U.S. patent application number 13/709897 was filed with the patent office on 2013-08-01 for rna-coded antibody.
This patent application is currently assigned to CureVac GmbH. The applicant listed for this patent is CureVac GmbH. Invention is credited to Ingmar HOERR, Steve Pascolo, Jochen Probst.
Application Number | 20130195867 13/709897 |
Document ID | / |
Family ID | 39427526 |
Filed Date | 2013-08-01 |
United States Patent
Application |
20130195867 |
Kind Code |
A1 |
HOERR; Ingmar ; et
al. |
August 1, 2013 |
RNA-CODED ANTIBODY
Abstract
The present application describes an antibody-coding,
non-modified or modified RNA and the use thereof for expression of
this antibody, for the preparation of a pharmaceutical composition,
in particular a passive vaccine, for treatment of tumours and
cancer diseases, cardiovascular diseases, infectious diseases,
auto-immune diseases, virus diseases and monogenetic diseases, e.g.
also in gene therapy. The present invention furthermore describes
and in vitro transcription method, in vitro methods for expression
of this antibody using the RNA according to the invention and an in
vivo method.
Inventors: |
HOERR; Ingmar; (Tubingen,
DE) ; Probst; Jochen; (Wolfschlugen, DE) ;
Pascolo; Steve; (Zurich, CH) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CureVac GmbH; |
Tubingen |
|
DE |
|
|
Assignee: |
CureVac GmbH
Tubingen
DE
|
Family ID: |
39427526 |
Appl. No.: |
13/709897 |
Filed: |
December 10, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12522214 |
Jan 4, 2010 |
|
|
|
PCT/EP2008/000081 |
Jan 8, 2008 |
|
|
|
13709897 |
|
|
|
|
Current U.S.
Class: |
424/135.1 ;
424/130.1; 424/133.1; 424/136.1; 424/141.1; 424/174.1; 435/68.1;
435/69.6; 435/91.3 |
Current CPC
Class: |
A61K 2039/505 20130101;
C07K 2317/515 20130101; Y02A 50/388 20180101; C07K 2317/622
20130101; C07K 2317/51 20130101; C07K 2317/55 20130101; C07K
16/1018 20130101; C07K 16/2863 20130101; C07K 16/32 20130101; C07K
2317/76 20130101; Y02A 50/41 20180101; C07K 2317/54 20130101; A61K
2039/51 20130101; A61P 35/00 20180101; C07K 16/1027 20130101; A61K
9/0019 20130101; A61K 48/00 20130101; A61P 37/00 20180101; C07K
16/3046 20130101; Y02A 50/487 20180101; C07K 16/3061 20130101; Y02A
50/30 20180101; A61P 25/00 20180101; A61P 33/00 20180101; C07K
16/2887 20130101; A61K 39/395 20130101; A61P 31/00 20180101; C07K
2317/92 20130101; A61K 39/40 20130101; Y02A 50/412 20180101; A61K
39/39558 20130101; A61K 39/42 20130101; C07K 2317/24 20130101; C07K
2317/52 20130101; A61K 48/0066 20130101; C07K 2317/21 20130101;
C07K 16/2803 20130101; C07K 2317/94 20130101; A61K 2039/53
20130101; A61P 9/00 20180101; C07K 2317/56 20130101; A61K 48/005
20130101; C07K 2317/77 20130101; A61K 48/0075 20130101; C07K 16/30
20130101 |
Class at
Publication: |
424/135.1 ;
424/130.1; 424/133.1; 424/141.1; 424/174.1; 424/136.1; 435/91.3;
435/68.1; 435/69.6 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 16/30 20060101 C07K016/30 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 9, 2007 |
DE |
10 2007 001 370.3 |
Claims
1-37. (canceled)
38. A method of treating a cancer disease, cardiovascular disease,
infectious disease or autoimmune disease, the method comprising
administering a pharmaceutical composition, the pharmaceutical
composition comprising a RNA for intracellular expression of an
antibody, wherein the RNA contains at least one coding region,
wherein at least one coding region codes for at least one
antibody.
39. The method of claim 38, wherein the pharmaceutical composition
is a passive vaccine for treatment of tumour or infectious
diseases.
40. The method of claim 38, wherein the cancer disease or tumour
disease is selected from the group consisting of a melanoma,
malignant melanoma, colon carcinoma, lymphoma, sarcoma, blastoma,
kidney carcinoma, gastrointestinal tumour, glioma, prostate tumour,
bladder cancer, rectal tumour, stomach cancer, oesophageal cancer,
pancreatic cancer, liver cancer, mammary carcinoma, uterine cancer,
cervical cancer, acute myeloid leukaemia (AML), acute lymphoid
leukaemia (ALL), chronic myeloid leukaemia (CML), chronic
lymphocytic leukaemia (CLL), hepatomas, diverse virus-induced
tumour, adenocarcinoma, herpes virus-induced tumour, hepatitis
B-induced tumour, HTLV-1- and HTLV-2-induced lymphoma, acusticus
neurinoma, lung carcinoma, small cell lung carcinoma, throat
cancer, anal carcinoma, glioblastoma, rectum carcinoma,
astrocytoma, brain tumour, retinoblastoma, basalioma, brain
metastasis, medulloblastoma, vaginal cancer, testicular cancer,
thyroid carcinoma, Hodgkin's syndrome, meningeomas, Schneeberger's
disease, pituitary tumour, mycosis fungoide, carcinoid, neurinoma,
spinalioma, Burkitt's lymphoma, laryngeal cancer. kidney cancer,
thymoma, corpus carcinoma, bone cancer, non-Hodgkin's lymphoma,
urethral cancer, CUP syndrome, head/neck tumour, oligodendroglioma,
vulval cancer, intestinal cancer, colon carcinoma, oesophageal
carcinoma, wart condition, small intestine tumour,
craniopharyngeomas, ovarian carcinoma, soft tissue tumour, ovarian
cancer, pancreatic carcinoma, endometrium carcinoma, liver
metastasis, penis cancer, tongue cancer, gallbladder cancer,
leukaemia, plasmocytoma, lid tumour and prostate cancer.
41. The method of claim 38, wherein the infectious disease is
selected from the group consisting of influenza, malaria, SARS,
yellow fever, AIDS, Lyme borreliosis, leishmaniasis, anthrax,
meningitis, viral infectious diseases, such as AIDS, condyloma
acuminate, molluscum contagiosum, dengue fever, three-day fever,
Ebola virus, colds, early summer meningoencephalitis (ESME),
influenza, shingles, hepatitis, herpes simplex type I, herpes
simplex type II, herpes zoster, influenza, Japanese encephalitis,
Lassa fever, Marburg virus, measles, foot and mouth disease,
mononucleosis, mumps, Norwalk virus infection, Pfeiffer's glandular
fever, smallpox, polio, pseuodcroup, infectious erythema, rabies,
warts, West Nile fever, chicken-pox, cytomegalovirus (CMV),
bacterial infectious diseases, anthrax, appendicitis, borreliosis,
botulism, Campylobacter, Chlamydia trachomatis (inflammation of the
urethra, conjunctiva), cholera, diphtheria, donavonosis,
epiglottitis, louse-borne typhus, typhoid fever, gas gangrene,
gonorrhoea, hare plague, Helicobacter pylori, whooping cough,
climatic bubo, osteomyelitis, legionnaires' disease, leprosy,
listeriosis, pneumonia, meningitis, bacterial meningitis, anthrax,
inflammation of the middle ear, Mycoplasma hominis, neonatal
sepsis, noma, paratyphoid fever, plague, Reiter's syndrome, Rocky
Mountain spotted fever, Salmonella paratyphoid fever, Salmonella
typhoid fever, scarlet fever, syphilis, tetanus, gonorrhoea,
tsutsugamushi fever, tuberculosis, typhus, vaginitis, soft chancre,
and infectious diseases caused by parasites, protozoa or fungi,
such as amoebic dysentery, bilharziosis, Chagas' disease,
Echinococcus, fish tapeworm, ichthyotoxism, fox tapeworm, mycosis
pedis, dog tapeworm, candiosis, ptyriasis, scabies, cutaneous
leishmaniasis, lamblian dysentery, lice, malaria, onchocercosis,
fungal diseases, beef tapeworm, schistosomiasis, sleeping sickness,
pork tapeworm, toxoplasmosis, trichomoniasis, trypanosomiasis,
visceral leishmaniasis, nappy dermatitis, or infections caused by
the dwarf tapeworm.
42. The method of claim 38, wherein the cardiovascular disease is
selected from the group consisting of coronary heart disease,
arteriosclerosis, apoplexy and hypertension, and neuronal
disease.
43. The method of claim 42, wherein the neuronal disease is
selected from the group consisting of Alzheimer's disease,
amyotrophic lateral sclerosis, dystonia, epilepsy, multiple
sclerosis and Parkinson's disease.
44. The method of claim 38, wherein the autoimmune disease is
selected from the group consisting of autoimmune type I disease,
autoimmune type H disease, autoimmune type III disease and
autoimmune type IV disease.
45. The method of claim 38, wherein the autoimmune disease is
selected from the group consisting of multiple sclerosis (MS),
rheumatoid arthritis, diabetes, diabetes type I, systemic lupus
erythematosus (SLE), chronic polyarthritis, Basedow's disease,
autoimmune forms of chronic hepatitis, colitis ulcerosa, allergy
type I diseases, allergy type II diseases, allergy type III
diseases, allergy type IV diseases, fibromyalgia, hair loss,
Bechterew's disease, Crohn's disease, myasthenia gravis,
neurodermatitis, polymyalgia rheumatica, progressive systemic
sclerosis (PSS), psoriasis, Reiter's syndrome, rheumatic arthritis,
psoriasis and vasculitis.
46. The method of claim 38, wherein the RNA is single-stranded or
double-stranded.
47. The method of claim 38, wherein the RNA Is linear or
circular,
48. The method of claim 38, wherein the RNA is rRNA, tRNA or
mRNA.
49. The method of claim 48, wherein the RNA is an mRNA.
50. The method of claim 38, wherein the antibody coded is chosen
from monoclonal and polyclonal antibodies, chimeric antibodies,
human antibodies, humanized antibodies, bispecific antibodies,
intrabodies and fragments of these antibodies.
51. The method of claim 38, wherein the coded antibody fragments
are chosen from Fab, Fab', F(ab').sub.2, Fe, Facb, pFc', Fd, and
FIT or scFv fragments of these antibodies.
52. The method of claim 38, wherein the coded antibodies or
antibody fragments specifically recognize and bind tumour-specific
surface antigens chosen from (TSSA), 5T4, a5.beta.1-integrin,
707-AP, AFP, ART-4, B7H4, BAGE, .beta.-catenin/m, Bcr-abl, MN/C
IX-antigen, CA125, CAMEL, CAP-1, CASP-8, .beta.-catenin/m, CB4,
CD19, CD20, CD22, CD25, CDC27/m, CD 30, CD33, CD52, CD56, CD80,
CDK4/m, CEA, CT, Cyp-B, DAM, EGFR, ErbB3, ELF2M, EMMPRIN, EpCam,
ETV6-AML1, G250, GAGE, GnT-V, Gp100, HAGE, HER-2/neu,
HLAA*0201-R170I, HPV-E7, HSP70-2M, HAST-2, hTERT (or hTRT), iCE,
IGF-1R, IL2R, IL-5, KIAA0205, LAGE, LDLR/FUT, MAGE, MART-1
/Melan-A, MART-2/Ski, MC1R, myosin/m, MUC1, MUM-1, -2, -3, NA88-A,
PAP, proteinase-3, p190 minor bcr-abl, Pm1/RAR.alpha., FRAME, PSA,
PSM, PSMA, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, survivin,
TEL/AML1, TGF.beta., TPI/m, TRP-1, TRP-2, TRP-2/INT2, VEGF and WT1,
NY-Eso-1 and NY-Eso-B.
53. The method of claim 38, wherein the RNA is modified.
54. The method of claim 53, wherein the modification is chosen from
modifications of the nucleotide sequence compared with a precursor
RNA sequence by introduction of non-native nucleotides and/or by
covalent coupling of the RNA with another group.
55. The method of claim 54, wherein the RNA has a G/C content in
the coding region of the base-modified RNA which is greater than
the G/C content of the coding region of the native RNA sequence,
the coded amino acid sequence being unchanged with respect to the
wild-type or, respectively, the precursor RNA.
56. The method of claim 54, wherein the coding region of the
modified RNA is modified compared with the coding region of the
native RNA such that at least one codon of the native RNA which
codes for a tRNA which is relatively rare in the ceil is exchanged
for a codon which codes for a tRNA which is relatively frequent in
the cell and which carries the same amino acid as the relatively
rare tRNA.
57. The method of claim 54, wherein the RNA has a lipid
modification.
58. The method of claim 54, wherein the RNA contains on at least
one nucleotide of the RNA a modification of a nucleotide, wherein
the nucleotides are chosen from 1-methyl-adenine, 2-methyl-adenine,
2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine,
N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine,
4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine,
1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine,
7-methyl-guanine, inosine, 1 -methyl-inosine, dihydro-uracil,
2-thio-uracil, 4-thio-uracil,
5-carboxymethylaminomethyl-2-thio-uracil,
5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil,
5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil,
5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester,
5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil,
5-methoxycarbonylmethyl-uracil, 5-methoxy-uracil,
uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v),
pseudouracil, 1-methyl-pseudouracil, queosine,
.beta.-D-mannosyl-queosine, wybutoxosine, and phosphoramidates,
phosphorothioates, peptide nucleotides, methylphosphonates,
7-deazagnanosines 5-methylcytosine and inosine.
59. The method of claim 54, wherein the RNA contains on at least
one nucleotide of the RNA a modification of a nucleotide, wherein
the nucleotides are base-modified nucleotides chosen from the group
consisting of 2-amino-6-chloropurine riboside 5'-triphosphate,
2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate,
2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate,
5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine
5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine
5'-triphosphate, 5-iodocytidine 5-triphosphate, 5-iodouridine
5'-triphosphate, 5-methylcytidine 51-triphosphate, 5-methyluridine
5'-triphosphate, 6-azacytidine 5'-triphosphate, 6-azauridine
5'-triphosphate, 6-cholorpurine riboside 5'-triphosphate,
7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate,
8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate,
benzimidazole riboside 5'-triphosphate, N1-methyladenosine
5'-triphosphate, N1-methylguanosine 5'-triphosphate,
N6-methyladenosine 5'-triphosphate, O6-methylguanosine
5'-triphosphate, pseudouridine 5'-triphosphate, puromycin
5'-triphosphate or xanthosine 5'-triphosphate.
60. The method of claim 59, wherein the base-modified nucleotides
are chosen from the group consisting of 5-methylcytidine
5'-triphosphate and pseudouridine 5'-triphosphate.
61. The method of claim 38, wherein the RNA additionally has a 5'
cap structure chosen from the group consisting of m7G(5')ppp
(5'(A,G(5')ppp(5')A and G(5')ppp(5')G.
62. The method of claim 38, wherein the RNA additionally has a
poly-A tail of from about 10 to 200 adenosine nucleotides (SEQ ID
NO: 62).
63. The method of claim 38, wherein the RNA additionally has a
poly-C tail of from about 10 to 200 cytosine nucleotides (SEQ ID
NO: 54).
64. The method of claim 38, wherein the RNA additionally codes a
tag for purification chosen from the group consisting of a
hexahistidine tag (SEQ ID NO: 59) (HIS tag, polyhistidine tag), a
streptavidin tag (Strep tag), an SBP tag (streptavidin-binding tag)
or a GST (glutathione S-transferase) tag, or codes for a tag for
purification via an antibody epitope chosen from the group
consisting of antibody-binding tags, a Mye tag, a Swa11 epitope, a
FLAG tag or an HA tag.
65. The method of claim 38, wherein the RNA additionally codes a
signal peptide and/or a localization sequence, in particular a
secretion sequence.
66. The method of claim 65, wherein the localization sequence is
chosen from one of the sequences according to SEQ ID NO: 18 to
50.
67. The method of claim 38, wherein the RNA contains an
antibody-coding sequence which codes for the heavy chains according
to SEQ ID NO: 2 and the light chains according to SEQ ID NO: 4.
68. The method of claim 38, wherein the RNA contains an
antibody-coding sequence according to SEQ ID NO: 5.
69. The method of claim 38, wherein the RNA contains an
antibody-coding sequence which codes for the heavy chains according
to SEQ ID NO: 7 and the light chains according to SEQ ID NO: 9.
70. The method of claim 38, wherein the RNA contains an
antibody-coding sequence according to SEQ ID NO: 10.
71. The method of claim 38, wherein the modified RNA contains an
antibody-coding sequence which codes for the heavy chains according
to SEQ ID NO: 12 and the light chains according to SEQ ID NO:
14.
72. The method of claim 38, wherein the RNA contains an
antibody-coding sequence according to SEQ ID NO: 15.
73. The method of claim 38, wherein the modified RNA contains an
antibody-coding sequence which has a sequence identity of at least
70% to the sequence SEQ ID NO: 5,10 or 15 over the total length of
the nucleic acid sequence of SEQ ID NO: 5, 10 or 15.
74. In vitro transcription method for the preparation of an
antibody-coding, optionally modified RNA, comprising the following
steps: a. provision of a nucleic acid which codes for an antibody,
as defined in claim 13; b. addition of the nucleic acid to an in
vitro transcription medium comprising an RNA polymerase, a suitable
buffer, a nucleic acid mix comprising one or more modified
nucleotides in exchange for one or more of the naturally occurring
nucleotides A, G, C or U, and optionally one or more naturally
occurring nucleotides A, G, C or U, if not ail the naturally
occurring nucleotides A, G, C or U are to be exchanged, or
optionally only naturally occurring nucleotides and optionally an
RNase inhibitor; c. incubation of the nucleic acid in the in vitro
transcription medium and in vitro transcription of the nucleic acid
to give an antibody-coding, optionally modified RNA according to
claim 38; d. optionally purification of the antibody-coding,
optionally modified RNA and removal of the non-incorporated
nucleotides from the in vitro transcription medium.
75. In vitro transcription and translation method for expression of
an antibody, comprising the following steps: a. provision of a
nucleic acid which codes for an antibody, as defined in claim 13;
b. addition of the nucleic acid to an in vitro transcription medium
comprising an RNA polymerase, a suitable buffer, a nucleic acid mix
comprising one or more modified nucleotides in exchange for one or
more of the naturally occurring nucleotides A, O, C or U, and
optionally one or more naturally occurring nucleotides A, G, C or
U, if not ail the naturally occurring nucleotides A, G, C or U are
to be exchanged, or optionally only naturally occurring nucleotides
and optionally an RNase inhibitor; c. incubation of the nucleic
acid in the in vitro transcription medium and in vitro
transcription of the nucleic acid to give an antibody-coding,
optionally modified RNA according to claim 38; d. optionally
purification of the antibody-coding, optionally modified RNA and
removal of the non-incorporated nucleotides from the in vitro
transcription medium, e. addition of the optionally modified RNA
obtained in step c) (and optionally in step d) to an in vitro
translation medium; f. incubation of the optionally modified RNA in
the in vitro translation medium and in vitro translation of the
antibody coded by the optionally modified RNA; g. optionally
purification of the antibody translated in step f).
