U.S. patent application number 13/862626 was filed with the patent office on 2013-08-22 for method for the production of 1-butanol.
This patent application is currently assigned to Butamax(TM) Advanced Biofuels LLC. The applicant listed for this patent is Butamax(TM) Advanced Biofuels LLC. Invention is credited to Michael G. Bramucci, Dennis Flint, Edward S. Miller, JR., Vasantha Nagarajan, Natalia Sedkova, Manjari Singh, Tina K. Van Dyk.
Application Number | 20130217060 13/862626 |
Document ID | / |
Family ID | 39643017 |
Filed Date | 2013-08-22 |
United States Patent
Application |
20130217060 |
Kind Code |
A1 |
Bramucci; Michael G. ; et
al. |
August 22, 2013 |
METHOD FOR THE PRODUCTION OF 1-BUTANOL
Abstract
A method for the production of 1-butanol by fermentation using a
microbial production host is disclosed. The method employs a
reduction in temperature during the fermentation process that
results in a more robust tolerance of the production host to the
butanol product.
Inventors: |
Bramucci; Michael G.;
(Boothwyn, PA) ; Flint; Dennis; (Newark, DE)
; Miller, JR.; Edward S.; (Knoxville, TN) ;
Nagarajan; Vasantha; (Wilmington, DE) ; Sedkova;
Natalia; (Cherry Hill, NJ) ; Singh; Manjari;
(West Chester, PA) ; Van Dyk; Tina K.;
(Wilmington, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Butamax(TM) Advanced Biofuels LLC; |
|
|
US |
|
|
Assignee: |
Butamax(TM) Advanced Biofuels
LLC
Wilmington
DE
|
Family ID: |
39643017 |
Appl. No.: |
13/862626 |
Filed: |
April 15, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12110503 |
Apr 28, 2008 |
8426173 |
|
|
13862626 |
|
|
|
|
60915455 |
May 2, 2007 |
|
|
|
Current U.S.
Class: |
435/29 ;
435/252.3; 435/252.31; 435/252.32; 435/252.33; 435/252.34;
435/254.2; 435/254.21; 435/254.22; 435/254.23 |
Current CPC
Class: |
Y02E 50/10 20130101;
C12N 15/70 20130101; C12Y 402/01017 20130101; C12N 15/74 20130101;
C12Y 402/01055 20130101; C12Y 103/01044 20130101; C12Y 103/01038
20130101; C12P 7/16 20130101 |
Class at
Publication: |
435/29 ;
435/252.3; 435/252.33; 435/252.34; 435/252.31; 435/252.32;
435/254.2; 435/254.21; 435/254.23; 435/254.22 |
International
Class: |
C12N 15/74 20060101
C12N015/74; C12N 15/70 20060101 C12N015/70 |
Claims
1-27. (canceled)
28. A recombinant microbial host cell comprising DNA molecules
encoding polypeptides that catalyze each of the following substrate
to product conversions: i) acetyl-CoA to acetoacetyl-CoA; ii)
acetoacetyl-CoA to 3-hydroxybutyryl-CoA; iii) 3-hydroxybutyryl-CoA
to crotonyl-CoA; iv) crotonyl-CoA to butyryl-CoA; v) butyryl-CoA to
butyraldehyde; and vi) butyraldehyde to 1-butanol; wherein the
polypeptide that catalyzes the substrate to product conversion of
acetyl-CoA to acetoacetyl-CoA is acetyl-CoA acetyltransferase; the
polypeptide that catalyzes the substrate to product conversion of
acetoacetyl-CoA to 3-hydroxybutyryl-CoA is 3-hydroxybutyryl-CoA
dehydrogenase; the polypeptide that catalyzes the substrate to
product conversion of 3-hydroxybutyryl-CoA to crotonyl-CoA is
crotonase; the polypeptide that catalyzes the substrate to product
conversion of crotonyl-CoA to butyryl-CoA is butyryl-CoA
dehydrogenase; the polypeptide that catalyzes the substrate to
product conversion of butyryl-CoA to butyraldehyde is butyraldehyde
dehydrogenase; and the polypeptide that catalyzes the substrate to
product conversion of butyraldehyde to 1-butanol is butanol
dehydrogenase.
29. The recombinant microbial host cell of claim 28, wherein the
acetyl-CoA acetyltransferase has an amino acid sequence having at
least 95% identity to an amino acid sequence selected from the
group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 129, SEQ
ID NO: 131, and SEQ ID NO: 133 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight
matrix.
30. The recombinant microbial host cell of claim 28, wherein the
3-hydroxybutyryl-CoA dehydrogenase has an amino acid sequence
having at least 95% identity to an amino acid sequence selected
from the group consisting of SEQ ID NO: 6, SEQ ID NO: 135, SEQ ID
NO: 137, and SEQ ID NO: 139 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight
matrix.
31. The recombinant microbial host cell of claim 28, wherein the
crotonase has an amino acid sequence having at least 95% identity
to an amino acid sequence selected from the group consisting of SEQ
ID NO: 8, SEQ ID NO: 141, SEQ ID NO: 143, and SEQ ID NO: 145 based
on the Clustal W method of alignment using the default parameters
of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of
protein weight matrix
32. The recombinant microbial host cell of claim 28, wherein the
butyryl-CoA dehydrogenase has an amino acid sequence having at
least 95% identity to an amino acid sequence selected from the
group consisting of SEQ ID NO: 10, SEQ ID NO: 147, SEQ ID NO: 149,
SEQ ID NO: 151, and SEQ ID NO: 187 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight
matrix.
33. The recombinant microbial host cell of claim 28, wherein the
butyraldehyde dehydrogenase has an amino acid sequence having at
least 95% identity to an amino acid sequence selected from the
group consisting of SEQ ID NO: 12, SEQ ID NO: 153, and SEQ ID NO:
189 based on the Clustal W method of alignment using the default
parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet
250 series of protein weight matrix.
34. The recombinant microbial host cell of claim 28, wherein the
butanol dehydrogenase has an amino acid sequence having at least
95% identity to an amino acid sequence selected from the group
consisting of SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 153, SEQ ID
NO: 155, and SEQ ID NO: 157 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight
matrix.
35. The recombinant microbial host cell of claim 28, wherein the
acetyl-CoA acetyltransferase has an amino acid sequence having at
least 95% identity to an amino acid sequence selected from the
group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 129, SEQ
ID NO: 131, and SEQ ID NO: 133 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix;
wherein the 3-hydroxybutyryl-CoA dehydrogenase has an amino acid
sequence having at least 95% identity to an amino acid sequence
selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 135,
SEQ ID NO: 137, and SEQ ID NO: 139 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix;
wherein the crotonase has an amino acid sequence having at least
95% identity to an amino acid sequence selected from the group
consisting of SEQ ID NO: 8, SEQ ID NO: 141, SEQ ID NO: 143, and SEQ
ID NO: 145 based on the Clustal W method of alignment using the
default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and
Gonnet 250 series of protein weight matrix; wherein the butyryl-CoA
dehydrogenase has an amino acid sequence having at least 95%
identity to an amino acid sequence selected from the group
consisting of SEQ ID NO: 10, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID
NO: 151, and SEQ ID NO: 187 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix;
wherein the butyraldehyde dehydrogenase has an amino acid sequence
having at least 95% identity to an amino acid sequence selected
from the group consisting of SEQ ID NO: 12, SEQ ID NO: 153, and SEQ
ID NO: 189 based on the Clustal W method of alignment using the
default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and
Gonnet 250 series of protein weight matrix; and wherein the butanol
dehydrogenase has an amino acid sequence having at least 95%
identity to an amino acid sequence selected from the group
consisting of SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 153, SEQ ID
NO: 155, and SEQ ID NO: 157 based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight
matrix.
36. The recombinant microbial host cell of claim 28, wherein the
recombinant microbial host cell is selected from the group
consisting of Clostridium, Zymomonas, Escherichia, Salmonella,
Rhodococcus, Pseudomonas, Bacillus, Lactobacillus, Enterococcus,
Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter,
Corynebacterium, Brevibacterium, Saccharomyces, Pichia, Candida,
and Hansenula.
37. The recombinant microbial host cell of claim 36, wherein the
recombinant microbial host cell is selected from the group
consisting of Escherichia coli, Alcaligenes eutrophus, Bacillus
licheniformis, Paenibacillus macerans, Rhodococcus erythropolis,
Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium,
Enterococcus gallinarium, Enterococcus faecalis, Bacillus subtilis,
and Saccharomyces cerevisiae.
38. A method to reduce the sensitivity of a recombinant microbial
host cell to 1-butanol comprising: a) providing a recombinant
microbial host cell which produces 1-butanol, wherein the
recombinant microbial host cell comprises DNA molecules encoding
polypeptides that catalyze each of the following substrate to
product conversions: i) acetyl-CoA to acetoacetyl-CoA; ii)
acetoacetyl-CoA to 3-hydroxybutyryl-CoA; iii) 3-hydroxybutyryl-CoA
to crotonyl-CoA; iv) crotonyl-CoA to butyryl-CoA; v) butyryl-CoA to
butyraldehyde; and vi) butyraldehyde to 1-butanol; wherein at least
one of the DNA molecules is heterologous to the recombinant
microbial host cell; b) growing the recombinant microbial host cell
in a fermentation culture; and c) determining the metabolic
activity of the fermentation culture by monitoring one or more
metabolic parameters selected from optical density, pH, respiratory
quotient, fermentable carbon substrate utilization, CO.sub.2
production, and 1-butanol production.
39. The method of claim 38, further comprising the step adjusting
the one or more metabolic parameters to support the metabolic
activity.
40. The method of claim 39, wherein a decrease in one or more of
the metabolic parameters indicates a decrease in metabolic
activity.
41. The method of claim 40, wherein the adjusting the one or more
metabolic parameters is lowering the temperature of the
fermentation culture when a decrease in metabolic activity is
detected.
42. The method of claim 38, wherein the polypeptide that catalyzes
the substrate to product conversion of acetyl-CoA to
acetoacetyl-CoA is acetyl-CoA acetyltransferase; the polypeptide
that catalyzes the substrate to product conversion of
acetoacetyl-CoA to 3-hydroxybutyryl-CoA is 3-hydroxybutyryl-CoA
dehydrogenase; the polypeptide that catalyzes the substrate to
product conversion of 3-hydroxybutyryl-CoA to crotonyl-CoA is
crotonase; the polypeptide that catalyzes the substrate to product
conversion of crotonyl-CoA to butyryl-CoA is butyryl-CoA
dehydrogenase; the polypeptide that catalyzes the substrate to
product conversion of butyryl-CoA to butyraldehyde is butyraldehyde
dehydrogenase; and the polypeptide that catalyzes the substrate to
product conversion of butyraldehyde to 1-butanol is butanol
dehydrogenase.
Description
FIELD OF THE INVENTION
[0001] The invention relates to a method for the production of
1-butanol by fermentation using a recombinant microbial host.
Specifically, the method employs a decrease in temperature during
fermentation that results in more robust tolerance of the
production host to the 1-butanol product.
BACKGROUND OF THE INVENTION
[0002] Butanol is an important industrial chemical, useful as a
fuel additive, as a feedstock chemical in the plastics industry,
and as a foodgrade extractant in the food and flavor industry. Each
year 10 to 12 billion pounds of butanol are produced by
petrochemical means and the need for this commodity chemical will
likely increase.
[0003] Methods for the chemical synthesis of 1-butanol are known,
such as the Oxo Process, the Reppe Process, and the hydrogenation
of crotonaldehyde (Ullmann's Encyclopedia of Industrial Chemistry,
6.sup.th edition, 2003, Wiley-VCHVerlag GmbH and Co., Weinheim,
Germany, Vol. 5, pp. 716-719). These processes use starting
materials derived from petrochemicals and are generally expensive
and are not environmentally friendly. The production of 1-butanol
from plant-derived raw materials would minimize greenhouse gas
emissions and would represent an advance in the art.
[0004] Methods of producing 1-butanol by fermentation are also
known, where the most popular process produces a mixture of
acetone, 1-butanol and ethanol and is referred to as the ABE
process (Blaschek et al., U.S. Pat. No. 6,358,717).
Acetone-butanol-ethanol (ABE) fermentation by Clostridium
acetobutylicum is one of the oldest known industrial fermentations,
and the pathways and genes responsible for the production of these
solvents have been reported (Girbal et al., Trends in Biotechnology
16:11-16 (1998)). Additionally, recombinant microbial production
hosts expressing a 1-butanol biosynthetic pathway have been
described (Donaldson et al., copending and commonly owned U.S.
patent application Ser. No. 11/527,995). However, biological
production of 1-butanol is believed to be limited by butanol
toxicity to the host microorganism used in the fermentation.
[0005] Some microbial strains that are tolerant to 1-butanol are
known in the art (see for example, Jain et al. U.S. Pat. No.
5,192,673; Blaschek et al. U.S. Pat. No. 6,358,717; Papoutsakis et
al. U.S. Pat. No. 6,960,465; and Bramucci et al., copending and
commonly owned U.S. patent application Ser. Nos. 11/743,220,
11/761,497, and 11/949,793). However, biological methods of
producing 1-butanol to higher levels are required for cost
effective commercial production.
[0006] There have been reports describing the effect of temperature
on the tolerance of some microbial strains to ethanol. For example,
Amartey et al. (Biotechnol. Lett. 13(9):627-632 (1991)) disclose
that Bacillus stearothermophillus is less tolerant to ethanol at
70.degree. C. than at 60.degree. C. Herrero et al. (Appl. Environ.
Microbiol. 40(3):571-577 (1980)) report that the optimum growth
temperature of a wild-type strain of Clostridium thermocellum
decreases as the concentration of ethanol challenge increases,
whereas the optimum growth temperature of an ethanol-tolerant
mutant remains constant. Brown et al. (Biotechnol. Lett.
4(4):269-274 (1982)) disclose that the yeast Saccharomyces uvarum
is more resistant to growth inhibition by ethanol at temperatures
5.degree. C. and 10.degree. C. below its growth optimum of
35.degree. C. However, fermentation became more resistant to
ethanol inhibition with increasing temperature. Additionally, Van
Uden (CRC Crit. Rev. Biotechnol. 1(3):263-273 (1984)) report that
ethanol and other alkanols depress the maximum and the optimum
growth temperature for growth of Saccharomyces cerevisiae while
thermal death is enhanced. Moreover, Lewis et al. (U.S. patent
Application Publication No. 2004/0234649) describe methods for
producing high levels of ethanol during fermentation of plant
material comprising decreasing the temperature during
saccharifying, fermenting, or simultaneously saccharifying and
fermenting.
[0007] Much less is known about the effect of temperature on the
tolerance of microbial strains to 1-butanol. Harada (Hakko
Kyokaishi 20:155-156 (1962)) discloses that the yield of 1-butanol
in the ABE process is increased from 18.4%-18.7% to 19.1%-21.2% by
lowering the temperature from 30.degree. C. to 28.degree. C. when
the growth of the bacteria reaches a maximum. Jones et al.
(Microbiol. Rev. 50(4):484-524 (1986)) review the role of
temperature in ABE fermentation. They report that the solvent
yields of three different solvent producing strains remains fairly
constant at 31% at 30.degree. C. and 33.degree. C., but decreases
to 23 to 25% at 37.degree. C. Similar results were reported for
Clostridium acetobutylicum for which solvent yields decreased from
29% at 25.degree. C. to 24% at 40.degree. C. In the latter case,
the decrease in solvent yield was attributed to a decrease in
acetone production while the yield of 1-butanol was unaffected.
However, Carnarius (U.S. Pat. No. 2,198,104) reports that an
increase in the butanol ratio is obtained in the ABE process by
decreasing the temperature of the fermentation from 30.degree. C.
to 24.degree. C. after 16 hours. However, the effect of temperature
on the production of 1-butanol by recombinant microbial hosts is
not known in the art.
[0008] There is a need, therefore, for a cost-effective process for
the production of 1-butanol by fermentation that provides higher
yields than processes known in the art. The present invention
addresses this need through the discovery of a method for producing
1-butanol by fermentation using a recombinant microbial host, which
employs a decrease in temperature during fermentation, resulting in
more robust tolerance of the production host to the 1-butanol
product.
SUMMARY OF THE INVENTION
[0009] The invention provides a method for the production of
1-butanol by fermentation using a recombinant microbial host, which
employs a decrease in temperature during fermentation that results
in more robust tolerance of the production host to the 1-butanol
product.
[0010] Accordingly, the invention provides a method for the
production of 1-butanol comprising: [0011] a) providing a
recombinant microbial production host which produces 1-butanol;
[0012] b) seeding the production host of (a) into a fermentation
[0013] medium comprising a fermentable carbon substrate to create a
fermentation culture; [0014] c) growing the production host in the
fermentation culture at a first temperature for a first period of
time; [0015] d) lowering the temperature of the fermentation
culture to a second temperature; and [0016] e) incubating the
production host at the second temperature of step (d) for a second
period of time; [0017] whereby 1-butanol is produced.
BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE DESCRIPTIONS
[0018] The invention can be more fully understood from the
following detailed description, FIGURE, and the accompanying
sequence descriptions, which form a part of this application.
[0019] FIG. 1 shows the 1-butanol biosynthetic pathway. The steps
labeled "a", "b", "c", "d", "e", and "f" represent the substrate to
product conversions described below.
[0020] The following sequences conform with 37 C.F.R. 1.821-1.825
("Requirements for Patent Applications Containing Nucleotide
Sequences and/or Amino Acid Sequence Disclosures--the Sequence
Rules") and are consistent with World Intellectual Property
Organization (WIPO) Standard ST.25 (1998) and the sequence listing
requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and
Section 208 and Annex C of the Administrative Instructions). The
symbols and format used for nucleotide and amino acid sequence data
comply with the rules set forth in 37 C.F.R. .sctn.1.822.
TABLE-US-00001 TABLE 1 Summary of Gene and Protein SEQ ID Numbers
SEQ ID NO SEQ Nucleic ID NO Description acid Peptide Acetyl-CoA
acetyltransferase thlA 1 2 from Clostridium acetobutylicum ATCC 824
Acetyl-CoA acetyltransferase thlB 3 4 from Clostridium
acetobutylicum ATCC 824 Acetyl-CoA acetyltransferase from 128 129
Escherichia coli Acetyl-CoA acetyltransferase from 130 131 Bacillus
subtilis Acetyl-CoA acetyltransferase from 132 133 Saccharomyces
cerevisiae 3-Hydroxybutyryl-CoA 5 6 dehydrogenase from Clostridium
acetobutylicum ATCC 824 3-Hydroxybutyryl-CoA 134 135 dehydrogenase
from Bacillus subtilis 3-Hydroxybutyryl-CoA 136 137 dehydrogenase
from Ralstonia eutropha 3-Hydroxybutyryl-CoA 138 139 dehydrogenase
from Alcaligenes eutrophus Crotonase from Clostridium 7 8
acetobutylicum ATCC 824 Crotonase from Escherichia coli 140 141
Crotonase from Bacillus subtilis 142 143 Crotonase from Aeromonas
caviae 144 145 Putative trans-enoyl CoA reductase 9 10 from
Clostridium acetobutylicum ATCC 824 Butyryl-CoA dehydrogenase from
146 147 Euglena gracilis Butyryl-CoA dehydrogenase from 148 149
Streptomyces collinus Butyryl-CoA dehydrogenase from 150 151
Streptomyces coelocolor Butyraldehyde dehydrogenase from 11 12
Clostridium beijerinckii NRRL B594 Butyraldehyde dehydrogenase from
152 153 Clostridium acetobutylicum Butanol dehydrogenase bdhB from
13 14 Clostridium acetobutylicum ATCC 824 Butanol dehydrogenase 15
16 bdhA from Clostridium acetobutylicum ATCC 824 Butanol
dehydrogenase 152 153 from Clostridium acetobutylicum Butanol
dehydrogenase 154 155 from Escherichia coli
[0021] SEQ ID NOs:17-44 are the nucleotide sequences of
oligonucleotide primers used to amplify the genes of the 1-butanol
biosynthetic pathway.
[0022] SEQ ID NOs:45-72 are the nucleotide sequences of
oligonucleotide primers used for sequencing.
[0023] SEQ ID NOs:73-75 are the nucleotide sequences of
oligonucleotide primers used to construct the transformation
vectors described in Example 13.
[0024] SEQ ID NO:76 is the nucleotide sequence of the
codon-optimized CAC0462 gene, referred to herein as CaTER.
[0025] SEQ ID NO:77 is the nucleotide sequence of the
codon-optimized EgTER gene, referred to herein as EgTER(opt).
[0026] SEQ ID NO:78 is the nucleotide sequence of the
codon-optimized ald gene, referred to herein as ald(opt).
[0027] SEQ ID NO:79 is the nucleotide sequence of the plasmid
pFP988.
[0028] SEQ ID NO:'s 80-127, 160-185, and 190-207 are the nucleic
acid sequences of cloning, sequencing, or PCR screening primers
used for the cloning, sequencing, or screening of the genes of the
1-butanol biosynthetic pathway described herein, and are more fully
described in Tables 4 and 5.
[0029] SEQ ID NO:156 is the nucleotide sequence of the cscBKA gene
cluster.
[0030] SEQ ID NO:157 is the amino acid sequence of sucrose
hydrolase (CscA).
[0031] SEQ ID NO:158 is the amino acid sequence of D-fructokinase
(CscK).
[0032] SEQ ID NO:159 is the amino acid sequence of sucrose permease
(CscB).
[0033] SEQ ID NO:186 is the nucleotide sequence of the codon
optimized tery gene described in Example 21.
[0034] SEQ ID NO:187 is the amino acid sequence of the butyl-CoA
dehydrogenase (ter) encoded by the codon optimized tery gene (SEQ
ID NO:186).
[0035] SEQ ID NO:188 is the nucleotide sequence of the codon
optimized aldy gene described in Example 21.
[0036] SEQ ID NO:189 is the amino acid sequence of the
butyraldehyde dehydrogenase (ald) encoded by the codon optimized
aldy gene (SEQ ID NO:188).
[0037] SEQ ID NO:208 is the nucleotide sequence of the template DNA
used in Example 18.
DETAILED DESCRIPTION OF THE INVENTION
[0038] The present invention relates to a method for the production
of 1-butanol using recombinant microorganisms that employs a
decrease in temperature during fermentation, resulting in more
robust tolerance of the production host to the 1-butanol product
and therefore a higher titer of 1-butanol. The present invention
meets a number of commercial and industrial needs. 1-Butanol is an
important industrial commodity chemical with a variety of
applications, where its potential as a fuel or fuel additive is
particularly significant. Although only a four-carbon alcohol,
butanol has an energy content similar to that of gasoline and can
be blended with any fossil fuel. Butanol is favored as a fuel or
fuel additive as it yields only CO.sub.2 and little or no SO.sub.X
or NO.sub.X when burned in the standard internal combustion engine.
Additionally 1-butanol is less corrosive than ethanol, the most
preferred fuel additive to date.
[0039] In addition to its utility as a biofuel or fuel additive,
1-butanol has the potential of impacting hydrogen distribution
problems in the emerging fuel cell industry. Fuel cells today are
plagued by safety concerns associated with hydrogen transport and
distribution. 1-Butanol can be easily reformed for its hydrogen
content and can be distributed through existing gas stations in the
purity required for either fuel cells or vehicles.
[0040] Finally the present invention produces 1-butanol from plant
derived carbon sources, avoiding the negative environmental impact
associated with standard petrochemical processes for butanol
production.
[0041] The following definitions and abbreviations are to be used
for the interpretation of the claims and the specification.
[0042] As used herein, the terms "comprises," "comprising,"
"includes," "including," "has," "having," "contains" or
"containing," or any other variation thereof, are intended to cover
a non-exclusive inclusion. For example, a composition, a mixture,
process, method, article, or apparatus that comprises a list of
elements is not necessarily limited to only those elements but may
include other elements not expressly listed or inherent to such
composition, mixture, process, method, article, or apparatus.
Further, unless expressly stated to the contrary, "or" refers to an
inclusive or and not to an exclusive or. For example, a condition A
or B is satisfied by any one of the following: A is true (or
present) and B is false (or not present), A is false (or not
present) and B is true (or present), and both A and B are true (or
present).
[0043] Also, the indefinite articles "a" and "an" preceding an
element or component of the invention are intended to be
nonrestrictive regarding the number of instances (i.e. occurrences)
of the element or component. Therefore "a" or "an" should be read
to include one or at least one, and the singular word form of the
element or component also includes the plural unless the number is
obviously meant to be singular.
[0044] The term "invention" or "present invention" as used herein
is a non-limiting term and is not intended to refer to any single
embodiment of the particular invention but encompasses all possible
embodiments as described in the specification and the claims.
[0045] As used herein, the term "about" modifying the quantity of
an ingredient or reactant of the invention employed refers to
variation in the numerical quantity that can occur, for example,
through typical measuring and liquid handling procedures used for
making concentrates or use solutions in the real world; through
inadvertent error in these procedures; through differences in the
manufacture, source, or purity of the ingredients employed to make
the compositions or carry out the methods; and the like. The term
"about" also encompasses amounts that differ due to different
equilibrium conditions for a composition resulting from a
particular initial mixture. Whether or not modified by the term
"about", the claims include equivalents to the quantities. In one
embodiment, the term "about" means within 10% of the reported
numerical value, preferably within 5% of the reported numerical
value.
[0046] "ABE" is the abbreviation for the Acetone-Butanol-Ethanol
fermentation process.
[0047] The term "1-butanol biosynthetic pathway" means the enzyme
pathway to produce 1-butanol from acetyl-coenzyme A
(acetyl-CoA).
[0048] The term "acetyl-CoA acetyltransferase" refers to an enzyme
that catalyzes the conversion of two molecules of acetyl-CoA to
acetoacetyl-CoA and coenzyme A (CoA). Preferred acetyl-CoA
acetyltransferases are acetyl-CoA acetyltransferases with substrate
preferences (reaction in the forward direction) for a short chain
acyl-CoA and acetyl-CoA and are classified as E.C. 2.3.1.9 [Enzyme
Nomenclature 1992, Academic Press, San Diego]; although, enzymes
with a broader substrate range (E.C. 2.3.1.16) will be functional
as well. Acetyl-CoA acetyltransferases are available from a number
of sources, for example, Escherichia coli (GenBank Nos:
NP.sub.--416728 (SEQ ID NO:129), NC.sub.--000913 (SEQ ID NO:128);
NCBI (National Center for Biotechnology Information) amino acid
sequence, NCBI nucleotide sequence), Clostridium acetobutylicum
(GenBank Nos: NP.sub.--349476.1 (SEQ ID NO:2), NC.sub.--003030 (SEQ
ID NO:1); NP.sub.--149242 (SEQ ID NO:4), NC.sub.--001988 (SEQ ID
NO:3), Bacillus subtilis (GenBank Nos: NP.sub.--390297 (SEQ ID
NO:131), NC.sub.--000964 (SEQ ID NO:130)), and Saccharomyces
cerevisiae (GenBank Nos: NP.sub.--015297 (SEQ ID NO:133),
NC.sub.--001148 (SEQ ID NO:132)).
[0049] The term "3-hydroxybutyryl-CoA dehydrogenase" refers to an
enzyme that catalyzes the conversion of acetoacetyl-CoA to
3-hydroxybutyryl-CoA. 3-Hydroxybutyryl-CoA dehydrogenases may be
reduced nicotinamide adenine dinucleotide (NADH)-dependent, with a
substrate preference for (S)-3-hydroxybutyryl-CoA or
(R)-3-hydroxybutyryl-CoA and are classified as E.C. 1.1.1.35 and
E.C. 1.1.1.30, respectively. Additionally, 3-hydroxybutyryl-CoA
dehydrogenases may be reduced nicotinamide adenine dinucleotide
phosphate (NADPH)-dependent, with a substrate preference for
(S)-3-hydroxybutyryl-CoA or (R)-3-hydroxybutyryl-CoA and are
classified as E.C. 1.1.1.157 and E.C. 1.1.1.36, respectively.
3-Hydroxybutyryl-CoA dehydrogenases are available from a number of
sources, for example, C. acetobutylicum (GenBank NOs:
NP.sub.--349314 (SEQ ID NO:6), NC.sub.--003030 (SEQ ID NO:5)), B.
subtilis (GenBank NOs: AAB09614 (SEQ ID NO:135), U29084 (SEQ ID
NO:134)), Ralstonia eutropha (GenBank NOs: YP.sub.--294481 (SEQ ID
NO:137), NC.sub.--007347 (SEQ ID NO:136)), and Alcaligenes
eutrophus (GenBank NOs: AAA21973 (SEQ ID NO:139), J04987 (SEQ ID
NO:138)).
[0050] The term "crotonase" refers to an enzyme that catalyzes the
conversion of 3-hydroxybutyryl-CoA to crotonyl-CoA and H.sub.2O.
Crotonases may have a substrate preference for
(S)-3-hydroxybutyryl-CoA or (R)-3-hydroxybutyryl-CoA and are
classified as E.C. 4.2.1.17 and E.C. 4.2.1.55, respectively.
Crotonases are available from a number of sources, for example, E.
coli (GenBank NOs: NP.sub.--415911 (SEQ ID NO:141), NC.sub.--000913
(SEQ ID NO:140)), C. acetobutylicum (GenBank NOs: NP.sub.--349318
(SEQ ID NO:8), NC.sub.--003030 (SEQ ID NO:6)), B. subtilis (GenBank
NOs: CAB13705 (SEQ ID NO:143), Z99113 (SEQ ID NO:142)), and
Aeromonas caviae (GenBank NOs: BAA21816 (SEQ ID NO:145), D88825
(SEQ ID NO:144)).
[0051] The term "butyryl-CoA dehydrogenase" refers to an enzyme
that catalyzes the conversion of crotonyl-CoA to butyryl-CoA.
Butyryl-CoA dehydrogenases may be either NADH-dependent or
NADPH-dependent and are classified as E.C. 1.3.1.44 and E.C.
1.3.1.38, respectively. Butyryl-CoA dehydrogenases are available
from a number of sources, for example, C. acetobutylicum (GenBank
NOs: NP.sub.--347102 (SEQ ID NO:10), NC.sub.--003030 (SEQ ID
NO:9))), Euglena gracilis (GenBank NOs: Q5EU90 SEQ ID NO:147),
AY741582 SEQ ID NO:146)), Streptomyces collinus (GenBank NOs:
AAA92890 (SEQ ID NO:149), U37135 (SEQ ID NO:148)), and Streptomyces
coelico/or (GenBank NOs: CAA22721 (SEQ ID NO:151), AL939127 (SEQ ID
NO:150)).
[0052] The term "butyraldehyde dehydrogenase" refers to an enzyme
that catalyzes the conversion of butyryl-CoA to butyraldehyde,
using NADH or NADPH as cofactor. Butyraldehyde dehydrogenases with
a preference for NADH are known as E.C. 1.2.1.57 and are available
from, for example, Clostridium beijerinckii (GenBank NOs: AAD31841
(SEQ ID NO:12), AF157306 (SEQ ID NO:11)) and C. acetobutylicum
(GenBank NOs: NP.sub.--149325 (SEQ ID NO:153), NC.sub.--001988 (SEQ
ID NO:152)).
[0053] The term "butanol dehydrogenase" refers to an enzyme that
catalyzes the conversion of butyraldehyde to 1-butanol, using
either NADH or NADPH as cofactor. Butanol dehydrogenases are
available from, for example, C. acetobutylicum (GenBank NOs:
NP.sub.--149325 (SEQ ID NO:153), NC.sub.--001988 SEQ ID NO:152;
note: this enzyme possesses both aldehyde and alcohol dehydrogenase
activity); NP.sub.--349891 (SEQ ID NO:14), NC.sub.--003030 (SEQ ID
NO:13); and NP.sub.--349892 (SEQ ID NO:16), NC.sub.--003030 (SEQ ID
NO:15)) and E. coli (GenBank NOs: NP.sub.--417484 (SEQ ID NO:155),
NC.sub.--000913 (SEQ ID NO:154)).
[0054] The term "a facultative anaerobe" refers to a microorganism
that can grow in both aerobic and anaerobic environments.
[0055] The term "carbon substrate" or "fermentable carbon
substrate" refers to a carbon source capable of being metabolized
by host organisms disclosed herein and particularly carbon sources
selected from the group consisting of monosaccharides,
oligosaccharides, polysaccharides, and one-carbon substrates or
mixtures thereof.
[0056] The term "gene" refers to a nucleic acid fragment that is
capable of being expressed as a specific protein, optionally
including regulatory sequences preceding (5' non-coding sequences)
and following (3' non-coding sequences) the coding sequence.
"Native gene" refers to a gene as found in nature with its own
regulatory sequences. "Chimeric gene" refers to any gene that is
not a native gene, comprising regulatory and coding sequences that
are not found together in nature. Accordingly, a chimeric gene may
comprise regulatory sequences and coding sequences that are derived
from different sources, or regulatory sequences and coding
sequences derived from the same source, but arranged in a manner
different than that found in nature. "Endogenous gene" refers to a
native gene in its natural location in the genome of an organism. A
"foreign" or "heterologous gene" refers to a gene not normally
found in the host organism, but that is introduced into the host
organism by gene transfer. Foreign genes can comprise native genes
inserted into a non-native organism, or chimeric genes. A
"transgene" is a gene that has been introduced into the genome by a
transformation procedure.
[0057] As used herein, an "isolated nucleic acid fragment" or
"isolated nucleic acid molecule" or "genetic construct" will be
used interchangeably and will mean a polymer of RNA or DNA that is
single- or double-stranded, optionally containing synthetic,
non-natural or altered nucleotide bases. An isolated nucleic acid
fragment in the form of a polymer of DNA may be comprised of one or
more segments of cDNA, genomic DNA or synthetic DNA.
[0058] A nucleic acid fragment is "hybridizable" to another nucleic
acid fragment, such as a cDNA, genomic DNA, or RNA molecule, when a
single-stranded form of the nucleic acid fragment can anneal to the
other nucleic acid fragment under the appropriate conditions of
temperature and solution ionic strength. Hybridization and washing
conditions are well known and exemplified in Sambrook, J., Fritsch,
E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual,
2.sup.nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor,
N.Y. (1989), particularly Chapter 11 and Table 11.1 therein
(entirely incorporated herein by reference). The conditions of
temperature and ionic strength determine the "stringency" of the
hybridization. Stringency conditions can be adjusted to screen for
moderately similar fragments (such as homologous sequences from
distantly related organisms), to highly similar fragments (such as
genes that duplicate functional enzymes from closely related
organisms). Post-hybridization washes determine stringency
conditions. One set of preferred conditions uses a series of washes
starting with 6.times.SSC, 0.5% SDS at room temperature for 15 min,
then repeated with 2.times.SSC, 0.5% SDS at 45.degree. C. for 30
min, and then repeated twice with 0.2.times.SSC, 0.5% SDS at
50.degree. C. for 30 min. A more preferred set of stringent
conditions uses higher temperatures in which the washes are
identical to those above except for the temperature of the final
two 30 min washes in 0.2.times.SSC, 0.5% SDS was increased to
60.degree. C. Another preferred set of highly stringent conditions
uses two final washes in 0.1.times.SSC, 0.1% SDS at 65.degree. C.
An additional set of stringent conditions include hybridization at
0.1.times.SSC, 0.1% SDS, 65.degree. C. and washes with 2.times.SSC,
0.1% SDS followed by 0.1.times.SSC, 0.1% SDS, for example.
[0059] Hybridization requires that the two nucleic acids contain
complementary sequences, although depending on the stringency of
the hybridization, mismatches between bases are possible. The
appropriate stringency for hybridizing nucleic acids depends on the
length of the nucleic acids and the degree of complementation,
variables well known in the art. The greater the degree of
similarity or homology between two nucleotide sequences, the
greater the value of Tm for hybrids of nucleic acids having those
sequences. The relative stability (corresponding to higher Tm) of
nucleic acid hybridizations decreases in the following order:
RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100
nucleotides in length, equations for calculating Tm have been
derived (see Sambrook et al., supra, 9.50-9.51). For hybridizations
with shorter nucleic acids, i.e., oligonucleotides, the position of
mismatches becomes more important, and the length of the
oligonucleotide determines its specificity (see Sambrook et al.,
supra, 11.7-11.8). In one embodiment the length for a hybridizable
nucleic acid is at least about 10 nucleotides. Preferably a minimum
length for a hybridizable nucleic acid is at least about 15
nucleotides; more preferably at least about 20 nucleotides; and
most preferably the length is at least about 30 nucleotides.
Furthermore, the skilled artisan will recognize that the
temperature and wash solution salt concentration may be adjusted as
necessary according to factors such as length of the probe.
[0060] A "substantial portion" of an amino acid or nucleotide
sequence is that portion comprising enough of the amino acid
sequence of a polypeptide or the nucleotide sequence of a gene to
putatively identify that polypeptide or gene, either by manual
evaluation of the sequence by one skilled in the art, or by
computer-automated sequence comparison and identification using
algorithms such as BLAST (Altschul, S. F., et al., J. Mol. Biol.,
215:403-410 (1993)). In general, a sequence of ten or more
contiguous amino acids or thirty or more nucleotides is necessary
in order to putatively identify a polypeptide or nucleic acid
sequence as homologous to a known protein or gene. Moreover, with
respect to nucleotide sequences, gene specific oligonucleotide
probes comprising 20-30 contiguous nucleotides may be used in
sequence-dependent methods of gene identification (e.g., Southern
hybridization) and isolation (e.g., in situ hybridization of
bacterial colonies or bacteriophage plaques). In addition, short
oligonucleotides of 12-15 bases may be used as amplification
primers in PCR in order to obtain a particular nucleic acid
fragment comprising the primers. Accordingly, a "substantial
portion" of a nucleotide sequence comprises enough of the sequence
to specifically identify and/or isolate a nucleic acid fragment
comprising the sequence. The instant specification teaches the
complete amino acid and nucleotide sequence encoding particular
fungal proteins. The skilled artisan, having the benefit of the
sequences as reported herein, may now use all or a substantial
portion of the disclosed sequences for purposes known to those
skilled in this art. Accordingly, the instant invention comprises
the complete sequences as reported in the accompanying Sequence
Listing, as well as substantial portions of those sequences as
defined above.
[0061] The term "complementary" is used to describe the
relationship between nucleotide bases that are capable of
hybridizing to one another. For example, with respect to DNA,
adenosine is complementary to thymine and cytosine is complementary
to guanine.
[0062] The terms "homology" and "homologous" are used
interchangeably herein. They refer to nucleic acid fragments
wherein changes in one or more nucleotide bases do not affect the
ability of the nucleic acid fragment to mediate gene expression or
produce a certain phenotype. These terms also refer to
modifications of the nucleic acid fragments of the instant
invention such as deletion or insertion of one or more nucleotides
that do not substantially alter the functional properties of the
resulting nucleic acid fragment relative to the initial, unmodified
fragment. It is therefore understood, as those skilled in the art
will appreciate, that the invention encompasses more than the
specific exemplary sequences.
[0063] Moreover, the skilled artisan recognizes that homologous
nucleic acid sequences encompassed by this invention are also
defined by their ability to hybridize, under moderately stringent
conditions (e.g., 0.5.times.SSC, 0.1% SDS, 60.degree. C.) with the
sequences exemplified herein, or to any portion of the nucleotide
sequences disclosed herein and which are functionally equivalent to
any of the nucleic acid sequences disclosed herein.
[0064] "Codon degeneracy" refers to the nature in the genetic code
permitting variation of the nucleotide sequence without effecting
the amino acid sequence of an encoded polypeptide. The skilled
artisan is well aware of the "codon-bias" exhibited by a specific
host cell in usage of nucleotide codons to specify a given amino
acid. Therefore, when synthesizing a gene for improved expression
in a host cell, it is desirable to design the gene such that its
frequency of codon usage approaches the frequency of preferred
codon usage of the host cell.
[0065] The term "percent identity", as known in the art, is a
relationship between two or more polypeptide sequences or two or
more polynucleotide sequences, as determined by comparing the
sequences. In the art, "identity" also means the degree of sequence
relatedness between polypeptide or polynucleotide sequences, as the
case may be, as determined by the match between strings of such
sequences. "Identity" and "similarity" can be readily calculated by
known methods, including but not limited to those described in: 1.)
Computational Molecular Biology (Lesk, A. M., Ed.) Oxford
University: NY (1988); 2.) Biocomputing: Informatics and Genome
Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Computer
Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H.
G., Eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular
Biology (von Heinje, G., Ed.) Academic (1987); and 5.) Sequence
Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY
(1991).
[0066] Preferred methods to determine identity are designed to give
the best match between the sequences tested. Methods to determine
identity and similarity are codified in publicly available computer
programs. Sequence alignments and percent identity calculations may
be performed using the MegAlign.TM. program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
Multiple alignment of the sequences is performed using the "Clustal
method of alignment" which encompasses several varieties of the
algorithm including the "Clustal V method of alignment"
corresponding to the alignment method labeled Clustal V (described
by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et
al., Comput. Appl. Biosci., 8:189-191 (1992)) and found in the
MegAlign.TM. program of the LASERGENE bioinformatics computing
suite (DNASTAR Inc.). For multiple alignments, the default values
correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default
parameters for pairwise alignments and calculation of percent
identity of protein sequences using the Clustal method are
KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For
nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5,
WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences
using the Clustal V program, it is possible to obtain a "percent
identity" by viewing the "sequence distances" table in the same
program. Additionally the "Clustal W method of alignment" is
available and corresponds to the alignment method labeled Clustal W
(described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins,
D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) and found in
the MegAlign.TM. v6.1 program of the LASERGENE bioinformatics
computing suite (DNASTAR Inc.). Default parameters for multiple
alignment (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen
Seqs(%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet
Series, DNA Weight Matrix=IUB). After alignment of the sequences
using the Clustal W program, it is possible to obtain a "percent
identity" by viewing the "sequence distances" table in the same
program.
[0067] It is well understood by one skilled in the art that many
levels of sequence identity are useful in identifying polypeptides,
from other species, wherein such polypeptides have the same or
similar function or activity. Useful examples of percent identities
include, but are not limited to: 24%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer
percentage from 24% to 100% may be useful in describing the present
invention, such as 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%,
47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%,
60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%,
73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99%. Suitable nucleic acid fragments not only have the above
homologies but typically encode a polypeptide having at least 50
amino acids, preferably at least 100 amino acids, more preferably
at least 150 amino acids, still more preferably at least 200 amino
acids, and most preferably at least 250 amino acids.
[0068] The term "sequence analysis software" refers to any computer
algorithm or software program that is useful for the analysis of
nucleotide or amino acid sequences. "Sequence analysis software"
may be commercially available or independently developed. Typical
sequence analysis software will include, but is not limited to: 1.)
the GCG suite of programs (Wisconsin Package Version 9.0, Genetics
Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX
(Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR
(DNASTAR, Inc. Madison, Wis.); 4.) Sequencher (Gene Codes
Corporation, Ann Arbor, Mich.); and 5.) the FASTA program
incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput.
Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992,
111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within
the context of this application it will be understood that where
sequence analysis software is used for analysis, that the results
of the analysis will be based on the "default values" of the
program referenced, unless otherwise specified. As used herein
"default values" will mean any set of values or parameters that
originally load with the software when first initialized.
[0069] As used herein the term "coding sequence" refers to a DNA
sequence that codes for a specific amino acid sequence. "Suitable
regulatory sequences" refer to nucleotide sequences located
upstream (5' non-coding sequences), within, or downstream (3'
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences may include
promoters, translation leader sequences, introns, polyadenylation
recognition sequences, RNA processing site, effector binding site
and stem-loop structure.
[0070] The term "promoter" refers to a DNA sequence capable of
controlling the expression of a coding sequence or functional RNA.
In general, a coding sequence is located 3' to a promoter sequence.
Promoters may be derived in their entirety from a native gene, or
be composed of different elements derived from different promoters
found in nature, or even comprise synthetic DNA segments. It is
understood by those skilled in the art that different promoters may
direct the expression of a gene in different tissues or cell types,
or at different stages of development, or in response to different
environmental or physiological conditions. Promoters which cause a
gene to be expressed in most cell types at most times are commonly
referred to as "constitutive promoters". It is further recognized
that since in most cases the exact boundaries of regulatory
sequences have not been completely defined, DNA fragments of
different lengths may have identical promoter activity.
[0071] The term "operably linked" refers to the association of
nucleic acid sequences on a single nucleic acid fragment so that
the function of one is affected by the other. For example, a
promoter is operably linked with a coding sequence when it is
capable of affecting the expression of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of
the promoter). Coding sequences can be operably linked to
regulatory sequences in sense or antisense orientation.
[0072] The term "expression", as used herein, refers to the
transcription and stable accumulation of sense (mRNA) or antisense
RNA derived from the nucleic acid fragment disclosed herein.
Expression may also refer to translation of mRNA into a
polypeptide.
[0073] As used herein the term "transformation" refers to the
transfer of a nucleic acid fragment into a host organism, resulting
in genetically stable inheritance. Host organisms containing the
transformed nucleic acid fragments are referred to as "transgenic"
or "recombinant" or "transformed" organisms.
[0074] The terms "plasmid" and "vector" refer to an extra
chromosomal element often carrying genes which are not part of the
central metabolism of the cell, and usually in the form of circular
double-stranded DNA molecules. Such elements may be autonomously
replicating sequences, genome integrating sequences, phage or
nucleotide sequences, linear or circular, of a single- or
double-stranded DNA or RNA, derived from any source, in which a
number of nucleotide sequences have been joined or recombined into
a unique construction which is capable of introducing a promoter
fragment and DNA sequence for a selected gene product along with
appropriate 3' untranslated sequence into a cell. "Transformation
vector" refers to a specific vector containing a foreign gene and
having elements in addition to the foreign gene that facilitates
transformation of a particular host cell.
[0075] As used herein the term "codon degeneracy" refers to the
nature in the genetic code permitting variation of the nucleotide
sequence without effecting the amino acid sequence of an encoded
polypeptide. The skilled artisan is well aware of the "codon-bias"
exhibited by a specific host cell in usage of nucleotide codons to
specify a given amino acid. Therefore, when synthesizing a gene for
improved expression in a host cell, it is desirable to design the
gene such that its frequency of codon usage approaches the
frequency of preferred codon usage of the host cell.
[0076] The term "codon-optimized" as it refers to genes or coding
regions of nucleic acid molecules for transformation of various
hosts, refers to the alteration of codons in the gene or coding
regions of the nucleic acid molecules to reflect the typical codon
usage of the host organism without altering the polypeptide encoded
by the DNA.
[0077] Standard recombinant DNA and molecular cloning techniques
used here are well known in the art and are described by Sambrook,
J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A
Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. (1989) (hereinafter "Maniatis");
and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W.,
Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, published by Greene
Publishing Assoc. and Wiley-Interscience (1987).
The 1-Butanol Biosynthetic Pathway
[0078] Carbohydrate utilizing microorganisms employ the
Embden-Meyerhof-Parnas (EMP) pathway, the Entner-Doudoroff pathway
and the pentose phosphate cycle as the central, metabolic routes to
provide energy and cellular precursors for growth and maintenance.
These pathways have in common the intermediate
glyceraldehyde-3-phosphate and, ultimately, pyruvate is formed
directly or in combination with the EMP pathway. Subsequently,
pyruvate is transformed to acetyl-coenzyme A (acetyl-CoA) via a
variety of means, including reaction with the pyruvate
dehydrogenase complex, pyruvate-formate lyase, and
pyruvate-ferredoxin oxidoreductase. Acetyl-CoA serves as a key
intermediate, for example, in generating fatty acids, amino acids
and secondary metabolites. The combined reactions of sugar
conversion to acetyl-CoA produce energy (e.g.
adenosine-5'-triphosphate, ATP) and reducing equivalents (e.g.
reduced nicotinamide adenine dinucleotide, NADH, and reduced
nicotinamide adenine dinucleotide phosphate, NADPH). NADH and NADPH
must be recycled to their oxidized forms (NAD.sup.+ and NADP.sup.+,
respectively). In the presence of inorganic electron acceptors
(e.g. O.sub.2, NO.sub.3.sup.- and SO.sub.4.sup.2-), the reducing
equivalents may be used to augment the energy pool; alternatively,
a reduced carbon by-product may be formed. The production of
ethanol and 1-butanol resulting from the fermentation of
carbohydrate are examples of the latter. As described by Donaldson,
supra, 1-butanol can be produced from carbohydrate sources by
recombinant microorganisms comprising a complete 1-butanol
biosynthetic pathway from acetyl-CoA to 1-butanol, as shown in FIG.
1."
[0079] This biosynthetic pathway, generally lacking in the
microbial community due to the absence of genes or the lack of
appropriate gene regulation, comprises the following substrate to
product conversions: [0080] a) acetyl-CoA to acetoacetyl-CoA, as
catalyzed for example by acetyl-CoA acetyltransferase; [0081] b)
acetoacetyl-CoA to 3-hydroxybutyryl-CoA, as catalyzed for example
by 3-hydroxybutyryl-CoA dehydrogenase; [0082] c)
3-hydroxybutyryl-CoA to crotonyl-CoA, as catalyzed for example by
crotonase; [0083] d) crotonyl-CoA to butyryl-CoA, as catalyzed for
example by butyryl-CoA dehydrogenase; [0084] e) butyryl-CoA to
butyraldehyde, as catalyzed for example by butyraldehyde
dehydrogenase; and [0085] f) butyraldehyde to 1-butanol, as
catalyzed for example by butanol dehydrogenase.
[0086] The pathway requires no ATP and generates NAD.sup.+ and/or
NADP.sup.+, thus, balances with the central metabolic routes that
generate acetyl-CoA. The ability of natural organisms to produce
1-butanol by fermentation is rare and exemplified most prominently
by Clostridium beijerinckii and Clostridium acetobutylicum. The
gene organization and gene regulation for Clostridium
acetobutylicum has been described (L. Girbal and P. Soucaille,
Trends in Biotechnology 216:11-16 (1998)). However, many of these
enzyme activities are associated also with alternate pathways, for
example, hydrocarbon utilization, fatty acid oxidation, and
poly-hydroxyalkanoate metabolism. Thus, in providing a recombinant
pathway from acetyl-CoA to 1-butanol, there exist a number of
choices to fulfill the individual reaction steps, and the person of
skill in the art will be able to utilize publicly available
sequences to construct the relevant pathways. A listing of a
representative number of genes known in the art and useful in the
construction of the 1-butanol biosynthetic pathway are listed below
in Table 2 and in Donaldson et al., copending and commonly owned
U.S. patent application Ser. No. 11/527,995, incorporated herein by
reference.
TABLE-US-00002 TABLE 2 Sources of 1-Buatnol Pathway Genes Gene
GenBank Citation acetyl-CoA NC_000913 Escherichia coli K12,
complete genome acetyltransferase
gi|49175990|ref|NC_000913.2|[49175990] NC_001988 Clostridium
acetobutylicum ATCC 824 plasmid pSOL1, complete sequence
gi|15004705|ref|NC_001988.2|[15004705] NC_000964 Bacillus subtilis
subsp. subtilis str. 168, complete genome
gi|50812173|ref|NC_000964.2|[50812173] NC_001148 Saccharomyces
cerevisiae chromosome XVI, complete chromosome sequence
gi|50593503|ref|NC_001148.3|[50593503] CP000017 Streptococcus
pyogenes MGAS5005, complete genome
gi|71852596|gb|CP000017.1|[71852596] NC_005773 Pseudomonas syringae
pv. phaseolicola 1448A, complete genome
gi|71733195|ref|NC_005773.3|[71733195] CR931997 Corynebacterium
jeikeium K411 complete genome gi|68262661|emb|CR931997.1|[68262661]
3-hydroxybutyryl-CoA NC_003030 Clostridium acetobutylicum ATCC 824,
dehydrogenase complete genome
gi|15893298|ref|NC_003030.1|[15893298] U29084 Bacillus subtilis
(mmgA), (mmgB), (mmgC), and citrate synthase III (mmgD) genes,
complete cds, and (mmgE) gene, partial cds
gi|881603|gb|U29084.1|BSU29084[881603] NC_007347 Ralstonia eutropha
JMP134 Raeut01_1, whole genome shotgun sequence
gi|45517296|ref|NZ_AADY01000001.1|[45517296] J04987 A. eutrophus
beta-ketothiolase (phbA) and acetoacetyl-CoA reductase (phbB)
genes, complete cds gi|141953|gb|J04987.1|AFAKTLAACA[141953]
NC_004129 Pseudomonas fluorescens Pf-5, complete genome
gi|70728250|ref|NC_004129.6|[70728250] NC_000913 Escherichia coli
K12, complete genome gi|49175990|ref|NC_000913.2|[49175990]
NC_004557 Clostridium tetani E88, complete genome
gi|28209834|ref|NC_004557.1|[28209834] NC_006350 Burkholderia
pseudomallei K96243 chromosome 1, complete sequence
gi|53717639|ref|NC_006350.1|[53717639] NC_002947 Pseudomonas putida
KT2440, complete genome gi|26986745|ref|NC_002947.3|[26986745]
crotonase NC_000913 Escherichia coli K12, complete genome
gi|49175990|ref|NC_000913.2|[49175990] NC_003030 Clostridium
acetobutylicum ATCC 824, complete genome
gi|15893298|ref|NC_003030.1|[15893298] Z99113 Bacillus subtilis
complete genome (section 10 of 21): from 1807106 to 2014934
gi|32468758|emb|Z99113.2|BSUB0010[32468758] D88825 Aeromonas caviae
phaC gene for PHA synthase, complete cds
gi|2335048|dbj|D88825.1|[2335048] NC_006274 Bacillus cereus ZK,
complete genome gi|52140164|ref|NC_006274.1|[52140164] NC_004557
Clostridium tetani E88, complete genome
gi|28209834|ref|NC_004557.1|[28209834] butyryl-CoA NC_003030
Clostridium acetobutylicum ATCC 824, dehydrogenase complete genome
gi|15893298|ref|NC_003030.1|[15893298] AY741582 Euglena gracilis
trans-2-enoyl-CoA reductase mRNA, complete cds
gi|58201539|gb|AY741582.1|[58201539] U37135 Streptomyces collinus
crotonyl-CoA reductase (ccr) gene, complete cds
gi|1046370|gb|U37135.1|SCU37135[1046370] AL939127 Streptomyces
coelicolor A3(2) complete genome; segment 24/29
gi|24429552|emb|AL939127.1|SCO939127[24429552] AP006716
Staphylococcus haemolyticus JCSC1435, complete genome
gi|68445725|dbj|AP006716.1|[68445725] NC_006274 Bacillus cereus ZK,
complete genome gi|52140164|ref|NC_006274.1|[52140164] NC_004557
Clostridium tetani E88, complete genome
gi|28209834|ref|NC_004557.1|[28209834] butyraldehyde AF157306
Clostridium beijerinckii strain NRRL B593 dehydrogenase
hypothetical protein, coenzyme A acylating aldehyde dehydrogenase
(ald), acetoacetate:butyrate/acetate coenzyme A transferase (ctfA),
acetoacetate:butyrate/acetate coenzyme A transferase (ctfB), and
acetoacetate decarboxylase (adc) genes, complete cds
gi|47422980|gb|AF157306.2|[47422980] NC_001988 Clostridium
acetobutylicum ATCC 824 plasmid pSOL1, complete sequence
gi|15004705|ref|NC_001988.2|[15004705] AY251646 Clostridium
saccharoperbutylacetonicum sol operon, complete sequence
gi|31075382|gb|AY251646.1|[31075382] butanol NC_001988 Clostridium
acetobutylicum ATCC 824 dehydrogenase plasmid pSOL1, complete
sequence gi|15004705|ref|NC_001988.2|[15004705] NC_003030
Clostridium acetobutylicum ATCC 824, complete genome
gi|15893298|ref|NC_003030.1|[15893298] NC_000913 Escherichia coli
K12, complete genome gi|49175990|ref|NC_000913.2|[49175990]
NC_003198 Salmonella enterica subsp. enterica serovar Typhi str.
