U.S. patent application number 13/645197 was filed with the patent office on 2014-01-16 for transgenic algae for delivering antigens to an animal.
This patent application is currently assigned to The Ohio State University Research Foundation. The applicant listed for this patent is ALGAEOMICS LLC, The Ohio State University Research Foundation. Invention is credited to Richard T. Sayre.
Application Number | 20140017272 13/645197 |
Document ID | / |
Family ID | 22792303 |
Filed Date | 2014-01-16 |
United States Patent
Application |
20140017272 |
Kind Code |
A1 |
Sayre; Richard T. |
January 16, 2014 |
TRANSGENIC ALGAE FOR DELIVERING ANTIGENS TO AN ANIMAL
Abstract
Delivery systems and methods are provided for delivering a
biologically active protein to a host animal. The systems and
methods provided include obtaining an algal cell transformed by an
expression vector, the expression vector comprising a nucleotide
sequence coding for the biologically active protein, operably
linked to a promoter. In one illustrated embodiment, the
biologically active protein is an antigenic epitope and upon
administration to the animal the algal cell induces an immune
response in the host animal.
Inventors: |
Sayre; Richard T.; (Los
Alamos, NM) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Ohio State University Research Foundation
ALGAEOMICS LLC |
Columbus
Wildwood |
OH
MO |
US
US |
|
|
Assignee: |
The Ohio State University Research
Foundation
Columbus
OH
ALGAEOMICS LLC
Wildwood
MO
|
Family ID: |
22792303 |
Appl. No.: |
13/645197 |
Filed: |
January 2, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12145249 |
Jun 24, 2008 |
8282915 |
|
|
13645197 |
|
|
|
|
10311741 |
Dec 18, 2002 |
7410637 |
|
|
PCT/US01/19643 |
Jun 20, 2001 |
|
|
|
12145249 |
|
|
|
|
60212757 |
Jun 20, 2000 |
|
|
|
Current U.S.
Class: |
424/192.1 ;
424/224.1; 435/257.2 |
Current CPC
Class: |
A61K 2039/54 20130101;
A23K 50/00 20160501; A61K 2039/523 20130101; C12N 15/8257 20130101;
A61K 9/5068 20130101; A61K 39/12 20130101; A23K 50/70 20160501;
A61K 39/205 20130101; A23K 20/147 20160501; C12N 2710/18034
20130101; C12N 15/8214 20130101; C12N 7/00 20130101; A61K 2039/552
20130101; C12N 2710/18022 20130101; A61K 39/0208 20130101; A61K
2039/517 20130101; C07K 14/195 20130101; A61K 2039/542 20130101;
A23K 50/75 20160501; C12N 1/12 20130101; A23K 10/16 20160501; A23K
50/80 20160501; A61K 39/05 20130101 |
Class at
Publication: |
424/192.1 ;
435/257.2; 424/224.1 |
International
Class: |
A61K 39/205 20060101
A61K039/205 |
Claims
1. A delivery system for delivering a biologically active protein
to a host animal comprising an algal cell transformed by an
expression vector, and the expression vector comprising a
nucleotide sequence coding for the biologically active protein,
operably linked to a promoter.
2. The delivery system of claim 1, wherein the algal cell is
suspended in water for immersing the host animal.
3. The delivery system of claim 1 wherein the biologically active
protein is selected from the group consisting of hormones and
antimicrobial peptides.
4. The delivery system of claim 1 wherein the algal cell is mixed
with a sample of feed for the host animal.
5. The delivery system of claim 1 wherein the animal is selected
from the group consisting of mammals, fish, birds, and
crustaceans.
6. The delivery system of claim 1 wherein the biologically active
protein is a peptide derived from the group consisting of
bactericidal proteins, insecticidal proteins, growth hormones, and
antigens.
7. A delivery system for delivering antigens to a host animal
comprising an algal cell transformed by an expression vector, and
the expression vector comprising a nucleotide sequence coding for
an antigenic determinant.
8. The delivery system of claim 7, wherein the expression vector
further comprises a promoter operably linked to the nucleotide
sequence coding for the antigenic determinant.
9. The delivery system of claim 8, wherein the expression vector
further comprises a terminator for terminating transcription.
10. The delivery system of claim 9, wherein the algal cell
expresses the antigenic determinant in an area selected from the
group consisting of nucleus, chloroplast, mitochondria, periplasmic
space, cell membrane, or cell wall.
11. The delivery system of claim 7, wherein the algal cell is
selected from the group consisting of green algae, brown algae, or
diatoms.
12. The delivery system of claim 7 wherein the algal cell is
Chlamydomonas reinhardtii.
13. The delivery system of claim 7 wherein the antigenic
determinant is a holoprotein or protein fragment from a pathogenic
organism in the host animal.
14. The delivery system of claim 13 wherein the antigenic
determinant is part of a fusion protein.
15. The delivery system of claim 7 wherein the algal cell is
disabled.
16. The delivery system of claim 7 wherein the algal cell is
packaged as a food product.
17. The delivery system of claim 16 wherein the food product is a
capsule.
18. The delivery system of claim 7 wherein multiple algal cells are
incorporated into a pellet.
19. The delivery system of claim 18 wherein the algal cells are
selected from the group consisting of living and dead cells.
20. The delivery system of claim 7 wherein the algal cell is
suspended in water for immersing the host animal.
21. The delivery system of claim 20 wherein the algal cell is dried
and aimed into a powder prior to being suspended in water.
22. The delivery system of claim 7 wherein the algal cell is mixed
with a liquid and packaged as a drink.
23. The delivery system of claim 7 wherein the expression vector is
incorporated into genetic material selected from the group
consisting of nuclear, chloroplast, and mitochondrial.
24. A method for inducing an immune response in an animal,
comprising the steps of obtaining a transgenic alga expressing an
antigenic peptide, and administering the transgenic alga to the
animal.
25. The method of claim 24 wherein the transgenic alga is
administered by feeding.
26. The method of claim 25 wherein the animal is a fish, and the
immune response is detectable in a sample of serum from the
fish.
27. The method of claim 24 wherein the transgenic alga is
administered by immersing the animal in a suspension comprising the
alga.
28. The method of claim 27 wherein the animal is a fish, and the
immune response is detectable in a sample of mucus from the
fish.
29. A method for inducing enhanced growth in an animal, comprising
the steps of obtaining a transgenic alga expressing a peptide
derived from a growth hormone, and administering the transgenic
alga to the animal.
30. A method for controlling a pathogenic population in an animal,
comprising the steps of obtaining a transgenic alga expressing a
peptide derived from a bactericidal or insecticidal protein, and
administering the transgenic alga to the animal.
Description
FIELD OF THE INVENTION
[0001] This invention relates to a system for delivering antigens
to an animal.
BACKGROUND OF THE INVENTION
[0002] Proteins, dipeptide and polypeptide (hereinafter
collectively referred to as proteins) are responsible for most of
the activities of a cell, such as catalysis, communication,
defense, movement, and transport.
[0003] Proteins can be delivered to animals for the purpose of
activating or supplementing a biological activity. Examples include
antigens that activate an immune response and hormones that
regulate growth and development.
[0004] The bases of a protein's biological activity is its sequence
and/or conformation. Hence, the biologically active portion (such
as an epitome) should remain essentially intact until it reaches
its target destination. Factors that could limit the biological
activity of a protein include chemical and enzymatic denaturation,
as well as structural barriers that preclude entry into the animal
or access to the target destination.
[0005] The patent describes a method for producing, and then
delivering biologically active proteins to an animal using
transgenic algae. The delivery of an antigen to an animal and
activation of an immune response is offered as a specific
example.
Infectious Disease in Humans
[0006] Infectious disease is an age-old problem. Early in human
history, infectious diseases such as smallpox, bubonic plague,
influenza, measles and many others caused epidemics and countless
deaths. More recently, epidemics of Legionnaires' disease, human
immunodeficiency virus, Ebola virus, Lyme disease, and others have
been significant threats to human health.
Solutions to Infectious Disease
[0007] Early in human history, quarantine of infected individuals
and improved sanitation measures were used to decrease the spread
of infectious disease. Later, chemotherapeutic agents (drugs) were
invented and, early on, included chemicals like sulfur and mercury.
Modern chemotherapeutics include antibiotics, antiviral drugs, and
antiparasitic drugs. Although essential, there are properties of
such drugs that are not ideal. For example, drugs do not prevent
disease. Rather, drugs are administered after a disease is
diagnosed. Another problem is that infectious agents can develop
resistance to the drugs such that the drugs are no longer effective
against the infectious agents. Finally, drugs can cause serious
side affects in the individual to which they are administered.
[0008] An alternative to chemotherapeutic agents is administration
of immunogenic agents, wherein the immunogens that comprise a
composition originating from the infectious agent whose infection
one is trying to prevent. After administration, such immunogenic
compositions preferably stimulate the immune system such that
subsequent infection by the infectious agent is prevented, or
disease symptoms caused by the infectious agent are decreased. Such
immunogenic compositions are advantageous in that they are
administered before the individual contracts the infectious agent.
The stimulation of immunity in the individual caused by
administration of the immunogenic composition, therefore, is
designed to prevent infection and disease. Such immunogenic
compositions normally produce few side effects in the individual to
which the composition is administered. Finally, infectious agents
do not normally develop resistance to immunity that develops as a
result of administration of the antigen composition.
