U.S. patent application number 14/051576 was filed with the patent office on 2014-02-13 for nutritional composition.
This patent application is currently assigned to AJINOMOTO CO., INC.. The applicant listed for this patent is AJINOMOTO CO., INC.. Invention is credited to Naoki Hayashi, Itaru Kon, Tomoyuki Mine, Kazunori Saima.
Application Number | 20140044828 14/051576 |
Document ID | / |
Family ID | 47009474 |
Filed Date | 2014-02-13 |
United States Patent
Application |
20140044828 |
Kind Code |
A1 |
Mine; Tomoyuki ; et
al. |
February 13, 2014 |
NUTRITIONAL COMPOSITION
Abstract
A nutritional composition is provided which has an effective
prophylactic and/or improving effect for various symptoms of muscle
mass decrease, decreased basal metabolism, low body temperature,
suppression of obesity, suppression of visceral fat accumulation,
hyperglycemia, hyperlipidemia and the like in elderly people. The
nutritional composition can include n-3 fatty acid and one or more
of free lysine, dipeptides containing lysine, and lysine salts,
wherein the content of free lysine, dipeptides containing lysine,
and/or lysine salts is 0.1 g-10.0 g per 100 kcal of the
composition, and the content of the total amount of n-3 fatty acid
is 0.17 g-5.00 g per 100 kcal of the composition.
Inventors: |
Mine; Tomoyuki; (Kanagawa,
JP) ; Hayashi; Naoki; (Kanagawa, JP) ; Kon;
Itaru; (Kanagawa, JP) ; Saima; Kazunori;
(Kanagawa, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
AJINOMOTO CO., INC. |
Tokyo |
|
JP |
|
|
Assignee: |
AJINOMOTO CO., INC.
Tokyo
JP
|
Family ID: |
47009474 |
Appl. No.: |
14/051576 |
Filed: |
October 11, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/JP2012/060186 |
Apr 13, 2012 |
|
|
|
14051576 |
|
|
|
|
Current U.S.
Class: |
426/2 ; 426/601;
426/72; 426/73; 426/74 |
Current CPC
Class: |
A61P 21/00 20180101;
A61P 3/00 20180101; A61K 31/355 20130101; A23L 2/52 20130101; A61K
31/198 20130101; A61K 33/30 20130101; A23L 33/18 20160801; A61P
3/02 20180101; A61K 33/04 20130101; A23L 33/17 20160801; A23L
33/155 20160801; A23L 33/12 20160801; A61K 31/714 20130101; A61K
31/525 20130101; A61K 31/202 20130101; A61K 31/20 20130101; A23L
33/175 20160801; A61K 31/4415 20130101; A61K 31/375 20130101; A23L
33/115 20160801; A23L 33/15 20160801; A61K 31/51 20130101; A61K
31/07 20130101; A23V 2002/00 20130101; A61K 38/05 20130101; A61K
31/07 20130101; A61K 2300/00 20130101; A61K 31/198 20130101; A61K
2300/00 20130101; A61K 31/20 20130101; A61K 2300/00 20130101; A61K
31/202 20130101; A61K 2300/00 20130101; A61K 31/355 20130101; A61K
2300/00 20130101; A61K 31/375 20130101; A61K 2300/00 20130101; A61K
31/4415 20130101; A61K 2300/00 20130101; A61K 31/51 20130101; A61K
2300/00 20130101; A61K 31/525 20130101; A61K 2300/00 20130101; A61K
31/714 20130101; A61K 2300/00 20130101; A61K 33/04 20130101; A61K
2300/00 20130101; A61K 33/30 20130101; A61K 2300/00 20130101; A61K
38/05 20130101; A61K 2300/00 20130101 |
Class at
Publication: |
426/2 ; 426/601;
426/72; 426/73; 426/74 |
International
Class: |
A23L 1/30 20060101
A23L001/30; A23L 1/305 20060101 A23L001/305; A23L 1/304 20060101
A23L001/304; A23L 1/302 20060101 A23L001/302; A23L 1/303 20060101
A23L001/303 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 13, 2011 |
JP |
2011-089626 |
Claims
1. A nutritional composition comprising: i) n-3 fatty acid, and ii)
an ingredient selected from the group consisting of free lysine,
dipeptides containing lysine and lysine salts, and combinations
thereof; wherein the ingredient is present in the composition in an
amount of 0.1 g-10.0 g per 100 kcal of the composition, and wherein
the n-3 fatty acid is present in the composition in an amount of
0.17 g-5.00 g per 100 kcal of the composition.
2. The nutritional composition according to claim 1, further
comprising a branched chain amino acid selected from the group
consisting of valine, leucine, isoleucine, and combinations
thereof.
3. The nutritional composition according to claim 2, wherein the
branched chain amino acid is present in the composition in an
amount of 1.0 g-20 g per 100 kcal of the composition.
4. The nutritional composition according to claim 2, wherein the
branched chain amino acid in a free form is present in the
composition in an amount of 0.1 g-15 g per 100 kcal of the
composition.
5. The nutritional composition according to claim 1, wherein the
n-3 fatty acid is selected from the group consisting of
eicosapentaenoic acid, docosapentaenoic acid, docosahexaenoic acid,
and combinations thereof.
6. The nutritional composition according to claim 5, comprising 10
mg-3000 mg of eicosapentaenoic acid per 100 kcal of the
composition.
7. The nutritional composition according to claim 1, further
comprising a vitamin selected from the group consisting of: 0.2
mg-20.0 mg of vitamin B1 per 100 kcal of the composition, 0.25
mg-20.0 mg of vitamin B2 per 100 kcal of the composition, 0.3
mg-20.0 mg of vitamin B6 per 100 kcal of the composition, 0.3
.mu.g-20.0 .mu.g of vitamin B12 per 100 kcal of the composition,
and combinations thereof.
8. The nutritional composition according to claim 1, further
comprising a vitamin selected from the group consisting of: 50
.mu.g retinol equivalents-2500 .mu.g retinol equivalents of vitamin
A per 100 kcal of the composition, 10 mg-700 mg of vitamin C per
100 kcal of the composition, 1 mg-50 mg of vitamin E based on
.alpha.-tocopherol per 100 kcal of the composition, and
combinations thereof.
9. The nutritional composition according to claim 1, further
comprising 1 mg-50 mg of zinc per 100 kcal of the composition
and/or 1.0 .mu.g-50.0 .mu.g of selenium per 100 kcal of the
composition.
10. The nutritional composition according to claim 1, comprising
medium chain fatty acid oil in an amount of 10 wt %-65 wt %
relative to the total amount of lipid.
11. The nutritional composition according to claim 1, which is
capable of increasing muscle mass and/or suppressing a decrease in
the muscle mass.
12. The nutritional composition according to claim 1, which is
capable of decreasing visceral fat or increasing energy
consumption.
13. The nutritional composition according to claim 1, which is
capable of an effect selected from the group consisting of i)
prophylaxis and/or improvement of muscle weakness symptom, ii)
promotion of rehabilitation effect for muscle recovery, iii)
prophylaxis and/or improvement of dyslipidemia associated with
visceral fat increase, iv) prophylaxis and/or improvement of
hyperglycemia associated with visceral fat increase, v) prophylaxis
and/or improvement of fatty liver associated with visceral fat
increase, vi) prophylaxis and/or improvement of deteriorated liver
function associated with visceral fat increase, vii) prophylaxis
and/or improvement of decrease in basal energy consumption, viii)
prophylaxis and/or improvement of decrease in basal body
temperature, ix) prophylaxis and/or improvement of muscle mass
decrease unaccompanied by an increase in inflammatory cytokine, x)
improvement of low nutrient condition, xi) improvement of
deterioration in locomotorium, xii) prophylaxis and/or improvement
of locomotive syndrome, xiii) prevention of falling, ixv) increase
of muscle mass in sports, and xv) combinations thereof.
14. A method for increasing muscle mass and/or suppressing a
decrease in muscle mass, comprising administering an effective
amount of the composition according to claim 1.
15. A method for decreasing visceral fat or increasing energy
consumption, comprising administering an effective amount of the
composition according to claim 1.
16. A method for treating a condition comprising administering an
effective amount of the composition according to claim 1, wherein
said condition is selected from the group consisting of i) the
prophylaxis and/or improvement of muscle weakness symptom, ii) the
promotion of rehabilitation effect for muscle recovery, iii) the
prophylaxis and/or improvement of dyslipidemia associated with
visceral fat increase, iv) the prophylaxis and/or improvement of
hyperglycemia associated with visceral fat increase, v) the
prophylaxis and/or improvement of fatty liver associated with
visceral fat increase, vi) the prophylaxis and/or improvement of
deteriorated liver function associated with visceral fat increase,
vii) the prophylaxis and/or improvement of decrease of basal energy
consumption, viii) the prophylaxis and/or improvement of decrease
of basal body temperature, ix) the prophylaxis and/or improvement
of muscle mass decrease unaccompanied by an increase in
inflammatory cytokine, x) the improvement of low nutrient
condition, xi) the improvement of deterioration in locomotorium,
xii) the prophylaxis and/or improvement of locomotive syndrome,
xiii) prevention of falling, ixv) a method for increasing muscle
mass in sports, and xv) combinations thereof.
