Method For Highly Sensitive Detection Of Protein-protein Interaction

Abstract

The present invention intends to provide an assay system using split luciferase that has a remarkably high detection sensitivity. In an embodiment, binding of mutually binding first and second proteins is detected by preparing a first fusion protein comprising the first protein fused with a peptide having the amino acid sequence of amino acid SEQ ID NO: 1 and a second fusion protein comprising the second protein fused with a peptide having an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6, and allowing the first fusion protein to bind with the second fusion protein to form a complex, and detecting luminescence emitted from the complex.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This invention claims priority on Japanese Patent Application No. 2009-131481 filed on May 29, 2009 and Japanese Patent Application No. 2010-37921 filed on Feb. 23, 2010, which are herein incorporated by reference.

TECHNICAL FIELD

[0002] This invention relates to methods for detecting a protein-protein interaction.

BACKGROUND ART

[0003] A method for detecting protein interaction between two target proteins by using complementarity of split luciferase fragments has been recently developed (Kim, S. B., Ozawa, T., Watanabe, S., Umezawa, Y., 2004. Proc. Natl. Acad. Sci. USA. 101, 11542-11547). The method for detecting a protein-protein interaction using complementarity is generally conducted by fusing fragments of a split reporter protein respectively with the target proteins, and in this process, each fragment does not have significant activity by itself. When the target proteins interact with each other, the inactive reporter protein fragments complement with each other to regain the activity which allows emission of the signal to enable indirect tracking of the protein-protein interaction.

[0004] Such method using the complementarity has been used for various reporter proteins such as dihydrofolate reductase and .beta.-lactamase green fluorescent protein. Also, several luciferases such as Renilla reniformis luciferase, Photinus Pyralis luciferase, red-emitting Photinus Pyralis luciferase, and green-emitting Photinus Pyralis luciferase have been used.

SUMMARY OF INVENTION

Technical Problem

[0005] An object of the present invention is to provide an assay system using split luciferase which has remarkably high detection sensitivity.

Solution to Problem

[0006] The inventors of the present invention made an intensive study for solving the problem as described above, and found that, when using luciferase from Brazilian larval click-beetle (Pyrearinus termitilluminans), a C terminal fragment having SEQ ID NO: 1 and an N terminal fragment having any one of SEQ ID NOS: 2 to 6 are fused with each of the two interacting proteins respectively, and the two fusion proteins are bound, a luminescence with an intensity about 30 fold stronger than the conventional assay is emitted. The present invention has been completed on the bases of such a finding.

[0007] Accordingly, one aspect of the present invention is a fusion protein having the amino acid sequence of amino acid SEQ ID NO: 1. Another aspect of the present invention is a fusion protein having an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6.

[0008] In the present specification, the "protein has an amino acid sequence" means that the protein contains the amino acid sequence and that the protein may contain an amino acid sequence other than such an amino acid sequence. The "fusion protein" means a peptide derived from Pyrearinus termitilluminans luciferase (which, in the present invention, is a peptide consisting of an amino acid sequence selected from the group consisting of amino acid SEQ ID NO: 1 to 6) fused with a peptide not derived from Pyrearinus termitilluminans luciferase.

[0009] A further aspect of the invention is a complex of a fusion protein having the amino acid sequence of amino acid SEQ ID NO: 1 and a fusion protein having an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6.

[0010] A still further aspect of the invention is a DNA coding for an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 1 to 6, or maybe an expression vector that contains this DNA and is capable of expressing a fusion protein having an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 1 to 6.

[0011] A still further aspect of the invention is a kit for detecting protein-protein interaction containing an expression vector for expressing a protein having a peptide comprising the amino acid sequence of amino acid SEQ ID NO: 1 and an expression vector for expressing a protein having a peptide comprising an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6.

[0012] A still further aspect of the invention is a method for detecting a fusion protein having the amino acid sequence of amino acid SEQ ID NO: 1, comprising the steps of allowing the fusion protein to interact with a binding fusion protein wherein the binding fusion protein has an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6 and is capable of binding with the fusion protein, to allow formation of a complex, and detecting luminescence emitted from the complex.

[0013] A still further aspect of the invention is a method for detecting a fusion protein containing an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6, comprising the steps of allowing the fusion protein to interact with a binding fusion protein wherein the binding fusion protein has the amino acid sequence of amino acid SEQ ID NO: 1 and is capable of binding with the fusion protein, to form a complex, and detecting luminescence emitted from the complex.

[0014] A still further aspect of the invention is a method for detecting a complex of a first fusion protein and a binding fusion protein being capable of binding with the first fusion protein, comprising the step of detecting luminescence emitted from the complex, wherein the first fusion protein has the amino acid sequence of amino acid SEQ ID NO: 1 and the binding fusion protein has an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6.

[0015] A still further aspect of the invention is a method for detecting binding of first and second fusion proteins which are bound to each other, wherein the first fusion protein has the amino acid sequence of amino acid SEQ ID NO: 1 and the second fusion protein has an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6, comprising the steps of allowing the first fusion protein to interact with the second fusion protein to allow formation of a complex, and detecting luminescence emitted from the complex. This method may further comprise the steps of fusing the amino acid sequence of amino acid SEQ ID NO: 1 with a first protein to prepare the first fusion protein, and fusing an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6 with a second protein to prepare the second fusion protein.

[0016] A still further aspect of the invention is a method for screening a fusion protein library for a binding fusion protein being capable of binding to a first fusion protein, comprising the steps of allowing the first fusion protein to interact with a plurality of second fusion proteins, wherein the first fusion protein has the amino acid sequence of amino acid SEQ ID NO: 1 and the second fusion proteins have an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6 and are in the fusion protein library, and identifying the binding fusion protein that forms a complex with the first fusion protein by detecting luminescence emitted by the complex.

[0017] A still further aspect of the invention is a method for screening for a binding fusion protein being capable of binding with a first fusion protein comprising the steps of allowing the first fusion protein to interact with a plurality of second fusion proteins, wherein the first fusion protein has an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6, and the second fusion proteins have the amino acid sequence of amino acid SEQ ID NO: 1, and identifying the binding fusion protein that forms a complex with the first fusion protein detecting luminescence emitted from the complex.

BRIEF DESCRIPTION OF DRAWINGS

[0018] [FIG. 1-1] FIG. 1A is the nucleotide sequence of the cDNA of Pyrearinus termitilluminans luciferase.

[0019] [FIG. 1-2] FIG. 1B is a list of PCR primers used in preparing plucN and plucC in one example of the present invention.

[0020] [FIG. 1-3] FIG. 1C is the nucleotide sequence of the DNA inserted in multicloning site of pcDNA3.1 in pcDNA3.1/myc-His(B).

[0021] [FIG. 1-4] FIG. 1D is the nucleotide sequence of the DNA inserted in multicloning site of pcDNA4 in pcDNA4/V5-His(B).

[0022] [FIG. 2-1] FIG. 2-1 is graphs showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combinations of pFRB-lucC389 to pFRB-lucC391 and plucN404-FKBP to plucN417-FKBP. For each sample, the left bar of the bar graph is the result for the rapamycin-containing culture medium, and the right bar is the result for the DMSO-containing culture medium.

[0023] [FIG. 2-2] FIG. 2-2 is graphs showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combinations of pFRB-lucC392 to pFRB-lucC394 and plucN404-FKBP to plucN417-RKBP. For each sample in the bar graph, the left bar is the result for the rapamycin-containing culture medium, and the right bar is the result for the DMSO-containing culture medium.

[0024] [FIG. 3-1] FIG. 3-1 is graphs showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combinations of pFRB-lucC394 to pFRB-lucC399 and plucN404-FKBP to plucN417-FKBP. For each sample in the bar graph, the left bar is the result for the rapamycin-containing culture medium, and the right bar is the result for the DMSO-containing culture medium.

[0025] [FIG. 3-2] FIG. 3-2 is graphs showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combinations of pFRB-lucC400 to pFRB-lucC403 and plucN404-FKBP to plucN417-FKBP. For each sample in the bar graph, the left bar is the result for the rapamycin-containing culture medium, and the right bar is the result for the DMSO-containing culture medium.

[0026] [FIG. 3-3] FIG. 3-3 is graphs showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combinations of pFRB-lucC404 to pFRB-lucC407 and plucN404-FKBP to plucN417-FKBP. For each sample in the bar graph, the left bar is the result for the rapamycin-containing culture medium, and the right bar is the result for the DMSO-containing culture medium.

[0027] [FIG. 4] FIG. 4 is a graph and a table showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combinations of pFRB-lucC394 and plucN412-FKBP to plucN416-FKBP. In the table, Rap+ is the luminescence intensity when binding was induced; DMSO is the luminescence intensity when binding was not induced (namely, the background); STDEV-R is the standard deviation when binding was induced with Rap+; and STDEV-D is the standard deviation when binding was not induced with DMSO. For each sample in the graph, the left bar is the result for the rapamycin-containing culture medium, and the right bar is the result for the DMSO-containing culture medium.

