U.S. patent application number 13/958154 was filed with the patent office on 2014-03-06 for methods for genetic diversification in gene conversion active cells.
The applicant listed for this patent is GSF-Forschungszentrum Fur Umwelt Und Gesundheit, GMBH. Invention is credited to Hiroshi ARAKAWA, Jean-Marie BUERSTEDDE.
Application Number | 20140068795 13/958154 |
Document ID | / |
Family ID | 34745862 |
Filed Date | 2014-03-06 |
United States Patent
Application |
20140068795 |
Kind Code |
A1 |
BUERSTEDDE; Jean-Marie ; et
al. |
March 6, 2014 |
Methods for Genetic Diversification in Gene Conversion Active
Cells
Abstract
The invention relates to a modified lymphoid cell having gene
conversion fully or partially replaced by hypermutation, wherein
said cell has no deleterious mutations in genes encoding paralogues
and analogues of the RAD51 protein, and wherein said cell is
capable of directed and selective genetic diversification of a
target nucleic acid by hypermutation or a combination of
hypermutation and gene conversion. The invention also relates to a
method for diversifying any transgenic target gene in said cell.
Preferably, the target gene is integrated into the immunoglobulin
light or heavy chain locus by targeted integration.
Inventors: |
BUERSTEDDE; Jean-Marie;
(Munchen, DE) ; ARAKAWA; Hiroshi; (Munchen,
DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GSF-Forschungszentrum Fur Umwelt Und Gesundheit, GMBH |
Neuherberg |
|
DE |
|
|
Family ID: |
34745862 |
Appl. No.: |
13/958154 |
Filed: |
August 2, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10590211 |
Aug 22, 2006 |
8518699 |
|
|
13958154 |
|
|
|
|
Current U.S.
Class: |
800/13 ; 435/325;
435/326; 435/349; 435/352; 435/6.12; 435/69.6 |
Current CPC
Class: |
C07K 16/00 20130101;
C12N 15/1024 20130101 |
Class at
Publication: |
800/13 ; 435/325;
435/349; 435/352; 435/326; 435/6.12; 435/69.6 |
International
Class: |
C07K 16/00 20060101
C07K016/00 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 23, 2004 |
EP |
04004062.8 |
Claims
1. A genetically modified lymphoid cell having gene conversion
fully or partially replaced by hypermutation, wherein said cell has
no deleterious mutations in genes encoding paralogues and analogues
of the RAD51 protein.
2. The cell according to claim 1, wherein the cell contains
wild-type homologous recombination activity.
3. The cell according to claim 1, wherein the cell has an
unaffected proliferation rate.
4. The cell according to claim 1, wherein the cell is DNA repair
proficient.
5. The cell according to claim 1, wherein the cell is an
immunoglobulin-expressing B cell.
6. The cell according to claim 1, wherein the cell is derived from
chicken, sheep, cow, pig or rabbit.
7. The cell according to claim 1, wherein the cell is a chicken
Bursal lymphoma cell.
8. The cell according to claim 1, wherein the cell is a DT40 cell
or a derivative thereof.
9. The cell according to claim 1, wherein the cell expresses
activation-induced deaminase (AID).
10. The cell according to claim 1, wherein the cell is capable of
directed and selective genetic diversification of a target nucleic
acid by hypermutation or a combination of hypermutation and gene
conversion.
11. The cell according to claim 10, wherein the target nucleic acid
encodes a protein or exercises a regulatory activity.
12. The cell according to claim 11, wherein the target nucleic acid
encodes an immunoglobulin chain, a selection marker, a DNA-binding
protein, an enzyme, a receptor protein, or a part thereof.
13. The cell according to claim 12, wherein the target nucleic acid
is a human immunoglobulin V-gene or a part thereof.
14. The cell according to claim 11, wherein the target nucleic acid
contains a transcription regulatory element or an RNAi
sequence.
15. The cell according to claim 10, wherein the cell further
contains at least one sequence capable of serving as a gene
conversion donor for the target nucleic acid.
16. The cell according to claim 10, wherein the target nucleic acid
is integrated into the chromosome at a defined location by targeted
integration.
17. The cell according to claim 11, wherein the target nucleic acid
is operably linked to control nucleic acid sequences that direct
genetic diversification.
18. The cell according to claim 11, wherein the cell expresses the
target nucleic acid in a manner that facilitates selection of cells
comprising mutants of said nucleic acid having a desired
activity.
19. The cell according to claim 18, wherein the selection is a
direct selection for the activity of the target nucleic acid within
the cell, on the cell surface or outside the cell.
20. The cell according to claim 18, wherein the selection is an
indirect selection for the activity of a reporter nucleic acid.
21. The cell according to claim 10, wherein genetic diversification
of the target nucleic acid by gene conversion and hypermutation is
modulated by genetic manipulation.
22. The cell according to claim 21, wherein the modulation is by
cis-acting regulatory sequences.
23. The cell according to claim 20, wherein the modulation is by
varying the number, the orientation, the length or the degree of
homology of the gene conversion donors.
24. The cell according to claim 20, wherein the modulation is by a
trans-acting regulatory factor.
25. The cell according to claim 24, wherein the trans-acting
regulatory factor is activation-induced deaminase (AID).
26. The cell according to claim 24, wherein the trans-acting factor
is a DNA repair or recombination factor other than a RAD51
paralogue or analogue.
27. A cell line derived from the cell of claim 1.
28. A non-human transgenic animal containing a lymphoid cell having
gene conversion fully or partially replaced by hypermutation,
wherein said cell has no deleterious mutations in genes encoding
paralogues and analogues of the RAD51 protein, and wherein said
cell is capable of directed and selective genetic diversification
of a transgenic target nucleic acid by hypermutation or a
combination of hypermutation and gene conversion.
29. A method for preparing a cell capable of directed and selective
genetic diversification of a target nucleic acid by hypermutation
or a combination of hypermutation and gene conversion comprising
(a) transfecting a lymphoid cell capable of gene conversion with a
genetic construct containing the target nucleic acid, and (b)
identifying a cell having the endogenous V-gene or a fragment
thereof replaced with the target nucleic acid.
30. The method according to claim 29, wherein the genetic construct
containing the target nucleic acid further contains at least one
nucleic acid capable of serving as a gene conversion donor for the
target nucleic acid.
31. The method according to claim 29, wherein the locus containing
the target nucleic acid is constructed by multiple rounds of
transfection.
32. The method according to claim 29 further comprising (c)
transfecting the cell from step (b) with a further genetic
construct comprising a reporter gene capable of being influenced by
the target nucleic acid.
33. The method according to claim 29 further comprising (d)
conditional expression of a trans-acting regulatory factor.
34. The method of claim 33, wherein the trans-acting regulatory
factor is activation-induced deaminase (AID).
35. The method according to claim 29, wherein the target nucleic
acid is inserted into the cell chromosome at a particular location
by targeted integration.
36. A method for preparing a gene product having a desired
activity, comprising the steps of: (a) culturing cells according to
claim 11 under appropriate conditions to express the target nucleic
acid, (b) identifying a cell or cells within the population of
cells which expresses a mutated gene product having the desired
activity; and (c) establishing one or more clonal populations of
cells from the cell or cells identified in step (b), and selecting
from said clonal populations a cell or cells which express(es) a
gene product having an improved desired activity.
37. The method according to claim 36, wherein steps (b) and (c) are
iteratively repeated.
38. The method according to claim 36 further comprising the step of
switching off genetic diversification.
39. The method according to claim 36, wherein the diversification
of the target nucleic acid is further modified by target sequence
optimization.
40. The method according to claim 36, wherein the genetic
diversification is switched off by down-regulation of the
expression of a trans-acting regulatory factor.
41. The method according to claim 40, wherein the trans-acting
regulatory factor is activation-induced deaminase (AID).
42. Use of the cell according to claim 10 or a cell line according
to claim 27 for the preparation of a gene product having a desired
activity.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation application of
U.S. application Ser. No. 10/590,211, filed Aug. 22, 2006
(allowed), which is a national phase application under 35 U.S.C.
