U.S. patent application number 13/912731 was filed with the patent office on 2014-01-23 for method for the production of polyunsaturated fatty acids.
The applicant listed for this patent is BASF Plant Science GmbH. Invention is credited to Amine Abbadi, Frederic Domergue, Ernst Heinz, Andreas Renz, Thorsten Zank.
Application Number | 20140026259 13/912731 |
Document ID | / |
Family ID | 32920641 |
Filed Date | 2014-01-23 |
United States Patent
Application |
20140026259 |
Kind Code |
A1 |
Renz; Andreas ; et
al. |
January 23, 2014 |
Method for the Production of Polyunsaturated Fatty Acids
Abstract
The present invention relates to a process for producing
polyunsaturated fatty acids in an organism by introducing nucleic
acids into the organism which code for polypeptides having
acyl-CoA:lysophospholipid a cyltransferase activity.
Advantageously, these nucleic acid sequences may, if appropriate
together with further nucleic acid sequences coding for
biosynthesis polypeptides of the fatty acid or lipid metabolism, be
expressed in the transgenic organism. The invention furthermore
relates to the nucleic acid sequences, to nucleic acid constructs
comprising the nucleic acid sequences of the invention, to vectors
comprising the nucleic acid sequences and/or the nucleic acid
constructs and to transgenic organisms comprising the
abovementioned nucleic acid sequences, nucleic acid constructs
and/or vectors. A further part of the invention relates to oils,
lipids and/or fatty acids produced by the process of the invention
and to their use.
Inventors: |
Renz; Andreas;
(Limburgerhof, DE) ; Heinz; Ernst; (Hamburg,
DE) ; Abbadi; Amine; (Ebergotzen, DE) ;
Domergue; Frederic; (Hamburg, DE) ; Zank;
Thorsten; (Mannheim, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BASF Plant Science GmbH |
Ludwigshafen |
|
DE |
|
|
Family ID: |
32920641 |
Appl. No.: |
13/912731 |
Filed: |
June 7, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12417171 |
Apr 2, 2009 |
8486671 |
|
|
13912731 |
|
|
|
|
10547447 |
Aug 26, 2005 |
7537920 |
|
|
PCT/EP2004/000771 |
Jan 29, 2004 |
|
|
|
12417171 |
|
|
|
|
Current U.S.
Class: |
800/298 ;
435/419 |
Current CPC
Class: |
C12N 9/1029 20130101;
C12N 15/8247 20130101; C12P 7/6472 20130101; C12P 7/6427
20130101 |
Class at
Publication: |
800/298 ;
435/419 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 27, 2003 |
DE |
10308836.9 |
Claims
1. A transgenic plant or plant cell comprising a heterologous
acyl-CoA:lysophospholipid-acyltransferase (LPLAT) gene, wherein
said plant or plant cell has an increased content of
polyunsaturated fatty acids in comparison with a corresponding
non-transgenic plant or plant cell lacking said heterologous LPLAT
gene.
2. The transgenic plant or plant cell of claim 1, wherein said
heterologous LPLAT gene is integrated into the genome of said plant
or plant cell and replaces a LPLAT gene native to said plant or
plant cell by recombination.
3. The transgenic plant or plant cell of claim 1, wherein the
polyunsaturated fatty acids produced in said plant or plant cell
comprises C.sub.18-, C.sub.20- and/or C.sub.22-fatty acids with at
least two double bonds.
4. The transgenic plant or plant cell of claim 1, further comprises
at least one heterologous nucleic acid encoding an enzyme of the
fatty acid or lipid metabolism.
5. The transgenic plant or plant cell of claim 4, wherein the at
least one heterologous nucleic acid encodes an enzyme of the fatty
acid or lipid metabolism selected from the group consisting of
acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein]
desaturase(s), acyl-ACP thioesterase(s), fatty acid
acyltransferase(s), fatty acid synthase(s), fatty acid
hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A
oxidase(s), fatty acid desaturase(s), fatty acid acetylenases,
lipoxygenases, triacylglycerol lipases, allenoxide synthases,
hydroperoxide lyases and fatty acid elongase(s).
6. The transgenic plant or plant cell of claim 4, wherein the at
least one heterologous nucleic acid encodes an enzyme of the fatty
acid or lipid metabolism selected from the group consisting of
.DELTA.4-desaturases, .DELTA.5-desaturases, .DELTA.6-desaturases,
.DELTA.8-desaturases, .DELTA.9-desaturases, .DELTA.12-desaturases,
.DELTA.5-elongases, .DELTA.6-elongases and .DELTA.9-elongases.
7. The transgenic plant or plant cell of claim 5, wherein the plant
is an oil crop plant, or wherein the plant cell is an oil crop
plant cell.
8. A method for modulating production of polyunsaturated fatty
acids in a non-human organism, comprising: (a) obtaining a
non-human organism comprising a heterologous LPLAT gene; and (b)
growing said non-human organism under conditions so that said
heterologous LPLAT gene is expressed, wherein expression of said
heterologous LPLAT gene modifies production of polyunsaturated
fatty acids in said non-human organism.
9. The method of claim 8, wherein said heterologous LPLAT gene is
integrated into the genome of said non-human organism and replaces
a LPLAT gene native to said non-human organism by
recombination.
10. The method of claim 8, wherein the polyunsaturated fatty acids
produced in said non-human organism comprises C.sub.18-, C.sub.20-
and/or C.sub.22-fatty acids with at least two double bonds.
11. The method of claim 8, wherein the non-human organism further
comprises at least one heterologous nucleic acid encoding an enzyme
of the fatty acid or lipid metabolism.
12. The method of claim 11, wherein the at least one heterologous
nucleic acid encodes an enzyme of the fatty acid or lipid
metabolism selected from the group consisting of acyl-CoA
dehydrogenase(s), acyl-ACP [=acyl carrier protein] desaturase(s),
acyl-ACP thioesterase(s), fatty acid acyltransferase(s), fatty acid
synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A
carboxylase(s), acyl-coenzyme A oxidase(s), fatty acid
desaturase(s), fatty acid acetylenases, lipoxygenases,
triacylglycerol lipases, allenoxide synthases, hydroperoxide lyases
and fatty acid elongase(s).
13. The method of claim 11, wherein the at least one heterologous
nucleic acid encodes an enzyme of the fatty acid or lipid
metabolism selected from the group consisting of
.DELTA.4-desaturases, .DELTA.5-desaturases, .DELTA.6-desaturases,
.DELTA.8-desaturases, .DELTA.9-desaturases, .DELTA.12-desaturases,
.DELTA.5-elongases, .DELTA.6-elongases and .DELTA.9-elongases.
14. The method of claim 8, wherein the non-human organism is an oil
crop plant.
15. A transgenic plant or plant cell capable of producing
docosahexaenoic acid (DHA), wherein said plant or plant cell
comprises a heterologous LPLAT gene, and wherein expression of said
heterologous LPLAT gene leads to the production of DHA in said
plant or plant cell.
16. The transgenic plant or plant cell of claim 15, wherein said
heterologous LPLAT gene is integrated into the genome of said plant
or plant cell and replaces a LPLAT gene native to said plant or
plant cell by recombination.
17. The transgenic plant or plant cell of claim 15, further
comprises at least one heterologous nucleic acid encoding an enzyme
of the fatty acid or lipid metabolism.
18. The transgenic plant or plant cell of claim 17, wherein the at
least one heterologous nucleic acid encodes an enzyme of the fatty
acid or lipid metabolism selected from the group consisting of
acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein]
desaturase(s), acyl-ACP thioesterase(s), fatty acid
acyltransferase(s), fatty acid synthase(s), fatty acid
hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A
oxidase(s), fatty acid desaturase(s), fatty acid acetylenases,
lipoxygenases, triacylglycerol lipases, allenoxide synthases,
hydroperoxide lyases and fatty acid elongase(s).
19. The transgenic plant or plant cell of claim 17, wherein the at
least one heterologous nucleic acid encodes an enzyme of the fatty
acid or lipid metabolism selected from the group consisting of
.DELTA.4-desaturases, .DELTA.5-desaturases, .DELTA.6-desaturases,
.DELTA.8-desaturases, .DELTA.9-desaturases, .DELTA.12-desaturases,
.DELTA.5-elongases, .DELTA.6-elongases and .DELTA.9-elongases.
20. The transgenic plant or plant cell of claim 15, wherein the
plant is an oil crop plant, or wherein the plant cell is an oil
crop plant cell.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. patent
application Ser. No. 12/417,171 filed Apr. 2, 2009, which is a
divisional of U.S. patent application Ser. No. 10/547,447 filed
Aug. 26, 2005, now U.S. Pat. No. 7,537,920, which is a national
stage application (under 35 U.S.C. 371) of PCT/EP2004/000771 filed
Jan. 29, 2004, which claims benefit to German application
10308836.9 filed Feb. 27, 2003. The entire contents of each of
these applications are hereby incorporated by reference herein.
SUBMISSION OF SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
filed in electronic format via EFS-Web and hereby incorporated by
reference into the specification in its entirety. The name of the
text file containing the Sequence Listing is
Sequence_Listing.sub.--12810.sub.--01526. The size of the text file
is 273 KB, and the text file was created on Jun. 7, 2013.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to a process for producing
polyunsaturated fatty acids in an organism by introducing nucleic
acids into said organism which code for polypeptides having
acyl-CoA:lysophospholipid-acyltransferase activity. Advantageously,
these nucleic acid sequences may, if appropriate together with
further nucleic acid sequences coding for biosynthesis polypeptides
of the fatty acid or lipid metabolism, be expressed in the
transgenic organism.
[0004] The invention furthermore relates to the nucleic acid
sequences, to nucleic acid constructs comprising the nucleic acid
sequences of the invention, to vectors comprising said nucleic acid
sequences and/or said nucleic acid constructs and to transgenic
organisms comprising the abovementioned nucleic acid sequences,
nucleic acid constructs and/or vectors.
[0005] A further part of the invention relates to oils, lipids
and/or fatty acids produced by the process of the invention and to
their use.
[0006] Fatty acids and triglycerides have a multiplicity of
applications in the food industry, in animal nutrition, in
cosmetics and in the pharmacological sector. Depending on whether
they are free saturated or unsaturated fatty acids or else
triglycerides with an elevated content of saturated or unsaturated
fatty acids, they are suitable for very different applications;
thus, for example, polyunsaturated fatty acids are added to baby
food to improve the nutritional value. Polyunsaturated
.omega.-3-fatty acids and .omega.-6-fatty acids are, in this
connection, an important constituent of animal and human food.
Owing to the composition of human food, which is customary today,
an addition of polyunsaturated .omega.-3-fatty acids which are
preferably present in fish oils to the food is particularly
important. Thus, for example, polyunsaturated fatty acids such as
docosahexaenoic acid (=DHA, C22:6.sup..DELTA.4,7,10,13,16,19) or
eisosapentaenoic acid (=EPA, C20:5.sup..DELTA.5,8,11,14,17) are
added to baby food to improve the nutritional value. The
unsaturated fatty acid DHA is said to have a positive effect on
brain development.
[0007] Hereinbelow, polyunsaturated fatty acids are referred to as
PUFA, PUFAs, LCPUFA or LCPUFAs (poly unsaturated fatty acids, PUFA
long chain poly unsaturated fatty acids LCPUFA).
[0008] The various fatty acids and triglycerides are obtained,
usually in the form of their triacylglycerides
(=triglycerides=triglycerols), mainly from microorganisms such as
Mortierella or Schizochytrium or from oil-producing plants such as
soybean, oilseed rape, algae such as Crypthecodinium or
Phaeodactylum and others. However, they may also be obtained from
animals such as, for example, fish. The free fatty acids are
advantageously prepared by hydrolysis. Higher polyunsaturated fatty
acids such as DHA, EPA, arachidonic acid (=ARA,
C20:4.sup..DELTA.5,8,11,14), dihomo-.gamma.-linolenic acid
(C20:3.sup..DELTA.8,11,14) or docosapentaenoic acid (DPA,
C22:5.sup..DELTA.7,10,13,16,19) cannot be isolated from oil crops,
such as oilseed rape, soybean, sunflower, safflower or others.
Conventional natural sources of these fatty acids are fish such as
herring, salmon, sardine, red fish, eel, carp, trout, halibut,
mackerel, zander or tuna, or algae.
[0009] Depending on the intended application, preference is given
to oils with saturated or unsaturated fatty acids; thus, for
example, lipids with unsaturated fatty acids, especially
polyunsaturated fatty acids, are preferred in human nutrition. The
polyunsaturated .omega.-3-fatty acids are said to have in this
connection a positive effect on the cholesterol level in the blood
and thus on the possibility of preventing heart disease. The risk
of heart disease, stroke or hypertension may be reduced markedly by
adding these .omega.-3-fatty acids to food. .omega.-3-fatty acids
can also have a positive effect on inflammatory, especially
chronically inflammatory, processes in connection with
immunological disorders such as rheumatoid arthritis. They are
therefore added to food, especially dietetic food, or are applied
in medicaments. .omega.-6-fatty acids such as arachidonic acid tend
to have a negative effect on these diseases in connection with said
rheumatic disorders, due to our customary foodstuff
composition.
[0010] .omega.-3- and .omega.-6-fatty acids are precursors of
tissue hormones, the "eicosanoides, such as the prostaglandins,
which are derived from dihomo-.gamma.-linolenic acid, arachidonic
acid and eicosapentaenoic acid, the thromoxanes and leukotrienes
which are derived from arachidonic acid and eicosapentaenoic acid.
Eicosanoides ("PG.sub.2 series") which are formed from
.omega.-6-fatty acids normally promote inflammatory reactions,
while eicosanoides ("PG.sub.3 series") from .omega.-3-fatty acids
have little or no proinflammatory effect.
[0011] Owing to their positive properties, there has been no lack
of attempts in the past to make available genes which are involved
in the synthesis of fatty acids or triglycerides for the production
of oils in various organisms with a modified content of unsaturated
fatty acids. Thus, WO 91/13972 and its US equivalent describe a
.DELTA.9-desaturase. WO 93/11245 claims a .DELTA.15-desaturase and
WO 94/11516 a .DELTA.12-desaturase. Further desaturases are
described, for example, in EP-A-0 550 162, WO 94/18337, WO
97/30582, WO 97/21340, WO 95/18222, EP-A-0 794 250, Stukey et al.,
J. Biol. Chem., 265, 1990: 20144-20149, Wada et al., Nature 347,
1990: 200-203 and Huang et al., Lipids 34, 1999: 649-659. However,
the biochemical characterization of the various desaturases has
been insufficient to date since the enzymes, being membrane-bound
proteins, can be isolated and characterized only with great
difficulty (McKeon et al., Methods in Enzymol. 71, 1981:
12141-12147, Wang et al., Plant Physiol. Biochem., 26, 1988:
777-792). Membrane-bound desaturases are normally characterized by
being introduced into a suitable organism which is subsequently
studied for enzyme activity by analyzing reactants and products.
.DELTA.6-desaturases are described in WO 93/06712, U.S. Pat. No.
5,614,393, U.S. Pat. No. 5,614,393, WO 96/21022, WO 00/21557 and WO
99/27111, as is the application for production in transgenic
organisms, namely in WO 98/46763, WO 98/46764, WO 9846765. The
expression of various desaturases such as those in WO 99/64616 or
WO 98/46776 and the formation of polyunsaturated fatty acids are
also described and claimed in this connection. Regarding the
efficacy of desaturase expression and its influence on the
formation of polyunsaturated fatty acids, it should be noted that
expression of a single desaturase, as described previously, has
resulted in only low contents of unsaturated fatty acids/lipids
such as, for example, .gamma.-linolenic acid and stearidonic acid.
Furthermore, a mixture of .omega.-3- and .omega.-6-fatty acids was
usually obtained.
[0012] Particularly suitable microorganisms for producing PUFAs are
microorganisms such as Thraustochytrium or Schizochytrium strains,
algae such as Phaeodactylum tricornutum or Crypthecodinium species,
ciliates, such as Stylonychia or Colpidium, fungi such as
Mortierella, Entomophthora or Mucor. Strain selection has resulted
in the development of a number of mutant strains of the
corresponding microorganisms, which produce a series of desirable
compounds including PUFAs. However, the mutation and selection of
strains with improved production of a particular molecule such as
the polyunsaturated fatty acids is a time-consuming and difficult
process. Therefore, preference is given, whenever possible, to
genetic engineering processes, as described above. However, only
limited amounts of the desired polyunsaturated fatty acids such as
DPA, EPA or ARA can be produced with the aid of the abovementioned
microorganisms, and, depending on the microorganism used, the
former are usually obtained as fatty acid mixtures of, for example,
EPA, DPA and DHA.
[0013] Alternatively, fine chemicals may be produced advantageously
on a large scale via production in plants which are developed so as
to produce the abovementioned PUFAs. Plants which are particularly
well suited for this purpose are oil crops which contain large
amounts of lipid compounds, such as oilseed rape, canola, linseed,
soybean, sunflower, borage and evening primrose. However, other
crop plants containing oils or lipids and fatty acids are also well
suited, as mentioned in the detailed description of the present
invention. Conventional breeding has been used to develop a number
of mutant plants which produce a spectrum of desirable lipids and
fatty acids, cofactors and enzymes. However, the selection of new
plant cultivars with improved production of a particular molecule
is a time-consuming and difficult process or even impossible if the
compound does not naturally occur in the respective plant, as is
the case with polyunsaturated C.sub.18-, C.sub.20-fatty acids and
C.sub.22-fatty acids and those having longer carbon chains.
[0014] Owing to the positive properties of unsaturated fatty acids,
there has been no lack of attempts in the past to make available
these genes which are involved in the synthesis of fatty acids or
triglycerides for the production of oils in various plants with a
modified content of polyunsaturated fatty acids. Previously,
however, it was not possible to produce longer-chain
polyunsaturated C.sub.20- and/or C.sub.22-fatty acids such as EPA
or ARA in plants.
[0015] However, in other organisms as well as microorganisms such
as algae or fungi too, genetically engineered modifications of the
fatty acid metabolic pathway via introducing and expressing, for
example, desaturases resulted only in relatively small increases in
productivity in these organisms. One reason for this may be the
high complexity of the fatty acid metabolism. Thus, incorporation
of polyunsaturated fatty acids into membrane lipids and/or into
triacylglycerides and their degradation and conversion are very
complex and, even now, has still not been fully elucidated and
understood biochemically and, especially genetically.
[0016] The biosynthesis of LCPUFAs and incorporation of LCPUFAs
into membranes or triacylglycerides are carried out via various
metabolic pathways (Abbadi et al. (2001) European Journal of Lipid
Science & Technology 103:106-113). In bacteria such as Vibrio
and microalgae such as Schizochytrium, malonyl-CoA is converted via
a LCPUFA-producing polyketide synthase to give LCPUFAs (Metz et al.
(2001) Science 293: 290-293; WO 00/42195; WO 98/27203; WO
98/55625). In microalgae such as Phaeodactylum and mosses such as
Physcomitrella, unsaturated fatty acids such as linoleic acid or
linolenic acid are converted in the form of their acyl-CoAs in
multiple desaturation and elongation steps to give LCPUFAs (Zank et
al. (2000) Biochemical Society Transactions 28: 654-658). In
mammals, the biosynthesis of DHA includes .beta.oxidation, in
addition to desaturation and elongation steps.
[0017] In microorganisms and lower plants, LCPUFAs are present
either exclusively in the form of membrane lipids, as is the case
in Physcomitrella and Phaeodactylum, or in membrane lipids and
triacylglycerides, as is the case in Schizochytrium and
Mortierella. Incorporation of LCPUFAs into lipids and oils is
catalyzed by various acyltransferases and transacylases. These
enzymes are already known to carry out the incorporation of
saturated and unsaturated fatty acids [Slabas (2001) J. Plant
Physiology 158: 505-513; Frentzen (1998) Fett/Lipid 100: 161-166);
Cases et al. (1998) Proc. Nat. Acad. Sci. USA 95: 13018-13023]. The
acyltransferases are enzymes of the "Kennedy pathway", which are
located on the cytoplasmic side of the membrane system of the
endoplasmic reticulum, referred to as "ER" hereinbelow. ER
membranes may be isolated experimentally as "microsomal fractions"
from various organisms (Knutzon et al. (1995) Plant Physiology 109:
999-1006; Mishra & Kamisaka (2001) Biochemistry 355: 315-322;
U.S. Pat. No. 5,968,791). These ER-bound acyltransferases in the
microsomal fraction use acyl-CoA as the activated form of fatty
acids. Glycerol-3-phosphate acyltransferase, referred to as GPAT
hereinbelow, catalyzes the incorporation of acyl groups at the sn-1
position of glycerol 3-phosphate. 1-Acylglycerol-3-phosphate
acyltransferase (E.C. 2.3.1.51), also known as
lysophosphatidic-acid acyltransferase and referred to as LPAAT
hereinbelow, catalyzes the incorporation of acyl groups at the sn-2
position of lysophosphatidic acid, abbreviated as LPA hereinbelow.
After dephosphorylation of phosphatidic acid by phosphatidic-acid
phosphatase, diacylglycerol acyltransferase, referred to as DAGAT
hereinbelow, catalyzes the incorporation of acyl groups at the sn-3
position of diacylglycerols. Apart from these Kennedy pathway
enzymes, further enzymes capable of incorporating acyl groups from
membrane lipids into triacylglycerides are involved in the
incorporation of fatty acids into triacylglycerides, namely
phospholipid diacylglycerol acyltransferase, referred to as PDAT
hereinbelow, and lysophosphatidylcholine acyltransferase, referred
to as LPCAT.
[0018] The enzymic activity of an LPCAT was first described in rats
[Land (1960) Journal of Biological Chemistry 235: 2233-2237]. A
plastic LPCAT isoform [Akermoun et al. (2000) Biochemical Society
Transactions 28: 713-715] and an ER-bound isoform [Tumaney and
Rajasekharan (1999) Biochimica et Biophysica Acta 1439: 47-56;
Fraser and Stobart, Biochemical Society Transactions (2000) 28:
715-7718] exist in plants. LPCAT is involved in the biosynthesis
and transacylation of polyunsaturated fatty acids in animals as
well as in plants [Stymne and Stobart (1984) Biochem. J. 223:
305-314; Stymne and Stobart (1987) in `The Biochemistry of Plants:
a Comprehensive Treatise`, Vol. 9 (Stumpf, P. K. ed.) pp. 175-214,
Academic Press, New York]. An important function of LPCAT or, more
generally, of an acyl-CoA:lysophospholipid acyltransferase,
referred to as LPLAT hereinbelow, in the ATP-independent synthesis
of acyl-CoA from phospholipids has been described by Yamashita et
al. (2001; Journal of Biological Chemistry 276: 26745-26752).
[0019] Despite many biochemical data, no genes coding for LPCAT
have been identified previously. Genes of various other plant
acyltransferases have been isolated and are described in WO
00/18889 (Novel Plant Acyltransferases).
[0020] Higher plants comprise polyunsaturated fatty acids such as
linoleic acid (C18:2) and linolenic acid (C18:3). Arachidonic acid
(ARA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
are, as described above, found not at all in the seed oil of higher
plants, or only in traces (E. Ucciani: Nouveau Dictionnaire des
Huiles Vegetales. Technique & Documentation--Lavoisier, 1995.
ISBN: 2-7430-0009-0). It is advantageous to produce LCPUFAs in
higher plants, preferably in oil seeds such as oilseed rape,
linseed, sunflower and soybean, since large amounts of high-quality
LCPUFAs for the food industry, animal nutrition and pharmaceutical
purposes may be obtained at low costs in this way. To this end, it
is advantageous to introduce into and express in oil seeds genes
coding for enzymes of the biosynthesis of LCPUFAs by genetic
engineering methods. Said genes encode, for example,
.DELTA.6-desaturase, .DELTA.6-elongase, .DELTA.5-desaturase,
.DELTA.5-elongase and .DELTA.4-desaturase. These genes may
advantageously be isolated from microorganisms, animals and lower
plants which produce LCPUFAs and incorporate them in the membranes
or triacylglycerides. Thus, .DELTA.6-desaturase genes have already
been isolated from the moss Physcomitrella patens and
.DELTA.6-elongase genes have already been isolated from P. patens
and the nematode C. elegans.
[0021] First transgenic plants which comprise and express genes
coding for enzymes of the LCPUFA biosynthesis and produce LCPUFAs
have been described for the first time, for example, in DE 102 19
203 (process for the production of polyunsaturated fatty acids in
plants). However, these plants produce LCPUFAs in amounts which
require further optimization for processing the oils present in
said plants.
[0022] In order to enable food and feed to be enriched with these
polyunsaturated fatty acids, there is therefore a great need for a
simple, inexpensive process for producing said polyunsaturated
fatty acids, especially in eukaryotic systems.
BRIEF SUMMARY OF THE INVENTION
[0023] It was therefore the object to develop a process for
producing polyunsaturated fatty acids in a eukaryotic organism.
This object was achieved by the process according to the invention
for producing polyunsaturated fatty acids in an organism, wherein
said process comprises the following steps: [0024] a) introducing
into the organism at least one nucleic acid sequence having the
sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or
SEQ ID NO: 7, which sequence codes for a polypeptide having an
acyl-CoA:lysophospholipid-acyltransferase activity; or [0025] b)
introducing into said organism at least one nucleic acid sequence
which can be derived, as a result of the degenerated genetic code,
from the coding sequence comprised in SEQ ID NO: 1, SEQ ID NO: 3,
SEQ ID NO: 5 or SEQ ID NO: 7, or [0026] c) introducing into said
organism at least one derivative of the nucleic acid sequence
depicted in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO:
7, which code for polypeptides having the amino acid sequence
depicted in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO:
8 and which are at least 40% homologous at the amino acid level to
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 and have
an equivalent acyl-CoA:lysophospholipid-acyltransferase activity,
and [0027] d) culturing and harvesting said organism.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 shows the amino acid sequence comparison of C.
elegans LPLATs (Ce-T06E8.1, SEQ ID NO: 36, and Ce-F59F4.4, SEQ ID
NO: 59) with M. musculus LPAAT (Mm-NP061350, SEQ ID NO: 58).
[0029] FIG. 2 shows the fatty acid profiles of transgenic C13ABYS86
S. cerevisiae cells.
[0030] FIG. 3 shows the fatty acid profiles of transgenic C13ABYS86
S. cerevisiae cells.
[0031] FIG. 4 shows the elongation of exogenously applied
18:2.sup..DELTA.9,12 and 18:3.sup..DELTA.9,12, 15, following their
endogenous .DELTA.6-desaturation (data of FIGS. 2 and 3).
[0032] FIG. 5 shows the fatty acid profiles of transgenic INVSc1 S.
cerevisiae cells.
[0033] FIG. 6 shows the fatty acid profiles of transgenic INVSc1 S.
cerevisiae cells.
[0034] FIG. 7 shows the acyl-CoA composition of transgenic INVSc1
yeasts transformed with the vectors pESCLeu PpD6Pse1/pYes2 (A) or
pESCLeu-PpD6-Pse1/pYes2-T06E8.1 (B).
[0035] FIG. 8 shows the vector map of pSUN3CeLPLAT.
[0036] FIG. 9A shows the vector map of pGPTVLeB4-700+T06E8.1.
[0037] FIG. 9B shows the vector map of pGPTVUSP/OCS-1,2,3
PSE1(Pp)+D6-Des(Pt)+2AT (T06E8-1).
[0038] FIG. 10A shows the biosynthetic pathway of LCPUFAs.
[0039] FIG. 10B shows the biosynthetic pathway of LCPUFAs.
DETAILED DESCRIPTION OF THE INVENTION
[0040] Advantageously, the polyunsaturated fatty acids produced in
the process of the invention comprise at least two, advantageously
three, double bonds. The fatty acids particularly advantageously
comprise four or five double bonds. Fatty acids produced in the
process advantageously have 16, 18, 20 or 22 carbon atoms in the
fatty acid chain. These fatty acids which have been produced may be
produced in said process as a single product or be present in a
fatty acid mixture.
[0041] The nucleic acid sequences used in the process of the
invention are isolated nucleic acid sequences which code for
polypeptides having acyl-CoA:lysophospholipid-acyltransferase
activity.
[0042] The polyunsaturated fatty acids produced in the process are
advantageously bound in membrane lipids and/or triacylglycerides
but may also occur in the organisms as free fatty acids or else
bound in the form of other fatty acid esters. In this context, they
may be present as "pure products" or else advantageously in the
form of mixtures of various fatty acids or mixtures of different
glycerides. The various fatty acids bound in the triacylglycerides
can be derived here from short-chain fatty acids having from 4 to 6
carbon atoms, medium-chain fatty acids having from 8 to 12 carbon
atoms or long-chain fatty acids having from 14 to 24 carbon atoms,
with preference being given to the long-chain fatty acids and
particular preference being given to the long-chain fatty acids,
LCPUFAs, of C.sub.18-, C.sub.20- and/or C.sub.22-fatty acids.
[0043] The process of the invention advantageously produces fatty
acid esters with polyunsaturated C.sub.16-, C.sub.18-, C.sub.20-
and/or C.sub.22-fatty acid molecules, with at least two double
bonds being present in the fatty acid ester. These fatty acid
molecules preferably comprise three, four or five double bonds and
advantageously lead to the synthesis of hexadecadienoic acid,
(C16:2.sup..DELTA.9,12), .gamma.-linolenic acid (=GLA,
C18:3.sup..DELTA.6,9,12), stearidonic acid (=SDA,
C18:4.sup..DELTA.6,9,12,15), dihomo-.gamma.-linolenic acid (=DGLA,
20:3.sup..DELTA.8,11,14), eicosatetraenoic acid (=ETA,
C20:4.sup..DELTA.5,8,11,14), arachidonic acid (ARA),
eicosapentaenoic acid (EPA) or mixtures thereof, preferably EPA
and/or ARA.
[0044] The fatty acid esters with polyunsaturated C.sub.16-,
C.sub.18-, C.sub.20- and/or C.sub.22-fatty acid molecules can be
isolated in the form of an oil or lipid, for example in the form of
compounds such as sphingolipids, phosphoglycerides, lipids,
glycolipids such as glycosphingolipid, phospholipids such as
phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine,
phosphatidylglycerol, phosphatidylinositol or
diphosphatidylglycerol, monoacylglycerides, diacylglycerides,
triacylglycerides or other fatty acid esters such as the
acetyl-coenzyme A esters which comprise the polyunsaturated fatty
acids with at least two, preferably three double bonds, from the
organisms which have been used for the preparation of the fatty
acid esters. In addition to these esters, the polyunsaturated fatty
acids are also present in the organisms, advantageously the plants
as free fatty acids or bound in other compounds. As a rule, the
various abovementioned compounds (fatty acid esters and free fatty
acids) are present in the organisms with an approximate
distribution of 80 to 90% by weight of triglycerides, 2 to 5% by
weight of diglycerides, 5 to 10% by weight of monoglycerides, 1 to
5% by weight of free fatty acids, 2 to 8% by weight of
phospholipids, the total of the various compounds amounting to 100%
by weight.
[0045] The process according to the invention yields the LCPUFAs
produced in a content of at least 3% by weight, advantageously at
least 5% by weight, preferably at least 8% by weight, especially
preferably at least 10% by weight, most preferably at least 15% by
weight, based on the total fatty acids in the transgenic organisms,
preferably in a transgenic plant. Since a plurality of reaction
steps are performed by the starting compounds hexadecadienoic acid
(C16:2), linoleic acid (C18:2) and linolenic acid (C18:3) in the
process according to the invention, the end products of the process
such as, for example, arachidonic acid (ARA) or eicosapentaenoic
acid (EPA) are not obtained as absolutely pure products; minor
traces of the precursors are always present in the end product. If,
for example, both linoleic acid and linolenic acid are present in
the starting organism and the starting plant, the end products such
as ARA and EPA are present as mixtures. The precursors should
advantageously not amount to more than 20% by weight, preferably
not to more than 15% by weight, especially preferably not to more
than 10% by weight, most preferably not to more than 5% by weight,
based on the amount of the end product in question. Advantageously,
only ARA or only EPA, bound or as free acids, are produced as end
products in a transgenic plant owing to the process according to
the invention. If both compounds (ARA and EPA) are produced
simultaneously, they are advantageously produced in a ratio of at
least 1:2 (EPA:ARA), advantageously of at least 1:3, preferably
1:4, especially preferably 1:5.
[0046] Owing to the nucleic acid sequences according to the
invention, an increase in the yield of polyunsaturated fatty acids
of at least 50%, advantageously of at least 80%, especially
advantageously of at least 100%, very especially advantageously of
at least 150%, in comparison with the nontransgenic starting
organism, can be obtained by comparison in GC analysis (see
examples).
[0047] Chemically pure polyunsaturated fatty acids or fatty acid
compositions can also be synthesized by the processes described
above. To this end, the fatty acids or the fatty acid compositions
are isolated from the organism, such as the microorganisms or the
plants or the culture medium in or on which the organisms have been
grown, or from the organism and the culture medium, in the known
manner, for example via extraction, distillation, crystallization,
chromatography or combinations of these methods. These chemically
pure fatty acids or fatty acid compositions are advantageous for
applications in the food industry sector, the cosmetics sector and
especially the pharmacological industry sector.
[0048] Suitable organisms for the production in the process
according to the invention are, in principle, any organisms such as
fungi, such as Mortierella or Thraustrochytrium, yeasts such as
Saccharomyces or Schizosaccharomyces, mosses such as Physcomitrella
or Ceratodon, nonhuman animals such as Caenorhabditis, algae such
as Crypthecodinium or Phaeodactylum or plants such as
dicotyledonous or monocotyledonous plants. Organisms which are
especially advantageously used in the process according to the
invention are organisms which belong to the oil-producing
organisms, that is to say which are used for the production of
oils, such as fungi, such as Mortierella or Thraustochytrium, algae
such as Crypthecodinium, Phaeodactylum, or plants, in particular
plants, preferably oil crop plants which comprise large amounts of
lipid compounds, such as peanut, oilseed rape, canola, sunflower,
safflower, poppy, mustard, hemp, castor-oil plant, olive, sesame,
Calendula, Punica, evening primrose, verbascum, thistle, wild
roses, hazelnut, almond, macadamia, avocado, bay, pumpkin/squash,
linseed, soybean, pistachios, borage, trees (oil palm, coconut or
walnut) or arable crops such as maize, wheat, rye, oats, triticale,
rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants
such as potato, tobacco, eggplant and tomato, Vicia species, pea,
alfalfa or bushy plants (coffee, cacao, tea), Salix species, and
perennial grasses and fodder crops. Preferred plants according to
the invention are oil crop plants such as peanut, oilseed rape,
canola, sunflower, safflower, poppy, mustard, hemp, castor-oil
plant, olive, Calendula, Punica, evening primrose, pumpkin/squash,
linseed, soybean, borage, trees (oil palm, coconut). Especially
preferred are plants which are high in C18:2- and/or C18:3-fatty
acids, such as sunflower, safflower, tobacco, verbascum, sesame,
cotton, pumpkin/squash, poppy, evening primrose, walnut, linseed,
hemp, thistle or safflower. Very especially preferred plants are
plants such as safflower, sunflower, poppy, evening primrose,
walnut, linseed or hemp.
[0049] It is advantageous to the inventive process described to
introduce, in addition to the nucleic acids introduced in steps (a)
to (c) of the process, further nucleic acids which encode enzymes
of the fatty acid or lipid metabolism.
[0050] In principle, all genes of the fatty acid or lipid
metabolism can be used in the process for the production of
polyunsaturated fatty acids, advantageously in combination with the
inventive acyl-CoA:lysophospholipid acyltransferase. Genes of the
fatty acid or lipid metabolism selected from the group consisting
of acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein]
desaturase(s), acyl-ACP thioesterase(s), fatty acid
acyltransferase(s), fatty acid synthase(s), fatty acid
hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A
oxidase(s), fatty acid desaturase(s), fatty acid acetylenases,
lipoxygenases, triacylglycerol lipases, allenoxide synthases,
hydroperoxide lyases or fatty acid elongase(s) are advantageously
used in combination with the acyl-CoA:lysophospholipid
acyltransferase. Genes selected from the group of the
.DELTA.4-desaturases, .DELTA.5-desaturases, .DELTA.6-desaturases,
.DELTA.8-desaturases, .DELTA.9-desaturases, .DELTA.12-desaturases,
.DELTA.5-elongases, .DELTA.6-elongases or .DELTA.9-elongases are
especially preferably used in combination with the
acyl-CoA:lysophospholipid acyltransferase in the process of the
invention.
[0051] Owing to the enzymatic activity of the nucleic acids used in
the process according to the invention which encode polypeptides
with acyl-CoA:lysophospholipid acyltransferase activity,
advantageously in combination with nucleic acid sequences which
encode polypeptides of the fatty acid or lipid metabolism, such as
.DELTA.4-, .DELTA.5-, .DELTA.6-, .DELTA.8-desaturase or .DELTA.5-,
.DELTA.6- or .DELTA.9-elongase activity, a wide range of
polyunsaturated fatty acids can be produced in the process
according to the invention. Depending on the choice of the
organisms, such as the advantageous plants, used for the process
according to the invention, mixtures of the various polyunsaturated
fatty acids or individual polyunsaturated fatty acids, such as EPA
or ARA, can be produced in free or bound form. Depending on the
prevailing fatty acid composition in the starting plant (C18:2- or
C18:3-fatty acids), fatty acids which are derived from C18:2-fatty
acids, such as GLA, DGLA or ARA, or fatty acids which are derived
from C18:3-fatty acids, such as SDA, ETA or EPA, are thus obtained.
If only linoleic acid (=LA, C18:2.sup..DELTA.9,12) is present as
unsaturated fatty acid in the plant used for the process, the
process can only afford GLA, DGLA and ARA as products, all of which
can be present as free fatty acids or in bound form. If only
.alpha.-linolenic acid (=ALA, C18:3.sup..DELTA.9,12,15) is present
as unsaturated fatty acid in the plant used for the process, as is
the case, for example, in linseed, the process can only afford SDA,
ETA and EPA as products, all of which can be present as free fatty
acids or in bound form, as described above. Owing to the
modification of the activity of the enzymes involved in the
synthesis, acyl-CoA:lysophospholipid acyltransferase,
advantageously in combination with .DELTA.5-, .DELTA.6-desaturase
and .DELTA.6-elongase or with .DELTA.5-.DELTA.8-desaturase and
.DELTA.9-elongase or in combination with only the first two genes,
.DELTA.6-desaturase and .DELTA.6-elongase or .DELTA.8-desaturase
and .DELTA.9-elongase, of the synthesis cascade, it is possible to
produce, in a targeted fashion, only individual products in the
abovementioned organisms, advantageously in the abovementioned
plants. Owing to the activity of .DELTA.6-desaturase and
.DELTA.6-elongase, for example, GLA and DGLA, or SDA and ETA, are
formed, depending on the starting plant and unsaturated fatty acid.
DGLA or ETA or mixtures of these are preferably formed. If
.DELTA.5-desaturase is additionally introduced into the organisms,
advantageously into the plant, ARA or EPA is additionally formed.
This also applies to organisms into which .DELTA.8-desaturase and
.DELTA.9-elongase have been introduced previously. Advantageously,
only ARA or EPA or mixtures of these are synthesized, depending on
the fatty acid present in the organism, or in the plant, which acts
as starting substance for the synthesis. Since biosynthetic
cascades are involved, the end products in question are not present
in pure form in the organisms. Small amounts of the precursor
compounds are always additionally present in the end product. These
small amounts amount to less than 20% by weight, advantageously
less than 15% by weight, especially advantageously less than 10% by
weight, most advantageously less than 5, 4, 3, 2 or 1% by weight,
based on the end products DGLA, ETA or their mixtures, or ARA, EPA
or their mixtures.
[0052] To increase the yield in the above-described process for the
production of oils and/or triglycerides with an advantageously
elevated content of polyunsaturated fatty acids, it is advantageous
to increase the amount of starting product for the synthesis of
fatty acids; this can be achieved for example by introducing, into
the organism, a nucleic acid which encodes a polypeptide with
.DELTA.12-desaturase activity.
[0053] This is particularly advantageous in oil-producing organisms
such as oilseed rape which are high in oleic acid. Since these
organisms are only low in linoleic acid (Mikoklajczak et al.,
Journal of the American Oil Chemical Society, 38, 1961, 678-681),
the use of the abovementioned .DELTA.12-desaturases for producing
the starting material linoleic acid is advantageous.
[0054] Nucleic acids used in the process according to the invention
are advantageously derived from plants such as algae such as
Isochrysis or Crypthecodinium, algae/diatoms such as Phaeodactylum,
mosses such as Physcomitrella or Ceratodon, or higher plants such
as the Primulaceae such as Aleuritia, Calendula stellata,
Osteospermum spinescens or Osteospermum hyoseroides, microorganisms
such as fungi, such as Aspergillus, Thraustochytrium, Phytophthora,
Entomophthora, Mucor or Mortierella, yeasts or animals such as
nematodes such as Caenorhabditis, insects or humans. The nucleic
acids are advantageously derived from fungi, animals, or from
plants such as algae or mosses, preferably from nematodes such as
Caenorhabditis.
[0055] The process according to the invention advantageously
employs the abovementioned nucleic acid sequences or their
derivatives or homologs which encode polypeptides which retain the
enzymatic activity of the proteins encoded by nucleic acid
sequences. These sequences, individually or in combination with the
nucleic acid sequence which encode acyl-CoA:lysophospholipid
acyltransferase, are cloned into expression constructs and used for
the introduction into, and expression in, organisms. Owing to their
construction, these expression constructs make possible an
advantageous optimal synthesis of the polyunsaturated fatty acids
produced in the process according to the invention.
[0056] In a preferred embodiment, the process furthermore comprises
the step of obtaining a cell or an intact organism which comprises
the nucleic acid sequences used in the process, where the cell
and/or the organism is transformed with the nucleic acid sequence
according to the invention which encodes the
acyl-CoA:lysophospholipid acyltransferase, a gene construct or a
vector as described above, alone or in combination with further
nucleic acid sequences which encode proteins of the fatty acid or
lipid metabolism. In a further preferred embodiment, this process
furthermore comprises the step of obtaining the fine chemical from
the culture. The culture can, for example, take the form of a
fermentation culture, for example in the case of the cultivation of
microorganisms, such as, for example, Mortierella, Saccharomyces or
Thraustochytrium, or a greenhouse- or field-grown culture of a
plant. The cell or the organism produced thus is advantageously a
cell of an oil-producing organism, such as an oil crop, such as,
for example, peanut, oilseed rape, canola, linseed, hemp, soybean,
safflower, sunflowers or borage.
[0057] In the case of plant cells, plant tissue or plant organs,
"growing" is understood as meaning, for example, the cultivation on
or in a nutrient medium, or of the intact plant on or in a
substrate, for example in a hydroponic culture, potting compost or
on arable land.
[0058] For the purposes of the invention, "transgenic" or
"recombinant" means with regard to, for example, a nucleic acid
sequence, an expression cassette (=gene construct) or a vector
comprising the nucleic acid sequence or an organism transformed
with the nucleic acid sequences, expression cassette or vector
according to the invention, all those constructions brought about
by recombinant methods in which either [0059] a) the nucleic acid
sequence according to the invention, or [0060] b) a genetic control
sequence which is operably linked with the nucleic acid sequence
according to the invention, for example a promoter, or [0061] c)
(a) and (b) are not located in their natural genetic environment or
have been modified by recombinant methods, it being possible for
the modification to take the form of, for example, a substitution,
addition, deletion, inversion or insertion of one or more
nucleotide residues. The natural genetic environment is understood
as meaning the natural genomic or chromosomal locus in the original
organism or the presence in a genomic library. In the case of a
genomic library, the natural genetic environment of the nucleic
acid sequence is preferably retained, at least in part. The
environment flanks the nucleic acid sequence at least on one side
and has a sequence length of at least 50 bp, preferably at least
500 bp, especially preferably at least 1000 bp, most preferably at
least 5000 bp. A naturally occurring expression cassette--for
example the naturally occurring combination of the natural promoter
of the inventive nucleic acid sequence with the corresponding
acyl-CoA:lysophospholipid acyltransferase gene--becomes a
transgenic expression cassette when this expression cassette is
modified by non-natural, synthetic ("artificial") methods such as,
for example, mutagenic treatment. Suitable methods are described,
for example, in U.S. Pat. No. 5,565,350 or WO 00/15815.
[0062] A transgenic organism or transgenic plant for the purposes
of the invention is understood as meaning, as above, that the
nucleic acids used in the process are not at their natural locus in
the genome of an organism, it being possible for the nucleic acids
to be expressed homologously or heterologously. However, as
mentioned, transgenic also means that, while the nucleic acids
according to the invention are at their natural position in the
genome of an organism, the sequence has been modified with regard
to the natural sequence, and/or that the regulatory sequences of
the natural sequences have been modified. Transgenic is preferably
understood as meaning the expression of the nucleic acids according
to the invention at an unnatural locus in the genome, i.e.
homologous or, preferably, heterologous expression of the nucleic
acids takes place. Preferred transgenic organisms are fungi such as
Mortierella or plants such as the oil crops.
[0063] Organisms or host organisms for the nucleic acids, the
expression cassette or the vector used in the process according to
the invention are, in principle, advantageously all organisms which
are capable of synthesizing fatty acids, specifically unsaturated
fatty acids, and/or which are suitable for the expression of
recombinant genes. Examples which may be mentioned are plants such
as Arabidopsis, Asteraceae such as Calendula or crop plants such as
soybean, peanut, castor-oil plant, sunflower, maize, cotton, flax,
oilseed rape, coconut, oil palm, safflower (Carthamus tinctorius)
or cacao bean, microorganisms, such as fungi, for example the genus
Mortierella, Saprolegnia, or Pythium, bacteria, such as the genus
Escherichia, yeasts, such as the genus Saccharomyces,
cyanobacteria, ciliates, algae or protozoans such as
dinoflagellates, such as Crypthecodinium. Preferred organisms are
those which are naturally capable of synthesizing substantial
amounts of oil, such as fungi, such as Mortierella alpina, Pythium
insidiosum, or plants such as soybean, oilseed rape, coconut, oil
palm, safflower, flax, hemp, castor-oil plant, Calendula, peanut,
cacao bean or sunflower, or yeasts such as Saccharomyces cerevisiae
with soybean, flax, oilseed rape, safflower, sunflower, Calendula,
Mortierella or Saccharomyces cerevisiae being especially preferred.
In principle, host organisms are, in addition to the abovementioned
transgenic organisms, also transgenic animals, advantageously
nonhuman animals, for example C. elegans.
[0064] Further utilizable host cells are detailed in: Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990).
[0065] Expression strains which can be used, for example those with
a lower protease activity, are described in: Gottesman, S., Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. (1990) 119-128.
[0066] These include plant cells and certain tissues, organs and
parts of plants in all their phenotypic forms such as anthers,
fibers, root hairs, stalks, embryos, calli, cotyledons, petioles,
harvested material, plant tissue, reproductive tissue and cell
cultures which are derived from the actual transgenic plant and/or
can be used for bringing about the transgenic plant.
[0067] Transgenic plants which comprise the polyunsaturated fatty
acids synthesized in the process according to the invention can
advantageously be marketed directly without there being any need
for the oils, lipids or fatty acids synthesized to be isolated.
Plants for the process according to the invention are listed as
meaning intact plants and all plant parts, plant organs or plant
parts such as leaf, stem, seeds, root, tubers, anthers, fibers,
root hairs, stalks, embryos, calli, cotyledons, petioles, harvested
material, plant tissue, reproductive tissue and cell cultures which
are derived from the actual transgenic plant and/or can be used for
bringing about the transgenic plant. In this context, the seed
comprises all parts of the seed such as the seed coats, epidermal
cells, seed cells, endosperm or embryonic tissue. However, the
compounds produced in the process according to the invention can
also be isolated from the organisms, advantageously plants, in the
form of their oils, fat, lipids and/or free fatty acids.
Polyunsaturated fatty acids produced by this process can be
obtained by harvesting the organisms, either from the crop in which
they grow, or from the field. This can be done via pressing or
extraction of the plant parts, preferably the plant seeds. In this
context, the oils, fats, lipids and/or free fatty acids can be
obtained by what is known as cold-beating or cold-pressing without
applying heat by pressing. To allow for greater ease of disruption
of the plant parts, specifically the seeds, they are previously
comminuted, steamed or roasted. The seeds which have been
pretreated in this manner can subsequently be pressed or extracted
with solvents such as warm hexane. The solvent is subsequently
removed. In the case of microorganisms, the latter are, after
harvesting, for example extracted directly without further
processing steps or else, after disruption, extracted via various
methods with which the skilled worker is familiar. In this manner,
more than 96% of the compounds produced in the process can be
isolated. Thereafter, the resulting products are processed further,
i.e. refined. In this process, substances such as the plant
mucilages and suspended matter are first removed. What is known as
desliming can be effected enzymatically or, for example,
chemico-physically by addition of acid such as phosphoric acid.
Thereafter, the free fatty acids are removed by treatment with a
base, for example sodium hydroxide solution. The resulting product
is washed thoroughly with water to remove the alkali remaining in
the product and then dried. To remove the pigments remaining in the
product, the products are subjected to bleaching, for example using
filler's earth or active charcoal. At the end, the product is
deodorized, for example using steam.
[0068] The PUFAs or LCPUFAs produced by this process are
advantageously C.sub.18-, C.sub.20- or C.sub.22-fatty acid
molecules with at least two double bonds in the fatty acid
molecule, preferably three, four, five or six double bonds. These
C.sub.18-, C.sub.20- or C.sub.22-fatty acid molecules can be
isolated from the organism in the form of an oil, a lipid or a free
fatty acid. Suitable organisms are, for example, those mentioned
above. Preferred organisms are transgenic plants.
[0069] One embodiment of the invention is therefore oils, lipids or
fatty acids or fractions thereof which have been produced by the
above-described process, especially preferably oil, lipid or a
fatty acid composition comprising PUFAs and being derived from
transgenic plants.
[0070] A further embodiment according to the invention is the use
of the oil, lipid, the fatty acids and/or the fatty acid
composition in feedstuffs, foodstuffs, cosmetics or
pharmaceuticals.
[0071] The term "oil", "lipid" or "fat" is understood as meaning a
fatty acid mixture comprising unsaturated or saturated, preferably
esterified, fatty acid(s). The oil, lipid or fat is preferably high
in polyunsaturated free or, advantageously, esterified fatty
acid(s), in particular linoleic acid, .gamma.-linolenic acid,
dihomo-.gamma.-linolenic acid, arachidonic acid, .alpha.-linolenic
acid, stearidonic acid, eicosatetraenoic acid, eicosapentaenoic
acid, docosapentaenoic acid or docosahexaenoic acid. The content of
unsaturated esterified fatty acids preferably amounts to
approximately 30%, a content of 50% is more preferred, a content of
60%, 70%, 80% or more is even more preferred. For the analysis, the
fatty acid content can, for example, be determined by gas
chromatography after converting the fatty acids into the methyl
esters by transesterification. The oil, lipid or fat can comprise
various other saturated or unsaturated fatty acids, for example
calendulic acid, palmitic acid, palmitoleic acid, stearic acid,
oleic acid and the like. The content of the various fatty acids in
the oil or fat can vary, in particular depending on the starting
organism.
[0072] The polyunsaturated fatty acids with advantageously at least
two double bonds which are produced in the process are, as
described above, for example sphingolipids, phosphoglycerides,
lipids, glycolipids, phospholipids, monoacylglycerol,
diacylglycerol, triacylglycerol or other fatty acid esters.
[0073] Starting from the polyunsaturated fatty acids with
advantageously at least two double bonds, which acids have been
prepared in the process according to the invention, the
polyunsaturated fatty acids which are present can be liberated for
example via treatment with alkali, for example aqueous KOH or NaOH,
or acid hydrolysis, advantageously in the presence of an alcohol
such as methanol or ethanol, or via enzymatic cleavage, and
isolated via, for example, phase separation and subsequent
acidification via, for example, H.sub.2SO.sub.4. The fatty acids
can also be liberated directly without the above-described
processing step.
[0074] After their introduction into an organism, advantageously a
plant cell or plant, the nucleic acids used in the process can
either be present on a separate plasmid or integrated into the
genome of the host cell. In the case of integration into the
genome, integration can be random or else be effected by
recombination such that the native gene is replaced by the copy
introduced, whereby the production of the desired compound by the
cell is modulated, or by the use of a gene in trans, so that the
gene is linked operably with a functional expression unit which
comprises at least one sequence which ensures the expression of a
gene and at least one sequence which ensures the polyadenylation of
a functionally transcribed gene. The nucleic acids are
advantageously introduced into the organisms via multiexpression
cassettes or constructs for multiparallel expression,
advantageously into the plants for the multiparallel seed-specific
expression of genes.
[0075] Mosses and algae are the only known plant systems which
produce substantial amounts of polyunsaturated fatty acids such as
arachidonic acid (ARA) and/or eicosapentaenoic acid (EPA) and/or
docosahexaenoic acid (DHA). Mosses comprise PUFAs in membrane
lipids, while algae, organisms which are related to algae and a few
fungi also accumulate substantial amounts of PUFAs in the
triacylglycerol fraction. This is why nucleic acid molecules which
are isolated from such strains which also accumulate PUFAs in the
triacylglycerol fraction are particularly advantageous for the
process according to the invention and thus for the modification of
the lipid and PUFA production system in a host, in particular
plants such as oil crops, for example oilseed rape, canola,
linseed, hemp, soybeans, sunflowers and borage. They can therefore
be used advantageously in the process according to the
invention.
[0076] Substrates of the acyl-CoA:lysophospholipid
acyltransferase(s) which are advantageously used are C.sub.16-,
C.sub.18-, C.sub.20- or C.sub.22-fatty acids.
[0077] To produce the long-chain PUFAs according to the invention,
the polyunsaturated C.sub.16- or C.sub.18-fatty acids must first be
desaturated by the enzymatic activity of a desaturase and
subsequently be elongated by at least two carbon atoms via an
elongase. After one elongation cycle, this enzyme activity gives
C.sub.18- or C.sub.20-fatty acids and after two or three elongation
cycles C.sub.22- or C.sub.24-fatty acids. The activity of the
desaturases and elongases used in the process according to the
invention preferably leads to C.sub.18-, C.sub.20- and/or
C.sub.22-fatty acids, advantageously with at least two double bonds
in the fatty acid molecule, preferably with three, four or five
double bonds, especially preferably to give C.sub.20- and/or
C.sub.22-fatty acids with at least two double bonds in the fatty
acid molecule, preferably with three, four or five double bonds in
the molecule. After a first desaturation and the elongation have
taken place, further desaturation steps such as, for example, one
in the .DELTA.5 position may take place. Products of the process
according to the invention which are especially preferred are
dihomo-.gamma.-linolenic acid, arachidonic acid, eicosapentaenoic
acid, docosapentaenoic acid and/or docosahexaenoic acid. The
C.sub.18-fatty acids with at least two double bonds in the fatty
acid can be elongated by the enzymatic activity according to the
invention in the form of the free fatty acid or in the form of the
esters, such as phospholipids, glycolipids, sphingolipids,
phosphoglycerides, monoacylglycerol, diacylglycerol or
triacylglycerol.
[0078] The preferred biosynthesis site of the fatty acids, oils,
lipids or fats in the plants which are advantageously used is, for
example, in general the seed or cell strata of the seed, so that
seed-specific expression of the nucleic acids used in the process
makes sense. However, it is obvious that the biosynthesis of fatty
acids, oils or lipids need not be limited to the seed tissue, but
can also take place in a tissue-specific manner in all the other
parts of the plant, for example in epidermal cells or in the
tubers.
[0079] If microorganisms such as yeasts, such as Saccharomyces or
Schizosaccharomyces, fungi such as Mortierella, Aspergillus,
Phytophtora, Entomophthora, Mucor or Thraustochytrium, algae such
as Isochrysis, Phaeodactylum or Crypthecodinium are used as
organisms in the process according to the invention, these
organisms are advantageously grown in fermentation cultures.
[0080] Owing to the use of the nucleic acids according to the
invention which encode acyl-CoA:lysophospholipid
acyltransferase(s), the polyunsaturated fatty acids produced in the
process can be increased by at least 10%, preferably by at least
15%, especially preferably by at least 20%, very especially
preferably by at least 50% in comparison with the wild type of the
organisms which do not comprise the nucleic acids
recombinantly.
[0081] In principle, the polyunsaturated fatty acids produced by
the process according to the invention in the organisms used in the
process can be increased in two different ways. Advantageously, the
pool of free polyunsaturated fatty acids and/or the content of the
esterified polyunsaturated fatty acids produced via the process can
be enlarged. Advantageously, the pool of esterified polyunsaturated
fatty acids in the transgenic organisms is enlarged by the process
according to the invention.
[0082] If microorganisms are used as organisms in the process
according to the invention, they are grown or cultured in the
manner with which the skilled worker is familiar, depending on the
host organism. As a rule, microorganisms are grown in a liquid
medium comprising a carbon source, usually in the form of sugars, a
nitrogen source, usually in the form of organic nitrogen sources
such as yeast extract or salts such as ammonium sulfate, trace
elements such as salts of iron, manganese and magnesium and, if
appropriate, vitamins, at temperatures of between 0.degree. C. and
100.degree. C., preferably between 10.degree. C. and 60.degree. C.,
while passing in oxygen. The pH of the liquid medium can either be
kept constant, that is to say regulated during the culturing
period, or not. The cultures can be grown batchwise, semi-batchwise
or continuously. Nutrients can be provided at the beginning of the
fermentation or fed in semicontinuously or continuously. The
polyunsaturated fatty acids produced can be isolated from the
organisms as described above by processes known to the skilled
worker, for example by extraction, distillation, crystallization,
if appropriate precipitation with salt, and/or chromatography. To
this end, the organisms can advantageously be disrupted
beforehand.
[0083] If the host organisms are microorganisms, the process
according to the invention is advantageously carried out at a
temperature of between 0.degree. C. and 95.degree. C., preferably
between 10.degree. C. and 85.degree. C., especially preferably
between 15.degree. C. and 75.degree. C., very especially preferably
between 15.degree. C. and 45.degree. C.
[0084] In this process, the pH value is advantageously kept between
pH 4 and 12, preferably between pH 6 and 9, especially preferably
between pH 7 and 8.
[0085] The process according to the invention can be operated
batchwise, semibatchwise or continuously. An overview over known
cultivation methods can be found in the textbook by Chmiel
(Bioproze.beta.technik 1. Einfuhrung in die Bioverfahrenstechnik
[Bioprocess technology 1. Introduction to Bioprocess technology]
(Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by
Storhas (Bioreaktoren and periphere Einrichtungen [Bioreactors and
peripheral equipment] (Vieweg Verlag, Braunschweig/Wiesbaden,
1994)).
[0086] The culture medium to be used must suitably meet the
requirements of the strains in question. Descriptions of culture
media for various microorganisms can be found in the textbook
"Manual of Methods for General Bacteriology" of the American
Society for Bacteriology (Washington D.C., USA, 1981).
[0087] As described above, these media which can be employed in
accordance with the invention usually comprise one or more carbon
sources, nitrogen sources, inorganic salts, vitamins and/or trace
elements.
[0088] Preferred carbon sources are sugars, such as mono-, di- or
polysaccharides. Examples of very good carbon sources are glucose,
fructose, mannose, galactose, ribose, sorbose, ribulose, lactose,
maltose, sucrose, raffinose, starch or cellulose. Sugars can also
be added to the media via complex compounds such as molasses or
other by-products from sugar raffination. The addition of mixtures
of a variety of carbon sources may also be advantageous. Other
possible carbon sources are oils and fats such as, for example,
soya oil, sunflower oil, peanut oil and/or coconut fat, fatty acids
such as, for example, palmitic acid, stearic acid and/or linoleic
acid, alcohols and/or polyalcohols such as, for example, glycerol,
methanol and/or ethanol, and/or organic acids such as, for example,
acetic acid and/or lactic acid.
[0089] Nitrogen sources are usually organic or inorganic nitrogen
compounds or materials comprising these compounds. Examples of
nitrogen sources comprise ammonia in liquid or gaseous form or
ammonium salts such as ammonium sulfate, ammonium chloride,
ammonium phosphate, ammonium carbonate or ammonium nitrate,
nitrates, urea, amino acids or complex nitrogen sources such as
cornsteep liquor, soya meal, soya protein, yeast extract, meat
extract and others. The nitrogen sources can be used individually
or as a mixture.
[0090] Inorganic salt compounds which may be present in the media
comprise the chloride, phosphorus and sulfate salts of calcium,
magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc,
copper and iron.
[0091] Inorganic sulfur-containing compounds such as, for example,
sulfates, sulfites, dithionites, tetrathionates, thiosulfates,
sulfides, or else organic sulfur compounds such as mercaptans and
thiols may be used as sources of sulfur for the production of
sulfur-containing fine chemicals, in particular of methionine.
[0092] Phosphoric acid, potassium dihydrogen phosphate or
dipotassium hydrogen phosphate or the corresponding
sodium-containing salts may be used as sources of phosphorus.
[0093] Chelating agents may be added to the medium in order to keep
the metal ions in solution. Particularly suitable chelating agents
include dihydroxyphenols such as catechol or protocatechuate and
organic acids such as citric acid.
[0094] The fermentation media used according to the invention for
culturing microorganisms usually also comprise other growth factors
such as vitamins or growth promoters, which include, for example,
biotin, riboflavin, thiamine, folic acid, nicotinic acid,
panthothenate and pyridoxine. Growth factors and salts are
frequently derived from complex media components such as yeast
extract, molasses, cornsteep liquor and the like. It is moreover
possible to add suitable precursors to the culture medium. The
exact composition of the media compounds heavily depends on the
particular experiment and is decided upon individually for each
specific case. Information on the optimization of media can be
found in the textbook "Applied Microbiol. Physiology, A Practical
Approach" (Editors P. M. Rhodes, P. F. Stanbury, IRL Press (1997)
pp. 53-73, ISBN 0 19 963577 3). Growth media can also be obtained
from commercial suppliers, for example Standard 1 (Merck) or BHI
(brain heart infusion, DIFCO) and the like.
