U.S. patent application number 13/897207 was filed with the patent office on 2013-09-19 for stabilization of hypoxia inducible factor (hif) alpha.
This patent application is currently assigned to FibroGen, Inc.. The applicant listed for this patent is Michael P. Arend, Lee A. Flippin, Volkmar Guenzler-Pukall, Alex Melekhov, Thomas B. Neff, Qingjian Wang. Invention is credited to Michael P. Arend, Lee A. Flippin, Volkmar Guenzler-Pukall, Alex Melekhov, Thomas B. Neff, Qingjian Wang.
Application Number | 20130245037 13/897207 |
Document ID | / |
Family ID | 27502557 |
Filed Date | 2013-09-19 |
United States Patent
Application |
20130245037 |
Kind Code |
A1 |
Guenzler-Pukall; Volkmar ;
et al. |
September 19, 2013 |
Stabilization of Hypoxia Inducible Factor (HIF) Alpha
Abstract
The present invention relates to methods of stabilizing the
alpha subunit of hypoxia inducible factor (HIF). The invention
further relates to methods of preventing, pretreating, or treating
conditions associated with HIF, including ischemic and hypoxic
conditions. Compounds for use in these methods are also
provided.
Inventors: |
Guenzler-Pukall; Volkmar;
(San Leandro, CA) ; Neff; Thomas B.; (Atherton,
CA) ; Wang; Qingjian; (Belmont, CA) ; Arend;
Michael P.; (Foster City, CA) ; Flippin; Lee A.;
(Woodside, CA) ; Melekhov; Alex; (Irvine,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Guenzler-Pukall; Volkmar
Neff; Thomas B.
Wang; Qingjian
Arend; Michael P.
Flippin; Lee A.
Melekhov; Alex |
San Leandro
Atherton
Belmont
Foster City
Woodside
Irvine |
CA
CA
CA
CA
CA
CA |
US
US
US
US
US
US |
|
|
Assignee: |
FibroGen, Inc.
San Francisco
CA
|
Family ID: |
27502557 |
Appl. No.: |
13/897207 |
Filed: |
May 17, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12928119 |
Dec 2, 2010 |
8466172 |
|
|
13897207 |
|
|
|
|
11494978 |
Jul 28, 2006 |
|
|
|
12928119 |
|
|
|
|
10313551 |
Dec 6, 2002 |
|
|
|
11494978 |
|
|
|
|
60337082 |
Dec 6, 2001 |
|
|
|
60359683 |
Feb 25, 2002 |
|
|
|
60349659 |
Jan 16, 2002 |
|
|
|
60385488 |
Jun 4, 2002 |
|
|
|
Current U.S.
Class: |
514/253.07 ;
514/300; 514/309; 514/311; 514/312; 514/345; 514/346; 514/597 |
Current CPC
Class: |
A61P 25/08 20180101;
A61P 17/02 20180101; A61P 25/16 20180101; A61P 31/00 20180101; A61K
31/472 20130101; A61P 9/00 20180101; A61P 29/00 20180101; A61P
37/04 20180101; A61K 31/44 20130101; A61P 35/00 20180101; A61P
39/00 20180101; A61K 31/4738 20130101; A61P 9/10 20180101; A61P
13/12 20180101; A61K 31/63 20130101; A61P 25/28 20180101; A61K
31/4418 20130101; A61P 11/00 20180101; A61K 31/496 20130101; A61P
1/04 20180101; C07K 14/4702 20130101; A61K 31/00 20130101; A61K
31/17 20130101; A61P 9/12 20180101; A61P 25/00 20180101; A61K 31/47
20130101; A61K 31/4745 20130101; A61P 9/04 20180101; A61K 31/4375
20130101; C07K 14/505 20130101; A61P 43/00 20180101; G01N 33/746
20130101; A61P 9/08 20180101; A61K 38/1709 20130101; A61P 7/00
20180101; A61P 1/16 20180101; A61P 3/10 20180101; A61P 7/06
20180101; A61P 37/00 20180101; A61P 25/14 20180101 |
Class at
Publication: |
514/253.07 ;
514/300; 514/309; 514/597; 514/311; 514/346; 514/312; 514/345 |
International
Class: |
A61K 31/496 20060101
A61K031/496; A61K 31/472 20060101 A61K031/472; A61K 31/4418
20060101 A61K031/4418; A61K 31/47 20060101 A61K031/47; A61K 31/44
20060101 A61K031/44; A61K 31/4375 20060101 A61K031/4375; A61K 31/17
20060101 A61K031/17 |
Claims
1. A method for treating a disorder associated with hypoxia or
ischemia in a subject, the method comprising administering to the
subject an effective amount of a compound that stabilizes the alpha
subunit of hypoxia inducible factor (HIF.alpha.).
2. The method of claim 1, wherein the compound is a compound that
inhibits HIF prolyl hydroxlase enzyme activity and is selected from
the group consisting of a heterocyclic carboxamide, a
phenanthroline, or a hydroxamate.
3. The method of claim 1, wherein the disorder is associated with
an ischemic event.
4. The method of claim 3, wherein the ischemic event is acute.
5. The method of claim 3, wherein the ischemic event is associated
with surgery, organ transplantation, infarction, trauma, or
injury.
6. The method of claim 3, wherein the ischemic event is
chronic.
7. The method of claim 3, wherein the ischemic event is associated
with ischemic reperfusion injury in a subject.
8. The method of claim 1, wherein the administering is oral
administration.
9. A method for stabilizing the alpha subunit of hypoxia inducible
factor (HIF.alpha.) in a subject, the method comprising
administering to the subject an effective amount of a compound that
inhibits HIF prolyl hydroxylase enzyme activity, wherein the
compound is selected from the group consisting of a heterocyclic
carboxamide, a phenanthroline, or a hydroxamate.
Description
[0001] This application is a continuation of U.S. application Ser.
No. 12/928,119, filed 2 Dec. 2010, which is a continuation of U.S.
application Ser. No. 11/494,978, filed 28 Jul. 2006, now abandoned,
which is a continuation of U.S. application Ser. No. 10/313,551,
filed 6 Dec. 2002, now abandoned, which claims the benefit of U.S.
Provisional Application Ser. No. 60/337,082, filed on 6 Dec. 2001;
U.S. Provisional Application Ser. No. 60/359,683, filed on 25 Feb.
2002; U.S. Provisional Application Ser. No. 60/349,659, filed on 16
Jan. 2002: and U.S. Provisional Application Ser. No. 60/386,488,
filed on 5 Jun. 2002, each of which is incorporated by reference
herein in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to methods of stabilizing the
alpha subunit of hypoxia inducible factor (HIF) and to compounds
that can be used in these methods.
BACKGROUND OF THE INVENTION
[0003] An early response to tissue hypoxia is induction of hypoxia
inducible factor (HIF), a basic helix-loop-helix (bHLH) PAS
(Per/Arnt/Sim) transcriptional activator that mediates changes in
gene expression in response to changes in cellular oxygen
concentration, HIF is a heterodimer containing an oxygen-regulated
alpha subunit (HIF.alpha.) and a constitutively expressed beta
subunit (HIF.beta.), also known as aryl hydrocarbon receptor
nuclear transporter (ARNT). In oxygenated (normoxic) cells,
HIF.alpha. subunits are rapidly degraded by a mechanism that
involves ubiquitination by the von Hippel-Lindau tumor suppressor
(pVHL) E3 ligase complex. Under hypoxic conditions, HIF.alpha. is
not degraded, and an active HIF.alpha./.beta. complex accumulates
in the nucleus and activates the expression of several genes
including glycolytic enzymes, glucose transporter (GLUT)-1,
erythropoietin (EPO), and vascular endothelial growth factor
(VEGF), (Jiang et al. (1996) J Biol Chem 271:17771-17778;
Iliopoulus et al. (1996) Proc Natl Acad Sci USA 93:10595-10599;
Maxwell et al. (1999) Nature 399:271-275; Slitter et al. (2000)
Proc Natl Acad Sci USA 97:4748-4753; Cockman et al. (2000) J Biol
Chem 275:25733-25741; and Tanimoto et al. (2000) EMBO J
19:4298-4309.)
[0004] Levels off HIF.alpha. protein are elevated in most cells in
response to hypoxia and HIF.alpha. is induced in viva when animals
are subjected to anemia or hypoxia. HIF.alpha. levels rise within a
few hours after the onset of hypoxia and return to baseline under
continued hypoxic conditions. HIF has been implicated in numerous
cellular and developmental processes including cell proliferation,
angiogenesis, and cell cycle arrest. HIF.alpha. has also been
associated with myocardial acute ischemia and early infarction,
pulmonary hypertension, and inflammation. Although HIF.alpha. has
been associated with tumor growth and metastasis, there is little
indication that HIF is directly involved in tumorigenesis. Hypoxic
preconditioning, in which a target organ is subjected to brief
periods of hypoxia, has been shown to protect both myocardium and
brain against hypoxic-ischemic injury. HIF.alpha. stabilization is
closely associated with ischemia and is induced by preconditioning.
(Wang and Semenza (1993) Proc Natl Acad Sci USA 90:4304-4308;
Stroka et al. (2001) FASEB J 15:2445-2453; Semenza et al. (1997)
Kidney Int 51:553-555: Carmeliet et al. (1998) Nature 394:485-490;
Zhong et al. (1999) Cancer Res 59:5830-5835; Lee et al. (2000) N
Engl J Med 343:148-449; Sharp et al. (2000) J Cereb Blood Flow
Metab 20:1011-1032; Semenza et al. (2000) Adv Exp Med Biol
1475:123-130; Thornton et al. (2000) Biochem J 350:307-312; Deindl
and Schaper (1998) Mol Cell Biochem 186:43-51; Bergeron et al.
(2000) Ann Neurol 48:285-296.)
[0005] Several investigators have studied the mechanism of
interaction between HIF.alpha. and pVHL. An oxygen-dependent
degradation domain (ODD) within HIF-1.alpha. from residue 401 to
603 was originally identified as sufficient to confer
oxygen-dependent instability to chimeric protein constructs. A
domain containing a portion of the ODD, from residue 526 to 652,
was found to be required for pVHL-dependent degradation. Further,
mutation of P.sub.564YI to aspartic acids or mutation of K.sub.532
to arginine within a region conserved among HIF.alpha. homologs
(residue 556 to 574 in HIF-1.alpha.) rendered the full-length
HIF.alpha. protein stable under normoxic conditions and resistant
to pVHL-mediated degradation. (Huang et al. (1998) Proc Natl Acad
Sci USA 95:7987-7992; and Tanimoto et al. (2000) EMBO J
19:4298-4309.)
[0006] HIF.alpha. levels are increased by a number of factors that
mimic hypoxia, including iron chelators such as desferrioxamine
(DFO) and divalent metal salts such as CoCl.sub.2. HIF.alpha.
levels are increased by angiotensin II, thrombin, and
platelet-derived growth factor under normoxic conditions using a
mechanism involving reactive oxygen species. Reports have also
suggested HIF.alpha.0 is regulated by phosphorylation through
pathways involving nitric oxide-activated phosphotidylinositol
3'-kinase (PI3K), hepatocyte growth factor, or mitogen-activated
protein kinase. Glycogen-synthase kinase, which is a downstream
target of PI3K, directly phosphorylates the HIF.alpha. ODD domain.
(Richard et al. (2000) J Biol Chem 275:26765-26771; Sandau et al.
(2000) Biochem Biophys Res Commun 278:263-267; Tacchini et al.
(2001) Carcinogenesis 22:1363-1371; and Sodhi et al. (2001) Biochem
Biophys Res Commun 287:292-300.)
[0007] Hypoxia, a state of reduced oxygen, can occur when the lungs
are compromised or blood flow is reduced. Ischemia, reduction in
blood flow, can be caused by the obstruction of an artery or vein
by a blood clot (thrombus) or by any foreign circulating matter
(embolus), or by a vascular disorder such as atherosclerosis.
Reduction in blood flow can have a sudden onset and short duration
(acute ischemia), or can have a slow onset with long duration or
frequent recurrence (chronic ischemia). Acute ischemia is often
associated with regional, irreversible tissue necrosis (an
infarct), whereas chronic ischemia is usually associated with
transient hypoxic tissue injury. If the decrease in perfusion is
prolonged or severe, however, chronic ischemia can also be
associated with an infarct. Infarctions commonly occur in the
spleen, kidney, lungs, brain, and heart, producing disorders such
as intestinal infarction, pulmonary infarction, ischemic stroke,
and myocardial infarction.
[0008] Pathologic changes in ischemic disorders depend on the
duration and severity of ischemia, and on the length of patient
survival. Necrosis can be seen within the infarct in the first 24
hours, and an acute inflammatory response develops in the viable
tissue adjacent to the infarct with leukocytes migrating into the
area of dead tissue. Over succeeding days, there is a gradual
breakdown and removal of cells within the infarct by phagocytosis,
and replacement with a collagenous or glial scar.
[0009] Hypoperfusion or infarction in one organ often affects other
organs. For example, ischemia of the lung, caused by, for example,
a pulmonary embolism, not only affects the lung, but also puts the
heart and other organs, such as the brain, under hypoxic stress.
Myocardial infarction, which often involves coronary artery
blockage due to thrombosis, arterial wall vasospasms, or viral
infection of the heart, can lead to congestive heart failure and
systemic hypotension. Secondary complications such as global
ischemic encephalopathy can develop if the cardiac arrest is
prolonged with continued hypoperfusion. Cerebral ischemia, most
commonly caused by vascular occlusion due to atherosclerosis, can
range in severity from transient ischemic attacks (TIAs) to
cerebral infarction or stroke. While the symptoms of TIAs are
temporary and reversible, TIAs tend to recur and are often followed
by a stroke.
[0010] Occlusive arterial disease includes coronary artery disease,
which can lead to myocardial infarction, and peripheral, arterial
disease, which can affect the abdominal aorta, its major branches,
and arteries of the legs. Peripheral arterial disease includes
Buerger's disease, Raynaud's disease, and acrocyanosis. Although
peripheral arterial disease is commonly caused by atherosclerosis,
other major causes include, e.g., diabetes, etc. Complications
associated with peripheral arterial disease include severe leg
cramps, angina, abnormal heart rhythms, heart failure, heart
attack, stroke, and kidney failure.
[0011] Ischemic and hypoxic disorders are a major cause of
morbidity and mortality. Cardiovascular diseases cause at least 15
million deaths every year and are responsible for 30% of deaths
worldwide. Among the various cardiovascular diseases, ischemic
heart disease and cerebrovascular diseases cause approximately 17%
of deaths. Annually, 1.3 million cases of nonfatal acute myocardial
infarction are reported, making the prevalence approximately 600
per 100,000 people. Further, an estimated five million Americans
suffer from venous thrombosis every year, and approximately 600,000
of these cases result in pulmonary embolism. About one-third of the
pulmonary embolisms end in death, making pulmonary embolism the
third most common cause of death in the United States.
[0012] Currently, treatment of ischemic and hypoxic disorders is
focused on relief of symptoms and treatment of causative disorders.
For example, treatments for myocardial infarction include
nitroglycerin and analgesics to control pain and relieve the
workload of the heart. Other medications, including digoxin,
diuretics, amrinone, .beta.-blockers, lipid-lowering agents and
angiotensin-converting enzyme inhibitors, are used to stabilize the
condition, but none of these therapies directly address the tissue
damage produced by the ischemia and hypoxia.
[0013] Due to deficiencies in current treatments, there remains a
need for methods that are effective in treating conditions
involving ischemia and hypoxia such as occlusive arterial disease,
angina pectoris, intestinal infarctions, pulmonary infarctions,
cerebral ischemia, and myocardial infarction. There is also a need
for methods that are effective in the prevention of tissue damage
caused by ischemia that occurs due to, e.g., atherosclerosis,
diabetes, and pulmonary disorders such as pulmonary embolism and
the like. In summary, there is a need in the art for methods and
compounds that can be used to stabilize HIF, and to treat and
prevent HIF-associated disorders including conditions involving
ischemia and hypoxia.
SUMMARY OF THE INVENTION
[0014] Described herein are methods of stabilizing the alpha
subunit of hypoxia inducible factor (HIF.alpha.). These methods can
be applied in vivo or in vitro.
[0015] The present invention relates generally to methods of
stabilizing the alpha subunit of hypoxia inducible factor (HIF). In
one embodiment, the method of stabilizing the alpha subunit of
HIF.alpha. (HIF.alpha.) comprises administering to a subject a
compound that inhibits hydroxylation of HIF.alpha.. In certain of
the embodiments of the present invention, the HIF.alpha. is
selected from the group consisting of HIF-1.alpha., HIF-2.alpha.,
HIF-3.alpha., and any fragment thereof. In a further embodiment,
the method comprises administering to a subject a compound that
inhibits 2-oxoglutarate dioxygenase enzyme activity. In various
embodiments, the 2-oxoglutarate dioxygenase enzyme is selected from
the group consisting of EGLN1, EGLN2, EGLN3, procollagen prolyl
4-hydroxylase, procollagen prolyl 3-hydroxylase, procollagen lysyl
hydroxylase, PHD4, FIH-1, and any subunit or fragment thereof,
respectively.
[0016] In particular methods for stabilizing HIF.alpha. according
to the present invention, the methods comprise inhibiting
HIF.alpha. prolyl hydroxylase enzyme activity. In further
embodiments, the HIF.alpha. prolyl hydroxylase enzyme is selected
from the group consisting of EGLN1, EGLN2, EGLN3, and any subunit
or fragment thereof, respectively.
[0017] The present invention provides, in one aspect, methods for
stabilizing endogenous HIF.alpha.. Thus, in a particular
embodiment, the HIF.alpha. is endogenous to the subject.
Embodiments of the present invention include methods for
stabilizing HIF.alpha. in which a compound that stabilizes
HIF.alpha. is administered to a subject in vivo. The subject can
be, for example, an animal, preferably, a mammal, and, more
preferably, a human. Methods of ex viva administration are also
contemplated. In such methods, the subject can be, e.g., a cell,
tissue, or organ, etc. In certain embodiments, the subject is a
cell, tissue, or organ derived from a system such as the renal,
cardiac, hepatic, pulmonary, hematopoietic, gastrointestinal,
neuronal, or musculoskeletal system, etc.
[0018] Methods for treating, preventing, or pretreating a
HIF-associated condition are also provided. In particular, the
present invention provides a method for treating, preventing, or
pretreating a HIF-associated condition, the method comprising
stabilizing HIF.alpha.. In specific aspects, the invention provide
a method for treatment, prevention, or pretreatment/preconditioning
of a HIF-associated condition in a subject, the method comprising
stabilization of HIF.alpha.. In various aspects, the HIF-associated
condition is associated with ischemia or hypoxia. In a preferred
aspect, the method comprises administering to the subject a
compound that stabilizes HIF.alpha..
[0019] In various embodiments, the compound is selected from the
group consisting of heterocyclic carboxamides, phenanthrolines,
hydroxamates, and physiologically active salts and prodrugs derived
therefrom. In particular embodiments, the compound is a
heterocyclic carboxamide selected from the group consisting of
pyridine carboxamides, quinoline carboxamides, isoquinoline
carboxamides, cinnoline carboxamides, and beta-carboline
carboxamides. In a preferred embodiment of the present invention,
the compound is delivered in an oral formulation. In another
preferred embodiment, the compound is delivered in a transdermal
formulation.
[0020] In one method of stabilizing HIF.alpha. according to the
present invention, the compound stabilizes HIF.alpha. by
specifically inhibiting hydroxylation of at least one amino acid
residue in HIF.alpha.. In a further aspect, the amino acid residue
is selected from the group consisting of proline and
asparagine.
[0021] Methods for treating, preventing, or pretreating a
HIF-associated condition in a subject, the methods comprising
inhibiting 2-oxoglutarate dioxygenase enzyme activity, are also
provided, and include methods in which the HIF-associated condition
is one associated with ischemia or hypoxia. In one aspect, the
present invention provides a method for treating, preventing, or
pretreating a HIF-associated condition, the method comprising
administering to the subject a compound that inhibits
2-oxoglutarate dioxygenase enzyme activity.
[0022] In a preferred embodiment, the present invention provides a
method of treating, preventing, or pretreating a HIF-associated
condition in a subject, the method comprising inhibiting HIF prolyl
hydroxylase enzyme activity. Again, HIF-associated conditions
include those associated with hypoxia, or with ischemia, etc. In a
particular embodiment, the method comprises administering to the
subject a compound that inhibits HIF prolyl hydroxylase
activity.
[0023] In a further embodiment, the method further comprises
administering a second compound. In particular embodiments, the
second compound inhibits 2-oxoglutarate dioxygenase enzyme
activity, or the compound and the second compound inhibit the
activities of different 2-oxoglutarate dioxygenase enzymes, or the
second compound is selected from the group consisting of an ACE
inhibitor (ACEI), angiotensin-II receptor blocker (ARB), diuretic,
digoxin, statin, or carnitine, etc.
[0024] In specific embodiments, HIF-associated conditions include
disorders such as pulmonary disorders, e.g., pulmonary embolism,
etc., cardiac disorders, e.g., myocardial infarction, congestive
heart failure, etc., neurological disorders, and the like. The
present invention thus clearly contemplates methods that can be
applied to the treatment, prevention, or
pretreatment/preconditioning of a HIF-associated condition
associated with any ischemic event, whether acute or transient, or
chronic. Acute ischemic events can include those associated with
surgery, organ transplantation, infarction (e.g., cerebral,
intestinal, myocardial, pulmonary, etc.), trauma, insult, or
injury, etc. Chronic events associated with ischemia can include
hypertension, diabetes, occlusive arterial disease, chronic venous
insufficiency, Raynaud's disease, cirrhosis, congestive heart
failure, systemic sclerosis, etc.
[0025] Methods of preconditioning or pretreating are specifically
contemplated. In one embodiment, the invention provides methods of
pretreating or preconditioning wherein HIF.alpha. is stabilized
prior to the occurrence of an event associated with a
HIF-associated condition, e.g., ischemia, etc., or the development
of a HIF-associated condition. Ischemias can be induced by acute
events. Such events can include, for example, surgery, e.g.,
angioplasty, organ transplantation, etc., and related procedures
such as administration of anesthesia, etc. Furthermore, chronic
events specific embodiments, the methods of pretreating or
preconditioning are applied in situations where a subject has a
disorder predictive of the development of a HIF-associated
condition, e.g., transient ischemic attack or angina pectoris,
indicative of stroke and myocardial infarction, respectively, in
order to prevent the development of or reduce the degree of
development of the HIF-associated condition. In a particular
embodiment, a compound that stabilizes HIF.alpha. is administered
to a subject in order to increase preconditioning factors for
ischemia, for example, EPO, etc.
[0026] Methods for increasing expression of various HIF-related
factors are specifically contemplated herein. In one aspect, the
present invention provides a method for increasing expression of
angiogenic factors in a subject, the method comprising stabilizing
HIF.alpha.. In another aspect, the present invention provides a
method of increasing expression of glycolytic factors in a subject,
the method comprising stabilizing HIF.alpha.. In a further aspect,
the invention provides a method of increasing expression of factors
associated with oxidative stress in a subject, the method
comprising stabilizing HIF.alpha.. A method of treating a subject
having a disorder associated with ischemic reperfusion injury, the
method comprising stabilizing HIF.alpha., is also contemplated.
[0027] Methods for identifying compounds that stabilize HIF.alpha.
are also provided herein. For example, the present invention
provides a method of identifying a compound that stabilizes
HIF.alpha., the method comprising: (a) administering a compound of
interest to a subject or to a sample from a subject; (b) measuring
the HIF.alpha. level in the subject or in the sample; and (c)
comparing the HIF.alpha. level in the subject or in the sample to a
standard level, wherein an increase in the HIF.alpha. level in the
subject or the sample is indicative of a compound that stabilizes
HIF.alpha..
[0028] In another aspect, the methods of the invention are used to
prevent the tissue damage caused by HIF-associated disorders
including, but not limited to, ischemic and hypoxic disorders. In
one embodiment, treatment is predicated on predisposing conditions,
e.g., hypertension, diabetes, occlusive arterial disease, chronic
venous insufficiency, Raynaud's disease, cirrhosis, congestive
heart failure, and systemic sclerosis.
[0029] In yet another aspect, the methods of the invention can be
used as a pretreatment to decrease or prevent the tissue damage
caused by HIF-associated disorders including, but not limited to,
ischemic and hypoxic disorders. In one embodiment, the need for
pretreatment is based on a patient's history of recurring episodes
of an ischemic condition, e.g., myocardial infarction or transient
ischemic attacks, or has symptoms of impending ischemia, e.g.,
angina pectoris, etc. In another embodiment, the need for
pretreatment is based on physical parameters implicating possible
or likely ischemia or hypoxia, such as is the case with, e.g.,
individuals placed under general anesthesia or temporarily working
at high altitudes. In yet another embodiment, the methods may be
used in the context of organ transplants to pretreat organ donors
and to maintain organs removed from the body prior to implantation
in a recipient.
