U.S. patent application number 14/041260 was filed with the patent office on 2014-03-06 for quantitative real-time assay for noroviruses and enteroviruses with built in quality control standard.
This patent application is currently assigned to The USA, as represented by the Secretary, Dept. of Health and Human Services. The applicant listed for this patent is The USA, as represented by the Secretary, Dept. of Health and Human Services, The USA, as represented by the Secretary, Dept. of Health and Human Services. Invention is credited to William Burkhardt, III, Jessica Nordstrom, Michael C.L. Vickery.
Application Number | 20140065603 14/041260 |
Document ID | / |
Family ID | 36461342 |
Filed Date | 2014-03-06 |
United States Patent
Application |
20140065603 |
Kind Code |
A1 |
Burkhardt, III; William ; et
al. |
March 6, 2014 |
Quantitative Real-Time Assay for Noroviruses and Enteroviruses with
Built in Quality Control Standard
Abstract
A method is provided for reverse transcription-polymerase chain
reaction (RT-PCR) comprising a) amplifying a reverse transcribed
cDNA in a mixture comprising Norovirus Genogroup I and Norovirus
Genogroup II primers and probes, wherein said Norovirus primers and
probes distinguish between Genogroup I and Genogroup II viruses; b)
quantifying virus; and c) normalizing data based on a universal
internal RNA control. Optionally, the method may also include
primers and probes for Enteroviruses. A reaction mixture comprising
Norovirus Genogroup I and Norovirus Genogroup II primers and
probes, wherein said Norovirus primers and probes distinguish
between Genogroup I and Genogroup II viruses and universal internal
RNA control primers and probes are also included.
Inventors: |
Burkhardt, III; William;
(Mobile, AL) ; Vickery; Michael C.L.; (Burmingham,
AL) ; Nordstrom; Jessica; (Irvington, AL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The USA, as represented by the Secretary, Dept. of Health and Human
Services |
Bethesda |
MD |
US |
|
|
Assignee: |
The USA, as represented by the
Secretary, Dept. of Health and Human Services
Bethesda
MD
|
Family ID: |
36461342 |
Appl. No.: |
14/041260 |
Filed: |
September 30, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11865228 |
Oct 1, 2007 |
8574844 |
|
|
14041260 |
|
|
|
|
10994158 |
Nov 19, 2004 |
|
|
|
11865228 |
|
|
|
|
Current U.S.
Class: |
435/5 |
Current CPC
Class: |
C12Q 1/701 20130101 |
Class at
Publication: |
435/5 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70 |
Goverment Interests
GOVERNMENTAL INTERESTS
[0001] This invention was developed employing support from the
United States Food and Drug Administration. The Government of the
United States of America may have certain rights in this invention.
Claims
1. A method of reverse transcription-polymerase chain reaction
(RT-PCR) comprising: a) amplifying a reverse transcribed cDNA in a
mixture comprising i) an oligonucleotide probe and primers specific
for Norovirus Genogroup I; and ii) an oligonucleotide probe and
primers specific for Norovirus Genogroup II; b) quantifying
Norovirus Genogroup I and Norovirus Genogroup II virus; and c)
normalizing data to amplification of a universal internal RNA
control in the same reaction mixture.
2. The method of RT-PCR of claim 1, wherein the primers specific
for Norovirus Genogroup I comprise SEQ ID NO: 1 and SEQ ID
NO:2.
3. The method of RT-PCR of claim 1, wherein the primers specific
for Norovirus Genogroup II comprise SEQ ID NO: 5 and SEQ ID
NO:6.
4. The method of RT-PCR of claim 1, wherein the oligonucleotide
probe specific for Norovirus Genogroup I comprise SEQ ID NO: 3 and
SEQ ID NO:4.
5. The method of RT-PCR of claim 1, wherein the oligonucleotide
probe specific for Norovirus Genogroup II comprises SEQ ID
NO:7.
6. The method of RT-PCR of claim 1, wherein the universal internal
RNA control primers comprise SEQ ID NO:11 and SEQ ID NO:12.
7. The method of RT-PCR of claim 1, wherein the universal internal
RNA control oligonucleotide probe comprises SEQ ID NO: 13.
8. The method of RT-PCR of claim 1, wherein the RT-PCR reaction
mixture further comprises an oligonucleotide probe and primers
specific for a RNA virus.
9. The method of RT-PCR of claim 8, wherein the RNA virus comprises
rotavirus or a positive strand RNA virus.
10. (canceled)
11. The method of RT-PCR of claim 9, wherein the positive strand
RNA virus comprises Hepatitis A virus or an Enterovirus group
virus.
12. The method of RT-PCR of claim 11, wherein the Enterovirus group
virus comprises poliovirus, coxsackievirus, echovirus, or
enterovirus.
13. The method of RT-PCR of claim 12, wherein the coxsackievirus
comprises coxsackievirus Group A or coxsackievirus Group B.
14. The method of RT-PCR of claim 1, wherein said cDNA comprises
reverse transcribed from RNA in a biological sample.
15. The method of RT-PCR of claim 14, wherein said biological
sample comprises blood, urine, or a stool sample.
16. The method of RT-PCR of claim 1, wherein said cDNA comprises
reverse transcribed from RNA in a food sample.
17. The method of RT-PCR of claim 16, wherein said food sample
comprises shellfish.
18. The method of RT-PCR of claim 1, wherein said cDNA comprises
reverse transcribed from RNA in a water sample.
19. The method of RT-PCR of claim 18, wherein said water sample
comprises wastewater, ocean water, lake water, river water,
groundwater, or recreational water.
20. A reverse transcription polymerase chain reaction (RT-PCR)
mixture comprising: a) an oligonucleotide probe and primers
specific for Norovirus Genogroup I; b) an oligonucleotide probe and
primers specific for Norovirus Genogroup II; c) a universal
internal nucleic acid molecule, wherein said molecule contains at
least one forward primer annealing site, at least one reverse
primer annealing site, and at least one amplifiable region; d) a
universal internal control oligonucleotide probe; and e) a
universal internal control primer.
21-33. (canceled)
34. A RT-PCR kit comprising: a) an oligonucleotide probe and
primers specific for Norovirus Genogroup I; b) an oligonucleotide
probe and primers specific for Norovirus Genogroup II; c) a
universal internal nucleic acid molecule, wherein said molecule
contains at least one forward primer annealing site, at least one
reverse primer annealing site, and at least on amplifiable region;
d) a universal internal RNA control probe; and e) a universal
internal RNA control primer in a package.
35. (canceled)
Description
FIELD OF THE INVENTION
[0002] This invention relates to methods and reagents for detecting
and quantifying viruses including Norovirus or Enterovirus by, for
example, detecting or quantifying nucleic acids.
BACKGROUND OF THE INVENTION
[0003] Noroviruses are estimated to be responsible for two-thirds
of the non-bacterial food-borne illness and nearly all (96%) of the
non-bacterial gastrointestinal illnesses each year in the United
States. Norovirus infection occurs via the fecal-oral route from
contaminated food such as oysters (Berg et al., 2000, J. Infect.
Dis., 181:S381-S386; Shieh et al., 2000, J. Infect. Dis., 181:
S360-S366), water (Yoder et al., 2004, Morb. Mortal. Wkly. Rep.,
53(SS-8): 1-15; Blackburn et al., 2004, Morb Mortal Wkly Rep,
53(SS-8): 23-39) and even bakery products (Deneen et al., 2000, J.
Infect. Dis., 181: S281-S283). Infections also occur by droplet
transmission, contact with contaminated fomites, or
person-to-person transmission in contained or semi-contained areas
such as cruise ships (Center for Disease Control and Prevention,
2002, Morb. Mortal. Wkly. Rep., 51(49): 1112-1115), hospitals,
nursing homes, restaurants, and schools (Gallimore et al., 2004, J.