76. In vitro transcription and translation method for expression of
an antibody in a host cell, comprising the following steps: a.
provision of a nucleic acid which codes for an antibody, as defined
in claim 13; b. addition of the nucleic acid to an in vitro
transcription medium comprising an RNA polymerase, a suitable
buffer, one or more modified nucleotides in exchange for one or
more of the naturally occurring nucleotides A, G, C or U and
optionally one or more naturally occurring nucleotides A, G, C or
U, if not all the naturally occurring nucleotides A, G, C or U are
to be exchanged, or only naturally occurring nucleotides and
optionally an RNase inhibitor; c. incubation of the nucleic acid in
the in vitro transcription medium and in vitro transcription of the
nucleic acid to give an antibody-coding, optionally modified RNA
according to claim 38; d. optionally purification of the
antibody-coding, optionally modified RNA according to the invention
and removal of the non-incorporated nucleotides from the in vitro
transcription medium, e. transfection of the optionally modified
RNA obtained in step c) (and optionally d)) into a host cell; f.
incubation of the optionally modified nucleic acid in the host cell
and translation of the antibody coded by the optionally modified
RNA in the host cell; g. optionally isolation and/or purification
of the antibody translated in step f).
Description
[0001] The present application describes an antibody-coding,
non-modified or modified RNA and the use thereof for expression of
this antibody, for the preparation of a pharmaceutical composition,
in particular a passive vaccine, for treatment of tumours and
cancer diseases, cardiovascular diseases, infectious diseases,
auto-immune diseases, virus diseases and monogenetic diseases, e.g.
also in gene therapy. The present invention furthermore describes
an in vitro transcription method, in vitro methods for expression
of this antibody using the RNA according to the invention and an in
vivo method.
[0002] The occurrence of tumours and cancer diseases is, alongside
cardiovascular and infectious diseases, one of the most frequent
causes of death in modern societies and is associated with usually
considerable costs during the therapy and subsequent rehabilitation
measures. The treatment of tumours and cancer diseases depends
greatly, for example, on the nature of the tumour which occurs and
at present conventionally is undertaken by using radio- or
chemotherapy, in addition to invasive interventions. However, these
therapies represent an exceptional burden on the immune system, and
in some cases can be employed to only a limited extent.
Furthermore, these therapy forms usually require long passes
between the individual treatments for regeneration of the immune
system. In recent years, alongside these "conventional methods",
molecular biology programmes in particular have emerged as
promising for the treatment or for assisting these therapies.
[0003] An example of these molecular biology methods comprises the
use of antibodies or immunoglobulins as essential effectors of the
immune system. Antibodies or immunoglobulins can be generated
either in vitro by using known molecular biology methods or by the
immune system of the organism itself to be treated. The immune
system of higher vertebrates thus has two separate functions of the
immune system: the innate immune system, which reacts
non-specifically to pathogens (e.g. by macrophage-mediated
phagocy-tosis) and the adaptive immune system, which, reacts
specifically to pathogens by means of specialized cells (e.g. B and
T cells). The antibodies or immunoglobulins which are secreted by
plasma cells during an immune response are part of this adaptive
immune system. Together with the complement system, they form the
humoral brands of the immune response.
[0004] Alongside their essential importance for the immune system
in higher vertebrates, precisely because of their high affinity and
specificity for a particular antigen antibodies are an outstanding
means both in biochemical and molecular biology research and in
diagnostics and medical uses. Thus, antibodies are capable of
binding specifically to their target structures (e.g. antigens,
which substantially comprise proteins, peptides, in some cases
lipids, carbohydrates etc.) and of thereby blocking (inhibiting)
or, where appropriate, labelling these. They can moreover activate
the immune system by means of their Fc part, so that the labelled
cells are destroyed. Over 100 therapeutic antibodies are currently
to be found in clinical studies. Antibodies which can be employed
in cancer therapy play by far the greatest role in this context.
Most of the antibodies prepared for this at present are monoclonal
antibodies which originate originally, for example, from the mouse.
In order to prevent an immune reaction against such monoclonal
antibodies, at present chiefly humanized or human antibodies are
employed for therapy (cf. David Male; "Immunologie auf einen Blick
[Immunology at a Glance]", 1st German edition, 2005, Elsevier-Urban
& Fischer Verlag; Charles A. Janeway, Paul Travers, Mark
Walport and Mark Shlomchik, Immunobiology, 5th edition, 2001,
Garland Publishing; Dissertation by Christian Klein, Monoklonale
Antikorper und rekombinante Antikorperfragmente gegen sedundare
Arzneipflanzemetabolite [Monoclonal Antibodies and Recombinant
Antibody Fragments Against Secondary Medicinal Plant Metabolites],
2004; Andreas Schmiedl and Stefan Dubel, Rekombinante Antikorper
& Phagen-Display [Recombinant Antibody & Phage Display],
2094, Molekulare Biotechnologie [Molecular Biotechnology]
(Wiley-VCH)),
[0005] Antibodies generally can be assigned to the group of
immunoglobulins. These Immunoglobulins can in turn be
differentiated into five main classes of immunoglobulins on the
basis of their heavy chain, the IgM (.mu.), IgD (.delta.), IgG
(.gamma.), IgA (.alpha.) and IgE (.epsilon.) antibodies, IgG
antibodies making up the largest proportion. Immunoglobulins can
moreover be differentiated into the isotypes .kappa. and .lamda. on
the basis of their light chains.
[0006] In spite of their different specificity, antibodies are
structurally quite similar in construction. Thus, IgG antibodies
typically are built up two identical light and two heavy protein
chains which are bonded to one another via disulfide bridges. The
light chain comprises the N-terminal variable domain V.sub.L and
the C-terminal constant domain C.sub.L. The heavy chain of an IgG
antibody can be divided into an N-terminal variable domain V.sub.H
and three constant domains C.sub.H1, C.sub.H2 and C.sub.H3 (cf.
FIG. 1). While the amino acid sequence is largely the same in the
region of the constant domains, wide differences in sequence are
typically found within the variable domains.
[0007] The antibody repertoire of a human comprises about at least
10.sup.11 different antibody specificities. In higher vertebrates,
the formation of antibodies takes place naturally in the immune
system by somatic recombination. In this context, an organism is
indeed theoretically capable of generating an antibody of
appropriate specificity against any antigen. However, if each of
these antibodies were to be coded by an endogenous gene, they would
burst the human genome. Instead, in humans antibody genes are
composed of a large number of individual gene segments. The part of
the antibody gene which codes for the variable region of a light
chain is formed from a V gene segment and a J gene segment. In this
context, numerous different V and J segments are available, which
can be combined with one another virtually as desired. In this
context, the variable region of a heavy chain is composed of three
different gene segments. In addition to the V and J segments,
additional D segments are also found here. The V.sub.B, D.sub.B and
J.sub.B segments can likewise be combined with one another
virtually as desired to form the variable region of the heavy chain
(cf. FIG. 2). The mechanism by which the various gene segments are
combined to form complete antibody genes is called immunoglobulin
rearrangement or somatic recombination. It takes place exclusively
in B lymphocytes at certain times of cell development.
[0008] In addition to pure gene rearrangement, further mechanisms
for increasing the antibody diversity also exist. Two mechanisms
which are accompanied by somatic recombination are first to be
mentioned in this context: The junctional diversity in this contest
describes controlled imprecise joining together of the rearranged
gene segments, as a result of which random removal and insertion of
nucleotides occurs at the cleavage sites. A further combinatorial
diversity results from the possibility of combining a particular
rearranged light chain with a particular rearranged heavy chain.
Finally, the diversity of antibodies is also additionally increased
after successful rearrangement and later activation of B cells, in
that an affinity maturation of antibodies occurs due to an
increased rate of mutation is the region of the variable regions of
activated B cells (somatic hypermutation).
[0009] In addition to the formation of antibodies which takes place
naturally by the immune system of the particular organism,
antibodies can also be generated by molecular biology methods.
However, in order to utilize the system elaborated for
specification of antibody formation and specification thereof for
particular antigens or nucleic acids, the formation of antibodies
is at present typically induced in selected organisms by injection
of a particular antigen, and the antibody is then isolated from the
organism for further use. In this context, the B lymphocytes of the
organism are conventionally purified selectively and fused with an
immortal myeloma cell to form a hybridoma cell. Those cells which
secrete the corresponding antigen-specific antibodies are then
determined by selection methods.
[0010] In addition to use of hybridoma cells, recombinant
preparation of these antibodies with the desired specificity is
also possible after isolation and sequencing. Cells which provide
the required posttranslational modifications are typically used for
this. On the basis of the immune reaction with formation of human
anti-mouse antibodies is the human organism is the case of native
antibodies produced in the mouse (or in other hosts), chimeric,
humanized or human antibodies are preferably prepared here.
[0011] After expression, these antibodies, optionally prepared by
recombinant methods, can be employed as agents both in biochemical
and molecular biology research, and in diagnostics and for medical
uses.
[0012] In medical uses, however, in many cases antibodies can be
employed directly only with difficulty, since these usually have
only a very short half-life in vivo and therefore, possibly, cannot
reach their target antigen or their target nucleic acid at all.
This requires either high active compound concentrations of the
desired antibody, or alternative methods which are suitable for
providing large amounts of antibodies in vivo.
[0013] Such methods include, e.g. molecular medicine methods of
gene therapy and genetic vaccination which, when used generally in
the therapy and prevention of diseases, have considerable effects
on medical practice. Both methods are based on the introduction of
nucleic acids into cells or into tissue of the patient and on
subsequent processing by the cells or, respectively, tissue of the
information coded by the nucleic acids introduced, i.e. expression
of the desired polypeptides, e.g. antibodies, in the cells or
respectively, the tissue.
[0014] The conventional procedure of methods of gene therapy and of
genetic vaccination to date is based on the use of DNA to sluice
the required genetic information into the cell. Various methods for
introducing DNA into cells have been developed in this connection,
such as, for example, calcium phosphate transfection, polyprene
transfection, protoplast fusion, electroporation, microinjection,
lipofection and the use of gene canons, lipofection in particular
having emerged as a suitable method.
[0015] A further method which has been proposed in particular in
the case of genetic vaccination methods is the use of DNA viruses
as DNA vehicles. Such viruses have the advantage that because of
their infectious properties a very high transfection rate can be
achieved. The viruses used are genetically modified, so that no
functional infectious particles are formed is the transfected cell.
The use of DNA viruses as DNA vehicles, however, has been
criticized in recent years because of the risk of recombination of
non-active viruses to give active viruses.
[0016] The use of DNA as an agent in gene therapy and genetic
vaccination or for passive immunization (by passive vaccines), e.g.
by using coding sequences for antibodies, may, however, also be
less advantageous from some points of view. DNA is degraded only
relatively slowly in the bloodstream, so that when (foreign) DNA is
used as the coding sequence for a desired protein, a formation of
anti-DNA antibodies may occur, which has been confirmed in an
animal model in the mouse (Gilkeson et al., J. Clin. Invest. 1995,
95: 1398-1402). The possible persistence of (foreign) DNA in the
organism can thus lead to a hyperactivation of the immune system,
which as is known results in splenomegaly in mice (Montheith et
al., Anticancer Drug Res. 1997, 12(5): 421-432). Furthermore,
(foreign) DNA can interact with, the host genome, and in particular
cause mutations by integration into the host genome. Thus, for
example, the (foreign) DNA introduced may be inserted into an
intact gene, which represents a mutation which can impede or even
completely switch off the function of the endogenous gene. On the
one hand enzyme systems which are vital for the cell may be
destroyed by such integration events, and on the other hand there
is also the danger of a transformation of the cell modified in this
way into a degenerated state if a gene which is decisive for
regulation of cell growth is modified by the integration of the
foreign DNA. With the methods to date of gene therapy and genetic
vaccination and also of passive immunization, a risk of development
of cancer therefore cannot necessarily be ruled out when (foreign)
DNA is used. In this context, passive immunization (by so-called
"passive vaccines") is to be strictly differentiated from so-called
active immunization. In active immunization, an antigen ("active
vaccine") is typically administered, after which the organism forms
antibodies against this antigen. Active immunization thus creates a
permanent immunization of the organism against the particular
antigen, which can be associated with the disadvantages described
above. In passive immunization, in contrast, only as antiserum or
the purified antibody itself ("passive vaccine") is administered to
the organism. The coding sequence for the antibody can likewise be
administered, as described above, as a so-called passive vaccine
for passive immunization.
[0017] Summarizing, in the prior art there is an increased demand
for and a considerable interest in agents which are suitable for
employing antibodies effectively in vivo, in particular for
providing increased active compound amounts of antibodies in vivo,
without the risks hitherto associated with the use of DNA.
[0018] This object is achieved according to the invention by the
use of an RNA (sequence) for intracellular expression of an
antibody, wherein the RNA (sequence) codes for an antibody or
contains at least one coding region, which codes for at least one
antibody, respectively. In connection with the present invention,
an antibody-coding RNA according to the invention includes any RNA
which encodes an antibody. More generally, the RNA of the present
invention (directed to intracellular expression) contains at least
one coding region, wherein the at least one coding region codes for
at least one antibody. If more than one coding region is contained
in the RNA molecule of the invention, the second, third etc. coding
region may code for antibodies as well, which may be the same or
distinct from the first antibody coding region. In a preferred
embodiment, the inventive RNA contains at least two coding regions,
all of them coding for identical or distinct antibodies. In still
another embodiment of the present invention, an inventive RNA may
code for more than one antibody within the same coding region. In
summary, the inventive RNA may be mono-, bi- or multicistronic,
codes for at least one antibody.
[0019] The antibody-coding RNA according to rise invention cars be
single-stranded or double-stranded, linear or circular, or in
particular in the form of mRNA. The antibody-coding RNA according
to the invention is particularly preferably in the form of
single-stranded RNA, even more preferably in the form of mRNA.
[0020] An antibody-coding RNA according to the invention preferably
has a length of from 50 to 15,000 nucleotides, more preferably a
length of from 50 to 10,000 nucleotides, even more preferably a
length of from 500 to 10,000 nucleotides and most preferably a
length of from 500 to 7,000, 500 to 5,000 or 700 to 3,000
nucleotides.
[0021] In connection with the present invention, the antibodies
coded by the RNA according to the invention can be chosen from all
antibodies, e.g. from all antibodies which are generated by
recombinant methods or are naturally occurring and are known to a
person skilled in the art from the prior art, in particular
antibodies which are (can be) employed for therapeutic purposes or
for diagnostic or for research purposes or have been found with
particular diseases, e.g. cancer diseases, infectious diseases
etc.
[0022] In the context of the present invention, antibodies which,
are coded by an RNA according, to the invention typically include
all antibodies (described above) which are known to a person
skilled in the art, e.g. naturally occurring antibodies or
antibodies generated is a host organism by immunization, antibodies
prepared by recombinant methods which have been isolated and
identified from naturally occurring antibodies or antibodies
generated in a host organism by (conventional) immunization or have
been generated with the aid of molecular biology methods, as well
as chimeric antibodies, human antibodies, humanized antibodies,
bispecific antibodies, intrabodies, i.e. antibodies expressed is
cells and possibly localized in particular cell compartments, and
fragments of the abovementioned antibodies. Insofar, the term
antibody is to be understood in its broadest meaning. In this
context, antibodies in general typically comprise a light chain and
a heavy chain, both of which have variable and constant domains.
The light chain comprises the N-terminal variable domain V.sub.L
and the C-terminal constant domain C.sub.L. The heavy chain of an
IgG antibody, in contrast, can be divided into an N-terminal
variable domain V.sub.H and three constant domains C.sub.H1,
C.sub.H2 and C.sub.H3 (cf. FIG. 1).
[0023] RNA molecules according to the invention can also be
prepared on the basis of polyclonal antibodies or, as an
antibody-coding RNA cocktail, can have a polyclonal character. In
the context of this invention, polyclonal antibodies are typically
mixtures of antibodies against a specific antigen or immunogon or
epitope of a protein which have been generated by immunization of a
host organism, for example mammals, i.e. animals, including cattle,
pigs, dogs, cats, donkeys, monkeys, including rodents, e.g. mice,
hamsters, rabbits etc., and man. Polyclonal antibodies
conventionally recognize different epitopes or regions of the same
specific antigen, each of these epitopes in turn being capable of
generating a clone of B lymphocytes which produces an antibody
against this epitope. From such polyclonal antibodies or from the
antibody sera obtained from the host organism, the individual
antibodies specific against the particular epitopes can be obtained
by individualization to monoclonal antibodies. The present
invention accordingly also provides RNA which codes for a
monoclonal antibody obtained by individualization of polyclonal
antibodies.
[0024] Monoclonal antibodies in the context of this invention are
therefore typically antibodies which are specific for a particular
antigen or epitope (of a protein), i.e. bind this antigen or
epitope (of a protein) with a high affinity, and conventionally are
expressed by a hybridoma cell. For the preparation of such
monoclonal antibodies, the corresponding antigen or immunogen or
epitope of a protein is typically injected at least once, but
typically several times, into a host organism as described here, as
a result of which the immune system of the host organism, in the
presence of suitable adjuvants, is preferably stimulated to
antibody production via activation of correspondingly specific B
cells. The B lymphocytes are then conventionally selectively
purified from the spleen or other organs or fluids suitable for
this from an animal immunized in this manner, and are fused with an
immortal myeloma cell to give the so-called hybridoma cell. After
selection methods and cloning of the hybridomas or hybridoma cells
formed, those clones which secernate, i.e. express and secrete,
antibodies of the desired specificity can be determined. These
clones can be isolated and sequenced with known molecular biology
methods. The data obtained from such a sequencing can serve further
in a nucleic acid synthesis for generation of synthetic DNA
sequences or for screening a cDNA library and isolation of the cDNA
fragments and generation of a DNA or nucleic acid template for in
vitro or in vivo synthesis of the RNA according to the invention
which codes for an antibody. Where appropriate, the RNA contained
in the hybridomas can also be isolated, for example by
fractionation, and subsequently the RNA molecules according to the
invention which code for the hybridoma antibody can be purified by
methods known to the person skilled in the art.
[0025] Nevertheless, RNA molecules which code for non-human
monoclonal or polyclonal antibody, e.g. murine monoclonal
antibodies or monoclonal antibodies from other, as described here,
non-human host organisms or hybridoma cells are of only limited
suitability for therapeutic use in humans, since in the human
organism itself they conventionally cause an immune reaction with
formation of human anti-antibodies directed against these non-human
host antibodies. As a result such non-human, monoclonal or
polyclonal antibodies as a rule can be administered to a person
only a single time. To by-pass this problem, RNA molecules which
code for chimeric, humanized and human antibodies can also be
provided according to the invention.
