U.S. patent application number 14/045357 was filed with the patent office on 2014-01-30 for method for predicting the response to a therapy.
This patent application is currently assigned to INDEX PHARMACEUTICALS AB. The applicant listed for this patent is Lisa Charlotta Bandholtz, Alexander Gielen, Nikolai Kouznetsov, Oliver Von Stein, Petra Von Stein. Invention is credited to Lisa Charlotta Bandholtz, Alexander Gielen, Nikolai Kouznetsov, Oliver Von Stein, Petra Von Stein.
Application Number | 20140030723 14/045357 |
Document ID | / |
Family ID | 40795763 |
Filed Date | 2014-01-30 |
United States Patent
Application |
20140030723 |
Kind Code |
A1 |
Kouznetsov; Nikolai ; et
al. |
January 30, 2014 |
Method for Predicting the Response to a Therapy
Abstract
A test kit for selecting a therapy for a steroid resistant
patient presenting inflammatory symptoms comprises primer pairs or
antibodies specific for at least one marker gene or protein
translated from at least one marker gene, and instructions for use.
The primer pairs or antibodies enable analysis of expression level
of the at least one marker gene or translated protein from the at
least one marker gene.
Inventors: |
Kouznetsov; Nikolai;
(Jarfalla, SE) ; Bandholtz; Lisa Charlotta;
(Stockholm, SE) ; Gielen; Alexander; (Bandhagen,
SE) ; Von Stein; Oliver; (Upplands Vasby, SE)
; Von Stein; Petra; (Upplands Vasby, SE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kouznetsov; Nikolai
Bandholtz; Lisa Charlotta
Gielen; Alexander
Von Stein; Oliver
Von Stein; Petra |
Jarfalla
Stockholm
Bandhagen
Upplands Vasby
Upplands Vasby |
|
SE
SE
SE
SE
SE |
|
|
Assignee: |
INDEX PHARMACEUTICALS AB
Stockholm
SE
|
Family ID: |
40795763 |
Appl. No.: |
14/045357 |
Filed: |
October 3, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12746758 |
Jul 22, 2010 |
8574834 |
|
|
PCT/SE2008/051446 |
Dec 12, 2008 |
|
|
|
14045357 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/7.92; 530/389.8; 536/24.33 |
Current CPC
Class: |
C12Q 1/6883 20130101;
C12Q 2600/154 20130101; G01N 2800/52 20130101; C12Q 2600/106
20130101; G01N 33/5044 20130101; C12Q 2600/158 20130101 |
Class at
Publication: |
435/6.12 ;
536/24.33; 530/389.8; 435/7.92 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 14, 2007 |
SE |
0702789-9 |
Claims
1. A test kit for selecting a therapy for a steroid resistant
patient presenting inflammatory symptoms, wherein said kit
comprises primer pairs or antibodies specific for at least one
marker gene or protein translated from at least one marker gene,
and said primer pairs or antibodies enable analysis of expression
level of said at least one marker gene or translated protein from
said at least one marker gene, and instructions for use.
2. A test kit according to claim 1, wherein said kit comprises
antibodies enabling analysis of the expression level of at least
one marker gene determined by the protein level translated from the
at least one marker gene, and wherein the at least one marker gene
is selected from the group consisting of CD163, Tsp1, ID-R2, TLR2,
TLR4, MKP-1 and TXK.
3. A test kit according to claim 1, wherein said kit comprises
specific primer pairs enabling analysis of expression level of at
least one marker gene, and instructions for use, and wherein said
specific primer pairs are specific for at least one of the genes
selected from the group consisting of CD163, Tsp1, TLR2, TLR4,
MKP-1 and TXK.
4. The kit according to claim 3, wherein said specific primer pairs
are selected from the group of SEQ ID NO: 1-14 or functionally
equivalent primer pairs specific for at least one of the genes
selected from the group consisting of CD163, Tsp1, ID-R2, TLR2,
TLR4, MKP-1 and TXK.
5. The kit according to claim 3, wherein said specific primer pairs
are selected from the group of SEQ ID NO: 1-6 or functionally
equivalent primer pairs specific for at least one of the genes
selected from the group consisting of CD163, Tsp1 and IL1-R2.
6. The kit according to claim 3, wherein said specific primer pairs
are SEQ ID NO: 1 and SEQ ID NO: 2 or functionally equivalent primer
pairs specific for the CD163 marker gene.
7. The kit according to claim 1, wherein said kit further comprises
means for cultivating cells.
8. The kit according to claim 1, wherein said kit further comprises
an agent for sensitizing cells to the action of steroids.
9. The kit according to claim 1, wherein said kit further comprises
means for carrying out hybridization or annealing assay.
Description
[0001] The specification incorporates by reference the Sequence
Listing submitted herewith as Sequence-Listing-188823A_ST25.txt of
3 KB size, created Oct. 3, 2013.
TECHNICAL FIELD
[0002] The present invention relates to the diagnosing and
treatment of steroid resistant or steroid dependent diseases or
disorders. The invention relates to a method for predicting the
response to a therapy and for selecting a therapy, particularly for
deciding on the applicability of a re-sensitization therapy. The
invention is based on in vitro determination of the expression
level of one or more marker gene(s) in a sample from a patient
presenting with a disease or disorder related to steroid resistance
or steroid dependence. The method may be applied to identifying
marker genes useful in the method. The invention also discloses
reagents and test kits for use in said method as well as methods
for selecting an efficient therapy for said patient.
BACKGROUND
[0003] Natural glucocorticoids are steroid hormones that regulate a
variety of biological processes and influence many physiological
functions by virtue of their diverse roles in the growth,
development, differentiation, and maintenance of basal and
stress-related homeostasis (Munck, 1984; Clark, 1992).
Glucocorticoids affect probably every organ in the mammalian body,
yet many of their effects are specific for certain cell types or
tissues. In addition, synthetic glucocorticoids are among the most
widely prescribed drugs worldwide, used primarily as
anti-inflammatory and immunosuppressive agents.
[0004] Steroid resistance or steroid dependence is still a major
clinical concern for a large number of patients afflicted with
inflammatory diseases as current therapies rely on the use of
potent immunomodulators that can induce serious side-effects.
Abnormalities in glucocorticoid sensitivity can be divided into 2
major groups: resistance and hypersensitivity. Resistance to
glucocorticoids is characterized by the inability of organism or
target tissues to respond to steroid molecules and can be
generalized or tissue-specific, transient or permanent, partial or
complete, and compensated or non-compensated (Chrousos, 1982;
Chrousos, 1993). Complete glucocorticoid resistance is not
compatible with life, given that absence of functional
glucocorticoid receptors (GRs) in GR -/- knockout mice leads to
severe neonatal respiratory distress syndrome and death within a
few hours after birth (Cole, 1995).
[0005] Treatment with glucocorticoids is the most potent therapy
available for acute and chronic asthma especially for patients with
severe disease. Unfortunately, a certain fraction of asthmatics are
steroid resistant (SR) and do not benefit from standard treatment.
A rough estimate is that SR asthma occurs in approximately 15-20%
of the asthmatic population. It is critical to identify these
patients as early as possible. Patients who do not respond to low
steroid doses are often placed on higher doses, which in SR
asthmatics can cause significant adverse effects without providing
significant benefit (Leung, 1995).
[0006] Inflammatory disorders normally treated with the natural or
synthetic glucocorticoids, comprise asthma, rheumatoid arthritis,
ulcerative colitis, Crohn's disease and other disorders. An
inflammatory disorder includes complex diseases, which involve many
factors and cell types and have a distinct inflammatory cytokine
profile. The nature and magnitude of an immune response is largely
dictated by the profile of the foreign antigen to which the immune
system has been exposed. This event sets into motion a series of
events that ultimately lead to the generation of humoral and
cell-mediated immunity. These two different effector functions are
brought about by the presence of two subpopulations of helper T
cells (Th1 and Th2). Under "normal" healthy conditions, there is a
delicate balance between the cytokines produced by the cell types
Th1 and Th2. If this balance is lost, there will be a polarization
resulting in predominantly Th1 or Th2 type inflammation and
clinical manifestation of the disease will occur. As also
indicated, different inflammatory diseases can be segregated as
being either Th1 or Th2, depending on the cytokine profile seen.
The cytokine picture indicates that asthma and ulcerative colitis
are Th2 type diseases, while rheumatoid arthritis is associated
with a Th1 type of inflammation.
[0007] New therapeutics have been applied to restore the
"in-balance" in Th1 type diseases by reducing the cytokine profile
of Th1 and thereby allowing an increase of the Th2 profile (Neurath
et al., 1995; Mannon et al., 2004). The bacterial DNA has been
shown to have immune stimulatory effects capable of activating B
cells and natural killer cells (reviewed in Krieg, 1998) due to the
presence of unmethylated CpG dinucleotides (CpG motifs). The
vertebrate immune system has evolved the ability to recognize
unmethylated CpG motifs and respond with a rapid and coordinated
cytokine response leading to the induction of humoral and
cell-mediated immunity (Krieg, 1996). For example, human and mouse
cells respond to oligonucleotides containing a CpG motif by
enhanced secretion of interferon-gamma (IFN-gamma) (Iho et al.,
1999: Cowdery et al., 1996), IL-1, IL-6, IL-12 and tumor necrosis
factor alpha (TNF-alpha) (Stacey et al., 1996; Jakob et al., 1998;
Sparwasser et al., 1998). Due to the nature of cytokines induced,
CpG containing oligonucleotides are largely considered to induce a
Th1 profile both in vitro and in vivo (Zimmermann et al., 1998;
Kline, 2000). In addition to the presence of CpG motifs,
researchers have also noted that synthesizing CpG oligonucleotides
with a full nuclease-resistant phosphorothioate backbone can
potentate the stimulatory effects of the oligonucleotides, probably
via stimulation of B-cells, whereas the same sequence with native
phosphodiester backbone had no effect (Zhao et al., 1996).
[0008] The use of CpG motifs containing oligodeoxynucleotides
(ODNs), or DNA vaccination which induce allergen-specific or
unspecific Th1 responses are currently considered as a strategy
both for the prevention and therapy of asthma (Wolleben, 2006).
[0009] The international patent application WO 2007/004977 concerns
the treatment of a steroid refractory or steroid dependent patient
afflicted with an inflammatory condition not responding or
responding poorly or inadequately to a given anti-inflammatory
treatment. The steroid efficacy can be enhanced by administering an
effective amount of an oligonucleotide having the sequence
5'-Xm-CG-Yn-3' to the patient. In the sequence of the
oligonucleotide X is A, T, C or G, Y is A, T, C or G, m=1-100,
n=1-100 and at least one CG dinucleotide is unmethylated.
[0010] The international patent application WO 2007/004979 concerns
a method for enhancing the steroid efficacy in a steroid refractory
or steroid dependent patient afflicted with an inflammatory
condition not responding or responding poorly or inadequately to a
given anti-inflammatory treatment by administering an effective
amount of an oligonucleotide having the sequence 5'-TTCGT-Yn-3' to
the patient. In the oligonucleotide sequence, X is A, T, C or G, Y
is A, T, C or G, m=1-7, n=1-7 and at least one CG dinucleotide is
unmethylated.
[0011] The above methods are applicable also in a situation, where
weaning down the dosing of the anti-flammatory treatment is
ineffective. Another therapy involving the use of oligonucleotides
is presented in the international application WO 2002/085308, which
discloses compositions, formulations, and kits for the treatment of
respiratory and pulmonary diseases including asthma, infectious
diseases, cancer and diseases having secondary effects on the
lungs. This indicates that the compositions containing both
anti-sense oligonucleotides and steroid agents and/or ubiquinones
have effects superior to each agent alone and may be used as
preventative, prophylactic or therapeutic single therapies or in
conjunction with other therapies. The anti-sense oligonucleotide
preferably contains about 0-15% of adenosine (A) and is anti-sense
to the initiation codon, the coding region, the 5'-end or the
3'-end genomic flanking regions, the 5' or 3' intron-exon
junctions, or regions within 2-10 nucleotides of the junctions of
at least one gene regulating or encoding a target polypeptide
associated with lung or airway dysfunction or cancer, or that is
anti-sense to the corresponding mRNA.
