U.S. patent application number 13/732625 was filed with the patent office on 2014-01-16 for method for detection of pathogenic organisms.
The applicant listed for this patent is Bjorn HERRMANN, Leif KIRSEBOM, Pelle STOLT. Invention is credited to Bjorn HERRMANN, Leif KIRSEBOM, Pelle STOLT.
Application Number | 20140018445 13/732625 |
Document ID | / |
Family ID | 20278064 |
Filed Date | 2014-01-16 |
United States Patent
Application |
20140018445 |
Kind Code |
A1 |
HERRMANN; Bjorn ; et
al. |
January 16, 2014 |
METHOD FOR DETECTION OF PATHOGENIC ORGANISMS
Abstract
A method for detection of pathogenic organisms wherein the
method includes differentiation between species. The method is
especially suitable to detect and to diagnose infection by
pathogenic organisms which are hard and/or laborious to detect with
conventional methods. The method relies upon analysis of specific
variable regions of the RNase P RNA gene, namely the P3 and/or P19
region(s).
Inventors: |
HERRMANN; Bjorn; (UPPSALA,
SE) ; KIRSEBOM; Leif; (UPPSALA, SE) ; STOLT;
Pelle; (UPPSALA, SE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
HERRMANN; Bjorn
KIRSEBOM; Leif
STOLT; Pelle |
UPPSALA
UPPSALA
UPPSALA |
|
SE
SE
SE |
|
|
Family ID: |
20278064 |
Appl. No.: |
13/732625 |
Filed: |
January 2, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10169831 |
Nov 13, 2002 |
8367321 |
|
|
PCT/SE01/00031 |
Jan 10, 2001 |
|
|
|
13732625 |
|
|
|
|
Current U.S.
Class: |
514/789 ;
435/6.12 |
Current CPC
Class: |
C12Q 1/689 20130101 |
Class at
Publication: |
514/789 ;
435/6.12 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 10, 2000 |
SE |
0000061-2 |
Claims
1. A method for detection of a pathogenic organism, comprising
analyzing a P3 and/or P19 hypervariable region of an RNase P RNA
gene.
2. The method according to claim 1, wherein the pathogenic organism
is mycobacteria or chlamydia.
3. The method according to claim 1, wherein said analyzing
comprises amplifying nucleic acid corresponding to the P3 and/or
P19 hypervariable region.
4. The method according to claim 3, wherein said analyzing further
comprises sequencing the nucleic acid for species
identification.
5. The method according to claims 3, wherein said analyzing further
comprises fingerprinting the nucleic acid for species
identification.
6. The method according to claim 5, wherein the nucleic acid is
fingerprinted by a technique selected from the group consisting of
Restriction Fragment Length Polymorphism (RFLP), heteroduplex
analysis, size determination, melting point determination and
combinations thereof.
7. The method according to claim 3, wherein the pathogenic organism
is chlamydia and primers used for amplification are JB1 (SEQ ID NO:
7) and JB2 (SEQ ID NO: 8).
8. A method for detection of a pathogenic organism, comprising
amplifying nucleic acids of at least one hypervariable region of
the RNase P RNA gene from the pathogenic organism; forming a
heteroduplex with related nucleic acid; and analyzing thereof.
9. The method according to claim 8, wherein the hypervariable
region is P3 and/or P19.
10. The method according to claim 8, wherein the pathogenic
organism is mycobacteria or chlamydia.
11. The method according to claim 10, wherein the pathogenic
organism is chlamydia and primers used for amplification are JB1
(SEQ ID NO: 7) and JB2 (SEQ ID NO: 8).
12. A method of treating a microbial infection comprising
administering an effective amount of a medicament that targets the
P3 and/or P19 variable region in the RNAse P RNA gene.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a method for detection of
pathogenic organisms wherein the method includes differentiation
between species. The method is especially suitable to detect and to
diagnose infection by pathogenic organisms which are hard and/or
laborious to detect with conventional methods. The method relies
upon analysis of specific variable regions of the RNase P RNA
gene.
BACKGROUND OF THE INVENTION
[0002] RNase P is an enzyme present in all living cells. It
catalyses the removal of 5' leader sequences from tRNA precursor
molecules. In bacteria, RNase P consists of an RNA molecule of some
400 nt in length (11, 28) and a small (about 120 aa) protein (33).
In the division bacteria, the RNA moiety has been shown to function
as an efficient catalyst in vitro (12); hence at least in these
organisms, RNase P is a ribozyme (an RNA molecule catalysing
chemical reactions). Bacterial RNase P RNAs have been separated
into two main structural classes. Type A is the most common
structural class and type B is found in the low G+C Gram-positive
Bacteria (50). The secondary structure of RNase P RNA has been
characterised for many bacterial lineages and variation among the
helices provides useful phylogenetic information (51).
[0003] The RNase P RNA gene sequences are not very well preserved
between bacterial groups, (5) but within a genus, genes can be
quite similar. Several hundreds of RNase P RNA sequences are
present in the RNase P RNA database
((http://jwbrown.mbio.ncsu.edu/RNaseP/home.html).
[0004] The order Chlamydiales is a group of obligately
intracellular bacteria which have a unique developmental cycle and
pathogenicity. They are parasites of humans and a wide variety of
animals. Species in the Chlamydiaceae family have recently been
reclassified into two genera, Chlamydia and Chlamydophila, that
include nine species (43). In addition, new families now also
belong to Chlamydiales, and they include Parachlamydiaceae and
Simkaniaceae (43). The type species of Parachlamydiaceae is
Parachlamydia acanthamoebae, a symbiont of the amoebae Acanthamoeba
castellani and an occasional pathogen of people who acquire this
amoebae (34). Simkania negevensis is the type species of
Simkaniaceae and, like many other chlamydiae, also causes human
infection (56, 57, 61).
[0005] It has previously been shown that the RNase P RNA genes in
the genus Clamydia differ sufficiently between species to be useful
as a diagnostic tool (13); thus the gene is potentially useful for
strain differentiation. The differences between sequences also give
hints to which parts of the molecule are important for catalytic
activity, complementing mutational and structural studies.
[0006] Another important family of pathogens, where fast and
sensitive diagnostic methods are vital, are the mycobacteria.
Traditional diagnostic methods have relied on the demonstration of
acid-fast bacilli in clinical samples following cultivation. This
is reliable but time consuming, since slow-growing species such as
Mycobacterium tuberculosis may need six to eight weeks to form a
sufficiently large population. In the last few years, many
PCR-based detection assays have been developed based on eg the
hsp60 gene (16) or the variable interspersing region between the
16S and 23S rRNA genes (15, 24, 30) and this trend continues.
[0007] The RNase P RNA gene sequence from M. tuberculosis is known
(6) as well as that from M. bovis BCG and M. leprae. The M. bovis
sequence is identical to that from M. tuberculosis, while there are
differences to M. leprae. The regions in the RNase P RNA gene which
have been indicated by other means as important for catalytic
activity, were almost totally conserved between the mycobacteria.
The close relationship within microbial genuses, such as
mycobacteria, has rendered differentiation between species of the
same genus very difficult or impossible.
SUMMARY OF THE INVENTION
[0008] The present invention solves the problem of differentiation
between species within the same genus, such as mycobacteria and
chlamydia. Furthermore, the present invention solves the problem of
detecting pathogens which are hard and/or laborious to detect with
conventional methods.
[0009] The inventive method may in principle be used for diagnosing
infection by any kind of pathogenic organism.
[0010] Thus the pathogens include archaebacteria and eubacteria.
The latter contains as its principal groups gliding bacteria,
spirochetes, rigid bacteria and mycoplasmas. Rigid bacteria include
actinomycetes and simple unicellular bacteria. The latter group
consists of obligate intracellular parasites and free-living
bacteria. Among the free-living variants there are (1)
gram-positive bacteria in which group there are (a) cocci, (b)
non-sporulating rods, (c) sporulating rods that can be further
subdivided into obligate aerobes and obligate anaerobes; and (2)
gram-negative bacteria in which there are (a) cocci, (b)
non-enteric rods with spiral forms and straight rods, and (c)
enteric rods with facultative anaerobes, obligate aerobes and
obligate anaerobes. For specific bacteria species see further
Medical Microbiology, (Brooks et al, eds., 19th ed. (1991),
Prentice-Hall International, USA).
[0011] The pathogens include also fungi, including pathogenic
yeasts and molds. Examples are Apergillus, Candida, Absidia, Mucor,
Rhizopus, Cryptococcus, Hisoplasma, Blastomyces, Coccidiodes,
Paracoccidiodes, Sporotrichosis, Chromoblastomycosis, Mycetoma,
Microsporum, Trichophyton and Epidermophyton.
[0012] Other pathogens that may be diagnosed may be found among the
protozoa and algae.
[0013] Of course, the method of the invention can also be used for
detection of non-pathogenic bacteria.
[0014] The following bacteria are especially interesting for the
purposes of the present invention: Bacteria of phylum II--Green
bacteria; Phylum III--Deinobacteria (Thermus/Deinococcus); Phylum
IV--Spirochetes; Phylum VI--Gram negative anaerobes and gliding
bacteria (Bacteroides/Flavobacterium); Phylum VIII--Chlamydia;
Phylum IX--Gram positives with the three lineages: lineage A ("Gram
negatives"), lineage B (G+C-rich bacteria), lineage C (G+C-poor
bacteria); Phylum X--cyanobacteria; Phylum XI--proteobacteria with
the five lineages alpha, beta, gamma, delta and E.
[0015] The present inventors detected differences in the RNase P
RNA gene which were sufficient to enable species determination.
[0016] In a first aspect, the invention relates to a method for
detection of pathogenic organisms including inter-species
differentiation, comprising using the P3 and/or P19 hypervariable
region(s) of the RNase P RNA gene as a diagnostic target.
[0017] The purpose of the method of the invention may be, for
example, diagnose of infection caused by pathogenic bacteria and
epidemic investigation of the spreading of drug resistant
bacteria.
[0018] Preferably, the region(s) is/are amplified, such as by PCR
(Polymerase Chain reaction) and sequenced or otherwise
fingerprinted for species identification, such as by heteroduplex
analysis, size determination, RFLP (Restriction Fragment Length
Polymorphism), melting point determination etc.
[0019] In a second aspect the invention relates to a method for
detection of bacteria including inter-species differentiation,
comprising amplification of nucleic acids of hypervariable
region(s) of the RNase P RNA gene from the pathogens; forming a
heteroduplex with related nucleic acid; and analysis thereof.
[0020] An example of a method according to the invention involving
a heteroduplex analysis, comprises of an amplification reaction, a
hybridisation step and a non-denaturing gel electrophoresis
analysis. The whole process can be carried out in less than 24
hours.
[0021] In a third aspect, the invention relates to use of the P3
and/or P19 variable regions(s) in the RNAse P RNA gene as a drug
target in the production of a medicament for the treatment of
microbial infection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 depicts the sequence alignment of the RNase P RNA
genes from mycobacteria;
[0023] FIG. 2 depicts the secondary structure of M. tuberculosis
RNase P RNA;
[0024] FIG. 3 depicts the sequence alignment of the RNase P RNA
gene from M. gastri (identical sequence from two different strains)
and six strains of M. kansasii;
[0025] FIG. 4A depicts the Heteroduplex analysis of the first 280
bp from RNase P RNA gene regions from different mycobacteria;
[0026] FIG. 4B depicts the Heteroduplex analysis of DNA amplified
from clinical samples of bacteria believed to be either M.
intracellulare or M. avium;
[0027] FIG. 5 depicts the suggested structure for the P18 loop of
RNase P from mycobacteria, based on sequence variations within the
genus;
[0028] FIG. 6 depicts the DNA sequence comparison of rnpB from the
9 Chlamydiaceae species, P. acanthamoebae and S. negevensis;
[0029] FIG. 7 depicts the deduced secondary structures of RNase P
RNA in C. psittaci, P. acanthamoebae and S. negevensis; and
[0030] FIG. 8 depicts the neighbour-joining tree based on rnpB,
showing the relationships among members of the family
Chlamydiaceae. P. acanthamoebae, strain Bn9T and S. negevensis,
strain ZT were chosen as outgroups.
DETAILED DESCRIPTION OF THE INVENTION
[0031] The invention will now be described in greater detail in
relation to two non-limiting examples.
Example 1
Mycobacteria
Materials and Methods
Bacterial Strains.
[0032] Mycobacteria used in this study are listed in Table 1 below.
Clinical strains were already typed by 16S RNA gene sequencing in
their respective institutes of provenance.
[0033] The RNase P RNA sequences for M. tuberculosis, M. bovis BCG
and M. leprae were retrieved from the GenBank sequence
database.
