U.S. patent application number 14/027489 was filed with the patent office on 2014-01-16 for gpr119 agonist.
This patent application is currently assigned to NIPPON CHEMIPHAR CO., LTD.. The applicant listed for this patent is NIPPON CHEMIPHAR CO., LTD.. Invention is credited to Tsuyoshi ENDO, Takaichi Hamano, Kaoru Hara, Toshihiro Kunigami, Mai Okamura, Rie Takahashi, Hiroto Tanaka.
Application Number | 20140018537 14/027489 |
Document ID | / |
Family ID | 41610536 |
Filed Date | 2014-01-16 |
United States Patent
Application |
20140018537 |
Kind Code |
A1 |
ENDO; Tsuyoshi ; et
al. |
January 16, 2014 |
GPR119 AGONIST
Abstract
A cyclic amine derivative represented by the formula (II) is a
GPR119 agonist, and is used as an agent for treating diabetes.
##STR00001## wherein Ar.sup.0 is phenyl or phenyl having a
substituent such as C.sub.1-8 alkylsulfonyl or the like, pyridyl,
or pyridyl having a substituent such as C.sub.1-8 alkylsulfonyl;
A.sup.0 is (CH.sub.2).sub.p, O, or the like; B.sup.0 is
(CH.sub.2).sub.q, or the like, provided that B.sup.0 is neither O
nor NR.sup.25 when A.sup.0 is O or NR.sup.24; one of U.sup.0 and
V.sup.0 is N, and the other is N or CR.sup.26; each of X.sup.0 and
Y.sup.0 is C.sub.1-3 alkylene or C.sub.1-3 alkylene having a
substituent; R.sup.23 is a C.sub.1-8 alkyl group or the like; each
of R.sup.21 and R.sup.22 is hydrogen, a halogen atom, or the
like.
Inventors: |
ENDO; Tsuyoshi; (Misato-shi,
JP) ; Takahashi; Rie; (Misato-shi, JP) ;
Tanaka; Hiroto; (Misato-shi, JP) ; Kunigami;
Toshihiro; (Misato-shi, JP) ; Hamano; Takaichi;
(Misato-shi, JP) ; Okamura; Mai; (Misato-shi,
JP) ; Hara; Kaoru; (Misato-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NIPPON CHEMIPHAR CO., LTD. |
Tokyo |
|
JP |
|
|
Assignee: |
NIPPON CHEMIPHAR CO., LTD.
Tokyo
JP
|
Family ID: |
41610536 |
Appl. No.: |
14/027489 |
Filed: |
September 16, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13056673 |
Jan 31, 2011 |
8536176 |
|
|
PCT/JP2009/063982 |
Jul 31, 2009 |
|
|
|
14027489 |
|
|
|
|
Current U.S.
Class: |
544/331 ;
546/194 |
Current CPC
Class: |
A61K 31/501 20130101;
A61K 31/506 20130101; A61K 31/454 20130101; A61P 43/00 20180101;
C07D 413/14 20130101; A61P 3/10 20180101; C07D 401/04 20130101;
A61K 31/4545 20130101; C07D 401/14 20130101 |
Class at
Publication: |
544/331 ;
546/194 |
International
Class: |
C07D 413/14 20060101
C07D413/14; C07D 401/14 20060101 C07D401/14; C07D 401/04 20060101
C07D401/04 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 1, 2008 |
JP |
2008-200229 |
Claims
1. (canceled)
2. A compound having the following formula (I) or a
pharmaceutically acceptable salt thereof: ##STR00069## wherein Ar
is an aryl or five-membered or six-membered heteroaryl group, which
optionally has a substituent selected from the group consisting of
a halogen atom, nitro, cyano, hydroxyl, a C.sub.1-8 alkyl group, a
C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group having one to three
halogen atoms, a C.sub.1-8 alkoxy group having one to three halogen
atoms, phenoxy, an alkoxycarbonyl group having a C.sub.1-8 alkoxy
group, carboxyl, carbamoyl, an acyl group having a C.sub.1-8 alkyl
group, an alkylaminocarbonyl group having a C.sub.1-8 alkyl group,
a dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, a C.sub.2-12 dialkylaminosulfonyl group, phenylsulfonyl, and
a five-membered or six-membered heteroaryl group; A is O, S, or
NR.sup.3, wherein R.sup.3 is hydrogen or a C.sub.1-8 alkyl group; B
is (CH.sub.2).sub.n, wherein n is an integer of 1 to 3; one of U
and V is N, and the other is CR.sup.5, wherein R.sup.5 is hydrogen,
a halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8
alkoxy group, a C.sub.1-8 alkyl group having one to three halogen
atoms, or a C.sub.1-8 alkoxy group having one to three halogen
atoms; W is C or CR.sup.6, wherein R.sup.6 is hydrogen, a halogen
atom, hydroxyl, a C.sub.1-8 alkyl, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, or a
C.sub.1-8 alkoxy group having one to three halogen atoms; X is a
C.sub.1-3 alkylene group, which optionally has a substituent
selected from the group consisting of a halogen atom, hydroxyl, a
C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl
group having one to three halogen atoms, and a C.sub.1-8 alkoxy
group having one to three halogen atoms; when W is C, X combines to
W with a double bond; Y is a C.sub.1-3 alkylene group, which
optionally has a substituent selected from the group consisting of
a halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8
alkoxy group, a C.sub.1-8 alkyl group having one to three halogen
atoms, and a C.sub.1-8 alkoxy group having one to three halogen
atoms; Z is C(O)OR.sup.7, C(O)R.sup.8, C(O)NR.sup.10R.sup.11,
CH.sub.2C(O)N(R.sup.12)(R.sup.13), or a five-membered or
six-membered heteroaryl group comprising carbon and nitrogen atoms,
said carbon atom combining to the nitrogen atom of the neighboring
cyclic amine, and said heteroaryl group optionally having a
substituent selected from the group consisting of a halogen atom, a
C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl
group having one to three halogen atoms, and a C.sub.1-8 alkoxy
group having one to three halogen atoms, wherein each of R.sup.7,
R.sup.8, R.sup.10, R.sup.11, R.sup.12, and R.sup.13 independently
is a C.sub.1-8 alkyl group, a C.sub.2-8 alkenyl group, a C.sub.3-8
cycloalkyl group, phenyl, or a C.sub.1-8 alkyl group having phenyl;
and each of R.sup.1 and R.sup.2 independently is hydrogen, a
halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms,
or a C.sub.1-8 alkoxy group having one to three halogen atoms.
3. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is phenyl, which optionally has a
substituent selected from the group consisting of a halogen atom,
nitro, cyano, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms, a
C.sub.1-8 alkoxy group having one to three halogen atoms, phenoxy,
an alkoxycarbonyl group having a C.sub.1-8 alkoxy group, carboxyl,
carbamoyl, an acyl group having a C.sub.1-8 alkyl group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, a
dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group.
4. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is pyridyl, which optionally has a
substituent selected from the group consisting of a halogen atom,
nitro, cyano, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms, a
C.sub.1-8 alkoxy group having one to three halogen atoms, phenoxy,
an alkoxycarbonyl group having a C.sub.1-8 alkoxy group, carboxyl,
carbamoyl, an acyl group having a C.sub.1-8 alkyl group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, a
dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group.
5. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is phenyl having only one substituent or
pyridyl having only one substituent, said substituent being
selected from the group consisting of an alkoxycarbonyl group
having a C.sub.1-8 alkoxy group, an alkylaminocarbonyl group having
a C.sub.1-8 alkyl group, an alkoxycarbonylmethylcarbonyl group
having a C.sub.1-8 Alkoxy group, an alkylsulfonylmethyl group
having a C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfonyl group,
phenylsulfonyl, a C.sub.1-8 alkylaminosulfonyl group, and a
five-membered or six-membered heteroaryl group.
6. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is phenyl, phenyl having a substituent,
pyridyl, or pyridyl having a substituent, said substituent being
C.sub.1-8 alkylsulfonyl.
7. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is phenyl having two substituents or pyridyl
having two substituents, one of said substituents being an
alkylsulfonylmethyl group having a C.sub.1-8 alkyl group or a
C.sub.1-8 alkylsulfonyl group, and the other being a C.sub.1-8
alkyl group or a halogen atom.
8. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is phenyl having a substituent or pyridyl
having a substituent, said substituent being 1-tetrazolyl.
9. A compound or a pharmaceutically acceptable salt thereof defined
in claim 2, wherein Ar is phenyl having two substituents or pyridyl
having two substituents, one of said substituents being
1-tetrazolyl, and the other being a C.sub.1-8 alkyl group or a
halogen atom.
10. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein A is O, and B is CH.sub.2.
11. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein A is S, and B is CH.sub.2.
12. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein one of U and V is N, and the other is
CH.
13. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein U is N, and V is CH.
14. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein each of X and Y is ethylene.
15. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein Z is C(O)OR.sup.7.
16. A compound or a pharmaceutically acceptable salt thereof
defined in claim 15, wherein R.sup.7 is a C.sub.1-8 alkyl
group.
17. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein Z is 3-C.sub.1-8
alkyl-1,2,4-oxadiazol-5-yl or 5-C.sub.1-8
alkyl-1,2,4-oxadiazol-3-yl.
18. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein Z is 5-C.sub.1-8
alkylpyrimidin-2-yl.
19. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein each of R.sup.1 and R.sup.2 is
hydrogen.
20. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein R.sup.1 is a C.sub.1-8 alkyl group, and
R.sup.2 is hydrogen.
21. A compound or a pharmaceutically acceptable salt thereof
defined in claim 2, wherein R.sup.1 is a halogen atom, and R.sup.2
is hydrogen.
22. An agent for treating diabetes containing a compound or a
pharmaceutically acceptable salt thereof defined in claim 2, as an
active ingredient.
23. A GPR119 agonist containing a compound or a pharmaceutically
acceptable salt thereof defined in claim 2, as an active
ingredient.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a GPR119 agonist.
BACKGROUND OF THE INVENTION
[0002] Diabetes is a life-style related disease and the number of
patients increases all over the world. The treatments for diabetes
are classified into diet, exercise and drug therapy (injectable
insulin and an oral anti-diabetic drug). Some oral anti-diabetic
drugs, for example, .alpha.-glucosidase inhibitors (acarbose,
voglibose), insulin-sensitizing agents (pioglitazone
hydrochloride), biguanides (metformin hydrochloride), sulfonylureas
(glibenclamide, glimepiride) and short-acting insulin secretagogues
(mitiglinide calcium hydrate) are commercially available in
Japan.
[0003] On the other hand, an incretin mimetics (excenatide) and a
DPP IV inhibitor (sitagliptin), which accelerates secretion of
insulin, are commercially available abroad. The incretin is a
gastrointestinal hormone, which accelerates secretion of insulin.
Further, SGLT inhibitors have been developed abroad.
[0004] GPR119 has been reported as a G protein-coupled-receptor
(GPCR) whose endogenous ligand is N-oleoylethanolamide and which
stimulate insulin secretion from pancreatic .beta.-cells
(Non-patent Document 1: Overton H A et al., Cell Metab., 2006, 3,
167-75). It has been reported that GPR119 agonist increases the
plasma concentration of Glucagon like peptide-1 (GLP-1), one of
incretins (Non-patent Document 2: Chu Z L et al., Endocrinology,
2008, 149, 2038-47), which may indirectly relate to stimulation of
insulin secretion. It has been further reported that GPR119 agonist
surpresses a weight increase in rats fed a high-fat diet
(Non-patent Document 1), which may relate to energy metabolism. For
the reasons mentioned above, the GPR119 agonist has been expected
as a drug not only for diabetes but also for life-style related
diseases such as obesity and metabolic syndrome.
[0005] Compounds such as (A) are described in WO 2004/076413
(Patent Document 1) as the GPR119 agonist.
##STR00002##
[0006] Compounds such as (B) are described in WO 2004/065380
(Patent Document 2) as the GPR119 agonist.
##STR00003##
[0007] Compounds such as (C) are described in WO 2005/007647
(Patent Document 3) as the GPR119 agonist.
##STR00004##
[0008] Compounds such as (D) are described in WO 2007/003960
(Patent Document 4) as the GPR119 agonist.
##STR00005##
[0009] Compounds such as (E) are described in WO 2008/025798
(Patent Document 5) as the GPR119 agonist.
##STR00006##
[0010] Compounds such as (F) are described in WO 2008/008887
(Patent Document 6) as the GPR119 agonist.
##STR00007##
[0011] However, there in no description of the compound represented
by the formula (I) in which the carbon atom contained in the
pyridine or pyridazine ring is directly combined with the carbon
atom contained in the cyclic amine.
[0012] Compounds such as (G) and (H) are described in WO 97/09311
(Patent Document 7), which have a pyridylpiperidine structure.
##STR00008##
[0013] Compounds such as (J) are described in WO 2002/042305
(Patent Document 8).
##STR00009##
[0014] These compounds are intermediates of a drug for Alzheimer
disease or GABA.sub.A agonist. There is no description in Patent
Documents 7 and 8 that these compounds are used as GPR119
agonists.
DISCLOSURE OF THE INVENTION
[0015] The object of the invention is to provide a compound
represented by the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof. The object also is
to provide a cyclic amine derivative represented by the formula
(II) described in (C) or (D), or a pharmaceutically acceptable salt
thereof. The object further is to provide a GPR119 agonist or an
agent for treating diabetes containing the compound or salt thereof
as an active ingredient.
[0016] (A) The present invention relates to a compound having the
following formula (I) or a pharmaceutically acceptable salt
thereof:
##STR00010##
[0017] wherein Ar is an aryl or five-membered or six-membered
heteroaryl group, which optionally has a substituent selected from
the group consisting of a halogen atom, nitro, cyano, hydroxyl, a
C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl
group having one to three halogen atoms, a C.sub.1-8 alkoxy group
having one to three halogen atoms, phenoxy, an alkoxycarbonyl group
having a C.sub.1-8 alkoxy group, carboxyl, carbamoyl, an acyl group
having a C.sub.1-8 alkyl group, an alkylaminocarbonyl group having
a C.sub.1-8 alkyl group, a dialkylaminocarbonyl group having
C.sub.2-12 alkyl groups, an alkoxycarbonylmethylcarbonyl group
having a C.sub.1-8 alkoxy group, an alkylsulfonylmethyl group
having a C.sub.1-8 alkyl group, amino, a C.sub.1-8 alkylamino
group, a C.sub.2-12 dialkylamino group, a C.sub.1-8
alkylsulfonylamino group, an acylamino group having a C.sub.1-8
alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, a C.sub.2-12 dialkylaminosulfonyl group, phenylsulfonyl, and
a five-membered or six-membered heteroaryl group;
[0018] A is (CH.sub.2).sub.m, O, S, NR.sup.3, or a bond, wherein m
is an integer of 1 to 3, and R.sup.3 is hydrogen or a C.sub.1-8
alkyl group;
[0019] B is (CH.sub.2).sub.n, CH.dbd.CH, O, S, or NR.sup.4, wherein
n is an integer of 1 to 3, and R.sup.4 is hydrogen or a C.sub.1-8
alkyl group, provided that B is neither O, S, nor NR.sup.4 when A
is O, S, or NR.sup.3;
[0020] one of U and V is N, and the other is N or CR.sup.5, wherein
R.sup.5 is hydrogen, a halogen atom, hydroxyl, a C.sub.1-8 alkyl
group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group having one
to three halogen atoms, or a C.sub.1-8 alkoxy group having one to
three halogen atoms;
[0021] W is C or CR.sup.6, wherein R.sup.6 is hydrogen, a halogen
atom, hydroxyl, a C.sub.1-8 alkyl, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, or a
C.sub.1-8 alkoxy group having one to three halogen atoms;
[0022] X is a C.sub.1-3 alkylene group, which optionally has a
substituent selected from the group consisting of a halogen atom,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, and a
C.sub.1-8 alkoxy group having one to three halogen atoms;
[0023] when W is C, X combines to W with a double bond;
[0024] Y is a C.sub.1-3 alkylene group, which optionally has a
substituent selected from the group consisting of a halogen atom,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, and a
C.sub.1-8 alkoxy group having one to three halogen atoms;
[0025] Z is C(O)OR.sup.7, C(O)R.sup.8, C(O)NR.sup.10R.sup.11,
CH.sub.2C(O)N(R.sup.12)(R.sup.13), or a five-membered or
six-membered heteroaryl group comprising carbon and nitrogen atoms,
said carbon atom combining to the nitrogen atom of the neighboring
cyclic amine, and said heteroaryl group optionally having a
substituent selected from the group consisting of a halogen atom, a
C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl
group having one to three halogen atoms, and a C.sub.1-8 alkoxy
group having one to three halogen atoms, wherein each of R.sup.7,
R.sup.8, R.sup.9, R.sup.10, R.sup.11, R.sup.12 and R.sup.13
independently is a C.sub.1-8 alkyl group, a C.sub.2-8 alkenyl
group, a C.sub.3-8 cycloalkyl group, phenyl, or a C.sub.1-8 alkyl
group having phenyl; and
[0026] each of R.sup.1 and R.sup.2 independently is hydrogen, a
halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms,
or a C.sub.1-8 alkoxy group having one to three halogen atoms.
[0027] (B) The invention also relates to a compound having the
following formula (I) or a pharmaceutically acceptable salt
thereof:
##STR00011##
[0028] wherein Ar is an aryl or five-membered or six-membered
heteroaryl group, which optionally has a substituent selected from
the group consisting of a halogen atom, nitro, cyano, hydroxyl, a
C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl
group having one to three halogen atoms, a C.sub.1-8 alkoxy group
having one to three halogen atoms, phenoxy, an alkoxycarbonyl group
having a C.sub.1-8 alkoxy group, carboxyl, carbamoyl, an acyl group
having a C.sub.1-8 alkyl group, an alkylaminocarbonyl group having
a C.sub.1-8 alkyl group, a dialkylaminocarbonyl group having
C.sub.2-12 alkyl groups, an alkoxycarbonylmethylcarbonyl group
having a C.sub.1-8 alkoxy group, an alkylsulfonylmethyl group
having a C.sub.1-8 alkyl group, amino, a C.sub.1-8 alkylamino
group, a C.sub.2-12 dialkylamino group, a C.sub.1-8
alkylsulfonylamino group, an acylamino group having a C.sub.1-8
alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group;
[0029] A is (CH.sub.2).sub.m, O, NR.sup.3, or a bond, wherein m is
an integer of 1 to 3, and R.sup.3 is hydrogen or a C.sub.1-8 alkyl
group;
[0030] B is (CH.sub.2).sub.n, O, or NR.sup.4, wherein n is an
integer of 1 to 3, and R.sup.4 is hydrogen or a C.sub.1-8 alkyl
group, provided that B is neither 0 nor NR.sup.4 when A is O or
NR.sup.3;
[0031] one of U and V is N, and the other is N or CR.sup.5, wherein
R.sup.5 is hydrogen, a halogen atom, hydroxyl, a C.sub.1-8 alkyl
group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group having one
to three halogen atoms, or a C.sub.1-8 alkoxy group having one to
three halogen atoms;
[0032] W is C or CR.sup.6, wherein R.sup.6 is hydrogen, a halogen
atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group,
a C.sub.1-8 alkyl group having one to three halogen atoms, or a
C.sub.1-8 alkoxy group having one to three halogen atoms;
[0033] X is a C.sub.1-3 alkylene group, which optionally has a
substituent selected from the group consisting of a halogen atom,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, and a
C.sub.1-8 alkoxy group having one to three halogen atoms;
[0034] when W is C, X combines to W with a double bond;
[0035] Y is a C.sub.1-3 alkylene group, which optionally has a
substituent selected from the group consisting of a halogen atom,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, and a
C.sub.1-8 alkoxy group having one to three halogen atoms;
[0036] Z is C(O)OR.sup.7, C(O)R.sup.8, C(O)NR.sup.10R.sup.11,
CH.sub.2C(O)N(R.sup.12)(R.sup.13) or a five-membered or
six-membered heteroaryl group comprising carbon and nitrogen atoms,
said carbon atom of the ring being combined to nitrogen atom of the
neighboring cyclic amine, and said heteroaryl group optionally
having a substituent selected from the group consisting of a
halogen atom, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, and a
C.sub.1-8 alkoxy group having one to three halogen atoms, wherein
each of R.sup.7, R.sup.8, R.sup.9, R.sup.10, R.sup.11, R.sup.12,
and R.sup.13 is a C.sub.1-8 alkyl group, a C.sub.2-8 alkenyl group,
a C.sub.3-8 cycloalkyl group, phenyl, or a C.sub.1-8 alkyl group
having phenyl; and
[0037] each of R.sup.1 and R.sup.2 independently is hydrogen, a
halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms,
or a C.sub.1-8 alkoxy group having one to three halogen atoms.
[0038] The invention further relates to an agent for treating
diabetes containing the compound of the formula (I) described in
(A) or (B), or a pharmaceutically acceptable salt thereof as an
active ingredient.
[0039] The invention further relates to a GPR119 agonist containing
the compound of the formula (I) described in (A) or (B), or a
pharmaceutically acceptable salt thereof as an active
ingredient.
[0040] (C) The invention also relates to a cyclic amine derivative
having the following formula (II) or a pharmaceutically acceptable
salt thereof:
##STR00012##
[0041] wherein Ar.sup.0 is phenyl, phenyl having a substituent,
pyridyl, or pyridyl having a substituent, said substituent being
selected from the group consisting of a halogen atom, nitro, cyano,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, a
C.sub.1-8 alkoxy group having one to three halogen atoms, phenoxy,
an alkoxycarbonyl group having a C.sub.1-8 alkoxy group, carboxyl,
carbamoyl, an acyl group having a C.sub.1-8 alkyl group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, a
dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, a C.sub.2-12 dialkylaminosulfonyl group, phenylsulfonyl, and
a five-membered or six-membered heteroaryl group;
[0042] A.sup.0 is (CH.sub.2).sub.p, O, S, NR.sup.24, or a bond,
wherein p is an integer of 1 to 3, and R.sup.24 is hydrogen or a
C.sub.1-8 alkyl group;
[0043] B.sup.0 is (CH.sub.2).sub.q, CH.dbd.CH, O, S, or NR.sup.25,
wherein q is an integer of 1 to 3, and R.sup.25 is hydrogen or a
C.sub.1-8 alkyl group, provided that B.sup.0 is neither O, S, nor
NR.sup.25 when A.sup.0 is O, S, or NR.sup.24;
[0044] one of U.sup.0 and V.sup.0 is N, and the other is N or
CR.sup.26, wherein R.sup.26 is hydrogen, a halogen atom, hydroxyl,
a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8
alkyl group having one to three halogen atoms, or a C.sub.1-8
alkoxy group having one to three halogen atoms;
[0045] each of X.sup.0 and Y.sup.0 independently is a C.sub.1-3
alkylene group, which optionally has a substituent selected from
the group consisting of a halogen atom, a C.sub.1-8 alkyl group, a
C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group having one to three
halogen atoms, and a C.sub.1-8 alkoxy group having one to three
halogen atoms;
[0046] R.sup.23 is a C.sub.1-8 alkyl group, a C.sub.2-8 alkenyl
group, a C.sub.3-8 cycloalkyl group, phenyl, or a C.sub.1-8 alkyl
group having phenyl; and
[0047] each of R.sup.21 and R.sup.22 independently is hydrogen, a
halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms,
or a C.sub.1-8 alkoxy group having one to three halogen atoms.
[0048] (D) The invention further relates to a cyclic amine
derivative having the following formula (II) or a pharmaceutically
acceptable salt thereof:
##STR00013##
[0049] wherein Ar.sup.0 is phenyl, phenyl having a substituent,
pyridyl, or pyridyl having a substituent, said substituent being
selected from the group consisting of a halogen atom, nitro, cyano,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, a
C.sub.1-8 alkoxy group having one to three halogen atoms, phenoxy,
an alkoxycarbonyl group having a C.sub.1-8 alkoxy group, carboxyl,
carbamoyl, an acyl group having a alkyl group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, a
dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group;
[0050] A.sup.0 is (CH.sub.2).sub.p, O, NR.sup.24, or a bond,
wherein p is an integer of 1 to 3, and R.sup.24 is hydrogen or a
C.sub.1-8 alkyl group;
[0051] B.sup.0 is (CH.sub.2).sub.g, O, or NR.sup.25, wherein q is
an integer of 1 to 3, and R.sup.25 is hydrogen or a C.sub.1-8 alkyl
group, provided that B.sup.0 is neither 0 nor NR.sup.25 when
A.sup.0 is O or NR.sup.24;
[0052] one of U.sup.0 and V.sup.0 is N, and the other is N or
CR.sup.26, wherein R.sup.26 is hydrogen, a halogen atom, hydroxyl,
a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8
alkyl group having one to three halogen atoms, or a C.sub.1-8
alkoxy group having one to three halogen atoms;
[0053] each of X.sup.0 and Y.sup.0 independently is a C.sub.1-3
alkylene group, which optionally has a substituent selected from
the group consisting of a halogen atom, a C.sub.1-8 alkyl group, a
C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group having one to three
halogen atoms, and a C.sub.1-8 alkoxy group having one to three
halogen atoms;
[0054] R.sup.23 is a C.sub.1-8 alkyl group, a C.sub.2-8 alkenyl
group, a C.sub.3-8 cycloalkyl group, phenyl, or a C.sub.1-8 alkyl
group having phenyl; and
[0055] each of R.sup.21 and R.sup.22 independently is hydrogen, a
halogen atom, hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy
group, a C.sub.1-8 alkyl group having one to three halogen atoms,
or a C.sub.1-8 alkoxy group having one to three halogen atoms.
[0056] The invention furthermore relates to an agent for treating
diabetes containing the cyclic amine derivative of the formula (II)
described in (C) or (D), or a pharmaceutically acceptable salt
thereof as an active ingredient.
