U.S. patent application number 13/954304 was filed with the patent office on 2014-02-20 for method of judging inflammatory disease by using single nucleotide polymorphism.
This patent application is currently assigned to RIKEN. The applicant listed for this patent is RIKEN. Invention is credited to Masatsugu HORI, Aritoshi IIDA, Yusuke NAKAMURA, Yozo OHNISHI, Kouichi OZAKI, Toshihiro TANAKA.
Application Number | 20140051074 13/954304 |
Document ID | / |
Family ID | 36647659 |
Filed Date | 2014-02-20 |
United States Patent
Application |
20140051074 |
Kind Code |
A1 |
TANAKA; Toshihiro ; et
al. |
February 20, 2014 |
METHOD OF JUDGING INFLAMMATORY DISEASE BY USING SINGLE NUCLEOTIDE
POLYMORPHISM
Abstract
An object of the present invention is to identify a novel single
nucleotide polymorphism (SNP) associated with the onset and the
advancement of inflammatory diseases such as myocardial infarction.
The present invention provides a method for judging an inflammatory
disease which comprises detecting at least 1 type of genetic
polymorphism existing in at least one gene selected from the group
consisting of the LBP-32 gene, the TSBP gene, and the WAP gene.
Inventors: |
TANAKA; Toshihiro;
(Kanagawa, JP) ; NAKAMURA; Yusuke; (Kanagawa,
JP) ; OHNISHI; Yozo; (Tokyo, JP) ; OZAKI;
Kouichi; (Tokyo, JP) ; IIDA; Aritoshi;
(Kanagawa, JP) ; HORI; Masatsugu; (Hyogo,
JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
RIKEN |
Saitama |
|
JP |
|
|
Assignee: |
RIKEN
Saitama
JP
|
Family ID: |
36647659 |
Appl. No.: |
13/954304 |
Filed: |
July 30, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11813450 |
Oct 5, 2009 |
8518644 |
|
|
PCT/JP2006/300095 |
Jan 6, 2006 |
|
|
|
13954304 |
|
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 2600/172 20130101;
C12Q 1/6876 20130101; C12Q 2600/136 20130101; C12Q 1/6883 20130101;
C12Q 2600/156 20130101; C12Q 2600/158 20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 7, 2005 |
JP |
2005-003089 |
Claims
1. A method of determining a susceptibility to myocardial
infarction in a human individual, comprising: analyzing a
biological sample from a human individual who has not had a
myocardial infarction for the presence or absence of any one of the
following alleles, and determining an increased susceptibility to
myocardial infarction for the individual when any one of the
following alleles is present in the biological sample, or
determining a decreased susceptibility to myocardial infarction for
the individual when any one of the following alleles is absent from
the biological sample: (1) allele A at nucleotide 151 in the
nucleotide sequence of intron 1 of an LBP-32 gene; (2) allele G at
nucleotide 306 in the nucleotide sequence of exon 25 of a TSBP
gene; and (3) allele A at nucleotide 1264 in the nucleotide
sequence of the 3' flanking region of a WAP12 gene.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a Divisional of U.S. application Ser.
No. 11/813,450, which is the National Stage of International
Application No. PCT/JP2006/300095, filed Jan. 6, 2006, which claims
priority to Japanese Patent Application No. 2005-003089, filed Jan.
7, 2005. The disclosure of application Ser. No. 11/813,450 and
PCT/JP2006/300095 are expressly incorporated by reference herein in
their entireties.
TECHNICAL FIELD
[0002] The present invention relates to a method for diagnosing
inflammatory diseases which comprises detecting genetic
polymorphisms existing in a LBP-32 gene, a TSBP gene and a WAP
gene, an oligonucleotide to be used in the method, a kit for
diagnosing inflammatory diseases which comprises the
oligonucleotide, and the use thereof.
BACKGROUND ART
[0003] Common genetic variants sometimes exert a strong influence
on expression levels and/or functions of the gene products. Such
common variants can be associated with susceptibility to diseases
and/or pharmacological responsiveness (Dean M, et al., (1996)
Genetic restriction of HIV-1 infection and progression to AIDS by a
deletion allele of the CKR5 structural gene. Hemophilia Growth and
Development Study, Multicenter AIDS Cohort Study, Multicenter
Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study.
Science 273:1856-1862; Risch N, et al., (1996) The future of
genetic studies of complex human diseases. Science 273:1516-1517;
and Kruglyak L (1997) The use of a genetic map of biallelic markers
in linkage studies. Nat Genet 17: 21-24).
[0004] SNPs are most simple and conventional DNA polymorphisms.
SNPs are present in every several hundred nucleotides on average
throughout the genome and relatively easy to genotype and analyze
the data. Recently, it has been hypothesized that common variants
may contribute to common diseases and pharmacological traits,
so-called "common disease-common variant" hypothesis (Risch N, et
al., (1996) The future of genetic studies of complex human
diseases. Science 273: 1516-1517). In that point of view, SNPs are
useful markers for identifying genes responsible for common
diseases (Kruglyak L (1999) Prospects for whole-genome linkage
disequilibrium mapping of common disease genes. Nat Genet 22:
139-144).
[0005] Myocardial infarction is one of the most common diseases in
Japan. Obesity, smoking, diabetes, high blood pressure, and
hyperlipidemia are well known risk factors of myocardial
infarction. However, family history is an independent risk factor
of myocardial infarction in various populations (Andresdottir M B,
et al., (2002) Fifteen percent of myocardial infarctions and
coronary revascularizations explained by family history unrelated
to conventional risk factors, The Reykjavik Cohort Study. Eur Heart
J 23: 1637-1638; Piegas L S, et al., AFIRMAR Study Investigators,
(2003) Risk factors for myocardial infarction in Brazil, Am Heart J
146: 331-338; and Yarnell J, et al., (2003) Family history,
longevity, and risk of coronary heart disease: the PRIME Study, Int
J Epidemiol 32: 71-77). Many candidate gene approaches have been
used for identifying the susceptibility gene for myocardial
infarction (Topol E J, et al., (2001) Single nucleotide
polymorphisms in multiple novel thrombospondin genes may be
associated with familial premature myocardial infarction,
Circulation 104: 2641-2644; Fumeron F, et al., (2002) Serotonin
transporter gene polymorphism and myocardial infarction: Etude
Cas-Temoins de l'Infarctus du Myocarde (ECTIM), Circulation 105:
2943-2945; and Yamada Y, et al., (2002) Prediction of the risk of
myocardial infarction from polymorphisms in candidate genes, N Engl
J Med 347: 1916-1923). However, there exist almost no reports
concerning systemic surveys for identification of genes associated
with myocardial infarction.
[0006] The present inventors have constructed a large SNP database
including SNPs based on over 170,000 or more genes (Haga H, et al.,
(2002) Gene-based SNP discovery as part of the Japanese Millennium
Genome Project: identification of 190,562 genetic variations in the
human genome, Single-nucleotide polymorphism, J Hum Genet 47:
605-610). The present inventors have also developed a
high-throughput genotyping system by which 450,000 genes were
genotyped per day (Ohnishi Y, et al., (2001) A high-throughput SNP
typing system for genome-wide association studies, J Hum Genet 46:
471-477).
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1 shows the results for LBP-32. FIG. 1(a) shows
pairwise linkage disequilibrium between SNPs, as measured by D' in
the genomic region that includes TAF1B and LBP-32. 11 common SNPs
were genotyped. Allelic frequencies of these SNPs were 30% or more.
LBP-32 was localized in one linkage disequilibrium block. Dark
black areas represent intense linkage disequilibrium, while white
areas represent D'<0.5. FIG. 1(b) shows the binding of unknown
nuclear factor(s) to an LBP-32 intron 1. An arrow indicates the
band that shows the binding of nuclear factor(s) to the allele A,
not to the allele G. FIG. 1(c) shows the effect of SNP in an LBP-32
intron on relative luciferase activity. Relative luciferase
activity due to allele A was significantly lower than that in the
case of allele G. *P=0.0001 for the comparison between allele G and
allele A using a Student t-test.
