to any nucleic acid molecule or polypeptide that does not originate from that particular cell as found in nature. Thus, a non-naturally-occurring nucleic acid molecule or protein is considered to be exogenous to a cell once introduced into the cell. A nucleic acid molecule or protein that is naturally-occurring also can be exogenous to a particular cell. For example, an entire coding sequence isolated from cell X is an exogenous nucleic acid with respect to cell Y once that coding sequence is introduced into cell Y, even if X and Y are the same cell type. The term "heterologous" is used herein interchangeably with "exogenous."

[0104] Expression: The process by which a gene's coded information is converted into the structures and functions of a cell, such as a protein, transfer RNA, or ribosomal RNA. Expressed genes include those that are transcribed into mRNA and then translated into protein and those that are transcribed into RNA but not translated into protein (for example, transfer and ribosomal RNAs).

[0105] Introduce: When used with reference to genetic material, such as a nucleic acid, and a cell, "introduce" refers to the delivery of the genetic material to the cell in a manner such that the genetic material is capable of being expressed within the cell. Introduction of genetic material includes both transformation and transfection. Transformation encompasses techniques by which a nucleic acid molecule can be introduced into cells such as prokaryotic cells or non-animal eukaryotic cells. Transfection encompasses techniques by which a nucleic acid molecule can be introduced into cells such as animal cells. These techniques include but are not limited to introduction of a nucleic acid via conjugation, electroporation, lipofection, infection, and particle gun acceleration.

[0106] Isolated: An "isolated" biological component (such as a nucleic acid molecule, polypeptide, or cell) has been substantially separated or purified away from other biological components in which the component naturally occurs, such as other chromosomal and extrachromosomal DNA and RNA and proteins. Nucleic acid molecules and polypeptides that have been "isolated" include nucleic acid molecules and polypeptides purified by standard purification methods. The term also includes nucleic acid molecules and polypeptides prepared by recombinant expression in a cell as well as chemically synthesized nucleic acid molecules and polypeptides. In one example, "isolated" refers to a naturally-occurring nucleic acid molecule that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived.

[0107] Medium chain: When used with reference to medium chain fatty acids or medium chain polyhydroxyalkanoates refers to a carbon chain length of from 7 to 18 carbons, and such as a carbon chain length of from 7 to 11 carbons.

[0108] Nucleic acid: Encompasses both RNA and DNA molecules including, without limitation, cDNA, genomic DNA, and mRNA. Nucleic acids also include synthetic nucleic acid molecules, such as those that are chemically synthesized or recombinantly produced. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid molecule can be the sense strand, the antisense strand, or both. In addition, the nucleic acid can be circular or linear.

[0109] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. An origin of replication is operably linked to a coding sequence if the origin of replication controls the replication or copy number of the nucleic acid in the cell. Operably linked nucleic acids may or may not be contiguous.

[0110] Operon: Configurations of separate genes that are transcribed in tandem as a single messenger RNA are denoted as operons. Thus, a set of in-frame genes in close proximity under the transcriptional regulation of a single promoter constitutes an operon. Operons may be synthetically generated using the methods described herein.

[0111] Overexpress: When a gene is caused to be transcribed at an elevated rate compared to the endogenous or basal transcription rate for that gene. In some examples, overexpression additionally includes an elevated rate of translation of the gene compared to the endogenous translation rate for that gene. Methods of testing for overexpression are well known in the art, for example transcribed RNA levels can be assessed using rtPCR and protein levels can be assessed using SDS page gel analysis.

[0112] Recombinant: A recombinant nucleic acid molecule or polypeptide is one that has a sequence that is not naturally occurring, has a sequence that is made by an artificial combination of two otherwise separated segments of sequence, or both. This artificial combination can be achieved, for example, by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acid molecules or polypeptides, such as genetic engineering techniques. "Recombinant" is also used to describe nucleic acid molecules that have been artificially manipulated but contain the same regulatory sequences and coding regions that are found in the organism from which the nucleic acid was isolated. A recombinant cell or microorganism is one that contains an exogenous nucleic acid molecule, such as a recombinant nucleic acid molecule.

[0113] Recombinant cell: A cell that comprises a recombinant nucleic acid.

[0114] Vector or expression vector: An entity comprising a nucleic acid molecule that is capable of introducing the nucleic acid, or being introduced with the nucleic acid, into a cell for expression of the nucleic acid. A vector can include nucleic acid sequences that permit it to replicate in the cell, such as an origin of replication. A vector can also include one or more selectable marker genes and other genetic elements known in the art. Examples of suitable vectors are found below.

[0115] Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0116] Exogenous nucleic acids encoding enzymes involved in a metabolic pathway for producing polyhydroxyalkanoates can be introduced stably or transiently into a cell using techniques well known in the art, including electroporation, calcium phosphate precipitation, DEAE-dextran mediated transfection, liposome-mediated transfection, conjugation, transduction, and the like. For stable transformation, a nucleic acid can further include a selectable marker. Suitable selectable markers include antibiotic resistance genes that confer, for example, resistance to neomycin, tetracycline, chloramphenicol, or kanamycin, genes that complement auxotrophic deficiencies, and the like. (See below for more detail.)

[0117] Various embodiments of the invention use an expression vector that includes a heterologous nucleic acid encoding a protein involved in a metabolic or biosynthetic pathway. Suitable expression vectors include, but are not limited to viral vectors, such as baculovirus vectors or those based on vaccinia virus, polio virus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, and the like; phage vectors, such as bacteriophage vectors; plasmids; phagemids; cosmids; fosmids; bacterial artificial chromosomes; P1-based artificial chromosomes; yeast plasmids; yeast artificial chromosomes; and any other vectors specific for cells of interest.

[0118] Useful vectors can include one or more selectable marker genes to provide a phenotypic trait for selection of transformed cells. The selectable marker gene encodes a protein necessary for the survival or growth of transformed cells grown in a selective culture medium. Cells not transformed with the vector containing the selectable marker gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. In alternative embodiments, the selectable marker gene is one that encodes dihydrofolate reductase or confers neomycin resistance (for use in eukaryotic cell culture), or one that confers tetracycline or ampicillin resistance (for use in a prokaryotic cell, such as E. coli).

[0119] The coding sequence in the expression vector is operably linked to an appropriate expression control sequence (promoters, enhancers, and the like) to direct synthesis of the encoded gene product. Such promoters can be derived from microbial or viral sources, including CMV and SV40. Depending on the cell/vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. can be used in the expression vector (see e.g., Bitter et al. (1987) Methods in Enzymology, 153:516-544).

[0120] Suitable promoters for use in prokaryotic cells include but are not limited to: promoters capable of recognizing the T4, T3, Sp6, and T7 polymerases; the P.sub.R and P.sub.L promoters of bacteriophage lambda; the trp, recA, heat shock, and lacZ promoters of E. coli; the alpha-amylase and the sigma-specific promoters of B. subtilis; the promoters of the bacteriophages of Bacillus; Streptomyces promoters; the int promoter of bacteriophage lambda; the bla promoter of the beta-lactamase gene of pBR322; and the CAT promoter of the chloramphenicol acetyl transferase gene. Prokaryotic promoters are reviewed by Glick, J. Ind. Microbiol. 1:277 (1987); Watson et al, Molecular Biology of the Gene, 4th Ed., Benjamin Cummins (1987); and Sambrook et al., In: Molecular Cloning: A Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Laboratory Press (2001).

[0121] Non-limiting examples of suitable promoters for use within a eukaryotic cell are typically viral in origin and include the promoter of the mouse metallothionein I gene (Hamer et al. (1982) J. Mol. Appl. Gen. 1:273); the TK promoter of Herpes virus (McKnight (1982) Cell 31:355); the SV40 early promoter (Benoist et al. (1981) Nature (London) 290:304); the Rous sarcoma virus promoter; the cytomegalovirus promoter (Foecking et al. (1980) Gene 45:101); the yeast gal4 gene promoter (Johnston et al. (1982) PNAS (USA) 79:6971; Silver et al. (1984) PNAS (USA) 81:5951); and the IgG promoter (Orlandi et al. (1989) PNAS (USA) 86:3833).

[0122] Coding sequences can be operably linked to an inducible promoter. Inducible promoters are those wherein addition of an effector induces expression. Suitable effectors include proteins, metabolites, chemicals, or culture conditions capable of inducing expression. Suitable inducible promoters include but are not limited to the lac promoter (regulated by IPTG or analogs thereof), the lacUV5 promoter (regulated by IPTG or analogs thereof), the tac promoter (regulated by IPTG or analogs thereof), the trc promoter (regulated by IPTG or analogs thereof), the araBAD promoter (regulated by L-arabinose), the phoA promoter (regulated by phosphate starvation), the recA promoter (regulated by nalidixic acid), the proU promoter (regulated by osmolarity changes), the cst-1 promoter (regulated by glucose starvation), the tetA promoter (regulated by tetracycline), the cadA promoter (regulated by pH), the nar promoter (regulated by anaerobic conditions), the p.sub.L promoter (regulated by thermal shift), the cspA promoter (regulated by thermal shift), the T7 promoter (regulated by thermal shift), the T7-lac promoter (regulated by IPTG), the T3-lac promoter (regulated by IPTG), the T5-lac promoter (regulated by IPTG), the T4 gene 32 promoter (regulated by T4 infection), the nprM-lac promoter (regulated by IPTG), the VHb promoter (regulated by oxygen), the metallothionein promoter (regulated by heavy metals), the MMTV promoter (regulated by steroids such as dexamethasone) and variants thereof.

[0123] Alternatively, a coding sequence can be operably linked to a repressible promoter. Repressible promoters are those wherein addition of an effector represses expression. Examples of repressible promoters include but are not limited to the trp promoter (regulated by tryptophan); tetracycline-repressible promoters, such as those employed in the "TET-OFF"-brand system (Clontech, Mountain View, Calif.); and variants thereof.

[0124] In some versions, the cell is genetically modified with a heterologous nucleic acid encoding a biosynthetic pathway gene product that is operably linked to a constitutive promoter. Suitable constitutive promoters are known in the art and include constitutive adenovirus major late promoter, a constitutive MPSV promoter, and a constitutive CMV promoter.

[0125] The relative strengths of the promoters described herein are well-known in the art.

[0126] In some versions, the cell is genetically modified with an exogenous nucleic acid encoding a single protein. In other embodiments, a modified cell is one that is genetically modified with exogenous nucleic acids encoding two or more proteins. Where the cell is genetically modified to express two or more proteins, those nucleic acids can each be contained in a single or in separate expression vectors. When the nucleic acids are contained in a single expression vector, the nucleotide sequences may be operably linked to a common control element (e.g., a promoter), that is, the common control element controls expression of all of the coding sequences in the single expression vector.

[0127] When the cell is genetically modified with heterologous nucleic acids encoding two or more proteins, one of the nucleic acids can be operably linked to an inducible promoter, and one or more of the nucleic acids can be operably linked to a constitutive promoter. Alternatively, all can be operably linked to inducible promoters or all can be operably linked to constitutive promoters.

[0128] Nucleic acids encoding enzymes desired to be expressed in a cell may be codon-optimized for that particular type of cell. Codon optimization can be performed for any nucleic acid by "OPTIMUMGENE"-brand gene design system by GenScript (Piscataway, N.J.).

[0129] The introduction of a vector into a bacterial cell may be performed by protoplast transformation (Chang and Cohen (1979) Molecular General Genetics, 168:111-115), using competent cells (Young and Spizizen (1961) Journal of Bacteriology, 81:823-829; Dubnau and Davidoff-Abelson (1971) Journal of Molecular Biology, 56: 209-221), electroporation (Shigekawa and Dower (1988) Biotechniques, 6:742-751), or conjugation (Koehler and Thorne (1987) Journal of Bacteriology, 169:5771-5278). Commercially available vectors for expressing heterologous proteins in bacterial cells include but are not limited to pZERO, pTrc99A, pUC19, pUC18, pKK223-3, pEX1, pCAL, pET, pSPUTK, pTrxFus, pFastBac, pThioHis, pTrcHis, pTrcHis2, and pLEx, in addition to those described in the following Examples.

[0130] Methods for transforming yeast cells with heterologous DNA and producing heterologous polypeptides therefrom are disclosed by Clontech Laboratories, Inc., Palo Alto, Calif., USA (in the product protocol for the "YEASTMAKER"-brand yeast tranformation system kit); Reeves et al. (1992) FEMS Microbiology Letters 99:193-198; Manivasakam and Schiestl (1993) Nucleic Acids Research 21(18):4414-5; and Ganeva et al. (1994) FEMS Microbiology Letters 121:159-64. Expression and transformation vectors for transformation into many yeast strains are available. For example, expression vectors have been developed for the following yeasts: Candida albicans (Kurtz, et al. (1986) Mol. Cell. Biol. 6:142); Candida maltosa (Kunze et al. (1985) J. Basic Microbiol. 25:141); Hansenula polymorpha (Gleeson et al. (1986) J. Gen. Microbiol. 132:3459) and Roggenkamp et al. (1986) Mol. Gen. Genet. 202:302); Kluyveromyces fragilis (Das et al. (1984) J. Bacteriol. 158:1165); Kluyveromyces lactis (De Louvencourt et al. (1983) J. Bacteriol. 154:737) and Van den Berg et al. (1990) Bio/Technology 8:135); Pichia quillerimondii (Kunze et al. (1985) J. Basic Microbiol. 25:141); Pichia pastoris (Cregg et al. (1985) Mol. Cell. Biol. 5:3376; U.S. Pat. No. 4,837,148; and U.S. Pat. No. 4,929,555); Saccharomyces cerevisiae (Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA 75:1929 and Ito et al. (1983) J. Bacteriol. 153:163); Schizosaccharomyces pombe (Beach et al. (1981) Nature 300:706); and Yarrowia lipolytica (Davidow et al. (1985) Curr. Genet. 10:380-471 and Gaillardin et al. (1985) Curr. Genet. 10:49).

[0131] Suitable procedures for transformation of Aspergillus cells are described in EP 238 023 and U.S. Pat. No. 5,679,543. Suitable methods for transforming Fusarium species are described by Malardier et al., Gene, 1989, 78:147-56 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al. (1983) Journal of Bacteriology, 153: 163; and Hinnen et al. (1978) PNAS USA, 75:1920.

[0132] The elements and method steps described herein can be used in any combination whether explicitly described or not.

[0133] All combinations of method steps as used herein can be performed in any order, unless otherwise specified or clearly implied to the contrary by the context in which the referenced combination is made.

[0134] As used herein, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0135] Numerical ranges as used herein are intended to include every number and subset of numbers contained within that range, whether specifically disclosed or not. Further, these numerical ranges should be construed as providing support for a claim directed to any number or subset of numbers in that range. For example, a disclosure of from 1 to 10 should be construed as supporting a range of from 2 to 8, from 3 to 7, from 5 to 6, from 1 to 9, from 3.6 to 4.6, from 3.5 to 9.9, and so forth.

[0136] All patents, patent publications, and peer-reviewed publications (i.e., "references") cited herein are expressly incorporated by reference to the same extent as if each individual reference were specifically and individually indicated as being incorporated by reference. In case of conflict between the present disclosure and the incorporated references, the present disclosure controls.

[0137] It is understood that the invention is not confined to the particular construction and arrangement of parts herein illustrated and described, but embraces such modified forms thereof as come within the scope of the claims.

EXAMPLES

Summary

[0138] The following Examples present a rational approach for producing mcl-PHA homopolymer from an unrelated carbon source (i.e., glucose) in E. coli. A characterization of a panel of mutant E. coli strains to determine the impact of .beta.-oxidation enzymes on fatty acid consumption and mcl-PHA synthesis is presented. A characterization of two PHA synthases (PhaC) and four enoyl-CoA hydratases (PhaJ) for producing mcl-PHA in E. coli, thereby identifying a suitable combination for making mcl-PHA, is also presented. An examination of the impact of different modes of regulating acyl-CoA synthetases on PHA titer is shown. Finally, engineering of a strain of E. coli to produce mcl-PHA with a composition matching the product profile of the expressed thioesterase is shown. The strategy involves constructing a strain of E. coli in which key genes in fatty acid .beta.-oxidation are deleted and BTE, phaJ3 and phaC2 from Pseudomonas aeruginosa PAO1, and PP.sub.--0763 from P. putida KT2440 are overexpressed. The resulting strain is shown to produce over 15% cell dry weight (CDW) mcl-PHA when grown in minimal glucose-based media.

Materials and Methods

Bacterial Strains, Reagents, Media, and Growth Conditions

[0139] All strains used in this study are listed in Table 1. E. coli DH5.alpha. was used to construct and propagate plasmids. E. coli K-12 MG1655 .DELTA.araBAD was used as the base strain for studying .beta.-oxidation and PHA production. Chemicals and reagents were purchased from Fisher Scientific (Pittsburgh, Pa.) unless otherwise specified. Enzymes used for cloning were purchased from New England Biolabs (Ipswich, Mass.). Oligonucleotides were purchased from Integrated DNA Technologies, Inc. (Coralville, Iowa) and sequences are listed in Table 2. For all growth experiments, single colonies were used to inoculate 5 mL starter cultures that were grown overnight prior to inoculation of experimental cultures. All growth experiments were performed at 37.degree. C. in a rotary shaker (250 rpm). Where necessary, cultures were supplemented with 100 .mu.g mL.sup.-1 ampicillin and/or 34 .mu.g mL.sup.-1 chloramphenicol.

