U.S. patent application number 13/662588 was filed with the patent office on 2014-02-27 for antagonists of neuropilin receptor function and use thereof.
This patent application is currently assigned to CHILDREN'S MEDICAL CENTER CORPORATION. The applicant listed for this patent is Children's Medical Center Corporation. Invention is credited to Michael Klagsbrun, Harry Hua-Quan Miao, Shay Soker, Seiji Takashima.
Application Number | 20140056872 13/662588 |
Document ID | / |
Family ID | 27371484 |
Filed Date | 2014-02-27 |
United States Patent
Application |
20140056872 |
Kind Code |
A1 |
Klagsbrun; Michael ; et
al. |
February 27, 2014 |
ANTAGONISTS OF NEUROPILIN RECEPTOR FUNCTION AND USE THEREOF
Abstract
The present invention relates to antagonists of neuropilin
receptor function and use thereof in the treatment of cancer,
particularly metastatic cancer, and angiogenic diseases.
Inventors: |
Klagsbrun; Michael; (Newton,
MA) ; Soker; Shay; (Greensboro, NC) ; Miao;
Harry Hua-Quan; (Edison, NJ) ; Takashima; Seiji;
(Osaka, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Children's Medical Center Corporation |
Boston |
MA |
US |
|
|
Assignee: |
CHILDREN'S MEDICAL CENTER
CORPORATION
Boston
MA
|
Family ID: |
27371484 |
Appl. No.: |
13/662588 |
Filed: |
October 29, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12726171 |
Mar 17, 2010 |
|
|
|
13662588 |
|
|
|
|
11893413 |
Aug 16, 2007 |
|
|
|
12726171 |
|
|
|
|
10104440 |
Mar 22, 2002 |
7731959 |
|
|
11893413 |
|
|
|
|
09580803 |
May 30, 2000 |
|
|
|
10104440 |
|
|
|
|
PCT/US98/26114 |
Dec 9, 1998 |
|
|
|
09580803 |
|
|
|
|
60069155 |
Dec 9, 1997 |
|
|
|
60069687 |
Dec 12, 1997 |
|
|
|
60078541 |
Mar 19, 1998 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/139.1; 530/387.9 |
Current CPC
Class: |
A61K 48/00 20130101;
C07K 14/71 20130101; A61K 38/00 20130101; C07K 16/2863 20130101;
C07K 16/28 20130101; A61K 39/39558 20130101; A61P 35/04
20180101 |
Class at
Publication: |
424/133.1 ;
424/139.1; 530/387.9 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 16/28 20060101 C07K016/28 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] The work described herein was supported, in part, by
National Institute of Health grants CA37392 and CA45548. The U.S.
Government has certain rights to the invention.
Claims
1. A method of inhibiting metastasis in a subject in need thereof,
the method comprising administering to a subject an effective
amount of an antagonist of neuropilin-2 (NP-2).
2. The method of claim 1, wherein the antagonist specifically binds
NP-2.
3. The method of claim 2, wherein the antagonist specifically binds
to an NP-2 having the sequence set forth in SEQ ID NO:4.
4. The method of claim 1, wherein the antagonist is an antibody or
antibody fragment thereof specifically binds NP-2.
5. The method of claim 4, wherein the antibody or antibody fragment
thereof specifically binds NP-2 at a VEGF binding site.
6. The method of claim 4, wherein the antibody or antibody fragment
thereof specifically binds NP-2 having the sequence set forth in
SEQ ID NO:4.
7. The method of claim 4, wherein the antibody or antibody fragment
thereof is monoclonal.
8. The method of claim 4, wherein the antibody or antibody fragment
thereof is a humanized antibody or antibody fragment thereof.
9. An isolated antibody or antibody fragment thereof that
specifically binds a neuropilin-2 (NP-2), wherein said isolated
antibody specifically inhibits binding of VEGF to NP-2.
10. The isolated antibody or antibody fragment thereof of claim 9,
wherein said NP-2 has the sequence set forth in SEQ ID NO:4.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application which claims
the benefit under 35 USC .sctn.120 of Ser. No. 12/726,171, filed on
Mar. 17, 2010, which is a continuation application which claims
benefit under 35 USC .sctn.120 of U.S. application Ser. No.
11/893,413, filed on Aug. 16, 2007, which is a divisional
application and claims benefit under 35 USC .sctn.120 of U.S.
application Ser. No. 10/104,440 filed Mar. 22, 2002, now U.S. Pat.
No. 7,731,959, issued Jun. 8, 2010, which is a continuation
application and claims benefit under 35 USC .sctn.120 of U.S. Ser.
No. 09/580,803 filed May 30, 2000, now abandoned, which is a
continuation application of International Application No.
PCT/US98/26114 filed Dec. 9, 1998, which designates the U.S. and
which claims the benefit under 35 U.S.C. .sctn.119(e) of U.S.
Provisional Application Ser. Nos. 60/069,155, filed Dec. 9, 1997;
60/069,687, filed Dec. 12, 1997; and 60/078,541, filed Mar. 19,
1998, the contents of each of which are incorporated herein by
reference in their entireties.
FIELD OF THE INVENTION
[0003] The present invention relates to antagonists of neuropilin
receptor function and use thereof in the treatment of cancer,
particularly metastatic cancer, and angiogenic diseases.
BACKGROUND OF THE INVENTION
[0004] Cancer, its development and treatment is a major health
concern. The standard treatments available are few and directed to
specific types of cancer, and provide no absolute guarantee of
success. Most treatments rely on an approach that involves killing
off rapidly growing cells in the hope that rapidly growing
cancerous cells will succumb, either to the treatment, or at least
be sufficiently reduced in numbers to allow the body's system to
eliminate the remainder. However most, of these treatments are
non-specific to cancer cells and adversely effect non-malignant
cells. Many cancers although having some phenotype relationship are
quite diverse. Yet, what treatment works most effectively for one
cancer may not be the best means for treating another cancer.
Consequently, an appreciation of the severity of the condition must
be made before beginning many therapies. In order to most
effective, these treatments require not only an early detection of
the malignancy, but an appreciation of the severity of the
malignancy. Currently, it can be difficult to distinguish cells at
a molecular level as it relates to effect on treatment. Thus,
methods of being able to screen malignant cells and better
understand their disease state are desirable.
[0005] While different forms of cancer have different properties,
one factor which many cancers share is that they can metastasize.
Until such time as metastasis occurs, --a tumor, although it may be
malignant, is confined to one area of the body. This may cause
discomfort and/or pain, or even lead to more serious problems
including death, but if it can be located, it may be surgically
removed and, if done with adequate care, be treatable. However,
once metastasis sets in, cancerous cells have invaded the body and
while surgical resection may remove the parent tumor, this does not
address other tumors. Only chemotherapy, or some particular form of
targeting therapy, then stands any chance of success.
[0006] The process of tumor metastasis is a multistage event
involving local invasion and destruction of intercellular matrix,
intravasation into blood vessels, lymphatics or other channels of
transport, survival in the circulation, extravasation out of the
vessels in the secondary site and growth in the new location
(Fidler, et al., Adv. Cancer Res. 28, 149-250 (1978), Liotta, et
al., Cancer Treatment Res. 40, 223-238 (1988), Nicolson, Biochim.
Biophy. Acta 948, 175-224 (1988) and Zetter, N. Eng. J. Med. 322,
605-612 (1990)). Success in establishing metastatic deposits
requires tumor cells to be able to accomplish these steps
sequentially. Common to many steps of the metastatic process is a
requirement for motility. The enhanced movement of malignant tumor
cells is a major contributor to the progression of the disease
toward metastasis. Increased cell motility has been associated with
enhanced metastatic potential in animal as well as human tumors
(Hosaka, et al., Gann 69, 273-276 (1978) and Haemmerlin, et al.,
Int. J. Cancer 27, 603-610 (1981)).
[0007] Identifying factors that are associated with onset of tumor
metastasis is extremely important. In addition, to using such
factors for diagnosis and prognosis, those factors are an important
site for identifying new compounds that can be used for treatment
and as a target for treatment identifying new modes of treatment
such as inhibition of metastasis is highly desirable.
[0008] Tumor angiogenesis is essential for both primary tumor
expansion and metastatic tumor spread, and angiogenesis itself
requires ECM degradation (Blood et al., Biochim. Biophys. Acta
1032:89-118 (1990)). Thus, malignancy is a systemic disease in
which interactions between the neoplastic cells and their
environment play a crucial role during evolution of the
pathological process (Fidler, I. J., Cancer Metastasis Rev. 5:29-49
(1986)).
[0009] There is mounting evidence that VEGF may be a major
regulator of angiogenesis (reviewed in Ferrara, et al., Endocr.
Rev., 13, 18-32 (1992); Klagsbrun, et al., Curr. Biol., 3, 699-702
(1993); Ferrara, et al., Biochem. Biophjs. Res. Commun., 161,
851-858 (1989)). VEGF was initially purified from the conditioned
media of folliculostellate cells (Ferrara, et al., Biochem.
Biophjs. Res. Commun., 161, 851-858 (1989)) and from a variety of
tumor cell lines (Myoken, et al., Proc. Natl. Acad. Sci. USA,
88:5819-5823 (1991); Plouet, et al., EMBO. J., 8:3801-3806 (1991)).
VEGF was found to be identical to vascular permeability factor, a
regulator of blood vessel permeability that was purified from the
conditioned medium of U937 cells at the same time (Keck, et al.,
Science, 246:1309-1312 (1989)). VEGF is a specific mitogen for
endothelial cells (EC) in vitro and a potent angiogenic factor in
vivo. The expression of VEGF is up-regulated in tissue undergoing
vascularization during embryogenesis and the female reproductive
cycle (Brier, et al., Development, 114:521-532 (1992); Shweiki, et
al., J. Clin. Invest., 91:2235-2243 (1993)). High levels of VEGF
are expressed in various types of tumors, but not in normal tissue,
in response to tumor-induced hypoxia (Shweiki, et al., Nature
359:843-846 (1992); Dvorak et al., J. Exp. Med., 174:1275-1278
(1991); Plate, et al., Cancer Res., 53:5822-5827; Ikea, et al., J.
Biol. Chem., 270:19761-19766 (1986)). Treatment of tumors with
monoclonal antibodies directed against VEGF resulted in a dramatic
reduction in tumor mass due to the suppression of tumor angiogeneis
(Kim, et al., Nature, 382:841-844 (1993)). VEGF appears to play a
principle role in many pathological states and processes related to
neovascularization. Regulation of VEGF expression in affected
tissues could therefore be key in treatment or prevention of VEGF
induced neovascularization/angiogenesis.
[0010] VEGF exists in a number of different isoforms that are
produced by alternative splicing from a single gene containing
eight exons (Ferrara, et al., Endocr. Rev., 13:18-32 (1992);
Tischer, et al., J. Biol. Chem., 806:11947-11954 (1991); Ferrara,
et al., Trends Cardio Med., 3:244-250 (1993); Polterak, et al., J.
Biol. Chem., 272:7151-7158 (1997)). Human VEGF isoforms consists of
monomers of 121, 145, 165, 189, and 206 amino acids, each capable
of making an active homodimer (Polterak et al., J. Biol. Chem.,
272:7151-7158 (1997); Houck, et al., Mol. Endocrinol., 8:1806-1814
(1991)). The VEGF.sub.121 and VEGF.sub.165 isoforms are the most
abundant. VEGF.sub.121 is the only VEGF isoforms that does not bind
to heparin and is totally secreted into the culture medium.
VEGF.sub.165 is functionally different than VEGF.sub.121 in that it
binds to heparin and cell surface heparin sulfate proteoglycans
(HSPGs) and is only partially released into the culture medium
(Houck, et al., J. Biol. Chem., 247:28031-28037 (1992); Park, et
al., Mol. Biol. Chem., 4:1317-1326 (1993)). The remaining isoforms
are entirely associated with cell surface and extracellular matrix
HSPGs (Houck, et al., J. Biol. Chem., 247:28031-28037 (1992); Park,
et al., Mol. Biol. Chem., 4:1317-1326 (1993)).
[0011] VEGF receptor tyrosine kinases, KDR/Flk-1 and/or Flt-1, are
mostly expressed by EC (Terman, et al., Biochem. Biophys. Res.
Commun., 187:1579-1586 (1992); Shibuya, et al., Oncogene, 5:519-524
(1990); De Vries, et al., Science, 265:989-991 (1992); Gitay-Goran,
et al., J. Biol. Chem., 287:6003-6096 (1992); Jakeman, et al., J.
Clin. Invest., 89:244-253 (1992)). It appears that VEGF activities
such as mitogenicity, chemotaxis, and induction of morphological
changes are mediated by KDR/Flk-1 but not Flt-1, even though both
receptors undergo phosphorylation upon binding of VEGF (Millauer,
et al., Cell, 72:835-846 (1993); Waltenberger, et al., J. Biol.
Chem., 269:26988-26995 (1994); Seetharam, et al., Oncogene,
10:135-147 (1995); Yoshida, et al., Growth Factors, 7:131-138
(1996)). Recently, Soker et al., identified a new VEGF receptor
which is expressed on EC and various tumor-derived cell lines such
as breast cancer-derived MDA-MB-231 (231) cells (Soker, et al., J.
Biol. Chem., 271:5761-5767 (1996)). This receptor requires the VEGF
isoform to contain the portion encoded by exon 7. For example,
although both VEGF.sub.121 and VEGF.sub.165R bind to KDFt/Flk-1 and
Flt-1, only VEGF.sub.165 binds to the new receptor. Thus, this is
an isoform-specific receptor and has been named the VEGF.sub.165
receptor (VEGF.sub.165R). It will also bind the 189 and 206
isoforms. VEGF.sub.165R has a molecular mass of approximately 130
kDa, and it binds VEGF.sub.165 with a Kd of about
2.times.10.sup.-10 M, compared with approximately
5.times.10.sup.-12 M for KDR/Flk-1. In structure-function analysis,
it was shown directly that VEGF.sub.165 binds to VEGF.sub.165R via
its exon 7-encoded domain which is absent in VEGF.sub.121 (Soker,
et al., J. Biol. Chem., 271:5761-5767 (1996)). However, the
function of the receptor was unclear.
[0012] Identifying the alterations in gene expression which are
associated with malignant tumors, including those involved in tumor
progression and angiogenesis, is clearly a prerequisite not only
for a full understanding of cancer, but also to develop new
rational therapies against cancer.
[0013] A further problem arises, in that the genes characteristic
of cancerous cells are very often host genes being abnormally
expressed. It is quite often the case that a particular protein
marker for a given cancer while expressed in high levels in
connection with that cancer is also expressed elsewhere throughout
the body, albeit at reduced levels.
[0014] The current treatment of angiogenic diseases is inadequate.
Agents which prevent continued angiogenesis, e.g, drugs (TNP-470),
monoclonal antibodies, antisense nucleic acids and proteins
(angiostatin and endostatin) are currently being tested. See,
Battegay, J. Mol. Med., 73, 333-346 (1995); Hanahan et al., Cell,
86, 353-364 (1996); Folkman, N. Engl. J. Med., 333, 1757-1763
(1995). Although preliminary results with the antiangiogenic
proteins are promising, there is still a need for identifying genes
encoding ligands and receptors involved in angiogenesis for the
development of new antiangiogenic therapies.
SUMMARY OF THE INVENTION
[0015] We have isolated a cDNA encoding the VEGF.sub.165R gene (SEQ
ID NO: 1) and have deduced the amino acid sequence of the receptor
(SEQ ID NO:2) We have discovered that this novel VEGF receptor is
structurally unrelated to Flt-1 or KDR/Flk-1 and is expressed not
only by endothelial cells but by non-endothelial cells, including
surprisingly tumor cells.
[0016] In ascertaining the function of the VEGF.sub.165R we have
further discovered that this receptor has been identified as a cell
surface mediator of neuronal cell guidance and called neuropilin-1.
Kolodkin et al., Cell 90:753-762 (1997). We refer to the receptor
as VEGF.sub.165R/NP-1 or NP-1.
[0017] In addition to the expression cloning of VEGF.sub.165R/NP-1
cDNA we isolated another human cDNA clone whose predicted amino
acid sequence was 47% homologous to that of VEGF.sub.165R/NP-1 and
over 90% homologous to rat neuropilin-2 (NP-2) which was recently
cloned (Kolodkin, et al., Cell 90, 753-762 (1997)).
[0018] Our results indicate that VEGFI65R/NP-1 and NP-2 are
expressed by both endothelial and tumor cells. (FIG. 19) We have
shown that endothelial cells expressing both KDR and
VEGF.sub.165R/NP-1 respond with increased chemotaxis towards
VEGF.sub.165, not VEGF.sub.121, when compared to endothelial cells
expressing KDR alone. While not wishing to be bound by theory, we
believe that VEGF.sub.165R/NP-1 functions in endothelial cells to
mediate cell motility as a co-receptor for KDR.
[0019] We have also shown in the Boyden chamber motility assay that
VEGF.sub.165 stimulates 231 breast carcinoma cell motility in a
dose-response manner (FIG. 15A). VEGF.sub.121 had no effect
motility of these cells (FIG. 15B). Since tumor cells such as, 231
cells, do not express the VEGF receptors, KDR or Flt-1, while not
wishing to be bound by theory, we believe that tumor cells are
directly responsive to VEGF.sub.165 via VEGF.sub.165R/NP-1.
[0020] We have also analyzed two variants of Dunning rat prostate
carcinoma cells, AT2.1 cells, which are of low motility and low
metastatic potential, and AT3.1 cells, which are highly motile, and
metastatic. Cross-linking and Northern blot analysis show that
AT3.1 cells express abundant VEGF.sub.165R/NP-1, capable of binding
VEGF.sub.165, while AT2.1 cells don't express VEGF.sub.165R/NP-1
(FIG. 18). Immunostaining of tumor sections confirmed the
expression of VEGF.sub.165R/NP-1 in AT3.1, but not AT2.1 tumors
(FIG. 17). Additionally, immunostaining showed that in subcutaneous
AT3.1 and PC3 tumors, the tumor cells expressing VEGF.sub.165R/NP-1
were found preferentially at the invading front of the tumor/dermis
boundary (FIG. 17). Furthermore, stable clones of AT2.1 cells
overexpressing VEGF.sub.165R/NP-1 had enhanced motility in the
Boyden chamber assay. These results indicate that neuropilin
expression on tumor cells is associated with the motile, metastatic
phenotype and angiogenesis, and thus is an important target for
antiangiogenic and anticancer therapy.
