U.S. patent application number 13/917269 was filed with the patent office on 2013-10-10 for method for differentiating embryonic stem cells into cells expressing aqp-1.
The applicant listed for this patent is Agency for Science, Technology and Research. Invention is credited to Gunter Maubach, Karthikeyan Narayanan, Annegret Schumacher, Karl M. Schumacher, Jackie Y. Ying.
Application Number | 20130268060 13/917269 |
Document ID | / |
Family ID | 40259873 |
Filed Date | 2013-10-10 |
United States Patent
Application |
20130268060 |
Kind Code |
A1 |
Schumacher; Karl M. ; et
al. |
October 10, 2013 |
METHOD FOR DIFFERENTIATING EMBRYONIC STEM CELLS INTO CELLS
EXPRESSING AQP-1
Abstract
The present invention relates to methods of differentiating a
human embryonic stem (ES) cell into a cell, specifically a renal
epithelial cell, expressing AQP-I. The methods disclosed comprise
culturing human ES cells in a renal specific medium in the presence
of an extracellular matrix molecule. The cells produced according
to said method can be used to treat renal related disorders such as
renal failure, nephrosis, Bright's disease and glomerulitis.
Inventors: |
Schumacher; Karl M.;
(Singapore, SG) ; Ying; Jackie Y.; (Singapore,
SG) ; Schumacher; Annegret; (Singapore, SG) ;
Narayanan; Karthikeyan; (Singapore, SG) ; Maubach;
Gunter; (Singapore, SG) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Agency for Science, Technology and Research |
Singapore |
|
SG |
|
|
Family ID: |
40259873 |
Appl. No.: |
13/917269 |
Filed: |
June 13, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12669457 |
Nov 29, 2010 |
8481316 |
|
|
PCT/SG08/00263 |
Jul 21, 2008 |
|
|
|
13917269 |
|
|
|
|
60929960 |
Jul 19, 2007 |
|
|
|
Current U.S.
Class: |
623/1.35 ;
435/366 |
Current CPC
Class: |
C12N 2506/02 20130101;
C12N 5/0686 20130101; A61P 13/12 20180101; A61F 2/06 20130101; C12N
2501/155 20130101; C12N 2501/11 20130101 |
Class at
Publication: |
623/1.35 ;
435/366 |
International
Class: |
C12N 5/071 20060101
C12N005/071; A61F 2/06 20060101 A61F002/06 |
Claims
1. A population of cells differentiated directly from a population
of human embryonic stem cells in a renal-specific culture medium
and in the presence of an extracellular matrix molecule, wherein
about 2% to about 50% of the cells express AQP-1.
2. The population of cells according to claim 1, when prepared by
culturing an undifferentiated hES cell in a renal-specific culture
medium in the presence of an extracellular matrix (ECM) molecule,
under conditions sufficient to induce differentiation of the hES
cell to a cell expressing AQP-1.
3. A bioartificial tubule assist device comprising a hollow core
fibre having an interior lumen, the interior lumen coated with an
extracellular matrix (ECM) molecule and a population of cells of
claim 1.
4. A method of preparing a bioartificial tubule assist device, the
method comprising providing a bioartificial tubule assist device
comprising a hollow core fibre having an interior lumen and seeding
the interior lumen with a population of cells of claim 1, wherein
the interior lumen is coated with an extracellular matrix molecule
prior to seeding with the population of cells.
5. The method according to claim 4 wherein the interior lumen is
coated with an extracellular matrix molecule comprising at least
one of fibronectin, laminin, collagen IV and Matrigel matrix.
6. The method according to claim 4, wherein the population of cells
is cultured to a confluent monolayer coating the interior
lumen.
7. A method of treating a renal related disorder in a subject in
need thereof, the method comprising implanting an effective amount
of a population of cells of claim 1 in the subject at a site where
cells expressing AQP-1 are required.
8. The method according to claim 7 wherein the population of cells
is provided within a bioartificial tubule assist device of claim
3.
9. A method of treating a renal related disorder in a subject
comprising externally connecting a bioartificial tubule assist
device of claim 3 to a subject in need thereof.
10. The method according to claim 7 wherein the renal related
disorder comprises renal failure, nephropathy, diabetic
nephropathy, nephrosis, Bright's disease, renal insufficiency,
glomerulitis, glomerulosclerosis or nephritis.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a division of application Ser. No. 12/669,457, filed
Nov. 29, 2010, which was the National Stage of International
Application No. PCT/SG08/00263, filed Jul. 21, 2008, which claims
the benefit of U.S. Provisional Application No. 60/929,960, filed
Jul. 19, 2007, all of the contents of which are fully incorporated
herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to methods for differentiating
embryonic stem cells into cells expressing AQP-I.
BACKGROUND OF THE INVENTION
[0003] Various approaches in regenerative medicine that are aimed
at replacing lost functions of organs are limited by a lack of
sources of sufficient cells. Thus, significant research has been
directed towards exploring human embryonic stem (hES) cells as a
potential cell source. Human embryonic stem (hES) cells are capable
of indefinite self-renewal and are pluripotent; that is, these
cells are able to differentiate into practically every type of cell
found in the organism from which they are derived (2,3). As such,
hES cells may provide a supply of different cell types for use in a
variety of research and medical purposes.
[0004] One such use is in the treatment of renal disease and loss
of renal function. The increasing prevalence of type II diabetes
has led to a growing incidence of end-stage renal disease. This
increased prevalence combined with the limited alternatives for
treatment has made kidney disease a major world-wide health problem
(2,4).
[0005] The major functions of the kidney include the elimination of
metabolic waste products and the regulation of water, electrolyte
and acid-base balance. These are mainly achieved by (i) a
filtration process that takes place in the glomeruli and leads to
the formation of a primary filtrate volume of 180 I/day, and (ii) a
reabsorption process in the subsequent tubular system (5-7). Upon
filtration, most of the water and the dissolved substances return
through transport over the proximal tubulus epithelium, back to the
capillary system with or without reduced reabsorption of the
metabolic waste products (5-7). The massive water reabsorption is
enabled by a specific water-transporting channel protein named
aquaporin-1 (AQP-I), which is localized on the cell membranes of
epithelial cells, lining the renal proximal tubulus structures as a
monolayer (8-10).
[0006] Artificial devices have been designed to mimic renal
function. In such devices a size-selective filtration process
normally performed by the glomeruli can be performed by polymer
membranes that are assembled as hollow fibers in cartridges, and
devices for hemodialysis or hemofiltration have been proven
successful in clinical applications, hi contrast, development of
methods to mimic the renal reabsorption function seems to be highly
dependent on the specific functionalities of renal cells
(11-12).
SUMMARY OF THE INVENTION
[0007] The present invention provides a method for generating from
human embryonic stem (hES) cells in vitro cells that can transport
water in a manner similar to renal epithelial cells. The method
involves culturing the hES cells in renal-specific growth medium
and in the presence of an extracellular matrix molecule to provide
nephrogenic differentiation conditions that induce differentiation
into cells expressing aquaporin 1 (AQP-I).
[0008] Thus the present method has the potential to provide a much
needed cell source for the therapy including the treatment of lost
renal function through bioartificial devices, cell therapies to
replace epithelial tissues and tissue engineering.
[0009] hi one aspect, there is provided a method of differentiating
a human embryonic stem (hES) cell into a cell expressing AQP-I, the
method comprising culturing an undifferentiated hES cell in a
renal-specific culture medium in the presence of an extracellular
matrix (ECM) molecule, under conditions sufficient to induce
differentiation of the hES cell to a cell expressing AQP-I.
[0010] In different embodiments, the renal-specific culture medium
may comprise renal epithelial basal medium or renal epithelial
growth medium and may comprise epithelial growth factor. The ECM
molecule may comprise at least one of fibronectin, laminin,
collagen FV and Matrigel matrix. Bone morphogenetic protein 2 may
be added to the renal-specific culture medium before or during
culturing of the cell.
[0011] In one embodiment, the method comprises adding bone
morphogenetic protein 2 to the renal-specific culture medium at a
concentration of from about 2.5 to about 10 ng/ml before or during
culturing, wherein culturing comprises growing the cells for 7-10
days,--the renal-specific culture medium comprises renal epithelial
growth medium and the ECM molecule comprises Matrigel matrix, and
wherein once differentiated, the cell expresses AQP-I and at least
one of CK-18, .beta.-catenin, CD-326 and CD-133.