[0012] The multi-gene approach disclosed in the international
patent application WO 2004/001073, provides specific marker genes,
which allow discrimination of inflammatory bowel disease,
ulcerative colitis and Crohn's disease. The method compares gene
expression profiles in biopsy samples obtained from inflamed, and
optionally also from non-inflamed, areas in the intestines.
[0013] U.S. 20040197786 presents a method for examining steroid
responsiveness in atopic dermatitis patients. In the method the
expression levels of the genes RING6 and HLA-DMB are suggested as
markers for testing steroid responsiveness and for use in the
screening for compounds that may be used to improve steroid
responsiveness.
[0014] The international patent application WO2003/021261 concerns
a method for predicting the efficacy of a drug for treating an
inflammatory disease, by analyzing the gene expression profile in a
sample isolated from the patient.
[0015] Steroid dependency and steroid resistance does also occur in
other conditions, such as steroid dependent nephrotic syndrome
(SDNS), steroid-dependent corneal inflammation, edema of various
etiology etc.
[0016] Despite the multitude of available therapies, the individual
variations to said therapies remains a challenge to a physician
confronting a patient presenting with syndromes related to a
disease with no response or a poor response to a given steroid
therapy. It would be advantageous for a physician dealing with said
problems to have a simple and rapid in vitro test, which would
enable a relatively reliable prediction of the response of the
individual patient to the chosen therapy.
[0017] Therefore, there is a great demand for a simple,
straightforward and rapid in vitro method for predicting steroid
efficacy in a steroid unresponsive individual and to determine if
the steroid efficacy in a steroid unresponsive, i.e. steroid
resistant or steroid dependent individual can be enhanced. A method
for predicting the response would simplify the choice of
anti-inflammatory treatment, help to ameliorate the disease in
question and decrease the costs and detrimental side effects of the
steroid therapy, thereby increasing the quality and length of life
for a large number of patients.
SUMMARY
[0018] The present invention relates to steroid resistant or
steroid dependent disorders or diseases, and in particular to an in
vitro method for selecting a therapy for a patient suspected of
being steroid resistant or steroid dependent, or predicting the
response of said patient presenting, wherein the method comprises
determining the expression level of at least one potentially useful
marker gene from cells, isolated from a sample of said patient and
cultivated in the presence of a steroid, an immunomodulatory
oligonucleotide or a mixture thereof. Said expression levels are
compared to the expression level obtained in the absence of the
steroid, immunomodulatory oligonucleotide or a mixture thereof and
to a control, for example but not limited to the corresponding
expression levels obtained with said marker gene from cells
isolated from samples of volunteering healthy persons.
[0019] The method may also be used for identifying genes, which are
potentially useful as marker genes for in vitro selection of an
effective therapy for a steroid resistant patient or for predicting
the responsiveness of said patient to different therapies.
Applicable marker genes may be identified among genes involved in
steroid response in a patient with an inflammatory condition. The
genes selected to be used in the method are genes which provide
expression levels in isolated cells cultivated in the presence or
absence of selected therapeutic agents, which expression levels
using statistical methods are significantly different in cells from
patients as compared to cells from healthy persons or from steroid
sensitive persons.
[0020] The present invention also relates to a test kit for
selecting a therapy for a steroid resistant patient presenting with
inflammatory symptoms, wherein said test kit comprises specific
primer pairs for enabling in vitro analysis of expression level of
at least one marker gene and instructions for use.
[0021] The invention also relates to the kit for determining
steroid responsiveness of a steroid resistant patient or a patient
with a poor steroid response and whether this steroid
responsiveness could be enhanced by administration of an
immunomodulatory oligonucleotide therapy, and to the use of the
method and the kit in a therapy of a steroid resistant patient or a
patient with a poor steroid response.
[0022] One embodiment of the invention is an in vitro method for
selecting the therapy for a steroid resistant patient, for example
a patient presenting with inflammatory symptoms, wherein the method
comprises [0023] isolating cells from a sample taken from said
patient; [0024] cultivating said isolated cells in the presence of
a steroid, an immunomodulatory oligonucleotide or a mixture
thereof; [0025] determining an expression level of at least one
marker gene in said isolated cells; and [0026] comparing said
expression level of said at least one marker gene to a value
obtained from the cultivation of cells from a healthy person in the
presence of a steroid, an immunomodulatory oligonucleotide or a
mixture thereof, or to a normalized value obtained from a healthy
population.
[0027] According to an embodiment of the above method, a
significant similarity in the expression level of at least one
selected marker gene measured in cells isolated from a sample of a
steroid resistant patient and a healthy person, which cells are
cultivated in the presence of a steroid, indicates that the
selected marker gene is a potential marker for steroid
responsiveness, and the results obtained are evaluated and used for
selecting the therapy for said patient.
[0028] Further, according to another embodiment of the above
method, a significant similarity in the expression levels of at
least one selected marker gene measured in cells isolated from a
sample of a steroid resistant patient and a healthy person, which
cells are cultivated in the presence of a steroid and an
immunomodulatory oligonucleotide, indicates that the selected
marker gene is a potential marker for re-sensitization to the
action of steroids.
[0029] According to another embodiment of the above method, a
significant difference in the expression levels of at least one
selected marker gene in cells isolated from a sample of a steroid
resistant patient and a healthy person, which cells are cultivated
in the presence of a steroid and an immunomodulatory
oligonucleotide, indicates that the selected marker gene is a
potential marker for steroid resistance, which may not be enhanced
by the addition of an immunomodulatory oligonucleotide.
[0030] According to an embodiment of the above method, the selected
marker gene or genes providing significantly different expression
levels are one or more chosen from the genes CD163, Tsp1, IL1-R2,
TLR2, TLR4, MKP1 and TXK.
[0031] According to an embodiment of the above method, an elevated
expression level of at least one of the selected marker genes in
cells isolated from a sample of the patient and cultivated in the
presence of a steroid as compared to the expression level in the
absence of the steroid, indicates that the patient would benefit
from a steroid therapy. Preferably, the selected marker gene or
genes is/are at least one of the genes CD163, Tsp1, and IL1-R2.
[0032] According to an embodiment of the above method, an elevated
expression level, and preferably a dose-dependent increase, of at
least one of the selected marker genes in cells isolated from a
sample of the patient and cultivated in the presence of a steroid
and an immunomodulatory oligonucleotide as compared to the
expression level in absence of said steroid and immunomodulatory
oligonucleotide, indicates that the patient would benefit from a
combination therapy. Preferably, the selected marker gene or genes
is/are at least one of the genes CD163, Tsp1, and IL1-R2.
[0033] According to an embodiment of the invention, a significant
difference in expression levels of at least one marker gene
measured in isolated cells from a sample of a steroid resistant
patient and healthy person and cultivated in the presence of a
steroid and an immunomodulatory oligonucleotide, indicates that
said steroid resistant patient would benefit from being excluded
from a steroid therapy and being subjected to an alternative
therapy comprising an immunomodulatory oligonucleotide therapy.
Here, the selected marker genes are preferably chosen from CD163,
Tsp1, IL1-R2, TLR2, TLR4, MKP-1 and TXK.
[0034] In the inventive method, the cell is preferably a blood
cell, and more preferably a peripheral blood mononuclear cell
(PMBC).
[0035] The methods according to the invention are applicable to all
conditions, where a patient exhibits steroid resistance or
dependence. A skilled person will be able to identify conditions,
where it would be valuable to determine if a patient is steroid
dependent or resistant, and if said patient would benefit from a
specific therapy.
[0036] The invention is particularly drawn towards patients
presenting with inflammatory symptoms, and most particularly, the
inflammatory symptom is an inflammatory symptom chosen from acute
or chronic asthma, chronic obstructive pulmonary disease (COPD),
ulcerative colitis, Crohn's disease, rheumatoid arthritis,
psoriasis, and emphysema.
[0037] The therapy concerned may be a combination therapy or an
alternative therapy comprising e.g. the administration of an
immunomodulatory oligonucleotide. Preferably the combination
therapy includes the administration of a steroid and an
immunomodulatory oligonucleotide.
[0038] The term "steroid" is used to encompass both corticosteroids
and glucocorticosteroids. The steroid can be chosen from but is not
limited to beclomethasone, prednisolone, methylprednisolone,
fluticasone, triamcinolone, budesonide or dexamethasone, including
equivalent drugs.
[0039] In the various embodiments of the invention, the steroid is
a glucocorticoid, preferably a synthetic glucocorticoid, such as
hydrocortisone, prednisone, prednisolone, methylprednisolone,
dexamethasone, betamethasone, triamcinolone, beclomethasone,
fludrocortisones, deoxycorticosterone, and aldosterone, preferably
dexamethasone.
[0040] According to an embodiment of the invention, the expression
level of said marker gene is determined by nucleic acid
amplification of said gene using gene specific primers, and
quantifying the amplification results. Preferably the nucleic acid
amplification is performed by a real time PCR and using the gene
specific primers chosen from SEQ ID NO: 1-7.
[0041] The invention also concerns a test kit for selecting a
therapy for a steroid resistant patient presenting with
inflammatory symptoms, wherein said test kit comprises specific
primer pairs for enabling in vitro analysis of expression level of
at least one marker gene and instructions for use.
[0042] In the above kit, said specific primer pairs are selected
from the group of SEQ ID NO: 1-14 or functionally equivalent primer
pairs specific for at least one of the genes CD163, Tsp1, IL1-R2,
TLR2, TLR4, MKP1 and TXK.
[0043] In a particular embodiment, said specific primer pairs are
SEQ ID NO: 1 and SEQ ID NO: 2 or functionally equivalent primer
pairs specific for the CD163 marker gene.
[0044] A kit according to the invention may further preferably
comprise means for cultivating cells, and an agent for sensitizing
the cells to the action of steroids.
[0045] Said kit preferably further comprises means for carrying out
hybridization or annealing assay.
[0046] The invention also concerns the use of a method as defined
above for determining steroid responsiveness of a steroid resistant
patient or a patient with a poor steroid response. Alternatively,
the method is used for identifying a steroid resistant patient, who
would benefit from an immunomodulatory oligonucleotide therapy.
Alternatively, the method is used for screening whether an
immunomodulatory compound enhances steroid responsiveness of a
steroid resistant patient or a patient with poor steroid
response.
[0047] The invention also discloses the use of any one of the genes
CD163, Tsp1, IL1-R2, TLR2, TLR4, MKP1 and TXK, for preparing a
reagent for in vitro identification of steroid responsive patients,
which would benefit from steroid therapy; or for preparing a
reagent for in vitro identification of steroid resistant patients,
which would benefit from combination therapy comprising steroid
therapy and immunomodulatory oligonucleotide therapy; or for
preparing a reagent for in vitro identification steroid responsive
patients, which would benefit from being excluded from steroid
therapy; or for preparing a reagent for in vitro identification
steroid resistant patients, which would benefit from being
subjected to an alternative therapy comprising an immunomodulatory
oligonucleotide therapy.
[0048] In the above, the reagent is preferably a primer pair
specific for said genes.
[0049] More preferably, the reagent is an oligonucleotide probe,
which is complementary to a specific region of said genes and
capable of hybridizing or annealing with said genes.
[0050] Further aspects of the invention are set out in the attached
claims, hereby incorporated by reference.