[0030] In another aspect, the invention provides compounds that
stabilize HIF.alpha. and methods of using the compounds to prevent,
pretreat, or treat HIF-associated conditions such as those
described above. In one embodiment, a therapeutically effective
amount of the compound or a pharmaceutically acceptable salt
thereof, alone or in combination with a pharmaceutically acceptable
excipient, is administered to a subject having a HIF-associated
condition. In one specific embodiment, the compound is administered
immediately following the diagnosis of an acute ischemic disorder.
In another specific embodiment, the compound is administered to a
subject during the course of a chronic ischemic condition. In yet
another specific embodiment, the ischemia is due to a transient or
acute trauma, insult, or injury such as, e.g., a spinal cord
injury. In a specific embodiment, the compound is administered to a
patient in need following diagnosis of a pulmonary disorder such as
COPD and the like.
[0031] In one aspect, the compound can be administered based on
predisposing conditions, e.g., chronic conditions, or as a
pretreatment to decrease or prevent tissue damage caused by
HIF-associated disorders. In a specific aspect, the compound is
administered to a subject who has a history of recurring episodes
of an ischemic condition, e.g., myocardial infarction or transient
ischemic attacks, or has symptoms of impending ischemia, e.g.,
angina pectoris. In another specific embodiment, the compound is
administered based on physical parameters implicating possible
ischemia or hypoxia, such as is the case with, e.g., individuals
placed under general anesthesia or temporarily working at high
altitudes. In yet another embodiment, the compounds may be used in
the context of organ transplants to pretreat organ donors and to
maintain organs removed from the body prior to implantation in a
recipient.
[0032] In one aspect, a compound of the present invention
stabilizes HIF.alpha. by specifically inhibiting hydroxylation of
amino acid residues in the HIF.alpha. protein. In one embodiment,
the agent inhibits hydroxylation of HIF.alpha. proline residues. In
one specific embodiment, the agent inhibits hydroxylation of the
HIF-1.alpha. P.sub.564 residue or a homologous proline in another
HIF.alpha. isoform. In another specific embodiment, the agent
inhibits hydroxylation of the HIF-1.alpha. P.sub.402 residue or a
homologous proline in another HIF.alpha. isoform. In yet another
embodiment, the compound may additionally inhibit hydroxylation of
HIF.alpha. asparagine residues. In one specific embodiment, the
agent inhibits hydroxylation of the HIF-1.alpha. N.sub.803 residue
or a homologous asparagine residue in another HIF.alpha.
isoform.
[0033] In certain embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (I)
##STR00001##
wherein A is 1,2-arylidene, 1,3-arylidene, 1,4-arylidene; or
(C.sub.1-C.sub.4)-alkylene, optionally substituted by one or two
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-hydroxyalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.1H.sub.(2f+1-g)Hal.sub.g,
(C.sub.1-C.sub.6)-fluoroalkoxy, (C.sub.1-C.sub.8)-fluoroalkenyloxy,
(C.sub.1-C.sub.8)-fluoroalkynyloxy, --OCF.sub.2Cl,
--O--CF.sub.2--CHFCl; (C.sub.1-C.sub.6)-alkylmercapto,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.6)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
phenyl, benzyl, phenoxy, benzyloxy, anilino, N-methylanilino,
phenylmercapto, phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or by a substituted
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.11)-aralkyloxy,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl radical, which
carries in the aryl moiety one to five identical or different
substituents selected from halogen, cyano, nitro, trifluoromethyl,
(C.sub.1-C.sub.6)-alkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)Hal.sub.g,
--OCF.sub.2Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-alkylsulfinyl,
(C.sub.1-C.sub.6)-alkylsulfonyl, (C.sub.1-C.sub.6)-alkylcarbonyl,
(C.sub.1-C.sub.6)-alkoxycarbonyl, carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
sulfamoyl, N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or wherein A is
--CR.sup.5R.sup.6 and R.sup.5 and R.sup.6 are each independently
selected from hydrogen, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.7)-cycloalkyl, aryl, or a substituent of the
.alpha.-carbon atom of an .alpha.-amino acid, wherein the amino
acid is a natural L-amino acid or its D-isomer.
[0034] B is --CO.sub.2H, --NH.sub.2, --NHSO.sub.2CF.sub.3,
tetrazolyl, imidazolyl, 3-hydroxyisoxazolyl, --CONHCOR''',
--CONHSOR''', CONHSO.sub.2R''', where R''' is aryl, heteroaryl,
(C.sub.3-C.sub.7)-cycloalkyl, or (C.sub.1-C.sub.4)-alkyl,
optionally monosubstituted by (C.sub.6-C.sub.12)-aryl, heteroaryl,
OH, SH, (C.sub.1-C.sub.4)-alkyl, (C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-thioalkyl, (C.sub.1-C.sub.4)-sulfinyl,
(C.sub.1-C.sub.4)-sulfonyl, CF.sub.3, Cl, Br, F, I, NO2, --COOH,
(C.sub.2-C.sub.5)-alkoxycarbonyl, NH.sub.2,
mono-(C.sub.1-C.sub.4-alkyl)-amino,
di-(C.sub.1-C.sub.4-alkyl)-amino, or
(C.sub.1-C.sub.4)-perfluoroalkyl; or wherein B is a CO.sub.2-G
carboxyl radical, where G is a radical of an alcohol G-OH in which
G is selected from (C.sub.1-C.sub.20)-alkyl radical,
(C.sub.3-C.sub.8) cycloalkyl radical, (C.sub.2-C.sub.20)-alkenyl
radical, (C.sub.3-C.sub.8)-cycloalkenyl radical, retinyl radical,
(C.sub.2-C.sub.20)-alkynyl radical, (C.sub.4-C.sub.20)-alkenynyl
radical, where the alkenyl, cycloalkenyl, alkynyl, and alkenynyl
radicals contain one or more multiple bonds;
(C.sub.6-C.sub.16)-carbocyclic aryl radical,
(C.sub.7-C.sub.16)-carbocyclic aralkyl radical, heteroaryl radical,
or heteroaralkyl radical, wherein a heteroaryl radical or
heteroaryl moiety of a heteroaralkyl radical contains 5 or 6 ring
atoms; and wherein radicals defined for G are substituted by one or
more hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.5-C.sub.8)-cycloalkenyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.16)-aralkyl, (C.sub.2-C.sub.12)-alkenyl,
(C.sub.2-C.sub.12)-alkynyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.1-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl, --O--[CH.sub.2].sub.x--C.sub.f
H.sub.(2f+1-g)--F.sub.g, --OCF.sub.2Cl, --OCF.sub.2--CHFCl,
(C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.12)-alkenylcarbonyl,
(C.sub.2-C.sub.12)-alkynylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.1-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl, acyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy, (C.sub.7-C.sub.16)
aralkyloxycarbonyloxy, (C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-carbarmoyl,
N--(C.sub.1-C.sub.16)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.2)-aryloxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.2-C.sub.12)-alkenylamino,
(C.sub.2-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino, (C.sub.6-C.sub.12)
arylcarbonylamino, (C.sub.7-C.sub.16)-aralkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkylcarbonylamino(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl, N--(C.sub.1-C.sub.10)
alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)cycloalkylalmino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl, sulfamoyl,
N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-alkylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, or
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
wherein radicals which are aryl or contain an aryl moiety, may be
substituted on the aryl by one to five identical or different
hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-carbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl, (C.sub.7-C.sub.16)
aralkylcarbonyl, (C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.7)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.2-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy
N--((C.sub.1-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.1)-alkylamino, (C.sub.3-C.sub.8)-cycloalkylamino,
(C.sub.3-C.sub.12)-alkenylamino, (C.sub.3-C.sub.12)-alkynylamino,
N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.1-C.sub.10)-aralkylamino, N-alkylaralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino,
(C.sub.6-C.sub.12)-arylcarbonylamino,
(C.sub.7-C.sub.16)-alkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.10-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl;
X is O or S;
[0035] Q is O, S, NR', or a bond; where, if Q is a bond, R.sup.4 is
halogen, nitrile, or trifluoromethyl; or where, if Q is O, S, or
NR', R.sup.4 is hydrogen, (C.sub.1-C.sub.10)-alkyl radical,
(C.sub.2-C.sub.10)-alkenyl radical, (C.sub.2-C.sub.10)-alkynyl
radical, wherein alkenyl or alkynyl radical contains one or two
C--C multiple bonds; unsubstituted fluoroalkyl radical of the
formula --[CH.sub.2].sub.x, --C.sub.1H.sub.(2f+1-g)--F,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alkyl radical,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.4)-alkyl
radical, aryl radical, heteroaryl radical,
(C.sub.7-C.sub.11)-aralkyl radical, or a radical of the formula
Z
--[CH.sub.2].sub.v--[O].sub.w--[CH.sub.2].sub.t-E (Z)
where E is a heteroaryl radical, a (C.sub.3-C.sub.8)-cycloalkyl
radical, or a phenyl radical of the formula F
##STR00002##
v is 0-6, w is 0 or 1, t is 0-3, and R.sup.7, R.sup.8, R.sup.9,
R.sup.10, and R.sup.11 are identical or different and are hydrogen,
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (C.sub.1-C.sub.6)alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)--F.sub.g,
--OCF.sub.2--Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-hydroxyalkyl,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.8)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl, or
(C.sub.7-C.sub.11)-aralkylcarbamoyl, optionally substituted by
fluorine, chlorine, bromine, trifluoromethyl,
(C.sub.1-C.sub.6)-alkoxy, N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, phenyl, benzyl, phenoxy,
benzyloxy, NR.sup.YR.sup.Z wherein R.sup.y and R.sup.z are
independently selected from hydrogen, (C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.10)-cycloalkyl, (C.sub.3-C.sub.12)-alkenyl,
(C.sub.3-C.sub.12)-alkynyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.7-C.sub.12)aralkoxy, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl, (C.sub.6-C.sub.12)
arylcarbonyl, (C.sub.7-C.sub.16)-aralkylcarbonyl; or further
wherein R.sup.y and R.sup.z together are --[CH.sub.2].sub.h, in
which a CH.sub.2 group can be replaced by O, S,
N--(C.sub.1-C.sub.4)-alkylcarbonylimino, or
N--(C.sub.1-C.sub.4)-alkoxycarbonylimino; phenylmercapto,
phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.8)-alkylsulfamoyl, or
N,N-di-(C.sub.1-C.sub.8)-alkylsulfamoyl; or alternatively R.sup.7
and R.sup.8, R.sup.8 and R.sup.9, R.sup.9 and R.sup.10, or R.sup.10
and R.sup.11, together are a chain selected from
--[CH.sub.2].sub.n-- or --CH.dbd.CH--CH.dbd.CH--, where a CH.sub.2
group of the chain is optionally replaced by O, S, SO, SO, or
NR.sup.Y; and n is 3, 4, or 5; and if E is a heteroaryl radical,
said radical can carry 1-3 substituents selected from those defined
for R.sup.7-R.sup.11, or if E is a cycloalkyl radical, the radical
can carry one substituent selected from those defined for
R.sup.7-R.sup.11; or where, if Q is NR', R.sup.4 is alternatively
R'', where R' and R'' are identical or different and are hydrogen,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkylcarbonyl, optionally substituted
(C.sub.7-C.sub.16)-aralkylcarbonyl, or optionally substituted
C.sub.6-C.sub.12)-arylcarbonyl; or R' and R'' together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, N-acylimino, or N--(C.sub.1-C.sub.10)-alkoxycarbonylimino, and h
is 3 to 7.
Y is N or CR.sup.3;
[0036] R.sup.1, R.sup.2 and R.sup.3 are identical or different and
are hydrogen, hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.1-C.sub.20)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.7)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub-
.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub-
.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.7-C.sub.16)-aralkenyl, (C.sub.7-C.sub.16)-aralkynyl,
(C.sub.2-C.sub.20)-alkenyl, (C.sub.2-C.sub.20)-alkynyl,
(C.sub.1-C.sub.20)-alkoxy, (C.sub.2-C.sub.20)-alkenyloxy,
(C.sub.2-C.sub.20)-alkynyloxy, retinyloxy,
(C.sub.1-C.sub.20)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alky-
l, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.16)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, (C.sub.2-C.sub.20)-alkenyloxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.2-C.sub.20)-alkynyloxy-(C.sub.1-C.sub.6)-alkyl,
retinyloxy-(C.sub.1-C.sub.6)-alkyl,
--O--[CH.sub.2].sub.xCfH.sub.(2f+1-g)F.sub.g, --OCF.sub.2Cl,
--OCF.sub.2--CHFCl, (C.sub.1-C.sub.20)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.20)-alkenylcarbonyl,
(C.sub.2-C.sub.20)-alkynylcarbonyl,
(C.sub.1-C.sub.20)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.20)-alkenyloxycarbonyl, retinyloxycarbonyl,
(C.sub.2-C.sub.20)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.1-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.su-
b.6)-alkyl)-carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.18)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl; CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.2)-arylimino, N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; a carbamoyl radical of the formula R
##STR00003##
in which R.sup.x and R.sup.v are each independently selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, (C.sub.3-C.sub.7)-cycloalkyl,
aryl, or the substituent of an .alpha.-carbon of an .alpha.-amino
acid, to which the L- and D-amino acids belong, is 1-5, T is OH, or
NR*R**, and R*, R** and R*** are identical or different and are
selected from hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (+)-dehydroabietyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, optionally substituted
(C.sub.6-C.sub.12)-aroyl; or R* and R** together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, SO, SO.sub.2, N-acylamino,
N--(C.sub.1-C.sub.10)-alkoxycarbonylimino,
N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxyamino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.20)-alkylmercapto, (C.sub.1-C.sub.20)-alkylsulfinyl,
(C.sub.1-C.sub.20)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl,
(C.sub.1-C.sub.12)-alkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylmercapto-(C.sub.1-C.sub.4)-alkyl,
(C.sub.6-C.sub.12)-arylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.6)-aralkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
sulfamoyl, N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)--aralkylsulfonamido, and
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkysulfonamido;
where an aryl radical may be substituted by 1 to 5 substituents
selected from hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.2-C.sub.16)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.-
1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.2-C.sub.16)-alkenyl, (C.sub.2-C.sub.12)-alkynyl,
(C.sub.1-C.sub.16)-alkoxy, (C.sub.1-C.sub.16)-alkenyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl-
, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, --O--[CH.sub.2].sub.xC.sub.fH.sub.(2f+1-g)F.sub.g,
--OCF.sub.2Cl, --OCF.sub.2--CHFCl,
(C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.su-
b.6)-alkyl)carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.16)-alkoxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by, O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.16)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10))-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamaoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.16)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl; or wherein R.sup.1 and R.sup.2,
or R.sup.2 and R.sup.3 form a chain [CH.sub.2].sub.o, which is
saturated or unsaturated by a C.dbd.C double bond, in which 1 or 2
CH.sub.2 groups are optionally replaced by O, S, SO, SO.sub.2, or
NR', and R' is hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, or optionally substituted
(C6-C12)-aroyl; and o is 3, 4 or 5; or wherein the radicals R.sup.1
and R.sup.2, or R.sup.4 and R.sup.3, together with the pyridine or
pyridazine carrying them, form a 5,6,7,8-tetrahydroisoquinoline
ring, a 5,6,7,8-tetrahydroquinoline ring, or a
5,6,7,8-tetrahydrocinnoline ring; or wherein R.sup.1 and R.sup.2,
or R.sup.2 and R.sup.3 form a carbocyclic or heterocyclic 5- or
6-membered aromatic ring; or where R.sup.1 and R.sup.2, or R.sup.2
and R.sup.3, together with the pyridine or pyridazine carrying
them, form an optionally substituted heterocyclic ring systems
selected from thienopyridines, furanopyridines, pyridopyridines,
pyrimidinopyridines, imidazopyridines, thiazolopyridines,
oxazolopyridines, quinoline, isoquinoline, and cinnoline; where
quinoline, isoquinoline or cinnoline preferably satisfy the
formulae Ia, Ib and Ic:
##STR00004##
and the substituents R.sup.12 to R.sup.23 in each case
independently of each other have the meaning of R.sup.1, R.sup.2
and R.sup.3; or wherein the radicals R.sup.1 and R.sup.2, together
with the pyridine carrying them, form a compound of Formula Id:
##STR00005##
where V is S, O, or NR.sup.k, and R.sup.k is selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, aryl, or benzyl; where an aryl
radical may be optionally substituted by 1 to 5 substituents as
defined above; and R.sup.24, R.sup.25, R.sup.26, and R.sup.27 in
each case independently of each other have the meaning of R.sup.1,
R.sup.2 and R.sup.3; f is 1 to 8; g is 0 or 1 to (2f+1); x is 0 to
3; and h is 3 to 7; including the physiologically active salts and
prodrugs derived therefrom.
[0037] In some embodiments, compounds of Formula (I) as defined
above include, but are not limited to,
[(3-methoxy-pyridine-2-carbonyl)-amino]-acetic acid;
3-methoxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride;
3-methoxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide;
3-methoxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide;
3-methoxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide;
3-methoxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methy)-amide racemate;
3-methoxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide;
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide;
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide;
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide;
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide;
5-(((3-lauryloxy)-propyl)amino)-carbonyl)-3-methoxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide,
[(3-hydroxy-pyridine-2-carbonyl)-amino]-acetic acid; and
[(3-methoxy-pyridine-2-carbonyl)-amino]-acetic acid. In other
embodiments, compounds of Formula (Ia) as defined above include,
but are not limited to,
N-((3-Hydroxy-6-isopropoxy-quinoline-2-carbonyl)-amino)-acetic
acid, N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
[(3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl)-amino]-acetic
acid, N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
N-((7-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine, and
[(6-chloro-3-hydroxy-quinoline-2-carbonyl)-amino]-acetic acid. In
still other embodiments, the compounds of Formula (Ib) as defined
above include, but are not limited to,
N-((1-chloro-4-hydroxy-7-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycine-
,
N-((1-chloro-4-hydroxy-6-(2-propyloxy)isoquinolin-3-yl)-carbonyl)-glycin-
e, N-((1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid,
N-((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((7-butyloxy)-1-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((6-benzyloxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid,
((7-benzyloxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-ac-
etic acid methyl ester,
N-((7-benzyloxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid, N-((8-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((7-butoxy-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid.
[0038] In other embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (II)
##STR00006##
where R.sup.28 is hydrogen, nitro, amino, cyano, halogen,
(C.sub.1-C.sub.4)-alkyl, carboxy or a metabolically labile ester
derivative thereof; (C.sub.1-C.sub.4)-alkylamino,
di-(C.sub.1-C.sub.4)-alkylamino, (C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.2-C.sub.4)-alkanoyl, hydroxy-(C.sub.1-C.sub.4)-alkyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.4)-alkylthio, (C.sub.1-C.sub.4)-alkylsulfinyl,
(C.sub.1-C.sub.4)-alkylsulfonyl, phenylthio, phenylsulfinyl,
phenylsulfonyl, said phenyl or phenyl groups being optionally
substituted with 1 to 4 identical or different halogen,
(C.sub.1-C.sub.4)-alkyoxy, (C.sub.1-C.sub.4)-alkyl, cyano, hydroxy,
trifluoromethyl, fluoro-(C.sub.1-C.sub.4)-alkylthio,
fluoro-(C.sub.1-C.sub.4)-alkylsulfinyl,
fluoro-(C.sub.1-C.sub.4)-alkylsulfonyl,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxycarbonyl,
N,N-di-[(C.sub.1-C.sub.4)-alkyl]carbamoyl-(C.sub.1-C.sub.4)-alkoxycarbony-
l, (C.sub.1-C.sub.4)-alkylamino-(C.sub.2-C.sub.4)-alkoxycarbonyl,
di-(C.sub.1-C.sub.4)-alkylamino-(C.sub.2-C.sub.4)-alkoxycarbonyl,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkox-
ycarbonyl, (C.sub.2-C.sub.4)-alkanoyloxy-C.sub.1-C.sub.4)-alkyl, or
N--[amino-(C.sub.2-C.sub.8)-alkyl]-carbamoyl; R.sup.29 is hydrogen,
hydroxy, amino, cyano, halogen, (C.sub.1-C.sub.4)-alkyl, carboxy or
metabolically labile ester derivative thereof,
(C.sub.1-C.sub.4)-alkylamino, di-(C.sub.1-C.sub.4)-alkylamino,
(C.sub.1-C.sub.6)-alkoxycarbonyl, (C.sub.2-C.sub.4)-alkanoyl,
(C.sub.1-C.sub.4)-alkoxy, carboxy-(C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-alkoxycarbonyl-(C.sub.1-C.sub.4)-alkoxy,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl,
N--[amino-(C.sub.2-C.sub.8)-alkyl)-carbamoyl,
N--[(C.sub.1-C.sub.4)-alkylamino-(C.sub.1-C.sub.8)-alkyl]-carbamoyl,
N--[di-(C.sub.1-C.sub.4)-alkylamino-(C.sub.1-C.sub.8-alkyl)]-carbamoyl,
N-cyclohexylcarbamoyl, N--[cyclopentyl]-carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcyclohexylcarbamoyl,
N--(C.sub.1-C.sub.4)-alkylcyclopentylcarbamoyl, N-phenylcarbamoyl,
N--(C.sub.1-C.sub.4)-alkyl-N-phenylcarbamoyl,
N,N-diphenylcarbamoyl,
N--[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl,
N--(C.sub.1-C.sub.4)-alkyl-N--[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl,
or N,N-di-[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl, said phenyl
or phenyl groups being optionally substituted with 1 to 4 identical
or different halogen, (C.sub.1-C.sub.4)-alkyoxy,
(C.sub.1-C.sub.4)-alkyl, cyano, hydroxy, trifluoromethyl,
N--[(C.sub.2-C.sub.4)-alkanoyl]-carbamoyl,
N--[(C.sub.1-C.sub.4)-alkoxycarbonyl]-carbamoyl,
N--[fluoro-(C.sub.2-C.sub.6)-alkyl]-carbamoyl,
N,N-[fluoro-(C.sub.2-C.sub.6)-alkyl]-N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-[di-fluoro-(C.sub.2-C.sub.6)-alkyl]carbamoyl,
pyrrolidin-1-ylcarbonyl, piperidinocarbonyl,
piperazin-1-ylcarbonyl, morpholinocarbonyl, wherein the
heterocyclic group, is optionally substituted with 1 to 4,
(C.sub.1-C.sub.4)-alkyl, benzyl,
1,2,3,4-tetrahydro-isoquinolin-2-ylcarbonyl,
N,N-[di-(C.sub.1-C.sub.4)-alkyl]-thiocarbamoyl,
N--(C.sub.2-C.sub.4)-alkanoylamino, or
N--[(C.sub.1-C.sub.4)-alkoxycarbonyl]-amino; R.sup.30 is hydrogen,
(C.sub.1-C.sub.4)-alkyl, (C.sub.2-C.sub.4)-alkoxy, halo, nitro,
hydroxy, fluoro-(1-4C)alkyl, or pyridinyl; R.sup.31 is hydrogen,
(C.sub.1-C.sub.4)-alkyl, (C.sub.2-C.sub.4)-alkoxy, halo, nitro,
hydroxy, fluoro-(C.sub.1-C.sub.4)-alkyl, pyridinyl, or methoxy;
R.sup.32 is hydrogen, hydroxy, amino, (C.sub.1-C.sub.4)-alkylamino,
di-(C.sub.1-C.sub.4)-alkylamino, halo,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxy,
fluoro-(C.sub.1-C.sub.6)-alkoxy, pyrrolidin-1-yl, piperidino,
piperazin-1-yl, or morpholino, wherein the heterocyclic group is
optionally substituted with 1 to 4 identical or different
(C.sub.1-C.sub.4)-alkyl or benzyl; and R.sup.33 and R.sup.34 are
individually selected from hydrogen, (C.sub.1-C.sub.4)-alkyl, and
(C.sub.1-C.sub.4)-alkoxy; including pharmaceutically-acceptable
salts and pro-drugs derived therefrom.
[0039] In some embodiments, compounds of Formula (II) as defined
above include, but are not limited to,
4-oxo-1,4-dihydro-[1,10]phenanthroline-3-carboxylic acid,
3-carboxy-5-hydroxy-4-oxo-3,4-dihydro-1,10-phenanthroline,
3-carboxy-5-methoxy-4-oxo-3,4-dihydro-1,10-phenanthroline,
5-methoxy-4-oxo-1,4-dihydro-[1,10]phenanthroline-3-carboxylic acid
ethyl ester,
5-methoxy-4-oxo-1,4-dihydro-[1,10]phenanthroline-3-carboxylic acid,
and 3-carboxy-8-hydroxy-4-oxo-3,4-dihydro-1,10-phenanthroline.