[0057] The invention furthermore relates to a GPR119 agonist
containing the cyclic amine derivative of the formula (II)
described in (C) or (D), or a pharmaceutically acceptable salt
thereof as an active ingredient.
BEST MODE OF THE INVENTION
[0058] The present invention is described below in more detail.
[0059] Preferred embodiments of the compound of the formula (I)
described in (A) or (B) are shown below.
[0060] (1) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is
phenyl, which optionally has a substituent selected from the group
consisting of a halogen atom, nitro, cyano, hydroxyl, a C.sub.1-8
alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group
having one to three halogen atoms, a C.sub.1-8 alkoxy group having
one to three halogen atoms, phenoxy, an alkoxycarbonyl group having
a C.sub.1-8 alkoxy group, carboxyl, carbamoyl, an acyl group having
a C.sub.1-8 alkyl group, an alkylaminocarbonyl group having a
C.sub.1-8 alkyl group, a dialkylaminocarbonyl group having
C.sub.2-12 alkyl groups, an alkoxycarbonylmethylcarbonyl group
having a C.sub.1-8 alkoxy group, an alkylsulfonylmethyl group
having a C.sub.1-8 alkyl group, amino, a C.sub.1-8 alkylamino
group, a C.sub.2-12 dialkylamino group, a C.sub.1-8
alkylsulfonylamino group, an acylamino group having a C.sub.1-8
alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group.
[0061] (2) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is
pyridyl, which optionally has a substituent selected from the group
consisting of a halogen atom, nitro, cyano, hydroxyl, a C.sub.1-8
alkyl group, a C.sub.1-8 alkoxy group, a C.sub.1-8 alkyl group
having one to three halogen atoms, a C.sub.1-8 alkoxy group having
one to three halogen atoms, phenoxy, an alkoxycarbonyl group having
a C.sub.1-8 alkoxy group, carboxyl, carbamoyl, an acyl group having
a C.sub.1-8 alkyl group, an alkylaminocarbonyl group having a
C.sub.1-8 alkyl group, a dialkylaminocarbonyl group having
C.sub.2-12 alkyl groups, an alkoxycarbonylmethylcarbonyl group
having a C.sub.1-8 alkoxy group, an alkylsulfonylmethyl group
having a C.sub.1-8 alkyl group, amino, a C.sub.1-8 alkylamino
group, a C.sub.2-12 dialkylamino group, a C.sub.1-8
alkylsulfonylamino group, an acylamino group having a C.sub.1-8
alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group.
[0062] (3) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is phenyl
having only one substituent or pyridyl having only one substituent,
said substituent being selected from the group consisting of an
alkoxycarbonyl group having a C.sub.1-8 alkoxy group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, a
C.sub.1-8 alkylsulfonyl group, phenylsulfonyl, a C.sub.1-8
alkylaminosulfonyl group, and a five-membered or six-membered
heteroaryl group.
[0063] (4) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is
phenyl, phenyl having a substituent, pyridyl, or pyridyl having a
substituent, said substituent being C.sub.1-8 alkylsulfonyl.
[0064] (5) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is phenyl
having two substituents or pyridyl having two substituents, one of
said substituents being an alkylsulfonylmethyl group having a
C.sub.1-8 alkyl group or a C.sub.1-8 alkylsulfonyl group, and the
other being a C.sub.1-8 alkyl group or a halogen atom.
[0065] (6) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is phenyl
having a substituent or pyridyl having a substituent, said
substituent being 1-tetrazolyl.
[0066] (7) A compound of the formula (I) described in (A) or (B),
or a pharmaceutically acceptable salt thereof, wherein Ar is phenyl
having two substituents or pyridyl having two substituents, one of
said substituents being 1-tetrazolyl, and the other being a
C.sub.1-8 alkyl group or a halogen atom.
[0067] (8) A compound of the formula (I) described in (A) or (B),
(1)-(7), or a pharmaceutically acceptable salt thereof, wherein A
is O, and B is CH.sub.2.
[0068] (9) A compound of the formula (I) described in (A), (B),
(1)-(7), or a pharmaceutically acceptable salt thereof, wherein A
is CH.sub.2, and B is O or NH.
[0069] (10) A compound of the formula (I) described in (A), (B),
(1)-(7), or a pharmaceutically acceptable salt thereof, wherein A
is CH.sub.2, and B is CH.sub.2.
[0070] (11) A compound of the formula (I) described in (A),
(1)-(7), or a pharmaceutically acceptable salt thereof, wherein A
is S, and B is CH.sub.2.
[0071] (12) A compound of the formula (I) described in (A), (B),
(1)-(11), or a pharmaceutically acceptable salt thereof, wherein
one of U and V is N, and the other is CH.
[0072] (13) A compound of the formula (I) described in (A), (B),
(1)-(11), or a pharmaceutically acceptable salt thereof, wherein
each of U and V is N.
[0073] (14) A compound of the formula (I) described in (A), (B),
(1)-(11), or a pharmaceutically acceptable salt thereof, wherein U
is N, and V is CH.
[0074] (15) A compound of the formula (I) described in (A), (B),
(1)-(14), or a pharmaceutically acceptable salt thereof, wherein
each of X and Y is ethylene.
[0075] (16) A compound of the formula (I) described in (A), (B),
(1)-(15), or a pharmaceutically acceptable salt thereof, wherein Z
is C(O)OR.sup.7.
[0076] (17) A compound of the formula (I) described in (16) or a
pharmaceutically acceptable salt thereof, wherein R.sup.7 is a
C.sub.1-8 alkyl group.
[0077] (18) A compound of the formula (I) described in (16) or a
pharmaceutically acceptable salt thereof, wherein R.sup.7 is a
C.sub.3-5 alkyl group.
[0078] (19) A compound of the formula (I) described in (A), (B),
(1)-(15), or a pharmaceutically acceptable salt thereof, wherein Z
is 3-C.sub.1-8 alkyl-1,2,4-oxadiazol-5-yl or 5-C.sub.1-8
alkyl-1,2,4-oxadiazol-3-yl.
[0079] (20) A compound of the formula (I) described in (A), (B),
(1)-(15), or a pharmaceutically acceptable salt thereof, wherein Z
is 5-C.sub.1-8 alkylpyrimidin-2-yl.
[0080] (21) A compound of the formula (I) described in (A), (B),
(1)-(20), or a pharmaceutically acceptable salt thereof, wherein
each of R.sup.1 and R.sup.2 is hydrogen.
[0081] (22) A compound of the formula (I) described in (A), (B),
(1)-(20), or a pharmaceutically acceptable salt thereof, wherein
R.sup.1 is a C.sub.1-8 alkyl group, and R.sup.2 is hydrogen.
[0082] (23) A compound of the formula (I) described in (A), (B),
(1)-(20), or a pharmaceutically acceptable salt thereof, wherein
R.sup.1 is a halogen atom, and R.sup.2 is hydrogen.
[0083] Preferred embodiments of the cyclic amine derivative of the
formula (II) described in (C) or (D) are shown below.
[0084] (24) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is phenyl, which optionally has a substituent selected
from the group consisting of a halogen atom, nitro, cyano,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, a
C.sub.1-8 alkoxy group having one to three halogen atoms, phenoxy,
an alkoxycarbonyl group having a C.sub.1-8 alkoxy group, carboxyl,
carbamoyl, an acyl group having a C.sub.1-8 alkyl group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, a
dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group.
[0085] (25) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is pyridyl, which optionally has a substituent selected
from the group consisting of a halogen atom, nitro, cyano,
hydroxyl, a C.sub.1-8 alkyl group, a C.sub.1-8 alkoxy group, a
C.sub.1-8 alkyl group having one to three halogen atoms, a
C.sub.1-8 alkoxy group having one to three halogen atoms, phenoxy,
an alkoxycarbonyl group having a C.sub.1-8 alkoxy group, carboxyl,
carbamoyl, an acyl group having a C.sub.1-8 alkyl group, an
alkylaminocarbonyl group having a C.sub.1-8 alkyl group, a
dialkylaminocarbonyl group having C.sub.2-12 alkyl groups, an
alkoxycarbonylmethylcarbonyl group having a C.sub.1-8 alkoxy group,
an alkylsulfonylmethyl group having a C.sub.1-8 alkyl group, amino,
a C.sub.1-8 alkylamino group, a C.sub.2-12 dialkylamino group, a
C.sub.1-8 alkylsulfonylamino group, an acylamino group having a
C.sub.1-8 alkyl group, a C.sub.1-8 alkylsulfinyl group, a C.sub.1-8
alkylsulfonyl group, sulfamoyl, a C.sub.1-8 alkylaminosulfonyl
group, phenylsulfonyl, and a five-membered or six-membered
heteroaryl group.
[0086] (26) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is phenyl having only one substituent or pyridyl having
only one substituent, said substituent being selected from the
group consisting of an alkoxycarbonyl group having a C.sub.1-8
alkoxy group, an alkylaminocarbonyl group having a C.sub.1-8 alkyl
group, an alkoxycarbonylmethylcarbonyl group having a C.sub.1-8
alkoxy group, an alkylsulfonylmethyl group having a C.sub.1-8 alkyl
group, a C.sub.1-8 alkylsulfonyl group, phenylsulfonyl, a C.sub.1-8
alkylaminosulfonyl group, and a five-membered or six-membered
heteroaryl group.
[0087] (27) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is phenyl, phenyl having a substituent, pyridyl, or
pyridyl having a substituent, said substituent being a C.sub.1-8
alkylsulfonyl group.
[0088] (28) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is phenyl having two substituents or pyridyl having two
substituents, one of said substituents being an alkylsulfonylmethyl
group having a C.sub.1-8 alkyl group or a C.sub.1-8 alkylsulfonyl
group, and the other being a alkyl group or a halogen atom.
[0089] (29) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is phenyl having a substituent or pyridyl having a
substituent, said substituent being 1-tetrazolyl.
[0090] (30) A cyclic amine derivative of the formula (II) described
in (C), (D), or a pharmaceutically acceptable salt thereof, wherein
Ar.sup.0 is phenyl having two substituents or pyridyl having two
substituents, one of said substituents being 1-tetrazolyl, and the
other being a C.sub.1-8 alkyl group or a halogen atom.
[0091] (31) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(30), or a pharmaceutically acceptable salt
thereof, wherein A.sup.0 is O, and B.sup.0 is CH.sub.2.
[0092] (32) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(30), or a pharmaceutically acceptable salt
thereof, wherein A.sup.0 is CH.sub.2, and B.sup.0 is O or NH.
[0093] (33) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(30), or a pharmaceutically acceptable salt
thereof, wherein A.sup.0 is CH.sub.2, and B.sup.0 is CH.sub.2.
[0094] (34) A cyclic amine derivative of the formula (II) described
in (C), (24)-(30), or a pharmaceutically acceptable salt thereof,
wherein A.sup.0 is S, and B.sup.0 is CH.sub.2.
[0095] (35) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(34), or a pharmaceutically acceptable salt
thereof, wherein one of U.sup.0 and V.sup.0 is N, and the other is
CH.
[0096] (36) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(34), or a pharmaceutically acceptable salt
thereof, wherein each of U.sup.0 and V.sup.0 is N.
[0097] (37) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(34), or a pharmaceutically acceptable salt
thereof, wherein U.sup.0 is N, and V.sup.0 is CH.
[0098] (38) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(37), or a pharmaceutically acceptable salt
thereof, wherein each of X.sup.0 and Y.sup.0 is ethylene.
[0099] (39) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(38), or a pharmaceutically acceptable salt
thereof, wherein R.sup.23 is a C.sub.1-8 alkyl group.
[0100] (40) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(38), or a pharmaceutically acceptable salt
thereof, wherein R.sup.23 is a C.sub.3-5 alkyl group.
[0101] (41) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(40), or a pharmaceutically acceptable salt
thereof, wherein each of R.sup.21 and R.sup.22 is hydrogen.
[0102] (42) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(40), or a pharmaceutically acceptable salt
thereof, wherein R.sup.21 is a C.sub.1-8 alkyl group, and R.sup.22
is hydrogen.
[0103] (43) A cyclic amine derivative of the formula (II) described
in (C), (D), (24)-(40), or a pharmaceutically acceptable salt
thereof, wherein R.sup.21 is a halogen atom, and R.sup.22 is
hydrogen.
[0104] In the compound of the formula (I) described in (A) or (B),
or the cyclic amine derivative of the formula (II) described in (C)
or (D), examples of the halogen atoms include a fluorine atom, a
chlorine atom, and a bromine atom. Examples of the C.sub.1-8 alkyl
groups include methyl, ethyl, propyl, isopropyl, butyl, t-butyl,
pentyl, neopentyl, and hexyl. Examples of the C.sub.2-8 alkenyl
groups include 2-propenyl and 3-methyl-2-butenyl. Examples of the
C.sub.3-8 cycloalkyl groups include cyclopropyl, cyclopentyl, and
cyclohexyl. Examples of the C.sub.1-8 alkyl groups having phenyl
include benzyl and phenethyl. Examples of the C.sub.1-8 alkoxy
groups include methoxy, ethoxy, and propoxy. Examples of the
C.sub.1-8 alkyl groups having one to three halogen atoms include
chloromethyl, fluoromethyl, 2-fluoroethyl, and trifluoromethyl.
Examples of the C.sub.1-8 alkoxy groups having one to three halogen
atoms include fluoromethoxy and trifluoromethoxy. Examples of the
alkoxycarbonyl groups having a C.sub.1-8 alkoxy group include
methoxycarbonyl and ethoxycarbonyl. Examples of the acyl groups
having a C.sub.1-8 alkyl group include acetyl. Examples of the
alkylaminocarbonyl groups having a C.sub.1-8 alkyl group include
methylaminocarbonyl and ethylaminocarbonyl. Examples of the
dialkylaminocarbonyl groups having C.sub.2-12 alkyl groups include
dimethylaminocarbonyl and diethylaminocarbonyl. Examples of the
alkoxycarbonylmethylcarbonyl groups having a C.sub.1-8 alkoxy group
include methoxycarbonyl-methylcarbonyl and
ethoxycarbonylmethylcarbonyl. Examples of the alkylsulfonylmethyl
groups having a C.sub.1-8 alkyl group include methanesulfonylmethyl
and ethanesulfonylmethyl. Examples of the C.sub.1-8 alkylamino
groups include methylamino and ethylamino. Examples of the
C.sub.2-12 dialkylamino groups include dimethylamino and
diethylamino. Examples of the C.sub.1-8 alkylsulfonylamino groups
include methanesulfonylamino and ethanesulfonylamino. Examples of
the acylamino groups having a C.sub.1-8 alkyl group include
acetylamino. Examples of the C.sub.1-8 alkylsulfinyl groups include
methanesulfinyl and ethanesulfinyl. Examples of the C.sub.1-8
alkylsulfonyl groups include methanesulfonyl and ethanesulfonyl.
Examples of the C.sub.1-8 alkylaminosulfonyl groups include
methylaminosulfonyl and ethylaminosulfonyl. Examples of the
C.sub.2-12 dialkylaminosulfonyl groups include
dimethylaminosulfonyl. Examples of the aryl groups include phenyl
and naphthyl.
[0105] In the formula (I) described in (A) or (B), examples of the
five-membered or six-membered heteroaryl groups of Ar, which
optionally has a substituent, include pyridyl.
[0106] In the formula (I) described in (A) or (B), examples of the
five-membered or six-membered heteroaryl groups of Z include
1,2,4-oxadiazolyl and pyrimidinyl.
[0107] In the formula (I) described in (A) or (B), examples of the
five-membered or six-membered heteroaryl groups of the substituent
for the aryl or five-membered or six-membered heteroaryl group of
Ar include tetrazolyl and 1,2,4-triazolyl.
[0108] In the formula (II) described in (C) or (D), examples of the
five-membered or six-membered heteroaryl groups of the substituent
for phenyl or pyridyl of Ar.sup.0 include tetrazolyl and
1,2,4-triazolyl.
[0109] The compound of the formula (I) described in (A) or (B), or
the cyclic amine derivative of the formula (II) described in (C) or
(D) can form a pharmaceutically acceptable salt with an organic or
inorganic acid such as hydrochloric acid, sulfuric acid, fumaric
acid, and oxalis acid.
[0110] The compound of the formula (I) described in (A) or (B), or
the cyclic amine derivative of the formula (II) described in (C) or
(D) include geometrical isomer such as cis and trans isomer,
racemic mixture, and enantiomer (optically active isomer).
[0111] The compound of the formula (I) described in (A) or (B), or
the cyclic amine derivative of the formula (II) described in (C) or
(D) include a hydrate and a solvate.
[0112] The process for preparation of the compound of the formula
(I) described in (A) or (B), the cyclic amine derivative of the
formula (II) described in (C) or (D), or a pharmaceutically
acceptable salt thereof is described below.
[0113] The following examples show the process for preparation of
the compound of the formula (I) described in (A) or (B) in which A
is O, each of X and Y is CH.sub.2CH.sub.2. The other compounds can
also be prepared according to analogous processes.
##STR00014##
<Method A>
##STR00015##
[0115] In the formulas, Halo is halogen such as chlorine, bromine
and iodine, and each of R.sup.1, R.sup.2, U, V, Z and Ar are
described above.
1) Starting Materials
[0116] The starting material (a) can be synthesized according to a
known method (cf., M. V. Chelliah et al., J. Med. Chem., 2007, 50,
5147; and WO 2006/114213) or an analogous method thereof. The
starting material (b) can also be synthesized according to a known
method (cf., D. J. Wustrow et al., Synthesis, 1991, 993) or an
analogous method thereof.
2) First Process
[0117] The condensation reaction of the starting material (a) with
the starting material (b) can be conducted in an inert solvent such
as toluene, tetrahydrofuran, dioxane and N,N-dimethylformamide, in
the presence of a base such as potassium carbonate, cesium
carbonate and sodium carbonate, using a catalyst such as
tetrakis(triphenylphosphine)palladium and
[1,1'-bis(diphenylphosphino)ferrocene]palladium(II) dichloride
dichloromethane complex, to give the compound of the formula (c).
The reaction temperature is in the range from 20 to 110.degree.
C.
3) Second Process
[0118] The compound of the formula (c) can be converted into the
compound of the formula (d) in an inert solvent such as methanol
and ethanol, in the presence of a catalyst such as palladium-carbon
according to a catalytic hydrogenation method.
4) Third Process
[0119] The compound of the formula (d) can be converted into the
compound of the formula (f) by a reaction of the compound (d) with
the compound of the formula (e) such as phenol and heteroaryl
alcohol, in an inert solvent such as tetrahydrofuran, dioxane and
toluene, in the presence of an azodicarboxylic ester such as
diisopropyl azodicarboxylate and diethyl azodicarboxylate, and a
phosphine such as triphenylphosphine. The reaction temperature is
in the range from 0 to 80.degree. C.
[0120] The intermediate of the formula (d) can also be synthesized
according to the following method B or C.
<Method B>
##STR00016##
[0122] In the formulas, Halo is halogen such as chlorine, bromine
and iodine, and each of R.sup.1, R.sup.2, U, V and Z are described
above.
1) Starting Material
[0123] The starting material (g) can be synthesized according to a
known method (cf., S., Billotte, Synlett, 1998, 379) or an
analogous method thereof.
2) First Process
[0124] The condensation reaction of the starting material (a) with
the starting material (g) can be conducted in an inert solvent such
as toluene, tetrahydrofuran and N,N-dimethylformamide, optionally
in the presence of an additive such as tri(2-furyl)phosphine, using
a catalyst such as tris(dibenzylideneacetone)palladium and
tetrakis(triphenylphosphine)palladium, to give the compound of the
formula (d). The reaction temperature is in the range from 20 to
110.degree. C.
<Method C>
##STR00017##
[0126] In the formulas, each of R.sup.1, R.sup.2, U, V and Z are
described above.
1) Starting Materials
[0127] The starting material (h) can be synthesized according to a
known method (cf., H. Azizian et al., J. Organomet. Chem., 1981,
215, 49; and C. Eaborn et al., J. Chem. Soc., 1962, 1131) or an
analogous method thereof. The starting material (i) can also be
synthesized according to a known method (cf., D. J. Wustrow et al.,
Synthesis, 1991, 993) or an analogous method thereof.
2) First Process
[0128] The condensation reaction of the starting material (h) with
the starting material (i) can be conducted in an inert solvent such
as toluene, tetrahydrofuran and N,N-dimethylformamide, using a
catalyst such as tetrakis(triphenylphosphine) palladium and
tris(dibenzylideneacetone)palladium, to give the compound of the
formula (d). The reaction temperature is in the range from 20 to
110.degree. C.
3) Second Process
[0129] The compound of the formula (j) can be converted into the
compound of the formula (d) in the same manner as in the
above-mentioned method A.
[0130] The compound of the formula (d) can also be converted into
the compound of the formula (f) according to the following method
D.
<Method D>
##STR00018## ##STR00019##
[0132] In the formulas, L is a halogen atom such as chlorine atom,
bromine atom, iodine atom or a leaving group such as
methanesulfonyloxy and p-toluenesulfonyloxy, and each of R.sup.1,
R.sup.2, U, V, Z and Ar are described above.
1) First Process
[0133] The compound of the formula (d) can be converted into the
compound of the formula (k) by a reaction of the compound (d) with
a reagent such as methanesulfonyl chloride, p-toluenesulfonyl
chloride and thionyl chloride, in an inert solvent such as toluene
and dichloromethane, optionally in the presence of a base such as
pyridine and triethylamine.
3) Second Process
[0134] The compound of the formula (k) can be converted into the
compound of the formula (f) by a reaction of the compound (k) with
a phenol or a heteroaryl alcohol represented by the formula (e) in
an inert solvent such as N,N-dimethylformamide and acetone, in the
presence of a base such as sodium hydride and potassium carbonate.
The reaction temperature is in the range from 0 to 80.degree.
C.
[0135] The compound of the formula (n), which is a compound of the
present invention and is an intermediate in preparation of the
compound represented by the formula (f), can also be prepared
according to the following method E.
<Method E>
##STR00020##
[0137] In the formulas, L is a halogen atom such as chlorine atom,
bromine atom, iodine atom or a leaving group such as
methanesulfonyloxy and p-toluenesulfonyloxy, and each of R.sup.1,
R.sup.2, U, V, Z and Ar are described above.
1) Starting Material
[0138] The starting material (1) can be synthesized according to a
known method (cf., EP 1555259) or an analogous method thereof.
2) First Process
[0139] The starting material (1) can be converted into the compound
of the formula (m) in the same manner as in the above-mentioned
method D.
3) Second Process
[0140] The compound of the formula (m) can be converted into the
compound of the formula (n) in the same manner as in the
above-mentioned method A.
4) Third Process
[0141] The compound of the formula (n) can be converted into the
compound of the formula (f) in the same manner as in the
above-mentioned method A.
[0142] The following examples show the process for preparation of
the compound of the formula (I) described in (A) or (B) in which B
is O or NH, each of X and Y is CH.sub.2CH.sub.2. The other
compounds can also be prepared according to analogous
processes.
##STR00021##
<Method F>
##STR00022## ##STR00023## ##STR00024##
[0144] In the formulas, Halo is halogen such as chlorine, bromine
and iodine, and each of Ar, B, R.sup.1, R.sup.2, U, V and Z are
described above.
1) First Process
[0145] (B is NH)
[0146] The compound of the formula (o) can be converted into the
compound of the formula (q) by a condensation of the compound (o)
with the aldehyde of the formula (p) in an inert solvent such as
tetrahydrofuran and acetonitrile, optionally in the presence of an
acid catalyst such as acetic acid and trifluoroacetic acid, and a
subsequent reaction of the resulting compound with a reagent such
as triethylsilane. The reaction temperature is in the range from 20
to 80.degree. C.
[0147] (B is O, and U is N)
[0148] The compound of the formula (r) can be converted into the
compound of the formula (t) by a reaction of the compound (r) with
the alcohol of the formula (s) in an inert solvent such as
tetrahydrofuran, toluene, and dichloromethane, in the presence of a
base such as potassium tert-butoxide and sodium hydride. The
reaction temperature is in the range from -20 to 110.degree. C.
[0149] (B is O, U is CH, and V is N)
[0150] The compound of the formula (u) can be converted into the
compound of the formula (v) by a reaction of the compound (u) with
the alcohol of the formula (s) in an inert solvent such as
tetrahydrofuran, dioxane, and toluene, in the presence of an
azodicarboxylic ester such as diethyl azodicarboxylate and
diisopropyl azodicarboxylate, and a phosphine such as
triphenylphosphine. The reaction temperature is in the range from 0
to 80.degree. C.
2) Second Process
[0151] The compound of the formula (q), (t) or (v) can be condensed
with the starting material (b) in the same manner as in the
above-mentioned method A.
3) Third Process
[0152] The compound of the formula (w) can be converted into the
compound of the formula (x) in an inert solvent such as methanol
and ethanol, in the presence of a catalyst such as platinum-carbon
and palladium-carbon, according to a catalytic hydrogenation
method.
[0153] The compound of the formula (I) described in (A) or (B) in
which B is NH can also be synthesized according to the following
method G.
<Method G>
##STR00025## ##STR00026## ##STR00027## ##STR00028## ##STR00029##
##STR00030##
[0155] In the formulas, Halo is halogen such as chlorine, bromine
and iodine, PG is a protective group such as tert-butoxycarbonyl
and benzyl, and each of Ar, R.sup.1, R.sup.2, U, V and Z are
described above.
1) First Process
[0156] The compound of the formula (o) can be converted into the
compound of the formula (z) by a condensation of the compound (o)
with the carboxylic acid of the formula (y) in an inert solvent
such as N,N-dimethylformamide and dichloromethane, in the presence
of a base such as N-methylmorpholine and triethylamine, a
condensing agent such as
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride
(WSC.HCl), and an additive such as 1-hydroxybenzotriazole. The
reaction temperature is in the range from 0 to 20.degree. C.
2) Second Process
[0157] The compound of the formula (z) can be condensed with the
starting material (aa) in the same manner as in the above-mentioned
method A.