DESCRIPTION OF THE DRAWINGS
[0051] The invention will be described in closer detail in the
description, examples and claims, with reference to the attached
figures in which:
[0052] FIG. 1 depicts the average value of expression level of
CD163 gene in peripheral blood mononuclear cells (PBMC) in response
to 48 hrs stimulation with the immunomodulatory oligonucleotide
IDX0150 alone, dexamethasone (Dex) alone, or IDX0150 and Dex in
combination as quantified by real-time PCR. PBMC were isolated from
blood samples of ten (n=10) healthy volunteers (HV) and seven (n=7)
steroid resistant asthma patients (SR). Cells were incubated in a
basal medium or in a basal medium with increasing concentrations of
IDX0150 (25 .mu.M or 100 .mu.M) in the presence or absence of Dex
at increasing concentrations (10.sup.-10, 10.sup.-8 or 10.sup.-6M)
as described in Example 1. After incubation, the total RNA was
isolated from PBMCs and used for first strand cDNA synthesis.
Real-time PCR reactions with PBMC cDNA were performed in
triplicates for each sample/treatment combination and in duplicates
for a housekeeper gene (.gamma.-actin). Each bar of the histogram
represents the average expression level value, normalized by basal
expression level value as described in Example 1. The error-bars
indicate the deviation range of the values of expression levels in
different blood donors.
[0053] FIG. 2 depicts the average value of expression level of Tsp1
gene in PBMC in response to 48 hrs stimulation with IDX0150 alone,
Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 1 and Example 1.
[0054] FIG. 3 depicts the average value of expression level of
IL1-R2 gene in PBMC in response to 48 hrs stimulation with IDX0150
alone, Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 1 and Example 1.
[0055] FIG. 4 depicts the average value of expression level of
CD163 gene in peripheral blood mononuclear cells (PBMC) in response
to 48 hrs stimulation with the immunomodulatory oligonucleotide
IDX0150 alone, dexamethasone (Dex) alone, or IDX0150 and Dex in
combination as quantified by real-time PCR. PBMC were isolated from
blood samples of ten (n=10) healthy volunteers (HV) and seven (n=7)
steroid resistant ulcerative colitis patients (SR). Cells were
incubated in a basal medium or in a basal medium with increasing
concentrations of IDX0150 (25 .mu.M or 100 .mu.M) in the presence
or absence of Dex at increasing concentrations (10.sup.-10,
10.sup.-8 or 10-6M) as described in Example 1. After incubation,
the total RNA was isolated from PBMCs and used for first strand
cDNA synthesis. Real-time PCR reactions with PBMC cDNA were
performed in triplicates for each sample/treatment combination and
in duplicates for a housekeeper gene (.gamma.-actin). Each bar of
the histogram represents the average expression level value,
normalized by basal expression level value as described in Example
1. The error-bars indicate the deviation range of the values of
expression levels in different blood donors.
[0056] FIG. 5 depicts the average value of expression level of Tsp1
gene in PBMC in response to 48 hrs stimulation with IDX0150 alone,
Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 4 and Example 1.
[0057] FIG. 6 depicts the average value of expression level of
IL1-R2 gene in PBMC in response to 48 hrs stimulation with IDX0150
alone, Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 4 and Example 1.
[0058] FIG. 7 depicts the average value of expression level of TLR2
gene in PBMC in response to 48 hrs stimulation with IDX0150 alone,
Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 1 and Example 1.
[0059] FIG. 8 depicts the average value of expression level of TLR4
gene in PBMC in response to 48 hrs stimulation with IDX0150 alone,
Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 1 and Example 1.
[0060] FIG. 9 depicts the average value of expression level of TXK
gene in PBMC in response to 48 hrs stimulation with IDX0150 alone,
Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 1 and Example 1.
[0061] FIG. 10 depicts the average value of expression level of
MKP1 gene in PBMC in response to 48 hrs stimulation with IDX0150
alone, Dex alone, or IDX0150 and Dex combination as quantified by
real-time PCR. The experimental conditions and data handling were
as described in FIG. 1 and Example 1.
DETAILED DESCRIPTION
[0062] Before the invention is described in detail, it is to be
understood that this invention is not limited to the particular
component parts of the devices described or the process steps of
the methods described, as such devices and methods may vary. It is
also to be understood that the terminology used herein is for
purposes of describing particular embodiments only, and is not
intended to be limiting.
[0063] It must be noted that, as used in the specification and the
appended claims, the singular forms "a", "an", and "the" also
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a sequence" includes
more than one such sequence, and the like,
[0064] In this specification and in the claims which follow,
reference will be made to a number of terms which shall be defined
to have the following meanings:
[0065] The term "about" is used to indicate a deviation of +/-2% of
the given value, preferably +/-5% and most preferably +/-10% of the
numeric values, when applicable.
[0066] The term "responsiveness" refers to a response of a patient
or the cells obtained from the patient to a given agent or
medicament. The term "steroid responsiveness" or "steroid response"
describes the change of an immune response when challenged with a
steroid. This change is measurable often through the release of
certain cytokines such as interferons and interleukins as well as
other physiological parameters such as proliferation. The response
can equally be one that serves to stimulate the immune system as
well as to repress the immune system depending on the cytokines
induced by the steroid treatment in question. Patients whose
symptoms are relieved by steroid administration are considered
"steroid responsive". In contrast, patients in which administration
of a steroid, typically effective in patients having such diseases
and healthy persons, is ineffective, are considered "steroid
resistant" or "steroid refractory" patients, which in the present
invention include also patients who respond poorly or inadequately,
i.e. exhibit only a slight effect or improvement of symptoms. Two
types of steroid resistant patients have been described i.e.
acquired steroid resistance (Type I) and primary steroid resistance
(Type II), both of which are comprised in the present
invention.
[0067] The determination of whether a patient is steroid refractory
is difficult as no universally accepted method or indeed end-point
exists which can be used to assess such a condition. Moreover,
steroid unresponsiveness is a dynamic scale and there are varying
degrees of unresponsiveness. From a clinical perspective, the
diagnosis of steroid unresponsiveness is often based on the
physician's judgment and treatment history with steroids. For
example, in IBD, increasing the dose of steroids for a certain
period of time without achieving symptomatic relief may be
indicative of a possible state of steroid unresponsiveness in that
individual. In asthma, patients can be given a two week course of
relatively high steroid doses, following which they undergo a lung
function test. A performance below a certain threshold may suggest
a steroid refractory state. The following references constitute
examples, disclosing how the physician evaluates the treatment of
the underlying disease and identifies steroid refractory patients
(Reinisch et al., 2002; Munkholm et al., 1994; Leung et al., 2002;
Gisbert et al., 2008).
[0068] Adrenocortical hormones or corticosteroids are steroid
hormones classified as glucocorticoids, mineralocorticoids and sex
hormones. Many of the clinically useful "steroids" are
glucocorticoids or glucocorticosteroids, including cortisone,
hydrocortisone, and their pharmaceutical derivatives such as
prednisone and dexamethasone that exert their effect by binding to
specific cytosolic receptors. Synthetic glucocorticoids with
greater glucocorticoid activity have been developed, having
increased affinity for the glucocorticoid receptors and/or delayed
plasma clearance. Glucocorticoids are used primarily as
"anti-inflammatory" and "immunosuppressive" agents. The term
"anti-inflammatory" refers to the property of a substance or
treatment that reduces symptoms of inflammation. "Immunosuppressive
agent" refers to an agent that suppresses the cell-mediated
immunity.
[0069] For purposes of the invention, the term "oligonucleotide"
refers to a polynucleoside formed from a plurality of linked
individual nucleoside units. Such oligonucleotides can be obtained
from existing nucleic acid sources, including genomic or cDNA, but
are preferably produced by synthetic methods. The nucleoside
residues can be coupled to each other by any of the numerous known
internucleoside linkages. Such internucleoside linkages include,
without limitation, the natural internucleoside phosphodiester bond
or indeed modified internucleosides such as, but not limited to,
phosphorothioate, phosphorodithioate, alkylphosphonate,
alkylphosphonothioate, phosphotriester, phosphoramidate, siloxane,
carbonate, carboalkoxy, acetamidate, carbamate, morpholino, borano,
thioether, bridged phosphoramidate, bridged methylene phosphonate,
bridged phosphorothioate, and sulfone internucleoside linkages. The
term "oligonucleotide" also encompasses polynucleosides having one
or more stereospecific internucleoside linkage (e.g., (Rp)- or
Sp)-phosphorothioate, alkylphosphonate, or phosphotriester
linkages). As used herein, the terms "oligonucleotide" and
"dinucleotide" are expressly intended to include polynucleosides
and dinucleosides having any such internucleoside linkage, whether
or not the linkage comprises a phosphate group.
[0070] The term "oligonucleotide" also encompasses polynucleosides
having additional substituents including, without limitation,
protein groups, lipophilic groups, intercalating agents, diamines,
folic acid, cholesterol and adamantane. The term "oligonucleotide"
also encompasses any other nucleobase containing polymer,
including, without limitation, peptide nucleic acids (PNA), peptide
nucleic acids with phosphate groups (PHONA), locked nucleic acids
(LNA), morpholino-backbone oligonucleotides, and oligonucleotides
having backbone sections with alkyl linkers or amino linkers.
[0071] The oligonucleotides contain naturally occurring
nucleosides, modified nucleosides, or mixtures thereof. As used
herein, the term "modified nucleoside" is a nucleoside that
includes a modified heterocyclic base, a modified sugar moiety, or
a combination thereof. In some embodiments, the modified nucleoside
is a non-natural pyrimidine or purine nucleoside, as herein
described. In some embodiments, the modified nucleoside is a
2'-substituted ribonucleoside an arabinonucleoside or a
2'-deoxy-2'-substituted-arabinoside.
[0072] The oligonucleotide used in the inventive method can be
modified according to methods known for the skilled person and as
defined above. For example, at least one nucleotide of the
oligonucleotide can have a phosphate backbone modification, wherein
the phosphate backbone modification is a phosphorothioate or
phosphorodithioate modification. The modification can occur at one
or more nucleotides at any position along the entire length of the
oligonucleotide. In one embodiment the nucleic acid backbone
includes the phosphate backbone modification on the 5'
inter-nucleotide linkages. As an alternative the nucleic acid
backbone includes the phosphate backbone modification on the 3'
inter-nucleotide linkages.
[0073] The term "oligonucleotide" also includes hybrid and chimeric
oligonucleotides. A "chimeric oligonucleotide" is an
oligonucleotide having more than one type of internucleoside
linkage within its sequence structure. One preferred example of
such a chimeric oligonucleotide is a chimeric oligonucleotide
comprising a phosphorothioate, phosphodiester or phosphorodithioate
region and non-ionic linkages such as alkylphosphonate or
alkylphosphonothioate linkages (Pederson et al. U.S. Pat. Nos.
5,635,377 and 5,366,878).
[0074] A "hybrid oligonucleotide" is an oligonucleotide having more
than one type of nucleoside. One preferred example of such a hybrid
oligonucleotide comprises a ribonucleotide or 2'-substituted
ribonucleotide region, and a deoxyribonucleotide region (Metelev
and Agrawal, U.S. Pat. Nos. 5,652,355, 6,346,614 and
6,143,881).
[0075] For purposes of the invention, the term "immunomodulatory
oligonucleotide" refers to an oligonucleotide as described above
that induces an immune response either by stimulating the immune
system or repressing the immune system or both in an organism when
administered to a vertebrate, such as a mammal. As used herein, the
term "mammal" includes, without limitation rats, mice, cats, dogs,
horses, cattle, cows, pigs, rabbits, non-human primates, and
humans.