[0095] All media components are sterilized, either by heat (20 min
at 1.5 bar and 121.degree. C.) or by filter sterilization. The
components may be sterilized either together or, if required,
separately. All media components may be present at the start of the
cultivation or added continuously or batchwise, as desired.
[0096] The culture temperature is normally between 15.degree. C.
and 45.degree. C., preferably at from 25.degree. C. to 40.degree.
C., and may be kept constant or may be altered during the
experiment. The pH of the medium should be in the range from 5 to
8.5, preferably around 7.0. The pH for cultivation can be
controlled during cultivation by adding basic compounds such as
sodium hydroxide, potassium hydroxide, ammonia and aqueous ammonia
or acidic compounds such as phosphoric acid or sulfuric acid.
Foaming can be controlled by employing antifoams such as, for
example, fatty acid polyglycol esters. To maintain the stability of
plasmids it is possible to add to the medium suitable substances
having a selective effect, for example antibiotics. Aerobic
conditions are maintained by introducing oxygen or
oxygen-containing gas mixtures such as, for example, ambient air
into the culture. The temperature of the culture is normally
20.degree. to 45.degree. C. and preferably 25.degree. C. to
40.degree. C. The culture is continued until formation of the
desired product is at a maximum. This aim is normally achieved
within 10 to 160 hours.
[0097] The fermentation broths obtained in this way, in particular
those containing polyunsaturated fatty acids, usually contain a dry
mass of from 7.5 to 25% by weight.
[0098] The fermentation broth can then be processed further. The
biomass may, according to requirement, be removed completely or
partially from the fermentation broth by separation methods such
as, for example, centrifugation, filtration, decanting or a
combination of these methods or be left completely in said broth.
It is advantageous to process the biomass after its separation.
[0099] However, the fermentation broth can also be thickened or
concentrated without separating the cells, using known methods such
as, for example, with the aid of a rotary evaporator, thin-film
evaporator, falling-film evaporator, by reverse osmosis or by
nanofiltration. Finally, this concentrated fermentation broth can
be processed to obtain the fatty acids present therein.
[0100] The fatty acids obtained in the process are also suitable as
starting material for the chemical synthesis of further products of
interest. For example, they can be used in combination with one
another or alone for the preparation of pharmaceuticals,
foodstuffs, animal feeds or cosmetics.
[0101] The invention furthermore relates to isolated nucleic acid
sequences coding for polypeptides having acyl-CoA:lysophospholipid
acyltransferase activity wherein the acyl-CoA:lysophospholipid
acyltransferases encoded by said nucleic acid sequences
specifically convert C.sub.16-, C.sub.18-, C.sub.20- or
C.sub.22-fatty acids having at least one double bond in the fatty
acid molecule.
[0102] Advantageous isolated nucleic acid sequences are sequences
selected from the group consisting of: [0103] a) a nucleic acid
sequence having the sequence depicted in SEQ ID NO: 1, SEQ ID NO:
3, SEQ ID NO: 5 or SEQ ID NO: 7, [0104] b) nucleic acid sequences
which can be derived from the coding sequence comprised in SEQ ID
NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 as a result of
the degenerated genetic code [0105] c) derivatives of the nucleic
acid sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5
or SEQ ID NO: 7 which code for polypeptides having the amino acid
sequence depicted in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or
SEQ ID NO: 8 and are at least 40% homologous at the amino acid
level to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8
and have an acyl-CoA:lysophospholipid-acyltransferase activity.
[0106] The abovementioned nucleic acid sequences are advantageously
derived from a eukaryotic organism.
[0107] The nucleic acid sequences used in the process which code
for proteins with acyl-CoA:lysophospholipid acyltransferase
activity or for proteins of the fatty acid or lipid metabolism are
advantageously introduced in an expression cassette (=nucleic acid
construct) which makes possible the expression of the nucleic acids
in an organism, advantageously a plant or a microorganism.
[0108] To introduce the nucleic acids used in the process, the
latter are advantageously amplified and ligated in the known
manner. Preferably, a procedure following the protocol for Pfu DNA
polymerase or a Pfu/Taq DNA polymerase mixture is followed. The
primers are selected taking into consideration the sequence to be
amplified. The primers should advantageously be chosen in such a
way that the amplificate comprises the entire codogenic sequence
from the start codon to the stop codon. After the amplification,
the amplificate is expediently analyzed. For example, a
gel-electrophoretic separation can be carried out, which is
followed by a quantitative and a qualitative analysis. Thereafter,
the amplificate can be purified following a standard protocol (for
example Qiagen). An aliquot of the purified amplificate is then
available for the subsequent cloning step. Suitable cloning vectors
are generally known to the skilled worker. These include, in
particular, vectors which are capable of replication in microbial
systems, that is to say mainly vectors which ensure efficient
cloning in yeasts or fungi and which make possible the stable
transformation of plants. Those which must be mentioned in
particular are various binary and cointegrated vector systems which
are suitable for the T-DNA-mediated transformation. Such vector
systems are, as a rule, characterized in that they comprise at
least the vir genes required for the Agrobacterium-mediated
transformation and the T-DNA-delimiting sequences (T-DNA border).
These vector systems advantageously also comprise further
cis-regulatory regions such as promoters and terminator sequences
and/or selection markers, by means of which suitably transformed
organisms can be identified. While in the case of cointegrated
vector systems vir genes and T-DNA sequences are arranged on the
same vector, binary systems are based on at least two vectors, one
of which bears vir genes, but no T-DNA, while a second one bears
T-DNA, but no vir gene. Owing to this fact, the last-mentioned
vectors are relatively small, easy to manipulate and to replicate
both in E. coli and in Agrobacterium. These binary vectors include
vectors from the series pBIB-HYG, pPZP, pBecks, pGreen. In
accordance with the invention, pBin19, pBI101, pBinAR, pGPTV and
pCAMBIA are used by preference. An overview of the binary vectors
and their use is found in Hellens et al, Trends in Plant Science
(2000) 5, 446-451. In order to prepare the vectors, the vectors can
first be linearized with restriction endonuclease(s) and then
modified enzymatically in a suitable manner. Thereafter, the vector
is purified, and an aliquot is employed for the cloning step. In
the cloning step, the enzymatically cleaved and, if appropriate,
purified amplificate is ligated with vector fragments which have
been prepared in a similar manner, using ligase. In this context, a
particular nucleic acid construct, or vector or plasmid construct,
can have one or else more than one codogenic gene segment. The
codogenic gene segments in these constructs are preferably linked
operably with regulatory sequences. The regulatory sequences
include, in particular, plant sequences such as the above-described
promoters and terminator sequences. The constructs can
advantageously be stably propagated in microorganisms, in
particular in Escherichia coli and Agrobacterium tumefaciens, under
selective conditions and make possible the transfer of heterologous
DNA into plants or microorganisms.
[0109] The nucleic acids used in the process, the inventive nucleic
acids and nucleic acid constructs, can be introduced into organisms
such as microorganisms or advantageously plants, advantageously
using cloning vectors, and thus be used in the transformation of
plants such as those which are published and cited in: Plant
Molecular Biology and Biotechnology (CRC Press, Boca Raton, Fla.),
Chapter 6/7, p. 71-119 (1993); F. F. White, Vectors for Gene
Transfer in Higher Plants; in: Transgenic Plants, Vol. 1,
Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press,
1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in:
Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung
and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev.
Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225. Thus, the
nucleic acids, the inventive nucleic acids and nucleic acid
constructs, and/or vectors used in the process can be used for the
recombinant modification of a broad spectrum of organisms,
advantageously plants, so that the latter become better and/or more
efficient PUFA producers.
[0110] A series of mechanisms exists by which the modification of
an acyl-CoA:lysophospholipid acyltransferase protein can influence
directly the yield, production and/or production efficiency of a
fine chemical from an oil crop plant or a microorganism, owing to a
modified protein. The number or activity of the
acyl-CoA:lysophospholipid acyltransferase protein or gene and also
of gene combinations of acyl-CoA:lysophospholipid acyltransferases,
desaturases and/or elongases may have increased, so that greater
amounts of the compounds produced are produced de novo, since the
organisms lacked this activity and ability to biosynthesize prior
to introduction of the corresponding gene(s). This applies
analogously to the combination with further desaturases or
elongases or further enzymes of the fatty acid and lipid
metabolism. The use of various divergent sequences, i.e. sequences
which differ at the DNA sequence level, may also be advantageous in
this context, or else the use of promoters for gene expression
which makes possible a different gene expression in the course of
time, for example as a function of the degree of maturity of a seed
or an oil-storing tissue.
[0111] Owing to the introduction of one or more
acyl-CoA:lysophospholipid acyltransferase, desaturase and/or
elongase genes into an organism, alone or in combination with other
genes in a cell, it is not only possible to increase biosynthesis
flux towards the end product, but also to increase, or to create de
novo the corresponding triacylglycerol composition. Likewise, the
number or activity of other genes which are involved in the import
of nutrients which are required for the biosynthesis of one or more
fine chemicals (e.g. fatty acids, polar and/or neutral lipids), can
be increased, so that the concentration of these precursors,
cofactors or intermediates within the cells or within the storage
compartment is increased, whereby the ability of the cells to
produce PUFAs as described below is enhanced further. Fatty acids
and lipids are themselves desirable fine chemicals; by optimizing
the activity or increasing the number of one or more
acyl-CoA:lysophospholipid acyltransferases, desaturases and/or
elongases which are involved in the biosynthesis of these
compounds, or by destroying the activity of one or more desaturases
which are involved in the degradation of these compounds, an
enhanced yield, production and/or efficiency of production of fatty
acid and lipid molecules in organisms, advantageously in plants, is
made possible.
[0112] The isolated nucleic acid molecules used in the process
according to the invention encode proteins or parts of these, where
the proteins or the individual protein or parts thereof comprise(s)
an amino acid sequence with sufficient homology to an amino acid
sequence which is shown in the sequence SEQ ID NO: 2, SEQ ID NO: 4,
SEQ ID NO: 6 or SEQ ID NO: 8, so that the protein or part thereof
retains an acyl-CoA:lysophospholipid acyltransferase activity. The
protein or part thereof which is encoded by the nucleic acid
molecule preferably retains its essential enzymatic activity and
the ability to participate in the metabolism of compounds required
for the synthesis of cell membranes or lipid bodies in organisms,
advantageously in plants, or in the transport of molecules across
these membranes. Advantageously, the protein encoded by the nucleic
acid molecules is at least approximately 40%, preferably at least
approximately 60% and more preferably at least approximately 70%,
80% or 90% and most preferably at least approximately 95%, 96%,
97%, 98%, 99% or more homologous to the amino acid sequences shown
in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.
Advantageous embodiments of the inventive amino acid sequence of
the sequence SEQ ID NO: 2 are amino acid sequences which have a
valine residue instead of the methionine at position 30 of SEQ ID
NO: 2 or have a glycine residue instead of the serine at position
100 or have a serine residue instead of the phenylalanine at
position 170. These are indicated in SEQ ID NO: 4, SEQ ID NO: 6 and
SEQ ID NO: 8, respectively.
[0113] Essential enzymatic activity of the
acyl-CoA:lysophospholipid acyltransferases used is understood as
meaning that they retain at least an enzymatic activity of at least
10%, preferably 20%, especially preferably 30% and very especially
40% in comparison with the proteins/enzymes encoded by the sequence
with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 and
their derivatives and can thus participate in the metabolism of
compounds required for the synthesis of fatty acids in an organism,
advantageously a plant cell, or in the transport of molecules
across membranes, meaning desaturated C.sub.16-, C.sub.18- or
C.sub.20-24-carbon chains with double bonds at at least two,
advantageously three, four or five positions.
[0114] Nucleic acids which can advantageously be used in the
process are derived from fungi or plants such as algae or mosses,
such as the genera Physcomitrella, Thraustochytrium, Phytophthora,
Ceratodon, Isochrysis, Aleurita, Muscarioides, Mortierella, Borago,
Phaeodactylum, Crypthecodinium or from nematodes such as
Caenorhabditis, specifically from the genera and species
Physcomitrella patens, Phytophtora infestans, Ceratodon purpureus,
Isochrysis galbana, Aleurita farinosa, Muscarioides viallii,
Mortierella alpina, Borago officinalis, Phaeodactylum tricornutum,
or especially advantageously from Caenorhabditis elegans.
[0115] Alternatively, the isolated nucleotide sequences used may
encode acyl-CoA:lysophospholipid acyltransferases which hybridize
with a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID
NO: 5 or SEQ ID NO: 7, for example under stringent conditions.
[0116] The nucleic acid sequences used in the process are
advantageously introduced into an expression cassette which makes
possible the expression of the nucleic acids in organisms such as
microorganisms or plants.
[0117] In doing so, the nucleic acid sequences which encode the
acyl-CoA:lysophospholipid acyltransferases of the invention, the
desaturases used and/or the elongases are linked operably with one
or more regulatory signals, advantageously for enhancing gene
expression. These regulatory sequences are intended to make
possible the specific expression of the genes and proteins.
Depending on the host organism, this may mean, for example, that
the gene is expressed and/or overexpressed only after induction has
taken place, or else that it expresses and/or overexpresses
immediately. For example, these regulatory sequences take the form
of sequences to which inductors or repressors bind, thus
controlling the expression of the nucleic acid. In addition to
these novel regulatory sequences, or instead of these sequences,
the natural regulation of these sequences may still be present
before the actual structural genes and, if appropriate, may have
been genetically modified in such a way that natural regulation has
been eliminated and expression of the genes has been enhanced.
However, the expression cassette (=expression construct=gene
construct) can also be simpler in construction, that is to say no
additional regulatory signals have been inserted before the nucleic
acid sequence or its derivatives, and the natural promoter together
with its regulation was not removed. Instead, the natural
regulatory sequence has been mutated in such a way that regulation
no longer takes place and/or gene expression is enhanced. These
modified promoters can also be positioned on their own before the
natural gene in the form of part-sequences (=promoter with parts of
the nucleic acid sequences used in accordance with the invention)
in order to enhance the activity. Moreover, the gene construct may
advantageously also comprise one or more what are known as enhancer
sequences in operable linkage with the promoter, which make
possible an enhanced expression of the nucleic acid sequence.
Additional advantageous sequences, such as further regulatory
elements or terminator sequences, may also be inserted at the 3'
end of the DNA sequences. The acyl-CoA:lysophospholipid
acyltransferase genes and the advantageously used
.DELTA.4-desaturase, .DELTA.5-desaturase, .DELTA.6-desaturase
and/or 48-desaturase genes and/or .DELTA.5-elongase,
.DELTA.6-elongase and/or .DELTA.9-elongase genes may be present in
one or more copies in the expression cassette (=gene construct).
Preferably, only one copy of the genes is present in each
expression cassette. This gene construct or the gene constructs can
be expressed together in the host organism. In this context, the
gene construct(s) can be inserted in one or more vectors and be
present in the cell in free form, or else be inserted in the
genome. It is advantageous for the insertion of further genes in
the host genome when the genes to be expressed are present together
in one gene construct.
[0118] In this context, the regulatory sequences or factors can, as
described above, preferably have a positive effect on the gene
expression of the genes introduced, thus enhancing it. Thus, an
enhancement of the regulatory elements, advantageously at the
transcriptional level, may take place by using strong transcription
signals such as promoters and/or enhancers. In addition, however,
enhanced translation is also possible, for example by improving the
stability of the mRNA.
[0119] A further embodiment of the invention is one or more gene
constructs which comprise one or more sequences which are defined
by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 or its
derivatives and which encode polypeptides as shown in SEQ ID NO: 2,
SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8. The abovementioned
acyl-CoA:lysophospholipid acyltransferases lead advantageously to
an exchange of fatty acids between the mono-, di- and/or
triglyceride pool of the cell and the CoA-fatty acid ester pool,
the substrate advantageously having one, two, three, four or five
double bonds and advantageously 16, 18, 20, 22 or 24 carbon atoms
in the fatty acid molecule. The same applies to their homologs,
derivatives or analogs, which are linked operably with one or more
regulatory signals, advantageously for enhancing gene
expression.
[0120] Advantageous regulatory sequences for the novel process are
present for example in promoters such as the cos, tac, trp, tet,
trp-tet, lpp, lac, lpp-lac, lacIq, T7, T5, T3, gal, trc, ara, SP6,
.lamda.-PR or .DELTA.-PL promoter and are advantageously employed
in Gram-negative bacteria. Further advantageous regulatory
sequences are, for example, present in the Gram-positive promoters
amy and SPO2, in the yeast or fungal promoters ADC1, MF.alpha., AC,
P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters
CaMV/35S [Franck et al., Cell 21 (1980) 285-294], PRP1 [Ward et
al., Plant. Mol. Biol. 22 (1993)], SSU, OCS, lib4, usp, STLS1, B33,
nos or in the ubiquitin or phaseolin promoter. Advantageous in this
context are also inducible promoters, such as the promoters
described in EP-A-0 388 186 (benzenesulfonamide-inducible), Plant
J. 2, 1992:397-404 (Gatz et al., tetracycline-inducible), EP-A-0
335 528 (abscissic acid-inducible) or WO 93/21334 (ethanol- or
cyclohexenol-inducible) promoters. Further suitable plant promoters
are the cytosolic FBPase promoter or the ST-LSI promoter of potato
(Stockhaus et al., EMBO J. 8, 1989, 2445), the glycine max
phosphoribosylpyrophosphate amidotransferase promoter (Genbank
Accession No. U87999) or the node-specific promoter described in
EP-A-0 249 676. Especially advantageous promoters are promoters
which make possible the expression in tissues which are involved in
the biosynthesis of fatty acids. Very especially advantageous are
seed-specific promoters, such as the USP promoter as described, but
also other promoters such as the LeB4, DC3, phaseolin or napin
promoter. Further especially advantageous promoters are
seed-specific promoters which can be used for monocotyledonous or
dicotyledonous plants and which are described in U.S. Pat. No.
5,608,152 (oilseed rape napin promoter), WO 98/45461 (Arabidopsis
oleosin promoter), U.S. Pat. No. 5,504,200 (Phaseolus vulgaris
phaseolin promoter), WO 91/13980 (Brassica Bce4 promoter), by
Baeumlein et al., Plant J., 2, 2, 1992:233-239 (LeB4 promoter from
a legume), these promoters being suitable for dicots. Examples of
promoters which are suitable for monocots are the barley Ipt-2 or
Ipt-1 promoter (WO 95/15389 and WO 95/23230), the barley hordein
promoter and other suitable promoters described in WO 99/16890.
[0121] In principle, it is possible to use all natural promoters
together with their regulatory sequences, such as those mentioned
above, for the novel process. It is also possible and advantageous
to use synthetic promoters, either in addition or alone, in
particular when they mediate seed-specific expression, such as
those described in WO 99/16890.
[0122] In order to achieve a particularly high PUFA content,
especially in transgenic plants, the PUFA biosynthesis genes should
advantageously be expressed in oil crops in a seed-specific manner.
To this end, seed-specific promoters can be used, or those
promoters which are active in the embryo and/or in the endosperm.
In principle, seed-specific promoters can be isolated both from
dicotyledonous and from monocotyledonous plants. Preferred
promoters are listed hereinbelow: USP (=unknown seed protein) and
vicilin (Vicia faba) [Baumlein et al., Mol. Gen. Genet., 1991,
225(3)], napin (oilseed rape) [U.S. Pat. No. 5,608,152], acyl
carrier protein (oilseed rape) [U.S. Pat. No. 5,315,001 and WO
92/18634], oleosin (Arabidopsis thaliana) [WO 98/45461 and WO
93/20216], phaseolin (Phaseolus vulgaris) [U.S. Pat. No.
5,504,200], Bce4 [WO 91/13980], legumines B4 (LegB4 promoter)
[Baumlein et al., Plant J., 2, 2, 1992], Lpt2 and Ipt1 (barley) [WO
95/15389 and WO 95/23230], seed-specific promoters from rice, maize
and wheat [WO 99/16890], Amy32b, Amy 6-6 and aleurain [U.S. Pat.
No. 5,677,474], Bce4 (oilseed rape) [U.S. Pat. No. 5,530,149],
glycinin (soybean) [EP 571 741], phosphoenol pyruvate carboxylase
(soybean) [JP 06/62870], ADR12-2 (soybean) [WO 98/08962],
isocitrate lyase (oilseed rape) [U.S. Pat. No. 5,689,040] or
.alpha.-amylase (barley) [EP 781 849].
[0123] Plant gene expression can also be facilitated via a
chemically inducible promoter (see review in Gatz 1997, Annu. Rev.
Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically inducible
promoters are particularly suitable when it is desired that gene
expression should take place in a time-specific manner. Examples of
such promoters are a salicylic-acid-inducible promoter (WO
95/19443), a tetracycline-inducible promoter (Gatz et al. (1992)
Plant J. 2, 397-404) and an ethanol-inducible promoter.
[0124] To ensure the stable integration of the biosynthesis genes
into the transgenic plant over a plurality of generations, each of
the nucleic acids which encode acyl-CoA:lysophospholipid
acyltransferase, the advantageous .DELTA.4-desaturase,
.DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase
and/or .DELTA.5-elongase, .DELTA.6-elongase and/or
.DELTA.9-elongase and which are used in the process should be
expressed under the control of a separate promoter, preferably a
promoter which differs from the other promoters, since repeating
sequence motifs can lead to instability of the T-DNA, or to
recombination events. In this context, the expression cassette is
advantageously constructed in such a way that a promoter is
followed by a suitable cleavage site, advantageously in a
polylinker, for insertion of the nucleic acid to be expressed and,
if appropriate, a terminator sequence is positioned behind the
polylinker. This sequence is repeated several times, preferably
three, four or five times, so that up to five genes can be combined
in one construct and introduced into the transgenic plant in order
to be expressed. Advantageously, the sequence is repeated up to
three times. To express the nucleic acid sequences, the latter are
inserted behind the promoter via the suitable cleavage site, for
example in the polylinker. Advantageously, each nucleic acid
sequence has its own promoter and, if appropriate, its own
terminator sequence. However, it is also possible to insert a
plurality of nucleic acid sequences behind a promoter and, if
appropriate, before a terminator sequence. Here, the insertion
site, or the sequence, of the inserted nucleic acids in the
expression cassette is not of critical importance, that is to say a
nucleic acid sequence can be inserted at the first or last position
in the cassette without its expression being substantially
influenced thereby. Advantageously, different promoters such as,
for example, the USP, LegB4 or DC3 promoter, and different
terminator sequences can be used in the expression cassette.
However, it is also possible to use only one type of promoter in
the cassette. This, however, may lead to undesired recombination
events.
[0125] As described above, the transcription of the genes which
have been introduced should advantageously be terminated by
suitable terminator sequences at the 3' end of the biosynthesis
genes which have been introduced (behind the stop codon). An
example of a sequence which can be used in this context is the OCS
1 terminator sequence. As is the case with the promoters, different
terminator sequences should be used for each gene.
[0126] As described above, the gene construct can also comprise
further genes to be introduced into the organisms. It is possible
and advantageous to introduce into the host organisms, and to
express therein, regulatory genes such as genes for inductors,
repressors or enzymes which, owing to their enzyme activity, engage
in the regulation of one or more genes of a biosynthesis pathway.
These genes can be of heterologous or of homologous origin.
Moreover, further biosynthesis genes of the fatty acid or lipid
metabolism can advantageously be present in the nucleic acid
construct, or gene construct; however, these genes can also be
positioned on one or more further nucleic acid constructs.
Biosynthesis genes of the fatty acid or lipid metabolism which are
preferably used are a gene selected from the group consisting of
acyl-CoA dehydrogenase(s), acyl-ACP [=acyl carrier protein]
desaturase(s), acyl-ACP thioesterase(s), fatty acid
acyltransferase(s), fatty acid synthase(s), fatty acid
hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl-coenzyme A
oxidase(s), fatty acid desaturase(s), fatty acid acetylenases,
lipoxygenases, triacylglycerol lipases, allenoxide synthases,
hydroperoxide lyases or fatty acid elongase(s) or combinations
thereof. Especially advantageous nucleic acid sequences are
biosynthesis genes of the fatty acid or lipid metabolism selected
from the group of the .DELTA.4-desaturase, .DELTA.5-desaturase,
.DELTA.6-desaturase, .DELTA.8-desaturase, .DELTA.9-desaturase,
2-desaturase, .DELTA.5-elongase, .DELTA.6-elongase or
.DELTA.9-elongase.
[0127] In this context, the abovementioned desaturases can be
cloned into expression cassettes of the invention in combination
with other elongases and desaturases and used for transforming
plants with the aid of Agrobacterium.
[0128] Here, the regulatory sequences or factors can, as described
above, preferably have a positive effect on, and thus enhance, the
expression of the genes which have been introduced. Thus,
enhancement of the regulatory elements can advantageously take
place at the transcriptional level by using strong transcription
signals such as promoters and/or enhancers. However, an enhanced
translation is also possible, for example by improving the
stability of the mRNA. In principle, the expression cassettes can
be used directly for introduction into the plants or else be
introduced into a vector.
[0129] These advantageous vectors, preferably expression vectors,
comprise the nucleic acids which encode acyl-CoA:lysophospholipid
acyltransferases and which are used in the process, or else a
nucleic acid construct which comprises the nucleic acid used either
alone or in combination with further biosynthesis genes of the
fatty acid or lipid metabolism such as .DELTA.4-desaturase,
.DELTA.5-desaturase, .DELTA.6-desaturase, .DELTA.8-desaturase,
.DELTA.9-desaturase, 2-desaturase, .DELTA.5-elongase,
.DELTA.6-elongase and/or .DELTA.9-elongase. As used in the present
context, the term "vector" refers to a nucleic acid molecule which
is capable of transporting another nucleic acid to which it is
bound. One type of vector is a "plasmid", a circular
double-stranded DNA loop into which additional DNA segments can be
ligated. A further type of vector is a viral vector, it being
possible for additional DNA segments to be ligated into the viral
genome. Certain vectors are capable of autonomous replication in a
host cell into which they have been introduced (for example
bacterial vectors with bacterial replication origin). Other vectors
are advantageously integrated into the genome of a host cell when
they are introduced into the host cell, and thus replicate together
with the host genome. Moreover, certain vectors can govern the
expression of genes with which they are in operable linkage. These
vectors are referred to in the present context as "expression
vectors". Usually, expression vectors which are suitable for DNA
recombination techniques take the form of plasmids. In the present
description, "plasmid" and "vector" can be used exchangeably since
the plasmid is the form of vector which is most frequently used.
However, the invention is also intended to cover other forms of
expression vectors, such as viral vectors, which exert similar
functions. Furthermore, the term "vector" is also intended to
encompass other vectors with which the skilled worker is familiar,
such as phages, viruses such as SV40, CMV, TMV, transposons, IS
elements, phasmids, phagemids, cosmids, linear or circular DNA.
[0130] The recombinant expression vectors advantageously used in
the process comprise the nucleic acids described below or the
above-described gene construct in a form which is suitable for
expressing the nucleic acids used in a host cell, which means that
the recombinant expression vectors comprise one or more regulatory
sequences, selected on the basis of the host cells used for the
expression, which regulatory sequence(s) is/are linked operably
with the nucleic acid sequence to be expressed. In a recombinant
expression vector, "linked operably" means that the nucleotide
sequence of interest is bound to the regulatory sequence(s) in such
a way that the expression of the nucleotide sequence is possible
and they are bound to each other in such a way that both sequences
carry out the predicted function which is ascribed to the sequence
(for example in an in-vitro transcription/translation system, or in
a host cell if the vector is introduced into the host cell). The
term "regulatory sequence" is intended to comprise promoters,
enhancers and other expression control elements (for example
polyadenylation signals). These regulatory sequences are described,
for example, in Goeddel: Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990), or see:
Gruber and Crosby, in: Methods in Plant Molecular Biology and
Biotechnology, CRC Press, Boca Raton, Fla., Ed.: Glick and
Thompson, Chapter 7, 89-108, including the references cited
therein. Regulatory sequences comprise those which govern the
constitutive expression of a nucleotide sequence in many types of
host cell and those which govern the direct expression of the
nucleotide sequence only in specific host cells under specific
conditions. The skilled worker knows that the design of the
expression vector can depend on factors such as the choice of host
cell to be transformed, the desired expression level of the protein
and the like.
[0131] The recombinant expression vectors used can be designed for
the expression of acyl-CoA:lysophospholipid acyltransferases,
desaturases and elongases in prokaryotic or eukaryotic cells. This
is advantageous since intermediate steps of the vector construction
are frequently carried out in microorganisms for the sake of
simplicity. For example, acyl-CoA:lysophospholipid acyltransferase,
desaturase and elongase genes can be expressed in bacterial cells,
insect cells (using Baculovirus expression vectors), yeast and
other fungal cells (see Romanos, M. A., et al. (1992) "Foreign gene
expression in yeast: a review", Yeast 8:423-488; van den Hondel, C.
A. M. J. J., et al. (1991) "Heterologous gene expression in
filamentous fungi", in: More Gene Manipulations in Fungi, J. W.
Bennet & L. L. Lasure, Ed., pp. 396-428: Academic Press: San
Diego; and van den Hondel, C. A. M. J. J., & Punt, P. J. (1991)
"Gene transfer systems and vector development for filamentous
fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J. F., et
al., Ed., pp. 1-28, Cambridge University Press: Cambridge), algae
(Falciatore et al., 1999, Marine Biotechnology. 1, 3:239-251),
ciliates of the types: Holotrichia, Peritrichia, Spirotrichia,
Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma,
Platyophrya, Potomacus, Desaturaseudocohnilembus, Euplotes,
Engelmaniella and Stylonychia, in particular of the genus
Stylonychia lemnae, using vectors in a transformation method as
described in WO 98/01572 and, preferably, in cells of multi-celled
plants (see Schmidt, R. and Willmitzer, L. (1988) "High efficiency
Agrobacterium tumefaciens-mediated transformation of Arabidopsis
thaliana leaf and cotyledon explants" Plant Cell Rep.: 583-586;
Plant Molecular Biology and Biotechnology, C Press, Boca Raton,
Fla., Chapter 6/7, pp. 71-119 (1993); F. F. White, B. Jenes et al.,
Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1,
Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press
(1993), 128-43; Potrykus, Annu. Rev. Plant Physiol. Plant Molec.
Biol. 42 (1991), 205-225 (and references cited therein)). Suitable
host cells are furthermore discussed in Goeddel, Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego,
Calif. (1990). As an alternative, the recombinant expression vector
can be transcribed and translated in vitro, for example using
T7-promoter regulatory sequences and T7-polymerase.
[0132] In most cases, the expression of proteins in prokaryotes
involves the use of vectors comprising constitutive or inducible
promoters which govern the expression of fusion or nonfusion
proteins. Typical fusion expression vectors are, inter alia, pGEX
(Pharmacia Biotech Inc; Smith, D. B., and Johnson, K. S. (1988)
Gene 67:31-40), pMAL (New England Biolabs, Beverly, Mass.) and
pRIT5 (Pharmacia, Piscataway, N.J.), where glutathione
S-transferase (GST), maltose-E binding protein and protein A,
respectively, is fused with the recombinant target protein.
[0133] Examples of suitable inducible nonfusion E. coli expression
vectors are, inter alia, pTrc (Amann et al. (1988) Gene 69:301-315)
and pET 11d (Studier et al., Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89).
The target gene expression from the pTrc vector is based on the
transcription from a hybrid trp-lac fusion promoter by the host RNA
polymerase. The target gene expression from the vector pET 11d is
based on the transcription of a T7-gn10-lac fusion promoter, which
is mediated by a viral RNA polymerase (T7 gn1), which is
coexpressed. This viral polymerase is provided by the host strains
BL21 (DE3) or HMS174 (DE3) from a resident .lamda.-prophage which
harbors a T7 gn1 gene under the transcriptional control of the
lacUV 5 promoter.
[0134] Other vectors which are suitable for prokaryotic organisms
are known to the skilled worker, these vectors are, for example in
E. coli pLG338, pACYC184, the pBR series such as pBR322, the pUC
series such as pUC18 or pUC19, the M113mp series, pKC30, pRep4,
pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1,
.lamda.gt11 or pBdCl, in Streptomyces pIJ101, pIJ364, pIJ702 or
pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium
pSA77 or pAJ667.
[0135] In a further embodiment, the expression vector is a yeast
expression vector. Examples for vectors for expression in the yeast
S. cerevisiae comprise pYeDesaturasec1 (Baldari et al. (1987) Embo
J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943),
pJRY88 (Schultz et al. (1987) Gene 54:113-123) and pYES2
(Invitrogen Corporation, San Diego, Calif.). Vectors and processes
for the construction of vectors which are suitable for use in other
fungi, such as the filamentous fungi, comprise those which are
described in detail in: van den Hondel, C. A. M. J. J., & Punt,
P. J. (1991) "Gene transfer systems and vector development for
filamentous fungi, in: Applied Molecular Genetics of fungi, J. F.
Peberdy et al., Ed., pp. 1-28, Cambridge University Press:
Cambridge, or in: More Gene Manipulations in Fungi [J. W. Bennet
& L. L. Lasure, Ed., pp. 396-428: Academic Press: San Diego].
Further suitable yeast vectors are, for example, pAG-1, YEp6, YEp13
or pEMBLYe23.
[0136] As an alternative, acyl-CoA:lysophospholipid
acyltransferases, desaturases and/or elongases can be expressed in
insect cells using Baculovirus expression vectors. Baculovirus
vectors which are available for the expression of proteins in
cultured insect cells (for example Sf9 cells) comprise the pAc
series (Smith et al. (1983) Mol. Cell Biol. 3:2156-2165) and the
pVL series (Lucklow and Summers (1989) Virology 170:31-39).
[0137] The abovementioned vectors offer only a small overview over
suitable vectors which are possible. Further plasmids are known to
the skilled worker and are described, for example, in: Cloning
Vectors (Ed. Pouwels, P. H., et al., Elsevier, Amsterdam-New
York-Oxford, 1985, ISBN 0 444 904018). For further suitable
expression systems for prokaryotic and eukaryotic cells, see the
Chapters 16 and 17 in Sambrook, J., Fritsch, E. F., and Maniatis,
T., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold
Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., 1989.
[0138] In a further embodiment of the process, the
acyl-CoA:lysophospholipid acyltransferases, desaturases and
elongases can be expressed in single-celled plant cells (such as
algae), see Falciatore et al., 1999, Marine Biotechnology 1
(3):239-251 and references cited therein, and in plant cells from
higher plants (for example spermatophytes such as arable crops).
Examples of plant expression vectors comprise those which are
described in detail in: Becker, D., Kemper, E., Schell, J., and
Masterson, R. (1992) "New plant binary vectors with selectable
markers located proximal to the left border", Plant Mol. Biol.
20:1195-1197; and Bevan, M. W. (1984) "Binary Agrobacterium vectors
for plant transformation", Nucl. Acids Res. 12:8711-8721; Vectors
for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1,
Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press,
1993, p. 15-38.
[0139] A plant expression cassette preferably comprises regulatory
sequences which are capable of governing the expression of genes in
plant cells and which are linked operably so that each sequence can
fulfill its function, such as transcriptional termination, for
example polyadenylation signals. Preferred polyadenylation signals
are those which are derived from Agrobacterium tumefaciens T-DNA,
such as gene 3 of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3
(1984) 835 et seq.), which is known as octopine synthase, or
functional equivalents thereof, but all other terminator sequences
which are functionally active in plants are also suitable.
[0140] Since plant gene expression is very often not limited to the
transcriptional level, a plant expression cassette preferably
comprises other sequences which are linked operably, such as
translation enhancers, for example the overdrive sequence, which
enhances the tobacco mosaic virus 5'-untranslated leader sequence,
which increases the protein/RNA ratio (Gallie et al., 1987, Nucl.
Acids Research 15:8693-8711).
[0141] As described above, plant gene expression must be linked
operably with a suitable promoter which triggers gene expression
with the correct timing or in a cell- or tissue-specific manner.
Utilizable promoters are constitutive promoters (Benfey et al.,
EMBO J. 8 (1989) 2195-2202), such as those which are derived from
plant viruses, such as 35S CaMV (Franck et al., Cell 21 (1980)
285-294), 19S CaMV (see also U.S. Pat. No. 5,352,605 and WO
84/02913), or plant promoters, such as the promoter of the small
rubisco subunit, which is described in U.S. Pat. No. 4,962,028.
[0142] Other preferred sequences for use in operable linkage in
plant gene expression cassettes are targeting sequences, which are
required for steering the gene product into its corresponding cell
compartment (see a review in Kermode, Crit. Rev. Plant Sci. 15, 4
(1996) 285-423 and references cited therein), for example into the
vacuole, into the nucleus, all types of plastids, such as
amyloplasts, chloroplasts, chromoplasts, the extracellular space,
the mitochondria, the endoplasmid reticulum, elaioplasts,
peroxisomes and other compartments of plant cells.
[0143] As described above, plant gene expression can also be
achieved via a chemically inducible promoter (see review in Gatz
1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:89-108).
Chemically inducible promoters are particularly suitable when it is
desired that the gene expression takes place in a time-specific
manner. Examples of such promoters are a salicylic-acid-inducible
promoter (WO 95/19443), a tetracyclin-inducible promoter (Gatz et
al. (1992) Plant J. 2, 397-404) and an ethanol-inducible
promoter.
[0144] Promoters which respond to biotic or abiotic stress
conditions are also suitable, for example the pathogen-induced PRP1
gene promoter (Ward et al., Plant. Mol. Biol. 22 (1993) 361-366),
the heat-inducible tomato hsp80 promoter (U.S. Pat. No. 5,187,267),
the chill-inducible potato alpha-amylase promoter (WO 96/12814) or
the wound-inducible pinII promoter (EP-A-0 375 091).
[0145] Especially preferred are those promoters which bring about
the gene expression in tissues and organs in which the biosynthesis
of fatty acids, lipids and oils takes place, in seed cells, such as
cells of the endosperm and of the developing embryo. Suitable
promoters are the oilseed rape napin gene promoter (U.S. Pat. No.
5,608,152), the Vicia faba USP promoter (Baeumlein et al., Mol Gen
Genet, 1991, 225 (3):459-67), the Arabidopsis oleosin promoter (WO
98/45461), the Phaseolus vulgaris phaseolin promoter (U.S. Pat. No.
5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the
legumine B4 promoter (LeB4; Baeumlein et al., 1992, Plant Journal,
2 (2):233-9), and promoters which bring about the seed-specific
expression in monocotyledonous plants such as maize, barley, wheat,
rye, rice and the like. Suitable noteworthy promoters are the
barley Ipt2 or Ipt1 gene promoter (WO 95/15389 and WO 95/23230) or
the promoters from the barley hordein gene, the rice glutelin gene,
the rice oryzin gene, the rice prolamine gene, the wheat gliadine
gene, the wheat glutelin gene, the maize zeine gene, the oat
glutelin gene, the sorghum kasirin gene or the rye secalin gene,
which are described in WO 99/16890.
[0146] In particular, it may be desired to bring about the
multiparallel expression of the acyl-CoA:lysophospholipid
acyltransferases used in the process alone or in combination with
desaturases and/or elongases. Such expression cassettes can be
introduced via the simultaneous transformation of a plurality of
individual expression constructs or, preferably, by combining a
plurality of expression cassettes on one construct. Also, a
plurality of vectors can be transformed with in each case a
plurality of expression cassettes and then transferred into the
host cell.
[0147] Other promoters which are likewise especially suitable are
those which bring about plastid-specific expression, since plastids
constitute the compartment in which the precursors and some end
products of lipid biosynthesis are synthesized. Suitable promoters,
such as the viral RNA polymerase promoter, are described in WO
95/16783 and WO 97/06250, and the clpP promoter from Arabidopsis,
described in WO 99/46394.
[0148] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
The terms "transformation" and "transfection", conjugation and
transduction, as used in the present context, are intended to
comprise a multiplicity of methods known in the prior art for the
introduction of foreign nucleic acid (for example DNA) into a host
cell, including calcium phosphate or calcium chloride
coprecipitation, DEAE-dextran-mediated transfection, lipofection,
natural competence, chemically mediated transfer, electroporation
or particle bombardment. Suitable methods for the transformation or
transfection of host cells, including plant cells, can be found in
Sambrook et al. (Molecular Cloning: A Laboratory Manual., 2nd ed.,
Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., 1989) and other laboratory textbooks such
as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium
protocols, Ed.: Gartland and Davey, Humana Press, Totowa, N.J.
[0149] Host cells which are suitable in principle for taking up the
nucleic acid according to the invention, the gene product according
to the invention or the vector according to the invention are all
prokaryotic or eukaryotic organisms. The host organisms which are
advantageously used are microorganisms such as fungi or yeasts, or
plant cells, preferably plants or parts thereof. Fungi, yeasts or
plants are preferably used, especially preferably plants, very
especially preferably plants such as oil crops, which are high in
lipid compounds, such as oilseed rape, evening primrose, hemp,
thistle, peanut, canola, linseed, soybean, safflower, sunflower,
borage, or plants such as maize, wheat, rye, oats, triticale, rice,
barley, cotton, cassava, pepper, Tagetes, Solanacea plants such as
potato, tobacco, eggplant and tomato, Vicia species, pea, alfalfa,
bushy plants (coffee, cacao, tea), Salix species, trees (oil palm,
coconut), and perennial grasses and fodder crops. Especially
preferred plants according to the invention are oil crops such as
soybean, peanut, oilseed rape, canola, linseed, hemp, evening
primrose, sunflower, safflower, trees (oil palm, coconut).
[0150] The invention furthermore relates to isolated nucleic acid
sequences as described above coding for polypeptides having
acyl-CoA:lysophospholipid-acyltransferase activity, wherein the
acyl-CoA:lysophospholipid acyltransferases encoded by said nucleic
acid sequences specifically convert C.sub.16-, C.sub.18-, C.sub.20-
or C.sub.22-fatty acids having at least one double bond in the
fatty acid molecule.
[0151] Advantageous isolated nucleic acid sequences are sequences
selected from the group consisting of: [0152] a) a nucleic acid
sequence having the sequence depicted in SEQ ID NO: 1, SEQ ID NO:
3, SEQ ID NO: 5 or SEQ ID NO: 7, [0153] b) nucleic acid sequences
which can be derived from the coding sequence comprised in SEQ ID
NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 as a result of
the degenerated genetic code [0154] c) derivatives of the nucleic
acid sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5
or SEQ ID NO: 7 which code for polypeptides having the amino acid
sequence depicted in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or
SEQ ID NO: 8 and are at least 40% homologous at the amino acid
level to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8
and have an acyl-CoA:lysophospholipid-acyltransferase activity.
[0155] The abovementioned nucleic acids according to the invention
are derived from organisms such as animals, ciliates, fungi, plants
such as algae or dinoflagellates which are capable of synthesizing
PUFAs.
[0156] In an advantageous embodiment, the term "nucleic acid
(molecule)" as used in the present context additionally comprises
the untranslated sequence at the 3' and at the 5' end of the coding
gene region: at least 500, preferably 200, especially preferably
100 nucleotides of the sequence upstream of the 5' end of the
coding region and at least 100, preferably 50, especially
preferably 20 nucleotides of the sequence downstream of the 3' end
of the coding gene region. An "isolated" nucleic acid molecule is
separate from other nucleic acid molecules which are present in the
natural source of the nucleic acid. An "isolated" nucleic acid
preferably has no sequences which naturally flank the nucleic acid
in the genomic DNA of the organism from which the nucleic acid is
derived (for example sequences which are located at the 5' and 3'
ends of the nucleic acid). In various embodiments, the isolated
acyl-CoA:lysophospholipid acyltransferase molecule can comprise for
example fewer than approximately 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5
kb or 0.1 kb of nucleotide sequences which naturally flank the
nucleic acid molecule in the genomic DNA of the cell from which the
nucleic acid is derived.
[0157] The nucleic acid molecules used in the process, for example
a nucleic acid molecule with a nucleotide sequence of SEQ ID NO: 1,
SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 or of a part thereof can
be isolated using molecular-biological standard techniques and the
sequence information provided herein. Also, for example a
homologous sequence or homologous, conserved sequence regions can
be identified at the DNA or amino acid level with the aid of
comparative algorithms. They can be used as hybridization probe
together with standard hybridization techniques (such as, for
example, those described in Sambrook et al., Molecular Cloning: A
Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) for
isolating further nucleic acid sequences which can be used in the
process. Moreover, a nucleic acid molecule comprising a complete
sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO:
7 or a part thereof can be isolated by polymerase chain reaction,
where oligonucleotide primers which are based on this sequence or
on parts thereof are used (for example a nucleic acid molecule
comprising the complete sequence or part thereof can be isolated by
polymerase chain reaction using oligonucleotide primers which have
been generated based on this same sequence). For example, mRNA can
be isolated from cells (for example by means of the guanidinium
thiocyanate extraction method of Chirgwin et al. (1979)
Biochemistry 18:5294-5299) and cDNA by means of reverse
transcriptase (for example Moloney MLV reverse transcriptase,
available from Gibco/BRL, Bethesda, Md., or AMV reverse
transcriptase, available from Seikagaku America, Inc., St.
Petersburg, Fla.). Synthetic oligonucleotide primers for the
amplification by means of polymerase chain reaction can be
generated based on one of the sequences shown in SEQ ID NO: 1, SEQ
ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 or with the aid of the amino
acid sequences detailed in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6
or SEQ ID NO: 8. A nucleic acid according to the invention can be
amplified by standard PCR amplification techniques using cDNA or,
alternatively, genomic DNA as template and suitable oligonucleotide
primers. The nucleic acid amplified thus can be cloned into a
suitable vector and characterized by means of DNA sequence
analysis. Oligonucleotides which correspond to a desaturase
nucleotide sequence can be generated by standard synthetic methods,
for example using an automatic DNA synthesizer.
[0158] Homologs of the acyl-CoA:lysophospholipid acyltransferase
nucleic acid sequences with the sequence SEQ ID NO: 1, SEQ ID NO:
3, SEQ ID NO: 5 or SEQ ID NO: 7 means, for example, allelic
variants with at least approximately 40 to 60%, preferably at least
approximately from 60 to 70%, more preferably at least
approximately from 70 to 80%, 80% to 90% or 90 to 95% and even more
preferably at least approximately 95%, 96%, 97%, 98%, 99% or more
homology with a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID
NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 or its homologs, derivatives or
analogs or parts thereof. Furthermore, isolated nucleic acid
molecules of a nucleotide sequence which hybridize with one of the
nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID
NO: 5 or SEQ ID NO: 7 or with a part thereof, for example
hybridized under stringent conditions. Allelic variants comprise in
particular functional variants which can be obtained by deletion,
insertion or substitution of nucleotides from/into the sequence
detailed in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO:
7, it being intended, however, that the enzyme activity of the
resulting proteins which are synthesized is advantageously retained
for the insertion of one or more genes. Proteins which retain the
enzymatic activity of acyl-CoA:lysophospholipid acyltransferase,
i.e. whose activity is essentially not reduced, means proteins with
at least 10%, preferably 20%, especially preferably 30%, very
especially preferably 40% of the original enzyme activity in
comparison with the protein encoded by SEQ ID NO: 1, SEQ ID NO: 3,
SEQ ID NO: 5 or SEQ ID NO: 7.
[0159] Homologs of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ
ID NO: 7 means for example also bacterial, fungal and plant
homologs, truncated sequences, single-stranded DNA or RNA of the
coding and noncoding DNA sequence.
[0160] Homologs of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ
ID NO: 7 also mean derivatives such as, for example, promoter
variants. The promoters upstream of the nucleotide sequences
detailed can be modified by one or more nucleotide exchanges, by
insertion(s) and/or deletion(s) without the functionality or
activity of the promoters being adversely affected, however. It is
furthermore possible that the modification of the promoter sequence
enhances their activity or that they are replaced entirely by more
active promoters, including those from heterologous organisms.
[0161] The abovementioned nucleic acids and protein molecules with
acyl-CoA:lysophospholipid acyltransferase activity which are
involved in the metabolism of lipids and fatty acids, PUFA
cofactors and enzymes or in the transport of lipophilic compounds
across membranes are used in the process according to the invention
for the modulation of the production of PUFAs in transgenic
organisms, advantageously in plants, such as maize, wheat, rye,
oats, triticale, rice, barley, soybean, peanut, cotton, Linum
species such as linseed or flax, Brassica species such as oilseed
rape, canola and turnip rape, pepper, sunflower, borage, evening
primrose and Tagetes, Solanaceae plants such as potato, tobacco,
eggplant and tomato, Vicia species, pea, cassava, alfalfa, bushy
plants (coffee, cacao, tea), Salix species, trees (oil palm,
coconut) and perennial grasses and fodder crops, either directly
(for example when the overexpression or optimization of a fatty
acid biosynthesis protein has a direct effect on the yield,
production and/or production efficiency of the fatty acid from
modified organisms) and/or can have an indirect effect which
nevertheless leads to an enhanced yield, production and/or
production efficiency of the PUFAs or a reduction of undesired
compounds (for example when the modulation of the metabolism of
lipids and fatty acids, cofactors and enzymes leads to
modifications of the yield, production and/or production efficiency
or the composition of the desired compounds within the cells,
which, in turn, can affect the production of one or more fatty
acids).
[0162] The combination of various precursor molecules and
biosynthesis enzymes leads to the production of various fatty acid
molecules, which has a decisive effect on lipid composition, since
polyunsaturated fatty acids (.dbd.PUFAs) are not only incorporated
into triacylglycerol but also into membrane lipids.
[0163] Lipid synthesis can be divided into two sections: the
synthesis of fatty acids and their binding to
sn-glycerol-3-phosphate, and the addition or modification of a
polar head group. Usual lipids which are used in membranes comprise
phospholipids, glycolipids, sphingolipids and phosphoglycerides.
Fatty acid synthesis starts with the conversion of acetyl-CoA into
malonyl-CoA by acetyl-CoA carboxylase or into acetyl-ACP by acetyl
transacylase. After a condensation reaction, these two product
molecules together form acetoacetyl-ACP, which is converted via a
series of condensation, reduction and dehydratization reactions so
that a saturated fatty acid molecule with the desired chain length
is obtained. The production of the unsaturated fatty acids from
these molecules is catalyzed by specific desaturases, either
aerobically by means of molecular oxygen or anaerobically
(regarding the fatty acid synthesis in microorganisms, see F. C.
Neidhardt et al. (1996) E. coli and Salmonella. ASM Press:
Washington, D.C., pp. 612-636 and references cited therein;
Lengeler et al. (Ed.) (1999) Biology of Procaryotes. Thieme:
Stuttgart, New York, and the references therein, and Magnuson, K.,
et al. (1993) Microbiological Reviews 57:522-542 and the references
therein). To undergo the further elongation steps, the resulting
phospholipid-bound fatty acids must be returned to the fatty acid
CoA ester pool. This is made possible by acyl-CoA:lysophospholipid
acyltransferases. Moreover, these enzymes are capable of
transferring the elongated fatty acids from the CoA esters back to
the phospholipids. If appropriate, this reaction sequence can be
followed repeatedly (see FIG. 10).
[0164] Examples of precursors for the biosynthesis of PUFAs are
oleic acid, linoleic acid and linolenic acid. These C.sub.18-carbon
fatty acids must be elongated to C.sub.20 and C.sub.22 in order to
obtain fatty acids of the eicosa and docosa chain type. With the
aid of the acyl-CoA:lysophospholipid acyltransferases used in the
process, advantageous in combination with desaturases such as
.DELTA.4-, .DELTA.5-, .DELTA.6- and .DELTA.8-desaturases and/or
.DELTA.5-, .DELTA.6-, .DELTA.9-elongases, arachidonic acid,
eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic
acid and various other long-chain PUFAs can be obtained, extracted
and employed in various applications regarding foodstuffs,
feedstuffs, cosmetics or pharmaceuticals. Preferably C.sub.18-,
C.sub.20- and/or C.sub.22-fatty acids with at least two,
advantageously at least three, four, five or six, double bonds in
the fatty acid molecule can be prepared using the abovementioned
enzymes, to give preferably C.sub.20- or C.sub.22-fatty acids with
advantageously three, four or five double bonds in the fatty acid
molecule. Desaturation may take place before or after elongation of
the fatty acid in question. This is why the products of the
desaturase activities and the further desaturation and elongation
steps which are possible result in preferred PUFAs with a higher
degree of desaturation, including a further elongation from
C.sub.20- to C.sub.22-fatty acids, to fatty acids such as
.gamma.-linolenic acid, dihomo-.gamma.-linolenic acid, arachidonic
acid, stearidonic acid, eicosatetraenoic acid or eicosapentaenoic
acid. Substrates of the acyl-CoA:lysophospholipid acyltransferases
used in the process according to the invention are C.sub.16-,
C.sub.18-, C.sub.20- or C.sub.22-fatty acids such as, for example,
palmitic acid, palmitoleic acid, linoleic acid, .gamma.-linolenic
acid, .alpha.-linolenic acid, dihomo-.gamma.-linolenic acid,
eicosatetraenoic acid or stearidonic acid. Preferred substrates are
linoleic acid, .gamma.-linolenic acid and/or .alpha.-linolenic
acid, dihomo-.gamma.-linolenic acid, arachidonic acid,
eicosatetraenoic acid or eicosapentaenoic acid. The C.sub.18-,
C.sub.20- or C.sub.22-fatty acids with at least two double bonds in
the fatty acid are obtained in the process according to the
invention in the form of the free fatty acid or in the form of
their esters, for example in the form of their glycerides.
[0165] The term "glyceride" is understood as meaning glycerol
esterified with one, two or three carboxyl radicals (mono-, di- or
triglyceride). "Glyceride" is also understood as meaning a mixture
of various glycerides. The glyceride or glyceride mixture may
comprise further additions, for example free fatty acids,
antioxidants, proteins, carbohydrates, vitamins and/or other
substances.
[0166] For the purposes of the invention, a "glyceride" is
furthermore understood as meaning glycerol derivatives. In addition
to the above-described fatty acid glycerides, these also include
glycerophospholipids and glyceroglycolipids. Preferred examples
which may be mentioned in this context are the glycerophospholipids
such as lecithin (phosphatidylcholine), cardiolipin,
phosphatidylglycerol, phosphatidylserine and
alkylacylglycerophospholipids.
[0167] Furthermore, fatty acids must subsequently be translocated
to various modification sites and incorporated into the
triacylglycerol storage lipid. A further important step in lipid
synthesis is the transfer of fatty acids to the polar head groups,
for example by glycerol fatty acid acyltransferase (see Frentzen,
1998, Lipid, 100(4-5):161-166).
[0168] Publications on plant fatty acid biosynthesis and on the
desaturation, the lipid metabolism and the membrane transport of
lipidic compounds, on beta-oxidation, fatty acid modification and
cofactors, triacylglycerol storage and triacylglycerol assembly,
including the references therein, see the following papers: Kinney,
1997, Genetic Engineering, Ed.: J K Setlow, 19:149-166; Ohlrogge
and Browse, 1995, Plant Cell 7:957-970; Shanklin and Cahoon, 1998,
Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:611-641; Voelker,
1996, Genetic Engineering, Ed.: J K Setlow, 18:111-13; Gerhardt,
1992, Prog. Lipid R. 31:397-417; Guhnemann-Schafer & Kindl,
1995, Biochim. Biophys Acta 1256:181-186; Kunau et al., 1995, Prog.
Lipid Res. 34:267-342; Stymne et al., 1993, in: Biochemistry and
Molecular Biology of Membrane and Storage Lipids of Plants, Ed.:
Murata and Somerville, Rockville, American Society of Plant
Physiologists, 150-158, Murphy & Ross 1998, Plant Journal.
13(1):1-16.
[0169] The PUFAs produced in the process comprise a group of
molecules which higher animals are no longer capable of
synthesizing and must therefore take up, or which higher animals
are no longer capable of synthesizing themselves in sufficient
quantity and must therefore take up additional quantities, although
they can be synthesized readily by other organisms such as
bacteria; for example, cats are no longer capable of synthesizing
arachidonic acid.
[0170] The term "acyl-CoA:lysophospholipid acyltransferases"
comprises for the purposes of the invention proteins which
participate in the transfer of the fatty acids bound to
phospholipids to the CoA-ester pool and vice versa and their
homologs, derivatives and analogs. Phospholipids for the purposes
of the invention are understood as meaning phosphatidylcholine,
phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol
and/or phosphatidylinositol, advantageously phosphatidylcholine.
The terms acyl-CoA:lysophospholipid acyltransferase(s) comprise
nucleic acid sequences which encode an acyl-CoA:lysophospholipid
acyltransferase and part of which may be a coding region and
likewise corresponding 5' and 3' untranslated sequence regions. The
terms production or productivity are known in the art and encompass
the concentration of the fermentation product (compounds of the
formula I) which is formed within a specific period of time and in
a specific fermentation volume (for example kg of product per hour
per liter). The term production efficiency comprises the time
required for obtaining a specific production quantity (for example
the time required by the cell to establish a certain throughput
rate of a fine chemical). The term yield or product/carbon yield is
known in the art and comprises the efficiency of the conversion of
the carbon source into the product (i.e. the fine chemical). This
is usually expressed for example as kg of product per kg of carbon
source. By increasing the yield or production of the compound, the
amount of the molecules obtained of this compound, or of the
suitable molecules of this compound obtained in a specific culture
quantity over a specified period of time is increased. The terms
biosynthesis or biosynthetic pathway are known in the art and
comprise the synthesis of a compound, preferably an organic
compound, by a cell from intermediates, for example in a multi-step
and strongly regulated process. The terms catabolism or catabolic
pathway are known in the art and comprise the cleavage of a
compound, preferably of an organic compound, by a cell to give
catabolites (in more general terms, smaller or less complex
molecules), for example in a multi-step and strongly regulated
process. The term metabolism is known in the art and comprises the
totality of the biochemical reactions which take place in an
organism. The metabolism of a certain compound (for example the
metabolism of a fatty acid) thus comprises the totality of the
biosynthetic pathways, modification pathways and catabolic pathways
of this compound in the cell which relate to this compound.
[0171] In a further embodiment, derivatives of the nucleic acid
molecule according to the invention represented in SEQ ID NO: 1,
SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 encode proteins with at
least 40%, advantageously from approximately 50 to 60%,
advantageously at least from approximately 60 to 70% and more
preferably at least from approximately 70 to 80%, 80 to 90%, 90 to
95% and most preferably at least approximately 96%, 97%, 98%, 99%
or more homology (=identity) with a complete amino acid sequence of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8. The
homology was calculated over the entire amino acid or nucleic acid
sequence region. The program PileUp (J. Mol. Evolution., 25,
351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the
programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48;
443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489
(1981)], which are part of the GCG software packet [Genetics
Computer Group, 575 Science Drive, Madison, Wis., USA 53711
(1991)], were used for the sequence alignment. The sequence
homology values which are indicated above as a percentage were
determined over the entire sequence region using the program
BestFit and the following settings: Gap Weight: 8, Length Weight:
2.
[0172] Moreover, the invention comprises nucleic acid molecules
which differ from one of the nucleotide sequences shown in SEQ ID
NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 (and parts
thereof) owing to the degeneracy of the genetic code and which thus
encode the same acyl-CoA:lysophospholipid acyltransferase as those
encoded by the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID
NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7.
[0173] In addition to the acyl-CoA:lysophospholipid
acyltransferase(s) shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO:
5 or SEQ ID NO: 7, the skilled worker will recognize that DNA
sequence polymorphisms which lead to changes in the amino acid
sequences of the acyl-CoA:lysophospholipid acyltransferase(s) may
exist within a population. These genetic polymorphisms in the
acyl-CoA:lysophospholipid acyltransferase gene may exist between
individuals within a population owing to natural variation. These
natural variants usually bring about a variance of 1 to 5% in the
nucleotide sequence of the acyl-CoA:lysophospholipid
acyltransferase gene. Each and every one of these nucleotide
variations and resulting amino acid polymorphisms in the
acyl-CoA:lysophospholipid acyltransferase which are the result of
natural variation and do not modify the functional activity of
acyl-CoA:lysophospholipid acyltransferases are to be encompassed by
the invention.
[0174] Owing to their homology to the acyl-CoA:lysophospholipid
acyltransferase nucleic acids disclosed here, nucleic acid
molecules which are advantageous for the process according to the
invention can be isolated following standard hybridization
techniques under stringent hybridization conditions, using the
sequences or part thereof as hybridization probe. In this context
it is possible, for example, to use isolated nucleic acid molecules
which are least 15 nucleotides in length and which hybridize under
stringent conditions with the nucleic acid molecules which comprise
a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5
or SEQ ID NO: 7. Nucleic acids with at least 25, 50, 100, 250 or
more nucleotides can also be used. The term "hybridizes under
stringent conditions" as used in the present context is intended to
describe hybridization and washing conditions under which
nucleotide sequences with at least 60% homology to one another
usually remain hybridized with one another. Conditions are
preferably such that sequences with at least approximately 65%,
preferably at least approximately 70% and especially preferably at
least 75% or more homology to one another usually remain hybridized
to one another. These stringent conditions are known to the skilled
worker and described, for example, in Current Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
A preferred nonlimiting example of stringent hybridization
conditions is hybridizations in 6.times. sodium chloride/sodium
citrate (=SSC) at approximately 45.degree. C., followed by one or
more washing steps in 0.2.times.SSC, 0.1% SDS at 50 to 65.degree.
