U.S. patent application number 13/784609 was filed with the patent office on 2013-11-07 for antidotes to antisense compounds.
This patent application is currently assigned to ISIS PHARMACEUTICALS, INC.. The applicant listed for this patent is Isis Pharmaceuticals, Inc.. Invention is credited to Brett P. Monia, Andrew M. Siwkowski, Hong Zhang.
Application Number | 20130296400 13/784609 |
Document ID | / |
Family ID | 40626420 |
Filed Date | 2013-11-07 |
United States Patent
Application |
20130296400 |
Kind Code |
A1 |
Monia; Brett P. ; et
al. |
November 7, 2013 |
ANTIDOTES TO ANTISENSE COMPOUNDS
Abstract
The present invention relates to antisense antidote compounds
and uses thereof. Such antidote compounds reduce the magnitude
and/or duration of the antisense activity of an antisense
compound.
Inventors: |
Monia; Brett P.; (Encinitas,
CA) ; Siwkowski; Andrew M.; (Carlsbad, CA) ;
Zhang; Hong; (Fremont, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Isis Pharmaceuticals, Inc.; |
|
|
US |
|
|
Assignee: |
ISIS PHARMACEUTICALS, INC.
Carlsbad
CA
|
Family ID: |
40626420 |
Appl. No.: |
13/784609 |
Filed: |
March 4, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12740974 |
Sep 13, 2010 |
8389488 |
|
|
PCT/US2008/082511 |
Nov 5, 2008 |
|
|
|
13784609 |
|
|
|
|
60985595 |
Nov 5, 2007 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
A61P 43/00 20180101;
C12N 15/111 20130101; C12N 2310/321 20130101; C12N 2310/11
20130101; C12N 2310/321 20130101; C12N 2310/341 20130101; C12N
15/11 20130101; C12N 2310/3525 20130101; C12N 2320/50 20130101;
C12N 15/113 20130101 |
Class at
Publication: |
514/44.A ;
536/23.1 |
International
Class: |
C12N 15/11 20060101
C12N015/11 |
Claims
1. An antidote compound comprising a modified oligonucleotide
consisting of 12 to 30 linked nucleosides and having a nucleobase
sequence complementary to an antisense compound.
2. The antidote compound of claim 1, wherein the modified
oligonucleotide is a single-stranded oligonucleotide.
3. The antidote compound of claim 1, wherein the antidote compound
is at least 90% complementary to the antisense compound.
4. The antidote compound of claim 1, wherein the antidote compound
is fully complementary to the antisense compound.
5. The antidote compound of claim 1, wherein at least one
internucleoside linkage is a modified internucleoside linkage.
6. (canceled)
7. The antidote compound of claim 1, wherein at least one
nucleoside comprises a modified sugar.
8. The antidote compound of claim 7, wherein at least one modified
sugar is a bicyclic sugar.
9. The antidote compound of claim 7, wherein at least one modified
sugar comprises a 2'-O-methoxyethyl.
10. The antidote compound of claim 1, wherein at least one
nucleoside comprises a modified nucleobase.
11. (canceled)
12. The antidote compound of claim 1, wherein the modified
oligonucleotide comprises: a gap segment consisting of linked
deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; a 3' wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment
and the 3' wing segment and wherein each nucleoside of each wing
segment comprises a modified sugar.
13. (canceled)
14. (canceled)
15. The antidote compound of claim 1, wherein each nucleoside is
modified.
16. The antidote compound of claim 1, wherein the antisense
compound is targeted to an mRNA.
17. The antidote compound of claim 1, wherein the antisense
compound is targeted to an mRNA encoding a blood factor.
18-25. (canceled)
26. The antidote compound of claim 1, wherein the antisense
compound is targeted to a pre-mRNA.
27. The antidote compound of claim 1, wherein the antisense
compound is targeted to a micro-RNA.
28. The antidote compound of claim 1, wherein the antisense
compound is an RNase H dependent antisense compound.
29. The antidote compound of claim 1, wherein the antisense
compound alters splicing of a target nucleic acid.
30. The antidote compound of claim 1, wherein the antisense
compound activates the RISC pathway.
31. The antidote compound of claim 1, wherein the antidote compound
activates RNase H.
32. The antidote compound of claim 1, wherein the antidote compound
activates the RISC pathway.
33-59. (canceled)
60. A kit comprising an antisense compound and an antidote
compound.
61. A kit comprising an antidote compound and a non-oligomeric
antidote.
62. The kit of claim 61 wherein the non-oligomeric antidote is a
target protein.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/740,974, filed Sep. 13, 2010, now U.S. Pat.
No. 8,389,488, issued Mar. 5, 2013, which is a 35 U.S.C. .sctn.371
national phase application of international application serial no.
PCT/US2008/082511, filed on Nov. 5, 2008, which is a
non-provisional of U.S. patent application Ser. No. 60/985,595,
filed on Nov. 5, 2007, the disclosure of each of which is
incorporated herein by reference in its entirety.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled CORE0076USC1SEQ.txt, created Mar. 4, 2013, which is
4.0 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The present invention provides methods and compositions for
modulating antisense activity.
BACKGROUND OF THE INVENTION
[0004] Antisense compounds have been used to modulate target
nucleic acids. Antisense compounds comprising a variety of
modifications and motifs have been reported. In certain instances,
such compounds are useful as research tools and as therapeutic
agents.
SUMMARY OF THE INVENTION
[0005] In certain embodiments, provided herein are antidote
compounds. Such compounds reduce antisense activity of an antisense
compound. In certain embodiments, the present invention provides
antidote compounds that are complementary to antisense
compounds.
[0006] In certain embodiments, the present invention provides
antidote compounds comprising a modified oligonucleotide consisting
of 12 to 30 linked nucleosides and having a nucleobase sequence
complementary to an antisense compound.
[0007] In certain such embodiments, the modified oligonucleotide is
a single-stranded oligonucleotide and/or is at least 90%
complementary to the antisense compound. In certain embodiments,
the antidote compound is fully complementary to the antisense
compound.
[0008] In certain embodiments, antidote compounds at least one
internucleoside linkage of an antidote compound is a modified
internucleoside linkage. In certain such embodiments, at least one
internucleoside linkage is a phosphorothioate internucleoside
linkage.
[0009] In certain embodiments, antidote compounds comprise at least
one nucleoside comprising a modified sugar. In certain such
embodiments, the modified sugar is a bicyclic sugar or sugar
comprising a 2'-O-methoxyethyl.
[0010] In certain embodiments, antidote compounds comprise at least
one nucleoside comprising a modified nucleobase. In certain such
embodiments, the modified nucleobase is a 5-methylcytosine.
[0011] In certain embodiments, antidote compounds comprise at least
one modification. In certain such embodiments, antidote compounds
comprise one or more nucleoside modifications and or one or more
linkage modifications. In certain embodiments, antidote compounds
comprise one or more modifications selected from: sugar
modifications, linkage modifications and nucleobase
modifications.
[0012] In certain embodiments, antidote compounds comprise a
modified oligonucleotide comprising: a gap segment consisting of
linked deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; a 3' wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment
and the 3' wing segment and wherein each nucleoside of each wing
segment comprises a modified sugar.
[0013] In certain embodiments, antidote compounds comprise a
modified oligonucleotide comprising: a gap segment consisting of
ten linked deoxynucleosides; a 5' wing segment consisting of five
linked nucleosides; a 3' wing segment consisting of five linked
nucleosides; wherein the gap segment is positioned between the 5'
wing segment and the 3' wing segment, wherein each nucleoside of
each wing segment comprises a 2'-O-methoxyethyl sugar; and wherein
each internucleoside linkage is a phosphorothioate linkage.
[0014] In certain embodiments, antidote compound of any of the
above claims, comprise a modified oligonucleotide consisting of 20
linked nucleosides.
[0015] In certain embodiments, antidote compound comprise a
modified oligonucleotide wherein each nucleoside is modified.
[0016] In certain embodiments, antidote compounds are complementary
to an antisense compound, wherein the antisense compound is
targeted to an mRNA. In certain embodiments, the antisense compound
is targeted to an mRNA encoding a blood factor. In certain
embodiments, the antisense compound is targeted to an mRNA encoding
a protein involved in metabolism. In certain embodiments, the
antisense compound is targeted to an mRNA encoding a protein
involved in diabetes. In certain embodiments, the antisense
compound is targeted to an mRNA encoding a protein involved in
cardiopathology. In certain embodiments, the antisense compound is
targeted to an mRNA encoding a protein expressed in nerve cells. In
certain embodiments, the antisense compound is targeted to an mRNA
encoding a protein expressed in the central nervous system. In
certain embodiments, the antisense compound is targeted to an mRNA
expressed in peripheral nerves.
[0017] In certain embodiments, the antisense compound is targeted
to an mRNA encoding a protein expressed in the liver. In certain
embodiments, the antisense compound is targeted to an mRNA encoding
a protein expressed in the kidney.
[0018] In certain embodiments, the antisense compound is targeted
to a pre-mRNA. In certain embodiments, the antisense compound is
targeted to a micro-RNA. In certain embodiments, the antisense
compound is an RNase H dependent antisense compound. In certain
embodiments, the antisense compound alters splicing of a target
nucleic acid. In certain embodiments, the antisense compound
activates the RISC pathway.
[0019] In certain embodiments, antidote compounds activate RNase H.
certain embodiments, antidote compounds activate the RISC
pathway.
[0020] In certain embodiments, the invention provides a composition
comprising an antidote compound or a salt thereof and a
pharmaceutically acceptable carrier or diluent.
[0021] In certain embodiments, the invention provides methods
comprising administering to an animal an antidote compound or
composition. In certain embodiments, the animal is a human. In
certain embodiments, the administering is oral, topical, or
parenteral.
[0022] In certain embodiments, the invention provides methods of
inhibiting antisense activity in a cell comprising contacting the
cell with an antidote compound according the present invention and
thereby inhibiting the antisense activity in the cell. In certain
such embodiments, the cell is in an animal. In certain embodiments,
the animal is a human.
[0023] In certain embodiments, the invention provides methods
comprising: contacting a cell with an antisense compound; detecting
antisense activity; and contacting the cell with an antidote
compound. In certain embodiments, the method the detecting
antisense activity comprises measuring the amount of target mRNA
present, the amount of target protein present, and/or the activity
of a target protein. In certain embodiments, such methods
comprising detecting antidote activity by measuring antisense
activity after contacting the cell with antidote compound. In
certain such methods, the cell is in an animal. In certain
embodiments, the animal is a human.
[0024] In certain embodiments, the invention provides methods of
ameliorating a side-effect of antisense treatment comprising:
contacting a cell with an antisense compound; detecting a
side-effect; contacting the cell with an antidote compound; and
thereby ameliorating the side effect of the antisense compound.
[0025] In certain embodiments, the invention provides methods of
treating a patient comprising: administering to the patient an
antisense compound; monitoring the patient for antisense activity;
and if the antisense activity becomes higher than desired,
administrating an antidote compound. In certain such embodiments,
the monitoring antisense activity comprises measuring the amount of
target mRNA present, measuring the amount of target protein present
and/or measuring the activity of a target protein. In certain
embodiments, such methods include detecting antidote activity by
measuring antisense activity after administration of the antidote
compound. In certain embodiments, the patient is a human.
[0026] In certain embodiments, the invention provides methods of
treating a patient comprising: administering to the patient an
antisense compound; monitoring the patient for one or more side
effect; and if the one or more side effect reaches an undesirable
level, administrating an antidote compound. In certain such
embodiments, the patient is a human.
[0027] In certain embodiments, the invention provides a kit
comprising an antisense compound and an antidote compound; an
antidote compound and a non-oligomeric antidote; or an antisense
compound, an antidote compound, and a non-oligomeric antidote. In
certain such embodiments, the non-oligomeric antidote is a target
protein.
BRIEF DESCRIPTION OF THE FIGURES
[0028] FIG. 1 shows Fas RNA levels in livers of mice after
antisense treatment with and without subsequent antidote treatment
as discussed in Example 3. Results are expressed as percent of
control mice.
[0029] FIG. 2 shows Kinetics of Fas antisense and antidote activity
as discussed in Example 4.
[0030] FIG. 3 shows Fas mRNA after treatment with antisense or
mismatch antisense, followed by antidote or mismatch antidote as
discussed in Example 4. The mismatch control oligonucleotide did
not demonstrate antidote activity.
[0031] FIG. 4 shows PTEN mRNA levels following antisense treatment
in mice followed by antidote treatment or by control injection as
described in Example 6.
[0032] FIG. 5 shows PTEN mRNA levels in mice following treatments
described in Example 6, demonstrating that (1) antisense compound
ISIS 116847 reduced PTEN mRNA in mouse liver, (2) antidote compound
ISIS 126525 partially restored PTEN mRNA by 3 days, and (3) ISIS
40169, which is used here as a non-sense control did not restore
PTEN mRNA.
[0033] FIG. 6 shows total prothrombin RNA from livers of mice at 3
days following antisense and antidote treatment as described in
Example 10. Data are expressed as percent of saline treated
(antisense control). Zero on the X-axis represents no antidote
(antidote control).
[0034] FIG. 7 shows total thrombin generation three days after
treatment with antidote or with control oligonucleotide as
described in Example 11.
[0035] FIG. 8 shows results of prothrombin time (PT-INR)
calculations described in Example 12.
[0036] FIG. 9 shows results of activated partial thromboplastin
time (aPPT) calculations described in Example 12.
[0037] FIG. 10 shows the total prothrombin RNA three days after
injection of non-complementary antidotes as described in Example
10. Results demonstrate the specificity of antidote activity.
DETAILED DESCRIPTION OF THE INVENTION
[0038] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the invention, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting. Also, terms such as "element" or
"component" encompass both elements and components comprising one
unit and elements and components that comprise more than one
subunit, unless specifically stated otherwise.
[0039] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, and treatises, are hereby expressly
incorporated by reference in their entirety for any purpose.
DEFINITIONS
[0040] Unless specific definitions are provided, the nomenclature
utilized in connection with, and the procedures and techniques of,
analytical chemistry, synthetic organic chemistry, and medicinal
and pharmaceutical chemistry described herein are those well known
and commonly used in the art. Standard techniques may be used for
chemical synthesis, and chemical analysis. Certain such techniques
and procedures may be found for example in "Carbohydrate
Modifications in Antisense Research" Edited by Sangvi and Cook,
American Chemical Society, Washington D.C., 1994; "Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 18th
edition, 1990; and "Antisense Drug Technology, Principles,
Strategies, and Applications" Edited by Stanley T. Crooke, CRC
Press, Boca Raton, Fla.; and Sambrook et al., "Molecular Cloning, A
laboratory Manual," 2.sup.nd Edition, Cold Spring Harbor Laboratory
Press, 1989, which are hereby incorporated by reference for any
purpose. Where permitted, all patents, applications, published
applications and other publications and other data referred to
throughout in the disclosure herein are incorporated by reference
in their entirety.
