U.S. patent application number 14/117737 was filed with the patent office on 2014-03-13 for daphne genkwa extracts, and pharmaceutical composition containing fractions of the extracts or compounds separated from the extracts as active ingredients for preventing or treating atopic dermatitis.
This patent application is currently assigned to KOREA RESEARCH INSTITUTE OF BIOSCIENCE AND BIOTECHNOLOGY. The applicant listed for this patent is Kyung Seop Ahn, Jae Jong Go, Da Jung Ji, Ho Bum Kang, Jae Wha Kim, Joo Heon Kim, Hyun Woo Oh, Sei Ryang Oh, Jae Sung Song, Jang Mi Sun. Invention is credited to Kyung Seop Ahn, Jae Jong Go, Da Jung Ji, Ho Bum Kang, Jae Wha Kim, Joo Heon Kim, Hyun Woo Oh, Sei Ryang Oh, Jae Sung Song, Jang Mi Sun.
Application Number | 20140072664 14/117737 |
Document ID | / |
Family ID | 47177499 |
Filed Date | 2014-03-13 |
United States Patent
Application |
20140072664 |
Kind Code |
A1 |
Kim; Jae Wha ; et
al. |
March 13, 2014 |
DAPHNE GENKWA EXTRACTS, AND PHARMACEUTICAL COMPOSITION CONTAINING
FRACTIONS OF THE EXTRACTS OR COMPOUNDS SEPARATED FROM THE EXTRACTS
AS ACTIVE INGREDIENTS FOR PREVENTING OR TREATING ATOPIC
DERMATITIS
Abstract
The present invention relates to a pharmaceutical composition
for the prevention or treatment of atopy comprising the extract of
Daphne genkwa, the fraction thereof, of the compound isolated from
the same as an active ingredient. More precisely, the extract of
Daphne genkwa, the fraction thereof, or the compound isolated from
the same, genekwadapnin or yuanhuacine, of the present invention
can increase the secretion of cytokine in Th1 immune cells and
suppress atopy in the atopy mouse model, so that the extract of
Daphne genkwa, the fraction thereof, or the compound isolated from
the same of the present invention can be effectively used for the
prevention or treatment of atopy.
Inventors: |
Kim; Jae Wha; (Daejeon,
KR) ; Ahn; Kyung Seop; (Daejeon, KR) ; Kang;
Ho Bum; (Daejeon, KR) ; Oh; Sei Ryang;
(Daejeon, KR) ; Go; Jae Jong; (Gyeonggi-do,
KR) ; Kim; Joo Heon; (Daejeon, KR) ; Sun; Jang
Mi; (Daejeon, KR) ; Song; Jae Sung; (Daejeon,
KR) ; Oh; Hyun Woo; (Daejeon, KR) ; Ji; Da
Jung; (Daejeon, KR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kim; Jae Wha
Ahn; Kyung Seop
Kang; Ho Bum
Oh; Sei Ryang
Go; Jae Jong
Kim; Joo Heon
Sun; Jang Mi
Song; Jae Sung
Oh; Hyun Woo
Ji; Da Jung |
Daejeon
Daejeon
Daejeon
Daejeon
Gyeonggi-do
Daejeon
Daejeon
Daejeon
Daejeon
Daejeon |
|
KR
KR
KR
KR
KR
KR
KR
KR
KR
KR |
|
|
Assignee: |
KOREA RESEARCH INSTITUTE OF
BIOSCIENCE AND BIOTECHNOLOGY
Daejeon
KR
|
Family ID: |
47177499 |
Appl. No.: |
14/117737 |
Filed: |
May 17, 2012 |
PCT Filed: |
May 17, 2012 |
PCT NO: |
PCT/KR2012/003903 |
371 Date: |
November 15, 2013 |
Current U.S.
Class: |
424/773 ;
424/725; 424/774; 424/778; 424/779; 514/452; 549/358 |
Current CPC
Class: |
A61P 17/00 20180101;
A23L 7/198 20160801; A61K 9/2018 20130101; A61K 31/357 20130101;
C07D 493/08 20130101; A61K 36/83 20130101; A61K 47/26 20130101;
A61K 9/4858 20130101; A23L 2/52 20130101; A61K 9/0095 20130101;
A61K 2236/00 20130101; A61K 9/0019 20130101; A23L 33/105
20160801 |
Class at
Publication: |
424/773 ;
424/725; 514/452; 549/358; 424/779; 424/774; 424/778 |
International
Class: |
C07D 493/08 20060101
C07D493/08; A61K 36/83 20060101 A61K036/83 |
Foreign Application Data
Date |
Code |
Application Number |
May 17, 2011 |
KR |
10-2011-0046274 |
May 17, 2012 |
KR |
10-2012-0052441 |
Claims
1-20. (canceled)
21. A method for treating atopy comprising administering to a
subject in need thereof a pharmaceutically effective amount of an
extract of Daphne genkwa, a fraction thereof, or a compound of
Formula 1 isolated from the extract of Daphne genkwa or the
fraction thereof: ##STR00003## wherein, R is --C.sub.6H.sub.5 or
--CH.dbd.CHCH.dbd.CH(CH.sub.2).sub.4CH.sub.3.
22. The method for treating atopy according to claim 21, wherein
the extract is an extract of a single or a mixed solvent comprising
at least one member selected from the group consisting of water,
C.sub.1 to C.sub.4 lower alcohol, and acetone.
23. The method for treating atopy according to claim 22, wherein
the C.sub.1 to C.sub.4 lower alcohol is methanol or ethanol.
24. The method for treating atopy according to claim 21, wherein
the extract of Daphne genkwa is an extract of the stems, roots,
leaves, floral leaves, or buds of Daphne genkwa.
25. The method for treating atopy according to claim 24, wherein
the extract of Daphne genkwa is an extract of the floral leaves of
Daphne genkwa or an extract of the buds of Daphne genkwa.
26. The method for treating atopy according to claim 21, wherein
the fraction of Daphne genkwa extract is obtained by fractionating
the Daphne genkwa extract with hexane, chloroform, and ethyl
acetate, stepwise.
27. The method for treating atopy according to claim 21, wherein
the compound of formula 1 is isolated from the extract of Daphne
genkwa.
28. The method for treating atopy according to claim 21, wherein
the extract of Daphne genkwa, the fraction thereof or the compound
of formula 1 maintains homeostasis of atopic skin by inducing the
secretion of type I cytokine.
29. A method of preparing the compound of formula 1 of claim 21,
comprising: a) adding water, a C.sub.1 to C.sub.4 lower alcohol, or
a mixture thereof to Daphne genkwa to obtain an extract of Daphne
genkwa; b) fractionating the extract obtained in (a) using hexane,
chloroform, and ethyl acetate to obtain fractions; and c) running
the fractions obtained in (b) through a silica gel chromatography
column to purify, separate, and obtain the compound of formula
1.