[0040] The compounds can be administered singly or in combination
with various other therapeutic approaches. In one embodiment, the
compound is administered with another 2-oxoglutarate dioxygenase
inhibitor, wherein the two compounds have differential specificity
for individual 2-oxoglutarate dioxygenase family members. The two
compounds may be administered at the same time as a ratio of one
relative to the other or may be administered consecutively during a
treatment time course, e.g., following myocardial infarction. In
one specific embodiment, one compound specifically inhibits HIF
prolyl hydroxylase activity, and a second compound specifically
inhibits procollagen prolyl 4-hydroxylase activity. In another
embodiment, the compound is administered with another therapeutic
agent having a different mode of action, e.g., an ACE inhibitor
(ACEI), angiotensin-II receptor blocker (ARB), diuretic, and/or
digoxin. In yet another embodiment, the compound is administered
with carnitine.
[0041] In one aspect, a compound of the invention inhibits one or
more 2-oxoglutarate dioxygenase enzymes. In one embodiment, the
compound inhibits at least two 2-oxoglutarate dioxygenase family
members, e.g., HIF prolyl hydroxylase and procollagen prolyl
4-hydroxylase, with either the same specificity or with
differential specificity. In another embodiment, the compound is
specific for one 2-oxoglutarate dioxygenase, e.g., HIF prolyl
hydroxylase, and shows little to no specificity for other family
members.
[0042] Preferred embodiments of the invention comprise methods
using oral and transdermal delivery mechanisms. Thus, the present
invention also provides an oral formulation comprising a compound
of the invention. In another preferred embodiment, the present
methods involve transdermal administration of a compound of the
invention. Thus, the present invention also provides a transdermal
patch or pad comprising a compound of the invention.
[0043] These and other embodiments of the subject invention will
readily occur to those of skill in the art in light of the
disclosure herein, and all such embodiments are specifically
contemplated.
BRIEF DESCRIPTION OF THE DRAWINGS
[0044] FIGS. 1A and 1B show HIF-1.alpha. stabilization in cells
treated with compounds of the invention. FIG. 1A shows
stabilization and accumulation of HIF-1.alpha. in human foreskin
fibroblasts (HFF) treated with various compounds of the invention.
FIG. 1B shows a dose response for HIF-1.alpha. stabilization and
accumulation in different human cells treated with a compound of
the invention. Cell lines shown in the figure include HFF, human
microvascular endothelial cells (HMEC), venous endothelium (AG7),
human umbilical vein endotheial cells (HUVEC), squamous cell
carcinoma (SCC), human lung fibroblasts (HLF), mammary gland
epithelial adenocarcinoma (MCF7), transformed fetal kidney cells
(293A), and cervical adenocarcinoma cells (HeLa).
[0045] FIGS. 2A and 2B show HIF-1.alpha. stabilization and
accumulation in human cells treated with compounds of the
invention. FIG. 2A shows 293A and human hepatocarcinoma cells
(Hep3B) treated with various compounds of the invention. FIG. 2B
shows a dose response for HIF-1.alpha. stabilization in Hep3B cells
treated with exemplary compounds of the invention.
[0046] FIGS. 3A and 3B show oxygen consumption and cell viability
in human cells treated with compounds of the invention. FIG. 3A
shows single-dose and dose-response oxygen consumption in cells
treated with various compounds of the invention. FIG. 3B shows cell
proliferation and viability as measured by cleavage of WST-1
tetrazolium salt (Roche Diagnostics Corp., Indianapolis Ind.) in
cells treated with selected compounds from FIG. 3A.
[0047] FIGS. 4A and 4B show increased expression of HIF-responsive
genes in human cells treated with compounds of the invention. FIG.
4A shows levels of vascular endothelial growth factor (VEGF), a key
gene in blood vessel formation, in human cell culture media
following treatment with compounds of the invention. Cell lines
shown in the figure are 293A, Hep3B, and HFF. FIG. 4B shows a time
course for increase in aldolase, a key enzyme in the glycolytic
pathway, in cells treated with a compound of the invention.
[0048] FIGS. 5A and 5B show increase in expression of angiogenic
proteins in the lung of animals treated with a compound of the
invention. FIG. 5A shows a montage of angiogenic gene expression.
Genes represented in the figure include vascular endothelial growth
factor (VEGF)--C, Flt-1/VEGF receptor-1, adrenomedullin,
endothelin-1, plasminogen activator inhibitor (PAI)-1, and Cyr61.
FIG. 5B shows expression of genes encoding endothelin-1 and
adrenomedullin selected from FIG. 5A.
[0049] FIGS. 6A and 6B show increased expression of HIF-responsive
genes in vivo. FIG. 6A shows increased levels of transcript
encoding VEGF in liver and kidney of mice treated with compounds of
the invention. FIG. 6B shows levels of VEGF in mouse plasma at 2,
5, and 20 hours following final treatment with a compound of the
invention relative to an untreated control group.
[0050] FIGS. 7A and 7B show increase in expression of glycolytic
enzymes in the kidney of animals treated with a compound of the
invention. FIG. 7A shows a montage of glycolytic gene expression.
Genes represented in the figure include aldolase-A, enolase-1,
Glut1, Glut3, GAPDH, hexokinase-1 and -2, lactate dehydrogenase-A,
phosphofructokinase-L and -C, phosphoglycerate kinase-1, and
pyruvate kinase-M. FIG. 7B shows expression of genes encoding
aldolase-A and phosphofructokinase-L selected from FIG. 7A.
[0051] FIG. 8 shows percent survival in a group treated with a
compound of the invention (n=34) compared to an untreated group
(n=34) at time intervals following induced myocardial
infarction.
[0052] FIGS. 9A and 9B show improvement in cardiac architecture
following myocardial infarction in animals treated with a compound
of the invention relative to untreated controls. FIG. 9A shows
changes in the left ventricular end systolic diameter (LVESD) in a
group treated with a compound of the invention relative to an
untreated group at time intervals following induced myocardial
infarction. FIG. 9B shows changes in the left ventricular end
diastolic diameter (LVEDD) in a group treated with a compound of
the invention relative to an untreated group at time intervals
following induced myocardial infarction.
[0053] FIGS. 10A and 10B show improvement in cardiac performance
following myocardial infarction in animals treated with a compound
of the invention relative to untreated controls. FIG. 10A shows
changes in the left ventricular ejection fraction in a group
treated with a compound of the invention relative to an untreated
group at time intervals following induced myocardial infarction.
FIG. 10B shows changes in the fractional shortening in a group
treated with a compound of the invention relative to an untreated
group at time intervals following induced myocardial
infarction.
[0054] FIG. 11 shows the contractile response of the heart 4 weeks
post-MI in a group treated with a compound of the invention
relative to an untreated group with and without an isoproterenol
challenge.
[0055] FIGS. 12A and 12B show improvements to heart architecture
following myocardial infarction in animals pretreated with a
compound of the invention relative to untreated controls. FIG. 12A
shows statistically significant improvement (p<0.05) in
fractional shortening in treated animals relative to untreated
controls one week after induced myocardial infarction. FIG. 12B
shows statistically significant improvement in left ventricle
end-diastolic diameter (LVEDD; p<0.005) and left ventricular
end-systolic diameter (LVESD; p<0.001) in treated animals
relative to untreated controls one week after induced myocardial
infarction.
[0056] FIG. 13 shows increased survivability in animals subjected
to renal ischemic-reperfusion injury that have been pretreated and
consequently treated with compounds of the invention relative to
untreated and sham-operated controls.
[0057] FIGS. 14A and 14B show improvement in kidney function
following ischemic-reperfusion injury in animals pretreated with a
compound of the invention relative to untreated controls. FIG. 14A
shows lower blood urea nitrogen levels in treated animals relative
to untreated controls at 3 and 7 days after inducing
ischemia-reperfusion injury. FIG. 14B shows lower blood cholesterol
levels in treated animals relative to untreated controls at 3, 7,
and 14 days after inducing ischemia-reperfusion injury.
[0058] FIGS. 15A and 15B show improved healing of chronic wounds in
animals treated with a compound of the invention relative to
untreated controls. FIG. 15A shows increased epithelialization and
formation of granulation tissue in treated animals relative to
untreated controls 7 and 10 days after induction of wounds, FIG.
15B shows no difference in peak-peak distance within the scar in
treated animals relative to untreated controls.
DESCRIPTION OF THE INVENTION
[0059] Before the present compositions and methods are described,
it is to be understood that the invention is not limited to the
particular methodologies, protocols, cell lines, assays, and
reagents described, as these may vary. It is also to be understood
that the terminology used herein is intended to describe particular
embodiments of the present invention, and is in no way intended to
limit the scope of the present invention as set forth in the
appended claims.
[0060] It must be noted that as used herein and in the appended
claims, the singular forms "a," "an," and "the" include plural
references unless context clearly dictates otherwise. Thus, for
example, a reference to "a fragment" includes a plurality of such
fragments; a reference to an "antibody" is a reference to one or
more antibodies and to equivalents thereof known to those skilled
in the art, and so forth.
[0061] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods, devices, and materials are now
described. All publications cited herein are incorporated herein by
reference in their entirety for the purpose of describing and
disclosing the methodologies, reagents, and tools reported in the
publications that might be used in connection with the invention.
Nothing herein is to be construed as an admission that the
invention is not entitled to antedate such disclosure by virtue of
prior invention.
[0062] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of chemistry,
biochemistry, molecular biology, cell biology, genetics, immunology
and pharmacology, within the skill of the art. Such techniques are
explained fully in the literature. See, e.g., Gennaro, A. R., ed.
(1990) Remington's Pharmaceutical Sciences, 18.sup.th ed., Mack
Publishing Co.; Hardman, J. G., Limbird, L. E., and Gilman, A. G.,
eds. (2001) The Pharmacological Basis of Therapeutics, 10.sup.th
ed., McGraw-Hill Co.; Colowick, S. et al., eds., Methods In
Enzymology, Academic Press, Inc.; Weir, D. M., and Blackwell, C.
C., eds. (1986) Handbook of Experimental Immunology, Vols. I-IV,
Blackwell Scientific Publications; Maniatis, T. et al., eds. (1989)
Molecular Cloning: A Laboratory Manual, 2.sup.nd edition, Vols.
I-III, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al.,
eds. (1999) Short Protocols in Molecular Biology, 4.sup.th edition,
John Wiley & Sons; Ream et al., eds. (1998) Molecular Biology
Techniques: An Intensive Laboratory Course, Academic Press; Newton,
C. R., and Graham, A., eds. (1997) PCR (Introduction to
Biotechniques Series), 2.sup.nd ed., Springer Verlag.
DEFINITIONS
[0063] The term "ischemia" refers to a reduction in blood flow.
Ischemia is associated with a reduction in nutrients, including
oxygen, delivered to tissues. Ischemia may arise due to conditions
such as atherosclerosis, formation of a thrombus in an artery or
vein, or blockage of an artery or vein by an embolus, vascular
closure due to other causes, e.g., vascular spasm, etc. Such
conditions may reduce blood flow, producing a state of
hypoperfusion to an organ or tissue, or block blood flow
completely. Other conditions that can produce ischemia include
tissue damage due to trauma or injury, such as, e.g., spinal cord
injury; viral infection, which can lead to, e.g., congestive heart
failure, etc. The terms "ischemic conditions" and "ischemic
disorders" refer to acute ischemic conditions including, but not
limited to, myocardial infarction, ischemic stroke, pulmonary
embolism, perinatal hypoxia, circulatory shock including, e.g.,
hemorrhagic, septic, cardiogenic, etc., mountain sickness, acute
respiratory failure, etc., chronic ischemic conditions including
atherosclerosis, chronic venous insufficiency, chronic heart
failure, cardiac cirrhosis, diabetes, macular degeneration, sleep
apnea, Raynaud's disease, systemic sclerosis, nonbacterial
thrombotic endocarditis, occlusive artery disease, angina pectoris,
TIAs, chronic alcoholic liver disease, etc. Ischemic conditions may
also result when individuals are placed under general anesthesia,
and can cause tissue damage in organs prepared for transplant.
[0064] The terms "hypoxia" and "hypoxic" refer to an environment
with levels of oxygen below normal. Hypoxia may be induced in cells
by culturing the cells in a reduced oxygen environment, or cells
may be treated with compounds that mimic hypoxia. Determining
oxygen levels that define hypoxia in cell culture is well within
the skill in the art.
[0065] The terms "hypoxic conditions" and "hypoxic disorders"
include, but are not limited to, ischemic disorders (ischemic
hypoxia) such as those listed above, wherein hypoxia results from
reduced circulation; pulmonary disorders (hypoxic hypoxia) such as
COPD, severe pneumonia, pulmonary edema, pulmonary hypertension,
hyaline membrane disease, and the like, wherein hypoxia results
from reduced oxygenation of the blood in the lungs; anemic
disorders (anemic hypoxia) such as gastric or duodenal ulcers,
liver or renal disease, thrombocytopenia or blood coagulation
disorders, cancer or other chronic illness, cancer chemotherapy and
other therapeutic interventions that produce anemia, and the like,
wherein hypoxia results from a decreased concentration of
hemoglobin or red blood cells; and altitude sickness, etc.
[0066] The terms "disorders" and "diseases" are used inclusively
and refer to any condition deviating from normal. The terms
"ischemic conditions" and "ischemic disorders" refer to any
condition, disease, or disorder that is associated with ischemia.
The terms "hypoxic conditions" and "hypoxic disorders" refer to any
condition, disease, or disorder that is associated with hypoxia.
Such ischemic and hypoxic disorders include, but are not limited
to, those disorders described above.
[0067] The term "HIF.alpha." refers to the alpha subunit of hypoxia
inducible factor protein. HIF.alpha. may be any human or other
mammalian protein, or fragment thereof, including, but not limited
to, human HIF-1.alpha. (Genbank Accession No. Q16665), HIF-2.alpha.
(Genbank Accession No. AAB41495), and HIF-3.alpha. (Genbank
Accession No. AAD22668); murine HIF-1.alpha. (Genbank Accession No.
Q61221), HIF-2.alpha. (Genbank Accession No. BAA20130 and
AAB41496), and HIF-3.alpha. (Genbank Accession No. AAC72734); rat
HIF-1.alpha. (Genbank Accession No. CAA70701), HIF-2.alpha.
(Genbank Accession No. CAB96612), and HIF-3.alpha. (Genbank
Accession No. CAB96611); and cow HIF-1.alpha. (Genbank Accession
No. BAA78675). HIF.alpha. may also be any non-mammalian protein or
fragment thereof, including Xenopus Iaevis HIF-1.alpha. (Genbank
Accession No. CAB96628), Drosophila melanogaster HIF-1.alpha.
(Genbank Accession No. JC4851), and chicken HIF-1.alpha. (Genbank
Accession No. BAA34234). HIF.alpha. gene sequences may also be
obtained by routine cloning techniques, for example, by using all
or part of a HIF.alpha. gene sequence described above as a probe to
recover and determine the sequence of a HIF.alpha. gene in another
species.
[0068] Fragments of HIF.alpha. include the regions defined by human
HIF-1.alpha. from amino acid 401 to 603 (Huang et al., supra),
amino acid 531 to 575 (Jiang et al. (1997) J Biol Chem
272:19253-19260), amino acid 556 to 575 (Tanimoto et al., supra),
amino acid 557 to 571 (Srinivas et alt (1999) Biochem Biophys Res
Commun 260:557-561), and amino acid 556 to 575 (Ivan and Kaelin
(2001) Science 292:464-468). Further, a fragment of HIF.alpha.
includes any fragment containing at least one occurrence of the
motif LXXLAP, e.g., as occurs in the HIF-1.alpha. native sequence
at L.sub.397TLLAP and L.sub.559EMLAP. Additionally, a fragment of
HIF.alpha. includes any fragment retaining at least one functional
or structural characteristic of HIF.alpha.. For example, a HIF
peptide for use in the screening assay of Example 7 may comprise
[methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO:5).
[0069] The terms "HIF prolyl hydroxylase" and "HIF PH" refer to any
enzyme capable of hydroxylating a proline residue in the HIF
protein. Preferably, the proline residue hydroxylated by HIF PH
includes the proline found within the motif LXXLAP, e.g., as occurs
in the human HIF-1.alpha. native sequence at L.sub.397TLLAP and
L.sub.559EMLAP. HIF PH includes members of the Egl-Nine (EGLN) gene
family described by Taylor (2001, Gene 275:125-132), and
characterized by Aravind and Koonin (2001, Genome Biol
2:RESEARCH0007), Epstein et al. (2001, Cell 107:43-54), and Bruick
and McKnight (2001, Science 294:1337-1340). Examples of HIF PH
enzymes include human SM-20 (EGLN1) (GenBank Accession No.
AAG33965; Dupuy et al. (2000) Genomics 69:348-54), EGLN2 isoform 1
(GenBank Accession No. CAC42510; Taylor, supra), EGLN2 isoform 2
(GenBank Accession No. NP.sub.--060025), and EGLN3 (GenBank
Accession No. CAC42511; Taylor, supra); mouse EGLN1 (GenBank
Accession No. CAC42515), EGLN2 (GenBank Accession No. CAC42511),
and EGLN3 (SM-20) (GenBank Accession No. CAC42517); and rat SM-20
(GenBank Accession No. AAA19321). Additionally, HIF PH may include
Caenorhabditis elegans EGL-9 (GenBank Accession No. AAD56365) and
Drosophila melanogaster CG1114 gene product (GenBank Accession No.
AAFS2050). HIP PH also includes any fragment retaining at least one
stuctural or function feature of the foregoing full-length
proteins, including a fragment having hydroxylase activity.
[0070] The terms "amino acid sequence" or "polypeptide" as used
herein, e.g., to refer to HIF.alpha. and fragments thereof, or HIF
PH and fragments thereof, contemplate an oligopeptide, peptide, or
protein sequence, or to a fragment of any of these, and to
naturally occurring or synthetic molecules. "Fragments" can refer
to any portion of a sequence that retains at least one structural
or functional characteristic of the protein. Immunogenic fragments
or antigenic fragments are fragments of polypeptides, preferably,
fragments of about five to fifteen amino acids in length, that
retain at least one biological or immunological activity. Where
"amino acid sequence" is used to refer to the polypeptide sequence
of a naturally occurring protein molecule, "amino acid sequence"
and like terms are not meant to limit the amino acid sequence to
the complete native sequence associated with the recited protein
molecule.
[0071] The term "related proteins" as used herein, for example, to
refer to proteins related to HIF.alpha. prolyl hydroxylase,
encompasses other 2-oxoglutarate dioxygenase enzymes, especially
those family members that similarly require Fe.sup.2+,
2-oxoglutarate, and oxygen to maintain hydroxylase activity. Such
enzymes include, but are not limited to, e.g., procollagen lysyl
hydroxylase, procollagen prolyl 4-hydroxylase, and Factor
Inhibiting HIF (FIH), an asparaginyl hydroxylase responsible for
regulating transactivation of HIF.alpha.. (GenBank Accession No.
AAL27308; Mahon et al. (2001) Genes Dev 15:2675-2686; Lando et al.
(2002) Science 295:858-861; and Lando et al. (2002) Genes Dev
16:1466-1471. See, also, Elkins et al. (2002) 1 Biol Chem
C200644200.)
[0072] The term "agonist" refers to a molecule that increases or
prolongs the duration of the effect of a particular molecule, e.g.,
an enzyme or protein, or a particular environment, e.g. hypoxia.
Agonists may include proteins, nucleic acids, carbohydrates, or any
other molecules that modulate the effects of the target
molecule.
[0073] The term "antagonist" refers to a molecule which decreases
the extent or duration of the effect of the biological or
immunological activity of a particular molecule. Antagonists may
include proteins, nucleic acids, carbohydrates, antibodies, or any
other molecules that decrease the effect of the target
molecule.
[0074] The term "microarray" refers to any arrangement of nucleic
acids, amino acids, antibodies, etc., on a substrate. The substrate
can be any suitable support, e.g., beads, glass, paper,
nitrocellulose, nylon, or any appropriate membrane, etc. A
substrate can be any rigid or semi-rigid support including, but not
limited to, membranes, filters, wafers, chips, slides, fibers,
beads, including magnetic or nonmagnetic beads, gels, tubing,
plates, polymers, microparticles, capillaries, etc. The substrate
can provide a surface for coating and/or can have a variety of
surface forms, such as wells, pins, trenches, channels, and pores,
to which the nucleic acids, amino acids, etc., may be bound.
[0075] The term "excipient" as used herein means an inert or
inactive substance used in the production of pharmaceutical
products or other tablets, including without limitation any
substance used as a binder, disintegrant, coating,
compression/encapsulation aid, cream or lotion, lubricant,
parenteral, sweetener or flavoring, suspending/gelling agent, or
wet granulation agent. Binders include, e.g., carbopol, povidone,
xanthan gum, etc.; coatings include, e.g., cellulose acetate
phthalate, ethylcellulose, gellan gum, maltodextrin, etc.;
compression/encapsulation aids include, e.g., calcium carbonate,
dextrose, fructose dc, honey dc, lactose (anhydrate or monohydrate;
optionally in combination with aspartame, cellulose, or
microcrystalline cellulose), starch dc, sucrose, etc.;
disintegrants include, e.g., croscarmellose sodium, gellan gum,
sodium starch glycolate, etc.; creams and lotions include, e.g.,
maltodextrin, carrageenans, etc.; lubricants include, e.g.,
magnesium stearate, stearic acid, sodium stearyl fumarate, etc.;
materials for chewable tablets include, e.g., dextrose, fructose
dc, lactose (monohydrate, optionally in combination with aspartame
or cellulose), etc.; parenterals include, e.g., mannitol, povidone,
etc.; plasticizers include, e.g., dibutyl sebacate,
polyvinylacetate phthalate, etc.; suspending/gelling agents
include, e.g., carrageenan, sodium starch glycolate, xanthan gum,
etc.; sweeteners include, e.g., aspartame, dextrose, fructose de,
sorbitol, sucrose de, etc.; and wet granulation agents include,
e.g., calcium carbonate, maltodextrin, microcrystalline cellulose,
etc.
[0076] The term "sample" is used herein in its broadest sense.
Samples may be derived from any source, for example, from bodily
fluids, secretions, tissues, cells, or cells in culture including,
but not limited to, saliva, blood, urine, serum, plasma, vitreous,
synovial fluid, cerebral spinal fluid, amniotic fluid, and organ
tissue (e.g., biopsied tissue); from chromosomes, organelles, or
other membranes isolated from a cell; from genomic DNA, cDNA, RNA,
mRNA, etc.; and from cleared cells or tissues, or blots or imprints
from such cells or tissues. Samples may be derived from any source,
such as, for example, a human subject, or a non-human mammalian
subject, etc. Also contemplated are samples derived from any animal
model of disease. A sample can be in solution or can be, for
example, fixed or bound to a substrate. A sample can refer to any
material suitable for testing for the presence of HIF.alpha. or of
fragments of HIF.alpha. or suitable for screening for molecules
that bind to HIF.alpha. or to fragments thereof. Methods for
obtaining such samples are within the level of skill in the
art.
[0077] The term "subject" is used herein in its broadest sense.
Subjects may include isolated cells, either prokaryotic or
eukaryotic, or tissues grown in culture. Preferably, subjects
include animals, particularly a mammalian species including rat,
rabbit, bovine, ovine, porcine, murine, equine, and primate,
particularly human.
INVENTION
[0078] The present invention provides methods of stabilizing
HIF.alpha., to compounds that can be used in the methods, and to
the use of the methods to prevent or treat disorders associated
with HIF including, but not limited to, hypoxic and/or ischemic
disorders such as those described above. The present invention
further relates to the discovery that stabilization of the alpha
subunit of hypoxia inducible factor (HIF.alpha.) is an effective
therapeutic approach with unexpected benefits when applied to
treatment or prevention of conditions associated with hypoxia
and/or ischemia, e.g., myocardial infarction, stroke, occlusive
arterial disease, angina pectoris, cardiac cirrhosis,
atherosclerosis, etc.