[0008] FIG. 2 shows the results for TSBP. FIG. 2(a) shows pair wise
linkage disequilibrium between SNPs, as measured by D' in the
genomic region that include BTNL2, TSBP, and NOTCH4. 22 common SNPs
were genotyped. Allelic frequencies of these SNPs were 30% or more.
The TSBP gene was localized in one linkage disequilibrium block.
Dark black areas represent intense linkage disequilibrium, while
white areas represent D'<0.5. FIG. 2(b) shows haplotype blocks
and P-value distribution. The haplotype blocks contained 11 common
SNPs including exon 25 306A>G. The most significant association
was observed at the last exon of TSBP (exon 25 306A>G)
(indicated with an arrow). FIG. 2(b) discloses SEQ ID NOS 19-21,
respectively, in order of appearance.
[0009] FIG. 3 shows the results for a WAP gene region. FIG. 3(a)
shows pairwise linkage disequilibrium between SNPs, as measured by
D' in the genomic region that includes WAP7-13 and TNNC2. 15 common
SNPs were genotyped. Allelic frequencies of these SNPs were 30% or
more. WAP8-13 genes were present in one linkage disequilibrium
block. Dark black areas represent intense linkage disequilibrium,
while white areas represent D'<0.5. FIG. 3(b) shows haplotype
blocks and P-value distribution. The haplotype blocks contained 18
common SNPs including WAP12 3' flanking+1264G>A. The most
significant association was observed for a plurality of SNPs
including WAP12 3' flanking+1264G>A. FIG. 3(b) discloses SEQ ID
NOS 22-25, respectively, in order of appearance.
[0010] FIG. 4 shows the results of expression and localization
analyses. FIG. 4(a): LBP-32 was allowed to be expressed in a human
heart tissue, HCASMC, and HCAEC. TSBP was allowed to be expressed
in a human heart tissue and HCAEC. FIG. 4(b): TSBP was localized in
the cytoplasm of HCASMC. LBP-32 was localized in the nucleus of
HCASMC.
DISCLOSURE OF THE INVENTION
Object to be Achieved by the Invention
[0011] An object to be achieved by the present invention is to
identify a novel single nucleotide polymorphism (SNP) associated
with the onset and the advancement of inflammatory diseases such as
myocardial infarction. Another object to be achieved by the present
invention is to provide a method for diagnosing inflammatory
diseases such as myocardial infarction or a method for developing a
therapeutic agent for inflammatory diseases, through the use of the
identified SNPs.
Means for Achieving the Object
[0012] As a result of intensive studies to achieve the objects, the
present inventors have discovered that single nucleotide
polymorphisms (SNPs) existing in a LBP-32 gene, a TSBP gene, and a
WAP gene are associated with the onset and the advancement of
myocardial infarction. Thus the present inventors have completed
the present invention.
[0013] Specifically, the present invention provides a method for
judging an inflammatory disease which comprises detecting at least
1 type of genetic polymorphism existing in at least one gene
selected from the group consisting of the LBP-32 gene, the TSBP
gene, and the WAP gene.
[0014] Preferably, the present invention provides a method for
judging an inflammatory disease which comprises detecting at least
1 type of single nucleotide polymorphism existing in at least one
gene selected from the group consisting of the LBP-32 gene, the
TSBP gene, and the WAP gene.
[0015] Preferably, the present invention provides a method for
judging an inflammatory disease which comprises detecting at least
one type of single nucleotide polymorphism selected from the group
consisting of the following (1) to (3): [0016] (1) a G/A
polymorphism at nucleotide 151 in the nucleotide sequence of intron
1 of an LBP-32 gene; [0017] (2) an A/G polymorphism at nucleotide
306 in the nucleotide sequence of exon 25 of a TSBP gene; and
[0018] (3) a G/A polymorphism at nucleotide 1264 in the nucleotide
sequence of the 3' flanking region of a WAP12 gene.
[0019] Preferably, the inflammatory disease is myocardial
infarction.
[0020] Another aspect of the present invention provides an
oligonucleotide which can hybridize to a sequence of at least 10
sequential nucleotides containing at least one site selected from
the group consisting of the following (1) to (3) or to a
complementary sequence thereof, and is used as a probe in the above
method of the present invention: [0021] (1) nucleotide 151 in the
nucleotide sequence of intron 1 of an LBP-32 gene; [0022] (2)
nucleotide 306 in the nucleotide sequence of exon 25 of a TSBP
gene; and [0023] (3) nucleotide 1264 in the nucleotide sequence of
the 3' flanking region of a WAP12 gene.
[0024] Still another aspect of the present invention provides an
oligonucleotide which can amplify a sequence of at least 10
sequential nucleotides containing at least one site selected from
the group consisting of the following (1) to (3) and/or a
complementary sequence thereof and is used as a primer in the above
method of the present invention: [0025] (1) nucleotide 151 in the
nucleotide sequence of intron 1 of an LBP-32 gene; [0026] (2)
nucleotide 306 in the nucleotide sequence of exon 25 of a TSBP
gene; and [0027] (3) nucleotide 1264 in the nucleotide sequence of
the 3' flanking region of a WAP12 gene.
[0028] Preferably, the primer is a forward primer and/or a reverse
primer.
[0029] Still another aspect of the present invention provides a kit
for diagnosing an inflammatory disease which comprises at least one
of the above oligonucleotides of the present invention. Preferably,
the inflammatory disease is myocardial infarction.
[0030] Still another aspect of the present invention provides a
method for analyzing the expression status of LBP-32, TSBP, or WAP
which comprises detecting at least one type of single nucleotide
polymorphism selected from the group consisting of the following
(1) to (3): [0031] (1) a G/A polymorphism at nucleotide 151 in the
nucleotide sequence of intron 1 of an LBP-32 gene; [0032] (2) an
A/G polymorphism at nucleotide 306 in the nucleotide sequence of
exon 25 of a TSBP gene; and [0033] (3) a G/A polymorphism at
nucleotide 1264 in the nucleotide sequence of the 3' flanking
region of a WAP12 gene.
[0034] Still another aspect of the present invention provides a
method for screening for a therapeutic agent for an inflammatory
disease which comprises the steps of analyzing intracellular
expression level of an LBP-32 gene, a TSBP gene, or a WAP gene in
the presence of a candidate substance and selecting a substance
that alters the expression level.
PREFERRED EMBODIMENTS FOR CARRYING OUT THE INVENTION
[0035] In the present invention, single nucleotide polymorphisms
(SNPs) within an LBP-32 gene, a TSBP gene, and a WAP gene were
identified, genotyping was performed for a myocardial infarction
patient group and a control group, and then association analysis
was conducted. As a result, it was discovered that the novel SNP
genotypes differed statistically significantly between the
myocardial infarction patient group and the control group.
[0036] As described above, it was determined in the present
invention that SNP within the LBP-32 gene, the TSBP gene, or the
WAP gene was associated with diseases such as myocardial
infarction. Accordingly, the use of such SNPs within the LBP-32
gene, the TSBP gene, or the WAP gene which were identified in the
present invention makes it possible to develop a novel method for
diagnosing, a novel method for preventing, or a novel therapeutic
agent for inflammatory diseases such as myocardial infarction.
Hereinafter, the embodiments of the present invention will be
further specifically described.
[1] Method for Judging Inflammatory Diseases
[0037] The method of the present invention is a method for judging
the occurrence or the non-occurrence of the onset of an
inflammatory disease or the possible onset of an inflammatory
disease by the detection of a genetic polymorphism, particularly a
single nucleotide polymorphism (SNP) existing in the LBP-32 gene,
the TSBP gene, or the WAP gene which is associated with the
inflammatory disease.
