U.S. patent application number 13/962561 was filed with the patent office on 2014-02-13 for fungal resistant plants expressing rlk1.
This patent application is currently assigned to BASF Plant Science Company GMBH. The applicant listed for this patent is BASF Plant Science Company GMBH. Invention is credited to Tobias MENTZEL, Holger SCHULTHEISS.
Application Number | 20140047579 13/962561 |
Document ID | / |
Family ID | 50068644 |
Filed Date | 2014-02-13 |
United States Patent
Application |
20140047579 |
Kind Code |
A1 |
SCHULTHEISS; Holger ; et
al. |
February 13, 2014 |
Fungal Resistant Plants Expressing RLK1
Abstract
The present invention relates to a method of increasing
resistance against fungal pathogens of the family Phacosporaceae in
plants and/or plant cells. This is achieved by increasing the
expression of an RLK1 protein or fragment thereof in a plant, plant
part and/or plant cell in comparison to wild type plants, wild type
plant parts and/or wild type plant cells. Furthermore, the
invention relates to transgenic plants, plant parts, and/or plant
cells having an increased resistance against fungal pathogens, in
particular, pathogens of the family Phacopsoraceae, and to
recombinant expression vectors comprising a sequence that is
identical or homologous to a sequence encoding an RLK1 protein.
Inventors: |
SCHULTHEISS; Holger;
(Boehl-Iggelheim, DE) ; MENTZEL; Tobias;
(Roemerberg, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BASF Plant Science Company GMBH |
Ludwigshafen |
|
DE |
|
|
Assignee: |
BASF Plant Science Company
GMBH
Ludwigshafen
DE
|
Family ID: |
50068644 |
Appl. No.: |
13/962561 |
Filed: |
August 8, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61681161 |
Aug 9, 2012 |
|
|
|
Current U.S.
Class: |
800/265 ;
426/634; 435/320.1; 435/419; 435/468; 554/1; 554/9; 800/279;
800/301 |
Current CPC
Class: |
C12N 9/1205 20130101;
A01H 5/00 20130101; C12Y 207/01037 20130101; C12Y 207/11 20130101;
C12N 15/8282 20130101 |
Class at
Publication: |
800/265 ;
435/468; 435/419; 435/320.1; 554/1; 554/9; 800/279; 800/301;
426/634 |
International
Class: |
C12N 15/82 20060101
C12N015/82; A01H 5/00 20060101 A01H005/00 |
Claims
1-20. (canceled)
21. A method for increasing fungal resistance in a plant, a plant
part, or a plant cell wherein the method comprises the step of
increasing the expression and/or activity of a RLK1 protein in the
plant, plant part, or plant cell in comparison to a wild type
plant, wild type plant part or wild type plant cell.
22. The method of claim 21, wherein the RLK1 protein comprises an
amino acid sequence having at least 60% identity with SEQ ID NO: 10
or 2, or a functional fragment thereof, an orthologue or a
paralogue thereof.
23. The method of claim 21, wherein the RLK1 protein is encoded by:
(i) an exogenous nucleic acid having at least 60% identity with SEQ
ID NO: 9, 1, or 3, or a functional fragment thereof, an orthologue
or a paralogue thereof, or a splice variant thereof; (ii) an
exogenous nucleic acid encoding a protein having at least 60%
identity with SEQ ID NO: 10 or 2, or a functional fragment thereof,
an orthologue or a paralogue thereof; (iii) an exogenous nucleic
acid capable of hybridizing under stringent conditions with a
complementary sequence of any of the nucleic acids according to (i)
or (ii); and/or by (iv) an exogenous nucleic acid encoding the same
RLK1 protein as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code.
24. The method of claim 21, comprising: (a) stably transforming a
plant cell with an expression cassette comprising: (i) an exogenous
nucleic acid having at least 60% identity with SEQ ID NO: 9, 1, or
3, or a functional fragment thereof, an orthologue or a paralogue
thereof, or a splice variant thereof; (ii) an exogenous nucleic
acid encoding a protein having at least 60% identity with SEQ ID
NO: 10 or 2, or a functional fragment thereof, an orthologue or a
paralogue thereof; (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
and/or (iv) an exogenous nucleic acid encoding the same RLK1
protein as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code; in functional linkage with a
promoter; (b) regenerating the plant from the plant cell; and (c)
expressing said exogenous nucleic acid.
25. A recombinant vector construct comprising: (a) (i) a nucleic
acid having at least 60% identity with SEQ ID NO: 9, 1, or 3, or a
functional fragment thereof, an orthologue or a paralogue thereof,
or a splice variant thereof; (ii) a nucleic acid encoding a protein
having at least 60% identity with SEQ ID NO: 10 or 2, or a
functional fragment thereof, an orthologue or a paralogue thereof;
(iii) a nucleic acid capable of hybridizing under stringent
conditions with a complementary sequence of any of the nucleic
acids according to (i) or (ii); and/or (iv) a nucleic acid encoding
the same RLK1 protein as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code; operably linked with (b)
a promoter; and (c) a transcription termination sequence.
26. The method of claim 24, wherein the promoter is a constitutive
promoter, pathogen-inducible promoter, a mesophyll-specific
promoter or an epidermis-specific promoter.
27. The recombinant vector construct of claim 25, wherein the
promoter is a constitutive promoter, pathogen-inducible promoter, a
mesophyll-specific promoter or an epidermis-specific promoter.
28. A transgenic plant, transgenic plant part, or transgenic plant
cell transformed with the recombinant vector construct of claim
25.
29. A method for the production of a transgenic plant, transgenic
plant part, or transgenic plant cell having increased fungal
resistance, comprising: (a) introducing the recombinant vector
construct of claim 25 into a plant, a plant part, or a plant cell;
(b) generating a transgenic plant, transgenic plant part, or
transgenic plant cell from the plant, plant part or plant cell; and
(c) expressing the RLK1 protein encoded by: (i) the exogenous
nucleic acid having at least 60% identity with SEQ ID NO: 9, 1, or
3, a functional fragment thereof, an orthologue or a paralogue
thereof, or a splice variant thereof; (ii) the exogenous nucleic
acid encoding a protein having at least 60% identity with SEQ ID
NO: 10 or 2, or a functional fragment thereof, an orthologue or a
paralogue thereof; (iii) the exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
and/or by (iv) the exogenous nucleic acid encoding the same RLK1
protein as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code.
30. The method of claim 29, further comprising the step of
harvesting the seeds of the transgenic plant and planting the seeds
and growing the seeds to plants, wherein the grown plants comprise:
(i) the exogenous nucleic acid having at least 60% identity with
SEQ ID NO: 9, 1, or 3, a functional fragment thereof, an orthologue
or a paralogue thereof, or a splice variant thereof; (ii) the
exogenous nucleic acid encoding a protein having at least 60%
identity with SEQ ID NO: 10 or 2, or a functional fragment thereof,
an orthologue or a paralogue thereof; (iii) the exogenous nucleic
acid capable of hybridizing under stringent conditions with a
complementary sequence of any of the nucleic acids according to (i)
or (ii); and/or (iv) the exogenous nucleic acid encoding the same
RLK1 protein as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code.
31. A harvestable part of the transgenic plant of claim 28.
32. The harvestable part of claim 31, comprising a transgenic seed
of the transgenic plant.
33. A product derived from the transgenic plant of claim 28.
34. The product of claim 33, comprising soybean meal or soy
oil.
35. A method for the production of a product comprising: a) growing
the transgenic plant of claim 28; and b) producing said product
from or by the plant and/or part of the plant.
36. The method of claim 35, comprising: a) growing the plant and
removing the harvestable parts; and b) producing said product from
or by the harvestable parts of the plant.
37. The method of claim 37, wherein the product is meal or oil.
38. The method of claim 21, wherein the fungal resistance is
resistance against rust fungus, downy mildew, powdery mildew, leaf
spot, late blight and/or septoria.
39. The method of claim 38, wherein the fungal resistance is a
resistance against soybean rust.
40. The method of claim 39, wherein the resistance against soybean
rust is resistance against Phakopsora meibomiae and/or Phakopsora
pachyrhizi.
41. The method of claim 21, wherein the plant is selected from the
group consisting of beans, soya, pea, clover, kudzu, lucerne,
lentils, lupins, vetches, groundnut, rice, wheat, barley,
arabidopsis, lentil, banana, canola, cotton, potato, corn, sugar
cane, alfalfa, and sugar beet.
42. A method for breeding a fungal resistant plant comprising: (a)
crossing the plant of claim 28 with a second plant; (b) obtaining
seed from the cross of step (a); (c) planting said seeds and
growing the seeds to plants; and (d) selecting from said plants
plants expressing an RLK1 protein encoded by (i) the exogenous
nucleic acid having at least 60% identity with SEQ ID NO: 9, 1, or
3, a functional fragment thereof, an orthologue or a paralogue
thereof, or a splice variant thereof; (ii) the exogenous nucleic
acid encoding a protein having at least 60% identity with SEQ ID
NO: 10 or 2, or a functional fragment thereof, an orthologue or a
paralogue thereof; (iii) the exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
and/or by (iv) the exogenous nucleic acid encoding the same RLK1
protein as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code.
Description
[0001] This application claims priority of application with number
U.S. 61/681,161, which is incorporated by reference in its
entirety.
SUMMARY OF THE INVENTION
[0002] The present invention relates to a method of increasing
resistance against fungal pathogens, in particular, pathogens of
the family Phacopsoraceae, for example soybean rust, in plants,
plant parts, and/or plant cells. This is achieved by increasing the
expression and/or activity of an RLK1 protein in a plant, plant
part and/or plant cell in comparison to wild type plants, wild type
plant parts and/or wild type plant cells.
[0003] Furthermore, the invention relates to transgenic plants,
plant parts, and/or plant cells having an increased resistance
against fungal pathogens, in particular, pathogens of the family
Phacopsoraceae, for example soybean rust, and to recombinant
expression vectors comprising a sequence that is identical or
homologous to a sequence encoding an RLK1 protein.
BACKGROUND OF THE INVENTION
[0004] The cultivation of agricultural crop plants serves mainly
for the production of foodstuffs for humans and animals.
Monocultures in particular, which are the rule nowadays, are highly
susceptible to an epidemic-like spreading of diseases. The result
is markedly reduced yields. To date, the pathogenic organisms have
been controlled mainly by using pesticides. Nowadays, the
possibility of directly modifying the genetic disposition of a
plant or pathogen is also open to man.
[0005] Resistance generally describes the ability of a plant to
prevent, or at least curtail the infestation and colonization by a
harmful pathogen. Different mechanisms can be discerned in the
naturally occurring resistance, with which the plants fend off
colonization by phytopathogenic organisms. These specific
interactions between the pathogen and the host determine the course
of infection (Schopfer and Brennicke (1999) Pflanzenphysiologie,
Springer Verlag, Berlin-Heidelberg, Germany).
[0006] With regard to the race specific resistance, also called
host resistance, a differentiation is made between compatible and
incompatible interactions. In the compatible interaction, an
interaction occurs between a virulent pathogen and a susceptible
plant. The pathogen survives, and may build up reproduction
structures, while the host mostly dies off. An incompatible
interaction occurs on the other hand when the pathogen infects the
plant but is inhibited in its growth before or after weak
development of symptoms (mostly by the presence of R genes of the
NBS-LRR family, see below). In the latter case, the plant is
resistant to the respective pathogen (Schopfer and Brennicke, vide
supra). However, this type of resistance is specific for a certain
strain or pathogen.
[0007] In both compatible and incompatible interactions a defensive
and specific reaction of the host to the pathogen occurs. In
nature, however, this resistance is often overcome because of the
rapid evolutionary development of new virulent races of the
pathogens (Neu et al. (2003) American Cytopathol. Society, MPMI 16
No. 7: 626-633).
[0008] Most pathogens are plant-species specific. This means that a
pathogen can induce a disease in a certain plant species, but not
in other plant species (Heath (2002) Can. J. Plant Pathol. 24:
259-264). The resistance against a pathogen in certain plant
species is called non-host resistance. The non-host resistance
offers strong, broad, and permanent protection from phytopathogens.
Genes providing non-host resistance provide the opportunity of a
strong, broad and permanent protection against certain diseases in
non-host plants. In particular, such a resistance works for
different strains of the pathogen.
[0009] Fungi are distributed worldwide. Approximately 100 000
different fungal species are known to date. Thereof rusts are of
great importance. They can have a complicated development cycle
with up to five different spore stages (spermatium, aecidiospore,
uredospore, teleutospore and basidiospore).
[0010] During the infection of plants by pathogenic fungi,
different phases are usually observed. The first phases of the
interaction between phytopathogenic fungi and their potential host
plants are decisive for the colonization of the plant by the
fungus. During the first stage of the infection, the spores become
attached to the surface of the plants, germinate, and the fungus
penetrates the plant. Fungi may penetrate the plant via existing
ports such as stomata, lenticels, hydatodes and wounds, or else
they penetrate the plant epidermis directly as the result of the
mechanical force and with the aid of cell-wall-digesting enzymes.
Specific infection structures are developed for penetration of the
plant.
[0011] Immediately after recognition of a potential pathogen the
plant starts to elicit defense reactions. Mostly the presence of
the pathogen is sensed via so called PAMP receptors, a class of
trans-membrane receptor like kinases recognizing conserved pathogen
associated molecules (e.g. flagellin or chitin). Receptor-like
kinases (RLKs) are signaling proteins that feature an extracellular
domain connected via a transmembrane domain to a cytoplasmic
kinase. This architecture indicates that RLKs perceive external
signals, transducing them into the cell. In plants, RLKs were first
implicated in the regulation of development, in pathogen responses,
and in recognition events. (Santiago A Morillo and Frans E Tax
(2006) Functional analysis of receptor-like kinases in monocots and
dicots. Current Opinion in Plant Biology 9:460-469).
[0012] Only very few of the RLKs are described to be involved in
the recognition of conserved structures of microbes (microbe
asociated molecular patterns, PAMPs, for review see Thorsten
Nurnberger and Birgit Kemmerling (2006) Receptor protein
kinases-pattern recognition receptors in plant immunity. TRENDS in
Plant Science 11(11)519ff).
[0013] Downstream of the PAMP receptors, the phytohormones
salicylic acid (SA), jasmonate (JA) and ethylene (ET) play a
critical role in the regulation of the different defense reactions.
Depending on the ratio of the different phytohormones, different
defense reactions are elicited by the host cell. Generally SA
dependent defense is linked with resistance against biotrophic
pathogens, whereas JA/ET dependent defense reactions are active
against necrotrophic pathogens (and insects).
[0014] Another more specific resistance mechanism is based on the
presence of so called resistance genes (R-genes). Most R genes
belong to the nucleotide-binding site-leucine-rich repeat (NBS-LRR)
gene family and function in monitoring the presence of pathogen
effector proteins (virulence factors). After recognizing the
pathogen derived proteins a strong defense reaction (mostly
accompanied by a programmed cell death) is elicited.
[0015] The soybean rust Phakopsora pachyrhizi directly penetrates
the plant epidermis. After crossing the epidermal cell, the fungus
reaches the intercellular space of the mesophyll, where the fungus
starts to spread through the leaves. To acquire nutrients the
fungus penetrates mesophyll cells and develops haustoria inside the
mesophyl cell. During the penetration process the plasmamembrane of
the penetrated mesophyll cell stays intact. Therefore the soybean
rust fungus establishes a biotrophic interaction with soybean.
[0016] The biotrophic phytopathogenic fungi, such as soybean rust
and all other rust fungi, depend for their nutrition on the
metabolism of living cells of the plants. This type of fungi belong
to the group of biotrophic fungi, like other rust fungi, powdery
mildew fungi or oomycete pathogens like the genus Phytophthora or
Peronospora. The necrotrophic phytopathogenic fungi depend for
their nutrition on dead cells of the plants, e.g. species from the
genus Fusarium, Rhizoctonia or Mycospaerella. Soybean rust has
occupied an intermediate position, since it penetrates the
epidermis directly, whereupon the penetrated cell becomes necrotic.
After the penetration, the fungus changes over to an
obligatory-biotrophic lifestyle. The subgroup of the biotrophic
fungal pathogens which follows essentially such an infection
strategy is heminecrotrohic.
[0017] Soybean rust has become increasingly important in recent
times. The disease may be caused by the biotrophic rusts Phakopsora
pachyrhizi and Phakopsora meibomiae. They belong to the class
Basidiomycota, order Uredinales, family Phakopsoraceae. Both rusts
infect a wide spectrum of leguminosic host plants. P. pachyrhizi,
also referred to as Asian rust, is the more aggressive pathogen on
soy (Glycine max), and is therefore, at least currently, of great
importance for agriculture. P. pachyrhizi can be found in nearly
all tropical and subtropical soy growing regions of the world. P.
pachyrhizi is capable of infecting 31 species from 17 families of
the Leguminosae under natural conditions and is capable of growing
on further 60 species under controlled conditions (Sinclair et al.
(eds.), Proceedings of the rust workshop (1995), National
SoyaResearch Laboratory, Publication No. 1 (1996); Rytter J. L. et
al., Plant Dis. 87, 818 (1984)). P. meibomiae has been found in the
Caribbean Basin and in Puerto Rico, and has not caused substantial
damage as yet.
[0018] P. pachyrhizi can currently be controlled in the field only
by means of fungicides. Soy plants with resistance to the entire
spectrum of the isolates are not available. When searching for
resistant soybean accessions, six dominant R-genes of the NBS-LRR
family, named Rpp1-5 and Rpp?(Hyuuga), which mediate resistance of
soy to P. pachyrhizi, were discovered by screening thousands of
soybean varieties. As the R-genes are derived from a host
(soybean), the resistance was lost rapidly, as P. pachyrhizi
develops new virulent races.
[0019] In recent years, fungal diseases, e.g. soybean rust, has
gained in importance as pest in agricultural production. There was
therefore a demand in the prior art for developing methods to
control fungi and to provide fungal resistant plants.
[0020] Much research has been performed on the field of powdery and
downy mildew infecting the epidermal layer of plants. However, the
problem to cope with soybean rust which infects the mesophyll
remains unsolved.
[0021] The object of the present invention is inter alia to provide
a method of increasing resistance against fungal pathogens,
preferably against fungal pathogens of the family Phacopsoraceae,
more preferably against fungal pathogens of the genus Phacopsora,
most preferably against Phakopsora pachyrhizi and Phakopsora
meibomiae, also known as soybean rust.
[0022] Surprisingly, we found that fungal pathogens, in particular
of the family Phacopsoraceae, for example soybean rust, can be
controlled by increasing the expression of a RLK1 protein.
[0023] The present invention therefore provides a method of
increasing resistance against fungal pathogens, preferably against
fungal pathogens of the family Phacopsoraceae, more preferably
against fungal pathogens of the genus Phacopsora, most preferably
against Phakopsora pachyrhizi and Phakopsora meibomiae, also known
as soybean rust, in transgenic plants, transgenic plant parts, or
transgenic plant cells by overexpressing one or more RLK1 nucleic
acids.
[0024] A further object is to provide transgenic plants resistant
against fungal pathogens, preferably of the family Phacopsoraceae,
more preferably against fungal pathogens of the genus Phacopsora,
most preferably against Phakopsora pachyrhizi and Phakopsora
meibomiae, also known as soybean rust, a method for producing such
plants as well as a vector construct useful for the above
methods.
[0025] Therefore, the present invention also refers to a
recombinant vector construct and a transgenic plant, transgenic
plant part, or transgenic plant cell comprising an exogenous RLK1
nucleic acid. Furthermore, a method for the production of a
transgenic plant, transgenic plant part or transgenic plant cell
using the nucleic acid of the present invention is claimed herein.
In addition, the use of a nucleic acid or the recombinant vector of
the present invention for the transformation of a plant, plant
part, or plant cell is claimed herein.
[0026] The objects of the present invention, as outlined above, are
achieved by the subject-matter of the main claims. Preferred
embodiments of the invention are defined by the subject matter of
the dependent claims.
BRIEF SUMMARY OF THE INVENTION
[0027] The object of the present invention is inter alia to provide
a method of increasing resistance against fungal pathogens,
preferably against fungal pathogens of the family Phacopsoraceae,
more preferably against fungal pathogens of the genus Phacopsora,
most preferably against Phakopsora pachyrhizi and Phakopsora
meibomiae, also known as soybean rust.
[0028] Surprisingly, we found that resistance against fungal
pathogens, in particular of the family Phacopsoraceae, for example
soybean rust, can be enhanced by increasing the expression of a
RLK1 protein.
[0029] The present invention therefore provides a method of
increasing resistance against fungal pathogens, preferably against
fungal pathogens of the family Phacopsoraceae, more preferably
against fungal pathogens of the genus Phacopsora, most preferably
against Phakopsora pachyrhizi and Phakopsora meibomiae, also known
as soybean rust, in transgenic plants, transgenic plant parts, or
transgenic plant cells by overexpressing one or more RLK1 nucleic
acids.
[0030] A further object is to provide transgenic plants resistant
against fungal pathogens, preferably of the family Phacopsoraceae,
more preferably against fungal pathogens of the genus Phacopsora,
most preferably against Phakopsora pachyrhizi and Phakopsora
meibomiae, also known as soybean rust, a method for producing such
plants as well as a vector construct useful for the above
methods.
[0031] Therefore, the present invention also refers to a
recombinant vector construct and a transgenic plant, transgenic
plant part, or transgenic plant cell comprising an exogenous RLK1
nucleic acid. Furthermore, a method for the production of a
transgenic plant, transgenic plant part or transgenic plant cell
using the nucleic acid of the present invention is claimed herein.
In addition, the use of a nucleic acid or the recombinant vector of
the present invention for the transformation of a plant, plant
part, or plant cell is claimed herein.
[0032] The objects of the present invention, as outlined above, are
achieved by the subject-matter of the main claims. Preferred
embodiments of the invention are defined by the subject matter of
the dependent claims.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0033] FIG. 1 shows the scoring system used to determine the level
of diseased leaf area of wildtype and transgenic soy plants against
the rust fungus P. pachyrhizi (as described in GODOY, C. V., KOGA,
L. J. & CANTERI, M. G. Diagrammatic scale for assessment of
soybean rust severity. Fitopatologia Brasileira 31:063-068.
2006).
[0034] FIG. 2 shows the schematic illustration of the plant
transformation vector harboring the RLK1 nucleic acid under control
of the parsley ubiquitine promoter.
[0035] FIG. 3 shows the full-length cDNA sequence of the RLK1 gene
from Arabidopsis thaliana having SEQ ID NO: 1.
[0036] FIG. 4 shows the sequence of a RLK1 protein (SEQ ID NO:
2).
[0037] FIG. 5 shows the sequence of the Arabidopsis thaliana
genomic sequence (part of accession No NC.sub.--003076.8) around
the region, which codes for RLK1, and having SEQ ID NO: 3.
[0038] FIG. 6 shows the alignment of the Arabidopsis genome
sequence (part of accession No NC.sub.--003076.8, SEQ ID NO: 3) and
the sequence of the cDNA of RLK1 (SEQ ID NO: 1). In FIG. 6 the
genome sequence (SEQ ID NO: 3) is truncated at its 3' and 5' end.
The truncated genome sequence is shown in SEQ ID NO: 8.
[0039] FIG. 7 shows the result of the scoring of 42 transgenic soy
plants (derived from 5 independent events) expressing the RLK1
overexpression vector construct. T.sub.1 soybean plants expressing
RLK1 protein were inoculated with spores of Phakopsora pachyrhizi.
The evaluation of the diseased leaf area on all leaves was
performed 14 days after inoculation. The average of the percentage
of the leaf area showing fungal colonies or strong
yellowing/browning on all leaves was considered as diseased leaf
area. At all 42 soybean T.sub.1 plants expressing RLK1 (expression
checked by RT-PCR) were evaluated in parallel to non-transgenic
control plants. The average of the diseased leaf area is shown in
FIG. 7. Overexpression of RLK1 significantly (*: p<0.05) reduces
the diseased leaf area in comparison to non-transgenic control
plants by 29.0%.
[0040] FIG. 8 contains a brief description of the sequences of the
sequence listing.
DETAILED DESCRIPTION OF THE INVENTION
[0041] The present invention may be understood more readily by
reference to the following detailed description of the preferred
embodiments of the invention and the examples included herein.
Definitions
[0042] Unless otherwise noted, the terms used herein are to be
understood according to conventional usage by those of ordinary
skill in the relevant art. In addition to the definitions of terms
provided herein, definitions of common terms in molecular biology
may also be found in Rieger et al., 1991 Glossary of genetics:
classical and molecular, 5th Ed., Berlin: Springer-Verlag; and in
Current Protocols in Molecular Biology, F. M. Ausubel et al., Eds.,
Current Protocols, a joint venture between Greene Publishing
Associates, Inc. and John Wiley & Sons, Inc., (1998
Supplement).
[0043] It is to be understood that as used in the specification and
in the claims, "a" or "an" can mean one or more, depending upon the
context in which it is used. Thus, for example, reference to "a
cell" can mean that at least one cell can be utilized. It is to be
understood that the terminology used herein is for the purpose of
describing specific embodiments only and is not intended to be
limiting.
[0044] Throughout this application, various publications are
referenced. The disclosures of all of these publications and those
references cited within those publications in their entireties are
hereby incorporated by reference into this application in order to
more fully describe the state of the art to which this invention
pertains. Standard techniques for cloning, DNA isolation,
amplification and purification, for enzymatic reactions involving
DNA ligase, DNA polymerase, restriction endonucleases and the like,
and various separation techniques are those known and commonly
employed by those skilled in the art. A number of standard
techniques are described in Sambrook et al., 1989 Molecular
Cloning, Second Edition, Cold Spring Harbor Laboratory, Plainview,
N.Y.; Maniatis et al., 1982 Molecular Cloning, Cold Spring Harbor
Laboratory, Plainview, N.Y.; Wu (Ed.) 1993 Meth. Enzymol. 218, Part
I; Wu (Ed.) 1979 Meth Enzymol. 68; Wu et al., (Eds.) 1983 Meth.