TABLE-US-00001 TABLE 1 Strain Species description Provenance M.
gastri ATCC 15754 ATCC M. kansasii ATCC 12748 ATCC M.
intracellulare D673 Trudeau Mycobacterial Collection M. xenopi ATCC
19276 ATCC M. smegmatis mc.sup.2 155 Ref. 26 M. avium D702 Trudeau
Mycobacterial Collection M. marinum clinical strain Research Centre
Borstel M. fortuitum clinical strain Research Centre Borstel M.
malmoense clinical strain Research Centre Borstel M.
paratuberculosis 6783 G-F Gerlach School of Veterinary Medicine,
Hanover Germany M. gordoniae clinical strain Research Centre
Borstel M. celatum clinical strain Research Centre Borstel
PCR Amplification of the RNase P RNA Genes.
[0034] Based on the published sequences of M. tuberculosis and M.
leprae, (GenBank Accession Numbers Z70692 and L78818 respectively)
a primer pair was designed which hybridised close to the ends of
the gene. The forward primer tbf (5' CGGATGAGTTGGCTGGGCGG 3') and
reverse primer tbr (5' GTTGGCCTGTAAGCCGGATT 3') both show one
mismatch to the M. leprae sequence. Using this primer pair, the
RNase P gene could be amplified from all mycobacteria tested. Most
reactions were run on untreated mycobacteria from cultures, without
previous isolation and purification of chromosomal DNA. PCR was
done in 50 .mu.l reactions in a Rapidcycler capillary PCR apparatus
(Idaho technology, Idaho Falls USA) with the following parameters:
94.degree. C. 10''; 50.degree. C. 10'' 72.degree. C. 15''.
Sequencing.
[0035] PCR products were purified over 1 percent agarose gels to
remove the primers. Approximately 1/20 of the purified DNA was used
for automated sequencing with the same primers as were used in the
amplification reaction. Sequencing was done on an Applied
Biosystems model 310 capillary sequencer.
Heteroduplex Analysis.
[0036] For heteroduplex analysis of the RNase P P3 loop region, DNA
was amplified (50 .mu.l reactions) with the oligonucleotides tbf
and 280r (5' CTTGCTTGCCCTCCCTTTGCC 3') which give a product of
about 250 bp. The products were gel purified and approximately 1/10
of the products used in each analysis. DNA was mixed with equal
amounts of DNA from M. tuberculosis, heated to 95.degree. C. for 1'
and allowed to cool to room temperature. The products were
separated on 10 percent non-denaturing polyacrylamide gels run at
15 mA for 14 hrs. Bands were visualised by silver staining.
Silver Staining of DNA Gels.
[0037] Gels were fixated in 10 percent ethanol for 5', and
incubated in 1 percent nitric acid for 5'. Staining was in a 1
mg/ml solution of silver nitrate for 30'. Bands were developed in a
sodium carbonate/formaldehyde solution (15 g anhydrous sodium
carbonate and 300 .mu.l 37 percent formaldehyde in 500 ml water)
until clearly visible. The reaction was stopped with 10 percent
acetic acid.
Results
[0038] The results from Example 1 will be presented below in
association with the accompanying drawings, FIGS. 1-5:
[0039] FIG. 1. Sequence alignment of the RNase P RNA genes from
mycobacteria. Dashes indicate sequence identities; stars mark bases
missing in a sequence.
[0040] FIG. 2. Secondary structure of M. tuberculosis RNase P RNA.
Regions diverging between mycobacterial species are shaded. Minor
variable regions are not shown.
[0041] FIG. 3. Sequence alignment of the RNase P RNA gene from M.
gastri (identical sequence from two different strains) and six
strains of M. kansasii. Bases unique to the M. gastri sequence are
boldfaced.
[0042] FIG. 4 A. Heteroduplex analysis of the first 280 bp from
RNase P RNA gene regions from different mycobacteria. DNA from
diverse mycobacterial species was hybridised with M. tuberculosis
DNA and the resulting duplexes separated on a 10 percent
polyacrylamide gel. Lane 1, control DNA from M. tuberculosis; lane
2, M. avium; lane 3, M. intracellulare; lane 4, M. malmoense; lane
5, M. celatum; lane 6, M. kansasii; lane 7, M. vaccae; lane 8, M.
xenopii.
[0043] FIG. 4B. Heteroduplex analysis of DNA amplified from
clinical samples of bacteria believed to be either M.
intracellulare or M. avium. Lane 1, control DNA from M.
tuberculosis; lanes 2, 3, 6, DNA from suspected M. avium; lanes 4,
5, 7, DNA from suspected M. intracellulare; lane 8, control DNA
from M. avium; lane 9, control DNA from M. intracellulare.
[0044] FIG. 5. Suggested structure for the P18 loop of RNase P from
mycobacteria, based on sequence variations within the genus. The
sequences are from A) M. tuberculosis; B) M. smegmatis; C) M.
marinum
[0045] In PCR amplifications of the RNase P RNA gene from
mycobacteria using the oligonucleotides tbf and tbr, each reaction
yielded a single fragment in the range of 387 (M. celatum) to 428
(M. tuberculosis) by depending on mycobacterial species.
[0046] Using these oligonucleotides it was possible to amplify the
RNase P RNA genes from all mycobacteria tested, using untreated
cells from culture or plates. No previous purification of
chromosomal DNA was necessary. An alignment of the sequences (FIG.
1) shows very well conserved nucleotide sequences along most of the
gene, with the exception of three major regions where the
similarities break down and no adequate alignment is possible. The
overall similarity of the genes was between 80 and 85 percent. This
is not a very informative figure however, since the similarity
within the well conserved regions is close to 100 percent, while
the divergent regions are too dissimilar to be aligned at all.
[0047] If the divergent regions are localised on a two-dimensional
representation of the RNase P RNA molecule (FIG. 2), it is
conspicuous how most of the differences fall into regions which
belong to ends of stem-loop structures. The major divergent regions
are the P3, P16 and P19 loops. In addition, there is a deletion in
the P12 loop in M. smegmatis and M. fortuitum, comprising several
unpaired nucleotides of this loop. The major interspecies
differences are within the P3 and P19 loops.
[0048] All species analysed had specific RNase P RNA gene
sequences. Several closely related species could be differentiated
on basis of the RNase P RNA sequences. The members of the MAI
complex M. avium and M. intracellulare differed in several
positions, including a deletion in the P19 loop in M. avium (FIG.
2). The very closely related (subspecies) M. paratuberculosis and
M. avium were indistinguishable on basis of RNase P RNA gene
sequences.
[0049] As far as our analysis went, within a species, sequences are
identical. We sequenced clinical samples from all members of the M.
tuberculosis complex (M. tuberculosis, M. bovis, M. bovis BCG, M.
africanum, M. microti and M. tuberculosis ssp asiaticum) without
detecting any deviations from the published M. tuberculosis
sequence (6). Thus, members of this group could not be
differentiated on the basis of RNase P RNA gene differences. The
possibility of sequence differences between different serovars of
mycobacteria was investigated for some species. In the case of M.
avium and M. intracellulare, the RNase P RNA gene from five
clinical isolates (animal) of M. avium and five M. intracellulare
(human) was amplified and sequenced. No differences between
serovars could be detected.
[0050] The one species where heterogenous RNase P RNA gene
sequences were observed between different serovars was M. kansasii
(FIG. 3). The differences were mainly C-to-T transitions. Two
strains of M. gastri were sequenced as well, but in this species
the gene sequences were identical between isolates. In four
positions, all RNase P RNA gene sequences from M. kansasii strains
differed from those of M. gastri. Three of these differences were
C-to-T transitions, while the fourth was a C-to-A transversion.
[0051] The interspecies differences found in the P3 and P19 loops
were considered to be large enough for an attempt at a simple
diagnostic application through heteroduplex analysis. The
hypervariable P3 region was chosen for this analysis and amplified
using the tbf and 280r oligonucleotides. Each PCR reaction yielded
single bands of about 250 bp. The region from M. tuberculosis was
used as a standard and was mixed in equal amounts with the products
from different species. After separating the fragments on
non-denaturing polyacrylamide gels, the bands were silver stained.
There were clear differences in the heteroduplex pattern between
all species tested (FIG. 4A).
[0052] This analysis was taken further by applying it to clinical
samples (from the Swedish Institute of Infectious Disease Control)
which had or had not been previously typed. On the resulting gel
(FIG. 4B) the samples in lanes 2, 3 and 6 can be attributed to M.
avium (compare to lane 8), while samples 4, 5 and 7 seem to be M.
intracellulare (compare to lane 9). Sequencing the RNase P RNA gene
in each case confirmed the results obtained from heteroduplex
analysis.
DISCUSSION
[0053] Compared with the case of Clamydia, the RNase P genes from
mycobacteria are better preserved between species, with overall
similarities of 80-85 percent. This overall value is misleading,
however, since most differences cluster in specific regions, where
the variability is of a degree that makes an unambiguous alignment
impossible. All mycobacterial RNase P RNAs show a P15-P17 region of
the Clamydia and cyanobacteria type, (13, 31) which is hardly
surprising given the close relatedness of the organisms.
[0054] All species studied had their own conspicuous sequence
characteristics. Within a species, no differences were seen except
for M. kansasii, a species which has on other grounds been
described as heterogeneous (1, 14, 32). Even though several of the
variant positions were shared between M. kansasii and M. gastri,
there are enough M. kansasii-specific bases in the gene to enable
differentiation from the closely related M. gastri through
microsequencing or heteroduplex analysis. M. kansasii is an
important cause of pulmonary disease resulting from non-tuberculous
mycobacteria.
[0055] The combination of very well conserved regions and
hypervariable sites in the RNase P RNA gene sequence enables fast
typing of unknown mycobacterial samples. Oligonucleotides will
hybridise with perfect or close to perfect match to conserved
regions allowing for a reliable amplification of the variable parts
in between.
[0056] The M. avium complex (MAI) which includes M. avium and M.
intracellulare, is a major opportunistic infection in AIDS patients
(21, 22). Differentiating between the members of this complex
requires molecular methods and our heteroduplex analysis of PCR
products from the RNase P RNA gene offers a rapid and fairly
inexpensive alternative to current methods (7, 8, 10, 18, 19, 23,
27, 29).
[0057] Sequence variances in the RNase P RNA gene between species
can also yield clues to the molecular structure of the RNA. In the
case of the mycobacteria (FIG. 2), almost all variances in the
sequences were in unpaired regions, or in structures which seem
unimportant for catalytic activity in vitro.
[0058] For instance, in two species, M. smegmatis and M. fortuitum,
the bases 160-164 corresponding to the end of the P12 loop, (FIG.
2) are not present in the RNase P RNA gene sequence. The P12 loop
is missing in the gene from some other organisms, such as
Mycoplasma fermentans (4, 25) and thus does not seem necessary for
ribozyme activity.
[0059] The alignment also supports conclusions about RNase P
structure drawn from other experiments. Suggested important regions
such as the motif by 75-85 and pairing nt 409-417 (FIG. 2) are
preserved throughout all analysed mycobacterial species. In all
probability, these two regions base pair, since matching sequences
are well conserved between organisms. The most variable regions
between mycobacterial species were the P3 and P19 loops
respectively. The P19 structure is not necessary for RNase P
activity in vitro (25) and there is considerable variability in the
P3 loop between organisms, but their role in vivo is unclear.
[0060] The suggested structure of M. tuberculosis RNase P RNA could
still be improved upon with the help of sequence variations between
species. A structure which is believed to be of importance is the
P18 stem-loop, (the region nt 330-351) which has a well-preserved
stem in the Escherichia coli and Clamydia RNase P RNAs. The
suggested mycobacterial structure has a far less convincing stem
structure. (See FIG. 2, which is based on the old structure
prediction.) However, in M. smegmatis and M. marinum there are
variations from the consensus sequence. (FIG. 1) A slightly
different stem-loop structure would accommodate for these exchanges
while keeping a consensus secondary structure intact, at the same
time allowing for a more convincing base-paring pattern (FIG. 5).
This also strengthens the argument for the importance of this
stem-loop for RNase P function.
Example 2
Chlamydia
Materials and Methods
Bacterial Strains.
[0061] DNA of analysed organisms were released by standard
Proteinase K treatment of cell culture grown organisms and phenol
extracted or were provided as purified DNA-preparations (Table
2).
