U.S. patent application number 13/914898 was filed with the patent office on 2013-11-07 for pyrazoloquinoline derivatives.
The applicant listed for this patent is Eisai R&D Management Co., Ltd.. Invention is credited to Koji Hagiwara, Yuki Ishihara, Yoshihiko Norimine, Nobuaki Sato, Yuichi Suzuki, Kunitoshi Takeda.
Application Number | 20130296352 13/914898 |
Document ID | / |
Family ID | 48043792 |
Filed Date | 2013-11-07 |
United States Patent
Application |
20130296352 |
Kind Code |
A1 |
Norimine; Yoshihiko ; et
al. |
November 7, 2013 |
PYRAZOLOQUINOLINE DERIVATIVES
Abstract
A compound and/or pharmacologically acceptable salt thereof
represented by the formula (I) has PDE9 inhibitory action, so that
the intracerebral cGMP concentration is anticipated to be elevated.
The PDE9 inhibitory action and the increase in cGMP lead to the
improvement of learning and memory behaviors, and the compound (I)
has applicability as a therapeutic agent for cognitive dysfunctions
in Alzheimer's disease. ##STR00001## wherein R.sup.1 is a hydrogen
atom; R.sup.2 is an aromatic ring group, etc.; R.sup.3 is a
hydrogen atom, etc; R.sup.4 is a hydrogen atom; R.sup.5 is an
oxepanyl group, etc.; R.sup.6 is a hydrogen atom.
Inventors: |
Norimine; Yoshihiko;
(Tsukuba, JP) ; Takeda; Kunitoshi; (Tsukuba,
JP) ; Hagiwara; Koji; (Tsukuba, JP) ; Suzuki;
Yuichi; (Tsukuba, JP) ; Ishihara; Yuki;
(Tsukuba, JP) ; Sato; Nobuaki; (Tsukuba,
JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Eisai R&D Management Co., Ltd. |
Tokyo |
|
JP |
|
|
Family ID: |
48043792 |
Appl. No.: |
13/914898 |
Filed: |
June 11, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13644745 |
Oct 4, 2012 |
|
|
|
13914898 |
|
|
|
|
61544860 |
Oct 7, 2011 |
|
|
|
61550623 |
Oct 24, 2011 |
|
|
|
61558110 |
Nov 10, 2011 |
|
|
|
61580903 |
Dec 28, 2011 |
|
|
|
Current U.S.
Class: |
514/274 ;
514/293 |
Current CPC
Class: |
A61P 25/28 20180101;
A61P 43/00 20180101; A61P 25/00 20180101; C07D 471/04 20130101 |
Class at
Publication: |
514/274 ;
514/293 |
International
Class: |
C07D 471/04 20060101
C07D471/04 |
Claims
1-20. (canceled)
21. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof a
compound represented by the formula (I) or a pharmacologically
acceptable salt thereof: ##STR00153## wherein R.sup.1 is a hydrogen
atom; R.sup.2 is an aromatic ring group selected from the group
consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl
group, where the two atoms on the aromatic ring which are adjacent
to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring
each independently has a substituent selected from Group A1, and
the other atoms on the aromatic ring independently optionally have
a substituent selected from Group B 1; R.sup.3 is a hydrogen atom,
or a fluorine atom; R.sup.4 is a hydrogen atom; R.sup.5 is an
oxepanyl group, a dioxepanyl group, a tetrahydropyranyl group, or a
tetrahydrofuranyl group optionally substituted with a methoxy
group; R.sup.6 is a hydrogen atom; Group A1 consists of a halogen
atom, a C1-6 alkyl group optionally substituted with 1 to 3 halogen
atoms, and a C1-6 alkoxy group; and Group B1 consists of a halogen
atom, a cyano group, a C1-6 alkyl group optionally substituted with
1 to 3 halogen atoms, a C1-6 alkoxy-C1-6 alkyl group, a C1-6 alkoxy
group optionally substituted with 1 to 3 halogen atoms, and a
tetrahydropyranyl group, with the proviso that when R.sup.2 is a
3-pyridinyl group, the substituent at the 4-position is a halogen
atom, or a C1-6 alkyl group optionally substituted with 1 to 3
halogen atoms.
22. The method of claim 21, wherein R.sup.2 is an aromatic ring
group selected from the group consisting of a phenyl group, a
3-pyridinyl group, a 4-pyridinyl group, and a 5-pyrimidinyl group,
where the two atoms on the aromatic ring which are adjacent to the
carbon atom attached to the pyrazolo[4,3-c]quinoline ring each
independently has a substituent selected from Group A2, and the
other atoms on the aromatic ring independently optionally have a
substituent selected from Group B2; R.sup.5 is a 4-oxepanyl group,
a 1,4-dioxepan-6-yl group, a 3,4,5,6-tetrahydro-2H-3-pyranyl group,
a 3,4,5,6-tetrahydro-2H-4-pyranyl group, or a 3-tetrahydrofuranyl
group; Group A2 consists of a chlorine atom, a methyl group
optionally substituted with 1 to 2 fluorine atoms, an ethyl group,
a methoxy group, and an ethoxy group; and Group B2 consists of a
fluorine atom, a chlorine atom, a cyano group, a methyl group
optionally substituted with 1 to 3 fluorine atoms, an ethyl group,
a methoxymethyl group, a methoxy group optionally substituted with
1 to 3 fluorine atoms, an ethoxy group, an isopropyloxy group, and
a 3,4,5,6-tetrahydro-2H-4-pyranyl group.
23. The method of claim 22, wherein R.sup.3 is a fluorine atom.
24. The method of claim 21, wherein R.sup.3 is a hydrogen atom; and
R.sup.5 is a tetrahydropyranyl group, or a tetrahydrofuranyl group
optionally substituted with a methoxy group.
25. The method of claim 22, wherein R.sup.3 is a hydrogen atom; and
R.sup.5 is a 3,4,5,6-tetrahydro-2H-3-pyranyl group, a
3,4,5,6-tetrahydro-2H-4-pyranyl group, or a 3-tetrahydrofuranyl
group.
26. The method of claim 21, wherein R.sup.2 is an aromatic ring
group selected from the group consisting of a phenyl group, a
3-pyridinyl group, and a 4-pyridinyl group, where the two atoms on
the aromatic ring which are adjacent to the carbon atom attached to
the pyrazolo[4,3-c]quinoline ring each independently has a
substituent selected from Group A3, and the other atoms on the
aromatic ring independently optionally have a substituent selected
from Group B3; R.sup.3 is a hydrogen atom; R.sup.4 is a hydrogen
atom; R.sup.5 is a 3,4,5,6-tetrahydro-2H-4-pyranyl group, or a
3-tetrahydrofuranyl group; Group A3 consists of a methyl group, and
a methoxy group; and Group B3 consists of a methyl group, a methoxy
group, and a methoxymethyl group.
27. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof a
compound selected from the group consisting of: 1)
7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, 2)
7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, 3)
(S)-7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one, 4)
8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one, 5)
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one, 6)
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one, 7)
(S)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one, 8)
7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, 9)
(-)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, 10)
(-)-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, 11)
(S)-8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one, 12)
(S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one, 13)
(S)-8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one, and 14)
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, or a pharmacologically acceptable
salt of any of the aforementioned.
28. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-p-
yrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable
salt thereof.
29. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
(S)-7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically
acceptable salt thereof ##STR00154##
30. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically
acceptable salt thereof.
31. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
(S)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically
acceptable salt thereof: ##STR00155##
32. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4 (5H)-one or a pharmacologically acceptable salt
thereof.
33. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable
salt thereof: ##STR00156##
34. A method for improving cognitive impairment in Alzheimer's
disease, comprising administering to a patient in need thereof
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable salt
thereof: ##STR00157##
35. A method for increasing intracerebral cGMP concentration,
comprising administering to a patient in need thereof a compound
represented by the formula (I) or a pharmacologically acceptable
salt thereof: ##STR00158## wherein R.sup.1 is a hydrogen atom;
R.sup.2 is an aromatic ring group selected from the group
consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl
group, where the two atoms on the aromatic ring which are adjacent
to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring
each independently has a substituent selected from Group A1, and
the other atoms on the aromatic ring independently optionally have
a substituent selected from Group B 1; R.sup.3 is a hydrogen atom,
or a fluorine atom; R.sup.4 is a hydrogen atom; R.sup.5 is an
oxepanyl group, a dioxepanyl group, a tetrahydropyranyl group, or a
tetrahydrofuranyl group optionally substituted with a methoxy
group; R.sup.6 is a hydrogen atom; Group A1 consists of a halogen
atom, a C1-6 alkyl group optionally substituted with 1 to 3 halogen
atoms, and a C1-6 alkoxy group; and Group B 1 consists of a halogen
atom, a cyano group, a C1-6 alkyl group optionally substituted with
1 to 3 halogen atoms, a C1-6 alkoxy-C1-6 alkyl group, a C1-6 alkoxy
group optionally substituted with 1 to 3 halogen atoms, and a
tetrahydropyranyl group, with the proviso that when R.sup.2 is a
3-pyridinyl group, the substituent at the 4-position is a halogen
atom, or a C1-6 alkyl group optionally substituted with 1 to 3
halogen atoms.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of the following
applications: U.S. provisional application No. 61/544,860 filed on
Oct. 7, 2011, U.S. provisional application No. 61/550,623 filed on
Oct. 24, 2011, U.S. provisional application No. 61/558,110 filed on
Nov. 10, 2011, and U.S. provisional application No. 61/580,903
filed on Dec. 28, 2011, the disclosures of all of which are herein
incorporated by reference in their entireties.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to pyrazoloquinoline
derivatives having inhibitory activity against phosphodiesterase 9
(PDE9), and pharmacologically acceptable salts thereof, and
pharmaceutical applications thereof.
[0004] 2. Related Background of the Invention
[0005] Cyclic guanosine monophosphate (hereinafter, referred to as
cGMP) functioning as a second messenger in cells is known to play
an important role in various physiological functions including
learning and memory behaviors.
[0006] On the postsynaptic site of the brain neural circuits,
nitrogen monoxide (hereinafter, referred to as NO) biosynthesized
by a nitrogen monoxide synthetase activates a guanylate cyclase,
which is a cGMP synthetase. The activated guanylate cyclase
biosynthesizes cGMP from guanosine triphosphate. The cGMP activates
a cGMP-dependent protein kinase (hereinafter, referred to as PKG)
to phosphorylate various proteins participating in synapse
plasticity. The activation of the NO/cGMP/PKG cascade is known to
participate in the induction of synapse plasticity (Long Term
Potentiation; hereinafter, referred to as LTP) of the hippocampus
known as a neural substrate for learning and memory behaviors (for
example, see Non Patent Literature 1). A medicine activating the
signal transmission of the cascade is known to improve LIP of the
hippocampus and the learning behavior of animals, while a medicine
inhibiting the cascade is known to exhibit the opposite action (Non
Patent Literature 2). Therefore, from these findings, an increase
in cGMP in the brain is anticipated to lead to an improvement of
learning and memory behaviors.
[0007] cGMP is metabolized to 5'-GMP having no PKG activation
action by a phosphodiesterase (hereinafter, referred to as PDE).
The PDE is known to have 11 families, and PDE9 is known to
metabolize specifically cGMP, and to be expressed in the brain, the
spleen, the small intestine and the like (for example, see Non
Patent Literature 3). That is, inhibition of PDE9 is anticipated to
increase cGMP in brains. It is reported that a PDE9 inhibitor
actually enhances hippocampus LTP, and improves the learning and
memory behaviors in a novel-object recognition test/passive
avoidance learning test or the like in animals (Non Patent
Literature 4). Clinically, guanylate cyclase activity decreases and
possibility of a decrease in the cGMP level is indicated in the
superior temporal cortex of Alzheimer's disease patients, (Non
Patent Literature 5). Therefore, the PDE9 has a possibility of
having many close relations with pathologies of neurodegenerative
diseases and psychiatric diseases, particularly with pathologies of
cognitive dysfunctions and the like in the Alzheimer's disease,
such as Alexander's disease, Alpers' disease, Alzheimer's disease,
amyotrophic lateral sclerosis (ALS; known as Lou Gehrig's disease
or motor neuron disease), ataxia-telangiectasia, Batten's disease
(known also as Spielmeyer-Vogt-Sjogren-Batten's disease),
Binswanger's dementia (subcortical angiosclerotic encephalopathy),
bipolar disorder, bovine spongiform encephalopathy (BSE), Canavan's
disease, chemotherapy induction dementia, Cockayne's syndrome,
corticobasal degeneration, Creutzfeldt-Jakob's disease, depression,
Down's syndrome, frontotemporal lobe degeneration (including
frontotemporal dementia, semantic dementia and progressive
nonfluent aphasia), Gerstmann-Straussler-Scheinker's disease,
glaucoma, Huntington's disease (chorea), ITV related dementia,
hyperkinesis, Kennedy's disease, Korsakoff's syndrome (amnesic
confabulation syndrome), Krabbe's disease, Lewy-bodies dementia,
progressive logopenic aphasia, Machado-Joseph's disease
(spinocerebellar ataxia type 3), multiple sclerosis, multiple
atrophy (olivopontocerebellar atrophy), myasthenia gravis,
Parkinson's disease, Pelizaeus-Merzbacher's disease, Pick's
disease, dementia presenilis (slight cognitive impairment), primary
lateral sclerosis, primary progressive aphasia, radiation-induced
dementia, Refsum's disease (phytanic acid storage disease),
Sandhoff's disease, Schilder's disease, schizophrenia, semantic
dementia, senile dementia, Shy-Drager syndrome, spinocerebellar
ataxia, spinal muscle atrophy, Steele-Richardson-Olszewski's
disease (progressive supranuclear palsy), and vascular amyloidosis
and vascular dementia (multiple infarct dementia).
[0008] Recently, the following compound has been known which has
PDE9 inhibitory activity and has a purpose of prevention or therapy
of Alzheimer's disease (Patent Literature 1).
##STR00002##
[0009] The above compound is a pyrazolopyrimidine derivative, and a
compound having a structure totally different from a
pyrazoloquinoline skeleton.
[0010] On the other hand, as a compound having a pyrazoloquinoline
skeleton, the following compound described in Patent Literature 2
is known.
##STR00003##
wherein a ring A is a benzene ring or the like; and R.sup.6 is a
direct bond or the like.
[0011] However, a ring B in the above compound denotes a benzene
ring or the like. Although it is stated that the above compound has
inhibitory activity against PDE4 and is used for various types of
inflammatory diseases, there is no description nor implication of
the inhibitory activity against PDE9, and the like.
[0012] As compounds having PDE9 inhibitory activity, the following
compounds described in Patent Literature 3 and Patent Literature 4
are known.
##STR00004##
[0013] Any of the above compounds is a quinoxaline derivative, and
is a compound having a structure totally different from a
pyrazoloquinoline skeleton.
[0014] As a compound having a pyrazoloquinoline skeleton and having
PDE9 inhibitory activity, the following compound described in
Patent Literature 5 is known.
##STR00005##
wherein either R.sup.1 or R.sup.2 is a group represent by the
formula
##STR00006##
[0015] The structure of the above compound is restricted in R.sup.1
and R.sup.2, thus the compound is a compound having a structure
totally different from the compound of the present invention.
[0016] [Patent Literature 1] WO 2008/139293 [0017] [Patent
Literature 2] WO 2007/032466 [0018] [Patent Literature 3] WO
2008/072779 [0019] [Patent Literature 4] WO 2010/101230 [0020]
[Patent Literature 5] WO 2012/033144 [0021] [Non Patent Literature
1] Domek-Lopacinska et al., "Cyclic GMP metabolism and its role in
brain physiology", J Physiol Pharmacol., vol. 56, Suppl 2: pp.
15-34, 2005 [0022] [Non Patent Literature 2] Wang X., "Cyclic
GMP-dependent protein kinase and cellular signaling in the nervous
system", J. Neurocem., vol. 68, pp. 443-456, 1997 [0023] [Non
Patent Literature 3] Fisher et al., "Isolation and characterization
of PDE9A, a novel human cGMP-specific phosphodiesterase", J. Biol.
Chem., vol. 273: pp. 15559-15564, 1998 [0024] [Non Patent
Literature 4] van der Staay et al., "The novel selective PDE9
inhibitor BAY 73-6691 improves learning and memory in rodents",
Neuropharmacology, vol. 55: pp. 908-918, 2008 [0025] [Non Patent
Literature 5] Bonkale et al., "Reduced nitric oxide responsive
soluble guanylyl cyclase activity in the superior temporal cortex
of patients with Alzheimer's disease", Neurosci. Lett., vol 187,
pp. 5-8, 1995
SUMMARY OF THE INVENTION
[0026] It is an object of the present invention to provide a novel
compound or pharmacologically acceptable salt thereof having PDE9
inhibitory action, and a pharmaceutical composition containing the
same.
[0027] As a result of exhaustive studies to solve the
above-mentioned problems, the present inventors have found a novel
pyrazoloquinoline derivative or pharmacologically acceptable salt
thereof having PDE9 inhibitory action.
[0028] That is, the present invention relates to the following
<1> to <20>.
<1> A compound and/or pharmacologically acceptable salt
thereof represented by the formula (I):
##STR00007##
wherein
[0029] R.sup.1 is a hydrogen atom;
[0030] R.sup.2 is an aromatic ring group selected from the group
consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl
group, where the two atoms on the aromatic ring which are adjacent
to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring
each independently has a substituent selected from Group A1, and
the other atoms on the aromatic ring independently optionally have
a substituent selected from Group B1;
[0031] R.sup.3 is a hydrogen atom, or a fluorine atom;
[0032] R.sup.4 is a hydrogen atom;
[0033] R.sup.5 is an oxepanyl group, a dioxepanyl group, a
tetrahydropyranyl group, or a tetrahydrofuranyl group optionally
having a methoxy group;
[0034] R.sup.6 is a hydrogen atom;
[0035] Group A1 consists of a halogen atom, a C1-6 alkyl group
optionally having 1 to 3 halogen atoms, and a C1-6 alkoxy group;
and
[0036] Group B1 consists of a halogen atom, a cyano group, a C1-6
alkyl group optionally having 1 to 3 halogen atoms, a C1-6
alkoxy-C1-6 alkyl group, a C1-6 alkoxy group optionally having 1 to
3 halogen atoms, and a tetrahydropyranyl group,
[0037] with the proviso that when R.sup.2 is a 3-pyridinyl group,
the substituent at the 4-position is a halogen atom, or a C1-6
alkyl group optionally having 1 to 3 halogen atoms.
<2> The compound and/or pharmacologically acceptable salt
thereof according to <1>, wherein
[0038] R.sup.2 is an aromatic ring group selected from the group
consisting of a phenyl group, a 3-pyridinyl group, a 4-pyridinyl
group, and a 5-pyrimidinyl group, where the two atoms on the
aromatic ring which are adjacent to the carbon atom attached to the
pyrazolo[4,3-c]quinoline ring each independently has a substituent
selected from Group A2, and the other atoms on the aromatic ring
independently optionally have a substituent selected from Group
B2;
[0039] R.sup.5 is a 4-oxepanyl group, a 1,4-dioxepan-6-yl group, a
3,4,5,6-tetrahydro-2H-3-pyranyl group, a
3,4,5,6-tetrahydro-2H-4-pyranyl group, or a 3-tetrahydrofuranyl
group;
[0040] Group A2 consists of a chlorine atom, and a methyl group
optionally having 1 to 2 fluorine atoms, an ethyl group, a methoxy
group, and an ethoxy group; and
[0041] Group B2 consists of a fluorine atom, a chlorine atom, a
cyano group, a methyl group optionally having 1 to 3 fluorine
atoms, an ethyl group, a methoxymethyl group, a methoxy group
optionally having 1 to 3 fluorine atoms, an ethoxy group, an
isopropyloxy group, and a 3,4,5,6-tetrahydro-2H-4-pyranyl
group.
<3> The compound and/or pharmacologically acceptable salt
thereof according to <2>, wherein R.sup.3 is a fluorine atom.
<3.1> The compound and/or pharmacologically acceptable salt
thereof according to <3>, wherein R.sup.5 is a
3,4,5,6-tetrahydro-2H-4-pyranyl group, or a 3-tetrahydrofuranyl
group. <4> The compound and/or pharmacologically acceptable
salt thereof according to <1>, wherein
[0042] R.sup.3 is a hydrogen atom; and
[0043] R.sup.5 is a tetrahydropyranyl group, or a tetrahydrofuranyl
group optionally having a methoxy group.
<5> The compound and/or pharmacologically acceptable salt
thereof according to <2>, wherein
[0044] R.sup.3 is a hydrogen atom; and
[0045] R.sup.5 is a 3,4,5,6-tetrahydro-2H-3-pyranyl group, a
3,4,5,6-tetrahydro-2H-4-pyranyl group, or a 3-tetrahydrofuranyl
group.
<6> The compound and/or pharmacologically acceptable salt
thereof according to <1>, wherein
[0046] R.sup.2 is an aromatic ring group selected from the group
consisting of a phenyl group, a 3-pyridinyl group, and a
4-pyridinyl group, where the two atoms on the aromatic ring which
are adjacent to the carbon atom attached to the
pyrazolo[4,3-c]quinoline ring each independently has a substituent
selected from Group A3, and the other atoms on the aromatic ring
independently optionally have a substituent selected from Group
B3;
[0047] R.sup.3 is a hydrogen atom;
[0048] R.sup.4 is a hydrogen atom;
[0049] R.sup.5 is a 3,4,5,6-tetrahydro-2H-4-pyranyl group, or a
3-tetrahydrofuranyl group;
[0050] Group A3 consists of a methyl group, and a methoxy group;
and
[0051] Group B3 consists of a methyl group, a methoxy group, and a
methoxymethyl group.
<7> A compound and/or pharmacologically acceptable salt
thereof selected from the following group: [0052] 1)
7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, [0053] 2)
7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, [0054] 3)
(S)-7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one, [0055] 4)
8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one, [0056] 5)
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(51-1)-one, [0057] 6)
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one, [0058] 7)
(S)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one, [0059] 8)
7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, [0060] 9)
(-)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, [0061] 10)
(-)-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one, [0062] 11)
(S)-8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one [0063] 12)
(S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one [0064] 13)
(S)-8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one and [0065] 14)
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(51-1)-one. <8>
7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-p-
yrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof. <9>
(S)-7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof
##STR00008##
[0065] <10>
8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof. <11>
(S)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof:
##STR00009##
<12>
7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically acceptable
salt thereof. <13>
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof:
##STR00010##
<14>
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one and/or a pharmacologically acceptable salt
thereof.
##STR00011##
<14.1>
8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof. <14.2>
(S)-8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof.
##STR00012##
<14.3>
8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof. <14.4>
(S)-8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(51-1)-one and/or a
pharmacologically acceptable salt thereof
##STR00013##
<14.5>
7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazol-
o[4,3-c]quinolin-4(5H)-one and/or a pharmacologically acceptable
salt thereof. <14.6>
(S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one and/or a pharmacologically
acceptable salt thereof:
##STR00014##
<15> A pharmaceutical composition comprising the compound
and/or pharmacologically acceptable salt thereof according to
<1> as an active ingredient. <16> The pharmaceutical
composition according to <15> which is a PDE9 inhibitor.
<17> The pharmaceutical composition according to <15>
for increasing the intracerebral cGMP concentration. <18> A
cognitive impairment improving agent in Alzheimer's disease,
comprising the compound and/or pharmacologically acceptable salt
thereof according to <1>. <19> A method for improving
cognitive impairment in Alzheimer's disease, comprising
administering the compound and/or pharmacologically acceptable salt
thereof according to <1> to a patient. <20> The
compound or pharmacologically acceptable salt thereof according to
<1> for use for improving cognitive impairment in Alzheimer's
disease.
[0066] The pyrazoloquinoline derivative (hereinafter, referred to
as a compound (I)) represented by the formula (I) or
pharmacologically acceptable salt thereof according to the present
invention has PDE9 inhibitory action as shown in activity data in
Pharmacological Test Example described later. The compound (I)
according to the present invention mostly exhibits an IC.sub.50
value of 1,000 nM or below as the PDE9 inhibitory action, and a
compound exhibiting an IC.sub.50 value of 100 nM or below is
preferable.
[0067] The compound (I) according to the present invention has PDE9
inhibitory action, so that the intracerebral cGMP concentration is
anticipated to be elevated. The PDE9 inhibitory action and the
increase in cGMP lead to the improvement of learning and memory
behaviors, and the compound (I) has applicability as a therapeutic
agent for cognitive dysfunctions and the like in Alzheimer's
disease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0068] FIG. 1 is a view showing a three-dimensional structure
obtained by X-ray diffraction of the compound obtained in
Preparation Example 53.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0069] Hereinafter, the content of the present invention will be
described in detail.
[0070] Throughout the present specification, the structural
formulas for the compounds will show only one specific isomer for
convenience, but the invention includes all isomers such as
geometric isomers, optical isomers, stereoisomers and tautomers
implied by the compound structures, as well as their isomer
mixtures, and the compounds may therefore be any of the isomers or
mixtures thereof in any desired proportion, without being limited
to the formulas that are shown for convenience. Thus, for example,
the compounds of the invention may exist as optically active forms
or racemic mixtures, all of which are included without limitations
according to the invention, and whether racemic mixtures or
optically active forms, they may be used as mixtures with the
optically active forms in any desired proportion. It will be
understood, however, that some isomers or racemates or other
mixtures of isomers may exhibit more activity than others.
[0071] Polymorphic crystals may also exist, and there may be used
any crystal form or a mixture thereof without any restrictions, as
well as amorphous forms, and the compounds of the invention also
include both anhydrate and solvate (especially hydrate).
[0072] Compounds of the compound (I) labeled with isotopes are also
included in the present invention. A compound labeled with an
isotope is the same as the compound (D, except that one or more
atoms are replaced by atoms having atomic masses or mass numbers
different from those usually found in the natural world. Isotopes
which can be incorporated in the compound according to the present
invention are isotopes of, for example, hydrogen, carbon, nitrogen,
oxygen, fluorine, phosphorus, sulfur, iodine, and chlorine, and
include .sup.2H, .sup.3H, .sup.11C, .sup.14C, .sup.15N, .sup.18O,
.sup.18F, .sup.32P, .sup.35S, .sup.123I and .sup.125I.
[0073] The above isotope-labeled compounds, for example, compounds
in which radioisotopes such as .sup.3H, and/or .sup.14C are
incorporated, are useful for the tissue distribution assay of
medicines and/or substrates. .sup.3H and .sup.14C are considered to
be useful for ease of the preparation and detection thereof.
Isotopes .sup.11C and .sup.18F are considered to be useful for PET
(positron-emission tomography); and an isotopes .sup.125I is
considered to be useful for SPECT (single photon emission computed
tomography); and all are useful for brain imaging. The replacement
by a heavier isotope such as .sup.3H causes some type of
therapeutic advantages including an increase in the in-vivo
half-life period or a decrease in the necessary dose due to higher
metabolic stability, and therefore, is considered to be useful
under some situation. The above isotope-labeled compounds can be
similarly prepared by carrying out procedures disclosed in the
following Examples by using reagents labeled with isotopes easily
utilizable in place of reagents not labeled with an isotope.
[0074] Hereinafter, the meanings of terms, symbols and the like
described in the present specification will be described, and the
present invention will be described in detail.
[0075] A "halogen atom" in the present specification means a
fluorine atom, a chlorine atom, a bromine atom or an iodine atom.
Suitable examples of the "halogen atom" include a fluorine atom and
a chlorine atom.
[0076] A "C1-6 alkyl group" in the present specification means a
straight-chain or branched-chain alkyl group having 1 to 6 carbon
atoms, and specific examples include a methyl group, an ethyl
group, a 1-propyl group, a isopropyl group, a 2-methyl-1-propyl
group, a 2-methyl-2-propyl group, a 1-butyl group, a 2-butyl group,
a 1-pentyl group, a 2-pentyl group, a 3-pentyl group, a 1-hexyl
group, a 2-hexyl group and a 3-hexyl group.
[0077] A "C1-6 alkoxy group" in the present specification means an
oxygen atom to which a "C1-6 alkyl group" defined in the above is
attached, and specific examples include a methoxy group, an ethoxy
group, a isopropyloxy group, a 1-pentyloxy group and a 1-hexyloxy
group.
[0078] A "C1-6 alkoxy-C1-6 alkyl group" in the present
specification means a "C1-6 alkyl group" defined in the above to
which a "C1-6 alkoxy group" defined in the above is attached, and
specific examples include a methoxymethyl group, a 1-methoxyethyl
group, a 2-methoxyethyl group, a 1-methoxypropyl group, a
2-methoxypropyl group, a 3-methoxypropyl group, a
2-methoxy-2-propyl group, a (1-propyloxy)methyl group, an
(isopropyloxy)methyl group, a 1-(1-propyloxy)ethyl group, a
2-(1-propyloxy)ethyl group, a 1-(isopropyloxy)ethyl group, a
2-(isopropyloxy)ethyl group, a 1-(1-propyloxy)propyl group, a
2-(1-propyloxy)propyl group, a 3-(1-propyloxy)propyl group, a
2-(1-propyloxy)-2-propyl group, a 1-(isopropyloxy)propyl group, a
2-(isopropyloxy)propyl group, a 3-(isopropyloxy)propyl group, and a
2-(isopropyloxy)-2-propyl group.
[0079] In the definition of R.sup.2, "an aromatic ring group
selected from the group consisting of a phenyl group, a pyridinyl
group, and a pyrimidinyl group, where the two atoms on the aromatic
ring which are adjacent to the carbon atom attached to the
pyrazolo[4,3-c]quinoline ring each independently has a substituent
selected from Group A1, and the other atoms on the aromatic ring
independently optionally have a substituent selected from Group B1"
means:
##STR00015##
wherein
[0080] X.sup.2 to X.sup.4 is a carbon atom or a nitrogen atom to
form a phenyl group, a pyridinyl group, or a pyrimidinyl group;
[0081] when X.sup.n (n=2 to 4) is a nitrogen atom, R.sup.xn is not
present; and when X.sup.n (n=2 to 4) is a carbon atom, R.sup.xn is
a hydrogen atom or a substituent selected from Group B1, and
R.sup.x1 and R.sup.x5 is independently a substituent selected from
Group A1.
[0082] The definitions of R.sup.1 to R.sup.6 of the compound
represented by the formula (I), and preferable examples will be
described hereinafter.
[0083] R.sup.1 is a hydrogen atom.
[0084] R.sup.2 is an aromatic ring group selected from the group
consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl
group, where the two atoms on the aromatic ring which are adjacent
to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring
each independently has a substituent selected from Group A1, and
the other atoms on the aromatic ring independently optionally have
a substituent selected from Group B1.
[0085] R.sup.2 is preferably an aromatic ring group selected from
the group consisting of a phenyl group, a 3-pyridinyl group, a
4-pyridinyl group, and a 5-pyrimidinyl group, where the two atoms
on the aromatic ring which are adjacent to the carbon atom attached
to the pyrazolo[4,3-c]quinoline ring each independently has a
substituent selected from Group A2, and the other atoms on the
aromatic ring independently optionally have a substituent selected
from Group B2
[0086] R.sup.2 is more preferably an aromatic ring group selected
from the group consisting of a phenyl group, a 3-pyridinyl group,
and a 4-pyridinyl group, where the two atoms on the aromatic ring
which are adjacent to the carbon atom attached to the
pyrazolo[4,3-c]quinoline ring each independently has a substituent
selected from Group A3, and the other atoms on the aromatic ring
independently optionally have a substituent selected from Group
B3.
[0087] R.sup.3 is a hydrogen atom, or a fluorine atom.
[0088] R.sup.4 is a hydrogen atom.
[0089] R.sup.5 is an oxepanyl group, a dioxepanyl group, a
tetrahydropyranyl group, or a tetrahydrofuranyl group optionally
having a methoxy group.
[0090] R.sup.5 is preferably a 4-oxepanyl group, a
1,4-dioxepan-6-yl group, a 3,4,5,6-tetrahydro-2H-3-pyranyl group, a
3,4,5,6-tetrahydro-2H-4-pyranyl group, or a 3-tetrahydrofuranyl
group, and more preferably is a 3,4,5,6-tetrahydro-2H-4-pyranyl
group, or a 3-tetrahydrofuranyl group.
[0091] R.sup.6 is a hydrogen atom.
[0092] Group A1 consists of a halogen atom, a C1-6 alkyl group
optionally having 1 to 3 halogen atoms, and a C1-6 alkoxy
group.
[0093] Group B1 consists of a halogen atom, a cyano group, a C1-6
alkyl group optionally having 1 to 3 halogen atoms, a C1-6
alkoxy-C1-6 alkyl group, a C1-6 alkoxy group optionally having 1 to
3 halogen atoms, and a tetrahydropyranyl group.
[0094] Group A2 consists of a chlorine atom, and a methyl group
optionally having 1 to 2 fluorine atoms, an ethyl group, a methoxy
group, and an ethoxy group.
[0095] Group B2 consists of a fluorine atom, a chlorine atom, a
cyano group, a methyl group optionally having 1 to 3 fluorine
atoms, an ethyl group, a methoxymethyl group, a methoxy group
optionally having 1 to 3 fluorine atoms, an ethoxy group, an
isopropyloxy group, and a 3,4,5,6-tetrahydro-2H-4-pyranyl
group.
[0096] Group A3 consists of a methyl group, and a methoxy
group.
[0097] Group B3 consists of a methyl group, a methoxy group, and a
methoxymethyl group.
[0098] A "pharmacologically acceptable salt" in the present
specification is not especially limited as long as a salt formed
with the compound according to the present invention, and specific
examples include inorganic acid salts, organic acid salts,
inorganic base salts, organic base salts, and acidic or basic amino
acid salts.
[0099] If only a "pharmacologically acceptable salt" in the present
specification is a salt formed in a suitable ratio unless there is
any especially limiting description, the number of acid molecules
per one molecule of the compound in a formed salt, although being
not especially limited, is preferably about 0.1 to about 5
molecules, more preferably about 0.5 to about 2 molecules, and
still more preferably about 0.5, about 1 or about 2 molecules, per
one molecule of the compound.
[0100] Preferable examples of inorganic acid salts include
hydrochlorides, hydrobromides, sulfates, nitrates and phosphates,
and preferable examples of organic acid salts include acetates,
succinates, fumarates, maleates, tartrates, citrates, lactates,
stearates, benzoates, methanesulfonates, p-toluenesulfonates and
benzenesulfonates.
[0101] Preferable examples of inorganic base salts include alkaline
metal salts such as sodium salts and potassium salts, alkaline
earth metal salts such as calcium salts and magnesium salts,
aluminum salts, and ammonium salts, and preferable examples of
organic base salts include diethylamine salts, diethanolamine
salts, meglumine salts and N,N-dibenzylethylenediamine salts.
[0102] Preferable examples of acidic amino acid salts include
aspartates and glutamates, and preferable examples of basic amino
acid salts include arginine salts, lysine salts and ornithine
salts.
[0103] [General Production Methods]
[0104] The compound according to the present invention can be
produced by methods described in the below. However, production
methods of the compound according to the present invention are not
limited thereto.
[0105] The compound (I) according to the present invention can be
produced by the following production methods A, B. C and D.
[0106] <Production Method A>
##STR00016##
wherein R.sup.1, R.sup.3, R.sup.4, R.sup.5 and R.sup.6 each have
the same definitions as the above definitions; P.sup.1 means a
protecting group of an NH group, such as 2,4-dimethoxybenzyl group;
and X.sup.1 and X.sup.2 denote a halogen atom.
Step A-1
[0107] This step is a step of condensation reaction of a compound
represented by the formula a-1 (referred to as a compound a-1 in
some cases; hereinafter, the same applies) with DMF-DMA, and
thereafter allowing the resultant to react with a hydrazine
derivative a-2 to structure a pyrazole ring to thereby obtain a
compound a-3, by a well-known method. The present reaction may be
carried out in a gas flow or an atmosphere of an inert gas such as
nitrogen or argon.
[0108] The compound a-1 can be synthesized according to a
well-known method (for example, the description in Reuman, Michael
et al., "Journal of Medicinal Chemistry", 1995, vol. 38, p.
2531-2540, or Wentland Mark P et al., "Journal of Medicinal
Chemistry", 1993, vol. 36, p. 1580-1596).
[0109] This step can be carried out specifically with reference to
the reaction condition, post-reaction operation, purifying method
and the like described in Preparation Examples 1, 2, 3, 4, 5, 6, 10
and 11 described later and the like.
[0110] As the compound a-2, a commercially available one as it is
may be used, or may be synthesized by means well-known by those
skilled in the art. The compound can be produced by converting a
corresponding ketone derivative to a hydrazideimine, and reducing
the hydrazideimine using borane, sodium cyanoborohydride or the
like. The compound a-2 may also be used in a form a salt such as a
hydrochloride.
[0111] With respect to a solvent used in the present reaction, in
the condensation reaction of the compound a-1 with DMF-DMA, the
DMF-DMA can be used in 5 to 20 times molar equivalent as a reaction
agent and concurrently solvent. A solvent used in the successive
pyrazole ring formation reaction with the hydrazine derivative a-2
is not especially limited as long as it is a solvent which
dissolves reaction starting raw materials to some degree, and does
not inhibit the reaction, but is suitably methanol, ethanol,
n-butanol, t-butanol, THF, 1,4-dioxane, water or a mixed solvent
thereof and more suitably ethanol.
[0112] The reaction temperature usually depends on starting raw
materials, solvents to be used, and other reagents and the like
used in the reaction. In the condensation reaction of the compound
a-1 with DMF-DMA, the reaction temperature is suitably 0.degree. C.
to a reflux temperature of the solvent (internal temperature of a
reaction vessel), and more suitably room temperature. In the
successive pyrazole ring formation reaction with the hydrazine
derivative a-2, the reaction temperature is suitably room
temperature to a reflux temperature of the solvent (internal
temperature of a reaction vessel), and more suitably 70.degree. C.
to a reflux temperature of the solvent.
[0113] The reaction time usually depends on starting raw materials,
solvents to be used, and other reagents and the like used in the
reaction. In the condensation reaction of the compound a-1 with
DMF-DMA, the reaction time is suitably 0.5 to 24 hours, and more
suitably 1 to 3 hours, at the above temperature after the addition
of the reagents. In the successive pyrazole ring formation reaction
with the hydrazine derivative a-2, the reaction time is suitably
0.5 to 24 hours, and more suitably 1 to 8 hours, at the above
temperature after the addition of the reagents.
[0114] Step A-2
[0115] This step is a step of hydrolyzing the compound a-3 in the
presence of a base to thereby obtain a compound a-4.
[0116] A solvent used in the present reaction is not especially
limited as long as it is a solvent which dissolves starling raw
materials to some degree, and does not inhibit the reaction, but
suitably includes methanol, ethanol, n-butanol, t-butanol, THF,
1,4-dioxane, water or mixed solvents thereof.
[0117] The base depends on starting raw materials, solvents to be
used and the like, and is not especially limited, but examples
thereof include sodium hydroxide, lithium hydroxide, potassium
hydroxide, lithium carbonate, sodium carbonate, potassium
carbonate, sodium hydrogencarbonate, potassium carbonate, cesium
carbonate, lithium tetramethylsilyl oxide (TMSOLi). A base can be
used in 1 to 10 times molar equivalent with respect to the a-3.
[0118] The reaction temperature usually depends on starting raw
materials, solvents to be used, and other reagents and the like
used in the reaction, and is suitably 0.degree. C. to a reflux
temperature of the solvent (internal temperature of a reaction
vessel), and more suitably room temperature to 50.degree. C.
[0119] The reaction time usually depends on starting raw materials,
solvents to be used, and other reagents and the like used in the
reaction, and is suitably 1 to 48 hours, and more suitably 2 to 12
hours, at the above temperature after the addition of the
reagents.
[0120] Step A-3
[0121] This step is a step of allowing the compound a-4 to react
with an amine derivative a-5 by using a condensing agent to thereby
obtain a compound a-6. The present reaction may be carried out also
in a gas flow or an atmosphere of an inert gas such as nitrogen or
argon.