TABLE-US-00003 TABLE 1 Strains and plasmids used in this study. Strain/Plasmid Relevant Genotype/Property Source or Reference Strains E. coli K-12 F.sup.- .lamda..sup.- ilvG.sup.- rfb-50 rph-1 ECGSC MG1655 E. coli LS5218 F.sup.+ fadR601 atoC512(Const) ECGSC E. coli DH10B F.sup.- mcrA .DELTA.(mrr-hsdRMS-mcrBC) .PHI.80lacZ.DELTA.M15 .DELTA.lacX74 Invitrogen recA1 endA1 araD139 .DELTA.(ara, leu)7697 galU galK .lamda..sup.- rpsL nupG E. coli DH5.alpha. F.sup.- .PHI.80lacZ.DELTA.M15 .DELTA.(lacZYA-argF) U169 recA1 endA1 hsdR17 Invitrogen (r.sub.k-, m.sub.k+) phoA supE44 .lamda..sup.- thi.sup.-1 gyrA96 relA1 E. coli DY330 F.sup.- .lamda..sup.- rph-1 INV(rrnD, rrnE) .DELTA.lacU169 gal490 pgl.DELTA.8 .lamda.cI857 (Yu et al., 2000) .DELTA.(cro-bioA) Pseudomonas Source for phaC1-2, phaJ1-4 ATCC BAA-47 .TM. aeruginosa PAO1 Pseudomonas Source for PP_0763 ATCC 47054 .TM. putida KT2440 NRD204 MG1655 .DELTA.araBAD::cat (De Lay and Cronan, 2007) araBAD MG1655 .DELTA.araBAD This work A MG1655 .DELTA.araBAD .DELTA.fadA This work B MG1655 .DELTA.araBAD .DELTA.fadB This work E MG1655 .DELTA.araBAD .DELTA.fadE This work I MG1655 .DELTA.araBAD .DELTA.fadI This work J MG1655 .DELTA.araBAD .DELTA.fadJ This work R MG1655 .DELTA.araBAD .DELTA.fadR This work RA MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadA This work RB MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadB This work RE MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadE This work RI MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadI This work RJ MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadJ This work AI MG1655 .DELTA.araBAD .DELTA.fadA .DELTA.fadI This work BJ MG1655 .DELTA.araBAD .DELTA.fadB .DELTA.fadJ This work AB MG1655 .DELTA.araBAD .DELTA.fadAB This work IJ MG1655 .DELTA.araBAD .DELTA.fadIJ This work RAI MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadA .DELTA.fadI This work RBJ MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadB .DELTA.fadJ This work RAB MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadA .DELTA.fadB This work RIJ MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadIJ This work ABU MG1655 .DELTA.araBAD .DELTA.fadAB .DELTA.fadIJ This work RABIJ MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadAB .DELTA.fadIJ This work .PHI.(P.sub.trc-fadD) MG1655 .DELTA.araBAD .PHI.(P.sub.trc-fadD) This work SA01 MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadIJ fadBA::.PHI.(P.sub.trc-BTE) This work Plasmids pCP20 FLP.sup.+, .lamda. cI857.sup.+, .lamda. p.sub.R Rep.sup.ts, Ap.sup.R, Cm.sup.R (Cherepanov and Wackernagel, 1995) pKD13 Template plasmid for gene disruption. Kan.sup.R cassette flanked (Datsenko and by FRT sites. Amp.sup.R Wanner, 2000) pTrc99A P.sub.trc promoter, pBR322 origin, Amp.sup.R (Amann et al., 1988) pTrc99A-fadD fadD cloned as a Kpn I -Xba I fragment into pTrc99a This work pTrc99A-BTE pTrc99A carrying BTE under Ptrc control, Amp.sup.R (Hoover et al., 2011) pMSB6 pTrc99A with altered MCS This work pMSB6-J1 pMSB6 containing phaJ1 gene (P. aeruginosa) This work pMSB6-J2 pMSB6 containing phaJ2 gene (P. aeruginosa) This work pMSB6-J3 pMSB6 containing phaJ3 gene (P. aeruginosa) This work pMSB6-J4 pMSB6 containing phaJ4 gene (P. aeruginosa) This work pBAD33 P.sub.BAD promoter, pACYC origin, Cm.sup.R (Guzman et al., 1995) pBAD33-C280* pBAD33 araE C280* .DELTA.281-292 (Lee et al., 2007) pBAD33*-C1 pBAD33-C280* containing phaC1 gene (P. aeruginosa) This work pBAD33*-C2 pBAD33-C280* containing phaC2 gene (P. aeruginosa) This work pDA-JC pMSB6 containing phaJ3 and phaC2 genes (P. aeruginosa) This work pDA-JAC pDA-JC with PP_0763 cloned between phaJ3 and phaC2 This work pBTE-int pTrc99A containing BTE with cat-FRT cassette from pKD3 (Youngquist et al., 2012) (Datsenko and Wanner, 2000) inserted 5' of lacI.sup.Q

TABLE-US-00004 TABLE 2 Oligonucleotides used in this study. Primer Restriction Name Sequence Enzyme phaJ1-F GACGATGAATTCAGGAGGTATTAATAATGAGCCAGGTC EcoRI CAGAACATTC (SEQ ID NO: 25) phaJ1-R GACGATGGATCCGGCCCGACGGTAGGGAAA BamHI (SEQ ID NO: 26) phaJ2-F GACGATGAATTCAGGAGGTATTAATAATGGCGCTCGAT EcoRI CCTGAGGTGC (SEQ ID NO: 27) phaJ2-R GACGATGGATCCCTTCGCTTCAGTCCGGCCGCT BamHI (SEQ ID NO: 28) phaJ3-F GACGATGAATTCAGGAGGTATTAATAATGCCCACCGCC EcoRI TGGCTCGAC (SEQ ID NO: 29) phaJ3-R GACGAAGGATCCTCAGCCCTGTAGCCGGCTCCA BamHI (SEQ ID NO: 30) phaJ4-F GACGATGAATTCAGGAGGTATTAATAATGCCATTCGTA EcoRI CCCGTAGCAG (SEQ ID NO: 31) phaJ4-R GACGATGGATCCTCAGACGAAGCAGAGGCTGAG BamHI (SEQ ID NO: 32) phaC1-F GGGGAGCTCAGGAGGTATAATTAATGAGTCAGAAGAAC SacI AATAACGAG (SEQ ID NO: 33) phaC1-R GGGGGTACCTCATCGTTCATGCACGTAGGT KpnI (SEQ ID NO: 34) phaC2-F GGGGAGCTCAGGAGGTATAATTAATGCGAGAAAAGCA SacI GGAATCGGG (SEQ ID NO: 35) phaC2-R GGGGGTACCTCAGCGTATATGCACGTAGGTGC KpnI (SEQ ID NO: 36) phaC2-F2 GGGTCTAGAAGGAGGTATAATTAATGCGAGAAAAGCA XbaI GGAATCGGG (SEQ ID NO: 37) phaC2-R2 GGGAAGCTTTCAGCGTATATGCACGTAGGTGC HindIII (SEQ ID NO: 38) acs-F GGGGGTACCAGGAGGTATAATTAATGTTGCAGACACGC KpnI ATCATC (SEQ ID NO: 39) acs-R GGGTCTAGATTACAACGTGGAAAGGAACGC XbaI (SEQ ID NO: 40) IJ::BTE-F GGTCAGACCACTTTATTTATTTTTTTACAGGGGAGTGTT n/a AGCGGCATGCGTTCCTATTCC (SEQ ID NO: 41) IJ::BTE-R CTCCGCCATTCAGCGCGGATTCATATAGCTTTGACCTTC n/a TTAAACACGAGGTTCCGCCGG (SEQ ID NO: 42) R::BTE-F GAGTCCAACTTTGTTTTGCTGTGTTATGGAAATCTCACT n/a AGCGGCATGCGTTCCTATTCC (SEQ ID NO: 43) R::BTE-R ACCCCTCGTTTGAGGGGTTTGCTCTTTAAACGGAAGGG n/a ATTAAACACGAGGTTCCGCCGG (SEQ ID NO: 44) C280*-F GGGCTCGAGTTAACCGGCACGGAACTCGCTCG XhoI (SEQ ID NO: 45) C280*-R GGGCTCGAGTTGGTAACGAATCAGACAATTGACGGC XhoI (SEQ ID NO: 46) PfadD-kan-F TGAATAATTGCTTGTTTTTAAAGAAAAAGAAACAGCGG n/a CTGGTCCGCTGTGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 47) PfadD-kan-R TCGATGGTGTCAACGTAAATGATTCCGGGGATCCGTCG n/a ACC (SEQ ID NO: 48) PfadD-Trc-F CATTTACGTTGACACCATCGA (SEQ ID NO: 49) n/a PfadD-sew-R TCAGGCTTTATTGTCCACTTTG (SEQ ID NO: 50) n/a fadIJ::Cm-F CAGGTCAGACCACTTTATTTATTTTTTTACAGGGGAGTG n/a TGAAGCGGCATGCGTTCCTATTCC (SEQ ID NO: 51) fadIJ::Cm-R TTGCAGGTCAGTTGCAGTTGTTTTCCAAAAACTTTCCCC n/a AGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 52) fadR::Cm-F TCTGGTACGACCAGATCACCTTGCGGATTCAGGAGACT n/a GAGAAGCGGCATGCGTTCCTATTCC (SEQ ID NO: 53) fadR::Cm-R AACCCGCTCAAACACCGTCGCAATACCCTGACCCAGAC n/a CGGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 54)

[0140] For dodecanoic acid catabolism experiments (FIGS. 2A and 3), each strain was cultured in 25 mL of LB to an optical density at 600 nm (OD.sub.600) of 1.0. Cultures were centrifuged (1,000.times.g for 20 min) and resuspended in 50 mL of M9 minimal media supplemented with 0.25 g L.sup.-1 sodium dodecanoate from a 5 g L.sup.-1 sodium dodecanoate aqueous stock solution. This amount was chosen because higher levels impaired growth of E. coli MG1655 .DELTA.araBAD (data not shown). Under these conditions, soluble dodecanoic acid existed in equilibrium with a solid precipitate. After transfer, cultures were incubated at 37.degree. C. with shaking and 2.5 mL culture samples were taken at 24 and 48 h for FAME analysis. In the case of fadD overexpression constructs, 1 mM isopropyl f3-D-thiogalactopyranoside (IPTG) was added at an OD.sub.600 of 0.02 and again after resuspension in minimal media.

[0141] For dodecanoic acid production experiments (FIG. 2B), each strain was inoculated to OD.sub.600 of 0.05 in 5 mL of LB+0.4% (D)-glucose and induced with 1 mM IPTG at an OD.sub.600 of 0.2. After induction, cultures were incubated for 48 h at 37.degree. C. with shaking at which point, cultures were harvested for PHA and FAME analysis.

[0142] For shake flask experiments summarized by Table 3, 35 mL of LB was inoculated to OD.sub.600 0.05 and incubated with shaking until cultures reached OD.sub.600 1.0. Cultures were centrifuged (1,000.times.g for 20 min) and the cell pellet resuspended in 50 mL M9 minimal media supplemented with 2.5 g L.sup.-1 dodecanoic acid and inducer(s) (1 mM IPTG; 0.2% (L)-arabinose). Cultures were harvested at 96 h for PHA and FAME analysis.

[0143] For PHA production experiments detailed in Table 4 and FIG. 4, 50 mL of MOPS+1% (D)-glucose was inoculated to OD.sub.600 of 0.05 and induced with 1 mM IPTG at an OD.sub.600 of 0.2. After induction, cultures were incubated for 96 h at 37.degree. C. with shaking at which point, cultures were harvested for PHA and FAME analysis. For strains lacking chromosomal expression of BTE, 0.25 g L.sup.-1 sodium dodecanoate from a 5 g L.sup.-1 sodium dodecanoate aqueous stock solution was added at the time of induction.

[0144] Bioreactor experiments were performed in a 3 L stirred bioreactor (Applikon Biotechnology, Inc., Schiedam, Netherlands) using a 1.0 L working volume. Temperature was maintained at 37.degree. C. using an electric heat blanket and temperature, pH, and dissolved oxygen (DO.sub.2) were monitored using specific probes. Vessel pH was maintained at 7.00.+-.0.05 by addition of 1M NaOH or 1M HCl solutions. Agitation was provided by a single impeller with the stirrer speed set to 700 rpm. Stirrer speed was occasionally increased to ensure the DO.sub.2 content did not decrease below 40% saturation in order to maintain an aerobic environment (Becker et al., 1997; Tseng et al., 1996). Air inflow was maintained at 1.5 L min.sup.-1.

[0145] Bioreactor experiments were inoculated at an OD.sub.600 of 0.05 with a culture of strain SA01 harboring plasmid pDA-JAC grown to an OD.sub.600 of .gtoreq.2.5 in MOPS minimal media supplemented with 1% glucose. Induction with 1 mM IPTG occurred when the OD.sub.600 of the bioreactor reached 0.2. The reactor was operated in batch mode with one addition of 10 g of glucose (50 mL of a 20% (w/v) glucose solution) at 24 h post-induction. The OD.sub.600 of the culture was monitored periodically and 15 mL of culture taken every 24 h for FAME and PHA analysis. The contents of the bioreactor were harvested at 96 h post-induction for PHA and FAME analysis.

Plasmid Construction

[0146] All plasmids used in this study are listed in Table 1. Plasmid pBAD33-C280* (Lee et al., 2007) was constructed by PCR amplification of plasmid pBAD33 with primers C280*-F/R (Table 2) (Guzman et al., 1995). The PCR product was treated with Dpn I and Xho I digestion and circularized by ligation with T4 DNA ligase. Genomic DNA was isolated from P. putida KT2440 and P. aeruginosa PAO1 with a Wizard.RTM. Genomic DNA Purification Kit (Promega). PHA genes phaJ1-4 and phaC1-2 were amplified by PCR from a P. aeruginosa PAO1 genomic DNA template with the respective phaC and phaJ primers (Table 2). PP.sub.--0763 was amplified by PCR from a P. putida KT2440 genomic DNA template with primers acs-F/R (Table 2). All constructs were confirmed by DNA sequence analysis. Annotated sequence files for relevant constructs were deposited in GenBank.

Chromosome Engineering

[0147] Chromosomal gene deletions were created in E. coli K12 MG1655 .DELTA.araBAD by P1 transduction (Thomason et al., 2007) using phage lysates generated from members of the KEIO collection (Baba et al., 2006). Deletions of fadBA and fadIJ were generated as described previously using pKD13 as template (Datsenko and Wanner, 2000). Chromosomal integration of a .PHI.(P.sub.trc-BTE) expression cassette (a fusion of the IPTG inducible trc promoter with BTE) was constructed as described previously (Youngquist et al., 2012). Briefly, an insertion template was generated by PCR amplification of a fragment comprising lacI.sup.Q-P.sub.trc-BTE-FRT-Cm.sup.R-FRT from plasmid pBTE-int. Primers contained 40 base pairs of sequence homology to regions of the E. coli chromosome flanking the fadBA locus (Table 2) to guide .lamda. red mediated recombination. To construct the fadD promoter replacement, .PHI.(P.sub.trc-fadD), the region consisting of lacI.sup.Q-P.sub.trc-fadD was PCR amplified off of plasmid pTrc-fadD. A region of pKD13 comprising the kanamycin resistance cassette flanked by FRT sites was PCR amplified separately. The two PCR products were stitched together in a third PCR, generating a linear DNA that was integrated onto the chromosome of E. coli DY330 via .lamda. red mediated recombination. For each mutant strain, resistance markers were removed by inducing FLP recombinase encoded on plasmid pCP20 which was subsequently cured by growth at a non-permissive temperature (Datsenko and Wanner, 2000). All chromosomal mutations were verified by colony PCR.

Fatty Acid and PHA Extraction and Characterization

[0148] FAME analysis was performed on 2.5 mL of culture or supernatant as described previously (Lennen et al., 2010). For PHA analysis, cells were harvested by centrifugation (3000.times.g for 25 min), washed with 25 mL 1.times. phosphate buffered saline (PBS), and lyophilized overnight. PHA content was analyzed by GC/MS based on the method of Kato et al. (Kato et al., 1996). PHA was converted to the corresponding monomer-esters by combining 2 mL of chloroform and 2 mL of 3% H.sub.2SO.sub.4 in methanol (v/v) with 10 mg of lyophilized cells in a 10 mL disposable glass centrifuge tube. 50 .mu.L of 10 mg mL.sup.-1 pentadecanoic acid in ethanol was added as an internal standard. The mixture was heated at 105.degree. C. in a heat block for 24 hours followed by addition of 5 mL of 100 mg mL.sup.-1 NaHCO.sub.3 in water. The mixture was vortexed and centrifuged (1,000.times.g for 10 min) and the aqueous layer was removed by aspiration. The organic (chloroform) phase (1 .mu.L) was analyzed using a Shimadzu GCMS QP2010S gas chromatograph mass spectrometer equipped with an AOC-20i auto-injector and a Restek Rxi.RTM.-5 ms column (catalog #13423). The temperature program used was as follows: 60.degree. C. hold for 1 minute, ramp from 60.degree. C. to 230.degree. C. at 10.degree. C. per minute and a final hold at 230.degree. C. for 10 minutes. The MS was operated in scanning mode between 35 and 500 m/z.

PHA Purification and Nuclear Magnetic-Resonance Spectroscopy

[0149] PHA was extracted for analysis by nuclear magnetic-resonance (NMR) as described previously (Jiang et al., 2006) and modified based on communications with Chris Nomura (State University of New York). Briefly, lyophilized cells were washed with methanol to remove fatty acids and other impurities followed by a second lyophilization step. The material was extracted with 120 mL refluxing chloroform in a Soxhlet apparatus followed by evaporation of the chloroform to recover the purified PHA. 10-15 mg of product was dissolved in 1 mL deuterated chloroform and analyzed at room temperature on a Bruker AC-300 spectrometer for .sup.1H NMR and on a Varian Mercury-300 spectrometer for .sup.13C NMR.

Results

Effect of Fad Deletions on Dodecanoic Acid Catabolism

[0150] .beta.-oxidation of fatty acids occurs in three stages. First, FFA are imported across the outer membrane via FadL and activated as CoA thioesters by FadD in the inner membrane. The acyl-CoA thioesters are a key regulatory signal which abrogates the DNA binding ability of FadR. In the absence of acyl-CoAs, FadR represses expression of enzymes involved in .beta.-oxidation. Once activated, acyl-CoAs are catabolized to acetyl-CoA via an iterative pathway comprised of four enzymatic reactions (FIG. 1)--acyl-CoA dehydrogenation (FadE), enoyl-CoA hydration (FadB), (3S)-hydroxyacyl-CoA dehydrogenation (FadB), and ketoacyl-CoA thiolation (FadA). Three additional fad genes--fadK, fadI and fadJ have strong sequence homology to fadD, fadA and fadB, respectively and have been shown to be critical for anaerobic beta-oxidation (Campbell et al., 2003). Each cycle ends when FadA (or FadI) cleaves a ketoacyl-CoA to generate an acetyl-CoA and an acyl-CoA reduced in length by two carbons that is the substrate for the next round. Finally, E. coli possesses additional .beta.-oxidation capacity in the ato genes which are responsible for processing short-chain FFAs.

[0151] The metabolic engineering strategy for producing mcl-PHA from endogenously synthesized fatty acids described herein involves the disruption of .beta.-oxidation such that (R)-3-hydroxyacyl-CoA thioesters can be polymerized but not catabolized to acetyl-CoA. The ability of strains harboring various deletions in .beta.-oxidation (fad) genes to catabolize dodecanoic acid after 24 and 48 h of shake flask cultivation (FIG. 2A) was therefore tested. The base strain, K12 MG1655 .DELTA.araBAD, was observed not to completely catabolize all of the dodecanoic acid until 48 h, while a fadR mutant was able to consume all of the dodecanoic acid within 24 h. A fadB deletion, which based on previous reports was expected to greatly impair dodecanoic acid catabolism under aerobic conditions, consumed .about.20% of the dodecanoic acid. A .DELTA.fadB, .DELTA.fadJ double knockout strain completely blocked dodecanoic acid consumption over the course of 48 h. Similarly, a .DELTA.fadA strain consumed .about.20% of the dodecanoic acid, while a .DELTA.fadA, .DELTA.fadI double mutant demonstrated negligible dodecanoic acid consumption. The performance of other fad strains and the effect of a fadR deletion combined with these strains, which generally improved the rate of dodecanoic acid metabolism, are shown in FIG. 2A.