[0012] In another aspect, there is provided a population of cells
differentiated directly from a population of human embryonic stem
cells in a renal-specific culture medium and in the presence of an
extracellular matrix molecule, wherein about 2% to about 50% of the
cells express AQP-I. The population of cells may be prepared by the
methods as described herein.
[0013] In yet another aspect, there is provided a bioartificial
tubule assist device comprising a hollow core fibre having an
interior lumen, the interior lumen coated with an extracellular
matrix (ECM) molecule and a population of cells as described
herein.
[0014] In a further aspect, there is provided a method of preparing
a bioartificial tubule assist device, the method comprising
providing a bioartificial tubule assist device comprising a hollow
core fibre having an interior lumen and seeding the interior lumen
with a population of cells as described herein, wherein the
interior lumen is coated with an extracellular matrix molecule
prior to seeding with the population of cells.
[0015] The extracellular matrix molecule may comprise at least one
of fibronectin, laminin, collagen IV and Matrigel matrix. The cells
may be cultured to a confluent monolayer coating the interior
lumen.
[0016] In still a further aspect, there is provided a method of
treating a renal related disorder in a subject in need thereof, the
method comprising implanting an effective amount of a population of
cells as described herein in the subject at a site where cells
expressing AQP-I are required. The cells may be implanted directly
or may be provided in a bioartificial tubule assist device.
[0017] In yet a further aspect, there is provided a method of
treating a renal related disorder in a subject comprising
externally connecting a bioartificial tubule assist device as
described herein to a subject in need thereof.
[0018] The renal related disorder may comprise renal failure,
nephropathy, diabetic nephropathy, nephrosis, Bright's disease,
renal insufficiency, glomerulitis, glomerulosclerosis or
nephritis.
[0019] Other aspects and features of the present invention will
become apparent to those of ordinary skill in the art upon review
of the following description of specific embodiments of the
invention in conjunction with the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In the figures, which illustrate, by way of example only,
embodiments of the present invention:
[0021] FIG. 1: Culture of undifferentiated hES cells, a, hES cells
cultured on a MEF feeder layer, and on MATRIGEL.TM. (MG) with
MEF-derived conditioned medium. b, Immunostaining of hES cells
showed expression of Oct3/4 (red). DAPI was used to stain the
nucleus (blue), c, Gene expression analysis by RT-PCR for stem cell
specific markers such as Oct3/4, Sox2, CD9 and Nanog in the two
culture conditions.
[0022] FIG. 2: Differentiation of hES cells into AQP-I expressing
epithelial cells, a, hES cells cultured on fibronectin (FN),
laminin (Lam), collagen type IV (Col IV) and MATRIGEL.TM. (MG) for
10 days were immunostained with AQP-I (red) and cytokeratin-18
(green). DAPI was used to stain the nucleus (blue), b, hES cells
subcultured under the same culture conditions were immunostained
with AQP-I (red) along with DAPI (blue), a-c, Increased AQP-I
expression could be found when cells were cultured on MATRIGEL.TM.,
and when cells were subcultured on all four selected ECM molecules,
d, Double staining experiments showed that differentiated hES cells
expressing AQP-I (red) were epithelial cells stained with
cytokeratin-18 (green), e, Differentiated hES cells, in particular
the AQP-I expressing cells (green), were stained positive for HNuc
(red), indicating their human origin.
[0023] FIG. 3: Protein profile of undifferentiated (lane 6) and
differentiated hES cells (lanes 1-5). Total protein was extracted
from cells grown on fibronectin (lane 1), laminin (lane 2),
collagen IV (lane 3), MATRIGEL.TM. (lane 4), subcultured on
fibronectin (lane 5), and undifferentiated hES cells (lane 6), and
subjected to SDS-PAGE, followed by electrotransfer onto PVDF
membranes. The membranes were probed with antibodies such as AQP-I,
CK-18, /3-catenin, Oct3/4 and GAPDH. Undifferentiated hES cells
(lane 6) show no expression for AQP-I and /3-catenin, and a weak
expression for cytokeratin-18, while expression of Oct3/4 was
maintained. In contrast, under nephrogenic culture conditions,
up-regulation of AQP-I, CK-18 and /3-catenin was observed. This
expression pattern was found at higher intensities when the cells
were cultured on MATRIGEL.TM. (lane 4), and subcultured on
fibronectin (lane 5). These results indicate the adoption of a
functional epithelial phenotype (n=6).
[0024] FIG. 4: Individual component analysis on hES cell
attachment, growth and cell proliferation, a, The effect of
omitting single factors in REGM. Few cells were attached to the
MATRIGEL.TM. surface in the absence of FBS. All other conditions
led to cell attachment and growth, b, Role of various factors on
cell proliferation. Insulin, epinephrine (epinep) and transferrin
(TF) were shown to be important for hES cell proliferation. EGF,
hydrocortisone (HC) and T3 had a minor effect on hES cell
proliferation, c, Role of EGF and insulin on the AQP-I expression.
Fewer AQP-I expressing cells were observed in REGM depleted with
EGF, whereas AQP-I expression was not significantly affected in the
absence of insulin.
[0025] FIG. 5: Effect of BMP-2 on the AQP-I and CD receptor
expression in differentiated hES cells, a, REGM culture medium with
BMP-2 caused an increased expression of AQP-I in differentiated
single cells compared to plain REGM, where a more clonal AQP-I
expression was observed, b, Differentiated hES cells (black bars)
showed expressions of CD56, CD133 and CD326. CD133 and CD326
expressions were also observed with primary human proximal tubule
cells (grey bars), indicating a similar phenotype as the
differentiated hES cells with regard to their CD receptor
expression profile.
[0026] FIG. 6: In vitro and in vivo function assessments of
differentiated hES cells, a, The differentiated cells were seeded
onto a SUPOR-800 polysulfone membrane, and cultured in a perfusion
bioreactor for 7-10 days. After perfusion culture, over 90% of the
differentiated hES cells revealed simultaneous AQP-I (red) and
cytokeratin-18 (green) expressions (n=8). b, Water transport assay
with calcein-loaded cells showed that several differentiated hES
cells (marked with arrows) lost their calcein staining after
exposure to a hypotonic solution, indicating the functionality of
AQP-I expressing channels, c, Injection of undifferentiated hES
cells under the renal capsule of SCID mice led to teratoma tumor
formation, whereas the injection of differentiated cells showed no
tumor formation (the injection area was indicated by arrow).
[0027] FIG. 7: Expression of megalin. This figure is a photograph
of cells with fluorescent staining depicting expression of
megalin.
[0028] FIG. 8: Expression of AQP-2, AQP-3, AQP-4 and megalin. PCR
results for AQP-2, AQP-3, AQP-4 and megalin, showing expression in
renal epithelial-like (RD-hES) cells differentiated according to
the present method as compared to hES cells.
DETAILED DESCRIPTION
[0029] In vitro differentiation of hES cells into hematopoietic,
neuronal and cardiac cells has been observed (1,13,14) and studies
have shown that different culture conditions, including the
presence of different growth factors, favour the formation and
growth of particular cell types (13,15,16). However there has been
no report of directed in vitro differentiation of hES cells into
human renal epithelial cells.
[0030] Recently, studies have reported successful directed
differentiation of mouse embryonic stem (mES) into renal progenitor
cells (4,17). The addition of factors including activin A, retinoic
acid, bone morphogenetic protein (BMP) 7 and BMP4 to culture media
has been shown to induce differentiation into renal progenitor
cells. However, the methods disclosed in these studies are limited
to the differentiation of mES cells and are not instructive on the
differentiation of hES cells. Differences exist between the
differentiation of mES and hES cells and the effect of cellular
factors and signals on these cells. For example, when cells are
grown on tissue culture dishes in vitro, the presence of leukemia
inhibitory factor (LIF) causes mES cells to remain in an
undifferentiated state while hES cells lose pluripotency and
differentiate rapidly despite the presence of LIF (3,18).
Similarly, BMP4 suppresses differentiation of mES cells but
promotes differentiation of hES cells (3). mES and hES cells also
differ in the stages of differentiation when certain cell surface
markers are present, suggesting basic species differences between
the differentiation of ES cells in early mouse and early human
development (19).