CT18, complete genome gi|16758993|ref|NC_003198.1|[16758993]
BX571966 Burkholderia pseudomallei strain K96243, chromosome 2,
complete sequence gi|52211453|emb|BX571966.1|[52211453 Z99120
Bacillus subtilis complete genome (section 17 of 21): from 3213330
to 3414388 gi|32468813|emb|Z99120.2|BSUB0017[32468813 NC_003366
Clostridium perfringens str. 13, complete genome
gi|18308982|ref|NC_003366.1|[18308982 NC_004431 Escherichia coli
CFT073, complete genome gi|26245917|ref|NC_004431.1|[26245917
Pathway Steps:
[0087] a) Acetyl-CoA to acetoacetyl-CoA, is catalyzed by acetyl-CoA
acetyltransferase. The skilled person will appreciate that
polypeptides having by acetyl-CoA acetyltransferase activity
isolated from a variety of sources will be useful in the present
invention independent of sequence homology. Examples of suitable by
acetyl-CoA acetyltransferase enzymes are available from a number of
sources, for example, for example, Escherichia coli (GenBank Nos:
NP.sub.--416728 (SEQ ID NO:129), NC.sub.--000913 (SEQ ID NO:128);
NCBI (National Center for Biotechnology Information) amino acid
sequence, NCBI nucleotide sequence), Clostridium acetobutylicum
(GenBank Nos: NP.sub.--349476.1 (SEQ ID NO:2), NC.sub.--003030 (SEQ
ID NO:1); NP.sub.--149242 (SEQ ID NO:4), NC.sub.--001988 (SEQ ID
NO:3), Bacillus subtilis (GenBank Nos: NP.sub.--390297 (SEQ ID
NO:131), NC.sub.--000964 (SEQ ID NO:130)), and Saccharomyces
cerevisiae (GenBank Nos: NP.sub.--015297 (SEQ ID NO:133),
NC.sub.--001148 (SEQ ID NO:132)). Preferred by acetyl-CoA
acetyltransferase enzymes are those that have at least 80%-85%
identity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:129, SEQ ID NO:131,
or SEQ ID NO:133, where at least 85%-90% identity is more preferred
and where at least 95% identity based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix,
is most preferred.
[0088] b) Acetoacetyl-CoA to 3-hydroxybutyryl-CoA is catalyzed by
3-hydroxybutyryl-CoA dehydrogenase. The skilled person will
appreciate that polypeptides having 3-hydroxybutyryl-CoA
dehydrogenase activity isolated from a variety of sources will be
useful in the present invention independent of sequence homology.
Example of suitable 3-hydroxybutyryl-CoA dehydrogenase enzymes are
available from a number of sources, for example, C. acetobutylicum
(GenBank NOs: NP.sub.--349314 (SEQ ID NO:6), NC.sub.--003030 (SEQ
ID NO:5)), B. subtilis (GenBank NOs: AAB09614 (SEQ ID NO:135),
U29084 (SEQ ID NO:134)), Ralstonia eutropha (GenBank NOs:
YP.sub.--294481 (SEQ ID NO:137), NC.sub.--007347 (SEQ ID NO:136)),
and Alcaligenes eutrophus (GenBank NOs: AAA21973 (SEQ ID NO:139),
J04987 (SEQ ID NO:138)). Preferred 3-hydroxybutyryl-CoA
dehydrogenase enzymes are those that have at least 80%-85% identity
to SEQ ID NO:6, SEQ ID NO:135, SEQ ID NO:137, or SEQ ID NO:139
where at least 85%-90% identity is more preferred and where at
least 95% identity based on the Clustal W method of alignment using
the default parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1,
and Gonnet 250 series of protein weight matrix, is most
preferred.
[0089] c) 3-hydroxybutyryl-CoA to crotonyl-CoA is catalyzed by
crotonase. The skilled person will appreciate that polypeptides
having crotonase activity isolated from a variety of sources will
be useful in the present invention independent of sequence
homology. Examples of suitable crotonase enzymes are available from
a number of sources, for example, E. coli (GenBank NOs:
NP.sub.--415911 (SEQ ID NO:141), NC.sub.--000913 (SEQ ID NO:140)),
C. acetobutylicum (GenBank NOs: NP.sub.--349318 (SEQ ID NO:8),
NC.sub.--003030 (SEQ ID NO:6)), B. subtilis (GenBank NOs: CAB13705
(SEQ ID NO:143), Z99113 (SEQ ID NO:142)), and Aeromonas caviae
(GenBank NOs: BAA21816 (SEQ ID NO:145), D88825 (SEQ ID NO:144)).
Preferred crotonase enzymes are those that have at least 80%-85%
identity to SEQ ID NO:8, SEQ ID NO:141, SEQ ID NO:143, and SEQ ID
NO:145 where at least 85%-90% identity is more preferred and where
at least 95% identity based on the Clustal W method of alignment
using the default parameters of GAP PENALTY=10, GAP LENGTH
PENALTY=0.1, and Gonnet 250 series of protein weight matrix, is
most preferred.
[0090] d) Crotonyl-CoA to butyryl-CoA, is catalyzed by butyryl-CoA
dehydrogenase. The skilled person will appreciate that polypeptides
having butyryl-CoA dehydrogenase activity isolated from a variety
of sources will be useful in the present invention independent of
sequence homology. Examples of suitable butyryl-CoA dehydrogenase
enzymes are available from a number of sources, for example, C.
acetobutylicum (GenBank NOs: NP.sub.--347102 (SEQ ID NO:10),
NC.sub.--003030 (SEQ ID NO:9))), Euglena gracilis (GenBank NOs:
Q5EU90 SEQ ID NO:147), AY741582 SEQ ID NO:146)), Streptomyces
collinus (GenBank NOs: AAA92890 (SEQ ID NO:149), U37135 (SEQ ID
NO:148)), and Streptomyces coelicolor (GenBank NOs: CAA22721 (SEQ
ID NO:151), AL939127 (SEQ ID NO:150)). Preferred butyryl-CoA
dehydrogenase enzymes are those that have at least 80%-85% identity
to SEQ ID NO:10, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, and
SEQ ID NO:187 where at least 85%-90% identity is more preferred and
where at least 95% identity based on the Clustal W method of
alignment using the default parameters of GAP PENALTY=10, GAP
LENGTH PENALTY=0.1, and Gonnet 250 series of protein weight matrix,
is most preferred.
[0091] e) Butyryl-CoA to butyraldehyde, is catalyzed by
butyraldehyde dehydrogenase. The skilled person will appreciate
that polypeptides having butyraldehyde dehydrogenase activity
isolated from a variety of sources will be useful in the present
invention independent of sequence homology. Examples of suitable
butyraldehyde dehydrogenase enzymes are available from a number of
sources, for example, Clostridium beijerinckii (GenBank NOs:
AAD31841 (SEQ ID NO:12), AF157306 (SEQ ID NO:11)) and C.
acetobutylicum (GenBank NOs: NP.sub.--149325 (SEQ ID NO:153),
NC.sub.--001988 (SEQ ID NO:152)). Preferred butyraldehyde
dehydrogenase enzymes are those that have at least 80%-85% identity
to SEQ ID NO:12, SEQ ID NO:153, and SEQ ID NO:189 where at least
85%-90% identity is more preferred and where at least 95% identity
based on the Clustal W method of alignment using the default
parameters of GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet
250 series of protein weight matrix, is most preferred.
[0092] f) Butyraldehyde to 1-butanol, is catalyzed by butanol
dehydrogenase. The skilled person will appreciate that polypeptides
having butanol dehydrogenase activity isolated from a variety of
sources will be useful in the present invention independent of
sequence homology. Some example of suitable butanol dehydrogenase
enzymes are available from a number of sources, for example, C.
acetobutylicum (GenBank NOs: NP.sub.--149325 (SEQ ID NO:153),
NC.sub.--001988 SEQ ID NO:152; note: this enzyme possesses both
aldehyde and alcohol dehydrogenase activity); NP.sub.--349891 (SEQ
ID NO:14), NC.sub.--003030 (SEQ ID NO:13); and NP.sub.--349892 (SEQ
ID NO:16), NC.sub.--003030 (SEQ ID NO:15)) and E. coli (GenBank
NOs: NP.sub.--417484 (SEQ ID NO:155), NC.sub.--000913 (SEQ ID
NO:154)). Preferred butanol dehydrogenase enzymes are those that
have at least 80%-85% identity to SEQ ID NO:14, SEQ ID NO:16, SEQ
ID NO:153, SEQ ID NO:155, and SEQ ID NO:157 where at least 85%-90%
identity is more preferred and where at least 95% identity based on
the Clustal W method of alignment using the default parameters of
GAP PENALTY=10, GAP LENGTH PENALTY=0.1, and Gonnet 250 series of
protein weight matrix, is most preferred.
Microbial Hosts for 1-Butanol Production
[0093] Microbial hosts for 1-butanol production may be selected
from bacteria, cyanobacteria, filamentous fungi and yeasts. The
microbial host used for 1-butanol production is preferably tolerant
to 1-butanol so that the yield is not limited by butanol toxicity.
Microbes that are metabolically active at high titer levels of
1-butanol are not well known in the art. Although
1-butanol-tolerant mutants have been isolated from solventogenic
Clostridia, little information is available concerning the
1-butanol tolerance of other potentially useful bacterial strains.
Most of the studies on the comparison of alcohol tolerance in
bacteria suggest that 1-butanol is more toxic than ethanol (de
Cavalho et al., Microsc. Res. Tech. 64:215-22 (2004) and Kabelitz
et al., FEMS Microbiol. Lett. 220:223-227 (2003)). Tomas et al. (J.
Bacteriol. 186:2006-2018 (2004)) report that the yield of 1-butanol
during fermentation in Clostridium acetobutylicum may be limited by
toxicity. The primary effect of 1-butanol on Clostridium
acetobutylicum is disruption of membrane functions (Hermann et al.,
Appl. Environ. Microbiol. 50:1238-1243 (1985)).
[0094] The microbial hosts selected for the production of 1-butanol
are preferably tolerant to 1-butanol and are able to convert
carbohydrates to 1-butanol. The criteria for selection of suitable
microbial hosts include the following: intrinsic tolerance to
1-butanol, high rate of glucose utilization, availability of
genetic tools for gene manipulation, and the ability to generate
stable chromosomal alterations.
[0095] Suitable host strains with a tolerance for 1-butanol may be
identified by screening based on the intrinsic tolerance of the
strain. The intrinsic tolerance of microbes to 1-butanol may be
measured by determining the concentration of 1-butanol that is
responsible for 50% inhibition of the growth rate (IC50) when grown
in a minimal medium. The IC50 values may be determined using
methods known in the art. For example, the microbes of interest may
be grown in the presence of various amounts of 1-butanol and the
growth rate monitored by measuring the optical density at 600
nanometers. The doubling time may be calculated from the
logarithmic part of the growth curve and used as a measure of the
growth rate. The concentration of 1-butanol that produces 50%
inhibition of growth may be determined from a graph of the percent
inhibition of growth versus the 1-butanol concentration.
Preferably, the host strain should have an IC50 for 1-butanol of
greater than about 0.5% weight/volume.
[0096] The microbial host for 1-butanol production should also
utilize glucose at a high rate. Most microbes are capable of
utilizing carbohydrates. However, certain environmental microbes
cannot utilize carbohydrates to high efficiency, and therefore
would not be suitable hosts.
[0097] The ability to genetically modify the host is essential for
the production of any recombinant microorganism. The mode of gene
transfer technology may be by electroporation, conjugation,
transduction or natural transformation. A broad range of host
conjugative plasmids and drug resistant markers are available. The
cloning vectors are tailored to the host organisms based on the
nature of antibiotic resistance markers that can function in that
host.
[0098] The microbial host also has to be manipulated in order to
inactivate competing pathways for carbon flow by deleting various
genes. This requires the availability of either transposons to
direct inactivation or chromosomal integration vectors.
Additionally, the production host should be amenable to chemical
mutagenesis so that mutations to improve intrinsic 1-butanol
tolerance may be obtained.
[0099] Based on the criteria described above, suitable microbial
hosts for the production of 1-butanol include, but are not limited
to, members of the genera Clostridium, Zymomonas, Escherichia,
Salmonella, Rhodococcus, Pseudomonas, Bacillus, Lactobacillus,
Enterococcus, Alcaligenes, Klebsiella, Paenibacillus, Arthrobacter,
Corynebacterium, Brevibacterium, Pichia, Candida, Hansenula and
Saccharomyces. Preferred hosts include: Escherichia coli,
Alcaligenes eutrophus, Bacillus licheniformis, Paenibacillus
macerans, Rhodococcus erythropolis, Pseudomonas putida,
Lactobacillus plantarum, Enterococcus faecium, Enterococcus
gallinarium, Enterococcus faecalis, Bacillus subtilis and
Saccharomyces cerevisiae.
Construction of Production Host
[0100] Recombinant organisms containing the necessary genes that
will encode the enzymatic pathway for the conversion of a
fermentable carbon substrate to 1-butanol may be constructed using
techniques well known in the art. Genes encoding the enzymes of the
1-butanol biosynthetic pathway, i.e., acetyl-CoA acetyltransferase,
3-hydroxybutyryl-CoA dehydrogenase, crotonase, butyryl-CoA
dehydrogenase, butyraldehyde dehydrogenase, and butanol
dehydrogenase, may be isolated from various sources, as described
above.
[0101] Methods of obtaining desired genes from a bacterial genome
are common and well known in the art of molecular biology. For
example, if the sequence of the gene is known, suitable genomic
libraries may be created by restriction endonuclease digestion and
may be screened with probes complementary to the desired gene
sequence. Once the sequence is isolated, the DNA may be amplified
using standard primer-directed amplification methods such as
polymerase chain reaction (Mullis, U.S. Pat. No. 4,683,202) to
obtain amounts of DNA suitable for transformation using appropriate
vectors. Tools for codon optimization for expression in a
heterologous host are readily available. Some tools for codon
optimization are available based on the GC content of the host
organism. The GC content of some exemplary microbial hosts is given
Table 3.
TABLE-US-00003 TABLE 3 GC Content of Microbial Hosts Strain % GC B.
licheniformis 46 B. subtilis 42 C. acetobutylicum 37 E. coli 50 P.
putida 61 A. eutrophus 61 Paenibacillus macerans 51 Rhodococcus
erythropolis 62 Brevibacillus 50 Paenibacillus polymyxa 50
[0102] Once the relevant pathway genes are identified and isolated
they may be transformed into suitable expression hosts by means
well known in the art. Vectors or cassettes useful for the
transformation of a variety of host cells are common and
commercially available from companies such as EPICENTRE.RTM.
(Madison, Wis.), Invitrogen Corp. (Carlsbad, Calif.), Stratagene
(La Jolla, Calif.), and New England Biolabs, Inc. (Beverly, Mass.).
Typically, the vector or cassette contains sequences directing
transcription and translation of the relevant gene, a selectable
marker, and sequences allowing autonomous replication or
chromosomal integration. Suitable vectors comprise a region 5' of
the gene which harbors transcriptional initiation controls and a
region 3' of the DNA fragment which controls transcriptional
termination. Both control regions may be derived from genes
homologous to the transformed host cell, although it is to be
understood that such control regions may also be derived from genes
that are not native to the specific species chosen as a production
host.
[0103] Initiation control regions or promoters, which are useful to
drive expression of the relevant pathway coding regions in the
desired host cell are numerous and familiar to those skilled in the
art. Virtually any promoter capable of driving these genetic
elements is suitable for the present invention including, but not
limited to, CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1,
TRP1, URA3, LEU2, ENO, TPI, CUP1, FBA, GPD, and GPM (useful for
expression in Saccharomyces); AOX1 (useful for expression in
Pichia); and lac, ara, tet, trp, IP.sub.L, IP.sub.R, T7, tac, and
trc (useful for expression in Escherichia coli, Alcaligenes, and
Pseudomonas); the amy, apr, npr promoters and various phage
promoters useful for expression in Bacillus subtilis, Bacillus
licheniformis, and Paenibacillus macerans; nisA (useful for
expression Gram-positive bacteria, Eichenbaum et al. Appl. Environ.
Microbiol. 64(8):2763-2769 (1998)); and the synthetic P11 promoter
(useful for expression in Lactobacillus plantarum, Rud et al.,
Microbiology 152:1011-1019 (2006)).
[0104] Termination control regions may also be derived from various
genes native to the preferred hosts. Optionally, a termination site
may be unnecessary, however, it is most preferred if included.
[0105] Certain vectors are capable of replicating in a broad range
of host bacteria and can be transferred by conjugation. The
complete and annotated sequence of pRK404 and three related
vectors-pRK437, pRK442, and pRK442(H) are available. These
derivatives have proven to be valuable tools for genetic
manipulation in Gram-negative bacteria (Scott et al., Plasmid
50(1):74-79 (2003)). Several plasmid derivatives of
broad-host-range Inc P4 plasmid RSF1010 are also available with
promoters that can function in a range of Gram-negative bacteria.
Plasmid pAYC36 and pAYC37, have active promoters along with
multiple cloning sites to allow for the heterologous gene
expression in Gram-negative bacteria.
[0106] Chromosomal gene replacement tools are also widely
available. For example, a thermosensitive variant of the
broad-host-range replicon pWV101 has been modified to construct a
plasmid pVE6002 which can be used to create gene replacement in a
range of Gram-positive bacteria (Maguin et al., J. Bacteriol.
174(17):5633-5638 (1992)). Additionally, in vitro transposomes are
available to create random mutations in a variety of genomes from
commercial sources such as EPICENTRE.RTM..
[0107] The expression of the 1-butanol biosynthetic pathway in
various preferred microbial hosts is described in more detail
below.
[0108] Expression of the 1-Butanol Biosynthetic Pathway in E.
Coli
[0109] Vectors or cassettes useful for the transformation of E.
coli are common and commercially available from the companies
listed above. For example, the genes of the 1-butanol biosynthetic
pathway may be isolated from various strains of Clostridium, cloned
into a modified pUC19 vector and transformed into E. coli NM522, as
described in Example 15. The expression of the 1-butanol
biosynthetic pathway in several other strains of E. coli is
described in Example 17.
[0110] Expression of the 1-Butanol Biosynthetic Pathway in
Rhodococcus Erythrodolis
[0111] A series of E. coli-Rhodococcus shuttle vectors are
available for expression in R. erythropolis, including, but not
limited to pRhBR17 and pDA71 (Kostichka et al., Appl. Microbiol.
Biotechno/62:61-68 (2003)). Additionally, a series of promoters are
available for heterologous gene expression in R. erythropolis (see
for example Nakashima et al., Appl. Envir. Microbiol. 70:5557-5568
(2004), and Tao et al., Appl. Microbiol. Biotechnol. 2005, DOI
10.1007/s00253-005-0064). Targeted gene disruption of chromosomal
genes in R. erythropolis may be created using the method described
by Tao et al., supra, and Brans et al. (Appl. Envir. Microbiol. 66:
2029-2036 (2000)).
[0112] The heterologous genes required for the production of
1-butanol, as described above, may be cloned initially in pDA71 or
pRhBR71 and transformed into E. coli. The vectors may then be
transformed into R. erythropolis by electroporation, as described
by Kostichka et al., supra. The recombinants may be grown in
synthetic medium containing glucose and the production of 1-butanol
can be followed using methods known in the art.
[0113] Expression of the 1-Butanol Biosynthetic Pathway in Bacillus
subtilis
[0114] Methods for gene expression and creation of mutations in B.
Subtilis are also well known in the art. For example, the genes of
the 1-butanol biosynthetic pathway may be isolated from various
strains of Clostridium, cloned into a modified pUC19 vector and
transformed into Bacillus subtilis BE1010, as described in Example
16. Additionally, the six genes of the 1-biosynthetic pathway can
be split into two operons for expression, as described in Example
18. The first three genes of the pathway (thI, hbd, and crt) were
integrated into the chromosome of Bacillus subtilis BE1010 (Payne
and Jackson, J. Bacteriol. 173:2278-2282 (1991)). The last three
genes (EgTER, aid, and bdhB) were cloned into expression plasmids
and transformed into the Bacillus strain carrying the integrated
1-butanol genes
[0115] Expression of the 1-Butanol Biosynthetic Pathway in Bacillus
licheniformis
[0116] Most of the plasmids and shuttle vectors that replicate in
B. subtilis may be used to transform B. licheniformis by either
protoplast transformation or electroporation. For example, the
genes required for the production of 1-butanol may be cloned in
plasmids pBE20 or pBE60 derivatives (Nagarajan et al., Gene
114:121-126 (1992)). Methods to transform B. licheniformis are
known in the art (for example see Fleming et al. Appl. Environ.
Microbiol., 61(11):3775-3780 (1995)). The plasmids constructed for
expression in B. subtilis may also be transformed into B.
licheniformis to produce a recombinant microbial host that produces
1-butanol.
[0117] Expression of the 1-Butanol Biosynthetic Pathway in
Paenibacillus macerans
[0118] Plasmids may be constructed as described above for
expression in B. subtilis and used to transform Paenibacillus
macerans by protoplast transformation to produce a recombinant
microbial host that produces 1-butanol.
[0119] Expression of the 1-Butanol Biosynthetic Pathway in
Alcaligenes (Ralstonia) eutrophus
[0120] Methods for gene expression and creation of mutations in
Ralstonia eutrophus are known in the art (see for example Taghavi
et al., Appl. Environ. Microbiol., 60(10):3585-3591 (1994)). The
genes for the 1-butanol biosynthetic pathway may be cloned in any
of the broad host range vectors described above, and electroporated
to generate recombinants that produce 1-butanol. The polyhydroxy
butyrate pathway in Ralstonia has been described in detail and a
variety of genetic techniques to modify the Ralstonia eutrophus
genome is known, and those tools can be applied for engineering the
1-butanol biosynthetic pathway.
Expression of the 1-Butanol Biosynthetic Pathway in Pseudomonas
Putida
[0121] Methods for gene expression in Pseudomonas putida are known
in the art (see for example Ben-Bassat et al., U.S. Pat. No.
6,586,229, which is incorporated herein by reference). For example,
the 1-butanol pathway genes may be inserted into pPCU18 and this
ligated DNA may be electroporated into electrocompetent Pseudomonas
putida DOT-T1 C5aAR1 cells to generate recombinants that produce
1-butanol.
[0122] Expression of the 1-Butanol Biosynthetic Pathway in
Saccharomyces cerevisiae
[0123] Methods for gene expression in Saccharomyces cerevisiae are
known in the art (see for example Methods in Enzymology, Volume
194, Guide to Yeast Genetics and Molecular and Cell Biology (Part
A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier
Academic Press, San Diego, Calif.). Expression of genes in yeast
typically requires a promoter, followed by the gene of interest,
and a transcriptional terminator. A number of yeast promoters can
be used in constructing expression cassettes for genes encoding the
1-butanol biosynthetic pathway, including, but not limited to
constitutive promoters FBA, GPD, and GPM, and the inducible
promoters GAL1, GAL10, and CUP1. Suitable transcriptional
terminators include, but are not limited to FBAt, GPDt, GPMt,
ERG10t, and GAL1t. Suitable promoters, transcriptional terminators,
and the genes of the 1-butanol biosynthetic pathway may be cloned
into yeast 2 micron (2.mu.) plasmids, as described in Example
21.
[0124] Expression of the 1-Butanol Biosynthetic Pathway in
Lactobacillus plantarum
[0125] The Lactobacillus genus belongs to the Lactobacillales
family and many plasmids and vectors used in the transformation of
Bacillus subtilis and Streptococcus may be used for lactobacillus.
Non-limiting examples of suitable vectors include pAM.beta.1 and
derivatives thereof (Renault et al., Gene 183:175-182 (1996); and
O'Sullivan et al., Gene 137:227-231 (1993)); pMBB1 and pHW800, a
derivative of pMBB1 (Wyckoff et al. Appl. Environ. Microbiol.
62:1481-1486 (1996)); pMGI, a conjugative plasmid (Tanimoto et al.,
J. Bacteriol. 184:5800-5804 (2002)); pNZ9520 (Kleerebezem et al.,
Appl. Environ. Microbiol. 63:4581-4584 (1997)); pAM401 (Fujimoto et
al., Appl. Environ. Microbiol. 67:1262-1267 (2001)); and pAT392
(Arthur et al., Antimicrob. Agents Chemother. 38:1899-1903 (1994)).
Several plasmids from Lactobacillus plantarum have also been
reported (e.g., van Kranenburg R, Golic N, Bongers R, Leer R J, de
Vos W M, Siezen R J, Kleerebezem M. Appl. Environ. Microbiol. 2005
March; 71(3): 1223-1230). For example, expression of the 1-butanol
biosynthetic pathway in Lactobacillus plantarum is described in
Example 22.
[0126] Expression of the 1-Butanol Biosynthetic Pathway in
Enterococcus faecium, Enterococcus gallinarium, and Enterococcus
faecalis
[0127] The Enterococcus genus belongs to the Lactobacillales family
and many plasmids and vectors used in the transformation of
Lactobacillus, Bacillus subtilis, and Streptococcus may be used for
Enterococcus. Non-limiting examples of suitable vectors include
pAM.beta.1 and derivatives thereof (Renault et al., Gene
183:175-182 (1996); and O'Sullivan et al., Gene 137:227-231
(1993)); pMBB1 and pHW800, a derivative of pMBB1 (Wyckoff et al.
Appl. Environ. Microbiol. 62:1481-1486 (1996)); pMGI, a conjugative
plasmid (Tanimoto et al., J. Bacteriol. 184:5800-5804 (2002));
pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol. 63:4581-4584
(1997)); pAM401 (Fujimoto et al., Appl. Environ. Microbiol.
67:1262-1267 (2001)); and pAT392 (Arthur et al., Antimicrob. Agents
Chemother. 38:1899-1903 (1994)). Expression vectors for E. faecalis
using the nisA gene from Lactococcus may also be used (Eichenbaum
et al., Appl. Environ. Microbiol. 64:2763-2769 (1998).
Additionally, vectors for gene replacement in the E. faecium
chromosome may be used (Nallaapareddy et al., Appl. Environ.
Microbiol. 72:334-345 (2006)). For example, expression of the
1-butanol biosynthetic pathway in Enterococcus faecalis is
described in Example 23.
Fermentation Media
[0128] Fermentation media in the present invention must contain
suitable carbon substrates. Suitable substrates may include but are
not limited to monosaccharides such as glucose and fructose,
oligosaccharides such as lactose or sucrose, polysaccharides such
as starch or cellulose or mixtures thereof and unpurified mixtures
from renewable feedstocks such as cheese whey permeate, cornsteep
liquor, sugar beet molasses, and barley malt. Additionally the
carbon substrate may also be one-carbon substrates such as carbon
dioxide, or methanol for which metabolic conversion into key
biochemical intermediates has been demonstrated. In addition to one
and two carbon substrates methylotrophic organisms are also known
to utilize a number of other carbon containing compounds such as
methylamine, glucosamine and a variety of amino acids for metabolic
activity. For example, methylotrophic yeast are known to utilize
the carbon from methylamine to form trehalose or glycerol (Bellion
et al., Microb. Growth C.sub.1 Compd., [Int. Symp.], 7th (1993),
415-32. Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher:
Intercept, Andover, UK). Similarly, various species of Candida will
metabolize alanine or oleic acid (Sutter et al., Arch. Microbiol.
153:485-489 (1990)). Hence it is contemplated that the source of
carbon utilized in the present invention may encompass a wide
variety of carbon containing substrates and will only be limited by
the choice of organism.
[0129] Although it is contemplated that all of the above mentioned
carbon substrates and mixtures thereof are suitable in the present
invention, preferred carbon substrates are glucose, fructose, and
sucrose. Sucrose may be derived from renewable sugar sources such
as sugar cane, sugar beets, cassava, sweet sorghum, and mixtures
thereof. Glucose and dextrose may be derived from renewable grain
sources through saccharification of starch based feedstocks
including grains such as corn, wheat, rye, barley, oats, and
mixtures thereof. In addition, fermentable sugars may be derived
from renewable cellulosic or lignocellulosic biomass through
processes of pretreatment and saccharification, as described, for
example, in co-owned and co-pending U.S. Patent Application
Publication No. 2007/0031918A1, which is herein incorporated by
reference. Biomass refers to any cellulosic or lignocellulosic
material and includes materials comprising cellulose, and
optionally further comprising hemicellulose, lignin, starch,
oligosaccharides and/or monosaccharides. Biomass may also comprise
additional components, such as protein and/or lipid. Biomass may be
derived from a single source, or biomass can comprise a mixture
derived from more than one source; for example, biomass may
comprise a mixture of corn cobs and corn stover, or a mixture of
grass and leaves. Biomass includes, but is not limited to,
bioenergy crops, agricultural residues, municipal solid waste,
industrial solid waste, sludge from paper manufacture, yard waste,
wood and forestry waste. Examples of biomass include, but are not
limited to, corn grain, corn cobs, crop residues such as corn
husks, corn stover, grasses, wheat, wheat straw, barley, barley
straw, hay, rice straw, switchgrass, waste paper, sugar cane
bagasse, sorghum, soy, components obtained from milling of grains,
trees, branches, roots, leaves, wood chips, sawdust, shrubs and
bushes, vegetables, fruits, flowers, animal manure, and mixtures
thereof.
[0130] In addition to an appropriate carbon source, fermentation
media must contain suitable minerals, salts, cofactors, buffers and
other components, known to those skilled in the art, suitable for
the growth of the cultures and promotion of the enzymatic pathway
necessary for 1-butanol production.
Culture Conditions with Temperature Lowering
[0131] In the present method, the recombinant microbial production
host which produces 1-butanol is seeded into a fermentation medium
comprising a fermentable carbon substrate to create a fermentation
culture. The production host is grown in the fermentation culture
at a first temperature for a first period of time. The first
temperature is typically from about 25.degree. C. to about
40.degree. C.
[0132] Suitable fermentation media in the present invention include
common commercially prepared media such as Luria Bertani (LB)
broth, Sabouraud Dextrose (SD) broth or Yeast Medium (YM) broth.
Other defined or synthetic growth media may also be used, and the
appropriate medium for growth of the particular microorganism will
be known by one skilled in the art of microbiology or fermentation
science. The use of agents known to modulate catabolite repression
directly or indirectly, e.g., cyclic adenosine 2':3'-monophosphate,
may also be incorporated into the fermentation medium.
[0133] Suitable pH ranges for the fermentation are between pH 5.0
to pH 9.0, where pH 6.0 to pH 8.0 is preferred as the initial
condition.
[0134] Fermentations may be performed under aerobic or anaerobic
conditions, where anaerobic or microaerobic conditions are
preferred.
[0135] The first period of time to grow the production host at the
first temperature may be determined in a variety of ways. For
example, during this period of growth a metabolic parameter of the
fermentation culture may be monitored. The metabolic parameter that
is monitored may be any parameter known in the art, including, but
not limited to the optical density, pH, respiratory quotient,
fermentable carbon substrate utilization, CO.sub.2 production, and
1-butanol production. During this period of growth, additional
fermentable carbon substrate may be added, the pH may be adjusted,
oxygen may be added for aerobic cells, or other culture parameters
may be adjusted to support the metabolic activity of the culture.
Though nutrients and culture conditions are supportive of growth,
after a period of time the metabolic activity of the fermentation
culture decreases as determined by the monitored parameter
described above. For example, a decrease in metabolic activity may
be indicated by a decrease in one or more of the following
parameters: rate of optical density change, rate of pH change, rate
of change in respiratory quotient (if the host cells are aerobic),
rate of fermentable carbon substrate utilization, rate of 1-butanol
production, rate of change in CO.sub.2 production, or rate of
another metabolic parameter. The decrease in metabolic activity is
related to the sensitivity of the host cells to the production of
1-butanol and/or the presence of 1-butanol in the culture. When
decreased metabolic activity is detected, the temperature of the
fermentation culture is lowered to reduce the sensitivity of the
host cells to 1-butanol and thereby allow further production of
1-butanol. In one embodiment, the lowering of the temperature
coincides with a change in the metabolic parameter that is
monitored.
[0136] In one embodiment, the change in metabolic activity is a
decrease in the rate of 1-butanol production. 1-Butanol production
may be monitored by analyzing the amount of 1-butanol present in
the fermentation culture medium as a function of time using methods
well known in the art, such as using high performance liquid
chromatography (HPLC) or gas chromatography (GC), which are
described in the Examples herein. GC is preferred due to the short
assay time.
[0137] Alternatively, the lowering of the temperature of the
fermentation culture may occur at a predetermined time. The first
period of time may be predetermined by establishing a correlation
between a metabolic parameter of the fermentation culture and time
in a series of test fermentations runs. A correlation between a
metabolic parameter, as described above, and time of culture growth
may be established for any 1-butanol producing host by one skilled
in the art. The specific correlation may vary depending on
conditions used including, but not limited to, carbon substrate,
fermentation conditions, and the specific recombinant 1-butanol
producing microbial production host. The correlation is most
suitably made between 1-butanol production or specific glucose
consumption rate and time of culture growth. Once the predetermined
time has been established from the correlation, the temperature of
the fermentation culture in subsequent fermentation runs is lowered
at the predetermined time. For example, if it is determined by
monitoring a metabolic parameter in the test fermentation runs that
the rate of production of 1-butanol decreases after 12 hours, the
temperature in subsequent fermentations runs is lowered after 12
hours without the need to monitor 1-butanol production in the
subsequent runs.
[0138] After the first period of time, the temperature of the
fermentation culture is lowered to a second temperature. Typically,
the second temperature is about 3.degree. C. to about 25.degree. C.
lower than the first temperature. Reduction in temperature to
enhance tolerance of the host cells to 1-butanol is balanced with
maintaining the temperature at a level where the cells continue to
be metabolically active for 1-butanol production. For example, a
fermentation culture that has been grown at about 35.degree. C. may
be reduced in temperature to about 28.degree. C.; or a culture
grown at about 30.degree. C. may be reduced in temperature to about
25.degree. C. The change in temperature may be done gradually over
time or may be made as a step change. The production host is
incubated at the second temperature for a second period of time, so
that 1-butanol production continues. The second period of time may
be determined in the same manner as the first period of time
described above, e.g., by monitoring a metabolic parameter or by
using a predetermined time.
[0139] Additionally, the temperature lowering and incubation steps
may be repeated one or more times to more finely balance metabolic
activity for 1-butanol production and 1-butanol sensitivity. For
example, a culture that has been grown at about 35.degree. C. may
be reduced in temperature to about 32.degree. C., followed by an
incubation period. During this period a metabolic parameter of the
fermentation culture may be monitored as described above, or a
predetermined time may be used. It is particularly suitable to
monitor the production of 1-butanol during this incubation period.
When monitoring indicates a decrease in metabolic activity or at a
predetermined time, the temperature may be reduced a second time.
For example, the temperature may be reduced from about 32.degree.
C. to about 28.degree. C. The temperature lowering and incubation
steps may be repeated a third time where the temperature is
reduced, for example, to about 20.degree. C. The production host is
incubated at the lowered temperature so that 1-butanol production
continues. The steps may be repeated further as necessary to obtain
the desired 1-butanol titer.
Industrial Batch and Continuous Fermentations
[0140] The present process employs a batch method of fermentation.
A classical batch fermentation is a closed system where the
composition of the medium is set at the beginning of the
fermentation and not subject to artificial alterations during the
fermentation. Thus, at the beginning of the fermentation the medium
is inoculated with the desired organism or organisms, and
fermentation is permitted to occur without adding anything to the
system. Typically, however, a "batch" fermentation is batch with
respect to the addition of carbon source and attempts are often
made at controlling factors such as pH and oxygen concentration. In
batch systems the metabolite and biomass compositions of the system
change constantly up to the time the fermentation is stopped.
Within batch cultures cells moderate through a static lag phase to
a high growth log phase and finally to a stationary phase where
growth rate is diminished or halted. If untreated, cells in the
stationary phase will eventually die. Cells in log phase generally
are responsible for the bulk of production of end product or
intermediate.
[0141] A variation on the standard batch system is the Fed-Batch
system. Fed-Batch fermentation processes are also suitable in the
present invention and comprise a typical batch system with the
exception that the substrate is added in increments as the
fermentation progresses. Fed-Batch systems are useful when
catabolite repression is apt to inhibit the metabolism of the cells
and where it is desirable to have limited amounts of substrate in
the media. Measurement of the actual substrate concentration in
Fed-Batch systems is difficult and is therefore estimated on the
basis of the changes of measurable factors such as pH, dissolved
oxygen and the partial pressure of waste gases such as CO.sub.2.
Batch and Fed-Batch fermentations are common and well known in the
art and examples may be found in Thomas D. Brock in Biotechnology:
A Textbook of Industrial Microbiology, Second Edition (1989)
Sinauer Associates, Inc., Sunderland, Mass., or Deshpande, Mukund
V., Appl. Biochem. Biotechnol., 36:227, (1992), herein incorporated
by reference.
[0142] Although the present invention is performed in batch mode it
is contemplated that the method would be adaptable to continuous
fermentation methods. Continuous fermentation is an open system
where a defined fermentation medium is added continuously to a
bioreactor and an equal amount of conditioned media is removed
simultaneously for processing. Continuous fermentation generally
maintains the cultures at a constant high density where cells are
primarily in log phase growth.
[0143] Continuous fermentation allows for the modulation of one
factor or any number of factors that affect cell growth or end
product concentration. For example, one method will maintain a
limiting nutrient such as the carbon source or nitrogen level at a
fixed rate and allow all other parameters to moderate. In other
systems a number of factors affecting growth can be altered
continuously while the cell concentration, measured by media
turbidity, is kept constant. Continuous systems strive to maintain
steady state growth conditions and thus the cell loss due to the
medium being drawn off must be balanced against the cell growth
rate in the fermentation. Methods of modulating nutrients and
growth factors for continuous fermentation processes as well as
techniques for maximizing the rate of product formation are well
known in the art of industrial microbiology and a variety of
methods are detailed by Brock, supra.
[0144] It is contemplated that the present invention may be
practiced using either batch, fed-batch or continuous processes and
that any known mode of fermentation would be suitable.
Additionally, it is contemplated that cells may be immobilized on a
substrate as whole cell catalysts and subjected to fermentation
conditions for 1-butanol production.
Methods for 1-Butanol Isolation from the Fermentation Medium
[0145] The bioproduced 1-butanol may be isolated from the
fermentation medium using methods known in the art. For example,
solids may be removed from the fermentation medium by
centrifugation, filtration, decantation, or the like. Then, the
1-butanol may be isolated from the fermentation medium, which has
been treated to remove solids as described above, using methods
such as distillation, liquid-liquid extraction, or membrane-based
separation. Because 1-butanol forms a low boiling point, azeotropic
mixture with water, distillation can only be used to separate the
mixture up to its azeotropic composition. Distillation may be used
in combination with another separation method to obtain separation
around the azeotrope. Methods that may be used in combination with
distillation to isolate and purify 1-butanol include, but are not
limited to, decantation, liquid-liquid extraction, adsorption, and
membrane-based techniques. Additionally, 1-butanol may be isolated
using azeotropic distillation using an entrainer (see for example
Doherty and Malone, Conceptual Design of Distillation Systems,
McGraw Hill, New York, 2001).
[0146] The 1-butanol-water mixture forms a heterogeneous azeotrope
so that distillation may be used in combination with decantation to
isolate and purify the 1-butanol. In this method, the 1-butanol
containing fermentation broth is distilled to near the azeotropic
composition. Then, the azeotropic mixture is condensed, and the
1-butanol is separated from the fermentation medium by decantation.
The decanted aqueous phase may be returned to the first
distillation column as reflux. The 1-butanol-rich decanted organic
phase may be further purified by distillation in a second
distillation column.
[0147] The 1-butanol may also be isolated from the fermentation
medium using liquid-liquid extraction in combination with
distillation. In this method, the 1-butanol is extracted from the
fermentation broth using liquid-liquid extraction with a suitable
solvent. The 1-butanol-containing organic phase is then distilled
to separate the 1-butanol from the solvent.
[0148] Distillation in combination with adsorption may also be used
to isolate 1-butanol from the fermentation medium. In this method,
the fermentation broth containing the 1-butanol is distilled to
near the azeotropic composition and then the remaining water is
removed by use of an adsorbent, such as molecular sieves (Aden et
al. Lignocellulosic Biomass to Ethanol Process Design and Economics
Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic
Hydrolysis for Corn Stover, Report NREL/TP-510-32438, National
Renewable Energy Laboratory, June 2002).
[0149] Additionally, distillation in combination with pervaporation
may be used to isolate and purify the 1-butanol from the
fermentation medium. In this method, the fermentation broth
containing the 1-butanol is distilled to near the azeotropic
composition, and then the remaining water is removed by
pervaporation through a hydrophilic membrane (Guo et al., J. Membr.
Sci. 245, 199-210 (2004)).
EXAMPLES
[0150] The present invention is further defined in the following
Examples. It should be understood that these Examples, while
indicating preferred embodiments of the invention, are given by way
of illustration only. From the above discussion and these Examples,
one skilled in the art can ascertain the essential characteristics
of this invention, and without departing from the spirit and scope
thereof, can make various changes and modifications of the
invention to adapt it to various uses and conditions.
General Methods
[0151] Standard recombinant DNA and molecular cloning techniques
used in the Examples are well known in the art and are described by
Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A
Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring
Harbor, (1989) (Maniatis) and by T. J. Silhavy, M. L. Bennan, and
L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. (1984) and by Ausubel,
F. M. et al., Current Protocols in Molecular Biology, pub. by
Greene Publishing Assoc. and Wiley-Interscience (1987).
[0152] Materials and methods suitable for the maintenance and
growth of bacterial cultures are well known in the art. Techniques
suitable for use in the following examples may be found as set out
in Manual of Methods for General Bacteriology (Phillipp Gerhardt,
R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A.
Wood, Noel R. Krieg and G. Briggs Phillips, eds), American Society
for Microbiology, Washington, D.C. (1994)) or by Thomas D. Brock in
Biotechnology: A Textbook of Industrial Microbiology, Second
Edition, Sinauer Associates, Inc., Sunderland, Mass. (1989). All
reagents, restriction enzymes and materials used for the growth and
maintenance of bacterial cells were obtained from Aldrich Chemicals
(Milwaukee, Wis.), BD Diagnostic Systems (Sparks, Md.), Life
Technologies (Rockville, Md.), or Sigma Chemical Company (St.
Louis, Mo.) unless otherwise specified. Microbial samples were
obtained from The American Type Culture Collection (ATCC; Manassas,
Va.) unless otherwise noted.
[0153] The oligonucleotide primers used for cloning in the
following Examples are given in Table 4. The primers used to
sequence or screen the cloned genes are given in Table 5. All the
oligonucleotide primers were synthesized by Sigma-Genosys
(Woodlands, Tex.).
TABLE-US-00004 TABLE 4 Oligonucleotide Cloning Primers Primer SEQ
ID Gene Name Sequence NO: Description crt N3 CACCATGGAACTAAACA 17
crt ATGTCATCCTTG forward crt N4 CCTCCTATCTATTTTTGA 18 crt AGCCTTC
reverse hbd N5 CACCATGAAAAAGGTAT 19 hbd GTGTTATAGGT forward hbd N6
CATTTGATAATGGGGAT 20 hbd TCTTGT reverse thlA N7 CACCATGAAAGAAGTTG
21 thlA TAATAGCTAGTGC forward thlA N8 CTAGCACTTTTCTAGCA 22 thlA
ATATTGCTG reverse bdhA N9 CACCATGCTAAGTTTTG 23 bdhA ATTATTCAATAC
forward bdhA N10 TTAATAAGATTTTTTAAA 24 bdhA TATCTCA reverse bdhB
N11 CACCATGGTTGATTTCG 25 bdhB AATATTCAATACC forward bdhB N12
TTACACAGATTTTTTGAA 26 bdhB TATTTGT reverse thlB N15
CACCATGAGAGATGTAG 27 thlB TAATAGTAAGTGCTG forward thlB N16
CCGCAATTGTATCCATA 28 thlB TTGAACC reverse CAC0462 N17
CACCATGATAGTAAAAG 29 CAC0462 CAAAGTTTG forward CAC0462 N21
GCTTAAAGCTTAAAACC 30 CAC0462 GCTTCTGGCG reverse ald N27F1
CACCATGAATAAAGACA 31 ald forward CACTAATACC ald N28R1
GCCAGACCATCTTTGAA 32 ald reverse AATGCGC thlA N44 CATGCATGCAAAGGAGG
33 thlA TTAGTAGAATGAAAGAAG forward thlA N45 GTCCTGCAGGGCGCGC 34
thlA CCAATACTTTCTAGCAC reverse TTTTC hbd N42 CATGTCGACAAAGGAGG 35
hbd TCTGTTTAATGAAAAAG forward GTATG hbd N43 GTCGCATGCCTTGTAAA 36
hbd CTTATTTTGAA reverse CAC0462 N68 CATAGATCTGGATCCAA 37 CAC0462
AGGAGGGTGAGGAAAT forward GATAGTAAAAG CAC0462 N69 CATGTCGACGTGCAGCC
38 CAC0462 TTTTTAAGGTTCT reverse crt N38 CATGAATTCACGCGTAA 39 crt
forward AGGAGGTATTAGTCATG GAAC crt N39 GTCGGATCCCTTACCTC 40 crt
reverse CTATCTATTTTTG ald N58 CATGCCCGGGGGTCAC 41 ald forward
CAAAGGAGGAATAGTTC ATGAATAAA ald N59 CATGGTTAACAAGAAGT 42 ald
reverse TAGCCGGCAAGTACA bdhB N64 CATGGTTAACAAAGGAG 43 bdhB
GGGTTAAAATGGTTGAT forward TTCGAAT bdhB N65 CATGGCATGCGTTTAAA 44
bdhB CGTAGGTTTACACAGAT reverse TTT -- BenF ACTTTCTTTCGCCTGTTT 73 --
CAC -- BenMAR CATGAAGCTTGGCGCG 74 -- CCGGGACGCGTTTTTGA
AAATAATGAAAACT -- BenBPR CATGAAGCTTGTTTAAA 75 -- CTCGGTGACCTTGAAAA
TAATGAAAACTTATATTG TTTTGAAAATAATGAAAA CTTATATTG EgTER N85
CATAGATCTGGATCCAA 80 Egter (opt) AGGAGGGTGAGGAAAT forward
GGCGATGTTTACG EgTER N86 GTCGACTTACTGCTGGG 81 Egter (opt) CGG
reverse Ptrc-ald T-Ptrc TTCCGTACTTCCGGACG 87 Ptrc (opt) (BspEI)
ACTGCACGGTGCACCAA forward TGCTTCTG Ptrc-ald B-aldopt
CGGATCTTAAGTACTTT 88 ald reverse (opt) (Scat) AAC CCGCCAGCACACAGCG
GCGCTGG ald AF CATTGGATCCATGAATA 93 ald forward BamHI
AAGACACACTAATACCT ACAAC ald AR Aat2 CATGACGTCACTAGTGT 94 ald
reverse TAACAAGAAGTTAGCCG GCAAG EgTER Forward CATGTTAACAAAGGAGG 95
EgTER 1 (E) AAAGATCTATGGCGATG SOE TTTACGACCACCGCAA forward EgTER
Bottom CCCCTCCTTTGGCGCGC 96 EgTER Reverse CTTACTGCTGGGCGGC SOE I
(E) GCTCGGCAGA reverse bdh Top GCCCAGCAGTAAGGCG 97 bdh SOE Forward
CGCCAAAGGAGGGGTT forward 2 (B) AAAATGGTTGATTTCGA AT bdh Reverse
GTCGACGTCATACTAGT 98 bdh SOE 2 (B) TTACACAGATTTTTTGAA reverse
TATTTGT -- Pamy/ CATTGTACAGAATTCGA 99 Pamy lacO F GCTCTCGAGGCCCCGC
forward ACATACGAAAAGAC -- Pamy/ CATTGTACAGTTTAAACA 100 Pamy lacO R
TAGGTCACCCTCATTTT reverse CGTAGGAATTGTTATCC -- Spac F
CATCTCGAGTAATTCTA 101 Pspac CACAGCCCAGTCC forward -- Spac R
CATGTTTAAACGGTGAC 102 Pspac CCAAGCTGGGGATCCG reverse CGG thl Top TF
CATTGGTCACCATTCCC 103 thl SOE GGGCATGCAAAGGAGG Forward TTAGTAGAATG
thl Bot TR CCTTTACGCGACCGGTA 104 thl SOE CTAGTCAAGTCGACAGG reverse
GCGCGCCCAATACTTTC crt Top CF CGCGCCCTGTCGACTTG 105 crt SOE
ACTAGTACCGGTCGCGT forward AAAGGAGGTATTAGTCA TGGAAC crt Bot CR
CATCGTTTAAACTTGGA 106 crt SOE TCCAGATCCCTTACCTC reverse CTAT ERG10-
OT731 AAAGCTGGAGCTCCACC 164 ERG10- ERG10t GCGGTGGCGGCCGCTC ERG10t
TAGAAGTTTTCAAAGCA forward GAGTTTCGTTTGAATATT TTACCA ERG10- OT732
TTCAATATGCATGCCTC 165 ERG10- ERG10t AGAACGTTTACATTGTAT ERG10t
CGACTGCCAGAACCC reverse GAL1- OT733 GCAGTCGATACAATGTA 166 GAL1-
GAL10 AACGTTCTGAGGCATGC GAL10 ATATTGAATTTTCAAAAA forward
TTCTTACTTTTTTTTTGG ATGGACGCA GAL1- OT734 ACCTGCACCTATAACAC 167
GAL1- GAL10 ATACCTTTTCCATGGTA GAL10 GTTTTTTCTCCTTGACGT reverse
TAAAGTATAGAGGTATA TTA hbd OT735 AAAAACTACCATGGAAA 168 hbd
AGGTATGTGTTATAGGT forward GCAGGTACTATGGGTTC AGGAATTGC hbd OT736
GTAAAAAAAAGAAGGCC 169 hbd GTATAGGCCTTATTTTG reverse
AATAATCGTAGAAACCT TTTCCTGATTTTCTTCCA AG GAL1t OT737
ACGATTATTCAAAATAAG 170 GAL1t GCCTATACGGCCTTCTT forward
TTTTTTACTTTGTTCAGA ACAACTTCTCATTTTTTT CTACTCATAA GAL1t OT738
GAATTGGGTACCGGGC 171 GAL1t CCCCCCTCGAGGTCGA reverse
CCGATGCCTCATAAACT TCGGTAGTTATATTACTC TGAGAT thlA OT797
AAAGTAAGAATTTTTGAA 172 thlA AATTCAATATGCATGCA forward
AGAAGTTGTAATAGCTA GTGCAGTAAGAAC thlA OT798 GAAAAAGATCATGAGAA 173
thlA AATCGCAGAACGTAAGG reverse CGCGCCTCAGCACTTTT CTAGCAATATTGCTGTT
CCTTG CUP1 OT806 CTCGAAAATAGGGCGC 174 CUP1 GCCCCCATTACCGACAT
forward TTGGGCGC CUP1 OT807 ACTGCACTAGCTATTAC 175 CUP1
AACTTCTTGCATGCGTG reverse ATGATTGATTGATTGATT GTA GPD OT808
TCGGTAATGGGGGCGC 176 GPD promoter GCCCTATTTTCGAGGAC promoter
CTTGTCACCTTGA forward GPD OT809 TTTCGAATAAACACACAT 177 GPD promoter
AAACAAACACCCCATGG promoter AAAAGGTATGTGTTATA reverse GGTGCAGG FBA1
OT799 TACCGGGCCCCCCCTC 178 FBA1 promoter GAGGTCGACGGCGCGC promoter
CACTGGTAGAGAGCGA forward CTTTGTATGCCCCA FBA1 OT761
CTTGGCCTTCACTAGCA 179 FBA1 promoter TGCTGAATATGTATTACT promoter
TGGTTATGGTTATATATG reverse ACAAAAG GPM1 OT803 CCCTCACTAAAGGGAAC 180
GPM1 promoter AAAAGCTGGAGCTCGAT promoter ATCGGCGCGCCCACAT forward
GCAGTGATGCACGCGC GA GPM1 OT804 AAGGATGACATTGTTTA 181 GPM1 promoter
GTTCCATGGTTGTAATA promoter TGTGTGTTTGTTTGG reverse crt OT785
CACACATATTACAACCA 182 Crt forward TGGAACTAAACAATGTC
ATCCTTGAAAAGGAAGG crt OT786 ATCATTCATTGGCCATT 183 Crt reverse
CAGGCCTTATCTATTTTT GAAGCCTTCAATTTTTCT TTTCTCTATG GPM1t OT787
CAAAAATAGATAAGGCC 184 GPM1t terminator TGAATGGCCAATGAATG terminator
ATTTGATGATTTCTTTTT forward CCCTCCATTTTTC GPM1t OT805
GAATTGGGTACCGGGC 185 GPM1t terminator CCCCCCTCGAGGTCGA terminator
CTTATAGTATTATATTTT reverse CTGATTTGGTTATAGCA AGCAGCGTTT GPD OT800
GGGAACAAAAGCTGGA 190 GPD promoter GCTCCACCGCGGTGGG promoter
GCGCGCCCTATTTTCGA forward GGACCTTGTCACCTTGA GCC GPD OT758
TTAAGGTATCTTTATCCA 191 GPD promoter TGGTGTTTGTTTATGTGT promoter
GTTTATTCGAAACT reverse GPD OT754 TTGGGTACCGGGCCCC 192 GPD
terminator CCCTCGAGGTCGACTG terminator GCCATTAATCTTTCCCAT forward
AT GPD OT755 TGTGTCCTAGCAGGTTA 193 GPD terminator GGGCCTGCAGGGCCGT
terminator GAATTTACTTTAAATCTTG reverse FBA1 OT760 CGAAAATAGGGCGCGC
194 FBA1 promoter CACTGGTAGAGAGCGA promoter CTTTGTATGCCCCAATTG
forward FBA1 OT792 CCCTTGACGAACTTGGC 195 FBA1 promoter
CTTCACTAGCATGCTGA promoter ATATGTATTACTTGGTTA reverse
TGGTTATATATGACAAAAG FBA1 OT791 CCCTTGACGAACTTGGC 196 FBA1
terminator CTTCACTAGCATGCTGA terminator ATATGTATTACTTGGTTA forward
TGGTTATATATGACAAAAG FBA1 OT765 GGAACAAAAGCTGGAG 197 FBA1 terminator
CTCCACCGCGGTGGTTT terminator AACGTATAGACTTCTAAT reverse
ATATTTCTCCATACTTGG TATT ldhL LDH GACGTCATGACCACCCG 198 ldhL EcoRV
CCGATCCCTTTT forward F ldhL LDH GATATCCAACACCAGCG 199 ldhL AatIIR
ACCGACGTATTAC reverse Cm Cm F ATTTAAATCTCGAGTAG 200 Cm
AGGATCCCAACAAACGA forward AAATTGGATAAAG Cm Cm R ACGCGTTATTATAAAAG
201 Cm CCAGTCATTAGG reverse P11 P11 F TCGAGAGCGCTATAGTT 202 P11
GTTGACAGAATGGACAT promoter ACTATGATATATTGTTGC forward TATAGCGCCC
P11 P11 R GGGCGCTATAGCAACAA 203 P11 TATATCATAGTATGTCCA promoter
TTCTGTCAACAACTATA reverse GCGCTC PldhL PldhL F GAGCTCGTCGACAAACC
204 ldhL AACATTATGACGTGTCT promoter GGGC forward PldhL PldhL R
GGATCCTACCATGTTTG 205 ldhL TGCAAAATAAGTG promoter reverse PnisA
F-PnisA TTCAGTGATATCGACAT 206 PnisA (EcoRV) ACTTGAATGACCTAGTC
forward PnisA R-PnisA TTGATTAGTTTAAACTGT 207 PnisA (Pmel
AGGATCCTTTGAGTGCC reverse BamHI) TCCTTATAATTTA
TABLE-US-00005 TABLE 5 Sequencing and PCR Screening Primers Gene-
SEQ ID Name Sequence specific NO: M13 Forward GTAAAACGACGGCCAGT
TOPO 45 vector M13 Reverse AACAGCTATGACCATG TOPO 46 vector N7SeqF1
GCAGGAGATGCTGACGTAATAA thlA 47 N7SeqR1 CCAACCTGCTTTTTCAATAGCTGC
thlA 48 N15SegF1 CAGAGATGGGGTCAAAGAATG thlB 49 N16SeqR1
GTGGTTTTATTCCGAGAGCG thlB 50 N5SeqF2 GGTCTATACTTAGAATCTCC hbd 51
N6SeqR2 CGGAACAGTTGACCTTAATATGGC hbd 52 N22SeqF1
GCCTCATCTGGGTTTGGTCTTG CAC0426 53 N22SeqF2 CGCCTAGGAGAAAGGACTATAA
CAC0426 54 AACTGG N22SeqF3 CAGAGTTATAGGTGGTAGAGCC CAC0426 55
N23SeqR1 CCATCCCGCTGTTCCTATTCTTCT CAC0426 56 N23SeqR2
CCAATCCTCTCCACCCATTACC CAC0426 57 N23SeqR3 CGTCCATCCTTAATCTTCCC
CAC0426 58 N31SeqF2 CCAACTATGGAATCCCTAGATGC ald 59 N31SeqF3
GCATAGTCTGCGAAGTAAATGC ald 60 N31SeqF4 GGATCTACTGGTGAAGGCATAACC ald
61 N32SeqR1 GTTAGCCGGCAAGTACACATC ald 72 N32SeqR2
GGCATCATGAGTTCTGTCATGAC ald 62 N32SeqR3 GCCTTCAATGATACTCTTACCAGCC
ald 63 N32SeqR4 GCATTTCCAGCAGCTATCATGC ald 64 N32SeqR5
CCTTCCCATATGTGTTTCTTCC ald 65 N11SeqF1 GTTGAAGTAGTACTAGCTATAG bdhB
66 N11 SeqF2 GACATAACACACGGCGTAGGGC bdhB 67 N12SeqR1
TAAGTGTACACTCCAATTAGTG bdhB 68 N12SeqR2 GCCATCTAACACAATATCCCATGG
bdhB 69 N9SeqF1 GCGATACATGGGACATGGTTAAAG bdhA 70 N10SeqR1
TGCACTTAACTCGTGTTCCATA bdhA 71 T7Primer TAATACGACTCACTATAGGG pET23
82 vector Trc99aF TTGACAATTAATCATCCGGC p Trc99a 83 vector N5SeqF4
GGTCAACTGTTCCGGAAATTC hbd 84 T-ald(BamHI) TGATCTGGATCCAAGAAGGAGC
ald 85 CCTTCACCATGAATAAAGACACAC B-ald(EgTER)
CATCGCCATTTCCTCACCCTCCT ald 86 TTTTAGCCGGCAAGTACACATCT TCTTTGTC
N3SeqF1 CCATCATACCATACTGACCC crt 107 N3SeqF2 GCTACTGGAGCATTGCTCAC
crt 108 N3SeqF3 CCATTAACAGCTGCTATTACAGGC crt 109 N4SeqR3
GGTCTCGGAATAACACCTGG crt 110 N5SeqF3 CAAGCTTCATAACAGGAGCTGG hbd 111
N7SeqR2 ATCCCACAATCCGTCAGTGATC thlA 112 N31SeqF1
CTGAGATAAGAAAGGCCGCA ald 113 N62SeqF2 CAACCCTGGGCGTGTTTCTG EgTER
114 N62SeqF3 GTGGCGAAGATTGGGAACTG EgTER 115 N62SeqF4
GGGAAATGGCAGAAGATGTTCAGC EgTER 116 N63SeqR1
CGGTCTGATAACCTGCAAAATCGC EgTER 117 N63SeqR2 CACCAGCGCTTTGGCAACAAC
EgTER 118 N63SeqR3 GAACGTGCATACAGACCTGCTTC EgTER 119 N63SeqR4
CGGCTGAATAACTTTTGCGG EgTER 120 Pamy SeqF2 GCCTTTGATGACTGATGATTTGGC
pFP988 121 vector Pamy SeqF TCTCCGGTAAACATTACGGCAAAC pFP988 122
vector Pamy SeqR CGGTCAGATGCAATTCGACATGTG pFP988 123 vector SpacF
Seq GAAGTGGTCAAGACCTCACT Pspac 124 promoter sacB Up
CGGGTTTGTTACTGATAAAGCAGG sacB 125 sacB Dn CGGTTAGCCATTTGCCTGCTTTTA
sacB 126 HT R ACAAAGATCTCCATGGACGCGT pHT01 127 vector Scr1
CCTTTCTTTGTGAATCGG csc 160 Scr2 AGAAACAGGGTGTGATCC csc 161 Scr3
AGTGATCATCACCTGTTGCC csc 162 Scr4 AGCACGGCGAGAGTCGACGG csc 163
Methods for Determining 1-Butanol Concentration in Culture
Media
[0154] The concentration of 1-butanol in the culture media can be
determined by a number of methods known in the art. For example, a
specific high performance liquid chromatography (HPLC) method
utilized a Shodex SH-1011 column with a Shodex SH-G guard column,
both purchased from Waters Corporation (Milford, Mass.), with
refractive index (RI) detection. Chromatographic separation was
achieved using 0.01 M H.sub.2SO.sub.4 as the mobile phase with a
flow rate of 0.5 mL/min and a column temperature of 50.degree. C.