Clin. Microbiol., 42: 1396-1401).
[0004] Noroviruses can not be propagated by cell culture
techniques. However, Noroviruses are now detectable by various
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
techniques. Real-time RT-PCR assays have been developed using
either SYBR.RTM. Green and TaqMan.RTM. style assays for the
detection and subsequent quantification of these viruses (Donaldson
et al., 2002, Water Res., 36: 2505-2514; Kageyama et al., 2003, J.
Clin. Microbiol., 41: 1548-1557; Kojima et al., 2002, J. Virol.
Methods, 100: 107-114; Richards et al., 2004, J. Virol. Methods,
116: 63-70). SYBR.RTM. green assays, while useful for detection,
are not reliable in quantification of template concentration due to
its non-specific intercalation into any double stranded DNA
(primer-dimer and products of non-specific amplification). There
remains a need for methods and reagents that can detect or quantify
more than one type of Norovirus and/or Enterovirus in a reaction
mixture.
SUMMARY OF THE INVENTION
[0005] The present invention includes methods and reagents for
detecting and quantifying viruses including Norovirus and
Enterovirus by, for example, detecting or quantifying nucleic
acids. The methods can employ and the reagents can include primers
and oligonucleotide probes configured for a multiplex, real-time
quantitative RT-PCR (qRT-PCR) assay. The present method can employ
a universal internal RNA control. This internal control nucleic
acid molecule can provide more efficient RT-PCR, allow
normalization of results, and/or can detect inhibitors of
RT-PCR.
[0006] In an embodiment, the present method can detect and quantify
Norovirus Genogroup I and Norovirus Genogroup II in a single
reaction. Detection and quantification of the two viruses from the
two genogroups can be simultaneous. The reaction mixture can
include an universal internal RNA control. The method can employ
primers and oligonucleotide probes that distinguish between
Norovirus Genogroups I and II. Optionally, the method of invention
can employ primers and oligonucleotide probes that hybridize to
Enterovirus nucleic acid.
[0007] In an embodiment, the present invention includes a reaction
mixture including Norovirus Genogroup I and Norovirus Genogroup II
primers and oligonucleotide probes, an internal control nucleic
acid molecule, and internal RNA control primers and oligonucleotide
probe. Said Norovirus primers are capable of distinguishing
Genogroup I and Genogroup II. Optionally, a reaction mixture can
also include primers and oligonucleotide probes for Enterovirus
nucleic acids. An embodiment includes Norovirus Genogroups I and II
primers and probes, an internal control nucleic acid molecule, and
internal control primers and probes packaged together in a kit.
BRIEF DESCRIPTION OF THE FIGURES
[0008] FIG. 1 is the standard curve established for the
quantification of Norovirus Genogroup I using FAM-labeled
oligonucleotide probes.
[0009] FIG. 2 is the standard curve established for the
quantification of Norovirus Genogroup II using a TET-labeled
oligonucleotide probe.
[0010] FIG. 3 is the standard curve established for the
quantification of viruses from the Enterovirus group using a
Cy5-labeled oligonucleotide probe. FIG. 4 is the standard curve
established for the internal RNA control using a TxR-labeled
oligonucleotide probe.
[0011] FIG. 4 is the standard curve established for the internal
RNA control using a TxR-labeled oligonucleotide probe.
[0012] FIG. 5 is a 4% TAE agarose gel to determine the effect of
template overload. Lane 1--10.degree. dilution; Lane 2--10.sup.-1
dilution; Lane 3--10.sup.-2 dilution; Lane 4--10.sup.-3 dilution;
Lane 5--10.sup.-4 dilution; Lane 6--10.sup.-5 dilution; Lane
7--10.sup.-6 dilution; Lane 8--10.sup.-7 dilution; Lane
9--10.sup.-8 dilution; Also shown is a negative control lacking
viral template RNA, a 100 bp ladder (Invitrogen, Inc., Carlsbad,
Calif.), and a 25 bp ladder (Invitrogen).
[0013] FIG. 6 is determination of the dynamic range for Noroviruses
and Enteroviruses. Norovirus Genogroup I, y=-3.71x+10.78,
r.sup.2=0.983, efficiency=86%; Norovirus Genogroup II,
y=-3.68x+8.56, r.sup.2=0.998, efficiency=87%; Enterovirus,
y=-3.26x+14.92, r.sup.2=0.970, Efficiency=103%; Universal internal
RNA Control, r.sup.2=0.11
DETAILED DESCRIPTION
Definitions
[0014] The term "biological sample" refers to a body sample from
any animal, but preferably is from a mammal, more preferably from a
human. Such samples include biological fluids such as serum,
plasma, vitreous fluid, lymph fluid, synovial fluid, follicular
fluid, seminal fluid, amniotic fluid, milk, whole blood, urine,
cerebro-spinal fluid, saliva, sputum, tears, perspiration, mucus,
and tissue culture medium, as well as tissue extracts such as
homogenized tissue, and cellular extracts.
[0015] As used herein, "buffer" refers to a buffered solution that
resists changes in pH by the action of its acid-base conjugate
components. Buffers may optionally comprise a salt such as
MgCl.sub.2, MnCl.sub.2, or the like. Buffers may also optionally
comprise other constituents to improve the efficiency of reverse
transcription or amplification, including, but not limited to,
betaine, bovine serum albumin, etc.
[0016] The term "cDNA" refers to a complementary DNA molecule
synthesized using a ribonucleic acid strand (RNA) as a template.
The RNA may be mRNA, tRNA, rRNA, or another form of RNA, such as
viral RNA. The cDNA may be single-stranded, double-stranded or may
be hydrogen-bonded to a complementary RNA molecule as in an
RNA/cDNA hybrid.
[0017] The term "Enterovirus group" refers to icosahedral,
nonenveloped, single-stranded, positive-sense RNA viruses of the
family Picornaviridae. The Enterovirus group is subdivided into
poliovirus, coxsackievirus (Groups A and B), echovirus, and
enterovirus. Enteroviruses cause a myriad of clinical pathologies
in humans, including gastroenteritis. As used herein, "Enterovirus
group" refers to the genus, and "enterovirus" refers to the
enterovirus species that is part of the Enterovirus group.
[0018] The term "food sample" refers to a substance that is
ingested by an animal, preferably a human. Food sample includes,
but is not limited to, water, shellfish (e.g., bivalve molluscan
shellfish such as oysters, mussels, and clams), and bakery
products.
[0019] The term "Hepatitis A Virus" or "HAV" refers to a single
stranded, positive-sense RNA virus of the family Picornaviridae.
Hepatitis A or type A viral hepatitis was also formerly known as
any of the following: infectious hepatitis, epidemic hepatitis,
epidemic hepatitis, epidemic jaundice, catarrhal jaundice,
infectious icterus, Botkins disease, and MS-1 hepatitis. Hepatitis
A is usually self-limiting and produces the acute symptoms of
fever, malaise, nausea, and abdominal discomfort followed by an
extended period of jaundice. The minimum infectious dose is unknown
but hypothesized to be between 10 and 100 virions. Hepatitis A is
primarily transmitted via the fecal-oral route. Usually, persons
infected in outbreaks acquire the disease through the ingestion of
contaminated food, mostly water, shellfish, and salads.
[0020] The term "internal control" refers to a non-competitive
universal RNA internal control, also referred herein as an internal
control nucleic acid molecule, an internal control molecule, or a
universal internal RNA control. The invention provides an internal
control nucleic acid molecule including at least one forward primer
annealing site, at least one reverse primer annealing site, and at
least one amplifiable region, wherein the forward primer annealing
site, the reverse primer annealing site, and the amplifiable region
are all randomly generated. The internal control is also described
in pending in PCT/US2004/015175, filed May 14, 2004, which claims
priority to U.S. Provisional Application No. 60/471,121, filed May
16, 2003, hereby incorporated by reference.
