U.S. patent application number 13/560580 was filed with the patent office on 2013-08-08 for biological production of organic compounds.
This patent application is currently assigned to ALLIANCE FOR SUSTAINABLE ENERGY, LLC. The applicant listed for this patent is Damian CARRIERI, Pin-Ching MANESS, Troy PADDOCK, Michael SEIBERT, Jianping YU. Invention is credited to Damian CARRIERI, Pin-Ching MANESS, Troy PADDOCK, Michael SEIBERT, Jianping YU.
Application Number | 20130203136 13/560580 |
Document ID | / |
Family ID | 48903227 |
Filed Date | 2013-08-08 |
United States Patent
Application |
20130203136 |
Kind Code |
A1 |
YU; Jianping ; et
al. |
August 8, 2013 |
BIOLOGICAL PRODUCTION OF ORGANIC COMPOUNDS
Abstract
Strains of cyanobacteria that produce high levels of alpha
ketoglutarate (AKG) and pyruvate are disclosed herein. Methods of
culturing these cyanobacteria to produce AKG or pyruvate and
recover AKG or pyruvate from the culture are also described herein.
Nucleic acid sequences encoding polypeptides that function as
ethylene-forming enzymes and their use in the production of
ethylene are further disclosed herein. These nucleic acids may be
expressed in hosts such as cyanobacteria, which in turn may be
cultured to produce ethylene.
Inventors: |
YU; Jianping; (Golden,
CO) ; PADDOCK; Troy; (Wheat Ridge, CO) ;
CARRIERI; Damian; (Denver, CO) ; MANESS;
Pin-Ching; (Golden, CO) ; SEIBERT; Michael;
(Lakewood, CO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
YU; Jianping
PADDOCK; Troy
CARRIERI; Damian
MANESS; Pin-Ching
SEIBERT; Michael |
Golden
Wheat Ridge
Denver
Golden
Lakewood |
CO
CO
CO
CO
CO |
US
US
US
US
US |
|
|
Assignee: |
ALLIANCE FOR SUSTAINABLE ENERGY,
LLC
Golden
CO
|
Family ID: |
48903227 |
Appl. No.: |
13/560580 |
Filed: |
July 27, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61512075 |
Jul 27, 2011 |
|
|
|
Current U.S.
Class: |
435/143 ;
435/136; 435/257.1 |
Current CPC
Class: |
C12N 1/12 20130101; C12P
5/026 20130101; C12P 7/50 20130101; C12P 7/40 20130101; C12R 1/01
20130101; C12N 9/0069 20130101; C12N 15/63 20130101 |
Class at
Publication: |
435/143 ;
435/136; 435/257.1 |
International
Class: |
C12P 7/50 20060101
C12P007/50; C12P 7/40 20060101 C12P007/40 |
Goverment Interests
CONTRACTUAL ORIGIN
[0002] The United States Government has rights in this invention
under Contract No. DE-AC36-08G028308 between the United States
Department of Energy and the Alliance for Sustainable Energy, LLC,
the Manager and Operator of the National Renewable Energy
Laboratory.
Claims
1. A method for producing alpha ketoglutarate (AKG) or pyruvate,
comprising: a) culturing a cyanobacterial cell that lacks a
functional ADP-glucose pyrophosphorylase (AGP) enzyme under
conditions that allow for AKG or pyruvate production, and b)
recovering the AKG or pyruvate from the cyanobacterial cell
culture.
2. The method of claim 1, wherein the cyanobacterial cell does not
express a functional glgC gene.
3. The method of claim 1, wherein the cyanobacterial cell is a
Synechocystis cell.
4. The method of claim 1, wherein the cyanobacterial cell is a
Synechocystis sp. PCC 6803 cell.
5. The method of claim 1, wherein the cyanobacterial cell is
cultured in media that does not contain nitrogen.
6. The method of claim 5, wherein the concentration of nitrogen in
the media is less than about 200 .mu.M.
7. The method of claim 6, further comprising a step of adding
nitrogen to the media at a final concentration of less than about 1
mM.
8. The method of claim 6, wherein the cyanobacterial cell is
cultured under a light intensity of at least about 350 .mu.E
m.sup.-2s.sup.-1.
9. The method of claim 6, wherein the cyanobacterial cell is
cultured under a light intensity of at least about 600 .mu.E
m.sup.-2s.sup.-1.
10. The method of claim 1, wherein the AKG concentration in the
culture is greater than 100 mg per liter.
11. The method of claim 1, wherein the AKG concentration in the
culture is greater than 1000 mg per liter.
12. The method of claim 1, wherein the cyanobacterial cell exhibits
at least a 10,000-fold increase in AKG production when compared to
a wild type cell.
13. The method of claim 1, wherein the pyruvate concentration in
the culture is greater than 1 g per liter.
14. The method of claim 1, wherein the pyruvate concentration in
the culture is greater than 100 g per liter.
15. The method of claim 1, wherein the cyanobacterial cell exhibits
at least a 10,000-fold increase in pyruvate production when
compared to a wild type cell.
16. A cyanobacterial cell that lacks a functional ADP-glucose
pyrophosphorylase (AGP) enzyme and produces 10,000-fold more AKG or
pyruvate when compared to a wild type cell.
17. The cyanobacterial cell of claim 16, wherein the cyanobacterial
cell does not express a functional glgC gene.
18. The cyanobacterial cell of claim 16, wherein the cyanobacterial
cell is a Synechocystis cell.
19. The cyanobacterial cell of claim 16, wherein the cyanobacterial
cell is a Synechocystis sp. PCC 6803 cell.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 61/512,075, filed Jul. 27, 2011, the contents of
which are incorporated by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0003] This application contains a Sequence Listing submitted as an
electronic text file entitled "11-18_ST25.txt," having a size in
bytes of 20 kb and created on Jul. 27, 2012. Pursuant to 37 CFR
.sctn.1.52(e)(5), the information contained in the above electronic
file is hereby incorporated by reference in its entirety.
BACKGROUND
[0004] Using algae or cyanobacteria to produce carbon compounds
photosynthetically from CO.sub.2 and water has theoretical
potential but has yet to be realized on an industrial scale. One
major limitation is that these cells are naturally high in protein,
especially under conditions that lead to maximum growth rates. Thus
a large fraction of carbon from photosynthesis is used to produce
nitrogen containing amino acids rather than other products
containing only carbon, hydrogen, and oxygen. When nitrogen sources
are removed from cultures of non-diazotrophic cyanobacteria, cells
accumulate high concentrations of glycogen, but large-scale
harvesting of microbial oxygenic phototrophs is difficult and
expensive with currently available technologies.
[0005] Alpha ketoglutarate (AKG) is used as an organic synthesis
intermediate, a medicine ingredient, a biochemical reagent, and as
a nutritional additive in food and sport drinks. Currently AKG is
produced by chemical synthesis using triethyl oxalosuccinic ester
derived from petroleum and concentrated hydrochloric acid, or by
fermentation using sugar as feedstock. Photosynthetic production of
AKG could therefore replace petroleum or sugar as the feedstock and
eliminate the use of corrosive acid.
[0006] Ethylene is used in the synthesis of diverse products from
plastics (e.g., polyethylene, polystyrene, and PVC) to textiles
such as polyester. Ethylene has been used to produce high-grade
ethanol industrially for the past 50 years, by a relatively simple
catalytic process involving the hydration of ethylene into ethanol.
In addition, the technology to polymerize ethylene to gasoline has
been known for nearly a century. Ethylene is the most widely
produced organic compound globally, with more than 132.9 million
tons produced in 2010 and projected growth of 5% a year through
2015.
[0007] The current method of producing ethylene is via steam
cracking of long chain hydrocarbons from petroleum, or via
dehydrogenation of ethane. Unfortunately, fossil fuel supplies are
finite and utilization of these feed stocks produces greenhouse
gases such as CO.sub.2 (1.5 to 3.0 tons CO.sub.2 per ton of
ethylene). For these reasons, sustainable, carbon neutral processes
that are capable of producing this essential chemical are needed.
One such alternative is the use of biological processes to convert
CO.sub.2 or other waste products into ethylene. Based on the
overall equation 2CO.sub.2+2H.sub.2O.dbd.C.sub.2H.sub.4+3O.sub.2,
photosynthetic production of one ton of ethylene could sequester
3.14 tons of CO.sub.2.
[0008] The foregoing examples of the related art and limitations
related therewith are intended to be illustrative and not
exclusive. Other limitations of the related art will become
apparent to those of skill in the art upon a reading of the
specification and a study of the drawings.
SUMMARY
[0009] The following embodiments and aspects thereof are described
and illustrated in conjunction with systems, tools and methods that
are meant to be exemplary and illustrative, not limiting in scope.
In various embodiments, one or more of the above-described problems
have been reduced or eliminated, while other embodiments are
directed to other improvements.
[0010] Exemplary embodiments provide methods for producing alpha
ketoglutarate (AKG) or pyruvate by culturing a cyanobacterial cell
that lacks a functional ADP-glucose pyrophosphorylase (AGP) enzyme
under conditions that allow for AKG or pyruvate production and
recovering the AKG or pyruvate from the cyanobacterial cell
culture.
[0011] In some embodiments, the cyanobacteria) cell does not
express a functional glgC gene and/or is a Synechocystis cell such
as a Synechocystis sp. PCC 6803 cell.
[0012] In certain embodiments, the cyanobacterial cell is cultured
under nitrogen starvation conditions in media that does not contain
nitrogen. In some embodiments, the concentration of nitrogen in the
media is less than about 200 .mu.M. The methods may include a step
of adding nitrogen to the media at a final concentration of less
than about 1 mM. In certain embodiments, the cyanobacterial cell is
cultured under a light intensity of at least about 350 or 600 .mu.E
m.sup.-2s.sup.-1.
[0013] In further embodiments, the AKG concentration in the culture
is greater than 100 mg per liter or 1000 mg per liter. In some
embodiment, the pyruvate concentration in the culture is greater
than 1 g per liter or 100 g per liter. In certain embodiments, the
cyanobacterial cell exhibits at least a 10,000-fold increase in AKG
and/or pyruvate production when compared to the wild type cell.
[0014] Also provided are cyanobacterial cells that lack a
functional ADP-glucose pyrophosphorylase (AGP) enzyme and produce
10,000-fold more AKG or pyruvate when compared to a wild type cell.
In some embodiments, the cyanobacterial cells do not express a
functional glgC gene and/or are Synechocystis cells such as a
Synechocystis sp. PCC 6803 cells.
[0015] Further provided are isolated nucleic acid molecules with
sequences at least 90% identical to SEQ ID NO:3 that encode
polypeptides that function as ethylene-forming enzymes. In some
embodiments, the nucleic acid molecule has a sequence at least 95%
identical to SEQ ID NO:3 or has or comprises the sequence of SEQ ID
NO:3.
[0016] In certain embodiments, the nucleic acid molecule further
comprises a promoter such as petE or psbA operably linked to the
nucleic acid molecule.
[0017] Also provided are expression vectors comprising nucleic acid
molecules with sequences at least 90% identical to SEQ ID NO:3 that
encode polypeptides that function as ethylene-forming enzymes.
[0018] Exemplary embodiments also provide host cells comprising
expression vectors described herein or expressing recombinant
polypeptides encoded by the nucleic acids described herein. In some
embodiments, the host cell is a microbial cell, a cyanobacterial
cell, a Synechocystis cell or a Synechocystis sp. PCC6803 cell. In
certain embodiments, the cell maintains a functional copy of the
ethylene-forming enzyme for at least four generations. In certain
embodiments, the host cells comprise at least one, two, three,
four, five or more copies of efe.
[0019] Additional embodiments provide methods for producing
ethylene comprising culturing a host cell that expresses a
recombinant ethylene-forming enzyme under conditions that allow for
ethylene production and isolating ethylene from the culture.
[0020] In some embodiments, the host cell is a Synechocystis cell
and expresses a nucleic acid molecule with a sequence at least 90%
identical to SEQ ID NO:3.
[0021] In certain embodiments, the method further comprises a step
of replenishing components of the culture medium that are depleted
during the culturing step to the cell culture.
[0022] In exemplary embodiments, ethylene is produced at a peak
production rate of at least 500 nL mL.sup.-1 hr.sup.-1, at least 1
.mu.L mL.sup.-1 hr.sup.-1, at least 10 .mu.L mL.sup.-1 hr.sup.-1,
at least 50 .mu.L mL.sup.-1 hr.sup.-1, at least 100 .mu.L mL.sup.-1
hr.sup.-1, or at least 200 .mu.L mL.sup.-1 hr.sup.-1.
[0023] In some embodiments, the step of culturing comprises
providing the cell carbon dioxide and light. The light may be
sunlight and the carbon dioxide may be atmospheric carbon
dioxide.
[0024] Further provided are methods for producing ethylene
comprising culturing host cells as described herein under
conditions that allow for the production of ethylene by the cells
and isolating the ethylene produced by the cells.
[0025] In addition to the exemplary aspects and embodiments
described above, further aspects and embodiments will become
apparent by reference to the drawings and by study of the following
descriptions.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Exemplary embodiments are illustrated in referenced figures
of the drawings. It is intended that the embodiments and figures
disclosed herein are to be considered illustrative rather than
limiting.
[0027] FIG. 1 illustrates the major carbon biosynthetic pathways in
cyanobacteria such as Synechocystis 6803 under nitrogen-deprived
conditions.
[0028] FIG. 2 shows growth curves of batch cultures of
Synechocystis sp. PCC 6803 cultured in full BG11 media (A) and
after suspension in BG11-N media (B). Cultures were under 24 hour
light at .about.50 .mu.Em.sup.-2s.sup.-1 light flux. Panel (C)
shows growth curves for wild type and mutant strains under nitrogen
deprivation conditions.