[0031] The reported methods of inducing differentiation of mES to a
renal lineage have employed indirect differentiation through
embryoid body (EB) formation. However, such an approach results in
a heterogeneous population of differentiated cells and a low yield
of renal progenitor cells.
[0032] To date, there has been no published report of aquaporin 1
(AQP-I) positive epithelial cells derived from hES cells using a
direct differentiation protocol. As stated above, AQP-I is a
water-transporting channel protein localized on the cell membranes
of renal epithelial cells that line the renal proximal tubulus
structures. AQP-I plays a role in the water reabsorption function
of the kidneys.
[0033] The present methods are based on the finding that human
embryonic stem (hES) cells can be induced in vitro to differentiate
into renal epithelial-like cells possessing water transport
functionality by culturing them in renal-specific culture
conditions. The present methods provide a method to differentiate
hES cells to cells expressing AQP-I. The differentiated hES cells
produced by the present methods could be cultured for a period of 7
days in a perfusion bioreactor without loss in the AQP-I
expression. The methods include culturing hES cells in a
renal-specific culture medium in the presence of an extracellular
matrix (ECM) molecule to provide nephrogenic differentiation
conditions. The cells produced by the present methods may also
exhibit a similar CD receptor expression profile as that found in
human proximal tubule cells. Thus, the present methods provide a
differentiation protocol for the generation of functional renal
epithelial-like cells.
[0034] When used to differentiate a population of cells, the
present methods result in from about 2% or more, and in some
instances from about 2% to about 50% of the cells in the population
differentiating to renal epithelial-like cells expressing AQP-I.
Thus, when used to differentiate a population of cells, the methods
described herein may result in some but not all of the hES cells
differentiating to renal epithelial-like cells.
[0035] When added to a renal-specific culture medium, epithelial
growth factor (EGF) and/or bone morphogenetic protein-2 (BMP-2)
were found to increase differentiation of hES cells to renal
epithelial-like cells as compared to the use of a renal-specific
culture medium without one or both of these or factors. As well,
multiple passages or sub-culturing of a population of cells may
increase the proportion of cells that differentiate into renal
epithelial-like cells possessing water transport functionality.
[0036] The present method allows for the direct differentiation of
hES cells into renal epithelial-like cells without the formation of
embryoid bodies (EBs). An EB is an aggregate of cells that can
facilitate differentiation comparable to an embryo and thus can
contains cells from all three germ layers, the ectoderm, meosderm
and endoderm. In indirect differentiation, ES cells are first
aggregated to form EBs and then the EBs are exposed to conditions
to promote differentiation into renal progenitor cells. Since the
formation of EBs leads to the formation of multiple cell types,
indirect differentiation using EBs results in a heterogeneous
population of differentiated cells and a low yield of renal
progenitor cells. Omission of the formation of embryoid bodies in a
hES cell differentiation protocol was found improve the efficiency
of differentiation into osteogenic cells (20). Thus, without being
limited to any particular theory, it appears that the present
method allows for a relatively uniform cellular environment and a
more homogeneous population of differentiated cells, and thus is
likely to provide a higher yield of renal epithelial-like cells
than methods involving the formation of EBs.
[0037] As used herein, the term "renal epithelial-like cell" refers
to a cell or cells that are differentiated directly from hES cells
to express renal epithelial cell protein markers, including one or
more of CK-18, .beta.-catenin, AQP-I, AQP-2, AQP-4 and megalin. A
renal epithelial cell protein marker includes a cellular protein
expressed in human renal epithelial cells and which is not
expressed or is expressed to a lesser extent in human embryonic
stem cells. Such a marker may be used as indication that a
particular cell has differentiated from an hES cell to become a
renal epithelial-like cell.
[0038] "Water transporting functionality" refers to a
characteristic of a cell, or a cell population that includes cells,
expressing AQP-I and is thus able to take up water in a manner
functionally similar to a renal epithelial cell involved in water
reabsorption. Thus, a cell that possesses water transporting
functionality expresses AQP-I and is able to, has the capability
of, or can function to take up water as in the renal reabsorption
process.
[0039] Thus, there is provided a method of differentiating human
embryonic stem cells into cells expressing AQP-I. The method
comprises culturing hES cells in a renal-specific culture medium in
the presence of an extracellular matrix (ECM) molecule.
[0040] The hES cells used in the present method are
undifferentiated hES cells.
[0041] As used herein, the term "cell" when referring to a human
embryonic stem cell is intended to refer to a single cell as well
as a plurality or population of cells. Similarly, the term "cells"
is also intended to refer to a single cell, where context allows.
The cell may be a cell grown in batch culture or in tissue culture
plates. The undifferentiated hES cell or cells are typically
originally obtained from a blastocyst, as is known in the art, but
may be previously expanded while kept in an undifferentiated
state.
[0042] Generally, methods of culturing hES cells to maintain the
cells in an undifferentiated state is known and thus the hES cells
may be maintained in an undifferentiated state using known methods
for hES cells, with or without feeder cells, prior to use in the
present method. In one embodiment, undifferentiated hES cells are
maintained by culturing the hES cells on a feeder cell layer, such
as mouse embryonic fibroblast (MEF) feeder layer. In another
embodiment, the hES cells used in the methods may be from a
feeder-free culture. For example, hES cells first cultured with
feeder cells, such as MEFs, may then be cultured in the absence of
feeder cells on extracellular matrix molecule, including for
example MATRIGEL.TM.. In one embodiment, the hES cells used are
first cultured on a layer of MEFs and then subsequently cultured on
a MATRIGEL.TM. layer using condition medium collected from the MEF
feeder layer in order to obtain fibroblast-free undifferentiated
hES cells.
[0043] In order to induce differentiation, the undifferentiated hES
cells are cultured in a renal-specific culture medium. The
renal-specific culture medium may be any growth medium designed to
support the growth of renal cells and that contains nutrients and
factors required to maintain attachment, growth and proliferation
of hES and induce the hES cells to differentiate and express AQP-I.
The renal-specific growth medium may contain basal factors to allow
for expansion of a renal cell population, and may also be
supplemented with additional factors, including fetal calf serum
(FCS), growth factors such as epidermal growth factor (EGF) and
basic fibroblast growth factor (bFGF), insulin, hydrocortisone,
epinephrine, and tri-iodothyronine (T3). Renal-specific culture
media are known and may be commercially available, including renal
epithelial basal medium (REBM) and renal epithelial growth medium
(REGM, available from Cambrex, USA).
[0044] The renal-specific culture medium may be supplemented with
EGF, for example about 0.05% to about 2.0% EGF, about 0.05% to
about 1.0% EGF, about 0.075% to about 0.5% EGF, or about 0.1% to
about 0.25%. The renal-specific culture medium may also be
supplemented with BMP-2, for example about 0.5 to about 50 ng/ml
BMP-2, about 1 to about 25 ng/ml BMP-2, or about 2.5 to about 10
ng/ml BMP-2.
[0045] hi one embodiment, REGM is used as the renal-specific growth
medium. REGM comprises REBM supplemented with about 0.25% FCS,
about 0.1% EGF, about 0.1% insulin, about 0.1% hydrocortisone,
about 0.1% epinephrine, and about 0.1% triiodothyronine.
[0046] Without being limited to any particular theory, based on
observations of the effect of omitting different factors from REGM,
FCS may be required for hES cell attachment, hi addition, insulin,
epinephrine and transferrin may play roles in hES cell
proliferation and EGF may play a role in inducing differentiation
of the hES cells to renal epithelial-like cells. Thus, the
renal-specific culture medium in one embodiment comprises FCS,
insulin, epinephrine, transferrin and EGF. In another embodiment
the renal-specific culture medium comprises EGF.
[0047] In addition to the renal-specific culture medium, an
extracellular matrix (ECM) molecule is included in the growth
conditions in order to induce the undifferentiated hES cells to
differentiate into cells expressing AQP-I. In one embodiment, the
hES cells are seeded on culture surface coated with ECM molecules
to mimic the epithelial basement membrane. The ECM molecule may be
any ECM molecule or mixture of ECM molecules that supports the
growth of hES cells in renal-specific culture medium. For example,
the ECM molecule may be fibronectin, laminin, collagen type IV or
MATRIGEL.TM. (BD Biosciences). MATRIGEL.TM. Matrix is a solubulized
basement membrane preparation extracted from EHS mouse sarcoma and
comprises various basement membrane components and bound growth
factors that are known to promote the establishment of epithelial
tissues (22), including laminin, collagen IV, heparan sulfate
proteoglycans and entactin.
