U.S. patent application number 13/948446 was filed with the patent office on 2014-01-02 for method for decreasing low density lipoprotein levels.
The applicant listed for this patent is Cynthia L. Bristow. Invention is credited to Cynthia L. Bristow.
Application Number | 20140005108 13/948446 |
Document ID | / |
Family ID | 44145911 |
Filed Date | 2014-01-02 |
United States Patent
Application |
20140005108 |
Kind Code |
A1 |
Bristow; Cynthia L. |
January 2, 2014 |
METHOD FOR DECREASING LOW DENSITY LIPOPROTEIN LEVELS
Abstract
The present invention features, in certain aspects, methods of
promoting endocytosis of LDL with .alpha.1PI or peptides derived
from .alpha.1PI. The present invention also provides methods for
decreasing LDL levels in response to .alpha..sub.1PI augmentation
therapy. In preferred embodiments, the methods are suitable for a
subject who is suffering from a disease or disorder selected from
heart disease, atherosclerosis, hypertension, HIV infection, viral
infection, bacterial infection, leukemia, a solid tumor, or
autoimmune disease.
Inventors: |
Bristow; Cynthia L.; (New
York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Bristow; Cynthia L. |
New York |
NY |
US |
|
|
Family ID: |
44145911 |
Appl. No.: |
13/948446 |
Filed: |
July 23, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13492294 |
Jun 8, 2012 |
|
|
|
13948446 |
|
|
|
|
PCT/US2010/059664 |
Sep 12, 2010 |
|
|
|
13492294 |
|
|
|
|
61267975 |
Dec 9, 2009 |
|
|
|
Current U.S.
Class: |
514/7.4 |
Current CPC
Class: |
C12N 15/1138 20130101;
A61K 45/06 20130101; A61K 38/17 20130101; C12N 2310/14 20130101;
A61K 38/57 20130101; A61P 3/06 20180101 |
Class at
Publication: |
514/7.4 |
International
Class: |
A61K 38/17 20060101
A61K038/17; A61K 45/06 20060101 A61K045/06 |
Claims
1. A method of decreasing low density lipoprotein (LDL) levels in a
subject comprising: identifying a subject in need of such
treatment, administering to the subject a therapeutically effective
amount of active alpha.1PI and monitoring the levels of LDL after
said administration; thereby decreasing the levels of LDL in the
subject.
2. A method of modulating the distribution of LDL levels, HDL
levels, cholesterol levels, triglyceride levels and other lipids
derived from LDL, HDL, cholesterol, and triglycerides in a subject
comprising the steps of: identifying a subject in need of such
treatment and administering to the subject a therapeutically
effective amount of active .alpha.1P 1PI; thereby modulating the
distribution of LDL levels, HDL levels, cholesterol levels,
triglyceride levels and other lipids derived from LDL, HDL,
cholesterol, and triglycerides in the subject.
3-6. (canceled)
7. The method of claim 1, wherein .alpha.1PI decreases LDL levels
by promoting LDL receptor mediated endocytosis.
8. The method of claim 1, wherein .alpha.1PI decreases LDL levels
by promoting LDL transport.
9. The method of claim 7, wherein the LDL receptor is very low
density LDL (VLDL) receptor.
10. The method of claim 1, wherein the subject is a human or a
non-human animal.
11. The method of claim 1, further comprising administering an LDL
inhibitor.
12. The method of claim 11, wherein the LDL inhibitor is a member
selected from the group consisting of a nucleic acid inhibitor, a
small molecule inhibitor, a peptide or a peptide mimetic.
13. The method of claim 12, wherein the nucleic acid inhibitor is a
siRNA.
14. The method of claim 12, wherein the peptide or peptide mimetic
comprises LDL Receptor Associated Protein.
15. A method of treating a subject with a disease associated with
an increase in the level of LDL, comprising: identifying a subject
in need of such treatment; administering to said subject a
therapeutically effective amount of active .alpha.1PI; and
determining the level of LDL in said subject after said
administration; wherein, following said administration, there is a
decrease in the level of LDL in said subject, thereby treating said
disease.
16-17. (canceled)
18. A method of treating a subject diagnosed with a disease
associated with an increase in the level of LDL comprising:
administering to a subject in need of such treatment a
therapeutically effective amount of active alpha 1PI; and
monitoring the level of LDL of said subject before and after
administration of said active alpha 1PI.
19-28. (canceled)
29. The method of claim 1, 15 or 18, wherein said therapeutically
effective amount is in the range of 5-100 ..mu.M.
30. The method of claim 29, wherein said therapeutically effective
amount of said .alpha.1PI is administered by a route selected from
the group consisting of topical application, intravenous drip or
injection, subcutaneous, intramuscular, intraperitoneal,
intracranial and spinal injection, ingestion via oral route,
inhalation, trans-epithelial diffusion or an implantable,
time-release drug delivery device.
31-36. (canceled)
37. The method of claim 2 wherein LDL levels are decreased.
38. The method of claim 37 wherein the levels of other lipids
related to LDL are decreased.
39. The method of claim 2 wherein the levels of HDL are
increased.
40. The method of claim 39 wherein the levels of other lipids
related to HDL are increased.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of International Patent
Application No. PCT/US2010/059664, filed on Dec. 9, 2010, which
claims the benefit of U.S. Provisional Application No. 61/267,975,
filed Dec. 9, 2009, the entire contents of which are incorporated
herein by reference.
RELATED APPLICATIONS/PATENTS & INCORPORATION BY REFERENCE
[0002] Each of the applications and patents cited in this text, as
well as each document or reference cited in each of the
applications and patents (including during the prosecution of each
issued patent; "application cited documents"), and each of the PCT
and foreign applications or patents corresponding to and/or
claiming priority from any of these applications and patents, and
each of the documents cited or referenced in each of the
application cited documents, are hereby expressly incorporated
herein by reference. More generally, documents or references are
cited in this text, either in a Reference List before the claims,
or in the text itself; and, each of these documents or references
("herein-cited references"), as well as each document or reference
cited in each of the herein-cited references (including any
manufacturer's specifications, instructions, etc.), is hereby
expressly incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] Full length active .alpha..sub.1proteinase inhibitor
(.alpha..sub.1PI, .alpha..sub.1antitrypsin) is composed of 394
amino acids (aa) having a mass of approximately 55 kDa when fully
glycosylated (Berninger, 1985). Hepatocytes are the primary source
of .alpha..sub.1PI, and in normal, healthy individuals, the range
of circulating .alpha..sub.1PI is 20-5311M between the 5.sup.th and
95.sup.th percentiles (Brantly et al., 1991; Bristow et al., 1998).
However, during the acute phase of the inflammatory response,
.alpha..sub.1PI may increase as much as 4-fold to 200 .mu.M
(Kushner, 1982). There are four common alleles of .alpha..sub.1PI,
and these are synthesized and secreted principally by hepatocytes
(OMIM, 2000). However, there are more than a hundred genetic
variants, some of which produce a molecule that prohibits
secretion, and affected individuals manifest with 10-15% of the
normal level of .alpha..sub.1PI in blood (Berninger, 1985).
Individuals with this inherited form of .alpha..sub.1PI deficiency,
especially males, are notably susceptible to respiratory infections
and emphysema, and 80% who survive to adulthood succumb to
respiratory failure between the fourth and sixth decades of life
(Berninger, 1985). Prevalence is 0.03%, and .alpha..sub.1PI
augmentation therapy in affected individuals is the only approved
therapeutic application of .alpha..sub.1PI (OMIM, 2000).
[0004] Stem cell migration from Drosophila to humans requires LDL
receptor-mediated Wnt-induced signaling (Cselenyi et al., 2008),
and in humans requires .alpha.1 proteinase inhibitor (.alpha.1PI,
.alpha.1antitrypsin, serpin A1) (Goselink et al., 1996), its
receptor cell surface human leukocyte elastase (HLE-CS) (Bristow et
al., 2003b; Lapidot and Petit, 2002), the chemokine CXCL12 (SDF-1),
and its receptor CXCR4 (Lapidot and Petit, 2002), the same
components involved in HIV-1 uptake (Bristow et al., 2003b). It has
long been known that coupling of active .alpha.1PI to soluble HLE
inactivates both proteins and exposes the C-terminal domain of
.alpha.1PI (C-36, VIRIP) which then binds to receptors for low
density lipoprotein (LDL) (Cao et al., 2006). Yet, it has not been
appreciated that HLE is also localized on the cell surface (Bristow
et al., 1995), and that when .alpha.1PI binds to HLE-CS at the
leading edge of a migrating cell, the complex induces receptor
polarization (Bristow et al., 2003b; Bristow et al., 2008e). Due to
forward movement of the cell, receptor complexes underneath the
cell reposition in "millipede-like locomotion" (Shulman et al.,
2009) to the trailing edge where .alpha.1PI binds to LDL receptors,
a condition that induces endocytosis of the complex and retraction
of the trailing edge, and recycling of receptors to the leading
edge of the migrating cell via endosomes in conveyor belt type
motion (Cao et al., 2006).
[0005] If one of the components involved in this conveyor belt
mechanism is missing or blocked, the cell halts migrating. For
example, bacteria, snake bites, blood clotting, and most other
non-normal situations produce non-normal proteases which cleave
sentinel proteinase inhibitors including .alpha.1PI which is the
most abundant proteinase inhibitor in serum. When .alpha.1PI is
inactivated, it can no longer bind its receptor HLE-CS. In the
absence of .alpha.1PI-HLE-CS complexes, the LDL receptors are not
triggered for endocytosis and this causes blood cells to stop
migrating.
[0006] Endocytosed LDL receptor-associated components are tagged
for degradation, used as nutrients, or recycled to the cell surface
from the trailing edge back to the leading edge via endosomes. In
addition to dietary lipids, many nutrients such as insulin and
growth factors are taken up by receptors that cluster with LDL
receptors during the migration of granulocytes, macrophages, and
lymphocytes which deliver and present endocytic cargo to the liver,
mucosa, and other tissues. RAP is a 39 kDa exocytic traffic
chaperone that binds LDL receptors thereby preventing their
association with lipoproteins and proteinase inhibitors during
synthesis. Endocytosed LDL Receptor-Associated Protein
(RAP)-coupled LDL receptors dissociate in late endosomes (Czekay et
al., 1997) where RAP is ubiquitinated and degraded, but LDL
receptors are recycled (Misra and Pizzo, 2001). By contrast, when
the LDL receptors are first bound to a proteinase inhibitor, it is
the LDL receptors that are ubiquitinated. Thus, whether endo some
components are tagged, degraded, recycled, or used as nutrients is
determined by the order and context of LDL receptor-associated
coupling during uptake and re-expression of selective cargo such as
Wnt (Cselenyi et al., 2008), neurotransmitters (Andrade et al.,
2007), antigenic material (Bristow and Flood, 1993; Robert et al.,
2008), rhinovirus (Marlovits et al., 1998), Hepatitis C (Bartosch
et al., 2003), and HIV-1 (Zhadina et al., 2007).
SUMMARY OF THE INVENTION
[0007] The present invention is directed to the use of
.alpha..sub.1PI and peptides derived from .alpha..sub.1PI to
promote endocytosis of LDL. The present invention also provides
methods for decreasing LDL levels in response to .alpha..sub.1PI
augmentation therapy. In preferred embodiments, the methods are
suitable for a subject who is suffering from a disease or disorder
selected from heart disease, atherosclerosis, hypertension, HIV
infection, viral infection, bacterial infection, leukemia, a solid
tumor, or autoimmune disease. Under physiologic conditions
proteinase inhibitors act as cogs in the LDL receptor-mediated cell
migration apparatus and under pathologic conditions, inactivation
by microbial proteinases or inflammation-induced cellular
proteinases halts migration of selective cells specifically at the
site of pathologic insult such as in atherosclerotic plaque,
Alzheimer's fibrosis, chronic obstructive pulmonary disease,
rheumatoid arthritis, multiple sclerosis, and tumor invasion.
[0008] In one aspect, the present invention provides a method of
decreasing low density lipoprotein (LDL) levels in a subject
comprising administering to the subject .alpha.1PI or at least one
peptide derived from .alpha.1PI, thereby decreasing the levels of
LDL in the subject.
[0009] In another aspect, the present invention features a method
of modulating the distribution of LDL levels, HDL levels,
cholesterol levels, triglyceride levels and other lipids derived
from LDL, HDL, cholesterol, and triglycerides in a subject
comprising administering to the subject .alpha.1PI or peptides
derived from .alpha.1PI, thereby modulating the distribution of LDL
levels, HDL levels, cholesterol levels, triglyceride levels and
other lipids derived from LDL, HDL, cholesterol, and triglycerides
in the subject.
[0010] In one embodiment, the .alpha.1PI peptides are produced by
peptide synthesis or by recombinant plasmid transfection.
[0011] In another embodiment, the .alpha.1PI peptides that are used
in the methods of the invention are derived from a wild-type amino
acid selected from the group consisting of residues 370-374 and
385. In another embodiment, at least one amino acid selected from
the group consisting of residues 370-374 and 385 is changed from
wild-type to glycine, threonine, or a hydrophobic amino acid. In
another embodiment, the hydrophobic amino acid is selected from the
group consisting of isoleucine, leucine, phenylalanine, tyrosine
and valine.
[0012] In certain embodiments, the .alpha.1PI peptides that are
used in the methods of the invention comprise a change in a
wild-type amino acid residues selected from the group consisting of
residues 370-374 and 385. In another embodiment, the residue change
is to glycine, threonine, or a hydrophobic amino acid. In another
embodiment, the hydrophobic amino acid is selected from the group
consisting of isoleucine, leucine, phenylalanine, tyrosine and
valine. In another embodiment, the human .alpha.1PI peptides
comprise at least two changes in wild-type amino acid residues
selected from the group consisting of residues 370-374 and 385. In
another embodiment, the methionine at position 385 is changed to a
non-methionine amino acid. In another embodiment, the
non-methionine amino acid is selected from the group consisting of
glycine, isoleucine, leucine, phenylalanine, threonine, and valine.
In another embodiment, the residue changes in the human .alpha.1PI
peptides comprise the following three amino acid substitutions:
Phe372Gly; Leu373Gly; and Met 385Val. In another embodiment, the
residue changes in the human .alpha.1PI peptides consist of the
following three amino acid substitutions: Phe372Gly; Leu373Gly; and
Met 385Val.
[0013] In one embodiment, the subject is suffering from a disease
or disorder selected from the group consisting of: heart disease,
atherosclerosis, hypertension, HIV infection, viral infection,
bacterial infection, leukemia, Alzheimer's Disease, a solid tumor,
or autoimmune disease.
[0014] In another embodiment, the subject is suffering from
HIV-1.
[0015] In a further embodiment, the number of CD4 T cells in the
subject is less than 500 CD4 cells/.mu.l.
[0016] In another embodiment, the subject is receiving proteinase
inhibitor therapy.
[0017] In still another embodiment, .alpha.1PI or peptides derived
from .alpha.1PI decrease LDL levels by promoting LDL
endocytosis.
[0018] In another further embodiment, .alpha.1PI or peptides
derived from .alpha.1PI decrease LDL levels by promoting LDL
transport.
[0019] In a further related embodiment, the LDL receptor is very
low density LDL (VLDL) receptor.
