U.S. patent application number 13/828488 was filed with the patent office on 2013-10-24 for methods to enhance rnai oligonucleotide delivery to respiratory epithelial cells.
This patent application is currently assigned to University of Iowa Research Foundation. The applicant listed for this patent is UNIVERSITY OF IOWA RESEARCH FOUNDATION. Invention is credited to Beverly L. Davidson, Sateesh Krishnamurthy, Paul B. McCray, JR..
Application Number | 20130281372 13/828488 |
Document ID | / |
Family ID | 49380655 |
Filed Date | 2013-10-24 |
United States Patent
Application |
20130281372 |
Kind Code |
A1 |
McCray, JR.; Paul B. ; et
al. |
October 24, 2013 |
METHODS TO ENHANCE RNAI OLIGONUCLEOTIDE DELIVERY TO RESPIRATORY
EPITHELIAL CELLS
Abstract
The present invention relates to methods of reducing a level of
a target mRNA in a well-differentiated airway epithelial cell by
contacting the cell with a sensitizing agent followed by contacting
the cell with a therapeutic RNAi agent.
Inventors: |
McCray, JR.; Paul B.; (Iowa
City, IA) ; Davidson; Beverly L.; (Iowa City, IA)
; Krishnamurthy; Sateesh; (Iowa City, IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY OF IOWA RESEARCH FOUNDATION |
Iowa City |
IA |
US |
|
|
Assignee: |
University of Iowa Research
Foundation
Iowa City
IA
|
Family ID: |
49380655 |
Appl. No.: |
13/828488 |
Filed: |
March 14, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61636406 |
Apr 20, 2012 |
|
|
|
Current U.S.
Class: |
514/9.6 ;
435/375; 514/44A |
Current CPC
Class: |
A61K 31/7064 20130101;
A61K 38/1808 20130101; A61K 31/519 20130101; A61K 31/519 20130101;
A61K 31/713 20130101; A61K 31/713 20130101; A61K 31/352 20130101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 31/352
20130101; A61K 31/5377 20130101; A61K 31/7105 20130101; A61K
31/5377 20130101; A61K 31/7105 20130101 |
Class at
Publication: |
514/9.6 ;
435/375; 514/44.A |
International
Class: |
A61K 38/18 20060101
A61K038/18; A61K 31/7064 20060101 A61K031/7064; A61K 31/713
20060101 A61K031/713 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under grant
number PO1 HL-51670 awarded by the National Institutes of Health.
The government has certain rights in the invention.
Claims
1. A method of reducing a level of a target mRNA in a
well-differentiated airway epithelial cell comprising contacting
the cell with a sensitizing agent followed by contacting the cell
with a therapeutic RNAi agent, wherein the mRNA level of the target
mRNA is reduced by at least 1% as compared to a control cell that
has not been contacted with the sensitizing compound.
2. The method of claim 1, wherein the mRNA level of the target mRNA
is reduced by at least 10%.
3. The method of claim 1, wherein the mRNA level of the target mRNA
is reduced by at least 20%.
4. The method of claim 1, wherein well differentiated cells are
more than five days old.
5. The method of claim 1, wherein the sensitizing agent is a small
molecule PI3K inhibitor, EGF, LY-294002, wortmannin or
triciribine.
6. The method of claim 1, wherein the RNAi molecule is an siRNA, an
miRNA, and/or an anti-sense oligonucleotide.
7. The method of claim 1, wherein the cell is contacted on its
mucosal surface.
8. The method of claim 1, wherein the airway epithelial cell is a
lung cell, a nasal cell, a tracheal cell, a bronchial cell, a
bronchiolar or alveolar epithelial cell.
9. A method of treating a subject having an airway epithelial
disease comprising administering to the subject an effective amount
of a sensitizing agent and an effective amount of a therapeutic
agent to alleviate the symptoms of the airway epithelial disease by
inducing a therapeutic effect.
10. The method of claim 9, wherein the sensitizing agent is
administered orally.
11. The method of claim 9, wherein the sensitizing agent is
administered by inhalation.
12. The method of claim 9, wherein the sensitizing agent is
administered by aerosol, dry powder, bronchoscopic instillation, or
intra-airway (tracheal or bronchial) aerosol.
13. The method of claim 9, wherein the therapeutic agent is
administered orally, by inhalation, by aerosol, dry powder,
bronchoscopic instillation, or intra-airway (tracheal or bronchial)
aerosol.
14. The method of claim 9, wherein the airway epithelial disease is
cystic fibrosis.
15. The method of claim 9, wherein the subject is a mammal.
16. The method of claim 15, wherein the subject is a human.
17. The method of claim 9, wherein the therapeutic RNAi agent is
present within a pharmaceutical composition.
18. The method of claim 9, wherein the symptoms are reduced by at
least 1%.
19. The method of claim 9, wherein the sensitizing agent is EGF, a
small molecule PI3K inhibitor, LY-294002, wortmannin or
triciribine.
20. A kit for reducing a level of a target mRNA in a
well-differentiated PAE cell comprising (a) a sensitizing agent,
(b) a therapeutic RNAi molecule, and (c) instructions for
contacting the cell with the sensitizing compound and the RNAi
molecule to reduce the mRNA level of the target mRNA by at least 1%
as compared to a control cell that has not been contacted with the
sensitizing compound.
Description
PRIORITY OF INVENTION
[0001] This application claims priority to U.S. Provisional
Application No. 61/636,406 that was filed on Apr. 20, 2012. The
entire content of this provisional application is hereby
incorporated herein by reference.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 13, 2013, is named 17023.121US1_SL.txt and is 6,874 bytes
in size.
BACKGROUND OF THE INVENTION
[0004] Small-interfering RNA (siRNA)-mediated silencing of genes
offers a novel approach for disease treatment. Direct delivery of
siRNA to respiratory epithelia is potentially advantageous for many
respiratory infections and for chronic diseases like cystic
fibrosis where airway epithelial cells are prominent sites of
production and release of pro-inflammatory cytokines such as IL-8
and others (Davidson B L, McCray P B, Jr. Current prospects for RNA
interference-based therapies. Nat Rev Genet 2011; 12(5):329-340).
Topical delivery avoids hepatic clearance and non-specific
accumulation associated with the systemic route and allows for
local accumulation within the target organ. But due to its high
molecular weight and polyanionic nature, siRNAs do not cross the
epithelial cell membrane freely. In addition, the intra pulmonary
physical barriers such as mucus to overcome before encountering the
problems with cell entry (Oakland M, Sinn P L, McCray P B Jr.
Advances in cell and gene-based therapies for cystic fibrosis lung
disease. Mol Ther. 2012 Feb. 28. doi: 10.1038/mt.2012.32. [Epub
ahead of print] PMID: 22371844). Thus, efficient delivery of siRNA
to the airways has been challenging due to significant
intracellular and extracellular barriers.
[0005] Non-viral siRNA delivery is an attractive and potentially
safer alternative to virus-based delivery systems. A number of
studies report successful delivery of naked siRNA to airways,
especially for counteracting viral infections (Zhang W et al.,
Inhibition of respiratory syncytial virus infection with intranasal
siRNA nanoparticles targeting the viral NS1 gene. Nat Med 2005;
11(1):56-62; Bitko V et al., Inhibition of respiratory viruses by
nasally administered siRNA. Nat Med 2005; 11(1):50-55). However,
recent reports also show that siRNAs delivered intranasally or
intratracheally, without delivery enhancement, may not target to
lung cells and thus do not cause RNA interference (Moschos S A et
al., Uptake, efficacy, and systemic distribution of naked, inhaled
short interfering RNA (siRNA) and locked nucleic acid (LNA)
antisense. Mol Ther 2011; 19(12):2163-2168). Furthermore, off
target immunostimulatory effects of early siRNA constructs likely
clouded some studies (Judge A D et al., Sequence-dependent
stimulation of the mammalian innate immune response by synthetic
siRNA. Nat Biotechnol 2005; 23(4):457-462; DeVincenzo J et al., A
randomized, double-blind, placebo-controlled study of an RNAi-based
therapy directed against respiratory syncytial virus. Proc Natl
Acad Sci USA 2010; 107(19):8800-8805; Kleinman M E et al.,
Sequence- and target-independent angiogenesis suppression by siRNA
via TLR3. Nature 2008; 452 (7187):591-597). Added to these
disappointing results, the delivery and efficacy of siRNA in
combination with various non-viral reagents in respiratory
epithelia has not been extensively investigated.
[0006] Accordingly, a more effective, simple-to-administer, and
efficient treatment for airway epithelial disease is needed.
SUMMARY OF THE INVENTION
[0007] In certain embodiments, the present invention provides a
method of reducing a level of a target mRNA in a
well-differentiated airway epithelial cell comprising contacting
the cell with a sensitizing agent followed by contacting the cell
with a therapeutic RNAi agent, wherein the mRNA level of the target
mRNA is reduced by at least 1% as compared to a control cell that
has not been contacted with the sensitizing compound. As used
herein, the term "well-differentiated" cells have fully
differentiated and form a pseudostratified epithelium with the
diversity of cells represented in the human conducting airways
(ciliated cells, goblet cells, non-ciliated cells, basal cells) and
"poorly-differentiated" cells to signify cells that have not
reached this differentiated state of maturation and do not form an
epithelium representative of the in vivo airways. As used herein an
"RNAi molecule" is an RNA molecule that functions in RNA
interference (e.g., siRNA, shRNA or DsiRNA). In certain
embodiments, the mRNA level is reduced by at least about 1%, 5%,
10%, 20, 30%, 40%, 50%, 60%, 70%, 80%, 90% 95%, or 99%. In certain
embodiments, the well differentiated cells are more than five days
old. In certain embodiments, the cell is contacted on its mucosal
surface. In certain embodiments, the airway epithelial cell is a
lung cell, a nasal cell, a tracheal cell, a bronchial cell, a
bronchiolar or alveolar epithelial cell.
[0008] In certain embodiments, the sensitizing agent is a small
molecule PI3K inhibitor. In certain embodiments, the sensitizing
compound is EGF. In certain embodiments, the sensitizing agent is
LY-294002 (2-morpholin-4-yl-8-phenylchromen-4-one), wortmannin or
triciribine.