[0152] To determine if metabolism of exogenously fed dodecanoic acid correlated with metabolism of endogenously produced FFAs, .beta.-oxidation deletion strains were transformed with pTrc99a-BTE and grown for 48 h on LB supplemented with glucose (FIG. 2B). Final fatty acid concentrations and especially saturated dodecanoic acid concentrations correlated with exogenous consumption data (FIG. 2A). Specifically, strains capable of complete consumption of exogenous dodecanoic acid after 48 h accumulated little to no endogenous dodecanoic acid while strains that were the most impaired in exogenous C.sub.12 consumption yielded the largest concentrations of endogenous C.sub.12 FFA. While FFA uptake has been well studied (DiRusso and Black, 2004), the mechanism of FFA secretion is poorly understood. It should be noted that the data presented in FIG. 2B does not distinguish rates of FFA secretion and reuptake from catabolism of intracellular FFA.

Effect of fadD Regulation on Dodecanoic Acid Catabolism

[0153] The proposed mcl-PHA pathway involves the activation of FFA and oxidation by FadE to yield enoyl-CoA thioesters. These genes could be upregulated by increasing the rate of acyl-CoA synthesis (e.g. replacing P.sub.fadD with a stronger promoter), removing repression via FadR, or both. Therefore, a fadD overexpression strain was constructed by replacing the native fadD promoter with the strong, IPTG inducible trc promoter (Brosius et al., 1985). Dodecanoic acid consumption in this strain was compared with the base strain, .DELTA.fadR, and .PHI.(P.sub.trc-fadD) .DELTA.fadR combination strains (FIG. 3). Interestingly, the .DELTA.fadR strain completely consumed the dodecanoic acid after 8 h while complete consumption was not observed for the .PHI.(P.sub.trc-fadD) overexpression strain until 24 h. Surprisingly, a .PHI.(P.sub.trc-fadD) .DELTA.fadR combination strain consumed dodecanoic acid at a rate in between the .PHI.(P.sub.trc-fadD) overexpression and .DELTA.fadR strains. Deletion of fadR may provide the additional benefit of upregulating fadE expression, which is involved in the production of enoyl-CoA thioesters in the preferred mcl-PHA strategy described herein.

Production of mcl-PHA in fad Strains in the Presence of Exogenous Dodecanoic Acid

[0154] Two PHA biosynthetic enzymes confer E. coli with the ability to synthesize mcl-PHA from enoyl-CoA thioesters, a PHA polymerase (PhaC) and an (R)-specific enoyl-CoA hydratase (PhaJ). P. aeruginosa DSM1707 phaJ1-4 have been previously characterized in E. coli LS5218 (Tsuge et al., 2003). Here, genes from P. aeruginosa PAO1 were selected based on sequence identity with DSM1707 and the ability of this strain to accumulate mcl-PHA. Individual phaJ and phaC clones were co-expressed from plasmids pMSB-6 and pBAD33-C280* respectively in LS5218 grown in the presence of exogenous dodecanoic acid as a sole carbon source. All phaJ-phaC combinations yielded mcl-PHA identified as methyl esters of 3-hydroxyacyl-chains after processing (Table 3). The observed acyl-chains ranged in length from C.sub.6 to C.sub.14 corresponding to mcl-PHA monomers (C.sub.6-C.sub.12) and components of lipid A (C.sub.14). The combination of phaJ3 and phaC2 was selected based on the ability to produce mcl-PHA containing C.sub.12 monomer units at yields greater than other combinations tested (Table 3).

[0155] P. aeruginosa phaC2 was cloned downstream of phaJ3 into pMSB-6 yielding pDA-JC and the plasmid was transformed into a selection of fad deletions strains for mcl-PHA production. Table 4 shows the ability of a .DELTA.fadR, .DELTA.fadRB, .DELTA.fadRBJ and .DELTA.fadRABIJ strains to accumulate mcl-PHA as well as the monomer composition of the resulting polymer. Most notably, .DELTA.fadR and .DELTA.fadRB strains both produced mcl-PHA with a heterogeneous monomer composition, although the fraction of C.sub.12 monomers in the .DELTA.fadRB strain was greatly increased over that of the .DELTA.fadR strain. The .DELTA.fadRBJ and .DELTA.fadRABIJ strains were both capable of producing mcl-PHA homopolymer consisting entirely of C.sub.12 monomers with the yield of PHA in the .DELTA.fadRABIJ strain slightly improved over that of the .DELTA.fadRBJ strain. This result was consistent with the relative rates of endogenous FFA production (FIG. 2B).

TABLE-US-00005 TABLE 3 GC/MS analysis of the composition of mcl-PHA produced in E. coli LS5218 expressing combinations of two phaC and four phaJ from P. aeruginosa PAO1 after culturing in the presence of exogenous dodecanoic acid. Cell Dry PHA Weight content PHA composition (wt. %) Genotype (g L.sup.-1) (wt. %) C.sub.6 C.sub.8 C.sub.10 C.sub.12 phaC1 phaJ1 1.0 0.3 8.4 90.7 0.0 0.9 phaC1 phaJ2 1.2 4.4 4.8 49.6 28.9 16.8 phaC1 phaJ3 1.4 10.8 3.9 43.5 33.0 19.6 phaC1 phaJ4 1.0 2.8 5.2 52.3 25.6 16.9 phaC1 1.1 0.6 4.7 65.1 22.0 8.3 phaC2 phaJ1 1.0 2.2 34.0 54.8 6.7 4.5 phaC2 phaJ2 1.1 13.9 11.1 35.9 28.8 24.2 phaC2 phaJ3 1.1 19.1 8.2 32.3 32.2 27.3 phaC2 phaJ4 0.9 9.4 9.6 35.0 29.3 26.1 phaC2 1.1 1.8 6.9 48.5 26.7 17.9 Note: C.sub.6: 3-hydroxyhexanoate; C.sub.8: 3-hydroxyoctanoate; C.sub.10: 3-hydroxydecanoate; C.sub.12: 3-hydroxydodecanoate.

TABLE-US-00006 TABLE 4 GC/MS analysis of the composition of mcl-PHA produced in a series of E. coli .beta.-oxidation deletion strains containing plasmid pDA-JC after culturing in the presence of exogenous dodecanoic acid. Cell Dry PHA Relevant Weight content PHA composition (wt. %) genotype (g L.sup.-1) (wt. %) C.sub.6 C.sub.8 C.sub.10 C.sub.12 .DELTA.fadR 0.97 .+-. .09 1.71 .+-. .18 4.0 30.3 34.0 31.8 .DELTA.fadRB 0.96 .+-. .08 0.39 .+-. .13 n.d. 8.3 42.4 49.3 .DELTA.fadRBJ 1.10 .+-. .19 0.38 .+-. .15 n.d. n.d. n.d. 100.0 .DELTA.fadRABIJ 0.93 .+-. .02 0.75 .+-. .03 n.d. n.d. n.d. 100.0 Note: C.sub.6: 3-hydroxyhexanoate; C.sub.8: 3-hydroxyoctanoate; C.sub.10: 3-hydroxydecanoate; C.sub.12: 3-hydroxydodecanoate.

Accumulation of mcl-PHA in a .DELTA.fadRABIJ Strain with Endogenous Dodecanoic Acid Production

[0156] Expression of the California Bay Laurel (Umbellularia californica) thioesterase (BTE) in E. coli results in the accumulation of FFAs composed predominantly (.gtoreq.80%) of saturated C.sub.12 and unsaturated C.sub.12:1 species with the remainder comprised mainly of C.sub.14 and unsaturated C.sub.14:1 FFAs (Voelker and Davies, 1994). A codon optimized version of BTE (Lennen et al., 2010) was integrated into the chromosome of E. coli K-12 MG1655 .DELTA.araBAD .DELTA.fadR .DELTA.fadIJ into the fadBA locus, resulting in a .DELTA.fadRABIJ strain with one copy of the .PHI.(P.sub.trc-BTE) cassette. This strain (SA01) when transformed with pDA-JC and grown in MOPS minimal media supplemented with 1% glucose accumulated mcl-PHA at a % CDW on par with a .DELTA.fadRABIJ strain cultured with exogenous dodecanoic acid (FIG. 4). A significant amount of residual dodecanoic and tetradecanoic acid was also observed indicating that there is room for further pathway optimization.

Effect of Overexpression of PP.sub.--0763 on mcl-PHA Accumulation in a .DELTA.fadRABIJ Strain with Endogenous Dodecanoic Acid Production

[0157] Given the presence of excess FFA, it was hypothesized that the rate of fatty acyl-CoA production was not balanced with FFA synthesis. Therefore, the predicted acyl-CoA synthetase, PP.sub.--0763 from P. putida KT2440 was cloned between phaJ3 and phaC2 in pDA-JC resulting in pDA-JAC. Strain SA01 was transformed with pDA-JAC which resulted in the production of 9.8% CDW mcl-PHA, a 5-fold increase compared to the same strain without PP.sub.--0763 (FIG. 4, Table 5). When cultured in a 1 L bioreactor, mcl-PHA accumulation increased to 17.3% CDW after 96 h. The identity of the purified product was confirmed to be predominantly polyhydroxydodecanoate by .sup.1H and .sup.13C NMR (FIGS. 5A and 5B).

TABLE-US-00007 TABLE 5 Results from PHA Production Studies Shown in FIG. 4 Cell Dry PHA PHA Weight content content PHA composition (wt. %) Genotype (g L.sup.-1) (g L.sup.-1) (% CDW) C.sub.6 C.sub.8 C.sub.10 C.sub.12 C.sub.14 .DELTA.fadRABIJ 0.9 .+-. .02 0.02 1.7 n.d. n.d. n.d. 43.3 56.7 SA01 1.2 .+-. .07 0.02 1.9 n.d. n.d. n.d. 34.9 65.1 SA01-acs 0.9 .+-. .04 0.09 9.8 n.d. n.d. n.d. 77.0 23.0 Bioreactor 1.3 0.23 17.3 n.d. n.d. n.d. 77.9 22.0 Note: All Strains harbored plasmids expressing phaJ3 and phaC2. .DELTA.fadRABIJ strain was fed exogenous dodecanoic acid. PHA values could include hydroxy-acids extracted from lipid A. Abbreviations: C.sub.6, 3-hydroxyhexanoate; C.sub.8, 3-hydroxyoctanoate; C.sub.10, 3-hydroxydecanoate; C.sub.12, 3-hydroxydodecanoate; C.sub.14, 3-hydroxytetradecanoate.

Cloning and Expression of Phasin Genes

[0158] Phasin genes annotated as "Polyhydroxyalkanoate granule-associated proteins" on the UniProKB database (http://www.uniprot.org/) and having locus tags PP.sub.--5008 and PP.sub.--5007 were cloned from Pseudomonas putida KT2440. The PP.sub.--5008 gene is homologous to phal, and PP.sub.--5007 is homologous to phaF. Each phasin gene was expressed in the SA01 E. coli strain with and without the pDA-JAC vector and cultured in MOPS+1% glucose in the absence of supplemented fatty acids. As shown in FIG. 6, expression of the phasin genes drastically increased C12 and C14 polyhydroxyalkanoate production. Expression of PP.sub.--5008 in particular resulted in an unexpectedly large increase in C12 and C14 polyhydroxyalkanoate production.

Discussion

Effect of fad Deletions on Dodecanoic Acid Metabolism

[0159] Previous work has demonstrated that the ability to use fatty acids .gtoreq.C.sub.12 as a sole carbon source is lost in the case of deletions in fadB (Dirusso, 1990), however, a fadB(A) phaC.sup.+ strain was still capable of aerobic production of mcl-PHA heteropolymer, indicating that E. coli can complement fadB activity (Langenbach et al., 1997; Prieto et al., 1999; Qi et al., 1997; Ren et al., 2000; Snell et al., 2002). Furthermore, a fadA insertion mutant was capable of aerobic growth on oleic acid (C.sub.18:1) as a sole carbon source after extended incubation (<5 days) on solid media (Campbell et al., 2003), further indicating that additional .beta.-oxidation activity is present. The data indicate both E. coli .DELTA.fadA and .DELTA.fadB mutants are capable of dodecanoic acid metabolism after 24 h, although with reduced capability compared to WT. Conversely, E. coli .DELTA.fadR .DELTA.fadA catabolized dodecanoic acid more efficiently than WT with nearly complete consumption of the dodecanoic acid after 48 h. As fadR is a negative regulator for fadIf, it is likely that fadIJ is capable of complementing fadBA and restoring .beta.-oxidation activity to that of WT. However, a .DELTA.fadR .DELTA.fadB strain did not show increased dodecanoic acid catabolism over the 48 h period. Therefore, fadJ may not be able to complement a fadB deletion as effectively as in the case of fadI with fadA.

[0160] Deletions of fadI or fadD had a minor negative effect on dodecanoic acid metabolism compared to WT which is expected if fadBA function as the major contributor to aerobic .beta.-oxidation. Similarly, .DELTA.fadR .DELTA.fadI and .DELTA.fadR .DELTA.fadJ strains were comparable to a .DELTA.fadR strain. An unexpected result was the reduced rate of dodecanoic acid consumption in both a .DELTA.fadBA and .DELTA.fadIJ double knockout compared to WT. These data indicate that functional expression of fadBA is not essential for dodecanoic acid metabolism under the conditions tested. It is important to note that dodecanoic acid metabolism was still active in a .DELTA.fadIJ strain which is in line with previous work that demonstrated both aerobic and anaerobic growth for a .DELTA.fadIJ (yfcYX) strain on oleic acid (Campbell et al., 2003).

[0161] Based on the behavior of the aforementioned deletions, it was anticipated that a .DELTA.fadA .DELTA.fadI or .DELTA.fadB .DELTA.fadJ strain would be incapable of C12 metabolism. This result was confirmed for these strains, a .DELTA.fadBA .DELTA.fadIJ strain and for each of the strains when combined with a fadR deletion.

Comparison of fadD Overexpression and fadR Deletion on Dodecanoic Acid Metabolism

[0162] Due to the ability of a fadR deletion to improve the initial rate of C.sub.12 metabolism, it was hypothesized that overexpression of fadD would result in a similar phenotype. A chromosomal trc promoter fusion with fadD, .PHI.(P.sub.trc-fadD), individually and in combination with a .DELTA.fadR strain, was therefore tested. Over a 24 h period, it was noted that .PHI.(P.sub.trc-fadD) was capable of improved C.sub.12 consumption compared with WT but was not as efficient as a .DELTA.fadR or .PHI.(P.sub.trc-fadD) .DELTA.fadR combination strain. Overexpression of fadD increases the cytoplasmic acyl-CoA pool faster than in WT resulting in faster de-repression of all .beta.-oxidation genes regulated by fadR, while in a .DELTA.fadR strain, there is no repression of .beta.-oxidation genes allowing for faster initial turnover of exogenous fatty acids.

Effect of Soluble vs. Membrane Associated CoA-Synthetases

[0163] Although mcl-PHA production in strain SA01 expressing pDA-JC was achieved with a defined composition from a non-fatty acid feedstock, a large amount of endogenously produced FFA remained in the culture broth. Therefore, it was hypothesized that the limiting step in PHA biosynthesis was CoA ligation. Or put another way, it was hypothesized that intracellular FFAs were leaving the cell at a faster rate than FadD ligation with CoA, the product of which (acyl-CoA) is not exportable. Two models of the CoA synthetase reaction can be envisioned (DiRusso and Black, 2004). First, cytoplasmic FFA, freshly produced by BTE, could be directly bound by a cytosolic FadD and converted to CoA thioesters. Alternatively, cytoplasmic FFA could begin to traverse the inner cell membrane, periplasm, and outer membrane and be re-imported for FadD activation. The import of extracellular fatty acids across the outer membrane is facilitated by FadL. Once across the outer membrane, FFA traverse the periplasm and intercalate into the inner membrane. FFA then bind to the FadD active site and become phosphorylated from an ATP donor. The final CoA ligation, disassociation of FadD from the inner membrane and association of the fatty acyl-CoA with the cytoplasm likely takes place in one concerted event. If the rate of re-import is inferior to continued export (which would be down the concentration gradient) dodecanoic acid could accumulate extracellularly as was observed in the BTE expressing strains. The predicted soluble CoA-synthetase encoded by P. putida gene PP.sub.--0763 (acs), a medium-chain-length acyl-CoA synthetase, was therefore co-expressed. Co-expressing acs with PHA biosynthesis genes in SA01 resulted in a 5-fold increase in mcl-PHA accumulation in shake flasks and a 7.5-fold increase in 3-OH--C.sub.12 content. This data supports the conclusion that balancing FFA production and CoA activation will be critical to maximizing mcl-PHA yields.

Bioreactor Scale-Up of mcl-PHA Production from Glucose

[0164] The PHA production strategy described herein is the first to produce a defined mcl-PHA from an unrelated carbon source. The highest mcl-PHA production (17.3% CDW) was achieved by cultivating strain SA01 pDA-JAC in a 1 L bioreactor using a fed-batch strategy. For comparison, prior studies achieved .about.6% CDW of an undefined mcl-PHA in E. coli when grown on gluconate (Rehm and Steinbuchel, 2001) and 11.6% CDW of undefined heteropolymer in E. coli grown on glucose (Wang et al., 2012). Finally, recent work in both P. putida and E. coli demonstrated production of mcl-PHA homopolymer in the case of feeding exogenous fatty acids (Liu et al., 2011; Tappel et al., 2012). In putida, an 85% C.sub.12-co-15% C.sub.10 PHA was produced at 9% CDW, and in E. coli, a C.sub.12 homopolymer was produced at 28.6% CDW. Based on maximum theoretical yield calculations, E. coli is capable of producing 0.38 g (R)-3-hydroxydodecanoic acid per g glucose fed. Thus, further optimization of the described pathway for mcl-PHA biosynthesis should lead to additional improvements in the yield on glucose as a sole carbon source. For example, improvements in PHA biosynthesis could be achieved through expression of alternative polymerases or hydratases with a higher activity for C.sub.12 units. Besides fadJ (yfcX), there exist at least five additional genes with homology to fadB on the E. coli chromosome (Park and Lee, 2004). When these genes were overexpressed in E. coli .DELTA.fadB in the presence of a PHA polymerase and LB+0.2% decanoic acid (C.sub.10), a 1.3- to 2.0-fold improvement in PHA accumulation (% CDW) was achieved over an empty vector control. Along with fadJ, overexpression of ydbU, paaF and paaG resulted in the greatest improvement. By contrast, no PHA accumulation was detected in E. coli fadB.sup.+ under the same conditions. Therefore, these gene products may have a role in both C.sub.12 metabolism and PHA biosynthesis in E. coli and overexpression of these genes in addition to or in place of phaJ could improve PHA accumulation.