C. The skilled worker knows that these hybridization conditions
differ depending on the type of nucleic acid and, for example when
organic solvents are present, regarding temperature and buffer
concentration. Under "standard hybridization conditions", for
example, the hybridization temperature is, depending on the type of
nucleic acid, between 42.degree. C. and 58.degree. C. in aqueous
buffer with a concentration of 0.1 to 5.times.SSC (pH 7.2). If
organic solvent, for example 50% formamide, is present in the
abovementioned buffer, the temperature under standard conditions is
approximately 42.degree. C. The hybridization conditions for
DNA:DNA hybrids, for example, are 0.1.times.SSC and 20.degree. C.
to 45.degree. C., preferably 30.degree. C. to 45.degree. C. The
hybridization conditions for DNA:RNA hybrids are, for example,
0.1.times.SSC and 30.degree. C. to 55.degree. C., preferably
45.degree. C. to 55.degree. C. The abovementioned hybridization
temperatures are determined by way of example for a nucleic acid
with approximately 100 bp (=base pairs) in length and with a G+C
content of 50% in the absence of formamide. The skilled worker
knows how to determine the required hybridization conditions on the
basis of the abovementioned textbooks or textbooks such as Sambrook
et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989;
Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A
Practical Approach", IRL Press at Oxford University Press, Oxford;
Brown (Ed.) 1991, "Essential Molecular Biology: A Practical
Approach", IRL Press at Oxford University Press, Oxford.
[0175] In order to determine the percentage of homology (=identity)
of two amino acid sequences (for example one of the sequences of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8) or of two
nucleic acids (for example SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5
or SEQ ID NO: 7), the sequences are written one under the other for
an optimal comparison (for example, gaps may be introduced into the
sequence of a protein or of a nucleic acid in order to generate an
optimal alignment with the other protein or the other nucleic
acid). Then, the amino acid residues or nucleotides at the
corresponding amino acid positions or nucleotide positions are
compared. If a position in a sequence is occupied by the same amino
acid residue or the same nucleotide as the corresponding position
in the other sequence, then the molecules are homologous at this
position (i.e. amino acid or nucleic acid "homology" as used in the
present context corresponds to amino acid or nucleic acid
"identity"). The percentage of homology between the two sequences
is a function of the number of positions which the sequences share
(i.e. % homology=number of identical positions/total number of
positions.times.100). The terms homology and identity are therefore
to be considered as synonymous.
[0176] An isolated nucleic acid molecule which encodes an
acyl-CoA:lysophospholipid acyltransferase which is homologous to a
protein sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ
ID NO: 8 can be generated by introducing one or more nucleotide
substitutions, additions or deletions in/into a nucleotide sequence
of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 so that
one or more amino acid substitutions, additions or deletions are
introduced in/into the protein which is encoded. Mutations in one
of the sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ
ID NO: 7 can be introduced by standard techniques such as
site-specific mutagenesis and PCR-mediated mutagenesis. It is
preferred to generate conservative amino acid substitutions in one
or more of the predicted nonessential amino acid residues. In a
"conservative amino acid substitution", the amino acid residue is
replaced by an amino acid residue with a similar side chain.
Families of amino acid residues with similar side chains have been
defined in the art. These families comprise amino acids with basic
side chains (for example lysine, arginine, histidine), acidic side
chains (for example aspartic acid, glutamic acid), uncharged polar
side chains (for example glycine, asparagine, glutamine, serine,
threonine, tyrosine, cysteine), unpolar side chains (for example
alanine, valine, leucine, isoleucine, proline, phenylalanine,
methionine, tryptophan), beta-branched side chains (for example
threonine, valine, isoleucine) and aromatic side chains (for
example tyrosine, phenylalanine, tryptophan, histidine). A
predicted nonessential amino acid residue in an
acyl-CoA:lysophospholipid acyltransferase is thus preferably
replaced by another amino acid residue from the same family of side
chains. In another embodiment, the mutations can, alternatively, be
introduced randomly over all or part of the sequence encoding the
acyl-CoA:lysophospholipid acyltransferase, for example by
saturation mutagenesis, and the resulting mutants can be screened
by the herein-described acyl-CoA:lysophospholipid acyltransferase
activity in order to identify mutants which have retained the
acyl-CoA:lysophospholipid acyltransferase activity. Following the
mutagenesis of one of the sequences of SEQ ID NO: 1, SEQ ID NO: 3,
SEQ ID NO: 5 or SEQ ID NO: 7, the protein which is encoded can be
expressed recombinantly, and the activity of the protein can be
determined, for example using the tests described in the present
text.
[0177] The present invention is illustrated in greater detail by
the examples which follow, which are not to be construed as
limiting. The content of all of the references, patent
applications, patents and published patent applications cited in
the present patent application is herewith incorporated by
reference.
EXAMPLES
Example 1
General Methods
a) General Cloning Methods:
[0178] Cloning methods such as, for example, restriction cleavages,
agarose gel electrophoresis, purification of DNA fragments,
transfer of nucleic acids to nitrocellulose and nylon membranes,
linking of DNA fragments, transformation of Escherichia coli and
yeast cells, cultivation of bacteria and sequence analysis of
recombinant DNA were carried out as described in Sambrook et al.
(1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6) or
Kaiser, Michaelis and Mitchell (1994) "Methods in Yeast Genetics"
(Cold Spring Harbor Laboratory Press: ISBN 0-87969-451-3).
b) Chemicals
[0179] Unless stated otherwise in the text, the chemicals used were
obtained in analytical-grade quality from Fluka (Neu-Ulm, Germany),
Merck (Darmstadt, Germany), Roth (Karlsruhe, Germany), Serva
(Heidelberg, Germany) and Sigma (Deisenhofen, Germany). Solutions
were prepared using purified, pyrogen-free water, referred to as
H.sub.2O hereinbelow, from a Milli-Q Water System water
purification system (Millipore, Eschborn, Germany). Restriction
endonucleases, DNA-modifying enzymes and molecular-biological kits
were obtained from AGS (Heidelberg, Germany), Amersham (Brunswick,
Germany), Biometra (Gottingen, Germany), Boehringer (Mannheim,
Germany), Genomed (Bad Oeynhausen, Germany), New England Biolabs
(Schwalbach/Taunus, Germany), Novagen (Madison, Wis., USA),
Perkin-Elmer (Weiterstadt, Germany), Pharmacia (Freiburg, Germany),
Qiagen (Hilden, Germany) and Stratagene (Amsterdam, the
Netherlands). Unless stated otherwise, they were used according to
the manufacturer's instructions.
c) Cloning and Expression of Desaturases and Elongases
[0180] The Escherichia coli strain XL1 Blue MRF' kan (Stratagene)
was used for subcloning .DELTA.6-desaturase from Physcomitrella
patens. This gene was functionally expressed using the
Saccharomyces cerevisiae strain INVSc 1 (Invitrogen Co.). E. coli
was cultured in Luria-Bertani broth (LB, Duchefa, Haarlem, the
Netherlands) at 37.degree. C. If necessary, ampicillin (100
mg/liter) was added and 1.5% (w/v) agar was added for solid LB
media. S. cerevisiae was cultured at 30.degree. C. either in YPG
medium or in complete minimal medium without uracil (CMdum; see in:
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman,
J. G., Smith, J. A., Struhl, K., Albright, L. B., Coen, D. M., and
Varki, A. (1995) Current Protocols in Molecular Biology, John Wiley
& Sons, New York) with either 2% (w/v) raffinose or glucose.
For solid media, 2% (w/v) Bacto.TM.-Agar (Difco) were added. The
plasmids used for cloning and expression are pUC18 (Pharmacia) and
pYES2 (Invitrogen Co.).
d) Cloning and Expression of PUFA-Specific Desaturases and
Elongases
[0181] For expression in plants, cDNA clones of SEQ ID NO: 9, 11 or
13 were modified so as for only the coding region to be amplified
by means of polymerase chain reaction with the aid of two
oligonucleotides. Care was taken here to observe a consensus
sequence upstream of the start codon, for efficient translation. To
this end, either the ATA or the AAA base sequence was chosen and
inserted into the sequence upstream of the ATG [Kozak, M. (1986)
Point mutations define a sequence flanking the AUG initiator codon
that modulates translation by eukaryotic ribosomes, Cell 44,
283-2929]. In addition, a restriction cleavage site was introduced
upstream of this consensus triplet, which must be compatible with
the cleavage site of the target vector into which the fragment is
to be cloned and with the aid of which gene expression is to be
carried out in microorganisms or plants.
[0182] The PCR reaction was carried out in a thermocycler
(Biometra), using plasmid DNA as template and Pfu DNA polymerase
(Stratagene) and the following temperature program: 3 min at
96.degree. C., followed by 30 cycles of 30 s at 96.degree. C., 30 s
at 55.degree. C. and 2 min at 72.degree. C., 1 cycle of 10 min at
72.degree. C. and stop at 4.degree. C. The annealing temperature
was varied depending on the oligonucleotides chosen. A synthesis
time of about one minute per kilobase pair of DNA has to be taken
as starting point. Other parameters which influence the PCR, such
as, for example, Mg ions, salt, DNA polymerase etc., are familiar
to the skilled worker in the field and may be varied as
required.
[0183] The correct size of the amplified DNA fragment was confirmed
by means of agarose-TBE gel electrophoresis. The amplified DNA was
extracted from the gel using the QIAquick gel extraction kit
(QIAGEN) and ligated into the SmaI restriction site of the
dephosphorylated pUC18 vector, using the Sure Clone Ligations Kit
(Pharmacia), resulting in the pUC derivatives. After transformation
of E. coli XL1 Blue MRF' kan a DNA minipreparation [Riggs, M. G.,
& McLachlan, A. (1986) A simplified screening procedure for
large numbers of plasmid mini-preparation. BioTechniques 4,
310-313] of ampicillin-resistant transformants was carried out, and
positive clones were identified by means of BamHI restriction
analysis. The sequence of the cloned PCR product was confirmed by
means of resequencing using the ABI PRISM Big Dye Terminator Cycle
Sequencing Ready Reaction Kit (Perkin-Elmer, Weiterstadt,
Germany).
e) Transformation of Agrobacterium
[0184] Unless described otherwise, Agrobacterium-mediated plant
transformation was carried out with the aid of an Agrobacterium
tumefaciens strain, as by Deblaere et al. (1984, Nucl. Acids Res.
13, 4777-4788).
f) Plant Transformation
[0185] Unless described otherwise, Agrobacterium-mediated plant
transformation was carried out using standard transformation and
regeneration techniques (Gelvin, Stanton B., Schilperoort, Robert
A., Plant Molecular Biology Manual, 2nd ed., Dordrecht: Kluwer
Academic Publ., 1995, in Sect., Ringbuc Zentrale Signatur: BT11-P
ISBN 0-7923-2731-4; Glick, Bernard R., Thompson, John E., Methods
in Plant Molecular Biology and Biotechnology, Boca Raton: CRC
Press, 1993, 360 S., ISBN 0-8493-5164-2).
[0186] According thereto, it is possible to transform, for example,
oilseed rape by means of cotyledon or hypocotyl transformation
(Moloney et al., Plant Cell 8 (1989) 238-242; De Block et al.,
Plant Physiol. 91 (1989) 694-701). The use of antibiotics for the
selection of agrobacteria and plants depends on the binary vector
used for transformation and the Agrobacterium strain. Normally,
oilseed rape is selected using kanamycin as selectable plant
marker.
[0187] The transformation of soya may be carried out using, for
example, a technique described in EP-A-0 0424 047 (Pioneer Hi-Bred
International) or in EP-A-0 0397 687, U.S. Pat. No. 5,376,543, U.S.
Pat. No. 5,169,770 (University Toledo).
[0188] The transformation of plants using particle bombardment,
polyethylene glycol-mediated DNA uptake or via the silicon
carbonate fiber technique is described, for example, by Freeling
and Walbot "The maize handbook" (1993) ISBN 3-540-97826-7, Springer
Verlag New York).
[0189] Unless described otherwise, Agrobacterium-mediated gene
transfer into linseed (Linum usitatissimum) was carried out by the
technique as described in Mlynarova et al. [(1994) Plant Cell
Report 13:282-285].
g) Plasmids for Plant Transformation
[0190] Binary vectors based on the vectors pBinAR (Hofgen and
Willmitzer, Plant Science 66 (1990) 221-230) or pGPTV (Becker et
al. 1992, Plant Mol. Biol. 20:1195-1197) were used for plant
transformation. The binary vectors which comprise the nucleic acids
to be expressed are constructed by ligating the cDNA in sense
orientation into the T-DNA. 5' of the cDNA, a plant promoter
activates cDNA transcription. A polyadenylation sequence is located
3' of the cDNA. The binary vectors may carry different marker genes
such as, for example, the acetolactate synthase gene (AHAS or ALS)
[Ott et al., J. Mol. Biol. 1996, 263:359-360] which imparts a
resistance to the imidazolinones or the nptII marker gene which
codes for a kanamycin resistance imparted by neomycin
phosphotransferase.
[0191] Tissue-specific expression of the nucleic acids can be
achieved using a tissue-specific promoter. Unless described
otherwise, the LeB4 or the USP promoter or the phaseolin promoter
was cloned 5' of the cDNA. Terminators used were the NOS terminator
and the OCS terminator (see FIG. 8). FIG. 8 depicts a vector map of
the vector used for expression, pSUN3CeLPLAT.
[0192] It is also possible to use any other seed-specific promoter
element such as, for example, the napin or arcelin promoter
(Goossens et al. 1999, Plant Phys. 120(4):1095-1103 and Gerhardt et
al. 2000, Biochimica et Biophysica Acta 1490(1-2):87-98).
[0193] The CaMV-355 promoter or a v-ATPase C1 promoter can be used
for constitutive expression in the whole plant.
[0194] The nucleic acids used in the process which encode
acyl-CoA:lysophospholipid acyltransferases; desaturases or
elongases were cloned into a binary vector one after the other by
constructing a plurality of expression cassettes, in order to mimic
the metabolic pathway in plants.
[0195] Within an expression cassette, the protein to be expressed
may be guided into a cellular compartment by using a signal
peptide, for example for plastids, mitochondria or the endoplasmic
reticulum (Kermode, Crit. Rev. Plant Sci. 15, 4 (1996) 285-423).
The signal peptide is cloned 5' of and in frame with the cDNA in
order to achieve the subcellular localization of the fusion
protein.
[0196] Examples of multiexpression cassettes were disclosed in DE
102 19 203 and are given again below.
i.) Promoter-Terminator Cassettes
[0197] Expression cassettes consist of at least two functional
units such as a promoter and a terminator. Further desired gene
sequences such as targeting sequences, coding regions of genes or
parts thereof etc. may be inserted between promoter and terminator.
To construct the expression cassettes, promoters and terminators
(USP promoter: Baeumlein et al., Mol Gen Genet, 1991, 225
(3):459-67); OCS terminator: Gielen et al. EMBO J. 3 (1984) 835ff.)
were isolated with the aid of the polymerase chain reaction and
tailor-made with flanking sequences of choice on the basis of
synthetic oligonucleotides.
[0198] Examples of oligonucleotides which may be used are the
following:
TABLE-US-00001 USP1 upstream (SEQ ID NO: 38):
CCGGAATTCGGCGCGCCGAGCTCCTCGAGCAAATTTACACATTGCCA- USP2 upstream (SEQ
ID NO: 39): CCGGAATTCGGCGCGCCGAGCTCCTCGAGCAAATTTACACATTGCCA- USP3
upstream (SEQ ID NO: 40):
CCGGAATTCGGCGCGCCGAGCTCCTCGAGCAAATTTACACATTGCCA- USP1 downstream
(SEQ ID NO: 41): AAAACTGCAGGCGGCCGCCCACCGCGGTGGGCTGGCTATGAAGAAATT-
USP2 downstream (SEQ ID NO: 42): CGCGGATCCGCTGGCTATGAAGAAATT- USP3
downstream (SEQ ID NO: 43):
TCCCCCGGGATCGATGCCGGCAGATCTGCTGGCTATGAAGAAATT- OCS1 upstream (SEQ
ID NO: 44): AAAACTGCAGTCTAGAAGGCCTCCTGCTTTAATGAGATAT- OCS2 upstream
(SEQ ID NO: 45):
CGCGGATCCGATATCGGGCCCGCTAGCGTTAACCCTGCTTTAATGAGATAT- OCS3 upstream
(SEQ ID NO: 46): TCCCCCGGGCCATGGCCTGCTTTAATGAGATAT- OCS1 downstream
(SEQ ID NO: 47):
CCCAAGCTTGGCGCGCCGAGCTCGAATTCGTCGACGGACAATCAGTAAATTGA- OCS2
downstream (SEQ ID NO: 48):
CCCAAGCTTGGCGCGCCGAGCTCGAATTCGTCGACGGACAATCAGTAAATTGA- OCS3
downstream (SEQ ID NO: 49):
CCCAAGCTTGGCGCGCCGAGCTCGTCGACGGACAATCAGTAAATTGA-
[0199] The methods are known to the skilled worker in the field and
are well known from the literature.
[0200] In a first step, a promoter and a terminator were amplified
via PCR. The terminator was then cloned into a recipient plasmid
and, in a second step, the promoter was inserted upstream of the
terminator. As a result, an expression cassette was cloned into the
basic plasmid. The plasmids pUT1, 2 and 3 were thus generated on
the basis of the pUC19 plasmid.
[0201] The corresponding constructs or plasmids are defined in SEQ
ID NO: 15, 16 to 17. They comprise the USP promoter and the OCS
terminator. Based on these plasmids, the construct pUT12 was
generated by cutting pUT1 by means of SaII/ScaI and pUT2 by means
of XhoI/ScaI. The fragments comprising the expression cassettes
were ligated and transformed into E. coli XL1 blue MRF. After
isolating ampicillin-resistant colonies, DNA was prepared and those
clones which comprise two expression cassettes were identified by
restriction analysis. The XhoI/SaII ligation of compatible ends has
eliminated here the two cleavage sites, XhoI and SaII, between the
expression cassettes. The resulting plasmid, pUT12, is indicated in
SEQ ID NO: 18. Subsequently, pUT12 was cut again by means of
SaI/ScaI and pUT3 was cut by means of XhoI/ScaI. The fragments
comprising the expression cassettes were ligated and transformed
into E. coli XLI blue MRF. After isolation from
ampicillin-resistant colonies, DNA was again prepared, and those
clones which comprise three expression cassettes were identified by
restriction analysis. In this manner, a set of multiexpression
cassettes was produced which can be utilized for insertion of
desired DNA and which is described in table 1 and which moreover
can incorporate further expression cassettes.
[0202] Said cassettes comprise the following elements:
TABLE-US-00002 TABLE 1 Cleavage sites Cleavage sites PUC19 upstream
of the USP Multiple downstream of the OCS derivative promoter
cloning cleavage sites terminator PUT1 EcoRI/AscI/SacI/XhoI
BstXI/NotI/PstI/XbaI/StuI SalI/EcoRI/SacI/AscI/ HindIII PUT2
EcoRI/AscI/SacI/XhoI BamHI/EcoRV/ApaI/NheI/HpaI
SalI/EcoRI/SacI/AscI/ HindIII PUT3 EcoRI/AscI/SacI/XhoI
BglII/NaeI/ClaI/SmaI/NcoI SalI/SacI/AscI/HindIII PUT12
EcoRI/AscI/SacI/XhoI BstXI/NotI/PstI/XbaI/StuI
SalI/EcoRI/SacI/AscI/ double and HindIII expression
BamHI/EcoRV/ApaI/NheI/HpaI cassette PUT123 EcoRI/AscI/SacI/XhoI 1.
BstXI/NotI/PstI/XbaI/StuI SalI/SacI/AscI/HindIII triple and
expression 2. BamHI/EcoRV/ApaI/NheI/HpaI cassette and 3.
BglII/NaeI/ClaI/SmaI/NcoI
[0203] Furthermore, further multiexpression cassettes may be
generated, as described and as specified in more detail in table 2,
with the aid of the [0204] i) USP promoter or with the aid of the
[0205] ii) 700 base pair 3' fragment of the LeB4 promoter or with
the aid of the [0206] iii) DC3 promoter and employed for
seed-specific gene expression.
[0207] The DC3 promoter is described in Thomas, Plant Cell 1996,
263:359-368 and consists merely of the region from -117 to +26,
which is why it therefore constitutes one of the smallest known
seed-specific promoters. The expression cassettes may comprise
several copies of the same promoter or else be constructed via
three different promoters.
[0208] Advantageously used polylinker- or
polylinker-terminator-polylinkers can be found in the sequences SEQ
ID NO: 23 to 25.
TABLE-US-00003 TABLE 2 Multiple expression cassettes Plasmid name
of Cleavage sites Cleavage sites the pUC19 upstream of the Multiple
downstream of the derivative particular promoter cloning cleavage
sites OCS terminator pUT1 EcoRI/AscI/SacI/XhoI (1)
BstXI/NotI/PstI/XbaI/StuI SalI/EcoRI/SacI/AscI/ (pUC19 with HindIII
USP-OCS1) PDCT EcoRI/AscI/SacI/XhoI (2) BamHI/EcoRV/ApaI/NheI/
SalI/EcoRI/SacI/AscI/ (pUC19 with HpaI HindIII DC3-OCS) PleBT
EcoRI/AscI/SacI/XhoI (3) BglII/NaeI/ClaI/SmaI/NcoI
SalI/SacI/AscI/HindIII (pUC19 with LeB4(700)-OCS) PUD12
EcoRI/AscI/SacI/XhoI (1) BstXI/NotI/PstI/XbaI/StuI
SalI/EcoRI/SacI/AscI/ (pUC 19 with and HindIII USP-OCS1 and (2)
BamHI/EcoRV/ApaI/NheI/ with DC3-OCS) HpaI PUDL123
EcoRI/AscI/SacI/XhoI (1) BstXI/NotI/PstI/XbaI/StuI and
SalI/SacI/AscI/HindIII Triple expression (2)
BamHI/(EcoRV*)/ApaI/NheI/ cassette HpaI and (pUC19 with (3)
BglII/NaeI/ClaI/SmaI/NcoI USP/DC3 and LeB4-700) *EcoRV cleavage
site cuts in the 700 base pair fragment of the LeB4 promoter
(LeB4-700)
[0209] Further promoters for multigene constructs can be generated
analogously, in particular by using the
a) 2.7 kB fragment of the LeB4 promoter or with the aid of the b)
phaseolin promoter or with the aid of the c) constitutive v-ATPase
c1 promoter.
[0210] It may be particularly desirable to use further particularly
suitable promoters for constructing seed-specific multiexpression
cassettes, such as, for example, the napin promoter or the
arcelin-5 promoter.
[0211] Further vectors which can be utilized in plants and which
have one or two or three promoter-terminator expression cassettes
can be found in the sequences SEQ ID NO: 26 to SEQ ID NO: 31.
ii.) Generation of Expression Constructs which Comprise Promoter,
Terminator and Desired Gene Sequence for the Expression of PUFA
Genes in Plant Expression Cassettes.
[0212] The .DELTA.6-elongase Pp_PSE1 is first inserted into the
first cassette in pUT123 via BstXI and XbaI. Then, the moss
.DELTA.6-desaturase (Pp_des6) is inserted via BamHI/NaeI into the
second cassette and, finally, the Phaeodactylum .DELTA.5-desaturase
(Pt_des5) is inserted via BgIII/NcoI into the third cassette (see
SEQ ID NO: 19). The triple construct is named pARA1. Taking into
consideration sequence-specific restriction cleavage sites, further
expression cassettes, as set out in table 3 and referred to as
pARA2, pARA3 and pARA4, may be generated.
TABLE-US-00004 TABLE 3 Combinations of desaturases and elongases
Gene plasmid .DELTA.6-Desaturase .DELTA.5-Desaturase
.DELTA.6-Elongase pARA1 Pp_des6 Pt_des5 Pp_PSE1 pARA2 Pt_des6
Pt_des5 Pp_PSE1 pARA3 Pt_des6 Ce_des5 Pp_PSE1 PARA4 Ce_des6 Ce_des5
Ce_PSE1 des5 = PUFA-specific .DELTA.5-desaturase des6 =
PUFA-specific .DELTA.6-desaturase PSE = PUFA-specific
.DELTA.6-elongase Pt_des5 = .DELTA.5-desaturase from Phaeodactylum
tricornutum Pp_des6 or Pt_des6 = .DELTA.6-desaturase from
Physcomitrella patens or Phaeodactylum tricornutum Pp =
Physcomitrella patens, Pt = Phaeodactylum tricornutum Pp_PSE1 =
.DELTA.6-elongase from Physcomitrella patens Pt_PSE1 =
.DELTA.6-elongase from Phaeodactylum tricornutum Ce_des5 =
.DELTA.5-desaturase from Caenorhabditis elegans (Genbank Acc. No.
AF078796) Ce_des6 = .DELTA.6-desaturase from Caenorhabditis elegans
(Genbank Acc. No. AF031477, bases 11-1342) Ce_PSE1 =
.DELTA.6-elongase from Caenorhabditis elegans (Genbank Acc. No.
AF244356, bases 1-867)
[0213] Further desaturases or elongase gene sequences may also be
inserted into the expression cassettes of the type described, such
as, for example, Genbank Acc. No. AF231981, NM.sub.--013402,
AF206662, AF268031, AF226273, AF110510 or AF110509.
iii.) Transfer of Expression Cassettes into Vectors for the
Transformation of Agrobacterium tumefaciens and for the
Transformation of Plants
[0214] The constructs thus generated were inserted into the binary
vector pGPTV by means of AscI. For this purpose, the multiple
cloning sequence was extended by an AscI cleavage site. For this
purpose, the polylinker was synthesized de novo in the form of two
double-stranded oligonucleotides, with an additional AscI DNA
sequence being inserted. The oligonucleotide was inserted into the
pGPTV vector by means of EcoRI and HindIII. The cloning techniques
required are known to the skilled worker and may readily be found
in the literature as described in example 1.
[0215] The nucleic acid sequences for .DELTA.5-desaturase (SEQ ID
NO: 13), .DELTA.6-desaturase (SEQ ID NO: 9) and .DELTA.6-elongase
(SEQ ID NO: 11), which were used for the experiments described
below, were the sequences from Physcomitrella patens and
Phaeodactylum tricornutum. The corresponding amino acid sequences
are the sequences SEQ ID NO: 10, SEQ ID NO: 12 and SEQ ID NO: 14. A
vector which comprises all of the abovementioned genes is indicated
in SEQ ID NO: 19. The corresponding amino acid sequences of the
genes can be found in SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO:
22.
Example 2
Cloning and characterization of the ceLPLATs
a) Database Search
[0216] The ceLPLATs (=acyl-CoA:lysophospholipid acyltransferase
from Caenorhabditis elegans) were identified by sequence
comparisons with known LPA-ATs. The search was restricted to the
nematode genome (Caenorhabditis elegans) with the aid of the
BLAST-Psi algorithm (Altschul et al., J. Mol. Biol. 1990, 215:
403-410), since this organism synthesizes LCPUFAs. The probe
employed in the sequence comparison was an LPAAT protein sequence
from Mus musculus (MsLPAAT Accession No. NP.sub.--061350). LPLAT
catalyzes, by a reversible transferase reaction, the
ATP-independent synthesis of acyl-CoAs from phospholipids with the
aid of CoA as cofactor (Yamashita et al., J. Biol. Chem. 2001, 20:
26745-26752). Sequence comparisons enabled two putative ceLPLAT
sequences to be identified (Accession No. T06E8.1 and F59F4.4). The
identified sequences are most similar to each other and to MsLPAATs
(FIG. 1). The alignment was generated using the Clustal
program.
b) Cloning of the CeLPLATs
[0217] Primer pairs were synthesized on the basis of the ceLPLAT
nucleic acid sequences (table 1) and the corresponding cDNAs were
isolated from a C. elegans cDNA library by means of PCR processes.
The respective primer pairs were selected so as to carry, apart
from the start codon, the yeast consensus sequence for
high-efficiency translation (Kozak, Cell 1986, 44:283-292). The
LPLAT cDNAs were amplified in each case using 2 .mu.l of
cDNA-library solution as template, 200 .mu.M dNTPs, 2.5 U of
"proof-reading" pfu polymerase and 50 .mu.mol of each primer in a
total volume of 50 .mu.l. The conditions for the PCR were as
follows: first denaturation at 95.degree. C. for 5 minutes,
followed by 30 cycles at 94.degree. C. for 30 seconds, 58.degree.
C. for one minute and 72.degree. C. for 2 minutes, and a final
extension step at 72.degree. C. for 10 minutes. The sequence of the
LPLAT cDNAs was confirmed by DNA sequencing.
TABLE-US-00005 TABLE 4 Nucleotide sequences of the PCR primers for
cloning CeLPLATs Primer Nucleotide sequence 5' T06E8.1f* 5'
ACATAATGGAGAACTTCTGGTCGATCGTC (SEQ ID NO: 50) 3' 3' T06E8.1r* 5'
TTACTCAGATTTCTTCCCGTCTTT 3' (SEQ ID NO: 51) 5' F59F4.4f* 5'
ACATAATGACCTTCCTAGCCATATTA 3' (SEQ ID NO: 52) 3' F59F4.4r* 5'
TCAGATATTCAAATTGGCGGCTTC 3' (SEQ ID NO: 53) *f: forward, r:
reverse
Example 3
Analysis of the Effect of the Recombinant Proteins on Production of
the Desired Product
a) Possible Preparation Methods
[0218] The effect of genetic modification in fungi, algae, ciliates
or, as described in the examples hereinabove, on the production of
the polyunsaturated fatty acids in yeasts, or in plants may be
determined by growing the modified microorganisms or the modified
plant under suitable conditions (such as those described above) and
studying the medium and/or the cellular components for increased
production of the lipids or fatty acids. These analytical
techniques are known to the skilled worker and comprise
spectroscopy, thin layer chromatography, various types of staining
methods, enzymic and microbiological methods and analytical
chromatography such as high-performance liquid chromatography (see,
for example, Ullmann, Encyclopedia of Industrial Chemistry, vol.
A2, pp. 89-90 and pp. 443-613, VCH: Weinheim (1985); Fallon, A., et
al., (1987) "Applications of HPLC in Biochemistry" in: Laboratory
Techniques in Biochemistry and Molecular Biology, vol. 17; Rehm et
al. (1993) Biotechnology, vol. 3, chapter III: "Product recovery
and purification", pp. 469-714, VCH: Weinheim; Better, P. A., et
al. (1988) Bioseparations: downstream processing for Biotechnology,
John Wiley and Sons; Kennedy, J. F., and Cabral, J. M. S. (1992)
Recovery processes for biological Materials, John Wiley and Sons;
Shaeiwitz, J. A., and Henry, J. D. (1988)
[0219] Biochemical Separations, in: Ullmann's Encyclopedia of
Industrial Chemistry, vol. B3; chapter 11, pp. 1-27, VCH: Weinheim;
and Dechow, F. J. (1989) Separation and purification techniques in
biotechnology, Noyes Publications).
[0220] Apart from the abovementioned methods for detecting fatty
acids in yeasts, plant lipids are extracted from plant material as
described by Cahoon et al. (1999) Proc. Natl. Acad. Sci. USA 96
(22):12935-12940, and Browse et al. (1986) Analytic Biochemistry
152:141-145. The qualitative and quantitative analysis of lipids or
fatty acids is described in Christie, William W., Advances in Lipid
Methodology, Ayr/Scotland: Oily Press (Oily Press Lipid Library;
2); Christie, William W., Gas Chromatography and Lipids. A
Practical Guide--Ayr, Scotland: Oily Press, 1989, Repr. 1992, IX,
307 S. (Oily Press Lipid Library; 1); "Progress in Lipid Research,
Oxford: Pergamon Press, 1 (1952) 16 (1977) under the title.:
Progress in the Chemistry of Fats and Other Lipids CODEN.
[0221] Thus, fatty acids or triacylglycerol (=TAG, abbreviations
indicated in brackets) may be analyzed, for example, by means of
fatty acid methyl esters (=FAME), gas liquid chromatography-mass
spectrometry (=GC-MS) or thin layer chromatography (TLC).
[0222] Unequivocal proof for the presence of fatty acid products
may be obtained by means of analyzing recombinant organisms
following standard analytical procedures: GC, GC-MS or TLC, as
variously described by Christie and references therein (1997, in:
Advances on Lipid Methodology, fourth ed.: Christie, Oily Press,
Dundee, 119-169; 1998,
Gaschromatographie-Massenspektrometrie-Verfahren [Gas
chromatography-mass spectrometry methods], Lipide 33:343-353).
[0223] The plant material to be analyzed may for this purpose be
disrupted either by sonification, glass milling, liquid nitrogen
and grinding or via other applicable processes. After the material
has been disrupted, it is then centrifuged. The sediment is then
resuspended in distilled water, heated at 100.degree. C. for 10
min, cooled on ice and centrifuged again, followed by extraction in
0.5 M sulfuric acid in methanol containing 2% dimethoxypropane for
1 h at 90.degree. C., leading to hydrolyzed oil and lipid compounds
which result in transmethylated lipids. These fatty acid methyl
esters may then be extracted in petroleum ether and finally be
subjected to GC analysis using a capillary column (Chrompack, WCOT
Fused Silica, CP-Wax-52 CB, 25 .mu.m, 0.32 mm), with a temperature
gradient of between 170.degree. C. and 240.degree. C. for 20 min
and at 240.degree. C. for 5 min. The identity of the resulting
fatty acid methyl esters can be defined using standards available
from commercial sources (i.e. Sigma).
[0224] In the case of fatty acids for which no standards are
available, the identity may be shown via derivatization and
subsequent GC-MS analysis. For example, the localization of
triple-bond fatty acids is shown via GC-MS after derivatization
with 4,4-dimethoxyoxazoline derivatives (Christie, 1998, see
above).
b) Fatty Acid Analysis in Plants
[0225] Total fatty acids were extracted from plant seeds and
analyzed by means of gas chromatography.
[0226] The seeds were taken up with 1% sodium methoxide in methanol
and incubated at RT (approx. 22.degree. C.) for 20 min. This was
followed by washing with NaCl solution and taking up the FAMEs in
0.3 ml of heptane.
[0227] The samples were fractionated on a ZEBRON-ZB Wax capillary
column (30 m, 0.32 mm, 0.25 .mu.m; Phenomenex) in a Hewlett Packard
6850 gas chromatograph with flame ionization detector. The oven
temperature was programmed from 70.degree. C. (hold for 1 min) to
200.degree. C. at a rate of 20.degree. C./min, then to 250.degree.
C. (hold for 5 min) at a rate of 5.degree. C./min and finally to
260.degree. C. at a rate of 5.degree. C./min. The carrier gas used
was nitrogen (4.5 ml/min at 70.degree. C.). The fatty acids were
identified by comparison with retention times of FAME standards
(SIGMA).
Example 4
Functional Characterization of CeLPLATs in Yeast
[0228] a) Heterologous Expression in Saccharomyces cerevisiae
[0229] To characterize the function of the C. elegans CeLPLATs, the
open reading frames of the particular cDNAs were cloned downstream
of the galactose-inducible GAL1 promoter of pYes2.1Topo, using the
pYes2.1TOPO TA Expression Kit (Invitrogen), resulting in
pYes2-T06E8.1 and pYes2-F59F4.4.
[0230] Since expression of the CeLPLATs should result in an
efficient exchange of the acyl substrates, the double construct
pESCLeu-PpD6-Pse1 which includes the open reading frames of a
.DELTA.6-desaturase (PpD6) and a .DELTA.6-elongase (PSE1) from
Physcomitrella patens (see DE 102 19 203) was also prepared. The
nucleic acid sequence of said .DELTA.6-desaturase (PpD6) and said
.DELTA.6-elongase (Pse1) are indicated in each case in SEQ ID NO: 9
and SEQ ID NO: 11. The corresponding amino acid sequences can be
found in SEQ ID NO: 10 and SEQ ID NO: 12.
[0231] The Saccharomyces cerevisiae strains C13ABYS86
(protease-deficient) and INVSc1 were transformed simultaneously
with the vectors pYes2-T06E8.1 and pESCLeu-PpD6-Pse1 and,
respectively, pYes2-F59F4.4 and pESCLeu-PpD6-Pse1 by means of a
modified PEG/lithium acetate protocol. The control used was a yeast
which was transformed with the pESCLeu-PpD6-Pse1 vector and the
empty vector pYes2. The transformed yeasts were selected on
complete minimal medium (CMdum) agar plates containing 2% glucose
but no uracil or leucine. After selection, 4 transformants, two
pYes2-T06E8.1/pESCLeu-PpD6-Pse1 and two
pYes2-F59F4.4/pESCLeu-PpD6-Pse1 and one pESCLeu-PpD6-Pse1/pYes2
were selected for further functional expression. The experiments
described were also carried out in the yeast strain INVSc1.
[0232] In order to express the CeLPLATs, precultures of in each
case 2 ml of CMdum liquid medium containing 2% (w/v) raffinose but
no uracil or leucine were first inoculated with the selected
transformants and incubated at 30.degree. C., 200 rpm, for 2 days.
5 ml of CMdum liquid medium (without uracil and leucine) containing
2% raffinose, 1% (v/v) Tergitol NP-40 and 250 .mu.M linoleic acid
(18:2.sup..DELTA.9,12) or linolenic acid (18:3.sup..DELTA.9,12,15)
were then inoculated with the precultures to an OD.sub.600 of 0.08.
Expression was induced at an OD.sub.600 of 0.2-0.4 by adding 2%
(w/v) galactose. The cultures were incubated at 20.degree. C. for a
further 48 h.
Fatty Acid Analysis
[0233] The yeast cells from the main cultures were harvested by
centrifugation (100.times.g, 10 min, 20.degree. C.) and washed with
100 mM NaHCO.sub.3, pH 8.0 in order to remove residual medium and
fatty acids. Fatty acid methyl esters (FAMEs) were prepared from
the yeast cell sediments by acidic methanolysis. For this, the cell
sediments were incubated with 2 ml of 1N methanolic sulfuric acid
and 2% (v/v) dimethoxypropane at 80.degree. C. for 1 h. Extraction
of the FAMES was carried out by extracting twice with petroleum
ether (PE). Nonderivatized fatty acids were removed by washing the
organic phases in each case once with 2 ml of 100 mM NaHCO.sub.3,
pH 8.0 and 2 ml of distilled water. The PE phases were subsequently
dried with Na.sub.2SO.sub.4, evaporated under argon and taken up in
100 .mu.l of PE. The samples were separated on a DB-23 capillary
column (30 m, 0.25 mm, 0.25 .mu.m, Agilent) in a Hewlett-Packard
6850 gas chromatograph with flame ionization detector. The
conditions for the GLC analysis were as follows: the oven
temperature was programmed from 50.degree. C. to 250.degree. C. at
a rate of 5.degree. C./min and finally at 250.degree. C. (hold) for
10 min.
[0234] The signals were identified by comparing the retention times
with those of corresponding fatty acid standards (Sigma).
Acyl-CoA Analysis
[0235] The acyl-CoA analysis was carried out as described in Larson
and Graham (2001; Plant Journal 25: 115-125).
Expression Analysis
[0236] FIGS. 2 A and B and FIGS. 3 A and B depict the fatty acid
profiles of transgenic C13ABYS86 yeasts fed with
18:2.sup..DELTA.9,12 and 18:3.sup..DELTA.9,12,15, respectively. The
substrates fed can be detected in large amounts in all transgenic
yeasts. All four transgenic yeasts display synthesis of
18:3.sup..DELTA.6,9,12 and 20:3.sup..DELTA.8,11,14 and,
respectively, 18:4.sup..DELTA.6,9,12,15 and
20:4.sup..DELTA.8,11,14,17, the products of the .DELTA.6-desaturase
and .DELTA.6-elongase reactions, meaning that the genes PpD6 and
Pse1 were able to be functionally expressed.
[0237] FIG. 2 depicts, as described above, the fatty acid profiles
of transgenic C13ABYS86 S. cerevisiae cells. The fatty acid methyl
esters were synthesized by acidic methanolysis of intact cells
which had been transformed either with the pESCLeu-PpD6-Pse1/pYes2
(A) or with the pYes2-T06E8.1/pESCLeu-PpD6-Pse1 (B) vectors. The
yeasts were cultured in minimal medium in the presence of
18:2.sup..DELTA.9,12. The fatty acid methyl esters were
subsequently analyzed by GLC.
[0238] In the control yeasts transformed with the
pESCLeu-PpD6-Pse1/pYes2 vectors, the proportion of
20:3.sup..DELTA.8,11,14 to which 18:3.sup..DELTA.6,9,12 is
elongated by Pse1 is substantially lower than in the yeasts which
additionally express LPLAT T06E8.1. In fact, elongation of
18:3.sup..DELTA.6,9,12 and 18:4.sup..DELTA.6,9,12,15 was improved
by 100-150% by additional expression of CeLPLAT (T06E8.1) (FIG. 4).
This significant increase in the LCPUFA content can be explained
only as follows: the exogenously fed fatty acids
(18:2.sup..DELTA.9,12 and 18:3.sup..DELTA.9,12,15, respectively)
are first incorporated into phospholipids and desaturated there by
.DELTA.6-desaturase to give 18:3.sup..DELTA.6,9,12 and
18:4.sup..DELTA.6,9,12,15. Only after reequilibration with the
acyl-CoA pool, 18:3.sup..DELTA.6,9,12 and 18:4.sup..DELTA.6,9,12,15
can be elongated by the elongase to give 20:3.sup..DELTA.8,11,14-
and 20:4.sup..DELTA.8,11,14,17-CoA, respectively and then
incorporated again into the lipids. LPLAT T06E8.1 is capable of
converting the .DELTA.6-desaturated acyl groups very efficiently
back to CoA thioesters. Interestingly, it was also possible to
improve the elongation of the fed fatty acids 18:2.sup..DELTA.9,12
and 18:3.sup..DELTA.9,12,15. (FIGS. 2 A and B and FIGS. 3 A and B,
respectively).
[0239] FIG. 3 indicates the fatty acid profiles of transgenic
C13ABYS86 S. cerevisiae cells. Synthesis of the fatty acid methyl
esters was carried out by acidic methanolysis of intact cells which
had been transformed either with the vectors
pESCLeu-PpD6-Pse1/pYes2 (A) or with the vectors
pYes2-T06E8.1/pESCLeu-PpD6-Pse1 (B). The yeasts were cultured in
minimal medium in the presence of 18:3.sup..DELTA.9,12,15. The
fatty acid methyl esters were subsequently analyzed via GLC.
[0240] In contrast, expression of a different CeLPLAT (F59F4.4) has
no influence on elongation (FIG. 4). F59F4.4 evidently does not
encode an LPLAT. Thus, not every putative LPLAT nucleic acid
sequence is enzymatically active in the reaction found according to
the invention.
[0241] FIG. 4 indicates the elongation of exogenously applied
18:2.sup..DELTA.9,12 and 18:3.sup..DELTA.9,12,15, following their
endogenous .DELTA.6-desaturation (data of FIGS. 2 and 3). The
exogenously fed fatty acids are first incorporated into
phospholipids and desaturated there to give 18:3.sup..DELTA.6,9,12
and 18:4.sup..DELTA.6,9,12,15. Only after reequilibration with the
acyl-CoA pool can 18:3.sup..DELTA.6,9,12 and
18:4.sup..DELTA.6,9,12,15 be elongated by the elongase to give
20:3.sup..DELTA.8,11,14- and 20:4.sup..DELTA.8,11,14,17-CoA,
respectively, and then incorporated again into the lipids. LPLAT
T06E8.1 is capable of converting the .DELTA.6-desaturated acyl
groups efficiently back to CoA-thioesters.
[0242] These results show that CeLPLAT (T06E8.1) after coexpression
with .DELTA.6-desaturase and .DELTA.6-elongase, leads to efficient
production of C20-PUFAs. These results can be explained by the fact
that CeLPLAT (T06E8.1) makes possible an efficient exchange of the
newly synthesized fatty acids between lipids and the acyl-CoA pool
(see FIG. 7).
[0243] FIG. 7 indicates the acyl-CoA composition of transgenic
INVSc1 yeasts transformed with the pESCLeu PpD6Pse1/pYes2 (A) or
pESCLeu-PpD6-Pse1/pYes2-T06E8.1 (B) vectors. The yeast cells were
cultured in minimal medium without uracil and leucine in the
presence of 250 .mu.M 18:2.sup..DELTA.9,12. The acyl-CoA
derivatives were analyzed via HPLC.
[0244] When using the yeast strain INVSc1 for coexpression of
CeLPLAT (T06E8.1) together with PpD6 and Pse1, the following
picture emerges: control yeasts expressing PpD6 and Pse1 comprise,
as already shown when using the strain C13ABYS86, only small
amounts of the elongation product (20:3.sup..DELTA.8,11,14, with
18:2 feed, and 20:4.sup..DELTA.8,11,14,17, with 18:3 feed; see
FIGS. 5 A and 6 A, respectively). Additional expression of CeLPLAT
(T06E8.1) results in a marked increase in these elongation products
(see FIGS. 5 B and 6 B). Table 6 indicates that additional
expression of CeLPLAT surprisingly causes an 8 fold increase in the
20:3.sup..DELTA.8,11,14 (with 18:2 feed) and, respectively, the
20:4.sup..DELTA.8,11,14,17 (with 18:3 feed) content. It is also
revealed that C16:2.sup..DELTA.6,9 is also elongated more
efficiently to give C18:2.sup..DELTA.6,9.
TABLE-US-00006 TABLE 5 Fatty acid composition (in mol %) of
transgenic yeasts transformed with the pESCLeu PpD6Pse1/pYes2 (PpD6
Pse1) or pESCLeu-PpD6-Pse1/ pYes2-T06E8.1 (PpD6 Pse1 + T06E8)
vectors. The yeast cells were cultured in minimal medium without
uracil and leucine in the presence of 250 .mu.M
18:2.sup..DELTA.9,12 or 18:3.sup..DELTA.9,12,15. The fatty acid
methyl esters were obtained by acidic methanolysis of whole cells
and analyzed via GLC. Each value indicates the average (n = 4) .+-.
standard deviation. Feeding with Feeding with 250 .mu.M
18:2.sup.9,12 250 .mu.M 18:3.sup.9,12,15 Pp 6/Pse1 + Pp 6/Pse1 +
Fatty acids Pp 6/Pse1 T06E8 Pp 6/Pse1 T06E8 16:0 15.31 .+-. 1.36
15.60 .+-. 1.36 12.20 .+-. 0.62 16.25 .+-. 1.85 16:1.sup..delta.9
23.22 .+-. 2.16 15.80 .+-. 3.92 17.61 .+-. 1.05 14.58 .+-. 1.93
18:0 5.11 .+-. 0.63 7.98 .+-. 1.28 5.94 .+-. 0.71 7.52 .+-. 0.89
18:1.sup..delta.9 15.09 .+-. 0.59 16.01 .+-. 2.53 15.62 .+-. 0.34
15.14 .+-. 2.61 18:1.sup..delta.11 4.64 .+-. 1.09 11.80 .+-. 1.12
4.56 .+-. 0.18 13.07 .+-. 1.66 18:2.sup..delta.9,12 28.72 .+-. 3.25
14.44 .+-. 1.61 -- -- 18:3.sup..delta.6,9,12 3.77 .+-. 0.41 4.72
.+-. 0.72 -- -- 18:3.sup..delta.9,12,15 -- -- 32.86 .+-. 1.20 14.14
.+-. 2.52 18:4.sup..delta.6,9,12,15 -- -- 5.16 .+-. 1.04 3.31 .+-.
1.15 20:2.sup..delta.11,14 2.12 .+-. 0.86 4.95 .+-. 4.71 -- --
20:3.sup..delta.8,11,14 1.03 .+-. 0.14 8.23 .+-. 1.59 -- --
20:3.sup..delta.11,14,17 -- -- 4.12 .+-. 1.54 6.95 .+-. 2.52
20:4.sup..delta.8,11,14,17 -- -- 1.34 .+-. 0.28 8.70 .+-. 1.11
[0245] The fatty acid profile of transgenic INVSc1 S. cerevisiae
cells can be found in FIG. 5. The fatty acid methyl esters were
synthesized by acidic methanolysis of intact cells which had been
transformed either with the pESCLeu-PpD6-Pse1/pYes2 (A) or with the
pYes2-T06E8.1/pESCLeu-PpD6-Pse1 (B) vectors. The yeasts were
cultured in minimal medium in the presence of 18:2.sup..DELTA.9,12.
The fatty acid methyl esters were subsequently analyzed via
GLC.
[0246] FIG. 6 depicts the fatty acid profiles of transgenic INVSc1
S. cerevisiae cells. The fatty acid methyl esters were synthesized
by acidic methanolysis of intact cells which had been transformed
either with the pESCLeu-PpD6-Pse1/pYes2 (A) or with the
pYes2-T06E8.1/pESCLeu-PpD6-Pse1 (B) vectors. The yeasts were
cultured in minimal medium in the presence of
18:3.sup..DELTA.,12,15. The fatty acid methyl esters were
subsequently analyzed via GLC.
[0247] A measure for the efficiency of LCPUFA biosynthesis in
transgenic yeast is the quotient of the content of the desired
.DELTA.6-elongation product after .DELTA.6-desaturation
(20:3.sup..DELTA.8,11,14 and 20:4.sup..DELTA.8,11,14,17,
respectively) to the content of fatty acid fed in
(18:2.sup..DELTA.9,12 and 18:3.sup..DELTA.9,12,15, respectively).
This quotient is 0.04 in INVSc1 control yeasts expressing PpD6 and
Pse1, and 0.60 in yeasts expressing CeLPLAT in addition to PpD6 and
Pse1. In other words: the content of desired .DELTA.6-elongation
product after .DELTA.6-desaturation with coexpression of CeLPLAT is
60% of the content of the fatty acid fed in in each case. In
control yeasts, this content is only approx. 4%, meaning a 15 fold
increase in the efficiency of LCPUFA biosynthesis in transgenic
yeast due to coexpression of LPLAT.
[0248] Interestingly, coexpression of CeLPLAT causes not only an
increase in the elongation products mentioned,
20:3.sup..DELTA.8,11,14 and 20:4.sup..DELTA.8,11,14,17, also an
increase in the 20:3.sup..DELTA.8,11,14:20:2.sup..DELTA.11,14 ratio
and the 20:4.sup..DELTA.8,11,14,17:20:3.sup..DELTA.11,14,17 ratio,
respectively. This means that, in the presence of LPLAT,
.DELTA.6-elongase preferably uses polyunsaturated fatty acids
(18:3.sup..DELTA.6,9,12 and 18:4.sup..DELTA.6,9,12,15) as
substrate, while no distinct substrate specificity is discernible
in the absence of LPLAT (18:2.sup..DELTA.9,12 and
18:3.sup..DELTA.9,12,15 are also elongated). The reason for this
may be protein-protein interactions between .DELTA.6-elongase,
.DELTA.6-desaturase and LPLAT or posttranslational modifications
(partial proteolysis, for example). This will also explain why the
above-described rise in .DELTA.6-elongation products with
coexpression of .DELTA.6-desaturase, .DELTA.6-elongase and LPLAT is
smaller when a protease-deficient yeast strain is used.
[0249] Acyl-CoA analyses of transgenic INVSc1 yeasts fed with
18:2.sup..DELTA.9,12 gave the following result: no
18:3.sup..DELTA.6,9,12-CoA and 20:3.sup..DELTA.8,11,14-CoA is
detectable in control yeasts expressing PpD6 and Pse1, indicating
that neither the substrate (18:3.sup..DELTA.6,9,12-CoA) nor the
product (20:3.sup..DELTA.8,11,14-CoA) of .DELTA.6-elongase is
present in detectable amounts in control yeasts. This suggests that
the transfer of 18:3.sup..DELTA.6,9,12 from membrane lipids into
the acyl-CoA pool does not take place or does not take place
correctly, meaning that there is hardly any substrate available for
the .DELTA.6-elongase present, and this in turn explains the low
elongation product content in control yeasts. INVSc1 yeasts which
express CeLPLAT in addition to PpD6 and Pse1 and which had been fed
with 18:2.sup..DELTA.9,12 have substantial amounts of
20:3.sup..DELTA.8,11,14-CoA but not of 18:3.sup..DELTA.6,9,12-CoA.
This indicates that LPLAT transfers 18:3.sup..DELTA.6,9,12 from the
membrane lipids to the acyl-CoA pool very efficiently.
18:3.sup..DELTA.6,9,12-CoA is then elongated by .DELTA.6-elongase
so that 20:3.sup..DELTA.8,11,14-CoA but not any
18:3.sup..DELTA.6,9,12-CoA is detectable.
b) Functional Characterization of the CeLPLATs in Transgenic
Plants
Expression of Functional CeLPLAT in Transgenic Plants
[0250] DE 102 19 203 describes transgenic plants whose seed oil
comprises small amounts of ARA and EPA, due to seed-specific
expression of functional genes coding for .DELTA.6-desaturase,
.DELTA.6-elongase and .DELTA.5-desaturase. The vector exploited for
transformation of these plants can be found in SEQ ID NO: 19. In
order to increase the content of these LCPUFAs, the gene CeLPLAT
(T06E8.1) was additionally expressed in seeds in the transgenic
plants mentioned.
[0251] For this purpose, the coding region of CeLPLAT was amplified
via PCR.
[0252] Table 6 indicates the primers used for cloning another
CeLPLAT clone into binary vectors.
TABLE-US-00007 TABLE 6 Nucleotide sequences of the PCR primers for
cloning CeLPLAT (T06E8.1) into the binary vector pSUN3 Primer
Nucleotide sequence ARe503f* (SEQ ID NO: 54) 5'
TTAAGCGCGGCCGCATGGAGAACTTCTGGTCG 3' ARe504r* (SEQ ID NO: 55) 5'
ACCTCGGCGGCCGCCCTTTTACTCAGATTTC 3' *f: forward, r: reverse
[0253] The PCR product was cloned into a pENTRY vector between USP
promoter and OCS terminator. The expression cassette was then
cloned into the binary pSUN300 vectors. The vector obtained was
referred to as pSUN3CeLPLAT (FIG. 8). In addition, the CeLPLAT
coding regions were amplified and cloned between LegB4 promoter and
OCS terminator. This vector was referred to as pGPTVCeLPLAT (FIG.
9A).
[0254] In addition, the CeLPLAT coding regions were amplified via
PCR and cloned between LegB4 promoter and OCS terminator. The PCR
primers used for this were selected so as for an efficient Kozak
sequence to be introduced into the PCR product. Moreover, the
CeLPLAT DNA sequence was modified so as to adapt to the codon usage
of higher plants.
[0255] The following primers were used for the PCR:
TABLE-US-00008 Forward primer (SEQ ID NO: 56):
5'-ACATAATGGAGAACTTCTGGTCTATTGTTGTGTTTTTTCTA-3' Reverse primer (SEQ
ID NO: 57): 5'-CTAGCTAGCTTACTCAGATTTCTTCCCGTCTTTTGTTTCTC-3'
[0256] The PCR product was cloned into the cloning vector pCR
Script and cloned via the restriction enzymes XmaI and SacI into
the vector pGPTV LegB4-700. The resulting plasmid was referred to
as pGPTV LegB4-700+T06E8.1 (FIG. 9A).
[0257] The same PCR product was in addition cloned into a
multi-gene expression vector which already comprised the genes for
a Phaeodactylum tricornutum delta-6-desaturase (SEQ ID NO: 32,
amino acid sequence SEQ ID NO: 33) and a P. patens
delta-6-elongase. The resulting plasmid was referred to as pGPTV
USP/OCS-1,2,3 PSE1(Pp)+D6-Des(Pt)+2AT (T06E8-1) (FIG. 9B). The
sequences of the vector and of the genes can be found in SEQ ID NO:
34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37. The
Phaeodactylum tricornutum .DELTA.6-desaturase extends from
nucleotide 4554 to 5987 in SEQ ID NO: 34. The Physcomitrella patens
.DELTA.6-elongase extends from nucleotide 1026 to 1898 and that of
Caenorhabditis elegans LPLAT extends from nucleotide 2805 to 3653
in SEQ ID NO: 34.
[0258] Tobacco plants were cotransformed with the pSUN3CeLPLAT
vector and the vector described in DE 102 19 203 and SEQ ID NO: 19,
which comprises genes coding for .DELTA.6-desaturase,
.DELTA.6-elongase and .DELTA.5-desaturase, with transgenic plants
being selected using kanamycin.
[0259] Tobacco plants were moreover transformed with the pGPTV
USP/OCS-1,2,3 PSE1(Pp)+D6-Des(Pt)+2AT (T06E8-1) vector [see SEQ ID
NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37].
[0260] Linseed was transformed with the pSUN3CeLPLAT vector. The
resulting transgenic plants were crossed with those transgenic
linseed plants which already comprised small amounts of ARA and
EPA, owing to functional gene expression of .DELTA.6-desaturase,
.DELTA.6-elongase and .DELTA.5-desaturase.
[0261] Linseed was furthermore transformed with the pGPTV
LegB4-700+T06E8.1 vector. The resulting transgenic plants were
crossed with those transgenic linseed plants which already
comprised small amounts of ARA and EPA, owing to functional
expression of .DELTA.6-desaturase, .DELTA.6-elongase and
.DELTA.5-desaturase.
[0262] The seeds of transgenic tobacco and linseed plants were, as
described hereinbefore [example 3b)], studied for increased LCPUFAs
contents.
[0263] The function of acyl-CoA:lysophopholipid acyltransferase
(LPLAT) can be deduced from the studies presented herein as
depicted in FIG. 10. The biosynthetic pathway of LCPUFAS is thus as
follows.
[0264] Desaturases catalyze the introduction of double bonds into
lipid-coupled fatty acids (sn2-acyl-phosphatidylcholine), while the
elongases exclusively catalyze the elongation of coenzyme
A-esterified fatty acids (acyl-CoAs). According to this mechanism,
the alternating action of desaturases and elongases requires
continuous exchange of acyl substrates between phospholipids and
acyl-CoA pool and thus the existence of an additional activity
which converts the acyl substrates to the substrate form required
in each case, i.e. lipids (for desaturases) or CoA thioesters (for
elongases). This exchange between acyl-CoA pool and phospholipids
is made possible by LCPUFA-specific LPLAT. The biosynthesis of ARA
(A) takes place analogously to that of EPA (B), but with the
difference that, in the case of EPA, a .DELTA.15-desaturation takes
place upstream of the .DELTA.6-desaturation so that .alpha.18:3-PC
acts as a substrate for .DELTA.6-desaturase. The biosynthesis of
DHA requires a further exchange between phospholipids and acyl-CoA
pool via LPLAT: 20:5.sup..DELTA.5,8,11,14,17 is transferred from
the phospholipids pool to the CoA pool and, after
.DELTA.5-elongation, 22:5.sup..DELTA.7,10,13,16,19 is transferred
from the CoA pool to the phospholipids pool and finally converted
by .DELTA.4-desaturase to give DHA. The same applies to the
exchange in the biosynthetic pathway using .DELTA.8-desaturase,
.DELTA.9-elongase and .DELTA.5-desaturase.
EQUIVALENTS
[0265] Many equivalents of the specific embodiments of the
invention described herein can be identified or found by the
skilled worker by using merely routine experiments. These
equivalents are intended to be within the scope of the patent
claims.