[0021] The present invention relates to antagonists of neuropilin
(NP) receptor function that can be use to inhibit metastasis and
angiogenesis. Antagonists of invention can block the receptor
preventing ligand binding, disrupt receptor function, or inhibit
receptor occurrence. Specific antagonists include, for example,
compounds that bind to NP-1 or NP-2 and antibodies that
specifically binds the receptor at a region that inhibits receptor
function. For example, one can add an effective amount of a
compound that binds to NP-1 to disrupt receptor function and thus
inhibit metastasis.
[0022] We have surprisingly discovered that members of the
semaphorin/collapsins family are not only inhibitors of neuronal
guidance but also inhibitors of endothelial and tumor cell motility
in cells that express neuropilin. Accordingly, preferred
antagonists include members of the semaphorin/collapsins family or
fragments thereof that bind NP and have VEGF antagonist activity as
determined, for example, by the human umbilical vein endothelial
cell (HUVEC) proliferation assay using VEGF.sub.165 as set forth in
Soker et al., J. Biol. Chem. 272, 31582-31588 (1997). Preferably,
the semaphorin/collapsin has at least a 25% reduction in HUVEC
proliferation, more preferably a 50% reduction, even more
preferably a 75% reduction, most preferably a 95% reduction.
[0023] VEGF antagonist activity of the semaphorin/collapsin may
also be determined by inhibition of binding of labeled VEGF.sub.165
to VEGF.sub.165R as disclosed in Soker et al., J. Biol. Chem. 271,
5761-5767 (1996)) or to PAE/NP cells. Preferably, the portion
inhibits binding by at least 25%, more preferably 50%, most
preferably 75%.
[0024] In accordance with the present invention, neuropilin
antagonists, or nucleic acids, e.g., DNA or RNA, encoding such
antagonists, are useful as inhibitors of VEGF and NP function and
can be used to treat diseases, disorders or conditions associated
with VEGF and NP expression. The antagonists can be used alone or
in combination with other anti-VEGF strategies including, for
example, those that antagonize VEGF directly (e.g. anti-VEGF
antibodies, soluble VEGF receptor extracellular domains), or
antagonize VEGF receptors (e.g. anti-KDR antibodies, KDR kinase
inhibitors, dominant-negative VEGF receptors) (Presta L G, et al.,
Cancer Res. 57: 4593-4599 (1997), Kendall R L, et al., (1996)
Biochem. Biophys. Res. Commun. 226: 324-328, Goldman C K, et al.,
(1998) Proc. Natl. Acad. Sci. USA 95: 8795-8800, Strawn L M, et
al., (1996) Cancer Res. 56: 3540-3545, Zhu Z, et al., (1998).
Cancer Res. 58: 3209-3214, Witte L, et al., (1998). Cancer
Metastasis Rev. 17: 155-161.)
[0025] Diseases, disorders, or conditions, associated with VEGF,
include, but are not limited to retinal neovascularization,
hemagiomas, solid tumor growth, leukemia, metastasis, psoriasis,
neovascular glaucoma, diabetic retinopathy, rheumatoid arthritis,
endometriosis, mucular degeneration, osteoarthtitis, and
retinopathy of prematurity (ROP).
[0026] In another embodiment, one can use isolated VEGF165R/NP-1 or
NP-2 or cells 10 expressing these receptors in assays to discover
compounds that bind to or otherwise interact with these receptors
in order to discover NP antagonists that can be used to inhibit
metastasis and/or angiogenesis.
[0027] Other aspects of the invention are disclosed infra.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 shows purification of VEGF.sub.165R From 231 Cells.
.sup.125I-VEGF.sub.165 (5 ng/ml) was bound and cross-linked to
receptors on 231 cells and analyzed by SDS PAGE and autoradiography
(lane 1). VEGF.sub.165R was purified by Con A and VEGF.sub.165
affinity column chromatography and analyzed by SDS-PAGE and silver
stain (lane 2). Two prominent bands were detected (arrows) and
N-terminally sequenced separately. Their N-terminal 18 amino acid
sequences are shown to the right of the arrows. The published
N-terminal sequences of human and mouse neuropilin (Kawakami et
al., J. Neurobiol., 29, 1-17 (1995); He and Tessier-Lavigne, Cell
90, 739-751 1997) are shown below (SEQ ID NOS: 5 and 6).
[0029] FIGS. 2A and 2B show isolation of VEGF.sub.165R cDNA by
Expression Cloning. Photomicrographs (dark field illumination) of
COS 7 cells binding .sup.125I-VEGF.sub.165. .sup.125I-VEGF.sub.165
was bound to transfected COS 7 cells which were then washed, fixed,
and overlayed with photographic emulsion that was developed as
described in the example, infra.
[0030] FIG. 2A shows COS 7 cells were transfected with a primary
plasmid pool (#55 of the 231 cell library) representing
approximately 3.times.10.sup.3 clones and one COS 7 cell binding
.sup.125I-VEGF.sub.165 in the first round of screening is
shown.
[0031] FIG. 2B shows several COS 7 cells transfected with a single
positive cDNA 5 clone (A2) binding .sup.125I-VEGF.sub.165 after the
third round of screening.
[0032] FIG. 3 shows the Deduced Amino Acid Sequence of Human
VEGF.sub.165R/NP-1 (SEQ ID NO:3). The deduced 923 amino acid
sequence of the open reading frame of VEGF.sub.165R/NP-1, clone A2
(full insert size of 6.5 kb) is shown. The putative signal peptide
sequence (amino acids 1-21) and the putative transmembrane region
(amino acids 860-883) are in boxes. The amino acid sequence
obtained by N-terminal amino acid sequencing (FIG. 3, amino acids
22-39) is underlined. The arrow indicates where the signal peptide
has been cleaved and removed, based on comparison of the N-terminal
sequence of purified VEGF.sub.165R/NP-1 and the cDNA sequence. The
sequence of human VEGF.sub.165R/NP-1 reported here differs from
that reported by He et al. (He and Tessier-Lavigne, Cell 90,
739-751 (1997)) in that we find Lys.sub.26 rather than Glu.sub.26,
and Asp.sub.855 rather than Glu.sub.855. Lys.sub.26 and Asp.sub.855
are found, however, in mouse and rat VEGF.sub.165R/NP-1 (Kwakami et
al., J. Neurobiol. 29, 1-17 (1995); He and Tessier-Lavigne, Cell
90, 739-751 (1997)).
[0033] FIGS. 4A and 4B show the Comparison of the Deduced Amino
Acid Sequence of Human VEGF.sub.165R/NP-1 (SEQ ID NO:2) and NP-2
(SEQ ID NO:4). The deduced open reading frame amino acid sequences
of VEGF.sub.165R/NP-1 and NP-2 are aligned using the DNASIS
program. Amino acids that are identical in both open reading frames
are shaded. The overall homology between the two sequences is
43%.
[0034] FIG. 5 shows a Northern Blot Analysis of VEGF.sub.165R/NP-1
Expression in Human EC and Tumor-Derived Cell Lines. Total RNA
samples prepared from HUVEC (lane 1) and tumor-derived breast
carcinoma, prostate carcinoma and melanoma cell lines as indicated
(lanes 2-8) were resolved on a 1% agarose gel and blotted onto a
GeneScreen nylon membrane. The membrane was probed with
.sup.32P-labeled VEGF.sub.165R/NP-1 cDNA and exposed to X-ray film.
Equal RNA loading was demonstrated by ethydium bromide staining of
the gel prior to blotting. A major species of VEGF.sub.165R/NP-1
mRNA of approximately 7 kb was detected in several of the cell
lines.
[0035] FIG. 6 shows a Northern Blot Analysis of VEGF.sub.165R/NP-1
and KDR mRNA in Adult Human Tissues. A pre-made Northern blot
membrane containing multiple samples of human mRNA (Clonetech) was
probed with .sup.32P-labeled VEGF.sub.165R/NP-1 cDNA (top) as
described in FIG. 5, and then stripped and reprobed with
.sup.32P-labeled KDR cDNA (bottom).
[0036] FIGS. 7A and 7B show a Scatchard Analysis of VEGF165 binding
to VEGF.sub.165R/NP-1. FIG. 7A. Increasing amounts of
.sup.125I-VEGF.sub.165 (0.1-50 ng/ml) were added to subconfluent
cultures of PAE cells transfected with human VEGF.sub.165R/NP-1
cDNA (PAE/NP-1 cells) in 48 well dishes. Non-specific binding was
determined by competition with a 200-fold excess of unlabeled
VEGF.sub.165. After binding, the cells were washed, lysed and the
cell-associated radioactivity was determined using a y counter.
[0037] FIG. 7B. The binding data shown in FIG. 7A were analyzed by
the method of Scatchard, and a best fit plot was obtained with the
LIGAND program (Munson and Rodbard, 1980). PAE/NP-1 cells express
approximately 3.times.10.sup.5 VEGF.sub.165 binding sites per cell
and bind .sup.125I-VEGF.sub.165 with a K.sub.d of
3.2.times.10.sup.-10 M.
[0038] FIG. 8 shows cross-linking of VEGF.sub.165 (left and center
panels) and VEGF.sub.121 (right panel) to PAE cells Expressing
VEGF.sub.165R/NP-1 and/or KDR. .sup.125I-VEGF.sub.165 (5 ng/ml)
(lanes 1-6) or .sup.125I-VEGF.sub.121 (10 ng/ml) (lanes 7-10) were
bound to subconfluent cultures of HUVEC (lane 1), PC3 (lane 2), PAE
(lanes 3 and 7), a clone of PAE cells transfected with human
VEGF.sub.165R/NP-1 cDNA (PAE/NP-1) (lanes 4 and 8), a clone of PAE
cells transfected with KDR (PAE/KDR) (lanes 5 and 9), and a clone
of PAE/KDR cells transfected with human VEGF.sub.165R/NP-1 cDNA
(PAE/KDR/NP-1) (lanes 6 and 10). The binding was carried out in the
presence of 1 pg/ml heparin. At the end of a 2 hour incubation,
each .sup.125I-VEGF isoform was chemically cross-linked to the cell
surface. The cells were lysed and proteins were resolved by 6%
SDS-PAGE. The polyacrylamide gel was dried and exposed to X-ray
film. Solid arrows denote radiolabeled complexes containing
125I-VEGF and KDR, open arrows denote radiolabeled complexes
containing .sup.125I-VEGF and VEGF.sub.165R/NP-1.
[0039] FIG. 9 shows cross linking of VEGF.sub.165 to PAE/KDR Cells
Co-expressing VEGF.sub.165R/N13-1 Transiently. PAE/KDR cells were
transfected with pCPhygro or pCPhyg-NP-1 plasmids as described in
"Experimental Procedures", and grown for 3 days in 6 cm dishes.
.sup.125I-VEGF.sub.165 (5 ng/ml) was bound and cross linked to
parental PAE/KDR cells (lane 1), to PAE/KDR cells transfected with
pCPhygro vector control (V) (lane 2), to PAE/KDR cells transfected
with pCPhyg-VEGF.sub.165R/NP-1 plasmids (VEGF.sub.165R/NP-1) (lane
3), and to HUVEC (lane 4).). The binding was carried out in the
presence of 1 .mu.g/ml heparin. The cells were lysed and proteins
were resolved by 6% SDS-PAGE as in FIG. 8. Solid arrows denote
radiolabeled complexes containing .sup.125I-VEGF.sub.165 and KDR.
Open arrows denote radiolabeled complexes containing
.sup.125I-VEGF.sub.165 and VEGF.sub.165R/NP-1.
[0040] FIG. 10 shows inhibition of .sup.125I-VEGF.sub.165 binding
to VEGF.sub.165R/NP-1 interferes with its binding to KDR.
.sup.125I-VEGF.sub.165 (5 ng/ml) was bound to subconfluent cultures
of PAE transfected with human VEGF.sub.165R/NP-1 cDNA (PAE/NP-1)
(lanes 1 and 2), PAE/KDR cells (lanes 3 and 4), and PAE/KDR cells
transfected with human VEGF.sub.165R/NP-1 cDNA (PAE/KDR/NP-1)
(lanes 5 and 16) in 35 mm dishes. The binding was carried out in
the presence (lanes 2, 4, and 6) or the absence (lanes 1, 3, and 5)
of 25 .mu.g/ml GST-Ex 7+8. Heparin (1 .mu.g/ml) was added to each
dish. At the end of a 2 hour incubation, .sup.125I-VEGF.sub.165 was
chemically cross-linked to the cell surface. The cells were lysed
and proteins were resolved by 6% SDS-PAGE as in FIG. 9. Solid
arrows denote radiolabeled complexes containing
.sup.125I-VEGF.sub.165 and KDR, open arrows denote radiolabeled
complexes containing .sup.125I-VEGF.sub.165 and
VEGF.sub.165R/NP-1.
[0041] FIGS. 11A-11C show a model for VEGF.sub.165R/NP-1 modulation
of VEGF.sub.165 Binding to KDR. FIG. 11A. Cells expressing KDR
alone. FIG. 11B. Cells co-expressing KDR and VEGF.sub.165R/NP-1.
FIG. 11C. Cells co-expressing KDR and VEGF.sub.165R/NP-1 in the
presence of GST-Ex 7-1-8 fusion protein.
[0042] A single KDR receptor or a KDR-VEGF.sub.165R/NP-1 pair is
shown in top portion of FIGS. 11A-11C. An expanded view showing
several receptors is shown in the bottom portion of FIGS. 11A-11C.
VEGF.sub.165 binds to KDR via exon 4 and to VEGF.sub.165R/NP-1 via
exon 7 (Keyt et al. J. Biol. Chem. 271, 5638-5646 (1996b); Soker et
al., J. Biol. Chem. 271, 5761-5767 (1996)). A rectangular
VEGF.sub.165 molecule represents a suboptimal conformation that
doesn't bind to KDR efficiently while a rounded VEGF.sub.165
molecule represents one that fits better into a binding site. In
cells expressing KDR alone, VEGF.sub.165 binds to KDR in a
sub-optimal manner. In cells co-expressing KDR and
VEGF.sub.165R/NP-1, the binding efficiency of VEGF.sub.165 to KDR
is enhanced. It may be that the presence of VEGF.sub.165R/NP-1
increases the concentration of VEGF.sub.165 on the cell surface,
thereby presenting more growth factor to KDR. Alternatively,
VEGF.sub.165R/NP-1 may induce a change in VEGF.sub.165 conformation
that allows better binding to KDR, or both might occur. In the
presence of GST-Ex 7+8, VEGF.sub.165 binding to VEGF.sub.165R/NP-1
is competitively inhibited and its binding to KDR reverts to a
sub-optimal manner.
[0043] FIG. 12 shows the human NP-2 amino acid sequence (SEQ ID
NO:4).
[0044] FIGS. 13A, 13B and 13C show the human NP-2 DNA sequence (SEQ
ID NO:3).
[0045] FIGS. 14A, 14B, 14C, 14D, 14E and 14F show the nucleotide
(SEQ ID NO:1) and amino acid sequences (SEQ ID NO:2) of
VEGF.sub.165R/NP-1.
[0046] FIGS. 15A and 15B show VEGF.sub.165 stimulation of MDA MB
231 cell motility. (FIG. 15A) Dose response of VEGF.sub.165
motility activity. (FIG. 15B) Both VEGF.sub.165 and bFGF stimulate
motility but VEGF.sub.121 does not.
[0047] FIGS. 16A, 16B and 16C show motility and neuropilin-1
expression of Dunning rat prostate carcinoma cell lines AT3-1 (high
motility, high metastatic potential) and AT2.1 (low motility, low
metastatic potential) cells. (FIG. 16A) AT3.1 cells are more motile
than AT2.1 cells in a Boyden chamber assay. (FIG. 16B)
.sup.125I-VEGF.sub.165 cross-links neuropilin-1 on AT3.1 cells but
does not cross-link to AT2.1 cells. (FIG. 16C) AT3.1 but not AT2.1
cells express neuropilin-1, while both cell types express VEGF.
[0048] FIGS. 17A, 17B and 17C show immunostaining of (FIG. 17A) a
PC3 subcutaneous tumor in a nude mouse, (FIG. 17B) an AT3.1 tumor
in a rat, (FIG. 17C) an AT2.1 tumor in rat with anti-neuropilin-1
antibodies. Neuropilin immunostaining is preferentially associated
with PC3 and AT3.1 tumor cells at the tumor/dermis boundary. Some
of these cells cluster around blood vessels. AT2.1 cells do not
express neuropilin-1.
[0049] FIGS. 18A and 18B show overexpression of neuropilin-1 in
AT2.1 cells. (FIG. 18A) Western blot, (FIG. 18B) motility activity.
Three AT2.1 clones (lanes 4, 5, 6) express higher amounts of
neuropilin-1 protein and are more motile compared to parental AT2.1
cells or AT2.1 vector (AT2.1N) controls and approach AT3.1 cell
neuropilin-1 levels and migration activity.
[0050] FIG. 19 shows expression of NP-1, NP-2 and p-actin in cancer
cell lines and endothelial cells using reverse transcriptase PCR
following primers:
TABLE-US-00001 Human NP-1 Forward (328-351): (SEQ ID NO: 7) 5'
TTTCGCAACGATAAATGTGGCGAT 3' Reverse (738-719): (SEQ ID NO: 8) 5'
TATCACTCCACTAGGTGTTG 3' Human NP-2 Forward (513-532): (SEQ ID NO:
9) 5' CCAACCAGAAGATTGTCCTC 3' Reverse (1181-1162): (SEQ ID NO: 10)
5' GTAGGTAGATGAGGCACTGA 3'.
[0051] FIG. 20 shows the effects of collapsin-1 treatment on PAE
cell motility in a Boyden chamber. Collpasin-1 inhibits, by about
65% the basal migration of PAE cells expressing neuropilin-1 but
not PAE cells expressing KDR alone One collapsing unit is about 3
ng/ml.
[0052] FIGS. 21A and 21B show results of the aortic ring assay.
