U.S. patent application number 13/899179 was filed with the patent office on 2013-12-26 for recombinant probiotic bacteria for the prevention and treatment of inflammatory bowel disease (ibd) and irritable bowel syndrome (ibs).
This patent application is currently assigned to INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE. The applicant listed for this patent is INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE (INRA), INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE, UNIVERSITE PARIS DIDEROT - PARIS 7. Invention is credited to Luis Bermudez-Humaran, Philippe Langella, Jean-Michel Sallenave, Nathalie Vergnolle.
Application Number | 20130344033 13/899179 |
Document ID | / |
Family ID | 42224980 |
Filed Date | 2013-12-26 |
United States Patent
Application |
20130344033 |
Kind Code |
A1 |
Vergnolle; Nathalie ; et
al. |
December 26, 2013 |
RECOMBINANT PROBIOTIC BACTERIA FOR THE PREVENTION AND TREATMENT OF
INFLAMMATORY BOWEL DISEASE (IBD) AND IRRITABLE BOWEL SYNDROME
(IBS)
Abstract
The present invention relates to the general field of therapy of
Inflammatory Bowel Disease (IBD) and/or Irritable Bowel Syndrome
(IBS). Thus, the invention relates to a molecule selected from the
trappin-2 protein or an active fraction thereof, a member of the
WAP family proteins or an active fraction thereof or a member of
the Serpin family proteins or an active fraction thereof for the
treatment of Irritable Bowel Syndrome (IBS). The invention also
relates to a recombinant food-grade bacterium comprising a gene
selected from a gene coding for the trappin-2 protein or an active
fraction thereof, a gene coding for a member of the WAP family
proteins or an active fraction thereof, or a gene coding for a
member of the Serpin family proteins or an active fraction
thereof.
Inventors: |
Vergnolle; Nathalie;
(Toulouse, FR) ; Sallenave; Jean-Michel; (Paris,
FR) ; Langella; Philippe; (Jouy en Josas, FR)
; Bermudez-Humaran; Luis; (Jouy en Josas, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE
UNIVERSITE PARIS DIDEROT - PARIS 7
INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE (INRA) |
Paris
Paris
Paris |
|
FR
FR
FR |
|
|
Assignee: |
INSTITUT NATIONAL DE LA SANTE ET DE
LA RECHERCHE MEDICALE
Paris
FR
UNIVERSITE PARIS DIDEROT - PARIS 7
Paris
FR
INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE (INRA)
Paris
FR
|
Family ID: |
42224980 |
Appl. No.: |
13/899179 |
Filed: |
May 21, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13357063 |
Jan 24, 2012 |
|
|
|
13899179 |
|
|
|
|
PCT/EP2011/050489 |
Jan 14, 2011 |
|
|
|
13357063 |
|
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/252.3; 530/350 |
Current CPC
Class: |
A61P 13/00 20180101;
C07K 14/811 20130101; C07K 14/8121 20130101; C07K 14/8125 20130101;
A61P 1/00 20180101; A61P 1/04 20180101; A61K 35/74 20130101; A61P
11/00 20180101; A61P 19/02 20180101; A61P 29/00 20180101; C12N
15/746 20130101; A61P 15/00 20180101; C07K 14/81 20130101 |
Class at
Publication: |
424/93.2 ;
530/350; 435/252.3 |
International
Class: |
C12N 15/74 20060101
C12N015/74 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 14, 2010 |
EP |
10305045.6 |
Claims
1. A molecule selected from the trappin-2 protein or an active
fraction of the trappin-2 protein, a member of the WAP Serpin
family proteins or an active fraction of a member of the WAP family
proteins or a member of the Serpin family or an active fraction of
a member of the Serpin family for the treatment of Irritable Bowel
Syndrome (IBS).
2. A molecule according to the claim 1 expressed by a genetically
engineered host cell.
3. A recombinant food-grade bacterium comprising a recombinant gene
selected from a gene coding for the trappin-2 protein or an active
fraction of the trappin-2 protein, a gene coding for a member of
the WAP family proteins or an active fraction of a member of the
WAP family proteins or a gene coding for a member of the Serpin
family proteins or an active fraction of a member of the Serpin
family proteins.
4. A bacterium according to claim 3 wherein the food-grade
bacterium is a probiotic bacterium.
5. A bacterium according to claim 3 wherein the bacterium comprises
a defective auxotrophic gene, whereby survival of said bacterium
depends upon the presence of specific compounds.
6. A bacterium according to claim 5 wherein the defective
auxotrophic gene is selected from the thyA gene or the alr
gene.
7. A bacterium according to claim 5 wherein the selected gene is
inserted in place of the defective auxotrophic gene.
8. A bacterium according to claim 7 wherein the gene coding for the
WAP or Serpin family protein encodes the trappin-2 protein or the
alpha 1-antitrypsin protein.
9. A bacterium according to claim 3 selected from Lactic Acid
Bacterium, Bifidobacterium, Lactococcus or Lactobacillus.
10. A bacterium according to claim 9 selected from Lactococcus
lactis, Lactococcus lactis htrA, Lactobacillus casei, Lactobacillus
plantarum, and Bifidobacterium longum.
11. A method for treating an inflammatory condition comprising
administering the bacterium of claim 3.
12. A method according to claim 11 wherein the inflammatory
condition is selected from Inflammatory Bowel Disease, Irritable
Bowel Syndrome, inflammatory pulmonary disease, inflammatory
articular disease or inflammatory urogenital disease.
13. A therapeutic composition comprising a bacterium according to
claim 3.
14. A method for treating an inflammatory condition comprising
administering the composition of claim 13.
15. A method according to claim 14 wherein the inflammatory
condition is selected from Inflammatory Bowel Disease, Irritable
Bowel Syndrome, inflammatory pulmonary disease, inflammatory
articular disease or inflammatory urogenital disease.
Description
RELATED APPLICATIONS AND INCORPORATION BY REFERENCE
[0001] This application is a continuation-in-part application of
international patent application Serial No. PCT/EP2011/050489 filed
14 Jan. 2011, which published as PCT Publication No. WO 2011/086172
on 21 Jul. 2011, which claims benefit of European patent
application Serial No. 10305045.6 filed 14 Jan. 2010.
[0002] The foregoing applications, and all documents cited therein
or during their prosecution ("appin cited documents") and all
documents cited or referenced in the appin cited documents, and all
documents cited or referenced herein ("herein cited documents"),
and all documents cited or referenced in herein cited documents,
together with any manufacturer's instructions, descriptions,
product specifications, and product sheets for any products
mentioned herein or in any document incorporated by reference
herein, are hereby incorporated herein by reference, and may be
employed in the practice of the invention. More specifically, all
referenced documents are incorporated by reference to the same
extent as if each individual document was specifically and
individually indicated to be incorporated by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to the general field of
therapy of gut inflammatory diseases such as Inflammatory Bowel
Diseases (IBD), pulmonary diseases such as cystic fibrosis and
broncho-pulmonary chronic obstructive diseases (BPCO), inflammatory
articular disease (such as osteoarthritis), inflammatory urogenital
disease, and diseases associated with chronic visceral pain
symptoms, such as Irritable Bowel Syndrome (IBS).
BACKGROUND OF THE INVENTION
[0004] The treatment of chronic inflammatory disorders such as IBD
represents a major medical challenge as they afflict several
millions of persons. Its highest incidence is among developed
countries and has been increasing steadily over the past 3 decades.
Current therapies for IBD strongly need to be improved, a high
percentage of patients (between 20 and 40%) being resistant to any
forms of treatments, severe side effects and high costs being also
associated to the currently available drugs (glucocorticoids and
monoclonal antibody therapies). In addition, the mechanisms
involved in the pathogenesis of IBD are not fully understood, and
the development of more effective treatments or even cures for IBD
depends upon better understanding the regulation of the
inflammatory response. Several studies have demonstrated a crucial
role for proteases in the maintenance of chronic inflammatory
response of the gastrointestinal tract (GIT) [Vergnolle, N. 2005;
Cenac, N. et al., 2007; Hyun, E., et al., 2008; Vergnolle, N., et
al., 2004]. Therefore, endogenous protease inhibitors seem to be
crucial to the control of intestinal inflammatory responses.