[0028] [FIG. 5] FIG. 5 is a table showing the results of the luminescence intensity measurement in a luciferase split assay in one Example of the present invention, which were obtained by using combination of plucN415-FKBP and pFRB-lucC394 and conventional combination of pTlucN-FKBP and pFRB-GlucC. Symbols are as defined above for FIG. 4.

[0029] [FIG. 6] FIG. 6 is a graph showing the results of the comparison of the luminescence intensity, in one Example of the present invention, for the cases when somatostatin was added and not added to HEK293 cells in which pSSTR2-lucC394 and plucN415-arrestin had been introduced to transiently express SSTR2-lucC394 and lucN415-arrestin, respectively. x axis shows presence (+) and absence (-) of the somatostatin, and y axis shows number of photons (.times.10.sup.4).

[0030] [FIG. 7] FIG. 7 is a graph showing dose-response curves in one Example of the present invention, when HEK293-ARRB2-SSTR2 cell line was stimulated with somatostatin or its analogs (RIM23052 or BIM23056) at various concentrations. x axis shows concentration of each reagent (log [molar concentration]), and y axis shows number of photons (.times.10.sup.4).

[0031] [FIG. 8] FIG. 8 is a graph showing a time-response curve in one Example of the present invention, when HEK293-ARRB2-SSTR2 cell line was stimulated with 1.times.10.sup.-6 M of somatostatin, and luminescence was measured with time. x axis shows time (min), and y axis shows number of photons (.times.10.sup.4).

[0032] [FIG. 9] FIG. 9 is a table showing names of the GPCRs used, PCR templates and primer sequences used in preparing the expression vectors for expressing fusion proteins, ligands used for the stimulation, ligand concentrations (EC50) at which the luminescence was detected (unit: molar concentration), and the times (T) of the maximum luminescence observation after the stimulation, in the experiment conducted for the GPCRs.

DESCRIPTION OF EMBODIMENTS

[0033] Next, embodiments of the present invention completed based on the finding as described above are described in detail by referring to Examples. Unless otherwise noted, methods described in standard protocols such as J. Sambrook, E. F. Fritsch & T. Maniatis (Ed.), Molecular cloning, a laboratory manual (3rd edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2001); F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl (Ed.), Current Protocols in Molecular Biology, John Wiley & Sons Ltd. as well as their modifications and improvements are used in the embodiments and Examples. When commercially available reagent, kit and assay apparatus are used, protocols attached thereto are used unless otherwise noted.

[0034] The objects, features, advantages, and ideas of the present invention are clear for those skilled in the art from the description of the invention, and those skilled in the art will be readily capable of reproducing the invention. The embodiments and Examples as described below are preferable embodiments of the present invention, which are presented for the purpose of illustration and explanation, and the present invention is not limited by these embodiments and Examples. It is clear for those skilled in the art that the description of the present invention can be modified in various ways within the scope and intention of the invention herein described.

[Principle]

[0035] The present invention provides a luciferase split assay system with a high detection sensitivity. In this assay system, an amino acid sequence comprising amino acid SEQ ID NO: 1 and an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6 from Pyrearinus termitilluminans luciferase whose sequence is described in FIG. 1A, are used. Next, methods using this assay system are described in detail. The luciferase split assay is a technique known in the art, and the procedure not described in this specification may be conducted according to common knowledge of those skilled in the art.

[0036] First, a first protein (referred to as a first fusion protein) having the amino acid sequence of amino acid SEQ ID NO: 1 (this peptide moiety is referred to as lucCmax) and a second protein (referred to as a second fusion protein) having an amino acid sequence (this peptide moiety is referred to as lucNmax) selected from the group consisting of amino acid SEQ ID NOS: 2 to 6 are synthesized. It should be noted that the first protein and the second protein can bind to each other under particular conditions.

[0037] While the fusion proteins can be chemically synthesized for use in the assay system, the fusion proteins maybe provided by constructing expression vectors coding for the fusion proteins and expressing the fusion proteins in the assay system, as will be described below. In such a case, the fusion proteins maybe expressed either transiently or permanently. The former is preferable when the assay system is an in vitro system, and the latter is preferable when the assay system is an in vivo system such as a cell. In each fusion protein, the lucCmax or the lucNmax may be connected to the protein either directly or via a linker. The linker is preferably a peptide moiety with an adequate length.

[0038] When both of the fusion proteins are introduced in the assay system, the first protein and the second protein bind to each other, and as a consequence, the lucCmax and the lucNmax will be located at positions capable of undergoing an interaction, and the lucCmax and the lucNmax will reconstitute the luciferase to recover luciferase activity so that the luciferase is capable of emitting light under adequate luminescent conditions. The luciferase activity may be measured, when the assay system is a cell, by adding luciferin to the cell culture, and preparing a cell extract to measure the luciferase activity. In this case, the activity is readily measurable by using a commercially available Emerald Luc Luciferase Assay Reagent/Lysis Solution (TOYOBO) or the like.

[0039] In this assay system, a luminescence intensity that is about 30 times or more stronger than the conventional assay is realized when the amino acid sequence of the lucC is amino acid SEQ ID NO: 1 and the amino acid sequence of the lucN is an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6.

[Construction of Expression Vectors]

[0040] As described above, the introduction of the fusion proteins into the assay system can be realized by constructing expression vectors coding for the fusion proteins and expressing the fusion proteins in the assay system.

[0041] The expression vectors coding for the fusion proteins can be readily constructed by constructing vectors containing DNA coding for the amino acid sequence selected from the group consisting of amino acid SEQ ID NO: 1 to 6 in advance.

[0042] For example, such a vector may be constructed to have DNA coding for the lucNmax having the initiation codon ATG inserted downstream of an expression promoter which can function in the assay system and followed by a multicloning site immediately downstream and a transcription termination signal further downstream. When DNA coding for the intended protein is inserted in frame in the multicloning site, expression of the fusion protein of the lucNmax and the intended protein is facilitated.

[0043] Another exemplary vector has a form comprising an expression promoter that can function in the assay system, the initiation codon ATG, DNA coding for the multicloning site and the lucCmax, and the transcription termination signal in this order. When DNA coding for the intended protein is inserted in frame in the multicloning site, expression of the fusion protein of the lucCmax and the intended protein is facilitated.

[0044] Furthermore, an expression vector for the fusion protein having lucCmax or lucNmax can be readily constructed for the purpose of, for example, detecting a protein-protein interaction when a kit containing a vector having DNA coding for the amino acid sequence of the amino acid SEQ ID NO: 1, namely, the lucCmax and a vector having DNA coding for an amino acid sequence selected from the group consisting of amino acid SEQ ID NOS: 2 to 6, namely, the lucNmax is prepared.

[Use of the Assay System]

[0045] Next, exemplary uses of the assay system of the present invention are described.

[0046] First of all, a fusion protein having lucCmax can be detected. For example, when a first fusion protein that has been made by fusing a target protein to be detected with lucCmax exists in the assay system, a second fusion protein that has been made by fusing a binding protein that binds to the target protein with lucNmax is prepared as a probe and is introduced in the assay system. Then, the binding protein in the second fusion protein should bind to the target protein in the first fusion protein; thereby the lucCmax and the lucNmax interact and gain luciferase activity. By detecting the luciferase activity, the target fusion protein having the lucCmax can be detected. Specifically, an expression vector expressing the first fusion protein is prepared and introduced in a cell. Next, an expression vector expressing the second fusion protein is prepared and introduced in the cell expressing the first fusion protein. Then the fusion protein having the lucCmax is detected by measuring the luciferase activity as described above.

[0047] Next, a fusion protein having lucNmax can be detected. For example, if a first fusion protein that has been made by fusing the target protein to be detected with lucNmax exists in the assay system, a second fusion protein that has been made by fusing a binding peptide that binds to the target protein with lucCmax is prepared as a probe and is introduced in the assay system. Then, the binding peptide in the second fusion protein will bind to the target peptide in the first fusion protein; thereby the lucNmax and the lucCmax interat and gain luciferase activity. By detecting the luciferase activity, the target fusion protein having the lucNmax can be detected. Specifically, an expression vector expressing the first fusion protein is prepared and introduced in a cell. Next, an expression vector expressing the second fusion protein is prepared, and introduced in the cell expressing the first fusion protein. Then the fusion protein having the lucNmax is detected by measuring the luciferase activity as described above.