Enzymol. 100 and 101; Grossman and Moldave (Eds.) 1980 Meth.
Enzymol. 65; Miller (Ed.) 1972 Experiments in Molecular Genetics,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Old and
Primrose, 1981 Principles of Gene Manipulation, University of
California Press, Berkeley; Schleif and Wensink, 1982 Practical
Methods in Molecular Biology; Glover (Ed.) 1985 DNA Cloning Vol. I
and II, IRL Press, Oxford, UK; Hames and Higgins (Eds.) 1985
Nucleic Acid Hybridization, IRL Press, Oxford, UK; and Setlow and
Hollaender 1979 Genetic Engineering: Principles and Methods, Vols.
1-4, Plenum Press, New York. Abbreviations and nomenclature, where
employed, are deemed standard in the field and commonly used in
professional journals such as those cited herein.
[0045] "Homologues" of a protein encompass peptides, oligopeptides,
polypeptides, proteins and/or enzymes having amino acid
substitutions, deletions and/or insertions relative to the
unmodified protein in question and having similar functional
activity as the unmodified protein from which they are derived.
[0046] "Homologues" of a nucleic acid encompass nucleotides and/or
polynucleotides having nucleic acid substitutions, deletions and/or
insertions relative to the unmodified nucleic acid in question,
wherein the protein coded by such nucleic acids has similar or
higher functional activity as the unmodified protein coded by the
unmodified nucleic acid from which they are derived. In particular,
homologues of a nucleic acid may encompass substitutions on the
basis of the degenerative amino acid code.
[0047] A "deletion" refers to removal of one or more amino acids
from a protein or to the removal of one or more nucleic acids from
DNA, ssRNA and/or dsRNA.
[0048] An "insertion" refers to one or more amino acid residues or
nucleic acid residues being introduced into a predetermined site in
a protein or the nucleic acid.
[0049] A "substitution" refers to replacement of amino acids of the
protein with other amino acids having similar properties (such as
similar hydrophobicity, hydrophilicity, antigenicity, propensity to
form or break .alpha.-helical structures or beta-sheet
structures).
[0050] On the nucleic acid level a substitution refers to a
replacement of one or more nucleotides with other nucleotides
within a nucleic acid, wherein the protein coded by the modified
nucleic acid has a similar function. In particular homologues of a
nucleic acid encompass substitutions on the basis of the
degenerative amino acid code.
[0051] Amino acid substitutions are typically of single residues,
but may be clustered depending upon functional constraints placed
upon the protein and may range from 1 to 10 amino acids; insertions
or deletion will usually be of the order of about 1 to 10 amino
acid residues. The amino acid substitutions are preferably
conservative amino acid substitutions. Conservative substitution
tables are well known in the art (see for example Creighton (1984)
Proteins. W.H. Freeman and Company (Eds) and Table 1 below).
TABLE-US-00001 TABLE 1 Examples of conserved amino acid
substitutions Conservative Residue Substitutions Ala Ser Arg Lys
Asn Gln; His Asp Glu Gln Asn Cys Ser Glu Asp Gly Pro His Asn; Gln
Ile Leu, Val Leu Ile; Val Lys Arg; Gln Met Leu; Ile Phe Met; Leu;
Tyr Ser Thr; Gly Thr Ser; Val Trp Tyr Tyr Trp; Phe Val Ile; Leu
[0052] Amino acid substitutions, deletions and/or insertions may
readily be made using peptide synthetic techniques well known in
the art, such as solid phase peptide synthesis and the like, or by
recombinant DNA manipulation.
[0053] Methods for the manipulation of DNA sequences to produce
substitution, insertion or deletion variants of a protein are well
known in the art. For example, techniques for making substitution
mutations at predetermined sites in DNA are well known to those
skilled in the art and include M13 mutagenesis, T7-Gene in vitro
mutagenesis (USB, Cleveland, Ohio), QuickChange Site Directed
mutagenesis (Stratagene, San Diego, Calif.), PCR-mediated
site-directed mutagenesis or other site-directed mutagenesis
protocols.
[0054] Orthologues and paralogues encompass evolutionary concepts
used to describe the ancestral relationships of genes. Paralogues
are genes within the same species that have originated through
duplication of an ancestral gene; orthologues are genes from
different organisms that have originated through speciation, and
are also derived from a common ancestral gene.
[0055] The terms "encode" or "coding for" is used for the
capability of a nucleic acid to contain the information for the
amino acid sequence of a protein via the genetic code, i.e., the
succession of codons each being a sequence of three nucleotides,
which specify which amino acid will be added next during protein
synthesis. The terms "encode" or "coding for" therefore includes
all possible reading frames of a nucleic acid. Furthermore, the
terms "encode" or "coding for" also applies to a nucleic acid,
which coding sequence is interrupted by non-coding nucleic acid
sequences, which are removed prior translation, e.g., a nucleic
acid sequence comprising introns.
[0056] The term "domain" refers to a set of amino acids conserved
at specific positions along an alignment of sequences of
evolutionarily related proteins. While amino acids at other
positions can vary between homologues, amino acids that are highly
conserved at specific positions indicate amino acids that are
likely essential in the structure, stability or function of a
protein.
[0057] Specialist databases exist for the identification of
domains, for example, SMART (Schultz et al. (1998) Proc. Natl.
Acad. Sci. USA 95, 5857-5864; Letunic et al. (2002) Nucleic Acids
Res 30, 242-244), InterPro (Mulder et al., (2003) Nucl. Acids. Res.
31, 315-318), Prosite (Bucher and Bairoch (1994), A generalized
profile syntax for biomolecular sequences motifs and its function
in automatic sequence interpretation. (In) ISMB-94; Proceedings 2nd
International Conference on Intelligent Systems for Molecular
Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D.,
Eds., pp 53-61, AAAI Press, Menlo Park; Hulo et al., Nucl. Acids.
Res. 32:D134-D137, (2004)), or Pfam (Bateman et al., Nucleic Acids
Research 30(1): 276-280 (2002)). A set of tools for in silico
analysis of protein sequences is available on the ExPASy proteomics
server (Swiss Institute of Bioinformatics (Gasteiger et al.,
ExPASy: the proteomics server for in-depth protein knowledge and
analysis, Nucleic Acids Res. 31:3784-3788 (2003)). Domains or
motifs may also be identified using routine techniques, such as by
sequence alignment.
[0058] Methods for the alignment of sequences for comparison are
well known in the art, such methods include GAP, BESTFIT, BLAST,
FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch
((1970) J Mol Biol 48: 443-453) to find the global (i.e. spanning
the complete sequences) alignment of two sequences that maximizes
the number of matches and minimizes the number of gaps. The BLAST
algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10)
calculates percent sequence identity or similarity or homology and
performs a statistical analysis of the identity or similarity or
homology between the two sequences. The software for performing
BLAST analysis is publicly available through the National Centre
for Biotechnology Information (NCBI). Homologues may readily be
identified using, for example, the ClustalW multiple sequence
alignment algorithm (version 1.83), with the default pairwise
alignment parameters, and a scoring method in percentage. Global
percentages of similarity/homology/identity may also be determined
using one of the methods available in the MatGAT software package
(Campanella et al., BMC Bioinformatics. 2003 Jul. 10; 4:29. MatGAT:
an application that generates similarity/homology/identity matrices
using protein or DNA sequences). Minor manual editing may be
performed to optimise alignment between conserved motifs, as would
be apparent to a person skilled in the art. Furthermore, instead of
using full-length sequences for the identification of homologues,
specific domains may also be used. The sequence identity values may
be determined over the entire nucleic acid or amino acid sequence
or over selected domains or conserved motif(s), using the programs
mentioned above using the default parameters. For local alignments,
the SmithWaterman algorithm is particularly useful (Smith T F,
Waterman M S (1981) J. Mol. Biol. 147(1); 195-7).
[0059] As used herein the terms "fungal-resistance", "resistant to
a fungus" and/or "fungalresistant" mean reducing, preventing, or
delaying an infection by fungi. The term "resistance" refers to
fungal resistance. Resistance does not imply that the plant
necessarily has 100% resistance to infection. In preferred
embodiments, enhancing or increasing fungal resistance means that
resistance in a resistant plant is greater than 10%, greater than
20%, greater than 30%, greater than 40%, greater than 50%, greater
than 60%, greater than 70%, greater than 80%, greater than 90%, or
greater than 95% in comparison to a wild type plant.
[0060] As used herein the terms "soybean rust-resistance",
"resistant to a soybean rust", "soybean rust-resistant",
"rust-resistance", "resistant to a rust", or "rust-resistant" mean
reducing or preventing or delaying an infection of a plant, plant
part, or plant cell by Phacopsoracea, in particular Phakopsora
pachyrhizi and Phakopsora meibomiae--also known as soybean rust or
Asian Soybean Rust (ASR), as compared to a wild type plant, wild
type plant part, or wild type plant cell. Resistance does not imply
that the plant necessarily has 100% resistance to infection. In
preferred embodiments, enhancing or increasing rust resistance
means that rust resistance in a resistant plant is greater than
10%, greater than 20%, greater than 30%, greater than 40%, greater
than 50%, greater than 60%, greater than 70%, greater than 80%,
greater than 90%, or greater than 95% in comparison to a wild type
plant that is not resistant to soybean rust. Preferably the wild
type plant is a plant of a similar, more preferably identical,
genotype as the plant having increased resistance to the soybean
rust, but does not comprise an exogenous RLK1 nucleic acid,
functional fragments thereof and/or an exogenous nucleic acid
capable of hybridizing with an RLK1 nucleic acid.
[0061] The level of fungal resistance of a plant can be determined
in various ways, e.g. by scoring/measuring the infected leaf area
in relation to the overall leaf area. Another possibility to
determine the level of resistance is to count the number of soybean
rust colonies on the plant or to measure the amount of spores
produced by these colonies. Another way to resolve the degree of
fungal infestation is to specifically measure the amount of rust
DNA by quantitative (q) PCR. Specific probes and primer sequences
for most fungal pathogens are available in the literature
(Frederick R D, Snyder C L, Peterson G L, et al. 2002 Polymerase
chain reaction assays for the detection and discrimination of the
rust pathogens Phakopsora pachyrhizi and P. meibomiae,
Phytopathology 92(2) 217-227).
[0062] The term "hybridization" as used herein includes "any
process by which a strand of nucleic acid molecule joins with a
complementary strand through base pairing" (J. Coombs (1994)
Dictionary of Biotechnology, Stockton Press, New York).
Hybridization and the strength of hybridization (i.e., the strength
of the association between the nucleic acid molecules) is impacted
by such factors as the degree of complementarity between the
nucleic acid molecules, stringency of the conditions involved, the
Tm of the formed hybrid, and the G:C ratio within the nucleic acid
molecules.
[0063] As used herein, the term "Tm" is used in reference to the
"melting temperature." The melting temperature is the temperature
at which a population of double-stranded nucleic acid molecules
becomes half dissociated into single strands. The equation for
calculating the Tm of nucleic acid molecules is well known in the
art. As indicated by standard references, a simple estimate of the
Tm value may be calculated by the equation: Tm=81.5+0.41 (% G+C),
when a nucleic acid molecule is in aqueous solution at 1 M NaCl
(see e.g., Anderson and Young, Quantitative Filter Hybridization,
in Nucleic Acid Hybridization (1985). Other references include more
sophisticated computations, which take structural as well as
sequence characteristics into account for the calculation of Tm.
Stringent conditions, are known to those skilled in the art and can
be found in Current Protocols in Molecular Biology, John Wiley
& Sons, N.Y. (1989), 6.3.1-6.3.6.
[0064] In particular, the term "stringency conditions" refers to
conditions, wherein 100 contigous nucleotides or more, 150
contigous nucleotides or more, 200 contigous nucleotides or more or
250 contigous nucleotides or more which are a fragment or identical
to the complementary nucleic acid molecule (DNA, RNA, ssDNA or
ssRNA) hybridizes under conditions equivalent to hybridization in
7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at
50.degree. C. with washing in 2.times.SSC, 0.1% SDS at 50.degree.
C. or 65.degree. C., preferably at 65.degree. C., with a specific
nucleic acid molecule (DNA; RNA, ssDNA or ss RNA). Preferably, the
hybridizing conditions are equivalent to hybridization in 7% sodium
dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50.degree. C. with
washing in 1.times.SSC, 0.1% SDS at 50.degree. C. or 65.degree. C.,
preferably 65.degree. C., more preferably the hybridizing
conditions are equivalent to hybridization in 7% sodium dodecyl
sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50.degree. C. with washing
in 0.1.times.SSC, 0.1% SDS at 50.degree. C. or 65.degree. C.,
preferably 65.degree. C. Preferably, the complementary nucleotides
hybridize with a fragment or the whole RLK1 nucleic acids.
Alternatively, preferred hybridization conditions encompass
hybridisation at 65.degree. C. in 1.times.SSC or at 42.degree. C.
in 1.times.SSC and 50% formamide, followed by washing at 65.degree.
C. in 0.3.times.SSC or hybridisation at 50.degree. C. in
4.times.SSC or at 40.degree. C. in 6.times.SSC and 50% formamide,
followed by washing at 50.degree. C. in 2.times.SSC. Further
preferred hybridization conditions are 0.1% SDS, 0.1 SSD and
65.degree. C.
[0065] "Identity" or "homology" or "similarity" between two nucleic
acids sequences or amino acid sequences refers in each case over
the entire length of the RLK1 nucleic acid sequences or RLK1 amino
acid sequences. The terms "identity", "homology" and "similarity"
are used herein interchangeably.
[0066] For example the identity may be calculated by means of the
Vector NTI Suite 7.1 program of the company Informax (USA)
employing the Clustal Method (Higgins D G, Sharp P M. Fast and
sensitive multiple sequence alignments on a microcomputer. Comput
Appl. Biosci. 1989 April; 5(2):151-1) with the following
settings:
Multiple Alignment Parameter:
TABLE-US-00002 [0067] Gap opening penalty 10 Gap extension penalty
10 Gap separation penalty range 8 Gap separation penalty off %
identity for alignment delay 40 Residue specific gaps off
Hydrophilic residue gap off Transition weighing 0
Pairwise Alignment Parameter:
TABLE-US-00003 [0068] FAST algorithm on K-tuple size 1 Gap penalty
3 Window size 5 Number of best diagonals 5
[0069] Alternatively the identity may be determined according to
Chema, Ramu, Sugawara, Hideaki, Koike, Tadashi, Lopez, Rodrigo,
Gibson, Toby J, Higgins, Desmond G, Thompson, Julie D. Multiple
sequence alignment with the Clustal series of programs. (2003)
Nucleic Acids Res 31 (13):3497-500, the web page:
http://www.ebi.ac.uk/Tools/clustalw/index.html# and the following
settings
TABLE-US-00004 DNA Gap Open Penalty 15.0 DNA Gap Extension Penalty
6.66 DNA Matrix Identity Protein Gap Open Penalty 10.0 Protein Gap
Extension Penalty 0.2 Protein matrix Gonnet Protein/DNA ENDGAP -1
Protein/DNA GAPDIST 4
[0070] All the nucleic acid sequences mentioned herein
(single-stranded and double-stranded DNA and RNA sequences, for
example cDNA and mRNA) can be produced in a known way by chemical
synthesis from the nucleotide building blocks, e.g. by fragment
condensation of individual overlapping, complementary nucleic acid
building blocks of the double helix. Chemical synthesis of
oligonucleotides can, for example, be performed in a known way, by
the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press,
New York, pages 896-897). The accumulation of synthetic
oligonucleotides and filling of gaps by means of the Klenow
fragment of DNA polymerase and ligation reactions as well as
general cloning techniques are described in Sambrook et al. (1989),
see below.
[0071] Sequence identity between the nucleic acid or protein useful
according to the present invention and the RLK1 nucleic acids or
RLK1 proteins may be optimized by sequence comparison and alignment
algorithms known in the art (see Gribskov and Devereux, Sequence
Analysis Primer, Stockton Press, 1991, and references cited
therein) and calculating the percent difference between the
nucleotide or protein sequences by, for example, the SmithWaterman
algorithm as implemented in the BESTFIT software program using
default parameters (e.g., University of Wisconsin Genetic Computing
Group).
[0072] The term "plant" is intended to encompass plants at any
stage of maturity or development, as well as any tissues or organs
(plant parts) taken or derived from any such plant unless otherwise
clearly indicated by context. Plant parts include, but are not
limited to, plant cells, stems, roots, flowers, ovules, stamens,
seeds, leaves, embryos, meristematic regions, callus tissue, anther
cultures, gametophytes, sporophytes, pollen, microspores,
protoplasts, hairy root cultures, and/or the like. The present
invention also includes seeds produced by the plants of the present
invention. Preferably, the seeds comprise the exogenous RLK1
nucleic acids. In one embodiment, the seeds can develop into plants
with increased resistance to fungal infection as compared to a
wild-type variety of the plant seed. As used herein, a "plant cell"
includes, but is not limited to, a protoplast, gamete producing
cell, and a cell that regenerates into a whole plant. Tissue
culture of various tissues of plants and regeneration of plants
therefrom is well known in the art and is widely published.
[0073] Reference herein to an "endogenous" nucleic acid and/or
protein refers to the nucleic acid and/or protein in question as
found in a plant in its natural form (i.e., without there being any
human intervention).
[0074] The term "exogenous" nucleic acid refers to a nucleic acid
that has been introduced in a plant by means of genetechnology. An
"exogenous" nucleic acid can either not occur in a plant in its
natural form, be different from the nucleic acid in question as
found in a plant in its natural form, or can be identical to a
nucleic acid found in a plant in its natural form, but integrated
not within their natural genetic environment. The corresponding
meaning of "exogenous" is applied in the context of protein
expression. For example, a transgenic plant containing a transgene,
i.e., an exogenous nucleic acid, may, when compared to the
expression of the endogenous gene, encounter a substantial increase
of the expression of the respective gene or protein in total. A
transgenic plant according to the present invention includes an
exogenous RLK1 nucleic acid integrated at any genetic loci and
optionally the plant may also include the endogenous gene within
the natural genetic background.
[0075] For the purposes of the invention, "recombinant" means with
regard to, for example, a nucleic acid sequence, a nucleic acid
molecule, an expression cassette or a vector construct comprising
any one or more RLK1 nucleic acids, all those constructions brought
about by man by genetechnological methods in which either [0076]
(a) the sequences of the RLK1 nucleic acids or a part thereof, or
[0077] (b) genetic control sequence(s) which is operably linked
with the RLK1 nucleic acid sequence according to the invention, for
example a promoter, or [0078] (c) a) and b) are not located in
their natural genetic environment or have been modified by man by
genetechnological methods. The modification may take the form of,
for example, a substitution, addition, deletion, inversion or
insertion of one or more nucleotide residues. The natural genetic
environment is understood as meaning the natural genomic or
chromosomal locus in the original plant or the presence in a
genomic library or the combination with the natural promoter.
[0079] A recombinant nucleic acid, expression cassette or vector
construct preferably comprises a natural gene and a natural
promoter, a natural gene and a non-natural promoter, a non-natural
gene and a natural promoter, or a non-natural gene and a
non-natural promoter.
[0080] In the case of a genomic library, the natural genetic
environment of the nucleic acid sequence is preferably retained, at
least in part. The environment flanks the nucleic acid sequence at
least on one side and has a sequence length of at least 50 bp,
preferably at least 500 bp, especially preferably at least 1000 bp,
most preferably at least 5000 bp.
[0081] A naturally occurring expression cassette--for example the
naturally occurring combination of the natural promoter of the
nucleic acid sequences with the corresponding nucleic acid sequence
encoding a protein useful in the methods of the present invention,
as defined above--becomes a recombinant expression cassette when
this expression cassette is modified by man by non-natural,
synthetic ("artificial") methods such as, for example, mutagenic
treatment. Suitable methods are described, for example, in U.S.
Pat. No. 5,565,350, WO 00/15815 or US200405323. Furthermore, a
naturally occurring expression cassette--for example the naturally
occurring combination of the natural promoter of the nucleic acid
sequences with the corresponding nucleic acid sequence encoding a
protein useful in the methods of the present invention, as defined
above--becomes a recombinant expression cassette when this
expression cassette is not integrated in the natural genetic
environment but in a different genetic environment.
[0082] The term "isolated nucleic acid" or "isolated protein"
refers to a nucleic acid or protein that is not located in its
natural environment, in particular its natural cellular
environment. Thus, an isolated nucleic acid or isolated protein is
essentially separated from other components of its natural
environment. However, the skilled person in the art is aware that
preparations of an isolated nucleic acid or an isolated protein can
display a certain degree of impurity depending on the isolation
procedure used. Methods for purifying nucleic acids and proteins
are well known in the art. The isolated gene may be isolated from
an organism or may be manmade, for example by chemical synthesis.
In this regard, a recombinant nucleic acid may also be in an
isolated form.
[0083] As used herein, the term "transgenic" refers to an organism,
e.g., a plant, plant cell, callus, plant tissue, or plant part that
exogenously contains the nucleic acid, recombinant construct,
vector or expression cassette described herein or a part thereof
which is preferably introduced by non-essentially biological
processes, preferably by Agrobacteria transformation. The
recombinant construct or a part thereof is stably integrated into a
chromosome, so that it is passed on to successive generations by
clonal propagation, vegetative propagation or sexual propagation.
Preferred successive generations are transgenic too. Essentially
biological processes may be crossing of plants and/or natural
recombination.
[0084] A transgenic plant, plants cell or tissue for the purposes
of the invention is thus understood as meaning that an exogenous
RLK1 nucleic acid, recombinant construct, vector or expression
cassette including one or more RLK1 nucleic acids is integrated
into the genome by means of genetechnology.
[0085] Preferably, constructs or vectors or expression cassettes
are not present in the genome of the original plant or are present
in the genome of the transgenic plant not at their natural locus of
the genome of the original plant.
[0086] A "wild type" plant, "wild type" plant part, or "wild type"
plant cell means that said plant, plant part, or plant cell does
not express exogenous RLK1 nucleic acid or exogenous RLK1
protein.
[0087] Natural locus means the location on a specific chromosome,
preferably the location between certain genes, more preferably the
same sequence background as in the original plant which is
transformed.
[0088] Preferably, the transgenic plant, plant cell or tissue
thereof expresses the RLK1 nucleic acids, RLK1 constructs or RLK1
expression cassettes described herein.
[0089] The term "expression" or "gene expression" means the
transcription of a specific gene or specific genes or specific
genetic vector construct. The term "expression" or "gene
expression" in particular means the transcription of a gene or
genes or genetic vector construct into structural RNA (rRNA, tRNA),
or mRNA with or without subsequent translation of the latter into a
protein. The process includes transcription of DNA and processing
of the resulting RNA product. The term "expression" or "gene
expression" can also include the translation of the mRNA and
therewith the synthesis of the encoded protein, i.e., protein
expression.
[0090] The term "increased expression" or "enhanced expression" or
"overexpression" or "increase of content" as used herein means any
form of expression that is additional to the original wild-type
expression level. For the purposes of this invention, the original
wild-type expression level might also be zero (absence of
expression).
[0091] Methods for increasing expression of genes or gene products
are well documented in the art and include, for example,
overexpression driven by appropriate promoters, the use of
transcription enhancers or translation enhancers. Isolated nucleic
acids which serve as promoter or enhancer elements may be
introduced in an appropriate position (typically upstream) of a
non-heterologous form of a polynucleotide so as to upregulate
expression of a nucleic acid encoding the protein of interest. For
example, endogenous promoters may be altered in vivo by mutation,
deletion, and/or substitution (see, Kmiec, U.S. Pat. No. 5,565,350;
Zarling et al., WO9322443), or isolated promoters may be introduced
into a plant cell in the proper orientation and distance from a
gene of the present invention so as to control the expression of
the gene.
[0092] If protein expression is desired, it is generally desirable
to include a polyadenylation region at the 3'-end of a
polynucleotide coding region. The polyadenylation region can be
derived from the natural gene, from a variety of other plant genes,
or from T-DNA. The 3' end sequence to be added may be derived from,
for example, the nopaline synthase or octopine synthase genes, or
alternatively from another plant gene, or less preferably from any
other eukaryotic gene.
[0093] An intron sequence may also be added to the 5' untranslated
region (UTR) and/or the coding sequence of the partial coding
sequence to increase the amount of the mature message that
accumulates in the cytosol. Inclusion of a spliceable intron in the
transcription unit in both plant and animal expression constructs
has been shown to increase gene expression at both the mRNA and
protein levels up to 1000-fold (Buchman and Berg (1988) Mol. Cell.
biol. 8: 4395-4405; Callis et al. (1987) Genes Dev 1:1183-1200).
Such intron enhancement of gene expression is typically greatest
when placed near the 5' end of the transcription unit. Use of the
maize introns Adh1-S intron 1, 2, and 6, the Bronze-1 intron are
known in the art. For general information see: The Maize Handbook,
Chapter 116, Freeling and Walbot, Eds., Springer, N.Y. (1994).
[0094] The term "functional fragment" refers to any nucleic acid or
protein which comprises merely a part of the fulllength nucleic
acid or fulllength protein, respectively, but still provides the
same function, e.g., fungal resistance, when expressed or repressed
in a plant, respectively. Preferably, the fragment comprises at
least 50%, at least 60%, at least 70%, at least 80%, at least 90%
at least 95%, at least 98%, at least 99% of the original sequence.
Preferably, the functional fragment comprises contiguous nucleic
acids or amino acids as in the original nucleic acid or original
protein, respectively. In one embodiment the fragment of any of the
RLK1 nucleic acids has an identity as defined above over a length
of at least 20%, at least 30%, at least 50%, at least 75%, at least
90% of the nucleotides of the respective RLK1 nucleic acid.