TABLE-US-00002 TABLE 2 Strains, host of origin, references, sources
and accession numbers Strain Host of origin Reference Source*
Accession no. Chlamydophila psittaci 6BC.sup.T
(VR-125.sup.T).dagger. Psittacine Golub & Wagner (1947) Storey
AJ012169 GD Duck Illner (1960) NADC NJ1 Turkey Page (1959) NADC WC
Cattle Page (1967) NADC VS225 Psittacine NADC 360 Duck Storey N352
Duck Richmond et al. (1982) Storey Cal10 Human Francis & Magill
(1938) Storey CP3 (VR-574) Pigeon Page & Bankowski (1960) NADC
M56 (VR-630) Muskrat Spalatio et al. (1966) NADC Chlamydophila
abortus B577.sup.T (VR-656.sup.T) Ovine, abortion Perez-Martinez
& Storz (1985) Denamur AJ131092 EBA Bovine, abortion
Perez-Martinez & Storz (1985) NADC OSP Ovine Andersen & Van
Deusen (1988) NADC EAE/Lx Ovine, abortion Storey AB7 Ovine,
abortion Rodolakis et al. (1989) Rodolakis OC1 Ovine,
conjunctivitis Rodolakis et al. (1989) Rodolakis AV1 Bovine,
abortion Rodolakis et al. (1989) Rodolakis AC1 Caprine, abortion
Rodolakis et al. (1989) Rodolakis IC1 Ovine Rodolakis et al. (1989)
Rodolakis Chlamydophila felis F P Baker.sup.T Feline Baker (1942)
NADC AJ012171 Cello Feline Cello (1967) Storey Pring Feline Wills
et al. (1984) Storey Chlamydophila caviae GPIC.sup.T (VR-813.sup.T)
Guinea pig Murray (1964) Storey AJ012172 Chlamydophila pecorum
E58.sup.T (VR-628.sup.T) Bovine McNutt & Waller (1940) NADC
AJ012173 IB1 Ovine Rodolakis et al. (1989) Rodolakis AJ131091 IC4
Ovine Rodolakis et al. (1989) Rodolakis AB10 Ovine, abortion
Rodolakis et al. (1989) Rodolakis IPA (VR-629) Ovine Page &
Cutlip (1968) NADC AJ131090 H3 Koala Storey AJ131089 Chlamydophila
pneumoniae.dagger-dbl. TW183.sup.T (VR-2282.sup.T) Human Grayston
et al. (1989) ATCC AJ012174 CM1 (VR-1360) Human Black et al. (1992)
Black CWL011 Human Black et al. (1992) Black CWL029 (VR-1310) Human
Black et al. (1992) Black CWL050 Human Black et al. (1992) Black
FML16 Human Black et al. (1992) Berdal P1 Human Herrmann et al.
(1996) UHU JG915 Human Herrmann et al. (1996) UHU JG954 Human
Herrmann et al. (1996) UHU TWAR 2023 (VR-1356) Human Chirgwin et
al. (1989) ATCC Chlamydia trachomatis A/Har-13.sup.T (VR-571
B.sup.T).sctn. Human Wang & Grayston (1962) Persson AJ131088
L1/440/LN (VR-901B).sctn. Human Schachter & Meyer (1969)
Persson AJ012175 Chlamydia suis S45.sup.T (VR-1474.sup.T) Swine
Kaltenboeck et al. (1993) NADC AJ012176 R22 Swine Rogers et al.
(1993) NADC Chlamydia muridarum MoPn.sup.T (VR-123.sup.T) Mouse
Nigg (1942) NADC AJ012177 SFPD Hamster Stills et al. (1991) NADC
Simkania negevensis Z.sup.T (VR-1471.sup.T) Cell culture Kahane el
al. (1995) Kahane AJ012178 Parachlamydia acanthamoebae
Bn.sub.9.sup.T Amoeba/human Amann et al. (1997) Michel AJ012179
Berg.sub.1T Amoeba/human Amann et al. (1997) Michel Superscript `T`
indicates the type species
PCR Amplification and DNA Sequence Determination.
[0062] The rnpB gene in species of Chlamydiaceae was amplified by
PCR with the primer pair BH1-BH2, which was designed based on the
C. trachomatis sequence (13) (Table 3).
TABLE-US-00003 TABLE 3 Primer used for amplification of the rnpB
gene Nucleotide positions in rnpB of Chlamydia trachomatis Primer
Sequence (see FIG. 6) BH1 5'CGGACTTATAAGAAAAGAT-3' 64 to 83 (upper)
BH2 5'-(A/G)TAAGCCGGGTTCTGT-3' 392 to 377 (lower) BM1
5'-(A/G)(A/G)(C/A)G(A/G) 48 to 64 (A/G)GAGGAAAGTCC-3' (upper) JB1
5'-CGAACTAATCGGAAGAGTAAG -8 to 15 GC-3' (upper) JB2
5'-GAGCGAGTAAGCCGG(A/G)TTC 398 to 377 TGT-3' (lower)
[0063] The reaction mixture contained 0.2 .mu.M of each primer, 200
.mu.M dNTP, 1.5 mM MgCl.sub.2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl,
15% glycerol and 2 U Taq polymerase. Amplification conditions
consisted of 7 cycles with 45 s at 94.degree. C., 45 s at
42.degree. C., 1 min at 72.degree. C. followed by 35 cycles where
the annealing temperature was increased to 58.degree. C. If not
otherwise stated, all PCR-products mentioned in the text refer to
the use of the primer pair BH1-BH2, which amplified 82% of the
full-length gene. To generate the 5'-flanking region from type
strains of the nine Chlamydiaceae species we used the primer pair
JB1-JB2 which was obtained from the complete RNase P RNA gene
sequence of C. trachomatis (kindly provided by Dr J. Brown).
Amplification conditions were as described for the BH1-BH2 primer
pair, except that glycerol was omitted and the annealing
temperatures were 53.degree. C. and 58.degree. C., respectively.
For amplification of S. negevensis and P. acanthamoebae the BH 1
primer was replaced by BM 1, which included highly conserved
nucleotides as previously described (13), but did not permit
sequencing of the 5' end of rnpB. The resulting PCR products were
sequenced by using a terminator labelled cycle sequencing chemistry
and sequence reactions were analyzed on a 310 Genetic Analyzer
(Perkin-Elmer). Sequences were submitted to EMBL and all accession
numbers listed in Table 2 are from the present study.
Sequence Alignment and Phylogenetic Analysis.
[0064] Sequence alignment required secondary structure modelling of
each RNase P RNA molecule which was performed manually by using
comparative sequence analysis. The predicted structures were
subsequently used in the alignment procedure as an aid for the
identification of loop and stem regions. The alignment was used to
study molecular phylogeny. The calculated distance matrix was
corrected for multiple base changes at single locations by the one
parameter model of Jukes & Cantor (1969)(55). This matrix was
subsequently used to compute a phylogenetic tree by using the
neighbor-joining program (77), implemented under the name NEIGHBOR
in the Phylogenetic Inference Package, PHYLIP version 3.51c (44).
Maximum parsimony trees were inferred using the DNAPARS program.
The SEQBOOT program was used to bootstrap the trees based on
neighbor-joining and maximum parsimony by resampling the data sets
1000 times. The construction of the maximum likelihood tree was
performed with the DNAML program using the F84 model of molecular
evolution applying empirical base frequencies, global rearrangement
and the jumble option.
Preparation of RNase P RNA and Substrates.
[0065] To test rnpB catalytic activity, the full-length C.
trachomatis rnpB was PCR amplified, cloned behind a T7 promoter,
and assayed for tRNA precursor cleavage. We designed a PCR primer
matching the 5' end (5'
TTGAATTCGAAATTAATACGACTCACTATAGCGAACTAATCGGAAGAGTA). Underlined
residues match the C. trachomatis rnpB while the remaining part of
the primer corresponds to the T7 promoter. We designed a primer
complementing the 3' end
(5'TTTAAGCTTGGATGGTACCTTGAAAAGCTCGGAAGAGCGAGTAA). Underlined
residues are complementary to the C. trachomatis rnpB and the
unmarked residues were incorporated in order to be able to cleave
the resulting plasmid with FokI). The PCR amplified C. trachomatis
rnpB was cut with EcoRI and HindIII and inserted into pUC19 which
had been cut with the same enzymes. The recombinant plasmid was
transformed in Escherichia coli strain DH5a following standard
protocols.
[0066] The E. coli RNase P RNA, the C. trachomatis RNase P RNA and
the precursor tRNATYrSu3 were generated using the T7 DNA dependent
RNA polymerase as described elsewhere (59 and references
therein).
[0067] RNase P RNA Assay.
[0068] The RNase P RNA activity was monitored at 37.degree. C. in
our standard reaction buffer (50 mM Tris-HCl (pH 7.5), 5% (w/v) PEG
6000, 100 mM NH.sub.4Cl (or 1M NH.sub.4Cl as indicated) and 100 mM
MgCl.sub.2) as previously described (59 and references therein) and
the final concentration of C. trachomatis RNase P RNA was
.apprxeq.2.4 pmolmL.sup.-1 and of precursor
tRNATYrSu3.apprxeq.0.052 pmolmL.sup.-1.
[0069] Nucleotide Sequence Accession Numbers.
[0070] Representative nucleotide sequences for examined species
have been submitted to EMBL. Accession numbers are listed in Table
2.
Results
[0071] The results from Example 2 will be discussed below in
association with the accompanying drawings FIGS. 6-8:
[0072] FIG. 6: DNA sequence comparison of rnpB from the 9
Chlamydiaceae species, P. acanthamoebae and S. negevensis. Dots
indicate identity with the C. trachomatis A/Har-13.sup.T sequence
and dashes indicate gaps in the alignment. The hypervaribale
regions P3, P12, P17 and P19 are indicated. Numbering is according
to Brown (39).
[0073] FIG. 7: Deduced secondary structures of RNase P RNA in C.
psittaci, P. acanthamoebae and S. negevensis. The nucleotides in
the primer sequences are in lower case type, m indicates an
adenine-cytosine mixture, and r indicates adenine-guanine mixture
at this position. N denotes tentative nucleotides in the flanking
regions of the primer based on the minimum consensus bacterial
RNase P RNA (39).
[0074] FIG. 8: Neighbour-joining tree based on rnpB, showing the
relationships among members of the family Chlamydiaceae. P.
acanthamoebae, strain Bn.sub.9.sup.T and S. negevensis, strain
Z.sup.T were chosen as outgroups. Parsimony and ML analyses
produced an identical branch order. However, two taxa branched
slightly different in the ML tree and this node is marked with an
asterisk. Bootstrap support values at the nodes were obtained from
1000 resamplings of the data set using neighbor-joining and maximum
parsimony. The scale bar indicates 5 substitutions per 100
nucleotides.
Comparison of rnpB Sequences
[0075] PCR products that included 82% of the full-length rnpB gene
were obtained from 60 chlamydial strains. The products from P.
acanthamoebae strain Bn.sub.9T and Berg.sub.17 were 313 bases long
and their sequences were identical. The sequence of the 299-bp
product from the Z.sup.T strain of S. negevensis was 68.9% similar
to the P. acanthamoebae sequence. The Chlamydiaceae PCR products
were between 63.8% and 69.3% similar to the segments available from
P. acanthamoebae and S. negevensis. The rnpB sequences from
Chlamydia and Chlamydophila, which are the 2 genera in the
Chlamydiaceae, were 75.9%-83.3% similar. The 18 strains belonging
to Chlamydia were >89.9% similar; the 38 strains belonging to
Chlamydophila were >84.8% similar. The 14 C. trachomatis
sequences differed by only a single base substitution in the LGV
biovar compared to the Trachoma biovar. The 2 Chlamydia suis
strains differed in only two nucleotide positions. The 6 Chlamydia
pecorum strains were identical or differed by only 1 or 2 bases.
Sequences were identical within species for 10 Chlamydia psittaci
strains (except strain M56, see below), 10 Chlamydia pneumoniae
TWAR biovar sequences, 9 Chlamydia abortus sequences, 3 Chlamydia
felis sequences and the 2 Chlamydia muridarum sequences.
[0076] Nearly full-length gene segments (98% of the rnpB gene) were
generated by PCR using primers JB1 and JB2 from a subset of 14
strains that included all of the 9 Chlamydiaceae species.
Comparison of these sequences reduced the inter-species similarity
as much as 2.6% as because they included the variable P3 region.
The diversity in rnpB was large enough to clearly distinguish
species groupings in the Chlamydiaceae. Unlike ompA gene products,
which differ by up to 50%, and ribosomal RNA genes, which differ by
<10%, this diversity will readily permit the design of genus-
and group-specific PCR probes.
[0077] The strains MoPn.sup.T (mouse) and SFPD (hamster) of the
species C. muridarum have been shown to differ in their MOMP gene
sequences (85). In contrast, the rnpB genes in the two C. muridarum
strains were identical, as also has been found in the ribosomal
16S/23S intergenic spacers and 23S domain I segments (42).
Evolutionary pressure on the surface exposed protein has clearly
been greater than on the genes involved in the translation
process.
[0078] Twenty two strains which were classified as C. psittaci
until recently have now been separated into C. psittaci, C.
abortus, C. felis and C. caviae.
[0079] Our study separated these strains into the 4 species
groupings by rnpB gene sequence differences of up to 6.7% (data not
shown). These species have been isolated from host groups of
distant origin and they cause a wide spectrum of diseases (Table
2). Only C. psittaci strain M56 conflicted with its classification
as C. psittaci and PCR of this strain produced an rnpB sequence
that matched the feline sequences analyzed in this study. M56
history provides some insight why this may have occurred. M56 was
isolated in 1961 from a muskrat in Canada (79), then stocked and
distributed to ATCC from the USDA National Animal Disease Center in
Ames, Iowa, USA. In cell culture, the ATCC preparation of M56 grew
out as M56 serotype in one cell line and as the feline serotype in
another (Andersen, unpublished). Fukushi & Hirai (1989)(46)
reported a feline serotype for M56 obtained from ATCC. PCR of M56
cultured at NADC on Aug. 1, 1990 in the yolk sacs of embryonating
eggs gave C. psittaci-avian-like ribosomal and full-length major
outer membrane protein gene sequences (42). M56 DNA used in the
current study was an aliquot from the 1997 study (Table 2). In view
of this history, our rnpB analysis suggests that M56 cultures were
contaminated with feline chlamydiae during the 1960's and that
uncontaminated isolates may no longer be available.