[0041] Unless otherwise indicated, the following terms have the
following meanings:
[0042] As used herein, the term "nucleoside" means a glycosylamine
comprising a nucleobase and a sugar. Nucleosides includes, but are
not limited to, naturally occurring nucleosides, abasic
nucleosides, modified nucleosides, and nucleosides having mimetic
bases and/or sugar groups.
[0043] As used herein, the term "nucleotide" refers to a
glycosomine comprising a nucleobase and a sugar having a phosphate
group covalently linked to the sugar. Nucleotides may be modified
with any of a variety of substituents.
[0044] As used herein, the term "nucleobase" refers to the base
portion of a nucleoside or nucleotide. A nucleobase may comprise
any atom or group of atoms capable of hydrogen bonding to a base of
another nucleic acid.
[0045] As used herein, the term "heterocyclic base moiety" refers
to a nucleobase comprising a heterocycle.
[0046] As used herein, the term "oligomeric compound" refers to a
polymeric structure comprising two or more sub-structures and
capable of hybridizing to a region of a nucleic acid molecule. In
certain embodiments, oligomeric compounds are oligonucleosides. In
certain embodiments, oligomeric compounds are oligonucleotides. In
certain embodiments, oligomeric compounds are antisense compounds.
In certain embodiments, oligomeric compounds are antidote
compounds. In certain embodiments, oligomeric compounds comprise
conjugate groups.
[0047] As used herein "oligonucleoside" refers to an
oligonucleotide in which the internucleoside linkages do not
contain a phosphorus atom.
[0048] As used herein, the term "oligonucleotide" refers to an
oligomeric compound comprising a plurality of linked nucleosides.
In certain embodiment, one or more nucleotides of an
oligonucleotide is modified. In certain embodiments, an
oligonucleotide comprises ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA). In certain embodiments,
oligonucleotides are composed of naturally- and/or
non-naturally-occurring nucleobases, sugars and covalent
internucleoside linkages, and may further include non-nucleic acid
conjugates.
[0049] As used herein "internucleoside linkage" refers to a
covalent linkage between adjacent nucleosides.
[0050] As used herein "naturally occurring internucleoside linkage"
refers to a 3' to 5' phosphodiester linkage.
[0051] As used herein, the term "antisense compound" refers to an
oligomeric compound that is at least partially complementary to a
target nucleic acid molecule to which it hybridizes. In certain
embodiments, an antisense compound modulates (increases or
decreases) expression or amount of a target nucleic acid. In
certain embodiments, an antisense compound alters splicing of a
target pre-mRNA resulting in a different splice variant. Antisense
compounds include, but are not limited to, compounds that are
oligonucleotides, oligonucleosides, oligonucleotide analogs,
oligonucleotide mimetics, and chimeric combinations of these.
Consequently, while all antisense compounds are oligomeric
compounds, not all oligomeric compounds are antisense
compounds.
[0052] As used herein, the term "antisense oligonucleotide" refers
to an antisense compound that is an oligonucleotide.
[0053] As used herein, the term "antisense activity" refers to any
detectable and/or measurable activity attributable to the
hybridization of an antisense compound to its target nucleic acid.
Such detection and or measuring may be direct or indirect. For
example, in certain embodiments, antisense activity is assessed by
detecting and or measuring the amount of target protein. In certain
embodiments, antisense activity is assessed by detecting and/or
measuring the amount of target nucleic acids and/or cleaved target
nucleic acids and/or alternatively spliced target nucleic
acids.
[0054] As used herein the term "detecting antisense activity" or
"measuring antisense activity" means that a test for detecting or
measuring antisense activity is performed on a particular sample
and compared to that of a control sample. Such detection and/or
measuring may include values of zero. Thus, if a test for detection
of antisense activity results in a finding of no antisense activity
(antisense activity of zero), the step of "detecting antisense
activity" has nevertheless been performed.
[0055] As used herein the term "control sample" refers to a sample
that has not been contacted with a reporter oligomeric
compound.
[0056] As used herein, the term "motif" refers to the pattern of
unmodified and modified nucleotides in an oligomeric compound.
[0057] As used herein, the term "antidote compound" refers to an
oligomeric compound that is complementary to and capable of
hybridizing with an antisense compound.
[0058] As used herein, the term "non-oligomeric antidote" refers to
a compound that does not hybridize with an antisense compound and
that reduces the amount or duration of an antisense activity. In
certain embodiments, a non-oligomeric antidote is a target
protein.
[0059] As used herein, the term "antidote activity" refers to any
decrease in intensity or duration of any antisense activity
attributable to hybridization of an antidote compound to an
antisense compound.
[0060] As used herein, the term "chimeric antisense oligomer"
refers to an antisense oligomeric compound, having at least one
sugar, nucleobase or internucleoside linkage that is differentially
modified as compared to at least on other sugar, nucleobase or
internucleoside linkage within the same antisense oligomeric
compound. The remainder of the sugars, nucleobases and
internucleoside linkages can be independently modified or
unmodified, the same or different.
[0061] As used herein, the term "chimeric antisense
oligonucleotide" refers to an antisense oligonucleotide, having at
least one sugar, nucleobase or internucleoside linkage that is
differentially modified as compared to at least on other sugar,
nucleobase or internucleoside linkage within the same antisense
oligonucleotide. The remainder of the sugars, nucleobases and
internucleoside linkages can be independently modified or
unmodified, the same or different.
[0062] As used herein, the term "mixed-backbone oligomeric
compound" refers to an oligomeric compound wherein at least one
internucleoside linkage of the oligomeric compound is different
from at least one other internucleoside linkage of the oligomeric
compound.
[0063] As used herein, the term "target protein" refers to a
protein, the modulation of which is desired.
[0064] As used herein, the term "target gene" refers to a gene
encoding a target protein.
[0065] As used herein, the term "target nucleic acid" refers to any
nucleic acid molecule the expression or activity of which is
capable of being modulated by an antisense compound. Target nucleic
acids include, but are not limited to, RNA (including, but not
limited to pre-mRNA and mRNA or portions thereof) transcribed from
DNA encoding a target protein, and also cDNA derived from such RNA,
and miRNA. For example, the target nucleic acid can be a cellular
gene (or mRNA transcribed from the gene) whose expression is
associated with a particular disorder or disease state, or a
nucleic acid molecule from an infectious agent.
[0066] As used herein, the term "target antisense compound" refers
to an antisense compound that is targeted by an antidote
compound.
[0067] As used herein, the term "targeting" or "targeted to" refers
to the association of an antisense compound to a particular target
nucleic acid molecule or a particular region of nucleotides within
a target nucleic acid molecule.
[0068] As used herein, the term "nucleobase complementarity" refers
to a nucleobase that is capable of base pairing with another
nucleobase. For example, in DNA, adenine (A) is complementary to
thymine (T). For example, in RNA, adenine (A) is complementary to
uracil (U). In certain embodiments, complementary nucleobase refers
to a nucleobase of an antisense compound that is capable of base
pairing with a nucleobase of its target nucleic acid. For example,
if a nucleobase at a certain position of an antisense compound is
capable of hydrogen bonding with a nucleobase at a certain position
of a target nucleic acid, then the position of hydrogen bonding
between the oligonucleotide and the target nucleic acid is
considered to be complementary at that nucleobase pair.
[0069] As used herein, the term "non-complementary nucleobase"
refers to a pair of nucleobases that do not form hydrogen bonds
with one another or otherwise support hybridization.
[0070] As used herein, the term "complementary" refers to the
capacity of an oligomeric compound to hybridize to another
oligomeric compound or nucleic acid through nucleobase
complementarity. In certain embodiments, an antisense compound and
its target are complementary to each other when a sufficient number
of corresponding positions in each molecule are occupied by
nucleobases that can bond with each other to allow stable
association between the antisense compound and the target. One
skilled in the art recognizes that the inclusion of mismatches is
possible without eliminating the ability of the oligomeric
compounds to remain in association. Therefore, described herein are
antisense compounds that may comprise up to about 20% nucleotides
that are mismatched (i.e., are not nucleobase complementary to the
corresponding nucleotides of the target). Preferably the antisense
compounds contain no more than about 15%, more preferably not more
than about 10%, most preferably not more than 5% or no mismatches.
The remaining nucleotides are nucleobase complementary or otherwise
do not disrupt hybridization (e.g., universal bases). One of
ordinary skill in the art would recognize the compounds provided
herein are at least 80%, at least 85%, at least 90%, at least 95%,
at least 96%, at least 97%, at least 98%, at least 99% or 100%
complementary to a target nucleic acid.
[0071] As used herein, "hybridization" means the pairing of
complementary oligomeric compounds (e.g., an antisense compound and
its target nucleic acid or an antidote to its antisense compound).
While not limited to a particular mechanism, the most common
mechanism of pairing involves hydrogen bonding, which may be
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding,
between complementary nucleoside or nucleotide bases (nucleobases).
For example, the natural base adenine is nucleobase complementary
to the natural nucleobases thymidine and uracil which pair through
the formation of hydrogen bonds. The natural base guanine is
nucleobase complementary to the natural bases cytosine and 5-methyl
cytosine. Hybridization can occur under varying circumstances.
[0072] As used herein, the term "specifically hybridizes" refers to
the ability of an oligomeric compound to hybridize to one nucleic
acid site with greater affinity than it hybridizes to another
nucleic acid site. In certain embodiments, an antisense
oligonucleotide specifically hybridizes to more than one target
site.
[0073] As used herein, "designing" or "designed to" refer to the
process of designing an oligomeric compound that specifically
hybridizes with a selected nucleic acid molecule.
[0074] As used herein, the term "modulation" refers to a
perturbation of function or activity when compared to the level of
the function or activity prior to modulation. For example,
modulation includes the change, either an increase (stimulation or
induction) or a decrease (inhibition or reduction) in gene
expression. As further example, modulation of expression can
include perturbing splice site selection of pre-mRNA
processing.
[0075] As used herein, the term "expression" refers to all the
functions and steps by which a gene's coded information is
converted into structures present and operating in a cell. Such
structures include, but are not limited to the products of
transcription and translation.
[0076] As used herein, "variant" refers to an alternative RNA
transcript that can be produced from the same genomic region of
DNA. Variants include, but are not limited to "pre-mRNA variants"
which are transcripts produced from the same genomic DNA that
differ from other transcripts produced from the same genomic DNA in
either their start or stop position and contain both intronic and
exonic sequence. Variants also include, but are not limited to,
those with alternate splice junctions, or alternate initiation and
termination codons.
[0077] As used herein, "high-affinity modified monomer" refers to a
monomer having at least one modified nucleobase, internucleoside
linkage or sugar moiety, when compared to naturally occurring
monomers, such that the modification increases the affinity of an
antisense compound comprising the high-affinity modified monomer to
its target nucleic acid. High-affinity modifications include, but
are not limited to, monomers (e.g., nucleosides and nucleotides)
comprising 2'-modified sugars.
[0078] As used herein, the term "2'-modified" or "2'-substituted"
means a sugar comprising substituent at the 2' position other than
H or OH. 2'-modified monomers, include, but are not limited to,
BNA's and monomers (e.g., nucleosides and nucleotides) with
2'-substituents, such as allyl, amino, azido, thio, O-allyl,
O--C1-C10 alkyl, --OCF3, O--(CH2)2-O--CH3, 2'-O(CH2)2SCH3,
O--(CH2)2-O--N(Rm)(Rn), or O--CH2-C(.dbd.O)--N(Rm)(Rn), where each
Rm and Rn is, independently, H or substituted or unsubstituted
C1-C10 alkyl. In certain embodiments, oligomeric compounds comprise
a 2' modified monomer that does not have the formula 2'--O(CH2)nH,
wherein n is one to six. In certain embodiments, oligomeric
compounds comprise a 2' modified monomer that does not have the
formula 2'-OCH3. In certain embodiments, oligomeric compounds
comprise a 2' modified monomer that does not have the formula or,
in the alternative, 2'--O(CH2)2OCH3.
[0079] As used herein, the term "bicyclic nucleic acid" or "BNA" or
"bicyclic nucleoside" or "bicyclic nucleotide" refers to a
nucleoside or nucleotide wherein the furanose portion of the
nucleoside includes a bridge connecting two carbon atoms on the
furanose ring, thereby forming a bicyclic ring system.
[0080] As used herein, unless otherwise indicated, the term
"methyleneoxy BNA" alone refers to .beta.-D-methyleneoxy BNA.
[0081] As used herein, the term "MOE" refers to a 2'-O-methoxyethyl
substituent.
[0082] As used herein, the term "gapmer" refers to a chimeric
oligomeric compound comprising a central region (a "gap") and a
region on either side of the central region (the "wings"), wherein
the gap comprises at least one modification that is different from
that of each wing. Such modifications include nucleobase, monomeric
linkage, and sugar modifications as well as the absence of
modification (unmodified). Thus, in certain embodiments, the
nucleotide linkages in each of the wings are different than the
nucleotide linkages in the gap. In certain embodiments, each wing
comprises nucleotides with high affinity modifications and the gap
comprises nucleotides that do not comprise that modification. In
certain embodiments the nucleotides in the gap and the nucleotides
in the wings all comprise high affinity modifications, but the high
affinity modifications in the gap are different than the high
affinity modifications in the wings. In certain embodiments, the
modifications in the wings are the same as one another. In certain
embodiments, the modifications in the wings are different from each
other. In certain embodiments, nucleotides in the gap are
unmodified and nucleotides in the wings are modified. In certain
embodiments, the modification(s) in each wing are the same. In
certain embodiments, the modification(s) in one wing are different
from the modification(s) in the other wing. In certain embodiments,
oligomeric compounds are gapmers having 2'-deoxynucleotides in the
gap and nucleotides with high-affinity modifications in the
wing.
[0083] As used herein, the term "prodrug" refers to a therapeutic
agent that is prepared in an inactive form that is converted to an
active form (i.e., drug) within the body or cells thereof by the
action of endogenous enzymes or other chemicals and/or
conditions.
[0084] As used herein, the term "pharmaceutically acceptable salts"
refers to salts of active compounds that retain the desired
biological activity of the active compound and do not impart
undesired toxicological effects thereto.