[0029] FIG. 3 shows glycogen content of cultures from log phase
(growing in BG11) and after incubation in BG11-N for 3 days. No
glycogen was detected for the AGP-strain in either condition. Error
bars represent standard deviation of biological replicates
(n=3).
[0030] FIG. 4 illustrates light-adapted quantum efficiency
(Fv'/Fm') of cells cultured in BG11-N media for up to 5 days. Wild
type (WT) is shown as dashed line because of phycobilin changes
that artificially increase the measured value. Error bars represent
standard deviation of biological replicates (n=3).
[0031] FIG. 5 shows whole-chain net oxygen evolution of cells
cultured in BG11-N media normalized to the volume of culture
measured (mL) with respect to days nitrogen-starved. Oxygen
evolution rates are shown as a percentage of non-nitrogen starved
cells. Non-nitrogen starved WT and mutant (AGP-) cultures were
within statistical error of each other (.about.150 .mu.mmol
O.sub.2*(mg Chla).sup.-1*hr.sup.-1). Error bars represent standard
deviation of biological replicates (n=3).
[0032] FIG. 6 shows relative intracellular concentrations of select
metabolites with and without nitrogen starvation (+N or -N) as
determined by GC/MS. Y-axis is in units of "normalized ion count,"
which accounts for the signal response of a 0.1 mg/mL derivatized
standard and the dry weight of the sample. Error bars represent
standard deviation of biological replicates (n=3).
[0033] FIG. 7A shows AKG production over 11 days of culturing in
BG11-N media at a cell density of about 0.5 g/L cell dry weight and
light flux of about 50 .mu.Em.sup.-2s.sup.-1. FIG. 7B shows
pyruvate production over 5 days under the same conditions. Error
bars represent standard deviation of biological replicates
(n=3).
[0034] FIG. 8 shows total dry weight of photosynthetically produced
material over 11 days of nitrogen starvation. Wild-type (WT) cells
produced nearly undetectable levels of excreted AKG, while a
significant amount of AKG was produced by the AGP-mutant strain and
is stacked over total cell dry weight to show total dry weight
material produced.
[0035] FIG. 9 shows dry weights of WT and AGP-cultures incubated
for up to 9 days in BG11-N.
[0036] FIG. 10 illustrates absorbance of whole cell suspensions at
630 nm divided by absorbance at 680 nm, used to estimate phycobilin
(PC)/Chlorophyll ratio in cells with respect to days of incubation
in BG11-N.
[0037] FIG. 11 shows the nucleic acid sequence for the glgC gene
(A; SEQ ID NO:1) and the amino acid sequence for the AGP protein
(B; SEQ ID NO:2).
[0038] FIG. 12 illustrates the overall scheme for glgC gene
replacement (A) and the assembly of the glgC (shown here as agp)
replacement construct using fusion PCR.
[0039] FIG. 13 shows a PCR analysis illustrating that the glgC
genomic fragment is only detectable in the wild type genome.
[0040] FIG. 14 illustrates a pathway for the synthesis of ethylene
via an ethylene forming enzyme (EFE) that converts
.alpha.-ketoglutarate, a key metabolite in the citric acid cycle,
to ethylene.
[0041] FIG. 15 shows growth rates of threes strains of
Synechocystis 6803.
[0042] FIG. 16 shows ethylene production from Synechocystis 6803
harboring an efe gene. A) Comparison of ethylene production rates
when efe is expressed from either the petE or the psbA promoters.
B) Ethylene production normalized to density and total ethylene
production (C) of Synechocystis 6803 expressing efe from the psbA
promoter across four consecutive cultures.
[0043] FIG. 17 illustrates growth conditions affecting ethylene
production. A) Restoration of ethylene production by various
additions to a stationary culture that has ceased high-level
ethylene production. B) The effect of various medium concentrations
on the total ethylene production. C) Refreshing the medium provides
a higher rate of ethylene production while allowing the peak
production rates to be sustained. Arrows indicate times at which
the culture was resuspended in fresh medium. Free squares represent
the ethylene production rates of the same culture before
resuspension in fresh medium.
[0044] FIG. 18 shows a comparison of ethylene production as a
function of time (A) or peak production rates (B) from strains
harboring one, two, three, or four copies of efe in their genomes.
In FIG. 18A, closed circles represent one copy of efe, closed
triangles represent two copies of efe, and the wild type strain is
represented by the open circles.
[0045] FIG. 19 shows ethylene total productivity (A), specific
productivity (B) and growth (C) after resuspension of cultures in
fresh 5.times.BG11 media over multiple weeks. One copy of efe is
represented by solid symbols, two copies of efe by open symbols.
Panel (D) shows resuspension of a strain harboring two copies of
efe in fresh 5.times.BG11 daily to an OD.sub.730 of 15.0.
[0046] FIG. 20 shows ethylene production under various light
conditions. A) Total ethylene productivity from cultures at various
light intensities. B) Specific ethylene productivity from cultures
at various light intensities.
[0047] FIG. 21 shows ethylene total productivity (A), specific
productivity (B) and growth (C) under high and low light
intensities. A strain with two copies of efe grown at 600 .mu.E
m.sup.-2s.sup.-1 is represented by the closed circles, a strain
with one copy of efe grown at 600 .mu.E m.sup.-2s.sup.-1 by the
open circles, a strain with two copies of efe grown at 50 .mu.E
m.sup.-2s.sup.-1 by the open triangles, and a strain with one copy
of efe grown at 50 .mu.E m.sup.-2s.sup.-1 by the closed
triangles.
[0048] FIG. 22 shows the DNA sequence of the efe gene modified for
expression in Synechoeystis 6803 (SEQ ID NO:3). The ATG start codon
is illustrated in bold.
[0049] FIG. 23 shows the amino acid sequence encoded by the P
syringae efe gene (SEQ ID NO:4).
[0050] FIG. 24 shows specific ethylene production of a strain
harboring a single copy of efe in different types of media. Closed
circles--5.times.BG11; open circle--5.times.BG11 dissolved in
seawater; closed triangle--seawater supplemented with 4 mg/L
phosphate and 150 mg/L nitrate; open triangle--sea water (n=3).
DETAILED DESCRIPTION
[0051] Disclosed herein are strains of cyanobacteria that produce
high levels of alpha ketoglutarate (AKG) and pyruvate. One example
is a mutant strain of Synechocystis lacking the glgC gene (FIG.
12A), which does not produce a functional AGP protein (FIG. 12B) or
glycogen in detectable levels but over-produces AKG and pyruvate.
Methods of culturing these cyanobacteria to produce AKG and
pyruvate are also described herein.
[0052] Syneehocystis, a non-diazotrophic cyanobacterium,
accumulates large amounts of glycogen when starved of nitrogen.
While not wishing to be bound to any particular theory, it is
believed that carbon flux from photosynthesis can be rerouted away
from a storage product (e.g., glycogen) and toward an excreted
product (e.g., AKG or pyruvate) by creating stable mutational
strains of cyanobacterial cells that are incapable of synthesizing
storage products such as glycogen or glucosylglycerol. Such strains
include those with disruptions or deletions in the gene that
encodes an ADP-glucose pyrophosphorylase (AGP), which catalyzes the
conversion of alpha-d-glucose-1-phosphate to adenosine
diphosphoglucose (ADP-glucose), the immediate precursor to
glycogen. Such AGP-deficient (AGP-) strains may not make detectable
amounts of glycogen under nitrogen starvation, but continue to fix
carbon photosynthetically at a rate similar to wild-type cells.
Yields of AKG and pyruvate in such mutant strains may exceed 100%
of the initial cell dry weight of cultures incubated under
continuous light in a nitrogen-free growth medium. In Synechocystis
sp. PCC 6803, a glgC gene (slr1176) encodes an AGP enzyme.
[0053] Suitable AGP-strains include those with a genetic mutation
to interrupt expression of glgC yet maintain the ability to grow
and produce metabolites such as AKG or pyruvate under nitrogen
starvation conditions. Additional mutations or deletions in genes
in the glycogen synthesis pathway (e.g., glycogen synthase) may
also result in the increased production of AKG or pyruvate. Under
nitrogen depletion conditions, the mutant strains may produce high
levels of AKG, up to or greater than 30% of the cell dry weight,
which is on the order of a 10,000-fold increase over the wild type.
In certain embodiments, the mutant strains may exhibit at least a
100, 200, 300, 400, 500, 1000, 2500, 5000, 7500, or 10,000-fold
increase in AKG production when compared to the wild type strain.
In some embodiments, the mutant strains may exhibit at least a 100,
200, 300, 400, 500, 1000, 2500, 5000, 7500, or 10,000-fold increase
in pyruvate production when compared to the wild type strain.
[0054] The photosynthetic AKG production rate may reach at least
150 grams per day per 1000 liter reactor at a cell density of 1
gram dry weight per liter. Pyruvate can be produced at a rate of at
least 275 grams per day per 1000 liter reactor at a cell density of
1 gram dry weight per liter. In some embodiments, AKG or pyruvate
production rates may reach at least about 10, 25, 50, 75, 100, 125,
150, 175, 200, 225, 250, 275 or 300 grams per day per 1000 liter
reactor at a cell density of 1 gram dry weight per liter. AKG or
pyruvate may be harvested from the growth medium without the need
to harvest and break cells, thus allowing a continuous "milking"
(verses batch culture) process.
[0055] AGP-strains may be used for photosynthetic AKG or pyruvate
production from only net substrates of CO.sub.2, water, and
sunlight. A continuous AKG or pyruvate production system in which
the culture serves as solar-driven catalyst to convert CO.sub.2 to
AKG or pyruvate is also contemplated. As there would be no need to
harvest cells in such a system, AKG or pyruvate can be harvested
continuously or in intervals from the medium. The removal of AKG or
pyruvate from the medium may help keep intracellular AKG or
pyruvate concentration lower, to prevent possible feedback
inhibition, and enhance the rate of production.
[0056] The nucleic acid sequence of the glgC gene (SEQ ID NO:1) and
the amino acid sequence of the glgC gene product (SEQ ID NO:2) are
shown in FIGS. 11A and B, respectively. Exemplary methods for
disrupting the glgC gene by fusion PCR are provided in the Examples
and figures, but any method suitable for disrupting, ablating or
mutating genes in cells may be used. In certain embodiments, all or
a portion of the targeted gene is replaced with a selectable
marker. Markers may be an inducible or non-inducible gene and will
generally allow for positive selection. Non-limiting examples of
selectable markers include the ampicillin resistance marker (i.e.,
beta-lactamase), tetracycline resistance marker, neomycin/kanamycin
resistance marker (i.e., neomycin phosphotransferase),
dihydrofolate reductase, glutamine synthetase, and the like. The
choice of the proper selectable marker will depend on the host
cell, and appropriate markers for different hosts as understood by
those of skill in the art.
[0057] Nucleic acid sequences encoding polypeptides that function
as ethylene-forming enzymes and their use in the production of
ethylene are also disclosed herein. These nucleic acids may be
expressed in hosts such as cyanobacteria, which in turn may be
cultured to produce ethylene. For example, methods for using the
unicellular cyanobacterium Synechocystis sp. PCC 6803 to
photosynthetically produce ethylene from atmospheric CO.sub.2 are
disclosed.
[0058] One function of ethylene is as a plant hormone that is
involved in regulating numerous processes such as germination,
senescence and fruit ripening. In plants, ethylene is synthesized
from methionine, which is first converted to
S-adenosyl-L-methionine, L-aminocyclopropane-L-carboxylic acid, and
finally to ethylene in a three step reaction. Some microbes are
also capable of producing ethylene through two pathways not found
in plants. Most bacteria generate ethylene from methionine in a two
step reaction with a 2-keto-4-methyl-thiobutyric acid intermediate.
This reaction, catalyzed by a NADH:Fe(III)EDTA oxidoreductase, is
rather inefficient. Many plant pathogens such as Pseudomonas
syringae synthesize ethylene during infection to weaken their host.
In P. syringae, ethylene is synthesized from the TCA cycle
intermediate, alpha-ketoglutarate, in an efficient single step
reaction catalyzed by the ethylene forming enzyme (EFE).
[0059] Atmospheric CO.sub.2 represents a feedstock that has
potential for conversion into other chemicals such as ethanol,
biodiesel, or ethylene using photosynthesis. To this end,
researchers have attempted to use this process, coupled with EFE,
to generate ethylene from atmospheric CO.sub.2. Previous attempts
have failed due to poor productivity and the inability to stably
express EFE (see Fukuda et al., Biotechnol. Lett. 16:1-6 (1994);
Sakai et al., J. Ferment. Bioeng. 84:434-443 (1997); Takahama et
al., J. Biosci. Bioeng. 95:302-305 (2003)).
[0060] Disclosed herein are methods for expressing or
overexpressing efe genes (for example, from P. syringe) in hosts
such as Synechocystis to generate strains that are capable of
producing ethylene phototrophically. The hosts may express at least
one, two, three, four, five or more copies of efe to increase
ethylene production rates. These methods overcome two major
problems that were previously encountered when using cyanobacteria
to produce ethylene: poor stability of efe and poor ethylene
productivity. Without wishing to be bound by any particular theory,
it has been discovered that removing the mutation hot spots and
expressing codon-optiinized efe in hosts such as Synechocystis
alleviates the metabolic burden and stability issues.
[0061] The methods disclosed herein allow for the inducible
expression of efe, but also allow the utilization of stronger,
constitutive promoters like psbA to increase production rates.
Other advantages include a decrease in the mutation rate within the
coding region of efe and the generation of strains better able to
cope with the metabolic drain imposed by ethylene production. The
strains generated exhibit little or no inhibition in growth while
producing ethylene, nor do they exhibit stress symptoms such as
yellowing that had previously been observed in other
ethylene-producing strains.
