U.S. patent application number 13/701652 was filed with the patent office on 2013-12-05 for yeast expressing saccharolytic enzymes for consolidated bioprocessing using starch and cellulose.
This patent application is currently assigned to Mascoma Corporation. The applicant listed for this patent is Frank Agbogbo, Aaron Argyros, John S. Bardsley, Trisha Barrett, Alan Belcher, Elena Brevnova, Nicky Caiazza, Yin-Ying Chiu, Kristen M. Deleault, Riaan Den Haan, Abigail S. Foster, Allan C. Froehlich, Chhayal V. Gandhi, Jennifer Gosselin, Heidi Hau, John E. McBride, Mark Mellon, Vineet B. Rajgarhia, Charles F. Rice, Indraneel Shikhare, Ryan Skinner, Emily Stonehouse, Shital A. Tripathi, Anne K. Warner, Kevin S. Wenger, Erin Wiswall, Haowen Xu. Invention is credited to Frank Agbogbo, Aaron Argyros, John S. Bardsley, Trisha Barrett, Alan Belcher, Elena Brevnova, Nicky Caiazza, Yin-Ying Chiu, Kristen M. Deleault, Riaan Den Haan, Abigail S. Foster, Allan C. Froehlich, Chhayal V. Gandhi, Jennifer Gosselin, Heidi Hau, John E. McBride, Mark Mellon, Vineet B. Rajgarhia, Charles F. Rice, Indraneel Shikhare, Ryan Skinner, Emily Stonehouse.
Application Number | 20130323822 13/701652 |
Document ID | / |
Family ID | 45067335 |
Filed Date | 2013-12-05 |
United States Patent
Application |
20130323822 |
Kind Code |
A1 |
Brevnova; Elena ; et
al. |
December 5, 2013 |
Yeast Expressing Saccharolytic Enzymes for Consolidated
Bioprocessing Using Starch and Cellulose
Abstract
The present invention is directed to a yeast strain, or strains,
secreting a full suite, or any subset of that full suite, of
enzymes to hydrolyze corn starch, corn fiber, lignocellulose,
(including enzymes that hydrolyze linkages in cellulose,
hemicellulose, and between lignin and carbohydrates) and to utilize
pentose sugars (xylose and arabinose). The invention is also
directed to the set of proteins that are well expressed in yeast
for each category of enzymatic activity. The resulting strain, or
strains can be used to hydrolyze starch and cellulose
simultaneously. The resulting strain, or strains can be also
metabolically engineered to produce less glycerol and uptake
acetate. The resulting strain, or strains can also be used to
produce ethanol from granular starch without liquefaction. The
resulting strain, or strains, can be further used to reduce the
amount of external enzyme needed to hydrolyze a biomass feedstock
during an Simultaneous Saccharification and Fermentation (SSF)
process, or to increase the yield of ethanol during SSF at current
saccharolytic enzyme loadings. In addition, multiple enzymes of the
present invention can be co-expressed in cells of the invention to
provide synergistic digestive action on biomass feedstock. In some
aspects, host cells expressing different heterologous saccharolytic
enzymes can also be co-cultured together and used to produce
ethanol from biomass feedstock.
Inventors: |
Brevnova; Elena; (Lebanon,
NH) ; McBride; John E.; (Lyme, NH) ; Wiswall;
Erin; (Danbury, NH) ; Wenger; Kevin S.;
(Hanover, NH) ; Caiazza; Nicky; (Lebanon, NH)
; Hau; Heidi; (Lebanon, NH) ; Argyros; Aaron;
(White River Junction, VT) ; Agbogbo; Frank;
(Lebanon, NH) ; Rice; Charles F.; (Hopkinton,
NH) ; Barrett; Trisha; (Bradford, VT) ;
Bardsley; John S.; (Newport, NH) ; Foster; Abigail
S.; (South Strafford, VT) ; Warner; Anne K.;
(Lebanon, NH) ; Mellon; Mark; (Grantham, NH)
; Skinner; Ryan; (White River Junction, VT) ;
Shikhare; Indraneel; (Lebanon, NH) ; Den Haan;
Riaan; (Vierlanden, ZA) ; Gandhi; Chhayal V.;
(Lebanon, NH) ; Belcher; Alan; (Nashua, NH)
; Rajgarhia; Vineet B.; (Courbevoie, FR) ;
Froehlich; Allan C.; (Lebanon, NH) ; Deleault;
Kristen M.; (Canaan, NH) ; Stonehouse; Emily;
(Lebanon, NH) ; Tripathi; Shital A.; (Berkley,
CA) ; Gosselin; Jennifer; (Lebanon, NH) ;
Chiu; Yin-Ying; (West Lebanon, NH) ; Xu; Haowen;
(Lebanon, NH) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Brevnova; Elena
McBride; John E.
Wiswall; Erin
Wenger; Kevin S.
Caiazza; Nicky
Hau; Heidi
Argyros; Aaron
Agbogbo; Frank
Rice; Charles F.
Barrett; Trisha
Bardsley; John S.
Foster; Abigail S.
Warner; Anne K.
Mellon; Mark
Skinner; Ryan
Shikhare; Indraneel
Den Haan; Riaan
Gandhi; Chhayal V.
Belcher; Alan
Rajgarhia; Vineet B.
Froehlich; Allan C.
Deleault; Kristen M.
Stonehouse; Emily
Tripathi; Shital A.
Gosselin; Jennifer
Chiu; Yin-Ying
Xu; Haowen |
Lebanon
Lyme
Danbury
Hanover
Lebanon
Lebanon
White River Junction
Lebanon
Hopkinton
Bradford
Newport
South Strafford
Lebanon
Grantham
White River Junction
Lebanon
Vierlanden
Lebanon
Nashua
Courbevoie
Lebanon
Canaan
Lebanon
Berkley
Lebanon
West Lebanon
Lebanon |
NH
NH
NH
NH
NH
NH
VT
NH
NH
VT
NH
VT
NH
NH
VT
NH
NH
NH
NH
NH
NH
CA
NH
NH
NH |
US
US
US
US
US
US
US
US
US
US
US
US
US
US
US
US
ZA
US
US
FR
US
US
US
US
US
US
US |
|
|
Assignee: |
Mascoma Corporation
Lebanon
NH
|
Family ID: |
45067335 |
Appl. No.: |
13/701652 |
Filed: |
June 3, 2011 |
PCT Filed: |
June 3, 2011 |
PCT NO: |
PCT/US11/39192 |
371 Date: |
August 7, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61420142 |
Dec 6, 2010 |
|
|
|
61351165 |
Jun 3, 2010 |
|
|
|
Current U.S.
Class: |
435/254.21 |
Current CPC
Class: |
C12N 9/2482 20130101;
C12Y 302/01021 20130101; C12N 9/248 20130101; C12Y 302/01008
20130101; Y02E 50/10 20130101; C12N 9/2437 20130101; C12N 9/2445
20130101; C12Y 302/01091 20130101; Y02E 50/17 20130101; C12N 9/2405
20130101; C12N 15/52 20130101; C12N 15/81 20130101; C12Y 302/01004
20130101; C12P 7/06 20130101 |
Class at
Publication: |
435/254.21 |
International
Class: |
C12N 15/81 20060101
C12N015/81 |
Claims
1-149. (canceled)
150. A recombinant yeast host cell comprising two or more
heterologous polynucleotides encoding two or more polypeptides
comprising an amino acid sequence at least 90% identical to an
amino acid sequence selected from the group consisting of: SEQ ID
NO: 288, SEQ ID NO: 278, SEQ ID NO: 450, SEQ ID NO: 468, SEQ ID NO:
289, and SEQ ID NO: 219.
151. The recombinant yeast host cell of claim 150, comprising three
or more heterologous polynucleotides encoding three or more
polypeptides comprising an amino acid sequence at least 90%
identical to an amino acid sequence selected from the group
consisting of: SEQ ID NO: 288, SEQ ID NO: 278, SEQ ID NO: 450, SEQ
ID NO: 468, SEQ ID NO: 289, and SEQ ID NO: 219.
152. The recombinant yeast host cell of claim 150, comprising four
or more heterologous polynucleotides encoding four or more
polypeptides comprising an amino acid sequence at least 90%
identical to an amino acid sequence selected from the group
consisting of: SEQ ID NO: 288, SEQ ID NO: 278, SEQ ID NO: 450, SEQ
ID NO: 468, SEQ ID NO: 289, and SEQ ID NO: 219.
153. The recombinant yeast host cell of claim 150, comprising five
or more heterologous polynucleotides encoding five or more
polypeptides comprising an amino acid sequence at least 90%
identical to an amino acid sequence selected from the group
consisting of: SEQ ID NO: 288, SEQ ID NO: 278, SEQ ID NO: 450, SEQ
ID NO: 468, SEQ ID NO: 289, and SEQ ID NO: 219.
154. The recombinant yeast host cell of claim 150, comprising each
of the heterologous polynucleotides encoding each of the
polypeptides comprising an amino acid sequence at least 90%
identical to an amino acid sequence selected from the group
consisting of: SEQ ID NO: 288, SEQ ID NO: 278, SEQ ID NO: 450, SEQ
ID NO: 468, SEQ ID NO: 289, and SEQ ID NO: 219.
155. The recombinant yeast host cell of claim 150, further
comprising one or more heterologous polynucleotides encoding one or
more polypeptides selected from the group consisting of: an
.alpha.-glucuronidase isolated from Aspergillus, a
.beta.-mannosidase isolated from Neosartorya fischeri and a
beta-glucosidase isolated from Aspergillus.
156. A recombinant yeast host cell comprising each of the
heterologous polynucleotides encoding the polypeptides comprising
an amino acid sequence at least 90% identical to the amino acid
sequences encoded by: SEQ ID NO: 466 and SEQ ID NO: 467, and
further comprising one or more heterologous polynucleotides
encoding one or more polypeptides comprising an amino acid sequence
at least 90% identical to an amino acid sequence selected from the
group consisting of: SEQ ID NO: 278, SEQ ID NO: 450, SEQ ID NO:
468, SEQ ID NO: 219, and SEQ ID NO: 248.
157. The recombinant host cell of claim 156, comprising two or more
heterologous polynucleotides encoding two or more polypeptides
comprising an amino acid sequence at least 90% identical to an
amino acid sequence selected from the group consisting of: SEQ ID
NO: 278, SEQ ID NO: 450, SEQ ID NO: 468, SEQ ID NO: 219, and SEQ ID
NO: 248.
158. The recombinant host cell of claim 156, comprising three or
more heterologous polynucleotides encoding three or more
polypeptides comprising an amino acid sequence at least 90%
identical to an amino acid sequence selected from the group
consisting of: SEQ ID NO: 278, SEQ ID NO: 450, SEQ ID NO: 468, SEQ
ID NO: 219, and SEQ ID NO: 248.
159. The recombinant host cell of claim 156, comprising four or
more heterologous polynucleotides encoding four or more
polypeptides comprising an amino acid sequence at least 90%
identical to an amino acid sequence selected from the group
consisting of: SEQ ID NO: 278, SEQ ID NO: 450, SEQ ID NO: 468, SEQ
ID NO: 219, and SEQ ID NO: 248.
160. The recombinant host cell of claim 156, comprising each of the
heterologous polynucleotides encoding each of the polypeptides
comprising amino acid sequences at least 90% identical to an amino
acid sequence selected from the group consisting of: SEQ ID NO:
278, SEQ ID NO: 450, SEQ ID NO: 468, SEQ ID NO: 219, and SEQ ID NO:
248.
161. The recombinant host cell of claim 156, further comprising a
heterologous polynucleotide encoding a polypeptide encoding a
beta-glucosidase isolated from Aspergillus.
162. The recombinant host cell of any one of claims 150 or 156,
further comprising one or more heterologous polynucleotides
encoding one or more polypeptides comprising an amino acid sequence
at least 90% identical to an amino acid sequence selected from the
group consisting of: SEQ ID NO: 461, SEQ ID NO: 457, SEQ ID NO:
460, SEQ ID NO: 459, and SEQ ID NO: 454.
163. The recombinant host cell of any one of claims 150 or 156,
further comprising two or more heterologous polynucleotides
encoding two or more polypeptides comprising an amino acid sequence
at least 90% identical to an amino acid sequence selected from the
group consisting of: SEQ ID NO: 461, SEQ ID NO: 457, SEQ ID NO:
460, SEQ ID NO: 459, and SEQ ID NO: 454.
164. The recombinant host cell of any one of claims 150 or 156,
further comprising three or more heterologous polynucleotides
encoding three or more polypeptides comprising an amino acid
sequence at least 90% identical to an amino acid sequence selected
from the group consisting of: SEQ ID NO: 461, SEQ ID NO: 457, SEQ
ID NO: 460, SEQ ID NO: 459, and SEQ ID NO: 454.
165. The recombinant host cell of any one of claims 150 or 156,
further comprising four or more heterologous polynucleotides
encoding four or more polypeptides comprising an amino acid
sequence at least 90% identical to an amino acid sequence selected
from the group consisting of: SEQ ID NO: 461, SEQ ID NO: 457, SEQ
ID NO: 460, SEQ ID NO: 459, and SEQ ID NO: 454.
166. The recombinant host cell of any one of claims 150 or 156,
further comprising each of the heterologous polynucleotides
encoding each of the polypeptides comprising an amino acid sequence
at least 90% identical to an amino acid sequence selected from the
group consisting of: SEQ ID NO: 461, SEQ ID NO: 457, SEQ ID NO:
460, SEQ ID NO: 459, and SEQ ID NO: 454.
167. The recombinant yeast host cell of any one of claims 150 or
156, further comprising a down-regulation of at least one gene
encoding an endogenous glycerol-producing enzyme selected from the
group consisting of: glycerol 3-phosphate dehydrogenase 1 and
glycerol-3 phosphate dehydrogenase 2.
168. The recombinant yeast host cell of any one of claims 150 or
156, further comprising one or more heterologous polynucleotides
encoding one or more polypeptides encoding an amino acid sequence
at least 90% identical to the amino acid sequence of a polypeptide
encoding SEQ ID NO: 449.
169. The recombinant yeast host cell of any one of claims 150 or
156, wherein the yeast strain is a Saccharomyces cerevisiae
strain.
170. The recombinant yeast host cell of any one of claims 150 or
156, wherein the recombinant yeast host cell produces ethanol at a
rate of at least about 0.5 g per hour per liter.
171. A method of producing ethanol comprising: (a) providing the
microorganism of any one of claims 150 or 156; and (b) culturing
said microorganism in the presence of a carbon containing feedstock
for sufficient time to produce ethanol.
172. A co-culture comprising at least two microorganisms wherein i.
one of the microorganisms comprises a microorganism from any one of
claims 150 or 156; and, ii. one of the microorganisms is
genetically distinct from (i).
173. The co-culture of claim 172, wherein the genetically distinct
microorganism is a yeast or bacterium.
174. The co-culture of claim 172, wherein the genetically distinct
microorganism is any organism selected from the group consisting
of: Issatchenkia, Pichia, Clavispora, Candida, Hansenula,
Kluyveromyces, Saccharomyces, Schizosaccharomyces, Kloeckera,
Schwanniomyces, Blakeslea, Cryptococcus, Cunninghamella, Lipomyces,
Mortierella, Mucor, Phycomyces, Pythium, Rhodosporidum,
Rhodotorula, Trichosporon and Yarrowia.
Description
BACKGROUND OF THE INVENTION
[0001] Biomass is biological material from living, or recently
living organisms, such as wood, waste, (hydrogen) gas, and alcohol
fuels. Biomass is carbon, hydrogen and oxygen based. Nitrogen and
small quantities of other atoms, including alkali, alkaline earth
and heavy metals can be found as well. Metals are often found in
functional molecules such as the porphyrins which include
chlorophyll which contains magnesium. Plants in particular combine
water and carbon dioxide to sugar building blocks. The required
energy is produced from light via photosynthesis based on
chlorophyll. On average, between 0.1 and 1% of the available light
is stored as chemical energy in plants. The sugar building blocks
are the starting point for all of the major fractions found in
terrestrial plants, lignin, hemicellulose and cellulose. Biomass is
widely recognized as a promising source of raw material for
production of renewable fuels and chemicals. The primary obstacle
impeding the more widespread production of energy from biomass
feedstocks is the general absence of low-cost technology for
overcoming the recalcitrance of these materials to conversion into
useful fuels. Biomass contains carbohydrate fractions (e.g.,
starch, cellulose, and hemicellulose) that can be converted into
ethanol. In order to convert these fractions, the starch,
cellulose, and, hemicellulose must ultimately be converted or
hydrolyzed into monosaccharides; it is the hydrolysis that has
historically proven to be problematic.
[0002] Biologically mediated processes are promising for energy
conversion, in particular for the conversion of biomass into fuels.
Biomass processing schemes involving enzymatic or microbial
hydrolysis commonly involve four biologically mediated
transformations: (1) the production of saccharolytic enzymes
(amylases, cellulases and hemicellulases); (2) the hydrolysis of
carbohydrate components present in pretreated biomass to sugars;
(3) the fermentation of hexose sugars (e.g., glucose, mannose, and
galactose); and (4) the fermentation of pentose sugars (e.g.,
xylose and arabinose). These four transformations occur in a single
step in a process configuration called consolidated bioprocessing
(CBP), which is distinguished from other less highly integrated
configurations in that it does not involve a dedicated process step
for cellulase and/or hemicellulase production.
[0003] CBP offers the potential for lower cost and higher
efficiency than processes featuring dedicated saccharolytic enzyme
production. The benefits result in part from avoided capital costs,
substrate and other raw materials, and utilities associated with
saccharolytic enzyme production. In addition, several factors
support the realization of higher rates of hydrolysis, and hence
reduced reactor volume and capital investment using CBP, including
enzyme-microbe synergy and the use of thermophilic organisms and/or
complexed saccharolytic systems. Moreover, cellulose-adherent
cellulolytic microorganisms are likely to compete successfully for
products of cellulose hydrolysis with non-adhered microbes, e.g.,
contaminants, which could increase the stability of industrial
processes based on microbial cellulose utilization. Progress in
developing CBP-enabling microorganisms is being made through two
strategies: engineering naturally occurring saccharolytic
microorganisms to improve product-related properties, such as yield
and titer; and engineering non-saccharolytic organisms that exhibit
high product yields and titers to express a heterologous
saccharolytic enzyme system enabling starch, cellulose, and,
hemicellulose utilization.
[0004] The breakdown of starch down into sugar requires amylolytic
enzymes. Amylase is an example of an amylolytic enzyme that is
present in human saliva, where it begins the chemical process of
digestion. The pancreas also makes amylase (alpha amylase) to
hydrolyze dietary starch into disaccharides and trisaccharides
which are converted by other enzymes to glucose to supply the body
with energy. Plants and some bacteria also produce amylases.
Amylases are glycoside hydrolases and act on .alpha.-1,4-glycosidic
bonds.
[0005] Several amylolytic enzymes are implicated in starch
hydrolysis. Alpha-amylases (EC 3.2.1.1) (alternate names:
1,4-.alpha.-D-glucan glucanohydrolase; glycogenase) are calcium
metalloenzymes, i.e., completely unable to function in the absence
of calcium. By acting at random locations along the starch chain,
alpha-amylase breaks down long-chain carbohydrates, ultimately
yielding maltotriose and maltose from amylose, or maltose, glucose
and "limit dextrin" from amylopectin. Because it can act anywhere
on the substrate, alpha-amylase tends to be faster-acting than
beta-amylase. Another form of amylase, beta-amylase (EC 3.2.1.2)
(alternate names: 1,4-.alpha.-D-glucan maltohydrolase; glycogenase;
saccharogen amylase) catalyzes the hydrolysis of the second
.alpha.-1,4 glycosidic bond, cleaving off two glucose units
(maltose) at a time. The third amylase is gamma-amylase (EC
3.2.1.3) (alternate names: Glucan 1,4-.alpha.-glucosidase;
amyloglucosidase; Exo-1,4-.alpha.-glucosidase; glucoamylase;
lysosomal .alpha.-glucosidase; 1,4-.alpha.-D-glucan
glucohydrolase). In addition to cleaving the last
.alpha.(1-4)glycosidic linkages at the nonreducing end of amylose
and amylopectin, yielding glucose, gamma-amylase will cleave
.alpha.(1-6) glycosidic linkages.
[0006] A fourth enzyme, alpha-glucosidase, acts on maltose and
other short malto-oligosaccharides produced by alpha-, beta-, and
gamma-amylases, converting them to glucose.
[0007] Three major types of enzymatic activities are required for
native cellulose degradation: The first type are endoglucanases
(1,4-.beta.-D-glucan 4-glucanohydrolases; EC 3.2.1.4).
Endoglucanases cut at random in the cellulose polysaccharide chain
of amorphous cellulose, generating oligosaccharides of varying
lengths and consequently new chain ends. The second type are
exoglucanases, including cellodextrinases (1,4-.beta.-D-glucan
glucanohydrolases; EC 3.2.1.74) and cellobiohydrolases
(1,4-.beta.-D-glucan cellobiohydrolases; EC 3.2.1.91).
Exoglucanases act in a processive manner on the reducing or
non-reducing ends of cellulose polysaccharide chains, liberating
either glucose (glucanohydrolases) or cellobiose
(cellobiohydrolase) as major products. Exoglucanases can also act
on microcrystalline cellulose, presumably peeling cellulose chains
from the microcrystalline structure. The third type are
.beta.-glucosidases (.beta.-glucoside glucohydrolases; EC
3.2.1.21). .beta.-Glucosidases hydrolyze soluble cellodextrins and
cellobiose to glucose units.
[0008] A variety of plant biomass resources are available as starch
and lignocellulosics for the production of biofuels, notably
bioethanol. The major sources are (i) wood residues from paper
mills, sawmills and furniture manufacturing, (ii) municipal solid
wastes, (iii) agricultural residues and (iv) energy crops such as
corn. Pre-conversion of particularly the cellulosic fraction in
these biomass resources (using either physical, chemical or
enzymatic processes) to fermentable sugars (glucose, cellobiose,
maltose, alpha- and cellodextrins) would enable their fermentation
to bioethanol, provided the necessary fermentative micro-organism
with the ability to utilize these sugars is used.
[0009] On a world-wide basis, 1.3.times.10.sup.10 metric tons (dry
weight) of terrestrial plants are produced annually (Demain, A. L.,
et al., Microbial. Mal. Biol. Rev. 69, 124-154 (2005)). Plant
biomass consists of about 40-55% cellulose, 25-50% hemicellulose
and 10-40% lignin, depending whether the source is hardwood,
softwood, or grasses (Sun, Y. and Cheng, J., Bioresource Technol.
83, 1-11 (2002)). The major polysaccharide present is
water-insoluble, cellulose that contains the major fraction of
fermentable sugars (glucose, cellobiose or cellodextrins).
[0010] Bakers' yeast (Saccharomyces cerevisiae) remains the
preferred micro-organism for the production of ethanol
(Hahn-Hagerdal, B., et al., Adv. Biochem. Eng. Biotechnol. 73,
53-84 (2001)). Attributes in favor of this microbe are (i) high
productivity at close to theoretical yields (0.51 g ethanol
produced/g glucose used), (ii) high osmo- and ethanol tolerance,
(iii) natural robustness in industrial processes, (iv) being
generally regarded as safe (GRAS) due to its long association with
wine and bread making, and beer brewing. Furthermore, S. cerevisiae
exhibits tolerance to inhibitors commonly found in hydrolyzaties
resulting from biomass pretreatment. The major shortcoming of S.
cerevisiae is its inability to utilize complex polysaccharides such
as starch and cellulose, or its break-down products, such as
cellobiose and cellodextrins.
[0011] Genes encoding cellobiohydrolases in T. reseei (CBH1 and
CBH2), A. niger (CBHA and CBHB) and P. chrysosporium (CBH1-4) have
been cloned and described. The proteins encoded by these genes are
all modular enzymes containing a catalytic domain linked via a
flexible liner sequence to a cellulose-binding molecule. CBH2 and
CBHB are family 6 glycosyl hydrolases. CBH1 and CBH1-4 are family 7
glycosyl hydrolases. Glycosyl hydrolases are a widespread group of
enzymes that hydrolyze the glycosidic bond between two or more
carbohydrates, or between a carbohydrate and a non-carbohydrate
moiety. A classification system for glycosyl hydrolases, based on
sequence similarity, has led to the definition of 85 different
families (Henrissat, B. et al., Proc. Natl. Acad. Sci. 92:7090-7094
(1995); Davies, G. and Henrissat, B., Structure 3: 853-859 (1995)).
Glycoside hydrolase family 7 (GHF7) comprises enzymes with several
known activities including endoglucanase and cellobiohydrolase.
These enzymes were formerly known as cellulase family C.
[0012] Cellobiohydrolases play a role in the conversion of
cellulose to glucose by cutting the dissaccharide cellobiose from
the reducing (CBH1; GHF7) or nonreducing (CBH2; GHF6) end of the
cellulose polymer chain. Structurally, cellulases and xylanases
generally consist of a catalytic domain joined to a
cellulose-binding domain (CBD) via a linker region that is rich in
proline and/or hydroxy-amino acids. In type I exoglucanases, the
CBD domain is found at the C-terminal extremity of these enzyme
(this short domain forms a hairpin loop structure stabilised by 2
disulphide bridges). Some cellulases have only the catalytic
domain.
[0013] Glycosyl hydrolase family 7 enzymes have a 67% homology at
the amino acid level, but the homology between any of these enzymes
and the glycosyl hydrolase family 6 CBH2 is less than 15%.
[0014] With the aid of recombinant DNA technology, several of these
heterologous cellulases from bacterial and fungal sources have been
transferred to S. cerevisiae, enabling the degradation of
cellulosic derivatives (Van Rensburg, P., et al., Yeast 14, 67-76
(1998)), or growth on cellobiose (Van Rooyen, R., et al., J.
Biotech. 120, 284-295 (2005)); McBride, J. E., et al., Enzyme
Microb. Techol. 37, 93-101 (2005)).
[0015] Related work was described by Fujita, Y., et al., (Appl.
Environ. Microbiol. 70, 1207-1212 (2004)) where cellulases
immobilised on the yeast cell surface had significant limitations.
Firstly, Fujita et al. were unable to achieve fermentation of
amorphous cellulose using yeast expressing only recombinant BGL1
and EGII. A second limitation of the Fujita et al. approach was
that cells had to be pre-grown to high cell density on standard
carbon sources before the cells were useful for ethanol production
using amorphous cellulose (e.g., Fujita et al. teaches high biomass
loadings of .about.15 g/L to accomplish ethanol production).
[0016] As noted above, ethanol producing yeast such as S.
cerevisiae require addition of external cellulases when cultivated
on cellulosic substrates such as pre-treated wood because this
yeast does not produce endogenous cellulases. Functional expression
of fungal cellulases such as T. reesei CBH1 and CBH2 in yeast S.
cerevisiae have been demonstrated (Den Haan R et al., Metab Eng.,
9, 87-94 (2007)). However, current levels of expression and
specific activity of cellulases heterologously expressed in yeast
are still not maximally efficient with respect to the
lignocellulosic substrate. Thus, there remains a significant need
for improvement in the amount and variety of cellulase activity
expressed in order to attain the goal of achieving a consolidated
bioprocessing (CBP) system capable of efficiently and
cost-effectively converting cellulosic substrates to ethanol.
[0017] The composition of lignocellulosic material varies greatly
based on its species of origin, the particular tissue from which it
is derived, and its pretreatment. Because of its varied
composition, organisms designed for CBP must produce digestive
enzymes that can accommodate a variety of substrates, in a variety
of conformations, in a variety of reaction environments. To date,
efficient usage of lignocellulosic substrates requires the addition
of external enzymes at high levels and externally added enzymes are
costly. Therefore it would be very beneficial to isolate cellulases
from cellulolytic organisms with high specific activity and high
expression levels in host organisms, such as the yeast S.
cerevisiae in order to achieve CBP. Also, in order to use
lignocellulosic material with maximal efficiency, it would also be
beneficial to discover combinations of paralogous and/or
orthologous enzymes that work synergistically to achieve more
efficient break down of Iignocellulosic components.
[0018] The secretome of Trichoderma reesei consists of 22 unique
identifiable protein species (Herpoel-Gimbert I, Margeot A, Dolla
A, et al., Comparative secretome analyses of two Trichoderma reesei
RUT-C30 and CL847 hypersecretory strains, Biotechnol Biofuels. 2008
Dec. 23; 1(1):18), identified by 2D gel electrophoresis and
MALDI-TOF mass spectrometry. However, a study of the
complementation of the T. reesei system, showed that the addition
of a small amount of supernatant from other cellulolytic fungi
provided a substantial increase in activity for T. reesei cellulase
preparations (Rosgaard L, Pedersen S, Cherry J R, et al.,
Efficiency of new fungal cellulase systems in boosting enzymatic
degradation of barley straw lignocellulose, Biotechnol Prog. 2006
March-April; 22(2):493-8). In addition to this, a comparison of the
T. reesei genome to several other cellulolytic fungi (Martinez D,
Berka R M, Henrissat B, et al., Genome sequencing and analysis of
the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea
jecorina), Nat Biotechnol. 2008 May; 26(5):553-60) found that its
genome encodes fewer cellulases and hemicellulases than all of the
other sequenced cellulolytic fungi, and may be particularly
deficient in hemicellulose degradation since it is missing the
tannase and feruoyl esterase enzyme families completely. These
studies suggest that activities not present in the T. reesei genome
may also be useful for hydrolyzing lignocellulose.
[0019] In addition, literature on reconstituted cellulase systems
from fungi do provide some insight into which enzymes (and how
much) are needed for hydrolysis. Gusakov A V, Salanovich T N,
Antonov A I, et al., Design of highly efficient cellulase mixtures
for enzymatic hydrolysis of cellulose, Biotechnol Bioeng. 2007 Aug.
1; 97(5):1028-38 used purified Chrysosporium lucknowense
cellulases, and showed that a mixture of CBH1, CBH2, EG2, EG5, BGL,
and XYN2 could extensively hydrolyze Organosolv pretreated douglas
fir. Because the Organosolv pretreatment extensively removes
lignin, it is likely it would remove the need for some enzyme
activities in addition. In another study (Zhou J, Wang Y H, Chu J,
et al., Optimization of cellulase mixture for efficient hydrolysis
of steam-exploded corn stover by statistically designed
experiments, Bioresour Technol. 2009 January; 100(2):819-25. Epub
2008 Sep. 3), .about.80% of the glucan in pretreated corn stover
could be converted by a mix of 7 enzymes, including CBH1, CBH2,
EG1, EG3, EG4, and BGL. In the optimized mix created by the
authors, the CBHs made up about two-thirds of the total cellulase,
and the ratio of CBH2 to CBH1 was 2:1. In both of these studies,
the reconstituted systems showed greater total hydrolysis than the
crude enzyme preparation, although this is likely a function of the
pretreatment conditions.
[0020] Beyond fungi, there are a large variety of cellulolytic
bacteria that can be used as gene donors for expression of
lignocellulolytic enzymes in yeast. In one aspect, the present
invention is drawn to identifying cellulolytic enzymes from a
variety of organisms and subsequently identifying enzymes that work
in maximally efficient combinations to digest lignocellolosic
material. Given the diversity of cellulolytic bacteria,
classification of these organisms based on several parameters (Lynd
et al., 2002) may inform the choice of gene donors. The following
are possible distinguishing characteristics: A) aerobic vs.
anaerobic, B) mesophiles vs. thermophiles; and, C) noncomplexed,
cell free enzymes vs. complexed, cell bound enzymes.
[0021] Another consideration when defining the needed set of
enzymatic activities is to attempt to characterize the linkages in
a lignocellulosic substrate. The following is an analysis for a
hardwood substrate. FIG. 1 provides an overview of the carbohydrate
structures present in plant material given in Van Zyl W H et al.,
Consolidated bioprocessing for bioethanol production using
Saccharomyces cerevisiae, Adv Biochem Eng Biotechnol., 108, 205-235
(2007). Although this depiction is not specific to hardwoods, it
corresponds relatively well with information from the Handbook of
Wood Chemistry and Composites (Rowell, 2005), which states that
hardwood hemicelluloses have the following characteristics: Largely
comprised of glucuronoxylans--similar to structure (B) from FIG. 1.
These have a xylan backbone (beta 1-4 linked xylopyranose units)
with acetyl groups at C2 or C-3, average of 7 acetyls per ten
xylose units, and are substituted with sidechains of
4-O-methylglucuronic acid (alpha 1-2 linkage). Hardwoods contain
2-5% of a glucomannan composed of beta-D-glucopyranose and
beta-D-mannopyranose units linked 1-4--somewhat similar to
structure (C) from FIG. 1; and hardwoods contain small amounts of
pectins, starch and proteins.
[0022] Panel F from FIG. 1 gives the structure for a type of
xylan--lignin linkage, as well as the 4-O-methylglucuronic acid
linkage to xylan that are associated with hardwoods. This figure
was taken from Spanikova S and Biely P, FEBS Lett., 580, 4597-4601
(2006). The authors of this paper identified an enzyme, glucuronoyl
esterase, which acts on these linkages. They identified the T.
reesei Cip2 as a homologue of this enzyme.
[0023] In order to address the limitations of heterologous
cellulase expression in consolidated bioprocessing systems, in one
aspect, the present invention provides for the identification of
novel saccharolytic enzymes that are capable of facilitating
efficient cellulase digestion and fermentation product production
in host cells. In particular, in one embodiment, the present
invention is directed to the isolation of novel genes for
saccarolytic enzymes from cellulolytic organisms. The present
invention provides novel genes that are capable of being
heterologously expressed in yeast systems and facilitate the
digestion of starch, pentose sugars, and lignocellulosic
components. Specifically, the present invention provides in one
embodiment for novel genes for saccharolytic enzymes from a variety
of bacterial, fungal, non-conventional yeast, and plant organisms
which can be expressed in yeast.
[0024] In another aspect, the present invention also describes
industrial yeast strains that express enzymes for the production of
fuel ethanol from corn starch.
[0025] Even though yeast strains expressing enzymes for the
production of fuel ethanol from whole grain or starch have been
previously disclosed, the application has not been commercialized
in the grain-based fuel ethanol industry, due to the relatively
poor ability of the resulting strains to produce/tolerate high
levels of ethanol. For example, U.S. Pat. No. 7,226,776 discloses
that a polysaccharase enzyme expressing ethanologen can make
ethanol directly from carbohydrate polymers, but the maximal
ethanol titer demonstrated is 3.9 g/l. U.S. Pat. No. 5,422,267
discloses the use of a glucoamylase in yeast for production of
alcoholic beverages; however, no commercially relevant titers of
ethanol are disclosed.
[0026] Additionally, although yeast cells are known to naturally
utilize sugars such as glucose and mannose, they lack the ability
to efficiently utilize pentose sugars such as xylose and
arabinose.
[0027] Therefore, in one embodiment, the present invention
describes industrial yeast strains that are engineered to express a
broad spectrum of various saccharolytic enzymes as well as pentose
utilization pathways for production of various compounds from
biomass feedstock containing mix of hexose and pentose mono- and
poly-saccharides.
[0028] Engineering and utilization of such yeast strain(s) would
allow a bioprocess with a biomass feedstock. Such biomass feedstock
could include several different polymeric compounds such as:
cellulose, hemicellulose, starch, pectin, inulin, levan and others.
Also, the biomass feedstock could contain the mix of pentose and
hexose carbohydrates. Therefore, complex substrates derived from
plants such as wood, corn, agave, switch grass and others that
contain combination of different carbohydrates and carbohydrate
polymers could be utilized in a bioprocess without prior separation
of different substrates. Furthermore, substrates derived from
different sources could be combined in the same bioprocess. The
substrates could be derived directly from plants or from any kind
of waste or byproducts containing carbohydrates.
[0029] The present invention represents the first demonstration of
a full CBP effect at commercial ethanol production level, wherein
yeast produced enzymes completely replace exogenous enzyme added in
standard commercial process. As a result, a yeast CBP strain was
able to produce over 125 g/l ethanol from liquefied corn mash in 72
hrs without any exogenous enzymes added. This was achieved due to
engineering selected set of enzymes into an industrial robust
background strain. The resulting strains may also be used to
produce ethanol directly from granular starch without
liquefaction.
BRIEF SUMMARY OF THE INVENTION
[0030] In some embodiments, the invention comprising a yeast
strain, or strains, secreting a full suite, or a subset of that
full suite, of enzymes to hydrolyze lignocellulose, including
enzymes that hydrolyze chemical linkages in cellulose,
hemicellulose, and between lignin and carbohydrates. In some
embodiments, the invention is also a set of proteins that are
well-expressed in yeast for each category of necessary enzymatic
activity in order to efficiently utilize a particular
lignocellulosic material. This full suite of enzymes contains
activities beyond those identified previously for expression in
yeast: CBH1, CBH2, EG, and BGL (as disclosed e.g. in PCT
Application No. PCT/US2009/065571). In some embodiments, the
present invention relates to a yeast cell that expresses one or
more gene products of the genes: Aspergillus fumigatus
Endoglucanase (Accession No. XP.sub.--747897); Neosartorya fischeri
Endoglucanase (Accession No. XP.sub.--001257357); Aspergillus
clavatus Endoglucanase (Accession No. XP.sub.--001270378);
Aspergillus terreus Endoglucanase (Accession No.
XP.sub.--001217291); Penicillium marneffei Endoglucanase (Accession
No. XP.sub.--002152969); Chaetomium globosum Endoglucanase
(Accession No. XP.sub.--001229968); Neurospora crassa Endoglucanase
(Accession No. XP.sub.--956431); Aspergillus oryzae Endoglucanase
(Accession No. BAA22589); Thielavia heterothallica Endoglucanase
(Accession No. AAE25067); Fusarium oxysporum Endoglucanase
(Accession No. AAG09047); Humicola insolens Endoglucanase
(Accession No. 1DYM_A); Pyrenophora tritici-repentis Endoglucanase
(Accession No. XP.sub.--001935476); Magnaporthe grisea
Endoglucanase (Accession No. XP.sub.--370166); Fusarium graminearum
Endoglucanase (Accession No. XP.sub.--388429); Chrysosporium
lucknowense Endoglucanase; Polyporus arcularius Endoglucanase
(Accession No. BAF75943.1); Aspergillus kawachii Endoglucanase
(Accession No. BAB62317.1); Heterodera schachtii Endoglucanase
(Accession No. CAC12958.1); Orpinomyces sp. Endoglucanase
(Accession No. AAD04193.1); Irpex lacteus Endoglucanase (Accession
No. BAD67544.1); Chaetomium globosum Endoglucanase (Accession No.
XP.sub.--001220409.1); Aspergillus niger Endoglucanase (Accession
No. XP.sub.--001397982.1); Penicillium decumbens Endoglucanase
(Accession No. ABY28340.1); Phanerochaete chrysosporium
Endoglucanase (Accession No. AAU12276); Stachybotrys echinata
Endoglucanase (Accession No. AAM77710); Neosartorya fischeri
Endoglucanase (Accession No. XP.sub.--001261563); Chaetomium
brasiliense Endoglucanase (Accession No. AAM77701); Chaetomium
globosum Endoglucanase (Accession No. EAQ86340); Aspergillus
fumigatus Endoglucanase (Accession No. CAF31975); Humicola insolens
Endoglucanase (Accession No. CAG27577); Neosartorya fischeri
Endoglucanase (Accession No. XP.sub.--001267517); Thielavia
terrestris Endoglucanase (Accession No. ACE10231); Chrysosporium
lucknowense Endoglucanase (Accession No. ACH15008); Chaetomium
globosum Endoglucanase (Accession No. XP.sub.--001226436);
Acremonium thermophilum Endoglucanase (Accession No. ACE10216);
Humicola insolens Endoglucanase (Accession No. CAB42307); Thielavia
terrestris Endoglucanase (Accession No. CAH03187); Chrysosporium
lucknowense Endoglucanase (Accession No. AAQ38151); Magnaporthe
grisea Endoglucanase (Accession No. EDJ97375); Chaetomium globosum
Endoglucanase (Accession No. EAQ84577); Humicola insolens
Endoglucanase 1DYS_B; Neurospera crassa Endoglucanase (Accession
No. XP.sub.--957415); Trichoderma reesei Xyloglucanase (Accession
No. AAP57752); Aspergillus niger Xyloglucanase (Accession No.
AAK77227); Aspergillus aculeatus Xyloglucanase (Accession No.
BAA29031); Neosartorya fischeri Xyloglucanase (Accession No.
XP.sub.--001261776); Chaetomium thermophilum Endoxylanase
(Accession No. CAD48749); Trichoderma reesei Endoxylanase
(Accession No. ABK59833); Chrysosporium lucknowense Endoxylanase
(Accession No. AAQ38147); Aureobasidium pullulans Endoxylanase
(Accession No. BAE71410); Aspergillus nidulans beta-xylosidase
(Accession No. CAA73902; Cochliobolus carbonum beta-xylosidase
(Accession No. AAC67554); Penicillium herquei beta-xylosidase
(Accession No. BAC75546); Pyrenophora tritici-repentis
beta-xylosidase (Accession No. XP.sub.--001940956); Aspergillus
niger beta-mannosidase (Accession No. Q9UUZ3); Aspergillus
aculeatus beta-mannosidase (Accession No. BAA29029); Neosartorya
fischeri beta-mannosidase (Accession No. XP.sub.--001258000);
Trichoderma reesei alpha-glucuronidase (Accession No. CAA92949);
Aspergillus niger alpha-glucuronidase (Accession No. CAC38119);
Talaromyces emersonii alpha-glucuronidase (Accession No. AAL33576);
Aspergillus niger acetylxylanesterase (Accession No.
XP.sub.--001395572); Trichoderma reesei acetylxylanesterase
(Accession No. Q99034); Neosartorya fischeri acetylxylanesterase
(Accession No. XP.sub.--001262186); Trichoderma reesei
arabinofuranosidase, 1,4-beta-D-arabinoxylan arabinofuranohydrolase
(Accession No. AAP57750); Chaetomium globosum arabinofuranosidase,
1,4-beta-D-arabinoxylan arabinofuranohydrolase (Accession No.
XP.sub.--001223478); Aspergillus niger arabinofuranosidase,
1,4-beta-D-arabinoxylan arabinofuranohydrolase (Accession No.
XP.sub.--001389998); Penicillium decumbens Swollenin (Accession No.
ACH57439); Neosartorya fischeri Swollenin (Accession No.
XP.sub.--001257521); Talaromyces stipitatus Swollenin (Accession No
EED19018); Trichoderma reesei (Accession No. AAP57751); Chaetomium
globosum (Accession No. XP.sub.--001228455); Magnaporthe grisea
(Accession No. XP.sub.--365869); Trichoderma reesei glucuronyl
esterase (Accession No. AAP57749); Chaetomium globosum glucuronyl
esterase (Accession No. XP.sub.--001226041); Aspergillus fumigatus
glucuronyl esterase (Accession No. XP.sub.--751313); Populus alba
alpha-expansin (Accession No. BAB39482); Vitis lubrusca
alpha-expansin (Accession No. BAC66697); Triticum aestivum
beta-expansin (Accession No. AAS48881); Eucalyptus globulus
beta-expansin (Accession No. AAZ08315); Aspergillus niger Feruoyl
esterase (Accession No. XP.sub.--001393337); Aspergillus terreus
Feruoyl esterase (Accession No. XP.sub.--001211092); Talaromyces
stipitatus Feruoyl esterase (Accession No. EED17739); Chaetomium
globosum Feruoyl esterase (Accession No. XP.sub.--001228412)
Streptomyces avermitilis 1,4-beta-cellobiosidase guxA1 (Accession
No. NP.sub.--821732.1); Streptomyces avermitilis
1,4-beta-cellobiosidase guxA2 (Accession No. NP.sub.--823029.1);
Streptomyces avermitilis 1,4-beta-cellobiosidase guxA3 (Accession
No. NP.sub.--823031.1); Streptomyces avermitilis
Endo-1,4-beta-glucanase celA1 (Accession No, NP.sub.--821730.1);
Streptomyces avermitilis Endo-1,4-beta-glucanase celA2 (Accession
No. NP.sub.--823030.1); Streptomyces avermitilis
Endo-1,4-beta-glucanase celA3 (Accession No. NP.sub.--823032.1);
Streptomyces avermitilis Endo-1,4-beta-glucanase celA4 (Accession
No. NP.sub.--823744.1); Streptomyces avermitilis
Endo-1,4-beta-glucanase (Accession No. NP.sub.--826394.1);
Streptomyces avermitilis Endo-1,4-beta-glucanase celA5 (Accession
No. NP.sub.--828072.1); Streptomyces avermitilis Beta-1,4-xylanase
(Accession No. NP.sub.--823272.1); Streptomyces avermitilis
Beta-1,4-xylanase (Accession No. NP.sub.--826161.1); Streptomyces
avermitilis Xylanase (Accession No. NF.sub.--827548.1);
Streptomyces avermitilis Endo-1,4-beta-xylanase xynD (Accession No.
NP.sub.--827557.1); Streptomyces avermitilis 1,4-beta-xylosidase
xynB 1 (Accession No. NP.sub.--822628.1); Streptomyces avermitilis
Beta-xylosidase (Accession No. NP.sub.--823285.1); Streptomyces
avermitilis 1,4-beta-xylosidase xynB2 (Accession No.
NP.sub.--826159.1); Streptomyces avermitilis 1,4-beta-xylosidase
xynB3 (Accession No. NP.sub.--827745.1); Streptomyces avermitilis
Beta-glucosidase bglC1 (Accession No. NP.sub.--822977.1);
Streptomyces avermitilis Beta-glucosidase bglC2 (Accession No.
NP.sub.--826430.1); Streptomyces avermitilis Beta-glucosidase bglC3
(Accession No. NP.sub.--826775.1); Streptomyces avermitilis AXE1
(Accession No. NP.sub.--822477.1); Streptomyces avermitilis AXE1
(Accession No. NP.sub.--822632.1); Streptomyces avermitilis abfA
(Accession No. NP.sub.--822218.1); Streptomyces avermitilis abfB
(Accession No. NP.sub.--822290.1); Streptomyces avermitilis abfA
(Accession No. NP.sub.--826920.1); Streptomyces avermitilis abfB
(Accession No. BAC74043.1); Streptomyces avermitilis SAV.sub.--6756
(Accession No. BAC74467.1); Streptomyces avermitilis agaA1
(Accession No. BAC68338.1); Streptomyces avermitilis agaA3
(Accession No. BAC68787.1); Streptomyces avermitilis agaB2
(Accession No. BAC69185.1); Saccharophagus degradans 2-40
Sde.sub.--2993 (Accession No. YP.sub.--528462.1); Saccharophagus
degradans 2-40 Sde.sub.--2996 (Accession No. YP.sub.--528465.1);
Saccharophagus degradans 2-40 Sde.sub.--3023 (Accession No.
YP.sub.--528492.1); Saccharophagus degradans 2-40 cel5A (Accession
No. ABD82260.1); Saccharophagus degradans 2-40 cel5E (Accession No.
ABD82186.1); Saccharophagus degradans 2-40 cel5F (Accession No.
ABD80834.1); Saccharophagus degradans 2-40 cel5J (Accession No.
ABD81754.1; Saccharophagus degradans 2-40 cel9A (Accession No.
ABD79898.1); Saccharophagus degradans 2-40 ced3A (Accession No.
ABD81757.1); Saccharophagus degradans 2-40 ced3B (Accession No.
ABD79509.1); Saccharophagus degradans 2-40 bgl1A (Accession No.
ABD82858.1); Saccharophagus degradans 2-40 bgl1B (Accession No.
ABD80656.1); Saccharophagus degradans 2-40 Cep94A (Accession No.
ABD80580.1); Saccharophagus degradans 2-40 Cep94B (Accession No.
ABD80168.1); Saccharophagus degradans 2-40 Sde.sub.--0509
(Accession No. YP.sub.--525985.1); Saccharophagus degradans 2-40
Sde.sub.--0169 (Accession No. YP.sub.--525645.1); Bacillus subtilis
Expansin exlX (Accession No. CAB13755.1); Bacillus subtilis
Endo-1,4-beta-glucanase eglS (Accession No. CAB13696.2); Bacillus
subtilis Endo-xylanase xynC (Accession No. CAB13698.1); Bacillus
subtilis Endo-1,4-beta-xylanase xynD (Accession No. CAB13699.1);
Bacillus subtilis Endo-1,4-beta-xylanase xynA (Accession No.
CAB13776.1); Bacillus subtilis Xylan beta-1,4-xylosidase xynB
(Accession No. CAB13642.2); Clostridium phytofermentans
Cphy.sub.--3367 (Accession No. YP.sub.--001560459.1); Clostridium
phytofermentans Cphy.sub.--3368 (Accession No.
YP.sub.--001560460.1); Clostridium phytofermentans Cphy.sub.--2058
(Accession No. YP.sub.--001559165.1); Clostridium phytofermentans
Cphy.sub.--3202 cellulase B (Accession No. YP.sub.--001560295.1);
Clostridium phytofermentans Cphy.sub.--1163 (Accession No.
YP.sub.--001558280.1); Clostridium phytofermentans Cphy.sub.--3329
(Accession No. YP.sub.--001560421.1); Clostridium phytofermentans
Cphy.sub.--1125 (Accession No. YP.sub.--001558242.1); Clostridium
phytofermentans Cphy.sub.--1510 (Accession No.
YP.sub.--001558623.1); Clostridium phytofermentans Cphy.sub.--0624
(Accession No. YP.sub.--001557750.1); Clostridium phytofermentans
Cphy.sub.--2105 XynA (Accession No. YP.sub.--001559210.1);
Clostridium phytofermentans Cphy.sub.--2108 (Accession No.
YP.sub.--001559213.1); Clostridium phytofermentans Cphy.sub.--3207
Y (Accession No. YP.sub.--001560300.1); Clostridium phytofermentans
Cphy.sub.--0191 (Accession No. YP.sub.--001557317.1); Clostridium
phytofermentans Cphy.sub.--0875 (Accession No.
YP.sub.--001558000.1); Clostridium phytofermentans Cphy.sub.--1169
(Accession No. YP.sub.--001558286.1); Clostridium phytofermentans
Cphy.sub.--1071 (Accession No. YP.sub.--001558190.1); Clostridium
phytofermentans Cphy.sub.--2128 (Accession No.
YP.sub.--001559233.1); Clostridium phytofermentans Cphy.sub.--2276
(Accession No. YP.sub.--001559376.1); Clostridium phytofermentans
Cphy.sub.--1936 (Accession No. YP.sub.--001559043.1); Clostridium
cellulolyticum cel5I (Accession No. AAL79562.1); Clostridium
cellulolyticum CelCCF (dockerin) Cel48F-yeast CO template pMU914
(Accession No. AAB41452.1); Clostridium cellulolyticum
Ccel.sub.--1259 (Accession No. YP.sub.--002505595); Clostridium
cellulolyticum Ccel.sub.--2226 (Accession No.
YP.sub.--002506548.1); Clostridium cellulolyticum Ccel.sub.--0732
(dockerin) Cel9E-yeast CO template pMU913 (Accession No.
YP.sub.--002505091.1); Clostridium cellulolyticum Ccel.sub.--1099
(dockerin) Cel5A-yeast CO template pMU967 (Accession No.
YP.sub.--002505438.1); Clostridium cellulolyticum Ccel.sub.--2392
(dockerin) (Accession No. YP.sub.--002506705.1); Clostridium
cellulolyticum Ccel.sub.--0731 (dockerin) Cel9G-yeast CO template
pMU892 (Accession No. YP.sub.--002505090.1); Clostridium
cellulolyticum Ccel.sub.--0840 (dockerin) Cel5D-yeast CO template
pMU891 (Accession No. YP.sub.--002505196.1); Clostridium
cellulolyticum CelCCC (dockerin) Cel8C-yeast CO template pMU969
(Accession No. AAA73867.1); Thermobifida fusca endo-1,4-beta
xylanase (Accession No. ABL73883.1); Thermobifida fusca
endo-1,4-beta-D-xylanase (xyl11) (Accession No. AAV64879.1);
Thermobifida fusca Endoglucanase (Accession No. AAZ55112.1);
Thermobifida fusca cellulase (Accession No. AAZ56745.1);
Thermobifida fusca exo-1,4-beta-glucosidase (Accession No.
AAZ55642.1); Thermobifida fusca beta-glucosidase (Accession No.
AAZ55664.1); Thermobifida fusca cellulose 1,4-beta-cellobiosidase
(Accession No. YP.sub.--290015.1); Thermobifida fusca CBD E8
(Accession No. AAZ55700.1); Thermobifida fusca celC (E3) (Accession
No. YP.sub.--288681.1); Thermobifida fusca celE (E5) (Accession No.
YP.sub.--288962.1); Thermobifida fusca cel5B (Endoglucanase)
(Accession No. AAP56348.1); Thermobifida fusca celA (E1) (Accession
No. AAC06387.1); Thermobifida fusca celB (E2) (Accession No.
YP.sub.--289135.1); Thermobifida fusca Tfu.sub.--1627
(1,4-beta-cellobiosidase) (Accession No. YP.sub.--289685.1);
Clostridium thermocellum celA (dockerin) (Accession No.
YP.sub.--001036701.1); Clostridium thermocellum celY (cel48Y)
(Accession No. CAI06105.1); Clostridium thermocellum
Cthe.sub.--0625 (dockerin) (Accession No. YP.sub.--001037053.1);
Clostridium thermocellum celC (Accession No. CAC27410.1);
Clostridium thermocellum (Accession No. YP.sub.--001037893.1);
Clostridium thermocellum (Accession No. YP.sub.--001038519.1);
Clostridium thermocellum bglA (Accession No. CAA42814.1);
Clostridium thermocellum bglB (Accession No. CAA33665.1);
Clostridium thermocellum Cthe.sub.--2548 (Accession No.
YP.sub.--001038942.1); Clostridium thermocellum Cthe.sub.--1273
(Accession No. YP.sub.--001037698.1); Clostridium thermocellum
Cthe.sub.--0040 (Cel9I) (Accession No. YP.sub.--001036474.1);
Clostridium thermocellum Cthe.sub.--0412 (dockerin) (Accession No.
YP.sub.--001036843.1); Clostridium thermocellum Cthe.sub.--0825
(dockerin) (Accession No. YP.sub.--001037253.1); Clostridium
stercorarium xynA (Accession No. CAD48307); Clostridium
stercorarium xynB (CelW--celloxylanase) (Accession No. CAD48313);
Clostridium stercorarium xynC (CelX--celloxylanase) (Accession No.
CAD48314); Clostridium stercorarium bxlB (b-Xylosidase B)
(Accession No. AJ508405); Clostridium stercorarium bxlA
(b-Xylosidase A) (Accession No. AJ508404);
Clostridium stercorarium bglZ (beta-glucosidase) (Accession No.
CAB08072); Clostridium stercorarium arfA
(alpha-arabinofuranosidaseA) (Accession No. AJ508406); Clostridium
stercorarium arfB (alpha-arabinofuranosidaseB) (Accession No.
AAC28125); Clostridium stercorarium celZ (Cs-Cel9Z--Avicellase I)
(Accession No CAA39010); Clostridium stercorarium celY
(Cs-Cel48Y--Avicellase II) (Accession No. CAA93280); Anaerocellum
thermophilum celA (1,4-beta-glucanase) (Accession No. CAB06786);
Anaerocellum thermophilum celD (EG) (Accession No. CAB01405);
Anaerocellum thermophilum xynA (1,4-beta-D-xylan xylanhydrolase)
(Accession No. CAA93627); Anaerocellum thermophilum celB (EG5)
(Accession No. Z86104); Anaerocellum thermophilum Athe.sub.--1866
(endo-1,4-beta-mannosidase) (Accession No. YP.sub.--002573059);
Anaerocellum thermophilum Athe.sub.--0594 ("cellulase") (Accession
No. YP.sub.--002572493).
[0031] In some embodiments, the cells of the invention can express
pairs of enzymes that have synergistic activity with respect to
their action on a given lignocellulosic substrate. Such pairs
include % but are not limited to (Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 (Accession No. NP.sub.--823030.1) and
Streptomyces avermitilis endo-1,4-beta-glucanase celA5 (Accession
No. NP.sub.--828072.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 (Accession No. NP.sub.--823030.1) and
Bacillus subtilis endo-1,4-beta-glucanase (Accession No
CAB13696.2)); (Streptomyces avermitilis endo-1,4-beta-glucanase
celA3 (Accession No. NP.sub.--823032.1) and Streptomyces
avermitilis endo-1,4-beta-glucanase (Accession No.
NP.sub.--826394.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 (Accession No. NP.sub.--823744.1) and
Streptomyces avermitilis xylanase (Accession No.
NP.sub.--827548.1)); (Bacillus subtilis endo-1,4-beta-glucanase
(Accession No CAB13696.2) and Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--826394.1));
(Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession
No. NP.sub.--823744.1) and Bacillus subtilis
endo-1,4-beta-glucanase (Accession No CAB13696.2)); (Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 (Accession No.
NP.sub.--828072.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 (Accession No. NP.sub.--823744.1));
(Streptomyces avermitilis endo-1,4-beta-glucanase celA5 (Accession
No. NP.sub.--828072.1) and Clostridium phytofermentans xylanase
(Accession No. YP.sub.--001557750.1)); (Saccharophagus degradans
2-40 mannanase (Accession No. YP.sub.--525985.1) and Streptomyces
avermitilis endo-1,4-beta-glucanase (Accession No.
NP.sub.--826394.1)); (Streptomyces avermitilis xylanase (Accession
No. NP.sub.--827548.1) and Saccharophagus degradans 2-40 mannanase
(Accession No. YP.sub.--525985.1)); (Clostridium phytofermentans
xylanase (Accession No. YP.sub.--001557750.1) and Streptomyces
avermitilis xylanase (Accession No. NP.sub.--827548.1));
(Clostridium phytofermentans xylanase (Accession No.
YP.sub.--001557750.1) and Streptomyces avermitilis xylanase
(Accession No. NP.sub.--827548.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 (Accession No. NP.sub.--828072.1) and
Streptomyces avermitilis xylanase (Accession No.
NP.sub.--827548.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--823744.1) and
Saccharophagus degradans 2-40 mannanase (Accession No.
YP.sub.--525985.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 (Accession No. NP.sub.--823030.1) and
Saccharophagus degradans 2-40 mannanase (Accession No.
YP.sub.--525985.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--823744.1) and
Streptomyces avermitilis endo-1,4-beta-glucanase celA3 (Accession
No. NP.sub.--823032.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--823744.1) and
Clostridium phytofermentans xylanase (Accession No.