[0020] In another embodiment, the subject is a human or a non-human
animal.
[0021] In another embodiment of the above aspects, the method
further comprises administering a LDL inhibitor.
[0022] In another embodiment of the above aspects, the LDL
inhibitor is a nucleic acid inhibitor, a small molecule inhibitor,
a peptide or a peptide mimetic.
[0023] In a further embodiment, the nucleic acid inhibitor is a
siRNA.
[0024] In another embodiment, the peptide or peptide mimetic
comprises LDL Receptor Associated Protein.
[0025] The invention provides a method of treating a subject with a
disease associated with an increase in the level of LDL,
comprising: identifying a subject in need of treatment;
administering to the subject .alpha.1PI or at least one peptide
derived from .alpha.1PI; determining the level of LDL in the
subject; wherein, following the administration, there is a decrease
in the level of LDL in the subject, thereby treating the
disease.
[0026] The invention also provides a method of treating a subject
with a disease associated with an increase in the level of LDL,
comprising; administering to the subject .alpha.1PI or at least one
peptide derived from .alpha.1PI identified as capable of decreasing
the level of LDL in the subject; determining the level of LDL in
the subject; wherein following the administration, there is a
decrease in the level of LDL in the subject thereby treating the
disease.
[0027] The invention also provides a method of treating a subject
with a disease, comprising; administering to the subject .alpha.1PI
or at least one peptide derived from .alpha.1PI identified as
capable of decreasing the level of LDL in the subject wherein
following the administration, there is a decrease in the level of
LDL in the subject thereby treating the disease.
[0028] The invention also provides a method of monitoring the
treatment of a subject diagnosed with a disease associated with an
increase in the level of LDL levels comprising: administering to
the subject .alpha.1PI or at least one peptide derived from
.alpha.1PI; and
comparing the level of LDL of the subject before and after
administration of the .alpha.1PI or at least one peptide derived
from .alpha.1PI.
[0029] In one embodiment, following administration of the
.alpha.1PI or at least one peptide derived from .alpha.1PI there is
a decrease in the level of LDL in the subject thereby indicating
treatment.
[0030] The invention also provides a method of monitoring the
treatment of a subject diagnosed with a disease associated with an
increase in the level of LDL comprising: determining the level of
LDL in the subject; administering to the subject .alpha.1PI or at
least one peptide derived from .alpha.1PI; and comparing the level
of LDL of the subject with the level of LDL of a control subject
that is not diagnosed with the disease.
[0031] In one embodiment, following administration of .alpha.1PI or
at least one peptide derived from .alpha.1PI there is a decrease in
the level of LDL of the subject diagnosed with the disease as
compared to the control subject, thereby indicating treatment.
[0032] The invention also provides a method of treating a subject
with a disease associated with an increase in the level of LDL
comprising: administering to the subject .alpha.1PI or at least one
peptide derived from .alpha.1PI; and determining the level of LDL;
wherein following the administration there is a decrease in the
level of LDL thereby treating the disease.
[0033] The invention also provides a method of decreasing the level
of LDL in a subject comprising: contacting a cell with .alpha.1PI
or at least one peptide derived from .alpha.1PI; and determining
the level of LDL of the subject; wherein the level of LDL decreases
following the contact.
[0034] The invention also provides a method of designing a
treatment protocol for a subject diagnosed with a disease
associated with an increase in the level of LDL; comprising
determining the level of LDL in the subject diagnosed with the
disease; and comparing the level of LDL in the subject with the
level of LDL of a control subject that does not have the
disease;
wherein an increase in the level of LDL of the subject as compared
to the control indicates that .alpha.1PI or at least one peptide
derived from .alpha.1PI that is identified as capable of decreasing
the level of LDL of the subject should be administered to the
subject; and wherein no increase in the level of LDL in the subject
as compared to the control indicates that .alpha.1PI or at least
one peptide derived from .alpha.1PI that is identified as capable
of decreasing the level of LDL of the subject should not be
administered to the subject.
[0035] In one embodiment of any of the methods described herein,
.alpha.1PI or at least one peptide derived from .alpha.1PI is
administered in a therapeutically effective amount or a
pharmaceutically acceptable salt or prodrug thereof, or a
pharmaceutical composition comprising a therapeutically effective
amount or a pharmaceutically acceptable salt or prodrug thereof, to
the subject, thereby treating the disease.
[0036] In one embodiment, the methods of the invention further
comprise obtaining .alpha.1PI or at least one peptide derived from
.alpha.1PI or the pharmaceutically acceptable salt or prodrug
thereof.
[0037] In another embodiment, the subject is a mammal.
[0038] In another embodiment, the subject is a human.
[0039] In another embodiment, the therapeutically effective amount
is in the range of 5-100 .mu.M.
[0040] In another embodiment, the therapeutically effective amount
of the .alpha.1PI or at least one peptide derived from .alpha.1PI
is administered by topical application, intravenous drip or
injection, subcutaneous, intramuscular, intraperitoneal,
intracranial and spinal injection, ingestion via oral route,
inhalation, trans-epithelial diffusion or an implantable,
time-release drug delivery device.
[0041] In another embodiment, the results of the determining step
are reported to the subject and/or a health care professional.
[0042] The invention also provides for a packaged pharmaceutical
comprising .alpha.1PI or at least one peptide derived from
.alpha.1PI or a pharmaceutically acceptable salt or prodrug thereof
which, upon administration to a subject, decreases the level of LDL
of a subject.
[0043] The invention also provides for a packaged pharmaceutical
comprising
[0044] (a) .alpha.1PI or at least one peptide derived from
.alpha.1PI or a pharmaceutically acceptable salt or prodrug
thereof; and
[0045] (b) associated instructions for using the .alpha.1PI or at
least one peptide derived from .alpha.1P1 to treat a disease
associated with an increase in the level of LDL of a subject.
[0046] In one embodiment, the .alpha.1PI or at least one peptide
derived from .alpha.1PI is present as a pharmaceutical composition
comprising a therapeutically effective amount or a pharmaceutically
acceptable salt or prodrug thereof and a pharmaceutically
acceptable carrier.
[0047] In one embodiment, the packaged pharmaceutical further
comprises a step of identifying a subject in need of the
pharmaceutical.
[0048] The packaged pharmaceutical further comprises a step of
identifying the .alpha.1PI or at least one peptide derived from
.alpha.1PI as capable of decreasing the level of LDL in a
subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] The following Detailed Description, given by way of example,
but not intended to limit the invention to specific embodiments
described, may be understood in conjunction with the accompanying
drawings, incorporated herein by reference. Various preferred
features and embodiments of the present invention will now be
described by way of non-limiting example and with reference to the
accompanying drawings in which:
[0050] FIG. 1 is a graph that shows the influence of
.alpha..sub.1PI on serum lipid levels. (a) Lipid levels (mg/dL) are
depicted by squares (.box-solid.) if receiving HIV-1 protease
inhibitor therapy and by circles ( ) if not. In patients with
<500 CD4 cells/.mu.l, LDL was correlated with active
.alpha..sub.1PI (r.sup.2=0.44, p<0.001, n=24). (b) LDL exhibited
negative correlation in patients with <20 .mu.M inactive
.alpha..sub.1PI (r.sup.2=0.35, p<0.001, n=33) and positive
correlation in patients with >20 .mu.M inactive .alpha..sub.1PI
(r.sup.2=0.29, p<0.02, n=19).
[0051] FIG. 2 is a graph that shows the kinetic influence of
.alpha..sub.1PI on HIV binding. (a) As compared with buffer
(purple) or isotype control (pink), flow cytometric analysis
depicts SHIV or SIV (green) bound to U937 clone 10 cells that had
been preconditioned with .alpha..sub.1PI for 15 min (t.sub.15), but
not 60 min (t.sub.60). (b) Fluorescence microscopic examination of
clone 10 and human (c) immature and (d) mature MDC depicts virus
(green) and cells using nuclear staining DAPI (blue). (e) Clone 10
cells were preconditioned with active .alpha..sub.1PI for 0 min (),
15 min (.diamond.), or 60 min ( ) prior to addition of infectious
HIV-1 NL4-3. Negative control cells (.box-solid.) were incubated
with .alpha..sub.1PI for 15 min in the presence of the HIV-1 fusion
inhibitor T20. Cells were prepared 3 times, and representative data
are presented. Cells cultured in autologous sera with and without
exogenous .alpha..sub.1PI (f) during (t.sub.0) or (g) 60 min
(t.sub.60) prior to in vitro co-culture with a CCR5-using primary
isolate of HIV-1. Influence of .alpha..sub.1PI on HIV outcome is
represented as .DELTA.HIV 100*(HIV spiked with
.alpha..sub.1PI)/(HIV without spiking). HLE.sub.CS mean
fluorescence intensity (MFI) on monocytic cells (CD14.sup.+)
correlated with .DELTA.HIV at t.sub.0 (r.sup.2=0.87, n=6, p=0.006)
and t.sub.60 (r.sup.2=0.96, n=4, p=0.02). Active .alpha..sub.1PI
was correlated with .DELTA.HIV (r.sup.2=0.95, p=0.001, n=6) at
t.sub.60, but not t.sub.0. PBMC and sera from different volunteers
were examined at least 3 times, and representative data are
presented.
[0052] FIG. 3 is a graph that shows the influence of VLDLR on
receptor recycling and on HIV-1 uptake. (a) By flow cytometric
analysis, U937 clone 10 transfected with VLDLR siRNA (green)
expressed 57% less VLDLR, 44% more CD4, 100% more CXCR4, and 10%
less HLE.sub.CS than cells transfected with negative control siRNA
(red). (b) HIV-1 infectivity of cells from part (a) transfected
with VLDLR siRNA ( ) or with negative control siRNA
(.largecircle.). (c) By confocal microscopic analysis of day 0
cells from part (b), cells (depicted by differential interference
contrast) did not internalize HIV-1 (green) after transfection with
VLDLR siRNA. Bar represents 25 .mu.m. (d) HIV-1 infectivity of
clone 10 in the absence of RAP and .alpha..sub.1PI ( ), after
preconditioning for 15 min with .alpha..sub.1PI (.largecircle.),
and after preconditioning with RAP for 15 min followed by 15 min
with .alpha..sub.1PI (.tangle-solidup.). Cells were prepared at
least three times, and representative results are presented.
[0053] FIG. 4 demonstrates feedback regulation by LDL and
.alpha..sub.1PI. LDL levels decreased in two HIV-1 patients Alpha
(.alpha.) and Beta (b) placed on .alpha..sub.1PI augmentation
therapy (Zemaira.RTM., CSL Behring) (Table S2). In patient Alpha,
decreased LDL was correlated increased active .alpha..sub.1PI Alpha
(r.sup.2=0.61, n=9, p=) and decreased inactive .alpha..sub.1PI
(r.sup.2=0.61, n=9, p=). In patient Beta, decreased LDL was
correlated increased active .alpha..sub.1PI Alpha (r.sup.2=0.42,
n=6, p=) and with decreased inactive .alpha..sub.1PI (r.sup.2=0.90,
n=6, (c) DNA microarray analysis of adherent cells from a healthy
volunteer and HIV patients on HIV protease inhibitor therapy
(ritonavir). Gene expression ratio of patient to healthy cells was
calculated using data from 2 patients. All the genes known to have
lipoprotein and proteinase inhibitor function that changed more
than 10-fold are represented. Probe sets ending with x_at and s_at,
were deleted.
[0054] FIG. 5 demonstrates the expression of VLDLR but not LRP on
U937 clone 10 cells. By flow cytometric analysis, as compared to
isotype control (.box-solid.), CD91 (.box-solid.) was not detected
on (a) U937 clone 10 cells, but was detected on (b) primary
monocytic cells. (c) As compared to 10 .mu.M nonspecific siRNA,
there was dose-dependent loss of VLDLR expression 48 hrs after
transfection of cells with (.box-solid.) 0.05 .mu.M (.box-solid.)
0.1 .mu.M (.box-solid.), 1 .mu.M (.box-solid.), and 10 .mu.M
(.box-solid.) VLDLR siRNA. The ratio VLDLR siRNA/nonspecific siRNA
yielded VLDLR expression of 100%, 76%, 52%, 43%, and 31% for
respective doses of VLDLR siRNA.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0055] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by a person
skilled in the art to which this invention belongs. The following
references provide one of skill with a general definition of many
of the terms used in this invention: Singleton et al., Dictionary
of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge
Dictionary of Science and Technology (Walker ed., 1988); The
Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer
Verlag (1991); and Hale & Marham, The Harper Collins Dictionary
of Biology (1991). As used herein, the following terms have the
meanings ascribed to them unless specified otherwise.
[0056] As used in the specification and claims, the singular form
"a", "an" and "the" include plural references unless the context
clearly dictates otherwise.
[0057] Ranges provided herein are understood to be shorthand for
all of the values within the range. For example, a range of 1 to 50
is understood to include any number, combination of numbers, or
sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, and 50.
[0058] Unless specifically stated or obvious from context, as used
herein, the term "or" is understood to be inclusive.
[0059] The recitation of a listing of chemical groups in any
definition of a variable herein includes definitions of that
variable as any single group or combination of listed groups. The
recitation of an embodiment for a variable or aspect herein
includes that embodiment as any single embodiment or in combination
with any other embodiments or portions thereof.
Any compositions or methods provided herein can be combined with
one or more of any of the other compositions and methods provided
herein.
[0060] In this disclosure, "comprises," "comprising," "containing"
and "having" and the like can have the meaning ascribed to them in
U.S. patent law and can mean "includes," "including," and the like;
"consisting essentially of" or "consists essentially" likewise has
the meaning ascribed in U.S. patent law and the term is open-ended,
allowing for the presence of more than that which is recited so
long as basic or novel characteristics of that which is recited is
not changed by the presence of more than that which is recited, but
excludes prior art embodiments.
[0061] The terms "administration" or "administering" are defined to
include an act of providing a compound or pharmaceutical
composition of the invention to a subject in need of treatment. In
the instant invention, preferred routes of administration include
parenteral administration, preferably, for example by injection,
for example by intravenous injection.
[0062] As used herein, the term "control" is meant a standard or
reference condition.
[0063] The term "active .alpha.1PI" as used herein is meant to
refer to the fraction of .alpha.1PI in plasma or other fluids that
has the capacity to inhibit elastase activity.
[0064] The term "inactive .alpha.1PI" as used herein is meant to
refer to the fraction of .alpha.1PI in plasma or other fluids that
does not have the capacity to inhibit elastase activity. Active
.alpha.1PI may be inactivated by proteolytic cleavage, proteinase
complexing, antibody complexing, or oxidation.
[0065] The term "human immunodeficiency virus" or HIV is meant to
refer to a virus that consists of either an HIV-1 or an HIV-2
virus, and more particularly any virus strain or isolate of an
HIV-1 or an HIV-2 virus.
[0066] As used herein, the term "alph.alpha.1-Proteinase Inhibitor"
(.alpha.1PI) is meant to refer to a glycoprotein produced by the
liver and secreted into the circulatory system. .alpha.1PI belongs
to the Serine Proteinase Inhibitor (Serpin) family of proteolytic
inhibitors. This glycoprotein of MW of 50,600 Da consists of a
single polypeptide chain containing one cysteine residue and 12-13%
carbohydrates of the total molecular weight. .alpha.1PI has three
N-glycosylation sites at asparagine residues 46, 83 and 247, which
are occupied by mixtures of complex bi- and triantennary glycans.