[0021] The term "label" when used herein refers to a detectable
compound or composition that is conjugated directly or indirectly
to a probe to generate a "labeled" probe. The label may be
detectable by itself (e.g. radioisotope labels or fluorescent
labels) or, in the case of an enzymatic label, may catalyze
chemical alteration of a substrate compound or composition that is
detectable (e.g., avidin-biotin).
[0022] The term "Norovirus", formerly called small round-structured
viruses or Norwalk-like viruses, refers to nonenveloped,
single-stranded, positive-sense RNA viruses of the family
Caliciviridae. The genus Norovirus is genetically divided into two
genogroups, genogroup 1 and genogroup 2 (Ando et al., 2000, J.
Infect. Dis., 181: S336-S348; Katayama et al., 2002, Virol., 299:
225-239). In humans, Noroviruses cause acute gastroenteritis.
[0023] The term "oligonucleotide" refers to a single-stranded
nucleic acid including at least between two and about 100 natural
or modified nucleotides or a mixture thereof. The oligonucleotide
can be derived from a natural nucleic acid or produced by chemical
or enzymatic synthesis.
[0024] "Polymerase chain reaction" or "PCR" refers to a procedure
or technique in which minute amounts of nucleic acid, RNA and/or
DNA, are amplified as described in U.S. Pat. No. 4,683,195 issued
Jul. 28, 1987. Generally, sequence information from the ends of the
region of interest or beyond needs to be available, such that
oligonucleotide primers can be designed; these primers will be
identical or similar in sequence to opposite strands of the
template to be amplified. The 5' terminal nucleotides of the two
primers may coincide with the ends of the amplified material. PCR
can be used to amplify specific RNA sequences, specific DNA
sequences from total genomic DNA, and cDNA transcribed from total
cellular RNA, bacteriophage or plasmid sequences, etc. See
generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol.,
51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY,
1989).
[0025] The term "Reverse transcription polymerase chain reaction"
or "RT-PCR" refers to the transcription of cDNA from a RNA template
by the enzyme reverse transcriptase. The cDNA is then amplified by
known PCR methods described above.
[0026] The term "primer" refers to an oligonucleotide capable of
acting as a point of initiation of synthesis along a complementary
strand when conditions are suitable for synthesis of a primer
extension product. The synthesizing conditions include the presence
of four different deoxyribonucleotide triphosphates and at least
one polymerization-inducing agent such as reverse transcriptase or
DNA polymerase. These are present in a suitable buffer, which may
include constituents which are co-factors or which affect
conditions such as pH and the like at various suitable
temperatures. A primer is preferably a single strand sequence, such
that amplification efficiency is optimized, but double stranded
sequences can be utilized.
[0027] The term "probe" refers to an oligonucleotide that
hybridizes to a target sequence. In the TaqMan.RTM. or
TaqMan.RTM.-style assay procedure, the probe hybridizes to a
portion of the target situated between the annealing site of the
two primers. A probe can further include a detectable label, e.g.,
a fluorophore (Texas-Red.RTM., Fluorescein isothiocyanate, etc.,).
The detectable label can be covalently attached directly to the
probe oligonucleotide, e.g., located at the probe's 5' end or at
the probe's 3' end. A probe including a fluorophore may also
further include a quencher, e.g., Black Hole Quencher.TM., Iowa
Black.TM., etc. A probe includes about eight nucleotides, about ten
nucleotides, about fifteen nucleotides, about twenty nucleotides,
about thirty nucleotides, about forty nucleotides, or about fifty
nucleotides. In some embodiments, a probe includes from about eight
nucleotides to about fifteen nucleotides.
[0028] The term "quenching" refers to a decrease in fluorescence of
a fluorescent detectable label caused by energy transfer associated
with a quencher moiety, regardless of the mechanism.
[0029] The term "reaction mixture" or "PCR reaction mixture" or
"RT-PCR reaction mixture" or "master mix" or "master mixture"
refers to an aqueous solution of constituents in a PCR or RT-PCR
reaction that can be constant across different reactions. An
exemplary RT-PCR reaction mixture includes buffer, a mixture of
deoxyribonucleoside triphosphates, reverse transcriptase, primers,
probes, and DNA polymerase. Generally, template RNA or DNA is the
variable in a PCR or RT-PCR reaction.
[0030] The term "reverse transcriptase" refers to a class of
polymerases characterized as RNA-dependent DNA polymerases. All
known reverse transcriptases require a primer to synthesize a DNA
transcript from an RNA template. Historically, reverse
transcriptase has been used primarily to transcribe mRNA into cDNA,
which can then be cloned into a vector for further
manipulation.
[0031] The term "rotavirus" refers to a segmented RNA virus of the
family Reoviridae. The genome comprises 11 double-stranded RNA
segments surrounded by three concentric layers of protein.
Rotaviruses have been classified into six serological groups. Three
of the serological groups infect humans (groups A, B, and C).
Rotaviruses are usually transmitted via the fecal-oral route.
Direct transmission between persons can occur, e.g., day care
centers, family homes, and food contaminated by food handlers.
Rotaviruses usually cause acute gastroenteritis, particularly in
infants and children. Other names for gastroenteritis caused by
rotaviruses include infantile diarrhea, winter diarrhea, acute
nonbacterial infectious gastroenteritis, and acute viral
gastroenteritis.
[0032] The term "specific for [a virus]" as applied herein to a
primer or an oligonucleotide probe refers to a primer or
oligonucleotide probe affective for annealing to its target
polynucleotide and thereby producing (e.g., through RT-PCR or PCR)
a detectable signal in the presence of said target polynucleotide
without unacceptable levels of signal resulting from the annealing
of the primer or oligonucleotide probe to a non-target
polynucleotide.
[0033] The term "water sample" refers to a sample collected from a
water source. The water source includes, but is not limited to,
surface water (lakes, rivers, reservoirs, oceans, etc.),
groundwater, wastewater (i.e., sewage), recreational water (water
used for the purpose of recreation, i.e., swimming pool, spa,
waterparks, etc.), and finished water (delivered to a distribution
system after treatment, if any). Water can be either treated or
untreated. Treated water has undergone a disinfection process
(e.g., chlorination, filtration) for the purpose of making it
safe.
Methods and Reagents for Detecting or Quantifying Norovirus and/or
Enterovirus
[0034] The present invention includes a method for detecting
Norovirus genogroups I and II, and optionally Enteroviruses, in a
single reaction mixture. The reaction mixture can include a
universal internal RNA control. In an embodiment, advantageously,
the method of the invention can discriminate between Norovirus
genogroup I and II in a single reaction mixture. In an embodiment,
the method of the invention can detect Norovirus genogroup I and II
in a single reaction mixture. In an embodiment, the method of the
invention can quantify Norovirus genogroup I and II in a single
reaction mixture. Existing assays cannot accomplish this.
Additionally, in an embodiment, the present method can employ the
universal internal control to provide one or more advantages. These
advantages include, for example, establishing a single standard
curve for detection and/or quantification, normalizing data in each
individual reaction, determining whether the conditions (i.e.,
cycling conditions, primer/probe concentrations, salt
concentrations, etc.) within the reaction were suitable or optimal,
and if or to what extent inhibitory materials or excessive target
template were present.
[0035] In an embodiment, the present method can employ or be a
single reaction mixture, which can be suitable for all of a set of
samples. The reaction mixture can be aliquotted into different PCR
tubes and template RNA added (or omitted for a negative control).