Infectious Disease in Non-Human Animals
[0009] Infectious diseases in non-human animals also cause
significant morbidity and mortality. Such disease is important, not
only because non-human animals can sometimes transmit the
infectious agents to humans, but also because non-human animals and
the products thereof are important human food sources and their
loss is economically burdensome.
Infectious Diseases in Aquaculture
[0010] An example of an area where infectious non-human animal
diseases continue to affect an important human food source is
aquaculture. Aquaculture is the fanning of aquatic organisms,
including fish and other seafood, for human consumption. Currently
in the U.S., the domestic fishing industry meets only a small part
of the total demand for fish. In 1997, for example, the federal
trade deficit for imported fish was nearly $9 billion, the third
largest component of the U.S. foreign trade deficit.
[0011] In an attempt to meet the demand for fish, the aquaculture
industry has responded and, in 1997, produced over $55 billion in
farmed fish (statistic from the Food and Agriculture Organization
of the United Nations). Furthermore, the aquaculture industry has
grown, historically between 10-20% per year for the last ten years.
Therefore, it is clear that aquaculture is a rapidly emerging
supplement and replacement for the traditional fishing industry and
has tremendous growth potential.
[0012] One of the major constraints for aquaculture, however, is
disease. Under the high density conditions under which fish and
other aquatic organisms are farmed, the incidence of infectious
disease can be high and, when disease does occur, it can spread
rapidly through entire populations with high mortality. On average,
10-30% of farmed fish production, and up to 80% of shrimp
production, is lost due to disease (Austin B., et al., 1987
Bacterial Fish Pathogens: Disease in Farmed and Wild Fish, 364 pp
Publishers: (Ellis Horwood Ltd., Chichester, UK)).
Solutions to Infectious Diseases in Aquaculture
[0013] Again using aquaculture as a specific example, fish diseases
with a bacterial etiology can be effectively treated with
chemotherapeutic agents from the class called antibiotics. However,
as much as 80% of the antibiotic may pass through the fish
(Pothuluri, et al., 1998, Res. Dev. Microbiol. 2:351-372), and
development of bacteria resistant to the antibiotic may also arise.
Such antibiotic-resistant bacterial pathogens can spread, creating
entire fish populations harboring pathogenic bacteria that are
resistant to the antibiotic. Clearly, it would be advantageous to
prevent infection of the fish by the bacteria altogether. Another
consideration is that viral and parasitic diseases cannot be
treated with antibiotics.
[0014] Another strategy for preventing infection and reducing fish
losses due to disease is prophylactic administration of an antigen
composition, wherein the antigens are derived from an infectious
agent, to stimulate the immune system of fish, other aquatic
organisms, or other organisms generally (Gudding, et al., 1999,
Vet. Immun. Immunopath. 72: 203-212).
Methods of Introducing Antigens into Animals
[0015] One problem with antigen compositions, especially in fish,
is that many methods for administering them may not be technically
or economically practical. For example, direct injection of the
antigen composition into fish is labor intensive and is often
expensive relative to the future market value of the fish.
Furthermore, injection needles can cross-infect fish with
contaminating infectious agents, and accidental injection of humans
can cause severe infections and anaphylactic reactions. In
addition, noninjurious injection of small fish may be
difficult.
[0016] An alternative route of administration is an oral method
wherein the antigen composition is incorporated into the fish food,
for example. Another improved method of administering antigens to
fish is immersion of the fish for a preset period of time in a
suspension of the antigen. However, it can be costly to produce,
purify, and package the antigens for such use. Prior art methods of
producing antigens have involved the difficulty of growing fish
viruses in culture systems to produce enough virus to obtain a
sufficient quantity of antigen. In addition, antigen compositions
to be administered orally are often encapsulated in expensive
polysaccharide-coated beads. Finally, oral administration of
antigen compositions have previously shown low and inconsistent
levels of stimulation of the fish immune system, thereby minimizing
protection against subsequent infection by the infectious
agent.
SUMMARY OF THE INVENTION
[0017] In accordance with the present invention, a delivery system
is provided for delivering peptides to a host animal. The peptides
may be growth hormones, antigens derived from a pathogen, other
antimicrobial peptides, etc. The delivery system is a transgenic
algae that comprises a transgene which comprises a) a
polynucleotide encoding at least one peptide, for example an
antigenic determinant for the pathogen, and b) a promoter for
driving expression of the polynucleotide in the algae. In a
preferred embodiment, the transgene further comprises c) a
terminator that terminates transcription, and d) all other genetic
elements required for transcription. In another preferred
embodiment, the transgenic algae further expresses the peptide. If
the peptide is an antigenic determinant it is preferably located on
the cell surface or within the cytoplasm or an organelle of the
transgenic algae. The transgenic algae of the present invention is
useful for inducing an immune response in the host animal to the
pathogen. The transgenic algae of the present invention is also for
treating, ameliorating, or preventing a disease caused by the
pathogen.
[0018] The present invention also provides methods for delivering
the peptide, for example, an antigenic determinant derived from a
pathogen, to a host animal. In one aspect, the method comprises
orally administering a transgenic algae which comprises (a) a
polynucleotide that encodes at least one antigenic determinant of a
pathogen for the host animal and (b) a promoter that drives
expression of the polynucleotide in the nucleus or an organelle of
the algae. Such method is especially useful for delivering the
antigenic determinant to a mammal or an aquatic animal. In another
aspect, the method comprises immersing the host animal into a
suspension comprising water and a transgenic algae which comprises
(a) a polynucleotide that encodes at least one antigenic
determinant of a pathogen for the host animal, and (b) a promoter
that drives expression of the polynucleotide in the nucleus or an
organelle of the algae. Such method is especially useful for
delivering the antigenic determinant to an aquatic animal.
[0019] Thus, in one aspect of the invention, a delivery system is
provided for delivering a biologically active protein to a host
animal comprising an algal cell transformed by an expression
vector, the expression vector comprising a nucleotide sequence
coding for the biologically active protein, operably linked to a
promoter.
[0020] In another aspect of the invention, a delivery system is
provided for delivering antigens to a host animal comprising an
algal cell transformed by an expression vector, the expression
vector comprising a nucleotide sequence coding for an antigenic
determinant.
[0021] In still another aspect of the invention, a method is
provided for inducing an immune response in an animal, comprising
the steps of obtaining a transgenic alga expressing an antigenic
peptide, administering the transgenic alga to the animal.
[0022] Additional features of the present invention will become
apparent to those skilled in the art upon consideration of the
following detailed description of preferred embodiments
exemplifying the best mode of carrying out the invention as
presently perceived.
BRIEF DESCRIPTION OF THE FIGURES
[0023] The present invention may be more readily understood by
reference to the following figures wherein:
[0024] FIG. 1 shows the pSSCR7 plasmid used for constructing
nuclear transfection vectors for use in the present invention;
[0025] FIG. 2 shows the pCPPTG plasmid used for constructing
chloroplast transfection vectors for use in the present
invention;
[0026] FIG. 3 is a diagram showing the expression between the 3'
end of a low CO.sub.2-induced plasma-membrane protein gene and a
P57 antigen, and showing that the P57 antigen is located on the
periplasm side of the cell membrane;
[0027] FIG. 4 is a western blot of trout sera probed against algal
cells used for oral immunization. Lane 1: E-22; Lane 2: CP57; Lane
3: CC-2137(WT); Lane 4: E-22; Lane 5: CP57; Lane 6: CC-2137(WT);
Lane 7: E-22; Lane 8: CP57; Lane 9: CC-2137(WT); Lane 10: E-22;
Lane 11: CP-57; Lane 12: CC-2137(WT); and
[0028] FIG. 5 is a western blot of Trout Mucus Probed Against Algal
Cells used for Immersion Immunization. Lane 1: E-22; Lane 2: CP57;
Lane 3: CC-2137(WT); Lane 4: E-22; Lane 5: CP57; Lane 6:
CC-2137(WT); Lane 7: E-22; Lane 8: CP57; Lane 9: CC-2137(WT); Lane
10: E-22; Lane 11: CP-57; Lane 12: CC-2137(WT);
DETAILED DESCRIPTION OF THE INVENTION
[0029] In one aspect of the present invention provides a delivery
system for introducing one or more peptides into a host animal. The
delivery system involves the use of is a transgenic algae
comprising a transgene which comprises a polynucleotide encoding
one or more peptides and a promoter which drives expression of the
peptide encoding sequence in the algae.
Antigenic Determinant
[0030] The term "antigenic determinant" as used herein refers to a
protein or polypeptide which is capable of eliciting an immune
response or defense response in the host animal. The antigenic
determinant is at least partially derived from a pathogenic
microorganism. Herein, the term "microorganism" means a bacterium,
virus, fungus, or parasite (i.e., protozoan or helminth, for
example). Preferably, the immune response or defense response
elicited by the antigenic determinant is protective in the host
animal in the sense that a subsequent infection of the host animal
by the pathogenic organism from which the antigenic determinant is
derived would be prevented, would not cause disease or, if disease
were caused, the disease or symptoms associated with the disease
would be ameliorated. Preferably, the antigenic determinant itself
does not cause disease or any other adverse symptoms in the host
animal.