[0038] In the present invention, "detecting at least one type of
genetic polymorphism (e.g., single nucleotide polymorphism)
existing in at least one gene selected from the group consisting of
an LBP-32 gene, a TSBP gene, and a WAP gene" refers to both (i)
direct detection of such genetic polymorphism (referred to as a
polymorphism on the gene side) and (ii) detection of such genetic
polymorphism (referred to as a polymorphism on the complementary
side) existing on the side of a sequence complementary to the above
gene, followed by presumption of the polymorphism on the gene side
based on the detection result. However, since nucleotides on the
gene side are not always completely in complementary relationships
with nucleotides on the complementary sequence side, direct
detection of a polymorphism on the gene side is preferable.
[0039] Preferable specific examples of genetic polymorphisms
existing in the LBP-32 gene, the TSBP gene, and the WAP gene
include: [0040] (1) a G/A polymorphism at nucleotide 151 in the
nucleotide sequence of intron 1 (the nucleotide sequence shown in
SEQ ID NO: 1) of the LBP-32 gene; [0041] (2) an A/G polymorphism at
nucleotide 306 in the nucleotide sequence of exon 25 (the
nucleotide sequence shown in SEQ ID NO: 2) of the TSBP gene; and
[0042] (3) a G/A polymorphism at nucleotide 1264 in the nucleotide
sequence of the 3' flanking region (the nucleotide sequence shown
in SEQ ID NO: 3) of the WAP12 gene.
[0043] For example, as shown in Table 2 below, when nucleotide 151
in the nucleotide sequence of intron 1 of the LBP-32 gene is A, it
can be judged that an inflammatory disease is being developed or
will be likely to be developed. Similarly, when nucleotide 306 in
the nucleotide sequence of exon 25 of the TSBP gene is G, it can be
judged that an inflammatory disease is being developed or will be
likely to be developed. Furthermore, when nucleotide 1264 in the
nucleotide sequence of the 3' flanking region of the WAP12 gene is
A, it can be judged that an inflammatory disease is being developed
or will be likely to be developed.
[0044] In contrast, when nucleotide 151 in the nucleotide sequence
of intron 1 of the LBP-32 gene is G, when nucleotide 306 in the
nucleotide sequence of exon 25 of the TSBP gene is A, and when
nucleotide 1264 in the nucleotide sequence of the 3' flanking
region of the WAP12 gene is G, it can be judged that an
inflammatory disease will be unlikely to be developed.
[0045] In the description, "judgment" of a disease means to judge
the occurrence or the non-occurrence of the onset of a disease, to
judge the possibility of the onset of a disease (prediction of
affection risk), to elucidate genetic factors of a disease, and the
like.
[0046] Furthermore, "judgment" of a disease can also be performed
based on the results obtained by the above method for detecting
single nucleotide polymorphisms and the results obtained by other
forms of polymorphism analysis (VNTR or RFLP) and/or other test
results, if desired.
[0047] Moreover, in the description, "inflammatory disease" is not
particularly limited, as long as it is a disease which shows
induction of cell adhesion factors or cytokines which are known to
be associated with pathological inflammatory conditions. Examples
of such inflammatory disease include chronic rheumatoid arthritis,
systemic lupus erythematosus, inflammatory enteritis, various
allergic reactions, bacterial shock, and arteriosclerotic diseases
such as myocardial infarction or apoplectic stroke. In particular,
such inflammatory disease is myocardial infarction.
(Detection Subjects)
[0048] A subject of genetic polymorphism detection is preferably
genomic DNA. Depending on circumstances (specifically, when the
sequence of a polymorphism site or the sequence of its neighboring
region is identical to or completely complementary to the genome),
cDNA or mRNA can also be used. Furthermore, examples of samples
from which the above subjects are collected include: any biological
samples such as body fluids (e.g., blood, bone marrow aspirate,
seminal fluid, abdominal fluid, and urine); cells of tissues such
as those in the liver; and hair such as body hair. Genomic DNA and
the like can be extracted, purified and then prepared from these
samples according to conventional methods.
(Amplification)
[0049] Upon genetic polymorphism detection, first a portion
containing a genetic polymorphism is amplified. Amplification is
performed by the PCR method, for example. Amplification may also be
performed by another known amplification method such as an NASBA
method, an LCR method, an SDA method, or a LAMP method.
[0050] Primers are selected so that a sequence of at least 10
sequential nucleotides, preferably 10 to 100 sequential
nucleotides, and more preferably 10 to 50 sequential nucleotides
containing the aforementioned single nucleotide polymorphism sites
of the present invention and/or the complementary sequences thereof
is amplified.
[0051] A primer may also contain 1 or more instances of
substitution, deletion, and/or addition in its sequence, as long as
it is capable of functioning as a primer for amplifying a sequence
of a predetermined number of nucleotides containing the above
single nucleotide polymorphism site.
[0052] Primers to be used for amplification may also be selected so
that either a forward primer or a reverse primer hybridizes to a
single nucleotide polymorphism site. In this case, amplification
takes place only when a sample is of a single allele genotype.
Primers can be labeled with a fluorescent substance, a radioactive
substance, or the like, if necessary.
(Detection of Genetic Polymorphisms)
[0053] Genetic polymorphisms can be detected by hybridization with
a probe specific to a single allele genotype. A probe may be
labeled with a fluorescent substance, a radioactive substance, or
the like, if necessary, by adequate means. A probe to be used
herein is not particularly limited, as long as it contains the
above single nucleotide polymorphism site, can hybridize to a test
sample, and imparts specificity at a detectable level under
detection conditions to be employed. As such probe, an
oligonucleotide capable of hybridizing to a sequence of at least 10
sequential nucleotides, preferably 10 to 100 sequential
nucleotides, and more preferably 10 to 50 sequential nucleotides
containing the above single nucleotide polymorphism site or a
sequence complementary thereto can be used, for example. For
example, an invader method or a TaqMan-PCR method can be employed.
Moreover, it is preferable to select an oligonucleotide, so that a
single nucleotide polymorphism site is present at almost the center
of the probe. Such oligonucleotide may contain one or more
instances of substitution, deletion, and/or addition, as long as it
is capable of functioning as a probe, and specifically, as long as
it hybridizes under conditions such that it hybridizes to a
sequence of a target allele genotype but does not hybridize to
sequences of other allele genotypes. Furthermore, another example
of a probe to be used herein is a probe that satisfies the above
probe conditions, such as a single-strand probe (padlock probe) to
be used in amplification performed by an RCA (rolling circle
amplification) method. Specifically, such probe anneals to genomic
DNA to form a cyclic form, and thus it satisfies the above probe
conditions.
[0054] Hybridization conditions to be employed in the present
invention are conditions sufficient for distinguishing allele
genotypes. For example, such conditions are conditions such as
stringent conditions, in which hybridization takes place when a
sample is of one allele genotype but hybridization does not take
place when a sample is of another allele genotype. Here, "stringent
conditions" are conditions described in Molecular Cloning A
Laboratory Manual, 2.sup.nd ed., (Sambrook et al., 1989), for
example. Specifically, such conditions involve overnight incubation
at 65.degree. C. with a probe in a solution containing 6.times.SSC
(1.times.SSC composition: 0.15 M NaCl, 0.015 M sodium citrate, and
pH 7.0), 0.5% SDS, 5.times. Denhardt, and 100 mg/ml herring sperm
DNA, for example.
[0055] One end of a probe may be immobilized on a substrate and
then the substrate can also be used as a DNA chip. On such a DNA
chip in this case, only probes that correspond to a single allele
genotype may be immobilized, or probes that correspond to both
allele genotypes may be immobilized.
[0056] Genetic polymorphisms can also be detected by a restriction
fragment length polymorphism (RFLP) analysis method. With this
method, a sample nucleic acid is digested with a restriction enzyme
(whether or not cleavage with the restriction enzyme takes place
depends on the genotype of a single nucleotide polymorphism site)
and then the size of a digested product (fragment) is examined.
