U.S. patent application number 13/804169 was filed with the patent office on 2013-11-07 for ngal for diagnosis of renal conditions.
The applicant listed for this patent is Jonathan M. Barasch, Prasad DEVARAJAN. Invention is credited to Jonathan M. Barasch, Prasad DEVARAJAN.
Application Number | 20130295589 13/804169 |
Document ID | / |
Family ID | 35320735 |
Filed Date | 2013-11-07 |
United States Patent
Application |
20130295589 |
Kind Code |
A1 |
DEVARAJAN; Prasad ; et
al. |
November 7, 2013 |
NGAL FOR DIAGNOSIS OF RENAL CONDITIONS
Abstract
Use of serum neutrophil gelatinase-associated lipocalin (NGAL)
as a biomarker, alone or in conjunction with creatinine to aid in
the diagnosis of renal conditions such as acute tubular necrosis
and acute renal failure, and a method and a kit for assigning a
diagnosis of acute tubular necrosis or acute renal failure to a
subject based on the correlation between the levels of NGAL and
optionally creatinine in a sample obtained from a subject when
compared to a sample obtained from a normal subject not
experiencing acute tubular necrosis or acute renal failure.
Inventors: |
DEVARAJAN; Prasad;
(Cincinnati, OH) ; Barasch; Jonathan M.; (New
York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DEVARAJAN; Prasad
Barasch; Jonathan M. |
Cincinnati
New York |
OH
NY |
US
US |
|
|
Family ID: |
35320735 |
Appl. No.: |
13/804169 |
Filed: |
March 14, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13359772 |
Jan 27, 2012 |
|
|
|
13804169 |
|
|
|
|
12817566 |
Jun 17, 2010 |
8247376 |
|
|
13359772 |
|
|
|
|
11123364 |
May 6, 2005 |
7776824 |
|
|
12817566 |
|
|
|
|
11096113 |
Mar 31, 2005 |
|
|
|
11123364 |
|
|
|
|
60615566 |
Oct 1, 2004 |
|
|
|
60568645 |
May 6, 2004 |
|
|
|
60577662 |
Jun 7, 2004 |
|
|
|
Current U.S.
Class: |
435/7.92 ;
422/430; 435/287.2; 436/501 |
Current CPC
Class: |
A61P 9/00 20180101; A61P
11/00 20180101; A61P 39/02 20180101; A61P 31/04 20180101; A61K
38/1709 20130101; A61P 1/16 20180101; A61P 37/06 20180101; G01N
2333/47 20130101; A61P 3/10 20180101; A61P 17/02 20180101; G01N
33/6893 20130101; G01N 33/74 20130101; A61P 29/00 20180101; A61P
43/00 20180101; A61P 25/00 20180101; A61P 9/14 20180101; A61K
39/025 20130101; A61P 17/00 20180101; A61P 13/12 20180101; A61P
1/18 20180101; A61P 9/12 20180101; A01N 1/0226 20130101; A61P 1/00
20180101; A61P 9/08 20180101; A61P 9/10 20180101; G01N 2800/347
20130101; A61P 31/00 20180101; A61P 13/10 20180101; A61K 38/1709
20130101; A61K 2300/00 20130101; A61K 39/025 20130101; A61K 2300/00
20130101 |
Class at
Publication: |
435/7.92 ;
436/501; 435/287.2; 422/430 |
International
Class: |
G01N 33/74 20060101
G01N033/74 |
Goverment Interests
INTERESTS
[0002] This invention was made with government support under Grant
Nos. DK53289, DK52612, and DK070163 awarded by the National
Institutes of Health (NIH). The Government has certain rights in
this invention.
Claims
1. A method of assigning a diagnosis of acute tubular necrosis to a
subject, comprising; a) measuring a level of NGAL in a sample
obtained from said subject, b) comparing the level of NGAL in the
sample from said subject with the level of NGAL in a sample from a
normal subject, and; assigning a diagnosis of acute tubular
necrosis when the level of NGAL in a sample obtained from said
subject is greater than said normal subject.
2. The method of claim 1 wherein the level of NGAL in said subject
is at least about 7 fold greater than said normal subject.
3. The method of claim 1 wherein the level of NGAL in a sample from
a normal subject is about 20 ng/mL.
4. A method of diagnosing whether a subject is experiencing acute
renal failure or chronic renal failure, comprising; a) measuring
the level of NGAL in a sample obtained from the subject; b)
measuring the level of creatinine in a sample obtained from the
subject; c) correlating the level of NGAL with the level of
creatinine, and assigning a diagnosis of acute renal failure or
chronic renal failure based on said correlation.
5. The method of claim 4 wherein when there is a high correlation
between the measured level of NGAL and creatinine, assigning a
diagnosis of acute renal failure to said subject.
6. The method of claim 4 wherein when there is no correlation
between the measured level of NGAL and creatinine, assigning a
diagnosis of chronic renal failure to said subject.
7. The method of claim 4 wherein the level of NGAL is measured in a
sample of serum obtained from said subject.
8. The method of claim 4 wherein the level of creatinine is
measured in a sample of serum obtained from said subject.
9. The method of claim 4 wherein the level of NGAL is measured in a
sample of plasma obtained from said subject.
10. The method of claim 4 wherein the level of NGAL is measured in
a sample of blood obtained from said subject.
11. A kit for the diagnosis of acute renal failure or chronic renal
failure in a subject, comprising: a) a monoclonal antibody that
recognises human NGAL; b) a tube for collecting a blood sample
containing either citrate, EDTA or heparin; c) instructions for
obtaining an assay result and performing a correlation of assay
data to determine whether a subject has acute renal failure or
chronic renal failure; wherein said instructions further indicate
that a high degree of correlation between a NGAL level and
creatinine level is indicative of acute renal failure; and wherein
when there is no correlation between a NGAL level and creatinine
level, said instructions indicate chronic renal failure is present.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 13/359,772, filed Jan. 27, 2012, which is a continuation of
U.S. application Ser. No. 12/817,566 (now U.S. Pat. No. 8,247,376),
filed on 17, Jun. 2010, which is a continuation of U.S. application
Ser. No. 11/123,364, filed on 6, May 2005 (now U.S. Pat. No.
7,776,824), which claims the benefit of U.S. Provisional
Applications 60/615,566 filed on filed 1, Oct. 2004 and 60/568,645
filed 6, May 2004; this application is also a continuation of U.S.
application Ser. No. 11/096,113 filed 31, Mar. 2005, which claims
the benefit of U.S. Provisional Application 60/577,662 filed 7,
Jun. 2004. Each of the foregoing applications is incorporated
herein by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to methods of reducing or
ameliorating ischemic and nephrotoxic injury in organs. The
invention further relates to the treatment of patients suffering
from various diseases that are associated with ischemic and
toxin-induced injury or insult. The invention further relates to
the treatment of patients suffering from acute or chronic kidney
injury.
BACKGROUND OF THE INVENTION
[0004] A decrease in oxygen flow to an organ, called ischemia,
triggers a complex series of events that affect the structure and
function of virtually every organelle and subcellular system of the
affected cells. Ischemia-reperfusion (resumption of blood flow)
injury leads to the production of excessive amounts of reactive
oxygen species (ROS) and reactive nitrogen species (RNS), thus
causing oxidative stress which results in a series of events such
as alterations in mitochondrial oxidative phosphorylation,
depletion of ATP, an increase in intracellular calcium and
activation of protein kinases, phosphatases, proteases, lipases and
nucleases leading to loss of cellular function/integrity. It has
been shown that the inflammatory response induced by ischemia
followed by reperfusion is largely responsible for tissue and organ
damage.
[0005] Ischemic-reperfusion injury is a serious problem in organ
transplantation because the harvested organ is removed from the
body, isolated from a blood source, and thus deprived of oxygen and
nutrients for an extended period of time. A critical problem to be
addressed in present-day kidney transplantation procedures is the
relatively high incidence of delayed graft function (DGF) due to
acute tubular necrosis (ATN) following surgery. Illustratively, DGF
affects about 20-35% of kidney transplants in many transplant
centers and is the most common complication of the immediate
post-operative period in renal transplantation. Although the
incidence and definition of DGF vary among transplant centers, the
consequences most frequently involve a prolonged hospital stay,
additional invasive procedures and additional costs to the patient
and health-care system. Delay in graft function not only affects
the individual patient, it also impacts the infrastructure for
organ procurement and sharing as a consequence of the drain it
places on the available organ supply. DGF also increases the risk
of early acute rejection episodes and increases early graft loss
from chronic rejection.
[0006] With current preservation methods, cold ischemia resulting
from organ preservation has been identified as a major risk factor
in causing DGF after transplant. For kidneys, cold ischemia times
in excess of 24 hours are associated with a significantly increased
risk of DGF. In the mid-1960's, cold preservation of kidneys was
effectively achieved by using machine perfusion and a solution
derived from cryoprecipitated plasma. Thereafter, by simple
cold-storage methods were introduced and involved the use of a cold
crystalloid solution. Since the early successes with kidneys,
preservation solutions have evolved into entirely synthetic defined
media designed to prevent cold ischemic injury by suppression of
cell swelling and provision of metabolic support. An early
synthetic solution, a lactobionate-based solution (UW) from the
University of Wisconsin has been used for both pancreas and liver.
With the advent of synthetic and serum-free preservation
formulations, the quality and duration of feasible organ
preservation have improved. Despite this, however, clinical data on
DGF in kidneys and other problems involving renal cell structure
and morphology clearly demonstrate that such solutions are not
completely successful in preventing ischemic injury or insult.
[0007] In addition, acute renal failure (ARF) secondary to ischemic
or nephrotoxic injury also remains a common and potentially
devastating problem in clinical nephrology, with a persistently
high rate of mortality despite significant advances in supportive
care. Over several decades, a number of studies have illuminated
the roles of persistent vasoconstriction, tubular obstruction,
cellular structural and metabolic alterations, and the inflammatory
response in the pathogenesis of ARF. Treatments and remedies for
ARF have been hampered by the multifaceted response of the kidney
to ischemia, as well as a lack of early markers for ARF. Recent
advances in cellular and molecular biology of ischemic and
nephrotoxic renal injury have shown that proximal tubule cells
undergo a complex temporal sequence of events, including loss of
cell polarity, cell death due to apoptosis and necrosis,
de-differentiation and proliferation of viable cells, and
re-establishment of the epithelial phenotype.
[0008] As a result of ischemic or nephrotoxic damage, cells may die
through two different processes. Apoptosis or programmed cell death
("cell suicide") is a physiological mechanism for removing
senescent, damaged or abnormal cells that affects individual cells.
Apoptosis is initiated by an endonuclease and is characterized by
DNA fragmentation into multiples of 180-200 base pairs. Apoptotic
cells are ingested by macrophages or neighboring cells without
release of proteolytic enzymes or toxic oxygen species and the
process is not accompanied by inflammation. By contrast, necrosis
("cell murder") is a pathological process that affects populations
of cells and results in focal tissue destruction, inflammation and
often serious systemic consequences. Apoptotic cell death has now
been shown to play an important role in an increasing array of
kidney diseases, including ischemia, ischemia-reperfusion,
nephrotoxins, polycystic kidney disease, obstruction, and
glomerular diseases. Down-regulation of apoptosis therefore offers
a unique and powerful therapeutic approach to the amelioration of
several acute and chronic kidney injuries.
[0009] An individual is considered to have acute renal failure when
the patient's serum creatinine value either (1) increased by at
least 0.5 mg/dL when the baseline serum creatinine level was less
than 2.0 mg/dL; (2) increased by at least 1.5 mg/dL when the
baseline serum creatinine level was greater than or equal to 2.0
mg/dL; or (3) increased by at least 0.5 mg/dL, regardless of the
baseline serum creatinine level, as a consequence of exposure to
radiographic agents.
[0010] cDNA microarray techniques have allowed the identification
of neutrophil gelatinase-associated lipocalin (NGAL) as a highly
induced transcript in the kidney early after ischemic and
nephrotoxic injury. The role of NGAL in the kidney has yet to be
elucidated. NGAL is a member of the lipocalin family of proteins
and is characterized as a secreted 25 kDa glycoprotein found in
granules of human neutrophils. (Kjeldsen et al, 1993, J. Biol.
Chem. 268:10425-10432). Lipocalins, which are able to bind small
lipophilic substances, share a common three-dimensional 13-barrel
structure which functions, in at least some lipocalins, to bind
lipophilic ligands, e.g., steroid, bilin, retinoid, or other lipid.
Murine forms of NGAL (homologs) from mice and rats are known. In
mice, NGAL has been designated as NGAL, 24p3 protein, SIP24, P25,
lipocalin 2, and uterocalin. NGAL in rats is known as NGAL or alpha
2-microglobulin. A full-length cDNA encoding human NGAL protein has
been cloned and sequenced. The human NGAL gene, which includes
seven exons and six introns, has also been cloned and sequenced,
and its expression in various tissues has been analyzed. The human
NGAL gene encodes a polypeptide of 197 amino acids, with a 19- or
20-amino acid signal sequence, and a mature NGAL polypeptide
containing 178 amino acids. The motifs Gly-X-Trp (amino acids 48-50
in mature human NGAL) and Thr-Asp/Asn-Tyr (amino acids 132-134 in
mature human NGAL) are present in all known lipocalins. On the
basis of X-ray crystallography, it has been suggested that these
motifs are important in the tertiary .beta.-barrel structure shared
among the lipocalins. The cysteine residues 95 and 194 in the human
NGAL sequence are conserved, and have been reported to form an
intramolecular disulfide bridge. Human NGAL contains a single
N-glycosylation site (an asparagine residue) at position 65 of the
mature amino acid sequence (approximately position 84 or 85 of the
pre-NGAL polypeptide).
[0011] A mechanism that may underlie ATN is mis-localized iron.
Unbound iron can catalyze the conversion of H.sub.2O.sub.2 to OH
and Off (the Haber-Weiss reaction) or form reactive ferryl or
perferryl species. These ions mutagenize many types of molecules
including lipids, nucleotides and the DNA backbone. Catalytic iron,
released from free hemoglobin and myoglobin into urine or blood,
and peroxidized lipids have been documented in many forms of acute
renal failure, including chemotherapy, ischemia-reperfusion,
transplant ischemia, and in proteinuria-mediated tubular damage.
Preloading animals with iron worsens the disease, and conversely
chelating iron with deferoxamine or bacterial siderophores blunts
the damage. Iron-catalyzed damage is thought to be one of the
earliest events in kidney dysfunction and is likely to be important
in other organs, including the heart and the liver (See Mori et al:
Endocytic delivery of lipocalin-siderophore-iron complex rescues
the kidney from ischemia-reperfusion injury. J Clin Invest
115:610-621, 2005).