[0095] The term "splice variant" as used herein encompasses
variants of a nucleic acid sequence in which selected introns
and/or exons have been excised, replaced, displaced or added, or in
which introns have been shortened or lengthened. Thus, a splice
variant can have one or more or even all introns removed or added.
According to this definition, a cDNA is considered as a splice
variant of the respective intron-containing genomic sequence and
vice versa. Such splice variants may be found in nature or may be
manmade. Methods for predicting and isolating such splice variants
are well known in the art (see for example Foissac and Schiex
(2005) BMC Bioinformatics 6: 25).
[0096] In cases where overexpression of nucleic acid is desired,
the term "similar functional activity" or "similar function" means
that any homologue and/or fragment provide fungal resistance when
expressed in a plant. Preferably similar functional activity means
at least 50%, at least 60%, at least 70%, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% or 100% or higher
fungal resistance compared with functional activity provided by the
exogenous expression of the RLK1 nucleotide sequence as defined by
SEQ ID NO: 1 or the RLK1 protein sequence as defined by SEQ ID NO:
2.
[0097] The term "increased activity" or "enhanced activity" as used
herein means any protein having increased activity and which
provides an increased fungal resistance compared with the wildtype
plant merely expressing the respective endogenous RLK1 nucleic
acid. As far as overexpression is concerned, for the purposes of
this invention, the original wild-type expression level might also
be zero (absence of expression).
[0098] With respect to a vector construct and/or the recombinant
nucleic acid molecules, the term "operatively linked" is intended
to mean that the nucleic acid to be expressed is linked to the
regulatory sequence, including promoters, terminators, enhancers
and/or other expression control elements (e.g., polyadenylation
signals), in a manner which allows for expression of the nucleic
acid (e.g., in a host plant cell when the vector is introduced into
the host plant cell). Such regulatory sequences are described, for
example, in Goeddel, Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990) and Gruber
and Crosby, in: Methods in Plant Molecular Biology and
Biotechnology, Eds. Glick and Thompson, Chapter 7, 89-108, CRC
Press: Boca Raton, Fla., including the references therein.
Regulatory sequences include those that direct constitutive
expression of a nucleotide sequence in many types of host cells and
those that direct expression of the nucleotide sequence only in
certain host cells or under certain conditions. It will be
appreciated by those skilled in the art that the design of the
vector can depend on such factors as the choice of the host cell to
be transformed, the level of expression of nucleic acid desired,
and the like.
[0099] The term "introduction" or "transformation" as referred to
herein encompass the transfer of an exogenous polynucleotide into a
host cell, irrespective of the method used for transfer. Plant
tissue capable of subsequent clonal propagation, whether by
organogenesis or embryogenesis, may be transformed with a vector
construct of the present invention and a whole plant regenerated
there from. The particular tissue chosen will vary depending on the
clonal propagation systems available for, and best suited to, the
particular species being transformed. Exemplary tissue targets
include leaf disks, pollen, embryos, cotyledons, hypocotyls,
megagametophytes, callus tissue, existing meristematic tissue
(e.g., apical meristem, axillary buds, and root meristems), and
induced meristem tissue (e.g., cotyledon meristem and hypocotyl
meristem). The polynucleotide may be transiently or stably
introduced into a host cell and may be maintained non-integrated,
for example, as a plasmid. Alternatively, it may be integrated into
the host genome. The host genome includes the nucleic acid
contained in the nucleus as well as the nucleic acid contained in
the plastids, e.g., chloroplasts, and/or mitochondria. The
resulting transformed plant cell may then be used to regenerate a
transformed plant in a manner known to persons skilled in the
art.
[0100] The term "terminator" encompasses a control sequence which
is a DNA sequence at the end of a transcriptional unit which
signals 3' processing and polyadenylation of a primary transcript
and termination of transcription. The terminator can be derived
from the natural gene, from a variety of other plant genes, or from
T-DNA. The terminator to be added may be derived from, for example,
the nopaline synthase or octopine synthase genes, or alternatively
from another plant gene, or less preferably from any other
eukaryotic gene.
DETAILED DESCRIPTION
RLK1 Nucleic Acids
[0101] The RLK1 nucleic acid to be overexpressed in order to
achieve increased resistance to fungal pathogens, e.g., of the
family Phacopsoraceae, for example soybean rust, is preferably a
nucleic acid coding for an RLK1 protein, and is preferably as
defined by SEQ ID NO: 9, 1, or 3, or a fragment, homolog,
derivative, orthologue or paralogue thereof, or a splice variant
thereof. Preferably, the nucleic acid coding for an RLK1 protein of
the present invention has at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 9, 1, or 3, or is a functional
fragment thereof, or a splice variant thereof. Most preferred is at
least 90% identity, at least 95% identity, more preferred is at
least 98% or at least 99% identity with SEQ ID NO: 9, 1, or 3.
[0102] Preferably, the RLK1 nucleic acid to be overexpressed in
order to achieve increased resistance to fungal pathogens, e.g., of
the family Phacopsoraceae, for example soybean rust, is preferably
a nucleic acid coding for a RLK1 protein, and is preferably as
defined by SEQ ID NO: 3, or a fragment, homolog, derivative,
orthologue or paralogue thereof, or a splice variant thereof.
Preferably, the nucleic acid coding for a RLK1 protein of the
present invention has at least 60% identity, preferably at least
70% sequence identity, at least 80%, at least 90%, at least 95%, at
least 98%, at least 99% sequence identity, or even 100% sequence
identity with SEQ ID NO: 3 or is a functional fragment thereof, or
a splice variant thereof. Most preferred is at least 90% identity,
at least 95% identity, more preferred is at least 98% or at least
99% identity with SEQ ID NO: 3.
[0103] More preferably, the RLK1 nucleic acid to be overexpressed
in order to achieve increased resistance to fungal pathogens, e.g.,
of the family Phacopsoraceae, for example soybean rust, is
preferably a nucleic acid coding for a RLK1 protein, and is
preferably as defined by SEQ ID NO: 1, or a fragment, homolog,
derivative, orthologue or paralogue thereof, or a splice variant
thereof. Preferably, the nucleic acid coding for a RLK1 protein of
the present invention has at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 1 or is a functional fragment
thereof, or a splice variant thereof. Most preferred is at least
95% identity, more preferred is at least 98% or at least 99%
identity with SEQ ID NO: 1.
[0104] More preferably, the RLK1 nucleic acid to be overexpressed
in order to achieve increased resistance to fungal pathogens, e.g.,
of the family Phacopsoraceae, for example soybean rust, is
preferably a nucleic acid coding for a RLK1 protein, and is
preferably as defined by SEQ ID NO: 9, or a fragment, homolog,
derivative, orthologue or paralogue thereof, or a splice variant
thereof. Preferably, the nucleic acid coding for a RLK1 protein of
the present invention has at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 9 or is a functional fragment
thereof, or a splice variant thereof. Most preferred is at least
95% identity, more preferred is at least 98% or at least 99%
identity with SEQ ID NO: 9.
[0105] SEQ ID NO: 9 corresponds to SEQ ID NO: 1, wherein in SEQ ID
NO: 9 a couple of nucleotides have been exchanged.
[0106] More preferably, the RLK1 nucleic acid to be overexpressed
in order to achieve increased resistance to fungal pathogens, e.g.,
of the family Phacopsoraceae, for example soybean rust, is
preferably a nucleic acid coding for a RLK1 protein, and is
preferably as defined by SEQ ID NO: 8, or a fragment, homolog,
derivative, orthologue or paralogue thereof, or a splice variant
thereof. Preferably, the nucleic acid coding for a RLK1 protein of
the present invention has at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 8 or is a functional fragment
thereof, or a splice variant thereof. Most preferred is at least
95% identity, more preferred is at least 98% or at least 99%
identity with SEQ ID NO: 8.
[0107] Preferably the RLK1 nucleic acid is an isolated nucleic acid
molecule consisting of or comprising a nucleic acid selected from
the group consisting of: [0108] (i) a nucleic acid having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the nucleic acid sequence represented
by SEQ ID NO: 9, 1, 3, or 8, or a functional fragment, derivative,
orthologue, or paralogue thereof, or a splice variant thereof;
[0109] (ii) a nucleic acid encoding a RLK1 protein having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the amino acid sequence represented by
SEQ ID NO: 2, or a functional fragment, derivative, orthologue, or
paralogue thereof; preferably the RLK1 protein has essentially the
same biological activity as a RLK1 protein encoded by SEQ ID NO: 9,
1, 3, or 8; preferably the RLK1 protein confers enhanced fungal
resistance relative to control plants; preferably the RLK1 protein
has receptor like kinase activity; [0110] (iii) a nucleic acid
molecule which hybridizes with a complementary sequence of any of
the nucleic acid molecules of (i) or (ii) under high stringency
hybridization conditions; preferably encoding a RLK1 protein;
preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and [0111] (iv) a nucleic acid encoding the same RLK1
protein as the RLK1 nucleic acids of (i) to (ii) above, but
differing from the RLK1 nucleic acids of (i) to (ii) above due to
the degeneracy of the genetic code.
[0112] Preferably, the nucleic acid coding for a RLK1 protein of
the present invention has at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 1. Most preferred is at least 95%
identity, more preferred is at least 98% or at least 99% identity
with SEQ ID NO: 1.
[0113] Preferably, the nucleic acid coding for a RLK1 protein of
the present invention has at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 9. Most preferred is at least 95%
identity, more preferred is at least 98% or at least 99% identity
with SEQ ID NO: 9.
[0114] Preferably the RLK1 nucleic acid is an isolated nucleic acid
molecule consisting of or comprising a nucleic acid selected from
the group consisting of: [0115] (i) a nucleic acid having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the nucleic acid sequence represented
by SEQ ID NO: 1, or a functional fragment, derivative, orthologue,
or paralogue thereof, or a splice variant thereof; [0116] (ii) a
nucleic acid encoding a RLK1 protein having in increasing order of
preference at least 60%, at least 61%, at least 62%, at least 63%,
at least 64%, at least 65%, at least 66%, at least 67%, at least
68%, at least 69%, at least 70%, at least 71%, at least 72%, at
least 73%, at least 74%, at least 75%, at least 76%, at least 77%,
at least 78%, at least 79%, at least 80%, at least 81%, at least
82%, at least 83%, at least 84%, at least 85%, at least 86%, at
least 87%, at least 88%, at least 89%, at least 90%, at least 91%,
at least 92%, at least 93%, at least 94%, at least 95%, at least
96%, at least 97%, at least 98%, at least 99% or 100% sequence
identity to the amino acid sequence represented by SEQ ID NO: 2, or
a functional fragment, derivative, orthologue, or paralogue
thereof; preferably the RLK1 protein has essentially the same
biological activity as a RLK1 protein encoded by SEQ ID NO: 1,
preferably the RLK1 protein confers enhanced fungal resistance
relative to control plants; [0117] (iii) a nucleic acid molecule
which hybridizes with a complementary sequence of any of the
nucleic acid molecules of (i) or (ii) under high stringency
hybridization conditions; preferably encoding a RLK1 protein;
preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and [0118] (iv) a nucleic acid encoding the same RLK1
protein as the RLK1 nucleic acids of (i) to (ii) above, but
differing from the RLK1 nucleic acids of (i) to (ii) above due to
the degeneracy of the genetic code.
[0119] Preferably the RLK1 nucleic acid is an isolated nucleic acid
molecule comprising a nucleic acid selected from the group
consisting of: [0120] (i) a nucleic acid having in increasing order
of preference at least 60%, at least 61%, at least 62%, at least
63%, at least 64%, at least 65%, at least 66%, at least 67%, at
least 68%, at least 69%, at least 70%, at least 71%, at least 72%,
at least 73%, at least 74%, at least 75%, at least 76%, at least
77%, at least 78%, at least 79%, at least 80%, at least 81%, at
least 82%, at least 83%, at least 84%, at least 85%, at least 86%,
at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least 97%, at least 98%, at least 99% or 100%
sequence identity to the nucleic acid sequence represented by SEQ
ID NO: 9, or a functional fragment, derivative, orthologue, or
paralogue thereof, or a splice variant thereof; [0121] (ii) a
nucleic acid encoding a RLK1 protein having in increasing order of
preference at least 60%, at least 61%, at least 62%, at least 63%,
at least 64%, at least 65%, at least 66%, at least 67%, at least
68%, at least 69%, at least 70%, at least 71%, at least 72%, at
least 73%, at least 74%, at least 75%, at least 76%, at least 77%,
at least 78%, at least 79%, at least 80%, at least 81%, at least
82%, at least 83%, at least 84%, at least 85%, at least 86%, at
least 87%, at least 88%, at least 89%, at least 90%, at least 91%,
at least 92%, at least 93%, at least 94%, at least 95%, at least
96%, at least 97%, at least 98%, at least 99% or 100% sequence
identity to the amino acid sequence represented by SEQ ID NO: 10,
or a functional fragment, derivative, orthologue, or paralogue
thereof; preferably the RLK1 protein has essentially the same
biological activity as a RLK1 protein encoded by SEQ ID NO: 9 or 1,
preferably the RLK1 protein confers enhanced fungal resistance
relative to control plants; [0122] (iii) a nucleic acid molecule
which hybridizes with a complementary sequence of any of the
nucleic acid molecules of (i) or (ii) under high stringency
hybridization conditions; preferably encoding a RLK1 protein;
preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and [0123] (iv) a nucleic acid encoding the same RLK1
protein as the RLK1 nucleic acids of (i) to (ii) above, but
differing from the RLK1 nucleic acids of (i) to (ii) above due to
the degeneracy of the genetic code.
[0124] Percentages of identity of a nucleic acid are indicated with
reference to the entire nucleotide region given in a sequence
specifically disclosed herein.
[0125] Preferably the portion of the RLK1 nucleic acid is about
1500-1600, about 1600-1700, about 1700-1800, about 1800-1900, about
1900-1995, about 1900-2000, about 2000-2200, about 2200-2400, about
2400-2600, about 2600-2800, about 2800-3000, about 3000-3200, about
3200-3400, about 3400-3600, about 3600-3800, about 3800-4000, about
4000-4200, about 4200-4400, or about 4400-4622 nucleotides,
preferably consecutive nucleotides, preferably counted from the 5'
or 3' end of the nucleic acid, in length, of the nucleic acid
sequences given in SEQ ID NO: 1 or 3.
[0126] Preferably, the RLK1 nucleic acid comprises at least about
1500, at least about 1600, at least about 1700, at least about
1800, at least about 1900, at least about 2000, at least about
2200, at least about 2400, at least about 2600, at least about
2800, at least about 3000, at least about 3200, at least about
3400, at least about 3600, at least about 3800, at least about
4000, at least about 4200, at least about 4400, or at least about
4600 nucleotides, preferably continuous nucleotides, preferably
counted from the 5' or 3' end of the nucleic acid or up to the full
length of the nucleic acid sequence set out in SEQ ID NO: 1 or
3.
[0127] Preferably, the RLK1 nucleic acid comprises at least about
1000, at least about 1200, at least about 1400, at least about
1600, at least about 1800, at least about 1900 nucleotides,
preferably continuous nucleotides, preferably counted from the 5'
or 3' end of the nucleic acid or up to the full length of the
nucleic acid sequence set out in SEQ ID NO: 1.
[0128] Preferably the portion of the RLK1 nucleic acid is about
1000-1100, about 1100-1200, about 1200-1300, about 1300-1400, about
1400-1500, about 1500-1600, about 1600-1700, about 1700-1800, about
1800-1995 nucleotides, preferably consecutive nucleotides,
preferably counted from the 5' or 3' end of the nucleic acid, in
length, of the nucleic acid sequences given in SEQ ID NO: 1.
[0129] Preferably, the RLK1 nucleic acid comprises at least about
1000, at least about 1200, at least about 1400, at least about
1600, at least about 1800, at least about 1900 nucleotides,
preferably continuous nucleotides, preferably counted from the 5'
or 3' end of the nucleic acid or up to the full length of the
nucleic acid sequence set out in SEQ ID NO: 9.
[0130] Preferably the portion of the RLK1 nucleic acid is about
1000-1100, about 1100-1200, about 1200-1300, about 1300-1400, about
1400-1500, about 1500-1600, about 1600-1700, about 1700-1800, about
1800-1995 nucleotides, preferably consecutive nucleotides,
preferably counted from the 5' or 3' end of the nucleic acid, in
length, of the nucleic acid sequences given in SEQ ID NO: 9.
[0131] Preferably, the RLK1 nucleic acid is a RLK1 nucleic acid
splice variant. Preferred splice variants are splice variants of a
nucleic acid represented by SEQ ID NO: 3. Preferred RLK1 nucleic
acids being a splice variant of SEQ ID NO: 3 are shown in FIG.
6.
[0132] Preferably, the RLK1 nucleic acid is an isolated nucleic
acid molecule comprising a splice variant of SEQ ID NO: 3, wherein
the splice variant is selected from the group consisting of: [0133]
(i) a nucleic acid having in increasing order of preference at
least 60%, at least 61%, at least 62%, at least 63%, at least 64%,
at least 65%, at least 66%, at least 67%, at least 68%, at least
69%, at least 70%, at least 71%, at least 72%, at least 73%, at
least 74%, at least 75%, at least 76%, at least 77%, at least 78%,
at least 79%, at least 80%, at least 81%, at least 82%, at least
83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least 89%, at least 90%, at least 91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least
97%, at least 98%, at least 99% or 100% sequence identity to the
nucleic acid sequence represented by SEQ ID NO: 9 or 1, or a
functional fragment, derivative, orthologue, or paralogue thereof;
[0134] (ii) a nucleic acid encoding a RLK1 protein having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the amino acid sequence represented by
SEQ ID NO: 10 or 2, or a functional fragment, derivative,
orthologue, or paralogue thereof; preferably the RLK1 protein has
essentially the same biological activity as a RLK1 protein encoded
by SEQ ID NO: 9, 1 or 3; preferably the RLK1 protein confers
enhanced fungal resistance relative to control plants; [0135] (iii)
a nucleic acid molecule which hybridizes with a complementary
sequence of any of the nucleic acid molecules of (i) or (ii) under
high stringency hybridization conditions; preferably encoding a
RLK1 protein; preferably wherein the nucleic acid molecule codes
for a polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and [0136] (iv) a nucleic acid encoding the same RLK1
protein as the RLK1 nucleic acids of (i) to (ii) above, but
differing from the RLK1 nucleic acids of (i) to (ii) above due to
the degeneracy of the genetic code.
[0137] Preferred splice variants of SEQ ID NO: 3 consist of or
comprise the nucleotide sequence shown in SEQ ID NO: 1.
[0138] Preferred splice variants of SEQ ID NO: 3 consist of or
comprise the nucleotide sequence shown in SEQ ID NO: 9.
[0139] Preferably the RLK1 nucleic acid is an isolated nucleic acid
molecule comprising a nucleic acid selected from the group
consisting of: [0140] (i) a nucleic acid having in increasing order
of preference at least 60%, at least 61%, at least 62%, at least
63%, at least 64%, at least 65%, at least 66%, at least 67%, at
least 68%, at least 69%, at least 70%, at least 71%, at least 72%,
at least 73%, at least 74%, at least 75%, at least 76%, at least
77%, at least 78%, at least 79%, at least 80%, at least 81%, at
least 82%, at least 83%, at least 84%, at least 85%, at least 86%,
at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least 97%, at least 98%, at least 99% or 100%
sequence identity to the nucleic acid sequence represented by SEQ
ID NO: 3, or a splice variant thereof; [0141] (ii) a nucleic acid
molecule which hybridizes with a complementary sequence of any of
the nucleic acid molecules of (i) under high stringency
hybridization conditions; preferably encoding a RLK1 protein;
preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; [0142] (iii) a nucleic acid encoding the same RLK1 protein
as the RLK1 nucleic acids of (i) to (ii) above, but differing from
the RLK1 nucleic acids of (i) to (ii) above due to the degeneracy
of the genetic code; wherein the splice variant is selected from
the group consisting of: [0143] (i) a nucleic acid having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the nucleic acid sequence represented
by SEQ ID NO: 1, or a functional fragment, derivative, orthologue,
or paralogue thereof; [0144] (ii) a nucleic acid encoding a RLK1
protein having in increasing order of preference at least 60%, at
least 61%, at least 62%, at least 63%, at least 64%, at least 65%,
at least 66%, at least 67%, at least 68%, at least 69%, at least
70%, at least 71%, at least 72%, at least 73%, at least 74%, at
least 75%, at least 76%, at least 77%, at least 78%, at least 79%,
at least 80%, at least 81%, at least 82%, at least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at
least 89%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99% or 100% sequence identity to the amino acid
sequence represented by SEQ ID NO: 2, or a functional fragment,
derivative, orthologue, or paralogue thereof; preferably the RLK1
protein has essentially the same biological activity as a RLK1
protein encoded by SEQ ID NO: 1 or 3; preferably the RLK1 protein
confers enhanced fungal resistance relative to control plants;
[0145] (iii) a nucleic acid molecule which hybridizes with a
complementary sequence of any of the nucleic acid molecules of (i)
or (ii) under high stringency hybridization conditions; preferably
encoding a RLK1 protein; preferably wherein the nucleic acid
molecule codes for a polypeptide which has essentially identical
properties to the polypeptide described in SEQ ID NO: 10 or 2;
preferably the encoded protein confers enhanced fungal resistance
relative to control plants; and [0146] (iv) a nucleic acid encoding
the same RLK1 protein as the RLK1 nucleic acids of (i) to (ii)
above, but differing from the RLK1 nucleic acids of (i) to (ii)
above due to the degeneracy of the genetic code.
[0147] More preferably the RLK1 nucleic acid is an isolated nucleic
acid molecule comprising a nucleic acid selected from the group
consisting of:
a nucleic acid having in increasing order of preference least 80%,
at least 81%, at least 82%, at least 83%, at least 84%, at least
85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least 91%, at least 92%, at least 93%, at least 94%,
at least 95%, at least 96%, at least 97%, at least 98%, at least
99% or 100% sequence identity to the nucleic acid sequence
represented by SEQ ID NO: 3, or a splice variant thereof; wherein
the splice variant thereof has in increasing order of preference at
least 80%, at least 81%, at least 82%, at least 83%, at least 84%,
at least 85%, at least 86%, at least 87%, at least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
at least 99% or 100% sequence identity to the nucleic acid sequence
represented by SEQ ID NO: 1.
[0148] More preferably the RLK1 nucleic acid is an isolated nucleic
acid molecule comprising a nucleic acid selected from the group
consisting of:
a nucleic acid having in increasing order of preference least 80%,
at least 81%, at least 82%, at least 83%, at least 84%, at least
85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least 91%, at least 92%, at least 93%, at least 94%,
at least 95%, at least 96%, at least 97%, at least 98%, at least
99% or 100% sequence identity to the nucleic acid sequence
represented by SEQ ID NO: 3, or a splice variant thereof; wherein
the splice variant thereof has in increasing order of preference at
least 80%, at least 81%, at least 82%, at least 83%, at least 84%,
at least 85%, at least 86%, at least 87%, at least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
at least 99% or 100% sequence identity to the nucleic acid sequence
represented by SEQ ID NO: 9.
[0149] The RLK1 nucleic acids described herein are useful in the
constructs, methods, plants, harvestable parts and products of the
invention.
RLK1 Proteins
[0150] The RLK1 protein is preferably defined by SEQ ID NO: 10 or
2, or a fragment, homolog, derivative, orthologue or paralogue
thereof. Preferably, the RLK1 protein of the present invention is
encoded by a nucleic acid, which has at least 60% identity,
preferably at least 70% sequence identity, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% sequence identity, or
even 100% sequence identity with SEQ ID NO: 10 or 2 or a functional
fragment thereof. More preferably, the RLK1 protein of the present
invention has at least 60%, preferably at least 70% sequence
identity, at least 80%, at least 90%, at least 95%, at least 98%,
at least 99% sequence identity, or even 100% sequence identity with
SEQ ID NO: 10 or 2, or is a functional fragment thereof, an
orthologue or a paralogue thereof. Most preferred is at least 90%
identity, least 95% identity, more preferred is at least 98% or at
least 99% identity with SEQ ID NO: 10 or 2.
[0151] Preferably, the RLK1 protein is a protein consisting of or
comprising an amino acid sequence selected from the group
consisting of: [0152] (i) an amino acid sequence having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the amino acid sequence represented by
SEQ ID NO: 10 or 2, or a functional fragment, derivative,
orthologue, or paralogue thereof; preferably the RLK1 protein has
essentially the same biological activity as a RLK1 protein encoded
by SEQ ID NO: 9, 1, or 3; preferably the RLK1 protein confers
enhanced fungal resistance relative to control plants; preferably
the RLK1 protein has receptor like kinase activity; or [0153] (ii)
an amino acid sequence encoded by a nucleic acid having in
increasing order of preference at least 60%, at least 61%, at least
62%, at least 63%, at least 64%, at least 65%, at least 66%, at
least 67%, at least 68%, at least 69%, at least 70%, at least 71%,
at least 72%, at least 73%, at least 74%, at least 75%, at least
76%, at least 77%, at least 78%, at least 79%, at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the nucleic acid sequence represented
by SEQ ID NO: 9, 1, or 3, or a functional fragment, derivative,
orthologue, or paralogue thereof, or a splice variant thereof;
preferably the RLK1 protein confers enhanced fungal resistance
relative to control plants; preferably the RLK2 protein has
receptor like kinase activity.
[0154] Preferably, the RLK1 protein is a protein comprising an
amino acid sequence selected from the group consisting of: [0155]
(i) an amino acid sequence having in increasing order of preference
at least 80%, at least 81%, at least 82%, at least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at
least 89%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99% or 100% sequence identity to the amino acid
sequence represented by SEQ ID NO: 10 or 2, or a functional
fragment, derivative, orthologue, or paralogue thereof; preferably
the RLK1 protein has essentially the same biological activity as a
RLK1 protein encoded by SEQ ID NO: 9, 1, or 3; preferably the RLK1
protein confers enhanced fungal resistance relative to control
plants; or [0156] (ii) an amino acid sequence encoded by a nucleic
acid having in increasing order of preference at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the nucleic acid sequence represented
by SEQ ID NO: 1, or a functional fragment, derivative, orthologue,
or paralogue thereof, or a splice variant thereof; preferably the
RLK1 protein confers enhanced fungal resistance relative to control
plants.
