U.S. patent application number 13/909641 was filed with the patent office on 2013-09-26 for soybean event 3560.4.3.5 and compositions and methods for the identification and/or detection thereof.
The applicant listed for this patent is E.I. du Pont de Nemours and Company, Pioneer Hi-Bred International, Inc.. Invention is credited to Robert F. Cressman, JR., Nancy L. Henderson, David Hondred, Nancy J. Leysens, Zhongsen Li, Natalie N. Weber, Aiqiu Xing, Cathy Xiaoyan Zhong.
Application Number | 20130252242 13/909641 |
Document ID | / |
Family ID | 38846444 |
Filed Date | 2013-09-26 |
United States Patent
Application |
20130252242 |
Kind Code |
A1 |
Cressman, JR.; Robert F. ;
et al. |
September 26, 2013 |
SOYBEAN EVENT 3560.4.3.5 AND COMPOSITIONS AND METHODS FOR THE
IDENTIFICATION AND/OR DETECTION THEREOF
Abstract
Compositions and methods related to transgenic glyphosate/ALS
inhibitor-tolerant soybean plants are provided. Specifically,
soybean plants having a 3560.4.3.5 event which imparts tolerance to
glyphosate and at least one ALS-inhibiting herbicide are provided.
The soybean plant harboring the 3560.4.3.5 event at the recited
chromosomal location comprises genomic/transgene junctions having
at least the polynucleotide sequence of SEQ ID NO:10 and/or 11. The
characterization of the genomic insertion site of the 3560.4.3.5
event provides for an enhanced breeding efficiency and enables the
use of molecular markers to track the transgene insert in the
breeding populations and progeny thereof. Various methods and
compositions for the identification, detection, and use of the
soybean 3560.4.3.5 events are provided.
Inventors: |
Cressman, JR.; Robert F.;
(Wilmington, DE) ; Henderson; Nancy L.;
(Landenberg, PA) ; Hondred; David; (Altoona,
IA) ; Leysens; Nancy J.; (Johnston, IA) ; Li;
Zhongsen; (Hockessin, DE) ; Weber; Natalie N.;
(Hockessin, DE) ; Xing; Aiqiu; (Wilmington,
DE) ; Zhong; Cathy Xiaoyan; (Wilmington, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
E.I. du Pont de Nemours and Company
Pioneer Hi-Bred International, Inc. |
Wilmington
Johnston |
DE
IA |
US
US |
|
|
Family ID: |
38846444 |
Appl. No.: |
13/909641 |
Filed: |
June 4, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12715469 |
Mar 2, 2010 |
|
|
|
13909641 |
|
|
|
|
11765940 |
Jun 20, 2007 |
7951995 |
|
|
12715469 |
|
|
|
|
60817011 |
Jun 28, 2006 |
|
|
|
60847154 |
Sep 26, 2006 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
536/23.1 |
Current CPC
Class: |
A01H 5/10 20130101; C12N
15/8278 20130101; C12Q 1/6895 20130101; C12N 15/8274 20130101; C12N
15/8275 20130101 |
Class at
Publication: |
435/6.11 ;
536/23.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1.-36. (canceled)
37. An isolated polynucleotide comprising SEQ ID NO: 11.
38. The isolated polynucleotide of claim 37, wherein said
polynucleotide is selected from the group consisting of: (a) a
nucleotide sequence set forth in SEQ ID NO: 13, 15, 28, or 42; and,
(b) a nucleotide sequence comprising a fragment of SEQ ID NO: 13,
15, 28, or 42.
39. A kit for identifying event 3560.4.3.5 in a biological sample,
said kit comprising a first and a second primer, wherein said first
and said second primer amplify a polynucleotide comprising a
3560.4.3.5 specific region, wherein said 3560.4.3.5 specific region
comprises SEQ ID NO: 11.
40. The kit of claim 39, wherein said kit further comprises a
polynucleotide for the detection of the 3560.4.3.5 specific
region.
41. The kit of claim 39, wherein said first primer comprises a
first fragment of SEQ ID NO: 6 and the second primer comprises a
second fragment of SEQ ID NO:6, wherein said first and said second
primer flank said 3560.4.3.5 specific region and share sufficient
sequence homology or complementarity to said polynucleotide to
amplify said 3560.4.3.5 specific region.
42. The kit of claim 41, wherein a) said first primer comprises a
fragment of SEQ ID NO:3 and said second primer comprises a fragment
of SEQ ID NO:5; or, b) said first primer comprises a fragment of
SEQ ID NO: 4 and said second primer comprises a fragment of SEQ ID
NO:5.
43. The kit of claim 41, wherein said first and said second primer
comprises at least 8 consecutive polynucleotides of SEQ ID NO:
6.
44. The kit of claim 42, wherein said first or said second primer
comprises at least 8 consecutive polynucleotides of SEQ ID NO:3, 4,
or 5.
45. The kit of claim 39, wherein said first or said second primer
comprise SEQ ID NO:7, 8, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 37, 38, 39, 40, 44, 45, 46, 51, 52, 53, 54, 55.
46. A DNA detection kit comprising at least one polynucleotide that
can specifically detect a 3560.4.3.5 specific region comprising SEQ
ID NO: 11, wherein said polynucleotide comprises at least one DNA
molecule of a sufficient length of contiguous nucleotides identical
or complementary to SEQ ID NO: 6.
47. The DNA detection kit of claim 46, wherein said polynucleotide
that can specifically detect a 3560.4.3.5 specific region
comprising a polynucleotide having SEQ ID NO: 11.
48. The DNA detection kit of claim 46, wherein said polynucleotide
comprises a sequence which hybridizes under stringent conditions
with sequences comprising the sequences of SEQ ID NO:5 and SEQ ID
NO:3.
49. A method for identifying event 3560.4.3.5 in a biological
sample, comprising (a) contacting said sample with a first and a
second primer; and, (b) amplifying a polynucleotide comprising a
3560.4.3.5 specific region comprising SEQ ID NO: 11.
50. The method of claim 49, further comprising detecting the
3560.4.3.5 specific region.
51. The method of claim 49, wherein said first primer comprises a
first fragment of SEQ ID NO: 6 and the second primer comprises a
second fragment of SEQ ID NO:6, wherein said first and said second
primer flank said 3560.4.3.5 specific region and share sufficient
sequence homology or complementarity to said polynucleotide to
amplify said 3560.4.3.5 specific region.
52. The method of claim 51, wherein a) said first primer comprises
a fragment of SEQ ID NO:3 and said second primer comprises a
fragment of SEQ ID NO:5; or, b) said first primer comprises a
fragment of SEQ ID NO: 5 and said second primer comprises a
fragment of SEQ ID NO:4.
53. The method of claim 51, wherein said first and said second
primer comprise at least 8 consecutive polynucleotides of SEQ ID
NO: 6.
54. The method of claim 52, wherein said first and said second
primer comprise at least 8 consecutive polynucleotides of SEQ ID
NO:5, 4 or 3.
55. The method of claim 13, wherein said first and said second
primer comprise SEQ ID NO:7, 8, 9, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 37, 38, 39 40, 44, 45, 46, 51, 52, 53, 54, or 55.
56. A pair of DNA molecules comprising a first DNA molecule and a
second DNA molecule, wherein said first DNA molecule comprising a
first fragment of SEQ ID NO: 6 and the second DNA molecule
comprising a second fragment of SEQ ID NO:6, wherein said first and
said second DNA molecule flank said 3560.4.3.5 specific region
comprising SEQ ID NO: 11 and share sufficient sequence homology or
complementarity to said polynucleotide to amplify said 3560.4.3.5
specific region.
57. The DNA detection kit of claim 46, wherein said polynucleotide
comprises at least 14 consecutive identical or complementary
nucleotides to SEQ ID NO: 6.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 12/715,469, filed Mar. 2, 2010, which is a divisional of U.S.
application Ser. No. 11/765,940, filed Jun. 20, 2007, which claims
the benefit of U.S. Provisional Application No. 60/817,011 filed on
Jun. 28, 2006, and U.S. Provisional Application No. 60/847,154
filed on Sep. 26, 2006, each of which is herein incorporated by
reference in its entirety.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named seqlist434138.txt, created on Jun. 4, 2013, and
having a size of 81.3 KB and is filed concurrently with the
specification. The sequence listing contained in this ASCII
formatted document is part of the specification and is herein
incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] This invention is in the field of molecular biology. More
specifically, this invention pertains to multiple herbicide
tolerances conferred by expression of a sequence that confers
tolerance to glyphosate in conjunction with the expression of
sequence that confers tolerance to one or more ALS inhibitor
chemistries.
BACKGROUND OF THE INVENTION
[0004] The expression of foreign genes in plants is known to be
influenced by their location in the plant genome, perhaps due to
chromatin structure (e.g., heterochromatin) or the proximity of
transcriptional regulatory elements (e.g., enhancers) close to the
integration site (Weising et al. (1988) Ann. Rev. Genet. 22:
421-477). At the same time the presence of the transgene at
different locations in the genome influences the overall phenotype
of the plant in different ways. For this reason, it is often
necessary to screen a large number of events in order to identify
an event characterized by optimal expression of an introduced gene
of interest. For example, it has been observed in plants and in
other organisms that there may be a wide variation in levels of
expression of an introduced gene among events. There may also be
differences in spatial or temporal patterns of expression, for
example, differences in the relative expression of a transgene in
various plant tissues, that may not correspond to the patterns
expected from transcriptional regulatory elements present in the
introduced gene construct. It is also observed that the transgene
insertion can affect the endogenous gene expression. For these
reasons, it is common to produce hundreds to thousands of different
events and screen those events for a single event that has desired
transgene expression levels and patterns for commercial purposes.
An event that has desired levels or patterns of transgene
expression is useful for introgressing the transgene into other
genetic backgrounds by sexual outcrossing using conventional
breeding methods. Progeny of such crosses maintain the transgene
expression characteristics of the original transformant. This
strategy is used to ensure reliable gene expression in a number of
varieties that are well adapted to local growing conditions.
[0005] It would be advantageous to be able to detect the presence
of a particular event in order to determine whether progeny of a
sexual cross contain a transgene of interest. In addition, a method
for detecting a particular event would be helpful for complying
with regulations requiring the pre-market approval and labeling of
foods derived from recombinant crop plants, or for use in
environmental monitoring, monitoring traits in crops in the field,
or monitoring products derived from a crop harvest, as well as, for
use in ensuring compliance of parties subject to regulatory or
contractual terms.
[0006] In the commercial production of crops, it is desirable to
easily and quickly eliminate unwanted plants (i.e., "weeds") from a
field of crop plants. An ideal treatment would be one which could
be applied to an entire field but which would eliminate only the
unwanted plants while leaving the crop plants unharmed. One such
treatment system would involve the use of crop plants which are
tolerant to a herbicide so that when the herbicide was sprayed on a
field of herbicide-tolerant crop plants, the crop plants would
continue to thrive while non-herbicide-tolerant weeds were killed
or severely damaged. Ideally, such treatment systems would take
advantage of varying herbicide properties so that weed control
could provide the best possible combination of flexibility and
economy. For example, individual herbicides have different
longevities in the field, and some herbicides persist and are
effective for a relatively long time after they are applied to a
field while other herbicides are quickly broken down into other
and/or non-active compounds. An ideal treatment system would allow
the use of different herbicides so that growers could tailor the
choice of herbicides for a particular situation.
[0007] Due to local and regional variation in dominant weed species
as well as preferred crop species, a continuing need exists for
customized systems of crop protection and weed management which can
be adapted to the needs of a particular region, geography, and/or
locality. Methods and compositions that allow for the rapid
identification of events in plants that produce such qualities are
needed. For example, a continuing need exists for methods of crop
protection and weed management which can reduce: the number of
herbicide applications necessary to control weeds in a field; the
amount of herbicide necessary to control weeds in a field; the
amount of tilling necessary to produce a crop; and/or programs
which delay or prevent the development and/or appearance of
herbicide-resistant weeds. A continuing need exists for methods and
compositions of crop protection and weed management which allow the
targeted use of particular herbicide combinations and for the
efficient detection of such an event.
BRIEF SUMMARY OF THE INVENTION
[0008] Compositions and methods related to transgenic
glyphosate/ALS inhibitor-tolerant soybean plants are provided.
Compositions comprise soybean plants containing a 3560.4.3.5 event
which imparts tolerance to glyphosate and at least one
ALS-inhibiting herbicide. The soybean plant harboring the
3560.4.3.5 event at the recited chromosomal location comprises
genomic/transgene junctions having at least the polynucleotide
sequence of SEQ ID NO:10 and/or 11. Further provided are the seeds
deposited as Patent Deposit No. PTA-8287 and plants, plant cells,
plant parts, grain and plant products derived therefrom. The
characterization of the genomic insertion site of event 3560.4.3.5
provides for an enhanced breeding efficiency and enables the use of
molecular markers to track the transgene insert in the breeding
populations and progeny thereof. Various methods and compositions
for the identification, detection, and use of the soybean event
3560.4.3.5 are provided.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 provides a schematic map of PHP20163 indicating
plasmid elements and restriction enzyme sites for Not I, Asc I, Xba
I and Hind III. Not I and Asc I were used for isolation of fragment
PHP20163A (FIG. 2).
[0010] FIG. 2 provides a schematic map of fragment PHP20163A
indicating restriction enzyme sites for Xba I, Hind III and various
genetic elements. This fragment was used for microprojectile
bombardment to produce the 3560.4.3.5 soybean event. Probes used
for Southern hybridization are indicated as boxes beneath the
fragment map and are identified as follows: A: glyat4601
(glyphosate acetyltransferase) probe B: gm-hra probe (two
non-overlapping segments were generated covering the entire region
and used together for hybridization.
[0011] FIG. 3 provides a schematic map of the insertion region in
soybean event 3560.4.3.5 and shows the three regions that were
sequenced from PCR products generated using genomic DNA as
template: inserted DNA from the bombarded PHP20163A DNA fragment,
5' flanking soybean genomic DNA and 3' flanking soybean genomic
DNA.
[0012] FIG. 4A-E provides a complete sequence of DNA insert and
flanking genomic border regions in the 3560.4.3.5 soybean event
(SEQ ID NO:6). The 5' and 3' flanking genomic border regions, by 1
to 3317 and by 8680 to 10849, respectively, are underlined.
[0013] FIG. 5 provides a breeding diagram for 3560.4.3.5
soybean.
[0014] FIG. 6 provides a schematic map of fragment PHP20163A
indicating location of the genetic elements contained in the two
gene expression cassettes and base pair positions for Bgl II and
Xba I restriction enzyme sites. The Not I and Asc I restriction
enzyme sites are lost upon excision of this fragment from PHP20163.
The total fragment size is 5362 base pairs. Approximate locations
of the probes used are shown as numbered boxes below the fragment
and are identified below. Additional details on these probes are
provided in Table 3.
[0015] FIG. 7 provides a schematic plasmid map of PHP20163
indicating the location of genetic elements and base pair positions
for restriction enzyme sites for Not I, Bgl II, Xba and Asc I. The
Not I-Asc I fragment of this plasmid was isolated (PHP20163A; map,
FIG. 2) and used for transformation to produce 3560.4.3.5 soybean.
The Xba I site located at by 1387 contains a Dam methylase
recognition site and is resistant to digestion by Xba I if the
plasmid is prepared from a Dam.sup.+ strain. The total plasmid size
is 7954 base pairs. Backbone probes are indicated schematically as
lines within the plasmid diagram and are identified below. Each
probe is comprised of two non-overlapping segments that were
combined for hybridization.
[0016] FIG. 8 provides a schematic map of the transgene insertion
in 3560.4.3.5 soybean based on Southern blot analysis. The flanking
soybean genome is represented by the horizontal dotted line. A
single, intact copy of the PHP20163A fragment integrated into the
soybean genome. Bgl II and Xba I restriction enzyme sites are
indicated with the sizes of observed fragments on Southern blots
shown below the map in base pairs (bp).
[0017] FIG. 9 provides a map of the 3560.4.3.5 event and depicts
where various primers anneal.
[0018] FIG. 10A-I provides the left genomic border/internal
transgene insert/right genomic border of the 3560.4.3.5 event (SEQ
ID NO:6). The regions where various primers anneal are
illustrated.
DETAILED DESCRIPTION OF THE INVENTION
[0019] The present inventions now will be described more fully
hereinafter with reference to the accompanying drawings, in which
some, but not all embodiments of the inventions are shown. Indeed,
these inventions may be embodied in many different forms and should
not be construed as limited to the embodiments set forth herein;
rather, these embodiments are provided so that this disclosure will
satisfy applicable legal requirements. Like numbers refer to like
elements throughout.
[0020] Many modifications and other embodiments of the inventions
set forth herein will come to mind to one skilled in the art to
which these inventions pertain having the benefit of the teachings
presented in the foregoing descriptions and the associated
drawings. Therefore, it is to be understood that the inventions are
not to be limited to the specific embodiments disclosed and that
modifications and other embodiments are intended to be included
within the scope of the appended claims. Although specific terms
are employed herein, they are used in a generic and descriptive
sense only and not for purposes of limitation.
[0021] Compositions and methods related to transgenic
glyphosate/ALS inhibitor-tolerant soybean plants are provided.
Compositions include soybean plants having event 3560.4.3.5. A
soybean plant having "event 3560.4.3.5" has been modified by the
insertion of the glyphosate acetyltransferase (glyat) gene derived
from Bacillus licheniformis and a modified version of the soybean
acetolactate synthase gene (gm-hra). The glyat gene was
functionally improved by a gene shuffling process to optimize the
kinetics of glyphosate acetyltransferase (GLYAT) activity for
acetylating the herbicide glyphosate. The insertion of the glyat
gene in the plant confers tolerance to the herbicidal active
ingredient glyphosate through the conversion of glyphosate to the
non-toxic acetylated form. The insertion of the gm-hra gene
produces a modified form of the acetolactate synthase (ALS) enzyme.
ALS is essential for branched chain amino acid biosynthesis and is
inhibited by certain herbicides. The modification in the gm-hra
gene overcomes this inhibition and thus provides tolerance to a
wide range of ALS-inhibiting herbicides. Thus, a soybean plant
having an event 3560.4.3.5 is tolerant to glyphosate and at least
one ALS-inhibiting herbicide. The soybean event 3560.4.3.5 is
otherwise known as Event DP-356O43-5 or 356043 soybean.
[0022] The polynucleotides conferring the glyphosate and ALS
inhibitor tolerance are linked on the same DNA construct and are
inserted at a characterized position in the soybean genome and
thereby produce the 3560.4.3.5 soybean event. The soybean plant
harboring the 3560.4.3.5 event at the recited chromosomal location
comprises genomic/transgene junctions having at least the
polynucleotide sequence of SEQ ID NO:10 and/or 11. The
characterization of the genomic insertion site of the 3560.4.3.5
event provides for an enhanced breeding efficiency and enables the
use of molecular markers to track the transgene insert in the
breeding populations and progeny thereof. Various methods and
compositions for the identification, detection, and use of the
soybean 3560.4.3.5 events are provided herein. As used herein, the
term "event 3560.4.3.5 specific" refers to a polynucleotide
sequence which is suitable for discriminatively identifying event
3560.4.3.5 in plants, plant material, or in products such as, but
not limited to, food or feed products (fresh or processed)
comprising, or derived from plant material.
[0023] Compositions further include seed deposited as Patent
Deposit Nos. PTA-8287 and plants, plant cells, and seed derived
therefrom. Applicant(s) have made a deposit of at least 2500 seeds
of soybean event 3560.4.3.5 with the American Type Culture
Collection (ATCC), Manassas, Va. 20110-2209 USA, on Mar. 27, 2007,
and the deposits were assigned ATCC Deposit No. PTA-8287. These
deposits will be maintained under the terms of the Budapest Treaty
on the International Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure. These deposits were made
merely as a convenience for those of skill in the art and are not
an admission that a deposit is required under 35 U.S.C. .sctn.112.
The seeds deposited with the ATCC on Mar. 26, 2007 were taken from
the deposit maintained by Pioneer Hi-Bred International, Inc., 7250
NW 62'' Avenue, Johnston, Iowa 50131-1000. Access to this deposit
will be available during the pendency of the application to the
Commissioner of Patents and Trademarks and persons determined by
the Commissioner to be entitled thereto upon request. Upon
allowance of any claims in the application, the Applicant(s) will
make available to the public, pursuant to 37 C.F.R. .sctn.1.808,
sample(s) of the deposit of at least 2500 seeds of soybean event
3560.4.3.5 with the American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va. 20110-2209. This deposit of
seed of soybean event 3560.4.3.5 will be maintained in the ATCC
depository, which is a public depository, for a period of 30 years,
or 5 years after the most recent request, or for the enforceable
life of the patent, whichever is longer, and will be replaced if it
becomes nonviable during that period. Additionally, Applicant(s)
have satisfied all the requirements of 37 C.F.R.
.sctn..sctn.1.801-1.809, including providing an indication of the
viability of the sample upon deposit. Applicant(s) have no
authority to waive any restrictions imposed by law on the transfer
of biological material or its transportation in commerce.
Applicant(s) do not waive any infringement of their rights granted
under this patent or rights applicable to event 3560.4.3.5 under
the Plant Variety Protection Act (7 USC 2321 et seq.). Unauthorized
seed multiplication prohibited. The seed may be regulated.
[0024] As used herein, the term "soybean" means Glycine max and
includes all plant varieties that can be bred with soybean. As used
herein, the term plant includes plant cells, plant organs, plant
protoplasts, plant cell tissue cultures from which plants can be
regenerated, plant calli, plant clumps, and plant cells that are
intact in plants or parts of plants such as embryos, pollen,
ovules, seeds, leaves, flowers, branches, fruit, stalks, roots,
root tips, anthers, and the like. Grain is intended to mean the
mature seed produced by commercial growers for purposes other than
growing or reproducing the species. Progeny, variants, and mutants
of the regenerated plants are also included within the scope of the
invention, provided that these parts comprise a 3650.4.3.5
event.
[0025] A transgenic "event" is produced by transformation of plant
cells with a heterologous DNA construct(s), including a nucleic
acid expression cassette that comprises a transgene of interest,
the regeneration of a population of plants resulting from the
insertion of the transgene into the genome of the plant, and
selection of a particular plant characterized by insertion into a
particular genome location. An event is characterized
phenotypically by the expression of the transgene(s). At the
genetic level, an event is part of the genetic makeup of a plant.
The term "event" also refers to progeny produced by a sexual
outcross between the transformant and another variety that include
the heterologous DNA. Even after repeated back-crossing to a
recurrent parent, the inserted DNA and flanking DNA from the
transformed parent is present in the progeny of the cross at the
same chromosomal location. The term "event" also refers to DNA from
the original transformant comprising the inserted DNA and flanking
sequence immediately adjacent to the inserted DNA that would be
expected to be transferred to a progeny that receives inserted DNA
including the transgene of interest as the result of a sexual cross
of one parental line that includes the inserted DNA (e.g., the
original transformant and progeny resulting from selfing) and a
parental line that does not contain the inserted DNA.
[0026] As used herein, "insert DNA" refers to the heterologous DNA
within the expression cassettes used to transform the plant
material while "flanking DNA" can comprise either genomic DNA
naturally present in an organism such as a plant, or foreign
(heterologous) DNA introduced via the transformation process which
is extraneous to the original insert DNA molecule, e.g. fragments
associated with the transformation event. A "flanking region" or
"flanking sequence" as used herein refers to a sequence of at least
20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base
pair or greater which is located either immediately upstream of and
contiguous with or immediately downstream of and contiguous with
the original foreign insert DNA molecule. Non-limiting examples of
the flanking regions of the 3560.4.3.5 event are set forth in SEQ
ID NO:4 and 5 and variants and fragments thereof.
[0027] Transformation procedures leading to random integration of
the foreign DNA will result in transformants containing different
flanking regions characteristic of and unique for each
transformant. When recombinant DNA is introduced into a plant
through traditional crossing, its flanking regions will generally
not be changed. Transformants will also contain unique junctions
between a piece of heterologous insert DNA and genomic DNA, or two
pieces of genomic DNA, or two pieces of heterologous DNA. A
"junction" is a point where two specific DNA fragments join. For
example, a junction exists where insert DNA joins flanking DNA. A
junction point also exists in a transformed organism where two DNA
fragments join together in a manner that is modified from that
found in the native organism. As used herein, "junction DNA" refers
to DNA that comprises a junction point. Non-limiting examples of
junction DNA from the 3560.4.3.5 event set are forth in SEQ ID
NO:1, 2, 6, 10, 11, 12, 13, 14, 15, 27, 28, 41, 42 or variants and
fragments thereof.
[0028] A 3560.4.3.5 plant can be bred by first sexually crossing a
first parental soybean plant grown from the transgenic 3560.4, 3.5
soybean plant (or progeny thereof derived from transformation with
the expression cassettes of the embodiments that confer herbicide
tolerance) and a second parental soybean plant that lacks the
herbicide tolerance phenotype, thereby producing a plurality of
first progeny plants; and then selecting a first progeny plant that
displays the desired herbicide tolerance; and selfing the first
progeny plant, thereby producing a plurality of second progeny
plants; and then selecting from the second progeny plants which
display the desired herbicide tolerance. These steps can further
include the back-crossing of the first herbicide tolerant progeny
plant or the second herbicide tolerant progeny plant to the second
parental soybean plant or a third parental soybean plant, thereby
producing a soybean plant that displays the desired herbicide
tolerance. It is further recognized that assaying progeny for
phenotype is not required. Various methods and compositions, as
disclosed elsewhere herein, can be used to detect and/or identify
the 3560.4.3.5 event.
[0029] It is also to be understood that two different transgenic
plants can also be sexually crossed to produce offspring that
contain two independently segregating added, exogenous genes.
Selling of appropriate progeny can produce plants that are
homozygous for both added, exogenous genes. Back-crossing to a
parental plant and out-crossing with a non-transgenic plant are
also contemplated, as is vegetative propagation. Descriptions of
other breeding methods that are commonly used for different traits
and crops can be found in one of several references, e.g., Fehr, in
Breeding Methods for Cultivar Development, Wilcos J. ed., American
Society of Agronomy, Madison Wis. (1987).
The term "germplasm" refers to an individual, a group of
individuals, or a clone representing a genotype, variety, species
or culture, or the genetic material thereof.
[0030] A "line" or "strain" is a group of individuals of identical
parentage that are generally inbred to some degree and that are
generally isogenic or near isogenic.
[0031] Inbred soybean lines are typically developed for use in the
production of soybean hybrids and for use as germplasm in breeding
populations for the creation of new and distinct inbred soybean
lines. Inbred soybean lines are often used as targets for the
introgression of novel traits through traditional breeding and/or
molecular introgression techniques. Inbred soybean lines need to be
highly homogeneous, homozygous and reproducible to be useful as
parents of commercial hybrids. Many analytical methods are
available to determine the homozygosity and phenotypic stability of
inbred lines.
[0032] The phrase "hybrid plants" refers to plants which result
from a cross between genetically different individuals.
[0033] The term "crossed" or "cross" in the context of this
invention means the fusion of gametes, e.g., via pollination to
produce progeny (i.e., cells, seeds, or plants) in the case of
plants. The term encompasses both sexual crosses (the pollination
of one plant by another) and, in the case of plants, selfing
(self-pollination, i.e., when the pollen and, ovule are from the
same plant).
[0034] The term "introgression" refers to the transmission of a
desired allele of a genetic locus from one genetic background to
another. In one method, the desired alleles can be introgressed
through a sexual cross between two parents, wherein at least one of
one of the parents has the desired allele in its genome.
[0035] In some embodiments, the polynucleotide conferring the
soybean 3560.4.3.5 event of the invention are engineered into a
molecular stack. In other embodiments, the molecular stack further
comprises at least one additional polynucleotide that confers
tolerance to a 3.sup.rd herbicide. In one embodiment, the sequence
confers tolerance to glufosinate, and in a specific embodiment, the
sequence comprises pat.
[0036] In other embodiments, the soybean 3560.4.3.5 event of the
invention comprise one or more trait of interest, and in more
specific embodiments, the plant is stacked with any combination of
polynucleotide sequences of interest in order to create plants with
a desired combination of traits. A trait, as used herein, refers to
the phenotype derived from a particular sequence or groups of
sequences. For example, herbicide-tolerance polynucleotides may be
stacked with any other polynucleotides encoding polypeptides having
pesticidal and/or insecticidal activity, such as Bacillus
thuringiensis toxic proteins (described in U.S. Pat. Nos.
5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; Geiser et
al. (1986) Gene 48: 109; Lee et al. (2003) Appl. Environ.
Microbial. 69: 4648-4657 (Vip3A); Galitzky et al. (2001) Acta
Crystallogr. D. Biol. Crystallogr. 57: 1101-1109 (Cry3BbI); and
Herman et al. (2004) J. Agric. Food Chem. 52: 2726-2734 (CrylF)),
lectins (Van Damme et al. (1994) Plant Mol. Biol. 24: 825, pentin
(described in U.S. Pat. No. 5,981,722), and the like. The
combinations generated can also include multiple copies of any one
of the polynucleotides of interest.
[0037] In some embodiments, soybean 3560.4.3.5 event may be stacked
with other herbicide-tolerance traits to create a transgenic plant
of the invention with further improved properties. Other
herbicide-tolerance polynucleotides that could be used in such
embodiments include those conferring tolerance to glyphosate or to
ALS inhibitors by other modes of action, such as, for example, a
gene that encodes a glyphosate oxido-reductase enzyme as described
more fully in U.S. Pat. Nos. 5,776,760 and 5,463,175. Other traits
that could be combined with the soybean 3560.4.3.5 events include
those derived from polynucleotides that confer on the plant the
capacity to produce a higher level of
5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), for example,
as more fully described in U.S. Pat. Nos. 6,248,876 B1; 5,627,061;
5,804,425; 5,633,435; 5,145,783; 4,971,908; 5,312,910; 5,188,642;
4,940,835; 5,866,775; 6,225,114 B1; 6,130,366; 5,310,667;
4,535,060; 4,769,061; 5,633,448; 5,510,471; Re. 36,449; RE 37,287
E; and 5,491,288; and international publications WO 97/04103; WO
00/66746; WO 01/66704; and WO 00/66747. Other traits that could be
combined with the soybean 3560.4.3.5 event include those conferring
tolerance to sulfonylurea and/or imidazolinone, for example, as
described more fully in U.S. Pat. Nos. 5,605,011; 5,013,659;
5,141,870; 5,767,361; 5,731,180; 5,304,732; 4,761,373; 5,331,107;
5,928,937; and 5,378,824; and international publication WO
96/33270.
[0038] In some embodiments, the soybean 3560.4.3.5 event may be
stacked with, for example, hydroxyphenylpyruvatedioxygenases which
are enzymes that catalyze the reaction in which
para-hydroxyphenylpyruvate (HPP) is transformed into homogentisate.
Molecules which inhibit this enzyme and which bind to the enzyme in
order to inhibit transformation of the HPP into homogentisate are
useful as herbicides. Traits conferring tolerance to such
herbicides in plants are described in U.S. Pat. Nos. 6,245,968 B1;
6,268,549; and 6,069,115; and international publication WO
99/23886. Other examples of suitable herbicide-tolerance traits
that could be stacked with the soybean 3560.4.3.5 event include
aryloxyalkanoate dioxygenase polynucleotides (which reportedly
confer tolerance to 2,4-D and other phenoxy auxin herbicides as
well as to aryloxyphenoxypropionate herbicides as described, for
example, in WO2005/107437) and dicamba-tolerance polynucleotides as
described, for example, in Herman et al. (2005) J. Biol. Chem. 280:
24759-24767.
[0039] Other examples of herbicide-tolerance traits that could be
combined with the soybean 3560.4.3.5 event include those conferred
by polynucleotides encoding an exogenous phosphinothricin
acetyltransferase, as described in U.S. Pat. Nos. 5,969,213;
5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477;
5,646,024; 6,177,616; and 5,879,903. Plants containing an exogenous
phosphinothricin acetyltransferase can exhibit improved tolerance
to glufosinate herbicides, which inhibit the enzyme glutamine
synthase. Other examples of herbicide-tolerance traits that could
be combined with the soybean 3560.4.3.5 event include those
conferred by polynucleotides conferring altered protoporphyrinogen
oxidase (protox) activity, as described in U.S. Pat. Nos. 6,288,306
B1; 6,282,837 B1; and 5,767,373; and international publication WO
01/12825. Plants containing such polynucleotides can exhibit
improved tolerance to any of a variety of herbicides which target
the protox enzyme (also referred to as "protox inhibitors").
[0040] Other examples of herbicide-tolerance traits that could be
combined with the soybean 3560.4.3.5 event include those conferring
tolerance to at least one herbicide in a plant such as, for
example, a soybean plant or horseweed. Herbicide-tolerant weeds are
known in the art, as are plants that vary in their tolerance to
particular herbicides. See, e.g., Green and Williams (2004)
"Correlation of Corn (Zea mays) Inbred Response to Nicosulfuron and
Mesotrione," poster presented at the WSSA Annual Meeting in Kansas
City, Mo., Feb. 9-12, 2004; Green (1998) Weed Technology 12:
474-477; Green and Ulrich (1993) Weed Science 41: 508-516. The
trait(s) responsible for these tolerances can be combined by
breeding or via other methods with the soybean 3560.4.3.5 event to
provide a plant of the invention as well as methods of use
thereof.
[0041] The soybean 3560.4.3.5 event can also be combined with at
least one other trait to produce plants of the present invention
that further comprise a variety of desired trait combinations
including, but not limited to, traits desirable for animal feed
such as high oil content (e.g., U.S. Pat. No. 6,232,529); balanced
amino acid content (e.g., hordothionins (U.S. Pat. Nos. 5,990,389;
5,885,801; 5,885,802; and 5,703,409; U.S. Pat. No. 5,850,016);
barley high lysine (Williamson et al. (1987) Eur. I Biochem. 165:
99-106; and WO 98/20122) and high methionine proteins (Pedersen et
al. (1986) J. Biol. Chem. 261: 6279; Kirihara et al. (1988) Gene
71: 359; and Musumura et al. (1989) Plant Mol. Biol. 12:123));
increased digestibility (e.g., modified storage proteins (U.S.
application Ser. No. 10/053,410, filed Nov. 7, 2001); and
thioredoxins (U.S. application Ser. No. 10/005,429, filed Dec. 3,
2001)); the disclosures of which are herein incorporated by
reference. Desired trait combinations also include LLNC (low
linolenic acid content; see, e.g., Dyer et al. (2002) Appl.
Microbiol. Biotechnol. 59: 224-230) and OLCH (high oleic acid
content; see, e.g., Fernandez-Moya et al. (2005) J. Agric. Food
Chem. 53: 5326-5330).
[0042] The soybean 3560.4.3.5 event can also be combined with other
desirable traits such as, for example, fumonisim detoxification
genes (U.S. Pat. No. 5,792,931), avirulence and disease resistance
genes (Jones et al. (1994) Science 266: 789; Martin et al. (1993)
Science 262: 1432; Mindrinos et al. (1994) Cell 78: 1089), and
traits desirable for processing or process products such as
modified oils (e.g., fatty acid desaturase genes (U.S. Pat. No.
5,952,544; WO 94/11516)); modified starches (e.g., ADPG
pyrophosphorylases (AGPase), starch synthases (SS), starch
branching enzymes (SBE), and starch debranching enzymes (SDBE));
and polymers or bioplastics (e.g., U.S. Pat. No. 5,602,321;
beta-ketothiolase, polyhydroxybutyrate synthase, and
acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacterial.
170:5837-5847) facilitate expression of polyhydroxyalkanoates
(PHAs)); the disclosures of which are herein incorporated by
reference. One could also combine herbicide-tolerant
polynucleotides with polynucleotides providing agronomic traits
such as male sterility (e.g., see U.S. Pat. No. 5,583,210), stalk
strength, flowering time, or transformation technology traits such
as cell cycle regulation or gene targeting (e.g., WO 99/61619, WO
00/17364, and WO 99/25821); the disclosures of which are herein
incorporated by reference.
[0043] In another embodiment, the soybean 3560.4.3.5 event can also
be combined with the Rcg1 sequence or biologically active variant
or fragment thereof. The Rcg1 sequence is an anthracnose stalk rot
resistance gene in corn. See, for example, U.S. patent application
Ser. Nos. 11/397,153, 11/397,275, and 11/397,247, each of which is
herein incorporated by reference.
[0044] These stacked combinations can be created by any method
including, but not limited to, breeding plants by any conventional
or TopCross methodology, or genetic transformation. If the
sequences are stacked by genetically transforming the plants, the
polynucleotide sequences of interest can be combined at any time
and in any order. The traits can be introduced simultaneously in a
co-transformation protocol with the polynucleotides of interest
provided by any combination of transformation cassettes. For
example, if two sequences will be introduced, the two sequences can
be contained in separate transformation cassettes (trans) or
contained on the same transformation cassette (cis). Expression of
the sequences can be driven by the same promoter or by different
promoters. In certain cases, it may be desirable to introduce a
transformation cassette that will suppress the expression of the
polynucleotide of interest. This may be combined with any
combination of other suppression cassettes or overexpression
cassettes to generate the desired combination of traits in the
plant. It is further recognized that polynucleotide sequences can
be stacked at a desired genomic location using a site-specific
recombination system. See, for example, WO99/25821, WO99/25854,
WO99/25840, WO99/25855, and WO99/25853, all of which are herein
incorporated by reference.
[0045] As used herein, the use of the term "polynucleotide" is not
intended to limit a polynucleotide to comprise DNA. Those of
ordinary skill in the art will recognize that polynucleotides, can
comprise ribonucleotides and combinations of ribonucleotides and
deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides
include both naturally occurring molecules and synthetic analogues.
The polynucleotides also encompass all forms of sequences
including, but not limited to, single-stranded forms,
double-stranded forms, hairpins, stem-and-loop structures, and the
like.
[0046] A 3560.4.3.5 plant comprises an expression cassette having a
glyphosate acetyltransferase polynucleotide and a genetically
modified acetolactate synthase polynucleotide (gm-hra). The
cassette can include 5' and 3' regulatory sequences operably linked
to the glyat and the gm-hra polynucleotides. "Operably linked" is
intended to mean a functional linkage between two or more elements.
For example, an operable linkage between a polynucleotide of
interest and a regulatory sequence (i.e., a promoter) is functional
link that allows for the expression of the polynucleotide of
interest. Operably linked elements may be contiguous or
non-contiguous. When used to refer to the joining of two protein
coding regions, by operably linked it is intended that the coding
regions are in the same reading frame. The cassette may
additionally contain at least one additional gene to be
cotransformed into the organism. Alternatively, the additional
gene(s) can be provided on multiple expression cassettes. Such an
expression cassette is provided with a plurality of restriction
sites and/or recombination sites for insertion of the
polynucleotide to be under the transcriptional regulation of the
regulatory regions. The expression cassette may additionally
contain selectable marker genes.
[0047] The expression cassette will include in the 5'-3' direction
of transcription, a transcriptional and translational initiation
region (i.e., a promoter), a coding region, and a transcriptional
and translational termination region functional in plants.
"Promoter" refers to a nucleotide sequence capable of controlling
the expression of a coding sequence or functional RNA. In general,
a coding sequence is located 3' to a promoter sequence. The
promoter sequence can comprise proximal and more distal upstream
elements, the latter elements are often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence that can
stimulate promoter activity and may be an innate element of the
promoter or a heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Promoters may be derived in their
entirety from a native gene, or be composed of different elements
derived from different promoters found in nature, or even comprise
synthetic nucleotide segments. It is understood by those skilled in
the art that different promoters may direct the expression of a
gene in different tissues or cell types, or at different stages of
development, or in response to different environmental conditions.
Promoters that cause a nucleic acid fragment to be expressed in
most cell types at most times are commonly referred to as
"constitutive promoters". New promoters of various types useful in
plant cells are constantly being discovered; numerous examples may
be found in the compilation by Okamuro and Goldberg (1989)
Biochemistry of Plants 15: 1-82. It is further recognized that
since in most cases the exact boundaries of regulatory sequences
have not been completely defined, nucleic acid fragments of
different lengths may have identical promoter activity.
[0048] The expression cassettes may also contain 5' leader
sequences. Such leader sequences can act to enhance translation.
The regulatory regions (i.e., promoters, transcriptional regulatory
regions, RNA processing or stability regions, introns,
polyadenylation signals, and translational termination regions)
and/or the coding region may be native/analogous or heterologous to
the host cell or to each other.
[0049] The "translation leader sequence" refers to a nucleotide
sequence located between the promoter sequence of a gene and the
coding sequence. The translation leader sequence is present in the
fully processed mRNA upstream of the translation start sequence.
The translation leader sequence may affect numerous parameters
including, processing of the primary transcript to mRNA, mRNA
stability and/or translation efficiency. Examples of translation
leader sequences have been described (Turner and Foster (1995) Mol.
Biotechnol. 3: 225-236). The "3' non-coding sequences" refer to
nucleotide sequences located downstream of a coding sequence and
include polyadenylation recognition sequences and other sequences
encoding regulatory signals capable of affecting mRNA processing or
gene expression. The polyadenylation signal is usually
characterized by affecting the addition of polyadenylic acid tracts
to the 3' end of the mRNA precursor. The use of different 3'
non-coding sequences is exemplified by Ingelbrecht et al. (1989)
Plant Cell 1: 671-680.
[0050] As used herein, "heterologous" in reference to a sequence is
a sequence that originates from a foreign species, or, if from the
same species, is substantially modified from its native form in
composition and/or genomic locus by deliberate human intervention.
For example, a promoter operably linked to a heterologous
polynucleotide is from a species different from the species from
which the polynucleotide was derived, or, if from the
same/analogous species, one or both are substantially modified from
their original form and/or genomic locus, or the promoter is not
the native promoter for the operably linked polynucleotide.
[0051] In preparing the expression cassette, the various DNA
fragments may be manipulated, so as to provide for the DNA
sequences in the proper orientation and, as appropriate, in the
proper reading frame. Toward this end, adapters or linkers may be
employed to join the DNA fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous DNA, removal of restriction sites, or the like. For
this purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g., transitions and transversions,
may be involved. The expression cassette can also comprise a
selectable marker gene for the selection of transformed cells.
Selectable marker genes are utilized for the selection of
transformed cells or tissues.
[0052] Isolated polynucleotides are provided that can be used in
various methods for the detection and/or identification of the
soybean 3560.4.3.5 event. An "isolated" or "purified"
polynucleotide, or biologically active portion thereof, is
substantially or essentially free from components that normally
accompany or interact with the polynucleotide as found in its
naturally occurring environment. Thus, an isolated or purified
polynucleotide is substantially free of other cellular material, or
culture medium when produced by recombinant techniques, or
substantially free of chemical precursors or other chemicals when
chemically synthesized. Optimally, an "isolated" polynucleotide is
free of sequences (optimally protein encoding sequences) that
naturally flank the polynucleotide (i.e., sequences located at the
5' and 3' ends of the polynucleotide) in the genomic DNA of the
organism from which the polynucleotide is derived. For example, in
various embodiments, the isolated polynucleotide can contain less
than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of
nucleotide sequence that naturally flank the polynucleotide in
genomic DNA of the cell from which the polynucleotide is
derived.
[0053] In specific embodiments, the polynucleotides comprise the
junction DNA sequence set forth in SEQ ID NO:10 or 11. In other
embodiments, the polynucleotides comprise the junction DNA
sequences set forth in SEQ ID NO:1, 2, 6, 12, 13, 14, 15, 27, 28,
41 or 42 or variants and fragments thereof. Fragments and variants
of junction DNA sequences are suitable for discriminatively
identifying event 3560.4.3.5. As discussed elsewhere herein, such
sequences find use as primers and/or probes.
[0054] In other embodiments, the polynucleotides are provided that
can detect a 3560.4.3.5 event or a 3560.4.3.5 specific region. Such
sequences include any polynucleotide set forth in SEQ ID NOS:1-56
or variants and fragments thereof. In specific embodiments, the
polynucleotide used to detect a 3560.4.3.5 event comprise the
sequence set forth in SEQ ID NO: 43 or a fragment of SEQ ID NO:43
having at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130,
140, 150, 160, 170, or 180 nucleotides. Fragments and variants of
polynucleotides that detect a 3560.4.3.5 event or a 3560.4.3.5
specific region are suitable for discriminatively identifying event
3560.4.3.5. As discussed elsewhere herein, such sequences find use
as primers and/or probes. Further provided are isolated DNA
nucleotide primer sequences comprising or consisting of a sequence
set forth in SEQ ID NO:7, 8, 9, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 37, 38, 39, 40, 43, 44, 45, 46, 51, 52, 53, 54, or 55 or a
complement thereof or variants and fragments of SEQ ID NO:1, 2, 3,
4, 5, 6, 10, 11, 12, 13, 14, 15, 27, 28, 41, 42, or 43.
[0055] "Variants" is intended to mean substantially similar
sequences. For polynucleotides, a variant comprises a
polynucleotide having deletions (i.e., truncations) at the 5'
and/or 3' end; deletion and/or addition of one or more nucleotides
at one or more internal sites in the native polynucleotide; and/or
substitution of one or more nucleotides at one or more sites in the
native polynucleotide.
[0056] As used herein, a "probe" is an isolated polynucleotide to
which is attached a conventional detectable label or reporter
molecule, e.g., a radioactive isotope, ligand, chemiluminescent
agent, enzyme, etc. Such a probe is complementary to a strand of a
target polynucleotide, in the instant case, to a strand of isolated
DNA from soybean event 3560.4.3.5 whether from a soybean plant or
from a sample that includes DNA from the event. Probes include not
only deoxyribonucleic or ribonucleic acids but also polyamides and
other probe materials that can specifically detect the presence of
the target DNA sequence.
[0057] As used herein, "primers" are isolated polynucleotides that
are annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand, then extended along the target DNA strand by a
polymerase, e.g., a DNA polymerase. Primer pairs refer to their use
for amplification of a target polynucleotide, e.g., by the
polymerase chain reaction (PCR) or other conventional nucleic-acid
amplification methods. "PCR" or "polymerase chain reaction" is a
technique used for the amplification of specific DNA segments (see,
U.S. Pat. Nos. 4,683,195 and 4,800,159; herein incorporated by
reference). Any combination of primers disclosed herein can be used
such that the pair allows for the detection a 3560.4.3.5 event or
specific region (i.e., SEQ ID NOS: 7-9, 16-26, 37, 38, 39, 40,
44-46, or 51-55). Non-limiting examples of primer pairs include SEQ
ID NOS:16 and 17; SEQ ID NOS:23 and 20; SEQ ID NOS:23 and 19; SEQ
ID NOS:18 AND 22; SEQ ID NOS:21 and 22; SEQ ID NO: 7 and 9; SEQ ID
NO:8 and 9; SEQ ID NO:7 and 8; SEQ ID NO:37 and 39; and SEQ ID
NO:38 and 39; and SEQ ID NO: 44 and 45 and SEQ ID NOS: 37 and
38.
[0058] Probes and primers are of sufficient nucleotide length to
bind to the target DNA sequence and specifically detect and/or
identify a polynucleotide having a 3560.4.3.5 event. It is
recognized that the hybridization conditions or reaction conditions
can be determined by the operator to achieve this result. This
length may be of any length that is of sufficient length to be
useful in a detection method of choice. Generally, 8, 11, 14, 16,
18, 20, 22, 24, 26, 28, 30, 40, 50, 75, 100, 200, 300, 400, 500,
600, 700 nucleotides or more, or between about 11-20, 20-30, 30-40,
40-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600,
600-700, 700-800, or more nucleotides in length are used. Such
probes and primers can hybridize specifically to a target sequence
under high stringency hybridization conditions. Probes and primers
according to embodiments may have complete DNA sequence identity of
contiguous nucleotides with the target sequence, although probes
differing from the target DNA sequence and that retain the ability
to specifically detect and/or identify a target DNA sequence may be
designed by conventional methods. Accordingly, probes and primers
can share about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or greater sequence identity or complementarity to the
target polynucleotide (i.e., SEQ ID NO:1-46 and 47-55), or can
differ from the target sequence (i.e., SEQ ID NO: 1-46 and 47-55)
by 1, 2, 3, 4, 5, 6 or more nucleotides. Probes can be used as
primers, but are generally designed to bind to the target DNA or
RNA and are not used in an amplification process.
[0059] Specific primers can be used to amplify an integration
fragment to produce an amplicon that can be used as a "specific
probe" or can itself be detected for identifying event 3560.4.3.5
in biological samples. Alternatively, a probe can be used during
the PCR reaction to allow for the detection of the amplification
event (i.e., a Taqman probe or a MGB probe) (so called real time
PCR). When the probe is hybridized with the polynucleotides of a
biological sample under conditions which allow for the binding of
the probe to the sample, this binding can be detected and thus
allow for an indication of the presence of event 3560.4.3.5 in the
biological sample. Such identification of a bound probe has been
described in the art. In an embodiment, the specific probe is a
sequence which, under optimized conditions, hybridizes specifically
to a region within the 5' or 3' flanking region of the event and
also comprises a part of the foreign DNA contiguous therewith. The
specific probe may comprise a sequence of at least 80%, between 80
and 85%, between 85 and 90%, between 90 and 95%, and between 95 and
100% identical (or complementary) to a specific region of the
3560.4.3.5 event.
[0060] As used herein, "amplified DNA" or "amplicon" refers to the
product of polynucleotide amplification of a target polynucleotide
that is part of a nucleic acid template. For example, to determine
whether a soybean plant resulting from a sexual cross contains the
3560.4.3.5 event, DNA extracted from the soybean plant tissue
sample may be subjected to a polynucleotide amplification method
using a DNA primer pair that includes a first primer derived from
flanking sequence adjacent to the insertion site of inserted
heterologous DNA, and a second primer derived from the inserted
heterologous DNA to produce an amplicon that is diagnostic for the
presence of the 3560.4.3.5 event DNA. By "diagnostic" for a
3650.4.3.5 event the use of any method or assay which discriminates
between the presence or the absence of a 3560.4.3.5 event in a
biological sample is intended. Alternatively, the second primer may
be derived from the flanking sequence. In still other embodiments,
primer pairs can be derived from flanking sequence on both sides of
the inserted DNA so as to produce an amplicon that includes the
entire insert polynucleotide of the expression construct as well as
the sequence flanking the transgenic insert. See, FIG. 1. The
amplicon is of a length and has a sequence that is also diagnostic
for the event (i.e., has a junction DNA from a 3560.4.3.5 event).
The amplicon may range in length from the combined length of the
primer pairs plus one nucleotide base pair to any length of
amplicon producible by a DNA amplification protocol. A member of a
primer pair derived from the flanking sequence may be located a
distance from the inserted DNA sequence, this distance can range
from one nucleotide base pair up to the limits of the amplification
reaction, or about twenty thousand nucleotide base pairs. The use
of the term "amplicon" specifically excludes primer dimers that may
be formed in the DNA thermal amplification reaction.
[0061] Methods for preparing and using probes and primers are
described, for example, in Molecular Cloning: A Laboratory Manual,
2.sup.nd ed, vol. 1-3, ed. Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. 1989 (hereinafter,
"Sambrook et al., 1989"); Current Protocols in Molecular Biology,
ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New
York, 1992 (with periodic updates) (hereinafter, "Ausubel et al.,
1992"); and Innis et al., PCR Protocols: A Guide to Methods and
Applications, Academic Press: San Diego, 1990. PCR primer pairs can
be derived from a known sequence, for example, by using computer
programs intended for that purpose such as the PCR primer analysis
tool in Vector NTT version 6 (Informax Inc., Bethesda Md.);
PrimerSelect (DNASTAR Inc., Madison, Wis.); and Primer (Version
0.5.COPYRGT., 1991, Whitehead Institute for Biomedical Research,
Cambridge, Mass.). Additionally, the sequence can be visually
scanned and primers manually identified using guidelines known to
one of skill in the art.
[0062] It is to be understood that as used herein the term
"transgenic" includes any cell, cell line, callus, tissue, plant
part, or plant, the genotype of which has been altered by the
presence of a heterologous nucleic acid including those transgenics
initially so altered as well as those created by sexual crosses or
asexual propagation from the initial transgenic. The term
"transgenic" as used herein does not encompass the alteration of
the genome (chromosomal or extra-chromosomal) by conventional plant
breeding methods or by naturally occurring events such as random
cross-fertilization, non-recombinant viral infection,
non-recombinant bacterial transformation, non-recombinant
transposition, or spontaneous mutation.
[0063] "Transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host organism, resulting in
genetically stable inheritance. Host organisms containing the
transformed nucleic acid fragments are referred to as "transgenic"
organisms, Examples of methods of plant transformation include
Agrobacterium-mediated transformation (De Blaere et al. (1987)
Meth. Enzymol. 143: 277) and particle-accelerated or "gene gun"
transformation technology (Klein et al. (1987) Nature (London) 327:
70-73; U.S. Pat. No. 4,945,050, incorporated herein by reference).