[0005] Based on this knowledge, the inventors propose that delivery
of those protease inhibitors into the GIT, could be used for the
treatment of an IBD and/or irritable Bowel syndrome (IBS).
[0006] The use of probiotics for the treatment of IBD has now been
proposed for several years and different studies have reported some
beneficial effects of these probiotic bacteria tested alone or in
combination [Hedin, C. et al., 2007; Sartor, R. B. 2004]. The
strategy of using recombinant non-pathogenic food-grade bacteria as
delivery vehicles of anti-inflammatory molecules at the mucosal
level has already been used to deliver the anti-inflammatory
cytokine IL-10 [Steidler, L., et al., 2000]. Phase I clinical
trials have demonstrated that orally given Lactococcus lactis
strain expressing IL-10 cytokine, was safe as no serious
side-effects occurred in those patients [Braat, H., et al., 2006].
However, the decreased disease activity in Crohn's disease patients
treated with IL-10 recombinant L. lactis was somehow limited. This
limited efficacy could be explained by the fact that IL-10 delivery
has always been reported to have only discrete beneficial effects
against the development of colitis [Braat, H. et al., 2003].
[0007] Citation or identification of any document in this
application is not an admission that such document is available as
prior art to the present invention.
SUMMARY OF THE INVENTION
[0008] The invention is based on the discovery that the use of a
food-grade bacterium to deliver an anti-inflammatory molecule such
as trappin-2 provides a safety and better efficiency than existing
treatments. A better choice in the nature of the anti-inflammatory
molecule to be delivered by L. lactis, could thus considerably
improve the efficacy of treatment. Here, the inventors propose to
use a food-grade bacterium to express and deliver anti-protease
trappin-2 into the gut.
[0009] Thus, the invention relates to a molecule selected from the
trappin-2 protein or an active fraction of the trappin-2 protein, a
member of the WAP family proteins or an active fraction of a member
of the WAP family proteins or a member of the Serpin family
proteins or an active fraction of a member of the Serpin family
proteins for the treatment of Irritable Bowel Syndrome (IBS).
[0010] A further object of the invention relates to a recombinant
food-grade bacterium comprising a gene selected from a gene coding
for the trappin-2 protein or an active fraction of the trappin-2
protein, a gene coding for a member of the WAP family proteins or
an active fraction of a member of the WAP family proteins, or a
gene coding for a member of the Serpin family proteins or an active
fraction of a member of the Serpin family proteins.
[0011] Another aspect of the invention relates to a therapeutic
composition comprising a recombinant food-grade bacterium as
defined above.
[0012] Accordingly, it is an object of the invention to not
encompass within the invention any previously known product,
process of making the product, or method of using the product such
that Applicants reserve the right and hereby disclose a disclaimer
of any previously known product, process, or method. It is further
noted that the invention does not intend to encompass within the
scope of the invention any product, process, or making of the
product or method of using the product, which does not meet the
written description and enablement requirements of the USPTO (35
U.S.C. .sctn.112, first paragraph) or the EPO (Article 83 of the
EPC), such that Applicants reserve the right and hereby disclose a
disclaimer of any previously described product, process of making
the product, or method of using the product.
[0013] It is noted that in this disclosure and particularly in the
claims and/or paragraphs, terms such as "comprises", "comprised",
"comprising" and the like can have the meaning attributed to it in
U.S. Patent law; e.g., they can mean "includes", "included",
"including", and the like; and that terms such as "consisting
essentially of" and "consists essentially of" have the meaning
ascribed to them in U.S. Patent law, e.g., they allow for elements
not explicitly recited, but exclude elements that are found in the
prior art or that affect a basic or novel characteristic of the
invention.
[0014] These and other embodiments are disclosed or are obvious
from and encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The following detailed description, given by way of example,
but not intended to limit the invention solely to the specific
embodiments described, may best be understood in conjunction with
the accompanying drawings.
[0016] FIGS. 1A-D: Weight differences (A), macroscopic score (B),
Wall thickness (C), and myeloperoxydase (MPO) activity (D) in
colonic tissues from mice that had water or water+DSS (3%) in their
drinking bottles, and that received daily oral treatments for
7-days with wild-type L. lactis, or recombinant L. lactis strains
expressing either Elafin or IL-10. Significant differences compared
to PBS-treated mice that have received DSS were noted * for
p<0.05, ** for p<0.01, and *** for p<0.005. Significant
differences compared to wild-type L. lactis-treated mice were noted
.PSI. for p<0.05, .PSI..PSI. for p<0.01, and .PSI..PSI..PSI.
for p<0.05. Significant differences between PBS+DSS group and
the PBS-water group were noted # for p<0.05, ## for p<0.01,
and ### for p<0.005. Significant differences compared to the
IL-10 recombinant L. lactis group were noted .omega. for p<0.05,
.omega..omega. for p<0.01, and .omega..omega..omega. for
p<0.005.
[0017] FIGS. 2A-B: Trypsin-like activity (A) and elastase activity
(B) in washes of the colonic lumen of mice that had water or
water+DSS (3%) in their drinking bottles, and that received daily
oral treatments for 7-days with wild-type L. lactis, or recombinant
L. lactis strains expressing either Elafin or IL-10. .epsilon.
means undetectable levels. Significant differences compared to
PBS-treated mice that have received DSS were noted * for p<0.05,
** for p<0.01. Significant differences compared to wild-type L.
lactis-treated mice were noted .PSI. for p<0.05. Significant
differences between PBS+DSS group and the PBS-water group were
noted # for p<0.05, ## for p<0.01, and ### for
p<0.005.
[0018] FIGS. 3A-C: Macroscopic score (A), Wall thickness (B), and
myeloperoxydase (MPO) activity (C) in colonic tissues from mice
that had water or water+DSS (3%) in their drinking bottles, and
that received daily oral treatments for 7-days with wild-type Lb.
casei, or recombinant Lb. casei strains expressing Elafin.
Significant differences compared to PBS-treated mice that have
received DSS were noted * for p<0.05, ** for p<0.01, and ***
for p<0.005. Significant differences compared to wild-type Lb.
casei-treated mice were noted .PSI. for p<0.05, .PSI..PSI. for
p<0.01, and .PSI..PSI..PSI. for p<0.005.
[0019] FIGS. 4A-B: Trypsin-like activity (A) and elastase activity
(B) in washes of the colonic lumen of mice that had water or
water+DSS (3%) in their drinking bottles, and that received daily
oral treatments for 7-days with wild-type Lb. casei, or recombinant
Lb. casei expressing elafin. Significant differences compared to
PBS-treated mice that have received DSS were noted * for p<0.05,
and significant differences compared to wild-type Lb. casei-treated
mice were noted .PSI. for p<0.05, and .PSI..PSI. for
p<0.01.
[0020] FIGS. 5A-G: Protein concentration of RANTES (A), TNF.alpha.
(B), IL-6 (C), MCP-1 (D), KC (E), INF.gamma. (F) and IL-17 (G)
detected in colonic tissues from mice that had water or water+DSS
(3%) in their drinking bottles, and that received daily oral
treatments for 7-days with wild-type Lb. casei, or recombinant Lb.
casei expressing Elafin. .epsilon. means undetectable levels.
Significant differences compared to PBS-treated mice that have
received DSS were noted * for p<0.05, ** for p<0.01, and ***
for p<0.005. .PSI. showed significant differences for p<0.05,
compared to mice treated with wild-type L. lactis. Significant
differences between PBS+DSS group and the PBS-water group were
noted # for p<0.05, ## for p<0.01, and ### for
p<0.005.