[0157] Preferably, the RLK1 protein is a protein comprising an
amino acid sequence selected from the group consisting of: [0158]
(i) an amino acid sequence having in increasing order of preference
at least 80%, at least 81%, at least 82%, at least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at
least 89%, at least 90%, at least 91%, at least 92%, at least 93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99% or 100% sequence identity to the amino acid
sequence represented by SEQ ID NO: 10, or a functional fragment,
derivative, orthologue, or paralogue thereof; preferably the RLK1
protein has essentially the same biological activity as a RLK1
protein encoded by SEQ ID NO: 9, 1, or 3; preferably the RLK1
protein confers enhanced fungal resistance relative to control
plants; or [0159] (ii) an amino acid sequence encoded by a nucleic
acid having in increasing order of preference at least 80%, at
least 81%, at least 82%, at least 83%, at least 84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%
or 100% sequence identity to the nucleic acid sequence represented
by SEQ ID NO: 9, or a functional fragment, derivative, orthologue,
or paralogue thereof, or a splice variant thereof; preferably the
RLK1 protein confers enhanced fungal resistance relative to control
plants.
[0160] SEQ ID NO: 10 corresponds to SEQ ID NO: 2, wherein in SEQ ID
NO: 10 a couple of amino acid residues have been exchanged.
[0161] A preferred derivative of a RLK1 protein is a RLK1 protein
consisting of or comprising an amino acid sequence selected from
the group consisting of:
an amino acid sequence having in increasing order of preference at
least 60%, at least 61%, at least 62%, at least 63%, at least 64%,
at least 65%, at least 66%, at least 67%, at least 68%, at least
69%, at least 70%, at least 71%, at least 72%, at least 73%, at
least 74%, at least 75%, at least 76%, at least 77%, at least 78%,
at least 79%, at least 80%, at least 81%, at least 82%, at least
83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least 89%, at least 90%, at least 91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least
97%, at least 98%, or at least 99% sequence identity to the amino
acid sequence represented by SEQ ID NO: 10 or 2, wherein the
non-identical amino acid residues are conservative amino acid
substitutions, preferably as shown in Table 1, of the corresponding
amino acid residue of SEQ ID NO: 10 or 2; preferably the RLK1
protein has essentially the same biological activity as SEQ ID NO:
10 or 2 or as a RLK1 protein encoded by SEQ ID NO: 9, 1, or 3;
preferably the RLK1 protein confers enhanced fungal resistance
relative to control plants.
[0162] Preferably, the RLK1 protein consists of or comprises an
amino acid sequence represented by SEQ ID NO: 2 with one or more
conservative amino acid substitutions, preferably as shown in Table
1, of the corresponding amino acid residues of SEQ ID NO: 2.
Preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 1-10,
10-20, 20-30, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110,
110-120, or 120-130 amino acid residues of SEQ ID NO: 2 are
conservative amino acid substitutions, preferably as shown in Table
1, of the corresponding amino acid residue of SEQ ID NO: 2.
[0163] Preferably, the RLK1 protein consists of or comprises an
amino acid sequence represented by SEQ ID NO: 10 with one or more
conservative amino acid substitutions, preferably as shown in Table
1, of the corresponding amino acid residues of SEQ ID NO: 10.
Preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 1-10,
10-20, 20-30, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110,
110-120, or 120-130 amino acid residues of SEQ ID NO: 10 are
conservative amino acid substitutions, preferably as shown in Table
1, of the corresponding amino acid residue of SEQ ID NO: 10.
[0164] More preferably, the RLK1 protein consists of or comprises
an amino acid sequence having at least 80%, at least 85%, at least
90%, at least 95%, at least 98% or at least 99% sequence identity
with an amino acid sequence as represented by SEQ ID NO: 10 or 2,
wherein at least 1, at least 2, at least 3, at least 4, at least 5,
at least 6, at least 7, at least 8, at least 9, at least 10, at
least 11, at least 12, at least 13, at least 14, at least 15, at
least 16, at least 17, at least 18, at least 19, at least 20, at
least 21, at least 22, at least 23, at least 24, at least 25, at
least 26, at least 27, at least 28, at least 29, or at least 30 of
the non-identical amino acid residues, or wherein 1-10, 10-20,
20-30, 40-50, 50-60, 60-70, 70-80, 80-90 or 90-100 or even all of
the non-identical amino acid residues are conservative amino acid
substitutions, preferably as shown in Table 1, of the corresponding
amino acid residue of SEQ ID NO: 10 or 2.
[0165] Percentages of identity of a polypeptide or protein are
indicated with reference to the entire amino acid sequence
specifically disclosed herein.
[0166] Preferably, the RLK1 protein comprises at least about 450,
at least about 500, at least about 520, at least about 540, at
least about 560, at least about 580, at least about 590, at least
about 600, at least about 610, at least about 620, at least about
630, at least about 640, at least about 650, or at least about 660
amino acid residues, preferably continuous amino acid residues,
preferably counted from the N-terminus or the C-terminus of the
amino acid sequence, or up to the full length of the amino acid
sequence set out in SEQ ID NO: 2.
[0167] Preferably, the RLK1 polypeptide comprises about 300-400,
about 400-500, about 500-520, about 520-540, about 540-560, about
560-580, about 580-590, about 590-600, about 600-610, about
610-620, about 620-630, about 630-640, about 640-650, or about
650-664 amino acids, preferably consecutive amino acids, preferably
counted from the N-terminus or C-terminus of the amino acid
sequence, or up to the full length of any of the amino acid
sequences encoded by the nucleic acid sequences set out in SEQ ID
NO: 2.
[0168] Preferably, the RLK1 protein comprises at least about 450,
at least about 500, at least about 520, at least about 540, at
least about 560, at least about 580, at least about 590, at least
about 600, at least about 610, at least about 620, at least about
630, at least about 640, at least about 650, or at least about 660
amino acid residues, preferably continuous amino acid residues,
preferably counted from the N-terminus or the C-terminus of the
amino acid sequence, or up to the full length of the amino acid
sequence set out in SEQ ID NO: 10.
[0169] Preferably, the RLK1 polypeptide comprises about 300-400,
about 400-500, about 500-520, about 520-540, about 540-560, about
560-580, about 580-590, about 590-600, about 600-610, about
610-620, about 620-630, about 630-640, about 640-650, or about
650-664 amino acids, preferably consecutive amino acids, preferably
counted from the N-terminus or C-terminus of the amino acid
sequence, or up to the full length of any of the amino acid
sequences encoded by the nucleic acid sequences set out in SEQ ID
NO: 10.
[0170] The RLK1 proteins described herein are useful in the
constructs, methods, plants, harvestable parts and products of the
invention.
Methods for Increasing Fungal Resistance; Methods for Modulating
Gene Expression
[0171] One embodiment of the invention is a method for increasing
fungal resistance, preferably resistance to Phacopsoracea, for
example soy bean rust, in a plant, plant part, or plant cell by
increasing the expression of an RLK1 protein or a functional
fragment, orthologue, paralogue or homologue thereof in comparison
to wild-type plants, wild-type plant parts or wild-type plant
cells.
[0172] The present invention also provides a method for increasing
resistance to fungal pathogens, in particular fungal pathogens of
the family Phacopsoraceae, preferably against fungal pathogens of
the genus Phacopsora, most preferably against Phakopsora pachyrhizi
and Phakopsora meibomiae, also known as soy bean rust in plants or
plant cells, wherein in comparison to wild type plants, wild type
plant parts, or wild type plant cells an RLK1 protein is
overexpressed.
[0173] The present invention further provides a method for
increasing resistance to fungal pathogens of the genus Phacopsora,
most preferably against Phakopsora pachyrhizi and Phakopsora
meibomiae, also known as soy bean rust in plants or plant cells by
overexpression of an RLK1 protein.
[0174] In preferred embodiments, the protein amount and/or function
of the RLK1 protein in the plant is increased by at least 10%, at
least 20%, at least 30%, at least 40%, at least 50%, at least 60%,
at least 70%, at least 80%, at least 90%, or at least 95% or more
in comparison to a wild type plant that is not transformed with the
RLK1 nucleic acid.
[0175] In one embodiment of the invention, the RLK1 protein is
encoded by [0176] (i) an exogenous nucleic acid having at least
60%, preferably at least 70%, for example at least 75%, more
preferably at least 80%, for example at least 85%, even more
preferably at least 90%, for example at least 95% or at least 96%
or at least 97% or at least 98% most preferably 99% identity with
SEQ ID NO: 9, 1, or 3, a functional fragment thereof, or an
orthologue or a paralogue thereof, or a splice variant thereof; or
by [0177] (ii) an exogenous nucleic acid encoding a protein having
at least 60% identity, preferably at least 70%, for example at
least 75%, more preferably at least 80%, for example at least 85%,
even more preferably at least 90%, for example at least 95% or at
least 96% or at least 97% or at least 98% most preferably 99%
homology with SEQ ID NO: 10 or 2, a functional fragment thereof, an
orthologue or a paralogue thereof, preferably the encoded protein
confers enhanced fungal resistance relative to control plants;
[0178] (iii) an exogenous nucleic acid capable of hybridizing under
stringent conditions with a complementary sequence of any of the
nucleic acids according to (i) or (ii), preferably encoding a RLK1
protein; preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; or by [0179] (iv) an exogenous nucleic acid encoding the
same RLK1 protein as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code.
[0180] A method for increasing fungal resistance, preferably
resistance to Phacopsoracea, for example soy bean rust, in a plant,
plant part, or plant cell, by increasing the expression of an RLK1
protein or a functional fragment, orthologue, paralogue or
homologue thereof, or a splice variant thereof, wherein the RLK1
protein is encoded by [0181] (i) an exogenous nucleic acid having
at least 60% identity, preferably at least 70% sequence identity,
at least 80%, at least 90%, at least 95%, at least 98%, at least
99% sequence identity, or even 100% sequence identity with SEQ ID
NO: 9, 1, or 3, or a functional fragment thereof, an orthologue or
a paralogue thereof, or a splice variant thereof; [0182] (ii) an
exogenous nucleic acid encoding a protein having at least 60%,
preferably at least 70% sequence identity, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% sequence identity, or
even 100% sequence identity with SEQ ID NO: 10 or 2, a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0183] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0184] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code is a further embodiment of the invention.
[0185] A method for increasing fungal resistance, preferably
resistance to Phacopsoracea, for example soy bean rust, in a plant,
plant part, or plant cell, by increasing the expression of a RLK1
protein or a functional fragment, orthologue, paralogue or
homologue thereof, or a splice variant thereof, wherein the RLK1
protein is encoded by [0186] (i) an exogenous nucleic acid having
at least 60% identity, preferably at least 70% sequence identity,
at least 80%, at least 90%, at least 95%, at least 98%, at least
99% sequence identity, or even 100% sequence identity with SEQ ID
NO: 1 or a functional fragment thereof, an orthologue or a
paralogue thereof, or a splice variant thereof; [0187] (ii) an
exogenous nucleic acid encoding a protein having at least 60%,
preferably at least 70% sequence identity, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% sequence identity, or
even 100% sequence identity with SEQ ID NO: 2, a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0188] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0189] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code is a further embodiment of the invention.
[0190] A method for increasing fungal resistance, preferably
resistance to Phacopsoracea, for example soy bean rust, in a plant,
plant part, or plant cell, by increasing the expression of a RLK1
protein or a functional fragment, orthologue, paralogue or
homologue thereof, or a splice variant thereof, wherein the RLK1
protein is encoded by [0191] (i) an exogenous nucleic acid having
at least 60% identity, preferably at least 70% sequence identity,
at least 80%, at least 90%, at least 95%, at least 98%, at least
99% sequence identity, or even 100% sequence identity with SEQ ID
NO: 9 or a functional fragment thereof, an orthologue or a
paralogue thereof, or a splice variant thereof; [0192] (ii) an
exogenous nucleic acid encoding a protein having at least 60%,
preferably at least 70% sequence identity, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% sequence identity, or
even 100% sequence identity with SEQ ID NO: 10, a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0193] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0194] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code is a further embodiment of the invention.
[0195] In a further method of the invention, the method comprises
the steps of [0196] (a) stably transforming a plant cell with a
recombinant expression cassette comprising [0197] (i) a nucleic
acid having at least 60% identity, preferably at least 70% sequence
identity, at least 80%, at least 90%, at least 95%, at least 98%,
at least 99% sequence identity, or even 100% sequence identity with
SEQ ID NO: 9, 1, or 3, or a functional fragment thereof, or an
orthologue or a paralogue thereof, or a splice variant thereof;
[0198] (ii) a nucleic acid coding for a protein having at least 60%
identity, preferably at least 70% sequence identity, at least 80%,
at least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 10 or 2, a
functional fragment thereof, an orthologue or a paralogue thereof;
preferably the encoded protein confers enhanced fungal resistance
relative to control plants; [0199] (iii) a nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or [0200] (iv) a nucleic
acid encoding the same RLK1 polypeptide as any of the nucleic acids
of (i) to (iii) above, but differing from the nucleic acids of (i)
to (iii) above due to the degeneracy of the genetic code, [0201] in
functional linkage with a promoter; [0202] (b) regenerating the
plant from the plant cell; and [0203] (c) expressing said nucleic
acid, optionally wherein the nucleic acid which codes for an RLK1
protein is expressed in an amount and for a period sufficient to
generate or to increase soybean rust resistance in said plant.
[0204] Preferably, the method comprises the steps of [0205] (a)
stably transforming a plant cell with a recombinant expression
cassette comprising [0206] (i) a nucleic acid having at least 60%
identity, preferably at least 70% sequence identity, at least 80%,
at least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 1, or a
functional fragment thereof, or an orthologue or a paralogue
thereof, or a splice variant thereof; [0207] (ii) a nucleic acid
coding for a protein having at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 2, a functional fragment thereof,
an orthologue or a paralogue thereof; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; [0208] (iii) a nucleic acid capable of hybridizing under
stringent conditions with a complementary sequence of any of the
nucleic acids according to (i) or (ii); preferably encoding a RLK1
protein; preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or [0209] (iv) a nucleic acid encoding the same RLK1
polypeptide as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code, [0210] in functional linkage with a
promoter; [0211] (b) regenerating the plant from the plant cell;
and [0212] (c) expressing said nucleic acid, optionally wherein the
nucleic acid which codes for a RLK1 protein is expressed in an
amount and for a period sufficient to generate or to increase
soybean rust resistance in said plant.
[0213] Preferably, the method comprises the steps of [0214] (a)
stably transforming a plant cell with a recombinant expression
cassette comprising [0215] (i) a nucleic acid having at least 60%
identity, preferably at least 70% sequence identity, at least 80%,
at least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 9, or a
functional fragment thereof, or an orthologue or a paralogue
thereof, or a splice variant thereof; [0216] (ii) a nucleic acid
coding for a protein having at least 60% identity, preferably at
least 70% sequence identity, at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 10, a functional fragment
thereof, an orthologue or a paralogue thereof; preferably the
encoded protein confers enhanced fungal resistance relative to
control plants; [0217] (iii) a nucleic acid capable of hybridizing
under stringent conditions with a complementary sequence of any of
the nucleic acids according to (i) or (ii); preferably encoding a
RLK1 protein; preferably wherein the nucleic acid molecule codes
for a polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or [0218] (iv) a nucleic acid encoding the same RLK1
polypeptide as any of the nucleic acids of (i) to (iii) above, but
differing from the nucleic acids of (i) to (iii) above due to the
degeneracy of the genetic code, [0219] in functional linkage with a
promoter; [0220] (b) regenerating the plant from the plant cell;
and [0221] (c) expressing said nucleic acid, optionally wherein the
nucleic acid which codes for a RLK1 protein is expressed in an
amount and for a period sufficient to generate or to increase
soybean rust resistance in said plant
[0222] Preferably, the method for increasing fungal resistance,
preferably resistance to Phacopsoracea, for example soy bean rust,
in a plant, plant part, or plant cell further comprises the step of
selecting a transgenic plant expressing [0223] (i) an exogenous
nucleic acid having at least 60% identity, preferably at least 70%
sequence identity, at least 80%, at least 90%, at least 95%, at
least 98%, at least 99% sequence identity, or even 100% sequence
identity with SEQ ID NO: 9, 1, or 3, or a functional fragment
thereof, or an orthologue or a paralogue thereof, or a splice
variant thereof; [0224] (ii) an exogenous nucleic acid coding for a
protein having at least 60% identity, preferably at least 70%
sequence identity, at least 80%, at least 90%, at least 95%, at
least 98%, at least 99% sequence identity, or even 100% sequence
identity with SEQ ID NO: 10 or 2, a functional fragment thereof, an
orthologue or a paralogue thereof; preferably the encoded protein
confers enhanced fungal resistance relative to control plants;
[0225] (iii) an exogenous nucleic acid capable of hybridizing under
stringent conditions with a complementary sequence of any of the
nucleic acids according to (i) or (ii); preferably encoding a RLK1
protein; preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or [0226] (iv) an exogenous nucleic acid encoding the
same RLK1 polypeptide as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code.
[0227] A preferred embodiment is a method for increasing resistance
to soy bean rust in a soy bean plant, soy bean plant part, or soy
bean plant cell, by increasing the expression of an RLK1 protein,
wherein the RLK1 protein is encoded by [0228] (i) an exogenous
nucleic acid having at least 80%, at least 90%, at least 95%, at
least 98%, at least 99% sequence identity, or even 100% sequence
identity with SEQ ID NO: 9, 1, or 3; [0229] (ii) an exogenous
nucleic acid encoding a protein having at least 80%, at least 90%,
at least 95%, at least 98%, at least 99% sequence identity, or even
100% sequence identity with SEQ ID NO: 10 or 2; preferably the
encoded protein confers enhanced fungal resistance relative to
control plants; [0230] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0231] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code, wherein increasing the expression of the RLK1 protein is
achieved by transforming the soy bean plant, plant part or plant
cell with a nucleic acid comprising the nucleic acid set out under
item (i) or (ii) or (iii) or (iv).
[0232] Also a preferred embodiment is a method for increasing
resistance to soy bean rust in a soy bean plant, soy bean plant
part, or soy bean plant cell, by increasing the expression of an
RLK1 protein, wherein the RLK1 protein is encoded by [0233] (i) an
exogenous nucleic acid having at least 80%, at least 90%, at least
95%, at least 98%, at least 99% sequence identity, or even 100%
sequence identity with SEQ ID NO: 9, 1, or 3; [0234] (ii) an
exogenous nucleic acid encoding a protein having at least 80%, at
least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO:10 or 2;
preferably the encoded protein confers enhanced fungal resistance
relative to control plants; or [0235] (iii) an exogenous nucleic
acid encoding the same RLK1 protein as any of the nucleic acids of
(i) to (ii) above, but differing from the nucleic acids of (i) to
(ii) above due to the degeneracy of the genetic code, wherein
increasing the expression of the RLK1 protein is achieved by
transforming the soy bean plant, plant part or plant cell with a
nucleic acid comprising the nucleic acid set out under item (i) or
(ii) or (iii).
[0236] The fungal pathogens or fungus-like pathogens (such as, for
example, Chromista) can belong to the group comprising
Plasmodiophoramycota, Oomycota, Ascomycota, Chytridiomycetes,
Zygomycetes, Basidiomycota or Deuteromycetes (Fungi imperfecti).
Pathogens which may be mentioned by way of example, but not by
limitation, are those detailed in Tables 2 and 3, and the diseases
which are associated with them.
TABLE-US-00005 TABLE 2 Diseases caused by biotrophic
phytopathogenic fungi Disease Pathogen Leaf rust Puccinia recondita
Yellow rust P. striiformis Powdery mildew Erysiphe
graminis/Blumeria graminis Rust (common corn) Puccinia sorghi Rust
(Southern corn) Puccinia polysora Tobacco leaf spot Cercospora
nicotianae Rust (soybean) Phakopsora pachyrhizi, P. meibomiae Rust
(tropical corn) Physopella pallescens, P. zeae = Angiopsora
zeae
TABLE-US-00006 TABLE 3 Diseases caused by necrotrophic and/or
hemibiotrophic fungi and Oomycetes Disease Pathogen Plume blotch
Septoria (Stagonospora) nodorum Leaf blotch Septoria tritici Ear
fusarioses Fusarium spp. Late blight Phytophthora infestans
Anthrocnose leaf blight Colletotrichum graminicola (teleomorph:
Glomerella Anthracnose stalk rot graminicola Politis); Glomerella
tucumanensis (anamorph: Glomerella falcatum Went) Curvularia leaf
spot Curvularia clavata, C. eragrostidis, = C. maculans
(teleomorph: Cochliobolus eragrostidis), Curvularia inaequalis, C.
intermedia (teleomorph: Cochliobolus intermedius), Curvularia
lunata (teleomorph: Cochliobolus lunatus), Curvularia pallescens
(teleomorph: Cochliobolus pallescens), Curvularia senegalensis, C.
tuberculata (teleomorph: Cochliobolus tuberculatus) Didymella leaf
spot Didymella exitalis Diplodia leaf spot or streak Stenocarpella
macrospora = Diplodialeaf macrospora Brown stripe downy mildew
Sclerophthora rayssiae var. zeae Crazy top downy mildew
Sclerophthora macrospora = Sclerospora macrospora Green ear downy
mildew Sclerospora graminicola (graminicola downy mildew) Leaf
spots, minor Alternaria alternata, Ascochyta maydis, A. tritici, A.
zeicola, Bipolaris victoriae = Helminthosporium victoriae
(teleomorph: Cochliobolus victoriae), C. sativus (anamorph:
Bipolaris sorokiniana = H. sorokinianum = H. sativum), Epicoccum
nigrum, Exserohilum prolatum = Drechslera prolata (teleomorph:
Setosphaeria prolata) Graphium penicillioides, Leptosphaeria
maydis, Leptothyrium zeae, Ophiosphaerella herpotricha, (anamorph:
Scolecosporiella sp.), Paraphaeosphaeria michotii, Phoma sp.,
Septoria zeae, S. zeicola, S. zeina Northern corn leaf blight
(white Setosphaeria turcica (anamorph: Exserohilum turcicum =
blast, crown stalk rot, stripe) Helminthosporium turcicum) Northern
corn leaf spot Cochliobolus carbonum (anamorph: Bipolaris zeicola =
Helminthosporium ear rot (race 1) Helminthosporium carbonum)
Phaeosphaeria leaf spot Phaeosphaeria maydis = Sphaerulina maydis
Rostratum leaf spot Setosphaeria rostrata, (anamorph: xserohilum
rostratum = (Helminthosporium leaf Helminthosporium rostratum)
disease, ear and stalk rot) Java downy mildew Peronosclerospora
maydis = Sclerospora maydis Philippine downy mildew
Peronosclerospora philippinensis = Sclerospora philippinensis
Sorghum downy mildew Peronosclerospora sorghi = Sclerospora sorghi
Spontaneum downy mildew Peronosclerospora spontanea = Sclerospora
spontanea Sugarcane downy mildew Peronosclerospora sacchari =
Sclerospora sacchari Sclerotium ear rot (southern blight)
Sclerotium rolfsii Sacc. (teleomorph: Athelia rolfsii) Seed
rot-seedling blight Bipolaris sorokiniana, B. zeicola =
Helminthosporium carbonum, Diplodia maydis, Exserohilum
pedicillatum, Exserohilum turcicum = Helminthosporium turcicum,
Fusarium avenaceum, F. culmorum, F. moniliforme, Gibberella zeae
(anamorph: F. graminearum), Macrophomina phaseolina, Penicillium
spp., Phomopsis sp., Pythium spp., Rhizoctonia solani, R. zeae,
Sclerotium rolfsii, Spicaria sp. Selenophoma leaf spot Selenophoma
sp. Yellow leaf blight Ascochyta ischaemi, Phyllosticta maydis
(teleomorph: Mycosphaerella zeae-maydis) Zonate leaf spot
Gloeocercospora sorghi
[0237] The following are especially preferred: [0238]
Plasmodiophoromycota such as Plasmodiophora brassicae (clubroot of
crucifers), Spongospora subterranea, Polymyxa graminis, [0239]
Oomycota such as Bremia lactucae (downy mildew of lettuce),
Peronospora (downy mildew) in snapdragon (P. antirrhini), onion (P.
destructor), spinach (P. effusa), soybean (P. manchurica), tobacco
("blue mold"; P. tabacina) alfalfa and clover (P. trifolium),
Pseudoperonospora humuli (downy mildew of hops), Plasmopara (downy
mildew in grapevines) (P. viticola) and sunflower (P. halstedii),
Sclerophthora macrospora (downy mildew in cereals and grasses),
Pythium (for example damping-off of Beta beet caused by P.
debaryanum), Phytophthora infestans (late blight in potato and in
tomato and the like), Albugo spec. [0240] Ascomycota such as
Microdochium nivale (snow mold of rye and wheat), Fusarium,
Fusarium graminearum, Fusarium culmorum (partial ear sterility
mainly in wheat), Fusarium oxysporum (Fusarium wilt of tomato),
Blumeria graminis (powdery mildew of barley (f.sp. hordei) and
wheat (f.sp. tritici)), Erysiphe pisi (powdery mildew of pea),
Nectria galligena (Nectria canker of fruit trees), Uncinula necator
(powdery mildew of grapevine), Pseudopeziza tracheiphila (red fire
disease of grapevine), Claviceps purpurea (ergot on, for example,
rye and grasses), Gaeumannomyces graminis (take-all on wheat, rye
and other grasses), Magnaporthe grisea, Pyrenophora graminea (leaf
stripe of barley), Pyrenophora teres (net blotch of barley),
Pyrenophora tritici-repentis (leaf blight of wheat), Venturia
inaequalis (apple scab), Sclerotinia sclerotium (stalk break, stem
rot), Pseudopeziza medicaginis (leaf spot of alfalfa, white and red
clover). [0241] Basidiomycetes such as Typhula incarnata (typhula
blight on barley, rye, wheat), Ustilago maydis (blister smut on
maize), Ustilago nuda (loose smut on barley), Ustilago tritici
(loose smut on wheat, spelt), Ustilago avenae (loose smut on oats),
Rhizoctonia solani (rhizoctonia root rot of potato), Sphacelotheca
spp. (head smut of sorghum), Melampsora lini (rust of flax),
Puccinia graminis (stem rust of wheat, barley, rye, oats), Puccinia
recondita (leaf rust on wheat), Puccinia dispersa (brown rust on
rye), Puccinia hordei (leaf rust of barley), Puccinia coronata
(crown rust of oats), Puccinia striiformis (yellow rust of wheat,
barley, rye and a large number of grasses), Uromyces appendiculatus
(brown rust of bean), Sclerotium rolfsii (root and stem rots of
many plants). [0242] Deuteromycetes (Fungi imperfecti) such as
Septoria (Stagonospora) nodorum (glume blotch) of wheat (Septoria
tritici), Pseudocercosporella herpotrichoides (eyespot of wheat,
barley, rye), Rynchosporium secalis (leaf spot on rye and barley),
Alternaria solani (early blight of potato, tomato), Phoma betae
(blackleg on Beta beet), Cercospora beticola (leaf spot on Beta
beet), Alternaria brassicae (black spot on oilseed rape, cabbage
and other crucifers), Verticillium dahliae (verticillium wilt),
Colletotrichum, Colletotrichum lindemuthianum (bean anthracnose),
Phoma lingam (blackleg of cabbage and oilseed rape), Botrytis
cinerea (grey mold of grapevine, strawberry, tomato, hops and the
like).