Secondary Structures of the RNase P RNA
[0080] Alignment of the sequences of the rnpB gene derived from the
nine Chlamydiaceae species indicated four hypervariable regions
located in distinct stem loops, denoted as P3, P12, P17 and P19 in
the suggested secondary structures (FIG. 7).
[0081] The P15 loop (see FIG. 7) is of interest since in most
bacterial RNase P RNA molecules it harbours a GGU-motif that
interacts with tRNA precursors by base pairing with the 3'-terminal
RCCA motif of the tRNA (60). The absence of this sequence motif
from all members of the Chlamydiales is striking and an ATAA-bulge
is seen in all nine Chlamydiaceae species (positions 291 to 294 in
C. psittaci, FIG. 7), except in C. pneumoniae (GAAA) and in C.
felis (ACAA). Furthermore, a different structure in the P15 region
of Chlamydiaceae species is rationalized by the finding that none
of the identified tRNA genes encode the 3' terminal CCA sequence
(80).
[0082] Interestingly, the P15 region in P. acanthamoebae harbours a
purine rich bulge carrying a GGU-motif. This might indicate that
these RNase P RNAs interact with the 3' terminal RCCA sequence as
does E. coli RNase P RNA, given that the CCA sequence is encoded in
the tRNA genes in this species. By contrast, the P15 loop structure
of RNase P RNA derived from S. negevensis is similar to that
observed in most cyanobacteria (87) and it carries a GGAU-motif in
the P15 loop as does RNase P RNA derived from Thermus thermophilus
(53). It has been suggested that this loop of RNase P RNA in T.
thermophilus carries a high-affinity binding site for the 3' end of
a tRNA precursor (52) and it may therefore also be valid for S.
negevensis.
[0083] The RNase P RNA in Chlamydiaceae species harbour a P18 helix
while P. acanthamoebae and S. negevensis appears to lack this
element. It has previously been shown that the P18 helix can be
deleted without losing catalytic activity, suggesting that it is
not directly involved in catalysis (49). The P18 helix, when
present, is associated with a phylogenetically conserved GNRA tetra
loop which docks into its suggested receptor in P8 (the G83C93 base
pair in C. psittaci; FIG. 2; (38, 62). Furthermore, bacterial RNase
P RNAs that lack the P18 helix have an extended P8 helix and it has
been suggested that this compensates for the loss of P18 (38).
Since neither P. acanthamoebae nor S. negevensis have an extended
P8 or an apparent P18 with a GNRA tetra loop, perhaps the
nucleotides in the P18 region form an alternative structural
element that interacts with P8.
[0084] A long range interaction has also been suggested between the
GNRA tetra loop in the P14 helix and the P8 stem (38, 62). This is
supported by our present data in all nine species of Chlamydiaceae
(the U82A94 base pair and G201 in C. psittaci, FIG. 7) and by the
presence of an A in the P14 loop and the GC base pair in P8 in P.
acanthamoebae and S. negevensis (FIG. 2). Given the presence of
this interaction, it is surprising that in the three serovars L1 to
L3 of C. trachomatis the G205 nucleotide (corresponding to G201 in
C. psittaci in FIG. 7) is substituted by an A, but without a
corresponding base pair shift in the P8 helix.
[0085] In the minimum consensus bacterial RNase P RNA certain
positions have 100% conserved nucleotide bases (39). Our data
showed that the well-conserved cytosine at position 60 has been
replaced by a uracil in all examined species of the Chlamydophila
genus (FIG. 7), while no change was observed for the Chlamydia
genus. This generates either a UG wobble base pair or a UA base
pair, depending on the residue at position 376 (numbering refers to
C. psittaci). The region of the RNase P RNA derived from these
species could not be examined with the primers used in the present
study.
Cleavage of tRNA Precursors by C. Trachomatis RNAse P RNA
[0086] Bacterial RNase P RNA is catalytically active in the absence
of the RNase P protein moiety (33 and references therein). To
investigate whether Chlamydia RNase P RNA alone is able to cleave
its substrate we generated C. trachomatis RNase P RNA and analysed
the cleavage pattern using the E. coli tRNATYrSu3 (pSu3) precursor
as substrate. This RNase P RNA was indeed able to cleave pSu3 at
the expected position only when using NH.sub.4Cl at high
concentration, as described in Methods. This is in keeping with a
previous observation of cleavage by C. trachomatis RNase P RNA
(51). Taken together with the structural observations this
demonstrates that RNase P RNA does not require a P15 internal loop
(or a P15 hairpin loop) for catalytic activity. However, we note
that the extent of cleavage by C. trachomatis RNase P RNA was
significantly reduced compared to cleavage by E. coli RNase P
RNA.
Phylogeny of the Family Chlamydiaceae
[0087] The secondary structures of the helices P15, P16, P17, P18,
and P19 were the most difficult regions to resolve for the members
of the Chlamydiaceae. Consequently, two of these regions, namely
P17 and P19, were removed from the final data set that was used for
phylogenetic calculations. This was due to the high nucleotide
variability in the locale of P17 and the apparent absence of the
helix P19 in the rnpB gene of P. acanthamoebae (FIGS. 6 & 7).
Also, the ambiguously aligned positions 94, 150, 151, 153, 286 and
298 (according to the numbering of the rnpB gene of C. trachomatis
in FIG. 6) were removed prior to phylogenetic analysis. Gapped
positions were generally not omitted from the final alignment
except for the termini of the 5'-end, since the positions 1 to 68
were not determined for S. negevensis and P. acanthamoebae.
Consequently, the corrected final alignment comprised 271
positions.
[0088] Different algorithms were used to calculate evolutionary
trees to reveal the phylogenetic relationships among the species of
the family Chlamydiaceae. Virtually identical tree topologies were
obtained by using distance matrix and character based methods. A
representative phylogenetic tree derived by using neighbor-joining
(NJ) (Saitou & Nei, 1987) is shown in FIG. 3. The stability of
the branching order was evaluated statistically by the
determination of bootstrap percentage values. These values as
obtained by NJ and maximum parsimony are given at the nodes. The
branching order supported by the maximum likelihood tree (ML) has
also been added to each branching point in FIG. 3. Two taxa
branched somewhat differently in the dendrogram constructed by ML
and the actual node displaying this instability has been furnished
with an asterisk. Identical tree topologies to those shown in FIG.
3 were also obtained when only using rnpB data from the species
belonging to Chlamydophila and Chlamydia but extending the data set
to comprise the nucleotide information of the 5'-end. Therefore,
the branching order in this part of the tree was not resolved.
[0089] The tree in FIG. 8 shows that the genera Chlamydophila and
Chlamydia can readily be distinguished from one another by
comparing rnpB gene sequences. These findings are consistent with
recently published phylogenies based on full-length 16S and 23S
ribosomal RNA genes, and on their intergenic spacer regions (42,
43, 73). However, this conflicts with the results presented for the
16S rRNA gene by Pettersson et al. (1997). A plausible explanation
is that the 16S rRNA study was based on only 4/5 of the full-length
nucleotide information for these genes and that some of the
sequences used for comparison were rather distantly related.
Therefore, some phylogenetic information was lost in the final data
set. In a subsequent 16S rRNA analysis using almost complete 16S
rRNA gene sequences and only close relatives as outgroups, there
was limited correlation with other branching orders. Thus it can be
concluded that 16S rRNA genes provide low resolution in describing
the evolutionary interrelationships of the members of the
Chlamydiaceae family.
[0090] Analysis of the rnpB gene demonstrated that chlamydial
phylogeny need not rely entirely on genes for which there is only
weak branch support. While 16S rRNA analyses show numerous long
branches with clusters attached, the rnpB analysis has evenly
distributed sequence differences that distinguish chlamydial groups
at family, genus, and species levels. The sequence diversity of the
rnpB gene in the species of the order Chlamydiales will make it
possible to use this gene for the discrimination of chlamydial
species. Moreover, this specificity reveals a functional isolation
of each grouping that is consistent with the species-specific
ecological niches as described (70). The conservation is also
consistent with previously identified groupings. The specificity
found in so basic a function as tRNA processing, suggests that the
species groupings in the Chlamydiaceae have been evolutionarily
isolated for a very long period of time. The presented phylogenetic
analysis supports the revision of the classification of the
Chlamydiaceae family as previously described (43).
[0091] In summary, the sequence of the RNase P RNA gene (rnpB) was
determined for 60 strains representing all nine species in the
Chlamydiaceae family and for the related Chlamydiales species,
Parachlamydia acanthamoebae and Simkania negevensis. These
sequences were used to infer evolutionary relationships among the
Chlamydiaceae. The analysis separated Chlamydophila and Chlamydia
into two lineages, with Chlamydophila forming three distinct
clusters: the Chlamydophila pneumoniae strains, the Chlamydophila
pecorum strains and a third cluster comprising the species
Chlamydophila psittaci, Chlamydophila abortus, Chlamydophila caviae
and Chlamydophila felis. The Chlamydia line of descent contained
two clusters, with the Chlamydia suis strains distinctly separated
from strains of Chlamydia trachomatis and Chlamydia muridarum. This
analysis indicated that the rnpB sequence and structure are
distinctive markers for species in the Chlamydiaceae. We also
demonstrated that the RNase P RNA derived from C. trachomatis is
able to cleave a tRNA precursor in the absence of protein. Our
findings are discussed in relation to the structure of Chlamydia
RNase P RNA.
REFERENCES
[0092] 1. Abed, Y., C. Bollet, and P. De Micco 1995. Demonstration
of Mycobacterium kansasii species heterogeneity by the
amplification of the 16S-23S spacer region. J. M. Microbiol. 43:
156-158 [0093] 2. Alcaide F., I. Richter, C. Bernasconi, B.
Springer, C. Hagenau R. Schulze-Robbecke, E. Tortoli, R. Martin, E.
C. Bottger, and A. Telenti. 1997. Heterogeneity and clonality among
isolates of Mycobacterium kansasii: Implications for
epidemiological and pathogenicity studies. J. Clin. Microbiol.
35:1959-1964 [0094] 3. Bascunana C. R. and K. Belak K. 1996.
Detection and identification of mycobacteria in formalin-fixed,
paraffin-embedded tissues by nested PCR and restriction enzyme
analysis. J. Clin. Microbiol. 10:2351-2355. [0095] 4. Brannvall,
M., J. G. Mattsson, S. G. Svard S. G., and L. A. Kirsebom. 1998.
RNase P RNA structure and cleavage reflect the primary structure of
tRNA genes. J. Mol. Biol. 283:771-83 [0096] 5. Brown J. W. and N.
R. Pace. 1992. Ribonuclease P RNA and protein subunits from
bacteria. Nucleic Acids Res. 20:1451-1456. [0097] 6. Cole S. T., R.
Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V.
Gordon, K. Eiglmeier, S. Gas, C. E. 3rd Barry, F. Tekaia, K.
Badcock, [0098] D. Basham, D. Brown, T. Chillingworth, R. Connor,
R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S.
Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al., 1998.
Deciphering the biology of Mycobacterium tuberculosis from the
complete genome sequence. Nature 393:537-44. [0099] 7. Crawford J.
T. 1994. Development of rapid techniques for identification of M.
avium infections. Res. Microbiol. 145:177-181. [0100] 8. Devallois
A., M. Picardeau, K. S. Goh, C. Sola, V. Vincent, and N. Rastogi.
1996. Comparative evaluation of PCR and commercial DNA probes for
detection and identification to species level of Mycobacterium
avium and Mycobacterium intracellulare. J. Clin. Microbiol.
34:2756-2759. [0101] 9. Devallois A., M. Picardeau, C. N.
Paramasivan, V. Vincent, and N. Rastogi. 1997 Molecular
characterization of Mycobacterium avium complex isolates giving
discordant results in AccuProbe tests by PCR-restriction enzyme
analysis, 16S rRNA gene sequencing, and DT1-DT6 PCR. J. Clin.
Microbiol. 35:2767-2772. [0102] 10. Frothingham R., and K. H.
Wilson. 1994. Molecular phylogeny of the Mycobacterium avium
complex demonstrates clinically meaningful divisions. J. Infect.
Dis. 169:305-312. [0103] 11. Gardiner K. and N. R Pace. 1980. RNase
P of Bacillus subtilis has an RNA component. J. Biol. Chem.
255:7507-7509 [0104] 12. Guerrier-Takada, C., K. Gardiner, T. L.
Marsh, N. R. Pace, and S. Altman. 1983. The RNA moiety of RNase P
is the catalytic subunit of the enzyme. Cell 35:849-857 [0105] 13.