Collapsin was added (FIG. 21A) or not added (FIG. 21B) to a segment
of rat aortic ring and the migration of endothelial cells out of
the rings and their formation of tubes was monitored after a week
in organ culture. Migration and tube formation are inhibited by
collapsin-1.
DETAILED DESCRIPTION OF THE INVENTION
[0053] We have discovered that there are VEGF receptors (VEGFR) and
neuropilins such as VEGF.sub.165R/NP-1 and NP-2 that are associated
with metastatic potential of a malignant cell and angiogenesis. As
used herein, "neuropilin" includes not only VEGF.sub.165R/NP-1 and
NP-2 but any neuropilin or VEGFR, where the constituents share at
least about 85% homology with either of the above
VEGF.sub.165R/NP-1 and NP-2 can be used. More preferably, such
constituent shares at least 90% homology. Still more preferably,
each constituent shares at least 95% homology.
[0054] Homology is measured by means well known in the art. For
example % homology can be determined by any standard algorithm used
to compare homologies. These include, but are not limited to BLAST
2.0 such as BLAST 2.0.4 and i. 2.0.5 available from the NIH (See
www.ncbi.nlm.nkh.gov/BLAST/newblast.html) (Altschul, S. F., et al.
Nucleic Acids Res. 25: 3389-3402 (1997)) and DNASIS (Hitachi
Software Engineering America, Ltd.). These programs should
preferably be set to an automatic setting such as the standard
default setting for homology comparisons. As explained by the NIH,
the scoring of gapped results tends to be more biologically
meaningful than ungapped results.
[0055] For ease of reference, this disclosure will generally talk
about VEGF.sub.165R/NP-1 and NP-2 and/or homologs thereof but all
teaching are applicable to the above-described homologs.
[0056] In another embodiment a VEGFR can be used as long as it
binds to a sequence having at least 90%, more preferably 95%
homology to exon 7 of VEGF.sub.165. These VEGF receptors and
neuropilins, e.g., VEGF.sub.165R/NP-1 and NP-2, are associated with
both tumor metastases and angiogenesis. We have shown that
expression of VEGF.sub.165FUNP-1 and NP-2 is upregulated in highly
metastatic prostate cancer cell lines relative to poorly metastatic
or nonmetastatic lines. Thus, expression of VEGF.sub.165R/NP-1 and
NP-2 is associated with a tumors metastatic potential.
[0057] In accordance with the present invention, antagonists of
neuropilin receptor function can be used inhibit or prevent the
metastasis process and/or angiogenesis. Antagonists of the
invention can block the receptors preventing ligand binding,
disrupt receptor function, or inhibit receptor occurrence. Specific
antagonists include, for example, compounds that bind to NP-1 or
NP-2 and antibodies that specifically binds the receptor at a
region that inhibits receptor function. For example, one can add an
effective amount of a compound that binds to NP-1 to disrupt
receptor function and thus inhibit metastasis.
[0058] Preferred antagonists include members of the
semaphorin/collapsins family. We have surprisingly discovered that
members of the semaphorin/collapsins family are not only inhibitors
of neuronal guidance but also inhibitors of endothelial and tumor
cell motility in cells that express neuropilin. Collapsin-1 is a
particularly preferred antagonist. Other members of the semaphorin
collapsin family can be selected by screening for neuropilin
binding.
[0059] Semaphorin/collapsins are a family of 100 kDa glycoproteins
(Luo, et al. (1993) Cell 75: 217-2271 Kolodkin, et al., (1993) Cell
75: 1389-1399, Behar, et al., (1996) Nature 383: 525-528.)
Semaphorins are the mammalian homologue and collapsins are the
chick homologue. Semaphorins are expressed primarily in the
developing CNS, but are also found in developing bones and heart.
The receptors for the semaphorins are neuropilin-1 and neuropilin-2
(He, et al., Cell 90, 739-751 (1997), Kolodkin, et al, Cell 90,
753-762 (1997)) and there is ligand binding specificity for
different semaphorin family members (Chen, et al., Neuron
19:547-559 (1997)). The Kd for semaphorin binding is about
3.times.10.sup.-10 M, similar to that for VEGF.sub.165 binding to
neuropilin-1. Semaphorins mediate neuronal guidance by repelling
and collapsing advancing dorsal root ganglion (DRG) growth
cones.
[0060] Semaphorin/collapsins are know in the art and can be
isolated from natural sources or produced using recombinant DNA
methods. See, for example, U.S. Pat. No. 5,807,826. Additionally,
fragments of the semaphorin/collapsins may be used. For example, a
70 amino acid region within the semaphorin domain specifies the
biological activities of three collapsin family members (Koppel, et
al., Neuron 19: 531-537).
[0061] Pure recombinant chick collapsin-1 (semaphorin III) was can
be produced by the methods set forth in the following references
(Luo, et al. (1993) Cell 75: 217-227.); Koppel, et al./Biol. Chem.
273: 15708-15713, Feiner, et al. (1997) Neuron 19: 539-545).
[0062] We have shown that when collapsin-1 was added to cultures of
porcine endothelial cells (PAE) and PAE neuropilin-1 and/or KDR
transfectants, 1251-Collapsin was found to bind to PAE cells
expressing neuropilin-1 but not to PAE cells expressing KDR.
Furthermore, in a Boyden chamber assay, collapsin-1 inhibited the
basal migration of PAE expressing neuropilin-1, by about 60-70%,
but had no effect on parental PAE or PAE expressing KDR alone (FIG.
20). Inhibition was dose-dependent and half-maximal inhibition
occurred with 50 collapsing units/ml (as measured on DRG, 1 CU=3
ng/ml). Thus, semaphorin/collapsins inhibit the motility of
non-neuronal cells as long as neuropilin-1 is expressed.
[0063] Antibodies that specifically binds the NP at a region that
inhibits receptor function can also be used as antagonists of the
invention. Antibodies may be raised against either a peptide of the
receptor or the whole molecule. Such a peptide may be presented
together with a carrier protein, such as an KLH, to an animal
system or, if it is long enough, say 25 amino acid residues,
without a carrier.
[0064] In accordance with yet another aspect of the present
invention, there are provided isolated antibodies or antibody
fragments which selectively binds the receptor. The antibody
fragments include, for example, Fab, Fab', F(ab')2 or Fv fragments.
The antibody may be a single chain antibody, a humanized antibody
or a chimeric antibody.
[0065] Antibodies, or their equivalents, or other receptor
antagonists may also be used in accordance with the present
invention for the treatment or prophylaxis of cancers.
Administration of a suitable dose of the antibody or the antagonist
may serve to block the receptor and this may provide a crucial time
window in which to treat the malignant growth.
[0066] Prophylaxis may be appropriate even at very early stages of
the disease, as it is not known what specific event actually
triggers metastasis in any given case. Thus, administration of the
antagonists which interfere with receptor activity, may be effected
as soon as cancer is diagnosed, and treatment continued for as long
as is necessary, preferably until the threat of the disease has
been removed. Such treatment may also be used prophylactically in
individuals at high risk for development of certain cancers, e.g.,
prostate or breast.
[0067] It will be appreciated that antibodies for use in accordance
with the present invention may be monoclonal or polyclonal as
appropriate. Antibody equivalents of these may comprise: the Fab'
fragments of the antibodies, such as Fab, Fab', F(ab')2 and Fv;
idiotopes; or the results of allotope grafting (where the
recognition region of an animal antibody is grafted into the
appropriate region of a human antibody to avoid an immune response
in the patient), for example. Single chain antibodies may also be
used. Other suitable modifications and/or agents will be apparent
to those skilled in the art.
[0068] Chimeric and humanized antibodies are also within the scope
of the invention. It is expected that chimeric and humanized
antibodies would be less immunogenic in a human subject than the
corresponding non-chimeric antibody. A variety of approaches for
making chimeric antibodies, comprising for example a non-human
variable region and a human constant region, have been described.
See, for example, Morrison et al., Proc. Natl. Acad. Sci. U.S.A.
81, 6851 (1985); Takeda, et al., Nature 314, 452 (1985), Cabilly et
al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397;
Tanaguchi et al., European Patent Publication EP 171496; European
Patent Publication 0173494, United Kingdom Patent GB 2177096B.
Additionally, a chimeric antibody can be further "humanized" such
that parts of the variable regions, especially the conserved
framework regions of the antigen-binding domain, are of human
origin and only the hypervariable regions are of non-human origin.
Such altered immunoglobulin molecules may be made by any of several
techniques known in the art, (e.g., Teng et al., Proc. Natl. Acad.
Sci. U.S.A., 80, 7308-7312 (1983); Kozbor et al., Immunology Today,
4, 7279 (1983); Olsson et al., Meth. Enzymol., 92, 3-16 (1982)),
and are preferably made according to the teachings of PCT
Publication WO92/06193 or EP 0239400. Humanized antibodies can be
commercially produced by, for example, Scotgen Limited, 2 Holly
Road, Twickenham, Middlesex, Great Britain.
[0069] The present invention further provides use of neuropilin for
intracellular or extracellular targets to affect binding.
Intracellular targeting can be accomplished through the use of
intracellularly expressed antibodies referred to as intrabodies.
Extracellular targeting can be accomplished through the use of
receptor specific antibodies.
[0070] These methods can be used to inhibit metastasis in malignant
cells as we have found that the presence of these receptors is
positively correlated with metastasis. One can treat a range of
afflictions or diseases associated with expression of the receptor
by directly blocking the receptor. This can be accomplished by a
range of different approaches. One preferred approach is the use of
antibodies that specifically block VEGF binding to the receptor.
For example, an antibody to the VEGF binding site. Antibodies to
these receptors can be prepared by standard means. For example, one
can use single chain antibodies to target these binding sites.
[0071] The antibody can be administered by a number of methods. One
preferred method is set forth by Marasco and Haseltine in PCT
WO94/02610, which is incorporated herein by reference. This method
discloses the intracellular delivery of a gene encoding the
antibody. One would preferably use a gene encoding a single chain
antibody. The antibody would preferably contain a nuclear
localization sequence. One preferably uses an SV40 nuclear
localization signal. By this method one can intracellularly express
an antibody, which can block VEGF.sub.165R/NP-1 or NP-2 functioning
in desired cells.
[0072] DNA encoding human VEGF.sub.165R/NP-1 or NP-2 and
recombinant human VEGF.sub.165R/NP-1 or NP-2 may be produced
according to the methods set forth in the Examples.
[0073] The receptors are preferably produced by recombinant
methods. A wide variety of molecular and biochemical methods are
available for generating and expressing the polypeptides of the
present invention; see e.g. the procedures disclosed in Molecular
Cloning, A Laboratory Manual (2nd Ed., Sambrook, Fritsch and
Maniatis, Cold Spring Harbor), Current Protocols in Molecular
Biology (Eds. Aufubel, Brent, Kingston, More, Feidman, Smith and
Stuhl, Greene Publ. Assoc., Wiley-Interscience, NY, N.Y. 1992) or
other procedures that are otherwise known in the art. For example,
the polypeptides of the invention may be obtained by chemical
synthesis, expression in bacteria such as E. coli and eukaryotes
such as yeast, baculovirus, or mammalian cell-based expression
systems, etc., depending on the size, nature and quantity of the
polypeptide.
[0074] The term "isolated" means that the polypeptide is removed
from its original environment (e.g., the native VEGF molecule). For
example, a naturally-occurring polynucleotides or polypeptides
present in a living animal is not isolated, but the same
polynucleotides or DNA or polypeptides, separated from some or all
of the coexisting materials in the natural system, is isolated.
Such polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a composition, and
still be isolated in that such vector or composition is not part of
its natural environment.
[0075] Where it is desired to express the receptor or a fragment
thereof, any suitable system can be used. The general nature of
suitable vectors, expression vectors and constructions therefor
will be apparent to those skilled in the art.
[0076] Suitable expression vectors may be based on phages or
plasmids, both of which are generally host-specific, although these
can often be engineered for other hosts. Other suitable vectors
include cosmids and retroviruses, and any other vehicles, which may
or may not be specific for a given system. Control sequences, such
as recognition, promoter, operator, inducer, terminator and other
sequences essential and/or useful in the regulation of expression,
will be readily apparent to those skilled in the art.
[0077] Correct preparation of nucleotide sequences may be
confirmed, for example, by the method of Sanger et al. (Proc. Natl.
Acad. Sci. USA 74:5463-7 (1977)).
[0078] A DNA fragment encoding the receptor or fragment thereof,
may readily be inserted into a suitable vector. Ideally, the
receiving vector has suitable restriction sites for ease of
insertion, but blunt-end ligation, for example, may also be used,
although this may lead to uncertainty over reading frame and
direction of insertion. In such an instance, it is a matter of
course to test transformants for expression, 1 in 6 of which should
have the correct reading frame. Suitable vectors may be selected as
a matter of course by those skilled in the art according to the
expression system desired.
[0079] By transforming a suitable organism or, preferably,
eukaryotic cell line, such as HeLa, with the plasmid obtained,
selecting the transformant with ampicillin or by other suitable
means if required, and adding tryptophan or other suitable
promoter-inducer (such as indoleacrylic acid) if necessary, the
desired polypeptide or protein may be expressed. The extent of
expression may be analyzed by SDS polyacrylamide gel
electrophoresis-SDS-PAGE (Lemelli, Nature 227:680-685 (1970)).
[0080] Suitable methods for growing and transforming cultures etc.
are usefully 20 illustrated in, for example, Maniatis (Molecular
Cloning, A Laboratory Notebook, Maniatis et al. (eds.), Cold Spring
Harbor Labs, N.Y. (1989)).
[0081] Cultures useful for production of polypeptides or proteins
may suitably be cultures of any living cells, and may vary from
prokaryotic expression systems up to eukaryotic expression systems.
One preferred prokaryotic system is that of E. coli, owing to its
ease of manipulation. However, it is also possible to use a higher
system, such as a mammalian cell line, for expression of a
eukaryotic protein. Currently preferred cell lines for transient
expression are the HeLa and Cos cell lines. Other expression
systems include the Chinese Hamster Ovary (CHO) cell line and the
baculovirus system.
[0082] Other expression systems which may be employed include
streptomycetes, for example, and yeasts, such as Saccharomyces
spp., especially S. cerevisiae. Any system may be used as desired,
generally depending on what is required by the operator. Suitable
systems may also be used to amplify the genetic material, but it is
generally convenient to use E. coli for this purpose when only
proliferation of the DNA is required.
[0083] The polypeptides and proteins may be isolated from the
fermentation or cell culture and purified using any of a variety of
conventional methods including: liquid chromatography such as
normal or reversed phase, using HPLC, FPLC and the like; affinity
chromatography (such as with inorganic ligands or monoclonal
antibodies); size exclusion chromatography; immobilized metal
chelate chromatography; gel electrophoresis; and the like. One of
skill in the art may select the most appropriate isolation and
purification techniques without departing from the scope of this
invention.
[0084] The present invention also provides binding assays using
VEGF.sub.165R/NP-1 or NP-2 that permit the ready screening for
compounds which affect the binding of the receptor and its ligands,
e.g., VEGF.sub.165. These assays can be used to identify compounds
that modulate, preferably inhibit metastasis and/or angiogenesis.
However, it is also important to know if a compound enhances
metastasis so that its use can be avoided. For example, in a direct
binding assay the compound of interest can be added before or after
the addition of the labeled ligand, e.g., VEGF.sub.165, and the
effect of the compound on binding or cell motility or angiogenesis
can be determined by comparing the degree of binding in that
situation against a base line standard with that ligand, not in the
presence of the compound. The assay can be adapted depending upon
precisely what is being tested.
[0085] The preferred technique for identifying molecules which bind
to the neuropilin receptor utilizes a receptor attached to a solid
phase, such as the well of an assay plate. The binding of the
candidate molecules, which are optionally labeled (e.g.,
radiolabeled), to the immobilized receptor can be measured.
Alternatively, competition for binding of a known, labeled receptor
ligand, such as I-.sup.125VEGF.sub.165, can be measured. For
screening for antagonists, the receptor can be exposed to a
receptor ligand, e.g., VEGF.sub.165, followed by the putative
antagonist, or the ligand and antagonist can be added to the
receptor simultaneously, and the ability of the antagonist to block
receptor activation can be evaluated. For example, VEGF antagonist
activity may also be determined by inhibition of binding of labeled
VEGF.sub.165 to VEGF.sub.165R as disclosed in the Examples.
[0086] The ability of discovered antagonists to influence
angiogenesis or metastasis can also be determined using a number of
know in vivo and in vitro assays. Such assays are disclosed in Jain
et al., Nature Medicine 3, 1203-1208 (1997), and the examples.
[0087] Where the present invention provides for the administration
of, for example, antibodies to a patient, then this may be by any
suitable route. If the tumor is still thought to be, or diagnosed
as, localized, then an appropriate method of administration may be
by injection direct to the site. Administration may also be by
injection, including subcutaneous, intramuscular, intravenous and
intradermal injections.
[0088] Formulations may be any that are appropriate to the route of
administration, and will be apparent to those skilled in the art.
The formulations may contain a suitable carrier, such as saline,
and may also comprise bulking agents, other medicinal preparations,
adjuvants and any other suitable pharmaceutical ingredients.
Catheters are one preferred mode of administration.
[0089] Neuropilin expression may also be inhibited in vivo by the
use of antisense technology. Antisense technology can be used to
control gene expression through triple-helix formation or antisense
DNA or RNA, both of which methods are based on binding of a
polynucleotide to DNA or RNA. An antisense nucleic acid molecule
which is complementary to a nucleic acid molecule encoding receptor
can be designed based upon the isolated nucleic acid molecules
encoding the receptor provided by the invention. An antisense
nucleic acid molecule can comprise a nucleotide sequence which is
complementary to a coding strand of a nucleic acid, e.g.
complementary to an mRNA sequence, constructed according to the
rules of Watson and Crick base pairing, and can hydrogen bond to
the coding strand of the nucleic acid. The antisense sequence
complementary to a sequence of an mRNA can be complementary to a
sequence in the coding region of the mRNA or can be complementary
to a 5' or 3' untranslated region of the mRNA. Furthermore, an
antisense nucleic acid can be complementary in sequence to a
regulatory region of the gene encoding the mRNA, for instance a
transcription initiation sequence or regulatory element.