Thus whether or not the sample nucleic acid is cleaved with the
restriction enzyme is determined, so that the polymorphism of the
sample is analyzed.
[0057] Genetic polymorphisms can also be detected by direct
sequencing of amplified products (direct sequencing method).
Sequencing can be performed by a known method such as a dideoxy
method or a Maxam-Gilbert method.
[0058] For genetic polymorphism detection, denaturing gradient gel
electrophoresis (DGGE), single strand conformation polymorphism
(SSCP) analysis, allele-specific PCR, a hybridization method that
involves an allele-specific oligonucleotide (ASO), chemical
cleavage of mismatches (CCM), an HET (heteroduplex method) method,
a PEX (primer extension) method, an RCA (rolling circle
amplification) method, or the like can also be employed.
[2] Kit for Diagnosing Inflammatory Diseases
[0059] A kit for diagnosing inflammatory diseases including the
above oligonucleotide to be used as a primer or a probe can be
provided. The kit may also include restriction enzymes, polymerase,
nucleoside triphosphate, labels, buffers, and the like, which are
used for the above method for analyzing genetic polymorphisms.
[3] Method for Analyzing the Expression Status of LBP-32, TSBP, and
WAP
[0060] According to the present invention, the expression status of
LBP-32, TSBP, or WAP can also be analyzed by detection of the above
single nucleotide polymorphisms.
[0061] For example, when nucleotide 151 is A in the case of a G/A
polymorphism at nucleotide 151 in the nucleotide sequence of intron
1 of the LBP-32 gene, the expression level of LBP-32 can be judged
to be low; and when the nucleotide 151 is G, the expression level
of LBP-32 can be judged to be high.
[4] Method for Screening for a Therapeutic Agent for Inflammatory
Diseases
[0062] According to the present invention, a therapeutic agent for
inflammatory diseases can be screened by analyzing the
intracellular expression level of the LBP-32 gene, the TSBP gene,
or the WAP gene in the presence of candidate substances and then
selecting a substance that alters the expression level. For
example, the intracellular expression level of the LBP-32 gene, the
TSBP gene, or the WAP gene is analyzed in the presence of candidate
substances and then a substance that increases or decreases such
expression level can be selected. Particularly preferably, a
substance that increases the expression level can be selected.
[0063] An example of the above screening that can be conducted
herein involves the steps of: causing cells to come into contact
with candidate substances; analyzing the intracellular expression
level of the LBP-32 gene, the TSBP gene, or the WAP gene; and
selecting a candidate substance that alters the expression level of
the relevant gene through comparison with expression level under
conditions in which the candidate substance is absent, as a
therapeutic agent for inflammatory diseases.
[0064] As such candidate substance, any substance can be used, and
candidate substance types are not particularly limited. The
candidate substance may be an individual low-molecular-weight
synthetic compound or a compound existing in an extract from a
natural product. Alternatively, the candidate substance may be a
member of a compound library, a phage display library, or a
combinatorial library. The candidate substance is preferably a
low-molecular-weight compound and is preferably a member of a
low-molecular-weight compound library. Construction of a compound
library is known by persons skilled in the art. Moreover, a
commercial compound library can also be used.
[5] Method for Determining the Transcriptional Activity of the
LBP-32 Gene, the TSBP Gene, or the WAP Gene
[0065] According to the present invention, the transcriptional
activity of the LBP-32 gene, the TSBP gene, or the WAP gene can be
determined by introducing a fragment of the LBP-32 gene, the TSBP
gene, or the WAP gene containing the above single nucleotide
polymorphism into cells, culturing the cells, and then analyzing
the expression of the gene.
[0066] According to a preferred embodiment of the present
invention, the expression of the gene is analyzed by introducing a
transcription unit wherein a reporter gene has been bound
downstream of a fragment of the LBP-32 gene, the TSBP gene, or the
WAP gene into cells, culturing the cells, and then determining the
reporter activity.
[0067] For example, when a single nucleotide polymorphism is
present in the promoter site, cells in which a system having a
reporter gene inserted downstream of a gene containing the single
nucleotide polymorphism has been introduced are cultured, and then
the reporter activity is determined. Hence, a difference in
transcription efficiency due to the single nucleotide polymorphism
can be measured.
[0068] Reporter genes to be used herein are genes of luciferase,
chloramphenicol, acetyltransferase, galactosidase, and the
like.
[6] Method for Screening for a Substance Inhibiting or Promoting
the Transcriptional Activity of the LBP-32 Gene, the TSBP Gene, or
the WAP Gene
[0069] According to the present invention, a substance inhibiting
or promoting the transcriptional activity of the LBP-32 gene, the
TSBP gene, or the WAP gene can be screened by introducing a
fragment of the LBP-32 gene, the TSBP gene, or the WAP gene
containing the above single nucleotide polymorphism into cells,
culturing the cells in the presence of candidate substances
inhibiting or promoting the transcriptional activity of the LBP-32
gene, the TSBP gene, or the WAP gene, and then analyzing the
expression of the gene.
[0070] According to a preferred embodiment of the present
invention, the expression of the gene is analyzed by introducing a
transcription unit wherein a reporter gene has been bound
downstream of a fragment of the LBP-32 gene, the TSBP gene, or the
WAP gene into cells, culturing the cells, and then determining the
reporter activity.
[0071] For example, a system having a reporter gene inserted
downstream of a gene having a single nucleotide polymorphism and
exerting a significantly high expression level of the LBP-32 gene,
the TSBP gene, or the WAP gene is introduced into cells. The cells
are cultured in both the presence and the absence of a candidate
substance. If lower reporter activity is determined when culture is
carried out in the presence of the candidate substance, the
candidate substance can be selected as a substance that inhibits
the transcriptional activity of the LBP-32 gene, the TSBP gene, or
the WAP gene.
[0072] As reporter genes to be used herein, the genes listed above
are used.
[0073] As such candidate substance, any substance can be used, and
candidate substance types are not particularly limited. The
candidate substance may be an individual low-molecular-weight
synthetic compound or a compound existing in an extract from a
natural product. Alternatively, the candidate substance may be a
member of a compound library, a phage display library, or a
combinatorial library. The candidate substance is preferably a
low-molecular-weight compound and is preferably a member of a
low-molecular-weight compound library. Construction of a compound
library is known by persons skilled in the art. Moreover, a
commercial compound library can also be used.
[0074] Substances that inhibit or promote the transcriptional
activity of the LBP-32 gene, the TSBP gene, or the WAP gene, which
are obtained by the above screening method, are also encompassed
within the scope of the present invention. Such substances
inhibiting or promoting the transcriptional activity of the LBP-32
gene, the TSBP gene, or the WAP gene are useful as candidate
substances to be used as various drugs such as therapeutic agents
for myocardial infarction, anti-inflammatory agents, and
immunosuppressant agents.
[7] Method for Screening for a Transcriptional Control Factor of
the LBP-32 Gene, the TSBP Gene, or the WAP Gene
[0075] According to the present invention, a transcriptional
control factor of the LBP-32 gene, the TSBP gene, or the WAP gene
can also be screened by causing a gene fragment containing the
above single nucleotide polymorphism to come into contact with a
sample assumed to contain a transcriptional control factor of the
LBP-32 gene, the TSBP gene, or the WAP gene and then detecting the
binding of the fragment with the transcriptional control factor.
Binding of such gene fragment containing the above single
nucleotide polymorphism with a substance assumed to contain a
transcriptional control factor of the LBP-32 gene, the TSBP gene,
or the WAP gene can be detected by a gel shift method
(electrophoretic mobility shift assay (EMSA)), a DNase I footprint
method, or the like. In particular, the gel shift method is
preferred. The gel shift method involves mixing a .sup.32P-labeled
gene fragment with a transcriptional control factor and then
subjecting the mixture to gel electrophoresis. This is because when
a protein (transcriptional control factor) binds, the molecular
size will increase and DNA mobility in electrophoresis will
decrease in the case of the gel shift method. It can be noted that
DNA with such factor bound thereto moves slowly, when the position
of the DNA is observed by autoradiography. Thus, such DNA is
detected as a band that shifts behind the general band.