.sctn.371 of International Application No. PCT/EP2005/001897, filed
Feb. 23, 2005, which claims the benefit of EP Application No.
04004062.8, filed Feb. 23, 2004. These applications are
incorporated herein by reference in its their entirety.
INCORPORATION OF SEQUENCE LISTING
[0002] A sequence listing containing the file named
"SequenceListing.txt" which is 8192 bytes (measured in
MS-Windows.RTM.) and created on Aug. 2, 2013, comprises 16
nucleotide sequences, is provided herewith via the USPTO's EFS
system and is herein incorporated by reference in its entirety.
[0003] Many approaches to the generation of diversity in gene
products rely on the generation of a very large number of mutants
which are then selected using powerful selection technologies.
However, these systems have a number of disadvantages. If the
mutagenesis is done in vitro on gene constructs which are
subsequently expressed in vitro or as transgenes in cells or
animals, the gene expression in the physiological context is
difficult and the mutant repertoire is fixed in time. If
mutagenesis is on the other hand performed in living cells, it is
difficult to direct mutations to a target nucleic acid where they
are desired. Therefore the efficiency of isolating molecules with
improved activity by repeated cycles of mutations and selection
with sufficient efficiency is limited. Moreover, random mutagenesis
in vivo is toxic and likely to induce a high level of undesirable
secondary mutations.
[0004] In nature, directed diversification of a selected nucleic
acid sequence takes place in the rearranged V(D)J segments of the
immunoglobulin (Ig) gene loci. The primary repertoire of antibody
specificities is generated by a process of DNA rearrangement
involving the joining of immunoglobulin V, D, and J gene segments.
Following antigen encounter, the rearranged V(D)J segments in those
B cells, whose surface Ig can bind the antigen with low or moderate
affinity, are subjected to a second wave of diversification by
hypermutation. This so-called somatic hypermutation generates the
secondary repertoire from which increased binding specificities are
selected thereby allowing affinity maturation of the humoral immune
response (Milstein and Rada, 1995).
[0005] The mouse and man immunoglobulin loci contain large pools of
V, D and J gene segments which can participate in the V(D)J
rearrangement, so that significant diversity is created at this
stage by random combination. Other species such as chicken, rabbit,
cow, sheep and pig employ a different strategy to develop their
primary Ig repertoire (Butler, 1998). After the rearrangement of a
single functional V and J segment, further diversification of the
chicken light chain gene occurs by gene conversion in a specialized
lymphoid organ, the Bursa of Fabricius (Reynaud et al., 1987;
Arakawa and Buerstedde, in press). During this process, stretches
of sequences from non-functional pseudo-V-genes are transferred
into the rearranged V-gene. The twenty-five pseudo-V-genes are
situated upstream of the functional V-gene and share sequence
homology with the V-gene. Similar to the situation in men and mice,
affinity maturation after antigen encounter takes place by
hypermutation in the splenic germinal centers of the chicken
(Arakawa et al., 1996).
[0006] All three B cell specific activities of Ig repertoire
formation--gene conversion (Arakawa et al., 2002), hypermutation
and isotype switch recombination (Muramatsu et al., 2000; Revy et
al., 2000)--require expression of the Activation Induced Deaminase
(AID) gene. Whereas it was initially proposed that AID is a DNA
editing enzyme (Muramatsu et al., 1999), more recent studies
indicate that AID directly modifies DNA by deamination of cytosine
to uracil (Di Noia and Neuberger, 2002). However, the cytosine
deamination activity must be further regulated, because only
differences in the type, the location and the processing of the
AID-induced DNA modification can explain the selective occurrence
of recombination or hypermutation in different species and B cell
environments. Based on the finding that certain AID mutations
affect switch recombination, but not somatic hypermutation, it was
suggested that AID needs the binding of a co-factor to start switch
recombination (Ta et al., 2003; Barreto et al., 2003).
[0007] Analysis of DT40 knock-out mutants indicates that the RAD54
gene (Bezzubova et al., 1997) and other members of the RAD52
recombination repair pathway are needed for efficient Ig gene
conversion (Sale et al., 2001). Disruption of RAD51 analogues and
paralogues reduces Ig gene conversion and induces hypermutation in
the rearranged light chain gene (Sale et al., 2001) suggesting that
a defect in DNA repair by homologous recombination can shift Ig
gene conversion to hypermutation.
[0008] Recently, first cell systems have been developed which
exploit the phenomenon of somatic hypermutation in the
immunoglobulin locus to generate mutants of a target gene in
constitutive and directed manner. These cell systems allow to
prepare a gene product having a desired activity by cyclical steps
of mutation generation and selection. Thus, WO 00/22111 and WO
02/100998 describe a human Burkitt lymphoma cell line (Ramos) which
is capable of directed constitutive hypermutation of a specific
nucleic acid region. This mutated region can be the endogenous
rearranged V segment or an exogenous gene operatively linked to
control sequences which direct hypermutation. A significant
disadvantage of this cell system is that human cells cannot be
efficiently genetically manipulated by targeted integration, since
transfected constructs insert primarily at random chromosomal
positions.
[0009] WO 02/100998 also describes another cell system for
generating genetic diversity in the Ig locus which is based on the
chicken B cell line DT40. DT40 continues gene conversion of the
rearranged light chain immunoglobulin gene during cell culture
(Buerstedde et al., 1990). Importantly, this cell line has a high
ratio of targeted to random integration of transfected constructs
thus allowing efficient genetic manipulation (Buerstedde and
Takeda, 1991). According to WO 02/100998, deletion in DT40 of the
paralogues of the RAD51 gene which are involved in homologous
recombination and DNA repair led to a decrease in gene conversion
and a simultaneous activation of hypermutation of the rearranged V
segment. However, the main disadvantage of this system is that the
mutant cells have a DNA repair deficiency as reflected by X-ray
sensitivity and chromosomal instability. The mutants also have a
low proliferation rate and a low gene targeting efficiency.
Therefore this system is poorly suited for efficient gene
diversification and selection.
[0010] The present invention overcomes the disadvantages of the
prior art systems and provides further advantages as well.
SUMMARY OF THE INVENTION
[0011] In the first aspect of the invention there is provided a
genetically modified lymphoid cell having gene conversion fully or
partially replaced by hypermutation, wherein said cell has no
deleterious mutations in genes encoding paralogues and analogues of
the RAD51 gene which encode important homologous recombination
factors. Specifically, the cell contains wild-type homologous
recombination factors. Due to the intact homologous recombination
machinery, the cell according to the invention is recombination and
repair proficient and has a normal proliferation rate.
[0012] The cell of the invention is an immunoglobulin-expressing B
lymphocyte derived from animal species which use the mechanism of
gene conversion for developing their immunoglobulin repertoire.
These species are for example chicken, sheep, cow, pig and rabbit.
Preferably, the cell is derived from a chicken Bursal lymphoma.
Most preferably, the cell is derived from or related to the DT40
cell line.
[0013] In a further embodiment, the cell according to the invention
is capable of directed and selective genetic diversification of a
target nucleic acid by hypermutation or a combination of
hypermutation and gene conversion. The target nucleic acid may
encode a protein or possess a regulatory activity. Examples of
proteins are an immunoglobulin chain, a selection marker, a
DNA-binding protein, an enzyme, a receptor protein or a part
thereof. In a preferred embodiment, the target nucleic acid is the
V(D)J segment of a rearranged human immunoglobulin gene. Examples
of regulatory nucleic acids are a transcription regulatory element
or a RNAi sequence.
[0014] In an embodiment, in which the target nucleic acid is
diversified by a combination of hypermutation and gene conversion,
the cell according to the invention contains at least one sequence
capable of serving as a gene conversion donor for the target
nucleic acid.
[0015] In a further embodiment, the target nucleic acid is an
exogenous nucleic acid operably linked to control nucleic acid
sequences that direct genetic diversification.
[0016] In an additional embodiment, the target nucleic acid is
expressed in the cell according to the invention in a manner that
facilitates selection of cells which exhibit a desired activity.