[0243] Especially preferred are biotrophic pathogens, e.g.,
Phakopsora pachyrhizi and/or those pathogens which have essentially
a similar infection mechanism as Phakopsora pachyrhizi, as
described herein. Particularly preferred are pathogens from the
subclass Pucciniomycetes, preferably from the order Pucciniales,
preferably the group Uredinales (rusts), among which in particular
the Melompsoraceae. Especially preferred are Phakopsora pachyrhizi
and/or Phakopsora meibomiae.
[0244] Also preferred rust fungi are selected from the group of
Puccinia, Gymnosporangium, Juniperus, Cronartium, Hemileia, and
Uromyces; preferably Puccinia sorghi, Gymnosporangium
juniperi-virginianae, Juniperus virginiana, Cronartium ribicola,
Hemileia vastatrix, Puccinia graminis, Puccinia coronata, Uromyces
phaseoli, Puccinia hemerocallidis, Puccinia persistens subsp.
Triticina, Puccinia striiformis, Puccinia graminis causes, and/or
Uromyces appendeculatus.
RLK1 Expression Constructs and Vector Constructs
[0245] A recombinant vector construct comprising: [0246] (a) (i) a
nucleic acid having at least 60% identity, preferably at least 70%
sequence identity, at least 80%, at least 90%, at least 95%, at
least 98%, at least 99% sequence identity, or even 100% sequence
identity with SEQ ID NO: 9, 1, or 3, or a functional fragment
thereof, or an orthologue or a paralogue thereof, or a splice
variant thereof; [0247] (ii) a nucleic acid coding for a protein
having at least 60% identity, preferably at least 70% sequence
identity, at least 80%, at least 90%, at least 95%, at least 98%,
at least 99% sequence identity, or even 100% sequence identity with
SEQ ID NO: 10 or 2, a functional fragment thereof, an orthologue or
a paralogue thereof; preferably the encoded protein confers
enhanced fungal resistance relative to control plants; [0248] (iii)
a nucleic acid capable of hybridizing under stringent conditions
with a complementary sequence of any of the nucleic acids according
to (i) or (ii); preferably encoding a RLK1 protein; preferably
wherein the nucleic acid molecule codes for a polypeptide which has
essentially identical properties to the polypeptide described in
SEQ ID NO: 10 or 2; preferably the encoded protein confers enhanced
fungal resistance relative to control plants; and/or [0249] (iv) a
nucleic acid encoding the same RLK1 protein as any of the nucleic
acids of (i) to (iii) above, but differing from the nucleic acids
of (i) to (iii) above due to the degeneracy of the genetic code,
[0250] operably linked with [0251] (b) a promoter and [0252] (c) a
transcription termination sequence is a further embodiment of the
invention.
[0253] Furthermore, a recombinant vector construct is provided
comprising: [0254] (a) (i) a nucleic acid having at least 80%, at
least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 9, 1, or
3; [0255] (ii) a nucleic acid coding for a protein having at least
80%, at least 90%, at least 95%, at least 98%, at least 99%
sequence identity, or even 100% sequence identity with SEQ ID NO:
10 or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; [0256] (iii) a nucleic acid
capable of hybridizing under stringent conditions with a
complementary sequence of any of the nucleic acids according to (i)
or (ii); preferably encoding a RLK1 protein; preferably wherein the
nucleic acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or [0257] (iv) a nucleic
acid encoding the same RLK1 protein as any of the nucleic acids of
(i) to (iii) above, but differing from the nucleic acids of (i) to
(iii) above due to the degeneracy of the genetic code, [0258]
operably linked with [0259] (b) a promoter and [0260] (c) a
transcription termination sequence is a further embodiment of the
invention.
[0261] Furthermore, a recombinant vector construct is provided
comprising: [0262] (a) (i) a nucleic acid having at least 80%, at
least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 1; [0263]
(ii) a nucleic acid coding for a protein having at least 80%, at
least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 2;
preferably the encoded protein confers enhanced fungal resistance
relative to control plants; [0264] (iii) a nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or [0265] (iv) a nucleic
acid encoding the same RLK1 protein as any of the nucleic acids of
(i) to (iii) above, but differing from the nucleic acids of (i) to
(iii) above due to the degeneracy of the genetic code, [0266]
operably linked with [0267] (b) a promoter and [0268] (c) a
transcription termination sequence is a further embodiment of the
invention.
[0269] Furthermore, a recombinant vector construct is provided
comprising: [0270] (a) (i) a nucleic acid having at least 80%, at
least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 9; [0271]
(ii) a nucleic acid coding for a protein having at least 80%, at
least 90%, at least 95%, at least 98%, at least 99% sequence
identity, or even 100% sequence identity with SEQ ID NO: 10;
preferably the encoded protein confers enhanced fungal resistance
relative to control plants; [0272] (iii) a nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or [0273] (iv) a nucleic
acid encoding the same RLK1 protein as any of the nucleic acids of
(i) to (iii) above, but differing from the nucleic acids of (i) to
(iii) above due to the degeneracy of the genetic code, [0274]
operably linked with [0275] (b) a promoter and [0276] (c) a
transcription termination sequence is a further embodiment of the
invention.
[0277] Promoters according to the present invention may be
constitutive, inducible, in particular pathogen-inducible,
developmental stage-preferred, cell type-preferred,
tissue-preferred or organ-preferred. Constitutive promoters are
active under most conditions. Non-limiting examples of constitutive
promoters include the CaMV 19S and 35S promoters (Odell et al.,
1985, Nature 313:810-812), the sX CaMV 35S promoter (Kay et al.,
1987, Science 236:1299-1302), the Sep1 promoter, the rice actin
promoter (McElroy et al., 1990, Plant Cell 2:163-171), the
Arabidopsis actin promoter, the ubiquitin promoter (Christensen et
al., 1989, Plant Molec. Biol. 18:675-689); pEmu (Last et al., 1991,
Theor. Appl. Genet. 81:581-588), the figwort mosaic virus 35S
promoter, the Smas promoter (Velten et al., 1984, EMBO J.
3:2723-2730), the GRP1-8 promoter, the cinnamyl alcohol
dehydrogenase promoter (U.S. Pat. No. 5,683,439), promoters from
the T-DNA of Agrobacterium, such as mannopine synthase, nopaline
synthase, and octopine synthase, the small subunit of ribulose
biphosphate carboxylase (ssuRUBISCO) promoter, and/or the like.
[0278] Preferably, the expression vector of the invention comprises
a constitutive promoter, mesophyll-specific promoter,
epidermis-specific promoter, root-specific promoter, a pathogen
inducible promoter, or a fungal-inducible promoter.
[0279] A promoter is inducible, if its activity, measured on the
amount of RNA produced under control of the promoter, is at least
30%, at least 40%, at least 50% preferably at least 60%, at least
70%, at least 80%, at least 90% more preferred at least 100%, at
least 200%, at least 300% higher in its induced state, than in its
un-induced state. A promoter is cell-, tissue- or organ-specific,
if its activity, measured on the amount of RNA produced under
control of the promoter, is at least 30%, at least 40%, at least
50% preferably at least 60%, at least 70%, at least 80%, at least
90% more preferred at least 100%, at least 200%, at least 300%
higher in a particular cell-type, tissue or organ, then in other
cell-types or tissues of the same plant, preferably the other
cell-types or tissues are cell types or tissues of the same plant
organ, e.g. a root. In the case of organ specific promoters, the
promoter activity has to be compared to the promoter activity in
other plant organs, e.g. leaves, stems, flowers or seeds.
Preferably, the promoter is a constitutive promoter,
mesophyll-specific promoter, or epidermis-specific promoter.
[0280] Especially preferred is a promoter from parsley, preferably,
the parsley ubiquitine promoter. A preferred terminator is the
terminator of the cathepsin D inhibitor gene from Solanum
tuberosum.
[0281] In preferred embodiments, the increase in the protein amount
and/or activity of the RLK1 protein takes place in a constitutive
or tissue-specific manner. In especially preferred embodiments, an
essentially pathogen-induced increase in the protein amount and/or
protein activity takes place, for example by recombinant expression
of the RLK1 nucleic acid under the control of a fungal-inducable
promoter. In particular, the expression of the RLK1 nucleic acid
takes place on fungal infected sites, where, however, preferably
the expression of the RLK1 nucleic acid remains essentially
unchanged in tissues not infected by fungus.
[0282] Developmental stage-preferred promoters are preferentially
expressed at certain stages of development. Tissue and organ
preferred promoters include those that are preferentially expressed
in certain tissues or organs, such as leaves, roots, seeds, or
xylem. Examples of tissue preferred and organ preferred promoters
include, but are not limited to fruitpreferred, ovule-preferred,
male tissue-preferred, seed-preferred, integument-preferred,
tuber-preferred, stalk-preferred, pericarp-preferred,
leaf-preferred, stigma-preferred, pollenpreferred,
anther-preferred, a petal-preferred, sepal-preferred,
pedicel-preferred, siliquepreferred, stem-preferred, root-preferred
promoters and/or the like. Seed preferred promoters are
preferentially expressed during seed development and/or
germination. For example, seed preferred promoters can be
embryo-preferred, endosperm preferred and seed coatpreferred. See
Thompson et al., 1989, BioEssays 10:108. Examples of seed preferred
promoters include, but are not limited to cellulose synthase
(celA), Cim1, gamma-zein, globulin-1, maize 19 kD zein (cZ19B1)
and/or the like.
[0283] Other suitable tissue-preferred or organ-preferred promoters
include, but are not limited to, the napin-gene promoter from
rapeseed (U.S. Pat. No. 5,608,152), the USP-promoter from Vicia
faba (Baeumlein et al., 1991, Mol Gen Genet. 225(3):459-67), the
oleosinpromoter from Arabidopsis (PCT Application No. WO 98/45461),
the phaseolin-promoter from Phaseolus vulgaris (U.S. Pat. No.
5,504,200), the Bce4-promoter from Brassica (PCT Application No. WO
91/13980), or the legumin B4 promoter (LeB4; Baeumlein et al.,
1992, Plant Journal, 2(2):233-9), as well as promoters conferring
seed specific expression in monocot plants like maize, barley,
wheat, rye, rice, etc. Suitable promoters to note are the Ipt2 or
Ipt1-gene promoter from barley (PCT Application No. WO 95/15389 and
PCT Application No. WO 95/23230) or those described in PCT
Application No. WO 99/16890 (promoters from the barley
hordein-gene, rice glutelin gene, rice oryzin gene, rice prolamin
gene, wheat gliadin gene, wheat glutelin gene, oat glutelin gene,
Sorghum kasirin-gene, and/or rye secalin gene).
[0284] Promoters useful according to the invention include, but are
not limited to, are the major chlorophyll a/b binding protein
promoter, histone promoters, the Ap3 promoter, the .beta.-conglycin
promoter, the napin promoter, the soybean lectin promoter, the
maize 15 kD zein promoter, the 22 kD zein promoter, the 27 kD zein
promoter, the g-zein promoter, the waxy, shrunken 1, shrunken 2,
bronze promoters, the Zm13 promoter (U.S. Pat. No. 5,086,169), the
maize polygalacturonase promoters (PG) (U.S. Pat. Nos. 5,412,085
and 5,545,546), the SGB6 promoter (U.S. Pat. No. 5,470,359), as
well as synthetic or other natural promoters.
[0285] Epidermis-spezific promoters may be selected from the group
consisting of:
[0286] WIR5 (=GstA1); acc. X56012; Dudler & Schweizer, GLP4,
acc. AJ310534; Wei Y., Zhang Z., Andersen C. H., Schmelzer E.,
Gregersen P. L., Collinge D. B., Smedegaard-Petersen V. and
Thordal-Christensen H., Plant Molecular Biology 36, 101 (1998),
[0287] GLP2a, acc. AJ237942, Schweizer P., Christoffel A. and
Dudler R., Plant J. 20, 541 (1999); Prx7, acc. AJ003141, Kristensen
B. K., Ammitzboll H., Rasmussen S. K. and Nielsen K. A., Molecular
Plant Pathology, 2(6), 311 (2001);
[0288] GerA, acc. AF250933; Wu S., Druka A., Horvath H., Kleinhofs
A., Kannangara G. and von Wettstein D., Plant Phys Biochem 38, 685
(2000);
[0289] OsROCl, acc. AP004656
[0290] RTBV, acc. AAV62708, AAV62707; Kloti A., Henrich C., Bieri
S., He X., Chen G., Burkhardt P. K., Wunn J., Lucca P., Hohn T.,
Potrykus I. and Futterer J., PMB 40, 249 (1999);
[0291] Chitinase ChtC2-Promoter from potato (Ancillo et al.,
Planta. 217(4), 566, (2003));
[0292] AtProT3 Promoter (Grallath et al., Plant Physiology. 137(1),
117 (2005));
[0293] SHN-Promoters from Arabidopsis (AP2/EREBP transcription
factors involved in cutin and wax production) (Aaron et al., Plant
Cell. 16(9), 2463 (2004)); and/or
[0294] GSTA1 from wheat (Dudler et al., WP2005306368 and Altpeter
et al., Plant Molecular Biology. 57(2), 271 (2005)).
[0295] Mesophyll-specific promoters may be selected from the group
consisting of:
[0296] PPCZm1 (.dbd.PEPC); Kausch A. P., Owen T. P., Zachwieja S.
J., Flynn A. R. and Sheen J., Plant Mol. Biol. 45, 1 (2001);
[0297] OsrbcS, Kyozuka et al., PlaNT Phys 102, 991 (1993); Kyozuka
J., McElroy D., Hayakawa T., Xie Y., Wu R. and Shimamoto K., Plant
Phys. 102, 991 (1993);
[0298] OsPPDK, acc. AC099041;
[0299] TaGF-2.8, acc. M63223; Schweizer P., Christoffel A. and
Dudler R., Plant J. 20, 541 (1999);
[0300] TaFBPase, acc. X53957;
[0301] TaWIS1, acc. AF467542; US 200220115849;
[0302] HvBIS1, acc. AF467539; US 200220115849;
[0303] ZmMIS1, acc. AF467514; US 200220115849;
[0304] HvPR1a, acc. X74939; Bryngelsson et al., Mol. Plant. Microbe
Interacti. 7 (2), 267 (1994);
[0305] HvPR1b, acc. X74940; Bryngelsson et al., Mol. Plant. Microbe
Interact. 7(2), 267 (1994);
[0306] HvB1,3gluc; acc. AF479647;
[0307] HvPrx8, acc. AJ276227; Kristensen et al., Molecular Plant
Pathology, 2(6), 311 (2001); and/or
[0308] HvPAL, acc. X97313; Wei Y., Zhang Z., Andersen C. H.,
Schmelzer E., Gregersen P. L., Collinge D. B., Smedegaard-Petersen
V. and Thordal-Christensen H. Plant Molecular Biology 36, 101
(1998).
[0309] Constitutive promoters may be selected from the group
consisting of [0310] PcUbi promoter from parsley (WO 03/102198)
[0311] CaMV 35S promoter: Cauliflower Mosaic Virus 35S promoter
(Benfey et al. 1989 EMBO J. 8(8): 2195-2202), [0312] STPT promoter:
Arabidopsis thaliana Short Triose phosphate translocator promoter
(Accession NM.sub.--123979) [0313] Act1 promoter: Oryza sativa
actin 1 gene promoter (McElroy et al. 1990 PLANT CELL 2(2)
163-171a) and/or [0314] EF1A2 promoter: Glycine max translation
elongation factor EF1 alpha (US 20090133159).
[0315] One type of vector construct is a "plasmid," which refers to
a circular double stranded DNA loop into which additional DNA
segments can be ligated. Another type of vector is a viral vector,
wherein additional DNA segments can be ligated into the viral
genome. Certain vector constructs are capable of autonomous
replication in a host plant cell into which they are introduced.
Other vector constructs are integrated into the genome of a host
plant cell upon introduction into the host cell, and thereby are
replicated along with the host genome. In particular the vector
construct is capable of directing the expression of gene to which
the vectors is operatively linked. However, the invention is
intended to include such other forms of expression vector
constructs, such as viral vectors (e.g., potato virus X, tobacco
rattle virus, and/or Gemini virus), which serve equivalent
functions.
[0316] In preferred embodiments, the increase in the protein
quantity or function of the RLK1 protein takes place in a
constitutive or tissue-specific manner. In especially preferred
embodiments, an essentially pathogen-induced increase in the
protein quantity or protein function takes place, for example by
exogenous expression of the RLK1 nucleic acid under the control of
a fungal-inducible promoter. In particular, the expression of the
RLK1 nucleic acid takes place on fungal infected sites, where,
however, preferably the expression of the RLK1 nucleic acid
sequence remains essentially unchanged in tissues not infected by
fungus. In preferred embodiments, the protein amount of an RLK1
protein in the plant is increased by at least 10%, at least 20%, at
least 30%, at least 40%, at least 50%, at least 60%, at least 70%,
at least 80%, at least 90%, or at least 95% or more in comparison
to a wild type plant that is not transformed with the RLK1 nucleic
acid.
Transgenic Organisms; Transgenic Plants, Plant Parts, and Plant
Cells
[0317] A preferred embodiment is a transgenic plant, transgenic
plant part, or transgenic plant cell overexpressing an exogenous
RLK1 protein. Preferably, the RLK1 protein overexpressed in the
plant, plant part or plant cell is encoded by [0318] (i) an
exogenous nucleic acid having at least 60% identity with SEQ ID NO:
9, 1, or 3, or a functional fragment, thereof, an orthologue or a
paralogue thereof, or a splice variant thereof; or by [0319] (ii)
an exogenous nucleic acid encoding a protein having at least 60%
identity with SEQ ID NO: 10 or 2, a functional fragment thereof, an
orthologue or a paralogue thereof; preferably the encoded protein
confers enhanced fungal resistance relative to control plants;
[0320] (iii) an exogenous nucleic acid capable of hybridizing under
stringent conditions with a complementary sequence of any of the
nucleic acids according to (i) or (ii); preferably encoding a RLK1
protein; preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or by [0321] (iv) an exogenous nucleic acid encoding
the same RLK1 protein as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code.
[0322] Most preferably, the exogenous nucleic acid has at least
80%, at least 90%, at least 95%, at least 98%, at least 99%
sequence identity, or even 100% sequence identity with SEQ ID NO:
1; or comprises an exogenous nucleic acid encoding a protein having
at least 80%, at least 90%, at least 95%, at least 98%, at least
99% sequence identity, or even 100% sequence identity with SEQ ID
NO: 2.
[0323] Most preferably, the exogenous nucleic acid has at least
80%, at least 90%, at least 95%, at least 98%, at least 99%
sequence identity, or even 100% sequence identity with SEQ ID NO:
9; or comprises an exogenous nucleic acid encoding a protein having
at least 80%, at least 90%, at least 95%, at least 98%, at least
99% sequence identity, or even 100% sequence identity with SEQ ID
NO: 10.
[0324] A preferred embodiment is a transgenic plant, transgenic
plant part, or transgenic plant cell overexpressing an exogenous
RLK1 protein. Preferably, the RLK1 protein overexpressed in the
plant, plant part or plant cell is encoded by [0325] (i) an
exogenous nucleic acid having at least 60% identity with SEQ ID NO:
1 or a functional fragment, thereof, an orthologue or a paralogue
thereof, or a splice variant thereof; or by [0326] (ii) an
exogenous nucleic acid encoding a protein having at least 60%
identity with SEQ ID NO: 2, a functional fragment thereof, an
orthologue or a paralogue thereof; preferably the encoded protein
confers enhanced fungal resistance relative to control plants;
[0327] (iii) an exogenous nucleic acid capable of hybridizing under
stringent conditions with a complementary sequence of any of the
nucleic acids according to (i) or (ii); preferably encoding a RLK1
protein; preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or by [0328] (iv) an exogenous nucleic acid encoding
the same RLK1 protein as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code.
[0329] A preferred embodiment is a transgenic plant, transgenic
plant part, or transgenic plant cell overexpressing an exogenous
RLK1 protein. Preferably, the RLK1 protein overexpressed in the
plant, plant part or plant cell is encoded by [0330] (i) an
exogenous nucleic acid having at least 60% identity with SEQ ID NO:
9 or a functional fragment, thereof, an orthologue or a paralogue
thereof, or a splice variant thereof; or by [0331] (ii) an
exogenous nucleic acid encoding a protein having at least 60%
identity with SEQ ID NO: 10, a functional fragment thereof, an
orthologue or a paralogue thereof; preferably the encoded protein
confers enhanced fungal resistance relative to control plants;
[0332] (iii) an exogenous nucleic acid capable of hybridizing under
stringent conditions with a complementary sequence of any of the
nucleic acids according to (i) or (ii); preferably encoding a RLK1
protein; preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or by [0333] (iv) an exogenous nucleic acid encoding
the same RLK1 protein as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code.
[0334] Most preferably, the exogenous nucleic acid has at least
80%, at least 90%, at least 95%, at least 98%, at least 99%
sequence identity, or even 100% sequence identity with SEQ ID NO: 9
or 1; or comprises an exogenous nucleic acid encoding a protein
having at least 95%, at least 98%, at least 99% sequence identity,
or even 100% sequence identity with SEQ ID NO: 10 or 2.
[0335] More preferably, the transgenic plant, transgenic plant
part, or transgenic plant cell according to the present invention
has been obtained by transformation with a recombinant vector
described herein.
[0336] Suitable methods for transforming or transfecting host cells
including plant cells are well known in the art of plant
biotechnology. Any method may be used to transform the recombinant
expression vector into plant cells to yield the transgenic plants
of the invention. General methods for transforming dicotyledonous
plants are disclosed, for example, in U.S. Pat. Nos. 4,940,838;
5,464,763, and the like. Methods for transforming specific
dicotyledonous plants, for example, cotton, are set forth in U.S.
Pat. Nos. 5,004,863; 5,159,135; and 5,846,797. Soy transformation
methods are set forth in U.S. Pat. Nos. 4,992,375; 5,416,011;
5,569,834; 5,824,877; 6,384,301 and in EP 0301749B1 may be used.
Transformation methods may include direct and indirect methods of
transformation. Suitable direct methods include polyethylene glycol
induced DNA uptake, liposome-mediated transformation (U.S. Pat. No.
4,536,475), biolistic methods using the gene gun (Fromm M E et al.,
Bio/Technology. 8(9):833-9, 1990; Gordon-Kamm et al. Plant Cell
2:603, 1990), electroporation, incubation of dry embryos in
DNA-comprising solution, and microinjection. In the case of these
direct transformation methods, the plasmids used need not meet any
particular requirements. Simple plasmids, such as those of the pUC
series, pBR322, M13 mp series, pACYC184 and the like can be used.
If intact plants are to be regenerated from the transformed cells,
an additional selectable marker gene is preferably located on the
plasmid. The direct transformation techniques are equally suitable
for dicotyledonous and monocotyledonous plants.
[0337] Transformation can also be carried out by bacterial
infection by means of Agrobacterium (for example EP 0 116 718),
viral infection by means of viral vectors (EP 0 067 553; U.S. Pat.
No. 4,407,956; WO 95/34668; WO 93/03161) or by means of pollen (EP
0 270 356; WO 85/01856; U.S. Pat. No. 4,684,611). Agrobacterium
based transformation techniques (especially for dicotyledonous
plants) are well known in the art. The Agrobacterium strain (e.g.,
Agrobacterium tumefaciens or Agrobacterium rhizogenes) comprises a
plasmid (Ti or Ri plasmid) and a T-DNA element which is transferred
to the plant following infection with Agrobacterium. The T-DNA
(transferred DNA) is integrated into the genome of the plant cell.
The T-DNA may be localized on the Ri- or Ti-plasmid or is
separately comprised in a so-called binary vector. Methods for the
Agrobacterium-mediated transformation are described, for example,
in Horsch R B et al. (1985) Science 225:1229. The
Agrobacterium-mediated transformation is best suited to
dicotyledonous plants but has also been adapted to monocotyledonous
plants. The transformation of plants by Agrobacteria is described
in, for example, White F F, Vectors for Gene Transfer in Higher
Plants, Transgenic Plants, Vol. 1, Engineering and Utilization,
edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15-38;
Jenes B et al. Techniques for Gene Transfer, Transgenic Plants,
Vol. 1, Engineering and Utilization, edited by S. D. Kung and R.
