U.S. patent application number 13/941213 was filed with the patent office on 2013-10-31 for multiple mesodermal lineage differentiation potentials for adipose tissue-derived stromal cells and uses thereof.
The applicant listed for this patent is Artecel Sciences Inc.. Invention is credited to Jeffrey Martin Gimble, Yuan-Di Chang Halvorsen, William O. Wilkison.
Application Number | 20130288262 13/941213 |
Document ID | / |
Family ID | 22532054 |
Filed Date | 2013-10-31 |
United States Patent
Application |
20130288262 |
Kind Code |
A1 |
Gimble; Jeffrey Martin ; et
al. |
October 31, 2013 |
Multiple Mesodermal Lineage Differentiation Potentials for Adipose
Tissue-Derived Stromal Cells and Uses Thereof
Abstract
The invention relates to methods and compositions for the
differentiation of stromal cells from adipose tissue into
hematopoietic supporting stromal cells and myocytes of both the
skeletal and smooth muscle type. The cells produced by the methods
are useful in providing a source of fully differentiated and
functional cells for research, transplantation and development of
tissue engineering products for the treatment of human diseases and
traumatic tissue injury repair.
Inventors: |
Gimble; Jeffrey Martin;
(Baton Rouge, LA) ; Halvorsen; Yuan-Di Chang;
(Holly Springs, NC) ; Wilkison; William O.;
(Bahama, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Artecel Sciences Inc. |
Durham |
NC |
US |
|
|
Family ID: |
22532054 |
Appl. No.: |
13/941213 |
Filed: |
July 12, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13085250 |
Apr 12, 2011 |
8486700 |
|
|
13941213 |
|
|
|
|
12209813 |
Sep 12, 2008 |
|
|
|
13085250 |
|
|
|
|
10327245 |
Dec 21, 2002 |
|
|
|
12209813 |
|
|
|
|
09638544 |
Aug 14, 2000 |
6555374 |
|
|
10327245 |
|
|
|
|
60149849 |
Aug 19, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/34; 435/7.21 |
Current CPC
Class: |
A61K 35/12 20130101;
C12N 5/0667 20130101; C12N 5/0647 20130101 |
Class at
Publication: |
435/6.12 ;
435/7.21; 435/34 |
International
Class: |
C12N 5/0789 20060101
C12N005/0789 |
Claims
1. A method for differentiating adipose tissue derived stromal
cells into hematopoietic supporting stromal cells which will
proliferate and differentiate along the myeloid lineage pathway or
the B-lineage lymphoid pathway, comprising: a) plating said stromal
cells at a density of about 30,000 cells per cm.sup.2 in chamber
slides; b) maintaining cells in culture for about 8 days in a
medium containing Dulbecco's Modified Eagle's Medium (DMEM) or
Ham's F-10; c) supplementing said medium with: (i) 1 to 20% fetal
bovine serum (ii) an antibiotic (iii) interleukins (iv) stem cell
factor (v) flt-3 ligand (vi) macrophage-colony stimulating factor
(vii) granulocyte-monocyte colony stimulating factor (viii)
erythropoetin (ix) thrombopoietin (x) osteoprotegerin ligand (xi)
dexamethasone (xii) hydrocortisone (xiii) 1,25 dihydroxy vitamin
D.sub.3 and (xiv) 2-mercaptoethanol; and d) examining the
expression of cell surface proteins which are consistent with cells
of the myeloid lineage or B-lymphoid lineage using a variety of
techniques which include but are not limited to
immunohistochemistry, flow cytometry, immunofluorescence and mRNA
expression in cell populations.
2. The method of claim 1, wherein said antibiotic is
penicillin.
3. The method of claim 1, wherein said antibiotic is
streptomycin.
4. The method of claim 2, wherein said penicillin is present in
amounts from about 10 to about 200 units per ml.
5. The method of claim 3, wherein said streptomycin is present in
amounts from about 10 .mu.g per ml to about 200 .mu.g per ml.
6. The method of claim 1, wherein said interleukins are selected
from the group consisting of: interleukin-1, interleukin-3,
interleukin-6, interleukin-7, interleukin-11 and
interleukin-12.
7. The method of claim 6, wherein the amount of interleukins is
present in amounts from about 5 pg/ml to about 1 ng/ml.
8. The method of claim 1, wherein said flt-3 ligand is present at
amounts from about 5 pg/ml to about 1 ng/ml.
9. The method of claim 1, wherein said stem cell factor is present
in amounts from about 5 pg/ml to about 1 ng/ml.
10. The method of claim 1, wherein said granulocyte-monocyte colony
stimulating factor is present in amounts from about 5 pg/ml to
about 1 ng/ml.
11. The method of claim 1, wherein said macrophage-colony
stimulating factor is present at amounts from about 5 pg/ml to
about 1 ng/ml.
12. The method of claim 1, wherein said erythropoietin is present
at amounts from about 5 units/ml to about 1000 units/ml.
13. The method of claim 1, wherein said thrombopoietin is present
at amounts from about 5 pg/ml to about 1 ng/ml.
14. The method of claim 1, wherein said osteoprotegerin ligand is
present from about 5 pg/ml to about 1 ng/ml.
15. The method of claim 1, wherein said dexamethasone is present
from about 1 nM to about 100 nM.
16. The method of claim 1, wherein said hydrocortisone is present
from about 1 nM to about 100 nM.
17. The method of claim 1, wherein said 1,25 dihydroxy vitamin
D.sub.3 is present in amounts from about 1 to about 10 nM.
18. The method of claim 1, wherein the 2-mercaptoethanol is present
from about 10 .mu.M to about 100 .mu.M.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 13/085,250 filed Apr. 12, 2011, now issued as
U.S. Pat. No. 8,486,700; which is a continuation application of
U.S. application Ser. No. 12/209,813 filed Sep. 12, 2008, now
abandoned; which is a divisional application of U.S. application
Ser. No. 10/327,245 filed Dec. 21, 2002, now abandoned; which is a
divisional application of U.S. application Ser. No. 09/638,544
filed Aug. 14, 2000, now issued as U.S. Pat. No. 6,555,374; which
claims the benefit under 35 USC .sctn.119(e) to U.S. Application
Ser. No. 60/149,849 filed Aug. 19, 1999, now expired. The
disclosure of each of the prior applications is considered part of
and is incorporated by reference in the disclosure of this
application.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The sequence listing associated with this application is
provided in text format in lieu of a paper copy and is hereby
incorporated by reference into the specification. The name of the
text file containing the sequence listing is ARTE1130-5_ST25.txt.
The text file is 6 KB, created on Jul. 3, 2013, and is submitted
herewith via EFS-Web.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] This invention relates to methods and compositions for the
differentiation of stromal cells from adipose tissue into
hematopoietic supporting stromal cells and myocytes of both the
skeletal and smooth muscle types.
[0005] 2. Background Information
[0006] The neonatal period in human development is characterized by
the presence of "stem" cells with the potential to develop along
multiple differentiation pathways. The terminal differentiation of
these cells is determined by cytokine and hormonal cues which
coordinate organogenesis and tissue architecture. Murine embryonic
stem cells have been isolated and studied extensively in vitro and
in vivo. Using exogenous stimuli in vitro, investigators have
induced ES cell differentiation along multiple lineage pathways.
These include neuronal, B lineage lymphoid, and adipocytes (Dani et
al. (1997) J Cell Sci. 110:1279; Remoncourt et al. (1998) Mech.
Dev. 79:185; O'Shea K S (1999) Anat. Rec. 257:32). The ES cells
have been manipulated in vivo by homologous recombination
techniques to generate gene specific null or "knock-out" mice
(Johnson R S (1989) Science 245:1234). Once ES cell clones lacking
a specific gene are isolated, they are transplanted into a
fertilized murine zygote. The progeny of this isolated ES cell can
develop into any and all murine tissues in a coordinated
manner.
[0007] A stem cell must meet the following criteria: (1) ability of
a clonal stem cell population to self-renew; (2) ability of a
clonal stem cell population to generate a new, terminally
differentiated cell type in vitro; and (3) ability of a clonal stem
cell population to replace an absent terminally differentiated cell
population when transplanted into an animal depleted of its own
natural cells.
[0008] Multipotential stem cells exist in tissues of the adult
organism. The best characterized example of a "stem cell" is the
hematopoietic progenitor isolated from the bone marrow and
peripheral blood. Seminal studies by Trentin, Till and McCulloch
(McCulloch et al. (1996) Proc. Can. Cancer Conf. 6:356-366; Curry
et al. (1967) J. Exp. Med. 125:703-720) examined lethally
irradiated mice. In the absence of treatment, these animals died
because they failed to replenish their circulating blood cells;
however, transplantation of bone marrow cells from a syngeneic
donor animal would rescue the host animal. The donor cells were
responsible for reconstituting all of the circulating blood cells.
A wealth of elegant studies have gone on to demonstrate that
donation of a finite number of undifferentiated hematopoietic stem
cells is capable of regenerating each of the eight or more
different blood cell lineages in a host. This work has provided the
basis for bone marrow transplantation, a widely accepted
therapeutic modality for the treatment of cancer and inborn errors
of metabolism in man. Thus, hematopoietic stem cells remain present
in the normal human bone marrow throughout life; they are not
limited to the neonatal period.