This gives rise to multiple .alpha.1PI isoforms, having isoelectric
point in the range of 4.0 to 5.0. The glycan monosaccharides
include N-acetylglucosamine, mannose, galactose, fucose and sialic
acid. .alpha.1PI serves as a pseudo-substrate for elastase;
elastase attacks the reactive center loop of the .alpha.1PI
molecule by cleaving the bond between methionine-358-serine-359
residues to form an .alpha.1PI-elastase complex. This complex is
rapidly removed from the blood circulation. .alpha.1PI is also
referred to as "alpha-1 antitrypsin" (AAT). In certain embodiments,
.alpha.1PI is human .alpha.1PI and is encoded by the amino acid
sequence set forth by NCBI Accession No. KO1396.
[0067] As used herein, the term "subject" is intended to include
vertebrates, preferably a mammal. Mammals include, but are not
limited to, humans.
[0068] As used herein, the term "peptide" means a polymer of amino
acids linked via peptide bonds. A peptide according to the
invention can be two or more amino acids, for example, 2, 3, 4, 5,
6, 7, 8, 9, 10, 15, 20 or more.
[0069] As used herein the term "at least one peptide" means one or
more (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more)
peptides derived from .alpha.1PI.
[0070] "Treatment", or "treating" as used herein, is defined as the
application or administration of .alpha.1PI or at least one peptide
derived therefrom to a subject or patient, or application or
administration of .alpha.1PI or at least one peptide derived
therefrom to an isolated tissue or cell line from a subject or
patient, who has a disease or disorder that is associated with an
increased level of LDL, with the purpose to cure, heal, alleviate,
relieve, alter, remedy, ameliorate, improve or affect the disease
or disorder, or symptoms of the disease or disorder. The term
"treatment" or "treating" is also used herein in the context of
administering agents prophylactically. The term "effective dose" or
"effective amount" or "effective dosage" or "therapeutic dosage" is
defined as an amount sufficient to achieve or at least partially
achieve the desired effect. The terms "therapeutically effective
dose" and "therapeutically effective amount" are defined as an
amount sufficient to cure or at least partially arrest the disease
and its complications in a patient already suffering from the
disease.
[0071] As used herein, "patient" or "subject" refers to a mammal
that is diagnosed with a disease associated with an increase in the
level of LDL.
[0072] The term "patient" or "subject" includes human and other
mammalian subjects that receive either prophylactic or therapeutic
treatment.
[0073] As used herein, "mammal" refers to any mammal including but
not limited to human, mouse, rat, sheep, monkey, goat, rabbit,
hamster, horse, cow or pig.
[0074] A "non-human mammal", as used herein, refers to any mammal
that is not a human.
[0075] As used herein, "treating" a disease refers to preventing
the onset of disease and/or reducing, delaying, or eliminating
disease symptoms, such as an increase in the level of LDL. By
"treating" is meant restoring the patient or subject to the basal
state as defined herein, and/or to prevent a disease in a subject
at risk thereof. Alternatively, "treating" means arresting or
otherwise ameliorating symptoms of a disease.
[0076] As used herein, "basal state" refers to the level of LDL of
an individual who is not susceptible to a disease and who has no
symptoms of a disease and/or an individual who has not been
diagnosed with the disease.
[0077] In one embodiment, a disease according to the invention is
associated with an increase in the level of LDL in a subject.
[0078] As used herein, "diagnosing" or "identifying a patient or
subject having" refers to a process of determining if an individual
is afflicted with a disease or ailment, for example a disease
associated with an increase in the level of LDL. To diagnose a
disease associated with an increase in the level of LDL the level
of LDL is measured by methods known in the art including but not
limited to methods described hereinbelow.
[0079] As used herein, "modulate" or "modulation" refers to
increase or decrease, or an increase or a decrease, for example an
increase or decrease in the level of LDL.
[0080] As used herein, "decrease" means that the level of LDL is 1,
2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 500, 1000 or
10,000-fold less after administration of .alpha.1PI or at least one
peptide derived therefrom as compared to before administration of
.alpha.1PI or at least one peptide derived therefrom of the
invention.
[0081] As used herein, "decrease" also means that the level of LDL
is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 99 or 100% less after administration of .alpha.1PI
or at least one peptide derived therefrom of the invention as
compared to before administration of .alpha.1PI or at least one
peptide derived therefrom of the invention.
[0082] As used herein "increased" as it refers to level of LDL,
means that the level of LDL is 1, 2, 3, 4, 5, 10, 15, 20, 25, 30,
35, 40, 45, 50, 100, 500, 1000 or 10.000-fold or more greater in a
patient diagnosed with a disease associated with an increase in the
level of LDL as compared to a control subject that is not diagnosed
with the disease.
[0083] As used herein "increased" as it refers to the level of LDL,
means that the level of LDL is 1, 5, 10, 15, 20, 25, 30, 35, 40,
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99 or 100% greater in a
patient diagnosed with a disease associated with an increase in the
level of LDL as compared to a control subject that is not diagnosed
with the disease.
[0084] As used herein, "increase" means that the level of LDL is 1,
2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 500, 1000 or
10,000-fold more after administration of .alpha.1PI or at least one
peptide derived therefrom of the invention as compared to before
.alpha.1PI or at least one peptide derived therefrom of the
invention.
[0085] As used herein, "increase" also means that the level of LDL
is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 99 or 100% more after administration of .alpha.1PI
or at least one peptide derived therefrom of the invention as
compared to before administration of .alpha.1PI or at least one
peptide derived therefrom of the invention
[0086] A method of "administration" useful according to the
invention includes but is not limited to subcutaneous,
intramuscular, intraperitoneal, intracranial and spinal injection,
ingestion via the oral route, inhalation, trans-epithelial
diffusion (such as via a drug-impregnated, adhesive patch), by the
use of an implantable, time-release drug delivery device, which may
comprise a reservoir of exogenously-produced agent or may, instead,
comprise cells that produce and secrete the therapeutic agent or
topical application or administration directly to a blood vessel,
including artery, vein or capillary, intravenous drip or injection.
Additional methods of administration are
[0087] A "therapeutically effective amount" of .alpha.1PI or at
least one peptide derived therefrom of the invention according to
the invention is in the range of 5-100 .mu.M subject. In another
embodiment, a "therapeutically effective amount" of .alpha.1PI or
at least one peptide derived therefrom is in the range of 10-75
.mu.M per subject. In another embodiment, a "therapeutically
effective amount" of .alpha.1PI or at least one peptide derived
therefrom is in the range of 20-50 .mu.M per subject. In another
embodiment, a "therapeutically effective amount" of .alpha.1PI or
at least one peptide derived therefrom is in the range of 18-48
.mu.M per subject. In another embodiment, a "therapeutically
effective amount" of .alpha.1PI or at least one peptide derived
therefrom is in the range of 5-25 .mu.M per subject. In another
embodiment, a "therapeutically effective amount" of .alpha.1PI or
at least one peptide derived therefrom is in the range of 5-20
.mu.M per subject. In another embodiment, a "therapeutically
effective amount" of .alpha.1PI or at least one peptide derived
therefrom is in the range of 5-10 .mu.M per subject.
[0088] As used herein "monitoring the treatment" means determining
whether, following treatment of a subject, for example, a subject
diagnosed with a disease associated with an increase in the level
of LDL, the subject has been treated such that the symptoms of the
disease are arrested or otherwise ameliorated and/or the disease
and/or its attendant symptoms are alleviated or abated.
[0089] As used herein, "control subject" means a subject that has
not been diagnosed with a disease and/or does not exhibit any
detectable symptoms associated with the disease, for example a
disease associated with an increase in the level of LDL.
[0090] As used herein, the term "pharmaceutically acceptable salt"
refers to those salts of the compounds formed by the process of the
present invention which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of humans
and lower animals without undue toxicity, irritation, allergic
response and the like, and are commensurate with a reasonable
benefit/risk ratio. Pharmaceutically acceptable salts are well
known in the art. For example, S. M. Berge, et al. describes
pharmaceutically acceptable salts in detail in J. Pharmaceutical
Sciences, 66: 1-19 (1977). The salts can be prepared in situ during
the final isolation and purification of the compounds of the
invention, or separately by reacting the free base function with a
suitable organic acid. Examples of pharmaceutically acceptable
include, but are not limited to, nontoxic acid addition salts are
salts of an amino group formed with inorganic acids such as
hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid
and perchloric acid or with organic acids such as acetic acid,
maleic acid, tartaric acid, citric acid, succinic acid or malonic
acid or by using other methods used in the art such as ion
exchange. Other pharmaceutically acceptable salts include, but are
not limited to, adipate, alginate, ascorbate, aspartate,
benzenesulfonate, benzoate, bisulfate, borate, butyrate,
camphorate, camphorsulfonate, citrate, cyclopentanepropionate,
digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate,
glucoheptonate, glycerophosphate, gluconate, hemisulfate,
heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate,
lactobionate, lactate, laurate, lauryl sulfate, malate, maleate,
malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate,
nitrate, oleate, oxalate, palmitate, pamoate, pectinate,
persulfate, 3-phenylpropionate, phosphate, picrate, pivalate,
propionate, stearate, succinate, sulfate, tartrate, thiocyanate,
p-toluenesulfonate, undecanoate, valerate salts, and the like.
Representative alkali or alkaline earth metal salts include sodium,
lithium, potassium, calcium, magnesium, and the like. Further
pharmaceutically acceptable salts include, when appropriate,
nontoxic ammonium, quaternary ammonium, and amine cations formed
using counterions such as halide, hydroxide, carboxylate, sulfate,
phosphate, nitrate, alkyl having from 1 to 6 carbon atoms,
sulfonate and aryl sulfonate.
[0091] "Prodrug", as used herein means a compound which is
convertible in vivo by metabolic means (e.g. by hydrolysis) to
afford any compound delineated by the formulae of the instant
invention. Various forms of prodrugs are known in the art, for
example, as discussed in Bundgaard, (ed.), Design of Prodrugs,
Elsevier (1985); Widder, et al. (ed.), Methods in Enzymology, vol.
4, Academic Press (1985); Krogsgaard-Larsen, et al., (ed). "Design
and Application of Prodrugs, Textbook of Drug Design and
Development, Chapter 5, 113-191 (1991); Bundgaard, et al., Journal
of Drug Deliver Reviews, 8:1-38 (1992); Bundgaard, J. of
Pharmaceutical Sciences, 77:285 et seq. (1988); Higuchi and Stella
(eds.) Prodrugs as Novel Drug Delivery Systems, American Chemical
Society (1975); and Bernard Testa & Joachim Mayer, "Hydrolysis
In Drug And Prodrug Metabolism: Chemistry, Biochemistry And
Enzymology," John Wiley and Sons, Ltd. (2002).
[0092] Other definitions appear in context throughout the
disclosure.
[0093] Treatment Population:
[0094] Active .alpha..sub.1PI promotes migration of lymphocytes and
monocytic cells expressing HLE.sub.CS (Bristow et al., 2003a;
Bristow et al., 2008d). Inactive .alpha..sub.1PI promotes migration
of neutrophils and cells expressing the LDL receptors including
LDL-receptor related protein, LRP, LDL receptor, and VLDL receptor
(Kounnas et al., 1996; Weaver et al., 1997). Treatment with human
.alpha..sub.1PI is indicated in individuals manifesting abnormal
distribution of LDL levels, HDL levels, cholesterol levels,
triglyceride levels and other lipids derived from LDL, HDL,
cholesterol, and triglycerides manifested in a disease, disorder or
condition selected from the group consisting of heart disease,
atherosclerosis, hypertension, HIV infection, viral infection,
bacterial infection, leukemia, a solid tumor, and autoimmune
disease. Treatment outcome is determined as described below in
Section 7 of the Detailed Description.
Treatment Regimen:
[0095] The dosage of an .alpha..sub.1PI peptide is determined by
its capacity to promote endocytosis of LDL as described in Section
6 of the Detailed Description. Individuals are injected with
.alpha..sub.1PI peptides in the concentration range of 5-100 .mu.M.
The frequency and length of treatment are determined by the
decrease in LDL levels. In addition to being monitored for PPE
inhibitory activity, .alpha..sub.1PI peptides are screened as
described in Section 3.2 of the Detailed Description for their
capacity to induce receptor capping and cell motility of lymphoid-
and myeloid-lineage blood cells such as lymphocytes and
neutrophils.
Recombinant .alpha..sub.1PI:
[0096] In addition to .alpha..sub.1PI peptides synthesized from
individual amino acids, recombinant .alpha..sub.1PI peptides will
be used to promote decreased LDL levels.
[0097] Structural Features of .alpha..sub.1PI:
[0098] The following represents the full length amino acid sequence
for .alpha.1PI (accession # K01396) including the 24 aa signal
peptide:
TABLE-US-00001 -24 MPSSVSWGIL LLAGLCCLVP VSLA 1 EDPQGDAAQK
TDTSHHDQDH PTFNKITPNL AEFAFSLYRQ LAHQSNSTNI 51 FFSPVSIATA
FAMLSLGTKA DTHDEILEGL NFNLTEIPEA QIHEGFQELL 101 RTLNQPDSQL
QLTTGNGLFL SEGLKLVDKF LEDVKKLYHS EAFTVNFGDT 151 EEAKKQINDY
VEKGTQGKIV DLVKELDRDT VFALVNYIFF KGKWERPFEV 201 KDTEEEDFHV
DQVTTVKVPM MKRLGMFNIQ HCKKLSSWVL LMKYLGNATA 251 IFFLPDEGKL
QHLENELTHD IITKFLENED RRSASLHLPK LSITGTYDLK 301 SVLGQLGITK
VFSNGADLSG VTEEAPLKLS KAVHKAVLTI DEKGTEAAGA 351 MFLEAIPMSI
PPEVKFNKPF VFLMIEQNTK SPLFMGKVVN PTQK
[0099] The known Asn-linked carboxylation sites (denoted in bold
underlined letters) are found at aa 46, 83, and 247 (Nukiwa et al.,
1986; Jeppsson et al., 1985). The oligosaccharide structure at each
site is either tri-antenary or bi-antenary, and the various
combinations give the protein a characteristic electrophoretic
charge denoted as phenotypic subtypes of the four common genotypic
alleles, M1A, M1V, M2, and M3.
[0100] The frequencies in US Caucasians of M1A, M1V, M2, and M3 are
0.20-0.23, 0.44-0.49, 0.1-0.11, and 0.14-0.19, respectively,
accounting for 95% of this population (Jeppsson et al., 1985). M1A
is thought to be the oldest variant, and M1V has a single aa
substitution, at position 213, Ala to Val. The M3 allele has a
single aa difference with M1V, Glu to Asp at position 376. The M2
allele has a single aa difference with M3, Arg to His at position
101.
[0101] More than a hundred genotypic alleles have been identified,
but except for the S and Z alleles, most of them are exceedingly
rare (OMIM, 2000). The S allele, frequency 0.02-0.04, has a single
aa substitution at position 264, Glu to Val, and individuals
homozygous for this allele manifest 60% normal .alpha..sub.1PI
blood levels, but are not at risk for emphysema or other known
diseases except in combination with the Z allele (Brantly et al.,
1991; Sifers et al., 1988). The Z allele, frequency 0.01-0.02, has
a single aa substitution at position 342, Glu to Lys, and
individuals homozygous for this allele manifest 10% normal
.alpha..sub.1PI blood levels, and are at risk for emphysema and
autoimmunity.
