U.S. patent application number 13/837137 was filed with the patent office on 2013-12-26 for 2,4- diaminopyrimidine derivatives.
This patent application is currently assigned to NOVARTIS AG. The applicant listed for this patent is Novartis AG. Invention is credited to Rolf BAENTELI, Nigel Graham COOKE, Rudolf DUTHALER, Klaus HINTERDING, Toshiyuki HONDA, Naoko MATSUURA, Kazuhiko NONOMURA, Osamu OHMORI, Christos PAPAGEORGIOU, Gebhard THOMA, Ichiro UMEMURA, Anette VON MATT, Gerhard ZENKE.
Application Number | 20130345180 13/837137 |
Document ID | / |
Family ID | 9933092 |
Filed Date | 2013-12-26 |
United States Patent
Application |
20130345180 |
Kind Code |
A1 |
BAENTELI; Rolf ; et
al. |
December 26, 2013 |
2,4- DIAMINOPYRIMIDINE DERIVATIVES
Abstract
There are provided compounds of formula I ##STR00001## wherein
X, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8 and R.sup.9 are as indicated in claim 1, useful in
disorders where ZAP-70 and/or Syk inhibition plays a role or caused
by a malfunction of signal cascades connected with FAK.
Inventors: |
BAENTELI; Rolf; (Basel,
CH) ; ZENKE; Gerhard; (Rheinfelden, DE) ;
COOKE; Nigel Graham; (Oberwil, CH) ; DUTHALER;
Rudolf; (Bettingen, CH) ; THOMA; Gebhard;
(Lorrach, DE) ; VON MATT; Anette; (Biel-Benken,
CH) ; HONDA; Toshiyuki; (Tsukuba-shi, JP) ;
MATSUURA; Naoko; (Tsukuba-shi, JP) ; NONOMURA;
Kazuhiko; (Tsukuba-shi, JP) ; OHMORI; Osamu;
(Tsukuba-shi, JP) ; UMEMURA; Ichiro; (Tsukuba-shi,
JP) ; HINTERDING; Klaus; (Wittlingen, DE) ;
PAPAGEORGIOU; Christos; (Riedisheim, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novartis AG; |
|
|
US |
|
|
Assignee: |
NOVARTIS AG
BASEL
CH
|
Family ID: |
9933092 |
Appl. No.: |
13/837137 |
Filed: |
March 15, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13069816 |
Mar 23, 2011 |
8431589 |
|
|
13837137 |
|
|
|
|
10507060 |
Jun 13, 2005 |
7943627 |
|
|
PCT/EP03/02710 |
Mar 14, 2003 |
|
|
|
13069816 |
|
|
|
|
Current U.S.
Class: |
514/157 ;
514/217.06; 514/235.8; 514/252.14; 514/275; 540/601; 544/122;
544/295; 544/323; 544/324 |
Current CPC
Class: |
C07D 401/14 20130101;
A61P 31/04 20180101; A61P 35/00 20180101; A61P 35/02 20180101; A61P
9/14 20180101; A61P 13/12 20180101; A61P 31/18 20180101; C07D
249/08 20130101; A61P 1/04 20180101; C07D 401/12 20130101; A61K
31/506 20130101; A61P 35/04 20180101; A61P 9/04 20180101; A61P
17/02 20180101; C07D 403/12 20130101; A61P 17/06 20180101; A61P
17/08 20180101; C07D 233/56 20130101; C07D 239/48 20130101; C07D
417/12 20130101; A61K 31/505 20130101; A61P 21/04 20180101; A61K
31/5377 20130101; A61P 3/10 20180101; A61P 11/00 20180101; A61P
11/16 20180101; A61P 9/12 20180101; A61P 19/02 20180101; A61P 5/14
20180101; A61P 17/00 20180101; A61P 27/02 20180101; A61K 45/06
20130101; A61P 25/28 20180101; A61P 9/10 20180101; A61K 31/55
20130101; A61P 37/06 20180101; A61P 1/16 20180101; A61P 31/00
20180101; C07D 231/12 20130101; A61P 37/00 20180101; A61P 11/06
20180101; A61P 43/00 20180101; A61P 9/00 20180101; A61P 25/00
20180101; A61P 29/00 20180101 |
Class at
Publication: |
514/157 ;
514/275; 544/324; 544/323; 540/601; 514/217.06; 544/122; 514/235.8;
544/295; 514/252.14 |
International
Class: |
C07D 239/48 20060101
C07D239/48; A61K 31/506 20060101 A61K031/506; C07D 403/12 20060101
C07D403/12; C07D 401/12 20060101 C07D401/12; A61K 31/55 20060101
A61K031/55; A61K 31/5377 20060101 A61K031/5377; C07D 417/12
20060101 C07D417/12; A61K 45/06 20060101 A61K045/06; A61K 31/505
20060101 A61K031/505 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 15, 2002 |
GB |
0206215.6 |
Claims
1-10. (canceled)
11. A compound of formula I ##STR00025## wherein X is
.dbd.CR.sup.0--; R.sup.0 is hydrogen; R.sup.2 is
--SO.sub.2N(R.sup.10)R.sup.11; each of R.sup.1 and R.sup.3
independently is hydrogen; hydroxy; C.sub.1-C.sub.8alkyl;
C.sub.2-C.sub.8alkenyl; C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkyl-C.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
arylC.sub.1-C.sub.8alkyl which optionally may be substituted on the
ring by hydroxy, C.sub.1-C.sub.8alkoxy, carboxy or
C.sub.1-C.sub.8alkoxycarbonyl; or each of R.sup.1 and R.sup.3,
independently, is halogen; halo-C.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxy; halo-C.sub.1-C.sub.8alkoxy;
hydroxyC.sub.1-C.sub.8alkoxy;
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkoxy; aryl;
arylC.sub.1-C.sub.8alkoxy; heteroaryl;
heteroaryl-C.sub.1-C.sub.4alkyl; 5 to 10 membered heterocyclic
ring; nitro; carboxy; C.sub.2-C.sub.8alkoxycarbonyl;
C.sub.2-C.sub.8alkylcarbonyl;
--N(C.sub.1-C.sub.8alkyl)C(O)C.sub.1-C.sub.8alkyl;
--N(R.sup.10)R.sup.11; --CON(R.sup.10)R.sup.11;
or)-C.sub.1-C.sub.4-alkylene-SO.sub.2N(R.sup.10)R.sup.11; wherein
each of R.sup.10 and R.sup.11 independently is hydrogen; hydroxy;
C.sub.1-C.sub.8alkyl; C.sub.2-C.sub.8alkenyl;
C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkyl-C.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkyl; (C.sub.1-C.sub.8alkyl)-carbonyl;
arylC.sub.1-C.sub.8alkyl which optionally may be substituted on the
ring by hydroxy, C.sub.1-C.sub.8alkoxy, carboxy or
C.sub.2-C.sub.8alkoxycarbonyl; or 5 to 10 membered heterocyclic
ring; R.sup.4 is hydrogen; R.sup.5 is hydrogen; halogen;
C.sub.1-4alkyl; or CF3; R.sup.6 is hydrogen; each of R.sup.7,
R.sup.8 and R.sup.9 is independently hydrogen; hydroxy;
C.sub.1-C.sub.8alkyl; C.sub.2-C.sub.8alkenyl;
halo-C.sub.1-C.sub.8alkyl; C.sub.1-C.sub.8alkoxy;
C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkylC.sub.1-C.sub.8alkyl;
arylC.sub.1-C.sub.8alkyl; --Y--R.sup.12 wherein Y is a direct bond
or O and R.sup.12 is a substituted or unsubstituted 5, 6 or 7
membered heterocyclic ring comprising 1, 2 or 3 heteroatoms
selected from N, O and S; carboxy;
(C.sub.1-C.sub.8alkoxy)-carbonyl;
--N(C.sub.1-8alkyl)-CO--NR.sup.10R.sup.11; --CONR.sup.10R.sup.11;
--N(R.sup.10)(R.sup.11); --SO.sub.2N(R.sup.10)R.sup.11; R.sup.7 and
R.sup.8 or R.sup.8 and R.sup.9, respectively form together with the
carbon atoms to which they are attached, a 5 or 6 membered
heteroaryl comprising 1, 2 or 3 heteroatoms selected from N, O and
S; or a 5 or 6 membered carbocyclic ring; wherein any alkyl,
alkoxy, alkenyl, cycloalkyl, heterocyclic ring, aryl or heteroaryl
may be unsubstituted or substituted by one or more substituents
selected from halogen; OH; C.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxy; nitro; cyano; COOH; carbamoyl;
C(NH.sub.2).dbd.NOH; --N(R.sup.10)R.sup.11;
C.sub.3-C.sub.6cycloalkyl; 3 to 7 membered heterocyclic ring;
phenyl; phenyl-C.sub.1-4alkyl; 5 or 6 membered heteroaryl; in free
form or salt form.
12. A compound according to claim 11 wherein at most one of R.sup.1
or R.sup.3 is --CON(R.sup.10)R.sup.11.
13. A compound according to claim 11 which is a compound of formula
X.sub.4 ##STR00026## wherein R.sup.2, R.sup.5, R.sup.7, R.sup.8 and
R.sup.9 are as defined in claim 11.
14. A process for the production of a compound of formula I
according to claim 11, comprising the steps of reacting a compound
of formula II ##STR00027## wherein R.sup.1, R.sup.2, R.sup.3,
R.sup.4, R.sup.5, R.sup.6 and X are as defined in claim 11, and Y
is a leaving group; with a compound of formula III ##STR00028##
wherein R.sup.7, R.sup.8 and R.sup.9 are as defined in claim 11;
and recovering the resulting compound of formula I in free form or
in salt form, and, where required, converting the compound of
formula I obtained in free form into the desired salt form, or vice
versa.
15. A compound according to claim 11 in free form or in
pharmaceutically acceptable salt form, for use as a
pharmaceutical.
16. A pharmaceutical composition comprising a compound of formula I
according to claim 11 or a pharmaceutically acceptable salt
thereof, together with one or more pharmaceutically acceptable
carriers or diluents therefor.
17. A method for the treatment or prevention of a disease or
condition in which ZAP-70, FAK and/or Syk tyrosine kinase
activation plays a role or is implicated, comprising administering
to a subject in need thereof a therapeutically effective amount of
a compound of formula I according to claim 11 in free form or in
pharmaceutically acceptable salt form.
18. A combination which comprises (a) a therapeutically effective
amount of a compound of formula I according to claim 11 as a
ZAP-70, FAK and/or Syk inhibitor and (b) a second drug
substance.
19. A combination which comprises (a) a therapeutically effective
amount of a compound of formula I according to claim 12 as a
ZAP-70, FAK and/or Syk inhibitor and (b) a second drug
substance.
20. A combination which comprises (a) a therapeutically effective
amount of a compound of formula I according to claim 13 as a
ZAP-70, FAK and/or Syk inhibitor and (b) a second drug substance.
Description
[0001] The present invention relates to pyrimidine derivatives, to
processes for their production, their use as pharmaceuticals and to
pharmaceutical compositions comprising them.