Herrmann B., O. Winqvist, J. G. Mattsson, and L. A. Kirsebom L A.
1996. Differentiation of Chlamydia spp. by sequence determination
and restriction endonuclease cleavage of RNase P RNA genes. J.
Clin. Microbiol. 34:1897-1902. [0106] 14. Iinuma Y., S. Ichiyama,
Y. Hasegawa, K. Shimokata, S. Kawahara, and T. Matsushima. 1997.
Large-restriction-fragment analysis of Mycobacterium kansasii
genomic DNA and its application in molecular typing. J. Clin.
Microbiol. 35: 596-599 [0107] 15. Ji-e Y., K. E. Kempsell, M. J.
Colston and R. A. Cox. 1994 Nucleotide sequences of the spacer-1,
spacer-2 and trailer regions of the rrn operons and secondary
structures of precursor 23S rRNAs and precursor 5S rRNAs of
slow-growing mycobacteria Microbiology 140:1763-1773. [0108] 16.
Kapur V., L.-L. Li, M. R. Hamrick, B. B. Plikaytis, T. M. Shinnick,
A. Telenti, [0109] Jr W. R. Jacobs, A. Banerjee, S. Cole, K. Y.
Yuen, J. E. Clarridge III, B. N. Kreiswirth, and J. M. Musser.
1995. Rapid Mycobacterium species assignment and unambiguous
identification of mutations associated with antimicrobial
resistance in Mycobacterium tuberculosis by automated DNA
sequencing. Arch. Pathol. Lab. Med. 119:131-138. [0110] 17. Kole R.
M. F. Baer, B. C. Stark, and S. Altman. 1980. E. coli RNAase P has
a required RNA component in vivo. Cell 19:881-887 [0111] 18. Kulski
J. K., C. Khinsoe, T. Pryce, and K. Christiansen. 1995. Use of a
multiplex PCR to detect and identify Mycobacterium avium and M.
intracellulare in blood culture fluids of AIDS patients. J. Clin.
Microbiol. 33:668-674. [0112] 19. Nishimori K., M. Eguchi, Y.
Nakaoka, Y. Onodera, T. Ito, and K. Tanaka. 1995. Distribution of
IS901 in strains of Mycobacterium avium complex from swine by using
IS901-detecting primers that discriminate between M. avium and
Mycobacterium intracellulare. J. Clin. Microbiol. 8:2102-2106.
[0113] 20. Picardeau M., G. Prod'hom, L. Raskine, M. P. LePennec,
and V. Vincent. 1997. Genotypic characterization of five subspecies
of Mycobacterium kansasii. J. Clin. Microbiol. 35 25-32. [0114] 21.
Rastogi N., W. W. Barrow, J. O. Falkinham III, C. O. Thoen, J. T.
Crawford, B. T. Mangura, L. B. Reichman, L. B Heifets, B.
Dautzenberg, L. S. Young, L. E. Bermudez, C. D. Inderlied, A. E.
Suzuki, J. M. Inamine, P. R. J. Gangadharam, M. V. Reddy, M. Denis,
H. Shiratsuchi, J., L. Johnson, J. J. Ellner, J. T. Belisle, and P.
J. Brennan. 1994. 11th Forum in Microbiology, "Laboratory and
clinical aspects of the Mycobacterium avium epidemic: contributing
factors associated with variability of drug susceptibility and
immune responsiveness, and the multifaceted nature of
pathogenicity". Res. Microbiol. 145:167-261. [0115] 22. Rastogi N.,
J. J. McFadden, M. L. Gourgeon, L. Montagnier, F. M. Collins, C. R.
Horsburgh, R. J. Coker, T. J. Hellyer, I. N. Brown, J. N. Weber, I.
M. Orme, D. Chatterjee, J. D. A. Van Embden, D. Van Soolingen, P.
M. Small, P. W. M. Hermans, S. E. Hoffner, G. Kallenius, S. B.
Svenson, R. S. Wallis, J. J. Ellner, H. Shiratsuchi, G. A. W. Rook,
A. Vyakarnam, D. M. Yajko, L. S. Young, L. E. M. Bermudez, C. B.
Inderlied, Z. M. Kunze, F. Portaels, and V. Labrousse. 1992. 8th
Forum in Microbiology, "Mycobacteria and AIDS: epidemiological and
genetic markers, virulence factors and interactions with the immune
system." Res Microbiol. 143:357-440. [0116] 23. Richter E., S,
Niemann, S. Rusch-Gerdes, and S. Hoffner. 1999 Identification of
Mycobacterium kansasii by using a DNA probe (AccuProbe) and
molecular techniques. J. Clin. Microbiol. 37: 964-970 [0117] 24.
Roth A., M. Fischer, M. E. Hamid, S. Michalke, W. Ludwig, and H.
Mauch. 1998 Differentiation of phylogenetically related slowly
growing mycobacteria based on 16S-23S rRNA gene internal
transcribed spacer sequences. J. Clin. Microbiol. 36:139-147.
[0118] 25. Siegel, R. W., A. B. Banta, E. S. Haas, J. W. Brown, and
N. R. Pace. 1996. Mycoplasma fermentans simplifies our view of the
catalytic core of ribonuclease P RNA. RNA 2: 452-62. [0119] 26.
Snapper, S. B., R. E. Melton, S. Mustafa, T. Kieser, and Jacobs WR
Jr. 1990. Isolation and characterization of efficient plasmid
transformation mutants of Mycobacterium smegmatis. Mol. Microbiol.
4:1911-1919 [0120] 27. Sritharan V., J. V. Iralu, and R. H. Barker
Jr. 1995. Specificity of diagnostic PCR amplification for M. avium
using the probe pMAV22. Mol. Cell. Probes 9:71-74. [0121] 28.
Stark, B. C., R. Kole, E. J. Bowman and S. Altman. 1978.
Ribonuclease P: an enzyme with an essential RNA component. Proc.
Natl. Acad. Sci. USA 3717-3721 [0122] 29. Telenti, A. F. Marchesi,
M. Balz, F. Bally E. C. Bottger, and T. Bodmer. 1993. Rapid
identification of mycobacteria to the species level by polymerase
chain reaction and restriction enzyme analysis. J. Clin. Microbiol.
31:175-178. [0123] 30. Van der Giessen J. W. B., R. M. Haring, and
B. A. M. Van der Zeijst. 1994 Comparison of the 23S ribosomal RNA
genes and the spacer region between the 16S and 23S rRNA genes of
the closely related Mycobacterium avium and Mycobacterium
paratuberculosis and the fast-growing Mycobacterium phlei.
Microbiology. 140:1103-1108. [0124] 31. Vioque A. 1992. Analysis of
the gene encoding the RNA subunit of ribonuclease P from
cyanobacteria. Nucleic Acids Res. 20:6331-37 [0125] 32. Woolford A.
J., R. G. Hewinson, M. Woodward, and J. W. Dale 1997. Sequence
heterogeneity of an mpb70 gene analogue in Mycobacterium kansasii.
FEMS Microbiol. Lett. 148:43-48) [0126] 33. Altman, S. &
Kirsebom, L. A. (1999). Ribonuclease P. In The RNA world: Second
edition (Gesteland, R. F., Cech, T. & Atkins, J. F., eds.), pp.
351-380. Cold Spring Harbour Laboratory Press, New York. [0127] 34.
Amann, R., Springer, N., Schonhuber, W., Ludwig, W., Schmid, E. N.,
Muller, K. D., Michel R. (1997). Obligate intracellular bacterial
parasites of acanthamoebae related to Chlamydia spp. Appl Environ
Microbiol 63, 115-121. [0128] 35. Andersen, A. A. & Van Deusen,
R. A. (1988). Production and partial characterization of monoclonal
antibodies to four Chlamydia psittaci isolates. Infect Immun 56,
2075-2079. [0129] 36. Baker, J. A. (1942). A virus obtained from a
pneumonia of cats and its possible relation to the cause of
atypical pneumonia in man. Science 96, 475-476. [0130] 37. Black,
C. M., Tharpe, J. A. & Russell, H. (1992). Distinguishing
Chlamydia species by restriction analysis of the major outer
membrane protein gene. Mol Cell Probes 6, 395-400. [0131] 38.
Brown, J. W., Nolan, J. M., Haas, E. S., Rubio, M-A. T., Major, F.,
Pace, N. (1996). Comparative analysis of ribonuclease P RNA using
gene sequences from natural microbial populations reveals tertiary
structural elements. Proc Natl Acad Sci 93, 301-3006. [0132] 39.
Brown, J. W. (1998). The Ribonuclease P Database. Nucl Acids Res
26, 351-352. [0133] 40. Cello, R. M. (1967). Ocular infections with
PLT (Bedsonia) group agents. Am J Ophthalmol 63, 1270-1273. [0134]
41. Chirgwin, K., Roblin, P. M. & Hammerschlag, M. R. (1989).
In vitro susceptibilities of Chlamydia pneumoniae (Chlamydia sp.
strain TWAR). Antimicrob Agents Chemother 33, 1634-1635. [0135] 42.
Everett, K. D. & Andersen, A. A. (1997). The ribosomal
intergenic spacer and domain I of the 23S rRNA gene are
phylogenetic markers for Chlamydia spp. Int J Syst Bacteriol, 47,
461-473. [0136] 43. Everett, K. D. E., Bush R. M. & Andersen,
A. A. (1999). Emended description of the order Chlamydiales,
proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov.,
each containing one monotypic genus, revised taxonomy of the family
Chlamydiaceae including a new genus and five new species, and
standards for the identification of organisms. Int J Syst Bacteriol
49, 415-440. [0137] 44. Felsenstein, J. (1993). PHYLIP (Phylogeny
inference package) (version 3.51c). Distributed by the author.
University of Washington, Seattle, Department of Genetics. [0138]
45. Francis, T., Jr., & Magill, T. P. (1938). An unidentified
virus producing acute meningitis and pneumonia in experimental
animals. J Exp Med 68, 147-160. [0139] 46. Fukushi, H. & Hirai,
K. (1989). Genetic diversity of avian and mammalian Chlamydia
psittaci strains and relation to host origin. J Bacteriol 171,
2850-2855. [0140] 47. Golub, O. J. & Wagner, J. C. (1947).
Studies on the interference phenomenon with certain members of the
psittacosis-lymphogranuloma group of viruses. J Immunol, 59, 59-70.
[0141] 48. Grayston, J. T., Kuo, C.-C., Campbell, L. A. & Wang,
S. P. (1989). Chlamydia pneumoniae sp nov for Chlamydia sp strain
TWAR. Int J Syst Bacteriol, 39, 88-90. [0142] 49. Haas, E. S.,
Brown, J. W., Pitulle, C. & Pace, N. R. (1994). Further
perspective on the catalytic core and secondary structure of
ribonuclease P RNA. Proc Natl Acad Sci 91, 2527-2531. [0143] 50.
Haas, E. S., Banta, A. B., Harris, J. K., Pace, N. R. & Brown,
J. W. (1996). Structure and evolution of ribonuclease P RNA in
Gram-positive bacteria. Nucl Acids Res 24, 4775-4782. [0144] 51.
Haas, E. S. & Brown, J. W. (1998). Evolutionary variation in
bacterial RNase P RNAs. Nucl Acids Res 26, 4093-4099. [0145] 52.
Hardt, W-D., Schlegl, J., Erdmann, V. A. & Hartmann, R. K.
(1995). Kinetics and thermodynamics of the RNase P RNA cleavage
reaction: Analysis of tRNA 3'-end variants. J Mol Biol 247,
161-172. [0146] 53. Hartmann, R. K. & Erdmann, V. A. (1991).
Analysis of the gene encoding the RNA subunit of ribonuclease P
from T. thermophilus HB8. Nucl Acids Res 19, 5957-5964. [0147] 54.
Illner, V. F. (1960). Zur Frage der Uebertragung des Ornithosevirus
durch das Ei. Monatsh Veterinaermed 17, 116-117. [0148] 55. Jukes,
T. & Cantor, C. R. (1969). Evolution of protein molecules. In
Mammalian protein metabolism, pp. 21-132. Edited by H. N. Munro,
New York: Academic Press. [0149] 56. Kahane, S., Metzer, E. &
Friedman, M. G. (1995). Evidence that the novel microorganism `Z`
may belong to a new genus in the family Chlamydiaceae. FEMS
Microbiol Lett 126, 203-207. [0150] 57. Kahane, S., Greenberg, D.,
Friedman, M. G., Haikin, H., & Dagan, R. (1998). High
prevalence of "Simkania Z," a novel chlamydia-like bacterium, in
infants with acute bronchiolitis. J Infect Dis 177, 1425-1429.
[0151] 58. Kaltenboeck, B., Kousoulas, K. G. & Storz, J.