[0031] The antigenic determinant is either a holoprotein or a
portion of a protein that stimulates the immune system of an animal
that is a host for the pathogenic organism. Typically, the
antigenic determinants are either secreted by the pathogen or is
found on the cell membrane or cell wall thereof, but could
potentially be any component of the pathogen. The antigenic
determinant may be part of fusion protein. For example, it may be
advantageous to fuse the antigenic determinant with a protein that
is expressed on the surface of the algal cell.
[0032] The transgenic algae of the present invention comprise at
least one antigenic determinant of a pathogenic microorganism. In
certain embodiments the present transgenic algae comprise a
plurality of antigenic determinants from a single microorganism. In
other embodiments, the present transgenic algae comprise one or
more antigenic determinants from a plurality of pathogenic
microorganisms. When expressed, the antigenic determinants may be
located in the cytoplasm, in an organelle, particularly the
mitochondria or chloroplast, on the cell surface, exported from the
cell or in a combination of locations in the algae.
Host Animals
[0033] As used herein the term "host animal" refers to all animals
capable of mounting an immune or defense response when infected
with a pathogenic microorganism. Accordingly, the term host animal,
as used herein, encompasses mammals, including humans, companion
animals such as cats and dogs, non-companion animals such as cattle
and sheep, birds, aquatic vertebrates, and aquatic
invertebrates.
[0034] Because algae are a food substance for numerous aquatic
animals, the transgenic algae of the present invention are
especially useful for delivering an antigenic determinant to
aquatic vertebrates and invertebrates. Such aquatic vertebrates
include, but are not limited to, all vertebrate fish, which may be
bony or cartilaginous fish. Such fin-fish include but are not
limited to salmonids, carp, catfish, yellowtail, seabream, and
seabass.
[0035] Immune systems in fish are essentially the same as the
immune systems of mammals. The immune system is organized into
discrete compartments to provide the milieu for the development and
maintenance of effective immunity. Those two overlapping
compartments: the lymphoid and reticuloendothelial systems (RES)
house the principal immunologic cells, the leukocytes. Leukocytes
derived from pluripotent stem cells in the bone marrow during
postnatal life include neutrophils, eosinophils, basophils,
monocytes and macrophages, natural killer (NK) cells, and T and B
lymphocytes. Hematopoietic and lymphoid precursor cells are derived
from pluripotent stem cells. Cells that are specifically committed
to each type of leukocyte (colony-forming units) are consequently
produced with the assistance of special stimulating factors (e.g.,
cytokines).
[0036] Leukocytes, the main cells in the immune system, provide
either innate or specific adaptive immunity. These cells are
derived from myeloid or lymphoid lineage. Myeloid cells include
highly phagocytic, motile neutrophils, monocytes, and macrophages
that provide a first line of defense against most pathogens. The
other myeloid cells, including eosinophils, basophils, and their
tissue counterparts, mast cells, are involved in defense against
parasites and in the genesis of allergic reactions. In contrast,
lymphocytes regulate the action of other leukocytes and generate
specific immune responses that prevent chronic or recurrent
infections.
[0037] Lymphoid Cells provide efficient, specific and long-lasting
immunity against microbes and are responsible for acquired
immunity. Lymphocytes differentiate into three separate lines:
thymic-dependent cells or T lymphocytes that operate in cellular
and humoral immunity, B lymphocytes that differentiate into plasma
cells to secrete antibodies, and natural killer (NK) cells. T and B
lymphocytes are the only lymphoid cells that produce and express
specific receptors for antigens. T Lymphocytes are involved in the
regulation of the immune response and in cell mediated immunity and
help B cells to produce antibody (humoral immunity). Mature T cells
express antigen-specific T cell receptors (TcR) that are clonally
segregated (i.e., one cell lineage-one receptor specificity). Every
mature T cell also expresses the CD3 molecule, which is associated
with the TcR. In addition mature T cells display one of two
accessory molecules, CD4 or CD8. The TcR/CD3 complex recognizes
antigens associated with the major histocompatibility complex (MHC)
molecules on target cells (e.g. virus-infected cell). The TcR is a
transmembrane heterodimer composed of two polypeptide chains
(usually, alpha and beta chains). Each chain consists of a constant
(C) and a variable (V) region, and is formed by a gene-sorting
mechanism similar to that found in antibody formation. The
repertoire is generated by combinatorial joining of variable (V),
joining (J), and diversity (D) genes, and by N region (nucleotides
inserted by the enzyme deoxynucleotidyl-transferase)
diversification. Unlike immunoglobulin genes, genes encoding TcR do
not undergo somatic mutation. Thus there is no change in the
affinity of the TcR during activation, differentiation, and
expansion.
[0038] The activation of B cells into antibody producing/secreting
cells (plasma cells) is antigen-dependent. Once specific antigen
binds to surface Ig molecule, the B cells differentiate into plasma
cells that produce and secrete antibodies of the same
antigen-binding specificity. If B cells also interact with Th
cells, they proliferate and switch the isotype (class) of
immunoglobulin that is produced, while retaining the same
antigen-binding specificity. This occurs as a result of
recombination of the same Ig VDJ genes (the variable region of the
Ig) with a different constant (C) region gene such as IgG. In the
case of protein antigens, Th2 cells are thought to be required for
switching from IgM to IgG, IgA, or IgE isotypes. IgM is therefore
the principal antibody produced during a primary immunization. This
primary antibody response is manifested by serum IgM antibodies as
early as 3-5 days after the first exposure to an immunogen
(immunizing antigen), peaks in 10 days, and persists for some
weeks. Secondary or anamnestic antibody responses following
repeated exposures to the same antigen appear more rapidly, are of
longer duration, have higher affinity, and principally are IgG
molecules.
[0039] When antibodies bind to antigens, they may 1) neutralize
pathogenic features of antigens such as their toxins, 2) facilitate
their ingestion by phagocytic cells (opsonization), 3) fix to and
activate complement molecules to produce opsonins and
chemoattractants (vide infra), or 4) participate in
antibody-dependent cellular cytotoxicity (ADCC). In addition to
antibody formation, B cells also process and present protein
antigens. After the antigen is internalized it is digested into
fragments, some of which are complexed with MHC class II molecules
and then presented on the cell surface to CD4+ T cells.
[0040] In the case of aquatic vertebrates, examples of pathogenic
microorganisms whose antigenic determinants may be expressed in the
transgenic algae include, but are not limited to Rennibacterium
salmoninarum (causative agent of bacterial kidney disease in
salmon, trout, char and whitefish; i.e., salmonids), Aeromonas
salmonicida, Aeromonas hydrophila, species of Vibrio (including V.
anguillarum and V. ordalii), species of Pasteurella (including P.
piscicida), species of Yersinia, species of Streptococcus,
Edwardsiella tarda and Edwardsiella ictaluria; the viruses causing
viral hemorrhagic septicemia, infectious pancreatic necrosis,
viremia of carp, infectious hematopoietic necrosis virus, channel
catfish virus, grass carp hemorrhagic virus, nodaviridae such as
nervous necrosis virus or striped jack nervous necrosis virus,
infectious salmon anaemia virus; and the parasites Ceratomyxa
shasta, Ichthyophthirius multifillius, Cryptobia salmositica,
Lepeophtheirus salmonis, Tetrahymena species, Trichodina species
and Epistylus species.
[0041] Examples of proteins for inducing an immune response in
certain aquatic vertebrates include but are not limited to p57
leukocyte agglutinizing protein from Rennibacterium salmoninarum
and the G-protein from infectious hematopoietic necrosis virus
(IHNV).
[0042] Aquatic invertebrates which are suitable host animals
include, but are not limited to, shrimp, crabs, oysters, and
clams.
[0043] Shellfish possess a defense system capable of defending
against pathogens. This system has many similarities to the
nonspecific defense system of vertebrates, such as the activation
of phagocytotic cells (hematocytes). However, there is no evidence
that shrimp or other invertebrates possess a specific defense
response similar to the immune system of vertebrates. Other defense
responses activated following infection reported for shrimp
include: increases in hematocyte production, production of active
oxygen species, activation of phenoloxidase and subsequent melanin
synthesis, the production of antimicrobial peptides, encapsulation
of the foreign body and coagulation of hematocytes (Rodriquez, et
al. 2000, Aquaculture 172:351-372). Unique to invertebrates are
specific proteins, such as a beta glucan-binding protein (BGBP) and
a lipopolysacchamide-binding agglutinin (LSBA), that recognize
cell-wall components of microorganisms and subsequently mobilize
hematocytes for phagocytosis (Bachere, E., 2000, Aquiculture 191:
3-11).
[0044] Invertebrates have many similarities to the defense response
in plants, such as the production of phenolic compounds and
reactive oxygen species and the mechanism in which the defense
system is activated. The plant-pathogen interaction is a
well-characterized signal transduction system composed of
nonspecific and specific pathogen elicitors--many the product of an
avirulence gene (avr)--and their cognate plant receptors. Following
receptor recognition of an elicitor, intracellular mediators
orchestrate a cascade response that activates several
well-characterized defense mechanisms and, is some cases,
short-term acquired immunity mediated by systemically transported
signaling molecules. BGBP and LSBA have an analogous role in
orchestrating a defense cascade in shrimp that also includes a
short-term acquired immunity.