[0048] Further, a complex of a fusion protein having the lucNmax and a fusion protein having the lucCmax can be detected. When these fusion proteins form a complex, the lucNmax and the lucCmax interact and gain luciferase activity. By detecting the luciferase activity, the complex can be detected. For detection, the assay system including the complex may be placed under the conditions wherein the luciferase activity can be detected. When the assay system is a cell, the luciferase activity may be measured by the procedure as described above.

[0049] Further, binding of the first and second proteins that have mutual binding ability can be detected, because a first fusion protein and a second fusion protein are synthesized by fusing a first protein and a second protein with the lucNmax and the lucCmax in advance respectively so that the luciferase activity will be detectable if the first fusion protein binds to the second fusion protein. It can be examined whether the first protein can bind to the second protein by using this method; when the first fusion protein prepared by fusing the lucNmax with the first protein and the second fusion protein prepared by fusing the lucCmax with the second peptide are introduced in the assay system, the luciferase activity will be detected if the first protein binds with the second protein and the luciferase activity will not be detected if the first protein does not bind with the second protein. Specifically, expression vectors expressing the first fusion protein or the second fusion protein are separately prepared and both of them are introduced in the same cell, and then, if luminescence from the luciferase reconstituted in the cell is observed by measuring the luciferase activity as described above, the first protein and the second protein can be judged to be bound each other, and the first protein and the second protein can be judged not to be bound if no luminescence is detected.

[0050] Further, it is possible to screen a protein library for a binding protein that is capable of binding to a first protein. More specifically, a first fusion protein is prepared by fusing a first protein with lucNmax or lucCmax, and second fusion proteins are prepared by fusing second proteins in the protein library with lucCmax or lucNmax, respectively; and when the first fusion protein and the second fusion proteins are allowed to interact with each other, only the second fusion proteins having the binding proteins capable of binding with the first protein form complexes with the first fusion protein. Accordingly, the second proteins that bind to the first protein can be identified by detecting luminescence emitted from the complexes. Specifically, a cell transformed with an expression vector which expresses a first fusion protein comprising a first protein fused with lucNmax is prepared, and a cDNA library which has been constructed to express proteins in the form fused with lucCmax is introduced in the cell; then, luciferin is added to the culture medium, and luminescent cells are identified and cloned. DNAs derived from the library are recovered from the clones, and the genes expressed are identified to thereby obtain cDNAs of the second proteins that form the complexes with the first protein.

EXAMPLES

Example 1

[0051] In this Example, interacting proteins, FKBP (NM.sub.--054014) and FRB (NM.sub.--019906), which are bound each other in the presence of rapamycin, were fused with lucNs, peptides having the N terminal sequence of Pyrearinus termitilluminans luciferase and lucCs, peptides having the C terminal sequence of Pyrearinus termitilluminans luciferase, respectively. It will be shown that the luminescence activity of the complex of the interacting proteins varies according to the combination of lucN and lucC, and is remarkably enhanced when lucNmax (SEQ ID NO: 2 to 6; the amino acid sequence of 1st-412nd to 416th amino acid residues) is used in combination with lucCmax (SEQ ID NO: 1; the amino acid sequence of 394th-542nd amino acid residues).

[0052] First, PCR was conducted using a cDNA of Pyrearinus termitilluminans luciferase, whose sequence is shown in FIG. 1A, as template and using the primers of FIG. 1R to obtain 14 kinds of DNA fragments coding for 14 kinds of peptide each having an amino acid sequence from N terminal amino acid residue to the 404th to 417th amino acid residues, which were obtained by using the pair of N-PtGR-F001 and N-PtGR-R404 to R417, and 25 kinds of DNA fragments coding for amino acid sequences from C terminal amino acid residue to the 389th to 413rd amino acid residues, which were obtained by using C-PtGR-R542 and C-PtGR-F389 to F413. The DNA coding for the N terminal region was cleaved with HindIII and BamHI, pFKBP was cleaved with BamHI and XhoI, and pcDNA3.1/myc-His (B) was cleaved with HindIII and XhoI to conduct three molecule ligation and thus 14 kinds of plucN-FKBP were prepared. In the meanwhile, the DNA coding for the C terminal region was cleaved with XhoI and SacII, pFRB was cleaved with BamHI and XhoI, and pcDNA4/V5-His (B) was cleaved with BamHI and SacII to conduct three molecule ligation and thus 25 kinds of pFRB-lucC were prepared. pcDNA3.1/myc-His (B) and pcDNA4/V5-His(B) are plasmid vectors having the sequence of SEQUENCE ID NOS: 7 and 8 inserted therein, respectively. The nucleotide sequence of the DNA inserted in the multicloning site of pcDNA3.1 is shown in FIG. 1C and the nucleotide sequence of the DNA inserted in the multicloning site of pcDNA4 is shown in FIG. 1D.

[0053] For the 339 cases where the luciferase was reconstructed as the amino acid sequence of the original luciferase (overlapping of the amino acid: 0), or with partial overlapping (overlapping of the amino acid: 1 or more) in the combinations of 14 kinds of plucN-FKBP and 25 kinds of pFRB-lucC, each pair of the expression vectors was transfected to COS7 cells on a 96 well plastic culture dish using TtansIT Transfection Reagents (TAKARA). After about 16 hours from the transfection, the culture medium was replaced with the medium containing 1 .mu.m of rapamycin; after 24 hours of incubation, ELA (TOYOBO) was added and the luminescence was measured by TriStar LB941 (Berthold Technologies).

[0054] As shown in FIGS. 2 and 3, high levels of signal were obtained for pFRB-lucC394, and the signal was the highest in the case of plucN412-FKBP to plucN416-FKBP. It should be noted that almost no signal was obtained for pFRB-lucC408 to pFRB-lucC413, and these cases are not shown in the drawings. Further, in FIG. 3, no signal was obtained in the case of plucN415-FKBP due to the experimental failure.

[0055] Accordingly, the experiment was conducted again for plucN412-FKBP to plucN416-FKBP, and as shown in FIG. 4, the highest signals were obtained for plucN412-FKBP to plucN416-FKBP at almost the same level.

[0056] The luminescence intensity obtained by using the combination of plucN415-FKBP and pFRB-lucC394 which was shown to be the most suitable was compared with the luminescence intensity obtained by the combination of pTlucN-FKBP and pFRB-GlucC which had been accepted as the most suitable combination. pTlucN-FKBP is a vector constructed by amplifying an N terminal fragment of the cDNA of red-emitting Photinus Pyralis luciferase by PCR using the primers as shown below and constructing the vector in the same manner as plucN-FKBP, and pFRB-GlucC is a vector constructed by amplifying a C terminal fragment of the cDNA of green-emitting Photinus Pyralis luciferase by PCR using the primers as shown below and constructing the vector in the same manner as pFRB-lucC.

TABLE-US-00001 (TlucN-1) (SEQ ID No. 9) 5'AAGCTTGCCATGGTAAAGCGTGAGAAAAATGTC 3' (TlucN-2) (SEQ ID No. 10) 5'GGATCCTCCGCCTCCTCCGCCGTCGTCGATGGCCTC 3' (GlucC-1) (SEQ ID No. 11) 5'aggCTCGAGTGGAGGCGGCGGAGGCTGGCTGCACTCTGGCGACTTC 3' (GlucC-2) (SEQ ID No. 12) 5'cgcGGGCCCAGCTTAGAAGCCTTCTCCATCAGGGC 3'

[0057] As shown in FIG. 5, the luminescence intensity obtained by the combination of plucN415-FKBP and pFRB-lucC394 was about 30 fold higher than the conventional combination of plucN415-FKBP and pFRB-lucC394. Thus, the luminescence intensity about 30 fold higher than the conventional luminescence intensity was realized by using the Pyrearinus termitilluminans luciferase and conducting the luciferase split assay by using the C terminal fragment lucC394 and the N terminal fragments lucN412 to lucN416.

Example 2

[0058] In this Example, somatostatin receptor (SSTR2; somatostatin type 2 receptor) (NM.sub.--000794) which is a GPCR (G-protein coupled receptor) and .beta.-arrestin (arrestin, beta 2) (NM.sub.--004313) were used instead of the FKBP and FRB. SSTR2 is a membrane protein on the cell membrane, and when somatostatin binds to extracellular domain of the GPCR, the intracellular domain of the SSTR2 binds to .beta.-arrestin that is an adaptor molecule in the cytoplasm, and a signal is transduced downstream. Accordingly, the C terminal of the SSTR2 was bonded to the C terminal of the Eluc, and the N terminal of the .beta.-arrestin was bonded to N terminal of the Eluc, and the fusion proteins were expressed in the cultured cells, and somatostatin was added to the cultured cells to examine luminescence from the cells.

[0059] First, PCR was conducted by using a human brain cDNA library (TAKARA) as template with the primers as shown below to obtain DNA fragments coding for arrestin and the SSTR2.