The template RNA can be from an unknown sample suspected of
including RNA from a Norovirus or Enterovirus. Thus, the template
RNA can be the variable amongst the different PCR tubes. The RT-PCR
reaction mixtures can contain buffer, reverse transcriptase, DNA
polymerase, and dNTPs.
[0036] In an embodiment, the present reaction mixture can include
at least one of: primers specific for Norovirus Genogroup I,
primers specific for Norovirus Genogroup II, an oligonucleotide
probe(s) specific for Norovirus Genogroup I, an oligonucleotide
probe(s) specific for Norovirus Genogroup II, an internal control
nucleic acid molecule, primers specific for said universal internal
RNA control, and an oligonucleotide probe(s) for said universal
internal RNA control. Optionally, the reaction mixture can also
include primers specific for a RNA virus and an oligonucleotide
probe(s) specific for a RNA virus. The RNA virus to be detected and
quantified can be Hepatitis A virus, Rotavirus, or a virus of the
Enterovirus group, such as poliovirus, echovirus, enterovirus, or
coxsackievirus. A suitable oligonucleotide probe can include a
detectable label, a quencher moiety, or both.
[0037] A suitable concentration range of the viral RNA primers in
the reaction mix is between about 200 nM and about 500 nM. A
suitable concentration range of the primers for the internal
control nucleic acid molecule in the reaction mix is between about
50 nM and about 200 nM. A suitable concentration range of the
oligonucleotide probes to hybridize to viral amplification products
in the reaction mix is between about 50 nM and about 400 nM. A
suitable concentration range of the primers for the internal
control nucleic acid molecule in the reaction mix is between about
50 nM and about 250 nM, more preferably between about 75 nM and
about 200 nM. Specific concentrations may perform better than other
concentrations depending upon RT-PCR conditions and the template to
be amplified.
[0038] PCR tubes with aliquots of reaction mixture described above
can be kept on ice and RNA template added. The individual PCR tubes
can be placed in a thermal cycler, preferably with a hot start, and
reverse transcription and amplification can proceed. Known and
commercially available instrumentation and software can then detect
and quantify virus in each PCR tube.
Virus Samples
[0039] The present method can operate on any of a variety of
samples suspected containing a viral RNA, such as a Norovirus RNA
and/or an Enterovirus RNA. The sample can be collected from any of
a variety of sources suspected of being contaminated with Norovirus
and/or an Enterovirus. In an embodiment, the sample can be from a
body of water, food, a food processing surface, a biological
sample, or the like. The present method can include collecting the
sample. Common vectors for enteric virus infection include bivalve
molluscan shellfish, which can become contaminated by
bio-accumulating virus from polluted waters.
[0040] In an embodiment, the virus or viral RNA can be isolated or
recovered prior to conducting RT-PCR. Virus or viral RNA can be
separated and concentrated from a sample by any of a variety of
well known methods, such as, elution, precipitation (e.g., PEG),
solvent extraction (e.g., chloroform, ether, etc.),
ultracentrifugation, ultrafiltration, antigen-antibody capture,
nucleic acid extraction, and the like. Such methods can be
employed, for example, on shellfish tissue. These and similar
methods can be used to extract virus or viral RNA from any of a
variety of samples.
RT-PCR
[0041] Reverse transcriptases have been extensively used in reverse
transcribing RNA prior to PCR amplification, otherwise known as
reverse transcription polymerase chain reaction (RT-PCR). RT-PCR,
such as real-time RT-PCR, is known. Any of a variety of published
protocols can be used (and modified as needed) for use in the
present method. Suitable RT-PCR procedures include those presented
in U.S. Pat. No. 5,618,703, which is hereby incorporated by
reference.
[0042] Briefly, RT-PCR includes three basic steps: (1) denaturating
RNA and hybridizing the reverse primer; (2) synthesis of cDNA; and
(3) PCR amplification. RT-PCR can be performed by an uncoupled or
coupled procedure. In an uncoupled RT-PCR, reverse transcription is
performed independently from the PCR amplification in separate
reactions. Whereas, continuous RT-PCR is performed in a single
reaction tube using a common reaction mixture including both the
reverse transcriptase and the DNA polymerase. The methods of the
invention encompass all versions of RT-PCR.
[0043] For primer extension to occur, the primer anneals to the RNA
template. Not every nucleotide of the primer need anneal to the
template for reverse transcription to occur. The primer sequence
need not reflect the exact sequence of the template. For example, a
non-complementary nucleotide fragment may be attached to the 5' end
of the primer with the remainder of the primer sequence being
complementary to the RNA. Alternatively, non-complementary bases
can be interspersed into the primer, provided that the primer
sequence has sufficient complementarity with the RNA template for
hybridization to occur and allow synthesis of a complementary DNA
strand. Thus, the embodiments of the invention contemplate variants
of the primers described herein.
[0044] Reverse transcriptase enzymatic activity provides a cDNA
transcript from an RNA template. The methods for production and
amplification of DNA segments from an RNA molecule where the RNA
molecule is a member of a population of total RNA or is present in
a small amount in a biological sample are well known. In sum, DNA
amplification procedures by PCR are well known and are described in
U.S. Pat. No. 4,683,202. In PCR, the primers anneal to the target
nucleic acid at sites distinct from one another and in an opposite
orientation. A primer annealed to the target sequence is extended
by the enzymatic action of a DNA polymerase. The extension product
is then denatured from the target sequence, and the process is
repeated. Successive cycling of this procedure provides
amplification at a logarithmic rate.
[0045] There are many reverse transcriptases (e.g., Moloney Murine
Leukemia Virus (M-MuLV) Reverse Transcriptase from New England
Biolabs, Inc., Beverly, Mass.; HIV reverse transcriptase from
Ambion, Inc., Austin, Tex.) and DNA polymerases (e.g., Taq and T7
DNA polymerases from New England Biolabs, Inc.; Pfu DNA polymerase
from Promega, Inc., Madison, Wis.) that are commercially available.
The methods of the invention are not limited to any particular
enzyme, although some enzymes may be preferable under specific
conditions.
Real-Time RT-PCR
[0046] Real-time PCR allows automated quantification of reaction
product for each sample per cycle. Commonly used instrumentation
and software products perform the quantification calculations
automatically. The quantification has a broad 10.sup.7-fold dynamic
range that is possible, but usually, the dynamic range is closer to
2-3 logs. The recent advancement in PCR instrumentation technology,
e.g., Cepheid's Smart Cycler.RTM. II, allows the simultaneous
detection and quantification of fluorescent signals in up to four
different channels in real-time. In addition, the latest generation
of thermal cyclers are designed to maximize dye excitation
providing a more accurate means of detecting fluorescence. Thus,
multiple amplification products can be assessed in the same
reaction mixture and quantified more accurately. Further, each
reaction site can be programmed independently, thereby starting the
reaction independent of other reactions. Thus, samples can be
evaluated as needed and do not have to wait for the completion of a
programmed reaction already in progress. Therefore, this new
technology now allows for the detection and quantification of
multiple targets in a single sample in real-time
[0047] There are four different probe systems in current use for
real-time PCR--Molecular Beacons (Sigma-Genosys, Inc., The
Woodlands, Tex.), Scorpions.RTM. (DxS Ltd., Manchester, UK),
SYBR.RTM. Green (Molecular Probes, Eugene, Oreg.), and TaqMan.RTM.
(Applied Biosystems, Foster City, Calif.). These four systems
employ fluorescent labels that the instrumentation detects
fluorescence and the software interprets levels of
fluorescence.
[0048] SYBR.RTM. Green is a fluorescent dye that only strongly
fluoresces when bound to double stranded DNA. As mentioned above,
SYBR.RTM. green assays, while useful for detection, are not
reliable in quantification of template concentration due to its
non-specific intercalation into any double stranded DNA
(primer-dimer and products of non-specific amplification). Thus,
SYBR.RTM. Green provides a quick method of detection, but is not
reliable for quantification. As a result, further assays are
required to confirm the quantification of reaction product.