[0009] The recent development of entire organisms from a single
donor cell are consistent with this hypothesis. The "Dolly"
experiment showed that cells isolated from an ovine mammary gland
could develop into a mature sheep (Pennisi & Williams (1997)
Science 275:1415-1416). In similar murine studies, cells derived
from the corpus luteum of the ovary could, develop into a mature
mouse (Pennisi (1998) Science 281:495). These studies suggest that
stem cells with the ability to differentiate into any and all cell
types continue to exist in the adult organism. Thus, "embryonic"
stem cells may be retained throughout life.
[0010] In vitro experiments using cell lines of embryonic origin
indicate that a mesodermal stem cell may exist. Work by Taylor and
colleagues in the late 1970's demonstrated that murine embryonic
fibroblasts such as C3H10T1/2 or 3T3 cells would differentiate
along multiple mesodermal lineage pathways following exposure to 1
to 10 .mu.M of 5'-azacytadine (Constantinides et al. (1977) Nature
267:364; Jones & Taylor (1980) Cell 20:85). Within 2 to 4
weeks, isolated clones displayed a morphology consistent with
adipocyte, myocyte, chondrocyte or osteoblast differentiation.
Biochemical data provided additional support for the identification
of each of these lineages. This finding provided the basis for the
identification of the master-regulatory transcription factor for
skeletal muscle differentiation, myoD (Lassar (1986) Cell
47:649).
[0011] The adult bone marrow microenvironment is the potential
source for these hypothetical mesodermal stem cells. Cells isolated
from adult marrow are referred to by a variety of names, including
stromal cells, stromal stem cells, mesenchymal stem cells (MSCs),
mesenchymal fibroblasts, reticular-endothelial cells, and
Westen-Bainton cells (Gimble et al. (1996) Bone 19:421-428). In
vitro studies have determined that these cells can differentiate
along multiple mesodermal or mesenchymal lineage pathways. These
include, but are not limited to, adipocytes (fat cells) (Gimble et
al. (1990) Eur. J. Immunol. 20:379-386; Pittenger et al. (1999)
Science 284:143-147; Nuttall et al. (1998) JBMR 13:371-382; Park et
al. (1999) Bone 24:549-554), chondrocytes (cartilage forming cells)
(Dennis et al. (1999) JBMR 14:700-709), hematopoietic supporting
cells (Gimble et al. (1990) Eur. J. Immunol. 20:379-386), myocytes
(skeletal muscle) (Phinney (1999) J. Cell. Biochem. 72:570-585),
myocytes (smooth muscle) (Remy-Martin et al. (1999) Exp. Hematol.
27:1782-1795), and osteoblasts (bone forming cells) (Beresford
(1989) Clin Orthop Res 240:270-280; Owen (1988) J. Cell. Sci.
10:63-76; Dorheim et al. (1993) J. Cell. Physiol. 154:317-328;
Haynesworth et al. (1992) Bone 13:81-88, Kuznetsov et al. (1997)
JBMR 12:1335-1347). The bone marrow has been proposed as a source
of stromal stem cells for the regeneration of bone, cartilage,
muscle, adipose tissue, and other mesenchymal derived organs. The
major limitations to the use of these cells are the difficulty and
risk attendant upon bone marrow biopsy procedures and the
accompanying loss of memory B cells and hematopoietic stem cells
with present harvesting procedures.
[0012] Another viable alternative to the use of bone marrow
multipotential stem cells is adipose tissue. Adipose stromal cells
provide an easily accessible and abundant source of stromal cells
which can differentiate along multiple mesenchymal lineages.
Methods and compositions are needed for the consistent and
quantitative differentiation of adipose derived stromal cells into
various cell types including for example hematopoietic stromal
cells and skeletal and smooth muscle myocytes.
SUMMARY OF THE INVENTION
[0013] Compositions and methods for the differentiation of
adipocytes are provided. Generally, the present invention provides
methods and compositions for consistent and quantitative induction
of stromal cells derived from subcutaneous, mammary, gonadal, or
omental adipose tissues into the following fully differentiated and
functional mesodermal cell lineages: hematopoietic supporting
stromal cells, skeletal myocytes, and smooth muscle myocytes
(myofibroblasts).
[0014] The compositions include a variety of chemical components
which act as mitogens and differentiation inducing agents for the
plated stromal cells and yield production of the desired cell type.
The mitogens and inducing agents include, but are not limited to,
interleukins, flt-3 ligand, stem cell factor, macrophage-colony
stimulating factor, granulocyte-monocyte colony stimulating factor,
erythropoietin, thrombopoietin, osteoprotegerin ligand,
dexamethasone, hydrocortisone, 1,25 dihydroxy vitamin D.sub.3,
2-mercaptoethanol, glutamine, 5'-azacytadine, amphotericin,
transforming growth factor 13 and fibroblast growth factor.
[0015] The invention provides methods for determining the ability
of these compositions to direct the differentiation and function of
the adipose-derived stromal cells, for the transduction of viral
vectors carrying regulatory genes into stromal cells, for the
transfection of plasmid vectors carrying regulatory genes into
stromal cells, for the tracking and detection of functional
proteins encoded by these genes, and for developing biomechanical
carriers for the re-introduction of these cells into living
organisms.
[0016] The invention also provides methods and compositions which
have utility in drug discovery for compounds and proteins with
relevance to a wide spectrum of disease states including, but not
limited to, aplastic anemia, muscular dystrophy, radiation
poisoning, neuropathic muscular degeneration, urogenital
malformations, and gastrointestinal malformations.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1. Human adipose-derived stromal cells were cultured in
6 well plates until confluent and quiescent in DMEM/F 10(1:1
vol:vol), 10% fetal bovine serum, penicillin 100 units/ml,
streptomycin 100 .mu.g/ml, and 7.5 mM HEPES pH 7.2. The cells were
then incubated in DMEM/F 10 (1:1 vol:vol), 2% fetal bovine serum,
penicillin 100 units/ml, streptomycin 100 .mu.g/ml, and 7.5 mM
HEPES pH 7.2 containing 100 ng/ml lipopolysaccharide (LPS). Cells
were harvested immediately (time "0") or after 4 hours (time "4")
for total RNA extraction and isolation using a
phenol/chloroform/acid procedure (Chomczynski & Sacchi (1987)
Analytical Biochem 162:156-159). Equal aliquots of total RNA were
reverse transcribed and amplified by polymerase chain reaction with
the following primer sets specific for the indicated human mRNAs;
the actin primers served as a positive control for equal loading
between samples:
TABLE-US-00001 [0018] Actin Forward 5' AGTAACAGCCCACGGTGTTC 3'
Reverse 5' AGCCTCCGAAAGGAAATTGT 3' Interleukin 6 (IL-6) Forward 5'
GTAGCCGCCCCACACAGACAGCC 3' Reverse 5' GCCATCTTTGGAAGGTTCAGG 3'
Interleukin 8 (IL-8) Forward 5' TCTGCAGCTCTGTGTGAAGGT 3' Reverse 5'
TGAATTCTCAGCCCTCTTCAA 3' Granulocyte Colony Stimulating Factor
(G-CSF) Forward 5' AGCTTCCTGCTCAAGTGCTTAGAG 3' Reverse 5'
TTCTTCCATCTGCTGCCAGATGGT 3' Macrophage Colony Stimulating Factor
(M-CSF) Forward 5' TTGGGAGTGGACACCTGCAGTCT 3' Reverse 5'
CCTTGGTGAAGCAGCTCTTCAGCC 3' Granulocyte/Monocyte Colony Stimulating
Factor (GM-CSF) Forward 5' GTCTCCTGAACCTGAGTAGAGACA 3' Reverse 5'
AAGGGGATGACAAGCAGAAAGTCC 3' Flt3 Ligand Forward 5'
TGGAGCCCAACAACCTATCTC 3' Reverse 5' GGGCTGAAAGGCACATTTGGT 3'
Leukemia Inhibitory Factor (LIF) Forward 5'
AACAACCTCATGAACCAGATCAGGAGC 3' Reverse 5'
ATCCTTACCCGAGGTGTCAGGGCCGTAGG 3'
[0019] The resulting PCR products were electrophoresed on a 2%
agarose gel, stained with ethidium bromide and photographed.
[0020] Table 1. Characterization of Adipose Derived Stromal Cell
Surface Markers Based on Antibody and PCR Detection. The listed
cell surface proteins and genes analyzed in human adipose derived
stromal cells is based on immunohistochemical staining, flow
cytometry, and/or by polymerase chain reaction. Markers are divided
among those expressed (listed as "positive") and not expressed
(listed as "negative").
[0021] Table 2. Cytokines Expressed by Adipose-Derived Stromal
Cells Constitutively or Following Endotoxin (LPS) Induction. The
listed cytokines were analyzed in total RNA isolated from human
adipose derived stromal cells following induction with 100 ng/ml of
lipopolysaccharide. The cytokines listed in the table were detected
using the oligonucleotide primers listed. All cytokines were
expressed either in a constitutive or inducible manner.
[0022] Table 3. Quantitative ELISA (pg/ml) LPS Induction of
Adipose-Derived Stromal Cell Secreted Cytokines. The listed
cytokines were assayed in conditioned medium from human adipose
derived stromal cells induced for 0 to 24 hours with 100 ng/ml of
LPS. All cytokines were detected by enzyme linked immunoassay
(ELISA) and are expressed as pg/ml of conditioned medium. Those
cytokines indicated by an "*" demonstrated significant increases
relative to the 0 hour time point within the 24 hour induction
period based on one way analysis of variance.