[0062] The specific rate of ethylene production typically peaks 24
hours after subculture and then decreases. One or more components
of the medium may be a limiting factor in ethylene producing
cultures. Ethylene production can be recovered without diluting the
culture, by resuspending a stationary phase culture in fresh
medium. An increase in ethylene production rate can also be
achieved by increasing the concentration of the medium. For
example, 10.times. medium may sustain high level ethylene
production longer than 1.times. medium. Peak rates of about 1500 nL
mL.sup.-1 hr.sup.-1 or greater per genomic copy of efe can be
achieved after multiple rounds of resuspension. Total ethylene
productivity of a culture may also be increased on a per cell basis
by growing the culture in higher light intensities. Light
intensities of about 350 .mu.E can be reached in an incubator, but
natural sunlight can be many times more intense. Higher ethylene
production rates may thus be reached in an outdoor
photobioreactor.
[0063] "Nucleic acid" or "polynucleotide" as used herein refers to
purine- and pyrimidine-containing polymers of any length, either
polyribonucleotides or polydeoxyribonucleotide or mixed
polyribo-polydeoxyribonucleotides. This includes single- and
double-stranded molecules (i.e., DNA-DNA, DNA-RNA and RNA-RNA
hybrids) as well as "protein nucleic acids" (PNA) formed by
conjugating bases to an amino acid backbone. This also includes
nucleic acids containing modified bases.
[0064] Nucleic acids referred to herein as "isolated" are nucleic
acids that have been removed from their natural milieu or separated
away from the nucleic acids of the genomic DNA or cellular RNA of
their source of origin (e.g., as it exists in cells or in a mixture
of nucleic acids such as a library), and may have undergone further
processing. Isolated nucleic acids include nucleic acids obtained
by methods described herein, similar methods or other suitable
methods, including essentially pure nucleic acids, nucleic acids
produced by chemical synthesis, by combinations of biological and
chemical methods, and recombinant nucleic acids that are
isolated.
[0065] Nucleic acids referred to herein as "recombinant" are
nucleic acids which have been produced by recombinant DNA
methodology, including those nucleic acids that are generated by
procedures that rely upon a method of artificial replication, such
as the polymerase chain reaction (PCR) and/or cloning into a vector
using restriction enzymes. Recombinant nucleic acids also include
those that result from recombination events that occur through the
natural mechanisms of cells, but are selected for after the
introduction to the cells of nucleic acids designed to allow or
make probable a desired recombination event. Portions of isolated
nucleic acids that code for polypeptides having a certain function
can be identified and isolated by, for example, the method
disclosed in U.S. Pat. No. 4,952,501.
[0066] An isolated nucleic acid molecule can be isolated from its
natural source or produced using recombinant DNA technology (e.g.,
polymerase chain reaction (PCR) amplification, cloning) or chemical
synthesis. Isolated nucleic acid molecules can include, for
example, genes, natural allelic variants of genes, coding regions
or portions thereof, and coding and/or regulatory regions modified
by nucleotide insertions, deletions, substitutions, and/or
inversions in a manner such that the modifications do not
substantially interfere with the nucleic acid molecule's ability to
encode a polypeptide or to form stable hybrids under stringent
conditions with natural gene isolates. An isolated nucleic acid
molecule can include degeneracies. As used herein, nucleotide
degeneracy refers to the phenomenon that one amino acid can be
encoded by different nucleotide codons. Thus, the nucleic acid
sequence of a nucleic acid molecule that encodes a protein or
polypeptide can vary due to degeneracies.
[0067] A nucleic acid molecule is not required to encode a protein
having protein activity. A nucleic acid molecule can encode a
truncated, mutated or inactive protein, for example. In addition,
nucleic acid molecules may also be useful as probes and primers for
the identification, isolation and/or purification of other nucleic
acid molecules, independent of a protein-encoding function.
[0068] Suitable nucleic acids include fragments or variants of SEQ
ID NO:3 that encode an ethylene-forming enzyme. For example, a
fragment can comprise the minimum nucleotides from SEQ ID NO:3
required to encode a functional ethylene-forming enzyme. Nucleic
acid variants include nucleic acids with one or more nucleotide
additions, deletions, substitutions, including transitions and
transversions, insertion, or modifications (e.g., via RNA or DNA
analogs). Alterations may occur at the 5' or 3' terminal positions
of the reference nucleotide sequence or anywhere between those
terminal positions, interspersed either individually among the
nucleotides in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0069] In certain embodiments, a nucleic acid may be identical to
the sequence represented as SEQ ID NO:3. In other embodiments, the
nucleic acids may be least about 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
identical to SEQ ID NO:3, or 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%
identical to SEQ ID NO:3. Sequence identity calculations can be
performed using computer programs, hybridization methods, or
calculations. Exemplary computer program methods to determine
identity and similarity between two sequences include, but are not
limited to, the GCG program package, BLASTN, BLASTX, TBLASTX, and
FASTA. The BLAST programs are publicly available from NCBI and
other sources. For example, nucleotide sequence identity can be
determined by comparing a query sequences to sequences in publicly
available sequence databases (NCBI) using the BLASTN2
algorithm.
[0070] Embodiments of the nucleic acids include those that encode a
polypeptide that functions as an ethylene-forming enzyme or
functional equivalents thereof. For example, the amino acid
sequence of the P. syringae EFE ethylene-forming enzyme is depicted
in FIG. 23 and represented by SEQ ID NO:4. A functional equivalent
includes fragments or variants that exhibit the ability to function
as an ethylene-forming enzyme. As a result of the degeneracy of the
genetic code, many nucleic acid sequences can encode a polypeptide
having, for example, the amino acid sequence of SEQ ID NO:4. Such
functionally equivalent variants are contemplated herein.
[0071] Altered or variant nucleic acids can be produced by one of
skill in the art using the sequence data illustrated herein and
standard techniques known in the art. Variant nucleic acids may be
detected and isolated by hybridization under high stringency
conditions or moderate stringency conditions, for example, which
are chosen to prevent hybridization of nucleic acids having
non-complementary sequences. "Stringency conditions" for
hybridizations is a term of art that refers to the conditions of
temperature and buffer concentration that permit hybridization of a
particular nucleic acid to another nucleic acid in which the first
nucleic acid may be perfectly complementary to the second, or the
first and second may share some degree of complementarity that is
less than perfect.
[0072] Nucleic acids may be derived from a variety of sources
including DNA, cDNA, synthetic DNA, synthetic RNA, or combinations
thereof. Such sequences may comprise genomic DNA, which may or may
not include naturally occurring introns. Moreover, such genomic DNA
may be obtained in association with promoter regions or poly (A)
sequences. The sequences, genomic DNA, or cDNA may be obtained in
any of several ways. Genomic DNA can be extracted and purified from
suitable cells by means well known in the art. Alternatively, mRNA
can be isolated from a cell and used to produce cDNA by reverse
transcription or other means.
[0073] Oligonucleotides that are fragments of SEQ ID NOS:1 and 3
and antisense nucleic acids that are complementary, in whole or in
part, to SEQ ID NOS:1 and 3 are contemplated herein.
Oligonucleotides may be used as primers or probes or for any other
use known in the art. Antisense nucleic acids may be used, for
example, to inhibit gene expression when introduced into a cell or
for any other use known in the art. Oligonucleotides and antisense
nucleic acids can be produced by standard techniques known in the
art.
[0074] Also disclosed herein are recombinant vectors, including
expression vectors, containing nucleic acids encoding
ethylene-forming enzymes. A "recombinant vector" is a nucleic acid
molecule that is used as a tool for manipulating a nucleic acid
sequence of choice or for introducing such a nucleic acid sequence
into a host cell. A recombinant vector may be suitable for use in
cloning, sequencing, or otherwise manipulating the nucleic acid
sequence of choice, such as by expressing or delivering the nucleic
acid sequence of choice into a host cell to form a recombinant
cell. Such a vector typically contains heterologous nucleic acid
sequences not naturally found adjacent to a nucleic acid sequence
of choice, although the vector can also contain regulatory nucleic
acid sequences (e.g., promoters, untranslated regions) that are
naturally found adjacent to the nucleic acid sequences of choice or
that are useful for expression of the nucleic acid molecules.
[0075] A recombinant vector can be either RNA or DNA, either
prokaryotic or eukaryotic, and typically is a plasmid. The vector
can be maintained as an extrachromosomal element (e.g., a plasmid)
or it can be integrated into the chromosome of a recombinant host
cell. The entire vector can remain in place within a host cell, or
under certain conditions, the plasmid DNA can be deleted, leaving
behind the nucleic acid molecule of choice. An integrated nucleic
acid molecule can be under chromosomal promoter control, under
native or plasmid promoter control, or under a combination of
several promoter controls. Single or multiple copies of the nucleic
acid molecule can be integrated into the chromosome. A recombinant
vector can contain at least one selectable marker.
[0076] The term "expression vector" refers to a recombinant vector
that is capable of directing the expression of a nucleic acid
sequence that has been cloned into it after insertion into a host
cell or other (e.g., cell-free) expression system. A nucleic acid
sequence is "expressed" when it is transcribed to yield an mRNA
sequence. In most cases, this transcript will be translated to
yield an amino acid sequence. The cloned gene is usually placed
under the control of (i.e., operably linked to) an expression
control sequence. The phrase "operatively linked" refers to linking
a nucleic acid molecule to an expression control sequence in a
manner such that the molecule can be expressed when introduced
(i.e., transformed, transduced, transfected, conjugated or
conduced) into a host cell.
[0077] Recombinant vectors and expression vectors may contain one
or more regulatory sequences or expression control sequences.
Regulatory sequences broadly encompass expression control sequences
(e.g., transcription control sequences or translation control
sequences), as well as sequences that allow for vector replication
in a host cell. Transcription control sequences are sequences that
control the initiation, elongation, or termination of
transcription. Suitable regulatory sequences include any sequence
that can function in a host cell or organism into which the
recombinant nucleic acid molecule is to be introduced, including
those that control transcription initiation, such as promoter,
enhancer, terminator, operator and repressor sequences. Additional
regulatory sequences include translation regulatory sequences,
origins of replication, and other regulatory sequences that are
compatible with the recombinant cell. The expression vectors may
contain elements that allow for constitutive expression or
inducible expression of the protein or proteins of interest.
Numerous inducible and constitutive expression systems are known in
the art.
[0078] Typically, an expression vector includes at least one
nucleic acid molecule encoding an ethylene-forming enzyme
operatively linked to one or more expression control sequences
(e.g., transcription control sequences or translation control
sequences). In one aspect, an expression vector may comprise a
nucleic acid encoding an ethylene-forming enzyme, as described
herein, operably linked to at least one regulatory sequence. It
should be understood that the design of the expression vector may
depend on such factors as the choice of the host cell to be
transformed and/or the type of polypeptide to be expressed.
[0079] Expression and recombinant vectors may contain a selectable
marker, a gene encoding a protein necessary for survival or growth
of a host cell transformed with the vector. The presence of this
gene allows growth of only those host cells that express the vector
when grown in the appropriate selective media. Typical selection
genes encode proteins that confer resistance to antibiotics or
other toxic substances, complement auxotrophic deficiencies, or
supply critical nutrients not available from a particular media.
Markers may be an inducible or non-inducible gene and will
generally allow for positive selection. Non-limiting examples of
selectable markers include the ampicillin resistance marker (i.e.,
beta-lactamase), tetracycline resistance marker, neomycin/kanamycin
resistance marker (i.e., neomycin phosphotransferase),
dihydrofolate reductase, glutamine synthetase, and the like. The
choice of the proper selectable marker will depend on the host
cell, and appropriate markers for different hosts as understood by
those of skill in the art.
[0080] Suitable expression vectors may include (or may be derived
from) plasmid vectors that are well known in the art, such as those
commonly available from commercial sources. The Examples below
illustrate the construction of exemplary expression vectors
containing an ethylene-forming enzyme. Vectors can contain one or
more replication and inheritance systems for cloning or expression,
one or more markers for selection in the host, and one or more
expression cassettes. The inserted coding sequences can be
synthesized by standard methods, isolated from natural sources, or
prepared as hybrids. Ligation of the coding sequences to
transcriptional regulatory elements or to other amino acid encoding
sequences can be carried out using established methods. A large
number of vectors, including bacterial, yeast, and mammalian
vectors, have been described for replication and/or expression in
various host cells or cell-free systems, and may be used with the
secretion sequences described herein for simple cloning or protein
expression.
[0081] Certain embodiments may employ cyanobacterial promoters or
regulatory operons. For example, a promoter may comprise an rbcLS
operon of Synechococcus, a cpc operon of Synechocystis sp. strain
PCC 6714, the tRNApro gene from Synechococcus, the nirA promoter
from Synechococcus sp. strain PCC 7942, which is repressed by
ammonium and induced by nitrite. The efficiency of expression may
be enhanced by the inclusion of enhancers that are appropriate for
the particular cyanobacterial cell system which is used, such as
those described in the literature. Suitable promoters also include
the petE and psbA promoters.
[0082] It will be appreciated by one skilled in the art that use of
recombinant DNA technologies can improve control of expression of
transformed nucleic acid molecules by manipulating, for example,
the number of copies of the nucleic acid molecules within the host
cell, the efficiency with which those nucleic acid molecules are
transcribed, the efficiency with which the resultant transcripts
are translated, and the efficiency of post-translational
modifications. Additionally, the promoter sequence might be
genetically engineered to improve the level of expression as
compared to the native promoter. Recombinant techniques useful for
controlling the expression of nucleic acid molecules include, but
are not limited to, integration of the nucleic acid molecules into
one or more host cell chromosomes, addition of vector stability
sequences to plasmids, substitutions or modifications of
transcription control signals (e.g., promoters, operators,
enhancers), substitutions or modifications of translational control
signals (e.g., ribosome binding sites), modification of nucleic
acid molecules to correspond to the codon usage of the host cell,
and deletion of sequences that destabilize transcripts.