[0021] FIGS. 6A-E: Protein concentration of IL-2 (A), IL-4 (B),
IL-5 (C), IL-10 (D) and IL-13 (E) detected in colonic tissues from
mice that had water or water+DSS (3%) in their drinking bottles,
and that received daily oral treatments for 7-days with wild-type
Lb. casei, or recombinant Lb. casei expressing Elafin. Significant
differences compared to PBS-treated mice that have received DSS
were noted * for p<0.05, and ** for p<0.01. Significant
differences compared to mice treated with wild-type Lb. casei were
noted .PSI. for p<0.05, and .PSI..PSI. for p<0.01.
[0022] FIGS. 7A-B: Total number of pain behaviors (A) or number of
abdominal contractions and licking, stretching and squashing
behaviors (B) in mice that have received intracolonically PBS
(n=5), or Mustard oil (0.01% (v/v) in ethanol 70%), and that have
received in for the previous 7-days, pre-treatments by oral gavage
of PBS (n=8), wild-type L. lactis (n=8), or recombinant L. lactis
expressing either elafin (n=8) or IL-10 (n=5). Significant
differences compared to PBS-treated mice that have received mustard
oil were noted * for p<0.05, ** for p<0.01, and *** for
p<0.005. .PSI. showed significant differences for p<0.05,
compared to mice treated with wild-type L. lactis.
[0023] FIG. 8: Elafin secreted by L. lactis wt and htrA strains.
Western blot experiments performed with antibodies anti-elafin on
cellular (C) and supernatant (S) extracts of wild type (wt) or htrA
(htrA) strains. Elafin production was induced by nisin from
exponential-phase cultures of wt or htrA strains (both containing
the expression vector where elafin gene expression may be induced
by nisin addition).
[0024] FIGS. 9A-C: Protective effects of L. lactis wt and htrA
mutant strains in DSS 5%-induced colitis model. Macroscopic (A),
histological damages (B) and MPO activities (C) were evaluated in
different groups of 10 mice treated either with water (negative
control) or with DSS 5%. Two first control groups were treated i)
with water and orally fed with PBS (negative control group) and ii)
with DSS 5% and orally fed with PBS (positive control group). The
other groups were all treated with DSS 5% and with either wt strain
(WT), wt strain expressing elafin (Elafin) and htrA mutant strain
expressing elafin (Elafin+).
[0025] FIGS. 10A-C: Protective effects of L. casei wt strain and
SOD-expressing, elafin-expressing and IL-10-expressing L. casei
strains in DSS 5%-induced colitis model. Macroscopic (A),
histological damages (B) and MPO activities (C) were evaluated in
different groups of 10 mice treated either with water (negative
control) or with DSS 5%. Two first control groups were treated i)
with water and orally fed with PBS (negative control group) and ii)
with DSS 5% and orally fed with PBS (positive control group). The
other groups were all treated with DSS 5% and with either L. casei
wt strain (WT) or L. casei strains expressing superoxide dismutase
(SOD), elafin (Elafin) or IL-10. * and ** indicate that the data
are significantly different (P<0.05) from the data obtained with
L. casei wt.
[0026] FIG. 11: Myeloperoxydase (MPO) activity (D) in colonic
tissues from mice. Myeloperoxydase (MPO) activity (D) was measured
in colonic tissues from mice that had water or water+DSS (3%) in
their clinking bottles, and that received daily oral treatments for
7-days with i) WT L. lactis, recombinant L. lactis and L. lactis
htrA strains expressing either Elafin or IL-10 and with ii) L.
casei wt strain and SOD-expressing, elafin-expressing and
IL-10-expressing L. casei strains. * and ** indicate that the data
are significantly different (P<0.05) from the data obtained with
L. casei wt.
[0027] FIG. 12: Elafin secretion in a L. lactis WT strain where the
elafin gene is expressed under the control of an EDTA-inducible
promoter [Llull D and Poquet I. 2004; EP 1 537 215 and FR 98
16462]. The L. lactis WT strain expressing elafin was grown
overnight in the presence (+) or not (-) of EDTA, a chelator agent
(in this construct, elafin gene expression is controlled by a
lactococcal promoter that may be induced by EDTA addition: on the
chromosome, this promoter controls the expression of genes encoding
an ABC uptake system specific for zinc and is depressed under zinc
starvation conditions that may be mimicked by EDTA addition).
Proteins were then extracted and fractionated between cell (C) and
supernatant fractions (S) and Western blot experiments were
performed using antibodies anti-elafin.
DETAILED DESCRIPTION OF THE INVENTION
[0028] As used herein, the term "trappin-2" (also known as elafin,
elafin-specific inhibitor (ESI) or SKALP for skin
anti-leucoprotease) of the WAP family, denotes a low molecular
weight (9.9 kDa) inhibitor of HNE (human neutrophil elastase) and
proteinase 3, which is secreted in the respiratory tract [Sallenave
et al., 1991 and 1993]. Along with (A1-Pi) and SLPI, trappin-2
comprises an integral part of the `anti-elastase shield` in the
lung. An exemplary sequence for human trappin-2 gene is deposited
in the database Genbank under accession number S58717.
[0029] As used herein, the term "WAP family" for "Whey Acidic
Protein" denotes a family of protein containing the trappin-2, and
the ps20.
[0030] As used herein, the term "Serpin family" for SERine Protease
INhibitors denotes a family of serine proteinase inhibitors which
are similar in amino acid sequence and mechanism of inhibition, but
differ in their specificity toward proteolytic enzymes. This family
includes alpha 1-antitrypsin (A1-Pi), angiotensinogen, ovalbumin,
antiplasmin, alpha 1-antichymotrypsin, thyroxine-binding protein,
complement 1 inactivators, antithrombin III, heparin cofactor II,
plasminogen inactivators, gene Y protein, placental plasminogen
activator inhibitor, and barley Z protein. This family does not
include the secretory leukocyte proteinase inhibitor (SLPI)
[Thierry Moreau et al., 2008]. Some members of the Serpin family
may be substrates rather than inhibitors of serine endopeptidases,
and some serpins occur in plants where their function is not
known.
[0031] As used herein, the term "alpha 1-antitrypsin protein"
denotes a glycoprotein. Alpha 1-antitrypsin is also referred to as
alpha-1 proteinase inhibitor (A1PI) because it is a serine protease
inhibitor (serpin), inhibiting a wide variety of proteases. It
protects tissues from enzymes of inflammatory cells, especially
elastase. An exemplary sequence for human Alpha 1-antitrypsin gene
is deposited in the database Genbank under accession number
NC008290.
[0032] As used herein, the term "an active fraction of denotes a
fraction of a protein with the activity of the complete protein".
For example, an active fraction of the trappin-2 protein denotes a
fraction of the protein which conserves the capacity to inhibit the
HNE or an active fraction of the Serpin family proteins denotes a
fraction of the protein which conserves the capacity of
inhibition.
[0033] As used herein, the term "food-grade bacterium" denotes a
bacterium that is widely used in fermented foods and possesses a
perfect safety profile recognized by the GRAS (Generally Recognized
As Safe) and QPS (Qualified Presumption of Safety) status in USA
and European Community, respectively. Such bacterium may be safely
in functional foods or food additives with allegations concerning
maintain in good health and well-being or prevention of
disease.
[0034] As used herein, the term "probiotic bacterium" denotes a
bacterium which ingested live in adequate quantities may exert
beneficial effects on the human health. They are now widely used as
a food additive for their health-promoting effects. Most of the
probiotic bacteria are Lactic Acid Bacterium (LAB) and among them
strains of the genera Lactobacillus and Bifidobacterium are the
most widely used probiotic bacteria.
[0035] As used herein, the term "thyA gene" denotes, the gene
coding for thymidylate synthase which is an enzyme generating
thymidine monophosphate (dTMP), which is subsequently
phosphorylated to thymidine triphosphate used in DNA synthesis and
repair.