Preferably, an antisense nucleic acid complementary to a region
preceding or spanning the initiation codon or in the 3'
untranslated region of an mRNA is used. An antisense nucleic acid
can be designed based upon the nucleotide sequence shown in SEQ ID
NO:1 (VEGF.sub.165R/NP-1) or SEQ ID NO:3 (NP-2). A nucleic acid is
designed which has a sequence complementary to a sequence of the
coding or untranslated region of the shown nucleic acid.
Alternatively, an antisense nucleic acid can be designed based upon
sequences of a VEGF.sub.165R gene, which can be identified by
screening a genomic DNA library with an isolated nucleic acid of
the invention. For example, the sequence of an important regulatory
element can be determined by standard techniques and a sequence
which is antisense to the regulatory element can be designed.
[0090] The antisense nucleic acids and oligonucleotides of the
invention can be constructed using chemical synthesis and enzymatic
ligation reactions using procedures known in the art. The antisense
nucleic acid or oligonucleotide can be chemically synthesized using
naturally occurring nucleotides or variously modified nucleotides
designed to increase the biological stability of the molecules or
to increase the physical stability of the duplex formed between the
antisense and sense nucleic acids e.g. phosphorothioate derivatives
and acridine substituted nucleotides can be used. Alternatively,
the antisense nucleic acids and oligonucleotides can be produced
biologically using an expression vector into which a nucleic acid
has been subcloned in an antisense orientation (i.e. nucleic acid
transcribed from the inserted nucleic acid will be of an antisense
orientation to a target nucleic acid of interest). The antisense
expression vector is introduced into cells in the form of a
recombinant plasmid, phagemid or attenuated virus in which
antisense nucleic acids are produced under the control of a high
efficiency regulatory region, the activity of which can be
determined by the cell type into which the vector is introduced.
For a discussion of the regulation of gene expression using
antisense genes see Weintraub, H. et al., Antisense RNA as a
molecular tool for genetic analysis, Reviews--Trends in Genetics,
Vol. 1 (1) 1986.
[0091] The term "pharmaceutically acceptable" refers to compounds
and compositions which may be administered to mammals without undue
toxicity. Exemplary pharmaceutically acceptable salts include
mineral acid salts such as hydrochlorides, hydrobromides,
phosphates, sulfates, and the like; and the salts of organic acids
such as acetates, propionates, malonates, benzoates, and the
like.
[0092] The antagonists of the invention are administered orally,
topically, or by parenteral means, including subcutaneous and
intramuscular injection, implantation of sustained release depots,
intravenous injection, intranasal administration, and the like.
Accordingly, antagonists of the invention may be administered as a
pharmaceutical composition comprising the antibody or nucleic acid
of the invention in combination with a pharmaceutically acceptable
carrier. Such compositions may be aqueous solutions, emulsions,
creams, ointments, suspensions, gels, liposomal suspensions, and
the like. Suitable carriers (excipients) include water, saline,
Ringer's solution, dextrose solution, and solutions of ethanol,
glucose, sucrose, dextran, mannose, mannitol, sorbitol,
polyethylene glycol (PEG), phosphate, acetate, gelatin, collagen,
Carbopol Registered TM, vegetable oils, and the like. One may
additionally include suitable preservatives, stabilizers,
antioxidants, antimicrobials, and buffering agents, for example,
BHA, BHT, citric acid, ascorbic acid, tetracycline, and the like.
Cream or ointment bases useful in formulation include lanolin,
Silvadene Registered TM (Marion), Aquaphor Registered TM (Duke
Laboratories), and the like. Other topical formulations include
aerosols, bandages, and other wound dressings. Alternatively one
may incorporate or encapsulate the compounds such as an antagonist
in a suitable polymer matrix or membrane, thus providing a
sustained-release delivery device suitable for implantation near
the site to be treated locally. Other devices include indwelling
catheters and devices such as the Alzet Registered TM minipump.
Ophthalmic preparations may be formulated using commercially
available vehicles such as Sorbi-care Registered TM (Allergan),
Neodecadron Registered TM (Merck, Sharp & Dohme), Lacrilube
Registered TM, and the like, or may employ topical preparations
such as that described in U.S. Pat. No. 5,124,155, incorporated
herein by reference. Further, one may provide an antagonist in
solid form, especially as a lyophilized powder. Lyophilized
formulations typically contain stabilizing and bulking agents, for
example human serum albumin, sucrose, mannitol, and the like. A
thorough discussion of pharmaceutically acceptable excipients is
available in Remington's Pharmaceutical Sciences (Mack Pub.
Co.).
[0093] The NP antagonists of the invention can be combined with a
therapeutically effective amount of another molecule which
negatively regulates angiogenesis which may be, but is not limited
to, TNP-470, platelet factor 4, thrombospondin-1, tissue inhibitors
of metalloproteases (TIMP1 and TIMP2), prolactin (16-Kd fragment),
angiostatin (38-Kd fragment of plasminogen), endostatin, bFGF
soluble receptor, transforming growth factor beta, interferon alfa,
soluble KDR and FLT-1 receptors and placental proliferin-related
protein.
[0094] An NP antagonist of the invention may also be combined with
chemotherapeutic agents.
[0095] The DNA encoding an antagonist, e.g., a collapsin, can be
used in the form of gene therapy and delivered to a host by any
method known to those of skill in the art to treat disorders
associated with VEGF.
[0096] The amount of an NP antagonist required to treat any
particular disorder will of course vary depending upon the nature
and severity of the disorder, the age and condition of the subject,
and other factors readily determined by one of ordinary skill in
the art.
[0097] All references cited above or below are herein incorporated
by reference.
[0098] The present invention is further illustrated by the
following Examples. These Examples are provided to aid in the
understanding of the invention and are not construed as a
limitation thereof.
Example I
Experimental Procedures
Materials
[0099] Cell culture media, lipofectin and lipofectamin reagents for
transfection were purchased from Life Technologies. Human
recombinant VEGF.sub.165 and VEGF.sub.121 were produced in Sf-21
insect cells infected with recombinant baculovirus vectors encoding
either human VEGF.sub.165 or VEGF.sub.121 as previously described
(Cohen et al., Growth Factors, 7, 131-138 (1992); Cohen et al., J.
Biol. Chem., 270, 11322-11326 (1995)). GST VEGF exons 7+8 fusion
protein was prepared in E. Coli and purified as previously
described (Soker et al., J. Biol. Chem., 271, 5761-5767 (1996)).
Heparin, hygromycin B and protease inhibitors were purchased from
Sigma (St. Louis, Mo.).125I-Sodium, .sup.32P-dCTP, and
GeneScreen-Plus hybridization transfer membrane were purchased from
DuPont NEN (Boston, Mass.). Disuccinimidyl suberate (DSS) and
IODO-BEADS were purchased from Pierce Chemical Co. (Rockford,
Ill.). Con A Sepharose was purchased from Pharmacia LKB
Biotechnology Inc. (Piscataway, N.J.). RNAzol-B was purchased from
TEL-TEST Inc. (Friendswood, Tex.). Silver Stain kit and Trans-Blot
PVDF membranes were purchased from Bio-Rad Laboratories (Hercules,
Calif.). Multiple tissue northern blot membranes were purchased
from Clontech (Palo Alto, Calif.). PolyATract mRNA isolation kits
were purchased from Promega (Madison, Wis.). RediPrime DNA labeling
kits and molecular weight markers were purchased from Amersham
(Arlington Heights, Ill.). Plasmids: pcDNA3.1 was purchased from
Invitrogen (Carlsbad, Calif.), and pCPhygro, containing the CMV
promoter and encoding hygromycin B phosphorylase, was kindly
provided by Dr. Urban Deutsch (Max Plank Institute, Bad Nauheim,
Germany). Restriction endonucleases and Ligase were purchased from
New England Biolabs, Inc (Beverly, Mass.). NT-B2 photographic
emulsion and x-ray film were purchased from the Eastman Kodak
company (Rochester N.Y.).
Cell Culture
[0100] Human umbilical vein EC(HUVEC) were obtained from American
Type Culture Collection (ATCC) (Rockville, Md.), and grown on
gelatin coated dishes in M-199 medium containing 20% fetal calf
serum (FCS) and a mixture of glutamine, penicillin and streptomycin
(GPS). Basic FGF (2 ng/ml) was added to the culture medium every
other day. Parental porcine aortic endothelial (PAE) cells and PAE
cells expressing KDR (PAE/KDR) (Waltenberger et al., J. Biol. Chem.
269, 26988-26995 (1994)) were kindly provided by Dr. Lena
Claesson-Welsh and were grown in F12 medium containing 10% FCS and
GPS. MDA-MB-231 cells and MDA-MB-453 cells were obtained from ATCC,
and grown in DMEM containing 10% FCS and GPS. The human melanoma
cell lines, RU-mel, EP-mel and WK-mel were kindly provided by Dr.
Randolf Byer (Boston University Medical School, Boston, Mass.), and
grown in DMEM containing 2% FCS, 8% calf serum and GPS. Human
metastatic prostate adenocarcinoma, LNCaP and prostate carcinoma,
PC3 cells were kindly provided by Dr. Michael Freeman (Children's
Hospital, Boston, Mass.), and grown in RPMI 1640 containing 5% FCS
and GPS.
Purification and Protein Sequencing
[0101] Approximately 5.times.10.sup.8 MDA-MB-231 cells grown in 150
cm dishes were washed with PBS containing 5 mM EDTA, scraped and
centrifuged for 5 min at 500 g. The cell pellet was lysed with 150
ml of 20 mM HEPES, pH 8.0, 0.5% triton X-100 and protease
inhibitors including 1 mM AEBSF, 5 .mu.g/ml leupeptin and 5
.mu.g/ml aprotinin for 30 mM on ice, and the lysate was centrifuged
at 30,000.times.g for 30 min. MnCl.sub.2 and CaCl.sub.2 were added
to the supernatant to obtain a final concentration of 1 mM each.
The lysate was absorbed onto a Con A Sepharose column (7 ml) and
bound proteins were eluted with 15 ml 20 mM HEPES, pH 8.0, 0.2 M
NaCl, 0.1% triton X-100 and 1 M methyl-a-D-mannopyranoside at 0.2
ml/min. The elution was repeated twice more at 30 minute intervals.
The Con A column eluates were pooled and incubated for 12 h at
4.degree. C. with 0.5 ml of VEGF.sub.165-Sepharose beads,
containing about 150 .mu.g VEGF.sub.165, prepared as described
previously (Wilchek and Miron, Biochem. Int. 4, 629-635. (1982)).
The VEGF.sub.165-Sepharose beads were washed with 50 ml of 20 mM
HEPES, pH 8.0, 0.2 M NaCl and 0.1% triton X-100 and then with 25 ml
of 20 mM HEPES, pH 8.0. The beads were boiled in SDS-PAGE buffer
and bound proteins were separated by 6% SDS-PAGE. Proteins were
transferred to a TmnsBlot PVDF membrane using a semi-dry electric
blotter (Hoeffer Scientific), and the PVDF membrane was stained
with 0.1% Coomassie Brilliant Blue in 40% methanol. The two
prominent proteins in a 130-140 kDa doublet were cut out separately
and N-terminally sequenced using an Applied Biosystems model 477A
microsequenator as a service provided by Dr. William Lane of the
Harvard Microchemistry facility (Cambridge, Mass.).
Expression Cloning and DNA Sequencing
[0102] Complementary DNA (cDNA) was synthesized from 5 .mu.g 231
mRNA. Double-stranded cDNA was ligated to EcoRI adaptors, and
size-fractionated on a 5-20% potassium acetate gradient. DNA
fragments larger than 2 kb were ligated to an eukaryotic expression
plasmid, pcDNA3.1. The plasmid library was transfected into E. coli
to yield a primary library of approximately 1.times.10.sup.7
individual clones. A portion of the transformed bacteria was
divided into 240 pools, each representing approximately
3.times.10.sup.3 individual clones. DNA prepared from each pool was
used to transfect COS-7 cells seeded in 12 well dishes, using the
Lipofectin reagent according to the manufacturer's instructions.
Three days after transfection, the cells were incubated on ice for
2 h with .sup.125I-VEGF.sub.165 (10 ng/ml) in the presence of 1
pg/ml heparin, washed and fixed with 4% paraformaldehyde in PBS.
.sup.125I-VEGF.sub.165 binding to individual cells was detected by
overlaying the monolayers with photographic emulsion, NT-B2, and
developing the emulsion after two days as described (Gearing et
al., 1989). Seven positive DNA pools were identified and DNA from
one of the positive pools was used to transform E. Coli. The E.
coli were sub-divided into 50 separate pools and plated onto 50 LB
ampicillin dishes, with each pool representing approximately 100
clones. DNA made from these pools was transfected into COS-7 cells
which were screened for .sup.125I-VEGF.sub.165 binding as described
above. Twenty positive pools were detected at this step, and their
corresponding DNAs were used to transform E. Coli. Each pool was
plated onto separate LB ampicillin dishes and DNA was prepared from
96 individual colonies and screened in a 96-well two dimensional
grid for .sup.125I-VEGF.sub.165 binding to tranfected COS-7 cells
as described above. Seven single clones were identified as being
positive at this step. The seven positive plasmid clones were
amplified and their DNA was analyzed by restriction enzyme
digestion. Six clones showed an identical digestion pattern of
digest and one was different. One clone from each group was
submitted for automated DNA sequencing.
Northern Analysis
[0103] Total RNA was prepared from cells in culture using RNAzol
according to the manufacturer's instructions. Samples of 20 .mu.g
RNA were separated on a 1% formaldehide-agarose gel, and
transferred to a GeneScreen-Plus membrane. The membrane was
hybridized with a .sup.32P labeled fragment of human
VEGF.sub.165R/NP-1 cDNA, corresponding to nucleotides 63-454 in the
ORF, at 63.degree. C. for 18 h. The membrane was washed and exposed
to an x-ray film for 18 h. A commercially-obtained multiple human
adult tissue mRNA blot (Clonetech, 2 .mu.g/lane) was probed for
human NP-I in a similar manner. The multiple tissue blot was
stripped by boiling in the presence of 0.5% SDS and re-probed with
a .sup.32P labeled fragment of KDR cDNA corresponding to
nucleotides 2841-3251 of the ORF (Terman et al., Oncogene 6,
1677-1683 (1991)).
Transfection of PAE Cells
[0104] Parental PAE cells and PAE cells expressing KDR (PAE/KDR)
(Waltenberger et al., 1994) were obtained from Dr. Lena
Claesson-Welsh. Human NP-1 cDNA was digested with XhoI and XbaI
restriction enzymes and subcloned into the corresponding sites of
pCPhygro, to yield pCPhyg-NP-1. PAE and PAE/KDR cells were grown in
6 cm dishes and transfected with 5 .mu.g of pCPhyg-NP-1 using
Lipofectamine, according to the manufacturer's instructions. Cells
were allowed to grow for an additional 48 h and the medium was
replaced with fresh medium containing 200 .mu.g/ml hygromycin B.
After 2 weeks, isolated colonies (5-10.times.10.sup.3 cell/colony)
were transferred to separate wells of a 48 well dish and grown in
the presence of 200 .mu.g/ml hygromycin B. Stable PAE cell clones
expressing VEGF.sub.165R/NP-1 (PAE/NP-1) or co-expressing
VEGF.sub.165R/NP-1 and KDR (PAE/KDR/NP-1) were screened for
VEGF.sub.165 receptor expression by binding and cross linking of
.sup.125I-VEGF.sub.165. For transient transfection, PAE/KDR cells
were transfected with VEGF.sub.165R/NP-1 as described above and
after three days .sup.125I-VEGF.sub.165 cross-linking analysis was
carried out.
Radio-Iodination of VEGF, Binding and Cross-Linking
Experiments.
[0105] The radio-iodination of VEGF.sub.165 and VEGF.sub.121 using
IODO-BEADS was carried out as previously described (Soker et al.,
J. Biol. Chem. 272, 31582-31588 (1997)). The specific activity
ranged from 40,000-100,000 cpm/ng protein. Binding and
cross-linking experiments using .sup.125I-VEGF.sub.165 and
.sup.125I-VEGF.sub.121 were performed as previously described
(Gitay-Goren et al., J. Biol. Chem. 267, 6093-6098 (1992); Soker et
al., J. Biol. Chem. 271, 5761-5767 (1996)). VEGF binding was
quantitated by measuring the cell-associated radioactivity in a
.gamma.-counter (Beckman, Gamma 5500). The counts represent the
average of three wells. All experiments were repeated at least
three times and similar results were obtained. The results of the
binding experiments were analyzed by the method of Scatchard using
the LIGAND program (Munson and Rodbard, 1980).
.sup.125I-VEGF.sub.165 and .sup.125I-VEGF.sub.121 cross linked
complexes were resolved by 6% SDS/PAGE and the gels were exposed to
an X-Ray film. X-ray films were subsequently scanned by using an
IS-I 000 digital imaging system (Alpha Innotech Corporation)
Purification of VEGF.sub.165R
[0106] Cross-linking of .sup.125I-VEGF.sub.165 to cell surface
receptors of 231 cells results in formation of a 165-175 kDa
labeled complex (Soker et al., J. Biol. Chem. 271, 5761-5767
(1996)). These cells have about 1-2.times.10.sup.5 VEGF.sub.165
binding sites/cell. In contrast to VEGF.sub.165, VEGF.sub.121 does
not bind to the 231 cells and does not form a ligand-receptor
complex (Soker et al., J. Biol. Chem. 271, 5761-5767 (1996)). The
relatively high VEGF.sub.165R number and the lack of any detectable
KDR or Flt-1 mRNA in 231 cells (not shown) suggested that these
cells would be a useful source for VEGF.sub.165R purification.
Preliminary characterization indicated that VEGF.sub.165R is a
glycoprotein and accordingly, a 231 cell lysate prepared from
approximately 5.times.10.sup.8 cells was absorbed onto a Con A
Sepharose column. Bound proteins, eluted from the Con A column,
were incubated with VEGF.sub.165-Sepharose and the
VEGF.sub.165-affinity purified proteins were analyzed by SDS-PAGE
and silver staining (FIG. 9, lane 2). A prominent doublet with a
molecular mass of about 130-135 kDa was detected. This size is
consistent with the formation of a 165-175 kDa complex of 40-45 kDa
VEGF.sub.165 bound to receptors approximately 130-135 kDa in size
(FIG. 9, lane 1). The two bands were excised separately and
N-terminal amino acid sequencing was carried out (FIG. 1, right).