[0012] Cells acquire iron from carrier proteins (such as
transferrin) and by cell surface iron transporters (such as
divalent metal transporter I). Intracellular iron is controlled by
the actions of the iron responsive proteins (such as IRP1, IRP2),
the ferritin complex and heme oxygenase I. Because IRPs are
modulated by hypoxia, oxidative stress, and phosphorylation,
changes in their activity may play an important role in ischemic
disease, by regulating formation of ferritin complexes, which
protect cells from iron mediated damage. Ferritin is an
iron-phosphorous-protein complex, comprising approximately 23%
iron, formed in the intestinal mucosa. Ferritin is the storage form
of iron in tissues such as liver, spleen, and bone marrow.
Hemoglobin and myoglobin molecules in blood and muscle,
respectively, require iron-binding to catalyze transfer of oxygen
to cells. However, few other aspects of iron trafficking, storage
or metabolism are known in ischemic cells or in other types of
tissue damage, despite the primacy of catalytic iron in their
pathogenesis.
[0013] Despite the many pathways of producing ATN, a number of
investigators have discovered general underlying mechanisms of
proximal tubule cell damage. These have included the release of
cytokines One idea is that ischemic cells and tubular toxins such
as free myoglobin and hemoglobin produce high concentrations of
iron locally in the nephron. It is thought that this iron is
catalytically active, and produces oxygen radicals. Evidence that
iron catalyzed cell damage is pathogenic and leads to proximal
tubular dysfunction includes the finding that tubular damage is
blunted by infusions of iron chelators. Additional support for the
idea that iron is central to the mechanism of organ dysfunction
after ischemia comes from experiments that used iron
free-bacterially derived, iron chelators, called siderophores, to
blunt the effects of ischemia-reperfusion injury in an in vitro
model of cardiac ischemia. Each of these general mechanisms is
thought to be the principle pathogenic event during different
stages of ATN. Iron catalyzed damage is thought to be one of the
earliest events in kidney dysfunction.
[0014] It is currently unknown how the proximal tubule captures
NGAL. Indeed an unambiguous identification of receptors for most
lipocalins is still lacking. Perhaps megalin, which is necessary
for reclamation of RBP, is also the NGAL receptor (Christensen et
al., 1999, J Am Soc Nephrol. 10(4) 685-95). In fact, knockout of
megalin leads to the appearance of NGAL in the urine, but these
animals were also, unexpectedly, found to have much higher levels
of NGAL message (Hilpert et al., 2002, Kidney Int. 62(5)1672-81),
suggesting that urinary NGAL might have derived from local
synthesis rather than a failure to capture the filtered load.
Despite this ambiguity, NGAL is similar to other lipocalins, such
as RBP and .alpha.-2u globulin lipocalin (see Borghoff et al.,
1990, Annu Rev Pharmacol Toxicol. 30:349-67), which enter the cell
by a megalin pathway and traffic to lysosomes for degradation.
These data contrast with the trafficking of NGAL in cell lines that
do not express megalin (such as embryonic kidney cells) and where
the protein escapes degradation (see Yang et al., 2002, Mol. Cell
10(5):1045-56). Similarly, transferrin is also degraded after
delivery to lysosomes by a megalin-cubulin based pathway in the
proximal tubule (see Kozyraki et al., 2001, Proc. Natl Acad Sci USA
98(22)12491-6), whereas it usually recycles in cell lines. Hence it
is reasonable to propose that after filtration, NGAL is captured by
megalin and degraded by the proximal tubule and is not recycled.
This hypothesis is supported by the observation that full length
NGAL does not reappear in the blood at delayed time points
post-injection.
[0015] There remains a need for compositions and methods suitable
for preventing, reducing, or ameliorating ischemic injury, e.g.,
cold ischemic injury, in organs such as the kidney. Such
compositions would be useful both in treating a patient's original
organs, as well as organs used for transplantation. Also needed are
new biomarkers that can be used to detect toxic damage to cells,
for example nephrotoxicity, in patients following drug
administration. New and improved methods of treating and reducing
ischemic-reperfusion injury to tissues and organs caused by organ
transplantation, and of treating and reducing structural and
metabolic alterations of organ cells, are clearly useful and
important to practitioners and patients alike.
SUMMARY OF THE INVENTION
[0016] The present invention relates to neutrophil
gelatinase-associated lipocalin (NGAL) and its use in compositions
and methods for treating, reducing, ameliorating, or preventing a
condition, injury or disease, typically selected from an ischemic,
an ischemia-reperfusion, or a toxin-induced injury in an organ. The
invention also relates to a method of administering to a patient or
subject NGAL in an amount effective to treat, reduce, ameliorate or
prevent the condition, injury or disease. The injury can include a
renal injury associated with conditions, treatments, therapies, or
diseases that predispose a patient to ischemic renal injury, a
renal tubule injury, or necrosis/apoptosis. The injury can include
acute (including but not limited to shock, stroke, sepsis, trauma,
infection, inflammation) or chronic (including but not limited to
hypertension, diabetes, heart failure, lupus, infections,
inflammations) kidney conditions.
[0017] The present invention also provides a method of ameliorating
reduction in kidney NGALfunction induced by ischemia-reperfusion
injury in a patient by administering NGAL to the patient in an
amount effective to ameliorate the reduction of kidney function. In
accordance with this aspect, NGAL administration reduces high
levels of serum or plasma creatinine following ischemia-reperfusion
injury. The amount of NGAL administered is effective to prevent or
ameliorate cell death.
[0018] The invention further provides a method of enhancing renal
re-epithelialization or tubular cell proliferation following an
ischemic, ischemic-reperfusion, or toxin-induced injury, and in
acute or chronic kidney disease, by administering NGAL to a patient
in an amount effective to enhance renal re-epithelialization or
effect proliferation of tubular cells.
[0019] An embodiment of the invention includes the use of NGAL in a
method of treating, reducing, preventing or ameliorating acute
renal failure (ARF). NGAL has been demonstrated to enhance tubule
cell proliferation and reduce or ameliorate tubule cell apoptosis.
The methods disclosed can ameliorate the reduction in kidney
function in a patient that is induced by an ischemia-reperfusion or
toxin-induced injury, and can further be used for treating,
reducing, ameliorating or preventing acute renal failure secondary
to ischemic injury in the patient.
[0020] The invention further provides the use of NGAL in a method
for reducing and/or treating delayed graft function (DGF) of a
transplanted organ in a patient. In some aspects, DGF is caused by
acute tubular necrosis (ATN).
[0021] The invention also provides the use of NGAL in a method for
transplanting and grafting of an organ into a patient. The use of
the method can reduce or ameliorate organ graft or transplant loss
or acute rejection by introducing NGAL into one or more of (i) the
organ or (ii) a donor thereof, in an amount effective to reduce or
ameliorate loss or acute rejection of the organ graft or
transplant. In various aspects, the organ is selected from kidney,
liver, heart, brain, lung, stomach, intestine, colon, pancreas,
blood vessels, bladder, cervix, skin, or a portion or section
thereof. In a particular aspect, the organ resides in a cadaverous
or living organ donor. In this situation, NGAL can be administered
to the patient before, during and/or after the organ is
transplanted or grafted into the patient. The organ can be a
cadaverous organ, and in those instances in which the organ is
obtained from a cadaverous donor, NGAL can be administered to
either the cadaver or the extracted organ to prevent injury,
insult, or failure of the organ following transplantation. The
organ can be a living organ donation, and in those instances NGAL
can be administered to the extracted organ to prevent injury,
insult, or failure of the organ following transplantation. The
organ can be a kidney, liver, heart, brain, lung, stomach,
pancreas, blood vessels, bladder, cervix, skin, or a portion or
section thereof. In a particular aspect of the present invention,
the organ is a kidney.
[0022] The present invention also provides the use of NGAL in
association with cadaveric and living donor renal transplantation,
where oxidant-mediated apoptosis is an important contributor to
tubule cell death. In addition to the usual complications of acute
renal failure (ARF), ischemia-reperfusion injury in the
transplanted kidney is known to result in delayed graft function
(DGF), which significantly increases the risk of graft loss and
acute rejection. As described herein, NGAL is employed in methods
for reducing or ameliorating the adverse ischemic effects
associated with organ transplantation. In one embodiment, NGAL can
be added to an organ preservation solution, such as is used during
cold storage of transplant organs, to ameliorate the DGF that is
characteristic of cadaveric kidney transplantation. In accordance
with this method, NGAL is at least partially effective even when
administered after the ischemic insult. Advantageously, the method
affords needed and novel therapeutic treatments of established
ischemic conditions, such as ARF, which is an existing,
clinically-relevant, adverse event that is commonly associated with
a dismal prognosis for the patient. The method of retarding or
ameliorating DGF associated with ischemic injury in an organ or
graft transplant in a patient includes introducing an amount of
NGAL into, or contacting NGAL with, (i) a transplanted organ or
graft; (ii) a donor of a transplanted organ; or (iii) both (i) and
(ii), in an amount effective to retard or ameliorate DGF, or the
loss or acute rejection of the transplanted or grafted organ.
Illustratively, and without limitation, the organ or graft for
transplant is selected from kidney, liver, heart, brain, lung,
stomach, intestine, colon, pancreas, blood vessels, bladder,
cervix, skin, or a portion or section thereof. In a particular
aspect, the organ is a kidney. More particularly, the kidney
transplanted is a cadaveric or living donor kidney. Further, NGAL
is a component of the organ preservation solution, e.g., an
NGAL-containing organ preservation solution is used during cold
storage of the organ transplant.
[0023] The present invention further provides a method of reducing,
ameliorating, preventing or protecting a patient from renal injury
that is associated with conditions, treatments, therapies, or
diseases that can predispose a patient to ischemic renal injury.
The method comprises administering to the patient an amount of NGAL
effective to reduce, ameliorate, prevent or protect the patient
from renal injury associated with the patient's condition,
treatment, therapy, or disease. Illustrative conditions,
treatments, or therapies include without limitation, contrast agent
treatment, antibody treatment, antibiotic treatment, organ
transplant, kidney transplant, cadaveric kidney transplant, cardiac
treatment, cardiac treatment after surgery, or central nervous
system treatment. Illustrative diseases according to this aspect
include, without limitation, infection, bacterial infection, acute
kidney disease, chronic kidney disease, ischemic-reperfusion
injury, shock, trauma, sepsis, stroke, cardiac reperfusion injury,
cardiopulmonary bypass, open heart surgery, and abdominal
surgery.
[0024] The invention also provides a method of treating, reducing
or ameliorating renal tubule injury or necrosis/apoptosis in a
patient, which comprises administering a therapeutically effective
amount of NGAL to the patient. According to this aspect, the
patient can be affected with acute kidney disease, chronic kidney
disease, ischemic-reperfusion injury, organ transplant,
toxin-induced injury, ischemia, kidney transplant, shock, trauma,
sepsis, stroke, cardiac reperfusion injury, renal tubule injury
following cardiopulmonary bypass, renal tubule injury following
open heart surgery, renal tubule injury following abdominal
surgery, infection, antibiotic treatment, antibody treatment, or
contrast agent treatment, for example. In the method, NGAL can
function to enhance proliferation of renal tubule cells, since NGAL
also directly targets renal proximal tubule cells, resulting in
reduction or amelioration of renal tubule injury or
necrosis/apoptosis.
[0025] The present invention also provides a method of treating,
reducing, or ameliorating a toxin-induced injury, including a
nephrotoxic injury, to an organ in a patient by administering NGAL
to the patient in an amount effective to treat, reduce or
ameliorate the toxin-induced injury to the organ. In another
aspect, the method of reducing or ameliorating a toxin-induced
injury includes co-administering both NGAL and a therapeutic
compound that is toxic to the patient, the NGAL being administered
in an amount effective to reduce or ameliorate the toxic effect of
the therapeutic on the organ.
[0026] The present invention also provides a method of treating,
reducing, or ameliorating other acute (including but not limited to
shock, stroke, sepsis, trauma, infection, inflammation) and chronic
(including but not limited to hypertension, diabetes, heart
failure, lupus, infections, inflammations) kidney injuries.
[0027] In the various methods of the present invention disclosed
herein, NGAL can be administered in conjunction with one or more
therapeutic agents, such as, for example, vasodilators or oxygen
supplying agents. In addition, NGAL can be administered in a
physiologically acceptable composition comprising a carrier,
diluent, or excipient by various routes of administration,
including, without limitation, intravenous or parenteral routes.
Further, NGAL can be administered prior to, during, or following
ischemia or nephrotoxicity, organ transplant or grafting, or renal
tubule insult, damage, or injury, as described herein.
[0028] The present invention also provides a method of evaluating a
therapeutic for its potential to induce nephrotoxicity by (a)
administering a test substance to cause a nephrotoxic injury a
mammalian model, such as a mouse; and (b) determining the presence
of neutrophil gelatinase-associated lipocalin (NGAL) in a urine or
plasma sample of the mammalian model following the administration
of the test substance, as an indication that the substance can
induce kidney damage. In a particular aspect of this method, NGAL
is detected in the urine or plasma within about three hours
following administration of the test substance.
[0029] The present invention also relates to a composition for use
in the treating, reducing, ameliorating, or preventing an injury to
an organ in a mammal, comprising a therapeutically-effective amount
of NGAL, or a derivative or analog thereof. The composition can
further a siderophore, typically in a 1:1 molar ratio, including a
complex of the NGAL with the siderophore. The composition can be
used in any of the methods disclosed herein.
[0030] The present invention also relates to the use of
siderophores in association with NGAL in a composition and a method
for treating, reducing, ameliorating, or preventing an ischemic or
toxin-induced condition and disease, including an ischemic, an
ischemia-reperfusion, or a toxin-induced injury in an organ.
[0031] In one embodiment of the invention, NGAL and a siderophore
are administered as a pharmaceutical composition in an amount
effective to enhance the treatment, reduction, amelioration or
prevention of an ischemic, an ischemia-reperfusion, or a
toxin-induced injury in an organ.
[0032] The present invention also relates to a pharmaceutical
composition that comprises a siderophore, for use in administration
to patients to enhance treatment prevention, amelioration, and
reduction of injury in an organ by endogenous NGAL. In another
embodiment, a method is provided for co-administering, typically as
a complexed compound, of NGAL and a siderophore. In another
embodiment, a siderophore is administered to a patient in an amount
effective to enhance the renal re-epithelialization or positively
affect the proliferation of tubular cells initiated by endogenous
NGAL secretion.
[0033] In particular, the invention provides a method of enhancing
the reduction or amelioration of delayed graft function (DGF) and
organ or graft transplant rejection in a patient by endogenous
NGAL, comprising the step of introducing a siderophore into (i) a
transplanted organ or graft; (ii) a donor of a transplanted organ;
or (iii) both (i) and (ii), in an amount effective to enhance the
reduction or amelioration of DGF, or the loss or acute rejection of
the transplanted or grafted organ. The method includes
administering a siderophore in an amount effective to treat,
reduce, ameliorate or prevent the injury to the organ.