17. A method for producing an agent for increasing muscle mass
and/or suppressing a decrease in muscle mass comprising formulating
a composition according to claim 1.
18. A method for producing an agent for decreasing visceral fat or
increasing energy consumption comprising formulating a composition
according to claim 1.
19. A method for producing an agent for treating a condition
comprising formulating a composition according to claim 1, wherein
the condition is selected from the group consisting of: i) the
prophylaxis and/or improvement of muscle weakness symptom, ii)
promoting a rehabilitation effect for muscle recovery, iii) the
prophylaxis and/or improvement of dyslipidemia associated with
visceral fat increase, iv) the prophylaxis and/or improvement of
hyperglycemia associated with visceral fat increase, v) the
prophylaxis and/or improvement of fatty liver associated with
visceral fat increase, vi) the prophylaxis and/or improvement of
deteriorated liver function associated with visceral fat increase,
vii) the prophylaxis and/or improvement of decrease of basal energy
consumption, viii) the prophylaxis and/or improvement of decrease
of basal body temperature, ix) the prophylaxis and/or improvement
of muscle mass decrease unaccompanied by an increase in
inflammatory cytokine, x) improvement of low nutrient condition,
xi) improving deterioration in locomotorium, xii) the prophylaxis
and/or improvement of locomotive syndrome, ixv) prevention of
falling, xv) increasing muscle mass in sports, and xvi)
combinations thereof.
Description
[0001] This application is a Continuation of, and claims priority
under 35 U.S.C. .sctn.120 to, International Application No.
PCT/JP2012/060186, filed Apr. 13, 2012, and claims priority
therethrough under 35 U.S.C. .sctn.119 to Japanese Patent
Application No. 2011-089626, filed Apr. 13, 2011, the entireties of
which are incorporated by reference herein. Also, the Sequence
Listing filed electronically herewith is hereby incorporated by
reference (File name: 2013-10-11T_US-504_Seq_List; File size: 1 KB;
Date recorded: Oct. 11, 2013).
FIELD OF THE INVENTION
[0002] The present invention relates to a nutritional composition
containing particular amounts of a particular amino acid and n-3
fatty acid, which is effective for increasing muscle mass and/or
suppressing a decrease in the muscle mass. More particularly, the
present invention relates to a nutritional composition containing
particular amounts of one or more of the following: free lysine,
dipeptides containing lysine and lysine salts, and n-3 fatty acid,
which is effective for increasing muscle mass and/or suppressing a
decrease in the muscle mass.
BRIEF DESCRIPTION OF THE RELATED ART
[0003] In elderly people, a specific skeletal muscle decrease
called sarcopenia can occur. A decrease in skeletal muscle reduces
the amount of activity elderly people are able to do, and the
decreased amount of activity can cause further loss of muscle
strength, thus forming a vicious circle. A decrease in the amount
of activity also can decrease the basal energy metabolism. This
condition is particularly apparent when in a bedridden state.
[0004] Moreover, elderly people have a high risk of falling when
undernourished. According to a search of the Social Insurance
Institute in Japan, about 40% of hospital patients and about 30% of
home-care patients are undernourished. Even when energy ingestion
is increased in an attempt to improve the nutrient condition,
muscle mass cannot be recovered. Conversely, fat accumulates and
leads to metabolism-associated diseases such as insulin resistance,
diabetes, hyperlipidemia, and osteoporosis (Clinical Nutrition,
2008, 8: 38-43).
[0005] To counter muscle mass decrease, protein ingestion is
recommended. In fact, it has been reported that ingestion of 18 g
of an essential amino acid mixture increased protein synthesis of
the skeletal muscle (Am J Clin Nutr, 2003, 78: 250-258). However,
ingesting a large amount of amino acids, such as up to 18 g, all at
once not only is difficult for elderly people due to their
depressed kidney function due to aging, but also is risky since it
may over burden on the kidneys. To increase the muscle mass in
elderly people, therefore, not only supplementing with a general
protein supplementation, but also ingestion of a more efficient
composition is necessary.
[0006] Ingestion of lysine is known to increase growth and muscle
mass in community residents and animals living on corn and wheat
(JP-A-2008-539793). However, this is because the protein
composition of the staple food is not balanced and lysine becomes a
limiting amino acid. In most areas where protein is not necessarily
obtained largely from corn and wheat, ingestion of lysine alone
does not show a clear effect on the growth of the whole body, or an
increase in the muscle mass that appears as one manifestation
thereof.
[0007] JP-A-H11-508282 discloses a composition for patients with
cachexia and/or anorexia, which contains a mixed oil with a weight
ratio of n-6 fatty acid to n-3 fatty acid of 0.1-3.0, amino acid
containing branched chain amino acid, and antioxidant such as
.beta.-carotene, vitamin C, vitamin E, and selenium. In addition,
Br J Cancer, 2004, 91: 408-412 reports that a carcinoma cachexia
model mouse ingested with n-3 fatty acid and a high
leucine-containing protein diet shows a decrease in the body weight
and an increase in the muscle mass. In the target patients,
particular cytokines (TNF-.alpha., IL-6 and the like) due to
cachexia in the late stages of cancer are involved, and the muscle
protein secretion decrease occurs based on the cytokines. It is
assumed that n-3 fatty acid suppresses secretion of the cytokines,
and branched chain amino acid such as leucine aids muscle protein
synthesis, whereby the decrease of muscle proteins can be
prevented. In other words, this composition was studied for
treating carcinoma cachexia wherein cytokine-dominant protein
decrease was extreme. However, this decrease is vastly different
from the muscle mass decrease in general elderly people experience
due to a decreased amount of activity by being bedridden and the
like, and the effect is unknown.
[0008] Although n-3 fatty acid is used as a hypertriglyceridemia
improving agent, a single use of n-3 fatty acid has been reported
to show no effect on the weight increase of muscle (Drugs of the
Future, 2010, 35: 41-52 and J Nutr Biochem, 2006, 17: 1-13).
[0009] While n-3 fatty acid has been reported to increase mRNA
expression of an enzyme involved in fat oxidation (J Nutr, 2005,
135: 2503-2508), enhanced energy metabolism causing enhanced
synthesis of protein such as muscle has not been confirmed to
date.
[0010] As mentioned above, as the situation stands, a nutritional
composition having an appropriate amino acid ratio, containing n-3
fatty acid, and having a function to maintain or increase the
muscle mass of elderly people has not been provided heretofore.
SUMMARY OF THE INVENTION
[0011] A novel nutritional composition is described having a
preventive and/or improving effect on a decrease in the muscle
mass, particularly said effect for elderly people with a decreased
muscle mass due to a decreased amount of activity.
[0012] A composition is described that contains particular
amount(s) of one or more kinds of free lysine, dipeptides
containing lysine and lysine salts, and a particular amount of n-3
fatty acid that can prevent and/or improve a decrease in the muscle
mass, can improve hyperglycemia and hyperlipidemia by suppressing
obesity and suppressing accumulation of visceral fat, and such
effect is remarkable particularly in elderly people.
[0013] It is an aspect of the present invention to provide a
nutritional composition comprising n-3 fatty acid and an ingredient
selected from the group consisting of free lysine, dipeptides
containing lysine, lysine salts, and combinations thereof; wherein
the ingredient is present in the composition in an amount of 0.1
g-10.0 g per 100 kcal of the composition, and wherein the n-3 fatty
acid is present in the composition in an amount of 0.17 g-5.00 g
per 100 kcal of the composition.
[0014] It is a further aspect of the present invention to provide
the nutritional composition as described above, further comprising
a branched chain amino acid selected from the group consisting of
valine, leucine, and isoleucine.
[0015] It is a further aspect of the present invention to provide
the nutritional composition as described above, wherein the
branched chain amino acid is present in the composition in an
amount of 1.0 g-20 g per 100 kcal of the composition.
[0016] It is a further aspect of the present invention to provide
the nutritional composition as described above, wherein the
branched chain amino acid in a free form is present in the
composition in an amount of 0.1 g-15 g per 100 kcal of the
composition.
[0017] It is a further aspect of the present invention to provide
the nutritional composition as described above, wherein the n-3
fatty acid is selected from the group consisting of
eicosapentaenoic acid, docosapentaenoic acid, docosahexaenoic acid,
and combinations thereof.
[0018] It is a further aspect of the present invention to provide
the nutritional composition as described above, comprising 10
mg-3000 mg of eicosapentaenoic acid per 100 kcal of the
composition.