[0079] The present invention contemplates methods of stabilizing
HIF to augment angiogenesis, the response to acute hypoxia, and
adaptation to chronic hypoxia. As tissue ischemia is a major cause
of morbidity and mortality, the identification of methods that
stabilize HIF.alpha. is beneficial in the treatment of hypoxic
conditions. Further, the methods can be used to produce the
beneficial effects of, e.g., a preconditioning hypoxic response, by
stabilizing HIF.alpha. in a normoxic environment prior to an
ischemic or hypoxic event. The methods can also be used to induce
HIF.alpha.-specific effects, as described below, including
therapeutic angiogenesis to restore blood flow to damaged tissues;
neuroprotection to prevent, e.g., apoptotic loss of neurons
associated with neurodegenerative diseases; and protection against
oxidative damage produced by reactive oxygen species resulting
from, e.g., reperfusion following an ischemic or hypoxic event.
[0080] When the methods of the invention are used to treat a
disorder associated with ischemia and/or hypoxia, the disorder may
be an acute ischemic disorder such as pulmonary, intestinal,
cerebral, and/or myocardial infarction, or a chronic ischemic
condition such as occlusive arterial disease, liver cirrhosis,
congestive heart failure, etc. Further, the methods of the
invention can be used to treat ischemia due to a transient or acute
trauma, insult, or injury such as, e.g., a spinal cord injury, or
to treat a patient diagnosed with, e.g., a pulmonary disorder such
as pulmonary embolism and the like.
[0081] When the methods of the invention are used to prevent tissue
damage caused by HIF-associated disorders including, but not
limited to, ischemic and hypoxic disorders, treatment may be
predicated on predisposing conditions, e.g., hypertension,
diabetes, occlusive arterial disease, chronic venous insufficiency,
Raynaud's disease, systemic sclerosis, cirrhosis, congestive heart
failure, etc. Similarly, the methods of the invention can be used
as a pretreatment to decrease or prevent the tissue damage caused
by HIF-associated disorders including, but not limited to, ischemic
and hypoxic disorders. The need for pretreatment may be based on a
patient's history of recurring episodes of an ischemic condition,
e.g., myocardial infarction or transient ischemic attacks; based on
symptoms of impending ischemia, e.g., angina pectoris; or based on
physical parameters implicating possible or likely ischemia or
hypoxia, such as is the case with, e.g., individuals placed under
general anesthesia or temporarily working at high altitudes. The
methods may also be used in the context of organ transplants to
pretreat organ donors and to maintain organs removed from the body
prior to implantation in a recipient.
[0082] Presented herein is the discovery that stabilization of
HIF.alpha. is modulated by proline hydroxylation and that
HIF.alpha. stabilization is effective for treating or preventing
the development or persistence of ischemic conditions such as DVT,
angina pectoris, pulmonary embolism, stroke, myocardial infarction,
etc. Specifically, it has been shown that HIF-1.alpha. and a
HIF-1.alpha. peptide corresponding to residues 556 to 575
[HIF(556-575)] preincubated with rabbit reticulocyte lysate (RRL)
bind specifically to the von Hippel Lindau protein (pVHL), and that
such binding leads to the ubiquitination and degradation of
HIF-1.alpha.. It has also been shown that mutation of the highly
conserved colinear sequence Ms.sub.561LAPYIPM within HIF(556-575)
to eight consecutive alanines stabilized HIF(556-575) under
normoxic conditions. (Srinivas et al., supra.) An alanine scan of
the region showed that mutation of P.sub.564 to alanine in the
context of full-length HIF-1.alpha. or a glutathione S-transferase
(GST)-HIF.alpha. oxygen degradation domain (ODD) fusion protein
(Gal-4-ODD) abrogated pVHL-binding activity. The modification of
P.sub.564 was identified as an hydroxylation by electrospray ion
trap tandem mass spectrometry (MS/MS), and by thin layer
chromatography of Gal-4-HIF(555-575) that was in vitro translated
using RRL in the presence of [.sup.3H]proline. The functional
significance of the proline hydroxylation was demonstrated by
showing that P.sub.564-hydroxylated HIF.alpha. bound pVHL, while
HIF-1.alpha. mutant containing a single point mutation of P.sub.564
to alanine was stable in COS7 cells and was insensitive to the
hypoxia mimetic desferrioxamine. (See Ivan and Kaelin, supra;
Jaakkola et al. (2001) Science 292:468-472.)
[0083] As HIF.alpha. is modified by proline hydroxylation, a
reaction requiring oxygen and Fe.sup.2+, the present invention
contemplates in one aspect that the enzyme responsible for
HIF.alpha. hydroxylation is a member of the 2-oxoglutarate
dioxygenase family. Such enzymes include, but are not limited to,
procollagen lysyl hydroxylase, procollagen prolyl 3-hydroxylase,
procollagen prolyl 4-hydroxylase .alpha.(1) and .alpha.(II),
thymine 7-hydroxylase, aspartyl (asparaginyl) .beta.-hydroxylase,
.epsilon.-N-trimethyllysine hydroxylase, and .gamma.-butyrobetaine
hydroxylase, etc. These enzymes require oxygen, Fe.sup.2+,
2-oxoglutarate, and ascorbic acid for their hydroxylase activity.
(See, e.g., Majamaa et al. (1985) Biochem J 229:127-133; Myllyharju
and Kivirikko (1997) EMBO J 16:1173-1180; Thornburg et al. (1993)
32:14023-14033; and Jia et al. (1994) Proc Natl Acad Sci USA
91:7227-7231.)
[0084] Several small molecule inhibitors of prolyl 4-hydroxylase
have been identified. (See, e.g., Majamaa et al., supra; Kivirikko
and Myllyharju (1998) Matrix Biol 16:357-368; Bickel et al. (1998)
Hepatology 28:404-411; Friedman et al. (2000) Proc Natl Acad Sci
USA 97:4736-4741; and Franklin et al. (2001) Biochem J 353:333-338;
all incorporated by reference herein in their entirety.) The
present invention contemplates the use of these compounds in the
methods provided herein.
[0085] Compounds that can be used in the methods of the invention
include, for example, structural mimetics of 2-oxoglutarate. Such
compounds may inhibit the target 2-oxoglutarate dioxygenase enzyme
family member competitively with respect to 2-oxoglutarate and
noncompetitively with respect to iron. (Majamaa et al. (1984) Eur J
Biochem 138:239-245; and Majamaa et al., supra.)
[0086] In certain embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (I)
##STR00007##
wherein A is 1,2-arylidene, 1,3-arylidene, 1,4-arylidene; or
(C.sub.1-C.sub.4)-alkylene, optionally substituted by one or two
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-hydroxyalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)Hal.sub.g,
(C.sub.1-C.sub.6) fluoroalkoxy, (C.sub.1-C.sub.8)-fluoroalkoxy,
(C.sub.1-C.sub.8)-fluoroalkenyloxy,
(C.sub.1-C.sub.8)-fluoroalkynyloxy, --OCF.sub.2Cl,
--O--CF.sub.2--CHFCl; (C.sub.1-C.sub.6)-alkylmercapto,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.6)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
phenyl, benzyl, phenoxy, benzyloxy, anilino, N-methylanilino,
phenylmercapto, phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or by a substituted
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.11)-aralkyloxy,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl radical, which
carries in the aryl moiety one to five identical or different
substituents selected from halogen, cyano, nitro, trifluoromethyl,
(C.sub.1-C.sub.6)-alkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)Hal.sub.g,
--OCF.sub.2Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-alkylsulfinyl,
(C.sub.1-C.sub.6)-alkylsulfonyl, (C.sub.1-C.sub.6)-alkylcarbonyl,
(C.sub.1-C.sub.6)-alkoxycarbonyl, carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, (C.sub.3-C.sub.8)-cycloalkyl,
sulfamoyl, N--(C.sub.1-C.sub.4)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.4)-alkylsulfamoyl; or wherein A is
--CR.sup.5R.sup.6 and R.sup.5 and R.sup.6 are each independently
selected from hydrogen, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.7)-cycloalkyl, aryl, or a substituent of the
.alpha.-carbon atom of an .alpha.-amino acid, wherein the amino
acid is a natural L-amino acid or its D-isomer: B is --CO.sub.2H,
--NH.sub.2, --NHSO.sub.2CF.sub.3, tetrazolyl, imidazolyl,
3-hydroxyisoxazolyl, --CONHCOR''', --CONHSOR''', CONHSO.sub.2R''',
where R''' is aryl, heteroaryl, (C.sub.3-C.sub.7)-cycloalkyl, or
(C.sub.1-C.sub.4)-alkyl, optionally monosubstituted by
(C.sub.6-C.sub.12)-aryl, heteroaryl, OH, SH,
(C.sub.1-C.sub.4)-alkyl, (C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-thioalkyl, (C.sub.1-C.sub.4)-sulfinyl,
(C.sub.1-C.sub.4)-sulfonyl, CF.sub.3, Cl, Br, F, I, NO2, --COOH,
(C.sub.2-C.sub.5)-alkoxycarbonyl, NH.sub.2,
mono-(C.sub.1-C.sub.4-alkyl)-amino,
di-(C.sub.1-C.sub.4-alkyl)-amino, or
(C.sub.1-C.sub.4)-perfluoroalkyl; or wherein B is a CO.sub.2-G
carboxyl radical, where G is a radical of an alcohol G-OH in which
G is selected from (C.sub.1-C.sub.20)-alkyl radical,
(C.sub.3-C.sub.8) cycloalkyl radical, (C.sub.2-C.sub.20)-alkenyl
radical, (C.sub.3-C.sub.8)-cycloalkenyl radical, retinyl radical,
(C.sub.2-C.sub.20)-alkynyl radical, (C.sub.4-C.sub.20)-alkenynyl
radical, where the alkenyl, cycloalkenyl, alkynyl, and alkenynyl
radicals contain one or more multiple bonds;
(C.sub.6-C.sub.16)-carbocyclic aryl radical,
(C.sub.7-C.sub.16)-carbocyclic aralkyl radical, heteroaryl radical,
or heteroaralkyl radical, wherein a heteroaryl radical or
heteroaryl moiety of a heteroaralkyl radical contains 5 or 6 ring
atoms; and wherein radicals defined for G are substituted by one or
more hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.5-C.sub.8)-cycloalkenyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.16)-aralkyl, (C.sub.2-C.sub.12)-alkenyl,
(C.sub.2-C.sub.12)-alkynyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)--F.sub.g,
--OCF.sub.2Cl, --OCF.sub.2--CHFCl,
(C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.12)-alkenylcarbonyl,
(C.sub.2-C.sub.1)-alkynylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl, acyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy, (C.sub.7-C.sub.16)
aralkyloxycarbonyloxy, (C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-carbamoyl,
N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.2-C.sub.12)-alkenylamino,
(C.sub.2-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino,
(C.sub.6-C.sub.12)arylcarbonylamino,
(C.sub.7-C.sub.16)-aralkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N-(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkylcarbonylamino(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl, N--(C.sub.1-C.sub.10)
alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl, sulfamoyl,
N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-alkylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.10-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, or
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
wherein radicals which are aryl or contain an aryl moiety, may be
substituted on the aryl by one to five identical or different
hydroxyl, halogen, cyano, trifluoromethyl, nitro, carboxyl,
(C.sub.1-C.sub.12)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.6-C.sub.12)aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)alkoxy-(C.sub.1-C.sub.12)alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1C.sub.12)alkoxy,
(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.1-C.sub.8)-hydroxyalkyl, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-carbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl, (C.sub.7-C.sub.16)
aralkylcarbonyl, (C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.10-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, carbamoyloxy,
N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arycarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkylaralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino,
(C.sub.6-C.sub.12)-arylcarbonylamino,
(C.sub.7-C.sub.16)-alkylcarbonylamino,
(C.sub.1-C.sub.12)-alkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-arylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkylcarbonyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-arylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkylcarbonylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfonyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl;
X is O or S;
[0087] Q is O, S, NR', or a bond; where, if Q is a bond, R.sup.4 is
halogen, nitrile, or trifluoromethyl; or where, if Q is O, S, or
NR', R.sup.4 is hydrogen, (C.sub.1-C.sub.10)-alkyl radical,
(C.sub.2-C.sub.10)-alkenyl radical, (C.sub.2-C.sub.10)-alkynyl
radical, wherein alkenyl or alkynyl radical contains one or two
C--C multiple bonds; unsubstituted fluoroalkyl radical of the
formula --[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)--F,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alkyl radical,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.4)-alkyl
radical, aryl radical, heteroaryl radical,
(C.sub.7-C.sub.11)-aralkyl radical, or a radical of the formula
Z
-[CH.sub.2].sub.v-[O].sub.w--[CH.sub.2].sub.t-E (Z)
where E is a heteroaryl radical, a (C.sub.3-C.sub.8)-cycloalkyl
radical, or a phenyl radical of the formula F
##STR00008##
v is 0-6, w is 0 or 1, t is 0-3, and R.sup.7, R.sup.8, R.sup.9,
R.sup.10, and R.sup.11 are identical or different and are hydrogen,
halogen, cyano, nitro, trifluoromethyl, (C.sub.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (C.sub.1-C.sub.6)-alkoxy,
--O--[CH.sub.2].sub.x--C.sub.fH.sub.(2f+1-g)--F.sub.g,
--OCF.sub.2--Cl, --O--CF.sub.2--CHFCl,
(C.sub.1-C.sub.6)-alkylmercapto, (C.sub.1-C.sub.6)-hydroxyalkyl,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.6)-alkoxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.6)-alkylsulfinyl, (C.sub.1-C.sub.6)-alkylsulfonyl,
(C.sub.1-C.sub.6)-alkylcarbonyl, (C.sub.1-C.sub.8)-alkoxycarbonyl,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl, or
(C.sub.7-C.sub.11)-aralkycarbamoyl, optionally substituted by
fluorine, chlorine, bromine, trifluoromethyl,
(C.sub.1-C.sub.6)-alkoxy, N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.6)-alkylcarbonyloxy, phenyl, benzyl, phenoxy,
benzyloxy, NR.sup.YR.sup.Z wherein R.sup.y and R.sup.z are
independently selected from hydrogen, (C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.10)-cycloalkyl, (C.sub.3-C.sub.12)-alkenyl,
(C.sub.3-C.sub.12)-alkynyl, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.12)-alkoxy,
(C.sub.7-C.sub.12)aralkoxy, (C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl, (C.sub.6-C.sub.12)
arylcarbonyl, (C.sub.7-C.sub.16)-aralkylcarbonyl; or further
wherein R.sup.y and R.sup.z together are --[CH2].sub.h, in which a
CH.sub.2 group can be replaced by O, S,
N--(C.sub.1-C.sub.4)-alkylcarbonylimino, or
N--(C.sub.1-C.sub.4)-alkoxycarbonylimino; phenylmercapto,
phenylsulfonyl, phenylsulfinyl, sulfamoyl,
N--(C.sub.1-C.sub.8)-alkylsulfamoyl, or
N,N-di-(C.sub.1-C.sub.8)-alkylsulfamoyl; or alternatively R.sup.7
and R.sup.8, R.sup.8 and R.sup.9, R.sup.9 and R.sup.10, or R.sup.10
and R.sup.11, together are a chain selected from
--[CH.sub.2].sub.n- or --CH.dbd.CH--CH.dbd.CH--, where a CH.sub.2
group of the chain is optionally replaced by O, S, SO, SO.sub.2, or
NR.sup.Y; and n is 3, 4, or 5; and if E is a heteroaryl radical,
said radical can carry 1-3 substituents selected from those defined
for R.sup.7-R.sup.11, or if E is a cycloalkyl radical, the radical
can carry one substituent selected from those defined for
R.sup.7-R.sup.11; or where, if Q is NR', R.sup.4 is alternatively
R'', where R' and R'' are identical or different and are hydrogen,
(C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.11)-aralkyl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkylcarbonyl, optionally substituted
(C.sub.7-C.sub.16)-aralkylcarbonyl or optionally substituted
C.sub.6-C.sub.12)-arylcarbonyl; or R' and R'' together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, N-acylimino, or N--(C.sub.1-C.sub.10)-alkoxycarbonylimino, and h
is 3 to 7.
Y is N or CR.sup.3;
[0088] R.sup.1, R.sup.2 and R.sup.3 are identical or different and
are hydrogen, hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.1-C.sub.20)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub-
.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub-
.1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.7-C.sub.16)-aralkenyl, (C.sub.7-C.sub.16)-aralkynyl,
(C.sub.2-C.sub.20)-alkenyl, (C.sub.2-C.sub.20)-alkynyl,
(C.sub.1-C.sub.20)-alkoxy, (C.sub.2-C.sub.20)-alkenyloxy,
(C.sub.2-C.sub.20)-alkynyloxy, retinyloxy,
(C.sub.1-C.sub.20)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alky-
l-(C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.16)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, (C.sub.2-C.sub.20)-alkenyloxy-(C.sub.1-C.sub.6)-alkyl,
(C.sub.2-C.sub.20)-alkynyloxy-(C.sub.1-C.sub.6)-alkyl,
retinyloxy-(C.sub.1-C.sub.6)-alkyl,
--O--[CH.sub.2].sub.xCfH.sub.(2f+1-g)F.sub.g, --OCF.sub.2Cl,
--OCF.sub.2--CHFCl, (C.sub.1-C.sub.20)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl, cinnamoyl,
(C.sub.2-C.sub.20)-alkenylcarbonyl,
(C.sub.2-C.sub.20)-alkynylcarbonyl,
(C.sub.1-C.sub.20)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.20)-alkenyloxycarbonyl, retinyloxycarbonyl,
(C.sub.2-C.sub.20)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.su-
b.6)-alkyl)-carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N-(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.18)-alkoxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl-carbarmoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl; CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; a carbamoyl radical of the formula R
##STR00009##
in which R.sup.x and R.sup.v are each independently selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, (C.sub.3-C.sub.7)-cycloalkyl,
aryl, or the substituent of an .alpha.-carbon of an .alpha.-amino
acid, to which the L- and D-amino acids belong, is 1-5, T is OH, or
NR*R**, and R*, R** and R*** are identical or different and are
selected from hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.7-C.sub.11)-aralkyl, (C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyl, (+)-dehydroabietyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, optionally substituted
(C.sub.6-C.sub.12)-aroyl; or R* and R** together are
--[CH.sub.2].sub.h, in which a CH.sub.2 group can be replaced by O,
S, SO, SO.sub.2, N-acylamino,
N--(C.sub.1-C.sub.10)-alkoxycarbonylimino,
N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)-carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyloxyamino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.30)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.20)-alkylmercapto, (C.sub.1-C.sub.20)-alkylsulfinyl,
(C.sub.1-C.sub.20)-alkylsulfonyl, (C.sub.6-C.sub.12)-arylmercapto,
(C.sub.6-C.sub.12)-arylsulfinyl, (C.sub.6-C.sub.12)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl,
(C.sub.7-C.sub.16)-aralkylsulfonyl,
(C.sub.1-C.sub.12)-alkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.1-C.sub.12)-alkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.6-C.sub.12)-arylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylmercapto-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.16)-aralkylsulfinyl-(C.sub.1-C.sub.6)-alkyl,
(C.sub.7-C.sub.36)-aralkylsulfonyl-(C.sub.1-C.sub.6)-alkyl,
sulfamoyl, N--(C.sub.1-C.sub.10)-alkylsulfamoyl,
N,N-di-(C.sub.1-C.sub.10)-alkylsulfamoyl,
(C.sub.3-C.sub.8)-cycloalkylsulfamoyl,
N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylsulfamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylsulfamoyl,
(C.sub.1-C.sub.10)-alkylsulfonamido,
N--((C.sub.1-C.sub.10)-alkyl)-(C.sub.1-C.sub.10)-alkylsulfonamido,
(C.sub.7-C.sub.16)-aralkylsulfonamido, and
N--((C.sub.1-C.sub.10)-alkyl-(C.sub.7-C.sub.16)-aralkylsulfonamido;
where an aryl radical may be substituted by 1 to 5 substituents
selected from hydroxyl, halogen, cyano, trifluoromethyl, nitro,
carboxyl, (C.sub.2-C.sub.16)-alkyl, (C.sub.3-C.sub.8)-cycloalkyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.8)-alkyl-(C.sub.1-C.sub.6)-al-
koxy,
(C.sub.3-C.sub.8)-cycloalkyl(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.-
1-C.sub.6)-alkyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)--
alkoxy, (C.sub.6-C.sub.12)-aryl, (C.sub.7-C.sub.16)-aralkyl,
(C.sub.2-C.sub.16)-alkenyl, (C.sub.2-C.sub.12)-alkynyl,
(C.sub.1-C.sub.16)-alkoxy, (C.sub.1-C.sub.16)-alkenyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxy,
(C.sub.1-C.sub.12)-alkoxy(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl-
, (C.sub.6-C.sub.12)-aryloxy, (C.sub.7-C.sub.16)-aralkyloxy,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxy,
(C.sub.1-C.sub.8)-hydroxyalkyl,
(C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.6)-alk-
yl,
(C.sub.7-C.sub.12)-aralkyloxy-(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.-
6)-alkyl, --O--[CH.sub.2].sub.xC.sub.fH.sub.(2f+1-g)F.sub.g,
--OCF.sub.2Cl, --OCF.sub.2--CHFCl,
(C.sub.1-C.sub.12)-alkylcarbonyl,
(C.sub.3-C.sub.8)-cycloalkylcarbonyl,
(C.sub.6-C.sub.12)-arylcarbonyl,
(C.sub.7-C.sub.16)-aralkylcarbonyl,
(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyl,
(C.sub.6-C.sub.12)-aryloxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyl,
(C.sub.2-C.sub.12)-alkenyloxycarbonyl,
(C.sub.2-C.sub.12)-alkynyloxycarbonyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.7-C.sub.16)-aralkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.3-C.sub.8)-cycloalkoxy-(C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.1-C.sub.12)-alkylcarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkylcarbonyloxy,
(C.sub.6-C.sub.12)-arylcarbonyloxy,
(C.sub.7-C.sub.16)-aralkylcarbonyloxy, cinnamoyloxy,
(C.sub.2-C.sub.12)-alkenylcarbonyloxy,
(C.sub.2-C.sub.12)-alkynylcarbonyloxy,
(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.1-C.sub.12)-alkoxy-(C.sub.1-C.sub.12)-alkoxycarbonyloxy,
(C.sub.6-C.sub.12)-aryloxycarbonyloxy,
(C.sub.7-C.sub.16)-aralkyloxycarbonyloxy,
(C.sub.3-C.sub.8)-cycloalkoxycarbonyloxy,
(C.sub.2-C.sub.12)-alkenyloxycarbonyloxy,
(C.sub.2-C.sub.12)-alkynyloxycarbonyloxy, carbamoyl,
N--(C.sub.1-C.sub.12)-alkylcarbamoyl,
N,N-di(C.sub.1-C.sub.12)-alkylcarbamoyl,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N,N-dicyclo-(C.sub.3-C.sub.8)-alkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyl,
N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.6)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N--((C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.su-
b.6)-alkyl)carbamoyl, N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.1-C.sub.6)-alkyl-N-(+)-dehydroabietylcarbamoyl,
N--(C.sub.6-C.sub.12)-arylcarbamoyl,
N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.16)-arylcarbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyl,
N--((C.sub.1-C.sub.16)-alkoxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.6-C.sub.16)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyl,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)-carbamoyl, CON(CH.sub.2).sub.h, in which a CH.sub.2
group can be replaced by, O, S, N--(C.sub.1-C.sub.8)-alkylimino,
N--(C.sub.3-C.sub.8)-cycloalkylimino,
N--(C.sub.3-C.sub.8)-cycloalkyl-(C.sub.1-C.sub.4)-alkylimino,
N--(C.sub.6-C.sub.12)-arylimino,
N--(C.sub.7-C.sub.16)-aralkylimino,
N--(C.sub.1-C.sub.4)-alkoxy-(C.sub.1-C.sub.6)-alkylimino, and h is
from 3 to 7; carbamoyloxy, N--(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N,N-di-(C.sub.1-C.sub.12)-alkylcarbamoyloxy,
N--(C.sub.3-C.sub.8)-cycloalkylcarbamoyloxy,
N--(C.sub.6-C.sub.16)-arylcarbamoyloxy,
N--(C.sub.7-C.sub.6)-aralkylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.6-C.sub.12)-arylcarbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--(C.sub.7-C.sub.16)-aralkylcarbamoyloxy,
N--((C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.10)-alkyl)carbamoyloxy,
N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.10-C.sub.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.1-C.sub.10)-alkoxy-(C.sub.1-C.sub.-
10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub-
.10)-alkyl)carbamoyloxy,
N--(C.sub.1-C.sub.10)-alkyl-N--((C.sub.7-C.sub.16)-aralkyloxy-(C.sub.1-C.-
sub.10)-alkyl)carbamoyloxy, amino, (C.sub.1-C.sub.12)-alkylamino,
di-(C.sub.1-C.sub.12)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkylamino, (C.sub.3-C.sub.12)-alkenylamino,
(C.sub.3-C.sub.12)-alkynylamino, N--(C.sub.6-C.sub.12)-arylamino,
N--(C.sub.7-C.sub.11)-aralkylamino, N-alkyl-aralkylamino,
N-alkyl-arylamino, (C.sub.1-C.sub.12)-alkoxyamino,
(C.sub.1-C.sub.12)-alkoxy-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino,
(C.sub.3-C.sub.8)-cycloalkanoylamino,
(C.sub.6-C.sub.12)-aroylamino, (C.sub.7-C.sub.16)-aralkanoylamino,
(C.sub.1-C.sub.12)-alkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.3-C.sub.8)-cycloalkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.6-C.sub.12)-aroyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.7-C.sub.11)-aralkanoyl-N--(C.sub.1-C.sub.10)-alkylamino,
(C.sub.1-C.sub.12)-alkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.3-C.sub.8)-cycloalkanoylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aroylamino-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.16)-aralkanoylamino-(C.sub.1-C.sub.8)-alkyl,
amino-(C.sub.1-C.sub.10)-alkyl,
N--(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
N,N-di-(C.sub.1-C.sub.10)-alkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.3-C.sub.8)-cycloalkylamino-(C.sub.1-C.sub.10)-alkyl,
(C.sub.1-C.sub.12)-alkylmercapto, (C.sub.1-C.sub.12)-alkylsulfinyl,
(C.sub.1-C.sub.12)-alkylsulfonyl, (C.sub.6-C.sub.16)-arylmercapto,
(C.sub.6-C.sub.16)-arylsulfinyl, (C.sub.6-C.sub.16)-arylsulfonyl,
(C.sub.7-C.sub.16)-aralkylmercapto,
(C.sub.7-C.sub.16)-aralkylsulfinyl, or
(C.sub.7-C.sub.16)-aralkylsulfonyl; or wherein R.sup.1 and R.sup.2,
or R.sup.2 and R.sup.3 form a chain [CH.sub.2].sub.o, which is
saturated or unsaturated by a C.dbd.C double bond, in which 1 or 2
CH.sub.2 groups are optionally replaced by O, S, SO, SO.sub.2, or
NR', and R' is hydrogen, (C.sub.6-C.sub.12)-aryl,
(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.8)-alkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.7-C.sub.12)-aralkoxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.6-C.sub.12)-aryloxy-(C.sub.1-C.sub.8)-alkyl,
(C.sub.1-C.sub.10)-alkanoyl, optionally substituted
(C.sub.7-C.sub.16)-aralkanoyl, or optionally substituted
(C6-C12)-aroyl; and o is 3, 4 or 5; or wherein the radicals R.sup.1
and R.sup.2, or R.sup.2 and R.sup.3, together with the pyridine or
pyridazine carrying them, form a 5,6,7,8-tetrahydroisoquinoline
ring, a 5,6,7,8-tetrahydroquinoline ring, or a
5,6,7,8-tetrahydrocinnoline ring; or wherein R.sup.1 and R.sup.2,
or R.sup.2 and R.sup.3 form a carbocyclic or heterocyclic 5- or
6-membered aromatic ring; or where R.sup.1 and R.sup.2, or R.sup.2
and R.sup.3, together with the pyridine or pyridazine carrying
them, form an optionally substituted heterocyclic ring systems
selected from thienopyridines, furanopyridines, pyridopyridines,
pyrimidinopyridines, imidazopyridines, thiazolopyridines,
oxazolopyridines, quinoline, isoquinoline, and cinnoline; where
quinoline, isoquinoline or cinnoline preferably satisfy the
formulae Ia, Ib and Ic:
##STR00010##
and the substituents R.sup.12 to R.sup.23 in each case
independently of each other have the meaning of R.sup.1, R.sup.2
and R.sup.3; or wherein the radicals R.sup.1 and R.sup.2, together
with the pyridine carrying them, form a compound of Formula Id:
##STR00011##
where V is S, O, or NR.sup.k, and R.sup.k is selected from
hydrogen, (C.sub.1-C.sub.6)-alkyl, aryl, or benzyl; where an aryl
radical may be optionally substituted by 1 to 5 substituents as
defined above; and R.sup.24, R.sup.25, R.sup.26, and R.sup.27 in
each case independently of each other have the meaning of R.sup.1,
R.sup.2 and R.sup.3; f is 1 to 8; g is 0 or 1 to (2f+1); x is 0 to
3; and h is 3 to 7; including the physiologically active salts and
prodrugs derived therefrom.