[0026] Chimeric antibodies in the context of the present invention
are preferably antibodies in which the constant domains of an
antibody as described here have been replaced by human sequences.
Preferably, chimeric antibodies are formed from monoclonal or
polyclonal antibodies as described here.
[0027] Humanized antibodies in the context of the present invention
are antibodies in which the constant and variable domains described
above of the non-human monoclonal or polyclonal antibodies, with
the exception of the hypervariable regions, have been replaced by
human sequences.
[0028] RNA molecules which code for human antibodies, i.e.
antibodies which have completely human sequences, that is to say in
the constant and variable domains, including the hypervariable
regions, can furthermore be used in the context of the present
invention. Such RNA molecules which code for human antibodies can
be isolated from human tissue or originate from immunized host
organisms as described here, e.g. mice, which are then transgenic
for the human IgG gene locus. RNA molecules which code for human
antibodies and have been isolated by means of phage display and
cloned with the aid of molecular biology methods are furthermore
provided (see below).
[0029] Antibodies which are coded by RNAs according so the
invention particularly preferably include so-called full length
antibodies, i.e. antibodies which comprise both the complete heavy
and the complete light chains, as described above.
[0030] RNAs which alternatively code for one or more antibody
fragment(s) of the antibodies described above, instead of the
corresponding full length antibody, can furthermore be provided in
the context of the present invention. Examples of such antibody
fragments are any antibody fragments known to a person skilled in
the art, e.g. Fab, Fab', F(ab').sub.2, Fc, Facb, pFc', Fd, and Fv
fragments of abovementioned antibodies etc. A diagram of the
structure of such antibody fragments is shown by way of example in
FIG. 4. Protein fragments consisting of the minimal binding subunit
of antibodies known as single-chain antibodies (scFvs) have
excellent binding specificity and affinity for their ligands. In
contrast, to antibodies, scFvs lack the non-binding regions.
Accordingly, RNA encoding scFvs are also encompassed by the present
invention.
[0031] For example, an Fab (fragment antigen binding) fragment
typically comprises the variable and a constant domain of a light
and a heavy chain, e.g., the C.sub.H1 and the V.sub.H domain of the
heavy chain and the complete light chain. The two chains are bonded
to one another via a disulfide bridge. An Fab fragment thus
conventionally contains the complete antigen-binding region of the
original antibody and usually has the same affinity for the
antigen, the immunogen or an epitope of a protein. Antibody
fragments, as also described above for antibodies, can be prepared
with the aid of molecular biology methods. In this context, the DMA
sequences which code for the various domains of the antibody
fragment are cloned into a specific expression vector. The RNA
which codes for these antibody fragments can then be expressed e.g.
in suitable host cells. Suitable host cells in connection with the
present invention include, inter alia, E. coli, yeasts, transgenic
plants or mammalian cells etc. (see below). In contrast, an scFv
fragment (single chain variable fragment) typically comprises the
variable domain of the light and of the heavy chain, which are
bonded to one another via an artificial polypeptide linker. In the
cloning of such scFv fragments, RNAs which code for a V.sub.H and
V.sub.L these being linked to one another by a polypeptide linker,
are preferably provided. As a rule, a polypeptide built up from
15-25 glycine, proline and/or serine residues (cf. FIG. 5) or the
associated nucleotide sequence is used at the RNA level for the
provision of this component.
[0032] Furthermore, RNA molecules which code for bispecific
antibodies cart also be provided in the context of the present
invention. Bispecific antibodies in the context of the present
invention are preferably antibodies which can act as adaptors
between an effector and a corresponding target, e.g. for recruiting
effector molecules (e.g. toxins, active compounds (drugs),
cytokines etc.), targeting of effector cells (e.g. CTL, NK cells,
macrophages, granulocytes etc. (see, for example, review by
Kontermann R. E., Acta Pharmacol. Sin, 2005, 26(1): 1-9). Is this
context, bispecific antibodies are in principle built up such as is
described here in general for antibodies, these bispecific
antibodies e.g. recognizing two different antigens, immunogens or
epitopes, or active compounds, cells, or other molecules (or
structures) as mentioned above, i.e. the antigen-binding regions of
the antibody are specific for two different molecules (or
structures). The various antigens, immunogens or epitopes etc., for
example, can thus be brought spatially close. Furthermore, by the
binding e.g. of a binding domain or other specificities, the
function of the antibody can be extended specifically, e.g. of a
binding protein, an immunotoxin etc. Such bispecific antibodies can
also be single-chain antibodies (e.g. scFv fragments etc.).
Bispecific antibodies can be used, for example, to bring two
reaction partners, e.g. two cells, two proteins, a protein and the
substrate thereof etc., spatially close in order to promote an
interaction between these (e.g. protein-protein interactions,
substrate conversions, modifications etc.). Bispecific antibodies
are used above all to bring effector cells (such as, for example, T
cells, NK cells, macrophages etc.) and target cells (e.g. tumour
cells, infected cells etc.) spatially close. Examples of bispecific
antibodies can include, without being limited thereto, e.g. those
antibodies or antibody fragments which bind on the one hand a
surface factor as described here, and on the other hand an antigen
as described here, preferably a tumour antigen as described here.
This includes e.g. CD28 and a tumour antigen (Grosse-Hovest L. et
al., 2003, Eur. Immunol. 33(5); 1334-40, (A recombinant bispecific
single-chain antibody induces targeted, supra-agonistic
CD28-stimulation and tumor cell killing)), CD19 and CD3 (CD19
tumour antigen of B cell lymphoma) etc.
[0033] Without being limited thereto, according to the present
invention RNAs which code for antibodies inter alia code for those
antibodies which bind antigens or specific nucleic acids. Antigens
in the context of the present invention are typically molecules
which are recognized as exogenous by the immune system and
conventionally cause an immune reaction or immune response with the
formation of antibodies directed specifically against them.
However, antigens can also include, especially in the case of
autoimmune diseases, endogenous molecules or structures which are
incorrectly recognized as exogenous by the immune system and
thereby trigger an immune reaction. Alternatively formulated,
antigens are therefore all molecules which are recognized by an
antibody in the context of the present invention. Antigens
substantially comprise proteins, peptides or epitopes of these
proteins or peptides. In this context, epitopes (also called
"antigenic determinants") are typically small regions (molecular
sections) lying on the surface of such protein or peptide
structures and having a length of from 5 to 15, in rare case also
to 25, preferably 6 to 9amino acids. Antigens can furthermore also
include lipids, carbohydrates etc. In the context of the present
invention, antigens also include, for example, so-called
immunogens, i.e. antigens which lead to an immunity of the organism
transfected therewith. Antigens by way of example include, without
being limited thereto, surface antigens of cells, tumour antigens
etc. For example, according to the present invention antibodies can
bind the following antigens (which typically occur in vertebrates),
e.g. tumour-specific surface antigens (TSSA), e.g. 5T4,
.alpha.5.beta.1-integrin, 707-AP, AFP, ART-4, B7H4, BAGE,
.beta.-catenin/m, Bcr-ab1, MN/C IX-antigen, CA125, CAMEL, CAP-1,
CASP-8, CD4, CD19, CD20, CD22, CD25, CDC27/m, CD 30, CD33, CD52,
CD56, CD80, CDK4/m, CEA, CT, Cyp-B, DAM, EGFR, ErbB3, ELF2M,
EMMPRIN, EpCam, ETV6-AML1, G250, GAGE, GnT-V, Gp100, HAGE,
HER-2/neu, HLA-A*0201-R170I, HPV-E7, HSP70-2M, HAST-2, hTERT (or
hTRT), iCE, IGF-1R, IL-2R, IL-5, KIAA0205, LAGE, LDLR/FUT, MAGE,
MART-1/Melan-A, MART-2/Ski, MC1R, myosin/m, MUC1, MUM-1, -2, -3,
NA88-A, NY-ESO1, PAP, proteinase-3, p190 minor bcr-abl,
Pm1/RAR.alpha., PRAME, PSA, PSM, PSMA, RAGE, RU1 or RU2, SAGE,
SART-1 or SART-3, survivin, TEL/AML1, TGF.beta., TFI/m, TRP-1,
TRP-2, TRP-2/INT2, VEGF and WT1, or sequences, such as e.g.
NY-Eso-1 or NY-Eso-B. Tumour antigens can, for example, typically
be responsible for metastasing, that is to say dissolving of tumour
cells out of their native tissue, transfer into the vascular system
(lymph or blood vessel system), exit from the vascular system and
colonization in a new tissue. In this context, such tumour antigens
which cause modified cell-cell interactions compared with the
native state are of interest in particular.
[0034] Antibodies encoded by the inventive RNA may also be directed
against tumour antigens listed by Table 1 or Table 2. In
particular, RNA encoding those antibodies may be used to treat (or,
may be used to prepare a medicament to treat, respectively) the
cancer diseases given in the last column of Tables 1 and 2.
TABLE-US-00001 TABLE 1 Antigens expressed in cancer diseases Tumor
antigen Name of tumor antigen Cancers or cancer diseases related
thereto 5T4 colorectal cancer, gastric cancer, ovarian cancer
707-AP 707 alanine proline melanoma 9D7 renal cell carcinoma AFP
alpha-fetoprotein hepatocellular carcinoma, gallbladder cancer,
testicular cancer, ovarian cancer, bladder cancer AlbZIP HPG1
prostate cancer alpha5beta1-Integrin alpha5beta6-Integrin colon
cancer alpha-methylacyl- prostate cancer coenzyme A racemase ART-4
adenocarcinoma antigen recognized by lung cancer, head and neck
cancer, leukemia, T cells 4 esophageal cancer, gastric cancer,
cervical cancer, ovarian cancer, breast cancer, squamous cell
carcinoma B7H4 ovarian cancer BAGE-1 B antigen bladder cancer, head
and neck cancer, lung cancer, melanoma, squamous cell carcinoma
BCL-2 leukemia BING-4 melanoma CA 15-3/CA 27-29 breast cancer,
ovary cancer, lung cancer, prostate cancer CA 19-9 gastric cancer,
pancreatic cancer, liver cancer, breast cancer, gallbladder cancer,
colon cancer, ovary cancer, lung cancer CA 72-4 ovarian cancer
CA125 ovarian cancer, colorectal cancer, gastric cancer, liver
cancer, pancreatic cancer, uterus cancer, cervix carcinoma, colon
cancer, breast cancer, lung cancer calreticulin bladder cancer
CAMEL CTL-recognized antigen on melanoma melanoma CASP-8 caspase-8
head and neck cancer cathepsin B breast cancer cathepsin L breast
cancer CD19 B-cell malignancies CD20 CD22 CD25 CD30 CD33 CD4 CD52
CD55 CD56 CD80 CEA carcinoembryonic antigen gut carcinoma,
colorectal cancer, colon cancer, hepatocellular cancer, lung
cancer, breast cancer, thyroid cancer, pancreatic cancer, liver
cancer cervix cancer, bladder cancer, melanoma CLCA2
calcium-activated chloride channel-2 lung cancer CML28 leukemia
Coactosin-like protein pancreatic cancer Collagen XXIII prostate
cancer COX-2 ovarian cancer, breast cancer, colorectal cancer
CT-9/BRD6 bromodomain testis-specific protein Cten C-terminal
tensin-like protein prostate cancer cyclin B1 cyclin D1 ovarian
cancer cyp-B cyclophilin B bladder cancer, lung cancer, T-cell
leukemia, squamous cell carcinoma, CYPB1 cytochrom P450 1B1
leukemia DAM-10/MAGE-B1 differentiation antigen melanoma 10
melanoma, skin tumors, ovarian cancer, lung cancer DAM-6/MAGE-B2
differentiation antigen melanoma 6 melanoma, skin tumors, ovarian
cancer, lung cancer EGFR/Her1 lung cancer, ovarian cancer, head and
neck cancer, colon cancer, pancreatic cancer, breast cancer EMMPRIN
tumor cell-associated extracellular lung cancer, breast cancer,
bladder cancer, ovarian matrix metalloproteinase inducer/ cancer,
brain cancer, lymphoma EpCam epithelial cell adhesion molecule
ovarian cancer, breast cancer, colon cancer, lung cancer EphA2
ephrin type-A receptor 2 glioma EphA3 ephrin type-A receptor 2
melanoma, sarcoma, lung cancer ErbB3 breast cancer EZH2 (enhancer
of Zeste homolog 2) endometrium cancer, melanoma, prostate cancer,
breast cancer FGF-5 fibroblast growth factor-5 renal cell
carcinoma, breast cancer, prostate cancer FN fibronectin melanoma
Fra-1 Fos-related antigen-1 breast cancer, esophageal cancer, renal
cell carcinoma, thyroid cancer G250/CAIX glycoprotein 250 leukemia,
renal cell carcinoma, head and neck cancer, colon cancer, ovarian
cancer, cervical cancer GAGE-1 G antigen 1 bladder cancer, lung
cancer, sarcoma, melanoma, head and neck cancer GAGE-2 G antigen 2
bladder cancer, lung cancer, sarcoma, melanoma, head and neck
cancer GAGE-3 G antigen 3 bladder cancer, lung cancer, sarcoma,
melanoma, head and neck cancer GAGE-4 G antigen 4 bladder cancer,
lung cancer, sarcoma, melanoma, head and neck cancer GAGE-5 G
antigen 5 bladder cancer, lung cancer, sarcoma, melanoma, head and
neck cancer GAGE-6 G antigen 6 bladder cancer, lung cancer,
sarcoma, melanoma, head and neck cancer GAGE-7b G antigen 7b
bladder cancer, lung cancer, sarcoma, melanoma, head and neck
cancer GAGE-8 G antigen 8 bladder cancer, lung cancer, sarcoma,
melanoma, head and neck cancer GDEP gene differentially expressed
in prostate prostate cancer GnT-V N-acetylglucosaminyltransferase V
glioma, melanoma gp100 glycoprotein 100 kDa melanoma GPC3 glypican
3 hepatocellular carcinoma, melanoma HAGE helicase antigen bladder
cancer HAST-2 human signet ring tumor-2 hepsin prostate
Her2/neu/ErbB2 human epidermal receptor- breast cancer, bladder
cancer, melanoma, ovarian 2/neurological cancer, pancreas cancer,
gastric cancer HERV-K-MEL melanoma HNE human neutrophil elastase
leukemia homeobox NKX 3.1 prostate cancer HOM-TES-14/SCP-1 ovarian
cancer HOM-TES-85 HPV-E6 cervical cancer HPV-E7 cervical cancer
HST-2 gastric cancer hTERT human telomerase reverse transcriptase
breast cancer, melanoma, lung cancer, ovarian cancer, sarcoma,
Non-Hodgkin-lymphoma, acute leukemia iCE intestinal carboxyl
esterase renal cell carcinoma IGF-1R colorectal cancer IL-13Ra2
interleukin 13 receptor alpha 2 chain glioblastoma IL-2R colorectal
cancer IL-5 immature laminin renal cell carcinoma receptor
kallikrein 2 prostate cancer kallikrein 4 prostate cancer Ki67
prostate cancer, breast cancer, Non-Hodgkin- lymphoma, melanoma
KIAA0205 bladder cancer KK-LC-1 Kita-kyushu lung cancer antigen 1
lung cancer KM-HN-1 tongue cancer, hepatocellular carcinomas,
melanoma, gastric cancer, esophageal, colon cancer, pancreatic
cancer LAGE-1 L antigen bladder cancer, head and neck cancer,
melanoma livin bladder cancer, melanoma MAGE-A1 melanoma antigen-A1
bladder cancer, head and neck cancer, melanoma, colon cancer, lung
cancer, sarcoma, leukemia MAGE-A10 melanoma antigen-A10 bladder
cancer, head and neck cancer, melanoma, colon cancer, lung cancer,
sarcoma, leukemia MAGE-A12 melanoma antigen-A12 bladder cancer,
head and neck cancer, melanoma, colon cancer, lung cancer, sarcoma,
leukemia, prostate cancer, myeloma, brain tumors MAGE-A2 melanoma
antigen-A2 bladder cancer, head and neck cancer, melanoma, colon
cancer, lung cancer, sarcoma, leukemia MAGE-A3 melanoma antigen-A3
bladder cancer, head and neck cancer, melanoma, colon cancer, lung
cancer, sarcoma, leukemia MAGE-A4 melanoma antigen-A4 bladder
cancer, head and neck cancer, melanoma, colon cancer, lung cancer,
sarcoma, leukemia MAGE-A6 melanoma antigen-A6 bladder cancer, head
and neck cancer, melanoma, colon cancer, lung cancer, sarcoma,
leukemia MAGE-A9 melanoma-antigen-A9 bladder cancer, head and neck
cancer, melanoma, colon cancer, lung cancer, sarcoma, leukemia
MAGE-B1 melanoma-antigen-B1 melanoma MAGE-B10 melanoma-antigen-B10
melanoma MAGE-B16 melanoma-antigen-B16 melanoma MAGE-B17
melanoma-antigen-B17 melanoma MAGE-B2 melanoma-antigen-B2 melanoma
MAGE-B3 melanoma-antigen-B3 melanoma MAGE-B4 melanoma-antigen-B4
melanoma MAGE-B5 melanoma-antigen-B5 melanoma MAGE-B6
melanoma-antigen-B6 melanoma MAGE-C1 melanoma-antigen-C1 bladder
cancer, melanoma MAGE-C2 melanoma-antigen-C2 melanoma MAGE-C3
melanoma-antigen-C3 melanoma MAGE-D1 melanoma-antigen-D1 melanoma
MAGE-D2 melanoma-antigen-D2 melanoma MAGE-D4 melanoma-antigen-D4
melanoma MAGE-E1 melanoma-antigen-E1 bladder cancer, melanoma
MAGE-E2 melanoma-antigen-E2 melanoma MAGE-F1 melanoma-antigen-F1
melanoma MAGE-H1 melanoma-antigen-H1 melanoma MAGEL2 MAGE-like 2
melanoma mammaglobin A breast cancer MART-1/Melan-A melanoma
antigen recognized by T melanoma cells-1/melanoma antigen A MART-2
melanoma antigen recognized by T melanoma cells-2 matrix protein 22
bladder cancer MC1R melanocortin 1 receptor melanoma M-CSF
macrophage colony-stimulating factor ovarian cancer gene mesothelin
ovarian cancer MG50/PXDN breast cancer, glioblastoma, melanoma MMP
11 M-phase phosphoprotein 11 leukemia MN/CA IX-antigen renal cell
carcinoma MRP-3 multidrug resistance-associated protein 3 lung
cancer MUC1 mucin 1 breast cancer MUC2 mucin 2 breast cancer,
ovarian cancer, pancreatic cancer NA88-A NA cDNA clone of patient
M88 melanoma N-acetylglucos- aminyltransferase-V Neo-PAP