30. The method of preparing the compound of formula 1 according to
claim 29, wherein the C.sub.1 to C.sub.4 lower alcohol is methanol
or ethanol.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to a pharmaceutical
composition for the prevention or treatment of atopy comprising the
extract of Daphne genkwa, the fraction thereof, or the compound
isolated from the same as an active ingredient.
[0003] 2. Description of the Related Art
[0004] Atopy is a chronic relapsing dermatitis accompanying severe
itch. Approximately 10.about.15% of children have atopic
dermatitis, and 90% of them get presumably better naturally within
5 years of breakout. This atopic dermatitis is generally improved
when patients become adults, and is not coming back at least
outwardly in approximately 30.about.40% of them. However, the rest
of them are still suffering dermatitis with such symptoms as dry
skin, skin irritation and housewife's eczema whenever stimulated by
irritants even as adults. Sensitive skin is characterized by low
water retention, weak recovery power, hyperkeratinization, and
itch, which therefore progresses easily to atopic skin.
[0005] The exact pathophysiology of atopy has not been completely
understood, yet, and is only presumed to be attributed to genetic
factors along with immunological and non-immunological mechanisms
altogether. Most of atopy cases are extrinsic atopy, which is
developed by IgE-related immune mechanism. There are many reports
saying that delayed-type immune response caused by T-cell
malfunction is responsible for this extrinsic atopy rather than
specific allergen mediated immediate-type immune response. It has
been recently reported that Th2 related cytokines including IL-4
which induce IgE generation from B cells are the causes of atopy (J
S Kang et al., Inhibition of atopic dermatitis by topical
application of silymarin in NC/Nga mice. intl immunopharm. (2008)
8. 1475-1480).
[0006] To treat atopy, ceramides, linoleic acids, vegetable oils or
mineral oils, steroids including hydrocortisone, the materials
which have been reinforced with anti-bacterial/anti-inflammatory
activity, DNA synthesis inhibitors, cell hyper-proliferation
inhibitors, and inflammation/itch suppressors have been proposed.
However, the said materials can cause side-effects. For example,
steroids can cause epidermal growth suppression, urea peroxides can
cause over-irritation on skin, and antibiotics including
anti-histamine agent can cause bacterial resistance and
photosensitivity. Moreover, long-term administration of such drugs
might bring more serious side effects such as telangiectasia and/or
thickness of keratin. Gamma-linoleic acid, frequently used for
relieving atopy these days (Korean Patent Publication No.
2000-0046633), is easily oxidized, indicating a problem of
stability, and causes skin irritation strongly, so that it is not
suitable for sensitive skin.
[0007] Therefore, natural substances have been focused recently to
treat atopy, which are exemplified by Artemisia vulgaris extract
(Korean Patent No. 10-0377262), the extract of Ganoderma lucidum,
Ulmus pumila, Licorice, Poria, Sesamurn indicum L. and Opuntia
ficus indica (Korean Patent No. 10-0517465), the extract of Evening
primrose, Aloe, pyroligneous liquor, Violet, Jujube, pine mushroom,
Aralia elata, Panax ginseng, green tea, Eucommia ulmoides, Rubus
coreanus, Schisandra chinensis, Artemisia vulgaris, Taraxacum
mongolicum, Saururus chinensis, Astragalus membranaceus, Prunella
vulgaris, Pinus thunbergii, Scutellaria baicalensis and Achyranthes
japonica (Korean Patent No. 10-0451444), the extract of blue
Perilla frutescens and red Perilla frutescens (Korean Patent No.
10-0454752), the extract of Castanea crenata, Coicis semen,
Schisandra chinensis, Platycodon grandiflorum, Raphanus sativus,
Liriope platyphylla and Acorus gramineus (Korean Patent No.
10-0483539), the extract of lavender, Eucalyptus globulus and tea
tree oil (Korean Patent No. 10-0597997), etc. Loranthus
parasiticus, Albizzia julibrissin, Xanthium strumarium, and malt
are also known to have an effect on atopy. However, these natural
substances are weaker in treatment effect and even though they
demonstrate some treatment effect they also cause allergic reaction
especially on sensitive skin, which limits them in use.
[0008] Thus, it is highly requested to develop a safer and more
effective substance than the conventional agents for the
improvement and treatment of atopy.
[0009] In the course of study to screen a material that has an
excellent effect in improving atopy from natural substances, the
present inventors found out that the extract of Daphne genkwa, the
fraction thereof, or genekwadapnin and yuanhuacine, the compounds
isolated from the same, could increase the secretion of cytokine
that converts Th1/Th2 imbalance resulted from atopic disease by
acting on immune cells and epithelial cells, and further confirmed
their effects on the improvement of atopy in the mouse model having
atopic disease, leading to the completion of the present
invention.
SUMMARY OF THE INVENTION
[0010] It is an object of the present invention to provide a
pharmaceutical composition for the prevention or treatment of atopy
comprising the extract of Daphne genkwa, the fraction thereof, or
the compound isolated from the same as an active ingredient.
[0011] It is another object of the present invention to provide a
cosmetic composition for the prevention or improvement of atopy
comprising the extract of Daphne genkwa, the fraction thereof, or
the compound isolated from the same as an active ingredient.
[0012] It is further an object of the present invention to provide
a treatment method of atopy containing the step of administering a
pharmaceutically effective dose of the extract of Daphne genkwa,
the fraction thereof, or the compound isolated from the same to a
subject having atopy.
[0013] It is also an object of the present invention to provide a
prevention method of atopy containing the step of administering a
pharmaceutically effective dose of the extract of Daphne genkwa,
the fraction thereof, or the compound isolated from the same to a
subject.
[0014] It is also an object of the present invention to provide a
use of the extract of Daphne genkwa, the fraction thereof, or the
compound isolated from the same as a pharmaceutical composition for
the prevention and treatment of atopy.
[0015] It is also an object of the present invention to provide a
use of the extract of Daphne genkwa, the fraction thereof, or the
compound isolated from the same as a cosmetic composition for the
prevention and improvement of atopy.
[0016] To achieve the above objects, the present invention provides
a pharmaceutical composition for the prevention or treatment of
atopy comprising the extract of Daphne genkwa, the fraction
thereof, or the compound represented by formula 1 as an active
ingredient.
##STR00001##
[0017] (Wherein,
[0018] R is --C.sub.6H.sub.5 or
--CH.dbd.CHCH.dbd.CH(CH.sub.2).sub.4CH.sub.3.)
[0019] The present invention also provides a cosmetic composition
for the prevention or improvement of atopy comprising the extract
of Daphne genkwa, the fraction thereof, or the compound represented
by formula 1, genekwadapnin (R.dbd.--C.sub.6H.sub.5) or yuanhuacine
(R.dbd.--CH.dbd.CHCH.dbd.CH(CH.sub.2).sub.4CH.sub.3), as an active
ingredient.
[0020] The present invention also provides a treatment method of
atopy containing the step of administering a pharmaceutically
effective dose of the extract of Daphne genkwa, the fraction
thereof, or the compound represented by formula 1 isolated from the
same to a subject having atopy.