[0089] Exemplary compounds according to Formula (I) are described
in European Patent Nos. EP0650960 and EP0650961. All compounds
listed in EP0650960 and EP0650961, in particular, those listed in
the compound claims and the final products of the working examples,
are hereby incorporated into the present application by reference
herein. Exemplary compounds of Formula (I) include, but are not
limited to, [(3-Hydroxy-pyridine-2-carbonyl)-amino]-acetic acid
(Compound G) and [(3-methoxy-pyridine-2-carbonyl)-amino]-acetic
acid (Compound P).
[0090] Additionally, exemplary compounds according to Formula (I)
are described in U.S. Pat. No. 5,658,933. All compounds listed in
U.S. Pat. No. 5,658,933, in particular, those listed in the
compound claims and the final products of the working examples, are
hereby incorporated into the present application by reference
herein. Exemplary compounds of Formula (I) include, but are not
limited to, 3-methoxypyridine-2-carboxylic acid
N-(((hexadecyloxy)-carbonyl)-methyl)-amide hydrochloride,
3-methoxypyridine-2-carboxylic acid
N-(((1-octyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((hexyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
3-methoxypyridine-2-carboxylic acid
N-(((2-nonyloxy)-carbonyl)-methyl)-amide racemate,
3-methoxypyridine-2-carboxylic acid
N-(((heptyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((octyloxy)-carbonyl)-methyl)-amide,
3-benzyloxypyridine-2-carboxylic acid
N-(((butyloxy)-carbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-((benzyloxycarbonyl)-methyl)-amide,
5-(((3-(1-butyloxy)-propyl)-amino)-carbonyl)-3-methoxypyridine-2-carboxyl-
ic acid N-(((1-butyloxy)-carbonyl)-methyl)-amide, and
5-(((3-lauryloxy)-propyl)amino)-carbonyl)-3-methoxypyridine-2-carboxylic
acid N-(((benzyloxy)-carbonyl)-methyl)-amide.
[0091] Additional compounds according to Formula (I) are
substituted heterocyclic carboxyamides described in U.S. Pat. No.
5,620,995; 3-hydroxypyridine-2-carboxamidoesters described in U.S.
Pat. No. 6,020,350; sulfonamidocarbonylpyridine-2-carboxamides
described in U.S. Pat. No. 5,607,954; and
sulfonamidocarbonyl-pyridine-2-carboxamides and
sulfonamidocarbonyl-pyridine-2-carboxamide esters described in U.S.
Pat. Nos. 5,610,172 and 5,620,996. All compounds listed in these
patents, in particular, those compounds listed in the compound
claims and the final products of the working examples, are hereby
incorporated into the present application by reference herein.
[0092] Exemplary compounds according to Formula (Ia) are described
in U.S. Pat. Nos. 5,719,164 and 5,726,305. All compounds listed in
the foregoing patents, in particular, those listed in the compound
claims and the final products of the working examples, are hereby
incorporated into the present application by reference herein.
Exemplary compounds of Formula (Ia) include, but are not limited
to, N-((3-hydroxy-6-isopropoxy-quinoline-2-carbonyl)-amino)-acetic
acid (Compound H),
N-((6-(1-butyloxy)-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
[(3-hydroxy-6-trifluoromethoxy-quinoline-2-carbonyl)-amino]-acetic
acid (Compound I),
N-((6-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine,
N-((7-chloro-3-hydroxyquinolin-2-yl)-carbonyl)-glycine, and
[(6-chloro-3-hydroxy-quinoline-2-carbonyl)-amino]-acetic acid
(Compound O).
[0093] Exemplary compounds according to Formula (Ib) are described
in U.S. Pat. No. 6,093,730. All compounds listed in U.S. Pat. No.
6,093,730, in particular, those listed in the compound claims and
the final products of the working examples, are hereby incorporated
into the present application by reference herein. Exemplary
compounds of Formula (Ib) include, but are not limited to,
N-((1-chloro-4-hydroxy-7-(2-propyloxy)
isoquinolin-3-yl)-carbonyl)-glycine,
N-((1-chloro-4-hydroxy-6-(2-propyloxy)
isoquinolin-3-yl)-carbonyl)-glycine,
N--((1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic acid
(Compound B),
N-((1-chloro-4-hydroxy-7-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((1-chloro-4-hydroxy-6-methoxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((7-butyloxy)-1-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((6-benzyloxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid (Compound J),
((7-benzyloxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid methyl ester (Compound K),
N-((7-benzyloxy-1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic
acid (Compound L),
N-((8-chloro-4-hydroxyisoquinolin-3-yl)-carbonyl)-glycine,
N-((7-butoxy-4-hydroxy-isoquinoline-3-carbonyl)-amino)-acetic acid
(Compound M).
[0094] Additionally, compounds related to Formula (I) that can also
be used in the methods of the invention include, but are not
limited to, 6-cyclohexyl-1-hydroxy-4-methyl-1H-pyridin-2-one
(Compound N),
7-(4-methyl-piperazin-1-ylmethyl)-5-phenylsulfanylmethyl-quinolin-8-ol
(Compound D), 4-nitro-quinolin-8-ol (Compound E), and
5-butoxymethyl-quinolin-8-ol (Compound F). Further, the invention
provides additional exemplary compounds wherein, e.g., position A
and B together may be, e.g., hexanoic acid, cyanomethyl,
2-aminoethyl, benzoic acid, 1H-benzoimidazol-2-ylmethyl, etc.
[0095] In other embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (II)
##STR00012##
where R.sup.28 is hydrogen, nitro, amino, cyano, halogen,
(C.sub.1-C.sub.4)-alkyl, carboxy or a metabolically labile ester
derivative thereof; (C.sub.1-C.sub.4)-alkylamino,
di-(C.sub.1-C.sub.4)-alkylamino, (C.sub.1-C.sub.6)-alkoxycarbonyl,
(C.sub.2-C.sub.4)-alkanoyl, hydroxy-(C.sub.1-C.sub.4)-alkyl,
carbamoyl, N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
(C.sub.1-C.sub.4)-alkylthio, (C.sub.1-C.sub.4)-alkylsulfinyl,
(C.sub.1-C.sub.4)-alkylsulfonyl, phenylthio, phenylsulfinyl,
phenylsulfonyl, said phenyl or phenyl groups being optionally
substituted with 1 to 4 identical or different halogen,
(C.sub.1-C.sub.4)-alkyoxy, (C.sub.1-C.sub.4)-alkyl, cyano, hydroxy,
trifluoromethyl, fluoro-(C.sub.1-C.sub.4)-alkylthio,
fluoro-(C.sub.1-C.sub.4)-alkylsulfinyl,
fluoro-(C.sub.1-C.sub.4)-alkylsulfonyl,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxycarbonyl,
N,N-di-[(C.sub.1-C.sub.4)-alkyl]carbamoyl-(C.sub.1-C.sub.4)-alkoxycarbony-
l, (C.sub.1-C.sub.4)-alkylamino-(C.sub.2-C.sub.4)-alkoxycarbonyl,
di-(C.sub.1-C.sub.4)-alkylamino-(C.sub.2-C.sub.4)-alkoxycarbonyl,
(C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkox-
ycarbonyl, (C.sub.2-C.sub.4)-alkanoyloxy-C.sub.1-C.sub.4)-alkyl, or
N--[amino-(C.sub.2-C.sub.8)-alkyl]-carbamoyl; R.sup.29 is hydrogen,
hydroxy, amino, cyano, halogen, (C.sub.1-C.sub.4)-alkyl, carboxy or
metabolically labile ester derivative thereof,
(C.sub.1-C.sub.4)-alkylamino, di-(C.sub.1-C.sub.4)-alkylamino,
(C.sub.1-C.sub.6)-alkoxycarbonyl, (C.sub.2-C.sub.4)-alkanoyl,
(C.sub.1-C.sub.4)-alkoxy, carboxy-(C.sub.1-C.sub.4)-alkoxy,
(C.sub.1-C.sub.4)-alkoxycarbonyl-(C.sub.1-C.sub.4)-alkoxy,
carbamoyl, N--(C.sub.1-C.sub.8)-alkylcarbamoyl,
N,N-di-(C.sub.1-C.sub.8)-alkylcarbamoyl,
N--[amino-(C.sub.2-C.sub.8)-alkyl)-carbamoyl,
N--[(C.sub.1-C.sub.4)-alkylamino-(C.sub.1-C.sub.8)-alkyl]-carbamoyl,
N--[di-(C.sub.1-C.sub.4)-alkylamino-(C.sub.1-C.sub.8)-alkyl)]-carbamoyl,
N-cyclohexylcarbamoyl, N--[cyclopentyl]-carbamoyl,
N--(C.sub.1-C.sub.4)-alkylcyclohexylcarbamoyl,
N--(C.sub.1-C.sub.4)-alkylcyclopentylcarbamoyl, N-phenylcarbamoyl,
N--(C.sub.1-C.sub.4)-alkyl-N-phenylcarbamoyl,
N,N-diphenylcarbamoyl,
N--[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl,
N--(C.sub.1-C.sub.4)-alkyl-N--[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl,
or N,N-di-[phenyl-(C.sub.1-C.sub.4)-alkyl]-carbamoyl, said phenyl
or phenyl groups being optionally substituted with 1 to 4 identical
or different halogen, (C.sub.1-C.sub.4)-alkyoxy,
(C.sub.1-C.sub.4)-alkyl, cyano, hydroxy, trifluoromethyl,
N--[(C.sub.2-C.sub.4)-alkanoyl]-carbamoyl,
N--[(C.sub.1-C.sub.4)-alkoxycarbonyl]-carbamoyl,
N--[fluoro-(C.sub.2-C.sub.6)-alkyl]-carbamoyl,
N,N-[fluoro-(C.sub.2-C.sub.6)-alkyl]-N--(C.sub.1-C.sub.4)-alkylcarbamoyl,
N,N-[di-fluoro-(C.sub.2-C.sub.6)-alkyl]carbamoyl,
pyrrolidin-1-ylcarbonyl, piperidinocarbonyl,
piperazin-1-ylcarbonyl, morpholinocarbonyl, wherein the
heterocyclic group, is optionally substituted with 1 to 4,
(C.sub.1-C.sub.4)-alkyl, benzyl,
1,2,3,4-tetrahydro-isoquinolin-2-ylcarbonyl,
N,N-[di-(C.sub.1-C.sub.4)-alkyl]-thiocarbamoyl,
N--(C.sub.2-C.sub.4)-alkanoylamino, or
N--[(C.sub.1-C.sub.4)-alkoxycarbonyl]-amino; R.sup.30 is hydrogen,
(C.sub.1-C.sub.4)-alkyl, (C.sub.2-C.sub.4)-alkoxy, halo, nitro,
hydroxy, fluoro-(1-4C)alkyl, or pyridinyl; R.sup.31 is hydrogen,
(C.sub.1-C.sub.4)-alkyl, (C.sub.2-C.sub.4)-alkoxy, halo, nitro,
hydroxy, fluoro-(C.sub.1-C.sub.4)-alkyl, pyridinyl, or methoxy;
[0096] R.sup.32 is hydrogen, hydroxy, amino,
(C.sub.1-C.sub.4)-alkylamino, di-(C.sub.1-C.sub.4)-alkylamino,
halo, (C.sub.1-C.sub.4)-alkoxy-(C.sub.2-C.sub.4)-alkoxy,
fluoro-(C.sub.1-C.sub.6)-alkoxy, pyrrolidin-1-yl, piperidino,
piperazin-1-yl, or morpholino, wherein the heterocyclic group is
optionally substituted with 1 to 4 identical or different
(C.sub.1-C.sub.4)-alkyl or benzyl; and
R.sup.33 and R.sup.34 are individually selected from hydrogen,
(C.sub.1-C.sub.4)-alkyl, and (C.sub.1-C.sub.4)-alkoxy; including
pharmaceutically-acceptable salts and pro-drugs derived
therefrom.
[0097] Exemplary compounds of Formula (II) are described in U.S.
Pat. Nos. 5,916,898 and 6,200,974, and International Publication
No. WO 99/21860. All compounds listed in the foregoing patents and
publication, in particular, those listed in the compound claims and
the final products of the working examples, are hereby incorporated
into the present application by reference herein. Exemplary
compounds of Formula (II) include
4-oxo-1,4-dihydro-[1,10]phenanthroline-3-carboxylic acid (Compound
A) (see, e.g., Seki et al. (1974) Chem Abstracts 81:424, No. 21),
3-carboxy-5-hydroxy-4-oxo-3,4-dihydro-1,10-phenanthroline,
3-carboxy-5-methoxy-4-oxo-3,4-dihydro-1,10-phenanthroline,
5-methoxy-4-oxo-1,4-dihydro-[1,10]phenanthroline-3-carboxylic acid
ethyl ester,
5-methoxy-4-oxo-1,4-dihydro-[1,10]phenanthroline-3-carboxylic acid
(Compound Q), and
3-carboxy-8-hydroxy-4-oxo-3,4-dihydro-1,10-phenanthroline.
[0098] In other embodiments, compounds used in the methods of the
invention are selected from a compound of the formula (III)
##STR00013##
or pharmaceutically acceptable salts thereof, wherein: a is an
integer from 1 to 4; b is an integer from 0 to 4; c is an integer
from 0 to 4; Z is selected from the group consisting of
(C.sub.3-C.sub.10) cycloalkyl, (C.sub.3-C.sub.10) cycloalkyl
independently substituted with one or more Y.sup.1, 3-10 membered
heterocycloalkyl and 3-10 membered heterocycloalkyl independently
substituted with one or more Y.sup.1; (C.sub.5-C.sub.20) aryl,
(C.sub.5-C.sub.20) aryl independently substituted with one or more
Y.sup.1, 5-20 membered heteroaryl and 5-20 membered heteroaryl
independently substituted with one or more Y.sup.1; Ar.sup.1 is
selected from the group consisting of (C.sub.5-C.sub.20) aryl,
(C.sub.5-C.sub.20) aryl independently substituted with one or more
Y.sup.2, 5-20 membered heteroaryl and 5-20 membered heteroaryl
independently substituted with one or more Y.sup.2; each Y.sup.1 is
independently selected from the group consisting of a lipophilic
functional group, (C.sub.5-C.sub.20) aryl, (C.sub.6-C.sub.26)
alkaryl, 5-20 membered heteroaryl and 6-26 membered alk-heteroaryl;
each Y.sup.2 is independently selected from the group consisting of
--R', --OR', --OR'', --SR', --SR'', --NR'R', --NO.sub.2, --CN,
-halogen, -trihalomethyl, trihalomethoxy, --C(O)R', --C(O)OR',
--C(O)NR'R', --C(O)NR'R', --C(NR'R').dbd.NOR', --NR'--C(O)R',
--SO.sub.2R', --SO.sub.2R'', --NR'--SO.sub.2--R',
--NR'--C(O)--NR'R', tetrazol-5-yl, --NR'--C(O)--OR',
--C(NR'R').dbd.NR', --S(O)--R', --S(O)--R'', and
--NR'--C(S)--NR'R'; and each R' is independently selected from the
group consisting of --H, (C.sub.1-C.sub.8) alkyl, (C.sub.2-C.sub.8)
alkenyl, and (C.sub.2-C.sub.8) alkynyl; and each R'' is
independently selected from the group consisting of
(C.sub.5-C.sub.20) aryl and (C.sub.5-C.sub.20) aryl independently
substituted with one or more --OR', --SR', --NR'R', --NO.sub.2,
--CN, halogen or trihalomethyl groups, or wherein c is 0 and
Ar.sup.1 is an N' substituted urea-aryl, the compound has the
structural formula (IIIa):
##STR00014##
or pharmaceutically acceptable salts thereof, wherein: a, b, and Z
are as defined above; and R.sup.35 and R.sup.36 are each
independently selected from the group consisting of hydrogen,
(C.sub.1-C.sub.8) alkyl, (C.sub.2-C.sub.8) alkenyl,
(C.sub.2-C.sub.8) alkynyl, (C.sub.3-C.sub.10) cycloalkyl,
(C.sub.5-C.sub.20) aryl, (C.sub.5-C.sub.20) substituted aryl,
(C.sub.6-C.sub.26) alkaryl, (C.sub.6-C.sub.26) substituted alkaryl,
5-20 membered heteroaryl, 5-20 membered substituted heteroaryl,
6-26 membered alk-heteroaryl, and 6-26 membered substituted
alk-heteroaryl; and R.sup.37 is independently selected from the
group consisting of hydrogen, (C.sub.1-C.sub.8) alkyl,
(C.sub.2-C.sub.8) alkenyl, and (C.sub.2-C.sub.8) alkynyl.
[0099] Exemplary compounds of Formula (III) are described in
International Publication No. WO 00/50390. All compounds listed in
WO 00/50390, in particular, those listed in the compound claims and
the final products of the working examples, are hereby incorporated
into the present application by reference herein. Exemplary
compounds of Formula (III) include
3-{[4-(3,3-dibenzyl-ureido)-benzenesulfonyl]-[2-(4-methoxy-phenyl-
)-ethyl]-amino}-N-hydroxy-propionamide (Compound C),
3-{{4-[3-(4-chloro-phenyl)-ureido]-benzenesulfonyl}-[2-(4-methoxy-phenyl)-
-ethyl]-amino}-N-hydroxy-propionamide, and
3-{{4-[3-(1,2-diphenyl-ethyl)-ureido]-benzenesufonyl}-[2-(4-methoxy-pheny-
l)-ethyl]-amino}-N-hydroxy-propionamide.
[0100] Based on the common mechanism of action of the
2-oxoglutarate dioxygenase family members, such as dependence on
Fe.sup.2+ and 2-oxoglutarate for activity, in certain aspects the
invention is directed to use of compounds, including the compounds
described herein, to inhibit HIF.alpha. hydroxylation and thus
stabilize HIF.alpha. in an oxygen-independent manner. Further, the
examples and figures of the present invention demonstrate that
application of such compounds stabilize HIF.alpha. and subsequently
induce HIF-regulated gene products in vitro and in vivo. In
specific embodiments, these compounds are used to produce a
specific benefit in the prevention and treatment of ischemic and
hypoxic conditions.
[0101] The methods of the present invention stabilize HIF.alpha. in
a dose-dependent manner in cells grown in a normoxic environment.
Although different cell types show different levels of HIF.alpha.
in the presence of a compound of the invention, all of the cell
lines tested showed some level of HIF.alpha. stabilization. The
level of HIF.alpha., in untreated cells is usually low to
undetectable.
[0102] Stabilization of HIF.alpha. leads to HIF-dependent gene
expression in vitro and in vivo, including genes encoding
angiogenic factors such as VEGF, Flt-1, EG-VEGF, PAT-1,
adrenomedullin, and Cyr61. Thus, the ability to stabilize
HIF.alpha. has potential benefits in the induction of angiogenesis
and prevention of tissue damage due to ischemia and hypoxia. For
example, transgenic mice expressing constitutively active
HIF-1.alpha. in the epidermis show enhanced expression of each VEGF
isoform and a significant increase in dermal capillaries. Unlike
overexpression of one VEGF isoform alone, the hypervascularity
induced by HIF.alpha. shows no edema, inflammation, or vascular
leakage. (See, Elson et al. (2001) Genes Dev 15:2520-2532; Detmar
et al. (1998) J Invest Derm 111:1-61; Larcher et al. (1998)
Oncogene 17:303-311; and Thurston et al. (1999) Science
286:2511-2514.) Therefore, in certain aspects, methods of the
invention can be used to induce therapeutic angiogenesis, which
involves the development of collateral blood vessels to
revascularize ischemic tissues.
[0103] Additionally, the methods of the invention produce a
dose-dependent decrease in oxygen consumption in cells without any
affect on cell viability. Stable HIF.alpha. complexes activate
expression of proteins involved in glucose uptake and utilization,
such as glucose transporter (GluT)-1 and GluT-3; aldolase-A,
enolase-1, hexokinase-1 and -2, and phosphofructokinase-L and -C.
The reduction in oxygen consumption associated with HIF.alpha.
stabilization is potentially due to a shift in cellular metabolism
from aerobic to anaerobic energy production. The present methods
can thus be applied to generate energy under low oxygen conditions,
beneficial in ischemic and hypoxic conditions such as, for example,
peripheral arterial disease, DVT, angina pectoris, pulmonary
embolism, stroke, and myocardial infarction. Methods of increasing
glucose uptake and utilization by cells of the body, generally
applicable to the treatment of other conditions, e.g., diabetes,
are also provided.