3) Third Process
[0158] The compound of the formula (ab) can be converted into the
compound of the formula (ac) in the same manner as in the
above-mentioned method A.
4) Fourth Process
[0159] The protective group (PG) for amine can be cleaved from the
compound of the formula (ac) according to a conventional method.
When the protective group is tert-butoxycarbonyl, the group can be
cleaved by a reaction of an acid such as trifluoroacetic acid,
optionally in an inert solvent such as dichloromethane.
5) Fifth Process
[0160] The compound of the formula (ad) can be converted into the
compound of the formula (ae) using a reducing agent such as lithium
aluminum hydride, sodium bis(2-methoxyethoxy)aluminum hydride and
diborane, in an inert solvent such as tetrahydrofuran and
toluene.
6) Sixth Process
[0161] The compound of the formula (ae) can be converted into the
compound of the formula (ag) by a reaction of the compound (ae)
with the acid chloride of the formula (af) in an inert solvent such
as dichloromethane, tetrahydrofuran and toluene, in the presence of
a base such as triethylamine and pyridine. The reaction temperature
is in the range from 0 to 50.degree. C.
[0162] Examples of the representative compounds of the present
invention are shown below.
Representative Compound (1)
##STR00031##
[0164] In the formula, R.sup.31, R.sup.32, R.sup.33, A, B, Q and
R.sup.34 are set forth in Tables 1 to 5.
TABLE-US-00001 TABLE 1 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
4-CO.sub.2C.sub.2H.sub.5 -- 3'-CH.sub.3 O CH.sub.2 C(O)O Isopropyl
3-CH.sub.3 4-CN -- CH.sub.2 O C(O)O C.sub.2H.sub.5
4-SO.sub.2CH.sub.3 -- -- O CH.sub.2 C(O)O t-Butyl 2-CH.sub.3
4-SO.sub.2CH.sub.3 -- O CH.sub.2 C(O) CH.sub.2C(CH.sub.3).sub.3
4-CF.sub.3 -- -- O CH.sub.2 CH.sub.2C(O)NH CH.sub.3 4-S(O)CH.sub.3
-- -- O CH.sub.2 C(O)NH Isopropyl 3-F 4-SO.sub.2CH.sub.3 --
CH.sub.2 NC.sub.2H.sub.5 C(O)O Cyclopro* 4-SO.sub.2NH.sub.2 -- -- O
CH.sub.2 C(O)O Isopropyl (Remark) Cyclopro*: Cyclopropyl
TABLE-US-00002 TABLE 2 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
4-NHSO.sub.2CH.sub.3 -- 4'-CH.sub.3 O CH.sub.2 C(O)O t-Butyl
4-CH.sub.2SO.sub.2CH.sub.3 -- -- CH.sub.2 NH S(O).sub.2 Cyclohexyl
4-N(CH.sub.3).sub.2 -- -- CH.sub.2CH.sub.2 O C(O)O n-Butyl 2-F
4-SO.sub.2CH.sub.3 -- NH CH.sub.2 C(O)O t-Butyl
4-SO.sub.2NHC.sub.2H.sub.5 -- 6'-CH.sub.3 O CH.sub.2 C(O)O CH.sub.3
4-SO.sub.2CH.sub.3 -- -- CH.sub.2 NH C(O)O t-Butyl
TABLE-US-00003 TABLE 3 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
2-OCH.sub.3 4-CO.sub.2H -- O CH.sub.2CH.sub.2 C(O)O Benzyl
##STR00032## -- -- O CH.sub.2 ##STR00033## Iso- propyl
4-SO.sub.2C.sub.2H.sub.5 -- -- O CH.sub.2 ##STR00034## Ethyl
2-CF.sub.3 4- -- O CH.sub.2 C(O) Phenyl SO.sub.2CH.sub.3
TABLE-US-00004 TABLE 4 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
4-Phenoxy -- -- NCH.sub.3 CH.sub.2 C(O)O Phenethyl
3-OC.sub.2H.sub.5 -- -- CH.sub.2 CH.sub.2 C(O)O t-Butyl 4-Br --
3'-Cl Bond O C(O)O CH.sub.2CH=CH.sub.2 4-NO.sub.2 -- -- O CH.sub.2
C(O)NH Isopropyl 4-SO.sub.2-Phenyl -- -- O CH.sub.2 C(O)O
(CH.sub.2).sub.5CH.sub.3 4-CONHCH.sub.3 -- -- O CH.sub.2 C(O)O
t-Butyl 4-COCH.sub.2CO.sub.2CH.sub.3 -- -- O CH.sub.2 C(O)
CH.sub.2CH=C(CH.sub.3).sub.2
TABLE-US-00005 TABLE 5 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
2-CH.sub.3 4-SO.sub.2CH.sub.3 3'-Cl O CH.sub.2 C(O)O t-Butyl 2-Br
4-SO.sub.2CH.sub.3 3'-CF.sub.3 O CH.sub.2 C(O)O Isopropyl 2-Cl
4-SO.sub.2CH.sub.3 -- S CH.sub.2 C(O)O Isopentyl 2-F ##STR00035##
3'-Cl O CH.sub.2 C(O)O t-Butyl 2-F 4-SO.sub.2CH.sub.3 -- CH.sub.2
CH.sub.2 C(O)O t-Butyl 2-F 4-SO.sub.2CH.sub.3 3'-CH.sub.3 O
CH.sub.2 ##STR00036## C.sub.2H.sub.5 3-Cl 4-SO.sub.2CH.sub.3 -- O
CH.sub.2 C(O)O t-Butyl 3-CH.sub.3 4-SO.sub.2CH.sub.3 3'-F O
CH.sub.2 C(O)O t-Butyl 2-F 4-SO.sub.2CH.sub.3 3'-F O CH.sub.2
##STR00037## Isopropyl
Representative compound (2)
##STR00038##
[0165] In the formula, R.sup.31, R.sup.32, R.sup.33, A, B, Q and
R.sup.34 are set forth in Tables 6 to 8.
TABLE-US-00006 TABLE 6 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
4-CN -- 4'-CH.sub.3 O CH.sub.2 C(O)O C.sub.2H.sub.5 2-F -- --
CH.sub.2 O S(O).sub.2 n-Propyl 4-SO.sub.2CH.sub.3 -- -- O CH.sub.2
C(O)O t-Butyl 2-CH.sub.3 4-SO.sub.2C.sub.2H.sub.5 -- CH.sub.2 NH
C(O)O Isopropyl 4-S(O)CH.sub.3 -- -- NH CH.sub.2 C(O)O CH.sub.3
4-SO.sub.2NH.sub.2 -- -- O CH.sub.2 -- Cyclo- propyl
TABLE-US-00007 TABLE 7 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
4-NHSO.sub.2CH.sub.3 -- -- CH.sub.2 O C(O)O Iso- propyl 2-F
4-SO.sub.2CH.sub.3 6'-CH.sub.3 NH CH.sub.2 C(O)O Cyclo- pentyl 3-Br
-- -- O CH.sub.3 C(O)O Iso- propyl 4-CH.sub.2SO.sub.2CH.sub.3 -- --
O CH.sub.2 C(O)O t-Butyl ##STR00039## -- -- O CH.sub.2 C(O)
t-Butyl
TABLE-US-00008 TABLE 8 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
4-SO.sub.2CH.sub.3 -- 3'CH.sub.3 CH.sub.2 O ##STR00040## Isopropyl
4-COCH.sub.2CO.sub.2C.sub.2H.sub.5 -- -- O CH.sub.2 C(O) CH.sub.2C
(CH.sub.3).sub.3 4-SO.sub.2NHC.sub.2H.sub.5 -- -- O CH.sub.2
##STR00041## Isopropyl
Representative Compound (3)
##STR00042##
[0167] In the formula, R.sup.31, R.sup.32, R.sup.33, A, B, Q and
R.sup.34 are set forth in Tables 9 and 10.
TABLE-US-00009 TABLE 9 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
2-F 4-SO.sub.2CH.sub.3 -- O CH.sub.2 C(O)O Isopropyl 3-NHCOCH.sub.3
-- -- O CH.sub.2 C(O) n-Butyl 4-SO.sub.2CH.sub.3 -- -- O CH.sub.2
C(O)O t-Butyl 2-CON(CH.sub.3).sub.2 -- -- CH.sub.2 O C(O)O
Isopropyl 3-CO.sub.2-isopropyl -- -- NH CH.sub.2 C(O)O CH.sub.3
4-SO.sub.2NH.sub.2 -- -- O CH.sub.2 C(O)O Cyclo- propyl
TABLE-US-00010 TABLE 10 R.sup.31 R.sup.32 R.sup.33 A B Q R.sup.34
##STR00043## -- -- O CH.sub.2 C(O)O t-Butyl
4-COCH.sub.2CO.sub.2C.sub.2H.sub.5 -- -- O NH C(O) C.sub.2H.sub.5
4-SO.sub.2NHC.sub.2H.sub.5 -- -- O CH.sub.2 ##STR00044##
Isopropyl
Representative Compound (4)
##STR00045##
[0169] In the formula, Ar, A, B, U, V, Q and R.sup.34 are set forth
in Tables 11 and 12.
TABLE-US-00011 TABLE 11 Ar A B U V Q R.sup.34 ##STR00046## O
CH.sub.2 N CH C(O)O Isopropyl ##STR00047## O CH.sub.2 N CH C(O)O
t-Butyl ##STR00048## CH.sub.2 O CH N C(O)O t-Butyl ##STR00049##
CH.sub.2 NH CH N ##STR00050## Isopropyl
TABLE-US-00012 TABLE 12 Ar A B U V Q R.sup.34 ##STR00051## O
CH.sub.2 N CH C(O)O Isopropyl ##STR00052## O CH.sub.2 N N C(O)O
Isopropyl ##STR00053## CH.sub.2 O N N C(O)O t-Butyl
Representative Compound (5)
##STR00054##
[0171] In the formula, Ar, A, B, G, Q and R.sup.34 are set forth in
Tables 13 and 14.
TABLE-US-00013 TABLE 13 Ar A B G Q R.sup.34 ##STR00055## O CH.sub.2
##STR00056## C(O)O Iso- propyl ##STR00057## O CH.sub.2 ##STR00058##
C(O)O t-Butyl ##STR00059## O CH.sub.2 ##STR00060## C(O)O
t-Butyl
TABLE-US-00014 TABLE 14 Ar A B G Q R.sup.34 ##STR00061## CH.sub.2 O
##STR00062## ##STR00063## Isopropyl ##STR00064## O CH.sub.2
##STR00065## C(O)O t-Butyl ##STR00066## CH.sub.2 O ##STR00067##
C(O)O) t-Butyl
[0172] Representative compound (6)
##STR00068##
[0173] In the formula, R.sup.32, R.sup.35, R.sup.33, A, B, Q and
R.sup.34 are set forth in Table 15.
TABLE-US-00015 TABLE 15 R.sup.33 R.sup.35 R.sup.32 A B Q R.sup.34
3'-Cl 2-F 3-F O CH.sub.2 C(O)O t-Butyl -- 2-F 5-F O CH.sub.2 C(O)O
Isopropyl 3'-CH.sub.3 2-CH.sub.3 3-CH.sub.3 O CH.sub.2 C(O)O
t-Butyl -- 2-CH.sub.3 5-CH.sub.3 O CH.sub.2 C(O)O t-Butyl -- 2-F
5-CH.sub.3 CH.sub.2 CH.sub.2 C(O)O t-Butyl -- 2-F 3-F O CH.sub.2
C(O)O t-Butyl 3'-F 2-CH.sub.3 5-F O CH.sub.2 C(O)O Isopentyl -- 2-F
3-F O CH.sub.2 C(O)O t-Butyl -- 2-CH.sub.3 3-CH.sub.3 O CH.sub.2
C(O)O t-Butyl
[0174] The pharmacological tests are described below.
(Pharmacological Test A)
[0175] The GPR119 agonist effect was studied by measuring the
effect of an analyte on increase of intracellular amount of cAMP in
human GPR119 introduced cells. The testing method is described
below.
(1) Construction of the Stable Cell Line Expressing Human G
Protein-Coupled-Receptor 119 (hGPR119)
[0176] Human GPR119 gene (NM 178471) is purchased from American
Type Culture Collection (ATCC No. 10807349). Hind III site-added
forward side primer (tcctggatccatggaatcatctttctcatt: sequence No.
1) and Apa I site-added reverse side primer
(tcctgggcccttagccatcaaactctgagc: sequence No. 2) are designed. The
target gene is amplyfied by a polymerase chain reaction (PCR)
method using KOD-Plus-Ver. 2 (TOYOBO #KOD-211). PCR is conducted by
repeating three steps consisting of the step of 98.degree. C.-10
seconds, the step of 55.degree. C.-30 seconds, and the step of
68.degree. C.-1 minute and 10 seconds in 35 cycles. The amplified
PCR product is inserted into pcDNA5/FRT/TO (Invitrogen #V6520-20)
plasmid. Cells, which can constantly express the target gene with
tetracycline, are constructed using Flp-In T-REx-systen
(invitorogen).
(2) Measurement of Intracellular Cyclic Adenosine Monophosphate
(cAMP)
[0177] The hGPR119 introduced cells prepared in (1) are plated on a
96-well plate using Dulbecco's Modified Eagle Medium containing
heat-inactived 10% fetal bovine serum. After incubation of 24
hours, tetracyclin (invitrogen #Q10019) is added to the culture
medium to induce hGPR119 gene expression. After further incubation
of 24 hours, the cells are stimulated with 0.5 mM
3-ISOBUTYL-1-METHYLXANTHINE (Sigma #17018) phosphate buffer
containing the analyte at 37.degree. C. for 30 minutes. The amount
of the intracellular cAMP is measured by using FLUOstar Optima (BMG
LABTECH) according to the protocol of HitHunter.TM. cAMP XS+Assay
(GE Healthcare #90007503) to give the agonist activity of the
analyte to the GPR119 receptor.
(3) Experimental Results
[0178] As is evident from Table 16 of Example 86 described below,
the compounds of Examples 1 and 2 show an excellent GPR119 agonist
effect.
[0179] As is also evident from Table 17 of Example 87 described
below, the compounds of Examples 25, 83, or the like show an
excellent GPR119 agonist effect.
(Pharmacological Test B)
[0180] Oral glucose tolerance is tested in normal mice.
(1) Experimental Procedure
[0181] In this experiment, the inhibitory effect of an analyte on
glycemic excursions is examined after glucose administration in
normal mice. The test methods are described below.
[0182] Male 9-week-old ICR mice, habituated to the experimental
environment for two weeks, are fasted for 18 hours and used to this
experiment. Mice are orally administered the analyte or vehicle
(polyethylene glycol 400:ethanol:Tween 80=8:1:1). After 30 minutes,
they were orally given glucose at the dose of 3 g/kg.
[0183] Blood was collected at just before the analyte or vehicle
administration (-30 minutes), immediately before glucose challenge
(0 minute), 20 minutes, 40 minutes, 60 minutes, and 120 minutes
after glucose ingestion to determine blood glucose levels.
[0184] Inhibition rate (%) of the analyte versus vehicle in areas
under the glycemic excursion curve between 0 and 120 min after
glucose challenge is determined.
(2) Experimental Results
[0185] As is evident from Table 18 of Example 88 described below,
the compound of Example 1 shows a strong inhibitory effect on
glycemic excursions in oral glucose tolerance test of normal
mice.
[0186] As is described above, the compound represented by the
formula (I) described in (A) or (B), the cyclic amine derivative
represented by the formula (II) described in (C) or (D), or a
pharmaceutically acceptable salt thereof has a GPR119 agonist
effect. Therefore, they are expected to be used for treatment of
diabetes. They are also expected to be used for a life-style
related diseases such as obesity and metabolic syndrome.
[0187] The compound represented by the formula (I) described in (A)
or (B), the cyclic amine derivative represented by the formula (II)
described in (C) or (D), or a pharmaceutically acceptable salt
thereof can be used in combination with a conventional agent for
treatment of diabetes.
[0188] The compound represented by the formula (I) described in (A)
or (B), the cyclic amine derivative represented by the formula (II)
described in (C) or (D), or a pharmaceutically acceptable salt
thereof can be administered to human beings by suitable
administration methods such as oral administration or parenteral
administration.
[0189] The compound or salt can be granulated in suitable manners
for the preparation of pharmaceuticals. For instance, the compound
or salt can be processed to give tablets, granule, powder, capsule,
suspension, injection, suppository, and the like.
[0190] For the preparation of these pharmaceuticals, when they are
tablets, appropriate additives such as excipients, disintegrators,
binders, lubricants and dyes can be used. Lactose, D-mannitol,
crystalline cellulose and glucose can be used as the excipients.
Starch and carboxymethylcellulose calcium (CMC-Ca) can be used as
the disintegrators, magnesium stearate and talc as the lubricants.
Hydroxypropylcellulose (HPC), gelatin and polyvinylpyrrolidone
(PVP) can be used as the binders. For the preparation of injection,
a solvent, a stabilizer, a solubilizer, a suspending agent, an
emulsifier, an analgesic, a buffer and a preservative can be
used.
[0191] The compound represented by the formula (I) described in (A)
or (B), the cyclic amine derivative represented by the formula (II)
described in (C) or (D), or a pharmaceutically acceptable salt
thereof can be administered to an adult generally in an amount of
0.01 mg to 100 mg a day by injection and 1 mg to 2,000 mg a day by
oral administration. The dosage can be adjusted according to age
and conditions of the patient.
[0192] The invention is further described by the following
non-limiting examples.
EXAMPLES
Example 1
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1--
carboxylate
(1) Benzyl
4-[(2-hydroxymethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1-car-
boxylate
[0193] To a solution of 5-bromopyridin-2-methanol (100 mg, 0.532
mmol) and benzyl
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyr-
idine-1-carboxylate (200 mg, 0.585 mmol) in dry
N,N-dimethylformamide (1.3 mL)--dry tetrahydrofuran (1.3 mL) was
added [1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II)
(complex with dichloromethane) (22 mg, 0.027 mmol) and cesium
carbonate (347 mg, 1.06 mmol). The mixture was stirred at
90.degree. C. under N.sub.2 for 2.5 hours, allowed to cool to room
temperature, diluted with water (5 mL) and extracted with ethyl
acetate. The organic layer was washed with brine, dried over
anhydrous sodium sulfate and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=1/2) to give the title compound as an orange
oil (120 mg, yield 70%).
[0194] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0195] 2.5-2.6 (2H, m), 3.58 (1H, brs), 3.7-3.8 (2H, m), 4.1-4.2
(2H, m), 4.76 (2H, s), 5.18 (2H, s), 6.0-6.2 (1H, m), 7.22 (1H, d,
J=8 Hz), 7.3-7.4 (5H, m), 7.65 (1H, dd, J=2 Hz, 8 Hz), 8.57 (1H, d,
J=2 Hz).
(2) tert-Butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate
[0196] To a solution of benzyl
4-[(2-hydroxymethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
(527 mg, 1.63 mmol) in methanol (16 mL) was added 10%
palladium-carbon (105 mg). The mixture was hydrogenated at room
temperature for 17 hours and filtered through Celite pad. The
filtrate was concentrated under reduced pressure.
[0197] To a solution of the residue in tetrahydrofuran (8 mL) water
(8 mL) was added triethylamine (0.34 mL, 2.43 mmol) and
di-tert-butyl dicarbonate (390 mg, 1.79 mmol). The mixture was
stirred at room temperature for 10 minutes, diluted with water (15
mL) and extracted with ethyl acetate. The organic layer was washed
with brine, dried over anhydrous sodium sulfate and concentrated
under reduced pressure. The residue was purified by silica gel
column chromatography (hexane/ethyl
acetate=1/2-chloroform/methanol=30/1) to give the title compound as
a pale yellow oil (322 mg, yield 68%).
[0198] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0199] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 3.61 (1H, brs), 4.2-4.4 (2H, m), 4.74 (2H, s),
7.20 (1H, d, J=8 Hz), 7.51 (1H, dd, J=2 Hz, 8 Hz), 8.43 (1H, d, J=2
Hz).
(3) tert-Butyl
4-[2-(methanesulfonyloxymethyl)pyridin-5-yl]piperidine-1-carboxylate
[0200] To an ice-cooled solution of tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (100 mg,
0.342 mmol) in chloroform (2.4 mL) was added triethylamine (0.07
mL, 0.51 mmol) and then added dropwise a solution of
methanesulfonyl chloride (0.030 mL, 0.39 mmol) in chloroform (1
mL). The mixture was stirred at room temperature under N.sub.2 for
3 hours and concentrated under reduced pressure. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=9/1.fwdarw.ethyl acetate) to give the title compound as an
orange oil (59 mg, yield 47%).
[0201] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0202] 1.49 (9H, s), 1.6-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 3.09 (3H, s), 4.2-4.3 (2H, m), 5.31 (2H, s),
7.42 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 8.48 (1H, d, J=2
Hz).
(4) tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e
[0203] A solution of 4-(methanesulfonyl)phenol (25 mg, 0.14 mmol)
in dry tetrahydrofuran (0.5 mL) was added dropwise over 5 minutes
to an ice-cooled suspension of sodium hydride (55% dispersion in
mineral oil, 10 mg, 0.22 mmol) in dry tetrahydrofuran (0.5 mL).
After stirring for an additional 20 minutes under N.sub.2, a
solution of tert-butyl
4-[2-(methanesulfonyloxymethyl)pyridine-5-yl]piperidine-1-carboxylate
(59 mg, 0.16 mmol) in dry tetrahydrofuran (0.5 mL) was added
dropwise over 5 minutes to the mixture. The resulting mixture was
stirred at room temperature for 2 hours and then refluxed
overnight, to which was added saturated aqueous ammonium chloride
solution and extracted with ethyl acetate. The organic layer was
washed with brine, dried over anhydrous sodium sulfate and
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=1/2) to give
a white solid. The solid was dissolved in ethyl acetate and
extracted with 1N hydrochloric acid. The aqueous layer was
neutralized by adding 1N sodium hydroxide and extracted with ethyl
acetate. The organic layer was washed with brine, dried over
anhydrous sodium sulfate and concentrated under reduced pressure to
give the title compound as a white crystal (7.5 mg, yield 11%).
[0204] FAB-MS (m/z): 447 (M+1)
[0205] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0206] 1.48 (9H, s), 1.6-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 3.03 (3H, s), 4.2-4.4 (2H, m), 5.25 (2H, s),
7.12 (2H, d, J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8
Hz), 7.87 (2H, d, J=9 Hz), 8.48 (1H, d, J=2 Hz).
Example 2
tert-Butyl
4-[5-(4-methanesulfonylphenoxymethyl)pyridin-2-yl]piperidine-1--
carboxylate
(1) Benzyl
4-[(5-hydroxymethyl)pyridin-2-yl]-3,6-dihydro-2H-pyridine-1-car-
boxylate
[0207] The title compound was prepared from
2-bromopyridin-5-methanol (219 mg, 1.17 mmol) following a procedure
analogous to that in Example 1(1) as a yellow oil (330 mg, yield
87%).
[0208] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0209] 2.11 (1H, brs), 2.6-2.7 (2H, m), 3.7-3.8 (2H, m), 4.2-4.3
(2H, m), 4.72 (2H, brs), 5.18 (2H, s), 6.5-6.6 (1H, m), 7.3-7.4
(5H, m), 7.69 (1H, dd, J=2 Hz, 8 Hz), 8.01 (1H, d, J=8 Hz), 8.53
(1H, d, J=2 Hz).
(2) tert-Butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate
[0210] The title compound was prepared from benzyl
4-[(5-hydroxymethyl)pyridin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
(330 mg, 1.02 mmol) following a procedure analogous to that in
Example 1(2) as a colorless oil (172 mg, yield 58%).
[0211] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0212] 1.47 (9H, s), 1.6-1.8 (2H, m), 1.8-2.0 (2H, m), 2.7-2.9 (3H,
m), 4.2-4.3 (2H, m), 4.71 (2H, s), 7.16 (1H, d, J=8 Hz), 7.67 (1H,
dd, J=2 Hz, 8 Hz), 8.52 (1H, d, J=2 Hz).
(3) tert-Butyl
4-[5-(4-methanesulfonylphenoxymethyl)pyridin-2-yl]piperidine-1-carboxylat-
e
[0213] Diethyl azodicarboxylate (2.2M in toluene, 0.17 mL) was
added dropwise under N.sub.2 to an ice-cooled solution of
tert-butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate (100 mg,
0.342 mmol), 4-(methanesulfonyl)phenol (65 mg, 0.38 mmol) and
triphenylphosphine (99 mg, 0.38 mmol) in dry tetrahydrofuran (1.7
mL). The mixture was stirred at room temperature for 26 hours, and
toluene (5 mL) and cyclohexane (5 mL) was added. The resulting
mixture was stirred for an additional 3 hours, washed with 1N
sodium hydroxide, dried over anhydrous sodium sulfate and
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (hexane/ethyl
acetate=15/85.fwdarw.ethyl acetate) to give the title compound as a
white crystal (59 mg, yield 39%).
[0214] FAB-MS (m/z): 447 (M+1)
[0215] m.p.: 140-142.degree. C.
[0216] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0217] 1.48 (9H, s), 1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.8-3.0 (3H,
m), 3.04 (3H, s), 4.2-4.4 (2H, m), 5.13 (2H, s), 7.10 (2H, d, J=9
Hz), 7.21 (1H, d, J=8 Hz), 7.72 (1H, dd, J=2 Hz, 8 Hz), 7.89 (2H,
d, J=9 Hz), 8.60 (1H, d, J=2 Hz).
[0218] IR (KBr, cm.sup.-1)
[0219] :2976, 2922, 1699, 1678, 1595, 1577, 1498, 1423, 1406, 1365,
1317, 1 298, 1254, 1173, 1147, 1117, 1095, 1016, 960, 835, 769,
544, 525.