[0034] In an embodiment of the invention, NGAL:siderophore
complexes can be added to an organ preservation solution, such as
is used during cold storage of transplant organs, to ameliorate the
DGF that is characteristic of cadaveric kidney transplantation. In
yet another embodiment, siderophores alone in a buffer solution can
be added to an organ preservation solution, such as is used during
cold storage of transplant organs, to ameliorate the DGF that is
characteristic of cadaveric kidney transplantation.
[0035] The invention further provides a method for manipulating
cellular and extracellular iron in an ischemic or toxin-damaged
organ by administering NGAL, or a derivative or analog thereof.
This method can also include administering an iron-binding
chemical, a co-factor for an iron-binding chemical, or a
siderophore in an amount effective to treat, reduce, ameliorate or
further prevent organ damage by ischemia or toxins. Typically the
ischemic or toxin-damaged organ is a kidney.
[0036] In another embodiment, the present invention provides a
therapeutic kit comprising a first container for containing a
therapeutically-effective amount of NGAL. The first container can
include at least one vial, at least one test tube, at least one
flask, and at least one bottle. The kit can also include a second
container into which at least one composition can be placed, and a
means for securing the containers together for commercial sale. The
kit can also include a third container for containing a sterile,
pharmaceutically acceptable buffer or other diluent. The first
container can be a syringe. The means for securing the containers
can be an injection or blow-molded plastic container into which the
containers are retained. Alternatively, the vials can be prepared
in such a way as to permit direct introduction of the composition
into an intravenous drug delivery system. Instructions for use are
also typically included.
[0037] Further aspects, features and advantages of the present
invention will be better appreciated upon a reading of the detailed
description of the invention when considered in connection with the
accompanying drawings.
BRIEF DESCRIPTION OF THE FIGURES
[0038] FIG. 1 shows Coomassie Blue (CB) and enhanced
chemiluminescence (ECL, with polyclonal NGAL antibody) analysis of
defined quantities (as shown) of recombinant purified NGAL.
[0039] FIG. 2 shows immunofluroescent staining of kidneys from
control non-ischemic animals one hour after injection, or ischemic
kidneys one or three hours after either injection, using polyclonal
NGAL antibody.
[0040] FIG. 3 shows Western blot for NGAL detection in urine
samples from non-ischemic (NI) and ischemic (I) animals within 1
hour of administration of NGAL.
[0041] FIG. 4 shows sections stained with hematoxylineosin of
kidneys from control non-ischemic mice, saline pre-treated ischemic
mice, or ischemic mice treated with NGAL one hour before, during,
or one hour after ischemia.
[0042] FIGS. 5A, 5B and 5C show scoring of histological sections of
kidneys from ischemic mice that were saline pre-treated or treated
with NGAL one hour before, during, or one hour after ischemia. The
sections were analyzed and scored for tubule dilatation (FIG. 5A),
tubule casts (FIG. 5B), and tubule cell necrosis (FIG. 5C) using an
arbitrary scale of 0 to 4.
[0043] FIG. 6 shows serum creatinine measured in non-ischemic (Non
Isch) control mice, or 24 hours following ischemia in mice
pre-treated with saline (Pre Sal) or treated with NGAL one hour
before (Pre NGAL), during (Dur NGAL) or one hour after (PostNGAL)
ischemic injury.
[0044] FIG. 7 shows results of TUNEL staining of representative
sections from non-ischemic control mice, or 24 hours following
ischemia in mice pre-treated with saline or treated with NGAL one
hour before, during, or one hour after ischemic injury. Arrows
point to the condensed, fragmented, intensely staining nuclei
characteristic of apoptosis in low and high power magnifications,
compared to staining with proliferating cell nuclear antigen
(PCNA).
[0045] FIG. 8 shows quantitation of apoptosis (upper panel) and
proliferation (center panel) in kidneys from non-ischemic control
mice, or 24 hours following ischemia in mice pre-treated with
saline or treated with NGAL one hour before, during, or one hour
after ischemic injury.
[0046] FIG. 9 shows a ratio of proliferation:apoptosis calculated
in kidneys from non-ischemic control mice, or 24 hours following
ischemia in mice pretreated with saline or treated with NGAL one
hour before, during, or one hour after ischemic injury.
[0047] FIG. 10 shows binding of .sup.55Fe detected in urine alone,
a urine and NGAL mixture (urine+Ngal), a urine and NGAL:siderophore
mixture (urine+Ngal:Si), plasma alone, buffer alone, buffer and
NGAL mixture (buffer+Ngal), a buffer and NGAL:siderophore mixture
(buffer+Ngal:Sid(1)), a second buffer and NGAL:siderophore mixture
(buffer+Ngal:Sid(2)), and a third buffer and NGAL:siderophore
mixture in which the siderophore was saturated with iron
(buffer+Ngal: Sid:Fe).
[0048] FIG. 11A shows immunoblots of NGAL protein in human urine
samples from healthy subjects (Normal), or subjects with Acute
Tubular Necrosis (ATN) or chronic renal failure (CRF), or from
subjects with liver cirrhosis, hemochromatosis, or pancreatic
carcinoma but lacking a renal diagnosis (Others). Monoclonal
anti-human NGAL (Mo) and polyclonal anti-mouse NGAL (Po) antibodies
recognizes recombinant and native human NGAL and NGAL
Standards.
[0049] FIG. 11B shows immunoblots of NGAL protein in human serum
samples from healthy subjects (Normal), or subjects with Acute
Tubular Necrosis (ATN) or chronic renal failure (CRF), or from
subjects with liver cirrhosis, hemochromatosis, or pancreatic
carcinoma but lacking a renal diagnosis (Others), compared to NGAL
Standards.
[0050] FIG. 11C shows a quantitative comparison of NGAL protein
levels in urine from healthy subjects (Normal), or subjects with
Acute Tubular Necrosis (ATN) or chronic renal failure (CRF). ATN is
further subdivided into non-sepsis and sepsis groups.
[0051] FIG. 11D shows a quantitative comparison of NGAL protein
levels in serum from healthy subjects (Normal), or subjects with
Acute Tubular Necrosis (ATN) or chronic renal failure (CRF). ATN is
further subdivided into non-sepsis and sepsis groups.
[0052] FIG. 11E shows an immunoblot of NGAL in urine from
ATN-injured and Sham-treated control mice, along with standards of
50, 5, and 1 ng NGAL protein.
[0053] FIG. 12A shows immunohistochemical staining for NGAL in a
healthy human kidney (Normal).
[0054] FIG. 12B shows immunohistochemical staining for NGAL in a
healthy human kidney.
[0055] FIG. 12C shows immunohistochemical staining for NGAL in a
healthy human kidney.
[0056] FIG. 12D shows increased immunohistochemical staining for
NGAL in a human kidney with ischemic ATN caused by sepsis (Ischemic
ATN).
[0057] FIG. 12E shows increased immunohistochemical staining for
NGAL in a human kidney with ischemic ATN caused by hypovolemia due
to vomiting and diarrhea.
[0058] FIG. 12F shows increased immunohistochemical staining for
NGAL in a human kidney with ischemic ATN caused by heart
failure.
[0059] FIG. 12G shows increased immunohistochemical staining for
NGAL in a human kidney with toxic ATN caused by nephrotoxicity due
to bisphosphonate (Toxic ATN).
[0060] FIG. 12H shows increased immunohistochemical staining for
NGAL in a human kidney with toxic ATN caused by nephrotoxicity due
to cephalosporin toxicity.
[0061] FIG. 12I shows increased immunohistochemical staining for
NGAL in a human kidney with toxic ATN caused by nephrotoxicity due
to hemoglobinuria.
[0062] FIG. 12J shows immunohistochemical staining for NGAL in a
human kidney with glomerular disease, with NGAL weakly expressed in
cresents.
[0063] FIG. 12K shows immunohistochemical staining for NGAL in a
human kidney with glomerular disease, with NGAL weakly expressed in
the proximal tubules of nephrotics.
[0064] FIG. 13A shows histological sections of sham-treated
(Control), ischemic (ATN), and NGAL-treated ATN-injured (ATN+Ngal)
kidneys. Loss of tubular nuclei is observed in ATN but not control
or ATN+Ngal sections (upper panels), as well as cortical (center
panels) and medullary (lower panels) intratubular casts. NGAL
pretreatment resulted in preservation of cortical tubules, but
residual cortical-medullary casts.
[0065] FIG. 13B shows histological sections of ischemic (ATN), and
NGAL-treated ATN-injured (ATN+Ngal) kidneys, with PAS staining
highlighting the luminal casts and the rescue of cortical tubules
by pre-treatment with NGAL.
[0066] FIG. 13C shows Jablonski scoring of sham-treated (Sham),
ischemic (ATN), and NGAL-treated ATN-injured (ATN+Ngal) kidneys to
demonstrate rescue of the ischemic cortex by NGAL.
[0067] FIG. 14A shows N-cadherin staining in kidney sections is
nearly abolished by ischemia reperfusion (ATN), but is rescued when
NGAL is administered (ATN+Ngal).
[0068] FIG. 14B shows full length N-cadherin protein levels are
rescued by NGAL treatment (ATN+Ngal), compared to ischemic (ATN),
as indicated by the N-cadherin fragments (arrow) in
ischemia-reperfusion and sham-treated animals, but their
suppression in NGAL-treated animals. GAPDH is the loading
control.
[0069] FIG. 14C shows tubules with TUNEL-positive apoptotic cells
(fluorescence) in ischemic-reperfused mice (I/R) reduced by
pretreatment with NGAL (I/R+Ngal). Toprol is the nuclear
counterstain.
[0070] FIG. 14D shows a quantitative analysis of the percentage of
tubules containing an apoptotic nucleus in sham-treated controls
(sham), ischemic-reperfused (I/R), and ischemic-reperfused mice
treated with NGAL (+Ngal).
[0071] FIG. 14E shows an immunoblot of heme oxygenase-1 (HO-1)
expression in sham-treated (Sham), ischemic-reperfused (ATN), or
ischemic-reperfused NGAL-treated kidneys (ATN+Ngal). Recombinant
HO-1 (HO-1) and rat cortex are included for comparison. GAPDH is
the loading control.
[0072] FIG. 15 shows an immunoblot of clearance of NGAL protein in
blood and urine of mice following intraperitoneal injection of 100
.mu.g NGAL.
[0073] FIG. 16A shows fluorescent-labeled (Alexa568) NGAL localized
to large vesicles in the proximal tubule (bottom panel) but not in
the glomerulus or medulla (small top panels). Uncoupled fluorescent
dye did not label the kidney.
[0074] FIG. 16B shows Alexa568-NGAL co-localized with FITC-dextran
in S1 and S2 segments of the proximal tubule.
[0075] FIG. 16C shows SDS-PAGE separation of .sup.125I-NGAL, with
full length and a 14 kDa fragment of NGAL found in the kidney 1 and
5 hours after injection.
[0076] FIG. 16D shows radioautograph of kidney one hour after
intraperitoneal injection of .sup.55Fe loaded siderophore-NGAL.
Radioactive decay is found in the cortex and is associated with the
apical zones of proximal tubule cells
[0077] FIG. 16E show radioautograph of kidney one hour after
intraperitoneal injection of .sup.55Fe loaded siderophore-NGAL,
with no radioactivity was found in the medulla.
[0078] FIG. 17A shows plasma creatinine in mice subjected to 30
minutes of ischemia. The first panel shows that holo-NGAL
(.gtoreq.1 .mu.g) from XL-1 bacteria (containing siderophore)
rescues renal function when introduced 15 minutes prior to ischemia
or within one hour after ischemia. However, NGAL is ineffective
when administered later. The second panel shows that apo-NGAL from
BL-21 bacteria (siderophore free) is minimally active, but when
loaded with enterochelin, the protein is protective. Both iron-free
(apo-NGAL:Sid) and iron-loaded siderophores (apo-NGAL:Sid:Fe) have
protective effect. In comparison, the gallium-loaded complex
(apo-NGAL:Sid:Ga) was ineffective as was a single dose of DFO or
the free siderophore (Sid). Retinol Binding Protein (RBP), a
lipocalin that is also filtered and reabsorbed by the proximal
tubule was ineffective
[0079] FIG. 17B shows immunoprecipitate preparations of NGAL.
NGAL:Sid contains enterochelin, but not iron. NGAL:Sid:Fe contains
siderophore and iron.
[0080] FIG. 18A shows that an iron-binding cofactor is present in
urine. Buffer is mixed with .sup.55Fe (no protein), with apo-NGAL,
apo-NGAL+siderophore, or apo-NGAL+siderophore+unlabeled iron. After
a series of washes, .sup.55Fe is retained by apo-NGAL+siderophore
but not by apo-NGAL or apo-NGAL ligated by the iron-saturated
siderophore, demonstrating that an unsaturated siderophore is
required for retention of .sup.55Fe by NGAL.
[0081] FIG. 18B shows that when urine (<3,000Da) is mixed with
.sup.55Fe or with apo-NGAL, as indicated, and then washed three
times on a 10 KDa filter, apo-NGAL+urine retains .sup.55Fe.
.sup.55Fe retention was blocked by the addition of excess
iron-citrate (Fe). Activity was also blocked by iron saturated
enterochelin (Sid:Fe).
[0082] FIG. 19 shows kidney biopsies obtained within 1 hour of
transplantation from living related (panels 0 and 1) or cadaveric
(panels 2 and 3) kidney transplants. Sections were stained with
NGAL antibody. NGAL expression was significantly increased in the
cadaveric group, which underwent a longer ischemic period.
[0083] FIG. 20 shows Western blots of urine samples obtained within
2 hours of transplantation from living related (LRD, n=4) or
cadaveric (CAD, n=4) kidney transplants, probed with NGAL antibody.
NGAL expression in the urine was absent before the operation. NGAL
expression was significantly increased in the CAD group compared to
the LRD group
[0084] FIG. 21 shows quantitation of urinary NGAL by Western blots
in LRD versus CAD, showing a significantly increased expression in
CAD.
[0085] FIG. 22 shows the correlation of urinary NGAL obtained 2
hours after CAD transplantation with cold ischemia time. The degree
of urinary NGAL expression correlates with ischemia time.
[0086] FIG. 23 shows the correlation of urinary NGAL obtained 2
hours after CAD transplantation with peak serum creatinine measured
2-4 days after the operation. The degree of urinary NGAL expression
correlates with peak serum creatinine
[0087] FIG. 24 shows standard curves for NGAL ELISA with the linear
relationships obtained from 10 independent standard curves.
[0088] FIG. 25 shows serial serum NGAL measurements in patients who
developed ARF following cardiopulmonary bypass during surgery (CPB)
(n=10).
[0089] FIG. 26 shows means.+-.SD for serial serum NGAL levels in
CBP patients who developed ARF (squares) (n=10) versus those who
had an uneventful postoperative course (diamonds) (n=30).
[0090] FIG. 27 shows serial urine NGAL measurements in CBP patients
who developed ARF following CPB (n=11).