YP.sub.--001557750.1)); (Streptomyces avermitilis xylanase
(Accession No. NP.sub.--827548.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase celA3 (Accession No. NP.sub.--823032.1));
(Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession
No. NP.sub.--823744.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--826394.1))
[0032] In some embodiments, host cells of the invention can express
three enzymes that have synergistic activity with respect to their
action on a given lignocellulosic substrate. Such triplets of
enzymes can be, for example (Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1); (Streptomyces avermitilis xylanase
NP.sub.--827548.1, Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 NP.sub.--823030.1); (Clostridium
phytofermentans xylanase YP.sub.--001557750.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1); (Saccharophagus degradans 2-40 mannanase
YP.sub.--525985.1, Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 NP.sub.--823030.1); (Streptomyces
avermitilis endo-1,4-beta-glucanase celA3 NP.sub.--823032.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 NP.sub.--823030.1); (Bacillus
subtilis endo-1,4-beta-glucanase eglS CAB13696.2, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase NP.sub.--826394.1, Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and Streptomyces
avermitilis endo-1,4-beta-glucanase celA2 NP.sub.--823030.1);
(Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1, Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1); (Streptomyces
avermitilis xylanase NP.sub.--827548.1Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and Streptomyces
avermitilis endo-1,4-beta-glucanase celA4 NP.sub.--823744.1);
(Clostridium phytofermentans xylanase YP.sub.--001557750.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1); (Saccharophagus
degradans 2-40 mannanase YP.sub.--525985.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA4
NP.sub.--823744.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA3 NP.sub.--823032.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA4
NP.sub.--823744.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase NP.sub.--826394.1, Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and Streptomyces
avermitilis endo-1,4-beta-glucanase celA4 NP.sub.--823744.1);
(Bacillus subtilis endo-1,4-beta-glucanase eglS CAB 13696.2,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1); (Streptomyces
avermitilis endo-1,4-beta-glucanase celA2 NP.sub.--823030.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Streptomyces avermitilis xylanase
NP.sub.--827548.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis xylanase NP.sub.--827548.1); (Clostridium
phytofermentans xylanase YP.sub.--001557750.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis xylanase NP.sub.--827548.1);
(Saccharophagus degradans 2-40 mannanase YP.sub.--525985.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Streptomyces avermitilis xylanase
NP.sub.--827548.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA3 NP.sub.--823032.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis xylanase NP.sub.--827548.1); (Streptomyces
avermitilis endo-1,4-beta-glucanase NP.sub.--826394.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis xylanase NP.sub.--827548.1); (Bacillus
subtilis endo-1,4-beta-glucahase eglS CAB 13696.2, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis xylanase NP.sub.--827548.1); (Streptomyces
avermitilis endo-1,4-beta-glucanase celA2 NP.sub.--823030.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Clostridium phytofermentans xylanase
YP.sub.--001557750.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Clostridium phytofermentans xylanase YP.sub.--001557750.1);
(Streptomyces avermitilis xylanase NP.sub.--827548.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Clostridium phytofermentans xylanase YP.sub.--001557750.1);
(Saccharophagus degradans 2-40 mannanase YP.sub.--525985.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA5
NP.sub.--828072.1, and Clostridium phytofermentans xylanase
YP.sub.--001557750.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA3 NP.sub.--823032.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Clostridium phytofermentans xylanase YP.sub.--001557750.1);
(Streptomyces avermitilis endo-1,4-beta-glucanase
NP.sub.--826394.1, Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 NP.sub.--828072.1, and Clostridium phytofermentans xylanase
YP.sub.--001557750.1); and, (Bacillus subtilis
endo-1,4-beta-glucanase eglS CAB13696.2, Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and Clostridium
phytofermentans xylanase YP.sub.--001557750.1)
[0033] In some embodiments, host cells of the invention can express
four enzymes that have synergistic activity with respect to their
action on a given lignocellulosic substrate. Such quadruplets of
enzymes can be, for example (Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1, Streptomyces
avermitilis xylanase NP.sub.--827548.1, Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 NF.sub.--828072.1, and Streptomyces
avermitilis endo-1,4-beta-glucanase celA2 NP.sub.--823030.1);
(Clostridium phytofermentans xylanase YP.sub.--001557750.1,
Streptomyces avermitilis xylanase NP.sub.--827548.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1); (Clostridium phytofermentans xylanase
YP.sub.--001557750.1, Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1); (Streptomyces avermitilis
endo-1,4-beta-glucanase NP.sub.--826394.1, Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 NP.sub.--823744.1, Streptomyces
avermitilis endo-1,4-beta-glucanase celA5 NP.sub.--828072.1, and
Streptomyces avermitilis endo-1,4-beta-glucanase celA2
NP.sub.--823030.1); (Saccharophagus degradans 2-40 mannanase
YP.sub.--525985.1, Streptomyces avermitilis xylanase
NP.sub.--827548.1, Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 NP.sub.--823030.1); and,
(Saccharophagus degradans 2-40 mannanase YP.sub.--525985.1,
Streptomyces avermitilis endo-1,4-beta-glucanase celA4,
NP.sub.--823744.1, Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 NP.sub.--828072.1, and Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 NP.sub.--823030.1)
[0034] In some embodiments, the yeast cell expresses any one or
more of the above-named genes in conjunction with one or more CBH1,
CBH2, EG, or BGL.
[0035] In some embodiments, the cells of the invention can be used
to reduce the amount of external enzyme needed to hydrolyze
lignocellulose during an SSF or CBP process, or to increase the
yield of a fermentation product during SSF or CBP at a given
cellulase loading.
[0036] In some embodiments, the invention provides polynucleotide
and amino acid sequences of endoglucanases, xylanases, xylosidases,
esterases, other hydrolases, and other accessory enzymes that are
active and well-expressed by S. cerevisiae and other yeast species.
In some embodiments, these well-expressed enzymes provide an
increased ability of cellulase cocktails to hydrolyze
lignocellulose. In some embodiments, combinations of the enzymes of
the present invention are useful for increasing the activity of
yeast expressed "core" cellulases, CBH1, CBH2, EG, and BGL. In some
embodiments, the host yeast cell expresses, in addition to the
"core" cellulases, xylanase, xylosidase, glucoamylase, and
acetixylan esterase. In some embodiments, the invention provides
technology for expressing multiple genes in multiple copies using
yeast high-expression vectors, centromeric vectors and by genomic
integration.
[0037] In some embodiments, the present invention relates to
processes of producing fermentation products by contacting cells of
the invention with lignocellulosic material and then recoving the
fermentation material.
[0038] In some embodiments, the invention relates to the products
produced by the fermentation of lignocellulosic materials.
[0039] In one aspect, the saccharolytic enzymes (amylases,
cellulases, hemicellulases, cellulolytic and amylolytic accessory
enzymes, inulinases, levanases, and others) and pentose utilizing
enzymes are combined in a single yeast strain. In another
embodiment, the hydrolytic and pentose hydrolyzing enzymes are
expressed in different yeast strains used in the same technological
process. In one aspect, yeast strains, each expressing a different
enzyme, or a different combination of enzymes, are co-cultured in
the same volume. In another embodiment, yeast strains, each
expressing a different enzyme, or a different combination of
enzymes, are cultured in separate tanks.
[0040] Complex biomass feedstocks contain varying amounts of
starch, lignocellulosic material, and pentose sugars. Accordingly,
the yeast strains of the present invention are constructed to
express different saccharolytic enzymes at different levels. In one
embodiment, a yeast strain expresses one or more cellulolytic
enzymes at a higher level than one or more amylolytic enzymes and
one or more pentose sugar utilizing enzymes. In another embodiment,
the yeast strain expresses one or more amylolytic enzymes at a
higher level than one or more cellulolytic enzymes and one or more
pentose sugar utilizing enzymes. In yet another embodiment, the
yeast strain expresses one or more pentose sugar utilizing enzymes
at a higher level than one or more cellulolytic enzymes and one or
more amylolytic enzymes.
[0041] In some embodiments, the present invention relates to a
recombinant yeast host cell comprising a heterologous
polynucleotide encoding a polypeptide comprising an amino acid
sequence at least 90% identical to any one of the amino acid
sequences of SEQ ID NOs: 442-446.
[0042] In some embodiments, the present invention relates to a
recombinant yeast host cell comprising one or more heterologous
polynucleotides encoding a polypeptide of Table 19.
[0043] In some embodiments, the present invention relates to a
recombinant yeast host cell comprising: (a) at least one
heterologous polynucleotide comprising a nucleic acid which encodes
a glucoamylase; (b) at least one heterologous polynucleotide
comprising a nucleic acid which encodes an alpha-glucosidase; (c)
at least one heterologous polynucleotide comprising a nucleic acid
which encodes an enzyme that utilizes pentose sugar; and (d)
further comprising at least one heterologous polynucleotide
encoding a polypeptide comprising an amino acid sequence according
to SEQ ID NOs: 442-446. In another embodiment, the yeast host cell
further comprises an alpha-amylase, a pullulanse, and/or an
isopullulanse.
[0044] In some embodiments, the cells of the invention can express
pairs of amylolytic enzymes that have synergistic activity with
respect to their action on a given biomass substrate. Such pairs
include, but are not limited to (SEQ ID NO: 443 and SEQ ID NO:
444); (SEQ ID NO: 443 and SEQ ID NO: 445); (SEQ ID NO: 445 and SEQ
ID NO: 446); (SEQ ID NO: 443 and SEQ ID NO: 445); (SEQ ID NO: 442
and SEQ ID NO: 445); (SEQ ID NO: 444 and Bacillus subtilis
arabinoxylanase (Accession No. CAB13699.1)); (SEQ ID NO: 444 and
Bacillus subtilis arabinoxylanase (Accession No. CAB13699.1)); (SEQ
ID NO: 444 and Bacillus subtilis arabinan
endo-1,5-alpha-L-arabinosidase (Accession No. CAB15969.1)); (SEQ ID
NO: 444 and Bacillus subtilis arabinan-endo 1,5-alpha-L-arabinase
(Accession No. CAA99586.1)); (SEQ ID NO: 444 and Bacillus subtilis
arabinan endo-1,5-alpha-L-arabinosidase (Accession No. AL009126));
(SEQ ID NO: 444 and Bacillus subtilis endo-arabinase (Accession No.
D85132)); (SEQ ID NO: 444 and Clostridium phytofermentans
arabinogalactan endo-1,4-beta-galactosidase (Accession No.
CP000885)); (SEQ ID NO: 444 and Bacillus licheniformis
arabinan-endo 1,5-alpha-L-arabinase (Accession No. AAU40201.1);
(SEQ ID NO: 444 and Bacillus licheniformis arabinan-endo
1,5-alpha-L-arabinase (Accession No. AAU41895.1); (SEQ ID NO: 444
and Bacillus licheniformis arabinogalactan
endo-1,4-beta-galactosidase (Accession No. AAU43089.1); (SEQ ID NO:
444 and Bacillus licheniformis arabinan
endo-1,5-alpha-L-arabinosidase (Accession No. AAU43033.1); (SEQ ID
NO: 444 and Bacillus licheniformis arabinan endo-1,4-beta-xylanase
(Accession No. AAU39947.1); (SEQ ID NO: 444 and
Thermoanaerobacterium saccharolyticum arabinogalactan
endo-1,4-beta-galactosidase); (SEQ ID NO: 444 and
Thermoanaerobacterium saccharolyticum alpha-N-arabinofuranosidase);
(SEQ ID NO: 444 and Streptomyces avermitilis endo-1,4-beta-xylanase
xynD (Accession No. 827557.1); (SEQ ID NO: 444 and Bacillus
subtilis endo-1,4-beta-xylanase xynA (Accession No. CAB13776.1);
(SEQ ID NO: 444 and Clostridium phytofermentans xylanase (Accession
No. YP.sub.--001558623.1); (SEQ ID NO: 444 and Clostridium
phytofermentans xylanase (Accession No. YP.sub.--001557750.1); (SEQ
ID NO: 444 and Thermobifida fusca endo-1,4-beta-D-xylanase (xyl11)
(Accession No. AAV64879.1); (SEQ ID NO: 444 and Clostridium
thermocellum xylanase (Accession No. YP.sub.--001038519.1); (SEQ ID
NO: 444 and Clostridium stercorarium endo-xylanase (Accession No.
CAD48307); (SEQ ID NO: 444 and Clostridium stercorarium xynC
(CelX--celloxylanase) (Accession No. CAD48314); (SEQ ID NO: 444 and
Aspergillus niger alpha-glucosidase (Accession No. BAA23616.1));
(SEQ ID NO: 444 and Thermoanaerobacterium saccharolyticum
glucoamylase).
[0045] In some embodiments, host cells of the invention can express
three enzymes that have synergistic activity with respect to their
action on a given biomass substrate. Such triplets of enzymes can
be, for example (SEQ ID NO: 442, SEQ ID NO: 445 and SEQ ID NO:
446); (SEQ ID NO: 444, SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID
NO: 442, SEQ ID NO: 445 and SEQ ID NO: 446).
[0046] In some embodiments, host cells of the invention can express
four enzymes that have synergistic activity with respect to their
action on a given biomass substrate. Such quadruplets of enzymes
can be, for example (SEQ ID NO: 442, SEQ ID NO: 444, SEQ ID NO: 445
and SEQ ID NO: 446); (SEQ ID NO: 443, SEQ ID NO: 444, SEQ ID NO:
445 and SEQ ID NO: 446).
[0047] In some embodiments, the present invention relates to a
method of producing a fermentation product comprising: (a)
combining a yeast cell of any one of claims 1-34 with grain
feedstock; (b) allowing the yeast cell to ferment the grain
feedstock; and (c) recovering one or more products of the
fermentation.
[0048] In some embodiments, the present invention relates to a
recombinant yeast host cell comprising two or more heterologous
polynucleotides encoding a polypeptide comprising: (a) at least one
amino acid sequences at least 90% identical to one or more of the
amino acid sequences of SEQ ID NOs: 219-436; and (b) at least one
amino acid sequences at least 90% identical to one or more of the
amino acid sequences of SEQ ID NOs: 442-446.
[0049] In some embodiments, the present invention relates to a
recombinant yeast host cell comprising: (a) at least one
heterologous polynucleotide encoding a polypeptide of Table 11; and
(b) at least one heterologous polynucleotide encoding a polypeptide
of Table 19.
BRIEF DESCRIPTION OF THE DRAWINGS
[0050] FIG. 1 depicts the complexity of cellulose and hemicellulose
and the enzymes involved in their degradation. Cellulose (a) and
hemicellulose structures for arabinoxylan (b), galactomannan (c),
and xyloglucan (d) depicting the different side chains present.
Hexoses are distinguished from pentoses by the presence of a
protruding line from the cyclic hexagon (pyranose ring), depicting
the CH.sub.2OH group. Hydrolase enzymes and the bonds targeted for
cleavage in the four polysaccharide structures are indicated by
arrow.
[0051] FIG. 2 depicts a basic cloning and expression vector for
testing cellulases (pMU1531). This vector is an episomal 2-.mu.
yeast expression vector used for expression of genes in yeast. ENO
1 promoter--S. cerevisiae ENO1 promoter; S.cer ENO1 ter--S.
cerevisiae ENO1 terminator; S.cer. URA3--S. cerevisiae URA3
auxotrophic marker; 2 mu ori--2.mu. S. cerevisiae plasmid origin of
replication; bla(AmpR)--Amp resistance marker; pBR322--E. coli
pB322 plasmid origin of replication; TEF1 pr--Ashbya gossypii TEF1
promoter; TEF1 ter--A. gossypii TEF1 terminator; ble (Zeo)
R--Streptoalloteichus hindustanus ble Zeocin resistance gene.
[0052] FIG. 3 depicts CMC (top panel) and avicel (bottom panel)
assay results for EG1 candidates expressed in M0509. All EG1
constructs were tested under the control of the ENO1 promoter and
terminator. Strain M1322 is expressing an EG from the termite C.
formosanus. T. reesei EG1 and T. reesei EG2 were included as
controls.
[0053] FIG. 4 depicts results from a pretreated hardwood (PHW)
assay for the top 6 EG1 candidates, mixed with yeast made,
purified, TeCBH1w/TrCBD, and C1CBH2, and Novozyme 188.
[0054] FIG. 5 depicts results of a PHW assay for EG1 candidates in
the presence of Novozyme 188.
[0055] FIG. 6 depicts results of a SDS-PAGE analysis of the
supernatants of (A) the EG2 and (B) the EG3 producing strains. A
strain containing a plasmid with no foreign gene was used as
reference strain (REF). The strain containing the plasmid pRDH180
expressing T.r.eg2, the most successful EG previously found, was
also included.
[0056] FIG. 7 depicts results of a CMC and a barley-.beta.-glucan
assay. Cultures were spotted on SC.sup.-URA plates containing 0.2%
of either CMC (A and B) or barley-.beta.-glucan (C). Numbers
indicate the plasmid contained by each strain. pRDH180 contained
the T. reesii eg2 and served as positive control. Plates were
incubated for 3 (A) or 24 (B & C) hours at 30.degree. C., after
which colonies were washed of and the plates were stained with 0.1%
congo red and de-stained with 1% NaCl.
[0057] FIG. 8 depicts results from an assay measuring activity of
YPD and SC cultured strains expressing EGs on avicel (24 hours) and
CMC (3 hours). A strain containing a plasmid with no foreign gene
was used as reference strain (REF) and the strain expressing
T.r.eg2 (pRDH180) was included as positive control.
[0058] FIG. 9 depicts results of a CMC plate assay of EG4, EG5, and
EG6 clones to verify activity expression of the genes.
[0059] FIG. 10 depicts PHW assay results for candidate EG4s, EG5s,
and EG6s.
[0060] FIG. 11 depicts results from experiments with EG4, EG5, EG6,
and xyloglucanase candidates by PHW assay. Cultures were grown in
15 mls of YPD for 2 days at 35 degrees in 50 ml tubes. Cultures
were spun down and 2 mls of each supernatent was added to 2 mls of
PHW components (Negative control is M0544, and M1179 expresses
CBH1, CBH2, EG2, and BGL). 4 mg/g, of purified enzymes was used as
a screening partner in a ratio of 40:0:15:5 of
CBH1:CBH2:EG2:BGL1.
[0061] FIG. 12 depicts results of a SDS-PAGE analysis of the
supernatants of (A) xylanase and (B) xylosidase producing strains.
A strain containing a plasmid with no foreign gene was used as
reference strain (REF). The strain containing the plasmid pRDH182
(expressing T.r.xyn2) or containing the plasmid pRDH181 (expressing
A.n.xlnD) was also included.
[0062] FIG. 13 depicts the results of a RBB-xylan assay. Cultures
were spotted on SC.sup.-URA plates containing 0.2% RBB-xylan.
Numbers indicate the plasmid contained by each strain. Plates were
incubated for 24 hours at 30.degree. C.
[0063] FIG. 14 depicts results of an assay measuring activity of
YPD and SC cultured strains expressing xylanases and xylosidases on
1% birchwood glucuronoxylan (A) and pNPX (B). A strain containing a
plasmid with no foreign gene was used as reference strain
(REF).
[0064] FIG. 15 depicts results from an assay measuring hydrolytic
activity as measured by reducing sugar released by mixtures of
yeast supernatants from 5% xylan.
[0065] FIG. 16 depicts results of a TLC assay measuring sugars
released by yeast supernatants from birchwood glucuronoxylan. Std1
contained xylotetrose, xylotriose, xylobiose and xylose; Std2
contained, xylotriose, xylobiose and xylose. 54 of reactions 1 to 6
were loaded.
[0066] FIG. 17 depicts results of an arabinofuranosidase activity
assay with pNPA as substrate.
[0067] FIG. 18 depicts results of an esterase activity of candidate
enzymes on pNP-acetate.
[0068] FIG. 19 depicts results in a PHW assay on unwashed MS630 for
various accessory enzymes. Cultures were grown for 3 days at 35
degrees in 10 mls YPD with 20 ug/ml zeocin in 50 ml conical tubes.
1 ml of supernatant was added for each candidate, 0.5 ml each of
M1457 (BC60 xylanase) and M138.1 (P.t.r. GH43 xylosidase) plus 2
mls of PHW core mix. Core enzymes added were 1 mg/g of purified
CBH1/CBH2/EG2 and 0.2 mg/g of BGL1.
[0069] FIG. 20 depicts results of a PHW assay using combinations of
accessory enzymes on unwashed MS630 (hardwood substrait). So called
"Big 6" enzymes were: 1 mg/g of purified CBH1 and CBH2, 0.4 mg/g
purified EG2, and 0.2 mg/g purified BGL, 0.5 mL of each of M1457
(GH10 xylanase from C. phytofermentens, or BC60--see bacterial
enzyme screening below) and M1381 (P.t.r. GH43 xylosidase). These
were combined with PHW and buffer in a total volume of 2 mL and 2
mL of additional enzymes were added as tests, split evenly between
the enzymes (i.e. 1 mL each of 2 enzymes, or 0.67 mL each of 3
enzymes, etc). Results for glucose and xylose liberated are
depicted in panels A and B respectively.
[0070] FIG. 21 depicts results from a xylanase assay of yeast
strains expressing bacterial (top) and fungal (bottom) enzymes. On
the top graph the numbers mean BC numbers described in Table 7.
[0071] FIG. 22 depicts results from an assay evaluating the
secreted activity on CMC of bacterial endoglucanases expressed in
yeast. Strains were patched on YPD+Zeo plates (Zeo 250 mg/L) for 2
days and inoculated in 600 uL YPD in 96 wp, and grown for 3 days at
35.degree. C. at 900 rpm. The standard CMC assay was performed on
supernatants. All strains have M0749 background. The negative
control is M0749 transformed with empty expression vector pMU1575.
T. reesei EG2 in pMU1575 was used as positive control
construct.
[0072] FIG. 23 depicts results from a PHW assay with yeast-made
bacterial endoglucanases (see Table 7) in the presence of yeast
made purified CBH1 and CBH2. All wells were supplemented with 3.5
mg/g TS BGL (Novozyme-188) and 2 mg/g TS yeast made purified
CBH1+CBH2 (ratio 1:1). Supernatant of the strain expressing empty
vector was used as negative control.
[0073] FIG. 24 depicts results from an assay measuring glucose
release from PHW provided by different combinations of bacterial
GH9 EG (T. fusca Cel9A) and fungal GH5 EG (T. reesei EG2). The
negative control (empty vector) was added in amount of 2 ml.
Compositions of all other samples are shown on the figure. Left
side bars depict results from samples that were supplemented by
purified yeast made enzymes (1 mg/g CBH1, 1 mg/g CBH2, 0.2 mg/g
BGL) plus not purified yeast made xylanase (BC60, 100 ul/well) and
xylosidase (M1381, 100 ul/well). Right side bars depict results
from samples that were supplemented with the same amount of
purified CBHs plus 1 mg/g AB BGL.
[0074] FIG. 25 depicts results of an assay of secreted activity on
birchwood xylan for bacterial xylanases expressed in yeast. Strains
were patched on YPD+Zeo plates (Zeo 250 mg/L) for 2 days and
inoculated in 600 .mu.L YPD in 96 well plate. Plates were then
grown for 3 days at 35.degree. C. at 900 rpm. Standard xylose assay
(DNS based) was performed on supernatants. All strains have M0749
background. The negative control is M0749 transformed with empty
expression vector pMU1575. T. reesei Xyn2 in pMU1575 was used as
positive control construct.
[0075] FIG. 26 depicts the results of an assay measuring the effect
of yeast made xylanases on glucose release from PHW by yeast made
cellulases measured by PHW assay. Left-side bars depict results
from an assay that was supplemented with yeast made purified
cellulases (CBH1--1 mg/g TS; CBH2--1 mg/g TS; EG2--0.4 mg/g TS,
BGL--0.2 mg/g TS) and yeast made unpurified Pyrenophora
tritici-repentis .beta.-xylosidase (GH43, M1381)--50 ul sup/4 ml
reaction. M1381 strain expressing xylosidase was grown in YPD in
shake flask for 3 days. Right side bars depict results from an
assay that was supplemented with the same amount of yeast made
purified CBH1, CBH2 and EG2 plus 1 mg/g TS AB BGL (ME057). The
glucose was measured by a glucose hexokinase kit (Sigma). Each
experiment was performed in triplicates. Supernatant from a strain
expressing empty vector was used as negative control (NegCon).
Supernatant expressing fungal T. reesei Xyn2 was used as positive
control.
[0076] FIG. 27 depicts results from a xylanase assay in which yeast
strains expressing T. saccharolyticum xylanase genes were
evaluated.
[0077] FIG. 28 depicts results from an assay measuring glucose
release from PHW provided by bacterial accessory enzymes in the
presence of yeast made enzymes. A standard PHW assay was performed.
Glucose was measured by HPLC. The sample numbers mean BC numbers
(see Table 7). All samples were added in amount of 2 ml. All
samples including NC (negative control) were supplemented with
purified 1 mg/gCBH1, 1 mg/gCBH2, 0.4 mg/gEG2, 0.2 mg/g BGL; not
purified 2.5% (v/v) xylanase (M1457) and 2.5% (v/v).
[0078] FIG. 29 depicts results from an assay measuring glucose
release from PHW provided by different combinations (pairs) of EGs
that belong to different GH families. Glucose was measured by
glucose hexokinase kit. The samples were taken at 27 hrs and 48
hrs. The sample numbers are the GHF numbers (see Tables below).
NegCon (NC--empty vector) supernantant was added in amount of 2 ml.
The first bar in each colored block is 2 ml of single EG. All other
bars in each colored block represent a combination of two different
EGs (1 ml each). All samples including NC were supplemented with 1
mg/g CBH1+1 mg/gCBH2+4 mg/g EE. EE--External Enzymes was composed
of 3.25 mg/g ME50-2 (cellulase Novozyme22C, batch# CZP00004,
Novozymes); 0.25 mg/g ME54-2 (xylnase XYN30, batch# EL2007020L, EB
Enzymes; 0.25 mg/g ME57 (.beta.-glucosidase ABK, batch# EL2008044L,
EB Enzymes; and 0.25 mg/g ME64 (Pectinase FE, batch#1660 05x/lm
401-083-3580, Genencor). MS630 (a pretreated hardwood) was used as
substrate. All experiments were performed in triplicate. The
missing bars or the bars without error bars had all or most of the
repeats fail.
[0079] FIG. 30 depicts results from an assay measuring glucose
release from PHW provided by different combinations (triplets) of
EGs that belong to different GH families. Glucose was measured by
GHK kit. The samples were taken at 48 hrs. The sample numbers are
GHF numbers (see Tables below). The negative control (NC--empty
vector) and other single EGs supernatants were added in amount of 2
ml. In samples with two EGs, 1 ml of each supernatant was added. In
samples with three EGs 0.666 ml of each supernatant was added. All
samples including NC were supplemented with 1 mg/g CBH1+1
mg/gCBH2+4 mg/g EE. MS630 was used as substrate (a pretreated
hardwood). All experiments were performed in triplicate. The bar
without error bars had two repeats fail.
[0080] FIG. 31 depicts results from an assay measuring glucose
release from PHW provided by different combinations of EGs that
belong to different GH families. Glucose was measured by a
glucohexokinase kit. The samples were taken at 24 (A), 48 (B), 72
(C) and 96 (D) hrs. The sample numbers are GHF numbers (see
Tables). The negative control (NC--empty vector) and other single
EGs supernatants were added in amount of 2 ml. In samples with two
EGs 1 ml of each supernantant was added. In samples with three EGs
0.666 ml of each supernatant was added. In samples with four EGs
0.5 ml of each supernatant was added. All samples including NC were
supplemented with 1 mg/g CBH1+1 mg/gCBH2+EE (EE composition, see
above). EE was added at 2 mg/g TS (blue bars) or 4 mg/g TS (purple
bars). All experiments were performed in triplicate.
[0081] FIG. 32 depicts a time course of glucose release from PHW
provided by selected samples from FIG. 31.
[0082] FIG. 33 depicts a CEN vector with a Gal promoter upstream of
the centromere and an ARS replication origin (another 2.mu. origin
is also present to fire replication at multiple points for large
vectors). The four endoglucanases have unique promoters driving
them. The promoter/EG/terminator cassettes were PCR amplified from
existing vectors and incorporated into NotI digested pMU1943. The
right hand panel shows the activity of 6 separate colonies picked
from the YML transformation plate, which all demonstrated EG
activity.
[0083] FIG. 34 depicts CEN vectors built for testing the ability to
assemble large constructs. M1634 contains the CEN with 7 genes (23
kB), and M1635 contains the CEN with 11 genes (M1635).
[0084] FIG. 35 depicts results from an assay measuring CMC activity
for colonies picked from selective and non-selective plates after
growth of the starting culture in YPD or YP-Galactose. Activity is
comparable before and after galactose treatment in colonies from
high antibiotic resistance plates. Colonies treated with galactose
and plated on YPD without hygromycin show a large variation as seen
from the error bars indicating that the CEN vector is functioning
as expected during galactose growth.
[0085] FIG. 36 depicts results from a CMC assay on strains
expressing CEN6 vector passaged twice (about 10 generations) in YPD
without antibiotic. The CMC activity is comparable after passaging
for about 10 generations in YPD without antibiotic. It should be
noted that FIG. 35 shows the CMC assay data after only an hour,
whereas the CMC assay before passaging the strains is for a 1.5
hour time point.
[0086] FIG. 37 depicts an assay which is a comparison between the
top-performing colonies from YPD/zeocin (100) and YPD/zeocin (50)
plates at various dilutions.
[0087] FIG. 38 depicts results from a PHW assay with yeast produced
enzymes alone. M1179 (Strain with core cellulases
CBH1/CBH2/EG2/BGL1) was used along with CEN strain expressing 4 EGs
(EG1, 4, 5 and 6) strain M1377 (EG3) and M1050 (cel9A).
[0088] FIG. 39 depicts conversion of xylan to ethanol by several
strains of S. cerevisiae expressing xylanase alone, xylosidase
alone, or a combination of the two enzymes.
[0089] FIG. 40 depicts a genetic construct used to co-express
xylanase and xylosidase via integration at the rDNA loci.
[0090] FIG. 41 depicts a map of the episomal 2-.mu. yeast
expression vector used for expression of genes from Tables 15-17.
S.cer ENO1 pr--S. cerevisiae ENOL promoter; S.cer Invertase SP--S.
cerevisiae Invertase signal peptide; S.ser ENO1 ter--S. cerevisiae
ENO 1 terminator; S.cer. URA3--S. cerevisiae URA3 auxotrophic
marker; 2 mu ori--2.mu. S. cerevisiae plasmid origin of
replication; bla(AmpR)--Amp resistance marker; pBR322--E. coli
pB322 plasmid origin of replication; TEF1 pr--Ashbya gossypii TEF1
promoter; TEF1 ter--A. gossypii TEF1 terminator; ble (Zeo)
R--Streptoalloteichus hindustanus ble Zeocin resistance gene.
[0091] FIG. 42 depicts secreted activity of strains expressing new
synthetic genes measured by Starch-DNS (top), Starch-GHK (middle),
and Maltose (bottom) assays. All genes are described in Tables 15
and 16. All genes were inserted between PacI/AscI of pMU1575 2.mu.
expression vector and transformed into M1744 strain. Transformants
were grown in YPD for 3 days and supernatants were analyzed for
activity. "CO"--codon optimized for yeast synthetic genes;
others--PCRed from genomic DNA or cDNA.
[0092] FIG. 43 depicts starch activity of yeast made amylolytic
enzymes in combination with yeast made AE8. Supernatants of strains
grown for 3 days in YPD were mixed with supernatant of AE8
expressing strain at 50:50 ratio. In the first sample AE8
supernatant was 100%. Supernatant of M0509 was used as negative
control. "CO"--codon optimized for yeast synthetic genes;
others--PCRed from genomic DNA or cDNA.
[0093] FIG. 44 depicts a corn mash assay for new secreted genes
individually and in combination with AE8. Supernatants of strains
grown for 3 days in YPD were mixed with supe of AE8 expressing
strain at 50:50 ratio. Supernatant of M0509 was used as negative
control.
[0094] FIG. 45 depicts the effect of arabinases (top) and xylanases
(bottom) added to AE8 on glucose release from non pretreated corn
fiber. Supernatants of strains grown for 3 days in YPD were mixed
with supernatant of AE8 expressing strain at 50:50 ratio.
Supernatant of M0509 was used as negative control. Arabinases are
described in Table 16 (AE67-78). `BC" genes are described in Table
7. "BCTsX1" is the putative xylanase gene PCR amplified from
Thermoanaerobacterium saccharolyticum genomic DNA based on genome
sequence obtained at Mascoma.
[0095] FIG. 46 depicts the expression of amylolytic enzymes in
different industrial strains. The expression level of amylases AE3,
AE8, and AE49 (see Table 16) was evaluated by activity of
supernatants on maltose. All genes were subcloned into pMU1575 2u
expression vector by yeast mediated ligation and transformed into
one of three strains. Transformants were grown in YPD for 3 days
and supernatants were analyzed for activity by Maltose assay. Four
transformants were analyzed for each transformation.
[0096] FIG. 47 depicts expression constructs used for random
integration strain construction (top). P--S. cerevisiae promoter;
t--S. cerevisiae terminator; URA3--S. cerevisiae URA3 marker;
D--delta integration sites; "CO"--codon optimized synthetic genes.
Combinations of genes used for random integration (bottom). Genes
used in each combination are marked gray.
[0097] FIG. 48 depicts the secreted activity on starch of strains
built by random integration. Supernatants of strains grown for 3
days in YPD were used in starch-DNS assay. Ura--transformants were
selected from SD-URA plates; Starch--transformants were selected
from YM-Starch plates (1xYNB plus 0.5% starch); Controls--strains
do not express amylases. CBP strain-M1973 was used as a positive
control. The same experiment was repeated twice in duplicates:
1.sup.st experiment--top; 2.sup.nd experiment--bottom.
[0098] FIG. 49 depicts a scheme of directed integration strain
construction approach with negative selection marker FCY1 used as
integration site. Amylolytic strains M1973 and M2016 expressing
glucoamylases AE8 and/or AE9 were used as examples. The expression
cassettes flanking regions of FCY were integrated into FCY1 locus
(position .about.677162 on chromosome 16) of industrial strain
M0139 as PCRed DNA fragments with overlapping ends. The host M0139
is a diploid, therefore each expression cassette was integrated in
two copies. The 2-.mu. plasmid with Hyg marker was co-transformed
with PCR products. The transformants were first cultivated in
liquid YPD+Hyg media overnight and then plated on media with FCY
knock-out selective compound 5-fluorocytosine. Precultivation on
media with antibiotic increases efficiency of double FCY1
knock-out.
[0099] FIG. 50 depicts integration of additional copies of
glucoamylase into a genomic site such as an
Adenine-phosphoribosyltransferase 2 (APT2) locus.
[0100] FIG. 51 depicts a scheme of directed integration strain
construction approach with universal integration site. Amylolytic
strain M2022 expressing multiple copies of glucoamylases AE8 and
AE9 was used as an example. In the first round of transformation
(top) four additional glucoamylase expression cassettes together
with APT2 flanking regions, dominant markers (Nat and Kan) and FCY1
marker were integrated into APT2 locus (position .about.1345055
chromosome 14) into industrial strain M1973 (already expressing 4
glucoamylase copies, see FIG. 50) as PCRed DNA fragments with
overlapping ends. The transformants were plated on YPD+Nat+Kan
plates that allow growth only for cells that have both dominant
markers integrated into different copies of chromosome. In the
second round of transformation (middle) the transformants selected
for the high amylolytic activity by Starch-DNS assay were
transformed with two PCR products that have overlapping ends:
5'-APT2 flanking region and 5' part of AE9 expression cassette. The
transformants were patched on 5-fluorocytosine containing media
that allows selection for lack of FCY1. On the bottom of the figure
the final APT2 integration locus of M2022 shown. It also shows
which S. cerevisiae promoters (pr) and terminators (ter) were
controlling expression of newly added AE8 and AE9.
[0101] FIG. 52 depicts ethanol produced by amylolytic yeast without
exogenous glucoamylase from liquefied corn mash. The numbers are
average of triplicate runs and error bars are 1 std. Inoculum of
0.1 g/L was used. Fermentations were performed in 250 mL sealed
shake flasks with a total fermentation mass of 50 g on corn mash
obtained from Valero bio-refinery at 30% solids (TS) at a
fermentation temperature of 32.degree. C. at a shaking speed of 125
rpm. The fermentations were performed using 500 ppm urea as the
only nutrient source. Standard dose (0.45 AGU/g TS) of commercial
glucoamylase (Spirizyme Ultra, Novozymes) was added to the control
strain M0139. All other strains were fermented without any
exogenous enzymes added. The ethanol produced after 60 h is
shown.
[0102] FIG. 53 depicts ethanol produced by amylolytic yeast without
exogenous glucoamylase from non-liquefied corn mash. 50 g flask
runs on raw starch (corn ground w/2 mm screen Wiley Mill); raw corn
slurry 30% solids; 0.006 mg/ml Pen G; 0.1 gDCW/1 inoculum;
T=35.degree. C. for 24 hrs followed by 32.degree. C. Average of
duplicate flasks shown. The fermentations were performed using 500
ppm urea as the only nutrient source. Standard dose (0.45 AGU/g TS)
of commercial glucoamylase (Speezyme, Genencor Inc.) was added to
the control strain M0139. All other strains were fermented without
any exogenous enzymes added.
[0103] FIG. 54 depicts the adaptation of amylolytic M1973 strain by
serial transfer. 1973--Original M1973 strain from freezer stock;
1973A--Adopted M1973 strain. The strains were evaluated by
fermentation on 30% or 35% TS corn mash (first number) at
32.degree. C. or 35.degree. C. (second number). Data shown for 48 h
time point.
[0104] FIG. 55 depicts an example of a process flow sheet with CBP
yeast strains. Ground corn mash is used as a substrate. Two yeast
CBP strains are used in the process and cultured separately, S1 and
S2. Liquefied corn pre-treated with alpha-amylases is fermented by
yeast strain S1. S1 has an optimal set of amylases and accessory
enzymes engineered to efficiently convert starch into glucose
without any exogenous enzymes added. After distillation the
stillage is being pre-treated and fermented by strain S2. S2 has a
cellulolytic set of enzymes engineered and optimized for corn fiber
conversion as well as xylose and arabinose pathways.
[0105] FIG. 56 depicts PCR genotyping of industrial yeast strains
genomic DNA (Ness et al. 1993). 1 kb--NEB 1 kb ladder. A--M0139
like pattern; B--M2390 like pattern.
[0106] FIG. 57 depicts growth of industrial yeast strains at
41.degree. C. Strains were streaked for singles on YPD plate and
incubated at 41.degree. C. for 4 days.
[0107] FIG. 58 (Top) depicts maximum growth rate at 41.degree. C.
in YPD of industrial strains described in Table 20. Growth rate
measured by plate reader Synergy 2 (BioTek) following manufacture's
instructions. Bottom--Corn flour fermentation in shake flasks at 72
h of industrial strains described in Table 20. Raw corn flour was
used as substrate. Fermentation was performed at 35% of total
solids; at the temperature of 35.degree. C. for 24 h followed by
32.degree. C. for the rest of fermentation. Strains marked with "*"
were done in separate experiment at similar conditions but at 33%
of total solids. Full commercial dose of exogenous GA was added to
all strains at concentration 0.6 AGU/g of total solids. Experiment
was done in duplicates. Commercial enzyme Spirizyme Ultra
(Novozymes) was used as exogenous glucoamylase. Ethanol was
measured by HPLC.
[0108] FIG. 59 depicts a map of expression construct used to
transform different industrial hosts. ENO 1--S. cerevisiae ENO 1
promoter; AE9 CO-- codon optimized for S. cerevisiae
Saccharomycopsis fibuligera glucoamylase gene (NCBI#CAC83969.1);
S.cer ENO1 ter--S. cerevisiae ENO1 terminator; PDC1--S. cerevisiae
PDC1 terminator; ADH1--S. cerevisiae ADH1 promoter; TEF--S.
cerevisiae TEF2 promoter; nat1--Streptomyces noursei nat1 genes
that confers resistance to antibiotic Nourseothricin; TRH--S.
cerevisiae TRH terminator. DNA fragments were PCRed separately and
recombined in vivo during yeast transformation.
[0109] FIG. 60 depicts secreted amylolytic activity of industrial
strains (Table 20) transformed with 4 copies of Saccharomycopsis
fibuligera glucoamylase gene (NCBI#CAC83969.1). Top panel shows the
names of host strains. Activity was measured by Starch assay.
Several transformants were picked for each host. Supernatant of
untransformed M0139 strain was used as negative control (C).
[0110] FIG. 61 depicts corn flour fermentation in shake flasks at
72 h of industrial strains and their transformants engineered to
express 4 copies of Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). Raw corn flour was used as a substrate. The
strains are described in the tables 20 and 22. Fermentation was
performed at 35% of total solids; at the temperature of 35 C for 24
h followed by 32.degree. C. for the rest of fermentation. Exogenous
GA was added to all strains at concentration 0.3 AGU/g of solids.
Transformed strains were done in duplicates. Host strains were done
in singles. Commercial enzyme Spirizyme Ultra (Novozymes) was used
as exogenous glucoamylase. Ethanol was measured by HPLC.
[0111] FIG. 62 depicts corn mash fermentation in shake flasks at 48
h of industrial strains and their transformants engineered to
express 4 copies of Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). Liquefied corn pre-treated with alpha-amylases
from conventional plant was used as substrate. The strains are
described in the tables 20 and 22. Fermentation was performed at
35% of total solids and 35.degree. C. Exogenous GA was added to all
strains at concentration 0.3 AGU/g of solids. The experiment was
done in duplicates. Commercial enzyme Spirizyme Ultra (Novozymes)
was used as exogenous glucoamylase. Ethanol was measured by
HPLC.
[0112] FIG. 63 depicts secreted amylolytic activity of M2390
transformants engineered to express 4 copies of
AE9--Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). About 1000 transformants were screened by Starch
assay. This experiment shows repeated Starch assay data for 30 the
most active transformants. Experiment was done in triplicates.
Supernatant of untransformed M2390 strain was used as negative
control. Strains M2111 and M2395 were used as positive control (see
Tables 20 and 21 for strains description).
[0113] FIG. 64 depicts corn mash fermentation in minivials at 72 h
of M2390 transformants engineered to express 4 copies of
AE9--Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). Seventeen best transformants from amylolytic
activity screen (FIG. 63) were selected for this experiment.
Fermentation was performed at 30% of total solids and 30.degree. C.
Exogenous GA was added to the untransformed M2390 strain only, at
concentration 0.3 AGU/g of solids. The experiment was done in
duplicates. M2111, M2395 and M2390 strains were used as controls
(see tables 20 and 21 for strains description). Commercial enzyme
Spirizyme Ultra (Novozymes) was used as exogenous glucoamylase.
Ethanol was measured by HPLC.
[0114] FIG. 65 depicts corn flour fermentation in minivials at 72 h
of M2390 transformants engineered to express 4 copies of
AE9--Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). Seventeen best transformants from amylolytic
activity screen (FIG. 63) were selected for this experiment.
Fermentation was performed at 30% of total solids and 30.degree. C.
Exogenous GA was added to the untransformed M2390 strain at
concentration 0.3 AGU/g of solids and at 0.1 AGU/g to all other
strains. The experiment was done in duplicates. M2111, M2395 and
M2390 strains were used as controls (see Tables 20 and 21 for
strains description). Commercial enzyme Spirizyme Ultra (Novozymes)
was used as exogenous glucoamylase. Ethanol was measured by
HPLC.
[0115] FIG. 66 depicts corn flour fermentation in shake flasks at
72 h of M2390 transformants engineered to express 4 copies of
AE9--Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). Seven best transformants from minivials
fermentation screen (FIGS. 64-65) were selected for this
experiment. Fermentation was performed at 33% of total solids at
the temperature of 35.degree. C. for 24 h followed by 32.degree. C.
for the rest of fermentation. Exogenous GA was added to the
untransformed M2390 strain at concentration 0.6 AGU/g of solids and
at 0.1 AGU/g to all other strains. The experiment was done in
duplicates. Commercial enzyme Spirizyme Ultra (Novozymes) was used
as exogenous glucoamylase. Ethanol was measured by HPLC.
[0116] FIG. 67 depicts time course of liquefied conventional corn
mash fermentation in shake flasks of M2691 strain--the best M2390
transformant engineered to express 4 copies of
AE9--Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1). Transformant P10-19 (FIG. 66) was re-named as
M2691. Fermentation was performed at 32.5% of total solids at the
temperature of 35.degree. C. for 24 h followed by 32.degree. C. for
the rest of fermentation. Exogenous GA was added to the
untransformed M2390 strain only, at concentration 0.3 AGU/g of
solids. The experiment was done in duplicates. Commercial enzyme
Spirizyme Ultra (Novozymes) was used as exogenous glucoamylase.
Ethanol was measured by HPLC.
[0117] FIG. 68 depicts time course of raw corn flour fermentation
in shake flasks of M2691 strain--the best M2390 transformant
engineered to express 4 copies of AE9-Saccharomycopsis fibuligera
glucoamylase gene (NCBI#CAC83969.1). Transformant P10-19 (FIG. 66)
was re-named as M2691. Fermentation was performed at 33% of total
solids at the temperature of 35.degree. C. for 24 h followed by
32.degree. C. for the rest of fermentation. Exogenous GA was added
to the untransformed M2390 strain at concentration 0.6 AGU/g of
solids and at 0.1 AGU/g to M2691. The experiment was done in
duplicates. Commercial enzyme Spirizyme Ultra (Novozymes) was used
as exogenous glucoamylase. Ethanol was measured by HPLC.
[0118] FIG. 69 depicts exogenous glucoamylase dose response for
untransformed M2390 strain, low GA producer M2395 strain, and high
GA producer M2519 (P6-65). Corn flour shake flasks fermentation was
performed at 35% of total solids at the temperature of 35.degree.
C. for 24 h followed by 32.degree. C. for the rest of fermentation.
The experiment was done in duplicates. Commercial enzyme Spirizyme
Ultra (Novozymes) was used as exogenous glucoamylase. Ethanol and
glucose were measured by HPLC.
[0119] FIG. 70 depicts stability test of two M2390+AE9
transformants, M2519 (top) and M2691 (bottom). Both strains were
propagated in YPD. Strains were grown to stationary phase and
passaged with 100.times. dilution 11 times (1 passage--about 9
generations). Several samples between passages were stocked. All
samples and original strain were plated and inoculated together and
activity on starch was measured in the same assay. Experiment was
done in triplicates.
[0120] FIG. 71 depicts Pullulan (top), Xylan (middle) and Pectin
(bottom) assays of yeast secreted enzymes (Table 23). The genes
were expressed under ENO1 promoter and terminator from 2-micron
plasmid pMU1575. The genes were inserted between PacI/AscI sites of
pMU1575 either by cloning or yeast mediated ligation. Expression
contracts were transformed into an industrial background Mascoma
strain M1744 and selected on minimal URA deficient media. Four
colonies were analyzed for each transformation. Transformants were
grown in YPD for 3 days and supernatants were analyzed for
activity. Supernatant of non-transformed strain M0139 (M1744
derived from M0139 through URA3 gene deletion) was used as negative
control. In Pectin assay C--commercial pectinase Multifect
(Genencor) diluted 10.times. by citrate buffer was used as positive
control (5 .mu.l used in assay).
[0121] FIG. 72 depicts corn syrup assay of yeast made enzymes.
CBH1, CBH2, EG2, BGL, XYL, and XLD were HPLC purified proteins. For
other enzymes yeast strains expressing enzymes were grown for 3
days in YPD and supernatants were used as enzyme source (Table 24).
B4--CBH1+CBH2+EG2+BGL; B6--CBH1+CBH2+EG2+BGL+XYL+XLD. Amounts of
purified enzymes used in assay are summarized in the Table 25. 250
.mu.l of M0139 (top) or M2111 (bottom) supe was added to all
samples. Other supernatant derived enzymes were added in amount of
250 .mu.l. In no other supernatant enzymes needed in the sample,
M0139 supernatant was added instead. For AE10+AE35 sample 125 .mu.l
of each supernatant was added in addition to 250 .mu.l of M0139 or
M2111 supernatant. NC-no other enzymes added except for M0139 or
M2111 supernatant.
[0122] FIG. 73 depicts a map of the episomal 2-micron yeast
expression vector pMU2382 used for construction of delta
integration expression cassettes with genes in Table 26. Gene of
interest under control of S. cerevisiae strong constitutive
promoter and terminator was inserted between URA3 and Delta2
fragments of pMU2382 vector digested with BamHI and EcoRI. The
cassette was inserted by yeast mediated ligation in the same
orientation as URA3. S.ser. URA3--S. cerevisiae URA3 auxotrophic
marker; 2 mu ori--2 micron S. cerevisiae plasmid origin of
replication; bla(AmpR)--Amp resistance marker; pBR322--E. coli
pB322 plasmid origin of replication, delta 1 and delta 2--fragments
of S. cerevisiae delta sites.
[0123] FIG. 74 depicts an example of corn flour assay of M2125
transformed with some genes and gene combos from Table 26.
Transformations (T) are described in the Table 27. Number after
dash means colony number for this transformation. Transformants
that are highlighted were selected for screening by fermentation.
BC60--M1744 strain expressing only BC60 on 2.mu. plasmid under ENO1
promoter. M2125--parental strain (M2111 with URA3 knockout).
Untransformed M0139 strain was used as negative control.
[0124] FIG. 75 depicts shake flask fermentation on homemade corn
mash of strains expressing additional to AE9 saccharolytic enzymes.
Strains selected based on highest ethanol titers reached in
minivial corn mash fermentation assay. Homemade mash was used. The
strains are described in the Table 28. Fermentation was performed
at 30% of total solids and 32.degree. C. Exogenous enzyme was added
to the untransformed M0139 strain only, at concentration 0.3 AGU/g
of solids. Parental M2111 strain was used as background control.
The experiment was done in duplicates. Commercial enzyme Spirizyme
Ultra (Novozymes) was used as exogenous glucoamylase. Ethanol was
measured by HPLC.
[0125] FIG. 76 depicts shake flask fermentation on corn flour of
strains expressing additional to AE9 saccharolytic enzymes. Strains
selected based on highest ethanol titers reached in minivial corn
flour fermentation assay. The strains are described in the Table
29. Fermentation was performed at 30% of total solids and
32.degree. C. Exogenous enzyme was added to the untransformed M0139
strain at concentration 0.3 AGU/g of solids and at 0.1 AGU/g to all
other strains. Parental M2111 strain was used as background
control. The experiment was done in duplicates. Commercial enzyme
Spirizyme Ultra (Novozymes) was used as exogenous glucoamylase.
Ethanol and sugars were measured by HPLC. Potential ethanol was
calculated based on glucose concentration (added theoretical
ethanol from unconsumed glucose).
[0126] FIG. 77 depicts shake flask fermentation on homemade corn
mash (top) and corn flour (bottom) of strains expressing AE9 only.
The strains were result of repeating the same transformation as was
done in M2111 construction with consequent screening of 1000
colonies for activity on starch. Strains for this shake flask
experiment were selected based on highest ethanol titers reached in
minivial corn homemade mash and flour fermentation assays. The
strains are described in Tables 30 and 31. Fermentation was
performed at 30% of total solids and 32.degree. C. Exogenous enzyme
was added to the untransformed M0139 strain at concentration 0.3
AGU/g of solids. In corn flour experiment exogenous enzyme was also
added to all other strains at concentration 0.1 AGU/g of solids.
Previously constructed M2111 strain was included for comparison.
The experiment was done in duplicates. Commercial enzyme Spirizyme
Ultra (Novozymes) was used as exogenous glucoamylase. Line--protein
(AE9) secreted by the strains after 3 days growth in YPD shake
flasks (separate from fermentation experiment). Ethanol and protein
concentration were measured by HPLC.
[0127] FIG. 78 depicts shake flask fermentation on industrial corn
mash of the best strains from shake flask screening experiments on
homemade mash and corn flour (FIGS. 75-77). The strains are
described in Table 32. Fermentation was performed at 30% of total
solids and 32.degree. C. Exogenous enzyme was added to the
untransformed M0139 strain only, at concentration 0.3 AGU/g of
solids. M2111 strain was included for comparison. The experiment
was done in duplicates. Commercial enzyme Spirizyme Ultra
(Novozymes) was used as exogenous glucoamylase. Ethanol and sugars
concentration were measured by HPLC. Potential ethanol was
calculated based on glucose concentration (added theoretical
ethanol from unconsumed glucose).
[0128] FIG. 79 depicts shake flask fermentation on industrial corn
mash of the best strains from shake flask screening experiments on
homemade mash and corn flour (FIGS. 75-77). The strains are
described in Table 33. Fermentation was performed at 30% of total
solids and 32.degree. C. Exogenous enzyme was added to the
untransformed M0139 strain only, at concentration 0.3 AGU/g of
solids. M2111 strain was included for comparison. The experiment
was done in duplicates. Commercial enzyme Spirizyme Ultra
(Novozymes) was used as exogenous glucoamylase. Ethanol and sugars
concentration were measured by HPLC. Potential ethanol was
calculated based on glucose concentration (added theoretical
ethanol from unconsumed glucose).
[0129] FIG. 80 depicts stability test of M2111 strain built by
directed integration (top) and strains built by random integration
(bottom). The strains were propagated in YPD, grown to stationary
phase and passaged with 100.times. dilution 11 times (1
passage--about 9 generations). Several. samples between passages
were stocked. All samples and original strain were plated and
inoculated together and activity on starch was measured in the same
assay. Random strains are described in Table 32. The experiment was
done in triplicates.
[0130] FIG. 81 depicts different possible strategies for directed
strains construction. Top--one site integration strategy;
bottom--multiple sites integration strategy. In one site strategy
negative markers alternate in each transformation round and all
expression cassettes are integrated into the same locus next to
each other. In multiple sites strategy positive and negative
markers alternate with each other and in each round of
transformation the expression cassette can be integrated into any
site on chromosome.
[0131] FIG. 82 depicts a schematic of TeCBH1+HgCBD expression
construct for integration at the .delta. sites in S.
cerevisiae.
[0132] FIG. 83 depicts assay of supernatants containing cellulases
on pretreated hardwood made by several strains of S. cerevisiae.
Supernatants were incubated with pretreated hardwood at 4% total
solids, an exogenous cellulase preparation at a 2 mg enzyme/g total
solids loading in the PHW assay. Accumulation of glucose in the
reaction was measured by HPLC.
[0133] FIG. 84 depicts a comparison of cellulolytic strains
containing either just one enzyme (CBH2, M1873), or seven enzymes
(M2232) to the control non-cellulase producing M1577 for ethanol
production in SSF. Both unwashed pretreated hardwood, and alkaline
washed pretreated hardwood substrates were used. Data is presented
from 160 hours of fermentation.
[0134] FIG. 85 depicts SDS-PAGE (left) and Western blot (right) of
yeast made alpha-glucuronidase. Alpha-glucuronidase, GH67 was PCR
amplified from Pichia stipitis genomic DNA and cloned+/-C-terminal
Histidine tag. Colonies from transformations were grown in yeast
extract (10 g/L), peptone (20 g/L), and glucose (20 g/L)+200
.mu.g/mL Zeocin, pH 7.0 in 50 mL vented conical tubes for 48-60
hours. Cultures supernatants were filtered through a 2 .mu.m PE
filter and concentrated approximately 20-fold in a 10,000 Da
molecular weight cut off filter. Protein quality was screened via
SDS-PAGE electrophoresis under non-reducing conditions and stained
with Coomassie Blue dye (left) or examined by Western Blot (right)
using an anti-Histidine primary antibody and alkaline phosphatase
conjugated secondary antibody (only His tagged constructs
visualized).
[0135] FIG. 86 depicts xyloglucanase activity on AZCL-xyloglucan
agar plates. Equal amounts of culture were spotted onto SC agar
plates containing 0.5% AZCL (Azurine-Crosslinked) tamarind
xyloglucan Megazyme catalog # I-AZXYG. Xyloglucanase activity is
indicated as blue zones such as those strains transformed with
pMU2856 and pMU2858+/-His tag. REF refers to control MO1744
background strain supernatant.
[0136] FIG. 87 depicts xyloglucanase activity in AZCL-xyloglucan.
70 .mu.L of supernatant of 3 day old 2.times.SC.sup.-ura cultures
were added to 280 .mu.L of 50 mM Na-Acetate buffer (pH 5.0)
containing 0.5% AZCL (Azurine-Crosslinked) tamarind xyloglucan
Megazyme catalog # I-AZXYG in a deep-well microtiter plate. The
plate was incubated in a microtiter plate shaker at 35.degree. C.
at 800 rpm agitation. Samples of 100 .mu.L were taken at 0, 60 and
180 minutes of incubation, spun down at 3000 rpm (2 minutes) after
which 50 .mu.L of the supernatant was placed in a fresh microtiter
plate and the OD at 600 nm was determined so that the increased OD
over time could be measured. REF refers to control MO1744
background strain.
[0137] FIG. 88 depicts SDS-PAGE (left) and Western (right) analysis
of yeast expressed xyloglucanases+/-His tags. Three days old
cultures in double strength SC.sup.-URA media buffered to pH6.0 (3
mL cultures in test tubes incubated at 30.degree. C. on rotary
wheel) were centrifuged and supernatants assayed by loading 15
.mu.L (+5 .mu.L loading buffer) onto 10% SDS-PAGE gels. REF refers
to control MO1744 background strain supernatant.
[0138] FIG. 89 depicts SDS-PAGE analysis of esterases expressed in
Saccharomyces cerevisiae. Three day old cultures in double strength
SC.sup.-URA media buffered to pH6.0 (3 mL cultures in test tubes
incubated at 30.degree. C. on rotary wheel) were centrifuged and
supernatants assayed by loading 15 .mu.L (+5 .mu.L loading buffer)
onto 10% SDS-PAGE gels and silver stained. REF refers to control
MO1744 background strain supernatant.
[0139] FIG. 90 depicts 1-Napthyl-acetate esterase assay of yeast
made esterases. Experiment was performed in duplicates. REF refers
to control M1744 background strain supernatant.
[0140] FIG. 91 depicts Alpha-galactosidase activity assay with
yeast made alpha-galactosidases. Experiment was performed in
duplicates. REF refers to control M1744 background strain
supernatant.
[0141] FIG. 92 depicts Western blot analysis of T. reesei
alpha-galactosidase (AGL3)+/-His tag expression in Saccharomyces
cerevisiae. Colonies from transformations were grown in yeast
extract (10 g/L), peptone (20 g/L), and glucose (20 g/L)+200 ug/mL
Zeocin, pH 7.0 in 50 mL vented conical tubes for 48-60 hours.
Cultures supernatants were filtered through a 2 .mu.m PE filter and
concentrated approximately 20-fold in a 10,000 molecular weight cut
off filter. Protein quality was screened via SDS-PAGE
electrophoresis under non-reducing conditions and examined by
Western Blot using an anti-Histidine primary antibody and alkaline
phosphatase conjugated secondary antibody (only His tagged
constructs visualized).
[0142] FIG. 93 depicts SDS-PAGE analysis of alpha-galactosidases
expression in Saccharomyces cerevisiae. Three day old cultures in
double strength SC.sup.-URA media buffered to pH6.0 (3 mL cultures
in test tubes incubated at 30.degree. C. on rotary wheel) were
centrifuged and supernatants assayed, and 15 .mu.L (+5 .mu.L
loading buffer) was loaded onto 10% SDS-PAGE gels and silver
stained.