The selection can be a direct selection for the activity of the
target nucleic acid within the cell, on the cell surface or outside
the cell. Alternatively, the selection can be an indirect selection
for the activity of a reporter nucleic acid.
[0017] In a further embodiment, the invention provides for genetic
means to modulate the genetic diversification of the target nucleic
acid in the cell according to the invention. The modulation can be
by modification of cis-acting regulatory sequences, by varying the
number of gene conversion donors, or by modification of
trans-acting regulatory factors such as activation-induced
deaminase (AID) or a DNA repair or recombination factor other than
a RAD51 analogue or paralogue. The cell preferably expresses
activation-induced deaminase (AID) conditionally.
[0018] In a second aspect, there is provided a cell line derived
from a cell according to the invention. In a preferred embodiment,
the cell line is DT40 or a modification thereof.
[0019] In a third aspect, there is provided a transgenic non-human
animal containing a lymphoid cell having gene conversion fully or
partially replaced by hypermutation, wherein said cell has no
deleterious mutations in genes encoding paralogues and analogues of
the RAD51 protein, and wherein said cell is capable of directed and
selective genetic diversification of a transgenic target nucleic
acid by hypermutation or a combination of hypermutation and gene
conversion. In a preferred embodiment, the animal is chicken.
[0020] In a further aspect, the invention provides a method for
preparing a cell capable of directed and selective genetic
diversification of a target nucleic acid by hypermutation or a
combination of hypermutation and gene conversion. The method
comprises (a) transfecting a lymphoid cell capable of gene
conversion with a genetic construct containing the target nucleic
acid, and (b) identifying a cell having the endogenous V-gene
segment of a part thereof replaced with the target nucleic
acid.
[0021] According to a further embodiment, the genetic construct
containing the target nucleic acid further contains at least one
nucleic acid capable of serving as a gene conversion donor for the
target nucleic acid. The locus containing the target nucleic acid
can be constructed by a single transfection or multiple rounds of
transfection with constructs containing different components of the
locus.
[0022] In the embodiment, in which selection for a cell with a
desired activity is indirect, the method of the invention further
comprises (c) transfecting the cell from step (b) with a further
genetic construct comprising a reporter gene capable of being
influenced by the target nucleic acid.
[0023] In a further embodiment, the method of the invention further
comprises (d) conditional expression of a trans-acting regulatory
factor. In a preferred embodiment, the trans-acting regulatory
factor is activation-induced deaminase (AID).
[0024] According to a particularly preferred embodiment, the target
nucleic acid is inserted into the cell by targeted integration.
[0025] In a further aspect, there is provided a method for
preparing a gene product having a desired activity, comprising the
steps of: (a) culturing cells according to the invention under
appropriate conditions to express the target nucleic acid, (b)
identifying a cell or cells within the population of cells which
expresses a mutated gene product having the desired activity; and
(c) establishing one or more clonal populations of cells from the
cell or cells identified in step (b), and selecting from said
clonal populations a cell or cells which expresses a gene product
having an improved desired activity.
[0026] In one embodiment, steps (b) and (c) are iteratively
repeated until a gene product with an optimized desired activity is
produced.
[0027] According to a further embodiment, the genetic
diversification can be switched off, for example, by
down-regulation of the expression of a trans-acting regulatory
factor, when the cell producing a gene product with an optimized
desired activity has been identified. The trans-acting regulatory
factor can be, for example, activation-induced deaminase (AID) or a
factor involved in homologous recombination or DNA repair, other
than a RAD51 paralogue or analogue.
[0028] In another embodiment, the diversification of the target
nucleic acid is further modified by target sequence optimization
such as the introduction of Ig hypermutation hotspots or an
increased GC content.
[0029] In a further aspect of the present invention, there is
provided the use of a cell capable of directed and selective
genetic diversification of a target nucleic acid by hypermutation
or a combination of hypermutation and gene conversion for the
preparation of a gene product having a desired activity.
DESCRIPTION OF THE FIGURES
[0030] FIG. 1 .psi.V gene deletion (A) A physical map of the
chicken rearranged Ig light chain locus and the .psi.V knock-out
constructs. The locus contains a total of 25 .psi.V genes upstream
of functional V segment. The knock-out strategy of .psi.V genes by
the targeted integration of the p.psi.VDel1-25 and the
p.psi.VDel3-25 constructs is shown below. Only the relevant EcoRI
sites are indicated. (B) Southern blot analysis of wild-type and
knock-out clones using the probe shown in (A) after EcoRI
digestion. The wild-type locus hybridizes as a 12-kb fragment,
whereas .psi.V.sup.partial and .psi.V.sup.- loci hybridize as a
7.4-kb and 6.3-kb fragment, respectively. (C) AID status. The AID
gene was amplified by PCR to verify the presence or absence of AID
cDNA expression cassette.
[0031] FIG. 2 sIgM expression analysis of control and .psi.V
knock-out clones (A) FACS anti-IgM staining profiles of
representative subclones derived from initially sIgM(+) clones. (B)
Average percentages of events falling into sIgM(-) gates based on
the measurement of 24 subclones.
[0032] FIG. 3 Ig light chain sequence analysis of the .psi.V
knock-out clones Mutation profiles of the AID.sup.R.psi.V.sup.-
(SEQ ID NO: 1) and AID.sup.R.psi.V.sup.partial (SEQ ID NO: 2)
clones. All nucleotide substitutions identified in different
sequences in the region from the leader sequence to the J-C intron
are mapped onto the rearranged light chain sequence present in the
AID.sup.R precursor clone. Mutations of the AID.sup.R.psi.V.sup.-
and the AID.sup.R.psi.V.sup.partial clones are shown above and
below the reference sequence, respectively. Deletions, insertions
and gene conversion events are also indicated. Hotspot motifs (RGYW
and its complement WRCY) are highlighted by bold letters.
[0033] FIG. 4 Mutation profiles of hypermutating cell lines (A)
Percentages of sequences carrying a certain number of mutations.
Each untemplated nucleotide substitution is counted, but gene
conversion, deletions and insertions involving multiple nucleotides
are counted as a single event. PM, point mutation; GC, gene
conversion; D, deletion; I, insertion. (B) Pattern of nucleotide
substitutions within sequences from .psi.V and the XRCC3 knock-out
clones. Nucleotide substitutions as part of gene conversion events
are excluded. The ratios of transition (trs) to transversion (trv)
are also shown. (C) Hotspot preference of untemplated nucleotide
substitution mutations. Mutations occurring within a hotspot motif
(RGYW or its complement WRCY) are shown by percentages. (D)
Trypan-blue positive cells as an indicator of spontaneously dying
cells.
[0034] FIG. 5 Distribution of nucleotide substitutions within
genomic sequences from unsorted AID.sup.R.psi.V.sup.- cells and
within cDNA sequences from sorted IgM (-) AID.sup.R.psi.V.sup.-
cells The number of mutations are counted for every 50 bp, and are
shown together with the corresponding physical maps of the light
chain genomic locus or the cDNA sequence.
[0035] FIG. 6 A model explaining the regulation of Ig gene
conversion and Ig hypermutation
[0036] FIG. 7 In situ mutagenesis of the GFP gene (A) Ig VJ
replacement vector. (B) in vivo mutagenesis of the GFP gene by
hypermutation. (C) .psi.V donor replacement vector. (D) in vivo
mutagenesis of GFP gene by gene conversion and hypermutation.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The present invention makes available a particularly useful
cell system for directed and selective genetic diversification of
any nucleic acid by hypermutation or a combination of hypermutation
and gene conversion. The system is based on B cell lines which
constitutively diversify the rearranged immunoglobulin V-gene in
vitro without requiring extracellular stimuli such as an
interaction with other cells or molecules or maintenance of the B
cell antigen receptor.
[0038] As used herein, "directed and selective diversification"
refers to the ability of certain cells to cause alteration of the
nucleic acid sequence of a specific region of endogenous or
transgenic nucleic acid, whereby sequences outside of these regions
are not subjected to mutation.