[0076] Preferably, the "immunomodulatory oligonucleotide" comprises
at least one naturally occurring phosphodiester, or one modified
phosphorothioate, or phosphorodithioate internucleoside linkage,
however preferred linkages or indeed backbone modifications
including, without limitation, methylphosphonates,
methylphosphonothioates, phosphotriesters, phosphothiotriesters,
phosphorothioates, phosphorodithioates, triester prodrugs,
sulfones, sulfonamides, sulfamates, formacetal,
N-methylhydroxylamine, carbonate, carbamate, morpholino,
boranophosphonate, phosphoramidates, especially primary
amino-phosphoramidates, N3 phosphoramidates and N5
phosphoramidates, and stereospecific linkages (e.g., (Rp)- or
(Sp)-phosphorothioate, alkylphosphonate, or phosphotriester
linkages).
[0077] In some embodiments, the "immunomodulatory oligonucleotide"
comprises an immunostimulatory dinucleotide of formula
5'-Pyr-Pur-3', wherein Pyr is a natural or synthetic pyrimidine
nucleoside and Pur is a natural or synthetic purine nucleoside. In
some preferred embodiments, the immunomodulatory oligonucleotide
comprises an immunostimulatory dinucleotide of formula
5'-Pur*-Pur-3', wherein Pur* is a synthetic purine nucleoside and
Pur is a natural or synthetic purine nucleoside. In various places
the dinucleotide is expressed as RpG, C*pG or YZ, in which case
respectively, R, C*, or Y represents a synthetic purine. A
particularly preferred synthetic purine is
2-oxo-7-deaza-8-methyl-purine. When this synthetic purine is in the
Pur* position of the dinucleotide, species-specificity (sequence
dependence) of the immunostimulatory effect is overcome and
cytokine profile is improved. As used herein, the term "pyrimidine
nucleoside" refers to a nucleoside wherein the base component of
the nucleoside is a monocyclic nucleobase. Similarly, the term
"purine nucleoside" refers to a nucleoside wherein the base
component of the nucleoside is a bicyclic nucleobase. For purposes
of the invention, a "synthetic" pyrimidine or purine nucleoside
includes a non-naturally occurring pyrimidine or purine base, a
non-naturally occurring sugar moiety, or a combination thereof.
[0078] In some embodiments, the sugar moiety of the nucleoside can
be a non-naturally occurring sugar moiety. For purposes of the
present invention, a "naturally occurring sugar moiety" is a sugar
moiety that occurs naturally as part of a nucleic acid, e.g.,
ribose and 2'-deoxyribose, and a "non-naturally occurring sugar
moiety" is any sugar that does not occur naturally as part of a
nucleic acid, but which can be used in the backbone for an
oligonucleotide, for example, but not limited to, hexose. Arabinose
and arabinose derivatives are examples of preferred sugar
moieties.
[0079] Preferred "immunostimulatory moieties" according to the
invention further include nucleosides having sugar modifications,
including, without limitation, 2'-substituted pentose sugars
including, without limitation, 2'-O-methylribose,
2'-O-methoxyethyl-ribose, 2'-.beta.-propargylribose, and
2'-deoxy-2'-fluororibose; 3'-substituted pentose sugars, including,
without limitation, 3'-O-methylribose; 1',2'-dideoxyribose;
arabinose; substituted arabinose sugars, including, without
limitation, 1'-methylarabinose, 3'-hydroxymethylarabinose,
4'-hydroxymethylarabinose, 3'-hydroxyarabinose and 2'-substituted
arabinose sugars; hexose sugars, including, without limitation,
1,5-anhydrohexitol; and alpha-anomers.
[0080] In another embodiment, preferred "immunostimulatory
moieties" according to the invention further include
oligonucleotides having other carbohydrate backbone modifications
and replacements, including peptide nucleic acids (PNA), peptide
nucleic acids with phosphate groups (PHONA), locked nucleic acids
(LNA), morpholino backbone oligonucleotides, and oligonucleotides
having backbone linker sections having a length of from about 2
angstroms to about 200 angstroms, including without limitation,
alkyl linkers or amino linkers. The alkyl linker may be branched or
unbranched, substituted or unsubstituted, and chirally pure or a
racemic mixture. Most preferably, such alkyl linkers have from
about 2 to about 18 carbon atoms. In some preferred embodiments
such alkyl linkers have from about 3 to about 9 carbon atoms. Some
alkyl linkers include one or more functional groups selected from
the group consisting of hydroxy, amino, thiol, thioether, ether,
amide, thioamide, ester, urea, and thioether. Some functionalized
alkyl linkers are poly (ethylene glycol) linkers of
formula-0-(CH.sub.2--CH.sub.2--O--), (n=1-9). Some other
functionalized alkyl linkers are peptides or amino acids.
[0081] In a further embodiment preferred "immunostimulatory
moieties" according to the invention further include DNA isoforms,
including, without limitation, -L-deoxyribonucleosides and
a-deoxyribonucleosides. Preferred immunostimulatory moieties
according to the invention incorporate 3' modifications, and
further include nucleosides having unnatural internucleoside
linkage positions, including, without limitation, 2'-5',2'-2',3'-3'
and 5'-5' linkages.
[0082] The "immunomodulatory oligonucleotide" according to the
invention comprise at least five nucleosides linked via
internucleoside linkage or a functionalized nucleobase or sugar via
a non-nucleotidic linker. For purposes of the invention, a
"non-nucleotidic linker" is any moiety that can be linked to the
oligonucleotides by way of covalent or non-covalent linkages.
[0083] Non-covalent linkages include, but are not limited to,
electrostatic interaction, hydrophobic interactions,-stacking
interactions, and hydrogen bonding. The term "non-nucleotidic
linker" is not meant to refer to an internucleoside linkage, as
described above, e.g. a phosphodiester, phosphorothioate, or
phosphorodithioate functional group that directly connects the
3'-hydroxyl groups of two nucleosides. For purposes of this
invention, such a direct 3'-3' linkage (no linker involved) is
considered to be a "nucleotidic linkage."
[0084] In some embodiments, the non-nucleotidic linker is a metal,
including, without limitation, gold particles. In some other
embodiments, the non-nucleotidic linker is a soluble or insoluble
biodegradable polymer bead. In yet other embodiments, the
non-nucleotidic linker is an organic moiety having functional
groups that permit attachment to the oligonucleotide. Such
attachment preferably is by any stable covalent linkage. In some
embodiments, the non-nucleotidic linker is a biomolecule,
including, without limitation, polypeptides, antibodies, lipids,
antigens, allergens, and oligosaccharides. In some other
embodiments, the non-nucleotidic linker is a small molecule. For
purposes of the invention, a small molecule is an organic moiety
having a molecular weight of less than 1,000 Da.
[0085] In some embodiments, the small molecule is an aliphatic or
aromatic hydrocarbon, either of which optionally can include,
either in the linear chain connecting the oligonucleotides or
appended to it, one or more functional groups selected from the
group consisting of hydroxy, amino, thiol, thioether, ether, amide,
thioamide, ester, urea, and thiourea. The small molecule can be
cyclic or acyclic. Examples of small molecule linkers include, but
are not limited to, amino acids, carbohydrates, cyclodextrins,
adamantane, cholesterol, haptens and antibiotics. However, for
purposes of describing the non-nucleotidic linker, the term "small
molecule" is not intended to include a nucleoside.
[0086] In some embodiments, the small molecule linker is glycerol
or a glycerol homolog of the formula HO-- (CH2)
o-CH(OH)--(CH.sub.2) p-OH, wherein o and p independently are
integers from 1 to about 6, from 1 to 4, or from 1 to 3. In some
other embodiments, the small molecule linker is a derivative of
1,3-diamino-2-hydroxypropane. Some such derivatives have the
formula HO--(CH2) m-C(O)NH--CH2-CH(OH)--CH2-NHC(O)-m-OH, wherein m
is an integer from 0 to about 10, from 0 to 6, from 2 to 6, or from
2 to 4.
[0087] Modified or substituted oligonucleotides are often preferred
over native forms because of desirable properties such as, for
example, enhanced cellular uptake, enhanced affinity for nucleic
acid target and increased stability in the presence of nucleases.
An oligonucleotide is usually comprised of more than two (2), and
typically more than ten (10) and up to one hundred (100) or more
deoxyribonucleotides or ribonucleotides, although preferably
between about eight (8) and about forty (40), most preferably
between about eight (8) and about twenty (20). The exact size will
depend on many factors, which in turn depends on the ultimate
function or use of the oligonucleotide. The oligonucleotide may be
generated in any manner, including chemical synthesis, DNA
replication, reverse transcription, or a combination thereof.
[0088] The term "CpG containing oligonucleotide" is used to
encompass an oligonucleotide having at least one unmethylated CG
dinucleotide within its entire sequence length and being preferably
8 to 100 nucleic acid bases in length.
[0089] The present inventors, who had previously demonstrated a
rapid and pronounced improvement of the patients and reduction in
the dose of steroids when providing patients suffering from an
inflammatory condition of bowel, including ulcerative colitis and
Crohn's diseases and not responding to steroid therapies, with an
immunomodulatory oligonucleotide containing a CpG motif together
with a steroid, recognized that it would be advantageous to have a
marker gene, which could be used for predicting the responsiveness
of a patient to a selected therapy. The present inventors
demonstrated a correlation between the expression levels of some
selected marker genes and the response to a given therapy. The
present invention therefore is related to a rapid and easy in vitro
method for predicting the response of a therapy and particularly
selecting an effective therapy for a steroid resistant patient
suffering from an inflammatory condition. The therapy in question
is either a combination therapy comprising a steroid and an
immunomodulatory oligonucleotide therapy or an alternative therapy
comprising an immunomodulatory oligonucleotide combined with
another therapy.
[0090] The first objective of the invention was to identify steroid
responsive genes that would act as potential marker genes for
re-sensitization of steroid resistant asthma patients to the action
of steroids as well as potential markers for resistance of asthma
patients to steroid treatment when compared to expression of these
genes in healthy. In other words, the objective of the present
invention was to identify genes, which by an easy and rapid in
vitro method would discriminate between steroid sensitive and
steroid resistant asthma patients and also candidate genes that are
indicative of a possible positive response in a steroid resistant
patient when given an immunomodulatory oligonucleotide containing
an unmethylated CpG motif, such as the IDX0150 or IDX0150 compound.
Such patient would be responsive to a so called re-sensitization
therapy.
[0091] The selected marker genes would be useful in selecting the
best therapy for steroid resistant patients or patients with a poor
steroid response.
[0092] The present invention relates to an in vitro method for
selecting the therapy for a steroid resistant patient presenting
with inflammatory symptoms, wherein the method comprises comparing
expression levels of at least one potentially useful marker gene
from cells, which are isolated from a sample of said patient and a
healthy person, and which cells are cultivated in the presence of a
steroid, an immunomodulatory oligonucleotide or a mixture
thereof.
[0093] In one embodiment of the present invention relates to a
method for determining "steroid efficacy" in a steroid refractory
patient afflicted with an inflammatory condition not responding or
responding poorly or inadequately to anti-inflammatory treatment,
and predicting if this "steroid efficacy" may be enhanced by
administration of an immunomodulatory oligonucleotide having the
sequence
5'-Xm-CG-Yn-3'
[0094] is administered in an effective amount to said patient and
wherein X is A, T, C or G, Y is A, T, C, or G, m=1-100, n=1-100 and
wherein at least one CG dinucleotide is unmethylated.
Alternatively, the immunomodulatory oligonucleotide may have the
sequence
5'-Xm-TTCGT-Yn-3
[0095] wherein X is A, T, C or G, Y is A, T, C, or G, m=1-7, n=1-7
and wherein at least one CG dinucleotide is unmethylated.`
[0096] The term "inflammatory symptoms" or "inflammatory condition"
are used to mean the same in the present invention and refer to the
first response of the immune system to infection or irritation and
may be referred to as the innate immune system. Inflammation helps
to fight disease, but in the long term it causes progressive
damage. The nature and magnitude of an immune response is largely
dictated by the profile of the foreign antigen to which the immune
system has been exposed. This event sets into motion a series of
events that ultimately leads to the generation of humoral and
cell-mediated immunity. Inflammatory diseases comprise such as
acute or chronic asthma, chronic obstructive pulmonary disease
(COPD), ulcerative colitis (UC), Crohn's disease (CD), rheumatoid
arthritis, psoriasis and emphysema. In a preferred embodiment the
inflammatory condition is asthma.