[0009] In certain embodiments, the RNAi molecule is an siRNA, an
miRNA, a microRNA mimic, and anti-Mir and/or an anti-sense
oligonucleotide. In certain embodiments, the present invention
provides a method of treating a subject having an airway epithelial
disease comprising administering to the subject an effective amount
of a sensitizing agent and an effective amount of a therapeutic
agent to alleviate the symptoms of the airway epithelial disease by
inducing a therapeutic effect. As used herein the term "therapeutic
effect" refers to a change in the associated abnormalities of the
disease state, including pathological and behavioral deficits; a
change in the time to progression of the disease state; a
reduction, lessening, or alteration of a symptom of the disease; or
an improvement in the quality of life of the person afflicted with
the disease. Therapeutic effects can be measured quantitatively by
a physician or qualitatively by a patient afflicted with the
disease state targeted by the therapeutic agent.
[0010] In certain embodiments, the sensitizing agent and/or
therapeutic agent is administered orally, by inhalation, by
aerosol, dry powder, bronchoscopic instillation, or intra-airway
(tracheal or bronchial) aerosol. In certain embodiments, the
therapeutic RNAi agent is present within a pharmaceutical
composition. In certain embodiments, the airway epithelial disease
is cystic fibrosis. In certain embodiments, the subject is a
mammal, such as a human. In certain embodiments the symptoms are
reduced by at least 1%, 5%, 10%, 20, 30%, 40%, 50%, 60%, 70%, 80%,
90% 95%, or 99%. In certain embodiments, the sensitizing agent is
EGF. In certain embodiments, the sensitizing agent is a small
molecule PI3K inhibitor, such as LY-294002, wortmannin and/or
triciribine.
[0011] In certain embodiments, the present invention provides a kit
for reducing a level of a target mRNA in a well-differentiated PAE
cell comprising (a) a sensitizing agent, (b) a therapeutic RNAi
molecule, and (c) instructions for contacting the cell with the
sensitizing compound and the RNAi molecule to reduce the mRNA level
of the target mRNA by at least 1% as compared to a control cell
that has not been contacted with the sensitizing compound.
[0012] In certain embodiments, the epithelial cell, such as an
airway epithelial cell (e.g., a lung cell, a nasal cell, a tracheal
cell, a bronchial cell, a bronchiolar or alveolar epithelial cell).
In certain embodiments, the airway epithelial cells are present in
a mammal.
BRIEF DESCRIPTION OF DRAWINGS AND TABLE
[0013] FIG. 1. siRNA delivery has no silencing effect in well
differentiated PAE (primary pig airway epithelia) HAE is primary
human airway epithelia cultures. (a) Well differentiated PAE
cultures were transfected with HPRT or NC1 siRNA (250 nM) using
either PEI or TAT-PEI, Accell siRNA or Transductin at the indicated
concentrations. The cells were harvested for RNA after 24 h, and
the RNA was reverse transcribed into cDNA, which was then
quantified by qPCR. All the mRNA levels normalized to those of the
NC1 samples (100%). Mean levels (.+-.s.d.) were calculated from
three replicate transfections. (b-c) Confocal imaging of epithelia
2 h after transfection with DIG-HPRT siRNA complexed with
transductin (b) or without any transfection reagent (c).
[0014] FIG. 2. siRNAs effectively silence targets in poorly
differentiated PAE cultures. (a) Poorly differentiated cultures,
2-day post-seeding, were transfected with 250 nM of siRNA against
HPRT with the use of RNAiMAX, Accell siRNA, or Transductin at the
indicated concentrations and then processed (RNA isolation, cDNA
synthesis and qPCR) 24 h later. The percentages of remaining mRNA
levels in samples were graphed in comparison with those of negative
control (NC1), which was set at 100%. Mean levels (.+-.s.d.) were
calculated from three replicate transfections. (b-c) Confocal
imaging of cells 2 h after transfection with DIG-HPRT siRNA
complexed with Transductin (b) or without any transfection reagent
(c).
[0015] FIG. 3. Effective silencing of targets is seen only in pig
airway cells that are less than 5-days old (a) Pig airway epithelia
from 2 donors that were 2 to 5 days old (2 D to 5 D) were
transfected with siRNA against HPRT (250 nM) using Transductin. The
cells were processed for RNA isolation and cDNA synthesis 24 h
later and then subjected to qPCR for quantification of HPRT mRNA.
The bars for HPRT samples denote the mRNA levels remaining
normalized to the NC1 samples (100%). Mean levels (.+-.s.d.) were
calculated from three replicate transfections. (b-e) Confocal
imaging of 2 (b), 3(c), 4(d) and 5(e) days old cells after
transfection of each with DIG-HPRT siRNA and then staining 2 h
later for antibody to DIG followed by fluorescent dye tagged
secondary antibody.
[0016] FIG. 4. EGF treatment of cells prior to siRNA delivery
enhances entry and cause modest silencing. Well-differentiated
airway cells from 3 donors were treated apically with EGF at a
concentration of 100 .mu.g/ml for 15 min before transfecting them
with siRNA against HPRT at a concentration of 250 nM. Twenty four
hours later, the cells were processed for RNA isolation, cDNA
synthesis and qPCR quantification of HPRT mRNA. NC1 mRNA levels,
treated or untreated with EGF were set at 100% and used for
comparison with HPRT treated samples. Mean levels (.+-.s.d.) were
calculated from three replicate transfections.
[0017] FIG. 5. Small molecule treatments of cells prior to siRNA
delivery cause effective silencing of targets. (a-b) Human airway
epithelia (a) and pig airway epithelia (b) were treated apically
with LY-294002 at a concentration of 10 .mu.M for 6 h or untreated
before transfecting them with respective siRNAs against HPRT. (c)
Human airway cells were either untreated or treated with other
small molecule PI3K inhibitors, wortmannin, and triciribine, each
at two different concentrations as a control meclofenamic acid, a
drug with a positive correlation in CMAP analysis were added before
transfection with siRNA against HPRT. mRNA levels were assessed by
real time PCR and normalized to NC1. Mean levels (.+-.s.d.) were
calculated from three replicate transfections.
[0018] FIG. 6. Dicer-substrate siRNA silence gene expression in PK1
cells. PK1 cells were reverse transfected with the indicated
concentration of siRNA against HPRT, IL-8 (1098), IL-8 (1466) or
with the negative control siRNA, NC, all with the use of the lipid
transfection reagent, RNAiMAX. Twenty four hours later the cellular
RNA was isolated, reversed transcribed and subjected to qPCR using
the respective gene specific primers and probes. The NC1 samples
were quantified for both HPRT and IL-8 mRNA levels. The remaining
mRNA levels of all the samples are displayed in comparison with
NC1, which was set at 100%. Mean levels (.+-.s.d.) were calculated
from three replicate transfections.
[0019] FIG. 7. siRNA delivery has no silencing effect in
well-differentiated HAE cultures (primary human airway epithelia
cultures). HAE cultures were transfected with HPRT siRNA using
RNAiMAX or Transductin and subjected to qPCR after RNA isolation
and cDNA synthesis. HPRT mRNA levels of the samples are compared to
that of the negative control (100%). Mean levels (.+-.s.d.) were
calculated from three replicate transfections.
[0020] FIG. 8. siRNA delivery has no silencing effect in well
differentiated PAE cultures treated with EGTA, LLnL or KGF. (a-c)
Pig airway epithelia were either untreated or treated apically with
EGTA, LLnL, or KGF under the conditions described in Materials and
Methods, before transfection with 250 nM HPRT siRNA using either
RNAiMAX or Transductin. The cells were processed for qPCR and mRNA
quantified. Bars represent HPRT mRNA levels. HPRT mRNA levels in
NC1 samples were set at 100%. Mean levels (.+-.s.d.) were
calculated from three replicate transfections.
[0021] FIG. 9. siRNAs effectively silence targets in poorly
differentiated cultures. (a) Knockdown of IL-8 is seen in poorly
differentiated pig airway cultures upon transfection of either of
the two siRNAs against IL-8 (1098 or 1466). siRNAs were transfected
at a concentration of 250 ng. Twenty four hours later, qPCR was
done to quantitate the mRNA levels in the samples and negative
control. Knockdown of HPRT was also done as a control. (b)
Silencing of HPRT is seen in poorly differentiated human airway
epithelia when transfected using Transductin. Indicated amounts of
HPRT siRNA was transfected into cells and 24 h later the samples
were processed for qPCR. In both (a and b), sample mRNA levels were
compared with that of negative control (100%). Mean levels
(.+-.s.d.) were calculated from three replicate transfections. Mean
levels (.+-.s.d.) were calculated from three replicate
transfections.
[0022] FIG. 10. Confocal imaging of human airway epithelial cells
transfected with DIG-HPRT siRNA. (a-d) Human airway epithelia were
transfected with 250 ng of DIG-HPRT siRNA after complexing it with
Transductin. Two hours later the cells were processed for
fluorescent imaging by confocal microscopy as detailed in Materials
and Methods. (a-b) Imaging of well differentiated cells after
transfection of DIG-HPRT siRNA with (a) or without (b) Transductin.
(c-d) Imaging of poorly differentiated cells after transfection of
DIG-HPRT siRNA with (c) or without (d) Transductin.
[0023] FIG. 11. Effective silencing of targets is seen only in
cells that are less than 5-day old. (a) Silencing of IL-8 is seen
in 2-day old pig airway epithelia, but not in 5-day old epithelia,
when 250 ng of siRNA against IL-8 (1098 or 1466) is transfected
into cells with Transductin. (b) In human airway epithelia,
significant knockdown of HPRT is seen only in 2-day old cells, but
not in 5-day old cells on transfection of 250 ng of siRNA against
HPRT. In both experiments (a and b), quantification of mRNA levels
were done by qPCR 24 h later and the results of the mRNA levels in
samples are presented in comparison with those of the negative
control (100%). Mean levels (.+-.s.d.) were calculated from three
replicate transfections.
[0024] FIG. 12. Small molecule treatment of cells prior to siRNA
delivery cause effective silencing of targets (a-b) LY-294002
treatment (10 .mu.M) of human airway cells apically before
transfection of siRNA causes knockdown of both Sin3A (a) and CFTR
(b). The siRNA (concentration of 250 ng) was transfected with the
use of Transductin and 24 h later the cells were harvested for RNA
isolation and cDNA synthesis. The mRNA levels were quantified by
qPCR and the results are presented as mRNA levels in comparison
with that of the negative control (100%). Mean levels (.+-.s.d.)
were calculated from three replicate transfections.