[0021] The present invention also provides a prevention method of
atopy containing the step of administering a pharmaceutically
effective dose of the extract of Daphne genkwa, the fraction
thereof, or the compound represented by formula 1 isolated from the
same to a subject.
[0022] The present invention also provides a use of the extract of
Daphne genkwa, the fraction thereof, or the compound represented by
formula 1 isolated from the same as a pharmaceutical composition
for the prevention and treatment of atopy.
[0023] In addition, the present invention provides a use of the
extract of Daphne genkwa, the fraction thereof, or the compound
represented by formula 1 isolated from the same as a cosmetic
composition for the prevention and improvement of atopy.
ADVANTAGEOUS EFFECT
[0024] As explained hereinbefore, the extract of Daphne genkwa, the
fraction thereof, or the compound of formula 1 isolated from the
same, genekwadapnin or yuanhuacine, of the present invention can
increase the secretion of cytokine in Th1 immune cells and suppress
atopy in the atopy mouse model, so that the extract of Daphne
genkwa, the fraction thereof, or the compound of formula 1 isolated
from the same of the present invention can be effectively used for
the prevention or treatment of atopy.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The application of the preferred embodiments of the present
invention is best understood with reference to the accompanying
drawings, wherein:
[0026] FIG. 1 is a diagram illustrating the fraction distribution
chart according to an example of the present invention.
[0027] FIG. 2 is a diagram illustrating the results of RT-PCR
performed to investigate the changes of mRNA levels of Type 1 and
Type II cytokines according to an example of the present
invention.
[0028] FIG. 3 is a diagram illustrating the atopy treatment effect
in the atopy mouse model according to an example of the present
invention: [0029] GD: genekwadapnin treated group; and [0030]
control: control group.
[0031] FIG. 4 is a diagram illustrating the atopy treatment effect
in the atopy induced mouse according to an example of the present
invention.
[0032] FIG. 5 is a diagram illustrating the atopy treatment effect
in the atopy patient according to an example of the present
invention.
[0033] FIG. 6 is a diagram illustrating the intracellular mechanism
according to an example of the present invention: [0034] GD:
genekwadapnin treated group or yuanhuacine treated group.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0035] Hereinafter, the present invention is described in
detail.
[0036] The present invention provides a pharmaceutical composition
for the prevention or treatment of atopy comprising the extract of
Daphne genkwa as an active ingredient.
[0037] To prepare the composition of the present invention, the
Daphne genkwa is either grown or purchased.
[0038] The said Daphne genkwa extract can be preferably obtained
from stems, roots, leaves, floral leaves or buds, and more
preferably from floral leaves or buds.
[0039] To prepare the composition of the present invention, a
solvent used for the extraction of Daphne genkwa is not limited as
long as it can be appropriate for the extraction of natural
substance, but preferably selected from the group consisting of
methanol, methanol aqueous solution, ethanol, ethanol aqueous
solution, butanol, acetone, or a mixture thereof, and more
preferably methanol.
[0040] The volume of the extraction solvent is preferably
2.about.200 times the weight of Daphne genkwa, and more preferably
10.about.30 times, but not always limited thereto.
[0041] The method for the extraction of Daphne genkwa is preferably
selected from the conventional extraction methods well known to
those in the art, which are exemplified by those using extraction
device such as hot-water extraction, soaking extraction,
supercritical extraction, subcritical extraction, high temperature
extraction, high pressure extraction, reflux extraction, and
ultrasonification extraction or those using adsorption resin like
XAD and HP-20. It is also preferred to extract by reflux extraction
with raising temperature or at room temperature. The preferable
temperature for the extraction is 10.about.30.degree. C. and the
preferable time for the extraction is 1.about.20 days, more
preferably 5.about.10 days, but not always limited thereto.
[0042] The present invention also provides a pharmaceutical
composition for the prevention or treatment of atopy comprising the
fraction of Daphne genkwa extract as an active ingredient.
[0043] The fraction of the present invention can be obtained by the
method comprising the following steps:
[0044] obtaining Daphne genkwa extract by adding water,
C.sub.1.about.C.sub.4 lower alcohol, or the mixture thereof to
Daphne genkwa (step 1); and
[0045] obtaining fractions by fractionation of the extract obtained
in step 1 by using hexane, chloroform, and ethyl acetate (step
2).
[0046] The preparation method mentioned above can be illustrated in
more detail, step by step, hereinafter.
[0047] First, step 1 is to obtain Daphne genkwa extract by using an
extraction solvent.
[0048] The Daphne genkwa extract can be obtained by the preparation
method described above.
[0049] Next, step 2 is to obtain fractions by performing
fractionation of the extract obtained in step 1 with hexane,
chloroform, and ethyl acetate.
[0050] Particularly, to obtain the fractions, the Daphne genkwa
extract obtained in step 1 (1.5 kg) was suspended in water, to
which hexane, chloroform, and ethyl acetate were added stepwise.
After separating each layer, chloroform layer was concentrated
under reduced pressure and then dried to give chloroform fraction
(150 g) and ethyl acetate fraction (164 g).
[0051] At this time, the concentration under reduced pressure can
be performed preferably by using rotary evaporator, but not always
limited thereto. The drying process herein can be preferably
performed by reduced pressurized drying, vacuum drying, boiling
drying, spray drying, room temperature drying, or freeze drying,
and more preferably performed by freeze drying, but not always
limited thereto.
[0052] In addition, the present invention provides a pharmaceutical
composition for the prevention or treatment of atopy comprising the
compound represented by formula 1 as an active ingredient:
##STR00002##
[0053] (Wherein,
[0054] R is --C.sub.6H.sub.5 or
--CH.dbd.CHCH.dbd.CH(CH.sub.2).sub.4CH.sub.3.)
[0055] In the compound of formula 1, when R is --C.sub.6H.sub.5,
the compound is genekwadapnin. In the meantime, when R is
--CH.dbd.CHCH.dbd.CH(CH.sub.2).sub.4CH.sub.3, the compound is
yuanhuacine.
[0056] The compound of formula 1, genekwadapnin or yuanhuacine, can
be obtained by the following steps: extracting Daphne genkwa
extract, fractionating thereof, separating and purifying the
compound from the Daphne genkwa chloroform fraction by using silica
gel column chromatography.
[0057] Particularly, the said silica gel column chromatography is
preferably performed one or a few times repeatedly. As a moving
phase, chloroform:methanol (99:1.about.1:1) is preferably used. At
this time, the solvent can be eluted by density gradient elution
which turns non-polarity to polarity stepwise. Atopy treating
effect of the collected fractions was measured to select an active
fraction.
[0058] The Daphne genkwa extract, the fraction thereof, or the
compound isolated from the same of the present invention was
confirmed to increase the secretion of cytokine in Th1 immune cells
(see FIG. 2), and to suppress atopy in the atopy mouse model (see
FIG. 3 and FIG. 4), suggesting that the extract, the fraction, or
the compound of the present invention can be effectively used for
the prevention or treatment of atopy.