TABLE-US-00002 ARRB2-nestF2: (SEQ ID NO: 54) AAAGGATCCATGGGGGAGAAACCCGGGACCAGGGTCT ARRB2-nestR-Eco: (SEQ ID NO: 55) AAGAATTCCAGCAGAGTTGATCATCATAGT SSTR2_start_Bam: (SEQ ID NO: 56) TTGGATCCATGGACATGGCGGATGAGCCAC SSTR2_R1107end_XhoI: (SEQ ID NO: 57) TTTCTCGAGCCGATACTGGTTTGGAGGTCTCCATTG

[0060] The DNA coding for the arrestin was cleaved with BamHI and EcoRI, and ligated to the plucN415 that had been cleaved with BamHI and EcoRI and plucN415-arrestin was obtained. The plucN415 used had been obtained by cleaving the plucN415-FKBP in Example 1 with HindIII and BamHI and ligating with pcDNA3.1/myc-His(B) cleaved with HindIII and BamHI.

[0061] In the meanwhile, the DNA fragment coding for the SSTR2 was cleaved with BamHI and XhoI, inserted in the multicloning site of pcDNA4/V5-His (B), and pSSTR2 was obtained. Then, the DNA coding for lucC394 with the linker whose length was extended to 22 amino acids was cleaved with XhoI and SacII, inserted at XhoI-SacII site of the pSSTR2 and pSSTR2-lucC394 was obtained. It is to be noted that the linker length of the lucC394 was extended to 22 amino acids step by step by conducting PCR using pFRB-lucC394 as template and linkerC12-F-XhoI (SEQ ID NO: 58) and PtGR-R542-SacII (SEQ ID NO: 61) as primers, cleaving the PCR product with XhoI and SacII, and inserting the fragment at the XhoI-SacII site of the pSSTR2; conducting PCR using this product as template and linker C17-F-XhoI (SEQ ID NO: 59) and PtGR-R542-SacII (SEQ ID NO: 61) as primers, cleaving the PCR product with XhoI and SacII, and inserting the fragment at XhoI-SacII site of the pSSTR2; and finally, conducting PCR using this product as template and linkerC22-F-XhoI (SEQ ID NO: 60) and PtGR-R542-SacII (SEQ ID NO: 61) as primers, cleaving the PCR product with XhoI and SacII, and inserting the fragment at XhoI-SacII site of the pSSTR2.

TABLE-US-00003 linkerC12-F-XhoI: (SEQ ID NO: 58) AGGCTCGAGTGGCGGTGGAGGTAGTGGAGGCGGCGGAACAAA linkerC17-F-XhoI: (SEQ ID NO: 59) AGGCTCGAGTGGTGGTGGGGGCAGTGGCGGTGGAGGTAGTGG linkerC22-F-XhoI: (SEQ ID No. 60) AGGCTCGAGTGGAGGTGGCGGTTCTGGTGGTGGGGGCAGTGGCGGT PtGR-R542-SacII: (SEQ ID No. 61) TTTCCGCGGCAGCTTAGAAGCCTTCTC

[0062] The pSSTR2-lucC394 and plucN415-arrestin thus prepared were transfected to the HEK293 cells cultured in a 96 well plastic culture dishes by using TtansIT Transfection Reagents (TAKARA). After about 40 hours from the transfection, the cells were incubated in a culture medium containing 1 .mu.m of somatostatin for 12 minutes, ELA (TOYOBO) was added, and the luminescence was measured with TriStar LB941 (Berthold Technologies). The luminescence was also measured for the control cell with no addition of the somatostatin, and the results were compared. As shown in FIG. 6, addition of the somatostatin resulted in the significant enhancement of the luminescence, whose intensity was eight times.

[0063] Next, HEK293 cells which had been transfected with plucN415-arrestin using 6 cm plastic culture dishes as described above were cultured for 20 days in a culture medium containing 0.8 mg/mL of G418 and an HEK293 cell line (HEK293-ARRB2) capable of constantly expressing lucN415-arrestin was prepared. This cell line was transfected with pSSTR2-lucC394 as described above, and the cells were cultured for 20 days in a culture medium containing 0.8 mg/mL of G418 and 0.04 mg/mL of Zeocin and an HEK293 cell line (HEK293-ARRB2-SSTR2) capable of constantly expressing lucN415-arrestin and SSTR2-lucC394 was prepared.

[0064] The cells were cultured in a 96 well plastic culture dish, and after stimulating the cells for 12 minutes with somatostatin or its analog (RIM23052 or BIM23056) at various concentrations, luminescence was measured as described above. A dose-response curve showing relationship of the luminescence intensity and the ligand concentration was made from the results obtained.

[0065] As shown in FIG. 7, in the case of somatostatin, enhancement in the luminescence was observed at a concentration of 3.times.10.sup.-9 to 3.times.10.sup.-7 M, and the enhancement was not enhanced at the higher somatostatin concentration. In the case of the somatostatin analogues, such enhancement in the luminescence was not observed at the same concentration. Thus, quantitative assay of the ligand activity to the receptor was enabled using the assay system in which the luciferase split assay of the present invention is applied to the receptor and the intracellular binding element.

[0066] When HEK293-ARRB2-SSTR2 was stimulated with 1.times.10.sup.-6 M somatostatin and the luminescence was measured at 3 minutes, 6 minutes, 12 minutes, 15 minutes, 30 minutes, 40 minutes, 50 minutes, and 90 minutes after the stimulation, the luminescence reached 90% of the maximum luminescence in 5 minutes and the luminescence reached its maximum in 12 minutes, as shown in FIG. 8. After 12 minutes, the luminescence gradually reduced. However, the level of 80% of the maximum luminescence was still maintained after 90 minutes. Thus, the assay system employing the luciferase split assay of the present invention has enabled more prompt detection compared to the conventional protein-protein interaction detection system.

[0067] The luciferase split assay of the present invention can be applied to the GPCR other than SSTR2, namely ADRB2 (adrenergic beta 2 receptor, surface) (NM.sub.--000024), AGTRL1 (apelin receptor) (NM.sub.--00516), EDNRB (endothelin receptor type B) (NM.sub.--000115), and CCKBR (cholecystokinin B receptor) (NM.sub.--17685), and the results shown in FIG. 9 were obtained in similar experimental systems.

INDUSTRIAL APPLICABILITY

[0068] The present invention has enabled to provide a split luciferase assay system having a remarkably high detection sensitivity.