DETAILED DESCRIPTION OF THE INVENTION
[0025] RNA interference (RNAi) is a powerful method to affect the
abundance of a cellular protein. The delivery of RNAi
oligonucleotides to airway epithelia has the potential to
manipulate gene expression for therapeutic ends, and may be useful
for diseases such as asthma, chronic obstructive pulmonary disease
(COPD), and cystic fibrosis. However, inefficient delivery of
reagents to target cells has hampered this line of therapeutic
investigation.
[0026] It has been found that once airway epithelial cells become
well differentiated, their barrier properties remarkably inhibit
the uptake of RNAi oligonucleotides delivered to the mucosal
surface of the cells in a variety of different formulations. The
gene expression profiles of poorly differentiated and well
differentiated human airway epithelial cells were profiled using
the Connectivity map to discover classes of compounds that might
enhance uptake of RNAi oligonucleotides. The treatment of well
differentiated airway epithelia by applying with certain classes of
drugs increased the uptake of RNAi oligonucleotides, and effected
genes silencing. This approach is used to enhance the delivery of
therapeutic oligonucleotides to the airways.
[0027] A large number of siRNA formulation approaches (lipid,
cholesterol, TAT, chitosan formulations, etc.) have been screened,
all showing no significant delivery or efficacy in well
differentiated human or pig airway epithelia. In contrast, when the
same formulations were tried on poorly differentiated cells (1-4
days in culture), the oligonucleotides were capable of being
delivered, and attained mRNA knockdown. The current studies show
that pretreatment of the mucosal surface of epithelia with EGF (200
.mu.g/ml), enhanced uptake and facilitated siRNA knockdown in well
differentiated cells. EGF can stimulate macropinocytosis in cells
in a dose and cell type specific fashion. The present data
establishes a principle whereby augmentation of macropinocytosis is
manipulated to enhance oligonucleotide delivery.
[0028] In certain embodiments, the present invention provides
methods of reducing a level of a target mRNA in a
well-differentiated PAE cell comprising contacting the cell with a
sensitizing agent followed by contacting the cell with a
therapeutic RNAi agent, wherein the mRNA level of the target mRNA
is reduced by at least 1% as compared to a control cell that has
not been contacted with the sensitizing compound.
Sensitizing Agents
[0029] The inventors identified candidate chemical agents might be
useful in sensitizing well differentiated airway epithelial cells
to RNAi silencing. These candidate agents included LY-294003
(2-morpholin-4-yl-8-phenylchromen-4-one), wortmannin and
triciribine. In certain embodiments, pharmaceutically acceptable
salts of these compounds are used. For in vivo use, a therapeutic
compound as described herein is generally incorporated into a
pharmaceutical composition prior to administration. Within such
compositions, one or more therapeutic compounds as described herein
are present as active ingredient(s) (i.e., are present at levels
sufficient to provide a statistically significant effect on the
symptoms of cystic fibrosis, as measured using a representative
assay). A pharmaceutical composition comprises one or more such
compounds in combination with any pharmaceutically acceptable
carrier(s) known to those skilled in the art to be suitable for the
particular mode of administration. In addition, other
pharmaceutically active ingredients (including other therapeutic
agents) may, but need not, be present within the composition.
RNA Interference (RNAi) Molecules
[0030] "RNA interference (RNAi)" is the process of
sequence-specific, post-transcriptional gene silencing initiated by
a small interfering RNA (siRNA). During RNAi, siRNA induces
degradation of target mRNA with consequent sequence-specific
inhibition of gene expression.
[0031] An "RNA interference," "RNAi," "small interfering RNA" or
"short interfering RNA" or "siRNA" or "short hairpin RNA" or
"shRNA" molecule, or "miRNA" is a RNA duplex of nucleotides that is
targeted to a nucleic acid sequence of interest, for example,
SIN3A. As used herein, the term "siRNA" is a generic term that
encompasses all possible RNAi triggers. An "RNA duplex" refers to
the structure formed by the complementary pairing between two
regions of a RNA molecule. siRNA is "targeted" to a gene in that
the nucleotide sequence of the duplex portion of the siRNA is
complementary to a nucleotide sequence of the targeted gene. In
certain embodiments, the siRNAs are targeted to the sequence
encoding SIN3A. In some embodiments, the length of the duplex of
siRNAs is less than 30 base pairs. In some embodiments, the duplex
can be 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18,
17, 16, 15, 14, 13, 12, 11 or 10 base pairs in length. In some
embodiments, the length of the duplex is 19 to 32 base pairs in
length. In certain embodiment, the length of the duplex is 19 or 21
base pairs in length. The RNA duplex portion of the siRNA can be
part of a hairpin structure. In addition to the duplex portion, the
hairpin structure may contain a loop portion positioned between the
two sequences that form the duplex. The loop can vary in length. In
some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides in
length. In certain embodiments, the loop is 18 nucleotides in
length. The hairpin structure can also contain 3' and/or 5'
overhang portions. In some embodiments, the overhang is a 3' and/or
a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.
[0032] As used herein, Dicer-substrate RNAs (DsiRNAs) are
chemically synthesized asymmetric 25-mer/27-mer duplex RNAs that
have increased potency in RNA interference compared to traditional
siRNAs. Traditional 21-mer siRNAs are designed to mimic Dicer
products and therefore bypass interaction with the enzyme Dicer.
Dicer has been recently shown to be a component of RISC and
involved with entry of the siRNA duplex into RISC. Dicer-substrate
siRNAs are designed to be optimally processed by Dicer and show
increased potency by engaging this natural processing pathway.
Using this approach, sustained knockdown has been regularly
achieved using sub-nanomolar concentrations. (U.S. Pat. No.
8,084,599; Kim et al., Nature Biotechnology 23:222 2005; Rose et
al., Nucleic Acids Res., 33:4140 2005).
[0033] The transcriptional unit of a "shRNA" is comprised of sense
and antisense sequences connected by a loop of unpaired
nucleotides. shRNAs are exported from the nucleus by Exportin-5,
and once in the cytoplasm, are processed by Dicer to generate
functional siRNAs. "miRNAs" stem-loops are comprised of sense and
antisense sequences connected by a loop of unpaired nucleotides
typically expressed as part of larger primary transcripts
(pri-miRNAs), which are excised by the Drosha-DGCR8 complex
generating intermediates known as pre-miRNAs, which are
subsequently exported from the nucleus by Exportin-5, and once in
the cytoplasm, are processed by Dicer to generate functional miRNAs
or siRNAs. "Artificial miRNA" or an "artificial miRNA shuttle
vector", as used herein interchangeably, refers to a primary miRNA
transcript that has had a region of the duplex stem loop (at least
about 9-20 nucleotides) which is excised via Drosha and Dicer
processing replaced with the siRNA sequences for the target gene
while retaining the structural elements within the stem loop
necessary for effective Drosha processing. The term "artificial"
arises from the fact the flanking sequences (.about.35 nucleotides
upstream and .about.40 nucleotides downstream) arise from
restriction enzyme sites within the multiple cloning site of the
siRNA. As used herein the term "miRNA" encompasses both the
naturally occurring miRNA sequences as well as artificially
generated miRNA shuttle vectors.
[0034] The siRNA can be encoded by a nucleic acid sequence, and the
nucleic acid sequence can also include a promoter. The nucleic acid
sequence can also include a polyadenylation signal. In some
embodiments, the polyadenylation signal is a synthetic minimal
polyadenylation signal or a sequence of six Ts.
[0035] "Off-target toxicity" refers to deleterious, undesirable, or
unintended phenotypic changes of a host cell that expresses or
contains a siRNA. Off-target toxicity may result in loss of
desirable function, gain of non-desirable function, or even death
at the cellular or organismal level. Off-target toxicity may occur
immediately upon expression of the siRNA or may occur gradually
over time. Off-target toxicity may occur as a direct result of the
expression siRNA or may occur as a result of induction of host
immune response to the cell expressing the siRNA. Without wishing
to be bound by theory, off-target toxicity is postulated to arise
from high levels or overabundance of RNAi substrates within the
cell. These overabundant or overexpressed RNAi substrates,
including without limitation pre- or pri RNAi substrates as well as
overabundant mature antisense-RNAs, may compete for endogenous RNAi
machinery, thus disrupting natural miRNA biogenesis and function.
Off-target toxicity may also arise from an increased likelihood of
silencing of unintended mRNAs (i.e., off-target) due to partial
complementarity of the sequence. Off target toxicity may also occur
from improper strand biasing of a non-guide region such that there
is preferential loading of the non-guide region over the targeted
or guide region of the RNAi. Off-target toxicity may also arise
from stimulation of cellular responses to dsRNAs which include
dsRNA. "Decreased off target toxicity" refers to a decrease,
reduction, abrogation or attenuation in off target toxicity such
that the therapeutic effect is more beneficial to the host than the
toxicity is limiting or detrimental as measured by an improved
duration or quality of life or an improved sign or symptom of a
disease or condition being targeted by the siRNA. "Limited off
target toxicity" or "low off target toxicity" refer to unintended
undesirable phenotypic changes to a cell or organism, whether
detectable or not, that does not preclude or outweigh or limit the
therapeutic benefit to the host treated with the siRNA and may be
considered a "side effect" of the therapy. Decreased or limited off
target toxicity may be determined or inferred by comparing the in
vitro analysis such as Northern blot or qPCR for the levels of
siRNA substrates or the in vivo effects comparing an equivalent
shRNA vector to the miRNA shuttle vector of the present
invention.
[0036] "Knock-down," "knock-down technology" refers to a technique
of gene silencing in which the expression of a target gene is
reduced as compared to the gene expression prior to the
introduction of the siRNA, which can lead to the inhibition of
production of the target gene product. The term "reduced" is used
herein to indicate that the target gene expression is lowered by
1-100%. In other words, the amount of RNA available for translation
into a polypeptide or protein is minimized. For example, the amount
of protein may be reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90,
95, or 99%. In some embodiments, the expression is reduced by about
90% (i.e., only about 10% of the amount of protein is observed a
cell as compared to a cell where siRNA molecules have not been
administered). Knock-down of gene expression can be directed by the
use of RNAi molecules.
[0037] In one embodiment according to a method of the present
invention, the expression of cystic fibrosis is modified via RNAi.