[0143] FIG. 94 depicts a 2% total solids PWH assay with different
combinations of commercial and yeast made purified enzymes and the
resultant glucose release. The assay plate was incubated at
38.degree. C. and samples were removed at various time points for
HPLC analysis on the BioRad 87H column
[0144] FIG. 95 depicts a 2% total solids PWH assay with different
combinations of commercial and yeast made purified enzymes and the
resultant glucose release. The assay plate was incubated at
38.degree. C. and samples were removed at various time points for
HPLC analysis on the BioRad 87H column.
[0145] FIG. 96 depicts a 2% total solids PWH assay with different
combinations of commercial and yeast made purified enzymes and the
resultant glucose release. The assay plate was incubated at
38.degree. C. and samples were removed at various time points for
HPLC analysis on the BioRad 87H column.
[0146] FIG. 97 depicts a 2% total solids paper sludge assay of
different combinations of yeast made purified enzymes and the
resultant glucose release. The assay plate was incubated at
38.degree. C. and samples were removed at various time points for
HPLC analysis on the BioRad 87H column.
[0147] FIG. 98 depicts a 2% total solids paper sludge assay of
different combinations of yeast made purified enzymes and the
resultant xylose release. The assay plate was incubated at
38.degree. C. and samples were removed at various time points for
HPLC analysis on the BioRad 87H column.
[0148] FIG. 99 depicts final ethanol titers (92 hours) for 2
different industrial paper sludges SSF. Sludge 1--first 5 bars;
Sludge 2--last 5 bars. Washed (1M Citric acid) 2% solids paper
sludges were used. Strain M2108 was inoculated at 1.1 g/l.
Fermentation was performed at pH5.0, 35.degree. C., 220 rpm, 92
hrs.
[0149] FIG. 100 depicts ethanol and potential ethanol titers
achieved on 30% TS corn flour with 0.1 AGU/g TS exogenous
gluco-amylase. The control strain (M0139) has a full dose (0.3
AGU/g TS) of gluco-amylase.
[0150] FIG. 101 depicts ethanol and potential ethanol titers at 72
hours for xylanase and accessory enzyme screen on 30% TS corn flour
(ELN afoster2 corn-090).
[0151] FIG. 102 depicts glucose, xylose and arabinose released from
a hydrolysis of 2% TS pretreated wet cake.
[0152] FIG. 103 depicts hydrolysis yields from 190.degree. C., 10
minutes water pretreated coarse fiber and 1% sulfuric acid
pretreated coarse fiber.
DETAILED DESCRIPTION OF THE INVENTION
[0153] The disclosed methods and materials are useful generally in
the field of engineered yeast.
DEFINITIONS
[0154] A "vector," e.g., a "plasmid" or "YAC" (yeast artificial
chromosome) refers to an extrachromosomal element often carrying
one or more genes that are not part of the central metabolism of
the cell, and is usually in the form of a circular double-stranded
DNA molecule. Such elements may be autonomously replicating
sequences, genome integrating sequences, phage or nucleotide
sequences, linear, circular, or supercoiled, of a single- or
double-stranded DNA or RNA, derived from any source, in which a
number of nucleotide sequences have been joined or recombined into
a unique construction which is capable of introducing a promoter
fragment and DNA sequence for a selected gene product along with
appropriate 3' untranslated sequence into a cell. Preferably, the
plasmids or vectors of the present invention are stable and
self-replicating.
[0155] An "expression vector" is a vector that is capable of
directing the expression of genes to which it is operably
associated.
[0156] The term "intergrated" as used herein refers to genetic
elements that are placed, through molecular biology techniques,
into the genome of a host cell. For example, genetic elements can
be placed into the chromosomes of the host cell as opposed to in a
vector such as a plasmid carried by the host cell. Methods for
integrating genetic elements into the genome of a host cell are
well known in the art and include homologous recombination.
[0157] The term "heterologous" when used in reference to a
polynucleotide, a gene, a polypeptide, or an enzyme refers to a
polynucleotide, gene, polypeptide, or an enzyme not normally found
in the host organism. "Heterologous" also includes a native coding
region, or portion thereof, that is removed from the source
organism and subsequently reintroduced into the source organism in
a form that is different from the corresponding native gene, e.g.,
not in its natural location in the organism's genome. The
heterologous polynucleotide or gene may be introduced into the host
organism by, e.g., gene transfer. A heterologous gene may include a
native coding region that is a portion of a chimeric gene including
non-native regulatory regions that is reintroduced into the native
host. Foreign genes can comprise native genes inserted into a
non-native organism, or chimeric genes. A heterologous
polynucleotide, gene, polypeptide, or an enzyme may be derived from
any source, e.g., eukaryotes, prokaryotes, viruses, or synthetic
polynucleotide fragments. The term "heterologous" as used herein
also refers to an element of a vector, plasmid or host cell that is
derived from a source other than the endogenous source. Thus, for
example, a heterologous sequence could be a sequence that is
derived from a different gene or plasmid from the same host, from a
different strain of host cell, or from an organism of a different
taxonomic group (e.g., different kingdom, phylum, class, order,
family genus, or species, or any subgroup within one of these
classifications). The term "heterologous" is also used synonymously
herein with the term "exogenous."
[0158] The term "domain" as used herein refers to a part of a
molecule or structure that shares common physical or chemical
features, for example hydrophobic, polar, globular, helical domains
or properties, e.g., a DNA binding domain or an ATP binding domain.
Domains can be identified by their homology to conserved structural
or functional motifs. Examples of cellobiohydrolase (CBH) domains
include the catalytic domain (CD) and the cellulose binding domain
(CBD).
[0159] A "nucleic acid," "polynucleotide," or "nucleic acid
molecule" is a polymeric compound comprised of covalently linked
subunits called nucleotides. Nucleic acid includes polyribonucleic
acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may
be single-stranded or double-stranded. DNA includes cDNA, genomic
DNA, synthetic DNA, and semi-synthetic DNA.
[0160] An "isolated nucleic acid molecule" or "isolated nucleic
acid fragment" refers to the phosphate ester polymeric form of
ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA
molecules") or deoxyribonucleosides (deoxyadenosine,
deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"),
or any phosphoester analogs thereof, such as phosphorothioates and
thioesters, in either single stranded form, or a double-stranded
helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are
possible. The term nucleic acid molecule, and in particular DNA or
RNA molecule, refers only to the primary and secondary structure of
the molecule, and does not limit it to any particular tertiary
forms. Thus, this term includes double-stranded DNA found, inter
alia, in linear or circular DNA molecules (e.g., restriction
fragments), plasmids, and chromosomes. In discussing the structure
of particular double-stranded DNA molecules, sequences may be
described herein according to the normal convention of giving only
the sequence in the 5' to 3' direction along the non-transcribed
strand of DNA (i.e., the strand having a sequence homologous to the
mRNA).
[0161] A "gene" refers to an assembly of nucleotides that encode a
polypeptide, and includes cDNA and genomic DNA nucleic acids.
"Gene" also refers to a nucleic acid fragment that expresses a
specific protein, including intervening sequences (introns) between
individual coding segments (exons), as well as regulatory sequences
preceding (5' non-coding sequences) and following (3' non-coding
sequences) the coding sequence. "Native gene" refers to a gene as
found in nature with its own regulatory sequences.
[0162] A nucleic acid molecule is "hybridizable" to another nucleic
acid molecule, such as a cDNA, genomic DNA, or RNA, when a single
stranded form of the nucleic acid molecule can anneal to the other
nucleic acid molecule under the appropriate conditions of
temperature and solution ionic strength. Hybridization and washing
conditions are well known and exemplified, e.g., in Sambrook, J.,
Fritsch, E. F. and Maniatis, T. MOLECULAR CLONING: A LABORATORY
MANUAL, Second Edition, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor (1989), particularly Chapter 11 and Table 11.1
therein (hereinafter "Maniatis", entirely incorporated herein by
reference). The conditions of temperature and ionic strength
determine the "stringency" of the hybridization. Stringency
conditions can be adjusted to screen for moderately similar
fragments, such as homologous sequences from distantly related
organisms, to highly similar fragments, such as genes that
duplicate functional enzymes from closely related organisms.
Post-hybridization washes determine stringency conditions. One set
of conditions uses a series of washes starting with 6.times.SSC,
0.5% SDS at room temperature for 15 min, then repeated with
2.times.SSC, 0.5% SDS at 45.degree. C. for 30 min, and then
repeated twice with 0.2.times.SSC, 0.5% SDS at 50.degree. C. for 30
min. For more stringent conditions, washes are performed at higher
temperatures in which the washes are identical to those above
except for the temperature of the final two 30 min washes in
0.2.times.SSC, 0.5% SDS are increased to 60.degree. C. Another set
of highly stringent conditions uses two final washes in
0.1.times.SSC, 0.1% SDS at 65.degree. C. An additional set of
highly stringent conditions are defined by hybridization at
0.1.times.SSC, 0.1% SDS, 65.degree. C. and washed with 2.times.SSC,
0.1% SDS followed by 0.1.times.SSC, 0.1% SDS.
[0163] Hybridization requires that the two nucleic acids contain
complementary sequences, although depending on the stringency of
the hybridization, mismatches between bases are possible. The
appropriate stringency for hybridizing nucleic acids depends on the
length of the nucleic acids and the degree of complementation,
variables well known in the art. The greater the degree of
similarity or homology between two nucleotide sequences, the
greater the value of Tm for hybrids of nucleic acids having those
sequences. The relative stability (corresponding to higher Tm) of
nucleic acid hybridizations decreases in the following order:
RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100
nucleotides in length, equations for calculating Tm have been
derived (see, e.g., Maniatis at 9.50-9.51). For hybridizations with
shorter nucleic acids, i.e., oligonucleotides, the position of
mismatches becomes more important, and the length of the
oligonucleotide determines its specificity (see, e.g., Maniatis, at
11.7-11.8). In one embodiment the length for a hybridizable nucleic
acid is at least about 10 nucleotides. Preferably a minimum length
for a hybridizable nucleic acid is at least about 15 nucleotides;
more preferably at least about 20 nucleotides; and most preferably
the length is at least 30 nucleotides. Furthermore, the skilled
artisan will recognize that the temperature and wash solution salt
concentration may be adjusted as necessary according to factors
such as length of the probe.
[0164] The term "percent identity", as known in the art, is a
relationship between two or more polypeptide sequences or two or
more polynucleotide sequences, as determined by comparing the
sequences. n the art, "identity" also means the degree of sequence
relatedness between polypeptide or polynucleotide sequences, as the
case may be, as determined by the match between strings of such
sequences.
[0165] As known in the art, "similarity" between two polypeptides
is determined by comparing the amino acid sequence and conserved
amino acid substitutes thereto of the polypeptide to the sequence
of a second polypeptide.
[0166] "Identity" and "similarity" can be readily calculated by
known methods, including but not limited to those described in:
Computational Molecular Biology (Lesk, A. M., ed.) Oxford
University Press, NY (1988); Biocomputing: Informatics and Genome
Projects (Smith, D. W., ed.) Academic Press, NY (1993); Computer
Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H.
G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular
Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence
Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton
Press, NY (1991). Preferred methods to determine identity are
designed to give the best match between the sequences tested.
Methods to determine identity and similarity are codified in
publicly available computer programs. Sequence alignments and
percent identity calculations may be performed using the Megalign
program of the LASERGENE bioinformatics computing suite (DNASTAR
Inc., Madison, Wis.). Multiple alignments of the sequences
disclosed herein were performed using the Clustal method of
alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the
default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default
parameters for pairwise alignments using the Clustal method were
KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
[0167] Suitable nucleic acid sequences or fragments thereof
(isolated polynucleotides of the present invention) encode
polypeptides that are at least about 70% to 75% identical to the
amino acid sequences reported herein, at least about 80%, 85%, or
90% identical to the amino acid sequences reported herein, or at
least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino
acid sequences reported herein. Suitable nucleic acid fragments are
at least about 70%, 75%, or 80% identical to the nucleic acid
sequences reported herein, at least about 80%, 85%, or 90%
identical to the nucleic acid sequences reported herein, or at
least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the
nucleic acid sequences reported herein. Suitable nucleic acid
fragments not only have the above identities/similarities but
typically encode a polypeptide having at least 50 amino acids, at
least 100 amino acids, at least 150 amino acids, at least 200 amino
acids, or at least 250 amino acids.
[0168] A DNA or RNA "coding region" is a DNA or RNA molecule which
is transcribed and/or translated into a polypeptide in a cell in
vitro or in vivo when placed under the control of appropriate
regulatory sequences. "Suitable regulatory regions" refer to
nucleic acid regions located upstream (5' non-coding sequences),
within, or downstream (3' non-coding sequences) of a coding region,
and which influence the transcription, RNA processing or stability,
or translation of the associated coding region. Regulatory regions
may include promoters, translation leader sequences, RNA processing
site, effector binding site and stem-loop structure. The boundaries
of the coding region are determined by a start codon at the 5'
(amino) terminus and a translation stop codon at the 3' (carboxyl)
terminus. A coding region can include, but is not limited to,
prokaryotic regions, cDNA from mRNA, genomic DNA molecules,
synthetic DNA molecules, or RNA molecules. If the coding region is
intended for expression in a eukaryotic cell, a polyadenylation
signal and transcription termination sequence will usually be
located 3' to the coding region.
[0169] An "isoform" is a protein that has the same function as
another protein but which is encoded by a different gene and may
have small differences in its sequence.
[0170] A "paralogue" is a protein encoded by a gene related by
duplication within a genome.
[0171] An "orthologue" is gene from a different species that has
evolved from a common ancestral gene by speciation. Normally,
orthologues retain the same function in the course of evolution as
the ancestral gene.
[0172] "Open reading frame" is abbreviated ORF and means a length
of nucleic acid, either DNA, cDNA or RNA, that comprises a
translation start signal or initiation codon, such as an ATG or
AUG, and a termination codon and can be potentially translated into
a polypeptide sequence.
[0173] "Promoter" refers to a DNA fragment capable of controlling
the expression of a coding sequence or functional RNA. In general,
a coding region is located 3' to a promoter. Promoters may be
derived in their entirety from a native gene, or be composed of
different elements derived from different promoters found in
nature, or even comprise synthetic DNA segments. It is understood
by those skilled in the art that different promoters may direct the
expression of a gene in different tissues or cell types, or at
different stages of development, or in response to different
environmental or physiological conditions. Promoters which cause a
gene to be expressed in most cell types at most times are commonly
referred to as "constitutive promoters". It is further recognized
that since in most cases the exact boundaries of regulatory
sequences have not been completely defined, DNA fragments of
different lengths may have identical promoter activity. A promoter
is generally bounded at its 3' terminus by the transcription
initiation site and extends upstream (5' direction) to include the
minimum number of bases or elements necessary to initiate
transcription at levels detectable above background. Within the
promoter will be found a transcription initiation site
(conveniently defined for example, by mapping with nuclease S1), as
well as protein binding domains (consensus sequences) responsible
for the binding of RNA polymerase.
[0174] A coding region is "under the control" of transcriptional
and translational control elements in a cell when RNA polymerase
transcribes the coding region into mRNA, which is then trans-RNA
spliced (if the coding region contains introns) and translated into
the protein encoded by the coding region.
[0175] "Transcriptional and translational control regions" are DNA
regulatory regions, such as promoters, enhancers, terminators, and
the like, that provide for the expression of a coding region in a
host cell. In eukaryotic cells, polyadenylation signals are control
regions.
[0176] The term "operably associated" refers to the association of
nucleic acid sequences on a single nucleic acid fragment so that
the function of one is affected by the other. For example, a
promoter is operably associated with a coding region when it is
capable of affecting the expression of that coding region (i.e.,
that the coding region is under the transcriptional control of the
promoter). Coding regions can be operably associated to regulatory
regions in sense or antisense orientation.
[0177] The term "expression," as used herein, refers to the
transcription and stable accumulation of sense (mRNA) or antisense
RNA derived from the nucleic acid fragment of the invention.
Expression may also refer to translation of mRNA into a
polypeptide.
[0178] The term "lignocellulose" refers to material that is
comprised of lignin and cellulose.
[0179] A "cellulolytic enzyme" can be any enzyme involved in
cellulose digestion, metabolism and/or hydrolysis. The term
"cellulase" refers to a class of enzymes produced chiefly by fungi,
bacteria, and protozoans that catalyze cellulolysis (i.e. the
hydrolysis) of cellulose. However, there are also cellulases
produced by other types of organisms such as plants and animals.
Several different kinds of cellulases are known, which differ
structurally and mechanistically. There are general types of
cellulases based on the type of reaction catalyzed: endocellulase
breaks internal bonds to disrupt the crystalline structure of
cellulose and expose individual cellulose polysaccharide chains;
exocellulase cleaves 2-4 units from the ends of the exposed chains
produced by endocellulase, resulting in the tetrasaccharides or
disaccharide such as cellobiose. There are two main types of
exocellulases (or cellobiohydrolases, abbreviate CBH)--one type
working processively from the reducing end, and one type working
processively from the non-reducing end of cellulose; cellobiase or
beta-glucosidase hydrolyses the exocellulase product into
individual monosaccharides; oxidative cellulases that depolymerize
cellulose by radical reactions, as for instance cellobiose
dehydrogenase (acceptor); cellulose phosphorylases that
depolymerize cellulose using phosphates instead of water. In the
most familiar case of cellulase activity, the enzyme complex breaks
down cellulose to beta-glucose. A "cellulase" can be any enzyme
involved in cellulose digestion, metabolism and/or hydrolysis,
including an endoglucanase, glucosidase, cellobiohydrolase,
xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, and feruoyl esterase protein.
[0180] An "amylolytic enzyme" can be any enzyme involved in amylase
digestion, metabolism and/or hydrolysis. The term "amylase" refers
to an enzyme that breaks starch down into sugar. Amylase is present
in human saliva, where it begins the chemical process of digestion.
Foods that contain much starch but little sugar, such as rice and
potato, taste slightly sweet as they are chewed because amylase
turns some of their starch into sugar in the mouth. The pancreas
also makes amylase (.alpha.-amylase) to hydrolyse dietary starch
into disaccharides and trisaccharides which are converted by other
enzymes to glucose to supply the body with energy. Plants and some
bacteria also produce amylase. All amylases are glycoside
hydrolases and act on .alpha.-1,4-glycosidic bonds. Some amylases,
such as .gamma.-amylase (glucoamylase), also act on
.alpha.-1,6-glycosidic bonds. Amylase enzymes include
.alpha.-amylase (EC 3.2.1.1), .beta.-amylase (EC 3.2.1.2), and
.gamma.-amylase (EC 3.2.1.3). The .alpha.-amylases are calcium
metalloenzymes, unable to function in the absence of calcium. By
acting at random locations along the starch chain, .alpha.-amylase
breaks down long-chain carbohydrates, ultimately yielding
maltotriose and maltose from amylose, or maltose, glucose and
"limit dextrin" from amylopectin. Because it can act anywhere on
the substrate, .alpha.-amylase tends to be faster-acting than
.beta.-amylase. In animals, it is a major digestive enzyme and its
optimum pH is about 6.7-7.0. Another form of amylase,
.beta.-amylase is also synthesized by bacteria, fungi, and plants.
Working from the non-reducing end, .beta.-amylase catalyzes the
hydrolysis of the second .alpha.-1,4 glycosidic bond, cleaving off
two glucose units (maltose) at a time. Many microbes produce
amylase to degrade extracellular starches. In addition to cleaving
the last .alpha.(1-4)glycosidic linkages at the nonreducing end of
amylose and amylopectin, yielding glucose, .gamma.-amylase will
cleave .alpha.(1-6) glycosidic linkages. Another amylolytic enzyme
is alpha-glucosidase that acts on maltose and other short
malto-oligosaccharides produced by alpha-, beta-, and
gamma-amylases, converting them to glucose. Another amylolytic
enzyme is pullulanase. Pullulanase is a specific kind of glucanase,
an amylolytic exoenzyme, that degrades pullulan. Pullulan is
regarded as a chain of maltotriose units linked by
alpha-1,6-glycosidic bonds. Pullulanase (EC 3.2.1.41) is also known
as pullulan-6-glucanohydrolase (Debranching enzyme). Another
amylolytic enzyme, isopullulanase, hydrolyses pullulan to isopanose
(6-alpha-maltosylglucose). Isopullulanase (EC 3.2.1.57) is also
known as pullulan 4-glucanohydrolase. An "amylase" can be any
enzyme involved in amylase digestion, metabolism and/or hydrolysis,
including .alpha.-amylase, .beta.-amylase, glucoamylase,
pullulanase, isopullulanase, and alpha-glucosidase.
[0181] The term "xylanolytic activity" is intended to include the
ability to hydrolyze glycosidic linkages in oligopentoses and
polypentoses. The term "xylanase" is the name given to a class of
enzymes which degrade the linear polysaccharide beta-1,4-xylan into
xylose, thus breaking down hemicellulose, one of the major
components of plant cell walls. As such, it plays a major role in
micro-organisms thriving on plant sources (mammals, conversely, do
not produce xylanase). Additionally, xylanases are present in fungi
for the degradation of plant matter into usable nutrients.
Xylanases include those enzymes that correspond to Enzyme
Commission Number 3.2.1.8. A "xylose metabolizing enzyme" can be
any enzyme involved in xylose digestion, metabolism and/or
hydrolysis, including a xylose isomerase, xylulokinase, xylose
reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate
dehydratase, xylose transketolase, and a xylose transaldolase
protein.
[0182] The term "pectinase" is a general term for enzymes, such as
pectolyase, pectozyme and polygalacturonase, commonly referred to
in brewing as pectic enzymes. These enzymes break down pectin, a
polysaccharide substrate that is found in the cell walls of plants.
One of the most studied and widely used commercial pectinases is
polygalacturonase. Pectinases are commonly used in processes
involving the degradation of plant materials, such as speeding up
the extraction of fruit juice from fruit, including apples and
sapota. Pectinases have also been used in wine production since the
1960s.
[0183] A "saccharolytic enzyme" can be any enzyme involved in
carbohydrate digestion, metabolism and/or hydrolysis, including
amylases, cellulases, hemicellulases, cellulolytic and amylolytic
accessory enzymes, inulinases, levanases, and pentose sugar
utilizing enzymes.
[0184] A "pentose sugar utilizing enzyme" can be any enzyme
involved in pentose sugar digestion, metabolism and/or hydrolysis,
including xylanase, arabinase, arabinoxylanase, arabinosidase,
arabinofuranosidase, arabinoxylanase, arabinosidase, and
arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase.
Host Cells Expressing Heterologous Saccharolytic Enzymes
[0185] In order to address the limitations of the previous systems,
in one aspect, the present invention provides host cells expressing
heterologous cellulases that can be effectively and efficiently
utilized to produce products such as ethanol from cellulose. In
another embodiment, the host cells express heterologous amylases
that can be effectively and efficiently utilized to produce
products such as ethanol from biomass feedstock, such as grain
feedstock. In yet another embodiment, the host cells express
heterologous enzymes that utilize pentose sugars.
[0186] In some embodiments, the host cell can be a yeast. According
to the present invention the yeast host cell can be, for example,
from the genera Saccharomyces, Kluyveromyces, Candida, Pichia,
Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, and
Yarrowia. Yeast species as host cells can include, for example, S.
cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S.
diastaticus, K. lactis, K. marxianus, or K. fragilis. In some
embodiments, the yeast is selected from the group consisting of
Saccharomyces cerevisiae, Schizzosaccharomyces pombe, Candida
albicans, Pichia pastoris, Pichia stipitis, Yarrowia lipolytica,
Hansenula polymorpha, Phaffia rhodozyma, Candida utilis, Arxula
adeninivorans, Debaryomyces hansenii, Debaryomyces polymorphus,
Schizosaccharomyces pombe and Schwanniomyces occidentalis. In one
particular embodiment, the yeast is Saccharomyces cerevisiae. The
selection of an appropriate host is deemed to be within the scope
of those skilled in the art from the teachings herein.
[0187] In some embodiments of the present invention, the host cell
is an oleaginous cell. According to the present invention, the
oleaginous host cell can be an oleaginous yeast cell. For example,
the oleaginous yeast host cell can be from the genera Blakeslea,
Candida, Cryptococcus, Cunninghamella, Lipomyces, Mortierella,
Mucor, Phycomyces, Pythium, Rhodosporidum, Rhodotorula,
Trichosporon or Yarrowia. According to the present invention, the
oleaginous host cell can be an oleaginous microalgae host cell. For
example, the oleaginous microalgea host cell can be from the genera
Thraustochytrium or Schizochytrium.
[0188] In some embodiments of the present invention, the host cell
is a thermotolerant host cell. Thermotolerant host cells can be
particularly useful in simultaneous saccharification and
fermentation processes by allowing externally produced cellulases
and ethanol-producing host cells to perform optimally in similar
temperature ranges.
[0189] Thermotolerant host cells of the invention can include, for
example, Issatchenkia orientalis, Pichia mississippiensis, Pichia
mexicana, Pichia farinosa, Clavispora opuntiae, Clavispora
lusitaniae, Candida mexicana, Hansenula polymorpha and
Kluyveromyces host cells.
[0190] In some particular embodiments of the present invention, the
host cell is a Kluyveromyces host cell. For example, the
Kluyveromyces host cell can be a K. lactis, K. marxianus, K.
blattae, K. phaffii, K. yarrowii, K. aestuarii, K. dobzhanskii, K.
wickerhamii, K. thermotolerans, or K. waltii host cell. In one
embodiment, the host cell is a K. lactis, or K. marxianus host
cell. In another embodiment, the host cell is a K. marxianus host
cell.
[0191] In some embodiments of the present invention the
thermotolerant host cell can grow at temperatures above about
30.degree. C., about 31.degree. C., about 32.degree. C., about
33.degree. C., about 34.degree. C., about 35.degree. C., about
36.degree. C., about 37.degree. C., about 38.degree. C., about
39.degree. C., about 40.degree. C., about 41.degree. C. or about
42.degree. C. In some embodiments of the present invention the
thermotolerant host cell can produce ethanol from cellulose at
temperatures above about 30.degree. C., about 31.degree. C., about
32.degree. C., about 33.degree. C., about 34.degree. C., about
35.degree. C., about 36.degree. C., about 37.degree. C., about
38.degree. C., about 39.degree. C., about 40.degree. C., about
41.degree. C., about 42.degree. C., or about 50.degree. C.
[0192] In some embodiments of the present invention, the
thermotolerant host cell can grow at temperatures from about
30.degree. C. to 60.degree. C., about 30.degree. C. to 55.degree.
C., about 30.degree. C. to 50.degree. C., about 40.degree. C. to
60.degree. C., about 40.degree. C. to 55.degree. C. or about
40.degree. C. to 50.degree. C. In some embodiments of the present
invention, the thermotolterant host cell can produce ethanol from
cellulose at temperatures from about 30.degree. C. to 60.degree.
C., about 30.degree. C. to 55.degree. C., about 30.degree. C. to
50.degree. C., about 40.degree. C. to 60.degree. C., about
40.degree. C. to 55.degree. C. or about 40.degree. C. to 50.degree.
C.
[0193] Host cells are genetically engineered (transduced or
transformed or transfected) with the polynucleotides encoding
saccharolytic enzymes (amylases, cellulases, hemicellulases,
cellulolytic and amylolytic accessory enzymes, inulinases,
levanases, pentose sugar hydrolases and others) of this invention
which are described in more detail herein. The polynucleotides
encoding saccharolytic enzymes can be introduced to the host cell
on a vector of the invention, which may be, for example, a cloning
vector or an expression vector comprising a sequence encoding a
heterologous saccharolytic enzyme. The host cells can comprise
polynucleotides of the invention as integrated copies or plasmid
copies.
[0194] In certain aspects, the present invention relates to host
cells containing the polynucleotide constructs described herein. In
one embodiment, the host cells of the present invention express one
or more heterologous polypeptides of saccharolytic enzymes. In some
embodiments, the host cell comprises a combination of
polynucleotides that encode heterologous saccharolytic enzymes or
fragments, variants or derivatives thereof. The host cell can, for
example, comprise multiple copies of the same nucleic acid
sequence, for example, to increase expression levels, or the host
cell can comprise a combination of unique polynucleotides. In other
embodiments, the host cell comprises a single polynucleotide that
encodes a heterologous saccharolytic enzyme or a fragment, variant
or derivative thereof. In particular, such host cells expressing a
single heterologous saccharolytic enzyme can be used in co-culture
with other host cells of the invention comprising a polynucleotide
that encodes at least one other heterologous saccharolytic enzyme
or fragment, variant or derivative thereof.
[0195] Introduction of a polynucleotide encoding a heterologous
saccharolytic enzyme into a host cell can be done by methods known
in the art. Introduction of polynucleotides encoding heterologous
saccharolytic enzyme into, for example yeast host cells, can be
effected by lithium acetate transformation, spheroplast
transformation, or transformation by electroporation, as described
in Current Protocols in Molecular Biology, 13.7.1-13.7.10.
Introduction of the construct in other host cells can be effected
by calcium phosphate transfection, DEAE-Dextran mediated
transfection, or electroporation. (Davis, L., et al., Basic Methods
in Molecular Biology, (1986)).
[0196] The transformed host cells or cell cultures, as described
above, can be examined for protein content of an endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, arabinofuranosidase, galactosidase, cellobiose
phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase,
xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase protein, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, arabinase, arabinoxylanase, arabinosidase, and
arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase. For the use of
secreted heterologous saccharolytic enzymes, protein content can be
determined by analyzing the host (e.g., yeast) cell supernatants.
In certain embodiments, high molecular weight material can be
recovered from the yeast cell supernatant either by acetone
precipitation or by buffering the samples with disposable
de-salting cartridges. Proteins, including tethered heterologous
saccharolytic enzymes, can also be recovered and purified from
recombinant yeast cell cultures by methods including spheroplast
preparation and lysis, cell disruption using glass beads, and cell
disruption using liquid nitrogen for example. Additional protein
purification methods include ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography,
hydroxylapatite chromatography, gel filtration, and lectin
chromatography. Protein refolding steps can be used, as necessary,
in completing configuration of the mature protein. Finally, high
performance liquid chromatography (HPLC) can be employed for final
purification steps.
[0197] Protein analysis methods include methods such as the
traditional Lowry method, the BCA assay, absorbance at 280 nm, or
the protein assay method according to BioRad's manufacturer's
protocol. Using such methods, the protein content of saccharolytic
enzymes can be estimated. Additionally, to accurately measure
protein concentration a heterologous cellulase can be expressed
with a tag, for example a His-tag or HA-tag and purified by
standard methods using, for example, antibodies against the tag, a
standard nickel resin purification technique or similar
approach.
[0198] The transformed host cells or cell cultures, as described
above, can be further analyzed for hydrolysis of cellulose, or
starch, or pentose sugar utilization (e.g., by a sugar detection
assay), for a particular type of saccharolytic enzyme activity
(e.g., by measuring the individual endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase) or for total
cellulase activity. Endoglucanase activity can be determined, for
example, by measuring an increase of reducing ends in an
endoglucanase specific CMC or hydroxyethylcellulose (HEC)
substrate. Cellobiohydrolase activity can be measured, for example,
by using insoluble cellulosic substrates such as the amorphous
substrate phosphoric acid swollen cellulose (PASC) or
microcrystalline cellulose (Avicel) and determining the extent of
the substrate's hydrolysis. .beta.-glucosidase activity can be
measured by a variety of assays, e.g., using cellobiose. Assays for
activity of other saccharolytic enzyme types are known in the art
and are exemplified below.
[0199] A total saccharolytic enzyme activity, which can include the
activity of endoglucanase, glucosidase, cellobiohydrolase,
xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase protein, alpha-amylase, beta-amylase,
glucoamylase, alpha-glucosidase, beta-glucosidase, galactosidase,
arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase,
arabinoxylanase, arabinosidase, pullulanase, isopullulanase,
arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose
isomerase, xylulokinase, xylose reductase, xylose dehydrogenase,
xylitol dehydrogenase, xylonate dehydratase, xylose transketolase,
and xylose transaldolase can hydrolyze biomass feedstocks
synergistically. For example, total cellulase activity can thus be
measured using insoluble substrates including pure cellulosic
substrates such as Whatman No. 1 filter paper, cotton linter,
microcrystalline cellulose, bacterial cellulose, algal cellulose,
and cellulose-containing substrates such as dyed cellulose,
alpha-cellulose or pretreated lignocellulose. Specific activity of
cellulases can also be detected by methods known to one of ordinary
skill in the art, such as by the Avicel assay (described supra)
that would be normalized by protein (cellulase) concentration
measured for the sample. Total saccharolytic activity could be also
measured using complex substrate containing starch, cellulose and
hemicellulose such as corn mash by measuring released monomeric
sugars. In such an assay different groups of enzymes could work in
"indirect synergy" when one group of enzymes such as cellulases can
make substrate for another group of enzymes such as amylases more
accessible through hydrolysis of cellulolytic substrate around
amylolytic substrate. This mechanism can also work vice versa.
[0200] One aspect of the invention is thus related to the efficient
production of saccharolytic enzymes to aid in the digestion and
utilization of starch, cellulose, and pentose sugars, and
generation of products such as ethanol. A "saccharolytic enzyme"
can be any enzyme involved in carbohydrate digestion, metabolism
and/or hydrolysis, including amylases, cellulases, hemicellulases,
cellulolytic and amylolytic accessory enzymes, inulinases,
levanases, and pentose sugar hydrolasing enzymes. A "cellulase" can
be any enzyme involved in cellulase digestion, metabolism and/or
hydrolysis, including an endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, and feruoyl esterase protein. An "amylase" can be any
enzyme involved in amylase digestion and/or metabolism, including
alpha-amylase, beta-amylase, glucoamylase, pullulanase,
isopullulanase, and alpha-glucosidase. A pentose sugar hydrolyzing
enzyme can be any enzyme involved in pentose sugar digestion,
and/or metabolism, including xylanase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase.
[0201] In additional embodiments, the transformed host cells or
cell cultures are assayed for ethanol production. Ethanol
production can be measured by techniques known to one or ordinary
skill in the art, e.g., by a standard HPLC refractive index
method.
Heterologous Saccharolytic Enzymes
[0202] According to one aspect of the present invention, the
expression of heterologous saccharolytic enzymes in a host cell can
be used advantageously to produce products such as ethanol from
biomass sources. For example, cellulases from a variety of sources
can be heterologously expressed to successfully increase efficiency
of ethanol production. The saccharolytic enzymes can be from fungi,
yeast, bacteria, plant, protozoan or termite sources. In some
embodiments, the saccharolytic enzyme is from H. grisea, T.
aurantiacus, T. emersonii, T. reesei, C. lacteus, C. formosanus, N.
takasagoensis, C. acinaciformis, M. darwinensis, N. walkeri, S.
fibuligera, C. luckowense R. speratus, Thermobfida fusca,
Clostridum thermocellum, Clostridium cellulolyticum, Clostridum
josui, Bacillus pumilis, Cellulomonas fimi, Saccharophagus
degradans, Piromyces equii, Neocallimastix patricarum or
Arabidopsis thaliana.
[0203] In some embodiments, the cellulase of the invention is any
cellulase disclosed in Table 4 or Table 7 produced herein. In some
embodiments, the cellulase is encoded by a nucleic acid sequence at
least about 80%, at least about 85%, at least about 90%, at least
about 95%, at least about 96%, at least about 97%, at least about
98%, at least about 99%, or 100% identical to any one of SEQ ID
NOs: 1-218. In some embodiments, the cellulase has an amino acid
sequence that is at least about 80%, at least about 85%, at least
about 90%, at least about 95%, at least about 96%, at least about
97%, at least about 98%, at least about 99%, or 100% identical to
any one of SEQ ID NOs: 219-436. In some embodiments, the cellulase
of the invention is any cellulase suitable for expression in an
appropriate host cell.
[0204] In other embodiments, the amylase of the invention is any
amylase disclosed in Table 19 produced herein. In some embodiments,
the amylase is encoded by a nucleic acid sequence at least about
80%, at least about 85%, at least about 90%, at least about 95%, at
least about 96%, at least about 97%, at least about 98%, at least
about 99%, or 100% identical to any one of SEQ ID NOs: 437-441. In
some embodiments, the cellulase has an amino acid sequence that is
at least about 80%, at least about 85%, at least about 90%, at
least about 95%, at least about 96%, at least about 97%, at least
about 98%, at least about 99%, or 100% identical to any one of SEQ
ID NOs: 442-446. In some embodiments, the amylase of the invention
is any amylase suitable for expression in an appropriate host
cell.
[0205] In some embodiments of the invention, multiple saccharolytic
enzymes from a single organism are co-expressed in the same host
cell. In some embodiments of the invention, multiple saccharolytic
enzymes from different organisms are co-expressed in the same host
cell. In particular, saccharolytic enzymes from two, three, four,
five, six, seven, eight, nine or more organisms can be co-expressed
in the same host cell. Similarly, the invention can encompass
co-cultures of yeast strains, wherein the yeast strains express
different saccharolytic enzymes. Co-cultures can include yeast
strains expressing heterologous saccharolytic enzymes from the same
organisms or from different organisms. Co-cultures can include
yeast strains expressing saccharolytic enzymes from two, three,
four, five, six, seven, eight, nine or more organisms.
[0206] Lignocellulases of the present invention include both
endoglucanases and exoglucanases. Other lignocellulases of the
invention include accesory enzymes which can act on the
lignocellulosic material. The lignocellulases can be, for example,
endoglucanases, glucosidases, cellobiohydrolases, xylanases,
glucanases, xylosidases, xylan esterases, arabinofuranosidases,
galactosidases, cellobiose phosphorylases, cellodextrin
phosphorylases, mannanases, mannosidases, xyloglucanases,
endoxylanases, glucuronidases, acetylxylanesterases,
arabinofuranohydrolases, swollenins, glucuronyl esterases,
expansins, pectinases, and feruoyl esterases. in some embodiments,
the lignocellulases of the invention can be any suitable enzyme for
digesting the desired lignocellulosic material.
[0207] In certain embodiments of the invention, the lignocellulase
can be an endoglucanase, glucosidase, cellobiohydrolase, xylanase,
glucanase, xylosidase, xylan esterase, arabinofuranosidase,
galactosidase, cellobiose phosphorylase, cellodextrin
phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase,
glucuronidase, acetylxylanesterase, arabinofuranohydrolase,
swollenin, glucuronyl esterase, expansin, pectinase, and feruoyl
esterase paralogue or orthologue. In particular embodiments, the
lignocellulase is derived from any species named in Tables 4 and 7.
In one particular embodiment, the lignocellulase comprises an amino
acid sequence selected from SEQ ID NOs: 219-436. In certain other
embodiments, the lignocellulase comprises an amino acid sequence
that is at least about 70, about 80, about 90, about 95, about 96,
about 97, about 98, about 99, or 100% identical to an amino acid
sequence selected from SEQ ID NOs: 219-436.
[0208] In other embodiments of the invention, the amylases can be
alpha-amylases, beta-amylases, glucoamylases, alpha-glucosidases,
pullulanase, or isopullulanase paralogues or orthologues.
[0209] As a practical matter, whether any polypeptide is at least
70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a
polypeptide of the present invention can be determined
conventionally using known computer programs. Methods for
determining percent identity, as discussed in more detail below in
relation to polynucleotide identity, are also relevant for
evaluating polypeptide sequence identity.
[0210] In some particular embodiments of the invention, the
saccharolytic enzyme comprises a sequence selected from the
saccharolytic enzymes disclosed in Table 4, or Table 7, or Table 19
presented herein. The saccharolytic enzymes of the invention also
include saccharolytic enzymes that comprise a sequence at least
about 70, about 80, about 90, about 95, about 96, about 97, about
98, about 99 or 100% identical to the sequences of Table 4, or
Table 7, or Table 19. Amino acid and nucleic acid sequences are
readily determined for a gene, protein or other element by a
accession number upon consulting the proper database, for example
Genebank. However, sequences for the genes and proteins of the
present invention are also disclosed herein (SEQ ID NOs:
1-445).
[0211] Some embodiments of the invention encompass a polypeptide
comprising at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200,
300, 400, or 500 or more consecutive amino acids of any of SEQ ID
NOs: 219-445, or domains, fragments, variants, or derivatives.
[0212] In certain aspects of the invention, the polypeptides and
polynucleotides of the present invention are provided in an
isolated form, e.g., purified to homogeneity.
[0213] The present invention also encompasses polypeptides which
comprise, or alternatively consist of, an amino acid sequence which
is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% similar to
the polypeptide of any of SEQ ID NOs: 219-436, or SEQ ID
NOs:442-446, and to portions of such polypeptide with such portion
of the polypeptide generally containing at least 30 amino acids and
more preferably at least 50 amino acids.
[0214] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and conserved amino
acid substitutes thereto of the polypeptide to the sequence of a
second polypeptide.
[0215] The present invention farther relates to a domain, fragment,
variant, derivative, or analog of the polypeptide of any of SEQ ID
NOs: 219-436, or SEQ ID NOs:442-446.
[0216] Fragments or portions of the polypeptides of the present
invention can be employed for producing the corresponding
full-length polypeptide by peptide synthesis. Therefore, the
fragments can be employed as intermediates for producing the
full-length polypeptides.
[0217] Fragments of lignocellulases of the invention encompass
domains, proteolytic fragments, deletion fragments and in
particular, fragments of any of the genes named in Tables 4 and 7,
which retain any specific biological activity of the endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, arabinofuranosidase, galactosidase, cellobiose
phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase,
xyloglucanase, endoxylanase, anase, glucuronidase,
acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl
esterase, expansin, pectinase, and feruoyl esterase proteins.
Polypeptide fragments further include any portion of the
polypeptide which retains a catalytic activity of endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, arabinofuranosidase, galactosidase, cellobiose
phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase,
xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, and feruoyl esterase protein.
[0218] Fragments of amylases of the invention encompass domains,
proteolytic fragments, deletion fragments and in particular,
fragments of any of the genes named in Tables 15, 16, and 19, which
retain any specific biological activity of the alpha-amylase,
beta-amylase, glucoamylase, pullulanase, isopullulanase, and
alpha-glucosidase proteins. Polypeptide fragments further include
any portion of the polypeptide which retains a catalytic activity
of alpha-amylase, beta-amylase, glucoamylase, pullulanase,
isopullulanase, and alpha-glucosidase protein.
[0219] The variant, derivative or analog of the polypeptide of any
of SEQ ID NOs: 219-436, or SEQ ID NOs:442-446 may be (i) one in
which one or more of the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide for purification of the polypeptide or (v) one
in which a fragment of the polypeptide is soluble, i.e., not
membrane bound, yet still binds ligands to the membrane bound
receptor. Such variants, derivatives and analogs are deemed to be
within the scope of those skilled in the art from the teachings
herein.
[0220] The polypeptides of the present invention further include
variants of the polypeptides. A "variant" of the polypeptide can be
a conservative variant, or an allelic variant. As used herein, a
conservative variant refers to alterations in the amino acid
sequence that do not adversely affect the biological functions of
the protein. A substitution, insertion or deletion is said to
adversely affect the protein when the altered sequence prevents or
disrupts a biological function associated with the protein. For
example, the overall charge, structure or hydrophobic-hydrophilic
properties of the protein can be altered without adversely
affecting a biological activity. Accordingly, the amino acid
sequence can be altered, for example to render the peptide more
hydrophobic or hydrophilic, without adversely affecting the
biological activities of the protein.
[0221] By an "allelic variant" is intended alternate forms of a
gene occupying a given locus on a chromosome of an organism. Genes
II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques. Allelic variants, though possessing a
slightly different amino acid sequence than those recited above,
will still have the same or similar biological functions associated
with the endoglucanases, glucosidases, cellobiohydrolases,
xylanases, glucanases, xylosidases, xylan esterases,
arabinofuranosidases, galactosidases, cellobiose phosphorylases,
cellodextrin phosphorylases, mannanases, mannosidases,
xyloglucanases, endoxylanases, glucuronidases,
acetylxylanesterases, arabinofuranohydrolases, swollenins,
glucuronyl esterases, expansins, pectinases, feruoyl esterases,
alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase of the invention.
The allelic variants, the conservative substitution variants, and
members of the endoglucanase, cellobiohydrolase,
.beta.-glucosidase, alpha-amylase, beta-amylase, glucoamylase,
pullulanase, isopullulanase, or alpha-glucosidase protein families,
can have an amino acid sequence having at least 75%, at least 80%,
at least 90%, at least 95% amino acid sequence identity with
endoglucanases, glucosidases, cellobiohydrolases, xylanases,
glucanases, xylosidases, xylan esterases, arabinofuranosidases,
galactosidases, cellobiose phosphorylases, cellodextrin
phosphorylases, mannanases, mannosidases, xyloglucanases,
endoxylanases, glucuronidases, acetylxylanesterases,
arabinofuranohydrolases, swollenins, glucuronyl esterases,
expansins, pectinases, feruoyl esterase, alpha-amylase,
beta-amylase, glucoamylase, pullulanase, isopullulanase,
alpha-glucosidase, and beta-glucosidase amino acid sequence set
forth in any one of SEQ ID NOs: 219-436, and SEQ ID NOs: 442-446.
Identity or homology with respect to such sequences is defined
herein as the percentage of amino acid residues in the candidate
sequence that are identical with the known peptides, after aligning
the sequences and introducing gaps, if necessary, to achieve the
maximum percent homology, and not considering any conservative
substitutions as part of the sequence identity. N-terminal,
C-terminal or internal extensions, deletions, or insertions into
the peptide sequence shall not be construed as affecting
homology.
[0222] Thus, in one aspect the proteins and peptides of the present
invention include molecules comprising the amino acid sequence of
SEQ ID NOs: 219-436, or and SEQ ID NOs: 442-446 or fragments
thereof having a consecutive sequence of at least about 3, 4, 5, 6,
10, 15, 20, 25, 30, 35 or more amino acid residues of the
endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase,
xylosidase, xylan esterase, arabinofuranosidase, galactosidase,
cellobiose phosphorylase, cellodextrin phosphorylase, mannanase,
mannosidase, xyloglucanase, endoxylanase, glucuronidase,
acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl
esterase, expansin, pectinase, feruoyl esterase, alpha-amylase,
beta-amylase, glucoamylase, pullulanase, isopullulanase,
alpha-glucosidase, and beta-glucosidase polypeptide sequences;
amino acid sequence variants of such sequences wherein at least one
amino acid residue has been inserted N- or C-terminal to, or
within, the disclosed sequence; amino acid sequence variants of the
disclosed sequences, or their fragments as defined above, that have
been substituted by another residue. Contemplated variants farther
include those containing predetermined mutations by, e.g.,
homologous recombination, site-directed or PCR mutagenesis, and the
corresponding proteins of other animal species, including but not
limited to bacterial, fungal, insect, rabbit, rat, porcine, bovine,
ovine, equine and non-human primate species, the alleles or other
naturally occurring variants of the family of proteins; and
derivatives wherein the protein has been covalently modified by
substitution, chemical, enzymatic, or other appropriate means with
a moiety other than a naturally occurring amino acid (for example,
a detectable moiety such as an enzyme or radioisotope).
[0223] Using known methods of protein engineering and recombinant
DNA technology, variants may be generated to improve or alter the
characteristics of the polypeptides of saccharolytic enzymes. For
instance, one or more amino acids can be deleted from the
N-terminus or C-terminus of the secreted protein without
substantial loss of biological function.
[0224] Thus, in another aspect the invention further includes
endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase,
xylosidase, xylan esterase, arabinofuranosidase, galactosidase,
cellobiose phosphorylase, cellodextrin phosphorylase, mannanase,
mannosidase, xyloglucanase, endoxylanase, glucuronidase,
acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl
esterase, expansin, pectinase, feruoyl esterase, alpha-amylase,
beta-amylase, glucoamylase, pullulanase, isopullulanase,
alpha-glucosidase, beta-glucosidase, galactosidase, arabinase,
arabinoxylanase, arabinosidase, arabinofuranosidase,
arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose
isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase,
xylulokinase, xylose reductase, xylose dehydrogenase, xylitol
dehydrogenase, xylonate dehydratase, xylose transketolase, and
xylose transaldolase polypeptide variants which show substantial
biological activity. Such variants include deletions, insertions,
inversions, repeats, and substitutions selected according to
general rules known in the art so as have little effect on
activity.
[0225] The skilled artisan is fully aware of amino acid
substitutions that are either less likely or not likely to
significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid), as
further described below.
[0226] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main strategies for studying
the tolerance of an amino acid sequence to change.
[0227] The first strategy exploits the tolerance of amino acid
substitutions by natural selection during the process of evolution.
By comparing amino acid sequences in different species, conserved
amino acids can be identified. These conserved amino acids are
likely important for protein function. In contrast, the amino acid
positions where substitutions have been tolerated by natural
selection indicates that these positions are not critical for
protein function. Thus, positions tolerating amino acid
substitution could be modified while still maintaining biological
activity of the protein.
[0228] The second strategy uses genetic engineering to introduce
amino acid changes at specific positions of a cloned gene to
identify regions critical for protein function. For example, site
directed mutagenesis or alanine-scanning mutagenesis (introduction
of single alanine mutations at every residue in the molecule) can
be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The
resulting mutant molecules can then be tested for biological
activity.
[0229] As the authors state, these two strategies have revealed
that proteins are often surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at certain amino acid positions
in the protein. For example, most buried (within the tertiary
structure of the protein) amino acid residues require nonpolar side
chains, whereas few features of surface side chains are generally
conserved. Moreover, tolerated conservative amino acid
substitutions involve replacement of the aliphatic or hydrophobic
amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and Thr; replacement of the acidic residues Asp and
Glu; replacement of the amide residues Asn and Gln, replacement of
the basic residues Lys, Arg, and His; replacement of the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized
amino acids Ala, Ser, Thr, Met, and Gly.
[0230] The terms "derivative" and "analog" refer to a polypeptide
differing from the endoglucanases, glucosidases,
cellobiohydrolases, xylanases, glucanases, xylosidases, xylan
esterases, arabinofuranosidases, galactosidases, cellobiose
phosphorylases, cellodextrin phosphorylases, mannanases,
mannosidases, xyloglucanases, endoxylanases, glucuronidases,
acetylxylanesterases, arabinofuranohydrolases, swollenins,
glucuronyl esterases, expansins, pectinases, feruoyl esterase,
alpha-amylase, beta-amylase, glucoamylase, pullulanase,
isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase,
arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase,
arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose
isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase,
xylulokinase, xylose reductase, xylose dehydrogenase, xylitol
dehydrogenase, xylonate dehydratase, xylose transketolase, and
xylose transaldolase polypeptides as disclosed herein, but
retaining essential properties thereof. Generally, derivatives and
analogs are overall closely similar, and, in many regions,
identical to the endoglucanase, glucosidase, cellobiohydrolase,
xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and xylose transaldolase polypeptides
disclosed herein. The terms "derivative" and "analog" when
referring to endoglucanases, glucosidases, cellobiohydrolases,
xylanases, glucanases, xylosidases, xylan esterases,
arabinofuranosidases, galactosidases, cellobiose phosphorylases,
cellodextrin phosphorylases, mannanases, mannosidases,
xyloglucanases, endoxylanases, glucuronidases,
acetylxylanesterases, arabinofuranohydrolases, swollenins,
glucuronyl esterases, expansins, pectinases, feruoyl esterase,
alpha-amylase, beta-amylase, glucoamylase, pullulanase,
isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase,
arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase,
arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose
isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase,
xylulokinase, xylose reductase, xylose dehydrogenase, xylitol
dehydrogenase, xylonate dehydratase, xylose transketolase, and
xylose transaldolase polypeptides include any polypeptides which
retain at least some of the activity of the corresponding native
polypeptide, e.g., the exoglucanase activity, or the activity of
the its catalytic domain.
[0231] Derivatives of the saccharolytic enzymes disclosed herein,
are polypeptides which have been altered so as to exhibit features
not found on the native polypeptide. Derivatives can be covalently
modified by substitution, chemical, enzymatic, or other appropriate
means with a moiety other than a naturally occurring amino acid
(for example, a detectable moiety such as an enzyme or
radioisotope). Examples of derivatives include fusion proteins.
[0232] An analog is another form of an endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and xylose transaldolase polypeptide of the
present invention. An "analog" also retains substantially the same
biological function or activity as the polypeptide of interest,
e.g., functions as a xylanase. An analog includes a proprotein
which can be activated by cleavage of the proprotein portion to
produce an active mature polypeptide.
[0233] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide. In some particular embodiments, the polypeptide is a
recombinant polypeptide.
[0234] Also provided in the present invention are allelic variants,
orthologs, and/or species homologs. Procedures known in the art can
be used to obtain full-length genes, allelic variants, splice
variants, full-length coding portions, orthologs, and/or species
homologs of genes corresponding to any of SEQ ID NOs: 1-218, or SEQ
ID NOs: 437-441 using information from the sequences disclosed
herein or the clones deposited with the ATCC. For example, allelic
variants and/or species homologs may be isolated and identified by
making suitable probes or primers from the sequences provided
herein and screening a suitable nucleic acid source for allelic
variants and/or the desired homologue.
Combinations of Saccharolytic Enzymes
[0235] In some embodiments of the present invention, the host cell
expresses a combination of heterologous saccharolytic enzymes. For
example, the host cell can contain at least two heterologous
saccharolytic enzymes, at least three heterologous saccharolytic
enzymes, at least four heterologous saccharolytic enzymes, at least
five heterologous saccharolytic enzymes, at least six heterologous
saccharolytic enzymes, at least seven heterologous saccharolytic
enzymes, at least eight heterologous saccharolytic enzymes, at
least nine heterologous saccharolytic enzymes, at least ten
heterologous saccharolytic enzymes, at least eleven heterologous
saccharolytic enzymes, at least twelve heterologous saccharolytic
enzymes, at least thirteen heterologous saccharolytic enzymes, at
least fourteen heterologous saccharolytic enzymes, or at least
fifteen heterologous saccharolytic enzymes. The heterologous
saccharolytic enzymes in the host cell can be from the same or from
different species. In one embodiment the host cell expresses
heterologous enzymes comprising cellobiohydrolases,
endo-gluconases, beta-glucosidases, xylanases, xylosidases,
glucoamylases, alpha-amylases, alpha-glucosidases, pullulanases,
isopullulanases, pectinases, and acetylxylan esterases.
Tethered and Secreted Saccharolytic Enzymes
[0236] According to the present invention, the saccharolytic
enzymes can be either tethered or secreted. As used herein, a
protein is "tethered" to an organism's cell surface if at least one
terminus of the protein is bound, covalently and/or
electrostatically for example, to the cell membrane or cell wall.
It will be appreciated that a tethered protein can include one or
more enzymatic regions that can be joined to one or more other
types of regions at the nucleic acid and/or protein levels (e.g., a
promoter, a terminator, an anchoring domain, a linker, a signaling
region, etc.). While the one or more enzymatic regions may not be
directly bound to the cell membrane or cell wall (e.g., such as
when binding occurs via an anchoring domain), the protein is
nonetheless considered a "tethered enzyme" according to the present
specification.
[0237] Tethering can, for example, be accomplished by incorporation
of an anchoring domain into a recombinant protein that is
heterologously expressed by a cell, or by prenylation, fatty acyl
linkage, glycosyl phosphatidyl inositol anchors or other suitable
molecular anchors which may anchor the tethered protein to the cell
membrane or cell wall of the host cell. A tethered protein can be
tethered at its amino terminal end or optionally at its carboxy
terminal end.
[0238] As used herein, "secreted" means released into the
extracellular milieu, for example into the media. Although tethered
proteins may have secretion signals as part of their immature amino
acid sequence, they are maintained as attached to the cell surface,
and do not fall within the scope of secreted proteins as used
herein.
[0239] As used herein, "flexible linker sequence" refers to an
amino acid sequence which links two amino acid sequences, for
example, a cell wall anchoring amino acid sequence with an amino
acid sequence that contains the desired enzymatic activity. The
flexible linker sequence allows for necessary freedom for the amino
acid sequence that contains the desired enzymatic activity to have
reduced steric hindrance with respect to proximity to the cell and
may also facilitate proper folding of the amino acid sequence that
contains the desired enzymatic activity.
[0240] In some embodiments of the present invention, the tethered
cellulase enzymes are tethered by a flexible linker sequence linked
to an anchoring domain. In some embodiments, the anchoring domain
is of CWP2 (for carboxy terminal anchoring) or FLO1 (for amino
terminal anchoring) from S. cerevisiae.
[0241] In some embodiments, heterologous secretion signals may be
added to the expression vectors of the present invention to
facilitate the extra-cellular expression of cellulase proteins. In
some embodiments, the heterologous secretion signal is the
secretion signal from T. reesei Xyn2. In other embodiments, the
heterologous secretion signal is the S. cerevisiae Invertase
signal. In yet other embodiments, the heterologous secretion signal
is the S. cerevisiae AF mating signal.
Fusion Proteins Comprising Saccharolytic Enzymes
[0242] The present invention also encompasses fusion proteins. For
example, the fusion proteins can be a fusion of a heterologous
saccharolytic enzyme and a second peptide. The heterologous
saccharolytic enzyme and the second peptide can be fused directly
or indirectly, for example, through a linker sequence. The fusion
protein can comprise for example, a second peptide that is
N-terminal to the heterologous saccharolytic enzyme and/or a second
peptide that is C-terminal to the heterologous saccharolytic
enzyme. Thus, in certain embodiments, the polypeptide of the
present invention comprises a first polypeptide and a second
polypeptide, wherein the first polypeptide comprises a heterologous
saccharolytic enzyme.
[0243] According to one aspect of the present invention, the fusion
protein can comprise a first and second polypeptide wherein the
first polypeptide comprises a heterologous saccharolytic enzyme and
the second polypeptide comprises a signal sequence. According to
another embodiment, the fusion protein can comprise a first and
second polypeptide, wherein the first polypeptide comprises a
heterologous saccharolytic enzyme and the second polypeptide
comprises a polypeptide used to facilitate purification or
identification or a reporter peptide. The polypeptide used to
facilitate purification or identification or the reporter peptide
can be, for example, a HIS-tag, a GST-tag, an HA-tag, a FLAG-tag, a
MYC-tag, or a fluorescent protein.
[0244] According to yet another embodiment, the fusion protein can
comprise a first and second polypeptide, wherein the first
polypeptide comprises a heterologous saccharolytic enzyme and the
second polypeptide comprises an anchoring peptide. In some
embodiments, the anchoring domain is of CWP2 (for carboxy terminal
anchoring) or FLO1 (for amino terminal anchoring) from S.
cerevisiae.