Additional transformation methods are disclosed below.
[0064] Thus, isolated polynucleotides can be incorporated into
recombinant constructs, typically DNA constructs, which are capable
of introduction into and replication in a host cell. Such a
construct can be a vector that includes a replication system and
sequences that are capable of transcription and translation of a
polypeptide-encoding sequence in a given host cell. A number of
vectors suitable for stable transfection of plant cells or for the
establishment of transgenic plants have been described in, e.g.,
Pouwels et al. (1985; Supp. 1987) Cloning Vectors: A Laboratory
Manual, Weissbach and Weissbach (1989) Methods for Plant Molecular
Biology (Academic Press, New York); and Flevin et al. (1990) Plant
Molecular Biology Manual (Kluwer Academic Publishers). Typically,
plant expression vectors include, for example, one or more cloned
plant genes under the transcriptional control of 5' and 3'
regulatory sequences and a dominant selectable marker. Such plant
expression vectors also can contain a promoter regulatory region
(e.g., a regulatory region controlling inducible or constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific expression), a transcription initiation start site,
a ribosome binding site, an RNA processing signal, a transcription
termination site, and/or a polyadenylation signal.
[0065] Various methods and compositions for identifying event
3560.4.3.5 are provided. Such methods find use in identifying
and/or detecting a 3560.4.3.5 event in any biological material.
Such methods include, for example, methods to confirm seed purity
and methods for screening seeds in a seed lot for a 3560.4.3.5
event. In one embodiment, a method for identifying event 3560.4.3.5
in a biological sample is provided and comprises contacting the
sample with a first and a second primer; and, amplifying a
polynucleotide comprising a 3560.4.3.5 specific region.
[0066] A biological sample can comprise any sample in which one
desires to determine if DNA having event 3560.4.3.5 is present. For
example, a biological sample can comprise any plant material or
material comprising or derived from a plant material such as, but
not limited to, food or feed products. As used herein, "plant
material" refers to material which is obtained or derived from a
plant or plant part. In specific embodiments, the biological sample
comprises a soybean tissue.
[0067] Primers and probes based on the flanking DNA and insert
sequences disclosed herein can be used to confirm (and, if
necessary, to correct) the disclosed sequences by conventional
methods, e.g., by re-cloning and sequencing such sequences. The
polynucleotide probes and primers specifically detect a target DNA
sequence. Any conventional nucleic acid hybridization or
amplification method can be used to identify the presence of DNA
from a transgenic event in a sample. By "specifically detect" it is
intended that the polynucleotide can be used either as a primer to
amplify a 3560.4.3.5 specific region or the polynucleotide can be
used as a probe that hybridizes under stringent conditions to a
polynucleotide having a 3560.4.3.5 event or a 3560.4.3.5 specific
region. The level or degree of hybridization which allows for the
specific detection of a 3560.4.3.5 event or a specific region of a
3560.4.3.5 event is sufficient to distinguish the polynucleotide
with the 3560.4.3.5 specific region from a polynucleotide lacking
this region and thereby allow for discriminately identifying a
3560.4.3.5 event. By "shares sufficient sequence identity or
complementarity to allow for the amplification of a 3560.4.3.5
specific event" is intended the sequence shares at least 80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity
or complementarity to a fragment or across the full length of the
polynucleotide having the 3560.4.3.5 specific region.
[0068] Regarding the amplification of a target polynucleotide
(e.g., by PCR) using a particular amplification primer pair,
"stringent conditions" are conditions that permit the primer pair
to hybridize to the target polynucleotide to which a primer having
the corresponding wild-type sequence (or its complement) would bind
and preferably to produce an identifiable amplification product
(the amplicon) having a 3560.4.3.5 specific region in a DNA thermal
amplification reaction. In a PCR approach, oligonucleotide primers
can be designed for use in PCR reactions to amplify a 3560.4.3.5
specific region. Methods for designing PCR primers and PCR cloning
are generally known in the art and are disclosed in Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring
Harbor Laboratory Press, Plainview, N.Y.). See also Innis et al.,
eds. (1990) PCR Protocols: A Guide to Methods and Applications
(Academic Press, New York); Innis and Gelfand, eds. (1995) PCR
Strategies (Academic Press, New York); and Innis and Gelfand, eds.
(1999) PCR Methods Manual (Academic Press, New York). Methods of
amplification are further described in U.S. Pat. Nos. 4,683,195,
4,683,202 and Chen et al. (1994) PNAS 91:5695-5699. These methods
as well as other methods known in the art of DNA amplification may
be used in the practice of the other embodiments. It is understood
that a number of parameters in a specific PCR protocol may need to
be adjusted to specific laboratory conditions and may be slightly
modified and yet allow for the collection of similar results. These
adjustments will be apparent to a person skilled in the art.
[0069] The amplified polynucleotide (amplicon) can be of any length
that allows for the detection of the 3560.4.3.5 event or a
3560.4.3.5 specific region. For example, the amplicon can be about
10, 50, 100, 200, 300, 500, 700, 100, 2000, 3000, 4000, 5000
nucleotides in length or longer.
[0070] In specific embodiments, the specific region of the
3560.4.3.5 event is detected.
[0071] Any primer that allows a 3560.4.3.5 specific region to be
amplified and/or detected can be employed in the methods. For
example, in specific embodiments, the first primer comprises a
fragment of a polynucleotide of SEQ ID NO: 4 or 5, wherein the
first or the second primer shares sufficient sequence identity or
complementarity to the polynucleotide to amplify the 3560.4.3.5
specific region. The primer pair can comprise a fragment of SEQ ID
NO:4 and a fragment of SEQ ID NO:5 or 3, or alternatively, the
primer pair can comprise a fragment of SEQ ID NO:5 and a fragment
of SEQ ID NO: 3 or 4. In still further embodiments, the first and
the second primer can comprise any one or any combination of the
sequences set forth in SEQ ID NO:7, 8, 9, 16-26, 37, 38, 39, 40,
44-46, or 51-55. The primers can be of any length sufficient to
amplify a 3560.4.3.5 region including, for example, at least 6, 7,
8, 9, 10, 15, 20, 15, or 30 or about 7-10, 10-15, 15-20, 20-25,
25-30, 30-35, 35-40, 40-45 nucleotides or longer.
[0072] As discussed elsewhere herein, any method to PCR amplify the
3560.4.3.5 event or specific region can be employed, including for
example, real time PCR. See, for example, Livak et al. (1995) PCR
Methods and Applications 4:357-362; U.S. Pat. No. 5,538,848; U.S.
Pat. No. 5,723,591; Applied Biosystems User Bulletin No. 2,
"Relative Quantitation of Gene Expression," P/N 4303859; and,
Applied Biosystems User Bulletin No. 5, "Multiplex PCR with Taqman
VIC probes," P/N 4306236; each of which is herein incorporated by
reference.
[0073] Thus, in specific embodiments, a method of detecting the
presence of soybean event 3560.4.3.5 or progeny thereof in a
biological sample is provided. The method comprises (a) extracting
a DNA sample from the biological sample; (b) providing a pair of
DNA primer molecules (i.e, any combination of SEQ ID NOS: 7-9,
16-26, 37, 38, 39, 40, 44-46, or 51-55, wherein said combination
amplifies a 3560.4.3.5 event), including, but not limited to, i)
the sequences of SEQ ID NO:16 and SEQ ID NO:17, ii) the sequences
of SEQ ID NO:23 and SEQ ID NO:20; iii) the sequences of SEQ ID
NO:23 and SEQ ID NO:19; iv) the sequences of SEQ ID NO:18 and SEQ
ID NO:22; v) SEQ ID NO:21 and SEQ ID NO:22; vi) SEQ ID NO: 7 and 9;
vii) SEQ ID NO: 8 and 9; iix) SEQ ID NO: 7 and 8; ix) SEQ ID NO: 37
and 39; x) SEQ ID NO: 38 and 39; xi) SEQ ID NO: 44 and 45; xii) SEQ
ID NO: 25 and 26; xiii) SEQ ID NO:25 and SEQ ID NO:24; (c)
providing DNA amplification reaction conditions; (d) performing the
DNA amplification reaction, thereby producing a DNA amplicon
molecule; and (e) detecting the DNA amplicon molecule, wherein the
detection of said DNA amplicon molecule in the DNA amplification
reaction indicates the presence of soybean event 3560.4.3.5. In
order for a nucleic acid molecule to serve as a primer or probe it
needs only be sufficiently complementary in sequence to be able to
form a stable double-stranded structure under the particular
solvent and salt concentrations employed.
[0074] In hybridization techniques, all or part of a polynucleotide
that selectively hybridizes to a target polynucleotide having a
3560.4.3.5 specific event is employed. By "stringent conditions" or
"stringent hybridization conditions" when referring to a
polynucleotide probe conditions under which a probe will hybridize
to its target sequence to a detectably greater degree than to other
sequences (e.g., at least 2-fold over background) are intended.
Regarding the amplification of a target polynucleotide (e.g., by
PCR) using a particular amplification primer pair, "stringent
conditions" are conditions that permit the primer pair to hybridize
to the target polynucleotide to which a primer having the
corresponding wild-type. Stringent conditions are
sequence-dependent and will be different in different
circumstances. By controlling the stringency of the hybridization
and/or washing conditions, target sequences that are 100%
complementary to the probe can be identified (homologous probing).
Alternatively, stringency conditions can be adjusted to allow some
mismatching in sequences so that lower degrees of identity are
detected (heterologous probing). Generally, a probe is less than
about 1000 nucleotides in length or less than 500 nucleotides in
length.
[0075] As used herein, a substantially identical or complementary
sequence is a polynucleotide that will specifically hybridize to
the complement of the nucleic acid molecule to which it is being
compared under high stringency conditions. Appropriate stringency
conditions which promote DNA hybridization, for example, 6.times.
sodium chloride/sodium citrate (SSC) at about 45.degree. C.,
followed by a wash of 2.times.SSC at 50.degree. C., are known to
those skilled in the art or can be found in Current Protocols in
Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
Typically, stringent conditions for hybridization and detection
will be those in which the salt concentration is less than about
1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration
(or other salts) at pH 7.0 to 8.3 and the temperature is at least
about 30.degree. C. for short probes (e.g., 10 to 50 nucleotides)
and at least about 60.degree. C. for long probes (e.g., greater
than 50 nucleotides). Stringent conditions may also be achieved
with the addition of destabilizing agents such as formamide.
Exemplary low stringency conditions include hybridization with a
buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium
dodecyl sulphate) at 37.degree. C., and a wash in 1.times. to
2.times.SSC (20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50
to 55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C. Exemplary high stringency conditions include
hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C.,
and a wash in 0.1.times.SSC at 60 to 65.degree. C. Optionally, wash
buffers may comprise about 0.1% to about 1% SDS. Duration of
hybridization is generally less than about 24 hours, usually about
4 to about 12 hours. The duration of the wash time will be at least
a length of time sufficient to reach equilibrium.
[0076] In hybridization reactions, specificity is typically the
function of post-hybridization washes, the critical factors being
the ionic strength and temperature of the final wash solution. For
DNA-DNA hybrids, the T.sub.m can be approximated from the equation
of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284:
T.sub.m=81.5.degree. C.+16.6 (log M)+0.41 (% GC)-0.61 (%
form)-500/L; where M is the molarity of monovalent cations, % GC is
the percentage of guanosine and cytosine nucleotides in the DNA, %
form is the percentage of formamide in the hybridization solution,
and L is the length of the hybrid in base pairs. The T.sub.m is the
temperature (under defined ionic strength and pH) at which 50% of a
complementary target sequence hybridizes to a perfectly matched
probe. T.sub.m is reduced by about 1.degree. C. for each 1% of
mismatching; thus, T.sub.m, hybridization, and/or wash conditions
can be adjusted to hybridize to sequences of the desired identity.
For example, if sequences with .gtoreq.90% identity are sought, the
T.sub.m can be decreased 10.degree. C. Generally, stringent
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence and its
complement at a defined ionic strength and pH. However, severely
stringent conditions can utilize a hybridization and/or wash at 1,
2, 3, or 4.degree. C. lower than the thermal melting point
(T.sub.m); moderately stringent conditions can utilize a
hybridization and/or wash at 6, 7, 8, 9, or 10.degree. C. lower
than the thermal melting point (T.sub.m); low stringency conditions
can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or
20.degree. C. lower than the thermal melting point (T.sub.m). Using
the equation, hybridization and wash compositions, and desired
T.sub.m, those of ordinary skill will understand that variations in
the stringency of hybridization and/or wash solutions are
inherently described. If the desired degree of mismatching results
in a T.sub.m of less than 45.degree. C. (aqueous solution) or
32.degree. C. (formamide solution), it is optimal to increase the
SSC concentration so that a higher temperature can be used. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2
(Elsevier, N.Y.); and Ausubel et al., eds. (1995) Current Protocols
in Molecular Biology, Chapter 2 (Greene Publishing and
Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.) and Haymes et al. (1985) In: Nucleic Acid
Hybridization, a Practical Approach, IRL Press, Washington,
D.C.
[0077] A polynucleotide is said to be the "complement" of another
polynucleotide if they exhibit complementarity. As used herein,
molecules are said to exhibit "complete complementarity" when every
nucleotide of one of the polynucleotide molecules is complementary
to a nucleotide of the other. Two molecules are said to be
"minimally complementary" if they can hybridize to one another with
sufficient stability to permit them to remain annealed to one
another under at least conventional "low-stringency" conditions.
Similarly, the molecules are said to be "complementary" if they can
hybridize to one another with sufficient stability to permit them
to remain annealed to one another under conventional
"high-stringency" conditions.
[0078] Further provided are methods of detecting the presence of
DNA corresponding to the 3560.4.3.5 event in a sample. In one
embodiment, the method comprises (a) contacting the biological
sample with a polynucleotide probe that hybridizes under stringent
hybridization conditions with DNA from soybean event 3560.4.3.5 and
specifically detects the 3560.4.3.5 event; (b) subjecting the
sample and probe to stringent hybridization conditions; and (c)
detecting hybridization of the probe to the DNA, wherein detection
of hybridization indicates the presence of the 3560.4.3.5 event. In
one embodiment, the DNA is digested with appropriate enzymes are
preformed prior to the hybridization event.
[0079] Various method can be used to detect the 3560.4.3.5 specific
region or amplicon thereof, including, but not limited to, Genetic
Bit Analysis (Nikiforov et al. (1994) Nucleic Acid Res. 22:
4167-4175). In one method, a DNA oligonucleotide is designed which
overlaps both the adjacent flanking DNA sequence and the inserted
DNA sequence. In other embodiments, DNA oligos are designed to
allow for a 3560.4.3.5 specific amplicon. The oligonucleotide is
immobilized in wells of a microwell plate. Following PCR of the
region of interest a single-stranded PCR product can be hybridized
to the immobilized oligonucleotide and serve as a template for a
single base extension reaction using a DNA polymerase and labeled
ddNTPs specific for the expected next base. Readout may be
fluorescent or ELISA-based. A signal indicates presence of the
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
[0080] Another detection method is the Pyrosequencing technique as
described by Winge ((2000) Innov. Pharma. Tech. 00: 18-24). In this
method, an oligonucleotide is designed that overlaps the adjacent
DNA and insert DNA junction or a pair of oligos are employed that
can amplify a 3560.4.3.5 specific region. The oligonucleotide is
hybridized to a single-stranded PCR product from the region of
interest (one primer in the inserted sequence and one in the
flanking sequence) and incubated in the presence of a DNA
polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5'
phosphosulfate and luciferin. dNTPs are added individually and the
incorporation results in a light signal which is measured. A light
signal indicates the presence of the transgene insert/flanking
sequence due to successful amplification, hybridization, and single
or multi-base extension.
[0081] Fluorescence Polarization as described by Chen et al.
((1999) Genome Res. 9: 492-498, 1999) is also a method that can be
used to detect an amplicon of the invention. Using this method, an
oligonucleotide is designed which overlaps the flanking and
inserted DNA junction or a pair of oligos are employed that can
amplify a 3560.4.3.5 specific region. The oligonucleotide is
hybridized to a single-stranded PCR product from the region of
interest (one primer in the inserted DNA and one in the flanking
DNA sequence) and incubated in the presence of a DNA polymerase and
a fluorescent-labeled ddNTP. Single base extension results in
incorporation of the ddNTP. Incorporation can be measured as a
change in polarization using a fluorometer. A change in
polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
[0082] Taqman.RTM. (PE Applied Biosystems, Foster City, Calif.) is
described as a method of detecting and quantifying the presence of
a DNA sequence and is fully understood in the instructions provided
by the manufacturer. Briefly, a FRET oligonucleotide probe is
designed which overlaps the flanking and insert DNA junction or a
pair of oligos are employed that can amplify a 3560.4.3.5 specific
region. The FRET probe and PCR primers (one primer in the insert
DNA sequence and one in the flanking genomic sequence) are cycled
in the presence of a thermostable polymerase and dNTPs.
Hybridization of the FRET probe results in cleavage and release of
the fluorescent moiety away from the quenching moiety on the FRET
probe. A fluorescent signal indicates the presence of the
flanking/transgene insert sequence due to successful amplification
and hybridization.
[0083] Molecular Beacons have been described for use in sequence
detection as described in Tyangi et al. ((1996) Nature Biotech. 14:
303-308). Briefly, a FRET oligonucleotide probe is designed that
overlaps the flanking and insert DNA junction or a pair of oligos
are employed that can amplify a 3560.4.3.5 specific region. The
unique structure of the FRET probe results in it containing
secondary structure that keeps the fluorescent and quenching
moieties in close proximity. The FRET probe and PCR primers (one
primer in the insert DNA sequence and one in the flanking sequence)
are cycled in the presence of a thermostable polymerase and dNTPs.
Following successful PCR amplification, hybridization of the FRET
probe to the target sequence results in the removal of the probe
secondary structure and spatial separation of the fluorescent and
quenching moieties. A fluorescent signal results. A fluorescent
signal indicates the presence of the flanking/transgene insert
sequence due to successful amplification and hybridization.
[0084] A hybridization reaction using a probe specific to a
sequence found within the amplicon is yet another method used to
detect the amplicon produced by a PCR reaction.
[0085] As used herein, "kit" refers to a set of reagents for the
purpose of performing the method embodiments, more particularly,
the identification and/or the detection of the 3560.4.3.5 event in
biological samples. The kit can be used, and its components can be
specifically adjusted, for purposes of quality control (e.g. purity
of seed lots), detection of event 3560.4.3.5 in plant material, or
material comprising or derived from plant material, such as but not
limited to food or feed products.
[0086] In specific embodiments, a kit for identifying event
3560.4.3.5 in a biological sample is provided. The kit comprises a
first and a second primer, wherein the first and second primer
amplify a polynucleotide comprising a 3560.4.3.5 specific region.
In further embodiments, the kit also comprises a polynucleotide for
the detection of the 3560.4.3.5 specific region. The kit can
comprise, for example, a first primer comprising a fragment of a
polynucleotide of SEQ ID NO:4 or 5, wherein the first or the second
primer shares sufficient sequence homology or complementarity to
the polynucleotide to amplify said 3560.4.3.5 specific region. For
example, in specific embodiments, the first primer comprises a
fragment of a polynucleotide of SEQ ID NO:4 or 5, wherein the first
or the second primer shares sufficient sequence homology or
complementarity to the polynucleotide to amplify said 3560.4.3.5
specific region. The primer pair can comprises a fragment of SEQ ID
NO:4 and a fragment of SEQ ID NO:5 or 3, or alternatively, the
primer pair can comprises a fragment of SEQ ID NO:5 and a fragment
of SEQ ID NO:3 or 4. In still further embodiments, the first and
the second primer can comprise any one or any combination of the
sequences set forth in SEQ ID NO:7, 8, 9, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 37, 38, 39, 40, 43, 44, 45, 46, or 51-55. The
primers can be of any length sufficient to amplify the 3560.4.3.5
region including, for example, at least 6, 7, 8, 9, 10, 15, 20, 15,
or 30 or about 7-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40,
40-45 nucleotides or longer.
[0087] Further provided are DNA detection kits comprising at least
one polynucleotide that can specifically detect a 3560.4.3.5
specific region, wherein said polynucleotide comprises at least one
DNA molecule of a sufficient length of contiguous nucleotides
homologous or complementary to SEQ ID NO: 3, 4 or 5. In specific
embodiments, the DNA detection kit comprises a polynucleotide
having SEQ ID NO:10 or 11 or comprises a sequence which hybridizes
with sequences selected from the group consisting of: a) the
sequences of SEQ ID NO: 4 and SEQ ID NO:3; and, b) the sequences of
SEQ ID NO: 5 and SEQ ID NO: 3, and a sequence of SEQ ID NO:4 and
43.
[0088] Any of the polynucleotides and fragments and variants
thereof employed in the methods and compositions can share sequence
identity to a region of the transgene insert of the 3560.4.3.5
event, a junction sequence of the 3560.4.3.5 event or a flanking
sequence of the 3560.4.3.5 event. Methods to determine the
relationship of various sequences are known. As used herein,
"reference sequence" is a defined sequence used as a basis for
sequence comparison. A reference sequence may be a subset or the
entirety of a specified sequence; for example, as a segment of a
full-length cDNA or gene sequence, or the complete cDNA or gene
sequence. As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two polynucleotides. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence a
gap penalty is typically introduced and is subtracted from the
number of matches.
[0089] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent sequence
identity between any two sequences can be accomplished using a
mathematical algorithm. Non-limiting examples of such mathematical
algorithms are the algorithm of Myers and Miller (1988) CABIOS
4:11-17; the local alignment algorithm of Smith et al. (1981) Adv.
Appl. Math. 2:482; the global alignment algorithm of Needleman and
Wunsch (1970) J. Mol. Biol. 48:443-453; the search-for-local
alignment method of Pearson and Lipman (1988) Proc. Natl. Acad.
Sci. 85:2444-2448; the algorithm of Karlin and Altschul (1990)
Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and
Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
[0090] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics
Software Package, Version 10 (available from Accelrys Inc., 9685
Scranton Road, San Diego, Calif., USA). Alignments using these
programs can be performed using the default parameters. The CLUSTAL
program is well described by Higgins et al. (1988) Gene 73:237-244
(1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet et al.
(1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) CABIOS
8:155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24:307-331.
The ALIGN program is based on the algorithm of Myers and Miller
(1988) supra. A PAM120 weight residue table, a gap length penalty
of 12, and a gap penalty of 4 can be used with the ALIGN program
when comparing amino acid sequences. The BLAST programs of Altschul
et al (1990) J. Mol. Biol. 215:403 are based on the algorithm of
Karlin and Altschul (1990) supra. BLAST nucleotide searches can be
performed with the BLASTN program, score=100, wordlength=12, to
obtain nucleotide sequences homologous to a nucleotide sequence
encoding a protein. BLAST protein searches can be performed with
the BLASTX program, score=50, wordlength=3, to obtain amino acid
sequences homologous to a protein or polypeptide. To obtain gapped
alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can
be utilized as described in Altschul et al. (1997) Nucleic Acids
Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used
to perform an iterated search that detects distant relationships
between molecules. See Altschul et al. (1997) supra. When utilizing
BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the
respective programs (e.g., BLASTN for nucleotide sequences, BLASTX
for proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may
also be performed manually by inspection.
[0091] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using GAP Version 10
using the following parameters: % identity and % similarity for a
nucleotide sequence using GAP Weight of 50 and Length Weight of 3,
and the nwsgapdna.cmp scoring matrix; % identity and % similarity
for an amino acid sequence using GAP Weight of 8 and Length Weight
of 2, and the BLOSUM62 scoring matrix; or any equivalent program
thereof. By "equivalent program" any sequence comparison program
that, for any two sequences in question, generates an alignment
having identical nucleotide or amino acid residue matches and an
identical percent sequence identity when compared to the
corresponding alignment generated by GAP Version 10 is
intended.
[0092] GAP uses the algorithm of Needleman and Wunsch (1970) J.
Mol. Biol. 48:443-453, to find the alignment of two complete
sequences that maximizes the number of matches and minimizes the
number of gaps. GAP considers all possible alignments and gap
positions and creates the alignment with the largest number of
matched bases and the fewest gaps. It allows for the provision of a
gap creation penalty and a gap extension penalty in units of
matched bases. GAP must make a profit of gap creation penalty
number of matches for each gap it inserts. If a gap extension
penalty greater than zero is chosen, GAP must, in addition, make a
profit for each gap inserted of the length of the gap times the gap
extension penalty. Default gap creation penalty values and gap
extension penalty values in Version 10 of the GCG Wisconsin
Genetics Software Package for protein sequences are 8 and 2,
respectively. For nucleotide sequences the default gap creation
penalty is 50 while the default gap extension penalty is 3. The gap
creation and gap extension penalties can be expressed as an integer
selected from the group of integers consisting of from 0 to 200.
Thus, for example, the gap creation and gap extension penalties can
be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65 or greater.
[0093] GAP presents one member of the family of best alignments.
There may be many members of this family, but no other member has a
better quality. GAP displays four figures of merit for alignments:
Quality, Ratio, Identity, and Similarity. The Quality is the metric
maximized in order to align the sequences. Ratio is the Quality
divided by the number of bases in the shorter segment. Percent
Identity is the percent of the symbols that actually match. Percent
Similarity is the percent of the symbols that are similar. Symbols
that are across from gaps are ignored. A similarity is scored when
the scoring matrix value for a pair of symbols is greater than or
equal to 0.50, the similarity threshold. The scoring matrix used in
Version 10 of the GCG Wisconsin Genetics Software Package is
BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci.
USA 89:10915).
[0094] As used herein, "sequence identity" or "identity" in the
context of two polynucleotides or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity". Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0095] As used herein, "percentage of sequence identity" means the
value determined by comparing two optimally aligned sequences over
a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0096] Methods are provided for controlling weeds in an area of
cultivation, preventing the development or the appearance of
herbicide resistant weeds in an area of cultivation, producing a
crop, and increasing crop safety. The term "controlling," and
derivations thereof, for example, as in "controlling weeds" refers
to one or more of inhibiting the growth, germination, reproduction,
and/or proliferation of; and/or killing, removing, destroying, or
otherwise diminishing the occurrence and/or activity of a weed.
[0097] As used herein, an "area of cultivation" comprises any
region in which one desires to grow a plant. Such areas of
cultivations include, but are not limited to, a field in which a
plant is cultivated (such as a crop field, a sod field, a tree
field, a managed forest, a field for culturing fruits and
vegetables, etc), a greenhouse, a growth chamber, etc.
[0098] The methods comprise planting the area of cultivation with
the soybean 3560.4.3.5 seeds or plants, and in specific
embodiments, applying to the crop, seed, weed or area of
cultivation thereof an effective amount of a herbicide of interest.
It is recognized that the herbicide can be applied before or after
the crop is planted in the area of cultivation. Such herbicide
applications can include an application of glyphosate, an ALS
inhibitor chemistry, or any combination thereof. In specific
embodiments, a mixture of an ALS inhibitor chemistry in combination
with glyphosate is applied to the soybean 3560.4.3.5, wherein the
effective concentration of at least the ALS inhibitor chemistry
would significantly damage an appropriate control plant. In one
non-limiting embodiment, the herbicide comprises at least one of a
sulfonylaminocarbonyltriazolinone; a triazolopyrimidine; a
pyrimidinyl(thio)benzoate; an imidazolinone; a triazine; and/or a
phosphinic acid.
[0099] In another non-limiting embodiment, the combination of
herbicides comprises glyphosate, imazapyr, chlorimuron-ethyl,
quizalofop, and fomesafen, wherein an effective amount is tolerated
by the crop and controls weeds. As disclosed elsewhere herein, any
effective amount of these herbicides can be applied. In specific
embodiments, this combination of herbicides comprises an effective
amount of glyphosate comprising about 1110 to about 1130 g
ai/hectare; an effective amount of imazapyr comprising about 7.5 to
about 27.5 g ai/hectare; an effective amount of chlorimuron-ethyl
comprising about 7.5 to about 27.5 g ai/hectare; an effective
amount of quizalofop comprising about 50 to about 70 g ai/hectare;
and, an effective amount of fomesafen comprising about 240 to about
260 g ai/hectare.
[0100] In other embodiments, a combination of at least two
herbicides is applied, wherein the combination does not include
glyphosate. In other embodiments, at least one ALS inhibitor and
glyphosate is applied to the plant. More details regarding the
various herbicide combinations that can be employed in the methods
are discussed elsewhere herein.
[0101] In one embodiment, the method of controlling weeds comprises
planting the area with the 3560.4.3.5 soybean seeds or plants and
applying to the crop, crop part, seed of said crop or the area
under cultivation, an effective amount of a herbicide, wherein said
effective amount comprises
[0102] i) an amount that is not tolerated by a first control crop
when applied to the first control crop, crop part, seed or the area
of cultivation, wherein said first control crop expresses a first
polynucleotide encoding GLYAT polypeptide that confers tolerance to
glyphosate and does not express a second polynucleotide that
encodes the gm-hra polypeptide;
[0103] ii) an amount that is not tolerated by a second control crop
when applied to the second crop, crop part, seed or the area of
cultivation, wherein said second control crop expresses the gm-hra
polynucleotide and does not express the glyat polynucleotide;
and,
[0104] iii) an amount that is tolerated when applied to the
3560.4.3.5 soybean crop, crop part, seed, or the area of
cultivation thereof. The herbicide can comprise a combination of
herbicides that either includes or does not include glyphosate. In
specific embodiments, the combination of herbicides comprises ALS
inhibitor chemistries as discussed in further detail below.
[0105] In another embodiment, the method of controlling weeds
comprises planting the area with a 3560.4.3.5 soybean crop seed or
plant and applying to the crop, crop part, seed of said crop or the
area under cultivation, an effective amount of a herbicide, wherein
said effective amount comprises a level that is above the
recommended label use rate for the crop, wherein said effective
amount is tolerated when applied to the 3560.4.3.5 soybean crop,
crop part, seed, or the area of cultivation thereof. The herbicide
applied can comprise a combination of herbicides that either
includes or does not include glyphosate. In specific embodiments,
the combination of herbicides comprises at least one ALS inhibitor
chemistry as discussed in further detail below. Further herbicides
and combinations thereof that can be employed in the various
methods are discussed in further detail below.
[0106] A "control" or "control plant" or "control plant cell"
provides a reference point for measuring changes in phenotype of
the subject plant or plant cell, and may be any suitable plant or
plant cell. A control plant or plant cell may comprise, for
example: (a) a wild-type plant or cell, i.e., of the same genotype
as the starting material for the genetic alteration which resulted
in the subject plant or cell; (b) a plant or plant cell of the same
genotype as the starting material but which has been transformed
with a null construct (i.e., with a construct which has no known
effect on the trait of interest, such as a construct comprising a
marker gene); (c) a plant or plant cell which is a non-transformed
segregant among progeny of a subject plant or plant cell; (d) a
plant or plant cell which is genetically identical to the subject
plant or plant cell but which is not exposed to the same treatment
(e.g., herbicide treatment) as the subject plant or plant cell; (e)
the subject plant or plant cell itself, under conditions in which
the gene of interest is not expressed; or (f) the subject plant or
plant cell itself, under conditions in which it has not been
exposed to a particular treatment such as, for example, a herbicide
or combination of herbicides and/or other chemicals. In some
instances, an appropriate control plant or control plant cell may
have a different genotype from the subject plant or plant cell but
may share the herbicide-sensitive characteristics of the starting
material for the genetic alteration(s) which resulted in the
subject plant or cell (see, e.g., Green (1998) Weed Technology 12:
474-477; Green and Ulrich (1993) Weed Science 41: 508-516. In some
instances, an appropriate control soybean plant is a "Jack" soybean
plant (Illinois Foundation Seed, Champaign, Ill.). In other
embodiments, the null segregant can be used as a control, as they
are near isogenic to 3560.4.3.5 with the exception of the
transgenic insert DNA.
[0107] Any herbicide can be applied to the 3560.4.3.5 soybean crop,
crop part, or the area of cultivation containing the crop plant.
Classification of herbicides (i.e., the grouping of herbicides into
classes and subclasses) is well-known in the art and includes
classifications by HRAC (Herbicide Resistance Action Committee) and
WSSA (the Weed Science Society of America) (see also, Retzinger and
Mallory-Smith (1997) Weed Technology 11: 384-393). An abbreviated
version of the HRAC classification (with notes regarding the
corresponding WSSA group) is set forth below in Table 1.
[0108] Herbicides can be classified by their mode of action and/or
site of action and can also be classified by the time at which they
are applied (e.g., preemergent or postemergent), by the method of
application (e.g., foliar application or soil application), or by
how they are taken up by or affect the plant. For example,
thifensulfuron-methyl and tribenuron-methyl are applied to the
foliage of a crop and are generally metabolized there, while
rimsulfuron and chlorimuron-ethyl are generally taken up through
both the roots and foliage of a plant. "Mode of action" generally
refers to the metabolic or physiological process within the plant
that the herbicide inhibits or otherwise impairs, whereas "site of
action" generally refers to the physical location or biochemical
site within the plant where the herbicide acts or directly
interacts. Herbicides can be classified in various ways, including
by mode of action and/or site of action (see, e.g., Table 1).
[0109] Often, an herbicide-tolerance gene that confers tolerance to
a particular herbicide or other chemical on a plant expressing it
will also confer tolerance to other herbicides or chemicals in the
same class or subclass, for example, a class or subclass set forth
in Table 1. Thus, in some embodiments, a transgenic plant is
tolerant to more than one herbicide or chemical in the same class
or subclass, such as, for example, an inhibitor of PPO, a
sulfonylurea, or a synthetic auxin.
[0110] Typically, the plants can tolerate treatment with different
types of herbicides (i.e., herbicides having different modes of
action and/or different sites of action) as well as with higher
amounts of herbicides than previously known plants, thereby
permitting improved weed management strategies that are recommended
in order to reduce the incidence and prevalence of
herbicide-tolerant weeds. Specific herbicide combinations can be
employed to effectively control weeds.
[0111] Transgenic soybean plants are provided which can be selected
for use in crop production based on the prevalence of
herbicide-tolerant weed species in the area where the transgenic
crop is to be grown. Weed management techniques, such as for
example, crop rotation using a crop that is tolerant to a herbicide
to which the local weed species are not tolerant can be used. See,
for example, the Herbicide Resistance Action Committee (HRAC), the
Weed Science Society of America, and various state agencies and the
herbicide tolerance scores for various broadleaf weeds from the
2004 Illinois Agricultural Pest Management Handbook). See also,
Owen and Hartzler (2004), 2005 Herbicide Manual for Agricultural
Professionals, Pub. WC 92 Revised (Iowa State University Extension,
Iowa State University of Science and Technology, Ames, Iowa); Weed
Control for Corn, Soybeans, and Sorghum, Chapter 2 of "2004
Illinois Agricultural Pest Management Handbook" (University of
Illinois Extension, University of Illinois at Urbana-Champaign,
Ill.); Weed Control Guide for Field Crops, MSU Extension Bulletin
E434 (Michigan State University, East Lansing, Mich.)).
TABLE-US-00001 TABLE 1 Abbreviated version of HRAC Herbicide
Classification I. ALS Inhibitors (WSSA Group 2) A. Sulfonylureas 1.
Azimsulfuron 2. Chlorimuron-ethyl 3. Metsulfuron-methyl 4.
Nicosulfuron 5. Rimsulfuron 6. Sulfometuron-methyl 7.
Thifensulfuron-methyl 8. Tribenuron-methyl 9. Amidosulfuron 10.
Bensulfuron-methyl 11. Chlorsulfuron 12. Cinosulfuron 13.
Cyclosulfamuron 14. Ethametsulfuron-methyl 15. Ethoxysulfuron 16.
Flazasulfuron 17. Flupyrsulfuron-methyl 18. Foramsulfuron 19.
Imazosulfuron 20. Iodosulfuron-methyl 21. Mesosulfuron-methyl 22.
Oxasulfuron 23. Primisulfuron-methyl 24. Prosulfuron 25.
Pyrazosulfuron-ethyl 26. Sulfosulfuron 27. Triasulfuron 28.
Trifloxysulfuron 29. Triflusulfuron-methyl 30. Tritosulfuron 31.
Halosulfuron-methyl 32. Flucetosulfuron B.
Sulfonylaminocarbonyltriazolinones 1. Flucarbazone 2. Procarbazone
C. Triazolopyrimidines 1. Cloransulam-methyl 2. Flumetsulam 3.
Diclosulam 4. Florasulam 5. Metosulam 6. Penoxsulam 7. Pyroxsulam
D. Pyrimidinyloxy(thio)benzoates 1. Bispyribac 2. Pyriftalid 3.
Pyribenzoxim 4. Pyrithiobac 5. Pyriminobac-methyl E. Imidazolinones
1. Imazapyr 2. Imazethapyr 3. Imazaquin 4. Imazapic 5.
Imazamethabenz-methyl 6. Imazamox II. Other Herbicides--Active
Ingredients/ Additional Modes of Action A. Inhibitors of Acetyl CoA
carboxylase (ACCase) (WSSA Group 1) 1. Aryloxyphenoxypropionates
(`FOPs`) a. Quizalofop-P-ethyl b. Diclofop-methyl c.
Clodinafop-propargyl d. Fenoxaprop-P-ethyl e. Fluazifop-P-butyl f.
Propaquizafop g. Haloxyfop-P-methyl h. Cyhalofop-butyl i.
Quizalofop-P-ethyl 2. Cyclohexanediones (`DIMs`) a. Alloxydim b.
Butroxydim c. Clethodim d. Cycloxydim e. Sethoxydim f. Tepraloxydim
g. Tralkoxydim B. Inhibitors of Photosystem II-HRAC Group C1/WSSA
Group 5 1. Triazines a. Ametryne b. Atrazine c. Cyanazine d.
Desmetryne e. Dimethametryne f. Prometon g. Prometryne h. Propazine
i. Simazine j. Simetryne k. Terbumeton l. Terbuthylazine m.
Terbutryne n. Trietazine 2. Triazinones a. Hexazinone b. Metribuzin
c. Metamitron 3. Triazolinone a. Amicarbazone 4. Uracils a.
Bromacil b. Lenacil c. Terbacil 5. Pyridazinones a. Pyrazon 6.
Phenyl carbamates a. Desmedipham b. Phenmedipham C. Inhibitors of
Photosystem II--HRAC Group C2/WSSA Group 7 1. Ureas a. Fluometuron
b. Linuron c. Chlorobromuron d. Chlorotoluron e. Chloroxuron f.
Dimefuron g. Diuron h. Ethidimuron i. Fenuron j. Isoproturon k.
Isouron l. Methabenzthiazuron m. Metobromuron n. Metoxuron o.
Monolinuron p. Neburon q. Siduron r. Tebuthiuron 2. Amides a.
Propanil b. Pentanochlor D. Inhibitors of Photosystem II--HRAC
Group C3/WSSA Group 6 1. Nitriles a. Bromofenoxim b. Bromoxynil c.
Ioxynil 2. Benzothiadiazinone (Bentazon) a. Bentazon 3.
Phenylpyridazines a. Pyridate b. Pyridafol E.
Photosystem-I-electron diversion (Bipyridyliums) (WSSA Group 22) 1.
Diquat 2. Paraquat F. Inhibitors of PPO (protoporphyrinogen
oxidase) (WSSA Group 14) 1. Diphenylethers a. Acifluorfen-Na b.
Bifenox c. Chlomethoxyfen d. Fluoroglycofen-ethyl e. Fomesafen f.
Halosafen g. Lactofen h. Oxyfluorfen 2. Phenylpyrazoles a.
Fluazolate b. Pyraflufen-ethyl 3. N-phenylphthalimides a.
Cinidon-ethyl b. Flumioxazin c. Flumiclorac-pentyl 4. Thiadiazoles
a. Fluthiacet-methyl b. Thidiazimin 5. Oxadiazoles a. Oxadiazon b.
Oxadiargyl 6. Triazolinones a. Carfentrazone-ethyl b. Sulfentrazone
7. Oxazolidinediones a. Pentoxazone 8. Pyrimidindiones a.
Benzfendizone b. Butafenicil 9. Others a. Pyrazogyl b. Profluazol
G. Bleaching: Inhibition of carotenoid biosynthesis at the phytoene
desaturase step (PDS) (WSSA Group 12) 1. Pyridazinones a.
Norflurazon 2. Pyridinecarboxamides a. Diflufenican b. Picolinafen
3. Others a. Beflubutamid b. Fluridone c. Flurochloridone d.
Flurtamone H. Bleaching: Inhibition of 4-
hydroxyphenyl-pyruvate-dioxygenase (4-HPPD) (WSSA Group 28) 1.
Triketones a. Mesotrione b. Sulcotrione 2. Isoxazoles a.
Isoxachlortole b. Isoxaflutole 3. Pyrazoles a. Benzofenap b.
Pyrazoxyfen c. Pyrazolynate 4. Others a. Benzobicyclon I.
Bleaching: Inhibition of carotenoid biosynthesis (unknown target)
(WSSA Group 11 and 13) 1. Triazoles (WSSA Group 11) a. Amitrole 2.
Isoxazolidinones (WSSA Group 13) a. Clomazone 3. Ureas a.
Fluometuron 3. Diphenylether a. Aclonifen J. Inhibition of EPSP
Synthase 1. Glycines (WSSA Group 9) a. Glyphosate b. Sulfosate K.
Inhibition of glutamine synthetase 1. Phosphinic Acids a.
Glufosinate-ammonium b. Bialaphos L. Inhibition of DHP
(dihydropteroate) synthase (WSSA Group 18) 1. Carbamates a. Asulam
M. Microtubule Assembly Inhibition (WSSA Group 3) 1.
Dinitroanilines a. Benfluralin b. Butralin c. Dinitramine d.
Ethalfluralin e. Oryzalin
f. Pendimethalin g. Trifluralin 2. Phosphoroamidates a.
Amiprophos-methyl b. Butamiphos 3. Pyridines a. Dithiopyr b.
Thiazopyr 4. Benzamides a. Pronamide b. Tebutam 5.
Benzenedicarboxylic acids a. Chlorthal-dimethyl N. Inhibition of
mitosis/microtubule organization WSSA Group 23) 1. Carbamates a.
Chlorpropham b. Propham c. Carbetamide O. Inhibition of cell
division (Inhibition of very long chain fatty acids as proposed
mechanism; WSSA Group 15) 1. Chloroacetamides a. Acetochlor b.
Alachlor c. Butachlor d. Dimethachlor e. Dimethanamid f.
Metazachlor g. Metolachlor h. Pethoxamid i. Pretilachlor j.
Propachlor k. Propisochlor l. Thenylchlor 2. Acetamides a.
Diphenamid b. Napropamide c. Naproanilide 3. Oxyacetamides a.
Flufenacet b. Mefenacet 4. Tetrazolinones a. Fentrazamide 5. Others
a. Anilofos b. Cafenstrole c. Indanofan d. Piperophos P. Inhibition
of cell wall (cellulose) synthesis 1. Nitriles (WSSA Group 20) a.
Dichlobenil b. Chlorthiamid 2. Benzamides (isoxaben (WSSA Group
21)) a. Isoxaben 3. Triazolocarboxamides (flupoxam) a. Flupoxam Q.
Uncoupling (membrane disruption): (WSSA Group 24) 1. Dinitrophenols
a. DNOC b. Dinoseb c. Dinoterb R. Inhibition of Lipid Synthesis by
other than ACC inhibition 1. Thiocarbamates (WSSA Group 8) a.
Butylate b. Cycloate c. Dimepiperate d. EPTC e. Esprocarb f.
Molinate g. Orbencarb h. Pebulate i. Prosulfocarb j. Benthiocarb k.
Tiocarbazil l. Triallate m. Vernolate 2. Phosphorodithioates a.
Bensulide 3. Benzofurans a. Benfuresate b. Ethofumesate 4.
Halogenated alkanoic acids (WSSA Group 26) a. TCA b. Dalapon c.
Flupropanate S. Synthetic auxins (IAA-like) (WSSA Group 4) 1.
Phenoxycarboxylic acids a. Clomeprop b. 2,4-D c. Mecoprop 2.
Benzoic acids a. Dicamba b. Chloramben c. TBA 3. Pyridine
carboxylic acids a. Clopyralid b. Fluroxypyr c. Picloram d.
Tricyclopyr 4. Quinoline carboxylic acids a. Quinclorac b.
Quinmerac 5. Others (benazolin-ethyl) a. Benazolin-ethyl T.
Inhibition of Auxin Transport 1. Phthalamates; semicarbazones (WSSA
Group 19) a. Naptalam b. Diflufenzopyr-Na U. Other Mechanism of
Action 1. Arylaminopropionic acids a. Flamprop-M-methyl/- isopropyl
2. Pyrazolium a. Difenzoquat 3. Organoarsenicals a. DSMA b. MSMA 4.
Others a. Bromobutide b. Cinmethylin c. Cumyluron d. Dazomet e.
Daimuron-methyl f. Dimuron g. Etobenzanid h. Fosamine i. Metam j.
Oxaziclomefone k. Oleic acid l. Pelargonic acid m. Pyributicarb
[0112] In one embodiment, one ALS inhibitor or at least two ALS
inhibitors are applied to the 3560.4.3.5 soybean crop or area of
cultivation. In non-limiting embodiments, the combination of ALS
inhibitor herbicides can include or does not include glyphosate.
The ALS inhibitor can be applied at any effective rate that
selectively controls weeds and does not significantly damage the
crop. In specific embodiments, at least one ALS inhibitor is
applied at a level that would significantly damage an appropriate
control plant. In other embodiments, at least one ALS inhibitor is
applied above the recommended label use rate for the crop. In still
other embodiments, a mixture of ALS inhibitors is applied at a
lower rate than the recommended use rate and weeds continue to be
selectively controlled. Herbicides that inhibit acetolactate
synthase (also known as acetohydroxy acid synthase) and are
therefore useful in the methods include sulfonylureas as listed in
Table 1, including agriculturally suitable salts (e.g., sodium
salts) thereof; sulfonylaminocarbonyltriazolinones as listed in
Table 1, including agriculturally suitable salts (e.g., sodium
salts) thereof; triazolopyrimidines as listed in Table 1, including
agriculturally suitable salts (e.g., sodium salts) thereof;
pyrimidinyloxy(thio)benzoates as listed in Table 1, including
agriculturally suitable salts (e.g., sodium salts) thereof; and
imidazolinones as listed in Table 1, including agriculturally
suitable salts (e.g., sodium salts) thereof. In some embodiments,
methods comprise the use of a sulfonylurea which is not
chlorimuron-ethyl, chlorsulfuron, rimsulfuron,
thifensulfuron-methyl, or tribenuron-methyl.
[0113] In still further methods, glyphosate, alone or in
combination with another herbicide of interest, can be applied to
the 3560.4.3.5 soybean plants or their area of cultivation.
Non-limiting examples of glyphosate formations are set forth in
Table 2. In specific embodiments, the glyphosate is in the form of
a salt, such as, ammonium, isopropylammonium, potassium, sodium
(including sesquisodium) or trimesium (alternatively named
sulfosate). In still further embodiments, a mixture of a
synergistically effective amount of a combination of glyphosate and
an ALS inhibitor (such as a sulfonylurea) is applied to the
3560.4.3.5 soybean plants or their area of cultivation.
TABLE-US-00002 TABLE 2 Glyphosate formulations comparisons. Active
Acid Acid ingredi- equiva- Apply- equiva- Herbicide by Registered
ent per lent per fl oz/ lent per Trademark Manufacturer Salt gallon
gallon acre acre Roundup Original Monsanto Isopropylamine 4 3 32
0.750 Roundup Original II Monsanto Isopropylamine 4 3 32 0.750
Roundup Original MAX Monsanto Potassium 5.5 4.5 22 0.773 Roundup
UltraMax Monsanto Isopropylamine 5 3.68 26 0.748 Roundup UltraMax
II Monsanto Potassium 5.5 4.5 22 0.773 Roundup Weathermax Monsanto
Potassium 5.5 4.5 22 0.773 Touchdown Syngenta Diammomium 3.7 3 32
0.750 Touchdown HiTech Syngenta Potassium 6.16 5 20 0.781 Touchdown
Total Syngenta Potassium 5.14 4.17 24 0.782 Durango Dow
AgroSciences Isopropylamine 5.4 4 24 0.750 Glyphomax Dow
AgroSciences Isopropylamine 4 3 32 0.750 Glyphomax Plus Dow
AgroSciences Isopropylamine 4 3 32 0.750 Glyphomax XRT Dow
AgroSciences Isopropylamine 4 3 32 0.750 Gly Star Plus Albaugh/Agri
Star Isopropylamine 4 3 32 0.750 Gly Star 5 Albaugh/Agri Star
Isopropylamine 5.4 4 24 0.750 Gly Star Original Albaugh/Agri Star
Isopropylamine 4 3 32 0.750 Gly-Flo Micro Flo Isopropylamine 4 3 32
0.750 Credit Nufarm Isopropylamine 4 3 32 0.750 Credit Extra Nufarm
Isopropylamine 4 3 32 0.750 Credit Duo Nufarm Isopro. + 4 3 32
0.750 monoamm. Credit Duo Extra Nufarm Isopro. + 4 3 32 0.750
monoamm. Extra Credit 5 Nufarm Isopropylamine 5 3.68 26 0.748
Cornerstone Agriliance Isopropylamine 4 3 32 0.750 Cornertsone Plus
Agriliance Isopropylamine 4 3 32 0.750 Glylos Cheminova
Isopropylamine 4 3 32 0.750 Glyos X-TRA Cheminova Isopropylamine 4
3 32 0.750 Rattler Helena Isopropylamine 4 3 32 0.750 Rattler Plus
Helena Isopropylamine 4 3 32 0.750 Mirage UAP Isopropylamine 4 3 32
0.750 Mirage Plus UAP Isopropylamine 4 3 32 0.750 Glyphosate 41%
Helm Agro USA Isopropylamine 4 3 32 0.750 Buccaneer Tenkoz
Isopropylamine 4 3 32 0.750 Bucaneer Plus Tenkoz Isopropylamine 4 3
32 0.750 Honcho Monsanto Isopropylamine 4 3 32 0.750 Honcho Plus
Monsanto Isopropylamine 4 3 32 0.750 Gly-4 Univ. Crop Prot. Alli
Isopropylamine 4 3 32 0.750 Gly-4 Plus Univ. Crop Prot. Alli
Isopropylamine 4 3 32 0.750 ClearOut 41 Chemical Products
Isopropylamine 4 3 32 0.750 Tech. ClearOut 41 Plus Chemical
Products Isopropylamine 4 3 32 0.750 Tech Spitfire Control
Solutions Isopropylamine 4 3 32 0.750 Spitfire Plus Control
Solutions Isopropylamine 4 3 32 0.750 Glyphosate 4 FarmerSaver.com
Isopropylamine 4 3 32 0.750 FS Glyphosate Plus Growmark
Isopropylamine 4 3 32 0.750 Glyphosate Original Griffin, LLC.