For example, SIN3A expression and/or function is suppressed in a
cell. The term "suppressing" refers to the diminution, reduction or
elimination in the number or amount of transcripts present in a
particular cell. It also relates to reductions in functional
protein levels by inhibition of protein translation, which do not
necessarily correlate with reductions in mRNA levels. For example,
the accumulation of mRNA encoding SIN3A is suppressed in a cell by
RNA interference (RNAi), e.g., the gene is silenced by
sequence-specific double-stranded RNA (dsRNA), which is also called
small interfering RNA (siRNA). These siRNAs can be two separate RNA
molecules that have hybridized together, or they may be a single
hairpin wherein two portions of a RNA molecule have hybridized
together to form a duplex.
[0038] A mutant protein refers to the protein encoded by a gene
having a mutation, e.g., a missense or nonsense mutation in one or
both alleles of a gene, such as CFTR, causing disease. The term
"gene" is used broadly to refer to any segment of nucleic acid
associated with a biological function. Thus, genes include coding
sequences and/or the regulatory sequences required for their
expression. For example, "gene" refers to a nucleic acid fragment
that expresses mRNA, functional RNA, or specific protein, including
regulatory sequences. "Genes" also include nonexpressed DNA
segments that, for example, form recognition sequences for other
proteins. "Genes" can be obtained from a variety of sources,
including cloning from a source of interest or synthesizing from
known or predicted sequence information, and may include sequences
designed to have desired parameters. An "allele" is one of several
alternative forms of a gene occupying a given locus on a
chromosome.
[0039] The term "nucleic acid" refers to deoxyribonucleic acid
(DNA) or ribonucleic acid (RNA) and polymers thereof in either
single- or double-stranded form, composed of monomers (nucleotides)
containing a sugar, phosphate and a base that is either a purine or
pyrimidine. Unless specifically limited, the term encompasses
nucleic acids containing known analogs of natural nucleotides that
have similar binding properties as the reference nucleic acid and
are metabolized in a manner similar to naturally occurring
nucleotides. Unless otherwise indicated, a particular nucleic acid
sequence also encompasses conservatively modified variants thereof
(e.g., degenerate codon substitutions) and complementary sequences,
as well as the sequence explicitly indicated. Specifically,
degenerate codon substitutions may be achieved by generating
sequences in which the third position of one or more selected (or
all) codons is substituted with mixed-base and/or deoxyinosine
residues. A "nucleic acid fragment" is a portion of a given nucleic
acid molecule.
[0040] A "nucleotide sequence" is a polymer of DNA or RNA that can
be single-stranded or double-stranded, optionally containing
synthetic, non-natural or altered nucleotide bases capable of
incorporation into DNA or RNA polymers.
[0041] The terms "nucleic acid," "nucleic acid molecule," "nucleic
acid fragment," "nucleic acid sequence or segment," or
"polynucleotide" are used interchangeably and may also be used
interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
[0042] The invention encompasses isolated or substantially purified
nucleic acid nucleic acid molecules and compositions containing
those molecules. In the context of the present invention, an
"isolated" or "purified" DNA molecule or RNA molecule is a DNA
molecule or RNA molecule that exists apart from its native
environment and is therefore not a product of nature. An isolated
DNA molecule or RNA molecule may exist in a purified form or may
exist in a non-native environment such as, for example, a
transgenic host cell. For example, an "isolated" or "purified"
nucleic acid molecule or biologically active portion thereof, is
substantially free of other cellular material, or culture medium
when produced by recombinant techniques, or substantially free of
chemical precursors or other chemicals when chemically synthesized.
In one embodiment, an "isolated" nucleic acid is free of sequences
that naturally flank the nucleic acid (i.e., sequences located at
the 5' and 3' ends of the nucleic acid) in the genomic DNA of the
organism from which the nucleic acid is derived. For example, in
various embodiments, the isolated nucleic acid molecule can contain
less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequences that naturally flank the nucleic acid molecule
in genomic DNA of the cell from which the nucleic acid is derived.
Fragments and variants of the disclosed nucleotide sequences are
also encompassed by the present invention. By "fragment" or
"portion" is meant a full length or less than full length of the
nucleotide sequence.
[0043] "Naturally occurring," "native," or "wild-type" is used to
describe an object that can be found in nature as distinct from
being artificially produced. For example, a protein or nucleotide
sequence present in an organism (including a virus), which can be
isolated from a source in nature and that has not been
intentionally modified by a person in the laboratory, is naturally
occurring.
[0044] A "variant" of a molecule is a sequence that is
substantially similar to the sequence of the native molecule. For
nucleotide sequences, variants include those sequences that,
because of the degeneracy of the genetic code, encode the identical
amino acid sequence of the native protein. Naturally occurring
allelic variants such as these can be identified with the use of
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR) and hybridization techniques. Variant
nucleotide sequences also include synthetically derived nucleotide
sequences, such as those generated, for example, by using
site-directed mutagenesis, which encode the native protein, as well
as those that encode a polypeptide having amino acid substitutions.
Generally, nucleotide sequence variants of the invention will have
at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%,
77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least
85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, to 98%, sequence identity to the native (endogenous)
nucleotide sequence.
[0045] The terms "protein," "peptide" and "polypeptide" are used
interchangeably herein.
[0046] "Functional RNA" refers to sense RNA, antisense RNA,
ribozyme RNA, siRNA, or other RNA that may not be translated but
yet has an effect on at least one cellular process.
[0047] The term "RNA transcript" or "transcript" refers to the
product resulting from RNA polymerase catalyzed transcription of a
DNA sequence. When the RNA transcript is a perfect complementary
copy of the DNA sequence, it is referred to as the primary
transcript or it may be a RNA sequence derived from
posttranscriptional processing of the primary transcript and is
referred to as the mature RNA. "Messenger RNA" (mRNA) refers to the
RNA that is without introns and that can be translated into protein
by the cell.
[0048] "Operably-linked" refers to the association of nucleic acid
sequences on single nucleic acid fragment so that the function of
one of the sequences is affected by another. For example, a
regulatory DNA sequence is said to be "operably linked to" or
"associated with" a DNA sequence that codes for an RNA or a
polypeptide if the two sequences are situated such that the
regulatory DNA sequence affects expression of the coding DNA
sequence (i.e., that the coding sequence or functional RNA is under
the transcriptional control of the promoter). Coding sequences can
be operably-linked to regulatory sequences in sense or antisense
orientation.
[0049] "Expression" refers to the transcription and/or translation
of an endogenous gene, heterologous gene or nucleic acid segment,
or a transgene in cells. For example, in the case of siRNA
constructs, expression may refer to the transcription of the siRNA
only. In addition, expression refers to the transcription and
stable accumulation of sense (mRNA) or functional RNA. Expression
may also refer to the production of protein.
[0050] The siRNAs of the present invention can be generated by any
method known to the art, for example, by in vitro transcription,
recombinantly, or by synthetic means. In one example, the siRNAs
can be generated in vitro by using a recombinant enzyme, such as T7
RNA polymerase, and DNA oligonucleotide templates.
Administration of Sensitizing and Therapeutic Agents
[0051] The sensitizing agent and therapeutic agent are administered
to the patient so that the sensitizing and therapeutic agents
contact cells of the patient's respiratory or digestive system. For
example, the sensitizing and/or therapeutic agent may be
administered directly via an airway to cells of the patient's
respiratory system. The sensitizing and therapeutic agents can be
administered intranasally (e.g., nose drops) or by inhalation via
the respiratory system, such as by propellant based metered dose
inhalers or dry powders inhalation devices.
[0052] Formulations suitable for administration include liquid
solutions. Liquid formulations may include diluents, such as water
and alcohols, for example, ethanol, benzyl alcohol, propylene
glycol, glycerin, and the polyethylene alcohols, either with or
without the addition of a pharmaceutically acceptable surfactant,
suspending agent, or emulsifying agent. The therapeutic agent can
be administered in a physiologically acceptable diluent in a
pharmaceutically acceptable carrier, such as a sterile liquid or
mixture of liquids, including water, saline, aqueous dextrose and
related sugar solutions, an alcohol, such as ethanol, isopropanol,
or hexadecyl alcohol, glycols, such as propylene glycol or
polyethylene glycol such as poly(ethyleneglycol) 400, glycerol
ketals, such as 2,2-dimethyl-1,3-dioxolane-4-methanol, ethers, an
oil, a fatty acid, a fatty acid ester or glyceride, or an
acetylated fatty acid glyceride with or without the addition of a
pharmaceutically acceptable surfactant, such as a soap or a
detergent, suspending agent, such as pectin, carbomers,
methylcellulose, hydroxypropylmethylcellulose, or
carboxymethylcellulose, or emulsifying agents and other
pharmaceutical adjuvants.
[0053] The sensitizing and therapeutic agents, alone or in
combination with other suitable components, can be made into
aerosol formulations to be administered via inhalation. These
aerosol formulations can be placed into pressurized acceptable
propellants, such as dichlorodifluoromethane, propane, and
nitrogen. Such aerosol formulations may be administered by metered
dose inhalers. They also may be formulated as pharmaceuticals for
non-pressured preparations, such as in a nebulizer or an atomizer.
In certain embodiments, administration may be, e.g., aerosol,
instillation, intratracheal, intrabronchial or bronchoscopic
deposition.
[0054] In certain embodiments, the therapeutic agent may be
administered in a pharmaceutical composition. Such pharmaceutical
compositions may also comprise a pharmaceutically acceptable
carrier and other ingredients known in the art. The
pharmaceutically acceptable carriers described herein, including,
but not limited to, vehicles, adjuvants, excipients, or diluents,
are well-known to those who are skilled in the art. Typically, the
pharmaceutically acceptable carrier is chemically inert to the
active compounds and has no detrimental side effects or toxicity
under the conditions of use. The pharmaceutically acceptable
carriers can include polymers and polymer matrices. Viscoelastic
gel formulations with, e.g., methylcellulose and/or
carboxymethylcellulose may be beneficial (see Sinn et al., Am J
Respir Cell Mol Biol, 32(5), 404-410 (2005)).
[0055] The sensitizing and therapeutic agents can be administered
by any conventional method available for use in conjunction with
pharmaceuticals, either as individual therapeutic agents or in
combination with at least one additional therapeutic agent.
[0056] In certain embodiments, the sensitizing and therapeutic
agents are administered with an agent that disrupts, e.g.,
transiently disrupts, tight junctions, such as EGTA (see U.S. Pat.
No. 6,855,549).