DETAILED DESCRIPTION OF THE INVENTION
[0023] The present invention provides methods and compositions for
the differentiation and culture of adipose tissue-derived stromal
cells into (a) hematopoietic supporting stromal cells, (b) skeletal
myocytes, and (c) smooth muscle myocytes (myofibroblasts).
[0024] Adipose tissue offers a potential alternative to the bone
marrow as a source of multipotential stromal stem cells. Adipose
tissue is readily accessible and abundant in many individuals.
Obesity is a condition of epidemic proportions in the United
States, where over 50% of adults exceed the recommended BMI based
on their height. Adipocytes can be harvested by liposuction on an
outpatient basis. This is a relatively non-invasive procedure with
cosmetic effects which are acceptable to the vast majority of
patients. It is well documented that adipocytes are a replenishable
cell population. Even after surgical removal by liposuction or
other procedures, it is common to see a recurrence of adipocytes in
an individual over time. This suggests that adipose tissue contains
stromal stem cells which are capable of self-renewal. Pathologic
evidence suggests that adipose-derived stromal cells are capable of
differentiation along multiple mesenchymal lineages. The most
common soft tissue tumor, liposarcomas, develop from adipocyte-like
cells. Soft tissue tumors of mixed origin are relatively common.
These may include elements of adipose tissue, muscle (smooth or
skeletal), cartilage, and/or bone. Just as bone forming cells
within the bone marrow can differentiate into adipocytes or fat
cells, the extramedullary adipocytes are capable of forming bone.
In patients with a rare condition known as paroxysmal osseous
heteroplasia, subcutaneous adipocytes form bone for unknown reasons
(Kaplan (1996) Arch. Dermatol. 132:815-818).
[0025] Adult human extramedullary adipose tissue-derived stromal
cells represent a stromal stem cell source which can be harvested
routinely with minimal risk to the patient. They can be expanded ex
vivo, differentiated along unique mesodermal lineage pathways,
genetically engineered, and re-introduced into individuals as
either an autologous or allogeneic transplantation. This invention
presents examples of methods and composition for the isolation,
characterization, and differentiation of adult human extramedullary
adipose tissue stromal cells along the mesodermal lineages and
outlines their use for the treatment of a number of human
conditions and diseases.
[0026] The cells produced by the methods of invention are useful in
providing a source of fully differentiated and functional cells for
research, transplantation, and development of tissue engineering
products for the treatment of human disease and traumatic injury
repair. Thus, in one aspect, the invention provides a method for
differentiating adipose tissue-derived stromal cells into one of
three functionally distinct mesodermal cell lineages: hematopoietic
supporting cells, myocytes (skeletal), and myocytes (smooth muscle
myofibroblasts) comprising: culturing said cells in a composition
which comprises a medium (a) capable of supporting the growth of
stromal cells and hematopoietic cells in co-culture with factors
present capable of inducing stromal expression of hematopoietic
growth factors or the addition of exogenous growth factors
directly; (b) capable of supporting the growth and differentiation
of stromal cells into functional and proliferating skeletal
myocytes; and (c) capable of supporting the growth and
differentiation of stromal cells into functional and proliferating
smooth muscle myocytes or myofibroblasts.
[0027] In another aspect, the invention provides compositions for
the differentiation of adipose tissue-derived stromal cells into
each of the three different mesodermal derived lineages. Such
compositions comprise:
[0028] (a) adipose tissue-derived stromal cells, a medium capable
of supporting the growth of the stromal cells, and growth factors
and agents capable of inducing stromal cell expression of
hematopoietic growth factors or exogenous hematopoietic growth
factors or non-peptide factors themselves.
[0029] (b) adipose tissue-derived stromal cells, a medium capable
of supporting the growth of the stromal cells, and amounts of 5'
azacytadine and/or amphotericin or other agents sufficient to
induce the differentiation of said stromal cells into skeletal
muscle myocytes.
[0030] (c) adipose tissue-derived stromal cells, a medium capable
of supporting the growth of the stromal cells, and amounts of
transforming growth factor .beta. or other peptide growth factors
sufficient to induce the differentiation of said stromal cells into
smooth muscle myocytes or myofibroblasts.
[0031] The methods comprise incubation of isolated adipose
tissue-derived stromal cells, plated at densities of about 1,000 to
25,000 cells/cm.sup.2 in medium consisting of the following for
each lineage:
[0032] (a) Hematopoietic supporting stromal cell--Glucose,
hematopoietic inducing cytokines, including but not limited to,
interleukins-1, 3, 6, 7, 11, 12, stem cell factor, flt-3 ligand,
macrophage colony stimulating factor, granulocyte-monocyte colony
stimulating factor, thrombopoietin, erythropoietin, osteoprotegerin
ligand, 1,25 dihydroxy vitamin D.sub.3, and 2-mercaptoethanol. The
medium may also contain hydrocortisone, dexamethasone, and
osteoprotegerin ligand. Cells are maintained at temperatures of
33.degree. C. (for myeloid cells) or 37.degree. C. (for B-lineage
lymphoid cells).
[0033] (b) Myocytes, Skeletal--Glucose, 5'-azacytadine or
amphotericin for a limited exposure period with manipulation of
fetal bovine serum of concentrations between 0% and 20%. The medium
may also include, but is not limited to, an antibiotic (as for
example penicillin or streptomycin), glutamine, sodium pyruvate,
and 2-mercaptoethanol.
[0034] (c) Myocytes, Smooth Muscle/Myofibroblasts--Glucose and 10%
fetal bovine serum in the presence of a collagen, gelatin, laminin,
fibronectin or other susbtratum or 3-dimensional matrix.
[0035] "Adipose stromal cells" refers to stromal cells that
originate from adipose tissue. By "adipose" is meant any fat
tissue. The adipose tissue may be brown or white adipose tissue,
derived from subcutaneous, omental/visceral, mammary, gonadal, or
other adipose tissue site. Preferably, the adipose is subcutaneous
white adipose tissue. Such cells may comprise a primary cell
culture or an immortalized cell line. The adipose tissue may be
from any organism having fat tissue. Preferably, the adipose tissue
is mammalian, most preferably the adipose tissue is human. A
convenient source of adipose tissue is from liposuction surgery,
however, the source of adipose tissue or the method of isolation of
adipose tissue is not critical to the invention. If stromal cells
are desired for autologous transplantation into a subject, the
adipose tissue will be isolated from that subject.
[0036] "Hematopoietic supporting stromal cell" refers to stromal
cells that are capable of supporting the proliferation and
maturation of hematopoietic progenitor, also known as hematopoietic
stem cells, derived from bone marrow, spleen, peripheral blood, or
umbilical blood, either CD34+ or CD34-. Co-cultures of
hematopoietic supporting stromal cells with hematopoietic
progenitors would result in the production of both adherent and
non-adherent populations of hematopoietic blood cells, including
but not limited to myeloid (macrophage, neutrophil, osteoclast),
erythroid (red blood cells), lymphoid (B-lymphoid, T-lymphoid), and
platelet (megakaryocyte), as well as eosinophils, basophils, mast
cells and other circulating blood cell types. Growth and
differentiation of hematopoietic cells will be determined by assays
which include, but are not limited to, those that assess the
surface expression of characteristic blood cell lineage specific
proteins (such as CD45 for B lineage lymphocytes, T cell receptor
for T lineage lymphocytes, Mac-I/LFA11 for macrophages, tartrate
resistant acid phosphatase for osteoclasts). Proliferation of
hematopoietic stem cells will be assessed in vitro by evidence that
co-culture derived hematopoietic cells can continue to expand to
multiple blood cell lineages when plated onto a fresh hematopoietic
supporting stromal cell layer and in vivo based on the ability of
co-culture derived hematopoietic cells to repopulate the bone
marrow and rescue a lethally irradiated animal host lacking its own
blood cells.
[0037] "Myocytes (skeletal)" refers to cells that are capable of
expressing characteristic biochemical markers of skeletal muscle,
including but not limited to the transcription factors myoD and
myogenin, skeletal actin, myosin light chain kinase, and myosin
heavy chain kinase, characteristic morphologic markers of skeletal
muscle, including but not limited to multinucleated complexes and
sarcomeres, and able to exhibit contractile function spontaneously
or in response to exogenous factors such as acetylcholine.
[0038] "Myocytes (smooth muscle, myofibroblasts)" refers to cells
that are capable of expressing characteristic biochemical markers
of smooth muscle, including but not limited to .alpha.-smooth
muscle actin, fibronectin, and .beta.-1 integrin, characteristic
morphologic markers of smooth muscle, including but not limited to
the formation of stress fibers in culture, and able to exhibit
characteristic smooth muscle functions, including but not limited
to the generation of tensile stress on collagen lattices in
vitro.
[0039] "Hematopoietic growth factors" refers to cytokines, hormones
and other protein agents. These may be derived directly from
stromal cells in the co-culture system or added to co-cultures at
concentrations determined by the investigator and obtained as
enriched or purified proteins developed from recombinant or natural
sources. These will include but are not limited to the following
cytokines and hormones: interleukin 7 for the growth of B lineage
lymphocytes; stem cell factor for all hematopoietic lineages; M-CSF
for macrophages and osteoclasts; osteoprotegerin ligand for
osteoclasts; erythropoietin for erythrocytes; thrombopoietin for
platelets and megakaryocytes; interleukin 6 for platelets,
megakaryocytes, and B lineage lymphocytes. Optimal concentrations
and length of treatment may be determined by the practitioner
through the use of known assays for the differentiation of each
blood cell lineage.