Sequence CWU 1

1

711149PRTPyrearinus termitilluminans 1Thr Lys Gly Tyr Val Asn Asn Pro Gln Ala Thr Lys Glu Ala Ile Asp 1 5 10 15 Asp Asp Gly Trp Leu His Ser Gly Asp Phe Gly Tyr Tyr Asp Glu Asp 20 25 30 Glu Tyr Phe Tyr Ile Val Asp Arg Tyr Lys Glu Leu Ile Lys Tyr Lys 35 40 45 Gly Tyr Gln Val Ala Pro Val Glu Leu Glu Glu Ile Leu Leu Gln His 50 55 60 Pro Gly Ile Arg Asp Val Ala Val Val Gly Ile Pro Asp Ile Glu Ala 65 70 75 80 Gly Glu Leu Pro Ala Gly Phe Val Val Lys Gln Pro Gly Ala Gln Leu 85 90 95 Thr Ala Lys Glu Val Tyr Asp Phe Leu Ala Gln Arg Val Ser His Ser 100 105 110 Lys Tyr Leu Arg Gly Gly Val Arg Phe Val Asp Ser Ile Pro Arg Asn 115 120 125 Val Thr Gly Lys Ile Ser Arg Lys Glu Leu Arg Glu Ala Leu Met Glu 130 135 140 Lys Ala Ser Lys Leu 145 2412PRTPyrearinus termitilluminans 2Met Glu Arg Glu Lys Asn Val Val Tyr Gly Pro Glu Pro Lys His Pro 1 5 10 15 Leu Gly Asn Phe Thr Ala Gly Glu Met Leu Tyr Asn Ala Leu His Lys 20 25 30 His Ser His Ile Pro Gln Ala Ile Leu Asp Val Met Gly Asn Glu Ser 35 40 45 Leu Ser Tyr Gln Glu Phe Phe Asp Thr Thr Val Lys Leu Gly Gln Ser 50 55 60 Leu Gln Asn Cys Gly Tyr Lys Met Asn Asp Val Val Ser Ile Cys Ala 65 70 75 80 Glu Asn Asn Lys Arg Phe Phe Ile Pro Ile Ile Ser Ala Trp Tyr Ile 85 90 95 Gly Met Val Val Ala Pro Val Asn Glu Asp Tyr Ile Pro Asp Glu Leu 100 105 110 Cys Lys Val Thr Gly Ile Ser Lys Pro Ile Leu Val Phe Thr Thr Arg 115 120 125 Lys Ile Leu Pro Lys Val Leu Glu Val Lys Asp Arg Thr Asn Tyr Ile 130 135 140 Lys Arg Ile Ile Ile Leu Asp Ser Glu Glu Asn Leu Leu Gly Cys Glu 145 150 155 160 Ser Leu His Asn Phe Met Ser Arg Tyr Ser Asp Asn Asn Leu Gln Thr 165 170 175 Phe Lys Pro Leu His Tyr Asp Pro Val Asp Gln Val Ala Ala Ile Leu 180 185 190 Cys Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Met Gln Thr His 195 200 205 Arg Asn Ile Cys Val Arg Leu Thr His Ala Ser Asp Pro Arg Val Gly 210 215 220 Thr Gln Leu Ile Pro Gly Val Ser Val Leu Ala Tyr Leu Pro Phe Phe 225 230 235 240 His Ala Phe Gly Phe Ser Ile Asn Leu Gly Tyr Phe Met Val Gly Leu 245 250 255 Arg Val Val Met Leu Arg Arg Phe Asn Gln Glu Val Phe Leu Lys Ala 260 265 270 Ile Gln Asp Tyr Glu Val Arg Ser Val Ile Asn Val Pro Ser Thr Ile 275 280 285 Leu Phe Leu Ser Lys Ser Pro Leu Val Asp Lys Tyr Asp Leu Ser Thr 290 295 300 Leu Ala Glu Leu Cys Cys Gly Ala Ala Pro Leu Ala Lys Glu Val Ala 305 310 315 320 Glu Ile Ala Val Lys Arg Leu Asn Leu Pro Gly Ile Arg Cys Gly Tyr 325 330 335 Gly Leu Thr Glu Ser Thr Ser Ala Asn Ile His Thr Leu His Asn Glu 340 345 350 Phe Lys Ser Gly Ser Leu Gly Lys Val Thr Pro Tyr Met Ala Ala Lys 355 360 365 Ile Ile Asp Arg Asn Thr Gly Glu Ala Leu Gly Pro Asn Gln Val Gly 370 375 380 Glu Leu Cys Ile Trp Gly Pro Met Val Thr Lys Gly Tyr Val Asn Asn 385 390 395 400 Pro Gln Ala Thr Lys Glu Ala Ile Asp Asp Asp Gly 405 410 3413PRTPyrearinus termitilluminans 3Met Glu Arg Glu Lys Asn Val Val Tyr Gly Pro Glu Pro Lys His Pro 1 5 10 15 Leu Gly Asn Phe Thr Ala Gly Glu Met Leu Tyr Asn Ala Leu His Lys 20 25 30 His Ser His Ile Pro Gln Ala Ile Leu Asp Val Met Gly Asn Glu Ser 35 40 45 Leu Ser Tyr Gln Glu Phe Phe Asp Thr Thr Val Lys Leu Gly Gln Ser 50 55 60 Leu Gln Asn Cys Gly Tyr Lys Met Asn Asp Val Val Ser Ile Cys Ala 65 70 75 80 Glu Asn Asn Lys Arg Phe Phe Ile Pro Ile Ile Ser Ala Trp Tyr Ile 85 90 95 Gly Met Val Val Ala Pro Val Asn Glu Asp Tyr Ile Pro Asp Glu Leu 100 105 110 Cys Lys Val Thr Gly Ile Ser Lys Pro Ile Leu Val Phe Thr Thr Arg 115 120 125 Lys Ile Leu Pro Lys Val Leu Glu Val Lys Asp Arg Thr Asn Tyr Ile 130 135 140 Lys Arg Ile Ile Ile Leu Asp Ser Glu Glu Asn Leu Leu Gly Cys Glu 145 150 155 160 Ser Leu His Asn Phe Met Ser Arg Tyr Ser Asp Asn Asn Leu Gln Thr 165 170 175 Phe Lys Pro Leu His Tyr Asp Pro Val Asp Gln Val Ala Ala Ile Leu 180 185 190 Cys Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Met Gln Thr His 195 200 205 Arg Asn Ile Cys Val Arg Leu Thr His Ala Ser Asp Pro Arg Val Gly 210 215 220 Thr Gln Leu Ile Pro Gly Val Ser Val Leu Ala Tyr Leu Pro Phe Phe 225 230 235 240 His Ala Phe Gly Phe Ser Ile Asn Leu Gly Tyr Phe Met Val Gly Leu 245 250 255 Arg Val Val Met Leu Arg Arg Phe Asn Gln Glu Val Phe Leu Lys Ala 260 265 270 Ile Gln Asp Tyr Glu Val Arg Ser Val Ile Asn Val Pro Ser Thr Ile 275 280 285 Leu Phe Leu Ser Lys Ser Pro Leu Val Asp Lys Tyr Asp Leu Ser Thr 290 295 300 Leu Ala Glu Leu Cys Cys Gly Ala Ala Pro Leu Ala Lys Glu Val Ala 305 310 315 320 Glu Ile Ala Val Lys Arg Leu Asn Leu Pro Gly Ile Arg Cys Gly Tyr 325 330 335 Gly Leu Thr Glu Ser Thr Ser Ala Asn Ile His Thr Leu His Asn Glu 340 345 350 Phe Lys Ser Gly Ser Leu Gly Lys Val Thr Pro Tyr Met Ala Ala Lys 355 360 365 Ile Ile Asp Arg Asn Thr Gly Glu Ala Leu Gly Pro Asn Gln Val Gly 370 375 380 Glu Leu Cys Ile Trp Gly Pro Met Val Thr Lys Gly Tyr Val Asn Asn 385 390 395 400 Pro Gln Ala Thr Lys Glu Ala Ile Asp Asp Asp Gly Trp 405 410 4414PRTPyrearinus termitilluminans 4Met Glu Arg Glu Lys Asn Val Val Tyr Gly Pro Glu Pro Lys His Pro 1 5 10 15 Leu Gly Asn Phe Thr Ala Gly Glu Met Leu Tyr Asn Ala Leu His Lys 20 25 30 His Ser His Ile Pro Gln Ala Ile Leu Asp Val Met Gly Asn Glu Ser 35 40 45 Leu Ser Tyr Gln Glu Phe Phe Asp Thr Thr Val Lys Leu Gly Gln Ser 50 55 60 Leu Gln Asn Cys Gly Tyr Lys Met Asn Asp Val Val Ser Ile Cys Ala 65 70 75 80 Glu Asn Asn Lys Arg Phe Phe Ile Pro Ile Ile Ser Ala Trp Tyr Ile 85 90 95 Gly Met Val Val Ala Pro Val Asn Glu Asp Tyr Ile Pro Asp Glu Leu 100 105 110 Cys Lys Val Thr Gly Ile Ser Lys Pro Ile Leu Val Phe Thr Thr Arg 115 120 125 Lys Ile Leu Pro Lys Val Leu Glu Val Lys Asp Arg Thr Asn Tyr Ile 130 135 140 Lys Arg Ile Ile Ile Leu Asp Ser Glu Glu Asn Leu Leu Gly Cys Glu 145 150 155 160 Ser Leu His Asn Phe Met Ser Arg Tyr Ser Asp Asn Asn Leu Gln