[0122] This step can be carried out specifically with reference to
the reaction condition, post-reaction operation, purifying method
and the like described in Preparation Example 1, 2, 4 and 5
described later and the like.
[0123] The condensing agent depends on starting raw materials,
solvents to be used and the like, and is not especially limited,
but DCC, EDC, PYBOP, CDI and the like can be used. A condensing
agent can be used in 1 to 5 times molar equivalent, and suitably 1
to 2 times molar equivalent, with respect to the compound a-4.
[0124] A solvent used in the present reaction is not especially
limited as long as it is a solvent which dissolves starting raw
materials to some degree, and does not inhibit the reaction, but
suitably includes THF, dichloromethane, DMF or mixed solvents
thereof.
[0125] The amine derivative a-5 can be used in 1 to 10 times molar
equivalent, and is suitably in 1 to 2 times molar equivalent, with
respect to the compound a-4.
[0126] The reaction temperature usually depends on starting raw
materials, solvents to be used, and other reagents and the like
used in the reaction, and is suitably 0.degree. C. to a reflux
temperature of the solvent (internal temperature of a reaction
vessel), and more suitably 0.degree. C. to room temperature.
[0127] The reaction time usually depends on starting raw materials,
solvents to be used, and other reagents and the like used in the
reaction. After the addition of the condensing agent to the
compound a-4, the reaction is carried out suitably for 1 to 48
hours; and more suitably 1 to 3 hours, at the above temperature,
and thereafter the amine derivative a-5 is added and the reaction
is carried out at the above temperature for 1 to 48 hours, and more
suitably for 8 to 15 hours.
[0128] Step A-4
[0129] This step is a step of intramolecularly cyclizing the
compound a-6 in the presence of a base to thereby obtain a compound
a-7. The present reaction may be carried out also in a gas flow or
an atmosphere of an inert gas such as nitrogen or argon.
[0130] This step can be carried out specifically with reference to
the reaction condition, post-reaction operation, purifying method
and the like described in Preparation Example 1, 2, 4 and 5
described later and the like.
[0131] A solvent used in the present reaction is not especially
limited as long as it is a solvent which dissolves starting raw
materials to some degree, and does not inhibit the reaction, but
suitably includes THF, DMF or mixed solvents thereof.
[0132] The base, in the case of being used in the reaction, depends
on starting raw materials, solvents to be used and the like, and is
not especially limited, but examples thereof include bases such as
sodium hydroxide, KTB, LDA, LHMDS, sodium hydride and potassium
hydride; but preferable is sodium hydroxide, KTB, sodium hydride or
the like. A base can be used in 1 to 5 times molar equivalent, and
preferably 1 to 3 times molar equivalent, with respect to the
compound a-6.
[0133] The reaction temperature usually depends on starting raw
materials, solvents to be used, and other reagents and the like
used in the reaction, and is suitably -78.degree. C. to a reflux
temperature of the solvent (internal temperature of a reaction
vessel), and more suitably -20.degree. C. to room temperature.
[0134] The reaction time usually depends on starting raw materials,
solvents to be used, and other reagents and the like used in the
reaction, and is suitably 1 to 48 hours, and more suitably 1 to 5
hours, at the above temperature.
[0135] <Production Method B>
##STR00017##
wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6 and
P.sup.1 each have the same definitions as the above definitions;
X.sup.1 and X.sup.3 means a halogen atom and M means
--BF.sub.3.sup.-K.sup.+, --B(OH).sub.2, a group represented by the
formula:
##STR00018##
--Sn(n-Bu).sub.3, --ZnBr, --ZnCl, or the like.
[0136] Step B-1
[0137] This step is a step of subjecting a compound a-7 and a
compound b-1 to a coupling reaction using a transition metal
catalyst to thereby convert them to a compound b-4.
[0138] This step can be carried out specifically with reference to
the reaction condition, post-reaction operation, purifying method
and the like described in Examples 1, 2 and 3 described later and
the like.
[0139] The compound a-7 can be obtained by <Production Method
A> or the like.
[0140] The present reaction may be carried out also in a gas flow
or an atmosphere of an inert gas such as nitrogen or argon.
[0141] A solvent used in the present reaction is not especially
limited as long as it is a solvent which dissolves starting raw
materials to some degree, and does not inhibit the reaction; but
examples thereof include alcoholic solvents such as methanol or
ethanol, etheric solvents such as THF, DME, MTBE, 1,4-dioxane,
cyclopentyl methyl ether, diethyl ether, diisopropyl ether, dibutyl
ether and dicyclopentyl ether, aromatic hydrocarbon-based solvents
such as benzene, toluene, xylene and mesitylene, amide-based
solvents such as DMF and NMP, aliphatic hydrocarbon-based solvents
such as heptane and hexane, water, or mixed solvents thereof;
suitable is an aromatic hydrocarbon-based solvent, an amide-based
solvent such as DMF or NMP, an etheric solvent such as 1,4-dioxane,
water, or a mixture thereof, and more suitable is a mixed solvent
of DMF, NMP or 1,4-dioxane with water.
[0142] The base depends on starting raw materials, solvents to be
used and the like, and is not especially limited, but examples
thereof include inorganic bases such as lithium hydroxide, sodium
hydroxide, potassium hydroxide, lithium carbonate, sodium
carbonate, potassium carbonate, sodium hydrogencarbonate, potassium
hydrogencarbonate, tripotassium phosphate n-hydrate, cesium
carbonate, cesium fluoride and potassium fluoride, and organic
bases such as imidazole, pyridine, TEA and DIPEA; and preferable
are TEA, cesium carbonate and the like. Potassium hydrogenfluoride
may also be added.
[0143] The transition metal catalyst depends on starting raw
materials, solvents to be used and the like, and is not especially
limited as long as not inhibiting the reaction, but suitably
includes Pd(PPh.sub.3).sub.4, PdCl.sub.2(PPh.sub.3).sub.2,
palladium (II) acetate/triphenylphosphine, palladium (II)
acetate/2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl,
palladium (II) acetate/bis[2-(diphenylphosphino)phenyl]ether,
palladium (1) chloride, Pd.sub.2(dba).sub.3/tri-t-butylphosphine,
Pd.sub.2(dba).sub.3, Pd(t-Bu.sub.3P).sub.2,
[(t-Bu).sub.2P(OH)].sub.2PdCl.sub.2, and
1,1'-bis(diphenylphosphino)ferrocene dichloropalladium (11).
Depending on a transition metal catalyst to be used, use of a
copper (II) iodide, lithium chloride or the like in combination
thereof gives good results such as an improvement in the yield and
a reduction in the reaction time in some cases.
[0144] The reaction temperature usually depends on starting raw
materials, solvents, and other reagents used in the reaction, and
is suitably 0.degree. C. to a reflux temperature of the solvent
(internal temperature of a reaction vessel), and more suitably 60
to 150.degree. C. Use of a microwave reaction apparatus gives good
results such as an improvement in the yield and a reduction in the
reaction time in some cases.
[0145] The reaction time usually depends on starting raw materials,
solvents, other reagents used in the reaction, and the reaction
temperature, and is suitably 1 to 48 hours, and more suitably 1 to
6 hours, at the above temperature after the addition of the
reagents.
[0146] The compound b-1 can be used in 1 to 5 times molar
equivalent, and is suitably in 1 to 3 times molar equivalent, with
respect to the compound a-7.
[0147] The base can be used in 1 to 10 times molar equivalent, and
is suitably in 2 to 5 times molar equivalent, with respect to the
compound a-7.
[0148] The transition metal catalyst can be used in 0.05 to 1 time
molar equivalent, and is suitably in 0.05 to 0.1 times molar
equivalent, with respect to the compound a-7.
[0149] Step B-2
[0150] This step is a step of converting a compound a-7 and
bis(pinacolato)diboron or the like to a compound b-2 by coupling
reaction using a transition metal catalyst.
[0151] Specifically, this step can be performed with reference to
the reaction conditions, the post-reaction operation, the
purification method and the like described in the later-described
Preparation Examples 1, 3, 4, 5 and 6 and the like.
[0152] The compound a-7 can be obtained by the <Preparation
Method A> or the like.
[0153] This reaction can also be performed in a stream or
atmosphere of an inert gas such as nitrogen or argon.
[0154] The solvent used in this reaction is not particularly
limited unless it can dissolve the starting material to a certain
extent and does not inhibit the reaction. Examples include ether
solvents such as THF, DME, MTBE, 1,4-dioxane, cyclopentyl methyl
ether, diethyl ether, diisopropyl ether, dibutyl ether and
dicyclopentyl ether, aromatic hydrocarbon solvents such as benzene,
toluene, xylene and mesitylene, amide solvents such as DMF and NMP,
and aliphatic hydrocarbon solvents such as heptane and hexane.
Aromatic hydrocarbon solvents, amide solvents such as DMF and NMP,
or ether solvents such as DME and 1,4-dioxane, or mixed solvents
thereof are preferred, and DMF, NMP or 1,4-dioxane, or mixed
solvents thereof are more preferred.
[0155] The base varies according to the starting material, the
solvent used and the like and is not particularly limited. Examples
include inorganic bases such as potassium acetate, lithium
hydroxide, sodium hydroxide, potassium hydroxide, lithium
carbonate, sodium carbonate, potassium carbonate, sodium
bicarbonate, potassium bicarbonate, cesium carbonate, cesium
fluoride and potassium fluoride, and organic bases such as
imidazole, pyridine, TEA and DIPEA. Potassium acetate or the like
is preferred.
[0156] The transition metal catalyst varies according to the
starting material, the solvent used and the like and is not
particularly limited unless it does not inhibit the reaction.
Preferred examples include Pd(PPh.sub.3).sub.4, palladium(II)
acetate/triphenylphosphine, palladium(II)
acetate/2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl,
palladium(II) chloride, Pd.sub.2(dba).sub.3/tri-t-butylphosphine,
Pd.sub.2(dba).sub.3, Pd(t-Bu.sub.3P).sub.2 and
1,1'-bis(diphenylphosphino)ferrocenedichloropalladium(II). More
preferred examples include
1,1'-bis(diphenylphosphino)ferrocenedichloropalladium(II).
[0157] The reaction temperature usually varies according to the
starting material, the solvent, and furthermore the reagent used in
the reaction, and is preferably 0.degree. C. to the reflux
temperature of the solvent (the internal temperature in the
reaction vessel), more preferably 60 to 150.degree. C. Use of a
microwave reaction apparatus gives good results such as an
improvement in the yield and a reduction in the reaction time in
some cases.
[0158] The reaction time usually varies according to the starting
material, the solvent, and furthermore the reagent used in the
reaction and the reaction temperature, and is preferably 1 to 48
hours, more preferably 1 to 6 hours, at the above temperature after
adding the reagent Bis(pinacolato)diboron can be used in an amount
of 1 to 5 molar equivalents based on the compound a-7. The amount
is preferably 1 to 3 molar equivalents.
[0159] The base can be used in an amount of 1 to 10 molar
equivalents based on the compound a-7. The amount is preferably 2
to 5 molar equivalents.
[0160] The transition metal catalyst can be used in an amount of
0.05 to 1 molar equivalent based on the compound a-7. The amount is
preferably 0.05 to 0.1 molar equivalent.
[0161] Step B-3
[0162] This step is a step of converting a compound b-3 and the
compound b-2 to a compound b-4 by coupling reaction using a
transition metal catalyst.
[0163] This step can be performed under the same conditions as in
Step B-1. Specifically, this step can be performed with reference
to the reaction conditions, the post-reaction operation, the
purification method and the like described in the later-described
Examples 4, 6, and 25 and the like.
[0164] Step B-4
[0165] This step is a step of removing a protecting group P.sup.1
of the compound b-4 to thereby obtain the compound (I). The
deprotection of a protecting group is described in many well-known
literatures, for example, T. Greene et al., "Protective Groups in
Organic Synthesis" (John Wiley & sons. Inc., New York, 1999)
(hereinafter, referred to as Synthesis Reference Literature 1). The
deprotection reaction of an amino group depends on the kind of a
protecting group, and is not especially limited, but for example,
in the case of a 2,4-dimethoxybenzyl group or the like, the
deprotection can be carried out under an acidic condition.
[0166] In the case where the protecting group P.sup.1 is a
2,4-dimethoxybenzyl group, a solvent used in the present reaction
may be any one as long as it dissolves starting raw materials to
some degree and does not inhibit the reaction. The solvent is not
especially limited, but examples thereof include alcoholic solvents
such as methanol and ethanol, etheric solvents such as THF, DME,
MTBE, cyclopentyl methyl ether, diethyl ether, diisopropyl ether,
dibutyl ether and dicyclopentyl ether, halogenated
hydrocarbon-based solvents such as dichloromethane and chloroform,
acetic acid, or mixed solvents thereof. An acid may be used as a
solvent.
[0167] As the acid, for example, trifluoroacetic acid (TFA),
hydrochloric acid and sulfuric acid can be used. Preferable is TFA.
An acid can be used in a 1 to 100 times volume with respect to the
compound b-4.
[0168] The reaction temperature usually depends on starting raw
materials, solvents, and other reagents used in the reaction, and
is suitably 0.degree. C. to a reflux temperature of the solvent
(internal temperature of a reaction vessel), and more suitably 40
to 60.degree. C.
[0169] The reaction time usually depends on starting raw materials,
solvents, other reagents used in the reaction, and the reaction
temperature, and is suitably 0.5 to 24 hours, and more suitably 1
to 12 hours, at the above temperature after the addition of the
reagents.
[0170] <Preparation Method C>
##STR00019##
In the formulas, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5,
R.sup.6 and M are as defined above, respectively, and X.sup.1,
X.sup.2 and X.sup.3 each represent a halogen atom.
[0171] Step C-1
[0172] This step is a step of converting a compound b-1 and a
compound a-3 to a compound c-1 by coupling reaction using a
transition metal catalyst.
[0173] This step can be performed under the same conditions as in
Step B-1 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Example 52 and the like.
[0174] Step C-2
[0175] This step is a step of converting a compound a-3 and
bis(pinacolato)diboron or the like to a compound c-2 by coupling
reaction using a transition metal catalyst.
[0176] This step can be performed under the same conditions as in
Step B-2 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Preparation Examples 3 and 6 and
the like.
[0177] Step C-3
[0178] This step is a step of converting a compound b-3 and the
compound c-2 to a compound c-1 by coupling reaction using a
transition metal catalyst.
[0179] This step can be performed under the same conditions as in
Step B-3 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Example 26 and the like.
[0180] Step C-4
[0181] This step is a step of obtaining a compound c-3 by
hydrolyzing the compound c-1 in the presence of a base.
[0182] This step can be performed under the same conditions as in
Step A-2 of the <Preparation Method A>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Example 26 and the like.
[0183] Step C-5
[0184] This step is a step of obtaining a compound c-4 by reacting
the compound c-3 with aqueous ammonia using a condensing agent.
This reaction can also be performed in a stream or atmosphere of an
inert gas such as nitrogen or argon.
[0185] This step can be performed under the same conditions as in
Step A-3 of the <Preparation Method A>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Examples 5, 26, 52, 53, 54 and 55
and the like.
[0186] Step C-6
[0187] This step can be performed under the same conditions as in
Step A-4 of the <Preparation Method A>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Examples 5, 26, 52, 53, 54 and 55
and the like.
[0188] <Preparation Method D>
##STR00020##
In the formulas, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5,
R.sup.6 and M are as defined above, respectively, and X.sup.1 and
X.sup.3 each represent a halogen atom.
[0189] Step D-1
[0190] This step is a step of obtaining a compound d-2 by a known
method by reacting a compound d-1 with thionyl chloride to convert
it to a corresponding acid chloride derivative, and then performing
condensation reaction with ethyl dimethylaminoacrylate and
subsequently reacting with a hydrazine derivative a-2 to form a
pyrazole ring. This reaction can also be performed in a stream or
atmosphere of an inert gas such as nitrogen or argon.
[0191] Specifically, this step can be performed with reference to
the reaction conditions, the post-reaction operation, the
purification method and the like described in the later-described
Preparation Example 7 and the like.
[0192] The compound a-2 can be a commercially available product
used as is, and can also be synthesized by a means known to a
person skilled in the art. The compound can be prepared by
converting a corresponding ketone derivative to a hydrazide imine
and reducing using borane, sodium cyanoborohydride or the like. The
compound a-2 can also be used as a salt such as hydrochloride.
[0193] The solvent used in the step of reacting a compound d-1 with
thionyl chloride to convert it to a corresponding acid chloride
derivative in this reaction is not particularly limited unless the
solvent can dissolve the reaction starting material to a certain
extent and does not inhibit the reaction. The solvent is preferably
THF, acetonitrile, DMF or DMA, more preferably acetonitrile. The
solvent used in the next condensation reaction with ethyl
dimethylaminoacrylate is not particularly limited unless it can
dissolve the reaction starting material to a certain extent and
does not inhibit the reaction. The solvent is preferably TI-IF,
acetonitrile, DMF or DMA, more preferably acetonitrile. The solvent
used in the subsequent pyrazole ring-forming reaction with a
hydrazine derivative a-2 is not particularly limited unless it can
dissolve the reaction starting material to a certain extent and
does not inhibit the reaction. The solvent is preferably methanol,
ethanol, n-butanol, t-butanol, THF, 1,4-dioxane, acetonitrile,
water or a mixed solvent thereof, more preferably a mixed solvent
of acetonitrile and water.
[0194] The reaction temperature usually varies according to the
starting material, the solvent used, and furthermore the reagent
used in the reaction. The reaction temperature in the step of
obtaining a corresponding acid chloride from a compound d-1 and
thionyl chloride is preferably 0.degree. C. to the reflux
temperature of the solvent (the internal temperature in the
reaction vessel), more preferably 50.degree. C. to 80.degree. C.
The reaction temperature in the next condensation reaction with
ethyl dimethylaminoacrylate is preferably 0.degree. C. to the
reflux temperature of the solvent (the internal temperature in the
reaction vessel), more preferably 20.degree. C. to 80.degree. C.
The reaction temperature in the subsequent pyrazole ring-forming
reaction with a hydrazine derivative a-2 is preferably room
temperature to the reflux temperature of the solvent (the internal
temperature in the reaction vessel), more preferably 50.degree. C.
to the reflux temperature of the solvent.
[0195] The reaction time usually varies according to the starting
material, the solvent used, and furthermore the reagent used in the
reaction. The reaction time in the step of obtaining a
corresponding acid chloride by reaction of a compound d-1 with
thionyl chloride is preferably 0.5 to 24 hours, more preferably 1
to 3 hours, at the above temperature after adding the reagent. The
reaction time in the next condensation reaction with ethyl
dimethylaminoacrylate is preferably 0.5 to 24 hours, more
preferably 1 to 3 hours, at the above temperature after adding the
reagent. The reaction time in the subsequent pyrazole ring-forming
reaction with a hydrazine derivative a-2 is preferably 0.5 to 60
hours, more preferably 12 to 24 hours, at the above temperature
after adding the reagent.
[0196] Step D-2
[0197] This step is a step of converting a compound b-1 and the
compound d-2 to a compound d-4 by coupling reaction using a
transition metal catalyst.
[0198] This step can be performed under the same conditions as in
Step B-1 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Examples 27, and 43 and the
like.
[0199] Step D-3
[0200] This step is a step of converting the compound d-2 and
bis(pinacolato)diboron or the like to a compound d-3 by coupling
reaction using a transition metal catalyst.
[0201] This step can be performed under the same conditions as in
Step B-2 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Preparation Examples 7 and 9 and
the like.
[0202] Step D-4
[0203] This step is a step of converting a compound b-3 and the
compound d-3 to a compound d-4 by coupling reaction using a
transition metal catalyst.
[0204] This step can be performed under the same conditions as in
Step B-3 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Examples 45 and 51 and the
like.
[0205] Step D-5
[0206] This step is a step of obtaining a compound (I) by a known
method by converting the nitro group of the compound d-4 to an
amino group using a reducing agent, and then condensing the amino
group with the ester to perform intramolecular cyclization
reaction. This reaction can also be performed in a stream or
atmosphere of an inert gas such as nitrogen or argon. Specifically,
this step can be performed with reference to the reaction
conditions, the post-reaction operation, the purification method
and the like described in the later-described Examples 27, 41, 43,
45, 51, and 62 and the like.
[0207] Examples of the reducing agent in this step include iron,
tin(II) chloride and sodium hydrosulfite. Iron and tin(II) chloride
are preferred, and iron is more preferred. The intramolecular
cyclization reaction proceeds by heating without using a reagent in
particular.
[0208] The solvent used in the step of converting the nitro group
of the compound d-4 to an amino group using a reducing agent in
this reaction is not particularly limited unless the solvent can
dissolve the reaction starting material to a certain extent and
does not inhibit the reaction. The solvent is methanol, ethanol,
n-butanol, t-butanol, ethyl acetate or a mixed solvent thereof,
more preferably methanol or ethanol. The solvent used in the
subsequent intramolecular cyclization reaction is not particularly
limited unless it can dissolve the reaction starting material to a
certain extent and does not inhibit the reaction. The solvent is
acetic acid, ethanol, n-butanol, t-butanol, THF or 1,4-dioxane,
preferably acetic acid, ethanol, n-butanol or t-butanol, more
preferably acetic acid.
[0209] The reaction temperature usually varies according to the
starting material, the solvent used, and furthermore the reagent
used in the reaction. The reaction temperature in the step of
converting the nitro group of the compound d-4 to an amino group
using a reducing agent is preferably 0.degree. C. to the reflux
temperature of the solvent (the internal temperature in the
reaction vessel), more preferably 80.degree. C. to the reflux
temperature of the solvent (the internal temperature in the
reaction vessel). The reaction temperature in the subsequent
intramolecular cyclization reaction is preferably 0.degree. C. to
the reflux temperature of the solvent (the internal temperature in
the reaction vessel), more preferably 50.degree. C. to the reflux
temperature of the solvent (the internal temperature in the
reaction vessel).
[0210] The reaction time usually varies according to the starting
material, the solvent used, and furthermore the reagent used in the
reaction. The reaction time in the step of converting the nitro
group of the compound d-4 to an amino group using a reducing agent
is preferably 0.5 to 24 hours, more preferably 1 to 3 hours, at the
above temperature after adding the reagent. The reaction time in
the subsequent intramolecular cyclization reaction is preferably
0.5 to 24 hours, more preferably 1 to 3 hours, at the above
temperature after adding the reagent.
[0211] Step D-6
[0212] This step is a step of obtaining a compound d-5 by a known
method by converting the nitro group of the compound d-2 to an
amino group using a reducing agent, and then condensing the amino
group with the ester to perform intramolecular cyclization
reaction.
[0213] This step can be performed under the same conditions as in
Step D-5 of the <Preparation Method D>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Example 63 and the like.
[0214] Step D-7
[0215] This step is a step of converting a compound represented by
compound b-1 and the compound d-5 to a compound (I) by coupling
reaction using a transition metal catalyst.
[0216] This step can be performed under the same conditions as in
Step B-1 of the <Preparation Method B>. Specifically, this
step can be performed with reference to the reaction conditions,
the post-reaction operation, the purification method and the like
described in the later-described Example 63 and the like.
[0217] After the completion of the reaction in each method and each
step described above, a target compound for each step can be
collected from a reaction mixture according to a conventional
method.
[0218] For example, in the case where the reaction mixture is
wholly a liquid, the reaction mixture, as desired, is returned to
room temperature or cooled with ice; an acid, an alkali, an
oxidizing agent or a reducing agent is suitably neutralized; an
organic solvent immiscible like water and ethyl acetate and not
reacting with a target compound is added; and a layer containing
the target compound is separated. Then, a solvent immiscible with
the obtained layer and not reacting with the target compound is
added to wash the layer containing the target compound, and the
layer is separated. Additionally, if the layer is an organic layer,
by drying the layer using a desiccant such as anhydrous magnesium
sulfate or anhydrous sodium sulfate, and distilling out the
solvent, the target compound can be collected. If the layer is a
water layer, by electrically desalting the layer, and thereafter
lyophilizing the layer, the target compound can be collected.
[0219] If the reaction mixture is wholly a liquid, and if possible,
only by distilling out substances (for example, a solvent and
reagents) other than a target compound under normal pressure or
reduced pressure, the target compound can be collected.
[0220] Further in the case where a target compound alone deposits
as a solid, or in the case where the reaction mixture is wholly a
liquid and only a target compound precipitates as a solid in the
procedure of collection, by first filter-collecting the target
compound by a filtration method, washing the filter-collected
target compound with a proper organic or inorganic solvent, and
drying the target compound, the target compound can be collected,
and by treating the mother liquid similarly to the case where the
reaction mixture is wholly a liquid, the target compound can
further be collected.
[0221] Further in the case where only a reagent or a catalyst is
present as a solid, or in the case where the reaction mixture is
wholly a liquid, where a reagent or a catalyst alone precipitates
as a solid in the procedure of collection, and where a target
compound is dissolved in a solution, by first filtrating out the
reagent or the catalyst by a filtration method, washing the
filtered-out reagent or catalyst with a proper organic or inorganic
solvent, combining the obtained washed liquid with the mother
liquid, and treating the obtained mixed liquid similarly to the
case where the reaction mixture is wholly a liquid, the target
compound can be collected.
[0222] Particularly in the case where substances other than a
target compound contained in the reaction mixture do not inhibit a
reaction of a next step, the reaction mixture as it is may be used
in the next step without particularly isolating the target
compound.
[0223] In order to improve the purity of the target compound
collected in the above method, a recrystallization method, various
types of chromatographies and a distillation method can be carried
out suitably.
[0224] In the case where a collected target compound is a solid,
the purity of the target compound can usually be improved by a
recrystallization method. In the recrystallization method, a single
solvent or a mixed solvent of a plurality of solvents which does
not react with the target compound can be used. Specifically, a
target compound is first dissolved at room temperature or under
heating in a single solvent or a mixed solvent of a plurality of
solvents which does not react with the target compound. By cooling
the obtained mixed liquid with ice water or the like or leaving it
at room temperature, the target compound can be crystallized from
the mixed liquid.
[0225] In the case where a collected target compound is a liquid,
the purity of the target compound can be improved by various types
of chromatographies. Weakly acidic silica gels such as Silica Gel
60 (70-230 mesh or 340-400 mesh) made by Merck or BW-300 (300 mesh)
made by Fuji Silysia Chemical Ltd. can generally be used. In the
case where a target compound has a basicity and exhibits too
intense adsorption by the above silica gels, or in other cases, a
propylamine-coated silica gel (200-350 mesh) made by Fuji Silysia
Chemical Ltd. or the like may be used. In the case where a target
compound has a bipolarity, in the case where the elution by a
highly polar solvent such as methanol is necessary, or in other
cases, NAM-200H or NAM-300H made by NAM Laboratory may be used. A
target compound improved in purity can be obtained by eluting the
target compound with a single solvent or a plurality of solvents
which do not react with the target compound by using these silica
gels, and distilling out the solvent(s).
[0226] In the case where a collected target compound is a liquid,
the purity of the target compound can be improved also by a
distillation method. In the distillation method, by depressurizing
a target compound at room temperature or under heating, the target
compound can be distilled out.
[0227] Although the above are typical examples of production
methods of the compound (I) according to the present invention, raw
material compounds and various types of reagents in production of
the compound according to the present invention may form salts,
hydrates or solvates, and any compounds and reagents thereof depend
on starting raw materials, solvents to be used and the like, and
are not especially limited as long as not inhibiting the reactions.
Also a solvent to be used depends on starting raw materials,
reagents and the like, and is not of course especially limited as
long as not inhibiting the reactions and dissolving starting
substances to some degree. In the case where the compound (I)
according to the present invention is obtained as a free body, the
compound (I) can be converted to the state of a salt which the
compound (I) may form or a hydrate thereof by a conventional
method.
[0228] In the case where the compound (I) according to the present
invention is obtained as a salt of the compound (I) or a hydrate of
the compound (I), the salt and the hydrate can be converted to a
free body of the compound (I) by a conventional method.
[0229] Various types of isomers (for example, geometric isomers,
optical isomers, rotational isomers, stereoisomers and tautomers)
obtained for the compound (I) according to the present invention
can be purified and isolated by using usual separation means, for
example, recrystallization, a diastereomeric salt method, an
enzymatic resolution method, and various types of chromatographies
(for example, thin-layer chromatography, column chromatography and
gas chromatography).
[0230] [Pharmaceutical preparation] A compound of the formula (I)
according to the present invention and/or a pharmaceutically
acceptable salt thereof can be pharmaceutically prepared by a
conventional method, and the dosage form can be made, for example,
an oral preparation, (tablet, granule, powder, capsule, syrup, or
the like), an injection (for intravenous administration, for
intramuscular administration, for subcutaneous administration, for
intraperitoneal administration, and for others), and an external
preparation (endermic preparation (ointment, patch, and the like),
eyedrops, nasal drops, suppository, and the like).
[0231] In the case of producing an oral solid preparation, to a
compound of the formula (I) and/or a pharmaceutically acceptable
salt thereof, as required, an excipient, a binder, a disintegrant,
a lubricant, a colorant and the like are added, and a tablet, a
granule, a powder and a capsule can be produced by conventional
methods. The tablet, granule, powder, capsule and the like, as
required, may be film-coated.
[0232] Examples of the excipient include lactose, cornstarch and
crystalline cellulose; examples of the binder include hydroxypropyl
cellulose and hydroxypropyl methyl cellulose; examples of the
disintegrant include carboxymethyl cellulose calcium and
croscarmellose sodium; examples of the lubricant include magnesium
stearate and calcium stearate; examples of the colorant include
titanium oxide; and examples of the film coating agent include
hydroxypropyl cellulose, hydroxypropyl methyl cellulose and methyl
cellulose, but these additives are of course not limited to these
examples.
[0233] These solid preparations such as tablets, capsules, granules
and powders can each contain usually 0.001 to 99.5% by weight,
preferably 0.01 to 90% by weight or the like, of a compound of the
formula (I) and/or a pharmaceutically acceptable salt thereof.
[0234] In the case of producing an injection (for intravenous
administration, for intramuscular administration, for subcutaneous
administration, for intraperitoneal administration, and for
others), to a compound of the formula (I) and/or a pharmaceutically
acceptable salt thereof, as required, a pH regulator, a buffer
agent, a suspending agent, a solubilizer, an antioxidant, a
preservative (antiseptic), an isotonic agent, and the like are
added, and an injection can be produced by a conventional method.
The preparations may be lyophilized to be made extemporaneous
dissolution-type lyophilized preparations.
[0235] Examples of the pH regulator and the buffer agent include
organic acids or inorganic acids and/or salts thereof; examples of
the suspending agent include methyl cellulose, Polysorbate 80 and
carboxymethyl cellulose sodium; examples of the solubilizer include
Polysorbate 80 and polyoxyethylene sorbitan monolaurate; examples
of the antioxidant include .alpha.-tocopherol; examples of the
preservative include methyl paraoxybenzoate and ethyl
paraoxybenzoate; and examples of the isotonic agent include
glucose, sodium chloride and mannitol, but these additives are of
course not limited to these examples.
[0236] These injections can each contain usually 0.000001 to 99.5%
by weight, preferably 0.00001 to 90% by weight or the like, of a
compound of the formula (I) and/or a pharmaceutically acceptable
salt thereof.
[0237] In the case of producing an external preparation, a basis
raw material is added to a compound of the formula (I) or a
pharmaceutically acceptable salt thereof, and as required, for
example, the preservative, a stabilizer, the pH regulator, the
antioxidant, the colorant and the like are added, and for example,
an endemic preparation (ointment, patch, and the like), eyedrops,
nasal drops, suppository, and the like can be produced by
conventional methods.
[0238] As basis raw materials to be used, various raw materials
usually used, for example, for medicines, quasi-drugs and cosmetics
can be used. Specific examples thereof include raw materials such
as animal and vegetable oils, mineral oils, ester oils, waxes,
emulsifiers, higher alcohols, fatty acids, silicon oils,
surfactants, phospholipids, alcohols, polyhydric alcohols,
water-soluble polymers, clay minerals and purified water.
[0239] These external preparations can each contain usually
0.000001 to 99.5% by weight, preferably 0.00001 to 90% by weight or
the like, of a compound of the formula (I) or a pharmaceutically
acceptable salt thereof.
[0240] The compound according to the present invention can be made
a chemical probe to trap a target protein of a physiologically
active low-molecular compound. That is, the compound according to
the present invention can be converted to an affinity
chromatography probe, a photoaffinity probe and the like by
introducing a labeling group, a linker or the like to a moiety
different from a structural moiety essential to develop the
activity of the compound, by the technique described in J. Mass
Spectrum. Soc. Jpn., Vol. 51, No. 5, 2003, p. 492-498,
WO2007/139149, or the like.
[0241] Examples of the labeling group, the linker or the like used
in a chemical probe include groups shown in the group consisting of
the following (1) to (5):
(1) protein labeling groups such as photoaffinity labeling groups
(for example, a benzoyl group, a benzophenone group, an azido
group, a carbonyl azido group, a diaziridine group, an enone group,
a diazo group and a nitro group), and chemoaffinity groups (for
example, ketone groups whose alpha-carbon atom is replaced by a
halogen atom, a carbamoyl group, an ester group, an alkylthio
group, an .alpha.,.beta.-unsaturated ketone, a Michael receptor of
an ester or the like, and an oxirane group); (2) cleavable linkers
such as --S--S--, --O--Si--O--, monosaccharides (a glucose group, a
galactose group, and the like), and disaccharides (lactose and the
like), and oligopeptide linkers cleavable by an enzymatic reaction;
(3) biotin and fishing tag groups such as a
3-(4,4-difluoro-5,7-dimethyl-4H-3a,4a-diaza-4-bora-s-indacen-3-yl)propion-
yl group; (4) radioactive labeling groups of .sup.125I, .sup.32P,
.sup.3H, .sup.14C or the like; fluorescent labeling groups such as
fluorescein, rhodamine, dansyl, umbelliferone, 7-nitrofurazanyl,
and
3-(4,4-difluoro-5,7-dimethyl-4H-3a,4a-diaza-4-bora-s-indecen-3-yl)propion-
yl group; chemiluminescent groups such as luciferin and luminol;
and markers capable of detecting heavy metal ions such as
lanthanide metal ions and radium ions; and (5) groups attached to
solid carriers such as glass beads, glass beds, microliter plates,
agarose bends, agarose beds, polystyrene beads, polystyrene beds,
nylon beads and nylon beds.
[0242] Probes prepared by introducing labeling groups selected from
the group consisting of the above (1) to (5), or the like, to the
compound according to the present invention by methods described in
the above literatures or the like can be used as chemical probes to
identify labeled proteins useful for search and the like of new
drug discovery targets.
[0243] The compound (I) according to the present invention can be
produced, for example, by methods described in the following
Examples, and the effects of the compound can be verified by
methods described in the following Test Examples. However, these
are only exemplifications, and the present invention is not limited
to the following specific examples in any case, and changes and
modifications may be made without departing from the scope of the
present invention.
[0244] It is indicated that compounds for which literature names or
the like are described were produced according to the literatures
or the like.
[0245] Abbreviations used in the present specification are common
ones well-known by those skilled in the art. The following
abbreviations will be used in the present specification.
Ac: acetyl BAST: bis(2-methoxyethyl)aminosulfur trifluoride Bn:
benzyl Boc: tert-butoxycarbonyl BOP:
benzotriazol-1-yloxy-tris(dimethylamino)phosphonium
hexafluorophosphate. Bu: butyl CAN: cerium ammonium nitrate CDI:
1,1'-carbonyldiimidazole DAST: diethylaminosulfur trifluoride DBU:
1,8-diazabicyclo[5.4.0]undec-7-ene DCC:
1,3-dicyclohexylcarbodiimide DCM: dichloromethane DDQ:
2,3-dichloro-5,6-dicyano-1,4-benzoquinone DEAD: diethyl
azodicarboxylate DIAD: diisopropyl azodicarboxylate DIBAL-H:
diisobutylaluminium hydride
DIPEA: N,N-diisopropylethylamine
[0246] DMAP: 4-(dimethylamino)pyridine DME: 1,2-dimethoxyethane
DMF: N,N-dimethylformamide
[0247] DMF-DMA: N,N-dimethylformamide dimethyl acetal DMSO:
dimethylsulfoxide DTT: dithiothreitol EDC:
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride EGTA:
glycol ether diamine tetraacetic acid HATU:
O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate HBTU:
O-benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate
HOBT: 1-hydroxybenzotriazole IPA: isopropyl alcohol KHMDS:
potassium bis(trimethylsilyl)amide KTB: potassium tert-butoxide
LAH: lithium aluminum hydride LDA: lithium diisopropylamide LHMDS:
lithium bis(trimethylsilyl)amide mCPBA: 3-chloroperbenzoic acid m-:
meta MTBE: t-butylmethylether n-: normal NaBH(OAc).sub.3: sodium
triacetoxyborohydride NaHMDS: sodium bis(trimethylsilyl)amide
NBS: N-bromosuccinimide
NCS: N-chlorosuccinimide
NIS: N-iodosuccinimide
[0248] NMP: N-methyl-2-pyrrolizinone o-: ortho p-: para
Pd(t-Bu.sub.3P).sub.2: bis(tri-t-butylphosphine)palladium
Pd.sub.2(dba).sub.3: tris(dibenzylideneacetone)dipalladium
Pd(dppf)Cl.sub.2 DCM complex:
[1,1-bis(diphenylphosphine)ferrocene]dichloropalladium(11) DCM
complex Pd(PPh.sub.3).sub.4:
tetrakis(triphenylphosphine)palladium(0)
PdCl.sub.2(PPh.sub.3).sub.2:
bis(triphenylphosphine)palladium(II)dichloride PYBOP:
benzotriazol-1-yloxytris(pyridino)phosphonium hexafluorophosphate
t-: tertiary TBAF: tetrabutylammonium fluoride TEA: triethylamine
Tf: trifluoromethanesulfonyl TFA: trifluoroacetic acid TFAA:
trifluoroacetic acid anhydride THF: tetrahydrofuran THP:
tetrahydropyran. TMEDA: N,N,N',N'-tetramethylethylenediamine TMS:
trimethylsilyl Tris: trishydroxymethylaminomethane Ts:
paratoluenesulfonyl .sup.1H-NMR: proton nuclear magnetic resonance
spectrometry LC-MS: liquid chromatography-mass spectrometry
Xantphos: 4,5-bis(diphenylphosphino)-9,9-dimethylxanthine Z:
benzyloxycarbonyl
[0249] "Room temperature" in the following Examples and Preparation
Examples usually indicates about 10.degree. C. to about 35.degree.
C. % indicates weight percent unless otherwise specified.
[0250] The chemical shift of the proton nuclear magnetic resonance
spectrum is recorded in .delta. units (ppm) from tetramethylsilane;
and the coupling constant is recorded in hertz (Hz). The
abbreviations of splitting patterns are as follows: s: singlet, d:
doublet, t triplet, q: quartet, m: multiplet, brs: broad singlet
and brd: broad doublet.
[0251] In a reaction using a microwave reaction apparatus in the
following Examples and Preparation Examples, Emrys.TM. Liberator
made by Personal chemistry was used.
[0252] For the optical resolution of a compound, Parallex Flex.TM.,
made by Biotage, (column: one of CHIRALPAK.RTM. AD-H, IA, B3 and IC
made by Daicel Corp., and CHIRALCEL.RTM. OD-H and OJ-H made by
Daicel Corp.; column size 2 cm.PHI..times.25 cm) was used. The
retention time in the tables in the examples means a value when one
of CHIRALPAK.RTM. AD-H, IA, 113 and IC made by Daicel Corp., and
CHIRALCEL.RTM. OD-H and OJ-H made by Daicel Corp. (column size:
0.46 cm.PHI..times.15 cm or 0.46 cm.PHI..times.25 cm) was used and
the flow rate was set at 1.00 ml/min. The optical rotation (+/-)
was measured by an OR-2090 chiral detector (Hg--Xe lamp, 150 W)
made by JASCO.