Neo-poly(A) polymerase NGEP prostate cancer NMP22 bladder cancer
NPM/ALK nucleophosmin/anaplastic lymphoma kinase fusion protein NSE
neuron-specific enolase small cell cancer of lung, neuroblastoma,
Wilm' tumor, melanoma, thyroid cancer, kidney cancer, testicle
cancer, pancreas cancer NY-ESO-1 New York esophageous 1 bladder
cancer, head and neck cancer, melanoma, sarcoma, B-lymphoma,
hepatoma, pancreatic cancer, ovarian cancer, breast cancer NY-ESO-B
OA1 ocular albinism type 1 protein melanoma OFA-iLRP oncofetal
antigen-immature laminin leukemia receptor OGT O-linked
N-acetylglucosamine transferase gene OS-9 osteocalcin prostate
cancer osteopontin prostate cancer, breast cancer, ovarian cancer
p15 protein 15 p15 melanoma p190 minor bcr-abl p53 PAGE-4 prostate
GAGE-like protein-4 prostate cancer PAI-1 plasminogen acitvator
inhibitor 1 breast cancer PAI-2 plasminogen acitvator inhibitor 2
breast cancer PAP prostate acic phosphatase prostate cancer PART-1
prostate cancer
PATE prostate cancer PDEF prostate cancer Pim-1-Kinase Pin1 Propyl
isomerase prostate cancer POTE prostate cancer PRAME preferentially
expressed antigen of melanoma, lung cancer, leukemia, head and neck
melanoma cancer, renal cell carcinoma, sarcoma prostein prostate
cancer proteinase-3 PSA prostate-specific antigen prostate cancer
PSCA prostate cancer PSGR prostate cancer PSM PSMA
prostate-specific membrane antigen prostate cancer RAGE-1 renal
antigen bladder cancer, renal cancer, sarcoma, colon cancer
RHAMM/CD168 receptor for hyaluronic acid mediated leukemia motility
RU1 renal ubiquitous 1 bladder cancer, melanoma, renal cancer RU2
renal ubiquitous 1 bladder cancer, melanoma, sarcoma, brain tumor,
esophagel cancer, renal cancer, colon cancer, breast cancer S-100
melanoma SAGE sarcoma antigen SART-1 squamous antigen rejecting
tumor 1 esophageal cancer, head and neck cancer, lung cancer,
uterine cancer SART-2 squamous antigen rejecting tumor 1 head and
neck cancer, lung cancer, renal cell carcinoma, melanoma, brain
tumor SART-3 squamous antigen rejecting tumor 1 head and neck
cancer, lung cancer, leukemia, melanoma, esophageal cancer SCC
squamous cell carcinoma antigen lung cancer Sp17 sperm protein 17
multiple myeloma SSX-1 synovial sarcoma X breakpoint 1
hepatocellular cell carcinom, breast cancer SSX-2/HOM-MEL- synovial
sarcoma X breakpoint 2 breast cancer 40 SSX-4 synovial sarcoma X
breakpoint 4 bladder cancer, hepatocellular cell carcinoma, breast
cancer STAMP-1 prostate cancer STEAP six transmembrane epithelial
antigen prostate cancer prostate survivin bladder cancer
survivin-2B intron 2-retaining survivin bladder cancer TA-90
melanoma TAG-72 prostate carcinoma TARP prostate cancer TGFb
TGFbeta TGFbRII TGFbeta receptor II TGM-4 prostate-specific
transglutaminase prostate cancer TRAG-3 taxol resistant associated
protein 3 breast cancer, leukemia, and melanoma TRG testin-related
gene TRP-1 tyrosine related protein 1 melanoma TRP-2/6b TRP-2/novel
exon 6b melanoma, glioblastoma TRP-2/INT2 TRP-2/intron 2 melanoma,
glioblastoma Trp-p8 prostate cancer Tyrosinase melanoma UPA
urokinase-type plasminogen activator breast cancer VEGF vascular
endothelial growth factor VEGFR-2/FLK-1 vascular endothelial growth
factor receptor-2 WT1 Wilm' tumor gene gastric cancer, colon
cancer, lung cancer, breast cancer, ovarian cancer, leukemia
TABLE-US-00002 TABLE 2 Mutant antigens expressed in cancer diseases
Mutant antigen Name of mutant antigen Cancers or cancer diseases
related thereto alpha-actinin-4/m lung carcinoma ARTC1/m melanoma
bcr/abl breakpoint cluster region-Abelson CML fusion protein
beta-Catenin/m beta-Catenin melanoma BRCA1/m breast cancer BRCA2/m
breast cancer CASP-5/m colorectal cancer, gastric cancer,
endometrial carcinoma CASP-8/m head and neck cancer, squamous cell
carcinoma CDC27/m cell-division-cycle 27 CDK4/m cyclin-dependent
kinase 4 melanoma CDKN2A/m melanoma CML66 CML COA-1/m colorectal
cancer DEK-CAN fusion protein AML EFTUD2/m melanoma ELF2/m
Elongation factor 2 lung squamous cell carcinoma ETV6-AML1 Ets
variant gene6/acute myeloid leukemia ALL 1 gene fusion protein
FN1/m fibronectin 1 melanoma GPNMB/m melanoma HLA-A*0201-R170I
arginine to isoleucine exchange at renal cell carcinoma residue 170
of the alpha-helix of the alpha2-domain in the HLA-A2 gene
HLA-A11/m melanoma HLA-A2/m renal cell carcinoma HSP70-2M heat
shock protein 70-2 mutated renal cell carcinoma, melanoma,
neuroblastoma KIAA0205/m bladder tumor K-Ras/m pancreatic
carcinoma, colorectal carcinoma LDLR-FUT LDR-Fucosyltransferase
fusion protein melanoma MART2/m melanoma ME1/m non-small cell lung
carcinoma MUM-1/m melanoma ubiquitous mutated 1 melanoma MUM-2/m
melanoma ubiquitous mutated 2 melanoma MUM-3/m melanoma ubiquitous
mutated 3 melanoma Myosin class I/m melanoma neo-PAP/m melanoma
NFYC/m lung squamous cell carcinoma N-Ras/m melanoma OGT/m
colorectal carcinoma OS-9/m melanoma p53/m Pml/RARa promyelocytic
leukemia/retinoic acid APL, PML receptor alpha PRDX5/m melanoma
PTPRX/m receptor-type protein-tyrosine phosphatase melanoma kappa
RBAF600/m melanoma SIRT2/m melanoma SYT-SSX-1 synaptotagmin
I/synovial sarcoma X sarcoma fusion protein SYT-SSX-2 synaptotagmin
I/synovial sarcoma X sarcoma fusion protein TEL-AML1 translocation
Ets-family leukemia/ AML acute myeloid leukemia 1 fusion protein
TGFbRII TGFbeta receptor II colorectal carcinoma TPI/m
triosephosphate isomerase melanoma
[0035] In a preferred embodiment according to the invention,
antibodies encoded by the inventive RNA are directed against the
following (protein) antigens (whereby the RNA molecules may be used
for the preparation of a medicament, e.g. a pharmaceutical
composition or more preferably a (passive) vaccine in the meaning
of the present invention), are selected from the group consisting
of 5T4, 707-AP, 9D7, AFP, A1bZIP HPG1, alpha-5-beta-1-integrin,
alpha-5-beta-6-integrin, alpha-actinin-4/m,
alpha-methylacyl-coenzyme A racemase, ART-4, ARTC1/m, B7H4, BAGE-1,
BCL-2, bcr/abl, beta-catenin/m, BING-4, BRCA1/m, BRCA2/m, CA
15-3/CA 27-29, CA 19-9, CA72-4, CA125, calreticulin, CAMEL,
CASP-8/m, cathepsin B, cathepsin L, CD19, CD20, CD22, CD25, CDE30,
CD33, CD4, CD52, CD55, CD56, CD80, CDC27/m, CDK4/m, CDKN2A/m, CEA,
CLCA2, CML28, CML66, COA-1/m, coactosin-like protein, collage
XXIII, COX-2, CT-9/BRD6, Cten, cyclin B1, cyclin D1, cyp-B, CYFB1,
DAM-10, DAM-6, DEK-CAN, EPTUD2/m, EGFR, ELF2/m, EMMPRIN, EpCam,
EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250,
GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE7b, GAGE-8,
GDEP, GnT-V, gp100, GPC3, GPNMB/m, HAGE, HAST-2, hepsin, Her2/neu,
HERV-K-MEL, HLA-85, A*020I-R171, HLA-11/m, HLA-A2/m, HNE, homeobox
NKX3.1, HOM-TES-14/SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M,
HST-2, hTBRT, iCE, IGF-1R, IL-13Ra2, IL-2R, IL-5, immature laminin
receptor, kallikrein-2, kallikrein-4, Ki67, KIAA0205, KIAA0205/m,
KK-LC-1, K-Ras/m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3,
MAGE-A4, MAGE-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-B1, MAGE-B2,
MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, MAGE-B16, MAGE-B17,
MAGE-C1, MAGE-C2, MAGE-C3, MAGE-D1, MAGE-D2, MAGE-D4, MAGE-E1,
MAGE-E2, MAGE-F1, MAGE-H1, MAGEL2, mammaglobin A, MART-1/melan-A,
MART-2, MART-2/m, matrix protein 22, MC1R, M-CSF, MEI/m,
mesothelin, MG50/PXDN, MMP11, MN/CA 1X-antigen, MRP-3, MUC-1,
MUC-2, MUM-1/m, MUM-2/m, MUM-3/m, myosin class I/m, NA88-A,
N-acetylglucosaminyltransferase-V, Neo-PAP, Neo-PAP/m, NFYC/m,
NGEP, NMP22, NPM/ALK, N-Ras/m, NSE, NY-ESO-1, NY-ESO0B, OA1,
OFA-iLRP, OGT, OGT/m, OS-9, OS-9/m, osteocalcin, osteopontin, p15,
p190 minor ber-abl, p53, p53/m, PAGE-4, PAI-1, PAI-2, PART-1, PATE,
PDEF, Pim-1-Kinase, Pin-1, PM1/PARalpha, POTE, PRAME, PRDX5/m,
prostein, proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK/m,
RAGE-1, RBAF600/m, RHAMM/CD168, RU1, RU2, S-100, SAGE, SART-1,
SART-2, SART-3, SCC, SIRT2/m, Sp17, SSX-1, SSX-2/HOM-MEL-40, SSX-4,
STAMP-1, STEAP, survinin, survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90,
TAGE-72, TARP, TEL-AML1, TGRbeta, TGFbetaR11, TGM-4, TPI/m, TRAG-3,
TRG, TRP-1, TRP-2/6b, TRP/INT2, TRP-p8, tyrosinase, UPA, VEGF,
VEGFR-2/FLK-1, and WT1.
[0036] In a particularly preferred embodiment, the RNA codes for
antibodies which are directed against protein antigens selected
front the group consisting of MAGE-A1, MAGE-A6, melan-A, GP100,
tyrosinase, survivin, CPA, Her-2/neu, WT1, FRAME, EGPR1 (epidermal
growth factor receptor 1), mucin-1 and SEC61G, hTERT, 5T4, NY-Eso1,
and TRP-2, more preferably from sequences of group consisting of
MAGE-A1 [accession number M77481], MAGE-A6 [accession number
NM.sub.--005363], melan-A [accession number NM.sub.--005511], GP100
[accession number M77348], tyrosinase [accession number
NM.sub.--000372], survivin [accession number AF077350], CEA
[accession number NM.sub.--004363], Her-2/neu [accession number
M11730], WT1 [accession number NM.sub.--000378], PRAME [accession
number NM.sub.--006115], EGFRI (epidermal growth factor receptor 1)
[accession number AF288738], mucin-1 [accession number
NM.sub.--002456] and SEC61G [accession number NM.sub.--014302],
hTERT [accession number NM.sub.--198253], 5T4 [accession number
NM.sub.--006670], NY-Eso1[accession number NM.sub.--001327], and
TRP-2 [accession number NM.sub.--001922].
[0037] Antibodies (and therefore also the RNAs according to the
invention on which these antibodies are based) which bind the
antigens described here and, possibly, other antigens or nucleic
acids can be identified e.g. by means of the method of phage
display developed by George P. Smith. In this context, antibodies
or antibody fragments are typically expressed on the surface of
filamentous phages (Smith, G. P., 1985, "Filamentous fusion phage:
novel expression vectors that display cloned antigens on the virion
surface". Science 228; 1315-1317). For this there are
conventionally 3 to 5 copies of the surface protein gpIII on the
proximal end of the phage, with the aid of which the phage infects
bacteria cells via the F pilus thereof. In phage display, for
example, the DNA for an antibody fragment which codes the
antigen-binding variable domain is then cloned in-frame before the
gpIII gene. In protein biosynthesis, a fusion protein is formed
therefrom, which is expressed on the virus surface without the
phage losing its infectiousness. With the aid of the phage display
technique, it is possible to generate large antibody libraries,
each phage expressing a different antibody fragment on the surface.
To this extent, the underlying RNA is therefore also available. A
particular antibody fragment can be isolated from such a library by
a method called "phage panning". For this, the corresponding
antigen is bound to a matrix and incubated with the phage
suspension. The phages which present an appropriate antibody
fragment interact with the fixed antigen, while the other phages
are removed by a washing step. The phages isolated are multiplied,
for example, in E. coli. The DNA is isolated accordingly and the
gene sequence is determined. Expression constructs which contain
the cDNA coding for the entire antibody or antibody fragments can
then be developed with the aid of genetic engineering methods. An
RNA (mRNA) which codes for the antibody can be generated from this
cDNA by means of in vitro transcription (see below). Nucleic acids
or, respectively, mRNA coding for monoclonal antibodies which are
entirely of human origin are obtained in this manner.
[0038] In the context of the present invention, RNA according to
the invention which codes for antibodies as described above is also
suitable for coding so-called intrabodies or for rendering possible
an expression of intrabodies. Intrabodies in the context of the
present invention can include any of the antibodies or antibody
fragments described here. Intrabodies are intracellularly expressed
antibodies, i.e. antibodies which are coded by nucleic acids
localized in the cell and are expressed there. For this, an RNA
according to the invention which encodes the antibodies or antibody
fragments as described above is introduced into cells beforehand,
for example with the aid of transfection methods according to the
invention or other suitable transfection methods (see below) and,
where appropriate, thereafter transplanted into an organism or
being or introduced directly as nucleic acids into an organism or
being. In this context (irrespective of whether an an intrabody or
a secreted antibody shall be introduce into the cell), the RNA
according to the invention (or a corresponding nucleic acid) can be
introduced in the naked form or as a complex with suitable carriers
(e.g. liposomes) into the organism or the being or can have such
modifications (of the RNA) which, where appropriate together with
one of the transfection methods mentioned, lead to a better cell
uptake, e.g. any of the RNA modifications mentioned here, such as,
for example, lipid modifications of the RNA according to the
invention. An organism or a being in connection with the present
invention typically means mammals, i.e. animals, including cattle,
pig, dog, cat, donkey, monkey, rodents, e.g. mouse, hamster, rabbit
etc., and humans. Intrabodies can be localized and expressed at
certain sites in the cell. For example, intrabodies can be
expressed in the cytoplasm, the formation of disulfide bridges
usually being decreased under the reducing conditions of the
cytoplasm. It has been possible to demonstrate, however, that
cytoplasmic intrabodies, and in particular scFv fragments, can be
functional. Cytoplasmic expression by the RNA according to the
invention opens up the possibility of also inhibiting cytoplasmic
proteins. This is not possible with treatment with monoclonal
antibodies from the prior art, since these antibodies can reach
only secreted and membrane-located (extracellular) proteins due to
their secretion from the cell after intracellular expression (which
represents the major difference between antibodies and
intrabodies). By expression of a signal peptide, intrabodies can be
transported into the endoplasmic reticulum (ER) and then secreted
as with regular antibodies. In this case, typically only secreted
or membrane-located proteins are a target for these antibodies. By
additional coding of a C-terminal ER retention signal (for example
KDEL) by the RNA according to the invention, the intrabody can
remain in the ER (where it may bind to specific antigen located in
the ER) and prevent secretion of its antigen and/or transport of
its antigen or its target molecule to the plasma membrane.
Depending on the requirement, intrabodies can include full length
antibodies or antibody fragments as described above. Intrabodies in
the context of the present invention preferably initially include
full length antibodies, which are retained in the cell and not
secreted from the cell (by whatever technique, e.g. retention
signal sequences etc.). However, if e.g. intracellular expression
of full length antibodies is technically not possible or not
appropriate, antibody fragments as described above can also be
employed as intrabodies.
[0039] Antibodies which are coded by the RNA according to the
invention furthermore also include those antibodies or antibody
fragments which have a sequence identity to one of the antibodies
or antibody fragments described here of at least 70%, 80% or 85%,
preferably at least 90%, more preferably at least 95% and most
preferably at least 99% over the entire length of the coding
nucleic acid or amino acid sequence of an antibody or antibody
fragment as described here. Preferably, such antibodies or antibody
fragments have the same biological function as or, respectively,
the specific activity of the corresponding full length antibody,
e.g. the specific binding of particular antigens or nucleic acids.
Accordingly, it is preferred, if the hypervariable region(s) are
conserved or are modified by merely conservative mutations.
[0040] The biological function of antibodies described here which
are coded by the RNA according to the invention includes e.g.
neutralization of antigens, complement activation or opsonization.
In the case of neutralization of antigens, the antibody can bind to
an antigen and thereby neutralize this. The antibody is
conventionally blocked by the binding of the antigen, and can
therefore display its action only against one antigen, or two
antigens in the case of bispecific antibodies. scFv antibody
fragments are suitable above all for this (neutralization) function
of an antibody, since they do not include the functions of the
constant domains of an antibody. In the case of complement
activation, the complex system of complement proteins which are
dependent upon the Fc part of the antibody can be activated via
binding of antibodies. End products of the complement cascade
typically lead to lysis of cells and to the creation of a
phlogistic (inflammatory) milieu. In the case of opsonization,
pathogens or foreign particles are rendered accessible to
phagocytes by binding by an antibody via the constant domains of
the antibody. Alternatively, the opsonized cells, which are
recognized as foreign, can be lysed via an antibody-dependent,
cell-mediated cytotoxicity (ADCC). In this context, NK cells in
particular can perform lytic functions in this manner via
activation of their Fc receptors.