[0085] As used herein, the term "cap structure" or "terminal cap
moiety" refers to chemical modifications, which have been
incorporated at either terminus of an antisense compound.
[0086] As used herein, the term "prevention" refers to delaying or
forestalling the onset or development of a condition or disease for
a period of time from hours to days, preferably weeks to
months.
[0087] As used herein, the term "amelioration" refers to a
lessening of at least one activity or one indicator of the severity
of a condition or disease. The severity of indicators may be
determined by subjective or objective measures which are known to
those skilled in the art.
[0088] As used herein, the term "treatment" refers to administering
a composition of the invention to effect an alteration or
improvement of the disease or condition. Prevention, amelioration,
and/or treatment may require administration of multiple doses at
regular intervals, or prior to onset of the disease or condition to
alter the course of the disease or condition. Moreover, a single
agent may be used in a single individual for each prevention,
amelioration, and treatment of a condition or disease sequentially,
or concurrently.
[0089] As used herein, the term "pharmaceutical agent" refers to a
substance that provides a therapeutic benefit when administered to
a subject. In certain embodiments, a pharmaceutical agent is an
active pharmaceutical agent. In certain embodiments, a
pharmaceutical agent is a prodrug.
[0090] As used herein, the term "therapeutically effective amount"
refers to an amount of a pharmaceutical agent that provides a
therapeutic benefit to an animal.
[0091] As used herein, "administering" means providing a
pharmaceutical agent to an animal, and includes, but is not limited
to administering by a medical professional and
self-administering.
[0092] As used herein, the term "co-administering" means providing
more than one pharmaceutical agent to an animal. In certain
embodiments, such more than one pharmaceutical agents are
administered together. In certain embodiments, such more than one
pharmaceutical agents are administered separately. In certain
embodiments, such more than one pharmaceutical agents are
administered at the same time. In certain embodiments, such more
than one pharmaceutical agents are administered at different times.
In certain embodiments, such more than one pharmaceutical agents
are administered through the same route of administration. In
certain embodiments, such more than one pharmaceutical agents are
administered through different routes of administration. In certain
embodiments, such more than one pharmaceutical agents are contained
in the same pharmaceutical formulation. In certain embodiments,
such more than one pharmaceutical agents are in separate
formulations.
[0093] As used herein, the term "pharmaceutical composition" refers
to a mixture of substances suitable for administering to an
individual. For example, a pharmaceutical composition may comprise
an antisense oligonucleotide and a sterile aqueous solution. In
certain embodiments, a pharmaceutical composition includes a
pharmaceutical agent and a diluent and/or carrier.
[0094] As used herein, the term "animal" refers to a human or
non-human animal, including, but not limited to, mice, rats,
rabbits, dogs, cats, pigs, and non-human primates, including, but
not limited to, monkeys and chimpanzees.
[0095] As used herein, the term "parenteral administration," refers
to administration through injection or infusion. Parenteral
administration includes, but is not limited to, subcutaneous
administration, intravenous administration, or intramuscular
administration.
[0096] As used herein, the term "subcutaneous administration"
refers to administration just below the skin. "Intravenous
administration" means administration into a vein.
[0097] As used herein, the term "dose" refers to a specified
quantity of a pharmaceutical agent provided in a single
administration. In certain embodiments, a dose may be administered
in two or more boluses, tablets, or injections. For example, in
certain embodiments, where subcutaneous administration is desired,
the desired dose requires a volume not easily accommodated by a
single injection. In such embodiments, two or more injections may
be used to achieve the desired dose. In certain embodiments, a dose
may be administered in two or more injections to minimize injection
site reaction in an individual.
[0098] As used herein, the term "dosage unit" refers to a form in
which a pharmaceutical agent is provided. In certain embodiments, a
dosage unit is a vial comprising lyophilized antisense
oligonucleotide. In certain embodiments, a dosage unit is a vial
comprising reconstituted antisense oligonucleotide.
[0099] As used herein, the term "active pharmaceutical ingredient"
refers to the substance in a pharmaceutical composition that
provides a desired effect.
[0100] As used herein, the term "side effects" refers to
physiological responses attributable to a treatment other than
desired effects. In certain embodiments, side effects include,
without limitation, injection site reactions, liver function test
abnormalities, renal function abnormalities, liver toxicity, renal
toxicity, central nervous system abnormalities, and myopathies. For
example, increased aminotransferase levels in serum may indicate
liver toxicity or liver function abnormality. For example,
increased bilirubin may indicate liver toxicity or liver function
abnormality.
[0101] As used herein, the term "alkyl," as used herein, refers to
a saturated straight or branched hydrocarbon radical containing up
to twenty four carbon atoms. Examples of alkyl groups include, but
are not limited to, methyl, ethyl, propyl, butyl, isopropyl,
n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically
include from 1 to about 24 carbon atoms, more typically from 1 to
about 12 carbon atoms (C1-C12 alkyl) with from 1 to about 6 carbon
atoms being more preferred. The term "lower alkyl" as used herein
includes from 1 to about 6 carbon atoms. Alkyl groups as used
herein may optionally include one or more further substituent
groups.
[0102] As used herein, the term "alkenyl," as used herein, refers
to a straight or branched hydrocarbon chain radical containing up
to twenty four carbon atoms and having at least one carbon-carbon
double bond. Examples of alkenyl groups include, but are not
limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl,
dienes such as 1,3-butadiene and the like. Alkenyl groups typically
include from 2 to about 24 carbon atoms, more typically from 2 to
about 12 carbon atoms with from 2 to about 6 carbon atoms being
more preferred. Alkenyl groups as used herein may optionally
include one or more further substituent groups.
[0103] As used herein, the term "alkynyl," as used herein, refers
to a straight or branched hydrocarbon radical containing up to
twenty four carbon atoms and having at least one carbon-carbon
triple bond. Examples of alkynyl groups include, but are not
limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl
groups typically include from 2 to about 24 carbon atoms, more
typically from 2 to about 12 carbon atoms with from 2 to about 6
carbon atoms being more preferred. Alkynyl groups as used herein
may optionally include one or more further substitutent groups.
[0104] As used herein, the term "aminoalkyl" as used herein, refers
to an amino substituted alkyl radical. This term is meant to
include C1-C12 alkyl groups having an amino substituent at any
position and wherein the alkyl group attaches the aminoalkyl group
to the parent molecule. The alkyl and/or amino portions of the
aminoalkyl group can be further substituted with substituent
groups.
[0105] As used herein, the term "aliphatic," as used herein, refers
to a straight or branched hydrocarbon radical containing up to
twenty four carbon atoms wherein the saturation between any two
carbon atoms is a single, double or triple bond. An aliphatic group
preferably contains from 1 to about 24 carbon atoms, more typically
from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms
being more preferred. The straight or branched chain of an
aliphatic group may be interrupted with one or more heteroatoms
that include nitrogen, oxygen, sulfur and phosphorus. Such
aliphatic groups interrupted by heteroatoms include without
limitation polyalkoxys, such as polyalkylene glycols, polyamines,
and polyimines. Aliphatic groups as used herein may optionally
include further substitutent groups.
[0106] As used herein, the term "alicyclic" or "alicyclyl" refers
to a cyclic ring system wherein the ring is aliphatic. The ring
system can comprise one or more rings wherein at least one ring is
aliphatic. Preferred alicyclics include rings having from about 5
to about 9 carbon atoms in the ring. Alicyclic as used herein may
optionally include further substitutent groups. As used herein, the
term "alkoxy," as used herein, refers to a radical formed between
an alkyl group and an oxygen atom wherein the oxygen atom is used
to attach the alkoxy group to a parent molecule. Examples of alkoxy
groups include, but are not limited to, methoxy, ethoxy, propoxy,
isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy,
neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may
optionally include further substitutent groups. As used herein, the
terms "halo" and "halogen," as used herein, refer to an atom
selected from fluorine, chlorine, bromine and iodine.
[0107] As used herein, the terms "aryl" and "aromatic," as used
herein, refer to a mono- or polycyclic carbocyclic ring system
radicals having one or more aromatic rings. Examples of aryl groups
include, but are not limited to, phenyl, naphthyl,
tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl
ring systems have from about 5 to about 20 carbon atoms in one or
more rings. Aryl groups as used herein may optionally include
further substitutent groups.
[0108] As used herein, the terms "aralkyl" and "arylalkyl," as used
herein, refer to a radical formed between an alkyl group and an
aryl group wherein the alkyl group is used to attach the aralkyl
group to a parent molecule. Examples include, but are not limited
to, benzyl, phenethyl and the like. Aralkyl groups as used herein
may optionally include further substitutent groups attached to the
alkyl, the aryl or both groups that form the radical group.
[0109] As used herein, the term "heterocyclic radical" as used
herein, refers to a radical mono-, or poly-cyclic ring system that
includes at least one heteroatom and is unsaturated, partially
saturated or fully saturated, thereby including heteroaryl groups.
Heterocyclic is also meant to include fused ring systems wherein
one or more of the fused rings contain at least one heteroatom and
the other rings can contain one or more heteroatoms or optionally
contain no heteroatoms. A heterocyclic group typically includes at
least one atom selected from sulfur, nitrogen or oxygen. Examples
of heterocyclic groups include, [1,3]dioxolane, pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl,
morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl,
pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as
used herein may optionally include further substitutent groups. As
used herein, the terms "heteroaryl," and "heteroaromatic," as used
herein, refer to a radical comprising a mono- or poly-cyclic
aromatic ring, ring system or fused ring system wherein at least
one of the rings is aromatic and includes one or more heteroatom.
Heteroaryl is also meant to include fused ring systems including
systems where one or more of the fused rings contain no
heteroatoms. Heteroaryl groups typically include one ring atom
selected from sulfur, nitrogen or oxygen. Examples of heteroaryl
groups include, but are not limited to, pyridinyl, pyrazinyl,
pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl,
isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl,
quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl,
quinoxalinyl, and the like. Heteroaryl radicals can be attached to
a parent molecule directly or through a linking moiety such as an
aliphatic group or hetero atom. Heteroaryl groups as used herein
may optionally include further substitutent groups.
[0110] As used herein, the term "heteroarylalkyl," as used herein,
refers to a heteroaryl group as previously defined having an alky
radical that can attach the heteroarylalkyl group to a parent
molecule. Examples include, but are not limited to,
pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the
like. Heteroarylalkyl groups as used herein may optionally include
further substitutent groups on one or both of the heteroaryl or
alkyl portions.
[0111] As used herein, the term "mono or poly cyclic structure" as
used in the present invention includes all ring systems that are
single or polycyclic having rings that are fused or linked and is
meant to be inclusive of single and mixed ring systems individually
selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl,
arylalkyl, heterocyclic, heteroaryl, heteroaromatic,
heteroarylalkyl. Such mono and poly cyclic structures can contain
rings that are uniform or have varying degrees of saturation
including fully saturated, partially saturated or fully
unsaturated. Each ring can comprise ring atoms selected from C, N,
O and S to give rise to heterocyclic rings as well as rings
comprising only C ring atoms which can be present in a mixed motif
such as for example benzimidazole wherein one ring has only carbon
ring atoms and the fused ring has two nitrogen atoms. The mono or
poly cyclic structures can be further substituted with substituent
groups such as for example phthalimide which has two .dbd.O groups
attached to one of the rings. In another aspect, mono or poly
cyclic structures can be attached to a parent molecule directly
through a ring atom, through a substituent group or a bifunctional
linking moiety.
[0112] As used herein, the term "acyl," as used herein, refers to a
radical formed by removal of a hydroxyl group from an organic acid
and has the general formula --C(O)--X where X is typically
aliphatic, alicyclic or aromatic. Examples include aliphatic
carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic
sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic
phosphates and the like. Acyl groups as used herein may optionally
include further substitutent groups.
[0113] As used herein, the term "hydrocarbyl" includes groups
comprising C, O and H. Included are straight, branched and cyclic
groups having any degree of saturation. Such hydrocarbyl groups can
include one or more heteroatoms selected from N, O and S and can be
further mono or poly substituted with one or more substituent
groups.
[0114] As used herein, the terms "substituent" and "substituent
group," as used herein, include groups that are typically added to
other groups or parent compounds to enhance desired properties or
give desired effects. Substituent groups can be protected or
unprotected and can be added to one available site or to many
available sites in a parent compound. Substituent groups may also
be further substituted with other substituent groups and may be
attached directly or via a linking group such as an alkyl or
hydrocarbyl group to a parent compound. Such groups include without
limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl
(--C(O)Raa), carboxyl (--C(O)O-Raa), aliphatic groups, alicyclic
groups, alkoxy, substituted oxo (--O-Raa), aryl, aralkyl,
heterocyclic, heteroaryl, heteroarylalkyl, amino (--NRbbRcc),
imino(.dbd.NRbb), amido (--C(O)N-RbbRccor --N(Rbb)C(O)Raa), azido
(--N3), nitro (--NO2), cyano (--CN), carbamido (--OC(O)NRbbRcc or
--N(Rbb)C(O)ORaa), ureido (--N(Rbb)C(O)NRbbRcc), thioureido
(--N(Rbb)C(S)NRbbRcc), guanidinyl (--N(Rbb)C(.dbd.NRbb)NRbbRcc),
amidinyl (--C(.dbd.NRbb)-NRbbRcc or --N(Rbb)C(NRbb)Raa), thiol
(--SRbb), sulfinyl (--S(O)Rbb), sulfonyl (--S(O)2Rbb), sulfonamidyl
(--S(O)2NRbbRcc or --N(Rbb)S(O)2Rbb) and conjugate groups. Wherein
each Raa, Rbb and Rcc is, independently, H, an optionally linked
chemical functional group or a further substituent group with a
preferred list including without limitation H, alkyl, alkenyl,
alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl,
alicyclic, heterocyclic and heteroarylalkyl.
Oligomeric Compounds
[0115] Antisense compounds and antidote compounds are oligomeric
compounds. In certain embodiments, it is desirable to chemically
modify oligomeric compounds, including antisense compounds and/or
antidote oligomeric compounds, compared to naturally occurring
oligomers, such as DNA or RNA. Certain such modifications alter the
activity of the oligomeric compound. Certain such chemical
modifications can alter activity by, for example: increasing
affinity of an antisense compound for its target nucleic acid or an
antidote for its antisense compound, increasing its resistance to
one or more nucleases, and/or altering the pharmacokinetics or
tissue distribution of the oligomeric compound. In certain
instances, the use of chemistries that increase the affinity of an
oligomeric compound for its target can allow for the use of shorter
oligomeric compounds.