[0245] According to yet another embodiment, the fusion protein can
comprise a first and second polypeptide, wherein the first
polypeptide comprises a heterologous saccharolytic enzyme and the
second polypeptide comprises a cellulose binding module (CBM or
SBM). In some embodiments, the CBM is from, for example, T. reesei
Cbh1 or Cbh2 or from C. lucknowense Cbh2b. In some particular
embodiments, the CBM is fused to a endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase.
[0246] In certain embodiments, the polypeptide of the present
invention encompasses a fusion protein comprising a first
polypeptide and a second polypeptide, wherien the first polypeptide
is an endoglucanase, glucosidase, cellobiohydrolase, xylanase,
glucanase, xylosidase, xylan esterase, arabinofuranosidase,
galactosidase, cellobiose phosphorylase, cellodextrin
phosphorylase, mannanase, mannosidase, xyloglucanase, endoxylanase,
glucuronidase, acetylxylanesterase, arabinofuranohydrolase,
swollenin, glucuronyl esterase, expansin, pectinase, feruoyl
esterase, alpha-amylase, beta-amylase, glucoamylase, pullulanase,
isopullulanase, alpha-glucosidase, beta-glucosidase, galactosidase,
arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase,
arabinoxylanase, arabinosidase, and arabinofuranosidase, arabinose
isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase,
xylulokinase, xylose reductase, xylose dehydrogenase, xylitol
dehydrogenase, xylonate dehydratase, xylose transketolase, and/or
xylose transaldolase. and the second polypeptide is selected from a
polypeptide encoded by a domain or fragment of a saccharolytic
enzyme disclosed herein. In certain embodiments, the polypeptides
of the present invention encompasses a fusion protein comprising a
first saccharolytic enzyme polypeptide, where the first polypeptide
is a domain, derivative or fragment of any saccharolytic enzyme
polypeptide disclosed herein, and a second polypeptide, where the
second polypeptide is a T. emersonii Cbh1, H. grisea Cbh1, or T.
aurantiacusi Cbh1, T. emersonii Cbh2, T. reesei Cbh1 or T. reesei
Cbh2, C. lucknowense Cbh2b, or domain, fragment, variant, or
derivative thereof. In additional embodiments, the first
polypeptide is either N-terminal or C-terminal to the second
polypeptide. In certain other embodiments, the first polypeptide
and/or the second polypeptide are encoded by codon-optimized
polynucleotides, for example, polynucleotides codon-optimized for
S. cerevisiae or Kluveromyces.
[0247] In certain other embodiments, the first polypeptide and the
second polypeptide are fused via a linker sequence. The linker
sequence can, in some embodiments, be encoded by a codon-optimized
polynucleotide. (Codon-optimized polynucleotides are described in
more detail below.) An amino acid sequence corresponding to a
codon-optimized linker 1 according to the invention is a flexible
linker--strep tag--TEV site--FLAG--flexible linker fusion and
corresponds to GGGGSGGGGS AWHPQFGG ENLYFQG DYKDDDK GGGGSGGGGS
[0248] An exemplary DNA sequence is as follows:
TABLE-US-00001 (SEQ ID NO: 41)
GGAGGAGGTGGTTCAGGAGGTGGTGGGTCTGCTTGGCATCCACAATTTGG
AGGAGGCGGTGGTGAAAATCTGTATTTCCAGGGAGGCGGAGGTGATTACA
AGGATGACGACAAAGGAGGTGGTGGATCAGGAGGTGGTGGCTCC
[0249] An amino acid sequence corresponding to optimized linker 2
is a flexible linker--strep tag--linker--TEV site--flexible linker
and corresponds to GGGGSGGGGS WSHPQFEK GG ENLYFQG GGGGSGGGGS. The
DNA sequence is as follows:
TABLE-US-00002
ggtggcggtggatctggaggaggcggttcttggtctcacccacaatttgaaaagggtggagaaaacttgtact-
ttcaaggcggtg gtggaggttctggcggaggtggctccggctca.
Co-Cultures
[0250] In another aspect, the present invention is directed to
co-cultures comprising at least two yeast host cells wherein the at
least two yeast host cells each comprise an isolated polynucleotide
encoding a saccharolytic enzyme. As used herein, "co-culture"
refers to growing two different strains or species of host cells
together in the same vessel. In some embodiments of the invention,
at least one host cell of the co-culture comprises a heterologous
polynucleotide comprising a nucleic acid which encodes an
endoglucanase, glucosidase, cellobiohydrolase, xylanase, glucanase,
xylosidase, xylan esterase, arabinofuranosidase, galactosidase,
cellobiose phosphorylase, cellodextrin phosphorylase, mannanase,
mannosidase, xyloglucanase, endoxylanase, glucuronidase,
acetylxylanesterase, arabinofuranohydrolase, swollenin, glucuronyl
esterase, expansin, pectinase, feruoyl esterase, alpha-amylase,
beta-amylase, glucoamylase, alpha-glucosidase, pullulanase,
isopullulanase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase at least one host
cell of the co-culture comprises a heterologous polynucleotide
comprising a nucleic acid which encodes a different endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, arabinofuranosidase, galactosidase, cellobiose
phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase,
xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, alpha-glucosidase, beta-glucosidase, pullulanase,
isopullulanase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and xylose transaldolase and at least one
host cell comprises a heterologous polynucleotide comprising a
nucleic acid which encodes a still different endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, alpha-glucosidase, beta-glucosidase, pullulanase,
isopullulanase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase.
[0251] The co-culture can comprise two or more strains of yeast
host cells and the heterologous saccharolytic enzymes can be
expressed in any combination in the two or more strains of host
cells. For example, according to the present invention, the
co-culture can comprise two strains: one strain of host cells that
expresses an endoglucanase and a second strain of host cells that
expresses a .beta.-glucosidase, a cellobiohydrolase and a second
cellobiohydrolase. Similarly, the co-culture can comprise one
strain of Lost cells that expresses two saccharolytic enzymes, for
example an endoglucanase and a beta-glucosidase and a second strain
of host cells that expresses one or more saccharolytic enzymes, for
example one or more endoglucanase, glucosidase, cellobiohydrolase,
xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase. The co-culture
can, in addition to the at least two host cells comprising
heterologous saccharolytic enzymes, also include other host cells
which do not comprise heterologous saccharolytic enzymes. The
co-culture can comprise one strain expressing an endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, arabinofuranosidase, galactosidase, cellobiose
phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase,
xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase; and a second
host cell expressing an endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase.
[0252] The various host cell strains in the co-culture can be
present in equal numbers, or one strain or species of host cell can
significantly outnumber another second strain or species of host
cells. For example, in a co-culture comprising two strains or
species of host cells the ratio of one host cell to another can be
about 1:1, 1:2, 1:3, 1:4, 1:5, 1:10, 1:100, 1:500 or 1:1000.
Similarly, in a co-culture comprising three or more strains or
species of host cells, the strains or species of host cells may be
present in equal or unequal numbers.
[0253] Biomass feedstocks contain varying proportions of starch,
lignocellulose, and pentose sugars. Therefore, in one aspect, yeast
strains express different saccharolytic enzymes at different
levels. In one embodiment, the one or more amylolytic enzymes are
expressed at higher levels in yeast strain(s) as compared to one or
more lignocellulases and/or the one or more pentose sugar utilizing
enzymes. In another embodiment, the one or more lignocellulases are
expressed at higher levels in yeast strains) as compared to one or
more amylolytic enzymes and/or the one or more pentose sugar
utilizing enzymes. In yet another embodiment, the one or more
pentose sugar utilizing enzymes are expressed at higher levels in
yeast strain(s) as compared to one or more lignocellulases and/or
the one or more amylolytic enzymes. In still another embodiment,
the one or more amylolytic enzymes, one or more cellulases, and one
or more pentose sugar utilizing enzymes are all expressed at
approximately equal levels in the yeast strain(s). In some
embodiments of the present invention, the ratio of expression of
amylolytic enzymes to cellulolytic enzymes in the yeast strain(s)
is about 1:5, about 1:2, about 1:1, about 2:1, or about 5:1. In
some embodiments of the present invention, the relative expression
levels of the amylolytic enzymes and cellulolytic enzymes can be
determined using chromatographic techniques, such as HPLC,
ion-exchange chromatography, size exclusion chromatography, or by
2D gel electrophoresis, immunoblotting, mass spectrometry,
MALDI_TOF, or functional assays.
[0254] The co-cultures of the present invention can include
tethered saccharolytic enzymes, secreted saccharolytic enzymes or
both tethered and secreted saccharolytic enzymes. For example, in
some embodiments of the invention, the co-culture comprises at
least one yeast host cell comprising a polynucleotide encoding a
secreted heterologous saccharolytic enzymes. In another embodiment,
the co-culture comprises at least one yeast host cell comprising a
polynucleotide encoding a tethered heterologous saccharolytic
enzymes. In one embodiment, all of the heterologous saccharolytic
enzymes in the co-culture are secreted, and in another embodiment,
all of the heterologous saccharolytic enzymes in the co-culture are
tethered. In addition, other saccharolytic enzymes, such as
externally added saccharolytic enzymes may be present in the
co-culture.
Polynucleotides Encoding Heterologous Saccharolytic Enzymes
[0255] In another aspect. the present invention includes isolated
polynucleotides encoding saccharolytic enzymes of the present
invention. Thus, the polynucleotides of the invention can encode
endoglucanases, exoglucanases, amylases, or pentose sugar utilizing
enzymes. The polynucleotides can encode an endoglucanase,
glucosidase, cellobiohydrolase, xylanase, glucanase, xylosidase,
xylan esterase, arabinofuranosidase, galactosidase, cellobiose
phosphorylase, cellodextrin phosphorylase, mannanase, mannosidase,
xyloglucanase, endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase.
[0256] The present invention also encompasses an isolated
polynucleotide comprising a nucleic acid that is at least about
70%, 75%, or 80% identical, at least about 90% to about 95%
identical, or at least about 96%, 97%, 98%, 99% or 100% identical
to a nucleic acid encoding an endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase disclosed
herein.
[0257] The present invention also encompasses variants of the
saccharolytic enzymes genes, as described above. Variants may
contain alterations in the coding regions, non-coding regions, or
both. Examples are polynucleotide variants containing alterations
which produce silent substitutions, additions, or deletions, but do
not alter the properties or activities of the encoded polypeptide.
In certain embodiments, nucleotide variants are produced by silent
substitutions due to the degeneracy of the genetic code. In further
embodiments, endoglucanase, glucosidase, cellobiohydrolase,
xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and xylose transaldolase polynucleotide
variants can be produced for a variety of reasons, e.g., to
optimize codon expression for a particular host. Codon-optimized
polynucleotides of the present invention are discussed further
below.
[0258] The present invention also encompasses an isolated
polynucleotide encoding a fusion protein. In certain embodiments,
the nucleic acid encoding a fusion protein comprises a first
polynucleotide encoding for a endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and xylose transaldolase as disclosed herein
and a CBD (as described above).
[0259] In further embodiments, the first and second polynucleotides
are in the same orientation, or the second polynucleotide is in the
reverse orientation of the first polynucleotide. In additional
embodiments, the first polynucleotide encodes a polypeptide that is
either N-terminal or C-terminal to the polypeptide encoded by the
second polynucleotide. In certain other embodiments, the first
polynucleotide and/or the second polynucleotide are encoded by
codon-optimized polynucleotides, for example, polynucleotides
codon-optimized for S. cerevisiae, Kluyveromyces or for both S.
cerevisiae and Kluyveromyces.
[0260] Also provided in the present invention are allelic variants,
orthologs, and/or species homologs. Procedures known in the art can
be used to obtain full-length genes, allelic variants, splice
variants, full-length coding portions, orthologs, and/or species
homologs of genes corresponding to any of SEQ ID NOs: 1-218, or any
of SEQ ID NOs: 437-441, using information from the sequences
disclosed herein or the clones deposited with the ATCC or otherwise
publically available. For example, allelic variants and/or species
homologs may be isolated and identified by making suitable probes
or primers from the sequences provided herein and screening a
suitable nucleic acid source for allelic variants and/or the
desired homologue.
[0261] By a nucleic acid having a nucleotide sequence at least, for
example, 95% "identical" to a reference nucleotide sequence of the
present invention, it is intended that the nucleotide sequence of
the nucleic acid is identical to the reference sequence except that
the nucleotide sequence may include up to five point mutations per
each 100 nucleotides of the reference nucleotide sequence encoding
the particular polypeptide. In other words, to obtain a nucleic
acid having a nucleotide sequence at least 95% identical to a
reference nucleotide sequence, up to 5% of the nucleotides in the
reference sequence may be deleted or substituted with another
nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the reference sequence may be inserted into the
reference sequence. The query sequence may be an entire sequence
shown of any of SEQ ID NOs: 1-218, or any of SEQ ID NOs: 437-441,
or any fragment or domain specified as described herein.
[0262] As a practical matter, whether any particular nucleic acid
molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%,
98% or 99% identical to a nucleotide sequence or polypeptide of the
present invention can be determined conventionally using known
computer programs. A method for determining the best overall match
between a query sequence (a sequence of the present invention) and
a subject sequence, also referred to as a global sequence
alignment, can be determined using the FASTDB computer program
based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990)
6:237-245.) In a sequence alignment the query and subject sequences
are both DNA sequences. An RNA sequence can be compared by
converting U's to T's. The result of said global sequence alignment
is in percent identity. Preferred parameters used in a FASTDB
alignment of DNA sequences to calculate percent identity are:
Matrix=Unitary, k-tuple=4, Mismatch Penalty=1, Joining Penalty=30,
Randomization Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap
Size Penalty 0.05, Window Size=500 or the length of the subject
nucleotide sequence, whichever is shorter.
[0263] If the subject sequence is shorter than the query sequence
because of 5' or 3' deletions, not because of internal deletions, a
manual correction must be made to the results. This is because the
FASTDB program does not account for 5' and 3' truncations of the
subject sequence when calculating percent identity. For subject
sequences truncated at the 5' or 3' ends, relative to the query
sequence, the percent identity is corrected by calculating the
number of bases of the query sequence that are 5' and 3' of the
subject sequence, which are not matched/aligned, as a percent of
the total bases of the query sequence. Whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of the
present invention. Only bases outside the 5' and 3' bases of the
subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score.
[0264] For example, a 90 base subject sequence is aligned to a 100
base query sequence to determine percent identity. The deletions
occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10
bases at 5' end. The 10 unpaired bases represent 10% of the
sequence (number of bases at the 5' and 3' ends not matched/total
number of bases in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject
sequence is compared with a 100 base query sequence. This time the
deletions are internal deletions so that there are no bases on the
5' or 3' of the subject sequence which are not matched/aligned with
the query. In this case the percent identity calculated by FASTDB
is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections
are to be made for the purposes of the present invention.
[0265] Some embodiments of the invention encompass a nucleic acid
molecule comprising at least 10, 20, 30, 35, 40, 50, 60, 70, 80,
90, 100, 200, 300, 400, 500, 600, 700, or 800 consecutive
nucleotides or more of any of SEQ ID NOs: 1-218, or any of SEQ ID
NOs: 437-441, or domains, fragments, variants, or derivatives
thereof.
[0266] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double stranded or
single-stranded, and if single stranded can be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptide can be identical to the coding sequence
encoding SEQ ID NO: 219-436, or SEQ ID NO: 442-446, or may be a
different coding sequence which coding sequence, as a result of the
redundancy or degeneracy of the genetic code, encodes the same
mature polypeptide as the nucleic acid sequences of any one of SEQ
ID NOs: 1-218, or any one of SEQ ID NOs: 437-441.
[0267] In certain embodiments, the present invention provides an
isolated polynucleotide comprising a nucleic acid fragment which
encodes at least 10, at least 20, at least 30, at least 40, at
least 50, at least 60, at least 70, at least 80, at least 90, at
least 95, or at least 100 or more contiguous amino acids of SEQ ID
NOs: 219-436, or SEQ ID NO: 442-446.
[0268] The polynucleotide encoding for the mature polypeptide of
SEQ ID NOs: 219-436, or SEQ ID NO: 442-446 may include: only the
coding sequence for the mature polypeptide; the coding sequence of
any domain of the mature polypeptide; and the coding sequence for
the mature polypeptide (or domain-encoding sequence) together with
non coding sequence, such as introns or non-coding sequence 5'
and/or 3' of the coding sequence for the mature polypeptide.
[0269] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only sequences encoding
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequences.
[0270] In further aspects of the invention, nucleic acid molecules
having sequences at least about 90%, 95%, 96%, 97%, 98% or 99%
identical to the nucleic acid sequences disclosed herein, encode a
polypeptide having an endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose
isomerase, xylulokinase, xylose reductase, xylose dehydrogenase,
xylitol dehydrogenase, xylonate dehydratase, xylose transketolase,
and xylose transaldolase. functional activity.
[0271] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
portion of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid
sequence of any of SEQ ID NOs: 1-218, or any of SEQ ID NOs:
437-441, or fragments thereof, will encode polypeptides having
functional activity. In fact, since degenerate variants of any of
these nucleotide sequences all encode the same polypeptide, in many
instances, this will be clear to the skilled artisan even without
performing the above described comparison assay. It will be further
recognized in the art that, for such nucleic acid molecules that
are not degenerate variants, a reasonable number will also encode a
polypeptide having functional activity.
[0272] The polynucleotides of the present invention also comprise
nucleic acids encoding an endoglucanase, glucosidase,
cellobiohydrolase, xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose
isomerase, xylulokinase, xylose reductase, xylose dehydrogenase,
xylitol dehydrogenase, xylonate dehydratase, xylose transketolase,
and xylose transaldolase, or domain, fragment, variant, or
derivative thereof, fused to a polynucleotide encoding a marker
sequence which allows for detection of the polynucleotide of the
present invention. In one embodiment of the invention, expression
of the marker is independent from expression of the saccharolytic
enzyme. The marker sequence may be a yeast selectable marker
selected from the group consisting of URA3, HIS3, LEU2, TRP1, LYS2,
ADE2 or any other suitable selectable marker known in the art.
Casey, G. P. et al., "A convenient dominant selection marker for
gene transfer in industrial strains of Saccharomyces yeast: SMR1
encoded resistance to the herbicide sulfometuron methyl," J Inst.
Brew. 94:93-97 (1988).
Codon Optimized Polynucleotides
[0273] According to one embodiment of the invention, the
polynucleotides encoding heterologous saccharolytic enzymes can be
codon-optimized. As used herein the term "codon-optimized coding
region" means a nucleic acid coding region that has been adapted
for expression in the cells of a given organism by replacing at
least one, or more than one, or a significant number, of codons
with one or more codons that are more frequently used in the genes
of that organism.
[0274] In general, highly expressed genes in an organism are biased
towards codons that are recognized by the most abundant tRNA
species in that organism. One measure of this bias is the "codon
adaptation index" or "CAI," which measures the extent to which the
codons used to encode each amino acid in a particular gene are
those which occur most frequently in a reference set of highly
expressed genes from an organism.
[0275] The CAI of codon optimized sequences of the present
invention corresponds to between about 0.8 and 1.0, between about
0.8 and 0.9, or about 1.0. A codon optimized sequence may be
further modified for expression in a particular organism, depending
on that organism's biological constraints. For example, large runs
of "As" or "Ts" (e.g., runs greater than 4, 5, 6, 7, 8, 9, or 10
consecutive bases) can be removed from the sequences if these are
known to effect transcription negatively. Furthermore, specific
restriction enzyme sites may be removed for molecular cloning
purposes. Examples of such restriction enzyme sites include PacI,
AscI, BamHI, BgIII, EcoRI and XhoI. Additionally, the DNA sequence
can be checked for direct repeats, inverted repeats and mirror
repeats with lengths of ten bases or longer, which can be modified
manually by replacing codons with "second best" codons, i.e.,
codons that occur at the second highest frequency within the
particular organism for which the sequence is being optimized.
[0276] Deviations in the nucleotide sequence that comprise the
codons encoding the amino acids of any polypeptide chain allow for
variations in the sequence coding for the gene. Since each codon
consists of three nucleotides, and the nucleotides comprising DNA
are restricted to four specific bases, there are 64 possible
combinations of nucleotides, 61 of which encode amino acids (the
remaining three codons encode signals ending translation). The
"genetic code" which shows which codons encode which amino acids is
reproduced herein as Table 1. As a result, many amino acids are
designated by more than one codon. For example, the amino acids
alanine and proline are coded for by four triplets, serine and
arginine by six, whereas tryptophan and methionine are coded by
just one triplet. This degeneracy allows for DNA base composition
to vary over a wide range without altering the amino acid sequence
of the proteins encoded by the DNA.
TABLE-US-00003 TABLE 1 The Standard Genetic Code T C A G T TTT Phe
(F) TCT Ser (S) TAT Tyr (Y) TGT Cys (C) TTC Phe (F) TCC Ser (S) TAC
Tyr (Y) TGC TTA Leu (L) TCA Ser (S) TAA Ter TGA Ter TTG Leu (L) TCG
Ser (S) TAG Ter TGG Trp (W) C CTT Leu (L) CCT Pro (P) CAT His (H)
CGT Arg (R) CTC Leu (L) CCC Pro (P) CAC His (H) CGC Arg (R) CTA Leu
(L) CCA Pro (P) CAA Gln (Q) CGA Arg (R) CTG Leu (L) CCG Pro (P) CAG
Gln (Q) CGG Arg (R) A ATT Ile (I) ACT Thr (T) AAT Asn (N) AGT Ser
(S) ATC Ile (I) ACC Thr (T) AAC Asn (N) AGC Ser (S) ATA Ile (I) ACA
Thr (T) AAA Lys (K) AGA Arg (R) ATG Met (M) ACG Thr (T) AAG Lys (K)
AGG Arg (R) G GTT Val (V) GCT Ala (A) GAT Asp (D) GGT Gly (G) GTC
Val (V) GCC Ala (A) GAC Asp (D) GGC Gly (G) GTA Val (V) GCA Ala (A)
GAA Glu (E) GGA Gly (G) GTG Val (V) GCG Ala (A) GAG Glu (E) GGG Gly
(G)
[0277] Many organisms display a bias for use of particular codons
to code for insertion of a particular amino acid in a growing
peptide chain. Codon preference or codon bias, differences in codon
usage between organisms, is afforded by degeneracy of the genetic
code, and is well documented among many organisms. Codon bias often
correlates with the efficiency of translation of messenger RNA
(mRNA), which is in turn believed to be dependent on, inter alia,
the properties of the codons being translated and the availability
of particular transfer RNA (tRNA) molecules. The predominance of
selected tRNAs in a cell is generally a reflection of the codons
used most frequently in peptide synthesis. Accordingly, genes can
be tailored for optimal gene expression in a given organism based
on codon optimization.
[0278] Given the large number of gene sequences available for a
wide variety of animal, plant and microbial species, it is possible
to calculate the relative frequencies of codon usage. Codon usage
Tables are readily available, for example, at
http://phenotype.biosci.umbc.edu/codon/sgd/index.php (visited May
7, 2008) or at http://www.kazusa.or.jp/codon/ (visited Mar. 20,
2008), and these tables can be adapted in a number of ways. See
Nakamura, Y., et al., "Codon usage tabulated from the international
DNA sequence databases: status for the year 2000," Nucl. Acids Res.
28:292 (2000). Codon usage tables for yeast, calculated from
GenBank Release 128.0 [15 Feb. 2002], are reproduced below as Table
2. This Table uses mRNA nomenclature, and so instead of thymine (T)
which is found in DNA, the tables use uracil (L) which is found in
RNA. The Table has been adapted so that frequencies are calculated
for each amino acid, rather than for all 64 codons.
TABLE-US-00004 TABLE 2 Codon Usage Table for Saccharomyces
cerevisiae Genes Frequency per Amino Acid Codon Number hundred Phe
UUU 170666 26.1 Phe UUC 120510 18.4 Total Leu UUA 170884 26.2 Leu
UUG 177573 27.2 Leu CUU 80076 12.3 Leu CUC 35545 5.4 Leu CUA 87619
13.4 Leu CUG 68494 10.5 Total Ile AUU 196893 30.1 Ile AUC 112176
17.2 Ile AUA 116254 17.8 Total Met AUG 136805 20.9 Total Val GUU
144243 22.1 Val GUC 76947 11.8 Val GUA 76927 11.8 Val GUG 70337
110.8 Total Ser UCU 153557 23.5 Ser UCC 92923 14.2 Ser UCA 122028
18.7 Ser UCG 55951 8.6 Ser AGU 92466 14.2 Ser AGC 63726 9.8 Total
Pro CCU 88263 13.5 Pro CCC 44309 6.8 Pro CCA 119641 18.3 Pro CCG
34597 5.3 Total Thr ACU 132522 20.3 Thr ACC 83207 12.7 Thr ACA
116084 17.8 Thr ACG 52045 8.0 Total Ala GCU 138358 21.2 Ala GCC
82357 12.6 Ala GCA 105910 16.2 Ala GCG 40358 6.2 Total Tyr UAU
122728 18.8 Tyr UAC 96596 14.8 Total His CAU 89007 13.6 His CAC
50785 7.8 Total Gln CAA 178251 27.3 Gln CAG 79121 12.1 Total Asn
AAU 233124 35.7 Asn AAC 162199 24.8 Total Lys AAA 273618 41.9 Lys
AAG 201361 30.8 Total Asp GAU 245641 37.6 Asp GAC 132048 20.2 Total
Glu GAA 297944 45.6 Glu GAG 125717 19.2 Total Cys UGU 52903 8.1 Cys
UGC 31095 4.8 Total Trp UGG 67789 10.4 Total Arg CGU 41791 6.4 Arg
CGC 16993 2.6 Arg CGA 19562 3.0 Arg CGG 11351 1.7 Arg AGA 139081
21.3 Arg AGG 60289 9.2 Total Gly GGU 156109 23.9 Gly GGC 63903 9.8
Gly GGA 71216 10.9 Gly GGG 39359 6.0 Total Stop UAA 6913 1.1 Stop
UAG 3312 0.5 Stop UGA 4447 0.7
[0279] By utilizing this or similar Tables, one of ordinary skill
in the art can apply the frequencies to any given polypeptide
sequence, and produce a nucleic acid fragment of a codon-optimized
coding region which encodes the polypeptide, but which uses codons
optimal for a given species. Codon-optimized coding regions can be
designed by various different methods.
[0280] In one method, a codon usage Table is used. to find the
single most frequent codon used for any given amino acid, and that
codon is used each time that particular amino acid appears in the
polypeptide sequence. For example, referring to Table 2 above, for
leucine, the most frequent codon is UUG, which is used 27.2% of the
time. Thus all the leucine residues in a given amino acid sequence
would be assigned the codon UUG.
[0281] In another method, the actual frequencies of the codons are
distributed randomly throughout the coding sequence. Thus, using
this method for optimization, if a hypothetical polypeptide
sequence had 100 leucine residues, referring to Table 2 for
frequency of usage in the S. cerevisiae, about 5, or 5% of the
leucine codons would be CUC, about 11, or 11% of the leucine codons
would be CUG, about 12, or 12% of the leucine codons would be CUU,
about 13, or 13% of the leucine codons would be CUA, about 26, or
26% of the leucine codons would be UUA, and about 27, or 27% of the
leucine codons would be UUG.
[0282] These frequencies would be distributed randomly throughout
the leucine codons in the coding region encoding the hypothetical
polypeptide. As will be understood by those of ordinary skill in
the art, the distribution of codons in the sequence can vary
significantly using this method; however, the sequence always
encodes the same polypeptide.
[0283] When using the methods above, the term "about" is used
precisely to account for fractional percentages of codon
frequencies for a given amino acid. As used herein, "about" is
defined as one amino acid more or one amino acid less than the
value given. The whole number value of amino acids is rounded up if
the fractional frequency of usage is 0.50 or greater, and is
rounded down if the fractional frequency of use is 0.49 or less.
Using again the example of the frequency of usage of leucine in
human genes for a hypothetical polypeptide having 62 leucine
residues, the fractional frequency of codon usage would be
calculated by multiplying 62 by the frequencies for the various
codons. Thus, 7.28 percent of 62 equals 4.51 UUA codons, or "about
5," i.e., 4, 5, or 6 UUA codons, 12.66 percent of 62 equals 7.85
UUG codons or "about 8," i.e., 7, 8, or 9 UUG codons, 12.87 percent
of 62 equals 7.98 CUU codons, or "about 8," i.e., 7, 8, or 9 CUU
codons, 19.56 percent of 62 equals 12.13 CUC codons or "about 12,"
i.e., 11, 12, or 13 CUC codons, 7.00 percent of 62 equals 4.34 CUA
codons or "about 4," i.e., 3, 4, or 5 CUA codons, and 40.62 percent
of 62 equals 25.19 CUG codons, or "about 25," i.e., 24, 25, or 26
CUG codons.
[0284] Randomly assigning codons at an optimized frequency to
encode a given polypeptide sequence, can be done manually by
calculating codon frequencies for each amino acid, and then
assigning the codons to the polypeptide sequence randomly.
Additionally, various algorithms and computer software programs are
readily available to those of ordinary skill in the art. For
example, the "EditSeq" function in the Lasergene Package, available
from DNAstar, Inc., Madison, Wis., the backtranslation function in
the VectorNTI Suite, available from InforMax, Inc., Bethesda, Md.,
and the "backtranslate" function in the GCG--Wisconsin Package,
available from Accelrys, Inc., San Diego, Calif. In addition,
various resources are publicly available to codon-optimize coding
region sequences, e.g., the "backtranslation" function at
http://www.entelechon.com/2008/10/backtranslation-tool/ (visited
May 30, 2010). Constructing a rudimentary algorithm to assign
codons based on a given frequency can also easily be accomplished
with basic mathematical functions by one of ordinary skill in the
art.
[0285] A number of options are available for synthesizing codon
optimized coding regions designed by any of the methods described
above, using standard and routine molecular biological
manipulations well known to those of ordinary skill in the art. In
one approach, a series of complementary oligonucleotide pairs of
80-90 nucleotides each in length and spanning the length of the
desired sequence is synthesized by standard methods. These
oligonucleotide pairs are synthesized such that upon annealing,
they form double stranded fragments of 80-90 base pairs, containing
cohesive ends, e.g., each oligonucleotide in the pair is
synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond
the region that is complementary to the other oligonucleotide in
the pair. The single-stranded ends of each pair of oligonucleotides
is designed to anneal with the single-stranded end of another pair
of oligonucleotides. The oligonucleotide pairs are allowed to
anneal, and approximately five to six of these double-stranded
fragments are then allowed to anneal together via the cohesive
single stranded ends, and then they ligated together and cloned
into a standard bacterial cloning vector, for example, a TOPO.RTM.
vector available from Invitrogen Corporation, Carlsbad, Calif. The
construct is then sequenced by standard methods. Several of these
constructs consisting of 5 to 6 fragments of 80 to 90 base pair
fragments ligated together, i.e., fragments of about 500 base
pairs, are prepared, such that the entire desired sequence is
represented in a series of plasmid constructs. The inserts of these
plasmids are then cut with appropriate restriction enzymes and
ligated together to form the final construct. The final construct
is then cloned into a standard bacterial cloning vector, and
sequenced. Additional methods would be immediately apparent to the
skilled artisan. In addition, gene synthesis is readily available
commercially.
[0286] In certain embodiments, an entire polypeptide sequence, or
fragment, variant, or derivative thereof is codon optimized by any
of the methods described herein. Various desired fragments,
variants or derivatives are designed, and each is then
codon-optimized individually. In addition, partially
codon-optimized coding regions of the present invention can be
designed and constructed. For example, the invention includes a
nucleic acid fragment of a codon-optimized coding region encoding a
polypeptide in which at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, or 100% of the codon positions have been
codon-optimized for a given species. That is, they contain a codon
that is preferentially used in the genes of a desired species,
e.g., a yeast species such as Saccharomyces cerevisiae or
Kluveromyces, in place of a codon that is normally used in the
native nucleic acid sequence.
[0287] In additional embodiments, a full-length polypeptide
sequence is codon-optimized for a given species resulting in a
codon-optimized coding region encoding the entire polypeptide, and
then nucleic acid fragments of the codon-optimized coding region,
which encode fragments, variants, and derivatives of the
polypeptide are made from the original codon-optimized coding
region. As would be well understood by those of ordinary skill in
the art, if codons have been randomly assigned to the full-length
coding region based on their frequency of use in a given species,
nucleic acid fragments encoding fragments, variants, and
derivatives would not necessarily be fully codon optimized for the
given species. However, such sequences are still much closer to the
codon usage of the desired species than the native codon usage. The
advantage of this approach is that synthesizing codon-optimized
nucleic acid fragments encoding each fragment, variant, and
derivative of a given polypeptide, although routine, would be time
consuming and would result in significant expense.
[0288] The codon-optimized coding regions can be, for example,
versions encoding an endoglucanase, glucosidase, cellobiohydrolase,
xylanase, glucanase, xylosidase, xylan esterase,
arabinofuranosidase, galactosidase, cellobiose phosphorylase,
cellodextrin phosphorylase, mannanase, mannosidase, xyloglucanase,
endoxylanase, glucuronidase, acetylxylanesterase,
arabinofuranohydrolase, swollenin, glucuronyl esterase, expansin,
pectinase, feruoyl esterase, alpha-amylase, beta-amylase,
glucoamylase, pullulanase, isopullulanase, alpha-glucosidase,
beta-glucosidase, galactosidase, arabinase, arabinoxylanase,
arabinosidase, arabinofuranosidase, arabinoxylanase, arabinosidase,
and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate
4-epimerase, xylose isomerase, xylulokinase, xylose reductase,
xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase,
xylose transketolase, and/or xylose transaldolase as disclosed
herein, or domains, fragments, variants, or derivatives
thereof.
[0289] Codon optimization is carried out for a particular species
by methods described herein, for example, in certain embodiments
codon-optimized coding regions encoding polypeptides disclosed in
the present application or domains, fragments, variants, or
derivatives thereof are optimized according to yeast codon usage,
e.g., Saccharomyces cerevisiae, Kluyveromyces lactis and/or
Kluyveromyces marxianus. Also provided are polynucleotides,
vectors, and other expression constructs comprising codon-optimized
coding regions encoding polypeptides disclosed herein, or domains,
fragments, variants, or derivatives thereof, and various methods of
using such polynucleotides, vectors and other expression
constructs.
[0290] In certain embodiments described herein, a codon-optimized
coding region encoding any of SEQ ID NOs: 219-436, or any of SEQ ID
NOs: 442-446, or domain, fragment, variant, or derivative thereof,
is optimized according to codon usage in yeast (e.g. Saccharomyces
cerevisiae, Kluyveromyces lactis or Kluyveromyces marxianus). In
some embodiments, the sequences are codon-optimized specifically
for expression in Saccharomyces cerevisiae. Alternatively, a
codon-optimized coding region encoding any of SEQ ID NOs: 219-436,
or any of SEQ ID NOs: 442-446 may be optimized according to codon
usage in any plant, animal, or microbial species.
Vectors and Methods of Using Vectors in Host Cells
[0291] In another aspect, the present invention relates to vectors
which include polynucleotides of the present invention, host cells
which are genetically engineered with vectors of the invention and
the production of polypeptides of the invention by recombinant
techniques.
[0292] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
genes of the present invention. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0293] The polynucleotides of the present invention can be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; and yeast plasmids.
However, any other vector may be used as long as it is replicable
and viable in the host.
[0294] The appropriate DNA sequence can be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0295] The DNA sequence in the expression vector is operatively
associated with an appropriate expression control sequence(s)
(promoter) to direct mRNA synthesis. Representative examples of
such promoters are as follows:
TABLE-US-00005 Gene Organism Systematic name Reason for
use/benefits PGK1 S. cerevisiae YCR012W Strong constitutive
promoter ENO1 S. cerevisiae YGR254W Strong constitutive promoter
TDH3 S. cerevisiae YGR192C Strong constitutive promoter TDH2 S.
cerevisiae YJR009C Strong constitutive promoter TDH1 S. cerevisiae
YJL052W Strong constitutive promoter ENO2 S. cerevisiae YHR174W
Strong constitutive promoter GPM1 S. cerevisiae YKL152C Strong
constitutive promoter TPI1 S. cerevisiae YDR050C Strong
constitutive promoter
[0296] Additionally, promoter sequences from stress and starvation
response genes are useful in the present invention. In some
embodiments, promoter regions from the S. cerevisiae genes GAC1,
GET3, GLC7, GSH1, GSH2, HSF1, HSP12, LCB5, LRE1, LSP1, NBP2, PDC1,
PIL1, PIM1, SGT2, SLG1, WHI2, WSC2, WSC3, WSC4, YAP1, YDC1, HSP104,
HSP26, ENA1, MSN2, MSN4, SIP2, SIP4, SIP5, DPL1, IRS4, KOG1, PEP4,
HAP4, PRB1, TAX4, ZPR1, ATG1, ATG2, ATG10, ATG11, ATG12, ATG13,
ATG14, ATG15, ATG16, ATG17, ATG18, and ATG19 may be used. Any
suitable promoter to drive gene expression in the host cells of the
invention may be used. Additionally the E. coli, lac or trp, and
other promoters known to control expression of genes in prokaryotic
or lower eukaryotic cells can be used.
[0297] In addition, the expression vectors may contain one or more
selectable marker genes to provide a phenotypic trait for selection
of transformed host cells such as URA3, HIS3, LEU2, TRP1, LYS2 or
ADE2, dihydrofolate reductase, neomycin (G418) resistance or zeocin
resistance for eukaryotic cell culture, or tetracycline or
ampicillin resistance in E. coli.
[0298] The expression vector may also contain a ribosome binding
site for translation initiation and/or a transcription terminator.
The vector may also include appropriate sequences for amplifying
expression, or may include additional regulatory regions.
[0299] The vector containing the appropriate DNA sequence as
disclosed herein, as well as an appropriate promoter or control
sequence, may be employed to transform an appropriate host to
permit the host to express the protein.
[0300] Thus, in certain aspects, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a host cell as described elsewhere in the application. The
host cell can be, for example, a lower eukaryotic cell, such as a
yeast cell, e.g., Saccharomyces cerevisiae or Kluyveromyces, or the
host cell can be a prokaryotic cell, such as a bacterial cell.
[0301] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; thermophilic or mesophlic bacteria; fungal
cells, such as yeast; and plant cells, etc. The selection of an
appropriate host is deemed to be within the scope of those skilled
in the art from the teachings herein.
[0302] Appropriate fungal hosts include yeast. In certain aspects
of the invention the yeast is selected from the group consisting of
Saccharomyces cerevisiae, Kluyveromyces lactis,
Schizzosaccharomyces pombe, Candida albicans, Pichia pastoris,
Pichia stipitis, Yarrowia lipolytica, Hansenula polymorpha, Phaffia
rhodozyma, Candida utilis, Arxula adeninivorans, Debaryomyces
hansenii, Debaryomyces polymorphus, Schwanniomyces occidentalis,
Issatchenkia orientalis, Kluyveromyces marxianus, Blakeslea,
Candida, Cryptococcus, Cunninghamella, Lipomyces, Mortierella,
Mucor, Phycomces, Pythium, Rhodosporidium, Rhodotorula,
Trichosporon and Yarrowia.
Methods of Using Host Cells to Produce Ethanol or Other
Fermentation Products
[0303] In another aspect, the present invention is directed to the
use of host cells and co-cultures to produce ethanol or other
products from a biomass feedstock comprising starch,
lignocellulosic matter, hexose and pentose sugars. Such methods can
be accomplished, for example, by contacting a biomass feedstock
with a host cell or a co-culture of the present invention.
Fermentation products include, but are not limited to products such
as butanol, acetate, amino acids, and vitamins.
[0304] Numerous biomass feedstocks can be used in accordance with
the present invention. Substrates for saccharolytic enzyme activity
assays can be divided into two categories, soluble and insoluble,
based on their solubility in water. Soluble substrates include
alpha-dextrins, cellodextrins or derivatives, carboxymethyl
cellulose (CMC), or hydroxyethyl cellulose (HEC). Insoluble
substrates include insoluble starch, crystalline cellulose,
microcrystalline cellulose (Avicel), amorphous cellulose, such as
phosphoric acid swollen cellulose (PASC), dyed or fluorescent
cellulose, and lignocellulosic biomass. These substrates are
generally highly ordered cellulosic material and thus only
sparingly soluble.
[0305] It will be appreciated that suitable lignocellulosic
material may be any feedstock that contains soluble and/or
insoluble cellulose, where the insoluble cellulose may be in a
crystalline or non-crystalline form. In various embodiments, the
lignocellulosic biomass comprises, for example, wood, corn, corn
stover, sawdust, bark, leaves, agricultural and forestry residues,
grasses such as switchgrass, ruminant digestion products, municipal
wastes, paper mill effluent, newspaper, cardboard or combinations
thereof.
[0306] In some embodiments, the invention is directed to a method
for hydrolyzing a biomass feedstock, for example a biomass
feedstock as described above, by contacting the biomass feedstock
with a host cell of the invention. In some embodiments, the
invention is directed to a method for hydrolyzing a biomass
feedstock, for example a biomass feedstock as described above, by
contacting the feedstock with a co-culture comprising yeast cells
expressing heterologous saccharolytic enzymes.
[0307] In some embodiments of the present invention, the necessity
of adding external saccharolytic enzymes to the fermentation medium
is reduced because cells of the invention express polypeptides of
the invention.
[0308] In some embodiments, the invention is directed to a method
for fermenting a biomass feedstock. Such methods can be
accomplished, for example, by culturing a host cell or co-culture
in a medium that contains insoluble biomass feedstock to allow
saccharification and fermentation of the biomass feedstock.
[0309] In addition to the enzymes of the present invention, in some
embodiments, host cells of the present invention can have further
genetic modifications to make them more suitable for fermenting
biomass feedstock to ethanol. For example, host cells of the
present invention may express xylose isomerase and/or arabinose
isomerase inorder to more efficiently use pentose sugars for
fermentation. In some embodiments, the xylose isomerase is from a
Pyromyces species. In addition to a xylose isomerase, host cells of
the invention, in some embodiments, can over-express genes related
to the pentose phosphate pathway. These genes include, but are not
limited to transkelolase and transaldolase genes. Components of the
pentose phosphate pathway are known to those skilled in the art and
are useful in aiding assimilation of carbons derived from pentose
sugars into fermentation processes. (See, e.g. WO 03/062430, WO
06/009434, and US 2006/0234364). In some embodiments, a host cell
is able to use xylose and other pentose sugars such as arabinose by
incorporating the carbons from pentose sugars into fermentative
pathways via the pentose phosphate pathway. The xylose-utilizing
host cell heterologously expresses xylose isomerase, e.g. Pyromyces
sp. E2 XylA, overexpresses xylulokinase, ribulose 5-phosphate
isomerase, ribulose 5-phosphate epimerase, transketolase and
transaldolase, and does not express an aldose reductase such as the
GRE3 gene (encoding an aldose reductase).
[0310] The production of ethanol can, according to the present
invention, be performed at temperatures of at least about
25.degree. C., about 28.degree. C., about 30.degree. C., about
31.degree. C., about 32.degree. C., about 33.degree. C., about
34.degree. C., about 35.degree. C., about 36.degree. C., about
37.degree. C., about 38.degree. C., about 39.degree. C., about
40.degree. C., about 41.degree. C., about 42.degree. C., or about
50.degree. C. In some embodiments of the present invention, the
thermotolerant host cell can produce ethanol from cellulose at
temperatures above about 30.degree. C., about 31.degree. C., about
32.degree. C., about 33.degree. C., about 34.degree. C., about
35.degree. C., about 36.degree. C., about 37.degree. C., about
38.degree. C., about 39.degree. C., about 40.degree. C., about
41.degree. C., about 42.degree. C., or about 50.degree. C. In some
embodiments of the present invention, the thermotolterant host cell
can produce ethanol from cellulose at temperatures from about
30.degree. C. to 60.degree. C., about 30.degree. C. to 55.degree.
C., about 30.degree. C. to 50.degree. C., about 40.degree. C. to
60.degree. C., about 40.degree. C. to 55.degree. C. or about
40.degree. C. to 50.degree. C.
[0311] In some embodiments, methods of producing ethanol can
comprise contacting a biomass feedstock with a host cell or
co-culture of the invention and additionally contacting the biomass
feedstock with externally produced saccharolytic enzymes. Exemplary
externally produced saccharolytic enzymes are commercially
available and are known to those of skill in the art and are
further exemplified below.
[0312] Therefore, the invention is also directed to methods of
reducing the amount of externally produced saccharolytic enzymes
required to produce a given amount of ethanol from the biomass
feedstock comprising contacting the saccharolytic enzyme with
externally produced saccharolytic enzymes and with a host cell or
co-culture of the invention. in some embodiments, the same amount
of ethanol production can be achieved using at least about 5%, 10%,
15%, 20%, 25%, 30%, or 50% fewer externally produced saccharolytic
enzymes.
[0313] In some embodiments, the methods comprise producing ethanol
at a particular rate. For example, in some embodiments, ethanol is
produced at a rate of at least about 0.1 mg per hour per liter, at
least about 0.25 mg per hour per liter, at least about 0.5 mg per
hour per liter, at least about 0.75 mg per hour per liter, at least
about 1.0 mg per hour per liter, at least about 2.0 mg per hour per
liter, at least about 5.0 mg per hour per liter, at least about 10
mg per hour per liter, at least about 15 mg per hour per liter, at
least about 20.0 mg per hour per liter, at least about 25 mg per
hour per liter, at least about 30 mg per hour per liter, at least
about 50 mg per hour per liter, at least about 100 mg per hour per
liter, at least about 200 mg per hour per liter, or at least about
500 mg per hour per liter.
[0314] In some embodiments, the host cells of the present invention
can produce ethanol at a rate of at least about 0.1 mg per hour per
liter, at least about 0.25 mg per hour per liter, at least about
0.5 mg per hour per liter, at least about 0.75 mg per hour per
liter, at least about 1.0 mg per hour per liter, at least about 2.0
mg per hour per liter, at least about 5.0 mg per hour per liter, at
least about 10 mg per hour per liter, at least about 15 mg per hour
per liter, at least about 20.0 mg per hour per liter, at least
about 25 mg per hour per liter, at least about 30 mg per hour per
liter, at least about 50 mg per hour per liter, at least about 100
mg per hour per liter, at least about 200 mg per hour per liter, or
at least about 500 mg per hour per liter more than a control strain
(lacking heterologous biomass feedstock hydrolyzing enzymes) and
grown under the same conditions. In some embodiments, the ethanol
can be produced in the absence of any externally added
saccharolytic enzymes.
[0315] Ethanol production can be measured using any method known in
the art. For example, the quantity of ethanol in fermentation
samples can be assessed using HPLC analysis. Many ethanol assay
kits are commercially available that use, for example, alcohol
oxidase enzyme based assays. Methods of determining ethanol
production are within the scope of those skilled in the art from
the teachings herein.
Synergistic Activity of Sacchcarolytic Enzymes
[0316] In some embodiments, the expression of two or more enzymes
of the present invention results in synergistic enzymatic activity
with respect to substrate digestion. For example, the presence of
two distinct paralogs or orthologs containing the same enzymatic
activity can significantly enhance the digestion of a substrate
compared to a comparable amount of either enzyme by itself.
Alternatively, synergistically acting enzymes do not need to have
exactly identical chemical activity, but can still operate to
liberate sugars in a capacity greater than either is capable of
individually. Without wishing to be bound by a particular theory,
it is thought that although the catalytic activity of the enzymes
can be the same, the different characteristics of the enzymes with
respect to the regions surrounding the chemical substrate as well
as other differing properties of the enzymes aid in digesting the
varied biomass feedstock components. In some embodiments, enzymatic
synergy allows biomass feedstock digestion and fermentation to take
place using reduced amounts of external saccharolytic enzymes. In
some embodiments, the two or more enzymes acting synergistically
are endoglucanases, glucosidases, cellobiohydrolases, xylanases,
glucanases, xylosidases, xylan esterases, arabinofuranosidases,
galactosidases, cellobiose phosphorylases, cellodextrin
phosphorylases, mannanases, mannosidases, xyloglucanases,
endoxylanases, glucuronidases, acetylxylanesterases,
arabinofuranohydrolases, swollenins, glucuronyl esterases,
expansins, pectinases, feruoyl esterases, alpha-amylase,
beta-amylase, glucoamylase, pullulanase, isopullulanase,
alpha-glucosidase, beta-glucosidase, galactosidase, arabinase,
arabinoxylanase, arabinosidase, arabinofuranosidase,
arabinoxylanase, arabinosidase, arabinose isomerase,
ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase,
xylose reductase, xylose dehydrogenase, xylitol dehydrogenase,
xylonate dehydratase, xylose transketolase, and/or xylose
transaldolase as disclosed herein. In some embodiments, the two or
more enzymes acting synergistically do not have the same enzymatic
activity. In other embodiments, the two or more enzymes acting
synergistically have the same enzyme activity. In some embodiments,
the enzyme pairs acting synergistically are (Streptomyces
avermitilis endo-1,4-beta-glucanase celA2 (Accession No.
NP.sub.--823030.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 (Accession No. NP.sub.--828072.1));
(Streptomyces avermitilis endo-1,4-beta-glucanase celA2 (Accession
No. NP.sub.--823030.1) and Bacillus subtilis
endo-1,4-beta-glucanase (Accession No CAB13696.2)); (Streptomyces
avermitilis endo-1,4-beta-glucanase celA3 (Accession No.
NP.sub.--823032.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--826394.1));
(Streptomyces avermitilis endo-1,4-beta-glucanase celA4 (Accession
No. NP.sub.--823744.1) and Streptomyces avermitilis xylanase
(Accession No. NP.sub.--827548.1)); (Bacillus subtilis
endo-1,4-beta-glucanase (Accession No CAB13696.2) and Streptomyces
avermitilis endo-1,4-beta-glucanase (Accession No.
NP.sub.--826394.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA4 (Accession No. NP.sub.--823744.1) and
Bacillus subtilis endo-1,4-beta-glucanase (Accession No
CAB13696.2)); (Streptomyces avermitilis endo-1,4-beta-glucanase
celA5 (Accession No. NP.sub.--828072.1) and Streptomyces
avermitilis endo-1,4-beta-glucanase celA4 (Accession No.
NP.sub.--823744.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 (Accession No. NP.sub.--828072.1) and
Clostridium phytofermentans xylanase (Accession No.
YP.sub.--001557750.1)); (Saccharophagus degradans 2-40 mannanase
(Accession No. YP.sub.--525985.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--826394.1));
(Streptomyces avermitilis xylanase (Accession No.
NP.sub.--827548.1) and Saccharophagus degradans 2-40 mannanase
(Accession No. YP.sub.--525985.1)); (Clostridium phytofermentans
xylanase (Accession No. YP.sub.--001557750.1) and Streptomyces
avermitilis xylanase (Accession No. NP.sub.--827548.1));
(Clostridium phytofermentans xylanase (Accession No.
YP.sub.--001557750.1) and Streptomyces avermitilis xylanase
(Accession No. NP.sub.--827548.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA5 (Accession No. NP.sub.--828072.1) and
Streptomyces avermitilis xylanase (Accession No.
NP.sub.--827548.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--823744.1) and
Saccharophagus degradans 2-40 mannanase (Accession No.
YP.sub.--525985.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase celA2 (Accession No. NP.sub.--823030.1) and
Saccharophagus degradans 2-40 mannanase (Accession No.
YP.sub.--525985.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--823744.1) and
Streptomyces avermitilis endo-1,4-beta-glucanase celA3 (Accession
No. NP.sub.--823032.1)); (Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--823744.1) and
Clostridium phytofermentans xylanase (Accession No.
YP.sub.--001557750.1)); (Streptomyces avermitilis xylanase
(Accession No. NP.sub.--827548.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase celA3 (Accession No. NP.sub.--823032.1));
or (Streptomyces avermitilis endo-1,4-beta-glucanase celA4
(Accession No. NP.sub.--823744.1) and Streptomyces avermitilis
endo-1,4-beta-glucanase (Accession No. NP.sub.--826394.1)); (SEQ ID
NO: 443 and SEQ ID NO: 444); (SEQ ID NO: 443 and SEQ ID NO: 445);
(SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID NO: 443 and SEQ ID NO:
445); (SEQ ID NO: 442 and SEQ ID NO: 445); (SEQ ID NO: 444 and
Bacillus subtilis arabinoxylanase (Accession No. CAB13699.1)); (SEQ
ID NO: 444 and Bacillus subtilis arabinoxylanase (Accession No.
CAB13699.1)); (SEQ ID NO: 444 and Bacillus subtilis arabinan
endo-1,5-alpha-L-arabinosidase (Accession No. CAB15969.1)); (SEQ ID
NO: 444 and Bacillus subtilis arabinan-endo 1,5-alpha-L-arabinase
(Accession No. CAA99586.1)); (SEQ ID NO: 444 and Bacillus subtilis
arabinan endo-1,5-alpha-L-arabinosidase (Accession No. AL009126));
(SEQ ID NO: 444 and Bacillus subtilis endo-arabinase (Accession No.
D85132)); (SEQ ID NO: 444 and Clostridium phytofermentans
arabinogalactan endo-1,4-beta-galactosidase (Accession No.
CP000885)); (SEQ ID NO: 444 and Bacillus licheniformis
arabinan-endo 1,5-alpha-L-arabinase (Accession No. AAU40201.1);
(SEQ ID NO: 444 and Bacillus licheniformis arabinan-endo
1,5-alpha-L-arabinase (Accession No. AAU41895.1); (SEQ ID NO: 444
and Bacillus licheniformis arabinogalactan
endo-1,4-beta-galactosidase (Accession No. AAU43089.1); (SEQ ID NO:
444 and Bacillus licheniformis arabinan
endo-1,5-alpha-L-arabinosidase (Accession No. AAU43033.1); (SEQ ID
NO: 444 and Bacillus licheniformis arabinan endo-1,4-beta-xylanase
(Accession No. AAU39947.1); (SEQ ID NO: 444 and
Thermoanaerobacterium saccharolyticum arabinogalactan
endo-1,4-beta-galactosidase; (SEQ ID NO: 444 and
Thermoanaerobacterium saccharolyticum alpha-N-arabinofuranosidase);
(SEQ ID NO: 444 and Streptomyces avermitilis endo-1,4-beta-xylanase
xynD (Accession No. 827557.1); (SEQ ID NO: 444 and Bacillus
subtilis endo-1,4-beta-xylanase xynA (Accession No. CAB13776.1);
(SEQ ID NO: 444 and Clostridium phytofermentans xylanase (Accession
No. YP.sub.--001558623.1); (SEQ ID NO: 444 and Clostridium
phytofermentans xylanase (Accession No. YP.sub.--001557750.1); (SEQ
ID NO: 444 and Thermobifida fusca endo-1,4-beta-D-xylanase (xyl11)
(Accession No. AAV64879.1); (SEQ ID NO: 444 and Clostridium
thermocellum xylanase (Accession No. YP.sub.--001038519.1); (SEQ ID
NO: 444 and Clostridium stercorarium endo-xylanase (Accession No.
CAD48307); (SEQ ID NO: 444 and Clostridium stercorarium xynC
(CelX--celloxylanase) (Accession No. CAD48314); (SEQ ID NO: 444 and
Aspergillus niger alpha-glucosidase (Accession No. BAA23616.1));
(SEQ ID NO: 444 and Thermoanaerobacterium saccharolyticum
glucoamylase).
[0317] In other embodiments, the enzyme triplets acting
synergistically include, but are not limited to (SEQ ID NO: 442,
SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID NO: 444, SEQ ID NO: 445
and SEQ ID NO: 446); or (SEQ ID NO: 442, SEQ ID NO: 445 and SEQ ID
NO: 446).
[0318] In yet other embodiments, the enzyme combinations acting
synergistically include, but are not limited to (SEQ ID NO: 442,
SEQ ID NO: 444, SEQ ID NO: 445 and SEQ ID NO: 446); (SEQ ID NO:
443, SEQ ID NO: 444, SEQ ID NO: 445 and SEQ ID NO: 446).
[0319] In other embodiments, enzymatic synergy may be achieved by
expressing 3, 4, 5, 6, or 7 or more enzymes with the same catalytic
activity. In one embodiment, two or more enzymes acting
synergistically with same enzymatic activity include, but are not
limited to (SEQ ID NO: 444 and SEQ ID NO: 444); (SEQ ID NO: 445 and
SEQ ID NO: 445).
Glycerol Reduction
[0320] Anaerobic growth conditions require the production of
endogenouse electron acceptors, such as the coenzyme nicotinamide
adenine dinucleotide (NAD.sup.+). In cellular redox reactions, the
NAD.sup.+/NADH couple plays a vital role as a reservoir and carrier
of reducing equivalents. Ansell, R., et al., EMBO J. 16:2179-87
(1997). Cellular glycerol production, which generates an NAD.sup.+,
serves as a redox valve to remove excess reducing power during
anaerobic fermentation in yeast. Glycerol production is, however,
an energetically wasteful process that expends ATP and results in
the loss of a reduced three-carbon compound. Ansell, R., et al.,
EMBO J. 16:2179-87 (1997). To generate glycerol from a starting
glucose molecule, glycerol 3-phosphate dehydrogenase (GPD) reduces
dihydroxyacetone phosphate to glycerol 3-phosphate and glycerol
3-phosphatase (GPP) dephosphorylates glycerol 3-phosphate to
glycerol. Despite being energetically wasteful, glycerol production
is a necessary metabolic process for anaerobic growth as deleting
GPD activity completely inhibits growth under anaeroblic
conditions. See Ansell, R., et al., EMBO J. 16:2179-87 (1997).
[0321] GPD is encoded by two isogenes, gpd1 and gpd2. GPD1 encodes
the major isoform in anaerobically growing cells, while GPD2 is
required for glycerol production in the absence of oxygen, which
stimulates its expression. Pahlman, A-K., et al., J. Biol. Chem.
276:3555-63 (2001). The first step in the conversion of
dihydroxyacetone phosphate to glycerol by GPD is rate controlling.
Guo, Z. P., et al., Metab. Eng. 13:49-59 (2011). GPP is also
encoded by two isogenes, gpp1 and gpp2. The deletion of GPP genes
arrests growth when shifted to anaerobic conditions, demonstrating
that GPP is important for cellular tolerance to osmotic and
anaerobic stress. See Pahlman, A-K., et al., J. Biol. Chem.
276:3555-63 (2001).
[0322] Because glycerol is a major by-product of anaerobic
production of ethanol, many efforts have been made to delete
cellular production of glycerol. However, because of the reducing
equivalents produced by glycerol synthesis, deletion of the
glycerol synthesis pathway cannot be done without compensating for
this valuable metabolic function. Attempts to delete glycerol
production and engineer alternate electron acceptors have been
made. Liden, G., et al., Appl. Env. Microbiol. 62:3894-96 (1996);
Medina, V. G., et al., Appl. Env. Microbiol. 76:190-195 (2010).