[0097] Genetic expression of a "marker gene" changes in response of
tissue or cell culture to administration of a pharmacological
agent, progression of cell differentiation, or in response to
changes in environmental conditions. Quantifying expression of a
marker gene therefore has predictive potential particularly in
medical diagnostics.
[0098] The term "expression level" refers to intensity of
transcription of a target gene into messenger RNA (mRNA) under
different experimental or environmental conditions and subsequent
translation into a protein. Gene expression corresponds to the
number of copies of mRNA that exists for a particular gene. In
living cells gene expression is controlled by transcription factors
binding to the regulatory regions of a gene. The genes can be
inducible, i.e. resulting in increase in the amount of mRNA, or
constitutively expressed, i.e. having a constant amount of mRNA
under different conditions. Methods to analyse the quality and
quantity of the transcribed mRNA are described in the several
laboratory handbooks (for example, in Sambrook and Russell, 2001)
and are well known for a person skilled in the art. These methods
comprise ribonuclease protection, primer extension, northern
blotting, dot blot hybridization, and conventional or real time
PCR.
[0099] Traditionally, the amount of a particular mRNA produced, and
thus the activation status of a gene has been measured by northern
blotting. Total RNA isolated from a sample is separated by agarose
gel electrophoresis, and probed with a complementary DNA probe
specific for the gene of interest. In conventional polymerase chain
reaction (PCR), the total RNA isolated from the cell or tissue to
be analyzed is reverse transcribed into first strand cDNA (RT-PCR),
which is then used as a template to amplify a double stranded
amplicon with target specific oligonucleotide primers. In both
techniques detection is based on detectable labels, such as
fluorescent dyes or radioactive isotopes. Also the recently
developed techniques known as DNA chips or microarrays are based on
hybridization the target DNA to complementary target specific
primers, washing out the unbound DNA and quantifying the bound
target DNA. Probes and primers used in the hybridization reactions
may be designed based on the nucleotide sequence of the marker gene
or amino acid sequence of the translated protein, corresponding to
the marker gene. A convenient quantitative hybridization method for
determining variations in the amounts of expressed RNA is described
in the international patent application WO 2002/055734.
[0100] Preferably, the "marker gene expression" may be quantified
with real time PCR, also called quantitative real time PCR. The
method follows the general pattern of polymerase chain reaction,
but the amplified region of the target DNA is quantified after each
round of amplification by using fluorescent dyes, such as SYBR
Green that intercalate with double-stranded DNA or modified DNA
oligonucleotide probes that fluoresce when hybridized with a
complementary DNA. Frequently, real time PCR is combined with
reverse transcription to quantify low abundance mRNA. The data can
be analysed by computer software, such as Applied Biosystems 7500
or 7500 Fast Real Time PCR Systems, to calculate relative gene
expression between several samples, or mRNA copy number based on a
standard curve. Relative quantification (RQ) is commonly used to
compare expression levels of wild-type with mutated alleles or the
expression levels of a gene in different tissues. RQ determines the
change in expression of a target gene in a test sample relative to
the same sequence in a basal or calibrator sample (a sample used as
the basis for comparative results). The calibrator sample can be an
untreated control or a sample at time zero in a time-course study.
By using an endogeneous or intrinsic control, it is possible to
normalize quantification of a cDNA target for differences in the
amount of cDNA added to each reaction. Typically, housekeeping
genes such as .beta.-actin, glyseraldehyde-3-phosphate
dehydrogenase (GAPDH) and ribosomal RNA (rRNA) are used as
endogeneous controls, because their expression levels are
relatively stable. Replicate reactions per sample and an endogenous
control are needed to ensure statistical significance.
[0101] The expression levels in the samples from a steroid
resistant patient and a patient with poor steroid response may be
compared by determining the expression intensity of the marker gene
as described above or by analyzing the protein translated from the
marker gene, i.e. a marker protein utilizing, for example
antibodies binding to the marker protein. The binding can be
detected by techniques such as western blotting, flowcytometry,
immunoprecipitation and ELISA. Also, response to a given treatment
can be quantified by measuring activity of the marker protein in
case the gene product is a functional protein, for example an
enzyme. Alternatively, the comparative analysis of different mRNA
splicing variants of the marker gene, which have been shown to be
translated into different forms of the marker protein and having
different predominance in cells of a healthy person and a patient
presenting with inflammation symptoms, may be used to predict the
effect of steroid therapy.
[0102] In one embodiment of the present invention the marker genes
useful in the method for selecting the therapy for a steroid
resistant patient may be identified among genes, which are involved
with steroid response in inflammatory conditions. The genes
selected are preferably genes, which provide significantly
different expression levels in cells isolated from samples of
patients and healthy persons.
[0103] Selection of the potentially useful marker genes may be
performed based on a database and literature search for known genes
related to the steroid response in the specific inflammatory
conditions. Alternatively such marker genes may be defined by a
screening approach, in which the expression level of a multitude of
genes is determined by methods such as real time PCR or methods
using DNA chips or DNA microarrays or by screening cDNA libraries
prepared from steroid resistant patients and healthy persons. The
number of potential marker genes may vary depending on the
information available and/or the chosen method to determine the
expression levels.
[0104] Many experiments in cellular biology are conducted outside
organisms or cells, i.e. "in vitro", in a controlled environment
such as in a test tube in contrast to in vivo tests, which are used
only to verify the results of the method of the present invention.
The "in vitro" conditions are suited for deducing the mechanisms of
action. The in vitro determination is carried out by determining
the expression levels or relative expression profiles obtained
using cells isolated from patients and healthy person and
cultivated in the presence or absence of selected therapeutic
agents. The effects found by these in vitro methods may be tested
inside living organisms, using not only cells, but also animal
experiments before making the final conclusions and verifying the
results in a clinical test.
[0105] The response to a given treatment may be determined by
cultivating the cells isolated from a biological sample, such as a
biopsy sample or blood sample from a steroid resistant patient and
a healthy person. The preferred peripheral blood mononuclear cells
(PBMC) of the present invention may be isolated from a heparinized
blood sample by a density gradient centrifugation. Said cells are
cultivated in a suitable buffered cultivation medium containing
required salts, vitamins, hormones and trace elements to keep the
cells alive and for their growth and differentiation. The PBMC are
cultivated in a RPMI medium for 48.degree. C. in a presence of a
steroid, an immunomodulatory oligonucleotide or a mixture thereof,
and the expression level of potential marker genes is determined
using methods described above. Finally, the expression levels of
particular marker genes in cells of said patients and healthy
persons, treated as described above are statistically compared.
[0106] The terms "significant similarity" and "significant
difference" means that using statistical methods the expression
levels measured in cultivated cells isolated from steroid resistant
patients and healthy persons are almost identical or are clearly
different, when they are cultivated and grown in the presence or
absence of the tested therapeutic agents. These significant
similarities or differences may be used for predicting the
responses of the patient and selecting appropriate therapies.
[0107] In one embodiment of the invention a "significant
similarity" in the expression levels of at least one selected
marker gene measured in cells isolated from a sample of a steroid
resistant patient and a healthy person, which cells are cultivated
in the presence of a steroid, indicates that the selected marker
gene is a potential marker for steroid responsiveness.
[0108] In another embodiment of the invention a significant
similarity in the expression levels of at least one selected marker
gene measured in cells isolated from a sample of a steroid
resistant patient and a healthy person, which cells are cultivated
in the presence of a steroid and an immunomodulatory
oligonucleotide, indicates that the selected marker gene is a
potential marker for re-sensitization to the action of
steroids.
[0109] The term "re-sensitization" means that cells, which should
be sensitive or susceptible to a given stimulatory drug, but have
lost that property, may again through a sensitization therapy
become sensitive or susceptible to said stimulatory drug.
[0110] The expression "enhance steroid efficacy" or "steroid
enhancing effect" is here used to encompass a steroid sparing
effect, evident as a clinical picture where a simultaneous or
sequential treatment with an immunomodulatory oligonucleotide,
preferably a pre-treatment, is shown to reduce the steroid dose
necessary to manage inflammation or improve the symptoms faster.
The expression "enhance steroid efficacy" is also intended to
encompass a synergistic use of an immunomodulatory oligonucleotide
and a steroid, either simultaneously or substantially
simultaneously, or sequentially or substantially sequentially,
shown to reduce the steroid dose necessary to manage inflammation
or to relieve the symptoms of the patient faster than without an
immunomodulatory administration.
[0111] In a further embodiment of the invention a "significant
difference" in the expression levels of at least one selected
marker gene in cells isolated from a sample of a steroid resistant
patient and a healthy person, which cells are cultivated in the
presence of a steroid and an immunomodulatory oligonucleotide,
indicates that the selected marker gene is a marker gene for
steroid resistance, which may not be enhanced by the addition of an
immunomodulatory oligonucleotide.
[0112] The meaning of the term "significant" or "significantly" is
that understood by a skilled person, and determined using a
statistical test such as, but not limited to Student's t-test,
Dunnett's test or Bonferroni test.
[0113] The candidate genes for developing an in vitro assay of the
present invention were selected based on a database and literature
search for known genes related to human PBMC steroid response. Such
genes have been described by several research groups (Galon et al.,
2002, Vermeer et al., 2004, Shahidi, 1999, Mariette, 2003, Wu et
al., 2004). The present inventors chose seven genes. These genes
include one member of interleukin 1 signaling pathway (IL1-R2), one
member of macrophage scavenger receptor family (CD163), a matrix
glycoprotein thrombospondin-1 (Tsp1), two members of Toll-like
receptors family (TLR2 and TLR4) and two enzymes (TXK and MPK-1).
The anti-inflammatory IL1-R2 receptor (Galon et al., 2002;
Mariette, 2003) is a member of interleukin 1 (IL1) signaling
pathway recognizing, for example the cytokines IL1.alpha. and
IL1.beta. and IL1 receptor antagonist. Glucocorticoids have been
shown to up-regulate IL1-R2 gene expression (Re 1994; Galon et al.,
2002).
[0114] CD163, also called M130, (Galon et al. 2002) is a member of
macrophage scavenger receptor family expressed in blood mononuclear
cells and most tissue macrophages. The function of CD163 in
inflammation may depend on the presence of different mRNA splicing
variants that may differ in their functional properties (Ritter et
al. 1999). Also, the L1 transposable element 1.4 kb upstream of the
transcription start site might influence the CD163 promoter
activity. CD163 is known to be involved in the innate immune
response.
[0115] Matrix glycoprotein thrombospondin-1, Tsp1 (Galon et al.,
2002) is a protein structurally related to matrix
metalloproteinases (MMPs) and regulating their functions (Chen,
2000). Glucocorticoids have been shown to up-regulate Tsp1
expression.
[0116] The Toll-like receptors (TLRs) are type I transmembrane
proteins that recognize microbes once they have breached physical
barriers such as the skin or intestinal tract mucosa, and activate
immune cell responses (Galon et al., 2002). TLRs recognize
molecules that are broadly shared by pathogens but distinguishable
from host molecules. TLR2 recognizes, for example lipoproteins,
gram positive peptidoglycan and viral glycoproteins. TLR4 is a key
component of the receptor for lipopolysaccharides (Beutler et al.,
2006).