Certain Monomers
[0116] In certain embodiment, oligomeric compounds comprise one or
more modified monomer. In certain such embodiments, oligomeric
compounds comprise one or more high affinity monomer. In certain
embodiments, such high-affinity monomer is selected from monomers
(e.g., nucleosides and nucleotides) comprising 2'-modified sugars,
including, but not limited to: BNA's and monomers (e.g.,
nucleosides and nucleotides) with 2'-substituents such as allyl,
amino, azido, thio, O-allyl, O--C1-C10 alkyl, --OCF3,
O--(CH2)2-O--CH3, 2'-O(CH2)2SCH3, O--(CH2)2-O--N(Rm)(Rn), or
O--CH2-C(.dbd.O)--N(Rm)(Rn), where each Rm and Rn is,
independently, H or substituted or unsubstituted C1-C10 alkyl.
[0117] In certain embodiments, the oligomeric compounds including,
but no limited to antidote and antisense oligomeric compounds of
the present invention, comprise one or more high affinity monomers
provided that the oligomeric compound does not comprise a
nucleotide comprising a 2'-O(CH2)nH, wherein n is one to six.
[0118] In certain embodiments, the oligomeric compounds including,
but no limited to antidote and antisense oligomeric compounds,
comprise one or more high affinity monomer provided that the
oligomeric compound does not comprise a nucleotide comprising a
2'-OCH3 or a 2'--O(CH2)2OCH3.
[0119] In certain embodiments, the oligomeric compounds including,
but no limited to antidote and antisense oligomeric compounds,
comprise one or more high affinity monomer provided that the
oligomeric compound does not comprise a .alpha.-L-Methyleneoxy
(4'-CH2-O-2') BNA.
[0120] In certain embodiments, the oligomeric compounds including,
but no limited to antidote and antisense oligomeric compounds,
comprise one or more high affinity monomer provided that the
oligomeric compound does not comprise a .beta.-D-Methyleneoxy
(4'-CH2-O-2') BNA.
[0121] In certain embodiments, the oligomeric compounds including,
but no limited to antidote and antisense oligomeric compounds,
comprise one or more high affinity monomer provided that the
oligomeric compound does not comprise a .alpha.-L-Methyleneoxy
(4'-CH2-O-2') BNA or a 13-D-Methyleneoxy (4'-CH2-O-2') BNA.
Certain Nucleobases
[0122] The naturally occurring base portion of a nucleoside is
typically a heterocyclic base. The two most common classes of such
heterocyclic bases are the purines and the pyrimidines. For those
nucleosides that include a pentofuranosyl sugar, a phosphate group
can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. In
forming oligonucleotides, those phosphate groups covalently link
adjacent nucleosides to one another to form a linear polymeric
compound. Within oligonucleotides, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The naturally occurring linkage or backbone of RNA
and of DNA is a 3' to 5' phosphodiester linkage.
[0123] In addition to "unmodified" or "natural" nucleobases such as
the purine nucleobases adenine (A) and guanine (G), and the
pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U),
many modified nucleobases or nucleobase mimetics known to those
skilled in the art are amenable with the compounds described
herein. In certain embodiments, a modified nucleobase is a
nucleobase that is fairly similar in structure to the parent
nucleobase, such as for example a 7-deaza purine, a 5-methyl
cytosine, or a G-clamp. In certain embodiments, nucleobase mimetic
include more complicated structures, such as for example a
tricyclic phenoxazine nucleobase mimetic. Methods for preparation
of the above noted modified nucleobases are well known to those
skilled in the art.
Certain Sugars
[0124] Oligomeric compounds provided herein may comprise one or
more monomer, including a nucleoside or nucleotide, having a
modified sugar moiety. For example, the furanosyl sugar ring of a
nucleoside can be modified in a number of ways including, but not
limited to, addition of a substituent group, bridging of two
non-geminal ring atoms to form a bicyclic nucleic acid (BNA). In
certain embodiments, oligomeric compounds comprise one or more
monomers that is a BNA. In certain such embodiments, BNA s include,
but are not limited to, (A) .alpha.-L-Methyleneoxy (4'-CH2-O-2')
BNA, (B) .beta.-D-Methyleneoxy (4'-CH2-O-2') BNA, (C) Ethyleneoxy
(4'-(CH2)2-O-2') BNA, (D) Aminooxy (4'-CH2-O--N(R)-2') BNA and (E)
Oxyamino (4'-CH2-N(R)--O-2') BNA, as depicted below:
##STR00001##
[0125] In certain embodiments, BNA compounds include, but are not
limited to, compounds having at least one bridge between the 4' and
the 2' position of the sugar wherein each of the bridges
independently comprises 1 or from 2 to 4 linked groups
independently selected from --[C(R1)(R2)]n--, --C(R1)=C(R2)-,
--C(R1)=N--, --C(.dbd.NR1)-, --C(.dbd.O)--, --C(.dbd.S)--, --O--,
--Si(R1)2-, --S(.dbd.O)x- and --N(R1)-;
[0126] wherein:
x is 0, 1, or 2; n is 1, 2, 3, or 4;
[0127] each R1 and R2 is, independently, H, a protecting group,
hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl,
substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12
alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical,
substituted heterocycle radical, heteroaryl, substituted
heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic
radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(.dbd.O)--H),
substituted acyl, CN, sulfonyl (S(.dbd.O)2-J1), or sulfoxyl
(S(.dbd.O)-J1); and
[0128] each J1 and J2 is, independently, H, C1-C12 alkyl,
substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12
alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl,
substituted C5-C20 aryl, acyl (C(.dbd.O)--H), substituted acyl, a
heterocycle radical, a substituted heterocycle radical, C1-C12
aminoalkyl, substituted C1-C12 aminoalkyl or a protecting
group.
[0129] In one embodiment, each of the bridges of the BNA compounds
is, independently, --[C(R1)(R2)]n-, --[C(R1)(R2)]n-O--,
--C(R1R2)-N(R1)-O-- or --C(R1R2)-O--N(R1)-. In another embodiment,
each of said bridges is, independently, 4'-CH2-2', 4'-(CH2)2-2',
4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O--N(R1)-2' and
4'-CH2-N(R1)-O-2'- wherein each R1 is, independently, H, a
protecting group or C1-C12 alkyl.
[0130] Certain BNA's have been prepared and disclosed in the patent
literature as well as in scientific literature (Singh et al., Chem.
Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54,
3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000,
97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8,
2219-2222; WO 94/14226; WO 2005/021570; Singh et al., J. Org.
Chem., 1998, 63, 10035-10039; Examples of issued US patents and
published applications that disclose BNA s include, for example,
U.S. Pat. Nos. 7,053,207; 6,268,490; 6,770,748; 6,794,499;
7,034,133; and 6,525,191; and U.S. Pre-Grant Publication Nos.
2004-0171570; 2004-0219565; 2004-0014959; 2003-0207841;
2004-0143114; and 20030082807.
[0131] Also provided herein are BNAs in which the 2'-hydroxyl group
of the ribosyl sugar ring is linked to the 4' carbon atom of the
sugar ring thereby forming a methyleneoxy (4'-CH2-O-2') linkage to
form the bicyclic sugar moiety (reviewed in Elayadi et al., Curr.
Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem.
Biol., 2001, 8 1-7; and Orum et al., Curr. Opinion Mol. Ther.,
2001, 3, 239-243; see also U.S. Pat. Nos. 6,268,490 and 6,670,461).
The linkage can be a methylene (--CH2-) group bridging the 2'
oxygen atom and the 4' carbon atom, for which the term methyleneoxy
(4'-CH2-O-2') BNA is used for the bicyclic moiety; in the case of
an ethylene group in this position, the term ethyleneoxy
(4'-CH2CH2-O-2') BNA is used (Singh et al., Chem. Commun., 1998, 4,
455-456: Morita et al., Bioorganic Medicinal Chemistry, 2003, 11,
2211-2226). Methyleneoxy (4'-CH2-O-2') BNA and other bicyclic sugar
analogs display very high duplex thermal stabilities with
complementary DNA and RNA (Tm=+3 to +10.degree. C.), stability
towards 3'-exonucleolytic degradation and good solubility
properties. Potent and nontoxic antisense oligonucleotides
comprising BNAs have been described (Wahlestedt et al., Proc. Natl.
Acad. Sci. U.S.A., 2000, 97, 5633-5638).
[0132] An isomer of methyleneoxy (4'-CH2-O-2') BNA that has also
been discussed is alpha-L-methyleneoxy (4'-CH2-O-2') BNA which has
been shown to have superior stability against a 3'-exonuclease. The
alpha-L-methyleneoxy (4'-CH2-O-2') BNA's were incorporated into
antisense gapmers and chimeras that showed potent antisense
activity (Frieden et al., Nucleic Acids Research, 2003, 21,
6365-6372).
[0133] The synthesis and preparation of the methyleneoxy
(4'-CH2-O-2') BNA monomers adenine, cytosine, guanine,
5-methyl-cytosine, thymine and uracil, along with their
oligomerization, and nucleic acid recognition properties have been
described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs
and preparation thereof are also described in WO 98/39352 and WO
99/14226.
[0134] Analogs of methyleneoxy (4'-CH2-O-2') BNA,
phosphorothioate-methyleneoxy (4'-CH2-O-2') BNA and 2'-thio-BNAs,
have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett.,
1998, 8, 2219-2222). Preparation of locked nucleoside analogs
comprising oligodeoxyribonucleotide duplexes as substrates for
nucleic acid polymerases has also been described (Wengel et al., WO
99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel
comformationally restricted high-affinity oligonucleotide analog
has been described in the art (Singh et al., J. Org. Chem., 1998,
63, 10035-10039). In addition, 2'-Amino- and 2'-methylamino-BNA's
have been prepared and the thermal stability of their duplexes with
complementary RNA and DNA strands has been previously reported.
[0135] Modified sugar moieties are well known and can be used to
alter, typically increase, the affinity of the antisense compound
for its target and/or increase nuclease resistance. A
representative list of preferred modified sugars includes but is
not limited to bicyclic modified sugars (BNA's), including
methyleneoxy (4'-CH2-O-2') BNA and ethyleneoxy (4'-(CH2)2-O-2'
bridge) BNA; substituted sugars, especially 2'-substituted sugars
having a 2'-F, 2'-OCH3 or a 2'--O(CH2)2-OCH3 substituent group; and
4'-thio modified sugars. Sugars can also be replaced with sugar
mimetic groups among others. Methods for the preparations of
modified sugars are well known to those skilled in the art. Some
representative patents and publications that teach the preparation
of such modified sugars include, but are not limited to, U.S.
Patents: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;
5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427;
5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265;
5,658,873; 5,670,633; 5,792,747; 5,700,920; 6,531,584; and
6,600,032; and WO 2005/121371.
[0136] In certain embodiments, BNA's include bicyclic nucleoside
having the formula:
##STR00002##
wherein:
[0137] Bx is a heterocyclic base moiety;
[0138] T1 is H or a hydroxyl protecting group;
[0139] T2 is H, a hydroxyl protecting group or a reactive
phosphorus group;
[0140] Z is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted
C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl,
acyl, substituted acyl, or substituted amide.
[0141] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with optionally protected
substituent groups independently selected from halogen, oxo,
hydroxyl, OJ1, NJ1J2, SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2,
NJ3C(.dbd.X)NJ1J2 and CN, wherein each J1, J2 and J3 is,
independently, H or C1-C6 alkyl, and X is O, S or NJ1.
[0142] In certain such embodiments, each of the substituted groups,
is, independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2,
SJ1, N3, OC(.dbd.X)J1, and NJ3C(.dbd.X)NJ1J2, wherein each J1, J2
and J3 is, independently, H, C1-C6 alkyl, or substituted C1-C6
alkyl and X is O or NJ1. In certain embodiments, the Z group is
C1-C6 alkyl substituted with one or more Xx, wherein each Xx is
independently OJ1, NJ1J2, SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2,
NJ3C(.dbd.X)NJ1J2 or CN; wherein each J1, J2 and J3 is,
independently, H or C1-C6 alkyl, and X is O, S or NJ1. In another
embodiment, the Z group is C1-C6 alkyl substituted with one or more
Xx, wherein each Xx is independently halo (e.g., fluoro), hydroxyl,
alkoxy (e.g., CH3O--), substituted alkoxy or azido.
[0143] In certain embodiments, the Z group is --CH2Xx, wherein Xx
is OJ1, NJ1J2, SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2,
NJ3C(.dbd.X)NJ1J2 or CN; wherein each J1, J2 and J3 is,
independently, H or C1-C6 alkyl, and X is O, S or NJ1. In another
embodiment, the Z group is --CH2Xx, wherein Xx is halo (e.g.,
fluoro), hydroxyl, alkoxy (e.g., CH3O--) or azido.
[0144] In certain such embodiments, the Z group is in the
(R)-configuration:
##STR00003##
[0145] In certain such embodiments, the Z group is in the
(S)-configuration:
##STR00004##
[0146] In certain embodiments, each T1 and T2 is a hydroxyl
protecting group. A preferred list of hydroxyl protecting groups
includes benzyl, benzoyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl,
t-butyldiphenylsilyl, mesylate, tosylate, dimethoxytrityl (DMT),
9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl
(MOX). In certain embodiments, T1 is a hydroxyl protecting group
selected from acetyl, benzyl, t-butyldimethylsilyl,
t-butyldiphenylsilyl and dimethoxytrityl wherein a more preferred
hydroxyl protecting group is T1 is 4,4'-dimethoxytrityl.
[0147] In certain embodiments, T2 is a reactive phosphorus group
wherein preferred reactive phosphorus groups include
diisopropylcyanoethoxy phosphoramidite and H-phosphonate. In
certain embodiments T1 is 4,4'-dimethoxytrityl and T2 is
diisopropylcyanoethoxy phosphoramidite.
[0148] In certain embodiments, oligomeric compounds have at least
one monomer of the formula:
##STR00005##
or of the formula:
##STR00006##
or of the formula:
##STR00007##
wherein
[0149] Bx is a heterocyclic base moiety;
[0150] T3 is H, a hydroxyl protecting group, a linked conjugate
group or an internucleoside linking group attached to a nucleoside,
a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric
subunit or an oligomeric compound;
[0151] T4 is H, a hydroxyl protecting group, a linked conjugate
group or an internucleoside linking group attached to a nucleoside,
a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric
subunit or an oligomeric compound;
[0152] wherein at least one of T3 and T4 is an internucleoside
linking group attached to a nucleoside, a nucleotide, an
oligonucleoside, an oligonucleotide, a monomeric subunit or an
oligomeric compound; and
[0153] Z is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted
C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl,
acyl, substituted acyl, or substituted amide. In one embodiment,
each of the substituted groups, is, independently, mono or poly
substituted with optionally protected substituent groups
independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2,
SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2, NJ3C(.dbd.X)NJ1J2 and CN,
wherein each J1, J2 and J3 is, independently, H or C1-C6 alkyl, and
X is O, S or NJ1.