Both the upper and lower bands had similar N-terminal amino acid
sequences which showed high degrees of sequence homology to the
predicted amino acid sequences in the N-terminal regions of mouse
(Kawakami et al., J. Neurobiol, 29, 1-17 (1995)) and human
neuroplilin-1 (NP-1) (He and Tessier-Lavigne, Cell 90739-751
(1997)).
Expression Cloning of VEGF.sub.165R from 231 Cell-Derived mRNA
[0107] Concomitant with the purification, VEGFI65R was cloned by
expression cloning (Aruffo and Seed, Proc. Natl. Acad. Sci. USA 84,
8573-8577 (1987a); Aruffo and Seed, EMBO J., 6, 3313-3316 (1987b);
Gearing et al., EMBO J. 8, 3667-3676 (1989)). For expression
cloning, 231 cell mRNA was used to prepare a cDNA library of
approximately 10.sup.7 clones in a eukaryotic expression plasmid.
E. coli transformed with the plasmid library were divided into
pools. The DNA prepared from each pool were transfected into COS-7
cells in separate wells and individual cells were screened for the
ability to bind .sup.125I-VEGF.sub.165 as detected by
autoradiography of monolayers overlayed with photographic emulsion
(FIG. 2A). After three rounds of subpooling and screening, seven
single positive cDNA clones were obtained. FIG. 2B shows binding of
.sup.125I-VEGF.sub.165 to COS-7 cells transfected with one of these
single positive clones (clone A2).
[0108] Restriction enzyme analysis revealed that six of the seven
positive single clones had identical restriction digestion patterns
but that one clone had a pattern that was different (not shown).
Sequencing of one of these similar cDNA clones, clone A2 (FIG. 3),
showed it to be identical to a sequence derived from a
human-expressed sequence tag data bank (dbEST). This sequence also
showed a high percentage of homology to the sequence of mouse
neuropilin, NP-1 (Kawakami et al., J. Neurobiol 29, 1-17 (1995)).
After we had cloned human VEGF.sub.165R, two groups reported the
cloning of rat and human receptors for semaphorin III and
identified them to be NP-1 (He and Tessier-Lavigne, Cell 90,
739-751 (1997); Kolodkin et al., Cell 90, 753-762 (1997)). The 231
cell-derived VEGFI65R cDNA sequence is virtually identical (see
figure legend 3 for exceptions) to the human NP-1 sequence (He and
Tessier-Lavigne, Cell 90, 739-751 (1997)). Significantly, the
predicted amino acid sequence obtained by expression cloning (FIG.
3) confirmed the identification of VEGF.sub.165R as NP-1 that was
determined by N-terminal sequencing (FIG. 1), and we have therefore
named this VEGF receptor, VEGF.sub.165R/NP-1.
[0109] The human VEGF.sub.165R/NP-1 cDNA sequence predicts an open
reading frame (ORF) of 923 amino acids with two hydrophobic regions
representing putative signal peptide and transmembrane domains
(FIG. 3). Overall, the sequence predicts ectodomain, transmembrane
and cytoplasmic domains consistent with the structure of a cell
surface receptor. The N-terminal sequence obtained via protein
purification as shown in FIG. 1 is downstream of a 21 amino acid
putative hydrophobic signal peptide domain, thereby indicating
directly where the signal peptide domain is cleaved and removed.
The short cytoplasmic tail of 40 amino acids is consistent with
results demonstrating that soluble VEGF.sub.165R/NP-1 released by
partial trypsin digestion of 231 cells is similar in size to intact
VEGF.sub.165R/NP-1 (not shown).
[0110] Sequence analysis of the one clone obtained by expression
cloning that had a different restriction enzyme profile predicted
an open reading frame of 931 amino acids with about a 47% homology
to VEGF.sub.165R/NP-1 (FIG. 4). This human cDNA has a 93% sequence
homology with rat neuropilin-2 (NP-2) and is identical to the
recently cloned human NP-2 (Chen et al., Neuron, 19, 547-559
(1997)).
Expression of VEGF16511/NP-1 in Adult Cell Lines and Tissues
[0111] Reports of NP-1 gene expression have been limited so far to
the nervous system of the developing embryo (Takagi et al., Dev.
Biol. 122, 90-100 (1987); Kawakami et al., J. Neurobiol. 29, 1-17
(1995); Takagi et al., Dev. Biol. 170, 207-222 (1995)). Cell
surface VEGF.sub.165R/NP-1, however, is associated with
non-neuronal adult cell types such as EC and a variety of
tumor-derived cells (Soker et al., J. Biol. Chem. 271, 5761-5767
(1996)). Northern blot analysis was carried out to determine
whether cells that crossed-linked .sup.125I-VEGF.sub.165 also
synthesized VEGF.sub.165R/NIP-1 mRNA. (FIG. 5). VEGF.sub.165R/NP-1
mRNA levels were highest in 231 and PC3 cells. VEGF.sub.165R/NP-1
mRNA was detected to a lesser degree in HUVEC, LNCaP, EP-mel and
RU-mel cells. There was little if any expression in MDA-MB-453 and
WK-mel cells. The VEGF.sub.165R/NP-1 gene expression patterns were
consistent with our previous results showing that HUVEC, 231, PC3,
LNCaP, EP-mel and RU-mel cells bind .sup.125I-VEGF.sup.165 to cell
surface VEGF.sub.165R/NP-1 but that MDA-MB-453 and WK-mel cells do
not (Soker et al., J. Biol. Chem. 271, 5761-5767 (1996)).
[0112] VEGF.sub.165R/NP-1 gene expression was analyzed also by
Northern blot in a variety of adult tissues in comparison to KDR
gene expression (FIG. 6). VEGF.sub.16511/NP-1 mRNA levels were
relatively highly in adult heart and placenta and relatively
moderate in lung, liver, skeletal muscle, kidney and pancreas. A
relatively low level of VEGF.sub.165R/NP-1 mRNA was detected in
adult brain. Interestingly, previous analysis of NP-1 gene
expression in mouse and chicken brain suggested that this gene was
expressed primarily during embryonic development and was greatly
diminished after birth (Kawakami et al., J. Neurobiol. 29, 1-17
(1995); Takagi et al., Dev. Biol. 170, 207-222 (1995)). The tissue
distribution of KDR mRNA was similar to that of VEGF.sub.165R/NP-1
with the exception that it was not expressed highly in the heart.
These results indicate that VEGF.sub.16511/NP-1 is expressed widely
in adult non-neuronal tissue, including tissues in which
angiogenesis occurs such as heart and placenta.
Characterization of VEGF.sub.165 Binding to VEGF.sub.165R/NP-1
[0113] In order to characterize the binding properties of
VEGF.sub.165R/NP-1, porcine aortic endothelial (PAE) cells were
transfected with the cDNA of VEGF.sub.165R/NP-1. The PAE cells were
chosen for these expression studies because they express neither
KDR, Flt-1 (Waltenberger et al., J. Biol. Chem. 269, 26988-26995
(1994)) nor VEGF.sub.165R. Stable cell lines synthesizing
VEGF.sub.16512/NP-1 (PAE/NP-1) were established and
.sup.125I-VEGF.sub.165 binding experiments were carried out (FIG.
7). .sup.1251-VEGF.sub.165 binding to PAE/NP-1 cells increased in a
dose-dependent manner and reached saturation at approximately 30
ng/ml demonstrating that VEGF.sub.165R/NP-1 is a specific
VEGF.sub.165 receptor (FIG. 7A). Scatchard analysis of VEGF.sub.165
binding revealed a single class of VEGF.sub.165 binding sites with
a Kd of approximately 3.2.times.10.sup.-10 M and approximately
3.times.10.sup.5 1251-VEGF.sub.165 binding sites per cell (FIG.
7B). Similar K.sub.d values were obtained for several
independently-generated PAE/NP-1 clones, although the receptor
number varied from clone to clone (not shown). The K.sub.d of
3.times.10.sup.-10 M for the PAE/NP-1 cell lines is consistent with
the 2-2.8.times.10.sup.-10 M K.sub.d values obtained for
VEGF.sub.165R/NP-1 expressed naturally by HUVEC and 231 cells
(Gitay-Goren et al., J. Biol. Chem. 267, 6093-6098 (1992); Soker et
al., J. Biol. Chem. 271, 5761-5767 (1996)). The binding of
.sup.125I-VEGF.sub.165 to PAE/NP-1 cells was enhanced by 1 .mu.g/ml
heparin (not shown), consistent with previous studies showing that
heparin enhances .sup.125I-VEGF.sub.165 binding to
VEGF.sub.165R/NP-1 on HUVEC and 231 cells (Gitay-Goren et al., J.
Biol. Chem. 267, 6093-6098 (1992); Soker et al., J. Biol. Chem.
271, 5761-5767 (1996)).
Isoform-Specific Binding of VEGF to Cells Expressing
VEGF.sub.165R/NP-1
[0114] VEGF.sub.165, but not VEGF.sub.121, binds to
VEGF.sub.165RJNP-1 on HUVEC and 231 cells (Gitay-Goren et al., J.
Biol. Chem. 271, 5519-5523 (1992); Soker et al., J. Biol. Chem.
271, 5761-5767 (1996)). To ascertain whether cells transfected with
VEGF.sub.165R/NP-1 had the same binding specificity, PAE/NP-1 cells
were incubated with .sup.125I-VEGF.sub.165 or
.sup.125I-VEGF.sub.121 followed by cross-linking (FIG. 8).
.sup.125I-VEGF.sub.165 did not bind to parental PAE cells (FIG. 8,
lane 3) but did bind to PAE/NP-1 cells via VEGF.sub.165R/NP-1 (FIG.
8, lane 4). The radiolabeled complexes formed with
VEGF.sub.165R/NP-1 were similar in size to those formed in HUVEC
(FIG. 8, lane 1) and PC3 cells (FIG. 8, lane 2). On the other hand,
.sup.125I-VEGF.sub.121, did not bind to either parental PAE (FIG.
8, lane 7) or to PAE/NP-1 cells (FIG. 8, lane 8). These results
demonstrate that the VEGF isoform-specific binding that occurs with
cells expressing endogenous VEGF.sub.165R/NP-1 such as HUVEC, 231
and PC3 cells, can be replicated in cells transfected with
VEGF.sub.165R/NP-1 cDNA and support the finding that VEGF.sub.165R
and NP-1 are identical.
Co-Expression of VEGF.sub.165R/NP-1 and KDR Modulates VEGF.sub.165
Binding to KDR
[0115] To determine whether expression of VEGF.sub.165R/NP-1 had
any effect on VEGF.sub.165 interactions with KDR, PAE cells that
were previously transfected with KDR cDNA to produce stable clones
of PAE/KDR cells (Waltenberger et al., J. Biol. Chem. 269,
26988-26995 (1994)), were transfected with VEGF.sub.165R/NP-1 cDNA
and stable clones expressing both receptors (PAE/KDR/NP-1) were
obtained. These cells bound .sup.125I-VEGF.sub.165 to KDR (FIG. 8,
lane 6, upper complex) and to VEGF.sub.165R/NP-1 (FIG. 8, lane 6,
lower complex) to yield a cross-linking profile similar to HUVEC
(FIG. 8, lane 1). On the other hand, the PAE/KDR/NP-1 cells bound
.sup.125I-VEGF.sub.121 to form a complex only with KDR (FIG. 8,
lanes 9 and 10), consistent with the inability of VEGF.sub.121 to
bind VEGF.sub.165R/NP-1.
[0116] It appeared that in cells co-expressing KDR and
VEGF.sub.165RJNP-1 (FIG. 8, lane 6), the degree of
.sup.125I-VEGF.sub.165-KDR 240 kDa complex formation was enhanced
compared to the parental PAE/KDR cells (FIG. 8, lane 5). These
results were reproducible and the degree of
.sup.125I-VEGF.sub.165-KDR 240 kDa complex formation in different
clones was correlated positively with the levels of
VEGF.sub.165R/NP-1 expressed (not shown). However, it could not be
ruled out definitively that these differential KDR binding results
were possibly due to clonal selection post-transfection. Therefore,
parental PAE/KDR cells were transfected with VEGF.sub.165R/NP-1
cDNA and .sup.125I-VEGF.sub.165 was bound and cross-linked to the
cells three days later in order to avoid any diversity of KDR
expression among individual clones (FIG. 9). A labeled 240 kDa
complex containing KDR was formed in parental PAE/KDR cells (FIG.
9, lane 1) and in PAE/KDR cells transfected with the expression
vector (FIG. 9, lane 2). However, when .sup.125I-VEGF.sub.165 was
cross-linked to PAE/KDR cells transiently expressing
VEGF.sub.165R/NP-1, a more intensely labeled 240 kDa complex, about
4 times greater, was observed (FIG. 9, lane 3), compared to
parental PAE/KDR cells (FIG. 9, lane 1) and PAE/KDR cells
transfected with expression vector (FIG. 9, lane 2). These results
suggest that co-expression of KDR and VEGF.sub.165R/NP-1 genes in
the same cell enhances the ability of VEGF.sub.165 to bind to
KDR.
A GST-VEGF Exon 7+8 Fusion Protein Inhibits VEGF.sub.165 Binding to
VEGF.sub.165R/NP-1 and KDR
[0117] We have shown that .sup.125I-VEGF.sub.165 binds to
VEGF.sub.165R/NP-1 through its exon 7-encoded domain (Soker et al.,
J. Biol. Chem. 271, 5761-5767 (1996)). In addition, a GST fusion
protein containing the peptide encoded by VEGF exon 7+8 (GST-Ex
7+8), inhibits completely the binding of .sup.125I-VEGF.sub.165 to
VEGF.sub.165R/NP-1 associated with 231 cells and HUVEC (Soker et
al., J. Biol. Chem. 271, 5761-5767 (1996); Soker et al., J. Biol.
Chem. 272, 31582-31588 (1997)). When, added to PAE/NP-1 cells, the
fusion protein completely inhibited binding to VEGF.sub.165R/NP-1
(FIG. 10, lane 2 compared to lane 1). On the other hand, it did not
inhibit .sup.125I-VEGF.sub.165 binding at all to KDR (FIG. 10, lane
4 compared to lane 3). Thus, these results demonstrate that GST-Ex
7+8 binds directly to VEGF.sub.165R/NP-1 but does not bind to KDR.
The effects of GST-Ex 7+8 are different, however, in cells
co-expressing both VEGF.sub.165R/NP-1 and KDR (PAE/KDR/NP-1).
Consistent with the results in FIGS. 8 and 9, the degree of
.sup.125I-VEGF.sub.165 binding to KDR in PAE/KDR/NP-1 cells (FIG.
10, lane 5) was greater than to the parental PAE/KDR cells (FIG.
10, lane 3). Interestingly, in PAE/KDR/NP-1 cells, GST-Ex 7+8
inhibited not only .sup.125I-VEGF.sub.165 binding to
VEGF.sub.165R/NP-1 completely as expected, but it also inhibited
binding to KDR substantially which was unexpected (FIG. 10, lane 6
compared to lane 5). In the presence of GST-Ex 7+8, binding of
.sup.125I-VEGF.sub.165 to KDR in these cells was reduced to the
levels seen in parental PAE/KDR cells not expressing
VEGF.sub.165R/NP-1 (FIG. 10, lane 6 compared to lanes 3 and 4).
Since the fusion protein does not bind directly to KDR, these
results suggest that inhibiting the binding of
.sup.125I-VEGF.sub.165 to VEGF.sub.165R/NP-1 directly, inhibits its
binding to KDR indirectly. Taken together, the results in FIGS. 8,
9 and 10 suggest that interactions of VEGF.sub.165 with
VEGF.sub.165R/NP-1 enhance VEGF interactions with KDR.
Neuropilin-1 is an Isoform-Specific VEGF.sub.165 Receptor
[0118] Recently, we described a novel 130-135 kDa VEGF cell surface
receptor that binds VEGF.sub.165 but not VEGF.sub.121 and that we
named, accordingly, VEGF.sub.165R (Soker et al., J. Biol. Chem.
271, 5761-5767 (1996)). We have now purified VEGF.sub.165R,
expression cloned its cDNA, and shown it to be identical to human
neuropilin-1 (NP-1) (He and Tessier-Lavigne, Cell 90 739-751
(1997)). The evidence that VEGF.sub.165R is identical to NP-1 and
that NP-1 serves as a receptor for VEGF.sub.165 is as follows: i)
purification of VEGF.sub.165R protein from human MDA-MB-231 (231)
cells using VEGF affinity, yielded a 130-140 kDa doublet upon
SDS-PAGE and silver stain. N-terminal sequencing of both proteins
yielded the same N-terminal sequence of 18 amino acids that
demonstrated a high degree of homology to mouse NP-1 (Kawakami et
al., J. Neurobiol. 29, 1-17 (1995)); ii). After we purified
VEGF.sub.165R from human 231 cells, the cloning of human NP-1 was
reported (He and Tessier-Lavigne, Cell 90, 739-751 (1997)) and the
N-terminal sequence of human VEGF.sub.165R was found to be
identical to a sequence in the N-terminal region of human NP-1;
iii) Expression cloning using a 231 cell cDNA library resulted in
isolation of several cDNA clones and their sequences were identical
to the human NP-1 cDNA sequence (He and Tessier-Lavigne, Cell 90,
739-751 (1997)). The combination of purification and expression
cloning has the advantage over previous studies where only
expression cloning was used (He and Tessier-Lavigne, Cell 90,
739-751 (1997); Kolodkin et al., Cell 90, 753762 (1997)), in
allowing unambiguous identification of the NP-1 protein N-terminus;
iv) Northern blot analysis of NP-1 gene expression was consistent
with previous .sup.125I-VEGF.sub.165 cross-linking experiments
(Soker et al., J. Biol. Chem. 271, 5761-5767 (1996)). Cells that
bound VEGF.sub.165 to VEGF.sub.165R synthesized relatively abundant
NP-1 mRNA while cells that showed very little if any VEGF.sub.165
binding, did not synthesize much if any NP-1 mRNA; v) when NP-1 was
expressed in PAE cells, the transfected, but not the parental
cells, were able to bind VEGF.sub.165 but not VEGF.sub.121,
consistent with the isoform specificity of binding previously shown
for HUVEC and 231 cells (Soker et al., J. Biol. Chem. 271,
5761-5767 (1996)). Furthermore, the K.sub.d of
.sup.125I-VEGF.sub.165 binding of to PAE expressing NP-1 was about
3.times.10.sup.-10 M, consistent with previous K.sub.d binding
values of 2-2.8.times.10.sup.-10 M for 231 cells and HUVEC (Soker
et al., J. Biol. Chem. 271, 5761-5767 (1996)); and vi) The binding
of VEGF.sub.165 to cells expressing NP-1 post-transfection was more
efficient in the presence of heparin as was the binding of this
ligand to HUVEC and 231 cells (Gitay-Goren et at., J. Biol. Chem.