1-Butanol had a retention time of 52.8 min under the conditions
used. Alternatively, gas chromatography (GC) methods are available.
For example, a specific GC method utilized an HP-INNOWax column (30
m.times.0.53 mm id, 1 .mu.m film thickness, Agilent Technologies,
Wilmington, Del.), with a flame ionization detector (FID). The
carrier gas was helium at a flow rate of 4.5 mL/min, measured at
150.degree. C. with constant head pressure; injector split was 1:25
at 200.degree. C.; oven temperature was 45.degree. C. for 1 min, 45
to 220.degree. C. at 10.degree. C./min, and 220.degree. C. for 5
min; and FID detection was employed at 240.degree. C. with 26
mL/min helium makeup gas. The retention time of 1-butanol was 5.4
min. A similar GC method using a Varian CP-WAX 58(FFAP) CB column
(25 m.times.0.25 mm id.times.0.2 .mu.m film thickness, Varian,
Inc., Palo Alto, Calif.) was also used.
[0155] The meaning of abbreviations is as follows: "s" means
second(s), "min" means minute(s), "h" means hour(s), "psi" means
pounds per square inch, "nm" means nanometers, "d" means day(s),
".mu.L" means microliter(s), "mL" means milliliter(s), "L" means
liter(s), "mm" means millimeter(s), "nm" means nanometers, "mM"
means millimolar, "M" means molar, "mmol" means millimole(s),
".mu.mole" means micromole(s)", "g" means gram(s), ".mu.g" means
microgram(s) and "ng" means nanogram(s), "PCR" means polymerase
chain reaction, "OD" means optical density, "OD.sub.600" means the
optical density measured at a wavelength of 600 nm, OD.sub.550''
means the optical density measured at a wavelength of 550 nm, "kDa"
means kilodaltons, "g" means the gravitation constant, "rpm" means
revolutions per minute, "bp" means base pair(s), "kbp" means
kilobase pair(s), "% w/v" means weight/volume percent, % v/v''
means volume/volume percent, "nt" means not tested, "HPLC" means
high performance liquid chromatography, and "GC" means gas
chromatography.
Example 1
Increased Tolerance of Lactobacillus plantarum PN0512 to 1-Butanol,
Iso-Butanol and 2-Butanol at Decreased Growth Temperatures
[0156] Tolerance levels of bacterial strain Lactobacillus plantarum
PN0512 (ATCC #PTA-7727) were determined at 25.degree. C.,
30.degree. C. and 37.degree. C. as follows. The strain was cultured
in S30L medium (i.e., 10 mM ammonium sulfate, 5 mM potassium
phosphate buffer, pH 7.0, 50 mM MOPS, pH 7.0, 2 mM MgCl.sub.2, 0.7
mM CaCl.sub.2, 50 .mu.M MnCl.sub.2, 1 .mu.M FeCl.sub.3, 1 .mu.M
ZnCl.sub.2, 1.72 .mu.M CuCl.sub.2, 2.53 .mu.M
[0157] CoCl.sub.2, 2.42 .mu.M Na.sub.2MoO.sub.4, 2 .mu.M thiamine
hydrochloride, 10 mM glucose, and 0.2% yeast extract). An overnight
culture in the absence of any test compound was started in 15 mL of
the S30L medium in a 150 mL flask, with incubation at 37.degree. C.
in a shaking water bath. The next morning, the overnight culture
was diluted into three 500 mL flasks containing 150 mL of fresh
medium to an initial OD.sub.600 of about 0.08. Each flask was
incubated in a shaking water bath, one each at 25.degree. C.,
30.degree. C. and 37.degree. C. Each large culture was allowed to
acclimate at the test temperature for at least 0.5 h. After the
acclimation period, each large culture was split into flasks in the
absence (control) and in the presence of various amounts of
1-butanol, isobutanol or 2-butanol, as listed in Tables 6, 7, and
8, respectively. Growth was followed by measuring OD.sub.600 for
six hours after addition of the compounds. The results are
summarized in Tables 6, 7, and 8 below.
TABLE-US-00006 TABLE 6 Growth of L. plantarum PN0512 in the
presence of 1-butanol at different temperatures Concentration 1-
butanol (% w/v) 37.degree. C. 30.degree. C. 25.degree. C. 0.0 + + +
1.0 + nt nt 1.2 + nt nt 1.4 + nt nt 1.5 + + + 1.6 + nt nt 1.8 + nt
nt 2.0 + + + 2.1 + nt nt 2.2 + nt nt 2.3 + nt nt 2.4 - + + 2.5 - nt
nt 2.7 - + nt 2.9 - - + 3.1 - - + 3.2 nt - - 3.3 nt nt - 3.4 nt -
-
TABLE-US-00007 TABLE 7 Growth of L. plantarum PN0512 in the
presence of isobutanol at different temperatures Concentration
isobutanol (% w/v) 37.degree. C. 30.degree. C. 25.degree. C. 0.0 +
+ + 0.5 + nt nt 1.0 + nt nt 1.5 + + + 1.6 + nt nt 1.8 + nt nt 2.0 +
+ + 2.1 + nt nt 2.3 + nt nt 2.4 + + + 2.5 + nt nt 2.7 + + + 2.9 + +
+ 3.1 + + + 3.3 nt - + 3.4 - nt nt 3.5 nt nt + 3.6 nt nt - 3.8 - nt
nt 4.3 - nt nt
TABLE-US-00008 TABLE 8 Growth of L. plantarum PN0512 in the
presence of 2-butanol at different temperatures Concentration 2-
butanol (% w/v) 37.degree. C. 30.degree. C. 25.degree. C. 0.0 + + +
1.8 + nt nt 2.1 + nt nt 2.5 + nt nt 2.9 + + + 3.1 + nt nt 3.5 + nt
nt 3.6 + nt nt 3.8 + + + 4.0 nt + nt 4.3 + + + 4.5 - + nt 4.7 - + +
4.9 nt - + 5.2 - nt + 5.6 - nt - 6.0 - nt nt 6.4 - nt nt 7.3 - nt
nt "+" = growth observed as an increase in OD.sub.600. "-" = no
growth observed, i.e. no change in OD.sub.600.
[0158] All three butanols showed a similar effect of temperature on
growth inhibition of L. plantarum PN0512. The concentration that
resulted in full growth inhibition was greater at 25.degree. C.
than at 37.degree. C. In the case of 1-butanol, growth was observed
at 37.degree. C. in 2.3% 1-butanol, but not 2.4%. However, at
30.degree. C. growth was observed in 2.7%, but not 2.9%, and at
25.degree. C. growth was observed even in 3.1% 1-butanol. Thus, the
concentration of 1-butanol that completely inhibited growth
increased as growth temperature decreased. Likewise, in the case of
isobutanol, growth was observed in 3.5% at 25.degree. C. while
growth was observed in 3.1% at 30.degree. C. and 37.degree. C., but
not in 3.3% or 3.4%. Similarly, in the case of 2-butanol growth was
observed at 37.degree. C. in 4.3%, but not in 4.5%; at 30.degree.
C. in 4.7%, but not in 4.9%; and at 25.degree. C. in 5.2%. Thus the
tolerance of L. plantarum PN0512 to butanols increased with
decreased growth temperature.
Example 2
Increased Tolerance of Escherichia coli to 1-Butanol at Decreased
Exposure Temperature
[0159] The effect of growth and exposure temperature on survival of
Escherichia coli in the presence of 1-butanol was tested using
stationary phase cultures in a rich medium and log phase cultures
in a defined medium. For the stationary phase studies, E. coli
strain MG1655 (ATCC #700926) was grown overnight in LB medium
(Teknova, Half Moon Bay, Calif.) with shaking at 250 rpm at
42.degree. C., 29.degree. C. or 28.degree. C. Survival of 1-butanol
shock was tested at exposure temperatures of 0.degree. C.,
28.degree. C. or 42.degree. C. The 1-butanol exposure at 28.degree.
C. or 42.degree. C. was started immediately after removing the
overnight cultures from the growth incubators. The 1-butanol
exposure at 0.degree. C. was done after allowing the overnight
cultures to cool on ice for about 15 min. A series of solutions of
1-butanol at different concentrations in LB medium was made and 90
.mu.L aliquots were put in microfuge tubes. To these were added 10
.mu.L of the overnight cultures and the tubes were immediately
placed in shaking incubators at 42.degree. C. or 28.degree. C. or
left on ice for 30 min. To stop the effect of 1-butanol on the
cultures, a 10.sup.-2 dilution was done by placing 2 .mu.L of the
treated culture into 198 .mu.L of LB medium in wells of a
microplate. Then, 5 .mu.L of the undiluted treated cultures were
spotted on LB agar plates. Subsequent 10-fold serial dilutions of
10.sup.-3, 10.sup.-4, 10.sup.-5 and 10.sup.-6 of the exposed
cultures were done by serial pipetting of 20.mu.L, starting with
the 10.sup.-2 dilution cultures, into 180 .mu.L of LB medium in the
microplate, using a multi-channel pipette. Prior to each transfer,
the cultures were mixed by pipetting up and down six times. Each
dilution (5 .mu.L) was spotted onto an LB plate using a
multi-channel pipette and allowed to soak into the plate. The
plates were inverted and incubated overnight at 37.degree. C. The
number of colonies for each dilution was counted and the % growth
inhibition was calculated by comparison with a control culture that
had not been exposed to 1-butanol. Survival of 0% was recorded when
no colonies in the spots of the undiluted or any of the serial
dilutions were observed. The results are shown in Table 9.
TABLE-US-00009 TABLE 9 Survival of stationary phase E. coli in
1-butanol at 42.degree. C., 28.degree. C., or 0.degree. C. Grown at
Grown at Grown at Grown at Grown at Grown at 42.degree. C.
29.degree. C. 42.degree. C. 28.degree. C. 42.degree. C. 29.degree.
C. % survival after % survival after % survival after 1-Butanol 30
min exposure 30 min exposure 30 min exposure % (w/v) at 42.degree.
C. at 28.degree. C. at 0.degree. C. 1.0 100 100 100 100 100 100 1.5
0.1 0.1 100 100 100 100 2.0 0 0.1 100 100 100 100 2.5 0 0 100 100
100 100 3.0 0 0 100 100 100 100 3.5 0 0 3 10 100 100 4.0 0 0 0.0004
0.0003 100 100 5.0 nt nt nt nt 1 1 6.0 nt nt nt nt 0 0.001 7.0 nt
nt nt nt 0 0
[0160] A similar study was done with log-phase cultures of E. coli
grown in a defined medium. E. coli strain MG1655 was allowed to
grow overnight in MOPS 0.2% glucose medium (Teknova, Half Moon Bay,
Calif.) at 42.degree. C. or 28.degree. C. The following day, the
cultures were diluted into fresh medium and allowed to grow at the
same temperature until in the log phase of growth. The OD.sub.600
was 0.74 for the 28.degree. C. culture and was 0.72 for the
42.degree. C. culture. Both of these log phase cultures were
exposed to 1-butanol at 42.degree. C., 28.degree. C. and 0.degree.
C. as follows. A series of solutions of 1-butanol at different
concentrations in MOPS 0.2% glucose medium was made and 90 .mu.L
aliquots were put in microfuge tubes. To these were added 10 .mu.L
of the log phase cultures and the tubes were immediately placed in
shaking incubators at 42.degree. C. or 28.degree. C. or left on ice
for 30 min. To stop the effect of 1-butanol on the cultures, a
10.sup.-2 dilution was done by placing 2 .mu.L of the treated
culture into 198 .mu.L of LB medium in wells of a microplate. Then
5 .mu.L of the undiluted treated cultures were spotted on LB agar
plates. Subsequent 10-fold serial dilutions of 10.sup.-3,
10.sup.-4, 10.sup.-5 and 10.sup.-6 of the exposed cultures were
done by serial pipetting of 20 .mu.L, starting with the 10.sup.-2
dilution cultures, into 180 of LB medium in the microplate, using a
multi-channel pipette. Prior to each transfer, the cultures were
mixed by pipetting up and down six times. Each dilution (5 .mu.L)
was spotted onto an LB plate using a multi-channel pipette and
allowed to soak into the plate. The plates were inverted and
incubated overnight at 37.degree. C. The number of colonies for
each dilution was counted and the % growth inhibition was
calculated by comparison with a control culture that had not been
exposed to 1-butanol. Survival of 0% was recorded when no colonies
in the spots of the undiluted or any of the serial dilutions were
observed. The results are shown in Table 10.
TABLE-US-00010 TABLE 10 Survival of log-phase E. coli in 1-butanol
at 42.degree. C., 28.degree. C., or 0.degree. C. Grown at Grown at
Grown at Grown at Grown at Grown at 42.degree. C. 28.degree. C.
42.degree. C. 28.degree. C. 42.degree. C. 29.degree. C. % survival
after % survival after % survival after 1-Butanol 30 min exposure
30 min exposure 30 min exposure % (w/v) at 42.degree. C. at
28.degree. C. at 0.degree. C. 1.0 100 100 nt nt nt nt 1.5 0 0 100
100 nt nt 2.0 0 0 100 100 nt nt 2.5 0 0 0.1 50 100 100 3.0 0 0 0 0
100 100 3.5 0 0 0.01 0 100 100 4.0 0 0 0.001 0 100 100 4.5 nt nt 0
0 100 100 5.0 nt nt nt nt 10 50 6.0 nt nt nt nt 1 1
[0161] For both the stationary phase and log-phase cultures of E.
coli MG1655, the growth temperature had very little, if any, effect
on the survival of a 1-butanol shock. However, the exposure
temperature had a major effect on the survival of E. coli to
1-butanol shock. As can be seen from the data in Tables 9 and 10,
the tolerance of E. coli MG1655 to 1-butanol increased with
decreasing exposure temperature.
Example 3
Increased Tolerance of Escherichia coli to 2-Butanone at Decreased
Exposure Temperature
[0162] The effect of exposure temperature on survival of
Escherichia coli in the presence of 2-butanone (also referred to
herein as methyl ethyl ketone or MEK) was tested as follows. E.
coli strain BW25113 (The Coli Genetic Stock Center (CGSC), Yale
University; #7636) was grown overnight in LB medium (Teknova, Half
Moon Bay, Calif.) with shaking at 250 rpm at 37.degree. C. Survival
of MEK shock was tested at exposure temperatures of 28.degree. C.
or 37.degree. C. A series of solutions of MEK at different
concentrations in LB medium was made and 90 .mu.L aliquots were put
in microfuge tubes. To these were added 10 .mu.L of the overnight
culture and the tubes were immediately placed in shaking incubators
at 37.degree. C. or 28.degree. C. for 30 min. To stop the effect of
MEK on the cultures, a 10.sup.-2 dilution was done by placing 2
.mu.L of the MEK treated culture into 198 .mu.L of LB medium in
wells of a microplate. Then 5 .mu.L of the undiluted treated
cultures were spotted on LB agar plates. Subsequent 10-fold serial
dilutions of 10.sup.-3, 10.sup.-4, 10.sup.-5 and 10.sup.-6 of the
exposed cultures were done by serial pipetting of 20 .mu.L,
starting with the 10.sup.-2 dilution cultures, into 180 .mu.L of LB
medium in the microplate, using a multi-channel pipette. Prior to
each transfer, the cultures were mixed by pipetting up and down six
times. Each dilution (5 .mu.L) was spotted onto LB plates using a
multi-channel pipette and allowed to soak into the plate. The
plates were inverted and incubated overnight at 37.degree. C. The
number of colonies for each dilution was counted and the % growth
inhibition was calculated by comparison with a control culture that
had not been exposed to MEK. Survival of 0% was recorded when no
colonies in the spots of the undiluted or any of the serial
dilutions were observed. The results, given as the average of
duplicate experiments, are shown in Table 11.
TABLE-US-00011 TABLE 11 Survival of E. coli in MEK at 37.degree. C.
and 28.degree. C. MEK % w/v % Survival at 37.degree. C. % Survival
at 28.degree. C. 0 100 100 4 100 100 6 0 100 8 0 0.002
[0163] Reducing the exposure temperature from 37.degree. C. to
28.degree. C. dramatically improved survival of E. coli to MEK
treatment. At 37.degree. C. there was full survival at 4% w/v and
no survival at 6% w/v, while at 28.degree. C. there was full
survival at 6% w/v. Thus, the tolerance of E. coli to MEK increased
with decreasing exposure temperature.
Example 4
Increased Tolerance of E. Coli and L. Plantarum PN0512 to 1-Butanol
at Decreased Exposure Temperature
[0164] This Example demonstrates that the toxic effects of
1-butanol and 2-butanol on various microbial cells was reduced at
lower temperatures. This was demonstrated by incubating E. coli
(strain MG1655; ATCC #700926), and L. plantarum (strain PN0512;
ATCC #PTA-7727) with either 1-butanol or 2-butanol at different
temperatures and then determining the fraction of the cells that
survived the treatment at the different temperatures.
[0165] Using overnight cultures or cells from plates, 30 mL
cultures of the microorganisms to be tested were started in the
following culture media: [0166] E. coli--Miller's LB medium
(Teknova, Half Moon Bay, Calif.): [0167] L. plantarum
PN0512--Lactobacilli MRS Broth (BD Diagnostic Systems, Sparks,
Md.). The E. coli and L. plantarum cultures were grown at
37.degree. C. aerobically with shaking until the cultures were in
log phase and the OD.sub.600 was between 0.6 and 0.8. A 50 .mu.L
aliquot of each culture was removed for a time zero sample. The
remainder of the cultures was divided into six 5 mL portions and
placed in six small incubation flasks or tubes. Different amounts
of 1-butanol or 2-butanol were added to the six flasks to bring the
concentration to predetermined values, as listed in the tables
below. The flasks or tubes were incubated at a desired temperature,
aerobically without shaking for 1 h. After the incubation with one
of the butanols, 2 .mu.L from each of the flasks (and in addition 2
.mu.L of the time zero sample of the culture before exposure to one
of the butanols) were pipetted into the "head" wells of a 96 well
(8.times.12) microtiter plate, each containing 198 .mu.L of LB
medium to give a 10.sup.-2 dilution of the culture. Subsequently,
10.sup.-3, 10.sup.-4, 10.sup.-5, and 10.sup.-6 serial dilutions of
the cultures were prepared as follows. The 10.sup.-3 dilution was
prepared by pipetting 20 .mu.L of the sample from the head well
into the 180 .mu.L LB medium in the next well using a multi-channel
pipette. This procedure was repeated 3 more times on successive
wells to prepare the 10.sup.-4, 10.sup.-5, and 10.sup.-6 dilutions.
After each liquid transfer, the solution in the well was mixed by
pipetting it up and down 10 times with the multi-channel pipetor. A
5 .mu.L aliquot of each dilution was spotted onto an LB plate using
a multi-channel pipette starting with the 10.sup.-6 dilution, then
the 10.sup.-6, and so on working from more to less dilute without a
change of tips. The spots were allowed to soak into the agar by
leaving the lid of the plate slightly open for 15 to 30 min in a
sterile transfer hood. The plates were covered, inverted, and
incubated overnight at 37.degree. C. The following day, the number
of colonies in the spots were counted from the different dilutions.
The number of living cells/mL in each of the original culture
solutions from which the 2 .mu.L was withdrawn was calculated and
compared to the number of cells in the control untreated culture to
determine the % of the cells surviving.
[0168] The results of experiments in which E. coli cells were
treated with 1-butanol at temperatures of 0, 30, and 37.degree. C.
are shown Table 12.
TABLE-US-00012 TABLE 12 Percentage of E. coli cells surviving in
1-butanol at 0, 30 and 37.degree. C. 1-butanol % Survival at %
Survival at % Survival at % v/v 0.degree. C. 30.degree. C.
37.degree. C. 0 100 100 100 1 nt 100 72 1.5 nt 100 20 2 nt 100 0
2.5 100 23 0 3 100 0 0 3.5 100 0 nt 4 100 nt nt 4.5 100 nt nt
[0169] The concentration at which 1-butanol kills E. coli cells was
affected by the treatment temperature. At 0.degree. C.,
concentrations of 1-butanol as high as 4.5% v/v had no toxic effect
on E. coli cells during a one hour treatment. At 30.degree. C., E.
coli cells were killed when treated with 3% v/v 1-butanol for one
hour. At 37.degree. C., E. coli cells were killed when treated with
2% v/v 1-butanol for one hour.
[0170] The results of experiments in which L. plantarum PN0512
cells were treated with 1-butanol at temperatures of 0, 23, and
37.degree. C. for one hour are shown Table 13.
TABLE-US-00013 TABLE 13 Percentage of L. plantarum PN0512 cells
surviving in 1-butanol at 0, 23 and 37.degree. C. 1-butanol %
Survival at % Survival at % Survival at % v/v 0.degree. C.
23.degree. C. 37.degree. C. 0 100 100 100 1 nt nt 80 1.5 nt nt 58 2
nt 100 29 2.5 nt 100 8 3 100 82 0 3.5 100 0 0 4 100 0 nt 4.5 100 0
nt 5 0 nt nt 5.5 0 nt nt
[0171] The concentration at which 1-butanol kills L. plantarum
PN0512 cells was affected by the treatment temperature. At
0.degree. C., concentrations of 1-butanol as high as 4.5% v/v had
no toxic effect on L. plantarum PN0512 cells during a one hour
treatment. At 23.degree. C., L. plantarum PN0512 cells were killed
when treated with 3.5% v/v 1-butanol for one hour. At 37.degree.
C., L. plantarum PN0512 cells were killed when treated with 2.5%
v/v 1-butanol for one hour.
Example 5
Cloning and Expression of Acetyl-CoA Acetyltransferase
[0172] The purpose of this Example was to express the enzyme
acetyl-CoA acetyltransferase, also referred to herein as
acetoacetyl-CoA thiolase, in E. coli. The acetoacetyl-CoA thiolase
gene thIA was cloned from C. acetobutylicum (ATCC 824) and
expressed in E. coli. The thIA gene was amplified from C.
acetobutylicum (ATCC 824) genomic DNA using PCR, resulting in a 1.2
kbp product.
[0173] The genomic DNA from Clostridium acetobutylicum (ATCC 824)
was either purchased from the American Type Culture Collection
(ATCC, Manassas, Va.) or was isolated from Clostridium
acetobutylicum (ATCC 824) cultures, as described below.
[0174] Genomic DNA from Clostridium acetobutylicum (ATCC 824) was
prepared from anaerobically grown cultures. The Clostridium strain
was grown in 10 mL of Clostridial growth medium (Lopez-Contreras et
al., Appl. Env. Microbiol. 69(2), 869-877 (2003)) in stoppered and
crimped 100 mL Bellco serum bottles (Bellco Glass Inc., Vineland,
N.J.) in an anaerobic chamber at 30.degree. C. The inoculum was a
single colony from a 2.times.YTG plate (Kishii, et al.,
Antimicrobial Agents & Chemotherapy, 47(1), 77-81 (2003)) grown
in a 2.5 L MGC AnaeroPak.TM. (Mitsubishi Gas Chemical America Inc,
New York, N.Y.) at 37.degree. C.
[0175] Genomic DNA was prepared using the Gentra Puregene.RTM. kit
(Gentra Systems, Inc., Minneapolis, Minn.; catalog no. D-6000A)
with modifications to the manufacturer's instruction (Wong et al.,
Current Microbiology, 32, 349-356 (1996)). The thIA gene was
amplified from Clostridium acetobutylicum (ATCC 824) genomic DNA by
PCR using primers N7 and N8 (see Table 4), given as SEQ ID NOs:21
and 22, respectively. Other PCR amplification reagents were
supplied in manufacturers' kits for example, Kod HiFi DNA
Polymerase (Novagen Inc., Madison, Wis.; catalog no. 71805-3) and
used according to the manufacturer's protocol. Amplification was
carried out in a DNA Thermocycler GeneAmp 9700 (PE Applied
Biosystems, Foster city, CA).
[0176] For expression studies the Gateway cloning technology
(Invitrogen Corp., Carlsbad, Calif.) was used. The entry vector
pENTR/SD/D-TOPO allowed directional cloning and provided a
Shine-Dalgarno sequence for the gene of interest. The destination
vector pDEST14 used a T7 promoter for expression of the gene with
no tag. The forward primer incorporated four bases (CACC)
immediately adjacent to the translational start codon to allow
directional cloning into pENTR/SD/D-TOPO (Invitrogen) to generate
the plasmid pENTRSDD-TOPOthIA. The pENTR construct was transformed
into E. coli Top10 (Invitrogen) cells and plated according to
manufacturer's recommendations. Transformants were grown overnight
and plasmid DNA was prepared using the QIAprep Spin Miniprep kit
(Qiagen, Valencia, Calif.; catalog no. 27106) according to
manufacturer's recommendations. Clones were submitted for
sequencing with M13 Forward and Reverse primers (see Table 5),
given as SEQ ID NOs:45 and 46, respectively, to confirm that the
genes inserted in the correct orientation and to confirm the
sequence. Additional sequencing primers, N7SeqF1 and N7SeqR1 (see
Table 5), given as SEQ ID NOs:47 and 48, respectively, were needed
to completely sequence the PCR product. The nucleotide sequence of
the open reading frame (ORF) for this gene and the predicted amino
acid sequence of the enzyme are given as SEQ ID NO:1 and SEQ ID
NO:2, respectively.
[0177] To create an expression clone, the thIA gene was transferred
to the pDEST 14 vector by recombination to generate pDEST14thIA.
The pDEST14thIA vector was transformed into BL21-AI cells.
Transformants were inoculated into LB medium supplemented with 50
.mu.g/mL of ampicillin and grown overnight. An aliquot of the
overnight culture was used to inoculate 50 mL of LB supplemented
with 50 .mu.g/mL of ampicillin. The culture was incubated at
37.degree. C. with shaking until the OD.sub.600 reached 0.6-0.8.
The culture was split into two 25-mL cultures and arabinose was
added to one of the flasks to a final concentration of 0.2% by
weight. The negative control flask was not induced with arabinose.
The flasks were incubated for 4 h at 37.degree. C. with shaking.
Cells were harvested by centrifugation and the cell pellets were
resuspended in 50 mM MOPS, pH 7.0 buffer. The cells were disrupted
either by sonication or by passage through a French Pressure Cell.
The whole cell lysate was centrifuged yielding the supernatant or
cell free extract and the pellet or the insoluble fraction. An
aliquot of each fraction (whole cell lysate, cell free extract and
insoluble fraction) was resuspended in SDS (MES) loading buffer
(Invitrogen), heated to 85.degree. C. for 10 min and subjected to
SDS-PAGE analysis (NuPAGE 4-12% Bis-Tris Gel, catalog no.
NP0322Box, Invitrogen). A protein of the expected molecular weight
of about 41 kDa, as deduced from the nucleic acid sequence, was
present in the induced culture but not in the uninduced
control.
[0178] Acetoacetyl-CoA thiolase activity in the cell free extracts
was measured as degradation of a Mg.sup.2+-acetoacetyl-CoA complex
by monitoring the decrease in absorbance at 303 nm. Standard assay
conditions were 100 mM Tris-HCl pH 8.0, 1 mM DTT (dithiothreitol)
and 10 mM MgCl.sub.2. The cocktail was equilibrated for 5 min at
37.degree. C.; then the cell-free extract was added. The reaction
was initiated with the addition of 0.05 mM acetoacetyl-CoA plus 0.2
mM CoA. Protein concentration was measured by either the Bradford
method or by the Bicinchoninic Kit (Sigma, catalog no. BCA-1).
Bovine serum albumin (Bio-Rad, Hercules, Calif.) was used as the
standard in both cases. In one typical assay, the specific activity
of the ThIA protein in the induced culture was determined to be
16.0 .mu.mol mg.sup.-1 min.sup.-1 compared to 0.27 .mu.mol
mg.sup.-1 min.sup.-1 in the uninduced culture.
Example 6
Cloning and Expression of Acetyl-CoA Acetyltransferase
[0179] The purpose of this Example was to express the enzyme
acetyl-CoA acetyltransferase, also referred to herein as
acetoacetyl-CoA thiolase, in E. coli. The acetoacetyl-CoA thiolase
gene thIB was cloned from C. acetobutylicum (ATCC 824) and
expressed in E. coli. The thIB gene was amplified from C.
acetobutylicum (ATCC 824) genomic DNA using PCR.
[0180] The thIB gene was cloned and expressed in the same manner as
the thIA gene described in Example 5. The C. acetobutylicum (ATCC
824) genomic DNA was amplified by PCR using primers N15 and N16
(see Table 4), given as SEQ ID NOs:27 and 28, respectively,
creating a 1.2 kbp product. The forward primer incorporated four
bases (CCAC) immediately adjacent to the translational start codon
to allow directional cloning into pENTR/SD/D-TOPO (Invitrogen) to
generate the plasmid pENTRSDD-TOPOthIB. Clones were submitted for
sequencing with M13 Forward and Reverse primers, given as SEQ ID
NOs:45 and 46 respectively, to confirm that the genes inserted in
the correct orientation and to confirm the sequence. Additional
sequencing primers, N15SeqF1 and N16SeqR1 (see Table 5), given as
SEQ ID NOs:49 and 50 respectively, were needed to completely
sequence the PCR product. The nucleotide sequence of the open
reading frame (ORF) for this gene and the predicted amino acid
sequence of the enzyme are given as SEQ ID NO:3 and SEQ ID NO:4,
respectively.
[0181] To create an expression clone, the thIB gene was transferred
to the pDEST 14 (Invitrogen) vector by recombination to generate
pDEST14thIB. The pDEST14thIB vector was transformed into BL21-AI
cells and expression from the T7 promoter was induced by addition
of arabinose. A protein of the expected molecular weight of about
42 kDa, as deduced from the nucleic acid sequence, was present in
the induced culture, but not in the uninduced control. Enzyme
assays were performed as described in Example 5. In one typical
assay, the specific activity of the ThIB protein in the induced
culture was determined to be 14.9 .mu.mol mg.sup.-1 min.sup.-1
compared to 0.28 .mu.mol mg.sup.-1 min.sup.-1 in the uninduced
culture.
Example 7
Cloning and Expression of 3-Hydroxybutyryl-CoA Dehydrogenase
[0182] The purpose of this Example was to clone the hbd gene from
C. acetobutylicum (ATCC 824) and express it in E. coli. The hbd
gene was amplified from C. acetobutylicum (ATCC 824) genomic DNA
using PCR.
[0183] The hbd gene was cloned and expressed using the method
described in Example 5. The hbd gene was amplified from C.
acetobutylicum (ATCC 824) genomic DNA by PCR using primers N5 and
N6 (see Table 4) given as SEQ ID NOs:19 and 20 respectively,
creating a 881 bp product. The forward primer incorporated four
bases (CACC) immediately adjacent to the translational start codon
to allow directional cloning into pENTR/SD/D-TOPO (Invitrogen) to
generate the plasmid pENTRSDD-TOPOhbd. Clones were submitted for
sequencing with M13 Forward and Reverse primers, given as SEQ ID
NOs:45 and 46 respectively, to confirm that the genes inserted in
the correct orientation and to confirm the sequence. Additional
sequencing primers, N5SeqF2 and N6SeqR2 (see Table 5), given as SEQ
ID NOs:51 and 52 respectively, were needed to completely sequence
the PCR product. The nucleotide sequence of the open reading frame
(ORF) for this gene and the predicted amino acid sequence of the
enzyme are given as SEQ ID NO:5 and SEQ ID NO:6, respectively.
[0184] To create an expression clone, the hbd gene was transferred
to the pDEST 14 (Invitrogen) vector by recombination to generate
pDEST14hbd. The pDEST14hbd vector was transformed into BL21-AI
cells and expression from the T7 promoter was induced by addition
of arabinose, as described in Example 5. A protein of the expected
molecular weight of about 31 kDa, as deduced from the nucleic acid
sequence, was present in the induced culture, but was absent in the
uninduced control.
[0185] Hydroxybutyryl-CoA dehydrogenase activity was determined by
measuring the rate of oxidation of NADH as measured by the decrease
in absorbance at 340 nm. A standard assay mixture contained 50 mM
MOPS, pH 7.0, 1 mM DTT and 0.2 mM NADH. The cocktail was
equilibrated for 5 min at 37.degree. C. and then the cell free
extract was added. Reactions were initiated by addition of the
substrate, 0.1 mM acetoacetyl-CoA. In one typical assay, the
specific activity of the BHBD protein in the induced culture was
determined to be 57.4 .mu.mol mg.sup.-1 min.sup.-1 compared to
0.885 .mu.mol mg.sup.-1 min.sup.-1 in the uninduced culture.
Example 8
Cloning and Expression of Crotonase
[0186] The purpose of this Example was to clone the crt gene from
C. acetobutylicum (ATCC 824) and express it in E. coli. The crt
gene was amplified from C. acetobutylicum (ATCC 824) genomic DNA
using PCR.
[0187] The crt gene was cloned and expressed using the method
described in Example 5. The crt gene was amplified from C.
acetobutylicum (ATCC 824) genomic DNA by PCR using primers N3 and
N4 (see Table 4), given as SEQ ID NOs:17 and 18, respectively,
creating a 794 bp product. The forward primer incorporated four
bases (CACC) immediately adjacent to the translational start codon
to allow directional cloning into pENTR/SD/D-TOPO (Invitrogen) to
generate the plasmid pENTRSDD-TOPOcrt. Clones were submitted for
sequencing with M13 Forward and Reverse primers, given as SEQ ID
NOs:45 and 46 respectively, to confirm that the genes inserted in
the correct orientation and to confirm the sequence. The nucleotide
sequence of the open reading frame (ORF) for this gene and its
predicted amino acid sequence are given as SEQ ID NO:7 and SEQ ID
NO:8, respectively.
[0188] To create an expression clone, the crt gene was transferred
to the pDEST 14 (Invitrogen) vector by recombination to generate
pDEST14crt. The pDEST14crt vector was transformed into BL21-AI
cells and expression from the T7 promoter was induced by addition
of arabinose, as described in Example 5. A protein of the expected
molecular weight of about 28 kDa, as deduced from the nucleic acid
sequence, was present in much greater amounts in the induced
culture than in the uninduced control.
[0189] Crotonase activity was assayed as described by Stern
(Methods Enzymol. 1, 559-566, (1954)). In one typical assay, the
specific activity of the crotonase protein in the induced culture
was determined to be 444 .mu.mol mg.sup.-1 min.sup.-1 compared to
47 .mu.mol mg.sup.-1 min.sup.-1 in the uninduced culture.
Example 9
Cloning and Expression of Butyryl-CoA Dehydrogenase
[0190] The purpose of this Example was to express the enzyme
butyryl-CoA dehydrogenase, also referred to herein as
trans-2-Enoyl-CoA reductase, in E. coli. The CAC0462 gene, a
putative trans-2-enoyl-CoA reductase homolog, was cloned from C.
acetobutylicum (ATCC 824) and expressed in E. coli. The CAC0462
gene was amplified from C. acetobutylicum (ATCC 824) genomic DNA
using PCR.
[0191] The CAC0462 gene was cloned and expressed using the method
described in Example 5. The CAC0462 gene was amplified from C.
acetobutylicum (ATCC 824) genomic DNA by PCR using primers N17 and
N21 (see Table 4), given as SEQ ID NOs:29 and 30, respectively,
creating a 1.3 kbp product. The forward primer incorporated four
bases (CACC) immediately adjacent to the translational start codon
to allow directional cloning into pENTR/SD/D-TOPO (Invitrogen) to
generate the plasmid pENTRSDD-TOPOCAC0462. Clones were submitted
for sequencing with M13 Forward and Reverse primers, given as SEQ
ID NO:45 and 46 respectively, to confirm that the genes inserted in
the correct orientation and to confirm the sequence. Additional
sequencing primers, N22SeqF1 (SEQ ID NO:53), N22SeqF2 (SEQ ID
NO:54), N22SeqF3 (SEQ ID NO:55), N23SeqR1 (SEQ ID NO:56), N23SeqR2
(SEQ ID NO:57), and N23SeqR3 (SEQ ID NO:58) (see Table 5) were
needed to completely sequence the PCR product. The nucleotide
sequence of the open reading frame (ORF) for this gene and the
predicted amino acid sequence of the enzyme are given as SEQ ID
NO:9 and SEQ ID NO:10, respectively.
[0192] To create an expression clone, the CAC0462 gene was
transferred to the pDEST 14 (Invitrogen) vector by recombination to
generate pDEST14CAC0462. The pDEST14CA0462 vector was transformed
into BL21-AI cells and expression from the T7 promoter was induced
by addition of arabinose, as described in Example 5. Analysis by
SDS-PAGE showed no overexpressed protein of the expected molecular
weight in the negative control or in the induced culture. The C.
acetobutylicum CAC0462 gene used many rare E. coli codons. To
circumvent problems with codon usage the pRARE plasmid (Novagen)
was transformed into BL21-AI cells harboring the pDEST14CAC0462
vector. Expression studies with arabinose induction were repeated
with cultures carrying the pRARE vector. A protein of the expected
molecular weight of about 46 kDa was present in the induced culture
but not in the uninduced control.
[0193] Trans-2-enoyl-CoA reductase activity was assayed as
described by Hoffmeister et al. (J. Biol. Chem. 280, 4329-4338
(2005)). In one typical assay, the specific activity of the TER
CAC0462 protein in the induced culture was determined to be 0.694
.mu.mol mg.sup.-1 min.sup.-1 compared to 0.0128 .mu.mol mg.sup.-1
min.sup.-1 in the uninduced culture.
Example 10
Cloning and Expression of Butyraldehyde Dehydrogenase
(Acetylating)
[0194] The purpose of this Example was to clone the ald gene from
C. beijerinckii (ATCC 35702) and express it in E. coli. The ald
gene was amplified from C. beijerinckii (ATCC 35702) genomic DNA
using PCR.
[0195] The ald gene was cloned and expressed using the method
described in Example 5. The ald gene was amplified from C.
beijerinckii (ATCC 35702) genomic DNA (prepared from anaerobically
grown cultures, as described in Example 5) by PCR using primers N27
F1 and N28 R1 (see Table 4), given as SEQ ID NOs:31 and 32
respectively, creating a 1.6 kbp product. The forward primer
incorporated four bases (CACC) immediately adjacent to the
translational start codon to allow directional cloning into
pENTR/SD/D-TOPO (Invitrogen) to generate the plasmid
pENTRSDD-TOPOald. Clones were submitted for sequencing with M13
Forward and Reverse primers, given as SEQ ID NOs:45 and 46
respectively, to confirm that the genes inserted in the correct
orientation and to confirm the sequence. Additional sequencing
primers, N31SeqF2 (SEQ ID NO:59), N31SeqF3 (SEQ ID NO:60), N31SeqF4
(SEQ ID NO:61), N32SeqR1 (SEQ ID NO:72), N31SeqR2 (SEQ ID NO:62),
N31SeqR3 (SEQ ID NO:63), N31SeqR4 (SEQ ID NO:64), and N31SeqR5 (SEQ
ID NO:65) (see Table 5) were needed to completely sequence the PCR
product. The nucleotide sequence of the open reading frame (ORF)
for this gene and the predicted amino acid sequence of the enzyme
are given as SEQ ID NO:11 and SEQ ID NO:12, respectively.
[0196] To create an expression clone, the ald gene was transferred
to the pDEST 14 (Invitrogen) vector by recombination to generate
pDEST14ald. The pDEST14ald vector was transformed into BL21-AI
cells and expression from the T7 promoter was induced by addition
of arabinose, as described in Example 5. A protein of the expected
molecular weight of about 51 kDa, as deduced from the nucleic acid
sequence, was present in the induced culture, but not in the
uninduced control.
[0197] Acylating aldehyde dehydrogenase activity was determined by
monitoring the formation of NADH, as measured by the increase in
absorbance at 340 nm, as described by Husemann et al. (Appl.
Microbiol. Biotechnol. 31:435-444 (1989)). In one typical assay,
the specific activity of the Ald protein in the induced culture was
determined to be 0.106 .mu.mol mg.sup.-1 min.sup.-1 compared to
0.01 .mu.mol mg.sup.-1 min.sup.-1 in the uninduced culture.
Example 11
Cloning and Expression of Butanol Dehydrogenase
[0198] The purpose of this Example was to clone the bdhB gene from
C. acetobutylicum (ATCC 824) and express it in E. coli. The bdhB
gene was amplified from C. acetobutylicum (ATCC 824) genomic DNA
using PCR.
[0199] The bdhB gene was cloned and expressed using the method
described in Example 5. The bdhB gene was amplified from C.
acetobutylicum (ATCC 824) genomic DNA by PCR using primers N11 and
N12 (see Table 4), given as SEQ ID NOs:25 and 26, respectively,
creating a 1.2 kbp product. The forward primer incorporated four
bases (CACC) immediately adjacent to the translational start codon
to allow directional cloning into pENTR/SD/D-TOPO (Invitrogen) to
generate the plasmid pENTRSDD-TOPObdhB. The translational start
codon was also changed from "GTG" to "ATG" by the primer sequence.
Clones were submitted for sequencing with M13 Forward and Reverse
primers, given as SEQ ID NOs:45 and 46 respectively, to confirm
that the genes inserted in the correct orientation and to confirm
the sequence. Additional sequencing primers, N11SeqF1 (SEQ ID
NO:66), N11SeqF2 (SEQ ID NO:67), N12SeqR1 (SEQ ID NO:68), and
N12SeqR2 (SEQ ID NO:69), (see Table 5) were needed to completely
sequence the PCR product. The nucleotide sequence of the open
reading frame (ORF) for this gene and the predicted amino acid
sequence of the enzyme are given as SEQ ID NO:13 and SEQ ID NO:14,
respectively.
[0200] To create an expression clone, the bdhB gene was transferred
to the pDEST 14 (Invitrogen) vector by recombination to generate
pDEST14bdhB. The pDEST14bdhB vector was transformed into BL21-AI
cells and expression from the T7 promoter was induced by addition
of arabinose, as described in Example 5. A protein of the expected
molecular weight of about 43 kDa, as deduced from the nucleic acid
sequence, was present in the induced culture, but not in the
uninduced control.
[0201] Butanol dehydrogenase activity was determined from the rate
of oxidation of NADH as measured by the decrease in absorbance at
340 nm as described by Husemann and Papoutsakis, supra. In one
typical assay, the specific activity of the BdhB protein in the
induced culture was determined to be 0.169 .mu.mol mg.sup.-1
min.sup.-1 compared to 0.022 .mu.mol mg.sup.-1 min.sup.-1 in the
uninduced culture.
Example 12
Cloning and Expression of Butanol Dehydrogenase
[0202] The purpose of this Example was to clone the bdhA gene from
C. acetobutylicum 824 and express it in E. coli. The bdhA gene was
amplified from C. acetobutylicum 824 genomic DNA using PCR.
[0203] The bdhA gene was cloned and expressed using the method
described in Example 5. The bdhA Gene was Amplified from C.
Acetobutylicum 824 Genomic DNA by PCR using primers N9 and N10 (see
Table 4), given as SEQ ID NOs:23 and 24, respectively, creating a
1.2 kbp product. The forward primer incorporated four bases (CACC)
immediately adjacent to the translational start codon to allow
directional cloning into pENTR/SD/D-TOPO (Invitrogen) to generate
the plasmid pENTRSDD-TOPObdhA. Clones, given as SEQ ID NOs:45 and
46 respectively, to confirm that the genes inserted in the correct
orientation and to confirm the sequence. Additional sequencing
primers, N9SeqF1 (SEQ ID NO:70) and N10SeqR1 (SEQ ID NO:71), (see
Table 5) were needed to completely sequence the PCR product. The
nucleotide sequence of the open reading frame (ORF) for this gene
and the predicted amino acid sequence of the enzyme are given as
SEQ ID NO:15 and SEQ ID NO:16, respectively.
[0204] To create an expression clone, the bdhA gene was transferred
to the pDEST 14 (Invitrogen) vector by recombination to generate
pDEST14bdhA. The pDEST14bdhA vector was transformed into BL21-AI
cells and expression from the T7 promoter was induced by addition
of arabinose, as described in Example 5. A protein of the expected
molecular weight of about 43 kDa, as deduced from the nucleic acid
sequence, was present in the induced culture, but not in the
uninduced control.
[0205] Butanol dehydrogenase activity was determined from the rate
of oxidation of NADH as measured by the decrease in absorbance at
340 nm, as described by Husemann and Papoutsakis, supra. In one
typical assay, the specific activity of the BdhA protein in the
induced culture was determined to be 0.102 .mu.mol mg.sup.-1
min.sup.-1 compared to 0.028 .mu.mol mg.sup.-1 min.sup.-1 in the
uninduced culture.
Example 13
Construction of a Transformation Vector for the Genes in the
1-Butanol Biosynthetic Pathway--Lower Pathway
[0206] To construct a transformation vector comprising the genes
encoding the six steps in the 1-butanol biosynthetic pathway, the
genes encoding the 6 steps in the pathway were divided into two
operons. The upper pathway comprises the first four steps catalyzed
by acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA
dehydrogenase, crotonase, and butyryl-CoA dehydrogenase. The lower
pathway comprises the last two steps, catalyzed by butyraldehyde
dehydrogenase and butanol dehydrogenase.
[0207] The purpose of this Example was to construct the lower
pathway operon. Construction of the upper pathway operon is
described in Example 14.
[0208] The individual genes were amplified by PCR with primers that
incorporated restriction sites for later cloning and the forward
primers contained an optimized E. coli ribosome binding site
(AAAGGAGG). PCR products were TOPO cloned into the pCR 4Blunt-TOPO
vector and transformed into E. coli Top10 cells (Invitrogen).
Plasmid DNA was prepared from the TOPO clones and the sequence of
the genes was verified. Restriction enzymes and T4 DNA ligase (New
England Biolabs, Beverly, Mass.) were used according to
manufacturer's recommendations. For cloning experiments,
restriction fragments were purified by gel electrophoresis using
QIAquick Gel Extraction kit (Qiagen).
[0209] After confirmation of the sequence, the genes were subcloned
into a modified pUC19 vector as a cloning platform. The pUC19
vector was modified by a HindIII/SapI digest, creating pUC19dHS.
The digest removed the lac promoter adjacent to the MCS (multiple
cloning site), preventing transcription of the operons in the
vector.
[0210] The ald gene was amplified from C. beijerinckii ATCC 35702
genomic DNA by PCR using primers N58 and N59 (see Table 4), given
as SEQ ID NOs:41 and 42, respectively, creating a 1.5 kbp product.
The forward primer incorporated the restriction sites AvaI and
BstEII and a RBS (ribosome binding site). The reverse primer
incorporated the HpaI restriction site. The PCR product was cloned
into pCRBlunt II-TOPO creating pCRBluntII-ald. Plasmid DNA was
prepared from the TOPO clones and the sequence of the genes
verified with primers M13 Forward (SEQ ID NO:45), M13 Reverse (SEQ
ID NO:46), N31SeqF2 (SEQ ID NO:59), N31SeqF3 (SEQ ID NO:60),
N31SeqF4 (SEQ ID NO:61), N32SeqR1 (SEQ ID NO:72), N31SeqR2 (SEQ ID
NO:62), N31SeqR3 SEQ ID NO:63), N31SeqR4 (SEQ ID NO:64), and
N31SeqR5 (SEQ ID NO:65) (see Table 5).
[0211] The bdhB gene was amplified from C. acetobutylicum (ATCC
824) genomic DNA by PCR using primers N64 and N65 (see Table 4),
given as SEQ ID NOs:43 and 44, respectively, creating a 1.2 kbp
product. The forward primer incorporated an HpaI restriction site
and a RBS. The reverse primer incorporated a PmeI and a SphI
restriction site. The PCR product was cloned into pCRBlunt II-TOPO
creating pCRBluntII-bdhB. Plasmid DNA was prepared from the TOPO
clones and the sequence of the genes verified with primers M13
Forward (SEQ ID NO:45), M13 Reverse (SEQ ID NO:46), N11SeqF1 (SEQ
ID NO:66), N11SeqF2 (SEQ ID NO:67), N12SeqR1 (SEQ ID NO:68), and
N12SeqR2 (SEQ ID NO:69) (see Table 5).
[0212] To construct the lower pathway operon, a 1.2 kbp SphI and
HpaI fragment from pCRBluntII-bdhB, a 1.4 kbp HpaI and SphI
fragment from pCRBluntII-ald, and the large fragment from a AvaI
and SphI digest of pUC19dHS were ligated together. The three-way
ligation created pUC19dHS-ald-bdhB.
[0213] The pUC19dHS-ald-bdhB vector was digested with BstEII and
PmeI releasing a 2.6 kbp fragment that was cloned into pBenBP, an
E. coli-Bacillus subtilis shuttle vector. Plasmid pBenBP was
created by modification of the pBE93 vector, which is described by
Nagarajan, WO 93/24631 (Example 4). The Bacillus amyloliquefaciens
neutral protease promoter (NPR), signal sequence and the phoA gene
were removed from pBE93 with a NcoI/HindIII digest. The NPR
promoter was PCR amplified from pBE93 by primers BenF and BenBPR,
given by SEQ ID NOs:73 and 75, respectively. Primer BenBPR
incorporated BstEII, PmeI and HindIII sites downstream of the
promoter. The PCR product was digested with NcoI and HindIII and
the fragment was cloned into the corresponding sites in the vector
pBE93 to create pBenBP. The lower operon fragment was subcloned
into the BstEII and PmeI sites in pBenBP creating
pBen-ald-bdhB.