[0059] The Daphne genkwa extract, the fraction thereof, or the
compound represented by formula 1 (genekwadapnin or yuanhuacine) of
the present invention can be preferably included in the
pharmaceutical composition of the invention at the volume of
0.1.about.50 weight %, but not always limited thereto.
[0060] The present invention also provides a cosmetic composition
for the prevention or improvement of atopy comprising the extract
of Daphne genkwa, the fraction thereof, or the compound isolated
from the same, genekwadapnin or yuanhuacine, as an active
ingredient.
[0061] The present invention also provides a preparation for skin
external application for the prevention or treatment of atopy
comprising the extract of Daphne genkwa, the fraction thereof, or
the compound isolated from the same, genekwadapnin or yuanhuacine,
as an active ingredient.
[0062] In addition, the present invention provides a health
functional food for the prevention or improvement of atopy
comprising the extract of Daphne genkwa, the fraction thereof, or
the compound isolated from the same, genekwadapnin or yuanhuacine,
as an active ingredient.
[0063] The pharmaceutical composition of the present invention can
additionally contain proper carriers, excipients and diluents
generally used for the preparation of drugs.
[0064] The pharmaceutical composition of the present invention can
be formulated for oral administration, for example powders,
granules, tablets, capsules, suspensions, emulsions, syrups and
aerosols, and for parenteral administration, for example external
use, suppositories and sterile injections, etc. The carriers,
excipients and diluents are exemplified by lactose, dextrose,
sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch,
acacia rubber, alginate, gelatin, calcium phosphate, calcium
silicate, cellulose, methyl cellulose, microcrystalline cellulose,
polyvinyl pyrrolidone, water, methylhydroxybenzoate,
propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
Formulations can be prepared by using generally used excipients or
diluents such as fillers, extenders, binders, wetting agents,
disintegrating agents and surfactant. The pharmaceutical
composition of the present invention can be prepared for oral or
parenteral administration by mixing with generally used diluents or
excipients such as fillers, extenders, binders, wetting agents,
disintegrating agents and surfactants. Solid formulations for oral
administration are tablets, pills, powders, granules and capsules.
These solid formulations are prepared by mixing the composition of
the present invention with one or more suitable excipients such as
starch, calcium carbonate, sucrose or lactose, gelatin, etc. Except
for the simple excipients, lubricants, for example magnesium
stearate, talc, etc, can be used. Liquid formulations for oral
administrations are suspensions, solutions, emulsions and syrups,
and the above-mentioned formulations can contain various excipients
such as wetting agents, sweeteners, aromatics and preservatives in
addition to generally used simple diluents such as water and liquid
paraffin. Formulations for parenteral administration are sterilized
aqueous solutions, water-insoluble excipients, suspensions,
emulsions, lyophilized preparations and suppositories. Water
insoluble excipients and suspensions can contain, in addition to
the active compound or compounds, propylene glycol, polyethylene
glycol, vegetable oil like olive oil, injectable ester like
ethylolate, etc. Suppositories can contain, in addition to the
active compound or compounds, witepsol, macrogol, tween 61, cacao
butter, laurin butter, glycerogelatin, etc.
[0065] The pharmaceutical composition of the present invention can
be administered orally or parenterally (for example, intravenous,
hypodermic, peritoneal, or local injection). The effective dosage
of the composition can be determined according to patient
condition, weight, age, gender, diet, excretion, disease severity,
administration method, administration pathway, and administration
period, etc. The dosage of the freeze-dried extract or fraction of
the present invention is 0.0001.about.500 mg/kg per day and
preferably 0.001.about.100 mg/kg per day, and administration
frequency is once a day or preferably a few times a day.
[0066] The pharmaceutical composition of the present invention can
be administered alone or together with surgical operation, hormone
therapy, chemo-therapy and biological regulators.
[0067] The cosmetic composition of the present invention can be
formulated as skin lotion, skin softener, skin toner, astringent,
lotion, milk lotion, moisture lotion, nutritive lotion, massage
cream, nutritive cream, moisture cream, hand cream, essence,
nutritive essence, pack, soap, shampoo, cleansing foam, cleansing
lotion, cleansing cream, body lotion, body cleanser, milk lotion,
press powder, loose powder, eye shadow, etc.
[0068] The cosmetic composition of the present invention can
include, in addition to the Daphne genkwa extract of the present
invention, a supplement generally used in the field of cosmetics
such as fatty substance, organic solvent, resolvent, concentrate,
gelling agent, softener, antioxidant, suspending agent, stabilizer,
foaming agent, odorant, surfactant, water, ionic or non-ionic
emulsifying agent, filler, sequestering agent, chelating agent,
preserving agent, vitamin, blocker, moisturizing agent, essential
oil, dye, pigment, hydrophilic or hydrophobic activator, lipid
vesicle or other components generally used in cosmetics.
[0069] The Daphne genkwa extract of the present invention can be
formulated as a preparation for skin external application. The
preparation for skin external application containing the Daphne
genkwa extract of the present invention can additionally include a
supplement generally used in the field of skin science such as
fatty substance, organic solvent, resolvent, concentrate, gelling
agent, softener, antioxidant, suspending agent, stabilizer, foaming
agent, odorant, surfactant, water, ionic or non-ionic emulsifying
agent, filler, sequestering agent, chelating agent, preserving
agent, vitamin, blocker, moisturizing agent, essential oil, dye,
pigment, hydrophilic or hydrophobic activator, lipid vesicle or
other components generally used in a preparation for skin external
application. The amount of the above supplement can be determined
as generally accepted in the field of skin science.
[0070] The Daphne genkwa extract of the present invention can be
used as a health functional food. The food herein is not limited.
For example, the Daphne genkwa extract can be added to drinks,
meat, sausages, bread, biscuits rice cakes, chocolates, candies,
snacks, cookies, pizza, ramyuns, flour products, gums, dairy
products including ice cream, soups, beverages, alcohol drinks and
vitamin complex, etc, and in wide sense, almost every food
applicable in the production of health food can be included.
[0071] The Daphne genkwa extract of the present invention can be
added as it is or as mixed with other food components according to
the conventional method. The mixing ratio of active ingredients can
be regulated according to the purpose of use (prevention or
improvement). In general, to produce health food or beverages, the
Daphne genkwa extract of the present invention is added preferably
by 0.1.about.90 weight part to the total food weight. However, if
long term administration is required for health and hygiene or
regulating health condition, the content can be lower than the
above but higher content can be accepted as well since the Daphne
genkwa extract of the present invention has been proved to be very
safe.
[0072] The composition for health beverages of the present
invention can additionally include various flavors or natural
carbohydrates, etc, like other beverages. The natural carbohydrates
above can be one of monosaccharides such as glucose and fructose,
disaccharides such as maltose and sucrose, polysaccharides such as
dextrin and cyclodextrin, and glucose alcohols such as xilytole,
sorbitol and erythritol. Besides, natural sweetening agents
(thaumatin, stevia extract, for example rebaudioside A,
glycyrrhizin, etc.) and synthetic sweetening agents (saccharin,
aspartame, etc.) can be included as a sweetening agent. The content
of the natural carbohydrate is preferably 1.about.20 g and more
preferably 5.about.12 g in 100 ml of the composition.