[0083] The nucleic acids, including parts or all of expression
vectors, may be isolated directly from cells, or, alternatively,
the polymerase chain reaction (PCR) method can be used to produce
the nucleic acids. Primers used for PCR can be synthesized using
the sequence information provided herein and can further be
designed to introduce appropriate new restriction sites, if
desirable, to facilitate incorporation into a given vector for
recombinant expression. The nucleic acids can be produced in large
quantities by replication in a suitable host cell (e.g.,
prokaryotic or eukaryotic cells such as bacteria, yeast, insect or
mammalian cells). The production and purification of nucleic acids
are described, for example, in Sambrook et al., 1989; F. M. Ausubel
et al., 1992, Current Protocols in Molecular Biology, J. Wiley and
Sons, New York, N.Y.
[0084] The nucleic acids described herein may be used in methods
for production of AKG, pyruvate or ethylene through incorporation
into cells, tissues, or organisms. In some embodiments, a nucleic
acid may be incorporated into a vector for expression in suitable
host cells. Alternatively, gene-targeting or gene-deletion vectors
may also be used to disrupt or ablate a gene. The vector may then
be introduced into one or more host cells by any method known in
the art. One method to produce an encoded protein includes
transforming a host cell with one or more recombinant nucleic acids
(such as expression vectors) to form a recombinant cell. The term
"transformation" is generally used herein to refer to any method by
which an exogenous nucleic acid molecule (i.e., a recombinant
nucleic acid molecule) can be inserted into a cell, but can be used
interchangeably with the term "transfection."
[0085] Non-limiting examples of suitable host cells include
photosynthetic bacteria, green algae, and cyanobacteria, including
naturally photosynthetic microorganisms or engineered
photosynthetic microorganisms. Exemplary microorganisms that are
either naturally photosynthetic or can be engineered to be
photosynthetic include, but are not limited to, bacteria; fungi;
archaea; protists; eukaryotes, such as a green algae; and animals
such as plankton, planarian, and amoeba. Examples of naturally
occurring photosynthetic microorganisms include Spirulina maximum,
Spirulina platensis, Dunaliella salina, Botrycoccus braunii,
Chlorella vulgaris, Chlorella pyrenoidosa, Serenastrum
capricomutum, Scenedesmus auadricauda, Porphyridium cruentum,
Scenedesmus acutus, Dunaliella Scenedesmus obliquus, Anabaenopsis,
Aulosira, Cylindrospermum, Synechoccus sp., Synechocystis sp.,
and/or Tolypothrix.
[0086] In exemplary embodiments, the host cell may be a microbial
cell, such as a cyanobacterial cell, and may be from any genera or
species of cyanobacteria that is genetically manipulable. Examples
of suitable cyanobacteria include the genus Synechocystis (e.g.,
strains such as Synechocystis sp. PCC 6803), Synechococcus,
Thermosynechococcus, Nostoc, Prochlorococcu, Microcystis, Anabaena,
Spirulina, and Gloeobacter.
[0087] Further examples of cyanobacteria suitable for use as host
cells in the methods described herein include Chroococcales
cyanobacteria from the genera Aphanocapsa, Aphanothece,
Chamaesiphon, Chroococcus, Chroogloeocystis, Coelosphaerium,
Crocosphaera, Cyanobacterium, Cyanobium, Cyanodictyon,
Cyanosarcina, Cyanothece, Dactylococcopsis, Gloecapsa, Gloeothece,
Merismopedia, Microcystis, Radiocystis, Rhabdoderma, Snowella,
Synychococcus, Synechocystis, Thermosenechococcus, and
Woronichinia; Nostacales cyanobacteria from the genera Anabaena,
Anabaenopsis, Aphanizomenon, Aulosira, Calothrix, Coleodesmium,
Cyanospira, Cylindrospermosis, Cylindrospermum, Fremyella,
Gleotrichia, Microchaete, Nodularia, Nostoc, Rexia, Richelia,
Scytonema, Sprirestis, and Toypothrix; Oscillatoriales
cyanobacteria from the genera Arthrospira, Geitlerinema,
Halomicronema, Halospirulina, Katagnymene, Leptolyngbya,
Lintnothrix, Lyngbya, Microcoleus, Oscillatoria, Phormidium,
Planktothricoides, Planktothrix, Plectonema,
Pseudoanabaena/Limnothrix, Schizothrix, Spirulina, Symploca,
Trichodesmium, and Tychonema; Pleurocapsales cyanobacteria from the
genera Chroococcidiopsis, Dermocarpa, Dermocarpella, Myxosarcina,
Pleurocapsa, Stanieria, and Xenococcus; Prochlorophytes
cyanobacteria from the genera Prochloron, Prochlorococcus, and
Prochlorothrix; and Stigonentatales cyanobacteria from the genera
Capsosira, Chlorogeoepsis, Fischerella, Hapalosiphon,
Mastigocladopsis, Nostochopsis, Stigonema, Symphyonema,
Symphonemopsis, Umezakia, and Westiellopsis. In certain
embodiments, the host cell may be from the genus Synechococcus,
such as Synechococcus bigranulatus, Synechococcus elongatus,
Synechococcus leopoliensis, Synechococcus lividus, Synechococcus
nidulans, and Synechococcus rubescens.
[0088] Host cells can be transformed, transfected, or infected as
appropriate with gene-disrupting constructs or plasmids (e.g., an
expression plasmid) by any suitable method including
electroporation, calcium chloride-, lithium chloride-, lithium
acetate/polyethylene glycol-, calcium phosphate-, DEAE-dextran-,
liposome-mediated DNA uptake, spheroplasting, injection,
microinjection, microprojectile bombardment, phage infection, viral
infection, or other established methods. Alternatively, vectors
containing a nucleic acid of interest can be transcribed in vitro,
and the resulting RNA introduced into the host cell by well-known
methods, for example, by injection. Exemplary embodiments include a
host cell or population of cells expressing one or more nucleic
acid molecules or expression vectors described herein (for example,
a genetically modified microorganism). The cells into which nucleic
acids have been introduced as described above also include the
progeny of such cells.
[0089] Vectors may be introduced into host cells such as
cyanobacteria by direct transformation, in which DNA is mixed with
the cells and taken up without any additional manipulation, by
conjugation, electroporation, or other means known in the art.
Expression vectors may be expressed by cyanobacteria or other host
cells episomally or the gene of interest may be inserted into the
chromosome of the host cell to produce cells that stably express
the gene with or without the need for selective pressure. For
example, expression cassettes may be targeted to neutral
cyanobacterial chromosomal sites by double recombination. In
certain embodiments, the gene encoding the ethylene-forming enzyme
is stable in the host cell for greater than 4, greater than 10,
greater than 25, greater than 50 or greater than 100 passages. In
some embodiments, the host cell expresses a function copy of the
ethylene-forming enzyme for greater than 4, greater than 10,
greater than 25, greater than 50 or greater than 100 passages.
[0090] Host cells with targeted gene disruptions or carrying an
expression vector (i.e., transformants or dories) may be selected
using markers depending on the mode of the vector construction. The
marker may be on the same or a different DNA molecule. In
prokaryotic hosts, the transformant may be selected, for example,
by resistance to ampicillin, tetracycline or other antibiotics.
Production of a particular product based on temperature sensitivity
may also serve as an appropriate marker.
[0091] Host cells may be cultured in an appropriate fermentation
medium. An appropriate, or effective, fermentation medium refers to
any medium in which a host cell, including a genetically modified
microorganism, when cultured, is capable of producing AKG, pyruvate
or ethylene. Such a medium is typically an aqueous medium
comprising assimilable carbon, nitrogen and phosphate sources, but
can also include appropriate salts, minerals, metals and other
nutrients. Microorganisms and other cells can be cultured in
conventional fermentation bioreactors or photobioreactors and by
any fermentation process, including batch, fed-batch, cell recycle,
and continuous fermentation. The pH of the fermentation medium is
regulated to a pH suitable for growth of the particular organism.
Culture media and conditions for various host cells are known in
the art. A wide range of media for culturing cyanobacteria, for
example, are available from ATCC.
[0092] Photosynthetic microorganisms may be cultured according to
techniques known in the art. For example, cyanobacteria may be
cultured or cultivated according to techniques known in the art
such as photobioreactor based techniques. One example of typical
laboratory culture conditions for cyanobacterium is growth in BG11
medium (ATCC Medium 616) at 30.degree. C., and 5% CO.sub.2 under 60
.mu.Em.sup.-2s.sup.-1 constant illumination from fluorescent bulbs,
with shaking for liquid cultures or without shaking for plates.
[0093] Methods for producing AKG, pyruvate or ethylene are also
disclosed herein. Cells may be cultured as described above and
exposed to a carbon source and light for production of AKG,
pyruvate or ethylene. Carbon sources include atmospheric carbon
dioxide or carbon dioxide provided from an artificial source such
as a compressed storage tank. Cultures may also be provided with
additional carbon sources such as sugars (e.g., glucose and other
saccharides). For phototrophic AKG, pyruvate or ethylene
production, cells may be exposed to either artificial light or
natural light such as sunlight. Nitrogen starvation may be achieved
by any conventional technique, such as resuspending cells in media
containing little or no nitrogenous compounds, or by replenishing
depleted media with fresh media containing little or no nitrogenous
compounds.
[0094] As used herein, "nitrogen starvation conditions" refers to
culturing cells in media that is substantially free of
nitrogen-containing compounds, for example, culturing cells in
nitrogen-depleted media. Nitrogen depleted media or conditions that
are substantially nitrogen free refers to media or conditions
wherein nitrogen ions are present at levels less than at most 200
.mu.M. Examples include nitrogen levels of 200, 150, 100, 50, 25 or
10 .mu.M or less. In certain embodiments, cells grown in
nitrogen-containing media may be subsequently cultured in
nitrogen-depleted media (for example, by isolating the cells and
resuspending the cells in nitrogen-depleted media, with or without
washing the cells in nitrogen-depleted media prior to the
resuspension. In some embodiments, cells cultured in
nitrogen-containing media may be supplemented with fresh
nitrogen-depleted media as the culture progresses.
[0095] Nitrogen-containing compounds may be added to cells growing
in nitrogen-depleted media to facilitate cell growth. In certain
embodiments, nitrogen-containing compounds may be added to cell
cultures to a final concentration of less than about 1 mM, or less
than about 900, 800, 700, 600, 500, 400, 300, 200, or 100
.mu.M.
[0096] Cell densities, light intensities, medium concentrations,
medium compositions and other culture conditions may be varied to
achieve peak AKG, pyruvate or ethylene production rates and/or
sustain AKG, pyruvate or ethylene production at peak rates.
Exemplary light conditions suitable for cell cultures include
growth under light (e.g., white light) of at least about 50, 100,
150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 .mu.E
m.sup.-2 s.sup.-1. Even higher light (e.g., up to about 2000 .mu.E
m.sup.-2 s.sup.-1) may be suitable for dense cultures, typically
with mixing. Examples include 800, 900, 1000, 1100, 1200, 1300,
1400, 1500, 1600, 1700, 1800, 1900, or 2000 .mu.E m.sup.-2
s.sup.-1
[0097] In certain embodiments, AKG or pyruvate culture
concentrations may be at least 100 mg L.sup.-1. Additional culture
concentrations of AKG or pyruvate that may be attained using the
methods herein include at least 10, 20, 50, 100, 200, 300, 400,
500, 600, 700, 800, 900, or 1000 mg L.sup.-1. In some embodiments,
AKG concentrations may be greater than 1000 mg L.sup.-1. For
example, AKG concentrations may be at least about 1000, 1500, 2000,
2500, 3000 or 3500 mg L.sup.-1. Pyruvate concentrations may be at
least about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 g
L.sup.-1. The peak ethylene production rate is the highest rate of
ethylene production attained for a given culture over a given time
period. In certain embodiments, ethylene is produced at a peak
production rate of at least 500 mL mL.sup.-1 hr.sup.-1. Additional
peak production rates that may be attained using the methods herein
include ethylene is produced at a peak production rate of at least
about 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, or 300 .mu.L
mL.sup.-1 hr.sup.-1. In some embodiments, ethylene may be produced
at a peak rate greater than 200 .mu.L mL.sup.-1 hr.sup.-1.
[0098] Cells may be cultured in batch fermentations and cells that
reach stationary phase may be resuspended in fresh medium to
continue ethylene production. The medium may be 1.times. in
concentration or may be increased anywhere from 1.times. to
5.times. to 10.times. or greater to support increased production.
Alternatively, medium components may be added back to the cultures
as they are depleted by the culture and/or waste products may be
removed from the cultures as they are produced.
[0099] AKG or pyruvate produced by the cell cultures may be
released from the cells and collect in the culture media. AKG or
pyruvate may be harvested or isolated from the cultures using any
means known in the art. For example, the cells may be separated
from the culture media and AKG or pyruvate separated from the
culture supernatant via conventional separation techniques. Cells
may also be lysed and AKG or pyruvate isolated from the cell
lysates via conventional separation techniques.
[0100] Ethylene produced by the cell cultures is released from the
cells and collects in the head space of the culture vessel.
Ethylene may be harvested from the cultures using any means known
in the art. For example, the culture vessel may contain collection
piping to remove ethylene from the head space by active or passive
processes. Culture vessel piping may be employed to both provide
carbon dioxide to the cells and to remove ethylene produced by the
cultures.
EXAMPLES
Example 1
[0101] The following materials and methods were used in subsequent
Examples detailed below.