[0214] Assays for butyraldehyde dehydrogenase and butanol
dehydrogenase activity were conducted on crude extracts using the
methods described above.
[0215] Both enzyme activities were demonstrated at levels above the
control strain that contained an empty vector.
Example 14
Prophetic
Construction of a Transformation Vector for the Genes in the
1-Butanol Biosynthetic Pathway--Upper Pathway
[0216] The purpose of this prophetic Example is to describe how to
assemble the upper pathway operon. The general approach is the same
as described in Example 13.
[0217] The thIA gene is amplified from C. acetobutylicum (ATCC 824)
genomic DNA by PCR using primer pair N44 and N45 (see Table 4),
given as SEQ ID NOs:33 and 34, respectively, creating a 1.2 kbp
product. The forward primer incorporates a SphI restriction site
and a ribosome binding site (RBS). The reverse primer incorporates
AscI and PstI restriction sites. The PCR product is cloned into
pCR4 Blunt-TOPO creating pCR4 Blunt-TOPO-thIA. Plasmid DNA is
prepared from the TOPO clones and the sequence of the genes is
verified with primers M13 Forward (SEQ ID NO:45), M13 Reverse (SEQ
ID NO:46), N7SeqF1 (SEQ ID NO:47), and N7SeqR1 (SEQ ID NO:48) (see
Table 5).
[0218] The hbd gene is amplified from C. acetobutylicum (ATCC 824)
genomic DNA by PCR using primer pair N42 and N43 (see Table 4)
given as SEQ ID NOs:35 and 36, respectively, creating a 0.9 kbp
product. The forward primer incorporates a SalI restriction site
and a RBS. The reverse primer incorporates a SphI restriction site.
The PCR product is cloned into pCR4 Blunt-TOPO creating pCR4
Blunt-TOPO-hbd. Plasmid DNA is prepared from the TOPO clones and
the sequence of the genes verified with primers M13 Forward (SEQ ID
NO:45), M13 Reverse (SEQ ID NO:46), N5SeqF2 (SEQ ID NO:51), and
N6SeqR2 (SEQ ID NO:52) (see Table 5).
[0219] The CAC0462 gene is codon optimized for expression in E.
coli as primary host and B. subtilis as a secondary host. The new
gene called CaTER, given as SEQ ID NO:76, is synthesized by
Genscript Corp (Piscataway, N.J.). The gene CaTER is cloned in the
pUC57 vector as a BamHI-SalI fragment and includes a RBS, producing
plasmid pUC57-CaTER.
[0220] The crt gene is amplified from C. acetobutylicum (ATCC 824)
genomic DNA by PCR using primer pair N38 and N39 (see Table 4),
given as SEQ ID NOs:39 and 40, respectively, creating a 834 bp
product. The forward primer incorporates EcoRI and MluI restriction
sites and a RBS. The reverse primer incorporates a BamHI
restriction site. The PCR product is cloned into pCR4 Blunt-TOPO
creating pCR4 Blunt-TOPO-crt. Plasmid DNA is prepared from the TOPO
clones and the sequence of the genes is verified with primers M13
Forward (SEQ ID NO:45) and M13 Reverse (SEQ ID NO:46) (see Table
5).
[0221] After confirmation of the sequence, the genes are subcloned
into a modified pUC19 vector as a cloning platform. The pUC19
vector was modified by a SphI/SapI digest, creating pUC19dSS. The
digest removed the lac promoter adjacent to the MCS, preventing
transcription of the operons in the vector.
[0222] To construct the upper pathway operon pCR4 Blunt-TOPO-crt is
digested with EcoRI and BamHI releasing a 0.8 kbp crt fragment. The
pUC19dSS vector is also digested with EcoRI and BamHI releasing a
2.0 kbp vector fragment. The crt fragment and the vector fragment
are ligated together using T4 DNA ligase (New England Biolabs) to
form pUC19dSS-crt. The CaTER gene is inserted into pCU19dSS-crt by
digesting pUC57-CaTER with BamHI and SalI, releasing a 1.2 kbp
CaTER fragment. The pUC19dSS-crt is digested with BamHI and SalI
and the large vector fragment is ligated with the CaTER fragment,
creating pUC19dSS-crt-CaTER. To complete the operon a 884 bp SalI
and SphI fragment from pCR4 Blunt-TOPO-hbd, a 1.2 kb SphI and PstI
thIA fragment from pCR4 Blunt-TOPO-thIA and the large fragment from
a SalI and PstI digest of pUC19dSS-crt-CaTER are ligated. The
product of the 3-way ligation is pUC19dSS-crt-CaTER-hbd-thIA.
[0223] The pUC19dSS-crt-CaTER-hbd-thIA vector is digested with MluI
and AscI releasing a 4.1 kbp fragment that is cloned into a
derivative of pBE93 (Caimi, WO2004/018645, pp. 39-40) an E. coli-B.
subtilis shuttle vector, referred to as pBenMA. Plasmid pBenMA was
created by modification of the pBE93 vector. The Bacillus
amyloliquefaciens neutral protease promoter (NPR), signal sequence
and the phoA gene are removed from pBE93 with a NcoI/HindIII
digest. The NPR promoter is PCR amplified from pBE93 by primers
BenF and BenMAR, given as SEQ ID NOS:73 and 74, respectively.
Primer BenMAR incorporates MluI, AscI, and HindIII sites downstream
of the promoter. The PCR product was digested with NcoI and HindIII
and the fragment is cloned into the corresponding sites in the
vector pBE93, creating pBenMA. The upper operon fragment is
subcloned into the MluI and AscI sites in pBenMA creating
pBen-crt-hbd-CaTER-thIA.
Example 15
Prophetic
Expression of the 1-Butanol Biosynthetic Pathway in E. coli
[0224] The purpose of this prophetic Example is to describe how to
express the 1-butanol biosynthetic pathway in E. coli.
[0225] The plasmids pBen-crt-hbd-CaTER-thIA and pBen-ald-bdhB,
constructed as described in Examples 14 and 13, respectively, are
transformed into E. coli NM522 (ATCC 47000) and expression of the
genes in each operon is monitored by SDS-PAGE analysis, enzyme
assay and Western analysis. For Westerns, antibodies are raised to
synthetic peptides by Sigma-Genosys (The Woodlands, Tex.). After
confirmation of expression of all the genes, pBen-ald-bdhB is
digested with EcoRI and PmeI to release the NPR promoter-ald-bdhB
fragment. The EcoRI digest of the fragment is blunt ended using the
Klenow fragment of DNA polymerase (New England Biolabs, catalog no.
M0210S). The plasmid pBen-crt-hbd-CaTER-thIA is digested with PvuII
to create a linearized blunt ended vector fragment. The vector and
NPR-ald-bdhB fragment are ligated, creating p1B1 O.1 and p1B1 O.2,
containing the complete 1-butanol biosynthetic pathway with the NPR
promoter-ald-bdhB fragment in opposite orientations. The plasmids
p1B1 O.1 and p1B1 O.2 are transformed into E. coli NM522 and
expression of the genes are monitored as previously described.
[0226] E. coli strain NM522/p1B1 O.1 or NM522/p1B1 O.1 is
inoculated into a 250 mL shake flask containing 50 mL of medium and
shaken at 250 rpm and 35.degree. C. The medium is composed of:
dextrose, 5 g/L; MOPS, 0.05 M; ammonium sulfate, 0.01 M; potassium
phosphate, monobasic, 0.005 M; S10 metal mix, 1% (v/v); yeast
extract, 0.1% (w/v); casamino acids, 0.1% (w/v); thiamine, 0.1
mg/L; proline, 0.05 mg/L; and biotin 0.002 mg/L, and is titrated to
pH 7.0 with KOH. S10 metal mix contains: MgCl.sub.2, 200 mM;
CaCl.sub.2, 70 mM; MnCl.sub.2, 5 mM; FeCl.sub.3, 0.1 mM;
ZnCl.sub.2, 0.1 mM; thiamine hydrochloride, 0.2 mM; CuSO.sub.4, 172
.mu.M; CoCl.sub.2, 253 .mu.M; and Na.sub.2MoO.sub.4, 242 .mu.M.
After 18 to 24 h, 1-butanol is detected by HPLC or GC analysis, as
described in the General Methods section.
Example 16
Prophetic
Expression of the 1-Butanol Biosynthetic Pathway in Bacillus
subtilis
[0227] The purpose of this prophetic Example is to describe how to
express the 1-butanol biosynthetic pathway in Bacillus subtilis.
The same approach as described in Example 15 is used.
[0228] The upper and lower operons constructed as described in
Examples 14 and 13, respectively, are used. The plasmids p1B1 O.1
and p1B1 O.2 are transformed into Bacillus subtilis BE1010 (J.
Bacteriol. 173:2278-2282 (1991)) and expression of the genes in
each operon is monitored as previously described.
[0229] B. subtilis strain BE1010/p1B1 O.1 or BE1010/p1B1 O.2 is
inoculated into a 250 mL shake flask containing 50 mL of medium and
shaken at 250 rpm and 35.degree. C. for 18 h. The medium is
composed of: dextrose, 5 g/L; MOPS, 0.05 M; glutamic acid, 0.02 M;
ammonium sulfate, 0.01 M; potassium phosphate, monobasic buffer,
0.005 M; S10 metal mix (as described in Example 15), 1% (v/v);
yeast extract, 0.1% (w/v); casamino acids, 0.1% (w/v); tryptophan,
50 mg/L; methionine, 50 mg/L; and lysine, 50 mg/L, and is titrated
to pH 7.0 with KOH. After 18 to 24 h, 1-butanol is detected by HPLC
or GC analysis, as described in the General Methods section.
Example 17
Production of 1-Butanol from Glucose using Recombinant E. coli
[0230] This Example describes the production of 1-butanol in E.
coli. Expression of the genes encoding the 6 steps of the 1-butanol
biosynthetic pathway was divided into three operons. The upper
pathway comprised the first four steps encoded by thIA, hbd, crt
and EgTER in one operon. The next step, encoded by ald, was
provided by a second operon. The last step in the pathway, encoded
by yqhD, was provided in a third operon. 1-Butanol production was
demonstrated in E. coli strains comprising the three operons.
[0231] Unless otherwise indicated in the text, cloning primers
described in this Example are referenced by their SEQ ID NO in
Table 4, and sequencing and PCR screening primers are referenced by
their SEQ ID NO in Table 5.
[0232] Acetyl-CoA Acetyltransferase.
[0233] The thIA gene was amplified from C. acetobutylicum (ATCC
824) genomic DNA by PCR using primer pair N44 and N45 (see Table
4), given as SEQ ID NOs:33 and 34, respectively, creating a 1.2 kbp
product. The forward primer incorporated a SphI restriction site
and a ribosome binding site (RBS). The reverse primer incorporated
AscI and PstI restriction sites. The PCR product was cloned into
pCR4Blunt-TOPO (Invitrogen Corp., Carlsbad, Calif.) creating
pCR4Blunt-TOPO-thIA. Plasmid DNA was prepared from the TOPO clones
and the sequence of the genes was verified with primers M13 Forward
(SEQ ID NO:45), M13 Reverse (SEQ ID NO:46), N7SeqF1 (SEQ ID NO:47),
and N7SeqR1 (SEQ ID NO:48) (see Table 5).
[0234] 3-Hydroxybutyryl-CoA dehydrogenase.
[0235] The hbd gene was amplified from C. acetobutylicum (ATCC 824)
genomic DNA by PCR using primer pair N42 and N43 (see Table 4)
given as SEQ ID NOs:35 and 36, respectively, creating a 0.9 kbp
product. The forward primer incorporated a SalI restriction site
and a RBS. The reverse primer incorporated a SphI restriction site.
The PCR product was cloned into pCR4Blunt-TOPO creating
pCR4Blunt-TOPO-hbd. Plasmid DNA was prepared from the TOPO clones
and the sequence of the genes verified with primers M13 Forward
(SEQ ID NO:45), M13 Reverse (SEQ ID NO:46), N5SeqF2 (SEQ ID NO:51),
and N6SeqR2 (SEQ ID NO:52) (see Table 5).
[0236] Crotonase.
[0237] The crt gene was amplified from C. acetobutylicum (ATCC 824)
genomic DNA by PCR using primer pair N38 and N39 (see Table 4),
given as SEQ ID NOs:39 and 40, respectively, creating a 834 bp
product. The forward primer incorporated EcoRI and MluI restriction
sites and a RBS. The reverse primer incorporated a BamHI
restriction site. The PCR product was cloned into pCR4Blunt-TOPO
creating pCR4Blunt-TOPO-crt. Plasmid DNA was prepared from the TOPO
clones and the sequence of the genes was verified with primers M13
Forward (SEQ ID NO:45) and M13 Reverse (SEQ ID NO:46) (see Table
5).
[0238] Butyryl-CoA Dehydrogenase (trans-2-enoyl-CoA reductase).
[0239] The CAC0462 gene was synthesized for enhanced codon usage in
E. coli as primary host and B. subtilis as a secondary host. The
new gene (CaTER, SEQ ID NO:76) was synthesized and cloned by
Genscript Corporation (Piscataway, N.J.) in the pUC57 vector as a
BamHI-SalI fragment and includes a RBS.
[0240] An alternative gene for butyryl-CoA dehydrogenase from
Euglena gracilis (TER, GenBank No. Q5EU90) was synthesized for
enhanced codon usage in E. coli and Bacillus subtilis. The gene was
synthesized and cloned by GenScript Corporation into pUC57 creating
pUC57::EgTER. Primers N85 and N86, (SED ID NO: 80 and 81
respectively) together with pUC57::EgTER as template DNA, provided
a PCR fragment comprising 1224 bp from pUC57::EgTER DNA. The
sequence of the 1224 bp is given as SEQ ID NO:77, where bp 1-1218
is the coding sequence (cds) of EgTER(opt). EgTER(opt) is a codon
optimized TER gene, lacking the normal mitochondrial presequence so
as to be functional in E. coli (Hoffmeister et al., J. Biol. Chem.
280:4329 (2005)).
[0241] EgTER(opt) was cloned into pCR4Blunt-TOPO and its sequence
was confirmed with primers M13 Forward (SEQ ID NO:45) and M13
Reverse (SEQ ID NO:46). Additional sequencing primers N62SeqF2 (SEQ
ID NO:114), N62SeqF3 (SEQ ID NO:115), N62SeqF4 (SEQ ID NO:116),
N63SeqR1 (SEQ ID NO:117), N63SeqR2 (SEQ ID NO:118), N63SeqR3 (SEQ
ID NO:119) and N63SeqR4 (SEQ ID NO:120) were needed to completely
sequence the PCR product. The 1.2 kbp EgTER(opt) sequence was then
excised with HincII and PmeI and cloned into pET23+ (Novagen)
linearized with HincII. Orientation of the EgTER(opt) gene to the
promoter was confirmed by colony PCR screening with primers
T7Primer and N63SeqR2 (SEQ ID NOs:82 and 118 respectively). The
resulting plasmid, pET23+::EgTER(opt), was transformed into BL21
(DE3) (Novagen) for expression studies.
[0242] Trans-2-enoyl-CoA reductase activity was assayed as
described by Hoffmeister et al., J. Biol. Chem. 280:4329 (2005). In
a typical assay, the specific activity of the EgTER(opt) protein in
the induced BL21 (DE3) /pET23+::EgTER(opt) culture was determined
to be 1.9 .mu.mol mg.sup.-1 min.sup.-1 compared to 0.547 .mu.mol
mg.sup.-1 min.sup.-1 in the uninduced culture.
[0243] The EgTER(opt) gene was then cloned into the pTrc99a vector
under the control of the trc promoter. The EgTER(opt) gene was
isolated as a 1287-bp BamHI/SalI fragment from pET23+::EgTER(opt).
The 4.2 kbp vector pTrc99a was linearized with BamHI/SalI. The
vector and fragment were ligated creating the 5.4 kbp
pTrc99a-EgTER(opt). Positive clones were confirmed by colony PCR
with primers Trc99aF and N63SeqR3 (SEQ ID NOs:83 and 119
respectively) producing a 0.5 kb product.
[0244] Construction of Plasmid pTrc99a-E-C-H-T Comprising Genes
Encoding Acetyl-CoA Acetyltransferase (thIA), 3-Hydroxybutyryl-CoA
Dehydrogenase (hbd), Crotonase (Crt), and Butyryl-CoA Dehydrogenase
(Trans-2-Enoyl-CoA Reductase, EgTER(opt)).
[0245] To initiate the construction of a four gene operon
comprising the upper pathway (EgTER(opt), crt, hbd and thIA),
pCR4Blunt-TOPO-crt was digested with EcoRI and BamHI releasing a
0.8 kbp crt fragment. The pUC19dSS vector (described in Example 14)
was also digested with EcoRI and BamHI releasing a 2.0 kbp vector
fragment. The crt fragment and the vector fragment were ligated
together using T4 DNA ligase (New England Biolabs) to form
pUC19dSS-crt. The CaTER gene was inserted into pUC19dSS-crt by
digesting pUC57-CaTER with BamHI and SalI, releasing a 1.2 kbp
CaTER fragment. The pUC19dSS-crt was digested with BamHI and SalI
and the large vector fragment was ligated with the CaTER fragment,
creating pUC19dSS-crt-CaTER. To complete the operon a 884 bp SalI
and SphI fragment from pCR4Blunt-TOPO-hbd, a 1.2 kb SphI and PstI
thIA fragment from pCR4Blunt-TOPO-thIA and the large fragment from
a SalI and PstI digest of pUC19dSS-crt-CaTER were ligated. The
product of the 3-way ligation was named pUC19dSS-crt-CaTER-hbd-thIA
or pUC19dss::Operon1.
[0246] Higher butyryl-CoA dehydrogenase activity was obtained from
pTrc99a-EgTER(opt) than from CaTER constructs, thus, an operon
derived from pTrc99a-EgTER(opt) was constructed. The CaTER gene was
removed from pUC19dss::Operon1 by digesting with BamHI/Sal I and
gel purifying the 5327-bp vector fragment. The vector was treated
with Klenow and religated creating pUC19dss::Operon 1 .DELTA.CaTer.
The 2934-bp crt-hbd-thIA (C-H-T) fragment was then isolated as a
EcoRI/PstI fragment from pUC19dss:Operon 1 ACaTer. The C-H-T
fragment was treated with Klenow to blunt the ends. The vector
pTrc99a-EgTER(opt) was digested with SalI and the ends treated with
Klenow. The blunt-ended vector and the blunt-ended C-H-T fragment
were ligated to create pTrc99a-E-C-H-T. Colony PCR reactions were
performed with primers N62SeqF4 and N5SeqF4 (SEQ ID NOs: 116 and 84
respectively) to confirm the orientation of the insert.
[0247] Construction of Plasmids pBHR T7-ald and pBHR-Ptrc-ald(Opt)
Comprising Genes Encoding Butyraldehyde Dehydrogenase (ald and
ald(opt)).
[0248] The PT7-ald operon was sub-cloned from pDEST14ald (Example
10) into the broad host range plasmid pBHR1 (MoBitec, Goettingen,
Germany) to create pBHR1 PT7-ald. The pBHRi plasmid is compatible
with pUC19 or pBR322 plasmids so pBHR1 PT7-ald can be used in
combination with pUC19 or pBR322 derivatives carrying the upper
pathway operon for 1-butanol production in E. coli. The pDEST14-ald
plasmid was digested with Bgl II and treated with the Klenow
fragment of DNA polymerase to make blunt ends. The plasmid was then
digested with EcoRI and the 2,245 bp PT7-ald fragment was
gel-purified. Plasmid pBHR1 was digested with ScaI and EcoRI and
the 4,883 bp fragment was gel-purified. The PT7-ald fragment was
ligated with the pBHR1 vector, creating pBHR T7-ald. Colony PCR
amplification of transformants with primers T-ald(BamHI) and
B-ald(EgTER) (SEQ ID NOs:85 and 86 respectively) confirmed the
expected 1.4 kb PCR product. Restriction mapping of pBHR T7-ald
clones with EcoRI and DrdI confirmed the expected 4,757 and 2,405
bp fragments.
[0249] For butyraldehyde dehydrogenase activity assays, the plasmid
pBHR T7-ald was transformed into BL21Star.TM. (DE3) cells
(Invitrogen) and expression from the T7 promoter was induced by
addition of L-arabinose as described in Example 5. Acylating
aldehyde dehydrogenase activity was determined by monitoring the
formation of NADH, as measured by the increase in absorbance at 340
nm, as described in Example 10.
[0250] An alternative DNA sequence for the ald gene from
Clostridium beijerinckii ATCC 35702 was synthesized (optimizing for
codon usage in E. coli and Bacillus subtilis) and cloned into pUC57
bp GenScript Corporation (Piscataway, N.J.), creating the plasmid
pUC57-ald(opt). pUC57-ald(opt) was digested with SacI and SalI to
release a 1498 bp fragment comprising the condon optimized gene,
ald(opt) and a RBS already for E. coli. The sequence of the 1498 bp
fragment is given as SEQ ID NO:78.
[0251] pTrc99a was digested with SacI and Sail giving a 4153 bp
vector fragment, which was ligated with the 1498 bp ald(opt)
fragment to create pTrc-ald(opt). Expression of the synthetic gene,
ald(opt), is under the control of the IPTG-inducible Ptrc
promoter.
[0252] The Ptrc-ald(opt) operon was subcloned into the broad host
range plasmid pBHR1 (MoBitec) in order to be compatible with the
upper pathway plasmid described above. The Ptrc-ald(opt) fragment
was PCR-amplified from pTrc99A::ald(opt) with T-Ptrc(BspEI) and
B-aldopt(ScaI), (SEQ ID NOs:87 and 88 respectively) incorporating
BspEI and ScaI restriction sites within the corresponding primers.
The PCR product was digested with BspEI and ScaI. The plasmid pBHR1
was digested with ScaI and BspEI and the 4,883 bp fragment was
gel-purified. The Ptrc-ald(opt) fragment was ligated with the pBHR1
vector, creating pBHR-PcatPtrc-ald(opt). Restriction mapping of the
pBHR-PcatPtrc-ald(opt) clones with ScaI and BspEI confirmed the
expected 4,883 and 1,704 bp fragments. To remove the plasmid-born
cat promoter (Pcat) region, plasmid pBHR-PcatPtrc-ald(opt) was
digested with BspEI and AatII and the 6,172 bp fragment was
gel-purified. T-BspEIAatII and B-BspEIAatII (SEQ ID NOs:89 and 90
respectively) were mixed in a solution containing 50 mM NaCl, 10 mM
Tris-HCl, and 10 mM MgCl.sub.2 (pH7.9) to a final concentration of
100 .mu.M and hybridized by incubating at 75.degree. C. for 5 min
and slowly cooling to room temperature. The hybridized
oligonucleotides were ligated with the 6,172 bp fragment, creating
pBHR-Ptrc-ald(opt).
[0253] Construction of E. Coli Strains Expressing Butanol
Dehydrogenase (yghD).
[0254] E. coli contains a native gene (yqhD) that was identified as
a 1,3-propanediol dehydrogenase (U.S. Pat. No. 6,514,733). The yqhD
gene has 40% identity to the gene adhB in Clostridium, a probable
NADH-dependent butanol dehydrogenase. The yqhD gene was placed
under the constitutive expression of a variant of the glucose
isomerase promoter 1.6GI (SEQ ID NO:91) in E. coli strain MG1655
1.6yqhD::Cm (WO 2004/033646) using Red technology (Datsenko and
Wanner, Proc. Natl. Acad. Sci. U.S.A. 97:6640 (2000)). Similarly,
the native promoter was replaced by the 1.5GI promoter (WO
2003/089621) (SEQ ID NO:92), creating strain MG1655 1.5GI-yqhD::Cm,
thus, replacing the 1.6GI promoter of MG1655 1.6yqhD::Cm with the
1.5GI promoter.
[0255] A P1 lysate was prepared from MG1655 1.5GI yqhD::Cm and the
cassette moved to expression strains, MG1655 (DE3), prepared from
E. coli strain MG1655 and a lambda DE3 lysogenization kit
(Invitrogen), and BL21 (DE3) (Invitrogen) creating MG1655 (DE3)
1.5GI-yqhD::Cm and BL21 (DE3) 1.5GI-yqhD::Cm, respectively.
[0256] Demonstration Of 1-Butanol Production from Recombinant E.
Coli.
[0257] E. coli strain MG1655 (DE3) 1.5GI-yqhD::Cm was transformed
with plasmids pTrc99a-E-C-H-T and pBHR T7-ald to produce the
strain, MG1655 (DE3) 1.5GI -yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald.
Two independent isolates were initially grown in LB medium
containing 50 .mu.g/mL kanamycin and 100 .mu.g/mL carbenicillin.
The cells were used to inoculate shake flasks (approximately 175 mL
total volume) containing 15, 50 and 150 mL of TM3a/glucose medium
(with appropriate antibiotics) to represent high, medium and low
oxygen conditions, respectively. TM3a/glucose medium contained (per
liter): 10 g glucose, 13.6 g KH.sub.2PO.sub.4, 2.0 g citric acid
monohydrate, 3.0 g (NH.sub.4).sub.2SO.sub.4, 2.0 g
MgSO.sub.4.7H.sub.2O, 0.2 g CaCl.sub.22H.sub.2O, 0.33 g ferric
ammonium citrate, 1.0 mg thiamine.HCl, 0.50 g yeast extract, and 10
mL trace elements solution, adjusted to pH 6.8 with NH.sub.4OH. The
solution of trace elements contained: citric acid .H.sub.2O (4.0
g/L), MnSO.sub.4.H.sub.2O (3.0 g/L), NaCl (1.0 g/L),
FeSO.sub.4.7H.sub.2O (0.10 g/L), CoCl.sub.2.6H.sub.2O (0.10 g/L),
ZnSO.sub.4. 7H.sub.2O (0.10 g/L), CuSO.sub.4.5H.sub.2O (0.010 g/L),
H.sub.3BO.sub.3 (0.010 g/L), and Na.sub.2MoO.sub.4. 2H.sub.2O
(0.010 g/L). The flasks were inoculated at a starting OD.sub.600 of
0.01 units and incubated at 34.degree. C. with shaking at 300 rpm.
The flasks containing 15 and 50 mL of medium were capped with
vented caps; the flasks containing 150 mL, were capped with
non-vented caps to minimize air exchange. IPTG was added to a final
concentration of 0.04 mM; the OD.sub.600 of the flasks at the time
of addition was .gtoreq.0.4 units.
[0258] Approximately 15 h after induction, an aliquot of the broth
was analyzed by HPLC (Shodex Sugar SH1011 column) with refractive
index (R1) detection and GC (Varian CP-WAX 58(FFAP) CB column, 25
m.times.0.25 mm id.times.0.2 .mu.m film thickness) with flame
ionization detection (FID) for 1-butanol content, as described in
the General Methods section.
The results of the 1-butanol determinations are given in Table
14.
TABLE-US-00014 TABLE 14 Production of 1-butanol by E. coli strain
MG1655 (DE3) 1.5GI-yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald. Strain
O.sub.2 Level 1-butanol, mM molar yield, % MG1655 a high 0.11 0.2
MG1655 b high 0.12 0.2 MG1655 a medium 0.13 0.3 MG1655 b medium
0.13 0.2 MG1655 a low 0.15 0.4 MG1655 b low 0.18 0.5 Values were
determined from HPLC analysis. Strain suffixes "a" and "b" indicate
independent isolates.
[0259] The two independent isolates of MG1655 (DE3)
1.5GI-yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald were tested for
1-butanol production in an identical manner except that the medium
contained 5 g/L yeast extract. The results are shown in Table
15.
TABLE-US-00015 TABLE 15 Production of 1-butanol by E. coli strain
MG1655 (DE3) 1.5GI-yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald. Strain
O.sub.2 Level 1-butanol, mM molar yield, % MG1655 a high - - MG1655
b high - - MG1655 a medium 0.08 0.1 MG1655 b medium 0.06 0.1 MG1655
a low 0.14 0.3 MG1655 b low 0.14 0.3 Quantitative values were
determined from HPLC analysis. "-" = not detected. Strain suffixes
"a" and "b" indicate independent isolates.
[0260] E. coli strain BL21 (DE3) 1.5GI-yqhD::Cm was transformed
with plasmids pTrc99a-E-C-H-T and pBHR T7-ald to produce the
strain, BL21 (DE3) 1.5GI -yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald. Two
independent isolates were tested for 1-butanol production exactly
as described above. The results are given in Tables 16 and 17.
TABLE-US-00016 TABLE 16 Production of 1-butanol by E. coli strain
BL21 (DE3) 1.5GI-yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald. Strain
O.sub.2 Level 1-butanol, mM molar yield, % DE a high + + DE b high
- - DE a medium 0.80 1.4 DE b medium 0.77 1.4 DE a low 0.06 0.2 DE
b low 0.07 0.2 Quantitative values were determined from HPLC
analysis. "-" indicates not detected. "+" indicates positive,
qualitative identification by GC with a lower detection limit than
with HPLC. Strain suffixes "a" and "b" indicate independent
isolates.
TABLE-US-00017 TABLE 17 Production of 1-butanol by E. coli strain
BL21 (DE3) 1.5GI-yqhD::Cm/pTrc99a-E-C-H-T/pBHR T7-ald. Strain
O.sub.2 Level 1-butanol, mM molar yield, % DE a high + + DE b high
+ + DE a medium 0.92 1.7 DE b medium 1.03 1.9 DE a low + + DE b low
+ + Quantitative values were determined from HPLC analysis. "-"
indicates not detected. "+" indicates positive, qualitative
identification by GC with a lower detection limit than with HPLC.
Strain suffixes "a" and "b" indicate independent isolates.
[0261] E. coli strain MG1655 1.5GI-yqhD::Cm was transformed with
plasmids pTrc99a-E-C-H-T and pBHR-Ptrc-ald(opt) to produce the
strain, MG1655 1.5GI -yqhD::Cm/pTrc99a-E-C-H-T/pBHR-Ptrc-ald(opt).
Two isolates were initially grown in LB medium containing 50
.mu.g/mL kanamycin and 100 .mu.g/mL carbenicillin. The cells were
used to inoculate shake flasks (approximately 175 mL total volume)
containing 50 and 150 mL of TM3a/glucose medium (with appropriate
antibiotics). The flasks were inoculated at a starting OD.sub.550
of 0.04 units and incubated as described above, with and without
induction. IPTG was added to a final concentration of 0.4 mM; the
OD.sub.550 of the flasks at the time of addition was between 0.6
and 1.2 units. In this case, induction was not necessary for
1-butanol pathway gene expression because of the leakiness of the
IPTG inducible promoters and the constitutive nature of the 1.5GI
promoter; however, induction provided a wider range of
expression.
[0262] Approximately 15 h after induction, an aliquot of the broth
was analyzed by GC with flame ionization detection for 1-butanol
content, as described above. The results are given in Table 18. For
the recombinant E. coli strains, 1-butanol was produced in all
cases; in separate experiments, wild type E. coli strains were
shown to produce no detectable 1-butanol (data not shown).
TABLE-US-00018 TABLE 18 Production of 1-butanol by E. coli strain
MG1655 1.5GI-yqhD::Cm/pTrc99a-E-C-H-T/pBHR-Ptrc-ald(opt). Strain
O.sub.2 Level 1-butanol, mM IPTG Induction MG1655 a medium 0.14 No
MG 1655 b medium 0.14 No MG1655 a medium 0.03 Yes MG 1655 b medium
0.07 Yes MG1655 a low 0.04 No MG 1655 b low 0.04 No MG1655 a low
0.02 Yes MG 1655 b low 0.03 Yes Strain suffixes "a" and "b"
indicate separate isolates.
Example 18
Production of 1-Butanol from Glucose Using Recombinant B.
Subtilis
[0263] This Example describes the production of 1-butanol in
Bacillus subtilis. The six genes of the 1-biosynthetic pathway,
encoding six enzyme activities, were split into two operons for
expression. The first three genes of the pathway (thI, hbd, and
crt) were integrated into the chromosome of Bacillus subtilis
BE1010 (Payne and Jackson, J. Bacteriol. 173:2278-2282 (1991)). The
last three genes (EgTER, ald, and bdhB) were cloned into an
expression plasmid and transformed into the Bacillus strain
carrying the integrated 1-butanol genes.
[0264] Unless otherwise indicated in the text, cloning primers
described in this Example are referenced by their SEQ ID NO in
Table 4, and sequencing and PCR screening primers are referenced by
their SEQ ID NO in Table 5.
[0265] Integration Plasmid.
[0266] Plasmid pFP988 is a Bacillus integration vector that
contains an E. coli replicon from pBR322, an ampicillin antibiotic
marker for selection in E. coli and two sections of homology to the
sacB gene in the Bacillus chromosome that directs integration of
the vector and intervening sequence by homologous recombination.
Between the sacB homology regions is the Pamy promoter and signal
sequence that can direct the synthesis and secretion of a cloned
gene, a His-Tag and erythromycin as a selectable marker for
Bacillus. The Pamy promoter and signal sequence is from Bacillus
amyloliquefaciens alpha-amylase. The promoter region also contains
the lacO sequence for regulation of expression by a lacI repressor
protein. The sequence of pFP988 (6509 bp) is given as SEQ ID
NO:79.
[0267] Since the 1-butanol pathway genes were to be expressed in
the cytoplasm, the amylase signal sequence was deleted. Plasmid
pFP988 was amplified with primers Pamy/lacO F and Pamy/lacO R
creating a 317 bp (0.3 kbp) product that contained the Pamy/lacO
promoter. The 5' end of the Pamy/lacO F primer incorporated a BsrGI
restriction site followed by an EcoRI site. The 5' end of the
Pamy/lacO R primer incorporated a BsrGI restriction site followed
by a PmeI restriction site. The PCR product was TOPO cloned into
pCR4Blunt-TOPO creating pCR4Blunt-TOPO-Pamy/lacO. Plasmid DNA was
prepared from overnight cultures and submitted for sequencing with
M13 Forward and M13 Reverse primers (SEQ ID NO:45 and SEQ ID NO:46,
respectively) to ensure no mutation had been introduced into the
promoter. A clone of pCR4Blunt-TOPO-Pamy/lacO was digested with
BsrGI and the 0.3 kbp fragment was gel-purified. The vector pFP988
was digested with BsrGI resulting in deletion of 11 bp from the 5'
sacB homology region and the removal of the Pamy/lacO promoter and
signal sequence and His-tag. The 6 kbp BsrGI digested vector was
gel-purified and ligated with Pamy/lacO BsrGI insert. The resulting
plasmids were screened with primers Pamy SeqF2 and Pamy SeqR to
determine orientation of the promoter. The correct clone restored
the Pamy/lacO promoter to its original orientation and was named
pFP988Dss.
[0268] The cassette with genes thI-crt was constructed by SOE
(splicing by overlap extension). The genes were amplified using as
template pUC19dss::Operon1. The thI primers were Top TF and Bot TR
amplifying a 0.9 kbp product. The crt primers were Top CF and Bot
CR amplifying a 1.3 kbp product. The two genes were joined by SOE
with PCR amplification using primers Top TF and Bot CR generating a
2.1 kbp product that was TOPO cloned into pCR4Blunt-TOPO creating
pCR4Blunt-TOPO-T-C. Clones were submitted for sequencing to confirm
the sequence. The plasmid pCR4Blunt-TOPO-T-C was digested with
BstEII and PmeI releasing a 2.1 kbp fragment that was gel-purified.
The insert was treated with Klenow polymerase to blunt the BstEII
site. Vector pFP988Dss was digested with PmeI and treated with calf
intestinal alkaline phosphatase (New England BioLabs) to prevent
self-ligation. The 2.1 kbp thI-crt fragment and the digested
pFP988Dss were ligated and transformed into E. coli Top10 cells.
Transformants were screened by PCR amplification with Pamy SeqF2
and N7SeqR2 for a 0.7 kbp product, the correct product was called
pFP988Dss-T-C.
[0269] Construction of the thI-crt cassette created unique SalI and
SpeI sites between the two genes. To add the hbd gene to the
cassette, the hbd gene was subcloned from pCR4Blunt-TOPO-hbd as a
0.9 kbp SalI/SpeI fragment. Vector pFP988Dss-T-C was digested with
SalI and SpeI and the 8 kbp vector fragment was gel-purified. The
vector and hbd insert were ligated and transformed into E. coli
Top10 cells. Transformants were screened by PCR amplification with
primers Pamy SeqF and N3SeqF3 for a 3.0 kbp fragment. The resulting
plasmid was named pFP988Dss-T-H-C.
[0270] The Pamy promoter subsequently was replaced with the Pspac
promoter from plasmid pMUTIN4 (Vagner et al., Microbiol.
144:3097-3104 (1998)). The Pspac promoter was amplified from
pMUTIN4 with primers Spac F and Spac R as a 0.4 kbp product and
TOPO cloned into pCR4Blunt-TOPO. Transformants were screened by PCR
amplification with M13 Forward and M13 Reverse primers for the
presence of a 0.5 kbp insert. Positive clones were submitted for
sequencing with the same primers. Plasmid pCR4Blunt-TOPO-Pspac was
digested with SmaI and XhoI and the 0.3 kbp fragment was
gel-purified. Vector pFP988Dss-T-H-C was digested with SmaI and
XhoI and the 9 kbp vector was isolated by gel purification. The
digested vector and Pspac insert were ligated and transformed into
E. coli Top10 cells. Transformants were screened by PCR
amplification with primers SpacF Seq and N7SeqR2. Positive clones
gave a 0.7 kbp product. Plasmid DNA was prepared from positive
clones and further screened by PCR amplification with primers SpacF
Seq and N3SeqF2. Positive clones gave a 3 kbp PCR product and were
named pFP988DssPspac-T-H-C.
[0271] Integration into B. subtilis BE1010 to Form B. subtilis
.DELTA.sacB::T-H-C::erm #28 Comprising Exogenous thI, hbd, and crt
Genes.
[0272] Competent cells of B. subtilis BE1010 were prepared as
described in Doyle et al., J. Bacteriol. 144:957-966 (1980).
Competent cells were harvested by centrifugation and the cell
pellets were resuspended in a small volume of the cell supernatant.
To 1 volume of competent cells, 2 volumes of SPII-EGTA medium
(Methods for General and Molecular Bacteriology, P. Gerhardt et
al., Eds, American Society for Microbiology, Washington, D.C.
(1994)) was added. Aliquots of 0.3 mL of cells were dispensed into
test tubes and the plasmid pFP988DssPspac-T-H-C was added to the
tubes. Cells were incubated for 30 minutes at 37.degree. C. with
shaking, after which 0.1 mL of 10% yeast extract was added to each
tube and the cells were further incubated for 60 min. Transformants
were plated for selection on LB erythromycin plates using the
double agar overlay method (Methods for General and Molecular
Bacteriology, supra). Transformants were initially screened by PCR
amplification with primers Pamy SeqF and N5SeqF3. Positive clones
that amplified the expected 2 kbp PCR product were further screened
by PCR amplification. If insertion of the cassette into the
chromosome had occurred via a double crossover event then primer
set sacB Up and N7SeqR2 and primer set sacB Dn and N4SeqR3 would
amplify a 1.7 kbp and a 2.7 kbp product respectively. A positive
clone was identified and named B. subtilis .DELTA.sacB::T-H-C::erm
#28.
[0273] Plasmid Expression of EgTER, ald, and bdhB Genes.
[0274] The three remaining 1-butanol genes were expressed from
plasmid pHT01 (MoBitec). Plasmid pHT01 is a Bacillus-E. coli
shuttle vector that replicates via a theta mechanism. Cloned
proteins are expressed from the GroEL promoter fused to a lacO
sequence. Downstream of the lacO is the efficient RBS from the gsiB
gene followed by a MCS. The ald gene was amplified by PCR with
primers AF BamHI and AR Aat2 using pUC19dHS-ald-bdhB (described in
Example 13) as template, creating a 1.4 kbp product. The product
was TOPO cloned into pCR4-TOPO and transformed into E. coli Top10
cells. Transformants were screened with M13 Forward and M13 Reverse
primers. Positive clones amplified a 1.6 kbp product. Clones were
submitted for sequencing with primers M13 forward and M13 reverse,
N31SeqF2, N31SeqF3, N32SeqR2, N32SeqR3 and N32SeqR4. The plasmid
was named pCR4TOPO-B/A-ald.
[0275] Vector pHT01 and plasmid pCR4TOPO-B/A-ald were both digested
with BamHI and AatII. The 7.9 kbp vector fragment and the 1.4 kbp
ald fragment were ligated together to create pHT01-ald. The
ligation was transformed into E. coli Top10 cells and transformants
were screened by PCR amplification with primers N31SeqF1 and HT R
for a 1.3 kbp product. To add the last two steps of the pathway to
the pHT01 vector, two cloning schemes were designed. For both
schemes, EgTER and bdhB were amplified together by SOE.
Subsequently, the EgTER-bdh fragment was either cloned into
pHT01-ald creating pHT01-ald-EB or cloned into pCR4-TOPO-B/A-ald
creating pCR4-TOPO-ald-EB. The ald-EgTer-bdhB fragment from the
TOPO vector was then cloned into pHT01 creating pHT01-AEB.
[0276] An EgTER-bdhB fragment was PCR amplified using primers
Forward 1 (E) and Reverse 2 (B), using template DNA given as SEQ ID
NO:208. The resulting 2.5 kbp PCR product was TOPO cloned into
pCR4Blunt-TOPO, creating pCR4Blunt-TOPO-E-B. The TOPO reaction was
transformed into E. coli Top10 cells. Colonies were screened with
M13 Forward and M13 Reverse primers by PCR amplification. Positive
clones generated a 2.6 kbp product. Clones of pCR4Blunt-TOPO-E-B
were submitted for sequencing with primers M13 Forward and Reverse,
N62SeqF2, N62SeqF3, N62SeqF4, N63SeqR1, N63SeqR2, N63SeqR3, N11Seq
F1 and N11Seq F2, N12SeqR1 and N12SeqR2.
[0277] Plasmid pCR4Blunt-TOPO-E-B was digested with HpaI and AatII
to release a 2.4 kbp fragment. The E-B fragment was treated with
Klenow polymerase to blunt the end and then was gel-purified.
Plasmid pHT01-ald was digested with AatII and treated with Klenow
polymerase to blunt the ends. The vector was then treated with calf
intestinal alkaline phosphatase and was gel-purified. The E-B
fragment was ligated to the linearized vector pHT01-ald,
transformed into E. coli Top10 cells, and selected on LB plates
containing 100 .mu.g/mL ampicillin. Transformants were screened by
PCR amplification with primers N3SeqF1 and N63SeqR1 to give a 2.4
kbp product. The resulting plasmid, pHT01-ald-EB, was transformed
into JM103 cells, a recA.sup.+ E. coli strain. Plasmids prepared
from recA.sup.+ strains form more multimers than recA.sup.-
strains. Bacillus subtilis transforms more efficiently with plasmid
multimers rather than monomers (Methods for General and Molecular
Bacteriology, supra). Plasmid DNA was prepared from JM103 and
transformed into competent B. subtilis .DELTA.sacB::T-H-C::erm #28
forming strain B. subtilis .DELTA.sacB::T-H-C::erm
#28/pHT01-ald-EB. Competent cells were prepared and transformed as
previously described. Transformants were selected on LB plates
containing 5 .mu.g/mL chloramphenicol and screened by colony PCR
with the primers N31SeqF1 and N63SeqR4 for a 1.3 kbp product.
[0278] In the alternate cloning strategy, pCR4Blunt-TOPO-E-B was
digested with HpaI and AatII releasing a 2.4 kbp fragment that was
gel-purified. Plasmid pCR4-TOPO-B/A-ald was digested with HpaI and
AatII and the 5.4 kbp vector fragment was gel-purified. The vector
fragment from pCR4-TOPO-B/A-ald was ligated with the HpaI-AatII E-B
fragment creating pCR4-TOPO-ald-EB. The ligation was transformed
into E. coli Top10 cells and the resulting transformants were
screened by PCR amplification with primers N11SeqF2 and N63SeqR4
for a 2.1 kbp product. Plasmid pCR4-TOPO-ald-EB was digested with
BamHI and AatII and SphI. The BamHI/AatII digest releases a 3.9 kbp
ald-EB fragment that was gel-purified. The purpose of the SphI
digest was to cut the remaining vector into smaller fragments so
that it would not co-migrate on a gel with the ald-EB insert.
Vector pHT01 was digested with BamHI and AatII and the 7.9 kbp
vector fragment was gel-purified. The vector and ald-EB insert
fragments were ligated to form plasmid pHT01-AEB and transformed
into E. coli Top10 cells. Colonies were screened by PCR
amplification with primers N62SeqF4 and HT R for a 1.5 kbp product.
Plasmid was prepared and transformed into JM103. Plasmid DNA was
prepared from JM103 and transformed into competent B. subtilis
.DELTA.sacB::T-H-C::erm #28 forming strain B. subtilis
.DELTA.sacB::T-H-C::erm #28/pHT01-AEB. Competent BE1010 cells were
prepared and transformed as previously described. Bacillus
transformants were screened by PCR amplification with primers
N31SeqF1 and N63SeqR4 for a 1.3 kbp product.
Demonstration of 1-Butanol Production from Recombinant B.
Subtilis.
[0279] Three independent isolates of each strain of B. subtilis
.DELTA.sacB::T-H-C::erm #28/pHT01-ald-EB and B. subtilis
.DELTA.sacB::T-H-C::erm #28/pHT01-AEB were inoculated into shake
flasks (approximately 175 mL total volume) containing 15 mL of
medium. A B. subtilis BE1010 strain lacking the exogenous
1-butanol, six gene pathway was also included as a negative
control. The medium contained (per liter): 10 mL of 1 M
(NH.sub.4).sub.2SO.sub.4; 5 mL of 1 M potassium phosphate buffer,
pH 7.0; 100 mL of 1 M MOPS/KOH buffer, pH 7.0; 20 mL of 1 M
L-glutamic acid, potassium salt; 10 g glucose; 10 mL of 5 g/L each
of L-methionine, L-tryptophan, and L-lysine; 0.1 g each of yeast
extract and casamino acids; 20 mL of metal mix; and appropriate
antibiotics (5 mg chloramphenicol and erythromycin for the
recombinant strains). The metal mix contained 200 mM MgCl.sub.2, 70
mM CaCl.sub.2, 5 mM MnCl.sub.2, 0.1 mM FeCl.sub.3, 0.1 mM
ZnCl.sub.2, 0.2 mM thiamine hydrochloride, 172 .mu.M CuSO.sub.4,
253 .mu.M CoCl.sub.2, and 242 .mu.M Na.sub.2MoO.sub.4. The flasks
were inoculated at a starting OD.sub.600 of 0.1 units, sealed with
non-vented caps, and incubated at 37.degree. C. with shaking at
approximately 200 rpm.
[0280] Approximately 24 h after inoculation, an aliquot of the
broth was analyzed by HPLC (Shodex Sugar SH1011 column) with
refractive index (R1) detection and GC (Varian CP-WAX 58(FFAP) CB
column, 0.25 mm.times.0.2 .mu.m.times.25 m) with flame ionization
detection (FID) for 1-butanol content, as described in the General
Methods section. The results of the 1-butanol determinations are
given in Table 19.
TABLE-US-00019 TABLE 19 Production of 1-butanol by strains B.
subtilis .DELTA.sacB::T-H-C::erm #28/pHT01-ald-EB and B. subtilis
.DELTA.sacB::T-H-C::erm #28/pHT01-AEB Strain 1-butanol, HPLC RI
peak area 1-butanol, mM* BE1010 control Not detected Not detected
pHT01-ald-EB a 4629 0.19 pHT01-ald-EB b 3969 Not determined
pHT01-ald-EB c 4306 Not determined pHT01-AEB a 4926 0.16 pHT01-AEB
b 3984 Not determined pHT01-AEB c 3970 Not determined
*Concentration determined by GC. Strain suffixes "a", "b", and "c"
indicate separate isolates.
Example 19
Production of 1-Butanol from Glucose or Sucrose by Recombinant E.
Coli
[0281] To endow E. coli MG1655 with the ability to use sucrose as
the carbon and energy source for 1-butanol production, a sucrose
utilization gene cluster (cscBKA) from plasmid pScrI (described
below) was subcloned into pBHR-Ptrc-ald(opt) (described in Example
17) in this organism. The sucrose utilization genes (cscA, cscK,
and cscB) encode a sucrose hydrolase (CscA), given as SEQ ID
NO:157, D-fructokinase (CscK), given as SEQ ID NO:158, and sucrose
permease (CscB), given as SEQ ID NO:159. To allow constitutive
expression of the three genes from their natural promoter, the
sucrose-specific repressor gene, cscR, that regulates the gene
cluster is not present in the construct.
[0282] Cloning and Expression of the Sucrose Utilization Gene
Cluster cscBKA in Plasmid pBHR-Ptrc-ald(opt).
[0283] The sucrose utilization gene cluster cscBKA, given as SEQ ID
NO:156, was isolated from genomic DNA of a sucrose-utilizing E.
coli strain derived from E. coli strain ATCC 13281. The genomic DNA
was digested to completion with BamHI and EcoRI. Fragments having
an average size of about 4 kbp were isolated from an agarose gel,
ligated to plasmid pLitmus28 (New England Biolabs, Beverly, Mass.),
which was then digested with BamHI and EcoRI. The resulting DNA was
transformed into ultracompetent E. coli TOP10F' (Invitrogen,
Carlsbad, Calif.). The transformants were plated on MacConkey agar
plates containing 1% sucrose and 100 .mu.g/mL ampicillin and
screened for purple colonies. Plasmid DNA was isolated from the
purple transformants and sequenced using primers M13 Forward (SEQ
ID NO:45), M13 Reverse (SEQ ID NO:46), scr1 (SEQ ID NO:160), scr2
(SEQ ID NO:161), scr3 (SEQ ID NO:162), and scr4 (SEQ ID NO:163).
The plasmid containing cscB, cscK, and cscA (cscBKA) genes was
designated pScr1.
[0284] Plasmid pScrI was digested with XhoI and treated with the
Klenow fragment of DNA polymerase to make blunt ends. The plasmid
was then digested with AgeI, and the 4,179 bp cscBKA gene cluster
fragment was gel-purified. Plasmid pBHR-Ptrc-ald(opt) was prepared
as described in Example 17 and was digested with AgeI and NaeI. The
resulting 6,003 bp pBHR-Ptrc-ald(opt) fragment was gel-purified.
The cscBKA fragment was ligated with the pBHR-Ptrc-ald(opt),
yielding pBHR-Ptrc-ald(opt)-cscAKB. Plasmid
pBHR-Ptrc-ald(opt)-cscAKB was transformed into E. coli NovaXG
electrocompetent cells (Novagen, Madison, Wis.) and sucrose
utilization was confirmed by plating the transformants on McConkey
agar plates containing 2% sucrose and 25 .mu.g/mL kanamycin. In the
pBHR-Ptrc-ald(opt)-cscAKB construct, the sucrose utilization genes
were cloned downstream of Ptrc-ald(opt) as a separate fragment in
the order cscA, cscK, and cscB.
[0285] Alternatively, the sucrose utilization genes were cloned in
the opposite direction in pBHR-Ptrc-ald(opt). Plasmid
pBHR-Ptrc-ald(opt) was digested with ScaI and AgeI, and the 5,971
bp pBHR-Ptrc-ald(opt) fragment was gel-purified. The 4,179 bp
cscBKA fragment, prepared as described above, was ligated with the
pBHR-Ptrc-ald(opt) fragment, yielding pBHR-Ptrc-ald(opt)-cscBKA.
Plasmid pBHR-Ptrc-ald(opt)-cscBKA was transformed into E. coli
NovaXG electrocompetent cells (Novagen, Madison, Wis.) and sucrose
utilization was confirmed by plating the transformants on McConkey
agar plates containing 2% sucrose and 25 .mu.g/mL kanamycin. In the
pBHR-Ptrc-ald(opt)-cscBKA construct, the sucrose utilization genes
were cloned as a separate fragment downstream of Ptrc-ald(opt) in
the order cscB, cscK, and cscA.
[0286] Demonstration of 1-Butanol Production from Glucose or
Sucrose Using Recombinant E. coli.
[0287] E. coli strain MG1655 1.5GI-yqhD::Cm (described in Example
17) was transformed with plasmids pTrc99a-E-C-H-T (prepared as
described in Example 17) and pBHR-Ptrc-ald(opt)-cscAKB or
pBHR-Ptrc-ald(opt)-cscBKA to produce two strains, MG1655 1.5GI
-yqhD::Cm/pTrc99a-E-C-H-T/pBHR-Ptrc-ald(opt)-cscAKB #9 and MG1655
1.5GI -yqhD::Cm/pTrc99a-E-C-H-T/pBHR-Ptrc-ald(opt)-cscBKA #1.
Starter cultures of the two strains were prepared by growing the
cells in LB medium containing 25 .mu.g/mL of kanamycin and 100
.mu.g/mL of carbenicillin. These cells were then used to inoculate
shake flasks (approximately 175 mL total volume) containing 50, 70
and 150 mL of TM3a/glucose medium (with appropriate antibiotics) to
represent high, medium and low oxygen conditions, respectively, as
described in Example 17. A third strain, E. coli MG1655/pScrI,
grown in TM3a/glucose medium containing 100 .mu.g/mL carbenicillin,
was used as a negative control. For each of the strains, an
identical set of flasks was prepared with TM3a/sucrose medium (with
appropriate antibiotics). TM3a/sucrose medium is identical to
TM3a/glucose medium except that sucrose (10 g/L) replaces glucose.
The flasks were inoculated at a starting OD.sub.550 of .ltoreq.0.03
units and incubated as described in Example 17. With the exception
of the negative control flasks, IPTG was added to the flasks (final
concentration of 0.04 mM) when the cultures reached an OD.sub.550
between 0.2 and 1.8 units. The cells were harvested when the
OD.sub.550 of the cultures increased at least 3-fold.
[0288] Approximately 24 h after inoculation, an aliquot of the
broth was analyzed by HPLC (Shodex Sugar SH1011 column) with
refractive index (R1) detection and GC (HP-INNOWax column, 30
m.times.0.53 mm id, 1 .mu.m film thickness) with flame ionization
detection (FID) for 1-butanol content, as described in the General
Methods section.
[0289] The concentrations of 1-butanol in cultures following growth
in the glucose and sucrose-containing media are given in Table 20
and Table 21, respectively. Both recombinant E. coli strains
containing the 1-butanol biosynthetic pathway produced 1-butanol
from glucose and sucrose under all oxygen conditions, while the
negative control strain produced no detectable 1-butanol.