[0019] It is a further aspect of the present invention to provide
the nutritional composition as described above, further comprising
a vitamin selected from the group consisting of:
[0020] 0.2 mg-20.0 mg of vitamin B1 per 100 kcal of the
composition,
[0021] 0.25 mg-20.0 mg of vitamin B2 per 100 kcal of the
composition,
[0022] 0.3 mg-20.0 mg of vitamin B6 per 100 kcal of the
composition,
[0023] 0.3 .mu.g-20.0 .mu.g of vitamin B12 per 100 kcal of the
composition, and
[0024] combinations thereof.
[0025] It is a further aspect of the present invention to provide
the nutritional composition as described above, further comprising
a vitamin selected from the group consisting of:
[0026] 50 .mu.g retinol equivalents-2500 .mu.g retinol equivalents
of vitamin A per 100 kcal of the composition,
[0027] 10 mg-700 mg of vitamin C per 100 kcal of the
composition,
[0028] 1 mg-50 mg of vitamin E based on .alpha.-tocopherol per 100
kcal of the composition, and
[0029] combinations thereof.
[0030] It is a further aspect of the present invention to provide
the nutritional composition as described above, comprising 1 mg-50
mg of zinc per 100 kcal of the composition and/or 1.0 .mu.g-50.0
.mu.g of selenium per 100 kcal of the composition.
[0031] It is a further aspect of the present invention to provide
the nutritional composition as described above, comprising medium
chain fatty acid oil in an amount of 10 wt %-65 wt % relative to
the total amount of lipid.
[0032] It is a further aspect of the present invention to provide
the nutritional composition as described above, which is capable of
increasing muscle mass and/or suppressing a decrease in the muscle
mass.
[0033] It is a further aspect of the present invention to provide
the nutritional composition as described above, which is capable of
decreasing visceral fat or increasing energy consumption.
[0034] It is a further aspect of the present invention to provide
the nutritional composition as described above, which is capable of
an effect selected from the group consisting of prophylaxis and/or
improvement of muscle weakness symptom, promotion of rehabilitation
effect for muscle recovery, prophylaxis and/or improvement of
dyslipidemia associated with visceral fat increase, prophylaxis
and/or improvement of hyperglycemia associated with visceral fat
increase, prophylaxis and/or improvement of fatty liver associated
with visceral fat increase, prophylaxis and/or improvement of
deteriorated liver function associated with visceral fat increase,
prophylaxis and/or improvement of decrease in basal energy
consumption, prophylaxis and/or improvement of decrease in basal
body temperature, prophylaxis and/or improvement of muscle mass
decrease unaccompanied by an increase in inflammatory cytokine,
improvement of low nutrient condition, improvement of deterioration
in locomotorium, prophylaxis and/or improvement of locomotive
syndrome, prevention of falling, increase of muscle mass in sports,
and combinations thereof.
[0035] It is a further aspect of the present invention to provide a
method for increasing muscle mass and/or suppressing a decrease in
muscle mass, comprising administering an effective amount of the
composition as described above.
[0036] It is a further aspect of the present invention to provide a
method for decreasing visceral fat or increasing energy
consumption, comprising administering an effective amount of the
composition as described above.
[0037] It is a further aspect of the present invention to provide a
method for treating a condition comprising administering an
effective amount of the composition as described above, wherein
said condition is selected from the group consisting of prophylaxis
and/or improvement of muscle weakness symptom, a method for the
promotion of rehabilitation effect for muscle recovery, a method
for the prophylaxis and/or improvement of dyslipidemia associated
with visceral fat increase, a method for the prophylaxis and/or
improvement of hyperglycemia associated with visceral fat increase,
a method for the prophylaxis and/or improvement of fatty liver
associated with visceral fat increase, a method for the prophylaxis
and/or improvement of deteriorated liver function associated with
visceral fat increase, a method for the prophylaxis and/or
improvement of decrease of basal energy consumption, a method for
the prophylaxis and/or improvement of decrease of basal body
temperature, a method for the prophylaxis and/or improvement of
muscle mass decrease unaccompanied by an increase in inflammatory
cytokine, a method for the improvement of low nutrient condition, a
method for the improvement of deterioration in locomotorium, a
method for the prophylaxis and/or improvement of locomotive
syndrome, a method for prevention of falling, a method for
increasing muscle mass in sports, and combinations thereof.
[0038] A method for producing an agent for increasing muscle mass
and/or suppressing a decrease in muscle mass comprising formulating
a composition as described above.
[0039] It is a further aspect of the present invention to provide a
method for producing an agent for decreasing visceral fat or
increasing energy consumption comprising formulating a composition
as described above.
[0040] It is a further aspect of the present invention to provide a
method for producing an agent for treating a condition comprising
formulating a composition as described above, wherein the condition
is selected from the group consisting of: the prophylaxis and/or
improvement of muscle weakness symptom, promoting of rehabilitation
effect for muscle recovery, the prophylaxis and/or improvement of
dyslipidemia associated with visceral fat increase, the prophylaxis
and/or improvement of hyperglycemia associated with visceral fat
increase, the prophylaxis and/or improvement of fatty liver
associated with visceral fat increase, the prophylaxis and/or
improvement of deteriorated liver function associated with visceral
fat increase, the prophylaxis and/or improvement of decrease of
basal energy consumption, the prophylaxis and/or improvement of
decrease of basal body temperature, the prophylaxis and/or
improvement of muscle mass decrease unaccompanied by an increase in
inflammatory cytokine, improvement of low nutrient condition,
improving deterioration in locomotorium, the prophylaxis and/or
improvement of locomotive syndrome, prevention of falling,
increasing muscle mass in sports, and combinations thereof.
[0041] The nutritional composition as described herein is effective
for increasing muscle mass and/or suppressing a decrease in muscle
mass. In addition, the nutritional composition is effective for
increasing energy consumption. In addition, the nutritional
composition is particularly useful for decreasing visceral fat
based on the effect of increasing energy consumption by enhanced
fat utilization and the like. In addition, it is useful for the
prophylaxis and/or improvement of dyslipidemia, hyperglycemia,
fatty liver, and deterioration of liver function associated with
visceral fat increase. Furthermore, by increasing muscle mass or
suppressing a decrease in muscle mass by fat energy supply and the
like, the nutritional composition is also useful for the
prophylaxis and/or improvement of sarcopenia, chronic obstructive
pulmonary disease (COPD), promotion of rehabilitation effect for
muscle recovery, improvement of low nutrient condition, improvement
of deterioration in locomotorium, prophylaxis and/or improvement of
locomotive syndrome, prevention of falling, increasing muscle mass
in sports and the like. Moreover, the nutritional composition is
effective for the prophylaxis and/or improvement of a decrease in
basal energy consumption, and prophylaxis and/or improvement of a
decrease in basal body temperature. Furthermore, the nutritional
composition is highly safe, and can be used for a long time without
causing an excessive protein load even for elderly people with
attenuated kidney function.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] FIG. 1 shows mesenteric fat weight and gastrocnemius muscle
weight of groups 1A-1D of Experimental Example 1.
[0043] FIG. 2 shows mesenteric fat weight and gastrocnemius muscle
weight of groups 2A-2D of Experimental Example 2.
[0044] FIG. 3 shows respiratory quotient and energy consumption of
groups 3A and 3B of Experimental Example 3.
[0045] FIG. 4 shows a ratio of DNA amount of mitochondria gene
(mtDNA) to that of nuclear coding gene (chDNA) of groups 3A and 3B
of Experimental Example 3.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0046] The nutritional composition can include one or more of free
lysine, dipeptides containing lysine, and/or lysine salts in a
total amount of 0.1 g-10.0 g per 100 kcal of the composition, and
n-3 fatty acid in a total amount of 0.17 g-5.00 g per 100 kcal of
the composition.