[0102] Functional Properties of .alpha..sub.1PI:
[0103] There are three distinct activities of .alpha..sub.1PI that
are determined by sites in the C-terminal region of .alpha..sub.1PI
defined herein as aa 357-394,
TABLE-US-00002 PMSI PPEVKFNKPF VFLMIEQNTK SPLFMGKVVN PTQK.
[0104] The crystal structure for active .alpha..sub.1PI (1HP7, NIH
NCBI Molecular Modeling DataBase mmdbId:15959) has been determined.
The C-terminal region of .alpha..sub.1PI (aa 369-394) forms a
.beta.-sheet. Two .alpha.-helix domains (aa 27-44 and 257-280)
shield the .beta.-sheet domain in a manner resembling the
antigen-binding cleft of the major histocompatibility complex.
[0105] The first activity of .alpha..sub.1PI is its well
characterized proteinase inhibition which is a property only of
active, uncleaved .alpha..sub.1PI. The reactive site for this
activity is Met (aa 358) contained in the domain
Pro-Met-Ser-Ile-Pro (PMSIP, aa 357-361). Active .alpha..sub.1PI may
be inactivated by proteinase complexing, cleavage, or oxidation of
Met (aa 358). Interaction at the scissile bond Met-Ser (aa 358-359)
may be mediated by many proteinases including HLE.sub.G. The two
cleavage products of .alpha..sub.1PI may dissociate under some
circumstances, but may remain associated in a new, rearranged
configuration that may irreversibly incorporate HLE.sub.G, but may
not incorporate other proteinases, for example metalloproteinases
(Perkins et al., 1992).
[0106] The tertiary structure for the rearranged .alpha..sub.1PI
configuration has not been solved (Mellet et al., 1998); however,
X-ray diffraction and kinetic analyses of cleaved .alpha..sub.1PI
suggest that the strand SIPPEVKFNKP (aa 359-369) may separate
70A.degree. from its original position and insert into the
.beta.-sheet formation on the opposite face of the molecule
(.beta.-sheet A) in a manner that would significantly alter
proteinase and receptor recognition (Elliott et al., 2000). Thus,
four configurations of the C-terminal region of .alpha..sub.1PI are
thought to occur (Table 1).
TABLE-US-00003 TABLE 1 Functions of the C-terminal region of
.alpha..sub.1PI Proteinase Lymphoid cell Myeloid cell Inhibition
migration migration Native configuration in the + + - active
.alpha..sub.1PI Rearranged configuration in - - Unknown cleaved
.alpha..sub.1PI Complexed with HLE in - + + inactivated
.alpha..sub.1PI Independent of other .alpha..sub.1PI - Unknown +
cleavage products
[0107] Because the cleaved configuration of .alpha..sub.1PI lacks
proteinase inhibitory activity, in deficient concentrations of
active .alpha..sub.1PI, the result is emphysema and
respiratory-related infections which are facilitated by the
presence of certain environmental factors, cigarette smoke,
microbial factors, and inherited mutations that prohibit successful
production of active .alpha..sub.1PI.
[0108] A second activity of .alpha..sub.1PI is the stimulation of
cell migration. It has long been known that coupling of active
.alpha..sub.1PI to soluble granule-released HLE (HLE.sub.G)
inactivates both proteins and exposes the C-terminal domain of
.alpha..sub.1PI (C-36, VIRIP) which then binds to receptors for low
density lipoprotein (LDL) (Janciauskiene et al., 2001). Yet, it has
not been appreciated that HLE is also localized on the cell surface
(Bangalore and Travis, 1994) and that when .alpha..sub.1PI binds to
HLE.sub.CS at the leading edge of a migrating cell, due to forward
movement of the cell, the receptor complexes underneath the cell
reposition in "millipede-like locomotion" (Shulman et al., 2009) to
the trailing edge where .alpha..sub.1PI binds to LDL receptors at
the trailing edge of the same cell, a condition that induces
endocytosis of the receptor aggregate and retraction of the
trailing edge of the cell (Cao et al., 2006). Endocytosed LDL
receptor-associated components are tagged for degradation, used as
nutrients, or recycled to the cell surface from the trailing edge
back to the leading edge via endosomes. In addition to dietary
lipids, many nutrients such as insulin and growth factors are taken
up by receptors that cluster with LDL receptors during the
migration of granulocytes, macrophages, and lymphocytes which
deliver and present endocytic cargo to the liver, mucosa, and other
tissues.
[0109] Expression of Recombinant .alpha..sub.1PI Peptides:
[0110] Any method known in the art may be used for producing
recombinant .alpha..sub.1PI peptides according to the invention.
Two preferred methods are briefly described below for producing
recombinant .alpha..sub.1PI peptides; one allows expression of
.alpha..sub.1PI peptides in rice cells and the other allows
bacterial expression. The cDNA encoding human .alpha..sub.1PI is
obtained from a human cDNA bank and amplification of the fragment
in accession number K01396 using two PCR primers: N-terminal primer
5' GAGGATCCCCAGGGAGATGCTGCCCAGAA 3' and C-terminal primer
5'CGCGCTCGAGTTATTTTTGGGTGGGATTCACCAC 3' as previously described
(Courtney et al., 1984; Terashima et al., 1999; Jean et al.,
1998).
[0111] For expression in rice cells, expression cassettes are
prepared by using a 1.1 kb NheI-PstI fragment, derived from
p1AS1.5, and cloned into the vector pGEM5zf-(Promega, Madison,
Wis.): ApaI, AatII, SphI, NcoI, SstII, EcoRV, SpeI, NotI, PstI,
SalI, NdeI, SacI, MluI, NsiI at the SpeI and PstI sites to form
pGEM5zf-(3D/NheI-PstI). The GEM5zf-(3D/NheI-PstI) is digested with
PstI and SacI and ligated in two nonkinased 30 mers with the
complementary sequences 5' GCTTG ACCTG TAACT CGGGC CAGGC GAGCT 3'
and 5' CGCCT AGCCC GAGTT ACAGG TCAAG CAGCT 3' to form p3DProSig. A
5-kb BamHI-KpnI fragment from lambda clone .lamda.OSg1 A is used as
a terminator. Hygromycin resistance is obtained from the 3-kb BamHI
fragment containing the 35S promoter-Hph-NOS of the plasmid
pMON410.
[0112] Microprojectile bombardment is applied for transforming a
Japonica rice variety TP309. The bombarded calli are then
transferred to NB medium containing 50 mg/l hygromycin and
incubated in the dark at 25.degree. C. for 10.+-.14 days. Rice
cells are cultured at 28.degree. C. (dark) using a shaker with
rotation speed 115 rpm in the AA(+sucrose) media. The medium is
changed every 5 days to maintain cell lines. AA(-sucrose) is used
for .alpha..sub.1PI expression. A bioreactor is used for 2-1-scale
culture. The reactor is operated at 28.degree. C. (dark) at
agitation speed 30.+-.50 rpm with aeration rate 100 ml/min. During
the growth phase (10 days), the pH of the media is controlled at pH
5.7, while in the production phase the pH is 5.7.+-.6.3
(un-controlled).
[0113] Recombinant .alpha..sub.1PI peptides are purified using
anti-human .alpha..sub.1PI antibody (Enzyme Research Laboratories,
South Bend, Ind.) immobilized to CNBr-activated Sepharose 4B with a
concentration of 1.5 mg/ml gel. The gel (3.5 ml) is packed in a
column (inner diameter 1.26 cm), and equilibrated with 50 mM
Tris-HCl buffer (pH 7.6). Crude medium is applied to the column at
1.0 ml/min. Absorbance at 280 nm is monitored at the outlet of the
column. After washing with the equilibrium buffer, .alpha..sub.1PI
is eluted with 0.1N HCl solution. A peak fraction is collected, and
its pH is immediately adjusted with 1M Tris-HCl buffer (pH 8.0).
These methods yield an estimated 5.7 mg .alpha..sub.1PI peptide/g
dry cell.
[0114] Alternatively, the .alpha..sub.1PI peptides cDNA are
expressed in Escherichia coli strain BL21 transformed with
pDS56.alpha..sub.1PI/hf (Invitrogen, Carlsbad, Calif.). Protein
expression is induced by addition of 1 mM isopropyl
b-D-thiogalactoside, and cultures are grown overnight at 31.degree.
C. The cells are washed in metal-chelation chromatography binding
buffer (5 mM imidazole/0.5M NaCl/20 mM Tris, pH 7.9) and disrupted
by cavitation. The clarified and filtered supernatants containing
soluble .alpha..sub.1PI peptides are applied to a Ni.sup.2+-agarose
column, and bound peptides are eluted with 100 mM EDTA. The eluates
are adjusted to 3.5M NaCl and applied to a phenyl-Sepharose column.
The bound .alpha..sub.1PI peptide/hf is eluted with 20 mM Bis-Tris,
pH 7.0 and concentrated (4 mg/ml final) by diafiltration in the
same buffer.
Genetic Modification of .alpha..sub.1PI Peptides:
[0115] Recombinant .alpha.1PI peptides are expressed according to
the procedures described in Section 3 of the Detailed Description.
Wild-type human .alpha..sub.1PI peptides are modified genetically
to diminish or enhance sequence-specific reactive sites. For
example, in HIV-1 disease, therapeutic s.alpha.1PI peptides
maintain binding to anti-gp120, but do not interfere with full
sequence .alpha..sub.1PI in its activities to inhibit soluble
HLE.sub.G and to induce cell migration.
[0116] The genetic modifications of interest are described in
Section 4.1 of the Detailed Description. Site-directed mutagenesis
of active s.alpha.1PI is performed using standard procedures
(Parfrey et al., 2003; Current Protocols in Molecular Biology,
2002). The DNA sequence encoding the human .alpha.1PI signal
peptide in pDS6.alpha..sub.1PI/hf is replaced with sequences
encoding the epitope (FLAG)-tag by insertion of the annealed
complimentary oligos 5'CTAGAGGATCCCATGGACTACAAGGACGACGATGACAAGGAA
3' and 5'GATCTTCCTTGTCATCGTCGTCCTTGTAGTCCATGGGATCCT 3'. The
resulting cDNA is subcloned into pDS56-6H is to generate
pDS56.alpha.1PI/hf. To generate pDS56.alpha.1PI/hf carrying an
amino acid substitution, the DNA sequence encoding the wild-type
amino acids is replaced by the complimentary oligos coding for the
amino acids described in Section 4.1 of the Detailed Description.
The resulting ORFs directed cytosolic expression of the recombinant
proteins initiating with a Met followed by the His and FLAG tags
and the mature sequences of mutant .alpha.1PI.
[0117] Modification within the domain that determines cell
migration (FVFLM, aa 370-374) is prepared by site-directed
mutagenesis of specific amino acids:
TABLE-US-00004 Phe (aa 370) to Ile, Leu, Val, Tyr, or Gly. Val (aa
371) to Phe, Leu, Ile, or Gly. Phe (aa 372) to Ile, Leu, Val, Tyr
or Gly. Leu (aa 373) to Ile, Val, Phe, or Gly. Met (aa 374) to Phe,
Thr, Ile, Leu, Val, or Gly.
[0118] Modification within the domain that determines LDL receptor
recognition is prepared by site-directed mutagenesis of Met (aa
385) to Phe, Thr, Ile, Leu, Val, or Gly.
5. .alpha..sub.1PI Peptide Synthesis:
[0119] All peptides will be prepared by Fmoc solid-phase synthesis
as previously described (Fields and Noble, 1990) and subsequently
purified by reversed-phase chromatography. Identity and homogeneity
of the products will be analyzed by reversed-phase HPLC, capillary
zone electrophoresis, electrospray mass spectrometry, and sequence
analysis. After proteolytic modification, the C-terminal
.alpha..sub.1PI domain acquires attributes that allow interaction
with the LDL receptor-related protein (LRP) (Poller et al., 1995),
the VLDL receptor (Rodenburg et al., 1998), and other receptors
that recognize a pentapeptide sequence FVFLM (aa 370-374) (Joslin
et al., 1992) in a manner that produces, chemotaxis, increased LDL
binding to monocytes, upregulated LDL receptors, increased cytokine
production, and .alpha..sub.1PI synthesis (Banda et al., 1988;
Janciauskiene et al., 1999b; Janciauskiene et al., 1999a). It has
been shown that fibrillar aggregates of the C-terminal fragment of
.alpha..sub.1PI facilitate uptake of LDL by LRP on the
hepatoblastoma cell line HepG2 (Janciauskiene and Lindgren, 1999),
and these fragments participate in atherosclerosis (Dichtl et al.,
2000).
6. .alpha..sub.1PI Peptides and Therapy:
[0120] The desired .alpha..sub.1PI peptides for treating disease
are those that produce decreased LDL levels, but do not
functionally interfere with the physiologic activity of
.alpha..sub.1PI. Peptides derived from .alpha..sub.1PI are selected
for use in treatment of specific blood cell diseases by determining
their capacity in vitro and in vivo to influence the following
functions in the following assays:
6.1 Inhibit Elastase:
[0121] The procedures for measuring the capacity of .alpha..sub.1PI
to inhibit soluble forms of porcine pancreatic elastase (PPE) or
HLE.sub.G are well established (U.S. Pat. No. 6,887,678) (Bristow
et al., 1998). Briefly, PPE is incubated for 2 min with
.alpha..sub.1PI, and to this mixture is added, the elastase
substrate succinyl-L-Ala-L-Ala-L-Ala-p-nitroanilide (SA.sup.3NA).
Results are detected by measuring the color change at 405 nm.
[0122] In complex mixtures, .alpha..sub.1PI competes for binding to
PPE with other proteinase inhibitors or ligands present in the
mixture. For example, PPE has higher affinity for
.alpha..sub.2macroglobulin (.alpha..sub.2M) than for
.alpha..sub.1PI, and when complexed with .alpha..sub.2M, PPE
retains the ability to cleave small substrates. In the presence of
.alpha..sub.2M, PPE binds .alpha..sub.2M and is protected from
inhibition by .alpha..sub.1PI, and the complexation of PPE with
.alpha..sub.2M can be measured by detecting the activity of PPE
using SA.sup.3NA. To measure the inhibitory capacity of
.alpha..sub.1PI in complex mixtures such as serum, two-fold serial
dilutions of serum are incubated with a constant, saturating
concentration of PPE. The added PPE is bound by .alpha..sub.2M and
.alpha..sub.1PI in the diluted serum depending on their
concentrations. The greater the concentration of serum, the greater
the concentration of .alpha..sub.2M and .alpha..sub.1PI. Since
there is more .alpha..sub.1PI in serum than .alpha..sub.2M, as
serum is diluted, .alpha..sub.2M is diluted out, and in the absence
of .alpha..sub.2M, PPE is bound and inhibited by .alpha..sub.1PI.