Example 3
tert-Butyl
4-[2-(4-methanesulfonylbenzylamino)pyridin-5-yl]piperidine-1-ca-
rboxylate
(1) N-(5-Bromopyridin-2-yl)-4-methanesulfonylbenzamide
[0220] To a solution of 4-methanesulfonylbenzoic acid (100 mg, 0.50
mmol) and 2-amino-5-bromopyridine (104 mg, 0.60 mmol) in dry
dichloromethane (10 mL) was added 4-(dimethylamino)pyridine (67 mg,
0.55 mmol) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
hydrochloride (105 mg, 0.55 mmol). The mixture was stirred at room
temperature overnight under N.sub.2, diluted with water (10 mL) and
extracted with ethyl acetate. The organic layer was washed with
brine, dried over anhydrous sodium sulfate and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (chloroform/ethyl acetate=3/1) to give the title
compound as a white crystal (56 mg, yield 32%).
[0221] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0222] 3.10 (3H, s), 7.90 (1H, dd, J=2 Hz, 9 Hz), 8.10 (4H, s),
8.32 (1H, d, J=9 Hz), 8.39 (1H, d, J=2 Hz), 8.55 (1H, brs).
(2) tert-Butyl
4-[2-(4-methanesulfonylbenzoylamino)pyridin-5-yl]-3,6-dihydro-2H-pyridine-
-1-carboxylate
[0223] To a solution of
N-(5-bromopyridin-2-yl)-4-methanesulfonylbenzamide (287 mg, 0.81
mmol) and tert-butyl
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-
-carboxylate (305 mg, 0.97 mmol) in dry N,N-dimethylformamide (10
mL) was added
[1,1-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (complex
with dichloromethane) (33 mg, 0.040 mmol) and cesium carbonate (527
mg, 1.6 mmol). The mixture was stirred at 90.degree. C. overnight
under N.sub.2, allowed to cool to room temperature, diluted with
water (10 mL) and extracted with ethyl acetate. The organic layer
was washed with brine, dried over anhydrous sodium sulfate and
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=1/2) to give
the title compound as a white crystal (83 mg, yield 22%).
[0224] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0225] 1.50 (9H, s), 2.4-2.6 (2H, m), 3.10 (3H, s), 3.6-3.7 (2H,
m), 4.0-4.2 (2H, m), 6.0-6.2 (1H, m), 7.78 (1H, dd, J=2 Hz, 9 Hz),
8.09 (2H, d, J=8 Hz), 8.12 (2H, d, J=8 Hz), 8.31 (1H, d, J=2 Hz),
8.34 (1H, d, J=9 Hz), 8.79 (1H, brs).
(3) tert-Butyl
4-[2-(4-methanesulfonylbenzoylamino)pyridin-5-yl]piperidine-1-carboxylate
[0226] To a solution of tert-butyl
4-[2-(4-methanesulfonylbenzoylamino)pyridin-5-yl]-3,6-dihydro-2H-pyridine-
-1-carboxylate (83 mg, 0.18 mmol) in methanol (2 mL) was added 10%
palladium-carbon (8.3 mg). The mixture was hydrogenated at room
temperature for 4 hours and filtered through Celite pad. The
filtrate was concentrated under reduced pressure. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=2/3) to give the title compound as a white crystal (47 mg,
yield 57%).
[0227] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0228] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.5-2.8 (1H,
m), 2.7-2.9 (2H, m), 3.10 (3H, s), 4.2-4.4 (2H, m), 7.63 (1H, dd,
J=2 Hz, 8 Hz), 8.0-8.2 (5H, m), 8.31 (1H, d, J=8 Hz), 9.03 (1H,
brs).
(4) tert-Butyl
4-[2-(4-methanesulfonylbenzylamino)pyridin-5-yl]piperidine-1-carboxylate
[0229] To a solution of tert-butyl
4-[2-(4-methanesulfonylbenzoylamino)pyridin-5-yl]piperidine-1-carboxylate
(47 mg, 0.10 mmol) in dichloromethane (1 mL) was added
trifluoroacetic acid (1 mL). The mixture was stirred at room
temperature for 30 minutes, diluted with water (10 mL) and
extracted with ethyl acetate. To the aqueous layer was added 30%
ammonia solution (3 mL) and extracted with ethyl acetate. The
combined organic layer was washed with brine, dried over anhydrous
sodium sulfate and concentrated under reduced pressure.
[0230] A solution of the residue in dry tetrahydrofuran (1 mL) was
added dropwise under N.sub.2 to a suspension of lithium aluminum
hydride (4.7 mg, 0.12 mmol) in dry tetrahydrofuran (2 mL). The
mixture was stirred at 80.degree. C. for 17 hours and cooled in an
ice bath followed by the addition of diethyl ether (5 mL) and
aqueous sodium sulfate solution. The resulting mixture was stirred
for 5 minutes, filtered through Celite pad and the filtrate was
concentrated under reduced pressure.
[0231] The residue was dissolved in tetrahydrofuran (1 mL)--water
(1 mL), and was added triethylamine (21 .mu.L, 0.15 mmol) and
di-tert-butyl dicarbonate (22 mg, 0.10 mmol). The mixture was
stirred at room temperature for 17 hours, diluted with water (5 mL)
and extracted with ethyl acetate. The organic layer was washed with
brine, dried over anhydrous sodium sulfate and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=2/1) to give the title
compound as a white amorphous (4.3 mg, yield 9%).
[0232] FAB-MS (m/z): 446 (M+1)
[0233] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0234] 1.47 (9H, s), 1.5-1.7 (2H, m), 1.7-1.8 (2H, m), 2.5-2.6 (1H,
m), 2.7-2.9 (2H, m), 3.04 (3H, s), 4.1-4.4 (2H, m), 4.64 (2H, d,
J=6 Hz), 4.9-5.0 (1H, m), 6.35 (1H, d, J=8 Hz), 7.2-7.3 (1H, m),
7.55 (2H, d, J=8 Hz), 7.89 (2H, d, J=8 Hz), 7.96 (1H, d, J=2
Hz).
Example 4
tert-Butyl
4-[6-(4-methanesulfonylphenoxymethyl)pyridazin-3-yl]-3,6-dihydr-
o-2H-pyridine-1-carboxylate
(1) 3-Chloro-6-(4-methanesulfonylphenoxymethyl)pyridazine
[0235] To a solution of potassium 4-(methanesulfonyl)phenolate (150
mg, 0.713 mmol) in N,N-dimethylformamide (2 mL) was added a
solution of 3-bromomethyl-6-chloropyridazine (221 mg, 1.07 mmol) in
N,N-dimethylformamide (2 mL). The mixture was stirred at room
temperature for 2.5 hours, poured into water and extracted with
ethyl acetate. The organic layer was washed with brine, dried over
anhydrous sodium sulfate and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=1/1.fwdarw.2/3) to give the title compound as
a white crystal (148 mg, yield 69%).
[0236] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0237] 3.04 (3H, s), 5.50 (2H, s), 7.14 (2H, d, J=9 Hz), 7.59 (1H,
d, J=9 Hz), 7.70 (1H, d, J=9 Hz), 7.90 (2H, d, J=9 Hz).
(2) tert-Butyl
4-[6-(4-methanesulfonylphenoxymethyl)pyridazin-3-yl]-3,6-dihydro-2H-pyrid-
ine-1-carboxylate
[0238] To a solution of
3-chloro-6-(4-methanesulfonylphenoxymethyl)pyridazine (79 mg, 0.26
mmol) and tert-butyl
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-
-carboxylate (82 mg, 0.26 mmol) in dry N,N-dimethylformamide (3 mL)
was added tetrakis(triphenylphosphine)palladium (9.0 mg, 7.9
.mu.mol) and cesium carbonate (129 mg, 0.397 mmol). The mixture was
stirred at 80.degree. C. for 2 hours, allowed to cool to room
temperature, poured into water and extracted with ethyl acetate.
The organic layer was washed with brine, dried over anhydrous
sodium sulfate and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (chloroform/ethyl
acetate=10/1 and hexane/ethyl acetate=1/2) to give the title
compound as a white crystal (16 mg, yield 14%).
[0239] FAB-MS (m/z): 446 (M+1)
[0240] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0241] 1.50 (9H, s), 2.7-2.9 (2H, m), 3.03 (3H, s), 3.6-3.8 (2H,
m), 4.1-4.3 (2H, m), 5.51 (2H, s), 6.67 (1H, brs), 7.15 (2H, d, J=9
Hz), 7.63 (2H, s), 7.88 (2H, d, J=9 Hz).
Example 5
tert-Butyl
4-[6-(4-methanesulfonylphenoxymethyl)pyridazin-3-yl]piperidine--
1-carboxylate
[0242] The title compound was prepared from tert-butyl
4-[6-(4-methanesulfonylphenoxymethyl)pyridazin-3-yl]-3,6-dihydro-2H-pyrid-
ine-1-carboxylate (Example 4) (14 mg, 31.4 .mu.mol) following a
procedure analogous to that in Example 3(3) as a white crystal (10
mg, yield 73%).
[0243] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0244] 1.48 (9H, s), 1.7-1.9 (2H, m), 1.9-2.1 (2H, m), 2.8-3.0 (2H,
m), 3.03 (3H, s), 3.0-3.2 (1H, m), 4.2-4.4 (2H, m), 5.49 (2H, s),
7.15 (2H, d, J=9 Hz), 7.39 (1H, d, J=9 Hz), 7.63 (1H, d, J=9 Hz),
7.89 (2H, d, J=9 Hz).
Example 6
tert-Butyl
4-[2-(4-methanesulfonylbenzyloxy)pyridin-5-yl]-3,6-dihydro-2H-p-
yridine-1-carboxylate
(1) 5-Bromo-2-(4-methanesulfonylbenzyloxy)pyridine
[0245] A solution of 2,5-dibromopyridine (474 mg, 2.00 mmol) and
4-(methanesulfonyl)benzyl alcohol (372 mg, 2.00 mmol) in
tetrahydrofuran (5 mL) was cooled to -15.degree. C. under N.sub.2
and potassium tert-butoxide (1.0M in tetrahydrofuran, 2.2 mL, 2.20
mmol) was added dropwise over 10 minutes. The mixture was stirred
at 0.degree. C. for 5.5 hours, poured into saturated aqueous
ammonium chloride solution and extracted with ethyl acetate. The
organic layer was washed with brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=1/1) to give the title compound (210 mg, yield 31%).
[0246] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0247] 3.05 (3H, s), 5.45 (2H, s), 6.76 (1H, d, J=9 Hz), 7.63 (2H,
d, J=9 Hz), 7.69 (1H, dd, J=2 Hz, 9 Hz), 7.94 (2H, d, J=9 Hz), 8.19
(1H, d, J=2 Hz).
(2) tert-Butyl
4-[2-(4-methanesulfonylbenzyloxy)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1--
carboxylate
[0248] The title compound was prepared from
5-bromo-2-(4-methanesulfonylbenzyloxy)pyridine (50 mg, 0.146 mmol)
following a procedure analogous to that in Example 3(2) as a white
crystal (25 mg, yield 39%).
[0249] FAB-MS (m/z): 445 (M+1)
[0250] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0251] 1.49 (9H, s), 2.4-2.6 (2H, m), 3.04 (3H, s), 3.6-3.7 (2H,
m), 4.0-4.1 (2H, m), 5.49 (2H, s), 5.97 (1H, brs), 6.82 (1H, d, J=8
Hz), 7.6-7.7 (3H, m), 7.94 (2H, d, J=9 Hz), 8.14 (1H, d, J=2
Hz).
Example 7
tert-Butyl
4-[2-(4-methanesulfonylbenzyloxy)pyridin-5-yl]piperidine-1-carb-
oxylate
[0252] To a solution of tert-butyl
4-[2-(4-methanesulfonylbenzyloxy)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1--
carboxylate (Example 6) (39 mg, 87.7 .mu.mol) in methanol (2 mL)
was added 10% platinum-carbon (15 mg). The mixture was hydrogenated
at room temperature for 17 hours and filtered through Celite pad.
The filtrate was concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (hexane/ethyl
acetate=1/1) to give the title compound as a white crystal (20 mg,
yield 51%).
[0253] FAB-MS (m/z): 447 (M+1)
[0254] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0255] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.5-2.7 (1H,
m), 2.7-2.9 (2H, m), 3.05 (3H, s), 4.1-4.4 (2H, m), 5.46 (2H, s),
6.80 (1H, d, J=8 Hz), 7.47 (1H, dd, J=2 Hz, 8 Hz), 7.64 (2H, d, J=8
Hz), 7.94 (2H, d, J=8 Hz), 7.99 (1H, d, J=2 Hz).
Example 8
5-[1-(5-Isopropyl-1,2,4-oxadiazol-3-yl)piperidin-4-yl]-2-(4-methanesulfony-
lphenoxymethyl)pyridine
(1)
4-[2-(4-Methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine
[0256] To a solution of tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (164 mg, 0.367 mmol) in dichloromethane (1.5 mL) was
added trifluoroacetic acid (1.5 mL). The mixture was stirred at
room temperature overnight and was then concentrated in vacuo. To
the residue was added saturated aqueous sodium hydrogen carbonate
solution and extracted with chloroform. The organic layer was dried
over anhydrous sodium sulfate and concentrated under reduced
pressure to give the title compound (125 mg, yield 98%).
[0257] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0258] 1.6-1.8 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H, m), 3.03 (3H,
s), 3.1-3.3 (2H, m), 5.25 (2H, s), 7.12 (2H, d, J=9 Hz), 7.41 (1H,
d, J=8 Hz), 7.59 (1H, dd, J=2 Hz, 8 Hz), 7.86 (2H, d, J=9 Hz), 8.49
(1H, d, J=2 Hz).
(2)
4-[2-(4-Methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-carbonit-
rile
[0259] To a solution of
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine (124
mg, 0.358 mmol) in dichloromethane (1 mL) was added a solution of
sodium hydrogen carbonate (60 mg, 0.716 mmol) in water (0.5 mL).
The mixture was cooled in an ice bath followed by the addition of a
solution of cyanogen bromide (45 mg, 0.430 mmol) in dichloromethane
(1 mL). The mixture was stirred at 0.degree. C. for 30 minutes and
then stirred at room temperature for an additional 1 hour. The
mixture was poured into saturated aqueous sodium hydrogen carbonate
solution and extracted with chloroform. The organic layer was dried
over anhydrous sodium sulfate and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (ethyl acetate) to give the title compound (114 mg,
yield 86%).
[0260] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0261] 1.8-2.0 (4H, m), 2.6-2.8 (1H, m), 3.03 (3H, s), 3.1-3.3 (2H,
m), 3.5-3.7 (2H, m), 5.26 (2H, s), 7.12 (2H, d, J=9 Hz), 7.46 (1H,
d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 7.87 (2H, d, J=9 Hz), 8.48
(1H, d, J=2 Hz).
(3)
N-Hydroxy-4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin--
1-carboxamidine
[0262] To a solution of
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-carbonitril-
e (92 mg, 0.248 mmol) in ethanol (0.8 mL) was added 50%
hydroxylamine solution (0.2 mL). The mixture was stirred at
60.degree. C. for 4 hours, allowed to cool to room temperature and
concentrated under reduced pressure to give the title compound (98
mg, yield 98%).
[0263] FAB-MS (m/z): 405 (M+1)
(4)
5-[1-(5-Isopropyl-1,2,4-oxadiazol-3-yl)piperidin-4-yl]-2-(4-methanesul-
fonylphenoxymethyl)pyridine
[0264] A solution of
N-hydroxy-4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-c-
arboxamidine (98 mg, 0.242 mmol), isobutyric acid (22 .mu.L, 0.242
mmol) and 1-hydroxybenzotriazole monohydrate (41 mg, 0.267 mmol) in
N,N-dimethylformamide (2 mL) was cooled in an ice bath followed by
the addition of N,N-diisopropylethylamine (0.14 mL, 0.800 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (55 mg,
0.291 mmol). The mixture was stirred at room temperature overnight,
poured into saturated aqueous sodium hydrogen carbonate solution
and extracted with ethyl acetate. The organic layer was dried over
anhydrous sodium sulfate and concentrated under reduced pressure. A
suspension of the residue in toluene (4 mL) was refluxed for 2
hours, allowed to cool to room temperature and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=1/2.fwdarw.1/5) to give a
crystal. The crystal was recrystallized from ethyl acetate/hexane
to give the title compound as a white crystal (59 mg, yield
53%).
[0265] FAB-MS (m/z): 457 (M+1)
[0266] m.p.: 143-145.degree. C.
[0267] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0268] 1.36 (6H, d, J=7 Hz), 1.7-2.0 (4H, m), 2.7-2.9 (1H, m),
2.9-3.2 (3H, m), 3.03 (3H, s), 4.1-4.3 (2H, m), 5.25 (2H, s), 7.12
(2H, d, J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz),
7.87 (2H, d, J=9 Hz), 8.50 (1H, d, J=2 Hz).
[0269] IR (KBr, cm.sup.-1)
[0270] :2976, 2925, 2836, 1579, 1541, 1498, 1458, 1406, 1387, 1292,
1246, 1 140, 1093, 1039, 1007, 972, 910, 833, 771, 550, 526.
Example 9
tert-Butyl
4-[2-(4-ethoxycarbonyl-3-fluorophenoxymethyl)pyridin-5-yl]piper-
idine-1-carboxylate
[0271] Diethyl azodicarboxylate (2.2M in toluene, 0.19 mL, 0.411
mmol) was added dropwise under N.sub.2 to an ice-cooled solution of
ethyl 2-fluoro-4-hydroxybenzoate (76 mg, 0.411 mmol), tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (80 mg,
0.274 mmol) and triphenylphosphine (108 mg, 0.411 mmol) in dry
tetrahydrofuran (2.1 mL). The mixture was stirred at room
temperature overnight, poured into water and extracted with ethyl
acetate. The organic layer was washed with brine, dried over
anhydrous sodium sulfate and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=3/1.fwdarw.1/2) to give the title compound as
a pale yellow crystal (71 mg, yield 56%).
[0272] FAB-MS (m/z): 459 (M+1)
[0273] m.p.: 92-95.degree. C.
[0274] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0275] 1.37 (3H, t, J=7 Hz), 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9
(2H, m), 2.6-2.9 (3H, m), 4.2-4.4 (2H, m), 4.35 (2H, q, J=7 Hz),
5.22 (2H, s), 6.73 (1H, dd, J=2 Hz, 12 Hz), 6.81 (1H, dd, J=2 Hz, 8
Hz), 7.42 (1H, d, J=8 Hz), 7.57 (1H, dd, J=2 Hz, 8 Hz), 7.90 (1H,
t, J=8 Hz), 8.48 (1H, d, J=2 Hz)
[0276] IR (KBr, cm.sup.-1)
[0277] :2978, 2856, 1705, 1684, 1622, 1576, 1508, 1456, 1429, 1363,
1340, 1 273, 1238, 1176, 1128, 1086, 1041, 1018, 976, 862, 843,
771, 688.
Example 10
tert-Butyl
4-[2-(4-carboxy-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-
-carboxylate
[0278] To a solution of tert-butyl
4-[2-(4-ethoxycarbonyl-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-ca-
rboxylate (Example 9) (60 mg, 0.131 mmol) in ethanol (0.9 mL)-water
(0.2 mL) was added lithium hydroxide monohydrate (16 mg, 0.393
mmol). The mixture was stirred at room temperature overnight,
diluted with water, neutralized by the addition of 1N hydrochloric
acid and then extracted with chloroform. The organic layer was
washed with brine, dried over anhydrous sodium sulfate and
concentrated under reduced pressure to give the title compound as a
white crystal (57 mg, quantitative yield).
[0279] FAB-MS (m/z): 431 (M+1)
[0280] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0281] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H,
m), 4.2-4.4 (2H, m), 5.29 (2H, s), 6.77 (1H, dd, J=2 Hz, 13 Hz),
6.85 (1H, dd, J=2 Hz, 9 Hz), 7.48 (1H, d, J=8 Hz), 7.64 (1H, d, J=8
Hz), 7.96 (1H, t, J=9 Hz), 8.51 (1H, brs).
[0282] IR (KBr, cm.sup.-1)
[0283] :2974, 2929, 2850, 1691, 1620, 1576, 1508, 1450, 1419, 1365,
1342, 1 298, 1277, 1232, 1173, 1155, 1117, 1093, 1043, 1020, 978,
943, 891, 8 49, 771, 752, 640, 607.
Example 11
tert-Butyl
4-[2-(2,6-dimethyl-4-methanesulfonylphenoxymethyl)pyridin-5-yl]-
piperidine-1-carboxylate
[0284] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (50 mg, 0.171 mmol) and
2,6-dimethyl-4-(methanesulfonyl)phenol (51 mg, 0.257 mmol)
following a procedure analogous to that in Example 9 as a colorless
oil (13 mg, yield 15%).
[0285] FAB-MS (m/z): 447 (M+1)
[0286] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0287] 1.48 (9H, s), 1.6-1.7 (2H, m), 1.8-1.9 (2H, m), 2.37 (6H,
s), 2.6-2.8 (1H, m), 2.7-2.9 (2H, m), 3.03 (3H, s), 4.2-4.4 (2H,
m), 5.25 (2H, s), 7.12 (2H, d, J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.56
(1H, dd, J=2 Hz, 8 Hz), 7.87 (2H, d, J=9 Hz), 8.48 (1H, d, J=2
Hz).
Example 12
tert-Butyl
4-[2-(2-fluoro-4-methanesulfonylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0288] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (33 mg, 0.113 mmol) and 2-fluoro-4-(methanesulfonyl)phenol
(32 mg, 0.170 mmol) following a procedure analogous to that in
Example 9 as a white crystal (18 mg, yield 33%).
[0289] FAB-MS (m/z): 465 (M+1)
[0290] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0291] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.04 (3H, s), 4.2-4.4 (2H, m), 5.32 (2H, s), 7.19 (1H, t, J=8
Hz), 7.47 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 7.6-7.7
(2H, m), 8.47 (1H, d, J=2 Hz).
[0292] IR (KBr, cm.sup.-1)
[0293] :2978, 2927, 2850, 1680, 1606, 1576, 1512, 1450, 1429, 1365,
1327, 1 304, 1238, 1178, 1147, 1128, 1076, 1036, 1005, 968, 906,
837, 766, 60 2, 534, 494.
Example 13
tert-Butyl
4-[2-(4-cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-c-
arboxylate
[0294] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (30 mg, 0.103 mmol) and 2-fluoro-4-hydroxybenzonitrile (21
mg, 0.155 mmol) following a procedure analogous to that in Example
9 as a pale yellow crystal (18 mg, yield 42%).
[0295] FAB-MS (m/z): 412 (M+1)
[0296] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0297] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 4.2-4.4 (2H, m), 5.23 (2H, s), 6.82 (1H, dd, J=2 Hz, 11 Hz),
6.87 (1H, dd, J=2 Hz, 8 Hz), 7.41 (1H, d, J=8 Hz), 7.52 (1H, t, J=8
Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 8.48 (1H, brs).
[0298] IR (KBr, cm.sup.-1):
[0299] 2976, 2943, 2918, 2229, 1699, 1620, 1574, 1506, 1444, 1417,
1365, 1 335, 1302, 1254, 1238, 1205, 1174, 1126, 1101, 1061, 1043,
1011, 976, 864, 825, 769, 737, 625.
Example 14
tert-Butyl
4-[2-(4-acetylaminophenoxymethyl)pyridin-5-yl]piperidine-1-carb-
oxylate
[0300] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (30 mg, 0.103 mmol) and N-(4-hydroxyphenyl)acetamide (23 mg,
0.155 mmol) following a procedure analogous to that in Example 9 as
a white crystal (19 mg, yield 44%).
[0301] FAB-MS (m/z): 426 (M+1)
[0302] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0303] 1.48 (9H, s), 1.5-1.9 (4H, m), 2.15 (3H, s), 2.6-2.9 (3H,
m), 4.1-4.4 (2H, m), 5.17 (2H, s), 6.94 (2H, d, J=9 Hz), 7.09 (1H,
brs), 7.38 (2H, d, J=9 Hz), 7.45 (1H, d, J=8 Hz), 7.55 (1H, d, J=8
Hz), 8.45 (1H, brs).
[0304] IR (KBr, cm.sup.1)
[0305] :3309, 2927, 1685, 1655, 1601, 1541, 1510, 1479, 1458, 1437,
1363, 1 300, 1277, 1236, 1174, 1126, 1055, 1012, 935, 883, 860,
827, 769, 520.
Example 15
tert-Butyl
4-[2-[3-fluoro-4-((R)-2-hydroxy-1-methylethyl-carbamoyl)phenoxy-
methyl]pyridin-5-yl]piperidine-1-carboxylate
[0306] A solution of tert-butyl
4-[2-(4-carboxy-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-carboxyla-
te (Example 10) (21 mg, 0.049 mmol), 1-hydroxybenzotriazole
monohydrate (9.3 mg, 0.061 mmol) and
1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (12 mg,
0.061 mmol) in dry tetrahydrofuran (0.5 mL) was stirred at room
temperature for 1 hour followed by the addition of a solution of
(S)-(+)-2-amino-1-propanol (7.6 .mu.L, 0.098 mmol) in dry
tetrahydrofuran (0.05 mL). The mixture was stirred at room
temperature overnight, to which was added saturated aqueous sodium
hydrogen carbonate solution and extracted with chloroform. The
organic layer was washed with brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure. The residue was
purified by silica gel column chromatography
(chloroform/methanol=100/1) to give the title compound as a white
crystal (21 mg, yield 86%).