[0040] "Non-peptide growth factors" refers to steroids, retinoids
and other chemical compounds or agents which induce the
differentiation of blood cell lineages. It is generally recognized
that concentrations may vary. Moreover, it is generally recognized
that the compounds or agents will be added in amounts sufficient to
stimulate differentiation. Generally, however, these will be used
at concentrations ranging from about 1 nM to about 100 nM for 1,25
dihydroxy vitamin D.sub.3, about 1 nM to about 100 nM
dexamethasone, about 1 nM to about 100 nM hydrocortisone, about 1
nM to about 100 nM retinoic acid, about 1 nM to about 100 nM 9-cis
retinoic acid, or at concentrations to be determined and optimized
by the practitioner.
[0041] Amounts of 5' azacytadine and/or amphotericin sufficient to
induce differentiation refers to concentrations of 5' azacytadine
and amphotericin, that when supplied in a medium capable of
supporting the growth of stromal cells (e.g., NIH-3T3, C3H 10T1/2,
human adipose tissue-derived stromal cells and the like), will
induce the differentiation of said stromal cells into skeletal
muscle myoblasts and myocytes over a period of about 1 to 6 weeks.
Typical use concentrations for 5' azacytadine range from about 1
.mu.M to about 30 .mu.M. Typical use concentrations for
amphotericin range from about 10 ng/ml to about 100 ng/ml. Optimal
concentrations and length of exposure may be determined by the
practitioner through the use of known assays for the
differentiation of skeletal muscle myoblasts. Such assays include,
but are not limited to, those that assess the morphological or
biochemical characteristics associated with skeletal muscle (e.g.,
formation of multinucleated myotubules, expression of myosin heavy
chain, expression of myoD at the protein or RNA level).
[0042] "Amounts of transforming growth factor f3 or other peptide
growth factors sufficient to induce differentiation" refers to
concentrations of transforming growth factor .beta. or other
peptides, that when supplied to medium capable of supporting the
growth of stromal cells (e.g., NIH-3T3, C3H 10T1/2, human adipose
tissue-derived stromal cells and the like), will induce the
differentiation of said stromal cells into smooth muscle myocytes
or myofibroblasts over a period of 1 day to 6 weeks. Typical use
concentrations for transforming growth factor range from about 20
ng/ml to about 40 ng/ml. Typical use concentrations for fibroblast
growth factor range from about 20 ng/ml to about 40 ng/ml. Optimal
concentrations and length of exposure may be determined by the
practitioner through the use of known assays for the
differentiation of smooth muscle myoblasts. Such assays include,
but are not limited to, those that assess the morphological or
biochemical characteristics associated with smooth muscle (e.g.,
expression of a smooth muscle actin and fibronectin, generation of
contractile forces when placed in collagen lattices in the presence
of thrombin or lysophosphatidic acid).
[0043] Any medium capable of supporting stromal cells in tissue
culture may be used. Media formulations that will support the
growth of fibroblasts include, but are not limited to, Dulbecco's
Modified Eagle's Medium (DMEM), alpha modified Minimal Essential
Medium (aMEM), and Roswell Park Memorial Institute Media 1640 (RPMI
Media 1640) and the like. Typically, 0 to 20% Fetal Bovine Serum
(FBS) will be added to the above media in order to support the
growth of stromal cells and hematopoietic cells. However, a defined
medium could be used if the necessary growth factors, cytokines,
and hormones in FCS for stromal cell and hematopoietic cell growth
are identified and provided at appropriate concentrations in the
growth medium.
[0044] Media useful in the methods of invention may contain one or
more compounds of interest, including, but not limited to,
antibiotics, compounds that are mitogenic for hematopoietic; stem
cells, differentiation inducing for hematopoietic stem cells,
and/or mitogenic or differentiative for stromal cells. Example of
antibiotics useful in the invention include but are not limited to
penicillin and streptomycin. Penicillin is typically used at about
10 units/ml to about 200 units/ml. Streptomycin is typically used
at about 10 .mu.g/ml to 200 .mu.g/ml. Examples of hematopoietic
mitogenic factors include but are not limited to stem cell factor
and interleukin 3; hematopoietic differentiation inducing factors
include but are not limited to 1,25 dihydroxy vitamin D.sub.3,
interleukin 7, and osteoprotegerin ligand; stromal cell mitogens
include but are not limited to transforming growth factor .beta.;
and stromal cell differentiating factors include but are not
limited to dexamethasone, hydrocortisone, transforming growth
factor .beta., and the like.
[0045] "Adipose tissue-derived stromal cells, a medium capable of
supporting the growth of the stromal cells, and growth factors and
agents capable of inducing stromal cell expression of hematopoietic
growth factors or exogenous hematopoietic growth factors or
non-peptide factors themselves" refers to growth factors, both
peptide and chemical in composition, which enhance the
proliferation and maturation of hematopoietic stem cells in vitro
and in vivo. These include, but are not limited to, interleukin 1,
interleukin 3, interleukin 6, interleukin 7, interleukin 11,
macrophage colony stimulating factor (M-CSF), granulocyte-monocyte
colony stimulating factor (GM-CSF), stem cell factor, flt3 ligand,
thrombopoietin, erythropoietin, osteoprotegerin ligand,
dexamethasone, hydrocortisone, and 1,25 dihydroxy vitamin D.sub.3.
The concentrations of these factors and the length of time of
exposure will be determined and optimized by the investigators.
Interleukins, M-CSF, GM-CSF, Flt 3 ligand and stem cell factor are
used at about 5 pg/ml to about 1 ng/ml. Thrombopoietin is typically
used at concentrations ranging from about 5 pg/ml to about 1 ng/ml.
Erythropoietin is used at about 5 units/ml to about 1000 units/ml.
Osteoprotegerin ligand is used at about 5 pg/ml to about 1 ng/ml.
Dexamethasone, hydrocortisone, and 1,25 dihydroxy vitamin D.sub.3
are at concentrations from about 1 nM to about 100 nM. Optimal
concentrations and treatment times will be determined by monitoring
the production of specific circulating blood cell lineages in the
co-cultures of hematopoietic stem cells and adipose tissue-derived
stromal cells. It is generally recognized that these factors will
be added in amounts sufficient to stimulate differentiation. Such
assays and indices include, but are not limited to, those that
assess the morphological or biochemical characteristics of the
cells, such as the expression of cell surface proteins unique to
specific blood cell lineages by flow cytometry,
immunohistochemistry, and/or immunofluorescent methods, expression
of specific mRNAs in the cell population, or by in vivo assessment
of the production of hematopoietic stern cells by the co-culture
system.
[0046] "Adipose tissue-derived stromal cells, a medium capable of
supporting the growth of the stromal cells, and amounts of
azacytadine and/or amphotericin or other agents sufficient to
induce the differentiation of said stromal cells into skeletal
muscle myocytes" refers to the differentiation inducing agents used
to promote expression of skeletal muscle specific gene markers and
skeletal muscle function in vitro. The medium comprises fetal
bovine serum, antibiotic, L-glutamine, sodium pyruvate,
2-mercaptoethanol, and 5' azacytadine or amphotericin. Fetal bovine
serum can be used at concentrations ranging from 0.5% to 20%. The
antibiotic typically used, but not limited to, is penicillin or
streptomycin. Penicillin is typically used at concentrations
ranging from about 10 units/ml to about 200 units/ml. Streptomycin
is typically used in concentrations ranging from about 10 .mu.g/ml
to about 200 .mu.g/ml. L-glutamine and sodium pyruvate are
typically used at 0.5 mM to about 2 mM. 2-mercaptoethanol is
typically used at about 10 .mu.M to about 100 .mu.M. 5' azacytadine
is typically used at about 1 .mu.M to about 30 .mu.M. Amphotericin
is typically used at about 10 ng/ml to about 100 ng/ml. The
concentrations of these factors and the length of time of exposure
will be determined and optimized by the investigators. Optimal
concentration and treatment times will be determined by monitoring
the morphologic and biochemical markers characteristic of skeletal
muscle. These include, but are not limited to, the production of
multi-nucleated myotubules in culture and the expression of muscle
specific genes and proteins, such as muscle transcription factors
(myoD, myogenin), myosin light chain kinase, myosin heavy chain
kinase, and skeletal muscle actin.
[0047] "Adipose tissue-derived stromal cells, a medium capable of
supporting the growth of the stromal cells, and amounts of
transforming growth factor .beta. or other peptide growth factors
sufficient to induce the differentiation of said stromal cells into
smooth muscle myocytes or myofibroblasts" refers to the
differentiation inducing conditions used to promote the expression
of smooth muscle associated gene markers and proteins and smooth
muscle function in vitro. The concentrations of factors and the
length of time of exposure will be determined and optimized by the
investigators. Optimal concentration and treatment times will be
determined by monitoring the morphologic and biochemical markers
characteristic of smooth muscle cells. These include, but are not
limited to, the generation of tensile forces by the cells when
placed in a collagen type I lattice and the expression of smooth
muscle specific genes and proteins, such as smooth muscle actin,
fibronectin, and laminin.
[0048] Preferably, the adipose tissue derived stromal cells are
isolated from the adipose tissue of the subject into which the
final differentiated cells are to be introduced. However, the
stromal cells may also be isolated from any organism of the same or
different species as the subject. Any organism with adipose tissue
can be a potential candidate. Preferably, the organism is
mammalian, most preferably the organism is human.