[0036] As used herein, the term "Irritable Bowel Syndrome (IBS)" is
a term for a variety of pathological conditions causing discomfort
in the gastro-intestinal tract. It is a functional bowel disorder
characterized by chronic abdominal pain, discomfort, bloating, and
alteration of bowel habits in the absence of any organic cause.
[0037] As used herein, the term "inflammatory bowel diseases (IBD)"
is a group of inflammatory diseases of the colon and small
intestine. The major types of IBD are Crohn's disease, ulcerative
colitis and pouchitis.
[0038] A first object of the invention relates to a molecule
selected from the trappin-2 protein or an active fraction of the
trappin-2 protein, a member of the WAP family proteins or an active
fraction of a member of the WAP family proteins, or a molecule
selected from the Serpin family or an active fraction of the Serpin
family for the treatment of Irritable Bowel Syndrome (IBS).
[0039] In a preferred embodiment, the member of the Serpin family
may be the alpha 1-antitrypsin protein.
[0040] In a preferred embodiment, said fraction of the protein
comprises at least about 75% identity over said protein, even more
preferably at least about 80%, at least about 85%, at least about
90%, at least about 95%, at least about 97%, at least about
99%.
[0041] Typically said protein or fraction of the protein thereof
may be used in combination with an anti-inflammatory agent.
[0042] Proteins of the invention or fractions of the proteins
thereof may be produced by any technique known per se in the art,
such as, without limitation, any chemical, biological, genetic or
enzymatic technique, either alone or in combination(s).
[0043] Knowing the amino acid sequence of the desired sequence, one
skilled in the art may readily produce a relevant part of the said
proteins or fraction of the protein, by standard techniques for
production of proteins. For instance, they may be synthesized using
well-known solid phase method, preferably using a commercially
available protein synthesis apparatus (such as that made by Applied
Biosystems, Foster City, Calif.) and following the manufacturer's
instructions.
[0044] Alternatively, the proteins or fraction of the proteins of
the invention thereof may be synthesized by recombinant DNA
techniques as is now well-known in the art. For example, these
fragments may be obtained as DNA expression products after
incorporation of DNA sequences encoding the desired polypeptide
into expression vectors and introduction of such vectors into
suitable eukaryotic or prokaryotic hosts that will express the
desired protein or fraction of the protein, from which they may be
later using well-known techniques.
[0045] Proteins or fraction of the proteins of the invention
thereof may be used in an (e.g., purified) form or contained in a
vector, such as a membrane or lipid vesicle (e.g. a liposome).
[0046] A further object of the invention relates to a recombinant
food-grade bacterium comprising a gene selected from a gene coding
for the trappin-2 protein or an active fraction of the trappin-2
protein, a gene coding for a member of the WAP family proteins or
an active fraction of a member of the WAP family proteins, or a
gene coding for a member of the Serpin family proteins or an active
fraction of a member of the Serpin family proteins.
[0047] In a preferred embodiment, the food-grade bacterium
according to the invention may be a probiotic bacterium.
[0048] In a preferred embodiment, the probiotic bacterium according
to the invention comprises a defective auxotrophic gene, whereby
survival of said bacterium may be strictly dependent upon the
presence of specific compounds.
[0049] In another preferred embodiment, the auxotrophic gene
according to the invention may be the thyA gene encoding the
thymidylate synthase.
[0050] In another preferred embodiment, the auxotrophic gene
according to the invention may be the alanine racemase (alr) gene
[Bron et al, 2002].
[0051] Inactivation of the thyA gene of the probiotic bacterium
according to the invention renders it auxotrophic to thymidine
which is absent from the gastrointestinal tract (GIT). This
recombinant thyA mutant will be able to deliver its protein of
interest but will not survive and thus persist in GIT limiting its
dissemination and conferring the requested biological containment
for recombinant bacteria. Similar results may be obtained with alr
gene.
[0052] In another preferred embodiment, the selected gene may be
inserted in the thyA gene.
[0053] Preferably, the recombinant gene may be located in the
chromosome into the thyA gene locus which may be thus inactivated
by gene disruption. As used herein, the term "gene disruption"
denotes disruption by insertion of a DNA fragment, disruption by
deletion of the gene, or a part thereof, as well as exchange of the
gene or a part thereof by another DNA fragment, and the disruption
may be induced by recombinant DNA techniques, and not by
spontaneous mutation. Preferably, disruption is the exchange of the
gene, or a part thereof, by another functional gene. Preferably,
the defective recombinant thyA gene may be a non-reverting mutant
gene.
[0054] As used herein, the term "non-reverting mutant" denotes that
the reversion frequency may be lower than about 10.sup.-8,
preferably the reversion frequency may be lower than about
10.sup.-10, even more preferably, the reversion frequency may be
lower than about 10.sup.-12, even more preferably, the reversion
frequency may be lower than about 10.sup.-14, most preferably, the
reversion frequency may not be detectable using the routine methods
known to the person skilled in the art.
[0055] In a preferred embodiment, the gene according to the
invention codes for the alpha 1-antitrypsin protein, or another
members of the Serpin family such as, but not limited to,
antiplasmin, alpha 1-antichymotrypsin.
[0056] In a preferred embodiment, the food-grade bacterium strain
according to the invention may be a L. lactis strain or a
Lactobacillus casei strain or a L. lactis htrA strain [Poquet et
al., 2000] or a Lactobacillus plantarum strain of a Bifidobacterium
longum strain.
[0057] In a preferred embodiment, the food-grade bacterium strain
according to the invention may be a Lactobacillus casei strain.
[0058] In a most preferred embodiment, the gene according to the
invention codes for trappin-2.
[0059] Indeed, the inventors showed that trappin-2 may be naturally
expressed in the human colonic mucosa, with a prominent expression
in intestinal epithelial cells [Motta et al.] and that, patients
with IBD show a down-regulation of trappin-2 in tissues compared to
healthy subjects [Motta et al.].
[0060] Furthermore, the inventors have demonstrated in different
models of colitis, that trappin-2 overexpression may be protective
against the development of colitis (in constitutive and transient
expression). Moreover, trappin-2 overexpression in models of
colitis may be able to completely inhibit the increase of elastase
and trypsin-like activities associated with colitis.
[0061] Finally, trappin-2 overexpression in mice may be also able
to significantly inhibit colitis-induced increases of
pro-inflammatory cytokines and chemokines (such as, but not limited
to, IL-6, Il-17A, TNF-alpha, Interferon-gamma, MCP-1 and KC).
[0062] All these results are in favor of delivery of trappin-2 and
others proteases from the WAP or Serpin family which have similar
properties to treat IBD. As shown in the results below, food-grade
bacteria are the most safe and efficient means to deliver this type
of proteases to the gut.
[0063] In another preferred embodiment, the gene according to the
invention codes for the alpha 1-antitrypsin protein.
[0064] Indeed, the alpha 1-antitrypsin protein inhibits
trypsin-like activities associated with IBD (like colitis) and thus
has similar effects as trappin-2.
[0065] In another preferred embodiment, the food-grade bacterium
strain according to the invention may be a Lactobacillus casei
strain which comprises a gene coding for trappin-2.
[0066] In another preferred embodiment, the food-grade bacterium
strain according to the invention may be a Lactobacillus casei
strain which comprises a gene coding for trappin-2 inserted in the
thyA gene.
[0067] In another embodiment, the food-grade bacterium according to
the invention is useful for the treatment of intestinal
inflammatory conditions.
[0068] In another preferred embodiment, the food-grade bacterium
according to the invention is useful for the treatment of an IBD
and/or IBS.
[0069] The inflammatory conditions may be selected from IBD, IBS,
inflammatory pulmonary disease, inflammatory articular disease or
inflammatory urogenital disease.
[0070] Another object of the invention relates to a therapeutic
composition comprising a food-grade bacterium according to the
invention.
[0071] In a preferred embodiment, therapeutic composition according
to the invention is intended for mucosal administration to a
subject.
[0072] In another preferred administration, therapeutic composition
according to the invention is intended for oral administration to a
subject. For example, compositions may be in the form of a
suspension, tablet, pill, capsule, granulate or powder.