[0039] "Genetic diversification" refers to alteration of individual
nucleotides or stretches of nucleotides in a nucleic acid. Genetic
diversification in the cells according to the invention occurs by
hypermutation, gene conversion or a combination of hypermutation
and gene conversion.
[0040] "Hypermutation" refers to the mutation of a nucleic acid in
a cell at a rate above background. Preferably, hypermutation refers
to a rate of mutation of between 10.sup.-5 and 10.sup.-3 bp.sup.-1
generation.sup.-1. This is greatly in excess of background mutation
rates, which are of order of 10.sup.-9 to 10.sup.-10 mutations
bp.sup.-1 generation.sup.-1 (Drake et al. 1988) and of spontaneous
mutations observed in PCR. Thirty cycles of amplification with Pfu
polymerase would produce <0.05.times.10.sup.-3 mutations
bp.sup.-1 in the product, which in the present case would account
for less than 1 in 100 of the observed mutations (Lundberg et al.,
1991).
[0041] "Gene conversion" refers to a phenomenon in which sequence
information is transferred in unidirectional manner from one
homologous allele to the other. Gene conversion may be the result
of a DNA polymerase switching templates and copying from a
homologous sequence, or the result of mismatch repair (nucleotides
being removed from one strand and replaced by repair synthesis
using the other strand) after the formation of a heteroduplex.
[0042] Hypermutation and gene conversion generate natural diversity
within the immunoglobulin V(D)J segment of B cells. Hypermutation
takes place in the germinal centers of such species as mouse and
human following antigen stimulation. Gene conversion takes place in
primary lymphoid organs like the Bursa of Fabricius or the
gut-associated lymphoid tissue in such species as chicken, cow,
rabbit, sheep and pig independent of antigen stimulation. In
chicken, stretches from the upstream pseudo-V-genes are transferred
into the rearranged V(D)J segment. According to the present
invention, therefore, the cell or cell line is preferably an
immunoglobulin-producing cell or cell line which is capable of
diversifying its rearranged immunoglobulin genes.
[0043] A direct connection between the initiation of hypermutation
and gene conversion is for the first time established in the
experiments reported herein. Specifically, partial or complete
deletion of pseudo-V-genes in a cell line which continues gene
conversion in cell culture leads to the activation of hypermutation
in the immunoglobulin locus. Deletion of all pseudogenes results in
the abolishment of gene conversion and simultaneous activation of
high rates of hypermutation, whereas deletion of a few pseudogenes
results in the down-regulation of gene conversion and simultaneous
activation of hypermutation at rates lower than the ones observed
for the complete pseudogene deletion. Therefore, the number of
available pseudogene donors directly correlates with gene
conversion rates and inversely correlates with hypermutation rates.
Gene conversion and hypermutation are established to be in a
reciprocal relationship to each other. Thus, the present invention
for the first time provides a cell system which allows to
genetically diversify a target nucleic acid by a combination of
hypermutation and gene conversion, whereby the contribution of
these two phenomena can be regulated by changing the number of the
gene conversion donors, their orientation or their degree or length
of homology.
[0044] An advantage of the cell system according to the invention
over a cell system with only hypermutating activity such as the one
based on the human Burkitt lymphoma cell line Ramos (WO 00/22111
and WO 02/100998) is the ability to combine genetic diversification
by hypermutation and gene conversion in one cell. For example, more
defined changes can be introduced into the target gene by gene
conversion than by random hypermutation, since gene conversion
donors can be engineered to contain sequences likely to influence
the target nucleic acid activity in a favorable way. Gene
conversion and hypermutation might thus increase the chance to
produce desirable variants, since pre-tested sequence blocks are
combined with random hypermutations. Pseudogenes with sequences
identical to a certain region of the target gene can also be used
to keep a part of the target nucleic acid stable by frequent
conversions having the effect that the hypermutations persist only
in the non-converting part. This approach is useful when the target
nucleic acid contains region which should remain stable for optimal
activity.
[0045] An advantage of the cell system according to the invention
over a cell system based on the suppression of homologous
recombination activity in gene conversion active cells (WO
02/100998) is genetic stability of the cell reflected in a normal
proliferation rate, radiation resistance and DNA repair
competence.
[0046] A particular advantage of the present cell system over all
known systems is the ability of the cells according to the
invention to integrate transfected nucleic acid constructs by
targeted integration into the homologous endogenous locus.
[0047] "Targeted integration" is integration of a transfected
nucleic acid construct comprising a nucleic acid sequence
homologous to an endogenous nucleic acid sequence by homologous
recombination into the endogenous locus. Targeted integration
allows to directly insert any nucleic acid into a defined
chromosomal position. In a preferred embodiment, a nucleic acid
encoding a gene product of interest is inserted by targeted
integration into the immunoglobulin locus in place of the
rearranged V(D)J segment or a portion thereof.
[0048] In a preferred embodiment, the cells according to the
invention are derived or related to cells which undergo Ig gene
conversion in vivo. Cells which undergo Ig gene conversion in vivo
are, for example, surface Ig expressing B cells in primary lymphoid
organs such as avian Bursal B cells. Lymphoma cells, derived from B
cells of primary lymphoid organs, are particularly good candidates
for constructing cells and cell lines according to the present
invention. In the most preferred embodiment, the cells are derived
from a chicken Bursal lymphoma cell line DT40.
[0049] The process of constitutive genetic diversification by
hypermutation and gene conversion is used in the present invention
to produce gene products with a desired, novel or improved,
activity.
[0050] A "target nucleic acid" is a nucleic acid sequence or
chromosomal region in the cell according to the present invention
which is subjected to direct and selective genetic diversification.
The target nucleic acid can be either endogenous or transgenic and
may comprise one or more transcription units encoding gene
products.
[0051] As used herein, a "transgene" is a nucleic acid molecule
which is inserted into a cell, such as by transfection or
transduction. For example, a transgene may comprise a heterologous
transcription unit which may be inserted into the genome of a cell
at a desired location.
[0052] In one embodiment, transgenes are immunoglobulin V-genes as
found in immunoglobulin-producing cells or fragments of V-genes.
Preferably, the target nucleic acid is a human immunoglobulin
V-gene. In this case, the cells according to the invention are
"factories" of human antibody variants capable of binding to any
given antigen.
[0053] Alternatively, the target nucleic acid is a
non-immunoglobulin nucleic acid, for example a gene encoding
selection markers, DNA-binding proteins, enzymes or receptor
proteins. For example, a novel fluorescent selection marker can be
produced by mutating a known marker by hypermutation or by a
combination of hypermutation and gene conversion with help of other
known markers with a different fluorescent spectrum serving as gene
conversion donors.
[0054] In one embodiment of the invention, the target nucleic acid
directly encodes a gene product of interest. Gene diversification
of such a nucleic acid will result in a truncation of the encoded
gene product or in a change of its primary sequence. With every
round of diversification and selection, a cell expressing the gene
product with an improved activity is search for.
[0055] Alternatively, the target nucleic acid is a regulatory
element, for example, a transcription regulatory element such as
promoter or enhancer, or interfering RNA (RNAi). In this
embodiment, an additional nucleic acid (reporter gene) which is
influenced by the target nucleic acid and encodes an identifiable
gene product is required to identify cells bearing the target
nucleic acid of interest.
[0056] In the embodiment, in which genetic diversification of the
target nucleic acid takes place by a combination of hypermutation
and gene conversion, additional nucleic acids capable of serving as
gene conversion donors are inserted into the cell genome,
preferably upstream of the target nucleic acid.
[0057] A "nucleic acids capable of serving as a gene conversion
donor" is a nucleic acid having a sequence homologous to the target
nucleic acid. Examples of natural gene conversion donors are
pseudo-V-genes in the immunoglobulin locus of certain species.
[0058] According to one embodiment of the invention, a cell capable
of directed and selective diversification of the target nucleic
acid is constructed by inserting the target nucleic acid into the
host cell by targeted integration at a defined chromosomal site.