Isopropylamine 4 3 32 0.750
[0114] Thus, in some embodiments, a transgenic plant is used in a
method of growing a 3560.4.3.5 soybean crop by the application of
herbicides to which the plant is tolerant. In this manner,
treatment with a combination of one of more herbicides which
include, but are not limited to: acetochlor, acifluorfen and its
sodium salt, aclonifen, acrolein (2-propenal), alachlor, alloxydim,
ametryn, amicarbazone, amidosulfuron, aminopyralid, amitrole,
ammonium sulfamate, anilofos, asulam, atrazine, azimsulfuron,
beflubutamid, benazolin, benazolin-ethyl, bencarbazone,
benfluralin, benfuresate, bensulfuron-methyl, bensulide, bentazone,
benzobicyclon, benzofenap, bifenox, bilanafos, bispyribac and its
sodium salt, bromacil, bromobutide, bromofenoxim, bromoxynil,
bromoxynil octanoate, butachlor, butafenacil, butamifos, butralin,
butroxydim, butylate, cafenstrole, carbetamide,
carfentrazone-ethyl, catechin, chlomethoxyfen, chloramben,
chlorbromuron, chlorflurenol-methyl, chloridazon,
chlorimuron-ethyl, chlorotoluron, chlorpropham, chlorsulfuron,
chlorthal-dimethyl, chlorthiamid, cinidon-ethyl, cinmethylin,
cinosulfuron, clethodim, clodinafop-propargyl, clomazone,
clomeprop, clopyralid, clopyralid-olamine, cloransulam-methyl,
CUH-35 (2-methoxyethyl
2-[[[4-chloro-2-fluoro-5-[(1-methyl-2-propynyl)oxy]-phenyl](3-fluorobenzo-
yl)amino]carbonyl]-1-cyclohexene-1-carboxylate), cumyluron,
cyanazine, cycloate, cyclosulfamuron, cycloxydim, cyhalofop-butyl,
2,4-D and its butotyl, butyl, isoctyl and isopropyl esters and its
dimethylammonium, diolamine and trolamine salts, daimuron, dalapon,
dalapon-sodium, dazomet, 2,4-DB and its dimethylammonium, potassium
and sodium salts, desmedipham, desmetryn, dicamba and its
diglycolammonium, dimethylammonium, potassium and sodium salts,
dichlobenil, dichlorprop, diclofop-methyl, diclosulam, difenzoquat
metilsulfate, diflufenican, diflufenzopyr, dimefuron, dimepiperate,
dimethachlor, dimethametryn, dimethenamid, dimethenamid-P,
dimethipin, dimethylarsinic acid and its sodium salt, dinitramine,
dinoterb, diphenamid, diquat dibromide, dithiopyr, diuron, DNOC,
endothal, EPTC, esprocarb, ethalfluralin, ethametsulfuron-methyl,
ethofumesate, ethoxyfen, ethoxysulfuron, etobenzanid,
fenoxaprop-ethyl, fenoxaprop-P-ethyl, fentrazamide, fenuron,
fenuron-TCA, flamprop-methyl, flamprop-M-isopropyl,
flamprop-M-methyl, flazasulfuron, florasulam, fluazifop-butyl,
fluazifop-P-butyl, flucarbazone, flucetosulfuron, fluchloralin,
flufenacet, flufenpyr, flufenpyr-ethyl, flumetsulam,
flumiclorac-pentyl, flumioxazin, fluometuron, fluoroglycofen-ethyl,
flupyrsulfuron-methyl and its sodium salt, flurenol,
flurenol-butyl, fluridone, fluorochloridone, fluoroxypyr,
flurtamone, fluthiacet-methyl, fomesafen, foramsulfuron,
fosamine-ammonium, glufosinate, glufosinate-ammonium, glyphosate
and its salts such as ammonium, isopropylammonium, potassium,
sodium (including sesquisodium) and trimesium (alternatively named
sulfosate), halosulfuron-methyl, haloxyfop-etotyl,
haloxyfop-methyl, hexazinone, HOK-201
(N-(2,4-difluorophenyl)-1,5-dihydro-N-(1-methylethyl)-5-oxo-1-[(t-
etrahydro-2H-pyran-2-yl)methyl]-4H-1,2,4-triazole-4-carboxamide),
imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin,
imazaquin-ammonium, imazethapyr, imazethapyr-ammonium,
imazosulfuron, indanofan, iodosulfuron-methyl, ioxynil, ioxynil
octanoate, ioxynil-sodium, isoproturon, isouron, isoxaben,
isoxaflutole, isoxachlortole, lactofen, lenacil, linuron, maleic
hydrazide, MCPA and its salts (e.g., MCPA-dimethylammonium,
MCPA-potassium and MCPA-sodium, esters (e.g., MCPA-2-ethylhexyl,
MCPA-butotyl) and thioesters (e.g., MCPA-thioethyl), MCPB and its
salts (e.g., MCPB-sodium) and esters (e.g., MCPB-ethyl), mecoprop,
mecoprop-P, mefenacet, mefluidide, mesosulfuron-methyl, mesotrione,
metam-sodium, metamifop, metamitron, metazachlor,
methabenzthiazuron, methylarsonic acid and its calcium,
monoammonium, monosodium and disodium salts, methyldymron,
metobenzuron, metobromuron, metolachlor, S-metholachlor, metosulam,
metoxuron, metribuzin, metsulfuron-methyl, molinate, monolinuron,
naproanilide, napropamide, naptalam, neburon, nicosulfuron,
norflurazon, orbencarb, oryzalin, oxadiargyl, oxadiazon,
oxasulfuron, oxaziclomefone, oxyfluorfen, paraquat dichloride,
pebulate, pelargonic acid, pendimethalin, penoxsulam, pentanochlor,
pentoxazone, perfluidone, pethoxyamid, phenmedipham, picloram,
picloram-potassium, picolinafen, pinoxaden, piperofos,
pretilachlor, primisulfuron-methyl, prodiamine, profoxydim,
prometon, prometryn, propachlor, propanil, propaquizafop,
propazine, propham, propisochlor, propoxycarbazone, propyzamide,
prosulfocarb, prosulfuron, pyraclonil, pyraflufen-ethyl,
pyrasulfotole, pyrazogyl, pyrazolynate, pyrazoxyfen,
pyrazosulfuron-ethyl, pyribenzoxim, pyributicarb, pyridate,
pyriftalid, pyriminobac-methyl, pyrimisulfan, pyrithiobac,
pyrithiobac-sodium, pyroxsulam, quinclorac, quinmerac,
quinoclamine, quizalofop-ethyl, quizalofop-P-ethyl,
quizalofop-P-tefuryl, rimsulfuron, sethoxydim, siduron, simazine,
simetryn, sulcotrione, sulfentrazone, sulfometuron-methyl,
sulfosulfuron, 2,3,6-TBA, TCA, TCA-sodium, tebutam, tebuthiuron,
tefuryltrione, tembotrione, tepraloxydim, terbacil, terbumeton,
terbuthylazine, terbutryn, thenylchlor, thiazopyr, thiencarbazone,
thifensulfuron-methyl, thiobencarb, tiocarbazil, topramezone,
tralkoxydim, tri-allate, triasulfuron, triaziflam,
tribenuron-methyl, triclopyr, triclopyr-butotyl,
triclopyr-triethylammonium, tridiphane, trietazine,
trifloxysulfuron, trifluralin, triflusulfuron-methyl, tritosulfuron
and vernolate is disclosed.
[0115] Other suitable herbicides and agricultural chemicals are
known in the art, such as, for example, those described in WO
2005/041654. Other herbicides also include bioherbicides such as
Alternaria destruens Simmons, Colletotrichum gloeosporiodes (Penz.)
Penz. & Sacc., Drechsiera monoceras (MTB-951), Myrothecium
verrucaria (Albertini & Schweinitz) Ditmar: Fries, Phytophthora
palmivora (Butyl.) Butyl. and Puccinia thlaspeos Schub.
Combinations of various herbicides can result in a
greater-than-additive (i.e., synergistic) effect on weeds and/or a
less-than-additive effect (i.e. safening) on crops or other
desirable plants. In certain instances, combinations of glyphosate
with other herbicides having a similar spectrum of control but a
different mode of action will be particularly advantageous for
preventing the development of resistant weeds. Herbicidally
effective amounts of any particular herbicide can be easily
determined by one skilled in the art through simple
experimentation.
[0116] Herbicides may be classified into groups and/or subgroups as
described herein above with reference to their mode of action, or
they may be classified into groups and/or subgroups in accordance
with their chemical structure.
[0117] Sulfonamide herbicides have as an essential molecular
structure feature a sulfonamide moiety (--S(O).sub.2NH--). As
referred to herein, sulfonamide herbicides particularly comprise
sulfonylurea herbicides, sulfonylaminocarbonyltriazolinone
herbicides and triazolopyrimidine herbicides. In sulfonylurea
herbicides the sulfonamide moiety is a component in a sulfonylurea
bridge (--S(O).sub.2NHC(O)NH(R)--). In sulfonylurea herbicides the
sulfonyl end of the sulfonylurea bridge is connected either
directly or by way of an oxygen atom or an optionally substituted
amino or methylene group to a typically substituted cyclic or
acyclic group. At the opposite end of the sulfonylurea bridge, the
amino group, which may have a substituent such as methyl (R being
CH.sub.3) instead of hydrogen, is connected to a heterocyclic
group, typically a symmetric pyrimidine or triazine ring, having
one or two substituents such as methyl, ethyl, trifluoromethyl,
methoxy, ethoxy, methylamino, dimethylamino, ethylamino and the
halogens. In sulfonylaminocarbonyltriazolinone herbicides, the
sulfonamide moiety is a component of a sulfonylaminocarbonyl bridge
(--S(O).sub.2NHC(O)--). In sulfonylaminocarbonyltriazolinone
herbicides the sulfonyl end of the sulfonylaminocarbonyl bridge is
typically connected to substituted phenyl ring. At the opposite end
of the sulfonylaminocarbonyl bridge, the carbonyl is connected to
the 1-position of a triazolinone ring, which is typically
substituted with groups such as alkyl and alkoxy. In
triazolopyrimidine herbicides the sulfonyl end of the sulfonamide
moiety is connected to the 2-position of a substituted
[1,2,4]triazolopyrimidine ring system and the amino end of the
sulfonamide moiety is connected to a substituted aryl, typically
phenyl, group or alternatively the amino end of the sulfonamide
moiety is connected to the 2-position of a
substituted[1,2,4]triazolopyrimidine ring system and the sulfonyl
end of the sulfonamide moiety is connected to a substituted aryl,
typically pyridinyl, group.
[0118] Representative of the sulfonylurea herbicides useful in the
embodiments are those of the formula:
##STR00001##
wherein: [0119] J is selected from the group consisting of
[0119] ##STR00002## ##STR00003## [0120] J is
R.sup.13SO.sub.2N(CH.sub.3)--; [0121] R is H or CH.sub.3; [0122]
R.sup.1 is F, Cl, Br, NO.sub.2, C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 haloalkyl, C.sub.3-C.sub.4 cycloalkyl,
C.sub.2-C.sub.4 haloalkenyl, alkoxy, C.sub.1-C.sub.4 haloalkoxy,
C.sub.2-C.sub.4 alkoxyalkoxy, CO.sub.2R.sup.14,
C(O)NR.sup.15R.sup.16, SO.sub.2NR.sup.17R.sup.18,
S(O).sub.nR.sup.19, C(O)R.sup.20, CH.sub.2CN or L; [0123] R.sup.2
is H, F, Cl, Br, I, CN, CH.sub.3, OCH.sub.3, SCH.sub.3, CF.sub.3 or
OCF.sub.2H; [0124] R.sup.3 is C.sub.1, NO.sub.2, CO.sub.2CH.sub.3,
CO.sub.2CH.sub.2CH.sub.3, C(O)CH.sub.3, C(O)CH.sub.2CH.sub.3,
C(O)-cyclopropyl, SO.sub.2N(CH.sub.3).sub.2, SO.sub.2CH.sub.3,
SO.sub.2CH.sub.2CH.sub.3, OCH.sub.3 or OCH.sub.2CH.sub.3; [0125]
R.sup.4 is C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2 haloalkyl,
C.sub.1-C.sub.2 alkoxy, C.sub.2-C.sub.4 haloalkenyl, F, Cl, Br,
NO.sub.2, CO.sub.2R.sup.14, C(O)NR.sup.15R.sup.16,
SO.sub.2NR.sup.17R.sup.18, S(O).sub.nR.sup.19, C(O)R.sup.20 or L;
[0126] R.sup.5 is H, F, Cl, Br or CH.sub.3; [0127] R.sup.6 is
C.sub.1-C.sub.3 alkyl optionally substituted with 0-3 F, 0-1 Cl and
0-1 C.sub.3-C.sub.4 alkoxyacetyloxy, or R.sup.6 is C.sub.1-C.sub.2
alkoxy, C.sub.2-C.sub.4 haloalkenyl, F, Cl, Br, CO.sub.2R.sup.14,
C(O)NR.sup.15R.sup.16, SO.sub.2NR.sup.17R.sup.18,
S(O).sub.nR.sup.19, C(O)R.sup.20 or L; [0128] R.sup.7 is H, F, Cl,
CH.sub.3 or CF.sub.3; [0129] R.sup.8 is H, C.sub.1-C.sub.3 alkyl or
pyridinyl; [0130] R.sup.9 is C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2
alkoxy, F, Cl, Br, NO.sub.2, CO.sub.2R.sup.14,
SO.sub.2NR.sup.17R.sup.18, S(O).sub.nR.sup.19, OCF.sub.2H,
C(O)R.sup.20, C.sub.2-C.sub.4 haloalkenyl or L; [0131] R.sup.10 is
H, Cl, F, Br, C.sub.1-C.sub.3 alkyl or C.sub.1-C.sub.2 alkoxy;
[0132] R.sup.11 is H, C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2
alkoxy, C.sub.2-C.sub.4 haloalkenyl, F, Cl, Br, CO.sub.2R.sup.14,
C(O)NR.sup.15R.sup.16, SO.sub.2NR.sup.17R.sup.18,
S(O).sub.nR.sup.19, C(O)R.sup.20 or L; [0133] R.sup.12 is halogen,
C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.3 alkylsulfonyl; [0134]
R.sup.13 is C.sub.1-C.sub.4 alkyl; [0135] R.sup.14 is allyl,
propargyl or oxetan-3-yl; or R.sup.14 is C.sub.1-C.sub.3 alkyl
optionally substituted by at least one member independently
selected from halogen, C.sub.1-C.sub.2 alkoxy and CN; [0136]
R.sup.15 is H, C.sub.1-C.sub.3 alkyl or C.sub.1-C.sub.2 alkoxy;
[0137] R.sup.16 is C.sub.1-C.sub.2 alkyl; [0138] R.sup.17 is H,
C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2 alkoxy, allyl or
cyclopropyl; [0139] R.sup.18 is H or C.sub.1-C.sub.3 alkyl; [0140]
R.sup.19 is C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.3 haloalkyl, allyl
or propargyl; [0141] R.sup.20 is C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 haloalkyl or C.sub.3-C.sub.5 cycloalkyl optionally
substituted by halogen; [0142] n is 0, 1 or 2; [0143] L is
[0143] ##STR00004## [0144] L.sup.1 is CH.sub.2, NH or O; [0145]
R.sup.21 is H or C.sub.1-C.sub.3 alkyl; [0146] X is H,
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4
haloalkoxy, C.sub.1-C.sub.4 haloalkyl, C.sub.1-C.sub.4
haloalkylthio, C.sub.1-C.sub.4 alkylthio, halogen, C.sub.2-C.sub.5
alkoxyalkyl, C.sub.2-C.sub.5 alkoxyalkoxy, amino, C.sub.1-C.sub.3
alkylamino or di(C.sub.1-C.sub.3 alkyl)amino; [0147] Y is H,
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4
haloalkoxy, C.sub.1-C.sub.4 alkylthio, C.sub.1-C.sub.4
haloalkylthio, C.sub.2-C.sub.5 alkoxyalkyl, C.sub.2-C.sub.5
alkoxyalkoxy, amino, C.sub.1-C.sub.3 alkylamino, di(C.sub.1-C.sub.3
alkyl)amino, C.sub.3-C.sub.4 alkenyloxy, C.sub.3-C.sub.4
alkynyloxy, C.sub.2-C.sub.5 alkylthioalkyl, C.sub.2-C.sub.5
alkylsulfinylalkyl, C.sub.2-C.sub.5 alkylsulfonylalkyl,
C.sub.1-C.sub.4 haloalkyl, C.sub.2-C.sub.4 alkynyl, C.sub.3-C.sub.5
cycloalkyl, azido or cyano; and [0148] Z is CH or N;
[0149] provided that (i) when one or both of X and Y is C.sub.1
haloalkoxy, then Z is CH; and (ii) when X is halogen, then Z is CH
and Y is OCH.sub.3, OCH.sub.2CH.sub.3, N(OCH.sub.3)CH.sub.3,
NHCH.sub.3, N(CH.sub.3).sub.2 or OCF.sub.2H. Of note is the present
single liquid herbicide composition comprising one or more
sulfonylureas of Formula I wherein when R.sup.6 is alkyl, said
alkyl is unsubstituted.
[0150] Representative of the triazolopyrimidine herbicides
contemplated for use in the embodiments are those of the
formula:
##STR00005##
wherein: [0151] R.sup.22 and R.sup.23 each independently halogen,
nitro, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 haloalkyl,
C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 haloalkoxy or
C.sub.2-C.sub.3 alkoxycarbonyl; [0152] R.sup.24 is H, halogen,
C.sub.1-C.sub.2 alkyl or C.sub.1-C.sub.2 alkoxy; [0153] W is
--NHS(O).sub.2-- or --S(O).sub.2NH--; [0154] Y.sup.1 is H,
C.sub.1-C.sub.2 alkyl or C.sub.1-C.sub.2 alkoxy; [0155] Y.sup.2 is
H, F, Cl, Br, C.sub.1-C.sub.2 alkyl or C.sub.1-C.sub.2 alkoxy;
[0156] Y.sup.3 is H, F or methoxy; [0157] Z.sup.1 is CH or N; and
[0158] Z.sup.2 is CH or N; provided that at least one of Y.sup.1
and Y.sup.2 is other than H.
[0159] In the above Markush description of representative
triazolopyrimidine herbicides, when W is --NHS(O).sub.2-- the
sulfonyl end of the sulfonamide moiety is connected to the
[1,2,4]triazolopyrimidine ring system, and when W is
--S(O).sub.2NH-- the amino end of the sulfonamide moiety is
connected to the [1,2,4]triazolopyrimidine ring system.
[0160] In the above recitations, the term "alkyl", used either
alone or in compound words such as "alkylthio" or "haloalkyl"
includes straight-chain or branched alkyl, such as, methyl, ethyl,
n-propyl, i-propyl, or the different butyl isomers. "Cycloalkyl"
includes, for example, cyclopropyl, cyclobutyl and cyclopentyl.
"Alkenyl" includes straight-chain or branched alkenes such as
ethenyl, 1-propenyl, 2-propenyl, and the different butenyl isomers.
"Alkenyl" also includes polyenes such as 1,2-propadienyl and
2,4-butadienyl. "Alkynyl" includes straight-chain or branched
alkynes such as ethynyl, 1-propynyl, 2-propynyl and the different
butynyl isomers. "Alkynyl" can also include moieties comprised of
multiple triple bonds such as 2,5-hexadiynyl. "Alkoxy" includes,
for example, methoxy, ethoxy, n-propyloxy, isopropyloxy and the
different butoxy isomers. "Alkoxyalkyl" denotes alkoxy substitution
on alkyl. Examples of "alkoxyalkyl" include CH.sub.3OCH.sub.2,
CH.sub.3OCH.sub.2CH.sub.2, CH.sub.3CH.sub.2OCH.sub.2,
CH.sub.3CH.sub.2CH.sub.2CH.sub.2OCH.sub.2 and
CH.sub.3CH.sub.2OCH.sub.2CH.sub.2. "Alkoxyalkoxy" denotes alkoxy
substitution on alkoxy. "Alkenyloxy" includes straight-chain or
branched alkenyloxy moieties. Examples of "alkenyloxy" include
H.sub.2C.dbd.CHCH.sub.2O, (CH.sub.3)CH.dbd.CHCH.sub.2O and
CH.sub.2.dbd.CHCH.sub.2CH.sub.2O. "Alkynyloxy" includes
straight-chain or branched alkynyloxy moieties. Examples of
"alkynyloxy" include HC.ident.CCH.sub.2O and
CH.sub.3CH.sub.3C.ident.CCH.sub.2O. "Alkylthio" includes branched
or straight-chain alkylthio moieties such as methylthio, ethylthio,
and the different propylthio isomers. "Alkylthioalkyl" denotes
alkylthio substitution on alkyl. Examples of "alkylthioalkyl"
include CH.sub.3SCH.sub.2, CH.sub.3SCH.sub.2CH.sub.2,
CH.sub.3CH.sub.2SCH.sub.2,
CH.sub.3CH.sub.2CH.sub.2CH.sub.2SCH.sub.2 and
CH.sub.3CH.sub.2SCH.sub.2CH.sub.2; "alkylsulfinylalkyl" and
"alkylsulfonylalkyl" include the corresponding sulfoxides and
sulfones, respectively. Other substituents such as "alkylamino",
"dialkylamino" are defined analogously.
[0161] The total number of carbon atoms in a substituent group is
indicated by the "C.sub.i-C.sub.j" prefix where i and j are numbers
from 1 to 5. For example, C.sub.1-C.sub.4 alkyl designates methyl
through butyl, including the various isomers. As further examples,
C.sub.2 alkoxyalkyl designates CH.sub.3OCH.sub.2; C.sub.3
alkoxyalkyl designates, for example, CH.sub.3CH(OCH.sub.3),
CH.sub.3OCH.sub.2CH.sub.2 or CH.sub.3CH.sub.2OCH.sub.2; and C.sub.4
alkoxyalkyl designates the various isomers of an alkyl group
substituted with an alkoxy group containing a total of four carbon
atoms, examples including CH.sub.3CH.sub.2CH.sub.2OCH.sub.2 and
CH.sub.3CH.sub.2OCH.sub.2CH.sub.2.
[0162] The term "halogen", either alone or in compound words such
as "haloalkyl", includes fluorine, chlorine, bromine or iodine.
Further, when used in compound words such as "haloalkyl", said
alkyl may be partially or fully substituted with halogen atoms
which may be the same or different. Examples of "haloalkyl" include
F.sub.3C, ClCH.sub.2, CF.sub.3CH.sub.2 and CF.sub.3CCl.sub.2. The
terms "haloalkoxy", "haloalkylthio", and the like, are defined
analogously to the term "haloalkyl". Examples of "haloalkoxy"
include CF.sub.3O, CCl.sub.3CH.sub.2O, HCF.sub.2CH.sub.2CH.sub.2O
and CF.sub.3CH.sub.2O. Examples of "haloalkylthio" include
CCl.sub.3S, CF.sub.3S, CCl.sub.3CH.sub.2S and
ClCH.sub.2CH.sub.2CH.sub.2S.
[0163] The following sulfonylurea herbicides illustrate the
sulfonylureas useful for this invention: amidosulfuron
(N-[[[[(4,6-dimethoxy-2-pyrirndinyl)amino]carbonyl]amino]-sulfonyl]-N-met-
hylmethanesulfonamide), azimsulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-1-methyl-4-(2-methyl-2H-
-tetrazol-5-yl)-1H-pyrazole-5-sulfonamide),
bensulfuron-methyl(methyl
2-[[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]-sulfonyl]methyl-
]benzoate), chlorimuron-ethyl(ethyl
2-[[[[(4-chloro-6-methoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]ben-
zoate), chlorsulfuron
(2-chloro-N-[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]benze-
nesulfonamide), cinosulfuron
(N-[[(4,6-dimethoxy-1,3,5-triazin-2-yl)amino]carbonyl]-2-(2-methoxyethoxy-
)benzenesulfonamide), cyclosulfamuron
(N-[[[2-(cyclopropylcarbonyl)phenyl]amino]-sulfonyl]-N.sup.1-(4,6-dimetho-
xypyrimidin-2-yl)urea), ethametsulfuron-methyl (methyl
2-[[[[[4-ethoxy-6-(methylamino)-1,3,5-triazin-2-yl]amino]carbonyl]amino]s-
ulfonyl]-benzoate), ethoxysulfuron
(2-ethoxyphenyl[[(4,6-dimethoxy-2-pyrimidinyl)amino]-carbonyl]sulfamate),
flazasulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-3-(trifluoromethyl)-2-p-
yridinesulfonamide), flucetosulfuron
(1-[3-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-2-p-
yridinyl]-2-fluoropropyl methoxyacetate), flupyrsulfuron-methyl
(methyl
2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-amino]sulfonyl]-6-(tri-
fluoromethyl)-3-pyridinecarboxylate), foramsulfuron
(2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-4-(for-
mylamino)-N,N-dimethylbenzamide), halosulfuron-methyl (methyl
3-chloro-5-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl-
]-1-methyl-1H-pyrazole-4-carboxylate), imazosulfuron
(2-chloro-N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]imidazo[1,2-a]p-
yridine-3-sulfonamide), iodosulfuron-methyl (methyl
4-iodo-2-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]-
sulfonyl]benzoate), mesosulfuron-methyl (methyl
2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-4-[[(me-
thylsulfonyl)amino]methyl]benzoate), metsulfuron-methyl (methyl
2-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]sulfony-
l]benzoate), nicosulfuron
(2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-N,N-di-
methyl-3-pyridinecarboxamide), oxasulfuron (3-oxetanyl
2-[[[[(4,6-dimethyl-2-pyrimidinyl)amino]-carbonyl]amino]sulfonyl]benzoate-
), primisulfuron-methyl (methyl
2-[[[[[4,6-bis(trifluoromethoxy)-2-pyrimidinyl]amino]carbonyl]amino]sulfo-
nyl]benzoate), prosulfuron
(N-[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]-2-(3,3,3-trif-
luoropropyl)benzenesulfonamide), pyrazosulfuron-ethyl (ethyl
5-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-1-methy-
l-1H-pyrazole-4-carboxylate), rimsulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-3-(ethylsulfonyl)-2-pyr-
idinesulfonamide), sulfometuron-methyl (methyl
2-[[[[(4,6-dimethyl-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]benzoate)-
, sulfosulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-2-(ethylsulfonyl)imidaz-
o[1,2-a]pyridine-3-sulfonamide), thifensulfuron-methyl (methyl
3-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]-carbonyl]amino]sulfon-
yl]-2-thiophenecarboxylate), triasulfuron
(2-(2-chloroethoxy)N-[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbo-
nyl]benzenesulfonamide), tribenuron-methyl (methyl
2-[[[[N-(4-methoxy-6-methyl-1,3,5-triazin-2-yl)N-methylamino]carbonyl]ami-
no]sulfonyl]benzoate), trifloxysulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-3-(2,2,2-trifluoroethox-
y)-2-pyridinesulfonamide), triflusulfuron-methyl (methyl
2-[[[[[4-dimethylamino)-6-(2,2,2-trifluoroethoxy)-1,3,5-triazin-2-yl]amin-
o]carbonyl]amino]sulfonyl]-3-methylbenzoate) and tritosulfuron
(N-[[[4-methoxy-6-(trifluoromethyl)-1,3,5-triazin-2-yl]amino]carbonyl]-2--
(trifluoromethyl)benzenesulfonamide).
[0164] The following triazolopyrimidine herbicides illustrate the
triazolopyrimidines useful for this invention: cloransulam-methyl
(methyl
3-chloro-2-[[(5-ethoxy-7-fluoro[1,2,4]-triazolo[1,5-c]pyrimidin-2-yl)sulf-
onyl]amino]benzoate, diclosulam
(N-(2,6-dichlorophenyl)-5-ethoxy-7-fluoro[1,2,4]triazolo[1,5-c]pyrimidine-
-2-sulfonamide, florasulam
(N-(2,6-difluorophenyl)-8-fluoro-5-methoxy[1,2,4]triazolo[1,5-c]pyrimidin-
e-2-sulfonamide), flumetsulam
(N-(2,6-difluorophenyl)-5-methyl[1,2,4]triazolo[1,5-c]pyrimidine-2-sulfon-
amide), metosulam
(N-(2,6-dichloro-3-methylphenyl)-5,7-dimethoxy[1,2,4]triazolo-[1,5-a]pyri-
midine-2-sulfonamide), penoxsulam
(2-(2,2-difluoroethoxy)-N-(5,8-dimethoxy-[1,2,4]triazolo[1,5-c]pyrimidin--
2-yl)-6-(trifluoromethyl)benzenesulfonamide) and pyroxsulam
(N-(5,7-dimethoxy[1,2,4]triazolo[1,5-a]pyrimidin-2-yl)-2-methoxy-4-(trifl-
uoromethyl)-3-pyridinesulfonamide).
[0165] The following sulfonylaminocarbonyltriazolinone herbicides
illustrate the sulfonylaminocarbonyltriazolinones useful for this
invention: flucarbazone
(4,5-dihydro-3-methoxy-4-methyl-5-oxo-N-[[2-(trifluoromethoxy)phenyl]sulf-
onyl]-1H-1,2,4-triazole-1-carboxamide) and procarbazone (methyl
2-[[[(4,5-dihydro-4-methyl-5-oxo-3-propoxy-1H-1,2,4-triazol-1-yl)carbonyl-
]amino]sulfonyl]benzoate).
[0166] Additional herbicides include phenmedipham, triazolinones,
and the herbicides disclosed in WO2006/012981, herein incorporated
by reference in its entirety.
[0167] The methods further comprise applying to the crop and the
weeds in a field a sufficient amount of at least one herbicide to
which the crop seeds or plants is tolerant, such as, for example,
glyphosate, a hydroxyphenylpyruvatedioxygenase inhibitor (e.g.,
mesotrione or sulcotrione), a phytoene desaturase inhibitor (e.g.,
diflufenican), a pigment synthesis inhibitor, sulfonamide,
imidazolinone, bialaphos, phosphinothricin, azafenidin,
butafenacil, sulfosate, glufosinate, triazolopyrimidine,
pyrimidinyloxy(thio)benzoate, or sulonylaminocarbonyltriazolinone,
an acetyl Co-A carboxylase inhibitor such as quizalofop-P-ethyl, a
synthetic auxin such as quinclorac, or a protox inhibitor to
control the weeds without significantly damaging the crop
plants.
[0168] Generally, the effective amount of herbicide applied to the
field is sufficient to selectively control the weeds without
significantly affecting the crop. "Weed" as used herein refers to a
plant which is not desirable in a particular area. Conversely, a
"crop plant" as used herein refers to a plant which is desired in a
particular area, such as, for example, a soybean plant. Thus, in
some embodiments, a weed is a non-crop plant or a non-crop species,
while in some embodiments, a weed is a crop species which is sought
to be eliminated from a particular area, such as, for example, an
inferior and/or non-transgenic soybean plant in a field planted
with soybean event 3560.4.3.5, or a soybean plant in a field
planted with 3560.4.3.5. Weeds can be either classified into two
major groups: monocots and dicots.
[0169] Many plant species can be controlled (i.e., killed or
damaged) by the herbicides described herein. Accordingly, the
methods are useful in controlling these plant species where they
are undesirable (i.e., where they are weeds). These plant species
include crop plants as well as species commonly considered weeds,
including but not limited to species such as: blackgrass
(Alopecurus myosuroides), giant foxtail (Setaria faberi), large
crabgrass (Digitaria sanguinalis), Surinam grass (Brachiaria
decumbens), wild oat (Avena fatua), common cocklebur (Xanthium
pensylvanicum), common lambsquarters (Chenopodium album), morning
glory (Ipomoea coccinea), pigweed (Amaranthus spp.), velvetleaf
(Abutilion theophrasti), common barnyardgrass (Echinochloa
crus-galli), bermudagrass (Cynodon dactylon), downy brome (Bromus
tectorum), goosegrass (Eleusine indica), green foxtail (Setaria
viridis), Italian ryegrass (Lolium multiflorum), Johnsongrass
(Sorghum halepense), lesser canarygrass (Phalaris minor), windgrass
(Apera spica-venti), wooly cupgrass (Erichloa villosa), yellow
nutsedge (Cyperus esculentus), common chickweed (Stellaria media),
common ragweed (Ambrosia artemisiifolia), Kochia scoparia,
horseweed (Conyza canadensis), rigid ryegrass (Lolium rigidum),
goosegrass (Eleucine indica), hairy fleabane (Conyza bonariensis),
buckhorn plantain (Plantago lanceolata), tropical spiderwort
(Commelina benghalensis), field bindweed (Convolvulus arvensis),
purple nutsedge (Cyperus rotundus), redvine (Brunnichia ovata),
hemp sesbania (Sesbania exaltata), sicklepod (Senna obtusifolia),
Texas blueweed (Helianthus ciliaris), and Devil's claws
(Proboscidea louisianica). In other embodiments, the weed comprises
a herbicide-resistant ryegrass, for example, a glyphosate resistant
ryegrass, a paraquat resistant ryegrass, a ACCase-inhibitor
resistant ryegrass, and a non-selective herbicide resistant
ryegrass. In some embodiments, the undesired plants are proximate
the crop plants.
[0170] As used herein, by "selectively controlled" it is intended
that the majority of weeds in an area of cultivation are
significantly damaged or killed, while if crop plants are also
present in the field, the majority of the crop plants are not
significantly damaged. Thus, a method is considered to selectively
control weeds when at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, or more of the weeds are significantly damaged or killed,
while if crop plants are also present in the field, less than 45%,
40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 1% of the crop plants are
significantly damaged or killed.
[0171] In some embodiments, a soybean 3560.4.3.5 plant is not
significantly damaged by treatment with a particular herbicide
applied to that plant at a dose equivalent to a rate of at least
0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30,
35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120,
150, 170, 200, 300, 400, 500, 600, 700, 800, 800, 1000, 2000, 3000,
4000, 5000 or more grams or ounces (1 ounce=29.57 ml) of active
ingredient or commercial product or herbicide formulation per acre
or per hectare, whereas an appropriate control plant is
significantly damaged by the same treatment.
[0172] In specific embodiments, an effective amount of an ALS
inhibitor herbicide comprises at least about 0.1, 1, 5, 10, 25, 50,
75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 750,
800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, or more grams or
ounces (1 ounce=29.57 ml) of active ingredient per hectare. In
other embodiments, an effective amount of an ALS inhibitor
comprises at least about 0.1-50, about 25-75, about 50-100, about
100-110, about 110-120, about 120-130, about 130-140, about
140-150, about 150-200, about 200-500, about 500-600, about
600-800, about 800-1000, or greater grams or ounces (1 ounce=29.57
ml) of active ingredient per hectare. Any ALS inhibitor, for
example, those listed in Table 1 can be applied at these
levels.
[0173] In other embodiments, an effective amount of a sulfonylurea
comprises at least 0.1, 1, 5, 10, 25, 50, 75, 100, 150, 200, 250,
300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 5000 or more
grams or ounces (1 ounce=29.57 ml) of active ingredient per
hectare. In other embodiments, an effective amount of a
sulfonylurea comprises at least about 0.1-50, about 25-75, about
50-100, about 100-110, about 110-120, about 120-130, about 130-140,
about 140-150, about 150-160, about 160-170, about 170-180, about
190-200, about 200-250, about 250-300, about 300-350, about
350-400, about 400-450, about 450-500, about 500-550, about
550-600, about 600-650, about 650-700, about 700-800, about
800-900, about 900-1000, about 1000-2000, or more grams or ounces
(1 ounce=29.57 ml) of active ingredient per hectare. Representative
sulfonylureas that can be applied at this level are set forth in
Table 1.
[0174] In other embodiments, an effective amount of a
sulfonylaminocarbonyltriazolinones, triazolopyrimidines,
pyrimidinyloxy(thio)benzoates, and imidazolinones can comprise at
least about 0.1, 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, 300,
350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950,
1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1550,
1600, 1650, 1700, 1800, 1850, 1900, 1950, 2000, 2500, 3500, 4000,
4500, 5000 or greater grams or ounces (1 ounce=29.57 ml) active
ingredient per hectare. In other embodiments, an effective amount
of a sulfonyluminocarbonyltriazolines, triazolopyrimidines,
pyrimidinyloxy(thio)benzoates, or imidazolinones comprises at least
about 0.1-50, about 25-75, about 50-100, about 100-110, about
110-120, about 120-130, about 130-140, about 140-150, about
150-160, about 160-170, about 170-180, about 190-200, about
200-250, about 250-300, about 300-350, about 350-400, about
400-450, about 450-500, about 500-550, about 550-600, about
600-650, about 650-700, about 700-800, about 800-900, about
900-1000, about 1000-2000, or more grams or ounces (1 ounce=29.57
ml) active ingredient per hectare.
[0175] Additional ranges of the effective amounts of herbicides can
be found, for example, in various publications from University
Extension services. See, for example, Bernards et al. (2006) Guide
for Weed Management in Nebraska
(www.ianrpubs.url.edu/sendlt/ec130); Regher et al. (2005) Chemical
Weed Control for Fields Crops, Pastures, Rangeland, and
Noncropland, Kansas State University Agricultural Extension Station
and Corporate Extension Service; Zollinger et al. (2006) North
Dakota Weed Control Guide, North Dakota Extension Service, and the
Iowa State University Extension at www.weeds.iastate.edu, each of
which is herein incorporated by reference.
[0176] In some embodiments, glyphosate is applied to an area of
cultivation and/or to at least one plant in an area of cultivation
at rates between 8 and 32 ounces of acid equivalent per acre, or at
rates between 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30 ounces
of acid equivalent per acre at the lower end of the range of
application and between 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and
32 ounces of acid equivalent per acre at the higher end of the
range of application (1 ounce=29.57 ml). In other embodiments,
glyphosate is applied at least at 1, 5, 10, 20, 30, 40, 50, 60, 70,
80, 90 or greater ounce of active ingredient per hectare (1
ounce=29.57 ml). In some embodiments, a sulfonylurea herbicide is
applied to a field and/or to at least one plant in a field at rates
between 0.04 and 1.0 ounces of active ingredient per acre, or at
rates between 0.1, 0.2, 0.4, 0.6, and 0.8 ounces of active
ingredient per acre at the lower end of the range of application
and between 0.2, 0.4, 0.6, 0.8, and 1.0 ounces of active ingredient
per acre at the higher end of the range of application. (1 ounce
29.57 ml)
[0177] Glyphosate herbicides as a class contain the same active
ingredient, but the active ingredient is present as one of a number
of different salts and/or formulations. However, herbicides known
to inhibit ALS vary in their active ingredient as well as their
chemical formulations. One of skill in the art is familiar with the
determination of the amount of active ingredient and/or acid
equivalent present in a particular volume and/or weight of
herbicide preparation.
[0178] In some embodiments, an ALS inhibitor herbicide is employed.
Rates at which the ALS inhibitor herbicide is applied to the crop,
crop part, seed or area of cultivation can be any of the rates
disclosed herein. In specific embodiments, the rate for the ALS
inhibitor herbicide is about 0.1 to about 5000 g ai/hectare, about
0.5 to about 300 g ai/hectare, or about 1 to about 150 g
ai/hectare.
[0179] Generally, a particular herbicide is applied to a particular
field (and any plants growing in it) no more than 1, 2, 3, 4, 5, 6,
7, or 8 times a year, or no more than 1, 2, 3, 4, or times per
growing season.
[0180] By "treated with a combination of" or "applying a
combination of" herbicides to a crop, area of cultivation or field"
it is intended that a particular field, crop or weed is treated
with each of the herbicides and/or chemicals indicated to be part
of the combination so that a desired effect is achieved, i.e., so
that weeds are selectively controlled while the crop is not
significantly damaged. In some embodiments, weeds which are
susceptible to each of the herbicides exhibit damage from treatment
with each of the herbicides which is additive or synergistic. The
application of each herbicide and/or chemical may be simultaneous
or the applications may be at different times, so long as the
desired effect is achieved. Furthermore, the application can occur
prior to the planting of the crop.
[0181] The proportions of herbicides used with other herbicidal
active ingredients in herbicidal compositions are generally in the
ratio of 5000:1 to 1:5000, 1000:1 to 1:1000, 100:1 to 1:100, 10:1
to 1:10 or 5:1 to 1:5 by weight. The optimum ratios can be easily
determined by those skilled in the art based on the weed control
spectrum desired. Moreover, any combinations of ranges of the
various herbicides disclosed in Table 1 can also be applied in the
methods.
[0182] Thus, in some embodiments, improved methods for selectively
controlling weeds in a field are provided wherein the total
herbicide application may be less than 90%, 85%, 80%, 75%, 70%,
65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or
1% of that used in other methods. Similarly, in some embodiments,
the amount of a particular herbicide used for selectively
controlling weeds in a field may be less than 90%, 85%, 80%, 75%,
70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%,
5%, or 1% of the amount of that particular herbicide that would be
used in other methods, L e., methods not utilizing a plant of the
invention.
[0183] In some embodiments, a 3560.4.3.5 soybean plant benefits
from a synergistic effect wherein the herbicide tolerance conferred
by the GLYAT polypeptide and the GM-HRA polypeptide is greater than
expected from simply combining the herbicide tolerance conferred by
each gene separately to a transgenic plant containing them
individually. See, e.g., McCutchen et al. (1997) J. Econ. Entomol.
90: 1170-1180; Priesler et al. (1999) J. Econ. Entomol. 92:
598-603. As used herein, the terms "synergy," "synergistic,"
"synergistically" and derivations thereof, such as in a
"synergistic effect" or a "synergistic herbicide combination" or a
"synergistic herbicide composition" refer to circumstances under
which the biological activity of a combination of herbicides, such
as at least a first herbicide and a second herbicide, is greater
than the sum of the biological activities of the individual
herbicides. Synergy, expressed in terms of a "Synergy Index (SI),"
generally can be determined by the method described by Kull et al.
Applied Microbiology 9, 538 (1961). See also Colby "Calculating
Synergistic and Antagonistic Responses of Herbicide Combinations,"
Weeds 15, 20-22 (1967).
[0184] In other instances, the herbicide tolerance conferred on a
3560.4.3.5 plant is additive; that is, the herbicide tolerance
profile conferred by the herbicide tolerance genes is what would be
expected from simply combining the herbicide tolerance conferred by
each gene separately to a transgenic plant containing them
individually. Additive and/or synergistic activity for two or more
herbicides against key weed species will increase the overall
effectiveness and/or reduce the actual amount of active
ingredient(s) needed to control said weeds. Where such synergy is
observed, the plant may display tolerance to a higher dose or rate
of herbicide and/or the plant may display tolerance to additional
herbicides or other chemicals beyond those to which it would be
expected to display tolerance. For example, a 3560.4.3.5 soybean
plant may show tolerance to organophosphate compounds such as
insecticides and/or inhibitors of 4-hydroxyphenylpyruvate
dioxygenase.
[0185] Thus, for example, the 3560.4.3.5 soybean plants can exhibit
greater than expected tolerance to various herbicides, including
but not limited to glyphosate, ALS inhibitor chemistries, and
sulfonylurea herbicides. The 3560.4.3.5 soybean plants may show
tolerance to a particular herbicide or herbicide combination that
is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%,
20%, 22%, 25%, 27%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
80%, 90%, 100%, 125%, 150%, 175%, 200%, 300%, 400%, or 500% or more
higher than the tolerance of an appropriate control plant that
contains only a single herbicide tolerance gene which confers
tolerance to the same herbicide or herbicide combination. Thus,
3560.4.3.5 soybean plants may show decreased damage from the same
dose of herbicide in comparison to an appropriate control plant, or
they may show the same degree of damage in response to a much
higher dose of herbicide than the control plant. Accordingly, in
specific embodiments, a particular herbicide used for selectively
containing weeds in a field is more than 1%, 5%, 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100% or greater
than the amount of that particular herbicide that would be used in
other methods, i.e., methods not utilizing a plant of the
invention.
[0186] In the same manner, in some embodiments, a 3560.4.3.5
soybean plant shows improved tolerance to a particular formulation
of a herbicide active ingredient in comparison to an appropriate
control plant. Herbicides are sold commercially as formulations
which typically include other ingredients in addition to the
herbicide active ingredient; these ingredients are often intended
to enhance the efficacy of the active ingredient. Such other
ingredients can include, for example, safeners and adjuvants (see,
e.g., Green and Foy (2003) "Adjuvants: Tools for Enhancing
Herbicide Performance," in Weed Biology and Management, ed.
Inderjit (Kluwer Academic Publishers, The Netherlands)). Thus, a
3560.4.3.5 soybean plant can show tolerance to a particular
formulation of a herbicide (e.g., a particular commercially
available herbicide product) that is at least 1%, 2%, 3%, 4%, 5%,
6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%, 20%, 22%, 25%, 27%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100%, 125%, 150%,
175%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1100%,
1200%, 1300%, 1400%, 1500%, 1600%, 1700%, 1800%, 1900%, or 2000% or
more higher than the tolerance of an appropriate control plant that
contains only a single herbicide tolerance gene which confers
tolerance to the same herbicide formulation.
[0187] In some embodiments, a 3560.4.3.5 soybean plant shows
improved tolerance to a herbicide or herbicide class to which at
least one other herbicide tolerance gene confers tolerance as well
as improved tolerance to at least one other herbicide or chemical
which has a different mechanism or basis of action than either
glyphosate or the herbicide corresponding to said at least one
other herbicide tolerance gene. This surprising benefit finds use
in methods of growing crops that comprise treatment with various
combinations of chemicals, including, for example, other chemicals
used for growing crops. Thus, for example, a 3560.4.3.5 soybean
plant may also show improved tolerance to chlorpyrifos, a systemic
organophosphate insecticide. Thus, further provided is a 3560.4.3.5
soybean plant that confers tolerance to glyphosate (i.e., a glyat
gene) and a sulfonylurea herbicide tolerance gene which shows
improved tolerance to chemicals which affect the cytochrome P450
gene, and methods of use thereof. In some embodiments, the
3560.4.3.5 soybean plants also show improved tolerance to dicamba.
In these embodiments, the improved tolerance to dicamba may be
evident in the presence of glyphosate and a sulfonylurea
herbicide.
[0188] In other methods, a herbicide combination is applied over a
3560.4.3.5 soybean plant, where the herbicide combination produces
either an additive or a synergistic effect for controlling weeds.
Such combinations of herbicides can allow the application rate to
be reduced, a broader spectrum of undesired vegetation to be
controlled, improved control of the undesired vegetation with fewer
applications, more rapid onset of the herbicidal activity, or more
prolonged herbicidal activity.
[0189] An "additive herbicidal composition" has a herbicidal
activity that is about equal to the observed activities of the
individual components. A "synergistic herbicidal combination" has a
herbicidal activity higher than what can be expected based on the
observed activities of the individual components when used alone,
Accordingly, the presently disclosed subject matter provides a
synergistic herbicide combination, wherein the degree of weed
control of the mixture exceeds the sum of control of the individual
herbicides, In some embodiments, the degree of weed control of the
mixture exceeds the sum of control of the individual herbicides by
any statistically significant amount including, for example, about
1% to 5%, about 5% to about 10%, about 10% to about 20%, about 20%
to about 30%, about 30% to 40%, about 40% to about 50%, about 50%
to about 60%, about 60% to about 70%, about 70% to about 80%, about
80% to about 90%, about 90% to about 100%, about 100% to 120% or
greater. Further, a "synergistically effective amount" of a
herbicide refers to the amount of one herbicide necessary to elicit
a synergistic effect in another herbicide present in the herbicide
composition. Thus, the term "synergist," and derivations thereof,
refer to a substance that enhances the activity of an active
ingredient (ai), i.e., a substance in a formulation from which a
biological effect is obtained, for example, a herbicide.
[0190] Accordingly, in some embodiments, the presently disclosed
subject matter provides a method for controlling weeds in an area
of cultivation. In some embodiments, the method comprises: (a)
planting the area with a 3560.4.3.5 crop seeds or crop plants; and
(b) applying to the weed, the crop plants, a crop part, the area of
cultivation, or a combination thereof, an effective amount of a
herbicide composition comprising at least one of a synergistically
effective amount of glyphosate and a synergistically effective
amount of an ALS inhibitor (for example, but not limited to, a
sulfonylurea herbicide), or agriculturally suitable salts thereof,
wherein at least one of: (i) the synergistically effective amount
of the glyphosate is lower than an amount of glyphosate required to
control the weeds in the absence of the sulfonylurea herbicide;
(ii) the synergistically effective amount of the ALS inhibitor
herbicide is lower than an amount of the ALS inhibitor required to
control the weeds in the absence of glyphosate; and (iii)
combinations thereof; and wherein the effective amount of the
herbicide composition is tolerated by the crop seeds or crop plants
and controls the weeds in the area of cultivation.
[0191] In some embodiments, the herbicide composition used in the
presently disclosed method for controlling weeds comprises a
synergistically effective amount of glyphosate and a sulfonylurea
herbicide. In further embodiments, the presently disclosed
synergistic herbicide composition comprises glyphosate and a
sulfonylurea herbicide selected from the group consisting of
metsulfuron-methyl, chlorsulfuron, and triasulfuron.
[0192] In particular embodiments, the synergistic herbicide
combination further comprises an adjuvant such as, for example, an
ammonium sulfate-based adjuvant, e.g., ADD-UP.RTM. (Wenkem S. A.,
Halfway House, Midrand, South Africa). In additional embodiments,
the presently disclosed synergistic herbicide compositions comprise
an additional herbicide, for example, an effective amount of a
pyrimidinyloxy(thio)benzoate herbicide. In some embodiments, the
pyrimidinyloxy(thio)benzoate herbicide comprises bispyribac, e.g.,
(VELOCITY.RTM., Valent U.S.A. Corp., Walnut Creek, Calif., United
States of America), or an agriculturally suitable salt thereof.
[0193] In some embodiments of the presently disclosed method for
controlling undesired plants, the glyphosate is applied
pre-emergence, post-emergence or pre- and post-emergence to the
undesired plants or plant crops; and/or the ALS inhibitor herbicide
(i.e., the sulfonylurea herbicide) is applied pre-emergence,
post-emergence or pre- and post-emergence to the undesired plants
or plant crops. In other embodiments, the glyphosate and/or the ALS
inhibitor herbicide (i.e., the sulfonylurea herbicide) are applied
together or are applied separately. In yet other embodiments, the
synergistic herbicide composition is applied, e.g. step (b) above,
at least once prior to planting the crop(s) of interest, e.g., step
(a) above.
[0194] Weeds that can be difficult to control with glyphosate alone
in fields where a crop is grown (such as, for example, a soybean
crop) include but are not limited to the following: horseweed
(e.g., Conyza canadensis); rigid ryegrass (e.g., Lolium rigidum);
goosegrass (e.g., Eleusine indica); Italian ryegrass (e.g., Lolium
multiflorum); hairy fleabane (e.g., Conyza bonariensis); buckhorn
plantain (e.g., Plantago lanceolata); common ragweed (e.g.,
Ambrosia artemisifolia); morning glory (e.g., Ipomoea spp.);
waterhemp (e.g., Amaranthus spp.); field bindweed (e.g.,
Convolvulus arvensis); yellow nutsedge (e.g., Cyperus esculentus);
common lambsquarters (e.g., Chenopodium album); wild buckwheat
(e.g., Polygonium convolvulus); velvetleaf (e.g., Abutilon
theophrasti); kochia (e.g., Kochia scoparia); and Asiatic dayflower
(e.g., Commelina spp.). In areas where such weeds are found, the
3560.4.3.5 soybeans are particularly useful in allowing the
treatment of a field (and therefore any crop growing in the field)
with combinations of herbicides that would cause unacceptable
damage to crop plants that did not contain both of these
polynucleotides. Plants that are tolerant to glyphosate and other
herbicides such as, for example, sulfonylurea, imidazolinone,
triazolopyrimidine, pyrimidinyl(thio)benzoate, and/or
sulfonylaminocarbonyltriazolinone herbicides in addition to being
tolerant to at least one other herbicide with a different mode of
action or site of action are particularly useful in situations
where weeds are tolerant to at least two of the same herbicides to
which the plants are tolerant. In this manner, plants of the
invention make possible improved control of weeds that are tolerant
to more than one herbicide.
[0195] For example, some commonly used treatments for weed control
in fields where current commercial crops (including, for example,
soybeans) are grown include glyphosate and, optionally, 2,4-D; this
combination, however, has some disadvantages. Particularly, there
are weed species that it does not control well and it also does not
work well for weed control in cold weather. Another commonly used
treatment for weed control in soybean fields is the sulfonylurea
herbicide chlorimuron-ethyl, which has significant residual
activity in the soil and thus maintains selective pressure on all
later-emerging weed species, creating a favorable environment for
the growth and spread of sulfonylurea-resistant weeds. However, the
3560.4.3.5 soybean can be treated with herbicides (e.g.,
chlorimuron-ethyl) and combinations of herbicides that would cause
unacceptable damage to standard plant varieties. Thus, for example,
fields containing the 3560.4.3.5 soybean can be treated with
sulfonylurea, imidazolinone, triazolopyrimidines,
pyrimidiny(thio)benzoates, and/or
sulfonylaminocarbonyltriazonlinone such as the sulfonylurea
chlorimuron-ethyl, either alone or in combination with other
herbicides. For example, fields containing soybean plants of the
invention can be treated with a combination of glyphosate and
tribenuron-methyl (available commercially as Express.RTM.). This
combination has several advantages for weed control under some
circumstances, including the use of herbicides with different modes
of action and the use of herbicides having a relatively short
period of residual activity in the soil. A herbicide having a
relatively short period of residual activity is desirable, for
example, in situations where it is important to reduce selective
pressure that would favor the growth of herbicide-tolerant weeds.
Of course, in any particular situation where weed control is
required, other considerations may be more important, such as, for
example, the need to prevent the development of and/or appearance
of weeds in a field prior to planting a crop by using a herbicide
with a relatively long period of residual activity. The 3560.4.3.5
soybean plants can also be treated with herbicide combinations that
include at least one of nicosulfuron, metsulfuron-methyl,
tribenuron-methyl, thifensulfuron-methyl, and/or rimsulfuron.
Treatments that include both tribenuron-methyl and
thifensulfuron-methyl may be particularly useful.
[0196] Other commonly used treatments for weed control in fields
where current commercial varieties of crops (including, for
example, soybeans) are grown include the sulfonylurea herbicide
thifensulfuron-methyl (available commercially as Harmony GT.RTM.).
However, one disadvantage of thifensulfuron-methyl is that the
higher application rates required for consistent weed control often
cause injury to a crop growing in the same field. The 3560.4.3.5
soybean plants can be treated with a combination of glyphosate and
thifensulfuron-methyl, which has the advantage of using herbicides
with different modes of action. Thus, weeds that are resistant to
either herbicide alone are controlled by the combination of the two
herbicides, and the 3560.4.3.5 soybean plants are not significantly
damaged by the treatment.