[0048] The hES cells are grown in the renal-specific culture medium
in the presence of the ECM molecule for a time period and at a
temperature and under growth conditions sufficient to induce
differentiation of at least some of the hES cells including
expression of AQP-I.
[0049] For example, the cells may be cultured up to 30 days, for
example from 5-15 days or from 7-10 days at 37.degree. C. with
2-10% CO.sub.2, or 5% CO.sub.2.
[0050] As stated above, when the present methods are performed on a
cell population such as a cell culture, not every cell within the
population or culture will necessarily differentiate to a cell
expressing AQP-I. Thus, some cells within the population or culture
may not differentiate and may retain their hES nature while other
cells within the same population or culture are induced to
differentiate and to express AQP-I.
[0051] Thus, the present method may result in differentiation of
the hES cells to cells expressing AQP-I to the extent that about 2%
or more of the cells in the culture population express renal
epithelial markers, including at least AQP-I and which may also
express one or more of CK-18, .beta.-catenin, AQP-2, AQP-4 and
megalin. For example, about 2% or more, about 5% or more, about 10%
or more, about 15% or more, about 20% or more or about 25% or more
of the cell population may express renal epithelial cell markers.
In other embodiments, from about 2% to about 50%, from about 5% to
about 50%, from about 10% to about 50%, from about 15% to about
50%, from about 20% to about 50%, or from about 25% to about 50% of
the cells may differentiate cells expressing AQP-I and possibly
other renal epithelial markers.
[0052] The extent of differentiation to cells expressing AQP-I may
be readily determined by a skilled person using standard
methodology, including as described in the Example below, such as
immunohistochemical techniques, Western blot techniques and PCR
techniques to confirm expression of particular marker proteins.
Furthermore, similarity between the differentiated cell population
produced by the method of the present invention and primary human
proximal tubule cells may be demonstrated by CD receptor expression
profile, including CD-326 and CD-133. In addition, the ability of
the cells to transport water may be determined using methods as
described in the Example below, including assaying for fluorescence
before and after exposure to a hypotonic solution, using a
fluorescent marker such as calcein.
[0053] Subculturing of the hES cells for one or more additional
growth period in a renal-specific growth medium on an ECM molecule
may increase the extent of differentiation of the hES cells to
renal epithelial-like cells. For example, the cells may be removed
from the initial culture medium, optionally washed and then placed
in fresh renal-specific growth medium along with ECM molecule for
an additional culture period, such as from 5-30 days, from 5-15
days or from 7-10 days. The cells may be passaged or subcultured
multiple times, for example one, two, three, four times, which may
increase the number of cells in the culture that have
differentiated to express AQP-I.
[0054] Bone morphogenetic protein 2 (BMP-2) may be involved in
switching on AQP-I expression levels in single cells. Thus, BMP-2
may optionally be added to the culture medium to increase the
number of AQP-I positive cells obtained. For example, from about
1.0 to about 20 ng/ml or from about 2.5 to about 10 ng/ml BMP-2 may
be included in the culture medium. The BMP-2 may be added to the
culture medium at the beginning of the differentiation method, for
example prior to adding cells to-the culture medium, or the BMP-2
may be added at later stages in the differentiation method,
including at any point at which the cells may be sub-cultured.
[0055] The present method conveniently provides in vitro generation
of cells expressing AQP-I from hES cells by directed
differentiation. The generated cells can be used in cell therapies,
including to treat lost renal function. In particular, the cells
expressing AQP-I of the present invention demonstrate water
transport functionality which is essential to the water adsorption
function of kidney epithelial cells. In addition, the renal
epithelial-like cells of the present invention may be capable of
maintaining a high degree of water-transporting channel protein
aquaporin-1 (AQP-I) expression after 7 days of culture in a
perfusion bioreactor, indicating utility in a BTAD. As will be
understood, a perfusion culture model mimics an epithelial barrier
by having a basal and luminal side.
[0056] Thus, the present method may be used to produce a cell
expressing AQP-I or a population of cells expressing AQP-I. As
described above, the cell or population of cells may express other
epithelial markers, including CK-18, .beta.-catenin, CD-326 and
CD-133. For a population of cells, about 2% or more, about 5% or
more, about 10% or more, about 15% or more, about 20% or more or
about 25% or more of the cell population may express AQP-I and
other renal epithelial cell markers. In other embodiments, from
about 2% to about 50%, from about 5% to about 0.50%, from about 10%
to about 50%, from about 15% to about 50%, from about 20% to about
50%, or from about 25% to about 50% of the cells may differentiate
to express AQP-I and other renal epithelial markers.
[0057] The presently described cells may be used in vivo or in
vitro to provide cells possessing water transporting functionality
and may be useful in regenerative strategies such as regenerative
therapy and bioengineering. Regenerative therapy involves the use
of cells to repair or replace diseased tissue or organs. For
example, renal-like cells are delivered to a diseased kidney where
they are incorporated to replace the function of damaged tissue
(2). Bioengineering is another regenerative strategy that involves
the use of organ specific cells in combination with other factors
and a matrix to create a de novo replacement organ (2).
[0058] It has been previously recognized that embryonic stem cells
could potentially provide a cell source for cell therapy strategies
(17, 23-25). However, prior to the present methods, directed in
vitro generation of renal-like cells from hES cells was not known
and the functionality of cells derived from hES in cell therapy
strategies has been primarily hypothetical (2,12,26). As such,
treatment of renal disease has been mainly focused on organ
transplantation or gene therapy (26).
[0059] Previous studies have shown that the renal reabsorption
function can be successfully conducted by human proximal tubule
epithelial cells isolated from kidney donor organs and seeded on
polysulfone hollow fiber systems (11). This approach has been
successfully demonstrated in Phase I/II clinical trials, with an
immunoprotective barrier on the polysulfone membrane to permit the
use of allogeneic cell sources in a cell therapeutic application
(11, 23). However, this approach is limited by the shortage of
kidney donor organs. Organs will generally be transplanted if
available, thus only in a few cases will the donor organs be used
as a cell source for a bioartificial tubule assist device.
[0060] Due to their water transporting functionality, the cells
expressing AQP-I produced according to the present methods provide
a readily obtainable source of cells that may be used in
bioartificial tubule assist devices in strategies to replace lost
renal function. Thus, also contemplated herein are devices and
methods for the treatment of lost renal function that incorporate
the differentiated cells expressing AQP-I of the present
invention.
[0061] The present invention provides a bioartificial tubule assist
device containing cells expressing AQP-I generated in vitro from
hES cells, which device may be used for the treatment of lost
kidney function.
[0062] Generally, bioartificial tubule assist devices are designed
as hollow core fibres having an interior lumen. Typically, the
lumen is formed at least in part by a tubular or flat bed having a
porous surface or membrane. Cells are seeded on the porous surface
or membrane and allowed to attach and expand in population on the
surface. The surfaces are typically exposed to fluid on two sides
(the cell free side and the side with seeded cells). Such devices
are known in the art (Ingenta) and may be incorporated into
bioreactor system or connected to a patient as in the manner of a
dialysis device.
[0063] For example, in such a device a hollow-fiber hemofiltration
cartridge with a membrane surface may be used as a scaffold for
cell growth. The inner lumen of the hollow fiber may be coated with
a suitable ECM molecule and cells added to the interior of the
lumen in the presence of renal-specific culture medium as described
above.
[0064] Thus, there is provided a method of preparing a device, the
method comprising differentiating hES cells into cells expressing
AQP-I as described above, either before or after seeding the cells
into an interior lumen of a hollow fibre device, the interior lumen
coated with an ECM molecule, including one or more of fibronectin,
laminin, collagen IV and Matrigel matrix.
[0065] The cell population may thus be grown on the inner surface
of the hollow fiber to provide within the bioartificial tubule
assist device a monolayer, including a confluent monolayer, of
renal epithelial-like cells or a population in which some of the
cells are differentiated to express AQP-I as described above.
[0066] hES cells prior to differentiation may be seeded into the
device and differentiated after seeding. Alternatively, the cells
may be differentiated in a renal-specific culture medium prior to
seeding into the device.