For this purpose, the transfected constructs may contain upstream
and downstream of the target nucleic acid sequences homologous to
the desired chromosomal integration site. Preferably, the cell is
constructed by replacing the endogenous V-gene or segments thereof
with a transgene by homologous recombination, or by gene targeting,
such that the transgene becomes a target for the gene conversion
and/or hypermutation events.
[0059] In another embodiment, transgenes according to the invention
also comprise sequences which direct hypermutation and/or gene
conversion. Thus, an entire locus capable of expressing a gene
product and directing hypermutation and gene conversion to this
transcription unit is transferred into the cells and is actively
diversified even after random chromosomal integration.
[0060] Screening of clones having incorporated the transgene by
targeted integration can be done by Southern blot analysis or by
PCR.
[0061] In a preferred embodiment, transgenes according to the
invention contain a selectable marker gene which allows selection
of clones which have stablely integrated the transgene. This
selectable marker gene may subsequently be removed by recombination
or inactivated by other means.
[0062] The present invention further provides a method for
preparing a gene product having a desired activity by repeated
rounds of cell expansion and selection for cells bearing a target
nucleic acid with a desired activity. As used herein, "selection"
refers to the determination of the presence of sequence alterations
in the target nucleic acid which result in a desired activity of
the gene product encoded by the target nucleic acid or in a desired
activity of the regulatory function of the target nucleic acid.
[0063] The process of gene conversion and hypermutation is employed
in vivo to generate improved or novel binding specificities in
immunoglobulin molecules. Thus, by selecting cells according to the
invention which produce immunoglobulins capable of binding to the
desired antigen and then propagating these cells in order to allow
the generation of further mutants, cells which express
immunoglobulins having improved binding to the desired antigen may
be isolated.
[0064] A variety of selection procedures may be applied for the
isolation of mutants having a desired specificity. These include
Fluorescence Activated Cell Sorting (FACS), cell separation using
magnetic particles, antigen chromatography methods and other cell
separation techniques such as use of polystyrene beads.
[0065] Fluorescence Activated Cell Sorting (FACS) can be used to
isolate cells on the basis of their differing surface molecules,
for example surface displayed immunoglobulins. Cells in the sample
or population to be sorted are stained with specific fluorescent
reagents which bind to the cell surface molecules. These reagents
would be the antigen(s) of interest linked (either directly or
indirectly) to fluorescent markers such as fluorescein, Texas Red,
malachite green, green fluorescent protein (GFP), or any other
fluorophore known to those skilled in the art. The cell population
is then introduced into the vibrating flow chamber of the FACS
machine. The cell stream passing out of the chamber is encased in a
sheath of buffer fluid such as PBS (Phosphate Buffered Saline). The
stream is illuminated by laser light and each cell is measured for
fluorescence, indicating binding of the fluorescent labeled
antigen. The vibration in the cell stream causes it to break up
into droplets, which carry a small electrical charge. These
droplets can be steered by electric deflection plates under
computer control to collect different cell populations according to
their affinity for the fluorescent labeled antigen. In this manner,
cell populations which exhibit different affinities for the
antigen(s) of interest can be easily separated from those cells
which do not bind the antigen. FACS machines and reagents for use
in FACS are widely available from sources world-wide such as
Becton-Dickinson, or from service providers such as Arizona
Research Laboratories.
[0066] Another method which can be used to separate populations of
cells according to the affinity of their cell surface protein(s)
for a particular antigen is affinity chromatography. In this
method, a suitable resin (for example CL-600 Sepharose, Pharmacia
Inc.) is covalently linked to the appropriate antigen. This resin
is packed into a column, and the mixed population of cells is
passed over the column. After a suitable period of incubation (for
example 20 minutes), unbound cells are washed away using (for
example) PBS buffer. This leaves only that subset of cells
expressing immunoglobulins which bound the antigen(s) of interest,
and these cells are then eluted from the column using (for example)
an excess of the antigen of interest, or by enzymatically or
chemically cleaving the antigen from the resin. This may be done
using a specific protease such as factor X, thrombin, or other
specific protease known to those skilled in the art to cleave the
antigen from the column via an appropriate cleavage site which has
previously been incorporated into the antigen-resin complex.
Alternatively, a non-specific protease, for example trypsin, may be
employed to remove the antigen from the resin, thereby releasing
that population of cells which exhibited affinity for the antigen
of interest.
[0067] The present invention provided for the first time a
mechanism which allows to regulate genetic diversification of the
target nucleic acid. As demonstrated by the present inventors,
activation-induced deaminase (AID) is a factor which regulates gene
conversion as well as hypermutation in the immunoglobulin locus. It
is suggested that AID induces a common modification in the
rearranged V(D)J segment leading to a conversion tract in the
presence of adjacent donor sequences and to a point mutation in
their absence. Therefore, by regulation of AID expression, both
phenomena can be modulated. In a preferred embodiment, the AID gene
is transiently expressed in the cell containing a target nucleic
acid. For example, AID can be expressed under a drug-responsive
promoter such as the tetracycline responsible gene expression
system. Otherwise the gene expression may be shut down by the
excision of the AID expression cassette by induced recombination.
Switching off the AID expression will prevent further
diversification of the target sequence. Preferably, AID expression
is switched off in the cell producing a gene product with a desired
activity in order to prevent further mutations which can lead to
the loss of the desired activity.
[0068] The invention is illustrated by the following examples.
EXAMPLES
1. AID Initiates Immunoglobulin Gene Conversion and Hypermutation
by a Common Intermediate
[0069] Herein it is reported that ablation of .psi.V donors
activates AID-dependent Ig hypermutation in chicken B cell line
DT40. This shows that Ig gene conversion and hypermutation are
competing pathways derived from the same AID-initiated
intermediate. Furthermore .psi.V knock-out DT40 is proposed as an
ideal model system to approach the molecular mechanism of Ig
hypermutation and as a new tool for in situ mutagenesis.
Methods
[0070] Cell Lines.
[0071] DT40.sup.Cre1 which displays increased Ig gene conversion
due to a v-myb transgene and contains a tamoxifen inducible Cre
recombinase has been described previously (Arakawa et al., 2001).
DT40.sup.Cre1 AID.sup.-/- was generated by the targeted disruption
of both AID alleles of DT40.sup.Cre1 (Arakawa et al., 2002).
AID.sup.R was derived from DT40.sup.Cre1 AID.sup.-/- after stable
integration of a floxed AID-IRES-GFP bicistronic cassette, in which
both AID and GFP are expressed from the same .beta.-actin promoter.
AID.sup.R.psi.V.sup.- was derived from AID.sup.R by transfection of
p.psi.VDel1-25 (FIG. 1A). Stable transfectants which had integrated
the construct into the rearranged light chain locus were then
identified by locus specific PCR. Targeted integration of
p.psi.VDel1-25 results in the deletion of the entire .psi.V gene
loci starting 0.4 kb upstream of .psi.V25 and ending one by
downstream of .psi.V1. AID.sup.R.psi.V.sup.partial was produced in
a similar way as AID.sup.R.psi.V.sup.- by transfection of
p.psi.VDel3-25 which upon targeted integration leads to a partial
deletion of the .psi.V loci starting 0.4 kb upstream of .psi.V25
and ending one by downstream of .psi.V3. Cell culture and
electroporation were performed as previously described (Arakawa et
al., 2002). XRCC3.sup.-/- was derived from DT40.sup.Cre1 by
deleting amino acids 72-170 of XRCC3 gene following transfection of
XRCC3 knock-out constructs. Clones having undergone targeted
integration were initially identified by long-range PCR and the
XRCC3 deletion was then confirmed by Southern blot analysis.
[0072] Ig Reversion Assay.
[0073] Subcloning, antibody staining, flow cytometry and
quantification of sIgM expression has been described previously
(Arakawa et al., 2002). All clones used in the study were sIgM(+)
due to the repair of the light chain frameshift of the original
C118(-) variant (Buerstedde et al., 1990) by a gene conversion
event.
[0074] PCR.