Culturing Conditions
[0102] Synechocystis was cultured at 30.degree. C. in BG11 media
(phycology medium, Sigma-Aldrich, USA) supplemented with 20 mM TES
buffer and 100 mM NaHCO.sub.3 (with or without 3 .mu.M NiCl.sub.2)
under a constant light flux of approximately 50 to 60 .mu.E
m.sup.-2 s.sup.-1 supplied by cool white fluorescent lamps.
Cultures were shaken (liquid cultures; plates were not shaken) and
either bubbled with 2% CO.sub.2 in air or under a 5% CO.sub.2
headspace in air. When appropriate, plates were supplemented with
50 .mu.g/mL spectinomycin and liquid cultures were supplemented
with 25 .mu.g/mL spectinomycin. The antibiotics gentamicin and
kanamycin were used at 5 and 50 .mu.g/mL in liquid cultures for
inoculation from plates. Thereafter, the antibiotics were removed
for growth of cultures in BG11. The same growth conditions were
used for nitrogen starved cultures, except that the cells were
resuspended in BG11-N media, which is identical to the BG11 medium
except that the NaNO.sub.3 is replaced with NaCl (mole:mole). Cells
were harvested from log-phase cultures in replete medium
(OD.sub.730, 0.6-0.8; DW, 0.3-0.5 g/L) by centrifugation, washed,
resuspended in BG11-N and placed under the same light and
atmosphere conditions as above.
[0103] Optical density was measured at 730 nm with a Biowave II
UV/Vis spectrophotometer (Biochrom, Inc., Cambridge, England).
Absorbance of whole-cell suspensions of cultures were monitored in
a wavelength range of 300-800 nm each day with a spectrophotometer
(DU800, Beckman Coulter, USA). Concurrent measurements of dry
weight were measured by passing 5 mL culture through 0.45 micron
pre-weight filters (Pall Corporation, USA), which were subsequently
dried to constant mass at 55.degree. C. for several days and
re-weighed.
[0104] E. coli was grown using standard procedures in LB medium at
37.degree. C., supplemented with 50 .mu.g/mL spectinomycin as
appropriate.
Glycogen Content
[0105] Glycogen content was measured as described by Ernst et al.
(Archives of Microbiology 140:120-125 (1984)). Briefly, 1-2 mL of
cells were pelleted by centrifugation at 13,000.times.g for 5
minutes. To each pellet, 200 .mu.L of aqueous KOH (40% by weight)
was added. The alkaline suspensions were vortexed and then
incubated at 100.degree. C. for 1 hour. Subsequently, 600 .mu.L of
cold (0.degree. C.) absolute ethanol was added and this suspension
and was centrifuged at 13,000.times.g. The supernatant was
discarded and the pellet was washed with cold ethanol, dried under
air at 70.degree. C., and suspended in 1 mL of 200 mM sodium
acetate buffer (pH 4.75) containing 10 units amyloglucosidase
(Sigma). This solution was incubated at 37.degree. C. for at least
5 hours after which glucose concentrations were determined by a
glucose assay kit, which utilizes hexose kinase and NADH (Sigma).
Glycogen recovery by this method with known quantities of bovine
glycogen (Sigma) was greater than 95%.
Dry Weight Determination
[0106] Clear glass bottles (Wheaton, USA) with an approximate
capacity of 25 mL were cleaned, acid/base washed, and placed at
55.degree. C. for drying for several weeks. Exactly 50 mL of cells
were harvested each day, transferred to 50 mL conical tubes, and
centrifuged for 10 minutes at 4,000.times.g in a swinging bucket
rotor. Supernatants were carefully decanted, and approximately 5 mL
of deionized water was used to resuspend each of the remaining cell
pellets and rinse residual material from conical tubes. Cell
suspensions and rinses were transferred to a pre-weighed glass
bottle, which was returned to a 55.degree. C. oven for several
weeks until all moisture had evaporated (indicated by constant cool
dry mass). Weights were measured once for each culture per day.
Error bars represent 3 separate cultures.
Photosynthetic Fluorescence Parameters and O.sub.2 Evolution
[0107] Light-adapted variable fluorescence .DELTA.Fv/Fm' measures
the effective quantum efficiency of cyanobacteria assuming that the
phycobilin content of the cells is similar. A Closed Fluorocam
FC-800 C (Photon System Instruments, Czech Republic) was used to
measure .DELTA.Fv/Fm' daily with respect to nitrogen starvation
time under approximately 100 .mu.E m.sup.-2 s.sup.-1 light for
wild-type and AGP-cultures.
Oxygen Evolution
[0108] Whole-chain oxygen evolution for wild-type and AGP-cultures
were measured electrochemically with an oxygen electrode system
(Photon System Instruments) using a custom microelectrode from
Microelectrodes, Inc (New Hampshire, USA). Samples were prepared by
centrifuging 7 mL cells from culture and resuspending in 3.5 mL
photosynthesis buffer immediately before each time point was
collected. Photosynthesis buffer consisted of 20 mM TES, 100 mM
sodium bicarbonate, and 1 mM potassium phosphate. Oxygen
concentrations were determined every 100 ins, and the slope of the
rise in oxygen concentration in the presence of saturating red
light was taken as the relative whole-chain oxygen evolution rate,
which was normalized by the difference in voltage between
air-saturated buffer and dithionite-treated (anaerobic) buffer.
Intracellular Metabolite Concentrations
[0109] To determine metabolite concentrations, 2 mL of cells were
centrifuged at 13,000.times.g for 2 minutes. The cell pellet was
then placed on dry ice after decanting the supernatant. Pellets
were stored at -80.degree. C. until extraction. For extraction, 2
mL of boiling 70% ethanol in water was poured over the frozen
pellet. The mixture was then incubated at 100.degree. C. for 4
minutes and subsequently centrifuged at 13,000.times.g for 4
minutes. The supernatant in 70% ethanol was dried at 37.degree. C.
under a steady stream of nitrogen gas, followed by adding 40 .mu.L
of 20 mg/mL methoxyamine hydrochloride in pyridine. The resulting
suspension was vortexed for 2 minutes and subsequently incubated at
37.degree. C. for 90 minutes, sealed with Teflon-coated rubber
screw-caps. Then, 60 .mu.L MSTFA
(N-methyl-N-trimethylsilyltrifluoroacetamide)+1% TMCS
(Trimethylchlorosilane) was added to the suspension, followed by
vortexing, and sealed incubation for 30 minutes at 55.degree.
C.
[0110] One microliter of the resulting suspension was injected into
a GC/MS (gas chromatograph/mass spectrometer) using a splitless
injector. The system used a 7890A GC system and a 5975C inert XL
MSD (mass selective detector) with a Tripple Axis Detector (Agilent
Technologies Inc., USA). Inlet temperature was 225.degree. C. and
compounds were separated using a 30 in DB-35MS column (Agilent
Technologies Inc.) with Helium carrier gas and a flow rate of 1
mL/min. GC parameters included 50.degree. C. isothermal heating for
2 minutes followed by a 5.degree. C./min increase to 150.degree.
C., a hold for 2 minutes at 150.degree. C., and a second
temperature ramping phase of 7.degree. C./min to 320.degree. C. and
a 2 minute hold at 320.degree. C. The MSD transfer line was
maintained at 280.degree. C. The MS quadrupole and MS source
temperature were maintained at 150.degree. C. and 230.degree. C.,
respectively. Compounds were detected using the scan mode with a
mass detection range of 40-500 atomic mass units (amu).
[0111] Chromatograms were analyzed with MSD Enhanced ChemStation
data analysis sothvare (Agilent Technologies Inc.). Identities of
compounds were based on retention time and MS spectral parameters
from pre-run standard compounds. Unique m/z ions (target ions) were
selected for each compound for manual quantification based on
target ion peak areas. Concentration amounts were estimated based
on the target ion peak area of the signal relative to this peak
response of the pre-run standard at a concentration of 0.1
mg/mL.
Measuring Extracellular AKG Concentrations
[0112] High-performance liquid chromatography (HPLC) was used to
measure alpha ketoglutarate (AKG) concentrations. Briefly, 2 mL
cell suspensions from cultures were taken and passed through a 0.45
.mu.M filter (Pall Corporation, USA). The resulting cell-free
solution was used for injection (100 .mu.L) into an Agilent 1200
HPLC. The HPLC was run at 45.degree. C. with a 4 mM aqueous
sulfuric acid mobile phase and a Biorad HPLC Organic Acid Analysis
(Aminex HPX-87H Ion exchange) column with a refractive index
detector. AKG gave a linear response between a concentration range
of 25 .mu.M and 10 mM.
[0113] The identity of AKG was also confirmed by GC/MS and proton
nuclear magnetic resonance (NMR) spectroscopy. The GC/MS protocol
for extracellular media was used as described above, except cell
media (2 mL) was dried under nitrogen, rather than a 70% cell
extract. Proton NMR was measured by drying 2 mL of cell extract in
70% ethanol followed by addition of 1 mL deutorated water (Sigma).
From the resulting solution, 600 .mu.L was added to a pyrex NMR
tube (5 mm diameter, 7 inch length). The sample was measured with
512 scans in a 500 MHz Varian Spectrometer.
Carbon-13 Isotope Labeling
[0114] Cells cultured in (nutrient replete) BG11 were resuspended
in BG11-N medium with some sodium bicarbonate replaced with
.sup.13C sodium bicarbonate (Sigma-Aldrich, USA) as indicated by
percentages (final concentration of .sup.12C+.sup.13C sodium
bicarbonate, 100 mM). Cell-free medium following 1-day of growth in
BG11-N was collected, and proton NMR spectra were determined as
above. Carbon spectra were collected on a 400-MHz Varian
spectrometer at 25.degree. C. (18,000 scans with a relaxation delay
of 1 s). All spectra were processed using MestReNova software v
6.0.4 (Mestrelab Research S.L., Santiago de Compostela, Spain).
Ethylene Production Assay
[0115] Stationary phase cultures were diluted to a starting
OD.sub.730 of approximately 0.2. Each day for the duration of the
experiment 2 mL of culture was transferred into a 13 mL Hungate
tube and incubated for 4 hours while shaking in 60
.mu.m.sup.-2s.sup.-1 light. The ethylene produced was then
quantified using gas chromatography.
Example 2
Mutagenesis and Creation of Mutant Strains
[0116] As depicted in FIG. 12, fusion PCR was used to create a gene
deletion DNA fragment that was composed of approximately 600 by
immediately upstream the glgC gene fused to a DNA fragment of the
genR coding sequences from the pUC119 DNA followed by approximately
600 by immediately downstream the glgC gene. This construct was
transformed into a glucose tolerant strain of Synechocystis and
selected over time on standard BG11 agar plates containing
gentamicin. Transgenic lines were screened by PCR followed by
western blot and glycogen assay for a complete depletion of the
glgC gene, AGP protein and glycogen, respectively. Herein we refer
to the generated mutant strain as the AGP-strain as an indication
that this strain lacks an ADP-glucose pyrophosphorylase.
[0117] A specific ORF replacement of the glgC gene (ski 176) with a
gentamicin-resistance gene was performed using homologous
recombination. A gene deletion construct was created using fusion
PCR that contained flanking regions of the glgC gene and the
pUC119-gen plasmid (PCR primers described in Table 1), using KOD
Hot Start DNA Polymerase (Novogen) under standard conditions.
Transformation of wild type was performed using the created
gene-deletion construct. Selection was performed on agar plates
with BG-11 (10 mM NaHCO.sub.3, gentamicin between 20 and 50
.mu.g/mL). Segregation of the mutation was verified by PCR product
analysis (FIG. 13) using primers listed in Table 1. Glycogen
determination, glucosyiglycerol determination by HPLC, and western
blot protein analysis demonstrated that the glgC mutant is a fully
segregated mutant. For western blotting, protein was isolated from
logarithmically growing cultures, extracted, and quantified.
Proteins were separated using Mini Protean TGX Gels (Biorad), and
blotted using Fast Semi Dry Blotter (Pierce) onto PVDF (Biorad)
membranes. A custom peptide primary antibody for GlgC (YenZym
Antibodies, LLC) was used in conjunction with Goat Anti-Rabbit
secondary antibody (Pierce) and a CN/DAB Substrate Kit (Thermo
Scientific).
[0118] Synechocystis sp. PCC 6803 strain .DELTA.glgC psbA2::glgC
was constructed from the .DELTA.glgC line above with the pPSBA2KS
vector altered by removal of the SalI site via partial digest and
blunting to allow for retention of the kanamycin resistance gene.
The glgC gene was amplified from genomic DNA isolated from WT by
PCR and inserted into the vector between the NdeI and SalI
restriction sites. Transformation was conducted by incubation of
approximately 1 .mu.g of the integration vector for 6 hours with
200 .mu.L cells (adjusted to optical density of 2.5 from
logarithmic-phase cultures), followed by addition of 2 mL BG11, 24
hours outgrowth in culture tubes under standard growth conditions,
and plating of 200 .mu.L on BG11 plates with 200 .mu.g/mL
kanamycin. The mutation was verified by PCR product analysis using
primers listed in Table 1.