[0197] Other herbicides which are used for weed control in fields
where current commercial varieties of crops (including, for
example, soybeans) are grown are the triazolopyrimidine herbicide
cloransulam-methyl (available commercially as FirstRate.RTM.) and
the imidazolinone herbicide imazaquin (available commercially as
Sceptor.RTM.). When these herbicides are used individually they may
provide only marginal control of weeds. However, fields containing
the 3560.4.3.5 soybean can be treated, for example, with a
combination of glyphosate (e.g., Roundup.RTM. (glyphosate
isopropylamine salt)), imazapyr (currently available commercially
as Arsenal.RTM.), chlorimuron-ethyl (currently available
commercially as Classic.RTM.), quizalofop-P-ethyl (currently
available commercially as Assure ITS), and fomesafen (currently
available commercially as Flexstar.RTM.). This combination has the
advantage of using herbicides with different modes of action. Thus,
weeds that are tolerant to just one or several of these herbicides
are controlled by the combination of the five herbicides, and the
3560.4.3.5 soybeans are not significantly damaged by treatment with
this herbicide combination. This combination provides an extremely
broad spectrum of protection against the type of herbicide-tolerant
weeds that might be expected to arise and spread under current weed
control practices.
[0198] Fields containing the 3560.4.3.5 soybean plants may also be
treated, for example, with a combination of herbicides including
glyphosate, rimsulfuron, and dicamba or mesotrione. This
combination may be particularly useful in controlling weeds which
have developed some tolerance to herbicides which inhibit ALS.
Another combination of herbicides which may be particularly useful
for weed control includes glyphosate and at least one of the
following: metsulfuron-methyl (commercially available as
Ally.RTM.), imazapyr (commercially available as Arsenal.RTM.),
imazethapyr, imazaquin, and sulfentrazone. It is understood that
any of the combinations discussed above or elsewhere herein may
also be used to treat areas in combination with any other herbicide
or agricultural chemical.
[0199] Some commonly-used treatments for weed control in fields
where current commercial crops (including, for example, maize) are
grown include glyphosate (currently available commercially as
Roundup.RTM.), rimsulfuron (currently available commercially as
Resolve.RTM. or Matrix.RTM.), dicamba (commercially available as
Clarity.RTM.), atrazine, and mesotrione (commercially available as
Callisto.RTM.). These herbicides are sometimes used individually
due to poor crop tolerance to multiple herbicides. Unfortunately,
when used individually, each of these herbicides has significant
disadvantages. Particularly, the incidence of weeds that are
tolerant to individual herbicides continues to increase, rendering
glyphosate less effective than desired in some situations.
Rimsulfuron provides better weed control at high doses which can
cause injury to a crop, and alternatives such as dicamba are often
more expensive than other commonly-used herbicides. However,
3560.4.3.5 soybean can be treated with herbicides and combinations
of herbicides that would cause unacceptable damage to standard
plant varieties, including combinations of herbicides that comprise
rimsulfuron and/or dicamba. Other suitable combinations of
herbicides for use with 3560.4.3.5 soybean plants include
glyphosate, sulfonylurea, imidazolinone, triazolopyrimidine,
pryimidinyloxy(thio)benzoates, and/or
sulfonylaminocarbonyltriazonlinone herbicides, including, for
example, and at least one of the following: metsulfuron-methyl,
tribenuron-methyl, chlorimuron-ethyl, imazethapyr, imazapyr, and
imazaquin.
[0200] For example, 3560.4.3.5 soybean plants can be treated with a
combination of glyphosate and rimsulfuron, or a combination or
rimsulfuron and at least one other herbicide. 3560.4.3.5 soybean
plants can also be treated with a combination of glyphosate,
rimsulfuron, and dicamba, or a combination of glyphosate,
rimsulfuron, and at least one other herbicide. In some embodiments,
at least one other herbicide has a different mode of action than
both glyphosate and rimsulfuron. The combination of glyphosate,
rimsulfuron, and dicamba has the advantage that these herbicides
have different modes of action and short residual activity, which
decreases the risk of incidence and spread of herbicide-tolerant
weeds.
[0201] Some commonly-used treatments for weed control in fields
where current commercial crops are grown include glyphosate
(currently available commercially as Roundup.RTM.),
chlorimuron-ethyl, tribenuron-methyl, rimsulfuron (currently
available commercially as Resolve.RTM. or Matrix.RTM.),
imazethapyr, imazapyr, and imazaquin. Unfortunately, when used
individually, each of these herbicides has significant
disadvantages. Particularly, the incidence of weeds that are
tolerant to individual herbicides continues to increase, rendering
each individual herbicide less effective than desired in some
situations. However, 3560.4.3.5 soybean can be treated with a
combination of herbicides that would cause unacceptable damage to
standard plant varieties, including combinations of herbicides that
include at least one of those mentioned above.
[0202] In the methods, a herbicide may be formulated and applied to
an area of interest such as, for example, a field or area of
cultivation, in any suitable manner. A herbicide may be applied to
a field in any form, such as, for example, in a liquid spray or as
solid powder or granules. In specific embodiments, the herbicide or
combination of herbicides that are employed in the methods
comprises a tankmix or a premix. A herbicide may also be
formulated, for example, as a "homogenous granule blend" produced
using blends technology (see, e.g., U.S. Pat. No. 6,022,552,
entitled "Uniform Mixtures of Pesticide Granules"). The blends
technology of U.S. Pat. No. 6,022,552 produces a nonsegregating
blend (i.e., a "homogenous granule blend") of formulated crop
protection chemicals in a dry granule form that enables delivery of
customized mixtures designed to solve specific problems. A
homogenous granule blend can be shipped, handled, subsampled, and
applied in the same manner as traditional premix products where
multiple active ingredients are formulated into the same
granule.
[0203] Briefly, a "homogenous granule blend" is prepared by mixing
together at least two extruded formulated granule products. In some
embodiments, each granule product comprises a registered
formulation containing a single active ingredient which is, for
example, a herbicide, a fungicide, and/or an insecticide. The
uniformity (homogeneity) of a "homogenous granule blend" can be
optimized by controlling the relative sizes and size distributions
of the granules used in the blend. The diameter of extruded
granules is controlled by the size of the holes in the extruder
die, and a centrifugal sifting process may be used to obtain a
population of extruded granules with a desired length distribution
(see, e.g., U.S. Pat. No. 6,270,025).
[0204] A homogenous granule blend is considered to be "homogenous"
when it can be subsampled into appropriately sized aliquots and the
composition of each aliquot will meet the required assay
specifications. To demonstrate homogeneity, a large sample of the
homogenous granule blend is prepared and is then subsampled into
aliquots of greater than the minimum statistical sample size.
[0205] In non-limiting embodiments, the 3560.4.5.3 soybean plant
can be treated with herbicides (e.g., chlorimuron-ethyl and
combinations of other herbicides that without the 3560.4.3.5 event
would have caused unacceptable crop response to plant varieties
without the glyphosate/ALS inhibitor genetics). Thus, for example,
fields planted with and containing 3560.4.3.5 soybeans can be
treated with sulfonylurea, imidazolinone, triazolopyrimidine,
pyrimidinyl(thio)benzoate, and/or
sulfonylaminocarbonyltriazonlinone herbicides, either alone or in
combination with other herbicides. Since ALS inhibitor chemistries
have different herbicidal attributes, blends of ALS inhibitor plus
other chemistries will provide superior weed management strategies
including varying and increased weed spectrum, the ability to
provide specified residual activity (SU/ALS inhibitor chemistry
with residual activity leads to improved foliar activity which
leads to a wider window between glyphosate applications, as well
as, an added period of control if weather conditions prohibit
timely application).
[0206] Blends also afford the ability to add other agrochemicals at
normal, labeled use rates such as additional herbicides (a
3.sup.rd/4.sup.th mechanism of action), fungicides, insecticides,
plant growth regulators and the like thereby saving costs
associated with additional applications.
[0207] Any herbicide formulation applied over the 3560.4.3.5
soybean plant can be prepared as a "tank-mix" composition. In such
embodiments, each ingredient or a combination of ingredients can be
stored separately from one another. The ingredients can then be
mixed with one another prior to application. Typically, such mixing
occurs shortly before application. In a tank-mix process, each
ingredient, before mixing, typically is present in water or a
suitable organic solvent. For additional guidance regarding the art
of formulation, see T. S. Woods, "The Formulator's Toolbox--Product
Forms for Modern Agriculture" Pesticide Chemistry and Bioscience,
The Food-Environment Challenge, T. Brooks and T. R. Roberts, Eds.,
Proceedings of the 9th International Congress on Pesticide
Chemistry, The Royal Society of Chemistry, Cambridge, 1999, pp.
120-133. See also U.S. Pat. No. 3,235,361, Col. 6, line 16 through
Col, 7, line 19 and Examples 10-41; U.S. Pat. No. 3,309,192, Col.
5, line 43 through Col. 7, line 62 and Examples 8, 12, 15, 39, 41,
52, 53, 58, 132, 138-140, 162-164, 166, 167 and 169-182; U.S. Pat.
No. 2,891,855, Col. 3, line 66 through Col. 5, line 17 and Examples
1-4; Klingman, Weed Control as a Science, John Wiley and Sons,
Inc., New York, 1961, pp 81-96; and Hance et al., Weed Control
Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989,
each of which is incorporated herein by reference in their
entirety.
[0208] The methods further allow for the development of herbicide
combinations to be used with the 3560.4.3.5 soybean plants. In such
methods, the environmental conditions in an area of cultivation are
evaluated. Environmental conditions that can be evaluated include,
but are not limited to, ground and surface water pollution
concerns, intended use of the crop, crop tolerance, soil residuals,
weeds present in area of cultivation, soil texture, pH of soil,
amount of organic matter in soil, application equipment, and
tillage practices. Upon the evaluation of the environmental
conditions, an effective amount of a combination of herbicides can
be applied to the crop, crop part, seed of the crop or area of
cultivation.
[0209] In some embodiments, the herbicide applied to the 3560.4.3.5
soybean plants serves to prevent the initiation of growth of
susceptible weeds and/or serve to cause damage to weeds that are
growing in the area of interest. In some embodiments, the herbicide
or herbicide mixture exert these effects on weeds affecting crops
that are subsequently planted in the area of interest (i.e., field
or area of cultivation). In the methods, the application of the
herbicide combination need not occur at the same time. So long as
the field in which the crop is planted contains detectable amounts
of the first herbicide and the second herbicide is applied at some
time during the period in which the crop is in the area of
cultivation, the crop is considered to have been treated with a
mixture of herbicides according to the invention. Thus, methods
encompass applications of herbicide which are "preemergent,"
"postemergent," "preplant incorporation" and/or which involve seed
treatment prior to planting.
[0210] In one embodiment, methods are provided for coating seeds.
The methods comprise coating a seed with an effective amount of a
herbicide or a combination of herbicides (as disclosed elsewhere
herein). The seeds can then be planted in an area of cultivation.
Further provided are seeds having a coating comprising an effective
amount of a herbicide or a combination of herbicides (as disclosed
elsewhere herein).
[0211] "Preemergent" refers to a herbicide which is applied to an
area of interest (e.g., a field or area of cultivation) before a
plant emerges visibly from the soil. "Postemergent" refers to a
herbicide which is applied to an area after a plant emerges visibly
from the soil. In some instances, the terms "preemergent" and
"postemergent" are used with reference to a weed in an area of
interest, and in some instances these terms are used with reference
to a crop plant in an area of interest. When used with reference to
a weed, these terms may apply to only a particular type of weed or
species of weed that is present or believed to be present in the
area of interest. While any herbicide may be applied in a
preemergent and/or postemergent treatment, some herbicides are
known to be more effective in controlling a weed or weeds when
applied either preemergence or postemergence. For example,
rimsulfuron has both preemergence and postemergence activity, while
other herbicides have predominately preemergence (metolachlor) or
postemergence (glyphosate) activity. These properties of particular
herbicides are known in the art and are readily determined by one
of skill in the art. Further, one of skill in the art would readily
be able to select appropriate herbicides and application times for
use with the transgenic plants of the invention and/or on areas in
which transgenic plants of the invention are to be planted.
"Preplant incorporation" involves the incorporation of compounds
into the soil prior to planting.
[0212] Thus, improved methods of growing a crop and/or controlling
weeds are provided such as, for example, "pre-planting burn down,"
wherein an area is treated with herbicides prior to planting the
crop of interest in order to better control weeds. Further provided
are methods of growing a crop and/or controlling weeds which are
"no-till" or "low-till" (also referred to as "reduced tillage"). In
such methods, the soil is not cultivated or is cultivated less
frequently during the growing cycle in comparison to traditional
methods; these methods can save costs that would otherwise be
incurred due to additional cultivation, including labor and fuel
costs.
[0213] The methods encompass the use of simultaneous and/or
sequential applications of multiple classes of herbicides. In some
embodiments, the methods involve treating a plant of the invention
and/or an area of interest (e.g., a field or area of cultivation)
and/or weed with just one herbicide or other chemical such as, for
example, a sulfonylurea herbicide.
[0214] The time at which a herbicide is applied to an area of
interest (and any plants therein) may be important in optimizing
weed control. The time at which a herbicide is applied may be
determined with reference to the size of plants and/or the stage of
growth and/or development of plants in the area of interest, e.g.,
crop plants or weeds growing in the area. The stages of growth
and/or development of plants are known in the art. For example,
soybean plants normally progress through vegetative growth stages
known as V.sub.E (emergence), V.sub.C (unifoliolate), V.sub.1
(first trifoliolate), and V.sub.2 to V.sub.N. Soybeans then switch
to the reproductive growth phase in response to photoperiod cues;
reproductive stages include R.sub.3 (beginning bloom), R.sub.2
(full bloom), R.sub.3 (beginning pod), R.sub.4 (full pod), R.sub.5
(beginning seed), R.sub.6 (full seed), R.sub.7 (beginning
maturity), and R.sub.8 (full maturity). Thus, for example, the time
at which a herbicide or other chemical is applied to an area of
interest in which plants are growing may be the time at which some
or all of the plants in a particular area have reached at least a
particular size and/or stage of growth and/or development, or the
time at which some or all of the plants in a particular area have
not yet reached a particular size and/or stage of growth and/or
development.
[0215] In some embodiments, the 3560.4.3.5 soybean plants show
improved tolerance to postemergence herbicide treatments. For
example, the 3560.4.3.5 plants may be tolerant to higher doses of
herbicide, tolerant to a broader range of herbicides (i.e.,
tolerance to more ALS inhibitor chemistries), and/or may be
tolerant to doses of herbicide applied at earlier or later times of
development in comparison to an appropriate control plant. For
example, in some embodiments, the 3560.4.3.5 soybean plants show an
increased resistance to morphological defects that are known to
result from treatment at particular stages of development.
[0216] Different chemicals such as herbicides have different
"residual" effects, i.e., different amounts of time for which
treatment with the chemical or herbicide continues to have an
effect on plants growing in the treated area. Such effects may be
desirable or undesirable, depending on the desired future purpose
of the treated area (e.g., field or area of cultivation). Thus, a
crop rotation scheme may be chosen based on residual effects from
treatments that will be used for each crop and their effect on the
crop that will subsequently be grown in the same area. One of skill
in the art is familiar with techniques that can be used to evaluate
the residual effect of a herbicide; for example, generally,
glyphosate has very little or no soil residual activity, while
herbicides that act to inhibit ALS vary in their residual activity
levels. Residual activities for various herbicides are known in the
art, and are also known to vary with various environmental factors
such as, for example, soil moisture levels, temperature, pH, and
soil composition (texture and organic matter). The 3560.4.3.5
soybean plants find particular use in methods of growing a crop
where improved tolerance to residual activity of a herbicide is
beneficial.
[0217] For example, in one embodiment, the 3560.4.3.5 soybean
plants have an improved tolerance to glyphosate as well as to ALS
inhibitor chemistries (such as sulfonylurea herbicides) when
applied individually, and further provide improved tolerance to
combinations of herbicides such as glyphosate and/or ALS inhibitor
chemistries. Moreover, the transgenic plants disclosed herein
provide improved tolerance to treatment with additional chemicals
commonly used on crops in conjunction with herbicide treatments,
such as safeners, adjuvants such as ammonium sulfonate and crop oil
concentrate, and the like.
[0218] The term "safener" refers to a substance that when added to
a herbicide formulation eliminates or reduces the phytotoxic
effects of the herbicide to certain crops. One of ordinary skill in
the art would appreciate that the choice of safener depends, in
part, on the crop plant of interest and the particular herbicide or
combination of herbicides included in the synergistic herbicide
composition. Exemplary safeners suitable for use with the presently
disclosed herbicide compositions include, but are not limited to,
those disclosed in U.S. Pat. Nos. 4,808,208; 5,502,025; 6,124,240
and U.S. Patent Application Publication Nos. 2006/0148647;
2006/0030485; 2005/0233904; 2005/0049145; 2004/0224849;
2004/0224848; 2004/0224844; 2004/0157737; 2004/0018940;
2003/0171220; 2003/0130120; 2003/0078167, the disclosures of which
are incorporated herein by reference in their entirety. The methods
can involve the use of herbicides in combination with herbicide
safeners such as benoxacor, BCS (1-bromo-4-[(chloromethyl)
sulfonyl]benzene), cloquintocet-mexyl, cyometrinil, dichlormid,
2-(dichloromethyl)-2-methyl-1,3-dioxolane (MG 191),
fenchlorazole-ethyl, fenclorim, flurazole, fluxofenim, furilazole,
isoxadifen-ethyl, mefenpyr-diethyl, methoxyphenone
((4-methoxy-3-methylphenyl)(3-methylphenyl)methanone), naphthalic
anhydride (1,8-naphthalic anhydride) and oxabetrinil to increase
crop safety. Antidotally effective amounts of the herbicide
safeners can be applied at the same time as the compounds, or
applied as seed treatments. Therefore an aspect of the present
invention relates to the use of a mixture comprising glyphosate, at
least one other herbicide, and an antidotally effective amount of a
herbicide safener.
[0219] Seed treatment is particularly useful for selective weed
control, because it physically restricts antidoting to the crop
plants. Therefore a particularly useful embodiment is a method for
selectively controlling the growth of weeds in a field comprising
treating the seed from which the crop is grown with an antidotally
effective amount of safener and treating the field with an
effective amount of herbicide to control weeds. Antidotally
effective amounts of safeners can be easily determined by one
skilled in the art through simple experimentation. An antidotally
effective amount of a safener is present where a desired plant is
treated with the safener so that the effect of a herbicide on the
plant is decreased in comparison to the effect of the herbicide on
a plant that was not treated with the safener; generally, an
antidotally effective amount of safener prevents damage or severe
damage to the plant treated with the safener. One of skill in the
art is capable of determining whether the use of a safener is
appropriate and determining the dose at which a safener should be
administered to a crop.
[0220] In specific embodiments, the herbicide or herbicide
combination applied to the 3560.4.3.5 plant acts as a safener. In
this embodiment, a first herbicide or a herbicide mixture is
applied at an antidotally effect amount to the plant. Accordingly,
a method for controlling weeds in an area of cultivation is
provided. The method comprises planting the area with crop seeds or
plants which comprise a first polynucleotide encoding a polypeptide
that can confer tolerance to glyphosate operably linked to a
promoter active in a plant; and, a second polynucleotide encoding
an ALS inhibitor-tolerant polypeptide operably linked to a promoter
active in a plant. A combination of herbicides comprising at least
an effective amount of a first and a second herbicide is applied to
the crop, crop part, weed or area of cultivation thereof. The
effective amount of the herbicide combination controls weeds; and,
the effective amount of the first herbicide is not tolerated by the
crop when applied alone when compared to a control crop that has
not been exposed to the first herbicide; and, the effective amount
of the second herbicide is sufficient to produce a safening effect,
wherein the safening effect provides an increase in crop tolerance
upon the application of the first and the second herbicide when
compared to the crop tolerance when the first herbicide is applied
alone.
[0221] In specific embodiments, the combination of safening
herbicides comprises a first ALS inhibitor and a second ALS
inhibitor. In other embodiments, the safening effect is achieved by
applying an effective amount of a combination of glyphosate and at
least one ALS inhibitor chemistry. In still other embodiments, a
safening affect is achieved when the 3560.4.3.5 soybean crops, crop
part, crop seed, weed, or area of cultivation is treated with at
least one herbicide from the sulfonylurea family of chemistries in
combination with at least one herbicide from the ALS family of
chemistries (such as, for example, an imidazolinone).
[0222] Such mixtures provide increased crop tolerance (i.e., a
decrease in herbicidal injury). This method allows for increased
application rates of the chemistries post or pre-treatment. Such
methods find use for increased control of unwanted or undesired
vegetation. In still other embodiments, a safening affect is
achieved when the 3560.4.3.5 soybean crops, crop part, crop seed,
weed, or area of cultivation is treated with at least one herbicide
from the sulfonylurea family of chemistry in combination with at
least one herbicide from the imidazolinone family. This method
provides increased crop tolerance (i.e., a decrease in herbicidal
injury). In specific embodiments, the sulfonylurea comprises
rimsulfuron and the imidazolinone comprises imazethapyr. In other
embodiments, glyphosate is also applied to the crop, crop part, or
area of cultivation.
[0223] As used herein, an "adjuvant" is any material added to a
spray solution or formulation to modify the action of an
agricultural chemical or the physical properties of the spray
solution. See, for example, Green and Foy (2003) "Adjuvants: Tools
for Enhancing Herbicide Performance," in Weed Biology and
Management, ed. Inderjit (Kluwer Academic Publishers, The
Netherlands). Adjuvants can be categorized or subclassified as
activators, acidifiers, buffers, additives, adherents,
antiflocculants, antifoamers, defoamers, antifreezes, attractants,
basic blends, chelating agents, cleaners, colorants or dyes,
compatibility agents, cosolvents, couplers, crop oil concentrates,
deposition agents, detergents, dispersants, drift control agents,
emulsifiers, evaporation reducers, extenders, fertilizers, foam
markers, formulants, inerts, humectants, methylated seed oils, high
load COCs, polymers, modified vegetable oils, penetrators,
repellants, petroleum oil concentrates, preservatives, rainfast
agents, retention aids, solubilizers, surfactants, spreaders,
stickers, spreader stickers, synergists, thickeners, translocation
aids, uv protectants, vegetable oils, water conditioners, and
wetting agents.
[0224] In addition, methods can comprise the use of a herbicide or
a mixture of herbicides, as well as, one or more other
insecticides, fungicides, nematocides, bactericides, acaricides,
growth regulators, chemosterilants, semiochemicals, repellents,
attractants, pheromones, feeding stimulants or other biologically
active compounds or entomopathogenic bacteria, virus, or fungi to
form a multi-component mixture giving an even broader spectrum of
agricultural protection. Examples of such agricultural protectants
which can be used in methods include: insecticides such as
abamectin, acephate, acetamiprid, amidoflumet (S-1955), avermectin,
azadirachtin, azinphos-methyl, bifenthrin, bifenazate, buprofezin,
carbofuran, cartap, chlorfenapyr, chlorfluazuron, chlorpyrifos,
chlorpyrifos-methyl, chromafenozide, clothianidin, cyflumetofen,
cyfluthrin, beta-cyfluthrin, cyhalothrin, lambda-cyhalothrin,
cypermethrin, cyromazine, deltamethrin, diafenthiuron, diazinon,
dieldrin, diflubenzuron, dimefluthrin, dimethoate, dinotefuran,
diofenolan, emamectin, endosulfan, esfenvalerate, ethiprole,
fenothiocarb, fenoxycarb, fenpropathrin, fenvalerate, flonicamid,
flubendiamide, flucythrinate, tau-fluvalinate, flufenerim
(UR-50701), flufenoxuron, fonophos, halofenozide, hexaflumuron,
hydramethylnon, imidacloprid, indoxacarb, isofenphos, lufenuron,
malathion, metaflumizone, metaldehyde, methamidophos, methidathion,
methomyl, methoprene, methoxychlor, metofluthrin, monocrotophos,
methoxyfenozide, nitenpyram, nithiazine, novaluron, noviflumuron
(XDE-007), oxamyl, parathion, parathion-methyl, permethrin,
phorate, phosalone, phosmet, phosphamidon, pirimicarb, profenofos,
profluthrin, pymetrozine, pyrafluprole, pyrethrin, pyridalyl,
pyriprole, pyriproxyfen, rotenone, ryanodine, spinosad,
spirodiclofen, spiromesifen (BSN 2060), spirotetramat, sulprofos,
tebufenozide, teflubenzuron, tefluthrin, terbufos,
tetrachlorvinphos, thiacloprid, thiamethoxam, thiodicarb,
thiosultap-sodium, tralomethrin, triazamate, trichlorfon and
triflumuron; fungicides such as acibenzolar, aldimorph, amisulbrom,
azaconazole, azoxystrobin, benalaxyl, benomyl, benthiavalicarb,
benthiavalicarb-isopropyl, binomial, biphenyl, bitertanol,
blasticidin-S, Bordeaux mixture (Tribasic copper sulfate),
boscalidlnicobifen, bromuconazole, bupirimate, buthiobate,
carboxin, carpropamid, captafol, captan, carbendazim, chloroneb,
chlorothalonil, chlozolinate, clotrimazole, copper oxychloride,
copper salts such as copper sulfate and copper hydroxide,
cyazofamid, cyflunamid, cymoxanil, cyproconazole, cyprodinil,
dichlofluanid, diclocymet, diclomezine, dicloran, diethofencarb,
difenoconazole, dimethomorph, dimoxystrobin, diniconazole,
diniconazole-M, dinocap, discostrobin, dithianon, dodemorph,
dodine, econazole, etaconazole, edifenphos, epoxiconazole,
ethaboxam, ethirimol, ethridiazole, famoxadone, fenamidone,
fenarimol, fenbuconazole, fencaramid, fenfuram, fenhexamide,
fenoxanil, fenpiclonil, fenpropidin, fenpropimorph, fentin acetate,
fentin hydroxide, ferbam, ferfurazoate, ferimzone, fluazinam,
fludioxonil, flumetover, fluopicolide, fluoxastrobin,
fluquinconazole, fluquinconazole, flusilazole, flusulfamide,
flutolanil, flutriafol, folpet, fosetyl-aluminum, fuberidazole,
furalaxyl, furametapyr, hexaconazole, hymexazole, guazatine,
imazalil, imibenconazole, iminoctadine, iodicarb, ipconazole,
iprobenfos, iprodione, iprovalicarb, isoconazole, isoprothiolane,
kasugamycin, kresoxim-methyl, mancozeb, mandipropamid, maneb,
mapanipyrin, mefenoxam, mepronil, metalaxyl, metconazole,
methasulfocarb, metiram, metominostrobin/fenominostrobin,
mepanipyrim, metrafenone, miconazole, myclobutanil, neo-asozin
(ferric methanearsonate), nuarimol, octhilinone, ofurace,
orysastrobin, oxadixyl, oxolinic acid, oxpoconazole, oxycarboxin,
paclobutrazol, penconazole, pencycuron, penthiopyrad, perfurazoate,
phosphonic acid, phthalide, picobenzamid, picoxystrobin, polyoxin,
probenazole, prochloraz, procymidone, propamocarb,
propamocarb-hydrochloride, propiconazole, propineb, proquinazid,
prothioconazole, pyraclostrobin, pryazophos, pyrifenox,
pyrimethanil, pyrifenox, pyroInitrine, pyroquilon, quinconazole,
quinoxyfen, quintozene, silthiofam, simeconazole, spiroxamine,
streptomycin, sulfur, tebuconazole, techrazene, tecloftalam,
tecnazene, tetraconazole, thiabendazole, thifluzamide, thiophanate,
thiophanate-methyl, thiram, tiadinil, tolclofos-methyl,
tolyfluanid, triadimefon, triadimenol, triarimol, triazoxide,
tridemorph, trimoprhamide tricyclazole, trifloxystrobin, triforine,
triticonazole, uniconazole, validamycin, vinclozolin, zineb, ziram,
and zoxamide; nematocides such as aldicarb, oxamyl and fenamiphos;
bactericides such as streptomycin; acaricides such as amitraz,
chinomethionat, chlorobenzilate, cyhexatin, dicofol, dienochlor,
etoxazole, fenazaquin, fenbutatin oxide, fenpropathrin,
fenpyroximate, hexythiazox, propargite, pyridaben and tebufenpyrad;
and biological agents including entomopathogenic bacteria, such as
Bacillus thuringiensis subsp. Aizawai, Bacillus thuringiensis
subsp. Kurstaki, and the encapsulated delta-endotoxins of Bacillus
thuringiensis (e.g., Cellcap, MPV, MPVII); entomopathogenic fungi,
such as green muscardine fungus; and entomopathogenic virus
including baculovirus, nucleopolyhedro virus (NPV) such as HzNPV,
AfNPV; and granulosis virus (GV) such as CpGV. The weight ratios of
these various mixing partners to other compositions (e.g.,
herbicides) used in the methods typically are between 100:1 and
1:100, or between 30:1 and 1:30, between 10:1 and 1:10, or between
4:1 and 1:4.
[0225] Further provide are compositions comprising a biologically
effective amount of a herbicide of interest or a mixture of
herbicides, and an effective amount of at least one additional
biologically active compound or agent and can further comprise at
least one of a surfactant, a solid diluent or a liquid diluent.
Examples of such biologically active compounds or agents are:
insecticides such as abamectin, acephate, acetamiprid, amidoflumet
(S-1955), avermectin, azadirachtin, azinphos-methyl, bifenthrin,
binfenazate, buprofezin, carbofuran, chlorfenapyr, chlorfluazuron,
chlorpyrifos, chlorpyrifos-methyl, chromafenozide, clothianidin,
cyfluthrin, beta-cyfluthrin, cyhalothrin, lambda-cyhalothrin,
cypermethrin, cyromazine, deltamethrin, diafenthiuron, diazinon,
diflubenzuron, dimethoate, diofenolan, emamectin, endosulfan,
esfenvalerate, ethiprole, fenothicarb, fenoxycarb, fenpropathrin,
fenvalerate, fipronil, flonicamid, flucythrinate, tau-fluvalinate,
flufenerim (UR-50701), flufenoxuron, fonophos, halofenozide,
hexaflumuron, imidacloprid, indoxacarb, isofenphos, lufenuron,
malathion, metaldehyde, methamidophos, methidathion, methomyl,
methoprene, methoxychlor, monocrotophos, methoxyfenozide,
nithiazin, novaluron, noviflumuron (XDE-007), oxamyl, parathion,
parathion-methyl, permethrin, phorate, phosalone, phosmet,
phosphamidon, pirimicarb, profenofos, pymetrozine, pyridalyl,
pyriproxyfen, rotenone, spinosad, spiromesifin (BSN 2060),
sulprofos, tebufenozide, teflubenzuron, tefluthrin, terbufos,
tetrachlorvinphos, thiacloprid, thiamethoxam, thiodicarb,
thiosultap-sodium, tralomethrin, trichlorfon and triflumuron;
fungicides such as acibenzolar, azoxystrobin, benomyl,
blasticidin-S, Bordeaux mixture (tribasic copper sulfate),
bromuconazole, carpropamid, captafol, captan, carbendazim,
chloroneb, chlorothalonil, copper oxychloride, copper salts,
cyflufenamid, cymoxanil, cyproconazole, cyprodinil,
(S)-3,5-dichloro-N-(3-chloro-1-ethyl-1-methyl-2-oxopropyl)-4-methylbenzam-
ide (RH 7281), diclocymet (S-2900), diclomezine, dicloran,
difenoconazole,
(S)-3,5-dihydro-5-methyl-2-(methylthio)-5-phenyl-3-(phenyl-amino)-4H-imid-
azol-4-one (RP 407213), dimethomorph, dimoxystrobin, diniconazole,
diniconazole-M, dodine, edifenphos, epoxiconazole, famoxadone,
fenamidone, fenarimol, fenbuconazole, fencaramid (SZX0722),
fenpiclonil, fenpropidin, fenpropimorph, fentin acetate, fentin
hydroxide, fluazinam, fludioxonil, flumetover (RPA 403397),
flumorf/flumorlin (SYP-L190), fluoxastrobin (HEC 5725),
fluquinconazole, flusilazole, flutolanil, flutriafol, folpet,
fosetyl-aluminum, furalaxyl, furametapyr (S-82658), hexaconazole,
ipconazole, iprobenfos, iprodione, isoprothiolane, kasugamycin,
kresoxim-methyl, mancozeb, maneb, mefenoxam, mepronil, metalaxyl,
metconazole, metomino-strobingenominostrobin (SSF-126), metrafenone
(AC375839), myclobutanil, neo-asozin (ferric methane-arsonate),
nicobifen (BAS 510), orysastrobin, oxadixyl, penconazole,
pencycuron, probenazole, prochloraz, propamocarb, propiconazole,
proquinazid (DPX-KQ926), prothioconazole (JAU 6476), pyrifenox,
pyraclostrobin, pyrimethanil, pyroquilon, quinoxyfen, spiroxamine,
sulfur, tebuconazole, tetraconazole, thiabendazole, thifluzamide,
thiophanate-methyl, thiram, tiadinil, triadimefon, triadimenol,
tricyclazole, trifloxystrobin, triticonazole, validamycin and
vinclozolin; nematocides such as aldicarb, oxamyl and fenamiphos;
bactericides such as streptomycin; acaricides such as amitraz,
chinomethionat, chlorobenzilate, cyhexatin, dicofol, dienochlor,
etoxazole, fenazaquin, fenbutatin oxide, fenpropathrin,
fenpyroximate, hexythiazox, propargite, pyridaben and tebufenpyrad;
and biological agents including entomopathogenic bacteria, such as
Bacillus thuringiensis subsp. Aizawai, Bacillus thuringiensis
subsp. Kurstaki, and the encapsulated delta-endotoxins of Bacillus
thuringiensis (e.g., Cellcap, MPV, MPVII); entomopathogenic fungi,
such as green muscardine fungus; and entomopathogenic virus
including baculovirus, nucleopolyhedro virus (NPV) such as HzNPV,
AfNPV; and granulosis virus (GV) such as CpGV. Methods may also
comprise the use of plants genetically transformed to express
proteins toxic to invertebrate pests (such as Bacillus
thuringiensis delta-endotoxins). In such embodiments, the effect of
exogenously applied invertebrate pest control compounds may be
synergistic with the expressed toxin proteins.
[0226] General references for these agricultural protectants
include The Pesticide Manual, 13th Edition, C. D. S. Tomlin, Ed.,
British Crop Protection Council, Farnham, Surrey, U.K., 2003 and
The BioPesticide Manual, 2.sup.nd Edition, L. G. Copping, Ed.,
British Crop Protection Council, Farnham, Surrey, U.K., 2001.
[0227] In certain instances, combinations with other invertebrate
pest control compounds or agents having a similar spectrum of
control but a different mode of action will be particularly
advantageous for resistance management. Thus, compositions can
further comprise a biologically effective amount of at least one
additional invertebrate pest control compound or agent having a
similar spectrum of control but a different mode of action.
Contacting a plant genetically modified to express a plant
protection compound (e.g., protein) or the locus of the plant with
a biologically effective amount of a compound can also provide a
broader spectrum of plant protection and be advantageous for
resistance management.
[0228] Thus, methods can employ a herbicide or herbicide
combination and may further comprise the use of insecticides and/or
fungicides, and/or other agricultural chemicals such as
fertilizers. The use of such combined treatments can broaden the
spectrum of activity against additional weed species and suppress
the proliferation of any resistant biotypes.
[0229] Methods can further comprise the use of plant growth
regulators such as aviglycine, N-(phenylmethyl)-1H-purin-6-amine,
ethephon, epocholeone, gibberellic acid, gibberellin A.sub.4 and
A.sub.7, harpin protein, mepiquat chloride, prohexadione calcium,
prohydrojasmon, sodium nitrophenolate and trinexapac-methyl, and
plant growth modifying organisms such as Bacillus cereus strain
BP01.
[0230] Embodiments are further defined in the following Examples.
It should be understood that these Examples are given by way of
illustration only. From the above discussion and these Examples,
one skilled in the art can ascertain the essential characteristics,
and without departing from the spirit and scope thereof, can make
various changes and modifications of the embodiments of the
invention to adapt it to various usages and conditions. Thus,
various modifications of the embodiments of the invention, in
addition to those shown and described herein, will be apparent to
those skilled in the art from the foregoing description. Such
modifications are also intended to fall within the scope of the
appended claims.
EXPERIMENTAL
Example 1
Insert and Flanking Border Sequence Characterization of Soybean
Event 3560.4.3.5
[0231] Soybean event 3560.4.3.5, hereafter referred to as
3560.4.3.5 soybean, was obtained by microprojectile bombardment
with the Not I-Asc I fragment from plasmid PHP20163. This fragment,
PHP20163A, contains the glyphosate acetylytransferase (glyat 4601)
gene under the control of the SCP1 promoter that is a synthetic
constitutive promoter comprising a portion of the CaMV 35S promoter
(Odell et al. (1985) Nature 313:810-812) and the Rsyn7-Syn II Core
synthetic consensus promoter (U.S. Pat. Nos. 6,072,050 and
6555673). See also, for example, US20030226166, Table 13, and SEQ
ID NO:3. Downstream of this element is the Tobacco Mosaic Virus
(TMV) omega 5'UTR translational enhancer element (Gallie et al.
(1992) Nucleic Acid Research 20:4631-4638) and the proteinase
inhibitor II (pinII) terminator from Solanum tuberosum (Keil et al.
(1986) Nucleic Acid Research 14:5641-5650 and An et al. (1989)
Plant Cell 1:115-122). PHP20163A also contains the gm-hra gene that
is a modified version of the acetolactate synthase gene from
soybean with 15 additional nucleotides on the 5' end (2697-2711)
derived from the als 5' UTR and two nucleotides changes within the
coding sequence under the control of the S-adenosyl-L-methionine
synthetase (SAMS) promoter (US Application Publication
2003/0226166) with its 5'UTR and intron (SAMS Pro) and the
acetolactate synthase (gm-als) terminator, both from soybean.
[0232] To characterize the integrity of the inserted DNA from
PHP20163A and the genomic insertion site, the sequence of the
insert and flanking genomic DNA border regions of 3560.4.3.5
soybean was determined. In total, 10849 base pairs (bp) of
3560.4.3.5 soybean was sequenced, comprising 5362 bp of DNA insert
from PHP20163A, 3317 bp of 5' flanking genomic border sequence, and
2170 bp of 3' flanking genomic border sequence. When compared to
the expected sequence from the DNA fragment used for
transformation, the insert was confirmed to be intact and identical
to PHP20163A and precisely integrated into the soy genome. PCR
amplification from the 3560.4.3.5 soybean insert and border
sequences confirmed that the border regions were of soybean origin
and that the junction regions could be used for identification of
3560.4.3.5 soybean.
[0233] BLASTn analysis of the border regions resulted in
significant identities to public and proprietary soybean genomic
sequences. Overall, characterization of the insert and genomic
border sequence of 3560.4.3.5 soybean along with Southern blot data
(data not show) indicated that a single insertion of the DNA
fragment, PHP20613A, was present in the soybean genome.
The following abbreviations are used in describing the present
invention. [0234] ALS acetolactate synthase protein [0235] bp base
pair [0236] glyat glyphosate acetyltransferase gene [0237] GLYAT
glyphosate acetyltransferase protein [0238] GLYAT4601 glyphosate
acetyltransferase protein derived from glyat4601 gene [0239] gm-als
wild type acetolactate synthase gene from soybean [0240] gm-hra
modified version of acetolactate synthase gene from soybean [0241]
kb kilobase [0242] PCR polymerase chain reaction [0243] UTR
untranslated region [0244] als acetolactate synthase gene [0245]
AMS ammonium sulfate [0246] DAT days after treatment [0247]
glyat4601 glyphosate acetyl transferase gene from the 7.sup.th
round of DNA shuffling a glyat gene family isolated from Bacillus
licheniformis (Castle et al. (2004) Science 304:1151-1154; Siehl et
al. (2005) Pest Manag. Sci. 61:235-240). [0248] GLYAT4601
glyphosate acetyl transferase protein from the 7.sup.th round of
DNA shuffling a glyat gene family isolated from Bacillus
licheniformis (Castle et al. (2004) Science 304:1151-1154; Siehl et
al. (2005) Pest Manag. Sci. 61:235-240). [0249] hra highly
resistant allele of the acetolactate synthase gene [0250]
glyat+gm-hra transgenic event expressing both the glyat4601 and
gm-hra genes [0251] NILs near isogenic lines [0252] NIS non-ionic
surfactant [0253] SAMS S-adenosyl-L-methionine synthase promoter
(US Patent Application No 2003/0226166) [0254] SCP1 Synthetic
constitutive promoter 1 (U.S. Pat. Nos. 6,072,050 and 6,555,673
B1.
[0255] Soybean (Glycine max) has been modified by the insertion of
the glyphosate acetyltransferase (glyat4601) gene derived from
Bacillus licheniformis and a modified version of the soybean
acetolactate synthase gene (gm-hra). The glyat4601 gene was
functionally improved by a gene shuffling process to optimize the
kinetics of glyphosate acetyltransferase (GLYAT) activity for
acetylating the herbicide glyphosate. The insertion of the
glya4601t gene in the plant confers tolerance to the herbicidal
active ingredient glyphosate through the conversion of glyphosate
to the non-toxic acetylated form. The insertion of the gm-hra gene
produces a modified form of the acetolactate synthase enzyme. ALS
is essential for branched chain amino acid biosynthesis and the
modification in the gm-hra gene overcomes this inhibition and thus
provides tolerance to a wide range of ALS-inhibiting
herbicides.
[0256] The publicly available cultivar Jack was used as the
recipient line for generation of 3560.4.3.5 soybean. The 3560.4.3.5
soybean was obtained by microprojectile bombardment with the Not
I-Asc I fragment from plasmid PHP20163 (FIG. 1). This fragment,
PHP20163A (FIG. 2), contains the glyat4601 gene under the control
of the SCP1 promoter and Tobacco Mosaic Virus (TMV) omega 5' UTR
translational enhancer element and the proteinase inhibitor II
(pinII) terminator from Solanum tuberosum. PHP20163A also contains
the gm-hra gene under the control of the S-adenosyl-L-methionine
synthetase (SAMS) promoter and the acetolactate synthase (gm-als)
terminator, both from soybean.
[0257] The transgenic 3560.4.3.5 soybean was generated using the
Biolistics PDS-1000/He particle gun, manufactured by Bio-Rad
(Hercules, Calif.), essentially as described by Klein et al.
(1987). The targets for transformation were clumps of secondary
somatic embryos derived from explants from small, immature soybean
seeds of the cultivar Jack. The secondary somatic embryos were
excised from immature explants, transferred to a liquid soybean
culture maintenance medium, and subcultured at regular intervals
until prepared for bombardment.
[0258] Soybean somatic embryogenic cultures were used in
transformation experiments 2-4 months after initiation. On the day
of transformation, microscopic gold particles were coated with the
purified fragment PHP20163A DNA and accelerated into the
embryogenic soybean cultures. Only PHP20163A DNA was used, and no
additional DNA (e.g., carrier DNA) was used in the transformation
process.
[0259] Following the transformation, the soybean tissue was
transferred to flasks of fresh liquid culture maintenance medium
for recovery. After seven days, the liquid culture medium was
changed to culture maintenance medium supplemented with
chlorsulfuron as the selection agent. Chlorsulfuron belongs to a
family of ALS-inhibiting herbicides, and therefore only soybean
cells that had stably inherited the gm-hra transgene continued to
grow.
[0260] After several weeks in the culture maintenance medium
supplemented with chlorsulfuron, small islands of healthy,
chlorsulfuron-tolerant green tissue became visible and started to
grow out of pieces of dying somatic embryogenic tissue. Green
embryogenic clumps were excised from associated pieces of dying or
dead tissue and received regular changes of fresh liquid selection
medium until the start of the regeneration process. Embryogenic
tissue samples were analyzed to confirm the presence of the
glyat4601 and gm-hra transgenes by Southern blot hybridization. TO
plants were regenerated and transferred to the greenhouse for seed
production. FIG. 5 describes a breeding diagram.
[0261] In the microprojectile bombardment transformation the
3560.4.3.5 soybean, DNA is inserted into the plant genome. The
integration of the DNA fragment can occur at virtually any site in
the plant genome. Once inserted, the genes that contain plant
expression elements are recognized by the plant and may be
expressed. Various molecular techniques are then used to
specifically characterize the integration site in the 3560.4.3.5
soybean.
[0262] Southern blot analyses indicated that a single, intact
PHP20163A fragment inserted into the soybean genome to produce the
3560.4.3.5 soybean (data not shown). Cloning and sequencing of the
flanking genomic border regions of 3560.4.3.5 soybean and the
inserted DNA was undertaken to characterize the insertion site in
the soybean genome and obtain sequence that could be used to
uniquely identify 3560.4.3.5 soybean.
[0263] Leaf tissue from the T5 generation of 3560.4.3.5 soybean was
used as for additional sequence characterization. The T5 generation
represents transformation of a Jack soybean variety, followed by
two self-crossings. A single plant from this second self-crossing
was selected for three subsequent rounds of self-crossing and seed
bulking. Southern blot analysis was used for event confirmation on
plant leaf tissue of 3560.4.3.5 soybean (data not shown).
[0264] Leaf tissue from soybean plants that were not genetically
modified was used as a control for sequence characterization. The
unmodified soybean plants have a genetic background representative
of 3560.4.3.5 soybean background; however, they do not contain the
plant transcription units for the glyat4601 and gm-hra genes.
[0265] The 100 bp and 1 kb step DNA Ladders (Promega, Madison,
Wis.) were used to estimate DNA fragment sizes on agarose gels.
[0266] Soybean seed for 3560.4.3.5 soybean and unmodified control
seed were planted to produce sufficient numbers of plants for DNA
analysis. For characterization of 3560.4.3.5 soybean line, eight T5
seeds were planted. Eight seeds were planted for control soybean
line as well. One seed was planted per pot, and the pot was
uniquely identified. Planting and growing conditions were conducive
to healthy plant growth including regulated light and water.
[0267] Leaf samples were collected for each of the control and
3560.4.3.5 soybean plants. For each sample, sufficient leaf
material from above the growing point was collected and placed in a
pre-labeled sample bag. The samples were placed on dry ice and were
transferred to an ultra low freezer following collection. All
samples were maintained frozen until processing.
[0268] Frozen leaf samples (1-2 gram quantities) were ground, and
the genomic DNA was isolated using a modified Urea Extraction
Buffer procedure (Chen et al. (1994) Urea-based plant DNA miniprep
in Freeling M. and Walbot V., eds, The Maize Handbook,
Springer-Verlag, New York, p 526-527). Genomic DNA was extracted
from leaf tissue harvested from individual plants as described
above. Specifically, the tissue was pulverized in tubes containing
grinding beads using a Geno/Grinder.TM. (SPEX CertiPrep, Inc.,
Metuchen, N.J.) instrument and the genomic DNA isolated using a
standard procedure. Approximately 1 gram ground tissue was
extracted with 5 mL Urea Extraction Buffer (7 M Urea, 0.34 M NaCl,
0.05 M Tris-HCl, pH 8.0, 0.02 M EDTA, 1% N-Lauroylsarcosine) for
12-30 minutes at 37.degree. C., followed by two extractions with
phenol/chloroform/isoamyl alcohol (25:24:1) and one extraction with
water saturated chloroform. The DNA was precipitated from the
aqueous phase by the addition of 1/10 volume of 3 M NaOAc (pH 5.2)
and 1 volume of isopropyl alcohol, followed by centrifugation to
pellet the DNA. After washing the pellet twice with 70% ethanol,
the DNA was dissolved in 0.5 mL TE buffer (10 mM Tris, 1 mM EDTA,
pH 7.5) and treated with 10 .mu.g Ribonuclease A for 15 minutes at
37.degree. C. The sample was extracted once with
phenol:chloroform:isoamyl alcohol (25:24:1) and once with water
saturated chloroform, followed by precipitation with isopropyl
alcohol and washing with 70% ethanol. After drying, the DNA was
re-dissolved with 0.5 mL TE buffer and stored at 4.degree. C.
Following extraction, the DNA was visualized on an agarose gel to
determine the DNA quality, and was quantified using Pico Green.RTM.
reagent (Molecular Probes, Inc., Eugene, Oreg.) and
spectrofluorometric analysis.
[0269] Phenotypic analysis of 3560.4.3.5 soybean plants and control
plants was carried out by western blot analysis using antibodies to
the GLYAT4601 protein to confirm the absence or presence of the
GLYAT4601 protein in material used for Southern blot analysis and
sequence characterization. Total protein was extracted by grinding
several leaf punches to homogeneity in 150 .mu.l of protein
extraction buffer (50 mM Tris-HCl (pH 7.5), 0.1% SDS, and 10 mM
.beta.-mercaptoethanol). An aliquot of each crude extract was mixed
with LDS Sample Buffer and reducing agent (Invitrogen) and heated
to approximately 95.degree. C. for 5 minutes. Proteins were
separated by size under denaturing conditions through a NuPAGE.TM.
Bis/Tris Gel system as described (Invitrogen). Selected molecular
weight standards were used to determine sufficient migration in the
gel and for molecular weight determination on the western blot
(Invitrogen). The Bis/Tris gel was transferred to a nitrocellulose
membrane using the method as described for the Novex.TM. XCell
II.TM. Blot Module Western Transfer (Invitrogen). Alternatively,
gels were stained with SimplyBlue.TM. SafeStain (Invitrogen) to
visualize the proteins to verify equivalent sample loading.
[0270] The GLYAT4601 protein band was detected using the
WesternBreeze.RTM. Chemiluminescent Western Blot Immunodetection
Kit as described (Invitrogen). Primary monoclonal antibodies
specific for the GLYAT4601 protein were used with the
WesternBreeze.RTM. Kit. Bands were then visualized using a
chemiluminescent substrate. Blots were exposed to X-ray film for
one or more time points to detect protein bands. Purified GLYAT4601
protein was used as a positive control on the western blots. Plants
were scored as positive for GLYAT4601 when a band of the
appropriate size was present and scored as negative when the band
was absent on the western blots.
[0271] A preliminary Southern blot analysis of DNA isolated from
all 3560.4.3.5 soybean plants was used to verify the presence of
both the glyat4601 and gin-hra genes. Methods for this preliminary
characterization are described below. Final Southern blot analysis
was carried out on a subset of 3560.4.3.5 soybean plants (data not
shown).
[0272] Genomic DNA samples extracted from selected 3560.4.3.5
soybean and control soybean plants were digested with restriction
enzymes following a standard procedure. Approximately 2 .mu.g of
genomic DNA was digested in a volume of 100 .mu.L using 50 units of
enzyme according to manufacturer's recommendations. The digestions
were carried out at 37.degree. C. for three hours, followed by
ethanol precipitation with 1/10 volume of 3 M NaOAc (pH 5.2) and 2
volumes of 100% ethanol. After incubation at 4.degree. C. and
centrifugation, the DNA was allowed to dry and re-dissolved in TE
buffer. The reference plasmid, PHP20163, was spiked into a control
plant DNA sample in an amount equivalent to approximately one or
three gene copies per soybean genome and digested with the same
enzyme to serve as a positive control for probe hybridization and
to verify sizes of internal fragments on the Southern blot.
[0273] Following restriction enzyme digestion, the DNA fragments
produced were electrophoretically separated by size through an
agarose gel and a molecular weight standard .PHI.X174 RF DNA/Hae
III Fragments (Invitrogen) was used to determine sufficient
migration and separation of the fragments on the gel. DIG labeled
DNA Molecular Weight Marker VII (Roche), visible after DIG
detection as described below, was used to determine hybridizing
fragment size on the Southern blots.
[0274] Agarose gels containing the separated DNA fragments were
depurinated, denatured, and neutralized in situ, and transferred to
a nylon membrane in 20.times.SSC buffer (3M NaCl, 0.3 M Sodium
Citrate) using the method as described for the TURBOBLOTTER.TM.
Rapid Downward Transfer System (Schleicher & Schuell, Keene,
N.H.). Following transfer to the membrane, the DNA was bound to the
membrane by UV crosslinking (Stratalinker, Stratagene, La Jolla,
Calif.). Probes for the SCP1 promoter, glyat4601, pinII terminator,
SAMS, gm-hra, and als terminator were used to detect genes and
elements within the insertion (Table 3). Backbone and hygromycin
resistance gene cassette regions (backbone 20163 and hyg20163
probes) of the PHP20163 plasmid were used to verify absence of
plasmid backbone DNA in 3560.4.3.5 soybean (Table 3). DNA fragments
of the probe elements were generated by PCR from plasmid PHP20163
(FIG. 1) or a plasmid with equivalent elements using specific
primers. PCR fragments were electrophoretically separated on an
agarose gel, excised and purified using a gel purification kit
(Qiagen, Valencia, Calif.). DNA probes were generated from these
fragments by PCR that incorporated a DIG labeled nucleotide,
[DIG-11]-dUTP, into the fragment. PCR labeling of isolated
fragments was carried out according to the procedures supplied in
the PCR DIG Probe Synthesis Kit (Roche).