[0067] As stated above, the cells, once seeded into the interior of
the hollow fiber device, may be expanded, including to confluence.
Expansion may be performed by growing the cells under suitable
conditions for growth and multiplication of the cell population
using a renal-specific culture medium, as described above.
[0068] By placing the presently described cells within such a
device, the cells may be used in clinical applications while being
separated by blood circulation via artificial immunological
barriers, reducing risk of immune rejection or other immune
complications and risk of possible tumourigenesis which may occur
with undifferentiated stem cells.
[0069] The above described bioartificial tubule assist device may
be used to treat a subject having a renal related disorder. The
cells within the bioartificial tubule assist device may act to
reasbsorb substances within the kidney ultrafiltrate, thus
mimicking the filtration and reabsorption functions of a healthy
kidney.
[0070] Thus, there is also presently provided a method of treating
a renal related disorder in a subject. The method comprises
connecting a bioartificial tubule assist device of the present
invention to a subject in need thereof.
[0071] Treating a renal related disorder refers to an approach for
obtaining beneficial or desired results, including clinical
results. Beneficial or desired clinical results can include, but
are not limited to, alleviation or amelioration of one or more
symptoms or conditions, diminishment of extent of disorder or
disease, stabilization of the state of disease, prevention of
development of disorder or disease, prevention of spread of
disorder or disease, delay or slowing of disorder or disease
progression, delay or slowing of disorder or disease onset,
amelioration or palliation of the disorder or disease state, and
remission (whether partial or total). "Treating" can also mean
prolonging survival of a subject beyond that expected in the
absence of treatment. "Treating" can also mean inhibiting the
progression of disorder or disease, slowing the progression of
disorder or disease temporarily, although more preferably, it
involves halting the progression of the disorder or disease
permanently.
[0072] The subject may be any subject having a renal related
disorder or requiring treatment for a renal related disorder. A
renal related disorder refers to any disease, disorder or condition
which may cause, result in, or is associated with renal
degeneration or renal failure, including nephropathy, diabetic
nephropathy, nephrosis, Bright's disease, renal insufficiency,
glomerulitis, glomerulosclerosis, or nephritis.
[0073] As stated above, such devices and uses of such devices are
known in the art. Generally, the device is used in a manner similar
to a conventional dialysis device or hemofiltration device. The
device is connected externally to a subject and the subject's blood
or fluid is pumped through the device, past the membrane with the
cells seeded on the opposite side of the membrane and then
eventually back into the subject. The cells are able to transport
water as the blood or fluid from the subject is passed through the
device.
[0074] There is also presently provided a method of treating a
renal related disorder in a subject comprising implanting a cell or
device of the present invention in a subject in need thereof.
[0075] Implantable devices are known, for example as described in
U.S. Pat. Nos. 6,150,164 and 6,942,879.
[0076] The cell or device may be implanted using standard surgical
or injection methods. The cell or device may be implanted at a
suitable site in the subject to provide therapeutic treatment of
the renal related disorder, for example a site where renal
epithelial cells are required, including in the renal proximal
tubulus structure.
[0077] An effective amount of cells expressing AQP-I, including
cells within a bioartificial tubule assist device, possessing water
transporting functionality is administered to the subject. The term
"effective amount" as used herein means an amount effective, at
dosages and for periods of time necessary to achieve the desired
result, for example, to treat the renal related disorder.
[0078] The number of total number cells to be administered will
vary, depending on several factors, including the severity and type
of the renal related disorder, the mode of administration, and the
age and health of the subject.
[0079] It will be appreciated that the cells expressing AQP-I may
be administered to treat a renal related disorder in combination
with other treatments or therapies, including drug therapy,
dialysis treatment and surgery.
[0080] The present methods, cell populations, devices and uses are
further exemplified by way of the following non-limited
examples.
EXAMPLES
Example 1
[0081] In this example, human embryonic stem (hES) were seeded on
various culture surfaces with different extracellular matrix (ECM)
components and cultured in a renal epithelial growth medium (REGM).
This method was applied to differentiate hES into renal
epithelial-like cells. After 10 days of culture in REGM,
immunohistochemistry and Western blotting revealed expression of
AQP-I and CK-18 indicating an epithelial phenotype. Flow cytometry
showed that the differentiated cells had a CD receptor expression
profile similar to that found in human renal proximal tubule. In
addition, the differentiated cells exhibited functional water
transport and could be cultured for 7 days in a perfusion
bioreactor without loss of AQP-I expression. Thus, this method
provides a differentiation protocol for the generation of
functional renal epithelial-like cells that can potentially be used
in strategies to replace lost renal function.
[0082] Materials and Methods
[0083] hES cell culture and differentiation: The HUES-7 cell line
(obtained from Howard Hughes Medical Institute, USA) was cultured
at 37.degree. C. with 5% of CO.sub.2 on neomycin-resistant primary
mouse fibroblasts, strain FVB (Cat. No. PMEF-N, CHEMICON
International, USA) in Knock-out DMEM (Invitrogen, USA, Cat. No.
10829018) supplemented with 20% of serum replacement (Invitrogen,
Cat. No. 10828028), 1% of GlutaMax (Invitrogen, Cat. No. 35050061),
1% of a non-essential amino acid solution (Invitrogen, Cat. No.
11140-050), 1% of penicillin-streptomycin (Invitrogen, Cat. No.
15070-063), 0.004% of basic fibroblast growth factor (bFGF)
(Invitrogen, Cat. No. 13526029), and 0.1% of 2-mercaptoethanol
(Invitrogen, Cat. No. 21985023). The primary mouse fibroblasts were
plated on a T75 flask coated with 0.1% of gelatin (Sigma, USA). The
culture medium was changed every day and cultured between 7 and 10
days. The conditioned culture media from MEF's were collected and
used with hES cells along with 10 ng/ml of bFGF. The hES cells
cultured on the fibroblast layer were trypsinized (0.05% of
trypsin, Invitrogen, USA), scraped, and filtered through a
100-.mu.m mesh. The filtered cells were cultured on a MATRIGELT.TM.
Matrix (BD Biosciences, Germany) coated (diluted 1:20 in Knock-out
DMEM) culture flask containing conditioned culture media from
MEF's. The hES cells were subcultured twice to obtain
fibroblast-free culture conditions (3,18,21). The expression of
Oct3/4 (Fig. Ib), Sox2, CD9 and Nanog, detected by RT-PCR analysis,
(Fig. Ic) confirmed the undifferentiated status of the hES
cells.
[0084] Upon expansion, the cells were seeded on various ECM
molecule coatings and cultured using REGM (Cambrex, USA) for 7-10
days. The ECM coatings were prepared as follows; fibronectin
(Invitrogen, Cat. No. 33016015), 50 .mu.g/ml in phosphate-buffered
saline (PBS), natural mouse laminin (Invitrogen, Cat. No.
33016015), 1.3 mg/ml 1:15 diluted in PBS and collagen IV (BD
Biosciences, Cat.-No. 354233)), 1:9 diluted in 0.05 M HCl. The
solutions were each exposed for 1 h to the surface of the cell
culture flask and than removed. The culture medium was changed
every other day. The subcultivation was performed by using 2 ml of
trypsin solution (Cambrex, Cat.-No. .alpha.-5012) for 1-2 min,
followed by the addition of 2 ml of trypsin neutralization solution
(Cambrex, Cat. No. cc-5002). The cells were centrifuged at
500.times.g for 5 min. The culture medium was changed every other
day. Human proximal tubule cells were cultured on a
fibronectin-coated culture flask in REGM (Cambrex, USA). For
certain experiments, BCP-2 was added at increasing concentration
from 2.5 to 10 ng/ml to the REGM.
[0085] RNA isolation and two-step RT-PCR: The total RNA was
isolated from the cells using the NucleoSpin RNA II isolation kit
(Macherey-Nagel, Germany) according to the manufacturer's protocol.
One microgram of total RNA was reverse transcribed into cDNA using
the High-capacity cDNA archive kit (Applied Biosystems, USA).
Briefly, 50 .mu.l of total RNA was mixed with 2.times. master mix
containing RT buffer, dNTP mixture, random hexamer and
MultiscribeRT (5 U/.mu.l). The reaction mixture was incubated in a
thermal cycler (PTC-200, MJ Research, USA) for 10 min at 25.degree.