[0045] Numerous signaling molecules can activate the defense system
of invertebrates, most of which are of pathogen origin. Treatment
with dead bacteria or cell wall components, such as B-glucans,
lippopolysaccarides, and peptoglycans, have been reported to
provide protection against shrimp pathogens when administered prior
to challenge. (Alabi, et al. 1999, Aquaculture 178:1-11) reported
that fresh or freeze dried Vibrio harveyi administered by
immersion, but not orally, reduced infection of P. indicus protozoa
by V. harveyi for 48 hours. More virulent strains increased the
level of protection suggesting that the defense response is
activated either by different defense eliciting molecules
(qualitative) or different numbers of the same defense eliciting
molecules (quantitative). Furthermore, tested strains provided
cross-protection suggesting that this is a non-specific response.
Others have reported that peptoglycan extracted from the cell wall
of the nonpathogen Bifidobacterium thermophilium, provided
protection against vibrosis and white spot syndrome baculovirus
when administered orally. These results further support that
invertebrates respond to pathogens through a general nonspecific
mechanism that can be activated by different elicitor molecules and
is effective against a broad range of pathogens. These
defense-activating signaling molecules (elicitors) do not result in
the production of antibodies. However, for purposes of convenience,
the term "antigenic determinant" as used herein also encompasses
the elicitors which prompt a defense response in aquatic
invertebrates.
[0046] Examples of microorganisms which are pathogenic for aquatic
invertebrates include, but are not limited to, white spot syndrome
virus (WSSV), tuarus virus, IHHNV and Vibrio harveyii.
[0047] Examples of proteins for inducing an immune response in
invertebrates include, but are not limited to, the VP28, VP26c and
VP24 proteins of WSSV shrimp virus. See van Hulten et al., Virology
266:227-236 (2000) and WO 0109340 for a discussion of WSSV and its
use in vaccines for crustaceans.
Algae
[0048] Algae are plant-like organisms without roots, stems or
leaves. Algae are distinct from plants in several ways, including
phylogenetically, biochemically, and morphologically. Algae contain
chlorophyll and vary in size from microscopic forms (phytoplankton)
to massive seaweeds. Their habitat is fresh or salt water, or moist
places. Most algae are eukaryotic (sub-kingdom=phyciobionta), but
several (e.g., cyanobacteria and prochlorophyta) are
prokaryotic.
[0049] The transgenic algae of the present invention encompass both
prokaryotic and eukaryotic algae, which preferably are unicellular.
Unicellular algae are also known as microalgae. Preferably, the
present transgenic of the present invention algae comprise walls
that either lack pores or gaps (referred to hereinafter as "walled"
algae) or that contain pores or gaps (referred to hereinafter as
"wall-less" algae). Optionally, the wall-less algae are coated with
a polysaccharide polymer as described in (Tsai, et al., 1994,
Progress. Fish-Culturist 56: 7-12)
[0050] The transgenic algae of the present invention comprise a
transgene comprising an exogenous polynucleotide which encodes the
antigenic determinant and is operably linked to a promoter which
drives expression of the exogenous polynucleotide in the algae, and
preferably comprises other genetic elements required for
expression. Preferably, the transgene comprises a terminator for
ending transcription. Also preferably, the transgene is stably
integrated into the genomic material found in the nucleus (known
hereinafter as a nuclear transformant), the chloroplast (known
herein after as a chloroplast transformant), or mitochondria (known
hereinafter as a mitochondrial transformant`) of the algae. In
nuclear transformants, the antigenic determinants preferably are
expressed on the cell membrane or cell wall of the transgenic algae
or in the cytoplasm thereof.
[0051] In certain preferred embodiments, the algae is a green algae
(Chlorophyta), a brown algae ((Phaeophyta), or diatoms
(Bacillariophyta).
[0052] Examples of green algae, which are especially well-suited
for use as the delivery system, include members of the
Chlamydomonas species, particularly Chlamydomonas reinhardtii; the
Chlorella species, the Volvox species, and some marine macrophytes.
Chlamydomonas reinhardtii, a unicellular eukaryotic green algae is
particularly advantageous for use in introducing antigens into
animals. C. reinhardtii grow vegetatively through mitotic division
of haploid cells. Haploid cells are of either the (-) or (+) mating
type. When grown in the absence of nitrogen, haploid cells of
opposite mating types associate, are held together through their
flagella, and eventually fuse to form a diploid zygospore. The
diploid zygote undergoes meiosis and releases four haploid cells
that resume the vegetative life cycle. One example of a walled
green algae is Chlamydomonas strain CC-744. One example of a
wall-less green algae is Chlamydomonas strain CC-425. Both of these
strains are available from Chlamydomonas Genetic Stock Center, Duke
University (Durham, N.C.).
[0053] Chlamydomonas reinhardtii is particularly preferred because
it grows rapidly and is easily and inexpensively grown in culture.
Exogenous DNA can easily be introduced into the nuclear,
chloroplast, and mitochondrial genome of this algae, and can be
expressed at high efficiency (.gtoreq.1% of total cellular
protein). Auxotrophic mutants (mutants that differ from the
wild-type in requiring one or more nutritional supplements for
growth) are readily available at the Chlamydomonas Genetic Stock
Center. Such mutants can be genetically complemented by transformed
DNA (i.e., exogenous DNA introduced into the cell), which
facilitates selection of algae containing a desired transgene. This
selection method is preferred, at it is free from use of
antibiotics.
[0054] In addition to the ease of growth and genetic manipulation,
as cited above, there are additional characteristics of C.
reinhardtii that make the organism useful for delivering antigens
to animals. C. reinhardtii is a potential food source for animals,
especially larval fish and marine invertebrates (C. reinhardtii is
nontoxic and nonpathogenic. Both freshwater C. reinhardtii and a
related marine species, C. pulsatilla, are available for
administering antigens to aquatic organisms in both
environments.
[0055] Optionally, the algae of the present invention are
genetically engineered such that they will not proliferate unless
they are in very specific controlled environments (i.e., such
strains will not grow or transfer their genes in the wild). Within
the context of this application, such algae are said to be
"disabled." Use of such disabled strains inhibits or limits spread
of the transgenic algae of the present invention into the
environment.
[0056] Such disabled strains of algae, particularly strains of C.
reinhardtii, are constructed by incorporating into the genomes of
such strains various genetic mutations that preclude growth and/or
mating outside of a specific environment. For example, the
transgenic algae may be engineered to contain mutations that
prevent photosynthesis. Strains containing such mutations are
unlikely to survive in the wild because they cannot produce the
energy or reduced carbon necessary to sustain life. Such
mutant-containing strains, however, can be grown in the laboratory
using acetate as a carbon source. One such type of mutation
preventing photosynthesis occurs in, but is not limited to, genes
comprising the psbD/psaC operon of C. reinhardtii, which is part of
the chloroplast genome of the organism. Such mutations in the
chloroplast genome are preferably in the chloroplast genome of
cells of the (+) mating type. C. reinhardtii of the (-) mating type
generally do not survive after a mating to produce a diploid cell
has occurred (see below).
[0057] Other mutations useful in constructing disabled algal
strains are mutations in genes resulting in strains that cannot
grow in the absence of specific metabolites (i.e., substances
produced by, or taking part in, metabolism). Such strains are said
to be "auxotrophic" for that particular metabolite. Strains
auxotrophic for various amino acids, vitamins, nucleotides, and so
forth are particularly useful. For example, some such useful
mutations require cells to be grown in the presence of arginine,
thiamine, or nicotinamide.
[0058] Other mutations that affect the ability of algae to grow
and/or transfer its genes, although such mutations are not
specifically stated herein, are also included within the scope of
this invention.
[0059] In one embodiment of this invention multiple mutations of
the type described above, for example, are combined into a single
strain of algae. Combinations of these mutations in a single strain
(also called "stacking" of mutations) result in disabled strains
that are particularly nonfunctional in growth and mating. Such
strains of algae are particularly unable to grow and transfer their
genes in the wild.
[0060] Another strategy useful in making disabled algal strains
embodied in this invention takes advantage of events that occur
naturally in a mating event. In C. reinhardtii, when haploid (-)
and (+) cells mate to form a diploid cell, only the chloroplast
genomes from the (+) mating type organism survive. The chloroplast
genomes of (-) mating type cells are degraded during mating.
Therefore, C. reinhardtii strains in which the transgenes encoding
the antigenic determinant are located in the chloroplast genome of
a (-) cell are advantageous when control of proliferation of
transgenic algae is desired.
[0061] Another type of disabled algal strain that is included in
this invention are algal strains that have mutations in the genes
encoding flagella. For example, in C. reinhardtii, flagella are
necessary to hold (-) and (+) cells together so that mating can
occur. Therefore, certain transgene-containing cells with mutations
in genes encoding flagella will be unable to transmit the transgene
through mating.
[0062] An additional disabling strategy that is part of the present
invention is use of the freshwater alga, C. reinhardtii, for use in
transferring antigens into saltwater aquatic organisms, as C.
reinhardtii is unable to survive in seawater for more than an hour.
C. reinhardti strains containing the P5CS gene for proline
synthesis can also be used similarly when survival of the algae for
longer times is important for a particular application. Strains
containing the P5CS gene can tolerate seawater for up to 10 hours
before 100% mortality occurs.