[0002] More particularly the present invention provides in a first
aspect, a compound of formula I
##STR00002##
wherein [0003] X is .dbd.CR.sup.0-- or .dbd.N--; [0004] each of
R.sup.0, R.sup.1, R.sup.2, R.sup.3 and R.sup.4 independently is
hydrogen; hydroxy; C.sub.1-C.sub.8alkyl; C.sub.2-C.sub.8alkenyl;
C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkyl-C.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
arylC.sub.1-C.sub.8alkyl which optionally may be substituted on the
ring by hydroxy, C.sub.1-C.sub.8alkoxy, carboxy or
C.sub.1-C.sub.8alkoxycarbonyl; [0005] or R.sup.3 and R.sup.4 form
together with the nitrogen and carbon atoms to which they are
attached a 5 to 10 membered heterocyclic ring and comprising
additionally 1, 2 or 3 heteroatoms selected from N, O and S; [0006]
or each of R.sup.1, R.sup.2 and R.sup.3, independently, is halogen;
halo-C.sub.1-C.sub.8alkyl; C.sub.1-C.sub.8alkoxy;
halo-C.sub.1-C.sub.8alkoxy; hydroxyC.sub.1-C.sub.8alkoxy;
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkoxy; aryl;
arylC.sub.1-C.sub.8alkoxy; heteroaryl;
heteroaryl-C.sub.1-C.sub.4alkyl; 5 to 10 membered heterocyclic
ring; nitro; carboxy; C.sub.2-C.sub.8alkoxycarbonyl;
C.sub.2-C.sub.8alkylcarbonyl;
--N(C.sub.1-C.sub.8alkyl)C(O)C.sub.1-C.sub.8alkyl;
--N(R.sup.10)R.sup.11; --CON(R.sup.10)R.sup.11;
--SO.sub.2N(R.sup.10)R.sup.11; or
--C.sub.1-C.sub.4-alkylene-SO.sub.2N(R.sup.10)R.sup.11; wherein
each of R.sup.10 and R.sup.11 independently is hydrogen; hydroxy;
C.sub.1-C.sub.8alkyl; C.sub.2-C.sub.8alkenyl;
C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkyl-C.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkoxyC.sub.1-C.sub.8alkyl;
hydroxyC.sub.1-C.sub.8alkyl; (C.sub.1-C.sub.8alkyl)-carbonyl;
arylC.sub.1-C.sub.8alkyl which optionally may be substituted on the
ring by hydroxy, C.sub.1-C.sub.8alkoxy, carboxy or
C.sub.2-C.sub.8alkoxycarbonyl; or 5 to 10 membered heterocyclic
ring; [0007] or R.sup.1 and R.sup.2 form together with the C-atoms
to which they are attached aryl or a 5 to 10 membered heteroaryl
residue comprising one or two heteroatoms selected from N, O and S;
or [0008] each of R.sup.5 and R.sup.6 independently is hydrogen;
halogen; cyano; C.sub.1-C.sub.8alkyl; halo-C.sub.1-C.sub.8alkyl;
C.sub.2-C.sub.8alkenyl; C.sub.2-C.sub.8alkynyl;
C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkylC.sub.1-C.sub.8alkyl;
C.sub.8-C.sub.10arylC.sub.1-C.sub.8alkyl; [0009] each of R.sup.7,
R.sup.8 and R.sup.9 is independently hydrogen; hydroxy;
C.sub.1-C.sub.8alkyl; C.sub.2-C.sub.8alkenyl;
halo-C.sub.1-C.sub.8alkyl; C.sub.1-C.sub.8alkoxy;
C.sub.3-C.sub.8cycloalkyl;
C.sub.3-C.sub.8cycloalkylC.sub.1-C.sub.8alkyl;
arylC.sub.1-C.sub.8alkyl; --Y--R.sup.12 wherein Y is a direct bond
or O and R.sup.12 is a substituted or unsubstituted 5, 6 or 7
membered heterocyclic ring comprising 1, 2 or 3 heteroatoms
selected from N, O and S; carboxy;
(C.sub.1-C.sub.8alkoxy)-carbonyl;
--N(C.sub.1-8alkyl)-CO--NR.sup.10R.sup.11; --CONR.sup.10R.sup.11;
--N(R.sup.10)(R.sup.11); --SO.sub.2N(R.sup.10)R.sup.11; or R.sup.7
and R.sup.8 or R.sup.8 and R.sup.9, respectively form together with
the carbon atoms to which they are attached, a 5 or 6 membered
heteroaryl comprising 1, 2 or 3 heteroatoms selected from N, O and
S; or a 5 or 6 membered carbocyclic ring. in free form or salt
form.
[0010] Any aryl may be phenyl, naphthyl or
1,2,3,4-tetrahydronaphthyl, preferably phenyl. Heteroaryl is an
aromatic heterocyclic ring, e.g. a 5 or 6 membered aromatic
heterocyclic ring, optionally condensed to 1 or 2 benzene rings
and/or to a further heterocylic ring.
[0011] Any heterocyclic ring may be saturated or unsaturated and
optionally condensed to 1 or 2 benzene rings and/or to a further
heterocyclic ring.
[0012] Examples of heterocyclic rings or heteroaryl include e.g.
morpholinyl, piperazinyl, piperidyl, pyrrolidinyl, pyridyl,
purinyl, pyrimidinyl, N-methyl-aza-cycloheptan-4-yl, indolyl,
quinolinyl, isoquinolinyl, 1,2,3,4-tetrahydroquinolinyl,
benzothiazolyl, thiazolyl, imidazolyl, benzimidazolyl,
benzoxadiazolyl, benzotriazolyl, indanyl, oxadiazolyl, pyrazolyl,
triazolyl, and tetrazolyl. Preferred heterocyclic rings or
heteroaryl are morpholinyl, piperazinyl, piperidyl, pyrrolidinyl,
pyridyl, N-methyl-aza-cycloheptan-4-yl, thiazolyl, imidazolyl and
tetrazolyl.
[0013] When R.sup.7 and R.sup.8 or R.sup.8 and R.sup.9 form
together with the carbon atoms to which they are attached a 5 or 6
membered carbocyclic ring, this may preferably be cyclopentyl or
cyclohexyl.
[0014] Halo-alkyl is alkyl wherein one or more H are replaced by
halogen, e.g. CF.sub.3.
[0015] Any alkyl or alkyl moiety may be linear or branched.
C.sub.1-8alkyl is preferably C.sub.1-4alkyl. C.sub.1-8alkoxy is
preferably C.sub.1-4alkoxy. Any alkyl, alkoxy, alkenyl, cycloalkyl,
heterocyclic ring, aryl or heteroaryl may be, unless otherwise
stated, unsubstituted or substituted by one or more substituents
selected from halogen; OH; C.sub.1-C.sub.8alkyl;
C.sub.1-C.sub.8alkoxy; nitro; cyano; COOH; carbamoyl;
C(NH.sub.2).dbd.NOH; --N(R.sup.10)R.sup.11;
C.sub.3-C.sub.6cycloalkyl; 3 to 7 membered heterocyclic ring;
phenyl; phenyl-C.sub.1-4alkyl; 5 or 6 membered heteroaryl. When
alkyl, alkoxy or alkenyl is substituted, the substituent is
preferably on the terminal C atom. When the heterocyclic ring or
heteroaryl is substituted, e.g. as disclosed above, this may be on
one or more ring carbon atoms and/or ring nitrogen atom when
present. Examples of a substituent on a ring nitrogen atom are e.g.
C.sub.1-8alkyl, carbamoyl, --C(NH.sub.2).dbd.NOH,
--NR.sup.10R.sup.11, C.sub.3-6cycloalkyl or phenyl-C.sub.1-4alkyl,
preferably C.sub.1-8alkyl, C.sub.3-6cycloalkyl or
phenyl-C.sub.1-4alkyl.
[0016] Preferably substituted alkyl or alkoxy as R.sub.7 is alkyl
or alkoxy substituted on the terminal C atom by OH, C.sub.1-4alkoxy
or a heterocyclic ring. When R.sup.10 or R.sup.11 is a 5 to 10
membered heterocyclic ring, it may be e.g. thiazolyl.
[0017] Halogen may be F, Cl, Br, or I.
[0018] Preferably at most one of R.sup.1, R.sup.2 or R.sup.3 is
CONR.sup.10R.sup.11 or SO.sub.2NR.sup.10R.sup.11, more preferably
SO.sub.2NR.sup.10R.sup.11.
[0019] The compounds of the invention may exist in free form or in
salt form, e.g. addition salts with e.g. organic or inorganic
acids, for example trifluoroacetic acid or hydrochloride acid, or
salts obtainable when they comprise a carboxy group, e.g. with a
base, for example alkali salts such as sodium, potassium, or
substituted or unsubstituted ammonium salts.
[0020] In formula I the following significances are preferred
independently, collectively or in any combination or
sub-combination: [0021] (a) X is .dbd.CR.sup.0; [0022] (b) R.sup.0
is hydrogen; halogen, e.g. Cl; C.sub.1-C.sub.4alkyl, e.g. methyl or
ethyl; C.sub.1-4alkoxy, e.g. methoxy; preferably hydrogen; [0023]
(c) R.sup.1 is hydrogen; halogen, e.g. Cl or F; OH;
C.sub.1-C.sub.8alkyl, e.g. methyl or ethyl; substituted
C.sub.1-8alkyl, e.g. terminally OH substituted C.sub.1-8alkyl;
--SO.sub.2N(R.sup.10)R.sup.11;
--N(C.sub.1-4alkyl)C(O)C.sub.1-4alkyl; a 5 or 6 membered
heterocyclic ring optionally substituted on a ring N atom (when
possible); C.sub.1-C.sub.8alkoxy, e.g. methoxy; aryl, e.g. phenyl;
or form together with R.sup.2 and the C-atoms to which R.sup.1 and
R.sup.2 are attached 5 to 10 membered aryl or heteroaryl, the
latter comprising 1 or 2 nitrogen atoms; [0024] (d) R.sup.2 is
hydrogen; hydroxy; C.sub.1-C.sub.8alkyl, e.g. methyl or ethyl;
substituted C.sub.1-8alkyl, e.g. terminally OH-- or
C.sub.1-4-alkoxy substituted C.sub.1-8alkyl; C.sub.1-8alkoxy;
C.sub.1-C.sub.4alkoxyC.sub.1-C.sub.8alkoxy;
--CON(R.sup.10)R.sup.11, --SO.sub.2N(R.sup.10)R.sup.11; or forms
together with R.sup.1 and the C-atoms to which R.sup.1 and R.sup.2
are attached a 5 to 10 membered aryl or heteroaryl, the latter
comprising 1 or 2 nitrogen atoms; [0025] (e) R.sup.3 is hydrogen;
halogen, e.g. Cl, Br; hydroxy; C.sub.1-C.sub.8alkyl, e.g. methyl or
ethyl; substituted C.sub.1-8alkyl, e.g. terminally OH substituted
C.sub.1-8alkyl; carboxy; CONR.sup.10R.sup.11;
--SO.sub.2N(R.sup.10)R.sup.11; a 5 or 6 membered heterocyclic ring
optionally substituted on a ring nitrogen atom (when possible); or
forms together with R.sup.4 and the N and C atoms to which R.sup.3
and R.sup.4 are attached a 6 membered heterocyclic ring; [0026] (f)
R.sup.4 is hydrogen; or forms together with R.sup.3 and the N and C
atoms to which R.sup.3 and R.sup.4 are attached a 6 membered
heterocyclic ring; preferably hydrogen; [0027] (g) R.sup.5 is
hydrogen; halogen; C.sub.1-4alkyl; or CF.sub.3; [0028] (h) R.sup.6
is hydrogen; [0029] (i) R.sup.7 is hydrogen; hydroxy;
C.sub.1-4alkyl; substituted C.sub.1-4alkyl, e.g. terminally OH
substituted C.sub.1-4alkyl; C.sub.1-8alkoxy; substituted
C.sub.1-8alkoxy, e.g. terminally substituted by OH, C.sub.1-4alkoxy
or a heterocyclic ring; NR.sup.10R.sup.11;
--SO.sub.2N(R.sup.10)R.sup.11; --Y--R.sup.12; CF.sub.3; or R.sup.7
forms together with R.sup.8 and the C-atoms to which R.sup.7 and
R.sup.8 are attached a 5 membered heteroaryl residue, e.g. bridged
by --NH--CH.dbd.CH--, --CH.dbd.CH--NH--, --NH--N.dbd.CH--,
--CH.dbd.N--NH--, --NH--N.dbd.N-- or --N.dbd.N--NH--; [0030] (k)
R.sup.8 is hydrogen; hydroxy; C.sub.1-4alkoxy; carboxy; a 5 or 6
membered heterocyclic ring optionally substituted on a ring C or N
atom; N(C.sub.1-4alkyl)-CO--NR.sup.10R.sup.11; or forms with
R.sup.7 or R.sup.9 and the C-atoms to which R.sup.7 and R.sup.8 or
Wand R.sup.9, respectively, are attached a 5 membered heteroaryl
residue, e.g. bridged by --NH--CH.dbd.CH--, --CH.dbd.CH--NH--,
--NH--N.dbd.CH--, --CH.dbd.N--NH--, --NH--N.dbd.N-- or
--N.dbd.N--NH--; [0031] (l) R.sup.9 is hydrogen; C.sub.1-4alkoxy;
NR.sup.10R.sup.11; or forms with R.sup.8 and the C atoms to which
R.sup.8 and R.sup.9 are attached a 5 membered heteroaryl, e.g.
bridged by --NH--CH.dbd.CH--, --CH.dbd.CH--NH--, --NH--N.dbd.CH--,
--CH.dbd.N--NH--, --NH--N.dbd.N-- or --N.dbd.N--NH--; [0032] (m)
one of R.sup.10 and R.sup.11, independently, is hydrogen or
C.sub.1-4alkyl and the other is hydrogen; OH; C.sub.1-8alkyl,
substituted C.sub.1-8alkyl, e.g. terminally substituted by OH,
C.sub.3-6cycloalkyl or a heterocyclic ring; C.sub.2-8alkenyl;
C.sub.3-8cycloalkyl; hydroxyC.sub.1-8alkoxyC.sub.1-8alkyl; or a 5
membered heterocyclic ring. [0033] R.sup.3 is preferably
SO.sub.2NR.sup.10R.sup.11.