[0091] FIG. 28 shows means.+-.SD for serial urine NGAL levels in
CBP patients who developed ARF (diamonds) (n=11) versus those who
had an uneventful postoperative course (squares) (n=30).
[0092] FIG. 29 shows the correlation between urine NGAL levels 2
hours after CPB versus CPB time.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0093] The accompanying sequence listings, which are incorporated
in and constitute a part of this specification, serve to explain
the principles of the invention.
[0094] SEQ:ID 01 is an example of a Primer sequence (forward
primer, positions 93-112) for mouse NGAL mRNA (Genbank
NM.sub.--008491).
[0095] SEQ:ID 02 is an example of a Primer sequence (reverse,
positions 576-557) for mouse NGAL mRNA (Genbank
NM.sub.--008491).
[0096] SEQ:ID 03 is an example of Sequences (forward, positions
415-434) for mouse .beta.-actin mRNA (Genbank X03672).
[0097] SEQ:ID 04 is an example of Sequences (reverse, positions
696-677) for mouse .beta.-actin mRNA (Genbank X03672).
DETAILED DESCRIPTION OF THE INVENTION
Definitions:
[0098] As used herein, the term "organ" means a differentiated
biological structure comprised of cells and tissues that perform a
certain function or functions in an organism, such as a mammal,
including humans. Representative organs include, but are not
limited to, the kidney, liver, heart, bone, cartilage, skin, lung,
blood vessels, bladder, certix, stomach, intestine, pancreas, small
intestine, colon, pancreas and brain, and portions or sections
thereof.
[0099] As used herein, the term "renal injury" or "renal disease"
shall include acute (including but not limited to ischemia,
ischemia-reperfusion, nephrotoxic, shock, stroke, sepsis, trauma,
infection, inflammation) or chronic (including but not limited to
hypertension, diabetes, heart failure, lupus, infections,
inflammations) kidney injuries or conditions.
[0100] The phrases "pharmaceutically acceptable,"
"pharmacologically acceptable," and "physiologically acceptable"
refer to molecular entities and compositions that do not produce an
adverse, allergic or other untoward reaction when administered to
an animal, such as, for example, a human.
[0101] The phrase "pharmaceutically acceptable carrier" as used
herein means a material, composition or vehicle, such as a liquid
or solid filler, diluent, excipient, solvent or encapsulating
material, involved in carrying or transporting the compounds of the
invention from one organ, or portion of the body, to another organ,
or portion of the body without affecting its biological effect.
Each carrier should be "acceptable" in the sense of being
compatible with other ingredients of the composition and not
injurious to the subject. Some examples of materials which can
serve as pharmaceutically-acceptable carriers include, but are not
limited to: any and all solvents, dispersion media, coatings,
surfactants, antioxidants, preservatives (e.g., antibacterial
agents, antifungal agents), isotonic agents, absorption delaying
agents, salts, preservatives, drugs, drug stabilizers, gels,
binders, excipients, disintegration agents, lubricants, sweetening
agents, flavoring agents, dyes, such like materials and
combinations thereof, as would be known to one of ordinary skill in
the art. Except insofar as any conventional carrier is incompatible
with the NGAL, sideophore, or complex thereof, or other optional
active agent or ingredient, its use in the therapeutic or
pharmaceutical compositions is contemplated.
[0102] The phrase "therapeutically effective amounts" refers to
those amounts of NGAL, siderophore, and mixtures thereof, or of
other optional active agents or ingredients, that is effective to
produce beneficial results, particularly with respect to the
treatments described herein, in the recipient, such as an animal or
patient. Such amounts can be initially determined by reviewing the
published literature, by conducting in vitro tests or by conducting
metabolic studies in healthy experimental animals. Before use in a
clinical setting, it can be beneficial to conduct confirmatory
studies in an animal model, typically a widely accepted animal
model of the particular disease to be treated. Typical animal
models for use in certain embodiments are rodent and murine models,
which are economical to use and, particularly, because the results
gained are widely accepted as predictive of clinical value.
[0103] The term "derivative(s)", in reference to NGAL, refers to
chemically modified NGAL compounds, substances, inhibitors, or
stimulators that still retain the desired effects on property(ies)
of ischemia, renal tubule necrosis, nephrotoxicity,
ischemic-reperfusion injury, and the like. Such derivatives can
include the addition, removal, or substitution of one or more
chemical moieties on the parent molecule. Such moieties can
include, but are not limited to, an element such as hydrogen, a
halide, or a molecular group such as a methyl group. Such a
derivative can be prepared by any method known to those of skill in
the art. The properties of such derivatives can be assayed for
their desired properties by any means described or known to those
of skill in the art.
[0104] The term "analog" includes a structural equivalent or
mimetic, as understood by those of skill in the art.
[0105] A "patient", "recipient", or "subject" means an animal or
organism, such as a warm-blooded animal or organism. Illustrative
animals include, without limitation, mammals, for example, humans,
non-human primates, pigs, cats, dogs, rodents, horses, cattle,
sheep, goats and cows. The invention is particularly suitable for
human patients and subjects.
[0106] An "inhibitor" means a compound, substance or agent that
produces any measurable decrease in the activity, function,
production, or secretion of a protein or biological compound, or in
the translation of mRNA, in or from a cell.
[0107] As used herein in connection with transplanted and grafted
organs, a "reduction" of ischemic injury or ischemic-reperfusion
injury refers to any measurable decrease, diminution or reversal of
damage to organs that (i) are stored, e.g., in preservation
solution or in a cadaver, or (ii) are transplanted or grafted into
a patient. Similarly, "reducing" refers to any measurable decrease
or diminution, or a complete inhibition of damage, injury, or
insult to organs that are stored, transplanted, or grafted into a
patient.
[0108] The words "a" and "an" as used herein refers to "one or
more". More specifically, the use of "comprising," "having," or
other open language in claims that claim a combination or method
employing an object, denotes that "one or more of the object" can
be employed in the claimed method or combination.
[0109] The present invention provides neutrophil
gelatinase-associated lipocalin, or NGAL, for use in methods of
treating, reducing, or ameliorating ischemic injury,
ischemic-reperfusion injury, and a toxin-induced injury, to an
organ such as the kidney. The present invention also provides the
use of NGAL in methods of treating, reducing, or ameliorating acute
kidney injuries (including but not limited to shock, trauma,
stroke, sepsis, infection, inflammation, stones, and surgeries) and
chronic kidney injuries (including but not limited to hypertension,
diabetes, heart failure, lupus, inflammation, glomerulonephritis
and interstitial nephritis). In accordance with the invention, yet
without wishing to be bound by theory, NGAL administration has been
found to affect tubule cell death so as to limit apoptotic tubule
cell death, i.e., apoptosis, and to enhance re-epithelialization,
i.e., the recovery of viable cells following ischemia in the kidney
involving de-differentiation and proliferation of viable cells and
re-establishment of the epithelial phenotype following
ischemia-reperfusion injury. NGAL administration has also been
shown to reduce increases in serum and plasma creatinine levels
after ischemic injury.
[0110] Human NGAL, a 25 kDa protein that is covalently bound to
gelatinase from human neutrophils, is expressed at very low levels
in several human tissues, including kidney, trachea, lungs,
stomach, and colon. NGAL expression is markedly induced in and
secreted by stimulated epithelia. For example, NGAL concentrations
are elevated in the serum of patients with acute bacterial
infections, the sputum of subjects with asthma or chronic
obstructive pulmonary disease, and the bronchial fluid from the
emphysematous lung. NGAL is also one of the maximally-induced genes
in the kidney following early ischemic injury. These data are
derived from analyses of mRNA by gene chip, implicating that the
damaged kidney synthesizes NGAL. Other studies have shown that NGAL
can be found at elevated levels in the serum of human patients with
inflammatory diseases. Hence we have evaluated the incidence of
expression of NGAL in human ATN compared to chronic forms of renal
disease. NGAL is highly expressed in clinically defined ATN and
appears in the proximal tubule in biopsied human kidney. Although
less abundant, NGAL is also expressed in the kidney in several
forms of chronic kidney disease. A mouse model of
ischemia/reperfusion induced ATN also expresses NGAL at very high
levels. Microgram quantities of injected NGAL provided dramatic
protection against ATN as measured by plasma creatinine and by the
histology of the kidney. The protection of the kidney was due to
the delivery to the proximal tubule of NGAL protein containing the
bacterial siderophore.
[0111] The preparation of a pharmaceutical composition or
formulation comprising NGAL is known to those of skill in the art
in light of the present invention, as exemplified by Remington's
Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990.
Moreover, for animal (e.g., human) administration, it will be
understood that preparations should meet sterility, pyrogenicity,
general safety and purity standards as required by the FDA Office
of Biological Standards.
[0112] Previously, the role of NGAL was unclear; however, NGAL has
now been identified as an iron-transporting protein during
nephrogenesis. Despite its high affinity for siderophores and for
iron, NGAL can deliver iron to the cytoplasm. The likely mechanism
for iron delivery from NGAL is by endocytosis. Fluorescent NGAL
protein is endocytosed, and this trafficking is blocked by
4.degree. C. temperatures. Acidification of these vesicles can be
necessary for iron release from NGAL because agents that inhibit
acidification blocked iron uptake. Moreover, addition of NGAL to
cells expressing a fluorescent iron reporter in the cell cytoplasm
stimulated iron-activated changes in reporter expression,
confirming that NGAL can serve as an iron donor. Notably, the
pathway for NGAL endocytosis differed from the pathway taken by
holo-transferrin in cells in culture. At steady state,
holotransferrin trafficked to rab-5 or rab-7 recycling vesicles
(rab5 and rab7 are markers for early and late endosomes,
respectively), while NGAL trafficked to late endosomes and in a
small percentage to lysosmes. These data demonstrate that NGAL can
serve in an iron delivery pathway when it contains a
siderophore.
[0113] The actions of NGAL in vivo might differ from its
pharmacological effects because the critical siderophore in vitro
is a bacterial product. A number of analyses have indicated the
possibility of endogenous low molecular weight co-factors for iron
transport. These include citrate and related compounds, but also
iron transport activities in the molecular weight range of 1000 Da.
To determine whether such a co-factor might also be present in the
kidney, we mixed apo-NGAL from BL21 bacteria with urine samples.
While the urine itself failed to trap .sup.55Fe, and apo-NGAL
diluted in salt solutions failed to trap .sup.55Fe, dilution of
NGAL in urine permitted retention of .sup.55Fe. This finding
suggests that a cofactor is present in urine that permits NGAL-iron
interactions.
[0114] In embodiments of the present invention, the exogenous
administration of NGAL can ameliorate the structural damage
inflicted by ischemia-reperfusion injury. Both apoptosis and
necrosis can be significantly blunted. Without wishing to be bound
by theory, the mechanism by which NGAL inhibits apoptosis in the
ischemic condition includes an anti-apoptotic effect analogous to
that of heme oxygenase 1 (HO-1), which facilitates the
extracellular transport of iron, thereby limiting iron-driven
oxidant stress in the intracellular compartment (C. D. Ferris et
al., 1999, Nat. Cell Biol., 3:152-157). As a carrier of any of
various siderophores, NGAL also facilitates the removal of excess
intracellular iron, thereby limiting oxidant-mediated apoptosis of
renal tubule cell death following ischemia-reperfusion injury. With
respect to necrosis, the response of the kidney following
ischemia-reperfusion injury can occur by a two-stage process,
namely initiation of apoptosis followed by a necrotic cell death.
In addition to limiting iron-mediated oxidative-stress, apoptosis
inhibition by NGAL can be effective in preventing the secondary
necrosis aspect of the process. By the process of apoptosis
inhibition, NGAL can be effective in a variety of kidney diseases
that are well known to be associated with increased apoptosis,
including but not limited to ischemia, ischemia-reperfusion,
nephrotoxins, polycystic kidney disease, obstruction, inflammation,
and glomerular diseases.
[0115] NGAL protein is composed of eight .beta. strands which form
a .beta.-barrel or a calyx. The calyx binds and transports low
molecular weight chemicals, including siderophores found in urine
and/or produced by bacteria. The best evidence for NGAL's
ligand-binding properties comes from crystallographic studies,
which demonstrated a bacterial siderophore (enterochelin) in the
.beta.-barrel. NGAL binds the siderophore with high affinity (0.4
nM) and the siderophore traps iron with high affinity
(10.sup.-49M). The stoichiometry of protein:siderophore:iron is
1:1:1, as demonstrated by binding studies and x-ray
crystallography. When the siderophore was loaded with iron, the
NGAL complex donated iron to embryonic mesenchyme in vitro and to
cell lines, and when the siderophore was iron-free, the NGAL
complex chelated iron. NGAL was endocytosed by many cell types, and
trafficked to a late endosomal compartment that differed from the
transferrin compartment. Donation of iron took place in an
endosomal compartment. Because NGAL is the first mammalian protein
found to bind bacterial siderophores, it can also been called
siderocalin.
[0116] Siderophores are small protein molecules that scavenge iron
from the environment, having a low molecular weight ranging from
about 500 to about 1000 MW. Siderophores can chelate ferric iron.
Iron-catalyzed damage is thought to be one of the earliest events
in kidney dysfunction following an ischemic, ischemic-reperfusion,
or toxin-induced injury, and is likely to be important in the early
stages of damage to other organs, including the heart and the
liver. Chelating iron with siderophores can blunt the damage to
these organs.
[0117] Siderophores can be synthetic or naturally-occurring
products harvested from bacterial cultures, and are commercially
available. Siderophores are avidly taken up by NGAL when mixed
together under physiological conditions in a wide variety of
commonly used buffers including 10 mM Tris or Phosphate-buffered
Saline. Typically, siderophores can be added in excess to a known
quantity of NGAL protein. NGAL molecules will bind to siderophore
molecules such that each complex will contain one molecule of each
species. The 1:1 complexes of NGAL:siderophore are washed to remove
the excess unbound siderophore molecules, and can then be further
processed for use in the practice of the invention. Alternatively,
equimolar amounts of siderophore and NGAL molecules can be combined
and incubated to allow binding. Exogenous siderophores contemplated
for use in the invention include, but are not limited to
enterochelin, carboxymycobactin, aminochelin, desferrioxamine,
aerobactin, arthrobactin, schizokinen, foroxymithine,
pseudobactins, neoenactin, photobactin, ferrichrome, hemin,
achromobactin, achromobactin, rhizobactin, and other bacterial
products, as well as citrate and synthetic analogs and moieties and
others that can be produced using organic chemistry processes.
Endogenous siderophores can also be complexed to NGAL in vivo, as
will be described in examples of the methods for use.
[0118] The methods of the present invention provide certain
advantages for the patient. Acute renal failure secondary to
ischemic injury remains a common problem, with limited and
unsatisfactory therapeutic options. The identification of factors
that inhibit, reduce, or oppose tubule cell death
(necrosis/apoptosis) and/or enhance the recovery phase (involving
de-differentiation and proliferation of viable renal tubule cells
and re-establishment of the epithelial phenotype) can serve as
novel therapeutic options. In accordance with this invention, NGAL,
both alone and together with siderophores, advantageously exhibits
the above-mentioned desirable and cytoprotective properties.