Preparation of the Transgenic Algae
[0063] In addition to an exogenous polynucleotide encoding an
antigenic determinant of a pathogenic microorganism, the transgene
which is incorporated into the transgenic algae comprises a
promoter which regulates transcription of the exogenous gene in the
nucleus, chloroplast, or mitochondria, of the algae, and preferably
other genetic elements required for expression. The transgene also
preferably includes a terminator for terminating transcription.
[0064] To prepare vectors for making the transgenic algae, the
exogenous polynucleotide encoding the antigenic determinant is
first cloned into an expression vector, a plasmid that can
integrate into the algal genome. In such an expression vector, the
DNA sequence which encodes the antigenic determinant or a fusion
protein comprising the antigenic determinant is operatively linked
to an expression control sequence, i.e., a promoter, which directs
mRNA synthesis. Preferably, the promoter is an endogenous promoter,
i.e., it directs transcription of genes that are normally present
in the algae. Examples of suitable promoters for Chlamydomonas
reinhardtii include, but are not limited to, the chloroplast gene
promoter psbA and the nuclear promoter region of the .beta..sub.2
tubulin gene. The expression vector, may also contains a ribosome
binding site for translation initiation and a transcription
terminator. Preferably, the recombinant expression vector also
includes an E. coli origin of replication and an E. coli selectable
marker to facilitate cloning of the vector in E. coli.
[0065] In one embodiment, the exogenous polynucleotide encoding the
antigenic determinant is fused to a polynucleotide which encodes a
membrane protein to express the antigen on the surface of the cell.
For example, the predicted folding topology of the CO.sub.2-induced
surface protein of Chlamydomonas reinhardtii indicates that both
the N-terminus and the C-terminus are located on the periplasmic
surface of the plasma membrane. Thus, this protein is especially
useful for expressing the antigenic determinant on the plasma
membrane of Chlamydomonas reinhardti.
[0066] Plasmids are introduced into the algae by standard
transformation methods known to those skilled in the art, such as
for example, electroporation, vortexing cells in the presence of
exogenous DNA, acid washed beads, polyethylene glycol, and
biolistics.
[0067] One particular advantage of the present invention is that
genes for multiple antigens from one infections agent, or multiple
antigens from different infectious agents, can be expressed
simultaneously in a single algal cell. Such multiple genes or
epitopes can be included in a single vector, for example a plasmid,
or in multiple plasmids, each of which must be transformed into the
algae. The advantage of such an algae that expresses multiple
antigens, is that all of the antigens are introduced into the
animal by administration of the particular algal strain to the
animal.
[0068] Transformation of the algae is determined by assaying for
the presence of the gene encoding the antigen by PCR, for example.
Procedures known to those of skill in the art, such as for example,
deflagellation, copper addition, and ammonium addition of the
algae, may be used to enhance expression of the antigenic
determinant in the transgenic algae. The choice of such procedure
depends upon the promoter used to prepare the construct. See, for
example, Davies et al., Nucleic Acids Research 20: 2959-2865
(1992); Dutcher, Current Opinions in Cell Biology 13:39-54 (2001);
Moseley et al., Photosynthesis: Mechanisms and Effects.
[0069] One type of plasmid vector integrates into the nucleus of
algal cells and expresses its proteins which are localized to the
cytoplasm of algal cells. One particular vector of this type is
pSSCR7, derived from a the plasmid described in Davies (Davies et
al. (1994) Plant Cell 6:53-63).
[0070] Another type of vector also integrates into the nucleus but
expresses proteins that are localized to the periplasm. One
particular vector of this type is a derivative of pSS CR7 which has
a 5' aryl sulfatase periplasmic targeting transit sequence (Davies
et al. (1994) Plant Cell 6:53-63).
[0071] A third type of vector integrates into the chloroplast
genome by homologous recombination and expresses proteins that are
localized to the chloroplasts (Hutchinson, et al., 1996, Chapter 9,
Chloroplast transformation. Pgs. 180-196; In: Molecular Genetics of
Photosynthesis, Frontiers in Molecular Biology. Anderson B., Salter
AH, and Barber J. eds.: Oxford University Press).
Administration of Transgenic Algae to Animals
[0072] Animals to which the transgenic algae are administered
include, but are not limited to, mammals, birds, and aquaculture
species. Aquaculture species include a diversity of species of
cultured fin-fish, shellfish, and other aquatic animals. Fin-fish
include all vertebrate fish, which may be bony or cartilaginous
fish. Such fin-fish include but are not limited to salmonids, carp,
catfish, yellowtail, seabream, and seabass. Salmonids are a family
of fin-fish which include trout (including rainbow trout), salmon,
and Arctic char. Examples of shellfish include, but are not limited
to, clams, lobster, shrimp, crab, and oysters. Other cultured
aquatic animals include, but are not limited to eels, squid, and
octopi.
[0073] One method of administering the present transgenic algae to
animals is oral delivery of the algae to the animal by feeding. The
transgenic algae may be delivered to the animal as a dried cell
powder or as a component of the normal diet. For example, in one
method of feeding the algae to fish, up to 5% freeze-dried
transgenic algae are added to an aqueous mixture containing 5% of a
casein-gelatin based protein source. The ingredients are
cold-pelleted, freeze-dried, crushed into 2 mm particles, and fed
to the fish. Live algae could be delivered in gelatin capsules.
[0074] Another method of administering algae to animals,
particularly aquatic animals, is immersion of the host animal in a
suspension of live algae. Good results have been obtained by
immersing trout in an aqueous suspension containing from between
10.sup.5-10.sup.7 algae per ml of water. Fish were immersed in the
suspension anywhere from between 20 seconds to 2 hours, and then
removed from the suspension. The immersion method is particularly
advantageous for introducing algae into smaller fish (less than
about 10 to 15 grams in weight). Such method can be used in
combination with oral delivery of algae though feeding, as
described above. Other methods of delivery are possible and are
within the scope of this invention.
[0075] The transgenic algae are introduced into the animal in a
regimen determined as appropriate by a person skilled in the art.
For example, the transgenic algae may be introduced into the animal
multiple times (e.g., two to five times) at an appropriate interval
(e.g., every two to three weeks) and dosage or dilution, by normal
feeding or by immersion.
EXAMPLES
[0076] The following examples are for purposes of illustration only
and are not intended to limit the scope of the invention as defined
in the claims which are appended hereto. The references cited in
this document are specifically incorporated herein by
reference.
Example 1
Transgenic Algae Expressing the P57 Immunogen from Rennibacterium
salmoninarum
[0077] Rennibacterium salmoninarum is the etiologic agent for
bacterial kidney disease, the most common disease of farmed
salmonoids. A transgenic algae expressing an antigenic determinant
of the fish pathogen. R. salmoninarum was prepared using a portion
of the P57 leucocyte agglutinizing protein (Genbank accession no.
AF123889) of Rennibacterium salmoninarum for surface display as an
antigen.