[0073] In addition to the ingredients mentioned above, the Daphne
genkwa extract of the present invention can include in variety of
nutrients, vitamins, minerals (electrolytes), flavors including
natural flavors and synthetic flavors, coloring agents and
extenders (cheese, chocolate, etc.), pectic acid and its salts,
alginic acid and its salts, organic acid, protective colloidal
viscosifiers, pH regulators, stabilizers, antiseptics, glycerin,
alcohols, carbonators which used to be added to soda, etc. The
Daphne genkwa extract of the present invention can also include
natural fruit juice, fruit beverages and/or fruit flesh addable to
vegetable beverages. All the mentioned ingredients can be added
singly or together. The mixing ratio of those ingredients does not
matter in fact, but in general, each can be added by 0.1.about.20
weight part per 100 weight part of the Daphne genkwa extract of the
invention.
[0074] The present invention also provides a treatment method of
atopy containing the step of administering a pharmaceutically
effective dose of the extract of Daphne genkwa, the fraction
thereof, or the compound isolated from the same, genekwadapnin or
yuanhuacine, to a subject having atopy.
[0075] The present invention also provides a treatment method of
atopy containing the step of administering a pharmaceutically
effective dose of the extract of Daphne genkwa, the fraction
thereof, or the compound isolated from the same, genekwadapnin or
yuanhuacine, to a subject.
[0076] The Daphne genkwa extract, the fraction thereof, or the
compound isolated from the same of the present invention was
confirmed to increase the secretion of cytokine in Th1 immune cells
(see FIG. 2), and to suppress atopy in the atopy mouse model (see
FIG. 3 and FIG. 4), suggesting that the extract, the fraction, or
the compound of the present invention can be effectively used for
the prevention or treatment method of atopy.
[0077] The present invention also provides a use of the extract of
Daphne genkwa, the fraction thereof, or the compound of formula 1
isolated from the same as a pharmaceutical composition for the
prevention and treatment of atopy.
[0078] The present invention also provides a use of the extract of
Daphne genkwa, the fraction thereof, or the compound of formula 1
isolated from the same as a cosmetic composition for the prevention
and improvement of atopy.
[0079] The Daphne genkwa extract, the fraction thereof, or the
compound isolated from the same of the present invention was
confirmed to increase the secretion of cytokine in Th1 immune cells
(see FIG. 2), and to suppress atopy in the atopy mouse model (see
FIG. 3 and FIG. 4), suggesting that the extract, the fraction, or
the compound of the present invention can be effectively used for
the prevention or treatment method of atopy.
[0080] Practical and presently preferred embodiments of the present
invention are illustrative as shown in the following Examples,
Experimental Examples and Manufacturing Examples.
[0081] However, it will be appreciated that those skilled in the
art, on consideration of this disclosure, may make modifications
and improvements within the spirit and scope of the present
invention.
Example 1
Separation of Genekwadapnin and Yuanhuacine
[0082] 11.7 kg of the dried buds of Daphne genkwa was loaded in 20
L of methanol, followed by extraction three times to give 1.5 kg of
methanol extract. The obtained methanol extract was suspended in 10
L of water, followed by extraction three times stepwise with 10 L
of each n-hexane, chloroform, and ethyl acetate as solvents. As a
result, 323 g of hexane fraction, 150 g of chloroform fraction, and
164 g of ethyl acetate fraction were obtained. Among them, 74 g of
chloroform fraction was loaded on silica gel column, followed by
elution with chloroform and methanol (density gradient of
99:1.about.1:1). As a result, 20 g of subtraction was obtained,
which was loaded again on reversed phase silica gel column. The
mixed solution of methanol and water (7:3) was used to give 1.1 g
of genekwadapnin containing fraction and 1.4 g of yuanhuacine
containing fraction. 1.1 g of the genekwadapnin containing fraction
was loaded on normal phase silica gel column (elution solvent:
n-hexane and ethyl acetate, 15:1) to give 208.7 mg of active
fraction. The obtained active fraction was purified by reversed
phase silica gel column chromatography (elution solvent: methanol
and water, 3:1) to give 125.6 mg of genekwadapnin compound. Normal
phase silica gel column chromatography (elution solvent: n-hexane
and ethyl acetate, 9:1.about.0:100) and methanol solvent
recrystallization were performed with 1.4 g of yuanhuacine
fraction. As a result, 74 mg of yuanhuacine was obtained.
Example 2
Cell Culture
[0083] Human cell lines (A549, NK92, muDC, Jurkat) were cultured in
a 37.degree. C., 5% CO.sub.2 humidified incubator.
[0084] Particularly, NK92 (human NK lymphoma), the IL-2 dependent
NK cell line, was purchased from ATCC (American Type Culture
Collection). The NK92 cell line was maintained in .alpha.-MEM (Life
Technologies, Karlsruhe, Germany) supplemented with 20% FCS
(HyClone, Logan, Utah), 2 mM L-glutamate, 100 .mu.g/ml penicillin,
100 .mu.g/ml streptomycin (Life Technologies) and 100 U/ml IL-2
(Chiron, Emeryville, Calif.).
Experimental Example 1
RT-PCR
[0085] RT-PCR was performed to investigate the changes of mRNA
levels in relation to the inducement of IFN-.gamma., IL-2, and
IL-12 in A549, NK92, muDC, and Jurkat cells cultured in <Example
2>. These cells were cultured in the presence of 2 ng of
genekwadapnin or yuanhuacine for 12 hours.
[0086] Phase II RT-PCR was performed with oligo-dT primer, reverse
transcriptase, specific primer set, and Taq polymerase (Takara,
Shiga, Japan). Total RNA was isolated according to the standard
protocol. cDNA was synthesized by using Accusript High Fidelity 1st
Strand cDNA Synthesis Kit (Stratagene) according to the
manufacturer's instruction. 1 .mu.l of the synthesized cDNA was
used for PCR with 20 .mu.l of reaction mixture containing 0.5 U
ExTaq DNA polymerase, 1.times. buffer, 1 mM dNTP mix (Takara) and
specific primer set. PCR amplification was performed using GeneAmp
PCR system 2700 (Applied Biosystems, Foster city, CA, USA) as
follows: predenaturation at 94.degree. C. for 5 minutes,
denaturation at 94.degree. C. for 45 seconds, annealing at
56.degree. C. for 45 seconds, polymerization at 72.degree. C. for 1
minute, 25.about.40 cycles from denaturation to polymerization, and
final extension at 72.degree. C. for 7 minutes. PCR primers shown
in [Table 1] were designed by using Primer 3 program, which were
purchased from Bioneer (Daejeon, Korea). At this time, GAPDH was
used as the internal control.
TABLE-US-00001 TABLE 1 Name Forward Reverse GAPDH
CCATCACCATCTTCCAGGAG ACAGTCTTCTGGGTGGCAGT (SEQ. ID. NO: 1) (SEQ.