[0253] With respect to the chromatography, in the case where there
is a description as silica gel column chromatography, was used a
Parallel Prep, made by Yamazen Corp., (column: Hi-Flash.TM. Column
(Silicagel), made by Yamazen Corp., size: one of S (16.times.60
mm), M (20.times.75 mm), L (26.times.100 mm), 2L (26.times.150 mm),
and 3L (46.times.130 mm)) or spherical shape silica gel for
chromatography PSQ60B.TM. made by Fuji Silysia Chemical Ltd.,
silica gel for chromatography BW-300.TM. made by Fuji Silysia
Chemical Ltd., Wakogel.RTM. C-200 made by Wako Pure Chemical
Industries, Ltd. or Silica Gel 60.RTM. (70-230 mesh) made by Merck
Ltd. Japan. In the case where there is a description as NH silica
gel column chromatography, was used a Parallel Prep, made by
Yamazen Corp., (column: Hi-Flash.TM. Column (Amino), made by
Yamazen Corp., size: one of S (16.times.60 mm), M (20.times.75 mm),
L (26.times.100 mm), 2L (26.times.150 mm), and 3L (46.times.130
mm)) or NH silica gel (200-350 mesh) made by Fuji Silysia Chemical
Ltd.
[0254] (.+-.)- indicates a racemate, and (+)- and (-)- indicate the
(+) type and the (-) type of an enantiomer, respectively.
[0255] The names of following compounds were used as those
indicated in "E notebook" ver. 12 (Perkin Elmer) except commonly
used reagents.
Preparation Example 1
Synthesis of
[5-(2,4-dimethoxybenzyl)-4-oxo-1-(tetrahydro-2H-pyran-4-yl)-4,5-dihydro-1-
H-pyrazolo[4,3-c]quinolin-7-yl]boronic acid
##STR00021## ##STR00022##
[0256] (1) Synthesis of ethyl
3-(4-bromo-2-chlorophenyl)-3-oxopropionate
[0257] 4-Bromo-2-chlorobenzoic acid (1 g) was suspended in DCM (10
mL). CDI (960 mg) was added to the resultant suspension, and
stirred at room temperature for 4 hours. The solution is taken as
"Solution 1". Potassium ethyl malonate (1.1 g) was suspended in
acetonitrile (20 mL) in another flask in a nitrogen atmosphere, and
TEA (1.5 mL) was added. The resultant solution was cooled to
0.degree. C., and magnesium chloride (805 mg) was added little by
little, and thereafter stirred at room temperature for 2 hours. The
reaction mixture was cooled to 0.degree. C., and "Solution 1"
prepared in the above was dropped therein. After the completion of
the dropping, the reaction mixture was stirred at room temperature
for 17 hours. The reaction mixture was further stirred at
50.degree. C. for 9 hours. The reaction mixture was concentrated
under reduced pressure and the DCM was removed. The obtained
residue was cooled to 0.degree. C., and ethyl acetate (50 mL) and a
2N hydrochloric acid (20 mL) were added, and stirred at room
temperature for 1 hour. The resultant organic layer was
partitioned. The resultant water layer was extracted with ethyl
acetate. The extract was combined with the organic layer, and dried
with anhydrous magnesium sulfate. The desiccant was removed by
filtration, and the filtrate was concentrated under reduced
pressure. The obtained residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 10%) to thereby
obtain the title compound (1.2 g).
[0258] ESI-MS m/z 307 [M+H].sup.+
(2) Synthesis of ethyl
5-(4-bromo-2-chlorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-car-
boxylate
[0259] Ethyl 3-(4-bromo-2-chlorophenyl)-3-oxopropionate (1.2 g) was
dissolved in DMF-DMA (4.7 mL), and stirred at room temperature for
1 hour. The reaction mixture was concentrated under reduced
pressure. Ethanol (23 mL) and (tetrahydro-2H-pyran-4-yl)hydrazine
hydrochloride (CAS No. 194543-22-1; ChemReach Inc.) (759 mg) were
added to the obtained residue, and stirred at room temperature for
15 hours. Thereafter, the resultant was heated to reflux for 2
hours. The reaction mixture was cooled to room temperature, and
thereafter concentrated under reduced pressure. Ethyl acetate and a
saturated sodium hydrogencarbonate aqueous solution were added to
the obtained residue, and partitioned. The resultant organic layer
was washed with a saturated sodium hydrogencarbonate aqueous
solution, and dried with anhydrous magnesium sulfate. The desiccant
was removed by filtration, and the filtrate was concentrated under
reduced pressure. The resultant residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 10% to 30% to 50%)
to thereby obtain the title compound (1.5 g).
[0260] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.15 (t,
J=7.2 Hz, 3H), 1.63-1.73 (m, 1H), 1.83-191 (m, 1H), 2.22-2.45 (m,
2H), 3.29-3.41 (m, 2H), 3.83-3.93 (m, 1H), 3.99-4.10 (m, 2H),
4.09-4.15 (m, 2H), 7.16 (d, J=8.2 Hz, 1H), 7.54 (dd, J=8.2 Hz, 2.0
Hz, 1H), 7.73 (d, J=2.0 Hz, 1H), 8.05 (s, 1H).
[0261] ESI-MS m/z 415 [M+H].sup.+
(3) Synthesis of
5-(4-bromo-2-chlorophenyl)-N-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-
-4-yl)-1H-pyrazole-4-carboxamide
[0262] Ethyl
5-(4-bromo-2-chlorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-car-
boxylate (1.5 g) was added to ethanol (28 mL), and heated to
60.degree. C. to be dissolved. A 5N sodium hydroxide aqueous
solution (2.1 mL) was added to the resultant solution, and stirred
at 50.degree. C. for 2 and a half hours. The reaction mixture was
cooled to room temperature, and thereafter, CHCl.sub.3 (100 mL), a
5N hydrochloric acid (12 mL) and a saturated saline solution were
added, and partitioned. The resultant organic layer was dried with
anhydrous magnesium sulfate. The desiccant was removed by
filtration, and the filtrate was concentrated under reduced
pressure. The obtained residue was suspended in DCM (31 mL); and
CDI (825 mg) was added, and stirred at room temperature. After 30
min, 2,4-dimethoxybenzylamine (1.0 mL) was added to the resultant
solution, and stirred at room temperature for 1 hour. A saturated
sodium hydrogencarbonate aqueous solution was added to the reaction
mixture, and partitioned. The resultant water layer was extracted
with ethyl acetate. The extract was combined with the resultant
organic layer, and washed with a saturated sodium hydrogencarbonate
aqueous solution. The resultant organic layer was dried with
anhydrous magnesium sulfate. The desiccant was removed by
filtration, and the filtrate was concentrated under reduced
pressure. The obtained residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 50% to 80%) to thereby
obtain the title compound (1.6 g).
[0263] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.57-1.64
(m, 1H), 1.83-1.90 (m, 1H), 2.18-2.29 (m, 1H), 2.33-2.44 (m, 1H),
327-3.39 (m, 2H), 3.75 (s, 3H), 3.80 (s, 3H), 3.97-4.09 (m, 2H),
4.33-4.26 (m, 2H), 5.72-5.81 (m, 1H), 6.37-6.44 (m, 3H), 7.08 (d,
J=82 Hz, 1H), 7.17 (d, J=8.4 Hz, 1H), 7.49 (dd, J=8.2 Hz, 2.0 Hz,
1H), 7.70 (d, J=2.0 Hz, 1H), 7.92 (s, 1H).
[0264] ESI-MS m/z 536 [M+H].sup.+
(4) Synthesis of
7-bromo-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-dihydropy-
razolo[4,3-c]quinolin-4(5H)-one
[0265]
5-(4-Bromo-2-chlorophenyl)-N-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-
-pyran-4-yl)-1H-pyrazole-4-carboxamide (1.6 g) was dissolved in THF
(29 mL). The solution was cooled to 0.degree. C., and KTB (434 g)
was added. The mixture was stirred at room temperature for 26
hours. A saturated ammonium chloride aqueous solution and methanol
were added to the reaction mixture, which was extracted with
CHCl.sub.3. The resultant organic layer was dried with anhydrous
magnesium sulfate. The desiccant was removed by filtration, and the
filtrate was concentrated under reduced pressure. DMF and water
were added to the obtained residue. The precipitated solid was
filter-collected to thereby obtain the title compound (1.1 g).
[0266] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.10-2.20
(m, 2H), 2.42-2.55 (m, 2H), 3.67 (t, J=11.0 Hz, 2H), 3.68 (s, 3H),
4.02 (s, 3H), 4.19-4.25 (m, 2H), 4.90-5.00 (m, 1H), 5.50 (s, 2H),
6.36 (dd, J=8.2 Hz, 4.2 Hz, 1H), 6.52 (d, J=4.2 Hz, 1H), 7.00 (d,
J=8.2 Hz, 1H), 7.39 (d, J=8.4 Hz, 1H), 7.81 (d, J=8.4 Hz, 1H), 7.82
(s, 1H), 832 (s, 1H).
[0267] ESI-MS m/z 500 [M+H].sup.+
(5) Synthesis of
5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-7-(4,4,5,5-tetrameth-
yl-1,3,2-dioxaborolan-2-yl)-1H-dihydropyrazolo[4,3-c]quinolin-4(5H)-one
[0268]
7-Bromo-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-dih-
ydropyrazolo[4,3-c]quinolin-4(5H)-one (200 mg) was dissolved in
1,4-diozane (10 mL). Bis(pinacolato)diboron (132 mg),
Pd(dppf)Cl.sub.2 DCM complex (15 mg) and potassium acetate (118 mg)
were added to the resultant solution, and allowed to react at
130.degree. C. for 2 hours using a microwave reaction apparatus.
The reaction mixture was returned to room temperature, and
thereafter concentrated under reduced pressure. The obtained
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 30% to 100%) to thereby obtain the title
compound (175 mg).
[0269] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.24 (s,
6H), 1.34 (s, 6H), 2.13-222 (m, 2H), 2.42-2.55 (m, 2H), 3.63-3.77
(m, 2H), 3.74 (s, 3H), 4.02 (s, 3H), 4.19-4.25 (m, 2H), 4.97-5.07
(m, 1H), 5.62 (s, 2H), 6.32 (dd, J=8.2 Hz, 4.2 Hz, 1H), 6.50 (d,
J=4.2 Hz, 1H), 7.03 (d, J=8.2 Hz, 1H), 7.68 (d, J=10.0 Hz, 1H),
7.95 (d, J=10.0 Hz, 1H), 8.02 (s, 1H), 8.34 (s, 1H).
[0270] ESI-MS m/z 546 [M+H].sup.+
(6) Synthesis of
[5-(2,4-dimethoxybenzyl)-4-oxo-1-(tetrahydro-2H-pyran-4-yl)-4,5-dihydro-1-
H-pyrazolo[4,3-c]quinolin-7-yl]boronic acid
[0271] Synthesized
5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-7-(4,4,5,5-tetrameth-
yl-1,3,2-dioxaborolan-2-yl)-1H-dihydropyrazolo[4,3-c]quinolin-4(5H)-one
(150 mg) was dissolved in 1,4-dioxane (10 mL). 2 N HCl (1 mL) was
added to the solution, and the mixture was stirred at room
temperature. After 30 minutes, the precipitated solid was collected
by filtration. The resulting solid was dried under reduced pressure
to give the title compound (104 mg).
[0272] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.13-2.25
(m, 2H), 2.42-2.60 (m, 2H), 3.71 (s, 3H), 3.72 (s, 3H), 3.81 (s,
2H), 4.17-4.29 (m, 2H), 4.98-5.09 (m, 1H), 5.62 (s, 2H), 6.32 (dd,
J=8.2 Hz, 4.2 Hz, 1H), 6.46 (d, J=4.2 Hz, 1H), 6.94 (d, J=82 Hz,
1H), 7.36 (d, J=10.0 Hz, 1H), 7.73 (s, 1H), 8.03 (d, J=10.0 Hz,
1H), 8.36 (s, 1H).
[0273] ESI-MS m/z 464 [M+H].sup.+
Preparation Example 2
Synthesis of
7-chloro-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazolo-
[4,3-c]quinolin-4(5H)-one
##STR00023##
[0275] The title compound was obtained by performing the reactions
(1) to (4) in accordance with Preparation Example 1 using
2,4-dichlorobenzoic acid and (tetrahydro-2H-pyran-4-yl)hydrazine
hydrochloride as raw materials.
[0276] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 2.00-2.09
(m, 2H), 2.10-2.24 (m, 2H), 3.62-3.76 (m, 2H), 3.69 (s, 3H), 3.94
(s, 3H), 3.95-4.04 (m, 2H), 5.18-5.27 (m, 1H), 5.36 (brs, 2H),
6.34-6.37 (m, 1H), 6.63-6.65 (m, 2H), 7.37-7.42 (m, 2H), 8.27-8.29
(m, 2H).
[0277] ESI-MS m/z 454 [M+H].sup.+
Preparation Example 3
Synthesis of ethyl
5-(2-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1-(tet-
rahydro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylate
##STR00024##
[0278] (1) Synthesis of ethyl
3-(4-bromo-2-fluorophenyl)-3-oxopropanoate
[0279] CDI (8.88 g) was added to a suspension of
4-bromo-2-fluorobenzoic acid (CAS No. 112704-79-7) (10 g) in DCM
(97 mL), and the mixture was stirred at room temperature for 3.5
hours. This solution is called "solution 1."
[0280] In another flask, TEA (15.9 mL) and magnesium chloride (10.9
g) were sequentially added to a suspension of potassium
ethylmalonate (15.5 g) in acetonitrile (303 mL), and the mixture
was stirred at room temperature for three hours and 10 minutes. The
"solution 1" prepared above was added dropwise to the reaction
mixture over 25 minutes, and then the reaction mixture was stirred
at mom temperature overnight. The reaction mixture was concentrated
to half volume under reduced pressure. The resulting residue was
diluted with ethyl acetate (500 mL), and 5 N hydrochloric acid (250
mL) was added under ice-cooling, followed by stirring at room
temperature for one hour. The organic layer was separated. The
organic layer was washed with brine, dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pressure. The
resulting residue was purified by silica gel column chromatography
(ethyl acetate/n-heptane, 5% to 20%) to give the title compound
(12.8 g).
[0281] ESI-MS m/z 291 [M+H].sup.+
(2) Synthesis of ethyl
5-(4-bromo-2-fluorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-car-
boxylate
[0282] A solution of ethyl
3-(4-bromo-2-fluorophenyl)-3-oxopropanoate (25.6 g) in DMF-DMA (129
mL) was stirred at room temperature for four hours. The reaction
mixture was concentrated under reduced pressure. Toluene (250 mL)
was added to the residue. The solution was concentrated under
reduced pressure. Ethanol (550 mL) was added to the residue. The
solution was cooled in an ice bath.
(Tetrahydro-2H-pyran-4-yl)hydrazine hydrochloride (15.4 g) was
added to the solution. The mixture was warmed to room temperature
over one hour and then heated under reflux for two hours. The
reaction mixture was stirred at room temperature overnight and then
concentrated under reduced pressure. The residue was partitioned by
adding ethyl acetate (400 mL) and brine (200 mL). The organic layer
was washed with brine (200 mL), dried over anhydrous magnesium
sulfate and filtered, and the filtrate was concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 10% to 25%). The resulting
crude purified product was suspended in a mixed solution of MTBE
(30 mL) and n-heptane (50 mL), followed by stirring at room
temperature overnight. The precipitated solid was collected by
filtration. The resulting solid was suspended in a mixed solution
of MTBE (30 mL) and n-heptane (50 mL), followed by stirring at room
temperature overnight. The precipitated solid was collected by
filtration. After drying, the title compound (22.8 g) was
obtained.
[0283] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.13-1.23
(m, 3H), 1.63-1.73 (m, 1H), 1.77-1.87 (m, 1H), 2.27-2.44 (m, 2H),
3.29-3.44 (m, 2H), 3.91-4.11 (m, 3H), 4.11-4.20 (m, 2H), 7.16-7.24
(m, 1H), 7.39-7.49 (m, 2H), 8.05 (d, J=0.59 Hz, 1H).
[0284] ESI-MS m/z 419 [M+Na].sup.+
(3) Synthesis of ethyl
5-[2-fluoro-4-(4,4,5,5-tetramethy]-1,3,2-dioxaborolan-2-yl)phenyl)-1-(tet-
rahydro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylate
[0285] A mixture of ethyl
5-(4-bromo-2-fluorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-car-
boxylate (2 g), bis(pinacolato)diboron (1.53 g),
Pd(dppf)Cl.sub.2-DCM complex (0.18 g) and potassium acetate (1.48
g) was dried under reduced pressure using a vacuum pump for one
hour. DMF (20 mL) was added to the dried residue, and the mixture
was stirred at 85.degree. C. for six hours. The reaction mixture
was returned to room temperature and then filtered through
Celite.TM.. The filtrate was concentrated under reduced pressure.
The residue was partitioned by adding ethyl acetate (100 mL) and
water (100 mL). The aqueous layer was extracted with ethyl acetate
(20 mL.times.2). The combined organic layers were dried over
anhydrous magnesium sulfate and filtered, and the filtrate was
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (ethyl acetate/n-heptane, 10% to
20%) to give the title compound (2.18 g).
[0286] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.12-1.17
(m, 3H), 1.37 (s, 12H), 1.64-1.72 (m, 1H), 1.81-1.85 (m, 1H),
2.30-2.39 (m, 2H), 3.28-3.36 (m, 2H), 3.94-4.08 (m., 3H), 4.13 (q,
J=7.0 Hz, 2H), 7.29-7.32 (m, 1H), 7.61-7.64 (m, 1H), 7.68-7.70 (m,
1H), 8.05 (s, 1H).
Preparation Example 4
Synthesis of
(.+-.)-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-3-yl)-7-(4,4,5,5-te-
tramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00025## ##STR00026##
[0288] The title compound was obtained by performing the reactions
(1) to (5) in accordance with Preparation Example 1 using ethyl
3-(4-bromo-2-chlorophenyl)-3-oxopropanoate obtained in Preparation
Example 1 and (.+-.)-(tetrahydro-2H-pyran-3-yl)hydrazine
hydrochloride obtained in Preparation Example 17 as raw
materials.
[0289] ESI-MS m/z 546 [M+H].sup.+
Preparation Example 5
Synthesis of
(.+-.)-5-(2,4-dimethoxybenzyl)-1-(tetrahydrofuran-3-yl)-7-(4,4,5,5-tetram-
ethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00027## ##STR00028##
[0290] (1) Synthesis of (.+-.)-ethyl
5-(4-bromo-2-chlorophenyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazole-4-carboxy-
late
[0291] Ethyl 3-(4-bromo-2-chlorophenyl)-3-oxopropanoate obtained in
Preparation Example 1(1) (2.00 g) was dissolved in DMF-DMA (6.96
mL), and the reaction mixture was stirred at room temperature for
1.5 hours. The reaction mixture was concentrated under reduced
pressure, and the residue was dissolved in ethanol (40 mL).
(.+-.)-(Tetrahydrofuran-3-yl)hydrazine hydrochloride (998 mg) was
added to the solution, and the mixture was heated under reflux for
two hours. The reaction mixture was cooled to room temperature and
then concentrated under reduced pressure. The residue was extracted
with ethyl acetate, and the organic layer was purified by silica
gel column chromatography (ethyl acetate/n-heptane, 10% to 30%) to
give the title compound (1.05 g).
[0292] ESI-MS m/z 401 [M+H].sup.+
(2) Synthesis of
(.+-.)-5-(4-bromo-2-chlorophenyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazole-4--
carboxylic acid
[0293] A mixture of (.+-.)-ethyl
5-(4-bromo-2-chlorophenyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazole-4-carboxy-
late (1.05 g) and a 5 M aqueous sodium hydroxide solution was
stirred in a mixed solvent of ethanol (20 mL) and water (5 mL) at
60.degree. C. for three hours. The reaction mixture was cooled to
room temperature and then concentrated under reduced pressure. 5 M
hydrochloric acid was added to the residue, followed by extraction
with ethyl acetate. The organic layer was dried over anhydrous
magnesium sulfate, and the desiccant was filtered off. The filtrate
was concentrated under reduced pressure to give the title compound
(1 g).
[0294] ESI-MS m/z 371 [M+H].sup.+
(3) Synthesis of
(.+-.)-5-(4-bromo-2-chlorophenyl)-N-(2,4-dimethoxybenzyl)-1-(tetrahydrofu-
ran-3-yl)-1H-pyrazole-4-carboxamide
[0295]
(.+-.)-5-(4-bromo-2-chlorophenyl)-1-(tetrahydrofuran-3-yl)-1H-pyraz-
ole-4-carboxylic acid (1 g) was dissolved in DCM (20 mL), and CDI
(611 mg) was added, followed by stirring at room temperature for
one hour. 2,4-dimethoxybenzylamine (0.809 mL) was added to the
reaction mixture, and the mixture was stirred at room temperature
for two hours. A saturated aqueous sodium bicarbonate solution was
added to the reaction mixture, followed by extraction with DCM. The
organic layer was concentrated under reduced pressure, and the
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 10% to 40%) to give the title compound (1.26
g).
[0296] ESI-MS m/z 522 [M+H].sup.+
(4) Synthesis of
(.+-.)-7-bromo-5-(2,4-dimethoxybenzyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4(5H)-one
[0297]
(.+-.)-5-(4-bromo-2-chlorophenyl)-N-(2,4-dimethoxybenzyl)-1-(tetrah-
ydrofuran-3-yl)-1H-pyrazole-4-carboxamide (1.26 g) was dissolved in
THF (25 mL), and KTB (597 mg) was added at 0.degree. C. The mixture
was stirred for 12 hours while gradually warming to room
temperature. The reaction mixture was cooled to 0.degree. C., and
water was added, followed by filtration. The filtration residue was
separately stored. The filtrate was extracted with ethyl acetate,
and the organic layer was concentrated under reduced pressure. The
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 10% to 70%). The resulting fraction and the
filtration residue obtained above were combined and concentrated to
give the title compound (488 mg).
[0298] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.50-2.62
(m, 1H), 2.72-2.82 (m, 1H), 3.76 (s, 3H), 4.02 (s, 3H), 4.07-4.15
(m, 1H), 4.19-4.32 (m, 2H), 4.35-4.42 (m, 1H), 5.46-5.57 (m, 3H),
6.34 (dd, J=8.6 Hz, 2.2 Hz, 1H), 6.52 (d, J=2.2 Hz, 1H), 6.99 (d,
J=8.6 Hz, 1H), 7.38 (dd, J=8.6 Hz, 1.8 Hz, 1H), 7.82 (d, J=1.8 Hz,
1H), 7.89 (d, J=8.6 Hz, 1H), 8.32 (s, 1H).
[0299] ESI-MS m/z 506 [M+Na].sup.+
(5) Synthesis of
(.+-.)-5-(2,4-dimethoxybenzyl)-1-(tetrahydrofuran-3-yl)-7-(4,4,5,5-tetram-
ethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0300] A mixture of
(.+-.)-7-bromo-5-(2,4-dimethoxybenzyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4(5H)-one (300 mg), bis(pinacolato)diboron (204
mg), Pd(dppf)Cl.sub.2-DCM complex (13.6 mg) and potassium acetate
(182 mg) was reacted in a mixed solvent of 1,4-dioxane (15 mL) and
DMSO (1 mL) using a microwave reactor at 130.degree. C. for three
hours. The reaction mixture was cooled to room temperature and then
concentrated under reduced pressure. The residue was extracted with
ethyl acetate, and the organic layer was concentrated under reduced
pressure. The residue was subjected to a silica gel pad and eluted
with ethyl acetate to give the title compound (428 mg) as a crude
purified product.
[0301] ESI-MS m/z 532 [M+H].sup.+
Preparation Example 6
Synthesis of ethyl
5-[2-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-[(S)-
-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
##STR00029##
[0302] (1) Synthesis of ethyl
5-(4-bromo-2-fluorophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-car-
boxylate
[0303] A solution of ethyl
3-(4-bromo-2-fluorophenyl)-3-oxopropanoate obtained in Preparation
Example 3(1) (45 g) in DMF-DMA (165 mL) was stirred at 50.degree.
C. for two hours and 15 minutes. The reaction mixture was
concentrated under reduced pressure. Toluene (200 mL) was added to
the residue, and the mixture was concentrated again under reduced
pressure. Ethanol (950 mL) was added to the residue, and the
mixture was warmed to 50.degree. C. A solution of
(S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride (21.6 g) in water
(60 mL) was added dropwise to the solution over 35 minutes. The
resulting reaction mixture was stirred at 50.degree. C. for two
hours and 10 minutes. The reaction mixture was cooled to room
temperature and then concentrated to half volume under reduced
pressure. Water (200 mL) was added to the residue, and ethanol was
distilled off under reduced pressure. Ethyl acetate (500 mL) was
added to the resulting residue, and the organic layer was
separated. The aqueous layer was extracted with ethyl acetate (100
mL). The combined organic layers were washed with brine, dried over
anhydrous magnesium sulfate, filtered and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 10% to 15%) and then
purified by short path NH silica gel column chromatography (ethyl
acetate/n-heptane, 33%) to give the title compound (43.1 g).
[0304] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.19 (t,
J=7.2 Hz, 3H), 2.19-2.49 (m, 2H), 3.87-4.07 (m, 3H), 4.11-4.25 (m,
3H), 4.58-4.65 (m, 1H), 7.17-7.26 (m, 1H), 7.39-7.47 (m, 2H), 8.06
(s, 1H).
[0305] ESI-MS m/z 407 [M+Na].sup.+
(2) Synthesis of ethyl
5-[2-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-[(S)-
-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0306] A mixture of ethyl
5-(4-bromo-2-fluorophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-car-
boxylate (43.1 g), bis(pinacolato)diboron (34.3 g),
Pd(dppf)Cl.sub.2-DCM complex (4.59 g) and potassium acetate (33.1
g) was dried under reduced pressure using a vacuum pump for one
hour. A solution of dried residue in DMF (430 mL) was stirred at
80.degree. C. for three hours and 10 minutes. The reaction mixture
was returned to room temperature and then filtered through
Celite.TM.. The filtrate was concentrated under reduced pressure.
Ethyl acetate (430 mL) and brine (200 mL) were added to the
residue, followed by stirring for five minutes. The insoluble
matter was filtered off through Celite.TM.. The organic layer was
separated from the filtrate. The aqueous layer was re-extracted
with ethyl acetate (50 mL). The combined organic layers were dried
over anhydrous magnesium sulfate and filtered, and the filtrate was
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (ethyl acetate/n-heptane, 10% to
15%) to give the title compound (51.9 g).
[0307] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.16 (t,
J=7.2H, 3H), 1.37 (s, 12H), 2.15-2.49 (m, 2H), 3.85-4.06 (m, 3H),
4.14 (q, J=7.2 Hz, 2H), 4.20 (dd, J=15.6, 8.4 Hz, 1H), 4.57-4.66
(m, 1H), 7.30 (t, J=7.2 Hz, 0.5H), 7.35 (t, J=7.2 Hz, 5H), 7.63
(dd, J=5.6, 2.0 Hz, 1H), 7.70 (dd, J=7.2, 2.0 Hz, 1H), 8.06 (s,
1H).
Preparation Example 7
Synthesis of ethyl
5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-[(S)--
tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
##STR00030##
[0308] (1) Synthesis of ethyl
5-(4-bromo-2-nitrophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carb-
oxylate
[0309] 4-bromo-2-nitrobenzoic acid (10 g) was dissolved in
acetonitrile (50 mL). Thionyl chloride (32 mL) was added to the
solution, and the mixture was stirred for three hours with heating
under reflux. The reaction mixture was cooled with ice water, and
triethylamine (11.3 mL) was added dropwise. Ethyl
3-dimethylamineacrylate (6.4 mL) was further added dropwise. After
stirring at room temperature for three hours,
(S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride (6.2 g) was
dissolved in water (10 mL), and the aqueous solution was added
dropwise to the reaction mixture. Thereafter, the mixture was
stirred at room temperature for 60 hours. The reaction mixture was
partitioned by adding water (50 mL) and ethyl acetate (200 mL). The
organic layer was washed with a 2 N aqueous sodium hydroxide
solution (100 mL) and brine (50 mL) and dried over anhydrous
magnesium sulfate. The desiccant was removed by filtration, and the
filtrate was concentrated under reduced pressure. Ethyl acetate (5
mL) was added to the resulting residue which was dissolved with
heating under reflux. The solution was cooled with ice water. After
one hour, the precipitated solid was collected by filtration to
give the crude purified product (7.5 g). Further, the filtrate was
concentrated under reduced pressure. MTBE (10 mL) was added to the
resulting residue, and the precipitated solid was collected by
filtration to give the title compound (1.5 g).
[0310] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.13 (td,
J=7.2 Hz, 1.6 Hz, 3H), 2.15-2.34 (m, 1H), 2.39-2.55 (m, 1H),
3.85-4.14 (m, 5H), 4.21 (q, J=7.7 Hz, 1H), 4.47-4.62 (m, 1H), 7.21
(d, J=8.2 Hz, 0.5H), 7.26 (d, J=8.2 Hz, 0.5H), 7.88 (t, J=2.2 Hz,
0.5H), 7.88 (I, J=2.2 Hz, 0.5H), 8.02 (s, 1H), 8.35 (d, J=2.2 Hz,
0.5H) 8.37 (d, J=2.2 Hz, 0.5H).
[0311] ESI-MS m/z 410 [M+H].sup.+
(2) Synthesis of ethyl
5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-[(S)--
tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0312] A mixture of ethyl
5-(4-bromo-2-nitrophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carb-
oxylate (650 mg), bis(pinacolato)diboron (483 mg),
Pd(dppf)Cl.sub.2-DCM complex (64.7 mg) and potassium acetate (467
mg) was dried under reduced pressure using a vacuum pump for one
hour. DMF (6.5 mL) was added to the dried residue, and the mixture
was stirred at 80.degree. C. for four hours. The reaction mixture
was returned to room temperature and then filtered through
Celite.TM.. The filtrate was concentrated under reduced pressure.
Water was added to the residue, followed by extraction with ethyl
acetate. The organic layer was dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pressure. The
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 100%) to give the title compound (417
mg).
[0313] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.07-1.11
(m, 3H), 1.38 (s, 12H), 2.14-2.31 (m, 1H), 2.41-2.53 (m, 1H),
3.85-4.11 (m, 5H), 4.12-424 (m, 1H), 4.49-4.57 (m, 1H), 7.29-7.40
(m, 1H), 8.02-8.03 (m, 1H), 8.13-8.16 (m, 1H), 8.58-8.60 (m,
1H).
Preparation Example 8
Synthesis of (.+-.)-ethyl
5-(4-bromo-2-nitrophenyl)-1-(oxepan-4-yl)-1H-pyrazole-4-carboxylate
##STR00031##
[0315] The title compound (369 mg) was obtained by the same method
as in Preparation Example 7 from 4-bromo-2-nitrobenzoic acid (2.5
g) and (.+-.)-oxepan-4-ylhydrazine hydrochloride obtained in
Preparation Example 15 (1.69 g).
[0316] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.13 (t,
J=7.2 Hz, 3H), 1.48-1.65 (m, 1H), 1.76-1.91 (m, 1H), 1.95-2.21 (m,
2H), 227-2.51 (m, 2H), 3.54-3.73 (m, 2H), 3.78-3.88 (m, 2H),
4.02-4.13 (m, 3H), 7.20 (d, J=8.0 Hz, 0.5H), 7.21 (d, J=8.0 Hz,
0.5H), 7.87 (dd, J=8.0, 2.0 Hz, 0.5H), 7.88 (dd, J=8.0, 2.0 Hz,
0.5H), 8.00 (s, 0.5H), 8.01 (s, 0.5H), 8.35 (d, J=2.0 Hz, 0.5H),
8.36 (d, J=2.0 Hz, 0.5H).
[0317] ESI-MS m/z 462 [M+Na].sup.+
Preparation Example 9
Synthesis of ethyl
1-(1,4-dioxepan-6-yl)-5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborola-
n-2-yl)phenyl]-1H-pyrazole-4-carboxylate
##STR00032##
[0318] (1) Synthesis of (Z)-ethyl
2-(4-bromo-2-nitrobenzoyl)-3-(dimethylamino)acrylate
[0319] A solution of 4-bromo-2-nitrobenzoic acid (2.5 g) in thionyl
chloride (2.93 mL) was stirred at 80.degree. C. for 3 hours. The
reaction mixture was concentrated under reduced pressure. Toluene
(3 mL) was added to the residue and the mixture was concentrated
again under reduced pressure. A solution of the resulting acid
chloride in acetonitrile (8 mL) was added dropwise to a solution of
ethyl 3-dimethylaminoacrylate (1.46 g) and TEA (2.83 mL) in
acetonitrile (30 mL) at room temperature over 6 minutes. The
resulting reaction mixture was stirred at room temperature
overnight. The reaction mixture was partitioned by adding ethyl
acetate and water. The aqueous layer was extracted again with ethyl
acetate. The combined organic layers were washed with brine, dried
over anhydrous magnesium sulfate, filtered and concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (ethyl acetate/heptane, 33 to 66%) to give the title
compound (2.55 g).
[0320] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 0.91 (t,
J=7.2 Hz, 3H), 3.11 (s, 3H), 3.39 (s, 3H), 3.89 (q, J=7.2 Hz, 2H),
7.25 (d, J=8.0 Hz, 1H), 7.74 (d, J=8.0, 1.6 Hz, 1H), 8.00 (s, 1H),
8.19 (d, J=1.6 Hz, 1H).
[0321] ESI-MS m/z 393 [M+Na].sup.+
(2) Synthesis of ethyl
5-(4-bromo-2-nitrophenyl)-1-(1,4-dioxepan-6-yl)-1H-pyrazole-4-carboxylate
[0322] To a solution of (Z)-ethyl
2-(4-bromo-2-nitrobenzoyl)-3-(dimethylamino)acrylate (642 mg) in
acetonitrile (8 mL) was added a solution of
(1,4-dioxepan-6-yl)hydrazine hydrochloride (341 mg) obtained in
Preparation Example 16 in water (2 mL) at room temperature. The
reaction mixture was stirred at room temperature overnight and
further stirred at 50.degree. C. for 9.5 hours. The reaction
mixture was returned to room temperature and partitioned by adding
ethyl acetate and water. The aqueous layer was extracted again with
ethyl acetate. The combined organic layers were sequentially washed
with the saturated aqueous sodium bicarbonate solution and brine,
and dried over anhydrous magnesium sulfate, filtered and
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/heptane, 20 to 33%) to give the title compound (408
mg).
[0323] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.12 (t,
J=72 Hz, 3H), 3.70-3.83 (m, 2H), 3.87-4.11 (m, 6H), 4.20-4.39 (m,
3H), 7.17 (d, J=8.0 Hz, 1H), 7.88 (dd, J=8.0, 2.0 Hz, 1H), 8.05 (s,
1H), 8.35 (d, J=2.0 Hz, 1H).
[0324] ESI-MS m/z 464 [M+Na].sup.+
(3) Synthesis of ethyl
1-(1,4-dioxepan-6-yl)-5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborola-
n-2-yl)phenyl]-1H-pyrazole-4-carboxylate
[0325] A mixture of ethyl
5-(4-bromo-2-nitrophenyl)-1-(1,4-dioxepan-6-yl)-1H-pyrazole-4-carboxyrate
(200 mg), bis(pinacolato)diboron (138 mg), Pd(dppf)Cl.sub.2-DCM
complex (19 mg) and potassium acetate (134 mg) was dried under
reduced pressure using a vacuum pump for 50 minutes. A solution of
the resulting residue in DMF (3 mL) was stirred at 80.degree. C.
for 2 hours and 20 minutes. After Pd(dppf)Cl.sub.2-DCM complex (19
mg) was added to the reaction mixture, the reaction mixture was
stirred at 80.degree. C. for 3 hours. The reaction mixture was
concentrated under reduced pressure. Brine and ethyl acetate were
added to the resulting residue, and the mixture was stirred at room
temperature for 5 minutes. The organic layer was separated. The
aqueous layer was extracted again with ethyl acetate. The combined
organic layers were dried over anhydrous magnesium sulfate,
filtered and concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/heptane, 33 to 50%) to give the title compound (183
mg).
[0326] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.08 (t,
J=6.8 Hz, 3H), 1.38 (s, 12H), 3.69-3.81 (m, 2H), 3.85-4.10 (m, 6H),
4.22-4.38 (m, 3H), 7.28 (d, J=7.6 Hz, 1H), 8.05 (s, 1H), 8.13 (dd,
J=7.6, 1.2 Hz, 1H), 8.57 (d, J=1.2 Hz, 1H).
Preparation Example 10
Synthesis of ethyl
5-(4-bromo-2,5-difluorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-
-carboxylate
##STR00033##
[0327] (1) Synthesis of ethyl
3-(4-bromo-2,5-difluorophenyl)-3-oxopropanoate
[0328] 4-bromo-2,5-difluorobenzoic acid (395 mg) was suspended in
DCM (3.6 mL). CDI (378 mg) was added to the solution, and the
mixture was stirred at room temperature for about three hours. This
solution is called "solution 1." In another flask, potassium
ethylmalonate (567 mg) was suspended in acetonitrile (11 mL) in a
nitrogen atmosphere, TEA (0.58 mL) and magnesium chloride (397 mg)
were sequentially added, and the mixture was then stirred at room
temperature for about three hours. The "solution 1" prepared above
was added dropwise to the reaction mixture. After completion of the
dropwise addition, the mixture was stirred at room temperature for
about 20 hours. Ethyl acetate (50 mL) was added to the reaction
mixture which was cooled to 0.degree. C. 5 N hydrochloric acid (25
mL) was added and the mixture was stirred at room temperature for
one hour. The organic layer was separated. The organic layer was
washed with brine and dried over anhydrous magnesium sulfate. The
desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The resulting residue was
subjected to silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 7%) to give the title compound (420
mg).
[0329] ESI-MS m/z 329, 331 [M+Na].sup.+
(2) Synthesis of ethyl 5-(4-bromo-2,5-d
fluorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylate
[0330] Ethyl 3-(4-bromo-2,5-difluorophenyl)-3-oxopropanoate (420
mg) was dissolved in DMF-DMA (2 mL). The reaction mixture was
stirred at room temperature for about 1.5 hours and further stirred
at 45.degree. C. for 30 minutes. The reaction mixture was
concentrated under reduced pressure. Ethanol (6 mL) and
(tetrahydro-2H-pyran-4-yl)hydrazine hydrochloride (250 mg) were
added to the resulting residue, and the mixture was stirred at
90.degree. C. for 40 minutes. The reaction mixture was concentrated
under reduced pressure. The resulting residue was partitioned by
adding ethyl acetate and brine. The organic layer was washed with
brine and dried over anhydrous magnesium sulfate. The desiccant was
removed by filtration, and the filtrate was concentrated under
reduced pressure. The residue was subjected to silica gel column
chromatography (ethyl acetate/n-heptane, 14% to 35% to 52%) to give
the title compound (400 mg).
[0331] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.21 (t,
J=7.1 Hz, 3H), 1.63-1.73 (m, 1H), 1.78-1.87 (m, 1H), 2.27-2.44 (m,
2H), 3.33-3.43 (m, 2H), 3.92-4.22 (m, 5H), 7.09-7.14 (m, 1H),
7.44-7.50 (m, 1H), 8.05 (s, 1H).
Preparation Example 11-1
Synthesis of ethyl
5-(4-bromo-2,5-difluorophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-
-carboxylate
##STR00034##
[0333] Ethyl 3-(4-bromo-2,5-difluorophenyl)-3-oxopropanoate
obtained in Preparation Example 10(1) (4 g) was dissolved in
DMF-DMA (18 mL), and the reaction mixture was stirred at room
temperature overnight. The reaction mixture was concentrated under
reduced pressure, and ethanol (80 mL) was added to the resulting
residue (5.9 g), followed by warming to 60.degree. C. A solution of
(S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride (2.17 g) in water
(4.5 mL) was added to the solution over two minutes, and the
mixture was stirred at 60.degree. C. for two hours. The reaction
mixture was cooled to mom temperature and then concentrated under
reduced pressure. The resulting residue was partitioned by adding
ethyl acetate and brine. The organic layer was washed with brine
and dried over anhydrous magnesium sulfate. The desiccant was
removed by filtration, and the filtrate was concentrated under
reduced pressure. The residue was subjected to NH silica gel column
chromatography (first time: ethyl acetate/n-heptane, 10% to 30%,
second time: ethyl acetate/n-heptane, 40%) to give the title
compound (4.31 g).