[0078] A highly antigenic determinant of the P57 protein encoding
the amino acids VYNKDGPAKELKV, (SEQ ID NO: 1) residues 112-124, was
identified using the program Sciprotein, Scivision (Burlington,
Mass.). The following is a synthetic oligonucleotide encoding this
peptide and using the codon bias preferred for expression of
nuclear genes in the alga Chlamydomonas reinhardtii:
TABLE-US-00001 (SEQ ID NO. 2)
5'-GATCTAGATTAACCTTCAGCTCCTTGGCGGGGCCGTCCTTGTTGT
ACACGCCCCCACCTTGGTGCGCCGTCAGAG-3'
The above synthetic oligonucleotide was used to generate a fusion
gene between the 3' end of a low CO.sub.2-induced plasma-membrane
protein gene (Genbank accession no. U31976) and the P57 antigen
encoding sequence creating by adding the above P57 fragment 3' of
nucleotide 677 of U31976, shown below:
TABLE-US-00002 (SEQ ID NO.: 3) 5'-ATGTCGGGCT TGAACAAGTT CATCTATGTG
GGCCTCGTTA TCTCGCAGCT GCTGACTCTG GCGGCCTACG TGGTCGTCAC GGCCGGCGCT
GCCCTTCTGC AGAAGAAGGC GAACACGCTC ACTCTGTTTG ACACCCAGGA GGGCATTGAC
AAGTACACTC CCGTTTACAA GGAGGTCTTC ACGGCGACCA CCTACATCAT CGCCTACCCC
CAGCAGCCCC AGTACCAGTT CCAGTACCAG TGGTGGATCA TCCAGTTCGA GCTGTTTGTG
TTCCTGCTGA CCGCCGCCTG CACCGTCTTC CCCTCCATCA TCAAGCGCAT GCGCCCCGTG
GCCCTGACCT TCATCGCCTC CGCCCTGGTG CTGGTCATGG ACAACATCAA CGCCATCTTC
TTCCTGCTCC GCAACGAGAC CGCCACCGCT GTGTTCGACG ACTACCGCAT CGCCACCGCT
CAGGCTGGCC TGATCATGGT TGGCGTGGCG AACGGCCTGA CCATCTTCTT CCTGGGCTCG
TACGACGCTG AGGAGTCGCA TGCGATGCCC AACGTGCACG TCACCTCTGA CGGCGCCACC
AAGGTGGGCG GCGTGTACAA CAAGGACGGC CCCGCCAAGG AGCTGAAGGT GTAA-3'
It was expected that the P57 epitope would be expressed on the
periplasm side of the cell membrane, as shown in FIG. 3. The gene
fusion then was cloned into the multi-cloning site of plasmid
pSSCR7 under control of the .beta..sub.2 tubulin promoter of
Chlamydomonas. pSSCR7 was constructed by cloning the HindIII/EcoRI
fragment (.about.2.7 Kbp) that carries the Chlamydomonas
.beta..sub.2-tubulin promoter and the 5' end of arysulfatase gene
(.about.1.0 Kbp) from pJD55 (Davies, 1992 Nucleic Acids Research
20: 2959-2965) into pUC18, and designated as p.beta..sub.2TU1. In
order to eliminate the 5' end of arysulfatase gene, the
.beta..sub.2-tubulin promoter was amplified by PCR. The PCR product
was cloned into the BamHI/EcoRI sites of pUC18 to make plasmid
p.beta..sub.2TU2. The TATA box was found by DNA sequence analysis
.about.100 bp away from BamHI site. In order to introduce a unique
NdeI site which contains an ATG codon, and a unique NarI site,
which was used to clone the 3' terminator, a NdeI site was removed
from pUC18 to make pUN and both sites were removed from pUC18 to
make pUNN. A XhoI/Nar fragment containing the 3'-terminator from
Chlamydomonas low CO.sub.2-induced membrane protein gene, as
follows:
TABLE-US-00003 (SEQ ID NO. 4) 5'-GGCGCCATCT AAGCAGAAGG CTGTGGGATG
TGTCACCGTT AAGCATCGGA GTTTGGGAAG TAGAGAATCT GGGGCTGCGG TTTTGTGGTT
TGCCGCTGCG GTCTGCACTT GGCAGGGTTG CCCCAGGTCT TGGGGTGACA GTTTAGTTGC
TAGGTTGGTA GCATGTCCTT CGTGACACCA GCGCATTGCA CCCGCTATGT ACATTCATCG
TTTTGGGTCT GGAGCGCTGC GCAGCACCTT TGGGTAGCGA ATACTTCGGG TGAGCTGCTT
ATCTGTATGG TACGGATGGG CACGGCTCCA AGCAGCAATA CACGGACGCA CATGCACCAA
ATTTTGGTTG TTTGAGTGGA CCGGCTTTAT CCAACGGTTC AGGTTTGGTT GCTCTCTCCA
TCGGAAGCAG AGCAGAAGCA CAACACACGT CGCAAACATG ATTGGAGCCA AGGAGCATGA
AATGCGAAAG AGCTGGACCA TGCACAGCGC ATGTAATAAG AGTACTGCAG A-3'
was combined with .beta..sub.2-tubulin promoter to form expression
vector pSSCR1. A KpnI/SstI fragment containing the multicloning
sites from pBluscript II KS was cloned into pSSCR5 to make the
final expression vector, pSSCR7. (FIG. 1.)
[0079] As seen in FIG. 1, the pSSCR7 has sixteen useful cloning
sites including NaeI, KpnI, ApaI, XhoI, SalI, ClaI, HindIII, EcoRV,
EcoRI, PstI, SmaI BamHI, SpeI, XbaI, NotI and NarI, that can be
used for introducing one or more coding sequences, as shown in FIG.
1. The fusion gene described above was cloned into the NdeI and
XbaI cites.
[0080] The resulting plasmid (pCREpitope) was co-transformed into
the nucleus by electroporation into Chlamydomonas reinhardtii
strain CC-425 using an equimolar amount of p389, a plasmid
containing the Arg-7 gene (see Debuchy et al., EMBO, 1989. Vol 8,
2803-2809). The Arg-7 gene compliments the arginine auxotrophic
strain of Chlamydomonas, CC-425 (Debuchy et al., EMBO, 1989. Vol 8,
2803-2809). Transformants were obtained after plating the cells on
TAP-agar containing 100 .mu.g arginine per ml of medium. The plates
were illuminated with fluorescent tubes at 10 mmol
photons/m.sup.2/sec at 22-27.degree. C. Transformants were found
after 9-10 days of incubation. The resulting transfected algae
expressing the fusion protein are known as E-22.
[0081] The main features of the new expression vector are (i) the
use of the .beta..sub.2-tubulin promoter, (ii) the construction of
sixteen unique cloning sites, (iii) the use of high copy number (in
E. coli), pUC18, as the original plasmid, and (iv) the small size
of new expression vector (4.4 Kpb).
[0082] Another plasmid was created by inserting the entire P57 gene
into pCPPTG, as shown in FIG. 2. pCPPTG is a plasmid constructed
for expression of foreign genes in chloroplasts. It based on a
modified E. coli vector, pUC18. As seen in FIG. 2, pCPPTG comprises
the psbA promoter, psbA terminator, aadA cassette, and a
multicloning site located between the psbA promoter and terminator.
The psbA promoter, psbA terminator, and aadA cassette are derived
from the pBA155dH3 plasmid, while the multicloning site is derived
from pBluescript IIKS (described in Hutchison et al, (1996) Chapter
9, and Ruffle et al, Chapter 16; In Molecular Genetics of
Photosynthesis, Frontiers in Molecular Biology. Oxford Univ.
Press). The entire P57 gene from R. salmoninarum was cloned into
the multicloning site, specifically the ApaI and PmeI sites, of
pCPPTG.
[0083] Co-transformants growing on medium lacking arginine and
containing the membrane protein-P57 fusion were identified by PCR
amplification of the membrane protein-P57 fusion gene using the
following oligonucleotide primers:
TABLE-US-00004 (SEQ ID NO. 5) Primer
C113-5'-AGCATATGGGGCCCATGTCGGGCTTGAACAAGTT CATCT (SEQ ID NO. 6)
EPITOPE-3'-GATCTAGATTAACCTTCAGCTCCTTGGCGGGGCCGTC
CTTGTTGTACACGCCCCCACCTTGGTGCGCCGTCAGAG
[0084] In order to perform PCR on the transformants, total genomic
DNA from C. reinhardtii was isolated. To do this, cell cultures (20
ml) were pelleted by centrifugation and resuspended in 0.35 ml TEN
buffer. The resuspended cells were incubated with 50 .mu.l of 2
mg/ml proteinase K and 25 .mu.l of 20% SDS for 2 hr at 55.degree.
C. Then, 50 .mu.l of 5M potassium acetate was added and the cells
were incubated on ice for 30 min. The lysate was extracted by
phenol:chloroform and DNA was precipitated by ethanol.
[0085] Those cells that were positive for the presence of the
membrane protein-P57 fusion product by PCR were then were screened
by western blot analysis using antibodies against the intact P57
protein. As demonstrated by western blot analysis (see FIG. 5),
antibodies generated against the intact P57 protein recognized the
57 kD P57 protein from solubilized whole cell extracts of
transgenic algae (CP57) expressing the P57 protein. No protein was
detected on the western blot for non-transformed cells.
Example 2
Immersion
[0086] Transgenic Chlamydomonas reinhardtii expressing the P57
protein from Rennibacterium salmoninarum as a fusion protein on the
plasma membrane (called E-22 algae) or in the chloroplast (called
CP57 algae) were constructed as described in Example 1. Control
algae (the CC-2137 strain of C. reinhardtii) were also used to test
administration by immersion.
[0087] The algae were grown in tris-acetate-phosphate (TAP) medium.
See Gorman DS and Levine RP (1965), Proc. Nat. Acad. Sci. 54:
1665-1669, to a density of 1.times.10.sup.6 cells/ml at
22-27.degree. C. with 10 .mu.mol photons/m.sup.2/sec illumination
from fluorescent tubes. The algal cells were harvested by
centrifugation and resuspended in water to a density of
approximately 1.times.10.sup.6 cells/ml.
[0088] Rainbow trout juveniles (average initial weight, 9.1.+-.0.5
g) were subjected to a bath treatment in water containing algae in
a 20 L barrel container (one barrel containing each of the E-22,
CP57 and CC-744 algae). Exposure of the trout to the various algae
was for 2 hours with intense aeration of the water. The
concentrations of the three types of algae were as follows: CP57,
7.97.times.10.sup.5 cells/ml; 2137, 2.71.times.10.sup.6 cells/ml;
and E-22, 2.97' 10.sup.6 cells/ml. A control treatment was also
performed where additional fish were handled identically, except
that they were not exposed to algae (sham immersion). After
immersion, both controls and those immersed in algae, were
distributed into 3 tanks per immersion treatment. All the fish
groups were fed with the same commercial diet at the rate of 2% of
fish weight for 3 weeks (Bioproducts, Inc. Oregon). After that
period, the fish were immersed again in a 2.sup.nd treatment
according to the same procedure as in the first treatment. The
concentrations of the three algae types for the 2.sup.nd treatment
were as follows: CP57, 1.46.times.10.sup.6 cells/ml; 2137,
6.57.times.10.sup.5 cells/ml; and E-22, 1.23.times.10.sup.6
cells/ml. The fish were fed with the commercial diet for 4 weeks
until the second sampling in the experiment (7 weeks) (a first
sampling was performed prior to any feeding). All fish were fasted
for 24 h prior to treatment.
[0089] The water temperature increased gradually from 12 to
17.degree. C. during the course experiment due to seasonal
environmental changes. Diurnal light:dark cycle was regulated at 12
h:12 h. Total fish weight in each tank was measured 3 weeks after
the first treatment, and then at 7 and 9 weeks after the first
immunization. The fish were kept for the last 2 weeks at the
feeding rate of 1.5% of fish weight.