Sequence CWU 1
1
591849DNACaenorhabditis
elegansCDS(1)..(849)Acyl-CoAlysophospholipid acyltransferase 1atg
gag aac ttc tgg tcg atc gtc gtg ttt ttt cta ctc tca att ctc 48Met
Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu Leu Ser Ile Leu 1 5 10
15 ttc att tta tat aac ata tcg aca gta tgc cac tac tat atg cgg att
96Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys His Tyr Tyr Met Arg Ile
20 25 30 tcg ttt tat tac ttc aca att tta ttg cat gga atg gaa gtt
tgt gtt 144Ser Phe Tyr Tyr Phe Thr Ile Leu Leu His Gly Met Glu Val
Cys Val 35 40 45 aca atg atc cct tct tgg cta aat ggg aag ggt gct
gat tac gtg ttt 192Thr Met Ile Pro Ser Trp Leu Asn Gly Lys Gly Ala
Asp Tyr Val Phe 50 55 60 cac tcg ttt ttc tat tgg tgt aaa tgg act
ggt gtt cat aca aca gtc 240His Ser Phe Phe Tyr Trp Cys Lys Trp Thr
Gly Val His Thr Thr Val 65 70 75 80 tat gga tat gaa aaa aca caa gtt
gaa ggt ccg gct gta gtt att tgt 288Tyr Gly Tyr Glu Lys Thr Gln Val
Glu Gly Pro Ala Val Val Ile Cys 85 90 95 aat cat cag agt tct ctc
gac att cta tcg atg gca tca atc tgg ccg 336Asn His Gln Ser Ser Leu
Asp Ile Leu Ser Met Ala Ser Ile Trp Pro 100 105 110 aag aat tgt gtt
gta atg atg aaa cga att ctt gcc tat gtt cca ttc 384Lys Asn Cys Val
Val Met Met Lys Arg Ile Leu Ala Tyr Val Pro Phe 115 120 125 ttc aat
ctc gga gcc tac ttt tcc aac aca atc ttc atc gat cga tat 432Phe Asn
Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe Ile Asp Arg Tyr 130 135 140
aac cgt gaa cgt gcg atg gct tca gtt gat tat tgt gca tct gaa atg
480Asn Arg Glu Arg Ala Met Ala Ser Val Asp Tyr Cys Ala Ser Glu Met
145 150 155 160 aag aac aga aat ctt aaa ctt tgg gta ttt ccg gaa gga
aca aga aat 528Lys Asn Arg Asn Leu Lys Leu Trp Val Phe Pro Glu Gly
Thr Arg Asn 165 170 175 cgt gaa gga ggg ttc att cca ttc aag aaa gga
gca ttc aat att gca 576Arg Glu Gly Gly Phe Ile Pro Phe Lys Lys Gly
Ala Phe Asn Ile Ala 180 185 190 gtt cgt gcg cag att ccc att att cca
gtt gta ttc tca gac tat cgg 624Val Arg Ala Gln Ile Pro Ile Ile Pro
Val Val Phe Ser Asp Tyr Arg 195 200 205 gat ttc tac tca aag cca ggc
cga tat ttc aag aat gat gga gaa gtt 672Asp Phe Tyr Ser Lys Pro Gly
Arg Tyr Phe Lys Asn Asp Gly Glu Val 210 215 220 gtt att cga gtt ctg
gat gcg att cca aca aaa ggg ctc act ctt gat 720Val Ile Arg Val Leu
Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu Asp 225 230 235 240 gac gtc
agc gag ttg tct gat atg tgt cgg gac gtt atg ttg gca gcc 768Asp Val
Ser Glu Leu Ser Asp Met Cys Arg Asp Val Met Leu Ala Ala 245 250 255
tat aag gaa gtt act cta gaa gct cag caa cga aat gcg aca cgg cgt
816Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln Arg Asn Ala Thr Arg Arg
260 265 270 gga gaa aca aaa gac ggg aag aaa tct gag taa 849Gly Glu
Thr Lys Asp Gly Lys Lys Ser Glu 275 280 2282PRTCaenorhabditis
elegans 2Met Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu Leu Ser
Ile Leu 1 5 10 15 Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys His Tyr
Tyr Met Arg Ile 20 25 30 Ser Phe Tyr Tyr Phe Thr Ile Leu Leu His
Gly Met Glu Val Cys Val 35 40 45 Thr Met Ile Pro Ser Trp Leu Asn
Gly Lys Gly Ala Asp Tyr Val Phe 50 55 60 His Ser Phe Phe Tyr Trp
Cys Lys Trp Thr Gly Val His Thr Thr Val 65 70 75 80 Tyr Gly Tyr Glu
Lys Thr Gln Val Glu Gly Pro Ala Val Val Ile Cys 85 90 95 Asn His
Gln Ser Ser Leu Asp Ile Leu Ser Met Ala Ser Ile Trp Pro 100 105 110
Lys Asn Cys Val Val Met Met Lys Arg Ile Leu Ala Tyr Val Pro Phe 115
120 125 Phe Asn Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe Ile Asp Arg
Tyr 130 135 140 Asn Arg Glu Arg Ala Met Ala Ser Val Asp Tyr Cys Ala
Ser Glu Met 145 150 155 160 Lys Asn Arg Asn Leu Lys Leu Trp Val Phe
Pro Glu Gly Thr Arg Asn 165 170 175 Arg Glu Gly Gly Phe Ile Pro Phe
Lys Lys Gly Ala Phe Asn Ile Ala 180 185 190 Val Arg Ala Gln Ile Pro
Ile Ile Pro Val Val Phe Ser Asp Tyr Arg 195 200 205 Asp Phe Tyr Ser
Lys Pro Gly Arg Tyr Phe Lys Asn Asp Gly Glu Val 210 215 220 Val Ile
Arg Val Leu Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu Asp 225 230 235
240 Asp Val Ser Glu Leu Ser Asp Met Cys Arg Asp Val Met Leu Ala Ala
245 250 255 Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln Arg Asn Ala Thr
Arg Arg 260 265 270 Gly Glu Thr Lys Asp Gly Lys Lys Ser Glu 275 280
3849DNACaenorhabditis elegansCDS(1)..(849)Acyl-CoAlysophospholipid
acyltransferase 3atg gag aac ttc tgg tcg atc gtc gtg ttt ttt cta
ctc tca att ctc 48Met Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu
Leu Ser Ile Leu 1 5 10 15 ttc att tta tat aac ata tcg aca gta tgc
cac tac tat atg cgg att 96Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys
His Tyr Tyr Met Arg Ile 20 25 30 tcg ttt tat tac ttc aca att tta
ttg cat gga atg gaa gtt tgt gtt 144Ser Phe Tyr Tyr Phe Thr Ile Leu
Leu His Gly Met Glu Val Cys Val 35 40 45 aca atg atc cct tct tgg
cta aat ggg aag ggt gct gat tac gtg ttt 192Thr Met Ile Pro Ser Trp
Leu Asn Gly Lys Gly Ala Asp Tyr Val Phe 50 55 60 cac tcg ttt ttc
tat tgg tgt aaa tgg act ggt gtt cat aca aca gtc 240His Ser Phe Phe
Tyr Trp Cys Lys Trp Thr Gly Val His Thr Thr Val 65 70 75 80 tat gga
tat gaa aaa aca caa gtt gaa ggt ccg gct gta gtt att tgt 288Tyr Gly
Tyr Glu Lys Thr Gln Val Glu Gly Pro Ala Val Val Ile Cys 85 90 95
aat cat cag agt tct ctc gac att cta tcg atg gca tca atc tgg ccg
336Asn His Gln Ser Ser Leu Asp Ile Leu Ser Met Ala Ser Ile Trp Pro
100 105 110 aag aat tgt gtt gta atg atg aaa cga att ctt gcc tat gtt
cca ttc 384Lys Asn Cys Val Val Met Met Lys Arg Ile Leu Ala Tyr Val
Pro Phe 115 120 125 ttc aat ctc gga gcc tac ttt tcc aac aca atc ttc
atc gat cga tat 432Phe Asn Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe
Ile Asp Arg Tyr 130 135 140 aac cgt gaa cgt gcg atg gct tca gtt gat
tat tgt gca tct gaa atg 480Asn Arg Glu Arg Ala Met Ala Ser Val Asp
Tyr Cys Ala Ser Glu Met 145 150 155 160 aag aac aga aat ctt aaa ctt
tgg gta tct ccg gaa gga aca aga aat 528Lys Asn Arg Asn Leu Lys Leu
Trp Val Ser Pro Glu Gly Thr Arg Asn 165 170 175 cgt gaa gga ggg ttc
att cca ttc aag aaa gga gca ttc aat att gca 576Arg Glu Gly Gly Phe
Ile Pro Phe Lys Lys Gly Ala Phe Asn Ile Ala 180 185 190 gtt cgt gcg
cag att ccc att att cca gtt gta ttc tca gac tat cgg 624Val Arg Ala
Gln Ile Pro Ile Ile Pro Val Val Phe Ser Asp Tyr Arg 195 200 205 gat
ttc tac tca aag cca ggc cga tat ttc aag aat gat gga gaa gtt 672Asp
Phe Tyr Ser Lys Pro Gly Arg Tyr Phe Lys Asn Asp Gly Glu Val 210 215
220 gtt att cga gtt ctg gat gcg att cca aca aaa ggg ctc act ctt gat
720Val Ile Arg Val Leu Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu Asp
225 230 235 240 gac gtc agc gag ttg tct gat atg tgt cgg gac gtt atg
ttg gca gcc 768Asp Val Ser Glu Leu Ser Asp Met Cys Arg Asp Val Met
Leu Ala Ala 245 250 255 tat aag gaa gtt act cta gaa gct cag caa cga
aat gcg aca cgg cgt 816Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln Arg
Asn Ala Thr Arg Arg 260 265 270 gga gaa aca aaa gac ggg aag aaa tct
gag taa 849Gly Glu Thr Lys Asp Gly Lys Lys Ser Glu 275 280
4282PRTCaenorhabditis elegans 4Met Glu Asn Phe Trp Ser Ile Val Val
Phe Phe Leu Leu Ser Ile Leu 1 5 10 15 Phe Ile Leu Tyr Asn Ile Ser
Thr Val Cys His Tyr Tyr Met Arg Ile 20 25 30 Ser Phe Tyr Tyr Phe
Thr Ile Leu Leu His Gly Met Glu Val Cys Val 35 40 45 Thr Met Ile
Pro Ser Trp Leu Asn Gly Lys Gly Ala Asp Tyr Val Phe 50 55 60 His
Ser Phe Phe Tyr Trp Cys Lys Trp Thr Gly Val His Thr Thr Val 65 70
75 80 Tyr Gly Tyr Glu Lys Thr Gln Val Glu Gly Pro Ala Val Val Ile
Cys 85 90 95 Asn His Gln Ser Ser Leu Asp Ile Leu Ser Met Ala Ser
Ile Trp Pro 100 105 110 Lys Asn Cys Val Val Met Met Lys Arg Ile Leu
Ala Tyr Val Pro Phe 115 120 125 Phe Asn Leu Gly Ala Tyr Phe Ser Asn
Thr Ile Phe Ile Asp Arg Tyr 130 135 140 Asn Arg Glu Arg Ala Met Ala
Ser Val Asp Tyr Cys Ala Ser Glu Met 145 150 155 160 Lys Asn Arg Asn
Leu Lys Leu Trp Val Ser Pro Glu Gly Thr Arg Asn 165 170 175 Arg Glu
Gly Gly Phe Ile Pro Phe Lys Lys Gly Ala Phe Asn Ile Ala 180 185 190
Val Arg Ala Gln Ile Pro Ile Ile Pro Val Val Phe Ser Asp Tyr Arg 195
200 205 Asp Phe Tyr Ser Lys Pro Gly Arg Tyr Phe Lys Asn Asp Gly Glu
Val 210 215 220 Val Ile Arg Val Leu Asp Ala Ile Pro Thr Lys Gly Leu
Thr Leu Asp 225 230 235 240 Asp Val Ser Glu Leu Ser Asp Met Cys Arg
Asp Val Met Leu Ala Ala 245 250 255 Tyr Lys Glu Val Thr Leu Glu Ala
Gln Gln Arg Asn Ala Thr Arg Arg 260 265 270 Gly Glu Thr Lys Asp Gly
Lys Lys Ser Glu 275 280 5849DNACaenorhabditis
elegansCDS(1)..(849)Acyl-CoAlysophospholipid acyltransferase 5atg
gag aac ttc tgg tcg atc gtc gtg ttt ttt cta ctc tca att ctc 48Met
Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu Leu Ser Ile Leu 1 5 10
15 ttc att tta tat aac ata tcg aca gta tgc cac tac tat gtg cgg att
96Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys His Tyr Tyr Val Arg Ile
20 25 30 tcg ttt tat tac ttc aca att tta ttg cat gga atg gaa gtt
tgt gtt 144Ser Phe Tyr Tyr Phe Thr Ile Leu Leu His Gly Met Glu Val
Cys Val 35 40 45 aca atg atc cct tct tgg cta aat ggg aag ggt gct
gat tac gtg ttt 192Thr Met Ile Pro Ser Trp Leu Asn Gly Lys Gly Ala
Asp Tyr Val Phe 50 55 60 cac tcg ttt ttc tat tgg tgt aaa tgg act
ggt gtt cat aca aca gtc 240His Ser Phe Phe Tyr Trp Cys Lys Trp Thr
Gly Val His Thr Thr Val 65 70 75 80 tat gga tat gaa aaa aca caa gtt
gaa ggt ccg gct gta gtt att tgt 288Tyr Gly Tyr Glu Lys Thr Gln Val
Glu Gly Pro Ala Val Val Ile Cys 85 90 95 aat cat cag agt tct ctc
gac att cta tcg atg gca tca atc tgg ccg 336Asn His Gln Ser Ser Leu
Asp Ile Leu Ser Met Ala Ser Ile Trp Pro 100 105 110 aag aat tgt gtt
gta atg atg aaa cga att ctt gcc tat gtt cca ttc 384Lys Asn Cys Val
Val Met Met Lys Arg Ile Leu Ala Tyr Val Pro Phe 115 120 125 ttc aat
ctc gga gcc tac ttt tcc aac aca atc ttc atc gat cga tat 432Phe Asn
Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe Ile Asp Arg Tyr 130 135 140
aac cgt gaa cgt gcg atg gct tca gtt gat tat tgt gca tct gaa atg
480Asn Arg Glu Arg Ala Met Ala Ser Val Asp Tyr Cys Ala Ser Glu Met
145 150 155 160 aag aac aga aat ctt aaa ctt tgg gta ttt ccg gaa gga
aca aga aat 528Lys Asn Arg Asn Leu Lys Leu Trp Val Phe Pro Glu Gly
Thr Arg Asn 165 170 175 cgt gaa gga ggg ttc att cca ttc aag aaa gga
gca ttc aat att gca 576Arg Glu Gly Gly Phe Ile Pro Phe Lys Lys Gly
Ala Phe Asn Ile Ala 180 185 190 gtt cgt gcg cag att ccc att att cca
gtt gta ttc tca gac tat cgg 624Val Arg Ala Gln Ile Pro Ile Ile Pro
Val Val Phe Ser Asp Tyr Arg 195 200 205 gat ttc tac tca aag cca ggc
cga tat ttc aag aat gat gga gaa gtt 672Asp Phe Tyr Ser Lys Pro Gly
Arg Tyr Phe Lys Asn Asp Gly Glu Val 210 215 220 gtt att cga gtt ctg
gat gcg att cca aca aaa ggg ctc act ctt gat 720Val Ile Arg Val Leu
Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu Asp 225 230 235 240 gac gtc
agc gag ttg tct gat atg tgt cgg gac gtt atg ttg gca gcc 768Asp Val
Ser Glu Leu Ser Asp Met Cys Arg Asp Val Met Leu Ala Ala 245 250 255
tat aag gaa gtt act cta gaa gct cag caa cga aat gcg aca cgg cgt
816Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln Arg Asn Ala Thr Arg Arg
260 265 270 gga gaa aca aaa gac ggg aag aaa tct gag taa 849Gly Glu
Thr Lys Asp Gly Lys Lys Ser Glu 275 280 6282PRTCaenorhabditis
elegans 6Met Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu Leu Ser
Ile Leu 1 5 10 15 Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys His Tyr
Tyr Val Arg Ile 20 25 30 Ser Phe Tyr Tyr Phe Thr Ile Leu Leu His
Gly Met Glu Val Cys Val 35 40 45 Thr Met Ile Pro Ser Trp Leu Asn
Gly Lys Gly Ala Asp Tyr Val Phe 50 55 60 His Ser Phe Phe Tyr Trp
Cys Lys Trp Thr Gly Val His Thr Thr Val 65 70 75 80 Tyr Gly Tyr Glu
Lys Thr Gln Val Glu Gly Pro Ala Val Val Ile Cys 85 90 95 Asn His
Gln Ser Ser Leu Asp Ile Leu Ser Met Ala Ser Ile Trp Pro 100 105 110
Lys Asn Cys Val Val Met Met Lys Arg Ile Leu Ala Tyr Val Pro Phe 115
120 125 Phe Asn Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe Ile Asp Arg
Tyr 130 135 140 Asn Arg Glu Arg Ala Met Ala Ser Val Asp Tyr Cys Ala
Ser Glu Met 145 150 155 160 Lys Asn Arg Asn Leu Lys Leu Trp Val Phe
Pro Glu Gly Thr Arg Asn 165 170 175 Arg Glu Gly Gly Phe Ile Pro Phe
Lys Lys Gly Ala Phe Asn Ile Ala 180 185 190 Val Arg Ala Gln Ile Pro
Ile Ile Pro Val Val Phe Ser Asp Tyr Arg 195 200 205 Asp Phe Tyr Ser
Lys Pro Gly Arg Tyr Phe Lys Asn Asp Gly Glu Val 210
215 220 Val Ile Arg Val Leu Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu
Asp 225 230 235 240 Asp Val Ser Glu Leu Ser Asp Met Cys Arg Asp Val
Met Leu Ala Ala 245 250 255 Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln
Arg Asn Ala Thr Arg Arg 260 265 270 Gly Glu Thr Lys Asp Gly Lys Lys
Ser Glu 275 280 7849DNACaenorhabditis
elegansCDS(1)..(849)Acyl-CoAlysophospholipid acyltransferase 7atg
gag aac ttc tgg tcg atc gtc gtg ttt ttt cta ctc tca att ctc 48Met
Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu Leu Ser Ile Leu 1 5 10
15 ttc att tta tat aac ata tcg aca gta tgc cac tac tat atg cgg att
96Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys His Tyr Tyr Met Arg Ile
20 25 30 tcg ttt tat tac ttc aca att tta ttg cat gga atg gaa gtt
tgt gtt 144Ser Phe Tyr Tyr Phe Thr Ile Leu Leu His Gly Met Glu Val
Cys Val 35 40 45 aca atg atc cct tct tgg cta aat ggg aag ggt gct
gat tac gtg ttt 192Thr Met Ile Pro Ser Trp Leu Asn Gly Lys Gly Ala
Asp Tyr Val Phe 50 55 60 cac tcg ttt ttc tat tgg tgt aaa tgg act
ggt gtt cat aca aca gtc 240His Ser Phe Phe Tyr Trp Cys Lys Trp Thr
Gly Val His Thr Thr Val 65 70 75 80 tat gga tat gaa aaa aca caa gtt
gaa ggt ccg gcc gta gtt att tgt 288Tyr Gly Tyr Glu Lys Thr Gln Val
Glu Gly Pro Ala Val Val Ile Cys 85 90 95 aat cat cag ggt tct ctc
gac att cta tcg atg gca tca atc tgg ccg 336Asn His Gln Gly Ser Leu
Asp Ile Leu Ser Met Ala Ser Ile Trp Pro 100 105 110 aag aat tgt gtt
gta atg atg aaa cga att ctt gcc tat gtt cca ttc 384Lys Asn Cys Val
Val Met Met Lys Arg Ile Leu Ala Tyr Val Pro Phe 115 120 125 ttc aat
ctc gga gcc tac ttt tcc aac aca atc ttc atc gat cga tat 432Phe Asn
Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe Ile Asp Arg Tyr 130 135 140
aac cgt gaa cgt gcg atg gct tca gtt gat tat tgt gca tct gaa atg
480Asn Arg Glu Arg Ala Met Ala Ser Val Asp Tyr Cys Ala Ser Glu Met
145 150 155 160 aag aac aga aat ctt aaa ctt tgg gta ttt ccg gaa gga
aca aga aat 528Lys Asn Arg Asn Leu Lys Leu Trp Val Phe Pro Glu Gly
Thr Arg Asn 165 170 175 cgt gaa gga ggg ttc att cca ttc aag aaa gga
gca ttc aat att gca 576Arg Glu Gly Gly Phe Ile Pro Phe Lys Lys Gly
Ala Phe Asn Ile Ala 180 185 190 gtt cgt gcg cag att ccc att att cca
gtt gta ttc tca gac tat cgg 624Val Arg Ala Gln Ile Pro Ile Ile Pro
Val Val Phe Ser Asp Tyr Arg 195 200 205 gat ttc tac tca aag cca ggc
cga tat ttc aag aat gat gga gaa gtt 672Asp Phe Tyr Ser Lys Pro Gly
Arg Tyr Phe Lys Asn Asp Gly Glu Val 210 215 220 gtt att cga gtt ctg
gat gcg att cca aca aaa ggg ctc act ctt gat 720Val Ile Arg Val Leu
Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu Asp 225 230 235 240 gac gtc
agc gag ttg tct gat atg tgt cgg gac gtt atg ttg gca gcc 768Asp Val
Ser Glu Leu Ser Asp Met Cys Arg Asp Val Met Leu Ala Ala 245 250 255
tat aag gaa gtt act cta gaa gct cag caa cga aat gcg aca cgg cgt
816Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln Arg Asn Ala Thr Arg Arg
260 265 270 gga gaa aca aaa gac ggg aag aaa tct gag taa 849Gly Glu
Thr Lys Asp Gly Lys Lys Ser Glu 275 280 8282PRTCaenorhabditis
elegans 8Met Glu Asn Phe Trp Ser Ile Val Val Phe Phe Leu Leu Ser
Ile Leu 1 5 10 15 Phe Ile Leu Tyr Asn Ile Ser Thr Val Cys His Tyr
Tyr Met Arg Ile 20 25 30 Ser Phe Tyr Tyr Phe Thr Ile Leu Leu His
Gly Met Glu Val Cys Val 35 40 45 Thr Met Ile Pro Ser Trp Leu Asn
Gly Lys Gly Ala Asp Tyr Val Phe 50 55 60 His Ser Phe Phe Tyr Trp
Cys Lys Trp Thr Gly Val His Thr Thr Val 65 70 75 80 Tyr Gly Tyr Glu
Lys Thr Gln Val Glu Gly Pro Ala Val Val Ile Cys 85 90 95 Asn His
Gln Gly Ser Leu Asp Ile Leu Ser Met Ala Ser Ile Trp Pro 100 105 110
Lys Asn Cys Val Val Met Met Lys Arg Ile Leu Ala Tyr Val Pro Phe 115
120 125 Phe Asn Leu Gly Ala Tyr Phe Ser Asn Thr Ile Phe Ile Asp Arg
Tyr 130 135 140 Asn Arg Glu Arg Ala Met Ala Ser Val Asp Tyr Cys Ala
Ser Glu Met 145 150 155 160 Lys Asn Arg Asn Leu Lys Leu Trp Val Phe
Pro Glu Gly Thr Arg Asn 165 170 175 Arg Glu Gly Gly Phe Ile Pro Phe
Lys Lys Gly Ala Phe Asn Ile Ala 180 185 190 Val Arg Ala Gln Ile Pro
Ile Ile Pro Val Val Phe Ser Asp Tyr Arg 195 200 205 Asp Phe Tyr Ser
Lys Pro Gly Arg Tyr Phe Lys Asn Asp Gly Glu Val 210 215 220 Val Ile
Arg Val Leu Asp Ala Ile Pro Thr Lys Gly Leu Thr Leu Asp 225 230 235
240 Asp Val Ser Glu Leu Ser Asp Met Cys Arg Asp Val Met Leu Ala Ala
245 250 255 Tyr Lys Glu Val Thr Leu Glu Ala Gln Gln Arg Asn Ala Thr
Arg Arg 260 265 270 Gly Glu Thr Lys Asp Gly Lys Lys Ser Glu 275 280
91578DNAPhyscomitrella patensCDS(1)..(1578)Delta-6-desaturase 9atg
gta ttc gcg ggc ggt gga ctt cag cag ggc tct ctc gaa gaa aac 48Met
Val Phe Ala Gly Gly Gly Leu Gln Gln Gly Ser Leu Glu Glu Asn 1 5 10
15 atc gac gtc gag cac att gcc agt atg tct ctc ttc agc gac ttc ttc
96Ile Asp Val Glu His Ile Ala Ser Met Ser Leu Phe Ser Asp Phe Phe
20 25 30 agt tat gtg tct tca act gtt ggt tcg tgg agc gta cac agt
ata caa 144Ser Tyr Val Ser Ser Thr Val Gly Ser Trp Ser Val His Ser
Ile Gln 35 40 45 cct ttg aag cgc ctg acg agt aag aag cgt gtt tcg
gaa agc gct gcc 192Pro Leu Lys Arg Leu Thr Ser Lys Lys Arg Val Ser
Glu Ser Ala Ala 50 55 60 gtg caa tgt ata tca gct gaa gtt cag aga
aat tcg agt acc cag gga 240Val Gln Cys Ile Ser Ala Glu Val Gln Arg
Asn Ser Ser Thr Gln Gly 65 70 75 80 act gcg gag gca ctc gca gaa tca
gtc gtg aag ccc acg aga cga agg 288Thr Ala Glu Ala Leu Ala Glu Ser
Val Val Lys Pro Thr Arg Arg Arg 85 90 95 tca tct cag tgg aag aag
tcg aca cac ccc cta tca gaa gta gca gta 336Ser Ser Gln Trp Lys Lys
Ser Thr His Pro Leu Ser Glu Val Ala Val 100 105 110 cac aac aag cca
agc gat tgc tgg att gtt gta aaa aac aag gtg tat 384His Asn Lys Pro
Ser Asp Cys Trp Ile Val Val Lys Asn Lys Val Tyr 115 120 125 gat gtt
tcc aat ttt gcg gac gag cat ccc gga gga tca gtt att agt 432Asp Val
Ser Asn Phe Ala Asp Glu His Pro Gly Gly Ser Val Ile Ser 130 135 140
act tat ttt gga cga gac ggc aca gat gtt ttc tct agt ttt cat gca
480Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val Phe Ser Ser Phe His Ala
145 150 155 160 gct tct aca tgg aaa att ctt caa gac ttt tac att ggt
gac gtg gag 528Ala Ser Thr Trp Lys Ile Leu Gln Asp Phe Tyr Ile Gly
Asp Val Glu 165 170 175 agg gtg gag ccg act cca gag ctg ctg aaa gat
ttc cga gaa atg aga 576Arg Val Glu Pro Thr Pro Glu Leu Leu Lys Asp
Phe Arg Glu Met Arg 180 185 190 gct ctt ttc ctg agg gag caa ctt ttc
aaa agt tcg aaa ttg tac tat 624Ala Leu Phe Leu Arg Glu Gln Leu Phe
Lys Ser Ser Lys Leu Tyr Tyr 195 200 205 gtt atg aag ctg ctc acg aat
gtt gct att ttt gct gcg agc att gca 672Val Met Lys Leu Leu Thr Asn
Val Ala Ile Phe Ala Ala Ser Ile Ala 210 215 220 ata ata tgt tgg agc
aag act att tca gcg gtt ttg gct tca gct tgt 720Ile Ile Cys Trp Ser
Lys Thr Ile Ser Ala Val Leu Ala Ser Ala Cys 225 230 235 240 atg atg
gct ctg tgt ttc caa cag tgc gga tgg cta tcc cat gat ttt 768Met Met
Ala Leu Cys Phe Gln Gln Cys Gly Trp Leu Ser His Asp Phe 245 250 255
ctc cac aat cag gtg ttt gag aca cgc tgg ctt aat gaa gtt gtc ggg
816Leu His Asn Gln Val Phe Glu Thr Arg Trp Leu Asn Glu Val Val Gly
260 265 270 tat gtg atc ggc aac gcc gtt ctg ggg ttt agt aca ggg tgg
tgg aag 864Tyr Val Ile Gly Asn Ala Val Leu Gly Phe Ser Thr Gly Trp
Trp Lys 275 280 285 gag aag cat aac ctt cat cat gct gct cca aat gaa
tgc gat cag act 912Glu Lys His Asn Leu His His Ala Ala Pro Asn Glu
Cys Asp Gln Thr 290 295 300 tac caa cca att gat gaa gat att gat act
ctc ccc ctc att gcc tgg 960Tyr Gln Pro Ile Asp Glu Asp Ile Asp Thr
Leu Pro Leu Ile Ala Trp 305 310 315 320 agc aag gac ata ctg gcc aca
gtt gag aat aag aca ttc ttg cga atc 1008Ser Lys Asp Ile Leu Ala Thr
Val Glu Asn Lys Thr Phe Leu Arg Ile 325 330 335 ctc caa tac cag cat
ctg ttc ttc atg ggt ctg tta ttt ttc gcc cgt 1056Leu Gln Tyr Gln His
Leu Phe Phe Met Gly Leu Leu Phe Phe Ala Arg 340 345 350 ggt agt tgg
ctc ttt tgg agc tgg aga tat acc tct aca gca gtg ctc 1104Gly Ser Trp
Leu Phe Trp Ser Trp Arg Tyr Thr Ser Thr Ala Val Leu 355 360 365 tca
cct gtc gac agg ttg ttg gag aag gga act gtt ctg ttt cac tac 1152Ser
Pro Val Asp Arg Leu Leu Glu Lys Gly Thr Val Leu Phe His Tyr 370 375
380 ttt tgg ttc gtc ggg aca gcg tgc tat ctt ctc cct ggt tgg aag cca
1200Phe Trp Phe Val Gly Thr Ala Cys Tyr Leu Leu Pro Gly Trp Lys Pro
385 390 395 400 tta gta tgg atg gcg gtg act gag ctc atg tcc ggc atg
ctg ctg ggc 1248Leu Val Trp Met Ala Val Thr Glu Leu Met Ser Gly Met
Leu Leu Gly 405 410 415 ttt gta ttt gta ctt agc cac aat ggg atg gag
gtt tat aat tcg tct 1296Phe Val Phe Val Leu Ser His Asn Gly Met Glu
Val Tyr Asn Ser Ser 420 425 430 aaa gaa ttc gtg agt gca cag atc gta
tcc aca cgg gat atc aaa gga 1344Lys Glu Phe Val Ser Ala Gln Ile Val
Ser Thr Arg Asp Ile Lys Gly 435 440 445 aac ata ttc aac gac tgg ttc
act ggt ggc ctt aac agg caa ata gag 1392Asn Ile Phe Asn Asp Trp Phe
Thr Gly Gly Leu Asn Arg Gln Ile Glu 450 455 460 cat cat ctt ttc cca
aca atg ccc agg cat aat tta aac aaa ata gca 1440His His Leu Phe Pro
Thr Met Pro Arg His Asn Leu Asn Lys Ile Ala 465 470 475 480 cct aga
gtg gag gtg ttc tgt aag aaa cac ggt ctg gtg tac gaa gac 1488Pro Arg
Val Glu Val Phe Cys Lys Lys His Gly Leu Val Tyr Glu Asp 485 490 495
gta tct att gct acc ggc act tgc aag gtt ttg aaa gca ttg aag gaa
1536Val Ser Ile Ala Thr Gly Thr Cys Lys Val Leu Lys Ala Leu Lys Glu
500 505 510 gtc gcg gag gct gcg gca gag cag cat gct acc acc agt taa
1578Val Ala Glu Ala Ala Ala Glu Gln His Ala Thr Thr Ser 515 520 525
10525PRTPhyscomitrella patens 10Met Val Phe Ala Gly Gly Gly Leu Gln
Gln Gly Ser Leu Glu Glu Asn 1 5 10 15 Ile Asp Val Glu His Ile Ala
Ser Met Ser Leu Phe Ser Asp Phe Phe 20 25 30 Ser Tyr Val Ser Ser
Thr Val Gly Ser Trp Ser Val His Ser Ile Gln 35 40 45 Pro Leu Lys
Arg Leu Thr Ser Lys Lys Arg Val Ser Glu Ser Ala Ala 50 55 60 Val
Gln Cys Ile Ser Ala Glu Val Gln Arg Asn Ser Ser Thr Gln Gly 65 70
75 80 Thr Ala Glu Ala Leu Ala Glu Ser Val Val Lys Pro Thr Arg Arg
Arg 85 90 95 Ser Ser Gln Trp Lys Lys Ser Thr His Pro Leu Ser Glu
Val Ala Val 100 105 110 His Asn Lys Pro Ser Asp Cys Trp Ile Val Val
Lys Asn Lys Val Tyr 115 120 125 Asp Val Ser Asn Phe Ala Asp Glu His
Pro Gly Gly Ser Val Ile Ser 130 135 140 Thr Tyr Phe Gly Arg Asp Gly
Thr Asp Val Phe Ser Ser Phe His Ala 145 150 155 160 Ala Ser Thr Trp
Lys Ile Leu Gln Asp Phe Tyr Ile Gly Asp Val Glu 165 170 175 Arg Val
Glu Pro Thr Pro Glu Leu Leu Lys Asp Phe Arg Glu Met Arg 180 185 190
Ala Leu Phe Leu Arg Glu Gln Leu Phe Lys Ser Ser Lys Leu Tyr Tyr 195
200 205 Val Met Lys Leu Leu Thr Asn Val Ala Ile Phe Ala Ala Ser Ile
Ala 210 215 220 Ile Ile Cys Trp Ser Lys Thr Ile Ser Ala Val Leu Ala
Ser Ala Cys 225 230 235 240 Met Met Ala Leu Cys Phe Gln Gln Cys Gly
Trp Leu Ser His Asp Phe 245 250 255 Leu His Asn Gln Val Phe Glu Thr
Arg Trp Leu Asn Glu Val Val Gly 260 265 270 Tyr Val Ile Gly Asn Ala
Val Leu Gly Phe Ser Thr Gly Trp Trp Lys 275 280 285 Glu Lys His Asn
Leu His His Ala Ala Pro Asn Glu Cys Asp Gln Thr 290 295 300 Tyr Gln
Pro Ile Asp Glu Asp Ile Asp Thr Leu Pro Leu Ile Ala Trp 305 310 315
320 Ser Lys Asp Ile Leu Ala Thr Val Glu Asn Lys Thr Phe Leu Arg Ile
325 330 335 Leu Gln Tyr Gln His Leu Phe Phe Met Gly Leu Leu Phe Phe
Ala Arg 340 345 350 Gly Ser Trp Leu Phe Trp Ser Trp Arg Tyr Thr Ser
Thr Ala Val Leu 355 360 365 Ser Pro Val Asp Arg Leu Leu Glu Lys Gly
Thr Val Leu Phe His Tyr 370 375 380 Phe Trp Phe Val Gly Thr Ala Cys
Tyr Leu Leu Pro Gly Trp Lys Pro 385 390 395 400 Leu Val Trp Met Ala
Val Thr Glu Leu Met Ser Gly Met Leu Leu Gly 405 410 415 Phe Val Phe
Val Leu Ser His Asn Gly Met Glu Val Tyr Asn Ser Ser 420 425 430 Lys
Glu Phe Val Ser Ala Gln Ile Val Ser Thr Arg Asp Ile Lys Gly 435 440
445 Asn Ile Phe Asn Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu
450 455 460 His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Lys
Ile Ala 465 470 475 480 Pro Arg Val Glu Val Phe Cys Lys Lys His Gly
Leu Val Tyr Glu Asp 485 490 495 Val Ser Ile Ala Thr Gly Thr Cys Lys
Val Leu Lys Ala Leu Lys Glu 500 505 510 Val Ala Glu Ala Ala Ala Glu
Gln His Ala Thr Thr Ser 515 520 525 111192DNAPhyscomitrella
patensCDS(58)..(930)Delta-6-elongase 11ctgcttcgtc tcatcttggg
ggtgtgattc
gggagtgggt tgagttggtg gagcgca 57atg gag gtc gtg gag aga ttc tac ggt
gag ttg gat ggg aag gtc tcg 105Met Glu Val Val Glu Arg Phe Tyr Gly
Glu Leu Asp Gly Lys Val Ser 1 5 10 15 cag ggc gtg aat gca ttg ctg
ggt agt ttt ggg gtg gag ttg acg gat 153Gln Gly Val Asn Ala Leu Leu
Gly Ser Phe Gly Val Glu Leu Thr Asp 20 25 30 acg ccc act acc aaa
ggc ttg ccc ctc gtt gac agt ccc aca ccc atc 201Thr Pro Thr Thr Lys
Gly Leu Pro Leu Val Asp Ser Pro Thr Pro Ile 35 40 45 gtc ctc ggt
gtt tct gta tac ttg act att gtc att gga ggg ctt ttg 249Val Leu Gly
Val Ser Val Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50 55 60 tgg
ata aag gcc agg gat ctg aaa ccg cgc gcc tcg gag cca ttt ttg 297Trp
Ile Lys Ala Arg Asp Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu 65 70
75 80 ctc caa gct ttg gtg ctt gtg cac aac ctg ttc tgt ttt gcg ctc
agt 345Leu Gln Ala Leu Val Leu Val His Asn Leu Phe Cys Phe Ala Leu
Ser 85 90 95 ctg tat atg tgc gtg ggc atc gct tat cag gct att acc
tgg cgg tac 393Leu Tyr Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr
Trp Arg Tyr 100 105 110 tct ctc tgg ggc aat gca tac aat cct aaa cat
aaa gag atg gcg att 441Ser Leu Trp Gly Asn Ala Tyr Asn Pro Lys His
Lys Glu Met Ala Ile 115 120 125 ctg gta tac ttg ttc tac atg tct aag
tac gtg gaa ttc atg gat acc 489Leu Val Tyr Leu Phe Tyr Met Ser Lys
Tyr Val Glu Phe Met Asp Thr 130 135 140 gtt atc atg ata ctg aag cgc
agc acc agg caa ata agc ttc ctc cac 537Val Ile Met Ile Leu Lys Arg
Ser Thr Arg Gln Ile Ser Phe Leu His 145 150 155 160 gtt tat cat cat
tct tca att tcc ctc att tgg tgg gct att gct cat 585Val Tyr His His
Ser Ser Ile Ser Leu Ile Trp Trp Ala Ile Ala His 165 170 175 cac gct
cct ggc ggt gaa gca tat tgg tct gcg gct ctg aac tca gga 633His Ala
Pro Gly Gly Glu Ala Tyr Trp Ser Ala Ala Leu Asn Ser Gly 180 185 190
gtg cat gtt ctc atg tat gcg tat tac ttc ttg gct gcc tgc ctt cga
681Val His Val Leu Met Tyr Ala Tyr Tyr Phe Leu Ala Ala Cys Leu Arg
195 200 205 agt agc cca aag tta aaa aat aag tac ctt ttt tgg ggc agg
tac ttg 729Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp Gly Arg
Tyr Leu 210 215 220 aca caa ttc caa atg ttc cag ttt atg ctg aac tta
gtg cag gct tac 777Thr Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu
Val Gln Ala Tyr 225 230 235 240 tac gac atg aaa acg aat gcg cca tat
cca caa tgg ctg atc aag att 825Tyr Asp Met Lys Thr Asn Ala Pro Tyr
Pro Gln Trp Leu Ile Lys Ile 245 250 255 ttg ttc tac tac atg atc tcg
ttg ctg ttt ctt ttc ggc aat ttt tac 873Leu Phe Tyr Tyr Met Ile Ser
Leu Leu Phe Leu Phe Gly Asn Phe Tyr 260 265 270 gta caa aaa tac atc
aaa ccc tct gac gga aag caa aag gga gct aaa 921Val Gln Lys Tyr Ile
Lys Pro Ser Asp Gly Lys Gln Lys Gly Ala Lys 275 280 285 act gag tga
gctgtatcaa gccatagaaa ctctattatg ttagaacctg 970Thr Glu 290
aagttggtgc tttcttatct ccacttatct tttaagcagc atcagttttg aaatgatgtg
1030tgggcgtggt ctgcaagtag tcatcaatat aatcggcctg agcacttcag
atggattgtt 1090agaacatgag taaaagcggt tattacggtg tttattttgt
accaaatcac cgcacgggtg 1150aattgaaata tttcagattt gatcaatttc
atctgaaaaa aa 119212290PRTPhyscomitrella patens 12Met Glu Val Val
Glu Arg Phe Tyr Gly Glu Leu Asp Gly Lys Val Ser 1 5 10 15 Gln Gly
Val Asn Ala Leu Leu Gly Ser Phe Gly Val Glu Leu Thr Asp 20 25 30
Thr Pro Thr Thr Lys Gly Leu Pro Leu Val Asp Ser Pro Thr Pro Ile 35
40 45 Val Leu Gly Val Ser Val Tyr Leu Thr Ile Val Ile Gly Gly Leu
Leu 50 55 60 Trp Ile Lys Ala Arg Asp Leu Lys Pro Arg Ala Ser Glu
Pro Phe Leu 65 70 75 80 Leu Gln Ala Leu Val Leu Val His Asn Leu Phe
Cys Phe Ala Leu Ser 85 90 95 Leu Tyr Met Cys Val Gly Ile Ala Tyr
Gln Ala Ile Thr Trp Arg Tyr 100 105 110 Ser Leu Trp Gly Asn Ala Tyr
Asn Pro Lys His Lys Glu Met Ala Ile 115 120 125 Leu Val Tyr Leu Phe
Tyr Met Ser Lys Tyr Val Glu Phe Met Asp Thr 130 135 140 Val Ile Met
Ile Leu Lys Arg Ser Thr Arg Gln Ile Ser Phe Leu His 145 150 155 160
Val Tyr His His Ser Ser Ile Ser Leu Ile Trp Trp Ala Ile Ala His 165
170 175 His Ala Pro Gly Gly Glu Ala Tyr Trp Ser Ala Ala Leu Asn Ser
Gly 180 185 190 Val His Val Leu Met Tyr Ala Tyr Tyr Phe Leu Ala Ala
Cys Leu Arg 195 200 205 Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe
Trp Gly Arg Tyr Leu 210 215 220 Thr Gln Phe Gln Met Phe Gln Phe Met
Leu Asn Leu Val Gln Ala Tyr 225 230 235 240 Tyr Asp Met Lys Thr Asn
Ala Pro Tyr Pro Gln Trp Leu Ile Lys Ile 245 250 255 Leu Phe Tyr Tyr
Met Ile Ser Leu Leu Phe Leu Phe Gly Asn Phe Tyr 260 265 270 Val Gln
Lys Tyr Ile Lys Pro Ser Asp Gly Lys Gln Lys Gly Ala Lys 275 280 285
Thr Glu 290 131410DNAPhaeodactylum
tricornutumCDS(1)..(1410)Delta-5-desaturase 13atg gct ccg gat gcg
gat aag ctt cga caa cgc cag acg act gcg gta 48Met Ala Pro Asp Ala
Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val 1 5 10 15 gcg aag cac
aat gct gct acc ata tcg acg cag gaa cgc ctt tgc agt 96Ala Lys His
Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser 20 25 30 ctg
tct tcg ctc aaa ggc gaa gaa gtc tgc atc gac gga atc atc tat 144Leu
Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr 35 40
45 gac ctc caa tca ttc gat cat ccc ggg ggt gaa acg atc aaa atg ttt
192Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe
50 55 60 ggt ggc aac gat gtc act gta cag tac aag atg att cac ccg
tac cat 240Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met Ile His Pro
Tyr His 65 70 75 80 acc gag aag cat ttg gaa aag atg aag cgt gtc ggc
aag gtg acg gat 288Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly
Lys Val Thr Asp 85 90 95 ttc gtc tgc gag tac aag ttc gat acc gaa
ttt gaa cgc gaa atc aaa 336Phe Val Cys Glu Tyr Lys Phe Asp Thr Glu
Phe Glu Arg Glu Ile Lys 100 105 110 cga gaa gtc ttc aag att gtg cga
cga ggc aag gat ttc ggt act ttg 384Arg Glu Val Phe Lys Ile Val Arg
Arg Gly Lys Asp Phe Gly Thr Leu 115 120 125 gga tgg ttc ttc cgt gcg
ttt tgc tac att gcc att ttc ttc tac ctg 432Gly Trp Phe Phe Arg Ala
Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu 130 135 140 cag tac cat tgg
gtc acc acg gga acc tct tgg ctg ctg gcc gtg gcc 480Gln Tyr His Trp
Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala 145 150 155 160 tac
gga atc tcc caa gcg atg att ggc atg aat gtc cag cac gat gcc 528Tyr
Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala 165 170
175 aac cac ggg gcc acc tcc aag cgt ccc tgg gtc aac gac atg cta ggc
576Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp Met Leu Gly
180 185 190 ctc ggt gcg gat ttt att ggt ggt tcc aag tgg ctc tgg cag
gaa caa 624Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp Gln
Glu Gln 195 200 205 cac tgg acc cac cac gct tac acc aat cac gcc gag
atg gat ccc gat 672His Trp Thr His His Ala Tyr Thr Asn His Ala Glu
Met Asp Pro Asp 210 215 220 agc ttt ggt gcc gaa cca atg ctc cta ttc
aac gac tat ccc ttg gat 720Ser Phe Gly Ala Glu Pro Met Leu Leu Phe
Asn Asp Tyr Pro Leu Asp 225 230 235 240 cat ccc gct cgt acc tgg cta
cat cgc ttt caa gca ttc ttt tac atg 768His Pro Ala Arg Thr Trp Leu
His Arg Phe Gln Ala Phe Phe Tyr Met 245 250 255 ccc gtc ttg gct gga
tac tgg ttg tcc gct gtc ttc aat cca caa att 816Pro Val Leu Ala Gly
Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile 260 265 270 ctt gac ctc
cag caa cgc ggc gca ctt tcc gtc ggt atc cgt ctc gac 864Leu Asp Leu
Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp 275 280 285 aac
gct ttc att cac tcg cga cgc aag tat gcg gtt ttc tgg cgg gct 912Asn
Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala 290 295
300 gtg tac att gcg gtg aac gtg att gct ccg ttt tac aca aac tcc ggc
960Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser Gly
305 310 315 320 ctc gaa tgg tcc tgg cgt gtc ttt gga aac atc atg ctc
atg ggt gtg 1008Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu
Met Gly Val 325 330 335 gcg gaa tcg ctc gcg ctg gcg gtc ctg ttt tcg
ttg tcg cac aat ttc 1056Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser
Leu Ser His Asn Phe 340 345 350 gaa tcc gcg gat cgc gat ccg acc gcc
cca ctg aaa aag acg gga gaa 1104Glu Ser Ala Asp Arg Asp Pro Thr Ala
Pro Leu Lys Lys Thr Gly Glu 355 360 365 cca gtc gac tgg ttc aag aca
cag gtc gaa act tcc tgc act tac ggt 1152Pro Val Asp Trp Phe Lys Thr
Gln Val Glu Thr Ser Cys Thr Tyr Gly 370 375 380 gga ttc ctt tcc ggt
tgc ttc acg gga ggt ctc aac ttt cag gtt gaa 1200Gly Phe Leu Ser Gly
Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu 385 390 395 400 cac cac
ttg ttc cca cgc atg agc agc gct tgg tat ccc tac att gcc 1248His His
Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala 405 410 415
ccc aag gtc cgc gaa att tgc gcc aaa cac ggc gtc cac tac gcc tac
1296Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr
420 425 430 tac ccg tgg atc cac caa aac ttt ctc tcc acc gtc cgc tac
atg cac 1344Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr
Met His 435 440 445 gcg gcc ggg acc ggt gcc aac tgg cgc cag atg gcc
aga gaa aat ccc 1392Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala
Arg Glu Asn Pro 450 455 460 ttg acc gga cgg gcg taa 1410Leu Thr Gly
Arg Ala 465 14469PRTPhaeodactylum tricornutum 14Met Ala Pro Asp Ala
Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val 1 5 10 15 Ala Lys His
Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser 20 25 30 Leu
Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr 35 40
45 Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe
50 55 60 Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met Ile His Pro
Tyr His 65 70 75 80 Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly
Lys Val Thr Asp 85 90 95 Phe Val Cys Glu Tyr Lys Phe Asp Thr Glu
Phe Glu Arg Glu Ile Lys 100 105 110 Arg Glu Val Phe Lys Ile Val Arg
Arg Gly Lys Asp Phe Gly Thr Leu 115 120 125 Gly Trp Phe Phe Arg Ala
Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu 130 135 140 Gln Tyr His Trp
Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala 145 150 155 160 Tyr
Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala 165 170
175 Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp Met Leu Gly
180 185 190 Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp Gln
Glu Gln 195 200 205 His Trp Thr His His Ala Tyr Thr Asn His Ala Glu
Met Asp Pro Asp 210 215 220 Ser Phe Gly Ala Glu Pro Met Leu Leu Phe
Asn Asp Tyr Pro Leu Asp 225 230 235 240 His Pro Ala Arg Thr Trp Leu
His Arg Phe Gln Ala Phe Phe Tyr Met 245 250 255 Pro Val Leu Ala Gly
Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile 260 265 270 Leu Asp Leu
Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp 275 280 285 Asn
Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala 290 295
300 Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser Gly
305 310 315 320 Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu
Met Gly Val 325 330 335 Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser
Leu Ser His Asn Phe 340 345 350 Glu Ser Ala Asp Arg Asp Pro Thr Ala
Pro Leu Lys Lys Thr Gly Glu 355 360 365 Pro Val Asp Trp Phe Lys Thr
Gln Val Glu Thr Ser Cys Thr Tyr Gly 370 375 380 Gly Phe Leu Ser Gly
Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu 385 390 395 400 His His
Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala 405 410 415
Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr 420
425 430 Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr Met
His 435 440 445 Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg
Glu Asn Pro 450 455 460 Leu Thr Gly Arg Ala 465 153598DNAArtificial
sequenceThis sequence is a plant promoter-terminator expression
cassette in vector pUC19 15tcgcgcgttt cggtgatgac ggtgaaaacc
tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca
gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg
cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accatatgcg
gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
240attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc
tcttcgctat 300tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt
aagttgggta acgccagggt 360tttcccagtc acgacgttgt aaaacgacgg
ccagtgaatt cggcgcgccg agctcctcga 420gcaaatttac acattgccac
taaacgtcta aacccttgta atttgttttt gttttactat 480gtgtgttatg
tatttgattt gcgataaatt tttatatttg gtactaaatt tataacacct
540tttatgctaa cgtttgccaa cacttagcaa tttgcaagtt gattaattga
ttctaaatta 600tttttgtctt ctaaatacat atactaatca actggaaatg
taaatatttg ctaatatttc 660tactatagga gaattaaagt gagtgaatat
ggtaccacaa ggtttggaga tttaattgtt 720gcaatgctgc atggatggca
tatacaccaa acattcaata attcttgagg ataataatgg 780taccacacaa
gatttgaggt gcatgaacgt cacgtggaca
aaaggtttag taatttttca 840agacaacaat gttaccacac acaagttttg
aggtgcatgc atggatgccc tgtggaaagt 900ttaaaaatat tttggaaatg
atttgcatgg aagccatgtg taaaaccatg acatccactt 960ggaggatgca
ataatgaaga aaactacaaa tttacatgca actagttatg catgtagtct
1020atataatgag gattttgcaa tactttcatt catacacact cactaagttt
tacacgatta 1080taatttcttc atagccagcc caccgcggtg ggcggccgcc
tgcagtctag aaggcctcct 1140gctttaatga gatatgcgag acgcctatga
tcgcatgata tttgctttca attctgttgt 1200gcacgttgta aaaaacctga
gcatgtgtag ctcagatcct taccgccggt ttcggttcat 1260tctaatgaat
atatcacccg ttactatcgt atttttatga ataatattct ccgttcaatt
1320tactgattgt ccgtcgacga attcgagctc ggcgcgccaa gcttggcgta
atcatggtca 1380tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc
cacacaacat acgagccgga 1440agcataaagt gtaaagcctg gggtgcctaa
tgagtgagct aactcacatt aattgcgttg 1500cgctcactgc ccgctttcca
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 1560caacgcgcgg
ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac
1620tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa
ggcggtaata 1680cggttatcca cagaatcagg ggataacgca ggaaagaaca
tgtgagcaaa aggccagcaa 1740aaggccagga accgtaaaaa ggccgcgttg
ctggcgtttt tccataggct ccgcccccct 1800gacgagcatc acaaaaatcg
acgctcaagt cagaggtggc gaaacccgac aggactataa 1860agataccagg
cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg
1920cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc
tcatagctca 1980cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
agctgggctg tgtgcacgaa 2040ccccccgttc agcccgaccg ctgcgcctta
tccggtaact atcgtcttga gtccaacccg 2100gtaagacacg acttatcgcc
actggcagca gccactggta acaggattag cagagcgagg 2160tatgtaggcg
gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg
2220acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag
agttggtagc 2280tcttgatccg gcaaacaaac caccgctggt agcggtggtt
tttttgtttg caagcagcag 2340attacgcgca gaaaaaaagg atctcaagaa
gatcctttga tcttttctac ggggtctgac 2400gctcagtgga acgaaaactc
acgttaaggg attttggtca tgagattatc aaaaaggatc 2460ttcacctaga
tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
2520taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc
agcgatctgt 2580ctatttcgtt catccatagt tgcctgactc cccgtcgtgt
agataactac gatacgggag 2640ggcttaccat ctggccccag tgctgcaatg
ataccgcgag acccacgctc accggctcca 2700gatttatcag caataaacca
gccagccgga agggccgagc gcagaagtgg tcctgcaact 2760ttatccgcct
ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
2820gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc
acgctcgtcg 2880tttggtatgg cttcattcag ctccggttcc caacgatcaa
ggcgagttac atgatccccc 2940atgttgtgca aaaaagcggt tagctccttc
ggtcctccga tcgttgtcag aagtaagttg 3000gccgcagtgt tatcactcat
ggttatggca gcactgcata attctcttac tgtcatgcca 3060tccgtaagat
gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
3120atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc
gccacatagc 3180agaactttaa aagtgctcat cattggaaaa cgttcttcgg
ggcgaaaact ctcaaggatc 3240ttaccgctgt tgagatccag ttcgatgtaa
cccactcgtg cacccaactg atcttcagca 3300tcttttactt tcaccagcgt
ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 3360aagggaataa
gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat
3420tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg
tatttagaaa 3480aataaacaaa taggggttcc gcgcacattt ccccgaaaag
tgccacctga cgtctaagaa 3540accattatta tcatgacatt aacctataaa
aataggcgta tcacgaggcc ctttcgtc 3598163590DNAArtificial sequenceThis
sequence is a plant promoter-terminator expression cassette in
vector pUC19 16tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat
gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg
tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg
cggcatcaga gcagattgta ctgagagtgc 180accatatgcg gtgtgaaata
ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240attcgccatt
caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
300tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta
acgccagggt 360tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt
cggcgcgccg agctcctcga 420gcaaatttac acattgccac taaacgtcta
aacccttgta atttgttttt gttttactat 480gtgtgttatg tatttgattt
gcgataaatt tttatatttg gtactaaatt tataacacct 540tttatgctaa
cgtttgccaa cacttagcaa tttgcaagtt gattaattga ttctaaatta
600tttttgtctt ctaaatacat atactaatca actggaaatg taaatatttg
ctaatatttc 660tactatagga gaattaaagt gagtgaatat ggtaccacaa
ggtttggaga tttaattgtt 720gcaatgctgc atggatggca tatacaccaa
acattcaata attcttgagg ataataatgg 780taccacacaa gatttgaggt
gcatgaacgt cacgtggaca aaaggtttag taatttttca 840agacaacaat
gttaccacac acaagttttg aggtgcatgc atggatgccc tgtggaaagt
900ttaaaaatat tttggaaatg atttgcatgg aagccatgtg taaaaccatg
acatccactt 960ggaggatgca ataatgaaga aaactacaaa tttacatgca
actagttatg catgtagtct 1020atataatgag gattttgcaa tactttcatt
catacacact cactaagttt tacacgatta 1080taatttcttc atagccagcg
gatccgatat cgggcccgct agcgttaacc ctgctttaat 1140gagatatgcg
agacgcctat gatcgcatga tatttgcttt caattctgtt gtgcacgttg
1200taaaaaacct gagcatgtgt agctcagatc cttaccgccg gtttcggttc
attctaatga 1260atatatcacc cgttactatc gtatttttat gaataatatt
ctccgttcaa tttactgatt 1320gtccgtcgac gaattcgagc tcggcgcgcc
aagcttggcg taatcatggt catagctgtt 1380tcctgtgtga aattgttatc
cgctcacaat tccacacaac atacgagccg gaagcataaa 1440gtgtaaagcc
tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact
1500gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg
gccaacgcgc 1560ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc
tcgctcactg actcgctgcg 1620ctcggtcgtt cggctgcggc gagcggtatc
agctcactca aaggcggtaa tacggttatc 1680cacagaatca ggggataacg
caggaaagaa catgtgagca aaaggccagc aaaaggccag 1740gaaccgtaaa
aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca
1800tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat
aaagatacca 1860ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt
ccgaccctgc cgcttaccgg 1920atacctgtcc gcctttctcc cttcgggaag
cgtggcgctt tctcatagct cacgctgtag 1980gtatctcagt tcggtgtagg
tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 2040tcagcccgac
cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca
2100cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga
ggtatgtagg 2160cggtgctaca gagttcttga agtggtggcc taactacggc
tacactagaa ggacagtatt 2220tggtatctgc gctctgctga agccagttac
cttcggaaaa agagttggta gctcttgatc 2280cggcaaacaa accaccgctg
gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 2340cagaaaaaaa
ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg
2400gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga
tcttcaccta 2460gatcctttta aattaaaaat gaagttttaa atcaatctaa
agtatatatg agtaaacttg 2520gtctgacagt taccaatgct taatcagtga
ggcacctatc tcagcgatct gtctatttcg 2580ttcatccata gttgcctgac
tccccgtcgt gtagataact acgatacggg agggcttacc 2640atctggcccc
agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc
2700agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa
ctttatccgc 2760ctccatccag tctattaatt gttgccggga agctagagta
agtagttcgc cagttaatag 2820tttgcgcaac gttgttgcca ttgctacagg
catcgtggtg tcacgctcgt cgtttggtat 2880ggcttcattc agctccggtt
cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 2940caaaaaagcg
gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt
3000gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc
catccgtaag 3060atgcttttct gtgactggtg agtactcaac caagtcattc
tgagaatagt gtatgcggcg 3120accgagttgc tcttgcccgg cgtcaatacg
ggataatacc gcgccacata gcagaacttt 3180aaaagtgctc atcattggaa
aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 3240gttgagatcc
agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac
3300tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa
aaaagggaat 3360aagggcgaca cggaaatgtt gaatactcat actcttcctt
tttcaatatt attgaagcat 3420ttatcagggt tattgtctca tgagcggata
catatttgaa tgtatttaga aaaataaaca 3480aataggggtt ccgcgcacat
ttccccgaaa agtgccacct gacgtctaag aaaccattat 3540tatcatgaca
ttaacctata aaaataggcg tatcacgagg ccctttcgtc 3590173584DNAArtificial
sequenceThis sequence is a plant promoter-terminator expression
cassette in vector pUC19 17tcgcgcgttt cggtgatgac ggtgaaaacc
tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca
gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg
cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accatatgcg
gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
240attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc
tcttcgctat 300tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt
aagttgggta acgccagggt 360tttcccagtc acgacgttgt aaaacgacgg
ccagtgaatt cggcgcgccg agctcctcga 420gcaaatttac acattgccac
taaacgtcta aacccttgta atttgttttt gttttactat 480gtgtgttatg
tatttgattt gcgataaatt tttatatttg gtactaaatt tataacacct
540tttatgctaa cgtttgccaa cacttagcaa tttgcaagtt gattaattga
ttctaaatta 600tttttgtctt ctaaatacat atactaatca actggaaatg
taaatatttg ctaatatttc 660tactatagga gaattaaagt gagtgaatat
ggtaccacaa ggtttggaga tttaattgtt 720gcaatgctgc atggatggca
tatacaccaa acattcaata attcttgagg ataataatgg 780taccacacaa
gatttgaggt gcatgaacgt cacgtggaca aaaggtttag taatttttca
840agacaacaat gttaccacac acaagttttg aggtgcatgc atggatgccc
tgtggaaagt 900ttaaaaatat tttggaaatg atttgcatgg aagccatgtg
taaaaccatg acatccactt 960ggaggatgca ataatgaaga aaactacaaa
tttacatgca actagttatg catgtagtct 1020atataatgag gattttgcaa
tactttcatt catacacact cactaagttt tacacgatta 1080taatttcttc
atagccagca gatctgccgg catcgatccc gggccatggc ctgctttaat
1140gagatatgcg agacgcctat gatcgcatga tatttgcttt caattctgtt
gtgcacgttg 1200taaaaaacct gagcatgtgt agctcagatc cttaccgccg
gtttcggttc attctaatga 1260atatatcacc cgttactatc gtatttttat
gaataatatt ctccgttcaa tttactgatt 1320gtccgtcgac gagctcggcg
cgccaagctt ggcgtaatca tggtcatagc tgtttcctgt 1380gtgaaattgt
tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa
1440agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct
cactgcccgc 1500tttccagtcg ggaaacctgt cgtgccagct gcattaatga
atcggccaac gcgcggggag 1560aggcggtttg cgtattgggc gctcttccgc
ttcctcgctc actgactcgc tgcgctcggt 1620cgttcggctg cggcgagcgg
tatcagctca ctcaaaggcg gtaatacggt tatccacaga 1680atcaggggat
aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg
1740taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg
agcatcacaa 1800aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga
ctataaagat accaggcgtt 1860tccccctgga agctccctcg tgcgctctcc
tgttccgacc ctgccgctta ccggatacct 1920gtccgccttt ctcccttcgg
gaagcgtggc gctttctcat agctcacgct gtaggtatct 1980cagttcggtg
taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc
2040cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa
gacacgactt 2100atcgccactg gcagcagcca ctggtaacag gattagcaga
gcgaggtatg taggcggtgc 2160tacagagttc ttgaagtggt ggcctaacta
cggctacact agaaggacag tatttggtat 2220ctgcgctctg ctgaagccag
ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 2280acaaaccacc
gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa
2340aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc
agtggaacga 2400aaactcacgt taagggattt tggtcatgag attatcaaaa
aggatcttca cctagatcct 2460tttaaattaa aaatgaagtt ttaaatcaat
ctaaagtata tatgagtaaa cttggtctga 2520cagttaccaa tgcttaatca
gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 2580catagttgcc
tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg
2640ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt
tatcagcaat 2700aaaccagcca gccggaaggg ccgagcgcag aagtggtcct
gcaactttat ccgcctccat 2760ccagtctatt aattgttgcc gggaagctag
agtaagtagt tcgccagtta atagtttgcg 2820caacgttgtt gccattgcta
caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 2880attcagctcc
ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa
2940agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg
cagtgttatc 3000actcatggtt atggcagcac tgcataattc tcttactgtc
atgccatccg taagatgctt 3060ttctgtgact ggtgagtact caaccaagtc
attctgagaa tagtgtatgc ggcgaccgag 3120ttgctcttgc ccggcgtcaa
tacgggataa taccgcgcca catagcagaa ctttaaaagt 3180gctcatcatt
ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag
3240atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt
ttactttcac 3300cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc
gcaaaaaagg gaataagggc 3360gacacggaaa tgttgaatac tcatactctt
cctttttcaa tattattgaa gcatttatca 3420gggttattgt ctcatgagcg
gatacatatt tgaatgtatt tagaaaaata aacaaatagg 3480ggttccgcgc
acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat
3540gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtc
3584184507DNAArtificial sequenceThis sequence is a plant
promoter-terminator expression cassette in vector pUC19
18tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta
ctgagagtgc 180accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
aaaataccgc atcaggcgcc 240attcgccatt caggctgcgc aactgttggg
aagggcgatc ggtgcgggcc tcttcgctat 300tacgccagct ggcgaaaggg
ggatgtgctg caaggcgatt aagttgggta acgccagggt 360tttcccagtc
acgacgttgt aaaacgacgg ccagtgaatt cggcgcgccg agctcctcga
420gcaaatttac acattgccac taaacgtcta aacccttgta atttgttttt
gttttactat 480gtgtgttatg tatttgattt gcgataaatt tttatatttg
gtactaaatt tataacacct 540tttatgctaa cgtttgccaa cacttagcaa
tttgcaagtt gattaattga ttctaaatta 600tttttgtctt ctaaatacat
atactaatca actggaaatg taaatatttg ctaatatttc 660tactatagga
gaattaaagt gagtgaatat ggtaccacaa ggtttggaga tttaattgtt
720gcaatgctgc atggatggca tatacaccaa acattcaata attcttgagg
ataataatgg 780taccacacaa gatttgaggt gcatgaacgt cacgtggaca
aaaggtttag taatttttca 840agacaacaat gttaccacac acaagttttg
aggtgcatgc atggatgccc tgtggaaagt 900ttaaaaatat tttggaaatg
atttgcatgg aagccatgtg taaaaccatg acatccactt 960ggaggatgca
ataatgaaga aaactacaaa tttacatgca actagttatg catgtagtct
1020atataatgag gattttgcaa tactttcatt catacacact cactaagttt
tacacgatta 1080taatttcttc atagccagcc caccgcggtg ggcggccgcc
tgcagtctag aaggcctcct 1140gctttaatga gatatgcgag acgcctatga
tcgcatgata tttgctttca attctgttgt 1200gcacgttgta aaaaacctga
gcatgtgtag ctcagatcct taccgccggt ttcggttcat 1260tctaatgaat
atatcacccg ttactatcgt atttttatga ataatattct ccgttcaatt
1320tactgattgt ccgtcgagca aatttacaca ttgccactaa acgtctaaac
ccttgtaatt 1380tgtttttgtt ttactatgtg tgttatgtat ttgatttgcg
ataaattttt atatttggta 1440ctaaatttat aacacctttt atgctaacgt
ttgccaacac ttagcaattt gcaagttgat 1500taattgattc taaattattt
ttgtcttcta aatacatata ctaatcaact ggaaatgtaa 1560atatttgcta
atatttctac tataggagaa ttaaagtgag tgaatatggt accacaaggt
1620ttggagattt aattgttgca atgctgcatg gatggcatat acaccaaaca
ttcaataatt 1680cttgaggata ataatggtac cacacaagat ttgaggtgca
tgaacgtcac gtggacaaaa 1740ggtttagtaa tttttcaaga caacaatgtt
accacacaca agttttgagg tgcatgcatg 1800gatgccctgt ggaaagttta
aaaatatttt ggaaatgatt tgcatggaag ccatgtgtaa 1860aaccatgaca
tccacttgga ggatgcaata atgaagaaaa ctacaaattt acatgcaact
1920agttatgcat gtagtctata taatgaggat tttgcaatac tttcattcat
acacactcac 1980taagttttac acgattataa tttcttcata gccagcggat
ccgatatcgg gcccgctagc 2040gttaaccctg ctttaatgag atatgcgaga
cgcctatgat cgcatgatat ttgctttcaa 2100ttctgttgtg cacgttgtaa
aaaacctgag catgtgtagc tcagatcctt accgccggtt 2160tcggttcatt
ctaatgaata tatcacccgt tactatcgta tttttatgaa taatattctc
2220cgttcaattt actgattgtc cgtcgacgaa ttcgagctcg gcgcgccaag
cttggcgtaa 2280tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc
tcacaattcc acacaacata 2340cgagccggaa gcataaagtg taaagcctgg
ggtgcctaat gagtgagcta actcacatta 2400attgcgttgc gctcactgcc
cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 2460tgaatcggcc
aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg
2520ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc
tcactcaaag 2580gcggtaatac ggttatccac agaatcaggg gataacgcag
gaaagaacat gtgagcaaaa 2640ggccagcaaa aggccaggaa ccgtaaaaag
gccgcgttgc tggcgttttt ccataggctc 2700cgcccccctg acgagcatca
caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 2760ggactataaa
gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg
2820accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt
ggcgctttct 2880catagctcac gctgtaggta tctcagttcg gtgtaggtcg
ttcgctccaa gctgggctgt 2940gtgcacgaac cccccgttca gcccgaccgc
tgcgccttat ccggtaacta tcgtcttgag 3000tccaacccgg taagacacga
cttatcgcca ctggcagcag ccactggtaa caggattagc 3060agagcgaggt
atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac
3120actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt
cggaaaaaga 3180gttggtagct cttgatccgg caaacaaacc accgctggta
gcggtggttt ttttgtttgc 3240aagcagcaga ttacgcgcag aaaaaaagga
tctcaagaag atcctttgat cttttctacg 3300gggtctgacg ctcagtggaa
cgaaaactca cgttaaggga ttttggtcat gagattatca 3360aaaaggatct
tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt
3420atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc
acctatctca 3480gcgatctgtc tatttcgttc atccatagtt gcctgactcc
ccgtcgtgta gataactacg 3540atacgggagg gcttaccatc tggccccagt
gctgcaatga taccgcgaga cccacgctca 3600ccggctccag atttatcagc
aataaaccag ccagccggaa gggccgagcg cagaagtggt 3660cctgcaactt
tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt
3720agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat
cgtggtgtca 3780cgctcgtcgt ttggtatggc ttcattcagc tccggttccc
aacgatcaag gcgagttaca 3840tgatccccca tgttgtgcaa aaaagcggtt
agctccttcg gtcctccgat cgttgtcaga 3900agtaagttgg ccgcagtgtt
atcactcatg gttatggcag cactgcataa ttctcttact 3960gtcatgccat
ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga
4020gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga
taataccgcg 4080ccacatagca gaactttaaa agtgctcatc attggaaaac
gttcttcggg gcgaaaactc 4140tcaaggatct taccgctgtt gagatccagt
tcgatgtaac ccactcgtgc acccaactga 4200tcttcagcat cttttacttt
caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 4260gccgcaaaaa
agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt
4320caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat
atttgaatgt 4380atttagaaaa ataaacaaat aggggttccg cgcacatttc
cccgaaaagt gccacctgac 4440gtctaagaaa ccattattat catgacatta
acctataaaa ataggcgtat cacgaggccc 4500tttcgtc
45071917752DNAArtificial sequenceConstruct comprising sequences
encoding Delta-6-elongase of Physcomitrella patens,
Delta-6-desaturase of Physcomitrella patens, and Delta-5-desaturase
of Phaeodactylum
tricornutum 19gatctggcgc cggccagcga gacgagcaag attggccgcc
gcccgaaacg atccgacagc 60gcgcccagca caggtgcgca ggcaaattgc accaacgcat
acagcgccag cagaatgcca 120tagtgggcgg tgacgtcgtt cgagtgaacc
agatcgcgca ggaggcccgg cagcaccggc 180ataatcaggc cgatgccgac
agcgtcgagc gcgacagtgc tcagaattac gatcaggggt 240atgttgggtt
tcacgtctgg cctccggacc agcctccgct ggtccgattg aacgcgcgga
300ttctttatca ctgataagtt ggtggacata ttatgtttat cagtgataaa
gtgtcaagca 360tgacaaagtt gcagccgaat acagtgatcc gtgccgccct
ggacctgttg aacgaggtcg 420gcgtagacgg tctgacgaca cgcaaactgg
cggaacggtt gggggttcag cagccggcgc 480tttactggca cttcaggaac
aagcgggcgc tgctcgacgc actggccgaa gccatgctgg 540cggagaatca
tacgcattcg gtgccgagag ccgacgacga ctggcgctca tttctgatcg
600ggaatgcccg cagcttcagg caggcgctgc tcgcctaccg cgatggcgcg
cgcatccatg 660ccggcacgcg accgggcgca ccgcagatgg aaacggccga
cgcgcagctt cgcttcctct 720gcgaggcggg tttttcggcc ggggacgccg
tcaatgcgct gatgacaatc agctacttca 780ctgttggggc cgtgcttgag
gagcaggccg gcgacagcga tgccggcgag cgcggcggca 840ccgttgaaca
ggctccgctc tcgccgctgt tgcgggccgc gatagacgcc ttcgacgaag
900ccggtccgga cgcagcgttc gagcagggac tcgcggtgat tgtcgatgga
ttggcgaaaa 960ggaggctcgt tgtcaggaac gttgaaggac cgagaaaggg
tgacgattga tcaggaccgc 1020tgccggagcg caacccactc actacagcag
agccatgtag acaacatccc ctcccccttt 1080ccaccgcgtc agacgcccgt
agcagcccgc tacgggcttt ttcatgccct gccctagcgt 1140ccaagcctca
cggccgcgct cggcctctct ggcggccttc tggcgctctt ccgcttcctc
1200gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag
ctcactcaaa 1260ggcggtaata cggttatcca cagaatcagg ggataacgca
ggaaagaaca tgtgagcaaa 1320aggccagcaa aaggccagga accgtaaaaa
ggccgcgttg ctggcgtttt tccataggct 1380ccgcccccct gacgagcatc
acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 1440aggactataa
agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc
1500gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
tggcgctttt 1560ccgctgcata accctgcttc ggggtcatta tagcgatttt
ttcggtatat ccatcctttt 1620tcgcacgata tacaggattt tgccaaaggg
ttcgtgtaga ctttccttgg tgtatccaac 1680ggcgtcagcc gggcaggata
ggtgaagtag gcccacccgc gagcgggtgt tccttcttca 1740ctgtccctta
ttcgcacctg gcggtgctca acgggaatcc tgctctgcga ggctggccgg
1800ctaccgccgg cgtaacagat gagggcaagc ggatggctga tgaaaccaag
ccaaccagga 1860agggcagccc acctatcaag gtgtactgcc ttccagacga
acgaagagcg attgaggaaa 1920aggcggcggc ggccggcatg agcctgtcgg
cctacctgct ggccgtcggc cagggctaca 1980aaatcacggg cgtcgtggac
tatgagcacg tccgcgagct ggcccgcatc aatggcgacc 2040tgggccgcct
gggcggcctg ctgaaactct ggctcaccga cgacccgcgc acggcgcggt
2100tcggtgatgc cacgatcctc gccctgctgg cgaagatcga agagaagcag
gacgagcttg 2160gcaaggtcat gatgggcgtg gtccgcccga gggcagagcc
atgacttttt tagccgctaa 2220aacggccggg gggtgcgcgt gattgccaag
cacgtcccca tgcgctccat caagaagagc 2280gacttcgcgg agctggtgaa
gtacatcacc gacgagcaag gcaagaccga gcgcctttgc 2340gacgctcacc
gggctggttg ccctcgccgc tgggctggcg gccgtctatg gccctgcaaa
2400cgcgccagaa acgccgtcga agccgtgtgc gagacaccgc ggccgccggc
gttgtggata 2460cctcgcggaa aacttggccc tcactgacag atgaggggcg
gacgttgaca cttgaggggc 2520cgactcaccc ggcgcggcgt tgacagatga
ggggcaggct cgatttcggc cggcgacgtg 2580gagctggcca gcctcgcaaa
tcggcgaaaa cgcctgattt tacgcgagtt tcccacagat 2640gatgtggaca
agcctgggga taagtgccct gcggtattga cacttgaggg gcgcgactac
2700tgacagatga ggggcgcgat ccttgacact tgaggggcag agtgctgaca
gatgaggggc 2760gcacctattg acatttgagg ggctgtccac aggcagaaaa
tccagcattt gcaagggttt 2820ccgcccgttt ttcggccacc gctaacctgt
cttttaacct gcttttaaac caatatttat 2880aaaccttgtt tttaaccagg
gctgcgccct gtgcgcgtga ccgcgcacgc cgaagggggg 2940tgccccccct
tctcgaaccc tcccggcccg ctaacgcggg cctcccatcc ccccaggggc
3000tgcgcccctc ggccgcgaac ggcctcaccc caaaaatggc agcgctggca
gtccttgcca 3060ttgccgggat cggggcagta acgggatggg cgatcagccc
gagcgcgacg cccggaagca 3120ttgacgtgcc gcaggtgctg gcatcgacat
tcagcgacca ggtgccgggc agtgagggcg 3180gcggcctggg tggcggcctg
cccttcactt cggccgtcgg ggcattcacg gacttcatgg 3240cggggccggc
aatttttacc ttgggcattc ttggcatagt ggtcgcgggt gccgtgctcg
3300tgttcggggg tgcgataaac ccagcgaacc atttgaggtg ataggtaaga
ttataccgag 3360gtatgaaaac gagaattgga cctttacaga attactctat
gaagcgccat atttaaaaag 3420ctaccaagac gaagaggatg aagaggatga
ggaggcagat tgccttgaat atattgacaa 3480tactgataag ataatatatc
ttttatatag aagatatcgc cgtatgtaag gatttcaggg 3540ggcaaggcat
aggcagcgcg cttatcaata tatctataga atgggcaaag cataaaaact
3600tgcatggact aatgcttgaa acccaggaca ataaccttat agcttgtaaa
ttctatcata 3660attgggtaat gactccaact tattgatagt gttttatgtt
cagataatgc ccgatgactt 3720tgtcatgcag ctccaccgat tttgagaacg
acagcgactt ccgtcccagc cgtgccaggt 3780gctgcctcag attcaggtta
tgccgctcaa ttcgctgcgt atatcgcttg ctgattacgt 3840gcagctttcc
cttcaggcgg gattcataca gcggccagcc atccgtcatc catatcacca
3900cgtcaaaggg tgacagcagg ctcataagac gccccagcgt cgccatagtg
cgttcaccga 3960atacgtgcgc aacaaccgtc ttccggagac tgtcatacgc
gtaaaacagc cagcgctggc 4020gcgatttagc cccgacatag ccccactgtt
cgtccatttc cgcgcagacg atgacgtcac 4080tgcccggctg tatgcgcgag
gttaccgact gcggcctgag ttttttaagt gacgtaaaat 4140cgtgttgagg
ccaacgccca taatgcgggc tgttgcccgg catccaacgc cattcatggc
4200catatcaatg attttctggt gcgtaccggg ttgagaagcg gtgtaagtga
actgcagttg 4260ccatgtttta cggcagtgag agcagagata gcgctgatgt
ccggcggtgc ttttgccgtt 4320acgcaccacc ccgtcagtag ctgaacagga
gggacagctg atagacacag aagccactgg 4380agcacctcaa aaacaccatc
atacactaaa tcagtaagtt ggcagcatca cccataattg 4440tggtttcaaa
atcggctccg tcgatactat gttatacgcc aactttgaaa acaactttga
4500aaaagctgtt ttctggtatt taaggtttta gaatgcaagg aacagtgaat
tggagttcgt 4560cttgttataa ttagcttctt ggggtatctt taaatactgt
agaaaagagg aaggaaataa 4620taaatggcta aaatgagaat atcaccggaa
ttgaaaaaac tgatcgaaaa ataccgctgc 4680gtaaaagata cggaaggaat
gtctcctgct aaggtatata agctggtggg agaaaatgaa 4740aacctatatt
taaaaatgac ggacagccgg tataaaggga ccacctatga tgtggaacgg
4800gaaaaggaca tgatgctatg gctggaagga aagctgcctg ttccaaaggt
cctgcacttt 4860gaacggcatg atggctggag caatctgctc atgagtgagg
ccgatggcgt cctttgctcg 4920gaagagtatg aagatgaaca aagccctgaa
aagattatcg agctgtatgc ggagtgcatc 4980aggctctttc actccatcga
catatcggat tgtccctata cgaatagctt agacagccgc 5040ttagccgaat
tggattactt actgaataac gatctggccg atgtggattg cgaaaactgg
5100gaagaagaca ctccatttaa agatccgcgc gagctgtatg attttttaaa
gacggaaaag 5160cccgaagagg aacttgtctt ttcccacggc gacctgggag
acagcaacat ctttgtgaaa 5220gatggcaaag taagtggctt tattgatctt
gggagaagcg gcagggcgga caagtggtat 5280gacattgcct tctgcgtccg
gtcgatcagg gaggatatcg gggaagaaca gtatgtcgag 5340ctattttttg
acttactggg gatcaagcct gattgggaga aaataaaata ttatatttta
5400ctggatgaat tgttttagta cctagatgtg gcgcaacgat gccggcgaca
agcaggagcg 5460caccgacttc ttccgcatca agtgttttgg ctctcaggcc
gaggcccacg gcaagtattt 5520gggcaagggg tcgctggtat tcgtgcaggg
caagattcgg aataccaagt acgagaagga 5580cggccagacg gtctacggga
ccgacttcat tgccgataag gtggattatc tggacaccaa 5640ggcaccaggc
gggtcaaatc aggaataagg gcacattgcc ccggcgtgag tcggggcaat
5700cccgcaagga gggtgaatga atcggacgtt tgaccggaag gcatacaggc
aagaactgat 5760cgacgcgggg ttttccgccg aggatgccga aaccatcgca
agccgcaccg tcatgcgtgc 5820gccccgcgaa accttccagt ccgtcggctc
gatggtccag caagctacgg ccaagatcga 5880gcgcgacagc gtgcaactgg
ctccccctgc cctgcccgcg ccatcggccg ccgtggagcg 5940ttcgcgtcgt
ctcgaacagg aggcggcagg tttggcgaag tcgatgacca tcgacacgcg
6000aggaactatg acgaccaaga agcgaaaaac cgccggcgag gacctggcaa
aacaggtcag 6060cgaggccaag caggccgcgt tgctgaaaca cacgaagcag
cagatcaagg aaatgcagct 6120ttccttgttc gatattgcgc cgtggccgga
cacgatgcga gcgatgccaa acgacacggc 6180ccgctctgcc ctgttcacca
cgcgcaacaa gaaaatcccg cgcgaggcgc tgcaaaacaa 6240ggtcattttc
cacgtcaaca aggacgtgaa gatcacctac accggcgtcg agctgcgggc
6300cgacgatgac gaactggtgt ggcagcaggt gttggagtac gcgaagcgca
cccctatcgg 6360cgagccgatc accttcacgt tctacgagct ttgccaggac
ctgggctggt cgatcaatgg 6420ccggtattac acgaaggccg aggaatgcct
gtcgcgccta caggcgacgg cgatgggctt 6480cacgtccgac cgcgttgggc
acctggaatc ggtgtcgctg ctgcaccgct tccgcgtcct 6540ggaccgtggc
aagaaaacgt cccgttgcca ggtcctgatc gacgaggaaa tcgtcgtgct
6600gtttgctggc gaccactaca cgaaattcat atgggagaag taccgcaagc
tgtcgccgac 6660ggcccgacgg atgttcgact atttcagctc gcaccgggag
ccgtacccgc tcaagctgga 6720aaccttccgc ctcatgtgcg gatcggattc
cacccgcgtg aagaagtggc gcgagcaggt 6780cggcgaagcc tgcgaagagt
tgcgaggcag cggcctggtg gaacacgcct gggtcaatga 6840tgacctggtg
cattgcaaac gctagggcct tgtggggtca gttccggctg ggggttcagc
6900agccagcgct ttactggcat ttcaggaaca agcgggcact gctcgacgca
cttgcttcgc 6960tcagtatcgc tcgggacgca cggcgcgctc tacgaactgc
cgataaacag aggattaaaa 7020ttgacaattg tgattaaggc tcagattcga
cggcttggag cggccgacgt gcaggatttc 7080cgcgagatcc gattgtcggc
cctgaagaaa gctccagaga tgttcgggtc cgtttacgag 7140cacgaggaga
aaaagcccat ggaggcgttc gctgaacggt tgcgagatgc cgtggcattc
7200ggcgcctaca tcgacggcga gatcattggg ctgtcggtct tcaaacagga
ggacggcccc 7260aaggacgctc acaaggcgca tctgtccggc gttttcgtgg
agcccgaaca gcgaggccga 7320ggggtcgccg gtatgctgct gcgggcgttg
ccggcgggtt tattgctcgt gatgatcgtc 7380cgacagattc caacgggaat
ctggtggatg cgcatcttca tcctcggcgc acttaatatt 7440tcgctattct
ggagcttgtt gtttatttcg gtctaccgcc tgccgggcgg ggtcgcggcg
7500acggtaggcg ctgtgcagcc gctgatggtc gtgttcatct ctgccgctct
gctaggtagc 7560ccgatacgat tgatggcggt cctgggggct atttgcggaa
ctgcgggcgt ggcgctgttg 7620gtgttgacac caaacgcagc gctagatcct
gtcggcgtcg cagcgggcct ggcgggggcg 7680gtttccatgg cgttcggaac
cgtgctgacc cgcaagtggc aacctcccgt gcctctgctc 7740acctttaccg
cctggcaact ggcggccgga ggacttctgc tcgttccagt agctttagtg
7800tttgatccgc caatcccgat gcctacagga accaatgttc tcggcctggc
gtggctcggc 7860ctgatcggag cgggtttaac ctacttcctt tggttccggg
ggatctcgcg actcgaacct 7920acagttgttt ccttactggg ctttctcagc
cccagatctg gggtcgatca gccggggatg 7980catcaggccg acagtcggaa
cttcgggtcc ccgacctgta ccattcggtg agcaatggat 8040aggggagttg
atatcgtcaa cgttcacttc taaagaaata gcgccactca gcttcctcag
8100cggctttatc cagcgatttc ctattatgtc ggcatagttc tcaagatcga
cagcctgtca 8160cggttaagcg agaaatgaat aagaaggctg ataattcgga
tctctgcgag ggagatgata 8220tttgatcaca ggcagcaacg ctctgtcatc
gttacaatca acatgctacc ctccgcgaga 8280tcatccgtgt ttcaaacccg
gcagcttagt tgccgttctt ccgaatagca tcggtaacat 8340gagcaaagtc
tgccgcctta caacggctct cccgctgacg ccgtcccgga ctgatgggct
8400gcctgtatcg agtggtgatt ttgtgccgag ctgccggtcg gggagctgtt
ggctggctgg 8460tggcaggata tattgtggtg taaacaaatt gacgcttaga
caacttaata acacattgcg 8520gacgttttta atgtactggg gtggtttttc
ttttcaccag tgagacgggc aacagctgat 8580tgcccttcac cgcctggccc
tgagagagtt gcagcaagcg gtccacgctg gtttgcccca 8640gcaggcgaaa
atcctgtttg atggtggttc cgaaatcggc aaaatccctt ataaatcaaa
8700agaatagccc gagatagggt tgagtgttgt tccagtttgg aacaagagtc
cactattaaa 8760gaacgtggac tccaacgtca aagggcgaaa aaccgtctat
cagggcgatg gcccactacg 8820tgaaccatca cccaaatcaa gttttttggg
gtcgaggtgc cgtaaagcac taaatcggaa 8880ccctaaaggg agcccccgat
ttagagcttg acggggaaag ccggcgaacg tggcgagaaa 8940ggaagggaag
aaagcgaaag gagcgggcgc cattcaggct gcgcaactgt tgggaagggc
9000gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt
gctgcaaggc 9060gattaagttg ggtaacgcca gggttttccc agtcacgacg
ttgtaaaacg acggccagtg 9120aattaattcc catcttgaaa gaaatatagt
ttaaatattt attgataaaa taacaagtca 9180ggtattatag tccaagcaaa
aacataaatt tattgatgca agtttaaatt cagaaatatt 9240tcaataactg
attatatcag ctggtacatt gccgtagatg aaagactgag tgcgatatta
9300tgtgtaatac ataaattgat gatatagcta gcttagctca tcgggggatc
cgtcgaagct 9360agcttgggtc ccgctcagaa gaactcgtca agaaggcgat
agaaggcgat gcgctgcgaa 9420tcgggagcgg cgataccgta aagcacgagg
aagcggtcag cccattcgcc gccaagctct 9480tcagcaatat cacgggtagc
caacgctatg tcctgatagc ggtccgccac acccagccgg 9540ccacagtcga
tgaatccaga aaagcggcca ttttccacca tgatattcgg caagcaggca
9600tcgccatggg tcacgacgag atcctcgccg tcgggcatgc gcgccttgag
cctggcgaac 9660agttcggctg gcgcgagccc ctgatgctct tcgtccagat
catcctgatc gacaagaccg 9720gcttccatcc gagtacgtgc tcgctcgatg
cgatgtttcg cttggtggtc gaatgggcag 9780gtagccggat caagcgtatg
cagccgccgc attgcatcag ccatgatgga tactttctcg 9840gcaggagcaa
ggtgagatga caggagatcc tgccccggca cttcgcccaa tagcagccag
9900tcccttcccg cttcagtgac aacgtcgagc acagctgcgc aaggaacgcc
cgtcgtggcc 9960agccacgata gccgcgctgc ctcgtcctgc agttcattca
gggcaccgga caggtcggtc 10020ttgacaaaaa gaaccgggcg cccctgcgct
gacagccgga acacggcggc atcagagcag 10080ccgattgtct gttgtgccca
gtcatagccg aatagcctct ccacccaagc ggccggagaa 10140cctgcgtgca
atccatcttg ttcaatccaa gctcccatgg gccctcgact agagtcgaga
10200tctggattga gagtgaatat gagactctaa ttggataccg aggggaattt
atggaacgtc 10260agtggagcat ttttgacaag aaatatttgc tagctgatag
tgaccttagg cgacttttga 10320acgcgcaata atggtttctg acgtatgtgc
ttagctcatt aaactccaga aacccgcggc 10380tgagtggctc cttcaacgtt
gcggttctgt cagttccaaa cgtaaaacgg cttgtcccgc 10440gtcatcggcg
ggggtcataa cgtgactccc ttaattctcc gctcatgatc ttgatcccct
10500gcgccatcag atccttggcg gcaagaaagc catccagttt actttgcagg
gcttcccaac 10560cttaccagag ggcgccccag ctggcaattc cggttcgctt
gctgtccata aaaccgccca 10620gtctagctat cgccatgtaa gcccactgca
agctacctgc tttctctttg cgcttgcgtt 10680ttcccttgtc cagatagccc
agtagctgac attcatccgg ggtcagcacc gtttctgcgg 10740actggctttc
tacgtgttcc gcttccttta gcagcccttg cgccctgagt gcttgcggca
10800gcgtgaagct tgcatgcctg caggtcgacg gcgcgccgag ctcctcgagc
aaatttacac 10860attgccacta aacgtctaaa cccttgtaat ttgtttttgt
tttactatgt gtgttatgta 10920tttgatttgc gataaatttt tatatttggt
actaaattta taacaccttt tatgctaacg 10980tttgccaaca cttagcaatt
tgcaagttga ttaattgatt ctaaattatt tttgtcttct 11040aaatacatat
actaatcaac tggaaatgta aatatttgct aatatttcta ctataggaga
11100attaaagtga gtgaatatgg taccacaagg tttggagatt taattgttgc
aatgctgcat 11160ggatggcata tacaccaaac attcaataat tcttgaggat
aataatggta ccacacaaga 11220tttgaggtgc atgaacgtca cgtggacaaa
aggtttagta atttttcaag acaacaatgt 11280taccacacac aagttttgag
gtgcatgcat ggatgccctg tggaaagttt aaaaatattt 11340tggaaatgat
ttgcatggaa gccatgtgta aaaccatgac atccacttgg aggatgcaat
11400aatgaagaaa actacaaatt tacatgcaac tagttatgca tgtagtctat
ataatgagga 11460ttttgcaata ctttcattca tacacactca ctaagtttta
cacgattata atttcttcat 11520agccagccca ccgcggtgga aa atg gag gtc gtg
gag aga ttc tac ggt gag 11572 Met Glu Val Val Glu Arg Phe Tyr Gly
Glu 1 5 10 ttg gat ggg aag gtc tcg cag ggc gtg aat gca ttg ctg ggt
agt ttt 11620Leu Asp Gly Lys Val Ser Gln Gly Val Asn Ala Leu Leu
Gly Ser Phe 15 20 25 ggg gtg gag ttg acg gat acg ccc act acc aaa
ggc ttg ccc ctc gtt 11668Gly Val Glu Leu Thr Asp Thr Pro Thr Thr
Lys Gly Leu Pro Leu Val 30 35 40 gac agt ccc aca ccc atc gtc ctc
ggt gtt tct gta tac ttg act att 11716Asp Ser Pro Thr Pro Ile Val
Leu Gly Val Ser Val Tyr Leu Thr Ile 45 50 55 gtc att gga ggg ctt
ttg tgg ata aag gcc agg gat ctg aaa ccg cgc 11764Val Ile Gly Gly
Leu Leu Trp Ile Lys Ala Arg Asp Leu Lys Pro Arg 60 65 70 gcc tcg
gag cca ttt ttg ctc caa gct ttg gtg ctt gtg cac aac ctg 11812Ala
Ser Glu Pro Phe Leu Leu Gln Ala Leu Val Leu Val His Asn Leu 75 80
85 90 ttc tgt ttt gcg ctc agt ctg tat atg tgc gtg ggc atc gct tat
cag 11860Phe Cys Phe Ala Leu Ser Leu Tyr Met Cys Val Gly Ile Ala
Tyr Gln 95 100 105 gct att acc tgg cgg tac tct ctc tgg ggc aat gca
tac aat cct aaa 11908Ala Ile Thr Trp Arg Tyr Ser Leu Trp Gly Asn
Ala Tyr Asn Pro Lys 110 115 120 cat aaa gag atg gcg att ctg gta tac
ttg ttc tac atg tct aag tac 11956His Lys Glu Met Ala Ile Leu Val
Tyr Leu Phe Tyr Met Ser Lys Tyr 125 130 135 gtg gaa ttc atg gat acc
gtt atc atg ata ctg aag cgc agc acc agg 12004Val Glu Phe Met Asp
Thr Val Ile Met Ile Leu Lys Arg Ser Thr Arg 140 145 150 caa ata agc
ttc ctc cac gtt tat cat cat tct tca att tcc ctc att 12052Gln Ile
Ser Phe Leu His Val Tyr His His Ser Ser Ile Ser Leu Ile 155 160 165
170 tgg tgg gct att gct cat cac gct cct ggc ggt gaa gca tat tgg tct
12100Trp Trp Ala Ile Ala His His Ala Pro Gly Gly Glu Ala Tyr Trp
Ser 175 180 185 gcg gct ctg aac tca gga gtg cat gtt ctc atg tat gcg
tat tac ttc 12148Ala Ala Leu Asn Ser Gly Val His Val Leu Met Tyr
Ala Tyr Tyr Phe 190 195 200 ttg gct gcc tgc ctt cga agt agc cca aag
tta aaa aat aag tac ctt 12196Leu Ala Ala Cys Leu Arg Ser Ser Pro
Lys Leu Lys Asn Lys Tyr Leu 205 210 215 ttt tgg ggc agg tac ttg aca
caa ttc caa atg ttc cag ttt atg ctg 12244Phe Trp Gly Arg Tyr Leu
Thr Gln Phe Gln Met Phe Gln Phe Met Leu 220 225 230 aac tta gtg cag
gct tac tac gac atg aaa acg aat gcg cca tat cca 12292Asn Leu Val
Gln Ala Tyr Tyr Asp Met Lys Thr Asn Ala Pro Tyr Pro 235 240 245 250
caa tgg ctg atc aag att ttg ttc tac tac atg atc tcg ttg ctg ttt
12340Gln Trp Leu Ile Lys Ile Leu Phe Tyr Tyr Met Ile Ser Leu Leu
Phe 255 260 265 ctt ttc ggc aat ttt tac gta caa aaa tac atc aaa ccc
tct gac gga 12388Leu Phe Gly Asn Phe Tyr Val Gln Lys Tyr Ile Lys
Pro Ser Asp Gly 270 275 280 aag caa aag gga gct aaa act gag tga
tctagaaggc ctcctgcttt 12435Lys Gln Lys Gly Ala Lys Thr Glu 285 290
aatgagatat gcgagacgcc tatgatcgca tgatatttgc tttcaattct gttgtgcacg
12495ttgtaaaaaa cctgagcatg tgtagctcag atccttaccg ccggtttcgg
ttcattctaa
12555tgaatatatc acccgttact atcgtatttt tatgaataat attctccgtt
caatttactg 12615attgtccgtc gagcaaattt acacattgcc actaaacgtc
taaacccttg taatttgttt 12675ttgttttact atgtgtgtta tgtatttgat
ttgcgataaa tttttatatt tggtactaaa 12735tttataacac cttttatgct
aacgtttgcc aacacttagc aatttgcaag ttgattaatt 12795gattctaaat
tatttttgtc ttctaaatac atatactaat caactggaaa tgtaaatatt
12855tgctaatatt tctactatag gagaattaaa gtgagtgaat atggtaccac
aaggtttgga 12915gatttaattg ttgcaatgct gcatggatgg catatacacc
aaacattcaa taattcttga 12975ggataataat ggtaccacac aagatttgag
gtgcatgaac gtcacgtgga caaaaggttt 13035agtaattttt caagacaaca
atgttaccac acacaagttt tgaggtgcat gcatggatgc 13095cctgtggaaa
gtttaaaaat attttggaaa tgatttgcat ggaagccatg tgtaaaacca
13155tgacatccac ttggaggatg caataatgaa gaaaactaca aatttacatg
caactagtta 13215tgcatgtagt ctatataatg aggattttgc aatactttca
ttcatacaca ctcactaagt 13275tttacacgat tataatttct tcatagccag cggatcc
atg gta ttc gcg ggc ggt 13330 Met Val Phe Ala Gly Gly 295 gga ctt
cag cag ggc tct ctc gaa gaa aac atc gac gtc gag cac att 13378Gly
Leu Gln Gln Gly Ser Leu Glu Glu Asn Ile Asp Val Glu His Ile 300 305
310 gcc agt atg tct ctc ttc agc gac ttc ttc agt tat gtg tct tca act
13426Ala Ser Met Ser Leu Phe Ser Asp Phe Phe Ser Tyr Val Ser Ser
Thr 315 320 325 gtt ggt tcg tgg agc gta cac agt ata caa cct ttg aag
cgc ctg acg 13474Val Gly Ser Trp Ser Val His Ser Ile Gln Pro Leu
Lys Arg Leu Thr 330 335 340 agt aag aag cgt gtt tcg gaa agc gct gcc
gtg caa tgt ata tca gct 13522Ser Lys Lys Arg Val Ser Glu Ser Ala
Ala Val Gln Cys Ile Ser Ala 345 350 355 360 gaa gtt cag aga aat tcg
agt acc cag gga act gcg gag gca ctc gca 13570Glu Val Gln Arg Asn
Ser Ser Thr Gln Gly Thr Ala Glu Ala Leu Ala 365 370 375 gaa tca gtc
gtg aag ccc acg aga cga agg tca tct cag tgg aag aag 13618Glu Ser
Val Val Lys Pro Thr Arg Arg Arg Ser Ser Gln Trp Lys Lys 380 385 390
tcg aca cac ccc cta tca gaa gta gca gta cac aac aag cca agc gat
13666Ser Thr His Pro Leu Ser Glu Val Ala Val His Asn Lys Pro Ser
Asp 395 400 405 tgc tgg att gtt gta aaa aac aag gtg tat gat gtt tcc
aat ttt gcg 13714Cys Trp Ile Val Val Lys Asn Lys Val Tyr Asp Val
Ser Asn Phe Ala 410 415 420 gac gag cat ccc gga gga tca gtt att agt
act tat ttt gga cga gac 13762Asp Glu His Pro Gly Gly Ser Val Ile
Ser Thr Tyr Phe Gly Arg Asp 425 430 435 440 ggc aca gat gtt ttc tct
agt ttt cat gca gct tct aca tgg aaa att 13810Gly Thr Asp Val Phe
Ser Ser Phe His Ala Ala Ser Thr Trp Lys Ile 445 450 455 ctt caa gac
ttt tac att ggt gac gtg gag agg gtg gag ccg act cca 13858Leu Gln
Asp Phe Tyr Ile Gly Asp Val Glu Arg Val Glu Pro Thr Pro 460 465 470
gag ctg ctg aaa gat ttc cga gaa atg aga gct ctt ttc ctg agg gag
13906Glu Leu Leu Lys Asp Phe Arg Glu Met Arg Ala Leu Phe Leu Arg
Glu 475 480 485 caa ctt ttc aaa agt tcg aaa ttg tac tat gtt atg aag
ctg ctc acg 13954Gln Leu Phe Lys Ser Ser Lys Leu Tyr Tyr Val Met
Lys Leu Leu Thr 490 495 500 aat gtt gct att ttt gct gcg agc att gca
ata ata tgt tgg agc aag 14002Asn Val Ala Ile Phe Ala Ala Ser Ile
Ala Ile Ile Cys Trp Ser Lys 505 510 515 520 act att tca gcg gtt ttg
gct tca gct tgt atg atg gct ctg tgt ttc 14050Thr Ile Ser Ala Val
Leu Ala Ser Ala Cys Met Met Ala Leu Cys Phe 525 530 535 caa cag tgc
gga tgg cta tcc cat gat ttt ctc cac aat cag gtg ttt 14098Gln Gln
Cys Gly Trp Leu Ser His Asp Phe Leu His Asn Gln Val Phe 540 545 550
gag aca cgc tgg ctt aat gaa gtt gtc ggg tat gtg atc ggc aac gcc
14146Glu Thr Arg Trp Leu Asn Glu Val Val Gly Tyr Val Ile Gly Asn
Ala 555 560 565 gtt ctg ggg ttt agt aca ggg tgg tgg aag gag aag cat
aac ctt cat 14194Val Leu Gly Phe Ser Thr Gly Trp Trp Lys Glu Lys
His Asn Leu His 570 575 580 cat gct gct cca aat gaa tgc gat cag act
tac caa cca att gat gaa 14242His Ala Ala Pro Asn Glu Cys Asp Gln
Thr Tyr Gln Pro Ile Asp Glu 585 590 595 600 gat att gat act ctc ccc
ctc att gcc tgg agc aag gac ata ctg gcc 14290Asp Ile Asp Thr Leu
Pro Leu Ile Ala Trp Ser Lys Asp Ile Leu Ala 605 610 615 aca gtt gag
aat aag aca ttc ttg cga atc ctc caa tac cag cat ctg 14338Thr Val
Glu Asn Lys Thr Phe Leu Arg Ile Leu Gln Tyr Gln His Leu 620 625 630
ttc ttc atg ggt ctg tta ttt ttc gcc cgt ggt agt tgg ctc ttt tgg
14386Phe Phe Met Gly Leu Leu Phe Phe Ala Arg Gly Ser Trp Leu Phe
Trp 635 640 645 agc tgg aga tat acc tct aca gca gtg ctc tca cct gtc
gac agg ttg 14434Ser Trp Arg Tyr Thr Ser Thr Ala Val Leu Ser Pro
Val Asp Arg Leu 650 655 660 ttg gag aag gga act gtt ctg ttt cac tac
ttt tgg ttc gtc ggg aca 14482Leu Glu Lys Gly Thr Val Leu Phe His
Tyr Phe Trp Phe Val Gly Thr 665 670 675 680 gcg tgc tat ctt ctc cct
ggt tgg aag cca tta gta tgg atg gcg gtg 14530Ala Cys Tyr Leu Leu
Pro Gly Trp Lys Pro Leu Val Trp Met Ala Val 685 690 695 act gag ctc
atg tcc ggc atg ctg ctg ggc ttt gta ttt gta ctt agc 14578Thr Glu
Leu Met Ser Gly Met Leu Leu Gly Phe Val Phe Val Leu Ser 700 705 710
cac aat ggg atg gag gtt tat aat tcg tct aaa gaa ttc gtg agt gca
14626His Asn Gly Met Glu Val Tyr Asn Ser Ser Lys Glu Phe Val Ser
Ala 715 720 725 cag atc gta tcc aca cgg gat atc aaa gga aac ata ttc
aac gac tgg 14674Gln Ile Val Ser Thr Arg Asp Ile Lys Gly Asn Ile
Phe Asn Asp Trp 730 735 740 ttc act ggt ggc ctt aac agg caa ata gag
cat cat ctt ttc cca aca 14722Phe Thr Gly Gly Leu Asn Arg Gln Ile
Glu His His Leu Phe Pro Thr 745 750 755 760 atg ccc agg cat aat tta
aac aaa ata gca cct aga gtg gag gtg ttc 14770Met Pro Arg His Asn
Leu Asn Lys Ile Ala Pro Arg Val Glu Val Phe 765 770 775 tgt aag aaa
cac ggt ctg gtg tac gaa gac gta tct att gct acc ggc 14818Cys Lys
Lys His Gly Leu Val Tyr Glu Asp Val Ser Ile Ala Thr Gly 780 785 790
act tgc aag gtt ttg aaa gca ttg aag gaa gtc gcg gag gct gcg gca
14866Thr Cys Lys Val Leu Lys Ala Leu Lys Glu Val Ala Glu Ala Ala
Ala 795 800 805 gag cag cat gct acc acc agt taa gctagcgtta
accctgcttt aatgagatat 14920Glu Gln His Ala Thr Thr Ser 810 815
gcgagacgcc tatgatcgca tgatatttgc tttcaattct gttgtgcacg ttgtaaaaaa
14980cctgagcatg tgtagctcag atccttaccg ccggtttcgg ttcattctaa
tgaatatatc 15040acccgttact atcgtatttt tatgaataat attctccgtt
caatttactg attgtccgtc 15100gagcaaattt acacattgcc actaaacgtc
taaacccttg taatttgttt ttgttttact 15160atgtgtgtta tgtatttgat
ttgcgataaa tttttatatt tggtactaaa tttataacac 15220cttttatgct
aacgtttgcc aacacttagc aatttgcaag ttgattaatt gattctaaat
15280tatttttgtc ttctaaatac atatactaat caactggaaa tgtaaatatt
tgctaatatt 15340tctactatag gagaattaaa gtgagtgaat atggtaccac
aaggtttgga gatttaattg 15400ttgcaatgct gcatggatgg catatacacc
aaacattcaa taattcttga ggataataat 15460ggtaccacac aagatttgag
gtgcatgaac gtcacgtgga caaaaggttt agtaattttt 15520caagacaaca
atgttaccac acacaagttt tgaggtgcat gcatggatgc cctgtggaaa
15580gtttaaaaat attttggaaa tgatttgcat ggaagccatg tgtaaaacca
tgacatccac 15640ttggaggatg caataatgaa gaaaactaca aatttacatg
caactagtta tgcatgtagt 15700ctatataatg aggattttgc aatactttca
ttcatacaca ctcactaagt tttacacgat 15760tataatttct tcatagccag
cagatctaaa atg gct ccg gat gcg gat aag ctt 15814 Met Ala Pro Asp
Ala Asp Lys Leu 820 cga caa cgc cag acg act gcg gta gcg aag cac aat
gct gct acc ata 15862Arg Gln Arg Gln Thr Thr Ala Val Ala Lys His
Asn Ala Ala Thr Ile 825 830 835 tcg acg cag gaa cgc ctt tgc agt ctg
tct tcg ctc aaa ggc gaa gaa 15910Ser Thr Gln Glu Arg Leu Cys Ser
Leu Ser Ser Leu Lys Gly Glu Glu 840 845 850 855 gtc tgc atc gac gga
atc atc tat gac ctc caa tca ttc gat cat ccc 15958Val Cys Ile Asp
Gly Ile Ile Tyr Asp Leu Gln Ser Phe Asp His Pro 860 865 870 ggg ggt
gaa acg atc aaa atg ttt ggt ggc aac gat gtc act gta cag 16006Gly
Gly Glu Thr Ile Lys Met Phe Gly Gly Asn Asp Val Thr Val Gln 875 880
885 tac aag atg att cac ccg tac cat acc gag aag cat ttg gaa aag atg
16054Tyr Lys Met Ile His Pro Tyr His Thr Glu Lys His Leu Glu Lys
Met 890 895 900 aag cgt gtc ggc aag gtg acg gat ttc gtc tgc gag tac
aag ttc gat 16102Lys Arg Val Gly Lys Val Thr Asp Phe Val Cys Glu
Tyr Lys Phe Asp 905 910 915 acc gaa ttt gaa cgc gaa atc aaa cga gaa
gtc ttc aag att gtg cga 16150Thr Glu Phe Glu Arg Glu Ile Lys Arg
Glu Val Phe Lys Ile Val Arg 920 925 930 935 cga ggc aag gat ttc ggt
act ttg gga tgg ttc ttc cgt gcg ttt tgc 16198Arg Gly Lys Asp Phe
Gly Thr Leu Gly Trp Phe Phe Arg Ala Phe Cys 940 945 950 tac att gcc
att ttc ttc tac ctg cag tac cat tgg gtc acc acg gga 16246Tyr Ile
Ala Ile Phe Phe Tyr Leu Gln Tyr His Trp Val Thr Thr Gly 955 960 965
acc tct tgg ctg ctg gcc gtg gcc tac gga atc tcc caa gcg atg att
16294Thr Ser Trp Leu Leu Ala Val Ala Tyr Gly Ile Ser Gln Ala Met
Ile 970 975 980 ggc atg aat gtc cag cac gat gcc aac cac ggg gcc acc
tcc aag cgt 16342Gly Met Asn Val Gln His Asp Ala Asn His Gly Ala
Thr Ser Lys Arg 985 990 995 ccc tgg gtc aac gac atg cta ggc ctc ggt
gcg gat ttt att ggt 16387Pro Trp Val Asn Asp Met Leu Gly Leu Gly
Ala Asp Phe Ile Gly 1000 1005 1010 ggt tcc aag tgg ctc tgg cag gaa
caa cac tgg acc cac cac gct 16432Gly Ser Lys Trp Leu Trp Gln Glu
Gln His Trp Thr His His Ala 1015 1020 1025 tac acc aat cac gcc gag
atg gat ccc gat agc ttt ggt gcc gaa 16477Tyr Thr Asn His Ala Glu
Met Asp Pro Asp Ser Phe Gly Ala Glu 1030 1035 1040 cca atg ctc cta
ttc aac gac tat ccc ttg gat cat ccc gct cgt 16522Pro Met Leu Leu
Phe Asn Asp Tyr Pro Leu Asp His Pro Ala Arg 1045 1050 1055 acc tgg
cta cat cgc ttt caa gca ttc ttt tac atg ccc gtc ttg 16567Thr Trp
Leu His Arg Phe Gln Ala Phe Phe Tyr Met Pro Val Leu 1060 1065 1070
gct gga tac tgg ttg tcc gct gtc ttc aat cca caa att ctt gac
16612Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile Leu Asp
1075 1080 1085 ctc cag caa cgc ggc gca ctt tcc gtc ggt atc cgt ctc
gac aac 16657Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu
Asp Asn 1090 1095 1100 gct ttc att cac tcg cga cgc aag tat gcg gtt
ttc tgg cgg gct 16702Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val
Phe Trp Arg Ala 1105 1110 1115 gtg tac att gcg gtg aac gtg att gct
ccg ttt tac aca aac tcc 16747Val Tyr Ile Ala Val Asn Val Ile Ala
Pro Phe Tyr Thr Asn Ser 1120 1125 1130 ggc ctc gaa tgg tcc tgg cgt
gtc ttt gga aac atc atg ctc atg 16792Gly Leu Glu Trp Ser Trp Arg
Val Phe Gly Asn Ile Met Leu Met 1135 1140 1145 ggt gtg gcg gaa tcg
ctc gcg ctg gcg gtc ctg ttt tcg ttg tcg 16837Gly Val Ala Glu Ser
Leu Ala Leu Ala Val Leu Phe Ser Leu Ser 1150 1155 1160 cac aat ttc
gaa tcc gcg gat cgc gat ccg acc gcc cca ctg aaa 16882His Asn Phe
Glu Ser Ala Asp Arg Asp Pro Thr Ala Pro Leu Lys 1165 1170 1175 aag
acg gga gaa cca gtc gac tgg ttc aag aca cag gtc gaa act 16927Lys
Thr Gly Glu Pro Val Asp Trp Phe Lys Thr Gln Val Glu Thr 1180 1185
1190 tcc tgc act tac ggt gga ttc ctt tcc ggt tgc ttc acg gga ggt
16972Ser Cys Thr Tyr Gly Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly
1195 1200 1205 ctc aac ttt cag gtt gaa cac cac ttg ttc cca cgc atg
agc agc 17017Leu Asn Phe Gln Val Glu His His Leu Phe Pro Arg Met
Ser Ser 1210 1215 1220 gct tgg tat ccc tac att gcc ccc aag gtc cgc
gaa att tgc gcc 17062Ala Trp Tyr Pro Tyr Ile Ala Pro Lys Val Arg
Glu Ile Cys Ala 1225 1230 1235 aaa cac ggc gtc cac tac gcc tac tac
ccg tgg atc cac caa aac 17107Lys His Gly Val His Tyr Ala Tyr Tyr
Pro Trp Ile His Gln Asn 1240 1245 1250 ttt ctc tcc acc gtc cgc tac
atg cac gcg gcc ggg acc ggt gcc 17152Phe Leu Ser Thr Val Arg Tyr
Met His Ala Ala Gly Thr Gly Ala 1255 1260 1265 aac tgg cgc cag atg
gcc aga gaa aat ccc ttg acc gga cgg gcg 17197Asn Trp Arg Gln Met
Ala Arg Glu Asn Pro Leu Thr Gly Arg Ala 1270 1275 1280 taa
agatctgccg gcatcgatcc cgggccatgg cctgctttaa tgagatatgc
17250gagacgccta tgatcgcatg atatttgctt tcaattctgt tgtgcacgtt
gtaaaaaacc 17310tgagcatgtg tagctcagat ccttaccgcc ggtttcggtt
cattctaatg aatatatcac 17370ccgttactat cgtattttta tgaataatat
tctccgttca atttactgat tgtccgtcga 17430cgagctcggc gcgcctctag
aggatcgatg aattcagatc ggctgagtgg ctccttcaac 17490gttgcggttc
tgtcagttcc aaacgtaaaa cggcttgtcc cgcgtcatcg gcgggggtca
17550taacgtgact cccttaattc tccgctcatg atcagattgt cgtttcccgc
cttcagttta 17610aactatcagt gtttgacagg atatattggc gggtaaacct
aagagaaaag agcgtttatt 17670agaataatcg gatatttaaa agggcgtgaa
aaggtttatc cttcgtccat ttgtatgtgc 17730atgccaacca cagggttccc ca
1775220290PRTArtificial sequenceDelta-6-elongase of Physcomitrella
patens 20Met Glu Val Val Glu Arg Phe Tyr Gly Glu Leu Asp Gly Lys
Val Ser 1 5 10 15 Gln Gly Val Asn Ala Leu Leu Gly Ser Phe Gly Val
Glu Leu Thr Asp 20 25 30 Thr Pro Thr Thr Lys Gly Leu Pro Leu Val
Asp Ser Pro Thr Pro Ile 35 40 45 Val Leu Gly Val Ser Val Tyr Leu
Thr Ile Val Ile Gly Gly Leu Leu 50 55 60 Trp Ile Lys Ala Arg Asp
Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu 65 70 75 80 Leu Gln Ala Leu
Val Leu Val His Asn Leu Phe Cys Phe Ala Leu Ser 85 90 95 Leu Tyr
Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg Tyr 100 105 110
Ser Leu Trp Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala Ile 115
120 125 Leu Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe Met Asp
Thr 130 135 140 Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln Ile Ser
Phe Leu His 145 150 155 160 Val Tyr His His Ser Ser Ile Ser Leu Ile
Trp Trp Ala Ile Ala His 165 170
175 His Ala Pro Gly Gly Glu Ala Tyr Trp Ser Ala Ala Leu Asn Ser Gly
180 185 190 Val His Val Leu Met Tyr Ala Tyr Tyr Phe Leu Ala Ala Cys
Leu Arg 195 200 205 Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp
Gly Arg Tyr Leu 210 215 220 Thr Gln Phe Gln Met Phe Gln Phe Met Leu
Asn Leu Val Gln Ala Tyr 225 230 235 240 Tyr Asp Met Lys Thr Asn Ala
Pro Tyr Pro Gln Trp Leu Ile Lys Ile 245 250 255 Leu Phe Tyr Tyr Met
Ile Ser Leu Leu Phe Leu Phe Gly Asn Phe Tyr 260 265 270 Val Gln Lys
Tyr Ile Lys Pro Ser Asp Gly Lys Gln Lys Gly Ala Lys 275 280 285 Thr
Glu 290 21525PRTArtificial sequenceDelta-6-desaturase of
Physcomitrella patens 21Met Val Phe Ala Gly Gly Gly Leu Gln Gln Gly
Ser Leu Glu Glu Asn 1 5 10 15 Ile Asp Val Glu His Ile Ala Ser Met
Ser Leu Phe Ser Asp Phe Phe 20 25 30 Ser Tyr Val Ser Ser Thr Val
Gly Ser Trp Ser Val His Ser Ile Gln 35 40 45 Pro Leu Lys Arg Leu
Thr Ser Lys Lys Arg Val Ser Glu Ser Ala Ala 50 55 60 Val Gln Cys
Ile Ser Ala Glu Val Gln Arg Asn Ser Ser Thr Gln Gly 65 70 75 80 Thr
Ala Glu Ala Leu Ala Glu Ser Val Val Lys Pro Thr Arg Arg Arg 85 90
95 Ser Ser Gln Trp Lys Lys Ser Thr His Pro Leu Ser Glu Val Ala Val
100 105 110 His Asn Lys Pro Ser Asp Cys Trp Ile Val Val Lys Asn Lys
Val Tyr 115 120 125 Asp Val Ser Asn Phe Ala Asp Glu His Pro Gly Gly
Ser Val Ile Ser 130 135 140 Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val
Phe Ser Ser Phe His Ala 145 150 155 160 Ala Ser Thr Trp Lys Ile Leu
Gln Asp Phe Tyr Ile Gly Asp Val Glu 165 170 175 Arg Val Glu Pro Thr
Pro Glu Leu Leu Lys Asp Phe Arg Glu Met Arg 180 185 190 Ala Leu Phe
Leu Arg Glu Gln Leu Phe Lys Ser Ser Lys Leu Tyr Tyr 195 200 205 Val
Met Lys Leu Leu Thr Asn Val Ala Ile Phe Ala Ala Ser Ile Ala 210 215
220 Ile Ile Cys Trp Ser Lys Thr Ile Ser Ala Val Leu Ala Ser Ala Cys
225 230 235 240 Met Met Ala Leu Cys Phe Gln Gln Cys Gly Trp Leu Ser
His Asp Phe 245 250 255 Leu His Asn Gln Val Phe Glu Thr Arg Trp Leu
Asn Glu Val Val Gly 260 265 270 Tyr Val Ile Gly Asn Ala Val Leu Gly
Phe Ser Thr Gly Trp Trp Lys 275 280 285 Glu Lys His Asn Leu His His
Ala Ala Pro Asn Glu Cys Asp Gln Thr 290 295 300 Tyr Gln Pro Ile Asp
Glu Asp Ile Asp Thr Leu Pro Leu Ile Ala Trp 305 310 315 320 Ser Lys
Asp Ile Leu Ala Thr Val Glu Asn Lys Thr Phe Leu Arg Ile 325 330 335
Leu Gln Tyr Gln His Leu Phe Phe Met Gly Leu Leu Phe Phe Ala Arg 340
345 350 Gly Ser Trp Leu Phe Trp Ser Trp Arg Tyr Thr Ser Thr Ala Val
Leu 355 360 365 Ser Pro Val Asp Arg Leu Leu Glu Lys Gly Thr Val Leu
Phe His Tyr 370 375 380 Phe Trp Phe Val Gly Thr Ala Cys Tyr Leu Leu
Pro Gly Trp Lys Pro 385 390 395 400 Leu Val Trp Met Ala Val Thr Glu