[0049] The adipose tissue derived stromal cells may be stably or
transiently transfected or transduced with a nucleic acid of
interest using a plasmid, viral or alternative vector strategy.
Nucleic acids of interest include, but are not limited to, those
encoding gene products which: (1) enhance the growth,
differentiation, maturation and proliferation of hematopoietic cell
lineages; examples include osteoprotegerin ligand which induces
osteoclast development, interleukin 7, which induces B lineage
lymphocyte development, erythropoietin, which induces erythrocyte
development, and thrombopoietin, which induces platelet
development; (2) enhance the differentiation of skeletal muscle;
examples include myoD and myogenin, transcription factors which
promote myotubule formation and expression of skeletal muscle
specific genes; (3) enhance the growth, differentiation and
maturation of smooth muscle cells; examples include transforming
growth factor .beta., which induces smooth muscle proliferation and
extracellular matrix production.
[0050] The blood cells produced by in vitro co-cultures of
hematopoietic stem cells and adipose tissue derived stromal cells
can be introduced alone or in combination with the stromal
component into subjects subject to anemia or limited blood cell
production. These may include, but are not limited to, patients
receiving high dose chemotherapy, patients undergoing bone marrow
transplantation, patients suffering from aplastic anemia, patients
suffering from sickle cell anemia, and other blood dyscrasias.
[0051] Other disorders which may be treated with infusion of stem
cells include, but are not limited to, diseases resulting from a
failure or a dysfunction of normal blood cell production and
maturation (i.e., aplastic anemia and hypoproliferative stem cell
disorders); neoplastic, malignant diseases in the hematopoietic
organs (e.g., leukemia and lymphomas); broad spectrum malignant
solid tumors of non-hematopoietic origin; autoimmune conditions;
and genetic disorders. Such disorders include, but are not limited
to diseases resulting from a failure or dysfunction of normal blood
cell production and maturation hyperproliferative stem cell
disorders, including aplastic anemia, pancytopenia,
agranulocytosis, thrombocytopenia, red cell aplasia,
Blackfan-Diamond syndrome, due to drugs, radiation, or infection,
idiopathic; hematopoietic malignancies including acute
lymphoblastic (lymphocytic) leukemia, chronic lymphocytic leukemia,
acute myelogenous leukemia, chronic myelogenous leukemia, acute
malignant myelosclerosis, multiple myeloma, polycythemia vera,
agnogenic myelometaplasia, Waldenstrom's macroglobulinemia,
Hodgkin's lymphoma, non-Hodgkin's lymphoma; immunosuppression in
patients with malignant, solid tumors including malignant melanoma,
carcinoma of the stomach, ovarian carcinoma, breast carcinoma,
small cell lung carcinoma, retinoblastoma, testicular carcinoma,
glioblastoma, rhabdomyosarcoma, neuroblastoma, Ewing's sarcoma,
lymphoma; autoimmune diseases including rheumatoid arthritis,
diabetes type I, chronic hepatitis, multiple sclerosis, systemic
lupus erythematosus; genetic (congenital) disorders including
anemias, familial aplastic, Fanconi's syndrome, Bloom's syndrome,
pure red cell aplasia (PRCA), dyskeratosis congenita,
Blackfan-Diamond syndrome, congenital dyserythropoietic syndrome
I-IV, Chwachmann-Diamond syndrome, dihydrofolate reductase
deficiencies, formamino transferase deficiency, Lesch-Nyhan
syndrome, congenital spherocytosis, congenital elliptocytosis,
congenital stomatocytosis, congenital Rh null disease, paroxysmal
nocturnal hemoglobinuria, G6PD (glucose-6-phosphate dehydrogenase)
variants 1, 2, 3, pyruvate kinase deficiency, congenital
erythropoietin sensitivity, deficiency, sickle cell disease and
trait, thalassemia alpha, beta, gamma, met-hemoglobinemia,
congenital disorders of immunity, severe combined immunodeficiency
disease (SCID), bare lymphocyte syndrome, ionophore-responsive
combined immunodeficiency, combined immunodeficiency with a capping
abnormality, nucleoside phosphorylase deficiency, granulocyte actin
deficiency, infantile agranulocytosis, Gaucher's disease, adenosine
deaminase deficiency, Kostmann's syndrome, reticular dysgenesis,
congenital leukocyte dysfunction syndromes; and others such as
osteopetrosis, myelosclerosis, acquired hemolytic anemias, acquired
immunodeficiencies, infectious disorders causing primary or
secondary immunodeficiencies, bacterial infections (e.g.,
Brucellosis, Listerosis, tuberculosis, leprosy), parasitic
infections (e.g., malaria, Leishmaniasis), fungal infections,
disorders involving disproportions in lymphoid cell sets and
impaired immune functions due to aging, phagocyte disorders,
Kostmann's agranulocytosis, chronic granulomatous disease,
Chediak-Higachi syndrome, neutrophil actin deficiency, neutrophil
membrane GP-180 deficiency, metabolic storage diseases,
mucopolysaccharidoses, mucolipidoses, miscellaneous disorders
involving immune mechanisms, Wiskott-Aldrich Syndrome, alpha
1-antitryp sin deficiency, etc.
[0052] The skeletal muscle cells produced by in vitro manipulation
of the adipose tissue derived stromal cells can be introduced alone
or in combination with a composition matrix to repair muscle
defects secondary to metabolic diseases (muscular dystrophy,
myositis), trauma, and disuse atrophy. Such compositions include,
but are not limited to, collagen matrices, poly-lactic polymers,
poly-glycolic polymers, alginate, or other solid supports.
[0053] The smooth muscle cells produced by in vitro manipulation of
the adipose tissue derived stromal cells can be introduced alone or
in combination with a composition matrix to repair smooth muscle
defects. These defects may include, but are not limited to, urinary
bladder wall abnormalities due to hereditary malformations in
neonates or secondary to trauma or tumor invasion in older
individuals, gastrointestinal tract abnormalities due to hereditary
malformations in neonates or secondary to trauma or tumor invasion
in older individuals, genital tract abnormalities (vaginal) due to
hereditary malformations in neonates, secondary to trauma or tumor
invasion, or for tissue reconstructive surgeries in transgender
operations, or for the development of functional large veins for
grafting purposes. Composition matrices may include, but are not
limited to, collagen matrices such as swine intestinal submucosa,
poly-lactic polymers, poly-glycolic polymers, alginate, or other
solid supports.
[0054] Another object of the invention is to provide methods for
the identification and study of compounds that enhance or inhibit
the differentiation of adipose tissue derived stromal cells into
either hematopoietic supporting stromal cells, skeletal muscle
myocytes, or smooth muscle myocytes. Compounds which enhance
differentiation: (a) hematopoietic supporting stromal cell function
may be of value in the treatment of blood dyscrasias characterized
by decreased production of circulating blood cells and improve
recovery of patients following high dose chemotherapy; (b) skeletal
muscle myocytes may be of value in the treatment of musculoskeletal
diseases secondary to hereditary defects or trauma; or (c) smooth
muscle myocytes may be of value in the treatment of smooth muscle
defects, including those of the urinary bladder (bladder wall),
gastrointestinal tract (colon, small intestine), and genital system
(vaginal). Conversely, compounds which inhibit differentiation of
(a) hematopoietic supporting stromal cells may be of value in the
treatment of blood dyscrasias characterized by overproduction of
circulating blood cells, such as polycythemia vera; (b) skeletal
muscle may be of value in the treatment of soft tissue tumors of
skeletal muscle origin, such as rhabdomyosarcomas; and (c) smooth
muscle may be of value in the treatment of soft tissue tumors of
smooth muscle origin, such as leiomyosarcomas.
[0055] Any compound may be tested for its ability to affect the
differentiation of adipose tissue derived stromal cells into either
hematopoietic supporting stromal cells, skeletal muscle myocytes,
or smooth muscle myocytes. Appropriate vehicles compatible with the
compound to be tested are known to those skilled in the art and may
be found in the current edition of Remington's Pharmaceutical
Sciences, the contents of which are incorporated herein by
reference.
[0056] The features and advantages of the present invention will be
more clearly understood by reference to the following examples,
which are not to be construed as limiting the invention.
EXAMPLES
Example 1
Expression of Cell Surface Adhesion Molecules and Hematopoietic
Cytokines by Adipose Tissue-Derived Stromal Cells In Vitro
[0057] Stromal cells are isolated from human subcutaneous adipose
tissue according to methods described in "Methods and Compositions
for the Differentiation of Human Preadipocytes into Adipocytes"
Ser. No. 09/240,029, filed Jan. 29, 1999. These cells are plated at
a density of 30,000 cells per cm.sup.2 in chamber slides, in 6 well
tissue culture plates, or in T25 cm.sup.2 flasks. Cells are
maintained in culture for 8 days in DMEM/Ham's F-10 supplemented
with 10% fetal bovine serum, penicillin 100 units/ml, streptomycin
100 .mu.g/ml, and 7.5 mM HEPES pH 7.2. The surface proteins
expressed by the stromal cells are determined by immunologic
techniques based on immunohistochemistry and/or flow cytometry. For
immunohistochemical analysis, chamber slides are fixed using 95%
ethanol/5% glacial acetic acid and incubated with murine monoclonal
antibodies detecting human cell surface proteins. After incubation
with an enzyme coupled anti-mouse secondary antibody, evidence of
protein expression is detected by histochemical reaction.