[0104] The invention further provides methods for increasing
oxygen-carrying capacity by inducing erythropoiesis, and
facilitating iron transport and utilization. Specifically, methods
of the invention increase expression of erythropoietin (EPO), a
naturally occurring hormone that stimulates the production of red
blood cells. (See, e.g., commonly owned, copending U.S. Patent
Application Publication No. 2003/0153503, incorporated herein by
reference in its entirety.) Methods for increasing expression of
enzymes and proteins involved in iron uptake, transport, and
processing are specifically contemplated. Such enzymes and proteins
include, but are not limited to, transferrin and transferrin
receptor, which together facilitate iron transport to and uptake
by, e.g., erythroid tissue; and ceruloplasmnin, a ferroxidase
required to oxidize ferrous iron to ferric iron. As transferrin can
only bind and transport ferric iron, ceruloplasmin is important for
supply of iron to tissues. The ability of the methods of the
invention to increase both endogenous erythropoietin and transport
and utilization of iron provides specific advantage in oxygen
delivery in both normoxic and hypoxic environments.
[0105] In one aspect, the invention includes methods that provide
neuroprotective benefits, e.g., by stabilizing HIF.alpha.. For
example, both VEGF and EPO have been shown to be neuroprotective.
(See, e.g., Jin et al. (2000) Proc Natl Acad Sci USA.
97:10242-10247; Bocker-Meffert et al. (2002) Invest Ophlthalmol Vis
Sci 43:2021-2026; Buemi et al. (2002) Clin Sci (Lond) 103:275-282;
and Siren et al. (2001) Proc Natl Acad Sci USA 98:4044-4049.) EPO
also facilitates recovery from spinal cord injuries and provides
neuroprotective benefits when induced prior to an ischemic event.
(See, e.g., Gorio et al. (2002) Proc Natl Acad Sci USA
99:9450-9455; and Dawson (2002) Lancet 359:96-97.) As the methods
of the invention increase expression of neuroprotective factors
such as VEGF and EPO, the methods provide neuroprotective benefit
that can be applied to treatment, pretreatment, or prevention of
conditions including, e.g., diabetic neuropathy, stroke,
neurodegenerative disease, trauma, injury, e.g., concussions,
spinal cord injuries, etc., or prior to surgical procedures, e.g.,
wherein cerebral ischemic reperfusion injury may result.
[0106] Hypoxic preconditioning has been shown to effectively
protect against subsequent acute ischemic insult. As the primary
effect of hypoxia is stabilization of HIF.alpha. and subsequent
activation of HIF-regulated genes, the methods of the invention
will mimic hypoxic preconditioning in a normoxic environment. For
example, the methods may be used prior to surgery, wherein
ischemic-reperfusion injury may be expected to produce deleterious
results in the patient. Such preventive therapy, when applied prior
to an ischemic event, can be provided at any time point prior to
the event, in a single or repeated dose format.
[0107] The methods of the invention also coordinately upregulate
genes involved in oxidative stress and vascular tone. Such genes
include, e.g., inducible nitric oxide synthase (iNOS), and heme
oxygenase 1. Production of iNOS has also been associated with the
beneficial effects of hypoxic preconditioning in several animal
models. (See, e.g., Serracino-Inglott et al. (2002) BMC
Gastroenterol 2:22-27; Kuntscher et al. (2002) Br J Plast Surg
55:430-433.) Significantly, blocking iNOS activity attenuates but
does not abrogate the beneficial effects of preconditioning,
whereas nonspecifically blocking protein production completely
abrogates the benefits of preconditioning. (Wang et al. (2002)
Cardiovasc Res 56:33-42.) This suggests that iNOS is an important
component of the physiological response to preconditioning, but is
not the only factor. As the methods of the invention coordinately
regulate various factors, including iNOS, involved in hypoxic
response, the methods of the invention will more accurately
replicate the beneficial effects of hypoxic preconditioning.
Methods of Using the Compounds of the Invention
[0108] The present invention provides methods of inhibiting
HIF.alpha. hydroxylation, thereby stabilizing HIF and activating
HIF-regulated gene expression. The methods can be applied to the
prevention, pretreatment, or treatment of conditions associated
with HIF including ischemic and hypoxic conditions. Such conditions
include, for example, myocardial infarction, liver ischemia, renal
ischemia, and stroke; peripheral vascular disorders, ulcers, burns,
and chronic wounds; pulmonary embolism; and ischemic-reperfusion
injury, including, for example, ischemic-reperfusion injury
associated with surgery and organ transplantation. In one
embodiment, the present invention provides methods of stabilizing
HIF.alpha. before, during, or immediately after ischemia or
hypoxia, particularly in association with myocardial infarction,
stroke, or renal ischemic-reperfusion injury.
[0109] In one aspect, the invention provides methods for treating
various ischemic and hypoxic conditions, in particular, using the
compounds described herein. In one embodiment, the methods of the
invention produce therapeutic benefit when administered following
ischemia or hypoxia. For example, the methods of the invention
produce a dramatic decrease in morbidity and mortality following
myocardial infarction, and a significant improvement in heart
architecture and performance. Further, the methods of the invention
improve liver function when administered following hepatic
toxic-ischemic injury. Hypoxia is a significant component of liver
disease, especially in chronic liver disease associated with
hepatotoxic compounds such as ethanol. Additionally, expression of
genes known to be induced by HIF.alpha., e.g., nitric oxide
synthase and glucose transporter-1, is increased in alcoholic liver
disease. (See, e.g., Areel et al. (1997) Hepatology 25:920-926;
Strubelt (1984) Fundam Appl Toxicol 4:144-151; Sato (1983)
Pharmacol Biochem Behav 18 (Suppl 1):443-447; Nanji et al. (1995)
Am J Pathol 146:329-334; and Morio et al. (2001) Toxicol Appl
Pharmacol 172:44-51.)
[0110] Therefore, the present invention provides methods of
treating conditions associated with ischemia or hypoxia, the method
comprising administering a therapeutically effective amount of a
compound or a pharmaceutically acceptable salt thereof, alone or in
combination with a pharmaceutically acceptable excipient, to a
subject. In one embodiment, the compound is administered
immediately following a condition producing acute ischemia, e.g.,
myocardial infarction, pulmonary embolism, intestinal infarction,
ischemic stroke, and renal ischemic-reperfusion injury. In another
embodiment, the compound is administered to a patient diagnosed
with a condition associated with the development of chronic
ischemia, e.g., cardiac cirrhosis, macular degeneration, pulmonary
embolism, acute respiratory failure, neonatal respiratory distress
syndrome, and congestive heart failure. In yet another embodiment,
the compound is administered immediately after a trauma or
injury.
[0111] In another aspect, the invention provides methods for
treating a patient at risk of developing an ischemic or hypoxic
condition, e.g., individuals at high risk for atherosclerosis,
etc., using the compounds described herein. Risk factors for
atherosclerosis include, e.g., hyperlipidemia, cigarette smoking,
hypertension, diabetes mellitus, hyperinsulinemia, and abdominal
obesity. Therefore, the present invention provides methods of
preventing ischemic tissue injury, the method comprising
administering a therapeutically effective amount of a compound or a
pharmaceutically acceptable salt thereof, alone or in combination
with a pharmaceutically acceptable excipient, to a patient in need.
In one embodiment, the compound can be administered based on
predisposing conditions, e.g., hypertension, diabetes, occlusive
arterial disease, chronic venous insufficiency, Raynaud's disease,
chronic skin ulcers, cirrhosis, congestive heart failure, and
systemic sclerosis.
[0112] In one specific embodiment, the methods are used to increase
vascularization and/or granulation tissue formation in damaged
tissue, wounds, and ulcers. For example, compounds of the invention
have been shown to be effective in stimulating granulation tissue
formation in wound healing. Granulation tissue contains newly
formed, leaky blood vessels and a provisional stroma of plasma
proteins, such as fibrinogen and plasma fibronectin. Release of
growth factors from inflammatory cells, platelets, and activated
endothelium, stimulates fibroblast and endothelial cell migration
and proliferation within the granulation tissue. Ulceration can
occur if vascularization or neuronal stimulation is impaired. The
methods of the invention are effective at promoting granulation
tissue formation. Thus, the invention provides methods for treating
a patient having tissue damage due to, e.g., an infarct, having
wounds induced by, e.g., trauma or injury, or having chronic wounds
or ulcers produced as a consequence of a disorder, e.g., diabetes.
The method comprises administering a therapeutically effective
amount of a compound or a pharmaceutically acceptable salt thereof,
alone or in combination with a pharmaceutically acceptable
excipient, to a patient in need.
[0113] In another aspect; the invention provides methods of using
the compounds to pretreat a subject to decrease or prevent the
development of tissue damage associated with ischemia or hypoxia.
The methods of the invention produce therapeutic benefit when
administered immediately before a condition involving ischemia or
hypoxia. For example, application of the methods of the invention
prior to induction of myocardial infarction shows statistically
significant improvement in heart architecture and performance.
Further, the methods of the invention produce therapeutic benefit
when administered immediately before and during
ischemic-reperfusion injury, significantly reducing diagnostic
parameters associated with renal failure.
[0114] Therefore, the invention provides methods of pretreating a
subject to decrease or prevent the tissue damage associated with
ischemia or hypoxia, the method comprising administering a
therapeutically effective amount of a compound or a
pharmaceutically acceptable salt thereof, alone or in combination
with a pharmaceutically acceptable excipient, to a patient with a
history of ischemic disorders, e.g., myocardial infarctions, or
having symptoms of impending ischemia, e.g., angina pectoris. In
another embodiment, the compound can be administered based on
physical parameters implicating possible ischemia, e.g.,
individuals placed under general anesthesia or temporarily working
at high altitudes. In yet another embodiment, the compounds may be
used in organ transplants to pretreat organ donors and to maintain
organs removed from the body prior to implantation in the
recipient.
[0115] Previous studies have shown that certain compounds used in
the methods of the present invention are effective inhibitors of
procollagen prolyl 4-hydroxylase. While it is recognized that
recovery from an initial infarct or wound requires connective
tissue deposition within the necrotic region, the present invention
demonstrates no adverse affects of treatment with respect to scar
formation. Thus, based on the benefits provided by certain
compounds of the invention on treatment and prevention of hypoxic
tissue damage and fibrosis, the present invention contemplates a
"dual-therapy" approach to treatment or prevention of conditions
involving ischemia or hypoxia, including ischemia or hypoxia
associated with subsequent reactive fibrosis, e.g., myocardial
infarction and resultant congestive heart failure. The method may
use one compound that inhibits more than one 2-oxoglutarate
dioxygenase enzyme, e.g., HIF prolyl hydroxylase and procollagen
prolyl 4-hydroxylase, with either the same specificity or with
different specificities. Alternatively, the method may use a
combination of compounds wherein each compound specifically
inhibits only one 2-oxoglutarate dioxygenase enzyme, e.g., one
compound specifically inhibits HIF prolyl hydroxylase and a second
compound specifically inhibits procollagen prolyl
4-hydroxylase.
[0116] In one aspect, a compound of the invention inhibits one or
more 2-oxoglutarate dioxygenase enzymes. In one embodiment, the
compound inhibits at least two 2-oxoglutarate dioxygenase family
members, e.g., HIF prolyl hydroxylase and HIF
asparagine-hydroxylase (FIH-1), with either the same specificity or
with differential specificity. In another embodiment, the compound
is specific for one 2-oxoglutarate dioxygenase, e.g., HIF prolyl
hydroxylase, and shows little to no specificity for other family
members.
[0117] The compounds can be administered in combination with
various other therapeutic approaches. In one embodiment, the
compound is administered with another 2-oxoglutarate dioxygenase
inhibitor, wherein the two compounds have differential specificity
for individual 2-oxoglutarate dioxygenase family members. The two
compounds may be administered at the same time as a ratio of one
relative to the other. Determination of a ratio appropriate to a
given course of treatment or a particular subject is within the
level of skill in the art. Alternatively, the two compounds may be
administered consecutively during a treatment time course, e.g.,
following myocardial infarction. In a particular embodiment, one
compound specifically inhibits HIF prolyl hydroxylase enzyme
activity, and a second compound specifically inhibits procollagen
prolyl 4-hydroxylase enzyme activity. In another specific
embodiment, one compound specifically inhibits HIF prolyl
hydroxylase enzyme activity, and a second compound specifically
inhibits HIF asparaginyl-hydroxylase enzyme activity. In another
embodiment, the compound is administered with another therapeutic
agent having a different mode of action, e.g., an ACE inhibitor
(ACEI), angiotensin-II receptor blocker (ARB), statin, diuretic,
digoxin, carnitine, etc.
Pharmaceutical Formulations and Routes of Administration
[0118] The compositions of the present invention can be delivered
directly or in pharmaceutical compositions along with suitable
carriers or excipients, as is well known in the art. Present
methods of treatment can comprise administration of an effective
amount of a compound of the invention to a subject having or at
risk for an ischemic condition, e.g., congestive heart failure,
atherosclerosis, etc. In a preferred embodiment, the subject is a
mammalian subject, and in a most preferred embodiment, the subject
is a human subject. Preferred routes of administration include oral
and transdermal delivery mechanisms.
[0119] An effective amount of such agents can readily be determined
by routine experimentation, as can the most effective and
convenient route of administration and the most appropriate
formulation. Various formulations and drug delivery systems are
available and selection of an appropriate formulation is within the
level of skill in the art. (See, e.g., Gennaro, ed. (1995)
Remington's Pharmaceutical Sciences, supra; and Hardman, Limbird,
and Gilman, eds. (2001) The Pharmacological Basis of Therapeutics,
supra.)
[0120] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, nasal, or intestinal administration and
parenteral delivery, including intramuscular, subcutaneous,
intramedullary injections, as well as intrathecal, direct
intraventricular, intravenous, intraperitoneal, intranasal, or
intraocular injections. The agent or composition thereof may be
administered in a local rather than a systemic manner. For example,
a suitable agent can be delivered via injection or in a targeted
drug delivery system, such as a depot or sustained release
formulation.
[0121] The pharmaceutical compositions of the present invention may
be manufactured by any of the methods well-known in the art, such
as by conventional mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping, or lyophilizing
processes. As noted above, the compositions of the present
invention can include one or more physiologically acceptable
carriers such as excipients and auxiliaries that facilitate
processing of active molecules into preparations for pharmaceutical
use.
[0122] Proper formulation is dependent upon the route of
administration chosen. For injection, for example, the composition
may be formulated in aqueous solutions, preferably in
physiologically compatible buffers such as Hanks's solution,
Ringer's solution, or physiological saline buffer. For transmucosal
or nasal administration, penetrants appropriate to the barrier to
be permeated are used in the formulation. Such penetrants are
generally known in the art. For oral administration, the compounds
can be formulated readily by combining the active compounds with
pharmaceutically acceptable carriers well known in the art. Such
carriers enable the compounds of the invention to be formulated as
tablets, pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions and the like, for oral ingestion by a subject. The
compounds may also be formulated in rectal compositions such as
suppositories or retention enemas, e.g., containing conventional
suppository bases such as cocoa butter or other glycerides.
[0123] Pharmaceutical preparations for oral use can be obtained as
solid excipients, optionally grinding a resulting mixture, and
processing the mixture of granules, after adding suitable
auxiliaries, if desired, to obtain tablets or dragee cores.
Suitable excipients are, in particular, fillers such as sugars,
including lactose, sucrose, mannitol, or sorbitol; cellulose
preparations such as, for example, maize starch, wheat starch, rice
starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate.
[0124] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0125] Pharmaceutical preparations for oral administration include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added.
[0126] In one embodiment, the compounds of the present invention
can be administered transdermally, such as through a skin patch, or
topically. In one aspect, the transdermal or topical formulations
of the present invention can additionally comprise one or multiple
penetration enhancers or other effectors, including agents that
enhance migration of the delivered compound. Transdermal or topical
administration could be preferred, for example, in situations in
which location specific delivery is desired.
[0127] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide, or any other suitable
gas. In the case of a pressurized aerosol, the appropriate dosage
unit may be determined by providing a valve to deliver a metered
amount. Capsules and cartridges of, for example, gelatin, for use
in an inhaler or insufflator may be formulated. These typically
contain a powder mix of the compound and a suitable powder base
such as lactose or starch.
[0128] Compositions formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion, can be
presented in unit dosage form, e.g., in ampoules or in multi-dose
containers, with an added preservative. The compositions may take
such forms as suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. Formulations for
parenteral administration include aqueous solutions or other
compositions in water-soluble form.
[0129] Suspensions of the active compounds may also be prepared as
appropriate oily injection suspensions. Suitable lipophilic
solvents or vehicles include fatty oils such as sesame oil and
synthetic fatty acid esters, such as ethyl oleate or triglycerides,
or liposomes. Aqueous injection suspensions may contain substances
that increase the viscosity of the suspension, such as sodium
carboxymethyl cellulose, sorbitol, or dextran. Optionally, the
suspension may also contain suitable stabilizers or agents that
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions. Alternatively, the
active ingredient may be in powder form for constitution with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0130] As mentioned above, the compositions of the present
invention may also be formulated as a depot preparation. Such long
acting formulations may be administered by implantation (for
example, subcutaneous or intramuscular) or by intramuscular
injection. Thus, for example, the present compounds may be
formulated with suitable polymeric or hydrophobic materials (for
example as an emulsion in an acceptable oil) or ion exchange
resins, or as sparingly soluble derivatives, for example, as a
sparingly soluble salt.
[0131] Suitable carriers for the hydrophobic molecules of the
invention are well-known in the art and include co-solvent systems
comprising, for example, benzyl alcohol, a nonpolar surfactant, a
water-miscible organic polymer, and an aqueous phase. The
co-solvent system may be the VPD co-solvent system. VPD is a
solution of 3% w/v benzyl alcohol, 8% w/v of the nonpolar
surfactant polysorbate 80, and 65% w/v polyethylene glycol 300,
made up to volume in absolute ethanol. The VPD co-solvent system
(VPD:5W) consists of VPD diluted 1:1 with a 5% dextrose in water
solution. This co-solvent system is effective in dissolving
hydrophobic compounds and produces low toxicity upon systemic
administration. Naturally, the proportions of a co-solvent system
may be varied considerably without destroying its solubility and
toxicity characteristics. Furthermore, the identity of the
co-solvent components may be varied. For example, other
low-toxicity nonpolar surfactants may be used instead of
polysorbate 80, the fraction size of polyethylene glycol may be
varied, other biocompatible polymers may replace polyethylene
glycol, e.g., polyvinyl pyrrolidone, and other sugars or
polysaccharides may substitute for dextrose.
[0132] Alternatively, other delivery systems for hydrophobic
molecules may be employed. Liposomes and emulsions are well known
examples of delivery vehicles or carriers for hydrophobic drugs.
Liposomal delivery systems are discussed above in the context of
gene-delivery systems. Certain organic solvents such as
dimethylsulfoxide also may be employed, although usually at the
cost of greater toxicity. Additionally, the compounds may be
delivered using sustained-release systems, such as semi-permeable
matrices of solid hydrophobic polymers containing the effective
amount of the composition to be administered. Various
sustained-release materials are established and available to those
of skill in the art. Sustained-release capsules may, depending on
their chemical nature, release the compounds for a few weeks up to
over 100 days. Depending on the chemical nature and the biological
stability of the therapeutic reagent, additional strategies for
protein stabilization may be employed.
[0133] For any composition used in the present methods of
treatment, a therapeutically effective dose can be estimated
initially using a variety of techniques well known in the art. For
example, based on information obtained from a cell culture assay, a
dose can be formulated in animal models to achieve a circulating
concentration range that includes the IC.sub.50. Similarly, dosage
ranges appropriate for human subjects can be determined, for
example, using data obtained from cell culture assays and other
animal studies.
[0134] A therapeutically effective dose of an agent refers to that
amount of the agent that results in amelioration of symptoms or a
prolongation of survival in a subject. Toxicity and therapeutic
efficacy of such molecules can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., by determining the LD.sub.50 (the dose lethal to 50% of the
population) and the ED.sub.50 (the dose therapeutically effective
in 50% of the population). The dose ratio of toxic to therapeutic
effects is the therapeutic index, which can be expressed as the
ratio LD.sub.50/ED.sub.50. Agents that exhibit high therapeutic
indices are preferred.
[0135] Dosages preferably fall within a range of circulating
concentrations that includes the ED.sub.50 with little or no
toxicity. Dosages may vary within this range depending upon the
dosage form employed and the route of administration utilized. The
exact formulation, route of administration, and dosage should be
chosen, according to methods known in the art, in view of the
specifics of a subject's condition.
[0136] Dosage amount and interval may be adjusted individually to
provide plasma levels of the active moiety that are sufficient to
modulate HIF.alpha. stabilization and HIF-regulated gene induction,
as desired, i.e., minimal effective concentration (MEC). The MEC
will vary for each compound but can be estimated from, for example,
in vitro data. Dosages necessary to achieve the MEC will depend on
individual characteristics of the compound and the route of
administration. Agents or compositions thereof should be
administered using a regimen which maintains plasma levels above
the MEC for about 10-90% of the duration of treatment, preferably
about 30-90% of the duration of treatment, and most preferably
between 50-90%. In cases of local administration or selective
uptake, the effective local concentration of the drug may not be
related to plasma concentration.
[0137] The amount of agent or composition administered will, of
course, be dependent on a variety of factors, including the sex,
age, and weight of the subject being treated, the severity of the
affliction, the manner of administration, and the judgment of the
prescribing physician.
[0138] The present compositions may, if desired, be presented in a
pack or dispenser device containing one or more unit dosage forms
containing the active ingredient. Such a pack or device may, for
example, comprise metal or plastic foil, such as a blister pack.
The pack or dispenser device may be accompanied by instructions for
administration. Compositions comprising a compound of the invention
formulated in a compatible pharmaceutical carrier may also be
prepared, placed in an appropriate container, and labeled for
treatment of an indicated condition. Suitable conditions indicated
on the label may include treatment of disorders or diseases in
which ischemia or hypoxia is a major indication.
Compound Screening and Identification
[0139] The present invention further provides methods of screening
for and identifying additional compounds that inhibit HIF.alpha.
hydroxylation, or that stabilize HIF.alpha., etc.
[0140] Various assays and screening techniques, including those
described below, can be used to identify small molecules that
modulate (e.g., increase or decrease) the level or activity of
HIF.alpha.. Assays will typically provide for detectable signals
associated with the consumption of a reaction substrate or
production of a reaction product. Detection can involve, for
example, fluorophores, radioactive isotopes, enzyme conjugates, and
other detectable labels well known in the art. The results may be
qualitative or quantitative. Isolation of the reaction product may
be facilitated by a label, such as biotin or a histidine tag that
allows purification from other reaction components via
precipitation or affinity chromatography.
[0141] Assays for HIF.alpha. hydroxylation may involve measuring
hydroxylated proline or lysine residues in HIF.alpha. or a fragment
thereof (see, e.g., Palmerini et al. (1985) J Chromatogr
339:285-292), or measuring formation of succinate from
2-oxoglutarate in the presence of enzyme and HIF.alpha. or a
fragment thereof (see, e.g., Cunliffe et al. (1986) Biochem J
240:617-619). Exemplary procedures that measure HIF.alpha.
hydroxylation are described in Ivan et al. (supra) and Example 10.
An exemplary procedure that measures production of succinate from
2-oxoglutarate is described by Kaule and Gunzler. (1990; Anal
Biochem 184:291-297.) Substrate molecules may include HIF-.alpha.
or a fragment thereof, e.g., HIF(556-575); for example, an
exemplary substrate for use in the assay described in Example 10 is
[methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO:5). Enzyme
may include, e.g., HIF.alpha. prolyl hydroxylase (see, e.g.,
GenBank Accession No. AAG33965, etc.), obtained from any source.
Enzyme may also be present in a crude cell lysate or in a partially
purified form. Compounds that stabilize HIF.alpha. or that inhibit
hydroxylation of HIF.alpha. a may be identified by measuring and
comparing enzyme activity in the absence and presence of the
compound.
[0142] Additionally and in combination with the above methods,
compounds can be identified by any of a variety of screening
techniques known in the art. Such screening methods may allow for
target polypeptides or the compounds to be free in solution,
affixed to a solid support, borne on a cell surface, or located
within a cell. For example, test compounds may be arrayed on a
surface and analyzed for activity in a manner analogous to array
methods currently available in the art. (See, e.g., Shalon et al.
(1995) International Publication No. WO 95/35505; Baldeschweiler et
al. (1995) International Publication No. WO 95/251116; Brennan et
al. (1995) U.S. Pat. No. 5,474,796; and Heller et alt (1997) U.S.