267. 6093-6098 (1992); Soker et al., J. Biol. Chem. 271, 5761-5767
(1996)). Taken together, these results show not only that
VEGF.sub.165R is identical to NP-1 but that it is a functional
receptor that binds VEGF.sub.165 in an isoform-specific manner.
Accordingly, we have named this VEGF receptor
VEGF.sub.165R/NP-1.
[0119] In addition to the expression cloning of VEGF.sub.165R/NP-1
cDNA, another human cDNA clone was isolated whose predicted amino
acid sequence was 47% homologous to that of VEGF.sub.165R/NP-1 and
over 90% homologous to rat neuropilin-2 (NP-2) which was recently
cloned (Kolodkin et al., Cell 90, 753-762 (1997)). NP-2 20 binds
members of the collapsin/semaphorin family selectively (Chen et
al., Neuron 19, 547-559 (1997)).
[0120] The discovery that NP-1 serves as a receptor for
VEGF.sub.165 was a surprise since NP-1 had previously been shown to
be associated solely with the nervous system during embryonic
development (Kawakami et al., J. Neurobiol. 29, 1-17 (1995); Takagi
et al., Dev. Biol. 170, 207-222 (1995)) and more recently as a
receptor for members of the collapsin/semaphorin family (He and
Tessier-Lavigne, Cell 90739751 (1997); Kolodkin et al., Cell 90,
753-762 (1997)). NP-1 is a 130-140 kDa transmembrane glycoprotein
first identified in the developing Xenopus optic system (Takagi et
al., Dev. Biol. 122, 90-100 (1987); Takagi et al., Neuron 7,
295-307 (1991)). NP-1 expression in the nervous system is highly
regulated spatially and temporally during development and in
particular is associated with those developmental stages when axons
are actively growing to form neuronal connections. (Fujisawa et
al., Dev. Neurosci. 17, 343-349 (1995); Kawakami et al., J.
Neurobiol 29, 1-17 (1995); Takagi et al., Dev. Biol. 170, 207-222
(1995)). The NP-1 protein is associated with neuronal axons but not
the stomata (Kawakami et al., J. Neurobiol 29, 1-17 (1995)).
Functionally, neuropilin has been shown to promote neurite
outgrowth of optic nerve fibers in vitro (Hirata et al., Neurosci.
Res. 17, 159-169 (1993)) and to promote cell adhesiveness (Tagaki
et al., Dev. Biol. 170, 207-222 (1995)). Targeted disruption of
NP-1 results in severe abnormalities in the trajectory of efferent
fibers of the peripheral nervous system (Kitsukawa et al., Neuron
19, 995-1005 (1997)). Based on the these studies, it has been
suggested that NP-1 is a neuronal cell recognition molecule that
plays a role in axon growth and guidance (Kawakami et al., J.
Neurobiol. 29, 1-17 (1995); He and Tessier-Lavigne, Cell 90,
739-751 (1997); Kitsukawa et al., Neuron 19, 995-1005 1997;
Kolodkin et al., Cell 90, 753-762 (1997)).
[0121] Our results are the first to show that VEGF165R/NP-1 is also
expressed in adult tissues, in contrast to the earlier studies that
have shown that NP-1 expression in Xenopus, chicken and mouse is
limited to the developmental and early post-natal stages (Fujisawa
et al., Dev. Neurosci. 17, 343-349 (1995); Kawakami et al., J.
Neurobiol. 29, 1-17 (1995); Takagi et al., Dev. Biol. 170, 207-222
(1995)). For example, in mice, NP-1 is expressed in the developing
nervous system starting in the dorsal root ganglia at day 9 and
ceases at day 15 (Kawakami et al., J. Neurobiol. 29, 1-17 (1995).
Our Northern blot analysis of human adult tissue demonstrates
relatively high levels of VEGF.sub.165R/NP-1 mRNA transcripts in
heart, placenta, lung, liver, skeletal muscle, kidney and pancreas.
Interestingly, there is very little relative expression in adult
brain, consistent with the mouse nervous system expression studies
(Kawakami et al., J. Neurobiol. 29, 1-17 (1995)).
VEGF.sub.165R/NP-1 is also expressed in a number of cultured
non-neuronal cell lines including EC and a variety of tumor-derived
cells. A possible function of VEGF.sub.165R/NP-1 in these cells is
to mediate angiogenesis as will be discussed below.
[0122] In addition, NP-1 has been identified as a receptor for the
collapsin/semaphorin family by expression cloning of a cDNA library
obtained from rat E 14 spinal cord and dorsal root ganglion (DRG)
tissue (He and Tessier-Lavigne, Cell 90, 739-751 (1997); Kolodkin
et al., Cell 90, 753-762 (1997)). The collapsin/semaphorins
(collapsin-D-1/Sema III/Sem D) comprise a large family of
transmembrane and secreted glycoproteins that function in repulsive
growth cone and axon guidance (Kolodkin et al., Cell 75, 1389-1399
(1993)). The repulsive effect of sema HI for DRG cells was blocked
by anti-NP-1 antibodies (He and Tessier-Lavigne, Cell 90, 739-751
(1997); Kolodkin et al., Cell 90, 753-762 (1997)). The K.sub.d of
sema III binding to NP-1, 0.15-3.25.times.10.sup.-10 M (He and
Tessier-Lavigne, Cell 90, 739-751 (1997); Kolodkin et al., Cell 90,
753-762 (1997)) is similar to that of VEGF.sub.165 binding
VEGF.sub.165/NP-1, which is about 3.times.10.sup.-10 M. These
results indicate that two structurally different ligands with
markedly different biological activities, VEGF-induced stimulation
of EC migration and proliferation on one hand, and sema III-induced
chemorepulsion of neuronal cells, on the other hand, bind to the
same receptor and with similar affinity. An interesting question is
whether the two ligands bind to the same site on VEGF.sub.165R/NP-1
or to different sites. VEGF.sub.165R/NP-1 has five discrete domains
in its ectodomain, and it has been suggested that this diversity of
protein modules in NP-1 is consistent with the possibility of
multiple binding ligands for NP-1 (Takagi et al., Neuron 7, 295-307
(1991); Feiner et al., Neuron 19 539-545 (1997); He and
Tessier-Lavigne, Cell 90 739-751 (1997). Preliminary analysis does
not indicate any large degree of sequence homology between sema III
and VEGF exon 7 which is responsible for VEGF binding to
VEGF.sub.165R/NP-1 (Soker et al., J. Biol. Chem. 271, 5761-5767
(1996)). However there may be some 3-dimensional structural
similarities between the two ligands. Since both neurons and blood
vessels display branching and directional migration, the question
also arises as to whether VEGF.sub.165 displays any neuronal
guidance activity and whether sema III has any EC growth factor
activity. These possibilities have not been examined yet. However,
it may be that VEGF requires two receptors, KDR and NP-1 for
optimal EC growth factor activity (Soker et al., J. Biol. Chem.
272, 31582-31588 (1997)) and that sema III requires NP-1 and an as
yet undetermined high affinity receptor for optimal chemorepulsive
activity (Feiner et al., Neuron 19, 539-545 (1997;) He and
Tessier-Lavigne, Cell 90, 739-751 (1997); Kitsukawa et al., Neuron
19, 995-1005 (1997)), so that the presence of NP-1 alone might not
be sufficient for these ligands to display novel biological
activities. Future studies will determine whether there are any
connections between the mechanisms that regulate neurogenesis and
angiogenesis.
VEGF.sub.165R/NP-1 Role Angiogenesis
[0123] VEGF.sub.165R/NP-1 modulates the binding of VEGF.sub.165 to
KDR, a high affinity RTK that is an important regulator of
angiogenesis as evidenced by KDR knock out experiments in mice
(Shalaby et al., Nature 376, 62-66 (1995). The affinity of KDR for
VEGF.sub.165 is about 50 times greater than for VEGF.sub.165R/NP-1
(Gitay-Goren et al., J. Biol. Chem. 287, 6003-6096 (1992);
Waltenberger et al., J. Biol. Chem. 269, 26988-26995 (1994)). When
VEGF.sub.165R/NP-1 and KDR are co-expressed, the binding of
.sup.125I-VEGF.sub.165 to KDR is enhanced by about 4-fold compared
to cells expressing KDR alone. The enhanced binding can be
demonstrated in stable clones co-expressing VEGF.sub.165R/NP-1 and
KDR (PAE/KDR/NP-1 cells), and also in PAE/ICDR cells transfected
transiently with VEGF.sub.165R/NP-1 cDNA where clonal selection
does not take place. Conversely, when the binding of
.sup.125I-VEGF.sub.165 to VEGF.sub.165R/NP-1 in PAE/KDR/NP-1 cells
is inhibited completely by a GST fusion protein containing VEGF
exons 7+8 (GST-Ex 7+8), the binding to KDR is inhibited
substantially, down to the levels observed in cells expressing KDR
alone. The fusion protein binds to VEGF.sub.165R/NP-1 directly but
is incapable of binding to KDR directly (Soker et al., J. Biol.
Chem. 272, 31582-31588 (1997)). Although, not wishing to be bound
by theory, we believe that VEGF.sub.165 binds to VEGF.sub.165R/NP-1
via the exon 7-encoded domain and facilitates VEGF.sub.165 binding
to KDR via the exon 4-encoded domain (FIG. 11). VEGF.sub.165R/NP-1,
with its relatively high receptor/cell number, about
0.2-2.times.10.sup.5 (Gitay-Goren et al., J. Biol. Chem. 287,
6003-6096 (1992); Soker et al., J. Biol. Chem. 271, 5761-5767
(1996)), appears to serve to concentrate VEGF.sub.165 on the cell
surface, thereby providing greater access of VEGF.sub.165 to KDR.
Alternatively, binding to VEGF.sub.165R/NP-1, VEGF.sub.165
undergoes a conformational change that enhances its binding to KDR.
The end result would be elevated KDR signaling and increased VEGF
activity. Although we can demonstrate enhanced binding to KDR, to
date we have not been able to demonstrate enhanced VEGF
mitogenicity for PAE/KDR/NP-1 cells compared to PAE/KDR cells. One
reason is that these cell lines do not proliferate readily in
response to VEGF as do HUVEC (Waltenberger et al., J. Biol. Chem.
269, 26988-26995 (1994). Nevertheless, we have shown that
VEGF.sub.165, which binds to both KDR and VEGF.sub.165R/NP-1, is a
better mitogen for HUVEC than is VEGF.sub.121, which binds only to
KDR (Keyt et al., J. Biol. Chem. 271, 5638-5646 (1996b); Soker et
al., J. Biol. Chem. 272, 31582-31588 (1997). Furthermore,
inhibiting VEGF.sub.165 binding to VEGF.sub.165RJNP-1 on HUVEC by
GST-EX 7+8, inhibits binding to KDR and also inhibits
VEGF.sub.165-induced HUVEC proliferation, down to the level induced
by VEGF.sub.121 (Soker et al., J. Biol. Chem. 272, 31582-31588
(1997)). Taken together, these results suggest a role for
VEGF.sub.165R/NP-1 in mediating VEGF.sub.165, but not VEGF121
mitogenic activity. The concept that dual receptors regulate growth
factor binding and activity has been previously demonstrated for
TGF-.beta., bFGF and NGF (Lopez-Casillas et al., Cell 67, 785-795
(1991); Yayon et al., Cell 64, 841-848 (1991; Barbacid, Curr. Opin.
Cell Biol. 7, 148-155 (1995)).
[0124] Another connection between VEGF.sub.165R/NP-1 and
angiogenesis comes from studies in which NP-1 was overexpressed
ectopically in transgenic mice (Kitsuskawa et al., Develop. 121,
4309-4318 (1995)). NP-1 overexpression resulted in embryonic
lethality and the mice died in utero no later than on embryonic day
15.5 and those that survived the best had lower levels of NP-1
expression. Mice overexpressing NP-1 displayed morphologic
abnormalities in a limited number of non-neural tissues such as
blood vessels, the heart and the limbs. NP-1 was expressed in both
the EC and in the mesenchymal cells surrounding the EC. The embryos
possessed excess and abnormal capillaries and blood vessels
compared to normal counterparts and in some cases dilated blood
vessels as well. Some of the chimeric mice showed hemorrhaging,
mainly in the head and neck. These results are consistent with the
possibility that ectopic overexpression of VEGF.sub.165R/NP-1
results in inappropriate VEGF165 activity, thereby mediating
enhanced and/or aberrant angiogenesis. Another piece of evidence
for a link between NP-1 and angiogenesis comes from a recent report
showing that in mice targeted for disruption of the NP-1 gene, the
embryos have severe abnormalities in the peripheral nervous system
but that their death in utero at days 10.5-12.5 is most probably
due to anomalies in the cardiovascular system (Kitsukawa et al.,
Neuron 19, 995-1005 (1997)).
VEGF.sub.165R/NP-1 is Associated with Tumor-Derived Cells
[0125] The greatest degree of VEGF.sub.165R/NP-1 expression that we
have detected so far occurs in tumor-derived cells such as 231
breast carcinoma cells and PC3 prostate carcinoma cells, far more
than occurs in HUVEC. The tumor cells express abundant levels of
VEGF.sub.165R/NP-1 mRNA and about 200,000 VEGFI65 receptors/cell
(Soker et al., J. Biol. Chem. 271, 5761-5767 (1996)). On the other
hand, these tumor cells do not express KDR or Flt-1 so that
VEGF.sub.165R/NP-1 is the only VEGF receptor associated with these
cells. The tumor cells are therefore useful for testing whether
VEGF.sub.165R/NP-I is a functional receptor for VEGF.sub.165 in the
absence of a KDR background. To date, we have not been able to show
that VEGF.sub.165R/NP-1 mediates a VEGF.sub.165 signal in
tumor-derived cells as measured by receptor tyrosine
phopshorylation. Nevertheless, VEGF.sub.165 might have an effect on
tumor cells by inducing some, as yet undetermined activity such as
enhanced survival, differentiation, or motility. A recent report
has demonstrated that glioma cells express a 190 kDa protein that
binds VEGF.sub.165 but not VEGF.sub.121 efficiently (Omura et al.,
J. Biol. Chem. 272, 23317-23322 (1997)). No stimulation of tyrosine
phosphorylation could be demonstrated upon binding of VEGF.sub.165
to this receptor. Whether the 190 kDa isoform-specific receptor is
related to VEGF.sub.165R/NP-1 is not known presently.
[0126] VEGF.sub.165R/NP-1 may have a storage and sequestration
function for VEGF.sub.165. One might envision that VEGF.sub.165 is
produced by a tumor cell and binds to VEGF.sub.165R/NP-1 on that
cell via the exon 7-encoded domain (Soker et al., J. Biol. Chem.
271, 5761-5767 (1996)). The stored VEGF.sub.165 could be then
released to stimulate tumor angiogenesis in a paracrine manner.
Alternatively, VEGF.sub.165R/NP-1 may mediate a juxtacrine effect
in which VEGF.sub.165 is bound to VEGF.sub.165R/NP-1 on a tumor
cell via the exon 7-encoded domain and is also bound to KDR on a
neighboring EC via the exon 4-encoded domain (Keyt et al., J. Biol.
Chem. 271, 5638-5646 (1996b)). Such a mechanism could result in a
more efficient way for tumor cells to attract EC, thereby enhancing
tumor angiogenesis.
[0127] In summary, we have demonstrated by independent purification
and expression cloning methods that the VEGF isoform specific
receptor, VEGF.sub.165R, is identical to NP-1, a cell surface
protein previously identified as playing a role in embryonic
development of the nervous system and as being a receptor for the
collapsins/semaphorins. Furthermore, binding to VEGF.sub.165R/NP-1
enhances the binding of VEGF165 to KDR on EC and tumor cells.
Experimental Rationale
[0128] We have discovered that tumor cell neuropilin-1 mediates
tumor cell motility and thereby metastasis. In a Boyden chamber
motility assay, VEGF.sub.165 (50 ng/ml) stimulates 231 breast
carcinoma cell motility in a dose-response manner, with a maximal
2-fold stimulation (FIG. 15A). On the other hand, VEGF.sub.121 has
no effect on motility of these cells (FIG. 15B). Since 231 cells do
not express KDR or Flt-1, these results suggest that tumor cells
are directly responsive to VEGF.sub.165 and that VEGF.sub.165 might
signal tumor cells via neuropilin-1. Possible candidates for
mediating VEGF.sub.165-induced motility of carcinoma cells are
PI3-kinase (PI3-K) (Carpenter, et al. (1996) Curr. Opin. Cell Biol.
8: 153-158.). Since 231 cells do not express KDR or Flt-1, these
results suggest that tumor cells are directly responsive to
VEGF.sub.165 and that VEGF.sub.165 might signal tumor cells via
neuropilin-1.