Liden and Medina both deleted the gpd1 and gpd2 genes and attempted
to bypass glycerol formation using additional carbon sources. Liden
engineered a xylose reductase from Pichia stipitis into an S.
cerevisiae gpd1/2 deletion strain. The xylose reductase activity
facilitated the anaerobic growth of the glycerol-deleted strain in
the presence of xylose. See Liden, G., et al., Appl. Env.
Microbiol. 62:3894-96 (1996). Medina engineered an acetylaldehyde
dehydrogenase, mhpF, from E. coli into an S. cerevisiae gpd1/2
deletion strain to convert acetyl-CoA to acetaldehyde. The
acetylaldehyde dehydrogenase activity facilitated the anaerobic
growth of the glycerol-deletion strain in the presence of acetic
acid but not in the presence of glucose as the sole source of
carbon. Medina, V. G., et al., Appl. Env. Microbiol. 76:190-195
(2010); see also EP 2277989. Medina noted several issues with the
mhpF-containing strain that needed to be addressed before
implementing industrially, including significantly reduced growth
and product formation rates than yeast comprising GPD1 and
GPD2.
[0323] Additional attempts to redirect flux from glycerol to
ethanol have included the engineering of a non-phosphorylating
NADP+-dependent glyceraldehydes-3-phosphate dehydrogenase (GAPN)
into yeast, either with or without the simultaneous knockout of
GPD1. Bro, C., et al., Metab. Eng. 8:102-111 (2006); U.S. Patent
Appl. Pub. No. US2006/0257983; Guo, Z. P., et al., Metab. Eng.
13:49-59 (2011). However, other cellular mechanisms exist to
control the production and accumulation of glycerol, including
glycerol exporters such as FPS1, that do not require the
engineering of alternate NADP+/NADPH coupling or deletion of
glycerol synthesis genes. Tamas, M. J., et al., Mol. Microbiol.
31:1087-1004 (1999).
[0324] FPS1 is a channel protein located in the plasma membrane
that controls the accumulation and release of glycerol in yeast
osmoregulation. Null mutants of this strain accumulate large
amounts of intracellular glycerol, grow much slower than wild-type,
and consume the sugar substrate at a slower rate. Tamas, M. J., et
al., Mol. Microbiol. 31:1087-1004 (1999). Despite slower growth
under anaerobic conditions, an fps1.DELTA. strain can serve as an
alternative to eliminating NAD.sup.+-dependant glycerol activity.
An fps1.DELTA. strain has reduced glycerol formation yet has a
completely functional NAD.sup.+-dependant glycerol synthesis
pathway. Alternatively, rather than deleting endogenous FPS1,
constitutively active mutants of FPS 1 or homologs from other
organisms can be used to regulate glycerol synthesis while keep the
NAD.sup.+-dependant glycerol activity intact. In embodiments of the
invention that modulate FPS1, the recombinant host cells can still
synthesize and retain glycerol and achieve improved robustness
relative to strains that are unable to make glycerol.
[0325] In one embodiment, one or more endogenous glycerol-producing
or regulating genes are deleted to create yeast strains with
altered glycerol production. In another embodiment, one or more
endogenous glycerol-producing genes are downregulated to create
yeast strains with altered glycerol production. In still another
embodiment, one or more endogenous glycerol-regulating genes are
downregulated to create yeast strains with altered glycerol
production. In yet another embodiment, one or more endogenous
glycerol-regulating genes are downregulated to create yeast strains
with altered glycerol production. In one embodiment, glycerol
production in such yeast strains is downregulated in comparison
with wild type yeast cell.
Pyruvate Formate Lyase (PFL)
[0326] The conversion of the pyruvate to acetyl-CoA and formate is
performed by pyruvate formate lyase (PFL). In E. coli, PFL is the
primary enzyme responsible for the production of formate. PFL is a
dimer of PflB that requires the activating enzyme PflAE, which is
encoded by pflA, radical S-adenosylmethionine, and a single
electron donor. See Waks, Z., and Silver, P. A., Appl. Env.
Microbiol. 75:1867-1875 (2009). Waks and Silver engineered strains
of S. cerevisiae to secrete formate by the addition of PFL and AdhE
from E. coli and deletion of endogenous formate dehydrogenases and
to produce hydrogen in a two-step process using E. coli. Waks and
Silver, however, did not combine formate production with the
removal of glycerol formation, and the use of formate as an
alternate electron acceptor for the reduction of glycerol was not
proposed or evaluated.
[0327] PFL enzymes for use in the recombinant host cells of the
invention can come from a bacterial or eukaryotic source. Examples
of bacterial PFL include, but are not limited to, Bacillus
licheniformis DSM13, Bacillus licheniformis ATCC14580,
Streptococcus thermophilus CNRZ1066, Streptococcus thermophilus
LMG18311, Streptococcus thermophilus LMD-9, Lactobacillus plantarum
WCFS1 (Gene Accession No. lp.sub.--2598), Lactobacillus plantarum
WCFS1 (Gene Accession No. lp.sub.--3313), Lactobacillus plantarum
JDM1 (Gene Accession No. JDM1.sub.--2695), Lactobacillus plantarum
JDM1 (Gene Accession No. JDM1.sub.--2087), Lactobacillus casei
bl23, Lactobacillus casei ATCC 334, Bifidobacterium adolescentis,
Bifidobacterium longum NCC2705, Bifidobacterium longum DJ010A,
Bifidobacterium animalis DSM 10140, Clostridium cellulolyticum, or
Escherichia coli. Additional PFL enzymes may be from the PFL1
family, the RNR pfl superfamily, or the PFL2 superfamily.
[0328] Examples of eukaryotic PFL include, but are not limited to,
Chlamydomonas reinhardtii PflA1, Piromyces sp. E2, or
Neocallimastix frontalis, Acetabularia acetabulum, Haematococcus
pluvialis, Volvox carteri, Ostreococcus tauri, Ostreococcus
lucimarinus, Micromonas pusilla, Micromonas sp., Porphyra
haitanensis, and Cyanophora paradoxa), an opisthokont (Amoebidium
parasiticum), an amoebozoan (Mastigamoeba balamuthi), a
stramenopile (Thalassiosira pseudonana (2)) and a haptophyte
(Prymnesium parvum), M. pusilla, Micromonas sp. O. tauri and O.
lucimarinus) an amoebozoan (M. balamuthi), and a stramenopile (T.
pseudonana). See Stairs, C. W., et al., "Eukaryotic pyruvate
formate lyase and its activating enzyme were acquired laterally
from a firmicute," Mol. Biol. and Evol., published on-line on Feb.
3, 2011, at http://mbe.oxfordjournals.org/.
Acetaldehyde/Alcohol Dehydrogenases
[0329] Engineering of acetaldehyde dehydrogenases, alcohol
dehydrogenases, and/or bifunctional acetylaldehyde/alcohol
dehydrogenases into a cell can increase the production of ethanol.
However, because the production of ethanol is redox neutral, an
acetaldehyde/alcohol dehydrogenase activity cannot serve as an
alternative for the redox balancing that the production of glycerol
provides to a cell in anaerobic metabolism. When Medina attempted
to express an acetylaldehyde dehydrogenase, mhpF, from E. coli in
an S. cerevisiae gpd1/2 deletion strain, the strain did not grow
under anaerobic conditions in the presence of glucose as the sole
source of carbon. Medina, V. G., et al., Appl. Env. Microbial.
76:190-195 (2010); see also EP 2277989. Rather, the anaerobic
growth of the glycerol-deletion strain required the presence of
acetic acid. However, an acetylaldehyde dehydrogenase has not been
expressed in combination with PFL or with the recombinant host
cells of the invention. Additionally, replacing the endogenous
acetylaldehyde dehydrogenase activity with either an improved
acetaldehyde dehydrogenase or using a bifunctional
acetaldehyde/alcohol dehydrogenase (AADH) can positively affect the
in vivo kinetics of the reaction providing for improved growth of
the host strain.
Improving Conversion of acetyl-CoA to Ethanol
[0330] To improve the conversion of acetyl-CoA to ethanol,
endogenous yeast genes can be replaced or complimented with either
an improved acetaldehyde dehydrogenase from C. phytofermentans or
other source) to convert acetyl-CoA to acetaldehyde, or a
bifunctional acetaldehyde/alcohol dehydrogenase (AADH) to convert
acetyl-CoA to acetaldehyde and acetaldehyde to ethanol. By
engineering in one or more such enzymes, the in vivo kinetics of
the conversion of acetyl-CoA to ethanol can be increased, providing
for improved growth of the host strain. The bi-functional
alcohol/aldehyde dehydrogenase can come from a variety of microbial
sources, including but not limited to E. coli, C. acetobutylicum,
T. saccharolyticum, C. thermocellum, C. phytofermentans, Piromyces
SP E2, or Bididobacterium adolescentis.
[0331] When glycerol deletion strains are grown anaerobically, they
are not capable of growth or fermentation and cannot consume sugar
during glycolysis. However, if these glycerol deletion strains are
complemented with an AADH, the strains are able to grow with the
supplementation of acetate in the media.
[0332] AADH enzymes for use in the recombinant host cells of the
invention can come from a bacterial or eukaryotic source. Examples
of bacterial AADH include, but are not limited to, Clostridium
phytofermentans, Escherichia coli, Bacillus coagulans, Bacillus
lentus, Bacillus licheniformis, Bacillus pumilus, Bacillus
subtilis, Bacteroides amylophilus, Bacteroides capillosus,
Bacteroides ruminocola, Bacteroides suis, Bifidobacterium
adolescentis, Bifidobacterium animalis, Bifidobacterium bifidum,
Bifidobacterium infantis, Bifidobacterium longum, Bifidobacterium
thermophiiutn, Lactobacillus acidophilus, Lactobacillus brevis,
Lactobacillus buchneri (cattle only), Lactobacillus bulgaricus,
Lactobacillus casei, Lactobacillus cellobiosus, Lactobacillus
curvatus, Lactobacillus delbruekii, Lactobacillus farciminis (swine
only), Lactobacillus fermentum, Lactobacillus helveticus,
Lactobacillus laetis, Lactobacillus plantarum, Lactobacillus
reuterii, Leuconostoc mesenteroides, Pediococcus acidilacticii,
Pediococcus pentosaceus, Propionibacterium acidpropionici (cattle
only), Propionibacterium freudenreichii, Propionibacterium
shermanii, Enterococcus cremoris, Enterococcus diacetylactis,
Enterococcus faecium, Enterococcus intermedius, Enterococcus
lactis, or Enterococcus thermophiles.
Xylose Metabolism
[0333] Xylose is a five-carbon monosaccharide that can be
metabolized into useful products by a variety of organisms. There
are two main pathways of xylose metabolism, each unique in the
characteristic enzymes they utilize. One pathway is called the
"Xylose Reductase-Xylitol Dehydrogenase" or XR-XDH pathway. Xylose
reductase (XR) and xylitol dehydrogenase (XDH) are the two main
enzymes used in this method of xylose degradation. XR, encoded by
the XYL1 gene, is responsible for the reduction of xylose to
xylitol and is aided by cofactors NADH or NADPH. Xylitol is then
oxidized to xylulose by XDH, which is expressed through the XYL2
gene, and accomplished exclusively with the cofactor NAD.sup.+.
Because of the varying cofbctors needed in this pathway and the
degree to which they are available for usage, an imbalance can
result in an overproduction of xylitol byproduct and an inefficient
production of desirable ethanol. Varying expression of the XR and
XDH enzyme levels have been tested in the laboratory in the attempt
to optimize the efficiency of the xylose metabolism pathway.
[0334] The other pathway for xylose metabolism is called the
"Xylose Isomerase" (XI) pathway. Enzyme XI is responsible for
direct conversion of xylose into xylulose, and does not proceed via
a xylitol intermediate. Both pathways create xylulose, although the
enzymes utilized are different. After production of xylulose both
the XR-XDH and XI pathways proceed through the enzyme xylulokinase
(XK), encoded on gene XKS1, to further modify xylulose into
xylulose-5-phosphate where it then enters the pentose phosphate
pathway for further catabolism.
[0335] Studies on flux through the pentose phosphate pathway during
xylose metabolism have revealed that limiting the speed of this
step may be beneficial to the efficiency of fermentation to
ethanol. Modifications to this flux that may improve ethanol
production include a) lowering phosphoglucose isomerase activity,
b) deleting the GND1 gene, and c) deleting the ZWF1 gene (Jeppsson
et al., Appl. Environ. Microbial. 68:1604-09 (2002)). Since the
pentose phosphate pathway produces additional NADPH during
metabolism, limiting this step will help to correct the already
evident imbalance between NAD(P)H and NAD.sup.+cofactors and reduce
xylitol byproduct. Another experiment comparing the two xylose
metabolizing pathways revealed that the XI pathway was best able to
metabolize xylose to produce the greatest ethanol yield, while the
XR-XDH pathway reached a much faster rate of ethanol production
(Karhumaa et al., Microb Cell Fact. 2007 Feb. 5; 6:5). See also
International Publication No. WO2006/009434, incorporated herein by
reference in its entirety.
[0336] In some embodiments, the recombinant microorganisms of the
invention have the ability to metabolize xylose using one or more
of the above enzymes.
Arabinose Metabolism
[0337] Arabinose is a five-carbon monosaccharide that can be
metabolized into useful products by a variety of organisms.
L-Arabinose residues are found widely distributed among many
heteropolysaccharides of different plant tissues, such as
arabinans, arabinogalactans, xylans and arabinoxylans. Bacillus
species in the soil participate in the early stages of plant
material decomposition, and B. subtilis secretes three enzymes, an
endo-arabanase and two arabinosidases, capable of releasing
arabinosyl oligomers and L-abinose from plant cell.
[0338] Three pathways for L-arabinose metabolism in microorganisms
have been described. Many bacteria, including Escherichia coli, use
arabinose isomerase (AraA; E.C. 5.3.1.4), ribulokinase (AraB; E.C.
2.7.1.16), and ribulose phosphate epimerase (AraD; E.C. 5.1.3.4) to
sequentially convert L-arabinose to D-xylulose-5-phosphate through
L-ribulose and L-ribulose 5-phosphate. See, e.g., Sa-Nogueira I, et
al., Microbiology 143:957-69 (1997). The D-xylulose-5-phosphate
then enters the pentose phosphate pathway for further catabolism.
In the second pathway, L-arabinose is converted to
L-2-keto-3-deoxyarabonate (L-KDA) by the consecutive action of
enzymes arabinose dehydrogenase (ADH), arabinolactone (AL), and
arabinonate dehydratase (AraC). See, e.g., Watanabe, S, et al., J.
Biol. Chem. 281: 2612-2623 (2006). L-KDA can be further metabolized
in two alternative pathways: 1) L-KDA conversion to 2-ketoglutarate
via 2-ketoglutaric semialdehyde (KGSA) by L-KDA dehydratase and
KGSA dehydrogenase or 2) L-KDA conversion to pyruvate and
glycolaldehyde by L-KDA aldolase. In the third, fungal pathway,
L-arabinose is converted to D-xylulose-5-phosphate through
L-arabinitol, L-xylulose, and xylitol, by enzymes such as
NAD(P)H-dependent aldose reductase (AR), L-arabinitol
4-dehydrogenase (ALDH), L-xylulose reductase (LXR), xylitol
dehydrogenase (XylD), and xylulokinase (XylB). These, and
additional proteins involved in arabinose metabolism and regulation
may be found at
http://www.nmpdr.org/FIG/wiki/rest.cgi/NmpdrPlugin/SeedViewer?page=Subsys-
tems;subsystem=L-Arabinose utilization, visited Mar. 21, 2011,
which is incorporated by reference herein in its entirety.
[0339] AraC protein regulates expression of its own synthesis and
the other genes of the Ara system. See Schleif, R., Trends Genet.
16(12):559-65 (2000). In the E. coli, the AraC protein positively
and negatively regulates expression of the proteins required for
the uptake and catabolism of the sugar L-arabinose. Homologs of
AraC, such as regulatory proteins RhaR and RhaS of the rhamnose
operon, have been identified that contain regions homologous to the
DNA-binding domain of AraC (Leal, T. F. and de Sa-Nogueira, I.,
FEMS Microbiol Lett. 241(1):41-48 (2004)). Such arabinose
regulatory proteins are referred to as the AraC/XylS family. See
also, Mota, L. J., et al., Mol. Microbiol. 33(3):476-89 (1999);
Mota, L. J., et al., J Bacteriol. 183(14):4190-261 (2001).
[0340] In E. coli, the transport of L-arabinose across the E. coli
cytoplasmic membrane requires the expression of either the
high-affinity transport operon, araFGH, a binding protein-dependent
system on the low-affinity transport operon, araE, a proton
symporter. Additional arabinose transporters include those
identified from K. marxianus and P. guilliermondii, disclosed. in
U.S. Pat. No. 7,846,712, which is incorporated by reference
herein.
[0341] In some embodiments, the recombinant microorganisms of the
invention have the ability to metabolize arabinose using one or
more of the above enzymes.
[0342] The following embodiments of the invention will now be
described in more detail by way of these non-limiting Examples.
EXAMPLES
Example 1
Expression of Fungal Lignocellulase System Components in Yeast
[0343] In order to generate strains expressing these various
enzymes, and in anticipation of co-expressing them, several
promoter and terminator pairs were created to use as expression
vectors. The promoter terminator pairs, and the enzyme types that
were tested under their control are listed in Table 3. Genes
encoding various enzyme activities were cloned into vector pMU1531
by standard molecular biology procedures (See e.g. Maniatis,
"Molecular Cloning" Cold Spring Harbor Press). FIG. 2 gives a
schematic of pMU1531 which was the backbone cloning vector used.
This vector contains the ENO1 promoter and terminator from S.
cerevisiae and the URA3 and zeocin markers for use in yeast. It was
subsequently modified to have the various promoter/terminator
combinations listed in Table 3.
TABLE-US-00006 TABLE 3 Promoters and terminators used for
expression of fungal and bacterial genes. # Promoter Terminator
Genes expressed 1 ENO1 ENO1 EG1, EG2, EG3, xylanase (GH11 and
GH10), xylosidase (GH43, GH3), complete bacterial library 2 ENO1
PYK1 EG1 3 ADH1 PDC1 fungal GH10 xylanase, Cy Xyl10 (bacterial) 4
ADH2 CYC1 Beta-mannase, GH11 xylanase 5 ENO2 TDH3 EG6 6 FBA1 PGI1
EG4 7 GPM1 TPI1 EG5 8 HXT7 PMA1 GH3 xylosidase, CIP1 9 PDC1 ENO2
TfCel9A, GH74 xyloglucanase 10 PGI1 HXT7 GH10 xylanase 11 PMA1 ADH1
EG2, 12 TDH3 GPM1 GH43 xylosidase 13 TPI1 FBA1 EG3 14 HXT2 ACT1
GH27 (AGLI) 15 PFK1 HXT2 CE1 (AXE) 16 HXT3 PFK1 GH62 (AXH) 17 PFK2
HXT3 CE1 (FAEA) 18 PYK1 PFK2 CE1 (FAEB) 19 TEF1 ADH2 SWO 20 ADH3
TEF1 GH2 (beta-mannosidase) 21 TEF2 ADH3 GH67 (alpha-glucuronidase)
22 GND1 TEF2 CIP2 23 ACT1 GND1 GH54 (ABF1) 24 TAL1 SOL1
alpha-expansin 25 TKL1 ADH5 beta-expansin
TABLE-US-00007 TABLE 4 Fungal enzyme system components expressed in
yeast. Cazy family/ enzyme type/ synonym Activity Organism
Accession # Strain # Plasmid # GH7B (EG1) Endoglucanase Aspergillus
XP_747897 M1311 pMU1626 fumigatus GH7B (EG1) Endoglucanase
Neosartorya XP_001257357 M1312 pMU1627 fischeri GH7B (EG1)
Endoglucanase Aspergillus XP_001270378 M1313 pMU1628 clavatus GH7B
(EG1) Endoglucanase Aspergillus XP_001217291 M1270 pMU1561 terreus
GH7B (EG1) Endoglucanase Trichoderma ACZ34302 M1317 pMU1632
longibrachiatum GH7B (EG1) Endoglucanase Penicillium XP_002152969
M1318 pMU1633 marneffei GH7B (EG1) Endoglucanase Chaetomium
XP_001229968 M1310 pMU1625 globosum GH7B (EG1) Endoglucanase
Neurospora XP_956431 M1271 pMU1562 crassa GH7B (EG1) Endoglucanase
Aspergillus oryzae BAA22589 M1314 pMU1629 GH7B (EG1) Endoglucanase
Thielavia AAE25067 M1315 pMU1630 heterothallica GH7B (EG1)
Endoglucanase Fusarium AAG09047 M1272 pMU1563 oxysporum GH7B (EG1)
Endoglucanase Humicola insolens 1DYM_A M1316 pMU1631 GH7B (EG1)
Endoglucanase Pyrenophora XP_001935476 M1319 pMU1634
tritici-repentis GH7B (EG1) Endoglucanase Magnaporthe XP_370166
M1273 pMU1564 grisea GH7B (EG1) Endoglucanase Fusarium XP_388429
M1274 pMU1565 graminearum GH7B (EG1) Endoglucanase Hypocrea P07981
M1276 pMU1574 jecorina GH5 (EG2) Endoglucanase Hypocrea P07982
M1138 pMU1400 jecorina GH5 (EG2) Endoglucanase Chrysosporium RDH160
pRDH160 lucknowense GH5 (EG2) Endoglucanase Polyporus BAF75943.1
RDH163 pRDH163 arcularius GH5 (EG2) Endoglucanase Aspergillus
BAB62317.1 RDH145 pRDH145 kawachii GH5 (EG2) Endoglucanase
Heterodera CAC12958.1 RDH146 pRDH146 schachtii GH5 (EG2)
Endoglucanase Orpinomyces sp. AAD04193.1 RDH148 pRDH148 GH5 (EG2)
Endoglucanase Irpex lacteus BAD67544.1 RDH149 pRDH149 GH5 (EG2)
Endoglucanase Chaetomium XP_001220409.1 RDH159 pRDH159 globosum GH5
(EG2) Endoglucanase Aspergillus niger XP_001397982.1 RDH161 pRDH161
GH5 (EG2) Endoglucanase Penicillium ABY28340.1 RDH162 pRDH162
decumbens GH12A Endoglucanase Trichoderma BAA20140 RDH164 pRDH164
(EG3) reesei GH12A Endoglucanase Phanerochaete AAU12276 RDH167
pRDH167 (EG3) chrysosporium GH12A Endoglucanase Stachybotrys
AAM77710 RDH165 pRDH165 (EG3) echinata GH12A Endoglucanase
Neosartorya XP_001261563 RDH166 pRDH166 (EG3) fischeri GH12A
Endoglucanase Chaetomium AAM77701 RDH168 pRDH168 (EG3) brasiliense
GH61A Endoglucanase Chaetomium EAQ86340 M1391 pMU1746 (EG4)
globosum GH61A Endoglucanase Aspergillus CAF31975 M1392 pMU1747
(EG4) fumigatus GH61A Endoglucanase Humicola insolens CAG27577
M1393 pMU1748 (EG4) GH61A Endoglucanase Neosartorya XP_001267517
M1394 pMU1749 (EG4) fischeri GH61A Endoglucanase Thielavia ACE10231
M1418 pMU1779 (EG4) terrestris GH45A Endoglucanase Chrysosporium
ACH15008 M1395 pMU1750 (EG5) lucknowense GH45A Endoglucanase
Chaetomium XP_001226436 M1420 pMU1753 (EG5) globosum GH45A
Endoglucanase Acremonium ACE10216 M1421 YML only (EG5) thermophilum
GH45A Endoglucanase Humicola insolens CAB42307 M1396 pMU1751 (EG5)
GH45A Endoglucanase Thielavia CAH03187 M1418 pMU1779 (EG5)
terrestris GH6 (EG6) Endoglucanase Chrysosporium AAQ38151 M1422 YML
only lucknowense GH6 (EG6) Endoglucanase Magnaporthe EDJ97375 M1397
pMU1752 grisea GH6 (EG6) Endoglucanase Chaetomium EAQ84577 M1398
pMU1753 globosum GH6 (EG6) Endoglucanase Humicola insolens 1DYS_B
M1399 pMU1754 GH6 (EG6) Endoglucanase Neurospera XP_957415 M1400
pMU1755 crassa GH74A Xyloglucanase Trichoderma AAP57752 M1423 YML
only (EGL6) reesei GH74A Xyloglucanase Aspergillus niger AAK77227
M1424 YML only (EGL6) GH74A Xyloglucanase Aspergillus BAA29031
M1425 YML only (EGL6) aculeatus GH74A Xyloglucanase Neosartorya
XP_001261776 M1426 YML only (EGL6) fischeri GH11 Endoxylanase
Chaetomium CAD48749 RDH170 pRDH170 thermophilum GH11 Endoxylanase
Trichoderma ABK59833 RDH169 pRDH169 reesei (synthetic version) GH11
Endoxylanase Trichoderma ABK59833 RDH182 pRDH182 reesei (native
version) GH10 Endoxylanase Chrysosporium AAQ38147 RDH183 pRDH183
lucknowense GH10 Endoxylanase Aureobasidium BAE71410 RDH171 pRDH171
pullulans GH3 beta-xylosidase Aspergillus niger XP_001389416 RDH181
pRDH181 GH3 beta-xylosidase Aspergillus CAA73902 RDH179 pRDH179
nidulans GH43 beta-xylosidase Cochliobolus AAC67554 RDH175 pRDH175
(BXL1) carbonum GH43 beta-xylosidase Penicillium BAC75546 RDH176
pRDH176 (BXL1) herquei GH43 beta-xylosidase Pyrenophora
XP_001940956 RDH177 pRDH177 (BXL1) tritici-repentis MAN1
beta-mannase Aspergillus AAA67426 pMU1903 (endo-enzyme) aculeatus
GH2 beta- Aspergillus niger Q9UUZ3 M1491 pMU1912 mannosidase
(exo-enzyme) GH2 beta- Aspergillus BAA29029 M1492 pMU1913
mannosidase aculeatus (exo-enzyme) GH2 beta- Neosartorya
XP_001258000 M1493 pMU1914 mannosidase fischeri (exo-enzyme) GH67
alpha- Trichoderma CAA92949 M1494 pMU1915 glucuronidase reesei GH67
alpha- Aspergillus niger CAC38119 M1547 YML only glucuronidase GH67
alpha- Talaromyces AAL33576 M1549 YML only glucuronidase emersonii
CE1 (AXE) acetylxylanesterase Aspergillus niger XP_001395572 M1513
pMU1933 CE1 (AXE) acetylxylanesterase Trichoderma Q99034 M1512
pMU1932 reesei CE1 (AXE) acetylxylanesterase Neosartorya
XP_001262186 M1514 pMU1934 fischeri GH27 (AGLI) alpha- Trichoderma
CAA93244 M1550 YML only galactosidase reesei (AGLI) GH54
arabinofuranosidase Aspergillus niger AAA93264 M1511 pMU1930 (ABF1)
GH62 (ABF2, arabinofuranosidase, Trichoderma AAP57750 M1483 pMU1904
AXHA) 1,4-beta- reesei D-arabinoxylan arabinofuranohydrolase GH62
(ABF2, arabinofuranosidase, Chaetomium XP_001223478 M1479 pMU1885
AXHA) 1,4-beta- globosum D-arabinoxylan arabinofuranohydrolase GH62
(ABF2, arabinofuranosidase, Aspergillus niger XP_001389998 M1481
pMU1890 AXHA) 1,4-beta- D-arabinoxylan arabinofuranohydrolase SWO
Swollenin Penicillium ACH57439 M1471 pMU1876 (expansin) decumbens
SWO Swollenin Neosartorya XP_001257521 M1472 pMU1877 (expansin)
fischeri SWO Swollenin Talaromyces EED19018 M1473 pMU1878
(expansin) stipitatus SWO Swollenin Trichoderma CAB92328 M1515
pMU1931 (expansin) reesei CIP1 Unknown Trichoderma AAP57751 M1484
pMU1905 reesei CIP1 Unknown Chaetomium XP_001228455 M1485 pMU1906
globosum CIP1 Unknown Magnaporthe XP_365869 M1486 pMU1907 grisea
CIP2 glucuronyl Trichoderma AAP57749 M1482 pMU1891 esterase reesei
CIP2 glucuronyl Chaetomium XP_001226041 M1474 pMU1879 esterase
globosum CIP2 glucuronyl Aspergillus XP_751313 M1480 pMU1886
esterase fumigatus alpha- alpha-expansin Populus alba BAB39482
M1488 pMU1909 expansin alpha- alpha-expansin Vitis lubrusca
BAC66697 M1487 pMU1908 expansin beta-expansin beta-expansin
Triticum aestivum AAS48881 M1490 pMU1911 beta-expansin
beta-expansin Eucalyptus AAZ08315 M1489 pMU1910 globulus CE1 (FAEA)
Feruoyl esterase Aspergillus niger XP_001393337 M1475 pMU1880
(FAEA) CE1 (FAEA) Feruoyl esterase Aspergillus XP_001211092 Please
pMU1884 (FAEA) terreus provide CE1 (FAEB) Feruoyl esterase
Talaromyces EED17739 M1476 pMU1881 (FAEB) stipitatus CE1 (FAEB)
Feruoyl esterase Chaetomium XP_001228412 M1477 pMU1882 (FAEB)
globosum
Example 2
Characterizing the Expression and Activity of Auxiliary
Cellulases
[0344] Following strain construction, strains expressing the fungal
EG1 candidates were grown in 50 mL shake flask cultures with 100
ug/mL zeocin and tested for activity on CMC and avicel. FIG. 3
demonstrates that several active EG1s were found and that several
were superior in activity to the comparable enzyme previously used
(Trichoderma reesei EG1, M1276). From these data, the top 6
candidates were selected based on activity on avicel for further
testing on PHW (FIGS. 4 and 5).
[0345] The PHW assay was carried out with a pretreated wood
substrate (MS149), both in the presence and absence of yeast made,
purified CBH1 and CBH2 (2 mg/g of each), and Novozyme 188 BGL. 2 mL
of supernatant was used from each EG1 expressing strain in the
assay. A strain expressing TrEG2 from the same plasmid was again
used as a control. The results from these assays can be found in
FIGS. 4 and 5. Several EG1s showed the ability to act with CBH 1
and CBH2 to increase hydrolysis, although not to the level that
TrEG2 is capable of. Similarly, several EG1s showed the ability to
release glucose from PHW in the presence of Novozymes 188 (a crude
beta-glucosidase preparation containing several activities beyond
BGL), and several also showed more xylose release than just the
strain background alone.
[0346] Given the strong performance of M1311 in CMC, avicel and PHW
assays, and the fact that it has a native CBD, the Aspergillus
fumigatus enzyme was chosen as the best EG1 candidate.
[0347] In order to investigate other EG2-type endoglucanases and to
investigate EG3-type endoglucanases for enhancement of current
cellulase expression configurations. The choice of additional cel5
sequences was based on sequences with relatively good homology to
the T. reesei eg2 or Aspergillus kawachii egA, the most
successfully expressed cel5 genes from the first round of testing.
The choice of cell 2 sequences to be tested was based on sequences
with relatively good homology to the T. reesei eg3 although
sequences with homology greater than 95% were disregarded. Table 4
indicates the genes chosen for synthesis as well as the designation
of the expression vector. All the genes were cloned under control
of the ENO1 promoter/terminator using the pMU1531 expression
plasmid.
[0348] The plasmids were all transformed to S. cerevisiae M0509 (an
industrially hearty strain expressing xylose isomerase) using YPD
containing 250 .mu.g/ml zeocin as selective medium and
transformants were confirmed with PCR. Along with the reference
strain (containing pMU1531) and a strain expressing the T. reesei
eg2 (pRDH180), the eg2/eg3 expressing strains were tested for
activity on avicel and CMC. The strains were grown in YPD or double
strength SC medium (3.4 g/L YNB; 3 g/L amino acid pool; 10 g/L
ammonium sulfate; 20 g/L glucose) that was buffered to pH 6 (20 g/L
succinic acid; 12 g/L NaOH, set pH to 6 with NaOH). Glucose was
added after autoclaving of the other components from a 50% glucose
stock solution. Zeocin was added to a final concentration of 100
.mu.g/ml for liquid cultures. 10 mL cultures in 125 mL erlenmeyer
flasks were grown at 30.degree. C. for three days (YPD) or four
days (SC).
[0349] Three flasks were inoculated for each strain. After
incubation, samples were taken for gel analysis, protein
determination and activity measurement. After centrifugation of the
samples, 12 .mu.l of each was taken, added to 5 .mu.l of protein
loading buffer and boiled for 5 minutes. The samples were
subsequently loaded on a 10% SDS-PAGE and separated, followed by
silver staining (FIG. 6).
[0350] From the gel it appeared that not all strains produced a
visible band in the expected size range (see Table 5 for predicted
sizes). The T.r.EG2 appeared as a band of about 55 kDa. As it was
predicted to be approximately 44 kDa, the extra weight may
represent hyperglycosylation. The EG2s of C. lucknowense, A. niger,
and P. decumbens were also visible in the same approximate size
range with the P. decumbens product being slightly smaller at
.about.50 kDa. From the gel it appeared that far more C.
lucknowense EG2 protein was produced compared to the other EG2s.
From FIG. 6B it was clear that there were no visible bands for the
S. echinata or P. chrysosporium eg3 gene products. The T. reesei,
N. fischeri and C. brasiliense eg3 gene products were visible as
30, 25 and 35 kDa bands, respectively. Again, the extra weight may
represent hyperglycosylation. However, the N. fischeri Eg3 was
found to be at or very near to its predicted size--this protein
contains no putative N-glycosylation sites.
[0351] To screen for EG activity, 5 .mu.l of the cultures used for
quantitative assays were spotted on SC.sup.-URA plates containing
0.2% of either CMC or barley-.beta.-glucan (FIG. 7). Two CMC
containing plates were made and stained after 3 or 24 hours. As can
be seen from FIG. 7 the T r. eg2 expressing strain (180) yielded
very good clearing zones on both substrates. The other eg2
expressing strains also showed good clearing zone formation along
with the strains expressing EG3's from T. reesei (164), S. echinata
(165), N. fischeri (166) and C. brasiliense (168). The N. fischeri
eg3 expressing strain (166) consistently yielded larger clearing
zones than the other EGs on the plate assays. Due to the smaller
size of this protein (FIG. 6B) and apparent lack of glycosylation
this enzyme may have superior diffusion qualities in this
media.
[0352] All strains were tested for activity using the
high-throughput avicel conversion method as prescribed. Activity on
CMC was determined with a similar assay while omitting the Novozyme
188 and starting with 1% CMC. The DNS used for the assay procedure
contained phenol. Activity data from strains grown on YPD and SC
can be seen in FIG. 8.
[0353] From the activity data it would appear that the strain
expressing T. reesei eg2 (pRDH180) produced the highest levels of
secreted activity. The EG2 from C. lucknowense displayed the next
best activity on both substrates. The T. reesei EG3 and N. fischeri
EG3 appear to be the superior enzymes for yeast expression from
this group (cell2, will subsequently be tested on PHW).
[0354] Strain M0509 was also transformed with 2 um plasmids
containing EG4s, EG5s, EG6s, and xyloglucanases (GH74/XG). These
strains were then spotted on YNB plates with CMC, grown overnight
at 30 degrees and stained with Congo red to check for activity of
the cloned gene (Data for some of the strains shown in FIG. 9). The
EG4 genes showed only weak activity on CMC, while both EG5
candidates showed large clearing zones, and all EG6s showed
intermediate clearing zone size. The XG candidates all showed very
small clearing zones on CMC. All enzyme types gave functional
candidates.
[0355] The candidates were also tested for activity in the PHW
assay in the presence of other enzymes. Purified, yeast made CBH1,
CBH2, EG2, and BGL were used as partners for the assay loaded at a
4 mg enzyme protein per gram of solids, and a 40%:40%:15%:5% (by
mass) mixture (FIG. 10). As controls, M0509 supernatant (negative)
or M1179 supernatant (positive control strain expressing CBH1,
CBH2, EG2, and BGL) were used.
[0356] The data in FIG. 10 demonstrate that addition of EG4 (from
Chaetomium globosum or Neosartorya fischeri) or EG5 (from
Chrysosporium lucknowense) can increase the hydrolysis of a 4 mg/g
loading of CBHs, EG2, and BGL. When compared to loading an
additional dose of CBH1, CBH2, EG2, and BGL (1179 supernatant), EG4
and EG5 give an increase in glucose release, although this
difference does not appear to be statistically significant based on
data from the glucose assay kit. Regardless, candidates for these 3
categories have been obtained, although several more remain to be
screened.
[0357] The XG candidates, and several EG4, 5, and 6 candidate genes
along with the best candidates from the previous round of assays
for EG4, 5, and 6 were used in a PHW assay (FIG. 11). The results
indicate that several of the enzymes have activity on PHW. The EG4s
from C. globosum and T. terrestris both gave an increase in glucose
release relative to the negative control and relative to the strain
expressing T. reesei EG2. The same was true for the C. globosum
EG5, and the N. crassa EG6. The XG candidates showed only a very
minor increase in reaction over the control strain, with the N.
fischerii XG appearing to be the best.
Example 3
Cloning and Expression of 5 Synthetic Xylanases and 5 Synthetic
Xylosidases in S. cerevisiae
[0358] Xylanases and xylosidases were examined for expression in
yeast in order to broaden the enzymatic activity spectrum of the
yeast made lignocellulolytic system. Xylanases were selected from
the public databases and their functional expression in yeast was
tested on substituted xylans. Xylosidases were selected based on
homology to A. niger xlnD (a GH family 3 enzyme) and to include
xylosidases from GH family 43. Table 5 (condensed version of Table
4) indicates the genes chosen for synthesis as well as the
designation of the expression vector. All the genes were cloned
under control of the ENO1 promoter/terminator using the pMU1531
expression plasmid. The plasmids were all transformed to S.
cerevisiae M0509 and transformants were confirmed with PCR.
TABLE-US-00008 TABLE 5 Xylanase and xylosidase encoding genes
expressed in S. cerevisiae. GH Expression Theoretical size Organism
& Gene: Family: plasmid: (kDaa) Xylanases: T. reesei xyn2
(native sequence) 11 pRDH182 21.0 T. reesei xyn2 (synthetic) 11
pRDH169 21.0 Chaetomium thermophilum 11 pRDH170 27.8 xyn11A
Aureobasidium pullulans var. 10 pRDH171 39.9 melanigenum xyn10
Cryptococcus albidus xylanase 10 pRDH172 35.8 Aspergillus niger
xylanase D 43 pRDH174 35.4 Xylosidases: Aspergillus niger xlnD -
native 3 pRDH181 86.7 sequence (S.c.MF.alpha. secretion signal)
Cochliobolus carbonum 43 pRDH175 36.8 .beta.-xylosidase Penicillium
herquei xylosidase 43 pRDH176 37.4 Pyrenophora tritici-repentis
.beta.- 43 pRDH177 36.9 xylosidase Aspergillus nidulans xylosidase
3 pRDH179 87.1
[0359] Along with the reference strain (containing pMU1531), a
strain expressing the native sequence of T.r.xyn2 (pRDH182) and a
strain expressing the native sequence of A.n.xlnD (pRDH181), the
xylanase/xylosidase expressing strains were tested for activity on
1% birchwood glucuronoxylan (Roth) and pNP-xylopyranoside (pNPX).
The strains were grown in YPD or buffered double strength SC medium
(pH 6). Zeocin was added to a final concentration of 100 .mu.g/mL
for liquid cultures. 10 mL Cultures in 125 mL Erlenmeyer flasks
were incubated at 30.degree. C. for three days (YPD) or four days
(SC). Three flasks were inoculated for each strain. After
incubation, samples were taken for gel analysis, protein
determination and activity measurement. After centrifugation of the
samples, 12 .mu.L of each was taken, added to 5 .mu.L of protein
loading buffer and boiled for 5 minutes. The samples were
subsequently loaded on a 10% SDS-PAGE and separated, followed by
silver staining (FIG. 12).
[0360] From the gel it appeared that not all strains produced a
visible band in the expected size range (see Table 5 for predicted
sizes). (A) The T.r.XYN2 appeared as a band of about 21 kDa as
predicted. The Chaetomium thermophilum XYN11A is visible as a faint
band of about 36 kDa, larger than the expected 27.8 kDa. The
Aureobasidium pullulans XYN10 is visible as a prominent band at
.about.50 kDa. The Cryptococcus albidus and Aspergillus niger
xylanases are also visible as bands slightly larger than predicted
but these gene products yielded no activity in liquid assays (FIG.
14). The increased sizes of the secreted enzymes can likely be
explained as a result of hyperglycosylation. (B) A large smear at
>90 kDa may represent heterogeneously glycosylated forms of the
A. niger XLND xylosidase. The Cochliobolus carbonum, Penicillium
herquei, and Pyrenophora tritici-repentis xylosidases are present
as 45, 50 and 55 kDa bands (slightly smeared), larger than the
predicted .about.37 kDa also indicating likely
hyperglycosylation.
[0361] To screen for xylanase activity, 5 .mu.L of the cultures
used for quantitative assays were spotted on an SC.sup.-URA plate
containing 0.2% RBB-xylan and incubated for 24 hours (FIG. 13). As
can be seen from the figure, the T.r.xyn2 expressing strain
(RDH182) yielded a very good clearing zone whereas the reference
strain did not. Of the other xylanase expressing strains Chaetomium
thermophilum xyn11A and Aureobasidium pullulans xyn10 yielded
clearing zones but none of the other strains produced a visible
clearing zone.
[0362] All strains were tested for activity on birchwood
glucuronoxylan (Roth) and pNP-xylopyranoside (pNPX). Xylanase
assays were performed essentially as described in La Grange et al.
(1996, Appl. Environ. Microbiol. 62, 1036-1044). Reactions were
miniaturized for use in a 96-well PCR plate. 5 .mu.L supernatant
was added to 45 .mu.L 1% glucuronoxylan and incubated at 35.degree.
C. for 5 minutes. Reactions were stopped by adding 75 .mu.L DNS
before heating at 99.degree. C. for 5 minutes. A standard curve was
set using xylose. Xylosidase assays were performed in the same
manner as for .beta.-glucosidase assays (see above protocol) but
with pNPX as substrate at pH5, 35.degree. C. for 2-5 minutes
depending on the activity. Activity data from strains grown on YPD
and SC can be seen in FIG. 14.
[0363] From the activity data it would appear that the strain
expressing the native T.r.xyn2 (pRDH182) produced the highest
levels of secreted xylanase activity. It was surprising that the
strain containing a codon optimized version of this gene (sequence
verified) displayed no secreted activity. The GH family 11 xylanase
encoded by Chaetomium thermophilum xyn11A did give notable
activity, however, far less than that generated by the strain
expressing native T.r.xyn2. The strain expressing Aureobasidium
pullulans xyn10 (GH family 10) also yielded appreciable activity.
This is particularly encouraging as it is known that family 10
xylanases often have only 10% of the specific activity of GH family
11 enzymes. However, family 10 xylanases are less restricted in
their action by side chain substitutions on the xylan backbone.
Somewhat surprisingly, the GH family 43 xylosidases encoded by the
genes from Cochliobolus carbonum and Pyrenophora tritici-repentis
gave substantial xylanase activity. These enzymes are also classed
as "exo-xylanases" and it will be very interesting to see how they
interact with other xylan degrading enzymes. The strains producing
these two enzymes also displayed far greater xylosidase activity on
pNPX than the strain expressing native A.n.xlnD. Furthermore, the
strain expressing native A.n.xlnD secreted only about 36% of the
total xylanase activity it produced when grown in YPD whereas 76%
and 99% of the C. carbonum and P. tritici-repentis heterologous
xylosidases were secreted. The secreted xylosidase activities of
the strains producing C. carbonum and P. tritici-repentis
xylosidases in YPD were respectively 3.3 and 6.9 fold higher than
the secreted activity of the strain expressing native A.n.xlnD.
[0364] An assay assessing synergy of the best xylanases and
xylosidases identified is shown in FIG. 15. Birchwood
glucuronoxylan (5% in 50 mM NaOAc, pH5) was prepared and 400 .mu.l,
aliquots were placed in a deep well plate. Subsequently,
supernatants of SC-grown yeast strains were added as follows:
1.100 .mu.l supernatant of REF strain 2. 50 .mu.l supernatant of
REF strain, 50 .mu.l supernatant of RDH182 strain (T.r.xyn2) 3. 50
.mu.l supernatant of REF strain, 50 .mu.l supernatant of RDH171
strain (A.p.xyn10) 4. 50 .mu.l supernatant of REF strain, 50 .mu.l
supernatant of RDH177 strain (P.tr.xld) 5. 50 .mu.l supernatant of
RDH182 strain (Tr.xyn2), 50 .mu.l supernatant of RDH177 strain
(P.tr.xld) 6. 50 .mu.l supernatant of RDH171 strain (A.p.xyrl10),
50 .mu.l supernatant of RDH177 strain (P.tr.xld)
[0365] The mixtures were shaken on a microtiter plate shaker at
1000 rpm, 35.degree. C. for 22 hours. DNS assays were performed to
ascertain the amounts of reducing sugar formed (FIG. 15). From this
result it would seem that there was a synergistic effect when the
xylanases and the xylosidase were mixed. The activity of the
T.r.XYN2 and P.tr.XLD Mix was 1.24 times more than the sum of the
activities separately. The activity of the A.p.XYN10 and P.tr.XLD
mix was 1.9 times more than the sum of the activities of those
supernatants separately. To analyze the released sugars, 5 .mu.L of
each reaction and standards were spotted on a silica coated thin
layer chromatography (TLC) plate and separated with and eluant
consisting of isopropanol: ethanol:water (7:1:2). The plate was
then developed by dipping it in a mixture of 5% H.sub.2SO.sub.4
(made in ethanol) and heating in a 180.degree. C. oven (FIG. 16).
The action of the xylanases (lanes 2 and 3) yielded small amounts
of xylotriose and more significant amounts of xylobiose. The
xylosidase from P. tritici-repentis released a small amount of
xylose from xylan (lane 4). Mixtures of the heterologously produced
xylanases with the xylosidase yielded significant amounts of xylose
(lanes 5 and 6) with no visible xylo-oligos remaining in these
reactions. These reactions will be further analysed with HPLC
analysis. The results presented in FIGS. 15 and 16 show that the
promising xylanases and xylosidases identified in this study can
synergise and yield the desired product namely xylose.
[0366] Derivatives of M0509 expressing the T. reesei Xyn2
(xylanase, pRDH182) and the P.t.r. GH43 xylosidase (xylosidase,
pRDH177), or both the enzymes (pMU1819 below) were created. A
cassette to integrate both enzymes was created so that both enzymes
could be integrated at the rDNA locus. (FIG. 40). Selection was
carried out via the natMX marker. The ability of the three strains
to utilize xylan was tested by cultivating them in media containing
yeast extract (1%), peptone (2%), glucose (2%), and xylan (5%). For
each strain the percentage of the xylan that could be converted to
ethanol in this test is shown in FIG. 39. The results demonstrate
the synergy between the two enzymes as well as the ability to
create a strain that can directly convert xylan to ethanol.
Example 4
Screening of Fungal Accessory Enzymes
[0367] Assays for arabinofuranosidase activity and esterase
activity were carried out to assess whether any of the accessory
enzymes were functional. The arabinofuranosidase assay was carried
out as follows: Substrate (1 mM 4-nitrophenyl-L-arabinofuranoside
(Sigma #N-3641)) was made up in 50 mM citrate buffer pH 5.4 and
preheated to 35 C. 20 ul of yeast supernatant plus 180 ul of
substrate was added to 96 well plate, and incubated at 35 degrees
for 30 minutes. The reaction was stopped by adding 100 ul of 1M
Na.sub.2CO.sub.3 and an OD measurement was taken at 405 nM.
Zoomerase (1 ul) at a concentration of 177 ug/ul was added in a
total of 20 ul citrate buffer. The esterase activity assay was
carried out as follows: A 200 mM stock of substrate (4-Nitrophenol
Acetate-Sigma N-8130) was made up in DMSO; 50 ul of this stock was
added to 10 mls of citrate buffer pH 5.4 to make a 1 mM final
concentration. 50 ul of supernatant to be tested was added to a 96
well flat bottom plate plus 100 ul of substrate solution. The
reaction was incubated at 35 degrees for 30 minutes and the OD at
410 nm was taken.
[0368] FIGS. 17 and 18 show the results for the assays that were
carried out. Only the Abfb gene from A. niger showed activity on
the synthetic substrate pNPA. This confirms expression of this
gene, which has been previously expressed in yeast (Crous et al.
1996), in our strain. The GH62 arabinofuranosidase candidates did
not show activity on this substrate, which could be due to poor
expression, or an inability to cleave the substrate. Several genes
were shown to have activity on the synthetic substrate
p-Nitrophenol-actetate (FIG. 18). Candidates for both types of
feruoyl esterases (FAEA and FAEB), as well as one of the acetyl
xylan esterases (AXE) were shown to be active.
[0369] PHW assays were set up to screen several accessory
components and assess their impact in the presence of other yeast
made enzymes. FIG. 19 shows the results of the first screen, which
demonstrate that both the Neosartorya fischeri and the Trichoderma
reesei AXE genes expressed in M0544 yield increased xylan and
glucan hydrolysis from unwashed pretreated hardwood substrate
(MS630). In fact, without the AXEs present, there is no measurable
release of xylose from this substrate using the yeast made xylanase
and xylosidase. The hydrolysis of the xylan in MS630 should result
in .about.1.8 g/L xylose release in this assay, thus the .about.1.4
g/L observed is about 77% of the total available, an increase of
25% over the control. Glucose hydrolysis was increased by
.about.25% by the presence of the N.f. AXE.
[0370] FIG. 20 shows the results of attempting combinations of
enzymes on unwashed MS630 (a pretreated hardwood substrate). A
couple of interesting results can be observed. One is that in the
presence of zoomerase (1 mg/g) the accessories are having only a
small impact on hydrolysis glucan in MS630 at the loadings tested.
However, xylan hydrolysis is substantially increased by the
presence either the N.f. AXE (acetylxylanesterase) or the T.r. AXE,
with the best combinations yielding .about.90% conversion. In the
absence of zoomerase these enzymes increased the hydrolysis of both
glucan and xylan. Additionally, reducing the amount of AXE and
simultaneously increasing the loading of yeast made xylanase and
xylosidase increased the rate of xylose release, indicating that
these enzymes are the rate limiting ones needed at higher
expression levels. The best combination of enzymes without
zoomerase yielded .about.72% conversion of the xylan to xylose.
Example 5
Testing Endoglucanases for Possible Xylanase Activity
[0371] It was shown previously that fungal and bacterial xylanases
of GH10 and GH11 produce ethylxylanopyranoside (EXP) during
fermentation. In order to find xylanases that do not produce EXP
several fungal and bacterial enzymes belonging to different GH
families were tested for xylanase activity. Enzymes from GH
families 5, 7, 8, 10, 11, 12, 16, 26, 43, 44, and 51 were screened
for activity on xylan as members of these families have been
reported to contain some xylanase activity. Cultures were grown in
YPD for 72 h and the supernatants were evaluated on the birchwood
xylanase assay (FIG. 21).
[0372] FIG. 21 demonstrates that BC 60 displayed significant
xylanase activity, and also, the strains containing a fungal GH10
xylanase from A. pullulans (M1379), and two GH7 EG1's from
Aspergillus fumigatus (M1311) and Trichoderma longibrachiatum
(M1317) did have activity on birchwood xylan, although it was less
than BC60 and T. reesei xyn2 (Con5).
Example 6
Expression of Bacterial Lignocellulolytic Enzyme System Components
in Yeast
[0373] Several potential bacterial donors of lignocellulolytic
enzymes are listed in Table 6, with preference given to mesophilic
organisms with noncomplexed cellulases. At the same time bacteria
from different groups (aerobic vs. anaerobic and meso vs. thermo)
were selected, to provide diversity. Also, preferred donors were
chosen if the functional expression of their genes in yeast was
previously reported (Thermobifida fusca, Cellulomonas fimi,
Clostridium phytofermentans, etc.). GC content of bacterial genomes
also influenced the choice of donor. The preference was given to
the organisms with GC content that is not too far from S.
cerevisiae GC content--38% (see Table 6), although the organisms
with high GC content also were not completely ruled out based on
successful expression in yeast of native cel9A from T. fusca that
has 67.5 GC content.
[0374] Table 7 gives the full list of the bacterial genes screened
for expression in yeast. All the genes except those indicated were
successfully amplified by PCR from genomic DNA and transformed into
yeast strain together with the 2.mu. vector backbone for cloning
via yeast mediated ligation. The enzymes not cloned from genomic
DNA were available as codon optimized versions.
TABLE-US-00009 TABLE 6 Characteristics of various bacterial donors
of cellulolytic enzymes, DBM- disulphide bonds machinery. Oxygen
Growth Cellulase GC Organism relation temp. Growth pH system
content DBM Streptomyces Aerobe Meso 7 Noncomplexed, 70.7 +
avermitilis cell free Saccharophagus Aerobe Meso 7.6 Noncomplexed,
45.8 + degradans cell free Bacillus subtilis Facult. Meso 6.8
Noncomplexed, 43.5 + cell free Clostridium Anaerobe Meso 7.5
Combined 37.4 + cellulolyticum Clostridium Anaerobe Meso 7
Noncomplexed, 35.3 + phytofermentans cell free Thermobifida Aerobe
Thermo 7.4 Noncomplexed 67.5 + fusca cell free Clostridium Anaerobe
Thermo 6.7 Combined 39 - thermocellum
TABLE-US-00010 TABLE 7 Bacterial genes screened for expression in
Saccharomyces cerevisiae. In certain figures and examples, BC #
designates the enzyme used in that experiment. Organism Activity
GHF Gene or locus taq Protein ID BC # MESOPHILES Aerobes
Streptomyces exo 6 1,4-beta- NP_821732.1 1 avermitilis
cellobiosidase guxA1 Streptomyces exo 6 1,4-beta- NP_823029.1 2
avermitilis cellobiosidase guxA2 Streptomyces exo/endo 48 1,4-beta-
NP_823031.1 3 avermitilis cellobiosidase guxA3 Streptomyces
endoglucahase/ 12 endo-1,4-beta- NP_821730.1 4 avermitilis
xylanase? glucanase celA1 Streptomyces endo endo-1,4-beta-
NP_823030.1 5 avermitilis glucanase celA2 Streptomyces endo
endo-1,4-beta- NP_823032.1 6 avermitilis glucanase celA3
Streptomyces endoglucahase/ 12 endo-1,4-beta- NP_823744.1 7
avermitilis xylanase? glucanase celA4 Streptomyces endo 6
endo-1,4-beta- NP_826394.1 8 avermitilis glucanase Streptomyces
endo 6 endo-1,4-beta- NP_828072.1 9 avermitilis glucanase celA5
Streptomyces endoxylanase 10 beta-1,4-xylanase NP_823272.1 10
avermitilis Streptomyces endoxylanase 10 beta-1,4-xylanase
NP_826161.1 11 avermitilis Streptomyces xylanase/ 43 xylanase
NP_827548.1 12 avermitilis xylosidase ? Streptomyces
xylanase/xylosidase ? 43 endo-1,4-beta- NP_827557.1 13 avermitilis
xylanase xynD Streptomyces xylosidase 39 1,4-beta-xylosidase
NP_822628.1 14 avermitilis xynB1 Streptomyces xylanase/ 43
beta-xylosidase NP_823285.1 15 avermitilis xylosidase ?