[0049] Molecular Beacons, Scorpions.RTM., and TaqMan.RTM. utilize
Forster Resonance Energy Transfer (FRET) by coupling a fluorescent
label with a quencher moiety. A fluorescent label is covalently
bound to the 5' end of an oligonucleotide probe, while the 3' end
has a quencher moiety attached. These oligonucleotide probes are
site specific to hybridize to the amplified product. Preferably,
the oligonucleotide probes are designed to hybridize to a central
region of the amplified product. For TaqMan.RTM. assays, the
5'-nuclease activity of the DNA polymerase cleaves the probe during
the replication cycle. Due to the cleavage of the probe, the
quencher moiety is no longer coupled to the fluorescence label and
cannot quench fluorescence. Fluorescence thus represents
replicating DNA.
[0050] Similarly, Molecular Beacons utilizes an oligonucleotide
probe with a fluorescent label attached to the 5' end and a
quencher moiety attached to the 3' end. When free in solution, the
Molecular Beacons oligonucleotide probe forms a hairpin structure.
In the hairpin structure, the quencher moiety is able to quench
fluorescence due to FRET. However, during PCR, the oligonucleotide
probe unfolds and hybridizes to its complementary DNA, and the
quencher is no longer close enough to the fluorescent label to
quench fluorescence. Thus, fluorescence reports the hybridization
between an oligonucleotide probe and its specific target cDNA.
However, Molecular Beacons are not accurate in quantifying the
reaction product due to competition from PCR product synthesis. In
this system, target/complement reannealing and target strand
folding provide competition for the site of Molecular Beacon
hybridization.
[0051] Scorpions.RTM. also utilize an oligonucleotide probe with a
fluorescent label attached to the 5' end and a quencher moiety
attached to the 3' end in a hairpin structure free in solution.
However, the Scorpions.RTM. oligonucleotide probe also serves as a
primer. The Scorpions.RTM. oligonucleotide probe/primer extends
from the hairpin loop structure and hybridizes to the target. The
Scorpions.RTM. oligonucleotide probe/primer fluoresces, and the DNA
polymerase extends the target DNA from the primer. Thus, the probe
detects the extension product, whish is its own primer-unimolecular
rearrangement. Thereby, the fluorescence reports the extension and
thus copy number of reaction product.
[0052] In an embodiment, the present method employs
TaqMan.RTM.-style probes (dual-labeled probes to fluoresce upon
5'.fwdarw.3' exonuclease activity). In certain embodiments, the
TaqMan.RTM.-style probes can be advantageous compared to, for
example, SYBR.RTM. Green probes. Although not limiting to the
present invention, this may be due to the ability to more
accurately quantify the amplification products.
[0053] In an embodiment, the present method employs
TaqMan.RTM.-style probes and oligonucleotides that selectively
hybridize to Norovirus Genogroup I or Norovirus Genogroup II (SEQ
ID NOs: 3, 4, and 7). In an embodiment, the Norovirus Genogroup I
probes can be coupled to 6-carboxyfluorescein at the 5' end of the
oligonucleotide, and the Norovirus Genogroup II probe can be
coupled to tetracholoro-6-carboxyfluorescein at the 5' end. In an
embodiment, the oligonucleotide can also be coupled to a quencher
moiety at the 3' end. A preferred quencher moiety for the Norovirus
probes is Black Hole Quencher.TM. (Biosearch Technologies, Novato,
Calif.). The oligonucleotide probes exemplified by SEQ ID NOs: 3
and 4 selectively bind to the amplification product of Norovirus
Genogroup I. Suitable instrumentation will thereby detect the
fluorescence produced from the cleavage of the oligonucleotide
probe by the nuclease activity of the DNA polymerase during
replication. Analysis software then determines the quantity of
amplification product based upon the fluorescence data.
[0054] Similarly, an embodiment of the invention can use the
oligonucleotide probe of SEQ ID NO:10 to selectively hybridize to
viruses of the Enterovirus group. This probe can be coupled to
cyanin5 (Amersham Biosciences Corp., Piscataway, N.J.) at the 5'
end and Iowa Black (Integrated DNA Technologies, Coralville, Iowa)
at the 3' end. Additionally, an embodiment of the invention can use
the oligonucleotide probe of SEQ ID NO:13 to hybridize to a
internal control nucleic acid. This probe can be coupled to Texas
Red at the 5' end and Iowa Black at the 3' end.
Quantification of PCR Results
Standard Curve
[0055] A standard curve can be generated from an RNA of known
concentration. The standard curve can then be used to determine RNA
levels (copy number) of unknown concentrations. Prior to the
development of the universal internal RNA control, use of a
standard curve required laborious and uncertain steps. Previous
methods incorporated the construction of plasmids containing the
cDNA to be transcribed in vitro. The transcribed RNA would be the
standard, but accurate quantification was difficult due to problems
with stability.
[0056] Other nucleic acids besides RNA can be used to establish a
standard curve. These methods are well known and include double
stranded DNA, a cDNA expressing a target gene, or an in vitro
generated single stranded DNA. Methods may vary according to the
nucleic acid chosen to serve as the standard to establish a
standard curve.
Comparative Cycle Threshold
[0057] The comparative cycle threshold (Ct) method, also known as
the 2.sup.-.DELTA..DELTA.Ct method, is also used to quantify RNA
levels. The Ct method compares a test reaction with a control or
calibrator sample. The Ct values of both the control/calibrator
sample and the test sample are normalized. In an embodiment of the
invention, the Ct values were normalized to an arbitrary cutoff,
20-22. In another embodiment, the Ct values were normalized to
within 1 Ct value of a negative control (a sample with no
inhibition). This allows for the sensitivity of the assay and
proper dynamic range.
[0058] The Ct method can also be described by the formula
.DELTA..DELTA.Ct=.DELTA.Ct.sub.test sample-.DELTA.Ct.sub.reference
sample. The amplification efficiencies of the test sample and the
reference sample must be about the same for the formula to operate.
Amplification efficiencies can be determined by a comparison of the
samples with template dilution. The amplification efficiency is
about the same when a plot of cDNA dilution versus .DELTA.Ct
approximates zero.
Universal Internal RNA Control
[0059] Internal control nucleic acid molecules in accordance with
the invention can function as a part of a system to provide a
method of eliminating false negatives during nucleic acid
amplification procedures and/or associated detection methods.
Internal control nucleic acid molecules can also function to
provide a means to estimate the degree of PCR inhibition in
reactions that make use of the quantitative capabilities of
real-time PCR and RT-PCR. If a substance is present in a test
sample matrix which inhibits or enhances the PCR amplification, the
degree of inhibition or enhancement may be estimated and the
quantitative data may be adjusted based upon shifts in the
amplification characteristics (for example shifts in the real-time
PCR Ct value) of the internal control.
[0060] The internal control nucleic acid molecule in accordance
with the invention can function by providing a known amplifiable
nucleotide for inclusion in a nucleic acid amplification procedure
to ensure that the sample conditions are not inhibiting
amplification of the nucleic acids. In addition, data obtained
during amplification of the internal control may be used to
estimate PCR inhibition and adjust quantitative data in
quantitative assays.
[0061] Primers.
[0062] An internal control nucleic acid molecule in accordance with
an embodiment of the invention includes at least one forward primer
annealing site, at least one reverse primer annealing site, and at
least one amplifiable region.
[0063] In one embodiment of the invention, the forward primer
annealing site and the reverse primer annealing site include from
about 15 to about 25 base pairs each. In another embodiment of the
invention, the forward primer annealing site and the reverse primer
annealing site include from about 18 to about 24 base pairs each.