Conclusions

[0165] The foregoing Examples present a scheme for producing mcl-PHA homopolymer from a non-fatty acid related carbon source at up to 17.3% CDW. Examination of a series of .beta.-oxidation deletion strains provided an understanding of knockouts suitable to completely inhibit iterative degradation of both exogenously fed and endogenously produced fatty acids. Specifically, disruption of both the aerobic and anaerobic pathways (i.e., fadBA or fadIJ) proved suitable for the proposed mcl-PHA biosynthesis pathway. Co-expression of phaJ3 and phaC2 from P. aeruginosa PAO1 in E. coli .DELTA.fadRABIJ yielded polyhydroxydodecanoate in the presence of dodecanoic acid feeding. When the plant acyl-ACP thioesterase, BTE, was expressed in this strain, PHA comprised primarily of hydroxydodecanoate monomers was observed. Finally, expression of an additional, soluble CoA-synthetase improved production 5-fold resulting in the highest reported production of mcl-PHA for a scheme involving a thioesterase.

[0166] This strategy can be generalized to produce a variety of mcl-PHA homo- and heteropolymers, where the resulting monomer composition can be tailored based on the known fatty acid production profile of a particular acyl-ACP thioesterase. If integrated with pathways for converting renewable substrates to acetyl-CoA, processes for synthesizing designer mcl-PHA can be developed. The use of inexpensive feedstocks will ultimately allow renewable, biodegradable PHAs to compete on a cost-basis with analogous, petroleum derived plastics.

REFERENCES

[0167] Amann, E., Ochs, B., Abel, K. J., 1988. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene. 69, 301-315. [0168] Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., Mori, H., 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology. 2, 11. [0169] Becker, S., Vlad, D., Schuster, S., Pfeiffer, P., Unden, G., 1997. Regulatory O-2 tensions for the synthesis of fermentation products in Escherichia coli and relation to aerobic respiration. Archives of Microbiology. 168, 290-296. [0170] Brosius, J., Erfle, M., Storella, J., 1985. Spacing of the -10 and -35 regions in the tac promoter: effect on its in vivo activity. Journal of Biological Chemistry. 260, 3539-3541. [0171] Campbell, J. W., Morgan-Kiss, R. M., Cronan, J. E., 2003. A new Escherichia coli metabolic competency: growth on fatty acids by a novel anaerobic beta-oxidation pathway. Molecular Microbiology. 47, 793-805. [0172] Chen, G. Q., Wu, Q., 2005. The application of polyhydroxyalkanoates as tissue engineering materials. Biomaterials. 26, 6565-6578. [0173] Cherepanov, P. P., Wackernagel, W., 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene. 158, 9-14. [0174] Chung, A., Liu, Q., Ouyang, S. P., Wu, Q., Chen, G. Q., 2009. Microbial production of 3-hydroxydodecanoic acid by pha operon and fadBA knockout mutant of Pseudomonas putida KT2442 harboring tesB gene. Applied Microbiology and Biotechnology. 83, 513-519. [0175] Datsenko, K. A., Wanner, B. L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America. 97, 6640-6645. [0176] De Lay, N. R., Cronan, J. E., 2007. In vivo functional analyses of the type II Acyl carrier proteins of fatty acid biosynthesis. Journal of Biological Chemistry. 282, 20319-20328. [0177] Dirusso, C. C., 1990. Primary sequence of the Escherichia-coli fadBA operon, encoding the fatty acid-oxidizing multienzyme complex, indicates a high degree of homology to eukaryotic enzymes. Journal of Bacteriology. 172, 6459-6468. [0178] DiRusso, C. C., Black, P. N., 2004. Bacterial long chain fatty acid transport: Gateway to a fatty acid-responsive signaling system. Journal of Biological Chemistry. 279, 49563-49566. [0179] Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J., 1995. Tight Regulation, Modulation, and High-Level Expression by Vectors Containing the Arabinose PBAD Promoter. Journal of Bacteriology. 177, 4121-4130. [0180] Hoover, S. W., Marner, W. D., Brownson, A. K., Lennen, R. M., Wittkopp, T. M., Yoshitani, J., Zulkifly, S., Graham, L. E., Chaston, S. D., McMahon, K. D., Pfleger, B. F., 2011. Bacterial production of free fatty acids from freshwater macroalgal cellulose. Applied Microbiology and Biotechnology. 91, 435-446. [0181] Jiang, X., Ramsay, J. A., Ramsay, B. A., 2006. Acetone extraction of mcl-PHA from Pseudomonas putida KT2440. Journal of Microbiological Methods. 67, 212-219. [0182] Kato, M., Bao, H. J., Kang, C. K., Fukui, T., Doi, Y., 1996. Production of a novel copolyester of 3-hydroxybutyric acid and medium chain length 3-hydroxyalkanaic acids by Pseudomonas sp 61-3 from sugars. Applied Microbiology and Biotechnology. 45, 363-370. [0183] Khanna, S., Srivastava, A. K., 2005. Recent advances in microbial polyhydroxyalkanoates. Process Biochemistry. 40, 607-619. [0184] Langenbach, S., Rehm, B. H. A., Steinbuchel, A., 1997. Functional expression of the PHA synthase gene PhaC1 from Pseudomonas aeruginosa in Escherichia coli results in poly(3-hydroxyalkanoate) synthesis. Ferns Microbiology Letters. 150, 303-309. [0185] Lee, S. K., Chou, H. H., Pfleger, B. F., Newman, J. D., Yoshikuni, Y., Keasling, J. D., 2007. Directed evolution of AraC for improved compatibility of arabinose- and lactose-inducible promoters. Applied and Environmental Microbiology. 73, 5711-5715. [0186] Lennen, R. M., Braden, D. J., West, R. M., Dumesic, J. A., Pfleger, B. F., 2010. A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes. Biotechnology and Bioengineering. 106, 193-202. [0187] Li, Z.-J., Shi, Z.-Y., Jian, J., Guo, Y.-Y., Wu, Q., Chen, G.-Q., 2010. Production of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) from unrelated carbon sources by metabolically engineered Escherichia coli. Metabolic Engineering. 12, 352-359. [0188] Liu, Q., Luo, G., Zhou, X. R., Chen, G.-Q., 2011. Biosynthesis of poly(3-hydroxydecanoate) and 3-hydroxydodecanoate dominating polyhydroxyalkanoates by beta-oxidation pathway inhibited Pseudomonas putida. Metabolic Engineering. 13, 11-17. [0189] Meng, D.-C., Shi, Z.-Y., Wu, L.-P., Zhou, Q., Wu, Q., Chen, J.-C., Chen, G.-Q., 2012. Production and characterization of poly(3-hydroxypropionate-co-4-hydroxybutyrate) with fully controllable structures by recombinant Escherichia coli containing an engineered pathway. Metabolic Engineering. 14, 317-324. [0190] Park, S. J., Lee, S. Y., 2004. New fadB homologous enzymes and their use in enhanced biosynthesis of medium-chain-length polyhydroxyalkanoates in fadB mutant Escherichia coli. Biotechnology and Bioengineering. 86, 681-686. [0191] Prieto, M. A., Kellerhals, M. B., Bozzato, G. B., Radnovic, D., Witholt, B., Kessler, B., 1999. Engineering of stable recombinant bacteria for production of chiral medium-chain-length poly-3-hydroxyalkanoates. Applied and Environmental Microbiology. 65, 3265-3271. [0192] Qi, Q. S., Rehm, B. H. A., Steinbuchel, A., 1997. Synthesis of poly(3-hydroxyalkanoates) in Escherichia coli expressing the PHA synthase gene phaC2 from Pseudomonas aeruginosa: comparison of PhaC1 and PhaC2. Fems Microbiology Letters. 157, 155-162. [0193] Qiu, Y. Z., Han, J., Guo, J. J., Chen, G. Q., 2005. Production of Poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) from gluconate and glucose by recombinant Aeromonas hydrophila and Pseudomonas putida. Biotechnology Letters. 27, 1381-1386. [0194] Rehm, B. H. A., Steinbuchel, A., 2001. Heterologous expression of the acyl-acyl carrier protein thioesterase gene from the plant Umbellularia californica mediates polyhydroxyalkanoate biosynthesis in recombinant Escherichia coli. Applied Microbiology and Biotechnology. 55, 205-209. [0195] Ren, Q., Sierro, N., Kellerhals, M., Kessler, B., Witholt, B., 2000. Properties of engineered poly-3-hydroxyalkanoates produced in recombinant Escherichia coli strains. Applied and Environmental Microbiology. 66, 1311-1320. [0196] Snell, K. D., Feng, F., Zhong, L., Martin, D., Madison, L. L., 2002. YfcX enables medium-chain-length poly(3-hydroxyalkanoate) formation from fatty acids in recombinant Escherichia coli fadB strains. Journal of Bacteriology. 184, 5696-5705. [0197] Steinbuchel, A., Valentin, H. E., 1995. Diversity of Bacterial Polyhydroxyalkanoic Acids. Fems Microbiology Letters. 128, 219-228. [0198] Tappel, R. C., Wang, Q., Nomura, C. T., 2012. Precise control of repeating unit composition in biodegradable poly(3-hydroxyalkanoate) polymers synthesized by Escherichia coli. Journal of bioscience and bioengineering. 113, 480-6. [0199] Theodorou, E. C., Theodorou, M. C., Kyriakidis, D. A., 2012. Involvement of the AtoSCDAEB regulon in the high molecular weight poly-(R)-3-hydroxybutyrate biosynthesis in phaCAB+Escherichia coli. Metabolic Engineering. 14, 354-365. [0200] Thomason, L. C., Costantino, N., Court, D. L., 2007. E. coli genome manipulation by P1 transduction. Current protocols in molecular biology/edited by Frederick M. Ausubel . . . [et al.]. Chapter 1, Unit 1.17. [0201] Tseng, C. P., Albrecht, J., Gunsalus, R. P., 1996. Effect of microaerophilic cell growth conditions on expression of the aerobic (cyoABCDE and cydAB) and anaerobic (narGHJI, frdABCD, and dmsABC) respiratory pathway genes in Escherichia coli. Journal of Bacteriology. 178, 1094-1098. [0202] Tsuge, T., Taguchi, K., Taguchi, S., Doi, Y., 2003. Molecular characterization and properties of (R)-specific enoyl-CoA hydratases from Pseudomonas aeruginosa: metabolic tools for synthesis of polyhydroxyalkanoates via fatty acid beta-oxidation. International Journal of Biological Macromolecules. 31, 195-205. [0203] Voelker, T. A., Davies, H. M., 1994. Alteration of the specificity and regulation of fatty-acid synthesis of Escherichia-coli by expression of a plant medium-chain acyl-acyl carrier protein thioesterase. Journal of Bacteriology. 176, 7320-7327. [0204] Wang, H. H., Zhou, X. R., Liu, Q. A., Chen, G. Q., 2011. Biosynthesis of polyhydroxyalkanoate homopolymers by Pseudomonas putida. Applied Microbiology and Biotechnology. 89, 1497-1507. [0205] Wang, Q., Tappel, R. C., Zhu, C. J., Nomura, C. T., 2012. Development of a New Strategy for Production of Medium-Chain-Length Polyhydroxyalkanoates by Recombinant Escherichia coli via Inexpensive Non-Fatty Acid Feedstocks. Applied and Environmental Microbiology. 78, 519-527. [0206] Youngquist, J. T., Lennen, R. M., Ranatunga, D. R., Bothfeld, W. H., II, W. D. M., Pfleger, B. F., 2012. Kinetic modeling of free fatty acid production in Escherichia coli based on continuous cultivation of a plasmid free strain. Biotechnology and Bioengineering. 109, 1518-1527. [0207] Yu, D. G., Ellis, H. M., Lee, E. C., Jenkins, N. A., Copeland, N. G., Court, D. L., 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America. 97, 5978-5983. [0208] Zhou, Q., Shi, Z.-Y., Meng, D.-C., Wu, Q., Chen, J.-C., Chen, G.-Q., 2011. Production of 3-hydroxypropionate homopolymer and poly(3-hydroxypropionate-co-4-hydroxybutyrate) copolymer by recombinant Escherichia coli. Metabolic Engineering. 13, 777-785.