[0047] Lysine is one of the essential amino acids, and is the
limiting amino acid when corn, wheat, and the like are staple
foods, and is particularly effectively when added to the feed for
domestic animals, since it contributes to the efficient growth of
the animal. In addition, lysine may be in any form as long as it is
in a free form, dipeptide form, salt form, or the like (hereinafter
the "lysine" can mean a concept encompassing free lysine,
dipeptides containing lysine, lysine salts and the like). Since the
lysine in the nutritional composition is in a free form, a
dipeptide form, a salt form or the like, the composition can be
used for a long time without causing an excessive protein load,
even for elderly people with attenuated kidney function. While the
lysine may be in the L form, D form, or DL form, the L form is a
particular example. The lysine in various forms can be used alone,
or two or more forms of lysine can be used in combination. While
the form of lysine is not limited, examples of the lysine salts
include acid addition salt, salt with base and the like. Examples
of the acid to be added to lysine to form a salt include inorganic
acids such as hydrogen chloride, hydrogen bromide, sulfuric acid,
phosphoric acid; organic acids such as acetic acid, lactic acid,
citric acid, tartaric acid, maleic acid, fumaric acid,
monomethylsulfuric acid; acidic amino acids such as glutamate,
aspartic acid, and the like. In addition, examples of the base that
forms a salt with lysine include hydroxide or carbohydroxide of
metal such as sodium, potassium, calcium, inorganic bases such as
ammonia; organic bases such as ethylenediamine, propylenediamine,
ethanolamine, monoalkylethanolamine, dialkylethanolamine,
diethanolamine, and triethanolamine. More specific examples of the
lysine salts include lysine hydrochloride, lysine acetate, lysine
glutamate, lysine aspartate and the like. "Dipeptide" refers to an
amino acid dimer wherein two amino acid molecules are
peptide-bonded, and the "dipeptides containing lysine" can refer to
a dipeptide wherein at least one molecule, or 2 molecules, of the
dipeptide is lysine. Examples of the dipeptides containing lysine
include lysyllysine and the like. Among these lysines, lysine in a
salt form can be used, and L-lysine hydrochloride, L-lysine
acetate, and L-lysine glutamate are particular examples when used
in food. Moreover, since flavor, pH upon dissolution, and the like
can vary depending on the form, the form of lysine can be
appropriately changed depending on the use.
[0048] The amount of lysine can be 0.1 g-10.0 g per 100 kcal of the
composition and, from the aspect of amino acid nutrition balance,
can be 0.2-5.0 g, or 0.25-4.5 g. When the amount of lysine is less
than 0.1 g per 100 kcal of the composition, the desired effect
cannot be expected since the lysine is consumed making body protein
or an energy source. Conversely, when the amount exceeds 10.0 g, a
large amount of a single amino acid is ingested, which is not very
desirable for the amino acid balance. The amount of lysine can be
based on the free form.
[0049] While the daily intake of lysine is individually determined
depending on the age, sex, body weight, diet condition, and the
like, it can be 20 mg-400 mg, or 40 mg-200 mg, per kg human body
weight, from the aspect of amino acid nutrition balance. While the
maximum tolerable intake of lysine per day has not been clarified,
when it is more than 20 g per human kg body weight, a large amount
of a single amino acid is ingested, which is not very desirable for
the amino acid balance.
[0050] The n-3 fatty acid can be an unsaturated fatty acid having a
double bond at the third position from the methyl group end of the
hydrocarbon chain. Examples thereof include eicosapentaenoic acid,
docosahexaenoic acid, .alpha.-linolenic acid, docosapentaenoic
acid, and the like. These may be used alone, or two or more kinds
thereof may be used in combination.
[0051] The n-3 fatty acid is abundantly present in fats and oils
such as fish oil, Japanese basil oil, and flaxseed oil. The n-3
fatty acids can be extracted from these fats and oils and used
after purification. It is also possible to use n-3 fatty acids
produced by a chemical synthesis method, a fermentation method and
the like, and a commercially available product for food can also be
used. As a lipid source, moreover, the fats and oils that contain
an abundant amount of n-3 fatty acid can also be used directly.
[0052] The total amount of n-3 fatty acid present in the
composition can be 0.17 g-5.00 g, 0.18 g-4.00 g, or 0.19 g-3.00 g,
per 100 kcal of the composition. When the total amount is less than
0.17 g per 100 kcal of the composition, a clear effect cannot be
expected. Conversely, an amount exceeding 5.00 g in total per 100
kcal of the composition is not very preferable in view of the
flavor. In Japan, ingesting not less than 2 g of n-3 fatty acid per
day is recommended. Fats and oils containing n-3 fatty acid may be
directly used, or n-3 fatty acid or fats and oils that contain an
abundant amount of n-3 fatty acids may be mixed with other oils and
used, as long as the amount of the n-3 fatty acid falls within the
aforementioned range.
[0053] The n-3 fatty acid can contain eicosapentaenoic acid,
docosapentaenoic acid, and/or docosahexaenoic acid. When the n-3
fatty acid contains eicosapentaenoic acid, the amount of
eicosapentaenoic acid can be 10 mg-3000 mg, 20 mg-2000 mg, 50
mg-1000 mg, per 100 kcal of the composition. In addition, the
amount of eicosapentaenoic acid relative to the total amount of n-3
fatty acid can be 1 wt %-60 wt %, or 5 wt %-40 wt %. In Japan,
ingesting not less than 1 g of eicosapentaenoic acid together with
docosahexaenoic acid per day is recommended, and the upper limit is
not particularly set.
[0054] The nutritional composition can further contain a total
amount of 1.0 g-20 g of one or more kinds of branched chain amino
acids, such as valine, leucine and/or isoleucine, per 100 kcal of
the composition.
[0055] The branched chain amino acid can be valine, leucine, and/or
isoleucine. The form of these branched chain amino acids is not
particularly limited and may be any form such as a protein form, a
peptide form, a salt form, or a free form. In consideration of the
burden on the kidney and in an attempt to not increase the overall
amount of protein, the free form is usually the most preferable. In
this case, the L form, D form, or DL form can be used. In addition,
as the aforementioned branched chain amino acid, any of the amino
acids obtained by extraction from animals and plants etc., and
purification thereof, and the amino acids obtained by a chemical
synthesis method, a fermentation method, or a gene recombination
method, may be used.
[0056] The above-mentioned branched chain amino acids have been
found to be more highly effective when present in not less than
about 0.1 g in total per 100 kcal of the composition, and an
increased amount of the branched chain amino acid can be used when
a stronger effect is expected. In consideration of degradation of
the taste, the amount thereof per 100 kcal of the composition can
be 1.0 g-20 g, or 1.2 g-12 g, in total. When the total amount of
the branched chain amino acids excesses 20 g per 100 kcal of the
composition, a large amount of a particular amino acid is ingested,
which is not very preferable for the amino acid balance.
[0057] The branched chain amino acid may be in any form such as a
free form, a peptide form, a protein form, or salt form. The
branched chain amino acids may be all one type of form, or may be a
mixture of two or more kinds of different forms. For example, the
branched chain amino acid may consist solely of a branched chain
amino acid in a free form, or may contain a branched chain amino
acid in a free form and a branched chain amino acid in a protein
form, and the like. When the nutritional composition contains a
branched chain amino acid in a free form, the total amount thereof
can be 0.1 g-15 g, or 0.25-12 g, per 100 kcal of the
composition.
[0058] The amount of branched chain amino acid is typically
expressed based on the free form.
[0059] The branched chain amino acid can be valine, leucine, and/or
isoleucine. In this case, the mixing ratio of isoleucine, leucine,
and valine can be generally
isoleucine:leucine:valine=1.0:1.5-3.0:0.5-1.5 in a weight ratio.
Particularly, the ratio of leucine can be increased to about 1.5-
to 3-fold relative to valine.
[0060] The nutritional composition can contain B vitamin.
[0061] Examples of B vitamins include vitamin B.sub.1 such as
thiamine; vitamin B.sub.2 such as riboflavin; vitamin B.sub.6 such
as pyridoxine, pyridoxal, pyridoxamine; vitamin B.sub.12 such as
cyanocobalamin. These may be used alone or in combinations of two
or more. B vitamins play an important role in the metabolism of
carbohydrates, protein, and lipid. The amount of B vitamins can be
0.2 mg-20.0 mg for vitamin B.sub.1, 0.25 mg-20.0 mg for vitamin
B.sub.2, 0.3 mg-20.0 mg for vitamin B.sub.6, and 0.20 .mu.g-10.0
.mu.g for vitamin B.sub.12, per 100 kcal of the composition.
[0062] In addition, the nutritional composition can also contain
antioxidant vitamin and antioxidant mineral. Examples of the
antioxidant vitamin include vitamin A such as retinol, retinal,
retinoic acid; vitamin C such as ascorbic acid; carotenoid such as
.beta.-carotene; vitamin E such as .alpha.-tocopherol, and the
like. Examples of the antioxidant mineral include zinc, selenium,
and the like. These may be used alone, or in combinations of two or
more. When fat is utilized as an energy source for muscle protein
synthesis, since excess radicals are produced and oxidative stress
is caused as a result, an antioxidant can be added for the
prevention and/or improvement thereof. To achieve sufficient
antioxidant activity, the amount of antioxidant vitamin and
antioxidant mineral can be 50 .mu.g retinol equivalents-2500 .mu.g
retinol equivalents for vitamin A, 10 mg-700 mg for vitamin C, 1
mg-50 mg based on .alpha.-tocopherol for vitamin E, 1 mg-50 mg for
zinc, and 1.0 .mu.g-50.0 .mu.g for selenium, per 100 kcal of the
composition.
[0063] The nutritional composition can also contain vitamins other
than B vitamins and antioxidant vitamins (e.g., vitamin D, vitamin
K, niacin, folic acid, pantothenic acid, biotin etc.), and minerals
other than antioxidant minerals (e.g., sodium, calcium, iron,
phosphorus, magnesium, potassium, copper, iodine, manganese,
chrome, molybdenum etc.). These may be used alone, or in
combinations of two or more.