Exogenously administered NGAL has been demonstrated to limit the
morphologic and functional consequences of ischemia-reperfusion
injury in a mouse model, by a combination of limiting apoptotic
tubule cell death and enhancing re-epithelialization.
[0119] In an embodiment of the invention for treating, reducing, or
ameliorating a toxin-induced injury, the toxin and/or the
therapeutic that is toxic, can include an antibiotic, an
anti-inflammatory agent, an antifungal agents, a radio-contrast
agent, a pharmaceutical, a chemotherapeutic agent, a test drug, a
medicament substance, or naturally-occuring, commercial and
industrial chemicals and minerals. Specific toxins and nephrotoxins
include, but not limited to, a cancer chemotherapeutic such as
cisplatin, mitomycin, cyclophosphamide, isosfamide, and
methotrexate, an antibiotic including gentamicin, vancomycin, and
tobramycin, an antifungal agent, such as amphotericin, an
anti-inflammatory agent, such as an NSAID, an immunosuppressant,
such as cyclosporine and tacrolimus, other medicaments, commercial
and industrial chemicals, such as hydrocarbons, chlorocarbons and
fluorocarbons, and minerals such as arsenic, mercury, bismuth and
lead. Other nephrotoxic compounds can include an aminoglycoside,
foscarnet, pentamidine, vancomycin, neomycin, nitrous oxide,
isoflurane, kanamycin, and cyclophosphamide.
[0120] In accordance with embodiments of the invention, NGAL can be
administered prior to, during (at the same time as), or following
ischemia, ischemic-reperfusion injury, organ transplant, ATN, toxin
admistration, and the like, as described herein. More particularly,
NGAL can be administered to the patient from about 30 minutes to
about 90 minutes before an organ is transplanted. It is also
contemplated that the compositions can be administered at times
outside the range of 30 to 90 minutes.
[0121] The invention also includes a method of administering from
about 1 to about 200 mg/kg body weight of NGAL to a patient, more
typically from about 1 to about 100 mg/kg body weight. The amount
of NGAL administered to a patient can vary or fall out side of the
ranges given above. As discussed herein, the amount of NGAL
administered to the patient can vary.
[0122] A composition of the present invention, such as a medicament
or pharmaceutical composition, can typically comprise a level of
NGAL and/or sideophore of at least about 10 microgram/100
microliter of composition, and more typically at least about 100
microgram/100 microliter of composition.
[0123] A composition of the present invention can include different
types of pharmaceutically acceptable carriers, depending on whether
they are to be administered in solid, liquid or aerosol form, and
whether they need to be sterile for such routes of administration
as injection. The present invention can be administered
intravenously, intradermally, intraarterially, intraperitoneally,
intralesionally, intracranially, intraarticularly,
intraprostaticaly, intrapleurally, intratracheally, intranasally,
intravitreally, intravaginally, intrarectally, topically,
intratumorally, intramuscularly, intraperitoneally, subcutaneously,
subconjunctival, intravesicularlly, mucosally, intrapericardially,
intraumbilically, intraocularally, orally, topically, locally,
inhalation (e.g., aerosol inhalation), injection, infusion,
continuous infusion, localized perfusion bathing target cells
directly, via a catheter, via a lavage, in cremes, in lipid
compositions (e.g., liposomes), or by other method or any
combination of the foregoing as would be known to one of ordinary
skill in the art.
[0124] The actual dosage amount of a composition of the present
invention administered to an animal patient can be determined by
physical and physiological factors such as body weight, severity of
the condition being treated, the type of disease being treated,
previous or concurrent therapeutic interventions, idiopathy of the
patient, and the route of administration. The practitioner
responsible for administration will, in any event, determine the
concentration of the NGAL, siderophore and mixtures thereof, and of
other optional active agents, in a composition and appropriate
dose(s) for the individual subject.
[0125] In certain embodiments, pharmaceutical compositions can
comprise, for example, at least about 0.1% of another optional
active agent or ingredient. In other embodiments, the active agent
or ingredient can comprise between about 2% to about 75% of the
weight of the unit, more typically between about 25% to about 60%,
and any range derivable therein. In other non-limiting examples, a
dose amount of the active agent or ingredient can comprise from
about 1 microgram/kg body weight about 500 milligram/kg body
weight, more typically from about 5 mg/kg body weight to about 100
mg/kg body weight.
[0126] In some instances, the composition can comprise various
antioxidants to retard oxidation of one or more ingredient.
Additionally, the prevention of the action of microorganisms can be
brought about by preservatives such as various antibacterial and
antifungal agents, including but not limited to parabens (e.g.,
methylparabens, propylparabens), chlorobutanol, phenol, sorbic
acid, thimerosal or combinations thereof.
[0127] The compositions can be formulated into a composition in a
free base, neutral or salt form. Pharmaceutically acceptable salts,
include the acid addition salts, e.g., those formed with the free
amino groups of a proteinaceous composition, or which are formed
with inorganic acids such as for example, hydrochloric or
phosphoric acids, or such organic acids as acetic, oxalic, tartaric
or mandelic acid. Salts formed with the free carboxyl groups can
also be derived from inorganic bases such as, for example, sodium,
potassium, ammonium, calcium or ferric hydroxides, or such organic
bases as isopropylamine, trimethylamine, histidine or procaine.
[0128] In embodiments where the composition is in a liquid form, a
carrier can be a solvent or dispersion medium including, but not
limited to, water, ethanol, polyol (e.g., glycerol, propylene
glycol, liquid polyethylene glycol, etc), lipids (e.g.,
triglycerides, vegetable oils, liposomes), and combinations
thereof. The proper fluidity can be maintained, for example, by the
use of a coating such as lecithin, by the maintenance of the
required particle size by dispersion in carriers such as, for
example liquid polyol or lipids, by the use of surfactants such as,
for example, hydroxypropylcellulose, or combinations thereof such
methods. In many cases it is typical to include isotonic agents,
such as, for example, sugars, sodium chloride or combinations
thereof
[0129] In other embodiments of the present invention, one can use
eye drops, nasal solutions or sprays, aerosols or inhalants. Such
compositions are generally designed to be compatible with the
target tissue type. In a non-limiting example, nasal solutions are
usually aqueous solutions designed to be administered to the nasal
passages in drops or sprays. Nasal solutions are prepared so that
they are similar in many respects to nasal secretions, so that
normal ciliary action is maintained. Thus, in typical embodiments,
the aqueous nasal solutions usually are isotonic or slightly
buffered to maintain a pH of about 5.5 to about 6.5. In addition,
antimicrobial preservatives, similar to those used in ophthalmic
preparations, drugs, or appropriate drug stabilizers, if required,
can be included in the formulation. For example, various commercial
nasal preparations are known and include drugs such as antibiotics
or antihistamines.
[0130] In certain embodiments, the compositions are prepared for
administration by such routes as oral ingestion. In these
embodiments, the solid composition can comprise, for example,
solutions, suspensions, emulsions, tablets, pills, capsules (e.g.,
hard or soft shelled gelatin capsules), sustained release
formulations, buccal compositions, troches, elixirs, suspensions,
syrups, wafers, or combinations thereof. Oral compositions can be
incorporated directly with the food of the diet. Typical carriers
for oral administration comprise inert diluents, assimilable edible
carriers, or combinations thereof. In other aspects of the
invention, an oral composition can be prepared as a syrup or
elixir, and can comprise, for example, at least one optional active
agent or ingredient, a sweetening agent, a preservative, a
flavoring agent, a dye, a preservative, or combinations thereof. In
other embodiments, an oral composition can comprise one or more
binders, excipients, disintegration agents, lubricants, flavoring
agents, or combinations thereof
[0131] In certain embodiments, a composition can comprise one or
more of the following: a binder, such as, for example, gum
tragacanth, acacia, cornstarch, gelatin or combinations thereof, an
excipient, such as, for example, dicalcium phosphate, mannitol,
lactose, starch, magnesium stearate, sodium saccharine, cellulose,
magnesium carbonate or combinations thereof, a disintegrating
agent, such as, for example, corn starch, potato starch, alginic
acid or combinations thereof, a lubricant, such as, for example,
magnesium stearate, a sweetening agent, such as, for example,
sucrose, lactose, saccharin or combinations thereof, a flavoring
agent, such as, for example peppermint, oil of wintergreen, cherry
flavoring, orange flavoring, etc., or combinations of the
foregoing. When the dosage unit form is a capsule, it can contain,
in addition to materials of the above type, carriers such as a
liquid carrier. Various other materials can be present as coatings
or to otherwise modify the physical form of the dosage unit. For
instance, tablets, pills, or capsules can be coated with shellac,
sugar or both.
[0132] Additional formulations that are suitable for other modes of
administration include suppositories. Suppositories are solid
dosage forms of various weights and shapes, usually medicated, for
insertion into the rectum, vagina or urethra. After insertion,
suppositories soften, melt or dissolve in the cavity fluids. In
general for suppositories, traditional carriers can include, for
example, polyalkylene glycols, triglycerides or combinations
thereof. In certain embodiments, suppositories can be formed from
mixtures containing, for example, the active agent or ingredient in
the range of about 0.5% to about 10%, and typically about 1% to
about 2%.
[0133] Sterile injectable solutions are prepared by incorporating
the active compounds in the required amount in the appropriate
solvent with several of the other ingredients enumerated above, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active compounds into a sterile vehicle that contains the basic
dispersion medium and/or the other ingredients. In the case of
sterile powders for the preparation of sterile injectable
solutions, suspensions or emulsion, the typical methods of
preparation are vacuum-drying or freeze-drying techniques that
yield a powder of the active compound plus any additional desired
ingredient from a previously sterile-filtered liquid medium
thereof. The liquid medium should be suitably buffered if necessary
and the liquid diluent first rendered isotonic prior to injection
with sufficient saline or glucose. The preparation of highly
concentrated compositions for direct injection is also
contemplated, where the use of DMSO as solvent is envisioned to
result in extremely rapid penetration, delivering high
concentrations of the active compounds to a small area.
[0134] The composition should be stable under the conditions of
manufacture and storage, and preserved against the contaminating
action of microorganisms, such as bacteria and fungi. It will be
appreciated that exotoxin contamination should be kept minimally at
a safe level, for example, less that 0.5 ng/mg protein.
Experimental Protocols
[0135] The invention will be better understood through examples
illustrating its use and efficacy. The experimental protocols
described below will be referenced in the examples that follow.
[0136] 1. Expression, Purification, and Radiolabeling of
Recombinant Human and Mouse NGAL:
[0137] Full length mouse NGAL cDNA was cloned into the pGEX
expression vector, expressed as a fusion protein with glutathione
S-transferase (GST) in bacteria, and purified using
glutathione-sepharose columns (Amersham) followed by thrombin
cleavage as previously by Bundgaard J et al., Biochem Biophys Res
Commun 202: 1468-1475, 1994; Yang J et al., Mol Cell 10: 1045-1056,
2002; and Del Rio M et al., J Am Soc Nephrol 15: 41-51, 2004.
Purified NGAL was made endotoxin-free with using the Detoxi-Gel
endotoxin removing column (Pierce) as recommended by the
manufacturer. Proteins were analyzed by SDS-PAGE followed by
Coomassie blue staining or by Western blotting with a polyclonal
antibody to NGAL as described by Mishra et al., J Am Soc Nephrol
14: 2534-2543, 2003. Protein concentrations were determined using
the Bradford assay. A single clean polypeptide of the predicted
size was detected, as shown in FIG. 1.
[0138] 2. Expression and Purification of Recombinant Human and
Mouse NGAL
[0139] Recombinant human and mouse GST-NGAL were expressed in BL21
or XL1-Blue strains of E. coli (Stratagene) with additional ferric
sulfate (50 Micro Molar, Sigma-Aldrich Co.). NGAL was isolated
using Glutathione Sepharose 4B beads (Amersham Biosciences), eluted
by thrombin cleavage (Sigma-Aldrich Co.; St. Louis, Mo.) and then
further purified by gel filtration (Superdex75, SMART system,
Amersham Biosciences) and examined by Coomassie gels (Biorad).
BL-21 derived NGAL was loaded with iron free or iron saturated
enterochelin, a siderophore (EMC Microcollections) using a 5 fold
molar excess. Unbound siderophore (0.7 KD) was removed by washing
(Microcon YM-10) with PBS. To produce .sup.55Fe or gallium (Ga)
loaded NGAL we incubated the iron-free enterochelin NGAL complex
with equimolar .sup.55Fe (18 mCi) or Ga in NaCl (150 mM) Hepes (20
mM; pH 7.4) and the complex was washed 3 times (10 K filter).
Iodobeads (Pierce) were used to label NGAL with .sup.125I and
unincorporated .sup.125I was removed by gel filtration (PD-10
column) followed by extensive dialysis (7 kDa cut off membrane,
Pierce) against PBS. Alexa-568 and fluorescein isothiocyanate
(Molecular Probes) was coupled to NGAL, according to the
manufacturer, and then extensively dialyzed. Protein concentration
was determined by Coomassie gels in comparison with bovine serum
albumin standard.
[0140] 3. NGAL Injections:
[0141] Purified endotoxin-free NGAL was administered either
intravenously into mice via tail vein injections, subcutaneously,
or intraperitoneally. In preliminary studies, animals were treated
with three different concentrations of NGAL (50, 100, or 250 .mu.g
of a 250 .mu.g/100 .mu.l solution), subjected to 30 minutes of
bilateral renal artery clamping one hour later, and examined after
24 hours of reflow. When compared to animals pre-treated with an
equal volume (100 .mu.l) of saline, only the group given 250 .mu.g
of NGAL exhibited a significant protection from the tubular damage
and azotemia. All subsequent studies as reported here were carried
out using the 250 .mu.g dose of NGAL. Comparisons were made between
five different animal groups: non-ischemic controls (n=8), ischemic
controls pre-treated with saline alone (n=8), NGAL pre-treated one
hour prior to renal artery clamping (n=6), NGAL treated during
renal artery clamping (n=6), and NGAL treated one hour post renal
artery clamping (n=6).
[0142] 4. Human Studies:
[0143] Healthy volunteers and patients diagnosed with either acute
or chronic renal failure were analyzed for NGAL protein levels in
urine and serum. Acute renal failure (ARF) was diagnosed by a
doubling of the serum creatinine in less than 5 days. The presumed
etiology of ARF included sepsis which was defined by the presence
of at least two of the following criteria: positive blood cultures
or evidence of local infection in the lung, skin or urinary tract
and fever or an elevated WBC count. Some of these patients required
blood pressure support. Other etiologies of ARF included
hypotension due to bleeding or heart failure, nephrotoxins, or
post-transplant ischemia. The definition of chronic renal failure
(CRF) was a serum creatinine greater than 2 mg/dl, but unchanged
during at least the prior 2 months. The presumed etiologies of CRF
included obstructive uropathy, chronic interstitial nephritis, and
diabetes. Samples of blood and urine were collected from patients
evaluated at Columbia University Medical Center and at Kyoto
University Hospital with approval of both Institutional Review
Boards and then analyzed in a blinded fashion.