TABLE-US-00003 TABLE 3 Description of DNA Probes Used for Southern
Blot Hybridization Position on Position on Figure PHP20163A
PHP20163 Length Probe Name Genetic Element Probe (bp to bp) (bp to
bp) (bp) SCP1 promoter SCP1 promoter FIG. 6 12 to 479 12 to 479 486
probe 1 (SEQ ID NO: 29) glyat4601 glyat4601 gene FIG. 6 597 to 1012
597 to 1012 416 probe 2 (SEQ ID NO: 30) pinII terminator pinII
terminator FIG. 6 1107 to 1340 1107 to 1340 234 probe 3 (SEQ ID NO:
31) SAMS.sup.1 SAMS promoter and FIG. 6 1702 to 2146 1702 to 2146
445 intron elements probe 4 (SEQ ID NO: 32) 2147 to 2638 2147 to
2638 492 (SEQ ID NO: 33) gm-hra.sup.1 gm-hra gene FIG. 6 2700 to
3629 2700 to 3629 930 probe 5 (SEQ ID NO: 34) 3635 to 4664 3635 to
4664 1030 (SEQ ID NO: 35) gm-als gm-als terminator FIG. 6 4670 to
5318 4670 to 5318 649 terminator probe 6 (SEQ ID NO: 36) backbone
plasmid backbone of FIG. 7 N/A.sup.2 7427-7954 528 20163.sup.1
PHP20163 probe A 6665-7416 752 hyg 20163.sup.1 hygromycin
resistance FIG. 7 N/A 6097-6619 523 gene of PHP20163 probe B
5389-6091 703 .sup.1Two non-overlapping segments were generated for
this probe and were combined for hybridization. .sup.2Not
Applicable; these are not present on the PHP20163A fragment.
[0275] Genomic DNA isolated from 3560.4.3.5 soybean plants was
digested with Hind III and Xba I, and electrophoretically
separated, transferred to nylon membranes, and hybridized to the
glyat4601 and gm-hra gene probes. Labeled probes were hybridized to
the target DNA on nylon membranes for detection of the specific
fragments using the procedures essentially as described for DIG
Easy Hyb solution (Roche). After stringent washes, the hybridized
DIG-labeled probes and DIG-labeled DNA standards were visualized
using CDP-Star Chemiluminescent Nucleic Acid Detection System with
DIG Wash and Block Buffer Set (Roche). Blots were exposed to X-ray
film for one or more time points to detect hybridizing fragments
and to visualize molecular weight standards. Images were then
digitally captured by detection with the Luminescent Image Analyzer
LAS-3000 (Fujifilm Medical Systems, Stamford, Conn.). The sizes of
detected bands were documented for each digest and each probe.
[0276] Following hybridization and detection, membranes were
stripped of DIG-labeled probe to prepare the blot for subsequent
re-hybridization to additional probes. Membranes were rinsed
briefly in distilled, de-ionized water and then stripped in a
solution of 0.2 M
[0277] NaOH and 1.0% SDS at 40.degree. C. with constant shaking.
The membranes were then rinsed in 2.times.SSC and either used
directly for subsequent hybridizations or stored at 4.degree. C. or
-20.degree. C. for later use. The alkali-based stripping procedure
effectively removes probes labeled with the alkali-labile DIG. This
preliminary Southern blot analysis showed the presence of the
insertion in 3560.4.3.5 soybean plants and confirmed that
3560.4.3.5 soybean plants used for this study contained the same
insertion (Table 4).
TABLE-US-00004 TABLE 4 Summary of Preliminary Southern Screen Data
for 3560.4.3.5 Soybean Line. Southern Blot Southern Blot Plant ID
Sample ID glyat4601 Probe.sup.2 gm-hra Probe.sup.2 T-F-05-140S-17
T-17 + + T-F-05-140S-18 T-18 + + T-F-05-140S-19 T-19 + +
T-F-05-140S-20 T-20 + + T-F-05-140S-21 T-21 + + T-F-05-140S-22 T-22
+ + T-F-05-140S-23 T-23 + + T-F-05-140S-24 T-24 + + + indicates
hybridization signal on Southern blot.
[0278] Four plants were chosen for insert and border sequence
analysis: 3560.4.3.5 soybean plants T17 and T18, and control plants
C1 and C2. PCR primers were synthesized by Sigma-Genosys, Inc. (The
Woodlands, Tex.) and MWG (Ebersberg, Germany), and used at
concentrations of 0.3-0.4 uM. For amplification of the PHP20163A
insert region, both the Advantage-GC-2 PCR system (Clontech) and
the Expand Long Template PCR System (Roche) were used to amplify
genomic DNA (100-500 ng); and for the 5' and 3' flanking genomic
border PCR, the Advantage-GC-2 PCR system was used to amplify from
genomic DNA (100 ng). The PCR products were visualized under UV
light following electrophoresis through a 1% agarose gel with
1.times.TAE and ethidium bromide; excised, and purified from the
gel using Qiaquick gel purification kit (Qiagen, Valencia,
Calif.).
[0279] The PCR products were cloned using the TOPO TA-cloning Kit
(pCR2.1-TOPO vector, Invitrogen, Carlsbad, Calif.). Plasmids were
isolated using QIAprep Spin Miniprep Kit (Qiagen), screened by
restriction enzyme digestions, and sequenced.
[0280] For complete sequence coverage of the cloned PCR products
representing the insert of the 3560.4.3.5 soybean, the clones were
sequenced by a transposon-based sub-cloning method to facilitate
bi-directional sequencing of a cloned insert from the site of the
transposition event (MJ Research TGS system; Happa et al. (1999)
Nucleic Acid Research 27:2777-2784. Since unintended mutations can
occur during the generation of the PCR products, we cloned and
sequenced products from two separate PCR reactions with T17 and T18
DNA. In all cases, any PCR-induced sequence error was present in
only one of the four clones, allowing reliable consensus calls to
be made on every base of the sequence.
[0281] Initial sequence characterization of the 5' flanking border
was carried out using the BD GenomeWalker Universal Kit (Clontech,
Mountain View, Calif.). The GenomeWalker protocol involves
digesting the genomic DNA with various restriction enzymes and
ligating these digests with an adaptor, thereby creating
"libraries" to be used as template for two rounds of PCR. The PCR
primers for the 2 rounds of PCR consisted of an insert-specific
(SCP1 promoter) primer, and an adaptor-specific primer. Based on
sequence information generated from the Genome Walker experiments,
primers were designed to perform PCR on genomic DNA from 3560.4.3.5
and control soybean plants, using primers that spanned the 5'
junction. (FIG. 3 and data not shown). To extend the 5' border
sequence further, we used the DNA Walking SpeedUp Kit (Seegene,
Inc. Rockville, Md.) was used, which is another PCR-based genomic
DNA walking approach based on the DNA Walking Annealing Control
Primer PCR Technology (Ochman et al. (1988) Genetics 120:621;
Silver et al. (1989) Journal of Virology 63:1924; Triglia et al.
(1988) NAR 16:8186). The last round of border extension was
performed by anchoring within the 5'-most end of the border and
again using the Genome Walker kit. The final 5' flanking border
sequence was verified by cloning and sequencing of 5' flanking
genomic border PCR products. In order to demonstrate that the
identified 5' flanking genomic border sequence is of soybean
origin, PCR was performed within this 5' flanking genomic region on
genomic DNA from 3560.4.3.5 soybean and control soybean plants
(FIG. 3 and data not shown).
[0282] Initial sequence characterization of the 3' flanking border
was carried out using inverse PCR (Silver et al. (1989) Journal of
Virology 63:1924; Ochman et al. (1988) Genetics 120:621; Triglia et
al. (1988) NAR 16:8186), with insert-specific primers anchored in
the glyat4601 and gm-hra genes. Sequence obtained from products
generated using inverse PCR was then used to design primers for PCR
on genomic DNA from 3560.4.3.5 and control soybean plants, using
primers that spanned the 3' junction. (FIG. 3 and data not shown).
The 3' flanking genomic border sequence was verified by cloning and
sequencing the 3' flanking genomic border PCR products. The genomic
flanking border was extended further using the sequence information
from proprietary soybean sequence that matched this flanking border
to design PCR primers. Cloning and sequencing the resulting PCR
products confirmed this additional flanking border sequence. In
order to demonstrate that the identified 3' flanking genomic border
sequences were of soybean origin, PCR was performed within this 3'
genomic region on DNA from 3560.4.3.5 soybean and control soybean
plants (FIG. 3 and data not shown).
[0283] For verification of the DNA sequence that inserted into the
soybean genome, PCR was performed to amplify, clone, and sequence
the inserted DNA from 3560.4.3.5 soybean. PCR primers just outside
the insert (primer pair 1297/1298) were used to amplify the entire
insert from DNA of 3560.4.3.5 soybean plants. This amplification
produced products of the expected size (5.4 kb) from two separate
reactions from each of two test samples; these were cloned and
sequenced. In addition, the DNA fragment PHP20163A used for
creating 3560.4.3.5 soybean line was sequenced, and compared with
the insert sequence generated from 3560.4.3.5 soybean genomic
DNA.
[0284] Both the 5' and 3' flanking border sequences of the
3560.4.3.5 soybean were subjected to BLASTn analysis in order to
identify the nature and potential function of the flanking
sequences in the soybean genome. The searches were performed
against the NCBI Genbank Nucleotide ("nt") dataset
(www.ncbi.nlm.nih.gov/), Release 154, last updated Jul. 31, 2006,
U.S. Pat. No. 4,302,011 total sequences), as well as to Genome
Survey Sequence dataset (GSS, Release Jul. 28, 2006). Finally,
sequences were compared to a dataset consisting of all proprietary
soybean genomic and EST sequences generated by Pioneer. Default
parameters were used in all cases. Both 5' and 3' border/insert
junctions were also screened for the presence of novel open reading
frames (ORFs).gtoreq.100 amino acids (300 bp) in length using
Vector NTI 9.1 (Invitrogen, Carlsbad, Calif.).
[0285] DNA isolated from eight 3560.4.3.5 soybean plants was
digested with Xba I and Hind III, and hybridized to gm-hra and
glyat4601 gene probes to verify the presence of the insertion and
to verify the molecular equivalence of the insertion among all 8
plants analyzed. The preliminary Southern blot screen indicated
that 3560.4.3.5 soybean plants exhibited identical hybridization
patterns (Table 4 and data not shown). In the Xba I digests, the
glyat4601 probe hybridized to a 1.4 kb band and the gm-hra probe
hybridized to a 3.9 kb band as expected (FIG. 2), demonstrating the
intact insertion of PHP20163A. In the Hind III digests, the
glyat4601 probe hybridized to a 5' flanking 6.1 kb band, the gm-hra
probe hybridized to 3' flanking 7.4 kb band, and an internal 2.4 kb
band, demonstrating that the insertion exists as a single copy in
the genome (FIG. 2). The gm-hra probe also hybridizes to other
bands corresponding to endogenous sequences. Four plants were
chosen for insert and border sequence analysis: 3560.4.3.5 soybean
plants T17 and T18, and control Jack plants C1 and C2.
[0286] In the initial characterization of the 3560.4.3.5 soybean
line, the flanking genomic border regions were cloned and sequenced
using the GenomeWalker and inverse PCR methods. This preliminary
sequence information was used to design primers for PCR to generate
products in the three regions of interest from 3560.4.3.5 soybean
genomic DNA: 5' flanking border, entire insert, and 3' flanking
border (Table 11, Table 4; Table 10; and, FIG. 3). Using
information from the flanking border sequence, PCR was performed on
3560.4.3.5 soybean genomic DNA and unmodified control genomic
DNA.
[0287] For the 5' flanking sequence, PCR was performed with a
forward primer in the 5' border (primer 1679) and a reverse primer
in the SCP1 Promoter (primer 1658), resulting in the expected
products in 3560.4.3.5 soybean plants (396 bp), and not in the
control DNAs (FIG. 3 and data not shown). Following two more rounds
of walking (with the DNA Walking SpeedUp and GenomeWalker Kits),
additional 5' flanking border sequence was obtained. To verify the
5' flanking border sequence, PCR products were generated from
3560.4.3.5 DNA, cloned and sequenced. The complete sequence
information is presented in FIG. 4A-E.
[0288] For the 3' flanking sequence, PCR was performed with a
forward primer in the gm-hra (primer 1439) and a reverse primer in
the 3' border sequence (primer 1666), resulting in the expected
products in 3560.4.3.5 soybean plants (1029 bp) and not the control
DNAs (FIG. 3 and data not shown). The 3' flanking border PCR
products were generated from 3560.4.3.5 soybean DNA, cloned and
sequenced. This sequence showed the same identity to a proprietary
soybean DNA sequence, which was used to design primers to further
extend the flanking border. Again, the resulting 3' flanking border
PCR products generated from 3560.4.3.5 soybean DNA were cloned and
sequenced. The complete sequence information is presented in FIG.
4A-E.
[0289] For amplification of the insert, PCR primers situated in
each flanking region were used to amplify the entire insert from
DNA of event 3560.4.3.5 plants (primer pair: 1297/1298). As
expected, the predicted PCR products of 5.5 kb were generated only
from 3560.4.3.5 soybean DNA, and not from the control DNA. The
insert PCR products were cloned and sequenced. The sequence
information is presented in FIG. 4A-E.
[0290] In addition, the DNA fragment PHP20163A used for creating
3560.4.3.5 soybean line was sequenced, and compared with the insert
sequence generated from 3560.4.3.5 soybean genomic DNA. The
sequence of the insert in 3560.4.3.5 soybean is identical to the
sequence of the PHP20163A DNA fragment.
[0291] In total, 10849 bp of sequence from genomic DNA of
3560.4.3.5 soybean was confirmed: 3317 bp of the 5' flanking
genomic border, 2170 bp of the 3' flanking genomic border, and the
5362 bp comprising the inserted DNA (FIG. 3 and FIG. 4A-E).
[0292] To demonstrate that the identified 5' and 3' flanking border
sequences are of soybean origin, PCR was performed within the 5'
and 3' flanking genomic regions (primer pairs 1679/1514 and
1660/1666, respectively) from 3560.4.3.5 soybean DNA samples and
unmodified control samples. The expected size PCR products (246 bp
for 5' genomic region and 297 bp for 3' genomic region) were
generated using genomic DNA from both 3560.4.3.5 soybean and
control soybean plants, indicating that the sequences were of
soybean genomic origin and not specific to 3560.4.3.5 soybean (FIG.
3 and data not data shown). These PCR products from both the
3560.4.3.5 and control soybean DNAs were cloned and sequenced and
shown to have identical sequence.
[0293] When the 3317 bp sequence from the 5' flanking region of
3560.4.3.5 soybean was compared to the Genbank Nucleotide ("nt")
dataset (www.ncbi.nlm.nih.gov/), no significant alignments were
returned. Analysis using the GSS subset returned a two areas of the
flanking region (nt 2723-2863; 2881-3203) with significant
similarity (98% and 92%, respectively) to genomic sequences from
the legume Medicago truncatula (barrel medic). The BLASTn search
against Pioneer proprietary soybean genomic and EST sequences
returned a 98% identity alignment encompassing nt 2860-3317 to a
single soybean genomic sequence. An additional region (nt 531-2144)
returned lower, yet significant identities (84%-92%) to several
different soybean genomic clones. The 3' flanking sequence produced
two highly significant alignments (97-99% identity) to two
different public soybean genomic sequences (accessions CL868338.1
and CL867466.1) and a single proprietary genomic sequence in the
region from nt 9772-10849. An additional region (nt 9250-9554)
displayed significant identity (92-94%) to wheat genomic and
mitochondrial sequences. The 5' and 3' junction regions between the
soybean genomic border sequence and the insertion in 3560.4.3.5
soybean were analyzed for the presence of novel open reading
frames. No open reading frames greater than or equal to 100 amino
acids were identified in the 5' or 3' border junction regions,
indicating that no novel open reading frames were generated as a
result of the insertion.
[0294] Southern blot analysis also confirmed that the DNA insertion
remained stable during traditional soybean breeding procedures. The
analysis was conducted on two self-crossed generations, T4 and T5,
and verified that the insertion remained intact and stably
integrated as demonstrated by identical hybridization patterns in
the two generations. The F3 generation was also analyzed by
Southern blot analysis and confirmed the same stable,
event-specific hybridization pattern as exhibited by the T4 and T5
generations. These results confirmed the stability of the insertion
in 3560.4.3.5 soybean across multiple breeding generations.
[0295] As discussed below, the Bgl II restriction enzyme has a
single site (bp position 2254) located within the PHP20163A
fragment (FIG. 6) and will generate a unique event-specific
hybridization pattern for 3560.4.3.5 soybean when hybridized to the
glyat4601 and gm-hra probes. This analysis confirms event stability
across generations as changes to the insertion structure in
3560.4.3.5 soybean would be detected. As discussed below, a band of
approximately 2500 bp would be expected with the glyat4601 probe to
confirm stability across generations (Table 5). Likewise, for the
gm-hra probe, a band of approximately 3500 bp would be expected to
confirm stability across generations (Table 6).
TABLE-US-00005 TABLE 5 Predicted and Observed Hybridizing Bands on
Southern Blots with glyat4601 Cassette Probes Observed Predicted
Predicted Fragment Fragment Fragment Size in Size from Size from
GLYAT Restriction PHP20163A.sup.1 PHP20163.sup.2 3560.4.3.5 Probe
Enzyme (bp) (bp) soybean.sup.3 (bp) SCP1 Bgl II >2300.sup.4.sup.
3485 ~2500 promoter glyat4601 Bgl II >2300.sup.4.sup. 3485 ~2500
pinII Bgl II >2300.sup.4.sup. 3485 ~2500 terminator SCP1 Xba I
1379 .sup. 1379.sup.5 1379.sup.6 promoter glyat4601 Xba I 1379
.sup. 1379.sup.5 1379.sup.6 pinII Xba I 1379 .sup. 1379.sup.5
1379.sup.6 terminator .sup.1Predicted fragment sizes for 3560.4.3.5
soybean are based on the map of PHP20163A as shown in FIG. 6.
.sup.2Predicted fragment sizes for hybridization to samples
containing the plasmid positive control are based on the PHP20163
plasmid map as shown in FIG. 7. .sup.3Observed fragment sizes are
considered approximate from these analyses and are based on the
indicated sizes of the DIG-labeled DNA Molecular Weight Marker VII
fragments on the Southern blots. Due to incorporation of DIG
molecules for visualization, the marker fragments typically run
approximately 5-10% larger than their actual indicated molecular
weight. .sup.4Minimum fragment size predicted based on an intact
insertion of PHP20163A (data not shown). .sup.5Predicted
hybridizing Xba I fragment size from plasmid PHP20163 grown in a
Dam.sup.- strain. For plasmid grown in a Dam.sup.+ strain, the
hybridizing Xba I fragment size is predicted to be 5307 bp.
.sup.6Observed fragment is equal to the predicted size based on
blot (data not shown) showing comparison to plasmid PHP20163 grown
in a Dam.sup.- strain.
TABLE-US-00006 TABLE 6 Predicted and Observed Hybridizing Bands on
Southern Blots with gm-hra Cassette Probes ##STR00006## An asterisk
(*) and gray shading indicates the designated band is due to probe
hybridization to endogenous soybean genome sequences, as can be
determined by the presence of the same band in all lanes, both
3560.4.3.5 soybean and control. .sup.1Predicted fragment sizes for
3560.4.3.5 soybean are based on the map of PHP20163A as shown in
FIG. 6. .sup.2Predicted fragment sizes for hybridization in samples
containing the plasmid positive control are based on the PHP20163
plasmid map as shown in FIG. 7. .sup.3Observed fragment sizes are
considered approximate from these analyses and are based on the
indicated sizes of the DIG-labeled DNA Molecular Weight Marker VII
fragments on the Southern blots. Due to incorporation of DIG
molecules for visualization, the marker fragments typically run
approximately 5-10% larger than their actual indicated molecular
weight. .sup.4Minimum fragment size predicted based on an intact
insertion of PHP20163A (data not shown). .sup.5Predicted
hybridizing Xba I fragment size from plasmid PHP20163 grown in a
Dam.sup.- strain. For plasmid grown in a Dam.sup.+ strain, the
hybridizing Xba I fragment size is predicted to be 5307 bp.
.sup.6Observed fragment is equal to the predicted size based on
blot (data not shown) showing comparison to plasmid PHP20163 grown
in a Dam.sup.- strain.
[0296] Genomic DNA of T4 and T5 generations of 3560.4.3.5 soybean
was digested with Bgl II and hybridized to the glyat4601 and gm-hra
probes to confirm stability across generations (data not shown). A
band of approximately 2500 bp specific to 3560.4.3.5 soybean
hybridized to the glyat4601 probe in both the T4 and T5 generations
(Table 5 and data not shown). With the gm-hra probe, a single band
of approximately 3500 bp specific to 3560.4.3.5 soybean was present
in both generations (Table 6 and data not shown). In addition to
the 3500 bp band, the gm-hra probe also hybridized to additional
bands that were determined to be endogenous to the soybean genome
since these bands were present in both 3560.4.3.5 soybean and
control soybean plants (data not shown). Hybridization results from
both the glyat4601 and gm-hra probes confirmed that the insertion
of the PHP20163A DNA fragment in 3560.4.3.5 soybean remained stable
across the self-crossed T4 and T5 generations.
[0297] Southern blot analysis of the F3 generation of 3560.4.3.5
soybean was also conducted. A total of 77 individual plants were
analyzed (data not shown). Genomic DNA of the F3 generation was
digested with Bgl II and hybridized to the glyat4601 and gm-hra
probes. A band of approximately 2500 bp was observed with the
glyat4601 probe (data not shown) and a single band of approximately
3500 bp specific to 3560.4.3.5 soybean was observed with the gm-hra
probe (data not shown). As with the previous analysis conducted,
the gm-hra probe hybridized to additional bands in 3560.4.3.5
soybean and control samples which were due to endogenous sequences
within the soybean genome (data not shown). Hybridizations results
from both the glyat4601 and gm-hra probes were consistent with the
results from the T4 and T5 generations described above and
confirmed the stability of inheritance of the insertion during
traditional soybean breeding.
[0298] Both the T4 and T5 generations were analyzed to confirm the
absence of plasmid sequence from plasmid PHP20163 outside of the
transformation fragment PHP20163A, i.e. the plasmid backbone
sequence removed prior to transformation. The results verified the
absence of backbone sequences in 3560.4.3.5 soybean.
[0299] The backbone 20163 and hyg 20163 probes (Table 3 and FIG. 7)
were designed to hybridize to areas of plasmid PHP20163 outside of
the transformation fragment (data not shown) and were hybridized to
Xba I-digested genomic DNA to confirm absence of these sections of
the plasmid in 3560.4.3.5 soybean. Neither of the two backbone
probes hybridized to 3560.4.3.5 soybean samples (data not shown),
confirming the absence of these sequences.
[0300] Genomic DNA from leaf material of the Jack soybean variety
was used as a negative control for all Southern blot analyses.
Genomic DNA from an elite soybean variety (Elite 1) was included as
an additional negative control for analysis of the F3 generation.
Plasmid PHP20163 was used as a positive control for probe
hybridization and to verify fragment sizes internal to the
transformation fragment PHP20163A. All probes used for the analysis
are indicated on the schematic maps of PHP20163A and PHP20163
(FIGS. 6 and 7, respectively) and outlined in Table 3.
[0301] The integration pattern of the insertion in 3560.4.3.5
soybean was investigated with Bgl II digestion to determine copy
number and with Xba I digestion to determine insertion integrity.
Southern blots were hybridized to several probes to confirm copy
number and integrity of each genetic element. SCP1 promoter,
glyat4601, and pinII terminator probes were used to characterize
the glyat4601 cassette (Table 3 data not shown). SAMS, gm-hra, and
als terminator probes were used to characterize the gm-hra cassette
(Table 3 and data not shown).
[0302] The Bgl II digest provides information about number of
copies integrated into the genome of 3560.4.3.5 soybean as there is
a single restriction enzyme site in the PHP20163A fragment at base
pair (bp) position 2254 (data not shown) and additional sites
outside the fragment in the soybean genome. Hybridization with the
probes from each cassette, except for the SAMS probe, would
indicate the number of copies of each element found in 3560.4.3.5
soybean based on the number of hybridizing bands (e.g. one
hybridizing band indicates one copy of the element). For the SAMS
probe, since the Bgl II site is located within the probe region,
two hybridizing bands would be expected for every one copy of the
element. Predicted and observed fragment sizes for 3560.4.3.5
soybean with Bgl II are given in Table 5 for the glyat4601 cassette
and in Table 6 for the gm-hra cassette.
[0303] Based on the Southern blot analyses as discussed below, it
was determined that a single, intact PHP20163A fragment has been
inserted into the genome of 3560.4.3.5 soybean as diagramed in the
insertion map (FIG. 8).
[0304] A single copy of all the elements of the glyat4601 cassette
was inserted into 3560.4.3.5 soybean. SCP1 promoter, glyat4601, and
pinII terminator probes were hybridized to Bgl II-digested genomic
DNA from individual 3560.4.3.5 soybean plants of the T4 generation
(Table 5 and data not shown). Each of the probes hybridized to the
same single fragment of approximately 2500 base pairs (bp) (Table 5
and data not shown), indicating the expected arrangement of genetic
elements on the fragment inserted in 3560.4.3.5 soybean.
[0305] Likewise, a single copy of all the elements of the gm-hra
cassette was inserted into 3560.4.3.5 soybean. The elements
comprising this cassette--the SAMS promoter region, gm-hra gene,
and als terminator--were used as probes to determine number of
copies inserted. The probes of this cassette are homologous to
elements endogenous to the soybean genome and therefore each probe
hybridized to bands in control soybean samples. The hybridizing
bands in 3560.4.3.5 soybean from the endogenous soybean genome are
indicated by asterisks in the shaded boxes of Table 6 and were
determined by their presence in control soybean samples and are
thus not associated with the insertion.
[0306] The SAMS probe hybridized to one band of approximately 2500
bp and a second band of approximately 3500 bp in 3560.4.3.5 soybean
(Table 6 and data not shown, SAMS probe). Two bands would be
expected to indicate one insertion of this element with this probe
as the Bgl II site is located within the SAMS region of PHP20163A
(FIG. 6) and the results indicated one copy of the element. The
2500 bp fragment was determined to be the same fragment containing
the glyat4601 cassette as described above.
[0307] The gm-hra and als terminator probes hybridized to the same
3500 bp fragment as the SAMS probe (Table 6 and data not shown,
gm-hra and gm-als terminator probes). The hybridization of all
three probes to the same 3500 bp fragment and of the SAMS probe to
the 2500 bp fragment confirmed the expected arrangement of the
genetic elements in the DNA insertion in 3560.4.3.5 soybean.
[0308] Xba I digestion was used to verify that the glyat4601 and
gm-hra cassettes were complete and intact in 3560.4.3.5 soybean as
there are three sites in the PHP20163A fragment (base pair
positions 8, 1387, and 5315) which precisely flank each gene
expression cassette (FIG. 6). Hybridization with the probes of the
glyat4601 and gm-hra cassettes confirmed that all the elements were
found on the appropriate internal fragments containing the
cassette. Expected and observed fragment sizes with Xba I are given
in Table 6 for the glyat4601 cassette and Table 6 for the gm-hra
cassette.
[0309] The SCP1 promoter, glyat4601, and pinII terminator probes
each hybridized to the expected internal band of 1378 bp (Table 5
and data not shown) and the size was confirmed by additional
hybridizations as described in the section below and data not
shown. Because these probes hybridized to the same internal
fragment of the predicted size, the glyat4601 cassette in
3560.4.3.5 soybean was determined to be intact and all elements of
the cassette were confirmed on this fragment.
[0310] The SAMS, gm-hra, and als terminator probes each hybridized
to the expected internal band of 3927 bp band (Table 6 and data not
shown) and the size was confirmed by additional hybridization
described in the section below. Because these probes hybridized to
the same fragment, the gm-hra cassette in 3560.4.3.5 soybean was
determined to be intact and all elements were present.
[0311] Plasmid PHP20163 was prepared from a strain of E. coli that
expresses a DNA methylase (a Dam.sup.+ strain). This plasmid did
not produce the expected bands when digested with Xba I and probed
with the glyat4601 and gm-hra cassette probes. A band of
approximately 5300 bp was observed in lanes containing plasmid
PHP20163 for all probes (data not shown) instead of the predicted
1379 bp and 3928 bp size bands (Tables 5 and 6). Based on the
plasmid sequence, it was determined that the Xba I site at by
position 1387 of PHP20163 (FIG. 7) overlaps a Dam methylation
recognition sequence. The final adenine in this site is methylated,
thus blocking digestion by Xba I.
[0312] The inability for Xba I enzyme to cut at this site affected
the size prediction from fragment PHP20163A in 3560.4, 3.5 soybean
(Tables 5 and 6, FIG. 6). In order to confirm the size in
3560.4.3.5 soybean and the plasmid result, plasmid PHP20163 was
prepared from a strain of E. coli lacking Dam methylase (Dam.sup.-
strain) and was compared to the plasmid PHP20163 (data not shown).
Southern hybridization results (data not shown) show the plasmid
comparison alongside samples of the T4 and T5 generations of
3560.4.3.5 soybean digested with Xba I. The blot probed with
glyat4601 and gm-hra probes demonstrated that plasmid PHP20163
prepared from the Dam.sup.- strain digested as expected by Xba I
and produced the predicted size bands of 1379 bp and 3927 bp (data
not shown), while the original plasmid from the Dam.sup.+ strain
again produced a band of approximately 5300 bp for both probes
(data not shown). These results confirmed that the central Xba I
site at position 1387 was blocked from digestion due to Dam
methylation. Furthermore, the hybridizing bands in 3560.4.3.5
soybean were of the equivalent size as those in the unmethylated
plasmid PHP20163 from the Dam.sup.- strain confirming that
3560.4.3.5 soybean contained a complete and intact insertion (data
not shown).
[0313] A Chi squared analysis of trait inheritance data from five
different generations (T1, F2, F3, BC1F2, C2F2) was performed to
determine the Mendelian heritability and stability of the glyat4601
and gm-hra genes in the progeny of 3560.4.3.5 soybean. The breeding
history of the five generations evaluated for Mendelian inheritance
is described in FIG. 5. For each of the generations tested, the
plants were expected to segregate 1:2:1 (homozygous positive
plants:hemizygous plants:homozygous negative [null] plants).
Various approaches, as outlined below, were used to confirm this
segregation ratio in the progeny of 3560.4.3.5 soybean.
[0314] In some studies, homozygous positive plants were not
differentiated from hemizygous plants, resulting in a 3:1
positive:negative segregation pattern (Table 7). For the three
generations listed in Table 7, three different methods,
respectively, were used to score the plants as positive or
negative: [0315] qualitative PCR analysis to identify the plants
containing the glyat4601 gene (T1 generation); or [0316] western
analysis to score plants for GLYAT4601 protein expression followed
by confirmation of those same plants by Southern analysis with both
glyat4601 and gm-hra probes (F3 generation), or [0317] an ALS seed
soak assay (BC1F2 generation). In this assay, seeds are soaked in
an ALS-inhibiting herbicide containing the active ingredient
chlorsulfuron. Only seed expressing the gm-hra gene will emerge
after planting.
[0318] In certain studies, plants that did not contain either the
glyat4601 or gm-hra genes were removed from the study prior to the
conduct of segregation analysis. Remaining plants were then scored
as homozygous positive or hemizygous, resulting in a 1:2 homozygous
positive:hemizygous segregation pattern (Table 8).
[0319] For the F2 generation listed in Table 8, two methods were
used to remove the negative plants and score the remaining plants
as homozygous positive or hemizygous: [0320] A glyphosate spray was
applied after the plants had emerged, removing all of the
homozygous negative (null) plants. This was followed by an
ALS-inhibiting herbicide "ragdoll" assay for the gm-hra gene, where
progeny seed from the F2 plants were screened to determine the F2
parent plant genotype. In the ragdoll assay, paper towels were
wetted with an ALS-inhibiting herbicide containing the active
ingredient chlorsulfuron. Ten progeny seeds from a single F2 parent
plant were rolled into the wetted towel and allowed to germinate.
An F2 parent plant was scored as homozygous positive for the gm-hra
gene if all ten progeny seeds germinated and grew normally. An F2
parent plant was scored as homozygous negative for the gm-hra gene
if all ten progeny seeds did not germinate and grow normally. A
hemizygous F2 parent genotype was characterized by having a mixture
of resistant and susceptible plants within the ten seed sample.
[0321] An ALS seed soak assay of the seeds prior to planting
removed all of the homozygous negative (null) plants, followed by a
quantitative real time PCR (qPCR) assay to distinguish plants that
were homozygous positive or hemizygous for the glyat4601 gene.
[0322] In some studies, all plants were identified as homozygous
positive, hemizygous, or homozygous negative to confirm a 1:2:1
expected segregation ratio (Table 9). Segregation analysis was
conducted for the C2F2 generation using quantitative real time PCR
(qPCR) assays for both the glyat4601 and gm-hra genes. Because the
glyat4601 and gm-hra genes were physically linked in the DNA
fragment used for transformation and are expected to have identical
segregation ratios in the progeny of 3560.4.3.5 soybean, the
glyat4601 results are applicable to the inheritance of gm-hra and
vice versa. In generations where both traits were analyzed in the
same plants (F3 and C2F2), identical segregation data would
experimentally confirm co-segregation of the glyat4601 and gm-hra
genes
[0323] Results from the Mendelian analysis are summarized in Tables
7, 8 and 9. All P-values were greater than 0.05, indicating no
statistically significant differences between the observed and
expected frequencies of the glyat4601 and/or gm-hra genes in five
generations of 3560.4.3.5 soybean. The results of this analysis are
consistent with the finding of a single locus of insertion of the
glyat4601 and gm-hra genes that segregates in 3560.4.3.5 soybean
progeny according to Mendel's laws of genetics. The stability of
the insert has been demonstrated in five generations of self- and
cross-pollinations.
TABLE-US-00007 TABLE 7 Comparison of Observed and Expected 3:1
Segregation Ratios for 3560.4.3.5 Soybean Chi- Observed Expected
squared Positives Negatives Positives Negatives test Generation
Method +/+ or +/- -/- +/+ or +/- -/- P-value T1 Glyat4601 PCR 59 23
61.5 20.5 0.610 F3 Elite 1 GLYAT 75 15 67.5 22.5 0.088 background
4601westerns followed by Southern analyses with glyat4601 and
gm-hra probes BC1F2 ALS seed soak Elite 7 700 222 691.5 230.5 0.543
background Elite 8 761 273 775.5 258.5 0.315 background Elite 9 160
54 160.5 53.5 1.000 background Elite 10 205 79 213 71 0.304
background
TABLE-US-00008 TABLE 8 Comparison of Observed and Expected 1:2
Segregation Ratios for 3560.4.3.5 Soybean Observed Expected Chi-
Homo- Hemi- Homo- Hemi- squared Gener- zygous zygous zygous zygous
test ation Method +/+ +/- +/+ +/- P-value F2 Elite 1 Glyphosate 16
24 13.3 26.7 0.467 back- spray to ground remove nulls Elite 2 and
followed 32 53 28.3 56.7 0.466 back- by ALS ground inhibitor
ragdoll test F2 Elite 3 ALS seed soak 110 182 97.3 194.7 0.131
back- to remove nulls ground followed by Elite 4 qPCR for 124 284
136 272 0.227 back- glyat4601 ground Elite 5 27 61 29.3 58.7 0.678
back- ground Elite 6 22 29 17 34 0.181 back- ground
TABLE-US-00009 TABLE 9 Comparison of Observed and Expected 1:2:1
Segregation Ratios for 3560.4.3.5 Soybean Chi- squared Gener-
Observed Expected test ation Method +/+ +/- -/- +/+ +/- -/- P-value
C2F2 Elite 44 Glyat4601 41 76 43 40 80 40 0.799 back- and gm-
ground hra qPCR Elite 45 160 294 142 149 298 149 0.550 back-
ground
TABLE-US-00010 TABLE 10 Description and Sizes of PCR Products
Forward Reverse Description of Size (bp) of Primer Primer amplified
region PCR product 1297 1298 Inserted DNA 5457 1679 1658 5'
flanking genomic border 396 to SCP1 Promoter 1679 1514 5' flanking
genomic border 246 1439 1666 gm-hra to 3' flanking 1029 genomic
border 1660 1666 3' flanking genomic border 297
TABLE-US-00011 TABLE 11 List of Primer Sequences Used in PCR
Reactions Target Abbreviated Sequence Primer Primer Location SEQ ID
Name Name Sequence (5'-3') (bp to bp).sup.1 NO 05-0-1227 1227
TGGTCTTCTGAGACTGTATCTTTGATATTC 3402- 24 3373 05-0-1297 1297
TGCCCGAGGTCGTTAGGTCGAATAGGCTAG 3268- 25 3297 05-0-1298 1298
TCCTATTCAAGATGGGCAGTGTCTTCCTAATGATG 8724- 17 8690 06-0-1439 1439
GATAACTGAGGGTGATGGTAGAACGAGGTACTGATTG 7951- 18 7987 06-0-1440 1440
TGTGATAACTGAGGGTGATGGTAGAACGAGGTACTG 7948- 26 7983 06-0-1473 1473
TTATTTCCGATCGGATCCTGCCAGTGGAG 10849- 50 10821 06-0-1504 1504
CCACCATGTTGACGGATCTCTAG 3347- 51 3325 06-0-1505 1505
GCAATGGAATCCGAGGAGGTTTC 3463- 52 3441 06-0-1506 1506
GCAATGATGGCATTTGTAGGTG 3532- 53 3511 06-0-1514 1514
TCGATCGGTCAAGAATCCGGTTCTC 3263- 19 3239 06-0-1549 1549
AAACTGAAGCGATGGCAGAACCGCACAG 1962- 54 1935 06-0-1550 1550
TCGAAGTGGCAATAGAGCCACACAATATCGATAAG 2012- 55 1978 06-0-1610 1610
AGCAATTGTTTTGTGCATTTCCAAATTTCAATCTG 1-35 40 06-0-1658 1658
CAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTG 3413- 20 3379 06-0-1660 1660
GTAATATCATCATTAGGAAGACACTGCCCATCTTG 8683- 21 8717 06-0-1666 1666
CCATATTTGAAAGCCTAAGCAGATGGCATAATTC 8979- 22 8946 06-0-1679 1679
TTCAGCAACAAACTCTCATCGTGAGCAG 3018- 23 3045 .sup.1Location in
sequence of 356043 soybean. (See FIG. 4) Bases 1-3317 = 5' genomic
border, bases 3318-8679 = insert, bases 8680-10849 = 3' genomic
border.
TABLE-US-00012 TABLE 12 Additional Primers for Detecting 3560.4.3.5
soybean Primer Characteristics SEQ ID NO GGTCGAATAGGCTAGGTTTACGAA
(start 751, length 24 nt, tm 59, % GC 7 59) AAGAGACTAAGGCCGCTC
(taqman mgb probe, start 776, lenth 9 18, tm 68, % gc 56)
CCACCATGTTGACGGATCTCT (start 815, length 21, tm 58) 8
GTCGAATAGGCTAGGTTTACGAAAAA primer DP-356-f1 37
TTTGATATTCTTGGAGTAGACGAGAGTGT Primer Dp-356-r1 38
6FAM-CTCTAGAGATCCGTCAACATGGTG Dp356-p (Taqman probe) 39
GAGCAC-TAMRA
Example 2
Additional Methods to Identify a 3560.4.3.5 Event
Oligonucleotide PCR Reagents:
TABLE-US-00013 [0324] (SEQ ID NO: 7) Forward Primer: 5'
GGTCGAATAGGCTAGGTTTACGAA (SEQ ID NO: 8) Reverse Primer: 5'
CCACCATGTTGACGGATCTCT Taciman MGB probe: (SEQ ID NO: 9) 5'
Fam-AAGAGACTAAGGCCGCTC-MGB 3'
Each primer is used at a concentration of 900 nM in the PCR. The
MGB probe was used at a concentration of 80 nM in the PCR. The PCR
mixture used was "Extract-N-Amp PCR Ready Mix" (Cat. No. E3004)
from Sigma-Aldrich. Rox reference dye was also included in the PCR
mixture by adding 0.01 volumes of Sigma-Aldrich "Reference Dye for
Quantitative PCR" (Cat. No. R4526). PCR was performed for 40 cycles
with one cycle consisting of the following two steps: Step 1: 15
seconds at 95.degree. C. and Step 2: 60 seconds at 60.degree. C.
Amplicon product had a size of 85 bp.
[0325] Additional primers that can be used to identify a 3560.4.3.5
soybean event are set forth in Table 13.
TABLE-US-00014 TABLE 13 Product SEQ Size ID Primer Sequence (bp) NO
104312 AGATCCGTCAACATGGTGGAGCAC 44 104314
TGACAGATAGCTGGGCAATGGAATCC 150 45 Probe 6FAM-TATCGGGAAACCTC-MGB 46
125323 109893 CTTTGCTGTTTGATTGCTGGGTTGTC 47 (endogenous control)
109894 TGTGTGGACCCATTGGCCTTTAGATTAT 144 48 (endogenous control)
Probe VIC-ACTCTGCAGTTGCCTT-MGB 49 125322 (endogenous control)
These primers were used in a presence/absence assay to detect a
3560.4.3.5 soybean event. Primers 104312+104314/SCP1TP10 detect the
transgenic insertion; control primers, such as, 109893+109894/probe
P94032A2 were used to detect house-keeping gene (aspartate
aminotransferase gene) and were used as internal control. A
3560.4.3.5 soybean event will show heterozygous signals (FAM and
VIC) and the non-transgenic genotypes will show homozygous P94032A2
(VIC) positive. PCR conditions employed in this method of detecting
the 3560.4.3.5 soybean are shown below.
TABLE-US-00015 TABLE 14 PCR Conditions Initial denat 120 sec 95 C.
Anneal 90 sec 66 C. Extend 90 sec 72 C. Denat 30 sec 95 C. 14
cycles Final extend 120 72 C. Initial denat 120 sec 95 C. Anneal 60
sec 60 C. Extend 10 sec 82 C. Denat 30 sec 95 C. Final extend 0 82
C. 32 cycles
[0326] Those skilled in the art would also include a control PCR
using an endogenous gene to verify that the isolated genomic DNA
was suitable for PCR amplification. Soybean endogenous genes that
have been used successfully with soybean samples are the following:
Lectin gene (Schmidt, M and Parrott, W, 2001) and conglycinin
.alpha.'-subunit gene (Shirai (1998) Biosci Biotechnol Biochem
62:1461-1464). Another location to find endogenous gene targets for
PCR is the web site (www.//biotech.jrc.it) which is sponsored by
the Joint Research Centre (JRC) of the European Commission. See,
also, Schmidt et al. (2001) Plant Cell Rep 20:422-428.
Example 3
[0327] Soybean event 3560.4.3.5 was selected as a lead event and
BC1F3 lines were created by backcrossing 3560.4.3.5 soybean into
four different conventional lines. Across these four backcross
populations, lines with the 3560.4.3.5 event (sprayed with
glyphosate) were not significantly different for yield compared to
negative null segregant lines (sprayed with conventional
herbicides). Soybean event 3560.4.3.5 confers a high level of
tolerance to glyphosate and ALS inhibitor herbicides with no yield
impact.
[0328] The first objective of this study was to evaluate 3560.4.3.5
soybean to determine the level of tolerance to different
application rates of glyphosate and ALS inhibitor herbicides. The
second objective was to develop homozygous positive and homozygous
negative null segregants (NILs) of 3560.4.3.5 soybean event to
determine if yield was impacted due to presence of the 3560.4.3.5
event. The third objective was to integrate event 3560.4.3.5 into
different genetic backgrounds to determine if there was any impact
on herbicide tolerance or yield performance.
Materials and Methods
[0329] For early generation transgenic event testing, TO plants
were sprayed at the V2 to V6 growth stage (Fehr et al. (1977) Coop.
Ext. Ser. Special Report 80. Iowa State Univ., Ames Iowa) with 1.68
kg ae ha.sup.-1 or 3.36 kg ae ha.sup.-1 glyphosate plus adjuvants
(0.25% v/v nonionic surfactant (NIS)+2.24 kg ai ha.sup.-1 ammonium
sulfate (AMS)) in the Newark, Del. greenhouses. Plants were rated
using a 1 to 9 scale ten days after treatment (DAT), where 1=dead
plant to 9=no observed spray response.
[0330] Selected events were advanced at the T1 generation for
herbicide tolerance confirmation in greenhouses. Plants were
sprayed at the V3 growth stage with either 1.68 kg ae ha.sup.-1
glyphosate, 60 g ai ha.sup.-1 thifensulfuron methyl (methyl
3-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]sulfony-
l]-2-thiophenecarboxylate), or a sequential application of 70 g ai
ha.sup.-1 thifensulfuron methyl at V3 followed by 2.24 kg ai ha-1
glyphosate at V6. All spray treatments included 0.25% v/v NIS+2.24
kg ai ha.sup.-1 AMS. At ten days after spray application, plants
were rated using a 1 to 9 scale. Since the T1 events were
segregating, only the non-susceptible plants were scored, and an
average rating of tolerant plants within each event was
calculated.
[0331] Plants from individual T1 events were grown separately in
2.4 m rows (76.2 cm row spacing). Presence or absence of glyat+hra
in each individual T1 plant was determined by using polymerase
chain reaction (PCR) amplification of the glyat4601 insert. PCR
results for each event were analyzed using chi square analyses to
identify events with Mendelian segregation. For each of the events
evaluated, T1 plants that were positive for the glyat+hra were
harvested separately and advanced as plant-to-row T2 short rows
(2.4 m rows with 76.2 cm row spacing). Twelve remnant seed from
each T2field entry were grown and V3 plants were sprayed with 3.36
kg ae ha.sup.-1 glyphosate plus 0.25% v/v NIS+2.24 kg ai ha.sup.-1
AMS to determine zygosity of the corresponding short row. Lines
were considered homozygous positive if all 12 plants were tolerant,
homozygous negative if all 12 plants were susceptible, and
heterozygous if the 12 plants were a mixture of tolerant and
susceptible phenotypes.
[0332] Chi square was used to analyze T2 results to identify events
with Mendelian segregation across generations. Twenty four
different lines at the T3 generation with the glyat/hra were
selected for advancement to herbicide tolerance trials. Homozygous
positive and homozgygous negative NILs from ten events were
advanced to isoline yield trials. 3560.4.3.5 soybean event was one
of the events selected for advancement.
[0333] The 3560.4.3.5 soybean event was evaluated for glyphosate
tolerance. 3560.4.3.5 soybean was grown in a randomized complete
block (RCB) design in a split plot arrangement with three
replications of paired 3.7 m rows (76.2 cm row spacing). Treatments
consisted of an unsprayed control, and three spray rates applied at
the V5 growth stage using either 3.36 kg ae ha.sup.-1, 6.72 kg ae
ha.sup.-1, or 13.44 kg ae ha.sup.-1 glyphosate. Plots were
evaluated for crop response at 7 and 14 days after treatment (DAT),
and rated using a 1-9 score. Crop response data were analyzed using
the general linear model (GLM) and mixed model analysis of variance
(ANOVA) procedures of SAS. (The SAS System is a registered
trademark of SAS Institute, Inc., Cary, N.C., USA)
[0334] Selected T4 lines were tested for glyphosate tolerance. This
experiment was a RCB design in a split plot arrangement with two
replications of individual 1.2 m rows (76.2 cm row spacing). At the
V3 growth stage, 6.72 kg ae ha.sup.-1 glyphosate was applied to one
block, while another was unsprayed for use as a control. The third
block received a sequential application of 6.72 kg ae ha.sup.-1
glyphosate at V3 followed by 6.72 kg ae ha.sup.-1 glyphosate at R1.
Plots were evaluated for crop response at 7 DAT and 14 DAT, and
assigned a visual response score from 0% to 100% response, where
0%=no response observed to 100%=plot completely dead. Crop response
data were analyzed using the GLM and mixed model ANOVA procedures
of SAS.
[0335] ALS inhibitor herbicide tolerance of the gm-hra gene was
compared to sulfonylurea tolerant soybeans (STS.RTM.) by growing T4
plants of event 3560.4.3.5 and a STS.RTM. cultivar. The experiment
was designed as a RCB design in a split plot arrangement with two
replications of paired 3.7 m rows (76.2 cm row spacing). Spray
treatments were applied at the V3 growth stage and consisted of one
of the following: an unsprayed control, 8.8 g ai ha.sup.-1
rimsulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-3-(ethylsulfonyl)-2-pyr-
idinesulfonamide), 8.8 g ai ha.sup.-1 tribenuron methyl (methyl
2-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)methylamino]carbonyl]amino]s-
ulfonyl]benzoate), or 30.0 g ai ha 1 chlorimuron ethyl (ethyl
2-[[[[(4-chloro-6-methoxypyrimidin-2-yl)amino]carbonyl]amino]sulfonyl]ben-
zoate)+9.67 g ai ha.sup.-1 thifensulfuron methyl. All spray
treatments listed had 0.25% v/v NIS+2.24 kg ai ha.sup.-1 AMS added.
Plots were evaluated for crop response at 7 DAT and 14 DAT, and
assigned a visual response score from 0% to 100% response. Crop
response data were analyzed using the mixed model ANOVA procedure
of SAS.
[0336] ALS inhibitor herbicide tolerance trials were completed at
two separate locations. Plants from the T5 generation of event
3560.4.3.5 and a STS.RTM. cultivar were grown in a RCB design in a
split plot arrangement with three replications of paired 2.4 m rows
(76.2 cm row spacing). Treatments were applied at the V3 growth
stage and consisted of an unsprayed control, 4.2 g ai ha.sup.-1
metsulfuron methyl (methyl
2-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]sulfony-
l]benzoate), 70.0 g ai ha.sup.-1 thifensulfuron methyl, and 17.5 g
ai ha.sup.-1 tribenuron methyl. All spray treatments listed had
0.25% v/v NIS+2.24 kg ai ha.sup.-1 AMS added. Visual response
ratings (0% to 100%) were assigned to each plot at 7 DAT, 14 DAT,
and 28 DAT. Crop response data were analyzed using the mixed model
ANOVA procedure of SAS.
[0337] Multiple trials were conducted with the lead event
3560.4.3.5 soybean to observe the level of tolerance to different
rates and application timings of glyphosate with and without other
pesticide mixtures. The first experiments were grown in an RCB
design of three replications of paired 3.7 m rows (76.2 cm row
spacing), blocked by replication with randomized spray treatments
within each replication. Treatments were applied at the V2 or R2
growth stage, and consisted of the following: unsprayed control,
3.36 kg ae ha.sup.-1 glyphosate, 3.36 kg ae ha.sup.-1
glyphosate+560.4 g ai ha.sup.-1 chlorpyrifos (O,O-diethyl
O-3,5,6-trichloro-2-pyridyl phosphorothioate), 3.36 kg ae ha.sup.-1
glyphosate+1120.9 g ai ha.sup.-1 bentazon
(3-isopropyl-1H-2,1,3-benzothiadiazin-4(3H)-one 2,2-dioxide), 3.36
kg ae ha.sup.-1 glyphosate+141.3 g ai ha.sup.-1 imazethapyr
(2-[4,5-dihydro-4-methyl-4-(1-methylethyl)-5-oxo-1H-imidazol-2-yl]-5-ethy-
l-3-pyridinecarboxylic acid), 3.36 kg ae ha.sup.-1 glyphosate+263.4
g ai ha.sup.-1 fomesafen
(5-[2-chloro-4-(trifluoromethyl)phenoxy]-N-(methylsulfonyl)-2-nitrobenzam-
ide), 3.36 kg ae glyphosate+17.5 g ai ha.sup.-1 thifensulfuron
methyl+17.5 g ai ha.sup.-1 tribenuron methyl, 3.36 kg ae ha.sup.-1
glyphosate+17.5 g ai ha.sup.-1 thifensulfuron methyl+17.5 g ai
ha.sup.-1 tribenuron methyl+560.4 g ai ha.sup.-1 chlorpyrifos, 3.36
kg ae ha.sup.-1 glyphosate+17.5 g ai ha.sup.-1 thifensulfuron
methyl+17.5 g ai ha.sup.-1 tribenuron methyl+1120.9 g ai ha.sup.-1
bentazon, 3.36 kg ae ha.sup.-1 glyphosate+17.5 g ai ha.sup.-1
thifensulfuron methyl+17.5 g ai ha.sup.-1 tribenuron methyl+141.3 g
ai ha.sup.-1 imazethapyr, and 3.36 kg ae ha.sup.-1 glyphosate+17.5
g ai ha.sup.-1 thifensulfuron methyl+17.5 g ai tribenuron
methyl+263.4 g ai ha.sup.-1 fomesafen. All spray treatments listed
had 0.25% v/v NIS+2.24 kg ai ha.sup.-1 AMS added. Visual response
ratings (0% to 100%) were assigned to each plot at 7 DAT, 14 DAT,
and 28 DAT. Crop response data were analyzed using the GLM and
mixed model ANOVA procedures of SAS.