[0129] The other type of evidence is that neuropilin-1 expression
might be associated with tumor cell motility. We have analyzed two
variants of Dunning rat prostate carcinoma cells, AT2.1 cells,
which are of low motility and low metastatic potential, and AT3.1
cells, which are highly motile, and metastatic. Cross-linking and
Northern blot analysis show that AT3.1 cells express abundant
neuropilin-1, capable of binding VEGF.sub.165, while AT2.1 cells
don't express neuropilin-1 (FIG. 16). Immunostaining of tumor
sections confirms the expression of neuropilin-1 in AT3.1, but not
AT2.1 tumors (FIG. 17). Furthermore, the immunostaining shows that
in subcutaneous AT3.1 and PC3 tumors, the tumor cells expressing
neuropilin-1 are found preferentially at the invading front of the
tumor/dermis boundary (FIG. 17). To determine more directly whether
neuropilin-1 expression is correlated with enhanced motility,
neuropilin-1 was overexpressed in AT2.1 cells (FIG. 18). Three
stable clones of AT2.1 cells overexpressing neuropilin-1 had
enhanced motility in the Boyden chamber assay.
[0130] These results indicate that expression of neuropilin-1 in
AT2.1 cells enhances their motility. Taken together, it appears
that neuropilin-1 expression on tumor cells is associated with the
motile, metastatic phenotype.
Example 2
Experimental Procedures
[0131] Collapsin/semaphorins. Expression plasmids for expressing
and purifying His-tagged collapsin-1 from transfected 293T cells
can be produced according to the methods of (Koppel, et al. (1998)
J. Biol. Chem. 273: 15708-15713, Feiner, et al. (1997) Neuron 19:
539-545.). Expression vectors for expressing sema E and sema IV
alkaline phosphate (AP) conjugates in cells are disclosed in (He Z,
Tessier-Lavigne M. (1997). Neuropilin is a receptor for the axonal
chemorepellent semaphorin III. Cell 90: 739-751.). Migration was
measured in a Boyden chamber Falk, et al., J. Immunol. 118:239-247
(1980) with increasing concentration of recombinant chick
collapsin-1 in the bottom well and PAE cell transfectants in the
upper well.
[0132] Aortic Ring Assay. 200 gram rats were sacrificed and the
aorta is dissected between the aortic arch and kidney artery and
the adipofibrotic tissue around the aorta was removed. Aortic rings
were sliced at 1 mm intervals and embedded in type I collagen gels.
Each ring was cultured in one well of a 48-well plate with
serum-free endothelial cell medium (GIBCO). The number of
microvessels were counted in each ring using a phase microscope
(Miao, et al. (1997). J. Clin. Invest. 99: 1565-1575.).
[0133] We established several endothelial cell lines by
transfection of parental porcine aortic endothelial cells (PAE),
which normally do not express VEGF receptors (Soker, et al. (1998)
Cell 92: 735-745). The cell lines included PAE cells expressing
neuropilin-1 alone (PAE/NP I), PAE cells expressing KDR alone
(PAE/KDR) and PAE cells expressing both neuropilin-1 and KDR
(PAE/NP I/KDR). Collapsin-1 was obtained from Dr. Jon Raper,
University of Pennsylvania (Luo, et al. (1993) Cell 75:
217-227.).
[0134] Binding studies demonstrated that .sup.125I-collapsin-1
could bind to PAE/NPI cells and PAE/NPI/KDR cells but not at all to
PAE or PAE/KDR cells.
[0135] In a Boyden chamber assay, collapsin-1 at 50-100 collapsin
units/ml (CU) inhibited the basal migration of PAE/NP and
PAE/NP1/KDR cells by 70% but had no inhibitory effect, whatsoever,
on basal PAE or PAE/KDR cell migration (FIG. 20). This effect is
fairly potent since 1 CU represents about 3 ng/ml protein. The
collapsin-1 inhibitory effect was inhibited by anti-neuropilin-1
antibodies. These results indicate that collapsins can inhibit the
migration of non-neuronal endothelial cells as long as they express
neuropilin-1.
[0136] Collapsin-I inhibited the migration of PAE/NP and PAE/NP/KDR
cells in the presence of VEGF.sub.165, to the same degree, the
baseline being higher. We have also found that addition of
collapsin in a rat aortic ring assay (a model for angiogenesis in
vitro) inhibits the migration of endothelial cells out of the ring,
and endothelial tube formation (FIG. 21).
[0137] The references cited throughout the specification are
incorporated herein by reference.
[0138] The present invention has been described with reference to
specific embodiments. However, this application is intended to
cover those changes and substitutions which may be made by those
skilled in the art without departing from the spirit and the scope
of the appended claims.
Sequence CWU 1
1
1115653DNAhuman 1aagggagagg aagccggagc taaatgacag gatgcaggcg
acttgagaca caaaaagaga 60agcgttcctc tcggatccag gcattgcctc gctgctttct
tttctccaag acgggctgag 120gattgtacag ctctaggcgg agttggggct
cttcggatcg cttagattct cctctttgct 180gcatttcccc ccacgtcctc
gttctcccgc gtctgcctgc ggacccggag aagggagaat 240ggagaggggg
ctgccgctcc tctgcgccgt gctcgccctc gtcctcgccc cggccggcgc
300ttttcgcaac gataaatgtg gcgatactat aaaaattgaa agccccgggt
accttacatc 360tcctggttat cctcattctt atcacccaag tgaaaaatgc
gaatggctga ttcaggctcc 420ggacccatac cagagaatta tgatcaactt
caaccctcac ttcgatttgg aggacagaga 480ctgcaagtat gactacgtgg
aagtgttcga tggagaaaat gaaaatggac attttagggg 540aaagttctgt
ggaaagatag cccctcctcc tgttgtgtct tcagggccat ttctttttat
600caaatttgtc tctgactacg aaacacatgg tgcaggattt tccatacgtt
atgaaatttt 660caagagaggt cctgaatgtt cccagaacta cacaacacct
agtggagtga taaagtcccc 720cggattccct gaaaaatatc ccaacagcct
tgaatgcact tatattgtct ttgcgccaaa 780gatgtcagag attatcctgg
aatttgaaag ctttgacctg gagcctgact caaatcctcc 840aggggggatg
ttctgtcgct acgaccggct agaaatctgg gatggattcc ctgatgttgg
900ccctcacatt gggcgttact gtggacagaa aacaccaggt cgaatccgat
cctcatcggg 960cattctctcc atggtttttt acaccgacag cgcgatagca
aaagaaggtt tctcagcaaa 1020ctacagtgtc ttgcagagca gtgtctcaga
agatttcaaa tgtatggaag ctctgggcat 1080ggaatcagga gaaattcatt
ctgaccagat cacagcttct tcccagtata gcaccaactg 1140gtctgcagag
cgctcccgcc tgaactaccc tgagaatggg tggactcccg gagaggattc
1200ctaccgagag tggatacagg tagacttggg ccttctgcgc tttgtcacgg
ctgtcgggac 1260acagggcgcc atttcaaaag aaaccaagaa gaaatattat
gtcaagactt acaagatcga 1320cgttagctcc aacggggaag actggatcac
cataaaagaa ggaaacaaac ctgttctctt 1380tcagggaaac accaacccca
cagatgttgt ggttgcagta ttccccaaac cactgataac 1440tcgatttgtc
cgaatcaagc ctgcaacttg ggaaactggc atatctatga gatttgaagt
1500atacggttgc aagataacag attatccttg ctctggaatg ttgggtatgg
tgtctggact 1560tatttctgac tcccagatca catcatccaa ccaaggggac
agaaactgga tgcctgaaaa 1620catccgcctg gtaaccagtc gctctggctg
ggcacttcca cccgcacctc attcctacat 1680caatgagtgg ctccaaatag
acctggggga ggagaagatc gtgaggggca tcatcattca 1740gggtgggaag
caccgagaga acaaggtgtt catgaggaag ttcaagatcg ggtacagcaa
1800caacggctcg gactggaaga tgatcatgga tgacagcaaa cgcaaggcga
agtcttttga 1860gggcaacaac aactatgata cacctgagct gcggactttt
ccagctctct ccacgcgatt 1920catcaggatc taccccgaga gagccactca
tggcggactg gggctcagaa tggagctgct 1980gggctgtgaa gtggaagccc
ctacagctgg accgaccact cccaacggga acttggtgga 2040tgaatgtgat
gacgaccagg ccaactgcca cagtggaaca ggtgatgact tccagctcac
2100aggtggcacc actgtgctgg ccacagaaaa gcccacggtc atagacagca
ccatacaatc 2160agagtttcca acatatggtt ttaactgtga atttggctgg
ggctctcaca agaccttctg 2220ccactgggaa catgacaatc acgtgcagct
caagtggagt gtgttgacca gcaagacggg 2280acccattcag gatcacacag
gagatggcaa cttcatctat tcccaagctg acgaaaatca 2340gaagggcaaa
gtggctcgcc tggtgagccc tgtggtttat tcccagaact ctgcccactg
2400catgaccttc tggtatcaca tgtctgggtc ccacgtcggc acactcaggg
tcaaactgcg 2460ctaccagaag ccagaggagt acgatcagct ggtctggatg
gccattggac accaaggtga 2520ccactggaag gaagggcgtg tcttgctcca
caagtctctg aaactttatc aggtgatttt 2580cgagggcgaa atcggaaaag
gaaaccttgg tgggattgct gtggatgaca ttagtattaa 2640caaccacatt
tcacaagaag attgtgcaaa accagcagac ctggataaaa agaacccaga
2700aattaaaatt gatgaaacag ggagcacgcc aggatacgaa ggtgaaggag
aaggtgacaa 2760gaacatctcc aggaagccag gcaatgtgtt gaagacctta
gatcccatcc tcatcaccat 2820catagccatg agtgccctgg gggtcctcct
gggggctgtc tgtggggtcg tgctgtactg 2880tgcctgttgg cataatggga
tgtcagaaag aaacttgtct gccctggaga actataactt 2940tgaacttgtg
gatggtgtga agttgaaaaa agacaaactg aatacacaga gtacttattc
3000ggaggcatga aggcagacag agatgaaaag acagtcaaag gacggaagtg
gaaggacggg 3060agtgagctgg ggagctgttg atctttcact atacaggctg
ggaagtgtgt tgatgaccac 3120tgagccaggc ttttctcagg agcttcaatg
agtatggccg acagacatgg acaaggagct 3180gtgttcacca tcggactcat
gtgcagtcag cttttttcct gttggtttca tttgaataat 3240cagatgctgg
tgttgagacc aagtatgatt gacataatca ttcatttcga cccctcctgc
3300ccctctctct ctctctcctc tcccctttgt ggattctttt tggaaactga
gcgaaatcca 3360agatgctggc accaagcgta ttccgtgtgg ccctttggat
ggacatgcta cctgaaaccc 3420agtgcccaga atatactaga atcaccgcat
ttcagtggac tcctgaagtt gtacttgtgt 3480ataattgccc gcgtcgtgca
taggcaaaga aggattaggc tgttttcttt ttaaagtact 3540gtagcctcag
tactggtgta gtgtgtcagc tctgtttacg aagcaatact gtccagtttt
3600cttgctgttt ttccggtgtt gtactaaacc tcgtgcttgt gaactccata
cagaaaacgg 3660tgccatccct gaacacggct ggccactggg tatactgctg
acaaccgcaa caacaaaaac 3720acaaatcctt ggcactggct agtctatgtc
ctctcaagtg cctttttgtt tgtactggtt 3780cattgtgtta cattaacgac
ccactctgct tcttgctggt gaaagccctg ctctttaatc 3840aaactctggt
ggcccactga ctaagaagaa agtttatttt cgtgtgagat gccagcccct
3900ccgggcaggc aagggctctg aagatttggc aacgtggctt aattgttctg
ctttttctgt 3960agttcaattt catgtttctt gacccttttg tataaagcta
caatattctc tcttattgtt 4020ctttcatatg gaatgtattt tcaaatgtaa
actctcttct ctttctctct cctatctctc 4080tgtctttttt ctctcttaga
attggaggat ttgccattgt ccaggaaaga aacttgcagc 4140tttaacctgc
tgggaatggc aaacgatttt actagacttt atgtttaaaa ataaataaat
4200aagggaaatt cctaactttg ccctccaaag tctaactttg gttttcttgt
taactggtta 4260aagtgacagt atcttttttc cttatctatt ctattcaaaa
tgacctttga tagaaatgtt 4320ggcatttagt agaaatagtg ataagttgag
gaaagaaata atacaaattg gctttcaagt 4380gagacccaaa ggaagaactg
gataaaatct tccaaatcca aaagcatgag atttttctat 4440ccaaatatgc
aaaaatgacc caagagaact ttcttatttt gctactgagt cacacaaggg
4500aagtggaagg aagaacagtt aatttaagaa tgaaactata aatcctgatg
cctgggggtc 4560aagtatttta agataagagg gggaaaaaca cataaagtca
aacaaatgtt ttaaaaattc 4620ataacagcaa ccttgaaaaa atagacttaa
atgaatgctt ctagaaactt ccagcggctc 4680acaaagaata agcctgcctt
agggctggca acatctaagc ctctaacagc acagggaagc 4740aaatatctta
ccaggcagcc tatgaattaa cccaaagaag ctttggttgg ttttggtgga
4800tttttatcat gccatgttgg acatgagatt ttttagatct tccttcccca
cattgctaga 4860cgtctcactc aaagacattt gttgggagtc acatttgcat
catagacgag acagtccatt 4920catcttagtt aaattggatt gagaatgcct
tttgtttcca ggaaaatatt gatcaccatg 4980aaagaagaat agttttttgt
ccccagagac attcatttag ttgatataat cctaccagaa 5040ggaaagcact
aagaaacact cgtttgttgt ttttaaaggc aacagactta aagttgtcct
5100cagccaagga aaaatgatac tgcaacttta aaatttaaag tatcttgcac
tgataaatat 5160atttaaaaat tatatgttta taaagttatt aatttgtaaa
ggcagtgtta caaaatgttc 5220agtttatatt gttttagatt gttttgtaat
ttttaaaggt gtaaaataac atataaatat 5280atttaaaaat tatatgttta
taaagttatt aatttgtaaa ggcagtgtta caaaatgttc 5340agtttatatt
gttttagatt gttttgtaat ttttaaaggt gtaaaataac atattttttc
5400tttatggaaa tctataaaac tttctgtagt aaaatgtttt cattttactg
gtatattatt 5460gcttcatgtt ttgtaccatc ataagatttt gtgcagattt
tttttacaga aattattatt 5520ttctatgaca atatgacact tgtaaattgt
tgtttcaaaa tgaacagcga agccttaact 5580ttaaatgaca tttgtattct
cagacactga gtagcataaa aaccacatga actgaactgt 5640aacttaaatt ctt
56532923PRThuman 2Met Glu Arg Gly Leu Pro Leu Leu Cys Ala Val Leu
Ala Leu Val Leu 1 5 10 15Ala Pro Ala Gly Ala Phe Arg Asn Asp Lys
Cys Gly Asp Thr Ile Lys 20 25 30Ile Glu Ser Pro Gly Tyr Leu Thr Ser
Pro Gly Tyr Pro His Ser Tyr 35 40 45His Pro Ser Glu Lys Cys Glu Trp
Leu Ile Gln Ala Pro Asp Pro Tyr 50 55 60Gln Arg Ile Met Ile Asn Phe
Asn Pro His Phe Asp Leu Glu Asp Arg65 70 75 80Asp Cys Lys Tyr Asp
Tyr Val Glu Val Phe Asp Gly Glu Asn Glu Asn 85 90 95Gly His Phe Arg
Gly Lys Phe Cys Gly Lys Ile Ala Pro Pro Pro Val 100 105 110Val Ser
Ser Gly Pro Phe Leu Phe Ile Lys Phe Val Ser Asp Tyr Glu 115 120
125Thr His Gly Ala Gly Phe Ser Ile Arg Tyr Glu Ile Phe Lys Arg Gly
130 135 140Pro Glu Cys Ser Gln Asn Tyr Thr Thr Pro Ser Gly Val Ile
Lys Ser145 150 155 160Pro Gly Phe Pro Glu Lys Tyr Pro Asn Ser Leu
Glu Cys Thr Tyr Ile 165 170 175Val Phe Ala Pro Lys Met Ser Glu Ile
Ile Leu Glu Phe Glu Ser Phe 180 185 190Asp Leu Glu Pro Asp Ser Asn
Pro Pro Gly Gly Met Phe Cys Arg Tyr 195 200 205Asp Arg Leu Glu Ile
Trp Asp Gly Phe Pro Asp Val Gly Pro His Ile 210 215 220Gly Arg Tyr