Streptomyces xylosidase/ 3 1,4-beta-xylosidase NP_826159.1 16
avermitilis glucosidase? xynB2 Streptomyces xylosidase 39
1,4-beta-xylosidase NP_827745.1 17 avermitilis xynB3 Streptomyces
beta-glucosidase 1 beta-glucosidase NP_822977.1 18 avermitilis
bglC1 Streptomyces beta-glucosidase 1 beta-glucosidase NP_826430.1
19 avermitilis bglC2 Streptomyces beta-glucosidase 1
beta-glucosidase NP_826775.1 20 avermitilis bglC3 Streptomyces
Acetyl xylan AXE1 NP_822477.1 21 avermitilis esterase Streptomyces
Acetyl xylan AXE1 NP_822632.1 22 avermitilis esterase Streptomyces
arabinofuranosidase/ 43 abfA NP_822218.1 23 avermitilis xylanase
Streptomyces arabinofuranosidase/ abfB NP_822290.1 24 avermitilis
xylanase Streptomyces arabinofuranosidase abfA NP_826920.1 25
avermitilis Streptomyces arabinofuranosidase/ abfB BAC74043.1 26
avermitilis galactosidase Streptomyces arabinofuranosidase SAV_6756
BAC74467.1 27 avermitilis Streptomyces galactosidase agaA1
BAC68338.1 28 avermitilis Streptomyces galactosidase agaA3
BAC68787.1 29 avermitilis Streptomyces galactosidase agaB2
BAC69185.1 30 avermitilis Saccharophagus Endo 5? Sde_2993
YP_528462.1 31 degradans 2-40 Saccharophagus Endo 5? Sde_2996
YP_528465.1 32 degradans 2-40 Saccharophagus Endo 5? Sde_3023
YP_528492.1 33 degradans 2-40 Saccharophagus Endo 5 cel5A
ABD82260.1 34 degradans 2-40 Saccharophagus Endo 5 cel5E ABD82186.1
35 degradans 2-40 Saccharophagus Endo 5 cel5F ABD80834.1 36
degradans 2-40 Saccharophagus Endo 5 cel5J ABD81754.1 37 degradans
2-40 Saccharophagus Endo 9 cel9A ABD79898.1 38 degradans 2-40
Saccharophagus beta-glucosidase 3 ced3A ABD81757.1 39 degradans
2-40 Saccharophagus beta-glucosidase 3 ced3B ABD79509.1 40
degradans 2-40 Saccharophagus beta-glucosidase 1 bgl1A ABD82858.1
41 degradans 2-40 Saccharophagus beta-glucosidase 1 bgl1B
ABD80656.1 42 degradans 2-40 Saccharophagus Cellobiose 94 Cep94A
ABD80580.1 43 degradans 2-40 phosphorylase Saccharophagus
Cellodextrin 94 Cep94B ABD80168.1 44 degradans 2-40 phosphorylase
Saccharophagus mannanase Sde_0509 YP_525985.1 45 degradans 2-40
Saccharophagus mannosidase 2 Sde_0169 YP_525645.1 46 degradans 2-40
Facultative Anaerobes Bacillus subtilis synergy with expansin exlX
CAB13755.1 47 endo/exo Bacillus subtilis endo/exo? endo-1,4-beta-
CAB13696.2 48 glucanase eglS Bacillus subtilis endo/exo 30
endo-xylanase xynC CAB13698.1 49 xlylanase? Bacillus subtilis
endo/exo 43 endo-1,4-beta- CAB13699.1 50 xlylanase? xylanase xynD
Bacillus subtilis endo xlylanase 11 endo-1,4-beta- CAB13776.1 51
xylanase xynA Bacillus subtilis xylanase/ 43 xylan beta-1,4-
CAB13642.2 52 xylosidase ? xylosidase xynB Anaerobes Clostridium
Exo/Endo 9 Cphy_3367 YP_001560459.1 53 phytofermentans Clostridium
Exo/Endo 48 Cphy_3368 YP_001560460.1 54 phytofermentans Clostridium
Endo 5 Cphy_2058 YP_001559165.1 55 phytofermentans Clostridium Endo
5 Cphy_3202 celulase B YP_001560295.1 56 phytofermentans
Clostridium Endo 5 Cphy_1163 YP_001558280.1 57 phytofermentans
Clostridium beta-glucosidase 3 Cphy_3329 YP_001560421.1 58
phytofermentans Clostridium beta-glucosidase 3 Cphy_1125
YP_001558242.1 59 phytofermentans Clostridium xylanase 10 Cphy_1510
YP_001558623.1 60 phytofermentans Clostridium xylanase 10 Cphy_0624
YP_001557750.1 61 phytofermentans Clostridium xylanase 11 Cphy_2105
XynA YP_001559210.1 62 phytofermentans Clostridium xylanase 10
Cphy_2108 YP_001559213.1 63 phytofermentans Clostridium xylanase/ 8
Cphy_3207 Y YP_001560300.1 64 phytofermentans endoglucanase
Clostridium Xylosidase/ 43 Cphy_0191 YP_001557317.1 65
phytofermentans Arabinofuranosidase Clostridium Xylosidase/ 43
Cphy_0875 YP_001558000.1 66 phytofermentans Arabinofuranosidase
Clostridium Arabinofuranosidase Cphy_1169 YP_001558286.1 67
phytofermentans Clostridium Mannanase 26 Cphy_1071 YP_001558190.1
68 phytofermentans Clostridium Mannosidase 26 Cphy_2128
YP_001559233.1 69 phytofermentans Clostridium Mannosidase 26
Cphy_2276 YP_001559376.1 70 phytofermentans Clostridium
Galactosidase Cphy_1936 YP_001559043.1 71 phytofermentans
Clostridium Endo 5 cel51 AAL79562.1 72 cellulolyticum Clostridium
Exo/Endo 48 CelCCF (dockerin) AAB41452.1 73 cellulolyticum
Cel48F-yeast CO template pMU914 Clostridium Xylosidase 39 Ccel_1259
YP_002505595 74 cellulolyticum Clostridium Endo 9 Ccel_2226
YP_002506548.1 75 cellulolyticum Clostridium Endo/Exo 9 Ccel_0732
YP_002505091.1 76 cellulolyticum (dockerin) Cel9E- yeast CO
template pMU913 Clostridium Endo 5 Ccel_1099 YP_002505438.1 77
cellulolyticum (dockerin) Cel5A- yeast CO template pMU967
Clostridium Endo/Exo 9 Ccel_2392 YP_002506705.1 78 cellulolyticum
(dockerin) Clostridium Endo 9 Ccel_0731 YP_002505090.1 79
cellulolyticum (dockerin) Cel9G- yeast CO template pMU892
Clostridium Endo/Exo 5 Ccel_0840 YP_002505196.1 80 cellulolyticum
(dockerin) Cel5D- yeast CO template pMU891 Clostridium Endo/Exo 8
CelCCC (dockerin) AAA73867.1 81 cellulolyticum Cel8C-yeast CO
template pMU969 THERMOPHILES Aerobes Thermobifida fusca xylanase 10
endo-1,4-beta ABL73883.1 82 xylanase (Umxyn10A) Thermobifida fusca
xylanase 11 endo-1,4-beta-D- AAV64879.1 83 xylanase (xyl11)
Thermobifida fusca endo 6 Endoglucanase AAZ55112.1 84 Thermobifida
fusca exo/endo? 5 Cellulase AAZ56745.1 85 Thermobifida fusca
beta-glucosidase 3 exo-1,4-beta- AAZ55642.1 86 glucosidase
Thermobifida fusca beta-glucosidase 1 beta-glucosidase AAZ55664.1
87 Thermobifida fusca exo/endo 48 cellulose 1,4-beta- YP_290015.1
88 cellobiosidase Thermobifida fusca synergy with CBD E8 AAZ55700.1
89 endo/exo Thermobifida fusca exo 6 celC (E3) YP_288681.1 90
Thermobifida fusca endo 5 celE (E5) YP_288962.1 91 Thermobifida
fusca endo 5 cel5B AAP56348.1 92 (Endoglucanase) Thermobifida fusca
endo 9 celA (E1) AAC06387.1 93 Thermobifida fusca endo 6 celB (E2)
YP_289135.1 94 Thermobifida fusca endo/exo? 9 Tfu_1627 (1,4-beta-
YP_289685.1 95 cellobiosidase) Anaerobes Clostridium Endo 8 celA
(dockerin) YP_001036701.1 96 thermocellum Clostridium Endo/Exo 48
celY (cel48Y) CAI06105.1 97 thermocellum Clostridium Endo 9
Cthe_0625 YP_001037053.1 98 thermocellum (dockerin) Clostridium
Endo 5 celC CAC27410.1 99 thermocellum Clostridium Endo 5 Cthe_1471
YP_001037893.1 100 thermocellum Clostridium xylanase 10 Cthe_2119
YP_001038519.1 101 thermocellum Clostridium beta-glucosidase 1 bglA
CAA42814.1 102 thermocellum Clostridium beta-glucosidase 3 bglB
CAA33665.1 103 thermocellum Clostridium arabinofuranosidase 51
Cthe_2548 YP_001038942.1 104 thermocellum Clostridium
arabinofuranosidase 54 Cthe_1273 YP_001037698.1 105 thermocellum
Clostridium Endo/Exo 9 Cthe_0040 (Cel9I) YP_001036474.1 106
thermocellum Clostridium Endo/Exo 9 Cthe_0412 YP_001036843.1 107
thermocellum (dockerin) Clostridium Endo/Exo 9 Cthe_0825
YP_001037253.1 108 thermocellum (dockerin) Clostridium
Endo-xylanase 11 xynA CAD48307 109 stercorarium Clostridium
Endo-xylanase 10 xynB (CelW- CAD48313 110 stercorarium
celloxylanase) Clostridium Endo-xylanase 10 xynC (CelX- CAD48314
111 stercorarium celloxylanase) Clostridium Xylosidase 3 bxlB
(b-Xylosidase AJ508405 112 stercorarium B) Clostridium Xylosidase
39 bxlA (b-Xylosidase AJ508404 113 stercorarium A) Clostridium
Xylosidase/beta- 3 bglZ (beta- CAB08072 114 stercorarium
glucosidase glucosidase)
Clostridium arabinofuranosidase 43 arfA (alpha- AJ508406 115
stercorarium arabinofuranosidase A) Clostridium arabinofuranosidase
51 arfB (alpha- AAC28125 116 stercorarium arabinofuranosidase B)
Clostridium Endo 9 celZ (Cs-Cel9Z- CAA39010 117 stercorarium
Avicellase I) Clostridium Exo 48 celY (Cs-Cel48Y- CAA93280 118
stercorarium Avicellase II) Anaerocellum Endo (Exo?) 48 celA
(1,4-beta- CAB06786 119 thermophilum glucanase) Anaerocellum Endo 5
celD (EG) CAB01405 120 thermophilum Anaerocellum Endo-xylanase 10
xynA (1,4-beta-D- CAA93627 121 thermophilum xylan xylanhydrolase)
Anaerocellum Endo 5 celB (EG5) Z86104 122 thermophilum Anaerocellum
Endo? 5 Athe_1866 (endo- YP_002573059 123 thermophilum 1,4-beta-
mannosidase) Anaerocellum Endo? 5 Athe_0594 YP_002572493 124
thermophilum ("cellulase") Thermobifida fusca endo/exo 9 Cel9A,
TfCel9A- 125 yeast CO gene from restriction digest of pMU1248
Example 7
Screening Bacterial Endoglucanases for Expression/Activity in
Yeast
[0375] All of the bacterial endoglucanases were pre-screened for
secreted activity on CMC (FIG. 22). Fifty seven yeast strains
expressing bacterial endoglucanases were screened. For each enzyme
two different transformation clones were assayed. The strains were
patched on YPD+Zeo plates (Zeo 250 mg/L) for 2 days and inoculated
in 600 uL YPD in 96 well plates. The strains were grown for 3 days
at 35 C at 900 rpm, and the CMC assay (see above) was performed on
the supernatants. NegCont is M0749 transformed with empty
expression vector pMU1575. TrEG2 in pMU1575 was used as positive
control construct.
[0376] FIG. 22 demonstrates that 15 bacterial enzymes (26%)
displayed secreted activity on CMC. Bacillus subtilis EglS and
Clostridium cellulolyticum Cel5A had secreted activity on CMC
similar to the well expressed control, which was T. reesei EG2. The
enzymes that demonstrated activity on CMC are listed in the Table 8
below. All genes except BC77, BC80 and BC81 are not codon optimized
for yeast; therefore the expression level of the best genes could
be increased further by codon optimization.
Example 8
Synergy of Bacterial Endoglucanases with Yeast Made CBHs on PHW
[0377] In order to determine which bacterial endoglucanase increase
pretreated lignocellulose conversion by CBHs, the PHW assay was
performed with several yeast made bacterial EGs selected by
screening on CMC in the presence of yeast made purified CBH1 and
CBH2 (FIG. 23). The assay was also supplemented with Novozyme-188
BGL.
[0378] FIG. 23 demonstrates that almost all tested bacterial EGs
significantly increase glucose release from PHW. Additive effect of
bacterial EGs was similar or higher compared to the positive
control--Trichoderma reesei EG2. Thermobifida fusca celE was
particularly successful among the EGs.
[0379] Previous work had demonstrated that the T. fusca Cel9A gene
is well expressed in yeast. We have generated a yeast codon
optimized version of this gene and expressed it and the native
sequence under control of the strong ENO1 promoter. This resulted
in activity on avicel that was roughly equivalent to that measured
for CBH 1 candidates (8% conversion in 48 hours, with only
Novozymes 188 present as a background). This indicated that both
the native and the codon optimized version of the gene were well
expressed. Thus, this candidate enzyme was tested for synergy with
yeast made, purified CBHs, and T. reesei EG2 in a PHW assay (FIG.
24). As can be seen below, combinations of Cel9A with EG2 have
significant synergy, and perform better than the individual enzymes
added alone, even though they are twice the concentration.
TABLE-US-00011 TABLE 8 List of bacterial endoglucanases
demonstrated functional expression in yeast (see FIG. 22). BC#
Donor organism GHF Gene or locus taq 4 Streptomyces avermitilis 12
endo-1,4-beta-glucanase celA1 34 Saccharophagus degradans 5 cel5A
48 Bacillus subtilis endo-1,4-beta-glucanase eglS 56 Clostridium
phytofermentans 5 Cphy_3202 celulase B 72 Clostridium
cellulolyticum 5 cel5I 77 Clostridium cellulolyticum 5 Ccel_1099
(yeast CO) 80 Clostridium cellulolyticum 5 Ccel_0840 (yeast CO) 81
Clostridium cellulolyticum 8 CelCCC (yeast CO) 91 Thermobifida
fusca 5 celE (E5) 93 Thermobifida fusca 9 celA (E1) 94 Thermobifida
fusca 6 celB (E2) 95 Thermobifida fusca 9 Tfu_1627 96 Clostridium
thermocellum 8 celA 99 Clostridium thermocellum 5 celC 108
Clostridium thermocellum 9 Cthe_0825 125 Thermobifida fusca 9
Cel9A
Example 9
Characterizing Bacterial Xylanases for Expression/Activity in
Yeast
[0380] Screening was carried out for bacterial genes annotated as
xylanases using birchwood xylan as the substrate--see protocol
above (FIG. 25). Twenty five yeast strains expressing bacterial
xylanases were screened. For each enzyme two different
transformation clones were assayed. The strains were grown in the
same manner as the endoglucanases described above. All strains have
M0749 yeast background. "NegCont" is M0749 transformed with empty
expression vector pMU1575, and the Trichoderma reesei Xyn2 gene
cloned into in pMU1575 was used as positive control construct.
[0381] FIG. 25 demonstrates that 8 bacterial enzymes (32%) had
secreted activity on xylan. Several xylanases including Clostridium
phytofermentans Cphy1510 (GHF10) and Thermobifida fusca xyl11 had
secreted activity on xylan similar to or higher than T. reesei
Xyn2. The enzymes that demonstrated activity on xylan are listed in
Table 9 below.
TABLE-US-00012 TABLE 9 List of bacterial xylanases demonstrated
functional expression in yeast (see FIG. 25). BC# Donor organism
GHF Gene or locus taq 13 Streptomyces avermitilis 43
endo-1,4-beta-xylanase xynD 51 Bacillus subtilis 11
endo-1,4-beta-xylanase xynA 60 Clostridium phytofermentans 10
Cphy_1510 61 Clostridium phytofermentans 10 Cphy_0624 83
Thermobifida fusca 11 endo-1,4-beta-D-xylanase (xyl11) 109
Clostridium stercorarium 11 xynA 110 Clostridium stercorarium 10
xynB (CelW-celloxylanase) 111 Clostridium stercorarium 10 xynC
(CelX-celloxylanase)
Example 10
Synergy of Bacterial Xylanases with Yeast Made CBHs and EG
[0382] In order to test synergy of yeast made enzymes with
bacterial xylanases, a PHW assay was performed with several yeast
made bacterial xylanases previously selected by screening on xylan
in the presence of yeast made purified CBH1, CBH2, TrEG2, and yeast
made GH43 xylosidase (from Pyrenophora tritici-repentis) (FIG. 26).
Trichoderma reesei Xyn2 was used as the positive control, and a
strain expressing an empty vector served as a negative control. The
assay was also supplemented with AB BGL.
[0383] FIG. 25 demonstrates that some bacterial xylanases
significantly increase glucose release from PHW, especially when
external enzyme is not present. Clostridium phytofermentans GH10
xylanases (BC 60, and BC61) and Clostridium stercorarium XynB
(BC110) had the most significant effect on glucose release from
PHW. There are several possible explanations for the fact that
these xylanases help release glucose. It is possible that some
xylanases also possess endoglucanase or other hydrolase activity,
and thus hydrolyze cellulose directly. Additionally, it is possible
that digestion of xylan in the PHW may make the cellulose more
accessible for the cellulases present in the reaction. Increased
release of xylose was not measured in the reaction, likely due to
the lack of appropriate complementary activities (xylosidase and/or
acetylxylanesterase).
Example 11
Cloning and Screening Thermoanaerobacter saccharolyticum
Xylanases
[0384] T. saccharolyticum xylanases were cloned from genomic DNA
and fused to the Enol promoter for expression in S. cerevisiae. A
total of 12 xylanase-related genes were cloned into the pMU1575
backbone (Table 4). The strains were screened for both xylanase and
xylosidase activities using the birchwood xylanase assay and the
pNPX xylosidase assay, respectively (FIG. 26). M1594 was the only
strain that demonstrated significant xylanase activity. No
xylosidase activity was detected from these strains.
TABLE-US-00013 TABLE 10 Description of T. saccharolyticum xylanases
cloned and expressed in yeast. Sample Contig Gene SP Gene
Annotation GH Vector # TsX1 Contig7 or0901 Trans
endo-1,4-beta-xylanase precursor 11 pMU1988 TsX2 Contig12 or1447 No
Xylan 1,4-beta-xylosidase 39 pMU1989 TsX3 Contig12 or1446 No Xylan
1,4-beta-xylosidase. 52 pMU1990 TsX4 Contig12 or1454 Trans
Cellulose 1,4-beta-cellobiosidase - 10 pMU1991 Beta-1 4-xylanase
xynA TsX5 Contig12 or1455 No Glycosyl hydrolase family 10 10
pMU1992 TsX6 Contig12 or1186 SP xylanase/chitin deacetylase pMU1993
TsX7 Contig0 or0277 No xylulokinase pMU1994 TsX8 Contig0 or0278 No
xylose isomerase xylA pMU1995 TsX9 Contig0 or0277 No xylulokinase -
No SP pMU1996 TsX10 Contig0 or0278 No xylose isomerase xylA - No SP
pMU1997
Example 12
Screening of Bacterial Genes with Mannanase Activity
[0385] In order to find an easy, high-throughput screen for
cellulases, mannanases, and xylanases, 4 Azurine-Crosslinked
Polysaccharides (AZCL) from Megazymes were tested in an agar plate
assay. In this assay the enzyme hydrolyzes the insoluble
polysaccharide, releasing the soluble dye-labeled fragments to
provide a "zone of dyeing". Galactomannan, debranched arabinan, and
xylan AZCL attached substrates were tested by the plate assay.
Clones with putative xylanase, and mannanase activity provided
colored zones; however, no arabinase activity was detected on the
debranched arabinan.
[0386] Xylanases that demonstrated activity by this plate assay
matched the ones that were active in previously applied birchwood
xylan assay (see above). Three functionally secreted yeast made
bacterial mannanases (BC68, BC69, and BC70 from C. phytofermentens)
were discovered by the mannanase plate assay.
[0387] Bacterial accessory enzymes expressed by yeast were also
screened for synergy with yeast made enzymes (CBH1, CBH2, EG2, BGL,
xylanase, xylosidase) by PHW assay without any external enzymes
added (FIG. 28). One enzyme--Clostridium phytofermentans
mannosidase (Cphy.sub.--2276, GH26, BC70), has a noticeable effect
on glucose release from PHW. None of the enzymes had significant
effect on xylose release. It is possible that other activities may
be needed in a system in order to notice the effect of some
accessory enzymes.
TABLE-US-00014 TABLE 11 Summary of functional, "best in class"
component expressed in yeast. ##STR00001## ##STR00002##
##STR00003##
Example 13
Combinations of Components to Enhance Hydrolysis: Effect of
Different EG Combinations (Pair Wise Combinations) on PHW
Conversion by Yeast Made CBHs in the Presence of External Enzymes
(EE)
[0388] In order to determine if different EGs were synergistic with
each other, PHW assays were used to analyze EG combinations with
the goal of determining synergistic relationships. If the EGs had
similar functions, then combinations of the EGs should be no better
than a single EG (either) loaded at twice the concentration.
However, if the EGs were synergistic, then combinations should
yield greater hydrolysis than a 2.times. concentration of either
enzyme.
[0389] To test pair wise combinations, a PHW assay was performed
with the supernatants of yeast strains expressing individual EGs
(Table 4) combined in pairs (1 ml+1 ml) in all possible
combinations. The EG expressing strains were patched on YPD+Zeo
plates for day (except M1023 that was patched on SD-URA),
inoculated in YPD in shake flasks and grown for 72 hours. The
strain expressing an empty vector was used as negative control (2
ml, NC). The strains expressing single EGs (2 ml or 1 ml+1 mlNC)
were used as positive controls. All samples including NC were
supplemented with 1 mg/g CBH1, 1 mg/g CBH2, and 1 mg/g AB BGL (FIG.
29) or 1 mg/g CBH1, 1 mg/gCBH2, 0.2 mg/g BGL, and 1 mg/g Zoomerase
(FIG. 29).
TABLE-US-00015 TABLE 12 Yeast strains expressing EGs of different
GH families. GHF Strain Organism Donor Gene Host GH7 M1311 Fungi
Aspergillus fumigatus EG1 M0509 GH5 M1450 Fungi Trichoderma reesei
EG2 M0749 GH12 M1378 Fungi Neosartorya fischeri EG3 M0509 GH61
M1391 Fungi Chaetomium globosum EG4 M0509 GH45 M1420 Fungi
Chaetomium globosum EG5 M0544 GH6 M1400 Fungi Neurospera crassa EG6
M0509 GH8 M1456 Bacteria Clostridium cellulolyticum Cel8C(BC81)
M0749 GH9 M1023 Bacteria Thermobifida fusca Cel9A(BC125) M0749 GHX
M1454 Bacteria Bacillus subtilis EglS(BC48) M0749
[0390] All EGs expressed on 2u plasmid under ENO pr/tt containing
URA3 and Zeo markers. Backbone vector pMU1531 for fungal EGs;
pMU1575 for bacterial EGs. Fungal EGs have native signal sequences;
bacterial EGs attached to S.c.Invertase signal. Strains with fungal
EGs were selected on YPD+Zeo plates; strains with bacterial EGs
were selected on SD-URA- plates.
[0391] As can be seen from FIG. 29, several combinations of EGs
outperformed a 2.times. loading of either enzyme, indicating that
the EGs are indeed synergistic. Even though there was some overlap
in synergy between different time-points (27 and 48 hrs), the
amount of synergy was changing over time.
[0392] In order to analyze the EG pairs experiment data the Tables
13A and 13B were composed based on FIGS. 31 and 32 data. In these
Tables two parameters were calculated for each EG pair: activity
(red numbers)--increase in glucose release compared to NegCont; and
synergy (black numbers)--increase in glucose release compared to
the more active component of the couple. Activity was calculated by
deducting the glucose release value for negative control from
glucose release value for EG couple. Synergy was calculated as % of
increase in glucose release for EG pair compared to the glucose
release for the more active component of the pair. The data
presented on FIGS. 33 and 34 and Tables 13A and B demonstrated
that:
1. EG combinations have a definite advantage in PHW cellulose
conversion compared to single EGs. 2. In early PHW conversion time
points each of the 9 EGs (from separate families) are synergistic
with some other EG. 3. The synergy effect becomes less noticeable
at the later time of conversion.
[0393] In order to select the most efficient EG couples, the best
EG pairs were ranged based on both parameters: activity and
synergy, for both time-points (Table 14). The pairs highlighted
green in the Table 14 are present in all four "winning" groups and
considered as the most efficient EG combinations for these
experimental conditions.
TABLE-US-00016 TABLE 13 Data analysis of experiment with different
EG combinations ##STR00004## Gray numbers denote activity-increase
in glucose release compared to NegCont (CBHs + EE), g/1 (EG couple
activity minus NC); Black numbers-Synergy-increase in glucose
release compared to the more active component of the couple, %
(100% * EG couple act. divided by EG max act. minus 100%). A-27 h
time-point; B-48 h time-point. ##STR00005##
TABLE-US-00017 TABLE 14 Data analysis of experiment with different
EG combinations (see FIG. 28 and Table 13). ##STR00006##
[0394] In this Table the best performing EG pairs based on activity
and synergy data from Table 13 listed in the order of performance
starting with the best pairs. Four groups of the best performers
were formed for two different parameters (activity and synergy) and
for two different time-points: 27 and 48 hrs. The pairs highlighted
green are the pairs that present in all 4 groups.
Example 14
Testing of Higher EG Combinations for Enhanced PHW Activity
[0395] Based on the EG pairs screening above, an experiment was
designed in which the most efficient EG pairs were combined with
each of the remaining EGs from Table 14. The PHW assay was
performed with all possible triple EG combinations at the presence
of external enzymes (EE, see composition above) and yeast made CBHs
(FIG. 30). The total assay volume was divided into 3 parts for the
triples (0.67 mL each), whereas it was divided into only 2 or 1
part for the pair and single controls, respectively.
[0396] FIG. 30 demonstrates that yeast cellulytic system, when used
with EE, does benefit from more complex EG compositions. Based on
48 hrs data two best EG triplets were selected for further
experiments: GH9+GH5+GH12 and GH9+GH5+GH7.
[0397] The best triplets were combined with each of the remaining
EGs and the PHW assay was repeated again at two different
concentrations of EE (FIG. 31). FIG. 31 demonstrates that:
1. EG combinations have a definite advantage in PHW glycan
conversion compared to single EGs. 2. Which EG combination is the
best depends on the EE load and time of conversion. 3. At all times
and EE loads tested the best EG combos include: Cel9A(GH9),
EG3(GH12), EG1(GH7) and EG2(GH5). 4. At lower EE loadings, the
combination of GH5, GH9, GH7, and GH12 appears the best.
[0398] The data for the best single EGs (GH9 and GH5) and the best
four EGs together (GH9, GH5, GH12, GH7) were plotted as a time
course of PHW conversion at the presence 2 mg/g EE next to the
controls--2 mg/g and 4 mg/g EE without EGs added (supernatant of
empty vector added instead) (FIG. 32). FIG. 32 demonstrates that
the four EG combination has a definite advantage over the best
single EGs at the same volume. Also, FIG. 32 demonstrates that the
best EG combination provides increase in PHW conversion equivalent
to 2 mg/g EE.
Example 15
Expression of a "Complete" System of Enzymatic Components to Digest
Lignocellulose
[0399] The technical challenge of developing a "complete" or mostly
complete lignocellulolytic enzyme system for expression in yeast,
is that this system is likely to consist of many components. These
components will need to be expressed in multiple copies in order to
generate enough activity to be meaningful. Thus, developing tools
for multi-gene, multicopy expression are very useful in this
context.
Transferable System for Expressing Multiple Genes in Multiple
Copies
[0400] Expressing multiple copies of the .about.25 gene types
listed in Table 4, in addition to the "core" enzymes (CBH1, CBH2,
EG2, and BGL) already produced in yeast, will require new molecular
tools. Repeated integration with marker removal will be labor
intensive. In addition to this, a system that would make the enzyme
system transferable between strains would extremely valuable since
new hosts are continually being created.
[0401] Expressing large pieces of DNA is a solution to the problem
outlined above. Among the options for expressing large pieces of
DNA are CEN based plasmids and Yeast artificial chromosomes (YACs).
"CEN" refers to centromeric, and CEN elements allow high fidelity
dispersion of genetic elements into mother and daughter cells
during cell division. First developed in 1987 (Burke D T, Carle G
F, Olson M V, "," Science. 1987 May 15; 236(4803):806-12), YACs
have been used for cloning very large pieces of DNA for expression
in non-yeast hosts (e.g. in mice; Schedl, 1993), and for genome
sequencing (e.g. Krzywinski M, Wallis J, Gosele C, et al.,
"Integrated and sequence-ordered BAC- and YAC-based physical maps
for the rat genome," Genome Res. 2004 April; 14(4):766-79). They
are able to maintain up to 3 megabases of DNA. Of particular
interest for our project, YACs have been developed whose copy
number can be amplified (Smith D R, Smyth A P, Moir D T.,
"Amplification of large artificial chromosomes," Proc Natl Acad Sci
USA. 1990 November; 87(21):8242-6). This is based on disrupting CEN
function, and selecting for cells with asymmet segregation of the
YAC. The authors showed that the system developed could increase
the copy number of a 560 Kb YAC to 13 copies, and of 120 Kb YAC to
20 copies. After 20 generations the 560 Kb YAC had fallen to 8.2
copies, and the 120 Kb YAC had fallen to 11.3 copies. These results
indicate that even these very large DNA fragments, with no, or
little selective benefit to the cell can be maintained with decent
stability. The copy number feature for YACs was originally created
in CEN plasmids (Chlebowicz-Sledziewska E, Sledziewski A Z.,
"Construction of multicopy yeast plasmids with regulated centromere
function," Gene. 1985; 39(1):25-31), and these plasmids are likely
the easiest option for expressing the .about.20 kb piece of DNA
that would comprise the "major" activities. In addition to these
features, researchers (Spencer F, Simchen G. "Transfer of YAC
clones to new yeast hosts," Methods Mol Biol. 1996; 54:239-52) have
shown that YACs can be transferred from one yeast host to another,
as well as being modified by homologous recombination.
[0402] For enzymes that are deemed necessary in only a single, or
double copy--"minor" components--a single large integrative
construct can be built, which will save the effort of producing a
large CEN plasmid, and create a more stable system.
Example 16
Assembly of Large Vectors for Expression of Multiple Genes
[0403] Assembly of genes into large constructs by homologous
recombination is well known in S. cerevisiae (Shao Z, Zhao H, Zhao
H., "DNA assembler, an in vivo genetic method for rapid
construction of biochemical pathways," Nucleic Acids Res. 2009
February; 37(2):e16. Epub 2008 Dec. 12)(Oldenburg K R, Vo K T,
Michaelis S, Paddon C., "Recombination-mediated PCR-directed
plasmid construction in vivo in yeast," Nucleic Acids Res. 1997
Jan. 15; 25(2):451-2). This represents a tool for both routine
cloning and for combining many genetic elements at once. Using the
enzymes tested above, we were able to assemble large CEN constructs
for expression of multiple genes in multiple copies. These vectors
were constructed with one of two markers (hph or zeocin marker),
with the ARS 1 origin of replication from S. cerevisiae, with a
disruptable centromere (CEN 4), and with a 2 micron element
present. This disruptable element was made by placing the inducible
Gal1 promoter upstream of the centromere. During growth on
galactose, the plasmid becomes unstable.
[0404] FIG. 33 demonstrates the ability to assemble four
endoglucanases simultaneously into a single vector (EG1 from A.
fumigatus under the control of the ENO1 promoter/PYK terminator,
EG4 from C. globosum under the control of the FBA promoter/PGI
terminator, EG5 from C. lucknowense under control of the GPM1
promoter and TPI terminator, and EG6 from C. globosum under control
of the ENO2 promoter and TDH3 terminator). Each cassette for
expression was amplified by PCR with overlapping sequences that
could recombine to form the final vector shown (actual vector is
circular, not linear). Several colonies picked from this
transformation all had activity on CMC, indicating that the EGs
were functionally expressed. The construct (pMU1943) was verified
by carrying out PCR across all of the junctions of the individual
pieces that were assembled. The yeast strain containing this
cassette was called M1509.
[0405] As outlined above, a similar CEN vector and strain were
created with the zeocin marker (pMU1666). EG1, EG4, EG5 and EG6
were successfully assembled by YML into CEN vectors with the zeocin
marker (strain M1553). PCR tests were done to confirm the junctions
between EG cassettes and between vector and cassettes for the first
(EG1) and last (EG4) cassettes.
[0406] CEN vectors were also built that had either 7 genes or 11
genes via yeast mediated ligation. Schematics for these two vectors
are shown in FIG. 34. These vectors were tested to verify the
presence of the inserts via PCR. The two vectors below demonstrate
that vectors as large as 23 kB and 35 kB, respectively can be
generated in this manner.
Example 17
Amplification of CEN Vectors for Multicopy Expression
[0407] Strain M1509 produced very few slow-growing colonies at TO
at a hygromycin concentration of 1000 .mu.g/ml. After growth in
YP+galactose, there was an increased number of colonies on
hygromcin 1000. These colonies also grew faster on YPD+hygromycin
1000 than colonies before the galactose treatment. This suggested
that the copy number may have increased with the galactose
treatment allowing faster growth and more colonies on the high
hygromycin concentration plate. However, a CMC assay revealed that
the endoglucanase activity both before and after the galactose
treatment remained almost the same (FIG. 35).
[0408] Outgrowth was also done in YPD without antibiotic for about
10 generations and the CMC activity before and after the outgrowth
remained fairly similar indicating the stability of the plasmid
(FIG. 36). Another interesting feature was that colonies from YPD
plate (no selection) after a galactose growth treatment showed
variable CMC activity, with some colonies having a large decrease
in activity (indicated by a very high standard deviations in FIG.
35). This indicates that the CEN vector was working as expected in
presence of galactose causing some cells to retain more copies of
plasmid and others to lose it.
[0409] As noted above, M1553 is a strain containing a CEN vector
with the zeocin resistance cassette and four endoglucanases EG1,
EG4, EG5 and EG6. This strain was tested for antibiotic resistance
and EG activity. Initially M1553 could grow up to a zeocin
concentration of 50 .mu.g/ml in YPD plates, and this strain
passaged in YPG (galactose) and zeocin at 50 .mu.g/ml showed
colonies when plated on YPD plates with zeocin at 100 .mu.g/m.
These zeocin (100)-resistant colonies also grew on YPD-zeo 500
ug/mL plates when re-streaked. Ten colonies from the YPD-zeo 100
ug/mL plate were compared against ten original CEN strain colonies
grown on YPD-zeo 50 ug/mL. Serial dilutions 1:5, 1:10, 1:20 and
1:40 were made from culture supernatants and a CMC assay was
carried out on the diluted supernatants.
[0410] FIG. 37 shows a comparison of the average performance of the
top 3 colonies from each of these plates at the different
dilutions. Colonies from the 100 ug/mL zeocin plate perform better
than the zeocin 50 ug/mL colonies indicating that amplification of
the CEN vector has occurred. Depending on the dilution analyzed
(the CMC assay appears to be at saturation in some dilutions), a
1.5 to 2.times. difference in CMCase activity can be observed
between the two sets of top colonies.
[0411] This demonstrates that growth in galactose to disrupt CEN
function coupled with selection via the zeocin marker can result in
vector amplification.
Example 18
Activity of a CEN Vector with Multiple EGs on PHW
[0412] A CEN vector with the zeocin resistance marker expressing
the A. fumigatus EG1, C. globosum EG4, C. lucknowense EG5, and C.
globosum EG6 from different promoters and terminators was created
in M0544 as described above. This vector was tested for its effect
on PHW hydrolysis in an unamplified state along with strains
expressing EG3 and Cel9A from 2 micron vectors (FIG. 38). The
results indicate that a 2.times. loading of a strain producing high
levels of the core enzymes (M1179) is equivalent to a 1.times.
loading of M1179 plus a 1.times. loading of the CEN vector strain
(or to a 1.times. loading of M1179 and a mixture of the CEN strain,
EG3, and Cel9A).
Example 19
Screening of Amylolytic Enzymes for Expression in Yeast
[0413] Over one hundred amylolytic, cellulolytic, and accessory
enzymes from yeast, fungi, bacteria and plants were screened for
functional expression in yeast. Most of the enzymes that were
selected for screening are summarized in Tables 15 and 16. The
bacterial enzymes marked "BC" are described in Table 7. The enzymes
from Tables 15 and 16 were expressed in yeast and screened by
multiple assays individually or in combinations. Table 15 includes
67 genes (first 10 overlap with Table 16). For 32 genes functional
expression in yeast was confirmed (marked gray). Table 16 contains
81 genes; for 18 genes functional expression in yeast was confirmed
(gray). The information about gene sequences was obtained from NCBI
database or from proprietary Mascoma genome sequencing data (marked
* in the Table 16). The genes were either synthesized (GeneArt or
DNA2.0) or PCR amplified. Synthetic genes were either native DNA
sequences or codon optimized for S. cerevisiae. When PCR was used
to obtain genes, either genomic DNA or cDNA was used as template.
The genes used are described in the Tables 15, 16, or Table 7. The
sequences of the important genes used for construction of CBP
strains are listed in Table 19. The genes were expressed under ENO1
promoter and terminator from 2-micron plasmid pMU1575 (FIG. 41).
The genes were inserted between PacI/AscI sites of pMU1575 either
by cloning or yeast mediated ligation. Yeast and fungal genes were
expressed with their native signal sequences. Bacterial genes (such
as AE49) were attached to S. cerevisiae Invertase signal sequence.
Expression constructs were transformed into an industrial
background strain M1744, M509, or M0139 and selected on minimal URA
deficient media. Transformants were grown in YPD for 3 days and
supernatants were analyzed for activity. Data for the most active
alpha-amylases (AA), glucoamylases (GA) and alpha-glucosidases
(AGL) screened by starch-DNS, starch-GHK, maltose and Corn mash
assays are summarized in Table 17. The example of screening of
several enzymes for functional expression in yeast demonstrated on
FIG. 42. Secreted activity of strains expressing synthetic genes
was measured by Starch-DNS, Starch-GHK, and Maltose assays. FIG. 42
demonstrates that different enzymes have different activity on
different substrates revealing different mechanisms of action.
TABLE-US-00018 TABLE 15 Amylolytic and other enzymes that were
approved by FDA for feed and/or food use screened for functional
expression in yeast. Grey boxes indicate enzymes that demonstrated
functional expression in yeast. SE# AE# Organism Source Enzyme
Protein ID 1 6 Bacteria Bacillus subtilis Alpha-amylase AAA22194.1
2 13 Bacteria Bacillus subtilis Alpha-amylase ACM91731.1 3 14
Bacteria Bacillus subtilis Alpha-amylase CAL64397.1 4 17 Bacteria
Bacillus subtilis Maltogenic AAF23874.1 alpha-amylase 5 15 Bacteria
Bacillus subtilis Pullulanase AAC00283.1 6 16 Bacteria Bacillus
subtilis Isomaltase? AAG23399.1 7 18 Bacteria Bacillus subtilis
Isomaltase? BAA23408.1 8 19 Bacteria Bacillus subtilis Isomaltase?
ZP_03592917.1 9 20 Bacteria Bacillus subtilis Isomaltase?
BAA22245.1 10 2 Yeast Saccharomyces Glucoamylase AAA35107.1
cerevisiae 11 Fungi Aspergillus Glucoamylase AAP04499.1 niger 12
Fungi Aspergillus Glucoamylase BAA01540.1 oryzae 13 Fungi Rhizopus
Glucoamylase BAA00033.1 oryzae 14 Fungi Aspergillus Alpha-
BAA23616.1 niger glucosidase 15 Bacteria Bacillus Alpha-amylase
CAA01355.1 licheniformis 16 Bacteria Bacillus Pullulanase
AAU24646.1 licheniformis 17 Bacteria Bacillus Pullulanase
ABE68909.1 acidopullulyticus 18 Bacteria Bacillus subtilis Protease
ABJ99976.1 19 Bacteria Bacillus Protease AAZ77709.1 licheniformis
20 Fungi Aspergillus Beta-glucosidase CAB75696.1 niger 21 Fungi
Talaromyces CBH1 AAL89553 emersonii 22 Fungi Trichoderma CBH2
AAA34210.1 reesei 23 Fungi Trichoderma EG1 AAA34212.1
longibrachiatum 24 Fungi Trichoderma EG2 ABA64553.1 reesei 25 Fungi
Trichoderma EG3 BAA20140.1 reesei 26 Fungi Trichoderma Xylanase
CAA49294.1 reesei 27 Fungi Aspergillus Xylosidase CAK37179.1 niger
28 Fungi Aspergillus Xylosidase/Arabinofuranosidase CAK39870.1
niger 29 Fungi Aspergillus Ferulic acid CAA70510.1 niger esterase
30 Fungi Aspergillus Alpha-amylase CAA36967.1 niger 31 Fungi
Aspergillus Alpha-amylase CAA36966.1 niger 32 Fungi Aspergillus
Xylanase AAS46914.1 niger 33 Fungi Aspergillus Xylanase AAS46913.1
niger 34 Fungi Aspergillus Xylanase CAA03655.1 niger 35 Fungi
Aspergillus Isopullulanase BAA19473.1 niger 36 Fungi Aspergillus
Alpha-amylase XP_001402054.1 niger 37 Fungi Aspergillus
Endopolygalacturonase XP_001389562.1 niger 38 Fungi Aspergillus
Pectinase CAK42510.1 niger 39 Fungi Aspergillus Arabinotaranosidase
CAK42333.1 niger 40 Fungi Aspergillus Protease XP_001401093.1 niger
41 Plant Zea mays Pullulanase NP_001104920.1 42 Plant Oryza sativa
Pullulanase ACY56113.1 43 Plant Zea mays Isoamylase ACG43008.1 44
Fungi Aspergillus Lipase ABG73613.1 niger 45 Fungi Aspergillus
Lipase ABG73614.1 niger 46 Bacteria Bacillus Xylanase ABF61784.1
licheiliformis 47 Fungi Humicola Xylanase CAA53632.1 insolens 48
Fungi Talaromyces Xylanase CAD34597.1 emersonii 49 Fungi
Trichoderma Xylanase AAQ67413.1 viride 50 Plant Triticum
Pullulanase ABL84490.1 aestivum 51 Yeast Saccharomyces
Endopolygalacturonase NP_012687.1 cerevisiae 52 Yeast Kluyveromyces
Endopolygalacturonase AAR84199.1 marxianus 53 Bacteria Bacillus
subtilis Pectin lyase NP_389746.1 54 Bacteria Bacillus
Polygalacturonase YP_080606.1 licheniformis 55 Bacteria Bacillus
Pectin lyase YP_079258.1 licheniformis 56 Fungi Aspergillus
Endopolygalacturonase CAB72125.1 niger 57 Fungi Aspergillus
Endopolygalacturonase CAB72126.1 niger 58 Fungi Aspergillus
Endopolygalacturonase XP_001390812.1 niger 59 Fungi Aspergillus
Endopolygalacturonase CAB72931.1 niger 60 Fungi Aspergillus
Endopolygalacturonase CAK44164.1 niger 61 Fungi Aspergillus Pectin
lyase CAK48529.1 niger 62 Fungi Aspergillus Pectin lyase CAK37997.1
niger 63 Fungi Aspergillus Pectin lyase AAW03313.1 niger 64 Fungi
Aspergillus Pectin lyase CAK47350.1 niger 65 Fungi Aspergillus
Pectin lyase ACE00421.1 niger 66 Fungi Trichoderma Acetyl Xylan
Q99034 reesei Esterase 67 Fungi Aspergillus Feruoyl esterase
XP_001393337 niger 60 Fungi Aspergillus Endopolygalacturonase
CAK44164.1 niger 61 Fungi Aspergillus Pectin lyase CAK48529.1 niger
62 Fungi Aspergillus Pectin lyase CAK37997.1 niger 63 Fungi
Aspergillus Pectin lyase AAW03313.1 niger 64 Fungi Aspergillus
Pectin lyase CAK47350.1 niger 65 Fungi Aspergillus Pectin lyase
ACE00421.1 niger 66 Fungi Trichoderma Acetyl Xylan Q99034 reesei
Esterase 67 Fungi Aspergillus Feruoyl esterase XP_001393337
niger
TABLE-US-00019 TABLE 16 Amylolytic and other enzymes screened for
functional expression in yeast. *the gene sequence was obtained
from genome sequence sequenced by Mascoma. ##STR00007##
##STR00008## ##STR00009## ##STR00010## ##STR00011##
##STR00012##
TABLE-US-00020 TABLE 17 Activity screening summary for yeast made
alpha-amylases (AA), glucoamylases (GA), and alpha-glucosidases
(AGL). Amount of pluses reflects relative activity level. NT-not
tested. CO-codon optimized. Strains express individual enzymes on
2u vector pMU1575 in M0509 or M0139 background strains.
##STR00013## ##STR00014## * Strains expressed individual enzymes on
2u vector pMU1575 in M0509 or M0139 background strains
##STR00015##
Example 20
Screening of Amylolytic and Accessory Enzymes for Synergy with
AE8
[0414] Particular combinations of hydrolytic enzymes were selected
for the best conversion of particular substrates such as corn mash.
This was achieved due to screening of over one hundred enzymes for
functional expression in yeast, synergy with each other, and
performance in industrially relevant bioprocess conditions.
Particular combinations include: AE9; AE9+AE8; AE9+AE1; AE9+AE7;
AE9+AE10; AE9+AE8+AE10; AE9+AE7+AE10; AE9+AE7+AE8+AE10;
AE1+AE8+AE9+AE10; and all other combinations of AE1, AE7, AE8, AE9,
and AE10 (see Tables 16 and 19). Other particular combinations of
hydrolytic enzymes that demonstrated high glucose release from
substrates such as pretreated corn fiber and corn syrup
(concentrated liquid fraction left after corn mash fermentation)
include: "core" cellulases, xylanase, xylosidase, glucoamylase
(AE9), alpha-amylase (AE7), isopullulanase (SE35),
alpha-glucosidase (AE10), acetylxylan esterase (T. reesei AXE), and
pectinase.
[0415] The enzymes that had the best secreted activity in yeast
were combined and screened for the best synergy with each other.
FIGS. 43-45 demonstrate examples of screening enzymes in
combination. Several amylolytic enzymes were screened for synergy
with AE8 by Starch-DNS, Corn Mash and Fiber assays. Supernatants of
strains grown for 3 days in YPD were mixed with supernatant with
AE8 at 50:50 ratio. In the first sample of FIG. 43, AE8 supernatant
was 100%. Supernatant of M0509 host strain was used as negative
control. FIG. 43 shows that several AAs and SE11 glucoamylases had
positive effect on glucose release when added to AE8 compared to
when additional AE8 added. AE7 alpha-amylase had particularly
strong effect. FIG. 44 shows that on corn mash SE14
alpha-glucosidase had positive effect on glucose release when
combined with AE8.
[0416] The effect of arabinases and xylanases on glucose release
from non pretreated corn fiber in the presence of AE8 was also
analyzed (FIG. 44). FIG. 44 shows that Arab had positive effect on
glucose release from fiber. Several xylanases also had some effect
on glucose release from fiber when added to AE8 (FIG. 45). The
information obtained from the screening of enzyme combinations was
used to select the optimal set of enzymes for a particular
substrates such as corn mash, pretreated corn fiber and corn
syrup.
Example 21
Screening Industrial Strains for High Ethanol Yield and
Heterologous Protein Production
[0417] In order to choose the industrial host strain for
engineering amylases several industrial and Mascoma developed
strains were screened for production of ethanol from liquefied corn
mash in the presence of standard dose of commercial glucoamylases
(data not shown). Two of the best performing strains, M0212 which
is a well established high performance ethanologen, and M0139 which
is a high performance ethanologen from the distillery industry,
were chosen for further evaluation. Since success of the CBP
process is dependent on sufficient expression of heterologous genes
in an industrial yeast strain, the strains were compared for their
ability to express amylases. Three strains were evaluated: two
strains selected for high ethanol yield, M0212 and M0139, and
M0749--a Mascoma robust strain that does not achieve the ethanol
titers of M0212 and M0139 but is known to produce high levels of
heterologous proteins (McBride et al., WO 2010/06000056, 2010). The
activity levels of three different glucoamylases (AE3, AE8, and
AE49) were measured in culture supernatants of the above strains
when expressed from a multicopy 2.mu. pMU1575 plasmid. The results
are shown in FIG. 46 using maltose as the substrate. Similar
results were obtained using starch (data not shown). The results
clearly show that expression is lowest when M0212 is the production
platform for all enzymes tested. However, strain M0139 served as
the best secretion platform and is also a comparable ethanologen to
M0212. A similar trend was also observed when an alpha amylase
(SE15) was expressed in all three strain backgrounds and activity
was measured on starch. Based on these results M0139 strain was
selected as host background strain for engineering CBP strains.
Example 22
Engineering of Marker Free Stable Amylolytic Strains in Industrial
Background
[0418] Two approaches were utilized to engineer strains expressing
amylolytic enzymes: random integration and directed integration. In
both cases the genes were stably integrated into the genome. When
using a radon integration approach, amylolytic genes were
integrated into delta sites by selection of a linked auxotrophic
marker. Several genes were integrated at the same time in different
combinations and transformants were screened on starch containing
URA- plates. When the directed integration approach was used, the
genes were integrated into designated loci. Both approaches are
described in more details below.
Construction of Strains by Random Integration
[0419] In order to study the potential of random integration and
the starch plate selection approach for strain construction, four
integrative constructs with the most active amylolytic enzymes were
built (FIG. 47, top). The constructs contain alpha-amylase, 2
glucoamylases, and alpha-glucosidase under different promoters and
terminators attached to URA3 marker and flanked by delta
integration sites. The constructs were mixed at equal amounts in 7
different combinations (FIG. 47, bottom) and 3 .mu.g of total DNA
was transformed into industrial strains M1744 (M0139 background)
and M0749 (M0509 background). Transformants were plated on SD-URA
plates and on YM-Starch plates (1xYNB plus 0.5% starch). It was
found that starch selection without additional marker works for
strains with M0509 strain background but does not in M0139
background strains. Nevertheless the combination of starch and URA
selection worked for M0139 strains (a large number of background
colonies are obtained if only starch used as marker for M0139
strains). The transformants selected from both kinds of plates and
in both host backgrounds were screened by Starch-DNS assay. The top
hits were tested again in duplicates twice (FIG. 48). As a result
several strains were made with high secreted activity on starch.
The combinations that made the strains with the highest activity
included: AE9 alone, AE8+AE7, AE9+AE10, and AE9+AE7.
Construction of Strains by Directed Integration
[0420] The directed integration approach creates transgenic strains
with integration events that are easier to characterize. Any
mistargeting events can be easily identified with a Southern blot.
Additionally, strains engineered by directed approach are
potentially more stable since each expression cassette at the
chromosome is integrated into a unique site (not tested). URA3 and
FCY1 negative selection approaches were both developed. FCY1 was
eventually chosen as the marker of choice since fcy mutation did
not effect robustness of the strains. Using this technology, many
clean strains were built in the industrial strain background. FIG.
49 demonstrates how glucoamylase expression cassettes were
integrated into FCY1 locus. In this case, counter selection for the
FCY1 knock out also selects for integration of the glucoamylase
expression cassette. In the expression cassettes, the glucoamylase
genes are under control of a strong promoter from various central
metabolism genes. When multiple copies are used, the expression
cassettes containing the same sequences are oriented toward each
other to decrease the chance of spontaneous recombination. The
glucoamylase expression cassettes were transformed into industrial
strain M0139 as PCR products with homologous ends targeting the
upstream and downstream regions of the FCY locus. Since removal of
both copies of FCY is necessary for resistance to 5-fluorocytosine
(5-FC), each expression cassette was found to be integrated on both
chromosomes. A 2-.mu. plasmid, which contains a cassette to
expresses the Hygroinycin restisatnce gene marker (Hyg), was
co-transformed with the PCR products. The transformants were first
cultivated in liquid YPD+Hyg (300 ug/ml) media overnight and then
plated on media containing 5-fluorocytosine. Precultivation on
media with antibiotic increases efficiency of double FCY1
knock-out. This approach was also utilized with other negative
selection markers such as URA3. Genetic manipulations at the FCY
locus result in strains that are marker free and can be easily
modified by recycling the FCY marker. For instance, additional
copies of AE8 and AE9 could be placed at other loci.
[0421] FIG. 50 demonstrates how more glucoamylase copies could be
integrated into another site such as an
Adenine-phosphoribosyltransferase 2 (APT2) locus. In the first
round of transformation four additional GA expression cassettes are
amplified by PCR with homologous tails for each other and a region
upstream and down stream of the APT2 locus. Dominant markers (Nat
and Kan) and the FCY1 marker were integrated into APT2 locus into
industrial strain M1973 (already expressing 4 GA copies, FIG. 49)
as PCR products with overlapping ends together with 4 additional
GAs. The transformants were plated on YPD+Nat+Kan plates that allow
growth of cells that have both dominant markers integrated on the
chromosome. Transformants were screened for the high amylolytic
activity by Starch-DNS assay. The strain demonstrating the highest
activity was chosen and the Kan and Nat markers were removed by
transformation of two PCR products that have homologous ends for
each other, the APT2 upstream flanking region and the 5'-part of
AE9 expression cassette. The transformants were plated on
5-fluorocytosine containing media that selects for strains that
have lost FCY1. In this approach, expression cassettes can be
integrated into any yeast site as long is the event does not
perturb an essential function. The strains with the highest
activity on starch were evaluated further by corn mash fermentation
in bioreactors.
Example 23
Evaluation of Amylolytic Strains by Corn Mash Fermentation
[0422] Several amylolytic CBP strains that demonstrated the highest
activity in screening assays were evaluated for their ability to
produce ethanol from liquefied corn mash. The strains used for this
experiment were built by either directed or random integration and
express different combinations of amylases from Saccharomycopsis
fibuligera (Tables 18, 19). Background non-amylolytic M0139 strain
was used as control. Fermentations were performed in sealed shake
flasks on corn mash obtained from Valero bio-refinery at 30% solids
(TS) at a fermentation temperature of 32.degree. C. at a shaking
speed of 125 rpm. The fermentations were performed using 500 ppm
urea as the only nutrient source. Standard dose (0.45 AGU/g TS) of
commercial glucoamylase glucoamylase (Spirizyrne Ultra, Novozymes)
was added to the control strain M0139. All other strains were
fermented without any exogenous enzymes added. The ethanol produced
after 60 hours of fermentation shown in FIG. 52. FIG. 52 shows that
all CRP strains produced ethanol in an amount similar to the
control strain with full dose of glucoamylase. The T6-2 strain
produced the same amount of ethanol in 60 hrs without any added
enzymes as control strain M0139. This is the first demonstration of
full CBP effect demonstrated at commercial ethanol production
level, when yeast produced enzymes completely replaced exogenous
enzyme added in standard commercial process.