TABLE-US-00020 TABLE 20 Production of 1-butanol from glucose by
recombinant E. coli strains MG1655 1.5GI-yqhD::Cm/pTrc99a-E-C-
H-T/pBHR-Ptrc-ald(opt)-cscAKB #9 and MG1655 1.5GI-
yqhD::Cm/pTrc99a-E-C-H-T/pBHR-Ptrc-ald(opt)-cscBKA #1 Strain
O.sub.2 Level 1-butanol, mM molar yield, % cscBKA #1 high 0.01 0.03
cscBKA #1 medium 0.20 0.43 cscBKA #1 low 0.07 0.21 cscAKB #9 high
0.01 0.02 cscAKB #9 medium 0.17 0.35 cscAKB #9 low 0.04 0.12 pScr1
high Not detected Not detected pScr1 medium Not detected Not
detected pScrl low Not detected Not detected
TABLE-US-00021 TABLE 21 Production of 1-butanol from sucrose by
recombinant E. coli strains. Strain O.sub.2 Level 1-butanol, mM
molar yield, % cscBKA #1 high 0.02 0.10 cscBKA #1 medium 0.02 0.11
cscBKA #1 low 0.01 0.09 cscAKB #9 high 0.03 0.11 cscAKB #9 medium
0.03 0.15 cscAKB #9 low 0.02 0.10 pScr1 high Not detected Not
detected pScr1 medium Not detected Not detected pScr1 low Not
detected Not detected
Example 20
Production of 1-Butanol from Sucrose Using Recombinant B.
Subtilis
[0290] This example describes the production of 1-butanol from
sucrose using recombinant Bacillus subtilis. Two independent
isolates of B. subtilis strain .DELTA.sacB::T-H-C::erm
#28/pHT01-ald-EB (Example 18) were examined for 1-butanol
production essentially as described in Example 18. The strains were
inoculated into shake flasks (approximately 175 mL total volume)
containing either 20 mL or 100 mL of medium to simulate high and
low oxygen conditions, respectively. Medium A was exactly as
described in Example 18, except that glucose was replaced with 5
g/L of sucrose. Medium B was identical to the TM3a/glucose medium
described in Example 17, except that glucose was replaced with 10
g/L sucrose and the medium was supplemented with (per L) 10 mL of a
5 g/L solution of each of L-methionine, L-tryptophan, and L-lysine.
The flasks were inoculated at a starting OD.sub.550 of .ltoreq.0.1
units, capped with vented caps, and incubated at 34.degree. C. with
shaking at 300 rpm.
[0291] Approximately 24 h after inoculation, an aliquot of the
broth was analyzed by GC (HP-INNOWax column, 30 m.times.0.53 mm id,
1.0 .mu.m film thickness) with FID detection for 1-butanol content,
as described in the General Methods section. The results of the
1-butanol determinations are given in Table 22. The recombinant
Bacillus strain containing the 1-butanol biosynthetic pathway
produced detectable levels of 1-butanol under high and low oxygen
conditions in both media.
TABLE-US-00022 TABLE 22 Production of 1-butanol from sucrose by B.
subtilis strain .DELTA.sacB::T-H-C::erm #28/pHT01-ald-EB Strain
Medium O.sub.2 Level 1-BuOH, mM.sup.1,2 none A Not applicable Not
detected pHT01-ald-EB a A high + pHT01-ald-EB b A high +
pHT01-ald-EB a A low 0.01 pHT01-ald-EB b A low 0.01 none B Not
applicable Not detected pHT01-ald-EB a B high + pHT01-ald-EB b B
high + pHT01-ald-EB a B low 0.04 pHT01-ald-EB b B low 0.03
.sup.1Concentration determined by GC. .sup.2"+" indicates
qualitative presence of 1-butanol. Strain suffixes "a" and "b"
indicate separate isolates.
Example 21
Production of 1-Butanol from Glucose and Sucrose Using Recombinant
Saccharomyces cerevisiae
[0292] This Example describes the production of 1-butanol in the
yeast Saccharomyces cerevisiae. Of the six genes encoding enzymes
catalyzing the steps in the 1-butanol biosynthetic pathway, five
were cloned into three compatible yeast 2 micron (2.mu.) plasmids
and co-expressed in Saccharomyces cerevisiae. The "upper pathway"
is defined as the first three enzymatic steps, catalyzed by
acetyl-CoA acetyltransferase (thIA, thiolase), 3-hydroxybutyryl-CoA
dehydrogenase (hbd), and crotonase (crt). The lower pathway is
defined as the fourth (butyl-CoA dehydrogenase, ter) and the fifth
(butylaldehyde dehydrogenase, ald) enzymatic steps of the pathway.
The last enzymatic step of the 1-butanol pathway is catalyzed by
alcohol dehydrogenase, which may be encoded by endogenous yeast
genes, e.g., adhIO and adhII.
[0293] Expression of genes in yeast typically requires a promoter,
followed by the gene of interest, and a transcriptional terminator.
A number of constitutive yeast promoters were used in constructing
expression cassettes for genes encoding the 1-butanol biosynthetic
pathway, including FBA, GPD, and GPM promoters. Some inducible
promoters, e.g. GAL1, GAL10, CUP1 were also used in intermediate
plasmid construction, but not in the final demonstration strain.
Several transcriptional terminators were used, including FBAt,
GPDt, GPMt, ERG10t, and GAL1t. Genes encoding the 1-butanol
biosynthetic pathway were first subcloned into a yeast plasmid
flanked by a promoter and a terminator, which yielded expression
cassettes for each gene. Expression cassettes were optionally
combined in a single vector by gap repair cloning, as described
below. For example, the three gene cassettes encoding the upper
pathway were subcloned into a yeast 2.mu. plasmid. The ter and ald
genes were each expressed individually in the 2.mu. plasmids.
Co-transformation of all three plasmids in a single yeast strain
resulted in a functional 1-butanol biosynthetic pathway.
Alternatively, several DNA fragments encoding promoters, genes, and
terminators were directly combined in a single vector by gap repair
cloning.
[0294] Methods for Constructing Plasmids and Strains in Yeast
Saccharomyces cerevisiae.
[0295] Basic yeast molecular biology protocols including
transformation, cell growth, gene expression, gap repair
recombination, etc. are described in Methods in Enzymology, Volume
194, Guide to Yeast Genetics and Molecular and Cell Biology (Part
A, 2004, Christine Guthrie and Gerald R. Fink (Eds.), Elsevier
Academic Press, San Diego, Calif.).
[0296] The plasmids used in this Example were E. coli-S. cerevisiae
shuttle vectors, pRS423, pRS424, pRS425, and pRS426 (American Type
Culture Collection, Rockville, Md.), which contain an E. coli
replication origin (e.g., pMB1), a yeast 2.mu. origin of
replication, and a marker for nutritional selection. The selection
markers for these four vectors are His3 (vector pRS423), Trp1
(vector pRS424), Leu2 (vector pRS425) and Ura3 (vector pRS426).
These vectors allow strain propagation in both E. coli and yeast
strains. A yeast haploid strain BY4741 (MA Ta his3.DELTA.1
leu2.DELTA.0 met15.DELTA.0 ura3.DELTA.0) (Research Genetics,
Huntsville, Ala., also available from ATCC 201388) and a diploid
strain BY4743 (MATa/alpha his3.DELTA.1/his3.DELTA.1
leu2.DELTA.0/leu2.DELTA.0 lys2.DELTA.0/LYS2 MET15/met15.DELTA.0
ura3.DELTA.0/ura3.DELTA.0) (Research Genetics, Huntsville, Ala.,
also available from ATCC 201390) were used as hosts for gene
cloning and expression. Construction of expression vectors for
genes encoding 1-butanol biosynthetic pathway enzymes were
performed by either standard molecular cloning techniques in E.
coli or by the gap repair recombination method in yeast.
[0297] The gap repair cloning approach takes advantage of the
highly efficient homologous recombination in yeast. Typically, a
yeast vector DNA is digested (e.g., in its multiple cloning site)
to create a "gap" in its sequence. A number of insert DNAs of
interest are generated that contain a .gtoreq.21 bp sequence at
both the 5' and the 3' ends that sequentially overlap with each
other, and with the 5' and 3' terminus of the vector DNA. For
example, to construct a yeast expression vector for "Gene X", a
yeast promoter and a yeast terminator are selected for the
expression cassette. The promoter and terminator are amplified from
the yeast genomic DNA, and Gene X is either PCR amplified from its
source organism or obtained from a cloning vector comprising Gene X
sequence. There is at least a 21 bp overlapping sequence between
the 5' end of the linearized vector and the promoter sequence,
between the promoter and Gene X, between Gene X and the terminator
sequence, and between the terminator and the 3' end of the
linearized vector. The "gapped" vector and the insert DNAs are then
co-transformed into a yeast strain and plated on the SD minimal
dropout medium, and colonies are selected for growth of cultures
and mini preps for plasmid DNAs. The presence of correct insert
combinations can be confirmed by PCR mapping. The plasmid DNA
isolated from yeast (usually low in concentration) can then be
transformed into an E. coli strain, e.g. TOP10, followed by mini
preps and restriction mapping to further verify the plasmid
construct. Finally the construct can be verified by sequence
analysis. Yeast transformants of positive plasmids are grown in SD
medium for performing enzyme assays to characterize the activities
of the enzymes expressed by the genes of interest.
[0298] Yeast cultures were grown in YPD complex medium or Synthetic
Minimal dropout medium containing glucose (SD medium) and the
appropriate compound mixtures that allow complementation of the
nutritional selection markers on the plasmids (Methods in
Enzymology, Volume 194, Guide to Yeast Genetics and Molecular and
Cell Biology, 2004, Part A, pp. 13-15). The sugar component in the
SD drop out medium was 2% glucose. For 1-Butanol production, yeast
cultures were also grown in Synthetic Minimal dropout medium with
2% sucrose (SS medium).
[0299] For enzyme activity analysis, a single colony of each strain
was streaked onto a fresh plate containing SD minimal drop out
medium and incubated at 30.degree. C. for 2 days. The cells on this
plate were used to inoculate 20 mL of SD drop out medium and in a
125 mL shake flask and grown overnight at 30.degree. C., with
shaking at 250 rpm. The optical density (OD.sub.600) of the
overnight culture was measured, and the culture was diluted to an
OD.sub.600=0.1 in 250 mL of the same medium in a 1.0 L shake flask,
and grown at 30.degree. C. with shaking at 250 rpm to an OD.sub.600
of between 0.8 to 1.0. The cells were then harvested by
centrifugation at 2000.times.g for 10 min, and resuspended in 20 mL
of 50 mM Tris-HCl buffer, pH 8.5. Enzyme assays were performed as
described above.
[0300] Construction of Plasmid pNY102 for thIA and hbd
Co-Expression.
[0301] A number of dual expression vectors were constructed for the
co-expression of thIA and hbd genes. The Saccharomyces cerevisiae
ERG10 gene is a functional ortholog of the thIA gene. Initially, a
dual vector of ERG10 and hbd was constructed using the yeast
GAL1-GAL10 divergent dual promoter, the GAL1 terminator (GAL1t) and
the ERG10 terminator (ERG10t). The ERG10 gene-ERG10t DNA fragment
was PCR amplified from genomic DNA of Saccharomyces cerevisiae
strain BY4743, using primers OT731 (SEQ ID NO:164) and OT732 (SEQ
ID NO:165). The yeast GAL1-GAL10 divergent promoter was also
amplified by PCR from BY4743 genomic DNA using primers OT733 (SEQ
ID NO:166) and OT734 (SEQ ID NO:167). The hbd gene was amplified
from E. coli plasmid pTrc99a-E-C-H-T (described in Example 17)
using PCR primers OT735 (SEQ ID NO:168) and OT736 (SEQ ID NO:169).
GAL1t was amplified from BY4743 genomic DNA using primers OT737
(SEQ ID NO:170) and OT738 (SEQ ID NO:171). Four PCR fragments,
erg10-ERG10t, GAL1-GAL10 promoters, hbd, and GAL1t, were thus
obtained with approximately 25 bp overlapping sequences between
each adjacent PCR fragment. GAL1t and ERG10-ERG10t fragments each
contain approximately 25 bp overlapping sequences with the yeast
vector pRS425. To assemble these sequences by gap repair
recombination, the DNA fragments were co-transformed into the yeast
strain BY4741 together with vector pRS425 which was digested with
BamHI and HindIII enzymes. Colonies were selected from SD-Leu
minimal plates, and clones with inserts were identified by PCR
amplification. The new plasmid was named pNY6
(pRS425.ERG10t-erg10-GAL10-GAL1-hbd-GAL1t). Further confirmation
was performed by restriction mapping.
[0302] The yeast strain BY4741 (pNY6), prepared by transforming
plasmid pNY6 into S. cerevisiae BY4741, showed good Hbd activity
but no thiolase activity. Due to the lack of thiolase activity, the
ERG10 gene was replaced with the thIA gene by gap repair
recombination. The thIA gene was amplified from E. coli vector
pTrc99a-E-C-H-T by PCR using primers OT797 (SEQ ID NO:172) which
adds a SphI restriction site, and OT798 (SEQ ID NO:173) which adds
an AscI restriction site. Plasmid pNY6 was digested with SphI and
PstI restriction enzymes, gel-purified, and co-transformed into
yeast BY4741 along with the PCR product of thIA. Due to the 30 bp
overlapping sequences between the PCR product of thIA and the
digested pNY6, the thIA gene was recombined into pNY6 between the
GAL10 promoter and the ERG10t terminator. This yielded plasmid pNY7
(pRS425.ERG10t-thIA-GAL10-GAL1-hbd-GAL1t), which was verified by
PCR and restriction mapping.
[0303] In a subsequent cloning step based on gap repair
recombination, the GAL10 promoter in pNY7 was replaced with the
CUP1 promoter, and the GAL1 promoter was replaced with the strong
GPD promoter. This plasmid, pNY10 (pRS425.
ERG10t-thIA-CUP1-GPD-hbd-GAL1t) allows for the expression of the
thIA gene under CUP1, a copper inducible promoter, and the
expression of the hbd gene under the GPD promoter. The CUP1
promoter sequence was PCR amplified from yeast BY4743 genomic DNA
using primers OT806 (SEQ ID NO:174), and OT807 (SEQ ID NO:175). The
GPD promoter was amplified from BY4743 genomic DNA using primers
OT808 (SEQ ID NO:176) and OT809 (SEQ ID NO:177). PCR products of
the CUP1 and the GPD promoters were combined with pNY7 plasmid
digested with NcoI and SphI restriction enzymes. From this gap
repair cloning step, plasmid pNY10 was constructed, which was
verified by PCR and restriction mapping. Yeast BY4741 strain
containing pNY10 had Hbd activity, but no ThIA activity. The Hbd
activity under GPD promoter was significantly improved compared to
the GAL1 promoter controlled Hbd activity (1.8 U/mg vs. 0.40 U/mg).
Sequencing analysis revealed that the thIA gene in pNY10 had a one
base deletion near the 3' end, which resulted in a truncated
protein. This explains the lack of thiolase activity in the
strain.
[0304] Plasmid pNY12 was constructed with the correct thIA gene
sequence. The thIA gene was cut from the vector pTrc99a-E-C-H-T by
digestion with SphI and AscI. The FBA1 promoter was PCR amplified
from BY4743 genomic DNA using primers OT799 (SEQ ID NO:178) and
OT761 (SEQ ID NO:179), and digested with SalI and SphI restriction
enzymes. The thIA gene fragment and FBA1 promoter fragment were
ligated into plasmid pNY10 at AscI and SalI sites, generating
plasmid pNY12 (pRS425.ERG10t-thIA-FBA1), which was confirmed by
restriction mapping. pNY12 was transformed into yeast strain BY4741
and the resulting transformant showed a ThIA activity of 1.66
U/mg.
[0305] The FBA1 promoter-th/A gene fragment from pNY12 was
re-subcloned into pNY10. The pNY10 vector was cut with the AscI
restriction enzyme and ligated with the AscI digested FBA1
promoter-th/A gene fragment isolated from plasmid pNY12. This
created a new plasmid with two possible insert orientations. The
clones with FBA1 and GPD promoters located adjacent to each other
in opposite orientation were chosen and this plasmid was named
pNY102. pNY102 (pRS425. ERG10t-thIA-FBA1-GPD-hbd-GAL1t) was
verified by restriction mapping. Strain DPD5206 was made by
transforming pNY102 into yeast strain BY4741. The ThIA activity of
DPD5206 was 1.24 U/mg and the Hbd activity was 0.76 U/mg.
[0306] Construction of Plasmid pNY11 for crt Expression.
[0307] The crt gene expression cassette was constructed by
combining the GPM1 promoter, the crt gene, and the GPM1t terminator
into vector pRS426 using gap repair recombination in yeast. The
GPM1 promoter was PCR amplified from yeast BY4743 genomic DNA using
primers OT803 (SEQ ID NO:180) and OT804 (SEQ ID NO:181). The crt
gene was amplified using PCR primers OT785 (SEQ ID NO:182) and
OT786 (SEQ ID NO:183) from E. coli plasmid pTrc99a-E-C-H-T. The
GPM1t terminator was PCR amplified from yeast BY4743 genomic DNA
using OT787 (SEQ ID NO:184) and OT805 (SEQ ID NO:185). Yeast vector
pRS426 was digested with BamHI and HindIII and was gel-purified.
This DNA was co-transformed with the PCR products of the GPM1
promoter, the crt gene and the GPM1 terminator into yeast BY4741
competent cells. Clones with the correct inserts were verified by
PCR and restriction mapping and the resulting yeast strain BY4741
(pNY11: pRS426-GPM1-crt-GPM1t) had a Crt activity of 85 U/mg.
[0308] Construction of Plasmid pNY103 for thIA, hbd and crt
Co-Expression.
[0309] For the co-expression of the upper 1-butanol pathway
enzymes, the crt gene cassette from pNY11 was subcloned into
plasmid pNY102 to create an hbd, thIA, and crt expression vector. A
2,347 bp DNA fragment containing the GPM1 promoter, the crt gene,
and the GPM1 terminator was cut from plasmid pNY11 with SacI and
NotI restriction enzymes and cloned into vector pNY102, which was
digested with NotI and partially digested with SacI, producing the
expression vector pNY103 (pRS425.
ERG10t-thIA-FBA1-GPD-hbd-GAL1t-GPM1t-crt-GPM1). Following
confirmation of the presence of all three cassettes in pNY103 bp
digestion with HindIII, the plasmid was transformed into yeast
BY4743 cells and the transformed yeast strain was named DPD5200.
When grown under standard conditions, DPD5200 showed ThIA, Hbd, and
Crt enzyme activities of 0.49 U/mg, 0.21 U/mg and 23.0 U/mg,
respectively.
[0310] Construction of Plasmid pNY8 for ald Expression.
[0311] A codon optimized gene named tery (SEQ ID NO:186), encoding
the Ter protein (SEQ ID NO:187), and a codon optimized gene named
aldy (SEQ ID NO:188), encoding the Ald protein (SEQ ID NO:189) were
synthesized using preferred codons of Saccharomyces cerevisiae.
Plasmid pTERy containing the codon optimized ter gene and pALDy
containing the codon optimized ald gene were made by DNA2.0 (Palo
Alto, Calif.).
[0312] To assemble pNY8 (pRS426.GPD-ald-GPDt), three insert
fragments including a PCR product of the GPD promoter (synthesized
from primers OT800 (SEQ ID NO:190) and OT758, (SEQ ID NO:191), and
BY4743 genomic DNA), an aldy gene fragment excised from pALDy by
digestion with NcoI and SfiI (SEQ ID NO:188), and a PCR product of
the GPD terminator (synthesized from primers OT754 (SEQ ID NO:192)
and OT755 (SEQ ID NO:193), and BY4743 genomic DNA) were recombined
with the BamHI, HindIII digested pRS426 vector via gap repair
recombination cloning. Yeast BY4741 transformation clones were
analyzed by PCR mapping. The new plasmid thus constructed, pNY8,
was further confirmed by restriction mapping. The yeast BY4741
transformants containing pNY8 were analyzed for Ald activity and
the specific activity towards butyryl-CoA was approximately 0.07
U/mg.
[0313] Construction of Plasmids pNY9 and pNY13 for ter
Expression.
[0314] The codon optimized tery gene was cloned into vector pRS426
under control of the FBA1 promoter by gap repair cloning. The FBA1
promoter was PCR amplified from yeast BY4743 genomic DNA using
primers OT760 (SEQ ID NO:194) and OT792 (SEQ ID NO:195). The tery
gene was obtained by digestion of plasmid pTERy by SphI and NotI
restriction enzymes that resulted in the fragment given as SEQ ID
NO:186. The PCR fragment of FBA1 terminator was generated by PCR
from yeast BY4743 genomic DNA using primers OT791 (SEQ ID NO:196)
and OT765 (SEQ ID NO:197). Three DNA fragments, the FBA1 promoter,
the ter gene and the FBA1 terminator, were combined with the BamHI,
HindIII digested pRS426 vector and transformed into yeast BY4741 bp
gap repair recombination. The resulting plasmid, pNY9
(pRS426-FBA1-tery-FBA1t) was confirmed by PCR mapping, as well as
restriction digestion. The yeast BY4741 transformant of pNY9
produced a Ter activity of 0.26 U/mg.
[0315] To make the final 1-butanol biosynthetic pathway strain, it
was necessary to construct a yeast expression strain that contained
several plasmids, each with a unique nutritional selection marker.
Since the parent vector pRS426 contained a Ura selection marker,
the ter expression cassette was subcloned into vector pRS423, which
contained a His3 marker. A 3.2 kb fragment containing the
FBA1-tery-FBA1t cassette was isolated from plasmid pNY9 bp
digestion with SacI and XhoI restriction enzymes, and ligated into
vector pRS423 that was cut with these same two enzymes. The new
plasmid, pNY13 (pRS423-FBA1-tery-FBA1t) was mapped by restriction
digestion. pNY13 was transformed into BY4741 strain and the
transformant was cultured in SD-His medium, yielding a strain with
a Ter activity of 0.19 U/mg.
[0316] Construction of a Yeast Strain Containing 1-Butanol
Biosynthetic Pathway Genes for Demonstration of 1-Butanol
Production.
[0317] As described above, yeast strain DPD5200 was constructed by
transformation of plasmid pNY103 into S. cerevisiae strain BY4743,
which allows co-expression of thIA, hbd and crt genes. Yeast
competent cells of DPD5200 were prepared as described above, and
plasmids pNY8 and pNY13 were co-transformed into DPD5200,
generating strain DPD5213. DPD5213 allows for the simultaneous
constitutive expression of five genes in the 1-butanol biosynthetic
pathway, thIA, hbd, crt, ter and aid. Strain DPD5212 (S. cerevisiae
strain BY4743 transformed with empty plasmids, pRS425 and pRS426)
was used as a negative control. Four independent isolates of strain
DPD5213 were grown on SD-Ura,-Leu,-His dropout minimal medium in
the presence of either 2% glucose or 2% sucrose to allow the growth
complementation of all three plasmids. A single isolate of DPD5212
was similarly grown in appropriate medium.
[0318] To demonstrate 1-butanol production by aerobic cultures, a
single colony of each strain was streaked onto a fresh agar plate
containing SD minimal drop out growth medium (containing 2%
glucose) or SS minimal drop out growth medium (containing 2%
sucrose) and incubated at 30.degree. C. for 2 days. Cells from
these plates were used to inoculate 20 mL of the minimal drop out
medium (either SD or SS) in 125 mL plastic shake flasks and were
grown overnight at 30.degree. C. with shaking at 250 rpm. The
optical density (OD.sub.600) of the overnight culture was measured,
the culture was diluted to OD.sub.600 of 0.1 in 25 mL of the same
medium in a 125 mL shake flask, and grown at 30.degree. C. with
shaking at 250 rpm.
[0319] Aliquots of the culture were removed at 24 h and 48 h for GC
analysis of 1-butanol production (HP-INNOWax column, 30
m.times.0.53 mm id, 1 .mu.m film thickness) with FID detection, as
described in the General Methods section. The results of the GC
analysis are given in Table 23.
TABLE-US-00023 TABLE 23 Production of 1-butanol from glucose and
sucrose by S. cerevisiae strain DPD5213 1-butanol at 24 h,
1-butanol at 48 h, Strain.sup.1 Sugar mg/L.sup.2 mg/L.sup.2 DPD5212
Glucose Not detected Not detected DPD5213 a Glucose 0.4 0.5 DPD5213
b Glucose 0.9 0.2 DPD5213 c Glucose 1.0 0.6 DPD5213 d Glucose 0.8
0.3 DPD5212 Sucrose Not detected Not detected DPD5213 a Sucrose Not
detected 1.7 DPD5213 b Sucrose Not detected 1.3 DPD5213 c Sucrose
0.2 1.5 DPD5213 d Sucrose 0.6 0.9 .sup.1Independent isolates are
indicated by a-d. .sup.2Concentration determined by GC.
Example 22
Prophetic
Expression of the 1-Butanol Biosynthetic Pathway in Lactobacillus
Plantarum
[0320] The purpose of this prophetic Example is to describe how to
express the 1-butanol biosynthetic pathway in Lactobacillus
plantarum. The six genes of the 1-butanol pathway, encoding six
enzyme activities, are divided into two operons for expression. The
first three genes of the pathway (thI, hbd, and crt, encoding the
enzymes acetyl-CoA acetyltransferase, 3-hydroxybutyryl-CoA
dehydrogenase, and crotonase, respectively) are integrated into the
chromosome of Lactobacillus plantarum by homologous recombination
using the method described by Hols et al. (Appl. Environ.
Microbiol. 60:1401-1413 (1994)). The last three genes (EgTER, aid,
and bdhB, encoding the enzymes butyryl-CoA dehydrogenase,
butyraldehyde dehydrogenase and butanol dehydrogenase,
respectively) are cloned into an expression plasmid and transformed
into the Lactobacillus strain carrying the integrated upper pathway
1-butanol genes. Lactobacillus is grown in MRS medium (Difco
Laboratories, Detroit, Mich.) at 37.degree. C. Chromosomal DNA is
isolated from Lactobacillus plantarum as described by Moreira et
al. (BMC Microbiol. 5:15 (2005)).
[0321] Integration.
[0322] The thI-hbd-crt cassette under the control of the synthetic
P11 promoter (Rud et al., Microbiology 152:1011-1019 (2006)) is
integrated into the chromosome of Lactobacillus plantarum ATCC
BAA-793 (NCIMB 8826) at the ldhL1 locus by homologous
recombination. To build the ldhL integration targeting vector, a
DNA fragment from Lactobacillus plantarum (Genbank NC.sub.--004567)
with homology to ldhL is PCR amplified with primers LDH EcoRV F
(SEQ ID NO:198) and LDH AatIIR (SEQ ID NO:199). The 1986 bp PCR
fragment is cloned into pCR4Blunt-TOPO and sequenced. The
pCR4Blunt-TOPO-ldhL1 clone is digested with EcoRV and AatII
releasing a 1982 bp ldhL1 fragment that is gel-purified. The
integration vector pFP988, described in Example 18, is digested
with HindIII and treated with Klenow DNA polymerase to blunt the
ends. The linearized plasmid is then digested with AatII and the
2931 by vector fragment is gel-purified. The EcoRV/AatII ldhL1
fragment is ligated with the pFP988 vector fragment and transformed
into E. coli Top10 cells. Transformants are selected on LB agar
plates containing ampicillin (100 .mu.g/mL) and are screened by
colony PCR to confirm construction of pFP988-ldhL.
[0323] To add a selectable marker to the integrating DNA, the Cm
gene with its promoter is PCR amplified from pC194 (Genbank
NC.sub.--002013) with primers Cm F (SEQ ID NO:200) and Cm R (SEQ ID
NO:201), amplifying a 836 bp PCR product. The amplicon is cloned
into pCR4Blunt-TOPO and transformed into E. coli Top10 cells,
creating pCR4Blunt-TOPO-Cm. After sequencing to confirm that no
errors are introduced by PCR, the Cm cassette is digested from
pCR4Blunt-TOPO-Cm as an 828 bp MluI/SwaI fragment and is
gel-purified. The ldhL-homology containing integration vector
pFP988-ldhL is digested with MluI and SwaI and the 4740 bp vector
fragment is gel-purified. The Cm cassette fragment is ligated with
the pFP988-ldhL vector creating pFP988-DldhL::Cm.
[0324] Finally the thI-hbd-crt cassette from pFP988Dss-T-H-C,
described in Example 18, is modified to replace the amylase
promoter with the synthetic P11 promoter. Then, the whole operon is
moved into pFP988-DldhL::Cm. The P11 promoter is built by
oligonucleotide annealing with primer P11 F (SEQ ID NO:202) and P11
R (SEQ ID NO:203). The annealed oligonucleotide is gel-purified on
a 6% Ultra PAGE gel (Embi Tec, San Diego, Calif.). The plasmid
pFP988Dss-T-H-C is digested with XhoI and SmaI and the 9 kbp vector
fragment is gel-purified. The isolated P11 fragment is ligated with
the digested pFP988Dss-T-H-C to create pFP988-P11-T-H-C. Plasmid
pFP988-P11-T-H-C is digested with XhoI and BamHI and the 3034 bp
P11-T-H-C fragment is gel-purified. pFP988-DldhL::Cm is digested
with XhoI and BamHI and the 5558 bp vector fragment isolated. The
upper pathway operon is ligated with the integration vector to
create pFP988-DldhL-P11-THC::Cm.
[0325] Integration of pFP988-DldhL-P11-THC::Cm into L. plantarum
BAA-793 to form L. plantarum .DELTA.ldhL1::T-H-C::Cm Comprising
Exogenous thI, hbd, and crt Genes.
[0326] Electrocompetent cells of L. plantarum are prepared as
described by Aukrust, T. W., et al. (In: Electroporation Protocols
for Microorganisms; Nickoloff, J. A., Ed.; Methods in Molecular
Biology, Vol. 47; Humana Press, Inc., Totowa, N.J., 1995, pp
201-208). After electroporation, cells are outgrown in MRSSM medium
(MRS medium supplemented with 0.5 M sucrose and 0.1 M MgCl.sub.2)
as described by Aukrust et al. supra for 2 h at 37.degree. C.
without shaking. Electroporated cells are plated for selection on
MRS plates containing chloramphenicol (10 .mu.g/mL) and incubated
at 37.degree. C. Transformants are initially screened by colony PCR
amplification to confirm integration, and initial positive clones
are then more rigorously screened by PCR amplification with a
battery of primers.
[0327] Plasmid Expression of EgTER, ald, and bdhB Genes.
[0328] The three remaining 1-butanol genes are expressed from
plasmid pTRKH3 (O'Sullivan D J and Klaenhammer T R, Gene
137:227-231 (1993)) under the control of the L. plantarum ldhL
promoter (Ferain et al., J. Bacteriol. 176:596-601 (1994)). The
ldhL promoter is PCR amplified from the genome of L. plantarum ATCC
BAA-793 with primers PldhL F (SEQ ID NO:204) and PldhL R (SEQ ID
NO:205). The 369 bp PCR product is cloned into pCR4Blunt-TOPO and
sequenced. The resulting plasmid, pCR4Blunt-TOPO-PldhL is digested
with SacI and BamHI releasing the 359 bp PldhL fragment.
[0329] pHT01-ald-EB, described in Example 18, is digested with SacI
and BamHIH and the 10503 bp vector fragment is recovered by gel
purification. The PldhL fragment and vector are ligated creating
pHT01-PldhL-ald-EB.
[0330] To subclone the ldhL promoter-ald-EgTER-bdh cassette,
pHT01-PldhL-ald-EB is digested with MluI and the ends are treated
with Klenow DNA polymerase. The linearized vector is digested with
Sail and the 4270 bp fragment containing the PldhL-AEB fragment is
gel-purified. Plasmid pTRKH3 is digested with Sail and EcoRV and
the gel-purified vector fragment is ligated with the PldhL-AEB
fragment. The ligation mixture is transformed into E. coli Top 10
cells and transformants are plated on Brain Heart Infusion (BHI,
Difco Laboratories, Detroit, Mich.) plates containing erythromycin
(150 mg/L). Transformants are screened by PCR to confirm
construction of pTRKH3-ald-E-B. The expression plasmid,
pTRKH3-ald-E-B is transformed into L. plantarum
.DELTA.ldhL1::T-H-C::Cm by electroporation, as described above.
[0331] L. plantarum .DELTA.ldhL1::T-H-C::Cm containing
pTRKH3-ald-E-B is inoculated into a 250 mL shake flask containing
50 mL of MRS medium plus erythromycin (10 .mu.g/mL) and grown at
37.degree. C. for 18 to 24 h without shaking. After 18 h to 24,
1-butanol is detected by HPLC or GC analysis, as described in the
General Methods section.
Example 23
Prophetic
Expression of the 1-Butanol Biosynthetic Pathway in Enterococcus
faecalis
[0332] The purpose of this prophetic Example is to describe how to
express the 1-butanol biosynthetic pathway in Enterococcus
faecalis. The complete genome sequence of Enterococcus faecalis
strain V583, which is used as the host strain for the expression of
the 1-butanol biosynthetic pathway in this Example, has been
published (Paulsen et al., Science 299:2071-2074 (2003)). Plasmid
pTRKH3 (O'Sullivan D J and Klaenhammer T R, Gene 137:227-231
(1993)), an E. coli/Gram-positive shuttle vector, is used for
expression of the six genes (thIA, hbd, crt, EgTER, aid, bdhB) of
the 1-butanol pathway in one operon. pTRKH3 contains an E. coli
plasmid p15A replication origin and the pAM.beta.1 replicon, and
two antibiotic resistance selection markers, tetracycline
resistance and erythromycin resistance. Tetracycline resistance is
only expressed in E. coli, and erythromycin resistance is expressed
in both E. coli and Gram-positive bacteria. Plasmid pAMf31
derivatives can replicate in E. faecalis (Poyart et al., FEMS
Microbiol. Lett. 156:193-198 (1997)). The inducible nisA promoter
(PnisA), which has been used for efficient control of gene
expression by nisin in a variety of Gram-positive bacteria
including Enterococcus faecalis (Eichenbaum et al., Appl. Environ.
Microbiol. 64:2763-2769 (1998)), is used to control expression of
the six desired genes encoding the enzymes of the 1-butanol
biosynthetic pathway.
[0333] The linear DNA fragment (215 bp) containing the nisA
promoter (Chandrapati et al., Mol. Microbiol. 46(2):467-477 (2002))
is PCR-amplified from Lactococcus lactis genomic DNA with primers
F-PnisA(EcoRV) (SEQ ID NO:206) and R-PnisA(PmeI BamHI) (SEQ ID
NO:207). The 215 bp PCR fragment is digested with EcoRV and BamHI,
and the resulting PnisA fragment is gel-purified. Plasmid pTRKH3 is
digested with EcoRV and BamHI and the vector fragment is
gel-purified. The linearised pTRKH3 is ligated with the PnisA
fragment. The ligation mixture is transformed into E. coli Top10
cells by electroporation and transformants are selected following
overnight growth at 37.degree. C. on LB agar plates containing
erythromycin (25 .mu.g/mL). The transformants are then screened by
colony PCR with primers F-PnisA(EcoRV) and R-PnisA(BamHI) to
confirm the correct clone of pTRKH3-PnisA.
[0334] Plasmid pTRKH3-PnisA is digested with PmeI and BamHI, and
the vector is gel-purified. Plasmid pHTO1-ald-EgTER-bdhB is
constructed as described in Example 18 and is digested with SmaI
and BamHI, and the 2,973 bp ald-EgTER-bdhB fragment is
gel-purified. The 2,973 bp ald-EgTER-bdhB fragment is ligated into
the pTRKH3-PnisA vector at the PmeI and BamHI sites. The ligation
mixture is transformed into E. coli Top10 cells by electroporation
and transformants are selected following incubation at 37.degree.
C. overnight on LB agar plates containing erythromycin (25
.mu.g/mL). The transformants are then screened by colony PCR with
primers ald forward primer N27F1 (SEQ ID NO: 31) and bdhB reverse
primer N65 (SEQ ID NO: 44). The resulting plasmid is named
pTRKH3-PnisA-ald-EgTER-bdhB (=pTRKH3-A-E-B).
[0335] Plasmid pTRKH3-A-E-B is purified from the transformant and
used for further cloning of the remaining genes (thIA, hbd, crt)
into the BamHI site located downstream of the bdhB gene. Plasmid
pTRKH3-A-E-B is digested with BamHI and treated with the Klenow
fragment of DNA polymerase to make blunt ends. Plasmid
pFP988Dss-thIA-hbd-crt (=pFP988Dss-T-H-C) is constructed as
described in Example 18 and is digested with SmaI and BamHI. The
resulting 2,973 bp th/A-hbd-crt fragment is treated with the Klenow
fragment of DNA polymerase to make blunt ends and is gel-purified.
The 2,973 bp th/A-hbd-crt fragment is ligated with the linearised
pTRKH3-A-E-B. The ligation mixture is transformed into E. coli
Top10 cells by electroporation and transformants are selected
following overnight growth at 37.degree. C. on LB agar plates
containing erythromycin (25 .mu.g/mL). The transformants are then
screened by colony PCR with primers thIA forward primer N7 (SEQ ID
NO: 21) and crt reverse primer N4 (SEQ ID NO: 18). The resulting
plasmid is named pTRKH3-PnisA-ald-EgTER-bdhB-thIA-hbd-crt
(=pTRKH3-A-E-B-T-H-C). Plasmid pTRKH3-A-E-B-T-H-C is prepared from
the E. coli transformants and transformed into electro-competent E.
faecalis V583 cells by electroporation using methods known in the
art (Aukrust, T. W., et al. In: Electroporation Protocols for
Microorganisms; Nickoloff, J. A., Ed.; Methods in Molecular
Biology, Vol. 47; Humana Press, Inc., Totowa, N.J., 1995, pp
217-226), resulting in E. faecalis V583/pTRKH3-A-E-B-T-H-C.
[0336] The second plasmid containing nisA regulatory genes, nisR
and nisK, the add9 spectinomycin resistance gene, and the pSH71
origin of replication is transformed into E. faecalis
V583/pTRKH3-A-E-B-T-H-C by electroporation. The plasmid containing
pSH71 origin of replication is compatible with pAM.beta.1
derivatives in E. faecalis (Eichenbaum et al., supra). Double drug
resistant transformants are selected on LB agar plates containing
erythromycin (25 .mu.g/mL) and spectinomycin (100 .mu.g/mL).
[0337] The resulting E. faecalis strain V5838 harboring two
plasmids, i.e., an expression plasmid (pTRKH3-A-E-B-T-H-C) and a
regulatory plasmid (pSH71-nisRK), is inoculated into a 250 mL shake
flask containing 50 mL of Todd-Hewitt broth supplemented with yeast
extract (0.2%) (Fischetti et al., J. Exp. Med. 161:1384-1401
(1985)), nisin (20 .mu.g/mL) (Eichenbaum et al., supra),
erythromycin (25 .mu.g/mL), and spectinomycin (100 .mu.g/mL). The
flask is incubated without shaking at 37.degree. C. for 18 to 24 h,
after which time, 1-butanol production is measured by HPLC or GC
analysis, as described in the General Methods section.
Example 24
Increased Tolerance of Saccharomyces cerevisiae to 1-Butanol at
Decreased Growth Temperatures
[0338] Tolerance levels were determined for yeast strain
Saccharomyces cerevisiae BY4741 (described in Example 21) at
25.degree. C. and 30.degree. C. as follows. The strain was cultured
in YPD medium. Overnight cultures in the absence of any test
compound were started in 25 mL of YPD medium in 150 mL flasks with
incubation at 30.degree. C. or at 25.degree. C. in shaking water
baths. The next morning, each overnight culture was diluted into a
500 mL flask-containing 300 mL of fresh medium to an initial OD600
of about 0.1. The flasks were incubated in shaking water baths at
30.degree. C. or 25.degree. C., using the same temperature as used
for each overnight culture. The large cultures were incubated for 3
hours and then were split into flasks in the absence (control) and
in the presence of 1% or 2% of 1-butanol. Growth was followed by
measuring OD600 for six hours after addition of the 1-butanol. The
.DELTA.OD.sub.600 was calculated by subtracting the initial
OD.sub.600 from the final OD.sub.600 at 6 hours. The percent growth
inhibition relative to the control culture was calculated as
follows: % Growth Inhibition=100-[100(Sample
.DELTA.OD.sub.600/Control .DELTA.OD.sub.600)]. The results are
summarized in Table 24 below and indicate that growth of strain
BY4741 was less inhibited by 1% 1-butanol at 25.degree. C. than by
1% 1-butanol at 30.degree. C.