[0041] In connection with the present invention, the term
"identity" means that the sequences are compared with one another
as follows. In order to determine the percentage identity of two
nucleic acid sequences, the sequences can first be aligned with
respect to one another in order subsequently to make a comparison
of these sequences possible. For this e.g. gaps can be inserted
into the sequence of the first nucleic acid sequence and the
nucleotides can be compared with the corresponding position of the
second nucleic acid sequence. If a position in the first nucleic
acid sequence is occupied by the same nucleotide as is the case at
a position in the second sequence, the two sequences are identical
at this position. The percentage identity between two sequences is
a function of the number of identical positions divided by the
number of all the positions compared in the sequences investigated,
if e.g. a specific sequence identity is assumed for a particular
nucleic acid (e.g. a nucleic acid which codes for a protein, as
described above) in comparison, with a reference nucleic acid (e.g.
a nucleic acid from the prior art) of defined length, this
percentage identity is stated relatively with reference to this
reference nucleic acid. Starting therefore, for example, from a
nucleic acid which has a sequence identity of 50% to a reference
nucleic acid 100 nucleotides long, this nucleic acid can be a
nucleic acid 50 nucleotides long which is completely identical to a
50 nucleotides long section of the reference nucleic acid. Indeed,
it can also be a nucleic acid 100 nucleotides long which has 50%
identity, i.e. In this case 50% identical nucleic acids, with the
reference nucleic acid over the entire length thereof.
Alternatively, this nucleic acid can be a nucleic acid 200
nucleotides long which is completely identical in a 100 nucleotides
long section of the nucleic acid to the reference nucleic acid 100
nucleotides long. Other nucleic acids of course equally meet these
criteria. The identity statements described for nucleic acids apply
equally to the antibodies and antibody fragments coded by the RNA
according to the invention. The same holds for the determination of
the sequence identity between two (poly)peptides, based on the
comparison/alignment of the respective amino acid sequences.
[0042] The percentage identity of two sequences can be determined
with the aid of a mathematical algorithm. A preferred, but not
limiting, example of a mathematical algorithm which can be used for
comparison of two sequences is the algorithm of Karlin et al.
(1993), PNAS USA, 90:5873-5877. Such an algorithm is integrated in
the NBLAST program, with which sequences which have a desired
identity to the sequences of the present invention can be
identified. In order to obtain a gapped alignment, as described
here, the "Gapped BLAST" program can be used, as is described in
Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402. If BLAST
and Gapped BLAST programs are used, the preset parameters of the
particular program (e.g. NBLAST) can be used. The sequences can be
aligned further using version 9 of GAP (global alignment program)
of the "Genetic Computing Group" using the preset (BLOSUM62) matrix
(values -4 to +11) with a gap open penalty of -12 (for the first
zero of a gap) and a gap extension penalty of -4 (for each
additional successive zero in the gap). After the alignment, the
percentage identity is calculated by expressing the number of
agreements as a percentage content of the nucleic acids in the
sequence claimed. The methods described for determination of the
percentage identity of two nucleic acid sequences can also be used
correspondingly, if necessary, on the coded amino acid sequences,
e.g. the antibodies described here.
[0043] According to a preferred embodiment the antibody-coding RNA
according to the invention contains acoding regions which codes for
one of the antibodies listed in Table 3. The antibody encoding RNA
may be used to treat (or, may be used to provide a pharmaceutical
composition to treat) one of the diseases, disorders, pathologies
listed in the right-band column of Table 3.
TABLE-US-00003 TABLE 3 Name Target Clinical application Oregovomab
(OvaRex) CA125 (MUC-16) Ovarian Cancer, Fallopian Tube Cancer,
Peritoneal Cavity Cancer Cantuzumab CanAg (MUC-1) Colon Cancer,
Gastric Cancer, Pancreatic Cancer, NSCLC HuC242-DM4 CanAg (MUC-1)
Colon Cancer, Gastric Cancer, Pancreatic Cancer PAM4 (IMMU-107)
CanAg (MUC-1) Pancreatic Cancer HuC242-DM4 CanAg (MUC-1) Colorectal
Cancer; Pancreatic Cancer HuHMFG1 CanAg (MUC-1) Breast Cancer
WX-G250 (Rencarex) Carbonische An- Renal Cell Carcinoma hydrase IX
(G250) MT103 CD19 Non-Hodgkin-Lymphoma Ibritumomab (Zevalin) CD20
Non-Hodgkin-Lymphoma, Lymphoma Rituximab (Rituxan, CD20
Non-Hodgkin-Lymphoma, Lymphoma, Chronic Lymphocytic MabThera)
Leukemia Tositumomab (Bexxar) CD20 Non-Hodgkin-Lymphoma, Lymphoma,
Myeloma Ofatumamab (HuMax- CD20 Lymphoma, B-Cell Chronic
Lymphocytic Leukemia CD20) Epratuzumab (Lympho- CD22
Non-Hodgkin-Lymphoma, Leukemia Cide) MDX-060 CD30 Hodgkin-Lymphoma,
Lymphoma SGN-30 CD30 Hodgkin-Lymphoma, Lymphoma Gemtuzumab
(Mylotarg) CD33 Leukemia Zanolimumab (HuMax- CD4 T-Cell-Lymphoma
CD4) SGN-40 CD40 Non-Hodgkin-Lymphoma, Myeloma, Leukemia, Chronic
Lymphocytic Leukemia Alemtuzumab (MabCampath) CD52 T-Cell-Lymphoma,
Leukemia HuN901-DM1 CD56 Myeloma Galiximab CD80
Non-Hodgkin-Lymphoma Labetuzumab CEA Colon Cancer, Pancreatic
Cancer, Ovarian Cancer Ipilimumab (MDX-010) CTLA4 Sarcoma,
Melanoma, Lung cancer, Ovarian Cancer leucemia, Lymphoma, Brain and
Central Nervous System Tumors, Testicular Cancer, Prostate Cancer,
Pancreatic Cancer, Breast Cancer Cetuximab (Erbitux) EGFR Colon
Cancer, Head and Neck Cancer, Pancreatic Cancer, Non-Small Cell
Lung Cancer, Cervical Cancer, Endometrial Cancer, Breast Cancer,
Myeloma, Lung Cancer, Gastric Cancer, Esophageal Cancer, Pancreatic
Cancer, Oropharyngeal Neoplasms, Hepatocellular Carcinoma, Squamous
Cell Carcinoma, Sarcoma, Larynx Cancer; Hypopharynx Cancer
Panitumumab (Vectibix) EGFR Colon Cancer, Lung Cancer, Breast
Cancer; Bladder Cancer; Ovarian Cancer Nimotuzumab EGFR Solid
Tumors, Lung Cancer (TheraCim) Matuzumab EGFR Lung Cancer, Cervical
Cancer, Esophageal Cancer Zalutumumab EGFR Head and Neck Cancer,
Squamous Cell Cancer Pertuzumab (Omnitarg) EGFR und Breast Cancer,
Ovarian Cancer, Lung Cancer, Prostate Cancer HER2/neu Catumaxomab
(Removab) EpCam Ovarian Cancer, Fallopian Tube Neoplasms,
Peritoneal Neo- plasms MORab-003 GP-3 Ovarian Cancer, Fallopian
Tube Cancer, Peritoneal Cancer MORab-009 GP-9 Pancreatic Cancer,
Mesothelioma, Ovarian Cancer, Non-Small Cell Lung Cancer, Fallopian
Tube Cancer, Peritoneal Cavity Cancer Ertumaxomab HER2/neu Breast
Cancer Trastuzumab (Herceptin) HER2/neu Breast Cancer, Endometrial
Cancer, Solid Tumors AMG 102 HGF Advanced Renal Cell Carcinoma
Apolizumab (Remitogen) HLA-DR-Antigen Solid Tumors, Leukemia,
Non-Hodgkin-Lymphoma, Lymphoma CNTO 95 Integrin-Rezeptor Melanoma
ID09C3 MHCII Non-Hodgkin-Lymphoma Denosumab (AMG-102) RANKL
Myeloma, Giant Cell Tumor of Bone, Breast Cancer, Prostate Cancer
GC1008 TGFbeta Advanced Renal Cell Carcinoma; Malignant Melanoma
Mapatumumab TRAIL-R1 Colon Cancer, Myeloma Bevacizumab (Avastin)
VEGF Colon Cancer, Breast Cancer, Brain and Central Nervous System
Tumors, Lung Cancer, Hepatocellular Carcinoma, Kidney Cancer,
Breast Cancer, Pancreatic Cancer, Bladder Cancer, Sarcoma,
Melanoma, Esophageal Cancer; Stomach Cancer, Metastatic Renal Cell
Carcinoma; Kidney Cancer, Glioblastoma, Liver Cancer MEDI 522 VLA3
(alpha5beta3- Solid Tumors, Leukemia, Lymphoma, Small Intestine
Cancer, Integrin) Melanoma Volociximab VLA5 (alpha5beta1- Renal
Cell Carcinoma, Pancreatic Cancer, Melanoma Integrin) Name Target
Application Hematology: Eculizumab (Alexion) C5 Komplementfaktor
Paroxysmale nachtliche Hamoglobinurie (PNH) Mepolizumab
Interleukin-5 Hypereosinophilie-Syndrom Dentology: CaroRx (CaroRx)
Streptococcus mutans Zahnkaries Autoimmune Diseases und allergic
Diseases: Efalizumab (Raptiva) CD11a Psoriasis (Schuppenflechte)
Epratuzumab (LymphoCide) CD22 Autoimmune Diseases, Non-Hodgkin-
Lymphom Lumiliximab CD23 Allergies Daclizumab CD25 Schubformige
Multiple Sclerosis Natalizumab (Tysabri) CD49d Multiple Sclerosis
Omalizumab (Xolair) IgE (Fc-Teil) Schweres Asthma bronchiale
Mepolizumab Interleukin-5 Asthma, Hypereosinophilic Syndrome,
Eosinophilic Gastroenteritis, Churg-Strauss Syndrome, Eosinophilic
Esophagitis Tocilizumab (Actemra) Interleukin-6 Rheumatoid
Arthritis Adalimumab (Humira) TNF.alpha. Rheumatoid Arthritis,
Psoriasis-Arthritis, Morbus Bechterew Infliximab (Remicade)
TNF.alpha. Morbus Crohn, Rheumatoide Arthritis, Morbus Bechterew,
Psoriasis-Arthritis, Colitis ulcerosa, Psoriasis (Schuppenflechte)
Golimumab (CNTO 148) TNF.alpha. Rheumatoid Arthritis Mapatumumab
TRAIL-R1 Myeloma Rituximab (Rituxan, MabThera) CD20 Urticaria,
Rheumatoid Arthritis, Ulcerative Colitis, Chronic Focal
Encephalitis Epratuzumab (LymphoCide) CD22 Autoimmune diseases,
Systemic Lupus Erythematosus Neurodegenerative Diseases: R1450
Amyloid-beta Alzheimer Ophthalmology: Ranibizumab (Lucentis) VEGF-A
Feuchte Macular Degeneration Bevacizumab (Avastin) VEGF Macular
Degeneration Infektious Diseases: Palivizumab (Synagis) Component
of RSV Prevention of RSV-Pneumonia bei Fruhgeborenen (Respiratory
Syncytial Virus) Cardiovascular Diseases: Abciximab (ReoPro)
GPIIb/Iia Verhinderung eines Gefa.beta.verschlusses nach PTCA Other
Diseases: Denosumab (AMG-102) RANKL Osteoporosis GC1008 TGFbeta
Pulmonary Fibrosis Bevacizumab (Avastin) VEGF Proliferative
Diabetic Retinopathy
[0044] According to a preferred embodiment, the antibody-coding RNA
according to the invention contains or has a sequence which codes
for the heavy chains according to SEQ ID NO: 2 and the light chains
according to SEQ ID NO: 4. According to an even more preferred
embodiment, the antibody-coding RNA according to the invention
contains or has a coding sequence according to SEQ ID NO: 5 or SEQ
ID NO: 51, respectively.
[0045] According to another preferred embodiment, the
antibody-coding RNA according to the invention contains or has a
sequence which codes for the heavy chains according to SEQ ID NO: 7
and the light chains according to SEQ ID NO: 9. According to an
even more preferred embodiment, the antibody-coding RNA according
to the invention contains or has a coding sequence according to SEQ
ID NO: 10 or SEQ ID NO: 52, respectively.
[0046] According to a further preferred embodiment, the
antibody-coding RNA according to the invention contains or has a
sequence which codes for the heavy chains according to SEQ ID NO:
12 and the light chains according to SEQ ID NO: 14. According to an
even more preferred embodiment, the antibody-coding RNA according
to the invention contains or has a coding sequence according to SEQ
ID NO: 15 or SEQ ID NO: 53, respectively.
[0047] Antibodies which are coded by the RNA according to the
invention can furthermore also encode such antibodies which have a
sequence identity to one of the coding sequences of the antibodies
described here, e.g. as described by Table 3 or by SEQ ID NO: 5
(51), 10 (52) or 15 (53), of at least 70%, 80% or 85%, preferably
at least 90%, more preferably at least 95% and most preferably at
least 99% over the entire length of the nucleic acid sequence or
amino acid sequence of an antibody as described here, e.g. as
described by Table 3 or by SEQ ID NO: 5 (51), 10 (52) or 15
(53).
[0048] Such antibodies which are coded by the RNA according to the
invention likewise include antibodies according to SEQ ID NO: 5
(51), 10 (52) or 15 (53) or according to Table 3 which contain or
have, in one of the heavy chains described here according to SEQ ID
NO: 2, 7 or 12 and/or in one of the light chains described here
according to SEQ ID NO: 4, 9 or 14, a nucleic acid or amino acid
sequence identity of at least 70%, 80% or 85%, preferably at least
90%, more preferably at least 95% and most preferably at least 99%
over the entire length of the coding sequence for the particular
light and/or heavy chain, with as otherwise unchanged coding
antibody sequence of SEQ ID NO: 5 (51), 10 (52) or 15 (53) or e.g.
antibodies of Table 3.
[0049] Overall, a novel route for carrying out antibody therapies
on fee basis of RNA, in particular mRNA, is thus provided with the
aid of the present invention. In such a manner, clinically tested
antibodies, for example angiogenesis inhibitors based on
antibodies, for example bevacizumab (monoclonal immunoglobulin
G.sub.1 antibody which binds to the vascular growth factor VEGF
(vascular endothelial growth factor); or trastuzumab (Herceptin),
an indirect inhibitor which inhibits the action of tumour proteins
on receptors, or for example rituximab or cetuximab (directed
against the epidermal growth factor receptor (EGFR)), based on RNA,
can be provided, so that the inventive RNA contains at least one
coding region which codes for at least one of these antibodies.
[0050] In a preferred embodiment, the antibody-coding RNA according
to the invention typically additionally has at least one of the
following modifications, which are preferably suitable for
increasing the stability of the coding RNA, improving the
expression of the antibody thereby coded, increasing the cell
permeability, rendering possible localization of the antibody on or
in certain cell compartments etc. Each of these modifications of
the RNA according to the invention, described here (modified RNA)
which are mentioned in the following can be combined with one
another in a suitable manner, such modifications which do not
interfere with one another or adversely influence the stability or
cell permeability of the antibody-coding, modified RNA according to
the invention or the expression of the antibody thereby coded
preferably being combined with one another. For the entire present
invention, the nomenclature "modified" is equated with the content
of "optionally modified".
[0051] Modifications of the RNA according to the invention
described here (modified RNA) can include, for example,
modifications of the nucleotides of the RNA. An RNA (modified RNA)
according to the invention can thus include, for example, backbone
modifications, sugar modifications or base modifications. In this
context, the antibody-coding RNA according to the invention
typically first contains nucleotides which can be chosen from all
naturally occurring nucleotides and analogues thereof (modified
nucleotides), such as e.g. ribonucleotides and/or
deoxyribonucleotides. Nucleotides in the context of the present
invention therefore include, without being limited thereto, for
example purines (adenine (A), guanine (G)) or pyrimidines (thymine
(T), cytosine (C), uracil (U)), and as modified nucleotides
analogues or derivatives of purines and pyrimidines, such as e.g.
1-methyl-adenine, 2-methyl-adenine,
2-methylthio-N6-isopentenyl-adenine, N6-methyl-adenine,
N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine,
4-acetyl-cytosine, 3-methyl-cytosine, 2,6-diaminopurine,
1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine,
7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil
(5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil,
5-carboxymethylaminomethyl-2-thio-uracil,
5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil,
5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil,
5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester,
5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil,
5'-methoxybarbonylmethyl-uracil, 5-methoxy-uracil,
uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v),
1-methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine,
wybutoxosine, and phosphoramidates, phosphorothioates, peptide
nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine
and inosine. The preparation of such analogues is known to a person
skilled in the art e.g. from the U.S. Pat. No. 4,373,071, U.S. Pat.
No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066,
U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No.
4,973,679, U.S. Pat. No. 5,047,324, U.S. Pat. No. 5,132,418, U.S.
Pat. No. 5,153,319, U.S. Pat. No. 5,262,330 and U.S. Pat. No.
5,700,642, the disclosure of which is included here in its full
scope by reference.
[0052] In particular, an antibody-coding RNA according to the
invention can contain RNA backbone modifications. In connection
with the present invention, a backbone modification is a
modification in which the phosphates of the backbone of the
nucleotides contained in the RNA are modified chemically. In this
context, such backbone modifications typically include, without
being limited thereto, modifications from the group consisting of
methylphosphonates, methylphosphoramidates, phosphoramidates,
phosphorothioates (e.g. cytidine 5'-O-(1-thiophosphate)),
boranophosphates, positively charged guanidinium groups etc, which
means by replacing the phosphodiester linkage by other anionic,
cationic or neutral groups.
[0053] An antibody-coding RNA according to the invention can
likewise also contain sugar modifications. A sugar modification in
connection with the present invention is a chemical modification of
the sugar of the nucleotides it contains and typically includes,
without being limited thereto, sugar modifications chosen from the
group consisting of 2'-deoxy-2'-fluoro-oligoribonucleotide
(2'-fluoro-2'-deoxycytidine 5'-triphosphate,
2'-fluoro-2'-deoxyuridine 5'-triphosphate),
2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine
5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate),
2'-O-alkyloligoribonucleotide,
2'-deoxy-2'-C-alkyloligoribonucleotide (2'-O-methylcytidine
5'-triphosphate, 2'-methyluridine 5'-triphosphate),
2'-C-alkyloligoribonucleotide, and isomers thereof (2'-aracytidine
5'-triphosphate, 2'-arauridine 5'-triphosphate), or
azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate,
2'azido-2'-deoxyuridine 5'-triphosphate).