[0334] ESI-MS m/z 423 [M+Na].sup.+
Preparation Example 11-2
Synthesis of ethyl
5-(4-bromo-2,5-difluorophenyl)-1-((R)-tetrahydrofuran-3-yl)-1H-pyrazole-4-
-carboxylate
##STR00035##
[0336] The title compound was synthesized in accordance with
Preparation Example 11-1 from (R)-(tetrahydrofuran-3-yl)hydrazine
hydrochloride.
[0337] ESI-MS m/z 423 [M+Na].sup.+
Preparation Example 12
Synthesis of (.+-.)-(tetrahydrofuran-3-yl)hydrazine hydrochloride
(Method A)
##STR00036##
[0338] (1) Synthesis of benzyl
2-[dihydrofuran-3(2H)-ylidene]hydrazinecarboxylate
[0339] 3-oxotetrahydrofuran (5.70 g) was dissolved in methanol (150
mL), and benzyl carbazate (10 g) was added to the solution. The
mixture was stirred at room temperature for 12 hours. The reaction
mixture was concentrated. 14.8 g of a residue was obtained as a
crude purified product. This was used for the next reaction without
further purification.
(2) Synthesis of (.+-.)-benzyl
2-(tetrahydrofuran-3-yl)hydrazinecarboxylate
[0340] Benzyl 2-[dihydrofuran-3(2H)-ylidene]hydrazinecarboxylate
(14.8 g) was suspended in water (96 mL). Acetic acid (42.1 mL) was
added to the suspension at room temperature. The mixture was
stirred at room temperature for one hour. The suspension turned
into a solution. Sodium cyanoborohydride (4.0 g) was added to the
solution in small portions. The mixed solution was stirred at room
temperature for two hours. The reaction mixture was cooled to
0.degree. C. The reaction mixture was neutralized by adding a 5 N
aqueous sodium hydroxide solution. The mixture was extracted with
chloroform. The organic layer was dried over anhydrous magnesium
sulfate and then filtered. The filtrate was concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (methanol/ethyl acetate, 5%). The title compound
(13.9 g) was obtained.
[0341] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.73-1.80
(m, 1H), 1.92-2.06 (m, 1H), 3.66-3.82 (m, 3H), 3.82-4.03 (m, 2H),
5.14 (s, 2H), 7.31-7.40 (m, 5H).
[0342] It was found that the title compound can be optically
resolved using chiral HPLC under the following condition. Optical
resolution condition [CHIRALPAC.RTM. OD-H manufactured by Daicel
Corporation, 10% ethanol/n-hexane, Retention Time=12.39 min, 13.5
min]
(3) Synthesis of (.+-.)-(tetrahydrofuran-3-yl)hydrazine
hydrochloride
[0343] Benzyl 2-(tetrahydrofuran-3-yl)hydrazinecarboxylate (32.3
mg) was dissolved in methanol (3 mL). 10% palladium carbon (50%
wet) (17 mg) was added to the solution, and the mixture was stirred
at room temperature for two hours in a hydrogen atmosphere. The
reaction mixture was filtered. The filtrate was concentrated under
reduced pressure. The residue was dissolved in methanol (1 mL). A 4
N hydrogen chloride-1,4-dioxane solution (3 mL) was added to the
solution. The mixture was stirred at room temperature for three
hours. The reaction mixture was concentrated under reduced pressure
to give the title compound (4.9 mg).
[0344] .sup.1H-NMR (400 MHz, CD.sub.3OD) .delta. (ppm): 1.90-2.10
(m, 1H), 2.19-2.32 (m, 1H), 3.53-4.35 (m, 5H).
Preparation Example 13
Synthesis of (.+-.)-(tetrahydrofuran-3-yl)hydrazine hydrochloride
(Method B)
##STR00037##
[0345] (1) Synthesis of t-butyl 2-[dihydrofuran-3
(2H)-ylidene]hydrazinecarboxylate
[0346] 3-oxotetrahydrofuran (10.38 g) was dissolved in methanol
(200 mL), and t-butyl carbazate (17.53 g) was added to the
solution. The mixture was stirred at room temperature for 12 hours.
The reaction mixture was concentrated to give the title compound
(27.3 g).
[0347] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.52 (s,
9H), 2.46 (t, J=6.9 Hz, 2 Hz), 4.10 (t, J=6.9 Hz, 2H), 4.33 (s,
2H).
(2) Synthesis of (.+-.)-t-butyl
2-(tetrahydrofuran-3-yl)hydrazinecarboxylate
[0348] t-butyl 2-[dihydrofuran-3(2H)-ylidene]hydrazinecarboxylate
(17.26 g) was suspended in water (130 mL). Acetic acid (57.2 mL)
was added to the suspension at room temperature. The mixture was
stirred at room temperature for one hour. Sodium cyanoborohydride
(5.36 g) was added to the solution in small portions. The mixed
solution was stirred at room temperature for two hours. The
reaction mixture was cooled to 0.degree. C. The reaction mixture
was neutralized by adding a 5 N aqueous sodium hydroxide solution.
The mixture was extracted with chloroform. The organic layer was
dried over anhydrous magnesium sulfate and then filtered. The
filtrate was concentrated under reduced pressure. The residue was
purified by silica gel column chromatography (5% methanol/ethyl
acetate). The title compound (15.3 g) was obtained.
(3) Synthesis of (.+-.)-(tetrahydrofuran-3-yl)hydrazine
hydrochloride
[0349] (.+-.)-t-butyl 2-(tetrahydrofuran-3-yl)hydrazinecarboxylate
(5 g) was dissolved in methanol (40 mL). A 4 N hydrogen
chloride-1,4-dioxane solution (40 mL) was added to the solution.
The mixture was stirred at room temperature overnight. The reaction
mixture was concentrated under reduced pressure. The residue was
triturated with ethyl acetate, water and methanol. The precipitated
solid was collected by filtration to give the title compound (2.09
g).
[0350] .sup.1H-NMR (400 MHz, CD.sub.3OD) .delta. (ppm): 1.92-2.02
(m, 1H), 2.19-2.30 (m, 1H), 3.70-3.84 (m, 3H).
Preparation Example 14
Synthesis of (S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride
##STR00038##
[0351] (1) Synthesis of t-butyl
(1,3-dioxoisoindolin-2-yl)carbamate
[0352] A suspension of phthalic anhydride (30.0 g) and t-butyl
carbazate (CAS No. 870-46-2) (26.8 g) in toluene (600 mL) was
azeotropically refluxed using a Dean-Stark trap for 3.25 hours. The
insoluble matter was removed by hot filtration. The filtrate was
concentrated to about one-third volume under reduced pressure and
then ice-cooled. The precipitated solid was collected by
filtration. The resulting solid was dissolved in ethyl acetate (750
mL) and purified by short path NH silica gel column chromatography
(100% ethyl acetate). The target fraction was concentrated, and the
residue was then triturated with ethyl acetate (20 mL). The
resulting solid was collected by filtration and dried under reduced
pressure to give the title compound (16.4 g).
[0353] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.52 (s,
9H), 6.55 (brs, 1H), 7.79 (dd, J=5.6, 3.2 Hz, 2H), 7.91 (dd, J=5.6,
3.2 Hz, 2H).
(2) Synthesis of (S)-t-butyl
(1,3-dioxoisoindolin-2-yl)(tetrahydrofuran-3-yl)carbamate
[0354] DEAD (11.5 mL) was added dropwise to a solution of
(R)-(-)-3-hydroxytetrahydrofuran (CAS No. 86087-24-3) (4.84 g),
t-butyl (1,3-dioxoisoindolin-2-yl)carbamate (12 g) and
triphenylphosphine (18.0 g) in THF (160 mL) under ice-cooling over
five minutes. The reaction mixture was stirred at 0.degree. C. for
three minutes and then at room temperature for seven hours and 40
minutes. The reaction mixture was concentrated under reduced
pressure. The resulting residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 20%) to give the title
compound (12.4 g).
[0355] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.29 (s,
6H), 1.53 (s, 3H), 2.12-2.33 (m, 2H), 3.63-3.97 (m, 4H), 4.84-4.94
(m, 0.33H), 5.04-5.14 (m, 0.67H), 7.75-7.84 (m, 2H), 7.87-7.94 (m,
2H).
[0356] ESI-MS m/z 355 [M+Na].sup.+
[0357] Optical purity analysis>98% ee [IC, 10% ethanol/n-hexane,
Retention Time=9.7 min]
(3) Synthesis of (S)-t-butyl
1-(tetrahydrofuran-3-yl)hydrazinecarboxylate
[0358] Methylhydrazine (3.94 mL) was added dropwise to a solution
of (S)-t-butyl
(1,3-dioxoisoindolin-2-yl)(tetrahydrofuran-3-yl)carbamate (12.3 g)
in THF (125 mL) under ice-cooling over two minutes. The reaction
mixture was stirred at 0.degree. C. for 30 minutes, at room
temperature for three days and then at 50.degree. C. for four
hours. The reaction mixture was ice-cooled, and the insoluble
matter was then removed from the reaction mixture by filtration.
The filtrate was concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 10% to 14%) to give the title compound (7.04
g).
[0359] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.48 (s,
9H), 2.00-2.11 (m, 2H), 3.67-3.82 (m, 4H), 3.87 (dd, J=8.8, 72 Hz,
1H), 3.97 (dd, J=15.2, 7.2 Hz, 1H), 4.67-4.80 (m, 1H).
[0360] ESI-MS m/z 225 [M+Na].sup.+
(4) Synthesis of (S)-(tetrahydrofuran-3-yl)hydrazine
hydrochloride
[0361] (S)-t-butyl (tetrahydrofuran-3-yl)hydrazinecarboxylate (7.04
g) was dissolved in a 4 N hydrogen chloride-1,4-dioxane solution
(60 mL). The resulting reaction mixture was stirred at room
temperature for 25 minutes and then at 50.degree. C. for two hours.
The reaction mixture was concentrated under reduced pressure. The
residue was triturated with MTBE and ethanol. The suspension was
concentrated under reduced pressure to give the title compound
(4.85 g).
[0362] .sup.1H-NMR (400 MHz, CD.sub.3OD) .delta. (ppm): 1.90-2.04
(m, 1H), 2.19-2.32 (m, 1H), 3.70-3.84 (m, 3H), 3.86-4.02 (m,
2H).
Preparation Example 15
Synthesis of (.+-.)-oxepan-4-ylhydrazine hydrochloride
##STR00039##
[0363] (1) Synthesis of oxepan-4-one
[0364] Boron trifluoride-diethyl ether complex (13.8 mL) was added
to a solution of tetrahydro-4H-pyran-4-one (CAS No. 2994342-8)
(10.0 g) in DCM (400 mL) at room temperature. The reaction mixture
was cooled to -25.degree. C. Trimethylsilyl diazomethane (2 M
solution in n-hexane, 55 mL) was added dropwise to the reaction
mixture over 40 minutes, and the mixture was then stirred at the
same temperature for 2.5 hours. Water (40 mL) was added to the
reaction mixture, followed by stirring at room temperature. The
organic layer was separated. The organic layer was washed with a
saturated aqueous ammonium chloride solution: 28% aqueous
ammonia=10:1 (55 mL), dried over anhydrous magnesium sulfate,
filtered and concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 10% to 14%) to give the title compound (3.80
g).
[0365] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.82-1.89
(m, 2H), 2.65-2.72 (m, 4H), 3.85-3.94 (m, 4H).
(2) Synthesis of (.+-.)-t-butyl
2-(oxepan-4-yl)hydrazinecarboxylate
[0366] The title compound (4.60 g) was obtained by the same method
as in Preparation Examples 13-(1) and 13-(2) from oxepan-4-one
(3.80 g) and t-butyl carbazate (3.61 g).
[0367] ESI-MS m/z 253 [M+Na].sup.+
(3) Synthesis of (.+-.)-oxepan-4-ylhydrazine hydrochloride
[0368] The title compound (3.72 g) was obtained by the same method
as in Preparation Example 13-(3) from (.+-.)-t-butyl
2-(oxepan-4-yl)hydrazinecarboxylate (4.60 g).
[0369] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 1.50-1.82
(m, 4H), 2.02-2.34 (m, 2H), 3.08-3.18 (m, 1H), 3.47-3.57 (m, 2H),
3.61-3.74 (m, 2H).
Preparation Example 16
Synthesis of (1,4-dioxepan-6-yl)hydrazine hydrochloride
##STR00040##
[0370] (1) Synthesis of 2-(oxiran-2-ylmethoxy)ethanol
[0371] Epichlorohydrin (31 g) was added dropwise to a mixture of
ethylene glycol (20.8 g) and boron trifluoride-diethyl ether
complex (0.255 mL) under ice-cooling over one hour. The reaction
mixture was stirred at room temperature for one hour and 10 minutes
and then at 80.degree. C. for one hour. The reaction mixture was
returned to room temperature. The reaction mixture was added
dropwise to a solution of ice-cooled potassium hydroxide powder
(20.7 g) in 1,4-dioxane (110 mL) over 45 minutes. The resulting
reaction mixture was stirred at room temperature for 30 minutes.
The insoluble matter in the reaction mixture was removed by
filtration. The filtrate was concentrated under reduced pressure.
The residue was purified by distillation to give a fraction having
a boiling point of 58 to 62.degree. C. at 0.3 mmHg. The product was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 75%) to give the title compound (3.11
g).
[0372] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.10 (t,
J=6.4 Hz, 1H), 2.65 (dd, J=4.8, 2.8 Hz, 1H), 2.82 (t, J=4.8 Hz,
1H), 3.16-3.21 (m, 1H), 3.46 (dd, J=12.0, 6.0 Hz, 1H), 3.57-3.78
(m, 3H), 3.81-3.89 (m, 2H).
(2) Synthesis of 1,4-dioxepan-6-ol
[0373] A solution of 2-(oxiran-2-ylmethoxy)ethanol (3.11 g) in
1,4-dioxane (200 mL) was added dropwise over four hours and 20
minutes to a solution of lithium tetrafluoroborate (415 mg) and
lithium hydroxide (69 mg) in 1,4-dioxane (200 mL) warmed at
55.degree. C. The reaction mixture was stirred at 50.degree. C. for
50 minutes and then at room temperature for 10 minutes. The
insoluble matter in the reaction mixture was removed by filtration.
The filtrate was concentrated under reduced pressure. The residue
was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 40% to 50%). It was then purified again by
silica gel column chromatography (diethyl ether/n-hexane 50% to
100%) to give the title compound (56 mg).
[0374] Further, the fraction containing impurities was purified
again by silica gel column chromatography (diethyl ether, 100%) to
give the title compound (212 mg).
[0375] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.57 (brd,
J=8.8 Hz, 1H), 3.70-3.77 (m, 2H), 3.82-3.91 (m, 6H), 3.96 (brs,
1H).
(3) Synthesis of t-butyl
1,4-dioxepan-6-yl(1,3-dioxoisoindolin-2-yl)carbamate
[0376] DEAD (2.2 M in toluen, 1.55 mL) was added dropwise to a
solution of 1,4-dioxepan-6-ol (265 mg), t-butyl
(1,3-dioxoisoindolin-2-yl)carbamate (560 mg) obtained in
preparation example 14-(1) and triphenylphosphine (840 mg) in THF
(10 mL) under ice-cooling over 3 minutes. The reaction mixture was
stirred at 0.degree. C. for 6 minutes, and further stirred at room
temperature overnight. The reaction mixture was concentrated under
reduced pressure. After toluene (2.5 mL) was added to the resulting
residue, the precipitated solid was removed by filtration. The
filtrate was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 20%) to give the title compound (713 mg).
[0377] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.28 (s,
5.4H), 1.50 (s, 3.6H), 3.60-3.72 (m, 4H), 4.02-4.11 (m, 2H),
4.13-4.21 (m, 2H), 4.64-4.71 (m, 0.4H), 4.83-4.92 (m, 0.6H),
7.77-7.83 (m, 2H), 7.89-7.96 (m, 2H). ESI-MS m/z 385
[M+Na].sup.+
(4) Synthesis of t-butyl
1-(1,4-dioxepan-6-yl)hydrazinecarboxylate
[0378] Methylhydrazine (0.21 mL) was added dropwise to a solution
of t-butyl 1,4-dioxepan-6-yl(1,3-dioxoisoindolin-2-yl)carbamate
(710 mg) in THF (7 mL) over 1 minute. The reaction mixture was
stirred at room temperature for 3 days and further stirred at
50.degree. C. for 11 hours. After the reaction mixture was returned
to room temperature, the insoluble matter was removed from the
reaction mixture by filtration. The filtrate was concentrated under
reduced pressure. After toluene was added to the residue,
precipitated solid was removed by filtration. The filtrate was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 15% to 25%) to give the title compound (393
mg).
[0379] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.47 (s,
9H), 3.67-3.88 (m, 6H), 3.94 (d, J=6.8 Hz, 4H), 4.40-4.60 (m,
1H).
[0380] ESI-MS m/z 255 [M+Na].sup.+
(5) Synthesis of (1,4-dioxepan-6-yl)hydrazine hydrochloride
[0381] A 4 M hydrogen chloride-1,4-dioxane solution (3 mL) was
added to a solution of t-butyl
1-(1,4-dioxepan-6-yl)hydrazinecarboxylate (392 mg) in dioxane (3
mL). The reaction mixture was stirred at room temperature overnight
and further stirred at 50.degree. C. for 1 hour. The reaction
mixture was concentrated under reduced pressure to give the title
compound (341 mg).
[0382] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 3.38
(quint, J=4.4 Hz, 1H), 3.62-3.74 (m, 4H), 3.80 (dd, J=12.8, 4.4 Hz,
2H), 3.86 (dd, J=12.8, 4.4 Hz, 2H).
Preparation Example 17
Synthesis of (.+-.)-(tetrahydro-2H-pyran-3-yl)hydrazine
hydrochloride
##STR00041##
[0384] The title compound was obtained by performing the reactions
(1) to (2) in accordance with Preparation Example 13 using
dihydro-pyran-3-one as a raw material.
[0385] .sup.1H-NMR (400 MHz, CD.sub.3OD) .delta. (ppm): 1.53-1.64
(m, 1H), 1.72-1.87 (m, 2H), 1.98-2.09 (m, 1H), 3.06-3.15 (m, 1H),
3.59-3.72 (m, 3H), 3.81-3.90 (m, 1H).
Preparation Example 18
Synthesis of (3SR,4RS)-4-hydrazinyltetrahydrofuran-3-ol
hydrochloride
##STR00042##
[0386] (1) Synthesis of t-butyl
2-[(3RS,4SR)-4-hydroxytetrahydrofuran-3-yl]hydrazinecarboxylate
[0387] 3,4-epoxytetrahydrofuran (3.33 mL) and t-butyl carbazate
(6.14 g) were dissolved in 2-propanol (15 mL), and the solution was
heated to 90.degree. C. After three days, t-butyl carbazate (6.3 g)
was further added. After heating with stirring for further two
days, the reaction mixture was cooled to room temperature and
concentrated under reduced pressure. Xylene was added to the
residue, and the mixture was concentrated again under reduced
pressure. The residue was partitioned by adding chloroform and
brine. The organic layer was dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration, and the filtrate
was concentrated under reduced pressure. The residue was purified
by NH silica gel column chromatography (ethyl acetate/n-heptane,
50% to 100%) to give the title compound (5.78 g).
[0388] ESI-MS m/z 241 [M+Na].sup.+
(2) Synthesis of (3SR,4RS)-4-hydrazinyltetrahydrofuran-3-ol
hydrochloride
[0389] A 4 M hydrogen chloride-1,4-dioxane solution (50 mL) was
added to a solution of t-butyl
2-((3RS,4SR)-4-hydroxytetrahydrofuran-3-yl)hydrazinecarboxylate
(5.78 g) in methanol (30 mL) under ice-cooling, and the mixture was
then warmed to room temperature and stirred overnight. The reaction
mixture was concentrated to give the title compound (5 g).
[0390] .sup.1H-NMR (400 MHz, CD.sub.3OD) .delta. (ppm): 3.49-3.54
(m, 1H), 3.57-3.63 (m, 1H), 3.65 (dd, J=9.67, 2.64 Hz, 1H),
3.70-3.76 (m, 1H), 3.96-4.08 (m, 2H), 4.28-4.32 (m, 1H).
Preparation Example 19
Synthesis of (2,4,6-trimethylpyridin-3-yl)boronic acid
##STR00043##
[0392] 3-bromo-2,4,6-trimethylpyridine (CAS No. 23079-73-4;
Prasenjit MaI etc., Journal of Organic Chemistry, 68(9), pp.
3446-3453) (1 g) was added to THF (20 mL). The solution was cooled
to -78.degree. C., and n-butyllithium (1.63 M solution in n-hexane,
3.37 mL) was added, followed by stirring at the same temperature
for 30 minutes. Trimethyl borate (0.78 mL) was added to the
reaction mixture, and the mixture was stirred at -78.degree. C. for
10 minutes and at room temperature for 50 minutes. A saturated
aqueous ammonium chloride solution was added to the reaction
mixture, and the reaction mixture was concentrated under reduced
pressure. The resulting residue was partitioned between oil and
water by adding water and DCM. The aqueous layer was concentrated
under reduced pressure. DCM and ethanol were added to the resulting
residue. The insoluble matter was filtered, and the filtrate was
concentrated under reduced pressure to give the title compound (242
mg).
[0393] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 2.50 (s,
3H), 2.63 (s, 3H), 2.67 (s, 3H), 7.52 (s, 1H).
Preparation Example 20
Synthesis of 2-bromo-5-(methoxymethyl)-1,3-dimethylbenzene
##STR00044##
[0395] 2-bromomesitylene (5.00 g) was dissolved in carbon
tetrachloride (50 mL). NBS (4.45 g) and benzoyl peroxide (182 mg)
were added to the solution, and the mixture was stirred at
80.degree. C. for three hours. The reaction mixture was returned to
room temperature and filtered. The solid collected by filtration
was washed with n-heptane. The filtrate was concentrated under
reduced pressure, and the residue was purified by silica gel column
chromatography (n-heptane). The resulting fraction was concentrated
under reduced pressure. The residue was dissolved in THF (120 mL).
Sodium methoxide (28% solution in methanol, 9.35 mL) was added to
the solution, and the mixture was stirred at 80.degree. C. for four
hours. The reaction mixture was returned to room temperature and
concentrated under reduced pressure. Water was added to the
residue, followed by extraction with DCM. The organic layer was
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (ethyl acetate/n-heptane, 0% to
5%). The resulting fraction was concentrated under reduced
pressure, and the residue was purified again by NH silica gel
column chromatography (n-heptane) to give the title compound (880
mg).
[0396] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.41 (s,
6H), 3.38 (s, 3H), 4.35 (s, 2H), 7.05 (s, 2H).
Preparation Example 21
Synthesis of 3-bromo-6-chloro-2,4-dimethylpyridine
##STR00045##
[0398] 5-bromo-4,6-dimethylpyridin-2-amine (CAS No. 89856-44-0;
Aldrich) (4.00 g) was added to a mixed solution of concentrated
hydrochloric acid (24 mL) and water (24 mL). The solution was
cooled to 0.degree. C., and sodium nitrite (3.57 g) was added,
followed by stirring at the same temperature for 10 minutes.
Copper(I) chloride (5.91 g) was added to the solution, and the
mixture was stirred at 0.degree. C. for five minutes and at room
temperature for four hours and 15 minutes. The reaction mixture was
cooled to 0.degree. C., and a 5 N aqueous sodium hydroxide solution
was added to make the reaction mixture basic. Ethyl acetate was
added to the reaction mixture, followed by filtration. The organic
layer in the filtrate was separated, and the aqueous layer was
extracted with ethyl acetate. The combined organic layers were
concentrated under reduced pressure. The residue was purified by
silica gel column chromatography (ethyl acetate/n-heptane, 5%) to
give the title compound (1.79 g).
[0399] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.39 (s,
3H), 2.65 (s, 3H), 7.06 (s, 1H).
Preparation Example 22
Synthesis of 3-bromo-6-methoxy-2,4-dimethylpyridine
##STR00046##
[0401] 3-bromo-6-chloro-2,4-dimethylpyridine obtained in
Preparation Example 21 (200 mg) was added to DMF (1 mL). Sodium
methoxide (28% solution in methanol, 0.741 mL) was added to the
solution, and the mixture was stirred at 60.degree. C. for 15
hours. Water was added to the reaction mixture, followed by
extraction with diethyl ether. The organic layer was concentrated
under reduced pressure. The residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 0% to 10%) to give
the title compound (172 mg).
[0402] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.34 (s,
3H), 2.57 (s, 3H), 3.88 (s, 3H), 6.46 (s, 1H).
Preparation Example 23
Synthesis of 3-bromo-6-methoxy-2,4-dimethylpyridine
##STR00047##
[0403] (1) Synthesis of 5-bromo-4,6-dimethylpyridin-2-ol
[0404] 2-amino-5-bromo-4,6-dimethylpyridine (15 g) was dissolved in
a mixed solution of sulfuric acid (14.2 mL) and water (212 mL). A
solution of sodium nitrite (6.18 g) in water (31 mL) was added to
the solution at 0.degree. C. The reaction mixture was stirred at
mom temperature for one hour, followed by extraction with
chloroform. The organic layer was dried over anhydrous magnesium
sulfate, and the desiccant was filtered off. The filtrate was
concentrated under reduced pressure. MTBE was added to the residue
to precipitate the solid, followed by filtration. The filtration
residue was washed with MTBE to give the title compound (13.7
g).
[0405] ESI-MS m/z 204 [M+H].sup.+
(2) Synthesis of 3-bromo-6-methoxy-2,4-dimethylpyridine
[0406] A mixture of 5-bromo-4,6-dimethylpyridin-2-ol (7 g), methyl
iodide (21.6 mL) and silver carbonate (19.1 g) was stirred in a
chloroform solvent (140 mL) at room temperature for 36 hours. The
reaction mixture was subjected to silica gel pad and eluted with a
mixed solvent of (ethyl acetate:n-heptane=2:8). The resulting
solution was concentrated under reduced pressure to give the title
compound (6.98 g).
[0407] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.32-2.35
(m, 3H), 2.56-2.58 (m, 3H), 3.88 (s, 3H), 6.43-6.48 (m, 1H).
[0408] ESI-MS m/z 216 [M+H].sup.+
Preparation Example 24
Synthesis of (6-methoxy-2,4-dimethylpyridin-3-yl)boronic acid
##STR00048##
[0410] 3-bromo-6-methoxy-2,4-dimethylpyridine (150 mg) was added to
THF (3 mL). The solution was cooled to -78.degree. C., and
n-butyllithium (1.63 M solution in n-hexane, 0.468 mL) was added,
followed by stirring at the same temperature for 30 minutes.
Trimethyl borate (0.108 mL) was added to the reaction mixture, and
the mixture was stirred at -78.degree. C. for 10 minutes and at
room temperature for 50 minutes. A saturated aqueous ammonium
chloride solution was added to the reaction mixture, and the
reaction mixture was concentrated under reduced pressure. THF was
distilled off. The resulting residue was filtered. The solid
collected by filtration was washed with water and n-heptane to give
the title compound (41 mg).
[0411] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.31 (s,
3H), 2.48 (s, 3H), 3.89 (s, 3H), 4.77 (brs, 2H), 6.35 (s, 1H).
Preparation Example 25
Synthesis of 3-chloro-2-methoxy-4,6-dimethylpyridine
##STR00049##
[0412] (1) Synthesis of
3-bromo-5-chloro-6-methoxy-2,4-dimethylpyridine
[0413] 3-bromo-6-methoxy-2,4-dimethylpyridine obtained in
Preparation Example 22 (800 mg) was added to DMF (4 mL). NCS (494
mg) was added to the solution, and the mixture was stirred at
80.degree. C. for 14 hours. The reaction mixture was concentrated
under reduced pressure. The resulting residue was purified by
silica gel column chromatography (ethyl acetate/n-heptane, 5% to
30%). The title compound (930 mg) was obtained.
[0414] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.51 (s,
3H), 2.56 (s, 3H), 3.98 (s, 3H).
(2) Synthesis of 3-chloro-2-methoxy-4,6-dimethylpyridine
[0415] 3-bromo-5-chloro-6-methoxy-2,4-dimethylpyridine (930 mg) was
added to THF (10 mL). The solution was cooled to -78.degree. C.,
and n-butyllithium (2.6 M solution in n-hexane, 1.428 mL) was
added, followed by stirring at the same temperature for one hour. A
saturated aqueous ammonium chloride solution was added to the
reaction mixture, followed by extraction with DCM. The organic
layer was washed with brine and dried over sodium sulfate. The
desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 5% to 30%) to give the title compound (300
mg).
[0416] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.31 (s,
3H), 2.38 (s, 3H), 3.99 (s, 3H), 6.62 (s, 1H).
Preparation Example 26
Synthesis of 3-bromo-2-methoxy-4,6-dimethylpyridine
##STR00050##
[0417] (1) Synthesis of 3-bromo-2-chloro-4,6-dimethylpyridine
[0418] 2-chloro-4,6-dimethylpyridin-3-amine (2.85 g) was dissolved
in hydrobromic acid (15 mL, 48% aqueous solution), and the solution
was cooled to 0.degree. C. A solution of sodium nitrite (1.51 g) in
water (2 mL) was slowly added dropwise to the solution, and the
mixture was stirred at 0.degree. C. for 15 minutes. A suspension of
copper(I) bromide (4.18 g) in hydrobromic acid (5 mL, 48% aqueous
solution) was added dropwise to the solution, and the mixture was
stirred at 0.degree. C. for 10 minutes and then at 60.degree. C.
for one hour. The reaction mixture was cooled to room temperature,
followed by extraction with ethyl acetate. The organic layer was
directly subjected to an NH-silica gel pad and eluted with ethyl
acetate. The resulting solution was concentrated under reduced
pressure, and the residue was purified by NH silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 30%) to give the
title compound (2.97 g).
[0419] ESI-MS m/z 220 [M+H].sup.+
(2) Synthesis of 3-bromo-2-methoxy-4,6-dimethylpyridine
[0420] A mixture of 3-bromo-2-chloro-4,6-dimethylpyridine (2.97 g)
and sodium methoxide (11.0 mL, 28% solution in methanol) was
stirred in a DMF solvent (30 mL) at 80.degree. C. for 36 hours.
Water was added to the reaction mixture, followed by extraction
with diethyl ether. The organic layer was concentrated under
reduced pressure, and the residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 10%) to give the
title compound (2.33 g).
[0421] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.33-2.34
(m, 3H), 2.36-2.38 (m, 3H), 3.98 (s, 3H), 6.61-6.64 (m, 1H).
[0422] ESI-MS m/z 216 [M+H].sup.+
Preparation Example 27
Synthesis of (2-methoxy-4,6-dimethylpyridin-3-yl)boronic acid
##STR00051##
[0424] The title compound was synthesized in accordance with
Preparation Example 24 using
3-bromo-2-methoxy-4,6-dimethylpyridine.
[0425] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.37-2.42
(s, 3H), 2.47-2.52 (s, 3H), 3.99 (s, 3H), 5.91 (s, 2H), 6.60-6.67
(s, 1H).
Preparation Example 28
Synthesis of 4-bromo-2-methoxy-3,5-dimethylpyridine
##STR00052##
[0426] (1) Synthesis of 3,5-dibromo-2-methoxypyridin-4-amine
[0427] A mixture of 2-methoxy-pyridin-4-ylamine (15 g) and NBS
(47.3 g) was stirred in an acetic acid solvent (150 mL) at room
temperature for three hours. The reaction mixture was concentrated
under reduced pressure, and a 5 M aqueous sodium hydroxide solution
(200 mL) was added to the residue at 0.degree. C., followed by
extraction with diethyl ether. The organic layer was directly
purified by a silica gel pad (ethyl acetate/n-heptane, 10%) to give
the title compound (32.4 g).
[0428] ESI-MS m/z 283 [M+H].sup.+
(2) Synthesis of 2-methoxy-3,5-dimethylpyridin-4-amine
[0429] A mixture of 3,5-dibromo-2-methoxypyridine-4-amine (16 g),
trimethylboroxin (19.8 mL), Pd(dppf)Cl.sub.2-DCM complex (4.15 g)
and potassium carbonate (23.5 g) was heated under reflux in a mixed
solvent of 1,4-dioxane (320 mL) and water (32 mL) for 12 hours. The
reaction mixture was cooled to room temperature and then
concentrated under reduced pressure. Water and ethyl acetate were
added to the residue, followed by filtration through Celite.TM..
The filtrate was extracted with ethyl acetate, and the organic
layer was subjected to a silica gel pad (NH-silica gel) and eluted
with ethyl acetate. NH-silica gel (30 g) was added to the resulting
solution, and the mixture was concentrated under reduced pressure.
The residue was purified by NH silica gel column chromatography
(ethyl acetate/n-heptane, 0% to 30%) to give the title compound
(4.43 g).
[0430] ESI-MS m/z 153 [M+H].sup.+
(3) Synthesis of 4-bromo-2-methoxy-3,5-dimethylpyridine
[0431] A mixture of copper(I) bromide (12.1 g) and t-butyl nitrite
(7.07 mL) was stirred in an acetonitrile solvent (80 mL) at
70.degree. C. for 10 minutes. A solution of
2-methoxy-3,5-dimethylpyridin-4-amine (3.9 g) in acetonitrile (40
mL) was added dropwise to the reaction mixture at the same
temperature, and the mixture was stirred at 70.degree. C. for one
hour. The reaction mixture was cooled to room temperature and then
concentrated under reduced pressure. Ethyl acetate and a saturated
aqueous sodium bicarbonate solution were added to the residue, and
the mixture was stirred at room temperature for 30 minutes. The
reaction mixture was filtered through Celite.TM., and the filtrate
was extracted with ethyl acetate. The organic layer was
concentrated under reduced pressure, and the residue was purified
by NH silica gel column chromatography (n-heptane, 100%, then
NH-silica gel pad, n-heptane, 100%) to give the title compound (4.3
g).
[0432] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.28-2.29
(m, 3H), 2.29-2.31 (m, 3H), 3.93 (s, 3H), 7.77-7.84 (m, 1H).
[0433] ESI-MS m/z 216 [M+H].sup.+
Preparation Example 29
Synthesis of (2-methoxy-3,5-dimethylpyridin-4-yl)boronic acid
##STR00053##
[0434] (1) Synthesis of 2-fluoro-3-iodo-5-methylpyridine
[0435] Diisopropylamine (92 mL) was added to THF (1.2 L), and the
mixture was cooled to -18.degree. C. in a nitrogen atmosphere. A
2.69 M solution of n-butyllithium in hexane (224 mL) was added
dropwise to the solution. After completion of the dropwise
addition, the mixture was warmed to -5.degree. C. with stirring
over 20 minutes. The reaction mixture was cooled to -73.degree. C.
A solution of 2-fluoro-5-methylpyridine (61 g) in THF (240 mL) was
added dropwise to the reaction mixture. The reaction mixture was
stirred at -75.degree. C. for 3.5 hours. A solution of iodine (139
g) in THF (24 mL) was added dropwise to the reaction mixture. The
reaction mixture was stirred at -75.degree. C. for one hour and 55
minutes. After completion of the reaction, water (220 mL) was added
to the reaction mixture at the same temperature. The mixture was
stirred at the same temperature for five minutes. The reaction
mixture was returned to room temperature, and water (1.2 L) was
then added. A solution of sodium thiosulfate pentahydrate (136 g)
in water (300 mL), and water (300 mL) were added to the mixture,
followed by stirring for 10 minutes. The mixture was extracted with
MTBE (1.2 L). The organic layer was washed with brine (500 mL). The
combined aqueous layers were extracted with MTBE (1 L). The
combined organic layers were dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration, and the filtrate
was concentrated under reduced pressure. n-heptane was added to the
residue, followed by cooling. The precipitated solid was collected
by filtration. The residue was washed with n-heptane. The filtrate
was cooled, and the precipitated solid was collected by filtration.
This operation was repeated five times to give the title compound
(109.69 g).
[0436] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.29-2.31
(m, 3H), 7.93-8.14 (m, 214).
[0437] ESI-MS m/z 238 [M+H].sup.+
(2) Synthesis of 2-fluoro-4-iodo-3,5-dimethylpyridine
[0438] Diisopropylamine (88 mL) was added to THF (1.2 L), and the
mixture was cooled to -18.degree. C. in a nitrogen atmosphere. A
2.69 M solution of n-butyllithium in hexane (215 mL) was added
dropwise to the solution. After completion of the dropwise
addition, the mixture was warmed to -5.degree. C. with stirring
over 30 minutes. The reaction mixture was cooled to -72.degree. C.
A solution of 2-fluoro-3-iodo-5-methylpyridine (109.69 g) in TIE
(240 mL) was added dropwise to the reaction mixture. The reaction
mixture was stirred at -74.degree. C. for 1.5 hours. A solution of
methyl iodide (36 mL) in THF (160 mL) was added dropwise to the
reaction mixture. The reaction mixture was stirred at -70.degree.
C. to -74.degree. C. for two hours. After completion of the
reaction, water (200 mL) was added to the reaction mixture at the
same temperature. The mixture was stirred at the same temperature
for two minutes. The reaction mixture was returned to room
temperature, and water (1.2 L) was then added. The mixed solution
was stirred for three minutes. Water (300 mL) was further added.
The mixture was extracted with MTBE (1.2 L). The organic layer was
washed with brine (500 mL). The combined aqueous layers were
extracted with MTBE (1 L). The combined organic layers were dried
over anhydrous magnesium sulfate. The desiccant was removed by
filtration, and the filtrate was concentrated under reduced
pressure. n-heptane (100 mL) was added to the residue, followed by
cooling. The precipitated solid was collected by filtration. The
residue was washed with n-heptane. The filtrate was cooled, and the
precipitated solid was collected by filtration. This operation was
repeated twice to give the title compound (86.9 g).
[0439] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.39-2.40
(m, 6H), 7.80-7.82 (m, 1H).
[0440] ESI-MS m/z 252 [M+H].sup.+
(3) Synthesis of 4-iodo-2-methoxy-3,5-dimethylpyridine
[0441] A 28% solution of sodium methoxide in methanol (185 mL) was
added to 2-fluoro-4-iodo-3,5-dimethylpyridine (97.4 g) in THF (954
mL) at 20.degree. C. The mixture was stirred at 55.degree. C. to
65.degree. C. for two hours. The reaction mixture was cooled and
then partitioned by adding MTBE (1 L) and water (1 L). The organic
layer was washed with brine. The combined aqueous layers were
extracted with MTBE (500 mL.times.2). The combined organic layers
were dried over anhydrous magnesium sulfate. The desiccant was
removed by filtration, and the filtrate was concentrated under
reduced pressure. n-heptane (50 mL) was added to the residue, and
the mixture was stirred at 0.degree. C. for one hour. The
precipitated solid was collected by filtration. The solid was
washed with cooled n-heptane (10 mL). The title compound (42.6 g)
was obtained. The filtrate was concentrated under reduced pressure.
n-heptane (5 mL) was added to the residue, and the mixture was
stirred at 0.degree. C. for 30 minutes. The precipitated solid was
collected by filtration. The solid was washed with cooled n-heptane
(2 mL). The title compound (20.2 g) was obtained. The filtrate was
concentrated under reduced pressure. n-heptane (5 mL) was added to
the residue, and the mixture was stirred at 0.degree. C. for 30
minutes. The precipitated solid was collected by filtration. The
solid was washed with cooled n-heptane (2 mL). The title compound
(10.7 g) was obtained. The combined title compound (73.5 g) was
obtained.
[0442] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.33-2.34
(m, 3H), 2.36-2.38 (m, 3H), 3.92 (s, 3H), 7.76 (s, 1H).