[0073] In a liquid therapeutic composition, the food-grade
bacterium according to the invention is present, free and not
immobilized, in suspension. The suspension has a composition which
ensures physiological conditions for a probiotic bacterium, so that
in particular the osmotic pressure within the cell does not lead to
lysis.
[0074] In a solid therapeutic composition, the food-grade bacterium
according to the invention may be present in free, preferably
lyophilized form, or in immobilized form. For example, the
food-grade bacterium according to the invention may be enclosed in
a gel matrix which provides protection for the cells.
[0075] A solid therapeutic composition intended for oral
administration and containing the food-grade bacterium according to
the invention in immobilized or non-immobilized form is preferably
provided with a coating resistant to gastric juice. It is thereby
ensured that the food-grade bacterium contained in the therapeutic
composition may pass through the stomach unhindered and undamaged
and the release of the food-grade bacterium first takes place in
the upper intestinal regions.
[0076] In another aspect of the invention, the therapeutic
composition contains sufficient colony-forming units (CFU) of the
food-grade bacterium capable of forming the protein according to
the invention so that with multiple administration of the
therapeutic composition according to a patient, the state of the
IBD or IBS is healed, the progression of the IBD or the IBS is
stopped, and/or the symptoms of the IBD or IBS may be alleviated.
According to the invention, it is in particular provided that a
therapeutic composition contains about
1.times.10.sup.8-1.times.10.sup.11, preferably about
1.times.10.sup.9 to about 1.times.10.sup.10 CFU of the food-grade
bacterium according to the invention.
[0077] In a further preferred embodiment of the invention, the
therapeutic composition containing the food-grade bacterium may be
administered intrarectally. A rectal administration preferably
takes place in the form of a suppository, enema or foam.
Intrarectal administration may be particularly suitable for chronic
inflammatory intestinal diseases which affect the lower intestinal
sections, for example the colon. Intranasal administrations are
also suitable to treat chronic pulmonary diseases such as, but not
limited to, cystic fibrosis and BPCO.
[0078] In another aspect, the invention relates to a food
composition comprising a food-grade bacterium according to the
invention.
[0079] In a preferred embodiment, food compositions according to
the invention are intended for oral administration to a subject.
For example, compositions may be in the form of a suspension,
tablet, pill, capsule, granulate, powder or yogurt.
[0080] In a preferred embodiment, the food composition may contain
1.times.10.sup.8-1.times.10.sup.11, preferably
1.times.10.sup.9-1.times.10.sup.10 CFU of the food-grade bacterium
according to the invention.
[0081] In a preferred embodiment, the food composition may be
administered to the patient at a daily dose of 10.sup.10
bacteria.
[0082] Although the present invention and its advantages have been
described in detail, it should be understood that various changes,
substitutions and alterations may be made herein without departing
from the spirit and scope of the invention as defined in the
appended claims.
[0083] The present invention will be further illustrated in the
following Examples which are given for illustration purposes only
and are not intended to limit the invention in any way.
Example
Material & Methods
[0084] Cloning of Elafin in recombinant lactic acid bacteria
(Lactococcus lactis and Lactobacillus casei)
Cloning and Expression of Elafin in Lactic Acid Bacteria
[0085] Gene coding for elafin was PCR amplified from plasmid
DK6-elafin. Sequences of primers used were: 5' forward Elafin
(CCAATGCATCAGCAGCTGTCACGGG AGTTCC) (SEQ ID No. 1) and 3'
reverse-Elafin (GGACTAGTCCTCACTGGGGAACGAAACA GGCC) (SEQ ID No. 2).
Primers were designed to eliminate first codons of elafin region
encoding for signal peptide (SP) and was replaced by the SP of
Usp45 protein (PS.sub.Usp45), the main secreted protein from L.
lactis. To that aim, PCR product was digested, purified, and cloned
in pSEC, a L. lactis secretion vector. In the resulting plasmid
pSEC:elafin, elafin is fused in frame with a DNA fragment encoding
for RBS and PS.sub.Usp45. Expression of the cassette is controlled
by the inducible promoter P.sub.nisA, the activity of which depends
upon the concentration of nisin used. This plasmid was then
introduced in a L. lactis strain bearing the nisin regulatory genes
nisR et nisK (L. lactis NZ9000) to give rise the recombinant
strain: NZ(pSEC:elafin). The tools used (replicons, promoter, RBS
and SP) are functional in lactobacilli strains such as, but not
limited to, Lactobacillus casei and Lb. plantarum. These two
strains (each bearing the genes nisRK on their chromosome) have
been chosen because of their persistence ability in the digestive
tract (up to 4 days, as opposed to 24 to 48 hr in L. lactis. In
addition, we have demonstrated recently that the Lb. casei BL23
strain possesses anti-inflammatory properties in a DSS-induced
colitis model [Rochat et al, 2007]. We therefore have at our
disposal non-immuno-modulatory strains weakly (L. lactis) and
strongly (Lb. plantarum) persistent as well as immuno-modulatory
strains strongly persistent (Lb. casei), allowing us to evaluate
the feasibility of combining the intrinsic anti-inflammatory
effects of the strains used with that of the molecules
over-expressed.
[0086] For the induction of the P.sub.nisA promoter, L. lactis
recombinant strains were cultured to OD.sub.600=.about.04-0.6 and
then induced with 10 .mu.g/ml de nisin (Sigma) during 1 h.
Functionality of this induction was then tested as follows: NZ
(pSEC:elafin) cultures (final OD.sub.600=.about.1) were separated
into pellets and supernatants and content in elafin was measured by
ELISA and/or Western Blot.
Animals
[0087] C57B16 mice (6-8 weeks old) were obtained from Janvier (St
Quentin Fallavier) and were kept at room temperature, under 12 h
light/dark cycles and having free access to food and water, except
the day before the induction of colitis, where they were fasted for
12 h. All procedures were approved by Institutional animal care
committee and veterinary services.
Induction of Colitis and Study Design
[0088] Colonic inflammation was induced by treatments with Dextran
Sodium Sulfate (DSS). In details, DSS was dissolved in drinking
water (3 or 5% wt/vol) and the animals were free to drink this
solution for 7-days. Water consumption was measured in the
DSS-treated groups and compared to groups of naive mice drinking
water: no difference was observed for the volume of liquid
consumed, between water and DSS-drinking mice. Mice were treated
daily orally, with 100 .mu.l of 5.10.sup.9 colony forming units
(cfu) of wild-type, elafin-recombinant L. lactis or Lb. casei, or
bacterial medium alone. The first treatment started at the same
time DSS was added to drinking water and the last treatment was on
the day of the sacrifice (day 7). Body weight and survival rate
were measured daily after the induction of colitis. On day 7 after
adding DSS to their drinking water, mice were sacrificed and colons
were harvested for measure of several parameters of inflammation:
macroscopic score, bowel thickness, myeloperoxydase (MPO) activity,
proteolytic activity, cytokine expression.
Measure of Inflammatory Parameters
[0089] Macroscopic damage was evaluated as follows. Briefly, when
observed, the following parameters were given a score of 1:
haemorrhage, edema, stricture, ulceration, fecal blood, mucus, and
diarrhoea. Erythema was scored a maximum of 2 depending on the
length of the area being affected (0: absent, 1: less than 1 cm, 2:
more than 1 cm). Adhesion was scored based on its severity (0:
absent, 1: moderate, 2: severe).
[0090] MPO was measured as an index of granulocyte infiltration in
colonic tissues harvested at the time of the sacrifice. Tissue
samples were homogenized in a solution of 0.5%
hexadecyltrimethylamonium bromide in phosphate buffer (pH 6), and
centrifuged at 13 000.times.G for 2 min. Supernatants were added to
a buffer containing 1% hydrogen peroxide and 0-dianisidine
dihydrochloride. Optical density readings for the enzymatic
solution were read for 2 min at 450 nm.