ID. NO: 2) IL-2 ACCTCAACTCCTGCCACAAT GCCTGATATGTTTTAAGTGGGAAG (SEQ.
ID. NO: 3) (SEQ. ID. NO: 4) IL-4 AATGGGTCTCACCTCCCAAC
TTCAGCTCGAACACTTTGAA (SEQ. ID. NO: 5) (SEQ. ID. NO: 6) IL-
GAGGCCTGTTTACCATTGGA AGGGACCTCGCTTTTTAGGA 12.alpha. (SEQ. ID. NO:
7) (SEQ. ID. NO: 8) IL-15 GAAGCCAACTGGGTGAATGT TTGAAATGCCGAGTGTTTTG
(SEQ. ID. NO: 9) (SEQ. ID. NO: 10) IL-18 GCACCCCGGACCATATTTA
GATTACAGGCGTGAGCCACT (SEQ. ID. NO: 11) (SEQ. ID. NO: 12) IFN.alpha.
CCTGGTGGTGCTCAGCTGCA ACCTCCCAGGCACAAGGGCT (SEQ. ID. NO: 13) (SEQ.
ID. NO: 14) IFN.gamma. TGGCTGAACTGTCGCCAGCA TGGCTGCCTAGTTGGCCCCT
(SEQ. ID. NO: 15) (SEQ. ID. NO: 16)
[0087] The PCR product was electrophoresed on 1.5% agarose gel,
which was stained with ethidium bromide (EtBr) and then visualized
by using Gel Doc 2000 UV trans-illuminator (Bio-Rad Laboratories,
Hercules, Calif., UV). Analysis was performed with Quantity One
software (Bio-Rad Laboratories). Each sample was tested at least
three times and the results are shown in FIGS. 2A and 2B.
[0088] As a result, as shown in FIG. 2A, the transcripts of Type I
cytokines, IFN-.gamma., IL-2, and IL-12, were significantly
increased in NR92 and A549 cells 12 hours after being treated with
genekwadapnin or yuanhuacine, while the transcript of type II
cytokine, IL-4, was not induced. In the meantime, the transcripts
of IL-15 and IL-18 were not controlled (FIG. 2A). As shown in FIG.
1B, the action of genekwadapnin or yuanhuacine to induce IL-12 and
IFN-.gamma. was induced within 3 hours at transcriptional level
(FIG. 1B).
Experimental Example 2
Atopy Treatment Effect of Genekwadapnin or Yuanhuacine in Atopy
Mouse Model
<2-1> Atopy Treatment Effect in NC Mouse Model
[0089] NC mouse is the mouse showing typical atopy symptom when it
is raised in the conventional space. Genekwadapnin or yuanhuacine
was spread locally on NC mouse starting to show atopy symptom,
followed by observation of changes of atopy symptom. To minimize
errors among mice and to confirm the treatment effect, each mouse
was treated locally and skin tissues proceeded to biopsy to prove
the atopy treatment effect experimentally.
[0090] As a result, as shown in FIG. 3, on the back where
genekwadapnin or yuanhuacine was spread, atopy symptom was
significantly reduced. The biopsy with those skin tissues also
demonstrated significant difference in the distribution of
inflammatory cells, which was that the area treated with
genekwadapnin or yuanhuacine exhibited almost normal phenotype
(FIG. 3).
<2-2> Confirmation of Atopy Treatment Effect in Atopy Induced
Mouse Model
[0091] DNCB, one of allergens, was spread on the shaved skin of a
normal Balb/C mouse to induce atopy intentionally. Atopy symptoms
varied from the dose of DNCB and the treatment period, which were
classified into different score groups (score 4.about.8 group and
score 10.about.13 group). In the mouse group (score 4.about.8
group) which was treated with a lower dose of DNCB, atopic skin was
recovered to normal skin within 24 hours from the treatment of
genekwadapnin or yuanhuacine. On the other hand, even in the mouse
group of score 10.about.13 which showed severe atopic symptoms, the
speed of recovery was at least two times faster than the control
group (FIG. 4). At that time, the test was performed in duplicate
with 10 mice each.
[0092] Therefore, it was confirmed that the Daphne genkwa extract,
and the compounds isolated therefrom, genekwadapnin and
yuanhuacine, of the present invention were effective in preventing
or treating atopy.
<2-3> Confirmation of Atopy Treatment Effect in Atopy
Patient
[0093] After spreading genekwadapnin or yuanhuacine on the skin of
atopy patients, atopy treatment effect of the compound was
confirmed.
[0094] Particularly, 5 ug/ml of genekwadapnin or yuanhuacine was
spread on the skin of atopy patients, followed by observation for
5.about.20 days. The treatment effect was confirmed by Medream Skin
Clinic (Goejeong-dong, Seogu, Daejeon, Korea).
[0095] As a result, as shown in FIG. 5, in the atopy patient spread
with genekwadapnin or yuanhuacine, the atopic skin was recovered to
normal 5 days after the treatment when the symptoms were minor, or
the atopic skin was recovered to normal 20 days after the treatment
when the symptoms were severe (FIG. 5).
<2-3> Intracellular Mechanism of Genekwadapnin or
Yuanhuacine
[0096] To investigate the intracellular mechanism of genekwadapnin
or yuanhuacine, the NK92 cells cultured in <Example 2> were
treated with genekwadapnin or yuanhuacine at the concentration of
500 ng/ml. 12 hours later, phosphorylation level of PKC isotype was
investigated by using antibodies. The quantity of protein used
herein was confirmed by using GAPDH.
[0097] Particularly, the cells treated with genekwadapnin or
yuanhuacine were dissolved in ice by using cold SDS-lysis buffer
[(50 mM HEPES, 150 mM NaCl, 0.2 mM EDTA, 0.5% NP-40, 0.1% SDS, 1 mM
Na3VO4, 10 mM NaF, and complete Protein Inhibitor Cocktail (Roche)]
for 30 minutes. The dissolved cell solution was spinned at the
speed of 13,000 rpm for 30 minutes in a high-speed rotating machine
to precipitate insoluble part and then water soluble part was
separated. The separated cell aqueous solution was quantified,
followed by electrophoresis using 10.about.20% SDS-PAGE. Cellular
protein separated on the gel was transcribed onto PVDF membrane
(Millipore, Billerica, Mass., USA) at 100 V for 2 hours. To confirm
PCK isotype phosphorylated in the cells, poly rabbit anti-PKD1,
-phosphoPKD1 (Ser916), -phosphoPKDl (Ser744/748),
phosphoPKC.alpha./.beta.II, -phosphoPKC.delta., -phosphoPKC.theta.,
and -phosphoPKC.zeta./.lamda. IgG (Cell signaling Technology, USA)
(1:1000) were used as primary antibodies. As a secondary antibody,
horseradish peroxidase peroxidase-conjugated goat anti-rabbit IgG
(Santa Cruz Biotechnology, USA) (1:3000) was treated at room
temperature for 60 minutes. To confirm the equal amount of cellular
protein, poly rabbit anti-GAPDH IgG (Santa Cruz Biotechnology,
Pasadena, Calif., USA) was used. Upon completion of the immune
reaction, the membrane was reacted with ECL reagent (Millipore,
Billerica, Mass., USA), which was then exposed on X-ray film in
order to observe the phosphorylation level of PKC isotype exhibited
as a band on the film.