Thr 165 170 175 Phe Lys Pro Leu His Tyr Asp Pro Val Asp Gln Val Ala Ala Ile Leu 180 185 190 Cys Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Met Gln Thr His 195 200 205 Arg Asn Ile Cys Val Arg Leu Thr His Ala Ser Asp Pro Arg Val Gly 210 215 220 Thr Gln Leu Ile Pro Gly Val Ser Val Leu Ala Tyr Leu Pro Phe Phe 225 230 235 240 His Ala Phe Gly Phe Ser Ile Asn Leu Gly Tyr Phe Met Val Gly Leu 245 250 255 Arg Val Val Met Leu Arg Arg Phe Asn Gln Glu Val Phe Leu Lys Ala 260 265 270 Ile Gln Asp Tyr Glu Val Arg Ser Val Ile Asn Val Pro Ser Thr Ile 275 280 285 Leu Phe Leu Ser Lys Ser Pro Leu Val Asp Lys Tyr Asp Leu Ser Thr 290 295 300 Leu Ala Glu Leu Cys Cys Gly Ala Ala Pro Leu Ala Lys Glu Val Ala 305 310 315 320 Glu Ile Ala Val Lys Arg Leu Asn Leu Pro Gly Ile Arg Cys Gly Tyr 325 330 335 Gly Leu Thr Glu Ser Thr Ser Ala Asn Ile His Thr Leu His Asn Glu 340 345 350 Phe Lys Ser Gly Ser Leu Gly Lys Val Thr Pro Tyr Met Ala Ala Lys 355 360 365 Ile Ile Asp Arg Asn Thr Gly Glu Ala Leu Gly Pro Asn Gln Val Gly 370 375 380 Glu Leu Cys Ile Trp Gly Pro Met Val Thr Lys Gly Tyr Val Asn Asn 385 390 395 400 Pro Gln Ala Thr Lys Glu Ala Ile Asp Asp Asp Gly Trp Leu 405 410 5415PRTPyrearinus termitilluminans 5Met Glu Arg Glu Lys Asn Val Val Tyr Gly Pro Glu Pro Lys His Pro 1 5 10 15 Leu Gly Asn Phe Thr Ala Gly Glu Met Leu Tyr Asn Ala Leu His Lys 20 25 30 His Ser His Ile Pro Gln Ala Ile Leu Asp Val Met Gly Asn Glu Ser 35 40 45 Leu Ser Tyr Gln Glu Phe Phe Asp Thr Thr Val Lys Leu Gly Gln Ser 50 55 60 Leu Gln Asn Cys Gly Tyr Lys Met Asn Asp Val Val Ser Ile Cys Ala 65 70 75 80 Glu Asn Asn Lys Arg Phe Phe Ile Pro Ile Ile Ser Ala Trp Tyr Ile 85 90 95 Gly Met Val Val Ala Pro Val Asn Glu Asp Tyr Ile Pro Asp Glu Leu 100 105 110 Cys Lys Val Thr Gly Ile Ser Lys Pro Ile Leu Val Phe Thr Thr Arg 115 120 125 Lys Ile Leu Pro Lys Val Leu Glu Val Lys Asp Arg Thr Asn Tyr Ile 130 135 140 Lys Arg Ile Ile Ile Leu Asp Ser Glu Glu Asn Leu Leu Gly Cys Glu 145 150 155 160 Ser Leu His Asn Phe Met Ser Arg Tyr Ser Asp Asn Asn Leu Gln Thr 165 170 175 Phe Lys Pro Leu His Tyr Asp Pro Val Asp Gln Val Ala Ala Ile Leu 180 185 190 Cys Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Met Gln Thr His 195 200 205 Arg Asn Ile Cys Val Arg Leu Thr His Ala Ser Asp Pro Arg Val Gly 210 215 220 Thr Gln Leu Ile Pro Gly Val Ser Val Leu Ala Tyr Leu Pro Phe Phe 225 230 235 240 His Ala Phe Gly Phe Ser Ile Asn Leu Gly Tyr Phe Met Val Gly Leu 245 250 255 Arg Val Val Met Leu Arg Arg Phe Asn Gln Glu Val Phe Leu Lys Ala 260 265 270 Ile Gln Asp Tyr Glu Val Arg Ser Val Ile Asn Val Pro Ser Thr Ile 275 280 285 Leu Phe Leu Ser Lys Ser Pro Leu Val Asp Lys Tyr Asp Leu Ser Thr 290 295 300 Leu Ala Glu Leu Cys Cys Gly Ala Ala Pro Leu Ala Lys Glu Val Ala 305 310 315 320 Glu Ile Ala Val Lys Arg Leu Asn Leu Pro Gly Ile Arg Cys Gly Tyr 325 330 335 Gly Leu Thr Glu Ser Thr Ser Ala Asn Ile His Thr Leu His Asn Glu 340 345 350 Phe Lys Ser Gly Ser Leu Gly Lys Val Thr Pro Tyr Met Ala Ala Lys 355 360 365 Ile Ile Asp Arg Asn Thr Gly Glu Ala Leu Gly Pro Asn Gln Val Gly 370 375 380 Glu Leu Cys Ile Trp Gly Pro Met Val Thr Lys Gly Tyr Val Asn Asn 385 390 395 400 Pro Gln Ala Thr Lys Glu Ala Ile Asp Asp Asp Gly Trp Leu His 405 410 415 6416PRTPyrearinus termitilluminans 6Met Glu Arg Glu Lys Asn Val Val Tyr Gly Pro Glu Pro Lys His Pro 1 5 10 15 Leu Gly Asn Phe Thr Ala Gly Glu Met Leu Tyr Asn Ala Leu His Lys 20 25 30 His Ser His Ile Pro Gln Ala Ile Leu Asp Val Met Gly Asn Glu Ser 35 40 45 Leu Ser Tyr Gln Glu Phe Phe Asp Thr Thr Val Lys Leu Gly Gln Ser 50 55 60 Leu Gln Asn Cys Gly Tyr Lys Met Asn Asp Val Val Ser Ile Cys Ala 65 70 75 80 Glu Asn Asn Lys Arg Phe Phe Ile Pro Ile Ile Ser Ala Trp Tyr Ile 85 90 95 Gly Met Val Val Ala Pro Val Asn Glu Asp Tyr Ile Pro Asp Glu Leu 100 105 110 Cys Lys Val Thr Gly Ile Ser Lys Pro Ile Leu Val Phe Thr Thr Arg 115 120 125 Lys Ile Leu Pro Lys Val Leu Glu Val Lys Asp Arg Thr Asn Tyr Ile 130 135 140 Lys Arg Ile Ile Ile Leu Asp Ser Glu Glu Asn Leu Leu Gly Cys Glu 145 150 155 160 Ser Leu His Asn Phe Met Ser Arg Tyr Ser Asp Asn Asn Leu Gln Thr 165 170 175 Phe Lys Pro Leu His Tyr Asp Pro Val Asp Gln Val Ala Ala Ile Leu 180 185 190 Cys Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Met Gln Thr His 195 200 205 Arg Asn Ile Cys Val Arg Leu Thr His Ala Ser Asp Pro Arg Val Gly 210 215 220 Thr Gln Leu Ile Pro Gly Val Ser Val Leu Ala Tyr Leu Pro Phe Phe 225 230 235 240 His Ala Phe Gly Phe Ser Ile Asn Leu Gly Tyr Phe Met Val Gly Leu 245 250 255 Arg Val Val Met Leu Arg Arg Phe Asn Gln Glu Val Phe Leu Lys Ala 260 265 270 Ile Gln Asp Tyr Glu Val Arg Ser Val Ile Asn Val Pro Ser Thr Ile 275 280 285 Leu Phe Leu Ser Lys Ser Pro Leu Val Asp Lys Tyr Asp Leu Ser Thr 290 295 300 Leu Ala Glu Leu Cys Cys Gly Ala Ala Pro Leu Ala Lys Glu Val Ala 305 310 315 320 Glu Ile Ala Val Lys Arg Leu Asn Leu Pro Gly Ile Arg Cys Gly Tyr 325 330 335 Gly Leu Thr Glu Ser Thr Ser Ala Asn Ile His Thr Leu His Asn Glu 340 345 350 Phe Lys Ser Gly Ser Leu Gly Lys Val Thr Pro Tyr Met Ala Ala Lys 355 360 365 Ile Ile Asp Arg Asn Thr Gly Glu Ala Leu Gly Pro Asn Gln Val Gly 370 375 380 Glu Leu Cys Ile Trp Gly Pro Met Val Thr Lys Gly Tyr Val Asn Asn 385 390 395 400 Pro Gln Ala Thr Lys Glu Ala Ile Asp Asp Asp Gly Trp Leu His Ser 405 410 415 71611DNAArtificial Sequencemyc-His 7aagcttaccg ccatggagag agagaagaac gtggtgtacg gccccgagcc caagcaccct 60ctgggcaact tcaccgccgg cgagatgctg tacaacgctc tgcacaagca ctcccacatc 120ccccaggcca tcctggacgt gatgggcaac gagtcccttt cctaccagga gttcttcgac 180actactgtga agctgggcca gagcctccag aactgtggct acaagatgaa cgatgtcgtg 240tcgatctgtg cagagaacaa caagagattc ttcatcccca tcatctccgc ctggtacatc 300ggcatggtgg tggcccctgt