C., followed by 2 h at 37.degree. C. 1 .mu.l of each cDNA was used
in the PCR reaction with the Platinum PCR Supermix (Invitrogen,
USA). The reaction conditions were 95.degree. C. for 3 min,
94.degree. C. for 30 s, 55.degree. C. for 1 min, 72.degree. C. for
1 min, amplified for 45 cycles. The primers for PCR were designed
using the Primer Express 3.0 software (Applied Biosystems, USA) and
the respective human sequences from Genbank. The primers were as
follows: SOX2 sense CCCATQCACCGCTACGA [SEQ ID NO.: 1], antisense
GGTGCCCTGCTGCGAGTA [SEQ ID NO.: 2], Nanog sense
TCCTCCATGGATCTGCTTATTCA [SEQ ID NO.: 3], antisense
CTTCCTTTTTTGCGACACTATTCTC [SEQ ID NO.: 4], Oct3/4 sense
AGTGCCCGAAACCCACACT [SEQ ID NO.: 5], antisense TTCTGGCGCCGGTTACAG
[SEQ ID NO.: 6], CD9 sense CGTTCGGCCCAGGCTAA [SEQ ID NO.: 7],
antisense CAAGCCAQAAGATGAAGTTAAATCC [SEQ ID NO.: 8], 18S sense
CGGAGGTTCGAAGACGATCA [SEQ ID NO.: 9], antisense GGCGGGTCATGGGAATAAC
[SEQ ID NO.: 10], AQP-2 sense CCACCTCCTTGGGATCCATT [SEQ ID NO.:11],
antisense GTGACGACAGCTGGAGCCA [SEQ ID NO.:12], AQP-3 sense
CCCATCGTGTCCCCACTC [SEQ ID NO.: 13], antisense GCCGATCATCAGCTGQTACA
[SEQ ID NO.:14], AQP-4 sense ACATQGAGGTQGAGGACAACA [SEQ ID NO.:
15], antisense CCCGGTCAACGTCAATCAC [SEQ ID NO.: 16], Megalin sense
GGCCTCAGTGTTGTGTATTA [SEQ ID NO.: 17], antisense GAGCCAAGGGTTCACTAC
[SEQ ID NO.: 18]. AU primers are given in the 5' to 3' direction.
The PCR products were resolved on agarose gel and visualized using
ethidiun.alpha. bromide.
[0086] Immunohistochemistry: The cells were fixed in ice-cold
ethanol for 10 min. After 3 rinses with PBS, the samples were
incubated with blocking solution containing PBS, 10% of FCS and 1%
of bovine serum albumin (BSA) for 30 min. The antibodies against
AQP-I, .beta.-catenin, Oct3/4 (all from Sigma, USA), Ms X Hu Nuclei
(HNuc, Chemicon International, USA) and cytokeratin-18 (CK-18,
Zymed Technologies, USA) were diluted at a ratio of 1:100 and
incubated for 2 h at room temperature. After 3 washes, the
specimens were incubated for 45 min with appropriate secondary
antibodies at a dilution of 1:200 in PBS containing 1% of BSA. DAPI
was obtained from Sigma-Aldrich (Germany) for nuclear staining. The
specimens were then analyzed using an 1.times.71 Olympus
microscope. Images were taken with a digital camera and processed
using Photoshop 5.5 (Adobe Systems, San Jose, Calif., USA); a cell
count was performed visually. The percentage of AQP-1-positive
cells was obtained from the ratio of AQP-1-positive/D API-positive
cells to AQP-1-negative/D API-positive cells.
[0087] Western blotting: The cells were lysed in SDS-Laemmli buffer
and sonicated. 15 .mu.g of the total protein was loaded onto each
lane and were separated according to their molecular weight in
SDS-PAGE. The proteins were transferred to polyvinylidine fluoride
(PVDF) membrane (Millipore, Bedford, USA) using the semi-dry
Western blot apparatus (BIO-RAD, USA) at 15 V for 30 min. The
remaining binding sites were blocked with PBS containing 5% of
non-fat dry milk and 0.02% of Tween for 1 h at room temperature.
The membrane was incubated with either AQP-I, .beta.-catenin,
Oct3/4, GAPDH (all from Santa Cruz Biotechnology, USA) and
cytokeratin-18 (CK-18, Zymed Technologies, USA) overnight at
4.degree. C. After 3 washing steps, the membrane was incubated with
alkaline phosphate-conjugated secondary antibodies (Dianova,
Germany) for 45 min. The blot was developed with a BCIP/NBT Kit
(Zymed Technologies, USA). The immunoblots were documented using a
Scan Jet 6200 C scanner (Hewlett Packard, Greely, USA). The
assessment of the apparent molecular weight was done by means of
SDS-PAGE standards, which were run in parallel in each experiment
(n=6).
[0088] Flow cytometry: 1 million cells were suspended in 80 .mu.l
of PBS containing 0.5% of BSA and 2 niM of
ethylenediaminetetraacetic acid (EDTA), 20 .mu.l of FcR blocking
reagent were added. Subsequently, 10 .mu.l of the phycoerythrin
(PE)-conjugated antibodies CD31, CD45, CD56, CD133 and CD326 (all
obtained from Miltenyi Biotec, Germany) were added for 10 min.
Control experiments were performed without antibody administration
and isotype controls. The cells were washed three times with buffer
addition and centrifugation for 10 min at 300*g. The analysis was
performed using a LSR II 3-laser FACS analyzer (BD Biosciences,
USA).
[0089] Water transport assay using calcein: Cells were cultured in
a monolayer in tissue culture plates for at least 24 h prior to the
assay. The cells were washed with PBS (without calcium and
magnesium salts) three times, each for 1 min. The cells were loaded
with calcein-AM (Invitrogen, USA) at a final concentration of 1.6
.mu.M in PBS for 10 min, followed by 3 washing steps with PBS, each
for 1 min. Cells were then live imaged in a fluorescent microscope
setup with a CCD camera. The medium was changed to a hypotonic
(0.06% NaCl in water) solution. Time lapse images were taken at an
interval of 10 s for 10 min. The Metamorph software (Molecular
Devices, USA) was used to measure the fluorescence intensity.
[0090] Bioreactor set-up and in vivo experiments: A SUPOR-800
polysulfone membrane (Pall Corporation, USA) with a pore size of
0.8 .mu.m was coated for 1 h with MATRIGEL.TM. diluted 1:20 in
REGM. Subsequently, differentiated hES cells were seeded onto the
membrane, and cultured in REGM for 24 h under 5% of CO.sub.2 at
37.degree. C. The membrane with the cells was then placed in a
bioreactor that has an inlet and an outlet. REGM was superfused
over the membrane with the adherent hES cells at a flow rate of 0.1
ml/min, with recirculation of the culture medium through
gas-permeable silicone tubes. The system was maintained under 5%
OfCO.sub.2 at 37.degree. C., with the silicone tubes allowing for
gas exchange (27). The membrane with the cells was subjected to
further analysis after 7-10 days of perfusion culture.
[0091] The animal experiments were conducted according to the
approved IACUC application #060160 and NUS-IRB Reference Code
06-052. SCID mice were anesthetized and 1 million cells were
injected under the renal capsule. After 6 weeks, the kidneys were
removed and paraffin-embedded. 6-.mu.m sections were cut using a
microtome, and stained with Hematoxylin & Eosin.
[0092] Results
[0093] The HUES-7 cell line obtained from the Howard Hughes Medical
Institute (USA) were maintained in an embryonic status on a mouse
embryonic fibroblast (MEF) feeder layer (Fig. Ia) (16). The hES
cells were subcultured twice on a surface coated with MATRIGEL.TM.
diluted in Knock-out Dulbecco's modified Eagle's medium (DMEM)
using conditioned medium collected from the MEF feeder layer (Figs.
Ia and b) to obtain fibroblast-free culture conditions (17-19).
Expression of Oct3/4 (Fig. Ib), Sox2, CD9 and Nanog (FIG. Ic)
confirmed the undifferentiated status under both conditions.