[0034] The present invention also provides a process for the
production of a compound of formula I, comprising reacting a
compound of formula II
##STR00003##
wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6 and X
are as defined above, and Y is a leaving group, preferably halogen
such as bromide, iodine, or in particular chloride; with a compound
of formula III
##STR00004##
wherein R.sup.7, R.sup.8 and R.sup.9 are as defined above; and
recovering the resulting compound of formula I in free or in form
of a salt, and, where required, converting the compound of formula
I obtained in free form into the desired salt form, or vice
versa.
[0035] The process may be performed according to methods known in
the art, e.g. as described in examples 1 to 4.
[0036] The compound of formula II used as starting materials may be
obtained by reacting a compound of formula IV
##STR00005##
with a compound of formula V
##STR00006##
wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, Y and
X are as defined above.
[0037] The compounds of formula IV and V are known or may be
produced in accordance with known procedures.
[0038] The following examples illustrate the invention without any
limitation.
[0039] The following abbreviations are employed:
APC=allophycocyanine,
BINAP=2,2'-bis(diphenylphosphino)-1,1'-binaphthyl,
cDNA=complementary DNA, DCM=dichloromethane, DIAD=diisopropyl
azodicarboxylate, DMAP=4-dimethylaminopyridine,
DMF=dimethylformamide, DMSO=dimethylsulfoxide,
DMF=dimethylformamide; Pmc=2,2,5,7,8-pentamethylchroman;
tBu=tert.-butyl; DIPCDI=N,N'-diisopropylcarbodiimid;
DTT=1,4-dithio-D,L-treitol, DNA=deoxyribonucleic acid,
EDTA=ethylenediaminetetra-acetic acid, Lck=lymphoid T-cell protein
tyrosine kinase, LAT-11=linker for activation of T cell, RT=room
temperature; RT-PCR=reverse transcription polymerase chain
reaction, MS=molecular ion (e.g. M+H.sup.1+) determined by
electrospray mass spectroscopy; Eu=europium; ZAP-70=zeta
chain-associated protein of 70 kD; Syk=p72syk protein tyrosine
kinase; SA=streptavidin.
EXAMPLE 1
2-[2-(1H-Indazol-6-ylamino)-pyrimidin-4-ylamino]-benzenesulfonamide
##STR00007##
[0040] (a) 2-(2-Chloro-pyrimidin-4-ylamino)-benzenesulfonamide
[0041] To a suspension of 8.52 g (49.47 mmol)
2-aminobenzenesulfonamide in 200 ml isopropanol is added 22.1 g
(148.42 mmol, 3 equivalent) 2,4-dichloropyrimidine and 20 ml 10 M
hydrochloric acid (200 mmol, 4 equivalent). The suspension is
stirred at 60.degree. C. for 2 h 15 min. The reaction mixture is
diluted with 2 l ethyl acetate and 500 ml water is added. The pH is
adjusted to 8-9 by addition of sodium bicarbonate. The layers are
separated and the aqueous layer is reextracted with 500 ml ethyl
acetate. The organic layers are dried with sodium sulfate, filtered
and evaporated to a volume of 300 ml. A crystalline precipitate is
formed and removed by filtration (side product). The filtrate is
evaporated to 100 ml whereupon the product crystallizes to give
2-(2-chloro-pyrimidin-4-ylamino)-benzenesulfonamide (97% purity by
HPLC). The mother liquor of this cristallisation is further
purified by column chromatography and crystallisation to give
further 2-(2-chloro-pyrimidin-4-ylamino)-benzenesulfonamide.
(b)
2-[2-(1H-Indazol-6-ylamino)-pyrimidin-4-ylamino]-benzenesulfonamide
[0042] To a suspension of 7.25 g (25.46 mmol)
2-(2-Chloro-pyrimidin-4-ylamino)-benzenesulfonamide and 4.07 g
(30.55 mmol, 1.2 equivalent) 6-aminoindazole in 400 ml isopropanol
is added 13 ml conc. HCl* (130 mmol, 5 equivalent). The suspension
is refluxed for 4 h 30 min. The reaction mixture is diluted with
1.5 l ethyl acetate and 11 water is added. The pH is adjusted to
8-9 by addition of sodium bicarbonate. The layers are separated and
the aqueous layer is re-extracted with 500 ml ethyl acetate. The
organic layers are dried with sodium sulfate, filtered and
evaporated to a volume of 300 ml. A crystalline precipitate (1.01
g) is formed and removed by filtration (side product). The filtrate
is purified by chromatography on 200 g silica gel eluting with
ethyl acetate/methanol 95/5 v/v. Upon evaporation crystals are
formed which are filtered to give the title compound.
[0043] .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 9.42 (s, 1H),
8.34 (d, 1h), 8.28 (d, 1H), 8.27 (s, 1H), 7.93 (s, 1H, 7.88 (d,
1H), 7.62 (m, 2H), 7.32 (d, 1H), 7.24 (t, 1H), 6.40 (d, 1H).
[0044] MS m/z (%): 382 (M+H, 100);
EXAMPLE 2
2-[2-(3,4,5-Trimethoxy-phenylamino)-pyrimidin-4-ylamino]-benzenesulfonamid-
e
##STR00008##
[0046] The title compound is prepared from
2-(2-chloro-pyrimidin-4-ylamino)-benzenesulfonamide as described in
Example 1 using 3,4,5-Trimethoxy-phenylamine instead of
6-aminoindazole in step (b).
[0047] .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 9.18 (s, 1H),
8.22 (d, 1H), 8.17 (d, 1H), 7.89 (d, 1H), 7.55 (t, 1H), 7.25 (t,
1H), 7.14 (s, 2H), 6.40 (d, 1H), 3.69 (s, 6H), 3.62 (s, 3H). MS m/z
(%): 432 (M+H, 100);
EXAMPLE 3
2-methyl-6-[2-(3,4,5-Trimethoxy-phenylamino)-pyrimidin-4-ylamino]-benzenes-
ulfonamide
##STR00009##
[0049] The title compound is prepared as described in Example 1
with the difference that in step (a)
2-amino-6-methyl-benzenesulfonamide is used instead of
2-aminobenzenesulfonamide. 2-Amino-6-methyl-benzenesulfonamide may
be prepared as described by Girard, Y et al.; J. J. Chem. Soc.
Perkin Trans. I 1979, 4, 1043-1047: Under an atmosphere of nitrogen
m-toluidin (32.1 g, 32.5 ml, 0.30 mmol) is added dropwise to a
solution of chlorosulfonyl isocyanate (51.3 ml, 83.6 g, 0.59 mmol)
in nitroethane (400 ml) at -55-49.degree. C. The cold bath is
removed and the mixture allowed to warm to -8.degree. C., whereupon
aluminium chloride (51 g, 0.38 mmol) is added. Heating the mixture
to 100.degree. C. for 20 min forms a clear brown solution, which is
cooled to RT and poured on ice. After filtration, washing with ice
water and diethyl ether the precipitate is collected and dissolved
in dioxane (300 ml). Water (1000 ml) and conc. HCl (1500 ml) are
added to form a suspension, which is heated to 120.degree. C. for
18 h. After cooling to RT the clear brown solution is washed with
diethyl ether/hexane (1400 ml, 1/1 v/v) and adjusted to pH=8 by
addition of sodium carbonate. Extraction using ethyl acetate
(2.times.1000 ml), washing of the organic phase with water (500 ml)
and brine (500 ml), drying (magnesium sulfate) and concentration
yields a brown solid, which is purified by chromatography on silica
using methylene chloride/ethanol (100/1 v/v) to yield the desired
product as a white solid.
[0050] Melting point: 72-75.degree. C. (Propan-2-ol);
[0051] .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 2.64 (s, 3H,
Me), 3.63 (s, 3H, OMe), 3.68 (s, 6H, OMe), 6.31 (d, J=5 Hz, 1H,
pyrimidine CH), 7.07 (d, J=8 Hz, 1H, arom. CH), 7.15 (s, 2H, arom.
CH), 7.40 (t, J=8 Hz, 1H, arom. CH), 7.65 (s, 2H,
SO.sub.2NH.sub.2), 8.04 (d, J=8 Hz, 1H, arom. CH), 8.12 (d, J=5 Hz,
1H, pyrimidine CH), 9.14 (s, 1H, NH), 9.40 (s, 1H, NH).
[0052] MS (ES.sup.+)m/z: 446 (MH.sup.+), 468 (MNa.sup.+)
[0053] MS (ES.sup.-): 444 (M-H).sup.-
EXAMPLE 4
2-Methoxy-6-[2-(3,4,5-trimethoxy-phenylamino)-pyrimidin-4-ylamino]-benzene-
sulfonamide
##STR00010##
[0055] The title compound is prepared as described in Example 1
with the difference that in step (a)
2-amino-6-methoxy-benzenesulfonamide is used instead of
2-Amino-6-methyl-benzenesulfonamide.
[0056] 2-Amino-6-methoxy-benzenesulfonamide may be prepared from
12.3 g of meta-anisidine following an analogous procedure as
described in Example 1a. NMR (400 MHz, DMSO-d.sub.6): .delta. 3.62
(s, 3H, OMe), 3.69 (s, 6H, OMe), 3.91 (s, 3H, OMe), 6.31 (d, J=5
Hz, 1H, pyrimidine CH), 6.86 (d, J=8 Hz, 1H, arom. CH), 7.12 (s,
2H, arom. CH), 7.43 (t, J=8 Hz, 1H, arom. CH), 8.01 (d, J=8 Hz, 1H,
arom. CH), 8.11 (d, J=5 Hz, 1H, pyrimidine CH), 9.18 (s, 1H, NH),
9.79 (br, 1H, NH).
[0057] MS (ES.sup.+): 462.2 (MH.sup.+), 484.2 (MNa.sup.+)
[0058] MS (ES.sup.-): 460.3 (M-H).sup.-
[0059] The compounds of formula X.sub.1
##STR00011##
wherein R.sup.3, R.sup.7 and R.sup.8 are as defined in Table 1, may
be prepared by following the procedure of Example 1 but using the
appropriate starting materials.