[0154] In one embodiment, each of the substituted groups, is,
independently, mono or poly substituted with substituent groups
independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2,
SJ1, N3, OC(.dbd.X)J1, and NJ3C(.dbd.X)NJ1J2, wherein each J1, J2
and J3 is, independently, H or C1-C6 alkyl, and X is O or NJ1.
[0155] In certain such embodiments, at least one Z is C1-C6 alkyl
or substituted C1-C6 alkyl. In certain embodiments, each Z is,
independently, C1-C6 alkyl or substituted C1-C6 alkyl. In certain
embodiments, at least one Z is C1-C6 alkyl. In certain embodiments,
each Z is, independently, C1-C6 alkyl. In certain embodiments, at
least one Z is methyl. In certain embodiments, each Z is methyl. In
certain embodiments, at least one Z is ethyl. In certain
embodiments, each Z is ethyl. In certain embodiments, at least one
Z is substituted C1-C6 alkyl. In certain embodiments, each Z is,
independently, substituted C1-C6 alkyl. In certain embodiments, at
least one Z is substituted methyl. In certain embodiments, each Z
is substituted methyl. In certain embodiments, at least one Z is
substituted ethyl. In certain embodiments, each Z is substituted
ethyl.
[0156] In certain embodiments, at least one substituent group is
C1-C6 alkoxy (e.g., at least one Z is C1-C6 alkyl substituted with
one or more C1-C6 alkoxy). In another embodiment, each substituent
group is, independently, C1-C6 alkoxy (e.g., each Z is,
independently, C1-C6 alkyl substituted with one or more C1-C6
alkoxy).
[0157] In certain embodiments, at least one C1-C6 alkoxy
substituent group is CH3O-- (e.g., at least one Z is CH3OCH2-). In
another embodiment, each C1-C6 alkoxy substituent group is CH3O--
(e.g., each Z is CH3OCH2-).
[0158] In certain embodiments, at least one substituent group is
halogen (e.g., at least one Z is C1-C6 alkyl substituted with one
or more halogen). In certain embodiments, each substituent group
is, independently, halogen (e.g., each Z is, independently, C1-C6
alkyl substituted with one or more halogen). In certain
embodiments, at least one halogen substituent group is fluoro
(e.g., at least one Z is CH2FCH2-, CHF2CH2- or CF3CH2-). In certain
embodiments, each halo substituent group is fluoro (e.g., each Z
is, independently, CH2FCH2-, CHF2CH2- or CF3CH2-).
[0159] In certain embodiments, at least one substituent group is
hydroxyl (e.g., at least one Z is C1-C6 alkyl substituted with one
or more hydroxyl). In certain embodiments, each substituent group
is, independently, hydroxyl (e.g., each Z is, independently, C1-C6
alkyl substituted with one or more hydroxyl). In certain
embodiments, at least one Z is HOCH2-. In another embodiment, each
Z is HOCH2-.
[0160] In certain embodiments, at least one Z is CH3-, CH3CH2-,
CH2OCH3-, CH2F-- or HOCH2-. In certain embodiments, each Z is,
independently, CH3-, CH3CH2-, CH2OCH3-, CH2F-- or HOCH2-.
[0161] In certain embodiments, at least one Z group is C1-C6 alkyl
substituted with one or more Xx, wherein each Xx is, independently,
OJ1, NJ1J2, SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2,
NJ3C(.dbd.X)NJ1J2 or CN; wherein each J1, J2 and J3 is,
independently, H or C1-C6 alkyl, and X is O, S or NJ1. In another
embodiment, at least one Z group is C1-C6 alkyl substituted with
one or more Xx, wherein each Xx is, independently, halo (e.g.,
fluoro), hydroxyl, alkoxy (e.g., CH3O--) or azido.
[0162] In certain embodiments, each Z group is, independently,
C1-C6 alkyl substituted with one or more Xx, wherein each Xx is
independently OJ1, NJ1J2, SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2,
NJ3C(.dbd.X)NJ1J2 or CN; wherein each J1, J2 and J3 is,
independently, H or C1-C6 alkyl, and X is O, S or NJ1. In another
embodiment, each Z group is, independently, C1-C6 alkyl substituted
with one or more Xx, wherein each Xx is independently halo (e.g.,
fluoro), hydroxyl, alkoxy (e.g., CH3O--) or azido.
[0163] In certain embodiments, at least one Z group is --CH2Xx,
wherein Xx is OJ1, NJ1J2, SJ1, N3, OC(.dbd.X)J1, OC(.dbd.X)NJ1J2,
NJ3C(.dbd.X)NJ1J2 or CN; wherein each J1, J2 and J3 is,
independently, H or C1-C6 alkyl, and X is O, S or NJ1 In certain
embodiments, at least one Z group is --CH2Xx, wherein Xx is halo
(e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O--) or azido.
[0164] In certain embodiments, each Z group is, independently,
--CH2Xx, wherein each Xx is, independently, OJ1, NJ1J2, SJ1, N3,
OC(.dbd.X)J1, OC(.dbd.X)NJ1J2, NJ3C(.dbd.X)NJ1J2 or CN;
[0165] wherein each J1, J2 and J3 is, independently, H or C1-C6
alkyl, and X is O, S or NJ1. In another embodiment, each Z group
is, independently, --CH2Xx, wherein each Xx is, independently, halo
(e.g., fluoro), hydroxyl, alkoxy (e.g., CH3O--) or azido. In
certain embodiments, at least one Z is CH3-. In another embodiment,
each Z is, CH3-.
[0166] In certain embodiments, the Z group of at least one monomer
is in the (R)-configuration represented by the formula:
##STR00008##
or the formula:
##STR00009##
or the formula:
##STR00010##
[0167] In certain embodiments, the Z group of each monomer of the
formula is in the (R)-configuration.
[0168] In certain embodiments, the Z group of at least one monomer
is in the (S)-configuration represented by the formula:
##STR00011##
or the formula:
##STR00012##
or the formula:
##STR00013##
[0169] In certain embodiments, the Z group of each monomer of the
formula is in the (S)-configuration.
[0170] In certain embodiments, T3 is H or a hydroxyl protecting
group. In certain embodiments, T4 is H or a hydroxyl protecting
group. In a further embodiment T3 is an internucleoside linking
group attached to a nucleoside, a nucleotide or a monomeric
subunit. In certain embodiments, T4 is an internucleoside linking
group attached to a nucleoside, a nucleotide or a monomeric
subunit. In certain embodiments, T3 is an internucleoside linking
group attached to an oligonucleoside or an oligonucleotide. In
certain embodiments, T4 is an internucleoside linking group
attached to an oligonucleoside or an oligonucleotide. In certain
embodiments, T3 is an internucleoside linking group attached to an
oligomeric compound. In certain embodiments, T4 is an
internucleoside linking group attached to an oligomeric compound.
In certain embodiments, at least one of T3 and T4 comprises an
internucleoside linking group selected from phosphodiester or
phosphorothioate.
[0171] In certain embodiments, oligomeric compounds have at least
one region of at least two contiguous monomers of the formula:
##STR00014##
or of the formula:
##STR00015##
or of the formula:
##STR00016##
to
[0172] In certain embodiments, the oligomeric compound comprises at
least two regions of at least two contiguous monomers of the above
formula. In certain embodiments, the oligomeric compound comprises
a gapped oligomeric compound. In certain embodiments, the
oligomeric compound comprises at least one region of from about 8
to about 14 contiguous .beta.-D-2'-deoxyribofuranosyl nucleosides.
In certain embodiments, the oligomeric compound comprises at least
one region of from about 9 to about 12 contiguous
.beta.-D-2'-deoxyribofuranosyl nucleosides.
[0173] In certain embodiments, monomers include sugar mimetics. In
certain such embodiments, a mimetic is used in place of the sugar
or sugar-internucleoside linkage combination, and the nucleobase is
maintained for hybridization to a selected target. Representative
examples of a sugar mimetics include, but are not limited to,
cyclohexenyl or morpholino. Representative examples of a mimetic
for a sugar-internucleoside linkage combination include, but are
not limited to, peptide nucleic acids (PNA) and morpholino groups
linked by uncharged achiral linkages. In some instances a mimetic
is used in place of the nucleobase. Representative nucleobase
mimetics are well known in the art and include, but are not limited
to, tricyclic phenoxazine analogs and universal bases (Berger et
al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by
reference). Methods of synthesis of sugar, nucleoside and
nucleobase mimetics are well known to those skilled in the art.
Monomeric Linkages
[0174] Described herein are linking groups that link monomers
(including, but not limited to, modified and unmodified nucleosides
and nucleotides) together, thereby forming an oligomeric compound.
The two main classes of linking groups are defined by the presence
or absence of a phosphorus atom. Representative phosphorus
containing linkages include, but are not limited to,
phosphodiesters (P.dbd.O), phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates (P.dbd.S). Representative
non-phosphorus containing linking groups include, but are not
limited to, methylenemethylimino (--CH2-N(CH3)-O--CH2-),
thiodiester (--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--);
siloxane (--O--Si(H)2-O--); and N,N'-dimethylhydrazine
(--CH2-N(CH3)-N(CH3)-). Oligomeric compounds having non-phosphorus
linking groups are referred to as oligonucleosides. Modified
linkages, compared to natural phosphodiester linkages, can be used
to alter, typically increase, nuclease resistance of the oligomeric
compound. In certain embodiments, linkages having a chiral atom can
be prepared a racemic mixtures, as separate enantomers.
Representative chiral linkages include, but are not limited to,
alkylphosphonates and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing linkages are
well known to those skilled in the art.
[0175] The oligomeric compounds described herein contain one or
more asymmetric centers and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S), such
as for sugar anomers, or as (D) or (L) such as for amino acids et
al. Included in the antisense compounds provided herein are all
such possible isomers, as well as their racemic and optically pure
forms.
Oligomeric Compounds
[0176] In certain embodiments, provided herein are oligomeric
compounds having reactive phosphorus groups useful for forming
linkages including for example phosphodiester and phosphorothioate
internucleoside linkages. Methods of preparation and/or
purification of precursors or oligomeric compounds are not a
limitation of the compositions or methods provided herein. Methods
for synthesis and purification of oligomeric compounds including
DNA, RNA, oligonucleotides, oligonucleosides, and antisense
compounds are well known to those skilled in the art.
[0177] Generally, oligomeric compounds comprise a plurality of
monomeric subunits linked together by linking groups. Nonlimiting
examples of oligomeric compounds include primers, probes, antisense
compounds, antisense oligonucleotides, external guide sequence
(EGS) oligonucleotides, alternate splicers, and siRNAs. As such,
these compounds can be introduced in the form of single-stranded,
double-stranded, circular, branched or hairpins and can contain
structural elements such as internal or terminal bulges or loops.
Oligomeric double-stranded compounds can be two strands hybridized
to form double-stranded compounds or a single strand with
sufficient self complementarity to allow for hybridization and
formation of a fully or partially double-stranded compound.
[0178] In certain embodiments, the present invention provides
chimeric oligomeric compounds. In certain such embodiments,
chimeric oligomeric compounds are chimeric oligonucleotides. In
certain such embodiments, the chimeric oligonucleotides comprise
differently modified nucleotides. In certain embodiments, chimeric
oligonucleotides are mixed-backbone antisense oligonucleotides.
[0179] In general a chimeric oligomeric compound will have modified
nucleosides that can be in isolated positions or grouped together
in regions that will define a particular motif Any combination of
modifications and/or mimetic groups can comprise a chimeric
oligomeric compound as described herein.
[0180] In certain embodiments, chimeric oligomeric compounds
typically comprise at least one region modified so as to confer
increased resistance to nuclease degradation, increased cellular
uptake, and/or increased binding affinity for the target nucleic
acid. In certain embodiments, an additional region of the
oligomeric compound may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids.
[0181] In certain embodiments, chimeric oligomeric compounds are
gapmers. In certain such embodiments, a mixed-backbone oligomeric
compound has one type of internucleotide linkages in one or both
wings and a different type of internucleoside linkages in the gap.
In certain such embodiments, the mixed-backbone oligonucleotide has
phosphodiester linkages in the wings and phosphorothioate linkages
in the gap. In certain embodiments in which the internucleoside
linkages in a wing is different from the internucleoside linkages
in the gap, the internucleoside linkage bridging that wing and the
gap is the same as the internucleoside linkage in the wing. In
certain embodiments in which the internucleoside linkages in a wing
is different from the internucleoside linkages in the gap, the
internucleoside linkage bridging that wing and the gap is the same
as the internucleoside linkage in the gap.
[0182] In certain embodiments, the present invention provides
oligomeric compounds, including antisense oligomeric compounds and
antidote oligomeric compounds, of any of a variety of ranges of
lengths. In certain embodiments, the invention provides oligomeric
compounds consisting of X-Y linked oligonucleosides, where X and Y
are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
and 50; provided that X<Y. For example, in certain embodiments,
the invention provides oligomeric compounds comprising: 8-9, 8-10,
8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21,
8-22, 8-23, 8-24, 8-25, 8-26, 8-27, 8-28, 8-29, 8-30, 9-10, 9-11,
9-12, 9-13, 9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22,
9-23, 9-24, 9-25, 9-26, 9-27, 9-28, 9-29, 9-30, 10-11, 10-12,
10-13, 10-14, 10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21,
10-22, 10-23, 10-24, 10-25, 10-26, 10-27, 10-28, 10-29, 10-30,
11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20,
11-21, 11-22, 11-23, 11-24, 11-25, 11-26, 11-27, 11-28, 11-29,
11-30, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20,
12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29,
12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21,
13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30,
14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23,
14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17,
15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26,
15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21,
16-22, 16-23, 16-24, 16-25, 26, 16-27, 16-28, 16-29, 16-30, 17-18,
17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27,
17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24,
18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22,
19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21,
20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30,
21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30,
22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24,
23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27,
24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27,
26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30
linked nucleosides.