[0098] As a result, as shown in FIG. 6, in NK92 cells, the cells
treated with genekwadapnin or yuanhuacine, PKD1 level was not
changed but phosphorylation of serin residues
(744.sup.th/748.sup.th, and 916.sup.th sites of PKD1 protein) was
confirmed. In the meantime, it was confirmed that other types of
PCK isotype were not phosphorylated (FIG. 6).
[0099] The Manufacturing Examples of the composition for the
present invention are described hereinafter.
Manufacturing Example 1
Preparation of Pharmaceutical Formulations
<1-1> Preparation of Powders
TABLE-US-00002 [0100] Daphne genkwa extract, fraction thereof, 20
mg or compound isolated from the same Lactose 20 mg
[0101] Powders were prepared by mixing all the above components,
which were filled in airtight packs according to the conventional
method for preparing powders.
<1-2> Preparation of Tablets
TABLE-US-00003 [0102] Daphne genkwa extract, fraction thereof, 20
mg or compound isolated from the same Corn starch 100 mg Lactose
100 mg Magnesium stearate 2 mg
[0103] Tablets were prepared by mixing all the above components by
the conventional method for preparing tablets.
<1-3> Preparation of Capsules
TABLE-US-00004 [0104] Daphne genkwa extract, fraction thereof, 10
mg or compound isolated from the same Crystalline cellulose 3 mg
Lactose 14.8 mg Magnesium stearate 0.2 mg
[0105] Capsules were prepared by mixing all the above components,
which were filled in gelatin capsules according to the conventional
method for preparing capsules.
<1-4> Preparation of Liquid Formulations
TABLE-US-00005 [0106] Daphne genkwa extract, fraction thereof, 20
mg or compound isolated from the same Isomerized sugar 10 g
Mannitol 5 g Purified water proper amount
[0107] All the above components were dissolved in purified water.
After adding lemon flavor, total volume was adjusted to be 100 ml
by adding purified water. Liquid formulations were prepared by
putting the mixture into brown bottles and sterilizing thereof by
the conventional method for preparing liquid formulations.
<1-5> Preparation of Injectable Solutions
TABLE-US-00006 [0108] Daphne genkwa extract, fraction thereof, 10
.mu.g /ml or compound isolated from the same Weak HCl BP until pH
7.6 Injectable NaCl BP up to 1 ml
[0109] The ethanol mixture extract was dissolved in proper volume
of injectable NaCl BP. pH of the prepared solution was regulated as
7.6 by using weak HCl BP. The volume was adjusted by using
injectable NaCl BP. The solution was well mixed and filled in 5 ml
type I transparent glass ampoules. The ampoules were sealed by
melting the glass of opening, followed by autoclave at 120.degree.
C. for at least 15 minutes for sterilization.
Manufacturing Example 2
Preparation of Foods
[0110] Foods containing the Daphne genkwa extract, the fraction
thereof, or the compound isolated from the same of the present
invention were prepared as follows.
<2-1> Preparation of Flour Foods
[0111] 0.5.about.5.0 weight part of the Daphne genkwa extract, the
fraction thereof, or the compound isolated from the same of the
present invention was added to flour. Health enhancing foods such
as bread, cake, cookies, crackers and noodles were prepared with
the flour mixture according to the conventional method.
<2-2> Preparation of Dairy Products
[0112] 5.about.10 weight part of the Daphne genkwa extract, the
fraction thereof, or the compound isolated from the same of the
present invention was added to milk. Health enhancing dairy
products such as butter and ice cream were prepared with the milk
mixture according to the conventional method.
<2-3> Preparation of Sun-Sik
[0113] Brown rice, barley, glutinous rice and Yulmu (Job's tears)
were gelatinized according to the conventional method, dried and
pulverized to obtain 60-mesh powders.
[0114] Black soybean, black sesame and wild sesame were steamed and
dried according to the conventional method and pulverized to obtain
60-mesh powders.
[0115] The Daphne genkwa extract, the fraction thereof, or the
compound isolated from the same of the present invention was
concentrated under reduced pressure, spray-dried and pulverized to
obtain 60-mesh dry powders.
[0116] Sun-Sik was prepared by mixing the dry powders of the
grains, seeds and the Daphne genkwa extract, the fraction thereof,
or the compound isolated from the same according to the below
ratio.
[0117] Grains (brown rice: 30 weight part, Yulmu: 15 weight part,
barley: 20 weight part),
[0118] Seeds (wild sesame: 7 weight part, black soybean: 8 weight
part, black sesame: 7 weight part),
[0119] Dry powders of the Daphne genkwa extract, the fraction
thereof, or the compound isolated from the same of the present
invention (3 weight part),
[0120] Ganoderma lucidum (0.5 weight part),
[0121] Rehmannia glutinosa (0.5 weight part)
<2-4> Preparation of Health Supplement Foods
TABLE-US-00007 [0122] Daphne genkwa extract, fraction thereof, 100
mg or compound isolated from the same Vitamin complex proper amount
Vitamin A acetate 70 .mu.g Vitamin E 1.0 mg Vitamin B1 0.13 mg
Vitamin B2 0.15 mg Vitamin B6 0.5 mg Vitamin B12 0.2 .mu.g Vitamin
C 10 mg Biotin 10 .mu.g Nicotinic acid amide 1.7 mg Folic acid 50
.mu.g Calcium pantothenate 0.5 mg Minerals proper amount Ferrous
sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg
Potassium phosphate monobasic 15 mg Potassium phosphate dibasic 55
mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium
chloride 24.8 mg
[0123] Vitamins and minerals were mixed according to the preferable
composition rate for health food. However, the composition rate can
be adjusted. The constituents were mixed according to the
conventional method for preparing health food (ex. granules, etc)
and then the composition for health food was prepared according to
the conventional method.
Manufacturing Example 3
Preparation of Health Beverages
TABLE-US-00008 [0124] Daphne genkwa extract, fraction thereof, 100
mg or compound isolated from the same Citric acid 100 mg
Oligosaccharide 100 mg Maesil (Prunus mume) Extract 2 mg Taurine
100 mg Purified water up to 500 ml
[0125] The above constituents were mixed according to the
conventional method for preparing health beverages. The mixture was
heated at 85.degree. C. for 1 hour with stirring and then filtered.
The filtrate was loaded in 1 l sterilized containers, which were
sealed and sterilized again, stored in a refrigerator until they
would be used for the preparation of a composition for health
beverages.
[0126] The constituents appropriate for favorite beverages were
mixed according to the preferred mixing ratio but the composition
ratio can be adjusted according to consumer characteristics,
purpose of use, regional and national preferences, etc.