Wu, Academic Press, 1993, pp. 128-143; Potrykus (1991) Annu Rev
Plant Physiol Plant Molec Biol 42:205-225. Transformation may
result in transient or stable transformation and expression.
Although a nucleotide sequence of the present invention can be
inserted into any plant and plant cell falling within these broad
classes, it is particularly useful in crop plant cells.
[0338] The genetically modified plant cells can be regenerated via
all methods with which the skilled worker is familiar. Suitable
methods can be found in the abovementioned publications by S. D.
Kung and R. Wu, Potrykus or Hofgen and Willmitzer.
[0339] After transformation, plant cells or cell groupings may be
selected for the presence of one or more markers which are encoded
by plant-expressible genes co-transferred with the gene of
interest, following which the transformed material is regenerated
into a whole plant. To select transformed plants, the plant
material obtained in the transformation is, as a rule, subjected to
selective conditions so that transformed plants can be
distinguished from untransformed plants. For example, the seeds
obtained in the above-described manner can be planted and, after an
initial growing period, subjected to a suitable selection by
spraying. A further possibility consists in growing the seeds, if
appropriate after sterilization, on agar plates using a suitable
selection agent so that only the transformed seeds can grow into
plants. Alternatively, the transformed plants are screened for the
presence of a selectable marker such as the ones described above.
The transformed plants may also be directly selected by screening
for the presence of the RLK1 nucleic acid.
[0340] Following DNA transfer and regeneration, putatively
transformed plants may also be evaluated, for instance using
Southern analysis, for the presence of the gene of interest, copy
number and/or genomic organisation. Alternatively or additionally,
expression levels of the newly introduced DNA may be monitored
using Northern and/or Western analysis, both techniques being well
known to persons having ordinary skill in the art.
[0341] The generated transformed plants may be propagated by a
variety of means, such as by clonal propagation or classical
breeding techniques. For example, a first generation (or T1)
transformed plant may be selfed and homozygous second-generation
(or T2) transformants selected, and the T2 plants may then further
be propagated through classical breeding techniques. The generated
transformed organisms may take a variety of forms. For example,
they may be chimeras of transformed cells and non-transformed
cells; clonal transformants (e.g., all cells transformed to contain
the expression cassette); grafts of transformed and untransformed
tissues (e.g., in plants, a transformed rootstock grafted to an
untransformed scion).
[0342] Preferably, the transgenic plant of the present invention or
the plant obtained by the method of the present invention has
increased resistance against fungal pathogens, preferably against
fungal pathogens of the family Phacopsoraceae, more preferably
against fungal pathogens of the genus Phacopsora, most preferably
against Phakopsora pachyrhizi and Phakopsora meibomiae, also known
as soybean rust. Preferably, resistance against Phakopsora
pachyrhizi and/or Phakopsora meibomiae is increased.
[0343] Preferably, the plant, plant part, or plant cell is a plant
or derived from a plant selected from the group consisting of
beans, soya, pea, clover, kudzu, lucerne, lentils, lupins, vetches,
groundnut, rice, wheat, barley, arabidopsis, lentil, banana,
canola, cotton, potatoe, corn, sugar cane, alfalfa, and sugar
beet.
[0344] In one embodiment of the present invention the plant is
selected from the group consisting of beans, soya, pea, clover,
kudzu, lucerne, lentils, lupins, vetches, and/or groundnut.
Preferably, the plant is a legume, comprising plants of the genus
Phaseolus (comprising French bean, dwarf bean, climbing bean
(Phaseolus vulgaris), Lima bean (Phaseolus lunatus L.), Tepary bean
(Phaseolus acutifolius A. Gray), runner bean (Phaseolus
coccineus)); the genus Glycine (comprising Glycine soja, soybeans
(Glycine max (L.) MeriII)); pea (Pisum) (comprising shelling peas
(Pisum sativum L. convar. sativum), also called smooth or
roundseeded peas; marrowfat pea (Pisum sativum L. convar. medullare
Alef. emend. C.O. Lehm), sugar pea (Pisum sativum L. convar.
axiphium Alef emend. C.O. Lehm), also called snow pea,
edible-podded pea or mangetout, (Pisum granda sneida L. convar.
sneidulo p. shneiderium)); peanut (Arachis hypogaea), clover
(Trifolium spec.), medick (Medicago), kudzu vine (Pueraria lobata),
common lucerne, alfalfa (M. sativa L.), chickpea (Cicer), lentils
(Lens) (Lens culinaris Medik.), lupins (Lupinus); vetches (Vicia),
field bean, broad bean (Vicia faba), vetchling (Lathyrus)
(comprising chickling pea (Lathyrus sativus), heath pea (Lathyrus
tuberosus)); genus Vigna (comprising moth bean (Vigna aconitifolia
(Jacq.) Marechal), adzuki bean (Vigna angularis (Wiiid.) Ohwi &
H. Ohashi), urd bean (Vigna mungo (L.) Hepper), mung bean (Vigna
radiata (L.) R. Wilczek), bambara groundnut (Vigna subterrane (L.)
Verdc.), rice bean (Vigna umbellata (Thunb.) Ohwi & H. Ohashi),
Vigna vexillata (L.) A. Rich., Vigna unguiculata (L.) Walp., in the
three subspecies asparagus bean, cowpea, catjang bean)); pigeonpea
(Cajanus cajan (L.) Millsp.), the genus Macrotyloma (comprising
geocarpa groundnut (Macrotyloma geocarpum (Harms) Marechal &
Baudet), horse bean (Macrotyloma uniflorum (Lam.) Verdc.); goa bean
(Psophocarpus tetragonolobus (L.) DC.), African yam bean
(Sphenostylis stenocarpa (Hochst. ex A. Rich.) Harms), Egyptian
black bean, dolichos bean, lablab bean (Lablab purpureus (L.)
Sweet), yam bean (Pachyrhizus), guar bean (Cyamopsis tetragonolobus
(L.) Taub.); and/or the genus Canavalia (comprising jack bean
(Canavalia ensiformis (L.) DC.), sword bean (Canavalia gladiata
(Jacq.) DC.).
[0345] Further preferred is a plant selected from the group
consisting of beans, soya, pea, clover, kudzu, lucerne, lentils,
lupins, vetches, and groundnut. Most preferably, the plant, plant
part, or plant cell is or is derived from soy.
Methods for the Production of Transgenic Plants
[0346] One embodiment according to the present invention provides a
method for producing a transgenic plant, a transgenic plant part,
or a transgenic plant cell resistant to a fungal pathogen,
preferably of the family Phacosporaceae, for example soybean rust,
wherein the recombinant nucleic acid used to generate a transgenic
plant comprises a promoter that is functional in the plant cell,
operably linked to an RLK1 nucleic acid, which is preferably SEQ ID
NO: 1 or 3, and
a terminator regulatory sequence.
[0347] In one embodiment, the present invention refers to a method
for the production of a transgenic plant, transgenic plant part, or
transgenic plant cell having increased fungal resistance,
comprising [0348] (a) introducing a recombinant vector construct
according to the present invention into a plant, a plant part or a
plant cell and [0349] (b) generating a transgenic plant from the
plant, plant part or plant cell.
[0350] Preferably, the method for the production of the transgenic
plant, transgenic plant part, or transgenic plant cell further
comprises the step [0351] (c) expressing the RLK1 protein,
preferably encoded by [0352] (i) an exogenous nucleic acid having
at least 60% identity with SEQ ID NO: 9, 1, or 3, a functional
fragment thereof, an orthologue or a paralogue thereof, or a splice
variant thereof; [0353] (ii) an exogenous nucleic acid encoding a
protein having at least 60% identity with SEQ ID NO: 10 or 2, or a
functional fragment thereof, an orthologue or a paralogue thereof;
preferably the encoded protein confers enhanced fungal resistance
relative to control plants; [0354] (iii) an exogenous nucleic acid
capable of hybridizing under stringent conditions with a
complementary sequence of any of the nucleic acids according to (i)
or (ii); preferably encoding a RLK1 protein; preferably wherein the
nucleic acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0355] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code.
[0356] Preferably, said introducing and expressing does not
comprise an essentially biological process.
[0357] More preferably, the method for the production of the
transgenic plant, transgenic plant part, or transgenic plant cell
further comprises the step [0358] (c) expressing the RLK1 protein,
preferably encoded by [0359] (i) an exogenous nucleic acid having
at least 60% identity with SEQ ID NO: 1, a functional fragment
thereof, an orthologue or a paralogue thereof, or a splice variant
thereof; [0360] (ii) an exogenous nucleic acid encoding a protein
having at least 60% identity with SEQ ID NO: 2, or a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0361] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0362] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code.
[0363] More preferably, the method for the production of the
transgenic plant, transgenic plant part, or transgenic plant cell
further comprises the step [0364] (c) expressing the RLK1 protein,
preferably encoded by [0365] (i) an exogenous nucleic acid having
at least 60% identity with SEQ ID NO: 9, a functional fragment
thereof, an orthologue or a paralogue thereof, or a splice variant
thereof; [0366] (ii) an exogenous nucleic acid encoding a protein
having at least 60% identity with SEQ ID NO: 10, or a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0367] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0368] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleis acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code.
[0369] Preferably, the method for the production of the transgenic
plant, transgenic plant part, or transgenic plant cell further
comprises the step of selecting a transgenic plant expressing
[0370] (i) an exogenous nucleic acid having at least 60% identity,
preferably at least 70% sequence identity, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% sequence identity, or
even 100% sequence identity with SEQ ID NO: 9, 1, or 3, or a
functional fragment thereof, or an orthologue or a paralogue
thereof, or a splice variant thereof; [0371] (ii) an exogenous
nucleic acid coding for a protein having at least 60% identity,
preferably at least 70% sequence identity, at least 80%, at least
90%, at least 95%, at least 98%, at least 99% sequence identity, or
even 100% sequence identity with SEQ ID NO: 10 or 2, a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0372] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or [0373] (iv) an
exogenous nucleic acid encoding the same RLK1 polypeptide as any of
the nucleic acids of (i) to (iii) above, but differing from the
nucleic acids of (i) to (iii) above due to the degeneracy of the
genetic code.
[0374] Preferably, the method for the production of the transgenic
plant, transgenic plant part, or transgenic plant cell additionally
comprises the step of harvesting the seeds of the transgenic plant
and planting the seeds and growing the seeds to plants, wherein the
grown plant(s) comprises [0375] (i) the exogenous nucleic acid
having at least 60% identity with SEQ ID NO: 9, 1, or 3, a
functional fragment thereof, an orthologue or a paralogue thereof,
or a splice variant thereof; [0376] (ii) the exogenous nucleic acid
encoding a protein having at least 60% identity with SEQ ID NO: 10
or 2, or a functional fragment thereof, an orthologue or a
paralogue thereof; preferably the encoded protein confers enhanced
fungal resistance relative to control plants; [0377] (iii) the
exogenous nucleic acid capable of hybridizing under stringent
conditions with a complementary sequence of any of the nucleic
acids according to (i) or (ii); preferably encoding a RLK1 protein;
preferably wherein the nucleic acid molecule codes for a
polypeptide which has essentially identical properties to the
polypeptide described in SEQ ID NO: 10 or 2; preferably the encoded
protein confers enhanced fungal resistance relative to control
plants; and/or [0378] (iv) the exogenous nucleic acid encoding the
same RLK1 protein as any of the nucleic acids of (i) to (iii)
above, but differing from the nucleic acids of (i) to (iii) above
due to the degeneracy of the genetic code; preferably, the step of
harvesting the seeds of the transgenic plant and planting the seeds
and growing the seeds to plants, wherein the grown plant(s)
comprises [0379] (i) the exogenous nucleic acid having at least 60%
identity with SEQ ID NO: 9, 1, or 3, a functional fragment thereof,
an orthologue or a paralogue thereof, or a splice variant thereof;
[0380] (ii) the exogenous nucleic acid encoding a protein having at
least 60% identity with SEQ ID NO: 10 or 2, or a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0381] (iii) the exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or [0382] (iv) the
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleic acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code; is repeated more than one time, preferably, 1, 2, 3, 4, 5, 6,
8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times.
[0383] The transgenic plants may be selected by known methods as
described above (e.g., by screening for the presence of one or more
markers which are encoded by plant-expressible genes co-transferred
with the RLK1 gene or by directly screening for the RLK1 nucleic
acid).
[0384] Furthermore, the use of the exogenous RLK1 nucleic acid or
the recombinant vector construct comprising the RLK1 nucleic acid
for the transformation of a plant, plant part, or plant cell to
provide a fungal resistant plant, plant part, or plant cell is
provided.
Harvestable Parts and Products
[0385] Harvestable parts of the transgenic plant according to the
present invention are part of the invention. Preferably, the
harvestable parts comprise the RLK1 nucleic acid or RLK1 protein.
The harvestable parts may be seeds, roots, leaves and/or flowers
comprising the RLK1 nucleic acid or RLK1 protein or parts thereof.
Preferred parts of soy plants are soy beans comprising the RLK1
nucleic acid or RLK1 protein.
[0386] Products derived from a transgenic plant according to the
present invention, parts thereof or harvestable parts thereof are
part of the invention. A preferred product is meal or oil,
preferably, soybean meal or soybean oil. Preferably, the soybean
meal and/or oil comprises the RLK1 nucleic acid or RLK1
protein.
Methods for Manufacturing a Product
[0387] In one embodiment the method for the production of a product
comprises [0388] a) growing the plants of the invention or
obtainable by the methods of invention and [0389] b) producing said
product from or by the plants of the invention and/or parts, e.g.
seeds, of these plants.
[0390] In a further embodiment the method comprises the steps a)
growing the plants of the invention, b) removing the harvestable
parts as defined above from the plants and c) producing said
product from or by the harvestable parts of the invention.
[0391] The product may be produced at the site where the plant has
been grown, the plants and/or parts thereof may be removed from the
site where the plants have been grown to produce the product.
Typically, the plant is grown, the desired harvestable parts are
removed from the plant, if feasible in repeated cycles, and the
product made from the harvestable parts of the plant. The step of
growing the plant may be performed only once each time the methods
of the invention is performed, while allowing repeated times the
steps of product production e.g. by repeated removal of harvestable
parts of the plants of the invention and if necessary further
processing of these parts to arrive at the product. It is also
possible that the step of growing the plants of the invention is
repeated and plants or harvestable parts are stored until the
production of the product is then performed once for the
accumulated plants or plant parts. Also, the steps of growing the
plants and producing the product may be performed with an overlap
in time, even simultaneously to a large extend or sequentially.
Generally the plants are grown for some time before the product is
produced.
[0392] In one embodiment the products produced by said methods of
the invention are plant products such as, but not limited to, a
foodstuff, feedstuff, a food supplement, feed supplement, fiber,
cosmetic and/or pharmaceutical. Foodstuffs are regarded as
compositions used for nutrition and/or for supplementing nutrition.
Animal feedstuffs and animal feed supplements, in particular, are
regarded as foodstuffs.
[0393] In another embodiment the inventive methods for the
production are used to make agricultural products such as, but not
limited to, plant extracts, proteins, amino acids, carbohydrates,
fats, oils, polymers, vitamins, and the like.
[0394] It is possible that a plant product consists of one or more
agricultural products to a large extent.
Methods for Breeding/Methods for Plant Improvement/Methods Plant
Variety Production
[0395] The transgenic plants of the invention may be crossed with
similar transgenic plants or with transgenic plants lacking the
nucleic acids of the invention or with non-transgenic plants, using
known methods of plant breeding, to prepare seeds. Further, the
transgenic plant cells or plants of the present invention may
comprise, and/or be crossed to another transgenic plant that
comprises one or more exogenous nucleic acids, thus creating a
"stack" of transgenes in the plant and/or its progeny. The seed is
then planted to obtain a crossed fertile transgenic plant
comprising the RLK1 nucleic acid. The crossed fertile transgenic
plant may have the particular expression cassette inherited through
a female parent or through a male parent. The second plant may be
an inbred plant. The crossed fertile transgenic may be a hybrid.
Also included within the present invention are seeds of any of
these crossed fertile transgenic plants. The seeds of this
invention can be harvested from fertile transgenic plants and be
used to grow progeny generations of transformed plants of this
invention including hybrid plant lines comprising the exogenous
nucleic acid.
[0396] Thus, one embodiment of the present invention is a method
for breeding a fungal resistant plant comprising the steps of
[0397] (a) crossing a transgenic plant described herein or a plant
obtainable by a method described herein with a second plant; [0398]
(b) obtaining a seed or seeds resulting from the crossing step
described in (a); [0399] (c) planting said seed or seeds and
growing the seed or seeds to plants; and [0400] (d) selecting from
said plants the plants expressing an RLK1 protein, preferably
encoded by [0401] (i) an exogenous nucleic acid having at least 60%
identity with SEQ ID NO: 9, 1, or 3, a functional fragment thereof,
an orthologue or a paralogue thereof, or a splice variant thereof;
[0402] (ii) an exogenous nucleic acid encoding a protein having at
least 60% identity with SEQ ID NO: 10 or 2, or a functional
fragment thereof, an orthologue or a paralogue thereof; preferably
the encoded protein confers enhanced fungal resistance relative to
control plants; [0403] (iii) an exogenous nucleic acid capable of
hybridizing under stringent conditions with a complementary
sequence of any of the nucleic acids according to (i) or (ii);
preferably encoding a RLK1 protein; preferably wherein the nucleic
acid molecule codes for a polypeptide which has essentially
identical properties to the polypeptide described in SEQ ID NO: 10
or 2; preferably the encoded protein confers enhanced fungal
resistance relative to control plants; and/or by [0404] (iv) an
exogenous nucleic acid encoding the same RLK1 protein as any of the
nucleis acids of (i) to (iii) above, but differing from the nucleic
acids of (i) to (iii) above due to the degeneracy of the genetic
code.
[0405] Another preferred embodiment is a method for plant
improvement comprising [0406] (a) obtaining a transgenic plant by
any of the methods of the present invention; [0407] (b) combining
within one plant cell the genetic material of at least one plant
cell of the plant of (a) with the genetic material of at least one
cell differing in one or more gene from the plant cells of the
plants of (a) or crossing the transgenic plant of (a) with a second
plant; [0408] (c) obtaining seed from at least one plant generated
from the one plant cell of (b) or the plant of the cross of step
(b); [0409] (d) planting said seeds and growing the seeds to
plants; and [0410] (e) selecting from said plants, plants
expressing the nucleic acid encoding the RLK1 protein; and
optionally [0411] (f) producing propagation material from the
plants expressing the nucleic acid encoding the RLK1 protein.
[0412] The transgenic plants may be selected by known methods as
described above (e.g., by screening for the presence of one or more
markers which are encoded by plant-expressible genes co-transferred
with the RLK1 gene or screening for the RLK1 nucleic acid
itself).
[0413] According to the present invention, the introduced RLK1
nucleic acid may be maintained in the plant cell stably if it is
incorporated into a non-chromosomal autonomous replicon or
integrated into the plant chromosomes. Whether present in an
extra-chromosomal non-replicating or replicating vector construct
or a vector construct that is integrated into a chromosome, the
exogenous RLK1 nucleic acid preferably resides in a plant
expression cassette. A plant expression cassette preferably
contains regulatory sequences capable of driving gene expression in
plant cells that are functional linked so that each sequence can
fulfill its function, for example, termination of transcription by
polyadenylation signals. Preferred polyadenylation signals are
those originating from Agrobacterium tumefaciens t-DNA such as the
gene 3 known as octopine synthase of the Ti-plasmid pTiACH5 (Gielen
et al., 1984, EMBO J. 3:835) or functional equivalents thereof, but
also all other terminators functionally active in plants are
suitable. As plant gene expression is very often not limited on
transcriptional levels, a plant expression cassette preferably
contains other functional linked sequences like translational
enhancers such as the overdrive-sequence containing the
5'-untranslated leader sequence from tobacco mosaic virus
increasing the polypeptide per RNA ratio (Gallie et al., 1987,
Nucl. Acids Research 15:8693-8711). Examples of plant expression
vectors include those detailed in: Becker, D. et al., 1992, New
plant binary vectors with selectable markers located proximal to
the left border, Plant Mol. Biol. 20:1195-1197; Bevan, M. W., 1984,
Binary Agrobacterium vectors for plant transformation, Nucl. Acid.
Res. 12:8711-8721; and Vectors for Gene Transfer in Higher Plants;
in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds.:
Kung and R. Wu, Academic Press, 1993, S. 15-38.
EXAMPLES
[0414] The following examples are not intended to limit the scope
of the claims to the invention, but are rather intended to be
exemplary of certain embodiments. Any variations in the exemplified
methods that occur to the skilled artisan are intended to fall
within the scope of the present invention.
Example 1
General Methods
[0415] The chemical synthesis of oligonucleotides can be affected,
for example, in the known fashion using the phosphoamidite method
(Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The
cloning steps carried out for the purposes of the present invention
such as, for example, restriction cleavages, agarose gel
electrophoresis, purification of DNA fragments, transfer of nucleic
acids to nitrocellulose and nylon membranes, linking DNA fragments,
transformation of E. coli cells, bacterial cultures, phage
multiplication and sequence analysis of recombinant DNA, are
carried out as described by Sambrook et al. Cold Spring Harbor
Laboratory Press (1989), ISBN 0-87969-309-6. The sequencing of
recombinant DNA molecules is carried out with an MWG-Licor laser
fluorescence DNA sequencer following the method of Sanger (Sanger
et al., Proc. Natl. Acad. Sci. USA 74, 5463 (1977)).
Example 2
Cloning of Overexpression Vector Constructs
[0416] A complex cDNA library was produced from Arabidopsis
thaliana (ecotype Col-0) RNA by using the Superscript II cDNA
synthesis kit (Invitrogen). All steps of cDNA preparation and
purification were performed according as described in the
manual.
[0417] First, the RLK1 sequence from 5'UTR to 3'UTR (including the
full-length HCP5) was specifically amplified from the cDNA by PCR
as described in the protocol of the Phusion hot-start polymerase
(Finnzymes). The composition of the PCR (according to the protocol
of the Phusion hot-start polymerase) was as follows: 1.times.PCR
buffer, 1 mM of each dNTP, 100 ng cDNA of Arabidopsis thaliana (var
Columbia-0, see above), 40 pmol forward primer, 40 pmol reverse
primer, 1 .mu.l Phusion hot-start polymerase.
[0418] The amplification cycles were as follows:
[0419] 1 cycle of 30 seconds at 98.degree. C., followed by 35
cycles of in each case 10 seconds at 98.degree. C., 30 seconds at
58.degree. C. and 30 seconds at 72.degree. C., followed by 1 cycle
of 10 minutes at 72.degree. C., then 14.degree. C.
[0420] The primers (as shown in SEQ ID NO: 4 and 5) were designed
in a way that the specifically bind to sequences in the 5' UTR
upstream of the start ATG and in the 3'UTR downstream of the stop
codon of the HCP-5 coding sequence.
TABLE-US-00007 i) foward primer: 5'- GGCTGGAGGCTGGAGATTATTTGG -3'
(SEQ ID NO: 4) ii) reverse primer: 5'- AAGGCATGGTCGGTGCTATC -3'
(SEQ ID NO: 5)
[0421] The amplified fragment was eluated and purified from an 1%
agarose gel by using the Nucleospin Extract II Kit (Macherey and
Nagel, dueren, Germany). To generate a cDNA fragment that contains
attB sites for further GATEWAY (Invitrogen) cloning, a Re--PCR was
performed using the Phusion hot-start polymerase (Finnzymes).
[0422] The composition of the PCR (according to the protocol of the
Phusion hot-start polymerase) was as follows: 1.times.PCR buffer, 1
mM of each dNTP, 10-50 ng template DNA derived from the previous
PCR, 40 pmol forward primer, 40 pmol reverse primer, 1 .mu.l
Phusion hot-start polymerase.
[0423] The amplification cycles were as follows:
[0424] 1 cycle of 30 seconds at 98.degree. C., followed by 35
cycles of in each case 10 seconds at 98.degree. C., 30 seconds at
70.degree. C. and 60 seconds at 72.degree. C., followed by 1 cycle
of 10 minutes at 72.degree. C., then 14.degree. C.
[0425] The primer sequences were designed to specifically amplify
the RLK1 ORF (Start-ATG to stop) and to add attB sites for
GATEWAY.RTM. (Invitrogen, Life Technologies, Carlsbad, Calif., USA)
mediated cloning of the plant transformation vector:
TABLE-US-00008 i) foward primer: (SEQ ID NO: 6) 5'-
GGGGACAAGTTTGTACAAAAAAGCAGGCTATGAGACTTTACTTA TC -3' ii) reverse
primer: (SEQ ID NO: 7) 5'-
GGGGACCACTTTGTACAAGAAAGCTGGGTTTATTTACTCCTATCAT CGTCG -3'
[0426] The amplified fragment was cloned into a Gateway pENTRY-B
vector (Invitrogen, Life Technologies, Carlsbad, Calif., USA) by
using a conventional GATEWAY.RTM. BP-reaction according to the
manual of the supplier (Invitrogen). The BP reaction was performed
in a way that the full-length RLK1 fragment is located in sense
direction between the attL1 and attL2 recombination sites.
[0427] It is also possible to generate all DNA fragments mentioned
in this invention by DNA synthesis (Geneart, Regensburg,
Germany).