[0091] For cytokine and chemokine protein measures, frozen colonic
samples harvested at sacrifice were homogenized using a polytron
for 30 s at 4.degree. C. in 500 .mu.l of cell lysis buffer (20 mM
Tris-Hcl, pH 7.5, 150 mM NaCl, 1 mM Na.sub.2EDTA, 1 mM EGTA, 1%
Triton X-100, 2.5 mM sodium pyrophospate, 1 mM
beta-glycerophosphate, 1 mM Na.sub.3VO.sub.4, 1 .mu.g/ml leupeptin;
Cell Signalling, Sigma) supplemented with anti-proteases (Roche
Diagnostics, Meylan, France) cocktail. After centrifugation (10
000.times.g, 10 min, 4.degree. C.), supernatants were filtered on
QIAshredder columns (Qiagen, France) and fifty microliters of this
homogenate was used for simultaneous dosage of cytokines and
chemokines using cytometric bead array on fluorescent cell sorter
FACSCalibur. Raw values were normalized to tissue weight (average
from 30 to 50 mg) and cytokine concentrations were extrapolated
from standard curves with the help of FCAP Array.RTM. software. In
accordance with the manufacturer's information, only values above
the limit of cytokine detection were considered.
Serine Protease Activity in Colonic Tissues and Luminal Washes
[0092] Upon sacrifice, the entire colon was excised and 1 ml PBS
was instilled and washed twice through the lumen. Proteolytic
activities (trypsin-like and elastase activity) were measured both
in those lumenal washes. Trypsin-like and elastase-like activities
were measured using tosyl-Gly-Pro-Arg-p-nitroanilide (150 .mu.M,
Sigma) and MeO-succinyl-Ala-Ala-Pro-Val-p-nitroanilide (100 .mu.M,
Sigma, Saint Quentin Fallavier, France) respectively as substrates.
Samples (20 .mu.l for trypsin activity or 10 .mu.l for elastase
activity) were re-suspended in their respective buffer: 100 mM
Tris/HCl, 1 mM CaCl.sub.2, pH=8 for trypsin activity and 50 mM
Tris-HCl, 500 mM NaCl, 0.1% Triton X100 for elastase activity. The
change in absorbance at 405 nm was determined over 30 minutes at
37.degree. C. with a microplate reader NOVOstar.TM. (BMG Labtech,
France). Activity was compared to known standard dilution of
trypsin from porcine pancreas (Sigma) or human neutrophil elastase
(Sigma). Protein concentration in the lumenal washes was determined
using colorimetric dosage of bicinchoninic acid on microplate (BCA
Kit.RTM., Pierce, Thermo Scientific, Courtaboeuf, France) and was
used to standardize the proteolytic activity in each samples.
Induction and Measure of Visceral Pain Behaviors in Response to
Mustard Oil
[0093] Cultures of the L. lactis three strains of (L. lactis wt, L.
lactis-Elafin, L. lactis-IL-10) were performed in M17 medium
(Oxoid) supplemented with glucose (0.5%) supplemented with
Chloramphenicol (10 .mu.g/mL) at 30.degree. C. without shaking
Bacteria from overnight cultures were grown in fresh medium at 1/50
(v/v) until OD.sub.600=0.4 to 0.6. Bacteria were then cultured for
one more hr with Nisin (1 ng/mL), added to enable recombinant
protein expression. Bacteria were harvested by centrifugation at
450 g and washed with sterile PBS. The pellets were resuspended in
sterile PBS at a final concentration of 5.times.10.sup.10 cfu/mL.
Groups of 4 to 8 mice were treated daily with 1004,
(5.times.10.sup.9 cfu) of bacterial suspension by intragastric
administration for seven days. At day 8, mice were administered
with 50 .mu.L of PBS or mustard oil (0.01% (v/v) in ethanol 70%) by
intracolonic instillation, performed under slight isoflurane
anesthesia. The number of pain-related behavioral responses
(abdominal retractions, licking of the abdomen, stretching, and
squashing of the lower abdomen against the floor) were then counted
for 20 min.
Statistics
[0094] Comparisons among groups were made using a 2-tailed
Student's t test with Bonferroni correction. Data are expressed as
mean.+-.SEM, and a P value less than 0.05 was considered
significant.
Results
Recombinant Lactococcus Lactis Expressing Elafin Protects Against
the Development of DSS Colitis in Mice
[0095] As expected, DSS-induced colitis (5% DSS) caused severe
weight loss in all groups of mice compared to control mice that
drank water. None of the lactic acid bacteria treatments
significantly modified this weight loss (FIG. 1A). DSS in drinking
water also caused macroscopic damage, increased wall thickness and
increased MPO activity in colonic tissues (FIGS. 1B, C, D). Mice
that were treated with wild-type L. lactis did not show significant
decrease in colonic wall thickness and MPO activity, only a slight
decrease in macroscopic damage score was observed in that group,
compared to DSS alone-treated mice. In contrast, mice treated with
recombinant L. lactis expressing elafin showed after the induction
of DSS colitis a significantly reduced macroscopic damage score and
significant less increase in colonic wall thickness, but MPO
activity was not different from DSS alone group (FIGS. 1B, C, D).
In addition, mice treated with recombinant L. lactis expressing
IL-10 cytokine showed reduced macroscopic damage score and MPO
activity after the induction of DSS colitis, but wall thickness was
not modified by this treatment compared to DSS alone (FIGS. 1B, C,
D). In non-inflammed mice, none of the treatments modified the
inflammatory parameters compared to naive control mice.
[0096] DSS-induced increase in trypsin-like activity was
significantly reduced in mice treated with recombinant L. lactis
expressing Elafin, but was not changed in mice treated with
wild-type L. lactis or recombinant L. lactis expressing IL-10 (FIG.
2A). Only treatment with recombinant L. lactis expressing elafin
was able to significantly reduce DSS-induced increase in elastase
activity (FIG. 2B).
Recombinant Lactobacillus casei Expressing Either Elafin Protects
Against the Development of DSS Colitis in Mice
[0097] While mouse treatment with wild-type Lb. casei significantly
reduced the macroscopic scores observed after the induction of DSS
colitis, this treatment failed to reduce the increased wall
thickness and MPO activity compared to DSS alone (FIGS. 3 A, B, C).
In contrast, treatments with recombinant Lb. casei expressing
elafin significantly reduced all parameters of inflammation:
macroscopic damage score, colonic wall thickness and MPO activity
(FIGS. 3A, B, C).
[0098] DSS-induced increase in trypsin-like activity was
significantly reduced in mice treated with recombinant Lb. casei
expressing Elafin, compared to mice treated with wild-type Lb.
casei (FIG. 4A). The level of elastase activity was also
significantly reduced in mice with colitis (DSS) treated with
recombinant Lb. casei expressing elafin, compared to inflammed
(colitis) mice treated with wild-type Lb. casei, or even compared
to inflammed mice treated with PBS (FIG. 4B).
[0099] Protein expression of the chemokine RANTES was not
significantly increased by DSS colitis at the observed time-point
(7-days after the start of DSS treatment). Wild-type or
Elafin-secreting Lb. casei failed to modify the level of RANTES
expression in DSS-treated mice (FIG. 5 A). TNF.alpha., IL-6, MCP1,
KC, INF.gamma. and IL-17A were all significantly increased by DSS
colitis, 7 days after its induction (FIGS. 5B to G). Treatment of
mice with recombinant Lb. casei expressing elafin significantly
reduced protein expression of IL-6, MCP1, KC and IL-17 (FIGS. 5C,
D, E, G), but failed to reduce the level of expression of other
pro-inflammatory cytokines such as TNF.alpha. and INF.gamma. (FIGS.
5B and F). Interestingly, while DSS colitis did not cause any
increase in the cytokines IL-2, IL-4, IL-5, IL-10 and IL-13 (FIGS.