Certain Conjugate Groups
[0183] In certain embodiments, oligomeric compounds are modified by
covalent attachment of one or more conjugate groups. In general,
conjugate groups modify one or more properties of the attached
oligomeric compound including but not limited to pharmacodynamic,
pharmacokinetic, binding, absorption, cellular distribution,
cellular uptake, charge and clearance. Conjugate groups are
routinely used in the chemical arts and are linked directly or via
an optional linking moiety or linking group to a parent compound
such as an oligomeric compound. A preferred list of conjugate
groups includes without limitation, intercalators, reporter
molecules, polyamines, polyamides, polyethylene glycols,
thioethers, polyethers, cholesterols, thiocholesterols, cholic acid
moieties, folate, lipids, phospholipids, biotin, phenazine,
phenanthridine, anthraquinone, adamantane, acridine, fluoresceins,
rhodamines, coumarins and dyes.
[0184] Preferred conjugate groups amenable to the present invention
include lipid moieties such as a cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid
(Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem.
Let., 1993, 3, 2765); a thiocholesterol (Oberhauser et al., Nucl.
Acids Res., 1992, 20, 533); an aliphatic chain, e.g., dodecandiol
or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10,
111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al.,
Biochimie, 1993, 75, 49); a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or
triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al.,
Nucl. Acids Res., 1990, 18, 3777); a polyamine or a polyethylene
glycol chain (Manoharan et al., Nucleosides & Nucleotides,
1995, 14, 969); adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651); a palmityl moiety (Mishra et
al., Biochim. Biophys. Acta, 1995, 1264, 229); or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923).
[0185] Linking groups or bifunctional linking moieties such as
those known in the art are amenable to the compounds provided
herein. Linking groups are useful for attachment of chemical
functional groups, conjugate groups, reporter groups and other
groups to selective sites in a parent compound such as for example
an oligomeric compound. In general a bifunctional linking moiety
comprises a hydrocarbyl moiety having two functional groups. One of
the functional groups is selected to bind to a parent molecule or
compound of interest and the other is selected to bind essentially
any selected group such as chemical functional group or a conjugate
group. In some embodiments, the linker comprises a chain structure
or an oligomer of repeating units such as ethylene glycol or amino
acid units. Examples of functional groups that are routinely used
in a bifunctional linking moiety include, but are not limited to,
electrophiles for reacting with nucleophilic groups and
nucleophiles for reacting with electrophilic groups. In some
embodiments, bifunctional linking moieties include amino, hydroxyl,
carboxylic acid, thiol, unsaturations (e.g., double or triple
bonds), and the like. Some nonlimiting examples of bifunctional
linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC)
and 6-aminohexanoic acid (AHEX or AHA). Other linking groups
include, but are not limited to, substituted C1-C10 alkyl,
substituted or unsubstituted C2-C10 alkenyl or substituted or
unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of
preferred substituent groups includes hydroxyl, amino, alkoxy,
carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl,
aryl, alkenyl and alkynyl.
Synthesis, Purification and Analysis
[0186] Oligomerization of modified and unmodified nucleosides and
nucleotides can be routinely performed according to literature
procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed.
Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001),
23, 206-217. Gait et al., Applications of Chemically synthesized
RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et
al., Tetrahedron (2001), 57, 5707-5713).
[0187] Oligomeric compounds provided herein can be conveniently and
routinely made through the well-known technique of solid phase
synthesis. Equipment for such synthesis is sold by several vendors
including, for example, Applied Biosystems (Foster City, Calif.).
Any other means for such synthesis known in the art may
additionally or alternatively be employed. It is well known to use
similar techniques to prepare oligonucleotides such as the
phosphorothioates and alkylated derivatives. The invention is not
limited by the method of antisense compound synthesis.
[0188] Methods of purification and analysis of oligomeric compounds
are known to those skilled in the art. Analysis methods include
capillary electrophoresis (CE) and electrospray-mass spectroscopy.
Such synthesis and analysis methods can be performed in multi-well
plates. The method of the invention is not limited by the method of
oligomer purification.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0189] Oligomeric compounds may be admixed with pharmaceutically
acceptable active and/or inert substances for the preparation of
pharmaceutical compositions or formulations. Compositions and
methods for the formulation of pharmaceutical compositions are
dependent upon a number of criteria, including, but not limited to,
route of administration, extent of disease, or dose to be
administered.
[0190] Oligomeric compounds, including antisense compounds and/or
antidote compounds, can be utilized in pharmaceutical compositions
by combining such oligomeric compounds with a suitable
pharmaceutically acceptable diluent or carrier. A pharmaceutically
acceptable diluent includes phosphate-buffered saline (PBS). PBS is
a diluent suitable for use in compositions to be delivered
parenterally. Accordingly, in one embodiment, employed in the
methods described herein is a pharmaceutical composition comprising
an antisense compound and/or antidote compound and a
pharmaceutically acceptable diluent. In certain embodiments, the
pharmaceutically acceptable diluent is PBS.
[0191] Pharmaceutical compositions comprising oligomeric compounds
encompass any pharmaceutically acceptable salts, esters, or salts
of such esters. In certain embodiments, pharmaceutical compositions
comprising oligomeric compounds comprise one or more
oligonucleotide which, upon administration to an animal, including
a human, is capable of providing (directly or indirectly) the
biologically active metabolite or residue thereof. Accordingly, for
example, the disclosure is also drawn to pharmaceutically
acceptable salts of antisense compounds, prodrugs, pharmaceutically
acceptable salts of such prodrugs, and other bioequivalents.
Suitable pharmaceutically acceptable salts include, but are not
limited to, sodium and potassium salts.
[0192] A prodrug can include the incorporation of additional
nucleosides at one or both ends of an oligomeric compound which are
cleaved by endogenous nucleases within the body, to form the active
oligomeric compound.
Antisense
[0193] Antisense mechanisms are all those involving the
hybridization of a compound with target nucleic acid, wherein the
outcome or effect of the hybridization is either target degradation
or target occupancy with concomitant stalling of the cellular
machinery involving, for example, transcription or splicing.
[0194] For example, a type of antisense mechanism involving target
degradation includes an RNase H. RNase H is a cellular endonuclease
which cleaves the RNA strand of an RNA:DNA duplex. It is known in
the art that single-stranded antisense compounds which are
"DNA-like" elicit RNAse H activity in mammalian cells. Activation
of RNase H, therefore, results in cleavage of the RNA target,
thereby greatly enhancing the efficiency of DNA-like
oligonucleotide-mediated inhibition of gene expression.
[0195] In certain embodiments, chemically-modified antisense
compounds have a higher affinity for target RNAs than does
non-modified DNA. In certain such embodiments, that higher affinity
in turn provides increased potency allowing for the administration
of lower doses of such compounds, reduced potential for toxicity
and improvement in therapeutic index and decreased overall cost of
therapy.
[0196] Antisense compounds are oligomeric compounds. Accordingly,
in certain embodiments, antisense compounds comprise, for example
and without limitation, any of the modifications and motifs
described in the discussion above for oligomeric compounds.
Antisense compounds may be single-stranded or double-stranded
oligomeric compounds. In embodiments where an antisense compound is
a double-stranded oligomeric compound, the two strands may have the
same modifications and motifs or may have modifications and motifs
that are different from one another. Certain antisense compounds
and modifications and motifs useful for such compounds are known in
the art.
Modulation of Target Expression
[0197] In certain embodiments, a target nucleic acid is a mRNA. In
certain such embodiments, antisense compounds are designed to
modulate that target mRNA or its expression. In certain
embodiments, designing an antisense compound to a target nucleic
acid molecule can be a multistep process. Typically the process
begins with the identification of a target protein, the activity of
which is to be modulated, and then identifying the nucleic acid the
expression of which yields the target protein. In certain
embodiments, designing of an antisense compound results in an
antisense compound that is hybridizable to the targeted nucleic
acid molecule. In certain embodiments, the antisense compound is an
antisense oligonucleotide or antisense oligonucleoside. In certain
embodiments, an antisense compound and a target nucleic acid are
complementary to one another. In certain such embodiments, an
antisense compound is perfectly complementary to a target nucleic
acid. In certain embodiments, an antisense compound includes one
mismatch. In certain embodiments, an antisense compound includes
two mismatches. In certain embodiments, an antisense compound
includes three or more mismatches.
[0198] Modulation of expression of a target nucleic acid can be
achieved through alteration of any number of nucleic acid
functions. In certain embodiments, the functions of RNA to be
modulated include, but are not limited to, translocation functions,
which include, but are not limited to, translocation of the RNA to
a site of protein translation, translocation of the RNA to sites
within the cell which are distant from the site of RNA synthesis,
and translation of protein from the RNA. RNA processing functions
that can be modulated include, but are not limited to, splicing of
the RNA to yield one or more RNA species, capping of the RNA, 3'
maturation of the RNA and catalytic activity or complex formation
involving the RNA which may be engaged in or facilitated by the
RNA. Modulation of expression can result in the increased level of
one or more nucleic acid species or the decreased level of one or
more nucleic acid species, either temporally or by net steady state
level. Thus, in one embodiment modulation of expression can mean
increase or decrease in target RNA or protein levels. In another
embodiment modulation of expression can mean an increase or
decrease of one or more RNA splice products, or a change in the
ratio of two or more splice products.
Hybridization
[0199] In certain embodiments, antisense compounds specifically
hybridize when there is a sufficient degree of complementarity to
avoid non-specific binding of the antisense compound to non-target
nucleic acid sequences under conditions in which specific binding
is desired, i.e., under physiological conditions in the case of in
vivo assays or therapeutic treatment, and under conditions in which
assays are performed in the case of in vitro assays.
[0200] As used herein, "stringent hybridization conditions" or
"stringent conditions" refers to conditions under which an
antisense compound will hybridize to its target sequence, but to a
minimal number of other sequences. Stringent conditions are
sequence-dependent and will be different in different
circumstances, and "stringent conditions" under which antisense
compounds hybridize to a target sequence are determined by the
nature and composition of the antisense compounds and the assays in
which they are being investigated.
[0201] It is understood in the art that incorporation of nucleotide
affinity modifications may allow for a greater number of mismatches
compared to an unmodified compound. Similarly, certain
oligonucleotide sequences may be more tolerant to mismatches than
other oligonucleotide sequences. One of ordinary skill in the art
is capable of determining an appropriate number of mismatches
between oligonucleotides, or between an oligonucleotide and a
target nucleic acid, such as by determining melting temperature
(Tm). Tm or .DELTA.Tm can be calculated by techniques that are
familiar to one of ordinary skill in the art. For example,
techniques described in Freier et al. (Nucleic Acids Research,
1997, 25, 22: 4429-4443) allow one of ordinary skill in the art to
evaluate nucleotide modifications for their ability to increase the
melting temperature of an RNA:DNA duplex.
Antidote
[0202] In certain instances it is desirable to inhibit antisense
activity. For example, in certain embodiments where the antisense
target is an mRNA, it is may be desirable to inhibit antisense
activity and thereby restore expression of a target protein. For
example, certain antisense compounds have been used
therapeutically. In certain such uses, antisense compounds are
long-acting. In certain instances, such long acting antisense
compounds are desirable, for their convenience. In such instances,
though, it may also be desirable to have a means to reverse the
antisense activity of an antisense compound. For example, a patient
may respond poorly to treatment or receive too high a dose. In such
an instance, an antidote to the antisense compound may be
administered to at least partially reduce the antisense activity of
the antisense compound. In certain embodiments, the long-lasting
effect of antisense compounds makes waiting for that effect to
slowly diminish through natural clearance an unattractive
option.
[0203] By way of example, and without limiting the present
invention, certain antisense compounds are useful for inhibiting
blood clotting factors (e.g., Factor II (prothrombin), Factor VII,
Factor IX, etc.). Certain such antisense compounds may be found,
for example in Provisional U.S. Application 60/980,376, which is
hereby incorporated by reference in its entirety. Such antisense
compounds have therapeutic potential as anticoagulants. Long
half-lives make such antisense compounds particularly attractive,
however, if a patient receives too high a dose, has surgery (where
anti-coagulation is undesirable) or otherwise desires a decrease in
the anti-coagulant effect, an antidote to the antisense
anti-coagulant compound may be administered. Such antidote compound
will restore coagulation function more quickly than simply waiting
for natural clearance of the antisense compound. This example is
provided for illustrative purposes. Antisense compounds have been
designed to a vast number of targets, including without limitation,
a vast number of messenger RNA (mRNA) targets and pre-mRNA targets,
as well as a vast number of non-coding RNA targets. Antidotes
provided herein are suitable for any antisense compound, regardless
of the target or mechanism of the antisense compound.
[0204] In certain embodiments, the invention provides antidote
compounds to an antisense compound targeted to an mRNA. In certain
such embodiments, the target mRNA encodes a protein involved in
metabolism. In certain such embodiments, the target mRNA encodes a
protein involved in cardiac function. In certain embodiments, the
target mRNA encodes a protein involved in blood-clotting. Antisense
compounds targeting any of a variety of target proteins are known
in the art. See, for example: Provisional U.S. Application
60/980,376; U.S. application Ser. No. 11/745,429, each of which is
hereby incorporated by reference in its entirety. Target mRNAs that
may be modulated with antisense and then with an antidote compound
include, but are not limited to those encoding any of the
following: prothrombin (Factor II), Factor VII, Factor IX, Factor
XI, ApoB, SGLT2, PTEN, SOD1, Huntingtin, PTP1B, ICAM-1, CRP, GCGR,
GCCR, Clusterin, Survivin, elf-4-e, Hsp27, VLA-4, PCSK-9, DGAT2,
and IL-4.alpha..
[0205] In certain embodiments, the invention provides antidote
compound to an antisense compound that modulates splicing of a
pre-mRNA. Certain such antisense compounds may be found for example
in U.S. Pat. Nos. 6,172,216; and 6,210,892; in U.S. application
Ser. Nos. 10/672,501; 11/339,785; and 10/416,214; and in
International Application Nos.: WO 2007/002390; WO 2007/028065; WO
2007/047913; each of which is hereby incorporated by reference in
its entirety.
[0206] In certain embodiments, the invention provides antidote
compound to an antisense compound that modulates a micro-RNA.
Certain such antisense compounds may be found for example in U.S.
application Ser. No. 10/909,125; International Application Nos.:
WO03/029459, which is hereby incorporated by reference in its
entirety.
[0207] Antisense activity may rely on any of variety of different
mechanisms to exert an effect. For example, a particular antisense
compound may function through RNase H cleavage, through the RISC
pathway, and/or by blocking translation or altering splicing by
simply occupying a target RNA. Antidote compounds may be designed
to any antisense compound, regardless of the mechanism(s) of action
of the antisense compound. Likewise, the antidote itself may work
through any mechanism(s). For example, in certain embodiments,
hybridization of the antidote compound to the antisense compound
results in cleavage of the antisense compound. In certain such
embodiments, cleavage is affected by RNase H. In certain
embodiments, hybridization of the antidote to the antisense
compounds does not result in cleavage of the antisense compound,
but nonetheless reduces antisense activity.