[0307] FAB-MS (m/z): 488 (M+1)
[0308] .sup.1H NMR (CDCl.sub.3,400 MHz): .delta.=
[0309] 1.28 (3H, d, J=7 Hz), 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9
(2H, m), 2.6-2.9 (4H, m), 3.6-3.7 (1H, m), 3.7-3.8 (1H, m), 4.2-4.4
(3H, m), 5.22 (2H, s), 6.72 (1H, dd, J=2 Hz, 14 Hz), 6.7-6.8 (1H,
m), 6.87 (1H, dd, J=2 Hz, 9 Hz), 7.43 (1H, d, J=8 Hz), 7.57 (1H,
dd, J=2 Hz, 8 Hz), 8.03 (1H, t, J=9 Hz), 8.48 (1H, d, J=2 Hz).
[0310] IR (KBr, cm.sup.-1)
[0311] :3325, 2976, 2935, 2858, 1695, 1627, 1573, 1539, 1504, 1456,
1427, 1 365, 1335, 1306, 1273, 1236, 1171, 1117, 1095, 1045, 1014,
974, 887, 843, 769.
Example 16
tert-Butyl
4-[2-[4-(1,2,4-triazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidi-
ne-1-carboxylate
[0312] The title compound was prepared from
4-(1,2,4-triazol-1-yl)phenol (13 mg, 0.079 mmol) following a
procedure analogous to that in Example 1(4) as a white crystal (28
mg, yield 82%).
[0313] FAB-MS (m/z): 436 (M+1)
[0314] m.p.: 147-150.degree. C.
[0315] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0316] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 4.2-4.4 (2H, m), 5.23 (2H, s), 7.10 (2H, d, J=9 Hz), 7.45 (1H,
d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.56 (2H, d, J=9 Hz), 8.07
(1H, s), 8.45 (1H, s), 8.49 (1H, brs).
[0317] IR (KBr, cm.sup.-1)
[0318] :3107, 3006, 2976, 2920, 2860, 1693, 1595, 1576, 1523, 1456,
1419, 1 369, 1306, 1277, 1232, 1171, 1115, 1086, 1059, 1016, 982,
953, 926, 8 89, 862, 829, 769, 673, 642, 521.
Example 17
tert-Butyl
4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidine-1--
carboxylate
[0319] The title compound was prepared from 4-(tetrazol-1-yl)phenol
(9.8 mg, 0.060 mmol) following a procedure analogous to that in
Example 1(4) as a white crystal (12 mg, yield 45%).
[0320] FAB-MS (m/z): 437 (M+1)
[0321] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0322] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 4.2-4.4 (2H, m), 5.25 (2H, s), 7.16 (2H, d, J=9 Hz), 7.45 (1H,
d, J=8 Hz), 7.57 (1H, dd, J=1 Hz, 8 Hz), 7.59 (2H, d, J=9 Hz), 8.49
(1H, brs), 8.89 (1H, s).
[0323] IR (KBr, cm.sup.-1)
[0324] :3124, 2978, 2929, 2852, 1699, 1684, 1520, 1458, 1419, 1365,
1309, 1 277, 1248, 1207, 1173, 1117, 1093, 1053, 1020, 997, 833,
773, 525.
Example 18
tert-Butyl
4-[2-(3-fluoro-4-methanesulfonylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0325] The title compound was prepared from
3-fluoro-4-methanesulfonylphenol (10 mg, 0.053 mmol) following a
procedure analogous to that in Example 1(4) as a white crystal (7.6
mg, yield 41%).
[0326] FAB-MS (m/z): 465 (M+1)
[0327] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0328] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.18 (3H, s), 4.2-4.4 (2H, m), 5.23 (2H, s), 6.85 (1H, dd, J=2
Hz, 12 Hz), 6.91 (1H, dd, J=2 Hz, 8 Hz), 7.39 (1H, d, J=8 Hz), 7.57
(1H, dd, J=2 Hz, 8 Hz), 7.86 (1H, t, J=8 Hz), 8.48 (1H, d, J=2
Hz).
[0329] IR (KBr, cm.sup.-1)
[0330] :3005, 2974, 2929, 2854, 1685, 1610, 1577, 1489, 1456, 1431,
1363, 1 323, 1304, 1277, 1236, 1171, 1157, 1134, 1078, 1036, 1012,
970, 887, 835, 771, 619, 509.
Example 19
tert-Butyl
4-[2-(3-methanesulfonylmethylphenoxymethyl)pyridin-5-yl]piperid-
ine-1-carboxylate
[0331] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (31 mg, 0.105 mmol) and 3-methanesulfonylmethylphenol (29 mg,
0.158 mmol) following a procedure analogous to that in Example 9 as
a white crystal (23 mg, yield 48%).
[0332] FAB-MS (m/z): 461 (M+1)
[0333] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0334] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 2.72 (3H, s), 4.21 (2H, s), 4.2-4.4 (2H, m), 5.19 (2H, s),
6.9-7.1 (3H, m), 7.33 (1H, t, J=8 Hz), 7.45 (1H, d, J=8 Hz), 7.55
(1H, dd, J=2 Hz, 8 Hz), 8.47 (1H, brs).
[0335] IR (KBr, cm.sup.-1)
[0336] :3018, 2979, 2924, 2856, 1712, 1597, 1495, 1448, 1414, 1367,
1298, 1 271, 1232, 1176, 1113, 1053, 1009, 958, 910, 887, 833, 798,
762, 734, 704, 507, 461.
Example 20
tert-Butyl
4-[2-(3-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1--
carboxylate
[0337] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (45 mg, 0.155 mmol) and 3-methanesulfonylphenol (40 mg, 0.233
mmol) following a procedure analogous to that in Example 9 as a
white crystal (22 mg, yield 39%).
[0338] FAB-MS (m/z): 447 (M+1)
[0339] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0340] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.05 (3H, s), 4.2-4.4 (2H, m), 5.23 (2H, s), 7.2-7.3 (1H, m),
7.44 (1H, d, J=8 Hz), 7.48 (1H, t, J=8 Hz), 7.5-7.6 (3H, m), 8.48
(1H, d, J=2 Hz).
[0341] IR (KBr, cm.sup.-1)
[0342] :3003, 2976, 2922, 2860, 1689, 1599, 1500, 1481, 1448, 1412,
1387, 1 363, 1298, 1240, 1173, 1140, 1119, 1095, 1065, 1007, 972,
768, 681, 5 34, 492.
Example 21
tert-Butyl
4-[2-(4-sulfamoylphenoxymethyl)pyridin-5-yl]piperidine-1-carbox-
ylate
(1) Potassium 4-sulfamoylphenolate
[0343] To a solution of 4-hydroxybenzenesulfonamide (200 mg, 1.15
mmol) in ethanol (1 mL) was added potassium hydroxide solution
(0.5M in ethanol, 2.5 mL). The mixture was stirred at room
temperature for 1 hour and concentrated under reduced pressure to
give the title compound as a pale orange crystal (quantitative
yield).
(2) tert-Butyl
4-[2-(4-sulfamoylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
[0344] To a solution of tert-butyl
4-[2-(methanesulfonyloxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 1(3)) (24 mg, 0.065 mmol) in dimethyl sulfoxide (1 mL) was
added potassium 4-sulfamoylphenolate (14 mg, 0.065 mmol). The
mixture was stirred at room temperature for 3.5 hours, to which was
added saturated aqueous ammonium chloride solution and extracted
with chloroform. The organic layer was washed with brine, dried
over anhydrous sodium sulfate and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=1/8 and
chloroform/methanol=200/120/1) to give the title compound as a
white crystal (16 mg, yield 54%).
[0345] FAB-MS (m/z): 448 (M+1)
[0346] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0347] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 4.2-4.4 (2H, m), 4.9-5.1 (2H, m), 5.21 (2H, s), 7.05 (2H, d,
J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.85
(2H, d, J=9 Hz), 8.47 (1H, d, J=2 Hz).
[0348] IR (KBr, cm.sup.-1)
[0349] :3329, 3005, 2981, 2858, 1676, 1593, 1576, 1496, 1450, 1414,
1365, 1 331, 1313, 1277, 1240, 1159, 1120, 1097, 1014, 989, 947,
897, 858, 83 9, 777, 627, 579, 548.
Example 22
tert-Butyl
4-[2-(4-methanesulfonyl-2-methylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0350] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (39 mg, 0.135 mmol) and 4-methanesulfonyl-2-methylphenol (38
mg, 0.203 mmol) following a procedure analogous to that in Example
9 as a white crystal (16 mg, yield 26%).
[0351] FAB-MS (m/z): 461 (M+1)
[0352] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0353] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.37 (3H,
s), 2.6-2.9 (3H, m), 3.02 (3H, s), 4.2-4.4 (2H, m), 5.27 (2H, s),
6.99 (1H, d, J=9 Hz), 7.43 (1H, d, J=8 Hz), 7.57 (1H, dd, J=2 Hz, 8
Hz), 7.7-7.8 (2H, m), 8.47 (1H, d, J=2 Hz).
[0354] IR (KBr, cm.sup.-1)
[0355] :3008, 2978, 2925, 2856, 1689, 1595, 1498, 1450, 1427, 1365,
1321, 1 298, 1269, 1236, 1173, 1124, 1095, 1045, 1012, 972, 887,
822, 769, 64 2, 619, 582, 532, 496.
Example 23
tert-Butyl
4-[2-(4-dimethylsulfamoylphenoxymethyl)pyridin-5-yl]piperidine--
1-carboxylate
(1) Potassium 4-(N,N-dimethylsulfamoyl)phenolate
[0356] The title compound was prepared from
4-hydroxy-N,N-dimethylbenzenesulfonamide (46 mg, 0.227 mmol)
following a procedure analogous to that in Example 21(1) as a pale
yellow crystal (quantitative yield).
(2) tert-Butyl
4-[2-(4-dimethylsulfamoylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxyl-
ate
[0357] The title compound was prepared from potassium
4-(N,N-dimethylsulfamoyl)phenolate (45 mg, 0.188 mmol) following a
procedure analogous to that in Example 21(2) as a pale yellow
crystal (14 mg, yield 16%).
[0358] FAB-MS (m/z): 476 (M+1)
[0359] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0360] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.69 (6H,
s), 2.6-2.9 (3H, m), 4.2-4.4 (2H, m), 5.23 (2H, s), 7.10 (2H, d,
J=9 Hz), 7.43 (1H, d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.72
(2H, d, J=9 Hz), 8.48 (1H, d, J=2 Hz).
[0361] IR (KBr, cm.sup.-1)
[0362] :2978, 2912, 2854, 1695, 1599, 1500, 1450, 1402, 1367, 1336,
1306, 1 273, 1240, 1178, 1159, 1120, 1093, 1061, 1026, 950, 833,
777, 741, 71 2, 681, 623, 573, 538.
Example 24
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro--
2H-pyridine-1-carboxylate
(1) tert-Butyl
4-[(2-hydroxymethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
[0363] The title compound was prepared from
5-bromopyridin-2-methanol (1.00 g, 5.32 mmol) and tert-butyl
4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-1-
-carboxylate (1.64 g, 5.32 mmol) following a procedure analogous to
that in Example 1(1) as a pale yellow oil (1.33 g, yield 86%).
[0364] FAB-MS (m/z):445 (M+1)
[0365] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0366] 1.50 (9H, s), 2.4-2.6 (2H, m), 3.6-3.7 (2H, m), 4.0-4.2 (2H,
m), 4.76 (2H, s), 6.0-6.2 (1H, m), 7.22 (1H, d, J=8 Hz), 7.65 (1H,
dd, J=2 Hz, 8 Hz), 8.58 (1H, brs).
(2) tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridin-
e-1-carboxylate
[0367] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
(30 mg, 0.103 mmol) following a procedure analogous to that in
Example 9 as a white crystal (6.1 mg, yield 13%).
[0368] FAB-MS (m/z): 445 (M+1)
[0369] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0370] 1.50 (9H, s), 2.5-2.6 (2H, m), 3.03 (3H, s), 3.6-3.7 (2H,
m), 4.0-4.2 (2H, m), 5.27 (2H, s), 6.1-6.2 (1H, m), 7.11 (2H, d,
J=9 Hz), 7.43 (1H, d, J=8 Hz), 7.69 (1H, dd, J=2 Hz, 8 Hz), 7.87
(2H, d, J=9 Hz), 8.64 (1H, brs).
[0371] IR (KBr, cm.sup.-1)
[0372] :3003, 2979, 2921, 2854, 1697, 1653, 1593, 1498, 1456, 1410,
1365, 1 296, 1238, 1169, 1140, 1111, 1061, 1038, 972, 860, 833,
810, 773, 552, 528.
Example 25
tert-Butyl
4-[2-(2-chloro-4-methanesulfonylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0373] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (33 mg, 0.114 mmol) and 2-chloro-4-methanesulfonylphenol (35
mg, 0.171 mmol) following a procedure analogous to that in Example
9 as a white crystal (23 mg, yield 42%).
[0374] FAB-MS (m/z): 481 (M+1)
[0375] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0376] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.04 (3H, s), 4.2-4.4 (2H, m), 5.34 (2H, s), 7.14 (1H, d, J=8
Hz), 7.52 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 7.79 (1H,
dd, J=2 Hz, 8 Hz), 7.98 (1H, d, J=2 Hz), 8.47 (1H, brs).
[0377] IR (KBr, cm.sup.-1)
[0378] :2974, 2929, 2854, 1689, 1585, 1495, 1456, 1423, 1394, 1365,
1317, 1 234, 1151, 1101, 1065, 1016, 964, 862, 769, 739, 584, 528,
491.
Example 26
tert-Butyl
4-[2-(4-methanesulfonyl-2-methoxyphenoxymethyl)pyridin-5-yl]pip-
eridine-1-carboxylate
(1) 4-Methanesulfonyl-2-methoxyphenol
[0379] A mixture of 4-bromo-2-methoxyphenol (500 mg, 2.46 mmol),
sodium methanesulfinate (1 g, 9.84 mmol), copper(I)
trifluoromethanesulfonate benzene complex (124 mg, 0.25 mmol) and
N,N'-dimethylethylenediamine (53 .mu.L, 0.49 mmol) in dimethyl
sulfoxide (3 mL) was stirred overnight at 130.degree. C. The
mixture was allowed to cool to room temperature followed by the
addition of ethyl acetate (8 mL) and water (8 mL). The resulting
mixture was filtered through Celite pad and to the filtrate was
added 2N hydrochloric acid and extracted with ethyl acetate. The
organic layer was washed sequentially with water and brine, dried
over anhydrous sodium sulfate and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=3/1.fwdarw.1/1) to give the
title compound as a white crystal (258 mg, yield 52%).
[0380] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0381] 3.04 (3H, s), 3.98 (3H, s), 6.10 (1H, s), 7.06 (1H, d, J=8
Hz), 7.41 (1H, d, J=2 Hz), 7.51 (1H, dd, J=2 Hz, 8 Hz).
(2) tert-Butyl
4-[2-(4-methanesulfonyl-2-methoxyphenoxymethyl)pyridin-5-yl]piperidine-1--
carboxylate
[0382] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (30 mg, 0.103 mmol) and 4-methanesulfonyl-2-methoxyphenol (31
mg, 0.155 mmol) following a procedure analogous to that in Example
9 as a white crystal (40 mg, yield 81%).
[0383] FAB-MS (m/z): 477 (M+1)
[0384] m.p.: 135-138.degree. C.
[0385] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0386] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.04 (3H, s), 3.97 (3H, s), 4.2-4.4 (2H, m), 5.32 (2H, s), 7.03
(1H, d, J=8 Hz), 7.4-7.5 (3H, m), 7.54 (1H, dd, J=2 Hz, 8 Hz), 8.47
(1H, brs).
[0387] IR (KBr, cm.sup.-1)
[0388] :2974, 2925, 2852, 1685, 1587, 1508, 1458, 1425, 1404, 1363,
1308, 1 261, 1234, 1169, 1134, 1092, 1020, 968, 893, 858, 764, 606,
541, 495.
Example 27
tert-Butyl
4-[2-(4-methanesulfonyl-2-trifluoromethyl-phenoxymethyl)pyridin-
-5-yl]piperidine-1-carboxylate
(1) 4-Methanesulfonyl-2-trifluoromethylphenol
[0389] The title compound was prepared from
4-bromo-2-trifluoromethylphenol (316 mg, 1.31 mmol) following a
procedure analogous to that in Example 26(1) (90 mg, yield
29%).
[0390] .sup.1H NMR (CD.sub.3OD, 400 MHz): .delta.=
[0391] 3.11 (3H, s), 7.14 (1H, d, J=9 Hz), 7.98 (1H, dd, J=2 Hz, 9
Hz), 8.05 (1H, d, J=2 Hz).
(2) tert-Butyl
4-[2-(4-methanesulfonyl-2-trifluoromethylphenoxymethyl)pyridin-5-yl]piper-
idine-1-carboxylate
[0392] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (40 mg, 0.137 mmol) and
4-methanesulfonyl-2-trifluoromethylphenol (49 mg, 0.205 mmol)
following a procedure analogous to that in Example 9 as a white
crystal (24 mg, yield 35%).
[0393] FAB-MS (m/z): 447 (M+1)
[0394] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0395] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.06 (3H, s), 4.1-4.4 (2H, m), 5.38 (2H, s), 7.25 (1H, d, J=9
Hz), 7.48 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 8.06 (1H,
dd, J=2 Hz, 9 Hz), 8.19 (1H, brs), 8.46 (1H, brs).
[0396] IR (KBr, cm.sup.-1)
[0397] :2978, 2927, 2860, 1741, 1697, 1614, 1498, 1456, 1427, 1369,
1308, 1 284, 1236, 1147, 1126, 1099, 1059, 1012, 968, 910, 862,
845, 820, 796, 766, 698, 623, 553, 532, 492.
Example 28
tert-Butyl
4-[2-(2-acetyl-4-methanesulfonylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0398] The title compound was prepared from tert-butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate (Example
1(2)) (36 mg, 0.123 mmol) and
2-hydroxy-5-methanesulfonylacetophenone (40 mg, 0.187 mmol)
following a procedure analogous to that in Example 9 as a white
amorphous, (35 mg, yield 58%).
[0399] FAB-MS (m/z): 489 (M+1)
[0400] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0401] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.67 (3H,
s), 2.6-2.9 (3H, m), 3.05 (3H, s), 4.1-4.4 (2H, m), 5.37 (2H, s),
7.22 (1H, d, J=8 Hz), 7.41 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8
Hz), 7.99 (1H, dd, J=2 Hz, 8 Hz), 8.26 (1H, d, J=2 Hz), 8.49 (1H,
d, J=2 Hz).
Example 29
tert-Butyl
4-[2-(2-ethyl-4-methanesulfonylphenoxymethyl)pyridin-5-yl]piper-
idine-1-carboxylate
(1) 2-Ethyl-4-methanesulfonylphenol
[0402] To an ice-cooled solution of aluminum chloride (172 mg, 1.29
mmol) in dry dichloromethane (4.3 mL) under N.sub.2 was added
borane tert-butylamine complex (224 mg, 2.57 mmol). The mixture was
stirred for 10 minutes and a solution of
2-hydroxy-5-methanesulfonylacetophenone (92 mg, 0.429 mmol) in dry
dichloromethane (1 mL) was added dropwise. The resulting mixture
was stirred at room temperature overnight followed by the addition
of 0.1M hydrochloric acid (2.2 mL) and concentrated under reduced
pressure. The residue was extracted with ethyl acetate. The organic
layer was washed sequentially with 0.1M hydrochloric acid and
brine, dried over anhydrous sodium sulfate and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=2/1) to give the title
compound as a colorless oil (23 mg, yield 27%).
[0403] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0404] 1.26 (3H, t, J=7 Hz), 2.69 (2H, q, J=7 Hz), 3.04 (3H, s),
6.00 (1H, brs), 6.8-6.9 (1H, m), 7.6-7.8 (2H, m).
(2) tert-Butyl
4-[2-(2-ethyl-4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-ca-
rboxylate
[0405] The title compound was prepared from
2-ethyl-4-methanesulfonylphenol (20 mg, 0.10 mmol) following a
procedure analogous to that in Example 1(4) as a pale yellow oil
(16 mg, yield 34%).
[0406] FAB-MS (m/z): 475 (M+1)
[0407] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0408] 1.28 (3H, t, J=7 Hz), 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9
(2H, m), 2.6-2.9 (5H, m), 3.03 (3H, s), 4.2-4.4 (2H, m), 5.27 (2H,
s), 7.00 (1H, d, J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.56 (1H, dd, J=2
Hz, 8 Hz), 7.7-7.8 (2H, m), 8.48 (1H, d, J=2 Hz).
Example 30
tert-Butyl
4-[2-(3-nitrophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e
[0409] The title compound was prepared from tert-butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate (Example
1(2)) (150 mg, 0.517 mmol) and 3-nitrophenol (108 mg, 0.775 mmol)
following a procedure analogous to that in Example 9 as a yellow
crystal (147 mg, yield 69%).
[0410] FAB-MS (m/z): 414 (M+1)
[0411] m.p.: 94-96.degree. C.
[0412] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0413] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 4.1-4.4 (2H, m), 5.24 (2H, s), 7.2-7.4 (1H, m), 7.4-7.5 (2H,
m), 7.57 (1H, dd, J=2 Hz, 8 Hz), 7.7-7.9 (2H, m), 8.49 (1H,
brs).
[0414] IR (KBr, cm.sup.-1)
[0415] :2970, 2931, 2848, 1685, 1525, 1477, 1427, 1348, 1296, 1246,
1167, 1 117, 1078, 1051, 1014, 989, 918, 891, 845, 814, 766, 739,
675.
Example 31
tert-Butyl
4-[2-(3-aminophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e
[0416] A suspension of zinc powder (553 mg, 8.46 mmol) and calcium
chloride (16 mg, 0.144 mmol) in ethanol (2.6 mL) water (0.6 mL) was
warmed to 90.degree. C. followed by the addition of a solution of
tert-butyl
4-[2-(3-nitrophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 30) (97 mg, 0.23 mmol) in ethanol (2 mL). The mixture was
stirred at 90.degree. C. for 1.5 hours, allowed to cool to room
temperature and filtered through Celite pad. The filtrate was
extracted with ethyl acetate. The organic layer was washed
sequentially with water and brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure. The residue was
purified by silica gel column chromatography
(chloroform/methanol=100/1.fwdarw.100/2) to give the title compound
(84 mg, yield 94%).
[0417] FAB-MS (m/z): 384 (M+1)
[0418] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0419] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.66 (2H, brs), 4.1-4.4 (2H, m), 5.14 (2H, s), 6.2-6.5 (3H, m),
7.05 (1H, t, J=8 Hz), 7.45 (1H, d, J=8 Hz), 7.53 (1H, dd, J=1 Hz, 8
Hz), 8.44 (1H, brs).
Example 32
[0420] tert-Butyl
4-[2-(3-methanesulfonylaminophenoxymethyl)pyridin-5-yl]piperidine-1-carbo-
xylate
[0421] The title compound was prepared from tert-butyl
4-[2-(3-aminophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 31) (20 mg, 0.051 mmol) following a procedure analogous to
that in Example 1(3) as a pale yellow amorphous (18 mg, yield
74%).
[0422] FAB-MS (m/z): 462 (M+1)
[0423] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0424] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.00 (3H, s), 4.1-4.4 (2H, m), 5.17 (2H, s), 6.48 (1H, brs),
6.7-6.9 (2H, m), 6.90 (1H, t, J=2 Hz), 7.2-7.3 (1H, m), 7.45 (1H,
d, J=8 Hz), 7.55 (1H, dd, J=2 Hz, 8 Hz), 8.47 (1H, d, J=2 Hz).
Example 33
tert-Butyl
4-[2-(4-nitrophenoxymethyl)pyridin-5-yl]-piperidine-1-carboxyla-
te
[0425] The title compound was prepared from tert-butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate (Example
1(2)) (150 mg, 0.517 mmol) and 4-nitrophenol (108 mg, 0.775 mmol)
following a procedure analogous to that in Example 9 as a pale
yellow crystal (75 mg, yield 35%).
[0426] FAB-MS (m/z): 414 (M+1)
[0427] m.p.: 149-150.degree. C.
[0428] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0429] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 4.2-4.4 (2H, m), 5.26 (2H, s), 7.06 (2H, d, J=9 Hz), 7.42 (1H,
d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 8.20 (2H, d, J=9 Hz), 8.49
(1H, d, J=2 Hz).
[0430] IR (KBr, cm.sup.-1)
[0431] :2972, 2912, 2837, 1685, 1591, 1510, 1450, 1417, 1365, 1333,
1279, 1 259, 1232, 1167, 1117, 1084, 1045, 1020, 989, 944, 887,
860, 840, 818, 771, 752, 675.
Example 34
tert-Butyl
4-[2-(4-aminophenoxymethyl)pyridin-5-yl]-piperidine-1-carboxyla-
te
[0432] The title compound was prepared from tert-butyl
4-[2-(4-nitrophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 33) (103 mg, 0.249 mmol) following a procedure analogous
to that in Example 31 as a yellow oil (98 mg, yield 100%).
[0433] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0434] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.5-3.8 (2H, m), 4.1-4.4 (2H, m), 5.14 (2H, s), 6.68 (2H, d,
J=9 Hz), 6.82 (2H, d, J=9 Hz), 7.46 (1H, d, J=8 Hz), 7.53 (1H, dd,
J=2 Hz, 8 Hz), 8.45 (1H, d, J=2 Hz).
Example 35
tert-Butyl
4-[2-(4-methanesulfonylaminophenoxymethyl)pyridin-5-yl]piperidi-
ne-1-carboxylate
[0435] The title compound was prepared from tert-butyl
4-[2-(4-aminophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 34) (26 mg, 0.067 mmol) following a procedure analogous to
that in Example 1(3) as a pale yellow crystal (24 mg, yield
78%).
[0436] FAB-MS (m/z): 462 (M+1)
[0437] m.p.: 171-173.degree. C.