[0054] Preferably, however, the modified RNA sequence according to
the invention contains no sugar modifications or backbone
modifications if e.g. an in vitro transcription is necessary. The
reason for this preferred exclusion lies in the problem that
certain backbone modifications and sugar modifications of RNA
sequences on the one hand can prevent or at least greatly reduce in
vitro transcription thereof. Thus, an in vitro transcription of
eGFP carried out by way of example functions, for example, only
with the sugar modifications 2'-amino-2'-deoxyuridine 5'-phosphate,
2'-fluoro-2'-deoxyuridine 5'-pbosphate and 2'-azido-2'-deoxyuridine
5'-phosphate. In addition, the translation of the protein, i.e. the
protein expression, in vitro or in vivo typically can be reduced
considerably by backbone modifications and, independently thereof,
by sugar modifications of RNA sequences. It was possible to
demonstrate this, for example, for eGFP in connection with the
backbone modifications and sugar modifications selected above.
[0055] An antibody-coding RNA according to the invention can
likewise also contain modifications of the bases of the nucleotides
it contains (base modifications). Thus, for example, the
antibody-coding RNA according to the invention can be modified such
that only one or several of the nucleotides of the modified RNA are
exchanged for nucleotides having base modifications, which are
preferably suitable for increasing the expression of the antibody
coded by the RNA significantly compared with the non-modified, i.e.
native RNA sequence. In this case, significant means an increase in
the expression of the antibody on the basis of the modified RNA
sequence compared with the native RNA sequence by at least 20%
preferably at least 30%, 40%, 50% or 60%, even more preferably by
at least 70%, 80%, 90% or even 100% and most preferably by at least
150%, 200% or even 300%. In connection with the present invention,
a modified nucleotide which contains a base modification is called
a base-modified nucleotide and, without being limited thereto, is
preferably chosen from the group consisting of:
2-amino-5-chloropurine riboside 5'-triphosphate, 2-aminoadenosine
5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine
5'-triphosphate, 4-thiouridine 5'-triphosphate,
5-aminoallylcytidine, 5'-triphosphate, 5'-aminoallyluridine
5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine
5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine
5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine
5'-triphospbate, 6-azacytidine 5'-triphosphate, 6-azauridine
5'-triphosphate, 6-chloropurine riboside 5'-triphosphate,
7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate,
8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate,
benzimidazole riboside 5'-triphosphate, N1-methyladenosine
5'-triphosphate, N1-methylguanosine 5'-triphosphate,
N6-methyladenosine 5'-triphosphate, O6-methylguanosine
5'-triphosphate, pseudouridine 5'-triphosphate, puromycin
5'-triphosphate or xanthosine 5'-triphosphate. Nucleotides for base
modifications are particularly preferably chosen from the group of
base-modified nucleotides consisting of 5-methylcytidine
5'-triphosphate and pseudouridine 5'-triphosphate.
[0056] Without being restricted thereto, in this connections rise
inventors attribute an increase in the expression of the antibody
coded by the (base)-modified RNA according to the invention to,
inter alia, the improvement in the stabilizing of secondary
structures and, where appropriate, to the "more rigid" structure
formed in the RNA and the increased base stacking. Thus, for
example, it is known of pseudouridine 5'-triphosphate that this
occurs naturally in structural RNAs (tRNA, rRNA and snRNA) in
eukatyotes as well as in prokaryotes. In this connection, it is
assumed that pseudouridine is necessary in rRNA for stabilizing
secondary structures. In the course of evolution, the content of
pseudouridine in RNA has increased, and it has been possible to
demonstrate, surprisingly, that the translation depends on the
presence of pseudouridine in the tRNA and rRNA, the interaction
between tRNA and mRNA presumably being intensified in this context.
The conversion of uridine into pseudouridine takes place
postrranscriptionally by pseudouridine synthase. A modification of
RNA likewise takes place in the case of 5-methylcytidine
5'-triphosphate, and is catalysed by methyltransferases. A further
increase in the content of pseudouridine and the base modification
of other nucleotides is assumed to lead to similar effects, which,
to contrast to the naturally occurring increased contents of
pseudouridine in the sequence, can be carried out in a targeted
manner and with a considerably wider variability. For
5-methylcytidine 5'-triphosphate and the further base modifications
mentioned here, a similar mechanism to that for pseudouridine
5'-triphosphate is therefore assumed, i.e. an improved stabilizing
of secondary structures, and on the basis of this an improved
translation efficiency. In addition to this structurally based
increase in expression, however, a positive effect on the
translation is presumed, independently of the stabilizing of
secondary structures and a "more rigid" structure of the RNA.
Further causes of the increase in expression are also to be found,
possibly, in the lower degradation rate of the RNA sequences by
RNAses in vitro or in vivo.
[0057] The modifications of the antibody-coding RNA according to
the invention which are described above can be introduced into the
RNA with the aid of methods known to a person skilled in the art.
Possible methods for this are, for example, synthesis methods using
(automatic or semi-automatic) oligonucleotide synthesis
apparatuses, biochemical methods, such as e.g. in vitro
transcription methods, etc. Preferably, in this connection, for
(shorter) sequences which in general do not exceed a length of
50-100 nucleotides, synthesis methods using (automatic or
semi-automatic) oligonucleotide synthesis apparatuses and also in
vitro transcription methods can be employed. For (longer)
sequences, e.g. sequences which have a length of more than 50 to
100 nucleotides, biochemical methods are preferred, such as, for
example, in vitro transcription methods, preferably an in vitro
transcription method as described here, optionally using the
modified RNA according to the invention.
[0058] Modifications with nucleotides as described here in an
antibody-coding RNA according to the invention can occur on at
least one (modifiable) nucleotide of the RNA sequence according to
the invention, preferably on at least 2, 3, 4, 5, 6, 7, 8, 9 or 10
(modifiable) nucleotides, more preferably on at least
10-20(modifiable) nucleotides, even more preferably on at least
10-100 (modifiable) nucleotides and most preferably on at least
10-200, 10 to 1,000 or 10 to 10,000 or more (modifiable), e.g. all,
nucleotides. Worded alternatively, modifications in an
antibody-coding RNA according to the invention can occur on at
least one (modifiable) nucleotide of the RNA sequence according to
the invention, preferably on at least 10% of all the (modifiable)
nucleotides, more preferably on at least 25% of all the
(modifiable) nucleotides, even more preferably on at least 50% of
all the (modifiable) nucleotides, even more preferably on at least
75% of all the (modifiable) nucleotides and most preferably on 100%
of the (modifiable) nucleotides contained in the RNA sequence
according to the invention. In this connection, a "modifiable
nucleotide" is any (preferably naturally occurring (native) and
therefore non-modified) nucleotide which is to be exchanged for a
nucleotide modified as described here. In this context, all the
nucleotides of the RNA sequence can be modified, or only certain
selected nucleotides of the RNA sequence. If all the nucleotides of
the RNA sequence are to be modified, 100% of the "modifiable
nucleotides" of the RNA sequence are all the nucleotides of the RNA
sequence used. On the other hand, if only certain selected
nucleotides of the RNA sequence are to be modified, the selected
nucleotides are, for example, adenosine, cytidine, guanosine or
uridine. Thus, for example, an adenosine of the native sequence can
be exchanged for a modified adenosine, a cytidine for a modified
cytidine, a uridine for a modified uridine and a guanosine for a
modified guanosine. In this case, 100% of the "modifiable
nucleotides" of the RNA sequence are 100% of the adenosines,
cytidines, guanosines and/or uridines in the RNA sequence used.
[0059] According to another very preferred embodiment of the
present invention, the antibody-coding RNA according to the
invention can contain, for example, a GC content which has been
modified compared with the native, i.e. non-modified (precursor)
RNA sequence. According to a first alternative of the
antibody-coding RNA according to the invention, the G/C content for
the coding region of the RNA according to the invention is greater
than the G/C content for the coding region of the native RNA
sequence, the coded amino acid sequence of the antibody or antibody
fragment being unchanged compared with the wild-type, i.e. the
antibody or antibody fragment amino acid sequence coded by the
native RNA sequence. In this context, the composition and the
sequence of the various nucleotides plays a major role. In
particular, sequences having an increased G (guanine)/C (cytosine)
content are more stable than sequences having an increased A
(adenine)/U (uracil) content. According to the invention, the
codons are therefore varied compared with the wild-type RNA, while
retaining the translated amino acid sequence, such that they
include an increased amount of G/C nucleotides. Since several
codons code for one and the same amino acid (degeneration of the
genetic code), the most favourable codons for the stability can be
determined (alternative codon usage).
[0060] Depending on the amino acid to be coded by the
antibody-coding RNA according to the invention, there are various
possibilities for modification of the native sequence of the RNA
according to the invention. In the case of amino acids which are
coded by codons which contain exclusively G or C nucleotides, no
modification of the codes is necessary. Thus, the codons for Pro
(CCC or CCG), Arg (CGC or CQG), Ala (GCC or GCG) and Gly (GGC or
GGG) require no modification, since no A or U is present.
[0061] In the following cases, the codons which contain A and/or U
nucleotides are modified by substitution of other codons which
encode the same amino acids but contain no A and/or U. Examples
are: [0062] the codons for Pro can be modified from CCU or CCA to
CCC or CCG; [0063] the codons for Arg can be modified from CGU or
CGA or AGA or AGG to CGC or CGG; [0064] the codons for Ala can be
modified from GCU or GCA to GCC or GCG; [0065] the codons for Gly
can be modified from GGU of GGA to GGC or GGG,
[0066] In other cases, although A or U nucleotides cannot be
eliminated from the codons, it is however possible to decrease the
A and U content by using codons which contain fewer A and/or U
nucleotides. For example: [0067] the codons for Phe can be modified
from UUU to UUC; [0068] the codons for Leu can be modified from
UUA, CUU or CUA to CUC or CUG; [0069] the codons for Ser can be
modified from UCU or UCA or AGU to UCC, UCG or AGC; [0070] the
codon for Tyr can be modified from UAU to UAC; [0071] the stop
codon UAA can be modified to UAG or UGA; [0072] the codon for Cys
can be modified from UGU to UGC; [0073] the codon for His can be
modified from CAU to CAC; [0074] the codon for Gln can be modified
from CAA to CAG; [0075] the codons for Ile can be modified from AUG
or AUA to AUC; [0076] the codons for Thr can be modified from ACU
or ACA to ACC or ACG; [0077] the codon for Asn can be modified from
AAU to AAC; [0078] the codon for Lys can be modified front AAA to
AAG; [0079] the codons for Val can be modified from GUU or GUA to
GUC or GUG; [0080] the codon for Asp can be modified from GAU to
GAC; [0081] the codon for Gin can be modified from GAA to GAG.
[0082] In the case of the codons for Met (AUG) and Trp (UCG), on
the other hand, there is no possibility of sequence
modification.
[0083] The substitutions listed above can of course be used
individually or also in all possible combinations to increase the
G/C content of the antibody-coding RNA according to the invention
compared with the native RNA sequence (and nucleic acid sequence,
respectively). Thus, for example, all the codons for Thr occurring
in the native RNA sequence can be modified to ACC (or ACG).
Preferably, however, combinations of the above substitution
possibilities are used, e.g.: [0084] substitution of all codons
coding for Thr in the native RNA sequence by ACC (or ACG) and
substitution of all codons originally coding for Ser by UCG (or UCG
or AGC); [0085] substitution of all codons coding for Ile in the
native RNA sequence by AUC and substitution of all codons
originally coding for Lys by AAG and substitution of all codons
originally coding for Tyr by UAC; [0086] substitution of all codons
coding for Val in the native RNA sequence by GUC (or GUG) and
substitution of all codons originally coding for Glu by GAG and
substitution of all codons originally coding for Ala by GCC (or
GCG) and substitution of all codons originally coding for Arg by
CGC (or CGG); [0087] substitution of all codons coding for Val in
the native RNA sequence by GUC (or GUG) and substitution of all
codons originally coding for Glu by GAG and substitution of all
codons originally coding for Ala by GCC (or GCG) and substitution
of all codons originally coding for Gly by GGC (or GGG) and
substitution of all codons originally coding for Asn by AAC; [0088]
substitution of all codons coding for Val in the native RNA
sequence by GUC (or GUG) and substitution of all codons originally
coding for Phe by UUC and substitution of all codons originally
coding for Cys by UGC and substitution of all codons originally
coding for Leu by CUG (or CUC) and substitution of all codons
originally coding for Gln by CAG and substitution of all codons
originally coding for Pro by GCC (or CCG); etc.
[0089] Preferably, the G/C content of the coding region of the
antibody-coding RNA according to the invention is increased
compared with the G/C content of the coding region of the native
RNA such that at least 5%, at least 10%, at least 15%, at least
20%, at least 25% or more preferably at least 30%, at least 35%, at
least 40%, at least 45%, at least 50% or at least 55%, even, more
preferably at least 60%, at least 65%, at least 70% or at least 75%
and most preferably at least 80%, at least 85%, at least 90% at
least 95% or at least 100% of the possible modifiable codons of the
coding region of the native RNA (and nucleic acid, respectively)
are modified.
[0090] In this connection, it is particularly preferable to
increase to the maximum the G/C content of the antibody-coding RNA
according to the invention, in particular in the coding region,
compared with the native RNA sequence.
[0091] A second alternative of the antibody-coding RNA according to
the invention with modifications is based on the knowledge that the
translation efficiency of the RNA is also determined by a different
frequency in the occurrence of tRNAs in cells. Thus, if so-called
"rare" codons are present in an RNA sequence to an. increased
extent, the corresponding RNA is translated to a significantly
poorer degree than in the case where codons which code for
relatively "frequent" tRNAs are present.
[0092] According to this second alternative of the antibody-coding
RNA according to the invention, the coding region of the RNA
according to the invention is therefore modified compared with the
coding region of the native RNA such that at least one codon of the
native RNA which codes for a tRNA which is relatively rare in the
cell is exchanged for a codon which codes for a tRNA which is
relatively frequent in the cell and which carries the same amino
acid as the relatively rare tRNA.
[0093] By this modification, the sequence of the antibody-coding
RNA according to the invention is modified such that codons for
which frequently occurring tRNAs are available are inserted. Which
tRNAs occur relatively frequently in the cell and which, in
contrast, are relatively rare is known to a person skilled in the
art; cf. e.g. Akashi, Curr. Opin. Genet. Dev. 2001, 11(6):
660-666.
[0094] According to the invention, by this modification all codons
of the sequence of the antibody-coding RNA according to the
invention which code tor a tRNA which is relatively rare in the
cell can be exchanged for a codon which codes for a tRNA which is
relatively frequent in the cell and which carries the same amino
acid as the relatively rare tRNA.
[0095] It is particularly preferable to link the increased, in
particular maximum, sequential G/C content in the antibody-coding
RNA according to the invention with the "frequent" codons without
modifying the amino acid sequence coded by the RNA according to the
invention. This preferred embodiment provides a particularly
efficiently translated and stabilized RNA sequence according to the
invention which encodes an antibody (for example for a
pharmaceutical composition according to the invention).
[0096] In the sequences of eukaryotic RNAs, there are typically
destabilizing sequence elements (DSE) to which signal proteins bind
and regulate the enzymatic degradation of the RNA in vivo. For
further stabilization of the antibody-coding RNA according to the
invention, one or more modifications compared with the
corresponding region of the native RNA are therefore optionally
carried out in the region coding for the protein, so that no
destabilizing sequence elements are present. According to the
invention, it is of course also preferable, where appropriate, to
eliminate from the RNA DSEs present in the untranslated regions (3'
and/or 5' UTR).
[0097] Such destabilizing sequences are, for example, AU-rich
sequences ("AURES"), which occur in 3' UTR sections of numerous
unstable RNAs (Caput et al., Proc. Natl. Acad. Sci. USA 1986, 83:
1670 to 1674). The antibody-coding RNA according to the invention
is therefore preferably modified compared with the native RNA such
that this no longer contains such destabilizing sequences. This
also applies to those sequence motifs which are recognized by
possible endonucleases, for example the sequence GAACAAG, which is
contained in the 3' UTR segment of the gene which codes for the
transferrin receptor (Binder et al., EMBO J, 1994, 13: 1969 to
1980). These sequence motifs are also preferably eliminated in the
antibody-coding RNA according to the invention.
[0098] A person skilled in the art is familiar with various methods
which are suitable in the present case for substitution of codons
in RNAs, i.e. substitution of codons in the antibody-coding RNA
according to the invention. In the case of relatively short coding
regions (which code for antibodies or antibody fragments as
described here), for example, the total antibody-coding RNA
according to the invention can be synthesized chemically using
standard techniques such as are familiar to a person skilled in the
art.
[0099] Nevertheless, base substitutions are preferably introduced
using a DNA template for the preparation of the antibody-coding RNA
according to the invention with the aid of techniques of the usual
targeted mutagenesis (see, for example, Maniatis et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
3rd ed., Cold Spring Harbor, N.Y., 2001). In this method, for the
preparation of the antibody-coding RNA according to the invention,
a corresponding DNA molecule is therefore transcribed in vitro (see
below). This DNA template optionally has a suitable promoter, for
example a T3, T7or SP6 promoter, for the in vitro transcription,
which is followed by the desired nucleotide sequence for the
antibody-coding RNA according to the invention to be prepared and a
termination signal for the in vitro transcription. The DNA molecule
which forms the template of the antibody-coding RNA construct to be
prepared can be prepared by fermentative proliferation and
subsequent isolation as part of a plasmid which can be replicated
in bacteria. Plasmids which may be mentioned as suitable for this
are, for example, the plasmids pT7Ts (GeoBank accession number
U26404; Lai et al., Development 1995, 121; 2349 to 2360), pGEM.RTM.
series, for example pGEM.RTM.-1 (GenBank accession number X65300;
from Promega) and pSP64 (GenBank accession number X63327); cf. also
Mezei and Storts, Purification of PCR Products, in: Griffin and
Griffin (ed.), PCR Technology: Current Innovation, CRC Press, Boca
Raton, Fla., 2001.
[0100] Using short synthetic RNA or DNA oligonucleotides which
contain short single-stranded transitions at the cleavage sites
formed, or genes prepared by chemical synthesis, the desired
nucleotide sequence can thus be cloned into a suitable plasmid by
molecular biology methods with which a person skilled in the art is
familiar (cf. Maniatis et al., (2001) supra). The RNA or DNA
molecule is then cut out of the plasmid, in which it can be present
in one or several copies, by digestion wife restriction
endonucleases.
[0101] According to a particular embodiment of the present
invention, the antibody-coding (modified) RNA according to the
invention described above, especially if the RNA is in the form of
mRNA, can moreover have a 5' cap structure (a modified guanosine
nucleotide). Examples of cap structures which may be mentioned,
without being restricted thereto, are m7G(5')ppp
(5'(A,G(5')ppp(5')A and G(5')ppp(5')G.
[0102] According to a further preferred embodiment of the present
invention, the antibody-coding (modified) RNA according to the
invention contains, especially if the RNA is in the form of mRNA, a
poly-A tail on the 3' terminus of typically about 10 to 200
adenosine nucleotides, preferably about 10 to 100 adenosine
nucleotides, more preferably about 20 to 70 adenosine nucleotides
or even more preferably about 20 to 60 adenosine nucleotides.