In yet another embodiment, the forward primer annealing site and
the reverse primer annealing site include from about 20 to about 23
base pairs each.
[0064] The amplifiable region is flanked by the forward primer
annealing site on one end and by the reverse primer annealing site
on the other end. The length of the amplifiable region, i.e., the
region between the forward primer annealing site and the reverse
primer annealing site can vary greatly from as little as about 15
base pairs to greater than about 1000 base pairs. The length of the
amplifiable region can depend on a number of factors, including,
but not limited to the length of the target genes that the nucleic
acid amplification procedure is targeting.
[0065] There are a number of design characteristics that can be
considered when generating the sequences. Examples of these
considerations include, but are not limited to: the GC content of
the sequence; a lack of identity to any known, naturally occurring
sequences, or amplifiable region; and the lack of repetitive
regions of the same base pair. The pseudo-randomly generated
sequence can be designed by considering any combination of these
various characteristics.
[0066] Internal control nucleic acid molecules can include
deoxyribonucleic acid (DNA), and ribonucleic acid (RNA). One of
skill in the art will also understand that once the internal
control nucleic acid molecule has been designed, it can be made by
any method commonly known and used by those of skill in the art.
Alternatively, the internal control nucleotide molecule can be
synthesized by a company such as Integrated DNA Technologies
(Coralville, Iowa). It is also practical to synthesize this
molecule in most molecular biology laboratories by combining
specific synthesized oligonucleotides into a designated
sequence.
[0067] Probes.
[0068] In another embodiment of the invention, the internal control
nucleic acid molecule also includes at least one probe
hybridization region. The probe hybridization region can be
configured to be complementary to a real-time PCR probe. The probe
for which the probe hybridization region is complementary may be
any probe that is commonly known and used in assays for DNA
detection and/or quantification. The nucleotide sequence of the
probe is designed to be complementary to a region of the internal
control nucleic acid molecule of the invention that can be
amplified by PCR using primers designed for use with the internal
control nucleic acid molecule. If for example, probe A with a base
pair sequence of ATCTCG is going to be used, the probe
hybridization region would have a sequence of (for example) CGAGAT.
The probe can be designed using specifications unique to each type
of probe--typically using specialized software such as (for
example) Primer Express (Applied Biosystems, Foster City, Calif.).
The probe will behave much like a primer in terms of the
hybridization of the probe to the internal control DNA sequence in
that it is designed to hybridize to regions in the internal control
nucleic acid molecule. These regions are unlikely to have
nucleotide identity to regions internal to amplifiable regions in
any naturally-occurring sequences for the same reasons described
above for the primer annealing regions.
[0069] Examples of assays that may utilize a probe include, but are
not limited to the 5' nuclease assay, which is known commercially
as TaqMan.RTM. (Applied Biosystems). In the TaqMan.RTM. or a
TaqMan.RTM.-style assay, a probe can be utilized that is designed
to hybridize to a DNA sequence internal to the primers targeting a
specific amplification region. The probe is typically labeled at
the 5' end with a reporter molecule such as a fluorescent dye and a
quencher molecule at the 3' end.
[0070] Detecting Inhibition.
[0071] While a positive and negative control are normally run for
every RT-PCR or PCR reaction mix to ensure the integrity of the
reagents, inhibition of the PCR by the sample matrix may cause a
falsely negative result. In quantitative real-time PCR this is even
more of a concern, as partial PCR inhibition may lead to inaccurate
quantification results. Therefore, it is desirable to include an
internal positive control in each individual reaction to prevent
the reporting of false negatives and to potentially allow accurate
adjustments to quantitative data.
[0072] Some matrices contain inhibitors of PCR analysis (i.e.,
shellfish). Matrices high in glycogen or have excessive amounts of
protein and/or DNA will inhibit amplification of a target RNA
template. The amplification product of the RT-PCR of recovered RNA
from one of these matrices will be logs away from the negative
control. With the inclusion of a universal internal RNA control,
viral RNA can be quantified within 1 or 2 logs by adjusting for the
inhibition. The negative control allows for a normalization to an
uninihibited sample.
Applications of the Present Method and Reagents
[0073] The applications of the invention are extensive. Provided
the hardware and software capabilities, the method of the invention
is relatively quick and easy to employ. The necessary hardware
includes a computer, a PCR thermal cycler, and optics for
fluorescence excitation and emission collection, plus capture and
analysis software. Additionally, many biotechnology suppliers
(i.e., Ambion, Inc.) manufacture RT-PCR kits for user ease.
Therefore, the invention can be used at sites prone to enteric
virus outbreak (i.e., cruise ships, food distribution centers) or
at medical facilities (i.e., hospitals).
[0074] For instance, the instrumentation and the methods of the
invention could be deployed on cruise ships to diagnose and
possibly prevent large outbreaks. A passenger with acute
gastroenteritis could provide a sample (e.g., stool sample) to a
ship's physician or technician trained in the procedure. The
etiologic agent can be detected in the patient sample. This same
equipment and embodiments of the invention can also be used to
detect, and thus isolate, the contaminated food source. Since more
than one virus may be present in detectable levels, a determination
of the copy number of virus present in the contaminated food source
will also help to correctly determine the etiologic agent of
gastroenteritis or any other ailments. Besides rehydration,
patients suffering from Norovirus can be treated with bismuth
sulfate (Center for Disease Control and Prevention, 2001, Morb.
Mortal. Wkly. Rep., 50(RR02): 1-69). The invention described herein
can be used to provide a relatively quick diagnosis and assessment
of enteric virus infection or contamination.
[0075] In another application, the food industry could test
commonly contaminated food products for enteric viruses by
utilizing the invention described herein. A technician could test
food samples (i.e., shellfish) for the presence of enteric virus.
Additionally, a technician could also quantify the level of enteric
virus present. By quantifying the virus levels, a technician could
determine whether contaminated food is above or below the threshold
for a minimum infectious dose.
Embodiments of the Current Invention
[0076] An embodiment of the current invention includes a method of
reverse transcription-polymerase chain reaction (RT-PCR), which
includes a) amplifying a reverse transcribed cDNA in a mixture
including oligonucleotide probes and primers specific for Norovirus
Genogroup I and Norovirus Genogroup I; b) quantifying virus; and c)
normalizing data to amplification of a universal internal RNA
control in the same reaction mixture. Optionally, the method may
include a step of detecting another RNA virus or virus group,
including Rotavirus and positive RNA strand virus, such as
Hepatitis A virus (HAV) and Enterovirus group (i.e., poliovirus,
enterovirus, echovirus, and coxsackievirus). The internal control
nucleic acid molecule used in the RT-PCR reaction mixture may
include SEQ ID NO: 14. The method may include at least one primer
of SEQ ID NOs: 1, 2, 5, 6, 8, 9, 11, and 12. The method may also
include at least one oligonucleotide probe of SEQ ID NOs: 3, 4, 7,
10, and 13. Samples to be tested for the presence and quantity of
RNA include a biological sample (e.g., blood, urine or stool), a
food sample (e.g., shellfish such as oysters, clams and mussels),
and a water sample (e.g., wastewater, groundwater, ocean water,
lake water, river water, or recreational water).
[0077] Another embodiment of the current invention is a RT-PCR
reaction including a) an oligonucleotide probe and primers specific
for Norovirus Genogroup I; b) an oligonucleotide probe and primers
specific for Norovirus Genogroup I; c) a universal internal nucleic
acid molecule, wherein said molecule contains at least one forward
primer annealing site, at least one reverse primer annealing site,
and at least on amplifiable region; d) a universal internal control
oligonucleotide probe; and e) a universal internal control primers.