[0064] In addition, the nutritional composition can contain a
medium chain fatty acid oil as a lipid source. The "medium chain
fatty acid" can mean a fatty acid having 8-10 carbons, such as
caprylic acid, capric acid. The term "medium chain fatty acid oil"
can also mean fats and oils including triglycerides of the
aforementioned medium chain fatty acid, and the like. The medium
chain fatty acid can be characterized in that it is digested and
absorbed about 4 times more rapidly than long chain fatty acids
that are generally present in fats and oils, delivered after
absorption in the liver via the portal vein without passing through
lymphatic vessels, and rapidly metabolized. Therefore, it can be
preferably utilized as an energy source. Fats and oils containing a
large amount of medium chain fatty acids such as coconut oil, palm
oil, palm kernel oil can be used as the medium chain fatty acid
oil. Coconut and palm oils, and the like, can be extracted and
purified from natural plants such as coconut. However, a
commercially available product can be conveniently used. Medium
chain fatty acid oils can be added in an amount of 10 wt %-65 wt %
relative to the total weight of lipid.
[0065] The nutritional composition can contain, as a fat source
other than medium chain fatty acid oil, for example, edible
vegetable oil such as cottonseed oil, sunflower oil, peanut oil,
canola oil, soybean oil, safflower oil, olive oil, rice oil, corn
oil, benne oil, cacao butter, edible animal oil such as beef fat,
lard, fish oil, butter, butter oil, and processed fats and oils
such as shortening. These may be used alone, or in combinations of
two or more.
[0066] The nutritional composition can contain, as a carbohydrate
source, for example, glucide, dietary fiber, and the like. Examples
of glucide include dextrin, oligosaccharide, saccharose, glucose,
fructose, starch, and the like. Examples of dietary fiber include
water-soluble dietary fiber (e.g., indigestible dextrin, pectin,
galactomannan etc.), insoluble dietary fiber (e.g., soybean- and
wheat-derived bran, crystalline cellulose etc.), and the like.
These may be used alone, or in combination of two or more
kinds.
[0067] The nutritional composition can contain as a protein source,
amino acids, peptides, proteins, and the like. As the protein,
animal-derived protein such as casein, acid casein, casein sodium,
casein calcium, whey protein, milk serum whey protein, fish
protein, egg protein, and hydrolysates thereof, and plant-derived
protein such as soybean protein, wheat protein, corn protein, and
hydrolysates thereof, and the like can be added. The total amount
of these protein sources in the nutritional composition can be 2-20
g per 100 kcal of the composition. When these protein sources
contain branched chain amino acids, one should include the amount
of the branched chain amino acid from these sources when
calculating the total amount of the branched chain amino acids in
the composition.
[0068] When the nutritional composition contains a branched chain
amino acid in a protein form, the total content of the protein
source in the nutritional composition also including the protein
can be 2-20 g per 100 kcal of the composition. Particularly, when
the chosen branched chain amino acid in the nutritional composition
consists only of a branched chain amino acid in the free form, the
content of the total amount of the protein source in the
nutritional composition can be 1.0-15 g per 100 kcal of the
composition.
[0069] The nutritional composition can be directly administered
into the bowels and stomach of patients showing insufficient oral
ingestion, by using an administration tube, or when oral ingestion
is possible, it can be given as a food or drink. Lysine and n-3
fatty acid, and further, one or more kinds of branched chain amino
acids such as valine, leucine and/or isoleucine, and the like, may
be directly mixed and ingested as a nutritional composition, or the
composition can also be formulated with a pharmaceutically
acceptable carrier and provided as a pharmaceutical product.
Alternatively, the composition can also be provided in the form of
food or drinks, such as food claiming specified health or
nutritional benefits, by adding to a food or drink, or a food
additive, or can be provided as a general food or drink.
[0070] The nutritional composition can be formulated as a liquid
preparation such as an elixir, suspension, syrup, emulsion,
ampoule; or a solid preparation such as gel, gum, drop, powder,
granule, pill, tablet (including sugar-coated tablet, film-coated
tablet), capsule, package agent, powder, and the like.
[0071] Examples of the pharmaceutically acceptable carrier, which
can be used for formulating the nutritional composition, include
cellulose and a derivative thereof such as crystalline cellulose,
hydroxypropylcellulose; excipients such as natural polymer compound
(gum arabic, sodium alginate etc.); binders such as guar gum,
stearic acid, polymeric polyvinylpyrrolidone; lubricants such as
talc, polyethylene glycol 6000; disintegrants such as adipic acid,
surfactants such as sucrose fatty acid ester, soybean lecithin,
polyoxyethylene hydrogenated castor oil, polyoxyethylene
monostearic acid ester; thickeners such as sodium
carboxymethylcellulose, carboxyvinyl polymer, xanthan gum, gelatin;
coating agents such as ethyl acrylate-methyl methacrylate copolymer
dispersion, caramel, Carnauba wax, shellac-pullulan; pH adjusters
such as citric acid, sodium citrate, acetic acid, sodium acetate,
sodium hydroxide; antioxidants such as erythorbic acid,
butylhydroxyanisole, propyl gallate; flavoring agents such as
aspartame, licorice extract, saccharin; preservatives such as
sodium benzoate, sodium edetate, sorbic acid, sodium sorbate,
methyl paraoxybenzoate, butyl paraoxybenzoate; colorants such as
ferric oxide red, yellow iron oxide, black iron oxide, carmine,
Food Color blue No. 1, Food Color yellow No. 4, Food Color Red No.
2, and the like.
[0072] When the nutritional composition can be provided as food and
drink, such products can include liquid products such as drinks,
milk products such as milk, milk beverage, yogurt, jelly products
such as jelly drinks, jelly, gum products, powder products,
granular products, sheet products, capsule products, tablet
products, solid products such as snack bar, cookie, and the
like.
[0073] Examples of materials which can be used for forming the
nutritional composition as a food or drinks include a sweetener,
colorant, preservative, thickening stabilizer, antioxidant, color
former, bleach, fungicide, gum base, bittering agent, enzyme, gloss
agent, acidulant, seasoning, emulsifier, enhancement agent, agent
for production, flavor, spice, and the like.
[0074] When the nutritional composition is provided as food and
drink, it can be packaged as a single serving. Single serving
packaging can be used when the amount of food and drink to be
ingested per meal is determined in advance. Examples thereof
include a single serving package such as pack, bag, bottle, box in
case of drinks, gum, jelly, yogurt, cookie and the like. The single
serving package can be a pack, bag, and the like, in case of foods
in the form of granule, powder, slurry, and the like. Particularly,
when the food or drink are specified for health, nutritional,
special-use, or invalid uses, the composition can be packaged as a
single serving unit amount, such as when the composition is to be
suspended or dissolved in a bottle to give a drink etc., for a
single consumption and the like.
[0075] The amount of the nutritional composition to be ingested per
day can be individually determined depending on the age, sex, body
weight, meal condition, and the like, and can be about 50 kcal-2000
kcal for an adult per day. This amount can be ingested in about 1
to 3 portions a day. When the nutritional composition is formulated
in a single serving food or drink in a package form of one
ingestion amount unit, the amount to be ingested one time as
determined above can be individually packed.
[0076] The nutritional composition can be produced by conventional
formulation techniques and food production techniques.
[0077] The nutritional composition can be useful as a
pharmaceutical product, food or drink, and the like for increasing
muscle mass and/or suppressing a decrease in muscle mass. In
addition, the nutritional composition can be useful as a
pharmaceutical product, food or drink, and the like for increasing
energy consumption. Furthermore, the nutritional composition can be
useful as a pharmaceutical product, food or drink, and the like for
the prophylaxis and/or improvement of a decrease in muscle mass
unaccompanied by an increase in inflammatory cytokine.
[0078] The nutritional composition can be useful as a
pharmaceutical product, food and drink, and the like for the
prevention and/or improvement of muscle weakness symptom. The
muscle weakness symptom is also called sarcopenia, decreases the
amount of activity due to the decreased muscular strength of four
limbs, and further causes chronic obstructive pulmonary diseases
(COPD). The nutritional composition can effectively prevent and/or
improve such muscle weakness symptom.
[0079] The nutritional composition can be useful as a
pharmaceutical product, food or drink, and the like for enhancing
rehabilitation effect for muscle recovery. Recovery of muscular
strength by rehabilitation takes time, but the muscle function
needs to be recovered before progression of contracture. The
composition can increase muscle mass and is useful for enhancing
rehabilitation effect. It is also useful for the improvement of low
nutrient condition, improvement of deterioration in locomotorium,
prophylaxis and/or improvement of locomotive syndrome, prevention
of falling and the like, as well as increase of muscle mass in
sports and the like.