TABLE-US-00001 TABLE 1 MS Data Example R.sup.3 R.sup.7 R.sup.8 *ES+
*ES- *EI 5 --OH --O-(1-methyl)-azacyclohept-4-yl --H 406 404 6
--SO.sub.2NH.sub.2 --O-(1-methyl)-azacyclohept-4-yl --H 469.3 7
--SO.sub.2NH.sub.2 --O-2-(1-methyl-azacyclopent-2- --H 469.3
yl)-ethyl 8 --OH --O-2-(1-piperidyl)-ethyl --OCH.sub.3 436.3 434.4
9 --OH --O-2-(1-methyl-azacyclopent-2- --H 406 404 yl)-ethyl 10
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2CH.sub.2-1-imidazolyl
--OCH.sub.3 496 494 11 --SO.sub.2NH.sub.2 --O-2-(1-piperidyl)-ethyl
--OCH.sub.3 499.2 497.3 12 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-methyl-imidazol-1- --H 466 464 yl 13 --OH
--O-2-[1-(1,2,4-triazolyl)]-ethyl --H 390 388 14 --OH
--O-2-hydroxyethyl --OCH.sub.3 369.4 367.3 15 --SO.sub.2NH.sub.2
--O-2-hydroxyethyl --OCH.sub.3 431 16 --SO.sub.2NH.sub.2
--O-CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 17 --SO.sub.2NH.sub.2
--O-2-[1-(1,2,4-triazolyl)]-ethyl --H 452 18 --SO.sub.2NH.sub.2
--NH--N.dbd.N-- 381 19 --SO.sub.2NHCH.sub.3
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 496 494 20
--SO.sub.2NH.sub.2 --O-2-(1-piperidyl)-ethyl --H 469 467 21
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-imidazolyl --H 452 450
22 --OH --O-2-(1-piperidyl)-ethyl --H 406 23 --COOH -4-morpholino
--H 24 --OH --O--CH.sub.2CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3
433 431 25 --SO.sub.2NHCH.sub.3 --CH.dbd.N--NH-- 396 394 26
--SO.sub.2NH.sub.2 --O-2-(4-morpholino)ethyl --H 471 469 27
--SO.sub.2NH.sub.2 --OCH.sub.3 --OCH.sub.3 402 400 28 --OH
--O-2-(4-morpholino)ethyl --H 408 406 29 --SO.sub.2NH.sub.2
--CH.dbd.N--NH-- 381 30 --SO.sub.2NHCH.sub.3
--O--CH.sub.2CH.sub.2-1-imidazolyl --H 31 --COOH amino --H 322 32
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2CH.sub.2-1-imidazolyl --H
466.2 464.3 33 --COOH --N(CH.sub.3).sub.2 --H 34
-5-(1,2,3,4-tetrazolyl) --NH--C(O)CH.sub.3 --H 388 386 35
--SO.sub.2NHCH.sub.3 --NH--N.dbd.N-- 36 --COOH --OH --H 37 --COOH
--H -4-piperidyl 38 --COOH --CH.sub.2--OH --H 39 --OH
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH3 40
--SO.sub.2NH--CH.sub.2CH.sub.2--OH
--O--CH.sub.2CH.sub.2-1-imidazolyl --H 496 494 41 --C(O)NH.sub.2
amino --H 321 42 --SO.sub.2NH.sub.2 --CH.dbd.CH--NH-- 381 43
-5-(1,2,3,4-tetrazolyl) --NHCH.sub.2-3-pyridyl --H 435 44
--SO.sub.2NH.sub.2 --NH--CH.dbd.CH-- 379 45 --COOH --H -4-
morpholino 46 --COOH --H -1-(4- amino)- piperidyl 47
--SO.sub.2NH.sub.2 --OCH.sub.3 --H 372 370 48
--SO.sub.2N(CH.sub.3).sub.2 --O--CH.sub.2CH.sub.2-1-imidazolyl --H
480 478
[0060] The compounds of formula X.sub.2
##STR00012##
wherein R.sup.3 and R.sup.8 are as defined in Table 2, may be
prepared by following the procedure of Example 1 but using the
appropriate starting materials.
TABLE-US-00002 TABLE 2 MS Data Example R.sup.3 R.sup.8 *ES+ *ES- 49
--COOH --OCH.sub.3 397 395 50 --SO.sub.2NH.sub.2 --OH 51
--SO.sub.2NHCH.sub.3 --OCH.sub.3 52 -5-(1,2,3,4-tetrazolyl)
--OCH.sub.3 421 53 --SO.sub.2NH-cyclopropyl --OCH.sub.3 472.2 470.3
54 --C(O)NHOH --OCH.sub.3 412 410 55
--SO.sub.2NH--CH.sub.2CH.sub.2--OH --OCH.sub.3 476 474 56
--SO.sub.2N(CH.sub.3).sub.2 --OCH.sub.3 460.3 458.3 57 --OH
--OCH.sub.3 369 367 58 --SO.sub.2NH--CH.sub.2CH.sub.2CH.sub.3
--OCH.sub.3 474 472 59 --CH.sub.2OH --OCH.sub.3 60
--SO.sub.2NH.sub.2 --H 402
[0061] The compounds of formula X.sub.3
##STR00013##
wherein R.sup.1, R.sup.7, R.sup.8 and R.sup.9 are as defined in
Table 3, may be prepared by following the procedure of Example 1
but using the appropriate starting materials.
TABLE-US-00003 TABLE 3 MS Data Example R.sup.1 R.sup.7 R.sup.8
R.sup.9 *ES+ *ES- 61
--SO.sub.2NH--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH --H
--N(CH.sub.3)--C(O)CH.sub.3 --H 62 --SO.sub.2NH.sub.2 --OCH.sub.3
--OCH.sub.3 --OCH.sub.3 63 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 --H 64
--SO.sub.2NH--CH.sub.2CH.sub.2--O--CH.sub.2CH.sub.2--OH --OCH.sub.3
--OCH.sub.3 --OCH.sub.3 520 518 65 --N(CH.sub.3) C(O)CH.sub.3
--OCH.sub.3 --OCH.sub.3 --OCH.sub.3 424 422 66
--CH.sub.2CH.sub.2--OH
--SO.sub.2NH--CH.sub.2CH.sub.2CH.sub.2CH.sub.3 --H --H 67
--SO.sub.2NH.sub.2 --OCH.sub.3 --H --OCH.sub.3 68
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-imidazolyl --H --H 69
--CH.sub.2CH.sub.2--OH --O--CH.sub.2CH.sub.2-1-imidazolyl --H --H
70 --CH.sub.2CH.sub.2--OH --OCH.sub.3 --H --OCH.sub.3 71
--SO.sub.2NH.sub.2 --OH --H --H 72 --O--CH.sub.2CH.sub.2--OH
--O--CH.sub.2CH.sub.2-1-imidazolyl --H --H 73
--SO.sub.2NH-2-thiazolyl --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 515
513
[0062] The compounds of formula X.sub.4
##STR00014##
wherein R.sup.2, R.sup.5, R.sup.7, R.sup.8 and R.sup.9 are as
defined in Table 4, may be prepared by following the procedure of
Example 1 but using the appropriate starting materials.
TABLE-US-00004 TABLE 4 MS Data Example R.sup.2 R.sup.5 R.sup.7
R.sup.8 R.sup.9 *ES+ *ES- 74 --SO.sub.2NH-2-propenyl --H
--OCH.sub.3 --OCH.sub.3 --OCH.sub.3 472 470 75 --SO.sub.2NH.sub.2
--H --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 76 --OH --H --O-(1-methyl)-
--H --H 406.3 404.3 azacyclohept-4-yl 77 --OH --H
--O--CH.sub.2CH.sub.2--OH --OCH.sub.3 --H 369 367 78
--SO.sub.2NH.sub.2 --Br --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 510.1/
508.1/ 512.1 510.2 79 --SO.sub.2NH.sub.2 --H --CH.dbd.N--NH-- --H
382 80 --SO.sub.2NH.sub.2 --CH.sub.3 --OCH.sub.3 --OCH.sub.3
--OCH.sub.3 446 444 81 --SO.sub.2NH.sub.2 --H
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 --H 482 480 82 --OH
--H --O--CH.sub.2CH.sub.2-1-piperidyl --OCH.sub.3 --H 436.3 434.3
83 --OH --H --O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 --H 419
417 84 --SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2-1-imidazolyl
--H --H 452 450 85 --CH.sub.3 --C.ident.N --OCH.sub.3 --OCH.sub.3
--OCH.sub.3 392 86 --SO.sub.2NH.sub.2 --H --NH--N.dbd.CH-- --H 382
87 --OH --H --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 369 367 88
--SO.sub.2NHCH.sub.3 --CH.sub.3 --OCH.sub.3 --OCH.sub.3 --OCH.sub.3
460 458 89 --OH --H --OH --COOH --OCH.sub.3 90 --OH --H
--O--CH.sub.2CH.sub.2-1-piperidyl --H --H 406 404 91
--SO.sub.2NH-2-propenyl --H --O--CH.sub.2CH.sub.2-1-imidazolyl --H
--H 492.3 490.3 92 --SO.sub.2NH.sub.2 --Br
--O--CH.sub.2CH.sub.2-1-(1-methyl)- --H --H 544.1/ 542/ imidazolyl
546 544.2 93 --SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2--OH
--OCH.sub.3 --H 94 --OH --H --O-(1-methyl)- --H --H
azacyclopent-2-yl 95 --OH --H --O--CH.sub.2CH.sub.2-1-imidazolyl
--H --H 389 387 96 --OH --H --O--CH.sub.2CH.sub.2CH.sub.2-1-
--OCH.sub.3 --H 433.4 431.4 imidazolyl 97 --SO.sub.2NH.sub.2 --H
--OCH.sub.3 --H --OCH.sub.3 98 --OH --H --OCH.sub.3 --OCH.sub.3 --H
339 337 99 --SO.sub.2NHCH.sub.2--CH.sub.2CH.sub.2CH.sub.3 --H
--OCH.sub.3 --OCH.sub.3 --OCH.sub.3 488 486 100
--SO.sub.2NH--CH.sub.3 --CH.sub.3
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 --H 510 508 101
--SO.sub.2NHCH.sub.2--CH.sub.2CH.sub.2CH.sub.3 --H
--O--CH.sub.2CH.sub.2-1-imidazolyl --H --H 08 506 102 --OH --H
--O--CH.sub.2CH.sub.2-4-morpholino --H --H 408 103 --OH --H
--NH--N.dbd.CH-- --H 319 317 104 --OH --H --CHN--NH-- --H 319 317
105 --OH --H --O--CH.sub.2CH.sub.2-1-imidazolyl --H --H 106
--SO.sub.2NH--CH.sub.3 --CH.sub.2--CH.sub.3 --OCH.sub.3 --OCH.sub.3
--OCH.sub.3 474.3 472.3 107 --SO.sub.2NH.sub.2 --H --OCH.sub.3
--OCH.sub.3 --OCH.sub.3
[0063] The compounds of formula X.sub.5
##STR00015##
wherein R.sup.0, R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are as
defined in Table 5, may be prepared by following the procedure of
Example 1 but using the appropriate starting materials.
TABLE-US-00005 TABLE 5 MS Data Example R.sup.0 R.sup.1 R.sup.2
R.sup.3 R.sup.4 *ES+ *ES- 108 --H --OCH.sub.3 --OH --H --H 109 --H
nitro --H --OH --H 414 412 110 --H --N.dbd.CH--CH.dbd.CH-- --H --H
111 --H --CH.dbd.N--NH-- --H --H 393 391 112 --H --NH--N.dbd.CH--
--H --H 393 113 --H --H --OH --CH.sub.2CH.sub.2CH.sub.2-- 409 407
114 --CH.sub.3 --H --CH.sub.3 --OH --H 397 115 --H phenyl --H
--SO.sub.2NH.sub.2 --H 508 506 116 --CH.sub.3 --H --H
--SO.sub.2NH.sub.2 --H 446 444
[0064] The compounds of formula X.sub.6
##STR00016##
wherein R.sup.5, R.sup.7, R.sup.8 and R.sup.9 are as defined in
Table 6, may be prepared by following the procedure of Example 1
but using the appropriate starting materials.
TABLE-US-00006 TABLE 6 Example R.sup.5 R.sup.7 R.sup.8 R.sup.9 *Es+
*Es- 117 --CH.sub.3 --O--CH.sub.2CH.sub.2-1-imidazolyl --H --H 466
118 --CH.sub.2CH.sub.3 --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 460 458
119 --Br --NH--N.dbd.CH-- --H 461 120 --CH.sub.3
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 --H 496 121
--CH.sub.3 --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 446 122 --CH.sub.3
--N.dbd.N--NH-- --H 397.2 395.2 123 --CH.sub.3
--O--CH.sub.2CH.sub.2-1-methyl-imidazol-1-yl --H --H 480 124 --Br
--CH.dbd.N--NH-- --H 461.3 458.1/ 460 125 --CH.sub.3
--NH--N.dbd.CH-- --H 396 126 --Br
--OCH.sub.2CH.sub.2-(4-methyl-piperazin-1-yl) --H --H 562/ 560/ 564
562
[0065] The compounds of formula X.sub.7
##STR00017##
wherein R.sup.1, R.sup.2, R.sup.3, R.sup.7 and R.sup.8 are as
defined in Table 7, may be prepared by following the procedure of
Example 1 but using the appropriate starting materials.