Pat. No. 5,605,662.)
[0143] These and other embodiments of the present invention will
readily occur to those of ordinary skill in the art in view of the
disclosure herein, and are specifically contemplated.
EXAMPLES
[0144] The invention is understood by reference to the following
examples, which are intended to be purely exemplary of the
invention. The present invention is not limited in scope by the
exemplified embodiments, which are intended as illustrations of
single aspects of the invention only. Any methods that are
functionally equivalent are within the scope of the invention.
Various modifications of the invention in addition to those
described herein will become apparent to those skilled in the art
from the foregoing description and accompanying figures. Such
modifications fall within the scope of the appended claims.
Example 1
HIF.alpha. Stabilization in Cells In Vitro
[0145] Human cells derived from adenovirus-transformed fetal kidney
epithelium (293A), cervical epithelial adenocarcinoma (HeLa),
hepatocellular carcinoma (Hep3B), foreskin fibroblast (HFF),
mammary gland epithelial adenocarcinoma (MCF7), umbilical vein
endothelium (HUVEC), microvascular endothelium (HMEC-1), squamous
carcinoma (SSC-25), lung fibroblast (HLF), and venous endothelium
(AG10774B) tissues (see, e.g., American Type Culture Collection,
Manassas Va.; and Qbiogene, Carlsbad Calif.) were separately seeded
into 35 mm culture dishes and gown at 37.degree. C., 20% O.sub.2,
5% CO.sub.2 in media as follows: HeLa cells in Dulbecco's
Modification of Eagle's Medium (DMEM), 2% fetal bovine serum (FBS);
HFF and HLF cells in DMEM, 10% FBS; 293A cells in DMEM, 5% FBS;
HUVEC and AG10774B cells in Endothelial Growth Media (EGM-2;
BioWhittaker, Inc., Walkersville Md.); and HMEC-1 in RPMI 1640, 10%
FBS; and Hep3B cells in Minimal Essential Medium (MEM), Earle's BSS
(Mediatech Inc., Herndon Va.), 2 mM L-glutamine, 0.1 mM
non-essential amino acids, 1 mM sodium pyruvate, 10% FBS. When cell
layers reached confluence, the media was replaced with OPTI-MEM
media (Invitrogen Life Technologies, Carlsbad Calif.) and cell
layers were incubated for approximately 24 hours in 20% O.sub.2, 5%
CO.sub.2 at 37.degree. C. Compound of the invention (one of
compounds A to O) or DMSO (0.5 to 1%) was then added to existing
medium, and incubation was continued overnight.
[0146] Following incubation, the media was removed, centrifuged,
and stored for analysis (see below). The cells were washed two
times in cold phosphate buffered saline (PBS) and then lysed in 1
ml of 10 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 0.5% IGEPAL
(Sigma-Aldrich, St. Louis Mo.), and a protease inhibitor mix (Roche
Molecular Biochemicals) for 15 minutes on ice. Cell lysates were
centrifuged at 3,000.times.g for 5 minutes at 4.degree. C., and the
cytosolic fractions (supernatant) were collected. The nuclei
(pellet) were resuspended and lysed in 100 .mu.l of 20 mM HEPES (pH
7.2), 400 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, and a protease
mix (Roche Molecular Biochemicals), centrifuged at 13,000.times.g
for 5 minutes at 4.degree. C., and the nuclear protein fractions
(supernatant) were collected.
[0147] Nuclear fractions were normalized based on protein
concentration and loaded onto a 4-12% TG gel and fractionated under
reducing conditions. Proteins were transferred to a PVDF membrane
(Invitrogen Corp., Carlsbad Calif.) at 500 mA for 1.5 hours. The
membrane was blocked in T-TBS, 2% milk for 1 hour at room
temperature and incubated overnight with mouse anti-human
HIF-1.alpha. antibody (BD Biosciences, Bedford Mass.), diluted
1:250 in T-TBS, 2% milk. The blot was developed using SUPERSIGNAL
WEST chemiluminescent substrate (Pierce, Rockford Ill.). As can be
seen in FIGS. 1A, various compounds of the invention (Compounds A
to F) stabilized HIF.alpha. in a normoxic environment in a
dose-dependent manner, allowing HIF.alpha. to accumulate within the
cell. As seen in FIG. 1B, various cell types, including
fibroblasts, epithelial cells, endothelial cells, and hepatocytes
from various sources, showed dose-dependent stabilization of
HIF.alpha. when treated with a compound of the invention in a
normoxic environment.
[0148] Alternatively, nuclear and cytosolic fractions as prepared
above were analyzed for HIF-1.alpha. using a QUANTIKINE immunoassay
(R&D Systems, Inc., Minneapolis Minn.) according to the
manufacturer's instructions. As shown in FIG. 2A, epithelial cells
(293A) and hepatocytes (Hep3B) treated with various compounds of
the invention (Compounds B and G to O) showed stabilization and
accumulation of HIF.alpha. as compared to vehicle-treated control
cells. As shown in FIG. 2B, cells treated with compounds of the
invention showed dose-dependent stabilization of HIF.alpha..
Example 2
Effect on Oxygen Consumption
[0149] Oxygen Sensor cell culture plates (BD Biosciences, Bedford
Mass.) contain a ruthenium complex which is more fluorescent in the
absence of oxygen. Therefore, the fluorescent read-out is increased
by the presence of oxygen-consuming cells in the plate, which
change the equilibrium to lower oxygen saturation and higher
fluorescence. A compound that stabilizes HIP by inhibiting
hydroxylation is expected to decrease oxygen consumption by
decreasing oxygen consumed by the hydroxylation event itself and/or
by shifting cellular metabolism from aerobic to anaerobic energy
production.
[0150] Human cells derived from adenovirus-transformed fetal kidney
epithelium (293A) or cervical epithelial adenocarcinoma (HeLa)
(American Type Culture Collection) were grown to confluence in
media (high glucose DMEM (Mediatech, Inc., Herndon Va.), 1%
penicillin/streptomycin mixture (Mediatech), 1% fetal bovine serum)
at 37.degree. C., 10% CO.sub.2. Cells were collected and
resuspended in media at a density of 500,000 cells/ml. The cell
suspension was distributed at 0.2 ml/well into each well of an
Oxygen Biosensor 96-well cell culture plate (BD Biosciences). The
following treatments were added in 10 .mu.l volumes to triplicate
sets of wells: (1) 0.5% DMSO; (2) 200 .mu.M sodium dodecyl sulfate;
or (3) 1, 10, or 50 .mu.M compound (one of compounds B, G, or a
prodrug of compound V [pV]).
[0151] Cultures were incubated at 37.degree. C., 10% CO.sub.2 for
72 hours and plates were then read in an FL600 flourimeter (Biotek
Instruments, Inc., Winooski Vt.) at an excitation wavelength of 485
nm and emission wavelength of 590 nm. Data was plotted as a
function of fold change relative to DMSO control (O.sub.2
consumption) or absorbance at a wavelength of 450 nm n (WST-1) and
descriptive statistical analysis was performed using EXCEL software
(Microsoft Corporation, Bellevue Wash.).
[0152] FIG. 3A shows the fold change in oxygen consumtion in cells
treated with compound relative to control cells. As can be seen in
the figure, all of the compounds produced a decrease in oxygen
consumtion to some degree. Further, the reduction in oxygen
consumption was dose-dependent (FIG. 3A), and even at the highest
doses little to no loss of cell viability was detected (FIG. 1B).
Additional experiments (not shown) in various cell culture test
systems, including incorporation of .sup.3H-thymidine and total
incorporation of amino acids, confirmed that the decrease in oxygen
consumption was not associated with cytotoxicity.
Example 3
Expression of HIF-Regulated Genes In Vitro
[0153] Conditioned media collected from cell cultures grown as in
Example 1 was analyzed for vascular endothelial growth factor
(VEGF) expression using a QUANTIKINE immunoassay (R&D Systems)
according to the manufacturer's instructions. As seen in FIG. 4A,
fibroblasts (HFF), epithelial cells (293A), and hepatocytes (Hep3B)
treated with various compounds of the invention (one of compounds
A, B, C, H, K, L, Q, and a prodrug of compound V [pV]) showed an
increase in VEGF expression (FIG. 4A). Values on the y-axis
represent fold-induction relative to control and are reported on a
log.sub.2 scale, such that a value of 1 represents 2-fold
induction.
[0154] Alternatively, human cells derived from
adenovirus-transformed fetal kidney epithelium (293A) were cultured
in DMEM, 5% FBS, 1% Penicillin-Streptomycin at 37.degree. C. and
10% CO.sub.2. After 48 hours, the cells were harvested and were
plated confluent in 35 mm culture dishes in regular culture media,
and after 1 day the media was changed to Opti-Mem I. After 18 to 24
hours, compound B was added, to the media and incubation was
continued for an additional 18 hours. Culture supernatant was then
removed, the plates were placed on ice, lysis buffer (LB)-1 was
added and the cells were harvested by scraping. The scraped cells
were collected and incubated for 15 minutes on ice followed by
centrifugation at 3000 g for 5 minutes at 4.degree. C. The
supernatant, which represents the cytosolic fraction, was collected
and cytosolic proteins were separated under denaturing and reducing
conditions using SDS polyacrylamide gels that were loaded with
equal amounts of protein per lane.
[0155] Gel electrophoresis was conducted at 150 V for 2 hours, and
after SDS-PAGE the proteins were transferred to a PVDF membrane for
1.5 hours at 400 mA at 4.degree. C. The membrane was then incubated
in blocking buffer, washed once with T-TBS, and then anti-aldolase
antibody diluted to working concentration in blocking buffer was
added and the blots were incubated over night with gentle agitation
at 4C. The membrane was then washed 4 times with T-TBS, followed by
incubation for one hour at room temperature with blocking buffer
containing labeled secondary antibody. The membrane was then washed
four times with T-TBS. The antigen specific for the primary
antibody was visualized by exposing X-ray-film and developed using
the ECL SUPERSIGNAL WEST FEMTO or PICO chemiluminescent substrate
(Pierce, Rockford Ill.) according to the manufacturer's
instructions.
[0156] FIG. 4B shows that the compound increased expression of
aldolase, an enzyme involved in glycolysis, over time. Thus,
stabilization of HIF.alpha. by compounds of the invention leads to
subsequent increase in expression of HIF-regulated genes.
Example 4
HIF.alpha. Stabilization in Cells In Vivo
[0157] Swiss Webster male mice (30-32 g) are obtained, e.g., from
Charles River Laboratories, Inc. (Wilmington Mass.), or Simonsen,
Inc. (Gilroy, Calif.), and treated by oral gavage one or more times
per day for at least one day with a 2 ml/kg volume of either 0.5%
carboxymethyl cellulose (CMC; Sigma-Aldrich) (control) or 5.0%
compound (0.5% CMC). At one or more time points after the final
dose, e.g., two and five hours, animals are anesthetized with
isoflurane and 0.1 ml blood is collected, e.g., from the orbital
sinus into a heparinized tube. After all selected time points have
been reached, animals are subjected to a sub-lethal dose of
CO.sub.2 and blood is collected from the abdominal vein into a
heparinized tube. All blood samples are stored at -80.degree.
C.
[0158] Tissues isolated from animals treated with compounds of the
invention as described above are analyzed for HIF.alpha. protein
levels as follows. Tissues are homogenized in 3 ml of 10 mM Tris
(pH 7.4), 1 mM EDTA, 150 mM NaCl, 0.5% IGEPAL (Sigma-Aldrich), and
a protease inhibitor mix (Roche Molecular Biochemicals) for 15
seconds using a POLYTRON PT-1200 homogenizer (Brinkmann
Instruments, Inc., Westbury N.Y.). Cell lysates are centrifuged at
3,000.times.g for 5 minutes at 4.degree. C., and the cytosolic
fraction (supernatant) is collected. The nuclei (pellet) are
resuspended and lysed in 100 .mu.l of 20 mM HEPES (pH 7.2), 400 mM
NaCl, 1 mM EDTA, 1 mM dithiothreitol, and a protease mix (Roche
Molecular Biochemicals), centrifuged at 13,000.times.g for 5
minutes at 4.degree. C., and the nuclear protein fraction
(supernatant) is collected.
[0159] Nuclear fractions are normalized based on protein
concentration and loaded onto a 4 to 12% TG gel and fractionated
under reducing conditions. Proteins are transferred to a PVDF
membrane (Invitrogen Life Technologies) at 500 mA for 1.5 hours.
The membrane is blocked in T-TBS, 2% milk for 1 hour at room
temperature and incubated overnight with anti-HIF.alpha. antibody
diluted in T-TBS, 2% milk. The blot is developed using SUPERSIGNAL
WEST PICO chemiluminescent substrate (Pierce, Rockford Ill.).
[0160] Alternatively, nuclear and cytosolic fractions as prepared
above are analyzed for HIF-1.alpha. using a QUANTIKINE immunoassay
(R&D Systems) according to the manufacturer's instructions.
Example 5
Expression of HIF-Regulated Genes in vivo
Experiment 1
[0161] Twenty four Swiss Webster male mice (30-32 g) were obtained
from Simonsen, Inc., and treated by oral gavage with a 4 ml/kg
volume of either 0.5% CMC (Sigma-Aldrich) (0 mg/kg/day) or 1.25%
Compound A (25 mg/ml in 0.5% CMC) (100 mg/kg). At 4, 8, 16, 24, 48,
or 72 hours after the final dose, animals were anesthetized with
isoflurane and a blood sample was collected from the abdominal
vein. The blood sample was collected into a MICROTAINER serum
separator tube (Becton-Dickinson, Franklin Lakes N.J.), incubated
at room temperature for 30 minutes, centrifuged at 8,000 rpm at
4.degree. C. for 10 min, and cell pellet was resuspended in
RNALATER solution (Ambion) and stored at -80.degree. C. The mice
were then sacrificed and tissue samples of kidney, liver, brain,
lung, and heart were isolated and stored in RNALATER solution
(Ambion) at -80.degree. C.
[0162] RNA isolation was carried out using the following protocol.
A 50 mg section of each organ was diced, 875 .mu.l of RLT buffer
(RNEASY kit, Qiagen Inc., Valencia Calif.) was added, and the
pieces were homogenized for about 20 seconds using a rotor-stator
POLYTRON homogenizer (Kinematica, Inc., Cincinnati Ohio). The
homogenate was micro-centrifuged for 3 minutes to pellet insoluble
material, the supernatant was transferred to a new tube and RNA was
isolated using an RNEASY kit (Qiagen) according to the
manufacturer's instructions. The RNA was eluted into 80 .mu.L of
water and quantitated with RIBOGREEN reagent (Molecular Probes,
Eugene Oreg.). Genomic DNA was then removed from the RNA using a
DNA-FREE kit (Ambion Inc., Austin Tex.) according to the
manufacturer's instructions. The absorbance at 260 and 280 nm was
measured to determine RNA purity and concentration.
[0163] Alternatively, tissue samples were diced and homogenized in
TRIZOL reagent (Invitrogen Life Technologies, Carlsbad Calif.)
using a rotor-stator POLYTRON homogenizer (Kinematica). Homogenates
were brought to room temperature, 0.2 volumes chloroform was added,
and samples were mixed vigorously. Mixtures were incubated at room
temperature for several minutes and then were centrifuged at 12,000
g for 15 min at 4.degree. C. The aqueous phase was collected and
0.5 volumes of isopropanol were added. Samples were mixed,
incubated at room temperature for 10 minutes, and centrifuged for
10 min at 12,000 g at 4.degree. C. The supernatant was removed and
the pellet was washed with 75% EtOH and centrifuged at 7,500 g for
5 min at 4.degree. C. Genomic DNA was then removed from the RNA
using a DNA-FREE kit (Ambion Inc., Austin Tex.) according to the
manufacturer's instructions. The absorbance at 260 and 280 nm was
measured to determine RNA purity and concentration.
[0164] RNA was precipitated in 0.3 M sodium acetate (pH 5.2), 50
ng/ml glycogen, and 2.5 volumes of ethanol for one hour at
-20.degree. C. Samples were centrifuged and pellets were washed
with cold 80% ethanol, dried, and resuspend in water. Double
stranded cDNA was synthesized using a T7-(dT)24 first strand primer
(Affymetrix, Inc., Santa Clara Calif.) and the SUPERSCRIPT CHOICE
system (Invitrogen) according to the manufacturer's instructions.
The final cDNA was extracted with an equal volume of 25:24:1
phenol:chloroform:isoamyl alcohol using a PHASE LOCK GEL insert
(Brinkman, Inc., Westbury N.Y.). The aqueous phase was collected
and cDNA was precipitated using 0.5 volumes of 7.5 M ammonium
acetate and 2.5 volumes of ethanol. Alternatively, cDNA was
purified using the GENECHIP sample cleanup module (Affymetrix)
according to the manufacturer's instructions.
[0165] Biotin-labeled cRNA was synthesized from the cDNA in an in
vitro translation (IVT) reaction using a BIOARRAY HighYield RNA
transcript labeling kit (Enzo Diagnostics, Inc., Farmingdale N.Y.)
according to the manufacturer's instructions. Final labeled product
was purified and fragmented using the GENECHIP sample cleanup
module (Affymetrix) according to the manufacturer's
instructions.
[0166] Hybridization cocktail was prepared by bringing 5 .mu.g
probe to 100 .mu.l in 1.times. hybridization buffer (100 mM MES, 1
M [Na.sup.+], 20 mM EDTA, 0.01% Tween 20), 100 .mu.g/ml herring
sperm DNA, 500 .mu.g/ml acetylated BSA, 0.03 nM control oligo B2
(Affymetrix), and 1.times. GENECHIP eukaryotic hybridization
control (Affymetrix). The cocktail was sequentially incubated at
99.degree. C. for 5 minutes and 45.degree. C. for 5 minutes, and
then centrifuged for 5 minutes. The Murine genome U74AV2 array
(MG-U74Av2; Affymetrix) was brought to room temperature and then
prehybridized with 1.times. hybridization buffer at 45.degree. C.
for 10 minutes with rotation. The buffer was then replaced with 80
.mu.l hybridization cocktail and the array was hybridized for 16
hours at 45.degree. C. at 60 rpm with counter balance. Following
hybridization, arrays were washed once with 6.times.SSPE, 0.1%
Tween 20, and then washed and stained using
R-phycoerythrin-conjugated streptavidin (Molecular Probes, Eugene
Oreg.), goat anti-streptavidin antibody (Vector Laboratories,
Burlingame Calif.), and a GENECHIP Fluidics Station 400 instrument
(Affymetrix) according to the manufacturer's micro.sub.--1v1
protocol (Affymetrix). Arrays were analyzed using a GENEARRAY
scanner (Affymetrix) and Microarray Suite software
(Affymetrix).
[0167] The Murine Genome U74AV2 array (Affymetrix) represents all
sequences (.about.6,000) in Mouse UniGene database build 74
(National Center for Biotechnology Information, Bethesda Md.) that
have been functionally characterized and approximately 6,000
unannotated expressed sequence tag (EST) clusters.
[0168] As seen in FIG. 5A, expression of genes encoding angiogenic
proteins was increased in a coordinated fashion after treatment
with a compound of the invention in lung, a representative organ.
Transcript patterns represented in the figure include VEGF-C,
Flt-1/VEGF receptor-1, adrenomedullin, endothelin-1, plasminogen
activator inhibitor (PAI)-1, and Cyr61. In the time course, mRNA
levels peak early, then return to control levels after 24 hours.
FIG. 5B shows the specific expression time course for two genes,
endothelin-1 and adrenomedullin, representative of the cluster of
genes shown in FIG. 5A. In similar experiments, a significant
increase was also seen for additional HIF-regulated genes
including, e.g., phosphofructokinase, enolase 1, lactate
dehydrogenase, glucose transporter 1, acyl CoA thioesterase, heme
oxygenase, transferrin receptor, IGFBP-1, nip3, nix, and cyclin
G3.
[0169] As can be seen in FIG. 7A, expression of genes encoding
glycolytic enzymes was increased in a coordinated fashion after
treatment with a compound of the invention in kidney, a
representative organ. Transcript patterns represented in the figure
include aldolase-A, enolase-1, glucose transporters (GluT)-1 and
-3, GAPDH, hexokinase-1 and -2, lactate dehydrogenase-A,
phosphofructokinase-L and -C, phosphoglycerate kinase-1, and
pyruvate kinase-M. In the time course, mRNA levels peak early, then
return to control levels after 24 hours. FIG. 7B shows the specific
expression time course for two genes, aldolase and
phosphofructokinase, representative of the cluster of genes shown
in FIG. 7A.
Experiment II
[0170] Twelve Swiss Webster male mice (30-32 g) were obtained from
Simonsen, Inc., and treated by oral gavage two times per day for
2.5 days (5 doses) with a 4 ml/kg volume of either 0.5% CMC
(Sigma-Aldrich) (0 mg/kg/day) or 2.5% compound (B or E; 25 mg/ml in
0.5% CMC) (200 mg/kg/day). Four hours after the final dose, animals
were anesthetized with isoflurane and a blood sample was collected
from the abdominal vein. The blood sample was collected into a
MICROTAINER serum separator tube (Becton-Dickinson), incubated at
room temperature for 30 minutes, centrifuged at 8,000 rpm at
4.degree. C. for 10 min., and then the serum fraction was processed
and analyzed for vascular endothelial growth factor (VEGF)
expression using a QUANTIKINE immunoassay (R&D Systems)
according to the manufacturer's instructions. The mice were then
sacrificed and approximately 150 mg of liver and each kidney were
isolated and stored in RNALATER solution (Ambion) at -20.degree.
C.
[0171] RNA isolation was carried out using the following protocol.
Tissue slices were cut into small pieces, 1.75 ml of RLT lysis
buffer (RNEASY kit; Qiagen) was added, and the pieces were
homogenized for about 20 seconds using a rotor-stator POLYTRON
homogenizer (Kinematica, Inc., Cincinnati Ohio). A 350 .mu.l volume
of homogenate was micro-centrifuged for 3 minutes to pellet
insoluble material, the supernatant was transferred to a new tube
and RNA was isolated using an RNEASY kit (Qiagen) according to the
manufacturer's instructions. The RNA was eluted into 80 .mu.L of
water and quantitated with RIBOGREEN reagent (Molecular Probes,
Eugene Oreg.). Genomic DNA was then removed from the RNA using a
DNA-FREE kit (Ambion) according to the manufacturer's instructions.
The absorbance at 260 and 280 nm was measured to determine RNA
purity and concentration.
[0172] cDNA synthesis was performed using 1 .mu.M random hexamer
primers, 1 .mu.g of total RNA, and OMNISCRIPT reverse transcriptase
(Qiagen), according to the manufacturer's instructions. Resulting
cDNA was diluted 5-fold with water to give 100 .mu.L final volume.
Analysis of the relative level of vascular endothelial growth
factor (VEGF) gene expression was performed by quantitative PCR
using a FASTSTART DNA MASTER SYBR GREEN I kit (Roche Molecular
Biochemicals) and VEGF-specific primers, using a LIGHTCYCLER system
(Roche Molecular Biochemicals), according to manufacturer's
instructions. Samples were heated to 94.degree. C. for 6 minutes
and then cycled through 95.degree. C. for 15 seconds, 60.degree. C.
for 5 seconds, and 72C for 10 seconds for a total of 42 cycles.
VEGF-specific primers were as follows:
TABLE-US-00001 (SEQ ID NO: 1) m-VEGF-F1 GTTGCAAGGCGAGGCAGCTT (SEQ
ID NO: 2) m-VEGF-R1 TGACGATGATGGCATGGTGGT
[0173] The relative level of 18S ribosomal RNA gene expression was
measured as a control. Quantitative PCR was performed using a
QUANTITECT SYBR GREEN PCR kit (Qiagen) and 18S rRNA-specific
primers, using a LIGHTCYCLER system (Roche Molecular Biochemicals),
according to manufacturer's instructions. Samples were heated to
950.degree. C. for 15 minutes and then cycled through 94.degree. C.
for 15 seconds, 60.degree. C. for 20 seconds, 72.degree. C. for 10
seconds for a total of 42 cycles. Ribosomal RNA-specific primers
were as follows:
TABLE-US-00002 (SEQ ID NO: 3) 18S-rat-2B TAGGCACGGCGACTACCATCGA
(SEQ ID NO: 4) 18S-rat-2A CGGCGGCTTTGGTGACTCTAGAT
[0174] Each PCR run included a standard curve and water blank. In
addition, a melt curve was run after completion of each PCR run to
assess the specificity of the amplification. VEGF gene expression
was normalized relative to the expression level of 18S ribosomal
RNA for that sample.