TABLE-US-00024 TABLE 24 Growth of Saccharomyces cerevisiae Strain
BY4741 at 25.degree. C. and 30.degree. C. with 1-Butanol. %
1-Butanol Temperature .degree. C. % Growth Inhibition 1 30 64 1 25
43 2 30 No growth 2 25 No growth
Sequence CWU 1
1
20811179DNAClostridium acetobutylicum 1atgaaagaag ttgtaatagc
tagtgcagta agaacagcga ttggatctta tggaaagtct 60cttaaggatg taccagcagt
agatttagga gctacagcta taaaggaagc agttaaaaaa 120gcaggaataa
aaccagagga tgttaatgaa gtcattttag gaaatgttct tcaagcaggt
180ttaggacaga atccagcaag acaggcatct tttaaagcag gattaccagt
tgaaattcca 240gctatgacta ttaataaggt ttgtggttca ggacttagaa
cagttagctt agcagcacaa 300attataaaag caggagatgc tgacgtaata
atagcaggtg gtatggaaaa tatgtctaga 360gctccttact tagcgaataa
cgctagatgg ggatatagaa tgggaaacgc taaatttgtt 420gatgaaatga
tcactgacgg attgtgggat gcatttaatg attaccacat gggaataaca
480gcagaaaaca tagctgagag atggaacatt tcaagagaag aacaagatga
gtttgctctt 540gcatcacaaa aaaaagctga agaagctata aaatcaggtc
aatttaaaga tgaaatagtt 600cctgtagtaa ttaaaggcag aaagggagaa
actgtagttg atacagatga gcaccctaga 660tttggatcaa ctatagaagg
acttgcaaaa ttaaaacctg ccttcaaaaa agatggaaca 720gttacagctg
gtaatgcatc aggattaaat gactgtgcag cagtacttgt aatcatgagt
780gcagaaaaag ctaaagagct tggagtaaaa ccacttgcta agatagtttc
ttatggttca 840gcaggagttg acccagcaat aatgggatat ggacctttct
atgcaacaaa agcagctatt 900gaaaaagcag gttggacagt tgatgaatta
gatttaatag aatcaaatga agcttttgca 960gctcaaagtt tagcagtagc
aaaagattta aaatttgata tgaataaagt aaatgtaaat 1020ggaggagcta
ttgcccttgg tcatccaatt ggagcatcag gtgcaagaat actcgttact
1080cttgtacacg caatgcaaaa aagagatgca aaaaaaggct tagcaacttt
atgtataggt 1140ggcggacaag gaacagcaat attgctagaa aagtgctag
11792392PRTClostridium acetobutylicum 2Met Lys Glu Val Val Ile Ala
Ser Ala Val Arg Thr Ala Ile Gly Ser 1 5 10 15 Tyr Gly Lys Ser Leu
Lys Asp Val Pro Ala Val Asp Leu Gly Ala Thr 20 25 30 Ala Ile Lys
Glu Ala Val Lys Lys Ala Gly Ile Lys Pro Glu Asp Val 35 40 45 Asn
Glu Val Ile Leu Gly Asn Val Leu Gln Ala Gly Leu Gly Gln Asn 50 55
60 Pro Ala Arg Gln Ala Ser Phe Lys Ala Gly Leu Pro Val Glu Ile Pro
65 70 75 80 Ala Met Thr Ile Asn Lys Val Cys Gly Ser Gly Leu Arg Thr
Val Ser 85 90 95 Leu Ala Ala Gln Ile Ile Lys Ala Gly Asp Ala Asp
Val Ile Ile Ala 100 105 110 Gly Gly Met Glu Asn Met Ser Arg Ala Pro
Tyr Leu Ala Asn Asn Ala 115 120 125 Arg Trp Gly Tyr Arg Met Gly Asn
Ala Lys Phe Val Asp Glu Met Ile 130 135 140 Thr Asp Gly Leu Trp Asp
Ala Phe Asn Asp Tyr His Met Gly Ile Thr 145 150 155 160 Ala Glu Asn
Ile Ala Glu Arg Trp Asn Ile Ser Arg Glu Glu Gln Asp 165 170 175 Glu
Phe Ala Leu Ala Ser Gln Lys Lys Ala Glu Glu Ala Ile Lys Ser 180 185
190 Gly Gln Phe Lys Asp Glu Ile Val Pro Val Val Ile Lys Gly Arg Lys
195 200 205 Gly Glu Thr Val Val Asp Thr Asp Glu His Pro Arg Phe Gly
Ser Thr 210 215 220 Ile Glu Gly Leu Ala Lys Leu Lys Pro Ala Phe Lys
Lys Asp Gly Thr 225 230 235 240 Val Thr Ala Gly Asn Ala Ser Gly Leu
Asn Asp Cys Ala Ala Val Leu 245 250 255 Val Ile Met Ser Ala Glu Lys
Ala Lys Glu Leu Gly Val Lys Pro Leu 260 265 270 Ala Lys Ile Val Ser
Tyr Gly Ser Ala Gly Val Asp Pro Ala Ile Met 275 280 285 Gly Tyr Gly
Pro Phe Tyr Ala Thr Lys Ala Ala Ile Glu Lys Ala Gly 290 295 300 Trp
Thr Val Asp Glu Leu Asp Leu Ile Glu Ser Asn Glu Ala Phe Ala 305 310
315 320 Ala Gln Ser Leu Ala Val Ala Lys Asp Leu Lys Phe Asp Met Asn
Lys 325 330 335 Val Asn Val Asn Gly Gly Ala Ile Ala Leu Gly His Pro
Ile Gly Ala 340 345 350 Ser Gly Ala Arg Ile Leu Val Thr Leu Val His
Ala Met Gln Lys Arg 355 360 365 Asp Ala Lys Lys Gly Leu Ala Thr Leu
Cys Ile Gly Gly Gly Gln Gly 370 375 380 Thr Ala Ile Leu Leu Glu Lys
Cys 385 390 31179DNAClostridium acetobutylicum 3atgagagatg
tagtaatagt aagtgctgta agaactgcaa taggagcata tggaaaaaca 60ttaaaggatg
tacctgcaac agagttagga gctatagtaa taaaggaagc tgtaagaaga
120gctaatataa atccaaatga gattaatgaa gttatttttg gaaatgtact
tcaagctgga 180ttaggccaaa acccagcaag acaagcagca gtaaaagcag
gattaccttt agaaacacct 240gcgtttacaa tcaataaggt ttgtggttca
ggtttaagat ctataagttt agcagctcaa 300attataaaag ctggagatgc
tgataccatt gtagtaggtg gtatggaaaa tatgtctaga 360tcaccatatt
tgattaacaa tcagagatgg ggtcaaagaa tgggagatag tgaattagtt
420gatgaaatga taaaggatgg tttgtgggat gcatttaatg gatatcatat
gggagtaact 480gcagaaaata ttgcagaaca atggaatata acaagagaag
agcaagatga attttcactt 540atgtcacaac aaaaagctga aaaagccatt
aaaaatggag aatttaagga tgaaatagtt 600cctgtattaa taaagactaa
aaaaggtgaa atagtctttg atcaagatga atttcctaga 660ttcggaaaca
ctattgaagc attaagaaaa cttaaaccta ttttcaagga aaatggtact
720gttacagcag gtaatgcatc cggattaaat gatggagctg cagcactagt
aataatgagc 780gctgataaag ctaacgctct cggaataaaa ccacttgcta
agattacttc ttacggatca 840tatggggtag atccatcaat aatgggatat
ggagcttttt atgcaactaa agctgcctta 900gataaaatta atttaaaacc
tgaagactta gatttaattg aagctaacga ggcatatgct 960tctcaaagta
tagcagtaac tagagattta aatttagata tgagtaaagt taatgttaat
1020ggtggagcta tagcacttgg acatccaata ggtgcatctg gtgcacgtat
tttagtaaca 1080ttactatacg ctatgcaaaa aagagattca aaaaaaggtc
ttgctactct atgtattggt 1140ggaggtcagg gaacagctct cgtagttgaa
agagactaa 11794392PRTClostridium acetobutylicum 4Met Arg Asp Val
Val Ile Val Ser Ala Val Arg Thr Ala Ile Gly Ala 1 5 10 15 Tyr Gly
Lys Thr Leu Lys Asp Val Pro Ala Thr Glu Leu Gly Ala Ile 20 25 30
Val Ile Lys Glu Ala Val Arg Arg Ala Asn Ile Asn Pro Asn Glu Ile 35
40 45 Asn Glu Val Ile Phe Gly Asn Val Leu Gln Ala Gly Leu Gly Gln
Asn 50 55 60 Pro Ala Arg Gln Ala Ala Val Lys Ala Gly Leu Pro Leu
Glu Thr Pro 65 70 75 80 Ala Phe Thr Ile Asn Lys Val Cys Gly Ser Gly
Leu Arg Ser Ile Ser 85 90 95 Leu Ala Ala Gln Ile Ile Lys Ala Gly
Asp Ala Asp Thr Ile Val Val 100 105 110 Gly Gly Met Glu Asn Met Ser
Arg Ser Pro Tyr Leu Ile Asn Asn Gln 115 120 125 Arg Trp Gly Gln Arg
Met Gly Asp Ser Glu Leu Val Asp Glu Met Ile 130 135 140 Lys Asp Gly
Leu Trp Asp Ala Phe Asn Gly Tyr His Met Gly Val Thr 145 150 155 160
Ala Glu Asn Ile Ala Glu Gln Trp Asn Ile Thr Arg Glu Glu Gln Asp 165
170 175 Glu Phe Ser Leu Met Ser Gln Gln Lys Ala Glu Lys Ala Ile Lys
Asn 180 185 190 Gly Glu Phe Lys Asp Glu Ile Val Pro Val Leu Ile Lys
Thr Lys Lys 195 200 205 Gly Glu Ile Val Phe Asp Gln Asp Glu Phe Pro
Arg Phe Gly Asn Thr 210 215 220 Ile Glu Ala Leu Arg Lys Leu Lys Pro
Ile Phe Lys Glu Asn Gly Thr 225 230 235 240 Val Thr Ala Gly Asn Ala
Ser Gly Leu Asn Asp Gly Ala Ala Ala Leu 245 250 255 Val Ile Met Ser
Ala Asp Lys Ala Asn Ala Leu Gly Ile Lys Pro Leu 260 265 270 Ala Lys
Ile Thr Ser Tyr Gly Ser Tyr Gly Val Asp Pro Ser Ile Met 275 280 285
Gly Tyr Gly Ala Phe Tyr Ala Thr Lys Ala Ala Leu Asp Lys Ile Asn 290
295 300 Leu Lys Pro Glu Asp Leu Asp Leu Ile Glu Ala Asn Glu Ala Tyr
Ala 305 310 315 320 Ser Gln Ser Ile Ala Val Thr Arg Asp Leu Asn Leu
Asp Met Ser Lys 325 330 335 Val Asn Val Asn Gly Gly Ala Ile Ala Leu
Gly His Pro Ile Gly Ala 340 345 350 Ser Gly Ala Arg Ile Leu Val Thr
Leu Leu Tyr Ala Met Gln Lys Arg 355 360 365 Asp Ser Lys Lys Gly Leu
Ala Thr Leu Cys Ile Gly Gly Gly Gln Gly 370 375 380 Thr Ala Leu Val
Val Glu Arg Asp 385 390 5849DNAClostridium acetobutylicum
5atgaaaaagg tatgtgttat aggtgcaggt actatgggtt caggaattgc tcaggcattt
60gcagctaaag gatttgaagt agtattaaga gatattaaag atgaatttgt tgatagagga
120ttagatttta tcaataaaaa tctttctaaa ttagttaaaa aaggaaagat
agaagaagct 180actaaagttg aaatcttaac tagaatttcc ggaacagttg
accttaatat ggcagctgat 240tgcgatttag ttatagaagc agctgttgaa
agaatggata ttaaaaagca gatttttgct 300gacttagaca atatatgcaa
gccagaaaca attcttgcat caaatacatc atcactttca 360ataacagaag
tggcatcagc aactaaaaga cctgataagg ttataggtat gcatttcttt
420aatccagctc ctgttatgaa gcttgtagag gtaataagag gaatagctac
atcacaagaa 480acttttgatg cagttaaaga gacatctata gcaataggaa
aagatcctgt agaagtagca 540gaagcaccag gatttgttgt aaatagaata
ttaataccaa tgattaatga agcagttggt 600atattagcag aaggaatagc
ttcagtagaa gacatagata aagctatgaa acttggagct 660aatcacccaa
tgggaccatt agaattaggt gattttatag gtcttgatat atgtcttgct
720ataatggatg ttttatactc agaaactgga gattctaagt atagaccaca
tacattactt 780aagaagtatg taagagcagg atggcttgga agaaaatcag
gaaaaggttt ctacgattat 840tcaaaataa 8496282PRTClostridium
acetobutylicum 6Met Lys Lys Val Cys Val Ile Gly Ala Gly Thr Met Gly
Ser Gly Ile 1 5 10 15 Ala Gln Ala Phe Ala Ala Lys Gly Phe Glu Val
Val Leu Arg Asp Ile 20 25 30 Lys Asp Glu Phe Val Asp Arg Gly Leu
Asp Phe Ile Asn Lys Asn Leu 35 40 45 Ser Lys Leu Val Lys Lys Gly
Lys Ile Glu Glu Ala Thr Lys Val Glu 50 55 60 Ile Leu Thr Arg Ile
Ser Gly Thr Val Asp Leu Asn Met Ala Ala Asp 65 70 75 80 Cys Asp Leu
Val Ile Glu Ala Ala Val Glu Arg Met Asp Ile Lys Lys 85 90 95 Gln
Ile Phe Ala Asp Leu Asp Asn Ile Cys Lys Pro Glu Thr Ile Leu 100 105
110 Ala Ser Asn Thr Ser Ser Leu Ser Ile Thr Glu Val Ala Ser Ala Thr
115 120 125 Lys Arg Pro Asp Lys Val Ile Gly Met His Phe Phe Asn Pro
Ala Pro 130 135 140 Val Met Lys Leu Val Glu Val Ile Arg Gly Ile Ala
Thr Ser Gln Glu 145 150 155 160 Thr Phe Asp Ala Val Lys Glu Thr Ser
Ile Ala Ile Gly Lys Asp Pro 165 170 175 Val Glu Val Ala Glu Ala Pro
Gly Phe Val Val Asn Arg Ile Leu Ile 180 185 190 Pro Met Ile Asn Glu
Ala Val Gly Ile Leu Ala Glu Gly Ile Ala Ser 195 200 205 Val Glu Asp
Ile Asp Lys Ala Met Lys Leu Gly Ala Asn His Pro Met 210 215 220 Gly
Pro Leu Glu Leu Gly Asp Phe Ile Gly Leu Asp Ile Cys Leu Ala 225 230
235 240 Ile Met Asp Val Leu Tyr Ser Glu Thr Gly Asp Ser Lys Tyr Arg
Pro 245 250 255 His Thr Leu Leu Lys Lys Tyr Val Arg Ala Gly Trp Leu
Gly Arg Lys 260 265 270 Ser Gly Lys Gly Phe Tyr Asp Tyr Ser Lys 275
280 7786DNAClostridium acetobutylicum 7atggaactaa acaatgtcat
ccttgaaaag gaaggtaaag ttgctgtagt taccattaac 60agacctaaag cattaaatgc
gttaaatagt gatacactaa aagaaatgga ttatgttata 120ggtgaaattg
aaaatgatag cgaagtactt gcagtaattt taactggagc aggagaaaaa
180tcatttgtag caggagcaga tatttctgag atgaaggaaa tgaataccat
tgaaggtaga 240aaattcggga tacttggaaa taaagtgttt agaagattag
aacttcttga aaagcctgta 300atagcagctg ttaatggttt tgctttagga
ggcggatgcg aaatagctat gtcttgtgat 360ataagaatag cttcaagcaa
cgcaagattt ggtcaaccag aagtaggtct cggaataaca 420cctggttttg
gtggtacaca aagactttca agattagttg gaatgggcat ggcaaagcag
480cttatattta ctgcacaaaa tataaaggca gatgaagcat taagaatcgg
acttgtaaat 540aaggtagtag aacctagtga attaatgaat acagcaaaag
aaattgcaaa caaaattgtg 600agcaatgctc cagtagctgt taagttaagc
aaacaggcta ttaatagagg aatgcagtgt 660gatattgata ctgctttagc
atttgaatca gaagcatttg gagaatgctt ttcaacagag 720gatcaaaagg
atgcaatgac agctttcata gagaaaagaa aaattgaagg cttcaaaaat 780agatag
7868261PRTClostridium acetobutylicum 8Met Glu Leu Asn Asn Val Ile
Leu Glu Lys Glu Gly Lys Val Ala Val 1 5 10 15 Val Thr Ile Asn Arg
Pro Lys Ala Leu Asn Ala Leu Asn Ser Asp Thr 20 25 30 Leu Lys Glu
Met Asp Tyr Val Ile Gly Glu Ile Glu Asn Asp Ser Glu 35 40 45 Val
Leu Ala Val Ile Leu Thr Gly Ala Gly Glu Lys Ser Phe Val Ala 50 55
60 Gly Ala Asp Ile Ser Glu Met Lys Glu Met Asn Thr Ile Glu Gly Arg
65 70 75 80 Lys Phe Gly Ile Leu Gly Asn Lys Val Phe Arg Arg Leu Glu
Leu Leu 85 90 95 Glu Lys Pro Val Ile Ala Ala Val Asn Gly Phe Ala
Leu Gly Gly Gly 100 105 110 Cys Glu Ile Ala Met Ser Cys Asp Ile Arg
Ile Ala Ser Ser Asn Ala 115 120 125 Arg Phe Gly Gln Pro Glu Val Gly
Leu Gly Ile Thr Pro Gly Phe Gly 130 135 140 Gly Thr Gln Arg Leu Ser
Arg Leu Val Gly Met Gly Met Ala Lys Gln 145 150 155 160 Leu Ile Phe
Thr Ala Gln Asn Ile Lys Ala Asp Glu Ala Leu Arg Ile 165 170 175 Gly
Leu Val Asn Lys Val Val Glu Pro Ser Glu Leu Met Asn Thr Ala 180 185
190 Lys Glu Ile Ala Asn Lys Ile Val Ser Asn Ala Pro Val Ala Val Lys
195 200 205 Leu Ser Lys Gln Ala Ile Asn Arg Gly Met Gln Cys Asp Ile
Asp Thr 210 215 220 Ala Leu Ala Phe Glu Ser Glu Ala Phe Gly Glu Cys
Phe Ser Thr Glu 225 230 235 240 Asp Gln Lys Asp Ala Met Thr Ala Phe
Ile Glu Lys Arg Lys Ile Glu 245 250 255 Gly Phe Lys Asn Arg 260
91197DNAClostridium acetobutylicum 9atgatagtaa aagcaaagtt
tgtaaaagga tttatcagag atgtacatcc ttatggttgc 60agaagggaag tactaaatca
aatagattat tgtaagaagg ctattgggtt taggggacca 120aagaaggttt
taattgttgg agcctcatct gggtttggtc ttgctactag aatttcagtt
180gcatttggag gtccagaagc tcacacaatt ggagtatcct atgaaacagg
agctacagat 240agaagaatag gaacagcggg atggtataat aacatatttt
ttaaagaatt tgctaaaaaa 300aaaggattag ttgcaaaaaa cttcattgag
gatgcctttt ctaatgaaac caaagataaa 360gttattaagt atataaagga
tgaatttggt aaaatagatt tatttgttta tagtttagct 420gcgcctagga
gaaaggacta taaaactgga aatgtttata cttcaagaat aaaaacaatt
480ttaggagatt ttgagggacc gactattgat gttgaaagag acgagattac
tttaaaaaag 540gttagtagtg ctagcattga agaaattgaa gaaactagaa
aggtaatggg tggagaggat 600tggcaagagt ggtgtgaaga gctgctttat
gaagattgtt tttcggataa agcaactacc 660atagcatact cgtatatagg
atccccaaga acctacaaga tatatagaga aggtactata 720ggaatagcta
aaaaggatct tgaagataag gctaagctta taaatgaaaa acttaacaga
780gttataggtg gtagagcctt tgtgtctgtg aataaagcat tagttacaaa
agcaagtgca 840tatattccaa cttttcctct ttatgcagct attttatata
aggtcatgaa agaaaaaaat 900attcatgaaa attgtattat gcaaattgag
agaatgtttt ctgaaaaaat atattcaaat 960gaaaaaatac aatttgatga
caagggaaga ttaaggatgg acgatttaga gcttagaaaa 1020gacgttcaag
acgaagttga tagaatatgg agtaatatta ctcctgaaaa ttttaaggaa
1080ttatctgatt ataagggata caaaaaagaa ttcatgaact taaacggttt
tgatctagat 1140ggggttgatt atagtaaaga cctggatata gaattattaa
gaaaattaga accttaa 119710398PRTClostridium acetobutylicum 10Met Ile
Val Lys Ala Lys Phe Val Lys Gly Phe Ile Arg Asp Val His 1 5 10 15
Pro Tyr Gly Cys Arg Arg Glu Val Leu Asn Gln Ile Asp Tyr Cys Lys 20
25 30 Lys Ala Ile Gly Phe Arg Gly Pro Lys Lys Val Leu Ile Val Gly
Ala 35 40 45 Ser Ser Gly Phe Gly Leu Ala Thr Arg Ile Ser Val Ala
Phe Gly Gly 50 55 60 Pro Glu Ala His Thr Ile Gly Val Ser Tyr Glu
Thr Gly Ala Thr Asp 65 70 75 80 Arg Arg Ile Gly Thr Ala Gly Trp Tyr
Asn Asn Ile Phe Phe Lys Glu 85 90 95 Phe Ala Lys Lys Lys Gly Leu
Val Ala Lys Asn Phe Ile Glu Asp Ala 100 105
110 Phe Ser Asn Glu Thr Lys Asp Lys Val Ile Lys Tyr Ile Lys Asp Glu
115 120 125 Phe Gly Lys Ile Asp Leu Phe Val Tyr Ser Leu Ala Ala Pro
Arg Arg 130 135 140 Lys Asp Tyr Lys Thr Gly Asn Val Tyr Thr Ser Arg
Ile Lys Thr Ile 145 150 155 160 Leu Gly Asp Phe Glu Gly Pro Thr Ile
Asp Val Glu Arg Asp Glu Ile 165 170 175 Thr Leu Lys Lys Val Ser Ser
Ala Ser Ile Glu Glu Ile Glu Glu Thr 180 185 190 Arg Lys Val Met Gly
Gly Glu Asp Trp Gln Glu Trp Cys Glu Glu Leu 195 200 205 Leu Tyr Glu
Asp Cys Phe Ser Asp Lys Ala Thr Thr Ile Ala Tyr Ser 210 215 220 Tyr
Ile Gly Ser Pro Arg Thr Tyr Lys Ile Tyr Arg Glu Gly Thr Ile 225 230
235 240 Gly Ile Ala Lys Lys Asp Leu Glu Asp Lys Ala Lys Leu Ile Asn
Glu 245 250 255 Lys Leu Asn Arg Val Ile Gly Gly Arg Ala Phe Val Ser
Val Asn Lys 260 265 270 Ala Leu Val Thr Lys Ala Ser Ala Tyr Ile Pro
Thr Phe Pro Leu Tyr 275 280 285 Ala Ala Ile Leu Tyr Lys Val Met Lys
Glu Lys Asn Ile His Glu Asn 290 295 300 Cys Ile Met Gln Ile Glu Arg
Met Phe Ser Glu Lys Ile Tyr Ser Asn 305 310 315 320 Glu Lys Ile Gln
Phe Asp Asp Lys Gly Arg Leu Arg Met Asp Asp Leu 325 330 335 Glu Leu
Arg Lys Asp Val Gln Asp Glu Val Asp Arg Ile Trp Ser Asn 340 345 350
Ile Thr Pro Glu Asn Phe Lys Glu Leu Ser Asp Tyr Lys Gly Tyr Lys 355
360 365 Lys Glu Phe Met Asn Leu Asn Gly Phe Asp Leu Asp Gly Val Asp
Tyr 370 375 380 Ser Lys Asp Leu Asp Ile Glu Leu Leu Arg Lys Leu Glu
Pro 385 390 395 111407DNAClostridium beijerinckii 11atgaataaag
acacactaat acctacaact aaagatttaa aagtaaaaac aaatggtgaa 60aacattaatt
taaagaacta caaggataat tcttcatgtt tcggagtatt cgaaaatgtt
120gaaaatgcta taagcagcgc tgtacacgca caaaagatat tatcccttca
ttatacaaaa 180gagcaaagag aaaaaatcat aactgagata agaaaggccg
cattacaaaa taaagaggtc 240ttggctacaa tgattctaga agaaacacat
atgggaagat atgaggataa aatattaaaa 300catgaattgg tagctaaata
tactcctggt acagaagatt taactactac tgcttggtca 360ggtgataatg
gtcttacagt tgtagaaatg tctccatatg gtgttatagg tgcaataact
420ccttctacga atccaactga aactgtaata tgtaatagca taggcatgat
agctgctgga 480aatgctgtag tatttaacgg acacccatgc gctaaaaaat
gtgttgcctt tgctgttgaa 540atgataaata aggcaattat ttcatgtggc
ggtcctgaaa atctagtaac aactataaaa 600aatccaacta tggagtctct
agatgcaatt attaagcatc cttcaataaa acttctttgc 660ggaactgggg
gtccaggaat ggtaaaaacc ctcttaaatt ctggtaagaa agctataggt
720gctggtgctg gaaatccacc agttattgta gatgatactg ctgatataga
aaaggctggt 780aggagcatca ttgaaggctg ttcttttgat aataatttac
cttgtattgc agaaaaagaa 840gtatttgttt ttgagaatgt tgcagatgat
ttaatatcta acatgctaaa aaataatgct 900gtaattataa atgaagatca
agtatcaaaa ttaatagatt tagtattaca aaaaaataat 960gaaactcaag
aatactttat aaacaaaaaa tgggtaggaa aagatgcaaa attattctta
1020gatgaaatag atgttgagtc tccttcaaat gttaaatgca taatctgcga
agtaaatgca 1080aatcatccat ttgttatgac agaactcatg atgccaatat
tgccaattgt aagagttaaa 1140gatatagatg aagctattaa atatgcaaag
atagcagaac aaaatagaaa acatagtgcc 1200tatatttatt ctaaaaatat
agacaaccta aatagatttg aaagagaaat agatactact 1260atttttgtaa
agaatgctaa atcttttgct ggtgttggtt atgaagcaga aggatttaca
1320actttcacta ttgctggatc tactggtgag ggaataacct ctgcaaggaa
ttttacaaga 1380caaagaagat gtgtacttgc cggctaa
140712468PRTClostridium beijerinckii 12Met Asn Lys Asp Thr Leu Ile
Pro Thr Thr Lys Asp Leu Lys Val Lys 1 5 10 15 Thr Asn Gly Glu Asn
Ile Asn Leu Lys Asn Tyr Lys Asp Asn Ser Ser 20 25 30 Cys Phe Gly
Val Phe Glu Asn Val Glu Asn Ala Ile Ser Ser Ala Val 35 40 45 His
Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55
60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Gln Asn Lys Glu Val
65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr
Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr
Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp
Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile
Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile
Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Ala Val
Val Phe Asn Gly His Pro Cys Ala Lys Lys Cys Val Ala 165 170 175 Phe
Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185
190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Glu Ser Leu Asp
195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr
Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys
Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile
Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Arg Ser Ile
Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Leu Pro Cys Ile Ala
Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu
Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu
Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310
315 320 Glu Thr Gln Glu Tyr Phe Ile Asn Lys Lys Trp Val Gly Lys Asp
Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser
Asn Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Asn Ala Asn His Pro
Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val
Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Lys Tyr Ala Lys Ile
Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser
Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp
Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430
Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435
440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg
Cys 450 455 460 Val Leu Ala Gly 465 131215DNAClostridium
acetobutylicum 13atggttgatt tcgaatattc aataccaact agaatttttt
tcggtaaaga taagataaat 60gtacttggaa gagagcttaa aaaatatggt tctaaagtgc
ttatagttta tggtggagga 120agtataaaga gaaatggaat atatgataaa
gctgtaagta tacttgaaaa aaacagtatt 180aaattttatg aacttgcagg
agtagagcca aatccaagag taactacagt tgaaaaagga 240gttaaaatat
gtagagaaaa tggagttgaa gtagtactag ctataggtgg aggaagtgca
300atagattgcg caaaggttat agcagcagca tgtgaatatg atggaaatcc
atgggatatt 360gtgttagatg gctcaaaaat aaaaagggtg cttcctatag
ctagtatatt aaccattgct 420gcaacaggat cagaaatgga tacgtgggca
gtaataaata atatggatac aaacgaaaaa 480ctaattgcgg cacatccaga
tatggctcct aagttttcta tattagatcc aacgtatacg 540tataccgtac
ctaccaatca aacagcagca ggaacagctg atattatgag tcatatattt
600gaggtgtatt ttagtaatac aaaaacagca tatttgcagg atagaatggc
agaagcgtta 660ttaagaactt gtattaaata tggaggaata gctcttgaga
agccggatga ttatgaggca 720agagccaatc taatgtgggc ttcaagtctt
gcgataaatg gacttttaac atatggtaaa 780gacactaatt ggagtgtaca
cttaatggaa catgaattaa gtgcttatta cgacataaca 840cacggcgtag
ggcttgcaat tttaacacct aattggatgg agtatatttt aaataatgat
900acagtgtaca agtttgttga atatggtgta aatgtttggg gaatagacaa
agaaaaaaat 960cactatgaca tagcacatca agcaatacaa aaaacaagag
attactttgt aaatgtacta 1020ggtttaccat ctagactgag agatgttgga
attgaagaag aaaaattgga cataatggca 1080aaggaatcag taaagcttac
aggaggaacc ataggaaacc taagaccagt aaacgcctcc 1140gaagtcctac
aaatattcaa aaaatctgtg taaaacgcct ccgaagtcct acaaatattc
1200aaaaaatctg tgtaa 121514390PRTClostridium acetobutylicum 14Met
Val Asp Phe Glu Tyr Ser Ile Pro Thr Arg Ile Phe Phe Gly Lys 1 5 10
15 Asp Lys Ile Asn Val Leu Gly Arg Glu Leu Lys Lys Tyr Gly Ser Lys
20 25 30 Val Leu Ile Val Tyr Gly Gly Gly Ser Ile Lys Arg Asn Gly
Ile Tyr 35 40 45 Asp Lys Ala Val Ser Ile Leu Glu Lys Asn Ser Ile
Lys Phe Tyr Glu 50 55 60 Leu Ala Gly Val Glu Pro Asn Pro Arg Val
Thr Thr Val Glu Lys Gly 65 70 75 80 Val Lys Ile Cys Arg Glu Asn Gly
Val Glu Val Val Leu Ala Ile Gly 85 90 95 Gly Gly Ser Ala Ile Asp
Cys Ala Lys Val Ile Ala Ala Ala Cys Glu 100 105 110 Tyr Asp Gly Asn
Pro Trp Asp Ile Val Leu Asp Gly Ser Lys Ile Lys 115 120 125 Arg Val
Leu Pro Ile Ala Ser Ile Leu Thr Ile Ala Ala Thr Gly Ser 130 135 140
Glu Met Asp Thr Trp Ala Val Ile Asn Asn Met Asp Thr Asn Glu Lys 145
150 155 160 Leu Ile Ala Ala His Pro Asp Met Ala Pro Lys Phe Ser Ile
Leu Asp 165 170 175 Pro Thr Tyr Thr Tyr Thr Val Pro Thr Asn Gln Thr
Ala Ala Gly Thr 180 185 190 Ala Asp Ile Met Ser His Ile Phe Glu Val
Tyr Phe Ser Asn Thr Lys 195 200 205 Thr Ala Tyr Leu Gln Asp Arg Met
Ala Glu Ala Leu Leu Arg Thr Cys 210 215 220 Ile Lys Tyr Gly Gly Ile
Ala Leu Glu Lys Pro Asp Asp Tyr Glu Ala 225 230 235 240 Arg Ala Asn
Leu Met Trp Ala Ser Ser Leu Ala Ile Asn Gly Leu Leu 245 250 255 Thr
Tyr Gly Lys Asp Thr Asn Trp Ser Val His Leu Met Glu His Glu 260 265
270 Leu Ser Ala Tyr Tyr Asp Ile Thr His Gly Val Gly Leu Ala Ile Leu
275 280 285 Thr Pro Asn Trp Met Glu Tyr Ile Leu Asn Asn Asp Thr Val
Tyr Lys 290 295 300 Phe Val Glu Tyr Gly Val Asn Val Trp Gly Ile Asp
Lys Glu Lys Asn 305 310 315 320 His Tyr Asp Ile Ala His Gln Ala Ile
Gln Lys Thr Arg Asp Tyr Phe 325 330 335 Val Asn Val Leu Gly Leu Pro
Ser Arg Leu Arg Asp Val Gly Ile Glu 340 345 350 Glu Glu Lys Leu Asp
Ile Met Ala Lys Glu Ser Val Lys Leu Thr Gly 355 360 365 Gly Thr Ile
Gly Asn Leu Arg Pro Val Asn Ala Ser Glu Val Leu Gln 370 375 380 Ile
Phe Lys Lys Ser Val 385 390 151170DNAClostridium acetobutylicum
15atgctaagtt ttgattattc aataccaact aaagtttttt ttggaaaagg aaaaatagac
60gtaattggag aagaaattaa gaaatatggc tcaagagtgc ttatagttta tggcggagga
120agtataaaaa ggaacggtat atatgataga gcaacagcta tattaaaaga
aaacaatata 180gctttctatg aactttcagg agtagagcca aatcctagga
taacaacagt aaaaaaaggc 240atagaaatat gtagagaaaa taatgtggat
ttagtattag caataggggg aggaagtgca 300atagactgtt ctaaggtaat
tgcagctgga gtttattatg atggcgatac atgggacatg 360gttaaagatc
catctaaaat aactaaagtt cttccaattg caagtatact tactctttca
420gcaacagggt ctgaaatgga tcaaattgca gtaatttcaa atatggagac
taatgaaaag 480cttggagtag gacatgatga tatgagacct aaattttcag
tgttagatcc tacatatact 540tttacagtac ctaaaaatca aacagcagcg
ggaacagctg acattatgag tcacaccttt 600gaatcttact ttagtggtgt
tgaaggtgct tatgtgcagg acggtatagc agaagcaatc 660ttaagaacat
gtataaagta tggaaaaata gcaatggaga agactgatga ttacgaggct
720agagctaatt tgatgtgggc ttcaagttta gctataaatg gtctattatc
acttggtaag 780gatagaaaat ggagttgtca tcctatggaa cacgagttaa
gtgcatatta tgatataaca 840catggtgtag gacttgcaat tttaacacct
aattggatgg aatatattct aaatgacgat 900acacttcata aatttgtttc
ttatggaata aatgtttggg gaatagacaa gaacaaagat 960aactatgaaa
tagcacgaga ggctattaaa aatacgagag aatactttaa ttcattgggt
1020attccttcaa agcttagaga agttggaata ggaaaagata aactagaact
aatggcaaag 1080caagctgtta gaaattctgg aggaacaata ggaagtttaa
gaccaataaa tgcagaggat 1140gttcttgaga tatttaaaaa atcttattaa
117016389PRTClostridium acetobutylicum 16Met Leu Ser Phe Asp Tyr
Ser Ile Pro Thr Lys Val Phe Phe Gly Lys 1 5 10 15 Gly Lys Ile Asp
Val Ile Gly Glu Glu Ile Lys Lys Tyr Gly Ser Arg 20 25 30 Val Leu
Ile Val Tyr Gly Gly Gly Ser Ile Lys Arg Asn Gly Ile Tyr 35 40 45
Asp Arg Ala Thr Ala Ile Leu Lys Glu Asn Asn Ile Ala Phe Tyr Glu 50
55 60 Leu Ser Gly Val Glu Pro Asn Pro Arg Ile Thr Thr Val Lys Lys
Gly 65 70 75 80 Ile Glu Ile Cys Arg Glu Asn Asn Val Asp Leu Val Leu
Ala Ile Gly 85 90 95 Gly Gly Ser Ala Ile Asp Cys Ser Lys Val Ile
Ala Ala Gly Val Tyr 100 105 110 Tyr Asp Gly Asp Thr Trp Asp Met Val
Lys Asp Pro Ser Lys Ile Thr 115 120 125 Lys Val Leu Pro Ile Ala Ser
Ile Leu Thr Leu Ser Ala Thr Gly Ser 130 135 140 Glu Met Asp Gln Ile
Ala Val Ile Ser Asn Met Glu Thr Asn Glu Lys 145 150 155 160 Leu Gly
Val Gly His Asp Asp Met Arg Pro Lys Phe Ser Val Leu Asp 165 170 175
Pro Thr Tyr Thr Phe Thr Val Pro Lys Asn Gln Thr Ala Ala Gly Thr 180
185 190 Ala Asp Ile Met Ser His Thr Phe Glu Ser Tyr Phe Ser Gly Val
Glu 195 200 205 Gly Ala Tyr Val Gln Asp Gly Ile Ala Glu Ala Ile Leu
Arg Thr Cys 210 215 220 Ile Lys Tyr Gly Lys Ile Ala Met Glu Lys Thr
Asp Asp Tyr Glu Ala 225 230 235 240 Arg Ala Asn Leu Met Trp Ala Ser
Ser Leu Ala Ile Asn Gly Leu Leu 245 250 255 Ser Leu Gly Lys Asp Arg
Lys Trp Ser Cys His Pro Met Glu His Glu 260 265 270 Leu Ser Ala Tyr
Tyr Asp Ile Thr His Gly Val Gly Leu Ala Ile Leu 275 280 285 Thr Pro
Asn Trp Met Glu Tyr Ile Leu Asn Asp Asp Thr Leu His Lys 290 295 300
Phe Val Ser Tyr Gly Ile Asn Val Trp Gly Ile Asp Lys Asn Lys Asp 305
310 315 320 Asn Tyr Glu Ile Ala Arg Glu Ala Ile Lys Asn Thr Arg Glu
Tyr Phe 325 330 335 Asn Ser Leu Gly Ile Pro Ser Lys Leu Arg Glu Val
Gly Ile Gly Lys 340 345 350 Asp Lys Leu Glu Leu Met Ala Lys Gln Ala
Val Arg Asn Ser Gly Gly 355 360 365 Thr Ile Gly Ser Leu Arg Pro Ile
Asn Ala Glu Asp Val Leu Glu Ile 370 375 380 Phe Lys Lys Ser Tyr 385
1729DNAArtificial SequencePrimer 17caccatggaa ctaaacaatg tcatccttg
291825DNAArtificial SequencePrimer 18cctcctatct atttttgaag ccttc
251928DNAArtificial SequencePrimer 19caccatgaaa aaggtatgtg ttataggt
282023DNAArtificial SequencePrimer 20catttgataa tggggattct tgt
232130DNAArtificial SequencePrimer 21caccatgaaa gaagttgtaa
tagctagtgc 302226DNAArtificial SequencePrimer 22ctagcacttt
tctagcaata ttgctg 262329DNAArtificial SequencePrimer 23caccatgcta
agttttgatt attcaatac 292425DNAArtificial SequencePrimer
24ttaataagat tttttaaata tctca 252530DNAArtificial SequencePrimer
25caccatggtt gatttcgaat attcaatacc 302625DNAArtificial
SequencePrimer 26ttacacagat tttttgaata tttgt 252732DNAArtificial
SequencePrimer
27caccatgaga gatgtagtaa tagtaagtgc tg 322824DNAArtificial
SequencePrimer 28ccgcaattgt atccatattg aacc 242926DNAArtificial
SequencePrimer 29caccatgata gtaaaagcaa agtttg 263027DNAArtificial
SequencePrimer 30gcttaaagct taaaaccgct tctggcg 273127DNAArtificial
SequencePrimer 31caccatgaat aaagacacac taatacc 273224DNAArtificial
SequencePrimer 32gccagaccat ctttgaaaat gcgc 243335DNAArtificial
SequencePrimer 33catgcatgca aaggaggtta gtagaatgaa agaag
353438DNAArtificial SequencePrimer 34gtcctgcagg gcgcgcccaa
tactttctag cacttttc 383539DNAArtificial SequencePrimer 35catgtcgaca
aaggaggtct gtttaatgaa aaaggtatg 393628DNAArtificial SequencePrimer
36gtcgcatgcc ttgtaaactt attttgaa 283744DNAArtificial SequencePrimer
37catagatctg gatccaaagg agggtgagga aatgatagta aaag
443830DNAArtificial SequencePrimer 38catgtcgacg tgcagccttt
ttaaggttct 303938DNAArtificial SequencePrimer 39catgaattca
cgcgtaaagg aggtattagt catggaac 384030DNAArtificial SequencePrimer
40gtcggatccc ttacctccta tctatttttg 304142DNAArtificial
SequencePrimer 41catgcccggg ggtcaccaaa ggaggaatag ttcatgaata aa
424232DNAArtificial SequencePrimer 42catggttaac aagaagttag
ccggcaagta ca 324341DNAArtificial SequencePrimer 43catggttaac
aaaggagggg ttaaaatggt tgatttcgaa t 414437DNAArtificial
SequencePrimer 44catggcatgc gtttaaacgt aggtttacac agatttt
374517DNAArtificial SequencePrimer 45gtaaaacgac ggccagt
174616DNAArtificial SequencePrimer 46aacagctatg accatg
164722DNAArtificial SequencePrimer 47gcaggagatg ctgacgtaat aa
224824DNAArtificial SequencePrimer 48ccaacctgct ttttcaatag ctgc
244921DNAArtificial SequencePrimer 49cagagatggg gtcaaagaat g
215020DNAArtificial SequencePrimer 50gtggttttat tccgagagcg
205120DNAArtificial SequencePrimer 51ggtctatact tagaatctcc
205224DNAArtificial SequencePrimer 52cggaacagtt gaccttaata tggc
245322DNAArtificial SequencePrimer 53gcctcatctg ggtttggtct tg
225428DNAArtificial SequencePrimer 54cgcctaggag aaaggactat aaaactgg
285522DNAArtificial SequencePrimer 55cagagttata ggtggtagag cc
225624DNAArtificial SequencePrimer 56ccatcccgct gttcctattc ttct
245722DNAArtificial SequencePrimer 57ccaatcctct ccacccatta cc
225820DNAArtificial SequencePrimer 58cgtccatcct taatcttccc
205923DNAArtificial SequencePrimer 59ccaactatgg aatccctaga tgc
236022DNAArtificial SequencePrimer 60gcatagtctg cgaagtaaat gc
226124DNAArtificial SequencePrimer 61ggatctactg gtgaaggcat aacc
246223DNAArtificial SequencePrimer 62ggcatcatga gttctgtcat gac
236325DNAArtificial SequencePrimer 63gccttcaatg atactcttac cagcc
256422DNAArtificial SequencePrimer 64gcatttccag cagctatcat gc
226522DNAArtificial SequencePrimer 65ccttcccata tgtgtttctt cc
226622DNAArtificial SequencePrimer 66gttgaagtag tactagctat ag
226722DNAArtificial SequencePrimer 67gacataacac acggcgtagg gc
226822DNAArtificial SequencePrimer 68taagtgtaca ctccaattag tg
226924DNAArtificial SequencePrimer 69gccatctaac acaatatccc atgg
247024DNAArtificial SequencePrimer 70gcgatacatg ggacatggtt aaag
247122DNAArtificial SequencePrimer 71tgcacttaac tcgtgttcca ta
227221DNAArtificial SequencePrimer 72gttagccggc aagtacacat c
217321DNAArtificial SequencePrimer 73actttctttc gcctgtttca c
217447DNAArtificial SequencePrimer 74catgaagctt ggcgcgccgg
gacgcgtttt tgaaaataat gaaaact 477579DNAArtificial SequencePrimer
75catgaagctt gtttaaactc ggtgaccttg aaaataatga aaacttatat tgttttgaaa
60ataatgaaaa cttatattg 79761197DNAArtificial SequenceCodon
optimized CAC0462 gene from Clostridium acetobutylicum 76atgattgtga
aagcaaaatt cgtgaaagga ttcattcgcg atgtgcaccc ttatgggtgc 60cgccgtgaag
ttctgaatca gatcgactac tgcaaaaaag ccattggctt tcgcggccca
120aagaaagtgc tgatcgttgg tgcttcctct ggcttcggtc tggctacccg
catttccgtg 180gcgttcggtg gcccagaagc ccacactatc ggcgtcagct
atgaaaccgg tgcgaccgat 240cgccgtattg gcacagcagg gtggtataac
aatattttct ttaaagaatt tgccaaaaag 300aaaggcctgg tggcaaaaaa
ctttatcgaa gacgccttct cgaacgaaac caaggacaaa 360gtcatcaaat
atattaaaga cgaatttggc aaaatcgatc tgttcgttta ctcgctggca
420gcaccgcgtc gtaaggatta taagactggg aacgtttata cctcacgtat
taaaacgatc 480ctgggtgatt ttgaagggcc gactatcgat gtggaacgtg
atgaaattac actgaaaaag 540gtctcatctg cgtcaatcga agagattgaa
gaaacccgta aggtgatggg cggcgaagat 600tggcaagagt ggtgtgaaga
actgctgtac gaagattgtt tcagtgataa agccaccacc 660atcgcctatt
cctatatcgg ttctcctcgc acctacaaaa tctaccgcga aggcactatc
720ggcattgcga aaaaggatct ggaagataag gcaaaactga tcaacgagaa
gctgaatcgc 780gtcattggcg ggcgcgcatt cgttagcgtg aataaagccc
tggttactaa ggcgagcgca 840tatattccga cctttcctct gtacgccgca
attctgtata aagttatgaa agaaaagaat 900attcacgaaa actgcattat
gcaaattgaa cgcatgtttt ccgagaaaat ttattcaaat 960gaaaagattc
aatttgatga taaaggtcgt ctgcgtatgg atgacctgga gctgcgtaag
1020gatgttcagg atgaagtaga ccgtatttgg agcaatatta caccggagaa
ttttaaggaa 1080ctgagcgact ataaaggcta caaaaaagaa tttatgaacc
tgaatggatt tgatctggac 1140ggcgtggatt attcaaagga tctggacatt
gaactgctgc gcaaactgga accataa 1197771224DNAArtificial
SequenceCondon optimized EgTER 77atggcgatgt ttacgaccac cgcaaaagtt
attcagccga aaattcgtgg ttttatttgc 60accaccaccc acccgattgg ttgcgaaaaa
cgtgttcagg aagaaatcgc atacgcacgc 120gcgcacccgc cgaccagccc
gggtccgaaa cgtgtgctgg ttattggctg cagtacgggc 180tatggcctga
gcacccgtat caccgcggcc tttggttatc aggccgcaac cctgggcgtg
240tttctggcag gcccgccgac caaaggccgt ccggccgcgg cgggttggta
taatacggtt 300gcgttcgaaa aagccgccct ggaagcaggt ctgtatgcac
gttctctgaa tggtgatgcg 360ttcgattcta ccacgaaagc ccgcaccgtg
gaagcaatta aacgtgatct gggtaccgtt 420gatctggtgg tgtatagcat
tgcagcgccg aaacgtaccg atccggccac cggcgtgctg 480cataaagcgt
gcctgaaacc gattggtgca acctacacca atcgtacggt gaacaccgat
540aaagcagaag ttaccgatgt gagtattgaa ccggccagtc cggaagaaat
cgcagatacc 600gtgaaagtta tgggtggcga agattgggaa ctgtggattc
aggcactgag cgaagccggc 660gtgctggccg aaggcgcaaa aaccgttgcg
tattcttata ttggcccgga aatgacgtgg 720ccggtgtatt ggagtggcac
cattggcgaa gccaaaaaag atgttgaaaa agcggcgaaa 780cgcatcaccc
agcagtacgg ctgtccggcg tatccggttg ttgccaaagc gctggtgacc
840caggccagta gcgccattcc ggtggtgccg ctgtatattt gcctgctgta
tcgtgttatg 900aaagaaaaag gcacccatga aggctgcatt gaacagatgg
tgcgtctgct gacgacgaaa 960ctgtatccgg aaaatggtgc gccgatcgtg
gatgaagcgg gccgtgtgcg tgttgatgat 1020tgggaaatgg cagaagatgt
tcagcaggca gttaaagatc tgtggagcca ggtgagtacg 1080gccaatctga
aagatattag cgattttgca ggttatcaga ccgaatttct gcgtctgttt
1140ggctttggta ttgatggtgt ggattacgat cagccggttg atgttgaagc
ggatctgccg 1200agcgccgccc agcagtaagt cgac 1224781498DNAArtificial
SequenceCodon optimized ald gene 78cggtacctcg cgaatgcatc tagatccaat
catgcccggg ggtcaccaaa ggaggaatag 60ttcatgaata aagatacgct gattccgacc
acgaaagatc tgaaagtgaa aaccaacggt 120gaaaatatca acctgaaaaa
ttataaagat aatagcagct gcttcggcgt gtttgaaaat 180gttgaaaacg
ccatttcttc tgccgttcac gcacagaaaa tcctgtctct gcactatacc
240aaagaacagc gcgaaaaaat cattaccgaa attcgcaaag cggccctgca
gaataaagaa 300gttctggcga ccatgatcct ggaagaaacc catatgggtc
gttacgaaga taaaatcctg 360aaacatgaac tggtggcgaa atacacgccg
ggtacggaag atctgaccac gaccgcatgg 420agcggtgata acggtctgac
cgtggtggaa atgtctccgt atggcgttat tggcgcaatt 480acgccgagca
cgaatccgac cgaaacggtt atttgtaaca gtattggcat gattgcagcc
540ggtaatgcag tggttttcaa tggtcatccg tgcgccaaaa aatgtgtggc
gtttgccgtt 600gaaatgatta acaaagcgat tattagctgc ggtggcccgg
aaaatctggt gacgacgatt 660aaaaacccga ccatggaaag tctggatgcg
attattaaac atccgtctat taaactgctg 720tgtggtaccg gcggtccggg
tatggtgaaa accctgctga attctggcaa aaaagcaatt 780ggcgcgggtg
cgggtaatcc gccggttatc gttgatgata ccgcggatat tgaaaaagca
840ggccgcagta ttattgaagg ttgtagcttt gataataacc tgccgtgcat
tgccgaaaaa 900gaagtgtttg ttttcgaaaa tgtggcggat gatctgatca
gcaacatgct gaaaaataac 960gccgtgatta ttaacgaaga tcaggtgtct
aaactgattg atctggttct gcagaaaaac 1020aacgaaacgc aggaatattt
cattaataaa aaatgggttg gtaaagatgc gaaactgttc 1080ctggatgaaa
tcgatgtgga aagtccgagc aacgtgaaat gtatcatctg cgaagtgaat
1140gccaaccatc cgtttgttat gacggaactg atgatgccga ttctgccgat
tgttcgtgtt 1200aaagatattg atgaagccat caaatatgcg aaaattgcgg
aacagaaccg caaacacagc 1260gcatatattt acagtaaaaa catcgataac
ctgaaccgtt tcgaacgtga aattgatacc 1320accatctttg tgaaaaatgc
caaaagtttt gcgggtgttg gctatgaagc cgaaggcttt 1380accacgttca
ccattgcagg ttctaccggc gaaggtatta ccagcgcgcg taattttacc
1440cgccagcgcc gctgtgtgct ggcgggttaa gttaacccaa tatcggatcc cgggcccg
1498796509DNAArtificial sequenceplasmid pFP988 79tcgaggcccc
gcacatacga aaagactggc tgaaaacatt gagcctttga tgactgatga 60tttggctgaa
gaagtggatc gattgtttga gaaaagaaga agaccataaa aataccttgt
120ctgtcatcag acagggtatt ttttatgctg tccagactgt ccgctgtgta
aaaaatagga 180ataaaggggg gttgttatta ttttactgat atgtaaaata
taatttgtat aaggaattgt 240gagcggataa caattcctac gaaaatgaga
gggagaggaa acatgattca aaaacgaaag 300cggacagttt cgttcagact
tgtgcttatg tgcacgctgt tatttgtcag tttgccgatt 360acaaaaacat
cagccggatc ccaccatcac catcaccatt aagaattcct agaaactcca
420agctatcttt aaaaaatcta gtaaatgcac gagcaacatc ttttgttgct
cagtgcattt 480tttattttgt acactagata tttcttctcc gcttaaatca
tcaaagaaat ctttatcact 540tgtaaccagt ccgtccacat gtcgaattgc
atctgaccga attttacgtt tccctgaata 600attctcatca atcgtttcat
caattttatc tttatacttt atattttgtg cgttaatcaa 660atcataattt
ttatatgttt cctcatgatt tatgtcttta ttattatagt ttttattctc
720tctttgatta tgtctttgta tcccgtttgt attacttgat cctttaactc
tggcaaccct 780caaaattgaa tgagacatgc tacacctccg gataataaat
atatataaac gtatatagat 840ttcataaagt ctaacacact agacttattt
acttcgtaat taagtcgtta aaccgtgtgc 900tctacgacca aaactataaa
acctttaaga actttctttt tttacaagaa aaaagaaatt 960agataaatct
ctcatatctt ttattcaata atcgcatccg attgcagtat aaatttaacg
1020atcactcatc atgttcatat ttatcagagc tcgtgctata attatactaa
ttttataagg 1080aggaaaaaat atgggcattt ttagtatttt tgtaatcagc
acagttcatt atcaaccaaa 1140caaaaaataa gtggttataa tgaatcgtta
ataagcaaaa ttcatataac caaattaaag 1200agggttataa tgaacgagaa
aaatataaaa cacagtcaaa actttattac ttcaaaacat 1260aatatagata
aaataatgac aaatataaga ttaaatgaac atgataatat ctttgaaatc
1320ggctcaggaa aaggccattt tacccttgaa ttagtaaaga ggtgtaattt
cgtaactgcc 1380attgaaatag accataaatt atgcaaaact acagaaaata
aacttgttga tcacgataat 1440ttccaagttt taaacaagga tatattgcag
tttaaatttc ctaaaaacca atcctataaa 1500atatatggta atatacctta
taacataagt acggatataa tacgcaaaat tgtttttgat 1560agtatagcta
atgagattta tttaatcgtg gaatacgggt ttgctaaaag attattaaat
1620acaaaacgct cattggcatt acttttaatg gcagaagttg atatttctat
attaagtatg 1680gttccaagag aatattttca tcctaaacct aaagtgaata
gctcacttat cagattaagt 1740agaaaaaaat caagaatatc acacaaagat
aaacaaaagt ataattattt cgttatgaaa 1800tgggttaaca aagaatacaa
gaaaatattt acaaaaaatc aatttaacaa ttccttaaaa 1860catgcaggaa
ttgacgattt aaacaatatt agctttgaac aattcttatc tcttttcaat
1920agctataaat tatttaataa gtaagttaag ggatgcagtt catcgatgaa
ggcaactaca 1980gctcaggcga caaccatacg ctgagagatc ctcactacgt
agaagataaa ggccacaaat 2040acttagtatt tgaagcaaac actggaactg
aagatggcta ccaaggcgaa gaatctttat 2100ttaacaaagc atactatggc
aaaagcacat cattcttccg tcaagaaagt caaaaacttc 2160tgcaaagcga
taaaaaacgc acggctgagt tagcaaacgg cgctctcggt atgattgagc
2220taaacgatga ttacacactg aaaaaagtga tgaaaccgct gattgcatct
aacacagtaa 2280cagatgaaat tgaacgcgcg aacgtcttta aaatgaacgg
caaatggtac ctgttcactg 2340actcccgcgg atcaaaaatg acgattgacg
gcattacgtc taacgatatt tacatgcttg 2400gttatgtttc taattcttta
actggcccat acaagccgct gaacaaaact ggccttgtgt 2460taaaaatgga
tcttgatcct aacgatgtaa cctttactta ctcacacttc gctgtacctc
2520aagcgaaagg aaacaatgtc gtgattacaa gctatatgac aaacagagga
ttctacgcag 2580acaaacaatc aacgtttgcg ccaagcttgc atgcgagagt
agggaactgc caggcatcaa 2640ataaaacgaa aggctcagtc gaaagactgg
gcctttcgtt ttatctgttg tttgtcggtg 2700aacgctctcc tgagtaggac
aaatccgccg ggagcggatt tgaacgttgc gaagcaacgg 2760cccggagggt
ggcgggcagg acgcccgcca taaactgcca ggcatcaaat taagcagaag
2820gccatcctga cggatggcct ttttgcgttt ctacaaactc tttttgttta
tttttctaaa 2880tacattcaaa tatgtatccg ctcatgctcc ggatctgcat
cgcaggatgc tgctggctac 2940cctgtggaac acctacatct gtattaacga
agcgctggca ttgaccctga gtgatttttc 3000tctggtcccg ccgcatccat
accgccagtt gtttaccctc acaacgttcc agtaaccggg 3060catgttcatc
atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc ggtatcatta
3120cccccatgaa cagaaattcc cccttacacg gaggcatcaa gtgaccaaac
aggaaaaaac 3180cgcccttaac atggcccgct ttatcagaag ccagacatta
acgcttctgg agaaactcaa 3240cgagctggac gcggatgaac aggcagacat
ctgtgaatcg cttcacgacc acgctgatga 3300gctttaccgc agctgcctcg
cgcgtttcgg tgatgacggt gaaaacctct gacacatgca 3360gctcccggag
acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca
3420gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt
cacgtagcga 3480tagcggagtg tatactggct taactatgcg gcatcagagc
agattgtact gagagtgcac 3540catatgcggt gtgaaatacc gcacagatgc
gtaaggagaa aataccgcat caggcgctct 3600tccgcttcct cgctcactga
ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 3660gctcactcaa
aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac
3720atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt
gctggcgttt 3780ttccataggc tccgcccccc tgacgagcat cacaaaaatc
gacgctcaag tcagaggtgg 3840cgaaacccga caggactata aagataccag
gcgtttcccc ctggaagctc cctcgtgcgc 3900tctcctgttc cgaccctgcc
gcttaccgga tacctgtccg cctttctccc ttcgggaagc 3960gtggcgcttt
ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc
4020aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt
atccggtaac 4080tatcgtcttg agtccaaccc ggtaagacac gacttatcgc