[0443] ESI-MS m/z 264 [M+H].sup.+
(4) Synthesis of (2-methoxy-3,5-dimethylpyridin-4-yl)boronic
acid
[0444] 4-iodo-2-methoxy-3,5-dimethylpyridine (2.0 g) in THF (40 mL)
was cooled to -78.degree. C. A 2.69 M solution of n-butyllithium in
hexane (6.5 mL) was added dropwise to the solution over 10 minutes.
The mixture was stirred at -78.degree. C. for 20 minutes.
Triisopropyl borate (5.26 mL) was added dropwise to the mixture
over five minutes. The mixture was stirred with warming to
20.degree. C. over 1.5 hours. Water was added to the reaction
mixture, followed by extraction with ethyl acetate. The aqueous
layer was neutralized with citric acid. The aqueous layer was
extracted with ethyl acetate. The combined organic layers were
dried over anhydrous magnesium sulfate. The desiccant was removed
by filtration, and the filtrate was then concentrated under reduced
pressure. The residue was triturated by adding MTBE. The
precipitated solid was collected by filtration. This solid is
called first crop. The filtrate was concentrated under reduced
pressure. The residue was triturated by adding MTBE. The
precipitated title compound (551 mg) was collected by filtration.
The first crop were suspended in ethyl acetate. Trituration was
performed by adding a small amount of MTBE. The precipitated title
compound (553.3 mg) was collected by filtration. The filtrate was
concentrated under reduced pressure. The residue was triturated by
adding MTBE. The precipitated title compound (121:1 mg) was
collected by filtration. The combined title compound (1.23 g) was
obtained.
[0445] .sup.1H-NMR. (400 MHz, CDCl.sub.3) .delta. (ppm): 2.19-2.20
(m, 3H), 2.23-224 (m, 3H), 3.91 (s, 3H), 494 (brs, 2H), 7.74 (s,
1H).
[0446] ESI-MS m/z 182 [M+H].sup.+
Preparation Example 30
Synthesis of 3-bromo-6-(difluoromethyl)-2,4-dimethylpyridine
##STR00054##
[0447] (1) Synthesis of
3-bromo-6-(bromomethyl)-2,4-dimethylpyridine
[0448] A mixture of 3-bromo-2,4,6-trimethylpyridine (15.6 g), NBS
(13.9 g) and benzoyl peroxide (567 mg) was heated under reflux in a
carbon tetrachloride solvent (300 mL) for two hours. The reaction
mixture was cooled to room temperature and then filtered, and the
filtration residue was washed with carbon tetrachloride. The
resulting filtrate was concentrated under reduced pressure, and the
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 10%) to give the title compound (8.00
g).
[0449] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 239-2.42
(m, 3H), 2.66-2.69 (m, 3H), 4.44 (s, 2H), 7.15 (s, 1H).
(2) Synthesis of 5-bromo-4,6-dimethylpicolinaldehyde
[0450] Sodium methoxide (1.16 g) was added to a solution of
2-nitropropane (1.96 mL) in methanol (40 mL) at mom temperature,
and the mixture was stirred at the same temperature for 20 minutes.
3-bromo-6-(bromomethyl)-2,4-dimethylpyridine (2.00 g) was added to
the reaction mixture, and the mixture was stirred at 50.degree. C.
for five hours. The reaction mixture was concentrated under reduced
pressure, and water was added to the residue, followed by
extraction with ethyl acetate. The organic layer was concentrated
under reduced pressure, and the residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 0% to 50%) to give
the title compound (565 mg).
[0451] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.42-2.55
(m, 3H), 2.72-2.85 (m, 3H), 7.60-7.70 (m, 1H), 10.00 (s, 1H).
(3) Synthesis of
3-bromo-6-(difluoromethyl)-2,4-dimethylpyridine
[0452] BAST (1.07 mL) was added to a solution of
5-bromo-4,6-dimethylpicolinealdehyde (565 mg) in DCM (10 mL) at
0.degree. C., and the mixture was stirred while gradually warming
to room temperature for 12 hours. A saturated aqueous sodium
bicarbonate solution was added to the reaction mixture, followed by
extraction with DCM. The organic layer was concentrated under
reduced pressure, and the residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 50%) to give the
title compound (415 mg).
[0453] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.47 (s,
3H), 2.71 (s, 3H), 6.39-6.70 (m, 1H), 7.33 (s, 1H).
Preparation Example 31
Synthesis of
3-bromo-(6-fluoromethyl)-2-methoxy-4-methylpyridine
##STR00055##
[0454] (1) Synthesis of
3-bromo-(6-fluoromethyl)-2-methoxy-4-methylpyridine
[0455] A mixture of 3-bromo-2-methoxy-4,6-dimethylpyridine obtained
in Preparation Example 26(2) (300 mg), NBS (247 mg) and benzoyl
peroxide (10.1 mg) was heated under reflux in a carbon
tetrachloride solvent (6 mL) for two hours. The reaction mixture
was cooled to room temperature and then filtered. The resulting
filtrate was concentrated under reduced pressure. The residue was
dissolved in TBAF (5.55 in L, 1 M solution in THF), and the mixture
was stirred at room temperature for two hours. The reaction mixture
was concentrated under reduced pressure, and the residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 5%) and subsequently by NH silica gel
column chromatography (ethyl acetate/n-heptane, 0% to 5%) to give
the title compound (136 mg).
[0456] ESI-MS m/z 234 [M+H].sup.+
Preparation Example 32
Synthesis of 3-bromo-6-(fluoromethyl)-2,4-dimethylpyridine
##STR00056##
[0457] (1) Synthesis of
3-bromo-6-(fluoromethyl)-2,4-dimethylpyridine
[0458] A mixture of 3-bromo-6-(bromomethyl)-2,4-dimethylpyridine
obtained in Preparation Example 30(1) (2.00 g) and TBAF (35.8 mL, 1
M solution in THF) was stirred at room temperature for two hours.
The reaction mixture was concentrated under reduced pressure, and
the residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 50%) to give the title compound (572
mg).
[0459] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.44 (s,
3H), 2.67 (s, 3H), 5.28-5.47 (m, 2H), 7.14-7.19 (m, 1H).
Preparation Example 33
Synthesis of 3-bromo-2-(fluoromethyl)-4,6-dimethylpyridine
##STR00057##
[0460] (1) Synthesis of
3-bromo-2-(bromomethyl)-4,6-dimethylpyridine
[0461] A mixture of 3-bromo-2,4,6-trimethylpyridine (15.6 g), NBS
(13.9 g) and benzoyl peroxide (567 mg) was heated under reflux in a
carbon tetrachloride solvent (300 mL) for two hours. The reaction
mixture was cooled to room temperature and then filtered, and the
filtration residue was washed with carbon tetrachloride. The
resulting filtrate was concentrated under reduced pressure, and the
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 10%) to give the title compound (3.51
g).
[0462] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.37-2.41
(m, 3H), 2.47 (s, 3H), 4.72 (s, 2H), 6.97 (s, 1H).
(2) Synthesis of 3-bromo-2-(fluoromethyl)-4,6-dimethylpyridine
[0463] A mixture of 3-bromo-2-(bromomethyl)-4,6-dimethylpyridine
(1.00 g) and TBAF (17.9 mL, 1 M solution in THF) was stirred at
room temperature for two hours. The reaction mixture was
concentrated under reduced pressure, and the residue was purified
by silica gel column chromatography (ethyl acetate/n-heptane, 0% to
30%) to give the title compound (651 mg).
[0464] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.40 (s,
3H), 2.51 (s, 3H), 5.49-5.67 (m, 2H), 7.05 (s, 1H).
Preparation Example 34
Synthesis of 3-bromo-2-(difluoromethyl)-4,6-dimethylpyridine
##STR00058##
[0465] (1) Synthesis of 3-bromo-4,6-dimethylpicolinaldehyde
[0466] Sodium methoxide (581 mg) was added to a solution of
2-nitropropane (0.982 mL) in methanol (20 mL) at room temperature,
and the mixture was stirred at the same temperature for 20 minutes.
3-bromo-2-(bromomethyl)-4,6-dimethylpyridine obtained in
Preparation Example 33(1) (1.00 g) was added to the reaction
mixture, and the mixture was stirred at 50.degree. C. for five
hours. The reaction mixture was concentrated under reduced
pressure, and water was added to the residue, followed by
extraction with ethyl acetate. The organic layer was concentrated
under reduced pressure, and the residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 0% to 50%) to give
the title compound (467 mg).
[0467] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.45-2.48
(m, 3H), 2.58 (s, 3H), 7.23-7.25 (m, 1H), 10.32 (s, 1H).
(2) Synthesis of
3-bromo-2-(difluoromethyl)-4,6-dimethylpyridine
[0468] BAST (0.884 mL) was added to a solution of
3-bromo-4,6-dimethylpicolinealdehyde (467 mg) in DCM (10 mL) at
0.degree. C., and the mixture was stirred while gradually warming
to room temperature for 12 hours. A saturated aqueous sodium
bicarbonate solution was added to the reaction mixture, followed by
extraction with DCM. The organic layer was concentrated under
reduced pressure, and the residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 50%) to give the
title compound (362 mg).
[0469] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.43 (s,
3H), 2.54 (s, 3H), 6.81-7.10 (m, 1H), 7.16 (s, 1H).
Preparation Example 35
Synthesis of
3-bromo-2-(fluoromethyl)-6-methoxy-4-methylpyridine
##STR00059##
[0470] (1) Synthesis of
3-bromo-2-(bromomethyl)-6-methoxy-4-methylpyridine
[0471] A mixture of 3-bromo-6-methoxy-2,4-dimethylpyridine obtained
in Preparation Example 22 (200 mg), NBS (165 mg) and benzoyl
peroxide (6.73 mg) was heated under reflux in a carbon
tetrachloride solvent (4 mL) for two hours. The reaction mixture
was cooled to room temperature and then filtered. The resulting
filtrate was concentrated under reduced pressure, and the residue
was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 5%) to give the title compound (126
mg).
[0472] ESI-MS m/z 296 [M+H].sup.+
(2) Synthesis of
3-bromo-2-(fluoromethyl)-6-methoxy-4-methylpyridine
[0473] A mixture of
3-bromo-2-(bromomethyl)-6-methoxy-4-methylpyridine (126 mg) and
TBAF (1.71 mL, 1 M solution in THF) was stirred at room temperature
for two hours. The reaction mixture was concentrated under reduced
pressure, and the resulting residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 0% to 10%) to give
the title compound (37 mg).
[0474] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.35-2.42
(m, 3H), 3.89-3.97 (m, 3H), 5.42-5.59 (m, 2H), 6.65 (s, 1H).
[0475] ESI-MS m/z 234 [M+H].sup.+
Preparation Example 36
Synthesis of
3-bromo-4-(fluoromethyl)-6-methoxy-2-methylpyridine
##STR00060##
[0476] (1) Synthesis of (2-chloro-6-methylpyridin-4-yl)methanol
[0477] Borane-THF complex (16.5 mL, 1.06 M solution in THF) was
added to a solution of 2-chloro-6-methylpyridine-4-carboxylic acid
(2 g) in THF (10 mL), and the mixture was heated under reflux for
12 hours. 5 M hydrochloric acid was added to the reaction mixture,
and the mixture was stirred at room temperature for 30 minutes. The
reaction mixture was neutralized by adding a saturated aqueous
sodium bicarbonate solution, followed by extraction with ethyl
acetate. The organic layer was concentrated under reduced pressure,
and the residue was purified by silica gel column chromatography
(ethyl acetate/n-heptane, 10% to 50%) to give the title compound
(1.75 g).
[0478] ESI-MS m/z 158 [M+H].sup.+
(2) Synthesis of (2-methoxy-6-methylpyridin-4-yl)methanol
[0479] Sodium methoxide (11.3 mL, 28% solution in methanol) was
added to a solution of (2-chloro-6-methylpyridin-4-yl)methanol
(1.75 g) in. DMF (18 mL), and the mixture was stirred at 80.degree.
C. for 12 hours. Subsequently, the reaction mixture was stirred at
120.degree. C. for seven hours. The reaction mixture was
concentrated under reduced pressure, and a saturated aqueous
ammonium chloride solution was added to the residue, followed by
extraction with ethyl acetate. The organic layer was concentrated
under reduced pressure, and the residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 10% to 70%) to give
the title compound (1.1 g).
[0480] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.76 (t,
J=6.1 Hz, 1H), 2.45 (s, 3H), 3.92 (s, 3H), 4.64 (d, J=6.1 Hz, 2H),
6.50-6.56 (m, 1H), 6.68-6.73 (m, 1H).
(3) Synthesis of
(3-bromo-6-methoxy-2-methylpyridin-4-yl)methanol
[0481] A mixture of (2-methoxy-6-methylpyridin-4-yl)methanol (1.1
g) and NBS (1.34 g) was stirred in an acetic acid solvent (22 mL)
at room temperature for 12 hours. A 5 M aqueous sodium hydroxide
solution was added to the reaction mixture, followed by extraction
with ethyl acetate. The organic layer was concentrated under
reduced pressure, and the residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 10% to 50%) to give the
title compound (1.32 g).
[0482] ESI-MS m/z 234 [M+H].sup.+
(4) Synthesis of
3-bromo-4-(fluoromethyl)-6-methoxy-2-methylpyridine
[0483] BAST (0.89 mL) was added to a solution of
(3-bromo-6-methoxy-2-methylpyridin-4-yl)methanol (800 mg) in DCM
(16 mL) at -60.degree. C., and the mixture was stirred while
gradually warming to room temperature for two hours and stirred at
room temperature for further one hour. A saturated aqueous sodium
bicarbonate solution was added to the reaction mixture, followed by
extraction with DCM. The organic layer was concentrated under
reduced pressure, and the residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 10%, then NH-silica
gel, ethyl acetate/n-heptane, 0% to 5%) to give the title compound
(632 mg).
[0484] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.57 (s,
3H), 3.91 (s, 3H), 5.29-5.47 (m, 2H), 6.70 (s, 1H).
[0485] ESI-MS m/z 234 [M+H].sup.+
Preparation Example 37
Synthesis of 3-bromo-5-chloro-2-methoxy-4-methylpyridine
##STR00061##
[0486] (1) Synthesis of 3-bromo-2-chloro-4-methylpyridine
[0487] 3-amino-2-chloro-4-methylpyridine (2 g) was added to a mixed
solvent of a 48% aqueous hydrogen bromide solution (17 mL) and
water (12 mL). Sodium nitrite (2.5 g) was added to the solution at
0.degree. C. Further, bromine (22 mL) was added. The reaction
mixture was warmed to room temperature and stirred for 12 hours.
The reaction mixture was partitioned by adding a 5 N aqueous sodium
hydroxide solution and ethyl acetate. The organic layer was washed
with brine and then dried over anhydrous magnesium sulfate. The
desiccant was removed by filtration. The filtrate was concentrated
under reduced pressure to give the title compound (1.7 g).
[0488] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.51 (s,
3H), 7.01-7.24 (m, 1H), 8.06-8.35 (m, 1H).
(2) Synthesis of 3-bromo-2-methoxy-4-methylpyridine
[0489] 3-bromo-2-chloro-4-methylpyridine (1 g) was added to DMF
(5.6 mL). Sodium methoxide (28% solution in methanol, 4.6 mL) was
added to the solution, and the mixture was stirred at 100.degree.
C. for 12 hours. The reaction mixture was partitioned by adding
ethyl acetate and water. The organic layer was dried over anhydrous
magnesium sulfate. The desiccant was removed by filtration, and the
filtrate was concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 5% to 30%) to give the title compound (1.1
g).
[0490] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.40 (s,
3H), 4.00 (s, 3H), 6.77 (d, J---5.1 Hz, 1H), 7.94 (d, Hz, 1H).
(3) Synthesis of 3-bromo-5-chloro-2-methoxy-4-methylpyridine
[0491] 3-bromo-2-methoxy-4-methylpyridine (100 mg) was added to DMF
(575 .mu.L). NCS (72.5 mg) was added to the solution, and the
mixture was stirred at 80.degree. C. for three hours. The reaction
mixture was concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 5% to 30%) to give the title compound (100
mg).
[0492] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.51 (s,
3H), 3.98 (s, 3H), 8.02 (s, 1H).
Preparation Example 38
Synthesis of 3-bromo-6-fluoro-2,4-dimethylpyridine
##STR00062##
[0494] 2-amino-5-bromo-4,6-dimethylpyridine (2 g) was suspended in
fluoroboric acid (48% aqueous solution, 7.5 mL). Sodium nitrite
(890 mg) dissolved in water (3 mL) was added to the solution at
0.degree. C. The reaction mixture was stirred at 0.degree. C. for
10 minutes. The precipitated solid was collected by filtration and
suspended in n-heptane (100 mL). The solution was stirred with
heating under reflux for two hours. After cooling to room
temperature, the precipitated solid was collected by filtration.
The resulting solid was dried under reduced pressure to give the
title compound (500 mg).
[0495] .sup.1H-NMR (400 MHz., CDCl.sub.3) .delta. (ppm): 2.43 (s,
3H), 2.62 (s, 3H), 6.67 (s, 1H).
Preparation Example 39
Synthesis of 3-bromo-4-chloro-2,6-dimethylpyridine
##STR00063##
[0496] (1) Synthesis of 4-chloro-2,6-dimethylpyridine
[0497] 2,6-dimethyl-4-hydroxypyridine (1 g) was added to phosphoryl
chloride (5 mL). The solution was stirred at 100.degree. C. for six
hours. The reaction mixture was partitioned by adding water, a 5 N
aqueous sodium hydroxide solution and ethyl acetate. The organic
layer was washed with brine and then dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration. The filtrate was
concentrated under reduced pressure to give the title compound
(1.15 g).
[0498] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.51 (s,
6H), 6.99 (s, 2H).
(2) Synthesis of 3-bromo-4-chloro-2,6-dimethylpyridine
[0499] 4-chloro-2,6-dimethylpyridine (1.5 g) was added to a mixed
solvent of trifluoroacetic acid (3 mL) and concentrated sulfuric
acid (6 mL). NBS (22 g) was added to the solution, and the mixture
was stirred at room temperature for 12 hours. A 5 N aqueous sodium
hydroxide solution was added to the reaction mixture, followed by
separation with ethyl acetate. The organic layer was washed with
brine and then dried over anhydrous magnesium sulfate. The
desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 5% to 30%) to give the title compound (500
mg).
[0500] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.46 (s,
3H), 2.49 (s, 3H), 7.11 (s, 1H).
[0501] ESI-MS m/z 222 [M+H].sup.+
Preparation Example 40
Synthesis of 3-bromo-5-chloro-2-methoxy-4,6-dimethylpyridine
##STR00064##
[0502] (1) Synthesis of 2-methoxy-4,6-dimethylpyridine
[0503] 2-chloro-4,6-dimethylpyridine (CAS number: 30838-93-8) (400
mg) was added to DMF (3.3 mL). Sodium methoxide (28% solution in
methanol, 2.6 mL) was added to the solution, and the mixture was
stirred at 100.degree. C. for 12 hours. The reaction mixture was
partitioned by adding ethyl acetate and water. The organic layer
was dried over anhydrous magnesium sulfate. The desiccant was
removed by filtration. The filtrate was concentrated under reduced
pressure to give the title compound (380 mg) as a 50% solution in
DMF.
[0504] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.24 (s,
3H), 2.40 (s, 3H), 3.89 (s, 3H), 6.35 (s, 1H), 6.56 (s, 1H).
(2) Synthesis of
3-bromo-5-chloro-2-methoxy-4,6-dimethylpyridine
[0505] 2-methoxy-4,6-dimethylpyridine (380 mg) was added to DMF (3
mL). NCS (407 mg) was added to the solution, and the mixture was
stirred at 80.degree. C. for one hour. Thereafter, NBS (542 mg) was
added to the solution, followed by stirring for one hour. The
reaction mixture was concentrated under reduced pressure. The
resulting residue was purified by silica gel column chromatography
(ethyl acetate/n-heptane, 5% to 30%) to give the title compound
(600 mg).
[0506] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.50 (s,
3H), 2.51 (s, 3H), 3.97 (s, 3H). ESI-MS m/z 252 [M+11].sup.+
Preparation Example 41
Synthesis of 3-bromo-5-fluoro-2-methoxy-4-methylpyridine
##STR00065##
[0507] (1) Synthesis of
3-bromo-5-fluoro-4-methylpyridyl-2-amine
[0508] 5-fluoro-4-methylpyridyl-2-amine (2 g) was added to
acetonitrile (14 mL). NBS (3.1 g) was added to the solution. The
reaction mixture was stirred at room temperature for five hours.
The reaction mixture was concentrated under reduced pressure, and
the resulting residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 5% to 30%) to give the
title compound (2.4 g).
[0509] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.33 (s,
3H), 4.82 (brs, 2H), 7.84 (s, 1H).
[0510] ESI-MS m/z 207 [M+H].sup.+
(2) Synthesis of 3-bromo-2-chloro-5-fluoro-4-methylpyridine
[0511] 3-bromo-5-fluoro-4-methylpyridyl-2-amine (2.4 g) was added
to a mixed solvent of concentrated hydrochloric acid (11 mL) and
water (11 mL). Sodium nitrite (2.1 g) and copper(I) chloride (3.5
g) were added to the solution, and the mixture was stirred at room
temperature for 12 hours. A 5 N aqueous sodium hydroxide solution
and ethyl acetate were added to the reaction mixture, and the
insoluble matter was removed by filtration through a glass filter.
The filtrate was separated. The organic layer was washed with brine
and dried over anhydrous magnesium sulfate. The desiccant was
removed by filtration, and the filtrate was concentrated under
reduced pressure. The resulting residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 5% to 30%) to give
the title compound (340 mg).
[0512] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.44 (s,
3H), 8.16 (s, 1H).
[0513] ESI-MS m/z 226 [M+H].sup.+
(3) Synthesis of 3-bromo-5-fluoro-2-methoxy-4-methylpyridine
[0514] 3-bromo-2-chloro-5-fluoro-4-methylpyridine (340 mg) was
added to DMF (1.8 mL). Sodium methoxide (28% solution in methanol,
5.4 mL) was added to the solution, and the mixture was stirred at
80.degree. C. for two hours. Water was added to the reaction
mixture. The precipitated solid was collected by filtration to give
the title compound (240 mg).
[0515] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.38 (s,
3H), 3.92 (s, 3H), 7.86 (s, 1H).
[0516] ESI-MS m/z 222 [M+H].sup.+
Preparation Example 42
Synthesis of 5-bromo-4,6-dimethylpicolinonitrile
##STR00066##
[0517] (1) Synthesis of 5-amino-4,6-dibromopicolinonitrile
[0518] 5-amino-2-cyanopyridine (2 g) was added to a 48% aqueous
hydrogen bromide solution (14 mL). Bromine (2.2 mL) was added to
the solution at 0.degree. C. The reaction mixture was warmed to
room temperature and stirred for six hours. The precipitated solid
was collected by filtration to give the title compound (4.5 g).
[0519] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 5.09 (brs,
2H), 7.69 (s, 1H).
[0520] ESI-MS m/z 278 [M+H].sup.+
(2) Synthesis of 5-amino-4,6-dimethylpicolinonitrile
[0521] 4,6-dibromo-5-amino-2-cyanopyridine (1 g) was dissolved in a
mixed solvent of 1,4-dioxane (10 mL) and water (1 mL).
Trimethylboroxin (1.3 g), Pd(dppf)Cl.sub.2-DCM complex (264 mg) and
potassium carbonate (1.5 mg) were added to the solution, and the
mixture was reacted using a microwave reactor at 140.degree. C. for
four hours. The reaction mixture was returned to mom temperature
and then partitioned by adding ethyl acetate and water. The organic
layer was washed with brine and dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration, and the filtrate
was concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 100%) to give the title compound (390
mg).
[0522] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.18 (s,
3H), 2.44 (s, 3H), 4.05 (brs, 2H), 7.28 (s, 1H).
(3) Synthesis of 5-bromo-4,6-dimethylpicolinonitrile
[0523] 5-amino-4,6-dimethylpicolinonitrile (390 mg) was added to
aqueous hydrogen bromide (2.9 mL). Bromine (164 .mu.l) and sodium
nitrite (467 mg) were added to the solution at 0.degree. C. The
solution was warmed to room temperature and stirred for four hours.
A 5 N aqueous sodium hydroxide solution was added to the reaction
mixture, followed by separation with ethyl acetate. The organic
layer was washed with brine and then dried using magnesium sulfate.
The desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 0% to 30%) to give the title compound (300
mg).
[0524] .sup.1H-NMR (400 MHz, CDCl.sub.3) (ppm): 2.47 (s, 3H), 2.72
(s, 3H), 7.40 (s, 1H).
[0525] ESI-MS m/z 213 [M+H].sup.+
Preparation Example 43
Synthesis of 3-bromo-6-(difluoromethoxy)-2,4-dimethylpyridine
##STR00067##
[0526] (1) Synthesis of
3-bromo-6-(difluoromethoxy)-2,4-dimethylpyridine
[0527] A mixture of 5-bromo-4,6-dimethylpyridin-2-ol obtained in
Preparation Example 23(1) (500 mg),
2-(fluorosulfonyl)difluoroacetic acid (0.307 mL) and sodium sulfate
(70.3 mg) was stirred in an acetonitrile solvent (10 mL) at room
temperature for 3.5 hours. A saturated aqueous sodium bicarbonate
solution was added to the reaction mixture, and the mixture was
then concentrated under reduced pressure. The residue was extracted
with ethyl acetate, and the organic layer was concentrated under
reduced pressure. The residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 0% to 10%) to give the
title compound (68.6 mg).
[0528] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.38-2.41
(m, 3H), 2.57-2.60 (m, 3H), 6.61-6.64 (m, 1H), 7.25-7.63 (m,
1H).
[0529] ESI-MS m/z 252 [M+H].sup.+
Preparation Example 44
Synthesis of 3-bromo-2-ethoxy-4-methylpyridine
##STR00068##
[0531] 3-bromo-2-chloro-4-methylpyridine obtained in Preparation
Example 37(1) (1 g) was added to a mixed solvent of ethanol (2 mL)
and DMF (5.6 mL). Sodium hydride (60% oil dispersion, 58 mg) was
added to the solution, and the mixture was stirred at 100.degree.
C. for five hours. The reaction mixture was partitioned by adding
ethyl acetate and water. The organic layer was dried over anhydrous
magnesium sulfate. The desiccant was removed by filtration, and the
filtrate was concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 5% to 30%) to give the title compound (40%
solution in n-heptane, 250 mg).
[0532] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.43 (t,
J=7.0 Hz, 3H), 2.39 (s, 3H), 4.41 (q, J=7.0 Hz, 2H), 6.57-6.88 (m,
1H), 7.80-8.04 (m, 1H).
Preparation Example 45
Synthesis of 2-(difluoromethoxy)-4-iodo-3,5-dimethylpyridine
##STR00069##
[0533] (1) Synthesis of 4-iodo-3,5-dimethylpyridin-2-ol
[0534] 4-iodo-2-methoxy-3,5-methylpyridine obtained in Preparation
Example 29(3) (3 g) and sodium iodide (4.27 g) were added to
acetonitrile (132 mL), and the mixture was stirred at room
temperature for one hour. Chlorotrimethylsilane (3.61 mL) was added
to the mixed solution, and the mixture was stirred at room
temperature for 30 minutes and then at 70.degree. C. for five
hours. The reaction mixture was cooled to room temperature, and
water and chloroform were then added. The precipitated solid was
collected by filtration to give the title compound (2.33 g).
[0535] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 2.10 (s,
3H), 2.20 (s, 3H), 7.15 (s, 1H), 11.59 (brs, 1H).
[0536] ESI-MS m/z 250 [M+H].sup.+
(2) Synthesis of
2-(difluoromethoxy)-4-iodo-3,5-dimethylpyridine
[0537] 4-iodo-3,5-dimethylpyridin-2-ol (350 mg),
2-(fluorosulfonyl)difluoroacetic acid (0.17 mL), and sodium sulfate
(39.9 mg) were added to acetonitrile (5.7 mL). The mixture was
stirred at room temperature for 3.5 hours. A saturated aqueous
sodium bicarbonate solution was added to the reaction mixture,
followed by extraction with ethyl acetate. The organic layer was
concentrated under reduced pressure to give the title compound
(378.6 mg).
[0538] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.39 (s,
3H), 2.43 (s, 3H), 7.42 (t, J=72.0 Hz, 1H), 7.79 (s, 1H).
[0539] ESI-MS m/z 300 [M+H].sup.+
Preparation Example 46
Synthesis of 2-ethoxy-4-iodo-3,5-dimethylpyridine
##STR00070##
[0541] A 20% solution of sodium ethoxide in ethanol (123 mL) was
added to a solution of 2-fluoro-4-iodo-3,5-dimethylpyridine
obtained in Preparation Example 29(2) (400 mg) in THF (5 mL), and
the mixed solution was stirred at room temperature overnight. The
reaction mixture was cooled at 0.degree. C., and MTBE (20 mL) and
water (20 mL) were then added. The organic layer was separated. The
organic layer was washed with brine. The combined aqueous layers
were extracted with MTBE. The combined organic layers were dried
over anhydrous magnesium sulfate and filtered. The filtrate was
concentrated under reduced pressure to give the title compound
(423.8 mg).
[0542] .sup.1H-NMR (400 MHz, CDCl.sub.3) (ppm): 1.38 (t, J=7.0 Hz,
3H), 2.32 (s, 3H), 2.37 (s, 3H), 4.33 (q, J=7.0 Hz, 2H), 7.74 (s,
1H).
[0543] ESI-MS m/z 278 [M+H].sup.+
Preparation Example 47
Synthesis of 4-iodo-2-isopropyloxy-3,5-dimethylpyridine
##STR00071##
[0545] Sodium hydride (60% oil dispersion, 191 mg) was added to a
solution of IPA (0.77 mL) in THF (5 mL). After foaming was stopped,
a solution of 2-fluoro-4-iodo-3,5-dimethylpyridine obtained in
Preparation Example 29 (500 mg) in THF (5 mL) was added to the
solution, and the mixture was stirred at mom temperature for two
hours. The mixture was stirred at 50.degree. C. for two hours, and
the reaction mixture was then cooled to room temperature. The
reaction mixture was cooled at 0.degree. C., and MTBE (20 mL) and
water (20 mL) were then added. The organic layer was separated. The
organic layer was washed with brine. The combined aqueous layers
were extracted with MTBE. The combined organic layers were dried
over anhydrous magnesium sulfate and filtered. The filtrate was
concentrated under reduced pressure to give the title compound (490
mg).
[0546] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.33 (d,
J=6.3 Hz, 6H), 2.31-2.32 (m, 3H), 2.34-2.35 (m, 3H), 5.21-5.27
(in., 1H), 7.73-7.75 (m, 1H).
[0547] ESI-MS m/z 292 [M+H].sup.+
Preparation Example 48
Synthesis of 3-bromo-6-isopropyloxy-2,4-dimethylpyridine
##STR00072##
[0549] KTB (222 mg) was added to a suspension of
5-bromo-4,6-dimethylpyridin-2-ol obtained in Preparation Example
23(1) (400 mg) in DME (2 mL), and the mixture was stirred at room
temperature for 30 minutes. Potassium carbonate (192 mg) and
2-iodopropane (572 mg) were added to the reaction mixture. The
mixture was heated under reflux overnight. The reaction mixture was
cooled to mom temperature, and the insoluble matter was removed by
filtration and washed with DME. The filtrate was concentrated under
reduced pressure. Chloroform was added to the residue. The solution
was washed with a 0.1 N aqueous hydrochloric acid solution. The
organic layer was dried over anhydrous magnesium sulfate and
filtered. The filtrate was concentrated under reduced pressure. The
resulting residue was purified by silica gel column chromatography
(ethyl acetate/n-heptane, 10% to 50%) to give the title compound
(133.9 mg).
[0550] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.31 (d,
J=6.25 Hz, 6H), 2.32 (s, 3H), 2.25 (s, 3H), 5.17-5.27 (m, 1H),
6.37-6.46 (m, 1H).
[0551] ESI-MS m/z 244 [M+H].sup.+
Preparation Example 49
Synthesis of 3-ethyl-4-iodo-2-methoxy-5-methylpyridine
##STR00073##
[0552] (1) Synthesis of
3-ethyl-2-fluoro-4-iodo-5-methylpyridine
[0553] The title compound was synthesized in accordance with
Preparation Examples 29(2) and 29(3) using
2-fluoro-3-iodo-5-methylpyridine and ethyl iodide as raw materials.
However, the temperature was gradually raised to -17.degree. C.
after adding ethyl iodide.
[0554] .sup.1H-NMR. (400 MHz, CDCl.sub.3) .delta. (ppm): 1.11-1.22
(m, 3H), 2.35-2.45 (m, 3H), 2.80-2.91 (m, 2H), 7.81 (s, 1H)
(2) Synthesis of 3-ethyl-4-iodo-2-methoxy-5-methylpyridine
[0555] The title compound was synthesized in accordance with
Preparation Example 29(3) using
3-ethyl-2-fluoro-4-iodo-5-methylpyridine.
[0556] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.04-1.13
(m, 3H), 2.29-2.37 (m, 3H), 2.83 (q, J=7.42 Hz, 2H), 3.89-3.93 (m,
3H), 7.76 (s, 1H)
Preparation Example 50
Synthesis of
4-(4-bromo-3,5-dimethylphenyl)-3,6-dihydro-2H-pyran
##STR00074##
[0557] (1) Synthesis of 4-bromo-3,5-dimethylphenyl
trifluoromethanesulfonate
[0558] Trifluoromethanesulfonic anhydride (2.0 mL) was added
dropwise to a solution of 4-bromo-3,5-dimethylphenol (CAS No.
7463-51-6) (2.0 g) and TEA (1.94 mL) in DCM (20 mL) under
ice-cooling over three minutes. The reaction mixture was stirred at
room temperature for 30 minutes. Ice and ethyl acetate were added
to the reaction mixture, and the organic layer was separated. The
organic layer was sequentially washed with 1 N hydrochloric acid,
water, a saturated aqueous sodium bicarbonate solution and brine,
dried over anhydrous magnesium sulfate, filtered and concentrated
under reduced pressure. The resulting residue was purified by
silica gel column chromatography (ethyl acetate/n-heptane, 5%) to
give the title compound (3.20 g).
[0559] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.45 (s,
6H), 7.01 (s, 2H).
(2) Synthesis of
4-(4-bromo-3,5-dimethylphenyl)-3,6-dihydro-2H-pyran
[0560] Potassium carbonate (1.99 g) and Pd(dppf)Cl.sub.2-DCM
complex (196 mg) were added to a solution of
4-bromo-3,5-dimethylphenyl trifluoromethanesulfonate (1.6 g) and
3,6-dihydro-2H-pyran-4-boronic acid pinacol ester (CAS No.
287944-16-5) (1.11 g) in DMF (16 mL). The reaction mixture was
stirred at 85.degree. C. for four hours. The reaction mixture was
returned to room temperature, and the reaction mixture was then
concentrated under reduced pressure. MTBE, water and brine were
added to the residue, and the organic layer was separated. The
organic layer was washed with brine, dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pressure. The
resulting residue was purified by silica gel column chromatography
(ethyl acetate/n-heptane, 2%) to give the title compound (747
mg).
[0561] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.42 (s,
6H), 2.45-2.51 (m, 2H), 3.92 (t, J=5.6 Hz, 2H), 4.30 (dd, J=6.0,
2.8 Hz, 2H), 6.08-6.12 (m, 1H), 7.09 (s, 2H).
[0562] ESI-MS m/z 267, 269 [M+H].sup.+
Preparation Example 51
Synthesis of 3-bromo-6-ethoxy-2,4-dimethylpyridine
##STR00075##
[0564] A mixture of 5-bromo-4,6-dimethylpyridin-2-ol obtained in
Preparation Example 23(1) (50 mg), ethyl iodide (2.0 mL) and silver
carbonate (1.4 g) was stirred in a chloroform solvent (10 mL) at
room temperature for 36 hours. The reaction mixture was subjected
to silica gel pad and eluted with a mixed solvent of (ethyl
acetate/n-heptane, 10%). The resulting solution was concentrated
under reduced pressure to give the title compound (550 mg).
[0565] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.36 (t,
J=7.0 Hz, 3H), 2.33 (s, 3H), 2.56 (s, 3H), 4.27 (q, J=7.0 Hz, 2H),
6.44 (s, 1H)
[0566] ESI-MS m/z 232 [M+H].sup.+
Preparation Example 52
Synthesis of (-)benzyl 2-(tetrahydrofuran-3-yl)hydrazinecarboxylate
and (+)-benzyl 2-(tetrahydrofuran-3-yl)hydrazinecarboxylate
##STR00076##
[0568] A saturated aqueous sodium bicarbonate solution (30 mL) was
added to a solution of (.+-.)-benzyl
2-(tetrahydrofuran-3-yl)hydrazinecarboxylate obtained in
Preparation Example 12-(2) (11.5 g) in MTBE (110 mL). The mixture
was stirred for 10 minutes at room temperature, and the organic
layer was then separated. The resulting organic layer was
sequentially washed with saturated sodium bicarbonate and brine and
dried over anhydrous magnesium sulfate, and the desiccant was
removed by filtration. The filtrate was concentrated under reduced
pressure. The resulting residue was purified by silica gel column
chromatography (ethyl acetate/hexane, 25 to 50%), and the target
fraction was concentrated. Diethyl ether (30 mL) and hexane (15 mL)
were added to the residue. The precipitated solid was collected by
filtration and dried under reduced pressure to give pure
(.+-.)-benzyl 2-(tetrahydrofuran-3-yl)hydrazinecarboxylate (6.17
g).
[0569] This product was dissolved in ethanol and filtered through a
millipore filter. The resulting filtrate was optically resolved
under two conditions. Condition 1: OD-H (20 min.PHI..times.250 mm
L), 20% IPA-hexane, 25 mL/min. Condition 2: AD-H (20
mm.PHI..times.250 mm L), 20% IPA-hexane, 24 mL/min. The target
fraction was concentrated to give the title compound with a short
retention time and a (-) optical rotation (2.60 g, >99% ee
[OD-H, 20% IPA/hexane, retention time=112 min]), and the title
compound with a long retention time and a (+) optical rotation
(2.59 g, 97.2% ee [OD-H, 20% IPA/hexane, retention time=12.4
min]).
Preparation Example 53
Synthesis of (S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride
##STR00077##
[0571] (-)-Benzyl 2-(tetrahydrofuran-3-yl)hydrazinecarboxylate (50
g) was dissolved in methanol (500 mL), and di-t-butyl dicarbonate
(92.4 g) and palladium carbon (50% wet) (5 g) were added. The
mixture was stirred at 25.degree. C. and 15 psi for 48 hours in a
hydrogen atmosphere. The reaction mixture was filtered, and the
filtrate was concentrated under reduced pressure. The resulting
residue was dissolved in diisopropyl ether (300 mL). After cooling
at 0.degree. C., hydrochloric acid/diisopropyl ether (500 mL) was
added to the solution. The mixture was stirred at 10.degree. C. for
14 hours. The precipitated solid was collected by filtration. The
same operation from (-)-benzyl
2-(tetrahydrofuran-3-yl)hydrazinecarboxylate (70 g) was performed
nine times, and the same operation from (-)-benzyl
2-(tetrahydrofuran-3-yl)hydrazinecarboxylate (50 g) was performed
once. The resulting solid was triturated with DCM/ethanol (10/1) (1
L) for two hours. The precipitated solid was collected by
filtration. The resulting solid was dried under reduced pressure to
give the title compound (235 g).
[0572] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 1.87-2.09
(m, 2H), 3.55-3.71 (m, 2H), 3.71-3.84 (m, 3H).
[0573] Both of the optical rotation of the Z-derivative of the
title compound and the optical rotation of the Z-derivative of
(S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride obtained in
Preparation Example 14 are negative. The retention times of both
compounds were identical according to chiral HPLC analysis.
[0574] The absolute configuration of the resulting title compound
was confirmed to be an (S)-form according to X-ray crystallography.