[0144] 5. Measurement of NGAL:
[0145] An anti-mouse NGAL polyclonal antibody was raised in rabbit
and then purified on a column of Sepharose 4 fast flow beads
(Amersham Biosciences) coupled to recombinant mouse NGAL (see
below) followed by elution at pH 2.5. Monoclonal anti-human NGAL
(AntibodyShop) was also used to detect NGAL. Human NGAL was better
recognized by the monoclonal antibody while mouse NGAL was
recognized only by the affinity-purified polyclonal.
[0146] Human blood samples were initially collected in citrate,
EDTA or heparin, but since all of these preparations showed similar
NGAL immunoreactivity, human serum and mouse plasma are collected
in the examples described below. The samples were centrifuged
through a 100 KDa cut-off filter (YM-100, Amicon) and the
flow-through used for immunoblot. In patients undergoing
hemodialysis, samples were taken immediately before dialysis. Fresh
urine samples were centrifuged at low speed and then used without
further concentration.
[0147] 6. Pathologic Specimens:
[0148] Pathological specimens included ischemic ATN (10 cases),
toxic ATN (11 cases--(5) antibiotics, (2) zoledronate, (1)
carboplatinum, (2) non-steroidal anti-inflammatory agents, and (1)
hemoglobinuria), and glomerulopathies (10 cases--including
diabetic, anti-GBM, pauci-immune cresentic glomerulonephritis, IgA
nephropathy, minimal change, focal segmental glomeruloscerosis),
and also normal kidneys (3 cases). Formalin-fixed,
paraffin-embedded tissues were sectioned (5 .mu.m) and subjected to
antigen retrieval using microwave in a citrate buffer (pH6.0) for
30 min. Endogenous peroxidase was blocked with 5% H.sub.2O.sub.2
for 30 min, followed by blocking in 10% goat serum/1% BSA. Affinity
purified anti-mouse NGAL (0.4 .mu.g/ml) was applied overnight at 4
C, followed by biotinylated goat anti-rabbit IgG (1:100, Vector)
and avidin-HRP, each for 30 minutes. Slides were developed with
DAB/0.3% H.sub.2O.sub.2 for 2.5 minutes and counterstained with
hematoxylin. Non-immune rabbit IgG (0.4 .mu.g/ml; Vector) was used
as a control.
[0149] 7. NGAL Trafficking
[0150] To detect delivery of NGAL to the kidney rNGAL (10 or 100
.mu.g), Alexa 568-NGAL (100 .mu.g), .sup.125I-NGAL (10 .mu.g,
2.times.10.sup.6 cpm), or .sup.55Fe loaded enterochelin-NGAL (10
.mu.g, 1.times.10.sup.6 cpm) was injected into the peritoneum and
blood, urine, kidney and liver samples were obtained. NGAL was
detected by immunoblot. Alexa-568 NGAL was detected by confocal
microscopy (LSM Meta Detector) and NGAL mediated iron trafficking
was detected by scintillation counter and by light microscopic
radioautography of Epon embedded kidneys. Slides were exposed to
emulsion (Polyscience) for 1 week and then developed with Microdol
and counterstained with Toluidine blue. To detect lysosomes in the
proximal tubule, mice were injected with Fluorescein Dextran (46
kD; 0.5 mg; Sigma) 24 hours before Alexa 568 NGAL injections. LAMP1
(Santa Cruz) was detected in cryostat sections of 4%
paraformaldehyde fixed kidneys.
[0151] 8. Mouse Model of ATN or Ischemia/Reperfusion Injury:
[0152] Male C57BL/6 mice (20-25 gr; Charles River) were
anesthetized with intraperitoneal pentobarbital (50mg/kg) and
placed on a heating pad under a warming light to maintain
37.COPYRGT. core body temperature. Kidneys were exposed through an
abdominal section and the right kidney was either removed or its
vascular pedicle and ureter ligated. The vascular pedicle of the
left kidney or both kidneys was clamped by a microaneurysm clip
(Kent Scientific) for 30 minutes after right nephrectomy. This
period of ischemia generated reproducible renal injury but
minimized mortality. During the procedure, PBS (0.5 ml) was used to
dampen the peritoneum. The animal was closed with 5-0 Nylon.
Saline, NGAL, retinol-loaded retinol binding protein (RBP),
enterochelin, or desferroxamine mesylate (DFO) were injected into
the peritoneum or subcutaneously 15 min. prior to ischemia or 1-2
hr after reperfusion.
[0153] After 6 or 24 hr of reperfusion, heparinized plasma, urine
and kidney samples were obtained to measure NGAL (polyclonal
1:500), Heme oxygenase-1 (Stressgen, 1:2000), E-cadherin (BD
Transduction Labs, 1:2000), N-cadherin (BD Transduction Labs,
1:3000) and GAPDH (Chemicon International, 1:3000) using
immunoblots. Plasma was also used for creatinine and blood urea
nitrogen colorimetric assays. Sagittal sections of the kidney were
fixed in 4% formalin, or were snap frozen for mRNA and protein
analysis. Paraffin-embedded sections (5 .mu.m) were stained with
hematoxylin-eosin or by an in situ kit (Fluorescein-TUNEL, Roche)
for apoptotic nuclei or for total nuclei (Toprol, Molecular
Probes). For cell proliferation analysis, BrdU was injected into
the peritoneum 1 hour before sacrifice, and cryostat sections were
stained with anti-BrdU (Roche) according to the manufacturer.
[0154] For some studies, the mice were allowed to recover in a
warmed cage, and timed urine collections were obtained. After
various reperfusion periods, the animals were then re-anesthetized,
the abdominal cavity opened, and blood obtained via puncture of the
inferior vena cava for measurement of serum creatinine by
quantitative colorimetric assay. The mice were killed, the kidneys
perfusion fixed in situ with 4% paraformaldehyde in PBS, and both
kidneys harvested. One half of each kidney was snap frozen in
liquid nitrogen and stored at -70.degree. C. until further
processing; a sample was fixed in formalin, paraffin-embedded, and
sectioned (4 .mu.m). Paraffin sections were stained with
hematoxylin-eosin and examined histologically. The other half of
each kidney was embedded in OCT compound (Tissue-Tek) and frozen
sections (4 .mu.m) obtained for immunohistochemistry.
[0155] 9. Real-Time PCR:
[0156] Total RNA was extracted from mouse kidneys using RNeasy mini
kit (Qiagen) with on-column DNase digestion according to the
manufacturer's instructions. The cDNA template was synthesized
using Omniscript Reverse Transcriptase and oligo-dT primer
(Qiagen). The PCR reaction was carried out using iQ SYBR green
super mix and MyiQ single-color real-time PCR detection system
(Biorad) with incubation times of 2 min at 95.degree. C., followed
by 40 cycles of 95.degree. C./30 s and 60.degree. C./30 s.
Specificity of the amplification was checked by melting curve
analysis and by agarose gel electrophoresis. Primer sequences for
mouse NGAL mRNA (Genbank NM.sub.--008491) were CTCAGAACTTGATCCCTGCC
(forward primer, positions 93-112) and TCCTTGAGGCCCAGAGACTT
(reverse, 576-557). Sequences for mouse .beta.-actin mRNA (Genbank
X03672) were CTAAGGCCAACCGTGAAAAG (forward, 415-434) and
TCTCAGCTGTGGTGGTGAAG (reverse, 696-677). Each plate included a
dilution series of standard sample, which was used to determine
mRNA quantities. The NGAL mRNA content was normalized by
.beta.-actin mRNA.
[0157] 10. Iron Binding Co-Factor
[0158] Cofactor-dependent iron binding to NGAL was measured in 150
mM NaCl-20 mM Hepes (pH7.4) buffer (100 .mu.l) with apo-NGAL (10
.mu.M), .sup.55Fe (1 .mu.M), and a low molecular weight fraction
(<3 Kd) of mouse urine (0-30 .mu.l) and incubated 70 min. at
room temperature. The urine fraction was obtained by passing fresh
urine sequentially through 10 kDa and 3 kDa membranes (YM-10 and
YM-3, Amicon). The mixture was then washed three times on 10 kDa
membrane (YM-10, Amicon). Iron-free enterochelin-loaded NGAL
(rather than NGAL without siderophore) served as a positive control
for iron capture. Ferric citrate (1 mM) or iron-loaded enterochelin
(Sid:Fe, 50 .mu.M) were used as competitors of .sup.55Fe
binding.
[0159] 11. NGAL Immunohistochemistry:
[0160] For NGAL detection, frozen kidney sections were
permeabilized with 0.2% Triton X-100 in PBS for 10 min, blocked
with goat serum for 1 hr, and incubated with primary antibody to
NGAL (1:500 dilution) for 1 hr. Slides were then exposed for 30 min
in the dark to secondary antibodies conjugated with Cy5 (Amersham,
Arlington Heights, Ill.), and visualized with a fluorescent
microscope (Zeiss Axiophot) equipped with rhodamine filters.
[0161] 12. Histopathology Scoring:
[0162] Kidney sections of 4 microns were stained with
hematoxylin-eosin and scored for histopathologic damage to the
tubules in a blinded fashion, as previously described by Yokota N.
et al., Am J Physiol Renal Physiol 285: F319-F325, 2003 and
Kjeldsen L. et al., Biochim Biophys Acta 1482: 272-283, 2000. Each
parameter was assessed in five high power fields (40.times.) in the
inner cortex and outer medullary regions (where the tubular damage
was most evident), and an average determined for each section. The
parameters included tubule dilatation, tubule cast formation, and
tubule cell necrosis. Each parameter was scored on a scale of 0 to
4, ranging from none (0), mild (1), moderate (2), severe (3), to
very severe/extensive (4).
[0163] 13 Apoptosis Assays:
[0164] For the TUNEL assay to detect apoptotic nuclei, we utilized
the ApoAlert DNA Fragmentation Assay Kit (Clontech). Paraffin
sections were deparaffinized through zylene and descending grades
of ethanol, fixed with 4% formaldehyde/PBS for 30 min at 4.degree.
C., permeabilized with proteinase K at room temperature for 15 min
and 0.2% triton X-100/PBS for 15 min at 4.degree. C., and incubated
with a mixture of nucleotides and TdT enzyme for 60 min at
37.degree. C. The reaction was terminated with 2.times.SSC, the
sections washed with PBS, and mounted with Crystal/mount (Biomeda,
Foster City, Calif.). TUNEL-positive apoptotic nuclei were detected
by visualization with a fluorescent microscope. Only cells that
displayed the characteristic morphology of apoptosis, including
nuclear fragmentation, nuclear condensation, and intensely
fluorescent nuclei by TUNEL assay, were counted as apoptotic.
Merely TUNEL positive cells, in the absence of morphologic
criteria, were not considered apoptotic. Slides were examined in a
blinded fashion, and apoptosis was quantified by counting the
number of TUNEL positive nuclei per 100 cells counted in an average
of five high power (40.times.) fields in each section.
[0165] 14. Proliferation Assays:
[0166] For detection of proliferating cells, sections were
incubated with a monoclonal antibody to Proliferating Cell Nuclear
Antigen (PCNA, 1:500 dilution, Upstate Biotechnology), and
detection accomplished by immunoperoxidase staining as recommended
by the manufacturer (ImmunoCruz Staining System, Santa Cruz
Biotechnology). Slides were examined in a blinded fashion, and
proliferation was quantified by counting the number of PCNA
positive cells per 100 cells counted in an average of five high
power (40.times.) fields in each section.
[0167] 15. Statistical Analysis:
[0168] The SPSS software (version 8/0) was employed to generate
univariate statistics for each continuous variable, including
means, standard deviations, distributions, range, and skewness. The
data were examined for normality and equality of distribution. One
way ANOVA was employed to compare means.+-.SD of continuous
variables among different treatment groups. The Kruskal-Wallis
ANOVA on Ranks was used for non-normally distributed data. To
identify the group or groups that differed from the others, a
multiple comparison procedure was used (Tukey test or Dunn's Method
depending on the normality of distribution). A p value<0.05 was
considered statistically significant. NGAL levels in humans were
log transformed for statistical analysis. The data were analyzed by
one-way ANOVA with Bonferroni's post-test to compare mean values
across groups. The Jablonski score of kidney damage was analyzed by
the Kruskal-Wallis test with Dunn's post-test.
EXAMPLES
[0169] The following examples are provided to more fully describe
the practice of the invention in its various embodiments.
Experimental protocols provided above are used as indicated in the
examples.
Example 1
[0170] Intravenous NGAL is rapidly taken up by proximal tubule
cells in vivo. Purified NGAL was delivered to its putative site of
action, namely the proximal tubule. Mice received intravenous NGAL
(250 .mu.g in 100 .mu.l saline) or an equal volume of saline alone,
subjected to ischemia-reperfusion injury, and the kidneys and urine
examined at various time periods, as shown in FIG. 2. Non-ischemic
saline control animals had no NGAL (upper left panel), while
non-ischemic NGAL-treated animals had NGAL (lower left panel).
Saline-injected animals were devoid of kidney NGAL at one hour
(upper center panel). Endogenous NGAL was detected in
saline-treated animals at 3 hours after ischemic-reperfusion injury
(upper right panel). In contrast, within one hour of NGAL
injection, it was easily detected in a punctate cytoplasmic
distribution predominantly in the proximal tubules (lower center
panel), and was still seen at 3 hours (lower right panel).
Identification of proximal tubules in these sections was based on
location and morphology. This represents uptake of injected NGAL
following ischemic injury, since NGAL was not detected at the one
hour reflow period in saline-injected animals. In addition, NGAL
was detected in the urine within one hour of injection, as shown in
FIG. 3.
Example 2
[0171] Intravenous NGAL rapidly appears in the urine following
administration and ischemic-reperfusion injury. Urine from the
animals of Example 1 was examined at various time periods.
Saline-injected animals were devoid of kidney or urinary NGAL at
the 1 hour reflow period, and NGAL was just detectable at the
3-hour reflow period, as shown in FIG. 3 (left panel). The 3 hour
data represents the endogenous response of kidney tubule cells to
ischemic injury. In contrast, in animals injected with NGAL and
simultaneously subjected to ischemia-reperfusion injury, NGAL was
easily detected in the kidney and urine with 1 hour of reflow, as
shown in FIGS. 3 (right panel).
Example 3
[0172] NGAL ameliorates the histopathologic damage to tubules
induced by ischemia-reperfusion injury. NGAL administered one hour
before, during, or even one hour after ischemia resulted in a
significant decrease in the histopathologic damage to tubules.