The primers and oligonucleotide probes may include at least one of
the polynucleotides of SEQ ID NOs: 1-7 and 11-13. The internal
control nucleic acid molecule may also include the polynucleotide
of SEQ ID NO:14. Another embodiment of the invention includes, the
reaction mixture, including the primers and oligonucleotide probes
discussed herein, packaged together as a kit, which may or may not
include instructions for use.
[0078] The present invention may be better understood with
reference to the following examples. These examples are intended to
be representative of specific embodiments of the invention, and are
not intended as limiting the scope of the invention.
EXAMPLES
Example 1
Development of a Quantitative Multiplex RT-PCR Assay for the
Detection of Noroviruses and Enteroviruses
[0079] The use of RT-PCR based assays has increased detection
sensitivity of Enteroviruses and reduced analysis time. The
predominant human Noroviruses, which are placed into two
genogroups, GI and GII, have not been cultured. Thus, Norovirus
detection is based primarily upon non-quantitative RT-PCR assays.
To date, no single assay has been capable of simultaneous detection
and enumeration of GI genogroup Norovirus and GII genogroup
Norovirus.
[0080] In the present study, a multiplex qRT-PCR assay using the
Cepheid SmartCycler.RTM. (Cepheid, Sunnyvale, Calif.) system has
been developed for the simultaneous detection and quantification of
viruses from the Enterovirus genus. The following example
demonstrated that the multiplex qRT-PCR can simultaneously detect
Enterovirus, Norovirus genogroup I, and Norovirus genogroup II. The
assay also incorporated a novel quantitative universal internal
control to prevent the reporting of false negatives due to
inhibition or failure of the qRT-PCR. The development of this
methodology allows the rapid semi-quantitative determination of
Norovirus and Enterovirus levels.
Methods
A. Reverse Transcription of RNA Templates
[0081] RNA was isolated and purified by known methods from a GI
Norovirus (Norwalk virus strain 8FIIa), a GII Norovirus isolated
from the stool of an ill individual (93% homologous to Lordsdale
strain), and human Polio virus 3 (Sabin Strain). The isolated GI
Norovirus, GII Norovirus, and Polio virus RNA were reverse
transcribed and amplified by RT-PCR using the QIAGEN.RTM. OneStep
RT-PCR Kit (Qiagen, Valencia, Calif.). Briefly, template RNA was
added to a RT-PCR reaction mixture of QIAGEN OneStep RT-PCR Buffer
(Tris.Cl/KCl/(NH.sub.4)SO.sub.4, 12.5 mM MgCl.sub.2, DTT; pH 8.70),
400 .mu.M of each dNTP (dATP, dCTP, dGTP, and dTTP), 1.25 U of
Super RNasin (Ambion), primers and probes (see Tables 1-5), the
internal control nucleic acid molecule (SEQ ID NO: 14) and QIAGEN
OneStep RT-PCR Enzyme Mix containing Omniscript.RTM. reverse
transcriptase, Sensiscript.RTM. reverse transcriptase, and
HotStarTaq DNA polymerase. A negative control was included that did
not contain template RNA. Each sample was tested in triplicate.
TABLE-US-00001 TABLE 1 GI Norovirus Primers and Probes Primer/ SEQ
ID Probe NO. Sequence (5'.fwdarw.3') COG1F 1 CGYTGGATGCGNTTYCATGA
COG1R 2 CTTAGACGCCATCATCATTYAC GI-P-1 3 AGATYGCGATCYCCTGTCCA
GI-P-1b 4 AGATCGCGGTCTCCTGTCCA
TABLE-US-00002 TABLE 2 GII Norovirus Primers and Probes SEQ Primer/
ID Probe NO. Sequence (5'.fwdarw.3') COG2F 5
CARGARBCNATGTTYAGRTGGATGAG COG2R 6 TCGACGCCATCTTCATTCACA GII-P 7
TGGGAGGGCGATCGCAATCT Y is C or T; R is A or G; B is C, G, or T; and
N is A, C, G, or T.
TABLE-US-00003 TABLE 3 Enterovirus Primers and Probes Primer/ SEQ
ID Probe NO. Sequence (5'.fwdarw.3') EV1F 8 CCTCCGGCCCCTGAATG EV4R
9 CACCGGATGGCCAATCCAA EV-P 10 CGGACACCCAAAGTAGTCGGTTCCG
TABLE-US-00004 TABLE 4 Universal Internal RNA Control Primers and
Probes Primer/ SEQ ID Probe NO. Sequence (5'.fwdarw.3') IC-46F 11
GACATCGATATGGGTGCCG IC-194R 12 AATATTCGCGAGACGATGCAG IC-P 13
TCTCATGCGTCTCCCTGGTGAATGTG
The reporter dye 6-carboxyfluorescein (FAM; Integrated DNA
Technologies, Coralville, Iowa) was coupled to the 5' end of probes
GI-P-1 and GI-P-1b; tetrachloro-6-carboxy-fluorescein (TET;
Integrated DNA Technologies) was coupled to the 5' end of probe
GII-P; cyanin 5 (Cy5.TM.; Amersham Biosciences Corp., Piscataway,
N.J.) was coupled to the 5' end of probe EV-P; and Texas Red.RTM.
(TxR; Integrated DNA Technologies) was coupled to the 5' end of the
universal internal RNA control probe. Black Hole Quencher.TM. 1
(BHQ1; Biosearch Technologies, Novato, Calif.) was coupled to the
3' end of probes GI-P-1, GI-P-1b, and GII-P, and Iowa Black.TM.
(Integrated DNA Technologies) was coupled to the 3' end of probe
EV-P and IC-P.
TABLE-US-00005 TABLE 5 Primer and Probe Concentrations in the
Master Mix Concentration Primer COG1F (SEQ ID NO: 1) 300 nM COG1R
(SEQ ID NO: 2) 300 nM COG2F (SEQ ID NO: 5) 300 nM COG2R (SEQ ID NO:
6) 300 nM EV1F (SEQ ID NO: 8) 400 nM EV1R (SEQ ID NO: 9) 400 nM
IRC-46F (SEQ ID NO: 11) 75 nM IRC-194R (SEQ ID NO: 11) 75 nM Probes
GI-P-1 (SEQ ID NO: 3) 100 nM GI-P1b (SEQ ID NO: 4) 100 nM GII-P
(SEQ ID NO: 7) 100 nM EVP (SEQ ID NO: 10) 300 nM IC-P (SEQ ID NO:
13) 150 nM
[0082] Using a hot start, the samples were kept on ice until the
Cepheid SmartCycler.RTM. reached its initial cycling temperature of
50.degree. C. and then the PCR tubes were placed in the thermal
cycler. The samples were incubated at 50.degree. C. for 3000 sec
followed by HotStartTaq.TM. DNA Polymerase activation at 95.degree.
C. for 900 sec. These incubations in the thermal cycler were
followed by 45 cycles of 95.degree. C. for 10 sec, 53.degree. C.
for 25 sec, and 62.degree. C. for 70 sec. Fluorescence was read at
the end of each elongation step. The resulting amplicons were also
visualized by 4% TAE gel electrophoresis.
B. Optics Graphs
[0083] The fluorescence intensity of each RT-PCR reaction was
plotted against PCR cycles. Cycle threshold (Ct) values are the
number of cycles required for the fluorescence intensity graph to
cross an arbitrary threshold. The Ct value for the reactions was
15.0. Data were collected, viewed, and graphed using the
SigmaPlot.RTM. 2000 (SPSS Inc., Chicago, Ill.).