(1993). Structures of and allelic diversity and relationships among
the major outer membrane protein (ompA) genes of the four
chlamydial species. J Bacteriol, 175, 487-502. [0152] 59. Kirsebom
& Svard (1992). The kinetics and specificity of cleavage by
RNase P is mainly dependent on the structure of the amino acid
acceptor stem. Nucl Acids Res 20, 425-432. [0153] 60. Kirsebom, L.
A. & Svard, S. G. (1994). Base pairing between Escherichia coli
RNase P RNA and its substrate. EMBO J. 13, 4870-4876. [0154] 61.
Lieberman, D., Kahane, S., Lieberman, D., & Friedman, M. G.
(1997). Pneumonia with serological evidence of acute infection with
the chlamydia-like microorganism "Z". Am. J. Respir. Crit. Care.
Med. 156, 578-82). [0155] 62. Massire, C., Jaeger, L. &
Westhof, E. (1998). Derivation of the three-dimensional
architecture of bacterial ribonuclease P RNAs from comparative
sequence analysis. J Mol Biol 279, 773-793. [0156] 63. McNutt, S.
H. & Waller, E. F. (1940). Sporadic bovine encephalomyelitis
(Buss disease). Cornell Vet 30, 437-448. [0157] 64. Murray, E. S.
(1964). Guinea pig inclusion conjunctivitis virus. I. Isolation and
identification as a member of the
psittacosis-lymphogranuloma-trachoma group. J Infect Dis 114, 1-12.
[0158] 65. Nigg, C. (1942). Unidentified virus which produces
pneumonia and systemic infection in mice. Science 95, 49-50. [0159]
66. Page, L. A. (1959). Experimental ornithosis in turkeys. Avian
Dis., 3, 51-66. [0160] 67. Page, L. A. (1967). Comparison of
"pathotypes" among Chlamydial (psittacosis) strains recovered from
diseased birds and mammals. Bull Wildl Dis Assoc, 2, 166-175.
[0161] 68. Page, L. A. & Bankowski, R. A. (1960). Factors
affecting the production and detection of ornithosis antibodies in
infected turkeys. Am J Vet Res., 21, 971-978. [0162] 69. Page, L.
A. & Cutlip, R. C. (1968). Chlamydial polyarthritis in Iowa
lambs. Iowa Vet 39, 10-18. [0163] 70. Palys, T., Nakamura, L. K.
& Cohan, F. M. (1997). Discovery and classification of
ecological diversity in the bacterial world: the role of DNA
sequence data. Int J Syst Bacteriol
47, 1145-1156. [0164] 71. Perez-Martinez, J. A. & Storz, J.
(1985). Antigenic diversity of Chlamydia psittaci of mammalian
origin determined by microimmunofluorescence. Infect Immun 50,
905-910. [0165] 72. Pettersson, B., Andersson, A., Leitner, T.,
Olsvik, O., Uhlen, M., Storey, C., Black, C. M. (1997).
Evolutionary relationships among members of the genus Chlamydia
based on 16S ribosomal DNA analysis. J Bacteriol 179, 4195-4205.
[0166] 73. Pudjiatmoko, Fukushi, H., Ochiai, Y., Yamaguchi, T.
& Hirai, K. (1997). Phylogenetic analysis of the genus
Chlamydia based on 16S rRNA gene sequences. Int J Syst Bacteriol
47, 425-431. [0167] 74. Richmond S. J., Sterling, P., Ashley, C. R.
(1982). Virus infecting the reticulate bodies of an avian strain of
Chlamydia psittaci. FEMS Microbiol. Letters, 14, 31-36. [0168] 75.
Rogers, D. G., Andersen, A. A., Hogg, A., Nielsen, D. L. &
Huebert, M. A. (1993). Conjunctivitis and keratoconjunctivitis
associated with chlamydiae in swine. J Am Vet Med Assoc 203,
1321-1323. [0169] 76. Rodolakis, A., Bernard, F. & Lantier, F.
(1989). Mouse models for evaluation of virulence of Chlamydia
psittaci isolated from ruminants. Res Vet Sci 46, 34-39. [0170] 77.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol 4,
406-425. [0171] 78. Schachter, J. & Meyer, K. F. (1969).
Lymphogranuloma venereum. II. Characterization of some recently
isolated strains. J Bacteriol 99, 636-638. [0172] 79. Spalatin, J.,
Fraser, C. E. O., Connell, R. P. & Berman, D. T. (1966). Agents
of psittacosis-lymphogranulomavenereum group isolated from muskrats
and snowshoe hares in Saskatchewan. Can J Comp Med Vet Sci 30,
225-420. [0173] 80. Stephens, R. S., Kalman, S., Fenner, C., Davis,
R. (1998) Chlamydia Genome Project. [0174] 81. Stills, H. F. J.,
Fox, J. G., Paster, B. J. & Dewhirst, F. E. (1991). A "new"
Chlamydia sp. strain SFPD isolated from transmissible proliferative
ileitis in hamsters. Microbiol. Ecol Health Dis 4, S99. [0175] 82.
Vioque, A. (1997). The RNase P RNA from cyanobacteria: short
tandemly repeated repetitive (STRR) sequences are present within
the RNase P RNA gene in heterocyst-forming cyanobacteria. Nucl
Acids Res 25, 3471-3477. [0176] 83. Wang, S.-P. & Grayston, J.
T. (1962). Classification of trachoma virus strains by protection
of mice from toxic death. J Immunol 90, 849-856. [0177] 84. Wills,
J. M., Gruffydd-Jones, T. J., Jones T, Richmond, S., Paul, I. D.
(1984). Isolation of Chlamydia psittaci from cases of
conjunctivitis in a colony of cats. Vet Rec 114, 344-346. [0178]
85. Zhang, Y. X., Fox, J. G., Ho, Y., Zhang, L., Stills, H. J.
& Smith, T. F. (1993). Comparison of the major outer-membrane
protein (MOMP) gene of mouse pneumonitis (MoPn) and hamster SFPD
strains of Chlamydia trachomatis with other Chlamydia strains. Mol
Biol Evol 10, 1327-42.
Sequence CWU 1
1
54120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1cggatgagtt ggctgggcgg 20220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2gttggcctgt aagccggatt 20321DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 3cttgcttgcc
ctccctttgc c 21420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 4cggactttat aagaaaagat 20517DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5rataagccgg gttctgt 17617DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 6rrmgrrgagg aaagtcc
17723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7cgaactaatc ggaagagtaa ggc 23822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8gagcgagtaa gccggrttct gt 22951DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9tttgaattcg aaattaatac
gactcactat agcgaactaa tcggaagagt a 511045DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10tttaagcttg gatggtacct tggaaaagct cggaagagcg agtaa
4511427DNAMycobacterium tuberculosis 11cggatgagtt ggctgggcgg
ccgcggctcg cgtagggctt gtgtggattc acgaggttca 60gcgtcgagtc gaggaaagtc
cggacttcac agagcagggt gattgctaac ggcaatccga 120ggtgactcgc
gggaaagtgc cacagaaaac agaccgccat cctcgtggtg gcaagggtga
180aacggtgcgg taagagcgca ccagcattcc gggtgaccgg ggtggctagg
caaaccccac 240ccgaagcaag gccaagaagg ccgcaccgaa agtgcggccg
cgcaggcgct tgagggttgc 300tcgcccgagc ctgcgggtag gccgctcgag
gcacccggta acggtgtgtc cagatggatg 360gtcgccgccg tgccgccgtt
agcttggctg tggcggcgcg gaacagaatc cggcttacag 420gccaact
42712433RNAMycobacterium tuberculosis 12cggaugaguu ggcugggcgg
ccgcggcucg cguagggcuu guguggauuc acgagguuca 60gcgucgaguc gaggaaaguc
cggacuucac agagcagggu gauugcuaac ggcaauccga 120ggugacucgc
gggaaagugc cacagaaaac agaccgccau ccucguggug gcaaggguga
180aacggugcgg uaagagcgca ccagcauucc gggugaccgg gguggcuagg
caaaccccac 240ccgaagcaag gccaagaagg ccgcaccgaa agugcggccg
cgcaggcgcu ugaggguugc 300ucgcccgagc cugcggguag gccgcucgag
gcacccggua acgguguguc cagauggaug 360gucgccgccg ugccgccguu
agcuuggcug uggcggcgcg gaacagaauc cggcuuacag 420gccaacucgu ccg
43313415DNAMycobacterium kansasii 13cggatgagtt ggctgggcgg
ccgcggctcg agttggttcg caaggatcgg cgccgagccg 60aggaaagtcc ggacttcaca
gagcagggtg attgctaacg gcaatccgag gtgactcgcg 120ggaaagtgcc
acagaaaaca aaccgccatc ctcgtggtgg taagggtgaa acggtgcggt
180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc aaaccccacc
cgaagcaagg 240ccaagaaggc cgcacgaagg tgcggccgcg cagacgccgg
agggttgctc gcccgagtct 300gcgggtaggc cgctcgaggc acccggtgac
ggtgtgtcca gatggatggt cgccgccgtg 360ccgccgttgg ttcagccgcg
gcggcaggga acagaatccg gcttacaggc caaca 41514398DNAChlamydia
trachomatis 14tcggaagagt aaggcaaccg ctgaaaccag ctttttaaaa
aagatgagta ccagaggaaa 60gtccggactt tataagaaaa gatgctggag aaattccagg
ggccgtaagg ctacggaaag 120tgcaacagaa aacactccgc tataaattgt
ataatttata gacaggctga aaaatcttac 180tttaggagta agagctgcta
gggagaccta gcagacttgt aaaccccatc tgaagcaaga 240gaaaaagtta
tttgtttctg caaacaacct ttctaacgaa aggcacaggc tttttcataa
300tcgcttgagg agtacagtaa tgtgctccct agatgaatgg ttgcccgcaa
gcaagaactt 360ccgttcgtgc ttgtcgacag aayccggctt actcgctc
39815396RNAChlamydia psittacimodified_base(389)..(396)a, c, g, or u
15ucggaagagu aaggcaaccg cuuuuuguac cuuuacuaag guauauuaag aggaaagucu
60ggacuucaua agaaaagaua cuggagaaac uccaggggcc guaaggcuac ggaaagugca
120acagaaaaca uuccgcuaua aaagggucuu uuuauagaca ggcugaaaau
uccuauuuua 180agaauaggag cuauuaaggu gacuuaguag acgugcaaac
ccuaucugaa gcaagagaaa 240aaguuuuugu uucugcauaa ugaggaaugg
uauuccucau gaacuuuuuc auaaucgcuu 300gagggauaua guaauauauc
cccuagauga augguugccc ucaagauggg uuuucucauc 360uuguagacag
aayccggcuu acucgcucnn nnnnnn 39616346RNASimkania
negevensismodified_base(1)..(31)a, c, g, or u 16nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nrrmgrrgag gaaaguccgg acuucgcaga 60aaaaggugcc
agugaaaaac ugggggccgu aaggcuacgg aaaguguaac agaaaacaaa
120ccgcuaauuc uaccuaggua agauuagaca ggaungaaaa ugucgagcuu
auggcucgac 180cucuuugugg aaacacaagg acgcugcaaa ccccaccuga
agcaagaaag aguucguuuc 240aguuuuucgc ucaggaacuc uuagagucgc