[0057] The total amount of the sensitizing and therapeutic agents
administered will also be determined by the route, timing and
frequency of administration as well as the existence, nature, and
extent of any adverse side effects that might accompany the
administration of the compound and the desired physiological
effect. It will be appreciated by one skilled in the art that
various conditions or disease states, in particular chronic
conditions or disease states, may require prolonged treatment
involving multiple administrations.
[0058] The sensitizing and therapeutic agents can be formulated as
pharmaceutical compositions and administered to a mammalian host,
such as a human patient in a variety of forms adapted to the chosen
route of administration, i.e., orally or parenterally, by
intravenous, intramuscular, topical or subcutaneous routes.
[0059] Thus, the present compounds may be systemically
administered, e.g., orally, in combination with a pharmaceutically
acceptable vehicle such as an inert diluent or an assimilable
edible carrier. They may be enclosed in hard or soft shell gelatin
capsules, may be compressed into tablets, or may be incorporated
directly with the food of the patient's diet. For oral therapeutic
administration, the active compound may be combined with one or
more excipients and used in the form of ingestible tablets, buccal
tablets, troches, capsules, elixirs, suspensions, syrups, wafers,
and the like. Such compositions and preparations should contain at
least 0.1% of active compound. The percentage of the compositions
and preparations may, of course, be varied and may conveniently be
between about 2 to about 60% of the weight of a given unit dosage
form. The amount of active compound in such therapeutically useful
compositions is such that an effective dosage level will be
obtained.
[0060] The tablets, troches, pills, capsules, and the like may also
contain the following: binders such as gum tragacanth, acacia, corn
starch or gelatin; excipients such as dicalcium phosphate; a
disintegrating agent such as corn starch, potato starch, alginic
acid and the like; a lubricant such as magnesium stearate; and a
sweetening agent such as sucrose, fructose, lactose or aspartame or
a flavoring agent such as peppermint, oil of wintergreen, or cherry
flavoring may be added. When the unit dosage form is a capsule, it
may contain, in addition to materials of the above type, a liquid
carrier, such as a vegetable oil or a polyethylene glycol. Various
other materials may be present as coatings or to otherwise modify
the physical form of the solid unit dosage form. For instance,
tablets, pills, or capsules may be coated with gelatin, wax,
shellac or sugar and the like. A syrup or elixir may contain the
active compound, sucrose or fructose as a sweetening agent, methyl
and propylparabens as preservatives, a dye and flavoring such as
cherry or orange flavor. Of course, any material used in preparing
any unit dosage form should be pharmaceutically acceptable and
substantially non-toxic in the amounts employed. In addition, the
active compound may be incorporated into sustained-release
preparations and devices.
[0061] The sensitizing and therapeutic agents may also be
administered intravenously or intraperitoneally by infusion or
injection. Solutions of the active compound or its salts can be
prepared in water, optionally mixed with a nontoxic surfactant.
Dispersions can also be prepared in glycerol, liquid polyethylene
glycols, triacetin, and mixtures thereof and in oils. Under
ordinary conditions of storage and use, these preparations contain
a preservative to prevent the growth of microorganisms.
[0062] The pharmaceutical dosage forms suitable for injection or
infusion can include sterile aqueous solutions or dispersions or
sterile powders comprising the active ingredient which are adapted
for the extemporaneous preparation of sterile injectable or
infusible solutions or dispersions, optionally encapsulated in
liposomes. In all cases, the ultimate dosage form should be
sterile, fluid and stable under the conditions of manufacture and
storage. The liquid carrier or vehicle can be a solvent or liquid
dispersion medium comprising, for example, water, ethanol, a polyol
(for example, glycerol, propylene glycol, liquid polyethylene
glycols, and the like), vegetable oils, nontoxic glyceryl esters,
and suitable mixtures thereof. The proper fluidity can be
maintained, for example, by the formation of liposomes, by the
maintenance of the required particle size in the case of
dispersions or by the use of surfactants. The prevention of the
action of microorganisms can be brought about by various
antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In
many cases, it will be preferable to include isotonic agents, for
example, sugars, buffers or sodium chloride. Prolonged absorption
of the injectable compositions can be brought about by the use in
the compositions of agents delaying absorption, for example,
aluminum monostearate and gelatin.
[0063] Sterile injectable solutions are prepared by incorporating
the active compound in the required amount in the appropriate
solvent with various of the other ingredients enumerated above, as
required, followed by filter sterilization. In the case of sterile
powders for the preparation of sterile injectable solutions, the
preferred methods of preparation are vacuum drying and the freeze
drying techniques, which yield a powder of the active ingredient
plus any additional desired ingredient present in the previously
sterile-filtered solutions.
[0064] For topical administration, the present compounds may be
applied in pure form, i.e., when they are liquids. However, it will
generally be desirable to administer them to the skin as
compositions or formulations, in combination with a
dermatologically acceptable carrier, which may be a solid or a
liquid.
[0065] Useful solid carriers include finely divided solids such as
talc, clay, microcrystalline cellulose, silica, alumina and the
like. Useful liquid carriers include water, alcohols or glycols or
water-alcohol/glycol blends, in which the present compounds can be
dissolved or dispersed at effective levels, optionally with the aid
of non-toxic surfactants. Adjuvants such as fragrances and
additional antimicrobial agents can be added to optimize the
properties for a given use. The resultant liquid compositions can
be applied from absorbent pads, used to impregnate bandages and
other dressings, or sprayed onto the affected area using pump-type
or aerosol sprayers.
[0066] Thickeners such as synthetic polymers, fatty acids, fatty
acid salts and esters, fatty alcohols, modified celluloses or
modified mineral materials can also be employed with liquid
carriers to form spreadable pastes, gels, ointments, soaps, and the
like, for application directly to the skin of the user.
[0067] Examples of useful dermatological compositions which can be
used to deliver the compounds to the skin are known to the art; for
example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S.
Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and
Wortzman (U.S. Pat. No. 4,820,508).
[0068] Useful dosages of the therapeutic agent can be determined by
comparing their in vitro activity, and in vivo activity in animal
models. Methods for the extrapolation of effective dosages in mice,
and other animals, to humans are known to the art; for example, see
U.S. Pat. No. 4,938,949.
[0069] The amount of the sensitizing and therapeutic agents, or an
active salt or derivative thereof, required for use in treatment
will vary not only with the particular salt selected but also with
the route of administration, the nature of the condition being
treated and the age and condition of the patient and will be
ultimately at the discretion of the attendant physician or
clinician.
[0070] Pharmaceutical compositions are administered in an amount,
and with a frequency, that is effective to inhibit or alleviate the
symptoms of airway epithelial disease (e.g., cystic fibrosis)
and/or to delay the progression of the disease. The effect of a
treatment may be clinically determined by nasal potential
difference measurements as described herein. The precise dosage and
duration of treatment may be determined empirically using known
testing protocols or by testing the compositions in model systems
known in the art and extrapolating therefrom. Dosages may also vary
with the severity of the disease. A pharmaceutical composition is
generally formulated and administered to exert a therapeutically
useful effect while minimizing undesirable side effects. In
general, an oral dose ranges from about 200 mg to about 1000 mg,
which may be administered 1 to 3 times per day. Compositions
administered as an aerosol are generally designed to provide a
final concentration of about 10 to 50 .mu.M at the airway surface,
and may be administered 1 to 3 times per day. It will be apparent
that, for any particular subject, specific dosage regimens may be
adjusted over time according to the individual need. In general,
however, a suitable dose will be in the range of from about 0.5 to
about 100 mg/kg, e.g., from about 10 to about 75 mg/kg of body
weight per day, such as 3 to about 50 mg per kilogram body weight
of the recipient per day, preferably in the range of 6 to 90
mg/kg/day, most preferably in the range of 15 to 60 mg/kg/day.
[0071] The compound is conveniently formulated in unit dosage form;
for example, containing 5 to 1000 mg, conveniently 10 to 750 mg,
most conveniently, 50 to 500 mg of active ingredient per unit
dosage form. In one embodiment, the invention provides a
composition comprising a compound of the invention formulated in
such a unit dosage form.
[0072] The desired dose may conveniently be presented in a single
dose or as divided doses administered at appropriate intervals, for
example, as two, three, four or more sub-doses per day. The
sub-dose itself may be further divided, e.g., into a number of
discrete loosely spaced administrations; such as multiple
inhalations from an insufflator or by application of a plurality of
drops into the eye.
[0073] Compounds of the invention can also be administered in
combination with other therapeutic agents, for example, other
agents that are useful to treat cystic fibrosis. Examples of such
agents include antibiotics. Accordingly, in one embodiment the
invention also provides a composition comprising a therapeutic
agent, or a pharmaceutically acceptable salt thereof, at least one
other therapeutic agent, and a pharmaceutically acceptable diluent
or carrier. The invention also provides a kit comprising a
therapeutic agent, or a pharmaceutically acceptable salt thereof,
at least one other therapeutic agent, packaging material, and
instructions for administering the therapeutic agent or the
pharmaceutically acceptable salt thereof and the other therapeutic
agent or agents to an animal to treat cystic fibrosis.
[0074] A pharmaceutical composition may be prepared with carriers
that protect active ingredients against rapid elimination from the
body, such as time release formulations or coatings. Such carriers
include controlled release formulations, such as, but not limited
to, microencapsulated delivery systems, and biodegradable,
biocompatible polymers, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid
and others known to those of ordinary skill in the art.
[0075] In certain embodiments, the sensitizing and therapeutic
agents are directly administered as a pressurized aerosol or
nebulized formulation to the patient's lungs via inhalation. Such
formulations may contain any of a variety of known aerosol
propellants useful for endopulmonary and/or intranasal inhalation
administration. In addition, water may be present, with or without
any of a variety of cosolvents, surfactants, stabilizers (e.g.,
antioxidants, chelating agents, inert gases and buffers). For
compositions to be administered from multiple dose containers,
antimicrobial agents are typically added. Such compositions are
also generally filtered and sterilized, and may be lyophilized to
provide enhanced stability and to improve solubility.