TABLE-US-00007 TABLE 7 Ex R.sup.1 R.sup.2 R.sup.3 R.sup.7 R.sup.8
*ES+ *ES- 127 --OCH.sub.3 --OH --H --OH --OCH.sub.3 128 --H
--CH.sub.3 --SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-imidazolyl
--H 466 464 129 --OCH.sub.3 --OH --H
--O--CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 130 --OCH.sub.3 --OH
--H --O--CH.sub.2CH.sub.2--OH --OCH.sub.3 399 397 131 --OCH.sub.3
--OH --H --O-(1-methyl-azacyclohept-4-yl) --H 436 132 --CH.sub.3
--H --SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-imidazolyl --H 466
464 133 --OCH.sub.3 --OH --H --O--CH.sub.2CH.sub.2-(1-methyl)- --H
436 434 azacyclopent-2-yl 134 --OCH.sub.3 OH --H --CF.sub.3 --H 135
--N.dbd.CH--CH.dbd.CH-- --H --O--CH.sub.2CH.sub.2-1-imidazolyl
--OCH.sub.3 136 --OCH.sub.3 --OH --H
--O--CH.sub.2CH.sub.2CH.sub.2-1-imidazolyl --OCH.sub.3 463 461 137
--OCH.sub.3 --OH --H --O--CH.sub.2CH.sub.2-1-piperidyl --OCH.sub.3
466.4 464.4 138 --CH.dbd.N--NH-- --H --NH--N.dbd.CH-- 139
--CH.dbd.N--NH-- --H --CH--N.dbd.NH-- 140 --OCH.sub.3 --H --H
--O--CH.sub.2CH.sub.2-1-piperidyl --H 436 434 141 --H --OCH.sub.3
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-pyrrolidinyl --H 485.3
483.3 142 --H --OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-pyrrolidinyl --CH.sub.3 499.2 497.3 143 --H
--OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2CH.sub.2-morpholino --OCH.sub.3 545.2 545.3
144 --H --OCH(CH.sub.3).sub.2 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-(4-methyl-piperazin- --OCH.sub.3 572.2 570.3
1-yl) 145 --H --OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-piperidinyl --H 499.2 497.3 146 --CH.sub.3
--OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2CH.sub.2-1-pyrrolidinyl --OCH.sub.3 543.2 147
--CH.sub.3 --OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2CH.sub.2-1-pyrrolidinyl --H 513.2 511.2 148
--H --OCH(CH.sub.3).sub.2 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-piperidinyl --H 527.2 525.3 149 --H
--CH.sub.3 --SO.sub.2NH.sub.2 --N(CH.sub.3).sub.2 --OCH.sub.3 429.3
427.3 150 --CH.sub.3 --CH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2CH.sub.2-1-pyrrolidinyl --OCH.sub.3 527.2
525.3 151 --OCH.sub.3 --H --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2CH.sub.2-1-pyrrolidinyl --OCH.sub.3 529.2
527.3 152 --H --F --SO.sub.2NH.sub.2 --N(CH.sub.3).sub.2
--OCH.sub.3 433.1 153 --H --CH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-(1-methyl-pyrrolidin- --H 2-yl) 154 --H
--OCH.sub.3 --SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2--OH --H 432.2
430.2 155 --H --CH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-(1-methyl-pyrrolidin- --OCH.sub.3 513.2 511.3
2-yl) 156 --OCH.sub.3 --H --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-piperidinyl --H 499.2 497.3 157 --OCH.sub.3
--H --SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-pyrrolidinyl
--OCH.sub.3 515.2 513.2 158 --H --CH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2--OH --OCH.sub.3 446.2 444.2 159
--OC.sub.2H.sub.5 --H --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-pyrrolidinyl --CH.sub.3 513.3 511.3 160
--OCH.sub.3 --OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-(4-methyl-piperazin- --OCH.sub.3 574.2 572.2
1-yl) 161 --H --Cl --SO.sub.2NH.sub.2 -(4-methyl-piperazin-1-yl)
--H 474.5 472.5 162 --H --CH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-(4-cyclopentyl- --H 552.3 550.3
piperazin-1-yl) 163 --CH.dbd.CH--CH.dbd.CH-- --SO.sub.2NH.sub.2
-(4-methyl-piperazin-1-yl) --H 490.5 488.4 164 --H --H
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-piperazin-1-yl --H 470.2
468.3 165 --H --OCH.sub.3 --SO.sub.2NH.sub.2 --H --OCH.sub.3 402.2
400.2 166 --H --OCH.sub.3 --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-(4-benzyl-piperazin- --H 590.3 588.3 1-yl)
167 --CH.sub.3 --H --SO.sub.2NH.sub.2
--O--CH.sub.2CH.sub.2-1-pyrrolidinyl --H 469.2 467.3 168 --Br --H
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1-piperidinyl --H 549.1
547.2
[0066] The compounds of formula X.sub.8
##STR00018##
wherein R.sup.1, R.sup.2, R.sup.3 and R.sup.8 are as defined in
Table 8, may be prepared by following the procedure of Example 1
but using the appropriate starting materials.
TABLE-US-00008 TABLE 8 Ex R.sup.1 R.sup.2 R.sup.3 R.sup.8 *ES+ *ES-
169 4-morpholino --H --H --H 170 --CH.dbd.N--NH-- --H --H 363 361
171 --OCH.sub.3 --OH --H --H 172 --CH.sub.3 --H --SO.sub.2NH.sub.2
--OCH.sub.3 446
[0067] The compounds of formula X.sub.9
##STR00019##
wherein R.sup.7, R.sup.8 and R.sup.9 are as defined in Table 9, may
be prepared by following the procedure of Example 1 but using the
appropriate starting materials.
TABLE-US-00009 TABLE 9 Example R.sup.7 R.sup.8 R.sup.9 *ES+ *ES-
173 --O--CH.sub.2CH.sub.2-1-piperidyl --OCH.sub.3 --H 470.3 468.3
174 --O-(1-methyl-azacyclohept-4-yl) --H --H 440 175
--O-(1-methyl-azacyclopent-2-yl) --H --H 440 438 176
--O--CH.sub.2CH.sub.2--CH.sub.2-1-imidazolyl --OCH.sub.3 --H 467
465 177 --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 178
--O--CH.sub.2CH.sub.2-1-(1,2,4-triazolyl) --H --H 424 422 179
--O--CH.sub.2CH.sub.2-1-piperidyl --H --H 180
--O--CH.sub.2CH.sub.2--OH --OCH.sub.3 --H 181
--O--CH.sub.2CH.sub.2-4-morpholino --H --H 442 440 182
--O--CH.sub.2CH.sub.2CH.sub.2-1-imidazolyl --H --H
[0068] The compounds of formula X.sub.10
##STR00020##
wherein R.sup.1, R.sup.7 and R.sup.9 are as defined in Table 10,
may be prepared by following the procedure of Example 1 but using
the appropriate starting materials.
TABLE-US-00010 TABLE 10 EX R.sup.1 R.sup.7 R.sup.9 *ES+ *ES- 183
--CH.sub.2CH.sub.2--OH --OCH.sub.3 --OCH.sub.3 411 409 184
--SO.sub.2NH.sub.2 --O--CH.sub.2CH.sub.2-1- --H 496.3 494.3
imidazolyl
[0069] The compounds of formula X.sub.11
##STR00021##
wherein R.sup.8 is --OCH.sub.3 (Example 185) or --OH (Example 186),
may be prepared by following the procedure of Example 1 but using
the appropriate starting materials.
[0070] The compounds of formula X.sub.12
##STR00022##
wherein R.sup.0, R.sup.1, R.sup.7, R.sup.8 and R.sup.9 are as
defined in Table 12, may be prepared by following the procedure of
Example 1 but using the appropriate starting materials.
TABLE-US-00011 TABLE 12 Example R.sup.0 R.sup.1 R.sup.7 R.sup.8
R.sup.9 187 --H --H --H --SO.sub.2NH.sub.2 --H 188 --H --H --H --H
--CH.sub.3 189 --H --H --H --CH.sub.3 --H 190 --H --F --OCH.sub.3
--OCH.sub.3 --OCH.sub.3 191 --H --H --H --CH.sub.3 --CH.sub.3 192
--H --H --CH.sub.3 --H --CH.sub.3 193 --H --H --OCH.sub.3
--CH.sub.3 --H 194 --H --H --H --H --N(CH.sub.3).sub.2 195 --H --H
--OCH(CH.sub.3).sub.2 --H --H 196 --H --H --H --OCH(CH.sub.3).sub.2
--H 197 --H --H --CH(CH.sub.3).sub.2 --H --H 198 --H --H --H
--CH.dbd.N--NH-- 199 --H --H --OCH.sub.3 --CH.sub.3 --OCH.sub.3 200
--OCH.sub.3 --H --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 201 --H --H --H
--H --H 202 --CH.sub.3 --Cl --OCH.sub.3 --OCH.sub.3 --OCH.sub.3 203
--H --H --H --H --CF.sub.3 204 --Cl --CH.sub.3 --OCH.sub.3
--OCH.sub.3 --OCH.sub.3 205 --H --H --H --NH--CH.dbd.N-- 206 --H
--H --H --N(--CH.sub.2CH.sub.2CH.sub.2-4- morpholino)-CH.dbd.CH--
207 --H --H --CH.sub.2CH.sub.2--CH.sub.2-- --H
[0071] The compounds of formula X.sub.13
##STR00023##
wherein R.sup.1, R.sup.2, R.sup.3 and R.sup.5 are as defined in
Table 13, may be prepared by following the procedure of Example 1
but using the appropriate starting materials.
TABLE-US-00012 TABLE 13 Example R.sup.1 R.sup.2 R.sup.3 R.sup.5
*ES+ *ES- 208 --H --H --SO.sub.2NHCH.sub.3 --CF.sub.3 514.0 209 --H
--H --SO.sub.2NHC.sub.3H.sub.7 --Br 210 --H --H
--SO.sub.2NH--CH.sub.2CH-- --Br cyclopropyl 211 --H --H
--SO.sub.2NHCH.sub.3 --CH.sub.3 212 --H --H
--SO.sub.2N(CH.sub.3).sub.2 --Br 213 --H --H --SO.sub.2NHCH.sub.3
--Cl 214 --H --H --SO.sub.2NHCH.sub.3 --I 215 --H --H
--SO.sub.2NHCH.sub.3 --Br 216 --CH.sub.3 --OCH.sub.3
--SO.sub.2NH.sub.2 --H 476 474 217 --H piperidino
--SO.sub.2NH.sub.2 --H 515.5 513.4 218 --H morpholino
--SO.sub.2NH.sub.2 --H 517.4 515.4 219 --H --C.sub.2H.sub.5
--SO.sub.2NH.sub.2 --H 220 --H --CH.sub.3 --SO.sub.2NH.sub.2 --Cl
221 --H --CH.sub.3 --SO.sub.2NHCH.sub.3 --H 460.4 222 --H phenyl
--SO.sub.2NH.sub.2 --H 508.2 506.3
[0072] The compounds of formula X.sub.14
##STR00024##
wherein R.sup.2, R.sup.3, R.sup.5, R.sup.7, R.sup.8 and R.sup.9 are
as defined in Table 14, may be prepared by following the procedure
of Example 1 but using the appropriate starting materials.
TABLE-US-00013 TABLE 14 Ex R.sup.2 R.sup.3 R.sup.5 R.sup.7 R.sup.8
R.sup.9 *ES+ *ES- 223 --OCH.sub.3 --SO.sub.2NH.sub.2 --H --H
--CH.dbd.N--N(CH.sub.3)-- 424 224 --OCH.sub.3 --SO.sub.2NH.sub.2
--H --O--CH.sub.2CH.sub.2--OCH.sub.3 --OCH.sub.3 --H 476.2 474.3
225 --OCH(CH.sub.3).sub.2 --SO.sub.2NH.sub.2 --H
--O--CH.sub.2CH.sub.2-- --OCH.sub.3 --H 551.2 555.3 piperidino 226
--OCH.sub.3 --SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2-(4- --H
--H 514.3 512.3 methyl-piperazin-1-yl)- 227 --OCH.sub.3
--SO.sub.2NH.sub.2 --H -morpholino --OCH.sub.3 --H 487.1 485.2 228
--CH.sub.3 --SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2CH.sub.2-
--OCH.sub.3 --H 527.3 piperidino 229 --CH.sub.3 --SO.sub.2NH.sub.2
--H --O--CH.sub.2CH.sub.2CH.sub.2-1- --OCH.sub.3 --H 513.2 511.3
pyrrolidinyl 230 --O--CH.sub.2CH.sub.2--OCH.sub.3
--SO.sub.2NH.sub.2 --H --H --CH.dbd.N--N(CH.sub.3)-- 539 537 231
-(4-methyl- --SO.sub.2NH.sub.2 --H --OCH.sub.3 --OCH.sub.3
--OCH.sub.3 530.4 528.4 piperazin-1-yl) 232 --OCH.sub.3
--SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2--OH --OCH.sub.3 --H
462.2 460.3 233 --OCH.sub.3 --SO.sub.2NH.sub.2 --Br
--O--CH.sub.2CH.sub.2--OCH.sub.3 --OCH.sub.3 --H 234 --CH.sub.3
--SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2-(4- --OCH.sub.3 --H
528.2 526.3 methyl-piperazin-1-yl) 235 --CH.sub.3
--SO.sub.2NH.sub.2 --H --O--CH.sub.2CH.sub.2--N(CH.sub.3).sub.2 --H
--H 443.2 441.3 236 --H --SO.sub.2NH.sub.2 --H
--O--CH.sub.2CH.sub.2-1- --OCH.sub.3 --H 485.2 483.3 pyrrolidinyl
237 --CH.sub.3 --SO.sub.2NH.sub.2 --H --H --N(CH.sub.3)--N.dbd.CH--
410 238 --CH.sub.3 --SO.sub.2NH.sub.2 --H --CH.sub.3 --OCH.sub.3
OCH.sub.3 239 --CH.sub.3 --SO.sub.2NH.sub.2 --Br
--O--CH.sub.2CH.sub.2--OCH.sub.3 --OCH.sub.3 --H 538/540 240
--OCH.sub.3 --SO.sub.2NH.sub.2 --H --OCH.sub.3 --H --H 402.2 400.2
241 --H --SO.sub.2NH.sub.2 --H --H
--CO--NH--CH.sub.2CH.sub.2--OCH.sub.3 --H ES+ means electrospray MS
positive mode; ES- means electrospray MS negative mode; and EL
means electron impact MS.