[0208] In certain embodiments, because the antidote compound is in
competition with the antisense target for binding with the
antisense compound, it is desirable to modify the antidote compound
to increase its affinity for the antisense compound. In certain
embodiments, one or more nucleoside of the antidote compound is
modified. In certain such embodiments, such modification increases
the affinity of the antidote compound for the antisense compound.
Such modifications are known in the art and include, but are not
limited to, BNA, including, but not limited to LNA, and ENA, 2'
substitutions including, but not limited to 2' MOE, 2'-F,
2'-O-alkyl, including, but not limited to 2'-OMe. Such
modifications may be used in any combination. In certain
embodiments, an antidote is an oligomeric compound. Such antidotes
may comprise any modification or motif, including, but not limited
to those discussed above and in the references cited herein.
[0209] Antidote compounds are oligomeric compounds. Accordingly, in
certain embodiments, antidote compounds comprise, for example and
without limitation, any of the modifications and motifs described
in the discussion above for oligomeric compounds. Antisense
compounds may be single-stranded or double-stranded oligomeric
compounds. In embodiments where an antisense compound is a
double-stranded oligomeric compound, the two strands may have the
same modifications and motifs or may have modifications and motifs
that are different from one another. Certain antisense compounds
and modifications and motifs useful for such compounds are known in
the art. Such modifications and motifs may likewise be useful for
antidote compounds.
[0210] In certain embodiments, motifs are designed with
consideration given to both the antisense compound and the
antidote. For example, certain antisense compounds are RNA-like
(certain such compounds may rely on RISC and/or other RNases for
their activity). In certain embodiments, an antidote for such a
compound could comprise 4 or more contiguous DNA-like monomers. In
certain embodiments, the resulting RNA/DNA duplex could activate
RNase H, resulting in cleavage of the RNA-like antisense compound.
In certain embodiments, antidote activity does not depend on
enzymatic activity. In certain such embodiments, compounds designed
without regard for enzymatic compatibility may incorporate
modifications to improve other attributes. For example, certain
motifs yield oligomeric compounds with high affinity for a target
nucleic acid, but that are unable to elicit enzymatic cleavage of
that target. Such motifs may be useful for antidote compounds in
embodiments where cleavage of the antisense compound is not
necessary.
[0211] In certain embodiments, an antisense compound and
corresponding antidote compound are the same length. In certain
embodiments, an antisense compound and corresponding antidote
compound are different lengths.
[0212] Non-limiting examples of antisense/antidote pairs is
provided in the following table:
TABLE-US-00001 Antisense Compound Antidote Compound Length Motif
Length Motif 20 5-10-5 MOE gapmer 20 5-10-5 MOE gapmer 20 5-10-5
MOE gapmer 20 Uniform MOE 20 5-10-5 MOE gapmer 20 Uniform 2'-F 20
5-10-5 MOE gapmer 18 Uniform BNA 20 5-10-5 MOE gapmer 20 5-10-5 LNA
gapmer 16 3-10-3 MOE gapmer 16 3-10-3 MOE gapmer 16 3-10-3 MOE
gapmer 14 2-10-2 LNA gapmer 18 4-10-4 LNA gapmer 18 4-10-4 LNA
gapmer 20 Uniform 2'-F 20 Uniform 2'-F 18 2-10-4-1 LNA-DNA- 20
Uniform LNA LNA-DNA 14 2-10-2 BNA-RNA-BNA 14 Uniform BNA
The above listed pairs of antisense and antidote compounds are only
exemplary. One of skill in the art can select any length and motif
for the sense and independently select any length and motif for the
antidote compound. The antisense and antidote compounds may,
likewise comprise modified internucleoside linkages in any
combination.
[0213] Because the antidote compound is complementary to the
antisense compound, it is at least partially identical to the
antisense target nucleic acid (i.e., it is a sense strand). In
certain embodiments, treatment with an antisense compound followed
by an antidote compound could result in formation of a
double-stranded duplex with antisense activity. For example, such a
duplex could be an siRNA and activate the RISC pathway. In
embodiments where a decrease of antisense activity is sought, such
duplexes should be avoided. Thus, in certain embodiments, where the
antisense compound comprises RNA-like nucleosides suitable for
loading into RISC, the antidote compound should avoid modifications
that will allow or facilitate such loading of the antisense
compound into RISC.
[0214] In certain embodiments, an antisense compound and an
antidote compound are administered to a patient. In certain such
embodiments, pharmaceutical compositions comprising an antisense
compound and those comprising an antidote compound comprise the
same formulation. In certain embodiments, pharmaceutical
compositions comprising an antisense compound and those comprising
an antidote compound comprise different formulations. In certain
embodiments an antisense compound and an antidote compound are
administered by the same route. In certain embodiments an antisense
compound and an antidote compound are administered by different
routes. For example, in certain embodiments, an antisense compound
is administered orally and an antidote compound is administered by
injection. In certain embodiments, the dosages of the antisense
compound and the antidote compound are the same. In certain
embodiments, the dosages of the antisense compound and the antidote
compound are different.
[0215] In certain embodiments, the toxicity profiles of the
antisense compound and the antidote compound are similar. In
certain embodiments, such toxicity profiles are different. For
example, in certain embodiments, an antisense compound may be
intended for chronic administration and the antidote compound is
only intended for acute use as needed. In such embodiments, the
tolerance for toxic side-effects of the antidote compound may be
higher. Accordingly, modifications and motifs that may be too toxic
for use in an antisense compound may be acceptable in an antidote
compound. For example, in certain embodiments, oligomeric compounds
comprising one or more LNA nucleoside have been shown to have high
affinity for a target nucleic acid, but in certain embodiments have
been shown to cause toxicity at relatively low concentrations. For
certain antisense compounds, where chronic administration is
intended, certain such compounds comprising LNA may not be
suitable. However, in embodiments where an antidote compound is not
intended for chronic administration, but rather for acute
administration when antisense activity is problematic, such LNA
modifications in an antidote compound may be acceptable. The
increased affinity of LNA may improve the antidote effect and since
the antidote is only administered for a short period of time, and
possibly when the patient is in distress, the increased toxicity of
LNA may be justified. Other high affinity, but potentially toxic
modifications are known.
[0216] In certain embodiments, an antisense activity is
counteracted by a non-oligomeric antidote. For example, in certain
embodiments, when the target nucleic acid is a target mRNA encoding
a protein it is desirable to reduce the antisense activity and to
increase in the amount of the target protein (e.g., target protein
amount has gone too low, or circumstances have changed resulting in
the desire to restore target protein amount). In such embodiments,
one may simply administer the target protein itself. Such
administration will immediately reverse the antisense activity of
target protein reduction. However, it may also be desirable to
administer an oligomeric antidote compound according to the present
invention. For example, the target protein may have a short
half-life in the animal. Accordingly, to maintain the restored
target protein concentration would require repeated administration
of target protein until the antisense compound has cleared and
normal protein expression is restored. In certain such embodiments,
it is still desirable to administer an antidote compound to shorten
the duration of the antisense activity. In certain embodiments an
antidote compound is co-administered with a non-oligomeric
antidote. In certain such embodiments, the non-oligomeric antidote
is a target protein. In certain embodiments, the non-oligomeric
antidote compound is a protein having similar physiological effect
as a target protein or that stimulates expression of the target
protein.
Research Tools
[0217] In certain instances, antisense compounds have been used as
research tools. For example, researchers investigating the function
of a particular gene product may design antisense compounds to
reduce the amount of that gene product present in a cell or an
animal and observe phenotypic changes in the cell or animal. In
certain embodiments, the present invention provides methods for
reducing the amount of a gene product in a cell or animal through
antisense and then reducing that antisense activity, thereby
restoring the inhibited gene product. In certain embodiments,
investigators may use such techniques to characterize proteins or
untranslated nucleic acids. In certain embodiments, investigators
may vary the amount of time between antisense and antidote
administration. In certain embodiments, such experiments are used
to investigate kinetics and/or turnover of gene products and/or
certain cellular functions.
Kits
[0218] In certain embodiments, the present invention provides kits
comprising one or more antisense compound and one or more
corresponding antidote compound. In certain embodiments, such kits
are intended for therapeutic application. In certain embodiments,
such kits are intended for research use.
Nonlimiting Disclosure and Incorporation by Reference
[0219] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references, GenBank accession numbers,
and the like recited in the present application is incorporated
herein by reference in its entirety.
[0220] The nucleoside sequences set forth in the sequence listing
and Examples, are independent of any modification to a sugar
moiety, a monomeric linkage, or a nucleobase. As such, oligomeric
compounds defined by a SEQ ID NO may comprise, independently, one
or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase. Oligomeric compounds described by Isis
Number (Isis NO.) indicate a combination of nucleobase sequence and
one or more modifications to a sugar moiety, an internucleoside
linkage, or a nucleobase, as indicated.
EXAMPLES
Example 1
Fas Antisense and Antidote Oligonucleotides
[0221] An antisense compound complementary to murine Fas and
antidote compounds to that antisense compound were synthesized
using an Applied Biosystems 380B automated DNA synthesizer (Applied
Biosystems, Foster City, Calif.). Compound details are provided in
Table 1, below.
TABLE-US-00002 TABLE 1 Fas antisense and antidotes SEQ ISIS #
Chemistry Motif Sequence Description ID 22023 5-10-5 MOE gap
TCCAGCACTTTCTTTTCCGG Fas Antisense 1 401770 5-10-5 MOE
CCGGAAAAGAAAGTGCTGGA Antidote to 22023 2 401769 Uniform MOE
CCGGAAAAGAAAGTGCTGGA Antidote to 22026 2 29837 5-10-5 MOE
TCGATCTCCTTTTATGCCCG Non-sense control 3
Example 2
Fas Antisense/Antidote Treatment of Mice
[0222] Eight week old Balb/c mice (Charles River Laboratories
(Willmingon, Mass.)) were injected sub-cutaneously with 35 mg/kg of
ISIS 22023 in a volume of 200 ml of saline or with 200 ml of saline
(control mice) every other day for two injections.
[0223] One day after the second injection, the mice were divided
into 3 groups: Group 1 received 35 mg/kg sub-cutaneous injections
of ISIS 401770 (5-10-5 MOE gapmer antidote to ISIS 22023) once
daily for two days; Group 2 received 35 mg/kg sub-cutaneous
injections of ISIS 401769 (uniform MOE antidote to ISIS-22023) once
daily for two days; and Group 3 received sub-cutaneous injections
of saline once daily for two days. All injections were in a total
volume of 200 .mu.l of sterile saline. Animals were sacrificed and
livers were collected at 2, 4, 7, 10, and 14 days after the first
day of antidote treatment.
Example 3
Fas RNA
[0224] Total RNA was isolated from the livers using Rneasy mini kit
(Quiagen). Fas RNA was assessed by quantitative real-time PCR,
using standard techniques. Results are summarized in FIG. 1.
[0225] Treatment with antisense compound ISIS 22023 resulted in
reduction of Fas mRNA. Subsequent treatment with antidote compound
ISIS 401770 or ISIS 401769 reduced the antisense activity of ISIS
22023 (i.e., treatment with such compounds reduced the reduction of
Fas mRNA).
Example 4
Kinetics and Specificity of Fas Antidotes
[0226] Part 1. To study the kinetic of the antidote activity, eight
week old Balb/c mice were injected sub-cutaneously with 35 mg/kg of
ISIS 22023 in a volume of 200 ml of saline or with 200 ml of saline
(control mice) every other day for two injections.
[0227] Two days after the second injection, the mice were divided
into 3 groups: Group 1 received a single 70 mg/kg sub-cutaneous
injection of ISIS 401770 (5-10-5 MOE gapmer antidote to ISIS
22023); Group 2 received a single 70 mg/kg sub-cutaneous injection
of ISIS 401769 (uniform MOE antidote to ISIS-22023); and Group 3
received a sub-cutaneous injection of saline. All injections were
in a total volume of 200 .mu.l of sterile saline. Animals were
sacrificed and livers were collected at 6 hours, 12 hours and 1, 2,
6, and 14 days after antidote treatment.
[0228] Livers were collected and total RNA was analyzed as
described above (Example 3). Results are shown in FIG. 2.
[0229] To test the specificity of the antisense activity and the
antidote activity, eight week old Balb/c mice were divided into 3
groups and injected sub-cutaneously using a first treatment
(antisense stage) and a second treatment (antidote stage) as
described above in part 1, using the compounds in Table 2,
below:
TABLE-US-00003 TABLE 2 Compounds to test specificity of
antisense/antidote activity Group First (antisense) treatment
Second (antidote) treatment 1 22023 (Fas antisense) 29837
(non-sense control) 2 29837 (non-sense control) 401769 (antidote to
22023) 3 29837 (non-sense control) 401770 (antidote to 22023)
[0230] ISIS 29837 is a 5-10-5 MOE gapmer with the same base
composition as ISIS 22023, but with the sequence scrambled,
resulting 8 mismatches. Thus, it is not expected to be an effective
antisense compound (groups 2 and 3) nor an effective antidote
compound to 22023 (group 1). As shown in FIG. 3, the mismatch
control oligonucleotide did not provide an antidote effect
suggesting that the antidote effect is sequence specific.
Example 5
PTEN Antisense and Antidote Oligonucleotides
[0231] An antisense compound complementary to PTEN and antidote
compounds to that antisense compound were synthesized using an
Applied Biosystems 380B automated DNA synthesizer (Applied
Biosystems, Foster City, Calif.). Compound details are provided in
Table 3, below.
TABLE-US-00004 TABLE 3 Fas antisense and antidote compounds SEQ
ISIS # Chemistry Motif Sequence Description ID 116847 5-10-5 MOE
gap CTGCTAGCCTCTGGATTTGA PTEN antisense 4 126525 Uniform MOE
TCAAATCCAGAGGCTAGCAG Antidote to 116847 5 401769 Uniform MOE
CCGGAAAAGAAAGTGCTGGA Non-sense control 6
Example 6
PTEN Antisense/Antidote Treatment of Mice
[0232] Eight week old Balb/c mice (Charles River Laboratories
(Willmingon, Mass.)) were injected sub-cutaneously with 35 mg/kg of
ISIS 116847 (5-10-5 MOE gapmer PTEN antisense) in a volume of 200
ml of saline or with 200 ml of saline (control mice) every other
day for two injections.