[0076] As noted above, sensitizing and therapeutic agents may be
administered to a mammal to stimulate chloride transport, and to
treat cystic fibrosis. Patients that may benefit from
administration of a therapeutic compound as described herein are
those afflicted with cystic fibrosis. Such patients may be
identified based on standard criteria that are well known in the
art, including the presence of abnormally high salt concentrations
in the sweat test, the presence of high nasal potentials, or the
presence of a cystic fibrosis-associated mutation. Activation of
chloride transport may also be beneficial in other diseases that
show abnormally high mucus accumulation in the airways, such as
asthma and chronic bronchitis. Similarly, intestinal constipation
may benefit from activation of chloride transport by the
therapeutic agents provided herein.
[0077] The term "therapeutically effective amount," in reference to
treating a disease state/condition, refers to an amount of a
compound either alone or as contained in a pharmaceutical
composition that is capable of having any detectable, positive
effect on any symptom, aspect, or characteristics of a disease
state/condition when administered as a single dose or in multiple
doses. Such effect need not be absolute to be beneficial.
[0078] The terms "treat," "treating" and "treatment" as used herein
include administering a compound prior to the onset of clinical
symptoms of a disease state/condition so as to prevent any symptom,
as well as administering a compound after the onset of clinical
symptoms of a disease state/condition so as to reduce or eliminate
any symptom, aspect or characteristic of the disease
state/condition. Such treating need not be absolute to be
useful.
Example 1
Airway Epithelia Requires Manipulation to Efficiently Internalize
siRNA and Silence Target Genes
[0079] The application of RNA interference-based gene silencing to
the airway surface epithelium holds great promise to manipulate
host and pathogen gene expression for therapeutic purposes.
However, well-differentiated airway epithelia display significant
barriers to double-stranded siRNA oligonucleotide ("oligo")
delivery despite testing varied classes of non-viral reagents. In
well-differentiated primary pig or human airway epithelia grown at
air-liquid interface, the delivery of a Dicer-substrate siRNA
duplex against HPRT with several non-viral reagents showed minimal
oligo uptake and no knockdown of the target. In contrast, poorly
differentiated cells (2-5 day post seeding) exhibited significant
internalization of the oligo and knockdown of the target. This
finding suggested that during differentiation the barrier
properties of the epithelium are modified to an extent that impedes
oligo uptake. Two methods were used to overcome this inefficiency.
First, the impact of agents that enhance macropinocytosis were
tested. Treatment of the cells with EGF, which induces actin
polymerization and membrane protrusion, improved oligo uptake
resulting in significant but modest levels of target knockdown. The
connectivity map was also used to correlate gene expression
signatures associated with mucociliary differentiation of airway
epithelia with small molecule treatments. The resulting drugs
identified were tested for their abilities to safely improve target
knockdown. Interestingly, treatment of well-differentiated cells
with several different drug classes resulted in modest to robust
knockdown of the target when delivered along with a DsiRNA oligo.
These results support that well-differentiated airway epithelia,
normally resistant to siRNA delivery, when pretreated with small
molecules, improved oligo uptake and RNAi responses.
[0080] This study explored the effectiveness of non-viral based
siRNA delivery to reduce target abundance in well-differentiated
primary airway epithelial cells. The results show that cells that
are well-differentiated epithelia are almost completely refractory
to entry of siRNA unless subjected to certain modifications.
[0081] Materials and Methods
[0082] Culture of Human or Pig Airway Epithelia
[0083] Pig airway epithelial cells were obtained from trachea of
lungs removed from slaughtered pigs. The studies were approved by
the institutional review board at the University of Iowa. Human
airway epithelial cells were obtained from trachea and bronchi of
lungs removed for organ donation from non-CF individuals. The
studies were approved by the institutional review board at the
University of Iowa. Cells were isolated by enzyme digestion as
previously described (Karp P H et al., An in vitro model of
differentiated human airway epithelia. Methods for establishing
primary cultures. Methods Mol Biol 2002; 188:115-137). Following
enzymatic dispersion, cells were seeded at a density of
5.times.10.sup.5 cells/cm.sup.2 onto collagen-coated, 0.6 cm.sup.2
semi permeable membrane filters (Millipore polycarbonate filters;
Millipore Corp., Bedford, Mass.). The cells were maintained at
37.degree. C. in a humidified atmosphere of 5% CO.sub.2 air.
Twenty-four hours after plating, the apical media was removed and
the cells were maintained at an air-liquid interface (ALI) to allow
differentiation of the epithelium. The culture medium consisted of
1:1 ratio mix of Dulbecco's modified Eagle's medium (DMEM)/Ham's
F12, 5% Ultroser G (Biosepra SA, Cedex, France), 100 U/ml
penicillin, 100 .mu.g/ml streptomycin, 1% nonessential amino acids
and 0.12 U/ml insulin. Studies were performed on WD cultures
confirmed as cultures containing ciliated cells (by confocal
microscopy) approximately 4 to 6 weeks after initiation of the ALI
cultures.
[0084] Dicer-Substrate siRNA Oligonucleotides
[0085] The 27-mer Dicer-substrate siRNAs (DsiRNAs) were designed
using algorithms developed by Integrated DNA Technologies (IDT,
Coralville, Iowa) and synthesized and HPLC purified by IDT. The
protocol for siRNA design and manufacture has been described in
detail (Kim D H et al., Synthetic dsRNA dicer substrates enhance
RNAi potency and efficacy. Nat Biotechnol 2005; 23(2):222-226;
Behlke M A. Chemical modification of siRNAs for in vivo use.
Oligonucleotides 2008; 18(4):305-319). The digoxigenin
(Dig)-labeled siRNA was also designed and synthesized by IDT. The
DIG label was internally coupled to an amino-dT base in a 2-O'
methyl modified pig-specific DsiRNA against HPRT. The DsiRNAs used
in this study are listed in Table 1.
TABLE-US-00001 TABLE 1 Dicer-substrate siRNA siRNA Target mRNA
siRNA target sequence ssHPRT Pig HPRT 5' pCCAGUAAAGUUAUCACAUGUUCUAG
SEQ ID N0: 1 3' GGIGUCAUUUCAAUAGUGUACAAGAUC SEQ ID NO: 2 hsHPRT
Human HPRT 5' pGCCAGACUUUGUUGGAUUUGAAATT SEQ ID NO: 3 3'
UUCGGUCUGAAACAACCUAAACUUUAA SEQ ID NO: 4 IL-8 1098 Pig IL-8 5'
pGGCAAAUUGUUAAACGAACAGAATA SEQ ID NO: 5 3'
AACCGUUUAACAAUUUGCUUGUCUUAU SEQ ID NO: 6 IL-8 1466 Pig IL-8 5'
pUGAGUGUAACUAUAGAACAUUUACA SEQ ID NO: 7 3'
ACACUCACAUUGAUAUCUUGUAAAUGU SEQ ID NO: 8 SIN3A Human SIN3A 5'
pGCGAUACAUGAAUUCAGAUACUACC SEQ ID NO: 9 3'
CUCGCUAUGUACUUAAGUCUAUGAUGG SEQ ID NO: 10 CFTR Human CFTR 5'
pGGAAGAAUUCUAUUCUCAAUCCAAT SEQ ID NO: 11 3'
UUCCUUCUUAAGAUAAGAGUUAGGUUA SEQ ID NO: 12 DIG-HPRT Pig HPRT 5'
pCCAGUAAAGUUA CACAUGUUCUAG SEQ ID NO: 13 3'
GUGGUCAUUUCAAUAGUGUACAAGAUC SEQ ID NO: 14 NC1 No known 5'
pCGUUAAUCGCGUAUAAUACGCGUAT SEQ ID NO: 15 targets in pig 3'
CAGCAAUUAGCGCAUAUUAUGCGCAUA SEQ ID NO: 16 or human DNA bases are in
bold; 2 O'methyl bases are underlined; amino dT base coupled to DIG
is in italics
[0086] Non-Viral Reagents
[0087] RNAiMAX was purchased from Invitrogen (Invitrogen, Grand
Island, N.Y.). The cationic polymers, PEI, and TAT-PEI were
synthesized and conjugated with siRNA into appropriate NP
concentration in the laboratory of Dr. Aliasger Salem at University
of Iowa. Accell siRNA (Thermo Scientific, Lafayette, Colo.), the
naked siRNA chemically modified for increased functionality,
stability and enhanced uptake by cells, was custom synthesized as
21-nt siRNA with a sequence for control NC1 and a sequence against
pig HPRT. PTD-DRBD was purchased as Transductin from IDT (IDT,
Coralville, Iowa).
[0088] Transfection
[0089] For airway epithelia that were either well or poorly
differentiated, transfection was done mostly according to the
manufacturer's protocol. In all cases, the apical surface of
epithelia was washed twice with PBS before adding the transfection
mixture to the apical surface. The mixture was then left on the
cells for 24 h for all transfection reagents. For PK1 cells,
reverse transfection was performed in a 48-well plate by first
adding the siRNA-RNAiMAX reagent mixture onto the plate and then
adding the dispersed cells (40,000 cells) on top of the mixture and
allowing the cells to adhere and establish growth for 24 h. Before
some transfections, pretreatment of cells with various chemicals
were performed: Keratinocyte Growth Factor (KGF; Prospec, East
Brunswick, N.J.) 50 ng/ml added both apically and basolaterally for
24 h; EGTA 6 mM added apically for 30 m;
N-Acetyl-L-Leucyl-L-Leucyl-L-Norleucinal (LLnL; ICN Biochemicals,
Inc, Costa Mesa, Calif.) 40 .mu.M added both apically and
basolaterally for 24 hrs; human Epidermal Growth Factor (EGF;
Sigma-Aldrich, St. Louis, Mo.) 100 .mu.g/ml, added apically for 15
m.
[0090] RNA Isolation and Quantitative Real-Time PCR
[0091] Total RNA was isolated using SV96 RNA isolation kit
(Promega), according to manufacturer's protocol. Two hundred fifty
ng of total RNA were reverse transcribed using oligo (dT) (Roche,
Indianapolis, Ind.) and random hexamers (Invitrogen, Grand Island,
N.Y.) and Superscript II (Invitrogen, Grand Island, N.Y.) according
to manufacturer's instructions. One-fifteenth of the cDNA was then
amplified and analyzed by Taqman assay in the 7900 Real Time PCR
System (Applied Biosystems) using synthesized primer-probe pairs
(IDT, Coralville, Iowa), reaction buffer and Immolase DNA
polymerase (Bioline, Taunton, Mass.). The reaction mix was
contained in a total volume of 10 .mu.l and the reaction condition
was an initial cycle of 95.degree. C. for 10 min, then 40 cycles of
95.degree. C. for 15 s and 60.degree. C. for 1 min. All data were
normalized to the internal standard, RPL4 mRNA for pig airway
samples and SFRS9 mRNA for human airway samples. Absolute
quantification of an mRNA target sequence within an unknown sample
was determined by reference to a standard curve. The standard curve
was based on the real-time PCR amplification of standard amounts of
the specific gene in a control NC1 cDNA. PCR efficiency for all
reactions was within the acceptable margin of 90-110%. All the
results of the samples were presented as remaining mRNA level in
comparison to the mRNA level in the control samples (NC1), which
was normalized to 100%.