[0338] The second set of tolerance experiments were designed to
measure yield potential of 3560.4.3.5soybean after application of
common field use rates of glyphosate and/or ALS inhibitor
herbicides. These experiments were six replications of paired 3.7 m
rows (76.2 cm row spacing), grown in a RCB design, blocked by
replication, with randomized spray treatments within each
replication. One experiment was grown at field A and two
experiments were grown at field B and C (which were separated by
planting date and physical distance of field locations.) In
addition, the two fields had different environmental influence; one
field experienced drought stress through the spring and early
summer, the other was well irrigated throughout the growing season.
Treatments were randomized within each of the replications and
sprayed at the VC, V2, R2, or R5 growth stages. Treatments
consisted of 1.68 kg ai ha.sup.-1 glyphosate, 5.8 g ai ha.sup.-1
chlorimuron ethyl+4.4 g ai ha.sup.-1 thifensulfuron methyl, and
1.68 kg ai ha.sup.-1 glyphosate+5.8 g ai ha.sup.-1 chlorimuron
ethyl+4.4 g ai thifensulfuron methyl. All spray treatments listed
had 0.25% v/v NIS+2.24 kg ai ha.sup.-1 AMS) added. Visual response
ratings (0% to 100%) were assigned to each plot at 7 DAT, 14 DAT,
and 28 DAT. Plots were harvested and yield was calculated for each
plot. Crop response data were analyzed using the GLM and mixed
model ANOVA procedures of SAS.
[0339] Homozygous positive and homozygous negative null segregants
(NILs) of 3560.4.3.5 soybean from T3 generation events were grown
in preliminary yield trials to determine if yield was impacted due
to the presence of 3560.4.3.5 event. Isoline yield trials were
designed as a RCB (blocked by event), with a single replication of
paired 3.7 m rows (76.2 cm row spacing). Trials were mechanically
cultivated and/or had labeled use rates of conventional soybean
herbicides applied, as needed, to ensure weed-free conditions.
Maturity scores and yield data were collected for each entry and
subject to ANOVA using the mixed model procedure of SAS.
[0340] T3 seed for each isoline entry was also advanced to the T4
generation. Remnant T3 seed from each line was confirmed to be
either homozygous positive or homozygous negative by evaluating 12
seedlings that were germinated in chlorsulfuron herbicide solution.
Conventional soybean lines are not tolerant to spray application of
chlorsulfuron, which is currently utilized in small grain
production to control broadleaf weeds. The chlorsulfuron herbicide
stock solution was created by mixing 66.7 mg of chlorsulfuron with
1 liter of water. The mixture was buffered to a pH of 7.5 using 1
mM phosphate buffer. From this stock solution, 20 ml was mixed with
1 liter of water, which was then used to saturate germination
paper. Seeds were added to the germination paper and observed 10
days after initial treatment for their response. Seedlings that
possessed the 3560.4.3.5 event germinated and grew normally, while
seedlings that lacked the event created hooked unifoliolate leaves
that did not expand and develop any further (data not shown). Lines
were scored as homozygous positive if all 12 seedlings grew
normally through the solution (data not shown). Lines were scored
as homozygous negative if all 12 plants had the inhibited hooked
unifoliolate phenotype (data not shown).
[0341] Homozygous positive 3560.4.3.5 event and homozygous negative
NILs were grown in isoline yield trial experiments. Trials were
mechanically cultivated and/or had labeled use rates of
conventional soybean herbicides applied, as needed, to ensure
weed-free conditions, Maturity scores and yield data were collected
for each entry and subject to ANOVA using the mixed model procedure
of SAS.
[0342] Remnant T4 seed from each line was confirmed to be either
homozygous positive or homozygous negative by evaluating 12
seedlings using the chlorsulfuron herbicide screen. T4 seed for
each selected isoline entry was advanced to the T5 generation.
[0343] Event 3560.4.3.5 was selected for additional isoline yield
trial evaluations. Homozygous positive and homozygous negative NILs
from event 3560.4.3.5 were grown using the same experimental yield
test design implemented above. Experiments were planted and trials
were mechanically cultivated and/or had labeled use rates of
conventional soybean herbicides applied, as needed, to ensure
weed-free conditions. Maturity scores and yield data were collected
for each entry and subject to ANOVA using the mixed model procedure
of SAS.
[0344] Event 3560.4.3.5 was selected for introgression into four
different Pioneer.RTM. conventional (non-transgenic) elite lines
with different genetic parentage. The four elite lines had relative
maturities (RM) of 22, 27, 30, and 38. After the initial cross, F1
seed was backcrossed to the respective recurrent parent and BC1F1
seed was advanced to the F2 generation. The four BC 1F2 populations
created were grown and harvested as individual plants. BC1F3 lines
were created using single plant-to-row 2.4 m increase rows.
Homozygous positive or homozygous negative sister lines were
selected for yield testing based upon screening of 12 remnant
seedlings for each line using the chlorsulfuron herbicide seedling
test. Based upon the remnant screening across the four populations,
328 positive 3560.4.3.5 soybean lines, and 116 negative lines were
selected for preliminary yield trials
[0345] For the 3560.4.3.5.times. elite preliminary yield trials,
BC1F3 lines were blocked by the recurrent parent and presence or
absence of the 3560.4.3.5 event. Positive and negative blocks were
planted adjacent to each other at different locations, based upon
expected maturity of the lines within the population. The
3560.4.3.5 event positive blocks had a V3 application of 2.24 kg ai
ha.sup.-1 glyphosate plus 0.25% v/v NIS+2.24 kg ai ha.sup.-1 AMS,
while negative blocks had conventional herbicides applied (as
needed) to maintain weed free plots. Maturity scores and yield data
were collected for each entry at each location and subject to
multiple regression and ANOVA using the GLM and mixed model
procedures of SAS.
Results and Discussion
[0346] T0 3560.4.3.5 soybean were evaluated for glyphosate
tolerance. The 3560.4.3.5 soybean were sprayed with 2.24 kg ai
ha.sup.-1 glyphosate and 4.48 kg ae ha.sup.-1 glyphosate (Table
15). The 2.24 kg ai ha.sup.-1 treatment would correspond to
2.times. the typical labeled field application rate of glyphosate,
while the 4.48 kg ae ha.sup.-1 treatment would correspond to
4.times. the typical labeled field application rate of glyphosate.
The untransformed parental line (sprayed as a control) did not
survive either glyphosate application rate and was consistently
rated a 1.
[0347] The 3560.4.3.5 event was advanced to the T1 generation in a
greenhouse to confirm herbicide tolerance. The 3560.4.3.5 event had
tolerance after application of 1.68 kg ae ha.sup.-1 glyphosate,
after application of 60.0 g ai ha.sup.-1 thifensulfuron methyl, and
after a sequential application of 70 g ai ha.sup.-1 thifensulfuron
methyl at V3, followed by 1.68 kg ae ha.sup.-1 glyphosate at V5 as
shown in Table 15. These data indicate event 3560.4.3.5 confers
tolerance to both glyphosate and thifensulfuron methyl application
at early generations after transformation.
[0348] The 3560.4.3.5 event was analyzed for Mendelian segregation
across early generations (Table 16).
TABLE-US-00016 TABLE 15 Southern copy number estimates and average
visual response ratings.sup..dagger. ten days after herbicide
application on T0 and T1 generation transgenic event 3560.4.3.5
Southern Generation bands.sup..dagger-dbl. T0 T1 Event glyat4601
hra 1.68.sup..sctn. 3.36.sup..sctn. 1.68.sup..sctn. 60.0.sup. 70.0
+ 1.68.sup.# 3560.4.3.5 1 1 7.0 6.5 7.0 7.0 8.0 8.0
.sup..dagger.Average visual response rating of tolerant plants 10
days after herbicide application in the greenhouse (0 = dead plant
to 9 = no response detected) .sup..dagger-dbl.Estimated number of
copies based upon Southern analysis using HindIII and the glyat4601
gene or gm-hra gene as a probe .sup..sctn.Glyphosate application
(1.68 kg ae ha.sup.-1, or 3.36 kg ae ha.sup.-1) + 0.25% v/v NIS +
2.24 kg ai ha.sup.-1 AMS applied at the V3 growth stage .sup.
Thifensulfuron methyl application (60.0 g ai ha.sup.-1 or 70.0 g ai
ha.sup.-1) + 0.25% v/v NIS + 2.24 kg ai ha.sup.-1 AMS applied at
the V3 growth stage. .sup.#Sequential application; initially
sprayed at the V3 growth stage with 70 g ai ha.sup.-1
thifensulfuron methyl + 0.25% v/v NIS + 2.24 kg ai ha.sup.-1 AMS,
followed by spray of 1.68 kg ae ha.sup.-1 glyphosate + 0.25% v/v
NIS + 2.24 kg ae ha.sup.-1 AMS at the V6 growth stage. The first
score is 10 days after the V3 thifensulfuron methyl application,
the second score is 10 days after the V6 glyphosate application
TABLE-US-00017 TABLE 16 Segregation ratios of T1 plants and T2
progeny rows of event 3560.4.3.5. Generation T1 plants.sup..dagger.
T2 lines.sup..dagger-dbl. Observed Expected Observed Expected Event
Positive Negative Positive Negative chi.sup.2 P.sup..sctn. Positive
Negative Positive Negative chi.sup.2 P.sup..sctn. 3560.4.3.5 59 23
61.5 21.1 0.605 34 9 32.3 10.3 0.609 .sup..dagger.T1 plants were
identified to be positive or negative for the glyat transgene
insert using PCR amplification .sup..dagger-dbl.T2 lines (derived
from individual glyat positive T1 plants) were screened by spraying
3.36 kg ae ha.sup.-1 glyphosate plus 0.25% v/v NIS + 2.24 kg ai
ha.sup.-1 AMS on 12 remnant V3 plants in a greenhouse.
.sup..sctn.chi.sup.2 probability that deviation from expected model
is due to chance alone
[0349] The T3 plants from the 3560.4.3.5 plants were sprayed in a
glyphosate herbicide tolerance field trial. Table 17 shows the
herbicide response at seven DAT after application of 3.36 kg ae
ha.sup.-1 glyphosate, after application of 6.72 kg ae ha.sup.-1
glyphosate, and after application of 13.44 kg ae ha.sup.-1
glyphosate. The untransformed control line was susceptible to any
glyphosate application and was consistently rated as a 1.
3560.4.3.5 soybean T4 plants were advanced for additional
glyphosate tolerance testing. Table 17 shows the spray ratings at
seven and fourteen DAT with 6.72 kg ae ha.sup.-1 glyphosate.
TABLE-US-00018 TABLE 17 LSMeans for visual ratings.sup..dagger. of
selected T3 and T4 3560.4.3.5 plants, sprayed with experimental
rates of glyphosate in field experiments. 2005 (T4
plants).sup..sctn. 2004 (T3 plants).sup..dagger-dbl. Glyphosate
spray rate (kg ae ha.sup.-1) Glyphosate spray rate (kg ae
ha.sup.-1) 6.72 Unsprayed 3.36 6.72 13.44 Unsprayed 6.72
sequential.sup. Event 7 DAT 7 DAT 7 DAT 7 DAT 7 DAT 14 DAT 7 DAT 14
DAT 7 DAT 14 DAT 3560.4.3.5 9.0 8.0 6.7 5.7 9.0 9.0 6.8 7.8 7.8 7.7
.sup..dagger.Visual response ratings on a 1 to 9 scale, where 1 =
completely dead plot to 9 = no response observed
.sup..dagger-dbl.test consisted of three randomized replications of
paired 3.7 m rows (76.2 cm row spacing) sprayed at the V3 growth
stage .sup..sctn.test consisted of two randomized replications of
paired 1.2 m rows (76.2 cm row spacing) sprayed at the V3 growth
stage .sup. Sequential spray; 6.72 kg ae ha.sup.-1 glyphosate
sprayed at V3, followed by 6.72 kg ae ha.sup.-1 glyphosate sprayed
on the same plots at R1 (rating data listed below this treatment is
after the R1 application)
[0350] In addition to the glyphosate herbicide tolerance trials,
event 3560.4.3.5 was compared to a STS.RTM. cultivar in two
experiments to determine if the hra gene had better tolerance to
different ALS inhibitor herbicides (Table 18). Across these two
experiments, the 3560.4.3.5 soybean had significantly lower crop
response compared to STS.RTM. at 7 DAT and 14 DAT after application
of 8.8 g ai ha.sup.-1 rimsulfuron, 8.8 g ai ha.sup.-1 tribenuron
methyl, 4.2 g ai ha.sup.-1 metsulfuron methyl, and 17.5 g ai
ha.sup.-1 tribenuron methyl (Table 18). These chemistries are
currently not labeled for use on soybean, and will cause high
levels of crop response on current STS.RTM. and conventional
soybean cultivars. The tolerance data obtained indicate that
3560.4.3.5 soybean had significantly higher tolerance to multiple
ALS inhibitor chemistries when compared directly to the STS.RTM.
trait.
TABLE-US-00019 TABLE 18 Difference of LSMeans for crop response
ratings.sup..dagger. of 3560.4.3.5 soybean compared to STS .RTM.
across different ALS inhibitor herbicide treatments in experiments.
Rate 7 DAT 14 DAT (g ai Loca- Differ- Differ-
Treatment.sup..dagger-dbl. ha.sup.-1) tion.sup..sctn. Reps
3560.4.3.5 STS .RTM. ence Pr > |t| 3560.4.3.5 STS .RTM. ence Pr
> |t| Rimsulfuron 8.8 A 2 10.0 50.0 -40.0 <.0001 5.0 55.0
-50.0 <.0001 Tribenuron 8.8 A 2 5.0 35.0 -30.0 <.0001 5.0
42.5 -37.5 <.0001 methyl Chlorimuron 30.0 + A 2 0.0 5.0 -5.0
0.200 0.0 5.0 -5.0 0.171 ethyl + 9.67 thifensulfuron methyl
Unsprayed 0 A 2 0.0 0.0 0.0 1.000 0.0 0.0 -45.0 <.0001 control
Metsulfuron 4.2 B 6 58.3 79.2 -20.8 <.0001 64.2 90.8 -26.7
<.0001 methyl Thifensulfuron 70 B 6 23.3 27.5 -4.2.0 0.549 6.7
8.3 -1.7 0.797 methyl Tribenuron 17.5 B 6 11.7 36.7 -25.0 <.0001
15.0 48.3 -33.3 <.0001 methyl Unsprayed 0 B 6 0.0 0.0 0.0 1.000
1.7 0.0 -1.7 0.747 control 28 DAT.sup. Differ-
Treatment.sup..dagger-dbl. 3560.4.3.5 STS .RTM. ence Pr > |t|
Metsulfuron 29.2 95.0 -65.8 <.0001 methyl Thifensulfuron 8.3 6.7
1.7 0.803 methyl Tribenuron 5.0 21.7 -16.7 0.015 methyl Unsprayed
1.7 0.0 1.7 0.804 control .sup..dagger.Visual response ratings from
0% to 100%, where 0% = no response observed to 100% plot completely
dead. .sup..dagger-dbl.0.25% v/v NIS + 2.24 kg ai ha.sup.-1 AMS was
added to all spray treatments .sup..sctn.A location consisted of
two replications of paired 3.7 m rows (76 cm row spacing); B
location consisted of three replications of paired 3.7 m rows (76.2
cm row spacing), grown at two different locations. .sup. Due to
minimal response of 35604.3.5 at 14 DAT, the 28 DAT ratings were
not recorded for the A experiment
Event 3560.4.3.5 was evaluated for herbicide tolerance and yield
performance in more extensive testing. For the first set of
experiments, event 3560.4.3.5 was sprayed at a vegetative stage and
a reproductive stage with different tank mixes of glyphosate and
other pesticides. Across the treatments evaluated, there was
minimal crop response at 7 DAT and 14 DAT (10% or less) for the
glyphosate and all glyphosate plus pesticide mixtures applied at
the V2 growth stage, except those containing bentazon or fomesafen
(Table 19). The treatments with bentazon or fomesafen caused up to
20% initial phytotoxicity at 7 DAT, which diminished to less than
12% by 14 DAT. These results were expected, as the leaf bronzing
observed was equivalent to phytotoxicity that is typically observed
on commodity soybeans up to 14 days after application with either
bentazon of fomesafen chemistry. It should also be noted that
herbicide response ratings are very subjective, and in general, a
10% response cannot be easily distinguished unless there is an
unsprayed control right next to the plot being evaluated. By 28
DAT, there was essentially no crop response to any of the
treatments applied at the V2 growth stage (Table 19). For the
mixtures applied at R2, all of the treatments had 10% or less
response at 7 DAT, 14 DAT, and 28 DAT except for the treatment
containing bentazon (Table 19). For this treatment an average crop
response of 11.4% was recorded at 7 DAT, which diminished to less
than 5% at 14 DAT and 0% at 28 DAT (Table 19). The crop response
observed was the typical leaf bronzing that is commonly observed up
to 14 DAT after application of bentazon on commodity soybeans. In
general, 3560.4.3.5 soybean had excellent tolerance to different
mixtures of glyphosate with and without other pesticides across two
different growth stages evaluated in different environments.
TABLE-US-00020 TABLE 19 LSMeans for crop response
ratings.sup..dagger. of 3560.4.3.5 soybean treated at two different
growth stages with different tank mixed pesticide formulations.
Glyphosate rate Other pesticides Application 7 DAT 14 DAT 28 DAT
Treatment.sup..dagger-dbl. Average (kg ae ha-1) rate (g ai
ha.sup.-1) Stage Reps Average Average Glyphosate 3.36 V2 9 3.9 3.3
0.6 Glyphosate + chlorpyrifos 3.36 560.4 V2 9 5.6 3.3 0.0
Glyphosate + bentazon 3.36 1120.9 V2 9 16.6 6.3 0.6 Glyphosate +
imazethapyr 3.36 141.3 V2 9 5.0 2.2 0.6 Glyphosate + fomesafen 3.36
263.4 V2 9 20.3 12.0 0.6 Glyphosate + tribenuron-methyl + 3.36 17.5
+17.5 V2 9 5.0 8.3 0.0 thifensulfuron-methyl Glyphosate +
tribenuron-methyl + 3.36 17.5 + 17.5 + 560.4 V2 9 7.6 10.8 0.0
thifensulfuron-methyl + chlorpyrifos Glyphosate + tribenuron-methyl
+ 3.36 17.5 + 17.5 + 1120.9 V2 9 17.9 5.0 0.0 thifensulfuron-methyl
+ bentazon Glyphosate + tribenuron-methyl + 3.36 17.5 + 17.5 +
141.3 V2 9 5.1 7.8 0.0 thifensulfuron-methyl + imazethapyr
Glyphosate + tribenuron-methyl + 3.36 17.5 + 17.5 + 263.4 V2 9 19.8
11.4 1.1 thifensulfuron-methyl + fomesafen Glyphosate 3.36 R2 9 1.7
0.6 0.0 Glyphosate + chlorpyrifos 3.36 560.4 R2 9 1.7 0.6 0.0
Glyphosate + bentazon 3.36 1120.9 R2 9 11.4 2.2 0.0 Glyphosate +
imazethapyr 3.36 141.3 R.2 9 0.6 0.0 0.0 Glyphosate + fomesafen
3.36 263.4 R2 9 9.6 1.7 0.0 Glyphosate + tribenuron-methyl + 3.36
17.5 + 17.5 R2 9 1.1 0.0 0.0 thifensulfuron-methyl Glyphosate +
tribenuron-methyl + 3.36 17.5 + 17.5 + 560.4 R2 9 2.8 0.0 0.0
thifensulfuron-methyl + chlorpyrifos Glyphosate + tribenuron-methyl
+ 3.36 17.5 + 17.5 + 1120.9 R2 9 7.0 1.7 0.0 thifensulfuron-methyl
+ bentazon Glyphosate + tribenuron-methyl + 3.36 17.5 + 17.5 +
141.3 R2 9 1.7 0.0 0.0 thifensulfuron-methyl + imazethapyr
Glyphosate + tribenuron-methyl + 3.36 17.5 + 17.5 + 263.4 R2 9 5.3
2.8 0.0 thifensulfuron-methyl + fomesafen Unsprayed control 3.36 R2
9 0.0 0.0 0.0 LSD (a = 0.05) 3.3 3.3 2.0 .sup..dagger.Visual
response ratings from 0% to 100%, where 0% = no response observed
to 100% = plot completely dead. .sup..dagger-dbl.All treatments had
0.25% v/v NIS + 2.24 kg ai ha.sup.-1 AMS added.
[0351] The second set of experiments conducted with event
3560.4.3.5 were designed to measure yield potential after
application of different herbicides at field use rates that would
be commonly utilized for soybean production. Across the glyphosate,
ALS inhibitor, and glyphosate plus ALS inhibitor treatments there
was minimal (10% or less) to essentially no response at 7, 14, and
28 DAT (Table 20). When yield data was collected, there were no
significant yield differences detected for any of the herbicide
treatments applied at different the growth stages (Table 20). In
addition, the replications that received herbicide treatments were
not statistically different from the unsprayed control replications
for yield (Table 20). Based upon multiple year herbicide tolerance
trials, it can be concluded that event 3560.4.3.5 had excellent
tolerance to field use rates of glyphosate, ALS inhibitor, and
glyphosate plus ALS inhibitor herbicides. In addition, yield
potential was not affected when event 3560.4.3.5 was sprayed with
glyphosate, ALS inhibitor, and glyphosate plus ALS inhibitor
chemistries at different vegetative and reproductive growth
stages.
TABLE-US-00021 TABLE 20 LSMeans for crop response
ratings.sup..dagger. and yield (kg ha.sup.-1) for 3560.4.3.5
soybean treated at four different growth stages with different
herbicide combinations. ALS Glyphosate inhibitor rate rate
Application (kg ae ha.sup.-1) (g ai ha.sup.-1) Stage Reps
Treatment.sup..dagger-dbl. 7 DAT 14 DAT 28 DAT Yield Glyphosate
1.68 VC 18 1.6 0.8 0.6 2745.7 Glyphosate 1.68 V2 18 5.3 2.8 0.6
2851.7 Glyphosate 1.68 R2 18 2.0 0.6 0.0 2702.9 Glyphosate 1.68 R5
18 0.3 0.3 0.0 2718.8 Chlorimuron ethyl + 5.8 + 4.4 VC 18
thifensulfuron methyl 0.7 0.6 0.6 2756.4 Chlorimuron ethyl + 5.8 +
4.4 V2 18 thifensulfuron methyl 0.6 0.0 0.3 2864.0 Chlorimuron
ethyl + 5.8 + 4.4 R2 18 thifensulfuron methyl 0.0 0.0 0.3 2899.2
Chlorimuron ethyl + 5.8 + 4.4 R5 18 thifensulfuron methyl 0.0 0.0
0.6 2861.1 Glyphosate + 1.68 5.8 + 4.4 VC 18 chlorimuron ethyl +
2.6 1.7 0.0 2647.3 thifensulfuron methyl Glyphosate + 1.68 5.8 +
4.4 V2 18 chlorimuron ethyl + 6.9 3.8 2.2 2829.7 thifensulfuron
methyl Glyphosate + 1.68 5.8 + 4.4 R2 18 chlorimuron ethyl + 0.8
0.0 0.3 2841.6 thifensulfuron methyl Glyphosate + 1.68 5.8 + 4.4 R5
18 chlorimuron ethyl + 1.1 0.0 0.0 2768.3 thifensulfuron methyl
Hand weeded control Control 18 0.0 0.0 0.0 2813.1 Unsprayed control
Control 18 0.0 0.0 0.0 2742.4 LSD (a = 0.05) 1.3 1.1 0.8 155.6
.sup..dagger.Visual response ratings from 0% to 100%, where 0% = no
response observed to 100% = plot completely dead
.sup..dagger-dbl.Two different field locations were utilized; one
field had severe drought stress during the spring and early summer,
the other was well irrigated. .sup..dagger-dbl.All treatments had
0.25% v/v NTS + 2.24 kg ai ha.sup.-1 AMS added
[0352] Isoline yield test data were collected in five additional
environments for event 3560.4.3.5 soybean. When isoline yield data
were subject to mixed model ANOVA, the year, and location (nested
within year) were significantly different (Table 21). Positive
3560.4.3.5 soybean and negative NILs, and the interactions with the
3560.4.3.5 event were not significantly different for yield (Table
21). These data indicate that presence of event 3560.4.3.5 does not
impact final yield potential when NILs were tested across multiple
years and environments.
TABLE-US-00022 TABLE 21 Mixed model ANOVA for yield (kg ha.sup.-1)
of positive and negative NILs of event 3560.4.3.5, tested in
fourteen environments. Type 3 Tests of Fixed Effects Effect Num DF
Den DF F Value Pr > F Year 2 80 26.92 <.0001 Location(Year)
11 80 7.82 <.0001 glyat + hra 1 80 0.04 0.850 Year* glyat + hra
2 80 0.63 0.533 Location(Year)*glyat + 11 80 1.75 0.077 hra
[0353] Event 3560.4.3.5 was backcrossed into four different
Pioneer.RTM. conventional elite lines to confirm Mendelian
segregation, and to measure yield impact of the event in different
genetic backgrounds. For each of the four different BC1F2
populations tested, the seedlings segregated in a 3:1
(tolerant:susceptible) ratio, when analyzed using chlorsulfiiron
screening (Table 22). When event 3560.4.3.5 was forward crossed
into 31 different genetic backgrounds, all F2 populations examined
segregated in a 3:1 (tolerant:susceptible) ratio when sprayed in
the field with glyphosate (Table 22). These data suggest that in
different genetic backgrounds, event 3560.4.3.5 will confer
tolerance to glyphosate and ALS inhibitor herbicides, and will
segregate as a single dominant gene.
TABLE-US-00023 TABLE 22 F2 segregation ratios of event 3560.4.3.5
backcrossed into four different elite genetic backgrounds, and
forward crossed into 31 different elite genetic backgrounds. plants
observed plants expected Population Generation.sup..dagger.
Resistant Susceptible Resistant Susceptible P.sup..dagger-dbl.
3560.4.3.5x Elite7 BC1F2 700 222 691.5 230.5 0.518 3560.4.3.5x
Elite8 BC1F2 761 273 775.5 258.5 0.298 3560.4.3.5x Elite9 BC1F2 160
54 160.5 53.5 0.937 3560.4.3.5x Elite10 BC1F2 205 79 213.0 71.0
0.273 3560.4.3.5x PHI1 F2 53 23 57.0 19.0 0.289 3560.4.3.5x PHI2 F2
76 20 72.0 24.0 0.346 3560.4.3.5x PHI3 F2 66 24 67.5 22.5 0.715
3560.4.3.5x PHI4 F2 75 23 73.5 24.5 0.726 3560.4.3.5x PHI5 F2 99 23
91.5 30.5 0.117 3560.4.3.5x PHI6 F2 96 24 90.0 30.0 0.206
3560.4.3.5x PHI11 F2 72 18 67.5 22.5 0.273 3560.4.3.5x PHI12 F2 115
36 113.3 37.8 0.742 3560.4.3.5x PHI13 F2 91 22 84.8 28.3 0.175
3560.4.3.5x PHI14 F2 97 26 92.3 30.8 0.323 3560.4.3.5x PHI15 F2 88
28 87.0 29.0 0.830 3560.4.3.5x PHI16 F2 66 24 67.5 22.5 0.715
3560.4.3.5x PHI17 F2 75 34 81.8 27.3 0.135 3560.4.3.5x PHI18 F2 108
25 99.8 33.3 0.099 3560.4.3.5x PHI19 F2 78 26 78.0 26.0 1.000
3560.4.3.5x PHI20 F2 95 29 93.0 31.0 0.678 3560.4.3.5x PHI21 F2 109
37 109.5 36.5 0.924 3560.4.3.5x PHI22 F2 75 26 75.8 25.3 0.863
3560.4.3.5x PHI23 F2 85 19 78.0 26.0 0.113 3560.4.3.5x PHI24 F2 81
18 74.3 24.8 0.117 3560.4.3.5x PHI25 F2 76 23 74.3 24.8 0.685
3560.4.3.5x PHI26 F2 97 36 99.8 33.3 0.582 3560.4.3.5x PHI27 F2 98
28 94.5 31.5 0.471 3560.4.3.5x PHI28 F2 89 22 83.3 27.8 0.208
3560.4.3.5x PHI29 F2 71 24 71.3 23.8 0.953 3560.4.3.5x PHI30 F2 54
15 51.8 17.3 0.532 3560.4.3.5x PHI31 F2 73 20 69.8 23.3 0.436
3560.4.3.5x PHI32 F2 53 12 48.8 16.3 0.223 3560.4.3.5x PHI33 F2 96
26 91.5 30.5 0.347 3560.4.3.5x PHI34 F2 76 20 72.0 24.0 0.346
3560.4.3.5x PHI35 F2 69 18 65.3 21.8 0.353 .sup..dagger.BC1F2
populations were screened using chlorsulfuron solution on emerging
seedlings. F2 populations were grown in the field and sprayed with
2.24 kg ai ha.sup.-1 glyphosate + 0.25% v/v NIS + 2.24 kg ai
ha.sup.-1 AMS at the V4 growth stage. Resistant and susceptible
plants were counted approximately 7 days after treatment for all
populations examined. .sup..dagger-dbl.chi.sup.2 probability that
deviation from expected model is due to chance alone
[0354] To test the yield impact of event 3560.4.3.5 in different
genetic backgrounds, BC1F3 lines were developed that were either
homozygous positive or homozygous negative for the 3560.4.3.5 event
(Table 23). Since these lines are not true NILs, there may be some
confounding error associated with the preliminary yield tests
evaluated. For example, later maturing soybean lines typically have
higher yield compared to earlier maturing lines within the same
population. Therefore, maturity for each BC1F3 line was calculated
as the number of days from planting to the estimated R8 growth
stage (date when 95% of the pods had reached their mature pod
color). Maturity estimates for each line were developed based upon
direct comparison at each location to several non-transgenic
Pioneer.RTM. experimental lines of known maturity. For the
preliminary yield trail data analysis, maturity was analyzed as a
covariate by nesting within the 3560.4.3.5 event to allow for a
yield comparison between 3560.4.3.5 event positive and 3560.4.3.5
event negative lines at the same estimated maturity. It should be
noted that the BC1F3 glyat+hra positive versus glyat+hra negative
comparisons reported may also be confounded by the different
herbicide programs utilized. However, blocking conventional
cultivar trials from glyphosate tolerant trials has been a common
practice in soybean cultivar development programs. In addition, for
the 3560.4.3.5.times. elite data analysis presented, it was assumed
that segregation of background maturity alleles, disease resistance
alleles, and all other background genetic effects would occur at
the same frequency within a population of 3560.4.3.5 event positive
lines and within a population of 3560.4.3.5 event negative lines
derived from the same initial BC1F1 plant.
[0355] Yield LSMeans of 3560.4.3.5 event positive and 3560.4.3.5
event negative lines were examined for each of the four BC1F3
populations tested across different locations (Table 23). For the
BC1F3 population of 3560.4.3.5.times.RM22 Elite, the 3560.4.3.5
event positive lines within maturity group 113 had significantly
higher yield compared to the 3560.4.3.5 event negative lines within
maturity group 113 (Table 23). This difference was most likely due
to environmental effect, as for all the other maturity groupings,
3560.4.3.5 event positive and 3560.4.3.5 event negative lines were
not statistically different for yield (Table 23). In addition, at a
specific location, and when yield data from all locations tested
were pooled, 3560.4.3.5 event positive lines were not significantly
different for yield compared to 3560.4.3.5 event negative lines
within the 3560.4.3.5.times.RM22 Elite population (Table 23).
[0356] For the population of 3560.4.3.5.times.RM27 Elite BC1F3
lines, the 3560.4.3.5 event positive lines tested had a significant
yield advantage compared to the 3560.4.3.5 event negative lines
(Table 23). This observation is most likely due to an environmental
effect, as when all locations were pooled, there were no
significant differences detected for yield between 3560.4.3.5 event
positive and 3560.4.3.5 event negative lines (Table 23). In
addition, there were no significant differences detected for yield
when 3560.4.3.5 event positive lines were compared to 3560.4.3.5
event negative lines at each specific maturity grouping (Table
23).
[0357] At two locations, there were significant yield differences
observed within the population of 3560.4.3.5.times.RM30 Elite BC1F3
lines. 3560.4.3.5 event positive lines had significantly higher
yield compared to 3560.4.3.5 event negative lines, while at a
different location, the opposite effect was noted (Table 23). When
all locations are pooled, there was not a significant difference
detected for yield between 3560.4.3.5 event positive and 3560.4.3.5
event negative lines (Table 23). These results suggest
environmental influence was most likely causing the effect, as at
each specific maturity grouping, there were no significant
differences detected for yield when 3560.4.3.5 event positive lines
were directly compared to 3560.4.3.5 event negative sister lines
(Table 23).
[0358] Two significant yield differences were also observed within
the population of 3560.4, 3.5.times.RM38 Elite BC lines at specific
locations. In one of the replications, 3560.4.3.5 event positive
lines had significantly higher yield compared to glyat+hra negative
lines, while in another location, 3560.4.3.5 event negative lines
had a yield advantage (Table 23). There was not a significant
difference detected for yield when all locations were pooled for
this population, which suggested environmental influence within a
single location is causing the difference. At each of the maturity
groupings, there was only a significant yield effect detected at
maturity group 125, and in that case the 3560.4.3.5 event positive
lines had significantly higher yield compared to 3560.4.3.5 event
negative lines (Table 23). No distinct yield trends were evident
across the four populations tested, indicating presence of the
3560.4.3.5 event does not impact yield potential when integrated
into different genetic backgrounds.
TABLE-US-00024 TABLE 23 LSMeans for yield (kg ha.sup.-1) at a
location and a specific maturity for homozygous 3560.4.3.5 event
positive and 3560.4.3.5 event negative BC1F3 lines within four
different populations of event 3560.4.3.5x elite backgrounds.
3560.4.3.5 event Population Location.sup..dagger.
Maturity.sup..dagger-dbl. Positive Negative Difference.sup..sctn.
Pr > |t| 3560.4.3.5x RM22 ELITE A All 2471.74 2439.77 31.97
0.675 3560.4.3.5x RM22 ELITE B All 3491.77 3393.32 98.45 0.193
3560.4.3.5x RM22 ELITE C All 2683.63 2747.03 -63.40 0.402
3560.4.3.5x RM22 ELITE D All 3180.61 3144.42 36.19 0.632
3560.4.3.5x RM22 ELITE E All 2996.18 2912.63 83.55 0.271
3560.4.3.5x RM22 ELITE All All 2964.78 2927.43 37.35 0.341
3560.4.3.5x RM22 ELITE All 111 2801.79 2836.18 -34.39 0.807
3560.4.3.5x RM22 ELITE All 112 2927.15 2704.48 222.68 0.072
3560.4.3.5x RM22 ELITE All 113 2881.95 2686.65 195.30* 0.041
3560.4.3.5x RM22 ELITE All 114 2625.92 2811.09 -185.17 0.285
3560.4.3.5x RM22 ELITE All 115 2899.19 2839.28 59.91 0.633
3560.4.3.5x RM22 ELITE All 116 2848.24 2859.77 -11.53 0.920
3560.4.3.5x RM22 ELITE All 125 3183.30 2969.74 213.56 0.231
3560.4.3.5x RM22 ELITE All 126 2976.31 3045.30 -69.00 0.770
3560.4.3.5x RM22 ELITE All 127 2853.20 3029.97 -176.77 0.327
3560.4.3.5x RM22 ELITE All 128 3031.55 3030.07 1.48 0.986
3560.4.3.5x RM22 ELITE All 129 3088.60 2994.95 93.65 0.350
3560.4.3.5x RM22 ELITE All 130 3198.18 3166.12 32.06 0.803
3560.4.3.5x RM22 ELITE All 131 3117.01 2981.93 135.08 0.435
3560.4.3.5x RM22 ELITE All 132 3074.62 3028.53 46.09 0.705
3560.4.3.5x RM27 ELITE B All 3331.34 3406.61 -75.26 0.640
3560.4.3.5x RM27 ELITE C All 3218.79 2886.77 332.02* 0.014
3560.4.3.5x RM27 ELITE D All 3475.08 3417.17 57.91 0.656
3560.4.3.5x RM27 ELITE E All 3028.48 3149.72 -121.24 0.530
3560.4.3.5x RM27 ELITE F All 3099.48 3021.84 77.64 0.600
3560.4.3.5x RM27 ELITE All All 3230.63 3176.42 54.21 0.487
3560.4.3.5x RM27 ELITE All 122 3311.82 3145.60 166.22 0.497
3560.4.3.5x RM27 ELITE All 123 3226.68 3164.15 62.53 0.668
3560.4.3.5x RM27 ELITE All 125 3148.80 3238.51 -89.71 0.660
3560.4.3.5x RM27 ELITE All 126 3086.18 3213.06 -126.88 0.449
3560.4.3.5x RM27 ELITE All 127 3271.69 3168.42 103.28 0.670
3560.4.3.5x RM27 ELITE All 128 3237.08 3106.81 130.27 0.436
3560.4.3.5x RM27 ELITE All 130 3127.15 2987.23 139.92 0.594
3560.4.3.5x RM27 ELITE All 133 3435.66 3387.58 48.08 0.843
3560.4.3.5x RM30 ELITE C All 3298.88 2983.11 315.77* <.0001
3560.4.3.5x RM30 ELITE D All 3544.23 3693.09 -148.86* 0.029
3560.4.3.5x RM30 ELITE G All 3472.84 3481.88 -9.05 0.888
3560.4.3.55 x RM30 ELITE E All 3177.69 3229.61 -51.92 0.418
3560.4.3.5x RM30 ELITE F All 3002.89 2975.75 27.13 0.673
3560.4.3.5x RM30 ELITE All All 3299.30 3272.69 26.62 0.512
3560.4.3.5x RM30 ELITE All 123 3356.46 3010.13 346.33 0.063
3560.4.3.5x RM30 ELITE All 125 3276.10 3172.47 103.63 0.194
3560.4.3.5x RM30 ELITE All 126 3266.42 3168.61 97.81 0.228
3560.4.3.5x RM30 ELITE All 127 3297.75 3299.10 -1.35 0.984
3560.4.3.5x RM30 ELITE All 128 3285.84 3282.21 3.63 0.934
3560.4.3.5x RM30 ELITE All 129 3278.27 3407.86 -129.59 0.051
3560.4.3.5x RM30 ELITE All 130 3334.29 3568.44 -234.15 0.118
3560.4.3.5x RM38 ELITE C All 2734.84 2659.09 75.75 0.256
3560.4.3.5x RM38 ELITE G All 3228.83 3305.91 -77.08 0.248
3560.4.3.5x RM38 ELITE E All 3049.84 3190.55 -140.71* 0.040
3560.4.3.5x RM38 ELITE Fl All 2678.11 2611.45 66.65 0.344
3560.4.3.5x RM38 ELITE F2 All 2687.71 2507.70 180.02* 0.008
3560.4.3.5x RM38 ELITE All All 2875.87 2854.94 20.93 0.608
3560.4.3.5x RM38 ELITE All 122 2700.19 2803.14 -102.96 0.547
3560.4.3.5x RM38 ELITE All 124 2743.61 2824.11 -80.50 0.564
3560.4.3.5x RM38 ELITE All 125 3206.30 2880.53 325.77* 0.001
3560.4.3.5x RM38 ELITE All 126 2788.26 2864.36 -76.10 0.550
3560.4.3.5x RM38 ELITE All 127 2849.14 2929.84 -80.71 0.514
3560.4.3.5x RM38 ELITE All 128 2842.31 2989.39 -147.07 0.306
3560.4.3.5x RM38 ELITE All 129 2928.44 2884.00 44.44 0.490
3560.4.3.5x RM38 ELITE All 130 2918.29 2864.10 54.19 0.325
3560.4.3.5x RM38 ELITE All 131 2906.27 2655.01 251.26 0.057
.sup..dagger-dbl.Maturity is calculated as the average number of
days between planting and R8 growth stage for the plot.
.sup..sctn.Estimated yield LSMean difference between 3560.4.3.5
event positive and 3560.4.3.5 event negative lines. *Indicates
estimated yield difference is significant at P = 0.05.
TABLE-US-00025 TABLE 24 Description of Genetic Elements in Fragment
PHP20163A Location on fragment PHP20163A Size (base pair Genetic
(base position) Element pairs) Description 1 to 16 polylinker 16
Region for cloning genetic elements region 17 to 502 SCP1 promoter
486 Constitutive synthetic promoter comprising a portion of the
CaMV 35S promoter (Odell et al. (1985) Nature 313: 801-812 and the
Rsyn7-Syn II Core consensus promoter (U.S. Pat. No. 6,0720,050 and
6,555,673). 503 to 504 polylinker 2 Region for cloning genetic
elements region 505 to 571 TMV omega 5'- 67 An enhancer element
derived from the Tobacco UTR Mosaic Virus omega 5' untranslated
leader (Gallie and Walbot (1992) NAR 20: 4631-4638. 572 to 596
polylinker 25 Region for cloning genetic elements region 597 to
1037 glyat4601 gene 441 Synthetic glyphosate N-acetyltransferase
(glyat) gene (Castle et al. (2004) Science 304: 1151-1154). 1038 to
1053 polylinker 16 Region for cloning genetic elements region 1054
to 1369 pinII terminator 316 Terminator region from Solanum
tuberosum proteinase inhibitor II (pinII) gene (Keil et al. (1986)
NAR 14: 5641-5650; An et al. (1989) Plant Cell 1: 115-122. 1370 to
1385 polylinker 16 Region for cloning genetic elements region 1386
to 2030 SAMS promoter 645 Promoter of the S-adenosyl-L-methionine
synthetase (SAMS) gene from soybean (Falco and Li (2003) US
publication 2003/0226166. 2031 to 2089 SAMS 5'-UTR 59 5'
untranslated region of the SAMS gene from soybean (Falco and Li,
2003 US publication 2003/0226166). 2090 to 2680 SAMS intron 591
Intron within the 5'-untranslated region of the SAMS gene from
soybean (Falco and Li, 2003 US publication 2003/0226166). 2681 to
2696 SAMS 5'-UTR 16 5' untranslated region (UTR) of the SAMS gene
from soybean (Falco and Li, 2003 US publication 2003/0226166). 2697
to 4667 gm-hra gene 1971 Modified version of the acetolactate
synthase gene from soybean with 15 additional nucleotides on the 5'
end (2697 to 2711) derived from the SAMS gene and two nucleotide
changes within the coding sequence. 4668 to 5319 als terminator 652
Native terminator from the soybean acetolactate synthase gene. 5319
to 5362 polylinker 43 Region for cloning genetic elements
region
TABLE-US-00026 TABLE 25 Summary Table of SEQ ID NOS SEQ ID NO
Description 1 Left sequence junction SC36 2 Right sequence junction
D32ALS 3 complete inserted transgene 4 Left genomic border 5 Right
genomic border 6 complete flanking and complete transgene insert 7
Forward primer 8 Reverse primer 9 Taqman MGB probe 10 Left flanking
genomic/left border transgene (10 nt/10 nt) 11 Right flanking
genomic/right border transgene (10 nt/10 nt) 12 Left flanking
genomic/left bordertransgene (20 nt/20 nt) 13 Right flanking
genomic/right border transgene (20 nt/20 nt) 14 Left flanking
genomic/5' transgene 15 Right flanking genomic/3' transgene 16
Primer 1297 17 Primer 1298 18 Primer 1439 19 Primer 1514 20 Primer
1558 21 Primer 1660 22 Primer 1666 23 Primer 1679 24 Primer 1227 25
Primer 1297 26 Primer 1440 27 left flanking genomic/left border
transgene (30 nt/30 nt) 28 Right flanking genomic/right border
transgene (30 nt/30 nt) 29 SCP1 promoter probe 30 glyat4601 probe
31 pinII terminator probe 32 SAMS probe (5' end) 33 SAMS probe (3'
end) 34 gm-hra probe (5' end) 35 gm-hra probe (3' end) 36 als probe
37 Primer DP-356-f1 38 Primer DP-356-r1 39 Primer DP-356-p 40
Primer 1610 41 Left flanking genomic/transgene 42 Right flanking
genomic/transgene 43 181 nucleotides of the 5' end of transgene
insert 44 Primer 104312 45 Primer 104314 46 Probe 125323 47 Primer
109893 (endogenous control) 48 Primer 109894 (endogenous control)
49 Probe 125322 (endogenous control) 50 Primer 1473 51 Primer 1504
52 Primer 1505 53 Primer 1506 54 Primer 1549 55 Primer 1550
[0359] The article "a" and "an" are used herein to refer to one or
more than one (i.e., to at least one) of the grammatical object of
the article. By way of example, "an element" means one or more
element.