[0117] Expression of protein tyrosine kinase (TXK), also called
resting lymphocyte kinase (RLK) is primarily detected in T cells,
acting as a Th1 cell specific transcription factor (Takeba 2002; Wu
et al., 2004) and in some myeloid cell lines. Activation of
glucocorticoid receptor by dexamethasone treatment has been shown
to induce expression of mitogen-activated protein kinase
phospatase-1 (MKP-1) in breast cancer cell lines (Wu et al.,
2004).
[0118] In one embodiment of the present invention the selected
marker genes providing significant similarity or differences in
expression levels in cells from patients and healthy volunteers,
which cells have been cultivated in the presence of a steroid, an
immunomodulatory oligonucleotide or a mixture thereof, are a CD163,
a Tsp1, an IL1-R2, a TLR2, a TLR4, a MKP-1, a TXK marker gene.
[0119] In another embodiment of the invention the enhanced
expression level of at least one marker gene in cells isolated from
a sample of the patient and cultivated in the presence of a
steroid, as compared to the expression level in the absence of the
steroid, indicates that the patient would benefit from a steroid
therapy. Preferably, the marker genes are CD163, Tsp1 and IL1-R2
genes.
[0120] In another embodiment of the present invention the enhanced
expression level of at least one marker gene in cells isolated from
a sample of the patient and cultivated in the presence of a steroid
and an immunomodulatory oligonucleotide, as compared to the
expression level in the absence of said steroid and
immunomodulatory oligonucleotide, indicates that the patient would
benefit from a combination therapy. Preferably, the marker gene is
CD163, Tsp1 and IL1-R2 genes.
[0121] Herein the term "combination therapy" means providing
steroid resistant patient in subsequent or simultaneous dosage
forms or treatment regimen an effective amount of a steroid, an
immunomodulatory oligonucleotide or mixtures thereof. One of the
therapeutic agents may be provided before or after the other or
both may be provide in a mixture as a single or mixed dose. An
effective amount may vary between about 0.01 mg to about 2 mg/kg
body weight and can be determined by the treating physician. The
term combination therapy is preferably provided as a composition
comprising an immunomodulatory oligonucleotide, with or without a
steroid, with or without an alternative therapeutic agent and one
or more pharmaceutically acceptable adjuvants or ingredients. The
therapy may comprise varying courses of treating depending upon the
disease and the condition of the patient, and may comprise a
temporally spaced treatment regimen or modality, wherein the
interval of dosing is speeded up or the intervals are delayed up to
several months apart.
[0122] In a further embodiment of the invention, a significant
difference in expression levels of at least one marker gene
measured in isolated cells from a sample of a steroid resistant
patient compared to corresponding sample isolated from a healthy
person, cultivated in the presence of a steroid and an
immunomodulatory oligonucleotide, indicates that a steroid
resistant patient would benefit from being excluded from an
corticosteroid therapy and being subjected to an alternative
therapy comprising an immunomodulatory oligonucleotide. The
alternative therapies in the present invention comprise an
immunomodulatory oligonucleotide re-sensitization therapy either as
monotherapy or in combination with, for example monoclonal
antibodies, chemotherapy or radiation therapy. Preferably, the
marker genes are TLR2, TLR4, MKP-1 and TXK.
[0123] Blood cells are preferred cells for the present invention.
More preferably, the cell is a peripheral blood mononuclear cell
(PMBC).
[0124] In one preferred embodiment of the present invention the
inflammatory symptom includes acute or chronic asthma, emphysema,
chronic obstructive pulmonary disease, ulcerative colitis, Crohn's
disease, rheumatoid arthritis, and psoriasis.
[0125] In one embodiment of the invention the therapy is a
combination therapy or an alternative therapy comprising and
immunomodulatory oligonucleotide therapy. Preferably, the therapy
is a steroid and an immunomodulatory oligonucleotide therapy. More
preferably, the immunomodulatory oligonucleotide is the DNA-based
Immunomodulatory Sequence IDX0150.
[0126] In one embodiment of the present invention, the steroid is a
corticosteroid. Preferably the corticosteroid is a dexamethasone,
prednisolone or derivatives or mixtures thereof.
[0127] In one embodiment of the invention, the expression level of
said marker gene is determined by nucleic acid amplification of
said gene using gene specific primer pairs, and quantifying the
amplification results. Preferably, the nucleic acid amplification
is performed by a real time PCR and using gene specific primer
pairs chosen from SEQ ID NO: 1-7.
[0128] The term "gene specific primer pairs" are designed to
hybridize or anneal to opposing strands of the DNA encoding the
marker gene of interest such that through PCR amplification, a
defined region of the marker gene is produced. A "primer pair" thus
refers to two primers, one having a forward designation and the
other having a reverse designation relative to their respective
orientations on a double-stranded DNA molecule, also called a sense
and antisense sequence, such that under the PCR amplification
conditions described in this invention, the forward primer anneals
to and primes the amplification of the sense sequence and reverse
primer anneals to and primes amplification of the antisense
sequence. Primers can be selected for use in the amplification
reaction on the basis of, having minimal complementarity with other
primers in the reaction (to minimize the formation of primer
dimers) and having Tm values with the range of reaction
temperatures appropriate for the amplification method, preferably
PCR. In addition, primers can be selected so as to anneal with
specific regions of RNA template such that the resulting DNA
amplification product ranges in size from 50 to 1000 base pairs,
preferably from 50 to 300 base pairs in length and most preferably
around 150 base pairs in length.
[0129] For example, in the real time PCR of the present invention,
the specific primer pair may consist of the oligonucleotide of SEQ
ID NO: 1 as the forward primer and the oligonucleotide of SEQ ID
NO: 2 as the reverse primer.
[0130] Primers, typically from 10 to 100 nucleotides, preferably
from 10 to 60 nucleotides in length, include naturally occurring or
synthetically produced oligonucleotides capable of annealing to the
target nucleic acids and acting as the point of initiation of
nucleic acid synthesis under appropriate conditions, i.e., in the
presence of nucleoside triphosphates, a polymerization agent,
suitable temperature, pH and buffer. The principles for designing
oligonucleotide primers, as well as performing the PCR and
detection of the amplified DNA products are well known in the
art.
[0131] The present invention relates also to a test kit for
selecting a therapy for a steroid resistant patient presenting with
inflammatory symptoms, wherein said test kit comprises specific
primer pairs for enabling in vitro analysis of expression level of
at least one marker gene and instructions for use.
[0132] Preferably, said specific primer pairs are selected from the
group of SEQ ID NO: 1-14, or functionally equivalent primer pairs
specific for the CD163, Tsp1, IL1-R2, TLR2, TLR4, MKP-1 and TXK
marker genes. Preferred specific primer pairs are selected from the
group of SEQ ID NO: 1-6, or functionally equivalent primer pairs
specific for the CD163, Tsp1 and IL1-R2 marker genes. Particularly
preferred specific primer pairs are SEQ ID NO: 1 and SEQ ID NO: 2,
or functionally equivalent primer pairs specific for the CD163
gene.
[0133] The term "functionally equivalent" means another primer,
which need not be any of the listed primers, but has a sequence,
which is complementary to a specific strand of the marker gene, and
enables hybridization or amplification reactions.
[0134] According to one embodiment of the invention, the kit
further comprises means for cultivating cells. Preferably, the kit
comprises an agent for sensitizing the cells. Such an agent may be
a steroid, an immunomodulatory oligonucleotide or a mixture
thereof.
[0135] In another embodiment of the invention, the kit further
comprises means for carrying out hybridization or amplification
assay.
[0136] The present invention also relates to the use of the method
as described previously for determining steroid responsiveness of a
steroid resistant patient.
[0137] The present invention also relates to the use of the method
as described previously for identifying a steroid resistant
patient, who would benefit from an immunomodulatory oligonucleotide
therapy.
[0138] The present invention further relates to the use the method
as described previously for screening whether an immunomodulatory
compound enhances steroid responsiveness of a steroid resistant
patient.
[0139] The present invention further relates to the use of CD163,
Tsp1, IL1-R2, TLR2, TLR4, MKP-1 and TXK genes for preparing a
reagent for in vitro identification of steroid patients, which
would benefit from corticosteroid therapy.
[0140] The present invention further relates to the use of CD163,
Tsp1, IL1-R2, TLR2, TLR4, MKP-1 and TXK genes for preparing a
reagent for in vitro identification of steroid patients, which
would benefit from a combination therapy comprising a steroid
therapy and an immunomodulatory oligonucleotide therapy.
[0141] The present invention also relates to the use of TLR2, TLR4,
MPK-1 and TXK genes for preparing a reagent for in vitro
identification of steroid patients, which would benefit from being
excluded from steroid therapy.
[0142] The present invention further relates to the use of TLR2,
TLR4, MPK-1 and TXK genes for preparing a reagent for in vitro
identification of steroid patients, which would benefit from being
subjected to an alternative therapy comprising the administration
of an immunomodulatory oligonucleotide.
[0143] The present invention also relates to the use of CD163,
Tsp1, IL1-R2, TLR2, TLR4, MKP-1 and TXK genes for preparing a
reagent for in vitro identification of steroid patients, which
would benefit from steroid therapy or a combination therapy and
those which would benefit from being excluded from steroid therapy,
wherein the reagent is a primer pair specific for said genes.
[0144] The present invention also relates to the use of CD163,
Tsp1, IL1-R2, TLR2, TLR4, MKP-1 and TXK genes for preparing a
reagent for in vitro identification of steroid patients, which
would benefit from steroid therapy or a combination therapy and
those which would benefit from being excluded from steroid therapy,
wherein the reagent is an oligonucleotide probe, which is
complementary to a specific region of said genes and capable of
hybridizing or annealing with said genes.
[0145] An advantage of the embodiments of the invention is that it
will now be possible to objectively assess steroid resistance, both
qualitatively and quantitatively. It also becomes possible to
identify not only this patient group, but also to distinguish
between sub-groups thereof, for example patients likely to respond
to resensitization, but who are slow-responders or require repeated
treatments.
[0146] The invention is a step towards more individualized therapy,
in that the condition of an individual patient can be accurately
determined, as well as in that the response of the patient can be
predicted, and the most suitable therapy chosen. Further advantages
will be evident to a skilled person upon study of the description,
examples and claims.
[0147] The following examples firstly present the test materials,
including therapeutic compounds and cells used in the study as well
the conditions to study expression profiles of selected genes and
methods to quantify the expression levels. The following examples
present the evaluation of results and selection of marker genes to
determine those capable for indicating re-sensitization or
resistance to a given therapy.
[0148] The latter examples are examples of screening other
potential marker genes linked to other cell types from an asthma
patient OR from cells of patients with other inflammation diseases,
such as rheumatoid arthritis, ulcerative colitis and Crohn's
disease, and selection of marker genes useful in predicting steroid
responsiveness in these diseases as well as determining the
response of cells to a corticosteroid, an immunomodulatory
oligonucleotide or a mixture thereof. The correlation between the
results obtained in the in vitro method of the present invention
and in vivo will be verified in pre-clinical and possibly also
clinical trials scheduled to be performed during the priority
year.
EXAMPLES
Example 1
Materials and Methods
Test Articles
[0149] In the invention the DNA-based immunomodulatory
oligonucleotide IDX0150, containing a CpG motif (also known as
IDX0150; Kappaproct.RTM., InDex Pharmaceuticals AB, Stockholm,
Sweden) was used to study stimulation of the defined genes in human
peripheral blood mononuclear cells (PMBC). Lyophilized IDX0150 was
weighed and dissolved in 1.times.PBS pH 7,4 (Gibco) at room
temperature. The stock concentration was adjusted by aid of UV
spectrophotometry (SmartSpec.TM. 3000, BIORAD) to 95% accuracy. The
IDX0150 stock solution was stored at -20.degree. C. For the
stimulation experiment, one portion of the stock solution was
diluted further, in order to obtain one low and one high
concentration of stock solution (25 .mu.M and 100 .mu.M, final
concentration, respectively). The concentration was determined in
the same manner, measuring optical density (OD) using a
spectrophotometer as mentioned above.