[0103] According to another preferred embodiment of the present
invention, the antibody-coding (modified) RNA according to the
invention contains, especially if the RNA is in the form of mRNA, a
poly-C tail on the 3' terminus of typically about 10 to 200
cytosine nucleotides, preferably about 10 to 100 cytosine
nucleotides, more preferably about 20 to 70 cytosine nucleotides or
even more preferably about 20 to 60 or even 10 to 40 cytosine
nucleotides. The poly-C tail may be added to the poly-A tail or may
substitute the poly-A tail.
[0104] According to a further embodiment, the antibody-coding
(modified) RNA according to the invention can additionally contain
a nucleic acid section which codes a tag for purification. Such
tags include, but without being limited thereto, e.g. a
hexahistidine tag (His tag, polyhistidine tag), a streptavidin tag
(Strep tag), an SBP tag (streptavidin-binding tag) a GST
(glutathione S transferase) tag etc. The antibody-coding (modified)
RNA according to the invention can furthermore encode a tag for
purification via an antibody epitope (antibody-binding tag), e.g. a
Myc tag, an Swa11 epitope, a FLAG tag, an HA tag etc., i.e. via
recognition of the epitope via the (immobilized) antibody.
[0105] For efficient translation of RNA, in particular mRNA,
effective binding of the ribosomes to the ribosome binding site
(Kozak sequence: GCCGCCACCAUGG (SEQ ID NO: 16), the AUG forms the
start codon) is necessary. In this respect, it has been found that
an increased A/U content around this site renders possible a more
efficient ribosome binding to the RNA. According to another
preferred embodiment of the present invention, the antibody-coding
(modified) RNA according to the invention can therefore have an
increased A/U content around the ribosome binding site, preferably
an A/U content which is increased by 5 to 50%, more preferably one
increased by 25 to 50% or more, compared with the native RNA.
[0106] According to one embodiment of the antibody-coding
(modified) RNA according to the invention, it is furthermore
possible to insert one or more so-called IRES (internal ribosomal
entry site) into the RNA. An IRES can thus function as the sole
ribosome binding site, but it can also serve to provide an
antibody-coding (modified) RNA according to the invention which
codes for several antibodies or antibody fragments or for at least
one antibody or antibody fragment which are to be translated by the
ribosomes independently of one another("multicistronic RNA"). Such
an RNA can code, for example, a complete sequence of an antibody,
the corresponding coding regions of the heavy and light chain being
linked (functionally) with one another by an IRES sequence.
However, the heavy and light chain to be encoded by the inventive
RNA may also be located is one single "cistron". According to the
invention, the IRES sequences described are employed in particular
for (virtually) simultaneous and uniform expression of the light
and the heavy chains of the antibody coded by the RNA according to
the invention. Examples of IRES sequences which can be used
according to the invention are those from picornaviruses (e.g.
FMDV), pestiviruses (CFFV), polioviruses (PV), encephalomyocarditis
viruses (ECMV), foot and month disease viruses (FMDV), hepatitis C
viruses (HCV), classical swine fever viruses (CSFV), murine leukoma
virus (MLV), simian immunodeficiency viruses (SIV), cricket
paralysis viruses (CrPV) or an SIRES sequence.
[0107] According to a further preferred embodiment of the present
invention, the antibody-coding (modified) RNA according to the
invention has, in the 5' and/or 3' untranslated regions,
stabilizing sequences which are capable of increasing the half-life
of the RNA in the cytosol. These stabilizing sequences can have a
100% sequence homology to naturally occurring sequences which occur
in viruses, bacteria and eukaryotes, but can also be partly or
completely synthetic in nature. The untranslated sequences (UTR) of
the .beta.-globin gene, for example from Homo sapiens or Xenopus
laevis, may be mentioned as an example of stabilizing sequences
which can be used in the present invention. Another example of a
stabilizing sequence has the general formula
(C/U)CCAN.sub.xCCC(U/A)Py.sub.xUC(C/U)CC (SEQ ID NO: 17), which is
contained in the 3' UTR of the very stable RNA which codes for
.alpha.-globin, .alpha.-(I)-collagen, 15-lipoxygenase or for
tyrosine hydroxylase (cf. Holcik et al., Proc. Natl. Acad. Sci. USA
1997, 94: 2410 to 2414). Such stabilizing sequences can of course
be used individually or in combination with one another and also in
combination with other stabilizing sequences known to a person
skilled in the art.
[0108] In a further preferred embodiment, the antibody-coding
(modified) RNA according to the invention can encode a secretory
signal peptide, in addition to the antibodies as described here.
Such signal peptides are (signal) sequences which conventionally
comprise a length of from 15 to 30 amino acids and are preferably
localized on the N-terminus of the coded antibody. Signal peptides
typically render possible transport of a protein or peptide fused
therewith (here e.g. an antibody) to or into a defined cell
compartment, preferably the cell surface, the endoplasmic reticulum
or the endosomal-lysosomal compartment. Examples of signal
sequences which can be used according to the invention are e.g.
signal sequences of conventional and non-conventional MHC
molecules, cytokines, immunoglobulins, the invariant chain, Lamp1,
tapasin, Erp57, calreticulin and calnexin, and all further
membrane-located, endosomally-lysosomally or endoplasmic
reticulum-associated proteins. The signal peptide of the human MHC
class I molecule HLA-A*0201 is preferably used.
[0109] Sequences which render possible transport of a protein or
peptide fused therewith, (here e.g. an antibody) to or into a
defined cell compartment, preferably the cell surface, the nucleus,
the nucleus region, the plasma membrane, the cytosol, the
endoplasmic reticulum, the organelles, the mitochondria, the Golgi
apparatus or the endosomal-lysosomal compartment, also include,
without being limited thereto, so-called routing signals, sorting
signals, retention signals or salvage signals and membrane
topology-stop transfer signals (cf. Pugsley, A. P., Protein
Targeting, Academic Press, Inc. (1989)) at the level of the RNA
according to the invention. In this connection, localization
sequences include nucleic acid sequences which encode e.g. signals,
i.e. amino acid sequences, such as, for example, KDEL (SEQ ID NO:
18) (Munro, et al., Cell 48:899-907 (1987)) DDEL (SEQ ID NO: 19),
DEEL (SEQ ID NO: 26), QEDL (SEQ ID NO: 21) and RDEL (SEQ ID NO: 22)
(Hangejorden, et al., J. Biol. Chem. 266:6015 (1991)) for the
endoplasmic reticulum; PKKKRKV (SEQ ID NO: 23) (Lanford, et al.
Cell 46:575 (1986)) PQKKIKS (SEQ ID NO: 24) (Stanton, L. W. et al.,
Proc. Natl. Acad. Sci USA 83:1772 (1986); QPKKP (SEQ ID NO: 25)
(Harlow, et al., Mol. Cell Biol. 5:1605 1985), and RKKR (SEQ ID NO:
26) for the nucleus; and RKKRRQRRRAHQ (SEQ ID NO: 27) (Seomi, et
al., J. Virology 64:1803 (1990)), RQARRNRRRRWRERQR (SEQ ID NO: 28)
(Kubota, et al., Biochem. and Biophy, Res. Comm. 162:963 (1989)),
and MPLTRRRPAASQALAPPTP (SEQ ID NO: 29) (Siomi, et al., Cell 55:
197 (1988)) for the nucleus region; MDDQRDLISNNEQLP (SEQ ID NO: 30)
(Bakke, et al., Cell 63:707-716 (1990)) for the endosomal
compartment (see, for example, Letourneur, et al., Cell 69:1183
(1992) for the targeting of liposomes). Myristoylation sequences
can furthermore be used in order to lead the expressed protein or
peptide (here e.g. an antibody) to the plasma membrane, or to
certain various sub-cell compartments, such as the nucleus region,
me organelles, the mitochondria and the Golgi apparatus.
Corresponding amino acid sequences which are coded by a
corresponding codon sequence of the RNA according to the invention
are given below. The sequence MLFNLRXXLNNAAFRHGHNFMVRNFRCGQPLX (SEQ
ID NO: 31) can be used to lead the antibody to the mitochondrial
matrix (Pugsley, supra). See Tang, et al., J. Bio. Chem. 207:10122,
in respect of the localization of proteins (antibodies) to the
Golgi apparatus; for the localization of proteins to the plasma
membrane: GCVCSSNP (SEQ ID NO: 32), GQTVTTPL (SEQ ID NO: 33),
GQELSQHE (SEQ ID NO: 34), GNSPSYNP (SEQ ID NO: 35), GVSGSKGQ (SEQ
ID NO: 36), GQTITTPL (SEQ ID NO: 37), GQTLTTPL (SEQ ID NO: 38),
GQIFSRSA (SEQ ID NO: 39), GQIHGLSP (SEQ ID NO: 40), GARASVLS (SEQ
ID NO: 41), and GCTLSAEE (SEQ ID NO: 42); to the endoplasmic
reticulum GQNLSTSN (SEQ ID NO: 43); to the nucleus GAALTILV (SEQ ID
NO: 44) and GAALTLLG (SEQ ID NO: 45); to the endoplasmic reticulum
and to the cytoplasm GAQVSSQK (SEQ ID NO: 46) and GAQLSRNT (SEQ ID
NO: 47); to the Golgi apparatus, to the nucleus, to the cytoplasm
and to the cytoskeleton: GNAAAAKK (SEQ ID NO: 48); to the cytoplasm
and to the cytoskeleton GNEASYPL (SEQ ID NO: 49); and to the plasma
membrane and to the cytoskeleton GSSKSKPK (SEQ ID NO: 50). Such
sequences as described above are preferably used for RNAs which
code for intrabodies, i.e antibodies which are retained in the cell
and are not secreted.
[0110] The modifications described here can be introduced into the
antibody-coding RNA sequence according to the invention in a
suitable manner by a person skilled in the art. For example, the
optimum modified RNA according to the invention can be determined
by methods known to the person, skilled in the art, e.g. the G/C
content can be adapted manually and/or by means of an automated
method as disclosed in WO 02/098443. In this context, the RNA
sequences can be adapted with the various additional optimization
aims described here: On the one hand, the adaptation can be earned
out with the highest possible G/C content, and on the other hand
taking into the best possible account the frequency of the tRNAs
according to codon usage. In this context, in the first step of the
method a virtual translation of any desired RNA (or DNA) sequence
is carried out in order to generate the corresponding amino acid
sequence. Starting from the amino acid sequence, a virtual reverse
translation is carried out, which on the basis of the degenerated
genetic code provides selection possibilities for the corresponding
codons. Depending on the optimization or modification required,
corresponding selection lists and optimization algorithms are used
for selection of the suitable codons. The algorithm is typically
implemented on a computer with the aid of suitable software. The
optimized RNA sequence is established in this way and can be
displayed, for example, with the aid of an appropriate display
device and compared with the original (wild-type) sequence. The
same also applies to the frequency of the individual, nucleotides.
In this context, the changes compared with the original nucleotide
sequence are preferably highlighted. According to a preferred
embodiment, stable sequences which are known in nature and can
provide the basis for an RNA stabilized in accordance with natural
sequence motifs are furthermore read in. A secondary structure
analysis which can analyse stabilizing and destabilizing properties
or, respectively, regions of the RNA with the aid of structure
calculations can likewise be envisaged.
[0111] Furthermore, according to a preferred embodiment effective
transfer of the antibody-coding (modified) RNA according to the
invention into the cells to be treated or the organism to be
treated can be improved by complexing the antibody-coding,
(modified) RNA according to the invention with a cationic peptide
or protein or binding it thereto. Such a complexing/condensing of
the RNA, in particular mRNA, includes, for example, complexing (or
binding) of the RNA according to the invention with a
(poly)cationic polymer, polyplexes, protein(s), in particular
polycationic protein(s), or peptide(s). Preferably, an RNA (mRNA)
according to the invention is complexed or condensed with at least
one canonic or polycationic agent. Preferably, such a cationic or
polycationic agent is an agent which is chosen from the group
consisting of protamine, poly-L-lysine, poly-L-arginine, nucleolin,
spermin and histones, nucleolin or derivatives thereof. The use of
protamine as a polycationic, nucleic acid-binding protein is
particularly preferred. This procedure for stabilizing RNA is
described, for example, in EP-A-1083232, the disclosure content of
which in this respect is included in its full scope in the present
invention.
[0112] According to a particular embodiment, the antibody-coding
(modified) RNA according to the invention can contain a lipid
modification. Such an RNA modified with a lipid typically comprises
an antibody-coding RNA, as defined here, according to the
invention, at least one linker covalently linked with this RNA and
at least one lipid covalently linked with the particular linker.
Alternatively, the (modified) RNA according to the invention
modified with a lipid comprises (at least) one (modified) RNA, as
defined here, according to the invention and at least one
(bifunctional) lipid covalently linked with this RNA. According to
a third alternative the (modified) RNA according to the invention
modified with a lipid comprises a (modified) RNA, as defined here,
according to the invention, at least one linker covalently linked
with this RNA and at least one lipid linked covalently with the
particular linker and at least one (bifunctional) lipid covalently
linked (without a linker) with this (modified) RNA according to the
invention.
[0113] The lipid employed for lipid modification of the
antibody-coding (modified) RNA according to the invention is
typically a lipid or a lipophilic residue, which is preferably
biologically active per se. Such lipids preferably include natural
substances, or compounds, such as e.g. vitamins, e.g.
.alpha.-tocopherol (vitamin E), including RRR-.alpha.-tocopherel
(formerly D-.alpha.-tocopherol), L-.alpha.-tocopherol, the racemate
D,L-.alpha.-tocopherol, vitamin E succinate (VES) or vitamin A and
derivatives thereof, e.g. retinic acid, retinol, vitamin D and
derivatives thereof, e.g. vitamin D and ergosterol precursors
thereof, vitamin E and derivatives thereof, vitamin K and
derivatives thereof, e.g. vitamin K and related quinone or phytol
compounds, or steroids, such as bile acids, for example cholic
acid, deoxycholic acid, dehyrocholic acid, cortisone, digoxygenin,
testosterone, cholesterol or thiocholesterol. Further lipids or
lipophilic residues in the context of the present invention
include, without being limited thereto, polyalkylene glycols,
(Oberhauser et al., Nucl. Acids Res., 1992, 20, 533), aliphatic
groups, such as e.g. C.sub.1-C.sub.20-alkanes,
C.sub.1-C.sub.20-alkenes, or C.sub.1-C.sub.20-alkanol compounds
etc., such as, for example, dodecanediol, hexadecanol or undecyl
residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 111; Kabanov
et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie,
1993, 75, 49), phospholipids, such as e.g. phosphatidylglycerol,
diacylphosphatidylglycerol, phosphatidylcholine,
dipalmitoylphosphatidylcholine, distearoylphosphatidylcholine,
phosphatidylserine, phosphatidylethanolamine,
dihexadecyl-rac-glycerol, sphingolipids, cerebrosides,
gangliosides, or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res.,
1990, 18, 3777), polyamines or polyalkylene glycols, such as e.g.
polyethylene glycol (PEG) (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969), hexaethylene glycol (HEG), palmitin,
or palmityl residues (Mishra et al., Biochim. Biophys. Acta, 1995,
1264, 229), octadecylamines, or hexylaminocarbonyloxycholesterol
residues (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923),
and waxes, terpenes, alicyclic hydrocarbons, saturated or mono- or
polyunsaturated fatty acid residues etc.
[0114] The linking between the lipid and the antibody-coding
(modified) RNA according to the invention can in principle take
place on any nucleotide, on the base or the sugar residue of any
nucleotide, on the 3' and/or 5' end, and/or on the phosphate
backbone of the antibody-coding (modified) RNA according to the
invention. According to the invention, a terminal lipid
modification of the (modified) RNA according to the invention on
the 3' and/or 5' end thereof is particularly preferred. A terminal
modification has several advantages over modifications within the
sequence. On the one hand, modifications within the sequence can
influence the hybridization properties, which may have an adverse
effect in the case of sterically demanding residues. (Sterically
demanding) modifications within the sequence very often also
interfere in translation, which can frequently lead to an
interruption in the protein synthesis. On the other hand, in the
case of preparation by synthesis of a lipid-modified (modified) RNA
according to the invention which is modified exclusively
terminally, synthesis of this antibody-coding (modified) RNA
according to the invention is carried out with monomers which are
commercially available in large amount, and synthesis protocols
known in the prior art are used.
[0115] According to a first preferred embodiment, the linking takes
place between the antibody-coding (modified) RNA according to the
invention and at least one lipid via a linker (linked covalently
with the (modified) RNA). Linkers in the context of the present
invention typically contain at least two and optionally 3, 4, 5, 6,
7, 8, 9, 10, 10-20, 20-30 or more reactive groups, chosen from e.g.
a hydroxyl group, an amino group, an alkoxy group etc. One reactive
group preferably serves to bond the antibody-coding (modified) RNA
according to the invention described here. This reactive group can
be in a protected form, e.g. as a DMT (dimethoxytrityl chloride)
group, as an Fmoc group, as an MMT (monomethoxytrityl) group, as a
TFA (trifluoroacetic acid) group etc. Sulfur groups can furthermore
be protected by disulfides, e.g. alkylthiols, such as, for example,
3-thiopropanol, or with activated components, such as
2-thiopyridine. According to the invention, one or more further
reactive groups serve for covalent bonding of one or more lipids.
According to the first embodiment, an antibody-coding (modified)
RNA according to the invention can therefore bond at least one
lipid via the covalently bonded linker, e.g., 1, 2, 3, 4, 5, 5-10,
10-20, 20-30or more lipid(s), particularly preferably at least 3-8
or more lipids per (modified) RNA. In this context, the bonded
lipids can be bonded separately from one another at various
positions of the antibody-coding (modified) RNA according to the
invention, but can also be in the form of a complex at one or more
positions of the (modified) RNA. An additional reactive group of
the linker can be used for direct or indirect (cleavable) bonding
to a carrier material, e.g. a solid phase. Preferred linkers
according to the present invention are e.g. glycol, glycerol and
glycerol derivatives, 2-aminobutyl-1,3-propanediol and
2-aminobutyl-1,3-propanediol derivatives/matrix, pyrrolidine
linkers or pyrrolidine-containing organic molecules (in particular
for a modification on the 3' end) etc. According to the invention,
glycerol or glycerol derivatives (C.sub.3 anchor) or a
2-aminobutyl-1,3-propanediol derivative/matrix (C.sub.7 anchor) are
particularly preferably used as linkers. A glycerol derivative
(C.sub.3 anchor) as a linker is particularly preferred if the lipid
modification can be introduced via an ether bond. If the lipid
modification is to be introduced e.g. via an amide or an urethane
bond, e.g. a 2-aminobutyl-1,3-propanediol matrix (C.sub.7 anchor)
is preferred. In this connection, the bond formed between the
linker and the antibody-coding (modified) RNA according to the
invention is preferably such that it is compatible with the
conditions and chemicals of amidite chemistry, that is to say it is
preferably neither acid- nor base-labile. In particular, those
bonds which are readily accessible synthetically and are not
hydrolysed by the ammoniacal cleavage procedure of a nucleic acid
synthesis process are preferred. Possible bonds are in principle
all appropriately suitable bonds, preferably ester bonds, amide
bonds, urethane bonds and ether bonds. In addition to the good
accessibility of the educts (few synthesis stages), the ether bond
is particularly preferred in this context because of its relatively
high biological stability to enzymatic hydrolysis.