[0438] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0439] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 2.95 (3H, s), 4.2-4.4 (2H, m), 5.15 (2H, s), 6.47 (1H, brs),
6.97 (2H, d, J=9 Hz), 7.19 (2H, d, J=9 Hz), 7.44 (1H, d, J=8 Hz),
7.55 (1H, dd, J=2 Hz, 8 Hz), 8.47 (1H, d, J=2 Hz)
[0440] IR (KBr, cm.sup.-1)
[0441] :2976, 2929, 2852, 2349, 1689, 1508, 1458, 1417, 1365, 1325,
1277, 1 238, 1149, 1117, 1020, 974, 835, 771, 526.
Example 36
tert-Butyl
4-[2-(2-bromo-4-methanesulfonylphenoxymethyl)pyridin-5-yl]piper-
idine-1-carboxylate
[0442] The title compound was prepared from tert-butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate (Example
1(2)) (45 mg, 0.155 mmol) and 2-bromo-4-methanesulfonylphenol (58
mg, 0.232 mmol) following a procedure analogous to that in Example
9 as a pale yellow amorphous (49 mg, yield 61%).
[0443] FAB-MS (m/z): 525 (M+1), 527 (M+3)
[0444] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0445] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.04 (3H, s), 4.2-4.4 (2H, m), 5.33 (2H, s), 7.10 (1H, d, J=9
Hz), 7.55 (1H, d, J=8 Hz), 7.59 (1H, dd, J=2 Hz, 8 Hz), 7.83 (1H,
dd, J=2 Hz, 9 Hz), 8.15 (1H, d, J=2 Hz), 8.46 (1H, d, J=2 Hz).
Example 37
tert-Butyl
4-[2-[2-fluoro-4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]pipe-
ridine-1-carboxylate
[0446] The title compound was prepared from tert-butyl
4-[(5-hydroxymethyl)pyridin-2-yl]piperidine-1-carboxylate (Example
1(2)) (96 mg, 0.33 mmol) and 1-(3-fluoro-4-hydroxyphenyl)tetrazole
(61 mg, 0.33 mmol) following a procedure analogous to that in
Example 9 as a pink crystal (4.6 mg, yield 3%).
[0447] FAB-MS (m/z): 455 (M+1)
[0448] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0449] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.32 (2H, s), 7.23 (1H, t,
J=9 Hz), 7.3-7.4 (1H, m), 7.5-7.6 (2H, m), 7.59 (1H, dd, J=2 Hz, 8
Hz), 8.49 (1H, d, J=2 Hz), 8.91 (1H, s).
Example 38
tert-Butyl
4-[2-[4-(tetrazol-1-yl)-2-trifluoromethyl-phenoxymethyl]pyridin-
-5-yl]piperidine-1-carboxylate
[0450] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (64 mg, 0.22 mmol) and
1-(4-hydroxy-3-trifluoromethylphenyl)tetrazole (50 mg, 0.22 mmol)
following a procedure analogous to that in Example 9 as a pale
orange crystal (34 mg, yield 31%).
[0451] FAB-MS (m/z): 505 (M+1)
[0452] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0453] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.38 (2H, s), 7.30 (1H, d,
J=9 Hz), 7.51 (1H, d, J=8 Hz), 7.60 (1H, dd, J=2 Hz, 8 Hz), 7.82
(1H, dd, J=3 Hz, 9 Hz), 7.94 (1H, d, J=3 Hz), 8.47 (1H, d, J=2 Hz),
8.94 (1H, s).
Example 39
tert-Butyl
4-[2-[2-chloro-4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]pipe-
ridine-1-carboxylate
[0454] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (75 mg, 0.26 mmol) and 1-(3-chloro-4-hydroxyphenyl)tetrazole
(50 mg, 0.25 mmol) following a procedure analogous to that in
Example 9 as a pink crystal (23 mg, yield 20%).
[0455] FAB-MS (m/z): 471 (M+1)
[0456] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0457] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.34 (2H, s), 7.19 (1H, d,
J=9 Hz), 7.5-7.7 (3H, m), 7.79 (1H, d, J=2 Hz), 8.47 (1H, s), 8.90
(1H, s).
Example 40
tert-Butyl
4-[2-[2-methyl-4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]pipe-
ridine-1-carboxylate
[0458] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (75 mg, 0.26 mmol) and 1-(3-methyl-4-hydroxyphenyl)tetrazole
(51 mg, 0.29 mmol) following a procedure analogous to that in
Example 9 as a pink crystal (15 mg, yield 12%).
[0459] FAB-MS (m/z): 451 (M+1)
[0460] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0461] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.41 (3H,
s), 2.6-2.8 (1H, m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.27 (2H,
s), 7.02 (1H, d, J=9 Hz), 7.43 (1H, dd, J=2 Hz, 9 Hz), 7.47 (1H, d,
J=8 Hz), 7.50 (1H, s), 7.58 (1H, dd, J=2 Hz, 8 Hz), 8.49 (1H, d,
J=1 Hz), 8.89 (1H, s).
Example 41
1,1-Dimethylpropyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e
[0462] To a solution of tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (30 mg, 0.067 mmol) in dry dichloromethane (0.35 mL)
under N.sub.2 was added trifluoroacetic acid (0.35 mL). The mixture
was stirred at room temperature for 2 hours and concentrated in
vacuo. To a solution of the residue in dry tetrahydrofuran (0.7 mL)
was added triethylamine (28 .mu.L, 0.2 mmol) and di-tert-amyl
dicarbonate (25 .mu.L, 0.1 mmol). The mixture was stirred at room
temperature for 3 hours, diluted with water (1 mL) and extracted
with ethyl acetate. The organic layer was washed with brine, dried
over anhydrous sodium sulfate and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=1/1) to give the title
compound as a white crystal (28 mg, yield 91%).
[0463] FAB-MS (m/z): 461 (M+1)
[0464] m.p.: 114-115.degree. C.
[0465] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0466] 0.91 (3H, t, J=8 Hz), 1.45 (6H, s), 1.6-1.7 (2H, m), 1.8-1.9
(4H, m), 2.7-2.8 (3H, m), 3.03 (3H, s), 4.26 (2H, m), 5.25 (2H, s),
7.11 (2H, d, J=9 Hz), 7.41 (1H, d, J=8 Hz), 7.55 (1H, dd, J=2 Hz, 8
Hz), 7.86 (2H, d, J=9 Hz), 8.48 (1H, d, J=2 Hz).
[0467] IR (KBr, cm.sup.-1)
[0468] :2974, 2925, 2858, 1687, 1593, 1498, 1466, 1427, 1365, 1313,
1292, 1 228, 1165, 1140, 1093, 1049, 1011, 968, 941, 837, 773, 615,
550, 526.
Example 42
[0469] Benzyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e
[0470] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (30 mg, 0.067 mmol) following a procedure analogous
to that in Example 41 as a white amorphous (24 mg, yield 73%).
[0471] FAB-MS (m/z): 481 (M+1)
[0472] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0473] 1.6-1.8 (2H, m), 1.8-2.0 (2H, m), 2.7-2.8 (1H, m), 2.8-3.0
(2H, m), 3.03 (3H, s), 4.2-4.5 (2H, m), 5.16 (2H, s), 5.25 (2H, s),
7.12 (2H, d, J=9 Hz), 7.3-7.5 (6H, m), 7.55 (1H, dd, J=2 Hz, 8 Hz),
7.87 (2H, d, J=9 Hz), 8.48 (1H, d, J=2 Hz).
Example 43
Ethyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carbo-
xylate
[0474] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (30 mg, 0.067 mmol) following a procedure analogous
to that in Example 41 as a white crystal (20 mg, yield 69%).
[0475] FAB-MS (m/z): 419 (M+1)
[0476] m.p.: 119-121.degree. C.
[0477] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0478] 1.28 (3H, t, J=7 Hz), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m),
2.7-2.8 (1H, m), 2.8-3.0 (2H, m), 3.03 (3H, s), 4.16 (2H, q, J=7
Hz), 4.2-4.4 (2H, m), 5.25 (2H, s), 7.12 (2H, d, J=9 Hz), 7.42 (1H,
d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.87 (2H, d, J=9 Hz), 8.48
(1H, d, J=2 Hz).
[0479] IR (KBr, cm.sup.-1)
[0480] :2925, 2854, 1693, 1595, 1579, 1498, 1437, 1385, 1292, 1230,
1142, 1 093, 1034, 970, 839, 773, 546, 526.
Example 44
Isobutyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-ca-
rboxylate
[0481] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (30 mg, 0.067 mmol) following a procedure analogous
to that in Example 41 as a white crystal (23 mg, yield 77%).
[0482] FAB-MS (m/z): 447 (M+1)
[0483] m.p.: 114-117.degree. C.
[0484] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0485] 0.95 (6H, d, J=7 Hz), 1.5-1.8 (2H, m), 1.8-1.9 (2H, m),
1.9-2.0 (1H, m), 2.7-2.8 (1H, m), 2.8-3.0 (2H, m), 3.03 (3H, s),
3.90 (2H, d, J=7 Hz), 4.2-4.4 (2H, m), 5.25 (2H, s), 7.12 (2H, d,
J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.87
(2H, d, J=9 Hz), 8.49 (1H, d, J=2 Hz).
[0486] IR (KBr, cm.sup.-1)
[0487] :2960, 2929, 2873, 1691, 1593, 1577, 1498, 1469, 1437, 1389,
1313, 1 290, 1269, 1248, 1228, 1140, 1120, 1093, 1047, 968, 837,
775, 550, 52 8.
Example 45
1-Methylcyclopropyl
4-[2-(4-methanesulfonyl-2-trifluoromethylphenoxymethyl)pyridin-5-yl]piper-
idine-1-carboxylate
[0488] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (28 mg, 0.063 mmol) following a procedure analogous
to that in Example 41 as a white crystal (19 mg, yield 68%).
[0489] FAB-MS (m/z): 445 (M+1)
[0490] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0491] 0.6-0.8 (2H, m), 0.8-1.0 (2H, m), 1.57 (3H, s), 1.5-1.8 (2H,
m), 1.8-2.0 (2H, m), 2.6-2.9 (3H, m), 3.03 (3H, s), 4.0-4.4 (2H,
m), 5.25 (2H, s), 7.11 (2H, d, J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.55
(1H, dd, J=2 Hz, 8 Hz), 7.87 (2H, d, J=9 Hz), 8.48 (1H, d, J=2
Hz).
Example 46
1-[4-[2-(4-Methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-yl]-3,3-d-
imethylbutan-1-one
[0492] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (30 mg, 0.067 mmol) and 3,3-dimethylbutyryl chloride
(14 .mu.L, 0.1 mmol) following a procedure analogous to that in
Example 41 as a white crystal (28 mg, yield 94%).
[0493] FAB-MS (m/z): 445 (M+1)
[0494] m.p.: 140-142.degree. C.
[0495] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0496] 1.08 (9H, s), 1.6-1.7 (2H, m), 1.9-2.0 (2H, m), 2.2-2.4 (2H,
m), 2.6-2.7 (1H, m), 2.7-2.8 (1H, m), 3.03 (3H, s), 3.1-3.2 (1H,
m), 4.0-4.2 (1H, m), 4.8-5.0 (1H, m), 5.25 (2H, s), 7.12 (2H, d,
J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.55 (1H, dd, J=2 Hz, 8 Hz), 7.86
(2H, d, J=9 Hz), 8.58 (1H, d, J=2 Hz).
[0497] IR (KBr, cm.sup.-1)
[0498] :2952, 2925, 2366, 1633, 1593, 1498, 1419, 1365, 1317, 1298,
1254, 1 146, 1095, 1051, 1007, 962, 833, 769, 544.
Example 47
1-[4-[2-(4-Methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-yl]-2-met-
hylpropan-1-one
[0499] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) following a procedure analogous to that in Example 41
as a pale brown crystal.
[0500] FAB-MS (m/z): 417 (M+1)
[0501] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0502] 1.15 (6H, brs), 1.5-1.7 (2H, m), 1.8-2.0 (2H, m), 2.5-2.7
(1H, m), 2.7-2.9 (2H, m), 3.03 (3H, s), 3.1-3.3 (1H, m), 4.0-4.2
(1H, m), 4.8-4.9 (1H, m), 5.26 (2H, s), 7.12 (2H, d, J=9 Hz), 7.44
(1H, d, J=8 Hz), 7.57 (1H, dd, J=2 Hz, 8 Hz), 7.87 (2H, d, J=9 Hz),
8.49 (1H, d, J=2 Hz).
Example 48
5-Ethyl-2-[4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-y-
l]pyrimidine
[0503] To a solution of tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-carboxylate
(Example 1) (50 mg, 0.11 mmol) in dry dichloromethane (0.55 mL) was
added trifluoroacetic acid (0.55 mL). The mixture was stirred at
room temperature for 2 hours and concentrated in vacuo.
[0504] To a solution of the residue in dry acetonitrile (1 mL) was
added potassium carbonate (76 mg, 0.55 mmol) and
5-ethyl-2-bromopyrimidine (26 .mu.L, 0.22 mmol). The mixture was
stirred at 80.degree. C. for 18 hours, allowed to cool to room
temperature, diluted with water (1 mL) and extracted with ethyl
acetate. The organic layer was washed with brine, dried over
anhydrous sodium sulfate and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=1/2) to give the title compound as a white
crystal (35 mg, yield 70%).
[0505] FAB-MS (m/z): 453 (M+1)
[0506] m.p.: 185-187.degree. C.
[0507] .sup.1H NMR (CDCl.sub.3, 400 MHz) .delta.=
[0508] 1.20 (3H, t, J=8 Hz), 1.7-1.8 (2H, m), 1.8-2.0 (2H, m), 2.48
(2H, q, J=8 Hz), 2.8-2.9 (1H, m), 2.9-3.1 (2H, m), 3.03 (3H, s),
4.8-5.0 (2H, m), 5.25 (2H, s), 7.11 (2H, d, J=9 Hz), 7.40 (1H, d,
J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.86 (2H, d, J=9 Hz), 8.19
(2H, s), 8.51 (1H, d, J=2 Hz).
[0509] IR (KBr, cm.sup.-1)
[0510] :2997, 2917, 1844, 1732, 1604, 1538, 1500, 1456, 1408, 1361,
1317, 1 296, 1271, 1241, 1178, 1147, 1093, 1043, 1009, 966, 947,
827, 795, 77 1, 739, 658, 627, 538, 486, 407.
Example 49
2-[4-[2-(4-Methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-yl]-5-pro-
pylpyrimidine
[0511] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (50 mg, 0.11 mmol) and 5-propyl-2-bromopyrimidine (26
.mu.L, 0.22 mmol) following a procedure analogous to that in
Example 48 as a white crystal (31 mg, yield 60%).
[0512] FAB-MS (m/z): 467 (M+1)
[0513] m.p.: 164-166.degree. C.
[0514] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0515] 0.94 (3H, t, J=7 Hz), 1.5-1.6 (2H, m), 1.6-1.8 (2H, m),
1.9-2.0 (2H, m), 2.41 (2H, t, J=7 Hz), 2.8-2.9 (1H, m), 2.9-3.1
(2H, m), 3.03 (3H, s), 4.9-5.0 (2H, m), 5.25 (2H, s), 7.11 (2H, d,
J=9 Hz), 7.41 (1H, d, J=8 Hz), 7.58 (1H, dd, J=2 Hz, 8 Hz), 7.86
(2H, d, J=9 Hz), 8.17 (2H, s), 8.50 (1H, d, J=2 Hz).
[0516] IR (KBr, cm.sup.-1)
[0517] :2958, 2927, 2852, 2359, 2322, 1603, 1541, 1481, 1458, 1369,
1302, 1 254, 1174, 1147, 1093, 1047, 1014, 964, 947, 841, 798, 769,
739, 629, 528, 492, 418.
Example 50
2-[4-[2-(4-Methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-yl]-5-pen-
tylpyrimidine
[0518] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (50 mg, 0.11 mmol) and 5-pentyl-2-bromopyrimidine (37
.mu.L, 0.22 mmol) following a procedure analogous to that in
Example 48 as a white crystal (35 mg, yield 64%).
[0519] FAB-MS (m/z): 495 (M+1)
[0520] m.p.: 154-157.degree. C.
[0521] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0522] 0.89 (3H, t, J=7 Hz), 1.3-1.4 (4H, m), 1.4-1.6 (2H, m),
1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.42 (2H, t, J=7 Hz), 2.8-2.9
(1H, m), 2.9-3.1 (2H, m), 3.03 (3H, s), 4.9-5.0 (2H, m), 5.25 (2H,
s), 7.12 (2H, d, J=9 Hz), 7.41 (1H, d, J=8 Hz), 7.57 (1H, dd, J=2
Hz, 8 Hz), 7.86 (2H, d, J=9 Hz), 8.17 (2H, s), 8.51 (1H, d, J=2
Hz).
[0523] IR (KBr, cm.sup.-1)
[0524] :2952, 2925, 2852, 2360, 2322, 1601, 1541, 1489, 1456, 1363,
1298, 1 250, 1149, 1093, 1053, 1012, 958, 839, 798, 771, 638, 532,
488.
Example 51
5-Ethyl-2-[4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidin-1-y-
l]pyrimidine
[0525] The title compound was prepared from tert-butyl
4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidine-1-carboxylat-
e (Example 17) (26 mg, 0.06 mmol) and 5-ethyl-2-bromopyrimidine (14
.mu.L, 0.12 mmol) following a procedure analogous to that in
Example 48 as a white crystal (10 mg, yield 38%).
[0526] FAB-MS (m/z): 437 (M+1)
[0527] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0528] 1.26 (3H, t, J=7 Hz), 1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.47
(2H, q, J=7 Hz), 2.8-2.9 (1H, m), 2.9-3.0 (2H, m), 4.8-5.0 (2H, m),
5.25 (2H, s), 7.16 (2H, d, J=9 Hz), 7.44 (1H, d, J=8 Hz), 7.5-7.6
(3H, m), 8.20 (2H, s), 8.51 (1H, d, J=2 Hz), 8.88 (1H, s).
Example 52
2-[4-[2-(4-Cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidin-1-yl]-5-ethy-
lpyrimidine
[0529] The title compound was prepared from tert-butyl
4-[2-(4-cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 13) (50 mg, 0.12 mmol) and 5-ethyl-2-bromopyrimidine (29
.mu.L, 0.24 mmol) following a procedure analogous to that in
Example 48 as a white crystal (37 mg, yield 73%).
[0530] FAB-MS (m/z): 418 (M+1)
[0531] m.p.: 129-131.degree. C.
[0532] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0533] 1.20 (3H, t, J=8 Hz), 1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.47
(2H, q, J=8 Hz), 2.8-2.9 (1H, m), 2.9-3.0 (2H, m), 4.9-5.0 (2H, m),
5.21 (2H, s), 6.8-6.9 (2H, m), 7.37 (1H, d, J=8 Hz), 7.52 (1H, t,
J=8 Hz), 7.57 (1H, dd, J=2 Hz, 8 Hz), 8.19 (2H, s), 8.50 (1H, d,
J=2 Hz).
[0534] IR (KBr, cm.sup.-1)
[0535] :2970, 2933, 2815, 2233, 1618, 1603, 1572, 1543, 1506, 1475,
1446, 1 381, 1360, 1302, 1246, 1223, 1171, 1115, 1041, 1013, 939,
847, 816, 7 89, 754, 634, 507, 453, 409.
Example 53
2-[4-[2-(4-Cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidin-1-yl]-5-prop-
ylpyrimidine
[0536] The title compound was prepared from tert-butyl
4-[2-(4-cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 13) (50 mg, 0.12 mmol) and 5-propyl-2-bromopyrimidine (33
.mu.L, 0.24 mmol) following a procedure analogous to that in
Example 48 as a white crystal (35 mg, yield 67%).
[0537] FAB-MS (m/z): 431 (M+1)
[0538] m.p.: 118-120.degree. C.
[0539] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0540] 0.94 (3H, t, J=7 Hz), 1.5-1.8 (4H, m), 1.9-2.0 (2H, m), 2.41
(2H, t, J=7 Hz), 2.8-2.9 (1H, m), 2.9-3.0 (2H, m), 4.9-5.0 (2H, m),
5.21 (2H, s), 6.8-6.9 (2H, m), 7.38 (1H, d, J=8 Hz), 7.52 (1H, dd,
J=8 Hz, 9 Hz), 7.57 (1H, dd, J=2 Hz, 8 Hz), 8.17 (2H, s), 8.51 (1H,
d, J=2 Hz).
[0541] IR (KBr, cm.sup.-1)
[0542] :3014, 2927, 2854, 2359, 2229, 1622, 1601, 1574, 1541, 1506,
1477, 1 450, 1365, 1329, 1300, 1269, 1244, 1171, 1115, 1047, 1012,
972, 943, 833, 798, 736, 627, 498.
Example 54
2-[4-[2-(4-Cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidin-1-yl]-5-pent-
ylpyrimidine
[0543] The title compound was prepared from tert-butyl
4-[2-(4-cyano-3-fluorophenoxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 13) (33 mg, 0.08 mmol) and 5-pentyl-2-bromopyrimidine (27
.mu.L, 0.16 mmol) following a procedure analogous to that in
Example 48 as a white crystal (24 mg, yield 65%).
[0544] FAB-MS (m/z): 460 (M+1)
[0545] m.p.: 92-94.degree. C.
[0546] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0547] 0.89 (3H, t, J=7 Hz), 1.2-1.4 (4H, m), 1.5-1.6 (2H, m),
1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.42 (2H, t, J=8 Hz), 2.8-2.9
(1H, m), 2.9-3.0 (2H, m), 4.8-5.0 (2H, m), 5.21 (2H, s), 6.7-6.9
(2H, m), 7.38 (1H, d, J=8 Hz), 7.52 (1H, dd, J=8 Hz, 9 Hz), 7.58
(1H, dd, J=2 Hz, 8 Hz), 8.17 (2H, s), 8.51 (1H, d, J=2 Hz).
[0548] IR (KBr, cm.sup.-1)
[0549] :2958, 2929, 2856, 2362, 2322, 2227, 1621, 1599, 1574, 1540,
1508, 1 456, 1365, 1335, 1304, 1240, 1225, 1174, 1105, 1043, 1014,
974, 943, 843, 800, 735, 629, 505.
Example 55
5-Propyl-2-[4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidin-1--
yl]pyrimidine
[0550] The title compound was prepared from tert-butyl
4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidine-1-carboxylat-
e (Example 17) (56 mg, 0.13 mmol) and 5-propyl-2-bromopyrimidine
(36 .mu.L, 0.26 mmol) following a procedure analogous to that in
Example 48 as a white crystal (6 mg, yield 10%).
[0551] FAB-MS (m/z): 457 (M+1)
[0552] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0553] 0.95 (3H, t, J=7 Hz), 1.4-1.6 (2H, m), 1.6-1.8 (2H, m),
1.9-2.0 (2H, m), 2.41 (2H, t, J=7 Hz), 2.8-3.0 (3H, m), 4.9-5.0
(2H, m), 5.25 (2H, s), 7.1-7.2 (2H, m), 7.4-7.5 (1H, m), 7.5-7.7
(3H, m), 8.18 (2H, s), 8.52 (1H, s), 8.88 (1H, s).
Example 56
5-Pentyl-2-[4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidin-1--
yl]pyrimidine
[0554] The title compound was prepared from tert-butyl
4-[2-[4-(tetrazol-1-yl)phenoxymethyl]pyridin-5-yl]piperidine-1-carboxylat-
e (Example 17) (52 mg, 0.12 mmol) and 5-pentyl-2-bromopyrimidine
(41 .mu.L, 0.24 mmol) following a procedure analogous to that in
Example 48 as a white crystal (26 mg, yield 45%).
[0555] FAB-MS (m/z): 485 (M+1)
[0556] m.p.: 174-176.degree. C.
[0557] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0558] 0.89 (3H, t, J=7 Hz), 1.2-1.4 (4H, m), 1.4-1.6 (2H, m),
1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.42 (2H, t, J=7 Hz), 2.8-2.9
(1H, m), 2.9-3.0 (2H, m), 4.9-5.0 (2H, m), 5.25 (2H, s), 7.16 (2H,
d, J=9 Hz), 7.44 (1H, d, J=8 Hz), 7.5-7.7 (3H, m), 8.17 (2H, s),
8.51 (1H, d, J=2 Hz), 8.88 (1H, s).
[0559] IR (KBr, cm.sup.-1)
[0560] :3128, 2952, 2927, 2854, 1604, 1541, 1520, 1483, 1460, 1367,
1306, 1 248, 1207, 1173, 1093, 1055, 947, 831, 796, 677, 642, 526,
496.
Example 57
5-Bromo-2-[4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1-y-
l]pyrimidine
[0561] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidine-1-carboxylat-
e (Example 1) (30 mg, 0.067 mmol) following a procedure analogous
to that in Example 48 as a white crystal (31 mg, yield 92%).
[0562] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0563] 1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.8-2.9 (1H, m), 2.9-3.1
(2H, m), 3.03 (3H, s), 4.8-5.0 (2H, m), 5.25 (2H, s), 7.11 (2H, d,
J=9 Hz), 7.42 (1H, d, J=8 Hz), 7.56 (1H, dd, J=2 Hz, 8 Hz), 7.86
(2H, d, J=9 Hz), 8.30 (2H, s), 8.58 (1H, d, J=2 Hz).
Example 58
5-Isopropenyl-2-[4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperid-
in-1-yl]pyrimidine
[0564] To a solution of
5-bromo-2-[4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-1--
yl]pyrimidine (Example 57) (31 mg, 0.062 mmol) and
isopropenylboronic acid pinacol ester (23 .mu.L, 0.124 mmol) in dry
N,N-dimethylformamide (0.3 mL) was added
[1,1-bis(diphenylphosphino)ferrocene]dichloropalladium (complex
with dichloromethane) (1 mg, 0.012 mmol) and cesium carbonate (40
mg, 0.124 mmol). The mixture was stirred at 90.degree. C. overnight
under N.sub.2, allowed to cool to room temperature, diluted with
water (1 mL) and extracted with ethyl acetate. The organic layer
was washed with brine, dried over anhydrous sodium sulfate and
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (hexane/ethyl acetate=1/2) to give
the title compound as a white crystal (23 mg, yield 78%).