Alternatively, flasks of cells are harvested by trypsin/EDTA
digestion and incubated with a fluorescent conjugated murine
monoclonal antibody detecting a specific human surface protein.
Cells are examined for fluorescent intensity by flow cytometry. The
results of these assays are summarized in Table 1. These studies
demonstrate that adipose-derived stromal cells express cell surface
proteins associated with and essential for hematopoietic support
function by bone marrow stromal cells (Miyake et al. (1990) J Exp
Med 171:477-488; Miyake et al. (1991) J Exp Med 173:599-607; Miyake
et al. (1991) J Cell Biol 114:557-565, 1991; Jacobsen et al. (1992)
J Exp Med 176:927-935; Kincade et al. (1993) Curr Top Microbiol
Immunol 184:215-222; Hayashi et al. (2000) Leuk Lymphoma
38:265-270) these include VCAM1, CD44, integrin .beta.1, integrin
.alpha.4,5 (VLA-4, VLA-5), and CD9, among others.
[0058] The cytokine expression profile of the adipose-derived
stromal cells is determined following induction with
lipopolysaccharide (LPS) or endotoxin, an inflammatory agent
capable of inducing hematopoietic cytokines in bone marrow stromal
cells (Gimble et al. (1989) Blood 74:303-311). Confluent and
quiescent cultures of cells are exposed to 100 ng/ml LPS for
periods of 0 to 24 hours in DMEM medium supplemented with 2% fetal
bovine serum, 100 .mu.g/ml streptomycin, 100 units/ml penicillin,
and 7.5 mM HEPES pH 7.2. The conditioned medium from each culture
is harvested and stored at -80.degree. C. while the total RNA is
harvested by the method of Chomczynski and Sacchi (See Anal.
Biochem. (1987) 162:156-159). The mRNA for the cytokines indicated
in Table 2 is detected by polymerase chain reaction using the
oligonucleotide primer sets listed below the table. A
representative set of reactions is demonstrated in FIG. 1. The
following cytokines demonstrated significant LPS inducible
expression of immunoreactive protein based on enzyme linked
immunoassay: macrophage colony stimulating factor (M-CSF),
granulocyte/monocyte colony stimulating factor (GM-CSF),
interleukin 6, 7, and 8 (IL-6, 7, 8). The profile of cytokines
expressed by the adipose derived stromal cells is consistent that
of bone marrow-derived stromal cells capable of supporting myeloid,
lymphoid, and osteoclast proliferation and differentiation in vitro
(Pietrangeli et al. (1988) Eur. J. Immunol. 18:863-872; Gimble et
al. (1989) Blood 74:303-311; Gimble et al. (1992) J. Cell Biochem
50:73-82; Kelly et al. (1998) Endocrinol. 139:2092-2101).
Example 2
Establishment of Myelopoietic Co-Cultures with an Adipose
Tissue-Derived Stromal Cells Layer In Vitro
[0059] Stromal cells are isolated from human subcutaneous adipose
tissue according to methods described in "Methods and Compositions
for the Differentiation of Human Preadipocytes into Adipocytes"
Ser. No. 09/240,029, filed Jan. 29, 1999. These cells are plated at
a density of 500 to 20,000 cells per cm.sup.2. Stromal cells are
established in the cultures for 1 to 3 days prior to the
introduction of hematopoietic progenitor cells into the co-culture
system. Hematopoietic progenitor cells are isolated from one of the
following human tissues: bone marrow, umbilical vein/placental
blood, peripheral blood, spleen. Alternatively, murine tissues are
used. Murine bone marrow cells are harvested by flushing the marrow
cavity of 6 to 10 week old mice with DMEM/10% FCS under sterile
conditions. Murine spleen cells are harvested by physical passage
through a fine metal screen under sterile conditions. One of three
methods are used to deplete the mixed hematopoietic cell population
of its stromal component. As a first alternative, the hematopoietic
stem cell population from the blood sample will be enriched by
magnetic immunobead purification using anti-CD34 antigen according
to established techniques. As a second alternative, hematopoietic
cells will be enriched by passage of the bone marrow or other blood
sample over a sterile G-10 Sephadex or nylon wool column;
hematopoietic progenitor cells are eluted while stromal cells are
retained. As a third alternative, hematopoietic cells will be
enriched by flow cytometric sorting based on surface protein
characteristics. The hematopoietic cells are washed once and the
number of nucleated cells is counted using a hematocytometer after
erythrocyte lysis with 0.3% acetic acid and trypan blue staining.
Hematopoietic cells are introduced into the liquid co-cultures at a
ratio of preferably 10 to 100 nucleated hematopoietic cells per
stromal cell plated, more preferably 20 to 30 nucleated
hematopoietic cells per stromal cell plated, most preferably 25 to
30 nucleated hematopoietic cells per stromal cell plated. Cells are
cultured in a medium consisting of DMEM (high glucose), 10% fetal
bovine serum supplemented with 10 to 100 nM hydrocortisone or 10%
horse serum, 10 to 200 units/ml of penicillin, 10 to 200 .mu.g of
streptomycin at 33.degree. C. in 5% CO.sub.2. One half of the
medium in the co-cultures is replaced every 3 to 4 days. The number
of non-adherent cells in the medium is determined by
hematocytometer count and/or by flow cytometery. The surface
antigen characteristics of the non-adherent cells are documented
using routine antibody markers for the major hematopoietic cell
lineages. These will include, but are not limited to, Mac-1, Thy 1,
Ig Heavy chain, Ter-81 (erythroid marker). The number and character
of the non-adherent cell population is determined over a period of
up to 10 weeks. At the conclusion of the study, the cellular
composition of the adherent cell layer is determined by flow
cytometric or immunohistochemical methods. As an alternative
approach, the hematopoietic studies are conducted in semi-solid
cultures. Cells are prepared as described above, but the
hematopoietic progenitor cells are plated in the additional
presence of 2.1% methylcellulose. Colony formation is assessed
after a 7 to 14 day period for the presence of granulocytes,
erythrocytes, macrophages, and monocytes using histologic,
morphologic and immunologic criteria.
Example 3
Ability of Adipose Tissue Derived Stromal Cell/Hematopoietic
Progenitor Cell Co-Cultures to Maintain Proliferation of
Hematopoietic Progenitors In Vitro
[0060] Adipose tissue derived stromal cell/hematopoietic progenitor
co-cultures established under liquid culture conditions described
in Example 1 are used to assess the ability of this system to
maintain the proliferation of the hematopoietic progenitor cells in
vitro. Co-cultures are established using human adipose tissue
derived stromal cells and murine hematopoietic progenitors.
Cultured cells are transduced with a viral vector expressing a
traceable protein marker such as green fluorescent protein or
beta-galactosidase. Alternatively, co-culture cells are identified
by expression of a unique antigen or genetic marker due to their
origin; e.g., the expression of human proteins for the stromal
cells, and the expression of a transgenic or male gender specific
marker for the murine hematopoietic cells. Established co-cultures
are harvested by limited incubation with trypsin/EDTA and infused
into a lethally irradiated immunodeficient mouse. Animals will be
followed over time. After 9 to 14 days, mice are sacrificed and
their spleens examined for the appearance of hematopoietic cell
islands or splenic colony forming units (CFU-S). Alternatively,
mice will be maintained for 14 days or longer and their circulating
blood cell count determined by hematologic and flow cytometric
assays. The presence of specific markers of the stromal cells and
the donor hematopoietic cells is detected with antibody reagents or
specific DNA markers on fixed cells, either by flow cytometry or
conventional pathologic/histologic methods. The ability of the
co-cultured cells to establish CFU-S in the recipient and/or to
maintain the proliferation and maturation of donor blood cells in
the host after 14 days is evidence of the continued expansion of
some hematopoietic progenitors in vitro by the adipose
tissue-derived stromal cells.
Example 4
Establishment of Lymphopoietic Co-Cultures with an Adipose
Tissue-Derived Stromal Cells Layer In Vitro
[0061] Stromal cells are isolated from human subcutaneous adipose
tissue according to methods described in "Methods and Compositions
for the Differentiation of Human Preadipocytes into Adipocytes"
Ser. No. 09/240,029, filed Jan. 29, 1999. These cells are plated at
a density of 500 to 20,000 cells per cm.sup.2. Stromal cells are
established in the cultures for 1 to 3 days prior to the
introduction of hematopoietic progenitor cells into the co-culture
system. Hematopoietic progenitor cells are isolated from one of the
following human tissues: bone marrow, umbilical vein/placental
blood, peripheral blood, spleen. Alternatively, murine tissues are
used. Murine bone marrow cells are harvested by flushing the marrow
cavity of 6 to 10 week old mice with RPMI/10% FCS under sterile
conditions. Murine spleen cells are harvested by physical passage
through a fine metal screen under sterile conditions. One of three
methods is used to deplete the mixed hematopoietic cell population
of its stromal component. As a first alternative, the hematopoietic
stem cell population from the blood sample will be enriched by
magnetic immunobead purification using anti-CD34 antigen according
to established techniques. As a second alternative, hematopoietic
cells will be enriched by passage of the bone marrow or other blood
sample over a sterile G-10 Sephadex or nylon wool column;
hematopoietic progenitor cells are eluted while stromal cells are
retained. As a third alternative, hematopoietic cells will be
enriched by flow cytometric sorting. The hematopoietic cells are
washed once and the number of nucleated cells is counted using a
hematocytometer after erythrocyte lysis with 0.3% acetic acid and
trypan blue staining. Hematopoietic cells are introduced into the
liquid co-cultures at a ratio of preferably 10 to 100 nucleated
hematopoietic cells per stromal cell plated, more preferably 20 to
30 nucleated hematopoietic cells per stromal cell plated, most
preferably 25 to 30 nucleated hematopoietic cells per stromal cell
plated. Cells are cultured in a medium consisting of RPMI1640,
prescreened 10% fetal bovine serum, 10 to 200 units/ml of
penicillin, 10 to 200 .mu.g/ml of streptomycin, 0.5 to 2 mM
L-glutamine, 10 to 100 mM 2-mercaptoethanol at 37.degree. C. in 5%
CO.sub.2. One half of the medium in the co-cultures is replaced
every 3 to 4 days. The number of non-adherent cells in the medium
is determined by hematocytometer count and/or by flow cytometery.