TABLE-US-00001 TABLE 1 SEQ ID NOs Fusion PCR Primers 5'agpF
GTCATGCCAATGCCGTTATC SEQ ID NO: 5 agp/gn atgR
CATCGTTGCTGCTGCGTAACATTTCGAAGTCAAGTTTAGAACAGAGG SEQ ID NO: 6 agp/gn
atgF CCTCGGTTCTAAACTTGACTTCGAAATGTTACGCAGCAGCAACGATG SEQ ID NO: 7
agp/gn taaR GTGCGAGGAAAGAAACTGGCCTAAGGTGGCGGTACTTGGGTCG SEQ ID NO:
8 agp/gn taaF CGACCCAAGTACCGCCACCTAAGGCCAGTTTCTTTCCTCGCAC SEQ ID
NO: 9 3'agpR GGTGAACGACAAAGCCAGTTA SEQ ID NO: 10 Genomic
Segregation Screening 5'outagpF CAGATGGCCCGCTGTTTATT SEQ ID NO: 11
agpR AACAACCAGAGGTATTGCCG SEQ ID NO: 12 GentintR
AAGAAGCGGTTGTTGGCGC SEQ ID NO: 13 PsbA2outF CCCATTGCCCCAAAATACATC
SEQ ID NO: 14
Example 3
[0119] Growth properties of Cyanobacterial Strains
[0120] As shown in FIG. 2A, the growth rates of wild-type and
AGP-cultures in fiill-nitrate medium are nearly identical. However,
these strains behave differently under nitrogen starvation (FIGS.
2B and C). Wild-type cultures of Synechocystis 6803 nearly double
in optical density (FIG. 2B) before reaching a steady state over 5
days of incubation in BG11-N. This behavior mimics the trends seen
for dry weight measurements taken over a period of nitrogen arrest
(FIG. 9). The AGP-strain remains blue-green over this period of
time, and does not increase in optical density or cell dry weight.
Nitrogen starvation of Synechocystis sp. PCC 6803 and other
non-diazotrophic cyanobacteria typically leads to a reduction in
phycobilin proteins, resulting in a culture color change from
blue-green to yellow-green, a process sometimes referred to as
"bleaching".
Example 4
Cyanobacterial Strain Characteristics
[0121] FIG. 3 displays glycogen content as a percentage of cell dry
weight in both wild-type (WT) and AGP-strains under growth in BG11
or incubation in BG11-N. No detectable amounts of glycogen were
observed in the AGP-strain under either condition (detection limit
0.2% of dry weight), but the glycogen content of wild-type cells
nearly tripled after 3 days of incubation in BG11-N. That the
optical densities and dry weights (FIGS. 8 and 9) of AGP-cultures
do not substantially change over the course of nitrogen starvation
suggests two possibilities: (1) photosynthesis of the AGP-strain
fixes no (or very little) net carbon, or (2) the AGP-strain is
producing another product from its fixed carbon that does not
contribute to cell dry weight (e.g. is excreted into the
medium).
[0122] To investigate these two possibilities, the effective
quantum efficiency of light-adapted cells (a relative indicator of
photochemical reactions) was examined under a constant light source
(FIG. 4). This measurement can be reliably obtained from
cyanobacterial cells that do not change phycobilin content, which
appeared to be the case for the AGP-strain, as the color of these
cultures does not change with respect to time, and the absorbencies
of whole-cell suspensions at 630 nm (phycobilins) and 680 nm
(chlorophyll) do not change substantially in the AGP-strain (FIG.
10). The light-adapted quantum efficiency (.DELTA.F/Fm') for
AGP-cells remains relatively constant for up to 5 days incubation
in BG11-N (FIG. 4). This may indicate that photosynthesis under
non-saturating light (.about.100 .mu.E m.sup.-2 s.sup.-1) leads to
continuous fixation of CO.sub.2 at the same rate at non-nitrogen
starved conditions (time=0 days) as after 5 days of nitrogen
starvation (time=5 days).
[0123] The relationship between photosynthetic capacity and
nitrogen starvation was also examined. Whole-chain oxygen evolution
under saturating light conditions was measured for wild-type and
AGP-cultures (FIG. 5). Evolution rates are reported as a percentage
of non-nitrogen starved cultures (day 0 cultures), but evolution
rates normalized to chlorophyll content at this time point were
within error (.about.200 .mu.mol O.sub.2 mg chla.sup.-1hr.sup.-1).
Normalizing to Chlorophyll content was not appropriate for cultures
starved of nitrogen for any period of time, as chlorophyll
concentrations degrade slightly with nitrogen starvation, which
would artificially increase apparent evolution rates. FIG. 5 shows
that O.sub.2 evolution rates of both wild-type and AGP-cultures
decline. However, the AGP-cultures decline at a rate similar to or
slower than that of the wild-type. These results indicate that AGP
deletion also causes a non-bleaching phenotype under nitrogen
starvation, but does not lead to significantly higher decline in
photosynthesis capacity relative to the wild-type strain. This in
turn suggests that the cells are fixing CO.sub.2 and directing the
resulting photosynthate into a product that does not contribute to
dry weight.
Example 5
AKG Production
[0124] Intracellular concentrations of some metabolites in both
wild-type and AGP-strains were measured by GC/MS for log-phase
(nitrogen replete) and nitrogen starved (2-days) cultures. Previous
results suggested that a fraction of photosynthate may have been
redirected into sucrose, a known secondary osmolyte, which has been
shown to increase in some salt-treated cells of Synechocystis 6803.
FIG. 6A shows that this is not the case, as the AGP-cultures in
both N+ and N- conditions have less sucrose than wild-type strains.
Measurements of some citric acid cycle intermediates (citric acid,
fumaric acid, and alpha ketoglutarate) indicate that flux has
instead been directed (at least in part) to the citric acid cycle
in APG-cultures lacking nitrogen (FIGS. 6B-D). In the absence of
available nitrogen from growth media (in the form of ammonium,
nitrate, or urea) or from phycobilin degradation, AKG, which is
produced irreversibly from isocitrate via isocitrate dehydrogenase,
is a "dead end" product. In other words, AKG apparently cannot be
further metabolized by cells in the absence of NH.sub.4.sup.+, and
therefore accumulates to high concentrations. In fact, AKG is known
to be the signaling molecule for sensing carbon:nitrogen ratio
status intracellularly in cyanobacteria.
[0125] Examination of extracellular media by HPLC revealed a
substantial accumulation of AKG in nitrogen-starved AGP-cultures
(FIG. 7). The identity of this extracellular metabolite was
confirmed by GC/MS (of derivatized dried cell media). Proton NMR
spectra of ethanol extracts of nitrogen-starved AGP-cells also
showed a high abundance of AKG. For approximately 4-5 days of
incubation in BG11-N, linear amounts of AKG are
produced--consistent with the observation that low-light
photosynthesis effective quantum yield is constant for this period
of time (FIG. 4).
[0126] FIG. 8 illustrates the redistribution of mass from cellular
constituents in the wild-type strain, to excreted alpha
ketoglutarate in the AGP-strain. While the total amount of material
made photosynthetically from the AGP-strain (sum of stacked values)
is similar to that of wild-type dry weight, approximately 50% of
the total amount of mass is in the form of one excreted product in
the AGP-strain: alpha ketoglutarate.
Example 6
Pyruvate Production
[0127] Proton NMR studies indicating the presence of AKG also
revealed two additional peaks in this material, at ppm shifts of
2.38 and 1.44 relative to the NMR internal standard trimethylsilyl
propionate, TSP. We designed a medium that is proton NMR silent.
That is, the cells were suspended in a medium that does not have
abundant peaks by proton NMR and incubated under standard nitrogen
starvation conditions. (Our standard BG-11 medium uses TES buffer,
citric acid, and ETDA, all of which have proton NMR signatures; the
new buffer is standard BG-11 with NaNO.sub.3 replaced with NaCl,
mole for mole, and with TES, citric acid, and Na.sub.2EDTA removed
with no substitutions). In doing so, additional peaks were observed
in this buffer that grew with respect to days of nitrogen
starvation.
[0128] The predominant peak is at a shift (with respect to TSP) of
2.36 ppm. This peak can be matched to either succinate or pyruvate
in proton NMR libraries. However, an additional peak is found at
1.47 ppm that is not present in succinate standards. Samples of
NMR-silent buffers in which cells had been nitrogen starved
revealed a new peak, previously unidentified because it has the
same retention time as TES. A standard of sodium pyruvate was
prepared in this buffer and had a matching retention time. Thus,
HPLC and proton NMR analyses confirmed that pyruvate is a second
metabolite produced by AGP-cells under nitrogen starvation.
Pyruvate and AKG account for approximately 85+/-11% of fixed
carbon.
Example 7
Construction of Stable, Ethylene Producing Strains of
Synechocystis
[0129] To generate petE:EFE, a modified P syringae efe gene was
synthesized in pUC57 vector. The efe coding region was excised from
pUC57 with LguI and transferred to pPETE cut with the same enzyme.
This placed efe under the control of the plasmid-born petE
promoter. This plasmid was named pJU101. NU101 was then integrated
into the chromosome of Synechocystis via double recombination into
the slr0168 region as previously described (Zang et al., J.
Microbiol, 45:241-245 (2007)). To generate psbA:EFE, the 5' end of
the modified efe was synthesized, with the first 75 by of the pea
plant chloroplast psbA promoter attached in vector pUC57. The psbA
promoter and efe coding region were excised from pUC57 with Sinai
and BsrGI and transferred to NU101 cut with the same enzymes. This
restored the full coding region of efe while simultaneously
replacing the petE promoter with the psbA promoter. This plasmid,
named pJU102, was then integrated into the chromosomes of
Synechocystis via double recombination into the slr0168 region.
[0130] To make a second plasmid for integration into an alternate
genomic site, efe was cloned from pJU102, cut with EcoRI and XhoI,
and placed into the SalI and NcoI sites of pPSBA2KS. This plasmid,
named pJU112, was then integrated into the chromosomes of the
Synechocystis containing the first copy of efe via double
recombination into the psbA2 locus to generate the
2.times.psbA:Sy-efe strain.
[0131] Previous attempts to engineer cyanobacteria to produce
ethylene were unsuccessful because the efe gene was readily
inactivated within three generations of successive culture growth
(see Takahama et al., J. Biosci. Bioeng. 95:302-305 (2003)).
Inactivation of the efe gene appeared to result from specific
duplications at certain mutation hot spots within the gene, leading
to truncated peptides. To overcome this stability issue, several
silent mutations were made in the P. syringae efe sequence that
eliminated the potential mutation hotspots while retaining the
correct amino acid sequence of EFE. In addition, we codon-optimized
the sequence of efe for improved expression in Synechocystis.
[0132] The nucleic acid sequence of the modified efe gene is shown
in FIG. 22 and is represented as SEQ ID NO:3. The amino acid
sequence of the product of the modified efe gene is shown in FIG.
23 and is represented as SEQ ID NO:4. The modified efe was placed
under the control of either the copper regulated petE promoter or
the constitutive pea plant psbA promoter. The efe gene and an
accompanying spectinomycin resistance cassette were inserted into
the chromosome of Synechocystis at a neutral site (s/r0168) via
double recombination.
[0133] A second source of instability of efe in previous studies
was the apparent metabolic burden that ethylene production imposed
on the organism. Previous work showed that EFE significantly
reduced a strain's specific growth rate, thereby applying a strong
selection pressure for cells that harbor non-functional copies of
efe (see Sakai et al., J. Ferment. Bioeng. 84:434-443 (1997) and
Takahama et al., J. Biosci. Bioeng. 95:302-305 (2003)). Colonies
expressing a functional copy of efe also appeared yellow,
indicating stress caused be expression of the efe gene. The
modified efe gene was expressed in Synechocystis and no repression
of growth rate was observed (see FIG. 15), suggesting no or less
metabolic burden resulting from EFE. This reduced selection against
functional copies of efe, resulting in increased stability of efe
in the efe-expressing Synechocystis strains. Additionally,
ethylene-producing colonies of Synechocystis appeared indiscernible
from wild-type colonies of the same strain, further suggesting
decreased metabolic stress from EFE expression.
Example 8
[0134] Ethylene Production Driven by the petE and psbA
Promoters
[0135] The modified efe was initially expressed under the control
of the copper-inducible petE promoter to impart stability to the
system by not inducing expression of efe until stationary phase.
For comparison, modified efe was also expressed from the pea plant
chloroplast genome psbA constitutive promoter. Ethylene production
rates of the two recombinant strains were compared using gas
chromatography and ethylene production was observed to peak early
in growth and then fall off as the culture enters stationary phase
(see FIG. 16A). Diluting the stationary cultures with fresh medium
reinitiated log phase growth and restored peak ethylene production
rates (See FIG. 16B). These data suggest that the observed decrease
in ethylene production was not due to inactivation of the efe
gene.
[0136] Higher EFE protein levels were also observed with the
expression of efe from the psbA promoter compared to the petE
promoter. The increase in expression from the psbA promoter was
corroborated by a 10-fold higher ethylene production from this
strain (see FIG. 16A). The psbA:EFE lines were then examined to
determine if ethylene production could be stably maintained over
several generations in this strain. In order to examine stability
of this ethylene producing strain, the cultures were serially
passed through 4 generations of growth and ethylene production was
measured daily for 10 days with each generation. In contrast to
previous studies in which the ability of a culture to produce
ethylene decreased over successive generations and had completely
disappeared after three generations (Takahama et al., J. Biosci.
Bioeng. 95:302-305 (2003)), consistent rates of ethylene production
were maintained through the course of 4 serial passages of the same
culture (see FIG. 16B). This suggests that the Synechocystis strain
was capable of maintaining a functional copy of the modified efe
gene over multiple serial passages of the culture.
Example 9
Effect of Medium on Ethylene Production
[0137] Ethylene production peaks early in the culture's growth
period and typically falls off as the culture ages (see FIG. 16B).
Ethylene production rates were restored each time in successive
subculture, indicating that the decrease in ethylene production was
not due to inactivation of efe. One possible reason for the
apparent decrease in ethylene production is that light, carbon, or
another nutrient becomes limiting as the culture reaches stationary
phase. In order to elucidate the limiting component(s) for ethylene
production, a stationary phase culture in which ethylene production
had nearly ceased was divided and transferred to cultures with high
light (150 .mu.m.sup.-2s) exposure, added additional nitrogen, or
fresh growth medium.