[0076] The present invention will be further specifically described
in detail by referring to the following examples. However, the
present invention is not limited by these examples.
EXAMPLE
(A) Materials and Methods
(1) Subjects
[0077] Japanese myocardial infarction patients were used. The
diagnostic of definite myocardial infarction requires two of the
following three criteria: (i) a clinical history of central chest
pressure, pain, or tightness lasting for 30 minutes or more, (ii)
ST-segment elevation of 0.1 mV or more based on at least one
standard or in two precordial leads, and (iii) a rise in serum
creatine kinase concentration twice or more the normal laboratory
value. A control group consisted of healthy Japanese subjects. All
subjects (patients) agreed to participate in this experiment.
(2) SNP Genotyping
[0078] For a large-scale association analysis, the present
inventors used their own SNP database (Haga H, et al., (2002)
Gene-based SNP discovery as part of the Japanese Millennium Genome
Project: Identification of 190,562 genetic variations in the human
genome. Single-nucleotide polymorphism. J Hum Genet 47: 605-610)
and carried out screening for SNPs as in the previous report
(Ohnishi Y, et al., (2001) A high-throughput SNP typing system for
genome-wide association studies. J Hum Genet 46: 471-477). To
construct an SNP map in a critical region, a reference sequence was
generated by assembling AC010969.11 for LBP-32. Z84814.1,
AL034394.2, AL035445.4, AF044083.1, and U89335.1 were used for
TSBP. AL031663.2, AL121778.12, AL031671.12, AL109656.10, and
AL050348.21 were used for a WAP region. Next, SNPs were deposited
in the reference sequence. To evaluate intense linkage
disequilibrium, the SNP sites of 190 myocardial infarction patients
and 190 control subjects were genotyped.
(3) Identification of SNP
[0079] To identify all gene-based variations in the critical
region, all genes known to be located in the critical region were
screened. Protocols for PCR primer design, PCR experiments, DNA
extraction, DNA sequencing, and SNP identification were as in the
previous report (Iida et al. 2001). SNPs in the critical region
were genotyped as in the previous report by direct sequencing of
PCR products with the use of invader assay or a capillary sequencer
(ABI3700, Applied Biosystems, CA) (Iida A, et al., (2001) Catalog
of 258 single-nucleotide polymorphisms (SNPs) in genes encoding
three organic anion transporters, three organic anion-transporting
polypeptides, and three NADH: Ubiquinone oxidoreductase
flavoproteins. J Hum Genet 46: 668-683; and Ohnishi Y, et al.,
(2001) A high-throughput SNP typing system for genome-wide
association studies. J Hum Genet 46: 471-477).
(4) Haplotype Structure Analysis
[0080] Haplotype phasing was estimated based on an EM-algorithm
(Excoffier L, et al., (1995) Maximum-likelihood estimation of
molecular haplotype frequencies in a diploid population, Mol Biol
Evol 12: 921-927). A haplotype block was constructed as in the
previous report excluding the following improvement (Daly M J, et
al., (2001) High-resolution haplotype structure in the human
genome, Nat Genet 29: 229-232). First, to make the next analysis
simple, neighboring SNPs absolutely linking to a single
representative SNP were clustered. Next, a constraint such that a
common haplotype set represented by maxN+1,2.sup.0.5N (wherein N
denotes the number of SNPs in the block) accounts for 90% or more
of a population was imposed. To eliminate vagueness, samples for
which no SNP sites could be genotyped as a result of the
calculation of haplotype frequencies were excluded.
(5) Statistical Analysis
[0081] Statistical analyses for association study, Hardy-Weinberg
equilibrium, and calculation of linkage disequilibrium coefficients
(D') were carried out as in the previous reports (Yamada R, et al.,
(2001) Association between a single-nucleotide polymorphism in the
promoter of the human interleukin-3 gene and rheumatoid arthritis
in Japanese patients, and maximum-likelihood estimation of
combinatorial effect that two genetic loci have on susceptibility
to the disease. Am J Hum Genet 68: 674-685).
(6) Luciferase Activity
[0082] A DNA fragment corresponding to intron 1 (+5 to +350) of
LBP-32 was amplified by PCR using Hind III and Nco I sequences and
using genomic DNA as a template. The resultant was cloned into Hind
III and Nco I sites of a pGL3-promoter vector in the 5'-3'
direction. HeLa cells were grown in DMEM medium supplemented with
10% fetal bovine serum. Subsequently, cells (3.times.10.sup.5) were
transfected with 0.5 .mu.g of a wild-type construct or a mutant
construct and 0.5 .mu.g of a pRL-TK vector (an internal control for
transfection efficiency) using an FuGene transfection reagent
(Roche, IN). 24 hours later, cells were harvested and then
luciferase activity was determined using a Dual-Luciferase Reporter
Assay System (Promega, WI).
(7) Gel-Shift Assay
[0083] A nuclear extract was prepared from HeLa cells as described
in the previous report (Andrews and Faller 1991) and then incubated
with .sup.32P-labeled oligonucleotides (28 bp each)
5'-TCCACGCCGCCACGGCCTTTGCCCCTTA-3' (allele G) (SEQ ID NO: 4) and
5'-TCCACGCCGCCACGACCTTTGCCCCTTA-3' (allele A) (SEQ ID NO: 5). For
competition studies, an extracted nucleus was preincubated with
unlabeled oligonucleotides (100-fold excess) before the addition of
.sup.32P-labeled oligonucleotides. The protein-DNA complexes were
separated on non-denaturing 8% polyacrylamide gel in 0.5.times.
Tris-Borate-EDTA buffers. Signals were detected by
autoradiography.
(8) Expression Analysis using RT-PCR
[0084] Total RNA was isolated from HCASMC (BioWhittaker) and HCAEC
(BioWhittaker) using a TRIZOL reagent (GibcoBRL). Single-strand
cDNA was prepared using an oligo dT primer and Superscript II
reverse transcriptase (Invitrogen) from the total RNAs of HCASMC
and HCAEC and polyA RNA (Clontech) of a human heart tissue. PCR
amplification was performed using the cDNAs as templates,
5'-ACTTTGGCTGTCATCCTGAC-3' (SEQ ID NO: 6) and
5'-CTTGATAGGTCCTGTAGCTC-3' (SEQ ID NO: 7) (for TSBP),
5'-AGCGCGATGACACAGGAGTA-3' (SEQ ID NO: 8) and
5'-CGTTGCTATGGAGACAGTGA-3' (SEQ ID NO: 9) (for LBP-32), or
5'-TGGTATCGTGGAAGGACTCAT-3' (SEQ ID NO: 10) and
5'-GTGGGTGTCGCTGTTGAAGTC-3' (SEQ ID NO: 11) (for GAPDH as internal
reference) as primers.
(9) Construction of Expression Vector
[0085] Human full-length TSBP and LBP-32 cDNAs were prepared by
RT-PCR using the following PCR primer sets:
TABLE-US-00001 (SEQ ID NO: 12)
5'-ATAGCGGCCGCAATGACAGTCTTGGAAATAAC-3' and (SEQ ID NO: 13) 5'-
AGACTCGAGTTACTCTTCCACTTTTTTGTTGTAC-3'; and (SEQ ID NO: 14) 5'-
GAGGCGGCCGCGATGACACAGGAGTACGACAAC-3' and (SEQ ID NO: 15) 5'-
AGAGTCGACGATCTCCGTCAGGGTGAGC-3'.