[0092] Confocal Imaging
[0093] The primary human airway epithelia grown at air-liquid
interface were transfected with the DIG-labeled siRNA at a
concentration of 250 ng/ml after complexing with Transductin. The
transfection mixture was left on the apical surface for 2 h. At the
end of this period, the cells were fixed in 2% formaldehyde,
permeabilized in 0.2% Triton-x-100 and blocked in 1% BSA for 1 h.
The cells were then stained with mouse antibody to DIG (Roche
Biochemicals) for 1 h followed by either Alexa 488 labeled goat
anti-mouse secondary antibody for 1 h followed by Alexa 488 labeled
rabbit anti-mouse tertiary antibody (Invitrogen) for 1 or in some
cases with Alexa 564 goat anti-mouse secondary antibody for 1 h.
The cells were finally stained with nuclear stain, ToPro 3 for 10
minutes. The filter, containing the cells, was removed from the
culture insert by cutting the edges with razor blade and then
mounted onto a slide by the use of Vectashield. The slide was
visualized by confocal microscopy.
[0094] Connectivity Map Analysis
[0095] The connectivity map is a large public database (Lamb J et
al., The connectivity map: Using gene-expression signatures to
connect small molecules, genes, and disease. Science 2006;
313(5795):1929-1935) of gene expression data sets in response to
drug treatments that can be used to connect a researcher's gene
expression signatures, explaining a particular biological process,
with small molecules that share a similar mechanism of action. The
input query signature in our study was a published microarray
profile (Ross A J et al., Transcriptional profiling of mucociliary
differentiation in human airway epithelial cells. Am J Respir Cell
Mol Biol 2007; 37(2):169-185) that reflects the longitudinal gene
expression changes associated with mucocilliary differentiation of
the human bronchial epithelial cells. Specifically, genes that had
more than 3-fold expression changes during the differentiation of
cells from 0-day old cultures to 4-day old cultures or 0 day
cultures to 8-day old cultures or 4-day old cultures to 8-day old
cultures were used as input signatures (probe ID defined by the
Affymetrix GeneChip Human Genome U133A array). Each reference
signature in the database was compared with the input signature and
given a score termed the "connectivity score" based on the extent
of similarity between the two. Score ranged from +1 meaning higher
similarity, to 0 meaning no similarity and -1 meaning opposite
similarity. We evaluated candidate agents that induced a `reverse
signature` (connectivity score of -1 or closer to it), i.e. changes
in gene expression in a direction opposite to the differentiation
process. Also, some were selected from the permuted results, which
give statistical significance of the replicates (permutation P
value).
[0096] Small Molecules
[0097] Wortmannin was purchased from Sigma (St. Louis, Mo.) as a
ready to use solution. LY-294002, Triciribine hydrate, and
Meclofenamic acid were purchased from Sigma (St. Louis, Mo.) and
were dissolved in DMSO. Monensin was purchased from Sigma (St.
Louis, Mo.) and was dissolved in water. For experiments with drugs,
the cells were pre-treated with drugs for 6 h usually at a
concentration that was used in the Cmap study (Lamb J et al., The
connectivity map: Using gene-expression signatures to connect small
molecules, genes, and disease. Science 2006; 313(5795):1929-1935)
or in other published studies. After the drug treatment, the cells
were transfected with siRNA as described before.
[0098] Results
[0099] Dicer-Substrate siRNA Silence Gene Expression in PK1
Cells
[0100] siRNAs were designed and synthesized to specifically target
pig HPRT (ssHPRT) and IL-8 (IL-8 1098 and IL-8 1466). The efficacy
and the functionality of these siRNAs were tested by reverse
transfecting them into a pig kidney cell line (PK1). Quantitative
real-time PCR was performed to measure the extent of mRNA
reduction. FIG. 1 shows the remaining mRNA levels of the respective
genes 24 h post translation. A nontargeting siRNA was used as a
control (NC1). The targeting mRNA was decreased by more than 90%
when the cells were treated with two different concentrations (1 nM
and 10 nM) of specific siRNAs as compared with the nontargeting
control (FIG. 6). The siRNAs targeting the human genes (HPRT, SIN3A
and CFTR) were either tested directly in primary airway cultures
maintained in air-liquid interface, or tested in other cell lines
(data not shown). The sequences of all the siRNAs are listed (see
Table 1).
[0101] siRNA delivery has no silencing effect in well
differentiated cultures
[0102] The goal was to test the effectiveness of the siRNA in
primary airway epithelial cells. Well differentiated airway
cultures are maintained at the air-liquid interface and simulate to
a great extent the in vivo morphology and thus are an ideal system
to test efficacy of siRNA and nonviral delivery reagents. Various
nonviral reagents or siRNA enhancements were tested, including
cationic polymers (PEI or TAT-PEI), modified naked siRNA (Accell),
peptide reagent (PTD-DRBD or Transductin) and lipid transfection
reagent (RNAiMAX) in well-differentiated cells. As shown in FIG. 2,
no silencing of HPRT mRNA was observed on apical transfection of
HPRT siRNA into pig airway cells with polymers, Accell or
Transductin (FIG. 1a). Nor was there a reduction of HPRT mRNA
levels in human airway epithelia following transfection of siRNA
conjugated with RNAiMAX or Transductin (FIG. 7). Thus,
well-differentiated airway cultures are not amenable to siRNA
transfection with a broad range of transfection reagents and siRNA
targets were not inhibited.
[0103] Well-Differentiated Transfected Cells on Imaging Show
Minimal Uptake of siRNA
[0104] After failing to silence targets in well-differentiated
cells, it was investigated if the reason for this failure was
because of a failure to uptake siRNA. siRNA was labelled with DIG
and transfected them into cells using Transductin. Subsequently,
the cell layers were fixed and processed for detection of the DIG
label using fluorescent labeled anti-DIG antibodies. Confocal
imaging of the cells revealed little to no internalization of siRNA
in both pig airway cells (FIG. 1b,c) and human airway cells (FIG.
10a, b). The results suggest that the inability of the epithelia to
silence gene expression is largely due to a failure of the siRNA to
enter the cells.
[0105] KGF, EGTA, and LLnL Treatment of Cells Prior to siRNA
Treatment have No Effect on Target Silencing
[0106] The decreased ability of well-differentiated cells to uptake
siRNA prompted the inventors to investigate the effect of
interventions known to influence cellular processes including
proliferation, permeability, processing on siRNA transfection and
silencing. Keratinocyte growth factor (KGF) is a member of the
fibroblast growth factor family. It has been shown previously that
KGF stimulates proliferation of differentiated human tracheal and
bronchial epithelia. Pretreatment of pig airway cells with KGF
prior to transfection of specific siRNA with either RNAiMAX or
Transductin did not reduce the mRNA levels of HPRT in comparison to
nonsilencing siRNA (FIG. 8a). In addition, the cells were treated
with EGTA, a calcium chelator, which causes a reversible increase
in paracellular permeability. Similar to the result seen with KGF,
siRNA transfection of cells with either RNAiMAX or Transductin,
after treatment with EGTA, did not result in silencing of HPRT
(FIG. 8b). Lastly, the cells were treated with a proteasome
inhibitor (LLnL) prior to transfection. LLnL is a tripeptide
proteasome inhibitor and has been shown to enhance recombinant
adeno-associated virus type 2 (rAAV-2) transduction from the apical
surface of human airway epithelia by modulating the intracellular
trafficking and processing of the virus. We wanted to examine if
LLnL has an effect on transfection efficiency and endocytosis of
siRNA as well. Treatment with LLnL had no effect on silencing of
HPRT following transfection of specific siRNA with either RNAiMAX
or Transductin (FIG. 8c). Thus, well-differentiated cells are
refractory to siRNA transfection even with certain physiological
manipulation of the cells.
[0107] siRNA Delivery Effectively Silences Targets in Poorly
Differentiated Epithelia
[0108] Since well-differentiated cells exhibit significant
extracellular barriers to siRNA entry, it was hypothesized that
poorly-differentiated cells, which lack many barriers of mature
cells, might be conducive to siRNA entry and knockdown of the
target gene. In contrast to well differentiated culture, poorly
differentiated epithelia lack ciliated and goblet cells and do not
have a pseudo stratified columnar architecture. On transfection of
poorly differentiated pig airway epithelia (2-day old post seeding)
with siRNA against HPRT, a decrease in mRNA levels was seen with
all transfection reagents used. siRNA transfection showed decrease
in HPRT mRNA levels of about 40% with RNAiMAX, 60-70% with Accell,
and about 50%-60% with Transductin (FIG. 2). Similar reduction was
also seen when these cells were transfected with siRNA against pig
IL-8 (FIG. S4a) or poorly differentiated human airway cells were
transfected with HPRT (Supplementary FIG. 9b). These results
demonstrated that airway cells very early post seeding and hence
not well differentiated are conducive to transfection of siRNA and
knockdown of targets.
[0109] Poorly Differentiated Transfected Cells on Imaging Show Good
Uptake of siRNA
[0110] After observing the silencing of target genes in poorly
differentiated epithelia, it was examined whether siRNA
internalization can be visualized as a result. Two days after
seeding, cells were studied for siRNA uptake by transfecting the
DIG-labeled siRNA with Transductin and subsequently imaging 2 h
later by confocal microscopy. In contrast to results in well
differentiated cells, abundant internalization of siRNA was
observed in both pig and human airway epithelia (FIG. 2b,c and FIG.
10c,d). In combination with previous results, these data indicate
that siRNAs can silence targets in poorly differentiated airway
epithelia by virtue of their ability to readily enter these
cells.
[0111] Effective Silencing of Targets are Seen Only in Cells that
are Less than 5-Day Old
[0112] The previous results showed that following siRNA
transfection, silencing is seen in poorly differentiated (2-day
post seeding), but not in well-differentiated epithelial cells.