[0138] The culture that was supplemented with additional ammonium
displayed a repressed ethylene production rate compared to the
control (see FIG. 17A). The culture that was transferred to high
light reached a significantly higher density. However, this culture
produced a similar amount of ethylene as the control despite the
fact that there were 1.5 times as many cells in the culture. In
contrast, the culture that was resuspended in fresh medium reached
a similar density as the control yet produced more ethylene.
Collectively, these findings suggest that maximum cell density and
ethylene production are limited by independent factors, with light
limiting the final cell density and component(s) of the medium
limiting ethylene production.
[0139] To determine whether increasing the medium concentration
could further stimulate ethylene production, medium concentrations
ranging between 1.times. and 10.times. were tested. Increasing the
medium concentration as much as 10-fold indeed promoted increasing
rates of ethylene production (see FIG. 17B). 10.times. medium led
to a 2-fold increase in total ethylene production relative to
1.times. medium, producing a peak rate of 700 nL mL.sup.-1
hr.sup.-1.
[0140] The ability of medium replenishment to restore ethylene
production from a culture that had ceased to produce ethylene was
also investigated. A stationary phase culture that had lost its
ability to produce ethylene was resuspended in fresh 5.times.
medium at the beginning of each week for a month. Ethylene
production was measured each day over the course of the experiment.
Ethylene production from a small sample of the culture was also
measured before it was resuspended to confirm that the culture had
ceased to produce high levels of ethylene prior to resuspension.
High-level ethylene production was determined to resume immediately
after resuspension in fresh medium; reaching a peak three days
later and then declining thereafter. Additionally, each time the
medium was refreshed, the peak production rate for that culture
also increased, eventually reaching a maximum of 1500 nL mL.sup.-1
hr.sup.-1 (see FIG. 17C). These findings suggest that a culture
will maintain high-level ethylene production provided the problem
of medium limitation is alleviated.
Example 10
Expression of Multiple Copies of EFE
[0141] Because expression of EFE produced no apparent metabolic
burden on Synechocystis, ethylene production in strains expressing
a second copy of efe was investigated. The second copy of efe was
also under control of the pea plant psbA promoter, and was
integrated into the Synechocystis genome at the psbA2 locus along
with a kanamycin resistance cassette. Increased expression of EFE
was verified by Western blotting. Comparison of ethylene production
between strains with a single or double copy of efe showed that a
second copy of efe doubled the ethylene output (FIG. 18).
Furthermore, the strain with a second copy of efe exhibited growth
characteristics similar to wild type (Table 2), suggesting that
increased ethylene production does not pose a severe metabolic
burden.
TABLE-US-00002 TABLE 2 Strain Generation time (h) wild type 10.7
+/- 0.41 psbA:Sy-efe 11.0 +/- 0.58 2X psbA:Sy-efe 10.9 +/- 0.63
Example 11
Ethylene Production in Semi-continuous Culture
[0142] Since depletion of medium components limits ethylene
productivity, regular medium replenishment should sustain high
level production. To test this, ethylene production in
semi-continuous culture expressing either one or two copies of efe
was examined. A stationary-phase culture was diluted to an
OD.sub.730 of 0.25, allowing it to resume log phase growth. Seven
days later, the culture reached stationary phase and ceased
producing significant amounts of ethylene. The culture was then
spun down and resuspended at the same cell concentration in fresh
5.times.BG11. The process of resuspending the previous culture
(without dilution) in fresh 5.times.BG11 was repeated weekly for 3
additional weeks. Ethylene production was measured each day over
the course of the experiment. High-level ethylene production
resumed immediately after resuspension in fresh medium, reaching a
peak 24 hours later and declined thereafter (FIG. 19). Each time
the medium was refreshed, growth resumed, and the peak production
rate for that culture also increased, eventually reaching a maximum
of 3100 .mu.L L.sup.-1 h.sup.-1 at OD.sub.730 of approximately 20.
Specific activity generally decreased as the culture density
increased, but was more than offset by the increase in culture
density, resulting in higher total production from high density
cultures.
[0143] Weekly media replacement was insufficient to sustain
ethylene production at the peak level (3100 .mu.L L.sup.-1
h.sup.-1) for longer than one day; thus conditions more closely
resembling continuous culture were investigated to determine if
this would extend ethylene production at the maximum rate. Daily
media refreshment was performed to maintain a specific culture
density. A culture expressing two copies of efe was concentrated to
an initial density of OD.sub.730 15.0. Each day for three weeks the
culture was spun down and resuspended at this same density;
ethylene production was measured after each resuspension. Under
these conditions the peak production rate of 3100 .mu.L L.sup.-1
h.sup.-1 was maintained continuously (FIG. 19). This finding
indicates that the peak rates reported in this study resemble the
continuous rate that can be expected using continuous culture.
Example 12
Effect of Light Intensity on Ethylene Production
[0144] Increases in total productivity can be achieved by using
cultures of increasing density. The potential to obtain a similar
increase in production on a per cell basis was also investigated.
Growing cells at very high density can result in light limitation
due to self shading, so alleviating this limitation could increase
the specific productivity. The effect of various light intensities,
up to 350 .mu.E, on specific ethylene production was examined. The
results presented in FIG. 20B demonstrate that specific
productivity increases with increasing light intensity. With high
light intensity, a measured total productivity of 2500 mL mL.sup.-1
hr.sup.-1 was achieved (see FIG. 20A). This production rate
resulted from a combination of increased specific productivity
while maintaining the high culture density that previously yielded
a production rate of 1500 mL mL.sup.-1 hr.sup.-1, rather than just
using more cells to generate increasing ethylene production
rates.
[0145] The effect of high light (600 .mu.E m.sup.-2s.sup.-1) on
ethylene production rates of high cell density (OD.sup.730
.about.15.0) was also examined. Cultures expressing either one or
two copies of efe were resuspended in fresh 5.times.BG11 to a
density of OD.sub.730 approximately 15 and placed under all white
Diamond series LED lights (Advanced LED Lights) with 600 .mu.E
m.sup.-2s.sup.-1 reaching the culture. Ethylene production was
measured daily for a week. As shown in FIG. 21, high light (600
.mu.E m.sup.-2s.sup.-1) approximately doubled the ethylene
production from both strains compared to 50 .mu.E m.sup.-2s.sup.-1,
with the peak rate reaching 5700 .mu.L L.sup.-1 h.sup.-1 for the
strain expressing two copies of efe. The culture growing in high
light also reached a higher density than the one grown in low
light.
Example 13
Ethylene Production in Sea Water
[0146] Competition for fresh water and arable land is a serious
concern for biofuel production. To determine whether sea water
could serve as a substitute for 5.times.BG11, ethylene production
in the presence of regular seawater, 5.times.BG11 media, or
5.times.BG11 medium made with sea water was examined. Filter
sterilized sea-pure (Caribsea) ocean water was used to substitute
for BG11 in sea-water experiments. Ethylene production was impaired
in sea water; however, seawater supplemented with 4 mg/L phosphate
and 150 mg/L nitrate (the same concentrations that are used in
5.times.BG11) could support growth and ethylene production at rates
comparable to those observed with 5.times.BG11 medium (FIG. 24).
Replacing growth medium with supplemented sea water can lower the
production cost of ethylene and conserve fresh water for other
uses. Furthermore, photosynthetic ethylene production could be
located in brackish water bodies, sea bay or coastal areas where it
would not compete for arable land and fresh water.
[0147] The Examples discussed above are provided for purposes of
illustration and are not intended to be limiting. Still other
embodiments and modifications are also contemplated.
[0148] While a number of exemplary aspects and embodiments have
been discussed above, those of skill in the art will recognize
certain modifications, permutations, additions and sub combinations
thereof. It is therefore intended that the following appended
claims and claims hereafter introduced are interpreted to include
all such modifications, permutations, additions and
sub-combinations as are within their true spirit and scope.
Sequence CWU 1
1
1411320DNASynechocystis sp. PCC 6803CDS(1)..(1320) 1gtg tgt tgt tgg
caa tcg aga ggt ctg ctt gtg aaa cgt gtc tta gcg 48Val Cys Cys Trp
Gln Ser Arg Gly Leu Leu Val Lys Arg Val Leu Ala 1 5 10 15 att atc
ctg ggc ggt ggg gcc ggg acc cgc ctc tat cct tta acc aaa 96Ile Ile
Leu Gly Gly Gly Ala Gly Thr Arg Leu Tyr Pro Leu Thr Lys 20 25 30
ctc aga gcc aaa ccc gca gtt ccc ttg gcc gga aag tat cgc ctc atc
144Leu Arg Ala Lys Pro Ala Val Pro Leu Ala Gly Lys Tyr Arg Leu Ile
35 40 45 gat att ccc gtc agt aat tgc atc aac tca gaa atc gtt aaa
att tac 192Asp Ile Pro Val Ser Asn Cys Ile Asn Ser Glu Ile Val Lys
Ile Tyr 50 55 60 gtc ctt acc cag ttt aat tcc gcc tcc ctt aac cgt
cac atc agc cgg 240Val Leu Thr Gln Phe Asn Ser Ala Ser Leu Asn Arg
His Ile Ser Arg 65 70 75 80 gcc tat aat ttt tcc ggc ttc caa gaa gga
ttt gtg gaa gtc ctc gcc 288Ala Tyr Asn Phe Ser Gly Phe Gln Glu Gly
Phe Val Glu Val Leu Ala 85 90 95 gcc caa caa acc aaa gat aat cct
gat tgg ttt cag ggc act gct gat 336Ala Gln Gln Thr Lys Asp Asn Pro
Asp Trp Phe Gln Gly Thr Ala Asp 100 105 110 gcg gta cgg caa tac ctc
tgg ttg ttt agg gaa tgg gac gta gat gaa 384Ala Val Arg Gln Tyr Leu
Trp Leu Phe Arg Glu Trp Asp Val Asp Glu 115 120 125 tat ctt att ctg
tcc ggc gac cat ctc tac cgc atg gat tac gcc caa 432Tyr Leu Ile Leu
Ser Gly Asp His Leu Tyr Arg Met Asp Tyr Ala Gln 130 135 140 ttt gtt