gaacgaggac tatatcccag acgagctgtg taaagtgacc 360ggcatctcca agccgatcct ggtcttcacc actaggaaga tcctgcctaa ggttttggag 420gttaaagaca gaaccaacta cataaagagg atcatcatac tggactctga agagaacctg 480ctgggctgcg agagcctgca caacttcatg tccaggtact ccgacaacaa cctccaaaca 540ttcaagcctc tgcactacga ccctgtggac caggtagccg ccatcctgtg ctcctccggc 600acaaccggcc tgcctaaagg cgtgatgcag acccacagga acatctgtgt gagactcaca 660cacgcatctg accccagagt gggtacacaa ctcatccccg gcgtatccgt gctggcctac 720ctgccattct tccacgcctt cggcttcagt atcaacctgg gctatttcat ggtgggcctg 780agagtggtga tgctccgaag gtttaaccag gaggtgttcc tgaaggccat ccaggactac 840gaggtgagga gcgtgatcaa cgttccctcc acaatcctgt tcctgtccaa gagccctctg 900gtggacaagt acgacctatc caccctggcg gagctgtgct gtggagccgc tcctctggcg 960aaggaggtgg ccgagatcgc cgtgaagagg ctgaacctgc cagggatacg gtgtggctac 1020ggtctaacag agtctacctc cgccaacatc catactctgc acaacgagtt caagtccggc 1080tccctgggca aggtgacacc ttacatggcc gccaagatca tcgacaggaa caccggcgag 1140gccctgggtc caaaccaggt gggcgagctg tgcatctggg gacctatggt aacaaaaggc 1200tatgtgaaca acccacaggc tactaaggag gccatcgacg acgacggctg gctgcacgga 1260ggaggcggag gatccatggg cgtgcaggtg gagactatct ccccaggaga cgggcgcacc 1320ttccccaagc gcggccagac ctgcgtggtg cactacaccg ggatgcttga agatggaaag 1380aaatttgatt cctcccggga cagaaacaag ccctttaagt ttatgctagg caagcaggag 1440gtgatccgag gctgggaaga aggggttgcc cagatgagtg tgggtcagag agccaaactg 1500actatatctc cagattatgc ctatggtgcc actgggcacc caggcatcat cccaccacat 1560gccactctcg tcttcgatgt ggagcttcta aaactggaac gctcgagtct a 16118790DNAArtificial SequenceV5-His 8ggatcccccg ggctgcagga attctatggt agccatcctc tggcatgaga tgtggcatga 60aggtctagaa gaggcctctc gcttgtactt tggggagagg aacgtcaaag gcatgtttga 120ggtgctggag cccctgcatg ctatgatgga acgcggtccc cagaccctga aggaaacgtc 180ctttaatcag gcatatggtc gagatttaat ggaggcacaa gaatggtgcc gaaagtacat 240gaaatcaggg aacgtcaagg acctcaccca agcctgggac ctctactatc acgtgttcag 300acggatatca cgctcgagtg gaggcggcgg aacaaaaggc tatgtgaaca acccacaggc 360tactaaggag gccatcgacg acgacggctg gctgcactct ggcgacttcg gctactacga 420cgaggacgag tatttctaca tcgtggaccg gtacaaggag ctgatcaaat acaagggcta 480tcaggtcgcc cctgtggagc tggaggagat cctccttcag cacccaggca tcagggacgt 540ggccgtcgtg ggtatccctg acatcgaggc cggcgagctg ccagccggct tcgtggtgaa 600gcagcccggc gcccaactca ccgctaagga ggtgtacgac ttcctggccc agagggtgtc 660tcactccaag tacctgaggg gcggcgtaag gttcgtggac tctatcccca ggaacgtgac 720aggcaagatt agtcgaaaag agctgaggga ggccctgatg gagaaggctt ctaagctggg 780cccgcggttc 790933DNAArtificial SequencePCR primer 9aagcttgcca tggtaaagcg tgagaaaaat gtc 331036DNAArtificial SequencePCR primer 10ggatcctccg cctcctccgc cgtcgtcgat ggcctc 361146DNAArtificial SequencePCR primer 11aggctcgagt ggaggcggcg gaggctggct gcactctggc gacttc 461235DNAArtificial SequencePCR primer 12cgcgggccca gcttagaagc cttctccatc agggc 351333DNAArtificial SequencePCR primer 13tttaagctta ccgccatgga gagagagaag aac 331439DNAArtificial SequencePCR primer 14tttggatcct ccgcctcctc cagtagcctg tgggttgtt 391539DNAArtificial SequencePCR primer 15tttggatcct ccgcctcctc ccttagtagc ctgtgggtt 391639DNAArtificial SequencePCR primer 16tttggatcct ccgcctcctc cctccttagt agcctgtgg 391739DNAArtificial SequencePCR primer 17tttggatcct ccgcctcctc cggcctcctt agtagcctg 391839DNAArtificial SequencePCR primer 18tttggatcct ccgcctcctc cgatggcctc cttagtagc 391939DNAArtificial SequencePCR primer 19tttggatcct ccgcctcctc cgtcgatggc ctccttagt 392039DNAArtificial SequencePCR primer 20tttggatcct ccgcctcctc cgtcgtcgat ggcctcctt 392139DNAArtificial SequencePCR primer 21tttggatcct ccgcctcctc cgtcgtcgtc gatggcctc 392239DNAArtificial SequencePCR primer 22tttggatcct ccgcctcctc cgccgtcgtc gtcgatggc 392339DNAArtificial SequencePCR primer 23tttggatcct ccgcctcctc cccagccgtc gtcgtcgat 392440DNAArtificial SequencePCR primer 24aggctcgagt ggaggcggcg gaacaaaagg ctatgtgaac 402531DNAArtificial SequencePCR primer 25ttttccgcgg gcccagctta gaagccttct c 312639DNAArtificial SequencePCR primer 26tttggatcct ccgcctcctc ccagccagcc gtcgtcgtc 392739DNAArtificial SequencePCR primer 27tttggatcct ccgcctcctc cgtgcagcca gccgtcgtc 392839DNAArtificial SequencePCR primer 28tttggatcct ccgcctcctc cagagtgcag ccagccgtc 392939DNAArtificial SequencePCR primer 29tttggatcct ccgcctcctc cgccagagtg cagccagcc 393040DNAArtificial SequencePCR primer 30aggctcgagt ggaggcggcg gaaaaggcta tgtgaacaac 403140DNAArtificial SequencePCR primer 31aggctcgagt ggaggcggcg gaggctatgt gaacaaccca 403240DNAArtificial SequencePCR primer 32aggctcgagt ggaggcggcg gatatgtgaa caacccacag 403340DNAArtificial SequencePCR primer 33aggctcgagt ggaggcggcg gagtgaacaa cccacaggct 403440DNAArtificial SequencePCR primer 34aggctcgagt ggaggcggcg gaaacaaccc acaggctact 403540DNAArtificial SequencePCR primer 35aggctcgagt ggaggcggcg gaccacaggc tactaaggag 403640DNAArtificial SequencePCR primer 36aggctcgagt ggaggcggcg gacaggctac taaggaggcc 403740DNAArtificial SequencePCR primer 37aggctcgagt ggaggcggcg gaactaagga ggccatcgac 403840DNAArtificial SequencePCR primer 38aggctcgagt ggaggcggcg gaaaggaggc catcgacgac 403940DNAArtificial SequencePCR primer 39aggctcgagt ggaggcggcg gagaggccat cgacgacgac 404040DNAArtificial SequencePCR primer 40aggctcgagt ggaggcggcg gagccatcga cgacgacggc 404140DNAArtificial SequencePCR primer 41aggctcgagt ggaggcggcg gaatcgacga cgacggctgg 404240DNAArtificial SequencePCR primer 42aggctcgagt ggaggcggcg gagacgacga cggctggctg 404340DNAArtificial SequencePCR primer 43aggctcgagt ggaggcggcg gagacgacgg ctggctgcac 404440DNAArtificial SequencePCR primer 44aggctcgagt ggaggcggcg gagacggctg gctgcactct 404540DNAArtificial SequencePCR primer 45aggctcgagt ggaggcggcg gaggctggct gcactctggc 404640DNAArtificial SequencePCR primer 46aggctcgagt ggaggcggcg gatggctgca ctctggcgac 404743DNAArtificial SequencePCR primer 47aggctcgagt ggaggcggcg gaaacccaca ggctactaag gag 434843DNAArtificial SequencePCR primer 48aggctcgagt ggaggcggcg gagctactaa ggaggccatc gac 434940DNAArtificial SequencePCR primer 49aggctcgagt ggaggcggcg gagtaacaaa aggctatgtg 405040DNAArtificial SequencePCR primer 50aggctcgagt ggaggcggcg gaatggtaac aaaaggctat 405140DNAArtificial SequencePCR primer 51aggctcgagt ggaggcggcg gacctatggt aacaaaaggc 405240DNAArtificial