[0090] Blood was taken before the initiation of the experiment and
at the time of weighing fish (3, 7, and 9 weeks) from caudal vein
with heparinized syringe for plasma, and with non-heparinized
syringe for serum. Six fish were randomly selected per tank for the
determinations of hematocrit, hemoglobin, liver and spleen weights.
Mucus from the fish was collected and frozen. Hematocrit was
determined by the microhematocrit method. Total hemoglobin was
determined with Sigma Diagnostic Kits (procedure No. 525) by using
human hemoglobin solution as standard. All procedures and handling
of animals were conducted in compliance with the guidelines of the
Institutional Laboratory Animal Care and Use Committee, The Ohio
State University.
TABLE-US-00005 TABLE 1 Weight, Spleen Relative Weight (SRW),
Hematocrit and Hemoglobin of Fish Treated by Immersion Final weight
SRW.sup.1 Hematocrit Hemoglobin Treatment (mean .+-. SD) (% body
weight) (%) (g/100 mlk) Control 22.0 .+-. 1.90 .sup. 0.080 .+-.
0.015 .sup.ab 37.8 .+-. 3.51 8.47 .+-. 1.09 E-22 22.4 .+-. 1.36
0.082 .+-. 0.012 .sup.a 36.2 .+-. 2.57 8.39 .+-. 0.85 CP57 21.5
.+-. 1.14 0.097 .+-. 0.004 .sup.a 36.5 .+-. 1.50 7.66 .+-. 0.31
2137 21.8 .+-. 1.34 0.082 .+-. 0.004 .sup.a 35.2 .+-. 2.25 7.84
.+-. 0.77 .sup.1Spleen relative weight (spleen wt. .times. 100/body
wt) was measured after 9 weeks. All other values were measured
after 7 weeks. .sup.2 Values (.+-.SD) having different superscripts
are significantly different (P < 0.05)
[0091] The fish growth and physiological parameter values in the
table above show that there were no significant differences in
growth rate (final weight), hematocrit, and hemoglobin among all
the treatment groups (P>0.05).
Example 3
Feed Pellet
[0092] Transgenic Chlamydomonas reinhardtii expressing the P57
protein from Rennibacterium salmoninarum as a fusion protein on the
plasma membrane (called E-22 algae) or in the chloroplast (called
CP57 algae) were prepared as described in Example 1.
[0093] The algae were grown in TAP medium as described above in
Example 2 to a density of 1.times.10.sup.6 cells/ml. The algal
cells were harvested by centrifugation, frozen in liquid nitrogen
and freeze-dried.
[0094] Three semi-purified diets formulated based on casein-gelatin
as a protein source were used for oral administration. The three
semi-purified diets were isonitrogenous and isocaloric to
incorporate 4% (on dry weight basis) of three different types of
algae. The three algae were E-22, CP57, and CC-2137. Five percent
of fish protein concentrate (CPSP 90, Sopropeche S. A.,
Boulogne-Sur-Mer, France) was supplemented into the diets to
enhance their palatability. The dietary ingredients were mixed with
distilled water and cold-pelleted into 2.0 mm diameter size, and
then freeze-dried to have less than 5% moisture. Diets were crushed
and sieved into a desirable particle size (0.8-2.0 mm), and stored
at -20.degree. C. until use.
[0095] Rainbow trout juveniles (average initial weight, 9.1.+-.0.5
g) were randomly distributed into 24 rectangular tanks (20 L
capacity) at a density of 22 fish per tank, 3 tanks per dietary
treatment. A control group was also used (each in triplicate tanks)
and were fed a commercial diet (Bioproducts, Inc. Oregon). The
control group was not exposed to any disturbances. Each
experimental diet was fed to a group (3 tanks) of fish at the
feeding rate of 2% of fish body weight for 3 consecutive days.
Accordingly, the results in an approximate intake of 25 mg of algae
protein/100 g fish body weight/day. After 3 days of feeding algae
diets twice a day, all the fish groups were fed with the same
commercial diet for 3 weeks (2.5% per day), twice per day, 7 days
per week. The 2.sup.nd oral treatment (boost) was conducted again
with the same algae diets and the commercial diet at the feeding
rate of 2% of fish body weight for 4 days. After the 4 days of the
2.sup.nd oral treatment, all the fish groups were fed the same
commercial diet for 4 weeks until the second sampling in this
experiment. The fish were kept for 2 additional weeks at the
feeding rate of 1.5% of fish weight and sampled again (third
sampling; 9 weeks).
TABLE-US-00006 TABLE 2 Weight, Spleen Relative Weight (SRW),
Hematocrit and Hemoglobin of Fish Treated Orally Final weight
SRW.sup.1 Hematocrit Hemoglobin Treatment (mean .+-. SD) (% body
weight) (%) (g/100 mlk) Control 19.9 .+-. 0.60 0.093 .+-. 0.004
.sup.a 38.3 .+-. 5.69 9.52 .+-. 0.96 E-22 21.5 .+-. 1.00 0.053 .+-.
0.001 .sup.c 38.5 .+-. 1.80 8.40 .+-. 0.83 CP57 22.0 .+-. 0.12
.sup. 0.056 .+-. 0.004 .sup.bc 39.5 .+-. 3.12 8.34 .+-. 0.62 2137
20.6 .+-. 0.66 0.052 .+-. 0.003 .sup.c 35.3 .+-. 0.58 7.61 .+-.
0.02 .sup.1Spleen relative weight (spleen wt. .times. 100/body wt)
was measured after 9 weeks. All other values were measured after 7
weeks. .sup.2 Values (.+-.SD) having different superscripts are
significantly different (P < 0.05)
[0096] The fish growth and physiological parameter values in the
able above show that there were no significant differences in
growth rate (final weight), hematocrit, and hemoglobin among all
the treatment groups (P>0.05). Spleen relative weight (SRW) was
significantly lower in orally treated fish groups than in a control
fish group and all the fish groups in immersion treatments
(P<0.05).
Example 4
Serum and Mucus Antibodies in Fish after Administration of
Algae
[0097] Serum and mucus obtained from the fish treated by the
immersion method (Example 2) as well as the oral feeding method
(Example 3) were examined for the presence of antibodies reactive
with the P57 immunogens expressed by the transgenic algae. This was
done by using the serum or the mucus from fish fed CP57, E-22,
CC-2137, or no algae to probe western blot membranes to which were
transferred proteins from SDS-PAGE gels of solubilized wild-type
Chlamydomonas cells or transgenic Chlamydomonas expressing the P57
protein in the chloroplast (CP57), or as a fusion protein between
the high CO.sub.2 induced protein and the P57 antigenic determinant
(E-22).
[0098] Wild-type, E-22 and CP57 algae were boiled in SDS-PAGE
loading buffer for 5 minutes. Samples were loaded at 15 .mu.g
chlorophyll per well (see Arnon D (1949), Plant Physiol. 24: 1-15,
for additional information on chlorophyll assays) on a 12.5%
acrylamide gel with a 6% acrylamide stacking gel. The samples were
electrophoresed at 15-18 mAmp constant current for 5-6 hr.
Following electrophoresis the proteins were transferred from the
gel to immobilon-P (PVDF=polyvinylidene fluoride) membrane using a
semi-dry system at 1.25 mA per square centimeter of membrane for
2-3 hr. After removing the membrane from semi-dry electroblotter,
the membrane was soaked in methanol for 15 second and dried at room
temperature for 30 minutes. The membrane was then washed twice with
PBST buffer (10 mM Sodium phosphate, 150 mM NaCl, 1% Tween-20, pH
7.4) for 5 minute each. (0.25 mL PBST per square centimeter of
membrane) and blocked with 3% casein (in PBST buffer) at 0.25 mL
per square centimeter for 1-2 hr. The membrane was then washed
twice with PBST buffer (10 mM Sodium phosphate, 150 mM NaCl, 1%
Tween-20, pH 7.4) for 5 minute each. (0.25 mL PBST per square
centimeter membrane).
[0099] All fish mucus and serum were treated with soluble protein
from CC-425 algal strain at 1:2 (vol/vol ratio) for 1 hr at room
temperature followed by centrifugation to remove non-specifically
bound proteins. Fish mucus or sera was used at a 1:150 dilution in
1% BSA in PBST and incubated at room temperature for 2 hr (used 0.1
mL of serum or mucus solution in buffer per square centimeter of
blotting membrane). The membrane was then washed twice with PBST
buffer (10 mM sodium phosphate, 150 mM NaCl, 1% Tween-20, pH 7.4)
for 5 minute each (0.25 mL PBST per square centimeter of membrane).
This was followed by incubation with mouse anti IgM Rainbow trout
serum (1:200 dilution in 1% bovine serum albumin (BSA) in PBST) at
room temperature for 2 hr (0.1 mL dilution buffer per square
centimeter of membrane). The membrane was then washed twice with
PBST buffer for 5 minute each (0.25 mL PBST per square centimeter
of membrane) followed by incubation with goat anti-mouse antisera
conjugated to horseradish peroxidase (BRP) at a 1:3,000 dilution in
1% BSA in PBST at room temperature for 1 hr (0.25 mL dilution
buffer per square centimeter of membrane). The membrane was then
washed twice with PBST buffer for 5 minute each. (0.25 mL PBST per
square centimeter of membrane). The HRP detection system was
Opti-4CN Substrate Kit from Bio-Rad. Opti-4CN is an improved and
more sensitive version of the colorimetric horseradish peroxidase
(BRP) substrate, 4-chloro-1-naphthol (4CN). Normally, this step
takes time about 20-30 minutes (0.25 mL substrate per square
centimeter of membrane).