The complexation of PPE with .alpha..sub.1PI can be measured by
detecting the loss of activity of PPE using SA.sup.3NA. As serum is
further diluted, .alpha..sub.1PI is also diluted out, and the loss
of complexation of PPE with .alpha..sub.1PI can be measured by
detecting the gain in activity of PPE using SA.sup.3NA. The plot of
PPE activity versus serum dilution makes a V shaped curve, PPE
activity first decreasing as serum is diluted, and then increasing
as serum is further diluted. The nadir of PPE activity is used to
calculate the precise concentration of active .alpha..sub.1PI in
the mixture (Bristow et al., 1998).
6.2 Induce Receptor Co-Capping and Cell Motility:
[0123] The procedures for inducing receptor capping have been
described (Bristow et al., 2003a; Bristow et al., 2008c). The cells
of interest (monocytes, lymphocytes, neutrophils, or other blood
cells, e.g. leukemic cells) are isolated from blood or tissue using
standard techniques (Messmer et al., 2002b) and examined for
reactivity with .alpha..sub.1PI.
[0124] To examine receptor capping, cells are incubated with active
or modified .alpha..sub.1PI for 15 min in humidified 5% CO.sub.2 at
37.degree. C. Cells are applied to the sample chambers of a
cytospin apparatus (Shandon Inc. Pittsburgh, Pa.), and slides are
centrifuged at 850 rpm for 3 min. Slides are fixed by application
of 50 .mu.l 10% formalin to the sample chambers of the cytospin
apparatus followed by an additional centrifugation at 850 rpm for 5
min. Slides are incubated for 90 min at 20.degree. C. with
fluorescently-labeled monoclonal antibodies having specificity for
the receptors of interest and examined by microscopy.
[0125] Cell motility results from selective and sequential
adherence and release produced by activation and deactivation of
receptors (Wright and Meyer, 1986; Ali et al., 1996), consequent
polar segregation of related membrane proteins to the leading edge
or trailing uropod, and both clockwise and counterclockwise
propagation of Ca.sup.++ waves which initiate from different
locations in the cell (Kindzelskii and Petty, 2003). Thus, several
aspects of the complex process may be quantitated. The most direct
and most easily interpreted method for quantitating cell motility
is the enumeration of adherent cells in response to a chemotactic
agent such as .alpha..sub.1PI.
[0126] For detecting adherence, sterile coverslips are washed in
endotoxin-free water, and to each coverslip is delivered various
dilutions of active or modified .alpha..sub.1PI. Cells are
subsequently delivered to the coverslips, mixed to uniformity with
.alpha..sub.1PI, and incubated for 30 min in humidified 5% CO.sub.2
at 37.degree. C. without dehydration. After stringently washing the
coverslips free of non-adherent cells, adherent cells are fixed by
incubation for 10 min at 20.degree. C. with 4% paraformaldehyde
containing 2.5 .mu.M of the nuclear staining fluorescent dye,
acridine orange (3,6-bis[dimethylamino]acridine. Slides are
examined by microscopy, and means and standard deviations are
determined by counting adherent cells in at least three
fields/coverslip.
7. Treatment Outcome Measurements:
[0127] 7.1
[0128] To determine the influence of .alpha..sub.1PI peptide
treatment on elastase inhibitory capacity, individuals are
monitored weekly for levels of active and inactive .alpha..sub.1PI
in blood (Bristow et al., 1998) (U.S. Pat. No. 6,887,678). Briefly,
a constant amount of active site-titrated PPE is allowed to
incubate with serial dilutions of serum for 2 min at 37.degree. C.
after which a PPE substrate is added. Determination of the
molecules of substrate cleaved by residual, uninhibited PPE is used
to calculate the molecules of active and inactive .alpha..sub.1PI
in blood.
7.2
[0129] To determine the influence of .alpha..sub.1PI peptide
treatment on inducing changes in lipid levels of blood cell
populations, treated individuals are monitored weekly for changes
in complete blood count and differential, as well as for changes in
LDL, HDL, cholesterol and triglycerides using standard, approved
clinical laboratory methods.
7.3
[0130] To determine the influence of treatment on disease
progression, individuals are monitored for the specific pathologic
determinants of disease which are well known in the art for the
various indications in heart disease, atherosclerosis,
hypertension, HIV infection, viral infection, bacterial infection,
leukemia, a solid tumor, and autoimmune disease.
8. Determining LDL Levels
[0131] Methods of determining the LDL level are known in the
art.
[0132] LDL=Total cholesterol HDL (Triglycerides/5). Total
cholesterol (mg/dL) is measured using an enzyme assay (cholesterol
esterase/cholesterol oxidase) to produce hydrogen peroxide which
causes a color change that can be quantitated (for example as
described in Allain et al. 1974 Clin Chem 20:470-475.
[0133] HDL (mg/dL) is measured in a similar manner, in an assay
utilizes an HDL specific detergent. The result is Total
cholesterol+HDL.
[0134] Triglycerides (mg/dL) are measured using a different set of
enzymes, including lipoproteinlipase (LPL), glycerol kinase (GK)
and glycerol phosphate dehydrogenase (GPO). Triglycerides are
hydrolyzed by LPL to liberate glycerol and free fatty acids.
Glycerol is converted to glycerol-3-phosphate (G3P) and ADP by GK
and ATP, G3P is then converted by GPO to dihydroxyacetone phosphate
(DAP) and hydrogen peroxide which causes a color change.
EXAMPLES
Example 1
[0135] The following data demonstrate a relationship between
.alpha..sub.1PI levels and LDL levels. In healthy individuals, the
normal range of active .alpha..sub.1PI is 18-5311M and 98% is in
the active form.sup.16. Inactive .alpha..sub.1PI arises during
infection or inflammation. Active, but not inactive
.alpha..sub.1PI, binds HLE.sub.CS.sup.16 and inactive, but not
active .alpha..sub.1PI binds LDL receptors.sup.12. Consistent with
previous reports.sup.14. The data presented below demonstrate that
many HIV-1 patients with below normal CD4 counts exhibit below
normal levels of active .alpha..sub.1PI (median 17 .mu.M) and above
normal levels of inactive .alpha..sub.1PI (median 33 .mu.M). In
patients with <500 CD4 cells/.mu.l, higher active
.alpha..sub.1PI was correlated with higher LDL (r.sup.2=0.44,
p<0.001, n=24) whereas in HIV-1 patients with >500 CD4 (n=46)
and in non-HIV-1 volunteers (n=18) LDL levels were not correlated
with active .alpha..sub.1PI (FIG. 1a). Lipoprotein levels were not
related to HLE.sub.CS, CXCL12, CD184, or CD4 numbers (Table 2).
TABLE-US-00005 TABLE 2 Correlation between lipoprotein levels and
.alpha..sub.1PI, CXCL12, and lymphocyte numbers Cholesterol HDL LDL
Triglycerides active.alpha..sub.1PI 0.05 (27) 0.00 (27) 0.66 (24)**
0.19 (27) inactive .alpha..sub.1PI 0.05 (27) 0.00 (27) 0.66 (24)**
0.19 (27) CXCL12 0.00 18) 0.04 (16) 0.02 (12) 0.01 (18) HLE.sub.CS
0.09 (17) 0.00 (15) 0.14 (11) 0.13 (17) CD4 0.01 (36) 0.03 (36)
0.01 (32) 0.01 (38) CD184 0.02 (18) 0.18 (16) 0.00 (12) 0.00 (18)
CD195 0.00 (18) 0.11 (16) 0.00 (12) 0.00 (18) *Values represent
correlation coefficients (r) and number of observations (n). CXCL12
(pM) was measured by ELISA, and .alpha..sub.1PI (.mu.M) was
measured for active concentration. Absolute numbers of lymphocytes
were counted by flow cytometry using whole blood analysis. Lipid
levels (mg/dL) were measured by a contractor medical lab and
extracted during chart review. **p < 0.001
[0136] In contrast, inactive .alpha..sub.1PI correlated with LDL
levels irrespective of CD4 counts, but exhibited bimodal
distribution (FIG. 1b). In patients with <20 .mu.M inactive
.alpha..sub.1PI, lower inactive .alpha..sub.1PI correlated with
higher LDL (r.sup.2=0.35, p<0.001, n=33) suggesting higher
inactive .alpha..sub.1PI diminished LDL. This is consistent with
reports that inactive .alpha..sub.1PI facilitates the binding of
LDL to LDL receptors thereby decreasing free LDL.sup.17. As
expected, in these patients, lower inactive .alpha..sub.1PI
correlated with higher active .alpha..sub.1PI (r.sup.2=0.24,
p=0.003, n=34, not shown). On the other hand, consistent with an
inflammation-induced LDL rise.sup.18, in patients with >20 .mu.M
inactive .alpha..sub.1PI, higher inactive .alpha..sub.1PI
correlated with higher LDL (r.sup.2=0.29, p<0.02, n=19). The LDL
therapeutic target is 100 mg/dL and corresponded to 28 .mu.M
inactive .alpha..sub.1PI in this population supporting the
observations that atherosclerosis is related to low active
.alpha..sub.1PI.sup.19 or high inactive .alpha..sub.1PI.sup.18. In
non-HIV-1 individuals, inactive .alpha..sub.1PI was 0-18 .mu.M,
(median=3 .mu.M) and as expected was below the threshold to be
related to LDL levels.
Example 2
[0137] Binding of active .alpha..sub.1PI to HLE.sub.CS produces
inactive .alpha..sub.1PI and induces receptor polarization and cell
migration.sup.8,22, activities that are time-ordered. To
discriminate the effects of active .alpha..sub.1PI binding to
HLE.sub.CS versus inactive .alpha..sub.1PI binding to LDL
receptors, cells were exposed to .alpha..sub.1PI for 15 min versus
60 min, and outcome was determined using HIV-1 localization.
Primary monocyte-derived dendritic cells (MDC) and promonocytic
U937 clone 10 cells were preconditioned with .alpha..sub.1PI at
37.degree. C. to induce polarization, and subsequently exposed at
2.degree. C. to two CD184-using non-infectious HIV-1
strains.sup.23. These conditions allow binding, but prevent
internalization of virus. In the absence of purified
.alpha..sub.1PI, little or no virus binding was detected (FIG.
2a-d, top panel). When virus was added to cells preconditioned with
.alpha..sub.1PI for 15 min, considerable bound virus was detected
(FIG. 2a-d, middle panel). In contrast, preconditioning cells with
.alpha..sub.1PI for 60 min prior to the addition of virus resulted
in few virus-bound cells (FIG. 2a-d, lower panel).
[0138] Infectious CD184-using HIV-1 was co-cultured with clone 10
after preconditioning cells with purified .alpha..sub.1PI for 0,
15, or 60 min in serum-free medium as previously described.sup.8.
Cells preconditioned with purified .alpha..sub.1PI for 15 min were
productively infected with HIV-1 at levels comparable to previous
reports.sup.24. In the absence of .alpha..sub.1PI or when cells
were preconditioned for 60 min, no infectivity was detected (FIG.
2e). Long-term infectivity kinetics were not examined due to slower
growth and virus yield by cells in serum-free medium.sup.6.
[0139] To examine the kinetic effect of .alpha..sub.1PI on HIV-1
binding and infectivity of primary peripheral blood mononuclear
cells (PBMC) from non-HIV-1 volunteers, cells were co-cultured with
a CD195-using primary clinical isolate in the presence of 20%
autologous serum with final culture concentrations of 0.8-13 .mu.M
active .alpha..sub.1PI/2.times.10.sup.5 cells. Cells were placed in
culture with no added .alpha..sub.1PI or were spiked with 3 .mu.M
purified .alpha..sub.1PI at 0 and 60 min prior to addition of
HIV-1. Change in infectivity (.DELTA.HIV) due to the addition of
.alpha..sub.1PI was compared using the ratio of HIV-1 produced in
.alpha..sub.1PI-spiked versus non-spiked culture medium. It was
found that higher .DELTA.HIV correlated with higher HLE.sub.CS
whether the cultures were exposed to HIV-1 before or after spiking
with .alpha..sub.1PI (FIG. 2f,g) suggesting that in vitro HIV-1
infectivity is dependent on HLE.sub.CS levels. When exogenous
.alpha..sub.1PI and HIV-1 were introduced to cells simultaneously
(t.sub.0), .DELTA.HIV and .alpha..sub.1PI were not correlated (FIG.
2f); however, when cells were preconditioned with purified
.alpha..sub.1PI for 60 min, lower .DELTA.HIV correlated with higher
.alpha..sub.1PI levels (FIG. 2g) suggesting .alpha..sub.1PI
inhibits HIV-1 infectivity in vitro in a dose dependent manner when
HIV-1 is introduced after prolonged .alpha..sub.1PI incubation.
Neither CD184, nor CD195 levels were related to .DELTA.HIV on
lymphocytes or monocytic cells (Table 3).
TABLE-US-00006 TABLE 3 Correlation between .DELTA.HIV,
.alpha..sub.1PI, and blood cells .DELTA.HIV t.sub.0 .DELTA.HIV
t.sub.60 .alpha..sub.1PI -0.48 -0.95 ** Mo HLE.sub.CS 0.93 ** 0.96
** Mo CD4 0.76 0.97 ** Mo CXCR4 0.63 0.76 Mo CCR5 0.65 0.67 Ly
HLE.sub.CS -0.58 -0.62 Ly CD4 -0.85 ** -0.93 Ly CXCR4 0.40 0.39 Ly
CCR5 0.22 0.24 *HIV-1 outcome was measured on day 6 of co-culture
using PBMC from 6 volunteers and a primary isolate of CD195-using
HIV-1. PBMC were spiked with .alpha..sub.1PI 0 min or 60 min prior
to addition of HIV-1. .DELTA.HIV is calculated as 100 * (HIV spiked
with .alpha..sub.1PI)/(HIV without spiking). Values represent
Pearson correlation coefficients (r) and stars designate
significance (p < 0.04). Lymphocytes (Ly) and CD14.sup.+
monocytic cells (Mo) were analyzed by flow cytometry using whole
blood. MFI of probed receptors is depicted. .alpha..sub.1PI (.mu.M)
was measured as the active concentration. .DELTA.HIV was negatively
correlated with CD4.sup.+ lymphocytes at t.sub.0 (r.sup.2 = 0.72, p
= 0.03, n = 6) and positively correlated with CD4.sup.+ monocytic
cells at t.sub.60 (r.sup.2 = 0.94, p = 0.03, n = 4), consistent
with the tropism of CD195-using virus.
Example 3
[0140] We considered that the opposing early and late influence of
.alpha..sub.1PI on receptor polarization may involve LDL
receptor-mediated endocytosis. To examine this possibility,
receptors and HIV-1 binding were measured after downregulating LDL
receptors. U937 clone 10 cells were transfected with LDL
receptor-specific siRNA. Flow cytometric analysis determined that
clone 10 cells express the VLDL receptor (VLDLR), but not LDL
receptor-related protein (LRP, CD91) (FIGS. 5a, b and c). After 48
hrs, VLDLR siRNA reduced the number of VLDLR-expressing cells in a
linear dose-dependent manner relative to nonspecific or
LRP-specific negative control siRNA (data not shown). At optima,
relative to nonspecific siRNA, VLDLR siRNA resulted in 57% VLDLR
expression (FIG. 3a). As compared with negative control siRNA,
VLDLR siRNA resulted in 44% and 100% increased surface expression
of recycling receptors CD4 and CXCR4, respectively, and 10%
decreased expression of HLE.sub.CS (FIG. 3a).