cactggcagc agccactggt 4140aacaggatta gcagagcgag gtatgtaggc
ggtgctacag agttcttgaa gtggtggcct 4200aactacggct acactagaag
gacagtattt ggtatctgcg ctctgctgaa gccagttacc 4260ttcggaaaaa
gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt
4320ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga
agatcctttg 4380atcttttcta cggggtctga cgctcagtgg aacgaaaact
cacgttaagg gattttggtc 4440atgagattat caaaaaggat cttcacctag
atccttttaa attaaaaatg aagttttaaa 4500tcaatctaaa gtatatatga
gtaaacttgg tctgacagtt accaatgctt aatcagtgag 4560gcacctatct
cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg
4620tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat
gataccgcga 4680gacccacgct caccggctcc agatttatca gcaataaacc
agccagccgg aagggccgag 4740cgcagaagtg gtcctgcaac tttatccgcc
tccatccagt ctattaattg ttgccgggaa 4800gctagagtaa gtagttcgcc
agttaatagt ttgcgcaacg ttgttgccat tgctgcaggc 4860atcgtggtgt
cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca
4920aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt
cggtcctccg 4980atcgttgtca gaagtaagtt ggccgcagtg ttatcactca
tggttatggc agcactgcat 5040aattctctta ctgtcatgcc atccgtaaga
tgcttttctg tgactggtga gtactcaacc 5100aagtcattct gagaatagtg
tatgcggcga ccgagttgct cttgcccggc gtcaatacgg 5160gataataccg
cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg
5220gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta
acccactcgt 5280gcacccaact gatcttcagc atcttttact ttcaccagcg
tttctgggtg agcaaaaaca 5340ggaaggcaaa atgccgcaaa aaagggaata
agggcgacac ggaaatgttg aatactcata 5400ctcttccttt ttcaatatta
ttgaagcatt tatcagggtt attgtctcat gagcggatac 5460atatttgaat
gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa
5520gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa
aaataggcgt 5580atcacgaggc cctttcgtct cgcgcgtttc ggtgatgacg
gtgaaaacct ctgacacatg 5640cagctcccgg agacggtcac agcttgtctg
taagcggatg ccgggagcag acaagcccgt 5700cagggcgcgt cagcgggtgt
tcatgtgcgt aactaacttg ccatcttcaa acaggagggc 5760tggaagaagc
agaccgctaa cacagtacat aaaaaaggag acatgaacga tgaacatcaa
5820aaagtttgca aaacaagcaa cagtattaac ctttactacc gcactgctgg
caggaggcgc 5880aactcaagcg tttgcgaaag aaacgaacca aaagccatat
aaggaaacat acggcatttc 5940ccatattaca cgccatgata tgctgcaaat
ccctgaacag caaaaaaatg aaaaatatca 6000agttcctgaa ttcgattcgt
ccacaattaa aaatatctct tctgcaaaag gcctggacgt 6060ttgggacagc
tggccattac aaaacgctga cggcactgtc gcaaactatc acggctacca
6120catcgtcttt gcattagccg gagatcctaa aaatgcggat gacacatcga
tttacatgtt 6180ctatcaaaaa gtcggcgaaa cttctattga cagctggaaa
aacgctggcc gcgtctttaa 6240agacagcgac aaattcgatg caaatgattc
tatcctaaaa gaccaaacac aagaatggtc 6300aggttcagcc acatttacat
ctgacggaaa aatccgttta ttctacactg atttctccgg 6360taaacattac
ggcaaacaaa cactgacaac tgcacaagtt aacgtatcag catcagacag
6420ctctttgaac atcaacggtg
tagaggatta taaatcaatc tttgacggtg acggaaaaac 6480gtatcaaaat
gtacagcatg ccacgcgtc 65098046DNAArtificial sequenceprimer N85
80catagatctg gatccaaagg agggtgagga aatggcgatg tttacg
468120DNAartificial sequenceprimer N86 81gtcgacttac tgctgggcgg
208220DNAArtificial sequenceT7 primer 82taatacgact cactataggg
208320DNAartificial sequencePrimer Trc99af 83ttgacaatta atcatccggc
208421DNAartificial sequencePrimer N5SeqF4 84ggtcaactgt tccggaaatt
c 218546DNAartificial sequencePrimer T-ald(BamHI) 85tgatctggat
ccaagaagga gcccttcacc atgaataaag acacac 468654DNAartificial
sequencePrimer B-ald(ETGER) 86catcgccatt tcctcaccct cctttttagc
cggcaagtac acatcttctt tgtc 548742DNAartificial sequencePrimer
T-Ptrc(BspEI) 87ttccgtactt ccggacgact gcacggtgca ccaatgcttc tg
428843DNAartificial sequencePrimer B-aldopt(BspEI) 88cggatcttaa
gtactttaac ccgccagcac acagcggcgc tgg 438932DNAartificial
sequencePrimer T-BspEIAatII 89ccggatcatg ataataatgg tttcttagac gt
329024DNAartificial sequencePrimer B-BspEIAatII 90ctaagaaacc
attattatca tgat 249142DNAartificial sequence1.6GI promoter
91gcccttgaca atgccacatc ctgagcaaat aattcaacca ct
429242DNAArtificial Sequence1.5GI promoter 92gcccttgact atgccacatc
ctgagcaaat aattcaacca ct 429339DNAartificial sequencePrimer AFBamHI
93cattggatcc atgaataaag acacactaat acctacaac 399439DNAartificial
sequencePrimer ARAat2 94catgacgtca ctagtgttaa caagaagtta gccggcaag
399550DNAartificial sequencePrimer Forward 1(E) 95catgttaaca
aaggaggaaa gatctatggc gatgtttacg accaccgcaa 509643DNAartificial
sequencePrimer bottom reverse 1(E) 96cccctccttt ggcgcgcctt
actgctgggc ggcgctcggc aga 439751DNAartificial sequencePrimer Top
Forward 2(B) 97gcccagcagt aaggcgcgcc aaaggagggg ttaaaatggt
tgatttcgaa t 519842DNAartificial sequencePrimer reverse 2(B)
98gtcgacgtca tactagttta cacagatttt ttgaatattt gt
429947DNAartificial sequencePrimer Pamy/lacOF 99cattgtacag
aattcgagct ctcgaggccc cgcacatacg aaaagac 4710052DNAArtificial
sequencePrimer Pam/la cOR 100cattgtacag tttaaacata ggtcaccctc
attttcgtag gaattgttat cc 5210152DNAartificial sequencePrimer Spac F
101cattgtacag tttaaacata ggtcaccctc attttcgtag gaattgttat cc
5210236DNAartificial sequencePrimer Spac R 102catgtttaaa cggtgaccca
agctggggat ccgcgg 3610344DNAartificial sequencePrimer Top TF
103cattggtcac cattcccggg catgcaaagg aggttagtag aatg
4410451DNAartificial sequencePrimer Bot TR 104cctttacgcg accggtacta
gtcaagtcga cagggcgcgc ccaatacttt c 5110557DNAartificial
sequencePrimer Top CF 105cgcgccctgt cgacttgact agtaccggtc
gcgtaaagga ggtattagtc atggaac 5710638DNAartificial sequencePrimer
Bot CR 106catcgtttaa acttggatcc agatccctta cctcctat
3810720DNAartificial sequencePrimer N3SeqF1 107ccatcatacc
atactgaccc 2010820DNAartificial sequencePrimer N3SeqF2
108gctactggag cattgctcac 2010924DNAartificial sequencePrimer
N3SeqF3 109ccattaacag ctgctattac aggc 2411020DNAartificial
sequencePrimer N4SeqR3 110ggtctcggaa taacacctgg
2011122DNAartificial sequencePrimer N5SeqF3 111caagcttcat
aacaggagct gg 2211222DNAartificial sequencePrimer N7SeqR2
112atcccacaat ccgtcagtga tc 2211320DNAartificial sequencePrimer
N31SeqF1 113ctgagataag aaaggccgca 2011420DNAartificial
sequencePrimer N62SeqF2 114caaccctggg cgtgtttctg
2011520DNAartificial sequencePrimer N62SeqF3 115gtggcgaaga
ttgggaactg 2011624DNAartificial sequencePrimer N62SeqF4
116gggaaatggc agaagatgtt cagc 2411724DNAartificial sequencePrimer
N63SeqR1 117cggtctgata acctgcaaaa tcgc 2411821DNAartificial
sequencePrimer N63SeqR2 118caccagcgct ttggcaacaa c
2111923DNAartificial sequencePrimer N63SeqR3 119gaacgtgcat
acagacctgc ttc 2312020DNAartificial sequencePrimer N63SeqR4
120cggctgaata acttttgcgg 2012124DNAartificial sequencePrimer Pamy
SeqF2 121gcctttgatg actgatgatt tggc 2412224DNAartificial
sequencePrimer Pamy SeqF 122tctccggtaa acattacggc aaac
2412324DNAartificial sequencePrimer Pamy seqR 123cggtcagatg
caattcgaca tgtg 2412420DNAartificial sequencePrimer SpacF Seq
124gaagtggtca agacctcact 2012524DNAartificial sequencePrimer sacB
Up 125cgggtttgtt actgataaag cagg 2412624DNAartificial
sequencePrimer sacB Dn 126cggttagcca tttgcctgct ttta
2412722DNAartificial sequencePrimer HT R 127acaaagatct ccatggacgc
gt 221281185DNAEscherichia coli 128atgaaaaatt gtgtcatcgt cagtgcggta
cgtactgcta tcggtagttt taacggttca 60ctcgcttcca ccagcgccat cgacctgggg
gcgacagtaa ttaaagccgc cattgaacgt 120gcaaaaatcg attcacaaca
cgttgatgaa gtgattatgg gtaacgtgtt acaagccggg 180ctggggcaaa
atccggcgcg tcaggcactg ttaaaaagcg ggctggcaga aacggtgtgc
240ggattcacgg tcaataaagt atgtggttcg ggtcttaaaa gtgtggcgct
tgccgcccag 300gccattcagg caggtcaggc gcagagcatt gtggcggggg
gtatggaaaa tatgagttta 360gccccctact tactcgatgc aaaagcacgc
tctggttatc gtcttggaga cggacaggtt 420tatgacgtaa tcctgcgcga
tggcctgatg tgcgccaccc atggttatca tatggggatt 480accgccgaaa
acgtggctaa agagtacgga attacccgtg aaatgcagga tgaactggcg
540ctacattcac agcgtaaagc ggcagccgca attgagtccg gtgcttttac
agccgaaatc 600gtcccggtaa atgttgtcac tcgaaagaaa accttcgtct
tcagtcaaga cgaattcccg 660aaagcgaatt caacggctga agcgttaggt
gcattgcgcc cggccttcga taaagcagga 720acagtcaccg ctgggaacgc
gtctggtatt aacgacggtg ctgccgctct ggtgattatg 780gaagaatctg
cggcgctggc agcaggcctt acccccctgg ctcgcattaa aagttatgcc
840agcggtggcg tgccccccgc attgatgggt atggggccag tacctgccac
gcaaaaagcg 900ttacaactgg cggggctgca actggcggat attgatctca
ttgaggctaa tgaagcattt 960gctgcacagt tccttgccgt tgggaaaaac
ctgggctttg attctgagaa agtgaatgtc 1020aacggcgggg ccatcgcgct
cgggcatcct atcggtgcca gtggtgctcg tattctggtc 1080acactattac
atgccatgca ggcacgcgat aaaacgctgg ggctggcaac actgtgcatt
1140ggcggcggtc agggaattgc gatggtgatt gaacggttga attaa
1185129394PRTEscherichia coli 129Met Lys Asn Cys Val Ile Val Ser
Ala Val Arg Thr Ala Ile Gly Ser 1 5 10 15 Phe Asn Gly Ser Leu Ala
Ser Thr Ser Ala Ile Asp Leu Gly Ala Thr 20 25 30 Val Ile Lys Ala
Ala Ile Glu Arg Ala Lys Ile Asp Ser Gln His Val 35 40 45 Asp Glu
Val Ile Met Gly Asn Val Leu Gln Ala Gly Leu Gly Gln Asn 50 55 60
Pro Ala Arg Gln Ala Leu Leu Lys Ser Gly Leu Ala Glu Thr Val Cys 65
70 75 80 Gly Phe Thr Val Asn Lys Val Cys Gly Ser Gly Leu Lys Ser
Val Ala 85 90 95 Leu Ala Ala Gln Ala Ile Gln Ala Gly Gln Ala Gln
Ser Ile Val Ala 100 105 110 Gly Gly Met Glu Asn Met Ser Leu Ala Pro
Tyr Leu Leu Asp Ala Lys 115 120 125 Ala Arg Ser Gly Tyr Arg Leu Gly
Asp Gly Gln Val Tyr Asp Val Ile 130 135 140 Leu Arg Asp Gly Leu Met
Cys Ala Thr His Gly Tyr His Met Gly Ile 145 150 155 160 Thr Ala Glu
Asn Val Ala Lys Glu Tyr Gly Ile Thr Arg Glu Met Gln 165 170 175 Asp
Glu Leu Ala Leu His Ser Gln Arg Lys Ala Ala Ala Ala Ile Glu 180 185
190 Ser Gly Ala Phe Thr Ala Glu Ile Val Pro Val Asn Val Val Thr Arg
195 200 205 Lys Lys Thr Phe Val Phe Ser Gln Asp Glu Phe Pro Lys Ala
Asn Ser 210 215 220 Thr Ala Glu Ala Leu Gly Ala Leu Arg Pro Ala Phe
Asp Lys Ala Gly 225 230 235 240 Thr Val Thr Ala Gly Asn Ala Ser Gly
Ile Asn Asp Gly Ala Ala Ala 245 250 255 Leu Val Ile Met Glu Glu Ser
Ala Ala Leu Ala Ala Gly Leu Thr Pro 260 265 270 Leu Ala Arg Ile Lys
Ser Tyr Ala Ser Gly Gly Val Pro Pro Ala Leu 275 280 285 Met Gly Met
Gly Pro Val Pro Ala Thr Gln Lys Ala Leu Gln Leu Ala 290 295 300 Gly
Leu Gln Leu Ala Asp Ile Asp Leu Ile Glu Ala Asn Glu Ala Phe 305 310
315 320 Ala Ala Gln Phe Leu Ala Val Gly Lys Asn Leu Gly Phe Asp Ser
Glu 325 330 335 Lys Val Asn Val Asn Gly Gly Ala Ile Ala Leu Gly His
Pro Ile Gly 340 345 350 Ala Ser Gly Ala Arg Ile Leu Val Thr Leu Leu
His Ala Met Gln Ala 355 360 365 Arg Asp Lys Thr Leu Gly Leu Ala Thr
Leu Cys Ile Gly Gly Gly Gln 370 375 380 Gly Ile Ala Met Val Ile Glu
Arg Leu Asn 385 390 1301182DNABacillus subtilis 130ttaatgaacc
tgcactaaga cggcgtctcc ctgtgctgcc ccgctgcaaa tagcggcaac 60gcccagaccc
cctccccgtc gctttaattc ataaacaagc gtcatgagaa ttctcgcacc
120gctcgcgccg atcgggtggc cgagcgcgat cgcaccgcca ttcacattta
ctttttcaag 180atcgaaacct acgatttttt cacatgtcaa aacaactgaa
gcaaaagctt catttacttc 240aaacaagtca atatcttgga cagttaaacc
attctttttc aggagcttgt taatagcaaa 300ccctggcgct gccgccagct
cgtgcgctgg cattcccgta gttgaaaaac caagaattgt 360agccagaggc
cgtttgccaa gctcagcagc tttttcctca gacatcagca cgaacgcgcc
420ggctccgtca ttgactccag gagcattgcc ggctgtgata gaaccgtcac
ttgcataaat 480cggagcaagt tttgcgagct gatccagact tgtgtcacgg
cgaatcgctt catctttatc 540aacaacgttt ggttttcctt ttcgaccgat
ccagttgacg ggaacaattt catcctgaaa 600cttcccttca tcggcggcct
tagctgccct tgcatgactt ctcaacgccc attcgtcctg 660ctctcttcgt
gagattgcat attccttggc agctgtattt ccgtgaacag ccatgtgcac
720ctcgtcaaat gcgcacgtta atccgtcata caccattaag tccctaagct
cgccgtcccc 780catccgtgct ccccagcgcc cggcgggaac ggcatacgga
atattgctca tgctttccat 840cccccccgca acaagtatgt ccgcatcctg
cgcccgaatc atttgatcac ataaagtgac 900agcgcgaagg ccggaagcac
agactttatt cagtgtttct gacggcacac tccaaggcat 960tcccgccaga
cgggcagctt gacgggaagg tatctgccct gagccggcct ggacaaccat
1020gcccatgacg tttccttcta catcatctcc agagactcca gcctgttgca
gcgcctcctt 1080catcacaatg cccccaagct cagcagcttt cacctctttc
aaaactccgc cgaatttgcc 1140aaatggagtt cttgcagcac ttacaatgac
tgttttcctc at 1182131393PRTBacillus subtilis 131Met Arg Lys Thr Val
Ile Val Ser Ala Ala Arg Thr Pro Phe Gly Lys 1 5 10 15 Phe Gly Gly
Val Leu Lys Glu Val Lys Ala Ala Glu Leu Gly Gly Ile 20 25 30 Val
Met Lys Glu Ala Leu Gln Gln Ala Gly Val Ser Gly Asp Asp Val 35 40
45 Glu Gly Asn Val Met Gly Met Val Val Gln Ala Gly Ser Gly Gln Ile
50 55 60 Pro Ser Arg Gln Ala Ala Arg Leu Ala Gly Met Pro Trp Ser
Val Pro 65 70 75 80 Ser Glu Thr Leu Asn Lys Val Cys Ala Ser Gly Leu
Arg Ala Val Thr 85 90 95 Leu Cys Asp Gln Met Ile Arg Ala Gln Asp
Ala Asp Ile Leu Val Ala 100 105 110 Gly Gly Met Glu Ser Met Ser Asn
Ile Pro Tyr Ala Val Pro Ala Gly 115 120 125 Arg Trp Gly Ala Arg Met
Gly Asp Gly Glu Leu Arg Asp Leu Met Val 130 135 140 Tyr Asp Gly Leu
Thr Cys Ala Phe Asp Glu Val His Met Ala Val His 145 150 155 160 Gly
Asn Thr Ala Ala Lys Glu Tyr Ala Ile Ser Arg Arg Glu Gln Asp 165 170
175 Glu Trp Ala Leu Arg Ser His Ala Arg Ala Ala Lys Ala Ala Asp Glu
180 185 190 Gly Lys Phe Gln Asp Glu Ile Val Pro Val Asn Trp Ile Gly
Arg Lys 195 200 205 Gly Lys Pro Asn Val Val Asp Lys Asp Glu Ala Ile
Arg Arg Asp Thr 210 215 220 Ser Leu Asp Gln Leu Ala Lys Leu Ala Pro
Ile Tyr Ala Ser Asp Gly 225 230 235 240 Ser Ile Thr Ala Gly Asn Ala
Pro Gly Val Asn Asp Gly Ala Gly Ala 245 250 255 Phe Val Leu Met Ser
Glu Glu Lys Ala Ala Glu Leu Gly Lys Arg Pro 260 265 270 Leu Ala Thr
Ile Leu Gly Phe Ser Thr Thr Gly Met Pro Ala His Glu 275 280 285 Leu
Ala Ala Ala Pro Gly Phe Ala Ile Asn Lys Leu Leu Lys Lys Asn 290 295
300 Gly Leu Thr Val Gln Asp Ile Asp Leu Phe Glu Val Asn Glu Ala Phe
305 310 315 320 Ala Ser Val Val Leu Thr Cys Glu Lys Ile Val Gly Phe
Asp Leu Glu 325 330 335 Lys Val Asn Val Asn Gly Gly Ala Ile Ala Leu
Gly His Pro Ile Gly 340 345 350 Ala Ser Gly Ala Arg Ile Leu Met Thr
Leu Val Tyr Glu Leu Lys Arg 355 360 365 Arg Gly Gly Gly Leu Gly Val
Ala Ala Ile Cys Ser Gly Ala Ala Gln 370 375 380 Gly Asp Ala Val Leu
Val Gln Val His 385 390 1321197DNASaccharomyces cerevisiae
132atgtctcaga acgtttacat tgtatcgact gccagaaccc caattggttc
attccagggt 60tctctatcct ccaagacagc agtggaattg ggtgctgttg ctttaaaagg
cgccttggct 120aaggttccag aattggatgc atccaaggat tttgacgaaa
ttatttttgg taacgttctt 180tctgccaatt tgggccaagc tccggccaga
caagttgctt tggctgccgg tttgagtaat 240catatcgttg caagcacagt
taacaaggtc tgtgcatccg ctatgaaggc aatcattttg 300ggtgctcaat
ccatcaaatg tggtaatgct gatgttgtcg tagctggtgg ttgtgaatct
360atgactaacg caccatacta catgccagca gcccgtgcgg gtgccaaatt
tggccaaact 420gttcttgttg atggtgtcga aagagatggg ttgaacgatg
cgtacgatgg tctagccatg 480ggtgtacacg cagaaaagtg tgcccgtgat
tgggatatta ctagagaaca acaagacaat 540tttgccatcg aatcctacca
aaaatctcaa aaatctcaaa aggaaggtaa attcgacaat 600gaaattgtac
ctgttaccat taagggattt agaggtaagc ctgatactca agtcacgaag
660gacgaggaac ctgctagatt acacgttgaa aaattgagat ctgcaaggac
tgttttccaa 720aaagaaaacg gtactgttac tgccgctaac gcttctccaa
tcaacgatgg tgctgcagcc 780gtcatcttgg tttccgaaaa agttttgaag
gaaaagaatt tgaagccttt ggctattatc 840aaaggttggg gtgaggccgc
tcatcaacca gctgatttta catgggctcc atctcttgca 900gttccaaagg
ctttgaaaca tgctggcatc gaagacatca attctgttga ttactttgaa
960ttcaatgaag ccttttcggt tgtcggtttg gtgaacacta agattttgaa
gctagaccca 1020tctaaggtta atgtatatgg tggtgctgtt gctctaggtc
acccattggg ttgttctggt 1080gctagagtgg ttgttacact gctatccatc
ttacagcaag aaggaggtaa gatcggtgtt 1140gccgccattt gtaatggtgg
tggtggtgct tcctctattg tcattgaaaa gatatga 1197133398PRTSaccharomyces
cerevisiae 133Met Ser Gln Asn Val Tyr Ile Val Ser Thr Ala Arg Thr
Pro Ile Gly 1 5 10 15 Ser Phe Gln Gly Ser Leu Ser Ser Lys Thr Ala
Val Glu Leu Gly Ala 20 25 30 Val Ala Leu Lys Gly Ala Leu Ala Lys
Val Pro Glu Leu Asp Ala Ser 35 40 45 Lys Asp Phe Asp Glu Ile Ile
Phe Gly Asn Val Leu Ser Ala Asn Leu 50 55 60 Gly Gln Ala Pro Ala
Arg Gln Val Ala Leu Ala Ala Gly Leu Ser Asn 65 70 75 80 His Ile Val
Ala Ser Thr Val Asn Lys Val Cys Ala Ser Ala Met Lys 85 90 95 Ala
Ile Ile Leu Gly Ala Gln Ser Ile Lys Cys Gly Asn Ala Asp Val 100 105
110 Val Val Ala Gly Gly Cys Glu Ser Met Thr Asn Ala Pro Tyr Tyr Met
115 120 125 Pro Ala Ala Arg Ala Gly Ala Lys Phe Gly Gln Thr Val Leu
Val Asp 130 135 140 Gly Val Glu Arg Asp Gly Leu Asn Asp Ala Tyr Asp
Gly Leu Ala Met 145 150 155 160 Gly Val His Ala Glu Lys Cys Ala Arg
Asp Trp Asp Ile Thr Arg Glu 165 170 175 Gln Gln Asp Asn Phe Ala Ile
Glu Ser Tyr Gln Lys Ser Gln Lys Ser
180 185 190 Gln Lys Glu Gly Lys Phe Asp Asn Glu Ile Val Pro Val Thr
Ile Lys 195 200 205 Gly Phe Arg Gly Lys Pro Asp Thr Gln Val Thr Lys
Asp Glu Glu Pro 210 215 220 Ala Arg Leu His Val Glu Lys Leu Arg Ser
Ala Arg Thr Val Phe Gln 225 230 235 240 Lys Glu Asn Gly Thr Val Thr
Ala Ala Asn Ala Ser Pro Ile Asn Asp 245 250 255 Gly Ala Ala Ala Val
Ile Leu Val Ser Glu Lys Val Leu Lys Glu Lys 260 265 270 Asn Leu Lys
Pro Leu Ala Ile Ile Lys Gly Trp Gly Glu Ala Ala His 275 280 285 Gln
Pro Ala Asp Phe Thr Trp Ala Pro Ser Leu Ala Val Pro Lys Ala 290 295
300 Leu Lys His Ala Gly Ile Glu Asp Ile Asn Ser Val Asp Tyr Phe Glu
305 310 315 320 Phe Asn Glu Ala Phe Ser Val Val Gly Leu Val Asn Thr
Lys Ile Leu 325 330 335 Lys Leu Asp Pro Ser Lys Val Asn Val Tyr Gly
Gly Ala Val Ala Leu 340 345 350 Gly His Pro Leu Gly Cys Ser Gly Ala
Arg Val Val Val Thr Leu Leu 355 360 365 Ser Ile Leu Gln Gln Glu Gly
Gly Lys Ile Gly Val Ala Ala Ile Cys 370 375 380 Asn Gly Gly Gly Gly
Ala Ser Ser Ile Val Ile Glu Lys Ile 385 390 395 134864DNABacillus
subtilis 134atggaaatca aacaaatcat ggtagctggc gcaggtcaga tggggagcgg
aattgctcaa 60acagccgccg acgcgggctt ttatgtgcgg atgtatgatg tgaatccaga
ggccgcggag 120gcaggattga aacggctgaa gaaacagctg gcccgtgatg
ctgagaaagg aaaaaggacc 180gagacggaag tgaagagcgt aatcaaccgc
atttcgattt ctcaaacact tgaggaggca 240gagcatgcgg acattgtgat
tgaggctatc gcagaaaaca tggcggcaaa aactgagatg 300tttaaaacac
ttgatcgcat ttgcccgcct catacgattt tggccagcaa tacatcttcc
360ttgcctatta cagaaatcgc tgctgtaaca aaccggcctc aacgggttat
tggcatgcat 420tttatgaatc ccgtccctgt aatgaagctg gtagaagtga
ttcgaggctt ggctacatca 480gaagaaacgg ccttagatgt tatggcatta
gcggaaaaga tggggaaaac agcggtagaa 540gtcaatgatt ttcctgggtt
tgtttccaac cgtgtgcttc ttccaatgat taatgaagcc 600atctattgcg
tgtatgaggg agtggcgaag ccggaggcaa tagatgaagt gatgaagctg
660ggcatgaatc atccgatggg tccgcttgca ttagcggatt ttatcggact
ggatacgtgt 720ttatcaatta tggaagtcct tcactcaggc cttggcgatt
ccaaataccg tccttgcccg 780ctgctccgca agtatgtcaa agcaggctgg
cttggcaaaa agagcggacg cggtttttat 840gactatgagg agaagacttc ctga
864135287PRTBacillus subtilis 135Met Glu Ile Lys Gln Ile Met Val
Ala Gly Ala Gly Gln Met Gly Ser 1 5 10 15 Gly Ile Ala Gln Thr Ala
Ala Asp Ala Gly Phe Tyr Val Arg Met Tyr 20 25 30 Asp Val Asn Pro
Glu Ala Ala Glu Ala Gly Leu Lys Arg Leu Lys Lys 35 40 45 Gln Leu
Ala Arg Asp Ala Glu Lys Gly Lys Arg Thr Glu Thr Glu Val 50 55 60
Lys Ser Val Ile Asn Arg Ile Ser Ile Ser Gln Thr Leu Glu Glu Ala 65
70 75 80 Glu His Ala Asp Ile Val Ile Glu Ala Ile Ala Glu Asn Met
Ala Ala 85 90 95 Lys Thr Glu Met Phe Lys Thr Leu Asp Arg Ile Cys
Pro Pro His Thr 100 105 110 Ile Leu Ala Ser Asn Thr Ser Ser Leu Pro
Ile Thr Glu Ile Ala Ala 115 120 125 Val Thr Asn Arg Pro Gln Arg Val
Ile Gly Met His Phe Met Asn Pro 130 135 140 Val Pro Val Met Lys Leu
Val Glu Val Ile Arg Gly Leu Ala Thr Ser 145 150 155 160 Glu Glu Thr
Ala Leu Asp Val Met Ala Leu Ala Glu Lys Met Gly Lys 165 170 175 Thr
Ala Val Glu Val Asn Asp Phe Pro Gly Phe Val Ser Asn Arg Val 180 185
190 Leu Leu Pro Met Ile Asn Glu Ala Ile Tyr Cys Val Tyr Glu Gly Val
195 200 205 Ala Lys Pro Glu Ala Ile Asp Glu Val Met Lys Leu Gly Met
Asn His 210 215 220 Pro Met Gly Pro Leu Ala Leu Ala Asp Phe Ile Gly
Leu Asp Thr Cys 225 230 235 240 Leu Ser Ile Met Glu Val Leu His Ser
Gly Leu Gly Asp Ser Lys Tyr 245 250 255 Arg Pro Cys Pro Leu Leu Arg
Lys Tyr Val Lys Ala Gly Trp Leu Gly 260 265 270 Lys Lys Ser Gly Arg
Gly Phe Tyr Asp Tyr Glu Glu Lys Thr Ser 275 280 285
136855DNARalstonia eutropha 136atggcaatca ggacagtggg catcgtgggt
gccggcacca tgggcaacgg catcgcgcag 60gcttgtgcgg tggtgggcct ggacgtggtg
atggtggata tcagcgacgc agcggtgcag 120aagggcatcg ccaccgtcgc
cggcagcctg gaccgcctga tcaagaagga caagatcagc 180gaagccgaca
agatgactgc gctcgcgcgc atccacggca gcaccgcgta tgacgacctg
240aagaaggccg atatcgtgat cgaggccgcc accgagaact ttgacctgaa
ggtcaagatc 300ctcaagcaga tcgacagcat cgtcggcgag aacgtcatca
ttgcttcgaa cacgtcgtcg 360atctcgatca ccaagctggc cgccgtgacg
agtcgccccg agcgcttcat cggcatgcac 420ttcttcaacc cggtgccggt
gatggcgctg gtggaactga tccgcggcct gcagaccagc 480gacgcggctc
acgccgatgt cgaggcgctg gccaaggaac tgggcaagta cccgatcacc
540gtcaagaaca gcccgggctt cgtcgtcaac cgcatcctgt gcccgatgat
caacgaagcc 600ttctgcgtgc tcggtgaagg cctggcctcg ccggaagaga
tcgacgaagg catgaagctc 660ggctgcaacc atccgatcgg ccccctggca
ctggccgaca tgatcggcct ggacaccatg 720ctggcagtga tggaagtgct
gtacacagaa tttgccgacc cgaagtatcg tccggccatg 780ctgatgcgcg
agatggtggc tgcggggtat ctgggccgca agactggccg tggcgtgtac
840gtctacagca agtaa 855137284PRTRalstonia eutropha 137Met Ala Ile
Arg Thr Val Gly Ile Val Gly Ala Gly Thr Met Gly Asn 1 5 10 15 Gly
Ile Ala Gln Ala Cys Ala Val Val Gly Leu Asp Val Val Met Val 20 25
30 Asp Ile Ser Asp Ala Ala Val Gln Lys Gly Ile Ala Thr Val Ala Gly
35 40 45 Ser Leu Asp Arg Leu Ile Lys Lys Asp Lys Ile Ser Glu Ala
Asp Lys 50 55 60 Met Thr Ala Leu Ala Arg Ile His Gly Ser Thr Ala
Tyr Asp Asp Leu 65 70 75 80 Lys Lys Ala Asp Ile Val Ile Glu Ala Ala
Thr Glu Asn Phe Asp Leu 85 90 95 Lys Val Lys Ile Leu Lys Gln Ile
Asp Ser Ile Val Gly Glu Asn Val 100 105 110 Ile Ile Ala Ser Asn Thr
Ser Ser Ile Ser Ile Thr Lys Leu Ala Ala 115 120 125 Val Thr Ser Arg
Pro Glu Arg Phe Ile Gly Met His Phe Phe Asn Pro 130 135 140 Val Pro
Val Met Ala Leu Val Glu Leu Ile Arg Gly Leu Gln Thr Ser 145 150 155
160 Asp Ala Ala His Ala Asp Val Glu Ala Leu Ala Lys Glu Leu Gly Lys
165 170 175 Tyr Pro Ile Thr Val Lys Asn Ser Pro Gly Phe Val Val Asn
Arg Ile 180 185 190 Leu Cys Pro Met Ile Asn Glu Ala Phe Cys Val Leu
Gly Glu Gly Leu 195 200 205 Ala Ser Pro Glu Glu Ile Asp Glu Gly Met
Lys Leu Gly Cys Asn His 210 215 220 Pro Ile Gly Pro Leu Ala Leu Ala
Asp Met Ile Gly Leu Asp Thr Met 225 230 235 240 Leu Ala Val Met Glu
Val Leu Tyr Thr Glu Phe Ala Asp Pro Lys Tyr 245 250 255 Arg Pro Ala
Met Leu Met Arg Glu Met Val Ala Ala Gly Tyr Leu Gly 260 265 270 Arg
Lys Thr Gly Arg Gly Val Tyr Val Tyr Ser Lys 275 280
138741DNAAlcaligenes eutrophis 138atgactcagc gcattgcgta tgtgaccggc
ggcatgggtg gtatcggaac cgccatttgc 60cagcggctgg ccaaggatgg ctttcgtgtg
gtggccggtt gcggccccaa ctcgccgcgc 120cgcgaaaagt ggctggagca
gcagaaggcc ctgggcttcg atttcattgc ctcggaaggc 180aatgtggctg
actgggactc gaccaagacc gcattcgaca aggtcaagtc cgaggtcggc
240gaggttgatg tgctgatcaa caacgccggt atcacccgcg acgtggtgtt
ccgcaagatg 300acccgcgccg actgggatgc ggtgatcgac accaacctga
cctcgctgtt caacgtcacc 360aagcaggtga tcgacggcat ggccgaccgt
ggctggggcc gcatcgtcaa catctcgtcg 420gtgaacgggc agaagggcca
gttcggccag accaactact ccaccgccaa ggccggcctg 480catggcttca
ccatggcact ggcgcaggaa gtggcgacca agggcgtgac cgtcaacacg
540gtctctccgg gctatatcgc caccgacatg gtcaaggcga tccgccagga
cgtgctcgac 600aagatcgtcg cgacgatccc ggtcaagcgc ctgggcctgc
cggaagagat cgcctcgatc 660tgcgcctggt tgtcgtcgga ggagtccggt
ttctcgaccg gcgccgactt ctcgctcaac 720ggcggcctgc atatgggctg a
741139246PRTAlcaligenes eutrophus 139Met Thr Gln Arg Ile Ala Tyr
Val Thr Gly Gly Met Gly Gly Ile Gly 1 5 10 15 Thr Ala Ile Cys Gln
Arg Leu Ala Lys Asp Gly Phe Arg Val Val Ala 20 25 30 Gly Cys Gly
Pro Asn Ser Pro Arg Arg Glu Lys Trp Leu Glu Gln Gln 35 40 45 Lys
Ala Leu Gly Phe Asp Phe Ile Ala Ser Glu Gly Asn Val Ala Asp 50 55
60 Trp Asp Ser Thr Lys Thr Ala Phe Asp Lys Val Lys Ser Glu Val Gly
65 70 75 80 Glu Val Asp Val Leu Ile Asn Asn Ala Gly Ile Thr Arg Asp
Val Val 85 90 95 Phe Arg Lys Met Thr Arg Ala Asp Trp Asp Ala Val
Ile Asp Thr Asn 100 105 110 Leu Thr Ser Leu Phe Asn Val Thr Lys Gln
Val Ile Asp Gly Met Ala 115 120 125 Asp Arg Gly Trp Gly Arg Ile Val
Asn Ile Ser Ser Val Asn Gly Gln 130 135 140 Lys Gly Gln Phe Gly Gln
Thr Asn Tyr Ser Thr Ala Lys Ala Gly Leu 145 150 155 160 His Gly Phe
Thr Met Ala Leu Ala Gln Glu Val Ala Thr Lys Gly Val 165 170 175 Thr
Val Asn Thr Val Ser Pro Gly Tyr Ile Ala Thr Asp Met Val Lys 180 185
190 Ala Ile Arg Gln Asp Val Leu Asp Lys Ile Val Ala Thr Ile Pro Val
195 200 205 Lys Arg Leu Gly Leu Pro Glu Glu Ile Ala Ser Ile Cys Ala
Trp Leu 210 215 220 Ser Ser Glu Glu Ser Gly Phe Ser Thr Gly Ala Asp
Phe Ser Leu Asn 225 230 235 240 Gly Gly Leu His Met Gly 245
140768DNAEscherichia coli 140atgagcgaac tgatcgtcag ccgtcagcaa
cgagtattgt tgctgaccct taaccgtccc 60gccgcacgta atgcgctaaa taatgccctg
ctgatgcaac tggtaaatga actggaagct 120gcggctaccg ataccagcat
ttcggtctgt gtgattaccg gtaatgcacg cttttttgcc 180gctggggccg
atctcaacga aatggcagaa aaagatctcg cggccacctt aaacgataca
240cgtccgcagc tatgggcgcg attgcaggcc tttaataaac cacttatcgc
agccgtcaat 300ggttacgcgc ttggggcggg ttgcgaactg gcattgttgt
gcgatgtggt ggttgccgga 360gagaacgcgc gttttgggtt gccggaaatc
actctcggca tcatgcctgg cgcaggcgga 420acgcaacgtt taatccgtag
tgtcggtaaa tcgttagcca gcaaaatggt gctgagcgga 480gaaagtatca
ccgctcagca agcacagcag gccgggctgg ttagcgacgt cttccccagc
540gatttaaccc tcgaatacgc cttacagctg gcatcgaaaa tggcacgtca
ctcgccgctg 600gccttacaag cggcaaagca agcgctgcgc cagtcgcagg
aagtggcttt gcaagccgga 660cttgcccagg agcgacagtt attcaccttg
ctggcggcaa cagaagatcg tcatgaaggc 720atctccgctt tcttacaaaa
acgcacgccc gactttaaag gacgctaa 768141255PRTEscherichia coli 141Met
Ser Glu Leu Ile Val Ser Arg Gln Gln Arg Val Leu Leu Leu Thr 1 5 10
15 Leu Asn Arg Pro Ala Ala Arg Asn Ala Leu Asn Asn Ala Leu Leu Met
20 25 30 Gln Leu Val Asn Glu Leu Glu Ala Ala Ala Thr Asp Thr Ser
Ile Ser 35 40 45 Val Cys Val Ile Thr Gly Asn Ala Arg Phe Phe Ala
Ala Gly Ala Asp 50 55 60 Leu Asn Glu Met Ala Glu Lys Asp Leu Ala
Ala Thr Leu Asn Asp Thr 65 70 75 80 Arg Pro Gln Leu Trp Ala Arg Leu
Gln Ala Phe Asn Lys Pro Leu Ile 85 90 95 Ala Ala Val Asn Gly Tyr
Ala Leu Gly Ala Gly Cys Glu Leu Ala Leu 100 105 110 Leu Cys Asp Val
Val Val Ala Gly Glu Asn Ala Arg Phe Gly Leu Pro 115 120 125 Glu Ile
Thr Leu Gly Ile Met Pro Gly Ala Gly Gly Thr Gln Arg Leu 130 135 140
Ile Arg Ser Val Gly Lys Ser Leu Ala Ser Lys Met Val Leu Ser Gly 145
150 155 160 Glu Ser Ile Thr Ala Gln Gln Ala Gln Gln Ala Gly Leu Val
Ser Asp 165 170 175 Val Phe Pro Ser Asp Leu Thr Leu Glu Tyr Ala Leu
Gln Leu Ala Ser 180 185 190 Lys Met Ala Arg His Ser Pro Leu Ala Leu
Gln Ala Ala Lys Gln Ala 195 200 205 Leu Arg Gln Ser Gln Glu Val Ala
Leu Gln Ala Gly Leu Ala Gln Glu 210 215 220 Arg Gln Leu Phe Thr Leu
Leu Ala Ala Thr Glu Asp Arg His Glu Gly 225 230 235 240 Ile Ser Ala
Phe Leu Gln Lys Arg Thr Pro Asp Phe Lys Gly Arg 245 250 255
142783DNABacillus subtilis 142atgggagatt ctattctttt tactgttaaa
aatgaacata tggcgttgat caccttaaac 60aggcctcagg cagcaaatgc tctttcagcg
gaaatgctta gaaacctgca aatgattatc 120caggaaattg aatttaactc
aaacatccgt tgcgtcatcc tcacaggcac cggtgaaaaa 180gcgttttgtg
caggggcaga cctgaaggaa cggataaaac tgaaagaaga tcaggttctg
240gaaagtgtat ctctcattca aagaacggcg gctttacttg atgccttgcc
gcagccggtc 300atagctgcga taaatggaag cgcattaggc ggcggactag
aattggcatt ggcatgcgac 360cttcgaatcg caactgaagc agctgtgctg
ggacttccgg aaacagggtt agctattatc 420ccgggcgctg gagggaccca
aaggctgccc cggctgattg gcagaggaaa agcaaaagaa 480ttcatttata
caggcagacg cgtgaccgca cacgaagcaa aagaaatcgg ccttgtagag
540catgtcacgg ctccttgtga ccttatgcca aaagcagagg aactggccgc
agccatttct 600gccaacggac cgatcgctgt ccgtcaggct aaatttgcaa
tcaataaagg attggagaca 660gatcttgcta caggccttgc gattgaacaa
aaagcgtatg aacaaaccat cccgacaaaa 720gacaggagag aagggcttca
ggcctttcaa gaaaaaagac gggccgtata caagggaata 780taa
783143260PRTBacillus subtilis 143Met Gly Asp Ser Ile Leu Phe Thr
Val Lys Asn Glu His Met Ala Leu 1 5 10 15 Ile Thr Leu Asn Arg Pro
Gln Ala Ala Asn Ala Leu Ser Ala Glu Met 20 25 30 Leu Arg Asn Leu
Gln Met Ile Ile Gln Glu Ile Glu Phe Asn Ser Asn 35 40 45 Ile Arg
Cys Val Ile Leu Thr Gly Thr Gly Glu Lys Ala Phe Cys Ala 50 55 60
Gly Ala Asp Leu Lys Glu Arg Ile Lys Leu Lys Glu Asp Gln Val Leu 65
70 75 80 Glu Ser Val Ser Leu Ile Gln Arg Thr Ala Ala Leu Leu Asp
Ala Leu 85 90 95 Pro Gln Pro Val Ile Ala Ala Ile Asn Gly Ser Ala
Leu Gly Gly Gly 100 105 110 Leu Glu Leu Ala Leu Ala Cys Asp Leu Arg
Ile Ala Thr Glu Ala Ala 115 120 125 Val Leu Gly Leu Pro Glu Thr Gly
Leu Ala Ile Ile Pro Gly Ala Gly 130 135 140 Gly Thr Gln Arg Leu Pro
Arg Leu Ile Gly Arg Gly Lys Ala Lys Glu 145 150 155 160 Phe Ile Tyr
Thr Gly Arg Arg Val Thr Ala His Glu Ala Lys Glu Ile 165 170 175 Gly
Leu Val Glu His Val Thr Ala Pro Cys Asp Leu Met Pro Lys Ala 180 185
190 Glu Glu Leu Ala Ala Ala Ile Ser Ala Asn Gly Pro Ile Ala Val Arg
195 200 205 Gln Ala Lys Phe Ala Ile Asn Lys Gly Leu Glu Thr Asp Leu
Ala Thr 210 215 220 Gly Leu Ala Ile Glu Gln Lys Ala Tyr Glu Gln Thr
Ile Pro Thr Lys 225 230 235 240 Asp Arg Arg Glu Gly Leu Gln Ala Phe
Gln Glu Lys Arg Arg Ala Val 245 250 255 Tyr Lys Gly Ile 260
144405DNAAeromonas caviae 144atgagcgcac aatccctgga agtaggccag
aaggcccgtc tcagcaagcg gttcggggcg 60gcggaggtag ccgccttcgc cgcgctctcg
gaggacttca accccctgca cctggacccg 120gccttcgccg ccaccacggc
gttcgagcgg cccatagtcc acggcatgct gctcgccagc 180ctcttctccg
ggctgctggg ccagcagttg ccgggcaagg ggagcatcta tctgggtcaa
240agcctcagct tcaagctgcc ggtctttgtc ggggacgagg tgacggccga
ggtggaggtg 300accgcccttc gcgaggacaa gcccatcgcc accctgacca
cccgcatctt cacccaaggc 360ggcgccctcg ccgtgacggg ggaagccgtg
gtcaagctgc cttaa 405145134PRTAeromonas
caviae 145Met Ser Ala Gln Ser Leu Glu Val Gly Gln Lys Ala Arg Leu
Ser Lys 1 5 10 15 Arg Phe Gly Ala Ala Glu Val Ala Ala Phe Ala Ala
Leu Ser Glu Asp 20 25 30 Phe Asn Pro Leu His Leu Asp Pro Ala Phe
Ala Ala Thr Thr Ala Phe 35 40 45 Glu Arg Pro Ile Val His Gly Met
Leu Leu Ala Ser Leu Phe Ser Gly 50 55 60 Leu Leu Gly Gln Gln Leu
Pro Gly Lys Gly Ser Ile Tyr Leu Gly Gln 65 70 75 80 Ser Leu Ser Phe
Lys Leu Pro Val Phe Val Gly Asp Glu Val Thr Ala 85 90 95 Glu Val
Glu Val Thr Ala Leu Arg Glu Asp Lys Pro Ile Ala Thr Leu 100 105 110
Thr Thr Arg Ile Phe Thr Gln Gly Gly Ala Leu Ala Val Thr Gly Glu 115
120 125 Ala Val Val Lys Leu Pro 130 1461912DNAEuglena gracilis
146ttttcgcccg tgcaccacga tgtcgtgccc cgcctcgccg tctgctgccg
tggtgtctgc 60cggcgccctc tgcctgtgcg tggcaacggt attgttggcg actggatcca
accccaccgc 120cctgtccact gcttccactc gctctccgac ctcactggtc
cgtggggtgg acaggggctt 180gatgaggcca accactgcag cggctctgac
gacaatgaga gaggtgcccc agatggctga 240gggattttca ggcgaagcca
cgtctgcatg ggccgccgcg gggccgcagt gggcggcgcc 300gctcgtggcc
gcggcctcct ccgcactggc gctgtggtgg tgggccgccc ggcgcagcgt
360gcggcggccg ctggcagcgc tggcggagct gcccaccgcg gtcacccacc
tggccccccc 420gatggcgatg ttcaccacca cagcgaaggt catccagccc
aagattcgtg gcttcatctg 480cacgaccacc cacccgatcg gctgtgagaa
gcgggtccag gaggagatcg cgtacgcccg 540tgcccacccg cccaccagcc
ctggcccgaa gagggtgctg gtcatcggct gcagtaccgg 600ctacgggctc
tccacccgca tcaccgctgc cttcggctac caggccgcca cgctgggcgt
660gttcctggcg ggccccccga cgaagggccg ccccgccgcg gcgggctggt
acaacaccgt 720ggcgttcgag aaggccgccc tggaggccgg gctgtacgcc
cggagcctta atggcgacgc 780cttcgactcc acaacgaagg cgcggacggt
cgaggcgatc aagcgggacc tcggcacggt 840ggacctcgtg gtgtacagca
tcgccgcccc gaagcggacg gaccctgcca ccggcgtcct 900ccacaaggcc
tgcctgaagc ccatcggcgc cacgtacacc aaccgcactg tgaacaccga
960caaggcggag gtgaccgacg tcagcattga gccggcctcc cccgaagaga
tcgcggacac 1020ggtgaaggtg atgggcgggg aggactggga gctctggatc
caggcgctgt cggaggccgg 1080cgtgctggcg gagggggcca agacggtggc
gtactcctac atcggccccg agatgacgtg 1140gcctgtctac tggtccggca
ccatcgggga ggccaagaag gacgtggaga aggctgccaa 1200gcgcatcacg
cagcagtacg gctgcccggc gtacccggtg gtggccaagg ccttggtcac
1260ccaggccagc tccgccatcc cggtggtgcc gctctacatc tgcctgctgt
accgcgttat 1320gaaggagaag ggcacccacg agggctgcat cgagcagatg
gtgcggctgc tcaccacgaa 1380gctgtacccc gagaacgggg cccccatcgt
cgatgaggcc ggacgtgtgc gggtggatga 1440ctgggagatg gcggaggatg
tgcagcaggc tgttaaggac ctctggagcc aggtgagcac 1500tgccaacctc
aaggacatct ccgacttcgc tgggtatcaa actgagttcc tgcggctgtt
1560cgggttcggc attgacggcg tggactacga ccagcccgtg gacgtggagg
cggacctccc 1620cagtgctgcc cagcagtagg tgctggacgc cgcctctctc
cggggggtct gccaaaatgg 1680tcgctccccc aacccaaccc cctgcccacc
atcggggtcc cgcgggtgaa tgcggccccc 1740acccaaaggc aaaggtcaag
gccggggccc caccgccaaa gggtaacaca tatgtatccg 1800tcgggggctg
atccgcgtgc gacacgggcc ataattgtgc cccacgggat gtccatgcgc
1860ctaagacaac tgccccggcc gacagtcgct accgccttga gttccccagg ca
1912147539PRTEuglena gracilis 147Met Ser Cys Pro Ala Ser Pro Ser
Ala Ala Val Val Ser Ala Gly Ala 1 5 10 15 Leu Cys Leu Cys Val Ala
Thr Val Leu Leu Ala Thr Gly Ser Asn Pro 20 25 30 Thr Ala Leu Ser
Thr Ala Ser Thr Arg Ser Pro Thr Ser Leu Val Arg 35 40 45 Gly Val
Asp Arg Gly Leu Met Arg Pro Thr Thr Ala Ala Ala Leu Thr 50 55 60
Thr Met Arg Glu Val Pro Gln Met Ala Glu Gly Phe Ser Gly Glu Ala 65
70 75 80 Thr Ser Ala Trp Ala Ala Ala Gly Pro Gln Trp Ala Ala Pro
Leu Val 85 90 95 Ala Ala Ala Ser Ser Ala Leu Ala Leu Trp Trp Trp
Ala Ala Arg Arg 100 105 110 Ser Val Arg Arg Pro Leu Ala Ala Leu Ala
Glu Leu Pro Thr Ala Val 115 120 125 Thr His Leu Ala Pro Pro Met Ala
Met Phe Thr Thr Thr Ala Lys Val 130 135 140 Ile Gln Pro Lys Ile Arg
Gly Phe Ile Cys Thr Thr Thr His Pro Ile 145 150 155 160 Gly Cys Glu
Lys Arg Val Gln Glu Glu Ile Ala Tyr Ala Arg Ala His 165 170 175 Pro
Pro Thr Ser Pro Gly Pro Lys Arg Val Leu Val Ile Gly Cys Ser 180 185
190 Thr Gly Tyr Gly Leu Ser Thr Arg Ile Thr Ala Ala Phe Gly Tyr Gln
195 200 205 Ala Ala Thr Leu Gly Val Phe Leu Ala Gly Pro Pro Thr Lys
Gly Arg 210 215 220 Pro Ala Ala Ala Gly Trp Tyr Asn Thr Val Ala Phe
Glu Lys Ala Ala 225 230 235 240 Leu Glu Ala Gly Leu Tyr Ala Arg Ser
Leu Asn Gly Asp Ala Phe Asp 245 250 255 Ser Thr Thr Lys Ala Arg Thr
Val Glu Ala Ile Lys Arg Asp Leu Gly 260 265 270 Thr Val Asp Leu Val
Val Tyr Ser Ile Ala Ala Pro Lys Arg Thr Asp 275 280 285 Pro Ala Thr
Gly Val Leu His Lys Ala Cys Leu Lys Pro Ile Gly Ala 290 295 300 Thr
Tyr Thr Asn Arg Thr Val Asn Thr Asp Lys Ala Glu Val Thr Asp 305 310
315 320 Val Ser Ile Glu Pro Ala Ser Pro Glu Glu Ile Ala Asp Thr Val
Lys 325 330 335 Val Met Gly Gly Glu Asp Trp Glu Leu Trp Ile Gln Ala
Leu Ser Glu 340 345 350 Ala Gly Val Leu Ala Glu Gly Ala Lys Thr Val
Ala Tyr Ser Tyr Ile 355 360 365 Gly Pro Glu Met Thr Trp Pro Val Tyr
Trp Ser Gly Thr Ile Gly Glu 370 375 380 Ala Lys Lys Asp Val Glu Lys
Ala Ala Lys Arg Ile Thr Gln Gln Tyr 385 390 395 400 Gly Cys Pro Ala
Tyr Pro Val Val Ala Lys Ala Leu Val Thr Gln Ala 405 410 415 Ser Ser
Ala Ile Pro Val Val Pro Leu Tyr Ile Cys Leu Leu Tyr Arg 420 425 430
Val Met Lys Glu Lys Gly Thr His Glu Gly Cys Ile Glu Gln Met Val 435
440 445 Arg Leu Leu Thr Thr Lys Leu Tyr Pro Glu Asn Gly Ala Pro Ile
Val 450 455 460 Asp Glu Ala Gly Arg Val Arg Val Asp Asp Trp Glu Met
Ala Glu Asp 465 470 475 480 Val Gln Gln Ala Val Lys Asp Leu Trp Ser
Gln Val Ser Thr Ala Asn 485 490 495 Leu Lys Asp Ile Ser Asp Phe Ala
Gly Tyr Gln Thr Glu Phe Leu Arg 500 505 510 Leu Phe Gly Phe Gly Ile
Asp Gly Val Asp Tyr Asp Gln Pro Val Asp 515 520 525 Val Glu Ala Asp
Leu Pro Ser Ala Ala Gln Gln 530 535 1481344DNASreptomyces collinus
148gtgaccgtga aggacatcct ggacgcgatc cagtcgaagg acgccacgtc
cgccgacttc 60gccgccctgc agctccccga gtcgtaccgt gcgatcaccg tgcacaagga
cgagacggag 120atgttcgcgg gtctggagac ccgcgacaag gacccgcgca
agtcgatcca cctcgacgag 180gtgcccgtgc ccgaactggg cccgggcgaa
gccctggtgg ccgtcatggc ctcctcggtc 240aactacaact cggtgtggac
ctcgatcttc gagccggtgt cgacgttcgc cttcctggag 300cgctacggca
agctgtcgcc gctgaccaag cgccacgacc tgccgtacca catcatcggc
360tccgacctcg cgggcgtcgt cctgcgcacc ggccccggcg tcaacgcctg
gcagcccggt 420gacgaggtcg tcgcgcactg cctgagcgtc gagctggagt
cgcccgacgg ccacgacgac 480accatgctcg accccgagca gcgcatctgg
ggcttcgaga ccaacttcgg cggcctcgcg 540gagatcgcgc tggtcaagac
gaaccagctg atgccgaagc cgaagcacct cacctgggag 600gaggccgcgg
ccccgggcct ggtgaactcc accgcctacc gccagctggt ctcccgcaac
660ggcgccgcca tgaagcaggg cgacaacgtc ctgatctggg gcgcgagcgg
cgggctcggc 720tcgtacgcca cgcagttcgc gctcgcgggc ggtgccaacc
cgatctgtgt cgtctcctcg 780ccccagaagg cggagatctg ccgctcgatg
ggcgccgagg cgatcatcga ccgcaacgcc 840gagggctaca agttctggaa
ggacgagcac acccaggacc ccaaggagtg gaagcgcttc 900ggcaagcgca
tccgcgagct gaccggcggc gaggacatcg acatcgtctt cgagcacccc
960ggccgcgaga ccttcggcgc ctccgtctac gtcacccgca agggcggcac
catcaccacc 1020tgcgcctcga cctcgggcta catgcacgag tacgacaacc
ggtacctgtg gatgtccctg 1080aagcggatca tcggctcgca cttcgccaac
taccgcgagg cgtacgaggc caaccgcctg 1140atcgccaagg gcaagatcca
cccgacgctg tcgaagacgt actccctgga ggagaccggc 1200caggcggcgt
acgacgtcca ccgcaacctg caccagggca aggtcggcgt cctgtgcctc
1260gcgccggagg aaggcctcgg cgtgcgcgac gcggagatgc gcgcccagca
catcgacgcc 1320atcaaccgct tccgcaacgt ctga 1344149447PRTStreptomyces
collinus 149Met Thr Val Lys Asp Ile Leu Asp Ala Ile Gln Ser Lys Asp
Ala Thr 1 5 10 15 Ser Ala Asp Phe Ala Ala Leu Gln Leu Pro Glu Ser
Tyr Arg Ala Ile 20 25 30 Thr Val His Lys Asp Glu Thr Glu Met Phe
Ala Gly Leu Glu Thr Arg 35 40 45 Asp Lys Asp Pro Arg Lys Ser Ile
His Leu Asp Glu Val Pro Val Pro 50 55 60 Glu Leu Gly Pro Gly Glu
Ala Leu Val Ala Val Met Ala Ser Ser Val 65 70 75 80 Asn Tyr Asn Ser
Val Trp Thr Ser Ile Phe Glu Pro Val Ser Thr Phe 85 90 95 Ala Phe
Leu Glu Arg Tyr Gly Lys Leu Ser Pro Leu Thr Lys Arg His 100 105 110
Asp Leu Pro Tyr His Ile Ile Gly Ser Asp Leu Ala Gly Val Val Leu 115
120 125 Arg Thr Gly Pro Gly Val Asn Ala Trp Gln Pro Gly Asp Glu Val
Val 130 135 140 Ala His Cys Leu Ser Val Glu Leu Glu Ser Pro Asp Gly
His Asp Asp 145 150 155 160 Thr Met Leu Asp Pro Glu Gln Arg Ile Trp
Gly Phe Glu Thr Asn Phe 165 170 175 Gly Gly Leu Ala Glu Ile Ala Leu
Val Lys Thr Asn Gln Leu Met Pro 180 185 190 Lys Pro Lys His Leu Thr
Trp Glu Glu Ala Ala Ala Pro Gly Leu Val 195 200 205 Asn Ser Thr Ala
Tyr Arg Gln Leu Val Ser Arg Asn Gly Ala Ala Met 210 215 220 Lys Gln
Gly Asp Asn Val Leu Ile Trp Gly Ala Ser Gly Gly Leu Gly 225 230 235
240 Ser Tyr Ala Thr Gln Phe Ala Leu Ala Gly Gly Ala Asn Pro Ile Cys
245 250 255 Val Val Ser Ser Pro Gln Lys Ala Glu Ile Cys Arg Ser Met
Gly Ala 260 265 270 Glu Ala Ile Ile Asp Arg Asn Ala Glu Gly Tyr Lys
Phe Trp Lys Asp 275 280 285 Glu His Thr Gln Asp Pro Lys Glu Trp Lys
Arg Phe Gly Lys Arg Ile 290 295 300 Arg Glu Leu Thr Gly Gly Glu Asp
Ile Asp Ile Val Phe Glu His Pro 305 310 315 320 Gly Arg Glu Thr Phe
Gly Ala Ser Val Tyr Val Thr Arg Lys Gly Gly 325 330 335 Thr Ile Thr
Thr Cys Ala Ser Thr Ser Gly Tyr Met His Glu Tyr Asp 340 345 350 Asn
Arg Tyr Leu Trp Met Ser Leu Lys Arg Ile Ile Gly Ser His Phe 355 360
365 Ala Asn Tyr Arg Glu Ala Tyr Glu Ala Asn Arg Leu Ile Ala Lys Gly
370 375 380 Lys Ile His Pro Thr Leu Ser Lys Thr Tyr Ser Leu Glu Glu
Thr Gly 385 390 395 400 Gln Ala Ala Tyr Asp Val His Arg Asn Leu His
Gln Gly Lys Val Gly 405 410 415 Val Leu Cys Leu Ala Pro Glu Glu Gly
Leu Gly Val Arg Asp Ala Glu 420 425 430 Met Arg Ala Gln His Ile Asp
Ala Ile Asn Arg Phe Arg Asn Val 435 440 445 1501344DNAStreptomyces
coelicolor 150gtgaccgtga aggacatcct ggacgcgatc cagtcgcccg
actccacgcc ggccgacatc 60gccgcactgc cgctccccga gtcgtaccgc gcgatcaccg
tgcacaagga cgagaccgag 120atgttcgcgg gcctcgagac ccgcgacaag
gacccccgca agtcgatcca cctggacgac 180gtgccggtgc ccgagctggg
ccccggcgag gccctggtgg ccgtcatggc ctcctcggtc 240aactacaact
cggtgtggac ctcgatcttc gagccgctgt ccaccttcgg gttcctggag
300cgctacggcc gggtcagcga cctcgccaag cggcacgacc tgccgtacca
cgtcatcggc 360tccgacctcg ccggtgtcgt cctgcgcacc ggtccgggcg
tcaacgcctg gcaggcgggc 420gacgaggtcg tcgcgcactg cctctccgtc
gagctggagt cctccgacgg ccacaacgac 480acgatgctcg accccgagca
gcgcatctgg ggcttcgaga ccaacttcgg cggcctcgcg 540gagatcgcgc
tggtcaagtc caaccagctg atgccgaagc cggaccacct gagctgggag
600gaggccgccg ctcccggcct ggtcaactcc accgcgtacc gccagctcgt
ctcccgcaac 660ggcgccggca tgaagcaggg cgacaacgtg ctcatctggg
gcgcgagcgg cggactcggc 720tcgtacgcca cccagttcgc cctcgccggc
ggcgccaacc cgatctgcgt cgtctcctcg 780ccgcagaagg cggagatctg