Leu Met Ser Gly Met Leu Leu Gly 405 410 415 Phe Val Phe Val Leu Ser
His Asn Gly Met Glu Val Tyr Asn Ser Ser 420 425 430 Lys Glu Phe Val
Ser Ala Gln Ile Val Ser Thr Arg Asp Ile Lys Gly 435 440 445 Asn Ile
Phe Asn Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu 450 455 460
His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Lys Ile Ala 465
470 475 480 Pro Arg Val Glu Val Phe Cys Lys Lys His Gly Leu Val Tyr
Glu Asp 485 490 495 Val Ser Ile Ala Thr Gly Thr Cys Lys Val Leu Lys
Ala Leu Lys Glu 500 505 510 Val Ala Glu Ala Ala Ala Glu Gln His Ala
Thr Thr Ser 515 520 525 22469PRTArtificial
sequenceDelta-5-desaturase of Phaeodactylum tricornutum 22Met Ala
Pro Asp Ala Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val 1 5 10 15
Ala Lys His Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser 20
25 30 Leu Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile
Tyr 35 40 45 Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile
Lys Met Phe 50 55 60 Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met
Ile His Pro Tyr His 65 70 75 80 Thr Glu Lys His Leu Glu Lys Met Lys
Arg Val Gly Lys Val Thr Asp 85 90 95 Phe Val Cys Glu Tyr Lys Phe
Asp Thr Glu Phe Glu Arg Glu Ile Lys 100 105 110 Arg Glu Val Phe Lys
Ile Val Arg Arg Gly Lys Asp Phe Gly Thr Leu 115 120 125 Gly Trp Phe
Phe Arg Ala Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu 130 135 140 Gln
Tyr His Trp Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala 145 150
155 160 Tyr Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp
Ala 165 170 175 Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp
Met Leu Gly 180 185 190 Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp
Leu Trp Gln Glu Gln 195 200 205 His Trp Thr His His Ala Tyr Thr Asn
His Ala Glu Met Asp Pro Asp 210 215 220 Ser Phe Gly Ala Glu Pro Met
Leu Leu Phe Asn Asp Tyr Pro Leu Asp 225 230 235 240 His Pro Ala Arg
Thr Trp Leu His Arg Phe Gln Ala Phe Phe Tyr Met 245 250 255 Pro Val
Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile 260 265 270
Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp 275
280 285 Asn Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg
Ala 290 295 300 Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr
Asn Ser Gly 305 310 315 320 Leu Glu Trp Ser Trp Arg Val Phe Gly Asn
Ile Met Leu Met Gly Val 325 330 335 Ala Glu Ser Leu Ala Leu Ala Val
Leu Phe Ser Leu Ser His Asn Phe 340 345 350 Glu Ser Ala Asp Arg Asp
Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu 355 360 365 Pro Val Asp Trp
Phe Lys Thr Gln Val Glu Thr Ser Cys Thr Tyr Gly 370 375 380 Gly Phe
Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu 385 390 395
400 His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala
405 410 415 Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr
Ala Tyr 420 425 430 Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val
Arg Tyr Met His 435 440 445 Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln
Met Ala Arg Glu Asn Pro 450 455 460 Leu Thr Gly Arg Ala 465
2326DNAArtificial sequencepolylinker sequence 23gaattcggcg
cgccgagctc ctcgag 2624265DNAArtificial
sequencepolylinker-terminator-polylinkers sequence 24ccaccgcggt
gggcggccgc ctgcagtcta gaaggcctcc tgctttaatg agatatgcga 60gacgcctatg
atcgcatgat atttgctttc aattctgttg tgcacgttgt aaaaaacctg
120agcatgtgta gctcagatcc ttaccgccgg tttcggttca ttctaatgaa
tatatcaccc 180gttactatcg tatttttatg aataatattc tccgttcaat
ttactgattg tccgtcgacg 240aattcgagct cggcgcgcca agctt
26525257DNAArtificial sequencepolylinker-terminator-polylinkers
sequence 25ggatccgata tcgggcccgc tagcgttaac cctgctttaa tgagatatgc
gagacgccta 60tgatcgcatg atatttgctt tcaattctgt tgtgcacgtt gtaaaaaacc
tgagcatgtg 120tagctcagat ccttaccgcc ggtttcggtt cattctaatg
aatatatcac ccgttactat 180cgtattttta tgaataatat tctccgttca
atttactgat tgtccgtcga cgaattcgag 240ctcggcgcgc caagctt
257265410DNAArtificial sequenceplant expression vector with one
promoter-terminator expression cassette 26ttttggaaat gatttgcatg
gaagccatgt gtaaaaccat gacatccact tggaggatgc 60aataatgaag aaaactacaa
atttacatgc aactagttat gcatgtagtc tatataatga 120ggattttgca
atactttcat tcatacacac tcactaagtt ttacacgatt ataatttctt
180catagccagc ggatccgata tcgggcccgc tagcgttaac cctgctttaa
tgagatatgc 240gagacgccta tgatcgcatg atatttgctt tcaattctgt
tgtgcacgtt gtaaaaaacc 300tgagcatgtg tagctcagat ccttaccgcc
ggtttcggtt cattctaatg aatatatcac 360ccgttactat cgtattttta
tgaataatat tctccgttca atttactgat tgtccgtcga 420gcaaatttac
acattgccac taaacgtcta aacccttgta atttgttttt gttttactat
480gtgtgttatg tatttgattt gcgataaatt tttatatttg gtactaaatt
tataacacct 540tttatgctaa cgtttgccaa cacttagcaa tttgcaagtt
gattaattga ttctaaatta 600tttttgtctt ctaaatacat atactaatca
actggaaatg taaatatttg ctaatatttc 660tactatagga gaattaaagt
gagtgaatat ggtaccacaa ggtttggaga tttaattgtt 720gcaatgctgc
atggatggca tatacaccaa acattcaata attcttgagg ataataatgg
780taccacacaa gatttgaggt gcatgaacgt cacgtggaca aaaggtttag
taatttttca 840agacaacaat gttaccacac acaagttttg aggtgcatgc
atggatgccc tgtggaaagt 900ttaaaaatat tttggaaatg atttgcatgg
aagccatgtg taaaaccatg acatccactt 960ggaggatgca ataatgaaga
aaactacaaa tttacatgca actagttatg catgtagtct 1020atataatgag
gattttgcaa tactttcatt catacacact cactaagttt tacacgatta
1080taatttcttc atagccagca gatctgccgg catcgatccc gggccatggc
ctgctttaat 1140gagatatgcg agacgcctat gatcgcatga tatttgcttt
caattctgtt gtgcacgttg 1200taaaaaacct gagcatgtgt agctcagatc
cttaccgccg gtttcggttc attctaatga 1260atatatcacc cgttactatc
gtatttttat gaataatatt ctccgttcaa tttactgatt 1320gtccgtcgac
gagctcggcg cgccaagctt ggcgtaatca tggtcatagc tgtttcctgt
1380gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca
taaagtgtaa 1440agcctggggt gcctaatgag tgagctaact cacattaatt
gcgttgcgct cactgcccgc 1500tttccagtcg ggaaacctgt cgtgccagct
gcattaatga atcggccaac gcgcggggag 1560aggcggtttg cgtattgggc
gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 1620cgttcggctg
cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga
1680atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg
ccaggaaccg 1740taaaaaggcc gcgttgctgg cgtttttcca taggctccgc
ccccctgacg agcatcacaa 1800aaatcgacgc tcaagtcaga ggtggcgaaa
cccgacagga ctataaagat accaggcgtt 1860tccccctgga agctccctcg
tgcgctctcc tgttccgacc ctgccgctta ccggatacct 1920gtccgccttt
ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct
1980cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
ccgttcagcc 2040cgaccgctgc gccttatccg gtaactatcg tcttgagtcc
aacccggtaa gacacgactt 2100atcgccactg gcagcagcca ctggtaacag
gattagcaga gcgaggtatg taggcggtgc 2160tacagagttc ttgaagtggt
ggcctaacta cggctacact agaaggacag tatttggtat 2220ctgcgctctg
ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa
2280acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta
cgcgcagaaa 2340aaaaggatct caagaagatc ctttgatctt ttctacgggg
tctgacgctc agtggaacga 2400aaactcacgt taagggattt tggtcatgag
attatcaaaa aggatcttca cctagatcct 2460tttaaattaa aaatgaagtt
ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 2520cagttaccaa
tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc
2580catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct
taccatctgg 2640ccccagtgct gcaatgatac cgcgagaccc acgctcaccg
gctccagatt tatcagcaat 2700aaaccagcca gccggaaggg ccgagcgcag
aagtggtcct gcaactttat ccgcctccat 2760ccagtctatt aattgttgcc
gggaagctag agtaagtagt tcgccagtta atagtttgcg 2820caacgttgtt
gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc
2880attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt
tgtgcaaaaa 2940agcggttagc tccttcggtc ctccgatcgt tgtcagaagt
aagttggccg cagtgttatc 3000actcatggtt atggcagcac tgcataattc
tcttactgtc atgccatccg taagatgctt 3060ttctgtgact ggtgagtact
caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 3120ttgctcttgc
ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt
3180gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac
cgctgttgag 3240atccagttcg atgtaaccca ctcgtgcacc caactgatct
tcagcatctt ttactttcac 3300cagcgtttct gggtgagcaa aaacaggaag
gcaaaatgcc gcaaaaaagg gaataagggc 3360gacacggaaa tgttgaatac
tcatactctt cctttttcaa tattattgaa gcatttatca 3420gggttattgt
ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg
3480ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca
ttattatcat 3540gacattaacc tataaaaata ggcgtatcac gaggcccttt
cgtctcgcgc gtttcggtga 3600tgacggtgaa aacctctgac acatgcagct
cccggagacg gtcacagctt gtctgtaagc 3660ggatgccggg agcagacaag
cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 3720ctggcttaac
tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga
3780aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgccattcgc
cattcaggct 3840gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg
ctattacgcc agctggcgaa 3900agggggatgt gctgcaaggc gattaagttg
ggtaacgcca gggttttccc agtcacgacg 3960ttgtaaaacg acggccagtg
aattcggcgc gccgagctcc tcgagcaaat ttacacattg 4020ccactaaacg
tctaaaccct tgtaatttgt ttttgtttta ctatgtgtgt tatgtatttg
4080atttgcgata aatttttata tttggtacta aatttataac accttttatg
ctaacgtttg 4140ccaacactta gcaatttgca agttgattaa ttgattctaa
attatttttg tcttctaaat 4200acatatacta atcaactgga aatgtaaata
tttgctaata tttctactat aggagaatta 4260aagtgagtga atatggtacc
acaaggtttg gagatttaat tgttgcaatg ctgcatggat 4320ggcatataca
ccaaacattc aataattctt gaggataata atggtaccac acaagatttg
4380aggtgcatga acgtcacgtg gacaaaaggt ttagtaattt ttcaagacaa
caatgttacc 4440acacacaagt tttgaggtgc atgcatggat gccctgtgga
aagtttaaaa atattttgga 4500aatgatttgc atggaagcca tgtgtaaaac
catgacatcc acttggagga tgcaataatg 4560aagaaaacta caaatttaca
tgcaactagt tatgcatgta gtctatataa tgaggatttt 4620gcaatacttt
cattcataca cactcactaa gttttacacg attataattt cttcatagcc
4680agcccaccgc ggtgggcggc cgcctgcagt ctagaaggcc tcctgcttta
atgagatatg 4740cgagacgcct atgatcgcat gatatttgct ttcaattctg
ttgtgcacgt tgtaaaaaac 4800ctgagcatgt gtagctcaga tccttaccgc
cggtttcggt tcattctaat gaatatatca 4860cccgttacta tcgtattttt
atgaataata ttctccgttc aatttactga ttgtccgtcg 4920agcaaattta
cacattgcca ctaaacgtct aaacccttgt aatttgtttt tgttttacta
4980tgtgtgttat gtatttgatt tgcgataaat ttttatattt ggtactaaat
ttataacacc 5040ttttatgcta acgtttgcca acacttagca atttgcaagt
tgattaattg attctaaatt 5100atttttgtct tctaaataca tatactaatc
aactggaaat gtaaatattt gctaatattt 5160ctactatagg agaattaaag
tgagtgaata tggtaccaca aggtttggag atttaattgt 5220tgcaatgctg
catggatggc atatacacca aacattcaat aattcttgag gataataatg
5280gtaccacaca agatttgagg tgcatgaacg tcacgtggac aaaaggttta
gtaatttttc 5340aagacaacaa tgttaccaca cacaagtttt gaggtgcatg
catggatgcc ctgtggaaag 5400tttaaaaata 54102712093DNAArtificial
sequenceplant expression vector with one promoter-terminator
expression cassette 27gatctggcgc cggccagcga gacgagcaag attggccgcc
gcccgaaacg atccgacagc 60gcgcccagca caggtgcgca ggcaaattgc accaacgcat
acagcgccag cagaatgcca 120tagtgggcgg tgacgtcgtt cgagtgaacc
agatcgcgca ggaggcccgg cagcaccggc 180ataatcaggc cgatgccgac
agcgtcgagc gcgacagtgc tcagaattac gatcaggggt 240atgttgggtt
tcacgtctgg cctccggacc agcctccgct ggtccgattg aacgcgcgga
300ttctttatca ctgataagtt ggtggacata ttatgtttat cagtgataaa
gtgtcaagca 360tgacaaagtt gcagccgaat acagtgatcc gtgccgccct
ggacctgttg aacgaggtcg 420gcgtagacgg tctgacgaca cgcaaactgg
cggaacggtt gggggttcag cagccggcgc 480tttactggca cttcaggaac
aagcgggcgc tgctcgacgc actggccgaa gccatgctgg 540cggagaatca
tacgcattcg gtgccgagag ccgacgacga ctggcgctca tttctgatcg
600ggaatgcccg cagcttcagg caggcgctgc tcgcctaccg cgatggcgcg
cgcatccatg 660ccggcacgcg accgggcgca ccgcagatgg aaacggccga
cgcgcagctt cgcttcctct 720gcgaggcggg tttttcggcc ggggacgccg
tcaatgcgct gatgacaatc agctacttca 780ctgttggggc cgtgcttgag
gagcaggccg gcgacagcga tgccggcgag cgcggcggca 840ccgttgaaca
ggctccgctc tcgccgctgt tgcgggccgc gatagacgcc ttcgacgaag
900ccggtccgga cgcagcgttc gagcagggac tcgcggtgat tgtcgatgga
ttggcgaaaa 960ggaggctcgt tgtcaggaac gttgaaggac cgagaaaggg
tgacgattga tcaggaccgc 1020tgccggagcg caacccactc actacagcag
agccatgtag acaacatccc ctcccccttt 1080ccaccgcgtc agacgcccgt
agcagcccgc tacgggcttt ttcatgccct gccctagcgt 1140ccaagcctca
cggccgcgct cggcctctct ggcggccttc
tggcgctctt ccgcttcctc 1200gctcactgac tcgctgcgct cggtcgttcg
gctgcggcga gcggtatcag ctcactcaaa 1260ggcggtaata cggttatcca
cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 1320aggccagcaa
aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct
1380ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
gaaacccgac 1440aggactataa agataccagg cgtttccccc tggaagctcc
ctcgtgcgct ctcctgttcc 1500gaccctgccg cttaccggat acctgtccgc
ctttctccct tcgggaagcg tggcgctttt 1560ccgctgcata accctgcttc
ggggtcatta tagcgatttt ttcggtatat ccatcctttt 1620tcgcacgata
tacaggattt tgccaaaggg ttcgtgtaga ctttccttgg tgtatccaac
1680ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc gagcgggtgt
tccttcttca 1740ctgtccctta ttcgcacctg gcggtgctca acgggaatcc
tgctctgcga ggctggccgg 1800ctaccgccgg cgtaacagat gagggcaagc
ggatggctga tgaaaccaag ccaaccagga 1860agggcagccc acctatcaag
gtgtactgcc ttccagacga acgaagagcg attgaggaaa 1920aggcggcggc
ggccggcatg agcctgtcgg cctacctgct ggccgtcggc cagggctaca
1980aaatcacggg cgtcgtggac tatgagcacg tccgcgagct ggcccgcatc
aatggcgacc 2040tgggccgcct gggcggcctg ctgaaactct ggctcaccga
cgacccgcgc acggcgcggt 2100tcggtgatgc cacgatcctc gccctgctgg
cgaagatcga agagaagcag gacgagcttg 2160gcaaggtcat gatgggcgtg
gtccgcccga gggcagagcc atgacttttt tagccgctaa 2220aacggccggg
gggtgcgcgt gattgccaag cacgtcccca tgcgctccat caagaagagc
2280gacttcgcgg agctggtgaa gtacatcacc gacgagcaag gcaagaccga
gcgcctttgc 2340gacgctcacc gggctggttg ccctcgccgc tgggctggcg
gccgtctatg gccctgcaaa 2400cgcgccagaa acgccgtcga agccgtgtgc
gagacaccgc ggccgccggc gttgtggata 2460cctcgcggaa aacttggccc
tcactgacag atgaggggcg gacgttgaca cttgaggggc 2520cgactcaccc
ggcgcggcgt tgacagatga ggggcaggct cgatttcggc cggcgacgtg
2580gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt tacgcgagtt
tcccacagat 2640gatgtggaca agcctgggga taagtgccct gcggtattga
cacttgaggg gcgcgactac 2700tgacagatga ggggcgcgat ccttgacact
tgaggggcag agtgctgaca gatgaggggc 2760gcacctattg acatttgagg
ggctgtccac aggcagaaaa tccagcattt gcaagggttt 2820ccgcccgttt
ttcggccacc gctaacctgt cttttaacct gcttttaaac caatatttat
2880aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga ccgcgcacgc
cgaagggggg 2940tgccccccct tctcgaaccc tcccggcccg ctaacgcggg
cctcccatcc ccccaggggc 3000tgcgcccctc ggccgcgaac ggcctcaccc
caaaaatggc agcgctggca gtccttgcca 3060ttgccgggat cggggcagta
acgggatggg cgatcagccc gagcgcgacg cccggaagca 3120ttgacgtgcc
gcaggtgctg gcatcgacat tcagcgacca ggtgccgggc agtgagggcg
3180gcggcctggg tggcggcctg cccttcactt cggccgtcgg ggcattcacg
gacttcatgg 3240cggggccggc aatttttacc ttgggcattc ttggcatagt
ggtcgcgggt gccgtgctcg 3300tgttcggggg tgcgataaac ccagcgaacc
atttgaggtg ataggtaaga ttataccgag 3360gtatgaaaac gagaattgga
cctttacaga attactctat gaagcgccat atttaaaaag 3420ctaccaagac
gaagaggatg aagaggatga ggaggcagat tgccttgaat atattgacaa
3480tactgataag ataatatatc ttttatatag aagatatcgc cgtatgtaag
gatttcaggg 3540ggcaaggcat aggcagcgcg cttatcaata tatctataga
atgggcaaag cataaaaact 3600tgcatggact aatgcttgaa acccaggaca
ataaccttat agcttgtaaa ttctatcata 3660attgggtaat gactccaact
tattgatagt gttttatgtt cagataatgc ccgatgactt 3720tgtcatgcag
ctccaccgat tttgagaacg acagcgactt ccgtcccagc cgtgccaggt
3780gctgcctcag attcaggtta tgccgctcaa ttcgctgcgt atatcgcttg
ctgattacgt 3840gcagctttcc cttcaggcgg gattcataca gcggccagcc
atccgtcatc catatcacca 3900cgtcaaaggg tgacagcagg ctcataagac
gccccagcgt cgccatagtg cgttcaccga 3960atacgtgcgc aacaaccgtc
ttccggagac tgtcatacgc gtaaaacagc cagcgctggc 4020gcgatttagc
cccgacatag ccccactgtt cgtccatttc cgcgcagacg atgacgtcac
4080tgcccggctg tatgcgcgag gttaccgact gcggcctgag ttttttaagt
gacgtaaaat 4140cgtgttgagg ccaacgccca taatgcgggc tgttgcccgg
catccaacgc cattcatggc 4200catatcaatg attttctggt gcgtaccggg
ttgagaagcg gtgtaagtga actgcagttg 4260ccatgtttta cggcagtgag
agcagagata gcgctgatgt ccggcggtgc ttttgccgtt 4320acgcaccacc
ccgtcagtag ctgaacagga gggacagctg atagacacag aagccactgg
4380agcacctcaa aaacaccatc atacactaaa tcagtaagtt ggcagcatca
cccataattg 4440tggtttcaaa atcggctccg tcgatactat gttatacgcc
aactttgaaa acaactttga 4500aaaagctgtt ttctggtatt taaggtttta
gaatgcaagg aacagtgaat tggagttcgt 4560cttgttataa ttagcttctt
ggggtatctt taaatactgt agaaaagagg aaggaaataa 4620taaatggcta
aaatgagaat atcaccggaa ttgaaaaaac tgatcgaaaa ataccgctgc
4680gtaaaagata cggaaggaat gtctcctgct aaggtatata agctggtggg
agaaaatgaa 4740aacctatatt taaaaatgac ggacagccgg tataaaggga
ccacctatga tgtggaacgg 4800gaaaaggaca tgatgctatg gctggaagga
aagctgcctg ttccaaaggt cctgcacttt 4860gaacggcatg atggctggag
caatctgctc atgagtgagg ccgatggcgt cctttgctcg 4920gaagagtatg
aagatgaaca aagccctgaa aagattatcg agctgtatgc ggagtgcatc
4980aggctctttc actccatcga catatcggat tgtccctata cgaatagctt
agacagccgc 5040ttagccgaat tggattactt actgaataac gatctggccg
atgtggattg cgaaaactgg 5100gaagaagaca ctccatttaa agatccgcgc
gagctgtatg attttttaaa gacggaaaag 5160cccgaagagg aacttgtctt
ttcccacggc gacctgggag acagcaacat ctttgtgaaa 5220gatggcaaag
taagtggctt tattgatctt gggagaagcg gcagggcgga caagtggtat
5280gacattgcct tctgcgtccg gtcgatcagg gaggatatcg gggaagaaca
gtatgtcgag 5340ctattttttg acttactggg gatcaagcct gattgggaga
aaataaaata ttatatttta 5400ctggatgaat tgttttagta cctagatgtg
gcgcaacgat gccggcgaca agcaggagcg 5460caccgacttc ttccgcatca
agtgttttgg ctctcaggcc gaggcccacg gcaagtattt 5520gggcaagggg
tcgctggtat tcgtgcaggg caagattcgg aataccaagt acgagaagga
5580cggccagacg gtctacggga ccgacttcat tgccgataag gtggattatc
tggacaccaa 5640ggcaccaggc gggtcaaatc aggaataagg gcacattgcc
ccggcgtgag tcggggcaat 5700cccgcaagga gggtgaatga atcggacgtt
tgaccggaag gcatacaggc aagaactgat 5760cgacgcgggg ttttccgccg
aggatgccga aaccatcgca agccgcaccg tcatgcgtgc 5820gccccgcgaa
accttccagt ccgtcggctc gatggtccag caagctacgg ccaagatcga
5880gcgcgacagc gtgcaactgg ctccccctgc cctgcccgcg ccatcggccg
ccgtggagcg 5940ttcgcgtcgt ctcgaacagg aggcggcagg tttggcgaag
tcgatgacca tcgacacgcg 6000aggaactatg acgaccaaga agcgaaaaac
cgccggcgag gacctggcaa aacaggtcag 6060cgaggccaag caggccgcgt
tgctgaaaca cacgaagcag cagatcaagg aaatgcagct 6120ttccttgttc
gatattgcgc cgtggccgga cacgatgcga gcgatgccaa acgacacggc
6180ccgctctgcc ctgttcacca cgcgcaacaa gaaaatcccg cgcgaggcgc
tgcaaaacaa 6240ggtcattttc cacgtcaaca aggacgtgaa gatcacctac
accggcgtcg agctgcgggc 6300cgacgatgac gaactggtgt ggcagcaggt
gttggagtac gcgaagcgca cccctatcgg 6360cgagccgatc accttcacgt
tctacgagct ttgccaggac ctgggctggt cgatcaatgg 6420ccggtattac
acgaaggccg aggaatgcct gtcgcgccta caggcgacgg cgatgggctt
6480cacgtccgac cgcgttgggc acctggaatc ggtgtcgctg ctgcaccgct
tccgcgtcct 6540ggaccgtggc aagaaaacgt cccgttgcca ggtcctgatc
gacgaggaaa tcgtcgtgct 6600gtttgctggc gaccactaca cgaaattcat
atgggagaag taccgcaagc tgtcgccgac 6660ggcccgacgg atgttcgact
atttcagctc gcaccgggag ccgtacccgc tcaagctgga 6720aaccttccgc
ctcatgtgcg gatcggattc cacccgcgtg aagaagtggc gcgagcaggt
6780cggcgaagcc tgcgaagagt tgcgaggcag cggcctggtg gaacacgcct
gggtcaatga 6840tgacctggtg cattgcaaac gctagggcct tgtggggtca
gttccggctg ggggttcagc 6900agccagcgct ttactggcat ttcaggaaca
agcgggcact gctcgacgca cttgcttcgc 6960tcagtatcgc tcgggacgca
cggcgcgctc tacgaactgc cgataaacag aggattaaaa 7020ttgacaattg
tgattaaggc tcagattcga cggcttggag cggccgacgt gcaggatttc
7080cgcgagatcc gattgtcggc cctgaagaaa gctccagaga tgttcgggtc
cgtttacgag 7140cacgaggaga aaaagcccat ggaggcgttc gctgaacggt
tgcgagatgc cgtggcattc 7200ggcgcctaca tcgacggcga gatcattggg
ctgtcggtct tcaaacagga ggacggcccc 7260aaggacgctc acaaggcgca
tctgtccggc gttttcgtgg agcccgaaca gcgaggccga 7320ggggtcgccg
gtatgctgct gcgggcgttg ccggcgggtt tattgctcgt gatgatcgtc
7380cgacagattc caacgggaat ctggtggatg cgcatcttca tcctcggcgc
acttaatatt 7440tcgctattct ggagcttgtt gtttatttcg gtctaccgcc
tgccgggcgg ggtcgcggcg 7500acggtaggcg ctgtgcagcc gctgatggtc
gtgttcatct ctgccgctct gctaggtagc 7560ccgatacgat tgatggcggt
cctgggggct atttgcggaa ctgcgggcgt ggcgctgttg 7620gtgttgacac
caaacgcagc gctagatcct gtcggcgtcg cagcgggcct ggcgggggcg
7680gtttccatgg cgttcggaac cgtgctgacc cgcaagtggc aacctcccgt
gcctctgctc 7740acctttaccg cctggcaact ggcggccgga ggacttctgc
tcgttccagt agctttagtg 7800tttgatccgc caatcccgat gcctacagga
accaatgttc tcggcctggc gtggctcggc 7860ctgatcggag cgggtttaac
ctacttcctt tggttccggg ggatctcgcg actcgaacct 7920acagttgttt
ccttactggg ctttctcagc cccagatctg gggtcgatca gccggggatg
7980catcaggccg acagtcggaa cttcgggtcc ccgacctgta ccattcggtg
agcaatggat 8040aggggagttg atatcgtcaa cgttcacttc taaagaaata
gcgccactca gcttcctcag 8100cggctttatc cagcgatttc ctattatgtc
ggcatagttc tcaagatcga cagcctgtca 8160cggttaagcg agaaatgaat
aagaaggctg ataattcgga tctctgcgag ggagatgata 8220tttgatcaca
ggcagcaacg ctctgtcatc gttacaatca acatgctacc ctccgcgaga
8280tcatccgtgt ttcaaacccg gcagcttagt tgccgttctt ccgaatagca
tcggtaacat 8340gagcaaagtc tgccgcctta caacggctct cccgctgacg
ccgtcccgga ctgatgggct 8400gcctgtatcg agtggtgatt ttgtgccgag
ctgccggtcg gggagctgtt ggctggctgg 8460tggcaggata tattgtggtg
taaacaaatt gacgcttaga caacttaata acacattgcg 8520gacgttttta
atgtactggg gtggtttttc ttttcaccag tgagacgggc aacagctgat
8580tgcccttcac cgcctggccc tgagagagtt gcagcaagcg gtccacgctg
gtttgcccca 8640gcaggcgaaa atcctgtttg atggtggttc cgaaatcggc
aaaatccctt ataaatcaaa 8700agaatagccc gagatagggt tgagtgttgt
tccagtttgg aacaagagtc cactattaaa 8760gaacgtggac tccaacgtca
aagggcgaaa aaccgtctat cagggcgatg gcccactacg 8820tgaaccatca
cccaaatcaa gttttttggg gtcgaggtgc cgtaaagcac taaatcggaa
8880ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg
tggcgagaaa 8940ggaagggaag aaagcgaaag gagcgggcgc cattcaggct
gcgcaactgt tgggaagggc 9000gatcggtgcg ggcctcttcg ctattacgcc
agctggcgaa agggggatgt gctgcaaggc 9060gattaagttg ggtaacgcca
gggttttccc agtcacgacg ttgtaaaacg acggccagtg 9120aattaattcc
catcttgaaa gaaatatagt ttaaatattt attgataaaa taacaagtca
9180ggtattatag tccaagcaaa aacataaatt tattgatgca agtttaaatt
cagaaatatt 9240tcaataactg attatatcag ctggtacatt gccgtagatg
aaagactgag tgcgatatta 9300tgtgtaatac ataaattgat gatatagcta
gcttagctca tcgggggatc cgtcgaagct 9360agcttgggtc ccgctcagaa
gaactcgtca agaaggcgat agaaggcgat gcgctgcgaa 9420tcgggagcgg
cgataccgta aagcacgagg aagcggtcag cccattcgcc gccaagctct
9480tcagcaatat cacgggtagc caacgctatg tcctgatagc ggtccgccac
acccagccgg 9540ccacagtcga tgaatccaga aaagcggcca ttttccacca
tgatattcgg caagcaggca 9600tcgccatggg tcacgacgag atcctcgccg
tcgggcatgc gcgccttgag cctggcgaac 9660agttcggctg gcgcgagccc
ctgatgctct tcgtccagat catcctgatc gacaagaccg 9720gcttccatcc
gagtacgtgc tcgctcgatg cgatgtttcg cttggtggtc gaatgggcag
9780gtagccggat caagcgtatg cagccgccgc attgcatcag ccatgatgga
tactttctcg 9840gcaggagcaa ggtgagatga caggagatcc tgccccggca
cttcgcccaa tagcagccag 9900tcccttcccg cttcagtgac aacgtcgagc
acagctgcgc aaggaacgcc cgtcgtggcc 9960agccacgata gccgcgctgc
ctcgtcctgc agttcattca gggcaccgga caggtcggtc 10020ttgacaaaaa
gaaccgggcg cccctgcgct gacagccgga acacggcggc atcagagcag
10080ccgattgtct gttgtgccca gtcatagccg aatagcctct ccacccaagc
ggccggagaa 10140cctgcgtgca atccatcttg ttcaatccaa gctcccatgg
gccctcgact agagtcgaga 10200tctggattga gagtgaatat gagactctaa
ttggataccg aggggaattt atggaacgtc 10260agtggagcat ttttgacaag
aaatatttgc tagctgatag tgaccttagg cgacttttga 10320acgcgcaata
atggtttctg acgtatgtgc ttagctcatt aaactccaga aacccgcggc
10380tgagtggctc cttcaacgtt gcggttctgt cagttccaaa cgtaaaacgg
cttgtcccgc 10440gtcatcggcg ggggtcataa cgtgactccc ttaattctcc
gctcatgatc ttgatcccct 10500gcgccatcag atccttggcg gcaagaaagc
catccagttt actttgcagg gcttcccaac 10560cttaccagag ggcgccccag
ctggcaattc cggttcgctt gctgtccata aaaccgccca 10620gtctagctat
cgccatgtaa gcccactgca agctacctgc tttctctttg cgcttgcgtt
10680ttcccttgtc cagatagccc agtagctgac attcatccgg ggtcagcacc
gtttctgcgg 10740actggctttc tacgtgttcc gcttccttta gcagcccttg
cgccctgagt gcttgcggca 10800gcgtgaagct tgcatgcctg caggtcgacg
gcgcgccgag ctcctcgagc aaatttacac 10860attgccacta aacgtctaaa
cccttgtaat ttgtttttgt tttactatgt gtgttatgta 10920tttgatttgc
gataaatttt tatatttggt actaaattta taacaccttt tatgctaacg
10980tttgccaaca cttagcaatt tgcaagttga ttaattgatt ctaaattatt
tttgtcttct 11040aaatacatat actaatcaac tggaaatgta aatatttgct
aatatttcta ctataggaga 11100attaaagtga gtgaatatgg taccacaagg
tttggagatt taattgttgc aatgctgcat 11160ggatggcata tacaccaaac
attcaataat tcttgaggat aataatggta ccacacaaga 11220tttgaggtgc
atgaacgtca cgtggacaaa aggtttagta atttttcaag acaacaatgt
11280taccacacac aagttttgag gtgcatgcat ggatgccctg tggaaagttt
aaaaatattt 11340tggaaatgat ttgcatggaa gccatgtgta aaaccatgac
atccacttgg aggatgcaat 11400aatgaagaaa actacaaatt tacatgcaac
tagttatgca tgtagtctat ataatgagga 11460ttttgcaata ctttcattca
tacacactca ctaagtttta cacgattata atttcttcat 11520agccagccca
ccgcggtggg cggccgcctg cagtctagaa ggcctcctgc tttaatgaga
11580tatgcgagac gcctatgatc gcatgatatt tgctttcaat tctgttgtgc
acgttgtaaa 11640aaacctgagc atgtgtagct cagatcctta ccgccggttt
cggttcattc taatgaatat 11700atcacccgtt actatcgtat ttttatgaat
aatattctcc gttcaattta ctgattgtcc 11760gtcgacgaat tcgagctcgg
cgcgcctcta gaggatcgat gaattcagat cggctgagtg 11820gctccttcaa
cgttgcggtt ctgtcagttc caaacgtaaa acggcttgtc ccgcgtcatc
11880ggcgggggtc ataacgtgac tcccttaatt ctccgctcat gatcagattg
tcgtttcccg 11940ccttcagttt aaactatcag tgtttgacag gatatattgg
cgggtaaacc taagagaaaa 12000gagcgtttat tagaataatc ggatatttaa
aagggcgtga aaaggtttat ccttcgtcca 12060tttgtatgtg catgccaacc
acagggttcc cca 120932812085DNAArtificial sequenceplant expression
vector with one promoter-terminator expression cassette
28gatctggcgc cggccagcga gacgagcaag attggccgcc gcccgaaacg atccgacagc
60gcgcccagca caggtgcgca ggcaaattgc accaacgcat acagcgccag cagaatgcca
120tagtgggcgg tgacgtcgtt cgagtgaacc agatcgcgca ggaggcccgg
cagcaccggc 180ataatcaggc cgatgccgac agcgtcgagc gcgacagtgc
tcagaattac gatcaggggt 240atgttgggtt tcacgtctgg cctccggacc
agcctccgct ggtccgattg aacgcgcgga 300ttctttatca ctgataagtt
ggtggacata ttatgtttat cagtgataaa gtgtcaagca 360tgacaaagtt
gcagccgaat acagtgatcc gtgccgccct ggacctgttg aacgaggtcg
420gcgtagacgg tctgacgaca cgcaaactgg cggaacggtt gggggttcag
cagccggcgc 480tttactggca cttcaggaac aagcgggcgc tgctcgacgc
actggccgaa gccatgctgg 540cggagaatca tacgcattcg gtgccgagag
ccgacgacga ctggcgctca tttctgatcg 600ggaatgcccg cagcttcagg
caggcgctgc tcgcctaccg cgatggcgcg cgcatccatg 660ccggcacgcg
accgggcgca ccgcagatgg aaacggccga cgcgcagctt cgcttcctct
720gcgaggcggg tttttcggcc ggggacgccg tcaatgcgct gatgacaatc
agctacttca 780ctgttggggc cgtgcttgag gagcaggccg gcgacagcga
tgccggcgag cgcggcggca 840ccgttgaaca ggctccgctc tcgccgctgt
tgcgggccgc gatagacgcc ttcgacgaag 900ccggtccgga cgcagcgttc
gagcagggac tcgcggtgat tgtcgatgga ttggcgaaaa 960ggaggctcgt
tgtcaggaac gttgaaggac cgagaaaggg tgacgattga tcaggaccgc
1020tgccggagcg caacccactc actacagcag agccatgtag acaacatccc
ctcccccttt 1080ccaccgcgtc agacgcccgt agcagcccgc tacgggcttt
ttcatgccct gccctagcgt 1140ccaagcctca cggccgcgct cggcctctct
ggcggccttc tggcgctctt ccgcttcctc 1200gctcactgac tcgctgcgct
cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 1260ggcggtaata
cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
1320aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
tccataggct 1380ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
cagaggtggc gaaacccgac 1440aggactataa agataccagg cgtttccccc
tggaagctcc ctcgtgcgct ctcctgttcc 1500gaccctgccg cttaccggat
acctgtccgc ctttctccct tcgggaagcg tggcgctttt 1560ccgctgcata
accctgcttc ggggtcatta tagcgatttt ttcggtatat ccatcctttt
1620tcgcacgata tacaggattt tgccaaaggg ttcgtgtaga ctttccttgg
tgtatccaac 1680ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc
gagcgggtgt tccttcttca 1740ctgtccctta ttcgcacctg gcggtgctca
acgggaatcc tgctctgcga ggctggccgg 1800ctaccgccgg cgtaacagat
gagggcaagc ggatggctga tgaaaccaag ccaaccagga 1860agggcagccc
acctatcaag gtgtactgcc ttccagacga acgaagagcg attgaggaaa
1920aggcggcggc ggccggcatg agcctgtcgg cctacctgct ggccgtcggc
cagggctaca 1980aaatcacggg cgtcgtggac tatgagcacg tccgcgagct
ggcccgcatc aatggcgacc 2040tgggccgcct gggcggcctg ctgaaactct
ggctcaccga cgacccgcgc acggcgcggt 2100tcggtgatgc cacgatcctc
gccctgctgg cgaagatcga agagaagcag gacgagcttg 2160gcaaggtcat
gatgggcgtg gtccgcccga gggcagagcc atgacttttt tagccgctaa
2220aacggccggg gggtgcgcgt gattgccaag cacgtcccca tgcgctccat
caagaagagc 2280gacttcgcgg agctggtgaa gtacatcacc gacgagcaag
gcaagaccga gcgcctttgc 2340gacgctcacc gggctggttg ccctcgccgc
tgggctggcg gccgtctatg gccctgcaaa 2400cgcgccagaa acgccgtcga
agccgtgtgc gagacaccgc ggccgccggc gttgtggata 2460cctcgcggaa
aacttggccc tcactgacag atgaggggcg gacgttgaca cttgaggggc
2520cgactcaccc ggcgcggcgt tgacagatga ggggcaggct cgatttcggc
cggcgacgtg 2580gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt
tacgcgagtt tcccacagat 2640gatgtggaca agcctgggga taagtgccct
gcggtattga cacttgaggg gcgcgactac 2700tgacagatga ggggcgcgat
ccttgacact tgaggggcag agtgctgaca gatgaggggc 2760gcacctattg
acatttgagg ggctgtccac aggcagaaaa tccagcattt gcaagggttt
2820ccgcccgttt ttcggccacc gctaacctgt cttttaacct gcttttaaac
caatatttat 2880aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga
ccgcgcacgc cgaagggggg 2940tgccccccct tctcgaaccc tcccggcccg
ctaacgcggg cctcccatcc ccccaggggc 3000tgcgcccctc ggccgcgaac
ggcctcaccc caaaaatggc agcgctggca gtccttgcca 3060ttgccgggat
cggggcagta acgggatggg cgatcagccc gagcgcgacg cccggaagca
3120ttgacgtgcc gcaggtgctg gcatcgacat tcagcgacca ggtgccgggc
agtgagggcg 3180gcggcctggg tggcggcctg cccttcactt cggccgtcgg
ggcattcacg gacttcatgg 3240cggggccggc aatttttacc ttgggcattc
ttggcatagt ggtcgcgggt gccgtgctcg 3300tgttcggggg tgcgataaac
ccagcgaacc atttgaggtg ataggtaaga ttataccgag 3360gtatgaaaac
gagaattgga cctttacaga attactctat gaagcgccat atttaaaaag
3420ctaccaagac gaagaggatg aagaggatga ggaggcagat tgccttgaat
atattgacaa 3480tactgataag ataatatatc ttttatatag aagatatcgc
cgtatgtaag gatttcaggg 3540ggcaaggcat aggcagcgcg cttatcaata
tatctataga atgggcaaag cataaaaact 3600tgcatggact aatgcttgaa
acccaggaca ataaccttat agcttgtaaa ttctatcata 3660attgggtaat
gactccaact tattgatagt gttttatgtt cagataatgc ccgatgactt
3720tgtcatgcag ctccaccgat tttgagaacg acagcgactt ccgtcccagc
cgtgccaggt 3780gctgcctcag attcaggtta tgccgctcaa ttcgctgcgt
atatcgcttg ctgattacgt 3840gcagctttcc cttcaggcgg gattcataca
gcggccagcc atccgtcatc catatcacca 3900cgtcaaaggg tgacagcagg
ctcataagac gccccagcgt cgccatagtg cgttcaccga 3960atacgtgcgc
aacaaccgtc ttccggagac tgtcatacgc gtaaaacagc cagcgctggc
4020gcgatttagc
cccgacatag ccccactgtt cgtccatttc cgcgcagacg atgacgtcac
4080tgcccggctg tatgcgcgag gttaccgact gcggcctgag ttttttaagt
gacgtaaaat 4140cgtgttgagg ccaacgccca taatgcgggc tgttgcccgg
catccaacgc cattcatggc 4200catatcaatg attttctggt gcgtaccggg
ttgagaagcg gtgtaagtga actgcagttg 4260ccatgtttta cggcagtgag
agcagagata gcgctgatgt ccggcggtgc ttttgccgtt 4320acgcaccacc
ccgtcagtag ctgaacagga gggacagctg atagacacag aagccactgg
4380agcacctcaa aaacaccatc atacactaaa tcagtaagtt ggcagcatca
cccataattg 4440tggtttcaaa atcggctccg tcgatactat gttatacgcc
aactttgaaa acaactttga 4500aaaagctgtt ttctggtatt taaggtttta
gaatgcaagg aacagtgaat tggagttcgt 4560cttgttataa ttagcttctt
ggggtatctt taaatactgt agaaaagagg aaggaaataa 4620taaatggcta
aaatgagaat atcaccggaa ttgaaaaaac tgatcgaaaa ataccgctgc
4680gtaaaagata cggaaggaat gtctcctgct aaggtatata agctggtggg
agaaaatgaa 4740aacctatatt taaaaatgac ggacagccgg tataaaggga
ccacctatga tgtggaacgg 4800gaaaaggaca tgatgctatg gctggaagga
aagctgcctg ttccaaaggt cctgcacttt 4860gaacggcatg atggctggag
caatctgctc atgagtgagg ccgatggcgt cctttgctcg 4920gaagagtatg
aagatgaaca aagccctgaa aagattatcg agctgtatgc ggagtgcatc
4980aggctctttc actccatcga catatcggat tgtccctata cgaatagctt
agacagccgc 5040ttagccgaat tggattactt actgaataac gatctggccg
atgtggattg cgaaaactgg 5100gaagaagaca ctccatttaa agatccgcgc
gagctgtatg attttttaaa gacggaaaag 5160cccgaagagg aacttgtctt
ttcccacggc gacctgggag acagcaacat ctttgtgaaa 5220gatggcaaag
taagtggctt tattgatctt gggagaagcg gcagggcgga caagtggtat
5280gacattgcct tctgcgtccg gtcgatcagg gaggatatcg gggaagaaca
gtatgtcgag 5340ctattttttg acttactggg gatcaagcct gattgggaga
aaataaaata ttatatttta 5400ctggatgaat tgttttagta cctagatgtg
gcgcaacgat gccggcgaca agcaggagcg 5460caccgacttc ttccgcatca
agtgttttgg ctctcaggcc gaggcccacg gcaagtattt 5520gggcaagggg
tcgctggtat tcgtgcaggg caagattcgg aataccaagt acgagaagga
5580cggccagacg gtctacggga ccgacttcat tgccgataag gtggattatc
tggacaccaa 5640ggcaccaggc gggtcaaatc aggaataagg gcacattgcc
ccggcgtgag tcggggcaat 5700cccgcaagga gggtgaatga atcggacgtt
tgaccggaag gcatacaggc aagaactgat 5760cgacgcgggg ttttccgccg
aggatgccga aaccatcgca agccgcaccg tcatgcgtgc 5820gccccgcgaa
accttccagt ccgtcggctc gatggtccag caagctacgg ccaagatcga
5880gcgcgacagc gtgcaactgg ctccccctgc cctgcccgcg ccatcggccg
ccgtggagcg 5940ttcgcgtcgt ctcgaacagg aggcggcagg tttggcgaag
tcgatgacca tcgacacgcg 6000aggaactatg acgaccaaga agcgaaaaac
cgccggcgag gacctggcaa aacaggtcag 6060cgaggccaag caggccgcgt
tgctgaaaca cacgaagcag cagatcaagg aaatgcagct 6120ttccttgttc
gatattgcgc cgtggccgga cacgatgcga gcgatgccaa acgacacggc
6180ccgctctgcc ctgttcacca cgcgcaacaa gaaaatcccg cgcgaggcgc
tgcaaaacaa 6240ggtcattttc cacgtcaaca aggacgtgaa gatcacctac
accggcgtcg agctgcgggc 6300cgacgatgac gaactggtgt ggcagcaggt
gttggagtac gcgaagcgca cccctatcgg 6360cgagccgatc accttcacgt
tctacgagct ttgccaggac ctgggctggt cgatcaatgg 6420ccggtattac
acgaaggccg aggaatgcct gtcgcgccta caggcgacgg cgatgggctt
6480cacgtccgac cgcgttgggc acctggaatc ggtgtcgctg ctgcaccgct
tccgcgtcct 6540ggaccgtggc aagaaaacgt cccgttgcca ggtcctgatc
gacgaggaaa tcgtcgtgct 6600gtttgctggc gaccactaca cgaaattcat
atgggagaag taccgcaagc tgtcgccgac 6660ggcccgacgg atgttcgact
atttcagctc gcaccgggag ccgtacccgc tcaagctgga 6720aaccttccgc
ctcatgtgcg gatcggattc cacccgcgtg aagaagtggc gcgagcaggt
6780cggcgaagcc tgcgaagagt tgcgaggcag cggcctggtg gaacacgcct
gggtcaatga 6840tgacctggtg cattgcaaac gctagggcct tgtggggtca
gttccggctg ggggttcagc 6900agccagcgct ttactggcat ttcaggaaca
agcgggcact gctcgacgca cttgcttcgc 6960tcagtatcgc tcgggacgca
cggcgcgctc tacgaactgc cgataaacag aggattaaaa 7020ttgacaattg
tgattaaggc tcagattcga cggcttggag cggccgacgt gcaggatttc
7080cgcgagatcc gattgtcggc cctgaagaaa gctccagaga tgttcgggtc
cgtttacgag 7140cacgaggaga aaaagcccat ggaggcgttc gctgaacggt
tgcgagatgc cgtggcattc 7200ggcgcctaca tcgacggcga gatcattggg
ctgtcggtct tcaaacagga ggacggcccc 7260aaggacgctc acaaggcgca
tctgtccggc gttttcgtgg agcccgaaca gcgaggccga 7320ggggtcgccg
gtatgctgct gcgggcgttg ccggcgggtt tattgctcgt gatgatcgtc
7380cgacagattc caacgggaat ctggtggatg cgcatcttca tcctcggcgc
acttaatatt 7440tcgctattct ggagcttgtt gtttatttcg gtctaccgcc
tgccgggcgg ggtcgcggcg 7500acggtaggcg ctgtgcagcc gctgatggtc
gtgttcatct ctgccgctct gctaggtagc 7560ccgatacgat tgatggcggt
cctgggggct atttgcggaa ctgcgggcgt ggcgctgttg 7620gtgttgacac
caaacgcagc gctagatcct gtcggcgtcg cagcgggcct ggcgggggcg
7680gtttccatgg cgttcggaac cgtgctgacc cgcaagtggc aacctcccgt
gcctctgctc 7740acctttaccg cctggcaact ggcggccgga ggacttctgc
tcgttccagt agctttagtg 7800tttgatccgc caatcccgat gcctacagga
accaatgttc tcggcctggc gtggctcggc 7860ctgatcggag cgggtttaac
ctacttcctt tggttccggg ggatctcgcg actcgaacct 7920acagttgttt
ccttactggg ctttctcagc cccagatctg gggtcgatca gccggggatg
7980catcaggccg acagtcggaa cttcgggtcc ccgacctgta ccattcggtg
agcaatggat 8040aggggagttg atatcgtcaa cgttcacttc taaagaaata
gcgccactca gcttcctcag 8100cggctttatc cagcgatttc ctattatgtc
ggcatagttc tcaagatcga cagcctgtca 8160cggttaagcg agaaatgaat
aagaaggctg ataattcgga tctctgcgag ggagatgata 8220tttgatcaca
ggcagcaacg ctctgtcatc gttacaatca acatgctacc ctccgcgaga
8280tcatccgtgt ttcaaacccg gcagcttagt tgccgttctt ccgaatagca
tcggtaacat 8340gagcaaagtc tgccgcctta caacggctct cccgctgacg
ccgtcccgga ctgatgggct 8400gcctgtatcg agtggtgatt ttgtgccgag
ctgccggtcg gggagctgtt ggctggctgg 8460tggcaggata tattgtggtg
taaacaaatt gacgcttaga caacttaata acacattgcg 8520gacgttttta
atgtactggg gtggtttttc ttttcaccag tgagacgggc aacagctgat
8580tgcccttcac cgcctggccc tgagagagtt gcagcaagcg gtccacgctg
gtttgcccca 8640gcaggcgaaa atcctgtttg atggtggttc cgaaatcggc
aaaatccctt ataaatcaaa 8700agaatagccc gagatagggt tgagtgttgt
tccagtttgg aacaagagtc cactattaaa 8760gaacgtggac tccaacgtca
aagggcgaaa aaccgtctat cagggcgatg gcccactacg 8820tgaaccatca
cccaaatcaa gttttttggg gtcgaggtgc cgtaaagcac taaatcggaa
8880ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg
tggcgagaaa 8940ggaagggaag aaagcgaaag gagcgggcgc cattcaggct
gcgcaactgt tgggaagggc 9000gatcggtgcg ggcctcttcg ctattacgcc
agctggcgaa agggggatgt gctgcaaggc 9060gattaagttg ggtaacgcca
gggttttccc agtcacgacg ttgtaaaacg acggccagtg 9120aattaattcc
catcttgaaa gaaatatagt ttaaatattt attgataaaa taacaagtca
9180ggtattatag tccaagcaaa aacataaatt tattgatgca agtttaaatt
cagaaatatt 9240tcaataactg attatatcag ctggtacatt gccgtagatg
aaagactgag tgcgatatta 9300tgtgtaatac ataaattgat gatatagcta
gcttagctca tcgggggatc cgtcgaagct 9360agcttgggtc ccgctcagaa
gaactcgtca agaaggcgat agaaggcgat gcgctgcgaa 9420tcgggagcgg
cgataccgta aagcacgagg aagcggtcag cccattcgcc gccaagctct
9480tcagcaatat cacgggtagc caacgctatg tcctgatagc ggtccgccac
acccagccgg 9540ccacagtcga tgaatccaga aaagcggcca ttttccacca
tgatattcgg caagcaggca 9600tcgccatggg tcacgacgag atcctcgccg
tcgggcatgc gcgccttgag cctggcgaac 9660agttcggctg gcgcgagccc
ctgatgctct tcgtccagat catcctgatc gacaagaccg 9720gcttccatcc
gagtacgtgc tcgctcgatg cgatgtttcg cttggtggtc gaatgggcag
9780gtagccggat caagcgtatg cagccgccgc attgcatcag ccatgatgga
tactttctcg 9840gcaggagcaa ggtgagatga caggagatcc tgccccggca
cttcgcccaa tagcagccag 9900tcccttcccg cttcagtgac aacgtcgagc
acagctgcgc aaggaacgcc cgtcgtggcc 9960agccacgata gccgcgctgc
ctcgtcctgc agttcattca gggcaccgga caggtcggtc 10020ttgacaaaaa
gaaccgggcg cccctgcgct gacagccgga acacggcggc atcagagcag
10080ccgattgtct gttgtgccca gtcatagccg aatagcctct ccacccaagc
ggccggagaa 10140cctgcgtgca atccatcttg ttcaatccaa gctcccatgg
gccctcgact agagtcgaga 10200tctggattga gagtgaatat gagactctaa
ttggataccg aggggaattt atggaacgtc 10260agtggagcat ttttgacaag
aaatatttgc tagctgatag tgaccttagg cgacttttga 10320acgcgcaata
atggtttctg acgtatgtgc ttagctcatt aaactccaga aacccgcggc
10380tgagtggctc cttcaacgtt gcggttctgt cagttccaaa cgtaaaacgg
cttgtcccgc 10440gtcatcggcg ggggtcataa cgtgactccc ttaattctcc
gctcatgatc ttgatcccct 10500gcgccatcag atccttggcg gcaagaaagc
catccagttt actttgcagg gcttcccaac 10560cttaccagag ggcgccccag
ctggcaattc cggttcgctt gctgtccata aaaccgccca 10620gtctagctat
cgccatgtaa gcccactgca agctacctgc tttctctttg cgcttgcgtt
10680ttcccttgtc cagatagccc agtagctgac attcatccgg ggtcagcacc
gtttctgcgg 10740actggctttc tacgtgttcc gcttccttta gcagcccttg
cgccctgagt gcttgcggca 10800gcgtgaagct tgcatgcctg caggtcgacg
gcgcgccgag ctcctcgagc aaatttacac 10860attgccacta aacgtctaaa
cccttgtaat ttgtttttgt tttactatgt gtgttatgta 10920tttgatttgc
gataaatttt tatatttggt actaaattta taacaccttt tatgctaacg
10980tttgccaaca cttagcaatt tgcaagttga ttaattgatt ctaaattatt
tttgtcttct 11040aaatacatat actaatcaac tggaaatgta aatatttgct
aatatttcta ctataggaga 11100attaaagtga gtgaatatgg taccacaagg
tttggagatt taattgttgc aatgctgcat 11160ggatggcata tacaccaaac
attcaataat tcttgaggat aataatggta ccacacaaga 11220tttgaggtgc
atgaacgtca cgtggacaaa aggtttagta atttttcaag acaacaatgt
11280taccacacac aagttttgag gtgcatgcat ggatgccctg tggaaagttt
aaaaatattt 11340tggaaatgat ttgcatggaa gccatgtgta aaaccatgac
atccacttgg aggatgcaat 11400aatgaagaaa actacaaatt tacatgcaac
tagttatgca tgtagtctat ataatgagga 11460ttttgcaata ctttcattca
tacacactca ctaagtttta cacgattata atttcttcat 11520agccagcgga
tccgatatcg ggcccgctag cgttaaccct gctttaatga gatatgcgag
11580acgcctatga tcgcatgata tttgctttca attctgttgt gcacgttgta
aaaaacctga 11640gcatgtgtag ctcagatcct taccgccggt ttcggttcat
tctaatgaat atatcacccg 11700ttactatcgt atttttatga ataatattct
ccgttcaatt tactgattgt ccgtcgacga 11760attcgagctc ggcgcgcctc
tagaggatcg atgaattcag atcggctgag tggctccttc 11820aacgttgcgg
ttctgtcagt tccaaacgta aaacggcttg tcccgcgtca tcggcggggg
11880tcataacgtg actcccttaa ttctccgctc atgatcagat tgtcgtttcc
cgccttcagt 11940ttaaactatc agtgtttgac aggatatatt ggcgggtaaa
cctaagagaa aagagcgttt 12000attagaataa tcggatattt aaaagggcgt
gaaaaggttt atccttcgtc catttgtatg 12060tgcatgccaa ccacagggtt cccca
120852912079DNAArtificial sequenceplant expression vector with one
promoter-terminator expression cassette 29gatctggcgc cggccagcga
gacgagcaag attggccgcc gcccgaaacg atccgacagc 60gcgcccagca caggtgcgca
ggcaaattgc accaacgcat acagcgccag cagaatgcca 120tagtgggcgg
tgacgtcgtt cgagtgaacc agatcgcgca ggaggcccgg cagcaccggc
180ataatcaggc cgatgccgac agcgtcgagc gcgacagtgc tcagaattac
gatcaggggt 240atgttgggtt tcacgtctgg cctccggacc agcctccgct
ggtccgattg aacgcgcgga 300ttctttatca ctgataagtt ggtggacata
ttatgtttat cagtgataaa gtgtcaagca 360tgacaaagtt gcagccgaat
acagtgatcc gtgccgccct ggacctgttg aacgaggtcg 420gcgtagacgg
tctgacgaca cgcaaactgg cggaacggtt gggggttcag cagccggcgc
480tttactggca cttcaggaac aagcgggcgc tgctcgacgc actggccgaa
gccatgctgg 540cggagaatca tacgcattcg gtgccgagag ccgacgacga
ctggcgctca tttctgatcg 600ggaatgcccg cagcttcagg caggcgctgc
tcgcctaccg cgatggcgcg cgcatccatg 660ccggcacgcg accgggcgca
ccgcagatgg aaacggccga cgcgcagctt cgcttcctct 720gcgaggcggg
tttttcggcc ggggacgccg tcaatgcgct gatgacaatc agctacttca
780ctgttggggc cgtgcttgag gagcaggccg gcgacagcga tgccggcgag
cgcggcggca 840ccgttgaaca ggctccgctc tcgccgctgt tgcgggccgc
gatagacgcc ttcgacgaag 900ccggtccgga cgcagcgttc gagcagggac
tcgcggtgat tgtcgatgga ttggcgaaaa 960ggaggctcgt tgtcaggaac
gttgaaggac cgagaaaggg tgacgattga tcaggaccgc 1020tgccggagcg
caacccactc actacagcag agccatgtag acaacatccc ctcccccttt
1080ccaccgcgtc agacgcccgt agcagcccgc tacgggcttt ttcatgccct
gccctagcgt 1140ccaagcctca cggccgcgct cggcctctct ggcggccttc
tggcgctctt ccgcttcctc 1200gctcactgac tcgctgcgct cggtcgttcg
gctgcggcga gcggtatcag ctcactcaaa 1260ggcggtaata cggttatcca
cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 1320aggccagcaa
aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct
1380ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
gaaacccgac 1440aggactataa agataccagg cgtttccccc tggaagctcc
ctcgtgcgct ctcctgttcc 1500gaccctgccg cttaccggat acctgtccgc
ctttctccct tcgggaagcg tggcgctttt 1560ccgctgcata accctgcttc
ggggtcatta tagcgatttt ttcggtatat ccatcctttt 1620tcgcacgata
tacaggattt tgccaaaggg ttcgtgtaga ctttccttgg tgtatccaac
1680ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc gagcgggtgt
tccttcttca 1740ctgtccctta ttcgcacctg gcggtgctca acgggaatcc
tgctctgcga ggctggccgg 1800ctaccgccgg cgtaacagat gagggcaagc
ggatggctga tgaaaccaag ccaaccagga 1860agggcagccc acctatcaag
gtgtactgcc ttccagacga acgaagagcg attgaggaaa 1920aggcggcggc
ggccggcatg agcctgtcgg cctacctgct ggccgtcggc cagggctaca
1980aaatcacggg cgtcgtggac tatgagcacg tccgcgagct ggcccgcatc
aatggcgacc 2040tgggccgcct gggcggcctg ctgaaactct ggctcaccga
cgacccgcgc acggcgcggt 2100tcggtgatgc cacgatcctc gccctgctgg
cgaagatcga agagaagcag gacgagcttg 2160gcaaggtcat gatgggcgtg
gtccgcccga gggcagagcc atgacttttt tagccgctaa 2220aacggccggg
gggtgcgcgt gattgccaag cacgtcccca tgcgctccat caagaagagc
2280gacttcgcgg agctggtgaa gtacatcacc gacgagcaag gcaagaccga
gcgcctttgc 2340gacgctcacc gggctggttg ccctcgccgc tgggctggcg
gccgtctatg gccctgcaaa 2400cgcgccagaa acgccgtcga agccgtgtgc
gagacaccgc ggccgccggc gttgtggata 2460cctcgcggaa aacttggccc
tcactgacag atgaggggcg gacgttgaca cttgaggggc 2520cgactcaccc
ggcgcggcgt tgacagatga ggggcaggct cgatttcggc cggcgacgtg
2580gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt tacgcgagtt
tcccacagat 2640gatgtggaca agcctgggga taagtgccct gcggtattga
cacttgaggg gcgcgactac 2700tgacagatga ggggcgcgat ccttgacact
tgaggggcag agtgctgaca gatgaggggc 2760gcacctattg acatttgagg
ggctgtccac aggcagaaaa tccagcattt gcaagggttt 2820ccgcccgttt
ttcggccacc gctaacctgt cttttaacct gcttttaaac caatatttat
2880aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga ccgcgcacgc
cgaagggggg 2940tgccccccct tctcgaaccc tcccggcccg ctaacgcggg
cctcccatcc ccccaggggc 3000tgcgcccctc ggccgcgaac ggcctcaccc