[0141] VLDLR siRNA also resulted in delayed HIV-1 infectivity (FIG.
3b). However, 6 days post-infection, the rate of p24 accumulation
in cells transfected with VLDLR siRNA was no different from cells
transfected with negative control siRNA. These results suggest that
blocking VLDLR-mediated endocytosis blocks CD4 and CXCR4 recycling
without blocking HIV-1 binding. To examine this possibility, cells
transfected with siRNA followed by HIV-1 incubation for 2 hr at
37.degree. C. were examined by confocal microscopy. Cells
transfected with VLDLR siRNA exhibited polarization as previously
reported (Bristow et al., 2003b), and HIV-1 was detected on both
non-permeabilized and permeabilized cells suggesting that HIV-1 had
not internalized (FIG. 3c). In contrast, cells transfected with
nonspecific siRNA exhibited polarization, but HIV-1 was only
detected in permeabilized cells suggesting that HIV-1 had
internalized. These results confirm that VLDLR siRNA transiently
blocks endocytosis of CD4 and CXCR4 without blocking HIV-1
binding.
[0142] Unlike transitory siRNA inhibition, RAP provides continuous
VLDLR blocking. Clone 10 cells were preconditioned with low
endotoxin recombinant RAP for 15 min in serum-free medium prior to
addition of .alpha..sub.1PI. Preconditioned cells were co-cultured
with HIV-1 and after removal of unbound HIV-1, maintained in
culture for 8 days in the presence of the same concentrations of
RAP and .alpha..sub.1PI. Under these conditions, RAP inhibited
HIV-1 infectivity 93% (FIG. 3d). In the presence of
.alpha..sub.1PI, cells cultured with RAP were 81.+-.10% viable at
the end of the culture period. In the absence of .alpha..sub.1PI,
cells cultured with RAP were 16.+-.10% viable.
Example 4
[0143] Active .alpha..sub.1PI, inactive .alpha..sub.1PI and LDL
participate in a feedback regulatory pathway. Two HIV-1 patients
with disease-associated .alpha..sub.1PI deficiency were
administered therapeutic .alpha..sub.1PI (Table 4).
TABLE-US-00007 TABLE 4 Zemaira .RTM. study population at baseline
HIV-1 HIV-1.sup.+ .alpha..sub.1PI CD4 HIV RNA Patient .sup.a
NRT/NNRT/PI .sup.b Age since (.mu.M) cells/.mu.l copies/ml Alpha
Epivir/Sustiva/ 47 2001 9 297 <400 none Beta Combivir/Sustiva/
53 1982 7 276 <400 none .sup.a Patients were at different stages
of disease progression and were on antiretroviral medication with
adequate suppression of virus. Patients received 8-12 weekly
infusions of .alpha..sub.1PI augmentation therapy at a dose of 120
mg/kg (Zemaira .RTM., lot# C405702,contributed by CSL Behring). No
adverse effects of treatment were reported by any patient. .sup.b
Antiretroviral medications: nucleoside reverse transcriptase
inhibitor (NRT), non nucleotide reverse transcriptase inhibitor
(NNRTI), aspartyl protease inhibitors lopinavir/ritonavir (PI)
[0144] LDL levels significantly decreased as active .alpha..sub.1PI
increased (r.sup.2=0.61, p=0.03, n=9; r.sup.2=0.42, p<0.0001,
n=6) (FIG. 4a,b) and significantly increased as inactive
.alpha..sub.1PI increased (r.sup.2=0.58, p=0.03, n=8; r.sup.2=0.90,
p<0.001, n=7). There were no untoward effects of treatment.
These results suggest that both active and inactive .alpha..sub.1PI
influence LDL transport.
[0145] LDL is inflammatory and induces IL-6.sup.20 which
up-regulates .alpha..sub.1PI synthesis thereby increasing
circulating active .alpha..sub.1PI. To examine the possibility that
LDL and .alpha..sub.1PI might participate in a regulatory pathway
at the cellular level, cDNA microarray analysis was performed on
14,500 functionally characterized genes using monocytic cells
harvested from HIV patients receiving ritonavir, an HIV-1 protease
inhibitor therapy known to elevate LDL levels.sup.21. Gene
expression ratios of patient to healthy cells showed that
.alpha..sub.1PI expression was increased 18-fold, and 6 additional
proteinase inhibitors were increased more than 12-fold (FIG. 4c).
Of the 7 proteinase inhibitors exhibiting major up-regulation, 5
bind HLE including SKALP, ovalbumin, thrombospondin,
.alpha..sub.1PI, and elafin; 1 binds .alpha..sub.1PI (heparin
cofactor); 1 binds LDL (Tissue Factor Pathway Inhibitor). It was
found that 4 other proteinase inhibitors were decreased in
expression 12-fold or more, but none of these inhibitors are known
to bind HLE, .alpha..sub.1PI, or lipoproteins. In contrast, 5 of 5
LDL-binding lipoproteins were decreased more than 14-fold. LDL
receptor and LDL receptor-related protein 5 (LRP5) were increased
4-fold and 8-fold, respectively. This is the first demonstration
that active .alpha..sub.1PI, inactive .alpha..sub.1PI, and LDL
physiologically participate in a feedback regulatory pathway.
Materials
[0146] The invention and results described herein are performed
with, but not limited to, the following materials and methods
Human Subjects.
[0147] Informed consent was obtained from all participants. Blood
was collected from 24 HIV-1 seronegative, healthy adults, 12 males
and 12 females and from 126 HIV-1 seropositive adults attending
clinic, 38 males and 2 females at Cabrini Medical Center and 57
males and 29 females at NY Presbyterian Weill Cornell Medical
Center which were measured by the respective hospital labs for
complete blood count, lymphocyte phenotype, and lipids. Inclusion
criteria for initiating .alpha..sub.1PI augmentation therapy in 3
HIV-1 patients were: i) active .alpha..sub.1PI below 11 .mu.M; ii)
one year history with CD4.sup.+ lymphocytes between 150 and 300
cells/4 iii) absence of HIV-1 disease progression; iv) adequate
suppression of virus (<50 HIV RNA/ml); and v) history of
compliance with antiretroviral medication. CSL Behring contributed
a sufficient quantity of Zemaira.RTM. (lot# C405702) for
administration of 8 weekly infusions at a dose of 120 mg/kg. Blood
was collected at each session and was sent to a contractor medical
laboratory for independent assessment of complete blood count,
lipids, blood chemistry, lymphocyte phenotype, and HIV RNA. No
adverse effects were reported by any patient.
Animals.
[0148] Blood was collected from male and female adult macaques
(Macaca mulatta) housed in the Tulane Regional Primate Research
Center as previously described (Messmer et al., 2002a). Animal care
operations were in compliance with the regulations detailed under
the animal welfare act, and in the Guide for the Care and Use of
Laboratory Animals. Before use, all animals used in this study
tested negative for antibodies recognizing SIV, type D
retroviruses, and simian T cell leukemia virus type 1.
Flow Cytometric Analysis of Receptor Expression.
[0149] Surface staining on whole blood or cell suspensions were
performed as previously described using ASR antibodies (BD
Biosciences, San Jose, Calif.) (Bristow et al., 2008b). HLE.sub.CS
was detected using FITC-conjugated rabbit anti-HLE (Biodesign,
Kennebunkport, Me.) or using rabbit anti-HLE
[0150] (Biodesign) and negative control rabbit IgG (Chemicon,
Temecula, Calif.) which had been conjugated to Alexa Fluor 647
(Molecular Probes, Eugene, Oreg.). Monoclonal anti-VLDLR (6A6,
Santa Cruz Biotechnology, Santa Cruz, Calif.) and isotype control
were detected using FITC-conjugated goat anti-mouse IgG.
Cell Culture and Preconditioning.
[0151] U937 subclones have been previously characterized (Franzoso
et al., 1994; Bristow et al., 2008a). Immature and mature
monocyte-derived dendritic cells (MDC) were generated from human or
macaque peripheral blood mononuclear cells (PBMC) and phenotype was
confirmed by flow cytometry for each experiment as previously
described (Messmer et al., 2002a). To stimulate receptor
polarization, cells were preconditioned with active-site
standardized .alpha..sub.1PI (Sigma, cat# A9024 or Zemaira.RTM.,
CSL Behring) or negative control buffer for various time points at
37.degree. C. In some cases, U937 clone 10 cells in serum-free
medium (1.times.10.sup.6) were incubated with or without 3 nmol low
endotoxin recombinant RAP (Molecular Innovations, Southfield,
Mich.) or negative control buffer for 15 min at 37.degree. C. prior
to addition of .alpha..sub.1PI.
VLDLR Targeted siRNA.
[0152] U937 clone 10 cells in RPMI 1640 containing 10% FBS were
transfected with LRP-1 siRNA (Ambion, Austin, Tex., ID#106762; SEQ
ID NO: 2), VLDLR siRNA (Ambion, ID#111310; SEQ ID NO: 1), or
negative control siRNA (Ambion, ID#1; SEQ ID NO: 3). Successful
delivery of siRNA was achieved for 2.5.times.10.sup.5 cells
suspended in 250 .mu.l culture media containing 0.15-30 nmol
individual siRNA by passage through a syringe fitted with a
25-gauge needle as previously described (Bristow et al., 2003b).
Minimal VLDLR expression relative to negative control siRNA using
U937 clone 10 cells was achieved 48 hr after transfecting 2 nmol
siRNA/1.times.10.sup.6 cells. Cells were measured for cell
viability and for expression of CD91 (LRP), VLDLR, CD4, CXCR4, and
HLE.sub.CS by flow cytometric analysis.
HIV-1 Infectivity of U937 Cells.
[0153] Without transferring cells from Eppendorf tubes, cells were
co-cultured with HIV-1 NL4-3 (TCID.sub.50=10.sup.-5.17, Advanced
Biotechnologies, Inc., Columbia, Md.) for 2 h at 37.degree. C.
Cells were washed and resuspended in 0.7 ml fresh medium containing
the .alpha..sub.1PI or RAP at concentrations matching
preconditioning concentrations. Negative control cells were
incubated with .alpha..sub.1PI in the presence of 0.214 T-20 fusion
inhibitor (AIDS Research and Reference Reagent Program, NIH).
Culture supernatant (100 .mu.l was collected without replacement of
fresh media every other day for 8 days and stored at -80.degree. C.
for analysis of p24 antigen (ZeptoMetrix Corp., Buffalo, N.Y.).
Cell counts and viability were determined on the 8.sup.th day
post-infection and in all cases were >85%.
Inactivated Virus Binding.
[0154] AT-2 chemically-inactivated SIV or SHIV preparations,
non-infectious virus with conformationally and functionally intact
envelope glycoproteins, were provided by the AIDS Vaccine Program
(SAIC-Frederick, National Cancer Institute at Frederick, Frederick,
Md., USA) (Rossio et al., 1998; Frank et al., 2002). The SIVmneE11S
virus was produced from a chronically infected subclone of HuT-78
designated HuT-78c1.E11S. The SHIV89.6 virus was produced from the
CEM X 174 (T1) cell line. Virus content of purified concentrated
preparations was determined with an antigen capture immunoassay for
the SIV gag p27 or HIV p24 (AIDS Vaccine Program).
[0155] MDC or U937 clone 10 were cultured in AIM V(R) serum-free
medium (Gibco/Invitrogen) for 24 h and resuspended at
1.times.10.sup.7/ml AIM V(R) prior to preconditioning. To prevent
virus internalization, all reagents were allowed to equilibrate to
2.degree. C. prior to virus pulsing of preconditioned cells. After
pulsing cells with virus (30 ng p27 or p24/10.sup.6 cells) for 2 h
at 2.degree. C. cells were washed using ice cold Dulbecco's PBS for
flow cytometric analysis or for adherance to Alcian blue-coated
slides respectively (Frank et al., 2002).
Viral Envelope-Staining
[0156] Cells attached to Alcian blue slides for microscopy or
maintained in suspension for flow cytometry were fixed and stained
as previously described (Frank et al., 2002). Inactivated virus was
detected using biotinylated tetravalent human CD4-IgG.sub.2
provided by Progenics Pharmaceutical Inc. (Tarrytown, N.Y., USA).
Live virus was detected using dodecameric human CD4-IgG.sub.1
(Arthos et al., 2002) which was kindly provided by the Laboratory
of Immunoregulation, NIAID, NIH. Both reagents specifically
recognize conformationally intact HIV-1/SIV envelope gp120.
Biotinylated CD4-IgG.sub.2 was detected using HRP-conjugated
streptavidin (NEN Life Science Products), and CD4-IgG.sub.1 was
detected using HRP-conjugated Rb anti-human IgG (Sigma).
CD4-IgG-labeled cells were coupled to FITC using the Tyramide
signal amplification system (NEN Life Science Products, Boston,
Mass., USA) as previously described (Frank et al., 2002). Cells
stained on slides were permeabilized using 0.05% saponin during the
blocking step and further stained with the nuclear staining dye,
4',6-diamidino-2-phenylindole (DAPI), mounted, and examined by
epifluorescence microscopy using an Olympus AX70 or by confocal
microscopy using an Olympus FluoView.
Statistical Analysis.
[0157] Multiple linear regression and computer generated curve
fitting were performed using SigmaPlot. Correlation coefficients
were determined by Spearman Rank Order. Measurements are presented
as mean.+-.standard deviation unless stated otherwise.
[0158] All publications and patent documents cited in this
application are incorporated by reference in their entirety for all
purposes to the same extent as if each individual publication or
patent document were so individually denoted. By their citation of
various references in this document, Applicants do not admit any
particular reference is "prior art" to their invention.
Virus Binding.
[0159] AT-2 chemically-inactivated SIV or SHIV preparations,
non-infectious virus with conformationally and functionally intact
envelope glycoproteins, were provided by the AIDS Vaccine Program
(SAIC-Frederick, Frederick, Md.).sup.23,29. After pulsing cells
with virus (30 ng p27 or p24/10.sup.6 cells) for 2 h at 2.degree.
C., cells were attached to Alcian blue slides for microscopy or
maintained in suspension for flow cytometry.sup.23. Inactivated
virus was detected using biotinylated tetravalent human
CD4-IgG.sub.2 (Progenics Pharmaceutical Inc. Tarrytown, N.Y., USA).
NL4-3 live virus was detected using dodecameric human
CD4-IgG.sub.1.sup.30 provided by the Laboratory of
Immunoregulation, NIAID, NIH. Biotinylated CD4-IgG.sub.2 was
detected using HRP-conjugated streptavidin (NEN Life Science
Products), and CD4-IgG.sub.1 was detected using HRP-conjugated Rb
anti-human IgG (Sigma). CD4-IgG-labeled cells were coupled to FITC
using the Tyramide signal amplification system (NEN Life Science
Products, Boston, Mass., USA).
Gene Expression in Monocytic Cells.
[0160] Total RNA (50 ng) was extracted from non-adherent PBMC from
1 non-HIV-1 donor and 2 HIV-1 patients on protease inhibitor
therapy (ritonavir), purified using RNeasy mini kit (Qiagen,
Chatsworth, Calif.), and amplified, yielding an average of 7 .mu.g
of single-stranded cDNA which was fragmented and labeled with
biotin using the Ovation Biotin system (NuGEN Technologies, Inc.,
San Carlos, Calif.). Expression patterns of 18,400 genes, 14,500
functionally characterized genes and 3,900 expressed sequence tag
clusters, were examined using GeneChip U133A2.0 arrays (Affymetrix,
Santa Clara, Calif.). Data were analyzed by large-scale microarrays
involving two independent primary culture preparations and DNA
microarray runs.