ucgaggauuu uggugacaaa gucccuagau 300gaaugauugc cucgcacaga
acccggcuua ynnnnnnnnn nnnnnu 34617361RNAParachlamydia
acanthamoebaemodified_base(1)..(33)a, c, g, or u 17nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nnnrrmgrrg aggaaagucc ggacuuuaua 60ggagaggaug
ccagugaaag acugggggcc gcaaggcuac ggaaagugcc acagaaaaca
120aaccgcuaac aagcuaugcu uguuagauag ggugaaaugc cugcuuuagg
agcauggccu 180uaucuagaga aauuuagaaa gugguaaacc ccauccaaag
caagacggaa auaaagcgau 240acaguucucc gcugugcuuu agaaaagucg
cuugaggguu ucggugacgg cgccccuaga 300ggaaugauug cucgucugcu
uugcagaccg acagaacccg gcuuaynnnn nnnnnnnnnn 360u
3611822RNAMycobacterium tuberculosis 18ggcacccggu aacggugugu cc
221922RNAMycobacterium smegmatis 19gguacccggc gacgggcuac cc
222022RNAMycobacterium marinum 20gguacccggc aacggugugc cc
2221385DNAMycobacterium celatum 21cggatgagtt ggctgggcgg ccgcggctcg
tttcggcgag tcgaggaaag tccggacttc 60acagagcagg gtggttgcta acggcaaccc
ggggtgaccc gcgggaaagt gccacagaaa 120acagaccgcc accttcgcgg
tggtaagggt gaaacggtgc ggtaagagcg caccagcatt 180ccgggtgacc
ggaatggctc ggcaaacccc acccgaagca aggccaagaa gaccgcacct
240tcggtgcggt cgcgcaggcg tccgagggtt gctcgcccga gcctgcgggt
aggccgcttg 300aggcacccgg tgacggtgtg tccagatgga tggtcgccgc
cgcgcacttg gtggcgcggt 360acagaatccg gcttacaggc caaca
38522406DNAMycobacterium xenopi 22cggatgagtt ggctgggcgg ccgcggctct
ccctggtccg caggaccagg cgagtcgagg 60aaagtccgga cttcacagag cagggtggtt
gctaacagca acccggggtg acccgcggga 120aagtgccaca gaaaacagac
cgccaccttc gcggtggtaa gggtgaaacg gtgcggtaag 180agcgcaccag
catcccgggt gaccgggatg gctaggcaaa ccccacccga agcaaggcca
240agaagaccgc acccggtgcg gtcgcgcagg cgcttgaggg ttgctcgccc
gagcctgcgg 300gtaggccgct tgaggcaccc ggtgacggtg tgtccagatg
gatggtcgcc gccccgctgc 360cgctattcgc ggtggcgggg aacagaatcc
ggcttacagg ccaaca 40623413DNAMycobacterium malmoense 23cggatgagtt
ggctgggcgg ccgcggctcg cgccggtcga gaggccggtg ccgagtcgag 60gaaagtccgg
acttcacaga gcagggtgat tgctaacggc aatccgaggt gactcgcggg
120aaagtgccac agaaaacaaa ccgccacctt cgcggtggta agggtgaaac
ggtgcggtaa 180gagcgcacca gcattccggg tgaccggaat ggctcggcaa
accccacccg aagcaaggcc 240aagaaggccg cacgaaagtg cggccgcgca
ggcgctcgag ggttgctcgc ccgagcctgc 300gggtaggccg cttgaggcac
ccggcgacgg tgtgtccaga tggatggtcg ccgccgcgcc 360gccgttgctt
atgccgcggc ggcggggaac agaatccggc ttacaggcca aca
41324416DNAMycobacterium leprae 24cggacgagtt ggctgggcgg ccgcggctcg
tgtcggtctg aaaggcccgg taacgagtcg 60aggaaagtcc ggacttcaca gagcagggtg
attgctaaca gcaatccgag gtgactcgcg 120ggatagtgcc acagaaaaca
aaccgccatc ctcgcggtgg taagggtgaa acggtgcggt 180aagagcgcac
cagcatcccg ggtgaccggg atggcttggt aaaccccacc cgaagcaagg
240tcaagaaggc tgcactacaa gtgcggccgc gcaggcgttc gagagctgct
cgcccgagcc 300tgcgggtagg ccgcttgagg cacccggcaa cggtgtgtcc
agatggatgg tcgccgccgc 360gccaccgtag gcaatgccgc gttggcgggg
aacagaatcc ggcttatagg ccaact 41625392DNAMycobacterium fortuitum
25cggatgagtt ggctgggcgg ccgcggcacc ggtgcaaacc ggggtcgagg aaagtccgga
60cttcacagag cggggtgatt gctaacggca atccgaggtg actcgcggga aagtgccaca
120gaaaacagac cgccagaaat ggtaagggtg aaacggtgcg gtaagagcgc
accagcaccc 180cgggtgaccg gggtggctag gcaaacccca cccgaagcaa
ggccaagaag accgcaacct 240ggttgcggtc gcgcaggcgc ctgagggctg
ctcgcccgag cctgcgggta ggccgcttga 300ggcacccggc gacggtgtgt
ccagatggat ggtcgccacc ggcccgcccg gtaacgggag 360ggccggcaca
gaatccggct tacaggccaa ca 39226385DNAMycobacterium smegmatis
26cggatgagtt ggctgggcgg ccgcggcatc gcctgatgtc gaggaaagtc cggacttcac
60agagcagggt gattgctaac ggcaatccga ggtgactcgc gggaaagtgc cacagaaaac
120agaccgccag aaatggtaag ggtgaaacgg tgcggtaaga gcgcaccagc
accccgggtg 180accggggtgg ctaggcaaac cccacccgaa gcaaggccaa
gaaggccgca actgcggttg 240cggccgcgca ggcgcccgag ggttgctcgc
ccgagcctgc gggtaggccg cttgaggtac 300ccggcgacgg gctacccaga
tggatggtcg ccgccccacc gccagagatg gcggcgggga 360acagaatccg
gcttacaggc caaca 38527392DNAMycobacterium avium 27cggatgagtt
ggctgggcgg ccgcggctcg tatcccgagt cgaggaaagt ccggacttca 60cagagcaggg
tgattgctaa cggcaatccg aggtgactcg cgggaaagtg ccacagaaaa
120cagaccgcca ccctcgtggt ggtaagggtg aaacggtgcg gtaagagcgc
accagcaccc 180cgggtgaccg gggtggctcg gcaaacccca cccgaagcaa
ggccaagaag gtcgtgccgc 240cggcacggcc gcgcaggcgt ccgagggttg
ctcgcccgag cctgcgggta ggccgctcga 300ggcacccggt gacggtgtgt
ccagatggat ggtcgccgcc gcgccgccgg ttttccggcg 360gcgcggaaca
gaatccggct tacaggccaa ca 39228392DNAMycobacterium paratuberculosis
28cggatgagtt ggctgggcgg ccgcggctcg tatcccgagt cgaggaaagt ccggacttca
60cagagcaggg tgattgctaa cggcaatccg aggtgactcg cgggaaagtg ccacagaaaa
120cagaccgcca ccctcgtggt ggtaagggtg aaacggtgcg gtaagagcgc
accagcaccc 180cgggtgaccg gggtggctcg gcaaacccca cccgaagcaa
ggccaagaag gccgtgccgc 240cggcacggcc gcgcaggcgt ccgagggttg
ctcgcccgag cctgcgggta ggccgctcga 300ggcacccggt gacggtgtgt
ccagatggat ggtcgccgcc gcggcgccgg ttttccggcg 360gcgcggaaca
gaatccggct tacaggccaa ca 39229417DNAMycobacterium gordonae
29cggatgagtt ggctgggcgg ccgcggcccg agtcggtccg agaggtgccg acttgagtcg
60aggaaagtcc ggacttcaca gagcagggtg attgctaacg gcaatccgag gtgactcgcg
120ggaaagtgcc acagaaaaca gaccgccacc gtcgtggtgg taagggtgaa
acggtgcggt 180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc
aaaccccacc cgaagcaagg 240ccaagaaggc cgcaccgaaa gtgcggccgc
gcagacgttt gagggctgct cgcccgagtc 300tgcgggtagg ccgctcgagg
cacccggtaa cggtgtgtcc agatggatgg tcgtcgccgt 360gccgccgtgg
attaaagccg cggcggtggg gaacagaatc cggcttacag gccaact
41730425DNAMycobacterium marinum 30cggatgagtt ggctgggcgg ccgcggctcg
ggttgggctc gtgttgtcac gagttcagcg 60ccgaatcgag gaaagtccgg acttcacaga
gctgggtgat tgctaacagc aatccgaggt 120gactcgcggg aaagtgccac
agaaaacaga ccgccaccct cgcggtggta agggtgaaac 180ggtgcggtaa
gagcgcacca gcaccccggg tgaccggggt ggctaggcaa accccacccg
240aagcaaggtc aagaaggccg taccgtaggg tgcggccgcg caggcgtttg
agggctgctc 300gcccgagtct gcgggtaggc cgctcgaggt acccggcaac
ggtgtgccca gatggatggt 360cgccgccgcg ccgccgctgg ttcagccgcg
gcggtgtgga acagaatccg gcttacgggc 420caaca 42531399DNAMycobacterium
intracellulare 31cggatgagtt ggctgggcgg ccgcgggccg tcgcaaggcg
gttcgaggaa agtccggact 60tcacagagca gggtgattgc taacggcaat ccgaggtgac
tcgcgggaaa gtgccacaga 120aaacagaccg ccaccctcgc ggtggtaagg
gtgaaacggt gcggtaagag cgcaccagca 180tcccgggtga ccggggtggc
tcggcaaacc ccacccgaag caaggccaag aaggccgcac 240cgctggtgcg
gccgcgcagg cgttcgaggg ctgctcgccc gagcctgcgg gtaggccgct
300cgaggcaccc ggtgacggtg tgtccagatg gatggtcgcc gccgcaccgc
cgttgctcac 360gcgcggcggt gtggaacaga atccggctta caggccaac
39932416DNAMycobacterium gastri 32cggatgagtt ggctgggcgg ccgcggctcg
agtcggttcg caaggaccgg cgccgagtcg 60aggaaagtcc ggacttcaca gagcagggtg
attgctaacg gcaatccgag gtgactcgcg 120ggaaagtgcc acagaaaaca
aaccgccacc ctcgcggtgg taagggtgaa acggtgcggt 180aagagcgcac
cagcatcccg ggtgaccggg gtggctaggc aaaccccacc cgaagcaagg
240ccaagaaggc cgcaccgaag gtgcggccgc gcagacgatc gagggttgct
cgcccgagtc 300tgcgggtagg ccgcttgagg cacccggtga cggtgtgtcc
agatggatgg tcgccgccgt 360gccgccgttg gttcagccgc ggcggcaggg
aacagaatcc ggcttacagg ccaaca 41633416DNAMycobacterium kansasii
33cggatgagtt ggctgggcgg ccgcggctcg agttggttcg caaggatcgg cgccgagccg
60aggaaagtcc ggacttcaca gagcagggtg attgctaacg gcaatccgag gtgactcgcg
120ggaaagtgcc acagaaaaca aaccgccatc ctcgtggtgg taagggtgaa
acggtgcggt 180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc
aaaccccacc cgaagcaagg 240ccaagaaggc cgcaccgaag gtgcggccgc
gcagacgccg gagggttgct cgcccgagtc 300tgcgggtagg ccgctcgagg
cacccggtga cggtgtgtcc agatggatgg tcgccgccgt 360gccgccgttg
gttcagccgc ggcggcaggg aacagaatcc ggcttacagg ccaaca
41634427DNAMycobacterium microti 34cggatgagtt ggctgggcgg ccgcggctcg
cgtagggctt gtgtggattc acgaggttca 60gcgtcgagtc gaggaaagtc cggacttcac
agagcagggt gattgctaac ggcaatccga 120ggtgactcgc gggaaagtgc
cacagaaaac agaccgccat cctcgtggtg gcaagggtga 180aacggtgcgg
taagagcgca ccagcattcc gggtgaccgg ggtggctagg caaaccccac
240ccgaagcaag gccaagaagg ccgcaccgaa agtgcggccg cgcaggcgct
tgagggttgc 300tcgcccgagc ctgcgggtag gccgctcgag gcacccggta
acggtgtgtc cagatggatg 360gtcgccgccg tgccgccgtt agcttggctg
tggcggcgcg gaacagaatc cggcttacag 420gccaaca
42735427DNAMycobacterium bovis 35cggatgagtt ggctgggcgg ccgcggctcg
cgtagggctt gtgtggattc acgaggttca 60gcgtcgagtc gaggaaagtc cggacttcac
agagcagggt gattgctaac ggcaatccga 120ggtgactcgc gggaaagtgc
cacagaaaac agaccgccat cctcgtggtg gcaagggtga 180aacggtgcgg
taagagcgca ccagcattcc gggtgaccgg ggtggctagg caaaccccac
240ccgaagcaag gccaagaagg ccgcaccgaa agtgcggccg cgcaggcgct
tgagggttgc 300tcgcccgagc ctgcgggtag gccgctcgag gcacccggta
acggtgtgtc cagatggatg 360gtcgccgccg tgccgccgtt agcttggctg
tggcggcgcg gaacagaatc cggcttacag 420gccaaca
42736427DNAMycobacterium tuberculosis 36cggatgagtt ggctgggcgg
ccgcggctcg cgtagggctt gtgtggattc acgaggttca 60gcgtcgagtc gaggaaagtc
cggacttcac agagcagggt gattgctaac ggcaatccga 120ggtgactcgc
gggaaagtgc cacagaaaac agaccgccat cctcgtggtg gcaagggtga
180aacggtgcgg taagagcgca ccagcattcc gggtgaccgg ggtggctagg
caaaccccac 240ccgaagcaag gccaagaagg ccgcaccgaa agtgcggccg
cgcaggcgct tgagggttgc 300tcgcccgagc ctgcgggtag gccgctcgag