[0080] The nutritional composition can be useful as a
pharmaceutical product, food or drink, and the like for decreasing
visceral fat. Increase in visceral fat induces insulin resistance,
which can result in the development or progression of various
diseases associated with insulin resistance. The nutritional
composition can effectively reduce visceral fat.
[0081] The nutritional composition is useful as a pharmaceutical
product, food or drink, and the like for the prophylaxis and/or
improvement of dyslipidemia associated with visceral fat increase.
When the visceral fat increases, dyslipidemia such as high
LDL-cholesterolemia, hypertriglyceridemia, remnant
hyperlipoproteinemia, high small dense LDL, and low
HDL-cholesterolemia can occur. As a result of the onset of
dyslipidemia, the production of lipoperoxides such as LDL
cholesterol peroxide increases, and the risk of developing
atherosclerosis becomes high. The nutritional composition can
effectively suppress the onset of dyslipidemia such as increased
blood LDL cholesterol associated with visceral fat increase, and is
useful for the prevention and/or improvement of dyslipidemia
associated with visceral fat increase.
[0082] The nutritional composition is useful as a pharmaceutical
product, food or drink, and the like for the prophylaxis and/or
improvement of hyperglycemia associated with visceral fat increase.
Insulin resistance due to visceral fat increase depresses glucose
uptake efficiency from blood into the cell, and causes
hyperglycemia. The nutritional composition is useful for the
prophylaxis and/or improvement of hyperglycemia associated with
visceral fat increase.
[0083] The nutritional composition is useful as a pharmaceutical
product, food or drink, and the like for the prophylaxis and/or
improvement of fatty liver and deterioration of liver function
associated with visceral fat increase. Mesenteric fat, which is
representative of increased visceral fat, releases free fatty acids
into the portal blood, and causes accumulation of fat in the liver,
which is the nearest organ. On the other hand, hyperinsulinemia due
to insulin resistance also activates synthesis of fat from sugar in
the liver. Furthermore, fat accumulation in the liver aggravates
liver function. The nutritional composition is useful for the
prophylaxis and/or improvement of fatty liver and deterioration of
liver function associated with visceral fat increase.
[0084] The nutritional composition can be useful as a
pharmaceutical product, food or drink, and the like for the
prophylaxis and/or improvement of a decrease in basal energy
consumption. A decrease in the basal energy consumption in elderly
people means depressed energy utilization in the body, which exerts
a vast influence on the metabolism such as synthesis of proteins to
be utilized as energy. In addition, when the energy utilization is
depressed, the ingested energy becomes redundant, and the redundant
energy accumulates as fat. The nutritional composition can be
useful for the prophylaxis and/or improvement of a decrease in the
basal energy consumption.
[0085] The nutritional composition can be useful as a
pharmaceutical product, food or drink, and the like for the
prophylaxis and/or improvement of a decrease in basal body
temperature. When the body temperature is low, the metabolic
activity becomes weak, and energy production and body protein
synthesis are depressed. Particularly, in elderly people since
thermoregulatory competence is also attenuated, a low body
temperature cannot be easily increased. The nutritional composition
is useful for the prophylaxis and/or improvement of a decrease in
the basal body temperature.
[0086] The nutritional composition can be a multipurpose type
comprehensive nutritional composition containing lysine and n-3
fatty acid, and further, one or more kinds of branched chain amino
acids such as valine, leucine and/or isoleucine, in a powder form
and the like.
[0087] The nutritional composition can be used for increasing
muscle mass and/or suppressing a further decrease in muscle mass of
a person with a decreased muscle mass (e.g., elderly people,
bedridden person etc.). It is particularly effective when visceral
fat associated with dyslipidemia, hyperglycemia, fatty liver,
and/or deterioration of liver function is particularly used as an
energy source for muscle protein synthesis. The nutritional
composition greatly contributes to those people having no effective
nutritional composition heretofore.
EXAMPLES
[0088] The present invention is now explained based on the
following non-limiting Examples.
Example 1
Preparation of Nutritional Composition
[0089] The nutritional composition shown in Table 1 was prepared
with the goal of providing an optimum nutritional effect for
elderly people. The amounts of the starting materials of the liquid
are shown in Table 2. Each component and an emulsifier were added
to water, mixed, and an emulsion step was repeatedly performed in a
high-pressure emulsifying machine under pressurization of 500-1,000
kg/cm.sup.2 to give an emulsion composition. As the amino acid
composition, L-leucine (0.38 g), L-valine (0.19 g), L-isoleucine
(0.23 g) and L-lysine (0.32 g) were added per 100 kcal of the
composition. In this case, the total amount of the branched chain
amino acids (leucine, valine, isoleucine) including those derived
from a protein was 1.46 g per 100 kcal of the composition. The
emulsion composition was placed in an aluminum bag by a
conventional filling machine, and sterilized by a retort
sterilization machine under general conditions. The nutritional
composition of this Example stably contained all ingredients one
year later, and the viscosity at 25.degree. C. was 9 mPas. A
thickener was added to the regulated liquid, whereby a nutritional
composition with regulated thickness (1,000-7,000 mPas) or jelly
could be produced. Furthermore, even when the amount of the amino
acid added was 2-fold, similar production was possible. The calorie
density of the nutritional composition was 1.0 kcal/ml.
TABLE-US-00001 TABLE 1 Example 1 nutritional composition component
unit content/100 kcal Protein source g 4.5 L-leucine g 0.38
L-valine g 0.19 L-isoleucine g 0.23 L-lysine g 0.32 lipid g 2.80
medium chain fatty acid g 0.54 containing EPA mg 67 containing n-3
fatty acid g 0.195 hydrocarbonate g 14.2 carbohydrates g 13 dietary
fiber g 1.2 sodium mg 185 calcium mg 65 iron mg 0.8 phosphorus mg
55 magnesium mg 26 potassium mg 130 copper mg 0.11 iodine .mu.g 13
manganese mg 0.34 selenium .mu.g 2.5 zinc mg 1.65 chrome .mu.g 2.5
molybdenum .mu.g 2.1 vitamin A .mu.g RE *1 81 vitamin D .mu.g 0.46
vitamin E mg .alpha.-TE *2 2.73 vitamin K .mu.g 6.3 vitamin B.sub.1
mg 0.6 vitamin B.sub.2 mg 0.36 niacin mg NE *3 1.3 vitamin B.sub.6
mg 0.6 folic acid .mu.g 20 vitamin B.sub.12 .mu.g 0.5 biotin .mu.g
4.2 pantothenic acid mg 0.5 vitamin C mg 40.0 *1: retinol
equivalents *2: amount based on .alpha.-tocopherol *3: niacin
equivalents
TABLE-US-00002 TABLE 2 Example 1 starting material composition
.largecircle. Example 1 composition mixing ratio amount starting
material (w/v %) added unit casein sodium 3.8000 114 kg Lysine
hydrochloride 0.4000 12.0 kg leucine 0.3833 11.5 kg isoleucine
0.2300 6.90 kg valine 0.1900 5.70 kg dextrin 11.07 332 kg sugar
2.367 71.0 kg edible vegetable oil 1.387 41.6 kg medium-chain
triglyceride 0.5367 16.1 kg fish oil 0.2633 7.90 kg citric acid
0.1593 4.78 kg trisodium citrate 0.5433 16.3 kg potassium carbonate
0.2280 6.84 kg magnesium chloride 0.2207 6.62 kg calcium lactate
0.2960 8.88 kg glycerolcalcium phosphate 0.1303 3.91 kg mineral
yeast premix *1 0.06293 1.888 kg Indigestible dextrin 1.5070 45.2
kg emulsifier 0.6606 19.8 kg .beta.-carotene oil 0.0015 45.0 g
vitamin E 0.0052 156 g vitamin premix *2 0.1035 3.105 kg sodium
ascorbate 0.0810 2.43 kg prepared water 83.08 2492 kg total 107.7
3231 kg starting material amount unit *1 mineral yeast premix
composition molybdenum-containing yeast 13.0 g water-soluble
chrome-containing yeast 21.0 g selenium-containing yeast 37.0 g
manganese-containing yeast 203 g copper-containing yeast 337 g
zinc-containing yeast 707 g biotin-containing yeast 344 g sodium
ferrous citrate 226 g total 1.888 kg *2 vitamin premix composition
folic acid 0.60 g vitamin D powder 8.50 g vitamin B 12 0.1% powder
15.0 g riboflavin 5'-phosphate sodium 19.1 g calcium pantothenate
22.3 g pyridoxine hydrochloride 28.6 g nicotinic acid amide 38.5 g
thiamine hydrochloride 40.7 g vitamin A powder 45.7 g vitamin K2
powder 58.0 g kelp extract powder 278 g sodium erythorbate 2550 g
total 3.105 kg
Example 2
Preparation of Integrated Nutritional Composition
[0090] In the same manner as in Example 1, the nutritional
composition shown in Table 3 was prepared. In the same manner as in
Example 1, each component and an emulsifier were added to water,
mixed, and an emulsion step was repeatedly performed several times
in a high-pressure emulsifying machine under pressurization of
50-500 kg/cm.sup.2 to give an emulsion composition. As the amino
acid composition, L-leucine (0.28 g), L-valine (0.14 g),
L-isoleucine (0.14 g) and L-lysine (0.28 g) were added per 100 kcal
of the composition. In this case, the total amount of the branched
chain amino acids (leucine, valine, isoleucine) including those
derived from a protein is 1.30 g per 100 kcal of the composition.