The result is shown in FIG. 1 as its ORTEP representation (flack
parameter=-0.05).
Preparation Example 54
Synthesis of (R)-(tetrahydrofuran-3-yl)hydrazine hydrochloride
##STR00078##
[0576] The title compound was obtained by the same method as in
Preparation Example 53 from (+)-benzyl
2-(tetrahydrofuran-3-yl)hydrazinecarboxylate.
[0577] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 1.85-2.07
(m, 2H), 3.55-3.71 (m, 2H), 3.71-3.80 (m, 3H).
Example 1
Synthesis of
7-(2,6-dimethylphenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazolo[4,3-c]qui-
nolin-4(5H)-one
##STR00079##
[0579]
7-chloro-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one obtained in Preparation Example 2
(100 mg) was dissolved in DMF (3.3 mL). 2,6-dimethylphenylboronic
acid (33 mg), Pd(PPh.sub.3).sub.4 (13 mg), potassium carbonate (91
mg) and water (0.7 mL) were added to the solution, and the mixture
was reacted using a microwave reactor at 150.degree. C. for two
hours. The reaction mixture was returned to room temperature and
then concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 30% to 50% to 80%) to give
5-(2,4-dimethoxybenzyl)-7-(2,6-dimethylphenyl)-1-(tetrahydro-2H-pyran-4-y-
l)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (80 mg). The
5-(2,4-dimethoxybenzyl)-7-(2,6-dimethylphenyl)-1-(tetrahydro-2H-pyran-4-y-
l)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (75 mg) was dissolved in
TFA. (1 mL), and the mixture was stirred at 65.degree. C. for two
hours. The reaction mixture was cooled to room temperature and then
concentrated under reduced pressure. The resulting residue was
neutralized by adding a saturated aqueous sodium bicarbonate
solution. The aqueous solution was extracted with DCM. The organic
layer was dried over anhydrous magnesium sulfate. The desiccant was
removed by filtration. The filtrate was concentrated under reduced
pressure. The resulting residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 50% to 70% to 80%) to give
the title compound (10 mg).
[0580] .sup.1H-NMR. (400 MHz, CDCl.sub.3) .delta. (ppm): 2.06 (s,
6H), 2.18-2.22 (m, 2H), 2.42-2.60 (m, 2H), 3.69-3.78 (m, 2H),
4.19-4.26 (m, 2H), 5.00-5.10 (m, 1H), 7.09-7.26 (m, 5H), 8.03 (d,
J=8.4 Hz, 1H), 8.31 (s, 1H), 8.83 (s, 1H).
[0581] ESI-MS m/z 374 [M+H].sup.+
Example 2
Synthesis of
7-(2,4,6-trimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one
##STR00080##
[0583] The title compound was obtained by the same method as in
Example 1 from
7-chloro-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one obtained in Preparation Example 2
and (2,4,6-trimethylpyridin-3-yl)boronic acid obtained in
Preparation Example 19.
[0584] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.05 (s,
3H), 2.17-2.21 (m, 2H), 2.29 (s, 3H), 2.48-2.60 (m, 2H), 2.57 (s,
3H), 3.67-3.76 (m, 2H), 4.20-4.28 (m, 2H), 5.01-5.11 (m, 1H), 6.99
(s, 1H), 7.13 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.27 (d, J=1.6 Hz, 1H),
8.05 (d, J=8.2 Hz, 1H), 8.31 (s, 1H), 10.60 (s, 1H).
[0585] ESI-MS m/z 389 [M+11].sup.+
Example 3
Synthesis of
7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
##STR00081##
[0587]
7-bromo-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one obtained in Preparation Example 1(4)
(41 mg) was dissolved in DMF (2 mL).
(6-methoxy-2,4-dimethylpyridin-3-yl)boronic acid obtained in
Preparation Example 24 (15 mg), Pd(PPh.sub.3).sub.4 (4.8 mg),
cesium carbonate (54 mg) and water (0.5 mL) were added to the
solution, and the mixture was reacted using a microwave reactor at
150.degree. C. for two hours. The reaction mixture was returned to
room temperature and then concentrated under reduced pressure. The
resulting residue was dissolved in TFA (1 mL), and the mixture was
stirred at 65.degree. C. for two hours. The reaction mixture was
cooled to room temperature and then concentrated under reduced
pressure. The resulting residue was neutralized by adding a 5 N
aqueous sodium hydroxide solution. The aqueous solution was
extracted with DCM. The organic layer was dried over anhydrous
magnesium sulfate. The desiccant was removed by filtration. The
filtrate was concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 100%) to give the title compound (3.7
mg).
[0588] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.03 (s,
3H), 2.17-2.21 (m, 2H), 2.22 (s, 3H), 2.48-2.60 (m, 2H), 3.67-3.76
(m, 2H), 3.97 (s, 3H), 4.20-4.28 (m., 2H), 5.01-5.11 (m, 1H), 6.55
(s, 1H), 7.13 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.19 (d, J=1.6 Hz, 1H),
8.03 (d, J=8.2 Hz, 1H), 8.32 (s, 1H), 10.60 (s, 1H).
[0589] ESI-MS m/z 405 [M+H].sup.+
Example 4
Synthesis of
7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
##STR00082##
[0591]
5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-7-(4,4,5,5-tet-
ramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
(100 mg) obtained in Preparation Example 1(5) was dissolved in
1,4-dioxane (4 mL). 3-chloro-2-methoxy-4,6-dimethylpyridine
obtained in Preparation Example 25 (472 mg),
[(t-Bu).sub.2P(OH)].sub.2PdCl.sub.2 (4.6 mg), cesium carbonate (119
mg) and water (1 mL) were added to the solution, and the mixture
was reacted using a microwave reactor at 130.degree. C. for four
hours. The reaction mixture was extracted with DCM. The organic
layer was washed with brine and dried over sodium sulfate. The
desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 100%) to give a 1:1 mixture of
5-(2,4-dimethoxybenzyl)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahy-
dro-2H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one and
5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazolo[4,3-c]qu-
inolin-4(5H)-one (76 mg). The mixture (76 mg) was dissolved in TFA
(1.5 mL), and the mixture was stirred at 65.degree. C. for three
hours. The reaction mixture was concentrated under reduced
pressure. DCM and a saturated aqueous sodium bicarbonate solution
were added to the resulting residue, followed by extraction with
DCM. The organic layer was washed with brine and dried over sodium
sulfate. The desiccant was removed by filtration, and the filtrate
was concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 100%) to give the title compound (22
mg).
[0592] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.10 (s,
3H), 2.15-2.23 (m, 2H), 2.47-2.59 (m, 2H), 2.48 (s, 3H), 3.65-3.73
(m, 2H), 3.86 (s, 3H), 4.20-4.26 (m, 2H), 5.01-5.10 (m, 1H), 6.74
(s, 1H), 720 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.27 (d, J=1.6 Hz, 1H),
8.01 (d, J=8.4 Hz, 1H), 8.30 (s, 1H), 10.01 (s, 1H).
[0593] ESI-MS m/z 405 [M+H].sup.+
Example 5
Synthesis of
7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(51-1)-one
##STR00083##
[0594] (1) Synthesis of ethyl
5-[2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-1-(tetrahydro-2-
H-pyran-4-yl)-1H-pyrazole-4-carboxylate
[0595] Water (5 mL), 3-bromo-2-methoxy-4,6-dimethylpyridine
obtained in Preparation Example 26 (784 mg), Pd(PPh.sub.3).sub.4
(380 mg) and cesium carbonate (2.36 g) were added to a solution of
ethyl
5-[2-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-(tet-
rahydro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylate obtained in
Preparation Example 3 (2.04 g) in 1,4-dioxane (20 mL), and the
reaction mixture was reacted at 110.degree. C. for two hours in a
nitrogen atmosphere. The reaction mixture was returned to room
temperature and then filtered through Celite.TM.. The filtrate was
concentrated under reduced pressure. Ethyl acetate (100 mL) and
water (100 mL) were added to the residue. The aqueous layer was
extracted with ethyl acetate (50 mL.times.2). The combined organic
layers were dried over anhydrous magnesium sulfate and filtered,
and the filtrate was concentrated under reduced pressure. The
residue was purified by NH silica gel column chromatography (ethyl
acetate/n-heptane, 10% to 23%). The title compound obtained by the
same method (578 mg) was combined, and the combined product was
purified again by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 70%) to give the title compound (2.07
g).
[0596] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.11-1.18
(m, 3H), 1.72-1.80 (m, 1H), 1.85-1.92 (m, 1H), 2.14 (s, 3H),
2.30-2.48 (m, 5H), 3.35-3.46 (m, 2H), 3.88 (s, 3H), 4.03-4.18 (m,
5H), 6.71-6.73 (m, 1H), 7.08-7.15 (m, 2H), 7.30-7.35 (m, 1H),
8.09-8.10 (m, 1H).
[0597] ESI-MS m/z 454 [M+H].sup.+
(2) Synthesis of
5-[2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-1-(tetrahydro-2-
H-pyran-4-yl)-1H-pyrazole-4-carboxamide
[0598] Ethyl
5-[2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-1-(tetrahydro-2-
H-pyran-4-yl]-1H-pyrazole-4-carboxylate (2.06 g) was added to
ethanol (30 mL). After stilling the suspension at 60.degree. C. for
three minutes, a 5 N aqueous sodium hydroxide solution (3.6 mL) was
added, and the mixture was stirred at 60.degree. C. to 70.degree.
C. for one hour. The reaction mixture was cooled to room
temperature and then concentrated under reduced pressure.
Chloroform (20 mL) and 5 N hydrochloric acid (6 mL) were added to
the residue. The precipitated solid was collected by filtration.
Toluene was added to the resulting solid, and the mixture was
concentrated under reduced pressure. The resulting residue was
dissolved in DMF (15 mL). CDI (935 mg) was added to the solution,
and the mixture was stirred at room temperature for one hour in a
nitrogen atmosphere. 28% aqueous ammonia (1.4 mL) was added to the
reaction mixture, and the mixture was stirred at room temperature
for five hours. The reaction mixture was concentrated under reduced
pressure. The residue was partitioned by adding chloroform (100 mL)
and water (50 mL). The aqueous layer was extracted with chloroform
(50 mL). The combined organic layers were washed with a saturated
aqueous sodium bicarbonate solution (50 mL). The washings were
extracted with chloroform (5 mL). The combined organic layers were
dried over anhydrous magnesium sulfate and filtered. The filtrate
was concentrated under reduced pressure. The residue was triturated
by adding MTBE (5 mL). The precipitated solid was collected by
filtration to give the title compound (1.5 g).
[0599] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.68-1.78
(m, 1H), 1.86-1.95 (m, 1H), 2.13 (s, 3H), 2.29-2.45 (m, 2H), 2.47
(s, 3H), 3.32-3.47 (m, 2H), 3.69 (s, 3H), 4.00-4.15 (m, 3H), 5.29
(brs, 2H), 6.72 (s, 1H), 7.14-7.26 (m, al), 7.37-7.43 (m, 1H), 8.07
(s, 1H).
[0600] ESI-MS m/z 447 [M+Na].sup.+
(3) Synthesis of
7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-py-
razolo[4,3-c]quinolin-4(51-1)-one
[0601] KTB (655 mg) was added to a solution of
5-[2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-(tetrahydro-2H--
pyran-4-yl)-1H-pyrazole-4-carboxamide (1.52 g) in NMP (15 mL), and
the mixture was stirred at 90.degree. C. for 30 minutes. KTB (40
mg) was added to the reaction mixture, and the mixture was stirred
at 90.degree. C. for 30 minutes. Further, KTB (40 mg) was added to
the reaction mixture, and the mixture was stirred at 90.degree. C.
for 30 minutes. The reaction mixture was cooled to room
temperature. Water (3 mL) was added to the reaction mixture. The
solid was precipitated. After stirring for one hour directly, the
precipitated solid was collected by filtration. The residue was
washed with water (1 mL). The resulting solid was suspended in
1-propanol/water (9/1) (2 mL) and dissolved by heating under
reflux. The solution was cooled to room temperature over one hour.
The precipitated solid was collected by filtration. The resulting
solid was dried under reduced pressure at 50.degree. C. to give the
title compound (872 mg). The instrumental data were identical to
those of the title compound synthesized in Example 4.
Example 6
Synthesis of
7-(2-methoxy-4-methylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4(5H)-one
##STR00084##
[0603]
5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-4-yl)-7-(4,4,5,5-tet-
ramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
(100 mg) obtained in Preparation Example 1(5) was dissolved in
1,4-dioxane (4 mL). 3-bromo-2-methoxy-4-methylpyridine obtained in
Preparation Example 37 (2) (55.6 mg), Pd(PPh.sub.3).sub.4 (10.6
mg), cesium carbonate (179 mg) and water (1 mL) were added to the
solution, and the mixture was reacted using a microwave reactor at
130.degree. C. for three hours. The reaction mixture was returned
to room temperature and then partitioned by adding ethyl acetate.
The organic layer was washed with brine and then dried over
magnesium sulfate. The desiccant was removed by filtration, and the
filtrate was concentrated under reduced pressure. The resulting
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 30% to 50% to 80%) to give
5-(2,4-dimethoxybenzyl)-7-(2-methoxy-4-methylpyridin-3-yl)-1-(tetrahydro--
2H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (78 mg). The
5-(2,4-dimethoxybenzyl)-7-(2-methoxy-4-methylpyridin-3-yl)-1-(tetrahydro--
2H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (78 mg) was
dissolved in TFA (1 mL), and the mixture was stirred at 65.degree.
C. for two hours. The reaction mixture was cooled to room
temperature and then concentrated under reduced pressure. The
resulting residue was neutralized by adding a saturated aqueous
sodium bicarbonate solution. The aqueous solution was extracted
with DCM. The organic layer was dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration. The filtrate was
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 70% to 80% to 100%) to give the title
compound (30 mg).
[0604] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.15 (s,
3H), 2.15-2.24 (m, 2H), 2.45-2.59 (m, 2H), 3.70 (t, J=12.0 Hz, 2H),
3.87 (s, 3H), 420-4.27 (m, 2H), 5.02-5.11 (m, 1H), 6.89 (d, J=5.1
Hz, 1H), 7.21 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.34 (d, J=1.6 Hz, 1H),
8.03 (d, J=8.6 Hz, 1H), 8.11 (d, J=5.1 Hz, 1H), 8.31 (s, 1H), 10.57
(brs, 1H).
[0605] ESI-MS m/z 391 [M+H].sup.+
[0606] The compounds of Examples 7 to 22 were synthesized as in
Example 6.
##STR00085##
TABLE-US-00001 TABLE 1 Example R.sup.2 NMR, Mass 7 ##STR00086##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.06 (s, 6H),
2.18- 2.24 (m, 2H), 2.49-2.60 (m, 2H), 3.47 (s, 3H), 3.70-3.82 (m,
2H), 4.22-4.30 (m, 2H), 4.46 (s, 2H), 4.97-5.13 (m, 1H), 7.13 (dd,
J = 8.4 Hz, 1.6 Hz, 1H), 7.14 (s, 2H), 7.19 (d, J = 1.6 Hz, 1H),
8.03 (d, J = 8.4 Hz, 1H), 8.31 (s, 1H), 9.01 (s, 1H). ESI-MS m/z
418 [M + H].sup.+ 8 ##STR00087## .sup.1H-NMR (400 MHz, CDCl.sub.3)
.delta. (ppm): 2.12 (s, 3H), 2.15- 2.24 (m, 2H), 2.26 (s, 3H),
2.47-2.61 (m, 2H), 3.64-3.77 (m, 2H), 4.21-4.30 (m, 2H), 5.02-5.13
(m, 1H), 6.76 (s, 1H), 7.12 (dd, J = 8.0 Hz, 1.2 Hz, 1H), 7.35 (d,
J = 1.2 Hz, 1H), 8.07 (d, J = 8.0 Hz, 1H), 8.32 (s, 1H), 11.34
(brs, 1H). ESI-MS m/z 393 [M + H].sup.+ 9 ##STR00088## .sup.1H-NMR
(400 MHz, CDCl.sub.3) .delta. (ppm): 2.16-2.24 (m, 2H), 2.36 (s,
3H), 2.47-2.60 (m, 2H), 2.60 (s, 3H), 3.65-3.77 (m, 2H), 4.21-4.28
(m, 2H), 5.01-5.12 (m, 1H), 7.18 (dd, J = 8.2 Hz, 1.6 Hz, 1H), 7.21
(s, 1H), 7.36 (d, J =1.6 Hz, 1H), 8.07 (d, J = 8.6 Hz, 1H), 8.32
(s, 1H), 10.86 (brs, 1H). ESI-MS m/z 409 [M + H].sup.+ 10
##STR00089## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm):
2.15-2.24 (m, 2H), 2.18 (s, 3H), 2.46-2.59 (m, 2H), 3.74-3.76 (m,
2H), 3.85 (s, 3H), 4.20-4.27 (m, 2H), 5.01-5.11 (m, 1H), 7.17 (dd,
J = 8.2 Hz, 1.6 Hz, 1H), 7.26 (d, J = 1.6 Hz, 1H), 8.04 (d, J = 8.6
Hz, 1H), 8.18 (s, 1H), 8.31 (s, 1H), 10.22 (brs, 1H). ESI-MS m/z
425 [M + H].sup.+ 11 ##STR00090## .sup.1H-NMR (400 MHz, CDCl.sub.3)
.delta. (ppm): 2.15-2.23 (m, 2H), 2.17 (s, 3H), 2.48-2.59 (m, 2H),
2.61 (s, 3H), 3.63-3.75 (m, 2H), 3.84 (s, 3H), 4.20-4.27 (m, 2H),
5.01-5.11 (m, 1H), 7.14-7.20 (m, 1H), 7.27 (s, 1H), 8.02 (d, J =
8.2 Hz, 1H), 8.30 (s, 1H), 9.44 (brs, 1H). ESI-MS m/z 439 [M +
H].sup.+ 12 ##STR00091## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.
(ppm): 2.11 (s, 3H), 2.15- 2.24 (m, 2H), 2.46-2.59 (m, 2H),
3.64-3.76 (m, 2H), 3.85 (s, 3H), 4.20-4.29 (m, 2H), 5.00-5.12 (m,
1H), 7.19 (d, J = 9.0 Hz, 1H), 7.31 (s, 1H), 8.02 (s, 1H), 8.05 (d,
J = 9.0 Hz, 1H), 8.31 (s, 1H), 10.35 (s, 1H). ESI-MS m/z 409 [M +
H].sup.+ 13 ##STR00092## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.
(ppm): 2.15 (s, 3H), 2.15- 2.25 (m, 2H), 2.36 (s, 3H), 2.48-2.62
(m, 2H), 3.65-3.77 (m,, 2H), 4.20-4.27 (m, 2H), 5.01-5.11 (m, 1H),
7.11 (dd, J = 8.4 Hz, 1.5 Hz, 1H), 7.24 (d, J = 1.5 Hz, 1H), 7.54
(s, 1H), 8.11 (d, J = 8.4 Hz, 1H), 8.32 (s, 1H), 10.45 (s, 1H).
ESI-MS m/z 400 [M + H].sup.+ 14 ##STR00093## .sup.1H-NMR (400 MHz,
CDCl.sub.3) .delta. (ppm): 2.15-2.24 (m, 2H), 2.28 (s, 3H),
2.47-2.59 (m, 2H), 3.64-3.76 (m, 2H), 3.93 (s, 3H), 4.06 (s, 3H),
4.20-4.28 (m, 2H), 5.02-5.11 (m, 1H), 7.20 (dd, J = 8.2 Hz, 1.6 Hz,
1H), 7.32 (d, J = 1.6 Hz, 1H), 8.02 (d, J = 8.6 Hz, 1H), 8.31 (s,
1H), 10.36 (s, 1H). ESI-MS m/z 422 [M + H].sup.+ 15 ##STR00094##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.94 (s, 3H), 1.96
(s, 3H), 2.15-2.26 (m, 2H), 2.47-2.61 (m, 2H), 3.66-3.76 (m, 2H),
4.01 (s, 3H), 4.20-4.29 (m, 2H), 5.01-5.11 (m, 1H), 7.09 (dd, J =
8.3 Hz, 1.4 Hz, 1H), 7.19 (d, J = 1.4 Hz, 1H), 7.95 (s, 1H), 8.05
(d, J = 8.3 Hz, 1H), 8.32 (s, 1H), 10.26 (brs, 1H). ESI-MS m/z 405
[M + H].sup.+ 16 ##STR00095## .sup.1H-NMR (400 MHz, CDCl.sub.3)
.delta. (ppm): 2.16 (s, 3H), 2.17- 2.26 (m, 2H), 2.35 (s, 3H),
2.47-2.61 (m, 2H), 3.66-3.76 (m, 2H), 4.20-4.29 (m, 2H), 5.01-5.11
(m, 1H), 6.50-6.80 (m, 1H), 7.13 (dd, J = 8.4 Hz, 1.6 Hz, 1H), 7.24
(d, J = 1.6 Hz, 1H), 7.46 (s, 1H), 8.09 (d, J = 8.4 Hz, 1H), 8.32
(s, 1H), 10.28 (brs, 1H). ESI-MS m/z 425 [M + H].sup.+ 17
##STR00096## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm):
2.13-2.24 (m, 5H), 2.46-2.60 (m, 2H), 3.64-3.75 (m, 2H), 3.85 (s,
3H), 4.18- 4.28 (m, 2H), 4.99-5.11 (m, 1H), 5.32-5.50 (m, 2H), 7.03
(s, 1H), 7.16 (d, J = 1.5 Hz, 1H), 7.19 (dd, J = 8.3 Hz, 1.5 Hz,
1H), 8.03 (d, J = 8.3 Hz, 1H), 8.30 (s, 1H), 8.91 (s, 1H). ESI-MS
m/z 423 [M + H].sup.+ 18 ##STR00097## .sup.1H-NMR (400 MHz,
CDCl.sub.3) .delta. (ppm): 2.08 (s, 3H), 2.15- 2.26 (m, 5H),
2.47-2.60 (m, 2H), 3.66-3.76 (m, 2H), 4.20- 4.29 (m, 2H), 5.00-5.10
(m, 1H), 6.71 (s, 1H), 7.11 (dd, J = 8.4 Hz, 1.5 Hz, 1H), 7.16 (d,
J = 1.5 Hz, 1H), 7.37-7.76 (m, 1H), 8.06 (d, J = 8.4 Hz, 1H), 8.31
(s, 1H), 9.71 (brs, 1H). ESI-MS m/z 441 [M + H].sup.+ 19
##STR00098## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.13
(s, 3H), 2.17- 2.26 (m, 2H), 2.31 (s, 3H), 2.47-2.62 (m, 2H),
3.65-3.77 (m, 2H), 4.20-4.30 (m, 2H), 5.01-5.13 (m, 1H), 5.43-5.58
(m, 2H), 7.14 (dd, J = 8.4 Hz, 1.6 Hz, 1H), 7.24 (d, J = 1.6 Hz,
1H), 7.28 (s, 1H), 8.07 (d, J = 8.4 Hz, 1H), 8.32 (s, 1H), 10.24
(brs, 1H). ESI-MS m/z 407 [M + H].sup.+ 20 ##STR00099## .sup.1H-NMR
(400 MHz, CDCl.sub.3) .delta. (ppm): 2.12 (s, 3H), 2.16- 2.24 (m,
2H), 2.46-2.60 (m, 2H), 2.64 (s, 3H), 3.66-3.76 (m, 2H), 4.20-4.29
(m, 2H), 5.01-5.11 (m, 1H), 5.11-5.26 (m, 2H), 7.16-7.18 (m, 1H),
7.18-7.22 (m, 1H), 7.30 (d, J = 1.8 Hz, 1H), 8.05 (d, J = 8.4 Hz,
1H), 8.31 (s, 1H), 10.39 (brs, 1H). ESI-MS m/z 407 [M + H].sup.+ 21
##STR00100## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.12
(s, 3H), 2.16- 2.24 (m, 2H), 2.47-2.60 (m, 2H), 2.65 (s, 3H),
3.66-3.75 (m, 2H), 4.21-4.28 (m, 2H), 5.01-5.10 (m, 1H), 6.29-6.57
(m, 1H), 7.18 (dd, J = 8.4 Hz, 1.6 Hz, 1H), 7.22 (d, J = 1.6 Hz,
1H), 7.25-7.26 (m, 1H), 8.05 (d, J = 8.4 Hz, 1H), 8.31 (s, 1H),
9.58 (s, 1H). ESI-MS m/z 425 [M + H].sup.+ 22 ##STR00101##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.15-2.24 (m, 2H),
2.26 (s, 3H), 2.47-2.60 (m, 2H), 3.66-3.76 (m, 2H), 4.00 (s, 3H),
4.19-4.30 (m, 2H), 4.98-5.14 (m, 3H), 6.81 (s, 1H), 7.14 (dd, J =
8.4 Hz, 1.6 Hz, 1H), 7.21 (d, J = 1.6 Hz, 1H), 8.04 (d, J = 8.4 Hz,
1H), 8.31 (s, 1H), 9.91 (brs, 1H). ESI-MS m/z 423 [M + H].sup.+
Example 23
Synthesis of
7-(2-ethoxy-4-methylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazol-
o[4,3-c]quinolin-4(5H)-one
##STR00102##
[0608]
[5-(2,4-dimethoxybenzyl)-4-oxo-1-(tetrahydro-2H-pyran-4-yl)-4,5-dih-
ydro-1H-pyrazolo[4,3-c]quinolin-7-yl]boronic acid obtained in
Preparation Example 1 (70 mg) was dissolved in 1,4-dioxane (4 mL).
3-bromo-2-ethoxy-4-methylpyridine obtained in Preparation Example
44 (49 mg), Pd(PPh.sub.3).sub.4 (8.7 mg), cesium carbonate (148 mg)
and water (1 mL) were added to the solution, and the mixture was
reacted using a microwave reactor at 130.degree. C. for two hours.
The reaction mixture was returned to room temperature and then
partitioned by adding ethyl acetate. The organic layer was washed
with brine and then dried over magnesium sulfate. The desiccant was
removed by filtration, and the filtrate was concentrated under
reduced pressure. The resulting residue was purified by silica gel
column chromatography (ethyl acetate/n-heptane, 30% to 50% to 80%)
to give
5-(2,4-dimethoxybenzyl)-7-(2-ethoxy-4-methylpyridin-3-yl)-1-(tetrahydro-2-
H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (55 mg). The
5-(2,4-dimethoxybenzyl)-7-(2-ethoxy-4-methylpyridin-3-yl)-1-(tetrahydro-2-
H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (55 mg) was
dissolved in TFA (1 mL), and the mixture was stirred at 65.degree.
C. for two hours. The reaction mixture was cooled to room
temperature and then concentrated under reduced pressure. The
resulting residue was neutralized by adding a saturated aqueous
sodium bicarbonate solution. The aqueous solution was extracted
with DCM. The organic layer was dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration. The filtrate was
concentrated under reduced pressure. The resulting residue was
purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 70% to 80% to 100%) to give the title
compound (17 mg).
[0609] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.25 (t,
J=7.5 Hz, 3H), 2.15 (s, 3H), 2.15-2.25 (m, 2H), 2.46-2.60 (m, 2H),
3.65-3.77 (m, 2H), 4.20-4.29 (m, 2H), 4.35 (q, J=7.5 Hz, 2H),
5.03-5.12 (m, 1H), 6.86 (d, J=5.5 Hz, 1H), 7.21 (dd, J=1.6 Hz, 8.2
Hz, 1H), 7.35 (s, 1H), 8.01 (d, J=8.2 Hz, 1H), 8.08 (d, J=5.5 Hz,
1H), 8.30 (s, 1H), 10.51 (brs, 11-1).
[0610] ESI-MS m/z 405 [M+H].sup.+
[0611] The compound of Example 24 was synthesized as in Example
23.
##STR00103##
TABLE-US-00002 TABLE 2 Example R.sup.2 NMR, Mass 24 ##STR00104##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.10 (s, 3H),
2.15- 2.25 (m, 2H), 2.47-2.60 (m, 2H), 3.66-3.76 (m, 2H), 4.01 (s,
3H), 4.19-4.29 (m, 2H), 5.00-5.19 (m, 3H), 6.74 (s, 1H), 7.16-7.23
(m, 2H), 8.04 (d, J = 8.2 Hz, 1H), 8.31 (s, 1H), 9.45 (brs, 1H).
ESI-MS m/z 423 [M + H].sup.+
Example 25
Synthesis of
(+)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one and
(-)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
##STR00105##
[0612] (1) Synthesis of
(.+-.)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-
-pyrazolo[4,3-c]quinolin-4(5H)-one
[0613] A mixture of
(.+-.)-5-(2,4-dimethoxybenzyl)-1-(tetrahydrofuran-3-yl)-7-(4,4,5,5-tetram-
ethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
obtained in Preparation Example 5 (219 mg),
4-bromo-2-methoxy-3,5-dimethylpyridine obtained in Preparation
Example 28 (134 mg), Pd(PPh.sub.3).sub.4 (23.8 mg) and cesium
carbonate (403 mg) was reacted in a mixed solvent of 1,4-dioxane (8
mL) and water (2 mL) using a microwave reactor at 130.degree. C.
for 70 minutes. The reaction mixture was cooled to mom temperature
and then directly purified by silica gel column chromatography
(ethyl acetate/n-heptane, 10% to 90%). The resulting coupling
product was dissolved in TFA (4 mL), and the mixture was stirred at
70.degree. C. for two hours. The reaction mixture was cooled to
room temperature and then concentrated under reduced pressure. A
saturated aqueous sodium bicarbonate solution was added to the
residue, followed by extraction with ethyl acetate. The organic
layer was concentrated under reduced pressure, and the residue was
purified by silica gel column chromatography (DCM, 100%, then ethyl
acetate/n-heptane, 50% to 100%) to give the title compound (78
mg).
[0614] ESI-MS m/z 391 [M+H].sup.+
(2) Synthesis of
(+)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one and
(-)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
[0615]
(.+-.)-7-(2-Methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(51-1)-one was analyzed by a chiral
column [AD-H (0.46 cm (1).times.15 cm), mobile phrase; 100%
ethanol] to identify (+)-form at 7.8 min and (-)-form at 9.7 min
and confirm that optical resolution is possible.
(.+-.)-7-(2-Methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-
-pyrazolo[4,3-c]quinolin-4(5H)-one (78 mg) was dissolved in a mixed
solvent of ethanol (12 mL) and methanol (12 mL), and the solution
was filtered through a cotton plug. The filtrate was optically
resolved by chiral column chromatography [chiral column: AD-H
column, elution solvent: 100% ethanol, flow rate: 10 mL/min,
elution time: 80 minutes/elution, injection: 2 mL/injection, short
retention time: (+)-form, long retention time: (-)-form] to give
26.4 mg of a (+)-form and 25.2 mg of a (-)-form of the title
compound.
[0616] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.92-1.94
(m, 3H), 1.94-1.96 (m, 3H), 2.55-2.66 (m, 1H), 2.76-2.86 (m, 1H),
4.00 (s, 3H), 4.09-4.16 (m, 1H), 4.24-4.37 (m, 2H), 4.39-4.45 (m,
1H), 5.61-5.68 (m, 1H), 7.04 (d, J=1.5 Hz, 1H), 7.08 (dd, J=1.5 Hz,
8.3 Hz, 1H), 7.94 (s, 1H), 8.13 (d, Hz, 1H), 8.31 (s, 1H), 8.86 (s,
1H).
[0617] ESI-MS m/z 391 [M+H].sup.+
Example 26
Synthesis of
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
##STR00106##
[0618] (1) Synthesis of ethyl
5-[2-fluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)-tetrahyd-
rofuran-3-yl]-1H-pyrazole-4-carboxylate
[0619] Water (170 mL), 4-iodo-2-methoxy-3,5-dimethylpyridine
obtained in Preparation Example 29(3) (35.6 g), Pd(PPh.sub.3).sub.4
(6.52 g) and cesium carbonate (110 g) were added to a solution of
ethyl
5-[2-fluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-[(S)-
-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate obtained in
Preparation Example 6 (51.9 g) in 1,4-dioxane (500 mL), and the
reaction mixture was reacted at 110.degree. C. for six hours. The
reaction mixture was returned to room temperature, and the organic
layer was then separated. The organic layer was concentrated under
reduced pressure. The aqueous layer, ethyl acetate (700 m) and
water (100 mL) were added to the resulting residue, and the organic
layer was separated. The aqueous layer was re-extracted with ethyl
acetate (50 mL). The combined organic layers were sequentially
washed with water and brine, dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pressure. The
residue was purified by NH silica gel column chromatography (ethyl
acetate/n-heptane, 5% to 14%). The product was then purified again
by NH silica gel column chromatography (ethyl acetate/n-heptane, 2%
to 10%) to give the title compound (435 g).
[0620] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.16 (t,
J=7.2 Hz, 1.5H), 1.17 (t, J=7.2 Hz, 1.5H), 1.97 (s, 1.5H), 1.98 (s,
1.5H), 1.99 (s, 1.5H), 2.00 (s, 1.51-1), 225-2.55 (m, 2H),
3.92-4.27 (m, 6H), 3.99 (s, 1.5H), 4.00 (s, 1.5H), 4.65-4.75 (m,
1H), 7.01 (d, J=9.2 Hz, 1H), 7.05 (d, J=7.2 Hz, 1H), 7.39 (t, J=7.2
Hz, 0.5H), 7.45 (t, J=72 Hz, 0.5H), 7.93 (s, 1H), 8.12 (s, 1H).
[0621] ESI-MS m/z 440 [M+H].sup.+
(2) Synthesis of
5-[2-fluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)-tetrahyd-
rofuran-3-yl]-1H-pyrazole-4-carboxylic acid
[0622] A 5 N aqueous sodium hydroxide solution (79 mL) was added to
a solution of ethyl
5-[2-fluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)-tetrahyd-
rofuran-3-yl]-1H-pyrazole-4-carboxylate (43.2 g) in ethanol (574
mL) at mom temperature, and the reaction mixture was stirred at
60.degree. C. for two hours and 10 minutes. The reaction mixture
was cooled to room temperature and then concentrated to half volume
under reduced pressure. Water (300 mL) was added to the residue,
and ethanol was distilled off under reduced pressure. MTBE (130 mL)
was added to the resulting residue, and the aqueous layer was
separated. The organic layer was extracted with water (30 mL). The
combined aqueous layers were made acidic with 5 N hydrochloric acid
(78 mL) under ice-cooling and extracted with ethyl acetate twice.
The combined organic layers were dried over anhydrous magnesium
sulfate, filtered and concentrated under reduced pressure to give
the title compound (39.0 g).
[0623] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.91 (s,
1.5H), 1.94 (s, 1.5H), 1.98 (s, 1.5H), 2.01 (s, 1.5H), 2.25-2.56
(m, 2H), 3.92-4.17 (m, 3H), 3.96 (s, 1.5H), 4.00 (s, 1.5H), 4.23
(dd, J=16.0, 8.0 Hz, 1H), 4.65-4.77 (m, 1H), 6.99 (brd, J=10.0 Hz,
1H), 7.03 (dr d, J=7.6 Hz, 1H), 7.38 (t, J=7.6 Hz, 0.5H), 7.44 (1.,
J=7.6 Hz, 0.5H), 7.90 (s, 0.5H), 7.94 (s, 0.5H), 8.14 (s, 1H).
[0624] ESI-MS m/z 434 [M+Na].sup.+
(3) Synthesis of
5-[2-fluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)tetrahydr-
ofuran-3-yl]-1H-pyrazole-4-carboxamide
[0625] CDI (21.4 g) was added at one time to a solution of
5-[2-fluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)-tetrahyd-
rofuran-3-yl]-1H-pyrazole-4-carboxylic acid (38.7 g) in DMF (290
mL) at room temperature, and the mixture was stirred at room
temperature for 95 minutes. 28% aqueous ammonia (95 mL) was added
to the reaction mixture, and the mixture was stirred at room
temperature for 35 minutes. 28% aqueous ammonia (95 mL) was added
again to the reaction mixture, and the mixture was stirred at room
temperature for 90 minutes. The reaction mixture was concentrated
under reduced pressure. Chloroform (250 mL) and water (80 mL) were
added to the resulting residue, and the organic layer was
separated. The aqueous layer was re-extracted with chloroform (50
mL). The combined organic layers were sequentially washed with a
saturated aqueous ammonium chloride solution (60 mL.times.3) and
brine, dried over anhydrous magnesium sulfate and filtered. The
filtrate was passed through a silica pad (NH-silica gel). The
filtrate was concentrated under reduced pressure to give the title
compound (37.2 g).
[0626] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.98 (brs,
6H), 2.24-2.60 (m, 2H), 3.90-4.20 (m, 3H), 3.99 (s, 3H), 4.23 (dd,
J=16.0, 8.0 Hz, 1H), 4.62-4.71 (m, 1H), 5.32 (brs, 2H), 7.05 (brd,
J=10.0 Hz, 1H), 7.10 (dd, J=7.6, 1.2 Hz, 1H), 7.42-7.56 (m, 1H),
7.94 (brs, 1H), 8.03 (s, 1H).
[0627] ESI-MS m/z 411 [M+11].sup.+
(4) Synthesis of
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
[0628] Sodium hydroxide powder (9.43 g) was added at one time to a
solution of
5-[2-fluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)-tetrahyd-
rofuran-3-yl]-1H-pyrazole-4-carboxamide (37.2 g) in DMSO (186 mL)
at room temperature. The reaction mixture was stirred at the same
temperature for 50 minutes and then at 70.degree. C. for 45
minutes. Under water-cooling, water (600 mL) was added dropwise to
the reaction mixture, and then acetic acid (13.5 mL) was added
dropwise. The precipitated powder was collected by filtration. The
precipitated solid was collected by filtration, washed with water
and MTBE and then dried under reduced pressure to give the title
compound (34.0 g).
[0629] The .sup.1H-NMR and ESI-MS of the title compound were
identical to those of Example 25. The title compound showed a (-)
optical rotation and had >99% ee of an optical purity [AD-H,
100% ethanol, retention time: 9.7 min].
Example 27
Synthesis of
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
##STR00107##
[0630] (1) Synthesis of ethyl
5-[4-(2-methoxy-3,5-dimethylpyridin-4-yl)-2-nitrophenyl]-1-[(S)-tetrahydr-
ofuran-3-yl]-1H-pyrazole-4-carboxylate
[0631] Ethyl
5-(4-bromo-2-nitrophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carb-
oxylate obtained in Preparation Example 7(1) (1.5 g) was dissolved
in toluene (50 mL). (2-methoxy-3,5-dimethylpyridin-4-yl)boronic
acid (728 mg) obtained in Preparation Example 29,
bis(triphenylphosphine)dichloropalladium(II) (128 mg), sodium
carbonate (1.16 g) and water (10 mL) were added to the solution,
and the mixture was reacted at 100.degree. C. for four hours. After
cooling the reaction mixture to room temperature, ethyl acetate (50
mL) and water (50 mL) were added, and the reaction mixture was
filtered through Celite.TM.. The filtrate was partitioned by adding
ethyl acetate (100 mL). The organic layer was washed with brine and
dried over anhydrous magnesium sulfate. The desiccant was removed
by filtration, and the filtrate was concentrated under reduced
pressure. Ethanol (2 mL) was added to the resulting residue which
was dissolved with heating under reflux. The solution was cooled
with ice water. After one hour, the precipitated solid was
collected by filtration to give the title compound (750 mg). The
filtrate was concentrated under reduced pressure. Ethanol (1 mL)
was added to the resulting residue which was dissolved with heating
under reflux. The solution was cooled with ice water. After one
hour, the precipitated solid was collected by filtration to give
the title compound (450 mg).
[0632] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.07-1.14
(m, 3H), 1.98 (d, J=3.9 Hz, 3H), 2.01 (d, J=3.9 Hz, 3H), 2.21-2.40
(m, 1H), 2.47-2.58 (m, 1H), 3.92-4.00 (m, 1H), 4.00 (s, 3H),
4.02-4.18 (m, 4H), 4.23 (q, J=7.7 Hz, 1H), 4.56-4.66 (m, 1H), 7.43
(d, J=8.2 Hz, 0.67H), 7.48 (d, J=82 Hz, 0.33H), 7.51-7.56 (m, 1H),
7.96-8.02 (m, 2H), 8.08 (s, 1H).