Next it was investigated how the time in culture after cell seeding
influenced siRNA entry and target knockdown. Primary airway
epithelia, maintained at air-liquid interface, take a minimum of
two-four weeks after seeding to fully differentiate into a
pseudo-stratified columnar epithelium. Cells obtained from two
donors of pigs were seeded and batches of cells from 2 to 5 days
post seeding were transfected with HPRT siRNA complexed with
Transductin. Quantitative real time PCR was used to estimate the
levels of mRNA remaining compared to those of nontargeting siRNA.
As shown in FIG. 3a, in both donor cultures tested, 20-45%
reduction in HPRT mRNA was seen in cultures of day 2 to day 4. In
contrast, no silencing was seen in cells that were 5-days old (FIG.
3a). Alternatively, the cells were also visualized for siRNA entry
after DIG-siRNA transfection following 2 to 5 days in culture. The
presence or absence of knockdown of the target correlated with the
internalization of DIG-siRNA (FIG. 3b-e). Cells transfected with
siRNA against IL-8 also showed decrease in IL-8 mRNA in 2-day old
cells, but not in 5-day old cells (FIG. 11a). Similarly, human
airway epithelial showed no knockdown of HPRT in 5 day old cultures
(FIG. 11b). Thus, silencing of targets is restricted to a narrow
time window in culture before cells undergo differentiation.
[0113] EGF Treatment of Cell Prior to siRNA Delivery Enhances siRNA
Entry and Cause Modest Silencing
[0114] It can be concluded from the these results that during and
after differentiation the barrier properties of the epithelia
impede siRNA entry. It was hypothesized that manipulation of the
cells to enhance endocytosis might promote better cellular uptake
of siRNA and silencing of target genes. Epidermal Growth Factor
(EGF) induces rapid actin filament assembly in the membrane
skeleton of variety of cells, which can result in membrane ruffling
and macropinocytosis. The inventors reasoned that since the Tat
protein, the cell penetrating domain of Transductin, has been shown
to enter cells through macropinocytosis, EGF treatment of cells
prior to transfection of siRNA-Transductin complex might enhance
cellular entry of siRNA. Human airway cells treated with EGF (100
.mu.g/ml for 15 min) prior to transfection of siRNA showed decrease
in HPRT mRNA levels of about 15-20% consistently when examined with
cultures from 3 different donors (FIG. 4a). EGF treated cells (100
.mu.g/ml for 15 min) imaged for siRNA entry 2 h after transfection
showed increased uptake of the DIG signal compared to the untreated
cells (data not shown). These results show that a transient
cellular response to EGF can increase both the uptake of siRNA and
silencing of target genes.
[0115] Connectivity Map Analysis Links Gene Signature of
Mucociliary Differentiation to Small Molecules
[0116] Ross et. al (Ross A J et al., Transcriptional profiling of
mucociliary differentiation in human airway epithelial cells. Am J
Respir Cell Mol Biol 2007; 37(2):169-185) previously identified
genes involved in mucociliary differentiation of human bronchial
epithelial cells grown at air-liquid interface over a period of
28-days. Since the results of our experiments show effective
silencing of target genes in cells less than one week old, the gene
expression profiles from cells at days, 0, 4 and 8 of culture was
utilized. It was theorized that changes in gene expression during
these periods might contribute to the development of barriers to
siRNA entry. To identify small molecule agents that induce or
counteract these changes, the connectivity map (Cmap) database was
queried (Lamb J et al., The connectivity map: Using gene-expression
signatures to connect small molecules, genes, and disease. Science
2006; 313(5795):1929-1935). Connectivity map is a large public
database of gene expression in response to drug treatment of cell
lines. Investigators compare a genomic signature describing
physiological state or disease to the Cmap database to discover
connections among drugs, genes and diseases. The database was
queried using signatures comprised of >3-fold gene expression
changes from epithelia between 0 and 4 days, 0 and 8 days and 4 and
8 days during mucociliary differentiation of airway culture.
Several small molecular agents were positively or negatively
correlated to the reference signatures. The inventors were
interested in agents that might drive gene expression changes in
well differentiated airway cells towards poorly differentiated
cells and therefore had high negative or anti-correlation score
with respect to reference signature. Four agents were selected that
were highly ranked with a strong anti-correlation score
(connectivity score of -1 or closer to -1). These included
LY-294002, ergocalciferol, paclitaxel, and nifedipine. Two
additional agents that were highly ranked in the permuted results
according to their P-values were also selected: naltrexone and
fasudil. As a negative control in the present experiments, two
drugs were selected, monensin, and meclofenamic acid, that had
strong positive correlation scores (connectivity score of +1 or
closer to +1).
[0117] Small Molecule Treatment of Cells, Based on Connectivity
Map, Prior to siRNA Delivery Cause Effective Silencing of
Targets
[0118] Primary airway epithelia were treated with the selected
small molecular agents at a concentration that was selected from
the Cmap study or published literature. The time of treatment was 6
hours as used in the Cmap study. At the end of 6 h, the cells were
transfected with siRNA-Transductin complex for a period of 24 h
before the cells were processed for qPCR to quantitate the mRNA
levels in the samples. When the pig or human epithelia were
transfected with the specific siRNA against HPRT, we observed no
reduction in mRNA levels for treated with ergocalciferol,
paclitaxel, nifedipine, naltrexone or fasudil (data not shown). In
contrast, following LY-294002 treatment (10 .mu.M), human and pig
epithelia showed silencing of HPRT at a level of about 40% (FIG.
5a) and 20% (FIG. 5b) respectively, compared to that of
nontargeting control. Results from several donor cells showed a
range of silencing effects, 10-55% inhibition in human airway cells
and 10-20% in pig airway cells (data not shown). The siRNA
silencing effect was a result of improved siRNA uptake, as shown by
fluorescent images of cells treated with LY-294002 and transfected
with DIG-siRNA (data not shown). LY-294002 inhibits all four
classes of PI3K isoforms and has been one of the most successful
and most widely used pathway inhibitors. The PI3K pathway, which is
inhibited by LY-294002, is activated by upstream receptor tyrosine
kinases by various growth factors. Activation of this pathway
results in a broad range of downstream signaling events, mostly
growth promoting or pleiotropic effects. Independent of its kinase
inhibition mechanism of action, LY-294002 can also cause certain
other effects in cells. In order to identify the enhanced silencing
effect following LY-294002 treatment is a result of PI3K pathway
inhibition or because of its other actions, cells were treated with
other PI3K pathway inhibitors, namely wortmannin and triciribine.
Wortmannin, unlike LY-294002, is an irreversible inhibitor of PI3K
pathway and triciribine is an inhibitor of AKT, a downstream
effector in the PI3K pathway. Since treatment of pig epithelia
resulted in moderate decreases in mRNA levels, we decided to use
only human airway cells for further experiments. Pretreatment of
epithelia with increasing doses of wortmannin and triciribine
before siRNA transfection resulted in dose dependent decreases in
HPRT mRNA levels (FIG. 5c). Treatment of cells with 10 nM and 40 nM
of wortmannin resulted about 20% and 30% decrease, respectively, in
HPRT mRNA levels compared to that of nontargeting controls; while
treatment of cells with 20 .mu.M and 60 .mu.M triciribine resulted
in 20% and 35% decrease, respectively, in HPRT mRNA levels compared
to that of nontargeting controls (FIG. 5c). These findings suggest
that the improved silencing of siRNA target is a consequence of
cellular changes that occur in response to PI3K pathway. The
effects of LY-294002 were also tested on two other siRNA gene
targets, namely CFTR and SIN3A. Pretreatment of human airway cells
with 10 mM of LY-294002 before transfection with specific siRNA
resulted in 20% and 25% reduction in mRNA levels of CFTR and SIN3A,
respectively, when compared to that of nontargeting control (FIG.
12a,b).
[0119] Although the foregoing specification and examples fully
disclose and enable the present invention, they are not intended to
limit the scope of the invention, which is defined by the claims
appended hereto.
[0120] All publications, patents and patent applications are
incorporated herein by reference. While in the foregoing
specification this invention has been described in relation to
certain embodiments thereof, and many details have been set forth
for purposes of illustration, it will be apparent to those skilled
in the art that the invention is susceptible to additional
embodiments and that certain of the details described herein may be
varied considerably without departing from the basic principles of
the invention.
[0121] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention are to be
construed to cover both the singular and the plural, unless
otherwise indicated herein or clearly contradicted by context. The
terms "comprising," "having," "including," and "containing" are to
be construed as open-ended terms (i.e., meaning "including, but not
limited to") unless otherwise noted. Recitation of ranges of values
herein are merely intended to serve as a shorthand method of
referring individually to each separate value falling within the
range, unless otherwise indicated herein, and each separate value
is incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0122] Embodiments of this invention are described herein,
including the best mode known to the inventors for carrying out the
invention. Variations of those embodiments may become apparent to
those of ordinary skill in the art upon reading the foregoing
description. The inventors expect skilled artisans to employ such
variations as appropriate, and the inventors intend for the
invention to be practiced otherwise than as specifically described
herein. Accordingly, this invention includes all modifications and
equivalents of the subject matter recited in the claims appended
hereto as permitted by applicable law. Moreover, any combination of
the above-described elements in all possible variations thereof is
encompassed by the invention unless otherwise indicated herein or
otherwise clearly contradicted by context.
Sequence CWU 1
1
16125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1ccaguaaagu uaucacaugu ucuag
25227RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2cuagaacaug ugauaacuuu acugngg
27325DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3gccagacuuu guuggauuug aaatt
25427RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 4aauuucaaau ccaacaaagu cuggcuu
27525DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 5ggcaaauugu uaaacgaaca gaata
25627RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6uauucuguuc guuuaacaau uugccaa
27725DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7ugaguguaac uauagaacau uuaca
25827RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8uguaaauguu cuauaguuac acucaca
27925DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9gcgauacaug aauucagaua cuacc
251027RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 10gguaguaucu gaauucaugu aucgcuc
271125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 11ggaagaauuc uauucucaau ccaat
251227RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 12auuggauuga gaauagaauu cuuccuu
271325DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 13ccaguaaagu uatcacaugu ucuag
251427RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 14cuagaacaug ugauaacuuu acuggug
271525DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 15cguuaaucgc guauaauacg cguat
251627RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16auacgcguau uauacgcgau uaacgac 27
* * * * *