The emulsion composition was placed in an aluminum bag by a
conventional filling machine, and sterilized by a retort
sterilization machine under general conditions. The nutritional
composition of this Example stably contained all ingredients one
year later, and the viscosity at 25.degree. C. was 4,000 mPas. An
appropriate amount of a thickener was added to the regulated liquid
to further impart viscosity, whereby a nutritional composition with
regulated thickness (1,000-7,000 mPas) or jelly could be produced.
The calorie density of the nutritional composition was 2.0
kcal/ml.
TABLE-US-00003 TABLE 3 Example 2 nutritional composition component
unit content/100 kcal Protein source g 4.5 L-leucine g 0.28
L-valine g 0.14 L-isoleucine g 0.14 L-lysine g 0.28 lipid g 2.80
medium chain fatty acid g 0.60 containing EPA mg 67 containing n-3
fatty acid g 0.19 hydrocarbonate g 14.2 carbohydrates g 13 dietary
fiber g 1.2 sodium mg 185 calcium mg 65 iron mg 0.8 phosphorus mg
55 magnesium mg 26 potassium mg 130 copper mg 0.11 iodine .mu.g 13
manganese mg 0.34 selenium .mu.g 2.5 zinc mg 1.65 chrome .mu.g 2.5
molybdenum .mu.g 2.1 vitamin A .mu.g RE *1 81 vitamin D .mu.g 0.46
vitamin E mg .alpha.-TE *2 2.73 vitamin K .mu.g 6.3 vitamin B.sub.1
mg 0.6 vitamin B.sub.2 mg 0.36 niacin mg NE *3 1.3 vitamin B.sub.6
mg 0.6 folic acid .mu.g 20 vitamin B.sub.12 .mu.g 0.5 biotin .mu.g
4.2 pantothenic acid mg 0.5 vitamin C mg 40.0 *1: retinol
equivalents *2: amount based on .alpha.-tocopherol *3: niacin
equivalents
Example 3
Preparation of Powder Nutritional Composition
[0091] The powder type nutritional composition shown in Table 4 was
prepared. The amounts of the starting materials of the liquid are
shown in Table 5. Each component and an emulsifier were added to an
appropriate amount of water, mixed, and an emulsion step was
repeatedly performed several times in a high-pressure emulsifying
machine under pressurization of 2-50 kg/cm.sup.2 to give an
emulsion composition. This emulsion composition was spray dried to
give a powder nutritional composition. As the amino acid
composition, L-leucine (3.9 g), L-valine (2.4 g), L-isoleucine (2.0
g) and L-lysine (4.1 g) were added per 100 kcal of the composition.
This powder nutritional composition was placed in an aluminum bag
by a conventional filling machine. The powder nutritional
composition of this Example stably contained all ingredients one
year later. This nutritional composition could be used even after
dissolving in warm water and mixing with a nutritional
supplement.
TABLE-US-00004 TABLE 4 Example 3 nutritional composition component
unit content/100 kcal Protein source g 12.4 L-leucine g 3.9
L-valine g 2.4 L-isoleucine g 2.0 L-lysine g 4.1 lipid g 4.8
containing EPA mg 812 containing n-3 fatty acid g 1.34
hydrocarbonate g 1.6 vitamin A .mu.g RE *1 413 vitamin E mg
.alpha.-TE *2 19.2 vitamin B.sub.1 mg 5.3 vitamin B.sub.2 mg 3.2
vitamin B.sub.6 mg 5.1 vitamin C mg 392.9 *1: retinol equivalents
*2: amount based on .alpha.-tocopherol
TABLE-US-00005 TABLE 5 Example 3 starting material composition name
of starting materials mixing ratio w/v % L-leucine 18.65
L-isoleucine 11.30 L-valine 9.475 L-lysine hydrochloride 24.64 fish
oil 22.99 vitamin A oil 500,000 IU/g 0.01230 thiamine hydrochloride
0.02571 riboflavin 5'-phosphate sodium 0.02037 Pyridoxine
hydrochloride 0.03038 tocopherol 40% 0.2146 L ascorbic acid Na
2.146 emulsifier 10.487 100.0
Experimental Example 1
Study of Enrichment Effect of Amino Acid and n-3 Fatty Acid in
Visceral Fat Increase Animal Model
[0092] The effects of amino acid and n-3 fatty acid in the
nutritional composition to improve visceral fat increase and muscle
mass decrease was examined by the following experiment. To be
specific, 10-week-old male C57BL/6J mice were fed with the same
high-fat diet as in 1B group shown in Table 6 to prepare visceral
fat increase models. They were divided into 3 groups (each group
N=5-9), and fed an experimental diet of the composition shown in
Table 6 for 2 weeks. 1B group was continuously fed a high-fat diet
containing a large amount of beef fat rich in saturated fatty acid.
1C group was fed an experimental diet of a standard composition. 1D
group was fed an experimental diet with an enriched composition,
wherein the total amount of protein and fat was not changed, and
0.32 g, 0.8 g, 0.24 g of lysine, BCAA (3 kinds of branched chain
amino acid consisting of leucine, valine, isoleucine) and fish oil,
respectively, per 100 kcal of experimental diet, were used for
substitution. In this case, 1D group was fed with 1.46 g of the
total amount of BCAA including those derived from protein, 0.24 g
of the total amount of n-3 fatty acid and 67 mg of eicosapentaenoic
acid (EPA), each per 100 kcal of the experimental diet. 1A group as
a normal control group was fed an experimental diet with a standard
composition throughout the test period, without a high-fat diet.
Two weeks after ingestion of experimental diets, they were fasted
for 16 hr, and the mesenteric fat weight and gastrocnemius muscle
weight were measured. The results are shown in FIG. 1.
TABLE-US-00006 TABLE 6 experimental diet composition table (content
per 100 kcal of experimental diet) fat (g) n-3 fatty Protein source
(g) fish oil acid L- L- L- L- beef (g) amount hydro- group casein
lysine valine leucine isoleucine soybean fat containing contained
carbonate constitution (g) (g) (g) (g) (g) oil (g) (g) EPA (mg) (g)
(g) 1A group 4.5 2.80 0.17 15.4 1B group 4.5 0.56 5.17 0.05 7.2 1C
group 4.5 2.80 0.17 15.4 1D group 3.38 0.32 0.2 0.4 0.2 2.56 0.24
0.24 15.4 67
[0093] The body weight of the 1B group fed a high-fat diet was 1.2
times that of the 1A group fed a general diet. Thereafter,
throughout the evaluation period when the experimental diet was
given, the body weight of the 1D group was lower than that of the
1C group, even though the calorie intake was the same (1D:
31.7.+-.3.3 g, 1C, 34.4.+-.1.7 g). Moreover, as shown in FIG. 1,
the mesenteric fat weight significantly increased in the 1B group
as compared to the 1A group, and the gastrocnemius muscle weight
was significantly decreased in the 1B group as compared to the 1A
group. On the other hand, the mesenteric fat weight was
significantly decreased in the 1D group and the gastrocnemius
muscle weight was significantly increased, as compared to the 1C
group. In this high-fat diet ingestion model, CRP in plasma (C
reactive protein) showed no difference between groups (1A group:
7.7.+-.2.4 ng/ml, 1B group: 9.0.+-.3.3 ng/ml, 1C group: 7.0.+-.5.3
ng/ml, 1D group: 8.6.+-.3.9 ng/ml).
[0094] From these test results, a diet enriched with lysine, BCAA,
eicosapentaenoic acid can decrease mesenteric fat weight, which is
the weight of visceral fat, and increase gastrocnemius muscle
weight.
Experimental Example 2
Single Effect and Combined Effect of Amino Acids (Lysine, BCAA) and
n-3 Fatty Acid
[0095] As a result of Experimental Example 1, enrichment with amino
acid and n-3 fatty acid was shown to be necessary for decreasing
mesenteric fat weight and increasing gastrocnemius muscle weight.