Sequence CWU 1

1

5412190DNAEscherichia coli 1atgctttaca aaggcgacac cctgtacctt gactggctgg aagatggcat tgccgaactg 60gtatttgatg ccccaggttc agttaataaa ctcgacactg cgaccgtcgc cagcctcggc 120gaggccatcg gcgtgctgga acagcaatca gatctaaaag ggctgctgct gcgttcgaac 180aaagcagcct ttatcgtcgg tgctgatatc accgaatttt tgtccctgtt cctcgttcct 240gaagaacagt taagtcagtg gctgcacttt gccaatagcg tgtttaatcg cctggaagat 300ctgccggtgc cgaccattgc tgccgtcaat ggctatgcgc tgggcggtgg ctgcgaatgc 360gtgctggcga ccgattatcg tctggcgacg ccggatctgc gcatcggtct gccggaaacc 420aaactgggca tcatgcctgg ctttggcggt tctgtacgta tgccacgtat gctgggcgct 480gacagtgcgc tggaaatcat tgccgccggt aaagatgtcg gcgcggatca ggcgctgaaa 540atcggtctgg tggatggcgt agtcaaagca gaaaaactgg ttgaaggcgc aaaggcggtt 600ttacgccagg ccattaacgg cgacctcgac tggaaagcaa aacgtcagcc gaagctggaa 660ccactaaaac tgagcaagat tgaagccacc atgagcttca ccatcgctaa agggatggtc 720gcacaaacag cggggaaaca ttatccggcc cccatcaccg cagtaaaaac cattgaagct 780gcggcccgtt ttggtcgtga agaagcctta aacctggaaa acaaaagttt tgtcccgctg 840gcgcatacca acgaagcccg cgcactggtc ggcattttcc ttaacgatca atatgtaaaa 900ggcaaagcga agaaactcac caaagacgtt gaaaccccga aacaggccgc ggtgctgggt 960gcaggcatta tgggcggcgg catcgcttac cagtctgcgt ggaaaggcgt gccggttgtc 1020atgaaagata tcaacgacaa gtcgttaacc ctcggcatga ccgaagccgc gaaactgctg 1080aacaagcagc ttgagcgcgg caagatcgat ggtctgaaac tggctggcgt gatctccaca 1140atccacccaa cgctcgacta cgccggattt gaccgcgtgg atattgtggt agaagcggtt 1200gttgaaaacc cgaaagtgaa aaaagccgta ctggcagaaa ccgaacaaaa agtacgccag 1260gataccgtgc tggcgtctaa cacttcaacc attcctatca gcgaactggc caacgcgctg 1320gaacgcccgg aaaacttctg cgggatgcac ttctttaacc cggtccaccg aatgccgttg 1380gtagaaatta ttcgcggcga gaaaagctcc gacgaaacca tcgcgaaagt tgtcgcctgg 1440gcgagcaaga tgggcaagac gccgattgtg gttaacgact gccccggctt ctttgttaac 1500cgcgtgctgt tcccgtattt cgccggtttc agccagctgc tgcgcgacgg cgcggatttc 1560cgcaagatcg acaaagtgat ggaaaaacag tttggctggc cgatgggccc ggcatatctg 1620ctggacgttg tgggcattga taccgcgcat cacgctcagg ctgtcatggc agcaggcttc 1680ccgcagcgga tgcagaaaga ttaccgcgat gccatcgacg cgctgtttga tgccaaccgc 1740tttggtcaga agaacggcct cggtttctgg cgttataaag aagacagcaa aggtaagccg 1800aagaaagaag aagacgccgc cgttgaagac ctgctggcag aagtgagcca gccgaagcgc 1860gatttcagcg aagaagagat tatcgcccgc atgatgatcc cgatggtcaa cgaagtggtg 1920cgctgtctgg aggaaggcat tatcgccact ccggcggaag cggatatggc gctggtctac 1980ggcctgggct tccctccgtt ccacggcggc gcgttccgct ggctggacac cctcggtagc 2040gcaaaatacc tcgatatggc acagcaatat cagcacctcg gcccgctgta tgaagtgccg 2100gaaggtctgc gtaataaagc gcgtcataac gaaccgtact atcctccggt tgagccagcc 2160cgtccggttg gcgacctgaa aacggcttaa 21902729PRTEscherichia coli 2Met Leu Tyr Lys Gly Asp Thr Leu Tyr Leu Asp Trp Leu Glu Asp Gly 1 5 10 15 Ile Ala Glu Leu Val Phe Asp Ala Pro Gly Ser Val Asn Lys Leu Asp 20 25 30 Thr Ala Thr Val Ala Ser Leu Gly Glu Ala Ile Gly Val Leu Glu Gln 35 40 45 Gln Ser Asp Leu Lys Gly Leu Leu Leu Arg Ser Asn Lys Ala Ala Phe 50 55 60 Ile Val Gly Ala Asp Ile Thr Glu Phe Leu Ser Leu Phe Leu Val Pro 65 70 75 80 Glu Glu Gln Leu Ser Gln Trp Leu His Phe Ala Asn Ser Val Phe Asn 85 90 95 Arg Leu Glu Asp Leu Pro Val Pro Thr Ile Ala Ala Val Asn Gly Tyr 100 105 110 Ala Leu Gly Gly Gly Cys Glu Cys Val Leu Ala Thr Asp Tyr Arg Leu 115 120 125 Ala Thr Pro Asp Leu Arg Ile Gly Leu Pro Glu Thr Lys Leu Gly Ile 130 135 140 Met Pro Gly Phe Gly Gly Ser Val Arg Met Pro Arg Met Leu Gly Ala 145 150 155 160 Asp Ser Ala Leu Glu Ile Ile Ala Ala Gly Lys Asp Val Gly Ala Asp 165 170 175 Gln Ala Leu Lys Ile Gly Leu Val Asp Gly Val Val Lys Ala Glu Lys 180 185 190 Leu Val Glu Gly Ala Lys Ala Val Leu Arg Gln Ala Ile Asn Gly Asp 195 200 205 Leu Asp Trp Lys Ala Lys Arg Gln Pro Lys Leu Glu Pro Leu Lys Leu 210 215 220 Ser Lys Ile Glu Ala Thr Met Ser Phe Thr Ile Ala Lys Gly Met Val 225 230 235 240 Ala Gln Thr Ala Gly Lys His Tyr Pro Ala Pro Ile Thr Ala Val Lys 245 250 255 Thr Ile Glu Ala Ala Ala Arg Phe Gly Arg Glu Glu Ala Leu Asn Leu 260 265 270 Glu Asn Lys Ser Phe Val Pro Leu Ala His Thr Asn Glu Ala Arg Ala 275 280 285 Leu Val Gly Ile Phe Leu Asn Asp Gln Tyr Val Lys Gly Lys Ala Lys 290 295 300 Lys Leu Thr Lys Asp Val Glu Thr Pro Lys Gln Ala Ala Val Leu Gly 305 310 315 320 Ala Gly Ile Met Gly Gly Gly Ile Ala Tyr Gln Ser Ala Trp Lys Gly 325 330 335 Val Pro Val Val Met Lys Asp Ile Asn Asp Lys Ser Leu Thr Leu Gly 340 345 350 Met Thr Glu Ala Ala Lys Leu Leu Asn Lys Gln Leu Glu Arg Gly Lys 355 360 365 Ile Asp Gly Leu Lys Leu Ala Gly Val Ile Ser Thr Ile His Pro Thr 370 375 380 Leu Asp Tyr Ala Gly Phe Asp Arg Val Asp Ile Val Val Glu Ala Val 385 390 395 400 Val Glu Asn Pro Lys Val Lys Lys Ala Val Leu Ala Glu Thr Glu Gln 405 410 415 Lys Val Arg Gln Asp Thr Val Leu Ala Ser Asn Thr Ser Thr Ile Pro 420 425 430 Ile Ser Glu Leu Ala Asn Ala Leu Glu Arg Pro Glu Asn Phe Cys Gly 435 440 445 Met His Phe Phe Asn Pro Val His Arg Met Pro Leu Val Glu Ile Ile 450 455 460 Arg Gly Glu Lys Ser Ser Asp Glu Thr Ile Ala Lys Val Val Ala Trp 465 470 475 480 Ala Ser Lys Met Gly Lys Thr Pro Ile Val Val Asn Asp Cys Pro Gly 485 490 495 Phe Phe Val Asn Arg Val Leu Phe Pro Tyr Phe Ala Gly Phe Ser Gln 500 505 510 Leu Leu Arg Asp Gly Ala Asp Phe Arg Lys Ile Asp Lys Val Met Glu 515 520 525 Lys Gln Phe Gly Trp Pro Met Gly Pro Ala Tyr Leu Leu Asp Val Val 530 535 540 Gly Ile Asp Thr Ala His His Ala Gln Ala Val Met Ala Ala Gly Phe 545 550 555 560 Pro Gln Arg Met Gln Lys Asp Tyr Arg Asp Ala Ile Asp Ala Leu Phe 565 570 575 Asp Ala Asn Arg Phe Gly Gln Lys Asn Gly Leu Gly Phe Trp Arg Tyr 580 585 590 Lys Glu Asp Ser Lys Gly Lys Pro Lys Lys Glu Glu Asp Ala Ala Val 595 600 605 Glu Asp Leu Leu Ala Glu Val Ser Gln Pro Lys Arg Asp Phe Ser Glu 610 615 620 Glu Glu Ile Ile Ala Arg Met Met Ile Pro Met Val Asn Glu Val Val 625 630 635 640 Arg Cys Leu Glu Glu Gly Ile Ile Ala Thr Pro Ala Glu Ala Asp Met 645 650 655 Ala Leu Val Tyr Gly Leu Gly Phe Pro Pro Phe His Gly Gly Ala Phe 660 665 670 Arg Trp Leu Asp Thr Leu Gly Ser Ala Lys Tyr Leu Asp Met Ala Gln 675 680 685 Gln Tyr Gln His Leu Gly Pro Leu Tyr Glu Val Pro Glu Gly Leu Arg 690 695 700 Asn Lys Ala Arg His Asn Glu Pro Tyr Tyr Pro Pro Val Glu Pro Ala 705 710 715 720 Arg Pro Val Gly Asp Leu Lys Thr Ala 725 32145DNAEscherichia coli 3atggaaatga catcagcgtt tacccttaat gttcgtctgg acaacattgc cgttatcacc 60atcgacgtac cgggtgagaa aatgaatacc ctgaaggcgg agtttgcctc gcaggtgcgc 120gccattatta agcaactccg tgaaaacaaa gagttgcgag gcgtggtgtt tgtctccgct 180aaaccggaca acttcattgc tggcgcagac atcaacatga tcggcaactg caaaacggcg 240caagaagcgg aagctctggc gcggcagggc caacagttga tggcggagat tcatgctttg 300cccattcagg ttatcgcggc tattcatggc gcttgcctgg gtggtgggct ggagttggcg 360ctggcgtgcc acggtcgcgt ttgtactgac gatcctaaaa cggtgctcgg tttgcctgaa 420gtacaacttg gattgttacc cggttcaggc ggcacccagc gtttaccgcg tctgataggc 480gtcagcacag cattagagat gatcctcacc ggaaaacaac ttcgggcgaa acaggcatta 540aagctggggc tggtggatga cgttgttccg cactccattc tgctggaagc cgctgttgag 600ctggcaaaga aggagcgccc atcttcccgc cctctacctg tacgcgagcg tattctggcg 660gggccgttag gtcgtgcgct gctgttcaaa atggtcggca agaaaacaga acacaaaact 720caaggcaatt atccggcgac agaacgcatc ctggaggttg ttgaaacggg attagcgcag 780ggcaccagca gcggttatga cgccgaagct cgggcgtttg gcgaactggc gatgacgcca 840caatcgcagg cgctgcgtag tatctttttt gccagtacgg acgtgaagaa agatcccggc 900agtgatgcgc cgcctgcgcc attaaacagc gtggggattt taggtggtgg cttgatgggc 960ggcggtattg cttatgtcac tgcttgtaaa gcggggattc cggtcagaat taaagatatc 1020aacccgcagg gcataaatca tgcgctgaag tacagttggg atcagctgga gggcaaagtt 1080cgccgtcgtc atctcaaagc cagcgaacgt gacaaacagc tggcattaat ctccggaacg 1140acggactatc gcggctttgc ccatcgcgat ctgattattg aagcggtgtt tgaaaatctc 1200gaattgaaac aacagatggt ggcggaagtt gagcaaaatt gcgccgctca taccatcttt 1260gcttcgaata cgtcatcttt accgattggt gatatcgccg ctcacgccac gcgacctgag 1320caagttatcg gcctgcattt cttcagtccg gtggaaaaaa tgccgctggt ggagattatt 1380cctcatgcgg ggacatcggc gcaaaccatc gctaccacag taaaactggc gaaaaaacag 1440ggtaaaacgc caattgtcgt gcgtgacaaa gccggttttt acgtcaatcg catcttagcg 1500ccttacatta atgaagctat ccgcatgttg acccaaggtg aacgggtaga gcacattgat 1560gccgcgctag tgaaatttgg ttttccggta ggcccaatcc aacttttgga tgaggtagga 1620atcgacaccg ggactaaaat tattcctgta ctggaagccg cttatggaga acgttttagc 1680gcgcctgcaa atgttgtttc ttcaattttg aacgacgatc gcaaaggcag aaaaaatggc 1740cggggtttct atctttatgg tcagaaaggg cgtaaaagca aaaaacaggt cgatcccgcc 1800atttacccgc tgattggcac acaagggcag gggcgaatct ccgcaccgca ggttgctgaa 1860cggtgtgtga tgttgatgct gaatgaagca gtacgttgtg ttgatgagca ggttatccgt 1920agcgtgcgtg acggggatat tggcgcggta tttggcattg gttttccgcc atttctcggt 1980ggaccgttcc gctatatcga ttctctcggc gcgggcgaag tggttgcaat aatgcaacga 2040cttgccacgc agtatggttc ccgttttacc ccttgcgagc gtttggtcga gatgggcgcg 2100cgtggggaaa gtttttggaa aacaactgca actgacctgc aataa 21454714PRTEscherichia coli 4Met Glu Met Thr Ser Ala Phe Thr Leu Asn Val Arg Leu Asp Asn Ile 1 5 10 15 Ala Val Ile Thr Ile Asp Val Pro Gly Glu Lys Met Asn Thr Leu Lys 20 25 30 Ala Glu Phe Ala Ser Gln Val Arg Ala Ile Ile Lys Gln Leu Arg Glu 35 40 45 Asn Lys Glu Leu Arg Gly Val Val Phe Val Ser Ala Lys Pro Asp Asn 50 55 60 Phe Ile Ala Gly Ala Asp Ile Asn Met Ile Gly Asn Cys Lys Thr Ala 65 70 75 80 Gln Glu Ala Glu Ala Leu Ala Arg Gln Gly Gln Gln Leu Met Ala Glu 85 90 95 Ile His Ala Leu Pro Ile Gln Val Ile Ala Ala Ile His Gly Ala Cys 100 105 110 Leu Gly Gly Gly Leu Glu Leu Ala Leu Ala Cys His Gly Arg Val Cys 115 120 125 Thr Asp Asp Pro Lys Thr Val Leu Gly Leu Pro Glu Val Gln Leu Gly 130 135 140 Leu Leu Pro Gly Ser Gly Gly Thr Gln Arg Leu Pro Arg Leu Ile Gly 145 150 155 160 Val Ser Thr Ala Leu Glu Met Ile Leu Thr Gly Lys Gln Leu Arg Ala 165 170 175 Lys Gln Ala Leu Lys Leu Gly Leu Val Asp Asp Val Val Pro His Ser 180 185 190 Ile Leu Leu Glu Ala Ala Val Glu Leu Ala Lys Lys Glu Arg Pro Ser 195 200 205 Ser Arg Pro Leu Pro Val Arg Glu Arg Ile Leu Ala Gly Pro Leu Gly 210 215 220 Arg Ala Leu Leu Phe Lys Met Val Gly Lys Lys Thr Glu His Lys Thr 225 230 235 240 Gln Gly Asn Tyr Pro Ala Thr Glu Arg Ile Leu Glu Val Val Glu Thr 245 250 255 Gly Leu Ala Gln Gly Thr Ser Ser Gly Tyr Asp Ala Glu Ala Arg Ala 260 265 270 Phe Gly Glu Leu Ala Met Thr Pro Gln Ser Gln Ala Leu Arg Ser Ile 275 280 285 Phe Phe Ala Ser Thr Asp Val Lys Lys Asp Pro Gly Ser Asp Ala Pro 290 295 300 Pro Ala Pro Leu Asn Ser Val Gly Ile Leu Gly Gly Gly Leu Met Gly 305 310 315 320 Gly Gly Ile Ala Tyr Val Thr Ala Cys Lys Ala Gly Ile Pro Val Arg 325 330 335 Ile Lys Asp Ile Asn Pro Gln Gly Ile Asn His Ala Leu Lys Tyr Ser 340 345 350 Trp Asp Gln Leu Glu Gly Lys Val Arg Arg Arg His Leu Lys Ala Ser 355 360 365 Glu Arg Asp Lys Gln Leu Ala Leu Ile Ser Gly Thr Thr Asp Tyr Arg 370 375 380 Gly Phe Ala His Arg Asp Leu Ile Ile Glu Ala Val Phe Glu Asn Leu 385 390 395 400 Glu Leu Lys Gln Gln Met Val Ala Glu Val Glu Gln Asn Cys Ala Ala 405 410 415 His Thr Ile Phe Ala Ser Asn Thr Ser Ser Leu Pro Ile Gly Asp Ile 420 425 430 Ala Ala His Ala Thr Arg Pro Glu Gln Val Ile Gly Leu His Phe Phe 435 440 445 Ser Pro Val Glu Lys Met Pro Leu Val Glu Ile Ile Pro His Ala Gly 450 455 460 Thr Ser Ala Gln Thr Ile Ala Thr Thr Val Lys Leu Ala Lys Lys Gln 465 470 475 480 Gly Lys Thr Pro Ile Val Val Arg Asp Lys Ala Gly Phe Tyr Val Asn 485 490 495 Arg Ile Leu Ala Pro Tyr Ile Asn Glu Ala Ile Arg Met Leu Thr Gln 500 505 510 Gly Glu Arg Val Glu His Ile Asp Ala Ala Leu Val Lys Phe Gly Phe 515 520 525 Pro Val Gly Pro Ile Gln Leu Leu Asp Glu Val Gly Ile Asp Thr Gly 530 535 540 Thr Lys Ile Ile Pro Val Leu Glu Ala Ala Tyr Gly Glu Arg Phe Ser 545 550 555 560 Ala Pro Ala Asn Val Val Ser Ser Ile Leu Asn Asp Asp Arg Lys Gly 565 570 575 Arg Lys Asn Gly Arg Gly Phe Tyr Leu Tyr Gly Gln Lys Gly Arg Lys 580 585 590 Ser Lys Lys Gln Val Asp Pro Ala Ile Tyr Pro Leu Ile Gly Thr Gln 595 600 605 Gly Gln Gly Arg Ile Ser Ala Pro Gln Val Ala Glu Arg Cys Val Met 610 615 620 Leu Met Leu Asn Glu Ala Val Arg Cys Val Asp Glu Gln Val Ile Arg 625 630 635 640 Ser Val Arg Asp Gly Asp Ile Gly Ala Val Phe Gly Ile Gly Phe Pro 645 650 655 Pro Phe Leu Gly Gly Pro Phe Arg Tyr Ile Asp Ser Leu Gly Ala Gly 660 665 670 Glu Val Val Ala Ile Met Gln Arg Leu Ala Thr Gln Tyr Gly Ser Arg 675 680 685 Phe Thr Pro Cys Glu Arg Leu Val Glu Met Gly Ala Arg Gly Glu Ser 690 695 700 Phe Trp Lys Thr Thr Ala Thr Asp Leu Gln 705 710 51164DNAEscherichia coli 5atggaacagg ttgtcattgt cgatgcaatt cgcaccccga tgggccgttc gaagggcggt 60gcttttcgta acgtgcgtgc agaagatctc tccgctcatt taatgcgtag cctgctggcg 120cgtaacccgg cgctggaagc ggcggccctc gacgatattt actggggttg tgtgcagcag 180acgctggagc agggttttaa tatcgcccgt aacgcggcgc tgctggcaga agtaccacac 240tctgtcccgg cggttaccgt taatcgcttg tgtggttcat ccatgcaggc actgcatgac 300gcagcacgaa tgatcatgac tggcgatgcg caggcatgtc tggttggcgg cgtggagcat 360atgggccatg tgccgatgag tcacggcgtc gattttcacc ccggcctgag ccgcaatgtc 420gccaaagcgg cgggcatgat gggcttaacg gcagaaatgc tggcgcgtat gcacggtatc 480agccgtgaaa tgcaggatgc ctttgccgcg cggtcacacg cccgcgcctg ggccgccacg 540cagtcggccg catttaaaaa tgaaatcatc ccgaccggtg gtcacgatgc cgacggcgtc 600ctgaagcagt ttaattacga cgaagtgatt cgcccggaaa ccaccgtgga agccctcgcc 660acgctgcgtc cggcgtttga tccagtaaac ggtatggtaa cggcgggcac atcttctgca 720ctttccgatg gcgcagctgc catgctggtg atgagtgaaa gccgcgccca tgaattaggt 780cttaagccgc gcgctcgtgt gcgttcgatg gcggtcgttg gttgtgaccc atcgattatg 840ggttacggcc cggttccggc ctcgaaactg gcgctgaaaa aagcggggct ttctgccagc 900gatatcggcg tgtttgaaat gaacgaagcc tttgccgcgc agatcctgcc atgtattaaa 960gatctgggac taattgagca gattgacgag aagatcaacc tcaacggtgg cgcgatcgcg 1020ctgggtcatc cgctgggttg ttccggtgcg cgtatcagca ccacgctgct gaatctgatg 1080gaacgcaaag acgttcagtt tggtctggcg acgatgtgta tcggtctggg tcagggtatt 1140gcgacggtgt