gcacccggta acggtgtgtc cagatggatg 360gtcgccgccg tgccgccgtt
agcttggctg tggcggcgcg gaacagaatc cggcttacag 420gccaact
42737415DNAMycobacterium gastri 37cggatgagtt ggctgggcgg ccgcggctcg
agtcggttcg caaggaccgg cgccgagtcg 60aggaaagtcc ggacttcaca gagcagggtg
attgctaacg gcaatccgag gtgactcgcg 120ggaaagtgcc acagaaaaca
aaccgccacc ctcgcggtgg taagggtgaa acggtgcggt 180aagagcgcac
cagcatcccg ggtgaccggg gtggctaggc aaaccccacc cgaagcaagg
240ccaagaaggc cgcacgaagg tgcggccgcg cagacgatcg agggttgctc
gcccgagtct 300gcgggtaggc cgcttgaggc acccggtgac ggtgtgtcca
gatggatggt cgccgccgtg 360ccgccgttgg ttcagccgcg gcggcaggga
acagaatccg gcttacaggc caaca 41538415DNAMycobacterium kansasii
38cggatgagtt ggctgggcgg ccgcggctcg ggttggttcg caaggatcgg cgccgagtcg
60aggaaagtcc ggacttcaca gagcagggtg attgctaacg gcaatccgag gtaactcgcg
120ggaaagtgcc acagaaaaca aaccgccatc ctcgtggcgg taagggtgaa
acggtgcggt 180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc
aaaccccacc cgaagcaagg 240ccaagaaggc cgcaccaagg tgcggccgcg
cagacgctcg agggttgctc gcccgagtct 300gcgggtaggc cgcttgaggc
acccggtgac ggtgtgtcca gatggatggt cgccgccgtg 360ccgccgttgg
ttcagccgcg gcggcaggga acagaatccg gcttacaggc caaca
41539415DNAMycobacterium kansasii 39cggatgagtt ggctgggcgg
ccgcggctcg ggttggttcg caaggatcgg cgccgagtcg 60aggaaagtcc ggacttcaca
gagcagggtg attgctaacg gcaatccgag gtaactcgcg 120ggaaagtgcc
acagaaaaca aaccgccatc ctcgcggtgg taagggtgaa acggtgcggt
180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc aaaccccacc
cgaagcaagg 240ccaagaaggc cgcaccaagg tgcggccgcg cagacgctcg
agggttgctc gcccgagtct 300gcgggtaggc cgcttgaggc acccggtgac
ggtgtgtcca gatggatggt cgccgccgtg 360ccgccgttgg ttcagccgcg
gcggcaggga acagaatccg gcttacaggc caaca 41540415DNAMycobacterium
kansasii 40cggatgagtt ggctgggcgg ccgcggctcg agttggttcg caaggatcgg
cgccgagtcg 60aggaaagtcc ggacttcaca gagcagggtg attgctaacg gcaatccgag
gtaactcgcg 120ggaaagtgcc acagaaaaca aaccgccatc ctcgcggtgg
taagggtgaa acggtgcggt 180aagagcgcac cagcatcccg ggtgaccggg
gtggctaggc aaaccccacc cgaagcaagg 240ccaagaaggc cgcaccaagg
tgcggccgcg cagacgctcg agggttgctc gcccgagtct 300gcgggtaggc
cgcttgaggc acccggtgac ggtgtgtcca gatggatggt cgccgccgtg
360ccgccgttgg ttcagccgcg gcggcaggga acagaatccg gcttacaggc caaca
41541415DNAMycobacterium kansasii 41cggatgagtt ggctgggcgg
ccgcggctcg agttggttcg caaggatcgg cgccgagccg 60aggaaagtcc ggacttcaca
gagcagggtg attgctaacg gcaatccgag gtgactcgcg 120ggaaagtgcc
acagaaaaca aaccgccatc ctcgtggtgg taagggtgaa acggtgcggt
180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc aaaccccacc
cgaagcaagg 240ccaagaaggc cgcacgaagg tgcgggcggg cagacgccgg
agggttgctc gcccgagtct 300gcgggtaggc cgctcgaggc acccggtgac
ggtgtgtcca gatggatggt cgccgccgtg 360ccgccgttgg ttcagccgcg
gcggcaggga acagaatccg gcttacaggc caaca 41542415DNAMycobacterium
kansasii 42cggatgagtt ggctgggcgg ccgcggctcg agttggttcg caaggatcgg
cgccgagtcg 60aggaaagtcc ggacttcaca gagcagggtg attgctaacg gcaatccgag
gtaactcgcg 120ggaaagtgcc acagaaaaca aaccgccatc ctcgcggtgg
taagggtgaa acggtgcggt 180aagagcgcac cagcatcccg ggtgaccggg
gtggctaggc aaaccccacc cgaagcaagg 240ccaagaaggc cgcaccaagg
tgcggccgcg cagacgctcg agggttgctc gcccgagtct 300gcgggtaggc
cgcttgaggc acccggtgac ggtgtgtcca gatggatggt cgccgccgtg
360ccgccgttgg ttcagccgcg gcggcaggga acagaatccg gcttacaggc caaca
41543415DNAMycobacterium kansasii
43cggatgagtt ggctgggcgg ccgcggctcg agttggttcg caaggatcgg cgccgagccg
60aggaaagtcc ggacttcaca gagcagggtg attgctaacg gcaatccgag gtgactcgcg
120ggaaagtgcc acagaaaaca aaccgccatc ctcgtggtgg taagggtgaa
acggtgcggt 180aagagcgcac cagcatcccg ggtgaccggg gtggctaggc
aaaccccacc cgaagcaagg 240ccaagaaggc cgcacgaagg tgcggccgcg
cagacgccgg agggttgctc gcccgagtct 300gcgggtaggc cgctcgaggc
acccggtgac ggtgtgtcca gatggatggt cgccgccgtg 360ccgccgttgg
ttcagccgcg gcggcaggga acagaatccg gcttacaggc caaca
41544398DNAChlamydia trachomatis 44tcggaagagt aaggcaaccg ctgaaaccag
ctttttaaaa aagatgagta ccagaggaaa 60gtccggactt tataagaaaa gatgctggag
aaattccagg ggccgtaagg ctacggaaag 120tgcaacagaa aacactccgc
tataaattgt ataatttata gacaggctga aaaatcttac 180tttaggagta
agagctgcta gggagaccta gcagacttgt aaaccccatc tgaagcaaga
240gaaaaagtta tttgtttctg caaacaacct ttctaacgaa aggcacaggc
tttttcataa 300tcgcttgagg agtacagtaa tgtgctccct agatgaatgg
ttgcccgcaa gcaagaactt 360ccgttcgtgc ttgtcgacag aayccggctt actcgctc
39845394DNAChlamydia suis 45tcggaagagt aaggcagccg ctggagcagt
ttgtttaaag ctgatgtcag aggaaagtcc 60ggacttcata agaaaagatg ctggagaaat
tccaggggcc gagaggctac ggaaagtgca 120acagaaaaca ctccgctata
aattgcaaaa tttatagaca ggctgaaaaa tcctacttta 180agagtaggag
ctgctgggga gacccggtag acctgtaaac cccatctgaa gcaagagaaa
240aagtcttttg tctctgcaaa gaacctctct aagggaaggt tcagactttt
tcataatcgc 300ttgagaagta tagtaatgtg cttcctagat gaatggctgc
ccgcaagcag gaatttttat 360tcgcgcttgt tgacagaayc cggcttactc gctc
39446395DNAChlamydia muridarum 46tcggaagagt aaggcaaccg ctgagccagt
tttagaaaaa ctgcgtatca gaggaaagtc 60cggacttcgt aagaaaagat gctggagaaa
ttccaggggc cgtaaggcta cggaaagtgc 120aacagaaaac attccgctat
aaatgatatc atttatagac aggctgaaaa atcctacttt 180aggagtagga
gctgctaggg agacctggta gacttgtaaa ccccatctga agcaagagaa
240aaagttattt gtctctgcaa aatcctttct aatgaaaggc ataaactttt
tcataatcgc 300ttgaggagta cagtaatgtg ctccctagat gaatggttgc
ccacaagtaa gaatttctta 360ttcgtacttg ttgacagaay ccggcttact cgctc
39547399DNAChlamydia pecorum 47tcggaagagt aaggcaaccg ctgtttatgc
tttttcacaa tgaaaaagca taaagagagg 60aaagtctgga cttcataaga aaagatactg
gagaaactcc aggggccgtg aggctacgga 120aagtgcaaca gaaaacattc
cgctataaaa tgaaagtttt atagacaggc tgaaaattcc 180tactttagga
gtaggagcta ttaaggtgac ttaatagaca tgcaaaccct atctgaagca
240agagaaaaaa gcttttttgt ttctgcaaaa ttgagaagtt ttcttctcat
aagttttttc 300ataatcgctc gagggattta gagatagatc ccctagatga
atggttgccc tcagggagac 360gtttgtccac cctgcagaca gaayccggct tactcgctc
39948388DNAChlamydia caviae 48tcggaagagt aaggcaaccg ctttttatat
ctctagttag gtatactgag aggaaagtct 60ggacttcata agaagagata ctggagaaac
tccaggggcc gtaaggctac ggaaagtgca 120acagaaaaca ctccgctata
aaagggtctt tttatagaca ggctgaaaat tcctacttta 180agagtaggag
ctattaaggt gacttaatag acatgcaaac cctatctgaa gcaagagaaa
240aagtttttgt ttctgcatag tgagggatag tattcctcat aaactttttc
ataatcgctt 300gaggggtata gtaatatgcc ccctagatga atggttgccc
tcaagatggt cttttccatc 360ttgtagacag aayccggctt actcgctc
38849376DNAChlamydia felis 49tcggaagagt aaggcaaccg cttcctgtat
ctctagtaga tatggtaaga ggaaagtctg 60gacttcataa gaagagatac tggagaaact
ccaggggccg taaggctacg gaaagtgcaa 120cagaaaacac tccgctataa
tatagacagg ctgaaaattc ctactttaag agtaggagct 180attaaggtga
cttaatagac gtgcaaaccc tatctgaagc aagagaaaaa gtttttgttt
240ctgcataatg aggagctctg ttcctcataa actttttcac aatcgcttga
gggatatagt 300aatatatccc ctagatgaat ggttgccctc aagatggtct
ttgccatctt gtagacagaa 360yccggcttac tcgctc 37650388DNAChlamydia
psittaci 50tcggaagagt aaggcaaccg ctttttgtac ctttactaag gtatattaag
aggaaagtct 60ggacttcata agaaaagata ctggagaaac tccaggggcc gtaaggctac
ggaaagtgca 120acagaaaaca ttccgctata aaagggtctt tttatagaca
ggctgaaaat tcctatttta 180agaataggag ctattaaggt gacttagtag
acgtgcaaac cctatctgaa gcaagagaaa 240aagtttttgt ttctgcataa
tgaggaatgg tattcctcat gaactttttc ataatcgctt 300gagggatata
gtaatatatc ccctagatga atggttgccc tcaagatggg ttttctcatc
360ttgtagacag aayccggctt actcgctc 38851390DNAChlamydia abortus
51tcggaagagt aaggcaaccg ctttttgtac cttaactaag gtagattaag aggaaagtct
60ggacttcata agaaaagata ctggagaaac tccaggggcc gtaaggctac ggaaagtgca
120acagaaaaca ttccgctata aaagggtctt tttatagaca ggctgaaaat
tcctatttta 180agaataggag ctattaaggt gacttagtag acatgcaaac
cctatctgaa gcaagagaaa 240aagtttttgt ttctgcataa tgagagggag
ggtatccctc atgaactttt tcataatcgc 300ttgagggata tagtaatata
tcccctagat gaatggttgc cctcaagatg agttttttca 360tcttgtagac
agaayccggc ttactcgctc 39052392DNAChlamydia pneumoniae 52tcggaagagt
aaggcaaccg ctgtttatat ttctcaaaaa atataaagag aggaaagtct 60ggacttcata
agagaagata ctggagaaat tccaggggcc gtaaggctac ggaaagtgca
120acagaaaaca ctccgctata aaatttattt tatagacagg ctgaaaattc
ctactttagg 180agtaggagcc attaaggtga cttaataggc atgcaaaccc
tatctgaagc aagagaaaaa 240agctttttgt gtctgcaaat gtgagaggaa
ttcctcccat aggctttttc gaaatcgctt 300gagggatcta gtaatagctc
ccctagatga atggttgccc ttaggatagt tcgcaagagc 360tatcttatag
acagaayccg gcttactcgc tc 39253313DNAParachlamydia acanthamoebae
53rrmgrrgagg aaagtccgga ctttatagga gaggatgcca gtgaaagact gggggccgca
60aggctacgga aagtgccaca gaaaacaaac cgctaacaag ctatgcttgt tagatagggt
120gaaatgcctg ctttaggagc atggccttat ctagagaaat ttagaaagtg
gtaaacccca 180tctcaagcaa gacggaaata aagcgataca gttctccgct
gtgctttaga aaagtcgctt 240gagggtttcg gtgacggcgc ccctagagga
atgattgctc gtctgctttg cagaccgaca 300gaacccggct tay
31354299DNASimkania negevensis 54rrmgrrgagg aaagtccgga cttcgcagaa
aaaggtgcca gtgaaaaact gggggccgta 60aggctacgga aagtgtaaca gaaaacaaac
cgctaattct acctaggtaa gattagacag 120gatgaaaatg tcgagcttat
ggctcgacct ctttgtggaa acacaaggac gctgcaaacc 180ccatctgaag
caagaaagag ttcgtttcag tttttcgctc aggaactctt agagtcgctc
240gaggattttg gtgacaaagt ccctagatga atgattgcct cgcacagaac ccggcttay
299
* * * * *
References