Cys Gly Gln Lys Thr Pro Gly Arg Ile Arg Ser Ser Ser225 230 235
240Gly Ile Leu Ser Met Val Phe Tyr Thr Asp Ser Ala Ile Ala Lys Glu
245 250 255Gly Phe Ser Ala Asn Tyr Ser Val Leu Gln Ser Ser Val Ser
Glu Asp 260 265 270Phe Lys Cys Met Glu Ala Leu Gly Met Glu Ser Gly
Glu Ile His Ser 275 280 285Asp Gln Ile Thr Ala Ser Ser Gln Tyr Ser
Thr Asn Trp Ser Ala Glu 290 295 300Arg Ser Arg Leu Asn Tyr Pro Glu
Asn Gly Trp Thr Pro Gly Glu Asp305 310 315 320Ser Tyr Arg Glu Trp
Ile Gln Val Asp Leu Gly Leu Leu Arg Phe Val 325 330 335Thr Ala Val
Gly Thr Gln Gly Ala Ile Ser Lys Glu Thr Lys Lys Lys 340 345 350Tyr
Tyr Val Lys Thr Tyr Lys Ile Asp Val Ser Ser Asn Gly Glu Asp 355 360
365Trp Ile Thr Ile Lys Glu Gly Asn Lys Pro Val Leu Phe Gln Gly Asn
370 375 380Thr Asn Pro Thr Asp Val Val Val Ala Val Phe Pro Lys Pro
Leu Ile385 390 395 400Thr Arg Phe Val Arg Ile Lys Pro Ala Thr Trp
Glu Thr Gly Ile Ser 405 410 415Met Arg Phe Glu Val Tyr Gly Cys Lys
Ile Thr Asp Tyr Pro Cys Ser 420 425 430Gly Met Leu Gly Met Val Ser
Gly Leu Ile Ser Asp Ser Gln Ile Thr 435 440 445Ser Ser Asn Gln Gly
Asp Arg Asn Trp Met Pro Glu Asn Ile Arg Leu 450 455 460Val Thr Ser
Arg Ser Gly Trp Ala Leu Pro Pro Ala Pro His Ser Tyr465 470 475
480Ile Asn Glu Trp Leu Gln Ile Asp Leu Gly Glu Glu Lys Ile Val Arg
485 490 495Gly Ile Ile Ile Gln Gly Gly Lys His Arg Glu Asn Lys Val
Phe Met 500 505 510Arg Lys Phe Lys Ile Gly Tyr Ser Asn Asn Gly Ser
Asp Trp Lys Met 515 520 525Ile Met Asp Asp Ser Lys Arg Lys Ala Lys
Ser Phe Glu Gly Asn Asn 530 535 540Asn Tyr Asp Thr Pro Glu Leu Arg
Thr Phe Pro Ala Leu Ser Thr Arg545 550 555 560Phe Ile Arg Ile Tyr
Pro Glu Arg Ala Thr His Gly Gly Leu Gly Leu 565 570 575Arg Met Glu
Leu Leu Gly Cys Glu Val Glu Ala Pro Thr Ala Gly Pro 580 585 590Thr
Thr Pro Asn Gly Asn Leu Val Asp Glu Cys Asp Asp Asp Gln Ala 595 600
605Asn Cys His Ser Gly Thr Gly Asp Asp Phe Gln Leu Thr Gly Gly Thr
610 615 620Thr Val Leu Ala Thr Glu Lys Pro Thr Val Ile Asp Ser Thr
Ile Gln625 630 635 640Ser Glu Phe Pro Thr Tyr Gly Phe Asn Cys Glu
Phe Gly Trp Gly Ser 645 650 655His Lys Thr Phe Cys His Trp Glu His
Asp Asn His Val Gln Leu Lys 660 665 670Trp Ser Val Leu Thr Ser Lys
Thr Gly Pro Ile Gln Asp His Thr Gly 675 680 685Asp Gly Asn Phe Ile
Tyr Ser Gln Ala Asp Glu Asn Gln Lys Gly Lys 690 695 700Val Ala Arg
Leu Val Ser Pro Val Val Tyr Ser Gln Asn Ser Ala His705 710 715
720Cys Met Thr Phe Trp Tyr His Met Ser Gly Ser His Val Gly Thr Leu
725 730 735Arg Val Lys Leu Arg Tyr Gln Lys Pro Glu Glu Tyr Asp Gln
Leu Val 740 745 750Trp Met Ala Ile Gly His Gln Gly Asp His Trp Lys
Glu Gly Arg Val 755 760 765Leu Leu His Lys Ser Leu Lys Leu Tyr Gln
Val Ile Phe Glu Gly Glu 770 775 780Ile Gly Lys Gly Asn Leu Gly Gly
Ile Ala Val Asp Asp Ile Ser Ile785 790 795 800Asn Asn His Ile Ser
Gln Glu Asp Cys Ala Lys Pro Ala Asp Leu Asp 805 810 815Lys Lys Asn
Pro Glu Ile Lys Ile Asp Glu Thr Gly Ser Thr Pro Gly 820 825 830Tyr
Glu Gly Glu Gly Glu Gly Asp Lys Asn Ile Ser Arg Lys Pro Gly 835 840
845Asn Val Leu Lys Thr Leu Asp Pro Ile Leu Ile Thr Ile Ile Ala Met
850 855 860Ser Ala Leu Gly Val Leu Leu Gly Ala Val Cys Gly Val Val
Leu Tyr865 870 875 880Cys Ala Cys Trp His Asn Gly Met Ser Glu Arg
Asn Leu Ser Ala Leu 885 890 895Glu Asn Tyr Asn Phe Glu Leu Val Asp
Gly Val Lys Leu Lys Lys Asp 900 905 910Lys Leu Asn Thr Gln Ser Thr
Tyr Ser Glu Ala 915 92033404DNAhuman 3gaattcggca cgaggggaaa
ataaaagaga gaaaaacaca aagatttaaa caagaaacct 60acgaacccag ctctggaaag
agccaccttc tccaaaatgg atatgtttcc tctcacctgg 120gttttcttag
ccctctactt ttcaagacac caagtgagag gccaaccaga cccaccgtgc
180ggaggtcgtt tgaattccaa agatgctggc tatatcacct ctcccggtta
cccccaggac 240tacccctccc accagaactg cgagtggatt gtttacgccc
ccgaacccaa ccagaagatt 300gtcctcaact tcaaccctca ctttgaaatc
gagaagcacg actgcaagta tgactttatc 360gagattcggg atggggacag
tgaatccgca gacctcctgg gcaaacactg tgggaacatc 420gccccgccca
ccatcatctc ctcgggctcc atgctctaca tcaagttcac ctccgactac
480gcccggcagg gggcaggctt ctctctgcgc tacgagatct tcaagacagg
ctctgaagat 540tgctcaaaaa acttcacaag ccccaacggg accatcgaat
ctcctgggtt tcctgagaag 600tatccacaca acttggactg cacctttacc
atcctggcca aacccaagat ggagatcatc 660ctgcagttcc tgatctttga
cctggagcat gaccctttgc aggtgggaga gggggactgc 720aagtacgatt
ggctggacat ctgggatggc attccacatg ttggccccct gattggcaag
780tactgtggga ccaaaacacc ctctgaactt cgttcatcga cggggatcct
ctccctgacc 840tttcacacgg acatggcggt ggccaaggat ggcttctctg
cgcgttacta cctggtccac 900caagagccac tagagaactt tcagtgcaat
gttcctctgg gcatggagtc tggccggatt 960gctaatgaac agatcagtgc
ctcatctacc tactctgatg ggaggtggac ccctcaacaa 1020agccggctcc
atggtgatga caatggctgg acccccaact tggattccaa caaggagtat
1080ctccaggtgg acctgcgctt tttaaccatg ctcacggcca tcgcaacaca
gggagcgatt 1140tccagggaaa cacagaatgg ctactacgtc aaatcctaca
agctggaagt cagcactaat 1200ggagaggact ggatggtgta ccggcatggc
aaaaaccaca aggtatttca agccaacaac 1260gatgcaactg aggtggttct
gaacaagctc cacgctccac tgctgacaag gtttgttaga 1320atccgccctc
agacctggca ctcaggtatc gccctccggc tggagctctt cggctgccgg
1380gtcacagatg ctccctgctc caacatgctg gggatgctct caggcctcat
tgcagactcc 1440cagatctccg cctcttccac ccaggaatac ctctggagcc
ccagtgcagc ccgcctggtc 1500agcagccgct cgggctggtt ccctcgaatc
cctcaggccc agcccggtga ggagtggctt 1560caggtagatc tgggaacacc
caagacagtg aaaggtgtca tcatccaggg agcccgcgga 1620ggagacagta
tcactgctgt ggaagccaga gcatttgtgc gcaagttcaa agtctcctac
1680agcctaaacg gcaaggactg ggaatacatt caggacccca ggacccagca
gccaaagctg 1740ttcgaaggga acatgcacta tgacacccct gacatccgaa
ggtttgaccc cattccggca 1800cagtatgtgc gggtataccc ggagaggtgg
tcgccggcgg ggattgggat gcggctggag 1860gtgctgggct gtgactggac
agactccaag cccacggtag agacgctggg acccactgtg 1920aagagcgaag
agacaaccac cccctacccc accgaagagg aggccacaga gtgtggggag
1980aactgcagct ttgaggatga caaagatttg cagctccctt cgggattcaa
ttgcaacttc 2040gatttcctcg aggagccctg tggttggatg tatgaccatg
ccaagtggct ccggaccacc 2100tgggccagca gctccagccc aaacgaccgg
acgtttccag atgacaggaa tttcttgcgg 2160ctgcagagtg acagccagag
agagggccag tatgcccggc tcatcagccc ccctgtccac 2220ctgccccgaa
gcccggtgtg catggagttc cagtaccagg ccacgggcgg ccgcggggtg
2280gcgctgcagg tggtgcggga agccagccag gagagcaagt tgctgtgggt
catccgtgag 2340gaccagggcg gcgagtggaa gcacgggcgg atcatcctgc
ccagctacga catggagtac 2400cagattgtgt tcgagggagt gatagggaaa
ggacgttccg gagagattgc cattgatgac 2460attcggataa gcactgatgt
cccactggag aactgcatgg aacccatctc ggcttttgca 2520ggtgagaatt
ttaaagtgga catcccagaa atacatgaga gagaaggata tgaagatgaa
2580attgatgatg aatacgaggt ggactggagc aattcttctt ctgcaacctc
agggtctggc 2640gccccctcga ccgacaaaga aaagagctgg ctgtacaccc
tggatcccat cctcatcacc 2700atcatcgcca tgagctcact gggcgtcctc
ctgggggcca cctgtgcagg cctcctgctc 2760tactgcacct gttcctactc
gggcctgagc tcccgaagct gcaccacact ggagaactac 2820aacttcgagc
tctacgatgg ccttaagcac aaggtcaaga tgaaccacca aaagtgctgc
2880tccgaggcat gacggattgc acctgaatcc tatctgacgt ttcattccag
caagaggggc 2940tggggaagat tacatttttt tttcctttgg aaactgaatg
ccataatctc gatcaaaccg 3000atccagaata ccgaaggtat ggacaggaca
gaaaagcgag tcgcaggagg aagggagatg 3060cagccgcaca ggggatgatt
accctcctag gaccgcggtg gctaagtcat tgcaggaacg 3120gggctgtgtt
ctctgctggg acaaaacagg agctcatctc tttggggtca cagttctatt
3180ttgtttgtga gtttgtatta ttattattat tattattatt atattttatt
tctttggtct 3240gtgagcaact caaagaggca gaagaggaga atgacttttc
cagaatagaa gtggagcagt 3300gatcattatt ctccgctttc tctttctaat
caacacttga aaagcaaagt gtcttttcag 3360cctttccatc tttacaaata
aaactcaaaa aagctgtcca gctt 34044931PRThuman 4Met Asp Met Phe Pro
Leu Thr Trp Val Phe Leu Ala Leu Tyr Phe Ser 1 5 10 15Arg His Gln
Val Arg Gly Gln Pro Asp Pro Pro Cys Gly Gly Arg Leu 20 25 30Asn Ser
Lys Asp Ala Gly Tyr Ile Thr Ser Pro Gly Tyr Pro Gln Asp 35 40
45Tyr Pro Ser His Gln Asn Cys Glu Trp Ile Val Tyr Ala Pro Glu Pro
50 55 60Asn Gln Lys Ile Val Leu Asn Phe Asn Pro His Phe Glu Ile Glu
Lys65 70 75 80His Asp Cys Lys Tyr Asp Phe Ile Glu Ile Arg Asp Gly
Asp Ser Glu 85 90 95Ser Ala Asp Leu Leu Gly Lys His Cys Gly Asn Ile
Ala Pro Pro Thr 100 105 110Ile Ile Ser Ser Gly Ser Met Leu Tyr Ile
Lys Phe Thr Ser Asp Tyr 115 120 125Ala Arg Gln Gly Ala Gly Phe Ser
Leu Arg Tyr Glu Ile Phe Lys Thr 130 135 140Gly Ser Glu Asp Cys Ser
Lys Asn Phe Thr Ser Pro Asn Gly Thr Ile145 150 155 160Glu Ser Pro
Gly Phe Pro Glu Lys Tyr Pro His Asn Leu Asp Cys Thr 165 170 175Phe
Thr Ile Leu Ala Lys Pro Lys Met Glu Ile Ile Leu Gln Phe Leu 180 185
190Ile Phe Asp Leu Glu His Asp Pro Leu Gln Val Gly Glu Gly Asp Cys
195 200 205Lys Tyr Asp Trp Leu Asp Ile Trp Asp Gly Ile Pro His Val
Gly Pro 210 215 220Leu Ile Gly Lys Tyr Cys Gly Thr Lys Thr Pro Ser
Glu Leu Arg Ser225 230 235 240Ser Thr Gly Ile Leu Ser Leu Thr Phe
His Thr Asp Met Ala Val Ala 245 250 255Lys Asp Gly Phe Ser Ala Arg
Tyr Tyr Leu Val His Gln Glu Pro Leu 260 265 270Glu Asn Phe Gln Cys
Asn Val Pro Leu Gly Met Glu Ser Gly Arg Ile 275 280 285Ala Asn Glu
Gln Ile Ser Ala Ser Ser Thr Tyr Ser Asp Gly Arg Trp 290 295 300Thr
Pro Gln Gln Ser Arg Leu His Gly Asp Asp Asn Gly Trp Thr Pro305 310
315 320Asn Leu Asp Ser Asn Lys Glu Tyr Leu Gln Val Asp Leu Arg Phe
Leu 325 330 335Thr Met Leu Thr Ala Ile Ala Thr Gln Gly Ala Ile Ser
Arg Glu Thr 340 345 350Gln Asn Gly Tyr Tyr Val Lys Ser Tyr Lys Leu
Glu Val Ser Thr Asn 355 360 365Gly Glu Asp Trp Met Val Tyr Arg His
Gly Lys Asn His Lys Val Phe 370 375 380Gln Ala Asn Asn Asp Ala Thr
Glu Val Val Leu Asn Lys Leu His Ala385 390 395 400Pro Leu Leu Thr
Arg Phe Val Arg Ile Arg Pro Gln Thr Trp His Ser 405 410 415Gly Ile
Ala Leu Arg Leu Glu Leu Phe Gly Cys Arg Val Thr Asp Ala 420 425
430Pro Cys Ser Asn Met Leu Gly Met Leu Ser Gly Leu Ile Ala Asp Ser
435 440 445Gln Ile Ser Ala Ser Ser Thr Gln Glu Tyr Leu Trp Ser Pro
Ser Ala 450 455 460Ala Arg Leu Val Ser Ser Arg Ser Gly Trp Phe Pro
Arg Ile Pro Gln465 470 475 480Ala Gln Pro Gly Glu Glu Trp Leu Gln
Val Asp Leu Gly Thr Pro Lys 485 490 495Thr Val Lys Gly Val Ile Ile
Gln Gly Ala Arg Gly Gly Asp Ser Ile 500 505 510Thr Ala Val Glu Ala
Arg Ala Phe Val Arg Lys Phe Lys Val Ser Tyr 515 520 525Ser Leu Asn
Gly Lys Asp Trp Glu Tyr Ile Gln Asp Pro Arg Thr Gln 530 535 540Gln
Pro Lys Leu Phe Glu Gly Asn Met His Tyr Asp Thr Pro Asp Ile545 550
555 560Arg Arg Phe Asp Pro Ile Pro Ala Gln Tyr Val Arg Val Tyr Pro
Glu 565 570 575Arg Trp Ser Pro Ala Gly Ile Gly Met Arg Leu Glu Val
Leu Gly Cys 580 585 590Asp Trp Thr Asp Ser Lys Pro Thr Val Glu Thr
Leu Gly Pro Thr Val 595 600 605Lys Ser Glu Glu Thr Thr Thr Pro Tyr
Pro Thr Glu Glu Glu Ala Thr 610 615 620Glu Cys Gly Glu Asn Cys Ser
Phe Glu Asp Asp Lys Asp Leu Gln Leu625 630 635 640Pro Ser Gly Phe
Asn Cys Asn Phe Asp Phe Leu Glu Glu Pro Cys Gly 645 650 655Trp Met
Tyr Asp His Ala Lys Trp Leu Arg Thr Thr Trp Ala Ser Ser 660 665
670Ser Ser Pro Asn Asp Arg Thr Phe Pro Asp Asp Arg Asn Phe Leu Arg
675 680 685Leu Gln Ser Asp Ser Gln Arg Glu Gly Gln Tyr Ala Arg Leu
Ile Ser 690 695 700Pro Pro Val His Leu Pro Arg Ser Pro Val Cys Met
Glu Phe Gln Tyr705 710 715 720Gln Ala Thr Gly Gly Arg Gly Val Ala
Leu Gln Val Val Arg Glu Ala 725 730 735Ser Gln Glu Ser Lys Leu Leu
Trp Val Ile Arg Glu Asp Gln Gly Gly 740 745 750Glu Trp Lys His Gly
Arg Ile Ile Leu Pro Ser Tyr Asp Met Glu Tyr 755 760 765Gln Ile Val
Phe Glu Gly Val Ile Gly Lys Gly Arg Ser Gly Glu Ile 770 775 780Ala
Ile Asp Asp Ile Arg Ile Ser Thr Asp Val Pro Leu Glu Asn Cys785 790
795 800Met Glu Pro Ile Ser Ala Phe Ala Gly Glu Asn Phe Lys Val Asp
Ile 805 810 815Pro Glu Ile His Glu Arg Glu Gly Tyr Glu Asp Glu Ile
Asp Asp Glu 820 825 830Tyr Glu Val Asp Trp Ser Asn Ser Ser Ser Ala
Thr Ser Gly Ser Gly 835 840 845Ala Pro Ser Thr Asp Lys Glu Lys Ser
Trp Leu Tyr Thr Leu Asp Pro 850 855 860Ile Leu Ile Thr Ile Ile Ala
Met Ser Ser Leu Gly Val Leu Leu Gly865 870 875 880Ala Thr Cys Ala
Gly Leu Leu Leu Tyr Cys Thr Cys Ser Tyr Ser Gly 885 890 895Leu Ser
Ser Arg Ser Cys Thr Thr Leu Glu Asn Tyr Asn Phe Glu Leu 900 905
910Tyr Asp Gly Leu Lys His Lys Val Lys Met Asn His Gln Lys Cys Cys
915 920 925Ser Glu Ala 930518PRThuman 5Phe Arg Asn Asp Glu Cys Gly
Asp Thr Ile Lys Ile Glu Asn Pro Gly 1 5 10 15Tyr Leu618PRThuman
6Phe Arg Ser Asp Lys Cys Gly Gly Thr Ile Lys Ile Glu Ser Pro Gly 1
5 10 15Tyr Leu724DNAhuman 7tttcgcaacg ataaatgtgg cgat 24820DNAhuman
8tatcactcca ctaggtgttg 20920DNAhuman 9ccaaccagaa gattgtcctc
201020DNAhuman 10gtaggtagat gaggcactga 201144PRThuman 11Pro Cys Gly
Pro Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp 1 5 10 15Pro
Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys 20 25
30Ala Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys Arg 35 40
* * * * *
References