caaaaatggc agcgctggca gtccttgcca 3060ttgccgggat cggggcagta
acgggatggg cgatcagccc gagcgcgacg cccggaagca 3120ttgacgtgcc
gcaggtgctg gcatcgacat tcagcgacca ggtgccgggc agtgagggcg
3180gcggcctggg tggcggcctg cccttcactt cggccgtcgg ggcattcacg
gacttcatgg 3240cggggccggc aatttttacc ttgggcattc ttggcatagt
ggtcgcgggt gccgtgctcg 3300tgttcggggg tgcgataaac ccagcgaacc
atttgaggtg ataggtaaga ttataccgag 3360gtatgaaaac gagaattgga
cctttacaga attactctat gaagcgccat atttaaaaag 3420ctaccaagac
gaagaggatg aagaggatga ggaggcagat tgccttgaat atattgacaa
3480tactgataag ataatatatc ttttatatag aagatatcgc cgtatgtaag
gatttcaggg 3540ggcaaggcat aggcagcgcg cttatcaata tatctataga
atgggcaaag cataaaaact 3600tgcatggact aatgcttgaa acccaggaca
ataaccttat agcttgtaaa ttctatcata 3660attgggtaat gactccaact
tattgatagt gttttatgtt cagataatgc ccgatgactt 3720tgtcatgcag
ctccaccgat tttgagaacg acagcgactt ccgtcccagc cgtgccaggt
3780gctgcctcag attcaggtta tgccgctcaa ttcgctgcgt atatcgcttg
ctgattacgt 3840gcagctttcc cttcaggcgg gattcataca gcggccagcc
atccgtcatc catatcacca 3900cgtcaaaggg tgacagcagg ctcataagac
gccccagcgt cgccatagtg cgttcaccga 3960atacgtgcgc aacaaccgtc
ttccggagac tgtcatacgc gtaaaacagc cagcgctggc 4020gcgatttagc
cccgacatag ccccactgtt cgtccatttc cgcgcagacg atgacgtcac
4080tgcccggctg tatgcgcgag gttaccgact gcggcctgag ttttttaagt
gacgtaaaat 4140cgtgttgagg ccaacgccca taatgcgggc tgttgcccgg
catccaacgc cattcatggc 4200catatcaatg attttctggt gcgtaccggg
ttgagaagcg gtgtaagtga actgcagttg 4260ccatgtttta cggcagtgag
agcagagata gcgctgatgt ccggcggtgc ttttgccgtt 4320acgcaccacc
ccgtcagtag ctgaacagga gggacagctg atagacacag aagccactgg
4380agcacctcaa aaacaccatc atacactaaa tcagtaagtt ggcagcatca
cccataattg 4440tggtttcaaa atcggctccg tcgatactat gttatacgcc
aactttgaaa acaactttga 4500aaaagctgtt ttctggtatt taaggtttta
gaatgcaagg aacagtgaat tggagttcgt 4560cttgttataa ttagcttctt
ggggtatctt taaatactgt agaaaagagg aaggaaataa 4620taaatggcta
aaatgagaat atcaccggaa ttgaaaaaac tgatcgaaaa ataccgctgc
4680gtaaaagata cggaaggaat gtctcctgct aaggtatata agctggtggg
agaaaatgaa 4740aacctatatt taaaaatgac ggacagccgg tataaaggga
ccacctatga tgtggaacgg 4800gaaaaggaca tgatgctatg gctggaagga
aagctgcctg ttccaaaggt cctgcacttt 4860gaacggcatg atggctggag
caatctgctc atgagtgagg ccgatggcgt cctttgctcg 4920gaagagtatg
aagatgaaca aagccctgaa aagattatcg agctgtatgc ggagtgcatc
4980aggctctttc actccatcga catatcggat tgtccctata cgaatagctt
agacagccgc 5040ttagccgaat tggattactt actgaataac gatctggccg
atgtggattg cgaaaactgg 5100gaagaagaca ctccatttaa agatccgcgc
gagctgtatg attttttaaa gacggaaaag 5160cccgaagagg aacttgtctt
ttcccacggc gacctgggag acagcaacat ctttgtgaaa 5220gatggcaaag
taagtggctt tattgatctt gggagaagcg gcagggcgga caagtggtat
5280gacattgcct tctgcgtccg gtcgatcagg gaggatatcg gggaagaaca
gtatgtcgag 5340ctattttttg acttactggg gatcaagcct gattgggaga
aaataaaata ttatatttta 5400ctggatgaat tgttttagta cctagatgtg
gcgcaacgat gccggcgaca agcaggagcg 5460caccgacttc ttccgcatca
agtgttttgg ctctcaggcc gaggcccacg gcaagtattt 5520gggcaagggg
tcgctggtat tcgtgcaggg caagattcgg aataccaagt acgagaagga
5580cggccagacg gtctacggga ccgacttcat tgccgataag gtggattatc
tggacaccaa 5640ggcaccaggc gggtcaaatc aggaataagg gcacattgcc
ccggcgtgag tcggggcaat 5700cccgcaagga gggtgaatga atcggacgtt
tgaccggaag gcatacaggc aagaactgat 5760cgacgcgggg ttttccgccg
aggatgccga aaccatcgca agccgcaccg tcatgcgtgc 5820gccccgcgaa
accttccagt ccgtcggctc gatggtccag caagctacgg ccaagatcga
5880gcgcgacagc gtgcaactgg ctccccctgc cctgcccgcg ccatcggccg
ccgtggagcg 5940ttcgcgtcgt ctcgaacagg aggcggcagg tttggcgaag
tcgatgacca tcgacacgcg 6000aggaactatg acgaccaaga agcgaaaaac
cgccggcgag gacctggcaa aacaggtcag 6060cgaggccaag caggccgcgt
tgctgaaaca cacgaagcag cagatcaagg aaatgcagct 6120ttccttgttc
gatattgcgc cgtggccgga cacgatgcga gcgatgccaa acgacacggc
6180ccgctctgcc ctgttcacca cgcgcaacaa gaaaatcccg cgcgaggcgc
tgcaaaacaa 6240ggtcattttc cacgtcaaca aggacgtgaa gatcacctac
accggcgtcg agctgcgggc 6300cgacgatgac gaactggtgt ggcagcaggt
gttggagtac gcgaagcgca cccctatcgg 6360cgagccgatc accttcacgt
tctacgagct ttgccaggac ctgggctggt cgatcaatgg 6420ccggtattac
acgaaggccg aggaatgcct gtcgcgccta caggcgacgg cgatgggctt
6480cacgtccgac cgcgttgggc acctggaatc ggtgtcgctg ctgcaccgct
tccgcgtcct 6540ggaccgtggc aagaaaacgt cccgttgcca ggtcctgatc
gacgaggaaa tcgtcgtgct 6600gtttgctggc gaccactaca cgaaattcat
atgggagaag taccgcaagc tgtcgccgac 6660ggcccgacgg atgttcgact
atttcagctc gcaccgggag ccgtacccgc tcaagctgga 6720aaccttccgc
ctcatgtgcg gatcggattc cacccgcgtg aagaagtggc gcgagcaggt
6780cggcgaagcc tgcgaagagt tgcgaggcag cggcctggtg gaacacgcct
gggtcaatga 6840tgacctggtg cattgcaaac
gctagggcct tgtggggtca gttccggctg ggggttcagc 6900agccagcgct
ttactggcat ttcaggaaca agcgggcact gctcgacgca cttgcttcgc
6960tcagtatcgc tcgggacgca cggcgcgctc tacgaactgc cgataaacag
aggattaaaa 7020ttgacaattg tgattaaggc tcagattcga cggcttggag
cggccgacgt gcaggatttc 7080cgcgagatcc gattgtcggc cctgaagaaa
gctccagaga tgttcgggtc cgtttacgag 7140cacgaggaga aaaagcccat
ggaggcgttc gctgaacggt tgcgagatgc cgtggcattc 7200ggcgcctaca
tcgacggcga gatcattggg ctgtcggtct tcaaacagga ggacggcccc
7260aaggacgctc acaaggcgca tctgtccggc gttttcgtgg agcccgaaca
gcgaggccga 7320ggggtcgccg gtatgctgct gcgggcgttg ccggcgggtt
tattgctcgt gatgatcgtc 7380cgacagattc caacgggaat ctggtggatg
cgcatcttca tcctcggcgc acttaatatt 7440tcgctattct ggagcttgtt
gtttatttcg gtctaccgcc tgccgggcgg ggtcgcggcg 7500acggtaggcg
ctgtgcagcc gctgatggtc gtgttcatct ctgccgctct gctaggtagc
7560ccgatacgat tgatggcggt cctgggggct atttgcggaa ctgcgggcgt
ggcgctgttg 7620gtgttgacac caaacgcagc gctagatcct gtcggcgtcg
cagcgggcct ggcgggggcg 7680gtttccatgg cgttcggaac cgtgctgacc
cgcaagtggc aacctcccgt gcctctgctc 7740acctttaccg cctggcaact
ggcggccgga ggacttctgc tcgttccagt agctttagtg 7800tttgatccgc
caatcccgat gcctacagga accaatgttc tcggcctggc gtggctcggc
7860ctgatcggag cgggtttaac ctacttcctt tggttccggg ggatctcgcg
actcgaacct 7920acagttgttt ccttactggg ctttctcagc cccagatctg
gggtcgatca gccggggatg 7980catcaggccg acagtcggaa cttcgggtcc
ccgacctgta ccattcggtg agcaatggat 8040aggggagttg atatcgtcaa
cgttcacttc taaagaaata gcgccactca gcttcctcag 8100cggctttatc
cagcgatttc ctattatgtc ggcatagttc tcaagatcga cagcctgtca
8160cggttaagcg agaaatgaat aagaaggctg ataattcgga tctctgcgag
ggagatgata 8220tttgatcaca ggcagcaacg ctctgtcatc gttacaatca
acatgctacc ctccgcgaga 8280tcatccgtgt ttcaaacccg gcagcttagt
tgccgttctt ccgaatagca tcggtaacat 8340gagcaaagtc tgccgcctta
caacggctct cccgctgacg ccgtcccgga ctgatgggct 8400gcctgtatcg
agtggtgatt ttgtgccgag ctgccggtcg gggagctgtt ggctggctgg
8460tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata
acacattgcg 8520gacgttttta atgtactggg gtggtttttc ttttcaccag
tgagacgggc aacagctgat 8580tgcccttcac cgcctggccc tgagagagtt
gcagcaagcg gtccacgctg gtttgcccca 8640gcaggcgaaa atcctgtttg
atggtggttc cgaaatcggc aaaatccctt ataaatcaaa 8700agaatagccc
gagatagggt tgagtgttgt tccagtttgg aacaagagtc cactattaaa
8760gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg
gcccactacg 8820tgaaccatca cccaaatcaa gttttttggg gtcgaggtgc
cgtaaagcac taaatcggaa 8880ccctaaaggg agcccccgat ttagagcttg
acggggaaag ccggcgaacg tggcgagaaa 8940ggaagggaag aaagcgaaag
gagcgggcgc cattcaggct gcgcaactgt tgggaagggc 9000gatcggtgcg
ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc
9060gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg
acggccagtg 9120aattaattcc catcttgaaa gaaatatagt ttaaatattt
attgataaaa taacaagtca 9180ggtattatag tccaagcaaa aacataaatt
tattgatgca agtttaaatt cagaaatatt 9240tcaataactg attatatcag
ctggtacatt gccgtagatg aaagactgag tgcgatatta 9300tgtgtaatac
ataaattgat gatatagcta gcttagctca tcgggggatc cgtcgaagct
9360agcttgggtc ccgctcagaa gaactcgtca agaaggcgat agaaggcgat
gcgctgcgaa 9420tcgggagcgg cgataccgta aagcacgagg aagcggtcag
cccattcgcc gccaagctct 9480tcagcaatat cacgggtagc caacgctatg
tcctgatagc ggtccgccac acccagccgg 9540ccacagtcga tgaatccaga
aaagcggcca ttttccacca tgatattcgg caagcaggca 9600tcgccatggg
tcacgacgag atcctcgccg tcgggcatgc gcgccttgag cctggcgaac
9660agttcggctg gcgcgagccc ctgatgctct tcgtccagat catcctgatc
gacaagaccg 9720gcttccatcc gagtacgtgc tcgctcgatg cgatgtttcg
cttggtggtc gaatgggcag 9780gtagccggat caagcgtatg cagccgccgc
attgcatcag ccatgatgga tactttctcg 9840gcaggagcaa ggtgagatga
caggagatcc tgccccggca cttcgcccaa tagcagccag 9900tcccttcccg
cttcagtgac aacgtcgagc acagctgcgc aaggaacgcc cgtcgtggcc
9960agccacgata gccgcgctgc ctcgtcctgc agttcattca gggcaccgga
caggtcggtc 10020ttgacaaaaa gaaccgggcg cccctgcgct gacagccgga
acacggcggc atcagagcag 10080ccgattgtct gttgtgccca gtcatagccg
aatagcctct ccacccaagc ggccggagaa 10140cctgcgtgca atccatcttg
ttcaatccaa gctcccatgg gccctcgact agagtcgaga 10200tctggattga
gagtgaatat gagactctaa ttggataccg aggggaattt atggaacgtc
10260agtggagcat ttttgacaag aaatatttgc tagctgatag tgaccttagg
cgacttttga 10320acgcgcaata atggtttctg acgtatgtgc ttagctcatt
aaactccaga aacccgcggc 10380tgagtggctc cttcaacgtt gcggttctgt
cagttccaaa cgtaaaacgg cttgtcccgc 10440gtcatcggcg ggggtcataa
cgtgactccc ttaattctcc gctcatgatc ttgatcccct 10500gcgccatcag
atccttggcg gcaagaaagc catccagttt actttgcagg gcttcccaac
10560cttaccagag ggcgccccag ctggcaattc cggttcgctt gctgtccata
aaaccgccca 10620gtctagctat cgccatgtaa gcccactgca agctacctgc
tttctctttg cgcttgcgtt 10680ttcccttgtc cagatagccc agtagctgac
attcatccgg ggtcagcacc gtttctgcgg 10740actggctttc tacgtgttcc
gcttccttta gcagcccttg cgccctgagt gcttgcggca 10800gcgtgaagct
tgcatgcctg caggtcgacg gcgcgccgag ctcctcgagc aaatttacac
10860attgccacta aacgtctaaa cccttgtaat ttgtttttgt tttactatgt
gtgttatgta 10920tttgatttgc gataaatttt tatatttggt actaaattta
taacaccttt tatgctaacg 10980tttgccaaca cttagcaatt tgcaagttga
ttaattgatt ctaaattatt tttgtcttct 11040aaatacatat actaatcaac
tggaaatgta aatatttgct aatatttcta ctataggaga 11100attaaagtga
gtgaatatgg taccacaagg tttggagatt taattgttgc aatgctgcat
11160ggatggcata tacaccaaac attcaataat tcttgaggat aataatggta
ccacacaaga 11220tttgaggtgc atgaacgtca cgtggacaaa aggtttagta
atttttcaag acaacaatgt 11280taccacacac aagttttgag gtgcatgcat
ggatgccctg tggaaagttt aaaaatattt 11340tggaaatgat ttgcatggaa
gccatgtgta aaaccatgac atccacttgg aggatgcaat 11400aatgaagaaa
actacaaatt tacatgcaac tagttatgca tgtagtctat ataatgagga
11460ttttgcaata ctttcattca tacacactca ctaagtttta cacgattata
atttcttcat 11520agccagcaga tctgccggca tcgatcccgg gccatggcct
gctttaatga gatatgcgag 11580acgcctatga tcgcatgata tttgctttca
attctgttgt gcacgttgta aaaaacctga 11640gcatgtgtag ctcagatcct
taccgccggt ttcggttcat tctaatgaat atatcacccg 11700ttactatcgt
atttttatga ataatattct ccgttcaatt tactgattgt ccgtcgacga
11760gctcggcgcg cctctagagg atcgatgaat tcagatcggc tgagtggctc
cttcaacgtt 11820gcggttctgt cagttccaaa cgtaaaacgg cttgtcccgc
gtcatcggcg ggggtcataa 11880cgtgactccc ttaattctcc gctcatgatc
agattgtcgt ttcccgcctt cagtttaaac 11940tatcagtgtt tgacaggata
tattggcggg taaacctaag agaaaagagc gtttattaga 12000ataatcggat
atttaaaagg gcgtgaaaag gtttatcctt cgtccatttg tatgtgcatg
12060ccaaccacag ggttcccca 120793013002DNAArtificial sequenceplant
expression vector with two promoter-terminator expression cassettes
30gatctggcgc cggccagcga gacgagcaag attggccgcc gcccgaaacg atccgacagc
60gcgcccagca caggtgcgca ggcaaattgc accaacgcat acagcgccag cagaatgcca
120tagtgggcgg tgacgtcgtt cgagtgaacc agatcgcgca ggaggcccgg
cagcaccggc 180ataatcaggc cgatgccgac agcgtcgagc gcgacagtgc
tcagaattac gatcaggggt 240atgttgggtt tcacgtctgg cctccggacc
agcctccgct ggtccgattg aacgcgcgga 300ttctttatca ctgataagtt
ggtggacata ttatgtttat cagtgataaa gtgtcaagca 360tgacaaagtt
gcagccgaat acagtgatcc gtgccgccct ggacctgttg aacgaggtcg
420gcgtagacgg tctgacgaca cgcaaactgg cggaacggtt gggggttcag
cagccggcgc 480tttactggca cttcaggaac aagcgggcgc tgctcgacgc
actggccgaa gccatgctgg 540cggagaatca tacgcattcg gtgccgagag
ccgacgacga ctggcgctca tttctgatcg 600ggaatgcccg cagcttcagg
caggcgctgc tcgcctaccg cgatggcgcg cgcatccatg 660ccggcacgcg
accgggcgca ccgcagatgg aaacggccga cgcgcagctt cgcttcctct
720gcgaggcggg tttttcggcc ggggacgccg tcaatgcgct gatgacaatc
agctacttca 780ctgttggggc cgtgcttgag gagcaggccg gcgacagcga
tgccggcgag cgcggcggca 840ccgttgaaca ggctccgctc tcgccgctgt
tgcgggccgc gatagacgcc ttcgacgaag 900ccggtccgga cgcagcgttc
gagcagggac tcgcggtgat tgtcgatgga ttggcgaaaa 960ggaggctcgt
tgtcaggaac gttgaaggac cgagaaaggg tgacgattga tcaggaccgc
1020tgccggagcg caacccactc actacagcag agccatgtag acaacatccc
ctcccccttt 1080ccaccgcgtc agacgcccgt agcagcccgc tacgggcttt
ttcatgccct gccctagcgt 1140ccaagcctca cggccgcgct cggcctctct
ggcggccttc tggcgctctt ccgcttcctc 1200gctcactgac tcgctgcgct
cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 1260ggcggtaata
cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
1320aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
tccataggct 1380ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
cagaggtggc gaaacccgac 1440aggactataa agataccagg cgtttccccc
tggaagctcc ctcgtgcgct ctcctgttcc 1500gaccctgccg cttaccggat
acctgtccgc ctttctccct tcgggaagcg tggcgctttt 1560ccgctgcata
accctgcttc ggggtcatta tagcgatttt ttcggtatat ccatcctttt
1620tcgcacgata tacaggattt tgccaaaggg ttcgtgtaga ctttccttgg
tgtatccaac 1680ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc
gagcgggtgt tccttcttca 1740ctgtccctta ttcgcacctg gcggtgctca
acgggaatcc tgctctgcga ggctggccgg 1800ctaccgccgg cgtaacagat
gagggcaagc ggatggctga tgaaaccaag ccaaccagga 1860agggcagccc
acctatcaag gtgtactgcc ttccagacga acgaagagcg attgaggaaa
1920aggcggcggc ggccggcatg agcctgtcgg cctacctgct ggccgtcggc
cagggctaca 1980aaatcacggg cgtcgtggac tatgagcacg tccgcgagct
ggcccgcatc aatggcgacc 2040tgggccgcct gggcggcctg ctgaaactct
ggctcaccga cgacccgcgc acggcgcggt 2100tcggtgatgc cacgatcctc
gccctgctgg cgaagatcga agagaagcag gacgagcttg 2160gcaaggtcat
gatgggcgtg gtccgcccga gggcagagcc atgacttttt tagccgctaa
2220aacggccggg gggtgcgcgt gattgccaag cacgtcccca tgcgctccat
caagaagagc 2280gacttcgcgg agctggtgaa gtacatcacc gacgagcaag
gcaagaccga gcgcctttgc 2340gacgctcacc gggctggttg ccctcgccgc
tgggctggcg gccgtctatg gccctgcaaa 2400cgcgccagaa acgccgtcga
agccgtgtgc gagacaccgc ggccgccggc gttgtggata 2460cctcgcggaa
aacttggccc tcactgacag atgaggggcg gacgttgaca cttgaggggc
2520cgactcaccc ggcgcggcgt tgacagatga ggggcaggct cgatttcggc
cggcgacgtg 2580gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt
tacgcgagtt tcccacagat 2640gatgtggaca agcctgggga taagtgccct
gcggtattga cacttgaggg gcgcgactac 2700tgacagatga ggggcgcgat
ccttgacact tgaggggcag agtgctgaca gatgaggggc 2760gcacctattg
acatttgagg ggctgtccac aggcagaaaa tccagcattt gcaagggttt
2820ccgcccgttt ttcggccacc gctaacctgt cttttaacct gcttttaaac
caatatttat 2880aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga
ccgcgcacgc cgaagggggg 2940tgccccccct tctcgaaccc tcccggcccg
ctaacgcggg cctcccatcc ccccaggggc 3000tgcgcccctc ggccgcgaac
ggcctcaccc caaaaatggc agcgctggca gtccttgcca 3060ttgccgggat
cggggcagta acgggatggg cgatcagccc gagcgcgacg cccggaagca
3120ttgacgtgcc gcaggtgctg gcatcgacat tcagcgacca ggtgccgggc
agtgagggcg 3180gcggcctggg tggcggcctg cccttcactt cggccgtcgg
ggcattcacg gacttcatgg 3240cggggccggc aatttttacc ttgggcattc
ttggcatagt ggtcgcgggt gccgtgctcg 3300tgttcggggg tgcgataaac
ccagcgaacc atttgaggtg ataggtaaga ttataccgag 3360gtatgaaaac
gagaattgga cctttacaga attactctat gaagcgccat atttaaaaag
3420ctaccaagac gaagaggatg aagaggatga ggaggcagat tgccttgaat
atattgacaa 3480tactgataag ataatatatc ttttatatag aagatatcgc
cgtatgtaag gatttcaggg 3540ggcaaggcat aggcagcgcg cttatcaata
tatctataga atgggcaaag cataaaaact 3600tgcatggact aatgcttgaa
acccaggaca ataaccttat agcttgtaaa ttctatcata 3660attgggtaat
gactccaact tattgatagt gttttatgtt cagataatgc ccgatgactt
3720tgtcatgcag ctccaccgat tttgagaacg acagcgactt ccgtcccagc
cgtgccaggt 3780gctgcctcag attcaggtta tgccgctcaa ttcgctgcgt
atatcgcttg ctgattacgt 3840gcagctttcc cttcaggcgg gattcataca
gcggccagcc atccgtcatc catatcacca 3900cgtcaaaggg tgacagcagg
ctcataagac gccccagcgt cgccatagtg cgttcaccga 3960atacgtgcgc
aacaaccgtc ttccggagac tgtcatacgc gtaaaacagc cagcgctggc
4020gcgatttagc cccgacatag ccccactgtt cgtccatttc cgcgcagacg
atgacgtcac 4080tgcccggctg tatgcgcgag gttaccgact gcggcctgag
ttttttaagt gacgtaaaat 4140cgtgttgagg ccaacgccca taatgcgggc
tgttgcccgg catccaacgc cattcatggc 4200catatcaatg attttctggt
gcgtaccggg ttgagaagcg gtgtaagtga actgcagttg 4260ccatgtttta
cggcagtgag agcagagata gcgctgatgt ccggcggtgc ttttgccgtt
4320acgcaccacc ccgtcagtag ctgaacagga gggacagctg atagacacag
aagccactgg 4380agcacctcaa aaacaccatc atacactaaa tcagtaagtt
ggcagcatca cccataattg 4440tggtttcaaa atcggctccg tcgatactat
gttatacgcc aactttgaaa acaactttga 4500aaaagctgtt ttctggtatt
taaggtttta gaatgcaagg aacagtgaat tggagttcgt 4560cttgttataa
ttagcttctt ggggtatctt taaatactgt agaaaagagg aaggaaataa
4620taaatggcta aaatgagaat atcaccggaa ttgaaaaaac tgatcgaaaa
ataccgctgc 4680gtaaaagata cggaaggaat gtctcctgct aaggtatata
agctggtggg agaaaatgaa 4740aacctatatt taaaaatgac ggacagccgg
tataaaggga ccacctatga tgtggaacgg 4800gaaaaggaca tgatgctatg
gctggaagga aagctgcctg ttccaaaggt cctgcacttt 4860gaacggcatg
atggctggag caatctgctc atgagtgagg ccgatggcgt cctttgctcg
4920gaagagtatg aagatgaaca aagccctgaa aagattatcg agctgtatgc
ggagtgcatc 4980aggctctttc actccatcga catatcggat tgtccctata
cgaatagctt agacagccgc 5040ttagccgaat tggattactt actgaataac
gatctggccg atgtggattg cgaaaactgg 5100gaagaagaca ctccatttaa
agatccgcgc gagctgtatg attttttaaa gacggaaaag 5160cccgaagagg
aacttgtctt ttcccacggc gacctgggag acagcaacat ctttgtgaaa
5220gatggcaaag taagtggctt tattgatctt gggagaagcg gcagggcgga
caagtggtat 5280gacattgcct tctgcgtccg gtcgatcagg gaggatatcg
gggaagaaca gtatgtcgag 5340ctattttttg acttactggg gatcaagcct
gattgggaga aaataaaata ttatatttta 5400ctggatgaat tgttttagta
cctagatgtg gcgcaacgat gccggcgaca agcaggagcg 5460caccgacttc
ttccgcatca agtgttttgg ctctcaggcc gaggcccacg gcaagtattt
5520gggcaagggg tcgctggtat tcgtgcaggg caagattcgg aataccaagt
acgagaagga 5580cggccagacg gtctacggga ccgacttcat tgccgataag
gtggattatc tggacaccaa 5640ggcaccaggc gggtcaaatc aggaataagg
gcacattgcc ccggcgtgag tcggggcaat 5700cccgcaagga gggtgaatga
atcggacgtt tgaccggaag gcatacaggc aagaactgat 5760cgacgcgggg
ttttccgccg aggatgccga aaccatcgca agccgcaccg tcatgcgtgc
5820gccccgcgaa accttccagt ccgtcggctc gatggtccag caagctacgg
ccaagatcga 5880gcgcgacagc gtgcaactgg ctccccctgc cctgcccgcg
ccatcggccg ccgtggagcg 5940ttcgcgtcgt ctcgaacagg aggcggcagg
tttggcgaag tcgatgacca tcgacacgcg 6000aggaactatg acgaccaaga
agcgaaaaac cgccggcgag gacctggcaa aacaggtcag 6060cgaggccaag
caggccgcgt tgctgaaaca cacgaagcag cagatcaagg aaatgcagct
6120ttccttgttc gatattgcgc cgtggccgga cacgatgcga gcgatgccaa
acgacacggc 6180ccgctctgcc ctgttcacca cgcgcaacaa gaaaatcccg
cgcgaggcgc tgcaaaacaa 6240ggtcattttc cacgtcaaca aggacgtgaa
gatcacctac accggcgtcg agctgcgggc 6300cgacgatgac gaactggtgt
ggcagcaggt gttggagtac gcgaagcgca cccctatcgg 6360cgagccgatc
accttcacgt tctacgagct ttgccaggac ctgggctggt cgatcaatgg
6420ccggtattac acgaaggccg aggaatgcct gtcgcgccta caggcgacgg
cgatgggctt 6480cacgtccgac cgcgttgggc acctggaatc ggtgtcgctg
ctgcaccgct tccgcgtcct 6540ggaccgtggc aagaaaacgt cccgttgcca
ggtcctgatc gacgaggaaa tcgtcgtgct 6600gtttgctggc gaccactaca
cgaaattcat atgggagaag taccgcaagc tgtcgccgac 6660ggcccgacgg
atgttcgact atttcagctc gcaccgggag ccgtacccgc tcaagctgga
6720aaccttccgc ctcatgtgcg gatcggattc cacccgcgtg aagaagtggc
gcgagcaggt 6780cggcgaagcc tgcgaagagt tgcgaggcag cggcctggtg
gaacacgcct gggtcaatga 6840tgacctggtg cattgcaaac gctagggcct
tgtggggtca gttccggctg ggggttcagc 6900agccagcgct ttactggcat
ttcaggaaca agcgggcact gctcgacgca cttgcttcgc 6960tcagtatcgc
tcgggacgca cggcgcgctc tacgaactgc cgataaacag aggattaaaa
7020ttgacaattg tgattaaggc tcagattcga cggcttggag cggccgacgt
gcaggatttc 7080cgcgagatcc gattgtcggc cctgaagaaa gctccagaga
tgttcgggtc cgtttacgag 7140cacgaggaga aaaagcccat ggaggcgttc
gctgaacggt tgcgagatgc cgtggcattc 7200ggcgcctaca tcgacggcga
gatcattggg ctgtcggtct tcaaacagga ggacggcccc 7260aaggacgctc
acaaggcgca tctgtccggc gttttcgtgg agcccgaaca gcgaggccga
7320ggggtcgccg gtatgctgct gcgggcgttg ccggcgggtt tattgctcgt
gatgatcgtc 7380cgacagattc caacgggaat ctggtggatg cgcatcttca
tcctcggcgc acttaatatt 7440tcgctattct ggagcttgtt gtttatttcg
gtctaccgcc tgccgggcgg ggtcgcggcg 7500acggtaggcg ctgtgcagcc
gctgatggtc gtgttcatct ctgccgctct gctaggtagc 7560ccgatacgat
tgatggcggt cctgggggct atttgcggaa ctgcgggcgt ggcgctgttg
7620gtgttgacac caaacgcagc gctagatcct gtcggcgtcg cagcgggcct
ggcgggggcg 7680gtttccatgg cgttcggaac cgtgctgacc cgcaagtggc
aacctcccgt gcctctgctc 7740acctttaccg cctggcaact ggcggccgga
ggacttctgc tcgttccagt agctttagtg 7800tttgatccgc caatcccgat
gcctacagga accaatgttc tcggcctggc gtggctcggc 7860ctgatcggag
cgggtttaac ctacttcctt tggttccggg ggatctcgcg actcgaacct
7920acagttgttt ccttactggg ctttctcagc cccagatctg gggtcgatca
gccggggatg 7980catcaggccg acagtcggaa cttcgggtcc ccgacctgta
ccattcggtg agcaatggat 8040aggggagttg atatcgtcaa cgttcacttc
taaagaaata gcgccactca gcttcctcag 8100cggctttatc cagcgatttc
ctattatgtc ggcatagttc tcaagatcga cagcctgtca 8160cggttaagcg
agaaatgaat aagaaggctg ataattcgga tctctgcgag ggagatgata
8220tttgatcaca ggcagcaacg ctctgtcatc gttacaatca acatgctacc
ctccgcgaga 8280tcatccgtgt ttcaaacccg gcagcttagt tgccgttctt
ccgaatagca tcggtaacat 8340gagcaaagtc tgccgcctta caacggctct
cccgctgacg ccgtcccgga ctgatgggct 8400gcctgtatcg agtggtgatt
ttgtgccgag ctgccggtcg gggagctgtt ggctggctgg 8460tggcaggata
tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg
8520gacgttttta atgtactggg gtggtttttc ttttcaccag tgagacgggc
aacagctgat 8580tgcccttcac cgcctggccc tgagagagtt gcagcaagcg
gtccacgctg gtttgcccca 8640gcaggcgaaa atcctgtttg atggtggttc
cgaaatcggc aaaatccctt ataaatcaaa 8700agaatagccc gagatagggt
tgagtgttgt tccagtttgg aacaagagtc cactattaaa 8760gaacgtggac
tccaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg
8820tgaaccatca cccaaatcaa gttttttggg gtcgaggtgc cgtaaagcac
taaatcggaa 8880ccctaaaggg agcccccgat ttagagcttg acggggaaag
ccggcgaacg tggcgagaaa 8940ggaagggaag aaagcgaaag gagcgggcgc
cattcaggct gcgcaactgt tgggaagggc 9000gatcggtgcg ggcctcttcg
ctattacgcc agctggcgaa agggggatgt gctgcaaggc 9060gattaagttg
ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg
9120aattaattcc catcttgaaa gaaatatagt ttaaatattt attgataaaa
taacaagtca 9180ggtattatag tccaagcaaa aacataaatt tattgatgca
agtttaaatt cagaaatatt 9240tcaataactg attatatcag ctggtacatt
gccgtagatg aaagactgag tgcgatatta 9300tgtgtaatac ataaattgat
gatatagcta gcttagctca tcgggggatc cgtcgaagct 9360agcttgggtc
ccgctcagaa gaactcgtca agaaggcgat agaaggcgat gcgctgcgaa
9420tcgggagcgg cgataccgta aagcacgagg aagcggtcag cccattcgcc
gccaagctct 9480tcagcaatat cacgggtagc caacgctatg tcctgatagc
ggtccgccac acccagccgg 9540ccacagtcga tgaatccaga aaagcggcca
ttttccacca tgatattcgg caagcaggca 9600tcgccatggg tcacgacgag
atcctcgccg tcgggcatgc gcgccttgag cctggcgaac 9660agttcggctg
gcgcgagccc ctgatgctct tcgtccagat
catcctgatc gacaagaccg 9720gcttccatcc gagtacgtgc tcgctcgatg
cgatgtttcg cttggtggtc gaatgggcag 9780gtagccggat caagcgtatg
cagccgccgc attgcatcag ccatgatgga tactttctcg 9840gcaggagcaa
ggtgagatga caggagatcc tgccccggca cttcgcccaa tagcagccag
9900tcccttcccg cttcagtgac aacgtcgagc acagctgcgc aaggaacgcc
cgtcgtggcc 9960agccacgata gccgcgctgc ctcgtcctgc agttcattca
gggcaccgga caggtcggtc 10020ttgacaaaaa gaaccgggcg cccctgcgct
gacagccgga acacggcggc atcagagcag 10080ccgattgtct gttgtgccca
gtcatagccg aatagcctct ccacccaagc ggccggagaa 10140cctgcgtgca
atccatcttg ttcaatccaa gctcccatgg gccctcgact agagtcgaga
10200tctggattga gagtgaatat gagactctaa ttggataccg aggggaattt
atggaacgtc 10260agtggagcat ttttgacaag aaatatttgc tagctgatag
tgaccttagg cgacttttga 10320acgcgcaata atggtttctg acgtatgtgc
ttagctcatt aaactccaga aacccgcggc 10380tgagtggctc cttcaacgtt
gcggttctgt cagttccaaa cgtaaaacgg cttgtcccgc 10440gtcatcggcg
ggggtcataa cgtgactccc ttaattctcc gctcatgatc ttgatcccct
10500gcgccatcag atccttggcg gcaagaaagc catccagttt actttgcagg
gcttcccaac 10560cttaccagag ggcgccccag ctggcaattc cggttcgctt
gctgtccata aaaccgccca 10620gtctagctat cgccatgtaa gcccactgca
agctacctgc tttctctttg cgcttgcgtt 10680ttcccttgtc cagatagccc
agtagctgac attcatccgg ggtcagcacc gtttctgcgg 10740actggctttc
tacgtgttcc gcttccttta gcagcccttg cgccctgagt gcttgcggca
10800gcgtgaagct tgcatgcctg caggtcgacg gcgcgccgag ctcctcgagc
aaatttacac 10860attgccacta aacgtctaaa cccttgtaat ttgtttttgt
tttactatgt gtgttatgta 10920tttgatttgc gataaatttt tatatttggt
actaaattta taacaccttt tatgctaacg 10980tttgccaaca cttagcaatt
tgcaagttga ttaattgatt ctaaattatt tttgtcttct 11040aaatacatat
actaatcaac tggaaatgta aatatttgct aatatttcta ctataggaga
11100attaaagtga gtgaatatgg taccacaagg tttggagatt taattgttgc
aatgctgcat 11160ggatggcata tacaccaaac attcaataat tcttgaggat
aataatggta ccacacaaga 11220tttgaggtgc atgaacgtca cgtggacaaa
aggtttagta atttttcaag acaacaatgt 11280taccacacac aagttttgag
gtgcatgcat ggatgccctg tggaaagttt aaaaatattt 11340tggaaatgat
ttgcatggaa gccatgtgta aaaccatgac atccacttgg aggatgcaat
11400aatgaagaaa actacaaatt tacatgcaac tagttatgca tgtagtctat
ataatgagga 11460ttttgcaata ctttcattca tacacactca ctaagtttta
cacgattata atttcttcat 11520agccagccca ccgcggtggg cggccgcctg
cagtctagaa ggcctcctgc tttaatgaga 11580tatgcgagac gcctatgatc
gcatgatatt tgctttcaat tctgttgtgc acgttgtaaa 11640aaacctgagc
atgtgtagct cagatcctta ccgccggttt cggttcattc taatgaatat
11700atcacccgtt actatcgtat ttttatgaat aatattctcc gttcaattta
ctgattgtcc 11760gtcgagcaaa tttacacatt gccactaaac gtctaaaccc
ttgtaatttg tttttgtttt 11820actatgtgtg ttatgtattt gatttgcgat
aaatttttat atttggtact aaatttataa 11880caccttttat gctaacgttt
gccaacactt agcaatttgc aagttgatta attgattcta 11940aattattttt
gtcttctaaa tacatatact aatcaactgg aaatgtaaat atttgctaat
12000atttctacta taggagaatt aaagtgagtg aatatggtac cacaaggttt
ggagatttaa 12060ttgttgcaat gctgcatgga tggcatatac accaaacatt
caataattct tgaggataat 12120aatggtacca cacaagattt gaggtgcatg
aacgtcacgt ggacaaaagg tttagtaatt 12180tttcaagaca acaatgttac
cacacacaag ttttgaggtg catgcatgga tgccctgtgg 12240aaagtttaaa
aatattttgg aaatgatttg catggaagcc atgtgtaaaa ccatgacatc
12300cacttggagg atgcaataat gaagaaaact acaaatttac atgcaactag
ttatgcatgt 12360agtctatata atgaggattt tgcaatactt tcattcatac
acactcacta agttttacac 12420gattataatt tcttcatagc cagcggatcc
gatatcgggc ccgctagcgt taaccctgct 12480ttaatgagat atgcgagacg
cctatgatcg catgatattt gctttcaatt ctgttgtgca 12540cgttgtaaaa
aacctgagca tgtgtagctc agatccttac cgccggtttc ggttcattct
12600aatgaatata tcacccgtta ctatcgtatt tttatgaata atattctccg
ttcaatttac 12660tgattgtccg tcgacgaatt cgagctcggc gcgcctctag
aggatcgatg aattcagatc 12720ggctgagtgg ctccttcaac gttgcggttc
tgtcagttcc aaacgtaaaa cggcttgtcc 12780cgcgtcatcg gcgggggtca
taacgtgact cccttaattc tccgctcatg atcagattgt 12840cgtttcccgc
cttcagttta aactatcagt gtttgacagg atatattggc gggtaaacct
12900aagagaaaag agcgtttatt agaataatcg gatatttaaa agggcgtgaa
aaggtttatc 12960cttcgtccat ttgtatgtgc atgccaacca cagggttccc ca
130023113905DNAArtificial sequenceplant expression vector with
three promoter-terminator expression cassettes 31gatctggcgc
cggccagcga gacgagcaag attggccgcc gcccgaaacg atccgacagc 60gcgcccagca
caggtgcgca ggcaaattgc accaacgcat acagcgccag cagaatgcca
120tagtgggcgg tgacgtcgtt cgagtgaacc agatcgcgca ggaggcccgg
cagcaccggc 180ataatcaggc cgatgccgac agcgtcgagc gcgacagtgc
tcagaattac gatcaggggt 240atgttgggtt tcacgtctgg cctccggacc
agcctccgct ggtccgattg aacgcgcgga 300ttctttatca ctgataagtt
ggtggacata ttatgtttat cagtgataaa gtgtcaagca 360tgacaaagtt
gcagccgaat acagtgatcc gtgccgccct ggacctgttg aacgaggtcg
420gcgtagacgg tctgacgaca cgcaaactgg cggaacggtt gggggttcag
cagccggcgc 480tttactggca cttcaggaac aagcgggcgc tgctcgacgc
actggccgaa gccatgctgg 540cggagaatca tacgcattcg gtgccgagag
ccgacgacga ctggcgctca tttctgatcg 600ggaatgcccg cagcttcagg
caggcgctgc tcgcctaccg cgatggcgcg cgcatccatg 660ccggcacgcg
accgggcgca ccgcagatgg aaacggccga cgcgcagctt cgcttcctct
720gcgaggcggg tttttcggcc ggggacgccg tcaatgcgct gatgacaatc
agctacttca 780ctgttggggc cgtgcttgag gagcaggccg gcgacagcga
tgccggcgag cgcggcggca 840ccgttgaaca ggctccgctc tcgccgctgt
tgcgggccgc gatagacgcc ttcgacgaag 900ccggtccgga cgcagcgttc
gagcagggac tcgcggtgat tgtcgatgga ttggcgaaaa 960ggaggctcgt
tgtcaggaac gttgaaggac cgagaaaggg tgacgattga tcaggaccgc
1020tgccggagcg caacccactc actacagcag agccatgtag acaacatccc
ctcccccttt 1080ccaccgcgtc agacgcccgt agcagcccgc tacgggcttt
ttcatgccct gccctagcgt 1140ccaagcctca cggccgcgct cggcctctct
ggcggccttc tggcgctctt ccgcttcctc 1200gctcactgac tcgctgcgct
cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 1260ggcggtaata
cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
1320aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
tccataggct 1380ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
cagaggtggc gaaacccgac 1440aggactataa agataccagg cgtttccccc
tggaagctcc ctcgtgcgct ctcctgttcc 1500gaccctgccg cttaccggat
acctgtccgc ctttctccct tcgggaagcg tggcgctttt 1560ccgctgcata
accctgcttc ggggtcatta tagcgatttt ttcggtatat ccatcctttt
1620tcgcacgata tacaggattt tgccaaaggg ttcgtgtaga ctttccttgg
tgtatccaac 1680ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc
gagcgggtgt tccttcttca 1740ctgtccctta ttcgcacctg gcggtgctca
acgggaatcc tgctctgcga ggctggccgg 1800ctaccgccgg cgtaacagat
gagggcaagc ggatggctga tgaaaccaag ccaaccagga 1860agggcagccc
acctatcaag gtgtactgcc ttccagacga acgaagagcg attgaggaaa
1920aggcggcggc ggccggcatg agcctgtcgg cctacctgct ggccgtcggc
cagggctaca 1980aaatcacggg cgtcgtggac tatgagcacg tccgcgagct
ggcccgcatc aatggcgacc 2040tgggccgcct gggcggcctg ctgaaactct
ggctcaccga cgacccgcgc acggcgcggt 2100tcggtgatgc cacgatcctc
gccctgctgg cgaagatcga agagaagcag gacgagcttg 2160gcaaggtcat
gatgggcgtg gtccgcccga gggcagagcc atgacttttt tagccgctaa
2220aacggccggg gggtgcgcgt gattgccaag cacgtcccca tgcgctccat
caagaagagc 2280gacttcgcgg agctggtgaa gtacatcacc gacgagcaag
gcaagaccga gcgcctttgc 2340gacgctcacc gggctggttg ccctcgccgc
tgggctggcg gccgtctatg gccctgcaaa 2400cgcgccagaa acgccgtcga
agccgtgtgc gagacaccgc ggccgccggc gttgtggata 2460cctcgcggaa
aacttggccc tcactgacag atgaggggcg gacgttgaca cttgaggggc
2520cgactcaccc ggcgcggcgt tgacagatga ggggcaggct cgatttcggc
cggcgacgtg 2580gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt
tacgcgagtt tcccacagat 2640gatgtggaca agcctgggga taagtgccct
gcggtattga cacttgaggg gcgcgactac 2700tgacagatga ggggcgcgat
ccttgacact tgaggggcag agtgctgaca gatgaggggc 2760gcacctattg
acatttgagg ggctgtccac aggcagaaaa tccagcattt gcaagggttt
2820ccgcccgttt ttcggccacc gctaacctgt cttttaacct gcttttaaac
caatatttat 2880aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga
ccgcgcacgc cgaagggggg 2940tgccccccct tctcgaaccc tcccggcccg
ctaacgcggg cctcccatcc ccccaggggc 3000tgcgcccctc ggccgcgaac
ggcctcaccc caaaaatggc agcgctggca gtccttgcca 3060ttgccgggat
cggggcagta acgggatggg cgatcagccc gagcgcgacg cccggaagca
3120ttgacgtgcc gcaggtgctg gcatcgacat tcagcgacca ggtgccgggc
agtgagggcg 3180gcggcctggg tggcggcctg cccttcactt cggccgtcgg
ggcattcacg gacttcatgg 3240cggggccggc aatttttacc ttgggcattc
ttggcatagt ggtcgcgggt gccgtgctcg 3300tgttcggggg tgcgataaac
ccagcgaacc atttgaggtg ataggtaaga ttataccgag 3360gtatgaaaac
gagaattgga cctttacaga attactctat gaagcgccat atttaaaaag
3420ctaccaagac gaagaggatg aagaggatga ggaggcagat tgccttgaat
atattgacaa 3480tactgataag ataatatatc ttttatatag aagatatcgc
cgtatgtaag gatttcaggg 3540ggcaaggcat aggcagcgcg cttatcaata
tatctataga atgggcaaag cataaaaact 3600tgcatggact aatgcttgaa
acccaggaca ataaccttat agcttgtaaa ttctatcata 3660attgggtaat
gactccaact tattgatagt gttttatgtt cagataatgc ccgatgactt
3720tgtcatgcag ctccaccgat tttgagaacg acagcgactt ccgtcccagc
cgtgccaggt 3780gctgcctcag attcaggtta tgccgctcaa ttcgctgcgt
atatcgcttg ctgattacgt 3840gcagctttcc cttcaggcgg gattcataca
gcggccagcc atccgtcatc catatcacca 3900cgtcaaaggg tgacagcagg
ctcataagac gccccagcgt cgccatagtg cgttcaccga 3960atacgtgcgc
aacaaccgtc ttccggagac tgtcatacgc gtaaaacagc cagcgctggc
4020gcgatttagc cccgacatag ccccactgtt cgtccatttc cgcgcagacg
atgacgtcac 4080tgcccggctg tatgcgcgag gttaccgact gcggcctgag
ttttttaagt gacgtaaaat 4140cgtgttgagg ccaacgccca taatgcgggc
tgttgcccgg catccaacgc cattcatggc 4200catatcaatg attttctggt
gcgtaccggg ttgagaagcg gtgtaagtga actgcagttg 4260ccatgtttta
cggcagtgag agcagagata gcgctgatgt ccggcggtgc ttttgccgtt
4320acgcaccacc ccgtcagtag ctgaacagga gggacagctg atagacacag
aagccactgg 4380agcacctcaa aaacaccatc atacactaaa tcagtaagtt
ggcagcatca cccataattg 4440tggtttcaaa atcggctccg tcgatactat
gttatacgcc aactttgaaa acaactttga 4500aaaagctgtt ttctggtatt
taaggtttta gaatgcaagg aacagtgaat tggagttcgt 4560cttgttataa
ttagcttctt ggggtatctt taaatactgt agaaaagagg aaggaaataa
4620taaatggcta aaatgagaat atcaccggaa ttgaaaaaac tgatcgaaaa
ataccgctgc 4680gtaaaagata cggaaggaat gtctcctgct aaggtatata
agctggtggg agaaaatgaa 4740aacctatatt taaaaatgac ggacagccgg
tataaaggga ccacctatga tgtggaacgg 4800gaaaaggaca tgatgctatg
gctggaagga aagctgcctg ttccaaaggt cctgcacttt 4860gaacggcatg
atggctggag caatctgctc atgagtgagg ccgatggcgt cctttgctcg
4920gaagagtatg aagatgaaca aagccctgaa aagattatcg agctgtatgc
ggagtgcatc 4980aggctctttc actccatcga catatcggat tgtccctata
cgaatagctt agacagccgc 5040ttagccgaat tggattactt actgaataac
gatctggccg atgtggattg cgaaaactgg 5100gaagaagaca ctccatttaa
agatccgcgc gagctgtatg attttttaaa gacggaaaag 5160cccgaagagg
aacttgtctt ttcccacggc gacctgggag acagcaacat ctttgtgaaa
5220gatggcaaag taagtggctt tattgatctt gggagaagcg gcagggcgga
caagtggtat 5280gacattgcct tctgcgtccg gtcgatcagg gaggatatcg
gggaagaaca gtatgtcgag 5340ctattttttg acttactggg gatcaagcct
gattgggaga aaataaaata ttatatttta 5400ctggatgaat tgttttagta
cctagatgtg gcgcaacgat gccggcgaca agcaggagcg 5460caccgacttc
ttccgcatca agtgttttgg ctctcaggcc gaggcccacg gcaagtattt
5520gggcaagggg tcgctggtat tcgtgcaggg caagattcgg aataccaagt
acgagaagga 5580cggccagacg gtctacggga ccgacttcat tgccgataag
gtggattatc tggacaccaa 5640ggcaccaggc gggtcaaatc aggaataagg
gcacattgcc ccggcgtgag tcggggcaat 5700cccgcaagga gggtgaatga
atcggacgtt tgaccggaag gcatacaggc aagaactgat 5760cgacgcgggg
ttttccgccg aggatgccga aaccatcgca agccgcaccg tcatgcgtgc
5820gccccgcgaa accttccagt ccgtcggctc gatggtccag caagctacgg
ccaagatcga 5880gcgcgacagc gtgcaactgg ctccccctgc cctgcccgcg
ccatcggccg ccgtggagcg 5940ttcgcgtcgt ctcgaacagg aggcggcagg
tttggcgaag tcgatgacca tcgacacgcg 6000aggaactatg acgaccaaga
agcgaaaaac cgccggcgag gacctggcaa aacaggtcag 6060cgaggccaag
caggccgcgt tgctgaaaca cacgaagcag cagatcaagg aaatgcagct
6120ttccttgttc gatattgcgc cgtggccgga cacgatgcga gcgatgccaa
acgacacggc 6180ccgctctgcc ctgttcacca cgcgcaacaa gaaaatcccg
cgcgaggcgc tgcaaaacaa 6240ggtcattttc cacgtcaaca aggacgtgaa
gatcacctac accggcgtcg agctgcgggc 6300cgacgatgac gaactggtgt
ggcagcaggt gttggagtac gcgaagcgca cccctatcgg 6360cgagccgatc
accttcacgt tctacgagct ttgccaggac ctgggctggt cgatcaatgg
6420ccggtattac acgaaggccg aggaatgcct gtcgcgccta caggcgacgg
cgatgggctt 6480cacgtccgac cgcgttgggc acctggaatc ggtgtcgctg
ctgcaccgct tccgcgtcct 6540ggaccgtggc aagaaaacgt cccgttgcca
ggtcctgatc gacgaggaaa tcgtcgtgct 6600gtttgctggc gaccactaca
cgaaattcat atgggagaag taccgcaagc tgtcgccgac 6660ggcccgacgg
atgttcgact atttcagctc gcaccgggag ccgtacccgc tcaagctgga
6720aaccttccgc ctcatgtgcg gatcggattc cacccgcgtg aagaagtggc
gcgagcaggt 6780cggcgaagcc tgcgaagagt tgcgaggcag cggcctggtg
gaacacgcct gggtcaatga 6840tgacctggtg cattgcaaac gctagggcct
tgtggggtca gttccggctg ggggttcagc 6900agccagcgct ttactggcat
ttcaggaaca agcgggcact gctcgacgca cttgcttcgc 6960tcagtatcgc
tcgggacgca cggcgcgctc tacgaactgc cgataaacag aggattaaaa
7020ttgacaattg tgattaaggc tcagattcga cggcttggag cggccgacgt
gcaggatttc 7080cgcgagatcc gattgtcggc cctgaagaaa gctccagaga
tgttcgggtc cgtttacgag 7140cacgaggaga aaaagcccat ggaggcgttc
gctgaacggt tgcgagatgc cgtggcattc 7200ggcgcctaca tcgacggcga
gatcattggg ctgtcggtct tcaaacagga ggacggcccc 7260aaggacgctc
acaaggcgca tctgtccggc gttttcgtgg agcccgaaca gcgaggccga
7320ggggtcgccg gtatgctgct gcgggcgttg ccggcgggtt tattgctcgt
gatgatcgtc 7380cgacagattc caacgggaat ctggtggatg cgcatcttca
tcctcggcgc acttaatatt 7440tcgctattct ggagcttgtt gtttatttcg
gtctaccgcc tgccgggcgg ggtcgcggcg 7500acggtaggcg ctgtgcagcc
gctgatggtc gtgttcatct ctgccgctct gctaggtagc 7560ccgatacgat
tgatggcggt cctgggggct atttgcggaa ctgcgggcgt ggcgctgttg
7620gtgttgacac caaacgcagc gctagatcct gtcggcgtcg cagcgggcct
ggcgggggcg 7680gtttccatgg cgttcggaac cgtgctgacc cgcaagtggc
aacctcccgt gcctctgctc 7740acctttaccg cctggcaact ggcggccgga
ggacttctgc tcgttccagt agctttagtg 7800tttgatccgc caatcccgat
gcctacagga accaatgttc tcggcctggc gtggctcggc 7860ctgatcggag
cgggtttaac ctacttcctt tggttccggg ggatctcgcg actcgaacct
7920acagttgttt ccttactggg ctttctcagc cccagatctg gggtcgatca
gccggggatg 7980catcaggccg acagtcggaa cttcgggtcc ccgacctgta
ccattcggtg agcaatggat 8040aggggagttg atatcgtcaa cgttcacttc
taaagaaata gcgccactca gcttcctcag 8100cggctttatc cagcgatttc
ctattatgtc ggcatagttc tcaagatcga cagcctgtca 8160cggttaagcg
agaaatgaat aagaaggctg ataattcgga tctctgcgag ggagatgata
8220tttgatcaca ggcagcaacg ctctgtcatc gttacaatca acatgctacc
ctccgcgaga 8280tcatccgtgt ttcaaacccg gcagcttagt tgccgttctt
ccgaatagca tcggtaacat 8340gagcaaagtc tgccgcctta caacggctct
cccgctgacg ccgtcccgga ctgatgggct 8400gcctgtatcg agtggtgatt
ttgtgccgag ctgccggtcg gggagctgtt ggctggctgg 8460tggcaggata
tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg
8520gacgttttta atgtactggg gtggtttttc ttttcaccag tgagacgggc
aacagctgat 8580tgcccttcac cgcctggccc tgagagagtt gcagcaagcg
gtccacgctg gtttgcccca 8640gcaggcgaaa atcctgtttg atggtggttc
cgaaatcggc aaaatccctt ataaatcaaa 8700agaatagccc gagatagggt
tgagtgttgt tccagtttgg aacaagagtc cactattaaa 8760gaacgtggac
tccaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg
8820tgaaccatca cccaaatcaa gttttttggg gtcgaggtgc cgtaaagcac
taaatcggaa 8880ccctaaaggg agcccccgat ttagagcttg acggggaaag
ccggcgaacg tggcgagaaa 8940ggaagggaag aaagcgaaag gagcgggcgc
cattcaggct gcgcaactgt tgggaagggc 9000gatcggtgcg ggcctcttcg
ctattacgcc agctggcgaa agggggatgt gctgcaaggc 9060gattaagttg
ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg
9120aattaattcc catcttgaaa gaaatatagt ttaaatattt attgataaaa
taacaagtca 9180ggtattatag tccaagcaaa aacataaatt tattgatgca
agtttaaatt cagaaatatt 9240tcaataactg attatatcag ctggtacatt
gccgtagatg aaagactgag tgcgatatta 9300tgtgtaatac ataaattgat
gatatagcta gcttagctca tcgggggatc cgtcgaagct 9360agcttgggtc
ccgctcagaa gaactcgtca agaaggcgat agaaggcgat gcgctgcgaa
9420tcgggagcgg cgataccgta aagcacgagg aagcggtcag cccattcgcc
gccaagctct 9480tcagcaatat cacgggtagc caacgctatg tcctgatagc
ggtccgccac acccagccgg 9540ccacagtcga tgaatccaga aaagcggcca
ttttccacca tgatattcgg caagcaggca 9600tcgccatggg tcacgacgag
atcctcgccg tcgggcatgc gcgccttgag cctggcgaac 9660agttcggctg
gcgcgagccc ctgatgctct tcgtccagat catcctgatc gacaagaccg
9720gcttccatcc gagtacgtgc tcgctcgatg cgatgtttcg cttggtggtc
gaatgggcag 9780gtagccggat caagcgtatg cagccgccgc attgcatcag
ccatgatgga tactttctcg 9840gcaggagcaa ggtgagatga caggagatcc
tgccccggca cttcgcccaa tagcagccag 9900tcccttcccg cttcagtgac
aacgtcgagc acagctgcgc aaggaacgcc cgtcgtggcc 9960agccacgata
gccgcgctgc ctcgtcctgc agttcattca gggcaccgga caggtcggtc
10020ttgacaaaaa gaaccgggcg cccctgcgct gacagccgga acacggcggc
atcagagcag 10080ccgattgtct gttgtgccca gtcatagccg aatagcctct
ccacccaagc ggccggagaa 10140cctgcgtgca atccatcttg ttcaatccaa
gctcccatgg gccctcgact agagtcgaga 10200tctggattga gagtgaatat
gagactctaa ttggataccg aggggaattt atggaacgtc 10260agtggagcat
ttttgacaag aaatatttgc tagctgatag tgaccttagg cgacttttga
10320acgcgcaata atggtttctg acgtatgtgc ttagctcatt aaactccaga
aacccgcggc 10380tgagtggctc cttcaacgtt gcggttctgt cagttccaaa
cgtaaaacgg cttgtcccgc 10440gtcatcggcg ggggtcataa cgtgactccc
ttaattctcc gctcatgatc ttgatcccct 10500gcgccatcag atccttggcg
gcaagaaagc catccagttt actttgcagg gcttcccaac 10560cttaccagag
ggcgccccag ctggcaattc cggttcgctt gctgtccata aaaccgccca
10620gtctagctat cgccatgtaa gcccactgca agctacctgc tttctctttg
cgcttgcgtt 10680ttcccttgtc cagatagccc agtagctgac attcatccgg
ggtcagcacc gtttctgcgg 10740actggctttc tacgtgttcc gcttccttta
gcagcccttg cgccctgagt gcttgcggca 10800gcgtgaagct tgcatgcctg
caggtcgacg gcgcgccgag ctcctcgagc aaatttacac 10860attgccacta
aacgtctaaa cccttgtaat ttgtttttgt tttactatgt gtgttatgta
10920tttgatttgc gataaatttt tatatttggt actaaattta taacaccttt
tatgctaacg 10980tttgccaaca cttagcaatt tgcaagttga ttaattgatt
ctaaattatt tttgtcttct 11040aaatacatat actaatcaac tggaaatgta
aatatttgct aatatttcta ctataggaga 11100attaaagtga gtgaatatgg
taccacaagg tttggagatt taattgttgc aatgctgcat 11160ggatggcata
tacaccaaac attcaataat tcttgaggat aataatggta ccacacaaga
11220tttgaggtgc atgaacgtca cgtggacaaa aggtttagta atttttcaag
acaacaatgt 11280taccacacac aagttttgag gtgcatgcat ggatgccctg
tggaaagttt aaaaatattt 11340tggaaatgat ttgcatggaa gccatgtgta
aaaccatgac atccacttgg aggatgcaat 11400aatgaagaaa actacaaatt
tacatgcaac tagttatgca tgtagtctat ataatgagga 11460ttttgcaata
ctttcattca tacacactca ctaagtttta cacgattata atttcttcat
11520agccagccca ccgcggtggg cggccgcctg cagtctagaa ggcctcctgc
tttaatgaga 11580tatgcgagac gcctatgatc gcatgatatt tgctttcaat
tctgttgtgc acgttgtaaa
11640aaacctgagc atgtgtagct cagatcctta ccgccggttt cggttcattc
taatgaatat 11700atcacccgtt actatcgtat ttttatgaat aatattctcc
gttcaattta ctgattgtcc 11760gtcgagcaaa tttacacatt gccactaaac
gtctaaaccc ttgtaatttg tttttgtttt 11820actatgtgtg ttatgtattt
gatttgcgat aaatttttat atttggtact aaatttataa 11880caccttttat
gctaacgttt gccaacactt agcaatttgc aagttgatta attgattcta
11940aattattttt gtcttctaaa tacatatact aatcaactgg aaatgtaaat
atttgctaat 12000atttctacta taggagaatt aaagtgagtg aatatggtac
cacaaggttt ggagatttaa 12060ttgttgcaat gctgcatgga tggcatatac
accaaacatt caataattct tgaggataat 12120aatggtacca cacaagattt
gaggtgcatg aacgtcacgt ggacaaaagg tttagtaatt 12180tttcaagaca
acaatgttac cacacacaag ttttgaggtg catgcatgga tgccctgtgg
12240aaagtttaaa aatattttgg aaatgatttg catggaagcc atgtgtaaaa
ccatgacatc 12300cacttggagg atgcaataat gaagaaaact acaaatttac
atgcaactag ttatgcatgt 12360agtctatata atgaggattt tgcaatactt
tcattcatac acactcacta agttttacac 12420gattataatt tcttcatagc
cagcggatcc gatatcgggc ccgctagcgt taaccctgct 12480ttaatgagat
atgcgagacg cctatgatcg catgatattt gctttcaatt ctgttgtgca
12540cgttgtaaaa aacctgagca tgtgtagctc agatccttac cgccggtttc
ggttcattct 12600aatgaatata tcacccgtta ctatcgtatt tttatgaata
atattctccg ttcaatttac 12660tgattgtccg tcgagcaaat ttacacattg
ccactaaacg tctaaaccct tgtaatttgt 12720ttttgtttta ctatgtgtgt
tatgtatttg atttgcgata aatttttata tttggtacta 12780aatttataac
accttttatg ctaacgtttg ccaacactta gcaatttgca agttgattaa
12840ttgattctaa attatttttg tcttctaaat acatatacta atcaactgga
aatgtaaata 12900tttgctaata tttctactat aggagaatta aagtgagtga
atatggtacc acaaggtttg 12960gagatttaat tgttgcaatg ctgcatggat
ggcatataca ccaaacattc aataattctt 13020gaggataata atggtaccac
acaagatttg aggtgcatga acgtcacgtg gacaaaaggt 13080ttagtaattt
ttcaagacaa caatgttacc acacacaagt tttgaggtgc atgcatggat
13140gccctgtgga aagtttaaaa atattttgga aatgatttgc atggaagcca
tgtgtaaaac 13200catgacatcc acttggagga tgcaataatg aagaaaacta
caaatttaca tgcaactagt 13260tatgcatgta gtctatataa tgaggatttt
gcaatacttt cattcataca cactcactaa 13320gttttacacg attataattt
cttcatagcc agcagatctg ccggcatcga tcccgggcca 13380tggcctgctt
taatgagata tgcgagacgc ctatgatcgc atgatatttg ctttcaattc
13440tgttgtgcac gttgtaaaaa acctgagcat gtgtagctca gatccttacc
gccggtttcg 13500gttcattcta atgaatatat cacccgttac tatcgtattt
ttatgaataa tattctccgt 13560tcaatttact gattgtccgt cgacgagctc
ggcgcgcctc tagaggatcg atgaattcag 13620atcggctgag tggctccttc
aacgttgcgg ttctgtcagt tccaaacgta aaacggcttg 13680tcccgcgtca
tcggcggggg tcataacgtg actcccttaa ttctccgctc atgatcagat
13740tgtcgtttcc cgccttcagt ttaaactatc agtgtttgac aggatatatt
ggcgggtaaa 13800cctaagagaa aagagcgttt attagaataa tcggatattt
aaaagggcgt gaaaaggttt 13860atccttcgtc catttgtatg tgcatgccaa
ccacagggtt cccca 13905321443DNAPhaeodactylum
tricornutumCDS(9)..(1442)delta-6-desaturase 32gatctaaa atg ggc aaa
gga ggg gac gct cgg gcc tcg aag ggc tca acg 50 Met Gly Lys Gly Gly