[0094] To initiate differentiation, the cells were cultured in a
renal epithelial growth medium (REGM) for 10 days. The REGM
comprises a renal epithelial basal medium (REBM) supplemented with
several factors, such as 0.25% of fetal calf serum (FCS), epidermal
growth factor (EGF), insulin, hydrocortisone, epinephrine and T3,
each at 0.1% of concentration. To mimic the epithelial basement
membrane, various culture surfaces with different ECM components
such as fibronectin, laminin, collagen type IV and MATRIGEL.TM.
were examined.
[0095] Initial experiments with DMEM culture media containing 10%
of FCS revealed only very few attached hES cells. However, REGM
caused a significant cell attachment and cell spreading in all ECM
coatings applied. After 10 days of culture in REGM,
immunohistochemistry with AQP-I antibody showed similar expression
pattern (with 5-10% of positive cells) for fibronectin, laminin and
collagen IV, while MATRIGEL.TM. yielded a higher positive
expression of AQP-I (with 22% of positive cells (FIG. 2a)).
Subculture of the hES cells on the same ECM led to a further
increase in the AQP-I positive cells in all 4 ECM coatings (FIG.
2b). The percentage of AQP-I expressing cells is summarized in FIG.
2c. The REGM culture medium significantly promoted cell spreading
and AQP-I expression in hES cells, m addition, the subculture of
hES on the same ECM and culture in REGM led to an increased number
of AQP-I expressing cells, independent of the respective ECM type.
Dual staining with CK-18 antibody revealed that all AQP-I
expressing cells express CK-18 (FIG. 2d), indicating their
epithelial phenotype (28). At the same time, all AQP-I positive
cells were positive for the human nuclear factor (hNuc), indicating
their human origin (FIG. 2d). To confirm the results obtained in
immunohistochemistry, Western blot was performed with the same
samples and antibodies used for immunohistochemistry (FIG. 3).
Western blot verified an increased expression of AQP-I in REGM
after 10 days of culture on MATRIGEL.TM., and when the cells were
subcultured on the same ECM coating. A parallel result was seen for
CK-18 and .beta.-catenin, two epithelial-associated proteins. No
band or a very faint band was found for the undifferentiated hES
cell population. In addition, under the differentiation conditions,
the expression of stem cell specific markers Oct3/4 was reduced,
correlating with the up-regulation of renal markers towards an
epithelial phenotype.
[0096] REGM is a complex culture medium containing various factors.
To assess the influential factors affecting cell attachment and
growth, factors were omitted one by one from the REGM (FIG. 4).
After 10 days of culture, it was observed that fetal bovine serum
(FBS) was essential for hES cell attachment even with MATRIGEL.TM.
coating. In addition, these factors influenced the cell
proliferation by different degrees. In particular, insulin showed a
significant impact on cell proliferation. A reduction of over 90%
in cell count was observed when insulin was not added to the media
for cell growth. Reductions of--45% and .about.30% in cell counts
were noted when epinephrine and transferrin were not supplemented
in the media (FIGS. 4a and b). The role of various factors in the
REGM culture medium on the AQP-I expression was also investigated.
AQP-I expression was detected at different levels under the various
culture conditions. When EGF was excluded, there were only a few
cells that were AQP-I positive, while many cells showed AQP-I
expression without insulin in the media (FIG. 4c).
[0097] It is known that during embryonic development, the kidney
and derived tubular cells arise from the mesodermal germ layer
beside cardiac, skeletal and smooth muscle cells (29-31). It has
been shown that BMP -2 acts as a morphogenetic factor for
mesodermal specification, and this is also underscored by the fact
that BMP -2 can direct embryonic stem cells into a heart muscle
cell type (31). Hence, it was examined whether BMP -2 has any
effect on the hES cells differentiation into AQP-I positive cells
(FIG. 5a). Upon treatment with BMP-2 (in the range of 2.5 to 10
ng/ml), an increased number of AQP-I positive cells was observed. A
more clonal expansion pattern was found when the cells were
differentiated without BMP-2, whereas BMP-2 induced a more
scattered expression pattern, indicating that AQP-I expression
could be caused by clonal expansion of AQP-I expressing cells and
by switching on the AQP-I expression in single cells.
[0098] To assess further similarities of primary human proximal
tubule cells and REGM differentiated hES cells, the CD receptor
expression of both cell types (differentiated on MATRIGEL.TM. in
REGM with no BMP-2 added) were analyzed using flow cytometry. It
was found that human proximal tubulus cells expressed a high amount
of CD326, which is typical for epithelial cells (32). In addition,
a subpopulation of this cell type also expressed CD133. This is
important since CD 133 is expressed in a small population of human
renal cortical cells, and it has been shown that these cells can
regenerate into renal tubular structures and are classified as
renal adult stem cells (33,34). A very similar distribution of
CD326- and CD133-positive cells was observed for the hES cells,
differentiated on MATRIGEL.TM. and with REGM, indicating that both
cell types share a common expression profile (FIG. 5b). However,
the present differentiation protocol induced expression of
CD56-positive cells, which is normally expressed by neuronal cells
(35), indicating the presence of a pool of differentiated
cells.
[0099] To determine whether these cells display functional
properties similar to proximal tubule, various in vitro and in vivo
experiments were conducted in addition to examination of specific
protein profile (FIG. 6). In a first set of experiments, the
undifferentiated hES cells were seeded on a MATRIGEL.TM.-coated
polymeric porous membrane, which was placed into a perfusion
bioreactor and superfused with REGM culture medium at a flow rate
of 0.1 ml/min with recirculation of the culture medium (27). After
7 days, the membrane with the hES cells was investigated
immunohistochemically for the phenotype expression. A confluent
monolayer of cells covered the porous membrane entirely, and double
immunostaining showed that more than 90% of the cells were positive
for simultaneous expression of cytokeratin-18 and AQP-I (FIG. 6a).
These results showed that the cells could survive the perfusion
culture condition with a high degree of AQP-I expression,
indicating their potential use in a bioartificial kidney
application (BTAD). To determine the functionality of the AQP-I
expressing cells with regard to their water transport, the cells
were first loaded with calcein in isotonic solution (300 mosM) and
then exposed to a hypotonic solution (30 mosM) (8). The calcein in
the differentiated cells was washed out by the hypotonic solution,
whereas other cells retained their calcein staining, indicating
that a portion of the cells exhibited functional water transport
(FIG. 6b). In addition, undifferentiated hES cells and
differentiated cells were injected under the renal capsule of SCID
mice. After 6 weeks, the histological examination revealed teratoma
formation in the mice injected with undifferentiated cells, while
those with the differentiated cells exhibited no tumor formation
(FIG. 6c). In the latter case, the injection area was characterized
by dilated tubules, indicating dysplastic changes, which are likely
to be induced by the injection procedure (also found in control
experiments where the needle was inserted without cell injection
(data not shown).
[0100] Expression of other cellular markers were compared. FIG. 7
shows fluorescent staining of Megalin in differentiated cells. FIG.
8 shows PCR products for AQP-2, AQP-3 and AQP-4 for differentiated
(RD-hES) and undifferentiated (hES) cells.
[0101] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present invention is not entitled to antedate such publication by
virtue of prior invention.
[0102] Concentrations given in this specification, when given in
terms of percentages, include weight/weight (w/w), weight/volume
(w/v) and volume/volume (v/v) percentages.
[0103] As used in this specification and the appended claims, the
singular forms "a", "an" and "the" include plural reference unless
the context clearly dictates otherwise. As used in this
specification and the appended claims, the terms "comprise",
"comprising", "comprises" and other forms of these terms are
intended in the non-limiting inclusive sense, that is, to include
particular recited elements or components without excluding any
other element or component. Unless defined otherwise all technical
and scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this
invention belongs.
[0104] 20
[0105] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it is readily apparent to those of ordinary skill
in the art in light of the teachings of this invention that certain
changes and modifications may be made thereto without departing
from the spirit or scope of the appended claims.
REFERENCES
[0106] 1. Itskovitz-Eldor J, Schuldiner M, Karsenti D, Eden A,
Yanuka O, Amit M, Soreq H, Benvenisty N. Differentiation of human
embryonic stem cells into embryoid bodies compromising the three
embryonic germ layers. MoI Med 6(2), 88-95 (200). [0107] 2. Little,
M. H. Regrow or repair: Potential regenerative therapies for the
kidney. J Am Soc Nephrol 17, 2390-2401 (2006). [0108] 3. Wang, G.
et al. Noggin and bFGF cooperate to maintain the pluripotency of
human embryonic stem cells in the absence of feeder layers. Biochem
Biophys Res Common 330, 934-942 (2005). [0109] 4. Bruce, S J. et
al. In vitro differentiation of murine embryonic stem cells toward
a renal lineage. Differentiation 75(5), 337-49 (2007). [0110] 5.