[0086] pTSBP-myc was constructed by inserting the TSBP cDNA
digested with Not I-Xho I into pCMV-myc (Clontech, Palo Alto,
Calif.). pLBP32-Flag was constructed by inserting a LBP-32 cDNA
digested with Not I-Sal I into pFLAG-CMV5a (Sigma).
(10) Immunofluorescence Analysis
[0087] HCASMC cells (5.times.10.sup.5) were transfected with 5
.mu.g of pTSBP-myc or pLBP32-Flag by Human AoSMC Nucleofector Kit
(amaxa biosystems) and then seeded on collagen-coated glass slide.
After 24 hours of culture, cells were fixed and then treated with
antibodies. Nuclei were stained with DAPI (Sigma).
(B) Results
(1) SNP Association Studies
[0088] First, the genotype frequency in 94 myocardial infarction
patients was compared with the genotype frequency in 658 healthy
subjects regarding 65,671 SNPs. Subsequently, genotyping was
further performed for SNPs with P values of less than 0.01 in a
larger replication panel. As the results of further genotyping,
four SNP sites including the LTA site were found to show
significant association (p<0.0001) with myocardial infarction,
as shown in Table 1. The other three sites were located in the
LBP-32 gene on chromosome 2p25.1, the TSBP gene on chromosome 6p21,
and the WAP12 gene on chromosome 20q13, respectively.
TABLE-US-00002 TABLE 1 Dominant Recessive P value model model
>=0.01 1,299 1,307 <0.01 27 18 <0.001 6 5 <0.0001 1 3
total 1,333 1,333
TABLE-US-00003 TABLE 2 Myocardial Chi square Odds ratio Genotype
infarction Control (p value) (95% c.i.) TSBP exon25 306A > G AA
1077 1057 AA vs. GG + AG 1.32 (58.4%) (65.0%) 16.1 (1.15-1.52) AG
661 496 (0.000062) (35.8%) (30.5%) GG 107 73 (5.8%) (4.5%) LBP-32
intron1 + 151G > A GG 1475 1247 AA vs. GG + GA 3.71 (79.3%)
(77.3%) 15.7 (1.85-7.41) GA 342 357 (0.000072) (18.4%) (22.1%) AA
42 10 (2.3%) (0.6%) WAP12 3'flanking + 1264G > A GG 775 767 AA
vs. GG + GA 1.60 (41.6%) (47.1%) 18.2 (1.29-1.99) GA 837 717
(0.000019) (45.0%) (44.0%) AA 250 144 (13.4%) (8.8%)
TABLE-US-00004 TABLE 3 (SEQ ID NOS 16-18, respectively, in order of
appearance) Name Sequence TSBP exon25 306A > G
5'-TAAAAATCAGTGAGATGAGT [A/G] TACCACAAGGACAGGGAGCC-3' LBP-32
Intron1 + 151G > A 5'-GTCCACTCCACGCCGCCACG [G/A]
CCTTTGCCCCTTAGCCCTGC-3' WAP12 3'flanking 5'-AGACATCATCAGCAGTAGGT +
1264G > A [G/A] GGCTATAAGGGCATGGTCTC -3'
(2) Linkage Disequilibrium Analysis
[0089] To estimate the extension of intense linkage disequilibrium
(LD) in these critical regions, the above SNPs in 95 myocardial
infarction patients and 95 control subjects were genotyped.
LBP-32 Gene Region:
[0090] Eleven SNPs spanning 157 kb on chromosome 2p25.1 including
TAF1B and LBP-32 were genotyped. An extended block of intense
linkage disequilibrium including LBP-32 is shown in FIG. 1a.
TSBP Region:
[0091] Twenty two SNPs spanning 250 kb on chromosome 6p21 including
BTNL2, TSBP, and NOTCH4 were genotyped. The allele frequency of
these SNPs was 30% or more. The D' value of each SNP pair was
plotted and labeled (FIG. 1a). Significant SNPs were located in one
block of intense linkage disequilibrium and D' was decreased
upstream and downstream of TSBP (FIG. 2a).
WAP Region:
[0092] 15 SNPs spanning 376 kb on chromosome 20q13 including
WAP7-13 and TNNC2 were genotyped. An extended block of intense
linkage disequilibrium including WAP8-13 is shown in FIG. 3a.
(3) High-Density SNP Mapping and Haplotype Block Analysis
[0093] To identify all gene-based variations in LBP-32,
approximately 52 kb including all the exons of LBP-32 was screened.
A total of 40 polymorphisms in this region were identified and then
genotyped for 190 myocardial infarction patients and 190 healthy
subjects. No significant association was observed as a result of
this genotyping except for LBP-32 intron 1+151G>A.
[0094] For TSBP, approximately 80 kb including all the exons were
screened. A total of 216 polymorphisms in this region were
identified. To estimate haplotype blocks, the above-found SNPs with
the allele frequency of 20% or more were genotyped for 95
myocardial infarction patients and 95 healthy subjects. As a result
of this genotyping, a haplotype block containing TSBP exon 25
306A>G for which significant association had been observed was
discovered (FIG. 2b).
[0095] For the WAP gene region, WAP7-13 and TNNC2 were screened. A
total of 54 polymorphisms were identified in this region and then
genotyped for 95 myocardial infarction patients and 95 healthy
subjects. As a result of this genotyping, a haplotype block
containing SNPs in the 3' flanking region of the WAP12 gene was
discovered. The haplotype block was composed of 18 SNPs spanning
over approximately 100 kb. These 18 SNPs were further genotyped for
other 475 myocardial infarction patients and other 475 healthy
subjects. As a result of this genotyping, the most significant
association was observed in a plurality of SNPs containing the 3'
flanking region+1264G>A of the WAP12 gene (FIG. 3b).
(4) Expression and Localization of the TSBP Gene and the LBP-32
Gene in Human Heart
[0096] Gene expression of TSBP and LBP-32 were analyzed by RT-PCR.
A TSBP transcript was detected in coronary artery endothelial cells
(HCAEC) and coronary artery smooth muscle cells (HCASMC) (FIG. 4a).
An LBP-32 transcript was also detected in human heart tissues and
HACEC (FIG. 4a).
[0097] To examine the cellular localization of TSBP and LBP-32,
HACSMC was transfected with Myc-tagged TSBP or Flag-tagged LBP-32.
As a result, TSBP was found to be localized in the cytoplasm and
LBP-32 was found to be localized in the nucleus (FIGS. 4b and
c).
(5) Binding of Nuclear Factors to SNP Sites
[0098] To examine whether any nuclear factors bind to the SNP
(intron 1+151G>A) in LBP-32, gel-shift assay was performed using
oligonucleotides containing SNP sites. A marked shift band was
observed only when oligonucleotides containing allele A had been
used (FIG. 1b).
(6) Transcriptional Regulatory Activity Affected by SNP
[0099] To determine whether the SNP (intron 1+151G>A) in LBP-32
would affect its expression level, two plasmids were constructed
using a genomic DNA fragment corresponding to each allele upstream
of a luciferase gene transcriptional unit. The relative luciferase
activity of a clone corresponding to allele A was about a half of
that of a clone corresponding to allele G (FIG. 1c).
(C) Discussion
[0100] Large-scale association studies were conducted for
myocardial infarction using 92,788 SNPs. 65,671 SNPs (70.7%) were
genotyped for 94 myocardial infarction patients. These SNPs covered
13,738 genes. This means that our screening accounted for
approximately 43% of all estimated genes. Over 96% of screened SNPs
(in the primary screening) for which a p value of less than 0.01
had been achieved failed to keep a significant association with
another set of samples. This result indicates that association
studies involving small numbers of samples are meaningless for
common diseases.
[0101] As a result of the large-scale association study of this
Example, significant association with increased risk for myocardial
infarction was confirmed at 4 SNPs. Of these 4 SNPs, one SNP is
located on LTA as in the previous report (Ozaki K, et al., (2002)
Functional SNPs in the lymphotoxin-alpha gene that are associated
with susceptibility to myocardial infarction, Nat Genet 32:
650-654). The other two SNPs were located on TSBP and LBP-32. The
last SNP was located on the WAP locus on chromosome 20q13.