[0360] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0361] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
551787DNAGlycine maxmisc_feature(0)...(0)785 bp of 5' genomic
sequence of Event 3560.4.3.5 (SC36) 1aaagttaaaa atatcactaa
tacgtttcta aatgcatttt ttttagaaat tataagtttc 60tagcactcca ttggagttgt
atagaactac tactaatcta ctattaataa caatttatct 120cctccaaata
tttaagtaaa ctgcatattt agagaatgtt ggacagtaaa gctagccact
180caatatttag gtgctccccg aaagaggaaa gcaaacaagc caccagcact
tcaatcagta 240aagctagcca ctcaactcgc tctcttcaaa ttccctttta
cattttattt cagatcctcc 300acctagccaa gtaggtctca aaaggtttac
cccgcatatg cttagtcgcc gcaagctcca 360tataggttac tttgcgggct
actgaataga atcttcggtg aaaggcgtct accatatcgg 420cgcaactatt
gatcgagtgc gtgtatacca cgtgaatgcg acacccgaaa gactagcaga
480aaagtgcttc agcaacaaac tctcatcgtg agcagtgtct ctgctggcaa
tttcgaaatt 540actaatatgc tgctctcgag atctccactt ccatcataca
accgaaacca gctaaggaag 600gagcgatcca taagaatcgc ctcgaatagc
cataacctca tctcgccttc caccgcacca 660gcaagaggaa accgaattag
agctgaaaga atactagagc catcgtagga gaaccggatt 720cttgaccgat
cgacttttgc ccgaggtcgt taggtcgaat aggctaggtt tacgaaaaag 780agactaa
7872845DNAGlycine maxmisc_feature(0)...(0)845 bp of 3' genomic
sequence of Event 3560.4.3.5 (glyatD32ALS) 2cgcgtaatat catcattagg
aagacactgc ccatcttgaa taggatttta gctactaaat 60atgttgatgg tctttatgaa
aaactattaa ctaggaatat tatgctaccc atatggaaag 120aagacgctag
gggaatagaa agaccatcaa ataaacgaag tcaacaccag gtcttccgaa
180gcattaacaa ttacctattt aatatgtact cagtccgggt ggatatctca
ctacattgac 240gcagtttgtt caaagacgaa cgccctgaat tatgccatct
gcttaggctt tcaaatatgg 300tacgctctaa tgccaagcct tatgctggtc
ttagggtatt atcatcaaat ctttaagcca 360gaggtagtta aatacatcaa
ggacaccata ggagtatggc acaacgatat tgtcaagatc 420gcatcagatc
taataggcaa taatgaattc ttcatgcagc ccgacgtggg aacgctcgaa
480agcagtgggg cctctgggac agggaccaga cctgagtcgc taacatttgg
gaataagaga 540agtagatata cccaattttt taactagcca aggaaggaaa
gcgggaaagg tccgatacaa 600aggaaagggt tgcgaggctt aacgatttag
aatatagctg ttgaggtggc acttgttccc 660ccggggcggg ggtatatgcc
cgtagcttta ttctgtcact tctttcagat caatgaagtt 720gaaaagttat
agagtaaggg acccttgttt acaaagctgt cactccaaga actcgaagtc
780aagcatcttc gggaatatcc agattagtct tcaactagag aaaggatagg
aatctccttt 840gcaga 84535362DNAArtificial Sequencetransgene insert
for event 3560.4.3.5 3ggccgctcta gagatccgtc aacatggtgg agcacgacac
tctcgtctac tccaagaata 60tcaaagatac agtctcagaa gaccaaaggg ctattgagac
ttttcaacaa agggtaatat 120cgggaaacct cctcggattc cattgcccag
ctatctgtca cttcatcaaa aggacagtag 180aaaaggaagg tggcacctac
aaatgccatc attgcgataa aggaaaggct atcgttcaag 240atgcctctgc
cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa
300aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatgat
cctatgcgta 360tggtatgacg tgtgttcaag atgatgactt caaacctacc
tatgacgtat ggtatgacgt 420gtgtcgactg atgacttaga tccactcgag
cggctataaa tacgtaccta cgcaccctgc 480gctaccatcc ctagagctgc
agcttatttt tacaacaatt accaacaaca acaaacaaca 540aacaacatta
caattactat ttacaattac agtcgacccg ggatccacac gacaccatga
600tagaggtgaa accgattaac gcagaggata cctatgaact aaggcataga
atactcagac 660caaaccagcc gatagaagcg tgtatgtttg aaagcgattt
acttcgtggt gcatttcact 720taggcggctt ttacaggggc aaactgattt
ccatagcttc attccaccag gccgagcact 780cggaactcca aggccagaaa
cagtaccagc tccgaggtat ggctaccttg gaaggttatc 840gtgagcagaa
agcgggatca actctagtta aacacgctga agaaatcctt cgtaagaggg
900gggcggacat gctttggtgt aatgcgagga catccgcctc aggctactac
aaaaagttag 960gcttcagcga gcagggagag atatttgaca cgccgccagt
aggacctcac atcctgatgt 1020ataaaaggat cacataacta gctagtcagt
taacctagac ttgtccatct tctggattgg 1080ccaacttaat taatgtatga
aataaaagga tgcacacata gtgacatgct aatcactata 1140atgtgggcat
caaagttgtg tgttatgtgt aattactagt tatctgaata aaagagaaag
1200agatcatcca tatttcttat cctaaatgaa tgtcacgtgt ctttataatt
ctttgatgaa 1260ccagatgcat ttcattaacc aaatccatat acatataaat
attaatcata tataattaat 1320atcaattggg ttagcaaaac aaatctagtc
taggtgtgtt ttgcgaattc gatatcaagc 1380tttgctctag atcaaactca
catccaaaca taacatggat atcttcctta ccaatcatac 1440taattatttt
gggttaaata ttaatcatta tttttaagat attaattaag aaattaaaag
1500attttttaaa aaaatgtata aaattatatt attcatgatt tttcatacat
ttgattttga 1560taataaatat atttttttta atttcttaaa aaatgttgca
agacacttat tagacatagt 1620cttgttctgt ttacaaaagc attcatcatt
taatacatta aaaaatattt aatactaaca 1680gtagaatctt cttgtgagtg
gtgtgggagt aggcaacctg gcattgaaac gagagaaaga 1740gagtcagaac
cagaagacaa ataaaaagta tgcaacaaac aaatcaaaat caaagggcaa
1800aggctggggt tggctcaatt ggttgctaca ttcaattttc aactcagtca
acggttgaga 1860ttcactctga cttccccaat ctaagccgcg gatgcaaacg
gttgaatcta acccacaatc 1920caatctcgtt acttaggggc ttttccgtca
ttaactcacc cctgccaccc ggtttcccta 1980taaattggaa ctcaatgctc
ccctctaaac tcgtatcgct tcagagttga gaccaagaca 2040cactcgttca
tatatctctc tgctcttctc ttctcttcta cctctcaagg tacttttctt
2100ctccctctac caaatcctag attccgtggt tcaatttcgg atcttgcact
tctggtttgc 2160tttgccttgc tttttcctca actgggtcca tctaggatcc
atgtgaaact ctactctttc 2220tttaatatct gcggaatacg cgtttgactt
tcagatctag tcgaaatcat ttcataattg 2280cctttctttc ttttagctta
tgagaaataa aatcactttt tttttatttc aaaataaacc 2340ttgggccttg
tgctgactga gatggggttt ggtgattaca gaattttagc gaattttgta
2400attgtacttg tttgtctgta gttttgtttt gttttcttgt ttctcataca
ttccttaggc 2460ttcaatttta ttcgagtata ggtcacaata ggaattcaaa
ctttgagcag gggaattaat 2520cccttccttc aaatccagtt tgtttgtata
tatgtttaaa aaatgaaact tttgctttaa 2580attctattat aacttttttt
atggctgaaa tttttgcatg tgtctttgct ctctgttgta 2640aatttactgt
ttaggtacta actctaggct tgttgtgcag tttttgaagt ataaccatgc
2700cacacaacac aatggcggcc accgcttcca gaaccacccg attctcttct
tcctcttcac 2760accccacctt ccccaaacgc attactagat ccaccctccc
tctctctcat caaaccctca 2820ccaaacccaa ccacgctctc aaaatcaaat
gttccatctc caaacccccc acggcggcgc 2880ccttcaccaa ggaagcgccg
accacggagc ccttcgtgtc acggttcgcc tccggcgaac 2940ctcgcaaggg
cgcggacatc cttgtggagg cgctggagag gcagggcgtg acgacggtgt
3000tcgcgtaccc cggcggtgcg tcgatggaga tccaccaggc gctcacgcgc
tccgccgcca 3060tccgcaacgt gctcccgcgc cacgagcagg gcggcgtctt
cgccgccgaa ggctacgcgc 3120gttcctccgg cctccccggc gtctgcattg
ccacctccgg ccccggcgcc accaacctcg 3180tgagcggcct cgccgacgct
ttaatggaca gcgtcccagt cgtcgccatc accggccagg 3240tcgcccgccg
gatgatcggc accgacgcct tccaagaaac cccgatcgtg gaggtgagca
3300gatccatcac gaagcacaac tacctcatcc tcgacgtcga cgacatcccc
cgcgtcgtcg 3360ccgaggcttt cttcgtcgcc acctccggcc gccccggtcc
ggtcctcatc gacattccca 3420aagacgttca gcagcaactc gccgtgccta
attgggacga gcccgttaac ctccccggtt 3480acctcgccag gctgcccagg
ccccccgccg aggcccaatt ggaacacatt gtcagactca 3540tcatggaggc
ccaaaagccc gttctctacg tcggcggtgg cagtttgaat tccagtgctg
3600aattgaggcg ctttgttgaa ctcactggta ttcccgttgc tagcacttta
atgggtcttg 3660gaacttttcc tattggtgat gaatattccc ttcagatgct
gggtatgcat ggtactgttt 3720atgctaacta tgctgttgac aatagtgatt
tgttgcttgc ctttggggta aggtttgatg 3780accgtgttac tgggaagctt
gaggcttttg ctagtagggc taagattgtt cacattgata 3840ttgattctgc
cgagattggg aagaacaagc aggcgcacgt gtcggtttgc gcggatttga
3900agttggcctt gaagggaatt aatatgattt tggaggagaa aggagtggag
ggtaagtttg 3960atcttggagg ttggagagaa gagattaatg tgcagaaaca
caagtttcca ttgggttaca 4020agacattcca ggacgcgatt tctccgcagc
atgctatcga ggttcttgat gagttgacta 4080atggagatgc tattgttagt
actggggttg ggcagcatca aatgtgggct gcgcagtttt 4140acaagtacaa
gagaccgagg cagtggttga cctcaggggg tcttggagcc atgggttttg
4200gattgcctgc ggctattggt gctgctgttg ctaaccctgg ggctgttgtg
gttgacattg 4260atggggatgg tagtttcatc atgaatgttc aggagttggc
cactataaga gtggagaatc 4320tcccagttaa gatattgttg ttgaacaatc
agcatttggg tatggtggtt cagttggagg 4380ataggttcta caagtccaat
agagctcaca cctatcttgg agatccgtct agcgagagcg 4440agatattccc
aaacatgctc aagtttgctg atgcttgtgg gataccggca gcgcgagtga
4500cgaagaagga agagcttaga gcggcaattc agagaatgtt ggacacccct
ggcccctacc 4560ttcttgatgt cattgtgccc catcaggagc atgtgttgcc
gatgattccc agtaatggat 4620ccttcaagga tgtgataact gagggtgatg
gtagaacgag gtactgattg cctagaccaa 4680atgttccttg atgcttgttt
tgtacaatat atataagata atgctgtcct agttgcagga 4740tttggcctgt
ggtgagcatc atagtctgta gtagttttgg tagcaagaca ttttattttc
4800cttttattta acttactaca tgcagtagca tctatctatc tctgtagtct
gatatctcct 4860gttgtctgta ttgtgccgtt ggattttttg ctgtagtgag
actgaaaatg atgtgctagt 4920aataatattt ctgttagaaa tctaagtaga
gaatctgttg aagaagtcaa aagctaatgg 4980aatcaggtta catattcaat
gtttttcttt ttttagcggt tggtagacgt gtagattcaa 5040cttctcttgg
agctcaccta ggcaatcagt aaaatgcata ttcctttttt aacttgccat
5100ttatttactt ttagtggaaa ttgtgaccaa tttgttcatg tagaacggat
ttggaccatt 5160gcgtccacaa aacgtctctt ttgctcgatc ttcacaaagc
gataccgaaa tccagagata 5220gttttcaaaa gtcagaaatg gcaaagttat
aaatagtaaa acagaataga tgctgtaatc 5280gacttcaata acaagtggca
tcacgtttct agttctagac ccatcagctg ggccggccac 5340tagtgagctc
ggtacccggg gg 536243317DNAGlycine maxmisc_feature(0)...(0)5'
genomic sequence of event 3560.4.3.5 4agcaattgtt ttgtgcattt
ccaaatttca atctgattta ttaaataaaa aaattttaat 60tcgggttgat tgtaaatcag
ctaaagacat tttacagaaa gacgtcaaaa atcttggctc 120caaacaaatt
tttgcaagat ggcaagcaat attaagtgtt tttgattttg acagaatata
180tcaagggcac tttaaactct ctacctaact atcttacacg tgaattctta
tagacaaatt 240ctcatgccac ctaaggcatc aggcacccct ctcaggggta
gacgaagcac gagtaaagga 300ttcaagttgg ccctaccaga gccaactatc
aaaaagagtt cttccgcatc ctctgggtca 360tctacccaaa aacctaaaat
aaaagggtca tcaacccaaa tagtcaccat caaacctgag 420tcatccactc
aggaatcccc aaaaccttca acctcaaaac aaacaaaggc cgactatacc
480ttctcagtac aacactccag gccctacaag aaattggtct aaccaaactc
ccaaaactcg 540ccaaaaagac ttgggcagac attgcctcag aatctaatga
tgaatttgaa actgatttac 600aaatcatgat tcaaaactcc aaacaatcca
aaacgattgt caatccaaaa ggaaaacaga 660ccttatccca acaaaagaca
ccattaccaa aacctactaa cagttatatt tacaaaaata 720aatttccaac
tgttttgtag atggagccaa aattttggga caaaaatccc ttcaaggcta
780cagccaaggc atttccaccg ggcttccatt tcaaacctat ttccaccaat
aaaacaagaa 840tcttttacga attcatactg atagacacaa actcagtgtc
tattaaacac ttcaaagacc 900caaatgacat aaatttaaac actcattcaa
ccatccagat tttaaagttc atacaacctc 960gacaatgtgg aacaaatata
aatcaagcca aacaattctt tgtacccttt gatcctatag 1020gttacactat
tgggattatg tagatgcatg gaccaatgta ttctggcatc aaaataacaa
1080attcaaacat tcttggctta tttatttcaa aactaacacc gtctataatt
ttccaaattg 1140gttcctccaa cggtgggact tttttggacc aaactttgat
atctacccgg agcaagtcca 1200acaagggttt gatcagttca aaaaaatgtt
caattctcag gaatcacgaa tccctgtaga 1260cctaaaatac ttttccaatt
ttgcattgtc gtggatattt tcatggcaat acagatatgg 1320gaaaactgaa
aacaacaagc agtttccatc actgcaacat catgcattta tcaagtggtg
1380gaattagttt gatacatcaa aagcagcacc agatcaagtg agaatctggt
ttcaagccca 1440tccagaattt ttgaaagttg ctaatcctga gacttcttta
ttcctcaatc agaagtctca 1500attagctgct ttcctttcta gttccaagtc
aaaagaaatt ctggcacaaa atctaaaaga 1560agtcctacag cttctccaac
aagaagaaga taaaggctct tcctcaaaga aggaagataa 1620caattcttca
aaagaagatg acgacccttt ctaccaaaat gaaaatgatt gttttggtat
1680ttctctaaat gatgattaat taaaaaatta catgtactat gtaaatagtt
tcggtcacga 1740aactggcact gtagctacag taaattttat ggctatttaa
ggagttctcg gcccatttgt 1800gaggtacctt ttcaggtagt cagatctcta
tttttagaga gagaaactct aggaaacaat 1860ctttgtaagt ttttctttcg
atttcaataa attcaaagtt ttctcttcat atctcttctc 1920cctcttgacc
ggtcctgtgc ggttctgcca tcgcttcagt ttcttctctt ctctcccctt
1980atcgatattg tgtggctcta ttgccacttc gatttctttt atgttgcttt
cattttaatt 2040tgttttacca ttttcttttg atattataat ttctatttaa
ctcttggtca tactgcatat 2100attcataata tattcttaca tcctatctat
ccgtttgatc tcttttcact gttatatata 2160tatatatata tatatatatc
gtttaacttc atgttagtaa taagattaga gtaaaaaata 2220tatatataac
gaagttattt taacaaaagg tatttttgta aaaaaaaatt atatgctaaa
2280aaagttttac tatatctaag catgattttt tttaattccc aaaacacgtg
taaatatttt 2340taggaatatt ttgtaaaaaa tcaaacattt ttttaattat
tcgtataaaa catcaatctt 2400taagaatcat aatttttaga aatcatgatt
tctggatata aaaatacttt ttcttgcagc 2460caaacgtctt ctaaagccac
atgttaatgg gtgtacaaat tataaagttt ttataaacat 2520atcacttttt
aaagttaaaa atatcactaa tacgtttcta aatgcatttt ttttagaaat
2580tataagtttc tagcactcca ttggagttgt atagaactac tactaatcta
ctattaataa 2640caatttatct cctccaaata tttaagtaaa ctgcatattt
agagaatgtt ggacagtaaa 2700gctagccact caatatttag gtgctccccg
aaagaggaaa gcaaacaagc caccagcact 2760tcaatcagta aagctagcca
ctcaactcgc tctcttcaaa ttccctttta cattttattt 2820cagatcctcc
acctagccaa gtaggtctca aaaggtttac cccgcatatg cttagtcgcc
2880gcaagctcca tataggttac tttgcgggct actgaataga atcttcggtg
aaaggcgtct 2940accatatcgg cgcaactatt gatcgagtgc gtgtatacca
cgtgaatgcg acacccgaaa 3000gactagcaga aaagtgcttc agcaacaaac
tctcatcgtg agcagtgtct ctgctggcaa 3060tttcgaaatt actaatatgc
tgctctcgag atctccactt ccatcataca accgaaacca 3120gctaaggaag
gagcgatcca taagaatcgc ctcgaatagc cataacctca tctcgccttc
3180caccgcacca gcaagaggaa accgaattag agctgaaaga atactagagc
catcgtagga 3240gaaccggatt cttgaccgat cgacttttgc ccgaggtcgt
taggtcgaat aggctaggtt 3300tacgaaaaag agactaa 331752170DNAGlycine
maxmisc_feature(0)...(0)3' genomic sequence for event 3560.4.3.5
5cgcgtaatat catcattagg aagacactgc ccatcttgaa taggatttta gctactaaat
60atgttgatgg tctttatgaa aaactattaa ctaggaatat tatgctaccc atatggaaag
120aagacgctag gggaatagaa agaccatcaa ataaacgaag tcaacaccag
gtcttccgaa 180gcattaacaa ttacctattt aatatgtact cagtccgggt
ggatatctca ctacattgac 240gcagtttgtt caaagacgaa cgccctgaat
tatgccatct gcttaggctt tcaaatatgg 300tacgctctaa tgccaagcct
tatgctggtc ttagggtatt atcatcaaat ctttaagcca 360gaggtagtta
aatacatcaa ggacaccata ggagtatggc acaacgatat tgtcaagatc
420gcatcagatc taataggcaa taatgaattc ttcatgcagc ccgacgtggg
aacgctcgaa 480agcagtgggg cctctgggac agggaccaga cctgagtcgc
taacatttgg gaataagaga 540agtagatata cccaattttt taactagcca
aggaaggaaa gcgggaaagg tccgatacaa 600aggaaagggt tgcgaggctt
aacgatttag aatatagctg ttgaggtggc acttgttccc 660ccggggcggg
ggtatatgcc cgtagcttta ttctgtcact tctttcagat caatgaagtt
720gaaaagttat agagtaaggg acccttgttt acaaagctgt cactccaaga
actcgaagtc 780aagcatcttc gggaatatcc agattagtct tcaactagag
aaaggatagg aatctccttt 840gcagagtttt cttctcctgc tgatgtagcg
gtaaagtcaa aagttggatg cccttttttc 900tttatttaat taattccgtt
gatagagctt ttgagcggat gcaagcacta gattcttcaa 960cgagtaccaa
taataaatga attcaccaga ctaagagaag aaaacagaac aaaaagatta
1020agcccagccg ccttcgggaa gacctatctt cgtcgggagg aagagccctc
tttacaccat 1080tgtgattaga aaaaaccgaa aagtggaccg gcctagtaac
caatagagcg gggcttgatc 1140cccactttaa atctattgga tagagccctc
agcccagggc aagcgattga attctatttg 1200attatgggtt aggtggaacc
tgaaactagc acttacaaat gagttagcaa aaggaaaaag 1260acaattctca
aatgcgtaca agactttctt ccttctttgt ttaagaggcc agtctgcgat
1320ggatgctcgt gcatgaaaaa gggctttgat ctattcacca cttatataat
agagccaatc 1380tctgcaggac aagatatcta ttttgtcatt gggaagtaag
gcttaagtcg acgaaaaagt 1440taggaaaggg gatcatatgg ctagggttgc
cctcggggct caagggttta gcgatgaaga 1500gtgccaagca aaaggtcaat
accggtacgc cgatcaaaga agtccagtgg caaggccctt 1560tcagccaagc
tagcgtgctg aacagaaagt cgtagagtga tgacagcttc ttcttcttga
1620gtcattcgtg tgacaacatc aggatctcgt cgaaagacct cctctgccta
tctctcccgc 1680aagagaggac tcgttatggc gcacctcttt ttagcagtct
cgtcaataag ataagattgc 1740ccctcccttc ttattgattt gataaagggc
tttgtccact ccctctcttc ttagccgagc 1800ggagtgacgg tttagtttag
gctttagatg ccactgcgaa agactctaga gatccactct 1860cacagcgtat
acgcgacatc cctatgtata cacaatcctt tcaagcagct aggacagcta
1920gcaagcaagt tatctgttcg cggacaagct ctctggatga caaaaaacat
gctctttcat 1980gcggaaaaaa cacggtcttt cgtggaagtt ggtcgatttg
aagtcgcttt atgagtgaaa 2040atgggtcgat gacgaaaaag acggggaaaa
tgatcaactg tcacattttg atgccagttt 2100agggctaaaa tgaactttca
tccaaaaaga ccgagaaaac gctccactgg caggatccga 2160tcggaaataa
2170610849DNAArtificial Sequencetransgene insert for event
3560.4.3.5 plus 5' and 3' genomic flanking sequence 6agcaattgtt
ttgtgcattt ccaaatttca atctgattta ttaaataaaa aaattttaat 60tcgggttgat
tgtaaatcag ctaaagacat tttacagaaa gacgtcaaaa atcttggctc
120caaacaaatt tttgcaagat ggcaagcaat attaagtgtt tttgattttg
acagaatata 180tcaagggcac tttaaactct ctacctaact atcttacacg
tgaattctta tagacaaatt 240ctcatgccac ctaaggcatc aggcacccct
ctcaggggta gacgaagcac gagtaaagga 300ttcaagttgg ccctaccaga
gccaactatc aaaaagagtt cttccgcatc ctctgggtca 360tctacccaaa
aacctaaaat aaaagggtca tcaacccaaa tagtcaccat caaacctgag
420tcatccactc aggaatcccc aaaaccttca acctcaaaac aaacaaaggc
cgactatacc 480ttctcagtac aacactccag gccctacaag aaattggtct
aaccaaactc ccaaaactcg 540ccaaaaagac ttgggcagac attgcctcag
aatctaatga tgaatttgaa actgatttac 600aaatcatgat tcaaaactcc
aaacaatcca aaacgattgt caatccaaaa ggaaaacaga 660ccttatccca
acaaaagaca ccattaccaa aacctactaa cagttatatt tacaaaaata
720aatttccaac tgttttgtag atggagccaa aattttggga caaaaatccc
ttcaaggcta 780cagccaaggc atttccaccg ggcttccatt tcaaacctat
ttccaccaat aaaacaagaa 840tcttttacga attcatactg atagacacaa
actcagtgtc tattaaacac ttcaaagacc 900caaatgacat aaatttaaac
actcattcaa ccatccagat tttaaagttc atacaacctc 960gacaatgtgg
aacaaatata aatcaagcca aacaattctt tgtacccttt gatcctatag
1020gttacactat tgggattatg tagatgcatg gaccaatgta ttctggcatc
aaaataacaa 1080attcaaacat tcttggctta tttatttcaa aactaacacc
gtctataatt ttccaaattg 1140gttcctccaa cggtgggact tttttggacc
aaactttgat atctacccgg agcaagtcca 1200acaagggttt gatcagttca
aaaaaatgtt caattctcag gaatcacgaa tccctgtaga 1260cctaaaatac
ttttccaatt ttgcattgtc gtggatattt tcatggcaat acagatatgg
1320gaaaactgaa aacaacaagc agtttccatc actgcaacat catgcattta
tcaagtggtg 1380gaattagttt gatacatcaa aagcagcacc agatcaagtg
agaatctggt ttcaagccca 1440tccagaattt ttgaaagttg ctaatcctga
gacttcttta ttcctcaatc agaagtctca 1500attagctgct ttcctttcta
gttccaagtc aaaagaaatt ctggcacaaa atctaaaaga 1560agtcctacag
cttctccaac aagaagaaga taaaggctct tcctcaaaga aggaagataa
1620caattcttca aaagaagatg acgacccttt ctaccaaaat gaaaatgatt
gttttggtat 1680ttctctaaat gatgattaat taaaaaatta catgtactat
gtaaatagtt tcggtcacga 1740aactggcact gtagctacag taaattttat
ggctatttaa ggagttctcg gcccatttgt 1800gaggtacctt ttcaggtagt
cagatctcta tttttagaga gagaaactct
aggaaacaat 1860ctttgtaagt ttttctttcg atttcaataa attcaaagtt
ttctcttcat atctcttctc 1920cctcttgacc ggtcctgtgc ggttctgcca
tcgcttcagt ttcttctctt ctctcccctt 1980atcgatattg tgtggctcta
ttgccacttc gatttctttt atgttgcttt cattttaatt 2040tgttttacca
ttttcttttg atattataat ttctatttaa ctcttggtca tactgcatat
2100attcataata tattcttaca tcctatctat ccgtttgatc tcttttcact
gttatatata 2160tatatatata tatatatatc gtttaacttc atgttagtaa
taagattaga gtaaaaaata 2220tatatataac gaagttattt taacaaaagg
tatttttgta aaaaaaaatt atatgctaaa 2280aaagttttac tatatctaag
catgattttt tttaattccc aaaacacgtg taaatatttt 2340taggaatatt
ttgtaaaaaa tcaaacattt ttttaattat tcgtataaaa catcaatctt
2400taagaatcat aatttttaga aatcatgatt tctggatata aaaatacttt
ttcttgcagc 2460caaacgtctt ctaaagccac atgttaatgg gtgtacaaat
tataaagttt ttataaacat 2520atcacttttt aaagttaaaa atatcactaa
tacgtttcta aatgcatttt ttttagaaat 2580tataagtttc tagcactcca
ttggagttgt atagaactac tactaatcta ctattaataa 2640caatttatct
cctccaaata tttaagtaaa ctgcatattt agagaatgtt ggacagtaaa
2700gctagccact caatatttag gtgctccccg aaagaggaaa gcaaacaagc
caccagcact 2760tcaatcagta aagctagcca ctcaactcgc tctcttcaaa
ttccctttta cattttattt 2820cagatcctcc acctagccaa gtaggtctca
aaaggtttac cccgcatatg cttagtcgcc 2880gcaagctcca tataggttac
tttgcgggct actgaataga atcttcggtg aaaggcgtct 2940accatatcgg
cgcaactatt gatcgagtgc gtgtatacca cgtgaatgcg acacccgaaa
3000gactagcaga aaagtgcttc agcaacaaac tctcatcgtg agcagtgtct
ctgctggcaa 3060tttcgaaatt actaatatgc tgctctcgag atctccactt
ccatcataca accgaaacca 3120gctaaggaag gagcgatcca taagaatcgc
ctcgaatagc cataacctca tctcgccttc 3180caccgcacca gcaagaggaa
accgaattag agctgaaaga atactagagc catcgtagga 3240gaaccggatt
cttgaccgat cgacttttgc ccgaggtcgt taggtcgaat aggctaggtt
3300tacgaaaaag agactaaggc cgctctagag atccgtcaac atggtggagc
acgacactct 3360cgtctactcc aagaatatca aagatacagt ctcagaagac
caaagggcta ttgagacttt 3420tcaacaaagg gtaatatcgg gaaacctcct
cggattccat tgcccagcta tctgtcactt 3480catcaaaagg acagtagaaa
aggaaggtgg cacctacaaa tgccatcatt gcgataaagg 3540aaaggctatc
gttcaagatg cctctgccga cagtggtccc aaagatggac ccccacccac
3600gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag
tggattgatg 3660tgatgatcct atgcgtatgg tatgacgtgt gttcaagatg
atgacttcaa acctacctat 3720gacgtatggt atgacgtgtg tcgactgatg
acttagatcc actcgagcgg ctataaatac 3780gtacctacgc accctgcgct
accatcccta gagctgcagc ttatttttac aacaattacc 3840aacaacaaca
aacaacaaac aacattacaa ttactattta caattacagt cgacccggga
3900tccacacgac accatgatag aggtgaaacc gattaacgca gaggatacct
atgaactaag 3960gcatagaata ctcagaccaa accagccgat agaagcgtgt
atgtttgaaa gcgatttact 4020tcgtggtgca tttcacttag gcggctttta
caggggcaaa ctgatttcca tagcttcatt 4080ccaccaggcc gagcactcgg
aactccaagg ccagaaacag taccagctcc gaggtatggc 4140taccttggaa
ggttatcgtg agcagaaagc gggatcaact ctagttaaac acgctgaaga
4200aatccttcgt aagagggggg cggacatgct ttggtgtaat gcgaggacat
ccgcctcagg 4260ctactacaaa aagttaggct tcagcgagca gggagagata
tttgacacgc cgccagtagg 4320acctcacatc ctgatgtata aaaggatcac
ataactagct agtcagttaa cctagacttg 4380tccatcttct ggattggcca
acttaattaa tgtatgaaat aaaaggatgc acacatagtg 4440acatgctaat
cactataatg tgggcatcaa agttgtgtgt tatgtgtaat tactagttat
4500ctgaataaaa gagaaagaga tcatccatat ttcttatcct aaatgaatgt
cacgtgtctt 4560tataattctt tgatgaacca gatgcatttc attaaccaaa
tccatataca tataaatatt 4620aatcatatat aattaatatc aattgggtta
gcaaaacaaa tctagtctag gtgtgttttg 4680cgaattcgat atcaagcttt
gctctagatc aaactcacat ccaaacataa catggatatc 4740ttccttacca
atcatactaa ttattttggg ttaaatatta atcattattt ttaagatatt
4800aattaagaaa ttaaaagatt ttttaaaaaa atgtataaaa ttatattatt
catgattttt 4860catacatttg attttgataa taaatatatt ttttttaatt
tcttaaaaaa tgttgcaaga 4920cacttattag acatagtctt gttctgttta
caaaagcatt catcatttaa tacattaaaa 4980aatatttaat actaacagta
gaatcttctt gtgagtggtg tgggagtagg caacctggca 5040ttgaaacgag
agaaagagag tcagaaccag aagacaaata aaaagtatgc aacaaacaaa
5100tcaaaatcaa agggcaaagg ctggggttgg ctcaattggt tgctacattc
aattttcaac 5160tcagtcaacg gttgagattc actctgactt ccccaatcta
agccgcggat gcaaacggtt 5220gaatctaacc cacaatccaa tctcgttact
taggggcttt tccgtcatta actcacccct 5280gccacccggt ttccctataa
attggaactc aatgctcccc tctaaactcg tatcgcttca 5340gagttgagac
caagacacac tcgttcatat atctctctgc tcttctcttc tcttctacct
5400ctcaaggtac ttttcttctc cctctaccaa atcctagatt ccgtggttca
atttcggatc 5460ttgcacttct ggtttgcttt gccttgcttt ttcctcaact
gggtccatct aggatccatg 5520tgaaactcta ctctttcttt aatatctgcg
gaatacgcgt ttgactttca gatctagtcg 5580aaatcatttc ataattgcct
ttctttcttt tagcttatga gaaataaaat cacttttttt 5640ttatttcaaa
ataaaccttg ggccttgtgc tgactgagat ggggtttggt gattacagaa
5700ttttagcgaa ttttgtaatt gtacttgttt gtctgtagtt ttgttttgtt
ttcttgtttc 5760tcatacattc cttaggcttc aattttattc gagtataggt
cacaatagga attcaaactt 5820tgagcagggg aattaatccc ttccttcaaa
tccagtttgt ttgtatatat gtttaaaaaa 5880tgaaactttt gctttaaatt
ctattataac tttttttatg gctgaaattt ttgcatgtgt 5940ctttgctctc
tgttgtaaat ttactgttta ggtactaact ctaggcttgt tgtgcagttt
6000ttgaagtata accatgccac acaacacaat ggcggccacc gcttccagaa
ccacccgatt 6060ctcttcttcc tcttcacacc ccaccttccc caaacgcatt
actagatcca ccctccctct 6120ctctcatcaa accctcacca aacccaacca
cgctctcaaa atcaaatgtt ccatctccaa 6180accccccacg gcggcgccct
tcaccaagga agcgccgacc acggagccct tcgtgtcacg 6240gttcgcctcc
ggcgaacctc gcaagggcgc ggacatcctt gtggaggcgc tggagaggca
6300gggcgtgacg acggtgttcg cgtaccccgg cggtgcgtcg atggagatcc
accaggcgct 6360cacgcgctcc gccgccatcc gcaacgtgct cccgcgccac
gagcagggcg gcgtcttcgc 6420cgccgaaggc tacgcgcgtt cctccggcct
ccccggcgtc tgcattgcca cctccggccc 6480cggcgccacc aacctcgtga
gcggcctcgc cgacgcttta atggacagcg tcccagtcgt 6540cgccatcacc
ggccaggtcg cccgccggat gatcggcacc gacgccttcc aagaaacccc
6600gatcgtggag gtgagcagat ccatcacgaa gcacaactac ctcatcctcg
acgtcgacga 6660catcccccgc gtcgtcgccg aggctttctt cgtcgccacc
tccggccgcc ccggtccggt 6720cctcatcgac attcccaaag acgttcagca
gcaactcgcc gtgcctaatt gggacgagcc 6780cgttaacctc cccggttacc
tcgccaggct gcccaggccc cccgccgagg cccaattgga 6840acacattgtc
agactcatca tggaggccca aaagcccgtt ctctacgtcg gcggtggcag
6900tttgaattcc agtgctgaat tgaggcgctt tgttgaactc actggtattc
ccgttgctag 6960cactttaatg ggtcttggaa cttttcctat tggtgatgaa
tattcccttc agatgctggg 7020tatgcatggt actgtttatg ctaactatgc
tgttgacaat agtgatttgt tgcttgcctt 7080tggggtaagg tttgatgacc
gtgttactgg gaagcttgag gcttttgcta gtagggctaa 7140gattgttcac
attgatattg attctgccga gattgggaag aacaagcagg cgcacgtgtc
7200ggtttgcgcg gatttgaagt tggccttgaa gggaattaat atgattttgg
aggagaaagg 7260agtggagggt aagtttgatc ttggaggttg gagagaagag
attaatgtgc agaaacacaa 7320gtttccattg ggttacaaga cattccagga
cgcgatttct ccgcagcatg ctatcgaggt 7380tcttgatgag ttgactaatg
gagatgctat tgttagtact ggggttgggc agcatcaaat 7440gtgggctgcg
cagttttaca agtacaagag accgaggcag tggttgacct cagggggtct
7500tggagccatg ggttttggat tgcctgcggc tattggtgct gctgttgcta
accctggggc 7560tgttgtggtt gacattgatg gggatggtag tttcatcatg
aatgttcagg agttggccac 7620tataagagtg gagaatctcc cagttaagat
attgttgttg aacaatcagc atttgggtat 7680ggtggttcag ttggaggata
ggttctacaa gtccaataga gctcacacct atcttggaga 7740tccgtctagc
gagagcgaga tattcccaaa catgctcaag tttgctgatg cttgtgggat
7800accggcagcg cgagtgacga agaaggaaga gcttagagcg gcaattcaga
gaatgttgga 7860cacccctggc ccctaccttc ttgatgtcat tgtgccccat
caggagcatg tgttgccgat 7920gattcccagt aatggatcct tcaaggatgt
gataactgag ggtgatggta gaacgaggta 7980ctgattgcct agaccaaatg
ttccttgatg cttgttttgt acaatatata taagataatg 8040ctgtcctagt
tgcaggattt ggcctgtggt gagcatcata gtctgtagta gttttggtag
8100caagacattt tattttcctt ttatttaact tactacatgc agtagcatct
atctatctct 8160gtagtctgat atctcctgtt gtctgtattg tgccgttgga
ttttttgctg tagtgagact 8220gaaaatgatg tgctagtaat aatatttctg
ttagaaatct aagtagagaa tctgttgaag 8280aagtcaaaag ctaatggaat
caggttacat attcaatgtt tttctttttt tagcggttgg 8340tagacgtgta
gattcaactt ctcttggagc tcacctaggc aatcagtaaa atgcatattc
8400cttttttaac ttgccattta tttactttta gtggaaattg tgaccaattt
gttcatgtag 8460aacggatttg gaccattgcg tccacaaaac gtctcttttg
ctcgatcttc acaaagcgat 8520accgaaatcc agagatagtt ttcaaaagtc
agaaatggca aagttataaa tagtaaaaca 8580gaatagatgc tgtaatcgac
ttcaataaca agtggcatca cgtttctagt tctagaccca 8640tcagctgggc
cggccactag tgagctcggt acccgggggc gcgtaatatc atcattagga
8700agacactgcc catcttgaat aggattttag ctactaaata tgttgatggt
ctttatgaaa 8760aactattaac taggaatatt atgctaccca tatggaaaga
agacgctagg ggaatagaaa 8820gaccatcaaa taaacgaagt caacaccagg
tcttccgaag cattaacaat tacctattta 8880atatgtactc agtccgggtg
gatatctcac tacattgacg cagtttgttc aaagacgaac 8940gccctgaatt
atgccatctg cttaggcttt caaatatggt acgctctaat gccaagcctt
9000atgctggtct tagggtatta tcatcaaatc tttaagccag aggtagttaa
atacatcaag 9060gacaccatag gagtatggca caacgatatt gtcaagatcg
catcagatct aataggcaat 9120aatgaattct tcatgcagcc cgacgtggga
acgctcgaaa gcagtggggc ctctgggaca 9180gggaccagac ctgagtcgct
aacatttggg aataagagaa gtagatatac ccaatttttt 9240aactagccaa
ggaaggaaag cgggaaaggt ccgatacaaa ggaaagggtt gcgaggctta
9300acgatttaga atatagctgt tgaggtggca cttgttcccc cggggcgggg
gtatatgccc 9360gtagctttat tctgtcactt ctttcagatc aatgaagttg
aaaagttata gagtaaggga 9420cccttgttta caaagctgtc actccaagaa
ctcgaagtca agcatcttcg ggaatatcca 9480gattagtctt caactagaga
aaggatagga atctcctttg cagagttttc ttctcctgct 9540gatgtagcgg
taaagtcaaa agttggatgc ccttttttct ttatttaatt aattccgttg
9600atagagcttt tgagcggatg caagcactag attcttcaac gagtaccaat
aataaatgaa 9660ttcaccagac taagagaaga aaacagaaca aaaagattaa
gcccagccgc cttcgggaag 9720acctatcttc gtcgggagga agagccctct
ttacaccatt gtgattagaa aaaaccgaaa 9780agtggaccgg cctagtaacc
aatagagcgg ggcttgatcc ccactttaaa tctattggat 9840agagccctca
gcccagggca agcgattgaa ttctatttga ttatgggtta ggtggaacct
9900gaaactagca cttacaaatg agttagcaaa aggaaaaaga caattctcaa
atgcgtacaa 9960gactttcttc cttctttgtt taagaggcca gtctgcgatg
gatgctcgtg catgaaaaag 10020ggctttgatc tattcaccac ttatataata
gagccaatct ctgcaggaca agatatctat 10080tttgtcattg ggaagtaagg
cttaagtcga cgaaaaagtt aggaaagggg atcatatggc 10140tagggttgcc
ctcggggctc aagggtttag cgatgaagag tgccaagcaa aaggtcaata
10200ccggtacgcc gatcaaagaa gtccagtggc aaggcccttt cagccaagct
agcgtgctga 10260acagaaagtc gtagagtgat gacagcttct tcttcttgag
tcattcgtgt gacaacatca 10320ggatctcgtc gaaagacctc ctctgcctat
ctctcccgca agagaggact cgttatggcg 10380cacctctttt tagcagtctc
gtcaataaga taagattgcc cctcccttct tattgatttg 10440ataaagggct
ttgtccactc cctctcttct tagccgagcg gagtgacggt ttagtttagg
10500ctttagatgc cactgcgaaa gactctagag atccactctc acagcgtata
cgcgacatcc 10560ctatgtatac acaatccttt caagcagcta ggacagctag
caagcaagtt atctgttcgc 10620ggacaagctc tctggatgac aaaaaacatg
ctctttcatg cggaaaaaac acggtctttc 10680gtggaagttg gtcgatttga
agtcgcttta tgagtgaaaa tgggtcgatg acgaaaaaga 10740cggggaaaat
gatcaactgt cacattttga tgccagttta gggctaaaat gaactttcat
10800ccaaaaagac cgagaaaacg ctccactggc aggatccgat cggaaataa
10849724DNAArtificial Sequenceprimer 7ggtcgaatag gctaggttta cgaa
24821DNAArtificial Sequenceprimer 8ccaccatgtt gacggatctc t
21918DNAArtificial Sequenceprimer 9aagagactaa ggccgctc
181020DNAArtificial SequenceJunction DNA of event 3560.4.3.5 (10 nt
5' genomic/ 10 nt transgene insert) 10aagagactaa ggccgctcta
201120DNAArtificial SequenceJunction DNA of event 3560.4.3.5 (10 nt
3' genomic/ 10 nt transgene insert) 11tacccggggg cgcgtaatat
201240DNAArtificial SequenceJunction DNA of event 3560.4.3.5 (20 nt
5' genomic/ 20 nt transgene insert) 12gtttacgaaa aagagactaa
ggccgctcta gagatccgtc 401340DNAArtificial SequenceJunction DNA of
event 3560.4.3.5 (20 nt 3' genomic/ 20 nt transgene insert)
13gtgagctcgg tacccggggg cgcgtaatat catcattagg 40148679DNAArtificial
Sequence5' genomic sequence and complete event 3560.4.3.5 transgene
insert 14agcaattgtt ttgtgcattt ccaaatttca atctgattta ttaaataaaa
aaattttaat 60tcgggttgat tgtaaatcag ctaaagacat tttacagaaa gacgtcaaaa
atcttggctc 120caaacaaatt tttgcaagat ggcaagcaat attaagtgtt
tttgattttg acagaatata 180tcaagggcac tttaaactct ctacctaact
atcttacacg tgaattctta tagacaaatt 240ctcatgccac ctaaggcatc
aggcacccct ctcaggggta gacgaagcac gagtaaagga 300ttcaagttgg
ccctaccaga gccaactatc aaaaagagtt cttccgcatc ctctgggtca
360tctacccaaa aacctaaaat aaaagggtca tcaacccaaa tagtcaccat
caaacctgag 420tcatccactc aggaatcccc aaaaccttca acctcaaaac
aaacaaaggc cgactatacc 480ttctcagtac aacactccag gccctacaag
aaattggtct aaccaaactc ccaaaactcg 540ccaaaaagac ttgggcagac
attgcctcag aatctaatga tgaatttgaa actgatttac 600aaatcatgat
tcaaaactcc aaacaatcca aaacgattgt caatccaaaa ggaaaacaga
660ccttatccca acaaaagaca ccattaccaa aacctactaa cagttatatt
tacaaaaata 720aatttccaac tgttttgtag atggagccaa aattttggga
caaaaatccc ttcaaggcta 780cagccaaggc atttccaccg ggcttccatt
tcaaacctat ttccaccaat aaaacaagaa 840tcttttacga attcatactg
atagacacaa actcagtgtc tattaaacac ttcaaagacc 900caaatgacat
aaatttaaac actcattcaa ccatccagat tttaaagttc atacaacctc
960gacaatgtgg aacaaatata aatcaagcca aacaattctt tgtacccttt
gatcctatag 1020gttacactat tgggattatg tagatgcatg gaccaatgta
ttctggcatc aaaataacaa 1080attcaaacat tcttggctta tttatttcaa
aactaacacc gtctataatt ttccaaattg 1140gttcctccaa cggtgggact
tttttggacc aaactttgat atctacccgg agcaagtcca 1200acaagggttt
gatcagttca aaaaaatgtt caattctcag gaatcacgaa tccctgtaga
1260cctaaaatac ttttccaatt ttgcattgtc gtggatattt tcatggcaat
acagatatgg 1320gaaaactgaa aacaacaagc agtttccatc actgcaacat
catgcattta tcaagtggtg 1380gaattagttt gatacatcaa aagcagcacc
agatcaagtg agaatctggt ttcaagccca 1440tccagaattt ttgaaagttg
ctaatcctga gacttcttta ttcctcaatc agaagtctca 1500attagctgct
ttcctttcta gttccaagtc aaaagaaatt ctggcacaaa atctaaaaga
1560agtcctacag cttctccaac aagaagaaga taaaggctct tcctcaaaga
aggaagataa 1620caattcttca aaagaagatg acgacccttt ctaccaaaat
gaaaatgatt gttttggtat 1680ttctctaaat gatgattaat taaaaaatta
catgtactat gtaaatagtt tcggtcacga 1740aactggcact gtagctacag
taaattttat ggctatttaa ggagttctcg gcccatttgt 1800gaggtacctt
ttcaggtagt cagatctcta tttttagaga gagaaactct aggaaacaat
1860ctttgtaagt ttttctttcg atttcaataa attcaaagtt ttctcttcat
atctcttctc 1920cctcttgacc ggtcctgtgc ggttctgcca tcgcttcagt
ttcttctctt ctctcccctt 1980atcgatattg tgtggctcta ttgccacttc
gatttctttt atgttgcttt cattttaatt 2040tgttttacca ttttcttttg
atattataat ttctatttaa ctcttggtca tactgcatat 2100attcataata
tattcttaca tcctatctat ccgtttgatc tcttttcact gttatatata
2160tatatatata tatatatatc gtttaacttc atgttagtaa taagattaga
gtaaaaaata 2220tatatataac gaagttattt taacaaaagg tatttttgta
aaaaaaaatt atatgctaaa 2280aaagttttac tatatctaag catgattttt
tttaattccc aaaacacgtg taaatatttt 2340taggaatatt ttgtaaaaaa
tcaaacattt ttttaattat tcgtataaaa catcaatctt 2400taagaatcat
aatttttaga aatcatgatt tctggatata aaaatacttt ttcttgcagc
2460caaacgtctt ctaaagccac atgttaatgg gtgtacaaat tataaagttt
ttataaacat 2520atcacttttt aaagttaaaa atatcactaa tacgtttcta
aatgcatttt ttttagaaat 2580tataagtttc tagcactcca ttggagttgt
atagaactac tactaatcta ctattaataa 2640caatttatct cctccaaata
tttaagtaaa ctgcatattt agagaatgtt ggacagtaaa 2700gctagccact
caatatttag gtgctccccg aaagaggaaa gcaaacaagc caccagcact
2760tcaatcagta aagctagcca ctcaactcgc tctcttcaaa ttccctttta
cattttattt 2820cagatcctcc acctagccaa gtaggtctca aaaggtttac
cccgcatatg cttagtcgcc 2880gcaagctcca tataggttac tttgcgggct
actgaataga atcttcggtg aaaggcgtct 2940accatatcgg cgcaactatt
gatcgagtgc gtgtatacca cgtgaatgcg acacccgaaa 3000gactagcaga
aaagtgcttc agcaacaaac tctcatcgtg agcagtgtct ctgctggcaa
3060tttcgaaatt actaatatgc tgctctcgag atctccactt ccatcataca
accgaaacca 3120gctaaggaag gagcgatcca taagaatcgc ctcgaatagc
cataacctca tctcgccttc 3180caccgcacca gcaagaggaa accgaattag
agctgaaaga atactagagc catcgtagga 3240gaaccggatt cttgaccgat
cgacttttgc ccgaggtcgt taggtcgaat aggctaggtt 3300tacgaaaaag
agactaaggc cgctctagag atccgtcaac atggtggagc acgacactct
3360cgtctactcc aagaatatca aagatacagt ctcagaagac caaagggcta
ttgagacttt 3420tcaacaaagg gtaatatcgg gaaacctcct cggattccat
tgcccagcta tctgtcactt 3480catcaaaagg acagtagaaa aggaaggtgg
cacctacaaa tgccatcatt gcgataaagg 3540aaaggctatc gttcaagatg
cctctgccga cagtggtccc aaagatggac ccccacccac 3600gaggagcatc
gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg
3660tgatgatcct atgcgtatgg tatgacgtgt gttcaagatg atgacttcaa
acctacctat 3720gacgtatggt atgacgtgtg tcgactgatg acttagatcc
actcgagcgg ctataaatac 3780gtacctacgc accctgcgct accatcccta
gagctgcagc ttatttttac aacaattacc 3840aacaacaaca aacaacaaac
aacattacaa ttactattta caattacagt cgacccggga 3900tccacacgac
accatgatag aggtgaaacc gattaacgca gaggatacct atgaactaag
3960gcatagaata ctcagaccaa accagccgat agaagcgtgt atgtttgaaa
gcgatttact 4020tcgtggtgca tttcacttag gcggctttta caggggcaaa
ctgatttcca tagcttcatt 4080ccaccaggcc gagcactcgg aactccaagg
ccagaaacag taccagctcc gaggtatggc 4140taccttggaa ggttatcgtg
agcagaaagc gggatcaact ctagttaaac acgctgaaga 4200aatccttcgt
aagagggggg cggacatgct ttggtgtaat gcgaggacat ccgcctcagg
4260ctactacaaa aagttaggct tcagcgagca gggagagata tttgacacgc
cgccagtagg 4320acctcacatc ctgatgtata aaaggatcac ataactagct
agtcagttaa cctagacttg 4380tccatcttct ggattggcca acttaattaa
tgtatgaaat aaaaggatgc acacatagtg 4440acatgctaat cactataatg
tgggcatcaa agttgtgtgt tatgtgtaat tactagttat 4500ctgaataaaa
gagaaagaga tcatccatat ttcttatcct aaatgaatgt cacgtgtctt
4560tataattctt tgatgaacca gatgcatttc attaaccaaa tccatataca
tataaatatt 4620aatcatatat aattaatatc aattgggtta gcaaaacaaa
tctagtctag gtgtgttttg 4680cgaattcgat atcaagcttt gctctagatc
aaactcacat ccaaacataa catggatatc 4740ttccttacca atcatactaa
ttattttggg ttaaatatta atcattattt ttaagatatt 4800aattaagaaa
ttaaaagatt ttttaaaaaa atgtataaaa ttatattatt catgattttt
4860catacatttg attttgataa taaatatatt ttttttaatt tcttaaaaaa
tgttgcaaga 4920cacttattag acatagtctt gttctgttta caaaagcatt
catcatttaa tacattaaaa 4980aatatttaat actaacagta gaatcttctt
gtgagtggtg tgggagtagg caacctggca 5040ttgaaacgag agaaagagag
tcagaaccag aagacaaata
aaaagtatgc aacaaacaaa 5100tcaaaatcaa agggcaaagg ctggggttgg
ctcaattggt tgctacattc aattttcaac 5160tcagtcaacg gttgagattc
actctgactt ccccaatcta agccgcggat gcaaacggtt 5220gaatctaacc
cacaatccaa tctcgttact taggggcttt tccgtcatta actcacccct
5280gccacccggt ttccctataa attggaactc aatgctcccc tctaaactcg
tatcgcttca 5340gagttgagac caagacacac tcgttcatat atctctctgc
tcttctcttc tcttctacct 5400ctcaaggtac ttttcttctc cctctaccaa
atcctagatt ccgtggttca atttcggatc 5460ttgcacttct ggtttgcttt
gccttgcttt ttcctcaact gggtccatct aggatccatg 5520tgaaactcta
ctctttcttt aatatctgcg gaatacgcgt ttgactttca gatctagtcg
5580aaatcatttc ataattgcct ttctttcttt tagcttatga gaaataaaat
cacttttttt 5640ttatttcaaa ataaaccttg ggccttgtgc tgactgagat
ggggtttggt gattacagaa 5700ttttagcgaa ttttgtaatt gtacttgttt
gtctgtagtt ttgttttgtt ttcttgtttc 5760tcatacattc cttaggcttc
aattttattc gagtataggt cacaatagga attcaaactt 5820tgagcagggg
aattaatccc ttccttcaaa tccagtttgt ttgtatatat gtttaaaaaa
5880tgaaactttt gctttaaatt ctattataac tttttttatg gctgaaattt
ttgcatgtgt 5940ctttgctctc tgttgtaaat ttactgttta ggtactaact
ctaggcttgt tgtgcagttt 6000ttgaagtata accatgccac acaacacaat
ggcggccacc gcttccagaa ccacccgatt 6060ctcttcttcc tcttcacacc
ccaccttccc caaacgcatt actagatcca ccctccctct 6120ctctcatcaa
accctcacca aacccaacca cgctctcaaa atcaaatgtt ccatctccaa
6180accccccacg gcggcgccct tcaccaagga agcgccgacc acggagccct
tcgtgtcacg 6240gttcgcctcc ggcgaacctc gcaagggcgc ggacatcctt
gtggaggcgc tggagaggca 6300gggcgtgacg acggtgttcg cgtaccccgg
cggtgcgtcg atggagatcc accaggcgct 6360cacgcgctcc gccgccatcc
gcaacgtgct cccgcgccac gagcagggcg gcgtcttcgc 6420cgccgaaggc
tacgcgcgtt cctccggcct ccccggcgtc tgcattgcca cctccggccc
6480cggcgccacc aacctcgtga gcggcctcgc cgacgcttta atggacagcg
tcccagtcgt 6540cgccatcacc ggccaggtcg cccgccggat gatcggcacc
gacgccttcc aagaaacccc 6600gatcgtggag gtgagcagat ccatcacgaa
gcacaactac ctcatcctcg acgtcgacga 6660catcccccgc gtcgtcgccg
aggctttctt cgtcgccacc tccggccgcc ccggtccggt 6720cctcatcgac
attcccaaag acgttcagca gcaactcgcc gtgcctaatt gggacgagcc
6780cgttaacctc cccggttacc tcgccaggct gcccaggccc cccgccgagg
cccaattgga 6840acacattgtc agactcatca tggaggccca aaagcccgtt
ctctacgtcg gcggtggcag 6900tttgaattcc agtgctgaat tgaggcgctt
tgttgaactc actggtattc ccgttgctag 6960cactttaatg ggtcttggaa
cttttcctat tggtgatgaa tattcccttc agatgctggg 7020tatgcatggt
actgtttatg ctaactatgc tgttgacaat agtgatttgt tgcttgcctt
7080tggggtaagg tttgatgacc gtgttactgg gaagcttgag gcttttgcta
gtagggctaa 7140gattgttcac attgatattg attctgccga gattgggaag
aacaagcagg cgcacgtgtc 7200ggtttgcgcg gatttgaagt tggccttgaa
gggaattaat atgattttgg aggagaaagg 7260agtggagggt aagtttgatc
ttggaggttg gagagaagag attaatgtgc agaaacacaa 7320gtttccattg
ggttacaaga cattccagga cgcgatttct ccgcagcatg ctatcgaggt
7380tcttgatgag ttgactaatg gagatgctat tgttagtact ggggttgggc
agcatcaaat 7440gtgggctgcg cagttttaca agtacaagag accgaggcag
tggttgacct cagggggtct 7500tggagccatg ggttttggat tgcctgcggc
tattggtgct gctgttgcta accctggggc 7560tgttgtggtt gacattgatg
gggatggtag tttcatcatg aatgttcagg agttggccac 7620tataagagtg
gagaatctcc cagttaagat attgttgttg aacaatcagc atttgggtat
7680ggtggttcag ttggaggata ggttctacaa gtccaataga gctcacacct