Dantzler, W. H. Regulation of renal proximal and distal tubule
transport: Sodium, chloride and organic anions. Comp Biochem
Physiol A Mollntegr Physiol 136, 453-478 (2003). [0111] 6. Kriz,
W., Kretzler, M., Provoost, A. P. & Shirato, I. Stability and
leakiness: Opposing challenges to the glomerulus. Kidney Int 49,
1570-1574 (1996). [0112] 7. Murer, H., Hernando, N., Forster, I.
Biber, J. Proximal tubular phosphate reabsorption: Molecular
mechanisms. Physiol Rev 80, 1373-1409 (2000). [0113] 8. Katsura, T.
et al. Constitutive and regulated membrane expression of aquaporin
1 and aquaporin 2 water channels in stably transfected LLC-P K1
epithelial cells. Proc Natl Acad Sd USA 92, 7212-7216 (1995).
[0114] 9. Nielsen, S., Kwon, T. H., Frokiaer, J. & Agre, P.
Regulation and dysregulation of aquaporins in water balance
disorders. J Intern Med 261, 53-64 (2007). [0115] 10. Verkman, A.
S. Roles of aquaporins in kidney revealed by transgenic mice. Semin
Nephrol 26, 200-208 (2006). [0116] 11. Humes, H. D. et al. Initial
clinical results of the bioartificial kidney containing human cells
in ICU patients with acute renal failure. Kidney Int 66, 1578-1588
(2004). [0117] 12. Saito, A. et al. Present status and perspectives
of bioartificial kidneys. J Artif Organs 9, 130-135 (2006). [0118]
13. Reubinoff B E, Pera M F, Fong C Y, Trounson A, Bongso A.
Embryonic stem cell lines from human blastocysts: somatic
differentiation in vitro. Nat Biotechnol 18(4), 399-404 (2000).
[0119] 14. Kouskoff V, Lacaud O, Schwantz S, Fehling H J, Keller G.
Sequential development of hematopoietic and cardiac mesoderm during
embryonic stem cell differentiation. Proc Natl Acad Sd USA 102(37),
13170-5 (2005). [0120] 15. Schuldiner M, Yanuka 0, Itskovitz-Eldor
J, Melton D A, Benvenisty N. Effects of eight growth factors on the
differentiation of cells derived from human embryonic stem cells.
Proc Natl Acad Sd USA 97(21), 11307-12 (2000). [0121] 16. Singla D
K, Sobel B E. Enhancement by growth factors of cardiac myocyte
differentiation from embryonic stem cells: a promising foundation
for cardiac regeneration. Biochem Biophys Res Commun 335(3), 637-42
(2005). [0122] 17. Kim, D. & Dressier, G. R. Nephrogenic
factors promote differentiation of mouse embryonic stem cells into
renal epithelia. J Am Soc Nephrol 16, 3527-3534 (2005). [0123] 18.
Richards, M., Fong, C. Y., Chan, W. K., Wong, P. C. & Bongso,
A. Human feeders support prolonged undifferentiated growth of human
inner cell masses and embryonic stem cells. Nat Biotechnol 20,
933-936 (2002). [0124] 19. Thomson, J. A. et al. Embryonic stem
cell lines derived from human blastocysts. Science 282, 1145-1147
(1998). [0125] 20. Karp J M, Ferreira L S, Khademhosseini A, Kwon A
H, Yeh J, Langer R S. Cultivation of human embryonic stem cells
without the embryoid body step enhances osteogenesis in vitro. Stem
Cells 24(4), 835-43 (2006). [0126] 21. -Xu, C. et al. Feeder-free
growth of undifferentiated human embryonic stem cells. Nat
Biotechnol 19, 971-974 (2001). [0127] 22. Mukhina, S. et al.
Autocrine growth hormone prevents lactogenic differentiation of
mouse mammary epithelial cells. Endocrinology 147, 1819-1829
(2006). [0128] 23. Tiranathanagul, K., Brodie, J. & Humes, H.
D. Bioartificial kidney in the treatment of acute renal failure
associated with sepsis. Nephrology (Canton) 11, 285-291 (2006).
[0129] 24. Atala, A. & Koh, C J. Tissue engineering
applications of therapeutic cloning. Annu Rev BiomedEng 6, 27-40
(2004). [0130] 25. Yamamoto, M. et al. Branching ducts similar to
mesonephric ducts or ureteric buds in teratomas originating from
mouse embryonic stem cells. Am J Physiol Renal Physiol 290, F52-60
(2006). [0131] 26. Steenhard, B. M. et al. Integration of embryonic
stem cells in metanephric kidney organ culture. J Am Soc Nephrol
16, 1623-1631 (2005). [0132] 27. Schumacher, K. et al. Perfusion
Culture Improves the Maintenance of Cultured Liver Tissue Slices.
Tissue Eng 13, 197-205 (2007). [0133] 28. Baer, P. C.,
Bereiter-Hahn, J., Schubert, R. & Geiger, H. Differentiation
status of human renal proximal and distal tubular epithelial cells
in vitro: Differential expression of characteristic markers. Cells
Tissues Organs 184, 16-22 (2006). [0134] 29. Davies, J. A.
Morphogenesis of the metanephric kidney. Scientific World Journal
2, 1937-1950 (2002). [0135] 30. James, R. G. & Schultheiss, T.
M. BMP signaling promotes intermediate mesoderm gene expression in
a dose-dependent, cell-autonomous and translation-dependent manner.
Dev Biol 288, 113-125 (2005). [0136] 31. Pal, R. & Khanna, A.
Similar pattern in cardiac differentiation of human embryonic stem
cell lines, BGO1V and ReliCellhES1, under low serum concentration
supplemented with bone morphogenetic protein-2. Differentiation 75,
112-122 (2007). [0137] 32. Baeuerle, P. A. & Gires, O. EpCAM (C
D326) finding its role in cancer. Br J Cancer 96, 417-423 (2007).
[0138] 33. Bussolati, B. et al. Isolation of renal progenitor cells
from adult human kidney. Am Pathol 166, 545-555 (2005). [0139] 34.
Sagrinati, C. et al Isolation and characterization of multipotent
progenitor cells from the Bowman's capsule of adult human kidneys.
J Am Soc Nephrol 17, 2443-2456 (2006). [0140] 35. Maness, P. F.
& Schachner, M. Neural recognition molecules of the
immunoglobulin superfamily: Signaling transducers of axon guidance
and neuronal migration. Nat Neurosci 10, 19-26 (2007).
Sequence CWU 1
1
18117DNAartificialsynthetic primer 1cccatgcacc gctacga
17218DNAartificialsynthetic primer 2ggtgccctgc tgcgagta
18323DNAartificialsynthetic primer 3tcctccatgg atctgcttat tca
23425DNAartificialsynthetic primer 4cttccttttt tgcgacacta ttctc
25519DNAartificialsynthetic primer 5agtgcccgaa acccacact
19618DNAartificialsynthetic primer 6ttctggcgcc ggttacag
18717DNAartificialsynthetic primer 7cgttcggccc aggctaa
17825DNAartificialsynthetic primer 8caagccagaa gatgaagtta aatcc
25920DNAartificialsynthetic primer 9cggaggttcg aagacgatca
201019DNAartificialsynthetic primer 10ggcgggtcat gggaataac
191120DNAartificialsynthetic primer 11ccacctcctt gggatccatt
201219DNAartificialsynthetic primer 12gtgacgacag ctggagcca
191318DNAartificialsynthetic primer 13cccatcgtgt ccccactc
181420DNAartificialsynthetic primer 14gccgatcatc agctggtaca
201521DNAartificialsynthetic primer 15acatggaggt ggaggacaac a
211619DNAartificialsynthetic primer 16cccggtcaac gtcaatcac
191720DNAartificialsynthetic primer 17ggcctcagtg ttgtgtatta
201818DNAartificialsynthetic primer 18gagccaaggg ttcactac 18
* * * * *