[0073] The compounds of formula I and their pharmaceutically
acceptable salts, exhibit valuable pharmacological properties when
tested in in vitro assays, and are therefore useful as
pharmaceuticals.
[0074] In particular the compounds of the invention exhibit ZAP-70
(zeta chain-associated protein of 70 kD), Focal Adhesion Kinase
(FAK) and/or Syk protein tyrosine kinases inhibiting activity. More
particularly the compounds of the invention are active at the human
ZAP-70, FAK and/or Syk protein tyrosine kinases. ZAP-70, FAK and/or
Syk protein tyrosine kinase interaction of the compounds of the
invention may be demonstrated by their ability to prevent
phosphorylation of e.g. LAT-11 (SEQ ID NO: 1) by human ZAP-70
protein tyrosine kinase, to prevent phosphorylation of e.g.
Biot-Y397 (SEQ ID NO:2) by human FAK protein tyrosine kinase,
and/or to prevent phosphorylation of e.g. polymeric glutamic
acid-tyrosine (Glu, Tyr) by human Syk protein tyrosine kinase in,
e.g. aqueous solution, e.g. as demonstrated in accordance with the
following test methods.
1. Cell-Free Kinase Assays: ZAP-70 and Syk Kinase Assays
[0075] ZAP-70, Lck and Syk are commercially available from Upstate
Biotechnology, Lake Placid, N.Y.
[0076] Preparation of LAT-11 (SEQ ID NO:1):
[0077] The peptide LAT-11 used as a substrate in the ZAP-70 kinase
assay may be prepared as disclosed in Example 1A of WO 02/12275,
the contents of which, particularly with reference to Example 1A,
is incorporated herein by reference.
[0078] ZAP-70 Kinase Assay:
[0079] The activities of the agents of invention are determined in
a homogenous ZAP-70 kinase assay based on time-resolved
fluorescence resonance energy transfer. Briefly, 80 nM ZAP-70 are
incubated with 80 nM Lck and 4 .mu.M ATP in ZAP-70 kinase buffer
(20 mM Tris, pH 7.5, 10 .mu.M Na.sub.3VO.sub.4, 1 mM DTT, 1 mM
MnCl.sub.2, 0.01% bovine serum albumin, 0.05% Tween 20) for 1 hour
at room temperature in a siliconized polypropylene tube. Then, the
selective Lck inhibitor PP2
(4-amino-5-(4-chloro-phenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine;
Alexis Biochemicals) is added (final concentration 1.2 .mu.M) and
incubated for further 10 min. Ten .mu.l of this solution is mixed
with the 10 .mu.l biotinylated peptide LAT-11 (1 .mu.M) as
substrate and 20 .mu.l of serial dilutions of inhibitors and
incubated for 4 hours at room temperature. The kinase reaction is
terminated with 10 .mu.l of a 10 mM EDTA solution in detection
buffer (20 mM Tris, pH 7.5, 0.01% bovine serum albumin, 0.05% Tween
20). The detection phase is performed by addition of 50 .mu.l
europium (Eu)-labelled anti-phosphotyrosine antibody (e.g. Eu-PT66;
final concentration 0.125 nM; Advant/Wallac) and 50 .mu.l
streptavidin-allophycocyanine (SA-APC; final concentration 40 nM)
in detection buffer. After 1 hour incubation at room temperature
fluorescence is measured, e.g., on the Victor2 Multilabel Counter
(Wallac) at 665 nm. Background values (low control) are obtained in
the absence of test samples and ATP and are subtracted from all
values. Signals obtained in the absence of test samples are taken
as 100% (high control). The inhibition obtained in the presence of
test compounds was calculated as percent inhibition of the high
control. The concentration of test compounds resulting in 50%
inhibition (IC.sub.50) was determined from the dose-response
curves. In this assay, the compounds of the invention have
IC.sub.50 values in the range of 10 nM to 2 .mu.M, preferably from
10 nM to 100 nM. Compound of Example 4 shows an IC.sub.50 value of
12 nM.
[0080] Syk Kinase Assay:
[0081] The activities of the agents of invention are determined in
a heterogenous Syk kinase assay based on the dissociation-enhanced
lanthanide fluoroimmunoassay (DELFIA) technology. This method
utilizes europium chelate-labelled anti-phosphotyrosine antibodies
to detect phosphate transfer by Syk to a polymeric glutamic
acid-tyrosine (Glu, Tyr) substrate coated onto microtiter plates as
described (Braunwalder A F, Yarwood D R, Sills M A, Lipson K E.
Measurement of the protein tyrosine kinase activity of c-src using
time-resolved fluorometry of europium chelates. Anal. Biochem.
1996; 238(2):159-64). The amount of phosphorylation is then
quantified with time-resolved, dissociation-enhanced fluorescence.
Briefly, hundred .mu.l of poly (Glu, Tyr) (4:1; 2 .mu.g/ml in
phosphate-buffered saline, PBS) are coated to ELISA plates
overnight at room temperature. The poly (Glu, Tyr) solution is
removed and 250 .mu.l of 1% bovine serum albumin in PBS are added
for one hour at room temperature. Plates are then washed three
times with 350 .mu.l of washing buffer (25 mM Tris-HCl, pH 7.4
containing 0.03% Tween-20). The kinase reaction is performed for
one hour at room temperature by mixing serial dilutions of
inhibitors in 30 .mu.l with 30 .mu.l of Syk kinase (20 ng/ml) and
ATP (1 .mu.M) in kinase buffer (20 mM Tris, pH 7.5, 10 .mu.M
Na.sub.3VO.sub.4, 1 mM DTT, 10 mM MnCl.sub.2, 2 mM MgCl.sub.2,
0.01% bovine serum albumin, 0.05% Tween 20). After washing the
plates four times as described above 60 .mu.l DELFIA europium
N1-labelled anti-phosphotyrosine antibody PY20 (Advant/Wallac) are
added (100 ng/ml in 50 mM Tris-HCl, pH7.4, 150 mM NaCl, 20 .mu.M
Titriplex V, 0.2% bovine serum albumine, 0.05% Tween-20) and
incubated for one hour at room temperature. Plates are washed eight
times and 60 .mu.l enhancement solution (Wallac) are added.
Fluorescence is determined at 615 nm (Victor2; Wallac). High
control values (100% signal) are obtained in absence of test
samples and low control values (background) in absence of test
samples and ATP. Low controls were subtracted from all values. The
inhibition obtained in the presence of test compounds was
calculated as percent inhibition of the high control. The
concentration of test compounds resulting in 50% inhibition
(IC.sub.50) was determined from the dose-response curves. In this
assay, the compounds of the invention have IC.sub.50 values in the
range of 100 nM to 10 .mu.M, preferably from 100 to 1 .mu.M.
Compound of Example 128 has an IC.sub.50 value of 150 nM.
2. Allogeneic Mixed Lymphocyte Reaction (MLR)
[0082] Compounds of the invention exhibit T cell inhibiting
activity. More particular the compounds of the invention prevent T
cell activation and/or proliferation in e.g. aqueous solution, e.g.
as demonstrated in accordance with the following test method. The
two-way MLR is performed according to standard procedures (J.
Immunol. Methods, 1973, 2, 279 and Meo T. et al., Immunological
Methods, New York, Academic Press, 1979, 227-39). Briefly, spleen
cells from CBA and BALB/c mice (1.6.times.10.sup.5 cells from each
strain per well in flat bottom tissue culture microtiter plates,
3.2.times.10.sup.5 in total) are incubated in RPMI medium
containing 10% FCS, 100 U/ml penicillin, 100 .mu.g/ml streptomycin
(Gibco BRL, Basel, Switzerland), 50 .mu.M 2-mercaptoethanol (Fluka,
Buchs, Switzerland) and serially diluted compounds. Seven
three-fold dilution steps in duplicates per test compound are
performed. After four days of incubation 1 .mu.Ci .sup.3H-thymidine
is added. Cells are harvested after an additional five-hour
incubation period, and incorporated .sup.3H-thymidine is determined
according to standard procedures. Background values (low control)
of the MLR are the proliferation of BALB/c cells alone. Low
controls are subtracted from all values. High controls without any
sample are taken as 100% proliferation. Percent inhibition by the
samples is calculated, and the concentrations required for 50%
inhibition (IC.sub.50 values) are determined. In this assay, the
compounds of the invention have IC.sub.50 values in the range of 10
nM to 10 .mu.M, preferably from 10 nM to 100 nM. Compound of
Example 120 shows an IC.sub.50 value of 13 nM.
3. FAK Assay
[0083] All steps are performed in a 96-well black microtiter plate.
Purified recombinant hexahistidine-tagged human FAK kinase domain
is diluted with dilution buffer (50 mM HEPES, pH 7.5, 0.01% BSA,
0.05% Tween-20 in water) to a concentration of 94 ng/mL (2.5 nM).
The reaction mixture is prepared by mixing 10 .mu.L 5.times. kinase
buffer (250 mM HEPES, pH 7.5, 50 .mu.M Na.sub.3VO.sub.4, 5 mM DTT,
10 mM MgCl.sub.2, 50 mM MnCl.sub.2, 0.05% BSA, 0.25% Tween-20 in
water), 20 .mu.L water, 5 .mu.L of 4 .mu.M biotinylated peptide
substrate (Biot-Y397) in aqueous solution, 5 .mu.L of test compound
in DMSO, and 5 .mu.L of recombinant enzyme solution and incubated
for 30 min at room temperature. The enzyme reaction is started by
addition of 5 .mu.L of 5 .mu.M ATP in water and the mixture is
incubated for 3 hours at 37.degree. C. The reaction is terminated
by addition of 200 .mu.L of detection mixture (1 nM Eu-PT66, 2.5
.mu.g/mL SA-(SL)APC, 6.25 mM EDTA in dilution buffer), and the FRET
signal from europium to allophycocyanin is measured by ARVOsx+L
(Perkin Elmer) after 30 min of incubation at room temperature. The
ratio of fluorescence intensity of 665 nm to 615 nm is used as a
FRET signal for data analysis in order to cancel the colour
quenching effect by a test compound. The results are determined as
percent inhibition of enzyme activity. DMSO and 0.5 M EDTA are used
as a control of 0% and 100% inhibition, respectively. IC50 values
are determined by non-linear curve fit analysis using the OriginPro
6.1 program (OriginLab). In this assay the compounds of formula I
inhibit FAK activity at a IC.sub.50<1 .mu.M. Examples 188, 208
and 213 show IC.sub.50 values of 15 nM, 1 nM and 7 nM
respectively.
[0084] The Biot-Y397 peptide (Biotin-SETDDYAEIID ammonium salt, SEQ
ID NO:2) is designed to have the same amino acid sequence as the
region from S392 to D402 of human (GenBank Accession Number L13616)
and is prepared by standard methods.