atcttggaga 7740tccgtctagc gagagcgaga tattcccaaa catgctcaag
tttgctgatg cttgtgggat 7800accggcagcg cgagtgacga agaaggaaga
gcttagagcg gcaattcaga gaatgttgga 7860cacccctggc ccctaccttc
ttgatgtcat tgtgccccat caggagcatg tgttgccgat 7920gattcccagt
aatggatcct tcaaggatgt gataactgag ggtgatggta gaacgaggta
7980ctgattgcct agaccaaatg ttccttgatg cttgttttgt acaatatata
taagataatg 8040ctgtcctagt tgcaggattt ggcctgtggt gagcatcata
gtctgtagta gttttggtag 8100caagacattt tattttcctt ttatttaact
tactacatgc agtagcatct atctatctct 8160gtagtctgat atctcctgtt
gtctgtattg tgccgttgga ttttttgctg tagtgagact 8220gaaaatgatg
tgctagtaat aatatttctg ttagaaatct aagtagagaa tctgttgaag
8280aagtcaaaag ctaatggaat caggttacat attcaatgtt tttctttttt
tagcggttgg 8340tagacgtgta gattcaactt ctcttggagc tcacctaggc
aatcagtaaa atgcatattc 8400cttttttaac ttgccattta tttactttta
gtggaaattg tgaccaattt gttcatgtag 8460aacggatttg gaccattgcg
tccacaaaac gtctcttttg ctcgatcttc acaaagcgat 8520accgaaatcc
agagatagtt ttcaaaagtc agaaatggca aagttataaa tagtaaaaca
8580gaatagatgc tgtaatcgac ttcaataaca agtggcatca cgtttctagt
tctagaccca 8640tcagctgggc cggccactag tgagctcggt acccggggg
8679157532DNAArtificial Sequence3' genomic sequence and complete
transgene insert for event 3560.4.3.5 15ggccgctcta gagatccgtc
aacatggtgg agcacgacac tctcgtctac tccaagaata 60tcaaagatac agtctcagaa
gaccaaaggg ctattgagac ttttcaacaa agggtaatat 120cgggaaacct
cctcggattc cattgcccag ctatctgtca cttcatcaaa aggacagtag
180aaaaggaagg tggcacctac aaatgccatc attgcgataa aggaaaggct
atcgttcaag 240atgcctctgc cgacagtggt cccaaagatg gacccccacc
cacgaggagc atcgtggaaa 300aagaagacgt tccaaccacg tcttcaaagc
aagtggattg atgtgatgat cctatgcgta 360tggtatgacg tgtgttcaag
atgatgactt caaacctacc tatgacgtat ggtatgacgt 420gtgtcgactg
atgacttaga tccactcgag cggctataaa tacgtaccta cgcaccctgc
480gctaccatcc ctagagctgc agcttatttt tacaacaatt accaacaaca
acaaacaaca 540aacaacatta caattactat ttacaattac agtcgacccg
ggatccacac gacaccatga 600tagaggtgaa accgattaac gcagaggata
cctatgaact aaggcataga atactcagac 660caaaccagcc gatagaagcg
tgtatgtttg aaagcgattt acttcgtggt gcatttcact 720taggcggctt
ttacaggggc aaactgattt ccatagcttc attccaccag gccgagcact
780cggaactcca aggccagaaa cagtaccagc tccgaggtat ggctaccttg
gaaggttatc 840gtgagcagaa agcgggatca actctagtta aacacgctga
agaaatcctt cgtaagaggg 900gggcggacat gctttggtgt aatgcgagga
catccgcctc aggctactac aaaaagttag 960gcttcagcga gcagggagag
atatttgaca cgccgccagt aggacctcac atcctgatgt 1020ataaaaggat
cacataacta gctagtcagt taacctagac ttgtccatct tctggattgg
1080ccaacttaat taatgtatga aataaaagga tgcacacata gtgacatgct
aatcactata 1140atgtgggcat caaagttgtg tgttatgtgt aattactagt
tatctgaata aaagagaaag 1200agatcatcca tatttcttat cctaaatgaa
tgtcacgtgt ctttataatt ctttgatgaa 1260ccagatgcat ttcattaacc
aaatccatat acatataaat attaatcata tataattaat 1320atcaattggg
ttagcaaaac aaatctagtc taggtgtgtt ttgcgaattc gatatcaagc
1380tttgctctag atcaaactca catccaaaca taacatggat atcttcctta
ccaatcatac 1440taattatttt gggttaaata ttaatcatta tttttaagat
attaattaag aaattaaaag 1500attttttaaa aaaatgtata aaattatatt
attcatgatt tttcatacat ttgattttga 1560taataaatat atttttttta
atttcttaaa aaatgttgca agacacttat tagacatagt 1620cttgttctgt
ttacaaaagc attcatcatt taatacatta aaaaatattt aatactaaca
1680gtagaatctt cttgtgagtg gtgtgggagt aggcaacctg gcattgaaac
gagagaaaga 1740gagtcagaac cagaagacaa ataaaaagta tgcaacaaac
aaatcaaaat caaagggcaa 1800aggctggggt tggctcaatt ggttgctaca
ttcaattttc aactcagtca acggttgaga 1860ttcactctga cttccccaat
ctaagccgcg gatgcaaacg gttgaatcta acccacaatc 1920caatctcgtt
acttaggggc ttttccgtca ttaactcacc cctgccaccc ggtttcccta
1980taaattggaa ctcaatgctc ccctctaaac tcgtatcgct tcagagttga
gaccaagaca 2040cactcgttca tatatctctc tgctcttctc ttctcttcta
cctctcaagg tacttttctt 2100ctccctctac caaatcctag attccgtggt
tcaatttcgg atcttgcact tctggtttgc 2160tttgccttgc tttttcctca
actgggtcca tctaggatcc atgtgaaact ctactctttc 2220tttaatatct
gcggaatacg cgtttgactt tcagatctag tcgaaatcat ttcataattg
2280cctttctttc ttttagctta tgagaaataa aatcactttt tttttatttc
aaaataaacc 2340ttgggccttg tgctgactga gatggggttt ggtgattaca
gaattttagc gaattttgta 2400attgtacttg tttgtctgta gttttgtttt
gttttcttgt ttctcataca ttccttaggc 2460ttcaatttta ttcgagtata
ggtcacaata ggaattcaaa ctttgagcag gggaattaat 2520cccttccttc
aaatccagtt tgtttgtata tatgtttaaa aaatgaaact tttgctttaa
2580attctattat aacttttttt atggctgaaa tttttgcatg tgtctttgct
ctctgttgta 2640aatttactgt ttaggtacta actctaggct tgttgtgcag
tttttgaagt ataaccatgc 2700cacacaacac aatggcggcc accgcttcca
gaaccacccg attctcttct tcctcttcac 2760accccacctt ccccaaacgc
attactagat ccaccctccc tctctctcat caaaccctca 2820ccaaacccaa
ccacgctctc aaaatcaaat gttccatctc caaacccccc acggcggcgc
2880ccttcaccaa ggaagcgccg accacggagc ccttcgtgtc acggttcgcc
tccggcgaac 2940ctcgcaaggg cgcggacatc cttgtggagg cgctggagag
gcagggcgtg acgacggtgt 3000tcgcgtaccc cggcggtgcg tcgatggaga
tccaccaggc gctcacgcgc tccgccgcca 3060tccgcaacgt gctcccgcgc
cacgagcagg gcggcgtctt cgccgccgaa ggctacgcgc 3120gttcctccgg
cctccccggc gtctgcattg ccacctccgg ccccggcgcc accaacctcg
3180tgagcggcct cgccgacgct ttaatggaca gcgtcccagt cgtcgccatc
accggccagg 3240tcgcccgccg gatgatcggc accgacgcct tccaagaaac
cccgatcgtg gaggtgagca 3300gatccatcac gaagcacaac tacctcatcc
tcgacgtcga cgacatcccc cgcgtcgtcg 3360ccgaggcttt cttcgtcgcc
acctccggcc gccccggtcc ggtcctcatc gacattccca 3420aagacgttca
gcagcaactc gccgtgccta attgggacga gcccgttaac ctccccggtt
3480acctcgccag gctgcccagg ccccccgccg aggcccaatt ggaacacatt
gtcagactca 3540tcatggaggc ccaaaagccc gttctctacg tcggcggtgg
cagtttgaat tccagtgctg 3600aattgaggcg ctttgttgaa ctcactggta
ttcccgttgc tagcacttta atgggtcttg 3660gaacttttcc tattggtgat
gaatattccc ttcagatgct gggtatgcat ggtactgttt 3720atgctaacta
tgctgttgac aatagtgatt tgttgcttgc ctttggggta aggtttgatg
3780accgtgttac tgggaagctt gaggcttttg ctagtagggc taagattgtt
cacattgata 3840ttgattctgc cgagattggg aagaacaagc aggcgcacgt
gtcggtttgc gcggatttga 3900agttggcctt gaagggaatt aatatgattt
tggaggagaa aggagtggag ggtaagtttg 3960atcttggagg ttggagagaa
gagattaatg tgcagaaaca caagtttcca ttgggttaca 4020agacattcca
ggacgcgatt tctccgcagc atgctatcga ggttcttgat gagttgacta
4080atggagatgc tattgttagt actggggttg ggcagcatca aatgtgggct
gcgcagtttt 4140acaagtacaa gagaccgagg cagtggttga cctcaggggg
tcttggagcc atgggttttg 4200gattgcctgc ggctattggt gctgctgttg
ctaaccctgg ggctgttgtg gttgacattg 4260atggggatgg tagtttcatc
atgaatgttc aggagttggc cactataaga gtggagaatc 4320tcccagttaa
gatattgttg ttgaacaatc agcatttggg tatggtggtt cagttggagg
4380ataggttcta caagtccaat agagctcaca cctatcttgg agatccgtct
agcgagagcg 4440agatattccc aaacatgctc aagtttgctg atgcttgtgg
gataccggca gcgcgagtga 4500cgaagaagga agagcttaga gcggcaattc
agagaatgtt ggacacccct ggcccctacc 4560ttcttgatgt cattgtgccc
catcaggagc atgtgttgcc gatgattccc agtaatggat 4620ccttcaagga
tgtgataact gagggtgatg gtagaacgag gtactgattg cctagaccaa
4680atgttccttg atgcttgttt tgtacaatat atataagata atgctgtcct
agttgcagga 4740tttggcctgt ggtgagcatc atagtctgta gtagttttgg
tagcaagaca ttttattttc 4800cttttattta acttactaca tgcagtagca
tctatctatc tctgtagtct gatatctcct 4860gttgtctgta ttgtgccgtt
ggattttttg ctgtagtgag actgaaaatg atgtgctagt 4920aataatattt
ctgttagaaa tctaagtaga gaatctgttg aagaagtcaa aagctaatgg
4980aatcaggtta catattcaat gtttttcttt ttttagcggt tggtagacgt
gtagattcaa 5040cttctcttgg agctcaccta ggcaatcagt aaaatgcata
ttcctttttt aacttgccat 5100ttatttactt ttagtggaaa ttgtgaccaa
tttgttcatg tagaacggat ttggaccatt 5160gcgtccacaa aacgtctctt
ttgctcgatc ttcacaaagc gataccgaaa tccagagata 5220gttttcaaaa
gtcagaaatg gcaaagttat aaatagtaaa acagaataga tgctgtaatc
5280gacttcaata acaagtggca tcacgtttct agttctagac ccatcagctg
ggccggccac 5340tagtgagctc ggtacccggg ggcgcgtaat atcatcatta
ggaagacact gcccatcttg 5400aataggattt tagctactaa atatgttgat
ggtctttatg aaaaactatt aactaggaat 5460attatgctac ccatatggaa
agaagacgct aggggaatag aaagaccatc aaataaacga 5520agtcaacacc
aggtcttccg aagcattaac aattacctat ttaatatgta ctcagtccgg
5580gtggatatct cactacattg acgcagtttg ttcaaagacg aacgccctga
attatgccat 5640ctgcttaggc tttcaaatat ggtacgctct aatgccaagc
cttatgctgg tcttagggta 5700ttatcatcaa atctttaagc cagaggtagt
taaatacatc aaggacacca taggagtatg 5760gcacaacgat attgtcaaga
tcgcatcaga tctaataggc aataatgaat tcttcatgca 5820gcccgacgtg
ggaacgctcg aaagcagtgg ggcctctggg acagggacca gacctgagtc
5880gctaacattt gggaataaga gaagtagata tacccaattt tttaactagc
caaggaagga 5940aagcgggaaa ggtccgatac aaaggaaagg gttgcgaggc
ttaacgattt agaatatagc 6000tgttgaggtg gcacttgttc ccccggggcg
ggggtatatg cccgtagctt tattctgtca 6060cttctttcag atcaatgaag
ttgaaaagtt atagagtaag ggacccttgt ttacaaagct 6120gtcactccaa
gaactcgaag tcaagcatct tcgggaatat ccagattagt cttcaactag
6180agaaaggata ggaatctcct ttgcagagtt ttcttctcct gctgatgtag
cggtaaagtc 6240aaaagttgga tgcccttttt tctttattta attaattccg
ttgatagagc ttttgagcgg 6300atgcaagcac tagattcttc aacgagtacc
aataataaat gaattcacca gactaagaga 6360agaaaacaga acaaaaagat
taagcccagc cgccttcggg aagacctatc ttcgtcggga 6420ggaagagccc
tctttacacc attgtgatta gaaaaaaccg aaaagtggac cggcctagta
6480accaatagag cggggcttga tccccacttt aaatctattg gatagagccc
tcagcccagg 6540gcaagcgatt gaattctatt tgattatggg ttaggtggaa
cctgaaacta gcacttacaa 6600atgagttagc aaaaggaaaa agacaattct
caaatgcgta caagactttc ttccttcttt 6660gtttaagagg ccagtctgcg
atggatgctc gtgcatgaaa aagggctttg atctattcac 6720cacttatata
atagagccaa tctctgcagg acaagatatc tattttgtca ttgggaagta
6780aggcttaagt cgacgaaaaa gttaggaaag gggatcatat ggctagggtt
gccctcgggg 6840ctcaagggtt tagcgatgaa gagtgccaag caaaaggtca
ataccggtac gccgatcaaa 6900gaagtccagt ggcaaggccc tttcagccaa
gctagcgtgc tgaacagaaa gtcgtagagt 6960gatgacagct tcttcttctt
gagtcattcg tgtgacaaca tcaggatctc gtcgaaagac 7020ctcctctgcc
tatctctccc gcaagagagg actcgttatg gcgcacctct ttttagcagt
7080ctcgtcaata agataagatt gcccctccct tcttattgat ttgataaagg
gctttgtcca 7140ctccctctct tcttagccga gcggagtgac ggtttagttt
aggctttaga tgccactgcg 7200aaagactcta gagatccact ctcacagcgt
atacgcgaca tccctatgta tacacaatcc 7260tttcaagcag ctaggacagc
tagcaagcaa gttatctgtt cgcggacaag ctctctggat 7320gacaaaaaac
atgctctttc atgcggaaaa aacacggtct ttcgtggaag ttggtcgatt
7380tgaagtcgct ttatgagtga aaatgggtcg atgacgaaaa agacggggaa
aatgatcaac 7440tgtcacattt tgatgccagt ttagggctaa aatgaacttt
catccaaaaa gaccgagaaa 7500acgctccact ggcaggatcc gatcggaaat aa
75321630DNAArtificial Sequenceprimer 16tgcccgaggt cgttaggtcg
aataggctag 301735DNAArtificial Sequenceprimer 17tcctattcaa
gatgggcagt gtcttcctaa tgatg 351837DNAArtificial SequenceTaqman
probe 18gataactgag ggtgatggta gaacgaggta ctgattg
371925DNAArtificial Sequenceprimer 19tcgatcggtc aagaatccgg ttctc
252035DNAArtificial Sequenceprimer 20caatagccct ttggtcttct
gagactgtat ctttg 352135DNAArtificial Sequenceprimer 21gtaatatcat
cattaggaag acactgccca tcttg 352234DNAArtificial Sequenceprimer
22ccatatttga aagcctaagc agatggcata attc 342328DNAArtificial
Sequenceprimer 23ttcagcaaca aactctcatc gtgagcag 282430DNAArtificial
Sequenceprimer 1227 24tggtcttctg agactgtatc tttgatattc
302530DNAArtificial Sequenceprimer 1297 (Taqman probe) 25tgcccgaggt
cgttaggtcg aataggctag 302636DNAArtificial Sequenceprimer 1440
26tgtgataact gagggtgatg gtagaacgag gtactg 362760DNAArtificial
SequenceJunction DNA of event 3560.4.3.5 (30 nt 5' genomic/ 30 nt
transgene insert) 27aataggctag gtttacgaaa aagagactaa ggccgctcta
gagatccgtc aacatggtgg 602860DNAArtificial SequenceJunction DNA of
event 3560.4.3.5 (30 nt 3' genomic/ 30 nt transgene insert)
28ccggccacta gtgagctcgg tacccggggg cgcgtaatat catcattagg aagacactgc
6029468DNAArtificial SequenceSCP1 promoter probe 29agatccgtca
acatggtgga gcacgacact ctcgtctact ccaagaatat caaagataca 60gtctcagaag
accaaagggc tattgagact tttcaacaaa gggtaatatc gggaaacctc
120ctcggattcc attgcccagc tatctgtcac ttcatcaaaa ggacagtaga
aaaggaaggt 180ggcacctaca aatgccatca ttgcgataaa ggaaaggcta
tcgttcaaga tgcctctgcc 240gacagtggtc ccaaagatgg acccccaccc
acgaggagca tcgtggaaaa agaagacgtt 300ccaaccacgt cttcaaagca
agtggattga tgtgatgatc ctatgcgtat ggtatgacgt 360gtgttcaaga
tgatgacttc aaacctacct atgacgtatg gtatgacgtg tgtcgactga
420tgacttagat ccactcgagc ggctataaat acgtacctac gcaccctg
46830416DNAArtificial Sequenceglyat4601 probe 30atgatagagg
tgaaaccgat taacgcagag gatacctatg aactaaggca tagaatactc 60agaccaaacc
agccgataga agcgtgtatg tttgaaagcg atttacttcg tggtgcattt
120cacttaggcg gcttttacag gggcaaactg atttccatag cttcattcca
ccaggccgag 180cactcggaac tccaaggcca gaaacagtac cagctccgag
gtatggctac cttggaaggt 240tatcgtgagc agaaagcggg atcaactcta
gttaaacacg ctgaagaaat ccttcgtaag 300aggggggcgg acatgctttg
gtgtaatgcg aggacatccg cctcaggcta ctacaaaaag 360ttaggcttca
gcgagcaggg agagatattt gacacgccgc cagtaggacc tcacat
41631234DNAArtificial SequencepinII terminator probe 31aggatgcaca
catagtgaca tgctaatcac tataatgtgg gcatcaaagt tgtgtgttat 60gtgtaattac
tagttatctg aataaaagag aaagagatca tccatatttc ttatcctaaa
120tgaatgtcac gtgtctttat aattctttga tgaaccagat gcatttcatt
aaccaaatcc 180atatacatat aaatattaat catatataat taatatcaat
tgggttagca aaac 23432445DNAArtificial SequenceSAMS probe (5' end)
32tgtgggagta ggcaacctgg cattgaaacg agagaaagag agtcagaacc agaagacaaa
60taaaaagtat gcaacaaaca aatcaaaatc aaagggcaaa ggctggggtt ggctcaattg
120gttgctacat tcaattttca actcagtcaa cggttgagat tcactctgac
ttccccaatc 180taagccgcgg atgcaaacgg ttgaatctaa cccacaatcc
aatctcgtta cttaggggct 240tttccgtcat taactcaccc ctgccacccg
gtttccctat aaattggaac tcaatgctcc 300cctctaaact cgtatcgctt
cagagttgag accaagacac actcgttcat atatctctct 360gctcttctct
tctcttctac ctctcaaggt acttttcttc tccctctacc aaatcctaga
420ttccgtggtt caatttcgga tcttg 44533492DNAArtificial SequenceSAMS
probe (3' end) 33cacttctggt ttgctttgcc ttgctttttc ctcaactggg
tccatctagg atccatgtga 60aactctactc tttctttaat atctgcggaa tacgcgtttg
actttcagat ctagtcgaaa 120tcatttcata attgcctttc tttcttttag
cttatgagaa ataaaatcac ttttttttta 180tttcaaaata aaccttgggc
cttgtgctga ctgagatggg gtttggtgat tacagaattt 240tagcgaattt
tgtaattgta cttgtttgtc tgtagttttg ttttgttttc ttgtttctca
300tacattcctt aggcttcaat tttattcgag tataggtcac aataggaatt
caaactttga 360gcaggggaat taatcccttc cttcaaatcc agtttgtttg
tatatatgtt taaaaaatga 420aacttttgct ttaaattcta ttataacttt
ttttatggct gaaatttttg catgtgtctt 480tgctctctgt tg
49234930DNAArtificial Sequencegm-hra probe (5'
end) 34ccacacaaca caatggcggc caccgcttcc agaaccaccc gattctcttc
ttcctcttca 60caccccacct tccccaaacg cattactaga tccaccctcc ctctctctca
tcaaaccctc 120accaaaccca accacgctct caaaatcaaa tgttccatct
ccaaaccccc cacggcggcg 180cccttcacca aggaagcgcc gaccacggag
cccttcgtgt cacggttcgc ctccggcgaa 240cctcgcaagg gcgcggacat
ccttgtggag gcgctggaga ggcagggcgt gacgacggtg 300ttcgcgtacc
ccggcggtgc gtcgatggag atccaccagg cgctcacgcg ctccgccgcc
360atccgcaacg tgctcccgcg ccacgagcag ggcggcgtct tcgccgccga
aggctacgcg 420cgttcctccg gcctccccgg cgtctgcatt gccacctccg
gccccggcgc caccaacctc 480gtgagcggcc tcgccgacgc tttaatggac
agcgtcccag tcgtcgccat caccggccag 540gtcgcccgcc ggatgatcgg
caccgacgcc ttccaagaaa ccccgatcgt ggaggtgagc 600agatccatca
cgaagcacaa ctacctcatc ctcgacgtcg acgacatccc ccgcgtcgtc
660gccgaggctt tcttcgtcgc cacctccggc cgccccggtc cggtcctcat
cgacattccc 720aaagacgttc agcagcaact cgccgtgcct aattgggacg
agcccgttaa cctccccggt 780tacctcgcca ggctgcccag gccccccgcc
gaggcccaat tggaacacat tgtcagactc 840atcatggagg cccaaaagcc
cgttctctac gtcggcggtg gcagtttgaa ttccagtgct 900gaattgaggc
gctttgttga actcactggt 930351030DNAArtificial Sequencegm-hra probe
(3' end) 35cgttgctagc actttaatgg gtcttggaac ttttcctatt ggtgatgaat
attcccttca 60gatgctgggt atgcatggta ctgtttatgc taactatgct gttgacaata
gtgatttgtt 120gcttgccttt ggggtaaggt ttgatgaccg tgttactggg
aagcttgagg cttttgctag 180tagggctaag attgttcaca ttgatattga
ttctgccgag attgggaaga acaagcaggc 240gcacgtgtcg gtttgcgcgg
atttgaagtt ggccttgaag ggaattaata tgattttgga 300ggagaaagga
gtggagggta agtttgatct tggaggttgg agagaagaga ttaatgtgca
360gaaacacaag tttccattgg gttacaagac attccaggac gcgatttctc
cgcagcatgc 420tatcgaggtt cttgatgagt tgactaatgg agatgctatt
gttagtactg gggttgggca 480gcatcaaatg tgggctgcgc agttttacaa
gtacaagaga ccgaggcagt ggttgacctc 540agggggtctt ggagccatgg
gttttggatt gcctgcggct attggtgctg ctgttgctaa 600ccctggggct
gttgtggttg acattgatgg ggatggtagt ttcatcatga atgttcagga
660gttggccact ataagagtgg agaatctccc agttaagata ttgttgttga
acaatcagca 720tttgggtatg gtggttcagt tggaggatag gttctacaag
tccaatagag ctcacaccta 780tcttggagat ccgtctagcg agagcgagat
attcccaaac atgctcaagt ttgctgatgc 840ttgtgggata ccggcagcgc
gagtgacgaa gaaggaagag cttagagcgg caattcagag 900aatgttggac
acccctggcc cctaccttct tgatgtcatt gtgccccatc aggagcatgt
960gttgccgatg attcccagta atggatcctt caaggatgtg ataactgagg
gtgatggtag 1020aacgaggtac 103036649DNAArtificial Sequencegm-als
terminator probe 36gcctagacca aatgttcctt gatgcttgtt ttgtacaata
tatataagat aatgctgtcc 60tagttgcagg atttggcctg tggtgagcat catagtctgt
agtagttttg gtagcaagac 120attttatttt ccttttattt aacttactac
atgcagtagc atctatctat ctctgtagtc 180tgatatctcc tgttgtctgt
attgtgccgt tggatttttt gctgtagtga gactgaaaat 240gatgtgctag
taataatatt tctgttagaa atctaagtag agaatctgtt gaagaagtca
300aaagctaatg gaatcaggtt acatattcaa tgtttttctt tttttagcgg
ttggtagacg 360tgtagattca acttctcttg gagctcacct aggcaatcag
taaaatgcat attccttttt 420taacttgcca tttatttact tttagtggaa
attgtgacca atttgttcat gtagaacgga 480tttggaccat tgcgtccaca
aaacgtctct tttgctcgat cttcacaaag cgataccgaa 540atccagagat
agttttcaaa agtcagaaat ggcaaagtta taaatagtaa aacagaatag
600atgctgtaat cgacttcaat aacaagtggc atcacgtttc tagttctag
6493726DNAArtificial Sequenceprimer DP-356-f1 37gtcgaatagg
ctaggtttac gaaaaa 263829DNAArtificial Sequenceprimer DP-356-r1
38tttgatattc ttggagtaga cgagagtgt 293930DNAArtificial
SequencePrimer DP-356-p (taqman probe) 39ctctagagat ccgtcaacat
ggtggagcac 304035DNAArtificial SequencePrimer 06-0-1610
40agcaattgtt ttgtgcattt ccaaatttca atctg 35418679DNAArtificial
Sequenceleft border sequence and complete transgene insert for
event 3560.4.3.5 41agcaattgtt ttgtgcattt ccaaatttca atctgattta
ttaaataaaa aaattttaat 60tcgggttgat tgtaaatcag ctaaagacat tttacagaaa
gacgtcaaaa atcttggctc 120caaacaaatt tttgcaagat ggcaagcaat
attaagtgtt tttgattttg acagaatata 180tcaagggcac tttaaactct
ctacctaact atcttacacg tgaattctta tagacaaatt 240ctcatgccac
ctaaggcatc aggcacccct ctcaggggta gacgaagcac gagtaaagga
300ttcaagttgg ccctaccaga gccaactatc aaaaagagtt cttccgcatc
ctctgggtca 360tctacccaaa aacctaaaat aaaagggtca tcaacccaaa
tagtcaccat caaacctgag 420tcatccactc aggaatcccc aaaaccttca
acctcaaaac aaacaaaggc cgactatacc 480ttctcagtac aacactccag
gccctacaag aaattggtct aaccaaactc ccaaaactcg 540ccaaaaagac
ttgggcagac attgcctcag aatctaatga tgaatttgaa actgatttac
600aaatcatgat tcaaaactcc aaacaatcca aaacgattgt caatccaaaa
ggaaaacaga 660ccttatccca acaaaagaca ccattaccaa aacctactaa
cagttatatt tacaaaaata 720aatttccaac tgttttgtag atggagccaa
aattttggga caaaaatccc ttcaaggcta 780cagccaaggc atttccaccg
ggcttccatt tcaaacctat ttccaccaat aaaacaagaa 840tcttttacga
attcatactg atagacacaa actcagtgtc tattaaacac ttcaaagacc
900caaatgacat aaatttaaac actcattcaa ccatccagat tttaaagttc
atacaacctc 960gacaatgtgg aacaaatata aatcaagcca aacaattctt
tgtacccttt gatcctatag 1020gttacactat tgggattatg tagatgcatg
gaccaatgta ttctggcatc aaaataacaa 1080attcaaacat tcttggctta
tttatttcaa aactaacacc gtctataatt ttccaaattg 1140gttcctccaa
cggtgggact tttttggacc aaactttgat atctacccgg agcaagtcca
1200acaagggttt gatcagttca aaaaaatgtt caattctcag gaatcacgaa
tccctgtaga 1260cctaaaatac ttttccaatt ttgcattgtc gtggatattt
tcatggcaat acagatatgg 1320gaaaactgaa aacaacaagc agtttccatc
actgcaacat catgcattta tcaagtggtg 1380gaattagttt gatacatcaa
aagcagcacc agatcaagtg agaatctggt ttcaagccca 1440tccagaattt
ttgaaagttg ctaatcctga gacttcttta ttcctcaatc agaagtctca
1500attagctgct ttcctttcta gttccaagtc aaaagaaatt ctggcacaaa
atctaaaaga 1560agtcctacag cttctccaac aagaagaaga taaaggctct
tcctcaaaga aggaagataa 1620caattcttca aaagaagatg acgacccttt
ctaccaaaat gaaaatgatt gttttggtat 1680ttctctaaat gatgattaat
taaaaaatta catgtactat gtaaatagtt tcggtcacga 1740aactggcact
gtagctacag taaattttat ggctatttaa ggagttctcg gcccatttgt
1800gaggtacctt ttcaggtagt cagatctcta tttttagaga gagaaactct
aggaaacaat 1860ctttgtaagt ttttctttcg atttcaataa attcaaagtt
ttctcttcat atctcttctc 1920cctcttgacc ggtcctgtgc ggttctgcca
tcgcttcagt ttcttctctt ctctcccctt 1980atcgatattg tgtggctcta
ttgccacttc gatttctttt atgttgcttt cattttaatt 2040tgttttacca
ttttcttttg atattataat ttctatttaa ctcttggtca tactgcatat
2100attcataata tattcttaca tcctatctat ccgtttgatc tcttttcact
gttatatata 2160tatatatata tatatatatc gtttaacttc atgttagtaa
taagattaga gtaaaaaata 2220tatatataac gaagttattt taacaaaagg
tatttttgta aaaaaaaatt atatgctaaa 2280aaagttttac tatatctaag
catgattttt tttaattccc aaaacacgtg taaatatttt 2340taggaatatt
ttgtaaaaaa tcaaacattt ttttaattat tcgtataaaa catcaatctt
2400taagaatcat aatttttaga aatcatgatt tctggatata aaaatacttt
ttcttgcagc 2460caaacgtctt ctaaagccac atgttaatgg gtgtacaaat
tataaagttt ttataaacat 2520atcacttttt aaagttaaaa atatcactaa
tacgtttcta aatgcatttt ttttagaaat 2580tataagtttc tagcactcca
ttggagttgt atagaactac tactaatcta ctattaataa 2640caatttatct
cctccaaata tttaagtaaa ctgcatattt agagaatgtt ggacagtaaa
2700gctagccact caatatttag gtgctccccg aaagaggaaa gcaaacaagc
caccagcact 2760tcaatcagta aagctagcca ctcaactcgc tctcttcaaa
ttccctttta cattttattt 2820cagatcctcc acctagccaa gtaggtctca
aaaggtttac cccgcatatg cttagtcgcc 2880gcaagctcca tataggttac
tttgcgggct actgaataga atcttcggtg aaaggcgtct 2940accatatcgg
cgcaactatt gatcgagtgc gtgtatacca cgtgaatgcg acacccgaaa
3000gactagcaga aaagtgcttc agcaacaaac tctcatcgtg agcagtgtct
ctgctggcaa 3060tttcgaaatt actaatatgc tgctctcgag atctccactt
ccatcataca accgaaacca 3120gctaaggaag gagcgatcca taagaatcgc
ctcgaatagc cataacctca tctcgccttc 3180caccgcacca gcaagaggaa
accgaattag agctgaaaga atactagagc catcgtagga 3240gaaccggatt
cttgaccgat cgacttttgc ccgaggtcgt taggtcgaat aggctaggtt
3300tacgaaaaag agactaaggc cgctctagag atccgtcaac atggtggagc
acgacactct 3360cgtctactcc aagaatatca aagatacagt ctcagaagac
caaagggcta ttgagacttt 3420tcaacaaagg gtaatatcgg gaaacctcct
cggattccat tgcccagcta tctgtcactt 3480catcaaaagg acagtagaaa
aggaaggtgg cacctacaaa tgccatcatt gcgataaagg 3540aaaggctatc
gttcaagatg cctctgccga cagtggtccc aaagatggac ccccacccac
3600gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag
tggattgatg 3660tgatgatcct atgcgtatgg tatgacgtgt gttcaagatg
atgacttcaa acctacctat 3720gacgtatggt atgacgtgtg tcgactgatg
acttagatcc actcgagcgg ctataaatac 3780gtacctacgc accctgcgct
accatcccta gagctgcagc ttatttttac aacaattacc 3840aacaacaaca
aacaacaaac aacattacaa ttactattta caattacagt cgacccggga
3900tccacacgac accatgatag aggtgaaacc gattaacgca gaggatacct
atgaactaag 3960gcatagaata ctcagaccaa accagccgat agaagcgtgt
atgtttgaaa gcgatttact 4020tcgtggtgca tttcacttag gcggctttta
caggggcaaa ctgatttcca tagcttcatt 4080ccaccaggcc gagcactcgg
aactccaagg ccagaaacag taccagctcc gaggtatggc 4140taccttggaa
ggttatcgtg agcagaaagc gggatcaact ctagttaaac acgctgaaga
4200aatccttcgt aagagggggg cggacatgct ttggtgtaat gcgaggacat
ccgcctcagg 4260ctactacaaa aagttaggct tcagcgagca gggagagata
tttgacacgc cgccagtagg 4320acctcacatc ctgatgtata aaaggatcac
ataactagct agtcagttaa cctagacttg 4380tccatcttct ggattggcca
acttaattaa tgtatgaaat aaaaggatgc acacatagtg 4440acatgctaat
cactataatg tgggcatcaa agttgtgtgt tatgtgtaat tactagttat
4500ctgaataaaa gagaaagaga tcatccatat ttcttatcct aaatgaatgt
cacgtgtctt 4560tataattctt tgatgaacca gatgcatttc attaaccaaa
tccatataca tataaatatt 4620aatcatatat aattaatatc aattgggtta
gcaaaacaaa tctagtctag gtgtgttttg 4680cgaattcgat atcaagcttt
gctctagatc aaactcacat ccaaacataa catggatatc 4740ttccttacca
atcatactaa ttattttggg ttaaatatta atcattattt ttaagatatt
4800aattaagaaa ttaaaagatt ttttaaaaaa atgtataaaa ttatattatt
catgattttt 4860catacatttg attttgataa taaatatatt ttttttaatt
tcttaaaaaa tgttgcaaga 4920cacttattag acatagtctt gttctgttta
caaaagcatt catcatttaa tacattaaaa 4980aatatttaat actaacagta
gaatcttctt gtgagtggtg tgggagtagg caacctggca 5040ttgaaacgag
agaaagagag tcagaaccag aagacaaata aaaagtatgc aacaaacaaa
5100tcaaaatcaa agggcaaagg ctggggttgg ctcaattggt tgctacattc
aattttcaac 5160tcagtcaacg gttgagattc actctgactt ccccaatcta
agccgcggat gcaaacggtt 5220gaatctaacc cacaatccaa tctcgttact
taggggcttt tccgtcatta actcacccct 5280gccacccggt ttccctataa
attggaactc aatgctcccc tctaaactcg tatcgcttca 5340gagttgagac
caagacacac tcgttcatat atctctctgc tcttctcttc tcttctacct
5400ctcaaggtac ttttcttctc cctctaccaa atcctagatt ccgtggttca
atttcggatc 5460ttgcacttct ggtttgcttt gccttgcttt ttcctcaact
gggtccatct aggatccatg 5520tgaaactcta ctctttcttt aatatctgcg
gaatacgcgt ttgactttca gatctagtcg 5580aaatcatttc ataattgcct
ttctttcttt tagcttatga gaaataaaat cacttttttt 5640ttatttcaaa
ataaaccttg ggccttgtgc tgactgagat ggggtttggt gattacagaa
5700ttttagcgaa ttttgtaatt gtacttgttt gtctgtagtt ttgttttgtt
ttcttgtttc 5760tcatacattc cttaggcttc aattttattc gagtataggt
cacaatagga attcaaactt 5820tgagcagggg aattaatccc ttccttcaaa
tccagtttgt ttgtatatat gtttaaaaaa 5880tgaaactttt gctttaaatt
ctattataac tttttttatg gctgaaattt ttgcatgtgt 5940ctttgctctc
tgttgtaaat ttactgttta ggtactaact ctaggcttgt tgtgcagttt
6000ttgaagtata accatgccac acaacacaat ggcggccacc gcttccagaa
ccacccgatt 6060ctcttcttcc tcttcacacc ccaccttccc caaacgcatt
actagatcca ccctccctct 6120ctctcatcaa accctcacca aacccaacca
cgctctcaaa atcaaatgtt ccatctccaa 6180accccccacg gcggcgccct
tcaccaagga agcgccgacc acggagccct tcgtgtcacg 6240gttcgcctcc
ggcgaacctc gcaagggcgc ggacatcctt gtggaggcgc tggagaggca
6300gggcgtgacg acggtgttcg cgtaccccgg cggtgcgtcg atggagatcc
accaggcgct 6360cacgcgctcc gccgccatcc gcaacgtgct cccgcgccac
gagcagggcg gcgtcttcgc 6420cgccgaaggc tacgcgcgtt cctccggcct
ccccggcgtc tgcattgcca cctccggccc 6480cggcgccacc aacctcgtga
gcggcctcgc cgacgcttta atggacagcg tcccagtcgt 6540cgccatcacc
ggccaggtcg cccgccggat gatcggcacc gacgccttcc aagaaacccc
6600gatcgtggag gtgagcagat ccatcacgaa gcacaactac ctcatcctcg
acgtcgacga 6660catcccccgc gtcgtcgccg aggctttctt cgtcgccacc
tccggccgcc ccggtccggt 6720cctcatcgac attcccaaag acgttcagca
gcaactcgcc gtgcctaatt gggacgagcc 6780cgttaacctc cccggttacc
tcgccaggct gcccaggccc cccgccgagg cccaattgga 6840acacattgtc
agactcatca tggaggccca aaagcccgtt ctctacgtcg gcggtggcag
6900tttgaattcc agtgctgaat tgaggcgctt tgttgaactc actggtattc
ccgttgctag 6960cactttaatg ggtcttggaa cttttcctat tggtgatgaa
tattcccttc agatgctggg 7020tatgcatggt actgtttatg ctaactatgc
tgttgacaat agtgatttgt tgcttgcctt 7080tggggtaagg tttgatgacc
gtgttactgg gaagcttgag gcttttgcta gtagggctaa 7140gattgttcac
attgatattg attctgccga gattgggaag aacaagcagg cgcacgtgtc
7200ggtttgcgcg gatttgaagt tggccttgaa gggaattaat atgattttgg
aggagaaagg 7260agtggagggt aagtttgatc ttggaggttg gagagaagag
attaatgtgc agaaacacaa 7320gtttccattg ggttacaaga cattccagga
cgcgatttct ccgcagcatg ctatcgaggt 7380tcttgatgag ttgactaatg
gagatgctat tgttagtact ggggttgggc agcatcaaat 7440gtgggctgcg
cagttttaca agtacaagag accgaggcag tggttgacct cagggggtct
7500tggagccatg ggttttggat tgcctgcggc tattggtgct gctgttgcta
accctggggc 7560tgttgtggtt gacattgatg gggatggtag tttcatcatg
aatgttcagg agttggccac 7620tataagagtg gagaatctcc cagttaagat
attgttgttg aacaatcagc atttgggtat 7680ggtggttcag ttggaggata
ggttctacaa gtccaataga gctcacacct atcttggaga 7740tccgtctagc
gagagcgaga tattcccaaa catgctcaag tttgctgatg cttgtgggat
7800accggcagcg cgagtgacga agaaggaaga gcttagagcg gcaattcaga
gaatgttgga 7860cacccctggc ccctaccttc ttgatgtcat tgtgccccat
caggagcatg tgttgccgat 7920gattcccagt aatggatcct tcaaggatgt
gataactgag ggtgatggta gaacgaggta 7980ctgattgcct agaccaaatg
ttccttgatg cttgttttgt acaatatata taagataatg 8040ctgtcctagt
tgcaggattt ggcctgtggt gagcatcata gtctgtagta gttttggtag
8100caagacattt tattttcctt ttatttaact tactacatgc agtagcatct
atctatctct 8160gtagtctgat atctcctgtt gtctgtattg tgccgttgga
ttttttgctg tagtgagact 8220gaaaatgatg tgctagtaat aatatttctg
ttagaaatct aagtagagaa tctgttgaag 8280aagtcaaaag ctaatggaat
caggttacat attcaatgtt tttctttttt tagcggttgg 8340tagacgtgta
gattcaactt ctcttggagc tcacctaggc aatcagtaaa atgcatattc
8400cttttttaac ttgccattta tttactttta gtggaaattg tgaccaattt
gttcatgtag 8460aacggatttg gaccattgcg tccacaaaac gtctcttttg
ctcgatcttc acaaagcgat 8520accgaaatcc agagatagtt ttcaaaagtc
agaaatggca aagttataaa tagtaaaaca 8580gaatagatgc tgtaatcgac
ttcaataaca agtggcatca cgtttctagt tctagaccca 8640tcagctgggc
cggccactag tgagctcggt acccggggg 8679427532DNAArtificial
Sequenceright border sequence and complete transgene insert for
event 3560.4.3.5 42ggccgctcta gagatccgtc aacatggtgg agcacgacac
tctcgtctac tccaagaata 60tcaaagatac agtctcagaa gaccaaaggg ctattgagac
ttttcaacaa agggtaatat 120cgggaaacct cctcggattc cattgcccag
ctatctgtca cttcatcaaa aggacagtag 180aaaaggaagg tggcacctac
aaatgccatc attgcgataa aggaaaggct atcgttcaag 240atgcctctgc
cgacagtggt cccaaagatg gacccccacc cacgaggagc atcgtggaaa
300aagaagacgt tccaaccacg tcttcaaagc aagtggattg atgtgatgat
cctatgcgta 360tggtatgacg tgtgttcaag atgatgactt caaacctacc
tatgacgtat ggtatgacgt 420gtgtcgactg atgacttaga tccactcgag
cggctataaa tacgtaccta cgcaccctgc 480gctaccatcc ctagagctgc
agcttatttt tacaacaatt accaacaaca acaaacaaca 540aacaacatta
caattactat ttacaattac agtcgacccg ggatccacac gacaccatga
600tagaggtgaa accgattaac gcagaggata cctatgaact aaggcataga
atactcagac 660caaaccagcc gatagaagcg tgtatgtttg aaagcgattt
acttcgtggt gcatttcact 720taggcggctt ttacaggggc aaactgattt
ccatagcttc attccaccag gccgagcact 780cggaactcca aggccagaaa
cagtaccagc tccgaggtat ggctaccttg gaaggttatc 840gtgagcagaa
agcgggatca actctagtta aacacgctga agaaatcctt cgtaagaggg
900gggcggacat gctttggtgt aatgcgagga catccgcctc aggctactac
aaaaagttag 960gcttcagcga gcagggagag atatttgaca cgccgccagt
aggacctcac atcctgatgt 1020ataaaaggat cacataacta gctagtcagt
taacctagac ttgtccatct tctggattgg 1080ccaacttaat taatgtatga
aataaaagga tgcacacata gtgacatgct aatcactata 1140atgtgggcat
caaagttgtg tgttatgtgt aattactagt tatctgaata aaagagaaag
1200agatcatcca tatttcttat cctaaatgaa tgtcacgtgt ctttataatt
ctttgatgaa 1260ccagatgcat ttcattaacc aaatccatat acatataaat
attaatcata tataattaat 1320atcaattggg ttagcaaaac aaatctagtc
taggtgtgtt ttgcgaattc gatatcaagc 1380tttgctctag atcaaactca
catccaaaca taacatggat atcttcctta ccaatcatac 1440taattatttt
gggttaaata ttaatcatta tttttaagat attaattaag aaattaaaag
1500attttttaaa aaaatgtata aaattatatt attcatgatt tttcatacat
ttgattttga 1560taataaatat atttttttta atttcttaaa aaatgttgca
agacacttat tagacatagt 1620cttgttctgt ttacaaaagc attcatcatt
taatacatta aaaaatattt aatactaaca 1680gtagaatctt cttgtgagtg
gtgtgggagt aggcaacctg gcattgaaac gagagaaaga 1740gagtcagaac
cagaagacaa ataaaaagta tgcaacaaac aaatcaaaat caaagggcaa
1800aggctggggt tggctcaatt ggttgctaca ttcaattttc aactcagtca
acggttgaga 1860ttcactctga cttccccaat ctaagccgcg gatgcaaacg
gttgaatcta acccacaatc 1920caatctcgtt acttaggggc ttttccgtca
ttaactcacc cctgccaccc ggtttcccta 1980taaattggaa ctcaatgctc
ccctctaaac tcgtatcgct tcagagttga gaccaagaca 2040cactcgttca
tatatctctc tgctcttctc ttctcttcta cctctcaagg tacttttctt
2100ctccctctac caaatcctag attccgtggt tcaatttcgg atcttgcact
tctggtttgc 2160tttgccttgc tttttcctca actgggtcca tctaggatcc
atgtgaaact ctactctttc 2220tttaatatct gcggaatacg cgtttgactt
tcagatctag tcgaaatcat ttcataattg 2280cctttctttc ttttagctta
tgagaaataa aatcactttt tttttatttc aaaataaacc 2340ttgggccttg
tgctgactga gatggggttt ggtgattaca gaattttagc gaattttgta
2400attgtacttg tttgtctgta gttttgtttt gttttcttgt ttctcataca
ttccttaggc 2460ttcaatttta ttcgagtata ggtcacaata ggaattcaaa
ctttgagcag gggaattaat 2520cccttccttc aaatccagtt tgtttgtata
tatgtttaaa aaatgaaact tttgctttaa 2580attctattat aacttttttt
atggctgaaa tttttgcatg tgtctttgct ctctgttgta 2640aatttactgt
ttaggtacta actctaggct tgttgtgcag tttttgaagt ataaccatgc
2700cacacaacac aatggcggcc accgcttcca gaaccacccg attctcttct
tcctcttcac 2760accccacctt ccccaaacgc attactagat ccaccctccc
tctctctcat caaaccctca 2820ccaaacccaa ccacgctctc aaaatcaaat
gttccatctc caaacccccc acggcggcgc 2880ccttcaccaa ggaagcgccg
accacggagc ccttcgtgtc acggttcgcc tccggcgaac
2940ctcgcaaggg cgcggacatc cttgtggagg cgctggagag gcagggcgtg
acgacggtgt 3000tcgcgtaccc cggcggtgcg tcgatggaga tccaccaggc
gctcacgcgc tccgccgcca 3060tccgcaacgt gctcccgcgc cacgagcagg
gcggcgtctt cgccgccgaa ggctacgcgc 3120gttcctccgg cctccccggc
gtctgcattg ccacctccgg ccccggcgcc accaacctcg 3180tgagcggcct
cgccgacgct ttaatggaca gcgtcccagt cgtcgccatc accggccagg
3240tcgcccgccg gatgatcggc accgacgcct tccaagaaac cccgatcgtg
gaggtgagca 3300gatccatcac gaagcacaac tacctcatcc tcgacgtcga
cgacatcccc cgcgtcgtcg 3360ccgaggcttt cttcgtcgcc acctccggcc
gccccggtcc ggtcctcatc gacattccca 3420aagacgttca gcagcaactc
gccgtgccta attgggacga gcccgttaac ctccccggtt 3480acctcgccag
gctgcccagg ccccccgccg aggcccaatt ggaacacatt gtcagactca
3540tcatggaggc ccaaaagccc gttctctacg tcggcggtgg cagtttgaat
tccagtgctg 3600aattgaggcg ctttgttgaa ctcactggta ttcccgttgc
tagcacttta atgggtcttg 3660gaacttttcc tattggtgat gaatattccc
ttcagatgct gggtatgcat ggtactgttt 3720atgctaacta tgctgttgac
aatagtgatt tgttgcttgc ctttggggta aggtttgatg 3780accgtgttac
tgggaagctt gaggcttttg ctagtagggc taagattgtt cacattgata
3840ttgattctgc cgagattggg aagaacaagc aggcgcacgt gtcggtttgc
gcggatttga 3900agttggcctt gaagggaatt aatatgattt tggaggagaa
aggagtggag ggtaagtttg 3960atcttggagg ttggagagaa gagattaatg
tgcagaaaca caagtttcca ttgggttaca 4020agacattcca ggacgcgatt
tctccgcagc atgctatcga ggttcttgat gagttgacta 4080atggagatgc
tattgttagt actggggttg ggcagcatca aatgtgggct gcgcagtttt
4140acaagtacaa gagaccgagg cagtggttga cctcaggggg tcttggagcc
atgggttttg 4200gattgcctgc ggctattggt gctgctgttg ctaaccctgg
ggctgttgtg gttgacattg 4260atggggatgg tagtttcatc atgaatgttc
aggagttggc cactataaga gtggagaatc 4320tcccagttaa gatattgttg
ttgaacaatc agcatttggg tatggtggtt cagttggagg 4380ataggttcta
caagtccaat agagctcaca cctatcttgg agatccgtct agcgagagcg
4440agatattccc aaacatgctc aagtttgctg atgcttgtgg gataccggca
gcgcgagtga 4500cgaagaagga agagcttaga gcggcaattc agagaatgtt
ggacacccct ggcccctacc 4560ttcttgatgt cattgtgccc catcaggagc
atgtgttgcc gatgattccc agtaatggat 4620ccttcaagga tgtgataact
gagggtgatg gtagaacgag gtactgattg cctagaccaa 4680atgttccttg
atgcttgttt tgtacaatat atataagata atgctgtcct agttgcagga
4740tttggcctgt ggtgagcatc atagtctgta gtagttttgg tagcaagaca
ttttattttc 4800cttttattta acttactaca tgcagtagca tctatctatc
tctgtagtct gatatctcct 4860gttgtctgta ttgtgccgtt ggattttttg
ctgtagtgag actgaaaatg atgtgctagt 4920aataatattt ctgttagaaa
tctaagtaga gaatctgttg aagaagtcaa aagctaatgg 4980aatcaggtta
catattcaat gtttttcttt ttttagcggt tggtagacgt gtagattcaa
5040cttctcttgg agctcaccta ggcaatcagt aaaatgcata ttcctttttt
aacttgccat 5100ttatttactt ttagtggaaa ttgtgaccaa tttgttcatg
tagaacggat ttggaccatt 5160gcgtccacaa aacgtctctt ttgctcgatc
ttcacaaagc gataccgaaa tccagagata 5220gttttcaaaa gtcagaaatg
gcaaagttat aaatagtaaa acagaataga tgctgtaatc 5280gacttcaata
acaagtggca tcacgtttct agttctagac ccatcagctg ggccggccac
5340tagtgagctc ggtacccggg ggcgcgtaat atcatcatta ggaagacact
gcccatcttg 5400aataggattt tagctactaa atatgttgat ggtctttatg
aaaaactatt aactaggaat 5460attatgctac ccatatggaa agaagacgct
aggggaatag aaagaccatc aaataaacga 5520agtcaacacc aggtcttccg
aagcattaac aattacctat ttaatatgta ctcagtccgg 5580gtggatatct
cactacattg acgcagtttg ttcaaagacg aacgccctga attatgccat
5640ctgcttaggc tttcaaatat ggtacgctct aatgccaagc cttatgctgg
tcttagggta 5700ttatcatcaa atctttaagc cagaggtagt taaatacatc
aaggacacca taggagtatg 5760gcacaacgat attgtcaaga tcgcatcaga
tctaataggc aataatgaat tcttcatgca 5820gcccgacgtg ggaacgctcg
aaagcagtgg ggcctctggg acagggacca gacctgagtc 5880gctaacattt
gggaataaga gaagtagata tacccaattt tttaactagc caaggaagga
5940aagcgggaaa ggtccgatac aaaggaaagg gttgcgaggc ttaacgattt
agaatatagc 6000tgttgaggtg gcacttgttc ccccggggcg ggggtatatg
cccgtagctt tattctgtca 6060cttctttcag atcaatgaag ttgaaaagtt
atagagtaag ggacccttgt ttacaaagct 6120gtcactccaa gaactcgaag
tcaagcatct tcgggaatat ccagattagt cttcaactag 6180agaaaggata
ggaatctcct ttgcagagtt ttcttctcct gctgatgtag cggtaaagtc
6240aaaagttgga tgcccttttt tctttattta attaattccg ttgatagagc
ttttgagcgg 6300atgcaagcac tagattcttc aacgagtacc aataataaat
gaattcacca gactaagaga 6360agaaaacaga acaaaaagat taagcccagc
cgccttcggg aagacctatc ttcgtcggga 6420ggaagagccc tctttacacc
attgtgatta gaaaaaaccg aaaagtggac cggcctagta 6480accaatagag
cggggcttga tccccacttt aaatctattg gatagagccc tcagcccagg
6540gcaagcgatt gaattctatt tgattatggg ttaggtggaa cctgaaacta
gcacttacaa 6600atgagttagc aaaaggaaaa agacaattct caaatgcgta
caagactttc ttccttcttt 6660gtttaagagg ccagtctgcg atggatgctc
gtgcatgaaa aagggctttg atctattcac 6720cacttatata atagagccaa
tctctgcagg acaagatatc tattttgtca ttgggaagta 6780aggcttaagt
cgacgaaaaa gttaggaaag gggatcatat ggctagggtt gccctcgggg
6840ctcaagggtt tagcgatgaa gagtgccaag caaaaggtca ataccggtac
gccgatcaaa 6900gaagtccagt ggcaaggccc tttcagccaa gctagcgtgc
tgaacagaaa gtcgtagagt 6960gatgacagct tcttcttctt gagtcattcg
tgtgacaaca tcaggatctc gtcgaaagac 7020ctcctctgcc tatctctccc
gcaagagagg actcgttatg gcgcacctct ttttagcagt 7080ctcgtcaata
agataagatt gcccctccct tcttattgat ttgataaagg gctttgtcca
7140ctccctctct tcttagccga gcggagtgac ggtttagttt aggctttaga
tgccactgcg 7200aaagactcta gagatccact ctcacagcgt atacgcgaca
tccctatgta tacacaatcc 7260tttcaagcag ctaggacagc tagcaagcaa
gttatctgtt cgcggacaag ctctctggat 7320gacaaaaaac atgctctttc
atgcggaaaa aacacggtct ttcgtggaag ttggtcgatt 7380tgaagtcgct
ttatgagtga aaatgggtcg atgacgaaaa agacggggaa aatgatcaac
7440tgtcacattt tgatgccagt ttagggctaa aatgaacttt catccaaaaa
gaccgagaaa 7500acgctccact ggcaggatcc gatcggaaat aa
753243181DNAArtificial Sequencefirst 181 nt of the 5' end of the
transgene insert for event 3560.4.3.5 43ggccgctcta gagatccgtc
aacatggtgg agcacgacac tctcgtctac tccaagaata 60tcaaagatac agtctcagaa
gaccaaaggg ctattgagac ttttcaacaa agggtaatat 120cgggaaacct
cctcggattc cattgcccag ctatctgtca cttcatcaaa aggacagtag 180a
1814424DNAArtificial Sequenceprimer 104312 44agatccgtca acatggtgga
gcac 244526DNAArtificial Sequenceprimer 104314 45tgacagatag
ctgggcaatg gaatcc 264614DNAArtificial SequenceTaqMan probe 125323
46tatcgggaaa cctc 144726DNAArtificial SequencePrimer 109893
(endogenous control) 47ctttgctgtt tgattgctgg gttgtc
264828DNAArtificial SequencePrimer 109894 (endogenous control)
48tgtgtggacc cattggcctt tagattat 284916DNAArtificial SequenceTaqMan
Probe 125322 (endogenous control) 49actctgcagt tgcctt
165029DNAArtificial Sequenceprimer 1473 50ttatttccga tcggatcctg
ccagtggag 295123DNAArtificial Sequenceprimer 1504 51ccaccatgtt
gacggatctc tag 235223DNAArtificial Sequenceprimer 1505 52gcaatggaat
ccgaggaggt ttc 235322DNAArtificial Sequenceprimer 1506 53gcaatgatgg
catttgtagg tg 225428DNAArtificial Sequenceprimer 1549 54aaactgaagc
gatggcagaa ccgcacag 285535DNAArtificial Sequenceprimer 1550
55tcgaagtggc aatagagcca cacaatatcg ataag 35
* * * * *
References