6 A to E), treatment of mice with Lb. casei recombinant for elafin
raised significantly the expression of those cytokines, but only in
a colitis context (after DSS treatment). This increase in Th2
cytokines in response to Lb. casei recombinant for elafin, could
explain, at least in part, the anti-inflammatory effects of this
recombinant bacteria. Levels of IL2, IL-4, IL-5, IL-10 and IL-13
were not modified by any of the other treatments in either
inflammed (DSS) or non-inflammed mice (FIGS. 6 A to E).
[0100] Recombinant Lactococcus lactis for the expression of elafin
decrease visceral pain behavior
[0101] Intracolonic administration of mustard oil caused a
significant increase in the number of pain behaviors: both the
number of abdominal retractions and the number of integrated pain
behaviors such as licking, stretching, and squashing against the
floor (FIGS. 7 A and B). Considering all behaviors together,
treatment with wild-type, IL-10 recombinant or elafin-secreting L.
lactis had no effect (FIG. 7A). When considering only the
integrated pain behaviors, elafin-, but not IL-10-recombinant L.
lactis or wild-type significantly reduced the number of pain
behaviors (FIG. 7B). Moreover, only recombinant L. lactis
expressing elafin induced a notable decrease in the number of pain
behaviors compared both to PBS treatment or wild-type L. lactis
treatment (FIG. 7B).
Results with the htrA Strain
[0102] L. lactis expresses only one housekeeping extracellular
protease called htrA which degrades all the unfolded exported
proteins] Poquet et al, 2000 and patents U.S. Pat. No. 6,994,997
and FR2787810]. A L. lactis mutant strain inactivated in htrA gene
was constructed and allowed increasing the production rate of
several heterologous secreted proteins in L. lactis [Poquet et al,
2000 and Miyoshi et al, 2002]. According to the invention, the
elafin expression cassette was cloned in the htrA mutant. Elafin
production levels in the htrA mutant and in the wild type (wt)
strain were compared by Western blot experiments (FIG. 8). A
significant increase of secreted elafin was observed in the
supernatant of the htrA mutant compared to the wt strain. Thus, the
htrA strain will allow higher production and secretion levels of
elafin.
[0103] These two strains were then tested in DSS-induced colitis
model and we confirmed in vivo that the htrA mutant protects the
mice against the colitis damages better than the wt strain (FIGS. 9
A, B and C).
Comparative Results
[0104] The protective effects of IL-10, superoxide dismutase (SOD)
and elafin-producing L. casei strains were evaluated in parallel in
DSS 5%-induced colitis model. It should be reminded that L. casei
possesses two major differences compared to L. lactis: i) higher
persistence in the GIT and ii) intrinsic anti-inflammatory
properties [Rochat et al, 2007; Watterlot et al, 2010]. As shown in
FIGS. 10A, B and C, the best protective effects on the three
criteria (macroscopic, histological and MPO activity) are obtained
with Elafin-producing L. casei strain followed by SOD-producing L.
casei strain. L. casei strain producing IL-10 provided only poor
effects.
[0105] Moreover, elafin-producing L. casei strain afforded a better
protection than the two L. lactis strains (wt L. Lactis and htrA
strain) (FIG. 11).
[0106] These results are most surprising considering the fact that
elafin possesses in vitro and in vivo antibacterial activities
[Simpson A J et al., 1999]. Accordingly, the skilled person would
have expected a poor or no production at all by the bacterium host.
On the contrary, the results obtained by the inventors show a very
good production of elafin by the probiotic and hence a therapeutic
effect.
[0107] Moreover, both in vitro and in vivo studies (including
clinical studies) showed that the lack of the host antimicrobial
shield is potentially deleterious in colonic diseases [Salzman N H
et al., 2003 and Bevins C L et al., 2009].
[0108] Thus, the pleiotropic anti-microbial/anti-inflammatory
activity of elafin makes it a very good therapeutic molecule
candidate as compared to IL-10.
EDTA Induction of Promoter Zinc (PZn) zitR-Controlled Expression in
L. Lactis.
[0109] Production of elafin in L. lactis driven by PZn zitR [Llull
D and Poquet I. 2004] was tested by Western blot analysis after 1 h
of induction with 1 mM of EDTA. Non-induced cultures samples,
cellular pellet (C) and supernatant (S), produce very low levels
and secretion of elafin while induced cultures result in higher
levels of expression and secretion (FIG. 12).
REFERENCES
[0110] Throughout this application, various references describe the
state of the art to which this invention pertains. The disclosures
of these references are hereby incorporated by reference into the
present disclosure. [0111] Bevins C L, Stange E F, Wehkamp J.
Decreased Paneth cell defensin expression in ileal Crohn's disease
is independent of inflammation, but linked to the NOD2 1007fs
genotype. Gut. 2009 June; 58(6):882-3. [0112] Braat, H., M. P.
Peppelenbosch, and D. W. Hommes. 2003. Interleukin-10-based therapy
for inflammatory bowel disease. Expert. Opin. Biol. Ther.
3:725-731. [0113] Braat, H., P. Rottiers, D. W. Hommes, N.
Huyghebaert, E. Remaut, J. P. Remon, S. J. van Deventer, S.
Neirynck, M. P. Peppelenbosch, and L. Steidler. 2006. A phase I
trial with transgenic bacteria expressing interleukin-10 in Crohn's
disease. Clin. Gastroenterol. Hepatol. 4:754-759. [0114] Bron Peter
A., Marcos G. Benchimol, Jolanda Lambert, Emmanuelle Palumbo, Marie
Deghorain, Jean Delcour, Willem M. de Vos, Michiel Kleerebezem, and
Pascal Hols. Use of the alr Gene as a Food-Grade Selection Marker
in Lactic Acid Bacteria. Environmental Microbiology, November 2002,
p. 5663-5670. [0115] Cenac, N., C. N. Andrews, M. Holzhausen, K.
Chapman, G. Cottrell, P. Andrade-Gordon, M. Steinhoff, G. Barbara,
P. Beck, N. W. Bunnett, K. A. Sharkey, J. G. Ferraz, E. Shaffer,
and N. Vergnolle. 2007. Role for protease activity in visceral pain
in irritable bowel syndrome. J. Clin. Invest 117:636-647. [0116]
Hedin, C., K. Whelan, and J. O. Lindsay. 2007. Evidence for the use
of probiotics and prebiotics in inflammatory bowel disease: a
review of clinical trials. Proc. Nutr. Soc. 66:307-315. Sallenave,
J.-M. Biol. Chem. Hoppe-Seyler 372 (1991), pp. 13-21. [0117] Hyun,
E., P. Andrade-Gordon, M. Steinhoff, and N. Vergnolle. 2008.
Protease-activated receptor-2 activation: a major actor in
intestinal inflammation. Gut 57:1222-1229. [0118] Llull D. and I.
Poquet. New Expression System Tightly Controlled by Zinc
Availability in Lactococcus lactis. Environmental Microbiology,
September 2004, p. 5398-5406. [0119] Motta Jean-Paul, Laurent
Magne, Delphyne Descamps, Corinne Rolland, Camila Squarzoni-Dale,
Perrine Rousset, Laurence Martin, Nicolas Cenac, Viviane Balloy,
Michel Huerre, Dieter Jenne, Julien Wartelle, Azzaq Belaaouaj,
Emmanuel Masl, Jean-Pierre Vinel, Laurent Alric, Michel Chignard,
Nathalie Vergnolle, Jean-Michel Sallenave. Modifying the protease,
anti-protease pattern by elafin over-expression protects mice from
colitis. Gastroenterology 2011, In Press. [0120] Poquet I, Saint V,
Seznec E, Simoes N, Bolotin A, Gruss A. HtrA is the unique surface
housekeeping protease in Lactococcus lactis and is required for
natural protein processing. Mol Microbiol. 2000 March;
35(5):1042-51. [0121] Sallenave J.-M, Silva A., Marsden M. E. and
Ryle A. P. Am. J. Respir. Cell Mol. Biol. 8 (1993), pp. 126-133.