[0633] ESI-MS m/z 467 [M+H].sup.+
(2) Synthesis of
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
[0634] Ethyl
5-[4-(2-methoxy-3,5-dimethylpyridin-4-yl)-2-nitrophenyl]-1-[(S)-tetrahydr-
ofuran-3-yl]-1H-pyrazole-4-carboxylate (1.1 g) was suspended in
ethanol (13 mL) Iron powder (280 mg) and a saturated aqueous
ammonium chloride solution (3 mL) were added to the solution, and
the mixture was stirred at 100.degree. C. for 3.5 hours. The
reaction mixture was cooled to room temperature and then filtered
through Celite.TM.. The filtrate was partitioned by adding ethyl
acetate (100 mL) and water (50 mL). The organic layer was washed
with brine and dried over anhydrous magnesium sulfate. The
desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The resulting residue was
dissolved in acetic acid (2 mL), followed by stirring at 50.degree.
C. After four hours, the reaction mixture was cooled to mom
temperature, and water (20 mL) was added. The precipitated solid
was collected by filtration. 1-propanol (10) and water (1.5 mL)
were added to the resulting solid which was dissolved with heating
under reflux. The solution was cooled with ice water. After one
hour, the precipitated solid was collected by filtration and washed
with MTBE (5 mL) to give the title compound (780 mg).
[0635] The compounds of Examples 28 to 32 were synthesized as in
Example 25.
##STR00108##
TABLE-US-00003 TABLE 3 Example Chiral column Mobile phase Optical
rotation (+/-) Retention time (min) R.sup.2 NMR, Mass Example 28
OD-H 100% ethanol (+): 7.0 (-): 6.0 ##STR00109## .sup.1H-NMR (400
MHz, CDCl.sub.3) .delta. (ppm): 2.10 (s, 3H), 2.48 (s, 3H),
2.54-2.65 (m, 1H), 2.75-2.84 (m, 1H), 3.86 (s, 3H), 4.08-4.16 (m,
1H), 4.22- 4.28 (m, 1H), 4.28-4.36 (m, 1H), 4.38-4.44 (m, 1H),
5.59-5.69 (m, 1H), 6.73 (s, 1H), 7.18 (dd, J = 8.4 Hz, 1.6 Hz, 1H),
7.23 (d, J = 1.6 Hz, 1H), 8.08 (d, J = 8.4 Hz, 1H), 8.29 (s, 1H),
9.60 (brs, 1H). ESI-MS m/z 391 [M + H].sup.+ Example 29 OD-H 100%
ethanol (+): 8.5 (-): 6.2 ##STR00110## .sup.1H-NMR (400 MHz,
CDCl.sub.3) .delta. (ppm): 2.03 (s, 3H), 2.22 (s, 3H), 2.55-2.67
(m, 1H), 2.76-2.86 (m, 1H), 3.97 (s, 3H), 4.09-4.17 (m, 1H), 4.23-
4.29 (m, 1H), 4.30-4.37 (m, 1H), 4.39-4.46 (m, 1H), 5.62-5.69 (m,
1H), 6.54 (s, 1H), 7.12 (dd, J = 8.4 Hz, 1.6 Hz, 1H), 7.21 (d, J =
1.6 Hz, 1H), 8.10 (d, J = 8.4 Hz, 1H), 8.31 (s, 1H), 10.00 (brs,
1H). ESI-MS m/z 391 [M + H].sup.+ Example 30 IA 100% ethanol (+):
9.0 (-): 9.7 ##STR00111## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.
(ppm): 2.10 (s, 3H), 2.56-2.67 (m, 1H), 2.76-2.86 (m, 1H), 4.01 (s,
3H), 4.08-4.17 (m, 1H), 4.23-4.37 (m, 2H), 4.39-4.46 (m, 1H),
5.01-5.20 (m, 2H), 5.61-5.69 (m, 1H), 6.74 (s, 1H), 7.15- 7.22 (m,
1H), 7.27-7.30 (m, 1H), 8.11 (d, J = 8.2 Hz, 1H), 8.31 (s, 1H),
10.11- 10.25 (m, 1H). ESI-MS m/z 409 [M + H].sup.+ Example 31 AD-H
100% ethanol (+): 6.0 (-): 7.1 ##STR00112## .sup.1H-NMR (400 MHz,
CDCl.sub.3) .delta. (ppm): 2.17 (s, 3H), 2.54-2.65 (m, 1H),
2.76-2.85 (m, 1H), 3.85 (s, 3H), 4.08-4.16 (m, 1H), 4.23-4.29 (m,
1H), 4.29-4.36 (m, 1H), 4.38-4.44 (m, 1H), 5.33-5.49 (m, 2H),
5.61-5.68 (m, 1H), 7.03 (s, 1H), 7.18 (d, J = 8.5 Hz, 1H), 7.21 (s,
1H), 8.10 (d, J = 8.5 Hz, 1H), 8.30 (s, 1H), 9.41 (brs, 1H). ESI-MS
m/z 409 [M + H].sup.+ Example 32 AD-H 100% ethanol (+): 5.8 (-):
7.5 ##STR00113## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm):
2.15 (s, 3H), 2.54-2.66 (m, 1H), 2.76-2.85 (m, 1H), 3.85 (s, 3H),
4.12 (td, J = 8.4 Hz, 4.7 Hz, 1H), 4.27 (q, J = 7.8 Hz, 1H), 4.33
(dd, J = 7.8 Hz, 1.6 Hz, 1H), 4.42 (dd, J = 8.4 Hz, 3.4 Hz, 1H),
5.61-5.69 (m, 1H), 6.89 (d, J = 5.5 Hz, 1H), 7.19 (dd, J = 8.4 Hz,
1.4 Hz, 1H), 7.33 (d, J = 1.4 Hz, 1H), 8.08- 8.14 (m, 2H), 8.30 (s,
1H), 10.49 (brs, 1H). ESI-MS m/z 377 [M + H].sup.+
Example 33
Synthesis of
(+)-7-(2,6-dimethylphenyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]qui-
nolin-4(51-1)-one and
(-)-7-(2-methoxy-4-methylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4(5H)-one
##STR00114##
[0637] The title compound was obtained by performing the reactions
(1) to (2) by the same method as in Example 25 using
(.+-.)-7-bromo-5-(2,4-dimethoxybenzyl)-1-(tetrahydrofuran-3-yl)-1H-pyrazo-
lo[4,3-c]quinolin-4(5H)-one obtained in Preparation Example 5(4)
and 2,6-dimethylphenylboronic acid as raw materials. The optical
resolution of (2) under the conditions of chiral column: IB, mobile
phase: 100% ethanol, and flow rate: 1.00 mL/min identified (-)-form
at 4.0 min and (+)-form at 4.4 min. Thus, the optical resolution
was performed using IB column for optical resolution under the
conditions of mobile phase: 100% ethanol, flow rate: 10.0 mL/min,
elution time: 60 min/run and injection: 1.5 mL/run and (-)-form of
a shorter retention time and (+)-form of a longer retention time
were obtained.
[0638] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.06 (s,
6H), 2.60-2.64 (m, 1H), 2.79-2.83 (m, 1H), 4.12-4.13 (m, 1H),
4.24-4.37 (m, 2H), 4.40-4.45 (m, 1H), 5.62-5.70 (m, 1H), 7.10-7.19
(m, 4H), 7.21-7.24 (m, 1H), 8.10-8.12 (m, 1H), 8.30 (s, 1H), 9.57
(brs, 1H).
[0639] ESI-MS m/z 360 [M+H].sup.+
Example 34
Synthesis of
(+)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-3-yl)-1-
H-pyrazolo[4,3-c]quinolin-4(5H)-one and
(-)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-3-yl)-1-
H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00115##
[0641] The title compound was obtained by performing the reactions
(1) to (2) by the same method as in Example 25 using
(.+-.)-5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-pyran-3-yl)-7-(4,4,5,5-te-
tramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
obtained in Preparation Example 4 and
3-bromo-2-methoxy-4,6-dimethylpyridine obtained in Preparation
Example 26 as raw materials. The optical resolution of (2) under
the conditions of chiral column: OD-H, mobile phase: 100% ethanol,
and flow rate: 1.00 mL/min identified (+)-form at 4.8 min and
(-)-form at 5.2 min. Thus, the optical resolution was performed
using OD-H column for optical resolution and using an elution
solvent of 100% ethanol and (+)-form of a shorter retention time
and (-)-form of a longer retention time were obtained.
[0642] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.92-2.00
(m, 2H), 2.10 (s, 3H), 2.38-2.54 (m, 5H), 3.53-3.61 (m, 1H), 3.86
(s, 3H), 3.88-3.95 (m, 1H), 4.04-4.10 (m, 1H), 4.28-4.35 (m, 1H),
4.95-5.05 (m, 1H), 6.72-6.75 (m, 1H), 7.18-7.21 (m, 1H), 7.22 (d,
J=1.4 Hz, 1H), 8.09 (d, J=8.4 Hz, 1H), 8.28 (s, 1H), 9.63 (s,
1H).
[0643] ESI-MS m/z 405 [M+H].sup.+
[0644] The compounds of Examples 35 to 39 were synthesized as in
Example 34.
##STR00116##
TABLE-US-00004 TABLE 4 Example Chiral column Mobile phase Optical
rotation (+/-) Retention time (min) R.sup.2 NMR, Mass Example 35
AD-H 100% ethanol (+): 5.8 (-): 6.4 ##STR00117## .sup.1H-NMR (400
MHz, CDCl.sub.3) .delta. (ppm): 1.93-2.02 (m, 2H), 2.17 (s, 3H),
2.37- 2.55 (m, 2H), 3.53-3.62 (m, 1H), 3.85 (s, 3H), 3.88-3.96 (m,
1H), 4.04-4.11 (m, 1H), 4.27-4.35 (m, 1H), 4.95-5.05 (m, 1H),
5.33-5.48 (m, 2H), 7.03 (s, 1H), 7.17-7.22 (m, 2H), 8.11 (d, J =
8.6 Hz, 1H), 8.28 (s, 1H), 9.35 (s, 1H). ESI-MS m/z 423 [M +
H].sup.+ Example 36 OD-H 100% ethanol (+): 4.6 (-): 5.1
##STR00118## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm):
1.91-2.04 (m, 8H), 2.39-2.56 (m, 2H), 3.54-3.62 (m, 1H), 3.89-3.97
(m, 1H), 4.00 (s, 3H), 4.04-4.14 (m, 1H), 4.28- 4.36 (m, 1H),
4.96-5.06 (m, 1H), 7.07- 7.12 (m, 1H), 7.14 (d, J = 1.4 Hz, 1H),
7.94 (s, 1H), 8.14 (d, J = 8.2 Hz, 1H), 8.30 (s, 1H), 9.83 (brs,
1H). ESI-MS m/z 405 [M + H].sup.+ Example 37 AD-H 100% ethanol (+):
8.0 (-): 10.7 ##STR00119## .sup.1H-NMR (400 MHz, CDCl.sub.3)
.delta. (ppm): 1.94-2.00 (m, 2H), 2.02 (d, J = 0.6 Hz, 3H), 2.22
(s, 3H), 2.40-2.53 (m, 2H), 3.52-3.62 (m, 1H), 3.89-3.95 (m, 1H),
3.96 (s, 3H), 4.05-4.11 (m, 1H), 4.28- 4.35 (m, 1H), 4.96-5.05 (m,
1H), 6.54 (s, 1H), 7.09 (d, J = 1.6 Hz, 1H), 7.13 (dd, J = 8.4 Hz,
1.6 Hz, 1H), 8.11 (d, J = 8.4 Hz, 1H), 8.29 (s, 1H), 9.01 (brs,
1H). ESI-MS m/z 405 [M + H].sup.+ Example 38 OD-H 100% ethano1 (+):
5.2 (-): 5.8 ##STR00120## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.
(ppm): 1.92-2.03 (m, 2H), 2.09 (s, 3H), 2.39- 2.54 (m, 2H),
3.53-3.62 (m, 1H), 3.89- 3.97 (m, 1H), 4.01 (s, 3H), 4.05-4.13 (m,
1H), 4.26-4.37 (m, 1H), 4.95-5.20 (m, 3H), 6.74 (s, 1H), 7.17-7.23
(m, 2H), 8.12 (d, J = 8.4 Hz, 1H), 8.29 (s, 1H), 9.56-9.67 (m, 1H).
ESI-MS m/z 423 [M + H].sup.+ Example 39 AD-H 100% ethanol (+): 6.0
(-): 6.6 ##STR00121## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta.
(ppm): 1.93-2.01 (m, 2H), 2.14 (s, 3H), 2.38- 2.53 (m, 2H),
3.53-3.61 (m, 1H), 3.87 (s, 3H), 3.88-3.95 (m, 1H), 4.04-4.11 (m,
1H), 4.27-4.35 (m, 1H), 4.95-5.04 (m, 1H), 6.88 (d, J = 5.3 Hz,
1H), 7.17 (d, J = 1.5 Hz, 1H), 7.21 (dd, J = 8.2 Hz, 1.5 Hz, 1H),
8.08-8.14 (m, 2H), 8.28 (s, 1H), 9.06 (brs, 1H). ESI-MS m/z 391 [M
+ H].sup.+
Example 40
Synthesis of
7-[2,6-dimethyl-4-(tetrahydro-2H-pyran-4-yl)phenyl]-1-(tetrahydro-2H-pyra-
n-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00122##
[0645] (1) Synthesis of
7-[4-(3,6-dihydro-2H-pyran-4-yl)-2,6-dimethylphenyl]-5-(2,4-dimethoxybenz-
yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0646] Water (0.2 mL),
4-(4-bromo-3,5-dimethylphenyl)-3,6-dihydro-2H-pyran (44.1 mg)
obtained in Preparation Example 50, Pd(PPh.sub.3).sub.4 (12.7 mg)
and cesium carbonate (108 mg) were added to a solution of
5-(2,4-dimethoxybenzyl)-1-(tetrahydro-2H-man-4-yl)-7-(4,4,5,5-tetramethyl-
-1,3,2-dioxaborolan-2-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
obtained in Preparation Example 1(5) (60 mg) in 1,4-dioxane (1.5
mL). The reaction mixture was stirred at 100.degree. C. overnight.
After returning the reaction mixture to room temperature, ethyl
acetate and water were added to the reaction mixture, and the
organic layer was separated. The organic layer was washed with
brine, dried over anhydrous magnesium sulfate, filtered and
concentrated under reduced pressure. The resulting residue was
purified by NH silica gel column chromatography (ethyl
acetate/n-heptane, 20 to 50%) to give the title compound (44
mg).
[0647] ESI-MS m/z 606 [M+H].sup.+
(2) Synthesis of
7-[2,6-dimethyl-4-(tetrahydro-2H-pyran-4-yl)phenyl]-1-(tetrahydro-2H-pyra-
n-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0648] 10% palladium carbon (50% wet, 15 mg) was added to a
solution of
7-[4-(3,6-dihydro-2H-pyran-4-yl)-2,6-dimethylphenyl]-5-(2,4-dimethoxybenz-
yl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
(44 mg) in ethanol (2 mL)-THF (2 mL). The reaction mixture was
stirred at mom temperature for four hours and 35 minutes in a
hydrogen atmosphere. The catalyst was removed from the reaction
mixture by filtration, and the filtrate was then concentrated under
reduced pressure. TFA (1.5 mL) was added to the resulting residue.
The reaction mixture was stirred at 60.degree. C. for 14 hours. The
reaction mixture was returned to room temperature, and the reaction
mixture was then concentrated under reduced pressure. Chloroform
and a saturated aqueous sodium bicarbonate solution were added to
the residue, and the organic layer was separated. The aqueous layer
was re-extracted with chloroform. The combined organic layers were
dried over anhydrous magnesium sulfate, filtered and concentrated
under reduced pressure. The resulting residue was purified by
silica gel column chromatography (chloroform 100%, then ethyl
acetate 100%). The target fraction was collected and concentrated.
Ethyl acetate and MTBE were added to the resulting residue. The
precipitated solid was collected by filtration and dried under
reduced pressure to give the title compound (14.8 mg).
[0649] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.79-1.95
(m, 4H), 2.07 (s, 6H), 2.20 (d, J=12.8 Hz, 2H), 2.53 (ddd, J=15.6,
11.6, 4.0 Hz, 2H), 2.72-2.81 (m, 1H), 3.56 (td, J=10.8, 2.8 Hz,
2H), 3.71 (t, J=10.4 Hz, 2H), 4.12 (dd, J=10.4, 2.8 Hz, 2H), 4.24
(d, J=10.8 Hz, 2H), 5.03-5.11 (m, 1H), 7.03 (s, 2H), 7.13 (dd,
J=8.0, 1.2 Hz, 1H), 7.25 (d, J=1.2 Hz, 1H), 8.01 (d, J=8.0 Hz, 1H),
8.31 (s, 1H), 10.26 (brs, 1H).
[0650] ESI-MS m/z 458 [M+H].sup.+
Example 41
Synthesis of
(.+-.)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(oxepan-4-yl)-1H-pyrazolo-
[4,3-c]quinolin-4(51-1)-one and
(-)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(oxepan-4-yl)-1H-pyrazolo[4,-
3-c]quinolin-4(5H)-one
##STR00123##
[0651] (1) Synthesis of (.+-.)-ethyl
5-[4-(2-methoxy-3,5-dimethylpyridin-4-yl)-2-nitrophenyl]-1-(oxepan-4-yl)--
1H-pyrazole-4-carboxylate
[0652] The title compound (80 mg) was obtained by the same method
as in Example 27-(1) from (.+-.)-ethyl
5-(4-bromo-2-nitrophenyl)-1-(oxepan-4-yl)-1H-pyrazole-4-carboxylate
obtained in Preparation Example 8 (85 mg) and
(2-methoxy-3,5-dimethylpyridin-4-yl)boronic acid obtained in
Preparation Example 29 (42.1 mg).
[0653] ESI-MS m/z 495 [M+11].sup.+
(2) Synthesis of
(.+-.)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(oxepan-4-yl)-1H-pyrazolo-
[4,3-c]quinolin-4(5H)-one
[0654] The title compound (53 mg) was obtained by the same method
as in Example 45-(2) from (.+-.)-ethyl
5-[4-(2-methoxy-3,5-dimethylpyridin-4-yl)-2-nitrophenyl]-1-(oxepan-4-yl)--
1H-pyrazole-4-carboxylate (80 mg).
[0655] .sup.1H-NMR. (400 MHz, CDCl.sub.3) .delta. (ppm): 1.90-2.05
(m, 2H), 1.94, 1.95, 1.96 (s, 3H), 1.97 (s, 3H), 2.33-2.70 (m, 4H),
3.70-3.80 (m, 1H), 3.92-4.08 (m, 3H), 4.01 (s, 3H), 5.20-5.29 (m,
1H), 7.08 (dd, J=8.4, 1.6 Hz, 1H), 7.19 (d, J=1.6 Hz, 1H), 7.95 (s,
1H), 8.11 (d, J=8.4 Hz, 1H), 8.30 (s, 1H), 10.30 (brs, 1H).
[0656] ESI-MS m/z 419 [M+H].sup.+
(3) Synthesis of
(+)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(oxepan-4-yl)-1H-pyrazolo[4,-
3-c]quinolin-4(5H)-one and
(-)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(oxepan-4-yl)-1H-pyrazolo[4,-
3-c]quinolin-4(5H)-one
[0657]
7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(oxepan-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one (53 mg) was dissolved in ethanol (5 mL),
and the solution was filtered through a millipore filter. The
filtrate was optically resolved by CIRALCEL.RTM. OD-H manufactured
by DAICEL Corporation (20 mm diameter.times.250 mm long) under the
condition of ethanol 100% and 10 mL/min. The title compound with a
retention time of 11 minutes and a (+) optical rotation (15.9 mg,
>98% ee [CIRALCEL.RTM. OD-H (0.46 cm (1).times.25 cm), 20%
ethanol/hexane, retention time=7.3 min]) and the title compound
with a retention time of 12 minutes and a (-) optical rotation
(16.7 mg, >98% ee [CIRALCEL.RTM. OD-H (0.46 cm.PHI..times.25
cm), 20% ethanol/hexane, retention time=7.9 min]) were
obtained.
[0658] The compound of Example 42 was synthesized as in Example
41.
##STR00124##
TABLE-US-00005 TABLE 5 Example Chiral column Mobile phase Optical
rotation (+/-) Retention time (min) R.sup.2 NMR, Mass Example 42 IA
100% IPA (+): 8.3 (-): 9.4 ##STR00125## .sup.1H-NMR (400 MHz,
CDCl.sub.3) .delta. (ppm): 1.90- 2.05 (m, 2H), 2.05 (s, 3H), 2.06
(s, 3H), 2.31- 2.68 (m, 4H), 3.70-3.78 (m, 1H), 3.85 (s, 3H),
3.92-4.07 (m, 3H), 5.19-5.28 (m, 1H), 6.71 (s, 2H), 7.12 (d, J =
8.4 Hz, 1H), 7.15 (s, 1H), 8.07 (d, J = 8.4 Hz, 1H), 8.30 (s, 1H),
9.62 (brs, 1H). ESI-MS m/z 418 [M + H].sup.+
Example 43
Synthesis of
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one
##STR00126##
[0659] (1) Synthesis of ethyl
1-(1,4-dioxepan-6-yl)-5-[4-(2-methoxy-3,5-dimethylpyridin-4-yl)-2-nitroph-
enyl]-1H-pyrazole-4-carboxylate
[0660] Water (0.2 mL), (2-methoxy-3,5-dimethylpyridin-4-yl)boronic
acid (39.5 mg) obtained in Preparation Example 29,
Pd(PPh.sub.3).sub.4 (10.5 mg) and cesium carbonate (178 mg) were
added to a solution of ethyl
5-(4-bromo-2-nitrophenyl)-1-(1,4-dioxepan-6-yl)-1H-pyrazole-4-carboxylate
(80 mg) obtained in Preparation Example 9-(2) in 1,4-dioxane (1.3
mL), and the reaction mixture was stirred at 100.degree. C. for
6.75 hours. (2-methoxy-3,5-dimethylpyridin-4-yl)boronic acid (15
mg) was added to the reaction mixture and the reaction mixture was
stirred at 100.degree. C. for 2.5 hours. After the reaction mixture
was returned to mom temperature, ethyl acetate and water were added
to the reaction mixture, and the organic layer was separated. The
resulting organic layer was washed with brine, dried over anhydrous
magnesium sulfate, filtered, and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (silica gel, ethyl acetate/n-heptane, 20 to 33%) to
give the title compound (64 mg).
[0661] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.09 (t,
J=7.2 Hz, 1.5H), 1.11 (t, J=7.2 Hz, 1.5H), 1.98 (s, 1.5H), 1.99 (s,
1.5H), 2.01 (s, 1.5H), 2.02 (s, 1.5H), 3.73-3.87 (m, 2H), 3.90-4.02
(m, 2H), 4.00 (s, 3H), 4.03-4.17 (m, 4H), 4.30-4.40 (m, 2H),
4.41-4.49 (m, 1H), 7.39 (d, J=7.6 Hz, 1H), 7.52 (dd, J=7.6, 1.6 Hz,
1H), 7.95-8.01 (m, 2H), 8.11 (s, 1H).
[0662] ESI-MS m/z 519 [M+Na].sup.+
(2) Synthesis of
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one
[0663] Iron powder (28.8 mg) was added to a solution of ethyl
1-(1,4-dioxepan-6-yl)-5-[4-(2-methoxy-3,5-dimethylpyridin-4-yl)-2-nitroph-
enyl]-1H-pyrazole-4-carboxylate (64 mg) in acetic acid (2 mL)-water
(0.1 mL), and the reaction mixture was stirred at 80.degree. C. for
2.5 hours in a nitrogen atmosphere. The reaction mixture was
returned to room temperature, and ethyl acetate (10 mL) was added
to the reaction mixture. The insoluble matter was removed by
filtration through Celite.TM.. The filtrate was concentrated under
reduced pressure. A solution of the residue in ethyl acetate was
sequentially washed with a saturated aqueous sodium bicarbonate
solution and brine, dried over anhydrous magnesium sulfate,
filtered. The filtrate was passed through a NH silica gel pad. The
resulting solution was concentrated under reduced pressure. Ethyl
acetate (0.3 mL) and MTBE (0.3 mL) were added to the residue. The
precipitated solid was collected by filtration to give the title
compound (29.1 mg).
[0664] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.93 (s,
3H), 1.96 (s, 3H), 3.90-4.07 (m, 4H), 4.00 (s, 3H), 4.38 (dd,
J=12.0, 6.0 Hz, 2H), 4.40 (dd, J=12.0, 6.8 Hz, 2H), 5.50 (tt,
J=6.8, 6.0 Hz, 1H), 7.08 (d, J=8.0 Hz, 1H), 7.17 (s, 1H), 7.94 (s,
1H), 8.13 (d, J=8.0 Hz, 1H), 836 (s, 1H), 10.23 (brs, 1H).
[0665] ESI-MS m/z 421 [M+H].sup.+
[0666] The compound of Example 44 was synthesized as in Example
43.
##STR00127##
TABLE-US-00006 TABLE 6 # R.sup.2 Mass, NMR 44 ##STR00128##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.05 (s, 6H), 3.85
(s, 3H), 3.91-4.07 (m, 4H), 4.38 (dd, J = 12.8, 6.0 Hz, 2H), 4.44
(dd, J = 12.8, 6.8 Hz, 2H), 5.51 (tt, J = 6.8, 6.0 Hz, 1H), 6.71
(s, 2H), 7.12 (dd, J = 8.4, 1.6 Hz, 1H), 7.24 (brs, 1H), 8.08 (d, J
= 8.4 Hz, 1H), 8.36 (s, 1H), 10.43 (brs, 1H). ESI-MS m/z 420 [M +
H].sup.+
Example 45
Synthesis of
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one
##STR00129##
[0667] (1) Synthesis of ethyl
1-(1,4-dioxepan-6-yl)-5-{4-(2-methoxy-4,6-dimethylpyridin-3-yl)-2-nitroph-
enyl}-1H-pyrazole-4-carboxylate
[0668] Water (0.3 mL), 3-bromo-2-methoxy-4,6-dimethylpyridine (32.5
mg) obtained in Preparation Example 26, Pd(PPh.sub.3).sub.4 (7.2
mg) and cesium carbonate (122 mg) were added to a solution of ethyl
1-(1,4-dioxepan-6-yl)-5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborola-
n-2-yl)phenyl]-1H-pyrazole-4-carboxylate (61 mg) in 1,4-dioxane (12
mL), and the reaction mixture was stirred at 100.degree. C. for 4
hours. Pd(PPh.sub.3).sub.4 (7.2 mg) was added to the reaction
mixture, and the reaction mixture was stirred at 100.degree. C. for
1 hour and 10 minutes. The reaction mixture was returned to room
temperature and partitioned by adding ethyl acetate and water, and
the organic layer was separated. The resulting organic layer was
sequentially washed with water and brine, dried over anhydrous
magnesium sulfate, filtered and concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 15 to 20%) to give the
title compound (15 mg).
[0669] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.06 (t,
J=7.2 Hz, 3H), 2.16 (s, 3H), 2.48 (s, 3H), 3.74-3.88 (m, 2H), 3.88
(s, 3H), 3.91-4.16 (m, 6H), 4.28-4.37 (m, 2H), 4.47-4.55 (m, 1H),
6.74 (s, 1H), 7.29 (d, J=7.6 Hz, 1H), 7.60 (dd, J=7.6, 1.6 Hz, 1H),
8.07 (d, J=1.6 Hz, 1H), 8.10 (s, 1H).
[0670] ESI-MS m/z 519[M+Na].sup.+
(2) Synthesis of
1-(1,4-dioxepan-6-yl)-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1H-pyrazolo[-
4,3-c]quinolin-4(5H)-one
[0671] Iron powder (17 mg) was added to a solution of ethyl
1-(1,4-dioxepan-6-yl)-5-{4-(2-methoxy-4,6-dimethylpyridin-3-yl)-2-nitroph-
enyl}-1H-pyrazole-4-carboxylate (15 mg) in acetic acid (1 mL)-water
(0.05 mL), and the mixture was stirred at 80.degree. C. for 4.25
hours in a nitrogen atmosphere. The reaction mixture was returned
to room temperature, and ethyl acetate (5 mL) was added to the
reaction mixture. The insoluble matter was removed by filtration
through Celite.TM.. The filtrate was concentrated under reduced
pressure. A solution of the residue in ethyl acetate was
sequentially washed with a saturated aqueous sodium bicarbonate
solution and brine, dried over anhydrous magnesium sulfate,
filtered and concentrated. The residue was purified by preparative
thin-layer chromatography (silica gel, ethyl acetate/n-heptane,
66%) to give the title compound (1.5 mg).
[0672] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.09 (s,
3H), 2.48 (s, 3H), 3.85 (s, 3H), 3.91-3.99 (m, 2H), 4.00-4.08 (m,
2H), 4.36 (dd, J=12.8, 6.4 Hz, 2H), 4.42 (dd, J=12.8, 6.4 Hz, 2H),
5.49 (tt, J=6.8, 6.4 Hz, 1H), 6.72 (s, 1H), 7.15-7.21 (m, 2H), 8.08
(d, J=8.0 Hz, 1H), 8.34 (s, 1H), 9.17 (br s, 1H).
[0673] ESI-MS m/z 421 [M+H].sup.+
[0674] The compounds of Examples 46 and 47 were synthesized as in
Example 45.
##STR00130##
TABLE-US-00007 TABLE 7 # R.sup.2 NMR, Mass 46 ##STR00131##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.02 (s, 3H), 2.21
(s, 3H), 3.91-3.99 (m, 2H), 3.96 (s, 3H), 4.00-4.07 (m, 2H), 4.38
(ddd, J = 13.2, 6.4, 2.4 Hz, 2H), 4.44 (dd, J = 13.2, 6.4 Hz, 2H),
5.50 (tt, J = 6.8, 6.4 Hz, 1H), 6.54 (s, 1H), 7.12 (dd, J = 8.0,
1.6 Hz, 1H), 7.17 (d, J = 1.6 Hz, 1H), 8.10 (d, J = 8.0 Hz, 1H),
8.34 (s, 1H), 9.78 (brs, 1H). ESI-MS m/z 421 [M + H].sup.+ 47
##STR00132## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.14
(s, 3H), 3.87 (s, 3H), 3.91-3.99 (m, 2H), 4.00-4.07 (m, 2H), 4.37
(dd, J = 12.8, 6.4 Hz, 2H), 4.43 (dd, J = 12.8, 6.4 Hz, 2H), 5.50
(tt, J = 6.4, 6.0 Hz, 1H), 6.88 (d, J = 5.6 Hz, 1H), 7.18-7.22 (m,
2H), 8.08-8.13 (m, 2H), 8.35 (s, 1H), 9.29 (brs, 1H). ESI-MS m/z
407 [M + H].sup.+
Example 48
Synthesis of
(S)-7-(2-isopropyloxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00133##
[0675] (1) Synthesis of ethyl
5-[4-(2-isopropyloxy-3,5-dimethylpyridin-4-yl)-2-nitrophenyl]-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0676] Ethyl
5-(4-bromo-2-nitrophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carb-
oxylate obtained in Preparation Example 7-(1) (200 mg) was
converted to ethyl
5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-
-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate by the same
method as in Preparation Example 7-(2). A solution of
4-iodo-2-isopropyloxy-3,5-dimethylpyridine obtained in Preparation
Example 47 (142 mg) in DMF (0.5 mL), and water (0.5 mL) were added
to the reaction mixture, and the mixture was stirred at 110.degree.
C. for two hours. The reaction mixture was cooled to room
temperature and then partitioned by adding ethyl acetate and water.
The aqueous layer was extracted with ethyl acetate. The combined
organic layers were dried over anhydrous magnesium sulfate and
filtered. The filtrate was concentrated under reduced pressure. The
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 50% to 100%) to give the title compound (138.1
mg).
[0677] ESI-MS m/z 517 [M+Na].sup.+
(2) Synthesis of
(S)-7-(2-isopropyloxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0678] The title compound (67.1 mg) was obtained by the same method
as in Example 45-(2) from ethyl
5-[4-(2-isopropyloxy-3,5-dimethylpyridin-4-yl)-2-nitrophenyl]-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate (138.1 mg).
[0679] .sup.1H-NMR. (400 MHz, CDCl.sub.3) .delta. (ppm): 1.37-1.41
(m, 6H), 1.91 (s, 3H), 1.95 (s, 3H), 2.59-2.64 (m, 1H), 2.79-2.83
(m, 1H), 4.12-4.29 (m, 1H), 4.23-4.27 (m, 2H), 4.39-4.46 (m, 1H),
5.29-5.40 (m, 1H), 5.62-5.69 (m, 1H), 7.07-7.09 (m, 1H), 7.19-7.20
(m, 1H), 7.90-7.92 (m, 1H), 8.13 (d, J=8.40 Hz, 1H), 8.31 (s, 1H),
10.18 (s, 1H).
[0680] ESI-MS m/z 419 [M+H].sup.+
[0681] The compounds of Examples 49 and 50 were synthesized as in
Example 48.
##STR00134##
TABLE-US-00008 TABLE 8 # R.sup.2 NMR, Mass 49 ##STR00135##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.01 (s, 6H),
2.59-2.64 (m, 1H), 2.70-2.90 (m, 1H), 4.10-4.20 (m, 1H), 4.25-4.35
(m, 2H), 4.40-4.45 (m, 1H), 5.60-5.63 (m, 1H), 6.99-7.10 (m, 2H),
7.52 (t, J = 72.0 Hz, 1H), 7.96 (s, 1H), 8.14-8.17 (m, 1H), 8.31
(s, 1H), 9.01 (brs, 1H). ESI-MS m/z 449 [M + Na].sup.+ 50
##STR00136## .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1, 43
(t, J = 7.13 Hz, 3H), 1.94 (s, 3H), 1.95 (s, 3H), 2.55-2.68 (m,
1H), 2.76-2.87 (m, 1H), 4.12-4.20 (m, 1H), 4.23-4.37 (m, 2H),
4.38-4.46 (m, 3H), 5.57-5.72 (m, 1H), 7.07-7.09 (m, 1H), 7.17-7.18
(m, 1H), 7.92 (s, 1H), 8.12-8.14 (m, 1H), 8.31 (s, 1H), 10.07 (brs,
1H). ESI-MS m/z 405 [M + H].sup.+
Example 51
Synthesis of
(S)-7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00137##
[0682] (1) Synthesis of ethyl
5-[4-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-2-nitrophenyl]-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0683] Ethyl
5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1-[(S)--
tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate obtained in
Preparation Example 7-(2) (70 mg) was dissolved in a mixed solution
of 1,4-dioxane (1 mL) and water (0.2 mL), and
3-bromo-6-isopropyloxy-2,4-dimethylpyridine (41.1 mg),
Pd(PPh.sub.3).sub.4 (17.7 mg) and cesium carbonate (150 mg) were
added. The reaction mixture was stirred at 110.degree. C.
overnight. After returning the reaction mixture to room
temperature, the reaction mixture was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 10 to 50% to 100%) to give
the title compound (66.5 mg).
[0684] ESI-MS m/z 495 [M H].sup.+
(2) Synthesis of
(S)-7-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)--
1H-pyrazolo[4,3-c]quinolin-4(51-1)-one
[0685] A solution of ethyl
5-[4-(6-isopropyloxy-2,4-dimethylpyridin-3-yl)-2-nitrophenyl]-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate (65.1 mg) in acetic
acid (1.5 mL)-water (0.15 mL) was stirred at 80.degree. C. for 15
minutes. Iron powder (45.1 mg) was added to the solution, and the
mixture was stirred at the same temperature for two hours in a
nitrogen atmosphere. The reaction mixture was returned to room
temperature, and ethyl acetate (5 mL) was added to the reaction
mixture. The insoluble matter was removed by filtration through
Celite.TM.. The filtrate was concentrated under reduced pressure. A
solution of the residue in ethyl acetate was washed with a
saturated aqueous sodium bicarbonate solution, dried over anhydrous
magnesium sulfate and filtered. The filtrate was concentrated under
reduced pressure. The residue was suspended and triturated by
adding MTBE. The precipitated solid was collected by filtration to
give the title compound (35.1 mg).
[0686] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.38 (d,
J=625 Hz, 6H), 2.01 (s, 3H), 2.20 (s, 3H), 2.55-2.67 (m, 1H),
2.76-2.87 (m, 1H), 4.12-4.14 (m, 1H), 4.23-4.37 (m, 2H), 4.39-4.45
(m, 1H), 5.30-5.35 (m, 1H), 5.61-5.69 (m, 1H), 6.48 (s, 1H),
7.11-7.13 (m, 1H), 7.16-7.17 (m, 1H), 8.09-8.11 (m, 1H), 8.31 (s,
1H), 9.58 (brs, 1H).
[0687] ESI-MS m/z 419 [M+H].sup.+
Example 52
Synthesis of
8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00138##
[0688] (1) Synthesis of ethyl
5-[2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-1-(tetrahyd-
ro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylate
[0689] Pd(PPh.sub.3).sub.4 (50 mg), cesium carbonate (282 mg) and
water (0.5 mL) were added to a mixed solution of ethyl
5-(4-bromo-2,5-difluorophenyl)-1-(tetrahydro-2H-pyran-4-yl)-1H-pyrazole-4-
-carboxylate obtained in Preparation Example 10 (180 mg),
(2-methoxy-4,6-dimethylpyridin-3-yl)boronic acid obtained in
Preparation Example 27 (90 mg) and 1,4-dioxane (2 mL), and the
mixture was stirred at 110.degree. C. for six hours. After cooling
the reaction mixture to room temperature, ethyl acetate and brine
were added, and the mixture was filtered through a cotton plug. The
organic layer was separated and dried over anhydrous magnesium
sulfate. The desiccant was removed by filtration, and the filtrate
was concentrated under reduced pressure. The residue was subjected
to silica gel column chromatography (ethyl acetate/n-heptane, 25%
to 46% to 53%) to give the title compound (157 mg).
[0690] ESI-MS m/z 494 [M+Na].sup.+
(2) Synthesis of
5-[2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-1-(tetrahyd-
ro-2H-pyran-4-yl)-1H-pyrazole-4-carboxamide
[0691] A 5 N aqueous sodium hydroxide solution (0.3 mL) was added
to a solution of ethyl
5-[2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl]-1-(tetrahyd-
ro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylate (157 mg) in ethanol (3
mL), and the mixture was stirred at 55.degree. C. for two hours.
The reaction mixture was cooled to room temperature and then
concentrated under reduced pressure. The residue was partitioned by
adding chloroform, 5 N hydrochloric acid and a saturated aqueous
ammonium chloride solution. The organic layer was dried over
anhydrous magnesium sulfate. The desiccant was removed by
filtration, and the filtrate was concentrated under reduced
pressure to give
5-[2,5-difluoro-4-(2-methoxy-4,6-dimethyl-pyridin-3-yl)phenyl]-1-(tetrahy-
dro-2H-pyran-4-yl)-1H-pyrazole-4-carboxylic acid (155 mg) as a
crude purified product. The carboxylic acid (155 mg) was dissolved
in DMF (1 mL) and THF (3 mL). CDI (108 mg) was then added, and the
mixture was stirred at room temperature for about 1.5 hours. A 28%
aqueous ammonia solution (0.35 mL) was added to the reaction
mixture, and the mixture was stirred at room temperature overnight.
The reaction mixture was concentrated under reduced pressure, and
the residue was partitioned by adding ethyl acetate and brine. The
organic layer was washed with a saturated aqueous sodium
bicarbonate solution and dried over anhydrous magnesium sulfate.
The desiccant was removed by filtration, and the filtrate was
concentrated under reduced pressure. The residue was solidified by
adding n-heptane/MTBE (119) to give the title compound (82 mg). The
title compound was used for the next reaction without further
purification.