[0565] FAB-MS (m/z): 465 (M+1)
[0566] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0567] 1.6-1.8 (2H, m), 1.9-2.0 (2H, m), 2.09 (3H, s), 2.8-3.0 (3H,
m), 3.02 (3H, s), 4.9-5.0 (3H, m), 5.25 (2H, s), 5.26 (1H, brs),
7.11 (2H, d, J=9 Hz), 7.41 (1H, d, J=8 Hz), 7.57 (1H, dd, J=2 Hz, 8
Hz), 7.86 (2H, d, J=9 Hz), 8.45 (2H, s), 8.50 (1H, brs).
Example 59
5-Isopropyl-2-[4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperidin-
-1-yl]pyrimidine
[0568] To a solution of
5-isopropenyl-2-[4-[2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]piperi-
din-1-yl]pyrimidine (Example 58) (21 mg, 0.045 mmol) in methanol
(0.45 mL) was added 10% palladium-carbon (10 mg). The mixture was
hydrogenated at room temperature for 1 hour and filtered through
Celite pad. The filtrate was concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=1/2) to give the title compound as a white
crystal (15 mg, yield 71%).
[0569] FAB-MS (m/z): 467 (M+1)
[0570] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0571] 1.23 (6H, d, J=7 Hz), 1.6-1.8 (2H, m), 1.9-2.0 (2H, m),
2.7-2.9 (2H, m), 2.9-3.0 (2H, m), 3.03 (3H, s), 4.9-5.0 (2H, m),
5.25 (2H, s), 7.12 (2H, d, J=9 Hz), 7.40 (1H, d, J=8 Hz), 7.57 (1H,
dd, J=2 Hz, 8 Hz), 7.87 (2H, d, J=9 Hz), 8.22 (2H, s), 8.51 (1H, d,
J=2 Hz).
[0572] IR (KBr, cm.sup.-1)
[0573] :2958, 2920, 2852, 1597, 1541, 1496, 1458, 1362, 1313, 1302,
1254, 1 230, 1176, 1149, 1095, 1051, 1014, 964, 947, 841, 804, 769,
528.
Example 60
tert-Butyl
4-[2-[2-(4-methanesulfonylphenoxyethyl)pyridine-5-yl]piperidine-
-1-carboxylate
(1) 2-(5-Bromopyridin-2-yl)ethanol
[0574] To a solution of (5-bromopyridin-2-yl)acetic acid (60.0 mg,
0.278 mmol) in dry tetrahydrofuran (1.4 mL) was added dropwise
borane-tetrahydrofuran complex (1.06M in tetrahydrofuran, 0.34 mL,
0.361 mmol) under N.sub.2. The mixture was stirred at room
temperature for 19 hours and water (5 mL)-acetic acid (5 mL) was
added slowly. The mixture was concentrated under reduced pressure,
the residue was poured into saturated aqueous sodium hydrogen
carbonate solution and extracted with ethyl acetate. The organic
layer was washed with saturated aqueous sodium hydrogen carbonate
solution, dried over anhydrous sodium sulfate and concentrated
under reduced pressure. The residue was purified by silica gel
column chromatography (hexane/ethyl acetate=7/1.fwdarw.ethyl
acetate) to give the title compound as a yellow oil (45 mg, yield
80%).
[0575] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0576] 2.98 (2H, t, J=5 Hz), 3.68 (1H, brs), 4.01 (2H, t, J=5 Hz),
7.09 (1H, d, J=8 Hz), 7.75 (1H, dd, J=2 Hz, 8 Hz), 8.57 (1H, d, J=2
Hz).
(2) tert-Butyl
4-[2-(2-hydroxyethyl)pyridin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
[0577] The title compound was prepared from
2-(5-bromopyridin-2-yl)ethanol (202 mg, 1.00 mmol) following a
procedure analogous to that in Example 3(2) as a yellow oil (310
mg, yield 99%).
[0578] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0579] 1.50 (9H, s), 2.4-2.6 (2H, m), 3.01 (2H, t, J=5 Hz), 3.6-3.7
(2H, m), 4.02 (2H, t, J=5 Hz), 4.0-4.2 (2H, m), 4.15 (1H, brs),
6.06 (1H, s), 7.13 (1H, d, J=8 Hz), 7.59 (1H, dd, J=2 Hz, 8 Hz),
8.52 (1H, d, J=2 Hz).
(3) tert-Butyl
4-[2-(2-hydroxyethyl)pyridin-5-yl]piperidine-1-carboxylate
[0580] The title compound was prepared from tert-butyl
4-[2-(2-hydroxyethyl)pyridin-2-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
(310 mg, 1.02 mmol) following a procedure analogous to that in
Example 3(3) as a yellow oil (312 mg, yield 99%).
[0581] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0582] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.05 (2H, t, J=5 Hz), 4.02 (2H, t, J=5 Hz), 4.2-4.4 (2H, m),
7.20 (1H, d, J=8 Hz), 7.55 (1H, dd, J=2 Hz, 8 Hz), 8.37 (1H, d, J=2
Hz).
(4) tert-Butyl
4-[2-[2-(4-methanesulfonylphenoxyethyl)pyridine-5-yl]-piperidine-1-carbox-
ylate
[0583] The title compound was prepared from tert-butyl
4-[2-(2-hydroxyethyl)pyridin-5-yl]piperidine-1-carboxylate (150 mg,
0.490 mmol) following a procedure analogous to that in Example 9 as
a white crystal (84 mg, yield 37%).
[0584] FAB-MS (m/z): 461 (M+1)
[0585] m.p.: 123-126.degree. C.
[0586] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0587] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 3.01 (3H, s), 3.26 (2H, t, J=7 Hz), 4.2-4.3
(2H, m), 4.44 (2H, t, J=7 Hz), 7.02 (2H, d, J=9 Hz), 7.20 (1H, d,
J=8 Hz), 7.46 (1H, dd, J=2 Hz, 8 Hz), 7.84 (2H, d, J=9 Hz), 8.42
(1H, d, J=2 Hz).
[0588] IR (KBr, cm.sup.-1)
[0589] :3014, 2981, 2920, 2870, 1685, 1597, 1577, 1493, 1460, 1423,
1365, 1 313, 1298, 1261, 1236, 1165, 1144, 1119, 1088, 1026, 966,
831, 808, 7 64, 555, 534.
Example 61
tert-Butyl
4-[2-[1-(4-methanesulfonylphenoxy)ethyl]pyridin-5-yl]piperidine-
-1-carboxylate
(1) tert-Butyl
4-[2-(1-hydroxyethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
[0590] The title compound was prepared from
1-(5-bromopyridin-2-yl)ethanol (100 mg, 0.495 mmol) following a
procedure analogous to that in Example 3(2) as a brown oil (71 mg,
yield 47%).
[0591] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0592] 1.50 (9H, s), 1.51 (3H, s), 2.4-2.6 (2H, m), 3.6-3.7 (2H,
m), 4.0-4.2 (2H, m), 4.12 (1H, brs), 4.89 (1H, q, J=6 Hz), 6.09
(1H, brs), 7.25 (1H, d, J=8 Hz), 7.66 (1H, dd, J=2 Hz, 8 Hz), 8.55
(1H, d, J=2 Hz).
(2) tert-Butyl
4-[2-(1-hydroxyethyl)pyridin-5-yl]piperidine-1-carboxylate
[0593] The title compound was prepared from tert-butyl
4-[2-(1-hydroxyethyl)pyridin-5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
(310 mg, 1.02 mmol) following a procedure analogous to that in
Example 3(3) as a yellow oil (71 mg, yield 99%).
[0594] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0595] 1.49 (9H, s), 1.4-1.6 (3H, m), 1.5-1.7 (2H, m), 1.8-1.9 (2H,
m), 2.6-2.8 (1H, m), 2.7-2.9 (2H, m), 4.1-4.4 (3H, m), 4.87 (1H, q,
J=6 Hz), 7.22 (1H, d, J=8 Hz), 7.52 (1H, dd, J=2 Hz, 8 Hz), 8.40
(1H, d, J=2 Hz).
(3) tert-Butyl
4-[2-[1-(4-methanesulfonylphenoxy)ethyl]-pyridin-5-yl]piperidine-1-carbox-
ylate
[0596] The title compound was prepared from tert-butyl
4-[2-(1-hydroxyethyl)pyridin-5-yl]piperidine-1-carboxylate (70 mg,
0.229 mmol) following a procedure analogous to that in Example 9 as
a pale yellow amorphous (79 mg, yield 75%).
[0597] FAB-MS (m/z): 461 (M+1)
[0598] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0599] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.70 (3H, d, J=6 Hz), 1.8-1.9
(2H, m), 2.6-2.9 (3H, m), 2.99 (3H, s), 4.2-4.3 (2H, m), 5.47 (1H,
q, J=6 Hz), 7.99 (2H, d, J=9 Hz), 7.30 (1H, d, J=8 Hz), 7.49 (1H,
dd, J=2 Hz, 8 Hz), 7.77 (2H, d, J=9 Hz), 8.44 (1H, d, J=2 Hz).
Example 62
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methylpyridin-5-yl]-3,6-
-dihydro-2H-pyridine-1-carboxylate
(1) 5-Bromo-2-(4-methanesulfonylphenoxymethyl)-3-methylpyridine
[0600] The title compound was prepared from
(5-bromo-3-methylpyridin-2-yl)methanol (200 mg, 0.990 mmol)
following a procedure analogous to that in Example 9 as a pale
yellow oil (238 mg, yield 68%).
[0601] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0602] 2.42 (3H, s), 3.02 (3H, s), 5.25 (2H, s), 7.14 (2H, d, J=9
Hz), 7.70 (1H, d, J=2 Hz), 7.85 (2H, d, J=9 Hz), 8.50 (1H, d, J=2
Hz).
(2) tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methylpyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate
[0603] The title compound was prepared from
5-bromo-2-(4-methanesulfonylphenoxymethyl)-3-methylpyridine (100
mg, 0.281 mmol) following a procedure analogous to that in Example
3(2) as a pale brown crystal (116 mg, yield 90%).
[0604] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0605] 1.49 (9H, s), 2.43 (3H, s), 2.4-2.6 (2H, m), 3.02 (3H, s),
3.6-3.7 (2H, m), 4.0-4.2 (2H, m), 5.29 (2H, s), 6.11 (1H, brs),
7.16 (2H, d, J=9 Hz), 7.48 (1H, s), 7.85 (2H, d, J=9 Hz), 8.46 (1H,
s).
Example 63
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methylpyridin-5-yl]pipe-
ridine-1-carboxylate
[0606] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methylpyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate (Example 62) (114 mg, 0.249 mmol)
following a procedure analogous to that in Example 3(3) as a white
crystal (90 mg, yield 79%).
[0607] FAB-MS (m/z): 461 (M+1)
[0608] m.p.: 130-132.degree. C.
[0609] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0610] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.41 (3H,
s), 2.6-2.9 (3H, m), 3.02 (3H, s), 4.2-4.4 (2H, m), 5.27 (2H, s),
7.16 (2H, d, J=9 Hz), 7.35 (1H, s), 7.85 (2H, d, J=9 Hz), 8.31 (1H,
s).
[0611] IR (KBr, cm.sup.-1)
[0612] :2972, 2924, 2843, 1693, 1595, 1577, 1502, 1400, 1367, 1313,
1298, 1 265, 1232, 1165, 1147, 1115, 1093, 1036, 1001, 970, 910,
866, 829, 80 2, 775, 621, 542, 526.
Example 64
tert-Butyl
4-[6-(4-methanesulfonylphenoxymethyl)-2-methylpyridin-3-yl]-3,6-
-dihydro-2H-pyridine-1-carboxylate
(1) 3-Bromo-6-(4-methanesulfonylphenoxymethyl)-2-methylpyridine
[0613] The title compound was prepared from
(3-bromo-2-methylpyridin-6-yl)methanol (160 mg, 0.792 mmol)
following a procedure analogous to that in Example 9 as a brown
crystal (296 mg, yield 99%).
[0614] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0615] 2.69 (3H, s), 3.03 (3H, s), 5.19 (2H, s), 7.10 (2H, d, J=9
Hz), 7.19 (1H, d, J=8 Hz), 7.83 (1H, d, J=8 Hz), 7.87 (2H, d, J=9
Hz).
(2) tert-Butyl
4-[6-(4-methanesulfonylphenoxymethyl)-2-methylpyridin-3-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate
[0616] The title compound was prepared from
3-bromo-6-(4-methanesulfonylphenoxymethyl)-2-methylpyridine (80 mg,
0.225 mmol) following a procedure analogous to that in Example 3(2)
as a pale brown amorphous (75 mg, yield 73%).
[0617] FAB-MS (m/z): 459 (M+1)
[0618] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0619] 1.51 (9H, s), 2.3-2.4 (2H, m), 2.53 (3H, s), 3.03 (3H, s),
3.6-3.7 (2H, m), 4.0-4.1 (2H, m), 5.23 (2H, s), 5.63 (1H, brs),
7.12 (2H, d, J=9 Hz), 7.27 (1H, d, J=8 Hz), 7.41 (1H, d, J=8 Hz),
7.87 (2H, d, J=9 Hz).
Example 65
tert-Butyl
4-[6-(4-methanesulfonylphenoxymethyl)-2-methylpyridin-3-yl]pipe-
ridine-1-carboxylate
[0620] The title compound was prepared from tert-butyl
4-[6-(4-methanesulfonylphenoxymethyl)-2-methylpyridin-3-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate (Example 64) (45 mg, 0.0981 mmol)
following a procedure analogous to that in Example 7 as a white
crystal (10.3 mg, yield 23%).
[0621] FAB-MS (m/z): 461 (M+1)
[0622] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0623] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.63 (3H,
s), 2.7-2.9 (3H, m), 3.03 (3H, s), 4.2-4.3 (2H, m), 5.23 (2H, s),
7.12 (2H, d, J=9 Hz), 7.31 (1H, s), 7.52 (1H, s), 7.87 (2H, d, J=9
Hz).
Example 66
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methoxypyridin-5-yl]-3,-
6-dihydro-2H-pyridine-1-carboxylate
(1)
5-Bromo-2-(4-methanesulfonylphenoxymethyl)-3-methoxypyridine
[0624] The title compound was prepared from
(5-bromo-3-methoxypyridin-2-yl)methanol (112 mg, 0.514 mmol)
following a procedure analogous to that in Example 9 as a white
amorphous (141 mg, yield 74%).
[0625] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0626] 3.02 (3H, s), 3.91 (3H, s), 5.25 (2H, s), 7.14 (2H, d, J=9
Hz), 7.40 (1H, d, J=2 Hz), 7.85 (2H, d, J=9 Hz), 8.29 (1H, d, J=2
Hz).
(2) tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methoxypyridin-5-yl]-3,6-dihydro--
2H-pyridine-1-carboxylate
[0627] The title compound was prepared from
5-bromo-2-(4-methanesulfonylphenoxymethyl)-3-methoxypyridine (141
mg, 0.379 mmol) following a procedure analogous to that in Example
3(2) as a pale yellow amorphous (159 mg, yield 88%).
[0628] FAB-MS (m/z): 475 (M+1)
[0629] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0630] 1.49 (9H, s), 2.5-2.6 (2H, m), 3.02 (3H, s), 3.6-3.7 (2H,
m), 3.91 (3H, s), 4.0-4.2 (2H, m), 5.29 (2H, s), 6.12 (1H, brs),
7.17 (2H, d, J=8 Hz), 7.18 (1H, s), 7.84 (2H, d, J=8 Hz), 8.25 (1H,
s).
Example 67
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methoxypyridin-5-yl]pip-
eridine-1-carboxylate
[0631] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-methoxypyridin-5-yl]-3,6-dihydro--
2H-pyridine-1-carboxylate (Example 66) (125 mg, 0.263 mmol)
following a procedure analogous to that in Example 7 as a white
crystal (70 mg, yield 56%).
[0632] FAB-MS (m/z): 477 (M+1)
[0633] m.p.: 153-154.degree. C.
[0634] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0635] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H,
m), 3.02 (3H, s), 3.89 (3H, s), 4.2-4.4 (2H, m), 5.27 (2H, s), 7.06
(1H, s), 7.17 (2H, d, J=9 Hz), 7.85 (2H, d, J=9 Hz), 8.12 (1H,
s).
[0636] IR (KBr, cm.sup.-1)
[0637] :2999, 2976, 2933, 2860, 1695, 1591, 1498, 1456, 1415, 1367,
1296, 1 246, 1163, 1140, 1117, 1086, 1020, 989, 955, 877, 839, 769,
571, 542, 523.
Example 68
tert-Butyl
4-[3-benzyloxy-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]--
3,6-dihydro-2H-pyridine-1-carboxylate
(1) 3-Benzyloxy-2,5-dibromopyridine
[0638] To a solution of 2,5-dibromopyridin-3-ol (200 mg, 0.791
mmol) in dry N,N-dimethylformamide (8 mL) was added potassium
carbonate (164 mg, 1.19 mmol) and benzyl bromide (0.11 mL, 0.949
mmol). The mixture was stirred at room temperature for 2 hours,
diluted with water (10 mL) and extracted with ethyl acetate. The
organic layer was washed with brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=19/1.fwdarw.3/2) to give the title compound as a white
crystal (211 mg, yield 78%).
[0639] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0640] 5.17 (2H, s), 7.30 (1H, d, J=2 Hz), 7.3-7.5 (5H, m), 8.07
(1H, d, J=2 Hz).
(2) (3-Benzyloxy-5-bromopyridin-2-yl)methanol
[0641] A solution of 3-benzyloxy-2,5-dibromopyridine (210 mg, 0.612
mmol) in toluene was cooled to -78.degree. C. under N.sub.2 and
n-butyllithium (1.60M, 0.46 mL, 0.735 mmol) was added dropwise. The
mixture was stirred at -78.degree. C. for 2.5 hours followed by the
addition of dry N,N-dimethylformamide (0.095 mL, 1.22 mmol). After
gradually warming to room temperature, methanol (5 mL) and sodium
borohydride (23 mg, 0.612 mmol) was added to the mixture. The
resulting mixture was stirred for 30 minutes, to which was added
saturated aqueous ammonium chloride solution and extracted with
ethyl acetate. The organic layer was washed with brine, dried over
anhydrous sodium sulfate and concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=4/1) to give the title compound as a yellow
crystal (111 mg, yield 62%).
[0642] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0643] 3.91 (1H, brs), 4.74 (2H, s), 5.10 (2H, s), 7.34 (1H, s),
7.3-7.5 (5H, m), 8.24 (1H, s).
(3) 3-Benzyloxy-5-bromo-2-(4-methanesulfonylphenoxymethyl)
pyridine
[0644] The title compound was prepared from
(3-benzyloxy-5-bromopyridin-2-yl)methanol (111 mg, 0.377 mmol)
following a procedure analogous to that in Example 9 as a yellow
amorphous (185 mg, yield 99%).
[0645] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0646] 3.02 (3H, s), 5.14 (2H, s), 5.29 (2H, s), 7.12 (2H, d, J=9
Hz), 7.3-7.5 (5H, m), 7.45 (1H, d, J=2 Hz), 7.83 (2H, d, J=9 Hz),
8.30 (1H, d, J=2 Hz).
(4) tert-Butyl
4-[3-benzyloxy-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydr-
o-2H-pyridine-1-carboxylate
[0647] The title compound was prepared from
3-benzyloxy-5-bromo-2-(4-methanesulfonylphenoxymethyl)pyridine (185
mg, 0.413 mmol) following a procedure analogous to that in Example
3(2) as a brown oil (168 mg, yield 74%).
[0648] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0649] 1.62 (9H, s), 2.4-2.5 (2H, m), 3.02 (3H, s), 3.6-3.7 (2H,
m), 4.0-4.1 (2H, m), 5.17 (2H, s), 5.34 (2H, s), 6.08 (1H, brs),
7.15 (2H, d, J=9 Hz), 7.23 (1H, s), 7.3-7.5 (5H, m), 7.82 (2H, d,
J=9 Hz), 8.26 (1H, s).
Example 69
tert-Butyl
4-[3-hydroxy-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]pip-
eridine-1-carboxylate
[0650] The title compound was prepared from tert-butyl
4-[3-benzyloxy-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydr-
o-2H-pyridine-1-carboxylate (Example 68) (60 mg, 0.109 mmol)
following a procedure analogous to that in Example 3(3) as a white
crystal (17 mg, yield 34%).
[0651] FAB-MS (m/z): 463 (M+1)
[0652] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0653] 1.48 (9H, s), 1.4-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.02 (3H, s), 4.2-4.3 (2H, m), 5.42 (2H, s), 6.58 (1H, brs),
7.06 (1H, d, J=1 Hz), 7.18 (2H, d, J=9 Hz), 7.88 (2H, d, J=9 Hz),
8.07 (1H, d, J=1 Hz).
Example 70
tert-Butyl
4-[3-chloro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-
-dihydro-2H-pyridine-1-carboxylate
(1) (5-Bromo-3-chloropyridin-2-yl)methanol
[0654] The title compound was prepared from
3-chloro-2,5-dibromopyridine (100 mg, 0.369 mmol) following a
procedure analogous to that in Example 68(2) as a pale yellow
crystal (48 mg, yield 59%).
[0655] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0656] 3.93 (1H, brs), 4.75 (2H, s), 7.86 (1H, d, J=2 Hz), 8.56
(1H, brs).
(2) 5-Bromo-3-chloro-2-(4-methanesulfonylphenoxymethyl)pyridine
[0657] The title compound was prepared from
(5-bromo-3-chloropyridin-2-yl)methanol (48 mg, 0.216 mmol)
following a procedure analogous to that in Example 9 as a yellow
crystal (64 mg, yield 79%).
[0658] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0659] 3.03 (3H, s), 5.33 (2H, s), 7.14 (2H, d, J=9 Hz), 7.87 (2H,
d, J=9 Hz), 7.94 (1H, d, J=2 Hz), 8.59 (1H, d, J=2 Hz).
(3) tert-Butyl
4-[3-chloro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate
[0660] The title compound was prepared from
5-bromo-3-chloro-2-(4-methanesulfonylphenoxymethyl)pyridine (64 mg,
0.170 mmol) following a procedure analogous to that in Example 3(2)
as a white amorphous (71 mg, yield 87%).
[0661] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0662] 1.49 (9H, s), 2.4-2.6 (2H, m), 3.03 (3H, s), 3.6-3.7 (2H,
m), 3.9-4.1 (2H, m), 5.36 (2H, s), 6.18 (1H, brs), 7.16 (2H, d, J=9
Hz), 7.70 (1H, d, J=2 Hz), 7.87 (2H, d, J=9 Hz), 8.55 (1H, d, J=2
Hz).
Example 71
tert-Butyl
4-[3-chloro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0663] To a solution of tert-butyl
4-[3-chloro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate (Example 70) (50 mg, 0.104 mmol) in ethyl
acetate (1 mL) was added platinum oxide (5 mg). The mixture was
hydrogenated at room temperature for 4 hours and filtered through
Celite pad. The filtrate was concentrated under reduced pressure.
The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=1/1) to give the title compound as a white
amorphous (13 mg, yield 26%).
[0664] FAB-MS (m/z): 481 (M+1)
[0665] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0666] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H,
m), 3.03 (3H, s), 4.2-4.4 (2H, m), 5.35 (2H, s), 7.16 (2H, d, J=9
Hz), 7.58 (1H, s), 7.87 (2H, d, J=9 Hz), 8.40 (1H, s).
Example 72
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-trifluoromethylpyridin--
5-yl]-3,6-dihydro-2H-pyridine-1-carboxylate
(1) (5-Bromo-3-trifluoromethylpyridin-2-yl)methanol
[0667] The title compound was prepared from
2,5-dibromo-3-trifluoromethylpyridine (120 mg, 0.394 mmol)
following a procedure analogous to that in Example 68(2) as a
yellow crystal (39 mg, yield 39%).
[0668] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0669] 4.16 (1H, t, J=5 Hz), 4.86 (2H, d, J=5 Hz), 8.10 (1H, d, J=2
Hz), 8.82 (1H, d, J=2 Hz).
(2)
5-Bromo-2-(methanesulfonylphenoxymethyl)-3-trifluoromethylpyridine
[0670] The title compound was prepared from
(5-bromo-3-trifluoromethylpyridin-2-yl)methanol (39 mg, 0.152 mmol)
following a procedure analogous to that in Example 9 as a yellow
crystal (58 mg, yield 93%).
[0671] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0672] 3.03 (3H, s), 5.37 (2H, s), 7.11 (2H, d, J=9 Hz), 7.87 (2H,
d, J=9 Hz), 8.18 (1H, d, J=2 Hz), 8.86 (1H, d, J=2 Hz).
(3) tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-trifluoromethylpyridin-5-yl]-3,6--
dihydro-2H-pyridine-1-carboxylate
[0673] The title compound was prepared from
5-bromo-2-(methanesulfonylphenoxymethyl)-3-trifluoromethylpyridine
(58 mg, 0.141 mmol) following a procedure analogous to that in
Example 3(2) as a pale yellow oil (7 mg, yield 10%).
[0674] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0675] 1.50 (9H, s), 2.5-2.6 (2H, m), 3.03 (3H, s), 3.6-3.7 (2H,
m), 4.1-4.2 (2H, m), 5.40 (2H, s), 6.24 (1H, brs), 7.12 (2H, d, J=9
Hz), 7.87 (2H, d, J=9 Hz), 7.97 (1H, d, J=2 Hz), 8.80 (1H, d, J=2
Hz).
Example 73
tert-Butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-trifluoromethylpyridin--
5-yl]piperidine-1-carboxylate
[0676] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonylphenoxymethyl)-3-trifluoromethylpyridin-5-yl]-3,6--
dihydro-2H-pyridine-1-carboxylate (Example 72) (7 mg, 0.0137 mmol)
following a procedure analogous to that in Example 71 as a white
amorphous (7 mg, yield 99%).