[0122] Sallenave J M. Secretory leukocyte protease inhibitor and
elafin/trappin-2: versatile mucosal antimicrobials and regulators
of immunity. Am J Respir Cell Mol Biol. 2010 June; 42(6):635-43.
Epub 2010 Apr. 15. Review. [0123] Sartor, R. B. 2004. Therapeutic
manipulation of the enteric microflora in inflammatory bowel
diseases: antibiotics, probiotics, and prebiotics. Gastroenterology
126:1620-1633. [0124] Salzman N H, Ghosh D, Huttner K M, Paterson
Y, Bevins C L. Protection against enteric salmonellosis in
transgenic mice expressing a human intestinal defensin. Nature.
2003 Apr. 3; 422(6931):522-6. [0125] Simpson A J, Maxwell A I,
Govan J R, Haslett C, Sallenave J M. Elafin (elastase-specific
inhibitor) has anti-microbial activity against gram-positive and
gram-negative respiratory pathogens. FEBS Lett. 1999 Jun. 11;
452(3):309-13. [0126] Steidler, L., W. Hans, L. Schotte, S.
Neirynck, F. Obermeier, W. Falk, W. Fiers, and E. Remaut. 2000.
Treatment of murine colitis by Lactococcus lactis secreting
interleukin-10. Science 289:1352-1355. [0127] Thierry Moreau, Kevin
Baranger, Sebastien Dade, Sandrine Dallet-Choisy, Nicolas Guyot,
Marie-Louise Zani. Multifaceted roles of human elafin and secretory
leukocyte proteinase inhibitor (SLPI), two serine protease
inhibitors of the chelonianin family. Biochimie 90 (2008) 284e295.
[0128] Vergnolle, N. 2005. Clinical relevance of
proteinase-activated receptors in the gut. Gut 54:867-874. [0129]
Vergnolle, N., L. Cellars, A. Mencarelli, G. Rizzo, S. Swaminathan,
P. Beck, M. Steinhoff, P. Andrade-Gordon, N. W. Bunnett, M. D.
Hollenberg, J. L. Wallace, G. Cirino, and S. Fiorucci. 2004. A role
for proteinase-activated receptor-1 in inflammatory bowel diseases.
J Clin Invest 114:1444-1456.
[0130] The invention is further described by the following numbered
paragraphs:
[0131] 1. A molecule selected from the trappin-2 protein or an
active fraction of the trappin-2 protein, a member of the WAP
family proteins or an active fraction of a member of the WAP family
proteins or a member of the Serpin family or an active fraction of
a member of the Serpin family for the treatment of Irritable Bowel
Syndrome (IBS).
[0132] 2. A molecule according to the paragraph 1 expressed by a
host cell genetically engineered.
[0133] 3. A recombinant food-grade bacterium comprising a gene
selected from a gene coding for the trappin-2 protein or an active
fraction of the trappin-2 protein, a gene coding for a member of
the WAP family proteins or an active fraction of a member of the
WAP family proteins or a gene coding for a member of the Serpin
family proteins or an active fraction of a member of the Serpin
family proteins.
[0134] 4. A bacterium according to paragraph 3 wherein the
food-grade bacterium is a probiotic bacterium.
[0135] 5. A probiotic bacterium according to paragraph 3 or 4
wherein the bacterium comprises a defective auxotrophic gene,
whereby survival of said bacterium is strictly dependent upon the
presence of specific compounds.
[0136] 6. A probiotic bacterium according to paragraph 5 wherein
the defective auxotrophic gene is the thyA gene.
[0137] 7. A probiotic bacterium according to paragraph 4 wherein
the selected gene is inserting in the thyA gene.
[0138] 8. A probiotic bacterium according to any one of paragraphs
3 to 5 wherein the gene coding for the WAP or Serpin family progene
is trappin-2 or the alpha I-antitrypsin protein.
[0139] 9. A food-grade bacterium according to any one of paragraph
3 to 6 selected from Lactococcus lactis, Lactobacillus casei,
Lactobacillus plantarum.
[0140] 10. A food-grade bacterium according to any one of
paragraphs 3 to 9 for the treatment of an inflammatory
condition.
[0141] 11. A food-grade bacterium according to paragraph 10 wherein
the inflammatory condition is selected from Inflammatory Bowel
Disease, Irritable Bowel Syndrome, inflammatory pulmonary disease,
inflammatory articular disease or inflammatory urogenital
disease.
[0142] 12. A therapeutic composition comprising a food-grade
bacterium according to any one of paragraphs 3 to 9.
[0143] 13. A food composition comprising a food-grade bacterium
according to any one of paragraphs 3 to 9.
[0144] 14. A composition according to any one of paragraphs 10 and
11 wherein the composition is intended for oral administration to a
subject.
[0145] 21. A molecule selected from the trappin-2 protein or an
active fraction of the trappin-2 protein, a member of the WAP
Serpin family proteins or an active fraction of a member of the WAP
family proteins or a member of the Serpin family or an active
fraction of a member of the Serpin family for the treatment of
Irritable Bowel Syndrome (IBS).
[0146] 22. A molecule according to the paragraph 21 expressed by a
genetically engineered host cell.
[0147] 23. A recombinant food-grade bacterium comprising a
recombinant gene selected from a gene coding for the trappin-2
protein or an active fraction of the trappin-2 protein, a gene
coding for a member of the WAP family proteins or an active
fraction of a member of the WAP family proteins or a gene coding
for a member of the Serpin family proteins or an active fraction of
a member of the Serpin family proteins.
[0148] 24. A bacterium according to paragraph 23 wherein the
food-grade bacterium is a probiotic bacterium.
[0149] 25. A probiotic bacterium according to paragraph 23 or 24
wherein the bacterium comprises a defective auxotrophic gene,
whereby survival of said bacterium is strictly dependent upon the
presence of specific compounds.
[0150] 26. A probiotic bacterium according to paragraph 25 wherein
the defective auxotrophic gene is selected from the thyA gene or
the alr gene.
[0151] 27. A probiotic bacterium according to paragraph 25 wherein
the selected gene is inserted in place of the defective auxotrophic
gene.
[0152] 28. A probiotic bacterium according to any one of paragraphs
23 to 25 wherein the gene coding for the WAP or Serpin family
protein encodes the trappin-2 protein or the alpha 1-antitrypsin
protein.
[0153] 29. A food-grade bacterium according to any one of
paragraphs 23 to 26 selected from Lactic Acid Bacterium,
Bifidobacterium, Lactococcus or Lactobacillus.
[0154] 30. A food-grade bacterium according to any one of
paragraphs 23 to 26 selected from Lactococcus lactis, Lactococcus
lactis htrA, Lactobacillus casei, Lactobacillus plantarum, and
Bifidobacterium longum.
[0155] 31. A food-grade bacterium according to any one of
paragraphs 23 to 30 for the treatment of an inflammatory
condition.
[0156] 32. A food-grade bacterium according to paragraph 31 wherein
the inflammatory condition is selected from Inflammatory Bowel
Disease, Irritable Bowel Syndrome, inflammatory pulmonary disease,
inflammatory articular disease or inflammatory urogenital
disease.
[0157] 33. A therapeutic composition comprising a food-grade
bacterium according to any one of paragraphs 23 to 30.
[0158] 34. A therapeutic composition according to paragraph 33,
wherein the composition is intended for mucosal, oral, intranasal
or rectal administration to a subject.
[0159] 35. A therapeutic composition according to paragraph 31 or
32, wherein the composition is intended for mucosal, oral,
intranasal or rectal administration to a subject.
[0160] Having thus described in detail preferred embodiments of the
present invention, it is to be understood that the invention
defined by the above paragraphs is not to be limited to particular
details set forth in the above description as many apparent
variations thereof are possible without departing from the spirit
or scope of the present invention.
Sequence CWU 1
1
2131DNAArtificialPrimer 1ccaatgcatc agcagctgtc acgggagttc c
31232DNAArtificialPrimer 2ggactagtcc tcactgggga acgaaacagg cc
32
* * * * *