[0692] ESI-MS m/z 465 [M+Na].sup.+
(3) Synthesis of
8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydro-2H-pyran-4--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0693] KTB (41 mg) was added to a solution of
5-(2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-(tetrahyd-
ro-2H-pyran-4-yl)-1H-pyrazole-4-carboxamide (81 mg) in NMP (0.4
mL), and the mixture was heated to 90.degree. C. After one hour,
KTB (20 mg) was further added, followed by stirring for 30 minutes.
The reaction mixture was cooled to room temperature, followed by
adding a saturated aqueous ammonium chloride solution (2 mL) and
water (1 mL). The generated solid was filtered off, washed with
water (2 mL) and dried under reduced pressure at 60.degree. C. to
give the title compound (57 mg).
[0694] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.11 (s,
3H), 2.14-2.24 (m, 2H), 2.50 (s, 3H), 2.42-2.63 (m, 2H), 3.65-3.79
(m, 2H), 3.87 (s, 3H), 4.20428 (m, 2H), 4.93-5.03 (m, 1H), 6.76 (s,
1H), 7.35 (d, J=6.44 Hz, 1H), 7.71 (d, J=10.35 Hz, 1H), 8.30 (s,
1H), 10.93 (brs, 1H).
[0695] ESI-MS m/z 423 [M+H].sup.+
Example 53
Synthesis of
(S)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00139##
[0696] (1) Synthesis of ethyl
5-(2,5-difluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0697] Ethyl
5-(4-bromo-2,5-difluorophenyl)-1-((S)-tetrahydrofuran-3-yl)-1H-pyrazole-4-
-carboxylate obtained in Preparation Example 11-1 (4.31 g),
bis(pinacolato)diboron (3.27 g), potassium acetate (3.16 g) and
Pd(dppf)Cl.sub.2-DCM complex (439 mg) were added to DMF (41.6 mL),
and the mixture was stirred at 95.degree. C. in a nitrogen
atmosphere. After two hours, the reaction mixture was stirred at
105.degree. C. for four hours. The reaction mixture was cooled to
room temperature and filtered through Celite.TM.. The filtrate was
concentrated under reduced pressure, brine and ethyl acetate were
added to the residue, and the mixture was then stirred at room
temperature for five minutes. The mixture was filtered again
through Celite.TM., and the filtrate was extracted with ethyl
acetate. The organic layer was dried over anhydrous magnesium
sulfate and filtered through Celite.TM.. The filtrate was
concentrated. The residue was purified by silica gel chromatography
(n-heptane/ethyl acetate, 20% to 30% to 80%) to give ethyl
5-(2,5-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1--
((S)-tetrahydrofuran-3-yl)-1H-pyrazole-4-carboxylate (2.95 g). The
resulting ethyl
5-(2,5-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1--
((S)-tetrahydrofuran-3-yl)-1H-pyrazole-4-carboxylate (900 mg),
4-iodo-2-methoxy-3,5-dimethylpyridine obtained in Preparation
Example 29(3) (634 mg), Pd(PPh.sub.3).sub.4 (116 mg) and cesium
carbonate (1.96 g) were added to a mixed solvent of 1,4-dioxane
(9.3 mL) and water (3.1 mL), and the mixture was heated under
reflux for 2.5 hours. The reaction mixture was cooled to room
temperature and partitioned by adding ethyl acetate and brine. The
organic layer was dried over anhydrous magnesium sulfate and
filtered. The filtrate was concentrated, and the residue was
purified by NH silica gel column chromatography (ethyl
acetate/n-heptane, first time: 15% to 36% to 47%, second time: 10%
to 30% to 35%) to give the title compound (280 mg).
[0698] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.17-1.23
(m, 3H), 1.99-2.06 (m, 6H), 2.26-2.55 (m, 2H), 3.92-4.29 (m, 9H),
4.65-4.75 (m, 1H), 6.95-7.03 (m, 1H), 7.14-7.25 (m, 1H), 7.96 (s,
1H), 8.12 (s, 1H).
[0699] ESI-MS m/z 480 [M+Na].sup.+
(2) Synthesis of
5-(2,5-difluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxamide
[0700] 5 N sodium hydroxide (0.5 mL) was added to a solution of
ethyl
5-[2,5-difluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl]-1-[(S)-tetr-
ahydrofuran-3-yl)-1H-pyrazole-4-carboxylate (280 mg) in ethanol
(3.6 mL), and the mixture was stirred at 65.degree. C. for three
hours. After cooling the reaction mixture to room temperature,
chloroform and brine were added, and the mixture was adjusted to pH
6 with 5 N hydrochloric acid and saturated ammonium chloride
solution. The organic layer was dried over anhydrous magnesium
sulfate, and the desiccant was removed by filtration. The filtrate
was concentrated under reduced pressure to give
5-(2,5-difluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl)-1-((S)-tetr-
ahydrofuran-3-yl)-1H-pyrazole-4-carboxylic acid (238 mg) as a crude
purified product. CDI (121 mg) was added to a solution of the
carboxylic acid (238 mg) in DMF (3 mL), and the mixture was stirred
at room temperature for one hour. A 28% aqueous ammonia solution
(0.6 mL) was added to the reaction mixture, followed by stirring
overnight. The reaction mixture was concentrated under reduced
pressure, and the residue was partitioned by adding chloroform and
a saturated aqueous sodium bicarbonate solution. The organic layer
was washed with brine and then dried over anhydrous magnesium
sulfate, and the desiccant was removed by filtration. The filtrate
was passed through a silica gel pad (NH silica gel; eluting with
ethyl acetate), and the resulting filtrate was concentrated under
reduced pressure to give the title compound (186 mg).
[0701] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.95-2.10
(m, 6H), 2.25-2.57 (m, 2H), 3.91-429 (m, 7H), 4.69 (brs, 1H),
5.24-5.57 (m, 2H), 7.01 (dd, J=8.79, 5.66 Hz, 1H), 7.17-7.26 (m,
1H), 7.94-7.99 (m, 2H).
[0702] ESI-MS m/z 451 [M+Na].sup.+
(3) Synthesis of
(S)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0703] Sodium hydroxide (powder, 82 mg) was added to a solution of
5-(2,5-difluoro-4-(2-methoxy-3,5-dimethylpyridin-4-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxamide (186 mg) in DMSO (1.5
mL), and the mixture was stirred at 75.degree. C. for 1.5 hours.
The reaction mixture was cooled to room temperature, and water (5.5
mL) was then added with stirring. Acetic acid (0.12 mL) was further
added, followed by stirring for 30 minutes. The generated solid was
filtered, washed with water (5 mL) and then dried under reduced
pressure at 60.degree. C. for one hour to give the title compound
(155 mg).
[0704] .sup.1H-NMR. (400 MHz, CDCl.sub.3) .delta. (ppm): 1.98 (s,
3H), 2.00 (s, 3H), 2.55-2.72 (m, 1H), 2.73-2.86 (m, 1H), 4.01 (s,
3H), 4.13 (td, J=8.40, 4.69 Hz, 1H), 4.20-4.39 (m, 2H), 4.43 (dt,
J=9.57, 3.03 Hz, 1H), 5.52-5.62 (m, 1H), 7.23 (d, J=5.25 Hz, 1H),
7.84 (d, J=9.96 Hz, 1H), 7.98 (s, 1H), 8.32 (s, 1H), 10.82 (brs,
1H).
[0705] ESI-MS m/z 409 [M+H].sup.+
Example 54
Synthesis of
(S)-8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00140##
[0706] (1) synthesis of ethyl
5-(2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0707] Ethyl
5-(4-bromo-2,5-difluorophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-
-carboxylate (4.31 g), bis(pinacolato)diboron (3.27 g), potassium
acetate (3.16 g), Pd(dppf)Cl.sub.2-DCM complex (439 mg) were added
to DMF (41.6 mL), and the reaction mixture was stirred at
95.degree. C. in a nitrogen atmosphere. After stirring the reaction
mixture for about 2 hours, the reaction mixture was stirred at
105.degree. C. for about 4 hours. The reaction mixture was cooled
to room temperature and then filtered through Celite.TM.. The
filtrate was concentrated under reduced pressure, and after brine
and ethyl acetate were added to the residue the solution was
stirred at room temperature for 5 minutes. The reaction mixture was
again filtered through Celite.TM., and the filtrate was extracted
with ethyl acetate. The organic layer was dried over anhydrous
magnesium sulfate and filtrated through Celite.TM.. The filtrate
was concentrated, and the residue was purified by silica gel
chromatography (heptane/ethyl acetate, 20% to 30% to 80%) to give
ethyl
5-(2,5-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1--
[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate (2.95 g).
Eethyl
5-(2,5-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1--
[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate (812 mg),
3-bromo-2-methoxy-4,6-dimethylpyridine (490 mg),
Pd(PPh.sub.3).sub.4 (130 mg) and cesium carbonate (1.77 g) were
added to a mixed solvent of 1,4-dioxane (9.00 mL) and water (3.00
mL), and the reaction mixture was heated under reflux for 4 hours.
The reaction mixture was cooled to room temperature and partitioned
by adding ethyl acetate and brine. The organic layer was dried over
anhydrous magnesium sulfate and filtered. The filtrate was
concentrated, and the residue was purified by NH silica gel column
chromatography (ethyl acetate/n-heptane, 11% to 30% to 50%) to give
the title compound (397 mg). The title compound was used for the
next reaction without further purification.
[0708] ESI-MS m/z 480 [M+Na].sup.+
(2) Synthesis of
5-(2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxamide
[0709] A 5 N aqueous sodium hydroxide solution (0.8 mL) was added
to a solution of ethyl
5-(2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate (397 mg) in ethanol (5
mL), and the reaction mixture was stirred at 70.degree. C. for 1
hour. After cooling the reaction mixture to room temperature,
chloroform and brine were added, and the mixture was adjusted to pH
6 with 5 N hydrochloric acid and a saturated aqueous ammonium
chloride solution. The organic layer was dried over anhydrous
magnesium sulfate, and the desiccant was removed by filtration. The
filtrates was concentrated under reduced pressure to give
5-(2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylic acid (457 mg) as a
crude. CDI (211 mg) was added to a solution of the carboxylic acid
(457 mg) in DMF (6 mL), and the reaction mixture was stirred at
room temperature. After 75 minutes, a 28% aqueous ammonia solution
(0.88 mL) was added to the reaction mixture and the reaction
mixture was stirred at room temperature overnight. The reaction
mixture was concentrated under reduced pressure, and the residue
was partitioned by adding ethyl acetate and a saturated aqueous
ammonium chloride solution. The organic layer was washed with a
saturated aqueous sodium bicarbonate solution, dried over anhydrous
magnesium sulfate, and the desiccant was removed by filtration.
After the filtrate was concentrated under reduced pressure, the
precipitated solid was removed by filtration and washed with
dichloromethane and ethyl acetate. The filtrate was concentrated
under reduced pressure and the residue was purified by silica gel
chromatography (ethyl acetate/n-heptane, 60% to 80% to 85%) to give
title compound (199 mg). This title compound was used for the next
reaction without further purification.
[0710] ESI-MS m/z 451 [M+Na].sup.+
(3) Synthesis of (S)-8-fluoro-7-(2-methoxy-4
k-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinol-
in-4(5H)-one
[0711] Sodium hydroxide (powder, 74 mg) was added to a solution of
5-(2,5-difluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxamide (199 mg) in DMSO (2
mL), and the reaction mixture was stirred at 75.degree. C. for 1.5
hours. After the reaction mixture was cooled to room temperature,
water, acetic acid (0.106 mL) and ethyl acetate were added to the
reaction mixture with stirring. After the precipitated solid was
filtered, organic layer was washed with water, a saturated aqueous
sodium bicarbonate solution and brine, dried over anhydrous
magnesium sulfate, and the desiccant was removed by filtration.
After the filtrate was concentrated under reduced pressure, the
residue was purified by silica gel column chromatography (ethyl
acetate/n-heptane, 55% to 90% to 96%), and the resulting crude was
solidified by adding n-heptane/MTBE to give the title compound (33
mg).
[0712] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.11 (s,
3H), 2.49 (s, 3H), 2.56-2.67 (m, 1H), 2.71-2.84 (m, 1H), 3.86 (s,
3H), 4.07-4.40 (m, 4H), 5.49-5.62 (m, 1H), 6.68-6.78 (m, 1H),
7.24-731 (m, 1H), 7.74-7.84 (m, 1H), 8.25-8.32 (m, 1H), 10.16 (br.
s., 1H).
[0713] ESI-MS m/z 409 [M+H].sup.+
Example 55
Synthesis of
(S)-8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00141##
[0714] (1) Synthesis of ethyl
5-(2,5-difluoro-4-(6-methoxy-2,4-dimethylpyridin-3-yl)phenyl)-1-[(S)-tetr-
ahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0715] A mixture of ethyl
5-[2,5-difluoro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-1--
[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate synthesized in
accordance with Example 53 (430 mg),
3-bromo-6-methoxy-2,4-dimethylpyridine obtained in Preparation
Example 23 (223 mg), potassium hydrogen fluoride (254 mg),
Pd(PPh.sub.3).sub.4 (90 mg) and tripotassium phosphate n-hydrate
(400 mg) in DME (8 mL) and water (2 mL) was heated under reflux at
110.degree. C. for seven hours. The reaction mixture was cooled to
room temperature and partitioned by adding ethyl acetate and brine.
The organic layer was dried over anhydrous magnesium sulfate and
filtered. The filtrate was concentrated, and the residue was
purified by NH silica gel column chromatography (ethyl
acetate/n-heptane: 16% to 37% to 46%) and silica gel column
chromatography (ethyl acetate/n-heptane: 28% to 49% to 54%) to give
the title compound (144 mg). This compound was used for the next
reaction without further purification.
[0716] ESI-MS m/z 458 [M+H].sup.+
[0717] The reactions of (2) to (3) were performed in accordance
with Example 53. However, in the reaction (3), the title compound
obtained as a crude purified product was subjected to silica gel
column chromatography (ethyl acetate/n-heptane, 60% to 95%) and
then purified by solidification from MTBE to give the title
compound.
[0718] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.02-2.10
(m, 3H), 2.23-2.27 (m, 3H), 2.56-2.69 (m, 1H), 2.72-2.87 (m, 1H),
3.97 (s, 3H), 4.13 (td, J=8.44, 4.59 Hz, 1H), 4.20-4.37 (m, 2H),
4.43 (dd, J=9.86, 3.22 Hz, 1H), 5.51-5.63 (m, 1H), 6.57 (d, J=0.59
Hz, 1H), 7.20-7.25 (m, 1H), 7.82 (d, J=10.15 Hz, 1H), 8.31 (s, 1H),
10.38 (brs, 1H).
[0719] ESI-MS m/z 409 [M+H].sup.+
Example 56
Synthesis of
(S)-7-(3-ethyl-2-methoxy-5-methylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1-
H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00142##
[0721] The title compound was obtained by performing the reactions
(1) to (3) in accordance with Example 53 using ethyl
5-(4-bromo-2-fluorophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-car-
boxylate obtained in Preparation Example 6(1) and
3-ethyl-4-iodo-2-methoxy-5-methylpyridine obtained in Preparation
Example 49.
[0722] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 0.94-1.06
(m, 3H), 1.88-1.96 (m, 3H), 2.35 (q, J=7.48 Hz, 2H), 2.55-2.69 (m,
1H), 2.75-2.88 (m, 1H), 3.96-4.05 (m, 3H), 4.08-4.19 (m, 1H),
4.22-4.38 (m, 2H), 4.38-4.48 (m, 1H), 5.60-5.72 (m, 1H), 7.09 (dd,
J=8.30, 1.66 Hz, 1H), 7.20-725 (m, 1H), 7.93-7.95 (m, 1H), 8.12 (d,
J=8.20 Hz, 1H), 8.30 (s, 1H), 10.38 (brs, 1H).
[0723] ESI-MS m/z 405 [M+H].sup.+
Example 57
Synthesis of
(R)-8-fluoro-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3--
yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00143##
[0725] The title compound was obtained by performing the reactions
(1) to (3) in accordance with Example 53 using ethyl
5-(4-bromo-2,5-difluorophenyl)-1-((R)-tetrahydrofuran-3-yl)-1H-pyrazole-4-
-carboxylate obtained in Preparation Example 11-2 and
4-iodo-2-methoxy-3,5-dimethylpyridine obtained in Preparation
Example 29(3). However, in the reaction (3), the title compound
obtained as a crude purified product was purified by washing with
1-propanol.
[0726] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.98 (s,
3H), 2.00 (s, 3H), 2.56-2.71 (m, 1H), 2.73-2.89 (m, 1H), 4.01 (s,
3H), 4.13 (td, J=8.40, 4.69 Hz, 1H), 4.18-4.38 (m, 2H), 4.40-4.48
(m, 1H), 5.51-5.64 (m, 1H), 7.21-7.30 (m, 1H), 7.84 (d, J=10.15 Hz,
1H), 7.98 (d, J=0.78 Hz, 1H), 8.32 (s, 1H), 11.05 (brs, 1H).
[0727] ESI-MS m/z 409 [M+H].sup.+
[0728] The compounds of Examples 58 and 59 were synthesized as in
Example 57.
##STR00144##
TABLE-US-00009 TABLE 9 # R.sup.2 NMR, Mass 58 ##STR00145##
.sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.11 (s, 3H), 2.50
(s, 3H), 2.56-2.69 (m, 1H), 2.71-2.87 (m, 1H), 3.87 (s, 3H), 4.12
(td, J = 8.40, 4.69 Hz, 1H), 4.21-4.36 (m, 1H), 4.38-4.47 (m, 1H),
5.50-5.61 (m, 1H), 6.73-6.78 (m, 1H), 7.36 (d, J = 6.44 Hz, 1H),
7.79 (d, J = 10.15 Hz, 1H), 8.30 (s, 1H), 11.05 (d, J = 8.01 Hz,
1H). ESI-MS m/z 409 [M + H].sup.+ 59 ##STR00146## .sup.1H-NMR (400
MHz, CDCl.sub.3) .delta. (ppm): 2.06 (s, 3H), 2.25 (s, 3H),
2.57-2.70 (m, 1H), 2.74-2.85 (m, 1H), 3.98 (s, 3H), 4.13 (td, J =
8.35, 4.59 Hz, 1H), 4.22-4.37 (m, 2H), 4.43 (dd, J = 9.57, 3.32 Hz,
1H), 5.54-5.62 (m, 1H), 6.57 (s, 1H), 7.30 (d, J = 3.64 Hz, 1H),
7.82 (d, J = 9.96 Hz, 1H) 8.32 (s, 1H), 10.96 (brs, 1H). ESI-MS m/z
409 [M + H].sup.+
Example 60
Synthesis of 7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-[(3RS,4
SR)-4-methoxytetrahydrofuran-3-yl]-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
##STR00147## ##STR00148##
[0729] (1) Synthesis of ethyl
5-(4-bromo-2-fluorophenyl)-1-[(3RS,4SR)-4-hydroxytetrahydrofuran-3-yl]-1H-
-pyrazole-4-carboxylate
[0730] The title compound was synthesized in accordance with
Preparation Example 7 using
(3SR,4RS)-4-hydrazinyltetrahydrofuran-3-ol hydrochloride obtained
in Preparation Example 18 in place of
(S)-(tetrahydrofuran-3-yl)hydrazine hydrochloride.
[0731] ESI-MS m/z 421 [M+Na].sup.+
(2) Synthesis of ethyl
5-(2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(3RS,4SR)-4--
hydroxytetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0732] Ethyl
5-(4-bromo-2-fluorophenyl)-1-[(3RS,4SR)-4-hydroxytetrahydrofuran-3-yl]-1H-
-pyrazole-4-carboxylate (3.8 g), bis(pinacolato)diboron (2.90 g),
potassium acetate (2.80 g) and Pd(dppf)Cl.sub.2-DCM complex (480
mg) were added to DMF (38.3 mL), and the mixture was stirred at
90.degree. C. in a nitrogen atmosphere. After stirring the reaction
mixture for about two hours, a solution of
3-bromo-2-methoxy-4,6-dimethylpyridine obtained in Preparation
Example 26 (3.09 g) in DMF (15 mL), and water (22 mL) were added,
and the mixture was warmed to 120.degree. C. and further stirred
for about five hours. The reaction mixture was cooled to room
temperature and concentrated under reduced pressure, and the
residue was passed through a silica gel pad (NH silica gel, eluting
with ethyl acetate). The filtrate was concentrated to about 200 mL
and then partitioned by adding brine. The organic layer was dried
over anhydrous magnesium sulfate and filtered. The filtrate was
concentrated, and the residue was purified by NH silica gel column
chromatography (ethyl acetate/n-heptane, 70% to 90%) to give the
title compound (2.26 g).
[0733] ESI-MS m/z 456 [M+H].sup.+
(3) Synthesis of ethyl
5-(2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(3RS,4SR)-4--
methoxytetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
[0734] Sodium hydride (60% oil dispersion, 86 mg) was added to a
solution of ethyl
5-(2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(3R-
S,4SR)-4-hydroxytetrahydrofuran-3-yl]-1H-pyrazole-4-carboxylate
(612 mg) in THF (5 mL) under ice-cooling, followed by stirring for
three minutes. Methyl iodide (0.142 mL) was added to the reaction
mixture, and the mixture was stirred at the same temperature for
five minutes, and then warmed to room temperature and stirred for
further two hours. A saturated aqueous ammonium chloride solution
was added to the reaction mixture, followed by extraction with
ethyl acetate. The organic layer was washed with brine, dried over
anhydrous magnesium sulfate and filtered. The filtrate was
concentrated, and the residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 27% to 48%) to give the
title compound (379 mg).
[0735] ESI-MS m/z 492 [M+Na].sup.+
(4) Synthesis of
5-(2-fluoro-4-(2-methoxy-4,6-dimethylpyridin-3-yl)phenyl)-1-[(3RS,4SR)-4--
methoxytetrahydrofuran-3-yl]-1H-pyrazole-4-carboxamide
[0736] The title compound was synthesized in accordance with
Example 53(2).
[0737] ESI-MS m/z 463 [M+Na].sup.+
(5) Synthesis of
7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-[(3RS,4SR)-4-methoxytetrahydrofu-
ran-3-yl]-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0738] The title compound was obtained in accordance with Example
53. However, the title compound obtained as a crude purified
product was purified by washing with MTBE.
[0739] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 2.10 (s,
3H), 2.49 (s, 3H), 3.42 (s, 3H), 3.86 (s, 3H), 4.10 (dd, J=10.15,
2.15 Hz, 1H), 4.24-4.37 (m, 2H), 4.47 (dd, J=9.47, 6.35 Hz, 1H),
4.64-4.70 (m, 1H), 5.47-5.51 (m, 1H), 6.73-6.74 (m, 1H), 7.17-7.23
(m, 1H), 7.27-7.30 (m, 1H), 8.16 (d, J=8.40 Hz, 1H), 8.27-8.32 (m,
1H), 10.11 (s, 1H).
[0740] ESI-MS m/z 421 [M+H].sup.+
Example 61
Synthesis of
7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-[(3RS,4SR)-4-methoxytetrahydrofu-
ran-3-yl]-1H-pyrazolo[4,3-c]quinolin-4(51-1)-one
##STR00149## ##STR00150##
[0742] The title compound was obtained by performing the reactions
(1) to (5) in accordance with Example 60 using
4-iodo-2-methoxy-3,5-dimethylpyridine obtained in Preparation
Example 29(3).
[0743] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.89-2.00
(m, 6H), 3.42 (d, J=3.59 Hz, 3H), 4.00 (s, 3H), 4.07-4.16 (m, 1H),
4.25-4.39 (m, 2H), 4.48 (dd, J=9.47, 6.35 Hz, 1H), 4.68 (dd, 1.95
Hz, 1H), 5.50 (ddd, J=5.20, 4.25, 1.86 Hz, 1H), 7.06-7.14 (m, 1H),
7.16-7.21 (m, 1H), 7.95 (s, 1H), 8.22 (d, J=8.40 Hz, 1H), 8.29-8.34
(m, 1H), 10.11 (s, 1H).
[0744] ESI-MS m/z 421 [M+H].sup.+
Example 62
Synthesis of
(S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one
##STR00151##
[0745] (1) Synthesis of ethyl
5-[4-(6-ethoxy-2,4-dimethylpyridin-3-yl)-2-nitrophenyl]-1-[(S)-tetrahydro-
furan-3-yl]-1H-pyrazole-4-carboxylate
[0746] Ethyl
5-[2-nitro-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl][(S)-tet-
rahydrofuran-3-yl]-1H-pyrazole-4-carboxylate obtained in
Preparation Example 7-(2) (200 mg) was dissolved in a mixed
solution of 1,4-dioxane (4 mL) and water (1 mL).
3-bromo-6-ethoxy-2,4-dimethylpyridine obtained in Preparation
Example 51 (121 mg), Pd(PPh.sub.3).sub.4 (25 mg) and cesium
carbonate (428 mg) were added, and the mixture was reacted using a
microwave reactor at 130.degree. C. for three hours. The reaction
mixture was returned to room temperature, followed by extraction
with ethyl acetate. The organic layer was washed with brine and
dried over anhydrous sodium sulfate. The desiccant was removed by
filtration, and the filtrate was concentrated under reduced
pressure. The residue was purified by silica gel column
chromatography (ethyl acetate/n-heptane, 30% to 100%) to give the
title compound (97 mg).
[0747] ESI-MS m/z 481 [M+H].sup.+
(2) Synthesis of
(S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyr-
azolo[4,3-c]quinolin-4(5H)-one
[0748] Ethyl
5-[4-(6-ethoxy-2,4-dimethylpyridin-3-yl)-2-nitrophenyl]-1-[(S)-tetrahydro-
furan-3-yl]-1H-pyrazole-4-carboxylate (97 mg) was dissolved in
acetic acid (1 mL). Iron powder (56 mg) was added to the solution,
and the mixture was stirred at 90.degree. C. for four hours. The
reaction mixture was returned to room temperature, and water (2 mL)
was added to the reaction mixture. The precipitated solid was
collected by filtration and washed with water. The resulting solid
was dissolved in ethanol (1 mL) at 90.degree. C. The solution was
ice-cooled, and the precipitated solid was collected by filtration.
The resulting solid was washed with MTBE to give the title compound
(16 mg).
[0749] .sup.1H-NMR (400 MHz, CDCl.sub.3) .delta. (ppm): 1.43 (t,
J=7.0 Hz, 3H), 2.03 (s, 3H), 2.21 (s, 3H), 2.55-2.67 (m, 1H),
2.76-2.87 (m, 1H), 4.07-4.17 (m, 2H), 4.23-4.47 (m, 4H), 5.62-5.70
(m, 1H), 6.53 (s, 1H), 7.12 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.32 (d,
J=1.6 Hz, 1H), 8.10 (d, J=8.6 Hz, 1H), 8.31 (s, 1H), 11.02 (brs,
1H).
[0750] ESI-MS m/z 405 [M+H].sup.+
Example 63
Synthesis of
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
##STR00152##
[0751] (1) Synthesis of
(S)-7-bromo-1-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one
[0752] Sodium hydrosulfite (265 mg) was added to a solution of
ethyl
5-(4-bromo-2-nitrophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazole-4-carb-
oxylate obtained in Preparation Example 7(1) (100 mg) in TIT (1 mL)
and water (0.5 mL) at 0.degree. C. The mixture was stirred at room
temperature for 46 hours. The reaction mixture was cooled at
0.degree. C., and 5 N hydrochloric acid (0.25 mL) was then added.
The mixture was stirred at room temperature for three hours. After
cooling at 0.degree. C., a 5 N aqueous sodium hydroxide solution
(0.25 mL) was added to the reaction mixture. The mixture was
extracted with isopropyl acetate. The organic layer was washed with
water and brine and then concentrated under reduced pressure. Ethyl
5-(2-amino-4-bromophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazolo-4-carb-
oxylate (71 mg) was obtained as a crude purified product. This was
used for the next step without further purification. Ethyl
5-(2-amino-4-bromophenyl)-1-[(S)-tetrahydrofuran-3-yl]-1H-pyrazolo-4-carb-
oxylate (50 mg) obtained as a crude purified product was added to
acetic acid (1 mL). The mixture was stirred at 60.degree. C. for
two hours. After cooling the reaction mixture to room temperature,
water (1 mL) was added, and the mixture was stifled at room
temperature for two hours. The precipitated solid was collected by
filtration. The solid was washed with ethanol (1 mL) and then dried
under reduced pressure. The title compound (42 mg) was
obtained.
[0753] .sup.1H-NMR (400 MHz, DMSO-d.sub.6) .delta. (ppm): 2.41-2.56
(m, 2H), 3.89-4.03 (m, 2H), 4.10-4.19 (m, 2H), 5.78 (m, 1H),
7.41-7.44 (m, 1H), 7.64-7.65 (m, 1H), 8.16-8.18 (m., 2H), 11.53 (s,
11-1).
[0754] ESI-MS m/z 336 [M+H].sup.+
(2) Synthesis of
(S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1H-py-
razolo[4,3-c]quinolin-4(5H)-one
[0755]
(S)-7-bromo-1-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinolin-4(5-
H)-one (100 mg), (2-methoxy-3,5-dimethyl-pyridin-4-yl)boronic acid
(65 mg) obtained in Preparation Example 29 (4) and cesium carbonate
(293 mg) were added to a mixed solution of DMF (5 mL) and water (1
mL) at room temperature. PdCl.sub.2(PPh.sub.3).sub.2 (10.5 mg) was
added to the mixture in a nitrogen gas stream. The mixture was
stirred at 80.degree. C. for one hour and at 100.degree. C. for 4.5
hours. After cooling the reaction mixture to room temperature,
water (5 mL) was added, and the mixture was extracted with
isopropyl acetate. The organic layer was washed with water and
brine and then concentrated under reduced pressure. A crude
purified product (64.7 mg) was obtained as the title compound. The
instrumental data of this compound were identical to those of the
(-)-form of Example 25.
Pharmacological Test Examples
A PDE9 Inhibitory Activity Test Example
[0756] 1) Preparation of a Human Recombinant PDE9 Protein
[0757] An hsPDE9A 1cDNA fragment was amplified by being based on a
base sequence (Accession No.: AF048837) of the hsPDE9A1 registered
on GenBank data base, and by using the following sequences
(Hokkaido System Science Co., Ltd.) as a primer and Human
hippocampus cDNA library (Clontech Laboratories, Inc.) as a
template DNA, and using Pfu50 DNA polymerase (Invitrogen Corp.),
and by a polymerase chain reaction (PCR) of the following
condition.
TABLE-US-00010 (SEQ No. 1) An hPDE9-1 primer:
AGGATGGGATCCGGCTCCTCCA (SEQ No. 2) An hPDE9A-3 primer:
CAGGCACAGTCTCCTTCACTG
The condition of PCR: [96.degree. C., 5 min].times.1 cycle,
[(96.degree. C., 10 sec), (57.degree. C., 5 sec), (72.degree. C., 2
min)].times.30 cycles
[0758] The obtained hsPDE9A 1 cDNA fragment was incorporated in a
TOPO-TA cloning vector (Invitrogen Corp.), and the base sequence
was checked; and thereafter, the resultant was transfected in a
pcDNA 3.1/myc His-tag vector (Invitrogen Corp.) to thereby make a
human PDE9 expression vector for mammal cells. The human PDE9
expression vector for mammal cells was transfected with transient
expression to an HEK293 cell by using a LIPOFETAMINE 2000 Reagent
(Gibco). It was confirmed by Western blot method that the PDE9A
expressed in the HEK293 cell, and then, the human PDE9A 1cDNA
fragment was transfected in a pYNG vector (Katakura Industries Co.,
Ltd.) to thereby make an expression vector for insect cells. A
supernatant of homogenized silk worm in which a large amount of
PDE9 was expressed was purified by an equilibrated Ni column using
a buffer A (20 mmol/L Tris-HCl, pH: 8.0, 1 mmol/L DTT, 10 mmol/L
imidazole). After 1 hour of mixing of the supernatant and the Ni
column, cleaning was carried out using a buffer B (20 mmol/L
Tris-HCl, pH: 8.0, 1 mmol/L Du), and elution was carried out using
a buffer C (20 mmol/L Tris-HCl, pH: 8.0, 1 mmol/L DTT, 100 mmol/L
imidazole). An elution fraction was preparatively collected to
thereby obtain a PDE9 enzyme solution.
[0759] 2) Measurement of PDE9 Inhibitory Action
[0760] To 100 .mu.L of a buffer D (40 mmol/L Tris-HCl, pH: 7.4, 10
mmol/L MgCl.sub.2, 1 mM DTT, 2 .mu.M cGMP) solution containing
[.sup.3H]-cGMP (0.5 .mu.Ci/mL), 10 .mu.L of a compound solution for
evaluation (a solution in which a compound was dissolved in DMSO
and diluted so that the DMSO concentration became 5%) and 90 .mu.L
of a solution prepared by diluting the PDE9 enzyme solution
prepared in the above with a buffer E (40 mmol/L Tris-HCl, pH: 7.4,
10 mmol/L MgCl.sub.2, 1 mM DTT, 1 mmol/L EGTA) were added under ice
cooling. The resultant mixed solution was incubated at 30.degree.
C. for 10 min, and thereafter heated for 2 min in boiled water to
stop the enzyme reaction of the PDE9. Then, the resultant was
returned to room temperature; 50 .mu.L of 5'-Nucleotidase (Biomol
GmbH, 10 units/mL) was added thereto; and the resultant was
incubated at 30.degree. C. for 10 min to thereby convert
[.sup.3H]-5'-GMP formed in the previous reaction to
[.sup.3H]-guanosine. 500 .mu.L of an anion exchange resin (Bio-Rad
AG1-X2 resin, mesh size: 200-400, H.sub.2O:resin=2:1) was added to
the resultant reaction liquid, and allowed to stand for 10 min, and
thereafter centrifuged (2,000 rpm, 10 min); and a supernatant in
which the [.sup.3H]-guanosine was present was transferred to a
LumaPlate (PerkinElmer, Inc.), and the radioactivity was measured
by a TopCount NXT microplate scintillation and luminescence counter
(PerkinElmer, Inc.).
[0761] The inhibition percentage of the evaluation compound was
calculated using the following expression, taking the radioactivity
of a control containing no evaluation compound to be (A), the
radioactivity of a blank containing no enzyme to be (B), and the
radioactivity of the evaluation compound to be (C).
Inhibition percentage=100-{[(C)-(B)]/[(A)-(B)]}.times.100 (%)
[0762] The IC.sub.50 value for PDE9 of the evaluation compound was
determined from inhibition percentage for various concentrations.
The IC.sub.50 value in each evaluation compound is shown in Table
10.
TABLE-US-00011 TABLE 10 PDE9 IC.sub.50 Example (.mu.M) 1 0.0243 2
0.025 3 0.014 4 0.00437 6 0.00686 7 0.0092 8 0.0252 9 0.0217 10
0.0208 11 0.0113 12 0.0197 13 0.0367 14 0.0212 15 0.00887 16
0.00632 17 0.00608 18 0.0093 19 0.013 20 0.0289 21 0.0539 22 0.0523
23 0.00951 24 0.0187 25 (-)S 0.00943 25 (+)R 0.041 28 (-) 0.00836
28 (+) 0.0296 29 (-) 0.0307 29 (+) 0.137 30 (-) 0.0708 30 (+) 0.225
31 (-) 0.00742 31 (+) 0.0201 32 (-) 0.0122 32 (+) 0.0707 33 (-)
0.0279 33 (+) 0.113 34 (-) 0.00336 34 (+) 0.00388 35 (-) 0.00296 35
(+) 0.00262 36 (-) 0.0081 36 (+) 0.00898 37 (-) 0.0101 37 (+)
0.0109 38 (-) 0.0124 38 (+) 0.0171 39 (-) 0.00408 39 (+) 0.00507 40
0.00321 41 (-) 0.0121 41 (+) 0.00591 42 (-) 0.022 42 (+) 0.00881 43
0.0105 44 0.0121 45 0.00333 46 0.0181 47 0.00567 48 0.00835 49
0.0122 50 0.00651 51 0.00487 52 0.00477 53 0.0101 54 0.00871 55
0.0175 56 0.0101 57 0.0439 58 0.0117 59 0.0715 60 0.0311 61 0.0775
62 0.0111
[0763] 3) Effect on Rodent Cerebrospinal Fluid cGMP
[0764] The test compound was administered to ICR male mice (Charles
River Laboratories Japan, Inc.), Sprague-Dawley male rats (SD)
(Charles River Laboratories Japan, Inc.) or Long-Evans male rats
(LE) (Institute for Animal Reproduction), and the cerebrospinal
fluid was then collected under pentobarbital anesthesia and stored
at -20.degree. C. cGMP in the cerebrospinal fluid was measured in
accordance with the acetylation EIA procedure of cGMP EIA kit (GE
Healthcare) or the non-acetylation procedure of cGMP EIA kit
(Cayman) The result was an increase (C) in the amount of cGMP of
the test compound-administered group (B) relative to the amount of
cGMP of the vehicle-administered group (A), and was calculated
using the following formula
cGMP increase (C)=[(B)-(A)]/(A).times.100 (%)
[0765] The results are shown in the following table.
TABLE-US-00012 TABLE 11 (+/-) % CSF cGMP or increase from, dose
(mg/kg, sampling Example (R/S) vehicle control species p.o.) time
(hr) 2 110 mouse 10 0.5 3 186 rat(SD) 10 2 4 246 rat(LE) 30 1 6 120
rat(SD) 10 1 12 91 rat(SD) 3 1 15 203 rat(LE) 30 1 18 123 rat(SD) 3
1 24 149 rat(SD) 10 1 26 S 274 rat(LE) 10 1 28 (-) 257 rat(SD) 3 1
29 (-) 238 rat(LE) 30 1 32 (-) 72 rat(SD) 10 1 43 292 rat(LE) 10 1
51 189 rat(LE) 10 1 53 202 rat(LE) 10 1 54 282 rat(LE) 10 1 55 323
rat(LE) 10 1 62 155 rat(LE) 3 1
[0766] 4) Effect on Rodent Hippocampal cGMP
[0767] The test compound was administered to Sprague-Dawley male
rats (Charles River Laboratories Japan, Inc.) or Long-Evans male
rats (Institute for Animal Reproduction) and then the animals were
sacrificed with microwave under pentobarbital anesthesia, and the
hippocampus was extracted. After measuring the wet weight, the
hippocampus was frozen with liquid nitrogen and stored at
-80.degree. C. In the measurement of cGMP in the hippocampus, a 0.5
M perchloric acid/1 mM EDTA solution was added at 5% (w/v) based on
the wet weight, and the mixture was homogenized. After the
homogenization, the homogenate was centrifuged (10000 rpm, 15 min),
and the supernatant was collected. The collected supernatant was
neutralized with a 2 M potassium bicarbonate solution and
centrifuged (13000 rpm, 10 min). The cGMP concentration in the
supernatant was measured in accordance with the non-acetylation EIA
procedure of cGMP EIA kit (GE Healthcare). The result was an
increase (C) in the amount of cGMP of the test
compound-administered group (B) relative to the amount of cGMP of
the vehicle-administered group (A), and was calculated using the
following formula.
cGMP increase (C)=[(B)-(A)]/(A).times.100 (%)
[0768] The results are shown in the following table.
TABLE-US-00013 TABLE 12 (+/-) % hippocampal cGMP dose or increase
from (mg/kg, sampling Example (R/S) vehicle control species p.o.)
time (hr) 3 32 rat(SD) 10 4 4 25 rat(LE) 30 1 15 33 rat(LE) 30 1 26
S 58 rat(LE) 10 1 29 (-) 34 rat(LE) 30 1 43 33 rat(LE) 10 1 51 17
rat(LE) 10 1 53 27 rat(LE) 10 1 54 23 rat(LE) 10 1 55 17 rat(LE) 10
1
Sequence CWU 1
1
2122DNAArtificialhPDE9-1 1aggatgggat ccggctcctc ca
22221DNAArtificialhPDE9A-3 2caggcacagt ctccttcact g 21
* * * * *