[0085] Purified recombinant hexahistidine-tagged human FAK kinase
domain is obtained in the following way: Full-length human FAK cDNA
is isolated by PCR amplification from human placenta
Marathon-Ready.TM. cDNA (Clontech, No. 7411-1) with the 5' PCR
primer (ATGGCAGCTGCTTACCTTGAC, SEQ ID NO:3) and the 3' PCR primer
(TCAGTGTGGTCTCGTCTGCCC, SEQ ID NO:4) and subcloned into a pGEM-T
vector (Promega, No. A3600). After digestion with AccIII, the
purified DNA fragment is treated with Klenow fragment. The cDNA
fragment is digested with BamHI and cloned into pFastBacHTb plasmid
(Invitrogen Japan K.K., Tokyo) previously cut with BamHI and Stu I.
The resultant plasmid, hFAK KD (M384-G706)/pFastBacHTb, is
sequenced to confirm its structure. The resulting DNA encodes a 364
amino acid protein containing a hexahistidine tag, a spacer region
and a rTEV protease cleavage site at the N-terminal and the kinase
domain of FAK (Met384-Gly706) from position 29 to 351.
[0086] Donor plasmid is transposed into the baculovirus genome,
using MaxEfficacy DH10Bac E. coli cells. Bacmid DNA is prepared by
a simple alkaline lysis protocol described in the Bac-to-Bac.RTM.
Baculovirus Expression system (Invitrogen). Sf9 insect cells are
transfected based on the protocol provided by the vendor
(CeIIFECTIN.RTM., Invitrogen). The expression of FAK in each lysate
is analysed by SDS-PAGE and Western blotting with anti-human FAK
monoclonal antibody (clone #77 from Transduction Laboratories).
[0087] The virus clone that shows the highest expression is further
amplified by infection to Sf9 cells. Expression in ExpresSF+.RTM.
cells (Protein Sciences Corp., Meriden, Conn., USA) gives high
level of protein with little degradation. Cell lysates are loaded
onto a column of HiTrap.TM. Chelating Sepharose HP (Amersham
Biosciences) charged with nickel sulfate and equilibrated with 50
mM HEPES pH 7.5, 0.5 M NaCl and 10 mM imidazole. Captured protein
is eluted with increasing amounts of imidazole in HEPES
buffer/NaCl, and further purified by dialysis in 50 mM HEPES pH
7.5, 10% glycerol and 1 mM DTT.
4. Phosphorylation Levels of FAK
[0088] Phosphorylation levels of FAK at Tyr397 are quantified by
the sandwich ELISA. Mouse mammary carcinoma 4T1 cells
(1.times.10.sup.5) are plated in wells of 96-well culture plates
and incubated with or without various concentrations of a compound
of formula I for 1 h in Dulbecco's modified eagle medium containing
10% FBS. The medium is removed and cells are lysed in 200 .mu.L 50
mM Tris-HCl, pH 7.4, containing 1% NP-40, 0.25% sodium
deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 mM
Na.sub.3VO.sub.4, 1 mM NaF, 1 .mu.g/mL aprotinin, 1 .mu.g/mL
leupeptin and 1 .mu.g/mL pepstatin. After centrifugation, the
supernatants are subjected to a sandwich ELISA to quantify the
phosphorylated FAK and total FAK. Cell lysates are applied to
96-well flat-bottom ELISA plates which have been pre-coated with
100 .mu.L/well of 4 .mu.g/mL mouse monoclonal anti-FAK antibody
(clone 77, Becton Dickinson Transduction Laboratories) in 50 mM
Tris-HCl, pH 9.5, containing 150 mM NaCl for 18 h at 4.degree. C.
and blocked with 300 .mu.L of BlockAce (Dainippon Pharmaceuticals
Co.) diluted at 1:4 with H.sub.2O at room temperature for 2 h.
After washing with TBSN (20 mM Tris-HCl, pH 8.3, containing 300 mM
NaCl, 0.1% SDS and 0.05% NP-40), total FAK is detected with 100
.mu.L of 1 .mu.g/ml anti-FAK polyclonal antibody (#65-6140, Upstate
Biology Inc.), and phosphorylated FAK is detected with 100 .mu.L of
0.25 .mu.g/.mu.L anti-phosphorylated FAK (Y397) antibody (Affinity
BioReagents, #OPA1-03071) in BlockAce diluted at 1:10 with
H.sub.2O. After 1 h incubation at room temperature, plates are
washed with TBSN and 100 .mu.L of biotinylated anti-rabbit IgG
(#65-6140, Zymed Laboratolies Inc.) diluted at 1:2000 with BlockAce
diluted at 1:10 with H.sub.2O is incubated at room temperature for
1 h. After washing with TBSN, ABTS solution substrate kit
(#00-2011, Zymed Lobolatories Inc.) is used for color development.
Absorbance at 405 nm is measured after 20 min incubation at room
temperature. The concentration of compound causing 50% reduction of
phosphorylation level of FAK (IC.sub.50) is determined. In this
assay, compounds of formula I reduce phosphorylation at an
IC.sub.50 of <1 .mu.M. Examples 190, 198 and 210 show IC.sub.50
values of 0.44 .mu.M, 0.043 .mu.M and 0.01 .mu.M respectively.
5. Anchorage-Independent Tumor Cell Growth Assay
[0089] Mouse mammary carcinoma 4T1 cells (5.times.10.sup.3) are
plated in 96-well Ultra low Attachment plates (#3474, Corning Inc.)
in 100 .mu.L of Dulbecco's modified eagle medium containing 10%
FBS. Cells are cultured for 2 h and inhibitors are added at various
concentrations in a final concentration of 0.1% DMSO. After 48 h,
cell growth is assayed with the cell counting kit-8 (Wako Pure
Chemical), which uses a water soluble tetrazolium salt WST8. Twenty
.mu.L of the reagent is added into each well and cells are further
cultured for 2 h. The optical density is measured at 450 nm. The
concentration of compound causing 50% inhibition of growth may thus
be determined. Examples 204, 213 and 206 show IC.sub.50 values of
0.4 .mu.M, 0.016 .mu.M and 0.09 .mu.M respectively.
[0090] The compounds of the invention are therefore useful in the
prevention or treatment of disorders or diseases where ZAP-70
inhibition, and/or Syk inhibition play a role, e.g. diseases or
disorders mediated by T lymphocytes, B lymphocytes, mast cells
and/or eosinophils e.g. acute or chronic rejection of organ or
tissue allo- or xenografts, atheriosclerosis, vascular occlusion
due to vacular injury such as angioplasty, restenosis,
hypertension, heart failure, chronic obstructive pulmonary disease,
CNS disease such as Alzheimer disease or amyotrophic lateral
sclerosis, cancer, infectious disease such as AIDS, septic shock or
adult respiratory distress syndrome, ischemia/reperfusion injury
e.g. myocardial infarction, stroke, gut ischemia, renal ailure or
hermorrhage shock, or traumatic shock. The agent of the invention
are also useful in the treatment and/or prevention of acute or
chronic inflammatory diseases or disorders or autoimmune diseases
e.g. rheumatoid arthritis, osteoarthritis, systemic lupus
erythematosus, Hashimoto's thyroidis, multiple sclerosis,
myasthenia gravis, diabetes (type I and II) and the disorders
associated with therewith, respiratory diseases such as asthma or
inflammatory liver injury, inflammatory glomerular injury,
cutaneous manifestations of immunologically-mediated disorders or
illnesses, inflammatory and hyperproliferative skin diseases (such
as psoriasis, atopic dermatitis, allergic contact dermatitis,
irritant contact dermatitis and further eczematous dermatitises,
seborrhoeic dermatitis), inflammatory eye diseases, e.g. Sjoegren's
syndrome, keratoconjunctivitis or uveitis, inflammatory bowel
disease, Crohn's disease or ulcerative colitis.
[0091] Compounds of the invention are also useful in the prevention
or treatment of conditions caused by a malfunction of signal
cascades connected with FAK, e.g. tumors, for example brain and
other central nervous system tumors (eg. tumors of the meninges,
brain, spinal cord, cranial nerves and other parts of central
nervous system, e.g. glioblastomas or medulla blastomas); head
and/or neck cancer; breast tumors; circulatory system tumors (e.g.
heart, mediastinum and pleura, and other intrathoracic organs,
vascular tumors and tumor-associated vascular tissue); excretory
system tumors (e.g. kidney, renal pelvis, ureter, bladder, other
and unspecified urinary organs); gastrointestinal tract tumors
(e.g. oesophagus, stomach, small intestine, colon, colorectal,
rectosigmoid junction, rectum, anus and anal canal), tumors
involving the liver and intrahepatic bile ducts, gall bladder,
other and unspecified parts of biliary tract, pancreas, other and
digestive organs); head and neck; oral cavity (lip, tongue, gum,
floor of mouth, palate, and other parts of mouth, parotid gland,
and other parts of the salivary glands, tonsil, oropharynx,
nasopharynx, pyriform sinus, hypopharynx, and other sites in the
lip, oral cavity and pharynx); reproductive system tumors (e.g.
vulva, vagina, Cervix uteri, Corpus uteri, uterus, ovary, and other
sites associated with female genital organs, placenta, penis,
prostate, testis, and other sites associated with male genital
organs); respiratory tract tumors (e.g. nasal cavity and middle
ear, accessory sinuses, larynx, trachea, bronchus and lung, e.g.
small cell lung cancer or non-small cell lung cancer); skeletal
system tumors (e.g. bone and articular cartilage of limbs, bone
articular cartilage and other sites); skin tumors (e.g. malignant
melanoma of the skin, non-melanoma skin cancer, basal cell
carcinoma of skin, squamous cell carcinoma of skin, mesothelioma,
Kaposi's sarcoma); and tumors involving other tissues incluing
peripheral nerves and autonomic nervous system, connective and soft
tissue, retroperitoneum and peritoneum, eye and adnexa, thyroid,
adrenal gland and other endocrine glands and related structures,
secondary and unspecified malignant neoplasm of lymph nodes,
secondary malignant neoplasm of respiratory and digestive systems
and secondary malignant neoplasm of other sites, tumors of blood
and lymphatic system (e.g. Hodgkin's disease, Non-Hodgkin's
lymphoma, Burkitt's lymphoma, AIDS-related lymphomas, malignant
immunoproliferative diseases, multiple myeloma and malignant plasma
cell neoplasms, lymphoid leukemia, acute or chronic myeloid
leukemia, acute or chronic lymphocytic leukemia, monocytic
leukemia, other leukemias of specified cell type, leukemia of
unspecified cell type, other and unspecified malignant neoplasms of
lymphoid, haematopoietic and related tissues, for example diffuse
large cell lymphoma, T-cell lymphoma or cutaneous T-cell lymphoma).
Myeloid cancer includes e.g. acute or chronic myeloid
leukaemia.
[0092] Where hereinbefore and subsequently a tumor, a tumor
disease, a carcinoma or a cancer is mentioned, also metastasis in
the original organ or tissue and/or in any other location are
implied alternatively or in addition, whatever the location of the
tumor and/or metastasis is.
[0093] The compositions of the invention may be administered by any
conventional route, in particular parenterally, for example in the
form of injectable solutions or suspensions, enterally, e.g.
orally, for example in the form of tablets or capsules, topically,
e.g. in the form of lotions, gels, ointments or creams, or in a
nasal or a suppository form. Pharmaceutical compositions comprising
an agent of the invention in association with at least one
pharmaceutical acceptable carrier or diluent may be manufactured in
conventional manner by mixing with a pharmaceutically acceptable
carrier or diluent. Unit dosage forms for oral administration
contain, for example, from about 0.1 mg to about 500 mg of active
substance. Topical administration is e.g. to the skin. A further
form of topical administration is to the eye.
[0094] The compounds of formula I may be administered in free form
or in pharmaceutically acceptable salt form, e.g. as indicated
above. Such salts may be prepared in conventional manner and
exhibit the same order of activity as the free compounds.
[0095] In accordance with the foregoing, the present invention also
provides:
(1) A compound of formula I or a pharmaceutically acceptable salt
thereof, for use as a pharmaceutical; (2) A compound of formula I
or a pharmaceutically acceptable salt thereof, for use as a ZAP-70,
FAK and/or Syk tyrosine kinase inhibitor, for example for use in
any of the particular indications hereinbefore set forth; (3) A
pharmaceutical composition, e.g. for use in any of the indications
herein before set forth, comprising a compound of formula I or a
pharmaceutically acceptable salt thereof, together with one or more
pharmaceutically acceptable diluents or carriers therefor. (4) A
method for the treatment of any of particular indication
hereinbefore set forth in a subject in need thereof which comprises
administering an effective amount of a compound of formula I or a
pharmaceutically acceptable salt thereof; (5) The use of a compound
of formula I or a pharmaceutically acceptable salt thereof, for the
manufacture of a medicament for the treatment or prevention of a
disease or condition in which ZAP-70, FAK and/or Syk tyrosine
kinase activation plays a role or is implicated; e.g. as discussed
above.