[0150] The corticosteroid dexamethasone (Dex) used in the
experiments was purchased from Sigma (Cat. No. D-8893) as a powder
and dissolved to stock concentration of 20 mg/ml in a RPMI medium
(Gibco/Sigma), a medium first developed at Roswell Park Memorial
Institute (RPMI) utilizing a bicarbonate buffering system and
alterations in the amounts of amino acids and vitamins.
Dexamethasone stock solution was stored at 4.degree. C.
[0151] Seven candidate genes for developing an in vitro, RT-PCR
based assay of the invention were selected (Table 1). These genes
include IL1-R2, one member of macrophage scavenger receptor family
(CD163), a matrix glycoprotein thrombospondin-1, two members of
interleukin 1 signaling pathway (TLR2 and TLR4) and two enzymes
(MKP-1 and TXK).
TABLE-US-00001 TABLE 1 Genes related to human PBMC steroid response
No. Gene Name/Function Reference 1 CD163 Hemoglobin scavenger
receptor Galon et al., 2002 2 Tsp1 Thrombospondin-1, matrix Galon
et al., 2002 glycoprotein 3 IL1-R2 Interleukin 1 receptor, type II
Galon et al., 2002 4 TXK Tyrosine kinase Wu et al., 2004 5 TLR2
Toll-like receptor, signal transduction Galon et al., 2002 6 TLR4
Toll-like receptor, signal transduction Galon et al., 2002 7 MKP-1
Tyrosine phosphatase Wu et al., 2004
[0152] The PCR primer oligonucleotides specific for the candidate
genes were designed by using 7500 System Applied Biosystems
software Primer Express (v.3). Primer oligonucleotides were custom
ordered from MWG Biotech (Edersberg, Germany). The primers were
dissolved in sterile deionised water (Gibco) at room temperature.
All primer oligonucleotides were stored at -20.degree. C. The
sequences of the PCR primer oligonucleotides used are listed in
Table 2.
TABLE-US-00002 TABLE 2 PCR primer oligonucleotides Primer Sequence
ID Sequence (5'-3') CD163 forward SEQ ID NO: 1
GCTGCAGTGAATTGCACAGATAT CD163 reverse SEQ ID NO: 2
CGGGATGAGCGACCTGTT Tsp1 forward SEQ ID NO: 3 CATCCGCAAAGTGACTGAAGAG
Tsp1 reverse SEQ ID NO: 4 GTACTGAACTCCGTTGTGATAG CATAG IL1-R2
forward SEQ ID NO: 5 TCACTAGGAGTATTGAGCTACG CATC IL1-R2 reverse SEQ
ID NO: 6 ATTGTCAGTCTTGACCCCAGAGA TXK forward SEQ ID NO: 7
CAATGCAGCCGGTCTCATG TXK reverse SEQ ID NO: 8 TCTCCCACTTTTCGTAGCTAAA
CC TLR2 forward SEQ ID NO: 9 AGGAGCTCTTAGTGACCAAGTGA AG TLR2
reverse SEQ ID NO: 10 CCCACACCATCCACAAAGTATG TLR4 forward SEQ ID
NO: 11 CCCTGCGTGGAGGTGGTT TLR4 reverse SEQ ID NO: 12
ATATGCCCCATCTTCAATTGTCT MKP-1 forward SEQ ID NO: 13
GGAGGATACGAAGCGTTTTCG MKP-1 reverse SEQ ID NO: 14
ACCGGGCCACCCTGAT
Biological Systems
Cell Preparation
[0153] Peripheral blood mononuclear cells (PMBC) were isolated from
blood samples of seven steroid resistant asthma or ulcerative
colitis patients and ten healthy volunteers by density gradient
centrifugation using Ficoll-Paque Plus (Pharmacia Biotech), washed
three times in buffered saline solution (PBS), and resuspended in
complete RPMI 1640 (Sigma/Gibco) containing 15% heat inactivated
fetal bovine serum (FCS) (Gibco, Life Technologies), 100 U/ml
penicillin, 100 .mu.g/ml streptomycin (Life Technologies), 2 mM
L-glutamine (Sigma), gentamycin 25 ug/ml (Sigma) and 5 mM Hepes
(Gibco, Life Technologies). Cells were counted using 0.4% Trypan
blue solution (Sigma Aldrich). On average the yield of PBMC was in
range of 60-120.times.10.sup.6 cells per donor sample.
Techniques
In Vitro Stimulation of PBMC
[0154] PBMCs, prepared as described previously, were resuspended in
RPMIc containing 5% of FBS (Gibco, Life Technologies) and seeded
into a 96-well flat bottomed cell culture plate (Falcon) at a cell
density of 0.5.times.10.sup.6 cells per well. Immediately after
plating, cells were stimulated with IDX0150 (25 .mu.M or 100 .mu.M)
in the presence or absence of corticosteroid Dex (10.sup.-10,
10.sup.-8 or 10.sup.-6M). During the treatment, cells were
incubated in a humified SteriCycle CO.sub.2 cell culture incubator
(ThermoForma) at 5% carbon dioxide (CO.sub.2), 37.degree. C. for 48
hrs. After the incubation period the supernatant was aspirated and
the cells covered by 50 .mu.l/well of RLT-lysis buffer (Qiagen)
containing 1.0% of .beta.-mercaptoethanol. The culture plates with
the PBMC were saved at -20.degree. C. until RNA isolation
procedure.
Total RNA Isolation from Stimulated PBMC
[0155] 96-well plates, prepared as described above, were removed
from -20.degree. C. and allowed to thaw at room temperature. After
thawing, PBMC were resuspended in 50 .mu.l/well of RLT lysis buffer
(Qiagen) containing 1.0% of .beta.-mercaptoethanol. RNA isolation
was performed using RNeasy RNA isolation kit (Qiagen) according to
the instructions of the manufacturer. RNA was eluted in 40 .mu.l of
RNase-free water and 5 .mu.l of the RNA eluate was used to
determine the RNA concentration by spectrophotometry (SmartSpec.TM.
3000, BIO-RAD). Quality of RNA was checked by gel electrophoresis
on a 1% agarose (Sigma) gel buffered with 1.times.TAE and
containing ethidium bromide to visualize RNA.
Conventional cDNA Synthesis
[0156] For the first strand cDNA synthesis 0.3-1.0 .mu.g of total
PBMC RNA was subjected to conventional reverse transcription with
the polymerase chain reaction (RT-PCR) using d(T).sub.20
oligonucleotide as a primer. Double stranded cDNA was synthetized
by PCR using PCR primer oligonucleotides (Table 2) specific for the
selected nucleotide sequences (Table 1). cDNA stock solutions were
diluted in adequate volume of sterile deionised water (Gibco). cDNA
samples were analyzed by gel electrophoresis on 1% agarose (Sigma)
gel buffered with 1.times.TAE and containing ethidium bromide to
confirm expected length of the synthetised PCR products.
[0157] Aliquotes of the RT-PCR reaction samples were sequenced at
MWG Biotech (Edersberg, Sverige) and the resulted DNA sequences
were verified by NCBI Blast bioinformatics analysis.
Real Time PCR Analysis of the PBMC cDNA
[0158] Real-time PCR with PBMC cDNA was performed in triplicates
for each sample-treatment/gene combination for considered genes and
in duplicate for a housekeeper gene (.gamma.-actin). Double
stranded cDNA was synthetized by real time PCR using PCR primer
oligonucleotides (Table 2) specific for the selected nucleotide
sequences (Table 1). Real-time PCR data for individual Cycle
threshold (deltaCt) and Relative Quantitation (RQ) values were
calculated and analysed with 7500 System SDS Software according to
the instructions of the supplier (Applied Biosystems). The
individual values were exported to Excel and analysed
statistically. Basal level of gene expression in non-treated
samples was determined in Excel by calculation of RQ value from
individual deltaCt values.
[0159] For each particular gene all average RQ values were
normalised against average RQ value of basal expression of this
gene. To evaluate individual values distribution the average
deviations of values range were calculated. The normalised average
RQ values with indication of average deviation of values range were
plotted in Excel. The distributions of individual expression values
were plotted using GraphPad Prism version 4.03 for Windows,
GraphPad Software, San Diego Calif. USA, www.graphpad.com.
Evaluation of Gene Expression of PBMC Upon Stimulation with
IDX0150
[0160] Seven selected genes were analyzed for gene expression in a
PBMC culture experiment as described previously. For each
gene/patient pair PBMC culture was split in 6 aliquote samples for
treatment with a CpG containing oligonucleotide IDX0150 or
corticosteroid Dex or IDX0150/Dex in combination. IDX0150 was used
at final concentrations of 25 and 100 .mu.M and Dex was added into
the cell growth medium at final concentrations of 10.sup.-10,
10.sup.-8 or 10.sup.-6M. Cells were cultivated 48 hours as
described previously.
[0161] The results of the gene expression are presented in Examples
2-8.
Example 2
Evaluation of CD163 Gene Expression of PBMC Upon Stimulation with
IDX0150
[0162] PBMC culture experiment setup performed was as described in
Example 1. The average values of expression level of CD163 gene are
presented in FIGS. 1 and 4. Deviation bars show range of expression
level values in groups of healthy volunteers (HV) and steroid
resistant asthma or ulcerative colitis patients (SR). The average
expression level value was normalized against the basal expression
level value as described in Example 1.
[0163] Scavenger receptors are known to be involved in the innate
immune response. CD163 expression has been shown to be up-regulated
by anti-inflammatory mediators and corticosteroids (Buechler, 2000;
Galon, 2002). The present study confirmed that CD163 expression was
up-regulated by the corticosteroid dexamethasone (Dex) in a dose
dependent manner both in the PBMC of healthy volunteers (HV) and
steroid resistant patients (SR) and showed for the first time that
this up-regulation was strongly increased by co-treatment with
IDX0150 in both groups (FIGS. 1 and 4). The enhancing effect was
even more pronounced in the samples of steroid resistant asthma and
ulcerative colitis patients (SR). The observation provides evidence
for a steroid "enhancing" effect of IDX0150 in both test
groups.
Example 3
Evaluation of Tsp1 and IL1-RL2 Gene Expression of PBMC Upon
Stimulation with IDX0150
[0164] Thrombospondins are structurally related to matrix
metalloproteinases (MMPs) and regulate their functions (Chen,
2000). The expression of Tsp1 has been shown to be up-regulated by
glucocorticoids (Galon, 2002). Also IL1-R2, an anti-inflammatory
decoy receptor limiting the deleterious effects of interleukin 1
(IL-1), is among the genes strongly up-regulated by glucocorticoids
(Re, 1994; Galon, 2002).
[0165] PBMC culture experiment setup was performed as described
previously (see Example 1).
[0166] The average values of expression levels of Tsp1 and IL1-R2
genes are presented in FIGS. 2, 3 (asthma) and 5, 6 (ulcerative
colitis), respectively. Approximately 3-5 fold induction of Tsp1
and IL1-R2 was demonstrated by 10.sup.-6 M Dex. The results showed
for the first time that Tsp1 and IL1-R2 up-regulation could be
strongly increased in a dose dependent manner by co-treatment with
IDX0150. The effect was even more pronounced in the samples of
steroid resistant asthma and ulcerative colitis patients (SR). The
observation provides evidence for a steroid "enhancing" effect of
IDX0150 in both test groups.
Example 4
Evaluation of TLR2, TLR4, MKP-1 and TXK Gene Expression of PBMC
Upon Stimulation with IDX0150
[0167] PBMC culture experiment setup was performed as described
previously (see Example 1). The average values of expression levels
of TLR2, TLR4, MKP-1 and TXK genes are presented in FIGS. 7, 8, 9
and 10, respectively.