[0100] The results of the studies are shown in FIG. 4 which shows
sera from fish that were fed algae in their diet, and in FIG. 5
which shows mucus from fish that were immersed in algae.
[0101] The first western blot (FIG. 4) shows that sera from fish
fed pellets containing either E-22 or CP57 algae recognized a 57 kD
protein present in algae (CP57) expressing the P57 protein in the
chloroplast (lanes 2 and 5). Significantly, no 57 kD band was
detected when using sera from fish fed either wild type or no algae
in the diet. In addition, two protein bands were detected at 22 and
27 kD in all serum treatments. These bands arise from non-specific
interactions. In contrast, no 57 kD proteins were detected in serum
from fish that were immersed in either E-22, CP57, wild-type or no
algae. These results indicate that fish fed food containing
transgenic algae expressing the P57 protein of Rennibacterium
salmoninarum generated specific antibodies against the P57 protein.
Unfortunately, due the cross-contaminating band at 22 kD it was not
possible to determine whether fish fed pellets containing E-22
algae generated antibodies against the 22 kD fusion protein.
However, the fact that the P57 protein present in CP57 algae was
detected using sera from E-22 fed fish suggests that the 22 kD
fusion protein was immunogenic against the P57 antigenic
determinant present in the fusion protein.
[0102] In addition, fish mucus was tested for the presence of
antibodies generated against the P57 protein. As shown in FIG. 5,
western blots probed with mucus from fish immersed in E-22 and CP57
algae was immunoreactive against the P57 protein present in CP57
algae (lanes 2 and 5). Again no immune reaction was observed using
mucus from fish immersed in wild-type or no algae. These results
demonstrate that P57-specific antibodies were expressed in mucus of
fish immersed in E-22 and/or CP57 algae. There also appears to be
an immune reaction specific for the 22 kD fusion protein when using
mucus from fish immersed in E-22 algae (lane 1). However, this
result is tentative since a non-specific interaction is observed at
the same molecular weight in lanes 5 and 6. Significantly,
immersion of fish with any algal strain failed to generate
P57-specific antibodies in sera. Overall, these results indicate
that immersion with algae expressing foreign and immunogenic
proteins (P57) is an effective means to generate the production of
protective antibodies in the mucus of fish.
Example 5
Algae Expressing WSSV Proteins and Administration to Shrimp
[0103] White Spot Syndrome Virus (WSSV) is a cause of disease of
shrimp. Shrimp production losses of 80% due to WSSV infection have
been reported and shrimp farms can be shut down for periods of up
to two years following a WSSV infestation.
[0104] VP28, VP26, VP24, and VP19 are known proteins from WSSV (PCT
Int. Appl. No. WO 0109340). Using gene specific primers, each of
the four known viral proteins is amplified using WSSV DNA as a
template (van Hulten, et al., 2001, PCT International Publication
WO 0109340). Each of these genes is cloned separately and together
into a Chlamydomonas expression vector similar to the methods
described in Example 1. For example the pSSCR7 plasmid which drives
high-level expression in the cytoplasm, and the pSSCR7 vector
having a 5' aryl sulfatase periplasmic targeting transit sequence
(Davies et al., 1994, Plant Cell 6: 53-63). The aforementioned
vectors randomly integrate into the Chlamydomonas nuclear genome.
In addition, a proprietary chloroplast transformation vector that
integrates into the chloroplast genome by homologous recombination
can be used (Hutchison, et al., 1996, Chapter 9, Chloroplast
transformation. Pgs. 180-196; In: Molecular Genetics of
Photosynthesis, Frontiers in Molecular Biology. Anderson B.,
Salter, A H, and Barber J. eds.; Oxford University Press). Each of
these vectors contains promoters that drive high levels of
expression in the cytoplasm or chloroplast. Viral protein
expression is quantified by western blot analysis normalized
against known loadings of WSSV (see objective 1A4 for
quantification of WSSV). For the western blot analysis polyclonal
antibodies are generated against WSSV proteins by injection of
purified and heat-denatured WSSV into rabbits.
[0105] The various expression systems are used to determine which
pattern of expression (periplasmic, cytoplasmic or chloroplast)
most effectively induces the shrimp "immune-response" (Bachere,
2000, Aquaculture 191: 3-11; Rombout et al., 1985, Cell Tissue Res.
239: 519-30). While periplasmic expressed viral proteins are
expected most effective, they are potentially most vulnerable to
digestion cytoplasmic and chloroplast expressed proteins would be
progressively less susceptible to digestion (D'Souza, et al., 1999,
Marine Biol. 133: 621-633).
[0106] PSF (pathogenic specific free) shrimp larvae are fed either
wild-type or VP-expressing microalgae 3-5 days prior to challenge
with known titers of WSSV. During the WSSV challenge, the shrimp
larvae are fed the appropriate algal strain either as live algae or
as dried algae in feed pellets (D'Souza, et al., 1999, Marine Biol.
133: 621-633). Various concentrations of algae feed are compared.
Relative percent survival will be calculated during the weeks
following WSSV exposure for all treatments. As described below,
molecular markers specific for shrimp disease inducible genes will
be used in quantitative real time-PCR experiments to evaluate the
"immune" response in shrimp prior to and after exposure to 1) WSSV
VP expressing algae, 2) wild type algae, 3) WSSV VP expressing
algae followed by WSSV exposure, 4) WSSV alone, and 4) no algae or
WSSV. Based on studies with injected WSSV proteins (van Hulten, et
al., 2001, PCT International Publication WO 0109340) it is expected
that shrimp fed microalgae expressing WSSV VP proteins will be
protected from WSSV infection.
Example 6
Rabbits
[0107] Transgenic algae expressing antigenic proteins (in the
chloroplast, cytoplasm, or on the cell surface as fusion proteins)
are delivered to rabbits as a component of the feed pellets,
essentially as described above for fish. Alternatively, the algae
are delivered as mixed with the drinking water. The transgenic
algae may, for example, express the CS6 and Vi antigens of
Salmonella typhi.
[0108] Although the invention has been described in detail with
reference to certain preferred embodiments, variations and
modifications exist within the scope and spirit of the invention as
described and defined in the following claims.
Sequence CWU 1
1
6113PRTRennibacterium salmoninarum 1Val Tyr Asn Lys Asp Gly Pro Ala
Lys Glu Leu Lys Val 1 5 10 275DNARennibacterium salmoninarum
2gatctagatt aaccttcagc tccttggcgg ggccgtcctt gttgtacacg cccccacctt
60ggtgcgccgt cagag 753624DNAChlamydomomas reinhardtii 3atgtcgggct
tgaacaagtt catctatgtg ggcctcgtta tctcgcagct gctgactctg 60gcggcctacg
tggtcgtcac ggccggcgct gcccttctgc agaagaaggc gaacacgctc
120actctgtttg acacccagga gggcattgac aagtacactc ccgtttacaa
ggaggtcttc 180acggcgacca cctacatcat cgcctacccc cagcagcccc
agtaccagtt ccagtaccag 240tggtggatca tccagttcga gctgtttgtg
ttcctgctga ccgccgcctg caccgtcttc 300ccctccatca tcaagcgcat
gcgccccgtg gccctgacct tcatcgcctc cgccctggtg 360ctggtcatgg
acaacatcaa cgccatcttc ttcctgctcc gcaacgagac cgccaaggct
420gtgttcgacg actaccgcat cgccaccgct caggctggcc tgatcatggt
tggcgtggcg 480aacggcctga ccatcttctt cctgggctcg tacgacgctg
aggagtcgca tgcgatgccc 540aacgtgcacg tcacctctga cggcgccacc
aaggtgggcg gcgtgtacaa caaggacggc 600cccgccaagg agctgaaggt gtaa
6244501DNAChlamydomomas reinhardtii 4ggcgccatct aagcagaagg
ctgtgggatg tgtcaccgtt aagcatcgga gtttgggaag 60tagagaatct ggggctgcgg
ttttgtggtt tgccgctgcg gtctgcactt ggcagggttg 120ccccaggtct
tggggtgaca gtttagttgc taggttggta gcatgtcctt cgtgacacca
180gcgcattgca cccgctatgt acattcatcg ttttgggtct ggagcgctgc
gcagcacctt 240tgggtagcga atacttcggg tgagctgctt atctgtatgg
tacggatggg cacggctcca 300agcagcaata cacggacgca catgcaccaa
attttggttg tttgagtgga ccggctttat 360ccaacggttc aggtttggtt
gctctctcca tcggaagcag agcagaagca caacacacgt 420cgcaaacatg
attggagcca aggagcatga aatgcgaaag agctggacca tgcacagcgc
480atgtaataag agtactgcag a 501539DNAArtificialsynthetic primer for
PCR 5agcatatggg gcccatgtcg ggcttgaaca agttcatct
39675DNAArtificialsynthetic primer for PCR 6gatctagatt aaccttcagc
tccttggcgg ggccgtcctt gttgtacacg cccccacctt 60ggtgcgccgt cagag
75
* * * * *