[0075] To minimize PCR-introduced artificial mutations, PfuUltra
hotstart polymerase (Stratagene) was used for amplification prior
to sequencing. Long-range PCR, RT-PCR and Ig light chain sequencing
were performed as previously described (Arakawa et al., 2002). The
promoter and J-C intron region of Ig light chain plasmid clones
were sequenced using the M13 forward and reverse primers. Bu-1 and
EF1.alpha. genes were amplified using BU1/BU2 (BU1,
GGGAAGCTTGATCATTTCCTGAATGCTATATTCA (SEQ ID NO: 13); BU2,
GGGTCTAGAAACTCCTAGGGGAAACTTTGCTGAG (SEQ ID NO: 14)) and EF6/EF8
(EF6, GGGAAGCTTCGGAAGAAAGAAGCTAAAGACCATC (SEQ ID NO: 15); EF8,
GGGGCTAGCAGAAGAGCGTGCTCACGGGTCTGCC (SEQ ID NO: 16)) primer pairs,
respectively. The PCR products of these genes were cloned into the
pBluescript plasmid vector, and were sequenced using the M13
reverse primer.
Results
Targeted Deletion of .psi.V Donor Sequences in the Rearranged Light
Chain Locus
[0076] Two .psi.V knock-out constructs were made by cloning genomic
sequences, which flank the intended deletion end points, upstream
and downstream of a floxed-gpt (guanine phosphoribosyl transferase)
cassette (Arakawa et al., 2001). Upon targeted integration, the
first construct, .psi.V Del1-25, deletes all pseudogenes (.psi.V25
to .psi.V1) whereas the second construct, .psi.VDel3-25, deletes
most pseudogenes (.psi.V25 to .psi.V3) (FIG. 1A). A surface IgM
positive (sIgM(+)) clone, derived from DT40.sup.Cre1 AID.sup.-/-
cells (Arakawa et al., 2002) by transfection and stable integration
of a floxed AID-IRES (internal ribosome entry site)-GFP transgene,
was chosen for the transfection of the .psi.V knock-out constructs.
This AID reconstituted clone, named AID.sup.R, has the advantage
that the appearance of deleterious Ig light chain mutations can be
easily detected by the loss of sIgM expression and that GFP-marked
AID expression can be shut down after tamoxifen induction of the
Cre recombinase transgene inherited from DT40.sup.Cre1 (Arakawa et
al., 2002).
[0077] Following transfection of the .psi.V knock-out constructs
into the AID.sup.R clone, mycophenolic acid resistant clones
containing targeted deletions of the rearranged light chain locus
were identified. These primary .psi.V knock-out clones contain two
floxed transgenes, the inserted gpt marker gene in the rearranged
light chain locus and the AID-IRES-GFP gene of the AID.sup.R
progenitor clone. Since the gpt gene might perturb the adjacent
transcription or chromatin configuration, the primary .psi.V
knock-outs were exposed to a low concentration of tamoxifen and
then subcloned by limited dilution. In this way, secondary .psi.V
knock-out clones could be isolated which had either deleted only
the gpt gene (AID.sup.R.psi.V.sup.- and
AID.sup.R.psi.V.sup.partial) or the gpt gene together with the
AID-IRES-GFP gene (AID.sup.-/-.psi.V.sup.- and
AID.sup.-/-.psi.V.sup.partial). The disruption of .psi.V genes in
the rearranged light chain locus and the excision of AID
over-expression cassette were confirmed by Southern blot analysis
(FIG. 1B) and PCR (FIG. 1C), respectively.
Increased Loss of sIgM Expression after Deletion of .psi.V Genes in
AID Positive Clones
[0078] To estimate the rates of deleterious Ig mutations, sIg
expression was measured by FACS after two weeks culture for 24
subclones each of the DT40.sup.Cre1, AID.sup.R, DT40.sup.Cre1
AID.sup.-/- and .psi.V knock-out clones (FIGS. 2A and 2B). Analysis
of the controls with the intact .psi.V locus revealed an average of
0.52% and 2.27% sIgM(-) cells for the DT40.sup.Cre1 and AID.sup.R
subclones respectively, but only 0.08% for the DT40.sup.Cre1
AID.sup.-/-. Previous analysis of spontaneously arising sIgM(-)
DT40 variants demonstrated that about a third contained frameshift
mutations in the rearranged light chain V segment which were
regarded as byproducts of the Ig gene conversion activity
(Buerstedde et al., 1990). This view is now supported by the
finding that the AID negative DT40.sup.Cre1 AID.sup.-/- clone,
which should have lost the Ig gene conversion activity, stably
remains sIgM(+). Most interestingly, subclones of the AID positive
.psi.V knock-out clones (AID.sup.R.psi.V.sup.partial and
AID.sup.R.psi.V.sup.-) rapidly accumulate sIgM(-) populations
whereas subclones of the AID negative .psi.V knock-out clones
(AID.sup.-/-.psi.V.sup.partial and AID.sup.-/-.psi.V.sup.-) remain
sIgM(+) (FIGS. 2A and 2B). This suggests that the deletion of the
pseudogenes dramatically increases the rate of deleterious light
chain mutations in AID expressing cells.
Replacement of Ig Gene Conversion by Hypermutation in the Absence
of .psi.V Donors
[0079] To analyze the newly identified mutation activity, the
rearranged light chain VJ segments of the .psi.V knock-out clones
were sequenced 5-6 weeks after subcloning. A total of 135
nucleotide changes (FIG. 4A, Table 1) were found in the 0.5 kb
region between the V leader and the 5' end of the J-C intron within
95 sequences from the AID.sup.R.psi.V.sup.- clone (FIG. 3, above
reference sequence). In contrast to the conversion tracts seen in
wild-type DT40 cells, almost all changes are single base
substitutions and apart from a few short deletions and
di-nucleotide changes, mutation clusters were not observed. The
lack of conversion events in AID.sup.R.psi.V.sup.-, which still
contains the .psi.V genes of the unrearranged light chain locus,
confirms that Ig gene conversion only recruits the .psi.V genes on
the same chromosome for the diversification of the rearranged light
chain gene (Carlson et al., 1990). No sequence diversity was found
in a collection of 95 light chain gene sequences from the
AID.sup.-/-.psi.V.sup.- clone (FIG. 4A, Table 1), indicating that
AID is required for the mutation activity.
[0080] Sequences derived from the AID.sup.R.psi.V.sup.partial clone
occasionally display stretches of mutations which can be accounted
for by the remaining .psi.V1 and .psi.V2 (FIG. 3, below reference
sequence). Nevertheless, the majority of
AID.sup.R.psi.V.sup.partial mutations are single untemplated base
substitutions as seen with the AID.sup.R.psi.V.sup.- cells (FIG.
4A, Table 1). Only 3 base substitutions, which possibly are PCR
artifacts, were found in 92 sequences of the
AID.sup.-/-.psi.V.sup.partial clone confirming that both the gene
conversion and the mutation activities of
AID.sup.R.psi.V.sup.partial are AID dependent.
The New Mutation Activity of the .psi.V Knock-Out Clones Closely
Resembles Somatic Hypermutation
[0081] The discovered Ig mutation activity in the .psi.V knock-out
clones with a predominance of single nucleotide substitutions
suggests that somatic hypermutation had replaced Ig gene
conversion. There is however a difference between the nucleotide
substitutions in the AID.sup.R.psi.V.sup.partial and
AID.sup.R.psi.V.sup.- clones and Ig hypermutations in germinal
center B cells in that the clones show very few mutations in A/T
bases and a preference for transversion mutations (FIG. 4B).
[0082] Ig hypermutations are typically localized within one kb of
the transcribed gene sequence with preferences for the
Complementary Determining Regions (CDRs) of the V(D)J segments,
whereas no or few mutations are present in the downstream C region
(Lebecque and Gearhart, 1990). To investigate whether the mutations
in the AID.sup.R.psi.V.sup.- clone follow a similar distribution,
sequence analysis was extended to the promoter region and the J-C
intron of the rearranged light chain gene (FIG. 5). Although
mutations are found close to the promoter and in the intron
downstream of the J segments, the peak incidence clearly coincides
with the CDR1 and CDR3, which are also preferred sites of gene
conversion in DT40 (unpublished results). Approximately half of all
point mutations fall within the RGYW (R=A/G; Y=C/T; W=A/T) sequence
motif or its complement WRCY (FIG. 4C), known as hot spots of Ig
hypermutation in humans and mice.