SequencePCR primer 52aggctcgagt ggaggcggcg gaggacctat ggtaacaaaa 405340DNAArtificial SequencePCR primer 53aggctcgagt ggaggcggcg gatggggacc tatggtaaca 405437DNAArtificial SequencePCR primer 54aaaggatcca tgggggagaa acccgggacc agggtct 375530DNAArtificial SequencePCR primer 55aagaattcca gcagagttga tcatcatagt 305630DNAArtificial SequencePCR primer 56ttggatccat ggacatggcg gatgagccac 305736DNAArtificial SequencePCR primer 57tttctcgagc cgatactggt ttggaggtct ccattg 365842DNAArtificial SequencePCR primer 58aggctcgagt ggcggtggag gtagtggagg cggcggaaca aa 425942DNAArtificial SequencePCR primer 59aggctcgagt ggtggtgggg gcagtggcgg tggaggtagt gg 426046DNAArtificial SequencePCR primer 60aggctcgagt ggaggtggcg gttctggtgg tgggggcagt ggcggt 466127DNAArtificial SequencePCR primer 61tttccgcggc agcttagaag ccttctc 276229DNAArtificial SequencePCR primer 62tttaagctta tgcagccgcc tccaagtct 296338DNAArtificial SequencePCR primer 63tttctcgagc cagatgagct gtatttatta ctggaacg 386430DNAArtificial SequencePCR primer 64ttggatccat ggggcaaccc gggaacggca 306534DNAArtificial SequencePCR primer 65tttctcgagc ccagcagtga gtcatttgta ctac 346632DNAArtificial SequencePCR primer 66ttggatccat ggaggaaggt ggtgattttg ac 326732DNAArtificial SequencePCR primer 67tttctcgagc cgtcaaccac aagggtctcc tg 326831DNAArtificial SequencePCR primer 68tttaagctta tggagctgct aaagctgaac c 316932DNAArtificial SequencePCR primer 69tttctcgagc cgccagggcc cagtgtgctg at 32701629DNAPyrearinus termitilluminans 70atggagagag agaagaacgt ggtgtacggc cccgagccca agcaccctct gggcaacttc 60accgccggcg agatgctgta caacgctctg cacaagcact cccacatccc ccaggccatc 120ctggacgtga tgggcaacga gtccctttcc taccaggagt tcttcgacac tactgtgaag 180ctgggccaga gcctccagaa ctgtggctac aagatgaacg atgtcgtgtc gatctgtgca 240gagaacaaca agagattctt catccccatc atctccgcct ggtacatcgg catggtggtg 300gcccctgtga acgaggacta tatcccagac gagctgtgta aagtgaccgg catctccaag 360ccgatcctgg tcttcaccac taggaagatc ctgcctaagg ttttggaggt taaagacaga 420accaactaca taaagaggat catcatactg gactctgaag agaacctgct gggctgcgag 480agcctgcaca acttcatgtc caggtactcc gacaacaacc tccaaacatt caagcctctg 540cactacgacc ctgtggacca ggtagccgcc atcctgtgct cctccggcac aaccggcctg 600cctaaaggcg tgatgcagac ccacaggaac atctgtgtga gactcacaca cgcatctgac 660cccagagtgg gtacacaact catccccggc gtatccgtgc tggcctacct gccattcttc 720cacgccttcg gcttcagtat caacctgggc tatttcatgg tgggcctgag agtggtgatg 780ctccgaaggt ttaaccagga ggtgttcctg aaggccatcc aggactacga ggtgaggagc 840gtgatcaacg ttccctccac aatcctgttc ctgtccaaga gccctctggt ggacaagtac 900gacctatcca ccctggcgga gctgtgctgt ggagccgctc ctctggcgaa ggaggtggcc 960gagatcgccg tgaagaggct gaacctgcca gggatacggt gtggctacgg tctaacagag 1020tctacctccg ccaacatcca tactctgcac aacgagttca agtccggctc cctgggcaag 1080gtgacacctt acatggccgc caagatcatc gacaggaaca ccggcgaggc cctgggtcca 1140aaccaggtgg gcgagctgtg catctgggga cctatggtaa caaaaggcta tgtgaacaac 1200ccacaggcta ctaaggaggc catcgacgac gacggctggc tgcactctgg cgacttcggc 1260tactacgacg aggacgagta tttctacatc gtggaccggt acaaggagct gatcaaatac 1320aagggctatc aggtcgcccc tgtggagctg gaggagatcc tccttcagca cccaggcatc 1380agggacgtgg ccgtcgtggg tatccctgac atcgaggccg gcgagctgcc agccggcttc 1440gtggtgaagc agcccggcgc ccaactcacc gctaaggagg tgtacgactt cctggcccag 1500agggtgtctc actccaagta cctgaggggc ggcgtaaggt tcgtggactc tatccccagg 1560aacgtgacag gcaagattag tcgaaaagag ctgagggagg ccctgatgga gaaggcttct 1620aagctgtaa 162971542PRTPyrearinus termitilluminans 71Met Glu Arg Glu Lys Asn Val Val Tyr Gly Pro Glu Pro Lys His Pro 1 5 10 15 Leu Gly Asn Phe Thr Ala Gly Glu Met Leu Tyr Asn Ala Leu His Lys 20 25 30 His Ser His Ile Pro Gln Ala Ile Leu Asp Val Met Gly Asn Glu Ser 35 40 45 Leu Ser Tyr Gln Glu Phe Phe Asp Thr Thr Val Lys Leu Gly Gln Ser 50 55 60 Leu Gln Asn Cys Gly Tyr Lys Met Asn Asp Val Val Ser Ile Cys Ala 65 70 75 80 Glu Asn Asn Lys Arg Phe Phe Ile Pro Ile Ile Ser Ala Trp Tyr Ile 85 90 95 Gly Met Val Val Ala Pro Val Asn Glu Asp Tyr Ile Pro Asp Glu Leu 100 105 110 Cys Lys Val Thr Gly Ile Ser Lys Pro Ile Leu Val Phe Thr Thr Arg 115 120 125 Lys Ile Leu Pro Lys Val Leu Glu Val Lys Asp Arg Thr Asn Tyr Ile 130 135 140 Lys Arg Ile Ile Ile Leu Asp Ser Glu Glu Asn Leu Leu Gly Cys Glu 145 150 155 160 Ser Leu His Asn Phe Met Ser Arg Tyr Ser Asp Asn Asn Leu Gln Thr 165 170 175 Phe Lys Pro Leu His Tyr Asp Pro Val Asp Gln Val Ala Ala Ile Leu 180 185 190 Cys Ser Ser Gly Thr Thr Gly Leu Pro Lys Gly Val Met Gln Thr His 195 200 205 Arg Asn Ile Cys Val Arg Leu Thr His Ala Ser Asp Pro Arg Val Gly 210 215 220 Thr Gln Leu Ile Pro Gly Val Ser Val Leu Ala Tyr Leu Pro Phe Phe 225 230 235 240 His Ala Phe Gly Phe Ser Ile Asn Leu Gly Tyr Phe Met Val Gly Leu 245 250 255 Arg Val Val Met Leu Arg Arg Phe Asn Gln Glu Val Phe Leu Lys Ala 260 265 270 Ile Gln Asp Tyr Glu Val Arg Ser Val Ile Asn Val Pro Ser Thr Ile 275 280 285 Leu Phe Leu Ser Lys Ser Pro Leu Val Asp Lys Tyr Asp Leu Ser Thr 290 295 300 Leu Ala Glu Leu Cys Cys Gly Ala Ala Pro Leu Ala Lys Glu Val Ala 305 310 315 320 Glu Ile Ala Val Lys Arg Leu Asn Leu Pro Gly Ile Arg Cys Gly Tyr 325 330 335 Gly Leu Thr Glu Ser Thr Ser Ala Asn Ile His Thr Leu His Asn Glu 340 345 350 Phe Lys Ser Gly Ser Leu Gly Lys Val Thr Pro Tyr Met Ala Ala Lys 355 360 365 Ile Ile Asp Arg Asn Thr Gly Glu Ala Leu Gly Pro Asn Gln Val Gly 370 375 380 Glu Leu Cys Ile Trp Gly Pro Met Val Thr Lys Gly Tyr Val Asn Asn 385 390 395 400 Pro Gln Ala Thr Lys Glu Ala Ile Asp Asp Asp Gly Trp Leu His Ser 405 410 415 Gly Asp Phe Gly Tyr Tyr Asp Glu Asp Glu Tyr Phe Tyr Ile Val Asp 420 425 430 Arg Tyr Lys Glu Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro Val 435 440 445 Glu Leu Glu Glu Ile Leu Leu Gln His Pro Gly Ile Arg Asp Val Ala 450 455 460 Val Val Gly Ile Pro Asp Ile Glu Ala Gly Glu Leu Pro Ala Gly Phe 465 470 475 480 Val Val Lys Gln Pro Gly Ala Gln Leu Thr Ala Lys Glu Val Tyr Asp 485 490 495 Phe Leu Ala Gln Arg Val Ser His Ser Lys Tyr Leu Arg Gly Gly Val 500 505 510 Arg Phe Val Asp Ser Ile Pro Arg Asn Val Thr Gly Lys Ile Ser Arg 515 520 525 Lys Glu Leu Arg Glu Ala Leu Met Glu Lys Ala Ser Lys Leu 530 535 540

Claims

1. A fusion protein having the amino acid sequence of amino acid SEQ ID No: 1.

2-13. (canceled)