[0102] LBP-32 was cloned as a protein which binds to a promoter
region of cytochrome P450scc (Huang N, et al., (2000) Cloning of
factors related to HIV-inducible LBP proteins that regulate
steroidogenic factor-1-independent human placental transcription of
the cholesterol side-chain cleavage enzyme, P450scc. J Biol Chem
275: 2852-2858). This is identical to human p70 MGR and is 94%
identical to mouse MGR (Wilanowski T, et al., (2002) A highly
conserved novel family of mammalian developmental transcription
factors related to Drosophila grainyhead, Mech Dev 114: 37-50).
Wilanowski et al. have reported that p70 MGR binds to the promoter
regions of Drosophila dopa decarboxylase, Drosophila PCNA, and
human En-1. As a result of an overexpression study using
Flag-tagged LBP-32, LBP-32 was found to be localized in the nucleus
in a manner similar to the case of mouse MGR. Substitution of
LBP-32 intron 1+151G>A results in a change in the binding motif
of a nuclear factor. Specifically, allele G has no motifs, whereas
allele A has a COUP/HNF-4 heterodimer binding motif. As a result of
luciferase assay, it was suggested that a minor allele of LBP-32
intron 1+151G>A may suppress the expression level of LBP-32, so
that the expression levels of downstream genes may be modulated.
P450scc is also referred to as estrogen synthetase. Because
estrogen plays an important role in coronary events, modulation of
the expression level of P450scc may relate to the onset of
myocardial infarction. The mechanism for affecting expression
levels may be binding of nuclear factor(s) to minor allele A (FIG.
1b).
[0103] TSBP has been identified for the first time from testis cDNA
(Liang Z G, et al., (1994) Human testis cDNAs identified by sera
from infertile patients: a molecular biological approach to
immunocontraceptive development, Reprod Fertil Dev 6: 297-305).
However, TSBP cDNA was detected in human heart tissues and HCAEC
(FIG. 3). In HCASMC, TSBP is localized in the cytoplasm. A
significant SNP in TSBP (exon 25 306A>G) is localized in a
coding region and results in amino acid substitution (I306V). TSBP
was mapped to 6p21 where LTA was also located. Two genes were
located at intervals of approximately 700 kb and were located in
different linkage disequilibrium blocks. Moreover, D' between the
critical SNP of TSBP and that of LTA was 0.4. This indicates that
significant association between TSBP and myocardial infarction is
independent of LTA.
[0104] A locus on chromosome 20q13 contains many genes encoding
proteins having homology with whey acidic protein (WAP). Potential
functions of WAPs can relate to host defense against microorganisms
(Clauss A, et al., (2002) A locus on human chromosome 20 contains
several genes expressing protease inhibitor domains with homology
to whey acidic protein, Biochem J 368: 233-242). The linkage
disequilibrium block containing SNPs at which significant
association had been observed extended to approximately 300 kb. A
target region was limited to 100 kb for haplotype block analysis.
Four WAP genes are present within the limited target region. Since
these genes contain overlapping regions, it is difficult to focus
on the gene associated with myocardial infarction.
[0105] As described in the above Example, two candidate genes and
one candidate locus susceptible for the onset of myocardial
infarction were identified by a large-scale association study.
INDUSTRIAL APPLICABILITY
[0106] According to the present invention, novel single nucleotide
polymorphisms (SNPs) associated with the onset and the advancement
of inflammatory diseases such as myocardial infarction have been
newly identified. The use of these SNPs identified according to the
present invention enables the provision of a method for diagnosing
inflammatory diseases such as myocardial infarction or a method for
developing a therapeutic agent for inflammatory diseases.
Sequence CWU 1
1
2513061DNAHomo sapiens 1gtgagtgagg cgcaggagtc cggccgccgc gggggggccg
cgctgagggg ccgcacctgc 60agcgagcgag ccgggcgcag acccgaggcc gcgcgggcgg
gcgggcgcgg ggcgcgagcc 120gggggccgct gtccactcca cgccgccacg
gcctttgccc cttagccctg ccgtgctctt 180tgttcggtcg gagcctcggg
aggagagacc ctgtcctcgg ggaaactcga caccggaggg 240gccaccctcc
tcccctcctc cgcggccagg ttgggtcccc tcgggcgcgc accttggggt
300ccgggccccc ggcgcggtcg ggtgcggcgc gaggtcgggg cgcagccaac
gcccccgggc 360ctccccgccc ccctctcctg cccggtcggc ctcgggagcc
tggtggggct cgcgccgcgt 420cgggacaggt ggacttctcc aggtaatctg
tggtctcagg ctcgtcactc ggcgacctgc 480tggaacctcc aaaacagaaa
tgtagggaaa ggttgaagtg ccccgatgtc cgggcgtttt 540cttttccctg
gctggcggca tgagtgggaa aacggctgta ggagttattt tgccacttgc
600atcattgatg gtaattacag attaccgtgt ttttagtgct cgagagaatc
aagaggatga 660aactttgaaa tccgggtgtt aaacgagaaa gtactgtaca
agctaatatg ctttttagag 720tgtgtgattt aaaagcgtat ttcgacaaat
gtgaggtggt agtgtaataa ggcatggggg 780attaactggg cgagggagtt
ttctgtattt tctttgcagc ttttctgaaa atataaaatt 840gtcctaaaaa
ttttaaaaac ttactaaaga aaaaacaggg aaatcgcacc aggccagtca
900gtatatttca gatcaggaag tttaaggcag ataggtaccc ctcccagttt
cttagttatt 960tgtgaaggat cggtttttgt cagtgtgttc tttttctgga
tgagatagat attttgtatg 1020gagtatctta aatggattac tcttatgttg
tagaatatgc agttaaatta ttgcctgaaa 1080catatttcag aagtctgaga
gatcgcagac gcggagttta aggctcacct gaaagtgatg 1140atgagccttc
ggcgactgaa gcctacttcc tgactgtcat gaggaagtgg actaagaaag
1200gcaactggtt ttgtgtttat ttcttgacgt atagtttaga taaggcaaat
tttccaaagc 1260taacattttg gccttaggca ggctttggaa atatgaaaca
ccttcagggt gattccaaac 1320ataaagccat ttctttctct gttttctatt
gcttgtacaa atttgggatg tgggtgggag 1380aagaagggaa gttgaaaact
agcattaagg gaattgaaca gccaagtgct gtcatagtct 1440tctggaagta
gctattacgc tattaattat agcttagcag tacatcagtc aatcagtcca
1500tggcaccagc cgttcagtag ctgttgtact ctggtcctga tggctcaggg
aatgccactt 1560tgtatatttc tttattttct ttaaagttga gatttgtgta
agcaatcttc tccattttta 1620gacaaatgat ctgctggctt tgaacagtct
tttatgtttg ttttgtgtta aaatagtata 1680ccacctcaag actttcttac
caaatgtaac gtttatgcca aaacgtgagt aaaaacattg 1740gctttcaaat
aacacttcat tttgactgag gatacattgt tggatttttt tccccttttt