ttgagcgggt ttaa 11646387PRTEscherichia coli 6Met Glu Gln Val Val Ile Val Asp Ala Ile Arg Thr Pro Met Gly Arg 1 5 10 15 Ser Lys Gly Gly Ala Phe Arg Asn Val Arg Ala Glu Asp Leu Ser Ala 20 25 30 His Leu Met Arg Ser Leu Leu Ala Arg Asn Pro Ala Leu Glu Ala Ala 35 40 45 Ala Leu Asp Asp Ile Tyr Trp Gly Cys Val Gln Gln Thr Leu Glu Gln 50 55 60 Gly Phe Asn Ile Ala Arg Asn Ala Ala Leu Leu Ala Glu Val Pro His 65 70 75 80 Ser Val Pro Ala Val Thr Val Asn Arg Leu Cys Gly Ser Ser Met Gln 85 90 95 Ala Leu His Asp Ala Ala Arg Met Ile Met Thr Gly Asp Ala Gln Ala 100 105 110 Cys Leu Val Gly Gly Val Glu His Met Gly His Val Pro Met Ser His 115 120 125 Gly Val Asp Phe His Pro Gly Leu Ser Arg Asn Val Ala Lys Ala Ala 130 135 140 Gly Met Met Gly Leu Thr Ala Glu Met Leu Ala Arg Met His Gly Ile 145 150 155 160 Ser Arg Glu Met Gln Asp Ala Phe Ala Ala Arg Ser His Ala Arg Ala 165 170 175 Trp Ala Ala Thr Gln Ser Ala Ala Phe Lys Asn Glu Ile Ile Pro Thr 180 185 190 Gly Gly His Asp Ala Asp Gly Val Leu Lys Gln Phe Asn Tyr Asp Glu 195 200 205 Val Ile Arg Pro Glu Thr Thr Val Glu Ala Leu Ala Thr Leu Arg Pro 210 215 220 Ala Phe Asp Pro Val Asn Gly Met Val Thr Ala Gly Thr Ser Ser Ala 225 230 235 240 Leu Ser Asp Gly Ala Ala Ala Met Leu Val Met Ser Glu Ser Arg Ala 245 250 255 His Glu Leu Gly Leu Lys Pro Arg Ala Arg Val Arg Ser Met Ala Val 260 265 270 Val Gly Cys Asp Pro Ser Ile Met Gly Tyr Gly Pro Val Pro Ala Ser 275 280 285 Lys Leu Ala Leu Lys Lys Ala Gly Leu Ser Ala Ser Asp Ile Gly Val 290 295 300 Phe Glu Met Asn Glu Ala Phe Ala Ala Gln Ile Leu Pro Cys Ile Lys 305 310 315 320 Asp Leu Gly Leu Ile Glu Gln Ile Asp Glu Lys Ile Asn Leu Asn Gly 325 330 335 Gly Ala Ile Ala Leu Gly His Pro Leu Gly Cys Ser Gly Ala Arg Ile 340 345 350 Ser Thr Thr Leu Leu Asn Leu Met Glu Arg Lys Asp Val Gln Phe Gly 355 360 365 Leu Ala Thr Met Cys Ile Gly Leu Gly Gln Gly Ile Ala Thr Val Phe 370 375 380 Glu Arg Val 385 71311DNAEscherichia coli 7atgggtcagg ttttaccgct ggttacccgc cagggcgatc gtatcgccat tgttagcggt 60ttacgtacgc cttttgcccg tcaggcgacg gcttttcatg gcattcccgc ggttgattta 120gggaagatgg tggtaggcga actgctggca cgcagcgaga tccccgccga agtgattgaa 180caactggtct ttggtcaggt cgtacaaatg cctgaagccc ccaacattgc gcgtgaaatt 240gttctcggta cgggaatgaa tgtacatacc gatgcttaca gcgtcagccg cgcttgcgct 300accagtttcc aggcagttgc aaacgtcgca gaaagcctga tggcgggaac tattcgagcg 360gggattgccg gtggggcaga ttcctcttcg gtattgccaa ttggcgtcag taaaaaactg 420gcgcgcgtgc tggttgatgt caacaaagct cgtaccatga gccagcgact gaaactcttc 480tctcgcctgc gtttgcgcga cttaatgccc gtaccacctg cggtagcaga atattctacc 540ggcttgcgga tgggcgacac cgcagagcaa atggcgaaaa cctacggcat cacccgagaa 600cagcaagatg cattagcgca ccgttcgcat cagcgtgccg ctcaggcatg gtcagacgga 660aaactcaaag aagaggtgat gactgccttt atccctcctt ataaacaacc gcttgtcgaa 720gacaacaata ttcgcggtaa ttcctcgctt gccgattacg caaagctgcg cccggcgttt 780gatcgcaaac acggaacggt aacggcggca aacagtacgc cgctgaccga tggcgcggca 840gcggtgatcc tgatgactga atcccgggcg aaagaattag ggctggtgcc gctggggtat 900ctgcgcagct acgcatttac tgcgattgat gtctggcagg acatgttgct cggtccagcc 960tggtcaacac cgctggcgct ggagcgtgcc ggtttgacga tgagcgatct gacattgatc 1020gatatgcacg aagcctttgc agctcagacg ctggcgaata ttcagttgct gggtagtgaa 1080cgttttgctc gtgaagcact ggggcgtgca catgccactg gcgaagtgga cgatagcaaa 1140tttaacgtgc ttggcggttc gattgcttac gggcatccct tcgcggcgac cggcgcgcgg 1200atgattaccc agacattgca tgaacttcgc cgtcgcggcg gtggatttgg tttagttacc 1260gcctgtgctg ccggtgggct tggcgcggca atggttctgg aggcggaata a 13118436PRTEscherichia coli 8Met Gly Gln Val Leu Pro Leu Val Thr Arg Gln Gly Asp Arg Ile Ala 1 5 10 15 Ile Val Ser Gly Leu Arg Thr Pro Phe Ala Arg Gln Ala Thr Ala Phe 20 25 30 His Gly Ile Pro Ala Val Asp Leu Gly Lys Met Val Val Gly Glu Leu 35 40 45 Leu Ala Arg Ser Glu Ile Pro Ala Glu Val Ile Glu Gln Leu Val Phe 50 55 60 Gly Gln Val Val Gln Met Pro Glu Ala Pro Asn Ile Ala Arg Glu Ile 65 70 75 80 Val Leu Gly Thr Gly Met Asn Val His Thr Asp Ala Tyr Ser Val Ser 85 90 95 Arg Ala Cys Ala Thr Ser Phe Gln Ala Val Ala Asn Val Ala Glu Ser 100 105 110 Leu Met Ala Gly Thr Ile Arg Ala Gly Ile Ala Gly Gly Ala Asp Ser 115 120 125 Ser Ser Val Leu Pro Ile Gly Val Ser Lys Lys Leu Ala Arg Val Leu 130 135 140 Val Asp Val Asn Lys Ala Arg Thr Met Ser Gln Arg Leu Lys Leu Phe 145 150 155 160 Ser Arg Leu Arg Leu Arg Asp Leu Met Pro Val Pro Pro Ala Val Ala 165 170 175 Glu Tyr Ser Thr Gly Leu Arg Met Gly Asp Thr Ala Glu Gln Met Ala 180 185 190 Lys Thr Tyr Gly Ile Thr Arg Glu Gln Gln Asp Ala Leu Ala His Arg 195 200 205 Ser His Gln Arg Ala Ala Gln Ala Trp Ser Asp Gly Lys Leu Lys Glu 210 215 220 Glu Val Met Thr Ala Phe Ile Pro Pro Tyr Lys Gln Pro Leu Val Glu 225 230 235 240 Asp Asn Asn Ile Arg Gly Asn Ser Ser Leu Ala Asp Tyr Ala Lys Leu 245 250 255 Arg Pro Ala Phe Asp Arg Lys His Gly Thr Val Thr Ala Ala Asn Ser 260 265 270 Thr Pro Leu Thr Asp Gly Ala Ala Ala Val Ile Leu Met Thr Glu Ser 275 280 285 Arg Ala Lys Glu Leu Gly Leu Val Pro Leu Gly Tyr Leu Arg Ser Tyr 290 295 300 Ala Phe Thr Ala Ile Asp Val Trp Gln Asp Met Leu Leu Gly Pro Ala 305 310 315 320 Trp Ser Thr Pro Leu Ala Leu Glu Arg Ala Gly Leu Thr Met Ser Asp 325 330 335 Leu Thr Leu Ile Asp Met His Glu Ala Phe Ala Ala Gln Thr Leu Ala 340 345 350 Asn Ile Gln Leu Leu Gly Ser Glu Arg Phe Ala Arg Glu Ala Leu Gly 355 360 365 Arg Ala His Ala Thr Gly Glu Val Asp Asp Ser Lys Phe Asn Val Leu 370 375 380 Gly Gly Ser Ile Ala Tyr Gly His Pro Phe Ala Ala Thr Gly Ala Arg 385 390 395 400 Met Ile Thr Gln Thr Leu His Glu Leu Arg Arg Arg Gly Gly Gly Phe 405 410 415 Gly Leu Val Thr Ala Cys Ala Ala Gly Gly Leu Gly Ala Ala Met Val 420 425 430 Leu Glu Ala Glu 435 9720DNAEscherichia coli 9atggtcatta aggcgcaaag cccggcgggt ttcgcggaag agtacattat tgaaagtatc 60tggaataacc gcttccctcc cgggactatt ttgcccgcag aacgtgaact ttcagaatta 120attggcgtaa cgcgtactac gttacgtgaa gtgttacagc gtctggcacg agatggctgg 180ttgaccattc aacatggcaa gccgacgaag gtgaataatt tctgggaaac ttccggttta 240aatatccttg aaacactggc gcgactggat cacgaaagtg tgccgcagct tattgataat 300ttgctgtcgg tgcgtaccaa tatttccact atttttattc gcaccgcgtt tcgtcagcat 360cccgataaag cgcaggaagt gctggctacc gctaatgaag tggccgatca cgccgatgcc 420tttgccgagc tggattacaa catattccgc ggcctggcgt ttgcttccgg caacccgatt 480tacggtctga ttcttaacgg gatgaaaggg ctgtatacgc gtattggtcg tcactatttc 540gccaatccgg aagcgcgcag tctggcgctg ggcttctacc acaaactgtc ggcgttgtgc 600agtgaaggcg cgcacgatca ggtgtacgaa acagtgcgtc gctatgggca tgagagtggc 660gagatttggc accggatgca gaaaaatctg ccgggtgatt tagccattca ggggcgataa 72010239PRTEscherichia coli 10Met Val Ile Lys Ala Gln Ser Pro Ala Gly Phe Ala Glu Glu Tyr Ile 1 5 10 15 Ile Glu Ser Ile Trp Asn Asn Arg Phe Pro Pro Gly Thr Ile Leu Pro 20 25 30 Ala Glu Arg Glu Leu Ser Glu Leu Ile Gly Val Thr Arg Thr Thr Leu 35 40 45 Arg Glu Val Leu Gln Arg Leu Ala Arg Asp Gly Trp Leu Thr Ile Gln 50 55 60 His Gly Lys Pro Thr Lys Val Asn Asn Phe Trp Glu Thr Ser Gly Leu 65 70 75 80 Asn Ile Leu Glu Thr Leu Ala Arg Leu Asp His Glu Ser Val Pro Gln 85 90 95 Leu Ile Asp Asn Leu Leu Ser Val Arg Thr Asn Ile Ser Thr Ile Phe 100 105 110 Ile Arg Thr Ala Phe Arg Gln His Pro Asp Lys Ala Gln Glu Val Leu 115 120 125 Ala Thr Ala Asn Glu Val Ala Asp His Ala Asp Ala Phe Ala Glu Leu 130 135 140 Asp Tyr Asn Ile Phe Arg Gly Leu Ala Phe Ala Ser Gly Asn Pro Ile 145 150 155 160 Tyr Gly Leu Ile Leu Asn Gly Met Lys Gly Leu Tyr Thr Arg Ile Gly 165 170 175 Arg His Tyr Phe Ala Asn Pro Glu Ala Arg Ser Leu Ala Leu Gly Phe 180 185 190 Tyr His Lys Leu Ser Ala Leu Cys Ser Glu Gly Ala His Asp Gln Val 195 200 205 Tyr Glu Thr Val Arg Arg Tyr Gly His Glu Ser Gly Glu Ile Trp His 210 215 220 Arg Met Gln Lys Asn Leu Pro Gly Asp Leu Ala Ile Gln Gly Arg 225 230 235 111686DNAEscherichia coli 11ttgaagaagg tttggcttaa ccgttatccc gcggacgttc cgacggagat caaccctgac 60cgttatcaat ctctggtaga tatgtttgag cagtcggtcg cgcgctacgc cgatcaacct 120gcgtttgtga atatggggga ggtaatgacc ttccgcaagc tggaagaacg cagtcgcgcg 180tttgccgctt atttgcaaca agggttgggg ctgaagaaag gcgatcgcgt tgcgttgatg 240atgcctaatt tattgcaata tccggtggcg ctgtttggca ttttgcgtgc cgggatgatc 300gtcgtaaacg ttaacccgtt gtataccccg cgtgagcttg agcatcagct taacgatagc 360ggcgcatcgg cgattgttat cgtgtctaac tttgctcaca cactggaaaa agtggttgat 420aaaaccgccg ttcagcacgt aattctgacc cgtatgggcg atcagctatc tacggcaaaa 480ggcacggtag tcaatttcgt tgttaaatac atcaagcgtt tggtgccgaa ataccatctg 540ccagatgcca tttcatttcg tagcgcactg cataacggct accggatgca gtacgtcaaa 600cccgaactgg tgccggaaga tttagctttt ctgcaataca ccggcggcac cactggtgtg 660gcgaaaggcg cgatgctgac tcaccgcaat atgctggcga acctggaaca ggttaacgcg 720acctatggtc cgctgttgca tccgggcaaa gagctggtgg tgacggcgct gccgctgtat 780cacatttttg ccctgaccat taactgcctg ctgtttatcg aactgggtgg gcagaacctg 840cttatcacta acccgcgcga tattccaggg ttggtaaaag agttagcgaa atatccgttt 900accgctatca cgggcgttaa caccttgttc aatgcgttgc tgaacaataa agagttccag 960cagctggatt tctccagtct gcatctttcc gcaggcggtg ggatgccagt gcagcaagtg 1020gtggcagagc gttgggtgaa actgaccgga cagtatctgc tggaaggcta tggccttacc 1080gagtgtgcgc cgctggtcag cgttaaccca tatgatattg attatcatag tggtagcatc 1140ggtttgccgg tgccgtcgac ggaagccaaa ctggtggatg atgatgataa tgaagtacca 1200ccaggtcaac cgggtgagct ttgtgtcaaa ggaccgcagg tgatgctggg ttactggcag 1260cgtcccgatg ctaccgatga aatcatcaaa aatggctggt tacacaccgg cgacatcgcg 1320gtaatggatg aagaaggatt cctgcgcatt gtcgatcgta aaaaagacat gattctggtt 1380tccggtttta acgtctatcc caacgagatt gaagatgtcg tcatgcagca tcctggcgta 1440caggaagtcg cggctgttgg cgtaccttcc ggctccagtg gtgaagcggt gaaaatcttc 1500gtagtgaaaa aagatccatc gcttaccgaa gagtcactgg tgactttttg ccgccgtcag 1560ctcacgggat acaaagtacc gaagctggtg gagtttcgtg atgagttacc gaaatctaac 1620gtcggaaaaa ttttgcgacg agaattacgt gacgaagcgc gcggcaaagt ggacaataaa 1680gcctga 168612561PRTEscherichia coli 12Met Lys Lys Val Trp Leu Asn Arg Tyr Pro Ala Asp Val Pro Thr Glu 1 5 10 15 Ile Asn Pro Asp Arg Tyr Gln Ser Leu Val Asp Met Phe Glu Gln Ser 20 25 30 Val Ala Arg Tyr Ala Asp Gln Pro Ala Phe Val Asn Met Gly Glu Val 35 40 45 Met Thr Phe Arg Lys Leu Glu Glu Arg Ser Arg Ala Phe Ala Ala Tyr 50 55 60 Leu Gln Gln Gly Leu Gly Leu Lys Lys Gly Asp Arg Val Ala Leu Met 65 70 75 80 Met Pro Asn Leu Leu Gln Tyr Pro Val Ala Leu Phe Gly Ile Leu Arg 85 90 95 Ala Gly Met Ile Val Val Asn Val Asn Pro Leu Tyr Thr Pro Arg Glu 100 105 110 Leu Glu His Gln Leu Asn Asp Ser Gly Ala Ser Ala Ile Val Ile Val 115 120 125 Ser Asn Phe Ala His Thr Leu Glu Lys Val Val Asp Lys Thr Ala Val 130 135 140 Gln His Val Ile Leu Thr Arg Met Gly Asp Gln Leu Ser Thr Ala Lys 145 150 155 160 Gly Thr Val Val Asn Phe Val Val Lys Tyr Ile Lys Arg Leu Val Pro 165 170 175 Lys Tyr His Leu Pro Asp Ala Ile Ser Phe Arg Ser Ala Leu His Asn 180 185 190 Gly Tyr Arg Met Gln Tyr Val Lys Pro Glu Leu Val Pro Glu Asp Leu 195 200 205 Ala Phe Leu Gln Tyr Thr Gly Gly Thr Thr Gly Val Ala Lys Gly Ala 210 215 220 Met Leu Thr His Arg Asn Met Leu Ala Asn Leu Glu Gln Val Asn Ala 225 230 235 240 Thr Tyr Gly Pro Leu Leu His Pro Gly Lys Glu Leu Val Val Thr Ala 245 250 255 Leu Pro Leu Tyr His Ile Phe Ala Leu Thr Ile Asn Cys Leu Leu Phe 260 265 270 Ile Glu Leu Gly Gly Gln Asn Leu Leu Ile Thr Asn Pro Arg Asp Ile 275 280 285 Pro Gly Leu Val Lys Glu Leu Ala Lys Tyr Pro Phe Thr Ala Ile Thr 290 295 300 Gly Val Asn Thr Leu Phe Asn Ala Leu Leu Asn Asn Lys Glu Phe Gln 305 310 315 320 Gln Leu Asp Phe Ser Ser Leu His Leu Ser Ala Gly Gly Gly Met Pro 325 330 335 Val Gln Gln Val Val Ala Glu Arg Trp Val Lys Leu Thr Gly Gln Tyr 340 345 350 Leu Leu Glu Gly Tyr Gly Leu Thr Glu Cys Ala Pro Leu Val Ser Val 355 360 365 Asn Pro Tyr Asp Ile Asp Tyr His Ser Gly Ser Ile Gly Leu Pro Val 370 375 380 Pro Ser Thr Glu Ala Lys Leu Val Asp Asp Asp Asp Asn Glu Val Pro 385 390 395 400 Pro Gly Gln Pro Gly Glu Leu Cys Val Lys Gly Pro Gln Val Met Leu 405 410 415 Gly Tyr Trp Gln Arg Pro Asp Ala Thr Asp Glu Ile Ile Lys Asn Gly 420 425 430 Trp Leu His Thr Gly Asp Ile Ala Val Met Asp Glu Glu Gly Phe Leu 435 440 445 Arg Ile Val Asp Arg Lys Lys Asp Met Ile Leu Val Ser Gly Phe Asn 450 455 460 Val Tyr Pro Asn Glu Ile Glu Asp Val Val Met Gln His Pro Gly Val 465 470 475 480 Gln Glu Val Ala Ala Val Gly Val Pro Ser Gly Ser Ser Gly Glu Ala 485 490 495 Val Lys Ile Phe Val Val Lys Lys Asp Pro Ser Leu Thr Glu Glu Ser 500 505 510 Leu Val Thr Phe Cys Arg Arg Gln Leu Thr Gly Tyr Lys Val Pro Lys 515 520 525 Leu Val Glu Phe Arg Asp Glu Leu Pro Lys Ser Asn Val Gly Lys Ile 530 535 540 Leu Arg Arg Glu Leu Arg Asp Glu Ala Arg Gly Lys Val Asp Asn Lys 545 550 555 560 Ala 131683DNAPseudomonas putida 13atgttgcaga cacgcatcat caagcccgcc gagggcgcct atgcctatcc attgctgatc 60aagcgcctgc tgatgtccgg cagccgctat gaaaagaccc gggaaatcgt ctaccgcgac 120cagatgcggc tgacgtatcc acagctcaac gagcgcattg cccgcctggc caacgtgctg 180accgaggccg gggtcaaggc cggtgacacc gtggcggtga tggactggga cagccatcgc 240tacctggaat gcatgttcgc catcccgatg atcggcgctg tggtgcacac catcaacgtg 300cgcctgtcgc ccgagcagat cctctacacc atgaaccatg ccgaagaccg cgtggtgctg 360gtcaacagcg acttcgtcgg cctgtaccag gccatcgccg ggcagctgac cactgtcgac