aaa aga cac cgg gaa acc aat gcc gac ata acc ctt tcc gtt 480Phe Val
Lys Arg His Arg Glu Thr Asn Ala Asp Ile Thr Leu Ser Val 145 150 155
160 gtg ccc gtg gat gac aga aag gca ccc gag ctg ggc tta atg aaa atc
528Val Pro Val Asp Asp Arg Lys Ala Pro Glu Leu Gly Leu Met Lys Ile
165 170 175 gac gcc cag ggc aga att act gac ttt tct gaa aag ccc cag
ggg gaa 576Asp Ala Gln Gly Arg Ile Thr Asp Phe Ser Glu Lys Pro Gln
Gly Glu 180 185 190 gcc ctc cgg gcc atg cag gtg gac acc agc gtt ttg
ggc cta agt gcg 624Ala Leu Arg Ala Met Gln Val Asp Thr Ser Val Leu
Gly Leu Ser Ala 195 200 205 gag aag gct aag ctt aat cct tac att gcc
tcc atg ggc att tac gtt 672Glu Lys Ala Lys Leu Asn Pro Tyr Ile Ala
Ser Met Gly Ile Tyr Val 210 215 220 ttc aag aag gaa gta ttg cac aac
ctc ctg gaa aaa tat gaa ggg gca 720Phe Lys Lys Glu Val Leu His Asn
Leu Leu Glu Lys Tyr Glu Gly Ala 225 230 235 240 acg gac ttt ggc aaa
gaa atc att cct gat tca gcc agt gat cac aat 768Thr Asp Phe Gly Lys
Glu Ile Ile Pro Asp Ser Ala Ser Asp His Asn 245 250 255 ctg caa gcc
tat ctc ttt gat gac tat tgg gaa gac att ggt acc att 816Leu Gln Ala
Tyr Leu Phe Asp Asp Tyr Trp Glu Asp Ile Gly Thr Ile 260 265 270 gaa
gcc ttc tat gag gct aat tta gcc ctg acc aaa caa cct agt ccc 864Glu
Ala Phe Tyr Glu Ala Asn Leu Ala Leu Thr Lys Gln Pro Ser Pro 275 280
285 gac ttt agt ttt tat aac gaa aaa gcc ccc atc tat acc agg ggt cgt
912Asp Phe Ser Phe Tyr Asn Glu Lys Ala Pro Ile Tyr Thr Arg Gly Arg
290 295 300 tat ctt ccc ccc acc aaa atg ttg aat tcc acc gtg acg gaa
tcc atg 960Tyr Leu Pro Pro Thr Lys Met Leu Asn Ser Thr Val Thr Glu
Ser Met 305 310 315 320 atc ggg gaa ggt tgc atg att aag caa tgt cgc
atc cac cac tca gtt 1008Ile Gly Glu Gly Cys Met Ile Lys Gln Cys Arg
Ile His His Ser Val 325 330 335 tta ggc att cgc agt cgc att gaa tct
gat tgc acc att gag gat act 1056Leu Gly Ile Arg Ser Arg Ile Glu Ser
Asp Cys Thr Ile Glu Asp Thr 340 345 350 ttg gtg atg ggc aat gat ttc
tac gaa tct tca tca gaa cga gac acc 1104Leu Val Met Gly Asn Asp Phe
Tyr Glu Ser Ser Ser Glu Arg Asp Thr 355 360 365 ctc aaa gcc cgg ggg
gaa att gcc gct ggc ata ggt tcc ggc acc act 1152Leu Lys Ala Arg Gly
Glu Ile Ala Ala Gly Ile Gly Ser Gly Thr Thr 370 375 380 atc cgc cga
gcc atc atc gac aaa aat gcc cgc atc ggc aaa aac gtc 1200Ile Arg Arg
Ala Ile Ile Asp Lys Asn Ala Arg Ile Gly Lys Asn Val 385 390 395 400
atg att gtc aac aag gaa aat gtc cag gag gct aac cgg gaa gag tta
1248Met Ile Val Asn Lys Glu Asn Val Gln Glu Ala Asn Arg Glu Glu Leu
405 410 415 ggt ttt tac atc cgc aat ggc atc gta gta gtg att aaa aat
gtc acg 1296Gly Phe Tyr Ile Arg Asn Gly Ile Val Val Val Ile Lys Asn
Val Thr 420 425 430 atc gcc gac ggc acg gta atc tag 1320Ile Ala Asp
Gly Thr Val Ile 435 2439PRTSynechocystis sp. PCC 6803 2Val Cys Cys
Trp Gln Ser Arg Gly Leu Leu Val Lys Arg Val Leu Ala 1 5 10 15 Ile
Ile Leu Gly Gly Gly Ala Gly Thr Arg Leu Tyr Pro Leu Thr Lys 20 25
30 Leu Arg Ala Lys Pro Ala Val Pro Leu Ala Gly Lys Tyr Arg Leu Ile
35 40 45 Asp Ile Pro Val Ser Asn Cys Ile Asn Ser Glu Ile Val Lys
Ile Tyr 50 55 60 Val Leu Thr Gln Phe Asn Ser Ala Ser Leu Asn Arg
His Ile Ser Arg 65 70 75 80 Ala Tyr Asn Phe Ser Gly Phe Gln Glu Gly
Phe Val Glu Val Leu Ala 85 90 95 Ala Gln Gln Thr Lys Asp Asn Pro
Asp Trp Phe Gln Gly Thr Ala Asp 100 105 110 Ala Val Arg Gln Tyr Leu
Trp Leu Phe Arg Glu Trp Asp Val Asp Glu 115 120 125 Tyr Leu Ile Leu
Ser Gly Asp His Leu Tyr Arg Met Asp Tyr Ala Gln 130 135 140 Phe Val
Lys Arg His Arg Glu Thr Asn Ala Asp Ile Thr Leu Ser Val 145 150 155
160 Val Pro Val Asp Asp Arg Lys Ala Pro Glu Leu Gly Leu Met Lys Ile
165 170 175 Asp Ala Gln Gly Arg Ile Thr Asp Phe Ser Glu Lys Pro Gln
Gly Glu 180 185 190 Ala Leu Arg Ala Met Gln Val Asp Thr Ser Val Leu
Gly Leu Ser Ala 195 200 205 Glu Lys Ala Lys Leu Asn Pro Tyr Ile Ala
Ser Met Gly Ile Tyr Val 210 215 220 Phe Lys Lys Glu Val Leu His Asn
Leu Leu Glu Lys Tyr Glu Gly Ala 225 230 235 240 Thr Asp Phe Gly Lys
Glu Ile Ile Pro Asp Ser Ala Ser Asp His Asn 245 250 255 Leu Gln Ala
Tyr Leu Phe Asp Asp Tyr Trp Glu Asp Ile Gly Thr Ile 260 265 270 Glu
Ala Phe Tyr Glu Ala Asn Leu Ala Leu Thr Lys Gln Pro Ser Pro 275 280
285 Asp Phe Ser Phe Tyr Asn Glu Lys Ala Pro Ile Tyr Thr Arg Gly Arg
290 295 300 Tyr Leu Pro Pro Thr Lys Met Leu Asn Ser Thr Val Thr Glu
Ser Met 305 310 315 320 Ile Gly Glu Gly Cys Met Ile Lys Gln Cys Arg
Ile His His Ser Val 325 330 335 Leu Gly Ile Arg Ser Arg Ile Glu Ser
Asp Cys Thr Ile Glu Asp Thr 340 345 350 Leu Val Met Gly Asn Asp Phe
Tyr Glu Ser Ser Ser Glu Arg Asp Thr 355 360 365 Leu Lys Ala Arg Gly
Glu Ile Ala Ala Gly Ile Gly Ser Gly Thr Thr 370 375 380 Ile Arg Arg
Ala Ile Ile Asp Lys Asn Ala Arg Ile Gly Lys Asn Val 385 390 395 400
Met Ile Val Asn Lys Glu Asn Val Gln Glu Ala Asn Arg Glu Glu Leu 405
410 415 Gly Phe Tyr Ile Arg Asn Gly Ile Val Val Val Ile Lys Asn Val
Thr 420 425 430 Ile Ala Asp Gly Thr Val Ile 435 31050DNAPseudomonas
syringaeCDS(1)..(1050) 3atg acc aat ttg caa act ttt gaa tta ccc acc
gaa gtg act ggc tgt 48Met Thr Asn Leu Gln Thr Phe Glu Leu Pro Thr
Glu Val Thr Gly Cys 1 5 10 15 gcc gct gat att tcc tta ggt cgc gcc
ctg att caa gcc tgg cag aaa 96Ala Ala Asp Ile Ser Leu Gly Arg Ala
Leu Ile Gln Ala Trp Gln Lys 20 25 30 gac ggc att ttt caa att aaa
acc gat agt gaa caa gac cgt aaa act 144Asp Gly Ile Phe Gln Ile Lys
Thr Asp Ser Glu Gln Asp Arg Lys Thr 35 40 45 caa gaa gct atg gcc
gct agc aaa cag ttt tgt aaa gaa ccc ttg acc 192Gln Glu Ala Met Ala
Ala Ser Lys Gln Phe Cys Lys Glu Pro Leu Thr 50 55 60 ttt aaa tcc
agt tgc gtg agc gat tta act tat tct ggc tac gtg gcc 240Phe Lys Ser
Ser Cys Val Ser Asp Leu Thr Tyr Ser Gly Tyr Val Ala 65 70 75 80 tcc
ggt gaa gaa gtt acc gct ggg aaa ccc gac ttt ccc gaa att ttt 288Ser
Gly Glu Glu Val Thr Ala Gly Lys Pro Asp Phe Pro Glu Ile Phe 85 90
95 acc gtg tgt aaa gat tta tcc gtg ggc gac caa cgg gtt aaa gct gga
336Thr Val Cys Lys Asp Leu Ser Val Gly Asp Gln Arg Val Lys Ala Gly
100 105 110 tgg ccc tgt cat ggc ccc gtt ccc tgg ccc aac aac acc tac
cag aaa 384Trp Pro Cys His Gly Pro Val Pro Trp Pro Asn Asn Thr Tyr
Gln Lys 115 120 125 agt atg aaa act ttt atg gaa gaa ttg ggg tta gcc
gga gaa cgc ttg 432Ser Met Lys Thr Phe Met Glu Glu Leu Gly Leu Ala
Gly Glu Arg Leu 130 135 140 tta aaa ctg acc gct ttg ggg ttt gaa ctg
ccc att aat acc ttt act 480Leu Lys Leu Thr Ala Leu Gly Phe Glu Leu
Pro Ile Asn Thr Phe Thr 145 150 155 160 gat ttg acc cgt gac gga tgg
cat cac atg cgc gtg tta cgt ttt ccc 528Asp Leu Thr Arg Asp Gly Trp
His His Met Arg Val Leu Arg Phe Pro 165 170 175 ccc caa acc tcc act
ctg agt cgg ggc att ggt gcc cat acc gat tat 576Pro Gln Thr Ser Thr
Leu Ser Arg Gly Ile Gly Ala His Thr Asp Tyr 180 185 190 ggt ctg ttg
gtg att gcc gct cag gat gac gtt ggc ggt ctg tac att 624Gly Leu Leu
Val Ile Ala Ala Gln Asp Asp Val Gly Gly Leu Tyr Ile 195 200 205 cgt
ccc ccc gtg gaa ggg gaa aaa cgg aat cgc aac tgg ttg ccc ggc 672Arg
Pro Pro Val Glu Gly Glu Lys Arg Asn Arg Asn Trp Leu Pro Gly 210 215
220 gaa agc tct gcc ggc atg ttt gaa cat gac gaa ccc tgg acc ttt gtt
720Glu Ser Ser Ala Gly Met Phe Glu His Asp Glu Pro Trp Thr Phe Val
225 230 235 240 acc ccc act ccc ggg gtg tgg acc gtt ttt ccc gga gat
att ctg caa 768Thr Pro Thr Pro Gly Val Trp Thr Val Phe Pro Gly Asp
Ile Leu Gln 245 250 255 ttt atg acc ggg gga cag tta ctg tcc act ccc
cat aaa gtg aaa ttg 816Phe Met Thr Gly Gly Gln Leu Leu Ser Thr Pro
His Lys Val Lys Leu 260 265 270 aat acc cgt gaa cgg ttt gcc tgt gct
tat ttt cac gaa ccc aac ttt 864Asn Thr Arg Glu Arg Phe Ala Cys Ala
Tyr Phe His Glu Pro Asn Phe 275 280 285 gaa gcc tct gct tac ccc ttg
ttt gaa ccc tcc gcc aat gaa cgg att 912Glu Ala Ser Ala Tyr Pro Leu
Phe Glu Pro Ser Ala Asn Glu Arg Ile 290 295 300 cat tat ggc gaa cac
ttt acc aac atg ttt atg cgg tgc tac ccc gat 960His Tyr Gly Glu His
Phe Thr Asn Met Phe Met Arg Cys Tyr Pro Asp 305 310 315 320 cgc att
acc act caa cgt att aac aaa gaa aac cgg tta gcc cat ctg 1008Arg Ile
Thr Thr Gln Arg Ile Asn Lys Glu Asn Arg Leu Ala His Leu 325 330 335
gaa gat ttg aaa aaa tac agt gac acc cgc gct act ggt agc 1050Glu Asp
Leu Lys Lys Tyr Ser Asp Thr Arg Ala Thr Gly Ser 340 345 350
4350PRTPseudomonas syringae 4Met Thr Asn Leu Gln Thr Phe Glu Leu
Pro Thr Glu Val Thr Gly Cys 1 5 10 15 Ala Ala Asp Ile Ser Leu Gly
Arg Ala Leu Ile Gln Ala Trp Gln Lys 20 25 30 Asp Gly Ile Phe Gln
Ile Lys Thr Asp Ser Glu Gln Asp Arg Lys Thr 35 40 45 Gln Glu Ala
Met Ala Ala Ser Lys Gln Phe Cys Lys Glu Pro Leu Thr 50 55 60 Phe
Lys Ser Ser Cys Val Ser Asp Leu Thr Tyr Ser Gly Tyr Val Ala 65 70
75 80 Ser Gly Glu Glu Val Thr Ala Gly Lys Pro Asp Phe Pro Glu Ile
Phe 85 90 95 Thr Val Cys Lys Asp Leu Ser Val Gly Asp Gln Arg Val
Lys Ala Gly 100 105 110 Trp Pro Cys His Gly Pro Val Pro Trp Pro Asn
Asn Thr Tyr Gln Lys 115 120 125 Ser Met Lys Thr Phe Met Glu Glu Leu
Gly Leu Ala Gly Glu Arg Leu 130 135 140 Leu Lys Leu Thr Ala Leu Gly
Phe Glu Leu Pro Ile Asn Thr Phe Thr 145 150 155 160 Asp Leu Thr Arg
Asp Gly Trp His His Met Arg Val Leu Arg Phe Pro 165 170 175 Pro Gln
Thr Ser Thr Leu Ser Arg Gly Ile Gly Ala His Thr Asp Tyr 180 185 190
Gly Leu Leu Val Ile Ala Ala Gln Asp Asp Val Gly Gly Leu Tyr Ile 195
200 205 Arg Pro Pro Val Glu Gly Glu Lys Arg Asn Arg Asn Trp Leu Pro
Gly 210 215 220 Glu Ser Ser Ala Gly Met Phe Glu His Asp Glu Pro Trp
Thr Phe Val 225 230 235 240 Thr Pro Thr Pro Gly Val Trp Thr Val Phe
Pro Gly Asp Ile Leu Gln 245 250 255 Phe Met Thr Gly Gly Gln Leu Leu
Ser Thr Pro His Lys Val Lys Leu 260 265 270 Asn Thr Arg Glu Arg Phe
Ala Cys Ala Tyr Phe His Glu Pro Asn Phe 275 280 285 Glu Ala Ser Ala
Tyr Pro Leu Phe Glu Pro Ser Ala Asn Glu Arg Ile 290 295 300 His Tyr
Gly Glu His Phe Thr Asn Met Phe Met Arg Cys Tyr Pro Asp 305 310 315
320 Arg Ile Thr Thr Gln Arg Ile Asn Lys Glu Asn Arg Leu Ala His Leu
325 330 335 Glu Asp Leu Lys Lys Tyr Ser Asp Thr Arg Ala Thr Gly Ser
340 345 350 520DNAArtificial SequencePCR Primer 5gtcatgccaa
tgccgttatc 20647DNAArtificial SequencePCR Primer 6catcgttgct
gctgcgtaac atttcgaagt caagtttaga acagagg 47747DNAArtificial
SequencePCR Primer 7cctcggttct aaacttgact tcgaaatgtt acgcagcagc
aacgatg 47843DNAArtificial SequencePCR Primer 8gtgcgaggaa
agaaactggc ctaaggtggc ggtacttggg tcg 43943DNAArtificial SequencePCR
Primer 9cgacccaagt accgccacct aaggccagtt tctttcctcg cac
431021DNAArtificial SequencePCR Primer 10ggtgaacgac aaagccagtt a
211120DNAArtificial SequencePCR Primer 11cagatggccc gctgtttatt
201220DNAArtificial SequencePCR Primer 12aacaaccaga ggtattgccg
201319DNAArtificial SequencePCR Primer 13aagaagcggt tgttggcgc
191421DNAArtificial SequencePCR Primer 14cccattgccc caaaatacat c
21
* * * * *