Representative kidney sections obtained at 24 hours of reflow and
stained with hematoxylin-eosin are shown in FIG. 4. While the
non-ischemic controls (Non-Ischemic panel) displayed normal
histology, animals pre-treated with saline alone (Saline
Pre-treated panel) (100 .mu.l, volume of diluent) displayed
extensive features of acute tubular necrosis, including tubular
dilatation, tubular cast formation, and necrotic cells. In
contrast, NGAL-treated kidneys displayed an attenuated
histopathologic response. This was most evident in animals
pre-treated with NGAL (NGAL Pre-treated panel), but was also
evident when the NGAL was administered during (NGAL During Isch
panel) or even one hour after (NGAL After Isch panel) the ischemic
injury. In order to quantify this response, kidney sections were
scored for histopathologic damage to the tubules in a blinded
fashion. The results are illustrated in FIG. 5A-5C. In all three
parameters examined, dilatation (FIG. 5A), casts (FIG. 5B), and
cell necrosis (FIG. 5C), all three modalities of NGAL treatment
(before, during, or after ischemia) resulted in a significantly
improved score when compared to controls. This difference was most
striking in animals pre-treated with NGAL, followed in a graded
fashion by findings in animals treated with NGAL during ischemia or
after the ischemic insult. However, the structural protection was
not complete, and even animals pre-treated with NGAL did display
some degree of histopathologic damage, which was completely absent
from non-ischemic controls.
Example 4
[0173] NGAL ameliorates the reduction in kidney function induced by
ischemia-reperfusion injury. NGAL administered one hour before,
during, or even one hour after ischemia resulted in a significant
decrease in the serum creatinine measured at 24 hours of reflow, as
shown in FIG. 6. While the non-ischemic controls (Non Isch)
displayed serum creatinine (0.65.+-.0.13 mg/dl), animals
pre-treated with saline alone (Pre Sal) (100 .mu.l, volume of
diluent) displayed a significant increase in serum creatinine
(2.6.+-.0.28 mg/dl). In contrast, NGAL-treated kidneys displayed an
attenuated functional response. This was most evident in animals
pre-treated with NGAL (1.25.+-.0.3 mg/dl), but was also evident
when the NGAL was administered during (Dur NGAL) (1.5.+-.0.2 mg/dl)
or even one hour after (Post NGAL) (1.95.+-.0.2 mg/dl) the ischemic
injury. However, the functional protection was not complete, and
even animals pre-treated with NGAL did display a significant
increase in serum creatinine when compared to non-ischemic
controls.
Example 5
[0174] NGAL ameliorates the apoptotic tubule cell death induced by
ischemia-reperfusion injury. The structural and functional
protection observed with exogenous NGAL administration was a result
of decreased apoptosis. Representative kidney sections obtained at
24 hours of reflow and subjected to TUNEL assay are shown in FIG. 7
at low (left column) and high (center column) magnifications. While
the non-ischemic controls displayed a minimal incidence of
apoptosis (2.2.+-.0.5 cells per hundred (%) cells examined),
animals pre-treated with saline alone (100 .mu.l, volume of
diluent) displayed a significantly greater number of apoptotic
tubule epithelial cells (12.6%.+-.2.2), as shown quantitatively in
FIG. 8 (left panel). In contrast, NGAL-treated kidneys displayed an
attenuated apoptotic response. This was most evident in animals
pre-treated with NGAL (6.7%.+-.1.6), but was also evident when the
NGAL was administered during (7.6%.+-.0.8) or even one hour after
(8.5%.+-.0.8) the ischemic injury. However, the protection from
apoptotic cell death was not complete, and even animals pre-treated
with NGAL did display a significantly greater degree of apoptotic
damage when compared to non-ischemic controls.
Example 6
[0175] NGAL enhances tubule cell proliferation following ischemic
injury. Representative kidney sections obtained at 24 hours of
reflow and stained with an antibody to PCNA are shown in FIG. 7
(right column). While the non-ischemic controls displayed a minimal
incidence of proliferating cells (1.9%.+-.0.4 cells per hundred
cells examined), animals pre-treated with saline alone (100 .mu.l,
volume of diluent) displayed a small but significant increase in
the number of PCNA-positive tubule epithelial cells (4.4%.+-.1.2),
as shown quantitatively in FIG. 8 (right panel). In contrast,
NGAL-treated kidneys displayed a marked increase in proliferating
cells. This was most evident in animals pre-treated with NGAL
(19.1%.+-.2.1), but was also evident when the NGAL was administered
during (14.9%.+-.1.2) or even one hour after (14.5%.+-.1.2) the
ischemic injury.
Example 7
[0176] NGAL tilts the balance of tubule cell fate towards survival
following ischemic injury. The overall tubule cell fate following
ischemic injury was estimated using a one-way ANOVA to compare
means.+-.SD of proliferation and apoptosis among the different
treatment groups at 24 hours of reflow. A ratio of unity can be
assumed to indicate equal rates of cell survival and death, as
would be expected in the mature kidney at rest, illustrated in FIG.
9. Non-ischemic control kidneys displayed a proliferation:apoptosis
ratio of 0.86.+-.0.1, close to the value of unity. Animals
pre-treated with saline alone (100 .mu.l, volume of diluent)
displayed a significant decrease in the proliferation:apoptosis
ratio (0.34%.+-.0.05), indicating that cell death is the
predominant feature at the 24 hour reflow time-point. In contrast,
NGAL-treated kidneys displayed a marked increase in the ratio of
proliferating versus apoptotic tubule cells. This was most evident
in animals pre-treated with NGAL (2.9%.+-.0.5), but was also
evident when the NGAL was administered during (2.0.+-.0.1) or even
one hour after (1.7%.+-.0.1) the ischemic injury. This analysis
indicates that NGAL tilts the overall balance of tubule cell fate
towards cell survival following ischemic injury.
Example 8
[0177] Expression of NGAL increases in Acute Renal Failure of the
Human. Acute renal failure in humans was marked by log order
elevations in the concentration of serum and urinary NGAL protein,
shown in FIG. 11. Urinary NGAL protein was 22 ng/ml (n=10) in
normal subjects, and 557 ng/ml (25-fold elevation, p<0.001) in
subjects with acute renal failure and a variety of co-morbidities.
Urinary NGAL immunoblots are shown in FIG. 11A, and as quantitative
graphs in FIG. 11C. Compared to normal subjects, in which serum
NGAL was 21 ng/ml (geometric mean; n=5) subjects with acute renal
failure and a variety of co-morbidities had 7.3-fold elevations in
serum NGAL (146 ng/ml, p<0.05). These data are shown as
immunoblots in FIG. 11B, and as quantitative graphs in FIG. 11D.
Patients with acute renal failure associated with bacterial
infection tended to have the highest levels of serum (331 ng/ml)
and urinary (2786 ng/ml) NGAL, but this was not statistically
different from acute renal failure without infection. To determine
whether NGAL expression correlated with the extent of acute renal
impairment, we used simple regression analysis after log
transformation of NGAL levels. We found both serum (r=0.64, n=32)
and urinary NGAL levels (r=0.68, n=38), as well as urine NGAL
normalized for urine creatinine (r=0.67, n=36) were highly
correlated with serum creatinine levels (p<0.0001). In
comparison, patients with chronic renal failure had less prominent
elevations in serum NGAL (49 ng/ml, n=10) and urine NGAL (119
ng/ml, n=9), and these values failed to correlate with serum
creatinine These data correlate NGAL expression with acute kidney
damage, implicating the kidney as the major source of serum and
urinary NGAL. Indeed, in several cases of severe renal failure, the
fractional excretion of NGAL (the clearance of NGAL, normalized for
the clearance of creatinine) was greater than 100%, demonstrating
that urinary NGAL derived from local synthesis, rather than only by
filtration from the blood. By comparison, mouse urine also
contained markedly elevated levels of NGAL, shown in FIG. 11E,
following induction of ATN injury.
[0178] To visualize sites of expression of NGAL in acute renal
diseases, human kidney tissue sections were stained with
affinity-purified polyclonal antibody to NGAL (FIG. 12). The normal
kidney demonstrated very weak staining in the distal tubular
epithelia (mean 10% of cortical area) and in medullary collecting
ducts, shown at low power in FIG. 12A, and at high power in FIGS.
12B, and 12C. Rare focal staining of glomerular parietal epithelial
cells, but not other glomerular cells was also identified. Proximal
tubules however were entirely negative. In contrast, nearly 50% of
cortical tubules were stained for NGAL in kidneys exposed to
nephrotoxins or ischemia in kidney sections from subjects with the
following diagnoses: FIG. 12D, ischemic ATN caused by sepsis; FIG.
12E, hypovolemia (acute loss of blood volume); FIG. 12F, heart
failure; FIG. 12G, nephrotoxicity due to bisphosphonate; FIG. 12H,
nephrotoxicity due to cephosporin; and FIG. 12I, hemoglobinuria.
NGAL was also widely expressed in the proximal tubule of patients
with proliferative glomerulopathies, shown in FIGS. 12J and 12K,
but to a lower degree than that found in ischemic damage
(percentage of cortical parenchyma positive for NGAL was 20% in
minimal change disease, 40% in diabetic nephropathy and 50 and 65%
in ANCA and anti-glomerular basement membrane diseases). Tubular
cells displaying features of cell injury, including simplification
and enlarged reparative nuclei with prominent nucleoli, had the
most intense staining Tubular cells with less derangement had much
less staining These data demonstrate de novo and widespread NGAL
reactivity in cortical tubules of different renal diseases and
demonstrate that NGAL expression is a common response of damaged
epithelia in human kidney.
Example 9
[0179] Exogenous NGAL Rescues the Mouse Proximal Tubule from ATN.
To examine the functional significance of NGAL expression in renal
ischemia, ATN injury was induced in mice. The renal artery was
clamped for 30 min and the contralateral kidney was removed.
Twenty-four hours after reperfusion, the plasma creatinine rose
from 0.41.+-.0.1 mg/dl (n=4) to 3.16.+-.0.17 mg/dl (n=8;
p<0.001) and NGAL mRNA message and protein were intensely
expressed. NGAL mRNA levels rose approximately 1000 fold, reducing
the threshold for detection by Real-Time PCR from 17.7.+-.0.87
cycles in sham kidneys to 7.52.+-.0.44 cycles (p<0.0001, n=4
each) in ischemic kidneys (normalized to beta actin mRNA levels).
NGAL protein rose 1000 fold in the urine (40 .mu.g/ml in ATN
compared to 40 ng/ml in the sham operated and normal mouse, as
shown in FIG. 11E), 300 fold in the blood (30 .mu.g/ml in ATN
compared to 100 ng/ml in the sham-operated mouse) and was elevated
close to 100 fold in kidney extracts (Average 73 .mu.g/g compared
to <1 .mu.g/g kidney wet weight in sham-operated kidney, n=3,
p<0.05). The amount of NGAL protein in the kidney correlated
well with the duration of cross-clamping.
[0180] To determine whether NGAL was protective in the ischemic
model of ATN, we introduced NGAL systemically (1-300 .mu.g by
subcutaneous or intraperitoneal injection) prior to, or within one
hour of the release of the arterial clamp. Injection of .mu.g 100
NGAL 15 minutes before clamping blocked the rise in plasma
creatinine measured 24 hours after reperfusion (1.18.+-.0.18 mg/dl,
n=7; compared to 3.16.+-.0.17 mg/dl in untreated animals). Similar
data were obtained for dosages ranging from 10-300 .mu.g of NGAL,
but 1 .mu.g NGAL was not protective (creatinine=3.09.+-.0.11 mg/dl,
n=3). Introduction of NGAL one hour after reperfusion also blocked
the azotemia (creatinine=1.60.+-.0.28, n=3, p<0.001), but to a
lesser degree than pre-treatment with NGAL. These data were
confirmed by measurement of the blood urea nitrogen (data not
shown).
[0181] The activity of NGAL was also demonstrated by histological
findings that rather than necrotic tubules and luminal debris,
normal epithelial morphology was preserved in the S1 and S2
segments of the proximal tubule, shown in FIG. 13A, in Control and
NGAL-treated kidneys (ATN+NGAL), compared to ATN kidneys. The S3
segment in the outer stripe of the outer medulla was less protected
by injection of NGAL, but tubular casts were less evident, shown in
FIG. 13B. These observations were supported by Jablonski scoring of
the sections, shown in FIG. 13C. In contrast, treatment with NGAL 2
hours after ischemia had no protective effect
(creatinine=3.12.+-.0.35 mg/dl, n=3).
Example 10
[0182] Correlates of Ischemia Perfusion Injury. Because the
trafficking and metabolism of the cadherins is rapidly affected by
ischemia, and because NGAL acts as an inducer of E-cadherin in rat
embryonic metanephric mesenchyme, NGAL rescues cadherin expression
in the ischemic kidney. To test this hypothesis we first confirmed
that while E-cadherin could be detected in mouse proximal tubules
by immunofluorescence, N-cadherin was present in all segments of
the proximal tubule, shown in FIG. 14A, and appeared to be its
major cadherin. N-cadherin is known to be processed by caspases,
.beta.-secretase and by matrix metalloproteinases which generate
30-40 Kd cytoplasmic fragments which are potentially important
signaling molecules that modulate CREB signaling. N-cadherin was
degraded to a 30 Kd fragment after ischemia reperfusion,
demonstrated by immunoblot in FIG. 14B, suggesting the activation
of one or more of these pathways. In some animals degradation of
the protein could be detected within 6 hours of reperfusion, and by
24 hours both N-cadherin immunofluorescence and the full-length
protein was nearly abolished. In contrast, pre-treatment with NGAL
preserved N-cadherin immunofluorescence, enhanced the expression of
full length N-cadherin and reduced the appearance of its fragment
when monitored at 6 hours (in some animals) or 24 hours of
reperfusion. Hence, the preservation of proximal tubule marker
N-cadherin correlates with and is a sensitive marker of NGAL
activity. E-cadherin, which is highly expressed in the distal
tubule and collecting duct, was much less affected by ischemia and
by NGAL treatment. Similarly, metal induced nephrotoxic ATN
triggered the degradation of N-cadherin but not E-cadherin. One
effect of NGAL, therefore, is to inhibit signaling by N-cadherin
fragments.
[0183] Because disruption of the proximal cell results in apoptotic
cell death, the effect of NGAL on cell viability was determined
using a TUNEL assay of apoptosis induction. Twenty-four hours after
reperfusion, we counted the percentage of tubules with at least one
TUNEL-positive tubular cell, shown in FIG. 14C. Ischemic kidneys
(I/R) showed 11.5%.+-.0.6 (SEM, n=4 animals) of cortical tubules
contained TUNEL-positive cells, but after treatment with NGAL
(I/R+Ngal), the percentage of positive tubules fell to 2.9%.+-.0.9
(SEM, n=7; p<0.001). By comparison, 0.5%.+-.0.3 of cortical
tubules had TUNEL-positive cells in sham kidneys, shown in the
quantitative graph in FIG. 14D.