1800tgaagatgtt ctcctttttc taaatctgta tctgttctta aaggccctgg
gtgactccca 1860aacgctaacc tttgttgatt acttgaaaag ataatcagtc
tttctacatt cacttttaaa 1920ataggcaggt cacctttagg ccatttacat
atttcatttg tgtgttgcaa tgagagccag 1980tccttcaatt tgcttgttag
aattgtaata attcagagga gttccaaaca tttaaaattt 2040atttttctcc
ttgaaaataa actgctttgt tttgctagag tcagtgttcc attttttctc
2100tttattgact tattaaatag taccaaccga acagttgttg agactgttta
catttcaagt 2160ttttggaatt agtaatgttt gctttaatct tttaaattaa
atcttctgta aggtttcact 2220aagatcgcca ttgatttttt tggatttttc
ccaccaaact acagtgttaa aatgaaacag 2280ttcttgtgca atgtggaaaa
ctagcaaaga ttttttaaaa gccagatttt cccacctatt 2340ttttttaaaa
ctttttgttc agtggcttca tttattgttg gatatcctta agtgtttatc
2400tctaagataa acagttaact cccatgccag aaaattatgc ctctttattg
atttacagtc 2460ccctttggcc acattccatg ctcaatctgc tggtaatcag
tagaatattc tggctttctc 2520atataccctg gaggattgcg tgaaggatcc
ctttttcttt ctgctgcttc tcccctcccc 2580actgtgttca ggtaggaatt
tttaaggcat ggcagccaca gtagaaagag ggaataacat 2640gtagcagtgt
gatgaacggc acacgctctt ctcaagaggg gacagtcctg attgtgtgtt
2700ggaagagaac aagtattctc ttttctttac tgtgtccttg tgtttgttta
tggaaagtat 2760ttgaatagcc tggcattttc tcggggatgg ttttgtttcg
cttttttgcc aaatagtata 2820ccctgggttc cacgtgtagg tgaactgcca
gttctctggc tgcctagata ctttatgtct 2880tactgtggga cccattggtc
tgcacttacg tggtttgtct tctggtcttg tcttaatttg 2940acttcctagg
gtcattgatg aaacaatagg ctattttata ggaatgtcaa ggaattggta
3000gcttatgata ccttgcagta gaaaagtgtg tgtttttgtt ttttttttaa
tttctctgaa 3060g 306121055DNAHomo sapiens 2ttatattaac aggttacatg
gatgaagaac ttgcaaaaaa accttgttcc aaaatccaga 60ttctaaaatg tggaggcact
gcaaggtctc agaatagccg agaagaaaac aaggaagcac 120taaagaatga
catcatattt acgaattctg tagaatcctt gaaatcagca cacataaagg
180agccagaaag agaaggaaaa ggcactgatt tagagaaaga caaaatagga
atggaggtca 240aggtagacag tgacgctgga ataccaaaaa gacaggaaac
ccaactaaaa atcagtgaga 300tgagtatacc acaaggacag ggagcccaaa
taaagaaaag tgtgtcagat gtaccaagag 360gacaggagtc ccaagtaaag
aagagtgagt caggtgtccc aaaaggacaa gaagcccaag 420taacgaagag
tgggttggtt gtactgaaag gacaggaagc ccaggtagag aagagtgaga
480tgggtgtgcc aagaagacag gaatcccaag taaagaagag tcagtctggt
gtctcaaagg 540gacaggaagc ccaggtaaag aagagggagt cagttgtact
gaaaggacag gaagcccagg 600tagagaagag tgagttgaag gtaccaaaag
gacaagaagg ccaagtagag aagactgagg 660cagatgtgcc aaaggaacaa
gaggtccaag aaaagaagag tgaggcaggt gtactgaaag 720gaccagaatc
ccaagtaaag aacactgagg tgagtgtacc agaaacactg gaatcccaag
780taaagaagag tgagtcaggt gtactaaaag gacaggaagc ccaagaaaag
aaggagagtt 840ttgaggataa aggaaataat gataaagaaa aggagagaga
tgcagagaaa gatccaaata 900aaaaagaaaa aggtgacaaa aacacaaaag
gtgacaaagg aaaggacaaa gttaaaggaa 960agagagaatc agaaatcaat
ggtgaaaaat caaaaggctc gaaaagggcg aaggcaaata 1020caggaaggaa
gtacaacaaa aaagtggaag agtaa 105531284DNAHomo sapiens 3gatcctgcct
cttttgctgc cactacaggt gatcattgag agcccactgt agcccccaaa 60gatgccccac
tcatcttgtg tcctggtgtt tgatttctct ccctggctat gcttctctac
120cctccttctc cttctttggc ccatgtatcc ctcccagccc tcaggatgcc
cagccccttg 180ctgttttgct cactgaacca gtactcccag ggggaggaac
tgctcatgtg cagcgtctcc 240tgatgctaag gagaacattt ctcaccctgg
agtcagaagg acccattaag cacgagatgg 300gtggcagtta gaacccaagg
taaagagtgg gaggccccca agcactgctt tggtctcctt 360agccttggta
ctcccccacc tcatgctccc caatctcttt ctgagcttca gattgctgtc
420tctttacaat gaggataatg agtcccagga aggccagcga catgcctaag
gccacaagag 480agagagagga tatgatgtgg ccggaagagg atgtttcctc
tgagctcact ttttctcact 540tctctccatt acttgagacc agaggcatcc
tagtgagagt gagtgcctgc accaacccca 600aagctcctcc tatccagcac
ccaccaacat ggctactcct ctgatgggac ccaatttggg 660tctcaggatc
taacactcca gcaccttcca ttaactgaat agtccctatc tttcccaagc
720cctcttcctt agaggcttat tctcttttct tttgatcaag aggaacacca
aggggtgggg 780aacaggtggt tcatgctgct attgctaagg agtaattggc
acagagtggc agtgggtctt 840gcctgtcatc ctactgtgag ttagtggaaa
ttaaccactg tggtacagac tctcccttac 900tctatgcaat cgcaactcct
ctgaaatgat cctggggcca gatccagggt tgcatcacat 960gtggctaatt
ggaacacgga gtcaaatgtg aagaggtttc aggaggacag gccatgccca
1020gaggcaggtg tgcagtgtta tgctccagtc tagtgcttct tgctgggcta
ttcaatgaaa 1080gagacatcag agaagaaaac ttcccccatc agaccagagg
ccatgagcca cctctgaggc 1140atcacaccag gctctggata tctcagattt
gtcttcacct ttctcaagag cttttcttgg 1200acaagggagt cttagaaaag
agatcataat caactaccaa cacagacatc atcagcagta 1260ggtgggctat
aagggcatgg tctc 1284428DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA sequence 4tccacgccgc cacggccttt
gcccctta 28528DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA sequence 5tccacgccgc cacgaccttt gcccctta
28620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA sequence 6actttggctg tcatcctgac 20720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA sequence
7cttgataggt cctgtagctc 20820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic DNA sequence 8agcgcgatga cacaggagta
20920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA sequence 9cgttgctatg gagacagtga 201021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic DNA sequence
10tggtatcgtg gaaggactca t 211121DNAArtificial SequenceDescription
of Artificial Sequence Synthetic DNA sequence 11gtgggtgtcg
ctgttgaagt c 211232DNAArtificial SequenceDescription of Artificial
Sequence Synthetic DNA sequence 12atagcggccg caatgacagt cttggaaata
ac 321334DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA sequence 13agactcgagt tactcttcca cttttttgtt gtac
341433DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA sequence 14gaggcggccg cgatgacaca ggagtacgac aac
331528DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA sequence 15agagtcgacg atctccgtca gggtgagc
281641DNAHomo sapiens 16taaaaatcag tgagatgagt rtaccacaag gacagggagc
c 411741DNAHomo sapiens 17gtccactcca cgccgccacg rcctttgccc
cttagccctg c 411841DNAHomo sapiens 18agacatcatc agcagtaggt
rggctataag ggcatggtct c 411911DNAHomo sapiens 19ccgatgctat a
112011DNAHomo sapiens 20ccgaagccac a 112111DNAHomo sapiens
21taactattgt g 112218DNAHomo sapiens 22gggcagtgcg gcggtatt
182318DNAHomo sapiens 23cttagacata ataacgcc 182418DNAHomo sapiens
24cgtcgatatg gcggcgcc 182518DNAHomo sapiens 25gggcagtgcg gcggcgcc
18
* * * * *