Results and Discussion
[0084] Advancements in real-time quantitative RT-PCR (qRT-PCR)
technology have allowed the recent development of several qRT-PCR
assays for the rapid detection and enumeration of enteroviruses,
and specifically Norovirus. However, the TaqMan.degree. style
assays developed for Norovirus detection requires separate simplex
reactions to distinguish the GI and GII genogroups (Kageyama et
al., 2003). Additionally, the SYBR.RTM. Green RT-PCR assay has two
distinct disadvantages--1) the assay is unable to reliably
distinguish these two genogroups, and 2) is not be reliable in the
quantification of template concentration due to its non-specific
intercalation into double stranded DNA to produce primer-dimers and
other non-specific amplification.
[0085] The multiplex qRT-PCR assay was able to simultaneously
detect Enterovirus group viruses, Norovirus GI, Norovirus GII, and
the internal control nucleic acid molecule (FIGS. 1-4). The assay
had a dynamic range of greater than seven logs. The resulting PCR
products were run on a 4% TAE gel. Amplicons were observed at the
predicted target size for Norovirus GI (84 bp), Norovirus GII (97
bp), Enterovirus (196 bp), and the universal internal RNA control
(149 bp) (FIG. 5).
[0086] The multiplex qRT-PCR assay incorporated a universal
internal control to determine amplification efficiency and data
normalization. The universal internal RNA control established a
single standard curve for all subsequent assays for the detection
and/or quantification of each of the target sequences (FIG. 6). The
standard curve was dependent upon established Ct values of the
universal internal RNA control within the sample and negative
template reaction. Ct values of universal internal RNA control
intra- and extra-assays were less than 0.5 cycles (approx. 0.1
log). The universal internal RNA control incorporated into each
reaction determined whether the conditions within the reaction were
optimal (i.e., cycling conditions, primer/probe concentrations,
etc.). The universal internal RNA control also determined if and to
what extent inhibitory materials or excessive target templates were
present in the sample.
[0087] Reliable, reproducible standard curves for each of these
three virus groups were established (r.sup.2>0.97) using this
real-time, multiplex qRT-PCR assay. Established standard curves
were used to quantify target levels. The standard curves were based
upon the end-point dilutions and established the end-point as 1
RT-PCR unit. The end-point was established whereby only <2 of 3
reactions gave way to a positive reaction (crossing the Ct) (FIG.
6). Thereby, at least 2 of the 3 reactions for a single sample were
within 1 Ct of the internal control.
Example 2
Quantitative Multiplex RT-PCR Assay for the Detection of
Noroviruses and Enteroviruses
[0088] RNA template was serially diluted 1:10 until a dilution of
10.sup.-9. Using the different concentrations of RNA template
tested the effect of template overload and the assay's threshold of
detectable levels of RNA.
Methods
[0089] The cDNAs from the RT-PCR of Example I were purified using a
NucleoSpin.RTM. Extraction Kit (BD Biosciences Clontech, Palo Alto,
Calif.) and cloned using a TOPO TA Cloning.RTM. Kit (Invitrogen
Corp., Carlsbad, Calif.) by known methods. Clones with full-length
inserts and proper orientation were subjected to a QIAprep.RTM.
Miniprep Kit (Qiagen) to purify their plasmids. Plasmids were
purified and sequenced in both the forward and reverse direction to
determine and/or verify their sequences. Each plasmid was
linearized by restriction digest with BamHI (New England
BioLabs.RTM., Inc., Beverly, Mass.) and run on a 1% agarose gel to
confirm linearization. The linearized plasmid was subjected to in
vitro RNA transcription (MEGAscript.RTM. High Yield Kit, Ambion,
Inc.). The in vitro reaction components were treated with DNAse.
RNA was purified using a MEGAclear.TM. Kit (Ambion).
[0090] The purified RNA was used as template for the multiplex
qRT-PCR described in Example 1. The template RNA was serially
diluted 1:10 ranging from 0 to 10.sup.-8. Each dilution was used as
template RNA for the multiplex qRT-PCR. The resultant PCR product
was visualized by 4% TAE gel electrophoresis.
Results and Discussion
[0091] Purified RNA from enterovirus, Norovirus GI, and Norovirus
GII was serially diluted and reverse transcribed by the multiplex
qRT-PCR according to the methods of Example 1. Results were
visualized in the graph of FIG. 4 and on a 4% TAE agarose gel (FIG.
5). The fluorescence reported by the GI and GII Norovirus probes
signified amplification in addition to the 84 bp and 97 bp
amplicons of the 4% TAE_gel. Template overload inhibited the RT-PCR
of the enterovirus and the universal internal RNA control as
reported by the fluorescent probes at the 0 and 1:10 dilution of
the RNA template. The inhibition of the universal internal RNA
control was confirmed by the lack of an amplicon on the 4% TAE_gel
for the 0 dilution. However, an enterovirus amplicon was present on
the 4% TAE_gel for the 0 dilution. Most likely, the difference
between the fluorescence data and the gel electrophoresis may be
due to the poor reporting signal strength of the 5' labeled Cy5.TM.
or the concentration of the Taq polymerase used, which had been
optimized by the manufacturer for product formation and not for
reactions tested.
[0092] It should be noted that, as used in this specification and
the appended claims, the singular forms "a," "an," and "the"
include plural referents unless the content clearly dictates
otherwise. Thus, for example, reference to a composition containing
"a compound" includes a mixture of two or more compounds. It should
also be noted that the term "or" is generally employed in its sense
including "and/or" unless the content clearly dictates
otherwise.
[0093] It should also be noted that, as used in this specification
and the appended claims, the term "configured" describes a system,
apparatus, or other structure that is constructed or configured to
perform a particular task or adopt a particular configuration. The
term "configured" can be used interchangeably with other similar
phrases such as adapted and configured, arranged and configured,
constructed and arranged, adapted, constructed, manufactured and
arranged, and the like.
[0094] All publications and patent applications in this
specification are indicative of the level of ordinary skill in the
art to which this invention pertains.
[0095] The invention has been described with reference to various
specific and preferred embodiments and techniques. However, it
should be understood that many variations and modifications may be
made while remaining within the spirit and scope of the invention.
Sequence CWU 1
1
14120DNANorovirusmisc_feature(12)..(12)n is a, c, t or g
1cgytggatgc gnttycatga 20222DNANorovirus 2cttagacgcc atcatcatty ac
22320DNANorovirus 3agatygcgat cycctgtcca 20420DNANorovirus
4agatcgcggt ctcctgtcca 20526DNANorovirusmisc_feature(9)..(9)n is a,
c, t or g 5cargarbcna tgttyagrtg gatgag 26621DNANorovirus
6tcgacgccat cttcattcac a 21720DNANorovirus 7tgggagggcg atcgcaatct
20817DNAEnterovirus 8cctccggccc ctgaatg 17919DNAEnterovirus
9caccggatgg ccaatccaa 191025DNAEnterovirus 10cggacaccca aagtagtcgg
ttccg 251119DNAArtificial SequenceUniversal Internal RNA PCR Primer
IC-46F 11gacatcgata tgggtgccg 191221DNAArtificial SequenceUniversal
Internal RNA PCR Primer IC-194R 12aatattcgcg agacgatgca g
211326DNAArtificial SequenceUniversal Internal RNA PCR Probe IC-P
13tctcatgcgt ctccctggtg aatgtg 2614311DNAArtificial
SequenceUniversal Internal Control Molecule 14ttcatgtggt cacagccctg
acgaagctgt catcaagttc ataatgacat cgatatgggt 60gccgttcgag cagtttagcc
ctaaatcacc ctaccggcag acgtatgtca cattcaccag 120ggagacgcat
gagattggat gctgttgtgc gccctcaaca atgtaacgaa tggctgcatc
180gtctcgcgaa tattgtcgta ccatcatctg acttggctca tgtctgcaag
aggcttcgca 240ctgggcttta tgaagggcga attctgcaga tatccatcac
actggcggcc gctcgagcat 300gcatctagag g 311
* * * * *