REFERENCES
[0161] Ali, H., Tomhave, E. D., Richardson, R. M., Haribabu, B.,
and Snyderman, R. (1996). Thrombin primes responsiveness of
selective chemoattractant receptors at a site distal to G protein
activation. J. Biol. Chem. 271, 3200-3206. [0162] Andrade, N.,
Komnenovic, V., Blake, S. M., Jossin, Y., Howell, B., Goffinet, A.,
Schneider, W. J., and Nimpf, J. (2007). ApoER2/VLDL receptor and
Dab1 in the rostral migratory stream function in postnatal neuronal
migration independently of Reelin. PNAS. 104, 8508-8513. [0163]
Arthos, J., Cicala, C., Steenbeke, R. D., Chun, T.-W., Dela Cruz,
C., Hanback, D. B., Khazanie, P., Nam, D., Schuck, P., Selig, S.
M., Van Ryk, D., Chaikin, M. A., and Fauci, A. S. (2002).
Biochemical and biological characterization of a dodecameric CD4-Ig
fusion protein. J. Biol. Chem. 277, 11456-11464. [0164] Banda, M.
J., Rice, A. G., Griffin, G. L., and Senior, R. M. (1988).
.alpha.1-proteinase inhibitor is a neutrophil chemoattractant after
proteolytic inactivation by macrophage elastase. J. Biol. Chem.
263, 4481-4484. [0165] Bangalore, N. and Travis, J. (1994).
Comparison of properties of membrane bound versus soluble forms of
human leukocytic elastase and cathepsin G. Biol. Chem.
Hoppe-Seyler. 375, 659-666. [0166] Bartosch, B., Vitelli, A.,
Granier, C., Goujon, C., Dubuisson, J., Pascale, S., Scarselli, E.,
Cortese, R., Nicosia, A., and Cosset, F. L. (2003). Cell Entry of
Hepatitis C Virus Requires a Set of Co-receptors That Include the
CD81 Tetraspanin and the SR-B1 Scavenger Receptor. J. Biol. Chem.
278, 41624-41630. [0167] Berninger, R. W. (1985). Alpha
1-antitrypsin. J. Med. 16, 23-99. [0168] Brantly, M. L., Wittes, J.
T., Vogelmeier, C. F., Hubbard, R. C., Fells, G. A., and Crystal,
R. G. (1991). Use of a highly purified alpha 1-antitrypsin standard
to establish ranges for the common normal and deficient alpha
1-antitrypsin phenotypes. Chest 100, 703-708. [0169] Bristow, C.
L., Cortes, J., Mukhtarzad, R., Trucy, M., Franklin, A., Romberg,
V., and Winston, W. (2009). .alpha.1Antitrypsin therapy increases
CD4.sup.+ lymphocytes to normal values in HIV-1 patients. In
Soluble Factors Mediating Innate Immune Responses to HIV Infection,
M. Alfano, ed. Bentham Science Publishers, In Press). [0170]
Bristow, C. L., di Meo, F., and Arnold, R. R. (1998). Specific
activity of .alpha.1proteinase inhibitor and .alpha.2macroglobulin
in human serum: Application to insulin-dependent diabetes mellitus.
Clin. Immunol. Immunopathol. 89, 247-259. [0171] Bristow, C. L.,
Fiscus, S. A., Flood, P. M., and Arnold, R. R. (1995). Inhibition
of HIV-1 by modification of a host membrane protease. Int. Immunol.
7, 239-249. [0172] Bristow, C. L. and Flood, P. M. (1993). T cell
antigen receptor immune complexes demonstrating biologic and
proteolytic activity. Int Immunol 5, 79-88. [0173] Bristow, C. L.,
Mercatante, D. R., and Kole, R. (2003b). HIV-1 preferentially binds
receptors co-patched with cell surface elastase. Blood 102,
4479-4486. [0174] Bristow, C. L., Mercatante, D. R., and Kole, R.
(2003a). HIV-1 preferentially binds receptors co-patched with cell
surface elastase. Blood 102, 4479-4486. [0175] Bristow, C. L.,
Wolkowicz, R., Trucy, M., Franklin, A., Di Meo, F., Kozlowski, M.
T., Winston, R., and Arnold, R. R. (2008b). NF-{kappa}B Signaling,
Elastase Localization, and Phagocytosis Differ in HIV-1 Permissive
and Nonpermissive U937 Clones. The Journal of Immunology 180,
492-499. [0176] Bristow, C. L., Wolkowicz, R., Trucy, M., Franklin,
A., Di Meo, F., Kozlowski, M. T., Winston, R., and Arnold, R. R.
(2008d). NF-{kappa}B Signaling, Elastase Localization, and
Phagocytosis Differ in HIV-1 Permissive and Nonpermissive U937
Clones. The Journal of Immunology 180, 492-499. [0177] Bristow, C.
L., Wolkowicz, R., Trucy, M., Franklin, A., Di Meo, F., Kozlowski,
M. T., Winston, R., and Arnold, R. R. (2008a). NF-{kappa}B
Signaling, Elastase Localization, and Phagocytosis Differ in HIV-1
Permissive and Nonpermissive U937 Clones. The Journal of Immunology
180, 492-499. [0178] Bristow, C. L., Wolkowicz, R., Trucy, M.,
Franklin, A., Di Meo, F., Kozlowski, M. T., Winston, R., and
Arnold, R. R. (2008c). NF-{kappa}B Signaling, Elastase
Localization, and Phagocytosis Differ in HIV-1 Permissive and
Nonpermissive U937 Clones. The Journal of Immunology 180, 492-499.
[0179] Bristow, C. L., Wolkowicz, R., Trucy, M., Franklin, A., Di
Meo, F., Kozlowski, M. T., Winston, R., and Arnold, R. R. (2008e).
NF-.kappa.B Signaling, Elastase Localization, and Phagocytosis
Differ in HIV-1 Permissive and Nonpermissive U937 Clones. J.
Immunol. 180, 492-499. [0180] Cao, C., Lawrence, D. A., Li, Y., Von
Amin, C. A., Herz, J., Su, E. J., Makarova, A., Hyman, B. T.,
Strickland, D. K., and Zhang, L. (2006). Endocytic receptor LRP
together with tPA and PAI-1 coordinates Mac-1-dependent macrophage
migration. EMBO J. 25, 1860-1870. [0181] Courtney, M., Buchwalder,
A., Tessier, L.-H. J. M., Benavente, A., Balland, A., Kohli, V.,
Lathe, R., Tolstoshev, P., and Lecocq, J. P. (1984). High-level
production of biologically active human .alpha.1-antitrypsin in
Escherichia coli. Proc Natl Acad Sci; USA 81, 669-673. [0182]
Cselenyi, C. S., Jernigan, K. K., Tahinci, E., Thorne, C. A., Lee,
L. A., and Lee, E. (2008). LRP6 transduces a canonical Wnt signal
independently of Axin degradation by inhibiting GSK3's
phosphorylation of + -catenin. PNAS. 105, 8032-8037. [0183] Current
Protocols in Molecular Biology (2002). Greene Publishing Associates
and Wiley-Intersciences, New York). [0184] Czekay, R. P., Orlando,
R. A., Woodward, L., Lundstrom, M., and Farquhar, M. G. (1997).
Endocytic trafficking of megalin/RAP complexes: dissociation of the
complexes in late endosomes. Molecular Biology of the Cell 8,
517-532. [0185] Dichtl, W., Moraga, F., Ares, M. P. S., Crisby, M.,
Nils son, J., Lindgren, S., and Janciauskiene, S. (2000). The
Carboxyl-Terminal Fragment of [alpha]1-Antitrypsin Is Present in
Atherosclerotic Plaques and Regulates Inflammatory Transcription
Factors in Primary Human Monocytes. Molecular Cell Biology Research
Communications 4, 50-61. [0186] Elliott, P. R., Pei, X. Y.,
Dafform, T. R., and Lomas, D. A. (2000). Topography of a 2.0 A
structure of alph.alpha.1-antitrypsin reveals targets for rational
drug design to prevent conformational disease [In Process
Citation]. Protein Sci 9, 1274-1281. [0187] Fields, G. B. and
Noble, R. L. (1990). Solid phase peptide synthesis utilizing
9-fluorenylmethoxycarbonyl amino acids. Int J Pept Protein Res. 35,
161-214. [0188] Frank, I., Piatak, M. J., Stoessel, H., Romani, N.,
Bonnyay, D., Lifson, J. D., and Pope, M. (2002). Infectious and
whole inactivated simian immunodeficiency viruses interact
similarly with primate dendritic cells (DCs): differential
intracellular fate of virions in mature and immature DCs. J. Virol.
76, 2936-2951. [0189] Franzoso, G., Biswas, P., Poli, G., Carlson,
L. M., Brown, K. D., Tomita-Yamaguchi, M., Fauci, A. S., and
Siebenlist, U. K. (1994). A family of serine proteases expressed
exclusively in myelo-monocytic cells specifically processes the
nuclear factor-kappa B subunit p65 in vitro and may impair human
immunodeficiency virus replication in these cells. J. Exp. Med. 94,
1445-1456. [0190] Goselink, H. M., van Damme, J., Hiemstra, P. S.,
Wuyts, A., Stolk, J., Fibbe, W. E., Willemze, R., and Falkenburg,
J. H. (1996). Colony growth of human hematopoietic progenitor cells
in the absence of serum is supported by a proteinase inhibitor
identified as antileukoproteinase. J. Exp. Med. 184, 1305-1312.
[0191] Janciauskiene, S, and Lindgren, S. (1999). Effects of
fibrillar C-terminal fragment of cleaved alph.alpha.1-antitrypsin
on cholesterol homeostasis in HepG2 cells. Hepatology 29, 434-442.
[0192] Janciauskiene, S., Wright, H. T., and Lindgren, S. (1999a).
Atherogenic properties of human monocytes induced by the carboxyl
terminal proteolytic fragment of alpha-1-antitrypsin.
Atherosclerosis 147, 263-275. [0193] Janciauskiene, S., Wright, H.
T., and Lindgren, S. (1999b). Atherogenic properties of human
monocytes induced by the carboxyl terminal proteolytic fragment of
alpha-1-antitryp sin. Atherosclerosis 147, 263-275. [0194]
Janciauskiene, S., Moraga, F., and Lindgren, S. (2001). C-terminal
fragment of [alpha]1-antitrypsin activates human monocytes to a
pro-inflammatory state through interactions with the CD36 scavenger
receptor and LDL receptor. Atherosclerosis 158, 41-51. [0195] Jean,
F., Stella, K., Thomas, L., Lui, G., Xiang, Y., and Reason, A. J.
(1998). .alpha.1-antitrypsin Portland, a bioengineered serpin
highly selective for furin: Application as an antipathogenic agent.
Proc Natl Acad Sci; USA 95, 7293-7298. [0196] Jeppsson, J. O.,
Lilja, H., and Johansson, M. (1985). Isolation and characterization
of two minor fractions of alpha 1-antitrypsin by high-performance
liquid chromatographic chromatofocusing. J. Chromatogr. 327,
173-177. [0197] Joslin, G., Griffin, G. L., August, A. M., Adams,
S., Fallon, R. J., Senior, R. M., and Perlmutter, D. H. (1992). The
serpin-enzyme complex (SEC) receptor mediates the neutrophil
chemotactic effect of .alpha.-.sub.1antitrypsin-elastase complexes
and amyloid-13 peptide. J. Clin. Invest. 90, 1150-1154. [0198]
Kindzelskii, A. L. and Petty, H. R. (2003). Intracellular Calcium
Waves Accompany Neutrophil Polarization,
Formylmethionylleucylphenylalanine Stimulation, and Phagocytosis: A
High Speed Microscopy Study. J. Immunol. 170, 64-72. [0199]
Kounnas, M. Z., Church, F. C., Argraves, W. S., and Strickland, D.
K. (1996). Cellular internalization and degradation of antithrombin
III-thrombin, heparin cofactor II-thrombin, and alpha
1-antitrypsin-trypsin complexes is mediated by the low density
lipoprotein receptor-related protein. J. Biol. Chem. 271,
6523-6529. [0200] Kushner, I. (1982). The phenomenon of the acute
phase response. Ann. N.Y. Acad. Sci. 389, 39-47. [0201] Lapidot, T.
and Petit, I. (2002). Current understanding of stem cell
mobilization: The roles of chemokines, proteolytic enzymes,
adhesion molecules, cytokines, and stromal cells. Exp. Hematol. 30,
973-981. [0202] Marlovits, T. C., Abrahamsberg, C., and Blaas, D.
(1998). Very-Low-Density Lipoprotein Receptor Fragment Shed from
HeLa Cells Inhibits Human Rhinovirus Infection. J. Virol. 72,
10246-10250. [0203] Mellet, P., Boudier, C., Mely, Y., and Bieth,
J. G. (1998). Stopped Flow Fluorescence Energy Transfer Measurement
of the Rate Constants Describing the Reversible Formation and the
Irreversible Rearrangement of the Elastase-alpha 1-Proteinase
Inhibitor Complex. Journal of Biological Chemistry 273, 9119-9123.
[0204] Messmer, D., Jacque, J. M., Santisteban, C., Bristow, C. L.,
Han, S. Y., Villamide-Herrera, L., Mehlhop, E. R., Marx, P. A.,
Steinman, R. M., Gettie, A., and Pope, M. (2002a). Endogenously
expressed nef uncouples cytokine and chemokine production from
membrane phenotypic maturation in dendritic cells. J. Immunol. 169,
4172-4182. [0205] Messmer, D., Jacque, J.-M., Santisteban, C.,
Bristow, C. L., Han, S.-Y., Villamide-Herrera, L., Mehlhop, E. R.,
Marx, P. A., Steinman, R. M., Gettie, A., and Pope, M. (2002b).
Endogenously expressed nef uncouples cytokine and chemokine
production from membrane phenotypic maturation in dendritic cells.
J. Immunol. 169, 4172-4182. [0206] Misra, U. K. and Pizzo, S. V.
(2001). Receptor-Associated Protein Binding Blocks Ubiquitinylation
of the Low Density Lipoprotein Receptor-Related Protein. Arch.
Biochem. Biophys. 396, 106-110. [0207] Nukiwa, T., Satoh, K.,
Brantly, M. L., Ogushi, F., Fells, G. A., Courtney, M., and
Crystal, R. G. (1986). Identification of a second mutation in the
protein-coding sequence of the Z type alpha 1-antitrypsin gene. J.
Biol. Chem. 261, 15989-15994. [0208] OMIM. Online Mendelian
Inheritance in Man, OMIM (TM). McKusick-Nathans Institute for
Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and
National Center for Biotechnology Information, National Library of
Medicine (Bethesda, Md.). 2000. Ref Type: Data File [0209] Parfrey,
H., Mahadeva, R., Ravenhill, N. A., Zhou, A., Dafform, T. R.,
Foreman, R. C., and Lomas, D. A. (2003). Targeting a surface cavity
of .alpha..sub.1-antitrypsin to prevent conformational disease. J.