[0175] FIG. 6A shows compound E increased VEGF expression in kidney
and compound B increased VEGF expression in liver and kidney. As
can be seen in FIG. 6B, levels of VEGF in the plasma of animals
treated with compound are significantly increased relative to
untreated control animals at 2, 5, and 20 hours after the final
dose.
Example 6
Cardiac Ischemia
Experiment 1
[0176] Nwogu et al. (2001; Circulation 104:2216-2221) reported the
use of a compound of the invention following myocardial infarction.
Although the authors interpreted their results relative to the
compounds affect on fibrosis, the present invention clearly shows
that the primary benefit on heart performance is due to
stabilization of HIF.alpha.. Experiments are as described in Nwogu
et al. (supra) and as described below.
[0177] Seventy adult male Wistar rats (200-250 g) were
anaesthetized and subjected to left coronary artery occlusion to
produce acute myocardial infarction (AMI). Nine animals were
subjected to identical surgery without coronary artery ligation.
Twenty-four to forty-eight hours after surgery, electrocardiogram
(ECG) electrodes were applied to the paws and a 15 MHz linear probe
(Acuson Corp., Mountain View Calif.) was applied to the chest to
obtain short axis transthoracic echocardiography (2DE) images at
the mid-papillary muscle level. The probe was moved cephalad or
caudad and angulated until clear endocardial visualization of the
left ventricular cavity was detected. Images were obtained using
the Sequoia ultrasound system (Acuson). Animals with less than 20%
fractional shortening and regional wall motion abnormality on the
2DE were randomized to treatment with compound A (n=14) or vehicle
(n=12). The sham controls were also randomized to treatment with
compound A (n=4) or vehicle (n=5).
[0178] Animals were treated by gavage 2 times per day for the
duration of the experiment with compound A at 50 mg/kg or with
vehicle alone. Serum level of drug was determined periodically to
establish that treated animals received sufficient and consistent
amount of drug and that the measured levels were sufficient to
inhibit prolyl 4-hydroxylase, a representative 2-oxoglutarate
dioxygenase.
[0179] Serial 2DE images were obtained weekly. Three short axis 2DE
digital clips containing 5 or more systolic and diastolic frames
were captured and stored. Two observers blinded to treatment did
measurements off-line. For the measurements, the digital images
were slowed and frozen at end systole and end diastole. Two
systolic and two diastolic frames from each of the three digital
clips were measured by consensus and averaged. The anterior wall in
systole (AWS) and diastole (AWD), posterior wall in systole (PWS)
and diastole (PWD), and left ventricular end systolic (LVESD) and
end diastolic (LVEDD) were measured according to the American
Society for Echocardiology (ASE) leading-edge method. For
consistency, measurements were done from the anterior to the
posterior mid points of the left ventricular cavity and were
randomly repeated to ensure reproducibility (reproducibility was
approximately 96%).
[0180] At four weeks of treatment, in vivo hemodynamic measurements
were determined, as described below, both before and after infusion
(0.2 ml over 1 minute) of 10.sup.7 M isoproterenol via the femoral
vein. Hearts were then excised and weighed as described below.
[0181] Alternatively, one hundred forty adult male Wistar rats
(200-250 g) were anaesthetized and subjected to left coronary
artery occlusion to produce AMI. Forty-eight hours after surgery,
2DE images were obtained and animals with a significant area of
infarction were randomized to treatment with compound A (n=34) or
vehicle (n=34).
[0182] Animals were treated by gavage 2 times per day for the
duration of the experiment with compound A at 50 mg/kg or with
vehicle alone. Serum level of drug was determined periodically to
establish that treated animals received sufficient and consistent
amount of drug and that the measured levels were sufficient to
inhibit prolyl 4-hydroxylase.
[0183] Digital mid-papillary muscle and apical four chamber 2DE
images were obtained biweekly on half of the animals in each group
until week 8. Two observers blinded to treatment did measurements
off-line. For the measurements, the digital images were slowed and
frozen at end systole and end diastole. Two to three endocardial
surfaces were traced in both the short axis and four chamber views
and averaged. The left venticular area in systole and diastole,
ejection fraction, fractional area change, wall thickness, mitral
peak E wave velocity, aortic peak velocity, and infarct size were
measured.
[0184] After 10 weeks of treatment, in vivo hemodynamic
measurements were determined and hearts were excised and weighed as
described below.
[0185] To collect in vivo hemodynamic measurements, animals were
anaesthetized and the right carotid artery was dissected free from
surrounding tissues and canulated with an SPR-671 ultra-miniature
pressure transducer (Millar Instruments, Inc., Houston Tex.). The
catheter was then advanced into the left ventricle. After steady
state was established, baseline heart rate (HR), developed pressure
(DP), contractile index (CI), left ventricle systolic pressure
(SBP) and end diastolic pressure (LVEDP), and maximal rate of
pressure rise and fall (+dP/dt and -dP/dt, respectively) were
recorded.
[0186] Following hemodynamic measurement, hearts were excised and
weighed. Pieces of scarred myocardium, and right ventricle and left
ventricle myocardium distant from the site of infarct were
dissected out and weighed. Hydroxyproline and proline were
determined by the method of Palmerini et al. (1985, J Chromatogr
339:285-92) except that L-azetidine-2-carboxylic acid
(Sigma-Aldrich) was substituted for 3,4-dehydroproline as the
internal standard.
[0187] An immediate reduction in mortality was seen when compounds
of the invention were administered following myocardial infarction.
As can be seen in FIG. 8, no deaths were seen in the treated group
immediately following insult to the heart, and over 90% of the
treated group was still alive 8 weeks later. In comparison, only
about 60% of the untreated group survived this period.
Statistically significant improvement in survival (P<0.05) in
the treated group relative to untreated group was seen at weeks 2
through 8, with a relative reduction in mortality of 77%.
[0188] Heart parameters were also improved in the treated group
over the untreated group. Table 1 shows no increase in left
ventricle end diastolic diameter (LVEDD) in the treated group,
whereas the untreated group shows an increase in both LVEDD and
left ventricle end systolic diameter (LVESD) measures over the same
time period. The dilation of the heart in the untreated group was
statistically different in the treated group relative to the
untreated group after 1 week of treatment.
TABLE-US-00003 TABLE 1 Changes in left ventricle end diastolic
diameter. Week Treated-MI (mm) Untreated-MI (mm) Sham (mm) 0 69
.+-. 1 67 .+-. 2 43 .+-. 3 1 68 .+-. 2 76 .+-. 2 44 .+-. 3 2 69
.+-. 3 74 .+-. 4 45 .+-. 2 3 68 .+-. 4 75 .+-. 3 45 .+-. 2 Values
in the table represent the mean .+-. standard deviation.
TABLE-US-00004 TABLE 2 Changes in left ventricle end systolic
diameter. Week Treated-MI (mm) Untreated-MI (mm) Sham (mm) 0 77
.+-. 2 75 .+-. 1 67 .+-. 2 1 82 .+-. 2 88 .+-. 1 65 .+-. 2 2 85
.+-. 2 86 .+-. 3 69 .+-. 2 3 85 .+-. 3 86 .+-. 2 68 .+-. 4 Values
in the table represent the mean .+-. standard deviation.
[0189] FIGS. 9A and 9B show graphical representations of the
increase in LVESD and LVEDD, respectively, over time. The left
ventricle end diastolic and systolic diameters were similar in the
three groups at the time of randomization. FIG. 10A shows
statistically significant improvement in left ventricular ejection
fraction (LVEF) in treated animals relative to untreated controls
in weeks 2 through 8. At randomization, the LVEF for both groups
was 33%. The apparent increase in LVEF between week 4 and week 6 in
the untreated control group reflects the high mortality in members
of this group.
[0190] Fractional shortening of the myocardium during contraction
was also improved in the treated group. Table 3 shows statistically
significant improvement in fractional shortening in the treated
group relative to the untreated group in weeks 1 to 4.
TABLE-US-00005 TABLE 3 Changes in fractional shortening. Weeks
Treated-MI (%) Untreated-MI (%) Sham (%) 0 10 .+-. 0.8 12 .+-. 1 34
.+-. 3 1 17 .+-. 1 13 .+-. 1 33 .+-. 3 2 20 .+-. 2 15 .+-. 2 33
.+-. 2 3 21 .+-. 2 12 .+-. 1 35 .+-. 2 4 21 .+-. 3 16 .+-. 2 36
.+-. 1 Values in the table represent the mean .+-. standard
deviation.
[0191] Further, as can be seen in FIG. 10B, fractional shortening
in the treated group increased from 10% at baseline to 20% at week
2, a 79% increase relative to baseline. Both the untreated group
and sham controls remained unchanged over the 4 week period.
[0192] The ability of the heart to contract and relax following
trauma induced by cardiac ischemia was also improved in the treated
group. Table 4A shows statistically significant differences in
negative change in pressure over time (-dP/dt), a measure of the
hearts ability to relax following contraction, in the treated group
relative to the untreated group following 4 weeks of treatment. As
shown in Table 4A and in FIG. 11, stimulation of the heart with
isoproterenol shows statistically significant differences in
positive change in pressure over time (+dP/dt), a measure of the
hearts ability to contract, in the treated group relative to the
untreated group.
TABLE-US-00006 TABLE 4A Hemodynamic data at 4 weeks post-MI.
Treated-MI Untreated-MI Sham Systolic BP (mmHg) baseline 143 .+-. 7
142 .+-. 3 144 .+-. 5 isoproterenol 130 .+-. 9 123 .+-. 7 197 .+-.
3 Developed pressure (mmHg) baseline 133 .+-. 6 133 .+-. 3 135 .+-.
6 isoproterenol 121 .+-. 9 115 .+-. 8 173 .+-. 3 +dP/dt (mmHg/sec)
baseline 9477 .+-. 581 8642 .+-. 209 9925 .+-. 1194 isoproterenol
16830 .+-. 1195 13832 .+-. 1097 21515 .+-. 1074 -dP/dt (mmHg/sec)
baseline 9978 .+-. 827 8009 .+-. 426 11578 .+-. 622 isoproterenol
9234 .+-. 703 8984 .+-. 622 11549 .+-. 10742 Values in the table
represent the mean .+-. standard deviation.
[0193] Table 4B shows statistically significant differences in both
+dP/dt and -dP/dt in the treated group relative to the untreated
group following 10 weeks of treatment.
TABLE-US-00007 TABLE 4B Hemodynamic data at 10 weeks post-MI.
Treated-MI Untreated-MI P-value Systolic BP (mmHg) 106 .+-. 4 92
.+-. 5 0.053 Developed pressure (mmHg) 97 .+-. 3 69 .+-. 14 0.031
+dP/dt (mmHg/sec) 6701 .+-. 331 4937 .+-. 828 0.042 -dP/dt
(mmHg/sec) 6395 .+-. 373 3641 .+-. 737 0.002 Values in the table
represent the mean .+-. standard deviation.
[0194] Significant improvement was also seen at 10 weeks in
developed pressure and systolic blood pressure in the treated group
relative to the untreated group.
[0195] While it is recognized that recovery from an initial infarct
requires connective tissue deposition within the necrotic region,
the present invention demonstrates no adverse affects of treatment
with respect to scar formation. On the contrary, as can be seen in
Table 5A, there is no statistically significant change in collagen
deposition in the scar and non-infarcted tissue at 4 weeks,
demonstrating the improvement in heart performance in the first 4
weeks is unrelated to collagen deposition.
TABLE-US-00008 TABLE 5A Collagen content in the heart at 4 weeks
post-MI. Treated-MI Untreated-MI Sham Hydroxyproline/proline 0.12
.+-. 0.06 0 18 .+-. 0.05 0.11 .+-. 0.02 in non-infarct left
ventricular myocardium Hydroxyproline/proline 0.13 .+-. 0.02 0.17
.+-. 0.03 0.15 .+-. 0.03 in non-infarct right ventricular
myocardium Hydroxyproline/proline 0.34 .+-. 0.08 0.45 .+-. 0.09 --
in infarct scar Values in the table represent the mean .+-.
standard deviation.
[0196] However, as can be seen in Table 5B, there is a
statistically significant absolute reduction in the collagen
content of the non-infarcted myocardium and scar tissue of the
treated group relative to the untreated group at 10 weeks,
demonstrating that the methods of the present invention do reduce
reactive cardiac fibrosis over a longer time course.
TABLE-US-00009 TABLE 5B Collagen content in the heart at 10 weeks
post-MI. Treated-MI Untreated-MI P-value Hydroxyproline/proline
0.099 .+-. 0.025 0.135 .+-. 0.036 <0.05 in non-infarct left
ventricular myocardium Hydroxyproline/proline 0.152 .+-. 0.044
0.175 .+-. 0.042 -- in non-infarct right ventricular myocardium
Hydroxyproline/proline 0.471 .+-. 0.024 0.638 .+-. 0.020 <0.05
in infarct scar Values in the table represent the mean .+-.
standard deviation.
Experiment II
[0197] Male Wistar rats (100-110 g), aged 4-5 weeks, were kept on a
regular diet and a 12 hour day-night cycle. The animals were
randomized into treatment regimens as follows: (1) Sham operated
animals (n=12), (2) myocardial infarction controls (n=25), and (3)
myocardial infarction with compound B treatment (n=25). Animals
were treated for two days prior to surgery and for one week
following surgery. Animals were treated by oral gavage two times
per day with either 0.5% CMC (Sigma-Aldrich) (control) or 50 mg/kg
compound B in 0.5% CMC. Ligation of the left anterior descending
coronary artery was performed in artificially ventilated animals
after left throacotomy. Animals were sacrificed one week after
surgery and echocardiography was performed. Fractional shortening,
end-diastolic diameters, and end-systolic diameters were determined
in a blinded fashion.
[0198] As can be seen in FIG. 12A, fractional shortening was
reduced from 51% in sham-operated animals to 29% in untreated MI
controls. Treatment with compound showed a statistically
significant (p<0.05; one-way ANOVA/Turey's test) improvement in
fractional shortening, to 41%, relative to the untreated control
group. Similarly, FIG. 12B shows statistically significant
improvement in left ventricular end-diastolic (LVEDD) and
end-systolic (LVESD) diameters in treated animals relative to
untreated MI controls (p<0.005 and p<0.001, respectively;
one-way ANOVA/Turey's test). Animals treated with compound showed
no increase in left ventricular end-systolic diameter and an 18%
increase in end-diastolic diameter over sham operated animals. The
untreated controls, however, showed a 15% and 65% increase in LVESD
and LVEDD, respectively.
Example 7
Liver Ischemia
[0199] Bickel et al. (1998; Hepatology 28:404-411) reported the use
of a compound of the invention following induction of
toxic-ischemic injury in the liver. Although the authors
interpreted their results relative to the effect of the compounds
on fibrosis, the authors acknowledged that the beneficial effects
on variables of liver function including serum levels of bilirubin,
bile acids, and alkaline phosphatase could not be directly
attributed to a reduction in fibrosis.
[0200] The model of toxic-ischemic liver injury was described in
Bickel et al. (supra). Briefly, male Wistar rats (212-320 g) either
received 1 ml/kg carbon tetrachloride (CCl.sub.4) in olive oil
(1:1) by gavage twice weekly for nine weeks (n=140) or received no
treatment (controls; a=10). Additionally, a group of animals
receiving CCl.sub.4 (n=60) also received compound P. The compound
was administered by intraperitoneal injection twice daily at 60 mg
compound/2 ml saline/kg body weight. After 9 weeks, the animals
were sacrificed and the liver was weighed. Bilirubin, alanine
transaminase, alkaline phosphatase, albumin, and total bile acids
in serum were determined using commercially available kits.
[0201] As can be seen in Table 6 (Bickel et al., supra, Table 2),
induction of liver damage produced a significant reduction in body
weight (BW), although no significant change in liver weight was
seen (not shown).
TABLE-US-00010 TABLE 6 Serum parameters of liver function after 9
weeks of treatment. Treatment N BW (g) BR (.mu.mol/L) tBA
(.mu.mol/L) ALT (U/L) AP (U/L) Control 10 425 .+-. 66.9 2.00 .+-.
0.50 8.48 .+-. 8.40 27.5 .+-. 10.9 156 .+-. 57.5 CCl.sub.4 80 370
.+-. 43.3 4.34 .+-. 3.93 81.3 .+-. 87.9 83.1 .+-. 51.7 269 .+-. 117
CCl.sub.4 + CPD 60 373 .+-. 38.9 2.83 .+-. 2.21 40.8 .+-. 51.4 59.0
.+-. 29.5 195 .+-. 72.7 Values in the table represent the mean .+-.
standard deviation.
[0202] Liver damage also produced a measurable and statistically
significant decrease in liver function as determined by serum
levels of bilirubin (BR), total bile acids (tBA), alanine
transaminase (ALT), and alkaline phosphatase (AP), which increased
117%, 856%, 201%, and 72%, respectively. However, treatment with a
compound of the invention (CPD) produced statistically significant
improvement in liver function. Serum levels of BR, tBA, ALT, and AP
decreased 64%, 65%, 43%, and 65%, respectively, in the treated
group relative to the untreated group. The improvement in liver
function is attributed to stabilization of HIF.alpha. by the
methods of the invention.
Example 8
Renal Ischemia-Reperfusion Injury
[0203] The model of ischemic acute renal failure was described in
Nemoto et al. (2001, Kidney Int 59:246-251.) Briefly, male
Sprague-Dawley rats (200-250 g) were treated with either 0.5%
carboxymethyl cellulose (CMC; Sigma-Aldrich) or 1.5% compound B
suspended in CMC by oral gavage in a volume of 4 ml/kg/day. Rats
were pretreated daily for 4 consecutive days (days -3 to 0). A few
hours after the fourth and last oral dose on day 0, renal
ischemia-reperfusion injury (IRI) was performed.
[0204] Animals were divided into four groups: (1) Vehicle
pretreatment and sham surgery; (2) compound B pretreatment and sham
surgery; (3) vehicle pretreatment and IRI surgery; and (4) compound
B pretreatment and IRI surgery. Animals were anesthetized under
isoflurane, an incision was made in the abdominal midline, and the
renal pedicles were bluntly dissected. A vascular clip was placed
on the right renal pedicle for 45 minutes while the left kidney
underwent simultaneous nephrectomy. After each occlusion, the clip
was released at 45 minutes, and reperfusion was observed by the
changing color of the kidney. Temperature was maintained constant,
and warm saline (0.5% of body weight) containing Buprenex analgesic
was administered directly into abdomen before the incision was
completely sutured.
[0205] The animal body weight and mortality were monitored. Blood
samples were obtained from the tail vein, and serum chemistry and
CBC were measured by IDEXX veterinary service (West Sacramento
Calif.). Data are presented as mean.+-.SE with number of animals in
parenthesis. The data were compared within the four groups at each
time point using one-way analysis of variance (ANOVA, SIGMASTAT)
and Student-Newman-Keuls method. A value of P<0.05 was
considered significant.
[0206] As can be seen in FIG. 13, treatment with the compound
prevented early mortality associated with ischemic-reperfusion
injury. Further, serum blood urea nitrogen (BUN), a gauge of renal
function, was significantly elevated by renal IRI at both 3 and 7
days, whereas treatment with compound produced significantly less
IRI-induced increase in BUN. (FIG. 14A.) Additionally, serum
cholesterol was significantly elevated by renal IRI at days 3, 7
and 14, whereas treatment with compound completely blocked
IRI-induced increase in serum cholesterol. (FIG. 14B.) Although the
reasons are still under investigation, elevated kidney cholesterol
is a natural reflection of renal ischemic-reperfusion injury.
(Zager et al. (2001) Am J Pathol 159:743-752; Appel (1991) Kidney
Int 39:169-183; and Abdel-Gayoum et al. (1999) Hum Exp Toxicol
18:454-459.)
Example 9
Enhanced Granulation Tissue Formation in Chronic Wounds
[0207] The ability to treat chronic wounds utilized the rabbit
cutaneous hypertrophic scarring model described in Morris et al.
(1997, Plast Reconstr Surg 100:674-681) and Marcus et al. (2000,
Plast Reconstr Surg 105:1591-1599). Briefly, female New Zealand
White rabbits (n=12; 3-6 months of age) were anesthetized and four,
7-mm dermal ulcer wounds were created on the ventral surface of
each ear with removal of the perichondrium. Wounds were treated and
covered with TEGADERM semi-occlusive polyurethane dressing (3M
Health Care, St. Paul Minn.). Wounds were treated by topical
application of 0.5% or 1% (w/v) a prodrug of compound V [pV] in an
aqueous 0.5% (w/v) CARBOPOL 971 PNF gel (pH 6.5; Noveon Inc.,
Cleveland Ohio) once per day for the first week. When tested in
vitro, gels released 50% of the drug within 2 hrs and 95% of the
drug within 4 hrs. The treatment ear received either a low-dose
treatment (0.5% compound) or a high dose treatment (1% compound),
while the control ear received gel alone. Treatment delivery was
facilitated by creating a hole in the dressing applied at the time
of wounding to prevent irritation of the area surrounding the wound
by daily removal of dressing. The hole was then covered by a
smaller piece of dressing to prevent wound desiccation. Wounds with
obvious desiccation or infection were excluded from the study.
[0208] At post-wounding days 7 and 12, wounds were harvested,
bisected, and stained with hemotoxylin-eosin for evaluation of
granulation tissue formation and wound epithelialization. Observers
blinded to treatment quantitated wound healing parameters in
histological sections by the use of a graduated eyepiece reticle.
Data were analyzed using the Student's t-test to compare treated
and untreated samples. A P<0.05 was considered significant.
[0209] The wounds were evaluated for granulation tissue formation
and wound epithelialization; parameters of wound healing that are
sensitive ischemia and hypoxia. (Corral et al. (1999) Arch Surg
134:200-205; and Ahn and Mustoe (1990) Ann Plast Surg 24:17-23.) As
shown in FIG. 5A, an increase in granulation tissue area was seen
in treated wounds relative to untreated wounds. As can be seen in
FIG. 15B, there was no difference in the peak-to-peak distance in
treated versus untreated animals. The peak-to-peak value is an
indicator of wound coverage by granulation tissue. Thus, the
methods of the invention can be used to increase vascularization
and granulation tissue formation in wounds, such as chronic wounds
and ulcers.
Example 10
Screening Assay
[0210] Compounds that inhibit HIF-specific prolyl hydroxylase
activity and thereby stabilize HIF.alpha. can be identified and
characterized using the following assay. A 50 .mu.l aliquot of a
reaction mix containing 4 mg/ml BSA, 0.1 M Tris HCl (pH 7.2), 2 mM
ascorbate, 80 .mu.M ferrous sulfate, 0.2 mM 2-oxoglutarate, 600
units/ml catalase, with or without 100 .mu.M HIF.alpha. peptide is
mixed with 50 .mu.l HeLa cell extract or purified HIF prolyl
hydroxylase and incubated 1.5 hours at 37.degree. C. Following
incubation, 50 .mu.l of streptavidin beads are added and the
mixture is incubated for 1 hour with agitation at 4C. The mixture
is transferred to tubes and centrifuged at low speed to pellet the
beads. The beads are washed three times with 0.5 to 1 ml 20 mM Tris
HCl (pH 7.2). The peptide is then eluted from the beads with 5
.mu.l 2 mM biotin in 20 mM Tris HCl (pH 7.2) for 1 hour. The tubes
are centrifuged to pellet the resin and 40-50 .mu.l of supernatant
is removed and an equal volume of acetonitrile is added.
Alternatively, the peptide is attached to methoxycoumarin, a pH
insensitive fluorophore. The fluorophore may provide sensitivity
and specificity to enhance detection in assays run with crude cell
lysate. An exemplary HIF peptide for use in the screening assay may
comprise [methoxycoumarin]-DLDLEALAPYIPADDDFQL-amide (SEQ ID NO:5).
The non-hydroxylated and hydroxylated peptides are then separated
by reverse-phase HPLC on a C18 column with UV detection at 214
nm.
[0211] Various modifications of the invention, in addition to those
shown and described herein, will become apparent to those skilled
in the art from the foregoing description. Such modifications are
intended to fall within the scope of the appended claims.
[0212] All references cited herein are hereby incorporated by
reference herein in their entirety.
Sequence CWU 1
1
5120DNAMus musculus 1gttgcaaggc gaggcagctt 20221DNAMus musculus
2tgacgatgat ggcatggtgg t 21322DNARattus norvegicus 3taggcacggc
gactaccatc ga 22423DNARattus norvegicus 4cggcggcttt ggtgactcta gat
23519PRTArtificial SequenceSynthetic Peptide 5Asp Leu Asp Leu Glu
Ala Leu Ala Pro Tyr Ile Pro Ala Asp Asp Asp 1 5 10 15 Phe Gln
Leu
* * * * *