420aagaccctgc tactgaccga tggcccggac aagactgccg aactgcccgg tctggtcggc 480gagtatgagc agctgctggc tgctgccagc ccgcgctacg acttcccgga tttcgacgag 540aattcggtgg ccactacctt ctacaccact ggcaccaccg gtaaccccaa gggcgtgtat 600ttcagtcacc gccagctggt gctgcacacc ctggccgagg cctcggtcac cggcagtatc 660gacagcgtgc gcctgctggg cagcaacgat gtgtacatgc ccatcacccc gatgttccac 720gtgcatgcct ggggcatccc ctacgctgcc accatgctcg gcatgaagca ggtgtaccca 780gggcgctacg agccggacat gctggtcaag ctttggcgtg aagagaaggt cactttctcc 840cactgcgtgc cgaccatcct gcagatgctg ctcaactgcc cgaacgccca ggggcaggac 900ttcggcggct ggaagatcat catcggcggc agctcgctca accgttcgct gtaccaggcc 960gccctggcgc gcggcatcca gctgaccgcc gcgtatggca tgtcggaaac ctgcccgctg 1020atctccgcgg cacacctgaa cgatgaactg caggccggca gcgaggatga gcgcgtcact 1080taccgtatca aggccggtgt gccggtgccg ttggtcgaag cggccatcgt cgacggcgaa 1140ggcaacttcc tgcccgccga tggtgaaacc cagggcgagc tggtactgcg tgcgccgtgg 1200ctgaccatgg gctacttcaa ggagccggag aagagcgagg agctgtggca gggcggctgg 1260ctgcacaccg gtgacgtcgc caccctcgac ggcatgggct acatcgacat ccgcgaccgc 1320atcaaggatg tgatcaagac cggtggcgag tgggtttcct cgctcgacct ggaagacctg 1380atcagccgcc acccggccgt gcgcgaagtg gcggtggtgg gggtggccga cccgcagtgg 1440ggtgagcgcc cgtttgccct gctggtggca cgtgacggcc acgatatcga cgccaaggcg 1500ctgaaggaac acctcaagcc attcgtcgag caaggtcata tcaacaagtg ggcgattcca 1560agccagatcg cccttgttac tgaaattccc aagaccagtg tcggcaagct cgacaagaaa 1620cgcattcgcc aggacatcgt ccagtggcag gccagcaaca gcgcgttcct ttccacgttg 1680taa 168314560PRTPseudomonas putida 14Met Leu Gln Thr Arg Ile Ile Lys Pro Ala Glu Gly Ala Tyr Ala Tyr 1 5 10 15 Pro Leu Leu Ile Lys Arg Leu Leu Met Ser Gly Ser Arg Tyr Glu Lys 20 25 30 Thr Arg Glu Ile Val Tyr Arg Asp Gln Met Arg Leu Thr Tyr Pro Gln 35 40 45 Leu Asn Glu Arg Ile Ala Arg Leu Ala Asn Val Leu Thr Glu Ala Gly 50 55 60 Val Lys Ala Gly Asp Thr Val Ala Val Met Asp Trp Asp Ser His Arg 65 70 75 80 Tyr Leu Glu Cys Met Phe Ala Ile Pro Met Ile Gly Ala Val Val His 85 90 95 Thr Ile Asn Val Arg Leu Ser Pro Glu Gln Ile Leu Tyr Thr Met Asn 100 105 110 His Ala Glu Asp Arg Val Val Leu Val Asn Ser Asp Phe Val Gly Leu 115 120 125 Tyr Gln Ala Ile Ala Gly Gln Leu Thr Thr Val Asp Lys Thr Leu Leu 130 135 140 Leu Thr Asp Gly Pro Asp Lys Thr Ala Glu Leu Pro Gly Leu Val Gly 145 150 155 160 Glu Tyr Glu Gln Leu Leu Ala Ala Ala Ser Pro Arg Tyr Asp Phe Pro 165 170 175 Asp Phe Asp Glu Asn Ser Val Ala Thr Thr Phe Tyr Thr Thr Gly Thr 180 185 190 Thr Gly Asn Pro Lys Gly Val Tyr Phe Ser His Arg Gln Leu Val Leu 195 200 205 His Thr Leu Ala Glu Ala Ser Val Thr Gly Ser Ile Asp Ser Val Arg 210 215 220 Leu Leu Gly Ser Asn Asp Val Tyr Met Pro Ile Thr Pro Met Phe His 225 230 235 240 Val His Ala Trp Gly Ile Pro Tyr Ala Ala Thr Met Leu Gly Met Lys 245 250 255 Gln Val Tyr Pro Gly Arg Tyr Glu Pro Asp Met Leu Val Lys Leu Trp 260 265 270 Arg Glu Glu Lys Val Thr Phe Ser His Cys Val Pro Thr Ile Leu Gln 275 280 285 Met Leu Leu Asn Cys Pro Asn Ala Gln Gly Gln Asp Phe Gly Gly Trp 290 295 300 Lys Ile Ile Ile Gly Gly Ser Ser Leu Asn Arg Ser Leu Tyr Gln Ala 305 310 315 320 Ala Leu Ala Arg Gly Ile Gln Leu Thr Ala Ala Tyr Gly Met Ser Glu 325 330 335 Thr Cys Pro Leu Ile Ser Ala Ala His Leu Asn Asp Glu Leu Gln Ala 340 345 350 Gly Ser Glu Asp Glu Arg Val Thr Tyr Arg Ile Lys Ala Gly Val Pro 355 360 365 Val Pro Leu Val Glu Ala Ala Ile Val Asp Gly Glu Gly Asn Phe Leu 370 375 380 Pro Ala Asp Gly Glu Thr Gln Gly Glu Leu Val Leu Arg Ala Pro Trp 385 390 395 400 Leu Thr Met Gly Tyr Phe Lys Glu Pro Glu Lys Ser Glu Glu Leu Trp 405 410 415 Gln Gly Gly Trp Leu His Thr Gly Asp Val Ala Thr Leu Asp Gly Met 420 425 430 Gly Tyr Ile Asp Ile Arg Asp Arg Ile Lys Asp Val Ile Lys Thr Gly 435 440 445 Gly Glu Trp Val Ser Ser Leu Asp Leu Glu Asp Leu Ile Ser Arg His 450 455 460 Pro Ala Val Arg Glu Val Ala Val Val Gly Val Ala Asp Pro Gln Trp 465 470 475 480 Gly Glu Arg Pro Phe Ala Leu Leu Val Ala Arg Asp Gly His Asp Ile 485 490 495 Asp Ala Lys Ala Leu Lys Glu His Leu Lys Pro Phe Val Glu Gln Gly 500 505 510 His Ile Asn Lys Trp Ala Ile Pro Ser Gln Ile Ala Leu Val Thr Glu 515 520 525 Ile Pro Lys Thr Ser Val Gly Lys Leu Asp Lys Lys Arg Ile Arg Gln 530 535 540 Asp Ile Val Gln Trp Gln Ala Ser Asn Ser Ala Phe Leu Ser Thr Leu 545 550 555 560 15858DNAPseudomonas aeruginosa 15atgcccaccg cctggctcga cctgcccgcc ccacccgccc tgcccggcct gttcctgcgc 60gccgcactgc gccgcggcat ccgcggcaag gccctgcccg agcgcggcct gcgcagccag 120gtcacggtgg acccgaagca cctcgagcgc taccgccagg tctgcggctt ccgcgacgac 180ggcctgctgc cgccgaccta cccgcacatc ctcgccttcc cgctgcagat ggcgctgctc 240accgacaagc gcttcccctt cccgctgctc ggcctggtcc acctggagaa ccgcatcgac 300gtgctgcgcg cgctcggcgg cctcggcccg ttcaccgtga gcgtcgcggt ggaaaacctg 360caaccgcacg acaagggcgc caccttcagc atcgtcaccc gcctggaaga ccagcttggc 420ctgctctggg tcggcgacag caaggtgctc tgccgcggcg tcaaggtgcc cggcgaaatt 480ccgccgaaag ccgagcagga gccgctgccg ctggagccgg tcgacaactg gaaggcgccc 540gccgacatcg gccggcgcta tgcccgtgcc gccggcgact acaacccgat ccacctgtcg 600gcgcccagcg ccaagctgtt cggctttccc cgcgccatcg cccacggcct gtggaacaag 660gctcgcagcc tggccgccct cggcgagcga ctgccagcct cgggctatcg ggtcgaggtg 720cgcttccaga agccagtgct gctgccggcc agcctcaccc tcctggccag cgcggcggcg 780gcggacggcc agttcagcct gcgcggcaag gacgacctgc cgcacatggc cgggcattgg 840agccggctac agggctga 85816285PRTPseudomonas aeruginosa 16Met Pro Thr Ala Trp Leu Asp Leu Pro Ala Pro Pro Ala Leu Pro Gly 1 5 10 15 Leu Phe Leu Arg Ala Ala Leu Arg Arg Gly Ile Arg Gly Lys Ala Leu 20 25 30 Pro Glu Arg Gly Leu Arg Ser Gln Val Thr Val Asp Pro Lys His Leu 35 40 45 Glu Arg Tyr Arg Gln Val Cys Gly Phe Arg Asp Asp Gly Leu Leu Pro 50 55 60 Pro Thr Tyr Pro His Ile Leu Ala Phe Pro Leu Gln Met Ala Leu Leu 65 70 75 80 Thr Asp Lys Arg Phe Pro Phe Pro Leu Leu Gly Leu Val His Leu Glu 85 90 95 Asn Arg Ile Asp Val Leu Arg Ala Leu Gly Gly Leu Gly Pro Phe Thr 100 105 110 Val Ser Val Ala Val Glu Asn Leu Gln Pro His Asp Lys Gly Ala Thr 115 120 125 Phe Ser Ile Val Thr Arg Leu Glu Asp Gln Leu Gly Leu Leu Trp Val 130 135 140 Gly Asp Ser Lys Val Leu Cys Arg Gly Val Lys Val Pro Gly Glu Ile 145 150 155 160 Pro Pro Lys Ala Glu Gln Glu Pro Leu Pro Leu Glu Pro Val Asp Asn 165 170 175 Trp Lys Ala Pro Ala Asp Ile Gly Arg Arg Tyr Ala Arg Ala Ala Gly 180 185 190 Asp Tyr Asn Pro Ile His Leu Ser Ala Pro Ser Ala Lys Leu Phe Gly 195 200 205 Phe Pro Arg Ala Ile Ala His Gly Leu Trp Asn Lys Ala Arg Ser Leu 210 215 220 Ala Ala Leu Gly Glu Arg Leu Pro Ala Ser Gly Tyr Arg Val Glu Val 225 230 235 240 Arg Phe Gln Lys Pro Val Leu Leu Pro Ala Ser Leu Thr Leu Leu Ala 245 250 255 Ser Ala Ala Ala Ala Asp Gly Gln Phe Ser Leu Arg Gly Lys Asp Asp 260 265 270 Leu Pro His Met Ala Gly His Trp Ser Arg Leu Gln Gly 275 280 285 171683DNAPseudomonas aeruginosa 17atgcgagaaa agcaggaatc gggtagcgtg ccggtgcccg ccgagttcat gagtgcacag 60agcgccatcg tcggcctgcg cggcaaggac ctgctgacga cggtccgcag cctggctgtc 120cacggcctgc gccagccgct gcacagtgcg cggcacctgg tcgccttcgg aggccagttg 180ggcaaggtgc tgctgggcga caccctgcac cagccgaacc cacaggacgc ccgcttccag 240gatccatcct ggcgcctcaa tcccttctac cggcgcaccc tgcaggccta cctggcgtgg 300cagaaacaac tgctcgcctg gatcgacgaa agcaacctgg actgcgacga tcgcgcccgc 360gcccgcttcc tcgtcgcctt gctctccgac gccgtggcac ccagcaacag cctgatcaat 420ccactggcgt taaaggaact gttcaatacc ggcgggatca gcctgctcaa tggcgtccgc 480cacctgctcg aagacctggt gcacaacggc ggcatgccca gccaggtgaa caagaccgcc 540ttcgagatcg gtcgcaacct cgccaccacg caaggcgcgg tggtgttccg caacgaggtg 600ctggagctga tccagtacaa gccgctgggc gagcgccagt acgccaagcc cctgctgatc 660gtgccgccgc agatcaacaa gtactacatc ttcgacctgt cgccggaaaa gagcttcgtc 720cagtacgccc tgaagaacaa cctgcaggtc ttcgtcatca gttggcgcaa ccccgacgcc 780cagcaccgcg aatggggcct gagcacctat gtcgaggccc tcgaccaggc catcgaggtc 840agccgcgaga tcaccggcag ccgcagcgtg aacctggccg gcgcctgcgc cggcgggctc 900accgtagccg ccttgctcgg ccacctgcag gtgcgccggc aactgcgcaa ggtcagtagc 960gtcacctacc tggtcagcct gctcgacagc cagatggaaa gcccggcgat gctcttcgcc 1020gacgagcaga ccctggagag cagcaagcgc cgctcctacc agcatggcgt gctggacggg 1080cgcgacatgg ccaaggtgtt cgcctggatg cgccccaacg acctgatctg gaactactgg 1140gtcaacaact acctgctcgg caggcagccg ccggcgttcg acatcctcta ctggaacaac 1200gacaacacgc ggctgcccgc ggcgttccac ggcgaactgc tcgacctgtt caagcacaac 1260ccgctgaccc gcccgggcgc gctggaggtc agcgggaccg cggtggacct gggcaaggtg 1320gcgatcgaca gcttccacgt cgccggcatc accgaccaca tcacgccctg ggacgcggtg 1380tatcgctcgg ccctcctgct gggcggccag cgccgcttca tcctgtccaa cagcgggcac 1440atccagagca tcctcaaccc tcccggaaac cccaaggcct gctacttcga gaacgacaag 1500ctgagcagcg atccacgcgc ctggtactac gacgccaagc gcgaagaggg cagctggtgg 1560ccggtctggc tgggctggct gcaggagcgc tcgggcgagc tgggcaaccc tgacttcaac 1620cttggcagcg ccgcgcatcc gcccctcgaa gcggccccgg gcacctacgt gcatatacgc 1680tga 168318560PRTPseudomonas aeruginosa 18Met Arg Glu Lys Gln Glu Ser Gly Ser Val Pro Val Pro Ala Glu Phe 1 5 10 15 Met Ser Ala Gln Ser Ala Ile Val Gly Leu Arg Gly Lys Asp Leu Leu 20 25 30 Thr Thr Val Arg Ser Leu Ala Val His Gly Leu Arg Gln Pro Leu His 35 40 45 Ser Ala Arg His Leu Val Ala Phe Gly Gly Gln Leu Gly Lys Val Leu 50 55 60 Leu Gly Asp Thr Leu His Gln Pro Asn Pro Gln Asp Ala Arg Phe Gln 65 70 75 80 Asp Pro Ser Trp Arg Leu Asn Pro Phe Tyr Arg Arg Thr Leu Gln Ala 85 90 95 Tyr Leu Ala Trp Gln Lys Gln Leu Leu Ala Trp Ile Asp Glu Ser Asn 100 105 110 Leu Asp Cys Asp Asp Arg Ala Arg Ala Arg Phe Leu Val Ala Leu Leu 115 120 125 Ser Asp Ala Val Ala Pro Ser Asn Ser Leu Ile Asn Pro Leu Ala Leu 130 135 140 Lys Glu Leu Phe Asn Thr Gly Gly Ile Ser Leu Leu Asn Gly Val Arg 145 150 155 160 His Leu Leu Glu Asp Leu Val His Asn Gly Gly Met Pro Ser Gln Val 165 170 175 Asn Lys Thr Ala Phe Glu Ile Gly Arg Asn Leu Ala Thr Thr Gln Gly 180 185 190 Ala Val Val Phe Arg Asn Glu Val Leu Glu Leu Ile Gln Tyr Lys Pro 195 200 205 Leu Gly Glu Arg Gln Tyr Ala Lys Pro Leu Leu Ile Val Pro Pro Gln 210 215 220 Ile Asn Lys Tyr Tyr Ile Phe Asp Leu Ser Pro Glu Lys Ser Phe Val 225 230 235 240 Gln Tyr Ala Leu Lys Asn Asn Leu Gln Val Phe Val Ile Ser Trp Arg 245 250 255 Asn Pro Asp Ala Gln His Arg Glu Trp Gly Leu Ser Thr Tyr Val Glu 260 265 270 Ala Leu Asp Gln Ala Ile Glu Val Ser Arg Glu Ile Thr Gly Ser Arg 275 280 285 Ser Val Asn Leu Ala Gly Ala Cys Ala Gly Gly Leu Thr Val Ala Ala 290 295 300 Leu Leu Gly His Leu Gln Val Arg Arg Gln Leu Arg Lys Val Ser Ser 305 310 315 320 Val Thr Tyr Leu Val Ser Leu Leu Asp Ser Gln Met Glu Ser Pro Ala 325 330 335 Met Leu Phe Ala Asp Glu Gln Thr Leu Glu Ser Ser Lys Arg Arg Ser 340 345 350 Tyr Gln His Gly Val Leu Asp Gly Arg Asp Met Ala Lys Val Phe Ala 355 360 365 Trp Met Arg Pro Asn Asp Leu Ile Trp Asn Tyr Trp Val Asn Asn Tyr 370 375 380 Leu Leu Gly Arg Gln Pro Pro Ala Phe Asp Ile Leu Tyr Trp Asn Asn 385 390 395 400 Asp Asn Thr Arg Leu Pro Ala Ala Phe His Gly Glu Leu Leu Asp Leu 405 410 415 Phe Lys His Asn Pro Leu Thr Arg Pro Gly Ala Leu Glu Val Ser Gly 420 425 430 Thr Ala Val Asp Leu Gly Lys Val Ala Ile Asp Ser Phe His Val Ala 435 440 445 Gly Ile Thr Asp His Ile Thr Pro Trp Asp Ala Val Tyr Arg Ser Ala 450 455 460 Leu Leu Leu Gly Gly Gln Arg Arg Phe Ile Leu Ser Asn Ser Gly His 465 470 475 480 Ile Gln Ser Ile Leu Asn Pro Pro Gly Asn Pro Lys Ala Cys Tyr Phe 485 490 495 Glu Asn Asp Lys Leu Ser Ser Asp Pro Arg Ala Trp Tyr Tyr Asp Ala 500 505 510 Lys Arg Glu Glu Gly Ser Trp Trp Pro Val Trp Leu Gly Trp Leu Gln 515 520 525 Glu Arg Ser Gly Glu Leu Gly Asn Pro Asp Phe Asn Leu Gly Ser Ala 530 535 540 Ala His Pro Pro Leu Glu Ala Ala Pro Gly Thr Tyr Val His Ile Arg 545 550 555 560 19930DNAUmbellularia californicaCDS(21)..(923) 19cccgggagga ggattataaa atg act cta gag tgg aaa ccg aaa cca aaa ctg 53 Met Thr Leu Glu Trp Lys Pro Lys Pro Lys Leu 1 5 10 cct caa ctg ctg gat gat cac ttc ggt ctg cac ggt ctg gtg ttt cgt 101Pro Gln Leu Leu Asp Asp His Phe Gly Leu His Gly Leu Val Phe Arg 15 20 25 cgt act ttc gca att cgt tct tat gaa gtg ggt cca gat cgt tct acc 149Arg Thr Phe Ala Ile Arg Ser Tyr Glu Val Gly Pro Asp Arg Ser Thr 30 35 40 tcc atc ctg gcc gtc atg aac cac atg cag gaa gcc acc ctg aat cac 197Ser Ile Leu Ala Val Met Asn His Met Gln Glu Ala Thr Leu Asn His 45 50 55 gcg aaa tct gtt ggt atc ctg ggt gat ggt ttc ggc act act ctg gaa 245Ala Lys Ser Val Gly Ile Leu Gly Asp Gly Phe Gly Thr Thr Leu Glu 60 65 70 75 atg tct aaa cgt gac ctg atg tgg gta gtg cgt cgc acc cac gta gca 293Met Ser Lys Arg Asp Leu Met Trp Val Val Arg Arg Thr His Val Ala 80 85 90 gta gag cgc tac cct act tgg ggt gac act gtg gaa gtc gag tgt tgg 341Val Glu Arg Tyr Pro Thr Trp Gly Asp Thr Val Glu Val Glu Cys Trp 95 100 105 att ggc gcg tcc ggt aac aat ggt atg cgt cgc gat ttt ctg gtc cgt 389Ile Gly Ala Ser Gly Asn Asn Gly Met Arg Arg Asp Phe Leu Val Arg 110 115 120 gac tgt aaa acg ggc gaa atc ctg acg cgt tgc acc tcc ctg agc gtt 437Asp Cys Lys Thr Gly Glu Ile Leu Thr Arg Cys Thr Ser Leu Ser Val 125 130 135 ctg atg aac acc cgc act cgt cgc ctg tct acc atc ccg gac gaa gtg 485Leu Met Asn Thr Arg Thr Arg Arg Leu Ser Thr Ile Pro Asp Glu Val