TABLE-US-00021 TABLE 18 Description of strains used for
fermentation in FIG. 52. The genes AE8, AE9, and AE10 described in
Tables 16 and 19. Strain Description M0139 Non-CBP strain with full
commercial dose of Glucoamylase (GA) M1973 Directed Integration
(DI) of 2AE8, 2AE9 at FCY site M2016 Directed Integration (DI) of
4AE9 at FCY site M2022 DI of MO1973 with 4 copies AE8 and 4 copies
AE9 at APT2 site T6-2 Random Integration (RI) of AE9 and AE10 at
delta sites
TABLE-US-00022 TAB1E 19 Protein and DNA sequences of amylases used
to build CBP strains. Seq Seq# Name Gene Source Protein DNA 1 AE1
Gene was MQISKAALLASLAALVY atgcaaatttcaaaagctgctttgcttgcctcatt
obtained AQPVTLFKRETNADKW ggctgcccttgtttatgctcaaccagtgactctat by
PCR with RSQSIYQIVTDRFARTD tcaaaagagaaactaatgctgataaatggag
Saccharomycopsis GDTSASCNTEDRLYCG
atcacagtctatttatcaaattgtcactgacaga fibuligera GSFQGIIKKLDYIKDMG
tttgctagaaccgatggtgatacaagtgcttcct genomic DNA as
FTAIWISPVVENIPDNTA gtaacacagaagatagactttactgtggtggtt template
YGYAYHGYWMKNIYKI ctttccaaggcatcataaagaagttggattaca (ATCC#9947)
NENFGTADDLKSLAQE tcaaagatatgggctttactgctatttggatttctc
LHDRDMLLMVDIVTNH cagttgttgaaaacattcccgataacacagca YGSDGSGDSIDYSEYT
tatggttatgcttatcatggttactggatgaaga PFNDQKYFHNYCLISNY
acatatacaaaattaatgaaaactttggtactg DDQAQVQSCWEGDSS
ctgatgatttgaagtctttggcacaagaattgca VALPDLRTEDSDVASVF
cgatcgtgatatgttgttaatggtcgatatcgtta NSWVKDFVGNYSIDGL
ccaaccattacggcagtgatggcagtggaga RIDSAKHVDQGFFPDF
tagtatcgattactcagagtacaccccgttcaa VSASGVYSVGEVFQGD
cgaccaaaagtacttccataactactgtcttatt PAYTCPYQNYiPGVSN
tcaaactatgatgaccaagctcaggttcaaag YPLYYPTTRFFKTTDSS
ttgctgggaaggtgactcttcagttgcattacca SSELTQMISSVASSCSD
gatttgagaacggaagatagcgacgtggcct PTLLTNFVENHDNERFA
cagttttcaattcttgggttaaagattttgttggca SMTSDQSLISNAIAFVLL
attactcaattgatggtttaagaattgatagtgct GDGIPVIYYGQEQGLS
aaacatgtggaccaaggctttttcccggattttg GKSDPNNREALWLSGY
ttagtgcatctggagtttactcagtaggcgaagt NKESDYYKLIAKANAAR
tttccaaggagacccagcttatacatgcccata NAAVYQDSSYATSQLS
ccaaaattacattccaggggttagtaattatcc VIFSNDHVIATKRGSVV
attgtactacccaaccacgagattttttaaaact SVFNNLGSSGSSDVTIS
actgattcaagttccagtgagttgactcaaatg NTGYSSGEDLVEVLTC
atttcaagcgttgcttccagttgttcggatccaa STVSGSSDLQVSIQGG
ctttgttgacaaactttgtagaaaatcacgataa QPQIFVPAKYASDICS
tgaaaggttcgcttcaatgaccagcgaccaa
agtttgatttctaatgctattgcatttgtccttttggg
tgatggtattcctgtcatttactatggacaagaa caaggcttgagcggaaaaagtgacccaaac
aacagagaggccttgtggttatccggctacaa caaagagagtgactattacaagctcattgcca
aagctaatgctgccagaaacgccgccgtttat caagactcaagctatgccacctcgcagctttct
gtgatcttttcaaatgaccatgttattgcaacaa
aaagaggcagcgttgtttctgttttcaacaacct
tggttccagcggttcttctgatgtgactatttcca
acacaggttacagttccggtgaggatttggtag aagttttgacatgcagtactgttagcggcagct
ctgacttacaagtttctatccaaggtggtcaac
cacaaatctttgttcctgctaaatatgcttctgac atttgttca 2 AE7 Gene was
MKFATILSTTALALSSLV atgaaatttgcaactatcttaagtacaactgctc obtained
ASKPIFLSKRDAGSSAA ttgcgctatcaagtttggttgcatccaagccaat by PCR with
AAWRSESIYQLVTDRF tttcttaagcaaaagggatgctggcagctctgc Debaryomyces
ARTDGSTSATCNTGDR tgctgcagcttggcgttctgaatctatctatcaa occidentalis
VYCGGTFQGIIDKLDYI cttgttaccgatagatttgccagaactgacgga genomic
QGMGFTAIWISPVVEQI tcgacttcagctacttgtaatactggagataga DNA as template
PDDTGYGYAYHGYWM gtatactgtgggggtactttccaaggtattattg (ATCC#26077)
KDIYAINSNFGTADDLK acaaattggattacatccaaggtatgggtttca
NLSNELHKRNMKLMVD ctgctatttggatttctccagttgttgaacaaattc
IVTNHYAWNGAGSSVA ctgatgatactggttatggttatgcttaccacgg
YSNYNPFNQQSYFHDY ctattggatgaaagatatttacgctataaattca
CLITNYDDQTNVEDCW aattttggtactgccgatgacttgaagaatctttc
EGDNTVSLPDLRTEDS aaatgaattgcataagagaaatatgaagctta DVSSIFNLWVAELVSNY
tggttgatattgttactaaccattatgcttggaat SIDGLRIDSAKHVDESF
ggtgccggtagcagtgttgcttactccaactac YPSFOSAAGVYLLGEV
aatccattcaaccaacaatcctacttccacgat YDGDPAYTCPYQNYMS
tattgtttaattacaaattacgatgatcaaacca GVTNYPLYYPMLRFFQ
atgttgaagattgctgggaaggcgataatact GTSNSVDELNAMISSLE
gttagtttaccagatcttcgtactgaggattcag SDCKDITLLGNFIENHD
atgttagctctattttcaatctgtgggttgctgagtt QPRLPSYTSDSALIKNAI
agtttctaattactcaattgatggtttaaggattg AFNLMSDGIPIIYYGQE
acagtgctaagcatgttgatgaatcattctacc QGYSGSSDPNNREAL
catcattccaaagtgctgcaggtgtctatcttctt WLSGYSTSNGYYKLISS
ggagaagtttatgacggtgatccagcttacact VNQIRNQAIYKDSKYTT
tgcccataccaaaactatatgtcaggggttact YWSDVLYASGHVIALQ
aactatcctttgtactatccaatgttaagattcttt RGADDQRIVSVFNNLG
caaggtacttctaactctgtcgatgaattaaatg SSGSQPTIFSTKYSGG
ctatgatttcaagtttagaaagtgattgtaagga EKVVDVLTCQTSYANS
tattactttattgggtaatttcattgaaaaccatg DSTLTVSISGGAPRIYA
atcaaccaagattaccatcttatacttctgatag PASLIANSGICNF
tgccttaatcaaaaatgcaattgcgtttaatttaa
tgtcagatggtattccaattatttactacggtcaa gaacaaggttacagtggtagctccgatccaa
acaacagagaagcattatggttatctggttaca
gcactagtaatggttactacaaacttatctcttc
agttaatcaaattagaaaccaagccatttataa ggatagcaaatacactacttattggagtgatgt
gttatacgcttcaggtcatgttattgctcttcaaa
gaggtgcagacgaccaaagaattgtttctgtct ttaacaatttaggctcaagcggatctcaaactg
taacattcagtactaaatacagcggtggagaa
aaagtcgttgacgttttaacttgtcaaacttcata
cgccaactcggatagtactttacctgtctctatt
agtggtggcgctccaagaatttatgctcctgctt ctcttattgcaaattctggaatttgcaacttc
3 AE8 Gene was MRFGVLISVFAAIVSALP
atgagattcggtgttttaatctccgtctttgctgct obtained LQEGPLNKRAYPSFEA
attgttagtgctttacctttgcaagaaggtcctttg by PCR with YSNYKVDRTDLETFLDK
aacaaaagagcctatccttcttttgaagcttatt Saccharomycopsis
QKEVSLYYLLQNIAYPE caaactataaagttgacagaactgacttggaa fibuligera
GQFNNGVPGTVIASPS accttcttggacaaacaaaaagaagtatcttta genomic DNA as
TSNPDYYYQWTRDSAI tactatcttttacaaaacattgcttatcctgaagg template
TFLTVLSELEDNNFNTT ccaatttaataatggtgttcctggtactgttattgc (ATCC#9947)
LAKAVEYYINTSYNLQR ttctccatcaacctctaatccggactactattac
TSNPSGSFDDENHKGL caatgaaccagagattccgcaattacatttttg GEPKFNTDGSAYTGAW
acagttctttctgaactagaagataataacttca GRPQNDGPALRAYAIS
ataccactttggccaaggcagttgagtactac RYLNDVNSLNEGKLVLT
attaacaccagttacaaccttcaaagaacca DSGGINFSSTEDIYKNII
gtaacccaagtggcagctttgatgatgaaaat KPDLEYVIGYWDSTGF
cataaaggcttgggagaaccaaaatttaaca DLWEENQGRHFFTSLV
cagatggttctgcatacaccggagcttggggg QQKALAYAVDIAKSFDD
agaccgcaaaatgatggtcctgctttgagagc GDFANTLSSTASTLESY
ttatgctatcagtagatacttgaatgatgtcaatt LSGSDGGFVNTDVNHI
ctttaaatgaaggtaaattagtattgactgattc VENPDLLQQNSRQGLD
aggtggtatcaacttttcttcaactgaagatattt SATYIGPLLTHDIGESSS
acaaaaatatcatcaaaccagacttggaatat TPFDVDNEYVLQSYYLL
gttatagggtactgggattctactgggtttgatct LEDNKDRYFVNSAYSA
ttgggaggaaaaccaaggcagacactttttta GAAIGRYPEDVYNGDG
caagcttggttcaacagaaagcccttgcttatg SSEGNPWFLATAYAAQ
ctgtcgatattgccaaaagttttgacgacggcg VPYKLAYDAKSASNDITI
actttgcgaacacactttcttcgactgcttctacc NKINYDFFNKYIVDLSTI
ctcgaaagttatttgagtggcagtgatggtgga NSAYQSSDSVTIKSGS
tttgttaatactgatgttaaccacattgttgaaaa DEFNTVADNLVTFGDS
cccagatttgcttcaacaaaactctagacaag FLQVILDHINDDGSLNE
gtctagattcagccacatatattggcccactttt QLNRYTGYSTGAYSLT
gactcatgatattggtgaaagcagctcaactc WSSGALLEAIRLRNKVK
catttgatgttgacaatgagtatgttttgcaatca ALA
tattacttgttattggaggataacaaagacaga
tactttgttaacagtgcttattctgctggtgcagct
attggcagatacccagaagatgtttacaatggt
gatggttcatctgaaggcaatccatggttcttag
ctactgcctatgctgcccaagttccatacaaac ttgcttatgatgcaaagtcggcctcaaatgaca
ttaccattaacaagattaactacgatttttttaac
aagtatattgttgatttatctaccatcaattctgctt
accagtcttctgatagtgtcaccattaaaagtg
gctctgatgaatttaacacggttgctgataatttg
gtcacattcggtgattcctttttgcaagtcattttg
gatcatattaatgatgatggctccttgaatgaac
aacttaacagatataccggttattccaccggtg
cctactctttgacatggagcagtggtgctcttctt gaagctartagacttagaaataaggtcaagg
ctttggcttaa 4 AE9 Gene was codon MIRLTVFLTAVFAAVAS
atgatcagattgaccgttttcttgaccgctgttttt optimized for CVPVELDKRNTGHFQA
gctgctgttgcttcttgtgttccagttgaattggat S.cerevisiae and
YSGYTVARSNFTQWIH aagagaaacaccggtcatttccaagcttattct synthetized by
EQPAVSWYYLLQNIDY ggttataccgttgctagatctaacttcacccaat GeneArt
PEGQFKSAKPGVVVAS ggattcatgaacaaccagctgtttcttggtacta
(PubMed#CAC83969. PSTSEPDYFYQWTRDT cttgttgcaaaacatcgattacccagaaggtc
1) AITFLSLIAEVEDHSFSN aattcaaatctgctaaaccaggtgttgttgttgct
TTLAKVVEYYISNTYTL tctccatctacatctgaaccagattacttctacc
QRVSNPSGNFDSPNHD aatggactagagataccgctattaccttcttgtc
GLGEPKFNVDDTAYTA cttgattgctgaagttgaagatcattctttctcca
SWGRPQNDGPALRAY acactaccttggctaaggttgtcgaatattacat
AISRYLNAVAKHNNGKL ttccaacacctacaccttgcaaagagtttctaat
LLAGQNGIPYSSASDIY ccatccggtaacttcgattctccaaatcatgatg
WKIIKPDLQHVSTHWST gtttgggtgaacctaagttcaacgttgatgatac
SGFDLWEENQGTHFFT tgcttatacagcttcttggggtagaccacaaaa
ALVQLKALSYGIPLSKT tgatggtccagctttgagagcttacgctatttcta
YNDPGFTSWLEKQKDA gatacttgaacgctgttgctaagcacaacaac LNSYINSSGFVNSGKKH
ggtaaattattattggccggtcaaaacggtattc IVESPQLSSRGGLDSAT
cttattcttctgcttccgatatctactggaagatta YIAALITHDIGDDDTYTP
ttaagccagacttgcaacatgtttctactcattg FNVDNSYVLNSLYYLLV
gtctacctctggttttgatttgtgggaagaaaatc DNKNRYKINGNYKAGA
aaggtactcatttcttcaccgctttggttcaattg AVGRYPEDVYNGVGTS
aaggctttgtcttacggtattccattgtctaagac EGNPWQLATAYAGQTF
ctacaatgatccaggtttcacttcttggttggaa YTLAYNSLKNKKNLVIE
aaacaaaaggatgccttgaactcctacattaa KLNYDLYNSFiADLSKID
ctcttccggtttcgttaactctggtaaaaagcac SSYASKDSLTLTYGSD
atcgttgaatctccacaattgtcatctagaggtg NYKNVIKSLLQFGDSFL
gtttggattctgctacttatattgctgccttgatca KVLLDHIDDNGQLTEEI
cccatgatatcggtgatgatgatacttacaccc NRYTGFQAGAVSLTWS
cattcaatgttgataactcctacgttttgaactcc SGSLLSANRARNKLIEL
ttgtattacctattggtcgacaacaagaacaga L tacaagatcaacggtaactacaaagctggtg
ctgctgttggtagatatcctgaagatgtttacaa
cggtgttggtacttctgaaggtaatccatggca
attggctactgcttatgctggtcaaactttttaca
ccttggcctacaattccttgaagaacaagaag aacttggtcatcgaaaagttgaactacgacttg
tacaactccttcattgctgatttgtccaagattga
ttcttcctacgcttctaaggattctttgactttgacc
tacggttccgataactacaagaacgttatcaa
gtccttgttgcaattcggtgactcattcttgaagg
ttttgttggatcacatcgatgacaacggtcaatt gactgaagaaatcaacagatacaccggttttc
aagctggtgcagtttctttgacttggtcatctggtt
ctttgttgtctgctaatagagccagaaacaagtt gatcgaattattg 5 AE10 Gene was
codon MIWLKLSLYSLAFALFA atgatctggttgaagttgtccttgtactctttggctt
optimized for DAAPVSSGEEAETSSS
ttgctttgtttgctgatgctgctccagtttcttctggt S.cerevisiae and
TSSSAPAQITVDNELTL gaagaagctgaaacttctagctctacttcttcat synthetized by
GVSQVPNIVNKTAIDAN ctgctccagctcaaattaccgttgataacgaat GeneArt
EAAKGYDLVNVTTTAK tgaccttgggtgtttctcaagttccaaacatcgtt
(PubMed#CAF31354. GLTGILKLNEATNIYGY
aacaagaccgctattgatgctaatgaagctgc 1) DFDYLNLSVEYQSDDR
taaaggttacgatttggttaacgttactactactg LNVHIEPVDTDNVFILPE
ctaagggtttgaccggtattttgaagttgaatga SLVAKPSADDGDKIESF
agccactaacatctacggttacgatttcgatta HFGGSSDLVFEYSSKN
cttgaacttgtccgtcgaataccaatccgatga FGFEILRKSTGKSIFSTI
tagattgaacgttcacatcgaaccagttgatac GNPLVFSNQFIQFNTSL
cgataacgttttcattttgccagaatccttggttg PKDHFITGLGESIHGFR
ctaaaccatctgctgatgatggtgataagatcg NEPGIVKTLYANDIANPI
aatcttttcatttcggtggttcctccgatttggttttt DGNIYGVHPFYIDQRFD
gaatactcttccaagaacttcggtttcgaaatct TNATHGVYWRTSAIQE
tgagaaagtctaccggtaagtctattttctccac VAVGNESLTWRALSGI
tattggtaacccattggttttctccaatcaattcat VDLYFFSGPKPKDVIQQ
ccaattcaacacatccttgccaaaggatcattt YVKEVGLPTFQPYWAL
cattactggtttgggtgaatccatccatggtttta GYHQCRWGYDTIEELD
gaaatgaaccaggtatcgtcaaaaccttgtac EVVENFKNFDIPLETIW
gctaatgatattgccaacccaatcgatggtaat SDIDYMDSYKDFTNDP
atctatggtgttcacccattctacatcgatcaaa HRYPLEKYQQFLDKLH
gatttgataccaacgctacccatggtgtttattg ENNQHYVPIIDAAIYVPN
gagaacttctgccattcaagaagttgctgttggt PENATDNDYDVFHYGN
aacgaatccttgacttggagagctttgtctggta ETDVFLKNPDGSLYIGA
tagttgacttgtactttttctccggtccaaaacct VWPGYTVFPDFLSENI
aaggatgtcattcaacaatacgtcaaagaagt QKYWTKVFKDWYQQIK
tggtttgccaacttttcaaccatattgggctttgg FDGIWLDMNEVSSFCV
gttaccatcaatgtagatggggttacgatacca GSCGSGKITDNPVHPP
tcgaagaattggatgaagtcgtcgaaaacttc FAVGGEATEFPEGFNK
aagaacttcgatattccattggaaaccatctgg TNGTEYASFTSSLAAAS
tccgatatcgattacatggattcctacaaggatt PTSDEDSSASSTSASID
tcaccaacgatccacatagatacccattggaa SLNTLAPGKGNINYPPY
aagtaccaacaattcttggacaagttgcacga AINNDQGDHDLATHAV
aaacaatcaacactacgttccaattattgatgc SPNATHQDGTLEYDVH
cgctatctacgttccaaatccagaaaatgctac NLYGYLETNATFEALLEI
cgataacgattacgatgttttccattacggtaac QPNKRPFIISRSSFAGS
gaaaccgacgtttttttgaagaatccagatggtt GRQTGHWGGDNYSQF
ccttgtacattggtgctgtttggccaggttatact RSAYFSIAQAFSFGLSG
gtttttccagatttcttgtccgaaaacatccaaa IPFFGADVCGFNGNSD
agtactggaccaaggttttcaaggactggtatc YELCSRWMQLGSFFPF
aacaaatcaagttcgatggtatctggttggata YRNHNILGAISQEPYVW
tgaacgaagtttcttctttctgtgttggttcttgtggt ESVTEATKTSMQIRYLL
tctggtaagattactgataacccagttcatcca LPYYYTLLHEAHITGIPIL
ccatttgctgttggtggtgaagctactgaatttcc RAFAWQFPENKNVSTV
agaaggtttcaacaagaccaacggtactgaa DTQFFVGDALVVTPALE
tacgcttctttcacttcttctttggctgctgcttctcc QGVDTVKGTFPGSGNE
aacttctgatgaagattcttctgcttcttctacctct EVYYDWYTHEKQNFTD
gcttctattgattctttgaacactttggctccaggt GKNETLQAPLGHIPLHI
aagggtaatattaactatccaccatacgccat RGGHILPTQEPAYTTTE
caacaacgatcaaggtgatcatgatttggcta SRQNPWGLIVALDKDG
ctcatgctgtttctccaaatgctactcatcaagat KAEGKLYSDDGESYEV
ggtactttggaatacgatgtccataacttgtacg EESLFVNFIASDNTLLST
gttacttggaaactaacgctactttcgaagcctt SYGEYEVEQPLANITIL
gttggaaatccaacctaacaaaagaccattc
GVENKPKEVKFDDSKV atcatctccagatcttcatttgctggttctggtag
DFTFENNTIFVTGLDDQ acaaactggtcattggggtggtgataattactct TEDGAFAKHFKLSW
caattcagatctgcctacttctctattgctcaagc
tttttctttcggtttgtccggtattccattttttggtgct
gatgtttgtggtttcaacggtaattccgattacga
attgtgttccagatggatgcaattgggttcattttt
cccattctacagaaaccacaacattttgggtgc
catttctcaagaaccatacgtttgggaatctgtt actgaagctactaagacctccatgcaaatca
gatatttgttgttgccttactactacaccttgttgc
atgaagctcatattaccggtatcccaattttgag agcttttgcttggcaattcccagaaaacaaga
acgtttctaccgttgatacccaattctttgttggtg
atgctttggttgttactccagctttggaacaaggt
gttgatactgttaagggtacttttccaggttctggt
aacgaagaagtttactacgattggtacaccca cgaaaagcaaaatttcactgacggtaagaac
gaaacattgcaagctccattgggtcatattcca
ttgcatattagaggtggtcatatcttgccaactc aagaaccagcttacactactactgaatctaga
caaaatccatggggtttgatagttgccttggata aggatggtaaagccgaaggtaaattatactcc
gatgatggtgaatcctacgaagttgaagaatc
cttgttcgttaacttcattgcttccgataatacctt
gttgtctacctcttacggtgaatatgaagtcgaa
caaccattggccaacattactattttgggtgttg aaaacaagccaaaagaagttaagttcgacg
attccaaggttgatttcaccttcgaaaacaaca
ccattttcgttaccggtttggatgatcaaactga
agatggtgcttttgctaagcactttaagttgtcttg g
Example 24
Evaluation of CBP Strains Performance on Raw Corn Mash
[0423] The performance of selected CBP strains was also evaluated
by fermentation of non-liquefied corn starch (FIG. 53). FIG. 53
demonstrates that even though the sets of enzymes expressed in
those CBP strains were not optimized for this substrate, over 80
.mu.l ethanol was produced by CBP strains from raw mash in 72 h
without any exogenous enzymes.
Example 25
Improving Strain Performance by Evolution
[0424] Yeast is known for its ability of adjustment to very broad
range of conditions. This property could be used to increase yeast
ethanol and high temperature resistance and improve performance
(ethanol yield) at certain relevant conditions such as during
fermentation of corn mash. To explore this possibility as a tool to
develop better CBP yeast strains that are able to reach higher
ethanol yield, one of the best CBP strains M1973 was evolved by
using serial transfer in corn mash. Serial transfer fermentations
were carried out using shake flasks containing 35% TS liquefied
corn mash with industrial medium grown at 35.degree. C. and 150
rpm. At 3 days intervals, 10 ml were transferred to fresh medium of
the same composition (5 transfers). At each transfer starting with
the second the temperature was raised 1 degree. At the last
transfer it was 38.degree. C. After 5 transfers (.about.500 hours),
the cell were plated on YPD plates for evaluation. The evolved
strain was evaluated by fermentation on liquefied corn mash at two
different temperatures (32.degree. C. and 35.degree. C.) and two
different concentrations of solids (30% and 35%). Original M1973
strain from the freezer stock was used as control (FIG. 54). FIG.
53 demonstrates that at all conditions tested adapted M1973 strain
was able to produce more ethanol than parental M1973 at 48 hrs.
Therefore evolution of yeast strains was proven to be a powerful
tool for developing better strains.
Example 26
Process Flow Sheet with CBP Strains
[0425] The example of CBP process in presented on FIG. 55. In this
example two yeast CBP strains are used in the process and cultured
separately, S1 and S2. Liquefied corn pre-treated with
alpha-amylases is fermented by yeast strain S 1. S1 has optimal set
of amylases and accessory enzymes engineered to efficiently convert
corn starch into glucose without any exogenous enzymes added. After
ethanol distillation the stillage is being pre-treated and
fermented by strain S2. S2 has cellulolytic set of enzymes
engineered and optimized for corn fiber conversion as well as
xylose and arabinose pathways. S2 also has amylolytic enzymes
engineered because more starch is being released while corn fiber
pretreatment. Ground raw corn mash could also be utilized. In this
case no alpha-amylase pre-treatment is necessary and alpha-amylase
could be expressed by strain S1.
Example 27
Screening and Characterization of Industrial Yeast Strains
[0426] The objective of this study was finding an industrial host
that will combine high temperature/ethanol tolerance and high
heterologous protein secretion. Several industrial yeast strains
were obtained from various commercial sources (Table 20). In order
to better understand the strains' relations with each other, all
strains were genotyped as described by Ness et al., 1993 (FIG. 56).
The similarity between band patterns or genotyping patterns
reflects strain's genetic similarity. Most of strains demonstrated
one of 2 genotyping patterns. One pattern was similar to M0139 and
other was similar to M2390. The pattern of M2392 was different from
others.
[0427] The industrial strains were compared for their ability to
grow at high temperature (FIG. 57). FIG. 57 shows that the strains
demonstrated significantly different growth at 41.degree. C. The
same pattern was confirmed when 41.degree. C. maximum growth rate
in WO was measured quantitatively by plate reader (FIG. 58, top).
The strains were also tested for robustness--maximum ethanol titer
reached on high solids with full enzyme dose (FIG. 58, bottom). A
comparison of the maximum growth data 41.degree. C. with robustness
data reveals that there is a positive correlation between high
temperature tolerance and high ethanol tolerance. Therefore, the
ability of strains to reach high ethanol titers could be estimated
by their 41.degree. C. maximum growth rate in high throughput
format. The data shown in FIGS. 56 and 58 are summarized in Table
21. The data in Table 21 demonstrate that strains from ethanol
industry (genotyping pattern B) tend to have higher ethanol and
high temperature tolerance compared to wine strains (genotyping
pattern A).
[0428] In order to compare ability of industrial strains to express
heterologous proteins, the host strains from Table 20 were
transformed with the same expression construct of
AE9--Saccharomycopsis fibuligera glucoamylase gene (Accession No,
CAC83969.1). Four copies of AE9 were directly integrated into FCY
locus. FCY was used as negative marker. The construct used was
similar to the one used for M2016 construction (Example 23). The
map of the expression construct used in this experiment shown on
FIG. 60. Several transformants for each host were picked and
screened for starch activity (FIG. 59). Different host strains
demonstrated different ability to secrete GA. Interestingly, two
batches of the same strain, M0212 and M2390, had different average
expression level of the same AE9 expression construct. Thus, it was
demonstrated that robust ethanol tolerant hosts from ethanol
industry like M2390 can be suitable host for engineering CBP
strains.
[0429] Transformants for each host that were the most active on
starch (Table 22) were tested in shake flask fermentation on raw
corn flour and conventional corn mash together with non-transformed
hosts (FIG. 61-62). FIGS. 61 and 62 demonstrate that both host
strains M0212 and M2390 and their GA transformants, M2395 and
M2399, have superior performance on both tested substrates compared
to other tested industrial strains. M2390 had higher average GA
expression/secretion level than M0212 and therefore was chosen as
the host to engineer CBP strains.
TABLE-US-00023 TABLE 20 Industrial ethanologen strains used in the
study. Strain Mascoma# name Producer Reference M139 N96 Anchor wine
http://www.anchorwineyeast.com/pdf/N_96.pdf yeast M212 Ethanol
LaSaffre http://www.lesaffreyeastcorp.com/home/ Red (old) M2390
Ethanol LaSaffre
http://www.pahc.com/Phibro/Performance-Products/Catalog/23/Ethanol-Red.ht-
ml Red (new) M2394 FALI ABMauri
http://www.alcoholyeast.com/downloads/doc1.pdf M2393 Premier
LaSaffre http://mountainhomebrew.com/premiercuvee-5grampackage.aspx
Cuvee M2392 Lalvin ICV- Lallemand
http://www.lalvinyeast.com/images/library/ICV-K1_Yeast.pdf K1
(V1116) M2391 Lalvin EC- Lallemand
http://store.homebrewheaven.com/lalvin-ec-1118-champagne-wine-yeast-p1076-
.aspx 1118 M2507 NABC Bio- North
http://www.na-bio.com/index.php?option=com_content&view=article&id=74&Ite-
mid=263 Ferm XR America Bioproducts
TABLE-US-00024 TABLE 21 Summary of industrial strains screening.
The summary is based on the data shown on FIGS. 56 and 58. EtOH 41
C on Main Genotyping growth flour Mascoma# application pattern rate
g/l M0139 Wine M130 like 0.03 132 M0212 Ethanol M212 like 0.21 141
M2390 Ethanol M212 like 0.16 143 M2394 Ethanol M212 like 0.17 143
M2393 Wine M139 like 0.03 132 M2392 Wine New 0.08 124 M2391 Wine
M139 like 0.18 146 M2507 Ethanol M212 like 0.35 147
TABLE-US-00025 TABLE 22 Industrial strains transformed with 4
copies of Saccharomycopsis fibuligera glucoamylase gene
(NCBI#CAC83969.1) and their most active on starch transformants
selected by starch assay (FIG. 59). Strain M2111 was made the same
way as M2016, only more colonies (84) were screened by starch
assay. Several the most active colonies were screened by industrial
corn mash fermentation and the best performing strain was named
M2111. Host strain Transformant M139 M2400, M2111 M212 M2399 M2390
M2395 M2394 M2398 M2393 M2397 M2391 M2396
Example 28
Increasing Heterologous GA Production by High Ethanol/Temperature
Tolerant Yeast Strain
[0430] The objective of this study was engineering
ethanol/temperature tolerant industrial yeast strain expressing
high level of heterologous glucoamylase. The strain M2111 was made
the same way as M2016 (Example 23), only more colonies (84) were
screened by starch assay. Even though it was demonstrated that
ethanologen M2390 host has much higher ethanol/temperature
tolerance compared to wine strain M0139 and performs significantly
better at high solids or high temp conditions when supplemented
with high dose of exogenous enzyme (Example 28), M2111 transformant
derived from M0139 (Table 22) has much higher AE9 secretion level
compared to M2395 derived from robust M2390 (FIG. 63). Due to high
level GA production, M2111 was reaching higher ethanol titer at
lower solids and lower temperature fermentations without exogenous
enzyme added compared to M2395. Therefore it was necessary to
increase GA production by M2390 host in order to improve CBP
performance--maximum ethanol reached at low or no exogenous enzyme
added. There is a significant activity variation between
transformants even when obtained with directed integration.
Therefore screening more transformants usually yields strains with
higher expression level. Only several transformants were screened
when M2395 was selected. In order to increase AE9 expression level
in M2390 host, M2390 was transformed with the same AE9 expression
construct as was used to obtain strain M2016. The expression
construct was integrated into FCY locus and FCY was used as
negative selection. About 1000 transformants were screened for
starch activity. Starch assay for the best 30 transformants was
repeated in triplicates (FIG. 63). Several transformants
demonstrated activity similar to M2111 and much higher than
M2395.
[0431] Seventeen of the most active transformants were screened for
CBP performance by minivial fermentation assay with corn flour and
homemade mash (FIGS. 64-65). The advantage of new robust background
was especially noticeable in corn flour fermentation experiment.
The new strains demonstrated significantly better performance
compared to less robust M2111 strain and reached higher ethanol
titers. Several best strains were further analyzed by shake flask
corn flour fermentation (FIG. 66). Results of shake flask
fermentation confirmed ability of new robust CBP strains to reach
above 140 g/l ethanol on 33% corn flour with 6 times less exogenous
enzyme added compared to standard raw corn flour process.
[0432] Time course fermentation of conventional mash (FIG. 67) and
raw corn flour (FIG. 68) was performed for one of the best
M2390+AE9 transformant--M2691 strain (P10-19). Untransformed host
M2390 was used as a control in both experiments. On corn mash,
M2691 was fermented without any exogenous enzymes added, while
standard (for corn mash process) dose of commercial glucoamylase
(0.3AGU/g solids) was added to the control M2390. On corn flour,
standard for raw substrate GA dose (0.6AGU/g) was added to the
M2390 and 6 times less enzyme was added to GA expressing M2691
strain. FIG. 67 demonstrates that in conventional liquefied corn
mash fermentation process genetically engineered GA producing
strain is able to provide complete CBP and reach above 125 g/l
ethanol at 72 hours. To our knowledge, this is the first time
demonstration of high industrially relevant ethanol titers reached
by genetically engineered strain without any exogenous enzymes
added. FIG. 68 demonstrates that on raw corn substrate GA producing
strains can reach even higher ethanol titer (above 140 g/L at 72 h)
which is a standard for raw corn flour fermentation industry. Small
dose of exogenous enzyme still needs to be added to the engineered
strain to provide optimal fermentation, but amount of exogenous
enzyme added can be decreased several fold.
Example 28
Increasing Heterologous GA Production Effects Exogenous Enzyme Dose
Reduction
[0433] FIG. 69 demonstrates how amount of GA heterologously
produced by yeast strains effects exogenous enzyme dose reduction.
Three strains were used for this experiment: untransformed M2390,
low GA producer M2395, and high GA producer M2519 (P6-65). The
strains were fermented on corn flour in shake flasks with different
dose of GA added. Standard corn flour industrial GA dose of
0.6AGU/g solids was counted as 100%. This data clearly demonstrate
that amount of GA produced by yeast strain has significant effect
on exogenous GA dose reduction. For the specific exogenous GA used
(Spirizyme Ultra) there was at least 75% dose reduction due to
heterologously expressed GA by M2519 strain. Furthermore, at the
end of fermentation there was extra glucose present with GA
producing strains. It was shown in other experiments that this
glucose can be transformed into additional ethanol yield at 100%
exogenous enzyme dose if fermentation of corn flour performed at
lower 33% solids.
Example 29
Stability of Glucoamylase Expression
[0434] Stability of GA expression was tested for several M2390+AE9
strains. Data for strains M2519 and M2691 are shown in FIG. 70.
Strains were propagated in YPD, grown to stationary phase and
passaged with 100.times. dilution 11 times (1 passage equals about
9 generations). Several samples between passages were stocked. All
samples and original strain were plated and inoculated in YPD
together. Then activity on starch for all samples was measured in
the same starch assay. Out of nine strains tested only three lost
some activity (10-50%). Majority of the strains retained 100% of
their amylolytic activity for up to 99 generations. This data
indicated that most of strains built by directed integration are
genetically stable.
Example 30
Screening Saccharolytic Genes for Functional Expression in
Yeast
[0435] Multiple genes encoding for saccharolytic enzymes were
screened for functional expression in yeast (Table 23). The genes
were either synthesized by GeneArt (now Life Technologies) or
isolated by PCR from genomic DNA. Some genes were expressed with
native signal sequences and in others native signal sequence was
replaced by S. cerevisiae invertase signal sequence. Some synthetic
genes were codon optimized for expression in S. cerevisiae (by
GeneArt) and others were synthesized with native DNA sequence. All
genes were expressed under ENO1 promoter and terminator from
2-micron plasmid pMU1575. The genes were inserted between PacI/AscI
sites of pMU1575 either by cloning or yeast mediated ligation.
Expression contracts were transformed into an industrial background
Mascoma strain M1744 and selected on minimal URA deficient media.
Transformants were grown in YPD for 3 days and supernatants were
analyzed for activity on starch, puldulan, xyian, pNPX (xylosidase
activity), maltose and pectin (FIG. 71). The assays for each enzyme
were chosen based on predicted activity. The enzymes that
demonstrated secreted activity in one or more assays are
highlighted in Table 23. FIG. 71 shows results of pullulan, xylan
and pectin assays for some enzymes. Isopullulanase SE35 was active
on pullulan. Five xylanases were active on xylan and three pectin
lyases were active on pectin. Pullulanase SE41 had slight secreted
activity on pullulan. Glucoamylase AE82 had some secreted activity
on starch and maltose.
TABLE-US-00026 TABLE 23 Genes analyzed for functional expression in
yeast. For most genes protein sequence was obtained from NCBI
database. For genes marked with "*" DNA gene sequence was obtained
from Mascoma Thermoanaerobacterium saccharolyticum genome sequence
data. ##STR00016## ##STR00017##
Example 31
Identifying Enzymes and their Combinations that Increase Sugars
Release from Industrial Corn Substrates
[0436] Distiller corn syrup, which is a soluble fraction left from
processing corn to ethanol, was one of the substrates used to
identify enzymes that will allow releasing more sugars from corn
mash. Corn syrup contains soluble oligosaccharides that are left
undigested in corn mash hydrolysis/fermentation process. Several
yeast-made enzymes were tested for conversion of corn syrup.
Several enzymes: CBH1, CBH2, EG2, BGL, XYL, and XLD were purified
by ion exchange and hydrophobic interaction chromatography on the
FPLC from yeast supernatants (Table 24). For others yeast strains
expressing enzymes were grown for 3 days in YPD and supernatants
were used as enzyme source. Table 24 summarizes the information on
enzymes used in this experiment. Supernatants of two enzymes were
mixed in equal ratio by volume. Supernatants of single enzymes were
mixed with supernatant of empty strain control M0139. FIG. 72 show
the results of one of those assays. The experiment was done with
and without yeast made glucoamylase (AE9). Table 25 shows how much
of each purified enzyme was used in this corn syrup assay. Addition
of some enzymes increased sugars release from corn syrup. AE9
itself had the biggest impact indicating that there is a lot of
starch left undigested after corn mash processing. Other enzymes
such as alpha-glucosidase, beta-glucosidase, acetyl xylan esterase
(in combination with cellulases and hemicellulases) also gave
essential increase in glucose release from corn syrup.
[0437] Based on this data, several genes were selected that have a
potential to improve AE9 glucoamylase expressing strain M2111 due
to increased sugar release from corn mash or corn flour. The
selected genes are listed in Table 26. Other candidates in Table 26
were chosen based on a rational approach based on which enzymes may
have effect on sugar release based on substrate structure (Saulnier
et al., Carbohydrate Polymers, 26: 279-287, 1995). All genes
selected demonstrated functional expression in yeast.
TABLE-US-00027 TABLE 24 Enzymes used in corn syrup assay (FIG. 24).
All enzymes except AE9 were expressed on 2u plasmid under S.
cerevisiae ENO1 promoter and terminator from 2-micron plasmid
pMU1575. AE9 in M2111 was expressed from 4 gene copies integrated
into chromosome (the same as in M2016). The genes were codon
optimized for S. cerevisiae and synthesized by GeneArt. Yeast and
fungal genes were expressed with native signal sequences. Bacterial
gene was attached to S. cerevisiae Invertase signal sequence. ID
Strain Source Enzyme Reference Enzyme prep CBH1 Talaromyces
cellobiohydrolase I WO/2010/060056 HPLC purified emersonii
Trichoderma reesei CBH2 Chrysosporium cellobiohydrolase II
WO/2010/060056 HPLC purified lucknowense EG2 Trichoderma reesei
endoglucanase II WO/2010/060056 HPLC purified BGL Saccharomycopsis
beta-glucosidase WO/2010/060056 HPLC purified fibuligera XYL
Clostridium Xylanase (BC60) NCBI# HPLC purified phytofermentans
YP_001558623.1 XLD Pyrenophora triticirepentis beta-xylosidase
NCBI# HPLC purified XM_001940921.1 NC M139 None none none
Supernatant AE9 M2111 Saccharomycopsis Glucoamylase (AE9) NCBI#
Supernatant fibuligera CAC83969.1 ABF M1511 Aspergillus niger
arabinofuranosidase NCBI# AAA93264 Supernatant AXE M1782
Trichoderma reesei acetylxylanesterase NCBI# Q99034 Supernatant FAE
M1475 Aspergillus niger feruoyl esterase NCBI# Supernatant
XP_001393337 ARA M2069 Bacillus arabinase NCBI# Supernatant
licheniformis AAU41895.1 AE10 M1923 Saccharomycopsis
alpha-glucosidase NCBI# Supernatant fibuligera CAF31354.1 SE35
M2614 Aspergillus niger isopullulanase NCBI# Supernatant
BAA19473.1
TABLE-US-00028 TABLE 25 Amounts of purified enzymes used in corn
syrup assay experiment (FIG. 72) in mg of enzyme per g of total
solids. Load Protein mg/g CBH1 1.6 CBH2 1.6 EG2 0.6 BGL 0.2 XYL 0.4
XLD 0.2
TABLE-US-00029 TABLE 26 Enzymes selected to be expressed in M2111
strain alone or in combinations. SBD--starch binding domain. Gene
ID Source Enzyme AE1 Saccharomycopsis fibuligera alpha-amylase AE3
Debaryomyces occidentalis alpha-glucosidase AE5 Debaryomyces
occidentalis alpha-amylase AE7 Debaryomyces occidentalis
alpha-amylase AE8 Saccharomycopsis fibuligera glucoamylase AE8 +
SBD Saccharomycopsis fibuligera S. f. glucoamylase + SBD
Aspergillus niger of A. n. glucoamylase (SE11) AE9 Saccharomycopsis
fibuligera glucoamylase AE10 Saccharomycopsis fibuligera
alpha-glucosidase AE22 Clostridium phytofermentans pullulanase AE73
(ARA) Bacillus licheniformis arabinase SE20 Aspergillus niger
beta-glucosidase SE32 Aspergillus niger xylanase SE33 Aspergillus
niger xylanase SE34 Aspergillus niger xylanase SE35 Aspergillus
niger isopullulanase SE39 (ABF) Aspergillus niger
arabinofuranosidase SE47 Humicola insolens xylanase SE48
Talaromyces emersonii xylanase SE66 (AXE) Trichoderma reseei acetyl
xylan esterase SE67 (FAE) Aspergillus niger feruoyl esterase BC60
(XYL) Clostridium phytofermentans xylanase FAE2 Talaromyces
stipitatus feruoyl esterase
Example 32
Construction and Screening of Improved Amylolytic Strains
[0438] To make a transformation host for additional AE9
saccharolytic. enzymes expression, URA3 was knocked out of M2111
and the resulting M2125 strain was used as a host for
transformations. For each enzyme from Table 26 integrative
expression cassette was built targeting delta sites on chromosome.
URA3 gene was used as autotrophic selection marker. Each gene of
interest under control of S. cerevisiae strong constitutive
promoter and terminator was inserted between URA3 and Delta2
fragments of pMU2382 vector digested with BamHI and EcoRI (FIG.
73). The expression cassette was inserted by yeast mediated
ligation in the same orientation as URA3. The fragment that
includes delta sites, URA3 and expression cassette was isolated by
PCR or restriction digest and transformed into M2125. Some enzymes
were transformed individually and others were transformed in
combinations. When more than one gene was transformed, different
DNA fragments were mixed in equal ratio (total DNA amount the same
as for single genes, about 1 .mu.g). For each transformation about
100 colonies were picked (one 96 wp) and pre-screened by specific
assays (for example, xylan assay for xylanases integrated, starch
assay for alpha-amylases). Consequently several of the most active
transformants were assayed by corn flour assay and screened for
increased sugars release. For each assay, transformants were grown
in YPD for 3 days and supe was assayed. The example of secondary
corn flour assay is shown on FIG. 74. FIG. 74 shows that many
transformants demonstrated activity above parental M2111 strain.
The transformations screened in this experiment are described in
the Table 27.
[0439] Transformers that released the most sugars in corn flour
assay (highlighted in FIG. 74) were selected for screening by
fermentation. First strains were pre-screened by minivial
fermentation assay on two substrates: homemade corn mash and raw
corn flour. Homemade mash and corn flour were picked as screening
substrates because they allow better discrimination between
different strains (tougher substrate), while industrial corn mash
is too digestible to allow noticing the small differences between
strains. Each substrate generated different groups of the best
performers. The only strains that seemed to perform well on both
substrates were strains with AE7 (Debaryomyces occidentalis
alpha-amylase) integrated. The next step of screening was scaled up
to shake flasks and also was done on the same two substrates, but
different sets of strains were used for each substrate depending on
performance in minivials assays. The results of shake flask
screening experiments are shown on FIGS. 75 and 76. FIGS. 75 and 76
show that several different saccharolytic genes and their
combinations had positive effect on ethanol titer. Confirming the
minivials assay results, AE7 had positive effect on both
substrates.
[0440] Remaking the M2111 strain was attempted in order to increase
AE9 production.
[0441] It was noticed that there is a significant activity
variation between transformants even when obtained with directed
integration. Therefore, screening more transformants usually yields
strains with higher expression level. Only 84 transformants were
screened when M2111 was selected. In order to increase AE9
expression level, M139 was transformed with the same AE9 expression
construct as was used for making the M2111 strain. The expression
construct was integrated into FCY locus and FCY was used as
negative selection. About 1000 transformants were screened for
starch activity. Several transformants demonstrated activity higher
than M2111. Several of the most active on starch transformants were
screened by minivials fermentation assay on homemade mash and raw
corn flour. Some transformants had higher EtOH yield compared to
M2111, on raw corn flour. In the follow up experiment, several best
strains were screened in shake flask fermentation on the same two
substrates (FIG. 77). This experiment confirmed that strains with
higher activity on starch reach higher ethanol titers on corn
flour. On homemade mash there is no significant difference
comparing to M2111. The performance difference on flour could be
due to higher secretion level of AE9. To test this hypothesis,
several of the best strains were inoculated and grown in YPD for 3
days. AE9 was measured by HPLC. The protein data was plotted in
FIG. 77 together with EtOH data. The correlation between AE9 level
production and EtOH yield was found for corn flour fermentation and
there is no such correlation for homemade mash. This data indicate
that on corn flour the strains are still GA limited, while on
homemade mash they are not.
[0442] The best performing strains that came out of screening on
homemade mash and raw corn flour were also tested on industrial
corn mash (FIGS. 78 and 79) which is the most commercially relevant
substrate for this application (used in majority of commercial corn
ethanol facilities). The best strains from that screen are
summarized in Table 34.
TABLE-US-00030 TABLE 27 Transformations ID (T) for corn flour
activity assay data from FIG. 74. S. cerevisiae promoter used with
each gene shown in parentheses. Transformation# Genes transformed 1
AE8 (TEF2p) 2 AE9 (ADH1p) 3 AE10 (FBA1p) 4 AE7 (ENO1p) 5 AE1
(ADH1p) 6 AE1 (TEF2p) 7 AE8 + SBD (ENO1p) 8 BC60 (ADH1p) 9 ARA
(ENO1p) 10 BC60 (ADH1p) + ABF (ENO1p) 11 BC60 (ADH1p) + AXE (ENO1p)
12 BC60 (ADH1p) + FAE1 (PFK2p) 13 BC60 (ADH1p) + FAE2 (PYK1p) 14
BC60 (ADH1p) + FAE1 (ENO1p) 15 SE32 (ENO1p) 16 SE33 (ENO1p) 17 SE34
(ENO1p) 18 SE35 (ENO1p) 19 SE47 (ENO1p) 20 SE48 (ENO1p) 21 SE35
(ENO1p) + AE8 (TEF2p) 22 SE35 (ENO1p) + AE10 (FBA1p) 23 SE35
(ENO1p) + AE7 (ENO1p) 24 SE35 (ENO1p) + BC60 (ADH1p) + ARA (ENO1p)
25 SE32 (ENO1p) + ABF (ENO1p) + AXE (ENO1p) 26 SE34 (ENO1p) + ABF
(ENO1p) + AXE (ENO1p) 27 SE35 (ENO1p) + AE8 (TEF2p) + AE7 (ENO1p) +
AE10 (FBA1p) 28 AE8 (TEF2p) + AE10 (FBA1p) + AE1 (ADH1p) 29 Empty
vector control 30 No DNA control 55 BC60 (ADH1p) + ARA (ENO1p)
TABLE-US-00031 TABLE 28 Strains expressing additional to AE9
saccharolytic enzymes selected for screening on corn mash in shake
flasks (FIG. 75). Strain # ID Strain description 1 T4-8 M2111 + AE7
2 T4-1 M2111 + AE7 3 T5-88 M2111 + AE1 4 b M2111 + AE1 + AE8 + AE10
5 d M2111 + AE1 + AE8 + AE10 6 i M2111 + AE1 + AE8 + AE10 7 o M2111
+ AE1 + AE8 + AE10 8 r M2111 + AE1 + AE8 + AE10 9 M2111 Control 10
M139 Control
TABLE-US-00032 TABLE 29 Strains expressing additional to AE9
saccharolytic enzymes selected for screening on corn flour in shake
flasks (FIG. 76). Strain # ID Strain description 1 T2-6 M2111 + AE9
2 T11-32 M2111 + BC60 + SE66 3 T18-11 M2111 + SE35 4 T5-88 M2111 +
AE1 5 T4-8 M2111 + AE7 6 b M2111 + AE1 + AE8 + AE10 7 i M2111 + AE1
+ AE8 + AE10 8 p M2111 + AE1 + AE8 + AE10 9 M2111 Control 10 M139
Control
TABLE-US-00033 TABLE 30 Strains expressing AE9 selected for
screening on homemade corn mash in shake flasks (FIG. 77, top).
Strain # ID Strain description 1 P4-19 M139 + AE9 2 P8-60 M139 +
AE9 3 P11-67 M139 + AE9 4 P12-65 M139 + AE9 5 P12-17 M139 + AE9 6
M2111 Control 7 M139 Control
TABLE-US-00034 TABLE 31 Strains expressing AE9 selected for
screening on corn flour in shake flasks (FIG. 77, bottom). Strain
Strain # ID description 1 P2-9 M139 + AE9 2 P11-20 M139 + AE9 3
P12-84 M139 + AE9 4 P12-65 M139 + AE9 5 P12-17 M139 + AE9 6 M2111
Control 7 M139 Control
TABLE-US-00035 TABLE 32 The best strains from shake flask screening
experiments on homemade mash and corn flour (FIGS. 75-77) selected
for screening on industrial corn mash in shake flasks (FIG. 78).
Strain # ID Strain description MXXXX 1 T2-6 M2111 + AE9 M2327 2
T4-1 M2111 + AE7 M2328 3 T4-8 M2111 + AE7 M2329 4 P11-67 M139 + AE9
(1000 colonies screen) M2330 5 P12-65 M139 + AE9 (1000 colonies
screen) M2331 6 P12-84 M139 + AE9 (1000 colonies screen) M2332 7
T2-25 M2111 + AE3 + AE5 + AE7 (D.o. genes) M2333 8 T2-40 M2111 +
AE3 + AE5 + AE7 (D.o. genes) M2334 9 T2-64 M2111 + AE3 + AE5 + AE7
(D.o. genes) M2335 10 T3-32 M2111 + AE3 + AE5 + AE7 (D.o. genes)
M2336 11 M2111 Control 12 ER Control 13 M139 Control
TABLE-US-00036 TABLE 33 The best strains from shake flask screening
experiments on homemade mash and corn flour (FIGS. 75-77) selected
for screening on industrial corn mash in shake flasks (FIG. 79).
Strain # ID Strain description MXXXX 1 T5-88 M2111 + AE1 M2337 2
T18-11 M2111 + SE35 M2338 3 b M2111 + AE1 + AE8 + AE10 (S.f. genes)
M2339 4 d M2111 + AE1 + AE8 + AE10 (S.f. genes) M2340 5 p M2111 +
AE1 + AE8 + AE10 (S.f. genes) M2341 6 T6-88 M2111 + SE32 + ABF
M2342 7 T11-12 M2111 + SE34 + AXE M2343 8 T11-45 M2111 + SE34 + AXE
M2344 9 T12-81 M2111 + SE34 + FAE1 M2345 10 M2111 Control 11 ER
Control 12 M139 Control
TABLE-US-00037 TABLE 34 Strains selected as best performers on
industrial corn mash (FIGS. 78 and 79). Strain ID Strain
description T11-45 M2125 + SE34 + SE66 T2-40 M2125 + AE3 + AE5 +
AE7 T4-8 M2125 + AE7 P12-84 M139 + AE9
Example 33
Stability of Strains Built by Directed and Random Integration
[0443] Stability of the M2111 strain built by directed integration
was tested. M2111 demonstrated remarkable stability. There was no
decrease in activity up to 99 generations in non-selective YPD
media (FIG. 80, top). In order to test if random integration
strains have sufficient stability for use in industrial
fermentation, two of the best performing strains from homemade mash
and corn flour shake flask fermentation experiment, T4-1
(M2125+AE7) and T2-6 (M2125+AE9) (FIGS. 75 and 76) were subjected
to the same stability test as M2111 (FIG. 80, bottom). FIG. 80
shows that even though these tested random strains do not have the
same level of stability as directed M2111, they lost very little
activity throughout propagation on YPD. There is no loss in
activity for upto 9-10 generations. Only 10% is lost at about 50
generations, and 20% at about 99 generations. The pattern of
activity decrease was very similar for two different random
strains. During industrial yeast preparation cells go through about
28 generations (volume increased 300000000 times). In propagation
stage cells go though about 4 generations and 4 generations during
fermentation. Thus, the total number of generations is about 36.
Therefore, no significant activity will be lost during all stages
of industrial application, considering that only 10% is lost at
about 50 generations.
Example 34
Integration Strategies for Directed Strains Construction Expressing
Multiple Enzymes
[0444] FIG. 81 demonstrates one site integration strategy (top) and
multiple sites strategy (middle) that could be used to construct
strains expressing multiple enzymes. In one site strategy, negative
markers alternate in each transformation round and all expression
cassettes integrated into the same locus next to each other. In
multiple sites strategy, positive and negative markers alternate
with each other and in each round of transformation the expression
cassette can be integrated into any site on chromosome.
Example 35
Expression of Several Cellulolytic Enzymes in a Single Yeast Strain
for Hydrolysis of Wood
[0445] From the data generated by mixing several cellulases in
assays in either crude or purified form, it was determined that a
strain producing multiple cellulolytic activities would increase
the ability of the expressing strain to hydrolyze lignocellulose.
To test this idea, strains of S. cerevisiae that expressed up to 7
enzymes simultaneously were created. Briefly, a robust, xylose
utilizing strain, M1577, was first engineered to make high levels
of the C. lucknowense CBH2.
[0446] Two transformations were carried out in series to generate
this strain. In the first step, plasmid pMU2115 was digested with
NotI to create an integration cassette that targets a CBH2
expression and zeocin selection cassette to the rDNA loci. Colonies
from this transformation were selected for on yeast extract (10
g/L), peptone (20 g/L), and xylose (20 g/L) containing agar with
zeocin (YPX+zeo), picked, and screened for enzyme activity in an
avicel assay protocol. Once the best transformant from those
screened was identified, this transformant was transformed again
with 2 additional constructs for CBH2 expression. One of these,
pMU2143 (digested with NotI) targets a CBH2 expression construct
and the kanamycin resistance marker to repeated tau1 genomic loci
in S. cerevisiae. The other plasmid, pMU2142 (also digested with
NotI) targets a CBH2 expression construct and the hygromycin
resistance marker to repeated tyB genomic loci. Following this
second transformation and selection on YPX agar plates with zeocin,
hygromycin, and G418 present, colonies were again screened using
the avicel assay method described below. The strain with the
highest CBH2 production was stored and named M1873. M1873 is
capable of producing .about.150 mg/L of CBH2 in shake flask
fermentations as measured by a HPLC assay.
[0447] M1873 was subsequently transformed with PCR cassettes that
were assembled by yeast via homologous recombination to create a
cassette that allows for co-expression of four cellulases
(endoglucanases) at the S. cerevisiae FCY1 locus. These four
endoglucanses were EG1 from Aspergillus fumigatus, EG2 from
Trichoderma reesei, EG3 from Neosartorya fischeri, and Cel9A from
Thermobifida fusca, all under control of different promoters and
terminators from S. cerevisiae (ENO1 promoter/PYK1 terminator, PMA1
promoter/ENO1 terminator, TPI1 promoter/FBA1 terminator, and PDC1
promoter/ENO2 terminator). Table 35 lists the primers and templates
used to generate the proper fragments for assembly. Table 37 lists
all the primer sequences and the plasmid sequences are listed below
as well. After transformation, strains were selected for resistant
to 5-fluorocytosine, which is toxic to cells that have an intact
FCY1 locus. In addition, strains were checked for their resistance
to Clonat, and checked by PCR (X10821/X10824) for an in tact FCY1
locus. Strains showing Clonat resistance and no native FCY1 locus
were screened for activity using the CMC activity assay, and the
PHW assay. The strain producing the most glucose from PHW was
stored and called M2217. The retention of CBH2 production was
confirmed by the HPLC assay.
[0448] After M2217 was built, a final transformation was used to
generate strains that also expressed the Talaromyces emersonii CBH1
fused with the CBD from Humicola grisea (pMU1392). This was carried
out in the same way as described above, only with a different set
of PCR products. In addition, two pieces for the gene assembly were
derived from a digestion of a plasmid, rather than as a PCR
product. Table 36 lists the fragments used. Two copies of an
expression cassette for a gene encoding a fusion protein between
the T. emersonii CBH1 and the Humicola grisea CBD (from the H.
grisea CBH1) were placed facing each other with integration flanks
specific to the .delta. sites of the Tyl transposon (FIG. 82).
Following transformation cells were plated to media containing 6.7
g/L Yeast Nitrogen Base and 20 g/L Cellobiose as the sugar source.
This media allows for selection of transformants based on selection
for expression and secretion of the S. fibuligera BGLI.
Transformants were then screened for activity in the PHW assay and
the top candidates were stored and given the numbers M2230, M2231,
and M2232.
[0449] After this set of strains had been built a final comparison
was carried out using the PHW assay. Briefly, the set of strains
was grown up aerobically in YPD media for 2 days in 48 well plates.
The supernatants from these cultures were added to PHW (4% total
solids final concentration), along with a small amount (2 mg/g) of
cellulase enzyme from Trichoderma reesei supplied by AB Enzymes and
buffer. The amount of glucose released from the PHW was followed
over time by HPLC. The data from this comparison can be found in
FIG. 83. M1873, producing only the C. lucknowense CBH2 provides a
large increase in activity relative to the control strain M1577 in
this test--an approximate 176% increase in glucose release. The
addition of set of four endoglucanases, provides another increase
relative to M1873 of 18%, and the addition of CBH1 and BGL provide
another 28% increase above that. Overall, strains producing 7
cellulolytic enzymes increase hydrolysis over the negative control
strain by >3 fold over the control strain, and by >50%
relative to a strain producing only a single enzyme.
[0450] A set of strains from those described above was subsequently
tested for its ability to impact the amount of ethanol produced
from pretreated hardwood. FIG. 84 presents data from simultaneous
saccharification and fermentation (SSF) reactions containing a
small amount of externally added cellulase enzyme. SSF conditions
were as follows: final solids loading was 18% (w/w) of substrate
MS887 (an insoluble substrate derived from pretreating hardwood
with water), 2 mg AB Enzyme cellulase preparation/g total solids,
10% v/v inoculum, 35.degree. C., pH 5.5 controlled with 5 g/L
CaCO.sub.3. The medium used was Corn Steep Liquor (CSL, 12 g/L) and
diammonium phosphate (DAP, 0.5 g/L). Reactions were carried out in
sealed plastic centrifuge bottles, fitted with vents and mixed via
large stir bars, by combining all the above ingredients in a 100
gram final mass batch culture, mixing at 225 rpm on a shaker, and
sampling over 160 hours. M1873 and M2232 both were able to produce
more ethanol under these conditions than non-cellulolytic M1577.
M1873 could increase yield by 15% and 33% relative to M1577 on
unwashed and alkaline washed pretreated hardwood respectively.
M2232 could produce 20% and 43% more ethanol than M1577 on these
two substrates. The ability of M2232 to produce more ethanol that
M1873 demonstrates the utility of expressing the package of 7
enzymes simultaneously in a single strain.
TABLE-US-00038 TABLE 35 PCR fragments used to assemble EG
expression islands in S. cerevisiae. Piece ID No. Description
Primers Template 1 FCY f1 X11631/X12837 gDNA 2 EG1 X12838/X12822
pMU1821 3 EG2 X12823/X12824 pMU1479 4 EG3 X12825/X12826 pMU1958 5
Cel9A X12827/X12828 pMU1975 6 Clonat Marker X12829/X12841 pMU227 7
FCY f2 X12842/X11634 gDNA
TABLE-US-00039 TABLE 36 PCR fragments used to assemble CBH1
expression islands in S. cerevisiae. Piece ID No. Description
Primers Template 1 Delta f1 X12427/X13008 gDNA 2 Eno1p- NA Digest
of pMU1392 TeCBH1 + with SmaI and AscI HgCBD 3 CYC term 1
X13009/X13010 pMU2142 4 AgTef term X13011/X13012 pMU183 5 SfBGL NA
pMU1260 digest with PacI/AscI 6 AgTef prom X13013/X13014 pMU183 7
CYC term 2 X13009/X13015 pMU2142 8 Delta f2 X13016/X12434 gDNA
TABLE-US-00040 TABLE 37 Primers used in the construction of these
strains Primer SEQ ID Name Sequence (5'-3') Description NO X10821
AAGAGGGTGGTGTTCCTATTGGCGGAT FCY check for 526
GTCTTATCAATAACAAAGACGGAAGT GTTCTC X10824
TTTTGAAATTAACGTTCTCACCGACAA FCY check rev 527
CACAGCGTGGAATACCATACATGATG ATGGCA X11631
TTGCCAAAGTGGATTCTCCTACTCAAG FCY f1 for 528 CTTTGCAAACAT X12837
GAAGCTCGGATCAGTAGATAACCCGC FCY f1 rev 529
CTAGAAGACTAGTAGCTATGAAATTTT TAACTC X12838
GAGAGCCAGCTTAAAGAGTTAAAAAT EG1 for 530 TTCATAGCTACTAGTCTTCTAGGCGGG
TTATC X12822 GTTTTTTCCCCGTCAGCGATGGTGACG EG1 rev 531
TAAACGACTAGATTTAGGACACTAATT GAATC X12823 AAAAAATGACGCGGGCAGATTCAATT
EG2 for 532 AGTGTCCTAAATCTAGTCGTTTACGTC ACCATC X12824
GATGGGTTCCTAGATATAATCTCGAAG EG2 rev 533 GGAATAAGTAGGCAAAGAGGTTTAGA
CATTG X12825 GTTCTAAGCTCAATGAAGAGCCAATGT EG3 for 534
CTAAACCTCTTTGCCTACTTATTCCCTT CGAG X12826
GTTTATTACATGAAGAAGAAGTTAGTT EG3 rev 535 TCTGCCTTGCTTGCTAGAGAATAAATT
CAAG X12827 GTTCAACATCATCTTTTAACTTGAATTT Ce19A for 536
ATTCTCTAGCAAGCAAGGCAGAAACT AAC X12828 CGGGTGACCCGGCGGGGACGAGGCAA
Ce19A rev 537 GCTAAACAGATCTCAAACAACTTAAA ATCAGTC X12829
GGCATATCAAGACCCTGCCTGGACTGA Clonat for 538
TTTTAAGTTGTTTGAGATCTGTTTAGCT TGCC X12841
ATATAAAATTAAATACGTAAATACAGC Clonat rev 539
GTGCTGCGTGCTATTAAGGGTTCTCGA GAGC X12842 CCAGTGTCGAAAACGAGCTCTCGAGA
FCY f2 for 540 ACCCTTAATAGCACGCAGCACGCTGTA TTTACG X11634
TAGCCCTTGGTTGAGCTTGAGCGACGT FCY f2 rev 541 TGAGGT X12427
GGCCGCTGTTGGAATAAAAATCC Delta f1 for 542 X13008
CTCGGATCAGTAGATAACCCGCCTAGA Delta f1 rev 543
AGACTAGTGGATCGATCCCCGGGATGT TTATATTCATTGATCCTATTACATTATC AATCC
X13009 ATCTGTACCAAGTTGAACGACTGGTAC CYC term 1 for 544
TCTCAATGTTTATAAGGCGCGCCACAG GCCCCTTTTCCTTTG X13010
CCGCCATCCAGTGTCGAAAACGAGCTC CYC term 1 rev 545
GTCGACAACTAAACTGGAATGTG X13011 CCTCACATTCCAGTTTAGTTGTCGACG AgTef
term for 546 AGC TCGTTTTCGACACTGGATGG X13012
GCTGTTAATGATATCAAGACATCTGTC 3 AgTef term rev 547
CTGTTTACTATTTGAGGCGCGCCTCAG TACTGACAATAAAAAGATTCTTG X13013
GCGACGCCGGCGAGGAGGGAGGTGAA AgTef prom for 548
GGAGACATTTTGTTTTTAATTAAGGTT GTTTATGTTCGGATGTGATG X13014
TTGTTGTTCCCTCACATTCCAGTTTAGT AgTef prom rev 549
TGTCGACAGCTTGCCTTGTCCC X13015 GGTGACCCGGCGGGGACAAGGCAAGC CYC term 2
rev 550 TGTCGACAACTAAACTGGAATGTG X13016 GCTCAATTAGTGGACGTTATCAGG
Delta f2 for 551 X12434 CCGCGGTGAGATATATGTGGGTA Delta f2 rev
552
Example 36
Expression of Accessory Enzymes in Yeast
[0451] For the proteins described below, various enzymes were
expressed in yeast in their native form as well as with the
addition of a cleavable His tag for the purposes of increased ease
of purification. Proteins were assayed with and without the His tag
to determine if the tag influenced the activity or banding pattern
of the protein. If deemed necessary, tags can be removed in
subsequent enzyme evaluation assays after cleavage with
enterokinase and re-purification. Genes were PCR amplified or codon
optimized and synthesized and cloned into vector pMU1531 that had
been digested with Pac1 and Asc1. A C-terminal enterokinase site
expressed as amino acids DDDDK, linker expressed as amino acids
GGSPPS and 6.times.His tag expressed as amino acids HHHHHH were
added by yeast via homologous recombination, and constructs were
sequenced to confirm the tag sequence was intact and the gene and
tag were in-frame.