However, it is not clear whether each component shows this effect
alone. Therefore, amino acid and n-3 fatty acid were tested either
singly or in combination. That is, visceral fat increase models
were prepared in the same manner as in Experimental Example 1,
divided into 4 groups (each group N=5-9), and fed an experimental
diet of the composition shown in Table 7 for 2 weeks. The 2A group
was fed an experimental diet of a standard composition. The 2D
group was fed with an experimental diet an enriched composition,
wherein the total amount of protein and fat was not changed, and
0.32 g, 0.8 g, 0.24 g of lysine, BCAA and fish oil, respectively,
per 100 kcal of experimental diet, were used. In this case, the 2D
group was fed 1.46 g of the total amount of BCAA including those
derived from protein, 0.24 g of the total amount of n-3 fatty acid,
and 67 mg of eicosapentaenoic acid (EPA), each per 100 kcal of the
experimental diet. Furthermore, the 2B group and 2C group were fed
an experimental diet enriched with amino acid or n-3 fatty acid.
Two weeks after ingestion of the experimental diet, they were
fasted for 16 hr, and the mesenteric fat weight and gastrocnemius
muscle weight were measured. The results are shown in FIG. 2.
TABLE-US-00007 TABLE 7 experimental diet composition table (content
per 100 kcal of experimental diet) fat (g) fish oil Protein source
(g) (g) casein L-lys L-val L-leu L-ile soybean with EPA n3 fatty
acid hydro- (g) (g) (g) (g) (g) oil (g) (mg) amount (g) carbonate
(g) 2A 4.5 2.80 0.17 15.4 2B 3.38 0.32 0.2 0.4 0.2 2.80 0.17 15.4
2C 4.5 2.56 0.24 0.24 15.4 67 2D 3.38 0.32 0.2 0.4 0.2 2.56 0.24
0.24 15.4 67
[0096] The total calorie intake was not different between groups
during ingestion of the experimental diet. As shown in FIG. 2, the
2D group significantly decreased mesenteric fat weight, which is
the visceral fat, and significantly increased gastrocnemius muscle
weight. In contrast, decrease of mesenteric fat weight and increase
of gastrocnemius muscle weight in the 2B group and the 2C group
were clearly weak as compared to the effects in the 2D group, and
the effect in the 2B group even combined with the effect in the 2C
group was still lower than the effect in the 2D group.
[0097] From these results, the mesenteric fat decreasing action and
gastrocnemius muscle increasing action by the enriched diet was not
provided by the amino acid nor the n-3 fatty acid alone, but by a
synergistic effect of the amino acid and n-3 fatty acid in
combination. That is, in this test, the combined use of lysine and
n-3 fatty acid, and further, branched chain amino acid was shown to
be useful.
Experimental Example 3
Energy Metabolism Enhancing Effect and Mitochondria Increasing
Effect of Amino Acids and n-3 Fatty Acid
[0098] Then, the influence of the nutritional composition enriched
with amino acid and n-3 fatty acid on energy metabolism using an
exhaled gas metabolism measuring apparatus was examined. That is,
visceral fat increase model prepared in the same manner as in
Experimental Example 1 was fed an experimental diet with a standard
composition (3A group) or an experimental diet with an enriched
composition (3B group) shown in Table 8, and subjected to an
evaluation. To stabilize the amount of intake, a one-week
experimental diet acclimation period was set, after which one
animal was placed in each cage within 2 weeks, and oxygen
consumption (ml/min) and carbon dioxide production (ml/min) were
measured (metabolism measuring system for small animals MK-5000 RQ,
Muromachi Kikai Co., Ltd.). During the measurement, an experimental
diet was given, and the amount of intake was measured. The
respiratory quotient was calculated by carbon dioxide
production/oxygen consumption, and the energy consumption was
calculated by the formula of Weir [energy consumption
(kcal/min)=3.9 (kcal).times.oxygen consumption (ml/min)+1.1
(kcal).times.carbon dioxide production (ml/min)]. The results are
shown in FIG. 3.
TABLE-US-00008 TABLE 8 experimental diet composition table (content
per 100 kcal of experimental diet) fat (g) fish oil Protein source
(g) (g) casein L-lys L-val L-leu L-ile soybean with EPA n3 fatty
acid hydro- (g) (g) (g) (g) (g) oil (g) (mg) amount (g) carbonate
(g) 3A 4.5 2.80 0.17 15.4 3B 3.38 0.32 0.2 0.4 0.2 2.56 0.24 0.24
15.4 67
[0099] As shown in FIG. 3, the respiratory quotient of the 3B group
decreased significantly as compared to the 3A group during the diet
ingestion period (9:00-16:00; diet) and the dark period after
eating (16:00-19:00; dark period), and also decreased significantly
as compared to the 3A group even in the light period (19:00-9:00:
light period), which is free of a direct influence of eating. The
energy consumption of the 3B group increases significantly or
increases as compared to the 3A group at any period.
[0100] In addition, the ability of the nutritional composition to
effect the mitochondria was examined. That is, visceral fat
increase model prepared in the same manner as in Experimental
Example 1 was fed an experimental diet with a standard composition
(3A group) or an experimental diet with an enriched composition (3B
group) shown in Table 8, and, on the last day of the test, the
liver and gastrocnemius muscle were rapidly collected and
cryopreserved. DNA was extracted from each of the cryopreserved
liver (100 mg) and gastrocnemius muscle (200 mg) by using ISOGEN
(Japan gene). To 50 ng DNA were added the primer of d-loop of
mitochondria shown in Table 9 and SYBER GREEN Master Mix (ABI), and
amplification and quantification analysis were performed using an
ABI 7700 detector. For the amendment of DNA amount, gene
cyclophillin A (intron code part) on the chromosome was used. As
for the synthesized primer, the occurrence of desired production
was confirmed by agarose electrophoresis after PCR reaction.
TABLE-US-00009 TABLE 9 DNA primer of mitochondria and chromosome
Gene sense antisense ch ACACGCCATAATGGCACTGG CAGTCTTGGCAGTGCAGAT
cyclo- (Sequence Listing (Sequence Listing phillin SEQ ID NO: 1)
SEQ ID NO: 2) A mt d- CGCAAAACCCAATCACCTAA TTGGGGTTTGGCATTAAGAG
loop (Sequence Listing (Sequence Listing SEQ ID NO: 3) SEQ ID NO:
4)
[0101] Since mitochondria plays an important role in fat combustion
in the cell, the number of intracellular mitochondria was analyzed.
While only one intranuclear chromosomal DNA is present in the cell,
the number of mitochondria is not the same. Therefore, the amount
of mitochondria in the cell was assumed by a method of determining
the ratio of the DNA amount of mitochondrial coding gene and that
of the nuclear coding gene. The results are shown in FIG. 4.
[0102] As shown in FIG. 4, the mitochondrial DNA amount of the 3B
group significantly increased in both the liver and gastrocnemius
muscle, as compared to the 3A group.
[0103] By this test, a nutritional composition containing lysine
and n-3 fatty acid, and further, a branched chain amino acid, can
result in an increase in the number of mitochondria to enhance fat
utilization, and can increase energy consumption that leads to an
increase in the body temperature, and the like.
INDUSTRIAL APPLICABILITY
[0104] The nutritional composition as described herein is effective
for increasing muscle mass and/or suppressing a decrease in muscle
mass. In addition, the nutritional composition is effective for
increasing energy consumption. In addition, the nutritional
composition is particularly useful for decreasing visceral fat by
increasing energy consumption by enhanced fat utilization and the
like. In addition, it is useful for the prophylaxis and/or
improvement of dyslipidemia, hyperglycemia, fatty liver, and
deterioration of liver function associated with visceral fat
increase. Furthermore, by increasing muscle mass or suppressing a
decrease in muscle mass by fat energy supply and the like, the
nutritional composition is also useful for the prophylaxis and/or
improvement of sarcopenia, chronic obstructive pulmonary disease
(COPD), promotion of rehabilitation effect for muscle recovery,
improvement of low nutrient condition, improvement of deterioration
in locomotorium, prophylaxis and/or improvement of locomotive
syndrome, prevention of falling, increasing muscle mass in sports
and the like. Moreover, the nutritional composition is effective
for the prophylaxis and/or improvement of a decrease in basal
energy consumption, and prophylaxis and/or improvement of a
decrease in basal body temperature. Furthermore, the nutritional
composition is highly safe, and can be used for a long time without
placing an excessive protein load even for elderly people with
attenuated kidney function.
[0105] While the invention has been described in detail with
reference to preferred embodiments thereof, it will be apparent to
one skilled in the art that various changes can be made, and
equivalents employed, without departing from the scope of the
invention. Each of the aforementioned documents is incorporated by
references herein in its entirety.
Sequence CWU 1
1
4120DNAArtificial Sequenceprimer 1acacgccata atggcactgg
20219DNAArtificial Sequenceprimer 2cagtcttggc agtgcagat
19320DNAArtificial Sequenceprimer 3cgcaaaaccc aatcacctaa
20420DNAArtificial Sequenceprimer 4ttggggtttg gcattaagag 20
* * * * *