Manufacturing Example 4
Preparation of Cosmetics
<4-1> Preparation of Emollient Toilet Water (Skin)
[0127] Emollient toilet water for atopic skin comprising the Daphne
genkwa extract, the fraction thereof, or the compound isolated from
the same of the present invention was prepared by mixing all the
components shown in [Table 2] by the conventional method for
preparing cosmetics.
TABLE-US-00009 TABLE 2 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same 1,3-butyleneglycol 3.0 Glycerine 5.0 Polyoxyethylene (60) 0.2
Hydrogenated castor oil Ethanol 8.0 Citric acid 0.02 Sodium citrate
0.06 Antiseptic Proper amount Flavor Proper amount Purified water
To 100
<4-2> Preparation of Nutritive Toilet Water (Lotion)
[0128] Nutritive toilet water for atopic skin comprising the Daphne
genkwa extract, the fraction thereof, or the compound isolated from
the same of the present invention was prepared by mixing all the
components shown in [Table 3] by the conventional method for
preparing cosmetics.
TABLE-US-00010 TABLE 3 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same 1,3-butyleneglycol 8.0 Glycerine 5.0 Squalane 10.0
Polyoxyethylene sorbitan 2.0 monooleate Guaiac oil 0.1~30%
1,3-butyleneglycol 3.0 Glycerine 5.0 Polyoxyethylene (60) 0.2
Hydrogenated castor oil Ethanol 8.0 Citric acid 0.02 Sodium citrate
0.06 Antiseptic Proper amount Flavor Proper amount Purified water
To 100
<4-3> Preparation of Essence
[0129] Essence for atopic skin comprising the Daphne genkwa
extract, the fraction thereof, or the compound isolated from the
same of the present invention was prepared by mixing all the
components shown in [Table 4] by the conventional method for
preparing cosmetics.
TABLE-US-00011 TABLE 4 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same Sitostorol 1.7 Polyglyceryl2-olate 1.5 Ceramide 0.7
Ceteareth-4 1.2 Cholesterol 1.5 Dicetyl phosphate 0.4 Concentrated
glycerin 5.0 Carboxyvinylpolymer 0.2 Xanthan gum 0.2 Antiseptic
Proper amount Flavor Proper amount Purified water To 100
<4-4> Preparation of Cleanser (Cleansing Foam)
[0130] Cleanser for atopic skin comprising the Daphne genkwa
extract, the fraction thereof, or the compound isolated from the
same of the present invention was prepared by mixing all the
components shown in [Table 5] by the conventional method for
preparing cosmetics.
TABLE-US-00012 TABLE 5 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same N-acyl sodium glutamate 20.0 Glycerine 10.0 PEG-400 15.0
Propyleneglycol 10.0 POE(15) oleylalcoholether 3.0 Laurin
derivative 2.0 Methylparabene 0.2 EDTA-4Na 0.03 Flavor 0.2 Purified
water To 100
<4-5> Preparation of Nutritive Cream
[0131] Nutritive cream for atopic skin comprising the Daphne genkwa
extract, the fraction thereof, or the compound isolated from the
same of the present invention was prepared by mixing all the
components shown in [Table 6] by the conventional method for
preparing cosmetics.
TABLE-US-00013 TABLE 6 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same Vaseline 7.0 Liquid paraffin 10.0 Wax 2.0 Polysorbate 60 2.5
Sorbitan sesquioleate 1.5 Squalane 3.0 Propyleneglycol 6.0
Glycerine 4.0 Triethanolamine 0.5 Xanthan gum 0.5 Tocophenylacetate
0.1 Flavor, Antiseptic Proper amount Purified water To 100
<4-6> Preparation of Massage Cream
[0132] Massage cream for atopic skin comprising the Daphne genkwa
extract, the fraction thereof, or the compound isolated from the
same of the present invention was prepared by mixing all the
components shown in [Table 7] by the conventional method for
preparing cosmetics.
TABLE-US-00014 TABLE 7 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same Propyleneglycol 6.0 Glycerine 4.0 Triethanolamine 0.5 Wax 2.0
Tocophenylacetate 0.1 Polysorbate 60 3.0 Sorbitan sesquioleate 2.5
Cetearyl alcohol 2.0 Liquid paraffin 30.0 Xanthan gum 0.5 Flavor,
Antiseptic Proper amount Purified water To 100
<4-7> Preparation of Pack
[0133] Pack for atopic skin comprising the Daphne genkwa extract,
the fraction thereof, or the compound isolated from the same of the
present invention was prepared by mixing all the components shown
in [Table 8] by the conventional method for preparing
cosmetics.
TABLE-US-00015 TABLE 8 Component Content (weight %) Daphne genkwa
extract, 0.1~30% fraction thereof, or compound isolated from the
same Propyleneglycol 2.0 Glycerine 4.0 Polyvinylalcohol 10.0
Ethanol 7.0 PEG-40 hydrogenated castor oil 0.8 Triethanolamine 0.3
Flavor, Antiseptic Proper amount Purified water To 100
[0134] The present invention is not limited in the above
illustrated examples, and can be modified or changed by those in
the art. The present invention can also be applied to various types
of cosmetics including color cosmetics, and can be used for the
preparation of ointment or drugs for light application on human
skin considering the effect. The said criteria is all included in
the spirit and scope of the present invention as set forth in the
appended Claims.
Sequence CWU 1
1
16120DNAArtificial SequenceGAPDH forward primer 1ccatcaccat
cttccaggag 20220DNAArtificial SequenceGAPDH reverse primer
2acagtcttct gggtggcagt 20320DNAArtificial SequenceIL-2 forward
primer 3acctcaactc ctgccacaat 20424DNAArtificial SequenceIL-2
reverse primer 4gcctgatatg ttttaagtgg gaag 24520DNAArtificial
SequenceIL-4 forward primer 5aatgggtctc acctcccaac
20620DNAArtificial SequenceIL-4 reverse primer 6ttcagctcga
acactttgaa 20720DNAArtificial SequenceIL-12 alpha forward primer
7gaggcctgtt taccattgga 20820DNAArtificial SequenceIL-12 alpha
reverse primer 8agggacctcg ctttttagga 20920DNAArtificial
SequenceIL-15 forward primer 9gaagccaact gggtgaatgt
201020DNAArtificial SequenceIL-15 reverse primer 10ttgaaatgcc
gagtgttttg 201119DNAArtificial SequenceIL-18 forward primer
11gcaccccgga ccatattta 191220DNAArtificial SequenceIL-18 reverse
primer 12gattacaggc gtgagccact 201320DNAArtificial SequenceINF
alpha forward primer 13cctggtggtg ctcagctgca 201420DNAArtificial
SequenceINF alpha reverse primer 14acctcccagg cacaagggct
201520DNAArtificial SequenceINF gamma forward primer 15tggctgaact
gtcgccagca 201620DNAArtificial SequenceINF gamma reverse primer
16tggctgccta gttggcccct 20
* * * * *