[0233] Two days after the second injection, the mice were divided
into 3 groups: Group 1 received a single 70 mg/kg sub-cutaneous
injection of ISIS 126525 (uniform MOE antidote to ISIS 116847);
Group 2 received a single 70 mg/kg sub-cutaneous injection of ISIS
401769 (Uniform MOE antidote to Fas, used here as non-sense
control); and Group 3 received a sub-cutaneous injection of saline.
All injections were in a total volume of 200 .mu.l of sterile
saline. Samples were collected at 12 hours and 1, 2, 3, 7, and 14
days after antidote treatment.
[0234] Samples were processed as described above in Example 3.
Results are shown in FIGS. 4 and 5, below.
Example 7
Prothrombin Antisense and Antidote Oligonucleotides
[0235] An antisense compound complementary to prothrombin and
antidote compounds to that antisense compound were synthesized
using an Applied Biosystems 380B automated DNA synthesizer (Applied
Biosystems, Foster City, Calif.). Compound details are provided in
Table 4, below.
TABLE-US-00005 TABLE 4 Prothrombin antisense and antidote compounds
SEQ ISIS # Chemistry Motif Sequence Description ID 401025 5-10-5
MOE gap ATTCCATAGTGTAGGCCTT Prothrombin antisense 7 405277 5-10-5
MOE gap AAGGACCTACACTATGGAAT Antidote to 401025 8 405278 Uniform
MOE AAGGACCTACACTATGGAAT Antidote to 401025 8
Example 8
Prothrombin Antisense/Antidote Treatment of Mice
[0236] Eight week old Balb/c mice (Charles River Laboratories
(Willmingon, Mass.)) were injected sub-cutaneously with 30 mg/kg of
ISIS 401025 (5-10-5 MOE gapmer prothromin antisense) in a volume of
200 ml of saline or with 200 ml of saline (antisense control) twice
per week for three weeks (total of 6 injections).
[0237] Two days after the second injection, the mice were divided
into 7 groups and treated as summarized in Table 5, below. All
injections were subcutaneous and in a total volume of 200 .mu.l of
sterile saline.
TABLE-US-00006 TABLE 5 Prothrombin antisense and antidote compounds
Group Treatment Description 1 Single injection of 30 mg/kg 5-10-5
MOE gap antidote of 405277 2 Single injection of 60 mg/kg 5-10-5
MOE gap antidote of 405277 3 Single injection of 90 mg/kg 5-10-5
MOE gap antidote of 405277 4 Single injection of 30 mg/kg Uniform
MOE antidote of 405278 5 Single injection of 60 mg/kg Uniform MOE
antidote of 405278 6 Single injection of 90 mg/kg Uniform MOE
antidote of 405278 7 Single injection of saline Antidote
control
Example 9
Sample Collection
[0238] Three days after antidote (or saline control) treatment,
platelet poor plasma (PPP) was collected by cardiac puncture, as
follows. Mice were anesthetized and a 27 gage needle attached to a
1 ml syringe preloaded with 65 .mu.l of buffered citrate (0.06
Molar sodium citrate, pH 7.4) was inserted between the ribs and
into the heart. 0.6 ml of blood was quickly withdrawn, resulting in
a final ratio of nine parts whole blood to one part citrate buffer.
Mice were euthanized. The needle was removed from the syringe and
the blood/citrate buffer sample was emptied into a plastic tube
with a cap. That sample was immediately mixed by tapping and
inverting the capped tube. Within four hours of cardiac puncture,
the sample was centrifuged at 2000 rcg for 15 minutes at 22.degree.
C. and the top rough plasma was removed and placed in a new tube.
That rough plasma was centrifuged a second time, and the top layer
was removed and placed in a new tube. That PPP sample was aliquoted
and stored at -80.degree. C.
[0239] Immediately after euthinization, livers were collected and
total RNA was isolated from the livers using Rneasy mini kit
(Quiagen).
Example 10
Prothrombin RNA
[0240] Total RNA from the livers (Example 9) were analyzed by
RT-PCR. The forward primer for those reactions was:
AAGGGAATTTGGCTGTGACAA (SEQ ID NO. 9) and the reverse primer was:
ACTTGGGTCCCCCTGCCTGCCX (SEQ ID NO. 10). Results are shown in FIG.
6.
Example 11
Thrombin Generation
[0241] Platelet poor plasma samples from Example 9 were diluted 1:2
with saline and thrombin generation was measured using by Thrombin
Generation Assay (TGA) using a Technothrombin TGA kit (Technoclone,
Vienna Austria) following manufacturers instructions. Results are
shown in FIG. 7.
Example 12
Prothrombin Time (PT)/Activated Partial Thromboplastin Time
(aPTT)
[0242] Mouse PPP samples were assayed for PT and aPTT using an ACL
1000 coagulation analyzer (IL Instrumentation, Beckman Coulter,
Fullerton, Calif.) at 37.degree. C. The PT tests were initiated
using thromboplastin (Dade Thromboplastin C Plus, Dade Behring
Marburg GmbH, Germany) and the aPTT tests were performed by adding
ellagic acid mixture (APTT-XL, Pacific Hemostasis, Fisher
Diagnosis, Middletown Va.) and CaCl2. Pooled values obtained from
the mice treated with saline were used as basal PT and aPTT. PT INR
was calculated according to: INR=(PT/baseline PT)ISI, where ISI is
the international sensitivity index of the thromboplastin used.
Relative aPTT was calculated by dividing the measured values by
baseline values. Results are shown in FIGS. 8 and 9.
Example 13
Specificity of Prothrombin Antidote Effect
[0243] To test the sequence-specificity of the observed antidote
effect, the same antidote compounds were tested for their ability
to restore prothrombin following treatment with a non-complementary
antisense compound that also targets prothrombin. Compounds are
summarized in Table 6, below.
TABLE-US-00007 TABLE 6 Prothrombin antisense and non-corresponding
antidote compounds Chemistry SEQ ISIS # Motif Sequence Description
ID 401029 5-10-5 MOE GACAATCACTTTTATTGAGA Prothrombin 11 gap
antisense 405277 5-10-5 MOE AAGGACCTACACTATGGAAT Antidote to 8 gap
401025 405278 Uniform AAGGACCTACACTATGGAAT Antidote to 8 MOE
401025
[0244] Mice were treated and samples were obtained and assayed as
described above (Examples 8-12). The single sub-cutaneous
injections of 90 mg/kg of antidote compounds capable of reversing
the antisense activity of antisense compound 401025 (to which they
are complementary) did not reverse the antisense effect of
non-complementary antisense compound 401029. Results for
prothrombin RNA are shown in FIG. 10. Similar results were obtained
for PT-INR.
Example 14
Toxicity Studies
[0245] Toxicity of antidotes ISIS-403277 and 403728 was assessed by
testing serum from animals treated with those compounds for known
markers of toxicity. The toxicity profile of those compounds was
similar to those previously observed for similarly modified
oligonucleotides.
Example 15
In Vivo Sense-Oligonucleotide-Antidote for Antisense Inhibition of
Murine Factor XI in BALB/c Mice
Oligonucleotides
TABLE-US-00008 [0246] Chemistry SEQ ISIS # Motif Sequence
Description ID 404071 5-10-5 MOE TGGTAATCCACTTTCAGAGG Antisense
targeting 12 gap all PS Factor XI 404057 5-10-5 MOE
TCCTGGCATTCTCGAGCATT Antisense targeting 13 gap all PS Factor XI
418026 5-10-5 MOE CCTCTGAAAGTGGATTACCA Antidote to 14 gap all PS
404071
Treatment
[0247] The effects of antisense compounds directed to Factor XI and
an antidote were tested in BALB/c mice. In a first cohort, ISIS
404071 (antisense compound targeted to Factor XI) was administered
subcutaneously to BALB/c mice twice a week for three weeks at a
dose of 40 mg/kg. Forty-eight hours after the final treatment of
ISIS 404071, a single injection of PBS was administered
subcutaneously.
[0248] In a second cohort, ISIS 404071 (antisense compound targeted
to Factor XI) was administered subcutaneously to BALB/c mice twice
a week for three weeks at a dose of 40 mg/kg. Forty-eight hours
after the final treatment of ISIS 404071, a single injection of 90
mg/kg of ISIS 418026 (Antidote complementary to ISIS 404071) was
administered.
[0249] In a third cohort, ISIS 404057 (antisense compound targeted
to Factor XI) was administered subcutaneously to BALB/c mice twice
a week for three weeks at a dose of 40 mg/kg. Forty-eight hours
after the final treatment of ISIS 404057, a single injection of PBS
was administered subcutaneously.
[0250] In a fourth cohort, ISIS 404057 (antisense compound targeted
to Factor XI) was administered subcutaneously to BALB/c mice twice
a week for three weeks at a dose of 40 mg/kg. Forty-eight hours
after the final treatment of ISIS 404057, a single injection of 90
mg/kg of ISIS 418026 (Antidote complementary to ISIS 404071) was
administered.
[0251] Following antidote or PBS administration, a set of 4 mice
from each cohort were sacrificed at 12 hours, 1 day, 2 days, 3
days, 7 days, and 14 days. Whole liver was collected for RNA
analysis and PPP was collected for aPTT analysis.
RNA Analysis
[0252] RNA was extracted from liver tissue for real-time PCR
analysis of Factor XI. Results are presented as percent inhibition
of Factor XI, relative to PBS control. As shown in Table 7, mice
treated with ISIS 404071 without antidote showed progressive
decrease in inhibition over the 14 day observation period. However,
mice treated with ISIS 404071 and its antidote (ISIS 418026) showed
an accelerated decrease in inhibition over the 14 day observation
period in comparison to mice which did not receive antidote. Also
shown in Table 7, treatment with ISIS 418026 did not accelerate the
decrease in the antisense activity of ISIS 404057.
TABLE-US-00009 TABLE 7 Percent inhibition of mouse Factor XI mRNA
compared to PBS control 12 14 hours 1 day 2 days 3 days 7 days days
ISIS 404071 93 90 89 88 81 67 ISIS 404071 + 90 87 72 66 57 31 ISIS
418026 ISIS 404057 n.d. n.d. n.d. 95 n.d. n.d. ISIS 404057 + n.d.
n.d. n.d. 97 n.d. n.d. ISIS 418026 nd = no data
aPTT Assay
[0253] As shown in Table 8, mice treated with ISIS 404071 and
antidote (ISIS 418026) showed progressive decrease of aPTT over the
14 day observation period compared to mice treated with ISIS 404071
without antidote.
TABLE-US-00010 TABLE 8 Effect of antidote treatment on aPTT INR 12
hours 1 day 2 day 3 day 7 day 14 day ISIS 404071 1.51 1.30 1.35
1.27 1.18 1.05 ISIS 404071 + 1.45 1.23 1.16 1.15 1.10 0.95 ISIS
418026
Example 16
In Vivo Factor VIIa Protein-Antidote for Antisense Inhibition of
Murine Factor XI in BALB/c Mice
Treatment
[0254] The effect of human Factor VIIa protein as a non-oligomeric
antidote for ISIS 404071 was tested in BALB/c mice. Two
experimental groups of BALB/c mice were treated with 20 mg/kg of
ISIS 404071, administered subcutaneously twice a week for 3 weeks.
Two control groups of BALB/c mice were treated with PBS,
administered subcutaneously twice a week for 3 weeks. Thrombus
formation was induced with FeCl3 in all of the mice except the
first control group. Fifteen minutes before FeCl3 treatment, the
first experimental group was treated with 5 .mu.g/kg of human
Factor VIIa protein antidote (product no. 407act, American
Diagnostica Inc.). Two days after their last dose, all mice were
anesthetized with 150 mg/kg of ketamine mixed with 10 mg/kg of
xylazine administered by intraperitoneal injection.
[0255] In mice undergoing FeCl3 treatment, thrombus formation was
induced by applying a piece of filter paper (2.times.4 mm)
pre-saturated with 10% FeCl3 solution directly on the vena cava.
After 3 minutes of exposure, the filter paper was removed. Thirty
minutes after the filter paper application, a fixed length of the
vein containing the thrombus was dissected out for platelet
analysis.
Quantification of Platelet Composition
[0256] Real-time PCR quantification of platelet factor-4 (PF-4) was
used to quantify platelets in the vena cava as a measure of
thrombus formation. Results are presented as a percentage of PF-4
in antidote treated and untreated mice, as compared to the two
PBS-treated control groups. As shown in Table 9, animals treated
with human Factor VIIa protein antidote expressed more PF-4 in
comparison to animals treated with ISIS 404071 alone. These data
indicate that human Factor VIIa is successful in rescuing the
effect of antisense oligonucleotide inhibition.
TABLE-US-00011 TABLE 9 Analysis of thrombus formation by real-time
PCR quantification of PF-4 in the FeCl.sub.3 induced venous
thrombosis model Treatment PF-4 PBS - FeCl.sub.3 0 PBS + FeCl.sub.3
100 ISIS 404071 18 ISIS 404071 + hFV7a 68
Sequence CWU 1
1
14120DNAArtificial SequenceSynthetic Oligonucleotide 1tccagcactt
tcttttccgg 20220DNAArtificial SequenceSynthetic Oligonucleotide
2ccggaaaaga aagtgctgga 20320DNAArtificial SequenceSynthetic
Oligonucleotide 3tcgatctcct tttatgcccg 20420DNAArtificial
SequenceSynthetic Oligonucleotide 4ctgctagcct ctggatttga
20520DNAArtificial SequenceSynthetic Oligonucleotide 5tcaaatccag
aggctagcag 20620DNAArtificial SequenceSynthetic Oligonucleotide
6ccggaaaaga aagtgctgga 20719DNAArtificial SequenceSynthetic
Oligonucleotide 7attccatagt gtaggcctt 19820DNAArtificial
SequenceSynthetic Oligonucleotide 8aaggacctac actatggaat
20921DNAArtificial SequencePrimer 9aagggaattt ggctgtgaca a
211021DNAArtificial SequencePrimer 10acttgggtcc ccctgcctgc c
211120DNAArtificial SequenceSynthetic Oligonucleotide 11gacaatcact
tttattgaga 201220DNAArtificial SequenceSynthetic Oligonucleotide
12tggtaatcca ctttcagagg 201320DNAArtificial SequenceSynthetic
Oligonucleotide 13tcctggcatt ctcgagcatt 201420DNAArtificial
SequenceSynthetic Oligonucleotide 14cctctgaaag tggattacca 20
* * * * *