ccgcgcgatg ggcgccgagg cgatcatcga ccgcaacgcc 840gagggctacc
ggttctggaa ggacgagaac acccaggacc cgaaggagtg gaagcgcttc
900ggcaagcgca tccgcgaact gaccggcggc gaggacatcg acatcgtctt
cgagcacccc 960ggccgcgaga ccttcggcgc ctccgtcttc gtcacccgca
agggcggcac catcaccacc 1020tgcgcctcga cctcgggcta catgcacgag
tacgacaacc gctacctgtg gatgtccctg 1080aagcgcatca tcggctcgca
cttcgccaac taccgcgagg cctgggaggc caaccgcctc 1140atcgccaagg
gcaggatcca ccccacgctc tccaaggtgt actccctcga ggacaccggc
1200caggccgcct acgacgtcca ccgcaacctc caccagggca aggtcggcgt
gctgtgcctg 1260gcgcccgagg agggcctggg cgtgcgcgac cgggagaagc
gcgcgcagca cctcgacgcc 1320atcaaccgct tccggaacat ctga
1344151447PRTStreptomyces coelicolor 151Met Thr Val Lys Asp Ile Leu
Asp Ala Ile Gln Ser Pro Asp Ser Thr 1 5 10 15 Pro Ala Asp Ile Ala
Ala Leu Pro Leu Pro Glu Ser Tyr Arg Ala Ile 20 25 30 Thr Val His
Lys Asp Glu Thr Glu Met Phe Ala Gly Leu Glu Thr Arg 35 40 45 Asp
Lys Asp Pro Arg Lys Ser Ile His Leu Asp Asp Val Pro Val Pro 50 55
60 Glu Leu Gly Pro Gly Glu Ala Leu Val Ala Val Met Ala Ser Ser Val
65 70 75 80 Asn Tyr Asn Ser Val Trp Thr Ser Ile Phe Glu Pro Leu Ser
Thr Phe 85 90 95 Gly Phe Leu Glu Arg Tyr Gly Arg Val Ser Asp Leu
Ala Lys Arg His 100 105 110 Asp Leu Pro Tyr His Val Ile Gly Ser Asp
Leu Ala Gly Val Val Leu 115 120 125 Arg Thr Gly Pro Gly Val Asn Ala
Trp Gln Ala Gly Asp Glu Val Val 130 135 140 Ala His Cys Leu Ser Val
Glu Leu Glu Ser Ser Asp Gly His Asn Asp 145 150 155 160 Thr Met Leu
Asp Pro Glu Gln Arg Ile Trp Gly Phe Glu Thr Asn Phe 165 170 175 Gly
Gly Leu Ala Glu Ile Ala Leu Val Lys Ser Asn Gln Leu Met Pro 180 185
190 Lys Pro Asp His Leu Ser Trp Glu Glu Ala Ala Ala Pro Gly Leu Val
195 200 205 Asn Ser Thr Ala Tyr Arg Gln Leu Val Ser Arg Asn Gly Ala
Gly Met 210 215 220 Lys Gln Gly Asp Asn Val Leu Ile Trp Gly Ala Ser
Gly Gly Leu Gly 225 230 235 240 Ser Tyr Ala Thr Gln Phe Ala Leu Ala
Gly Gly Ala Asn Pro Ile Cys 245 250 255 Val Val Ser Ser Pro Gln Lys
Ala Glu Ile Cys Arg Ala Met Gly Ala 260 265 270 Glu Ala Ile Ile Asp
Arg Asn Ala Glu Gly Tyr Arg Phe Trp Lys Asp 275 280 285 Glu Asn Thr
Gln Asp Pro Lys Glu Trp Lys Arg Phe Gly Lys Arg Ile 290 295 300 Arg
Glu Leu Thr Gly Gly Glu Asp Ile Asp Ile Val Phe Glu His Pro 305 310
315 320 Gly Arg Glu Thr Phe Gly Ala Ser Val Phe Val Thr Arg Lys Gly
Gly 325 330 335 Thr Ile Thr Thr Cys Ala Ser Thr Ser Gly Tyr Met His
Glu Tyr Asp 340 345 350 Asn Arg Tyr Leu Trp Met Ser Leu Lys Arg Ile
Ile Gly Ser His Phe 355 360 365 Ala Asn Tyr Arg Glu Ala Trp Glu Ala
Asn Arg Leu Ile Ala Lys Gly 370 375 380 Arg Ile His Pro Thr Leu Ser
Lys Val Tyr Ser Leu Glu Asp Thr Gly 385 390 395 400 Gln Ala Ala Tyr
Asp Val His Arg Asn Leu His Gln Gly Lys Val Gly 405 410 415 Val Leu
Cys Leu Ala Pro Glu Glu Gly Leu Gly Val Arg Asp Arg Glu 420 425 430
Lys Arg Ala Gln His Leu Asp Ala Ile Asn Arg Phe Arg Asn Ile 435
440 445 1522589DNAClostridium acetobutylicum 152atgaaagtca
caacagtaaa ggaattagat gaaaaactca aggtaattaa agaagctcaa 60aaaaaattct
cttgttactc gcaagaaatg gttgatgaaa tctttagaaa tgcagcaatg
120gcagcaatcg acgcaaggat agagctagca aaagcagctg ttttggaaac
cggtatgggc 180ttagttgaag acaaggttat aaaaaatcat tttgcaggcg
aatacatcta taacaaatat 240aaggatgaaa aaacctgcgg tataattgaa
cgaaatgaac cctacggaat tacaaaaata 300gcagaaccta taggagttgt
agctgctata atccctgtaa caaaccccac atcaacaaca 360atatttaaat
ccttaatatc ccttaaaact agaaatggaa ttttcttttc gcctcaccca
420agggcaaaaa aatccacaat actagcagct aaaacaatac ttgatgcagc
cgttaagagt 480ggtgccccgg aaaatataat aggttggata gatgaacctt
caattgaact aactcaatat 540ttaatgcaaa aagcagatat aacccttgca
actggtggtc cctcactagt taaatctgct 600tattcttccg gaaaaccagc
aataggtgtt ggtccgggta acaccccagt aataattgat 660gaatctgctc
atataaaaat ggcagtaagt tcaattatat tatccaaaac ctatgataat
720ggtgttatat gtgcttctga acaatctgta atagtcttaa aatccatata
taacaaggta 780aaagatgagt tccaagaaag aggagcttat ataataaaga
aaaacgaatt ggataaagtc 840cgtgaagtga tttttaaaga tggatccgta
aaccctaaaa tagtcggaca gtcagcttat 900actatagcag ctatggctgg
cataaaagta cctaaaacca caagaatatt aataggagaa 960gttacctcct
taggtgaaga agaacctttt gcccacgaaa aactatctcc tgttttggct
1020atgtatgagg ctgacaattt tgatgatgct ttaaaaaaag cagtaactct
aataaactta 1080ggaggcctcg gccatacctc aggaatatat gcagatgaaa
taaaagcacg agataaaata 1140gatagattta gtagtgccat gaaaaccgta
agaacctttg taaatatccc aacctcacaa 1200ggtgcaagtg gagatctata
taattttaga ataccacctt ctttcacgct tggctgcgga 1260ttttggggag
gaaattctgt ttccgagaat gttggtccaa aacatctttt gaatattaaa
1320accgtagctg aaaggagaga aaacatgctt tggtttagag ttccacataa
agtatatttt 1380aagttcggtt gtcttcaatt tgctttaaaa gatttaaaag
atctaaagaa aaaaagagcc 1440tttatagtta ctgatagtga cccctataat
ttaaactatg ttgattcaat aataaaaata 1500cttgagcacc tagatattga
ttttaaagta tttaataagg ttggaagaga agctgatctt 1560aaaaccataa
aaaaagcaac tgaagaaatg tcctccttta tgccagacac tataatagct
1620ttaggtggta cccctgaaat gagctctgca aagctaatgt gggtactata
tgaacatcca 1680gaagtaaaat ttgaagatct tgcaataaaa tttatggaca
taagaaagag aatatatact 1740ttcccaaaac tcggtaaaaa ggctatgtta
gttgcaatta caacttctgc tggttccggt 1800tctgaggtta ctccttttgc
tttagtaact gacaataaca ctggaaataa gtacatgtta 1860gcagattatg
aaatgacacc aaatatggca attgtagatg cagaacttat gatgaaaatg
1920ccaaagggat taaccgctta ttcaggtata gatgcactag taaatagtat
agaagcatac 1980acatccgtat atgcttcaga atacacaaac ggactagcac
tagaggcaat acgattaata 2040tttaaatatt tgcctgaggc ttacaaaaac
ggaagaacca atgaaaaagc aagagagaaa 2100atggctcacg cttcaactat
ggcaggtatg gcatccgcta atgcatttct aggtctatgt 2160cattccatgg
caataaaatt aagttcagaa cacaatattc ctagtggcat tgccaatgca
2220ttactaatag aagaagtaat aaaatttaac gcagttgata atcctgtaaa
acaagcccct 2280tgcccacaat ataagtatcc aaacaccata tttagatatg
ctcgaattgc agattatata 2340aagcttggag gaaatactga tgaggaaaag
gtagatctct taattaacaa aatacatgaa 2400ctaaaaaaag ctttaaatat
accaacttca ataaaggatg caggtgtttt ggaggaaaac 2460ttctattcct
cccttgatag aatatctgaa cttgcactag atgatcaatg cacaggcgct
2520aatcctagat ttcctcttac aagtgagata aaagaaatgt atataaattg
ttttaaaaaa 2580caaccttaa 2589153862PRTClostridium acetobutylicum
153Met Lys Val Thr Thr Val Lys Glu Leu Asp Glu Lys Leu Lys Val Ile
1 5 10 15 Lys Glu Ala Gln Lys Lys Phe Ser Cys Tyr Ser Gln Glu Met
Val Asp 20 25 30 Glu Ile Phe Arg Asn Ala Ala Met Ala Ala Ile Asp
Ala Arg Ile Glu 35 40 45 Leu Ala Lys Ala Ala Val Leu Glu Thr Gly
Met Gly Leu Val Glu Asp 50 55 60 Lys Val Ile Lys Asn His Phe Ala
Gly Glu Tyr Ile Tyr Asn Lys Tyr 65 70 75 80 Lys Asp Glu Lys Thr Cys
Gly Ile Ile Glu Arg Asn Glu Pro Tyr Gly 85 90 95 Ile Thr Lys Ile
Ala Glu Pro Ile Gly Val Val Ala Ala Ile Ile Pro 100 105 110 Val Thr
Asn Pro Thr Ser Thr Thr Ile Phe Lys Ser Leu Ile Ser Leu 115 120 125
Lys Thr Arg Asn Gly Ile Phe Phe Ser Pro His Pro Arg Ala Lys Lys 130
135 140 Ser Thr Ile Leu Ala Ala Lys Thr Ile Leu Asp Ala Ala Val Lys
Ser 145 150 155 160 Gly Ala Pro Glu Asn Ile Ile Gly Trp Ile Asp Glu
Pro Ser Ile Glu 165 170 175 Leu Thr Gln Tyr Leu Met Gln Lys Ala Asp
Ile Thr Leu Ala Thr Gly 180 185 190 Gly Pro Ser Leu Val Lys Ser Ala
Tyr Ser Ser Gly Lys Pro Ala Ile 195 200 205 Gly Val Gly Pro Gly Asn
Thr Pro Val Ile Ile Asp Glu Ser Ala His 210 215 220 Ile Lys Met Ala
Val Ser Ser Ile Ile Leu Ser Lys Thr Tyr Asp Asn 225 230 235 240 Gly
Val Ile Cys Ala Ser Glu Gln Ser Val Ile Val Leu Lys Ser Ile 245 250
255 Tyr Asn Lys Val Lys Asp Glu Phe Gln Glu Arg Gly Ala Tyr Ile Ile
260 265 270 Lys Lys Asn Glu Leu Asp Lys Val Arg Glu Val Ile Phe Lys
Asp Gly 275 280 285 Ser Val Asn Pro Lys Ile Val Gly Gln Ser Ala Tyr
Thr Ile Ala Ala 290 295 300 Met Ala Gly Ile Lys Val Pro Lys Thr Thr
Arg Ile Leu Ile Gly Glu 305 310 315 320 Val Thr Ser Leu Gly Glu Glu
Glu Pro Phe Ala His Glu Lys Leu Ser 325 330 335 Pro Val Leu Ala Met
Tyr Glu Ala Asp Asn Phe Asp Asp Ala Leu Lys 340 345 350 Lys Ala Val
Thr Leu Ile Asn Leu Gly Gly Leu Gly His Thr Ser Gly 355 360 365 Ile
Tyr Ala Asp Glu Ile Lys Ala Arg Asp Lys Ile Asp Arg Phe Ser 370 375
380 Ser Ala Met Lys Thr Val Arg Thr Phe Val Asn Ile Pro Thr Ser Gln
385 390 395 400 Gly Ala Ser Gly Asp Leu Tyr Asn Phe Arg Ile Pro Pro
Ser Phe Thr 405 410 415 Leu Gly Cys Gly Phe Trp Gly Gly Asn Ser Val
Ser Glu Asn Val Gly 420 425 430 Pro Lys His Leu Leu Asn Ile Lys Thr
Val Ala Glu Arg Arg Glu Asn 435 440 445 Met Leu Trp Phe Arg Val Pro
His Lys Val Tyr Phe Lys Phe Gly Cys 450 455 460 Leu Gln Phe Ala Leu
Lys Asp Leu Lys Asp Leu Lys Lys Lys Arg Ala 465 470 475 480 Phe Ile
Val Thr Asp Ser Asp Pro Tyr Asn Leu Asn Tyr Val Asp Ser 485 490 495
Ile Ile Lys Ile Leu Glu His Leu Asp Ile Asp Phe Lys Val Phe Asn 500
505 510 Lys Val Gly Arg Glu Ala Asp Leu Lys Thr Ile Lys Lys Ala Thr
Glu 515 520 525 Glu Met Ser Ser Phe Met Pro Asp Thr Ile Ile Ala Leu
Gly Gly Thr 530 535 540 Pro Glu Met Ser Ser Ala Lys Leu Met Trp Val
Leu Tyr Glu His Pro 545 550 555 560 Glu Val Lys Phe Glu Asp Leu Ala
Ile Lys Phe Met Asp Ile Arg Lys 565 570 575 Arg Ile Tyr Thr Phe Pro
Lys Leu Gly Lys Lys Ala Met Leu Val Ala 580 585 590 Ile Thr Thr Ser
Ala Gly Ser Gly Ser Glu Val Thr Pro Phe Ala Leu 595 600 605 Val Thr
Asp Asn Asn Thr Gly Asn Lys Tyr Met Leu Ala Asp Tyr Glu 610 615 620
Met Thr Pro Asn Met Ala Ile Val Asp Ala Glu Leu Met Met Lys Met 625
630 635 640 Pro Lys Gly Leu Thr Ala Tyr Ser Gly Ile Asp Ala Leu Val
Asn Ser 645 650 655 Ile Glu Ala Tyr Thr Ser Val Tyr Ala Ser Glu Tyr
Thr Asn Gly Leu 660 665 670 Ala Leu Glu Ala Ile Arg Leu Ile Phe Lys
Tyr Leu Pro Glu Ala Tyr 675 680 685 Lys Asn Gly Arg Thr Asn Glu Lys
Ala Arg Glu Lys Met Ala His Ala 690 695 700 Ser Thr Met Ala Gly Met
Ala Ser Ala Asn Ala Phe Leu Gly Leu Cys 705 710 715 720 His Ser Met
Ala Ile Lys Leu Ser Ser Glu His Asn Ile Pro Ser Gly 725 730 735 Ile
Ala Asn Ala Leu Leu Ile Glu Glu Val Ile Lys Phe Asn Ala Val 740 745
750 Asp Asn Pro Val Lys Gln Ala Pro Cys Pro Gln Tyr Lys Tyr Pro Asn
755 760 765 Thr Ile Phe Arg Tyr Ala Arg Ile Ala Asp Tyr Ile Lys Leu
Gly Gly 770 775 780 Asn Thr Asp Glu Glu Lys Val Asp Leu Leu Ile Asn
Lys Ile His Glu 785 790 795 800 Leu Lys Lys Ala Leu Asn Ile Pro Thr
Ser Ile Lys Asp Ala Gly Val 805 810 815 Leu Glu Glu Asn Phe Tyr Ser
Ser Leu Asp Arg Ile Ser Glu Leu Ala 820 825 830 Leu Asp Asp Gln Cys
Thr Gly Ala Asn Pro Arg Phe Pro Leu Thr Ser 835 840 845 Glu Ile Lys
Glu Met Tyr Ile Asn Cys Phe Lys Lys Gln Pro 850 855 860
1541164DNAEscherichia coli 154atgaacaact ttaatctgca caccccaacc
cgcattctgt ttggtaaagg cgcaatcgct 60ggtttacgcg aacaaattcc tcacgatgct
cgcgtattga ttacctacgg cggcggcagc 120gtgaaaaaaa ccggcgttct
cgatcaagtt ctggatgccc tgaaaggcat ggacgtgctg 180gaatttggcg
gtattgagcc aaacccggct tatgaaacgc tgatgaacgc cgtgaaactg
240gttcgcgaac agaaagtgac tttcctgctg gcggttggcg gcggttctgt
actggacggc 300accaaattta tcgccgcagc ggctaactat ccggaaaata
tcgatccgtg gcacattctg 360caaacgggcg gtaaagagat taaaagcgcc
atcccgatgg gctgtgtgct gacgctgcca 420gcaaccggtt cagaatccaa
cgcaggcgcg gtgatctccc gtaaaaccac aggcgacaag 480caggcgttcc
attctgccca tgttcagccg gtatttgccg tgctcgatcc ggtttatacc
540tacaccctgc cgccgcgtca ggtggctaac ggcgtagtgg acgcctttgt
acacaccgtg 600gaacagtatg ttaccaaacc ggttgatgcc aaaattcagg
accgtttcgc agaaggcatt 660ttgctgacgc taatcgaaga tggtccgaaa
gccctgaaag agccagaaaa ctacgatgtg 720cgcgccaacg tcatgtgggc
ggcgactcag gcgctgaacg gtttgattgg cgctggcgta 780ccgcaggact
gggcaacgca tatgctgggc cacgaactga ctgcgatgca cggtctggat
840cacgcgcaaa cactggctat cgtcctgcct gcactgtgga atgaaaaacg
cgataccaag 900cgcgctaagc tgctgcaata tgctgaacgc gtctggaaca
tcactgaagg ttccgatgat 960gagcgtattg acgccgcgat tgccgcaacc
cgcaatttct ttgagcaatt aggcgtgccg 1020acccacctct ccgactacgg
tctggacggc agctccatcc cggctttgct gaaaaaactg 1080gaagagcacg
gcatgaccca actgggcgaa aatcatgaca ttacgttgga tgtcagccgc
1140cgtatatacg aagccgcccg ctaa 1164155387PRTEscherichia coli 155Met
Asn Asn Phe Asn Leu His Thr Pro Thr Arg Ile Leu Phe Gly Lys 1 5 10
15 Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val
20 25 30 Leu Ile Thr Tyr Gly Gly Gly Ser Val Lys Lys Thr Gly Val
Leu Asp 35 40 45 Gln Val Leu Asp Ala Leu Lys Gly Met Asp Val Leu
Glu Phe Gly Gly 50 55 60 Ile Glu Pro Asn Pro Ala Tyr Glu Thr Leu
Met Asn Ala Val Lys Leu 65 70 75 80 Val Arg Glu Gln Lys Val Thr Phe
Leu Leu Ala Val Gly Gly Gly Ser 85 90 95 Val Leu Asp Gly Thr Lys
Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu 100 105 110 Asn Ile Asp Pro
Trp His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115 120 125 Ser Ala
Ile Pro Met Gly Cys Val Leu Thr Leu Pro Ala Thr Gly Ser 130 135 140
Glu Ser Asn Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys 145
150 155 160 Gln Ala Phe His Ser Ala His Val Gln Pro Val Phe Ala Val
Leu Asp 165 170 175 Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val
Ala Asn Gly Val 180 185 190 Val Asp Ala Phe Val His Thr Val Glu Gln
Tyr Val Thr Lys Pro Val 195 200 205 Asp Ala Lys Ile Gln Asp Arg Phe
Ala Glu Gly Ile Leu Leu Thr Leu 210 215 220 Ile Glu Asp Gly Pro Lys
Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val 225 230 235 240 Arg Ala Asn
Val Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245 250 255 Gly
Ala Gly Val Pro Gln Asp Trp Ala Thr His Met Leu Gly His Glu 260 265
270 Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val
275 280 285 Leu Pro Ala Leu Trp Asn Glu Lys Arg Asp Thr Lys Arg Ala
Lys Leu 290 295 300 Leu Gln Tyr Ala Glu Arg Val Trp Asn Ile Thr Glu
Gly Ser Asp Asp 305 310 315 320 Glu Arg Ile Asp Ala Ala Ile Ala Ala
Thr Arg Asn Phe Phe Glu Gln 325 330 335 Leu Gly Val Pro Thr His Leu
Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345 350 Ile Pro Ala Leu Leu
Lys Lys Leu Glu Glu His Gly Met Thr Gln Leu 355 360 365 Gly Glu Asn
His Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370 375 380 Ala
Ala Arg 385 1563883DNAEscherichia coli 156ctatattgct gaaggtacag
gcgtttccat aactatttgc tcgcgttttt tactcaagaa 60gaaaatgcca aatagcaaca
tcaggcagac aatacccgaa attgcgaaga aaactgtctg 120gtagcctgcg
tggtcaaaga gtatcccagt cggcgttgaa agcagcacaa tcccaagcga
180actggcaatt tgaaaaccaa tcagaaagat cgtcgacgac aggcgcttat
caaagtttgc 240cacgctgtat ttgaagacgg atatgacaca aagtggaacc
tcaatggcat gtaacaactt 300cactaatgaa ataatccagg ggttaacgaa
cagcgcgcag gaaaggatac gcaacgccat 360aatcacaact ccgataagta
atgcattttt tggccctacc cgattcacaa agaaaggaat 420aatcgccatg
cacagcgctt cgagtaccac ctggaatgag ttgagataac catacaggcg
480cgttcctaca tcgtgtgatt cgaataaacc tgaataaaag acaggaaaaa
gttgttgatc 540aaaaatgtta tagaaagacc acgtccccac aataaatatg
acgaaaaccc agaagtttcg 600atccttgaaa actgcgataa aatcctcttt
ttttacccct cccgcatctg ccgctacgca 660ctggtgatcc ttatctttaa
aacgcatgtt gatcatcata aatacagcgc caaatagcga 720gaccaaccag
aagttgatat ggggactgat actaaaaaat atgccggcaa agaacgcgcc
780aatagcatag ccaaaagatc cccaggcgcg cgctgttcca tattcgaaat
gaaaatttcg 840cgccattttt tcggtgaagc tatcaagcaa accgcatccc
gccagatacc ccaagccaaa 900aaatagcgcc cccagaatta gacctacaga
aaaattgctt tgcagtaacg gttcataaac 960gtaaatcata aacggtccgg
tcaagaccag gatgaaactc atacaccaga tgagcggttt 1020cttcagaccg
agtttatcct gaacgatgcc gtagaacatc ataaatagaa tgctggtaaa
1080ctggttgacc gaataaagtg tacctaattc cgtccctgtc aaccctagat
gtcctttcag 1140ccaaatagcg tataacgacc accacagcga ccaggaaata
aaaaagagaa atgagtaact 1200ggatgcaaaa cgatagtacg catttctgaa
tggaatattc agtgccataa ttacctgcct 1260gtcgttaaaa aattcacgtc
ctatttagag ataagagcga cttcgccgtt tacttctcac 1320tattccagtt
cttgtcgaca tggcagcgct gtcattgccc ctttcgccgt tactgcaagc
1380gctccgcaac gttgagcgag atcgataatt cgtcgcattt ctctctcatc
tgtagataat 1440cccgtagagg acagacctgt gagtaacccg gcaacgaacg
catctcccgc ccccgtgcta 1500tcgacacaat tcacagacat tccagcaaaa
tggtgaactt gtcctcgata acagaccacc 1560accccttctg cacctttagt
caccaacagc atggcgatct catactcttt tgccagggcg 1620catatatcct
gatcgttctg tgtttttcca ctgataagtc gccattcttc ttccgagagc
1680ttgacgacat ccgccagttg tagcgcctgc cgcaaacaca agcggagcaa
atgctcgtct 1740tgccatagat cttcacgaat attaggatcg aagctgacaa
aacctccggc atgccggatc 1800gccgtcatcg cagtaaatgc gctggtacgc
gaaggctcgg cagacaacgc aattgaacag 1860agatgtaacc attcgccatg
tcgccagcag ggcaagtctg tcgtctctaa aaaaagatcg 1920gcactggggc
ggaccataaa cgtaaatgaa cgttcccctt gatcgttcag atcgacaagc
1980accgtggatg tccggtgcca ttcatcttgc ttcagatacg tgatatcgac
tccctcagtt 2040agcagcgttc tttgcattaa cgcaccaaaa ggatcatccc
ccacccgacc tataaaccca 2100cttgttccgc ctaatctggc gattcccacc
gcaacgttag ctggcgcgcc gccaggacaa 2160ggcagtaggc gcccgtctga
ttctggcaag agatctacga ccgcatcccc taaaacccat 2220actttggctg
acattttttt cccttaaatt catctgagtt acgcatagtg ataaacctct
2280ttttcgcaaa atcgtcatgg atttactaaa acatgcatat tcgatcacaa
aacgtcatag 2340ttaacgttaa catttgtgat attcatcgca tttatgaaag
taagggactt tatttttata 2400aaagttaacg ttaacaattc accaaatttg
cttaaccagg atgattaaaa tgacgcaatc 2460tcgattgcat gcggcgcaaa
acgccctagc aaaacttcat gagcaccggg gtaacacttt 2520ctatccccat
tttcacctcg cgcctcctgc cgggtggatg aacgatccaa acggcctgat
2580ctggtttaac gatcgttatc acgcgtttta tcaacatcat ccgatgagcg
aacactgggg 2640gccaatgcac tggggacatg ccaccagcga cgatatgatc
cactggcagc atgagcctat 2700tgcgctagcg ccaggagacg ataatgacaa
agacgggtgt ttttcaggta gtgctgtcga 2760tgacaatggt gtcctctcac
ttatctacac cggacacgtc tggctcgatg gtgcaggtaa 2820tgacgatgca
attcgcgaag tacaatgtct ggctaccagt cgggatggta ttcatttcga
2880gaaacagggt gtgatcctca ctccaccaga aggaatcatg cacttccgcg
atcctaaagt 2940gtggcgtgaa gccgacacat ggtggatggt agtcggggcg
aaagatccag gcaacacggg 3000gcagatcctg ctttatcgcg gcagttcgtt
gcgtgaatgg accttcgatc gcgtactggc 3060ccacgctgat gcgggtgaaa
gctatatgtg ggaatgtccg gactttttca gccttggcga 3120tcagcattat
ctgatgtttt ccccgcaggg aatgaatgcc gagggataca gttaccgaaa
3180tcgctttcaa agtggcgtaa tacccggaat gtggtcgcca ggacgacttt
ttgcacaatc 3240cgggcatttt actgaacttg ataacgggca tgacttttat
gcaccacaaa gctttttagc 3300gaaggatggt cggcgtattg ttatcggctg
gatggatatg tgggaatcgc caatgccctc 3360aaaacgtgaa ggatgggcag
gctgcatgac gctggcgcgc gagctatcag agagcaatgg 3420caaacttcta
caacgcccgg tacacgaagc tgagtcgtta cgccagcagc atcaatctgt
3480ctctccccgc acaatcagca ataaatatgt tttgcaggaa aacgcgcaag
cagttgagat 3540tcagttgcag tgggcgctga agaacagtga tgccgaacat
tacggattac agctcggcac 3600tggaatgcgg ctgtatattg ataaccaatc
tgagcgactt gttttgtggc ggtattaccc 3660acacgagaat ttagacggct
accgtagtat tcccctcccg cagcgtgaca cgctcgccct 3720aaggatattt
atcgatacat catccgtgga agtatttatt aacgacgggg aagcggtgat
3780gagtagtcga atctatccgc agccagaaga acgggaactg tcgctttatg
cctcccacgg 3840agtggctgtg ctgcaacatg gagcactctg gctactgggt taa
3883157477PRTEscherichia coli 157Met Thr Gln Ser Arg Leu His Ala
Ala Gln Asn Ala Leu Ala Lys Leu 1 5 10 15 His Glu His Arg Gly Asn
Thr Phe Tyr Pro His Phe His Leu Ala Pro 20 25 30 Pro Ala Gly Trp
Met Asn Asp Pro Asn Gly Leu Ile Trp Phe Asn Asp 35 40 45 Arg Tyr
His Ala Phe Tyr Gln His His Pro Met Ser Glu His Trp Gly 50 55 60
Pro Met His Trp Gly His Ala Thr Ser Asp Asp Met Ile His Trp Gln 65
70 75 80 His Glu Pro Ile Ala Leu Ala Pro Gly Asp Asp Asn Asp Lys
Asp Gly 85 90 95 Cys Phe Ser Gly Ser Ala Val Asp Asp Asn Gly Val
Leu Ser Leu Ile 100 105 110 Tyr Thr Gly His Val Trp Leu Asp Gly Ala
Gly Asn Asp Asp Ala Ile 115 120 125 Arg Glu Val Gln Cys Leu Ala Thr
Ser Arg Asp Gly Ile His Phe Glu 130 135 140 Lys Gln Gly Val Ile Leu
Thr Pro Pro Glu Gly Ile Met His Phe Arg 145 150 155 160 Asp Pro Lys
Val Trp Arg Glu Ala Asp Thr Trp Trp Met Val Val Gly 165 170 175 Ala
Lys Asp Pro Gly Asn Thr Gly Gln Ile Leu Leu Tyr Arg Gly Ser 180 185
190 Ser Leu Arg Glu Trp Thr Phe Asp Arg Val Leu Ala His Ala Asp Ala
195 200 205 Gly Glu Ser Tyr Met Trp Glu Cys Pro Asp Phe Phe Ser Leu
Gly Asp 210 215 220 Gln His Tyr Leu Met Phe Ser Pro Gln Gly Met Asn
Ala Glu Gly Tyr 225 230 235 240 Ser Tyr Arg Asn Arg Phe Gln Ser Gly
Val Ile Pro Gly Met Trp Ser 245 250 255 Pro Gly Arg Leu Phe Ala Gln
Ser Gly His Phe Thr Glu Leu Asp Asn 260 265 270 Gly His Asp Phe Tyr
Ala Pro Gln Ser Phe Leu Ala Lys Asp Gly Arg 275 280 285 Arg Ile Val
Ile Gly Trp Met Asp Met Trp Glu Ser Pro Met Pro Ser 290 295 300 Lys
Arg Glu Gly Trp Ala Gly Cys Met Thr Leu Ala Arg Glu Leu Ser 305 310
315 320 Glu Ser Asn Gly Lys Leu Leu Gln Arg Pro Val His Glu Ala Glu
Ser 325 330 335 Leu Arg Gln Gln His Gln Ser Val Ser Pro Arg Thr Ile
Ser Asn Lys 340 345 350 Tyr Val Leu Gln Glu Asn Ala Gln Ala Val Glu
Ile Gln Leu Gln Trp 355 360 365 Ala Leu Lys Asn Ser Asp Ala Glu His
Tyr Gly Leu Gln Leu Gly Thr 370 375 380 Gly Met Arg Leu Tyr Ile Asp
Asn Gln Ser Glu Arg Leu Val Leu Trp 385 390 395 400 Arg Tyr Tyr Pro
His Glu Asn Leu Asp Gly Tyr Arg Ser Ile Pro Leu 405 410 415 Pro Gln
Arg Asp Thr Leu Ala Leu Arg Ile Phe Ile Asp Thr Ser Ser 420 425 430
Val Glu Val Phe Ile Asn Asp Gly Glu Ala Val Met Ser Ser Arg Ile 435
440 445 Tyr Pro Gln Pro Glu Glu Arg Glu Leu Ser Leu Tyr Ala Ser His
Gly 450 455 460 Val Ala Val Leu Gln His Gly Ala Leu Trp Leu Leu Gly
465 470 475 158304PRTEscherichia coli 158Met Ser Ala Lys Val Trp
Val Leu Gly Asp Ala Val Val Asp Leu Leu 1 5 10 15 Pro Glu Ser Asp
Gly Arg Leu Leu Pro Cys Pro Gly Gly Ala Pro Ala 20 25 30 Asn Val
Ala Val Gly Ile Ala Arg Leu Gly Gly Thr Ser Gly Phe Ile 35 40 45
Gly Arg Val Gly Asp Asp Pro Phe Gly Ala Leu Met Gln Arg Thr Leu 50
55 60 Leu Thr Glu Gly Val Asp Ile Thr Tyr Leu Lys Gln Asp Glu Trp
His 65 70 75 80 Arg Thr Ser Thr Val Leu Val Asp Leu Asn Asp Gln Gly
Glu Arg Ser 85 90 95 Phe Thr Phe Met Val Arg Pro Ser Ala Asp Leu
Phe Leu Glu Thr Thr 100 105 110 Asp Leu Pro Cys Trp Arg His Gly Glu
Trp Leu His Leu Cys Ser Ile 115 120 125 Ala Leu Ser Ala Glu Pro Ser
Arg Thr Ser Ala Phe Thr Ala Met Thr 130 135 140 Ala Ile Arg His Ala
Gly Gly Phe Val Ser Phe Asp Pro Asn Ile Arg 145 150 155 160 Glu Asp
Leu Trp Gln Asp Glu His Leu Leu Arg Leu Cys Leu Arg Gln 165 170 175
Ala Leu Gln Leu Ala Asp Val Val Lys Leu Ser Glu Glu Glu Trp Arg 180
185 190 Leu Ile Ser Gly Lys Thr Gln Asn Asp Gln Asp Ile Cys Ala Leu
Ala 195 200 205 Lys Glu Tyr Glu Ile Ala Met Leu Leu Val Thr Lys Gly
Ala Glu Gly 210 215 220 Val Val Val Cys Tyr Arg Gly Gln Val His His
Phe Ala Gly Met Ser 225 230 235 240 Val Asn Cys Val Asp Ser Thr Gly
Ala Gly Asp Ala Phe Val Ala Gly 245 250 255 Leu Leu Thr Gly Leu Ser
Ser Thr Gly Leu Ser Thr Asp Glu Arg Glu 260 265 270 Met Arg Arg Ile
Ile Asp Leu Ala Gln Arg Cys Gly Ala Leu Ala Val 275 280 285 Thr Ala
Lys Gly Ala Met Thr Ala Leu Pro Cys Arg Gln Glu Leu Glu 290 295 300
159415PRTEscherichia coli 159Met Ala Leu Asn Ile Pro Phe Arg Asn
Ala Tyr Tyr Arg Phe Ala Ser 1 5 10 15 Ser Tyr Ser Phe Leu Phe Phe
Ile Ser Trp Ser Leu Trp Trp Ser Leu 20 25 30 Tyr Ala Ile Trp Leu
Lys Gly His Leu Gly Leu Thr Gly Thr Glu Leu 35 40 45 Gly Thr Leu
Tyr Ser Val Asn Gln Phe Thr Ser Ile Leu Phe Met Met 50 55 60 Phe
Tyr Gly Ile Val Gln Asp Lys Leu Gly Leu Lys Lys Pro Leu Ile 65 70
75 80 Trp Cys Met Ser Phe Ile Leu Val Leu Thr Gly Pro Phe Met Ile
Tyr 85 90 95 Val Tyr Glu Pro Leu Leu Gln Ser Asn Phe Ser Val Gly
Leu Ile Leu 100 105 110 Gly Ala Leu Phe Phe Gly Leu Gly Tyr Leu Ala
Gly Cys Gly Leu Leu 115 120 125 Asp Ser Phe Thr Glu Lys Met Ala Arg
Asn Phe His Phe Glu Tyr Gly 130 135 140 Thr Ala Arg Ala Trp Gly Ser
Phe Gly Tyr Ala Ile Gly Ala Phe Phe 145 150 155 160 Ala Gly Ile Phe
Phe Ser Ile Ser Pro His Ile Asn Phe Trp Leu Val 165 170 175 Ser Leu
Phe Gly Ala Val Phe Met Met Ile Asn Met Arg Phe Lys Asp 180 185 190
Lys Asp His Gln Cys Val Ala Ala Asp Ala Gly Gly Val Lys Lys Glu 195
200 205 Asp Phe Ile Ala Val Phe Lys Asp Arg Asn Phe Trp Val Phe Val
Ile 210 215 220 Phe Ile Val Gly Thr Trp Ser Phe Tyr Asn Ile Phe Asp
Gln Gln Leu 225 230 235 240 Phe Pro Val Phe Tyr Ser Gly Leu Phe Glu
Ser His Asp Val Gly Thr 245 250 255 Arg Leu Tyr Gly Tyr Leu Asn Ser
Phe Gln Val Val Leu Glu Ala Leu 260 265 270 Cys Met Ala Ile Ile Pro
Phe Phe Val Asn Arg Val Gly Pro Lys Asn 275 280 285 Ala Leu Leu Ile
Gly Val Val Ile Met Ala Leu Arg Ile Leu Ser Cys 290 295 300 Ala Leu
Phe Val Asn Pro Trp Ile Ile Ser Leu Val Lys Leu Leu His 305 310 315
320 Ala Ile Glu Val Pro Leu Cys Val Ile Ser Val Phe Lys Tyr Ser Val
325 330 335 Ala Asn Phe Asp Lys Arg Leu Ser Ser Thr Ile Phe Leu Ile
Gly Phe 340 345 350 Gln Ile Ala Ser Ser Leu Gly Ile Val Leu Leu Ser
Thr Pro Thr Gly 355 360 365 Ile Leu Phe Asp His Ala Gly Tyr Gln Thr
Val Phe Phe Ala Ile Ser 370 375 380 Gly Ile Val Cys Leu Met Leu Leu
Phe Gly Ile Phe Phe Leu Ser Lys 385 390 395 400 Lys Arg Glu Gln Ile
Val Met Glu Thr Pro Val Pro Ser Ala Ile 405 410 415
16018DNAArtificial SequencePrimer Scr1 160cctttctttg tgaatcgg
1816118DNAArtificial SequencePrimer Scr2 161agaaacaggg tgtgatcc
1816220DNAArtificial SequencePrimer Scr3 162agtgatcatc acctgttgcc
2016320DNAArtificial SequencePrimer Scr4 163agcacggcga gagtcgacgg
2016474DNAArtificial SequencePrimer OT731 164aaagctggag ctccaccgcg
gtggcggccg ctctagaagt tttcaaagca gagtttcgtt 60tgaatatttt acca
7416550DNAArtificial SequencePrimer OT732 165ttcaatatgc atgcctcaga
acgtttacat tgtatcgact gccagaaccc 5016679DNAArtificial
SequencePrimer OT733 166gcagtcgata caatgtaaac gttctgaggc atgcatattg
aattttcaaa aattcttact 60ttttttttgg atggacgca 7916772DNAArtificial
SequencePrimer OT734 167acctgcacct ataacacata ccttttccat ggtagttttt
tctccttgac gttaaagtat 60agaggtatat ta 7216860DNAArtificial
SequencePrimer OT735 168aaaaactacc atggaaaagg tatgtgttat aggtgcaggt
actatgggtt caggaattgc 6016971DNAArtificial SequencePrimer OT736
169gtaaaaaaaa gaaggccgta taggccttat tttgaataat cgtagaaacc
ttttcctgat 60tttcttccaa g 7117081DNAArtificial SequencePrimer OT737
170acgattattc aaaataaggc ctatacggcc ttcttttttt tactttgttc
agaacaactt 60ctcatttttt tctactcata a 8117173DNAArtificial
SequencePrimer OT738 171gaattgggta ccgggccccc cctcgaggtc gaccgatgcc
tcataaactt cggtagttat 60attactctga gat 7317265DNAArtificial
SequencePrimer OT797 172aaagtaagaa tttttgaaaa ttcaatatgc atgcaagaag
ttgtaatagc tagtgcagta 60agaac 6517373DNAArtificial SequencePrimer
OT798 173gaaaaagatc atgagaaaat cgcagaacgt aaggcgcgcc tcagcacttt
tctagcaata 60ttgctgttcc ttg 7317441DNAArtificial SequencePrimer
OT806 174ctcgaaaata gggcgcgccc ccattaccga catttgggcg c
4117555DNAArtificial SequencePrimer OT807 175actgcactag ctattacaac
ttcttgcatg cgtgatgatt gattgattga ttgta 5517655DNAArtificial
SequencePrimer OT808 176actgcactag ctattacaac ttcttgcatg cgtgatgatt
gattgattga ttgta 5517760DNAArtificial SequencePrimer OT809
177tttcgaataa acacacataa acaaacaccc catggaaaag gtatgtgtta
taggtgcagg 6017862DNAArtificial SequencePrimer OT799 178taccgggccc
cccctcgagg tcgacggcgc gccactggta gagagcgact ttgtatgccc 60ca
6217960DNAArtificial SequencePrimer OT761 179cttggccttc actagcatgc
tgaatatgta ttacttggtt atggttatat atgacaaaag 6018068DNAArtificial
SequencePrimer OT803 180ccctcactaa agggaacaaa agctggagct cgatatcggc
gcgcccacat gcagtgatgc 60acgcgcga 6818149DNAArtificial
SequencePrimer OT804 181aaggatgaca ttgtttagtt ccatggttgt aatatgtgtg
tttgtttgg 4918251DNAArtificial SequencePrimer OT785 182cacacatatt
acaaccatgg aactaaacaa tgtcatcctt gaaaaggaag g 5118363DNAArtificial
SequencePrimer OT786 183atcattcatt ggccattcag gccttatcta tttttgaagc
cttcaatttt tcttttctct 60atg 6318465DNAArtificial SequencePrimer
OT787 184caaaaataga taaggcctga atggccaatg aatgatttga tgatttcttt
ttccctccat 60ttttc 6518577DNAArtificial SequencePrimer PT805
185gaattgggta ccgggccccc cctcgaggtc gacttatagt attatatttt
ctgatttggt 60tatagcaagc agcgttt 771861269DNAArtificial
SequenceCodon optimized ter 186actagtacca taaccaagta atacatattc
agcatgctag tgaaggccaa gttcgtcaag 60ggctttatta gagatgttca tccgtatggg
tgtaggagag aagtgttaaa ccagattgac 120tactgcaaga aagcaattgg
ctttaggggc cctaaaaagg ttcttattgt aggtgcttct 180tcaggcttcg
gactagctac tagaatatct gttgcattcg gagggcctga agcccataca
240atcggtgttt catacgagac tggagctaca gacagaagga taggtacggc
tgggtggtac 300aataatatct tctttaaaga attcgctaag aagaaaggtt
tggtggcaaa gaatttcata 360gaagatgcat tttcgaatga aaccaaggat
aaagtgataa agtatataaa ggacgaattt 420ggtaaaattg atttattcgt
atattcttta gctgctccta gaagaaagga ctacaaaacc 480ggtaatgttt
atacctcaag aattaaaaca attctaggtg actttgaagg gcctactatt
540gacgtagaaa gagatgaaat aactttaaag aaggtatctt ctgctagtat
cgaggaaatc 600gaagaaacac gtaaagtaat gggcggagaa gactggcagg
agtggtgtga ggagttatta 660tacgaagatt gtttttctga taaagctaca
accatcgctt attcctatat tggcagtcct 720agaacttata aaatatatcg
tgaaggaacc attgggattg ctaagaagga tttagaagac 780aaagccaagt
tgatcaacga aaagcttaat agagtcatag gaggtagggc atttgtgtct
840gttaacaaag ctttagtaac caaggcatct gcttatattc caaccttccc
tctatacgct 900gccatattat ataaagtaat gaaagaaaag aacattcacg
aaaattgtat tatgcaaatt 960gagcgtatgt tctcagagaa aatatactcc
aacgaaaaga ttcagttcga tgataagggc 1020cgtcttagaa tggacgattt
agaactaaga aaggatgttc aggatgaagt tgacagaatt 1080tggtctaaca
taacaccaga aaacttcaag gagcttagtg actacaaggg gtataagaaa
1140gagtttatga atctaaatgg ttttgattta gatggagttg attattccaa
ggatcttgat 1200attgaattac ttagaaaact agagccttaa gcggccgcgt
taattcaaat taattgatat 1260agtactagt 1269187398PRTArtificial
SequenceModified Ter protein 187Met Leu Val Lys Ala Lys Phe Val Lys
Gly Phe Ile Arg Asp Val His 1 5 10 15 Pro Tyr Gly Cys Arg Arg Glu
Val Leu Asn Gln Ile Asp Tyr Cys Lys 20 25 30 Lys Ala Ile Gly Phe
Arg Gly Pro Lys Lys Val Leu Ile Val Gly Ala 35 40 45 Ser Ser Gly
Phe Gly Leu Ala Thr Arg Ile Ser Val Ala Phe Gly Gly 50 55 60 Pro
Glu Ala His Thr Ile Gly Val Ser Tyr Glu Thr Gly Ala Thr Asp 65 70
75 80 Arg Arg Ile Gly Thr Ala Gly Trp Tyr Asn Asn Ile Phe Phe Lys
Glu 85 90 95 Phe Ala Lys Lys Lys Gly Leu Val Ala Lys Asn Phe Ile
Glu Asp Ala 100 105 110 Phe Ser Asn Glu Thr Lys Asp Lys Val Ile Lys
Tyr Ile Lys Asp Glu 115 120 125 Phe Gly Lys Ile Asp Leu Phe Val Tyr
Ser Leu Ala Ala Pro Arg Arg 130 135 140 Lys Asp Tyr Lys Thr Gly Asn
Val Tyr Thr Ser Arg Ile Lys Thr Ile 145 150 155 160 Leu Gly Asp Phe
Glu Gly Pro Thr Ile Asp Val Glu Arg Asp Glu Ile 165 170 175 Thr Leu
Lys Lys Val Ser Ser Ala Ser Ile Glu Glu Ile Glu Glu Thr 180 185 190
Arg Lys Val Met Gly Gly Glu Asp Trp Gln Glu Trp Cys Glu Glu Leu 195
200 205 Leu
Tyr Glu Asp Cys Phe Ser Asp Lys Ala Thr Thr Ile Ala Tyr Ser 210 215
220 Tyr Ile Gly Ser Pro Arg Thr Tyr Lys Ile Tyr Arg Glu Gly Thr Ile
225 230 235 240 Gly Ile Ala Lys Lys Asp Leu Glu Asp Lys Ala Lys Leu
Ile Asn Glu 245 250 255 Lys Leu Asn Arg Val Ile Gly Gly Arg Ala Phe
Val Ser Val Asn Lys 260 265 270 Ala Leu Val Thr Lys Ala Ser Ala Tyr
Ile Pro Thr Phe Pro Leu Tyr 275 280 285 Ala Ala Ile Leu Tyr Lys Val
Met Lys Glu Lys Asn Ile His Glu Asn 290 295 300 Cys Ile Met Gln Ile
Glu Arg Met Phe Ser Glu Lys Ile Tyr Ser Asn 305 310 315 320 Glu Lys
Ile Gln Phe Asp Asp Lys Gly Arg Leu Arg Met Asp Asp Leu 325 330 335
Glu Leu Arg Lys Asp Val Gln Asp Glu Val Asp Arg Ile Trp Ser Asn 340
345 350 Ile Thr Pro Glu Asn Phe Lys Glu Leu Ser Asp Tyr Lys Gly Tyr
Lys 355 360 365 Lys Glu Phe Met Asn Leu Asn Gly Phe Asp Leu Asp Gly
Val Asp Tyr 370 375 380 Ser Lys Asp Leu Asp Ile Glu Leu Leu Arg Lys
Leu Glu Pro 385 390 395 1881484DNAArtificial SequenceCodon
optimized ald 188actagttcga ataaacacac ataaacaaac accatggata
aagatacctt aatcccaacc 60accaaagact tgaaagtgaa gactaatggt gaaaacatca
acttaaagaa ttacaaagat 120aactcttcat gttttggagt atttgaaaat
gttgagaatg ccatttcttc tgcagtacat 180gcacaaaaga ttctttccct
acactacaca aaggaacaaa gagagaaaat aatcaccgaa 240ataagaaaag
ccgcattaca gaataaagag gtcttagcca caatgatcct ggaggaaacc
300cacatgggaa ggtatgagga taaaatcttg aaacatgaat tagtggccaa
gtatacccca 360ggcactgaag atctgacaac aacagcatgg tccggcgata
atggactaac agtggttgaa 420atgagtccat acggagttat cggcgctata
actccaagca cgaatccaac agaaaccgtt 480atctgcaatt ctataggtat
gatagctgcg gggaatgcag ttgtatttaa tggtcaccca 540tgcgccaaaa
agtgtgtcgc tttcgcagta gaaatgataa acaaagccat aattagctgt
600ggtggacctg aaaaccttgt cactactata aagaacccaa ctatggaaag
tttagacgct 660attatcaaac atccatccat aaaattgttg tgcggtacgg
gtggcccggg tatggtaaaa 720acccttctta attctggtaa aaaggccatc
ggagctggcg cgggtaatcc tccggttatt 780gtagacgata cagcagatat
cgagaaggcc ggcagaagca ttattgaagg ttgttcgttt 840gacaacaatc
ttccttgtat cgcggaaaaa gaagtgttcg tgtttgaaaa cgttgcagat
900gatctgatct ctaacatgtt gaaaaacaac gccgtcatta tcaatgaaga
ccaagtatcc 960aagctgatag accttgttct tcaaaagaac aatgaaactc
aagaatattt cattaataag 1020aagtgggttg gtaaggacgc taaactgttt
ttggatgaaa tagatgtaga gtcaccaagt 1080aatgtaaagt gtattatttg
tgaagtcaac gcaaaccatc cgttcgttat gacggagttg 1140atgatgccaa
ttttgcctat agttagagtg aaggacattg atgaagccat taaatacgcc
1200aagatagctg agcagaatag aaaacattcc gcctacattt attctaagaa
catcgataac 1260cttaatagat tcgaacgtga aattgataca actatctttg
ttaagaatgc aaagtcattt 1320gcaggtgtcg gttatgaagc tgagggtttc
acaaccttta caattgccgg atccacaggt 1380gaaggaatca cgtcagctag
aaactttacc aggcaaagac gttgtgtcct agcaggttag 1440ggcctgcagg
gccgtgaatt tactttaaat cttgcattac tagt
1484189468PRTArtificialModified Ald 189Met Asp Lys Asp Thr Leu Ile
Pro Thr Thr Lys Asp Leu Lys Val Lys 1 5 10 15 Thr Asn Gly Glu Asn
Ile Asn Leu Lys Asn Tyr Lys Asp Asn Ser Ser 20 25 30 Cys Phe Gly
Val Phe Glu Asn Val Glu Asn Ala Ile Ser Ser Ala Val 35 40 45 His
Ala Gln Lys Ile Leu Ser Leu His Tyr Thr Lys Glu Gln Arg Glu 50 55
60 Lys Ile Ile Thr Glu Ile Arg Lys Ala Ala Leu Gln Asn Lys Glu Val
65 70 75 80 Leu Ala Thr Met Ile Leu Glu Glu Thr His Met Gly Arg Tyr
Glu Asp 85 90 95 Lys Ile Leu Lys His Glu Leu Val Ala Lys Tyr Thr
Pro Gly Thr Glu 100 105 110 Asp Leu Thr Thr Thr Ala Trp Ser Gly Asp
Asn Gly Leu Thr Val Val 115 120 125 Glu Met Ser Pro Tyr Gly Val Ile
Gly Ala Ile Thr Pro Ser Thr Asn 130 135 140 Pro Thr Glu Thr Val Ile
Cys Asn Ser Ile Gly Met Ile Ala Ala Gly 145 150 155 160 Asn Ala Val
Val Phe Asn Gly His Pro Cys Ala Lys Lys Cys Val Ala 165 170 175 Phe
Ala Val Glu Met Ile Asn Lys Ala Ile Ile Ser Cys Gly Gly Pro 180 185
190 Glu Asn Leu Val Thr Thr Ile Lys Asn Pro Thr Met Glu Ser Leu Asp
195 200 205 Ala Ile Ile Lys His Pro Ser Ile Lys Leu Leu Cys Gly Thr
Gly Gly 210 215 220 Pro Gly Met Val Lys Thr Leu Leu Asn Ser Gly Lys
Lys Ala Ile Gly 225 230 235 240 Ala Gly Ala Gly Asn Pro Pro Val Ile
Val Asp Asp Thr Ala Asp Ile 245 250 255 Glu Lys Ala Gly Arg Ser Ile
Ile Glu Gly Cys Ser Phe Asp Asn Asn 260 265 270 Leu Pro Cys Ile Ala
Glu Lys Glu Val Phe Val Phe Glu Asn Val Ala 275 280 285 Asp Asp Leu
Ile Ser Asn Met Leu Lys Asn Asn Ala Val Ile Ile Asn 290 295 300 Glu
Asp Gln Val Ser Lys Leu Ile Asp Leu Val Leu Gln Lys Asn Asn 305 310
315 320 Glu Thr Gln Glu Tyr Phe Ile Asn Lys Lys Trp Val Gly Lys Asp
Ala 325 330 335 Lys Leu Phe Leu Asp Glu Ile Asp Val Glu Ser Pro Ser
Asn Val Lys 340 345 350 Cys Ile Ile Cys Glu Val Asn Ala Asn His Pro
Phe Val Met Thr Glu 355 360 365 Leu Met Met Pro Ile Leu Pro Ile Val
Arg Val Lys Asp Ile Asp Glu 370 375 380 Ala Ile Lys Tyr Ala Lys Ile
Ala Glu Gln Asn Arg Lys His Ser Ala 385 390 395 400 Tyr Ile Tyr Ser
Lys Asn Ile Asp Asn Leu Asn Arg Phe Glu Arg Glu 405 410 415 Ile Asp
Thr Thr Ile Phe Val Lys Asn Ala Lys Ser Phe Ala Gly Val 420 425 430
Gly Tyr Glu Ala Glu Gly Phe Thr Thr Phe Thr Ile Ala Gly Ser Thr 435
440 445 Gly Glu Gly Ile Thr Ser Ala Arg Asn Phe Thr Arg Gln Arg Arg
Cys 450 455 460 Val Leu Ala Gly 465 19069DNAArtificial
SequencePrimer PT800 190gggaacaaaa gctggagctc caccgcggtg gggcgcgccc
tattttcgag gaccttgtca 60ccttgagcc 6919150DNAArtificial
SequencePrimer OT758 191ttaaggtatc tttatccatg gtgtttgttt atgtgtgttt
attcgaaact 5019252DNAArtificial SequencePrimer OT754 192ttgggtaccg
ggccccccct cgaggtcgac tggccattaa tctttcccat at 5219352DNAArtificial
SequencePrimer OT755 193tgtgtcctag caggttaggg cctgcagggc cgtgaattta
ctttaaatct tg 5219450DNAArtificial SequencePrimer OT760
194cgaaaatagg gcgcgccact ggtagagagc gactttgtat gccccaattg
5019571DNAArtificial SequencePrimer OT792 195cccttgacga acttggcctt
cactagcatg ctgaatatgt attacttggt tatggttata 60tatgacaaaa g
7119671DNAArtificial SequencePrimer OT791 196cccttgacga acttggcctt
cactagcatg ctgaatatgt attacttggt tatggttata 60tatgacaaaa g
7119773DNAArtificial SequencePrimer OT765 197ggaacaaaag ctggagctcc
accgcggtgg tttaacgtat agacttctaa tatatttctc 60catacttggt att
7319829DNAArtificial SequencePrimer LDHEcoRV F 198gacgtcatga
ccacccgccg atccctttt 2919930DNAArtificial SequencePrimer LDH AatlR
199gatatccaac accagcgacc gacgtattac 3020047DNAArtificial
SequencePrimer Cm F 200atttaaatct cgagtagagg atcccaacaa acgaaaattg
gataaag 4720129DNAArtificial SequencePrimer Cm R 201acgcgttatt
ataaaagcca gtcattagg 2920262DNAArtificial SequencePrimer P11 F
202tcgagagcgc tatagttgtt gacagaatgg acatactatg atatattgtt
gctatagcgc 60cc 6220358DNAArtificial SequencePrimer P11 R
203gggcgctata gcaacaatat atcatagtat gtccattctg tcaacaacta tagcgctc
5820438DNAArtificial SequencePrimer PldhL F 204gagctcgtcg
acaaaccaac attatgacgt gtctgggc 3820530DNAArtificial SequencePrimer
PldhL R 205ggatcctacc atgtttgtgc aaaataagtg 3020634DNAArtificial
SequencePrimer F-PnisA (EcoRV) 206ttcagtgata tcgacatact tgaatgacct
agtc 3420748DNAArtificial SequencePrimer R-PnisA(PmeI BamHI)
207ttgattagtt taaactgtag gatcctttga gtgcctcctt ataattta
482082460DNAArtificial SequenceTemplate DNA 208tgatccaaag
gagggtgagg aaatggcgat gtttacgacc accgcaaaag ttattcagcc 60gaaaattcgt
ggttttattt gcaccaccac ccacccgatt ggttgcgaaa aacgtgttca
120ggaagaaatc gcatacgcac gcgcgcaccc gccgaccagc ccgggtccga
aacgtgtgct 180ggttattggc tgcagtacgg gctatggcct gagcacccgt
atcaccgcgg cctttggtta 240tcaggccgca accctgggcg tgtttctggc
aggcccgccg accaaaggcc gtccggccgc 300ggcgggttgg tataatacgg
ttgcgttcga aaaagccgcc ctggaagcag gtctgtatgc 360acgttctctg
aatggtgatg cgttcgattc taccacgaaa gcccgcaccg tggaagcaat
420taaacgtgat ctgggtaccg ttgatctggt ggtgtatagc attgcagcgc
cgaaacgtac 480cgatccggcc accggcgtgc tgcataaagc gtgcctgaaa
ccgattggtg caacctacac 540caatcgtacg gtgaacaccg ataaagcaga
agttaccgat gtgagtattg aaccggccag 600tccggaagaa atcgcagata
ccgtgaaagt tatgggtggc gaagattggg aactgtggat 660tcaggcactg
agcgaagccg gcgtgctggc cgaaggcgca aaaaccgttg cgtattctta
720tattggcccg gaaatgacgt ggccggtgta ttggagtggc accattggcg
aagccaaaaa 780agatgttgaa aaagcggcga aacgcatcac ccagcagtac
ggctgtccgg cgtatccggt 840tgttgccaaa gcgctggtga cccaggccag
tagcgccatt ccggtggtgc cgctgtatat 900ttgcctgctg tatcgtgtta
tgaaagaaaa aggcacccat gaaggctgca ttgaacagat 960ggtgcgtctg
ctgacgacga aactgtatcc ggaaaatggt gcgccgatcg tggatgaagc
1020gggccgtgtg cgtgttgatg attgggaaat ggcagaagat gttcagcagg
cagttaaaga 1080tctgtggagc caggtgagta cggccaatct gaaagatatt
agcgattttg caggttatca 1140gaccgaattt ctgcgtctgt ttggctttgg
tattgatggt gtggattacg atcagccggt 1200tgatgttgaa gcggatctgc
cgagcgccgc ccagcagtaa gtcaacaaag gaggggttaa 1260aatggttgat
ttcgaatatt caataccaac tagaattttt ttcggtaaag ataagataaa
1320tgtacttgga agagagctta aaaaatatgg ttctaaagtg cttatagttt
atggtggagg 1380aagtataaag agaaatggaa tatatgataa agctgtaagt
atacttgaaa aaaacagtat 1440taaattttat gaacttgcag gagtagagcc
aaatccaaga gtaactacag ttgaaaaagg 1500agttaaaata tgtagagaaa
atggagttga agtagtacta gctataggtg gaggaagtgc 1560aatagattgc
gcaaaggtta tagcagcagc atgtgaatat gatggaaatc catgggatat
1620tgtgttagat ggctcaaaaa taaaaagggt gcttcctata gctagtatat
taaccattgc 1680tgcaacagga tcagaaatgg atacgtgggc agtaataaat
aatatggata caaacgaaaa 1740actaattgcg gcacatccag atatggctcc
taagttttct atattagatc caacgtatac 1800gtataccgta cctaccaatc
aaacagcagc aggaacagct gatattatga gtcatatatt 1860tgaggtgtat
tttagtaata caaaaacagc atatttgcag gatagaatgg cagaagcgtt
1920attaagaact tgtattaaat atggaggaat agctcttgag aagccggatg
attatgaggc 1980aagagccaat ctaatgtggg cttcaagtct tgcgataaat
ggacttttaa catatggtaa 2040agacactaat tggagtgtac acttaatgga
acatgaatta agtgcttatt acgacataac 2100acacggcgta gggcttgcaa
ttttaacacc taattggatg gagtatattt taaataatga 2160tacagtgtac
aagtttgttg aatatggtgt aaatgtttgg ggaatagaca aagaaaaaaa
2220tcactatgac atagcacatc aagcaataca aaaaacaaga gattactttg
taaatgtact 2280aggtttacca tctagactga gagatgttgg aattgaagaa
gaaaaattgg acataatggc 2340aaaggaatca gtaaagctta caggaggaac
cataggaaac ctaagaccag taaacgcctc 2400cgaagtccta caaatattca
aaaaatctgt gtaaacctac gtttaaactt acgcgtatga 2460
* * * * *