The surface antigen characteristics of the non-adherent cells are
documented using routine antibody markers for the major
hematopoietic cell lineages. These will include, but are not
limited to, Mac-1, Thy 1, Ig Heavy chain, Ter-81 (erythroid
marker). The number and character of the non-adherent cell
population is determined over a period of up to 10 weeks. At the
conclusion of the study, the cellular composition of the adherent
cell layer is determined by flow cytometric or immunohistochemical
methods. As an alternative approach, the hematopoietic studies are
conducted in semi-solid cultures. Cells are prepared as described
above but the hematopoietic progenitor cells are plated in the
additional presence of 2.1% methylcellulose. Colony formation is
assessed after a 7 to 14 day period for the presence of B lineage
lymphoid cells as well as granulocytes, erythrocytes, macrophages,
and monocytes using histologic, morphologic and immunologic
criteria. Alternatively, co-cultures and/or semi-solid cultures are
established as described above with the addition of interleukin 7
at concentrations to be determined by the practitioner which
enhance the proliferation and maturation of B lineage lymphocytes.
The techniques outlined above are used to assess the affect of this
growth factor on the hematopoietic support function of the adipose
tissue derived stromal cell.
Example 5
Establishment of Osteoclastogenic Co-Cultures with an Adipose
Tissue-Derived Stromal Cells Layer In Vitro
[0062] Stromal cells are isolated from human subcutaneous adipose
tissue according to methods described in "Methods and Compositions
for the Differentiation of Human Preadipocytes into Adipocytes"
Ser. No. 09/240,029, Filed Jan. 29, 1999. These cells are plated at
a density of 500 to 20,000 cells per cm.sup.2 in 24 well plates.
Cells are cultured in a medium consisting of DMEM (high glucose),
prescreened 10% fetal bovine serum, 10 to 200 units/ml of
penicillin, 10 to 200 .mu.g of streptomycin, 0.5 to 2 mM
L-glutamine, 0.5 to 2 mM sodium pyruvate, 10 to 100 .mu.M
2-mercaptoethanol at 37.degree. C. in 5% CO.sub.2. Three days after
the stromal cultures are established, the medium is supplemented
with either 10 to 100 nM 1,25 dihydroxy vitamin D.sub.3 and or
osteoprotegerin ligand at concentrations determined by the
practitioner. Stromal cells are established in the cultures for 6
days prior to the introduction of hematopoietic progenitor cells
into the co-culture system.
[0063] Hematopoietic progenitor cells are isolated from one of the
following human tissues: bone marrow, umbilical vein/placental
blood, peripheral blood, spleen. Alternatively, murine tissues are
used. Murine bone marrow cells are harvested by flushing the marrow
cavity of 6 to 10 week old mice with DMEM (high glucose)/10% FCS
under sterile conditions. Murine spleen cells are harvested by
physical passage through a fine metal screen under sterile
conditions. One of three methods are used to deplete the mixed
hematopoietic cell population of its stromal component. As a first
alternative, the hematopoietic stem cell population from the blood
sample will be enriched by magnetic immunobead purification using
anti-CD34 antigen according to established techniques. As a second
alternative, hematopoietic cells will be enriched by passage of the
bone marrow or other blood sample over a sterile G-10 Sephadex or
nylon wool column; hematopoietic progenitor cells are eluted while
stromal cells are retained. As a third alternative, hematopoietic
cells will be enriched by flow cytometric sorting based on surface
protein characteristics. The hematopoietic cells are washed once
and the number of nucleated cells is counted using a
hematocytometer after erythrocyte lysis with 0.3% acetic acid and
trypan blue staining. Hematopoietic cells are introduced into the
liquid co-cultures at a ratio of preferably 10 to 100 nucleated
hematopoietic cells per stromal cell plated, more preferably 20 to
30 nucleated hematopoietic cells per stromal cell plated, most
preferably 25 to 30 nucleated hematopoietic cells per stromal cell
plated. One half of the medium in the co-cultures is replaced every
3 to 4 days. Co-cultures are maintained in the presence of 1,25
dihydroxy vitamin D.sub.3 or osteoprotegerin ligand continuously
after the introduction of hematopoietic cells.
[0064] After a period of co-culture of 6 to 9 days, co-cultures are
fixed with 0.5 ml 3.7% (vol:vol) formaldehyde in phosphate buffered
saline for 5 minutes, dried for 30 seconds with acetone:ethanol
(50:50, vol/vol), and stained for 10 minutes with 10 mM sodium
tartrate, 40 mM sodium acetate (pH 5.0), 0.1 mg/ml naphthol AS-MS
phosphate (Sigma N-5000), and 0.6 mg/ml fast red violet LB salt
(Sigma F-3381). Stained cultures are rinsed in distilled water and
stored under 50% glycerol/PBS. The number of tartrate resistant
acid phosphatase positive cells per well is assessed under light
microscopy based on the red staining of the cytoplasm. TRAP+ cells
are, numerically counted and those with 1-2 nuclei are
distinguished from those multinucleated cells with nuclei per cell.
This assay demonstrates the ability of adipose tissue derived
stromal cells to support the differentiation and proliferation of
osteoclastogenic precursors in vitro. This culture procedure is
able to expand and promote differentiation of osteoclasts. This has
potential application to rare clinical conditions such as
osteopetrosis characterized by brittle bones where patients fail to
produce native osteoclasts. This in vitro method offers a means to
expand an individual's own osteoclast progenitors and to promote
their differentiation ex vivo. This cell population can be
re-infused into the affected individual with potential short-term
or long-term benefit. The non-invasive nature of the methodology
and the potential to rely exclusively on autologous cells indicates
that this procedure could be used repetitively in the treatment of
an individual patient.
Example 6
Use of Adipose Tissue Derived Stromal Cell Supported EX Vivo
Hematopoiesis as a Therapeutic Modality for Bone Marrow Transplant
and Hematologically Compromised Patients
[0065] The co-culture models outlined in Examples 1-4 have the
potential to be used to facilitate the recovery of bone marrow
function in patients receiving high dose chemotherapy, high dose
radiation treatment or any other therapeutic modality which
compromises blood cell production and bone marrow function. In
advance of any elective procedure, an individual can donate his or
her own adipose tissue and blood cells for subsequent autologous
transplantation. Prior to immunocompromising procedures, the
individual's own blood cells and stromal co-cultures can be
established and expanded. Following any immunocompromising
procedure, the patient's own blood cell/stromal cell co-culture can
be re-infused into the patient according to standard transfusion
methodologies. This can be done in the absence or presence of
exogenous hematopoietic cytokines, either added to the co-cultures
or given directly to the patient. This approach may accelerate the
rate of blood cell production in the patient, reduce the need for
cytokine therapies, and reduce the overall costs and risk of the
chemotherapy or other immunocompromising procedure. With the ex
vivo nature of the procedure, it is possible to manipulate the
stromal cells to enhance production of specific blood cell
lineages. Stromal cells transiently expressing interleukin 7, for
example, would facilitate the rapid expansion of B lineage lymphoid
cells while stromal cells expressing erythropoietin would favor
expansion of erythrocytes.
[0066] As outlined above, the approach is designed primarily for
the treatment of nosocomial induced blood cell dyscrasias. However,
large scale ex vivo production of autologous stromal/hematopoietic
co-cultures is of potential value for elective and non-elective
surgical procedures requiring transfusion intra-operatively and
post-operatively. At present, the majority of patients requiring
blood transfusion receive blood products donated by others. This
presents risk to the recipient of transmission of unrecognized
infectious disease from the donor. With the ability to develop
blood cell production ex vivo, an individual can expand his/her
hematopoietic cell population at a capacity which is no longer
limited by the bone marrow cavity volume. Using cell factory tissue
culture approaches with recirculating systems, continuous
production of blood cells by an adipose tissue derived stromal
cell/hematopoietic cell co-culture is feasible. This approach has
the advantage of avoiding risks inherent in transfusion of blood
from a donor to a recipient; these include the transmission of
infectious diseases such as HIV, hepatitis, cytomegalovirus,
Jacob/Creukzfeld disease, among others.
Example 7
Differentiation of Adipose Tissue Derived Stromal Cells into
Skeletal Muscle Myoblasts
[0067] Stromal cells are isolated from human subcutaneous adipose
tissue according to methods described in "Methods and Compositions
for the Differentiation of Human Preadipocytes into Adipocytes"
Ser. No. 09/240,029, filed Jan. 29, 1999. These cells are plated at
a density of 500 to 20,000 cells per cm.sup.2 in 24 well plates.