[0096] Compounds of the invention may be administered as the sole
active ingredient or together with other drugs useful against
neoplastic diseases, inflammatory disorders or in immunomodulating
regimens. For example, the compounds of the invention may be used
in combination with an active agent effective in various diseases
as described above, e.g. with cyclosporins, rapamycins or
ascomycins, or their immunosuppressive analogs or derivatives, e.g.
cyclosporin A, cyclosporin G, Is a tx247, FK-506, sirolimus or
everolimus; CCI-779, ABT578, AP23573, corticosteroids e.g.
prednisone; cyclophosphamide; azathioprene; methotrexate; gold
salts, sulfasalazine, antimalarials; leflunomide; mizoribine;
mycophenolic acid; mycophenolate mofetil; 15-deoxyspergualine; an
EDG receptor agonist having accelerating lymphocyte homing
activity, e.g FTY720 or an analogue thereof, immuno-suppressive
monoclonal antibodies, e.g. monoclonal antibodies to leukocyte
receptors, e.g. MHC, CD2, CD3, CD4, CD7, CD25, CD28, CD40, CD45,
CD58, CD80, CD86, CD152, CD137, CD154, ICOS, LFA-1, VLA-4 or their
ligands; or other immunomodulatory compounds, e.g. CTLA4Ig.
[0097] A compound of formula I may also be used to advantage in
combination with other antiproliferative agents. Such
antiproliferative agents include, but are not limited to aromatase
inhibitors, antiestrogens, topoisomerase I inhibitors,
topoisomerase II inhibitors, microtubule active agents, alkylating
agents, histone deacetylase inhibitors, farnesyl transferase
inhibitors, COX-2 inhibitors, MMP inhibitors, mTOR inhibitors,
antineoplastic antimetabolites, platin compounds, compounds
decreasing the protein kinase activity and further anti-angiogenic
compounds, gonadorelin agonists, anti-androgens, bengamides,
bisphosphonates, antiproliferative antibodies and temozolomide
(TEMODAL.RTM.).
[0098] The term "aromatase inhibitors" as used herein relates to
compounds which inhibit the estrogen production, i.e. the
conversion of the substrates androstenedione and testosterone to
estrone and estradiol, respectively. The term includes, but is not
limited to steroids, especially exemestane and formestane and, in
particular, non-steroids, especially aminoglutethimide, vorozole,
fadrozole, anastrozole and, very especially, letrozole. A
combination of the invention comprising an antineoplastic agent
which is an aromatase inhibitor may particularly be useful for the
treatment of hormone receptor positive breast tumors.
[0099] The term "antiestrogens" as used herein relates to compounds
which antagonize the effect of estrogens at the estrogen receptor
level. The term includes, but is not limited to tamoxifen,
fulvestrant, raloxifene and raloxifene hydrochloride.
[0100] The term "topoisomerase I inhibitors" as used herein
includes, but is not limited to topotecan, irinotecan,
9-nitrocamptothecin and the macromolecular camptothecin conjugate
PNU-166148 (compound A1 in WO99/17804).
[0101] The term "topoisomerase II inhibitors" as used herein
includes, but is not limited to the antracyclines doxorubicin
(including liposomal formulation, e.g. CAELYX.TM.), epirubicin,
idarubicin and nemorubicin, the anthraquinones mitoxantrone and
losoxantrone, and the podophillotoxines etoposide and
teniposide.
[0102] The term "microtubule active agents" relates to microtubule
stabilizing and microtubule destabilizing agents including, but not
limited to the taxanes paclitaxel and docetaxel, the vinca
alkaloids, e.g., vinblastine, especially vinblastine sulfate,
vincristine especially vincristine sulfate, and vinorelbine,
discodermolide and epothilones, such as epothilone B and D.
[0103] The term "alkylating agents" as used herein includes, but is
not limited to cyclophosphamide, ifosfamide and melphalan.
[0104] The term "histone deacetylase inhibitors" relates to
compounds which inhibit the histone deacetylase and which possess
antiproliferative activity.
[0105] The term "farnesyl transferase inhibitors" relates to
compounds which inhibit the farnesyl transferase and which possess
antiproliferative activity.
[0106] The term "COX-2 inhibitors" relates to compounds which
inhibit the cyclooxygenase type 2 enyzme (COX-2) and which possess
antiproliferative activity such as celecoxib (Celebrex.RTM.),
rofecoxib (Vioxx.RTM.) and lumiracoxib (COX189).
[0107] The term "MMP inhibitors" relates to compounds which inhibit
the matrix metalloproteinase (MMP) and which possess
antiproliferative activity.
[0108] The term "antineoplastic antimetabolites" includes, but is
not limited to 5-fluorouracil, tegafur, capecitabine, cladribine,
cytarabine, fludarabine phosphate, fluorouridine, gemcitabine,
6-mercaptopurine, hydroxyurea, methotrexate, edatrexate and salts
of such compounds, and furthermore ZD 1694 (RALTITREXED.TM.),
LY231514 (ALIMTA.TM.), LY264618 (LOMOTREXOL.TM.) and OGT719.
[0109] The term "platin compounds" as used herein includes, but is
not limited to carboplatin, cis-platin and oxaliplatin.
[0110] The term "compounds decreasing the protein kinase activity
and further anti-angiogenic compounds" as used herein includes, but
is not limited to compounds which decrease the activity of e.g. the
Vascular Endothelial Growth Factor (VEGF), the Epidermal Growth
Factor (EGF), c-Src, protein kinase C, Platelet-derived Growth
Factor (PDGF), Bcr-Abl tyrosine kinase, c-kit, Flt-3 and
Insulin-like Growth Factor I Receptor (IGF-IR) and Cyclin-dependent
kinases (CDKs), and anti-angiogenic compounds having another
mechanism of action than decreasing the protein kinase
activity.
[0111] Compounds which decrease the activity of VEGF are especially
compounds which inhibit the VEGF receptor, especially the tyrosine
kinase activity of the VEGF receptor, and compounds binding to
VEGF, and are in particular those compounds, proteins and
monoclonal antibodies generically and specifically disclosed in WO
98/35958 (describing compounds of formula I), WO 00/09495, WO
00/27820, WO 00/59509, WO 98/11223, WO 00/27819, WO 01/55114, WO
01/58899 and EP 0 769 947; those as described by M. Prewett et al
in Cancer Research 59 (1999) 5209-5218, by F. Yuan et al in Proc.
Natl. Acad. Sci. USA, vol. 93, pp. 14765-14770, December 1996, by
Z. Zhu et al in Cancer Res. 58, 1998, 3209-3214, and by J. Mordenti
et al in Toxicologic Pathology, vol. 27, no. 1, pp 14-21, 1999; in
WO 00/37502 and WO 94/10202; Angiostatin.TM., described by M. S.
O'Reilly et al, Cell 79, 1994, 315-328; and Endostatin.TM.,
described by M. S. O'Reilly et al, Cell 88, 1997, 277-285;
compounds which decrease the activity of EGF are especially
compounds which inhibit the EGF receptor, especially the tyrosine
kinase activity of the EGF receptor, and compounds binding to EGF,
and are in particular those compounds generically and specifically
disclosed in WO 97/02266 (describing compounds of formula IV), EP 0
564 409, WO 99/03854, EP 0520722, EP 0 566 226, EP 0 787 722, EP 0
837 063, WO 98/10767, WO 97/30034, WO 97/49688, WO 97/38983 and,
especially, WO 96/33980; compounds which decrease the activity of
c-Src include, but are not limited to, compounds inhibiting the
c-Src protein tyrosine kinase activity as defined below and to SH2
interaction inhibitors such as those disclosed in WO97/07131 and
WO97/08193; compounds inhibiting the c-Src protein tyrosine kinase
activity include, but are not limited to, compounds belonging to
the structure classes of pyrrolopyrimidines, especially
pyrrolo[2,3-d]pyrimidines, purines, pyrazopyrimidines, especially
pyrazo[3,4-d]pyrimidines, pyrazopyrimidines, especially
pyrazo[3,4-d]pyrimidines and pyridopyrimidines, especially
pyrido[2,3-d]pyrimidines. Preferably, the term relates to those
compounds disclosed in WO 96/10028, WO 97/28161, WO97/32879 and
WO97/49706; compounds which decreases the activity of the protein
kinase C are especially those staurosporine derivatives disclosed
in EP 0 296 110 (pharmaceutical preparation described in WO
00/48571) which compounds are protein kinase C inhibitors; further
specific compounds that decrease protein kinase activity and which
may also be used in combination with the compounds of the present
invention are Imatinib (Gleevec.RTM./Glivec.RTM.), PKC412,
Iressa.TM. (ZD1839), PK1166, PTK787, ZD6474, GW2016, CHIR-200131,
CEP-7055/CEP-5214, CP-547632 and KRN-633; anti-angiogenic compounds
having another mechanism of action than decreasing the protein
kinase activity include, but are not limited to e.g. thalidomide
(THALOMID), celecoxib (Celebrex), SU5416 and ZD6126.
[0112] The term "gonadorelin agonist" as used herein includes, but
is not limited to abarelix, goserelin and goserelin acetate.
Goserelin is disclosed in U.S. Pat. No. 4,100,274.
[0113] The term "anti-androgens" as used herein includes, but is
not limited to bicalutamide (CASODEX.TM.), which can be formulated,
e.g. as disclosed in U.S. Pat. No. 4,636,505.
[0114] The term "bengamides" relates to bengamides and derivatives
thereof having aniproliferative properties.
[0115] The term "bisphosphonates" as used herein includes, but is
not limited to etridonic acid, clodronic acid, tiludronic acid,
pamidronic acid, alendronic acid, ibandronic acid, risedronic acid
and zoledronic acid.
[0116] The term "antiproliferative antibodies" as used herein
includes, but is not limited to trastuzumab (Herceptin.TM.),
Trastuzumab-DM1, erlotinib (Tarceva.TM.), bevacizumab
(Avastin.TM.), rituximab (Rituxan.RTM.), PRO64553 (anti-CD40) and
2C4 Antibody.
[0117] The structure of the active agents identified by code nos.,
generic or trade names may be taken from the actual edition of the
standard compendium "The Merck Index" or from databases, e.g.
Patents International (e.g. IMS World Publications).
[0118] In accordance with the foregoing the present invention
provides in a yet further aspect:
(6) A method as defined above comprising co-administration, e.g.
concomitantly or in sequence, of a therapeutically effective amount
of a) a compound of formula I or a pharmaceutically acceptable salt
thereof, and b) a second drug substance, said second drug substance
being for example for use in any of the particular indications
hereinbefore set forth. (7) A combination comprising a
therapeutically effective amount of a ZAP-70, FAK and/or Syk
tyrosine kinase inhibitor, e.g. a compound of formula I or a
pharmaceutically acceptable salt thereof, and a second drug
substance, said second drug substance being for example as
disclosed above.
[0119] Where a ZAP-70, FAK and/or Syk tyrosine kinase inhibitor,
e.g. a compound of formula I, is administered in conjunction with
other immunosuppressive/immunomodulatory, anti-inflammatory or
antineoplastic agent, e.g. as disclosed above, dosages of the
co-administered drug or agent will of course vary depending on the
type of co-drug or -agent employed, or the specific drug or agent
used, or the condition being treated and so forth.
[0120] Representative FAK inhibitors are the compounds of Examples
Nos. 187-203 and 209-212.
Sequence CWU 1
1
4114PRTArtificial sequenceLAT-11 is a synthetic peptid substrate to
be used in ZAP-70 kinase assay 1Glu Glu Gly Ala Pro Asp Tyr Glu Asn
Leu Gln Gln Leu Asn 1 5 10 211PRTArtificial sequenceBiot-Y397 is a
synthetic peptid substrate of human FAK protein tyrosine kinase
(amino acid sequence 392 to 402 of human biotin) 2Ser Glu Thr Asp
Asp Tyr Ala Glu Ile Ile Asp 1 5 10 321DNAArtificial sequencePCR
primer for preparing human FAK cDNA 3atggcagctg cttaccttga c
21421DNAArtificial sequencePCR primer for preparing human FAK cDNA
4tcagtgtggt ctcgtctgcc c 21
* * * * *