[0428] To obtain the binary plant transformation vector, a triple
LR reaction (Gateway system, Invitrogen, Life Technologies,
Carlsbad, Calif., USA) was performed according to manufacturer's
protocol by using a pENTRY-A vector containing a parsley ubiquitine
promoter, the RLK1 gene in a pENTRY-B vector and a pENTRY-C vector
containing the terminator of the cathepsin D inhibitor gene from
Solanum tuberosum. As target a binary pDEST vector was used which
is composed of: (1) a Spectinomycin/Streptomycin resistance
cassette for bacterial selection, (2) a pVS1 origin for replication
in Agrobacteria, (3) a pBR322 origin of replication for stable
maintenance in E. coli, and (4) between the right and left border
an AHAS selection under control of a pcUbi-promoter (see FIG. 2).
The recombination reaction was transformed into E. coli (DH5alpha),
mini-prepped and screened by specific restriction digestions. A
positive clone from each vector construct was sequenced and
submitted soy transformation.
Example 3
Soy Transformation
[0429] The expression vector constructs (see example 2) were
transformed into soy. 3.1 Sterilization and Germination of Soy
Seeds
[0430] Virtually any seed of any soy variety can be employed in the
method of the invention. A variety of soybean cultivar (including
Jack, Williams 82, Jake, Stoddard and Resnik) is appropriate for
soy transformation. Soy seeds were sterilized in a chamber with a
chlorine gas produced by adding 3.5 ml 12N HCl drop wise into 100
ml bleach (5.25% sodium hypochlorite) in a desiccator with a
tightly fitting lid. After 24 to 48 hours in the chamber, seeds
were removed and approximately 18 to 20 seeds were plated on solid
GM medium with or without 5 .mu.M 6-benzyl-aminopurine (BAP) in 100
mm Petri dishes. Seedlings without BAP are more elongated and roots
develop, especially secondary and lateral root formation. BAP
strengthens the seedling by forming a shorter and stockier
seedling.
[0431] Seven-day-old seedlings grown in the light (>100
.mu.Einstein/m.sup.2s) at 25.degree. C. were used for explant
material for the three-explant types. At this time, the seed coat
was split, and the epicotyl with the unifoliate leaves have grown
to, at minimum, the length of the cotyledons. The epicotyl should
be at least 0.5 cm to avoid the cotyledonary-node tissue (since
soycultivars and seed lots may vary in the developmental time a
description of the germination stage is more accurate than a
specific germination time).
[0432] For inoculation of entire seedlings, see Method A (example
3.3.1 and 3.3.2) or leaf explants, see Method B (example
3.3.3).
[0433] For method C (see example 3.3.4), the hypocotyl and one and
a half or part of both cotyledons were removed from each seedling.
The seedlings were then placed on propagation media for 2 to 4
weeks. The seedlings produce several branched shoots to obtain
explants from. The majority of the explants originated from the
plantlet growing from the apical bud. These explants were
preferably used as target tissue.
3.2--Growth and Preparation of Agrobacterium Culture
[0434] Agrobacterium cultures were prepared by streaking
Agrobacterium (e.g., A. tumefaciens or A. rhizogenes) carrying the
desired binary vector (e.g. H. Klee. R. Horsch and S. Rogers 1987
Agrobacterium-Mediated Plant Transformation and its further
Applications to Plant Biology; Annual Review of Plant Physiology
Vol. 38: 467-486) onto solid YEP growth medium (YEP media: 10 g
yeast extract, 10 g Bacto Peptone, 5 g NaCl, Adjust pH to 7.0, and
bring final volume to 1 liter with H2O, for YEP agar plates add 20
g Agar, autoclave) and incubating at 25.degree. C. until colonies
appeared (about 2 days). Depending on the selectable marker genes
present on the Ti or Ri plasmid, the binary vector, and the
bacterial chromosomes, different selection compounds were be used
for A. tumefaciens and A. rhizogenes selection in the YEP solid and
liquid media. Various Agrobacterium strains can be used for the
transformation method.
[0435] After approximately two days, a single colony (with a
sterile toothpick) was picked and 50 ml of liquid YEP was
inoculated with antibiotics and shaken at 175 rpm (25.degree. C.)
until an OD.sub.600 between 0.8-1.0 is reached (approximately 2 d).
Working glycerol stocks (15%) for transformation are prepared and
one-ml of Agrobacterium stock aliquoted into 1.5 ml Eppendorf tubes
then stored at -80.degree. C.
[0436] The day before explant inoculation, 200 ml of YEP were
inoculated with 5 .mu.l to 3 ml of working Agrobacterium stock in a
500 ml Erlenmeyer flask. The flask was shaken overnight at
25.degree. C. until the OD.sub.600 was between 0.8 and 1.0. Before
preparing the soy explants, the Agrobacteria were pelleted by
centrifugation for 10 min at 5,500.times.g at 20.degree. C. The
pellet was resuspended in liquid CCM to the desired density
(OD.sub.600 0.5-0.8) and placed at room temperature at least 30 min
before use.
3.3--Explant Preparation and Co-Cultivation (Inoculation)
3.3.1 Method A: Explant Preparation on the Day of
Transformation.
[0437] Seedlings at this time had elongated epicotyls from at least
0.5 cm but generally between 0.5 and 2 cm. Elongated epicotyls up
to 4 cm in length had been successfully employed. Explants were
then prepared with: i) with or without some roots, ii) with a
partial, one or both cotyledons, all preformed leaves were removed
including apical meristem, and the node located at the first set of
leaves was injured with several cuts using a sharp scalpel.
[0438] This cutting at the node not only induced Agrobacterium
infection but also distributed the axillary meristem cells and
damaged pre-formed shoots. After wounding and preparation, the
explants were set aside in a Petri dish and subsequently
co-cultivated with the liquid CCM/Agrobacterium mixture for 30
minutes. The explants were then removed from the liquid medium and
plated on top of a sterile filter paper on 15.times.100 mm Petri
plates with solid co-cultivation medium. The wounded target tissues
were placed such that they are in direct contact with the
medium.
3.3.2 Modified Method A: Epicotyl Explant Preparation
[0439] Soyepicotyl segments prepared from 4 to 8 d old seedlings
were used as explants for regeneration and transformation. Seeds of
soya cv. L00106CN, 93-41131 and Jack were germinated in 1/10 MS
salts or a similar composition medium with or without cytokinins
for 4 to 8 d. Epicotyl explants were prepared by removing the
cotyledonary node and stem node from the stem section. The epicotyl
was cut into 2 to 5 segments. Especially preferred are segments
attached to the primary or higher node comprising axillary
meristematic tissue.
[0440] The explants were used for Agrobacterium infection.
Agrobacterium AGL1 harboring a plasmid with the gene of interest
(GOI) and the AHAS, bar or dsdA selectable marker gene was cultured
in LB medium with appropriate antibiotics overnight, harvested and
resuspended in a inoculation medium with acetosyringone. Freshly
prepared epicotyl segments were soaked in the Agrobacterium
suspension for 30 to 60 min and then the explants were blotted dry
on sterile filter papers. The inoculated explants were then
cultured on a coculture medium with L-cysteine and TTD and other
chemicals such as acetosyringone for increasing T-DNA delivery for
2 to 4 d. The infected epicotyl explants were then placed on a
shoot induction medium with selection agents such as imazapyr (for
AHAS gene), glufosinate (for bar gene), or D-serine (for dsdA
gene). The regenerated shoots were subcultured on elongation medium
with the selective agent.
[0441] For regeneration of transgenic plants the segments were then
cultured on a medium with cytokinins such as BAP, TDZ and/or
Kinetin for shoot induction. After 4 to 8 weeks, the cultured
tissues were transferred to a medium with lower concentration of
cytokinin for shoot elongation. Elongated shoots were transferred
to a medium with auxin for rooting and plant development. Multiple
shoots were regenerated.
[0442] Many stable transformed sectors showing strong cDNA
expression were recovered. Soybean plants were regenerated from
epicotyl explants. Efficient T-DNA delivery and stable transformed
sectors were demonstrated.
3.3.3 Method B: Leaf Explants
[0443] For the preparation of the leaf explant the cotyledon was
removed from the hypocotyl. The cotyledons were separated from one
another and the epicotyl is removed. The primary leaves, which
consist of the lamina, the petiole, and the stipules, were removed
from the epicotyl by carefully cutting at the base of the stipules
such that the axillary meristems were included on the explant. To
wound the explant as well as to stimulate de novo shoot formation,
any pre-formed shoots were removed and the area between the
stipules was cut with a sharp scalpel 3 to 5 times.
[0444] The explants are either completely immersed or the wounded
petiole end dipped into the Agrobacterium suspension immediately
after explant preparation. After inoculation, the explants are
blotted onto sterile filter paper to remove excess Agrobacterium
culture and place explants with the wounded side in contact with a
round 7 cm Whatman paper overlaying the solid CCM medium (see
above). This filter paper prevents A. tumefaciens overgrowth on the
soy-explants. Wrap five plates with Parafilm.TM. "M" (American
National Can, Chicago, Ill., USA) and incubate for three to five
days in the dark or light at 25.degree. C.
3.3.4 Method C: Propagated Axillary Meristem
[0445] For the preparation of the propagated axillary meristem
explant propagated 3-4 week-old plantlets were used. Axillary
meristem explants can be pre-pared from the first to the fourth
node. An average of three to four explants could be obtained from
each seedling. The explants were prepared from plantlets by cutting
0.5 to 1.0 cm below the axillary node on the internode and removing
the petiole and leaf from the explant. The tip where the axillary
meristems lie was cut with a scalpel to induce de novo shoot growth
and allow access of target cells to the Agrobacterium. Therefore, a
0.5 cm explant included the stem and a bud.
[0446] Once cut, the explants were immediately placed in the
Agrobacterium suspension for 20 to 30 minutes. After inoculation,
the explants were blotted onto sterile filter paper to remove
excess Agrobacterium culture then placed almost completely immersed
in solid CCM or on top of a round 7 cm filter paper overlaying the
solid CCM, depending on the Agrobacterium strain. This filter paper
prevents Agrobacterium overgrowth on the soy-explants. Plates were
wrapped with Parafilm.TM. "M" (American National Can, Chicago,
Ill., USA) and incubated for two to three days in the dark at
25.degree. C.
3.4--Shoot Induction
[0447] After 3 to 5 days co-cultivation in the dark at 25.degree.
C., the explants were rinsed in liquid SIM medium (to remove excess
Agrobacterium) (SIM, see Olhoft et al 2007 A novel Agrobacterium
rhizogenes-mediated transformation method of soy using primary-node
explants from seedlings In Vitro Cell. Dev. Biol.--Plant (2007)
43:536-549; to remove excess Agrobacterium) or Modwash medium
(1.times.B5 major salts, 1.times.B5 minor salts, 1.times.MSIII
iron, 3% Sucrose, 1.times. B5 vitamins, 30 mM MES, 350 mg/L
Timentin.TM. pH 5.6, WO 2005/121345) and blotted dry on sterile
filter paper (to prevent damage especially on the lamina) before
placing on the solid SIM medium. The approximately 5 explants
(Method A) or 10 to 20 (Methods B and C) explants were placed such
that the target tissue was in direct contact with the medium.
During the first 2 weeks, the explants could be cultured with or
without selective medium. Preferably, explants were transferred
onto SIM without selection for one week.
[0448] For leaf explants (Method B), the explant should be placed
into the medium such that it is perpendicular to the surface of the
medium with the petiole imbedded into the medium and the lamina out
of the medium.
[0449] For propagated axillary meristem (Method C), the explant was
placed into the medium such that it was parallel to the surface of
the medium (basipetal) with the explant partially embedded into the
medium.
[0450] Wrap plates with Scotch 394 venting tape (3M, St. Paul,
Minn., USA) were placed in a growth chamber for two weeks with a
temperature averaging 25.degree. C. under 18 h light/6 h dark cycle
at 70-100 .mu.E/m.sup.2s. The explants remained on the SIM medium
with or without selection until de novo shoot growth occurred at
the target area (e.g., axillary meristems at the first node above
the epicotyl). Transfers to fresh medium can occur during this
time. Explants were transferred from the SIM with or without
selection to SIM with selection after about one week. At this time,
there was considerable de novo shoot development at the base of the
petiole of the leaf explants in a variety of SIM (Method B), at the
primary node for seedling explants (Method A), and at the axillary
nodes of propagated explants (Method C).
[0451] Preferably, all shoots formed before transformation were
removed up to 2 weeks after co-cultivation to stimulate new growth
from the meristems. This helped to reduce chimerism in the primary
transformant and increase amplification of transgenic meristematic
cells. During this time the explant may or may not be cut into
smaller pieces (i.e. detaching the node from the explant by cutting
the epicotyl).
3.5--Shoot Elongation
[0452] After 2 to 4 weeks (or until a mass of shoots was formed) on
SIM medium (preferably with selection), the explants were
transferred to SEM medium (shoot elongation medium, see Olhoft et
al 2007 A novel Agrobacterium rhizogenes-mediated transformation
method of soy using primary-node explants from seedlings. In Vitro
Cell. Dev. Biol. Plant (2007) 43:536-549) that stimulates shoot
elongation of the shoot primordia. This medium may or may not
contain a selection compound.
[0453] After every 2 to 3 weeks, the explants were transferred to
fresh SEM medium (preferably containing selection) after carefully
removing dead tissue. The explants should hold together and not
fragment into pieces and retain somewhat healthy. The explants were
continued to be transferred until the explant dies or shoots
elongate. Elongated shoots >3 cm were removed and placed into RM
medium for about 1 week (Method A and B), or about 2 to 4 weeks
depending on the cultivar (Method C) at which time roots began to
form. In the case of explants with roots, they were transferred
directly into soil. Rooted shoots were transferred to soil and
hardened in a growth chamber for 2 to 3 weeks before transferring
to the greenhouse. Regenerated plants obtained using this method
were fertile and produced on average 500 seeds per plant.
[0454] After 5 days of co-cultivation with Agrobacterium
tumefaciens transient expression of the gene of interest (GOI) was
widespread on the seedling axillary meristem explants especially in
the regions wounding during explant preparation (Method A).
Explants were placed into shoot induction medium without selection
to see how the primary-node responds to shoot induction and
regeneration. Thus far, greater than 70% of the explants were
formed new shoots at this region. Expression of the GOI was stable
after 14 days on SIM, implying integration of the T-DNA into the
soy genome. In addition, preliminary experiments resulted in the
formation of cDNA expressing shoots forming after 3 weeks on
SIM.
[0455] For Method C, the average regeneration time of a soy
plantlet using the propagated axillary meristem protocol was 14
weeks from explant inoculation. Therefore, this method has a quick
regeneration time that leads to fertile, healthy soy plants.
Example 4
Pathogen Assay
4.1. Growth of Plants
[0456] 10 T.sub.1 plants per event were potted and grown for 3-4
weeks in the phytochamber (16 h-dayund 8 h-night-Rhythm at a
temperature of 16 and 22.degree. C. and a humidity of 75%) till the
first 2 trifoliate leaves were fully expanded.
4.2 Inoculation
[0457] The plants were inoculated with P. pachyrhizi.
[0458] In order to obtain appropriate spore material for the
inoculation, soybean leaves which had been infected with rust 15-20
days ago, were taken 2-3 days before the inoculation and
transferred to agar plates (1% agar in H2O). The leaves were placed
with their upper side onto the agar, which allowed the fungus to
grow through the tissue and to produce very young spores. For the
inoculation solution, the spores were knocked off the leaves and
were added to a Tween-H2O solution. The counting of spores was
performed under a light microscope by means of a Thoma counting
chamber. For the inoculation of the plants, the spore suspension
was added into a compressed-air operated spray flask and applied
uniformly onto the plants or the leaves until the leaf surface is
well moisturized. For macroscopic assays we used a spore density of
1-5.times.10.sup.5 spores/ml. For the microscopy, a density of
>5.times.10.sup.5 spores/m.sup.1 is used. The inoculated plants
were placed for 24 hours in a greenhouse chamber with an average of
22.degree. C. and >90% of air humidity. The following
cultivation was performed in a chamber with an average of
25.degree. C. and 70% of air humidity.
Example 5
Microscopical Screening
[0459] For the evaluation of the pathogen development, the
inoculated leaves of plants were stained with aniline blue 48 hours
after infection.
[0460] The aniline blue staining serves for the detection of
fluorescent substances. During the defense reactions in host
interactions and non-host interactions, substances such as phenols,
callose or lignin accumulated or were produced and were
incorporated at the cell wall either locally in papillae or in the
whole cell (hypersensitive reaction, HR). Complexes were formed in
association with aniline blue, which lead e.g. in the case of
callose to yellow fluorescence. The leaf material was transferred
to falcon tubes or dishes containing destaining solution II
(ethanol/acetic acid 6/1) and was incubated in a water bath at
90.degree. C. for 10-15 minutes. The destaining solution II was
removed immediately thereafter, and the leaves were washed 2.times.
with water. For the staining, the leaves were incubated for 1.5-2
hours in staining solution II (0.05% aniline blue=methyl blue,
0.067 M di-potassium hydrogen phosphate) and analyzed by microscopy
immediately thereafter.
[0461] The different interaction types were evaluated (counted) by
microscopy. An Olympus UV microscope BX61 (incident light) and a UV
Longpath filter (excitation: 375/15, Beam splitter: 405 LP) are
used. After aniline blue staining, the spores appeared blue under
UV light. The papillae could be recognized beneath the fungal
appressorium by a green/yellow staining. The hypersensitive
reaction (HR) was characterized by a whole cell fluorescence.
Example 6
Evaluating the Susceptibility to Soybean Rust
[0462] The progression of the soybean rust disease was scored by
the estimation of the diseased area (area which was covered by
sporulating uredinia) on the backside (abaxial side) of the leaf.
Additionally the yellowing of the leaf was taken into account (for
scheme see FIG. 1).
[0463] At all 42 T.sub.1 soybean plants (5 independent events, 8-10
plants each) expressing the RLK1 protein were inoculated with
spores of Phakopsora pachyrhizi. The macroscopic disease symptoms
caused by P. pachyrhizi on the inoculated soybean plants were
scored 14 days after inoculation.
[0464] The average of the percentage of the leaf area showing
fungal colonies or strong yellowing/browning on all leaves was
considered as diseased leaf area. At all 42 soybean T.sub.1 plants
expressing RLK1 (expression checked by RT-PCR) were evaluated in
parallel to non-transgenic control plants. Non-transgenic soy
plants grown in parallel to the transgenic plants were used as
control. The average of the diseased leaf area is shown in FIG. 7
for plants exogenously expressing RLK1 compared with wildtype
plants. Overexpression of RLK1 reduces the diseased leaf area in
comparison to non-transgenic control plants by 29.0% in average
over all events generated. This data clearly indicates that the
in-planta expression of the RLK1 expression vector construct lead
to a lower disease scoring of transgenic plants compared to
non-transgenic controls. So, the expression of RLK1 (as shown in
SEQ ID NO: 1) in soybean significantly (*: p<0.05) increases the
resistance of soybean against soybean rust.