Cells are cultured in a medium consisting of DMEM (high glucose),
prescreened 10% fetal bovine serum, 10 to 200 units/ml of
penicillin, 10 to 200 .mu.g of streptomycin, 0.5 to 2 mM
L-glutamine, 0.5 to 2 mM sodium pyruvate, 10 to 100 .mu.M
2-mercaptoethanol at 37.degree. C. in 5% CO.sub.2. Cells are
exposed to 1 to 30 .mu.M 5' azacytadine or 10 to 100 ng/ml of
amphotericin for periods of 1 to 6 days to assure that cells
throughout S phase are continuously exposed to these agents.
Following this period, cultures are maintained in the culture
medium without azacytadine or amphotericin supplements. Cultures
are either continued at the established cell density or sub-cloned
by limit dilution methods to select for cell clones capable of
expressing characteristic markers of skeletal muscle myoblasts.
These cells are selected based on morphologic criteria,
specifically, the ability to form multinucleated myotubules in
culture; biochemical criteria, specifically, the expression of
myosin heavy and light chain kinase, skeletal muscle actin and
myosin and the expression of myogenic transcription factors, myoD
and/or myogenin.
Example 8
Application of Skeletal Muscle Myoblasts Differentiated from
Adipose Tissue-Derived Stromal Cell
[0068] The cells skeletal muscle myoblasts developed in Example 6
can be used for tissue engineering purposes in the treatment of
myodystrophies, muscle atrophy, and physical loss of skeletal
muscle secondary to surgical procedures for the treatment of cancer
or trauma, The ex vivo development of a proliferating population of
myoblasts from adipose tissue can be used to supplement and repair
skeletal muscle mass in afflicted individuals. Myoblasts can be
cultured in biodegradable matrices composed of poly-lactic,
poly-glycolic, collagen or other materials to form muscle strands.
These can then be implanted to an afflicted site and tethered by
suture to existing muscle, tendon or bone. Alternatively, ex vivo
expanded myoblasts can be genetically engineered by viral
transduction, plasmid transfection, or other means to express novel
genes. These cells can be injected directly into existing muscle
sites where these novel gene products will now be expressed. This
approach has direct application to muscular dystrophy, where
patients suffer secondary to a mutation in an important skeletal
muscle gene. Likewise, the engineered stromal cells can convert the
muscle into a production site for a deficient circulating protein.
For example, adipose tissue derived stromal cells expressing
lipoprotein lipase can be used to treat the many patients with
mutations in their native lipoprotein lipase gene who are at
increased risk of severe cardiovascular disease.
Example 9
Differentiation and Expansion of Smooth Muscle Myoblasts from
Adipose Tissue Derived Stromal Cells Ex Vivo
[0069] Stromal cells are isolated from human subcutaneous adipose
tissue according to methods described in "Methods and Compositions
for the Differentiation of Human Preadipocytes into Adipocytes"
Ser. No. 09/240,029, filed Jan. 29, 1999. These cells are plated at
a density of 500 to 20,000 cells per cm.sup.2 in 24 well plates.
Cells are cultured in a medium consisting of DMEM (high glucose),
prescreened 10% fetal bovine serum, 10 to 200 units/ml of
penicillin, 10 to 200 .mu.g of streptomycin, 0.5 to 2 mM
L-glutamine, 0.5 to 2 mM sodium pyruvate, at 37.degree. C. in 5%
CO.sub.2. Cultures are supplemented with transforming growth factor
.beta. and/or fibroblast growth factor at concentrations determined
by the practitioner but not to exceed 40 ng/. Cells are maintained
in culture as a monolayer or in a 3-dimensional lattice composed of
collagen type I or other biodegradable material (alginate,
synthetic polymer or other). Cells are characterized based on
morphologic, biochemical, and functional criteria for smooth muscle
myoblast differentiation; these include, but are not limited to,
expression of smooth muscle actin, fibronectin, laminin, and other
extracellular matrix proteins, the ability to generate a tensile
force as measured by a pressure transducer, and to organize along a
line of force in a 3-dimensional lattice.
Example 10
Application of Smooth Muscle Myoblasts Differentiated from Adipose
Tissue-Derived Stromal Cells EX Vivo
[0070] The smooth muscle myoblasts described under Example 8 can be
used to treat conditions where smooth muscle function is
compromised. For example, over 1000 neonates each year suffer from
bladder wall abnormalities. The severity of this disorder is
variable but it can be devastating and requires expensive surgical
procedures to accomplish an acceptable repair and an approach to
normal function. In many cases, the bladder size is too small or
the bladder wall is incompletely foamed, necessitating the
implantation of prosthetic materials as a bladder wall replacement.
Methods under investigation include the use of swine intestinal
submucosa as a replacement material for the bladder wall. One issue
is whether or not the surgically implanted bladder wall will
achieve the appropriate physical and mechanical characteristics
associated with stretching and retraction. Much of this is mediated
by functional smooth muscle cells. Current methods implant the SIS
material without preimplantation of any smooth muscle cells ex
vivo. Surgeons rely on the recruitment of fibroblasts and
myofibroblasts from adjacent tissues, including the omental adipose
tissue. With the availability of adipose tissue derived stromal
cells capable of smooth muscle myoblast differentiation, it is
possible to pre-incubate SIS material with these cells ex vivo. The
introduction of these cells prior to the surgical repair of the
bladder wall is expected to accelerate and improve the attainment
of appropriate bladder tone. This approach has broad application to
all elastic soft tissue organs which rely on smooth muscle cells.
These include, but are not limited to, the small intestine, large
intestine, vagina, urethra, and venous blood vessels. The adipose
tissue derived stromal cells have potential application to the
surgical repair of defects in any of these organs.
[0071] All publications mentioned in the specification are
indicative of the level of those skilled in the art to which this
invention pertains. Publications are herein incorporated by
reference to the same extent as if each individual publication was
specifically and individually indicated to be incorporated by
reference.
[0072] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
and understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
26120DNAArtificial SequencePCR primer for Actin 1agtaacagcc
cacggtgttc 20220DNAArtificial SequenceReverse PCR primer for Actin
2agcctccgaa aggaaattgt 20323DNAArtificial SequencePCR primer for
Interleukin-6 3gtagccgccc cacacagaca gcc 23421DNAArtificial
Sequencereverse PCR primer for Interleukin 6 4gccatctttg gaaggttcag
g 21521DNAArtificial SequencePCR primer for Interleukin 8
5tctgcagctc tgtgtgaagg t 21621DNAArtificial SequenceReverse PCR
primer for Interleukin 8 6tgaattctca gccctcttca a
21724DNAArtificial SequencePCR primer for Granulocyte Colony
Stimulating Factor 7agcttcctgc tcaagtgctt agag 24824DNAArtificial
SequenceReverse PCR primer for Granulocyte Colony Stimulating
Factor. 8ttcttccatc tgctgccaga tggt 24923DNAArtificial SequencePCR
primer for Macrophage Colony Stimulating Factor 9ttgggagtgg
acacctgcag tct 231024DNAArtificial SequenceReverse PCR Primer for
Granulocyte/Monocyte Colony Stimulating Factor 10ccttggtgaa
gcagctcttc agcc 241124DNAArtificial SequencePCR primer for
Granulocyte/Monocyte Colony Stimulating Factor 11gtctcctgaa
cctgagtaga gaca 241224DNAArtificial SequenceReverse PCR primer for
Granulocyte/Monocyte Colony Stimulating Factor 12aaggggatga
caagcagaaa gtcc 241321DNAArtificial SequencePCR primer for Flt3
ligand 13tggagcccaa caacctatct c 211421DNAArtificial
SequenceReverse PCR primer for Flt3 ligand 14gggctgaaag gcacatttgg
t 211527DNAArtificial SequencePCR primer for Leukemia Inhibitory
Factor 15aacaacctca tgaaccagat caggagc 271629DNAArtificial
SequenceReverse PCR primer for Leukimia Inhibitory Factor
16atccttaccc gaggtgtcag ggccgtagg 291721DNAArtificial SequencePCR
Primer Sequence for Stem Cell Factor 17ctcctattta atcctctcgt c
211822DNAArtificial SequenceReverse PCR Primer for Stem Cell Factor
18tactaccatt ctcgcttatc ca 221921DNAArtificial SequencePCR primer
for Bone Morphogenetic Protein 2 19ggaagaacta ccagaaacga g
212021DNAArtificial SequenceReverse PCR primer for Bone
Morphogenetic Protein 2 20agatgatcag ccagaggaaa a
212121DNAArtificial SequencePCR primer for Bone Morphogenetic
Protein 4 21acctgagacg gggaagaaaa a 212221DNAArtificial
SequenceReverse PCRprimer for Bone Morphogenetic Protein 4
22ttaaagagga aacgaaaagc a 212328DNAArtificial SequencePCR primer
for Interleukin 7 23atgttccatg tttcttttag gtatatct
282425DNAArtificial SequenceReverse PCR primer for Interleukin 7
24tgcatttctc aaatgcccta atccg 252521DNAArtificial SequencePCR
primer for Interleukin 11 25atgaactgtg tttgccgcct g
212621DNAArtificial SequenceReverse PCR primer for Interleukin 11
26gagctgtaga gctcccagtg c 21
* * * * *