[0184] BrDU uptake was determined as a method to measure cell
proliferation by determining the percent of cortical tubules with
at least one BrDU-positive tubular cell in histological sections of
kidneys (not shown). Ischemic cortical tubules contained rare
BrDU-positive cells (1.9%.+-.0.3; n=3) while ischemic kidneys
pretreated with NGAL had a small but significant increase in
positive cells (3.9%.+-.0.5; n=4; p<0.05) measured 24 hours
after the insult. By comparison, 3.7%.+-.0.7 of cortical tubules
had BrdU-positive cells in sham kidneys. Hence, rescue by NGAL
reduced apoptosis of cortical cells and either stimulated
compensatory tubular cell proliferation or rescued cells from
damage.
[0185] Because the expression of NGAL correlates with ischemic
damage, endogenous NGAL expression after treatment with exogenous
NGAL protein was measured. Treatment of ischemic animals with 100
mg NGAL reduced the increase in endogenous NGAL RNA by 72%.+-.16
(p<0.01; n=5) at 24 hours of reperfusion as measured by real
time PCR. Treatment with 100 mg NGAL reduced the appearance of
endogenous NGAL protein in the kidney by 2.5 fold (ischemia 73.+-.7
.mu.g/g; NGAL-treated ischemia, 29.+-.7 .mu.g/g; n=3 each;
p<0.01) as measured by immunoblot, preserved tubular cells with
proliferation potential.
Example 11
[0186] NGAL Upregulates Heme Oxygenase-1 in ATN. A number of
studies have identified heme oxygenase 1 (HO-1) as a critical
regulator of the proximal tubule in renal ischemia. HO-1 is
necessary for recovery from ATN and its level of expression is
directly correlated with the rescue of tissue damage. As shown in
FIG. 14E, ischemia reperfusion (ATN lanes) enhanced the expression
of HO-1, but when ATN-injured mice were treated with 10-100 .mu.g
NGAL (ATN Ngal lanes), the enzyme was further upregulated 5-10 fold
by 24 hours after reperfusion. To determine whether NGAL alone
induced HO-1, healthy mice (Sham lanes) were injected with
increasing doses of NGAL, and HO-1 protein levels were measured.
However, the expression of HO-1 after NGAL injection was much less
than the NGAL-treated ATN-injured kidneys, indicating that NGAL
synergizes with other activators to upregulate HO-1 during
ischemic-reperfusion events and protect the kidney from
iron-mediated damage.
Example 12
[0187] Mechanism of Rescue from ATN: NGAL Targets the Proximal
Tubule. Distribution of exogenous NGAL was determined after an
intraperitoneal or subcutaneous injection to establish the
mechanism by which NGAL protects the proximal tubule from ischemic
damage. NGAL was found in the urine within 10 min of injection of
100 .mu.g exogenous NGAL suggesting that the protein was rapidly
cleared by the kidney, shown in FIG. 15. The same time course was
observed following injection of 10 .mu.g NGAL (not shown). However,
only 0.1-0.2% of the injected NGAL was recovered in the urine in
the first hour. To better follow trafficking, fluorescent
conjugates of NGAL were administered. Both fluorescein- and
Alexa-labeled NGAL localized to large vesicles in the subapical
domain of the cortical proximal tubule (S1 and S2 segments of the
nephron) by one hour, but not to other segments of the tubule,
shown in FIG. 16A. It should be noted that protein trafficking
itself is also unlikely to be the mechanism of renal protection
because a second lipocalin, retinoid loaded RBP, which is also
captured by the proximal tubule and degraded in lysosomes was
ineffective (FIG. 6A). To determine if these organelles were
lysosomes, we labeled proximal tubular lysosomes with
fluorescein-dextran (43kDa) the day before administering Alexa-568
NGAL. One hour after injecting NGAL, 33% of the NGAL vesicles also
contained dextran, shown in FIG. 16B. In addition, many of these
vesicles co-stained with the lysosomal marker LAMP1 (data not
shown). Similar results were observed following injection of
[.sup.125I]-NGAL, FIG. 16C, which showed that the full length
protein was rapidly cleared from the blood and located in the
kidney by the one hour time-point. In fact, the kidney had 13-fold
more [.sup.125]-NGAL than the liver/mg protein. Nearly identical
data were previously reported with human NGAL, which rapidly
cleared the circulation (t.sub.1/2=10 minutes) and located in the
kidney at levels 12-fold higher than the liver/mg protein. The
kidney-localized protein was TCA precipitable (70%), and composed
of both full-length NGAL and a specific 14 kDa degradation product.
These species persisted, and were only slowly lost after 5 hours
after injection. In contrast, the plasma, and particularly the
urine contained mostly low molecular weight, TCA soluble
[.sup.125I]-fragments, (35% and 20% TCA precipitable,
respectively).
[0188] These data show that full length NGAL is rapidly cleared by
the proximal tubule where it traffics to lysosomes and degrades to
a 14 kDa fragment. It is likely that the endogenous protein (low
levels of serum NGAL) traffics in a similar manner, because there
is very little urinary NGAL in normal mouse or human urine, despite
the fact that it is freely filtered from the circulation (human:
filtered load=20 ng/ml.times.GFR, whereas urine NGAL=22 ng/ml;
mouse: filtered load=100 ng/ml.times.GFR, whereas urine NGAL=40
ng/ml).
Example 13
[0189] Rescue of the Proximal Tubule from ATN Requires
Fe:Siderophore. To determine if NGAL can deliver iron to the
proximal tubule, NGAL was saturated with the radionuclide iron
species .sup.55Fe by incubating iron-free enterochelin-NGAL
(Sid:NGAL) with .sup.55Fe at a 1:1 stoichiometry
(.sup.55Fe:Sid:NGAL). One hour after injecting this radiolabeled
.sup.55Fe:Sid:NGAL complex (10 .mu.g intraperitoneal), the majority
of .sup.55Fe was recovered in the kidney (55%), while only trace
amounts were found in the plasma (4.3%), urine (0.6%), liver
(2.4%,), and spleen (0.2%). To determine the location of the
.sup.55Fe in the kidney, radioautography of tissue sections was
performed. .sup.55Fe was localized in the proximal tubule,
particularly along the apical surface, beneath the brush border, as
shown in FIG. 16E, and in Table 1, where X.sup.2=21.2 and
p=0.0017.
TABLE-US-00001 TABLE 1 SilverGrains.sup.a Area.sup.b Relative
Location (% Total) (% Point Count) SA.sup.c .chi..sup.2 Lumen 26.46
18.49 1.43 3.43 Apical MB 12.91 5.84 2.21 8.54 Cytosol 48.98 48.81
1 0.00062 Nucleus 4.02 7.17 0.56 1.39 Basal MB 3.81 6.41 0.59 1.06
Interstitium 3.71 12.2 0.3 5.91 Glomerular Tuft 0.13 1.16 0.11 0.91
Key: .sup.aTotal silver grains = 2601 .sup.bTotal point count = 999
.sup.c % grains/% point count.
[0190] In contrast, .sup.55Fe was not found in the medulla, shown
in FIG. 16D. These data demonstrate that both the NGAL protein and
its ligand, iron, can be captured by the proximal tubule when
exogenous .sup.55Fe:Sid:NGAL complex is injected. It should be
noted that the distribution of .sup.55Fe:Sid:NGAL was quite
different from the distribution of non-protein bound .sup.55Fe
citrate, wherein only 1.5% of the iron was recovered in the kidney
(not shown).
Example 14
[0191] To determine the role of iron delivery in renal protection,
we compared NGAL cloned in two different strains of E. coli
bacteria. NGAL cloned in XL-1Blue bacteria contains enterochelin
and is iron-loaded, while NGAL cloned in BL-21 bacteria does not
contain enterochelin. Ten .mu.g of XL-1Blue-cloned NGAL (holo-Ngal
10 .mu.g, left panel) protected the kidney in comparison with
sham-treated (Sham) and untreated ATN-injured kidney (ATN), shown
in FIG. 17A. However, there was a reduced level of protection with
10 .mu.g of BL-21-cloned NGAL (apo-Ngal 10 .mu.g, center panel)
lacking enterochelin. Therefore, BL-21-cloned NGAL was
reconstituted with iron-free (apo-Ngal:Sid) and iron-saturated
enterochelin (apo-Ngal:Sid:Fe). Loading with enterochelin (with or
without iron) enhanced the protection of the kidney and blunted the
rise in serum creatinine The presence of iron was slightly less
protective, since iron-saturated siderophore has a diminished
capacity for chelating iron in the kidney. Because both the
iron-loaded form and the iron free-form of NGAL:Sid were
protective, it is possible that the siderophore itself, rather than
iron was active. To test the role of iron further, a
gallium:Sid:NGAL:Sid:gallium (apo-Ngal:Sid:Ga) complex was also
tested. Because gallium is a metal that occupies iron binding sites
with high affinity, including the enterochelin siderophore (gallium
blocks .sup.55Fe binding to enterochelin to the same extent as
unlabeled iron), and because it can not undergo redox reactions
typical of iron, gallium competes with iron for binding to the
siderophore. In contrast to the iron complex, mice treated with the
gallium complex 15 minutes prior to ischemia were not protected
(creatinine=3.17.+-.0.1; n=4). In addition, a single dose of free
Siderophore (Sid), desferrioxamine mesylate (DFO) or
retinol-binding protein (RBP) failed to protect against ATN. These
data demonstrate that NGAL:siderophore complexes provide the
protective activity of NGAL, and that iron transport by the
siderophore is dependent upon NGAL. An immunoblot of
NGAL:Siderophore complexes with or without iron (Fe) are shown in
FIG. 17B.
Example 15
[0192] Demonstration of a Urine Siderophore. The actions of
endogenous NGAL in vivo might differ from the pharmacological
effect of exogenous NGAL, because the critical siderophore
associated with exogenous NGAL is a bacterial product. The presence
of endogenous low molecular weight factors that transport iron,
however, have been suggested by a variety of studies. These
molecules can include citrate, and related compounds, but also
iron-transporting activities that have a molecular weight in the
range of 1 Kd. To determine whether an NGAL co-factor is present in
the urine, apo-NGAL from BL21 bacteria was mixed with urine samples
from healthy mice. While the low molecular weight components of the
urine (<3 Kd) failed to trap .sup.55Fe above a 10 Kd cut-off
filter, and apo-NGAL diluted in Tris or phosphate buffer failed to
trap .sup.55Fe, incubation of NGAL with urine (<3,000 Da)
permitted the retention of .sup.55Fe, shown in FIG. 18A. The
capture of iron by NGAL was inhibited by the presence of 1000-fold
unlabeled iron citrate, and more powerfully by a 50-fold
concentration of iron-saturated enterochelin, shown in FIG. 18B.
The capture of iron was saturable, and when using 30 .mu.l of mouse
urine, approximately 20% of NGAL molecules bound iron. These
findings suggest that mouse urine contains a low molecular weight
co-factor that permits NGAL-iron interactions. Because the
endogenous factor is competitive with the bacterial siderophore,
which binds the calyx with high affinity (0.4 nM), it appears that
both bacterial and mammalian factors occupy the same binding pocket
of the lipocalin.
Example 16
[0193] NGAL expression in patients undergoing kidney
transplantation. Humans undergoing kidney transplantation were
evaluated to determine NGAL expression during the recovery period.
Kidney biopsies were obtained within 1 hour of transplantation from
living related donors (LRD, n=10) or cadaveric (CAD, n=12) kidney
transplants. Biopsy specimens were sectioned and
immunohistochemically stained with NGAL antibody. NGAL expression
was significantly increased in the CAD group, as shown in FIG. 19.
Since cadaveric kidneys are maintained outside the body for a
longer period of time than is typical for kidneys from living
related donors, the degree of ischemic injury is generally greater,
and was positively correlated by NGAL expression.
[0194] Western blots of urine samples obtained prior to
transplantation, and within 2 hours of transplantation from LRD
(n=4) or CAD (n=4) kidney transplants, shown in FIG. 20. NGAL
expression in the urine was absent before the operation. NGAL
expression was significantly increased in the CAD group compared to
the LRD group. Quantitation of urinary NGAL measured by Western
blots in LRD versus CAD showed a significantly increased expression
in CAD, shown in FIG. 21. Quantitation by ELISA demonstrated
similar results (not shown). This finding again correlated with the
longer period of ischemia associated with CAD kidney
transplantation. Correlation of urinary NGAL obtained 2 hours after
CAD transplantation with cold ischemia time, shown in FIG. 22.
[0195] The serum creatinine levels, which peaked at 2-4 days after
the transplant surgery occurred, also correlate with the urinary
NGAL. Correlation of urinary NGAL obtained 2 hours after CAD
transplantation with peak serum creatinine is shown in FIG. 23.
Example 17
[0196] Use of NGAL measurement as a diagnostic tool for Acute Renal
Failure. One of the unfortunate outcomes of cardiopulmonary bypass
(CPB) during open heart surgery is the development of acute renal
failure (ARF). Serum NGAL measurement can be highly predictive for
patients who at risk of developing ARF. Standard curves for NGAL
ELISA are shown in FIG. 24, the linear relationships obtained from
10 independent standard curves. Serial serum NGAL was measured in
samples from patients who developed ARF following CPB (n=10), shown
in FIG. 25. NGAL was markedly elevated in samples collected after
surgery, and remained elevated for at least 4 days. In contrast,
patients who did not develop ARF had no increases in serum NGAL
levels during the first 4 post-operative days. FIG. 26 shown
means.+-.SD for serial serum NGAL in patients who developed ARF
(n=10) versus those who had an uneventful postoperative course
(n=30) Serial urine NGAL measurements in patients who developed ARF
following CPB (n=11) was also elevated as shown in FIG. 27, but was
more variable than serum NGAL. However, urine NGAL levels were
predictive of ARF, as shown in FIG. 28, with and analysis of
means.+-.SD for serial urine NGAL in patients who developed ARF
(n=11) versus those who had an uneventful postoperative course
(n=30). Urine NGAL levels at 2 hr postoperative correlated with
length of CBP time during surgery, shown in FIG. 29.
[0197] While the present invention has been illustrated by the
description of embodiments and examples thereof, and while the
embodiments and examples have been described in considerable
detail, it is not intended to restrict or in any way limit the
scope of the appended claims to such detail. Additional advantages
and modifications will be readily apparent to those skilled in the
art. The invention in its broader aspects is therefore not limited
to the specific details, representative methods and structures, and
illustrated examples shown and described. Accordingly, departures
can be made from such details without departing from the scope or
spirit of the invention.
Sequence CWU 1
1
4120DNAMurinae gen. sp. 1ctcagaactt gatccctgcc 20220DNAMurinae gen.
sp. 2tccttgaggc ccagagactt 20320DNAMurinae gen. sp. 3ctaaggccaa
ccgtgaaaag 20420DNAMurinae gen. sp. 4tctcagctgr ggrggrgaag 20
* * * * *