[0168] TLR2, TLR4, MPK-1 and TXK genes showed different expression
levels in PBMC material of healthy volunteers (HV) in comparison
with steroid resistant asthma patients (SR), when treated with only
Dex and in combination of IDX0150 and Dex (FIGS. 7-10).
[0169] The observation supports the use of these genes as putative
markers for resistance of asthma patients to corticosteroid
treatment when compared to the expression of these genes in healthy
persons.
Example 5
Human Pilot Study
[0170] Clinical studies are in progress with the primary objective
to explore the clinical efficacy of the combination therapy
comprising a DNA-based immunomodulatory oligonucleotide IDX0150
(Kappaproct.RTM., InDex Pharmaceuticals AB) and a corticosteroid
dexamethasone, and particularly to explore the correlation between
an in vitro method according to an embodiment of the present
invention. The study will also test the clinical efficacy of the
treatment selected based on said in vitro method. The test group
consists of ulcerative colitis patients, which in the in vitro
method have been shown to be responsive to said combination
therapy, i.e. PBMC cells obtained from these patients showed
enhanced expression of selected marker genes in the presence of a
steroid and an immunomodulatory oligonucleotide. The clinical
efficacy is determined by endoscopic and clinical
remission/improvement rates, histological improvement and changes
in clinical laboratory parameters.
[0171] The study is placebo controlled; double blinded single dose
and considered patients that were unresponsive to corticosteroids
or corticosteroid dependent who were on concomitant steroid
therapies.
[0172] The dose level used is 3 mg and 30 mg given as a single
rectal administration.
[0173] Although particular embodiments have been disclosed herein
in detail, this has been done by way of example for purposes of
illustration only, and is not intended to be limiting with respect
to the scope of the appended claims that follow. In particular, it
is contemplated by the inventor that various substitutions,
alterations, and modifications may be made to the invention without
departing from the spirit and scope of the invention as defined by
the claims.
REFERENCES
[0174] Beutler B, Jiang Z, Georgel P, Crozat K, Croker B,
Rutschmann S, Du X, Hoebe K. 2006. Genetic analysis of host
resistance: Toll-like receptor signaling and immuninty at large.
Ann. Rev. Immunol. 24: 353-389. [0175] Buechler C, Ritter M, Orso
E, Langmann T, Klucken J, Schmitz G. 2000. Regulation of scavenger
receptor CD163 expression in human mononuclear cells and
macrophages by pro- and antiinflammatory stimuli. J. Leukoc. Biol.
67: 97-103. [0176] Chen H, Herndon M E, Lawler J. 2000. The cell
biology of thrombospondin-1. Matrix Biol. 19: 597-614. [0177]
Chrousos G P, Vingerhoeds A, Brandon D. 1982. Primary cortisol
resistance in man. A glucocorticoid receptor-mediated disease. J.
Clin. Invest. 69(6): 1261-1269. [0178] Chrousos G P,
Detera-Wadleigh S D, Karl M. 1993. Syndromes of glucocorticoid
resistance. Ann. Intern. Med. 119(11): 1113-1124. [0179] Clark J K,
Schrader W T, O'Malley B W. 1992. Mechanism of steroid hormones.
1992. In: J D Wilson, D W Foster, eds. Williams Textbook of
Endocrinology. W B Saunders Co., Philadelphia, Pa., pp. 35-90.
[0180] Cole T J, Blendy J A, Monaghan A P. 1995. Targeted
disruption of the glucocorticoid receptor gene blocks adrenergic
chromaffin cell development and severely retards lung maturation.
Genes. Dev. 9(13): 1608-1621. [0181] Cowdery J S, Chace J H, Yi A
K, Krieg A M. 1996. Bacterial DNA induces NK cells to produce
IFN-gamma in vivo and increases the toxicity of
lipopolysaccharides. J. Immunol. 156(12): 4570-4575. [0182] Galon
J, Franchimont D, Hiroi N, Frey G, Boettner A, Ehrhart-Bornstein
M., O'Shea J J, Chrousos G P, Bornstein S R. 2002. Gene profiling
reveals unknown enhancing and suppressive actions of
glucocorticoids on immune cells. FASEB J. 16(1): 61-71. [0183]
Gisbert J P et al., 2008. Crohnology: A tale of time and times and
inflammatory bowel diseases. World J. Gastroenterol. 14(36):
5504-7. [0184] Iho S, Yamamoto T, Takahashi T, Yamamoto S. 1999.
Oligodeoxynucleotides containing palindrome sequences with internal
5'CpG-3' act directly on human NK and activated T cells to induce
IFN-gamma production in vitro. J. Immunol. 163(7): 3642-3652.
[0185] Jakob T, Walker P S, Krieg A M, Udey M C, Vogel J C. 1998.
Activation of cutaneous dendritic cells by CpG-containing
oligodeoxynucleotides: a role for dendritic cells in the
augmentation of TH1 responses by immunostimulatory DNA. J. Immunol.
161(6): 3042-3049. [0186] Kline J N. 2000. Effects of CpG DNA on
Th1/Th2 balance in asthma. Curr. Top. Microbiol. Immunol. 247:
211-225. [0187] Krieg A. 1996. Lymphocyte activation by CpG
dinucleotide motifs in prokaryotic DNA. Trends Microbiol. 4(2):
73-76. [0188] Krieg A. 1998. Leukocyte stimulation by
oligodeoxynucleotides. C A Stein, A M Krieg, eds. Applied Antisense
Oligonucleotide Technology. John Wiley and Sons Inc., New York,
N.Y. pp. 431-448. [0189] Leung D Y M, Szefler S S. 1995.
Steroid-Resistant Asthma. Med. Sci. Update 13(2),
(http://library2.nationaliewish.orq/MSU/13n2MSU StRe Asthma.html).
[0190] Leung et al. 2002. Steroid-unresponsive asthma. Semin Respir
Crit. Care Med. 23(4):387-98. [0191] Mannon P J, Fuss I J, Mayer L,
Elson C O, Sandborn W J, Present D, Dolin B, Goodman N, Groden C,
Hornung R L, Quezado M, Neurath M F, Salfeld J, Veldman G M,
Schwertschlag U, Strober W. 2004. Anti-IL-12 Crohn's disease study
group. Anti-interleukin-12 antibody for active Crohn's disease. N.
Engl. J. Med. 351(20): 2069-2079. [0192] Munkholm et al. 1994.
Frequency of glucocorticoid resistance and dependency in Crohn's
disease. Gut; 35(3):360-2. [0193] Mariette X. 2003. Anti-cytokines
in the treatment of inflammation. Rev. Prat. 53(5): 507-511. [0194]
Munck A, Guyre P M, Holbrook N J. 1984. Physiological functions of
glucocorticoids in stress and their relation to pharmacological
actions. Endocr. Rev. 5(1): 25-44. [0195] Neurath M F, Fuss I,
Kelsall B L, Stuber E, Strober W. 1995. Antibodies to interleukin
12 abrogate established experimental colitis in mice. J. Exp. Med.
182(5): 1281-1290. [0196] Re, F, Muzio, M, De Rossi, M,
Polentarutti, N, Girl, J G., Mantovani, A, Colotta, F. 1994. The
type II `receptor` as a decoy target for interleukin 1 in
polymorphonuclear leukocytes: characterization of induction by
dexamethasone and ligand binding properties of the released decoy
receptor. J. Exp. Med. 179: 739-743. [0197] Ritter M, Buechler C,
Langmann T, Orso E, Klucken J, Schmitz G. 1999. The scavenger
receptor CD163: Regulation, promoter structure and genomic
organization. Pathobiol. 67(5-6): 257-261. [0198] Reinisch W and
Vogelsang H. 2002. Steroid dependency in Crohn's disease.
Gastroenterology, 123(1):393-5 [0199] Sambrook J, Russell D W.
2001. Molecular cloning. A laboratory manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. [0200] Shadidi H,
Vottero A, Stratakis C A, Taymans S E, Karl M, Longui C A, Chrousos
G P, Daughaday W H, Gregory S A, Plate J M. 1999. Imbalanced
expression of the glucocorticoid receptor isoforms in cultured
lymphocytes from a patient with systemic glucocorticoid resistance
and chronic lymphocytic leukemia. Biochem. Biophys. Res. Commun.
254(3): 559-565. [0201] Sparwasser T, Koch E S, Vabulas R M, Heeg
K, Lipford G B, Ellwart J W, Wagner H. 1998. Bacterial DNA and
immunostimulatory CpG oligonucleotides trigger maturation and
activation of murine dendritic cells. Eur. J. Immunol. 28(6):
2045-2054. [0202] Stacey K J, Sweet M J, Hume D A. 1996.
Macrophages ingest and are activated by bacterial DNA. J. Immunol.
157(5): 2116-2122. [0203] Takeba Y, Nakafuchi H, Takeno m,
Kashiwakura J, Suzuki N. 2002. Txk, a member of nonreceptor
tyrosine kinase of Tec family, acts as a Th1 cell-specific
transcription factor and regulates IFN-gamma gene transcription. J.
Immunol. 168: 2365-2370. [0204] Vermeer H, Hendriks-Stegeman B I,
van Suylekom D, Rijkers G T, van Buul-Offers S C, Jansen M. 2004.
An in vitro bioassay to determine individual sensitivity to
glucocorticoids: induction of FKBP51 mRNA in peripheral blood
mononuclear cells. Mol. Cell. Endocrinol. 218(1-2): 49-55. [0205]
Wolleben G, Erb K J. 2006. Immune stimulatory strategies for the
prevention and treatment of asthma. Curr. Pharm. Des. 12(25):
3281-3292. [0206] Wu W, Chaudhuri S, Brcikley D R, Pang D, Karrison
T, Conzen S D. 2004. Microarray analysis reveals
glucocorticoid-regulated survival genes that are associated with
inhibition of apoptosis in breast epithelial cells. Cancer Res.
64(5): 1757-1764. [0207] Zhao Q, Temsamani J, iadarola P L, Jiang
Z, Agrawal S. 1996. Effect of different chemically modified
oligodeoxynucleotides on immune stimulation. Biochem. Pharmacol.
51(2): 173-182. [0208] Zimmerman S, Egeter O, Hausmann S, Lipford G
B, Rocken M, Wagner H, Heeg K. 1998. CpG oligodeoxynucleotides
trigger protective and curative Th1 responses in lethal murine
Leishmaniasis. J. Immunol. 160(8): 3627-3630.
Sequence CWU 1
1
14123DNAArtificial SequencePCR primer 1gctgcagtga attgcacaga tat
23218DNAArtificial SequencePCR primer 2cgggatgagc gacctgtt
18322DNAArtificial SequencePCR primer 3catccgcaaa gtgactgaag ag
22427DNAArtificial SequencePCR primer 4gtactgaact ccgttgtgat
agcatag 27526DNAArtificial SequencePCR primer 5tcactaggag
tattgagcta cgcatc 26623DNAArtificial SequencePCR primer 6attgtcagtc
ttgaccccag aga 23719DNAArtificial SequencePCR primer 7caatgcagcc
ggtctcatg 19824DNAArtificial SequencePCR primer 8tctcccactt
ttcgtagcta aacc 24925DNAArtificial SequencePCR primer 9aggagctctt
agtgaccaag tgaag 251022DNAArtificial SequencePCR primer
10cccacaccat ccacaaagta tg 221118DNAArtificial SequencePCR primer
11ccctgcgtgg aggtggtt 181223DNAArtificial SequencePCR primer
12atatgcccca tcttcaattg tct 231321DNAArtificial SequencePCR primer
13ggaggatacg aagcgttttc g 211416DNAArtificial SequencePCR primer
14accgggccac cctgat 16
* * * * *
References