[0452] Colonies from transformations were grown in indicated media
for 48-72 hours. Cultures supernatants were filtered through a 2 um
PE filter and concentrated approximately 20-fold using 10,000
molecular weight cut off filters. Protein quality was screened via
SDS-PAGE electrophoresis under non-reducing conditions.
Expression of Alpha-Glucuronidase in Yeast
[0453] Pichia stipitis alpha-glucuronidase, GH67 (NCBI#ABN67901)
was expressed in yeast (FIG. 85). Alpha-glucuronidase is predicted
to be approximately 111 kDa (untagged) and 113 (C-terminal His
tagged), and is seen as a band between 100 and 150 kDa in FIG. 85.
Most GH67 alpha-glucuronidases characterized to date liberate
MeGlcA. residues linked to terminal xylopyranosyl residues. The
protein described here liberates MeGlcA residues linked to terminal
and internal xylopyranosyl residues (Ryabova et al, FEBS Letters
583:1457-1462, (2009)).
Expression of Xyloglucanases in Yeast
[0454] Several xyloglucanases (Table 38) were functionally
expressed in S. cerevisiae (FIGS. 86-87). The strain expressing
Aspergillus niger XGL produced the most activity; however, His tag
addition had a negative effect on activity (about 50% less activity
at 1 hour).
[0455] Secreted xyloglucanases were also characterized by Silver
stained SDS-PAGE and Western blot analysis (FIG. 88). On SDS-PAGE a
large clear band was visible for Aspergillus niger xgl1 (.about.150
kDa); no band for Aspergillus aculeatus xgl1; and a discrete band
for Neosartorya fischeri xgl (.about.130 kDa). His tag versions of
the proteins showed apparently less secreted protein. The Western
blot analysis showed that the signals for the Aspergillus niger
xglH is tag was strong; for Neosartorya fischeri xglHis tag was
poor, and A.c.xgl-His tag was not visible. Trichoderma reesei
xgl+/-His tag was not examined due to undetectable activity in the
AZCL xyloglucan assay.
TABLE-US-00041 TABLE 38 Xyloglucanases expressed in Saccharomyces
cerevisiae Accession Untagged Tagged Activity: Enzyme: Organism:
number Plasmid size size xyloglucanase GH74A Trichoderma AAP57752
pMU2088 87.0 kDa 88.9 kDa (EGL6) reesei GH74A Aspergillus AAK77227
pMU2856 90.3 kDa 92.2 kDa (EGL6) niger GH74A Aspergillus BAA29031
pMU2857 89.7 kDa 91.6 kDa (EGL6) aculeatus GH74A Neosartorya
XP_001261776 pMU2858 89.3 kDa 91.2 kDa (EGL6) fischeri XG*
Expression of Esterases in Yeast
[0456] Several esterases (Table 39) were functionally expressed in
S. cerevisiae. The expression was characterized by SDS-PAGE (FIG.
89) and activity assay (FIG. 90). SDS-PAGE analysis demonstrated
that Aspergillus niger FAEA (pMU1880) showed a prominent band at
.about.36 kDa, Chaetomium globosum FAEB (pMU1882) showed multiple
visible bands, and no bands were noted for Aspergillus terreus FAEA
(pMU1884). Prominent bands were visible for Chaetomium globosum
CIP2 (pMU2095+/-C His tag) and Trichoderma reesei CIP2 (pMU2097)
glucuronyl esterases. 1-Napthtyl-acetate was used to assay ferulic
acid esterases (FIG. 90), but this substrate did not work well for
the glucuronoyl esterases. Glucuronoyl esterases were not tested
further for activity. Aspergillus niger FAEA (pMU1880) exhibited
the best activity on this substrate followed by Chaetomium globosum
FAEB (pMU1882).
TABLE-US-00042 TABLE 39 Esterases expressed in Saccharomyces
cerevisiae Accession Untagged Tagged Activity: Enzyme: Organism:
number Plasmid size size ferulic CE1 Aspergillus XP_001393337
pMU1880 30.5 kDa 32.4 kDa acid/ (FAEA) niger cinnamoyl CE1
Aspergillus XP_001211092 pMU1884 35.5 kDa 37.4 kDa esterase (FAEA)
terreus CE1 Talaromyces EED17739 pMU1881 37.5 kDa 39.4 kDa (FAEB)
stipitatus CE1 Chaetomium XP_001228412 pMU1882 36.7 kDa 38.6 kDa
(FAEB) globosum glucuronyl CIP2 Trichoderma AAP57749 pMU2097 48.2
kDa 50.1 kDa esterase reesei CIP2 Chaetomium XP_001226041 pMU2095
49.8 kDa 51.7 kDa globosum
Expression of .alpha.-Galactosidases in Yeast
[0457] Several alpha-galactosidases (Table 40) were functionally
expressed in yeast (FIGS. 91-93). All AGL1 and 2 expressing strains
exhibited secreted activity (FIG. 91), but the His tag had a
negative impact on activity (decreased by about 50%). AGL3 stains
were not available for testing at the time these experiments were
conducted.
[0458] Alpha-galactosidases were also analyzed by Western blot
(FIG. 92) and silver stain (FIG. 93). Trichoderma reesei AGL3
sample had one prominent band at approximately 50-70 kDa by Western
blot. On SDS-PAGE visible (smeared) bands (over 100 kDa) are noted
for Trichoderma reesei agl1 and Talaromyces emersonii agl1
(predicted sizes: 48.5 & 49.4 kDa); discreet band of .about.80
kDA noted for Trichoderma reesei agl2 (predicted size: 82 kDa), but
was poorly expressed (not shown).
TABLE-US-00043 TABLE 40 Alpha-galaetosidases expressed in
Saccharomyces cerevisiae Accession Untagged Tagged Activity:
Enzyme: Organism: number Plasmid size size alpha- GH27 Trichoderma
CAA93244 pMU2859 48.4 kDa 50.3 kDa galactosidase (AGL I) reesei.
GH27 Talaromyces EU106878 pMU2860 49.3 kDa 51.2 kDa (AGL I)
emersonii GH27 Trichoderma Z69254 pMU2861 82.0 kDa 83.9 kDa (AGL
II) reesei GH27 Trichoderma CAA93246 pMU2697 67.0 kDa 68.9 kDa (AGL
reesei III)
Example 37
Enzymatic Conversion of Pretreated Mixed Hardwoods
[0459] To assess the effect of various enzymes on pretreated mixed
hardwoods (PHW), an assay was conducted with 2% solids, pH 5.0 and
38.degree. C. Yeast-produced and purified enzymes were assessed in
the assay either with or without additional commercial enzymes. The
activity of the mix with yeast-produced enzymes evaluated by the
release of sugars, predominantly glucose due to the nature of the
pretreatment, by HPLC using a BioRad 87H column. The data below
shows the results of some of those mixing experiments. FIG. 94
shows that the addition of CBH2, BGL, EG1, EG2 and EG3 improves
hydrolysis of the substrate above what the commercial enzyme mix
can do with just the addition of CBH2 and BGL. Therefore,
yeast-made EG1, EG2 and EG3 provide benefits in hydrolyzing PHW.
FIG. 95 shows that further addition of yeast-produced and purified
xylanase, xylosidase and AXE improved hydrolysis of the PHW above
what was seen with either just the commercial enzyme mix or the
commercial mix with CBH2 added. This further suggests the benefits
of the accessory enzymes described above.
[0460] FIG. 96 shows that the addition of these enzymes in
combination continues to show improvement over the addition of just
one of the accessory enzymes.
Example 38
Enzymatic Conversion of Paper Sludge
[0461] The information above was done on PHW in the presence of
commercial enzymes. The following data shows the effectiveness of
the purified, yeast-produced enzymes to hydrolyze paper sludge
without any additional enzymes added in both a 2%, pH 5.0,
38.degree. C. hydrolysis assay as well as an SSF. These results are
compared to the same assay or fermentation with the addition of
commercial enzymes.
[0462] These data in FIGS. 97 and 98 show that the combination of
CBH1, CBH2, BGL, EG1, EG2, EG4, EG5, xylanase and xylosidase
hydrolyze more substrate when combined together than when assayed
alone. This was further confirmed in fermentation (FIG. 99). The
purified enzymes were analyzed by SSF on two different types of
industrial paper sludge. Both paper sludge substrates were washed
with 1M citric acid. The SSFs were carried out under the following
conditions: 2% total solids, 1.1 g/L dry cell weight M2108, 15
mg/mL Tetracycline, YP media, pH 5.0, 35.degree. C. and 220 rpm. A
selected cocktail of yeast made enzymes was dosed at 4.1 mg/g TS
and compared to a dose response of AB Whole Broth ranging from
0-6.1 mg/g TS. The purified enzyme cocktail is specified in Table
41 and the results are shown in FIG. 99. Based on data shown on
FIG. 99, the yeast made enzyme dose is equivalent to a dose of
approximately 3 mg/g TS AB Whole Broth commercial enzymes mix on
both substrates. These data support the claim that the combination
of the yeast-produced, purified enzymes can hydrolyze industrially
relevant substrates such as paper sludge without any additional
commercial enzymes. Generated by yeast made enzymes sugars are
successfully converted by yeast to ethanol in SSF process.
TABLE-US-00044 TABLE 41 Yeast made enzyme cocktail used in paper
sludge SSF. dose (mg/g Enzyme TS) TeCBH1 with Hg CBD 2.25 Cl CBH2
0.7 Sf BGL 0.1 Af EG1 0.35 Hj EG2 0.15 Tt EG4 0.05 Cl EG5 0.05 EG6
0.05 An Xyn 0.2 Ptr Xld 0.2 Total 4.1
TABLE-US-00045 TABLE 42 Summary of the best yeast expressed
cellulases, hemicellulases and accessory enzymes. Highlighted
yellow-key enzymes for wood conversion; Yellow + Green-key enzymes
for paper sludge conversion (based on data shown in FIGS. 94-99).
##STR00018## ##STR00019##
Example 39
Strain Identification and Activities for Strains Tested on 30% TS
Corn Flour
[0463] Supernatants were assayed on the supernatant remaining at
the end of a corn mash fermentation to determine if any of these
enzymes could further hydrolyze the soluble oligomers. Cell
supernatants of strains engineered with .alpha.-glucosidase
activity released glucose from soluble oligomers remaining at the
end of a corn mash fermentation. The increase observed was higher
than cell supernatant from the background strain (M749). All
samples contained a blanket dose of commercial glucoamylase.
[0464] The control M0139 with 0.3AGU/g TS GA reaches 121 g/L
ethanol with potential ethanol of 127 g/L. M2111 is a bit higher
with respect to both ethanol produced and potential ethanol,
showing a CBP effect. There are a handful of strains that have
potential ethanol of over 128 g/L, with T2-6 at 133 g/L. T2-6 (AE9)
reached the highest ethanol titers as well, 125 g/L. T11-32 (BC60,
AXE) also has potential ethanol over 130 g/L. All of these strains
show a CBP effect over the control strain.
TABLE-US-00046 TABLE 43 Groups of enzymes used in evaluation of
pretreated wet cake with the addition of supernatants Protein Group
Name CBH1 Big 4 Big 6 CBH2 EG2 BGL Xyl Big 2 Xld
[0465] MO139 is the control strain and has no enzymatic activities.
Each yeast-made purified enzyme was added to the control strain and
a small benefit is seen. When added together, as seen with the Big
4 or Big 6, a large increase in hydrolysis is seen. The largest
glucose and xylose yields are seen with the addition of 1 mg/g TS
commercial Pectinase (Multifect) to the Big 6.
Example 40
Strain Identification and Activities Expressed in Supernatant that
were Evaluated on Pretreated Wet Cake (ELN afoster2 Corn-074
[0466] Corn wet cake that was pretreated by autohydrolysis in the
steam gun (30% TS, 160.degree. C., 20 minutes) was used to evaluate
the effect on hydrolysis when yeast-made purified enzymes are used
in the presence of a mixture of commercial enzymes. The mixture of
commercial enzymes (referred to as MM) used was 0.9 mg/g TS AB
Whole Broth, 0.1 mg/g TS Multifect Pectinase and 0.1 mg/g TS
Spirizyme GA. Purified CBH1 was added at a concentration of 1 mg/g
TS where all other purified enzymes were added at 0.25 mg/g TS.
These enzymes were added to 2% TS pretreated wet cake (PWC), 75 mM
Na citrate buffer pH 5.0, 0.01% Na Azide to a total volume of 4 mLs
in a 24 well plate. The hydrolysis was incubated at 35.degree. C.,
220 rpm. The 48 hour results are shown in FIG. 102.
[0467] The glucose released with just the commercial enzyme mix
"MM" is 2.8 g/L. When purified yeast made enzymes are then loaded
in addition to "MM," an increasing trend in hydrolysis is observed.
When all of the purified enzymes are added without "MM," (shown in
the last bar on the right side of the graph), glucose release is
still observed. The addition of puffed enzymes with or without
commercial enzymes shows hydrolysis. Corn coarse fiber (similar to
wet cake but with the protein removed) was pretreated in the steam
gun at 190.degree. C. for 10 minutes with water where another
condition used 1% sulfuric acid for the pretreatment. These two
substrates were evaluated in the presence of a commercial enzyme
mixture with the addition of purified yeast made enzymes, similar
to the previous experiment. The purpose of this particular assay
was to determine the best ratio of purified CBH1 and CBH2 in the
presence of 1 mg/g TS commercial enzyme mixture of C-tec: H-tec:
Multifect Pectinase at ratios of 30%:45%: 25% with 0.5 U/gTS Depol
FAE. The various mixtures used are specified in Table 44 and the
results are shown in FIG. 103.
TABLE-US-00047 TABLE 44 Mixtures of purified enzymes used to
determine the optimal ratio of CBH1 to CBH2 on pretreated corn
coarse fiber. The commercial mixture of C-tec:H-tec:Multifect
Pectinase at ratios of 30%:45%:25% with 0.5U/gTS Depol FAE was
dosed at 1 mg/g TS to each sample ng/gTS ng/n Nk1 Nk2 Nk3 Nk4 Nk5
Nk6 Nk7 Nk8 Nk9 CBH1 245 3 225 15 075 0 4 225 225 225 CBH2 124 0
075 15 225 3 0 075 075 075 B 083 01 01 01 01 01 01 01 01 01 X ( )
148 0 05 033 XLD 334 0 05 033 AXE 118 1 0 033 5 1 1 1 1 1 1 1 1 1
total 31 31 31 31 31 41 41 41 41 indicates data missing or
illegible when filed
[0468] Results showed that decreasing amounts of CBH1 correlate to
a decrease in glucose yields. This effect was more dramatic on the
acid pretreated coarse fiber than on the 190.degree. C., 10 min
substrate. When 4 mg/g TS CBH1 only is added, there is an equal or
better yield seen than when there is CBH2 present. In short, the
more CBH1, the better the glucose yields. Additions of XLD, XLN and
AXE (0.33 mg/g TS each) also helped boost final yields a small
amount over the commercial enzyme mixture.
Example 41
Methods
Yeast Strains
[0469] M0509 (NCPy102; ura-3::kanMX/ura-3::kanMX gre3::loxP/gre3::
loxP TAL1+/loxP-PTP1-TAL1 RKI1+/loxP-PTPI-RKI1 RPE1+/loxP-PTPI-RPE1
TKL+/loxP-PTPI-TKL delta::PTPI-xylA PTPI-XKS) and M0749 (NCPy102;
ura-3::kanMX/ura-3::kanMX gre3::loxP/gre3::loxP
TAL1+/loxP-PTPI-TAL1 RKI1+/loxP-PTPI-RKI1 RPE1+/loxP-PTPI-RPE1
TKL+/loxP-PTPI-TKL delta:: PTPI-xylA PTPI-XKS
fur1.DELTA.::Nat/FUR1) strains derived from diploid wine strain NCP
Y120 (obtained from University of Stellenbosch, South Mica) and are
described in McBride et al., WO 2010/060056, 2010. M0139 (MAT a/MAT
alpha) is S. cerevisiae diploid wine strain that was received from
University of Stellenbosch. M1744 is derivative of M0139 with
double URA3 knockout (markerless). Ethanol Red (ER) is commercially
available diploid ethanologen strain that was obtained from
Lesaffre Corp.
[0470] Starch-DNS Assay
[0471] Reagents:
[0472] Dinitrosalicylic Acid Reagent Solution (DNS), 1%
(Could be stored at 4.degree. C. for several months) [0473]
3,5-dinitrosalicylic acid: 10 g [0474] Sodium sulfite: 0.5 g [0475]
Sodium hydroxide: 10 g [0476] Add water to: 1 liter [0477]
Calibrate DNS by glucose (use glucose samples with conc. 0, 1, 2,
3, 4, 5 and 6 g/l, calculate the slope [S])
[0478] Starch 2.2%, pH 5.0
(Prepare fresh before use; will be diluted by enzymes to 2%) [0479]
Dissolve 1.1 g of corn starch in 50 ml of water in a boiling water
bath [0480] Add 1 ml of 3M NaAc buffer pH 5.0
Procedure:
[0480] [0481] 1. Aliquot starch into 96w PCR plate 150 .mu.l/well
(one well for each sample to be measured). Shake starch between
refilling repeat pipette to prevent starch settling. [0482] 2.
Aliquot DNS into different 96w PCR plate 50 .mu.l/well (two wells
for each sample to be measured) [0483] 3. Add 16.7 .mu.l of enzyme
sample (cells supernatant) into starch, mix and immediately take 25
.mu.l into 50 .mu.l of DNS (control sample at t=0) [0484] 4.
Incubate enzyme/starch samples at 35.degree. C. for 3 h in PCR
machine [0485] 5. Take 25 .mu.l of enzyme/starch samples into 50
.mu.l of DNS (t=3 h samples) [0486] 6. Incubate DNS samples at
99.degree. C. for 5 min to develop a color and cool down at
4.degree. C. for 5 min (use. PCR machine) [0487] 7. Transfer 50
.mu.l of DNS sample into 96w assay plate and measure absorbance at
565 nm Amylolytic activity [A] calculation (% of starch
converted):
[0487] A ( % ) = OD 565 [ t = 3 h ] - OD 565 [ t = 0 ] S ( DNS
slope ) g / L X 100 % 20 g / L ##EQU00001##
Should use supernatant of cell cultures with the same growth OD. If
cells are grown differently, the activity should be normalized by
cells density.
[0488] Starch-GHK Assay
Reagents:
[0489] Hexokinase (HK) reagent (Could be stored at -20.degree. C.
for several months) [0490] Add 50 ml of water into HK reagent
bottles (Sigma #G3293-50 mL) and mix by turning up and down
(usually use 6 bottles to make stock) [0491] After complete
dissolving combine reagent from all bottles and add Tris (5.45 g
per 6 bottles) [0492] Prepare 22 mL aliquots in 50 mL screw cap
centrifuge tubes. (One tube is sufficient to assay a 96 well
microplate). [0493] Store aliquots frozen [0494] Calibrate each new
stock by glucose standards and calculate the slope S (with glucose
conc. 2, 1, 0.5, 0.25, 0.125, 0 g/l). The assay is linear up to 2
g/l glucose [0495] Starch 2.2%, pH 5.0
[0496] (Prepare fresh before use; will be diluted by enzymes to 2%)
[0497] Dissolve 1.1 g of corn starch in 50 ml of water in a boiling
water bath [0498] Add 1 ml of 3M NaAc buffer pH 5.0
Procedure:
[0499] 1. Aliquot starch into 96w PCR plate 150 .mu.l/well (one
well for each sample to be measured)
[0500] 2. Aliquot HK reagent into 96w assay plate 200 .mu.l/well
(two wells for each sample to be measured)
[0501] 3. Add 16.7 .mu.l of enzyme sample (cells supernatant) into
starch, mix and immediately take 10 .mu.l and mix into 200 .mu.l of
HK reagent (control sample at t=0). Cover with plate film and
incubate HK plate at 30 C for >30 min
[0502] 4. Incubate enzyme/starch samples at 35.degree. C. for 3 h
in PCR machine
[0503] 5. Take 10 .mu.l of enzyme/starch samples and mix with 200
.mu.l of HK reagent (t=3 h samples). Cover with plate film and
incubate HK plate at 30 C for >30 min
[0504] 6. Measure absorbance of both HK plates at 340 nm
Amylolytic activity [A] calculation (g/L glucose released):
A=OD.sub.340[t=3 h]-OD.sub.340[t=0] g/L
S (slope)
Should use supernatant of cell cultures with the same growth OD. If
cells are grown differently, the activity should be normalized by
cells density
[0505] Maltose Assay
Reagents:
[0506] Maltose 2.2%: [0507] 1.1 g D-maltose [0508] 1 mL 3M sodium
acetate buffer pH5.0 [0509] Bring to 50 mL with water [0510]
Hexokinase (HK) reagent (see Starch-GHK assay)
Procedure:
[0511] 1. Aliquot 1504 maltose solution into 96w PCR plate 2. Add
16.7 .mu.L supernatant to the maltose solution 3. Incubate at 35 C
in PCR machine for 3 h (during the last hour get GHK reagent from
freezer and allow to thaw at room temperature--do not heat. One 50
mL tube containing 22 mL reagent is sufficient to do one 96 well
plate) 4. Put 10 .mu.L of supernatant/maltose sample into a well of
the assay plate (Corning, cat#3641) 5. Add 200 .mu.L of HK reagent
and cover with plate film
6. Incubate at 35 C for >35 min
[0512] 7. Measure absorbance at 340 nm Amylolytic activity [A]
calculation (g/L glucose):
A=OD.sub.340[t=3 h] g/L
S (HK slope)
Should use supernatant of cell cultures with the same growth OD. If
cells are grown differently, the activity should be normalized by
cells density
[0513] Corn Mash Assay
Procedure:
[0514] 1. Cut 1 mL tips so that there is an opening approximately 4
mm in diameter. Tips do not have to be sterile for this assay. 2.
Inoculate strain to be tested in YPD. Grow with shaking for 2-3
days, 35.degree. C. to an OD.sub.600 of approximately 8-10
(stationary phase). 3. If comparing strains, inoculate strain M0509
in YPD. Grow with shaking for 2-3 days, 35.degree. C. to an
OD.sub.600 approximately 8-10 (stationary phase). This will serve
as a negative control in the assay. 4. Per 24-well plate, prepare
substrate mix in a final volume of 100 mL:
TABLE-US-00048 Concen- Final Amount to tration concentration add
per in in CM assay 100 mL Master (96-well Substrate/Stock Solution
Master Mix Mix plate) Pretreated wet corn mash 12.12 g 4% 2% (~33%
solids; test on LMA and adjust the amount added accordingly) 1M Na
citrate (sodium 15 mL 150 mM 75 mM citrate dihydrate) pH 5.0 100X
Anti-fungal/bacterial 2 mL 2X 1X mix, Sigma #A5955 0.5% NaN3
(sodium azide) 4 mL 0.02% 0.01% in 5 mM Na citrate pH 5.0 dH20
Bring -- -- volume to 100 mL
5. Using cut tips, add 2 mL/well of the substrate mix prepared
above to a 24-well plate. Use continuous stirring with a magnetic
stirrer while dispensing the substrate. 3 replicates for each
strain/condition are recommended. 6. Add 2 mL of supernatant to be
assayed to each well that contains substrate mix. 7. Put 24-well
reaction plate into shaker and incubate at 35.degree. C. and 250
rpm. 8. Samples taken at 24 and 48 h sample by allowing the
substrate in the plate to settle either by gravity or by
centrifugation. Then transfer 150 .mu.L of supernatant to a
centrifuge tube with a 0.2 um filter insert or a 96-well, 0.2 .mu.m
filter plate (Fisher: Millipore part # MSGVN2250) with 7.5 .mu.L
10% sulfuric acid added. After filtration, transfer the sample to a
total recovery HPLC vial for analysis on the H-column.
[0515] Corn Fiber Assay
Procedure:
[0516] 1. Cut 5 mL tips so that there is an opening approximately 4
mm in diameter. Tips do not have to be sterile for this assay. 2.
Inoculate strain to be tested in YPD. Grow with shaking for 2-3
days, 35.degree. C. to an OD.sub.600 of approximately 8-10
(stationary phase). 3. If comparing strains, inoculate strain M0509
in YPD. Grow with shaking for 2-3 days, 35.degree. C. to an
OD.sub.600 approximately 8-10 (stationary phase). This will serve
as a negative control in the assay. 4. Per 24-well plate, prepare
substrate mix in a final volume of 100 mL:
TABLE-US-00049 Concen- Amount to add tration Final per 100 mL in
Master concentration Substrate/Stock Solution Master Mix Mix in
assay Washed fermentation 4.4 g 4% 2% residuals (~90% solids; test
on LMA and adjust the amount added accordingly) 1M Na citrate
(sodium 15 mL 150 mM 75 mM citrate dihydrate) pH 4.0 0.5% NaN3
(sodium azide) 4 mL 0.02% 0.01% in 5 mM Na citrate pH 5.0 dH20
Bring volume -- -- to 100 mL
5. Using cut tips, add 2 mL/well of the substrate mix prepared
above to a 24-well plate. Use continuous stirring with a magnetic
stirrer while dispensing the substrate. 3 replicates for each
strain/condition are recommended. 6. Put 24-well reaction plate
into shaker and incubate at 35.degree. C. and 250 rpm. 7. Add 2 mL
of supernatant to be assayed to each well that contains substrate
mix. Samples taken at 24 and 48 h sample by allowing the substrate
in the plate to settle either by gravity or by centrifugation. Then
transfer 150 .mu.L of supernatant to a centrifuge tube with a 0.2
.mu.m filter insert or a 96-well, 0.2 .mu.m filter plate (Fisher:
Millipore part # MSGVN2250) with 7.5 .mu.L 10% sulfuric acid added.
After filtration, transfer the sample to a total recovery HPLC vial
for analysis on the H-column.
[0517] CMC Conversion Assay
[0518] Procedure: [0519] 1. Inoculate strains to be tested in 10 mL
YPD (or other media) in 50 ml tubes and grow with shaking for 3
days [0520] 2. Prepare the 1.14% CMC substrate, 1.14 g CMC per 100
mL citrate buffer (50 mM pH5.5) autoclaved for 20-25 min. Agitate
to make sure all CMC is dissolved [0521] 3. To 44 mL of 1.14% CMC
add 1 mL of 0.5% of sodium azide [0522] 4. Spin cells in 50 ml
tubes at max speed for 10 min [0523] 5. Add CMC to deep well
96-well plate, 4504/well [0524] 6. Do 4 replicates for each strain
[0525] 7. Aliquot 10 .mu.L of DNS into 96-well PCR plate [0526] 8.
Add 50 .mu.L of yeast supernatant or buffer to the substrate and
mix by pipetting [0527] 9. Take T=0 sample: transfer 50 .mu.L to
the 96-well PCR plate containing DNS and mix [0528] 10. Put the
deep well plate at 35.degree. C. 800 rpm [0529] 11. Heat the PCR
plate at 99.degree. C. for 5 min and cool down to 4.degree. C. in
PCR machine [0530] 12. Transfer 50 .mu.L to microtiter plate [0531]
13. Measure absorbance at 565 nm [0532] 14. Take samples from
reaction plate after 24 and repeat steps 6-12 [0533] 15. Calculate
% of CMC converted at time 24 hrs using formula:
[0533] Y = ( OD ( T = 24 ) - OD ( T = 0 ) ) .times. 100 % S .times.
A = .DELTA. OD .times. 100 0.1 .times. 10 = .DELTA. OD .times. 100
##EQU00002##
Y--% of CMC converted at 24 S--DNS/glucose calibration slope that
is 0.1 for DNS from May 8, 2007 at 565 nm A--CMC concentration at
T=0 that is 10 g/L for 1% CMC
Reagents:
Dinitrosalicylic Acid Reagent Solution (DNS), 1%
[0534] (Could be stored at 4.degree. C. for several months) [0535]
3,5-dinitrosalicylic acid: 10 g [0536] Sodium sulfite: 0.5 g [0537]
Sodium hydroxide: 10 g [0538] Add water to: 1 liter Calibrate DNS
by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5, 6, 7,
8, 9, 10 g/l, calculate the slope [S], for DNS from May 8, 2007
S=0.1)
[0539] Avicel Conversion Assay (High Throughput)
[0540] Procedure: [0541] 1. Inoculate strains to be tested in 600
ul YPD in deep 96-well plate. Perform 4 repeats for each strain or
4 transformants for each transformation. Grow with shaking for 3
days at 30.degree. C. [0542] 2. Spin cells at max speed for 10 min
[0543] 3. Prepare substrate mix: [0544] Substrate mix for full
96-well plate, total volume 30 ml: [0545] 0.6 g Avicel (2%) [0546]
500 .mu.l M Na Ac pH 5.0 (50 mM) [0547] 1.2 ml 0.5% Na Azide
(0.02%) [0548] 30 .mu.l BGL (Novozyme-188, Sigma) [0549] Add dH20
to 30 ml [0550] 4. Add substrate to new deep 96-well plate, 300
.mu.l/well. Shake between additions; do not let the Avicel settle
[0551] 5. Add 300 .mu.l of yeast spined supernatant or buffer to
the substrate. [0552] 6. Take T=0 sample: by multichannel pipette
mix the reaction mix and transfer 100 .mu.l to 96-well PCR plate
[0553] 7. Put deep 96-well reaction plate into shaker at 35.degree.
C. and 800 rpm [0554] 8. Spin 96-well PCR plate with T=0 samples at
2000 rpm for 2 min [0555] 9. Aliquot 100 .mu.l of DNS into new
96-well PCR plate [0556] 10. Carefully (without touching pellet)
take 50 .mu.l of super from T=0 spined 96-well PCR plate and mix it
into DNS [0557] 11. Heat at 99.degree. C. for 5 min and cool down
to 4.degree. C. in PCR machine [0558] 12. Transfer 500 to micro
titre plate [0559] 13. Measure absorbance at 565 nm by plate reader
[0560] 14. Take samples from reaction plate after 24 and 48 hrs and
repeat steps 6-13 [0561] 15. Calculate % of Avicel converted at
time 24 and 48 hrs using formula:
[0561] Y = ( OD ( T = 24 or 48 ) - OD ( T = 0 ) ) .times. 100 % S
.times. A = .DELTA. OD .times. 100 0.1 .times. 10 = .DELTA. OD
.times. 100 ##EQU00003##
Y--% of Avicel converted at 24 or 48 hrs S--DNS/glucose calibration
slope that is 0.1 for DNS from May 8, 2007 at 565 nm A--Avicel
concentration at T=0 that is 10 g/L for 1% Avicel
Reagents:
Dinitrosalicylic Acid Reagent Solution (DNS), 1%
[0562] (Could be stored at 4.degree. C. for several months) [0563]
3,5-dinitrosalicylic acid: 10 g [0564] Sodium sulfite: 0.5 g [0565]
Sodium hydroxide: 10 g [0566] Add water to: 1 liter Calibrate DNS
by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5, 6, 7,
8, 9, 10 g/l, calculate the slope [S], for DNS from May 8, 2007
S=0.1)
[0567] 24-Well PHW Assay
[0568] Procedure: [0569] 1. Patch all strains to be tested
including all controls on selective media plates. Incubate for 2
days [0570] 2. Inoculate strains to be tested in 4 ml YPD in 24
well plates (autoclaved) in triplicates. Cover plates with two
sticky Rayon Films for Biological Cultures (VWR). Grow with shaking
for 2-3 days, 35.degree. C. at 225 rpm (attach plates on sticky
pads in the fermentation lab shaker) [0571] 3. Per 24-well plate,
prepare substrate mix in a final volume of 100 mL:
TABLE-US-00050 [0571] Amount to add per 100 mL Master Concentration
Concentration Substrate/Stock Solution Mix in Master Mix in PHW
assay MS149 Pretreated wood 8.3 g 4% 2% (~48% solids) CaCO.sub.3
0.30 g 3 g/L 1.5 g/L 1M Na citrate (sodium 15 mL 150 mM 75 mM
citrate dihydrate) pH 5.4 100X Anti-fungal/bacterial 2 mL 2X 1X
mix, Sigma #A5955 Novozyme-188 .beta.- 100 ul 0.140 mg/mL 0.070
mg/mL glucosidase (141 mg/mL) dH20 Bring -- -- volume to 100 mL
[0572] 4. If testing for synergy with other enzymes, aliquot
additional enzymes into appropriate wells (for instance, for
synergy with yeast made CBHs, mix purified CBH1 and CBH2 to reach
ratio 1:1 and aliquot the mix for the final concentration 2 mg
CBH/g DW PHW). 24 well plates and tips for this assay don't have to
be sterile [0573] 5. Using 5 mL cut tips, add 2 mL/well of the
substrate mix prepared above to a 24-well assay plate. Use
continuous stirring with a magnetic stirrer while dispensing the
substrate [0574] 6. Spin cultures to be tested in 24 wp at 3000 rpm
for 5 min [0575] 7. Add 2 mL of supernatants to 24-well assay plate
with substrate mix using multichannel pipette with adjustable
spacer for 100-1200 .mu.l (Rainin) [0576] 8. For negative control,
strain M0509 or empty vector strains could be used. For the
positive control, dilute Zoomerase to 160 .mu.g/mL (4 mg/g DW PHW,
in negative control strain supernatant [0577] 9. Take T=0 sample by
allowing the substrate in the plate to settle either by gravity or
by centrifugation. Then transfer 200 .mu.L of supernatant to 96 PCR
wp using multichannel pipette with adjustable spacer for 20-300
.mu.l (Rainin). The samples could be frozen at this point for
future analysis [0578] 10. Put 24-well assay plate into shaker and
incubate at 35.degree. C. at 225 rpm (attach plates on sticky pads
in the fermentation lab shaker) [0579] 11. Take subsequent time
points, preferably 24 and 48 hours [0580] 12. For HPLC analysis
aliquot 5 .mu.L 10% sulphuric acid into 96 wp with filters
(Millipore, MSGVN2250). Add 100 .mu.l of samples. After filtration
(using vacuum in analytical lab), transfer the samples to a total
recovery HPLC vials for analysis on the H-column. Multichannel
pipette with adjustable spacer for 20-300 .mu.l (Rainin) could be
used for transfer to make it faster. 96-well collection plate used
to collect filtered samples could be recycled [0581] 13. Glucose
and xylose concentration in the samples also could be measured by
kits (see separate protocols)
[0582] Mini Vials Fermentation Assay
Procedure for Corn Mash:
[0583] 1) Determine the solids content of the mash by drying it at
105.degree. C. and weighing [0584] 2) Weigh liquid corn mash into
the 10 mL pressure bottles according to the desired final % of
solids [0585] 3) To each bottle add penicillin to final
concentration 0.006 mg/mL, urea to final concentration 500 PPM, and
water if needed to reach final weigh 4 g. [0586] 4) Add desired
enzyme to each bottle. [0587] 5) Add yeast cells inoculum to final
cone. 0.1 g/L DCW. [0588] 6) Cap each bottle and insert the 23
gauge needle into the stopper. [0589] 7) Incubate the bottles at
desired temperature at 125 rpm. [0590] 8) At 72 hours, harvest
samples and measure ethanol concentration by HPLC analysis.
Procedure for Corn Flour:
[0590] [0591] 1) Mix corn flour with water according to desired
final concentration [0592] 2) Add penicillin to final concentration
0.006 mg/mL and urea to final concentration 700 PPM [0593] 3) Weigh
liquid substrate mix into the 10 mL pressure bottles according to
the desired final % of solids. [0594] 4) Add desired enzyme to each
bottle. [0595] 5) Add yeast cells inoculum to final concentration
0.1 g/L DCW. [0596] 6) Cap each bottle and insert the 23 gauge
needle into the stopper. [0597] 7) Incubate the bottles at desired
temperature at 125 rpm. [0598] 8) At 72 hours, harvest samples and
measure ethanol concentration by HPLC analysis.
[0599] Shake Flask Fermentation
Procedure for Corn Mash:
[0600] 1) Inoculate yeast into 50 mL of YPD and incubate for 15-18
hrs at 35.degree. C. at 200 rpm [0601] 2) Spin cell down in 50 mL
Falcon tubes, resuspend in 50 mL of water and spin again. [0602] 3)
Resuspend cells in 10 mL of sterile water and determine dry cell
weigh concentration by liquid moister analyzer (Sartorius). [0603]
1) Determine the solids content of the mash by drying it at
105.degree. C. and weighing [0604] 2) Add mash into shake flasks
according to desired final solids concentration [0605] 3) Add
penicillin to final concentration 0.006 mg/mL, urea to final conc.
500 PPM, and water if needed to reach final weigh 50 g. [0606] 4)
Add desired enzyme to each flask. [0607] 5) Dilute 0.005 g of cells
in 1 mL of water and add cells to the flask (0.1 g/L inoculum)
[0608] 6) Take 1 mL samples at T=24 h, T=48 h and T=72 h. Dilute
samples 4.times. and measure ethanol and sugars concentration by
HPLC analysis.
Procedure for Corn Flour:
[0608] [0609] 1) Inoculate yeast into 50 mL of YPD and incubate for
15-18 hrs at 35 C at 200 rpm [0610] 2) Spin cell down in 50 mL
Falcon tubes, resuspend in 50 mL of water and spin again. [0611] 3)
Resuspend cells in 10 mL of sterile water and determine dry cell
weigh concentration by liquid moister analyzer (Sartorius). [0612]
4) Mix corn flour with water according to desired final conc.
[0613] 5) Add penicillin to final conc. 0.006 mg/mL and urea to
final conc. 700 PPM [0614] 6) Weigh liquid substrate mix into shake
flasks according to the desired final % of solids. [0615] 7) Add
desired enzyme to each flask. [0616] 8) Dilute 0.005 g of cells in
1 mL of water and add cells to the flask (0.1 g/L inoculum) [0617]
Take 2 mL samples at T=24 h, T=48 h and T=72 h. Measure ethanol and
sugars concentration by HPLC analysis.
[0618] Xylan Assay [0619] 1. Prepare a substrate solution: 1.0%
Birchwood 4-O-methyl glucuronoxylan (Sigma) in 0.05 M Na-citrate
buffer, pH 5.0. Homogenize 1.0 g in 80 ml buffer at 60.degree. C.
and heat to boiling point, on a magnetic stirrer. Cool with
continued stirring, cover and stir slowly overnight. Make up to 100
ml with buffer. Store at 4.degree. C. for a maximum of 1 week or
freeze aliquots of e.g. 25 ml at -20.degree. C. [0620] 2. Aliquot
150 .mu.l of substrate into 96-well PCR plate [0621] 3. Add 16.7
.mu.l of enzyme containing supernatant [0622] 4. Incubate at
35.degree. C. for 3 h [0623] 5. Remove 25 .mu.l of assay sample and
mix with 50 .mu.l DNS in a PCR plate [0624] 6. Boil at 99.degree.
C. for 5 min; cool at 4.degree. C. [0625] 7. Transfer 50 .mu.l to
flat bottom corning plate [0626] 8. Read absorbance at 540 or 565
nm
[0627] Xylan Plate Assay
1. Prepare substrate: mix 0.1% Azurine-Crosslinked Xylan
(Megazymes) with 1.5% agar in water and autoclave for 20 min 2.
Pore substrate on pre-made YPD plates and wait until solid 3. Patch
yeast colonies and incubate at 35.degree. C. for 24-48 hrs.
[0628] Esterase Assay (for AXE and FAE) [0629] 1. Prepare
substrate: 1M 4-Nitrophenyl acetate (Sigma N-8130) in methanol or
DMSO [0630] 2. Dilute substrate to 1 mM by 50 mM Na-Citrate buffer
pH5.4 [0631] 3. Put 50 .mu.l of enzymes containing yeast
supernatants or controls into a 96-well analytical plate [0632] 4.
Add 100 .mu.l 4-Nitrophenyl acetate preheated (35.degree. C.)
substrate [0633] 5. Read absorbance at 410 nm over a given time
course: e.g. 30 min, 1 hr and 2 hours. Incubate sample plate at
35.degree. C. between time points. [0634] 6. Reaction can be
stopped by adding 100 .mu.l Na.sub.2CO.sub.3 (1 M).
[0635] Arabinofuranosidase Assay [0636] 1. Prepare substrate: 1M
4-Nitrophenyl .alpha.-L-arabinofuranoside (pNPA) (Sigma N-3641) in
methanol [0637] 2. Dilute substrate to 1 mM by 50 mM Na-Citrate
buffer pH5.4 [0638] 3. Put 20 .mu.l of enzymes containing yeast
supernatants or controls into a 96-well analytical plate [0639] 4.
Add 180 .mu.l 4-Nitrophenyl acetate preheated (35.degree. C.)
substrate [0640] 5. Read absorbance at 405 nm over a given time
course: e.g. 30 min, 1 hr and 2 hours Incubate sample plate at
35.degree. C. between time points [0641] 6. Reaction can be stopped
by adding 1000 Na.sub.2CO.sub.3 (1 M)
[0642] PWC (Pretreated Wet Cake) Assay [0643] 1. Prepare substrate
mix (70 ml for one 24-well plate): 8 g of 35% PWC (modified
distiller's dried grains (MDDG) pretreated at 160 C for 20 min), 7
ml 0.5% NaAz, 5.25 ml of 1 M Na Citrate pH5, 0.7 ml of 100.times.
anti-fungal/bacterial mix (Sigma#A5955), and water to final volume
70 ml [0644] 2. Aliquot purified enzymes into 24-well deep plate in
desired amount (under 200 .mu.l) [0645] 3. Add 2 ml of enzymes
containing yeast supernatants or supernatant of empty strain (no
enzymes) as control [0646] 4. Add 2 ml of substrate mix [0647] 5.
Incubate at 35.degree. C. with shaking for 48 hrs [0648] 6. Take
200 .mu.l samples at T=0, T=24, T=48 his (allow the substrate in
the plate to settle either by gravity or by centrifugation) into
96-well PCR plate. [0649] 7. Spin down PCR plate and transfer 100
.mu.L of supernatant to 96-well, 0.2 .mu.m filter plate (Fisher:
Millipore# MSGVN2250) with 5 .mu.L 10% sulphuric acid added. [0650]
8. Use filtered sample to measure ethanol and sugars concentration
by HPLC.
[0651] Xyloglucanase Assay (96-Well Plate)
70 .mu.L of supernatant of 3 day old 2.times.SC.sup.-URA cultures
were added to 280 .mu.L of 50 mM Na-Acetate buffer (pH 5.0)
containing 0.5% AZCL (Azurine-Crosslinked) tamarind xyloglucan
(Megazyme catalog # I-AZXYG) in a 96-well deep plate The plate was
incubated in a microtiter plate shaker at 35.degree. C. at 800 rpm
agitation Samples of 10 .mu.L were taken at 0, 60 and 180 minutes
of incubation into 96-well PCR plate spun down at 3000 rpm for 2
min after which 50 .mu.L of the supernatant was placed in a fresh
96-well analytical plate and OD at 600 nm was measured
[0652] Xyloglucanase Plate Assay
Plates containing 1.5% agar+YPD were overlain with 0.1 or 0.5% AZCL
(Azurine-Crosslinked) tamarind xyloglucan (Megazyme catalog #
I-AZXYG) in 1.5% agar and spotted with 2 .mu.L of overnight yeast
culture. Plates were incubated overnight at 35.degree. C. Blue zone
indicated hydrolysis of substrate
[0653] Pullulan Assay [0654] 1. Add 150 .mu.l of 1% pullulan (in
100 mM NaCitrate buffer pH5.0) to each well [0655] 2. Mix 16.7
.mu.l of enzyme supernatant [0656] 3. Incubate 3 h at 35'' C with
shaking (900 rpm) [0657] 4. Remove 25 .mu.l of assay sample and mix
with 50 .mu.l DNS (the same as in starch assay) in a PCR plate
[0658] 5. Boil at 99.degree. C. for 5 min; cool at 4.degree. C.
[0659] 6. Transfer 50 .mu.l to flat bottom corning plate [0660] 7.
Read absorbance; at 565 or 540 nm
[0661] Pectin Assay [0662] 1. Made 0.1% pectin solution (0.05 g of
apple pectin in 50 mL of 100 mM sodium citrate buffer pH 5.0; heat
to dissolve) [0663] 2. Put 50 .mu.L enzyme containing supernatants
into wells of new 96 deep well plate (5 multifect pectinase in
M0139 supernatant for total of 504) [0664] 3. Added 450 .mu.L
pectin solution [0665] 4. Incubated at 35.degree. C., 900 rpm for 4
hr [0666] 5. Aliquot 100 .mu.L DNS (same as in starch assay) into
96-well PCR plate [0667] 6. Added 50 .mu.L pectin/supernatants
solution to DNS and heated at 99.degree. C. for 5 min followed by
cooling down to 4.degree. C. [0668] 7. Transferred 50 .mu.L to
assay plate (flat-bottomed) and measured absorbance at 565 nm or
540 nm
[0669] Modified Avicel Assay Protocol:
Procedure:
[0670] Inoculate strains to be tested in 600 ul YPD in deep 96-well
plate. Do 4 repeats for each strain or 4 transformants for each
transformation. Grow with shaking for 3 days at 30.degree. C.
[0671] 1. Spin cells at max speed for 10 min [0672] 2. Prepare
substrate mix: [0673] Substrate mix for fall 96-well late, total
volume 30 ml: [0674] 0.6 g Avicel (2%) [0675] 500 .mu.l 3M Na Ac pH
5.0 (50 mM) [0676] 1.2 ml 0.5% Na Azide (0.02%) [0677] 300 BGL
(Novozyme-188, Sigma) [0678] 600 .mu.l Zoomerase from 1 mg/ml stock
(to get 1 mg/gm of avicel [0679] Add dH20 to 30 ml. [0680] 3. Add
substrate to new deep 96-well plate, 300 ul/well. Shake between
additions, don't let Avicel to settle. [0681] 4. Add 300 .mu.l of
yeast spined supernatant or buffer to the substrate. [0682] 5. Take
T=0 sample: by multichannel pipette mix the reaction mix and
transfer 100 .mu.l to 96-well PCR plate [0683] 6. Put deep 96-well
reaction plate into shaker at 35.degree. C. and 800 rpm [0684] 7.
Spin 96-well PCR plate with T=0 samples at 2000 rpm for 2 min
[0685] 8. Aliquot 50 .mu.l of DNS into new 96-well PCR plate [0686]
9. Carefully (without touching pellet) take 25 .mu.l of super from
T=0 spined 96-well PCR plate and mix it into DNS [0687] 10. Heat at
99.degree. C. for 5 min and cool down to 4.degree. C. in PCR
machine [0688] 11. Transfer 50 .mu.l to micro titre plate. [0689]
12. Measure absorbance at 540 nm by plate reader [0690] 13. Take
samples from reaction plate after 2 and 4 hrs and repeat steps 6-13
[0691] 14. Calculate % of Avicel converted at time 2 and 4 hrs
using formula:
[0691] Y = ( OD ( T = 24 or 48 ) - OD ( T = 0 ) ) .times. 100 % S
.times. A = .DELTA. OD .times. 100 0.25 .times. 10 = .DELTA. OD
.times. 40 ##EQU00004##
Y--% of Avicel converted at 24 or 48 hrs S--DNS/glucose calibration
slope that is 0.25 for DNS, at 540 nm A--Avicel concentration at
T=0 that is 10 g/L for 1% Avicel
[0692] Reagents:
Dinitrosalicylic Acid Reagent Solution (DNS), 1%
[0693] (Could be stored at 4.degree. C. for several months) [0694]
3,5-dinitrosalicylic acid: 10 g [0695] Sodium sulfite: 0.5 g [0696]
Sodium hydroxide: 10 g [0697] Add water to: 1 liter Calibrate DNS
by glucose (use glucose samples with conc. 0, 1, 2, 3, 4, 5, 6, 7,
8, 9, 10 g/l, calculate the slope [S], for DNS S=0.25)
Concentration Determination of TeCBH1-HgCBM-C and ClCBH2b in Media
by HPLC Analysis.
[0698] For determination of the concentration of CBHs produced by
strains expressing TeCBH1-HgCBM-C (M1111, expressing plasmid
pMU1392) and ClCBH2b (M1873), a phenyl reversed phase method was
developed on an Agilent 2100 HPLC with the MWD detector at 214 and
280 nm. In this method, the purified CBHs described above were used
for generating a standard curve from 200-10 .mu.g. The sample was
injected onto a phenyl RP column (Tosoh phenyl-5PW RP, 4.6
mm.times.7.5 cm, 10 .mu.m) that was equilibrated at 55.degree. C.
in 0.1% trifluoracetic acid (TFA) (w/v), 20% acetonitrile. The
protein was eluted from the column at 0.75 ml/min using a linear
gradient of acetonitrile with 0.1% TFA (w/v) from 20-60% in 45
minutes. After cleaning the column with 95% acetonitrile/TFA, the
column was re-equilibrated. To determine the concentration of
TeCBH1-HgCBM-C and ClCBH2b produced in media by various strains,
the peak area of the sample was compared to the standard curve
generated from the peak areas of the purified CBHs (.mu.g/.mu.L
injected).
Purification of TeCBH1-HgCBM-C and ClCBH2b for Protein Standards in
the HPLC Assay.
[0699] 1 or 1.5 liter of YPD medium was inoculated with a 10%
volume of an overnight pre-culture of the strain producing CBH1 or
CBH2 (M1111, expressing plasmid pMU1392 and M1873, respectively).
The cultures were grown with shaking (210 rpm) at 30.degree. C.
After 3 days of cultivation the supernatants were harvested by
removing the cells by centrifugation. The supernatants were
concentrated and changed into 50 mM sodium acetate (pH 5) with a 10
kDa cut-off Pellicon PTGC membrane (Millipore). The CBH1 sample was
loaded into DEAE Sepharose FF column equilibrated with 50 mM sodium
acetate, pH 5.0. The bound CBH1 was eluted with linear salt
gradient of from 0 to 0.35 M NaCl. The elution volumes were 15 and
20 column volumes. The fractions were tested for CBH1 activity with
MULac by incubating 10 .mu.l sample with 90 .mu.l 2 mM MULac in 50
mM NaAc (pH 5.0), in ambient temperature for 20 minutes and
stopping the reaction with 0.5 M Na.sub.2CO.sub.3. The fluorescence
was measured with a Varioscan (Thermo Labsystems) microtiter plate
reader (ex. 355 nm and em. 460 nm). The CBH1 proteins were
visualized on SDS-PAGE and the fractions containing a single band
were pooled and changed into 50 mM sodium acetate (pH 5) using 20
ml spin concentrators, 10 kDa MWCO (Vivaspin, Vivascience GmbH). A
second step was then carried out in the purification where a 5 ml
GE phenyl HR column was utilized to further remove media
components. In this procedure, the column was equilibrated with 25
mM sodium acetate, 1.2 M ammonium sulfate, pH 5. Ammonium sulfate
was added to the sample to bring the concentration in the buffer to
1.2 M and this material was injected onto the column. The protein
was eluted with a linear gradient of 25 mM sodium acetate, pH 5 and
fractions that were active on MULac were pooled. Purity was
assessed by SDS-PAGE and concentration was determined by absorbance
at 280 nm using the theoretical absorptivity value. ClCBH2b was
purified using the same chromatography steps, DEAE anion exchange
followed by phenyl HIC. In this purification, ClCBH2b is found in
the flow through of the DEAE step and was eluted from the phenyl
HIC column within the decreasing ammonium sulfate gradient. Active
fractions were determined using a 1% Avicel hydrolysis assay at pH
5.0 as described above. Purity and concentration determination were
determined as described above.
[0700] PHW Assay [0701] 1. Prepare substrate mix (100 mL per one
24-well plate): 8.3 g of pretreated wood (48% of solids), 20 ml of
1M Na Citrate pH4.8, 2 ml of 100.times. anti-fungal/bacterial mix
(Sigma#A5955), and water to final volume 100 ml. In some assay
0.222 ml of commercial glucoamylase (AB Enzymes#EL2008044L 63
ml/ml) is added (heat treated to remove side activities) [0702] 2.
Add purified enzymes into wells of 24-well deep plate (under 200
.mu.l) [0703] 3. Add 2 mL of enzymes containing yeast supernatants
and empty strain supernatant as control [0704] 4. Using cut 5 ml
tips, add 2 ml/well of the substrate mix to enzymes. Use continuous
stirring with a magnetic stirrer while dispensing the substrate
[0705] 5. Incubate 24-well reaction plate at 38.degree. C. and 250
rpm [0706] 6. Take 200 .mu.l samples at T=0, T=24, T=48 hrs (allow
the substrate in the plate to settle either by gravity or by
centrifugation) into 96-well PCR plate [0707] 7. Spin down PCR
plate and transfer 100 .mu.L of supernatant to 96-well, 0.2 .mu.M
filter plate (Fisher: Millipore# MSGVN2250) with 5 .mu.L 10%
sulphuric acid added [0708] 8. Use filtered sample to measure
ethanol and sugars concentration by HPLC
[0709] Paper Sludge Assay [0710] 1. Prepare substrate mix (100 mL
per one 24-well plate): 10.5 g of paper sludge (38% of solids), 40
ml of 1M Na Citrate pH5.2, 2 ml of 100.times. anti-fungal/bacterial
mix (Sigma#A5955), and water to final volume 100 ml. In some assays
0.222 ml of commercial thermostable .beta.-glucosidase (AB Enzymes
63 ml/ml) is added (heat treated to remove side activities) [0711]
2. Add purified enzymes into wells of 24-well deep plate (under 200
.mu.l) [0712] 3. Add 2 mL of enzymes containing yeast supernatants
and empty strain supernatant as control [0713] 4. Using cut 5 ml
tips, add 2 ml/well of the substrate mix to enzymes. Use continuous
stirring with a magnetic stirrer while dispensing the substrate
[0714] 5. Incubate 24-well reaction plate at 35.degree. C. and 250
rpm [0715] 6. Take 200 .mu.l samples at T=0, T=24, T=48 hrs (allow
the substrate in the plate to settle either by gravity or by
centrifugation) into 96-well PCR plate [0716] 7. Spin down PCR
plate and transfer 100 .mu.L of supernatant to 96-well, 0.2 .mu.am
filter plate (Fisher: Millipore# MSGVN2250) with 5 .mu.L 10%
sulphuric acid added [0717] 8. Use filtered sample to measure
ethanol and sugars concentration by HPLC.
[0718] 1-Napthyl-acetate Esterase Assay [0719] 1. Inoculate SC or
YPD medium with the stain to be tested and incubate on a rotary
shaker. [0720] 2. Remove the cells by centrifugation. [0721] 3. Set
up the reaction as follows in a 96 well plate: [0722] 88 .mu.L
Citrate buffer (50 mM, pH 5.0)* * (Phosphate buffer can also be
used but Acetate buffers cause a precipitate) [0723] 10 .mu.L
Supernatant [0724] 2 .mu.L 1-naphtyl-acetate in ethanol (500 mM)**
**(Sigma 46010) [0725] 100 .mu.L Total [0726] 4. Incubate for 5-30
min at 35.degree. C. The incubation time depend on the level of
activity. [0727] 5. Stop the reaction by adding 100 .mu.l 0.01%
Fast Corrinth V salt solution. [0728] 6. Read 100 .mu.L at 535 nm
[0729] 50 mM Citrate buffer pH 5.0 [0730] 1 M Citric acid 20.5 mL
[0731] 1 M Na-citrate 29.5 mL [0732] This is 50 mL 1 M Citrate
Phosphate buffer (pH5.0). Dilute to appropriate concentration with
water. [0733] 500 mM 1-naphtyl-acetate (Mr 186 g/mol) [0734]
1-naphtyl-acetate 0.0931 g [0735] Ethanol (100%) 1000 .mu.l [0736]
(make fresh batch each day) [0737] Fast Corrinth V salt solution
(Sigma 227366) [0738] Fast Corrinth V salt (0.01%) 0.001 g [0739]
Tween 20 (10%) 1 [0740] 1M Na-Acetate buffer pH 4.49 mL [0741] 10
mL [0742] NB: Make this solution fresh each day and keep in a dark
bottle--use same day, very light sensitive. [0743] 1-Naphtol (for
standard curve) (Sigma 31097) [0744] Prepare a 1 g/L 1-naphtol
solution in the buffer used for the assay to set the standard
curve. [0745] Set the standard cure between 0.025 g/L and 0.4
g/L
[0746] Alpha-galactosidase Activity Assay Using NpGal [0747]
Reference: Margolles-Clark et al. 1996. Eur J Biochem. 240:
104-111. [0748] 1. Prepare solutions as indicated below [0749] 2.
Patch colonies to be screened on selection plates and incubate at
30-35.degree. C. for 48 h [0750] 3. Inoculate 600 .mu.l YPD in 96
well plate and incubate at 35.degree. C. with 800 rpm shaking for
48-72 h [0751] 4. Spin cells for 2 min at 2500 rpm [0752] 5. Place
20 .mu.l supernatant into a 96 well plate [0753] 6. Add 180 .mu.l
NpGal preheated (35.degree. C.) substrate [0754] 7. Incubate for
given time course at 35.degree. C.: e.g. 30 min, 1 hr and 2 hours
(may have to go overnight according to some enzymes in literature)
[0755] 8. Read absorbance at 405 nm over a given time course.
Incubate sample plate at 35.degree. C. between time points [0756]
9. Stop reaction by adding 100 .mu.l Na.sub.2CO.sub.3 (1 M) [0757]
1 mM p-nitrophenyl-.alpha.-D-galactopyranoside (NpGal) (Sigma
N0877) 301.3 g/mol) [0758] Make a 1M Stock=0.151 g in 500 .mu.l
methanol or DMSO [0759] 1 mM Stock=10 .mu.l of 1M stock in 9.99 ml
citrate buffer [0760] Citrate-Buffer (0.05 M pH 5.4) 1 L [0761] 0.1
M Citric acid: 21.01 g citric acid in 1000 ml H.sub.2O [0762] 0.1 M
Sodium citrate: 29.41 g of C.sub.6H.sub.5O.sub.7Na.sub.3.2H.sub.2O
in 1000 ml H.sub.2O [0763] 20.5 ml of citric acid+29.5 ml of sodium
citrate, add dH.sub.2O to a total of 100 ml
INCORPORATION BY REFERENCE
[0764] All documents cited herein, including journal articles or
abstracts, published or corresponding U.S. or foreign patent
applications, issued or foreign patents, or any other documents,
are each entirely incorporated by reference herein, including all
data, tables, figures, and text presented in the cited
documents.
EQUIVALENTS
[0765] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20130323822A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20130323822A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References