Sequence CWU 1
1
1011995DNAArabidopsis thaliana 1atgagacttt acttatcttc aacgatgcag
ctttctctta tgagtcttgt tctagggttc 60ctctttgttt cctgtgacgc gtttgcctct
aaagaagttg aagcagttag aagattcaag 120gaagccattt ataaggaccc
attgctagtt atgtctaatt ggaatgtccc caatttgagt 180ccttgtgatt
ggaatggcat taaatgttct ccatctaagg atcacattat caagataaat
240atatcgggga catcgatgag agggtttctt gtgccagaac ttggtcaaat
aacctacttg 300caagaactga tcctgcgtgg gaacattcta atggggacaa
taccaaagga gataggaaag 360ttaaagaaac tcaagatctt agacctggga
aacaatcatt tgacaggacc gattccagca 420gagatcggga aattgtcaag
gattaagaca ataaaccttc agtccaatgg tttaatagga 480aagttacctc
cagagattgg aaacttgaag caccttaaag aacttcttat tggcaggaat
540aggcttcgag gaagtattcc tattgccgcg aaaacatcaa aaaagtatgc
ttcaaatcca 600agtgcaaaca tcagtggttt gtgcaagtct tctctattta
aagtggcaga tttctcttac 660aactttttcg agggaagagt tccgagttgc
ttggattacc tcccaataac gagctttcaa 720ggaaactgca tgaaaaccat
ggatgttaag cagagacctc tttcagaatg tgctcgctta 780gctgtaaccg
tggccaagaa gaagcatcga gcatcgagac aaacatggct tcggaatttt
840gagatagtca cgggatcatc agttggcttg ctctttctag tcgtaatgtt
ctctgcatgt 900agcttgtgca aaataaagcg ctctctcatc gttccctgga
agaaatctgc aagtgaaaag 960gagaagttca cggtctacgt tgattctgaa
atgctgaagg atgtttcaag atatacaaga 1020caagagctag aagtagcatg
tgaagacttc agcaacatca ttgattctag tgcagagagt 1080cagatttaca
aaggaacgat caaaggcggg actgagatcg cggttatctc tctctgcgtt
1140aaagaagaaa attggactgg atatcttgag cttaatttcc agagagaggt
tgcggctttg 1200gctagattaa accatgagaa tgcggggaaa ttactgggat
actgtaaaga gagtacaccg 1260ttcacaagaa tgcttgtgtt tgagtatgca
tcaaacggga cactatacga ccatctccac 1320tatgcggacg ggagtttagt
atcgtgggca aaacgcatga aaattgttat aggcatcgca 1380cgtggtctca
agtaccttca tactgaactc catcctccat ttacagtctc tgagttgagc
1440tcaactgcag tgtatctcac tgaagatttt actcccaaac tggttgattt
cgaatgctgg 1500aagattattc aggtgagatc agagaagaac ctgaagaata
tctgtaatga aggagcaata 1560tgtgtacttc ccaatgcaat ggaacaccga
gatatggatt tacaagggaa tatctactca 1620tttggcatac ttttgctgga
aattgtaagc ggaagacctt cttattgcca agacagaggt 1680tgcttggttg
aatgggtaag ggagaaaaac cttggtgcac cagatgtgat ggctagcttg
1740gtggatcctg agctcaagca tttcaagcaa aaagaacttg aggcagtatg
tgaagtggca 1800agccaatgtc tgaacttgga ccagaatgaa aaagacaagg
ataagctttc ttgttcgatt 1860caagcgcttt gtgagacact agagagtaga
atcactgtgt ccatttctgc agaattcaaa 1920tcgtcttctc tggcgtgggc
cgagctagcg ctggcctcgc cttctaacga agacgacgat 1980gataggagta aataa
19952664PRTArabidopsis thaliana 2Met Arg Leu Tyr Leu Ser Ser Thr
Met Gln Leu Ser Leu Met Ser Leu 1 5 10 15 Val Leu Gly Phe Leu Phe
Val Ser Cys Asp Ala Phe Ala Ser Lys Glu 20 25 30 Val Glu Ala Val
Arg Arg Phe Lys Glu Ala Ile Tyr Lys Asp Pro Leu 35 40 45 Leu Val
Met Ser Asn Trp Asn Val Pro Asn Leu Ser Pro Cys Asp Trp 50 55 60
Asn Gly Ile Lys Cys Ser Pro Ser Lys Asp His Ile Ile Lys Ile Asn 65
70 75 80 Ile Ser Gly Thr Ser Met Arg Gly Phe Leu Val Pro Glu Leu
Gly Gln 85 90 95 Ile Thr Tyr Leu Gln Glu Leu Ile Leu Arg Gly Asn
Ile Leu Met Gly 100 105 110 Thr Ile Pro Lys Glu Ile Gly Lys Leu Lys
Lys Leu Lys Ile Leu Asp 115 120 125 Leu Gly Asn Asn His Leu Thr Gly
Pro Ile Pro Ala Glu Ile Gly Lys 130 135 140 Leu Ser Arg Ile Lys Thr
Ile Asn Leu Gln Ser Asn Gly Leu Ile Gly 145 150 155 160 Lys Leu Pro
Pro Glu Ile Gly Asn Leu Lys His Leu Lys Glu Leu Leu 165 170 175 Ile
Gly Arg Asn Arg Leu Arg Gly Ser Ile Pro Ile Ala Ala Lys Thr 180 185
190 Ser Lys Lys Tyr Ala Ser Asn Pro Ser Ala Asn Ile Ser Gly Leu Cys
195 200 205 Lys Ser Ser Leu Phe Lys Val Ala Asp Phe Ser Tyr Asn Phe
Phe Glu 210 215 220 Gly Arg Val Pro Ser Cys Leu Asp Tyr Leu Pro Ile
Thr Ser Phe Gln 225 230 235 240 Gly Asn Cys Met Lys Thr Met Asp Val
Lys Gln Arg Pro Leu Ser Glu 245 250 255 Cys Ala Arg Leu Ala Val Thr
Val Ala Lys Lys Lys His Arg Ala Ser 260 265 270 Arg Gln Thr Trp Leu
Arg Asn Phe Glu Ile Val Thr Gly Ser Ser Val 275 280 285 Gly Leu Leu
Phe Leu Val Val Met Phe Ser Ala Cys Ser Leu Cys Lys 290 295 300 Ile
Lys Arg Ser Leu Ile Val Pro Trp Lys Lys Ser Ala Ser Glu Lys 305 310
315 320 Glu Lys Phe Thr Val Tyr Val Asp Ser Glu Met Leu Lys Asp Val
Ser 325 330 335 Arg Tyr Thr Arg Gln Glu Leu Glu Val Ala Cys Glu Asp
Phe Ser Asn 340 345 350 Ile Ile Asp Ser Ser Ala Glu Ser Gln Ile Tyr
Lys Gly Thr Ile Lys 355 360 365 Gly Gly Thr Glu Ile Ala Val Ile Ser
Leu Cys Val Lys Glu Glu Asn 370 375 380 Trp Thr Gly Tyr Leu Glu Leu
Asn Phe Gln Arg Glu Val Ala Ala Leu 385 390 395 400 Ala Arg Leu Asn
His Glu Asn Ala Gly Lys Leu Leu Gly Tyr Cys Lys 405 410 415 Glu Ser
Thr Pro Phe Thr Arg Met Leu Val Phe Glu Tyr Ala Ser Asn 420 425 430
Gly Thr Leu Tyr Asp His Leu His Tyr Ala Asp Gly Ser Leu Val Ser 435
440 445 Trp Ala Lys Arg Met Lys Ile Val Ile Gly Ile Ala Arg Gly Leu
Lys 450 455 460 Tyr Leu His Thr Glu Leu His Pro Pro Phe Thr Val Ser
Glu Leu Ser 465 470 475 480 Ser Thr Ala Val Tyr Leu Thr Glu Asp Phe
Thr Pro Lys Leu Val Asp 485 490 495 Phe Glu Cys Trp Lys Ile Ile Gln
Val Arg Ser Glu Lys Asn Leu Lys 500 505 510 Asn Ile Cys Asn Glu Gly
Ala Ile Cys Val Leu Pro Asn Ala Met Glu 515 520 525 His Arg Asp Met
Asp Leu Gln Gly Asn Ile Tyr Ser Phe Gly Ile Leu 530 535 540 Leu Leu
Glu Ile Val Ser Gly Arg Pro Ser Tyr Cys Gln Asp Arg Gly 545 550 555
560 Cys Leu Val Glu Trp Val Arg Glu Lys Asn Leu Gly Ala Pro Asp Val
565 570 575 Met Ala Ser Leu Val Asp Pro Glu Leu Lys His Phe Lys Gln
Lys Glu 580 585 590 Leu Glu Ala Val Cys Glu Val Ala Ser Gln Cys Leu
Asn Leu Asp Gln 595 600 605 Asn Glu Lys Asp Lys Asp Lys Leu Ser Cys
Ser Ile Gln Ala Leu Cys 610 615 620 Glu Thr Leu Glu Ser Arg Ile Thr
Val Ser Ile Ser Ala Glu Phe Lys 625 630 635 640 Ser Ser Ser Leu Ala
Trp Ala Glu Leu Ala Leu Ala Ser Pro Ser Asn 645 650 655 Glu Asp Asp
Asp Asp Arg Ser Lys 660 34622DNAArabidopsis thaliana 3ttaaaattta
ttggaaacgt atatattttg tttttattta atgtaataat attttgtctt 60ctttcacatt
ttaagcaggt tatatattga ctataaatgt ttcacagata gatgcatgtt
120gatacatttt tccttgtata caaaatacac attacagtta aataaattta
tttatttctg 180gcttacaatt agagatatta ctgtgaagtg tgaacatgca
ttagatggga aagaaatata 240aaacaatttc attacataaa attgggatct
attactaatt aaatgtggaa taatcttaat 300tttagtcaaa gttataggga
cacatattta aataaaagtg atatctttct tttctaaaag 360acaaaattga
aaagcaaaat gtcttcttct ccgtttagaa tagaacaaca acaaaaaaaa
420aactgtcttt gaatccaagt ctctctcttt tgtcaccatc tctgttactt
actaagaaac 480ttctttttct ttaatggttt ttttgctaaa tacccgtaat
attattaatt aaagcatttt 540cctttttctg ctaaatcttg ctttgctctt
taagctcttg tcattgttgt taattgtctc 600ctggaggctg gaggctggag
attatttggt cttttgtgat gactataatg tgagaaattc 660tgggttttgc
tagaatttga agaaatcttt gagcaaggag gaaaaaagaa tgagacttta
720cttatcttca acgatgcagc tttctcttat gagtcttgtt ctagggttcc
tctttgtttc 780ctgtgacgcg tttgcctcta aagaaggtat tttgatttct
ccattttctc caatttttgg 840atgctgagaa agtttagtct ttttagcctc
tgtctgttaa cacttgctca ttgagttgat 900ctagaaagtt agaaacttta
gttttgttac tgatcattta gaagtatttg atgttttgct 960gttttgtatt
cagttgaagc agttagaaga ttcaaggaag ccatttataa ggacccattg
1020ctagttatgt ctaattggaa tgtccccaat ttgagtcctt gtgattggaa
tggcattaaa 1080tgttctccat ctaaggatca cattatcaag atgtaggaaa
ctttgatctc tttctatcag 1140taaaatcagt tatgtttagt atgatgatga
tttggtatct gtttcatgct gtgaaacttg 1200cagaaatata tcggggacat
cgatgagagg gtttcttgtg ccagaacttg gtcaaataac 1260ctacttgcaa
gaactgtatg gttttgattc atattgacaa tacctgaaga tataagtttg
1320atgattggta ctgtttgtaa atgtttagat gactttgttt tttctgtgtt
gaatgcttct 1380ttaggatcct gcgtgggaac attctaatgg ggacaatacc
aaaggagata ggaaagttaa 1440agaaactcaa gatcttagac ctgggaaaca
atcatttgac aggaccgatt ccagcagaga 1500tcgggaaatt gtcaaggatt
aagacaatgt aagaaaatct ttaagagaat gtcatctatc 1560cgataatgtg
ctgagataac cattttgtgt ctctttaaca ccacagaaac cttcagtcca
1620atggtttaat aggaaagtta cctccagaga ttggaaactt gaagcacctt
aaagaacttc 1680ttattggcag gaataggctt cgaggaagta ttcctattgc
cgcgaaaaca tcaaaaaagt 1740gagtttagct aatagtccaa ggtagcataa
gatggaaact taatgtttat gattgaaatg 1800ttaatgtatc ttctttttgt
gttggtcagg tatgcttcaa atccaagtgc aaacatcagt 1860ggtttgtgca
agtcttctct atttaaagtg gcagatttct cttacaactt tttcgaggga
1920agagttccga gttgcttgga ttacctccca atgtatttct tataagaccc
tttttctagc 1980tttcctttat ttttctcatt tgataatatc tctctgtatc
attgaacatc attgtagaac 2040gagctttcaa ggaaactgca tgaaaaccat
ggatgttaag cagagacctc tttcagaatg 2100tggtttgtag aatatgagtt
tcactttctt gatgctgata atcgtttctt tatcttgttt 2160ttcattttga
aattgtttca attggttagc tcgcttagct gtaaccgtgg ccaagaagaa
2220gcatcgagca tcgagacaaa catggcttcg gaattttgag atagtcacgg
gatcatcagt 2280tggcttgctc tttctagtcg taatgttctc tgcatgtagc
ttgtgcaaaa taaagcgctc 2340tctcatcgtt ccctggaaga aatctgcaag
tgaaaaggag aagttcacgg tctacgttgg 2400ttagaaactc ttaaaaattc
taagatttca atacaaataa ctgaaagagc ttccagagat 2460gaaaaaatta
ctgataaact gtttttctac agattctgaa atgctgaagg atgtttcaag
2520atatacaaga caagagctag aagtagcatg tgaagacttc agcaacatca
ttgattctag 2580tgcagagagt cagatttaca aaggaacgat caaaggcggg
actgagatcg cggttatctc 2640tctctgcgtt aaagaagaaa attggactgg
atatcttgag cttaatttcc agagagaggt 2700tcttcttctt atggttgttt
atcaccaagt cacttgcaag aaaacatcag tattaaactt 2760gattttatta
atattcattg tttcaggttg cggctttggc tagattaaac catgagaatg
2820cggggaaatt actgggatac tgtaaagaga gtacaccgtt cacaagaatg
cttgtgtttg 2880agtatgcatc aaacgggaca ctatacgacc atctccactg
taatatataa tcaaacttct 2940tcagagctct ttctttggta ggactgataa
tgataccaaa tgatgataaa aatttgatgc 3000agatgcggac gggagtttag
tatcgtgggc aaaacgcatg aaaattgtta taggcatcgc 3060acgtggtctc
aagtaccttc atactgaact ccatcctcca tttacagtct ctgagttgag
3120ctcaactgca gtgtatctca ctgaagattt tactcccaaa gtaaatttga
tcctcttttt 3180tctatgcggt tagctaagct ttgctactat ctctatactc
ttattttgat cctcttattt 3240ctatgcagct ggttgatttc gaatgctgga
agattattca ggtgagatca gagaagaacc 3300tgaagaatat ctgtaatgaa
ggagcaatat gtgtacttcc caatgcaatg gaacaccgag 3360atatggattt
acaagggaat atctactcat ttggcatact tttgctggaa attgtaagcg
3420gaagaccttc ttattgccaa gacagaggtt gcttggttga atgggtaaga
atagcttttc 3480tctataagct taaagctgag tacttataat aagtctctct
ctctctctta gcggtttacg 3540tgttttcatg cgtttgatgc tgaggatttg
attcaaactc ctaaatattg caggtaaggg 3600agaaaaacct tggtgcacca
gatgtgatgg ctagcttggt ggatcctgag ctcaagcatt 3660tcaagcaaaa
agaacttgag gcagtatgtg aagtggcaag ccaatgtctg aacttggacc
3720agaatgaaaa agacaaggat aagctttctt gttcgattca agcgctttgt
gagacactag 3780agagtagaat cactgtgtcc atttctgcag aattcaaatc
gtcttctctg gcgtgggccg 3840agctagcgct ggcctcgcct tctaacgaag
acgacgatga taggagtaaa taaaattggc 3900tttgttgtta tgacattgac
atacacttgt tcgaacattt ttgcttcaat tttgcattcg 3960gttttgatag
caccgaccat gccttggata agttatcagg taggttgtta cggtcggtct
4020attgttaata ccaataaact ggaggtgtaa tcttgtatac caagttcttg
acgaatgaaa 4080ttgtgttgag ccaaaaaaga aaaaaatgac aggtagcttg
aaactagagg aatacatctg 4140tgaaccgaat aaaaagttat aaactctcac
cttttcaaac tagttttgga cttcaaacaa 4200caatcagaaa gaaaaagtaa
aagtacaaaa aagagacaaa atcgttggca tctgaagtac 4260aggagatgtt
tgttgtgtag gagaaacaaa gatcagtgca tagaacgaga gtaatggttg
4320tcattagggt ttcttttctg gctgaaaacc gacatagctt ttctcacagg
aggctgcaat 4380ggcgcctttc tatcactatg atggttcaag aacacatcat
ctgatacgaa gtactcatca 4440ccctgcaaac aacagcataa tttaccttaa
gatttcaatc aaagttacag atttgagttt 4500gagatagaag acacgaagag
actaaccggt ttgcttgctt tcttcttggt cctagggtgg 4560agaagctttt
gagggagttg atcttcccgt agaatcagat tcttggtgat tgcctctctt 4620cc
4622424DNAArtificial sequenceRLK1 forward primer 4ggctggaggc
tggagattat ttgg 24520DNAArtificial sequenceRLK1 reverse primer
5aaggcatggt cggtgctatc 20646DNAArtificial sequenceRLK1 forward
reamplification primer 6ggggacaagt ttgtacaaaa aagcaggcta tgagacttta
cttatc 46751DNAArtificial sequenceRLK1 reverse reamplification
primer 7ggggaccact ttgtacaaga aagctgggtt tatttactcc tatcatcgtc g
5183259DNAArabidopsis thaliana 8tagaatttga agaaatcttt gagcaaggag
gaaaaaagaa tgagacttta cttatcttca 60acgatgcagc tttctcttat gagtcttgtt
ctagggttcc tctttgtttc ctgtgacgcg 120tttgcctcta aagaaggtat
tttgatttct ccattttctc caatttttgg atgctgagaa 180agtttagtct
ttttagcctc tgtctgttaa cacttgctca ttgagttgat ctagaaagtt
240agaaacttta gttttgttac tgatcattta gaagtatttg atgttttgct
gttttgtatt 300cagttgaagc agttagaaga ttcaaggaag ccatttataa
ggacccattg ctagttatgt 360ctaattggaa tgtccccaat ttgagtcctt
gtgattggaa tggcattaaa tgttctccat 420ctaaggatca cattatcaag
atgtaggaaa ctttgatctc tttctatcag taaaatcagt 480tatgtttagt
atgatgatga tttggtatct gtttcatgct gtgaaacttg cagaaatata
540tcggggacat cgatgagagg gtttcttgtg ccagaacttg gtcaaataac
ctacttgcaa 600gaactgtatg gttttgattc atattgacaa tacctgaaga
tataagtttg atgattggta 660ctgtttgtaa atgtttagat gactttgttt
tttctgtgtt gaatgcttct ttaggatcct 720gcgtgggaac attctaatgg
ggacaatacc aaaggagata ggaaagttaa agaaactcaa 780gatcttagac
ctgggaaaca atcatttgac aggaccgatt ccagcagaga tcgggaaatt
840gtcaaggatt aagacaatgt aagaaaatct ttaagagaat gtcatctatc
cgataatgtg 900ctgagataac cattttgtgt ctctttaaca ccacagaaac
cttcagtcca atggtttaat 960aggaaagtta cctccagaga ttggaaactt
gaagcacctt aaagaacttc ttattggcag 1020gaataggctt cgaggaagta
ttcctattgc cgcgaaaaca tcaaaaaagt gagtttagct 1080aatagtccaa
ggtagcataa gatggaaact taatgtttat gattgaaatg ttaatgtatc
1140ttctttttgt gttggtcagg tatgcttcaa atccaagtgc aaacatcagt
ggtttgtgca 1200agtcttctct atttaaagtg gcagatttct cttacaactt
tttcgaggga agagttccga 1260gttgcttgga ttacctccca atgtatttct
tataagaccc tttttctagc tttcctttat 1320ttttctcatt tgataatatc
tctctgtatc attgaacatc attgtagaac gagctttcaa 1380ggaaactgca
tgaaaaccat ggatgttaag cagagacctc tttcagaatg tggtttgtag
1440aatatgagtt tcactttctt gatgctgata atcgtttctt tatcttgttt
ttcattttga 1500aattgtttca attggttagc tcgcttagct gtaaccgtgg
ccaagaagaa gcatcgagca 1560tcgagacaaa catggcttcg gaattttgag
atagtcacgg gatcatcagt tggcttgctc 1620tttctagtcg taatgttctc
tgcatgtagc ttgtgcaaaa taaagcgctc tctcatcgtt 1680ccctggaaga
aatctgcaag tgaaaaggag aagttcacgg tctacgttgg ttagaaactc
1740ttaaaaattc taagatttca atacaaataa ctgaaagagc ttccagagat
gaaaaaatta 1800ctgataaact gtttttctac agattctgaa atgctgaagg
atgtttcaag atatacaaga 1860caagagctag aagtagcatg tgaagacttc
agcaacatca ttgattctag tgcagagagt 1920cagatttaca aaggaacgat
caaaggcggg actgagatcg cggttatctc tctctgcgtt 1980aaagaagaaa
attggactgg atatcttgag cttaatttcc agagagaggt tcttcttctt
2040atggttgttt atcaccaagt cacttgcaag aaaacatcag tattaaactt
gattttatta 2100atattcattg tttcaggttg cggctttggc tagattaaac
catgagaatg cggggaaatt 2160actgggatac tgtaaagaga gtacaccgtt
cacaagaatg cttgtgtttg agtatgcatc 2220aaacgggaca ctatacgacc
atctccactg taatatataa tcaaacttct tcagagctct 2280ttctttggta
ggactgataa tgataccaaa tgatgataaa aatttgatgc agatgcggac
2340gggagtttag tatcgtgggc aaaacgcatg aaaattgtta taggcatcgc
acgtggtctc 2400aagtaccttc atactgaact ccatcctcca tttacagtct
ctgagttgag ctcaactgca 2460gtgtatctca ctgaagattt tactcccaaa
gtaaatttga tcctcttttt tctatgcggt 2520tagctaagct ttgctactat
ctctatactc ttattttgat cctcttattt ctatgcagct 2580ggttgatttc
gaatgctgga agattattca ggtgagatca gagaagaacc tgaagaatat
2640ctgtaatgaa ggagcaatat gtgtacttcc caatgcaatg gaacaccgag
atatggattt 2700acaagggaat atctactcat ttggcatact tttgctggaa
attgtaagcg gaagaccttc 2760ttattgccaa gacagaggtt gcttggttga
atgggtaaga atagcttttc tctataagct 2820taaagctgag tacttataat
aagtctctct ctctctctta gcggtttacg tgttttcatg 2880cgtttgatgc
tgaggatttg attcaaactc ctaaatattg caggtaaggg agaaaaacct
2940tggtgcacca gatgtgatgg ctagcttggt ggatcctgag ctcaagcatt
tcaagcaaaa 3000agaacttgag gcagtatgtg aagtggcaag ccaatgtctg
aacttggacc agaatgaaaa 3060agacaaggat aagctttctt gttcgattca
agcgctttgt gagacactag agagtagaat 3120cactgtgtcc atttctgcag
aattcaaatc gtcttctctg gcgtgggccg agctagcgct 3180ggcctcgcct
tctaacgaag acgacgatga taggagtaaa taaaattggc tttgttgtta
3240tgacattgac atacacttg 325991995DNAArtificial sequenceA. thaliana
RLK1 sequence modified 9atgaggctct accttagctc tactatgcag cttagcctga
tgagccttgt gctcggattc 60ctgttcgtta gttgcgacgc cttcgctagt
aaagaggttg aggccgttag gcgttttaaa 120gaggctatct ataaggaccc
cctcctcgtg atgtctaact ggaacgttcc caaccttagc 180ccctgcgact
ggaacggtat taagtgctca cctagtaagg atcacattat taagattaac
240attagcggca ctagtatgag gggctttatc gtgccagaga tcggtcagat
cacctacctt 300caagagctga tccttagggg taatatcctg atggctacta
tccctaaaga gatcggtaag 360cttaagaagc ttaggattct cgacctcggt
aacaatcacc tcaccggacc tattccagcc 420gagattggta aacttagtag
gattaagact attaaccttc agtctaacgg ccttatcggt 480aagctcccac
cagagattgg taaccttaag caccttaaag agctgctgat cggccgtaat
540aggcttaggg gatcagttcc tattgccgct aagactagta agaagtacgc
tagtaaccct 600agcgctaata ttagtggcct ctgtaagtct agcctgttta
aggtggccga ctttagctat 660aacttcttcg agggtagagt gcctagctgc
cttgattacc tccctatcac tagctttcag 720ggcaactgta tgaaaactat
ggacgttaag cagaggcccc ttagtgagtg cgctagactt 780gctgttaccg
tggctaagaa gaagcacagg gctagtaggc aaacctggct taggaacttc
840gagatcgtga ccggatctag cgtgggactt cttttccttg tggtgatgtt
tagcgcctgc 900tcactctgta agattaagcg tagccttatc gtgccctgga
agaaatcagc tagcgagaaa 960gaaaagttca ccgtttacgt ggactcagag
atgcttaagg acgttagccg ttacactagg 1020caagagcttg aagtggcttg
cgaggacttt agcaatatta tcgactctag cgccgagtct 1080cagatctata
agggcactat taagggcggc accgagatcg ctgttattag cctttgcgtt
1140aaggaagaga actggaccgg ttacctcgag cttaactttc agagggaagt
ggctgctctc 1200gctaggctta atcacgaaaa cgctggtaag ctcctcggct
actgtaaaga gtctaccccc 1260ttcactagga tgctcgtgtt cgaatacgct
agtaacggca ccctctacga tcaccttcac 1320tacgctgacg gatcactcgt
tagttgggct aagaggatga agatcgtgat cggaatcgct 1380aggggcctta
agtaccttca cactgaactt cacccaccct tcaccgttag cgagcttagt
1440tctaccgctg tttacctcac cgaggacttc acccctaagc ttgttgattt
cgagtgctgg 1500aagattattc aggttaggtc agagaagaac cttaagaata
tctgtaacga gggcgctatc 1560tgcgtgctcc ctaacgctat ggaacacagg
gatatggacc ttcagggtaa tatctatagc 1620ttcggaatcc tgctcctcga
gatcgttagt ggtaggccta gctactgtca agataggggt 1680tgccttgttg
agtgggttag ggaaaagaac cttggtgctc cagacgtgat ggctagcctt
1740gttgatccag agcttaagca ctttaagcag aaagaactcg aggccgtgtg
cgaagttgct 1800agtcagtgcc ttaacctcga tcagaacgag aaggataagg
ataagcttag ctgctctatt 1860caggccctct gcgagactct tgagtctagg
attaccgtta gtattagcgc cgagtttaag 1920tctagctcac tcgcttgggc
tgagttggct cttgctagtc ctagtaacga ggacgacgac 1980gataggtcta agtga
199510664PRTArtificial sequenceRLK1 protein sequence optimized
10Met Arg Leu Tyr Leu Ser Ser Thr Met Gln Leu Ser Leu Met Ser Leu 1
5 10 15 Val Leu Gly Phe Leu Phe Val Ser Cys Asp Ala Phe Ala Ser Lys
Glu 20 25 30 Val Glu Ala Val Arg Arg Phe Lys Glu Ala Ile Tyr Lys
Asp Pro Leu 35 40 45 Leu Val Met Ser Asn Trp Asn Val Pro Asn Leu
Ser Pro Cys Asp Trp 50 55 60 Asn Gly Ile Lys Cys Ser Pro Ser Lys
Asp His Ile Ile Lys Ile Asn 65 70 75 80 Ile Ser Gly Thr Ser Met Arg
Gly Phe Ile Val Pro Glu Ile Gly Gln 85 90 95 Ile Thr Tyr Leu Gln
Glu Leu Ile Leu Arg Gly Asn Ile Leu Met Ala 100 105 110 Thr Ile Pro
Lys Glu Ile Gly Lys Leu Lys Lys Leu Arg Ile Leu Asp 115 120 125 Leu
Gly Asn Asn His Leu Thr Gly Pro Ile Pro Ala Glu Ile Gly Lys 130 135
140 Leu Ser Arg Ile Lys Thr Ile Asn Leu Gln Ser Asn Gly Leu Ile Gly
145 150 155 160 Lys Leu Pro Pro Glu Ile Gly Asn Leu Lys His Leu Lys
Glu Leu Leu 165 170 175 Ile Gly Arg Asn Arg Leu Arg Gly Ser Val Pro
Ile Ala Ala Lys Thr 180 185 190 Ser Lys Lys Tyr Ala Ser Asn Pro Ser
Ala Asn Ile Ser Gly Leu Cys 195 200 205 Lys Ser Ser Leu Phe Lys Val
Ala Asp Phe Ser Tyr Asn Phe Phe Glu 210 215 220 Gly Arg Val Pro Ser
Cys Leu Asp Tyr Leu Pro Ile Thr Ser Phe Gln 225 230 235 240 Gly Asn
Cys Met Lys Thr Met Asp Val Lys Gln Arg Pro Leu Ser Glu 245 250 255
Cys Ala Arg Leu Ala Val Thr Val Ala Lys Lys Lys His Arg Ala Ser 260
265 270 Arg Gln Thr Trp Leu Arg Asn Phe Glu Ile Val Thr Gly Ser Ser
Val 275 280 285 Gly Leu Leu Phe Leu Val Val Met Phe Ser Ala Cys Ser
Leu Cys Lys 290 295 300 Ile Lys Arg Ser Leu Ile Val Pro Trp Lys Lys
Ser Ala Ser Glu Lys 305 310 315 320 Glu Lys Phe Thr Val Tyr Val Asp
Ser Glu Met Leu Lys Asp Val Ser 325 330 335 Arg Tyr Thr Arg Gln Glu
Leu Glu Val Ala Cys Glu Asp Phe Ser Asn 340 345 350 Ile Ile Asp Ser
Ser Ala Glu Ser Gln Ile Tyr Lys Gly Thr Ile Lys 355 360 365 Gly Gly
Thr Glu Ile Ala Val Ile Ser Leu Cys Val Lys Glu Glu Asn 370 375 380
Trp Thr Gly Tyr Leu Glu Leu Asn Phe Gln Arg Glu Val Ala Ala Leu 385
390 395 400 Ala Arg Leu Asn His Glu Asn Ala Gly Lys Leu Leu Gly Tyr
Cys Lys 405 410 415 Glu Ser Thr Pro Phe Thr Arg Met Leu Val Phe Glu
Tyr Ala Ser Asn 420 425 430 Gly Thr Leu Tyr Asp His Leu His Tyr Ala
Asp Gly Ser Leu Val Ser 435 440 445 Trp Ala Lys Arg Met Lys Ile Val
Ile Gly Ile Ala Arg Gly Leu Lys 450 455 460 Tyr Leu His Thr Glu Leu
His Pro Pro Phe Thr Val Ser Glu Leu Ser 465 470 475 480 Ser Thr Ala
Val Tyr Leu Thr Glu Asp Phe Thr Pro Lys Leu Val Asp 485 490 495 Phe
Glu Cys Trp Lys Ile Ile Gln Val Arg Ser Glu Lys Asn Leu Lys 500 505
510 Asn Ile Cys Asn Glu Gly Ala Ile Cys Val Leu Pro Asn Ala Met Glu
515 520 525 His Arg Asp Met Asp Leu Gln Gly Asn Ile Tyr Ser Phe Gly
Ile Leu 530 535 540 Leu Leu Glu Ile Val Ser Gly Arg Pro Ser Tyr Cys
Gln Asp Arg Gly 545 550 555 560 Cys Leu Val Glu Trp Val Arg Glu Lys
Asn Leu Gly Ala Pro Asp Val 565 570 575 Met Ala Ser Leu Val Asp Pro
Glu Leu Lys His Phe Lys Gln Lys Glu 580 585 590 Leu Glu Ala Val Cys
Glu Val Ala Ser Gln Cys Leu Asn Leu Asp Gln 595 600 605 Asn Glu Lys
Asp Lys Asp Lys Leu Ser Cys Ser Ile Gln Ala Leu Cys 610 615 620 Glu
Thr Leu Glu Ser Arg Ile Thr Val Ser Ile Ser Ala Glu Phe Lys 625 630
635 640 Ser Ser Ser Leu Ala Trp Ala Glu Leu Ala Leu Ala Ser Pro Ser
Asn 645 650 655 Glu Asp Asp Asp Asp Arg Ser Lys 660
* * * * *
References