[0083] It was previously reported that the deletion of RAD51
paralogues induces Ig hypermutation in DT40 (Sale et al., 2001). To
compare the hypermutation activity in the .psi.V gene negative and
RAD51 paralogue negative backgrounds, the XRCC3 gene was disrupted
in the DT40.sup.Cre1 clone and the rearranged VJ genes were
sequenced 6 weeks after subcloning. Similar to the mutation
spectrum in the AID.sup.R.psi.V.sup.- clone and what was previously
reported (Sale et al., 2001), the mutations in the sequences from
the XRCC3.sup.-/- cells show a transversion preference and an
absence of mutations in A/T bases (FIG. 4B). Nevertheless the
mutation rate in the XRCC3 mutant was about 2.5 fold lower than in
the AID.sup.R.psi.V.sup.- clone and there was a clear slow growth
phenotype of the XRCC3 mutant compared to wild-type DT40 and the
AID.sup.R.psi.V.sup.- clone (FIG. 4D).
[0084] To identify the mutations responsible for the loss of sIgM
expression in the AID.sup.R.psi.V.sup.- clone, 94 light chain cDNAs
from sorted sIgM(-) cells were amplified and sequenced. Although
one short insertion and five deletions were detected in this
collection (Table 1), 89% of the 245 total mutations are single
nucleotide substitutions within the VJ segments (FIG. 5).
Surprisingly, only about 10% of the sequences contained a stop
codon or a frameshift, suggesting that the lack of sIgM(-)
expression is mainly caused by amino acid substitutions which
affect the pairing of the Ig light and heavy chain proteins.
Ig Locus Specificity of Hypermutation
[0085] It has been reported that high AID expression in fibroblasts
(Yoshikawa et al., 2002) and B cell hybridomas (Martin and Scharff,
2002) leads to frequent mutations in transfected transgenes. To
rule out that the pseudogene deletions had induced a global
hypermutator phenotype, the 5' ends of the genes encoding the B
cell specific marker Bu-1 and the translation elongation factor
EF1.alpha. were sequenced for the AID.sup.R.psi.V.sup.- clone. Only
a single one by deletion was found within 95 sequences of the Bu-1
gene and only two single nucleotide substitutions within 89
sequences of EF1.alpha. (Table 1). As these changes most likely
represent PCR artifacts, this further supports the view that the
hypermutations induced by the .psi.V deletions are Ig locus
specific.
Discussion
[0086] The results demonstrate that the deletion of the nearby
pseudogene donors abolishes Ig gene conversion in DT40 and
activates a mutation activity which closely resembles Ig
hypermutation. The features shared between the new activity and
somatic hypermutation include 1) AID dependence, 2) a predominance
of single nucleotide substitutions, 3) distribution of the
mutations within the 5' transcribed region, 4) a preference for
hotspots and 5) Ig gene specificity. The only difference with
regard to Ig hypermutation in vivo is the relative lack of
mutations in A/T bases and a predominance of transversion mutations
in the .psi.V knock-out clones. However, this difference is also
seen in hypermutating EBV transformed B cell lines (Bachl and Wabl,
1996; Faili et al., 2002) and DT40 mutants of RAD51-paralogues
(Sale et al., 2001) indicating that part of the Ig hypermutator
activity is missing in transformed B cell lines. Interestingly, the
rate of Ig hypermutation in the AID.sup.R.psi.V.sup.- clone seems
higher than the rate of Ig gene conversion in the DT40.sup.Cre1
progenitor. An explanation for this could be that some conversion
tracts are limited to stretches of identical donor and target
sequences and thus leave no trace.
[0087] The induction of Ig hypermutation by the blockage of Ig gene
conversions supports a simple model explaining how hypermutation
and recombination is initiated and regulated (FIG. 6). At the top
of the events is a modification of the rearranged V(D)J segment
which is either directly or indirectly induced by AID. The default
processing of this lesion in the absence of nearby donors or in the
absence of high homologous recombination activity leads to Ig
hypermutation in form of a single nucleotide substitution (FIG. 6,
right side). However, if donor sequences are available, processing
of the AID induced lesion can be divided into a stage before strand
exchange, when a shift to Ig hypermutation is still possible and a
stage after strand exchange when the commitment toward Ig gene
conversion has been made (FIG. 6, left side). Whereas completion of
the first stage requires the participation of the RAD51 paralogues,
the second stage involves other recombination factors like the
RAD54 protein.
[0088] This difference in commitment explains why disruptions of
the RAD51 paralogues not only decrease Ig gene conversion, but also
induce Ig hypermutation (Sale et al., 2001) whereas disruption of
the RAD54 gene only decreases Ig gene conversion (Bezzubova et al.,
1997). The model also predicts that low cellular homologous
recombination activity prevents Ig gene conversion even in the
presence of conversion donors. Such a low homologous recombination
activity might be the reason why human and murine B cells never use
Ig gene conversion despite the presence of nearby candidate donors
in form of unrearranged V segments and why chicken germinal center
B cells shave shifted from Ig gene conversion to Ig hypermutation
(Arakawa et al., 1998).
[0089] The AID.sup.R and the .psi.V knock-out DT40 clones are a
powerful experimental system to address the role of trans-acting
factors and cis-acting regulatory sequences for Ig gene conversion
and hypermutation. Compared to alternative animal or cell culture
systems it offers the advantages of: 1) parallel analysis of Ig
gene conversion and Ig hypermutation, 2) conditional AID
expression, 3) easy genome modifications by gene targeting, 4)
normal cell proliferation and repair proficiency and 5) Ig locus
specificity of hypermutation. The ability to induce gene specific
hypermutation in the DT40 cell line might also find applications in
biotechnology. One possibility is to replace the chicken antibody
coding regions by their human counterparts and then to simulate
antibody affinity maturation from a repertoire which continuously
evolves by Ig hypermutation.
2. Targeted In Vivo Mutagenesis of GFP by Gene Conversion and
Hypermutation
[0090] The gene encoding Green Fluorescent Protein (GFP) is an
example of a target nucleic acid which can be genetically
diversified using the cell system of the invention, in particular
the DT40 cell line. The GFP gene inserted into the Ig light chain
locus by targeted integration will be subjected to hypermutation
and its activity with respect to color, intensity and half-life
will evolve with time (FIG. 7B). If a combination of hypermutation
and gene conversion is used to modify the GFP activities, variant
GFP sequences which can serve as gene conversion donors for GFP are
also inserted into the Ig locus (FIG. 7D).
[0091] An Ig VJ replacement vector, pVjRepBsr, which allows to
replace the Ig light chain VJ gene by any nucleic acid target is
depicted in FIG. 7A. A potential target for mutagenesis can be
cloned into SpeI site, which is compatible with XbaI, NheI, AvrII
and SpeI sites. For example, the GFP gene can be inserted into the
Ig light chain locus by targeted integration using pVjRepBsr. A
.psi.V-gene donor replacement vector, pPseudoRepBsr, which allows
to replace the Ig .psi.V gene light chain locus by any nucleic acid
target is depicted in FIG. 7C. Potential gene conversion donors can
be cloned into either NheI or SpeI site, which is compatible with
XbaI, NheI, AvrII and SpeI sites. Because NheI site is located
between two loxPs, this site can be used for conditional knockout
design. By stepwise targeted integration using pPseudoRepGpt and
pVjRepBsr, .psi.V genes can be replaced by .psi.GFP gene and its
variants (e.g. .psi.CFP: cyano fluorescence protein and .psi.YFP:
yellow fluorescence protein) and the VJ gene can be replaced by GFP
carrying a frameshift mutation (FsGFP) to monitor genetic
diversification of the GFP gene. The frameshift in FsGFP is
expected to be repaired by gene conversion of .psi.GFP, .psi.CFP
and .psi.YFP as templates. In addition, the gene will be further
diversified by hypermutation.