Asp Ala Arg Ala Ser Lys Gly Ser Thr 1 5 10 gcg gct cgc aag atc agt
tgg cag gaa gtc aag acc cac gcg tct ccg 98Ala Ala Arg Lys Ile Ser
Trp Gln Glu Val Lys Thr His Ala Ser Pro 15 20 25 30 gag gac gcc tgg
atc att cac tcc aat aag gtc tac gac gtg tcc aac 146Glu Asp Ala Trp
Ile Ile His Ser Asn Lys Val Tyr Asp Val Ser Asn 35 40 45 tgg cac
gaa cat ccc gga ggc gcc gtc att ttc acg cac gcc ggt gac 194Trp His
Glu His Pro Gly Gly Ala Val Ile Phe Thr His Ala Gly Asp 50 55 60
gac atg acg gac att ttc gct gcc ttt cac gca ccc gga tcg cag tcg
242Asp Met Thr Asp Ile Phe Ala Ala Phe His Ala Pro Gly Ser Gln Ser
65 70 75 ctc atg aag aag ttc tac att ggc gaa ttg ctc ccg gaa acc
acc ggc 290Leu Met Lys Lys Phe Tyr Ile Gly Glu Leu Leu Pro Glu Thr
Thr Gly 80 85 90 aag gag ccg cag caa atc gcc ttt gaa aag ggc tac
cgc gat ctg cgc 338Lys Glu Pro Gln Gln Ile Ala Phe Glu Lys Gly Tyr
Arg Asp Leu Arg 95 100 105 110 tcc aaa ctc atc atg atg ggc atg ttc
aag tcc aac aag tgg ttc tac 386Ser Lys Leu Ile Met Met Gly Met Phe
Lys Ser Asn Lys Trp Phe Tyr 115 120 125 gtc tac aag tgc ctc agc aac
atg gcc att tgg gcc gcc gcc tgt gct 434Val Tyr Lys Cys Leu Ser Asn
Met Ala Ile Trp Ala Ala Ala Cys Ala 130 135 140 ctc gtc ttt tac tcg
gac cgc ttc tgg gta cac ctg gcc agc gcc gtc 482Leu Val Phe Tyr Ser
Asp Arg Phe Trp Val His Leu Ala Ser Ala Val 145 150 155 atg ctg gga
aca ttc ttt cag cag tcg gga tgg ttg gca cac gac ttt 530Met Leu Gly
Thr Phe Phe Gln Gln Ser Gly Trp Leu Ala His Asp Phe 160 165 170 ctg
cac cac cag gtc ttc acc aag cgc aag cac ggg gat ctc gga gga 578Leu
His His Gln Val Phe Thr Lys Arg Lys His Gly Asp Leu Gly Gly 175 180
185 190 ctc ttt tgg ggg aac ctc atg cag ggt tac tcc gta cag tgg tgg
aaa 626Leu Phe Trp Gly Asn Leu Met Gln Gly Tyr Ser Val Gln Trp Trp
Lys 195 200 205 aac aag cac aac gga cac cac gcc gtc ccc aac ctc cac
tgc tcc tcc 674Asn Lys His Asn Gly His His Ala Val Pro Asn Leu His
Cys Ser Ser 210 215 220 gca gtc gcg caa gat ggg gac ccg gac atc gat
acc atg ccc ctt ctc 722Ala Val Ala Gln Asp Gly Asp Pro Asp Ile Asp
Thr Met Pro Leu Leu 225 230 235 gcc tgg tcc gtc cag caa gcc cag tct
tac cgg gaa ctc caa gcc gac 770Ala Trp Ser Val Gln Gln Ala Gln Ser
Tyr Arg Glu Leu Gln Ala Asp 240 245 250 gga aag gat tcg ggt ttg gtc
aag ttc atg atc cgt aac caa tcc tac 818Gly Lys Asp Ser Gly Leu Val
Lys Phe Met Ile Arg Asn Gln Ser Tyr 255 260 265 270 ttt tac ttt ccc
atc ttg ttg ctc gcc cgc ctg tcg tgg ttg aac gag 866Phe Tyr Phe Pro
Ile Leu Leu Leu Ala Arg Leu Ser Trp Leu Asn Glu 275 280 285 tcc ttc
aag tgc gcc ttt ggg ctt gga gct gcg tcg gag aac gct gct 914Ser Phe
Lys Cys Ala Phe Gly Leu Gly Ala Ala Ser Glu Asn Ala Ala 290 295 300
ctc gaa ctc aag gcc aag ggt ctt cag tac ccc ctt ttg gaa aag gct
962Leu Glu Leu Lys Ala Lys Gly Leu Gln Tyr Pro Leu Leu Glu Lys Ala
305 310 315 ggc atc ctg ctg cac tac gct tgg atg ctt aca gtt tcg tcc
ggc ttt 1010Gly Ile Leu Leu His Tyr Ala Trp Met Leu Thr Val Ser Ser
Gly Phe 320 325 330 gga cgc ttc tcg ttc gcg tac acc gca ttt tac ttt
cta acc gcg acc 1058Gly Arg Phe Ser Phe Ala Tyr Thr Ala Phe Tyr Phe
Leu Thr Ala Thr 335 340 345 350 gcg tcc tgt gga ttc ttg ctc gcc att
gtc ttt ggc ctc ggc cac aac 1106Ala Ser Cys Gly Phe Leu Leu Ala Ile
Val Phe Gly Leu Gly His Asn 355 360 365 ggc atg gcc acc tac aat gcc
gac gcc cgt ccg gac ttc tgg aag ctc 1154Gly Met Ala Thr Tyr Asn Ala
Asp Ala Arg Pro Asp Phe Trp Lys Leu 370 375 380 caa gtc acc acg act
cgc aac gtc acg ggc gga cac ggt ttc ccc caa 1202Gln Val Thr Thr Thr
Arg Asn Val Thr Gly Gly His Gly Phe Pro Gln 385 390 395 gcc ttt gtc
gac tgg ttc tgt ggt ggc ctc cag tac caa gtc gac cac 1250Ala Phe Val
Asp Trp Phe Cys Gly Gly Leu Gln Tyr Gln Val Asp His 400 405 410 cac
tta ttc ccc agc ctg ccc cga cac aat ctg gcc aag aca cac gca 1298His
Leu Phe Pro Ser Leu Pro Arg His Asn Leu Ala Lys Thr His Ala 415 420
425 430 ctg gtc gaa tcg ttc tgc aag gag tgg ggt gtc cag tac cac gaa
gcc 1346Leu Val Glu Ser Phe Cys Lys Glu Trp Gly Val Gln Tyr His Glu
Ala 435 440 445 gac ctt gtg gac ggg acc atg gaa gtc ttg cac cat ttg
ggc agc gtg 1394Asp Leu Val Asp Gly Thr Met Glu Val Leu His His Leu
Gly Ser Val 450 455 460 gcc ggc gaa ttc gtc gtg gat ttt gta cgc gat
gga ccc gcc atg taa a 1443Ala Gly Glu Phe Val Val Asp Phe Val Arg
Asp Gly Pro Ala Met 465 470 475 33477PRTPhaeodactylum tricornutum
33Met Gly Lys Gly Gly Asp Ala Arg Ala Ser Lys Gly Ser Thr Ala Ala 1
5 10 15 Arg Lys Ile Ser Trp Gln Glu Val Lys Thr His Ala Ser Pro Glu
Asp 20 25 30 Ala Trp Ile Ile His Ser Asn Lys Val Tyr Asp Val Ser
Asn Trp His 35 40 45 Glu His Pro Gly Gly Ala Val Ile Phe Thr His
Ala Gly Asp Asp Met 50 55 60 Thr Asp Ile Phe Ala Ala Phe His Ala
Pro Gly Ser Gln Ser Leu Met 65 70 75 80 Lys Lys Phe Tyr Ile Gly Glu
Leu Leu Pro Glu Thr Thr Gly Lys Glu 85 90 95 Pro Gln Gln Ile Ala
Phe Glu Lys Gly Tyr Arg Asp Leu Arg Ser Lys 100 105 110 Leu Ile Met
Met Gly Met Phe Lys Ser Asn Lys Trp Phe Tyr Val Tyr 115 120 125 Lys
Cys Leu Ser Asn Met Ala Ile Trp Ala Ala Ala Cys Ala Leu Val 130 135
140 Phe Tyr Ser Asp Arg Phe Trp Val His Leu Ala Ser Ala Val Met Leu
145 150 155 160 Gly Thr Phe Phe Gln Gln Ser Gly Trp Leu Ala His Asp
Phe Leu His 165 170 175 His Gln Val Phe Thr Lys Arg Lys His Gly Asp
Leu Gly Gly Leu Phe 180 185 190 Trp Gly Asn Leu Met Gln Gly Tyr Ser
Val Gln Trp Trp Lys Asn Lys 195 200 205 His Asn Gly His His Ala Val
Pro Asn Leu His Cys Ser Ser Ala Val 210 215 220 Ala Gln Asp Gly Asp
Pro Asp Ile Asp Thr Met Pro Leu Leu Ala Trp 225 230 235 240 Ser Val
Gln Gln Ala Gln Ser Tyr Arg Glu Leu Gln Ala Asp Gly Lys 245 250 255
Asp Ser Gly Leu Val Lys Phe Met Ile Arg Asn Gln Ser Tyr Phe Tyr 260
265 270 Phe Pro Ile Leu Leu Leu Ala Arg Leu Ser Trp Leu Asn Glu Ser
Phe 275 280 285 Lys Cys Ala Phe Gly Leu Gly Ala Ala Ser Glu Asn Ala
Ala Leu Glu 290 295 300 Leu Lys Ala Lys Gly Leu Gln Tyr Pro Leu Leu
Glu Lys Ala Gly Ile 305 310 315 320 Leu Leu His Tyr Ala Trp Met Leu
Thr Val Ser Ser Gly Phe Gly Arg 325 330 335 Phe Ser Phe Ala Tyr Thr
Ala Phe Tyr Phe Leu Thr Ala Thr Ala Ser 340 345 350 Cys Gly Phe Leu
Leu Ala Ile Val Phe Gly Leu Gly His Asn Gly Met 355 360 365 Ala Thr
Tyr Asn Ala Asp Ala Arg Pro Asp Phe Trp Lys Leu Gln Val 370 375 380
Thr Thr Thr Arg Asn Val Thr Gly Gly His Gly Phe Pro Gln Ala Phe 385
390 395 400 Val Asp Trp Phe Cys Gly Gly Leu Gln Tyr Gln Val Asp His
His Leu 405 410 415 Phe Pro Ser Leu Pro Arg His Asn Leu Ala Lys Thr
His Ala Leu Val 420 425 430 Glu Ser Phe Cys Lys Glu Trp Gly Val Gln
Tyr His Glu Ala Asp Leu 435 440 445 Val Asp Gly Thr Met Glu Val Leu
His His Leu Gly Ser Val Ala Gly 450 455 460 Glu Phe Val Val Asp Phe
Val Arg Asp Gly Pro Ala Met 465 470 475 3417061DNAArtificial
sequenceConstruct comprising sequences encoding Physcomitrella
patens delta-6-elongase, Caenorhabditis elegans LPLAT, and
Phaeodactylum tricornutum delta-6-desaturase 34tggggaaccc
tgtggttggc atgcacatac aaatggacga aggataaacc ttttcacgcc 60cttttaaata
tccgattatt ctaataaacg ctcttttctc ttaggtttac ccgccaatat
120atcctgtcaa acactgatag tttaaactga aggcgggaaa cgacaatctg
atcatgagcg 180gagaattaag ggagtcacgt tatgaccccc gccgatgacg
cgggacaagc cgttttacgt 240ttggaactga cagaaccgca acgttgaagg
agccactcag ccgatctgaa ttcatcgatc 300ctctagaggc gcgccgagct
cctcgagcaa atttacacat tgccactaaa cgtctaaacc 360cttgtaattt
gtttttgttt tactatgtgt gttatgtatt tgatttgcga taaattttta
420tatttggtac taaatttata acacctttta tgctaacgtt tgccaacact
tagcaatttg 480caagttgatt aattgattct aaattatttt tgtcttctaa
atacatatac taatcaactg 540gaaatgtaaa tatttgctaa tatttctact
ataggagaat taaagtgagt gaatatggta 600ccacaaggtt tggagattta
attgttgcaa tgctgcatgg atggcatata caccaaacat 660tcaataattc
ttgaggataa taatggtacc acacaagatt tgaggtgcat gaacgtcacg
720tggacaaaag gtttagtaat ttttcaagac aacaatgtta ccacacacaa
gttttgaggt 780gcatgcatgg atgccctgtg gaaagtttaa aaatattttg
gaaatgattt gcatggaagc 840catgtgtaaa accatgacat ccacttggag
gatgcaataa tgaagaaaac tacaaattta 900catgcaacta gttatgcatg
tagtctatat aatgaggatt ttgcaatact ttcattcata 960cacactcact
aagttttaca cgattataat ttcttcatag ccagcccacc gcggtgggcg 1020gccgc
atg gag gtc gtg gag aga ttc tac ggt gag ttg gat ggg aag gtc 1070
Met Glu Val Val Glu Arg Phe Tyr Gly Glu Leu Asp Gly Lys Val 1 5 10
15 tcg cag ggc gtg aat gca ttg ctg ggt agt ttt ggg gtg gag ttg acg
1118Ser Gln Gly Val Asn Ala Leu Leu Gly Ser Phe Gly Val Glu Leu Thr
20 25 30 gat acg ccc act acc aaa ggc ttg ccc ctc gtt gac agt ccc
aca ccc 1166Asp Thr Pro Thr Thr Lys Gly Leu Pro Leu Val Asp Ser Pro
Thr Pro 35 40 45 atc gtc ctc ggt gtt tct gta tac ttg act att gtc
att gga ggg ctt 1214Ile Val Leu Gly Val Ser Val Tyr Leu Thr Ile Val
Ile Gly Gly Leu 50 55 60 ttg tgg ata aag gcc agg gat ctg aaa ccg
cgc gcc tcg gag cca ttt 1262Leu Trp Ile Lys Ala Arg Asp Leu Lys Pro
Arg Ala Ser Glu Pro Phe 65 70 75 ttg ctc caa gct ttg gtg ctt gtg
cac aac ctg ttc tgt ttt gcg ctc 1310Leu Leu Gln Ala Leu Val Leu Val
His Asn Leu Phe Cys Phe Ala Leu 80 85 90 95 agt ctg tat atg tgc gtg
ggc atc gct tat cag gct att acc tgg cgg 1358Ser Leu Tyr Met Cys Val
Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg 100 105 110 tac tct ctc tgg
ggc aat gca tac aat cct aaa cat aaa gag atg gcg 1406Tyr Ser Leu Trp
Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala 115 120 125 att ctg
gta tac ttg ttc tac atg tct aag tac gtg gaa ttc atg gat 1454Ile Leu
Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe Met Asp 130 135 140
acc gtt atc atg ata ctg aag cgc agc acc agg caa ata agc ttc ctc
1502Thr Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln Ile Ser Phe Leu
145 150 155 cac gtt tat cat cat tct tca att tcc ctc att tgg tgg gct
att gct 1550His Val Tyr His His Ser Ser Ile Ser Leu Ile Trp Trp Ala
Ile Ala 160 165 170 175 cat cac gct cct ggc ggt gaa gca tat tgg tct
gcg gct ctg aac tca 1598His His Ala Pro Gly Gly Glu Ala Tyr Trp Ser
Ala Ala Leu Asn Ser 180 185 190 gga gtg cat gtt ctc atg tat gcg tat
tac ttc ttg gct gcc tgc ctt 1646Gly Val His Val Leu Met Tyr Ala Tyr
Tyr Phe Leu Ala Ala Cys Leu 195 200 205 cga agt agc cca aag tta aaa
aat aag tac ctt ttt tgg ggc agg tac 1694Arg Ser Ser Pro Lys Leu Lys
Asn Lys Tyr Leu Phe Trp Gly Arg Tyr 210 215 220 ttg aca caa ttc caa
atg ttc cag ttt atg ctg aac tta gtg cag gct 1742Leu Thr Gln Phe Gln
Met Phe Gln Phe Met Leu Asn Leu Val Gln Ala 225 230 235 tac tac gac
atg aaa acg aat gcg cca tat cca caa tgg ctg atc aag 1790Tyr Tyr Asp
Met Lys Thr Asn Ala Pro Tyr Pro Gln Trp Leu Ile Lys 240 245 250 255
att ttg ttc tac tac atg atc tcg ttg ctg ttt ctt ttc ggc aat ttt
1838Ile Leu Phe Tyr Tyr Met Ile Ser Leu Leu Phe Leu Phe Gly Asn
Phe
260 265 270 tac gta caa aaa tac atc aaa ccc tct gac gga aag caa aag
gga gct 1886Tyr Val Gln Lys Tyr Ile Lys Pro Ser Asp Gly Lys Gln Lys
Gly Ala 275 280 285 aaa act gag tga tctagaaggc ctcctgcttt
aatgagatat gcgagacgcc 1938Lys Thr Glu 290 tatgatcgca tgatatttgc
tttcaattct gttgtgcacg ttgtaaaaaa cctgagcatg 1998tgtagctcag
atccttaccg ccggtttcgg ttcattctaa tgaatatatc acccgttact
2058atcgtatttt tatgaataat attctccgtt caatttactg attgtccgtc
gagcaaattt 2118acacattgcc actaaacgtc taaacccttg taatttgttt
ttgttttact atgtgtgtta 2178tgtatttgat ttgcgataaa tttttatatt
tggtactaaa tttataacac cttttatgct 2238aacgtttgcc aacacttagc
aatttgcaag ttgattaatt gattctaaat tatttttgtc 2298ttctaaatac
atatactaat caactggaaa tgtaaatatt tgctaatatt tctactatag
2358gagaattaaa gtgagtgaat atggtaccac aaggtttgga gatttaattg
ttgcaatgct 2418gcatggatgg catatacacc aaacattcaa taattcttga
ggataataat ggtaccacac 2478aagatttgag gtgcatgaac gtcacgtgga
caaaaggttt agtaattttt caagacaaca 2538atgttaccac acacaagttt
tgaggtgcat gcatggatgc cctgtggaaa gtttaaaaat 2598attttggaaa
tgatttgcat ggaagccatg tgtaaaacca tgacatccac ttggaggatg
2658caataatgaa gaaaactaca aatttacatg caactagtta tgcatgtagt
ctatataatg 2718aggattttgc aatactttca ttcatacaca ctcactaagt
tttacacgat tataatttct 2778tcatagccag cggatccgcc cacata atg gag aac
ttc tgg tct att gtt gtg 2831 Met Glu Asn Phe Trp Ser Ile Val Val
295 ttt ttt cta ctc tca att ctc ttc att tta tat aac ata tcg aca gta
2879Phe Phe Leu Leu Ser Ile Leu Phe Ile Leu Tyr Asn Ile Ser Thr Val
300 305 310 315 tgc cac tac tat atg cgg att tcg ttt tat tac ttc aca
att tta ttg 2927Cys His Tyr Tyr Met Arg Ile Ser Phe Tyr Tyr Phe Thr
Ile Leu Leu 320 325 330 cat gga atg gaa gtt tgt gtt aca atg atc cct
tct tgg cta aat ggg 2975His Gly Met Glu Val Cys Val Thr Met Ile Pro
Ser Trp Leu Asn Gly 335 340 345 aag ggt gct gat tac gtg ttt cac tcg
ttt ttc tat tgg tgt aaa tgg 3023Lys Gly Ala Asp Tyr Val Phe His Ser
Phe Phe Tyr Trp Cys Lys Trp 350 355 360 act ggt gtt cat aca aca gtc
tat gga tat gaa aaa aca caa gtt gaa 3071Thr Gly Val His Thr Thr Val
Tyr Gly Tyr Glu Lys Thr Gln Val Glu 365 370 375 ggt ccg gct gta gtt
att tgt aat cat cag agt tct ctc gac att cta 3119Gly Pro Ala Val Val
Ile Cys Asn His Gln Ser Ser Leu Asp Ile Leu 380 385 390 395 tcg atg
gca tca atc tgg ccg aag aat tgt gtt gta atg atg aaa cga 3167Ser Met
Ala Ser Ile Trp Pro Lys Asn Cys Val Val Met Met Lys Arg 400 405 410
att ctt gcc tat gtt cca ttc ttc aat ctc gga gcc tac ttt tcc aac
3215Ile Leu Ala Tyr Val Pro Phe Phe Asn Leu Gly Ala Tyr Phe Ser Asn
415 420 425 aca atc ttc atc gat cga tat aac cgt gaa cgt gcg atg gct
tca gtt 3263Thr Ile Phe Ile Asp Arg Tyr Asn Arg Glu Arg Ala Met Ala
Ser Val 430 435 440 gat tat tgt gca tct gaa atg aag aac aga aat ctt
aaa ctt tgg gta 3311Asp Tyr Cys Ala Ser Glu Met Lys Asn Arg Asn Leu
Lys Leu Trp Val 445 450 455 ttt ccg gaa gga aca aga aat cgt gaa gga
ggg ttc att cca ttc aag 3359Phe Pro Glu Gly Thr Arg Asn Arg Glu Gly
Gly Phe Ile Pro Phe Lys 460 465 470 475 aaa gga gca ttc aat att gca
gtt cgt gcg cag att ccc att att cca 3407Lys Gly Ala Phe Asn Ile Ala
Val Arg Ala Gln Ile Pro Ile Ile Pro 480 485 490 gtt gta ttc tca gac
tat cgg gat ttc tac tca aag cca ggc cga tat 3455Val Val Phe Ser Asp
Tyr Arg Asp Phe Tyr Ser Lys Pro Gly Arg Tyr 495 500 505 ttc aag aat
gat gga gaa gtt gtt att cga gtt ctg gat gcg att cca 3503Phe Lys Asn
Asp Gly Glu Val Val Ile Arg Val Leu Asp Ala Ile Pro 510 515 520 aca
aaa ggg ctc act ctt gat gac gtc agc gag ttg tct gat atg tgt 3551Thr
Lys Gly Leu Thr Leu Asp Asp Val Ser Glu Leu Ser Asp Met Cys 525 530
535 cgg gac gtt atg ttg gca gcc tat aag gaa gtt act cta gaa gct cag
3599Arg Asp Val Met Leu Ala Ala Tyr Lys Glu Val Thr Leu Glu Ala Gln
540 545 550 555 caa cga aat gcg aca cgg cgt gga gaa aca aaa gac ggg
aag aaa tct 3647Gln Arg Asn Ala Thr Arg Arg Gly Glu Thr Lys Asp Gly
Lys Lys Ser 560 565 570 gag taa gctagcgtta accctgcttt aatgagatat
gcgagacgcc tatgatcgca 3703Glu tgatatttgc tttcaattct gttgtgcacg
ttgtaaaaaa cctgagcatg tgtagctcag 3763atccttaccg ccggtttcgg
ttcattctaa tgaatatatc acccgttact atcgtatttt 3823tatgaataat
attctccgtt caatttactg attgtccgtc gagcaaattt acacattgcc
3883actaaacgtc taaacccttg taatttgttt ttgttttact atgtgtgtta
tgtatttgat 3943ttgcgataaa tttttatatt tggtactaaa tttataacac
cttttatgct aacgtttgcc 4003aacacttagc aatttgcaag ttgattaatt
gattctaaat tatttttgtc ttctaaatac 4063atatactaat caactggaaa
tgtaaatatt tgctaatatt tctactatag gagaattaaa 4123gtgagtgaat
atggtaccac aaggtttgga gatttaattg ttgcaatgct gcatggatgg
4183catatacacc aaacattcaa taattcttga ggataataat ggtaccacac
aagatttgag 4243gtgcatgaac gtcacgtgga caaaaggttt agtaattttt
caagacaaca atgttaccac 4303acacaagttt tgaggtgcat gcatggatgc
cctgtggaaa gtttaaaaat attttggaaa 4363tgatttgcat ggaagccatg
tgtaaaacca tgacatccac ttggaggatg caataatgaa 4423gaaaactaca
aatttacatg caactagtta tgcatgtagt ctatataatg aggattttgc
4483aatactttca ttcatacaca ctcactaagt tttacacgat tataatttct
tcatagccag 4543cagatctaaa atg ggc aaa gga ggg gac gct cgg gcc tcg
aag ggc tca 4592 Met Gly Lys Gly Gly Asp Ala Arg Ala Ser Lys Gly
Ser 575 580 585 acg gcg gct cgc aag atc agt tgg cag gaa gtc aag acc
cac gcg tct 4640Thr Ala Ala Arg Lys Ile Ser Trp Gln Glu Val Lys Thr
His Ala Ser 590 595 600 ccg gag gac gcc tgg atc att cac tcc aat aag
gtc tac gac gtg tcc 4688Pro Glu Asp Ala Trp Ile Ile His Ser Asn Lys
Val Tyr Asp Val Ser 605 610 615 aac tgg cac gaa cat ccc gga ggc gcc
gtc att ttc acg cac gcc ggt 4736Asn Trp His Glu His Pro Gly Gly Ala
Val Ile Phe Thr His Ala Gly 620 625 630 gac gac atg acg gac att ttc
gct gcc ttt cac gca ccc gga tcg cag 4784Asp Asp Met Thr Asp Ile Phe
Ala Ala Phe His Ala Pro Gly Ser Gln 635 640 645 tcg ctc atg aag aag
ttc tac att ggc gaa ttg ctc ccg gaa acc acc 4832Ser Leu Met Lys Lys
Phe Tyr Ile Gly Glu Leu Leu Pro Glu Thr Thr 650 655 660 665 ggc aag
gag ccg cag caa atc gcc ttt gaa aag ggc tac cgc gat ctg 4880Gly Lys
Glu Pro Gln Gln Ile Ala Phe Glu Lys Gly Tyr Arg Asp Leu 670 675 680
cgc tcc aaa ctc atc atg atg ggc atg ttc aag tcc aac aag tgg ttc
4928Arg Ser Lys Leu Ile Met Met Gly Met Phe Lys Ser Asn Lys Trp Phe
685 690 695 tac gtc tac aag tgc ctc agc aac atg gcc att tgg gcc gcc
gcc tgt 4976Tyr Val Tyr Lys Cys Leu Ser Asn Met Ala Ile Trp Ala Ala
Ala Cys 700 705 710 gct ctc gtc ttt tac tcg gac cgc ttc tgg gta cac
ctg gcc agc gcc 5024Ala Leu Val Phe Tyr Ser Asp Arg Phe Trp Val His
Leu Ala Ser Ala 715 720 725 gtc atg ctg gga aca ttc ttt cag cag tcg
gga tgg ttg gca cac gac 5072Val Met Leu Gly Thr Phe Phe Gln Gln Ser
Gly Trp Leu Ala His Asp 730 735 740 745 ttt ctg cac cac cag gtc ttc
acc aag cgc aag cac ggg gat ctc gga 5120Phe Leu His His Gln Val Phe
Thr Lys Arg Lys His Gly Asp Leu Gly 750 755 760 gga ctc ttt tgg ggg
aac ctc atg cag ggt tac tcc gta cag tgg tgg 5168Gly Leu Phe Trp Gly
Asn Leu Met Gln Gly Tyr Ser Val Gln Trp Trp 765 770 775 aaa aac aag
cac aac gga cac cac gcc gtc ccc aac ctc cac tgc tcc 5216Lys Asn Lys
His Asn Gly His His Ala Val Pro Asn Leu His Cys Ser 780 785 790 tcc
gca gtc gcg caa gat ggg gac ccg gac atc gat acc atg ccc ctt 5264Ser
Ala Val Ala Gln Asp Gly Asp Pro Asp Ile Asp Thr Met Pro Leu 795 800
805 ctc gcc tgg tcc gtc cag caa gcc cag tct tac cgg gaa ctc caa gcc
5312Leu Ala Trp Ser Val Gln Gln Ala Gln Ser Tyr Arg Glu Leu Gln Ala
810 815 820 825 gac gga aag gat tcg ggt ttg gtc aag ttc atg atc cgt
aac caa tcc 5360Asp Gly Lys Asp Ser Gly Leu Val Lys Phe Met Ile Arg
Asn Gln Ser 830 835 840 tac ttt tac ttt ccc atc ttg ttg ctc gcc cgc
ctg tcg tgg ttg aac 5408Tyr Phe Tyr Phe Pro Ile Leu Leu Leu Ala Arg
Leu Ser Trp Leu Asn 845 850 855 gag tcc ttc aag tgc gcc ttt ggg ctt
gga gct gcg tcg gag aac gct 5456Glu Ser Phe Lys Cys Ala Phe Gly Leu
Gly Ala Ala Ser Glu Asn Ala 860 865 870 gct ctc gaa ctc aag gcc aag
ggt ctt cag tac ccc ctt ttg gaa aag 5504Ala Leu Glu Leu Lys Ala Lys
Gly Leu Gln Tyr Pro Leu Leu Glu Lys 875 880 885 gct ggc atc ctg ctg
cac tac gct tgg atg ctt aca gtt tcg tcc ggc 5552Ala Gly Ile Leu Leu
His Tyr Ala Trp Met Leu Thr Val Ser Ser Gly 890 895 900 905 ttt gga
cgc ttc tcg ttc gcg tac acc gca ttt tac ttt cta acc gcg 5600Phe Gly
Arg Phe Ser Phe Ala Tyr Thr Ala Phe Tyr Phe Leu Thr Ala 910 915 920
acc gcg tcc tgt gga ttc ttg ctc gcc att gtc ttt ggc ctc ggc cac
5648Thr Ala Ser Cys Gly Phe Leu Leu Ala Ile Val Phe Gly Leu Gly His
925 930 935 aac ggc atg gcc acc tac aat gcc gac gcc cgt ccg gac ttc
tgg aag 5696Asn Gly Met Ala Thr Tyr Asn Ala Asp Ala Arg Pro Asp Phe
Trp Lys 940 945 950 ctc caa gtc acc acg act cgc aac gtc acg ggc gga
cac ggt ttc ccc 5744Leu Gln Val Thr Thr Thr Arg Asn Val Thr Gly Gly
His Gly Phe Pro 955 960 965 caa gcc ttt gtc gac tgg ttc tgt ggt ggc
ctc cag tac caa gtc gac 5792Gln Ala Phe Val Asp Trp Phe Cys Gly Gly
Leu Gln Tyr Gln Val Asp 970 975 980 985 cac cac tta ttc ccc agc ctg
ccc cga cac aat ctg gcc aag aca cac 5840His His Leu Phe Pro Ser Leu
Pro Arg His Asn Leu Ala Lys Thr His 990 995 1000 gca ctg gtc gaa
tcg ttc tgc aag gag tgg ggt gtc cag tac cac 5885Ala Leu Val Glu Ser
Phe Cys Lys Glu Trp Gly Val Gln Tyr His 1005 1010 1015 gaa gcc gac
ctt gtg gac ggg acc atg gaa gtc ttg cac cat ttg 5930Glu Ala Asp Leu
Val Asp Gly Thr Met Glu Val Leu His His Leu 1020 1025 1030 ggc agc
gtg gcc ggc gaa ttc gtc gtg gat ttt gta cgc gat gga 5975Gly Ser Val
Ala Gly Glu Phe Val Val Asp Phe Val Arg Asp Gly 1035 1040 1045 ccc
gcc atg taa agatctgccg gcatcgatcc cgggccatgg cctgctttaa 6027Pro Ala
Met tgagatatgc gagacgccta tgatcgcatg atatttgctt tcaattctgt
tgtgcacgtt 6087gtaaaaaacc tgagcatgtg tagctcagat ccttaccgcc
ggtttcggtt cattctaatg 6147aatatatcac ccgttactat cgtattttta
tgaataatat tctccgttca atttactgat 6207tgtccgtcga cgagctcggc
gcgccgtcga cctgcaggca tgcaagcttc acgctgccgc 6267aagcactcag
ggcgcaaggg ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag
6327aaacggtgct gaccccggat gaatgtcagc tactgggcta tctggacaag
ggaaaacgca 6387agcgcaaaga gaaagcaggt agcttgcagt gggcttacat
ggcgatagct agactgggcg 6447gttttatgga cagcaagcga accggaattg
ccagctgggg cgccctctgg taaggttggg 6507aagccctgca aagtaaactg
gatggctttc ttgccgccaa ggatctgatg gcgcagggga 6567tcaagatcat
gagcggagaa ttaagggagt cacgttatga cccccgccga tgacgcggga
6627caagccgttt tacgtttgga actgacagaa ccgcaacgtt gaaggagcca
ctcagccgcg 6687ggtttctgga gtttaatgag ctaagcacat acgtcagaaa
ccattattgc gcgttcaaaa 6747gtcgcctaag gtcactatca gctagcaaat
atttcttgtc aaaaatgctc cactgacgtt 6807ccataaattc ccctcggtat
ccaattagag tctcatattc actctcaatc cagatctcga 6867ctctagtcga
gggcccatgg gagcttggat tgaacaagat ggattgcacg caggttctcc
6927ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa
tcggctgctc 6987tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg
gttctttttg tcaagaccga 7047cctgtccggt gccctgaatg aactgcagga
cgaggcagcg cggctatcgt ggctggccac 7107gacgggcgtt ccttgcgcag
ctgtgctcga cgttgtcact gaagcgggaa gggactggct 7167gctattgggc
gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa
7227agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg
ctacctgccc 7287attcgaccac caagcgaaac atcgcatcga gcgagcacgt
actcggatgg aagccggtct 7347tgtcgatcag gatgatctgg acgaagagca
tcaggggctc gcgccagccg aactgttcgc 7407caggctcaag gcgcgcatgc
ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg 7467cttgccgaat
atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct
7527gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg
ctgaagagct 7587tggcggcgaa tgggctgacc gcttcctcgt gctttacggt
atcgccgctc ccgattcgca 7647gcgcatcgcc ttctatcgcc ttcttgacga
gttcttctga gcgggaccca agctagcttc 7707gacggatccc ccgatgagct
aagctagcta tatcatcaat ttatgtatta cacataatat 7767cgcactcagt
ctttcatcta cggcaatgta ccagctgata taatcagtta ttgaaatatt
7827tctgaattta aacttgcatc aataaattta tgtttttgct tggactataa
tacctgactt 7887gttattttat caataaatat ttaaactata tttctttcaa
gatgggaatt aattcactgg 7947ccgtcgtttt acaacgtcgt gactgggaaa
accctggcgt tacccaactt aatcgccttg 8007cagcacatcc ccctttcgcc
agctggcgta atagcgaaga ggcccgcacc gatcgccctt 8067cccaacagtt
gcgcagcctg aatggcgccc gctcctttcg ctttcttccc ttcctttctc
8127gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt
agggttccga 8187tttagtgctt tacggcacct cgaccccaaa aaacttgatt
tgggtgatgg ttcacgtagt 8247gggccatcgc cctgatagac ggtttttcgc
cctttgacgt tggagtccac gttctttaat 8307agtggactct tgttccaaac
tggaacaaca ctcaacccta tctcgggcta ttcttttgat 8367ttataaggga
ttttgccgat ttcggaacca ccatcaaaca ggattttcgc ctgctggggc
8427aaaccagcgt ggaccgcttg ctgcaactct ctcagggcca ggcggtgaag
ggcaatcagc 8487tgttgcccgt ctcactggtg aaaagaaaaa ccaccccagt
acattaaaaa cgtccgcaat 8547gtgttattaa gttgtctaag cgtcaatttg
tttacaccac aatatatcct gccaccagcc 8607agccaacagc tccccgaccg
gcagctcggc acaaaatcac cactcgatac aggcagccca 8667tcagtccggg
acggcgtcag cgggagagcc gttgtaaggc ggcagacttt gctcatgtta
8727ccgatgctat tcggaagaac ggcaactaag ctgccgggtt tgaaacacgg
atgatctcgc 8787ggagggtagc atgttgattg taacgatgac agagcgttgc
tgcctgtgat caaatatcat 8847ctccctcgca gagatccgaa ttatcagcct
tcttattcat ttctcgctta accgtgacag 8907gctgtcgatc ttgagaacta
tgccgacata ataggaaatc gctggataaa gccgctgagg 8967aagctgagtg
gcgctatttc tttagaagtg aacgttgacg atatcaactc ccctatccat
9027tgctcaccga atggtacagg tcggggaccc gaagttccga ctgtcggcct
gatgcatccc 9087cggctgatcg accccagatc tggggctgag aaagcccagt
aaggaaacaa ctgtaggttc 9147gagtcgcgag atcccccgga accaaaggaa
gtaggttaaa cccgctccga tcaggccgag 9207ccacgccagg ccgagaacat
tggttcctgt aggcatcggg attggcggat caaacactaa 9267agctactgga
acgagcagaa gtcctccggc cgccagttgc caggcggtaa aggtgagcag
9327aggcacggga ggttgccact tgcgggtcag cacggttccg aacgccatgg
aaaccgcccc 9387cgccaggccc gctgcgacgc cgacaggatc tagcgctgcg
tttggtgtca acaccaacag 9447cgccacgccc gcagttccgc aaatagcccc
caggaccgcc atcaatcgta tcgggctacc 9507tagcagagcg gcagagatga
acacgaccat cagcggctgc acagcgccta ccgtcgccgc 9567gaccccgccc
ggcaggcggt agaccgaaat aaacaacaag ctccagaata gcgaaatatt
9627aagtgcgccg aggatgaaga tgcgcatcca ccagattccc gttggaatct
gtcggacgat 9687catcacgagc aataaacccg ccggcaacgc ccgcagcagc
ataccggcga cccctcggcc 9747tcgctgttcg ggctccacga aaacgccgga
cagatgcgcc ttgtgagcgt ccttggggcc 9807gtcctcctgt ttgaagaccg
acagcccaat gatctcgccg tcgatgtagg cgccgaatgc 9867cacggcatct
cgcaaccgtt cagcgaacgc ctccatgggc tttttctcct cgtgctcgta
9927aacggacccg aacatctctg gagctttctt cagggccgac aatcggatct
cgcggaaatc 9987ctgcacgtcg gccgctccaa gccgtcgaat ctgagcctta
atcacaattg tcaattttaa 10047tcctctgttt atcggcagtt cgtagagcgc
gccgtgcgtc ccgagcgata ctgagcgaag 10107caagtgcgtc gagcagtgcc
cgcttgttcc tgaaatgcca gtaaagcgct ggctgctgaa 10167cccccagccg
gaactgaccc cacaaggccc tagcgtttgc aatgcaccag
gtcatcattg 10227acccaggcgt gttccaccag gccgctgcct cgcaactctt
cgcaggcttc gccgacctgc 10287tcgcgccact tcttcacgcg ggtggaatcc
gatccgcaca tgaggcggaa ggtttccagc 10347ttgagcgggt acggctcccg
gtgcgagctg aaatagtcga acatccgtcg ggccgtcggc 10407gacagcttgc
ggtacttctc ccatatgaat ttcgtgtagt ggtcgccagc aaacagcacg
10467acgatttcct cgtcgatcag gacctggcaa cgggacgttt tcttgccacg
gtccaggacg 10527cggaagcggt gcagcagcga caccgattcc aggtgcccaa
cgcggtcgga cgtgaagccc 10587atcgccgtcg cctgtaggcg cgacaggcat
tcctcggcct tcgtgtaata ccggccattg 10647atcgaccagc ccaggtcctg
gcaaagctcg tagaacgtga aggtgatcgg ctcgccgata 10707ggggtgcgct
tcgcgtactc caacacctgc tgccacacca gttcgtcatc gtcggcccgc
10767agctcgacgc cggtgtaggt gatcttcacg tccttgttga cgtggaaaat
gaccttgttt 10827tgcagcgcct cgcgcgggat tttcttgttg cgcgtggtga
acagggcaga gcgggccgtg 10887tcgtttggca tcgctcgcat cgtgtccggc
cacggcgcaa tatcgaacaa ggaaagctgc 10947atttccttga tctgctgctt
cgtgtgtttc agcaacgcgg cctgcttggc ctcgctgacc 11007tgttttgcca
ggtcctcgcc ggcggttttt cgcttcttgg tcgtcatagt tcctcgcgtg
11067tcgatggtca tcgacttcgc caaacctgcc gcctcctgtt cgagacgacg
cgaacgctcc 11127acggcggccg atggcgcggg cagggcaggg ggagccagtt
gcacgctgtc gcgctcgatc 11187ttggccgtag cttgctggac catcgagccg
acggactgga aggtttcgcg gggcgcacgc 11247atgacggtgc ggcttgcgat
ggtttcggca tcctcggcgg aaaaccccgc gtcgatcagt 11307tcttgcctgt
atgccttccg gtcaaacgtc cgattcattc accctccttg cgggattgcc
11367ccgactcacg ccggggcaat gtgcccttat tcctgatttg acccgcctgg
tgccttggtg 11427tccagataat ccaccttatc ggcaatgaag tcggtcccgt
agaccgtctg gccgtccttc 11487tcgtacttgg tattccgaat cttgccctgc
acgaatacca gcgacccctt gcccaaatac 11547ttgccgtggg cctcggcctg
agagccaaaa cacttgatgc ggaagaagtc ggtgcgctcc 11607tgcttgtcgc
cggcatcgtt gcgccacatc taggtactaa aacaattcat ccagtaaaat
11667ataatatttt attttctccc aatcaggctt gatccccagt aagtcaaaaa
atagctcgac 11727atactgttct tccccgatat cctccctgat cgaccggacg
cagaaggcaa tgtcatacca 11787cttgtccgcc ctgccgcttc tcccaagatc
aataaagcca cttactttgc catctttcac 11847aaagatgttg ctgtctccca
ggtcgccgtg ggaaaagaca agttcctctt cgggcttttc 11907cgtctttaaa
aaatcataca gctcgcgcgg atctttaaat ggagtgtctt cttcccagtt
11967ttcgcaatcc acatcggcca gatcgttatt cagtaagtaa tccaattcgg
ctaagcggct 12027gtctaagcta ttcgtatagg gacaatccga tatgtcgatg
gagtgaaaga gcctgatgca 12087ctccgcatac agctcgataa tcttttcagg
gctttgttca tcttcatact cttccgagca 12147aaggacgcca tcggcctcac
tcatgagcag attgctccag ccatcatgcc gttcaaagtg 12207caggaccttt
ggaacaggca gctttccttc cagccatagc atcatgtcct tttcccgttc
12267cacatcatag gtggtccctt tataccggct gtccgtcatt tttaaatata
ggttttcatt 12327ttctcccacc agcttatata ccttagcagg agacattcct
tccgtatctt ttacgcagcg 12387gtatttttcg atcagttttt tcaattccgg
tgatattctc attttagcca tttattattt 12447ccttcctctt ttctacagta
tttaaagata ccccaagaag ctaattataa caagacgaac 12507tccaattcac
tgttccttgc attctaaaac cttaaatacc agaaaacagc tttttcaaag
12567ttgttttcaa agttggcgta taacatagta tcgacggagc cgattttgaa
accacaatta 12627tgggtgatgc tgccaactta ctgatttagt gtatgatggt
gtttttgagg tgctccagtg 12687gcttctgtgt ctatcagctg tccctcctgt
tcagctactg acggggtggt gcgtaacggc 12747aaaagcaccg ccggacatca
gcgctatctc tgctctcact gccgtaaaac atggcaactg 12807cagttcactt
acaccgcttc tcaacccggt acgcaccaga aaatcattga tatggccatg
12867aatggcgttg gatgccgggc aacagcccgc attatgggcg ttggcctcaa
cacgatttta 12927cgtcacttaa aaaactcagg ccgcagtcgg taacctcgcg
catacagccg ggcagtgacg 12987tcatcgtctg cgcggaaatg gacgaacagt
ggggctatgt cggggctaaa tcgcgccagc 13047gctggctgtt ttacgcgtat
gacagtctcc ggaagacggt tgttgcgcac gtattcggtg 13107aacgcactat
ggcgacgctg gggcgtctta tgagcctgct gtcacccttt gacgtggtga
13167tatggatgac ggatggctgg ccgctgtatg aatcccgcct gaagggaaag
ctgcacgtaa 13227tcagcaagcg atatacgcag cgaattgagc ggcataacct
gaatctgagg cagcacctgg 13287cacggctggg acggaagtcg ctgtcgttct
caaaatcggt ggagctgcat gacaaagtca 13347tcgggcatta tctgaacata
aaacactatc aataagttgg agtcattacc caattatgat 13407agaatttaca
agctataagg ttattgtcct gggtttcaag cattagtcca tgcaagtttt
13467tatgctttgc ccattctata gatatattga taagcgcgct gcctatgcct
tgccccctga 13527aatccttaca tacggcgata tcttctatat aaaagatata
ttatcttatc agtattgtca 13587atatattcaa ggcaatctgc ctcctcatcc
tcttcatcct cttcgtcttg gtagcttttt 13647aaatatggcg cttcatagag
taattctgta aaggtccaat tctcgttttc atacctcggt 13707ataatcttac
ctatcacctc aaatggttcg ctgggtttat cgcacccccg aacacgagca
13767cggcacccgc gaccactatg ccaagaatgc ccaaggtaaa aattgccggc
cccgccatga 13827agtccgtgaa tgccccgacg gccgaagtga agggcaggcc
gccacccagg ccgccgccct 13887cactgcccgg cacctggtcg ctgaatgtcg
atgccagcac ctgcggcacg tcaatgcttc 13947cgggcgtcgc gctcgggctg
atcgcccatc ccgttactgc cccgatcccg gcaatggcaa 14007ggactgccag
cgctgccatt tttggggtga ggccgttcgc ggccgagggg cgcagcccct
14067ggggggatgg gaggcccgcg ttagcgggcc gggagggttc gagaaggggg
ggcacccccc 14127ttcggcgtgc gcggtcacgc gcacagggcg cagccctggt
taaaaacaag gtttataaat 14187attggtttaa aagcaggtta aaagacaggt
tagcggtggc cgaaaaacgg gcggaaaccc 14247ttgcaaatgc tggattttct
gcctgtggac agcccctcaa atgtcaatag gtgcgcccct 14307catctgtcag
cactctgccc ctcaagtgtc aaggatcgcg cccctcatct gtcagtagtc
14367gcgcccctca agtgtcaata ccgcagggca cttatcccca ggcttgtcca
catcatctgt 14427gggaaactcg cgtaaaatca ggcgttttcg ccgatttgcg
aggctggcca gctccacgtc 14487gccggccgaa atcgagcctg cccctcatct
gtcaacgccg cgccgggtga gtcggcccct 14547caagtgtcaa cgtccgcccc
tcatctgtca gtgagggcca agttttccgc gaggtatcca 14607caacgccggc
ggccgcggtg tctcgcacac ggcttcgacg gcgtttctgg cgcgtttgca
14667gggccataga cggccgccag cccagcggcg agggcaacca gcccggtgag
cgtcgcaaag 14727gcgctcggtc ttgccttgct cgtcggtgat gtacttcacc
agctccgcga agtcgctctt 14787cttgatggag cgcatgggga cgtgcttggc
aatcacgcgc accccccggc cgttttagcg 14847gctaaaaaag tcatggctct
gccctcgggc ggaccacgcc catcatgacc ttgccaagct 14907cgtcctgctt
ctcttcgatc ttcgccagca gggcgaggat cgtggcatca ccgaaccgcg
14967ccgtgcgcgg gtcgtcggtg agccagagtt tcagcaggcc gcccaggcgg
cccaggtcgc 15027cattgatgcg ggccagctcg cggacgtgct catagtccac
gacgcccgtg attttgtagc 15087cctggccgac ggccagcagg taggccgaca
ggctcatgcc ggccgccgcc gccttttcct 15147caatcgctct tcgttcgtct
ggaaggcagt acaccttgat aggtgggctg cccttcctgg 15207ttggcttggt
ttcatcagcc atccgcttgc cctcatctgt tacgccggcg gtagccggcc
15267agcctcgcag agcaggattc ccgttgagca ccgccaggtg cgaataaggg
acagtgaaga 15327aggaacaccc gctcgcgggt gggcctactt cacctatcct
gcccggctga cgccgttgga 15387tacaccaagg aaagtctaca cgaacccttt
ggcaaaatcc tgtatatcgt gcgaaaaagg 15447atggatatac cgaaaaaatc
gctataatga ccccgaagca gggttatgca gcggaaaagc 15507gccacgcttc
ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca
15567ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag
tcctgtcggg 15627tttcgccacc tctgacttga gcgtcgattt ttgtgatgct
cgtcaggggg gcggagccta 15687tggaaaaacg ccagcaacgc ggccttttta
cggttcctgg ccttttgctg gccttttgct 15747cacatgttct ttcctgcgtt
atcccctgat tctgtggata accgtattac cgcctttgag 15807tgagctgata
ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa
15867gcggaagagc gccagaaggc cgccagagag gccgagcgcg gccgtgaggc
ttggacgcta 15927gggcagggca tgaaaaagcc cgtagcgggc tgctacgggc
gtctgacgcg gtggaaaggg 15987ggaggggatg ttgtctacat ggctctgctg
tagtgagtgg gttgcgctcc ggcagcggtc 16047ctgatcaatc gtcacccttt
ctcggtcctt caacgttcct gacaacgagc ctccttttcg 16107ccaatccatc
gacaatcacc gcgagtccct gctcgaacgc tgcgtccgga ccggcttcgt
16167cgaaggcgtc tatcgcggcc cgcaacagcg gcgagagcgg agcctgttca
acggtgccgc 16227cgcgctcgcc ggcatcgctg tcgccggcct gctcctcaag
cacggcccca acagtgaagt 16287agctgattgt catcagcgca ttgacggcgt
ccccggccga aaaacccgcc tcgcagagga 16347agcgaagctg cgcgtcggcc
gtttccatct gcggtgcgcc cggtcgcgtg ccggcatgga 16407tgcgcgcgcc
atcgcggtag gcgagcagcg cctgcctgaa gctgcgggca ttcccgatca
16467gaaatgagcg ccagtcgtcg tcggctctcg gcaccgaatg cgtatgattc
tccgccagca 16527tggcttcggc cagtgcgtcg agcagcgccc gcttgttcct
gaagtgccag taaagcgccg 16587gctgctgaac ccccaaccgt tccgccagtt
tgcgtgtcgt cagaccgtct acgccgacct 16647cgttcaacag gtccagggcg
gcacggatca ctgtattcgg ctgcaacttt gtcatgcttg 16707acactttatc
actgataaac ataatatgtc caccaactta tcagtgataa agaatccgcg
16767cgttcaatcg gaccagcgga ggctggtccg gaggccagac gtgaaaccca
acatacccct 16827gatcgtaatt ctgagcactg tcgcgctcga cgctgtcggc
atcggcctga ttatgccggt 16887gctgccgggc ctcctgcgcg atctggttca
ctcgaacgac gtcaccgccc actatggcat 16947tctgctggcg ctgtatgcgt
tggtgcaatt tgcctgcgca cctgtgctgg gcgcgctgtc 17007ggatcgtttc
gggcggcggc caatcttgct cgtctcgctg gccggcgcca gatc
1706135290PRTArtificial sequencePhyscomitrella patens
delta-6-elongase 35Met Glu Val Val Glu Arg Phe Tyr Gly Glu Leu Asp
Gly Lys Val Ser 1 5 10 15 Gln Gly Val Asn Ala Leu Leu Gly Ser Phe
Gly Val Glu Leu Thr Asp 20 25 30 Thr Pro Thr Thr Lys Gly Leu Pro
Leu Val Asp Ser Pro Thr Pro Ile 35 40 45 Val Leu Gly Val Ser Val
Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50 55 60 Trp Ile Lys Ala
Arg Asp Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu 65 70 75 80 Leu Gln
Ala Leu Val Leu Val His Asn Leu Phe Cys Phe Ala Leu Ser 85 90 95
Leu Tyr Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg Tyr 100
105 110 Ser Leu Trp Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala
Ile 115 120 125 Leu Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe
Met Asp Thr 130 135 140 Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln
Ile Ser Phe Leu His 145 150 155 160 Val Tyr His His Ser Ser Ile Ser
Leu Ile Trp Trp Ala Ile Ala His 165 170 175 His Ala Pro Gly Gly Glu
Ala Tyr Trp Ser Ala Ala Leu Asn Ser Gly 180 185 190 Val His Val Leu
Met Tyr Ala Tyr Tyr Phe Leu Ala Ala Cys Leu Arg 195 200 205 Ser Ser
Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp Gly Arg Tyr Leu 210 215 220
Thr Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu Val Gln Ala Tyr 225
230 235 240 Tyr Asp Met Lys Thr Asn Ala Pro Tyr Pro Gln Trp Leu Ile
Lys Ile 245 250 255 Leu Phe Tyr Tyr Met Ile Ser Leu Leu Phe Leu Phe
Gly Asn Phe Tyr 260 265 270 Val Gln Lys Tyr Ile Lys Pro Ser Asp Gly
Lys Gln Lys Gly Ala Lys 275 280 285 Thr Glu 290 36282PRTArtificial
sequenceCaenorhabditis elegans LPLAT 36Met Glu Asn Phe Trp Ser Ile
Val Val Phe Phe Leu Leu Ser Ile Leu 1 5 10 15 Phe Ile Leu Tyr Asn
Ile Ser Thr Val Cys His Tyr Tyr Met Arg Ile 20 25 30 Ser Phe Tyr
Tyr Phe Thr Ile Leu Leu His Gly Met Glu Val Cys Val 35 40 45 Thr
Met Ile Pro Ser Trp Leu Asn Gly Lys Gly Ala Asp Tyr Val Phe 50 55
60 His Ser Phe Phe Tyr Trp Cys Lys Trp Thr Gly Val His Thr Thr Val
65 70 75 80 Tyr Gly Tyr Glu Lys Thr Gln Val Glu Gly Pro Ala Val Val
Ile Cys 85 90 95 Asn His Gln Ser Ser Leu Asp Ile Leu Ser Met Ala
Ser Ile Trp Pro 100 105 110 Lys Asn Cys Val Val Met Met Lys Arg Ile
Leu Ala Tyr Val Pro Phe 115 120 125 Phe Asn Leu Gly Ala Tyr Phe Ser
Asn Thr Ile Phe Ile Asp Arg Tyr 130 135 140 Asn Arg Glu Arg Ala Met
Ala Ser Val Asp Tyr Cys Ala Ser Glu Met 145 150 155 160 Lys Asn Arg
Asn Leu Lys Leu Trp Val Phe Pro Glu Gly Thr Arg Asn 165 170 175 Arg
Glu Gly Gly Phe Ile Pro Phe Lys Lys Gly Ala Phe Asn Ile Ala 180 185
190 Val Arg Ala Gln Ile Pro Ile Ile Pro Val Val Phe Ser Asp Tyr Arg
195 200 205 Asp Phe Tyr Ser Lys Pro Gly Arg Tyr Phe Lys Asn Asp Gly
Glu Val 210 215 220 Val Ile Arg Val Leu Asp Ala Ile Pro Thr Lys Gly
Leu Thr Leu Asp 225 230 235 240 Asp Val Ser Glu Leu Ser Asp Met Cys
Arg Asp Val Met Leu Ala Ala 245 250 255 Tyr Lys Glu Val Thr Leu Glu
Ala Gln Gln Arg Asn Ala Thr Arg Arg 260 265 270 Gly Glu Thr Lys Asp
Gly Lys Lys Ser Glu 275 280 37477PRTArtificial
sequencePhaeodactylum tricornutum delta-6-desaturase 37Met Gly Lys
Gly Gly Asp Ala Arg Ala Ser Lys Gly Ser Thr Ala Ala 1 5 10 15 Arg
Lys Ile Ser Trp Gln Glu Val Lys Thr His Ala Ser Pro Glu Asp 20 25
30 Ala Trp Ile Ile His Ser Asn Lys Val Tyr Asp Val Ser Asn Trp His
35 40 45 Glu His Pro Gly Gly Ala Val Ile Phe Thr His Ala Gly Asp
Asp Met 50 55 60 Thr Asp Ile Phe Ala Ala Phe His Ala Pro Gly Ser
Gln Ser Leu Met 65 70 75 80 Lys Lys Phe Tyr Ile Gly Glu Leu Leu Pro
Glu Thr Thr Gly Lys Glu 85 90 95 Pro Gln Gln Ile Ala Phe Glu Lys
Gly Tyr Arg Asp Leu Arg Ser Lys 100 105 110 Leu Ile Met Met Gly Met
Phe Lys Ser Asn Lys Trp Phe Tyr Val Tyr 115 120 125 Lys Cys Leu Ser
Asn Met Ala Ile Trp Ala Ala Ala Cys Ala Leu Val 130 135 140 Phe Tyr
Ser Asp Arg Phe Trp Val His Leu Ala Ser Ala Val Met Leu 145 150 155
160 Gly Thr Phe Phe Gln Gln Ser Gly Trp Leu Ala His Asp Phe Leu His
165 170 175 His Gln Val Phe Thr Lys Arg Lys His Gly Asp Leu Gly Gly
Leu Phe 180 185 190 Trp Gly Asn Leu Met Gln Gly Tyr Ser Val Gln Trp
Trp Lys Asn Lys 195 200 205 His Asn Gly His His Ala Val Pro Asn Leu
His Cys Ser Ser Ala Val 210 215 220 Ala Gln Asp Gly Asp Pro Asp Ile
Asp Thr Met Pro Leu Leu Ala Trp 225 230 235 240 Ser Val Gln Gln Ala
Gln Ser Tyr Arg Glu Leu Gln Ala Asp Gly Lys 245 250 255 Asp Ser Gly
Leu Val Lys Phe Met Ile Arg Asn Gln Ser Tyr Phe Tyr 260 265 270 Phe
Pro Ile Leu Leu Leu Ala Arg Leu Ser Trp Leu Asn Glu Ser Phe 275 280
285 Lys Cys Ala Phe Gly Leu Gly Ala Ala Ser Glu Asn Ala Ala Leu Glu
290 295 300 Leu Lys Ala Lys Gly Leu Gln Tyr Pro Leu Leu Glu Lys Ala
Gly Ile 305 310 315 320 Leu Leu His Tyr Ala Trp Met Leu Thr Val Ser
Ser Gly Phe Gly Arg 325 330 335 Phe Ser Phe Ala Tyr Thr Ala Phe Tyr
Phe Leu Thr Ala Thr Ala Ser 340 345 350 Cys Gly Phe Leu Leu Ala Ile
Val Phe Gly Leu Gly His Asn Gly Met 355 360 365 Ala Thr Tyr Asn Ala
Asp Ala Arg Pro Asp Phe Trp Lys Leu Gln Val 370 375 380 Thr Thr Thr
Arg Asn Val Thr Gly Gly His Gly Phe Pro Gln Ala Phe 385 390 395 400
Val Asp Trp Phe Cys Gly Gly Leu Gln Tyr Gln Val Asp His His Leu 405
410 415 Phe Pro Ser Leu Pro Arg His Asn Leu Ala Lys Thr His Ala Leu
Val 420 425 430 Glu Ser Phe Cys Lys Glu Trp Gly Val Gln Tyr His Glu
Ala Asp Leu 435 440 445 Val Asp Gly Thr Met Glu Val Leu His His Leu
Gly Ser Val Ala Gly 450 455 460 Glu Phe Val Val Asp Phe Val Arg Asp
Gly Pro Ala Met 465 470 475 3847DNAArtificial sequencesynthetic
oligonucleotide 38ccggaattcg gcgcgccgag ctcctcgagc aaatttacac
attgcca 473947DNAArtificial sequencesynthetic oligonucleotide
39ccggaattcg gcgcgccgag ctcctcgagc aaatttacac attgcca
474047DNAArtificial sequencesynthetic oligonucleotide 40ccggaattcg
gcgcgccgag ctcctcgagc aaatttacac attgcca 474148DNAArtificial
sequencesynthetic oligonucleotide 41aaaactgcag gcggccgccc
accgcggtgg gctggctatg aagaaatt 484227DNAArtificial
sequencesynthetic oligonucleotide 42cgcggatccg ctggctatga agaaatt
274345DNAArtificial sequencesynthetic oligonucleotide 43tcccccggga
tcgatgccgg cagatctgct ggctatgaag aaatt 454440DNAArtificial
sequencesynthetic oligonucleotide 44aaaactgcag tctagaaggc
ctcctgcttt aatgagatat 404551DNAArtificial sequencesynthetic
oligonucleotide 45cgcggatccg atatcgggcc cgctagcgtt aaccctgctt
taatgagata t 514633DNAArtificial sequencesynthetic oligonucleotide
46tcccccgggc catggcctgc tttaatgaga tat 334753DNAArtificial
sequencesynthetic oligonucleotide 47cccaagcttg gcgcgccgag
ctcgaattcg tcgacggaca atcagtaaat tga
534853DNAArtificial sequencesynthetic oligonucleotide 48cccaagcttg
gcgcgccgag ctcgaattcg tcgacggaca atcagtaaat tga 534947DNAArtificial
sequencesynthetic oligonucleotide 49cccaagcttg gcgcgccgag
ctcgtcgacg gacaatcagt aaattga 475029DNAArtificial sequencesynthetic
oligonucleotide 50acataatgga gaacttctgg tcgatcgtc
295124DNAArtificial sequencesynthetic oligonucleotide 51ttactcagat
ttcttcccgt cttt 245226DNAArtificial sequencesynthetic
oligonucleotide 52acataatgac cttcctagcc atatta 265324DNAArtificial
sequencesynthetic oligonucleotide 53tcagatattc aaattggcgg cttc
245432DNAArtificial sequencesynthetic oligonucleotide 54ttaagcgcgg
ccgcatggag aacttctggt cg 325531DNAArtificial sequencesynthetic
oligonucleotide 55acctcggcgg ccgccctttt actcagattt c
315641DNAArtificial sequencesynthetic oligonucleotide 56acataatgga
gaacttctgg tctattgttg tgttttttct a 415741DNAArtificial
sequencesynthetic oligonucleotide 57ctagctagct tactcagatt
tcttcccgtc ttttgtttct c 4158285PRTMus musculus 58Met Glu Leu Trp
Pro Gly Ala Trp Thr Ala Leu Leu Leu Leu Leu Leu 1 5 10 15 Leu Leu
Leu Ser Thr Leu Trp Phe Cys Ser Ser Ser Ala Lys Tyr Phe 20 25 30
Phe Lys Met Ala Phe Tyr Asn Gly Trp Ile Leu Phe Leu Ala Ile Leu 35
40 45 Ala Ile Pro Val Cys Ala Val Arg Gly Arg Asn Val Glu Asn Met
Lys 50 55 60 Ile Leu Arg Leu Leu Leu Leu His Ala Lys Tyr Leu Tyr
Gly Ile Arg 65 70 75 80 Val Glu Val Arg Gly Ala His His Phe Pro Pro
Thr Gln Pro Tyr Val 85 90 95 Val Val Ser Asn His Gln Ser Ser Leu
Asp Leu Leu Gly Met Met Glu 100 105 110 Val Leu Pro Asp Arg Cys Val
Pro Ile Ala Lys Arg Glu Leu Leu Trp 115 120 125 Ala Gly Ser Ala Gly
Leu Ala Cys Trp Leu Ala Gly Ile Ile Phe Ile 130 135 140 Asp Arg Lys
Arg Thr Gly Asp Ala Ile Ser Val Met Ser Glu Val Ala 145 150 155 160
Gln Thr Leu Leu Thr Gln Asp Val Arg Val Trp Val Phe Pro Glu Gly 165
170 175 Thr Arg Asn His Asn Gly Ser Met Leu Pro Phe Lys Arg Gly Ala
Phe 180 185 190 His Leu Ala Val Gln Ala Gln Val Pro Ile Ile Pro Ile
Val Met Ser 195 200 205 Ser Tyr Gln Asp Phe Tyr Ser Lys Lys Glu Arg
Arg Phe Thr Ser Pro 210 215 220 Gly Arg Cys Gln Val Arg Val Leu Pro
Pro Val Ser Thr Glu Gly Leu 225 230 235 240 Thr Pro Asp Asp Val Pro
Ala Leu Ala Asp Ser Val Arg His Ser Met 245 250 255 Leu Thr Ile Phe
Arg Glu Ile Ser Thr Asp Gly Leu Gly Gly Gly Asp 260 265 270 Cys Leu
Lys Lys Pro Gly Gly Ala Gly Glu Ala Arg Leu 275 280 285
59262PRTCaenorhabditis elegans 59Met Thr Phe Leu Ala Ile Leu Phe
Val Ile Ala Val Leu Leu Leu Leu 1 5 10 15 Ala Gln Leu Pro Val Ile
Gly Phe Tyr Ile Arg Ala Val Tyr Phe Gly 20 25 30 Met Cys Leu Ile
Ile Gly Gly Phe Leu Gly Gly Leu Ala Ser Ile Pro 35 40 45 Phe Gly
Lys Ser Pro Asn Asn His Phe Arg Met Phe Lys Ile Phe Gln 50 55 60
Ala Met Thr Trp Pro Met Gly Val Arg Phe Glu Leu Arg Asn Ser Glu 65
70 75 80 Ile Leu His Asp Lys Lys Pro Tyr Ile Ile Ile Ala Asn His
Gln Ser 85 90 95 Ala Leu Asp Val Leu Gly Met Ser Phe Ala Trp Pro
Val Asp Cys Val 100 105 110 Val Met Leu Lys Ser Ser Leu Lys Tyr Leu
Pro Gly Phe Asn Leu Cys 115 120 125 Ala Tyr Leu Cys Asp Ser Val Tyr
Ile Asn Arg Phe Ser Lys Glu Lys 130 135 140 Ala Leu Lys Thr Val Asp
Thr Thr Leu His Glu Ile Val Thr Lys Lys 145 150 155 160 Arg Lys Val
Trp Ile Tyr Pro Glu Gly Thr Arg Asn Ala Glu Pro Glu 165 170 175 Leu
Leu Pro Phe Lys Lys Gly Ala Phe Ile Leu Ala Lys Gln Ala Lys 180 185
190 Ile Pro Ile Val Pro Cys Val Phe Ser Ser His Lys Phe Phe Tyr Ser
195 200 205 His Ala Glu Lys Arg Leu Thr Ser Gly Asn Cys Ile Ile Asp
Ile Leu 210 215 220 Pro Glu Val Asp Ser Ser Lys Phe Asp Ser Ile Asp
Asp Leu Ser Ala 225 230 235 240 His Cys Arg Lys Ile Met Gln Ala His
Arg Glu Lys Leu Asp Ala Glu 245 250 255 Ala Ala Asn Leu Asn Ile
260
* * * * *