140 145 150 155 cgc ggt gag atc ggt cct gct ttc atc gat aac gtg gca gtt aaa gac 533Arg Gly Glu Ile Gly Pro Ala Phe Ile Asp Asn Val Ala Val Lys Asp 160 165 170 gac gaa atc aag aaa ctg caa aaa ctg aac gac tcc acc gcg gac tac 581Asp Glu Ile Lys Lys Leu Gln Lys Leu Asn Asp Ser Thr Ala Asp Tyr 175 180 185 atc cag ggc ggt ctg act ccg cgc tgg aac gac ctg gat gtt aat cag 629Ile Gln Gly Gly Leu Thr Pro Arg Trp Asn Asp Leu Asp Val Asn Gln 190 195 200 cat gtg aac aac ctg aaa tac gtt gct tgg gtc ttc gag act gtg ccg 677His Val Asn Asn Leu Lys Tyr Val Ala Trp Val Phe Glu Thr Val Pro 205 210 215 gac agc att ttc gaa agc cat cac att tcc tct ttt act ctg gag tac 725Asp Ser Ile Phe Glu Ser His His Ile Ser Ser Phe Thr Leu Glu Tyr 220 225 230 235 cgt cgc gaa tgt act cgc gac tcc gtt ctg cgc agc ctg acc acc gta 773Arg Arg Glu Cys Thr Arg Asp Ser Val Leu Arg Ser Leu Thr Thr Val 240 245 250 agc ggc ggt tct agc gag gca ggt ctg gtc tgc gac cat ctg ctg caa 821Ser Gly Gly Ser Ser Glu Ala Gly Leu Val Cys Asp His Leu Leu Gln 255 260 265 ctg gaa ggc ggc tcc gaa gtc ctg cgt gcg cgt acg gag tgg cgt cca 869Leu Glu Gly Gly Ser Glu Val Leu Arg Ala Arg Thr Glu Trp Arg Pro 270 275 280 aag ctg acg gat tct ttc cgc ggc atc tcc gta att ccg gcg gaa cct 917Lys Leu Thr Asp Ser Phe Arg Gly Ile Ser Val Ile Pro Ala Glu Pro 285 290 295 cgt gtt taagctt 930Arg Val 300 20301PRTUmbellularia californica 20Met Thr Leu Glu Trp Lys Pro Lys Pro Lys Leu Pro Gln Leu Leu Asp 1 5 10 15 Asp His Phe Gly Leu His Gly Leu Val Phe Arg Arg Thr Phe Ala Ile 20 25 30 Arg Ser Tyr Glu Val Gly Pro Asp Arg Ser Thr Ser Ile Leu Ala Val 35 40 45 Met Asn His Met Gln Glu Ala Thr Leu Asn His Ala Lys Ser Val Gly 50 55 60 Ile Leu Gly Asp Gly Phe Gly Thr Thr Leu Glu Met Ser Lys Arg Asp 65 70 75 80 Leu Met Trp Val Val Arg Arg Thr His Val Ala Val Glu Arg Tyr Pro 85 90 95 Thr Trp Gly Asp Thr Val Glu Val Glu Cys Trp Ile Gly Ala Ser Gly 100 105 110 Asn Asn Gly Met Arg Arg Asp Phe Leu Val Arg Asp Cys Lys Thr Gly 115 120 125 Glu Ile Leu Thr Arg Cys Thr Ser Leu Ser Val Leu Met Asn Thr Arg 130 135 140 Thr Arg Arg Leu Ser Thr Ile Pro Asp Glu Val Arg Gly Glu Ile Gly 145 150 155 160 Pro Ala Phe Ile Asp Asn Val Ala Val Lys Asp Asp Glu Ile Lys Lys 165 170 175 Leu Gln Lys Leu Asn Asp Ser Thr Ala Asp Tyr Ile Gln Gly Gly Leu 180 185 190 Thr Pro Arg Trp Asn Asp Leu Asp Val Asn Gln His Val Asn Asn Leu 195 200 205 Lys Tyr Val Ala Trp Val Phe Glu Thr Val Pro Asp Ser Ile Phe Glu 210 215 220 Ser His His Ile Ser Ser Phe Thr Leu Glu Tyr Arg Arg Glu Cys Thr 225 230 235 240 Arg Asp Ser Val Leu Arg Ser Leu Thr Thr Val Ser Gly Gly Ser Ser 245 250 255 Glu Ala Gly Leu Val Cys Asp His Leu Leu Gln Leu Glu Gly Gly Ser 260 265 270 Glu Val Leu Arg Ala Arg Thr Glu Trp Arg Pro Lys Leu Thr Asp Ser 275 280 285 Phe Arg Gly Ile Ser Val Ile Pro Ala Glu Pro Arg Val 290 295 300 21420DNAPseudomonas putida 21atggccaaag tgattgcgaa gaaaaaagac gaagccctgg acacgcttgg cgaggtgcgc 60ggctatgcgc gcaagatctg gctggccggt atcggcgcct acgcccgcgt cggtcaggaa 120ggcgctgact acttcaaaga gctggtcagg gcgggtgaag gtgtcgagaa gcgcggcaag 180aagcgcatcg acaaagagct cgatgcggcc aaccaccagc ttgacgaagt cggtgaagaa 240gtgagccgcg tacgcggcaa ggtagaaatt caactcgaca agatcgaaaa agctttcgac 300gcacgggtcg gtcgcgcctt gaatcgcctg ggtattccgt ctaaacatga cgttgaggcg 360ttgtcgatca agcttgaaca gttgcatgag ctgcttgagc gcgtcgcgca caaaccataa 42022139PRTPseudomonas putida 22Met Ala Lys Val Ile Ala Lys Lys Lys Asp Glu Ala Leu Asp Thr Leu 1 5 10 15 Gly Glu Val Arg Gly Tyr Ala Arg Lys Ile Trp Leu Ala Gly Ile Gly 20 25 30 Ala Tyr Ala Arg Val Gly Gln Glu Gly Ala Asp Tyr Phe Lys Glu Leu 35 40 45 Val Arg Ala Gly Glu Gly Val Glu Lys Arg Gly Lys Lys Arg Ile Asp 50 55 60 Lys Glu Leu Asp Ala Ala Asn His Gln Leu Asp Glu Val Gly Glu Glu 65 70 75 80 Val Ser Arg Val Arg Gly Lys Val Glu Ile Gln Leu Asp Lys Ile Glu 85 90 95 Lys Ala Phe Asp Ala Arg Val Gly Arg Ala Leu Asn Arg Leu Gly Ile 100 105 110 Pro Ser Lys His Asp Val Glu Ala Leu Ser Ile Lys Leu Glu Gln Leu 115 120 125 His Glu Leu Leu Glu Arg Val Ala His Lys Pro 130 135 23786DNAPseudomonas putida 23atggctggca agaagaacac cgaaaaagaa ggcagctcct gggtcggcgg gatcgagaaa 60tactcccgca agatctggct ggcggggctg ggtatctatt cgaagatcga ccaggacggc 120ccgaagctgt tcgactcgct ggtgaaggat ggcgagaagg ccgagaagca ggcgaaaaag 180acggctgaag atgttgccga gactgccaag tcttcgacca cttcgcgggt gtcgggcgtg 240aaggaccgtg cgctgggcaa gtggagcgaa cttgaagaag ccttcgacaa gcgccttaac 300agcgccatct cgcgccttgg cgtgccgagc cgcaacgaga tcaaggcact gcaccagcag 360gtggacagcc tgaccaagca gatcgagaag ctgaccggtg cttcggttac gccgatttcg 420tcgcgcgctg cagcaaccaa gccggctgca agcaaggctg cggccaagcc actggccaag 480gcagcagcta agcctgcggc gaaaacggcg gcggccaaac ctgctggcaa aaccgcagcg 540gccaaacccg cagccaaaac cgcagcggaa aaacctgcag ctaagccagc agccaagcct 600gcagcggcca aacctgcggc agccaagaaa cctgcggtga agaaagctcc agccaaaccg 660gcagcggcca aaccagcagc accagctgcc agcgctgcgc ctgcagcgac cacagcaccg 720gcaactgccg ccaccccggc cagcagcacg ccgtcggcac cgactggcac cggtaccctg 780atctga 78624261PRTPseudomonas putida 24Met Ala Gly Lys Lys Asn Thr Glu Lys Glu Gly Ser Ser Trp Val Gly 1 5 10 15 Gly Ile Glu Lys Tyr Ser Arg Lys Ile Trp Leu Ala Gly Leu Gly Ile 20 25 30 Tyr Ser Lys Ile Asp Gln Asp Gly Pro Lys Leu Phe Asp Ser Leu Val 35 40 45 Lys Asp Gly Glu Lys Ala Glu Lys Gln Ala Lys Lys Thr Ala Glu Asp 50 55 60 Val Ala Glu Thr Ala Lys Ser Ser Thr Thr Ser Arg Val Ser Gly Val 65 70 75 80 Lys Asp Arg Ala Leu Gly Lys Trp Ser Glu Leu Glu Glu Ala Phe Asp 85 90 95 Lys Arg Leu Asn Ser Ala Ile Ser Arg Leu Gly Val Pro Ser Arg Asn 100 105 110 Glu Ile Lys Ala Leu His Gln Gln Val Asp Ser Leu Thr Lys Gln Ile 115 120 125 Glu Lys Leu Thr Gly Ala Ser Val Thr Pro Ile Ser Ser Arg Ala Ala 130 135 140 Ala Thr Lys Pro Ala Ala Ser Lys Ala Ala Ala Lys Pro Leu Ala Lys 145 150 155 160 Ala Ala Ala Lys Pro Ala Ala Lys Thr Ala Ala Ala Lys Pro Ala Gly 165 170 175 Lys Thr Ala Ala Ala Lys Pro Ala Ala Lys Thr Ala Ala Glu Lys Pro 180 185 190 Ala Ala Lys Pro Ala Ala Lys Pro Ala Ala Ala Lys Pro Ala Ala Ala 195 200 205 Lys Lys Pro Ala Val Lys Lys Ala Pro Ala Lys Pro Ala Ala Ala Lys 210 215 220 Pro Ala Ala Pro Ala Ala Ser Ala Ala Pro Ala Ala Thr Thr Ala Pro 225 230 235 240 Ala Thr Ala Ala Thr Pro Ala Ser Ser Thr Pro Ser Ala Pro Thr Gly 245 250 255 Thr Gly Thr Leu Ile 260 2548DNAArtificial SequencePrimer 25gacgatgaat tcaggaggta ttaataatga gccaggtcca gaacattc 482630DNAArtificial SequencePrimer 26gacgatggat ccggcccgac ggtagggaaa 302748DNAArtificial SequencePrimer 27gacgatgaat tcaggaggta ttaataatgg cgctcgatcc tgaggtgc 482833DNAArtificial SequencePrimer 28gacgatggat cccttcgctt cagtccggcc gct 332947DNAArtificial SequencePrimer 29gacgatgaat tcaggaggta ttaataatgc ccaccgcctg gctcgac 473033DNAArtificial SequencePrimer 30gacgaaggat cctcagccct gtagccggct cca 333148DNAArtificial SequencePrimer 31gacgatgaat tcaggaggta ttaataatgc cattcgtacc cgtagcag 483233DNAArtificial SequencePrimer 32gacgatggat cctcagacga agcagaggct gag 333347DNAArtificial SequencePrimer 33ggggagctca ggaggtataa ttaatgagtc agaagaacaa taacgag 473430DNAArtificial SequencePrimer 34gggggtacct catcgttcat gcacgtaggt 303546DNAArtificial SequencePrimer 35ggggagctca ggaggtataa ttaatgcgag aaaagcagga atcggg 463632DNAArtificial SequencePrimer 36gggggtacct cagcgtatat gcacgtaggt gc 323746DNAArtificial SequencePrimer 37gggtctagaa ggaggtataa ttaatgcgag aaaagcagga atcggg 463832DNAArtificial SequencePrimer 38gggaagcttt cagcgtatat gcacgtaggt gc 323944DNAArtificial SequencePrimer 39gggggtacca ggaggtataa ttaatgttgc agacacgcat catc 444030DNAArtificial SequencePrimer 40gggtctagat tacaacgtgg aaaggaacgc 304160DNAArtificial SequencePrimer 41ggtcagacca ctttatttat ttttttacag gggagtgtta gcggcatgcg ttcctattcc 604260DNAArtificial SequencePrimer 42ctccgccatt cagcgcggat tcatatagct ttgaccttct taaacacgag gttccgccgg 604360DNAArtificial SequencePrimer 43gagtccaact ttgttttgct gtgttatgga aatctcacta gcggcatgcg ttcctattcc 604460DNAArtificial SequencePrimer 44acccctcgtt tgaggggttt gctctttaaa cggaagggat taaacacgag gttccgccgg 604532DNAArtificial SequencePrimer 45gggctcgagt taaccggcac ggaactcgct cg 324636DNAArtificial SequencePrimer 46gggctcgagt tggtaacgaa tcagacaatt gacggc 364770DNAArtificial SequencePrimer 47tgaataattg cttgttttta aagaaaaaga aacagcggct ggtccgctgt gtgtaggctg 60gagctgcttc 704841DNAArtificial SequencePrimer 48tcgatggtgt caacgtaaat gattccgggg atccgtcgac c 414921DNAArtificial SequencePrimer 49catttacgtt gacaccatcg a 215022DNAArtificial SequencePrimer 50tcaggcttta ttgtccactt tg 225163DNAArtificial SequencePrimer 51caggtcagac cactttattt atttttttac aggggagtgt gaagcggcat gcgttcctat 60tcc 635260DNAArtificial SequencePrimer 52ttgcaggtca gttgcagttg ttttccaaaa actttcccca gtgtaggctg gagctgcttc 605363DNAArtificial SequencePrimer 53tctggtacga ccagatcacc ttgcggattc aggagactga gaagcggcat gcgttcctat 60tcc 635460DNAArtificial SequencePrimer 54aacccgctca aacaccgtcg caataccctg acccagaccg gtgtaggctg gagctgcttc 60

Claims

1. A recombinant cell for producing polyhydroxyalkanoate comprising one or more recombinant genes selected from the group consisting of an R-specific enoyl-CoA hydratase gene, a PHA polymerase gene, a thioesterase gene, and an acyl-CoA-synthetase gene, wherein a gene product from a gene selected from the group consisting of an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase, and a 3-ketoacyl-CoA thiolase gene is functionally deleted, and wherein the recombinant cell is capable of producing polyhydroxyalkanoate.

2. The recombinant cell of claim 1 wherein the recombinant cell is a microbial cell.

3. The recombinant cell of claim 1 wherein the recombinant cell is a bacterial cell.

4. The recombinant cell of claim 1 wherein the enoyl-CoA hydratase gene is selected from the group consisting of fadB and fadJ.

5. The recombinant cell of claim 1 wherein the 3-hydroxyacyl-CoA dehydrogenase gene is selected from the group consisting of fadB and fadJ.

6. The recombinant cell of claim 1 wherein the 3-ketoacyl-CoA thiolase gene is selected from the group consisting of fadA and fadI.

7. The recombinant cell of claim 1 wherein gene products of fadA and fadI; fadB and fadJ; or fadA, fadI, fadB and fadJ are functionally deleted.

8. The recombinant cell of claim 1 wherein a gene product of fadR is functionally deleted.

9. The recombinant cell of claim 1 wherein gene products of fadA and fadI; fad R, fadA, and fadI; fadB and fadJ; fad R, fadB, and fadJ; fadA, fadB, fadI, and fadJ; or fad R, fadA, fadB, fadI, and fadJ are functionally deleted.

10. The recombinant cell of claim 1 wherein the enoyl-CoA hydratase gene is a phaJ gene.

11. The recombinant cell of claim 1 wherein the PHA polymerase gene is a phaC gene.

12. The recombinant cell of claim 1 wherein the enoyl-CoA hydratase gene is phaJ3 and the PHA polymerase gene is phaC2.

13. The recombinant cell of claim 1 wherein the thioesterase gene is Umbellularia californica thioesterase or a homolog thereof.

14. The recombinant cell of claim 1 wherein the acyl-CoA-synthetase gene is PP.sub.--0763 from P. putida.

15. The recombinant cell of claim 1 further comprising a recombinant phasin gene.

16. The recombinant cell of claim 1 comprising the R-specific enoyl-CoA hydratase gene, the PHA polymerase gene, the thioesterase gene, and the acyl-CoA-synthetase gene, wherein the recombinant cell is capable of producing polyhydroxyalkanoate from carbohydrate in a medium devoid of a fatty acid source.

17. The recombinant cell of claim 16 wherein gene products of fadA and fadI; fad R, fadA, and fadI; fadB and fadJ; fad R, fadB, and fadJ; fadA, fadB, fadI, and fadJ; or fad R, fadA, fadB, fadI, and fadJ are functionally deleted.

18. A method of producing polyhydroxyalkanoate comprising culturing a recombinant cell as recited in claim 1.

19. The method of claim 18 comprising culturing the recombinant cell in aerobic conditions.

20. The method of claim 18 comprising culturing the recombinant cell in a medium comprising a carbohydrate and substantially devoid of a fatty acid source.

21. The method of claim 18 wherein the culturing produces polyhydroxyalkanoate to at least about 7.5% cell dry weight.

22. The method of claim 18 wherein the culturing produces polyhydroxyalkanoate comprised of hydroxyalkanoate monomers, wherein greater than about 50% of the hydroxyalkanoate monomers comprise hydrocarbon chains comprising same number of carbons.