REFERENCES
[0092] 1. Milstein, C. & Rada C. Immunoglobulin genes (Academic
Press, London, ed. 2, 1995), pp. 57-81. [0093] 2. Butler, J. E.
Immunoglobulin diversity, B-cell and antibody repertoire
development in large farm animals. Rev. Sci. Tech. 17, 43-70
(1998). [0094] 3. Reynaud, C-A., Anquez, V., Grimal, H. &
Weill, J-C. A hyperconversion mechanism generates the chicken light
chain preimmune repertoire. Cell 48, 379-388 (1987). [0095] 4.
Arakawa, H. & Buerstedde, J-M. Immunoglobulin Gene Conversion:
Insights from Bursal B Cells and the DT40 Cell Line. Dev. Dynamics,
in press. [0096] 5. Arakawa, H., Furusawa, S., Ekino, S. &
Yamagishi, H. Immunoglobulin gene hyperconversion ongoing in
chicken splenic germinal centers. EMBO J. 15, 2540-2546 (1996).
[0097] 6. Arakawa, H., Hauschild, J. & Buerstedde, J-M.
Requirement of the Activation-Induced Deaminase (AID) Gene for
Immunoglobulin Gene Conversion. Science 295, 1301-1306 (2002).
[0098] 7. Muramatsu, M. et al. Class switch recombination and
hypermutation require activation-induced cytidine deaminase (AID),
a potential RNA editing enzyme. Cell 102, 553-563 (2000). [0099] 8.
Revy, P. et al. Activation-induced cytidine deaminase (AID)
deficiency causes the autosomal recessive form of the Hyper-IgM
syndrome. Cell 102, 565-575 (2000). [0100] 9. Muramatsu, M. et al.
Specific expression of activation-induced cytidine deaminase (AID),
a novel member of the RNA-editing deaminase family in germinal
center B cells. J. Biol. Chem. 274, 18470-18476 (1999). [0101] 10.
Di Noia, J. & Neuberger, M. S. Altering the pathway of
immunoglobulin hypermutation by inhibiting uracil-DNA glycosylase.
Nature 419, 43-48 (2002). [0102] 11. Ta V. T. et al. AID mutant
analyses indicate requirement for class-switch-specific cofactors.
Nat. Immunol. 4, 843-848 (2003). [0103] 12. Barreto, V.,
Reina-San-Martin, B., Ramiro, A. R., McBride, K. M. &
Nussenzweig M. C. C-terminal deletion of AID uncouples class switch
recombination from somatic hypermutation and gene conversion. Mol.
Cell 12, 501-508 (2003). [0104] 13. Bezzubova, O., Silbergleit, A.,
Yamaguchi-Iwai, Y., Takeda, S. & Buerstedde, J-M. Reduced X-ray
resistance and homologous recombination frequencies in a RAD54-/-
mutant of the chicken DT40 cell line. Cell 89, 185-193 (1997).
[0105] 14. Sale, J. E., Calandrini, D. M., Takata, M., Takeda, S.
& Neuberger, M. S. Ablation of XRCC2/3 transforms
immunoglobulin V gene conversion into somatic hypermutation. Nature
412, 921-926 (2001). [0106] 15. Arakawa, H., Lodygin D. &
Buerstedde J-M. Mutant loxP vectors for selectable marker recycle
and conditional knock-outs. BMC Biotechnology 1, 7 (2001). [0107]
16. Buerstedde, J-M. et al. Light chain gene conversion continues
at high rate in an ALV-induced cell line. EMBO J. 9, 921-927
(1990). [0108] 17. Carlson, L. M., McCormack, W. T., Postema, C.
E., Humphries, E. H. & Thompson, C. B. Templated insertions in
the rearranged chicken IgL V gene segment arise by intrachromosomal
gene conversion. Genes Dev. 4, 536-547 (1990). [0109] 18. Lebecque,
S. G. & Gearhart, P. J. Boundaries of somatic mutation in
rearranged immunoglobulin genes: 5' boundary is near the promoter,
and 3' boundary is approximately 1 kb from V(D)J gene. J. Exp. Med.
172, 1717-1727 (1990). [0110] 19. Yoshikawa, K. et al. AID
enzyme-induced hypermutation in an actively transcribed gene in
fibroblasts. Science 296, 2033-2036 (2002). [0111] 20. Martin, A.
& Scharff, M. D. Somatic hypermutation of the AID transgene in
B and non-B cells. Proc. Natl. Acad. Sci. USA 99, 12304-12308
(2002). [0112] 21. Bachl, J. & Wabl, M. An immunoglobulin
mutator that targets G.C base pairs. Proc. Natl. Acad. Sci. USA 93,
851-855 (1996). [0113] 22. Faili, A. et al. AID-dependent somatic
hypermutation occurs as a DNA single-strand event in the BL2 cell
line. Nat. Immunol. 3, 815-821 (2002). [0114] 23. Arakawa, et al.
Oligoclonal development of B cells bearing discrete Ig chains in
chicken single germinal centers. J. Immunol. 160, 4232-4241 (1998).
[0115] 24. Drake, J. W. Genetics 148, 1667-1686 (1998). [0116] 25.
Lundberg, K. S. et al. Gene 108, 1-6 (1991). [0117] 26. Buerstedde,
J. M. & Takeda, S. Increased ratio of targeted to random
integration after transfection of chicken B cell lines. Cell
October 4, 67(1):179-88 (1991).
Sequence CWU 1
1
161476DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 1tccctggtgc aggcagcgct gactcagccg
gcctcggtgt cagcaaaccc aggagaaacc 60gtcaagatca cctgctccgg gggtggcagc
tatgctggaa gttactatta tggctggtac 120cagcagaagt ctcctggcag
tgcccctgtc actgtgatct atgacaacga caagagaccc 180tcggacatcc
cttcacgatt ctccggttcc aaatccggct ccacagccac attaaccatc
240actggggtcc gagccgatga cgaggctgtc tatttctgtg ggagctacga
agacaacagt 300ggtgctgcat ttggggccgg gacaaccctg accgtcctag
gtgagtcgct gacctcgtct 360cggtctttct tcccccatcg tgaaattgtg
acattttgtc gatttttggt gatttggggg 420tttttcttgg acttggcggc
aggctggggt ctgccaccgg cgcagggccg ggcact 4762476DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
2tccctggtgc aggcagcgct gactcagccg gcctcggtgt cagcaaaccc aggagaaacc
60gtcaagatca cctgctccgg gggtggcagc tatgttggaa gttactatta tggctggtac
120cagcagaagt ctcctggcag tgcccctgtc actgtgatct atgacaacga
caagagaccc 180tcggacatcc cttcacgatt ctccggttcc aaatccggct
ccacagccac attaaccatc 240actggggtcc gagccgatga cgaggctgtc
tatttctgtg ggagcactgc agacaacagt 300ggtgctgcat ttggggccgg
gacaaccctg accgtcctag gtgagtcgct gacctcgtct 360cggtctttct
tcccccatcg tgaaattgtg acattttgtc gatttttggt gatttggggg
420tttttcttgg acttggcggc aggctggggt ctgccaccgg cgcagggccg ggcact
476312DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3ggtagcggct at 12458DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4aacctgggag gaaccgtcga gatcacctgc tccgggggtt
acagcggcta tgcctgga 58526DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 5tggaagttac
tattatggct ggtacc 26618DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 6tataatggca ataacaga
18733DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7atctactatg atgatgagag accctcgaac atc
33827DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8ggttctggat ccggctccac aaacaca
27912DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9gggtacgaag ac 121015DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 10gctatctatt actgt 151115DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 11gggagctgca tagac 151221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 12tattactgtg ggtgcataga c 211334DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13gggaagcttg atcatttcct gaatgctata ttca 341434DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14gggtctagaa actcctaggg gaaactttgc tgag 341534DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15gggaagcttc ggaagaaaga agctaaagac catc 341634DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16ggggctagca gaagagcgtg ctcacgggtc tgcc 34
* * * * *