[0677] FAB-MS (m/z): 515 (M+1)
[0678] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0679] 1.49 (9H, s), 1.6-1.7 (2H, m), 1.8-1.9 (2H, m), 2.7-2.8 (3H,
m), 3.03 (3H, s), 4.2-4.4 (2H, m), 5.38 (2H, s), 7.12 (2H, d, J=9
Hz), 7.84 (1H, d, J=2 Hz), 7.87 (2H, d, J=9 Hz), 8.67 (1H, d, J=2
Hz).
Example 74
tert-Butyl
4-[3-fluoro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-
-dihydro-2H-pyridine-1-carboxylate
(1) (5-Bromo-3-fluoropyridin-2-yl)methanol
[0680] The title compound was prepared from
3-fluoro-2,5-dibromopyridine (200 mg, 0.785 mmol) following a
procedure analogous to that in Example 68(2) as a pale yellow
crystal (109 mg, yield 67%).
[0681] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0682] 3.54 (1H, t, J=5 Hz), 4.79 (2H, dd, J=1 Hz, 5 Hz), 7.60 (1H,
dd, J=1 Hz, 8 Hz), 8.49 (1H, s).
(2) 5-Bromo-3-fluoro-2-(4-methanesulfonylphenoxymethyl)pyridine
[0683] The title compound was prepared from
(5-bromo-3-fluoropyridin-2-yl)methanol (109 mg, 0.529 mmol)
following a procedure analogous to that in Example 9 as a white
crystal (137 mg, yield 72%).
[0684] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0685] 3.03 (3H, s), 5.29 (2H, d, J=2 Hz), 7.15 (2H, d, J=9 Hz),
7.68 (1H, dd, J=2 Hz, 9 Hz), 7.87 (2H, d, J=9 Hz), 8.54 (1H, d, J=2
Hz).
(3) tert-Butyl
4-[3-fluoro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate
[0686] The title compound was prepared from
5-bromo-3-fluoro-2-(4-methanesulfonylphenoxymethyl)pyridine (70 mg,
0.194 mmol) following a procedure analogous to that in Example 3(2)
as a pale yellow amorphous (93 mg, yield>99%).
[0687] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0688] 1.49 (9H, s), 2.4-2.6 (2H, m), 3.02 (3H, s), 3.6-3.7 (2H,
m), 4.1-4.2 (2H, m), 5.32 (2H, d, J=2 Hz), 6.19 (1H, brs), 7.17
(2H, d, J=9 Hz), 7.41 (1H, dd, J=2 Hz, 11 Hz), 7.87 (2H, d, J=9
Hz), 8.50 (1H, brs).
Example 75
tert-Butyl
4-[3-fluoro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0689] The title compound was prepared from tert-butyl
4-[3-fluoro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate (Example 74) (50 mg, 0.108 mmol) following
a procedure analogous to that in Example 7 as a white crystal (13
mg, yield 26%).
[0690] FAB-MS (m/z): 465 (M+1)
[0691] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0692] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.7-2.9 (3H,
m), 3.02 (3H, s), 4.2-4.3 (2H, m), 5.30 (2H, d, J=2 Hz), 7.17 (2H,
d, J=9 Hz), 7.30 (1H, dd, J=2 Hz, 9 Hz), 7.87 (2H, d, J=9 Hz), 8.34
(1H, brs).
Example 76
tert-Butyl
4-[4-chloro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-
-dihydro-2H-pyridine-1-carboxylate
(1) 5-Bromo-4-chloro-2-(4-methanesulfonylphenoxymethyl)pyridine
[0693] The title compound was prepared from
(5-bromo-4-chloropyridin-2-yl)methanol (100 mg, 0.450 mmol)
following a procedure analogous to that in Example 9 as a white
crystal (127 mg, yield 75%).
[0694] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0695] 3.04 (3H, s), 5.21 (2H, s), 7.11 (2H, d, J=9 Hz), 7.62 (1H,
s), 7.90 (2H, d, J=9 Hz), 8.73 (1H, s).
(2) tert-Butyl
4-[4-chloro-2-(4-methanesulfonylphenoxymethyl)pyridin-5-yl]-3,6-dihydro-2-
H-pyridine-1-carboxylate
[0696] The title compound was prepared from
5-bromo-4-chloro-2-(4-methanesulfonylphenoxymethyl)pyridine (127
mg, 0.337 mmol) following a procedure analogous to that in Example
3(2) as a white crystal (128 mg, yield 79%).
[0697] FAB-MS (m/z): 479 (M+1)
[0698] m.p.: 148-150.degree. C.
[0699] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0700] 1.51 (9H, s), 2.4-2.5 (2H, m), 3.04 (3H, s), 3.6-3.7 (2H,
m), 4.0-4.2 (2H, m), 5.24 (2H, s), 5.79 (1H, brs), 7.13 (2H, d, J=9
Hz), 7.51 (1H, s), 7.89 (2H, d, J=9 Hz), 8.39 (1H, s).
Example 77
tert-Butyl
4-[2-[(4-methanesulfonylphenylamino)methyl]pyridin-5-yl]piperid-
ine-1-carboxylate
(1) tert-Butyl
4-[(2-azidomethyl)pyridin-5-yl]piperidine-1-carboxylate
[0701] To an ice-cooled solution of tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (116 mg, 0.397 mmol) in dry tetrahydrofuran (4.0 mL) was
added sequentially diphenylphosphoryl azide (94 .mu.L, 0.437 mmol)
and 1,8-diazabicyclo[5,4,0]undec-7-ene (59 .mu.L, 0.397 mmol) under
N.sub.2. The mixture was stirred at 0.degree. C. for 1 hour and
then stirred at room temperature for an additional 24 hours. To the
mixture was added saturated aqueous citric acid solution and
extracted with ethyl acetate. The organic layer was washed
sequentially with water and brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure. The residue was
purified by silica gel column chromatography to give the title
compound (55 mg, yield 44%).
[0702] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0703] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 4.46 (2H, s), 7.29 (1H, d,
J=8 Hz), 7.55 (1H, dd, J=2 Hz, 8 Hz), 8.47 (1H, d, J=2 Hz).
(2) tert-Butyl
4-[2-[(4-methanesulfonylphenylamino)methyl]pyridin-5-yl]piperidine-1-carb-
oxylate
[0704] To a solution of tert-butyl
4-[(2-azidomethyl)pyridin-5-yl]piperidine-1-carboxylate (55 mg,
0.173 mmol) in methanol (5.0 mL) was added 10% palladium-carbon
(6.0 mg). The mixture was hydrogenated at room temperature for 24
hours and filtered through Celite pad. The filtrate was
concentrated under reduced pressure to give tert-butyl
4-[(2-aminomethyl)pyridin-5-yl]-piperidine-1-carboxylate.
[0705] solution of tert-butyl
4-[(2-aminomethyl)pyridin-5-yl]piperidine-1-carboxylate,
1-bromo-4-methanesulfonylbenzene (40 mg, 0.170 mmol), potassium
hydroxide (19 mg, 0.339 mmol),
tris(dibenzylideneacetone)dipalladium(0) (3 mg, 3.28 .mu.mol) and
5-(di-tert-butylphosphino)-1',3',5'-triphenyl-1'H-[1,4']bipyrazole
(5 mg, 9.87 .mu.mol) in 2-methyl-2-butanol (8.0 mL)-water (4.0 mL)
was stirred at 100.degree. C. overnight, allowed to cool to room
temperature, diluted with water and extracted with ethyl acetate.
The organic layer was washed with brine, dried over anhydrous
sodium sulfate and concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (chloroform/ethyl
acetate=1/3) to give the title compound as a pale yellow oil (3.4
mg, yield 4%).
[0706] FAB-MS (m/z): 446 (M+1)
[0707] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0708] 1.48 (9H, s), 1.5-1.9 (4H, m), 2.6-2.8 (1H, m), 2.7-2.9 (2H,
m), 3.00 (3H, s), 4.2-4.4 (2H, m), 4.49 (2H, s), 5.61 (1H, brs),
6.71 (2H, d, J=9 Hz), 7.27 (1H, d, J=8 Hz), 7.54 (1H, dd, J=2 Hz, 8
Hz), 7.71 (2H, d, J=9 Hz), 8.46 (1H, d, J=2 Hz).
Example 78
tert-Butyl(E)-4-[2-[2-(4-methanesulfonylphenyl)vinyl]pyridin-5-yl]piperidi-
ne-1-carboxylate
[0709] A solution of tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (200 mg, 0.684 mmol), tetrabromomethane (227 mg, 0.684 mmol)
and triphenylphosphine (216 mg, 0.824 mmol) in dry dichloromethane
(5.0 mL) was stirred at 0.degree. C. for 1 hour under N.sub.2. The
mixture was diluted with water and extracted with ethyl acetate.
The organic layer was washed sequentially with water and brine,
dried over anhydrous sodium sulfate and concentrated under reduced
pressure.
[0710] To the residue was added triethyl phosphite (273 .mu.L, 2.12
mmol). The resulting mixture was stirred at 150.degree. C. for 1
hour and concentrated in vacuo. An ice-cooled solution of the
residue in dry tetrahydrofuran (3.0 mL) was added sodium hydride
(60% dispersion in mineral oil, 33 mg, 0.825 mmol) under N.sub.2.
The mixture was stirred at room temperature for 1 hour followed by
the addition of a solution of 4-methanesulfonylbenzaldehyde (84 mg,
0.456 mmol) in dry tetrahydrofuran (2.0 mL). The resulting mixture
was stirred at room temperature for 2 hours, diluted with water and
extracted with ethyl acetate. The organic layer was washed with
brine, dried over anhydrous sodium sulfate and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography to give the title compound as a pale brown crystal
(27 mg, yield 9%).
[0711] FAB-MS (m/z): 443 (M+1)
[0712] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0713] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.6-2.8 (1H,
m), 2.7-2.9 (2H, m), 3.07 (3H, s), 4.1-4.4 (2H, m), 7.28 (1H, d,
J=15 Hz), 7.37 (1H, d, J=8 Hz), 7.54 (1H, dd, J=2 Hz, 8 Hz), 7.65
(1H, d, J=15 Hz), 7.73 (2H, d, J=8 Hz), 7.93 (2H, d, J=8 Hz), 8.51
(1H, d, J=2 Hz).
Example 79
tert-Butyl
4-[2-[2-(4-methanesulfonylphenyl)ethyl]pyridin-5-yl]piperidine--
1-carboxylate
[0714] The title compound was prepared from
tert-butyl(E)-4-[2-[2-(4-methanesulfonylphenyl)vinyl]pyridin-5-yl]piperid-
ine-1-carboxylate (Example 78) (14 mg, 31.6 .mu.mmol) following a
procedure analogous to that in Example 3(3) as a white crystal (11
mg, yield 78%).
[0715] FAB-MS (m/z): 445 (M+1)
[0716] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0717] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.7 (1H,
m), 2.7-2.9 (2H, m), 3.04 (3H, s), 3.0-3.1 (2H, m), 3.1-3.2 (2H,
m), 4.1-4.4 (2H, m), 7.02 (1H, d, J=8 Hz), 7.38 (2H, d, J=8 Hz),
7.41 (1H, dd, J=2 Hz, 8 Hz), 7.83 (2H, d, J=8 Hz), 8.42 (1H,
brs).
Example 80
tert-Butyl
4-[2-(2-chloro-4-methanesulfonylphenoxymethyl)-3-methylpyridin--
5-yl]piperidine-1-carboxylate
(1)
5-Bromo-2-(tert-butyldimethylsilanyloxymethyl)-3-methylpyridine
[0718] To a solution of 5-bromo-2-hydroxymethyl-3-methylpyridine (1
g, 5 mmol) in N,N-dimethylformamide (50 mL) was added triethylamine
(1.56 mL, 15 mmol) and tert-butylchlorodimethylsilane (1.13 g, 7.5
mmol). The mixture was stirred at room temperature for 4 hours,
diluted with water (50 mL) and extracted with ethyl acetate. The
organic layer was washed with brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure.
[0719] The residue was purified by silica gel column chromatography
(hexane/ethyl acetate=4/1) to give the title compound as a
colorless oil (1.51 g, yield 100%).
[0720] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0721] 0.07 (6H, s), 0.89 (9H, s), 2.40 (3H, s), 4.77 (2H, s), 7.61
(1H, brs), 8.41 (1H, d, J=2 Hz).
(2) tert-Butyl
4-[2-(tert-butyldimethylsilanyloxymethyl)-3-methylpyridin-5-yl]-3,6-dihyd-
ro-2H-pyridine-1-carboxylate
[0722] The title compound was prepared from
5-bromo-2-(tert-butyldimethylsilanyloxymethyl)-3-methylpyridine
(907 mg, 3 mmol) following a procedure analogous to that in Example
3(2) as a yellow oil (1.12 g, yield 97%).
[0723] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0724] 0.07 (6H, s), 0.89 (9H, s), 1.49 (9H, s), 2.41 (3H, s),
2.4-2.6 (2H, m), 3.6-3.7 (2H, m), 4.0-4.1 (2H, m), 4.81 (2H, s),
6.07 (1H, brs), 7.42 (1H, d, J=2 Hz), 8.37 (1H, d, J=2 Hz).
(3) tert-Butyl
4-[(2-hydroxymethyl)-3-methylpyridin-5-yl]piperidine-1-carboxylate
[0725] To a solution of tert-butyl
4-[2-(tert-butyldimethylsilanyloxymethyl)-3-methylpyridin-5-yl]-3,6-dihyd-
ro-2H-pyridine-1-carboxylate (1.18 g, 2.91 mmol) in dry
tetrahydrofuran (29 mL) was added tetrabutylammonium fluoride (1.0M
in tetrahydrofuran, 4.37 mL, 4.37 mmol). The mixture was stirred at
room temperature for 5 hours and diluted with ethyl acetate. The
organic layer was washed with brine, dried over anhydrous sodium
sulfate and concentrated under reduced pressure.
[0726] To a solution of the residue in methanol (29 mL) was added
10% palladium-carbon (617 mg). The mixture was hydrogenated at room
temperature for 1 hour and filtered through Celite pad. The
filtrate was concentrated under reduced pressure. The residue was
purified by silica gel column chromatography (hexane/ethyl
acetate=1/2) to give the title compound as a white crystal (605 mg,
yield 68%).
[0727] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0728] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.20 (3H,
s), 2.6-2.9 (3H, m), 4.2-4.4 (2H, m), 4.6-4.8 (1H, m), 4.66 (2H,
s), 7.26 (1H, s), 8.26 (1H, s).
(4) tert-Butyl
4-[2-(2-chloro-4-methanesulfonylphenoxymethyl)-3-methylpyridin-5-yl]piper-
idine-1-carboxylate
[0729] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonyloxymethyl)-3-methylpyridin-5-yl]piperidine-1-carbo-
xylate (30 mg, 0.098 mmol) and 2-chloro-4-methanesulfonylphenol (26
mg, 0.127 mmol) following a procedure analogous to that in Example
9 as a white crystal (17 mg, yield 34%).
[0730] FAB-MS (m/z): 495 (M+1)
[0731] m.p.: 143-145.degree. C.
[0732] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0733] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.46 (3H,
s), 2.6-2.9 (3H, m), 3.03 (3H, s), 4.2-4.4 (2H, m), 5.38 (2H, s),
7.3-7.4 (2H, m), 7.77 (1H, dd, J=2 Hz, 9 Hz), 7.92 (1H, d, J=2 Hz),
8.29 (1H, d, J=2 Hz).
[0734] IR (KBr, cm.sup.-1)
[0735] :3022, 2981, 2929, 2852, 1685, 1585, 1491, 1429, 1392, 1367,
1311, 1 279, 1236, 1149, 1122, 1101, 1059, 1030, 999, 962, 901,
864, 825, 762, 725, 584, 525, 492.
Example 81
tert-Butyl
4-[2-(2-bromo-4-methanesulfonylphenoxymethyl)-3-methylpyridin-5-
-yl]piperidine-1-carboxylate
[0736] The title compound was prepared from tert-butyl
4-[2-(4-methanesulfonyloxymethyl)-3-methylpyridin-5-yl]piperidine-1-carbo-
xylate (Example 80(3)) (30 mg, 0.098 mmol) and
2-bromo-4-methanesulfonylphenol (32 mg, 0.127 mmol) following a
procedure analogous to that in Example 9 as a colorless oil (15 mg,
yield 27%).
[0737] FAB-MS (m/z): 539 (M+1), 541 (M+3)
[0738] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0739] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.47 (3H,
s), 2.6-2.9 (3H, m), 3.03 (3H, s), 4.2-4.4 (2H, m), 5.38 (2H, s),
7.3-7.4 (2H, m), 7.80 (1H, dd, J=2 Hz, 9 Hz), 7.92 (1H, d, J=2 Hz),
8.29 (1H, d, J=2 Hz).
Example 82
tert-Butyl
4-[2-(4-methanesulfonyl-2-methylphenoxymethyl)-3-methylpyridin--
5-yl]piperidine-1-carboxylate
[0740] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)-3-methylpyridin-5-yl]piperidine-1-carboxylate
(Example 80(3)) (69 mg, 0.225 mmol) and
4-methanesulfonyl-2-methylphenol (48 mg, 0.260 mmol) following a
procedure analogous to that in Example 1(3) and (4) as a pale
yellow amorphous (37 mg, yield 30%).
[0741] FAB-MS (m/z): 474 (M+1)
[0742] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0743] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.26 (3H,
s), 2.42 (3H, s), 2.6-2.9 (3H, m), 3.01 (3H, s), 4.1-4.4 (2H, m),
5.29 (2H, s), 7.19 (1H, d, J=9 Hz), 7.35 (1H, d, J=2 Hz), 7.68 (1H,
d, J=2 Hz), 7.73 (1H, dd, J=2 Hz, 9 Hz), 8.30 (1H, d, J=2 Hz).
Example 83
tert-Butyl
4-[2-[2-fluoro-4-(tetrazol-1-yl)phenoxymethyl]-3-methylpyridin--
5-yl]piperidine-1-carboxylate
[0744] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)-3-methylpyridin-5-yl]piperidine-1-carboxylate
(Example 80(3)) (80 mg, 0.26 mmol) and
1-(3-fluoro-4-hydroxyphenyl)tetrazole (50 mg, 0.27 mmol) following
a procedure analogous to that in Example 9 as a pink crystal (25
mg, yield 20%).
[0745] FAB-MS (m/z): 469 (M+1)
[0746] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0747] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.47 (3H,
s), 2.6-2.8 (1H, m), 2.7-2.9 (2H, m), 4.2-4.4 (2H, m), 5.35 (2H,
s), 7.3-7.5 (3H, m), 7.48 (1H, dd, J=2 Hz, 8 Hz), 8.30 (1H, d, J=2
Hz), 8.88 (1H, s).
Example 84
tert-Butyl
4-[2-(4-methanesulfonylphenylthiomethyl)pyridin-5-yl]piperidine-
-1-carboxylate
[0748] A suspension of tert-butyl
4-[2-(methanesulfonyloxymethyl)pyridin-5-yl]piperidine-1-carboxylate
(Example 1(3)) (61 mg, 0.165 mmol), methanesulfonylbenzenethiol (31
mg, 0.165 mmol) and cesium carbonate (81 mg, 0.247 mmol) in acetone
(1.6 mL) was stirred at room temperature for 20 hours. To the
mixture was added saturated aqueous ammonium chloride solution and
extracted with ethyl acetate. The organic layer was washed with
brine, dried over anhydrous sodium sulfate and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (hexane/ethyl acetate=1/2) and recrystallization
(hexane-ethyl acetate) to give the title compound as a white
crystal (52 mg, yield 68%).
[0749] FAB-MS (m/z): 463 (M+1)
[0750] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0751] 1.48 (9H, s), 1.5-1.7 (2H, m), 1.7-1.9 (2H, m), 2.6-2.9 (3H,
m), 3.02 (3H, s), 4.2-4.3 (2H, m), 4.34 (2H, s), 7.36 (1H, d, J=8
Hz), 7.4-7.5 (3H, m), 7.78 (2H, d, J=8 Hz), 8.42 (1H, d, J=2
Hz).
[0752] IR (KBr, cm.sup.-1)
[0753] :3003, 2976, 2922, 2850, 1687, 1577, 1479, 1423, 1394, 1365,
1304, 1 275, 1234, 1171, 1151, 1082, 1022, 970, 887, 862, 820, 779,
735, 573, 532.
Example 85
tert-Butyl
4-[2-(4-methanesulfonyl-3-methylphenoxymethyl)pyridin-5-yl]pipe-
ridine-1-carboxylate
[0754] The title compound was prepared from tert-butyl
4-[(2-hydroxymethyl)pyridin-5-yl]piperidine-1-carboxylate (Example
1(2)) (64 mg, 0.219 mmol) and 4-methanesulfonyl-3-methylphenol (41
mg, 0.219 mmol) following a procedure analogous to that in Example
1(3) and (4) as a pale yellow amorphous (35 mg, yield 35%).
[0755] FAB-MS (m/z): 461 (M+1)
[0756] .sup.1H NMR (CDCl.sub.3, 400 MHz): .delta.=
[0757] 1.49 (9H, s), 1.5-1.7 (2H, m), 1.8-1.9 (2H, m), 2.66 (3H,
s), 2.6-2.9 (3H, m), 3.04 (3H, s), 4.2-4.4 (2H, m), 5.22 (2H, s),
6.8-7.0 (2H, m), 7.41 (1H, d, J=8 Hz), 7.55 (1H, dd, J=2 Hz, 8 Hz),
7.96 (1H, d, J=8 Hz), 8.48 (1H, d, J=2 Hz).
Example 86
Pharmacological Experiment 1
[0758] (1) Construction of the Stable Cell Line Expressing Human
G-Protein Coupled Receptor 119 (hGPR119)
[0759] hGPR119 gene (NM 178471) was purchased from American Type
Culture Collection (ATCC No. 10807349). The forward primer that was
added a HindIII site (tcctggatccatggaatcatctttctcatt (sequence
number 1)), and the reverse primer that was added an ApaI site
(tcctgggcccttagccatcaaactctgagc (sequence number 2)) were designed,
the target gene was amplified by polymerase chain reaction (PCR)
using a KOD-Plus-Ver.2 (TOYOBO #KOD-211). PCR was repeated 3 steps
(98.degree. C. for 10 sec, 55.degree. C. for 30 sec, 68.degree. C.
for 1 min 15 sec) by 35 cycles. Amplified PCR product was inserted
in pcDNA5/FRT/TO (Invitrogen #V6520-20), and the stable cell line
that expresses target gene when induced with tetracycline was
created using the Flp-In T-Rex system (Invitrogen).
(2) Measuring Method of Intracellular Cyclic Adenosine
Monophosphate (cAMP)
[0760] hGPR119 stable cells made by above-mentioned (1) were plated
on 96 well plates in Dulbecco's Modified Eagle Medium containing
10% heat-inactivated FBS. After 24 hours, the hGPR119 expression
was induced by adding medium containing tetracycline (Invitrogen
#Q10019) and incubating for another 24 hours. Following incubation,
cells were stimulated by 0.5 mM 3-ISOBUTYL-1-METHYLXANTHINE (Sigma
#17018) phosphate buffered saline containing test compound for 30
minutes at 37.degree. C. Agonist activity of test compound to the
GPR119 receptor was estimated by measuring the intracellular cAMP
concentration using a Fluostar optima plate reader (BMG LABTECH)
according to the manufacturer's protocol of the HitHunter.TM. cAMP
XS+Assay (GE Healthcare #90007503).
(3) Experimental Result
[0761] Examination results are shown in Table 16
TABLE-US-00016 TABLE 16 Test compound EC.sub.50 (nM) Example 1 26.8
Example 2 606
[0762] As is clear from Table 16, the compounds of Example 1 and 2
according to the invention show an excellent GPR119 agonist
effect.
Example 87
Pharmacological Experiment 2
[0763] The examination was performed by the method similar to
Example 86 (Pharmacological experiment 1)-(1), -(2). Those results
are shown in Table 17
TABLE-US-00017 TABLE 17 Test compound EC.sub.50 (nM) Example 8 137
Example 12 54.7 Example 16 129 Example 17 34.0 Example 18 85.4
Example 21 59.3 Example 22 24.0 Example 25 21.2 Example 37 80.6
Example 41 114 Example 48 137 Example 51 257 Example 63 28.4
Example 71 29.3 Example 73 48.0 Example 75 22.4 Example 79 142
Example 80 65.9 Example 81 39.2 Example 82 58.8 Example 83 21.9
Example 84 128
Example 88
Pharmacological Experiment 3
[0764] Oral Glucose Tolerance Test in Normal Mice
(Experimental Procedure)
[0765] In this experiment, we examined the inhibitory effect of
test compound on glycemic excursions after glucose administration
in normal mice. The test methods are shown as follows.
[0766] Male 9-week-old ICR mice, habituated to the experimental
environment for two weeks, were fasted for 18 hours and used to
this experiment. Mice were orally administered the test compound or
vehicle (polyethylene glycol 400:ethanol:Tween80=8:1:1), and after
30 minutes, they were orally given glucose at the dose of 3
g/kg.
[0767] Blood was collected at just before the test compound or
vehicle administration (-30 min), immediately before glucose
challenge (0 min), 20 min, 40 min, 60 min and 120 min after glucose
ingestion and then blood glucose levels were determined.
[0768] Inhibition rate (%) of the test compound versus vehicle in
areas under the glycemic excursion curve between 0 and 120 min
after glucose challenge was determined.
(Experimental Result)
[0769] Results are shown at table 18.
TABLE-US-00018 TABLE 18 Test compound (10 mg/kg) Inhibition rate
(%) Example 1 41.8
[0770] As described above, this invented compound showed strong
inhibitory effect of glycemic excursions on oral glucose tolerance
test in normal mice.
* * * * *