Biol. Chem. 278, 33060-33066. [0210] Perkins, S. J., Smith, K. F.,
Nealis, A. S., Haris, P. I., Chapman, D., Bauer, C. J., and
Harrison, R. A. (1992). Secondary structure changes stabilize the
reactive-centre cleaved form of SERPINs. J. Mol. Biol. 228,
1235-1254. [0211] Poller, W., Willnow, T. E., Hilpert, J., and
Herz, J. (1995). Differential recognition of alpha
1-antitrypsin-elastase and alpha 1-antichymotrypsin-cathepsin-G
complexes by the low density lipoprotein receptor-related protein.
J. Biol. Chem. 270, 2841-2845. [0212] Robert, J., Ramanayake, T.,
Maniero, G. D., Morales, H., and Chida, A. S. (2008). Phylogenetic
Conservation of Glycoprotein 96 Ability to Interact with CD91 and
Facilitate Antigen Cross-Presentation. The Journal of Immunology
180, 3176-3182. [0213] Rodenburg, K. W., Kjoller, L., Petersen, H.
H., and Andreasen, P. A. (1998). Binding of urokinase-type
plasminogen activator-plasminogen activator inhibitor-1 complex to
the endocytosis receptors alpha2-macroglobulin receptor/low-density
lipoprotein receptor-related protein and very-low-density
lipoprotein receptor involves basic residues in the inhibitor.
Biochemical Journal 329, 55-63. [0214] Rossio, J. L., Esser, M. T.,
Suryanarayana, K., Schneider, D. K., Bess, J. W., Jr., Vasquez, G.
M., Wiltrout, T. A., Chertova, E., Grimes, M. K., Sattentau, Q.,
Arthur, L. O., Henderson, L. E., and Lifson, J. D. (1998).
Inactivation of human immunodeficiency virus type 1 infectivity
with preservation of conformational and functional integrity of
virion surface proteins. J. Virol. 72, 7992-8001. [0215] Shulman,
Z., Shinder, V., Klein, E., Grabovsky, V., Yeger, O., Geron, E.,
Montresor, A., Bolomini-Vittori, M., Feigelson, S. W., Kirchhausen,
T., Laudanna, C., Shakhar, G., and Alon, R. (2009). Lymphocyte
Crawling and Transendothelial Migration Require Chemokine
Triggering of High-Affinity LFA-1 Integrin. Immunity 30, 384-396.
[0216] Sifers, R. N., Brashears-Macatee, S., Kidd, V. J., Muensch,
H., and Woo, S. L. (1988). A frameshift mutation results in a
truncated alpha 1-antitrypsin that is retained within the rough
endoplasmic reticulum. Journal of Biological Chemistry 263,
7330-7335. [0217] Terashima, M., Murai, T., Kawamura, M.,
Nakanishi, S., Stoltz, T., Chen, L., Drohan, W., Rodriguez, R. L.,
and Katoh, S. (1999). Production of functional human cd-antitrypsin
by plant cell culture. Appl Microbiol Biotechnol 52, 516-523.
[0218] Weaver, A. M., Hussaini, I. M., Mazar, A., Henkin, J., and
Gonias, S. L. (1997). Embryonic Fibroblasts That Are Genetically
Deficient in Low Density Lipoprotein Receptor-related Protein
Demonstrate Increased Activity of the Urokinase Receptor System and
Accelerated Migration on Vitronectin. Journal of Biological
Chemistry 272, 14372-14379.
[0219] Wright, S. D. and Meyer, B. C. (1986). Phorbol esters cause
sequential activation and deactivation of complement receptors on
polymorphonuclear leukocytes. J. Immunol. 136, 1759-1764. [0220]
Zhadina, M., McClure, M. O., Johnson, M. C., and Bieniasz, P. D.
(2007). Ubiquitin-dependent virus particle budding without viral
protein ubiquitination. PNAS. 104, 20031-20036.
REFERENCES
[0220] [0221] 1. Mu, H. & Hoy, C.-E. The digestion of dietary
triacylglycerols. Prog. Lipid Res. 43, 105-133 (2004). [0222] 2.
Spijkers, P. P. E. M. et al. LDL-receptor-related protein regulates
{beta}2-integrin-mediated leukocyte adhesion. Blood 105, 170-177
(2005). [0223] 3. Mantuano, E., Jo, M., Gonias, S. L. &
Campana, W. M. Low Density Lipoprotein Receptor-related Protein
(LRP1) Regulates Rac1 and RhoA Reciprocally to Control Schwann Cell
Adhesion and Migration. J. Biol. Chem. 285, 14259-14266 (2010).
[0224] 4. Strickland, D. K., Gonias, S. L. & Argraves, W. S.
Diverse roles for the LDL receptor family. Trends Endocrinol.
Metab. 13, 66-74 (2002). [0225] 5. Bangalore, N. & Travis, J.
Comparison of properties of membrane bound versus soluble forms of
human leukocytic elastase and cathepsin G. Biol. Chem.
Hoppe-Seyler. 375, 659-666 (1994). [0226] 6. Bristow, C. L. et al.
NF-.kappa.B Signaling, Elastase Localization, and Phagocytosis
Differ in HIV-1 Permissive and Nonpermissive U937 Clones. J.
Immunol. 180, 492-499 (2008). [0227] 7. Cao, C. et al. Endocytic
receptor LRP together with tPA and PAI-1 coordinates
Mac-1-dependent macrophage migration. EMBO J. 25, 1860-1870 (2006).
[0228] 8. Bristow, C. L., Mercatante, D. R. & Kole, R. HIV-1
preferentially binds receptors co-patched with cell surface
elastase. Blood 102, 4479-4486 (2003). [0229] 9. Clark, A. J. The
Mode of Action of Drugs on Cells. E. Arnold and Co., London (1933).
[0230] 10. Shulman, Z. et al. Lymphocyte Crawling and
Transendothelial Migration Require Chemokine Triggering of
High-Affinity LFA-1 Integrin. Immunity 30, 384-396 (2009). [0231]
11. Kounnas, M. Z., Church, F. C., Argraves, W. S. &
Strickland, D. K. Cellular internalization and degradation of
antithrombin III-thrombin, heparin cofactor II-thrombin, and alpha
1-antitrypsin-trypsin complexes is mediated by the low density
lipoprotein receptor-related protein. J. Biol. Chem. 271, 6523-6529
(1996). [0232] 12. Janciauskiene, S., Moraga, F. & Lindgren, S.
C-terminal fragment of [alpha]1-antitrypsin activates human
monocytes to a pro-inflammatory state through interactions with the
CD36 scavenger receptor and LDL receptor. Atherosclerosis 158,
41-51 (2001). [0233] 13. Weaver, A. M., Lysiak, J. J. & Gonias,
S. L. LDL receptor family-dependent and -independent pathways for
the internalization and digestion of lipoprotein lipase-associated
beta-VLDL by rat vascular smooth muscle cells. J. Lipid Res. 38,
1841-1850 (1997). [0234] 14. Bristow, C. L., Patel, H. &
Arnold, R. R. Self antigen prognostic for human immunodeficiency
virus disease progression. Clin Diagn. Lab. Immunol. 8, 937-942
(2001). [0235] 15. Bristow, C. L. et al. Soluble Factors Mediating
Innate Immune Responses to HIV Infection. Alfano, M. (ed.), pp.
102-110 (Bentham Science Publishers, 2010). [0236] 16. Bristow, C.
L., di Meo, F. & Arnold, R. R. Specific activity of
.alpha.1proteinase inhibitor and .alpha.2macroglobulin in human
serum: Application to insulin-dependent diabetes mellitus. Clin.
Immunol. Immunopathol. 89, 247-259 (1998). [0237] 17.
Janciauskiene, S., Lindgren, S. & Wright, H. T. The C-terminal
peptide of .alpha.-1-antitrypsin increases low density lipoprotein
binding in HepG2 cells. Eur. J. Biochem. 254, 460-467 (1998).
[0238] 18. Hansson, G. Inflammatory mechanisms in atherosclerosis.
J. Thromb. Haemost. 7, 328-331 (2009). [0239] 19. Talmud, P. J. et
al. Progression of Atherosclerosis Is Associated With Variation in
the {alpha}1-Antitrypsin Gene. Arterioscler Thromb Vasc Biol 23,
644-649 (2003). [0240] 20. Benitez, S., Bancells, C.,
Ordonez-Llanos, J. & Sanchez-Quesada, J. L. Pro-inflammatory
action of LDL(-) on mononuclear cells is counteracted by increased
IL10 production. Biochim Biophys Acta 1771, 613-622 (2007). [0241]
21. Purnell, J. Q. et al. Effect of ritonavir on lipids and
post-heparin lipase activities in normal subjects. AIDS 14, 51-57
(2000). [0242] 22. Stockley, R. A., Shaw, J., Afford, S. C.,
Morrison, H. M. & Burnett, D. Effect of alpha-1-proteinase
inhibitor on neutrophil chemotaxis. Am. J. Respir. Cell Mol. Biol.
2, 163-170 (1990). [0243] 23. Frank, I. et al. Infectious and whole
inactivated simian immunodeficiency viruses interact similarly with
primate dendritic cells (DCs): differential intracellular fate of
virions in mature and immature DCs. J. Virol. 76, 2936-2951 (2002).
[0244] 24. Wen, W., Chen, S., Cao, Y., Zhu, Y. & Yamamoto, Y.
HIV-1 infection initiates changes in the expression of a wide array
of genes in U937 promonocytes and HUT78 T cells. Virus Res. 113,
26-35 (2005). [0245] 25. Bristow, C. L., Fiscus, S. A., Flood, P.
M. & Arnold, R. R. Inhibition of HIV-1 by modification of a
host membrane protease. Int. Immunol. 7, 239-249 (1995). [0246] 26.
Shapiro, L., Pott, G. B. & Ralston, A. H. Alpha-1-antitrypsin
inhibits human immunodeficiency virus type 1. FASEB J. 15, 115-122
(2001). [0247] 27. Munch, J. et al. Discovery and Optimization of a
Natural HIV-1 Entry Inhibitor Targeting the gp41 Fusion Peptide.
Cell 129, 263-275 (2007). [0248] 28. Hussaini I M et al. Stable
antisense RNA expression neutralizes the activity of low-density
lipoprotein receptor-related protein and promotes urokinase
accumulation in the medium of an astrocytic tumor cell line.
Antisense Nucleic Acid Drug Dev. 9, 183-190 (1999). [0249] 29.
Rossio, J. L. et al. Inactivation of human immunodeficiency virus
type 1 infectivity with preservation of conformational and
functional integrity of virion surface proteins. J. Virol. 72,
7992-8001 (1998). [0250] 30. Arthos, J. et al. Biochemical and
biological characterization of a dodecameric CD4-Ig fusion protein.
J. Biol. Chem. 277, 11456-11464 (2002).
Sequence CWU 1
1
111417PRTHomo sapiens 1Met Pro Ser Ser Val Ser Trp Gly Ile Leu Leu
Leu Ala Gly Leu Cys 1 5 10 15 Cys Leu Val Pro Val Ser Leu Ala Glu
Asp Pro Gln Gly Asp Ala Ala 20 25 30 Gln Lys Thr Asp Thr Ser His
His Asp Gln Asp His Pro Thr Phe Asn 35 40 45 Lys Ile Thr Pro Asn
Leu Ala Glu Phe Ala Phe Ser Tyr Arg Gln Leu 50 55 60 Ala His Gln
Ser Asn Ser Thr Asn Ile Phe Phe Ser Pro Val Ser Ile 65 70 75 80Ala
Thr Ala Phe Ala Met Leu Ser Leu Gly Thr Lys Ala Asp Thr His 85 90
95 Asp Glu Ile Leu Glu Gly Leu Asn Phe Asn Leu Thr Glu Ile Pro Glu
100 105 110 Ala Gln Ile His Glu Gly Phe Gln Glu Leu Leu Arg Thr Leu
Asn Gln 115 120 125 Pro Asp Ser Gln Leu Gln Leu Thr Thr Gly Asn Gly
Leu Phe Leu Ser 130 135 140 Glu Gly Leu Lys Leu Val Asp Lys Phe Leu
Glu Asp Val Lys Lys Leu 145 150 155 160Tyr His Ser Glu Ala Phe Thr
Val Asn Phe Gly Asp Thr Glu Glu Ala 165 170 175 Lys Lys Gln Ile Asn
Asp Tyr Val Glu Lys Gly Thr Gln Gly Lys Ile 180 185 190 Val Asp Leu
Val Lys Glu Leu Asp Arg Asp Thr Val Phe Ala Leu Val 195 200 205 Asn
Tyr Ile Phe Phe Lys Gly Lys Trp Glu Arg Pro Phe Glu Val Lys 210 215
220 Asp Thr Glu Glu Glu Asp Phe His Val Asp Gln Val Thr Thr Val Lys
225 230 235 240Val Pro Met Met Lys Arg Leu Gly Met Phe Asn Ile Gln
His Cys Lys 245 250 255 Lys Leu Ser Ser Trp Val Leu Leu Met Lys Tyr
Leu Gly Asn Ala Thr 260 265 270 Ala Ile Phe Phe Leu Pro Asp Glu Gly
Lys Leu Gln His Leu Glu Asn 275 280 285 Glu Leu Thr His Asp Ile Ile
Thr Lys Phe Leu Glu Asn Glu Asp Arg 290 295 300 Arg Ser Ala Ser Leu
His Leu Pro Lys Leu Ser Ile Thr Gly Thr Tyr 305 310 315 320Asp Leu
Lys Ser Val Leu Gly Gln Leu Gly Ile Thr Lys Val Phe Ser 325 330 335
Asn Gly Ala Asp Leu Ser Gly Val Thr Glu Glu Ala Pro Leu Lys Leu 340
345 350 Ser Lys Ala Val His Lys Ala Val Leu Thr Ile Asp Glu Lys Gly
Thr 355 360 365 Glu Ala Ala Gly Ala Met Phe Leu Glu Ala Ile Pro Met
Ser Ile Pro 370 375 380 Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe
Leu Met Ile Glu Gln 385 390 395 400Asn Thr Lys Ser Pro Leu Phe Met
Gly Lys Val Val Asn Pro Thr Gln 405 410 415 Lys 238PRTHomo sapiens
2Pro Met Ser Ile Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Phe 1
5 10 15 Leu Met Ile Glu Gln Asn Thr Lys Ser Pro Leu Phe Met Gly Lys
Val 20 25 30 Val Asn Pro Thr Gln Lys 35 35PRTHomo sapiens 3Pro Met
Ser Ile Pro 1 5411PRTHomo sapiens 4Ser Ile Pro Pro Glu Val Lys Phe
Asn Lys Pro 1 5 10 529DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 5gaggatcccc agggagatgc
tgcccagaa 29634DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 6cgcgctcgag ttatttttgg gtgggattca ccac
34730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7gcttgacctg taactcgggc caggcgagct
30830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8cgcctagccc gagttacagg tcaagcagct
30942DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9ctagaggatc ccatggacta caaggacgac
gatgacaagg aa 421042DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 10gatcttcctt gtcatcgtcg
tccttgtagt ccatgggatc ct 42115PRTHomo sapiens 11Phe Val Phe Leu Met
1 5
* * * * *