[0116] According to a second preferred embodiment, for the lipid
modification of the (modified) RNA according to the invention the
linking of (at least one) (modified) RNA according to the invention
takes place directly with at least one (bifunctional) lipid as
described here, i.e. without using a linker as described here. In
this case, the (bifunctional) lipid according to the invention
preferably contains at least two reactive groups, or optionally 3,
4, 5, 6, 7, 8, 9, 19 or more reactive groups, a first reactive
group serving for direct or indirect bonding of the lipid to a
carrier material described here and at least one further reactive
group serving for bonding of the (modified) RNA. According to the
second embodiment, an antibody-coding (modified) RNA according to
the invention can therefore preferably bond at least one lipid
(directly without a linker), e.g. 1, 2, 3, 4, 5, 5-10, 10-20, 20-30
or more lipid(s), particularly preferably at least 3-8 or more
lipids per (modified) RNA. In this context, the bonded lipids can
be bonded separately from one another at various positions of the
antibody-coding (modified) RNA according to the invention, but can
also be in the form of a complex at one or more positions of the
(modified) RNA. Alternatively, according to the second embodiment,
at least one antibody-coding (modified) RNA, e.g. optionally 3, 4,
5, 6, 7, 8, 9, 10, 10-20, 20-30 or more (modified) RNAs, according
to the invention can be bonded to a lipid as described above via
reactive groups thereof. Lipids which can be used for this second
embodiment particularly preferably include such (bifunctional)
lipids which render possible a coupling (preferably on their
termini or optionally intramolecularly), such as e.g. polyethylene
glycol (PEG) and derivatives thereof, hexaethylene glycol (HEG) and
derivatives thereof, alkanediols, aminoalkanes, thioalkanols etc.
The bond between a (bifunctional) lipid and an antibody-coding
(modified) RNA according to the invention as described above is
preferably such as is described for the first preferred
embodiment.
[0117] According to a third embodiment, for the lipid modification
of the (modified) RNA according to the invention the linking
between the antibody-coding (modified) RNA according to the
invention and at least one lipid as described here takes place via
both of the abovementioned embodiments simultaneously. Thus e.g.
the antibody-coding (modified) RNA according to the invention can
be linked at one position of the RNA with at least one lipid via a
linker (analogously to the 1st embodiment) and at another position
of the (modified) RNA directly with at least one lipid without
using a linker (analogously to the 2nd embodiment). For example, at
least one lipid as described here can be linked covalently with the
RNA at the 3' end of the (modified) RNA via a linker, and a lipid
as described here can be linked covalently with the RNA at the 5'
end of the (modified) RNA without a linker. Alternatively, at least
one lipid as described here can be linked covalently with the
(modified) RNA at the 5' end of an antibody-coding (modified) RNA
according to the invention via a linker, and a lipid as described
here can be linked covalently with the (modified) RNA at the 3' end
of the (modified) RNA without a linker. Covalent linkings can
likewise take place not only on the termini of the antibody-coding
(modified) RNA according to the invention, but also
intramolecularly, as described above, e.g. on the 3' end and
intramolecularly, on the 5' end and intramolecularly, on the 3' and
5' end and intramolecularly, exclusively intramolecularly etc.
[0118] The (modified) RNA according to the invention described here
can be prepared by preparation processes known in the prior art,
e.g. automatically or manually via known nucleic acid syntheses
(see, for example, Maniatis et al. (2001) supra) or also via
molecular biology methods, for example with subsequent
purification, for example via chromatography methods.
[0119] According to further subject matter of the present
invention, the antibody-coding (modified) RNA according to the
invention can be used for the preparation of a pharmaceutical
composition for treatment of tumours and cancer diseases,
cardiovascular diseases, infectious diseases, autoimmune diseases
or optionally monogenetic diseases, e.g. in gene therapy.
[0120] A pharmaceutical composition in the context of the present
invention comprises an antibody-coding (modified) RNA as described
here and optionally a pharmaceutically suitable carrier and/or
further auxiliary substances and additives. The pharmaceutical
composition employed according to the present invention typically
comprises a safe and effective amount of a (modified) RNA as
described here. As used here, "safe and effective amount" means an
amount of the antibody-coding (modified) RNA according to the
invention such as is sufficient to induce significantly, by
expression of the coded antibody, a positive change of a state to
be treated, e.g. a tumour disease or cancer disease, a
cardiovascular disease or an infectious disease, as described in
the following. At the same time, however, a "safe and effective
amount" is low enough to avoid serious side effects in the therapy
of these diseases, that is to say to render possible a reasonable
ratio of advantage and risk. Determination of these limits
typically lies within the range of reasonable medical judgement.
The concentration of the antibody-coding (modified) RNA according
to the invention in such pharmaceutical compositions can therefore
vary, for example, without being limited thereto, within a wide
range of from e.g. 0.1 ng to 1,000 mg/ml. Such a "safe and
effective amount" of an antibody-coding (modified) RNA according to
the invention can vary in connection with the particular state to
be treated and the age and the physical state of the patient to be
treated, the severity of the state, the duration of the treatment,
the nature of the concomitant therapy, of the particular
pharmaceutically suitable carrier used and similar factors within
the knowledge and experience of the treating doctor. The
pharmaceutical composition described here can be employed for human
and also for veterinary medicine purposes.
[0121] The pharmaceutical composition according to the invention
described here can optionally comprise a pharmaceutically suitable
carrier (and/or vehicle). The term "pharmaceutically suitable
carrier (and/or vehicle)" used here preferably includes one or more
compatible solid or liquid carriers or vehicles, (e.g. fillers, or
diluents or encapsulating compounds) which are suitable tor
administration to a person. The term "compatible" as used here
means that the constituents of the composition are capable of being
mixed together with the antibody-coding (modified) RNA according to
the invention and the auxiliary substance optionally contained in
the composition, as such and with one another in a manner such that
no interaction occurs which would substantially reduce the
pharmaceutical effectiveness of the composition under usual
condition of use, such as e.g. would reduce the pharmaceutical
activity of the coded antibody or even suppress or impair
expression of the coded antibody. Pharmaceutically suitable carrier
must of course have a sufficiently high purity and a sufficiently
low toxicity to render them suitable for administration to a person
to be treated.
[0122] Pharmaceutically suitable carriers or vehicles, that may be
used in the inventive pharmaceutical composition, may be typically
distinguished into solid or liquid carriers or vehicles, wherein a
specific determination may depend on the viscosity of the
respective carrier or vehicle to be used.
[0123] In this context, solid carriers and vehicles typically
include e.g., but are not limited to, ion exchangers, alumina,
aluminum stearate, lecithin, and salts, if provided in solid form,
such as protamine sulfate, disodium hydrogen phosphate, potassium
hydrogen phosphate, sodium, chloride, zinc salts, colloidal silica,
magnesium trisilicate, or polyvinyl pyrrolidone, waxes,
polyethylene-polyoxypropylene-block polymers, wool fat, sugars,
such as, for example, lactose, glucose and sucrose; starches, such
as, for example, com starch or potato starch; or cellulose-based
substances, e.g. cellulose and its derivatives, such as, for
example, sodium carboxymethylcellulose, ethylcellulose, cellulose
acetate; pulverized tragcanth; malt; gelatine; tallow; solid
lubricants, such as, for example, stearic acid, magnesium stearate;
calcium sulfate; wetting agents, such as, for example, sodium
lauryl sulfate; colouring agents; flavouring agents; drug (active
agent) carriers; tablet-forming agents; stabilizers; antioxidants;
preservatives; etc.
[0124] Liquid carriers or vehicles, e.g. for aqueous or oleaginous
suspensions, typically include, but are not limited to, e.g.,
water; pyrogen-free water; solutions of ion exchangers, alumina,
aluminum stearate, lecithin, or serum proteins, such as human serum
albumin; alginic acid; isotonic saline solutions or
phosphate-buffered solutions. Ringer's solution, isotonic sodium
chloride solution, etc. or salts or electrolytes, if provided in
solubilized form, such as protamine sulfate, phosphates, e.g.
disodium hydrogen phosphate, potassium, hydrogen phosphate, sodium
chloride, zinc salts, or (other) buffer substances including e.g.
glycine, sorbic acid, potassium sorbate; liquid solutions of
polyols, such as, for example, polyethylene glycol, polypropylene
glycol, glycerol, 1,3-butanediol, sorbitol, Mannitol; sterile,
fixed oils, any suitable bland fixed oil, e.g. including synthetic
mono- or di-glycerides, partial glyceride mixtures of saturated
vegetable fatty acids, fatty acids, such as oleic acid and its
glyceride derivatives, natural pharmaceutically-acceptable oils,
e.g. plant oils, such as, for example, groundnut oil, cottonseed
oil, sesame oil, corn oil and oil from Theobroma; olive oil or
castor oil, especially in their polyoxyethylated versions. These
liquid carriers or vehicles may also contain or comprise a
long-chain alcohol diluent or dispersant, such as carboxymethyl
cellulose or similar dispersing agents, or commonly used
surfactants or emulsifiers, such as Tween.RTM., Spans and other
emulsifying agents or bioavailability enhancers, etc., if provided
in a liquid form.
[0125] The choice of a pharmaceutically suitable carrier as
described above is determined in particular by the mode in which
the pharmaceutical composition according to the invention is
administered. The pharmaceutical composition according to the
invention can be administered, for example, systemically.
Administration routes include e.g. transdermal, oral, parenteral,
including subcutaneous or intravenous injections, topical and/or
intranasal routes. The suitable amount of the pharmaceutical
composition according to the invention which is to be used can be
determined by routine experiments using animal models. Such models
include, but without being limited thereto, models of the rabbit,
sheep, mouse, rat, dog and non-human primate models. Preferred unit
dose forms for injection include sterile solutions of water,
physiological saline solution or mixtures thereof. The pH of such
solutions should be adjusted to about 7.4. Suitable carriers for
injection include hydrogels, devices for controlled or delayed
release, polylactic acid and collagen matrices. Pharmaceutically
suitable carriers which can be used here include those which are
suitable for use in lotions, creams, gels and the like. If the
compound is to be administered perorally, tablets, capsules and the
like are the preferred unit dose form. The pharmaceutically
suitable carriers for the preparation of unit dose forms which can
be used for oral administration are well-known in the prior art.
Their choice will depend on secondary considerations, such as
flavour, cost and storage stability, which are not critical for the
purposes of the present invention and can be implemented without
difficulties by a person skilled in the art.
[0126] The pharmaceutical composition according to the invention
can furthermore comprise an injection buffer, which preferably
improves the transaction and also the translation of the
antibody-coding RNA according to the invention in cells or an
organism. The pharmaceutical composition according to the invention
can comprise, for example, an aqueous injection buffer which
contains, with respect to the total pharmaceutical composition, if
this is in liquid form, a sodium salt, preferably at least 50 mM
sodium salt, a calcium salt, preferably at least 0.01 mM calcium
salt, and optionally a potassium salt, preferably at least 3 mM
potassium salt. According to a preferred embodiment, the sodium
salts, calcium salts and optionally potassium salts contained in
such an injection buffer are in the form, of halides, e.g.
chlorides, iodides or bromides, or in the form of their hydroxides,
carbonates, bicarbonates or sulfates. Examples which are to be
mentioned here are, for the sodium salt NaCl, NaI, NaBr,
Na.sub.2CO.sub.3, NaHCO.sub.3, Na.sub.2SO.sub.4, for the potassium
salt optionally present KCl, KI, KBr, K.sub.2CO.sub.3, KHCO.sub.3,
K.sub.2SO.sub.4, and for the calcium salt CaCl.sub.2, CaI.sub.2,
CaBr.sub.2, CaCO.sub.3, CaSO.sub.4, Ca(OH).sub.2. The injection
buffer can also contain organic anions of the abovementioned
cations. In a particularly preferred embodiment, such an injection
buffer contains as salts sodium chloride (NaCl), calcium chloride
(CaCl.sub.2) and optionally potassium chloride (KCl), it also being
possible for other anions to be present in addition to the
chlorides.
[0127] These salts are typically present in the injection buffer
optionally used in the pharmaceutical composition according to the
invention, with respect to the total pharmaceutical composition (if
this is in liquid form), in a concentration of at least 50 mM
sodium chloride (NaCl), at least 3 mM potassium chloride (KCl) and
at least 0.01 mM calcium chloride (CaCl.sub.2). The injection
buffer can be in the form of both hypertonic and isotonic or
hypotonic injection buffers. In connection with the present
invention, in this context the injection buffer is hypertonic,
isotonic or hypotonic with respect to the particular reference
medium, i.e. the injection buffer has either a higher, the same or
a lower salt content compared with the particular reference medium,
such concentrations of the abovementioned salts which do not lead
to damage to the cells caused by osmosis or other concentration
effects preferably being employed. Reference media here are, for
example, liquids which occur in "in vivo" methods, such as, for
example, blood, lymph fluid, cytosol fluids or other fluids which
occur in the body, or liquids or buffers conventionally employed in
"in vitro" methods. Such liquids and buffers are known to a person
skilled in the art.
[0128] The injection buffer optionally contained in the
pharmaceutical composition according to the invention can also
contain further components, for example sugars (mono-, di-, tri- or
polysaccharides), in particular glucose or mannitol. In a preferred
embodiment, however, no sugars are present in the injection buffer
used. It is also preferable for the injection buffer precisely to
contain no non-charged components, such as, for example, sugars.
The injection buffer typically contains exclusively metal cations,
in particular from the group consisting of the alkali or alkaline
earth metals, and anions, in particular the anions described above.
The pH of the injection buffer used, with respect to the total
pharmaceutical composition, if this is in liquid form, is
preferably between 1 and 8.5, preferably between 3 and 5, more
preferably between 5.5 and 7.5, in particular between 5.3 and 6.5.
If appropriate, the injection buffer can also contain a buffer
system which fixes the injection buffer at a buffered pH. This can
be, for example, a phosphate buffer system, HEPES or
Na.sub.2HPO.sub.4/NaH.sub.2PO.sub.4. However, the injection buffer
used very particularly preferably contains none of the
abovementioned buffer systems or contains no buffer system at
all.
[0129] The injection buffer optionally contained in the
pharmaceutical composition according to the invention can contain,
in addition to or as an alternative to the monovalent and divalent
cations described, divalent cations, in particular from the group
consisting of alkaline earth metals, such as, for example,
magnesium (Mg.sup.2+), or also iron (Fe.sup.2+), and monovalent
cations. In particular from the groups consisting of alkali metals,
such as, for example, lithium (Li.sup.+). These monovalent cations
are preferably in the form of their salts, e.g. in the form of
halides, e.g. chlorides, iodides or bromides, or in the form of
their hydroxides, carbonates, bicarbonates or sulfates. Examples
which are to be mentioned here are, for the lithium salt LiCl, LiI,
LiBr, Li.sub.2CO.sub.3, LiHCO.sub.3, Li.sub.2SO.sub.4, for the
magnesium salt MgCl.sub.2, MgI.sub.2, MgBr.sub.2, MgCO.sub.3,
MgSO.sub.4, and Mg(OH).sub.2, and for the iron salt FeCl.sub.2,
FeBr.sub.2, FeI.sub.2, FeF.sub.2, Fe.sub.2O.sub.3, FeCO.sub.3,
FeSO.sub.4, Fe(OH).sub.2. All the combinations of di- and/or
monovalent cations, as described above, are likewise included. Such
injection buffers which contain only divalent, only monovalent or
di- and monovalent cations can thus be used in the pharmaceutical
composition according to the invention. Such injection buffers
which contain only one type of di- or monovalent cations,
particularly preferably e.g. only Ca.sup.2+ cations, or a salt
thereof, e.g. CaCl.sub.2, can likewise be used. The molarities
given above for Ca.sup.2+ (as a divalent Cation) and Na.sup.3+ (as
a monovalent cation) (that is to say typically concentrations of at
least 50 mM Na.sup.+, at least 0.01 mM Ca.sup.2+ and optionally at
least 3 mM K.sup.+) in the injection buffer can also be taken into
consideration if another di- or monovalent cation, in particular
other cations from the group consisting of the alkaline earth
metals and alkali metals, are employed instead of some or all the
Ca.sup.2+ or, respectively, Na.sup.3+ in the injection buffer used
according to the invention for the preparation of the injection
solution. All the Ca.sup.2+ or Na.sup.3+, as mentioned above, can
indeed be replaced by other di- or, respectively, monovalent
cations in the injection buffer used, for example also by a
combination of other divalent cations (instead of Ca.sup.2+) and/or
a combination of other monovalent cations (instead of Na.sup.1+)
(in particular a combination of other divalent cations from the
group consisting of the alkaline earth metals or, respectively, of
other monovalent cations from the group consisting of the alkali
metals), but it is preferable to replace at most some of the
Ca.sup.2+ or Na.sup.1+, i.e. for at least 20%, preferably at least
40%, even more preferably at least 60% and still more preferably at
least 80% of the particular total molarities of the mono- and
divalent cations in the injection buffer to be occupied by
Ca.sup.2+ and, respectively, Na.sup.1+. However, it is very
particularly preferable if the injection buffer optionally
contained in the pharmaceutical composition according to the
invention contains exclusively Ca.sup.2+ as a divalent cation and
Na.sup.1+ as a monovalent cation, that is to say, with respect to
the total pharmaceutical composition, Ca.sup.2+ represents 100% of
the total molarity of divalent cations, just as Na.sup.1+
represents 100% of the total molarity of monovalent cations. The
aqueous solution of the injection buffer can contain, with respect
to the total pharmaceutical composition, up to 30 mol % of the
salts contained in the solution, preferably up to 25 mol %,
preferably up to 20 mol %, furthermore preferably up to 15 mol %,
more preferably up to 10 mol %, even more preferably up to 5 mol %,
likewise more preferably up to 2 mol % of insoluble or sparingly
soluble salts. Salts which are sparingly soluble in the context of
the present invention are those of which the solubility product is
<10.sup.-4. Salts which are readily soluble are those of which
the solubility product is >10.sup.-4. Preferably, the injection
buffer optionally contained in the pharmaceutical composition
according to the invention is from 50 mM to 800 mM, preferably from
60 mM to 500 mM, more preferably from 70 mM to 250 mM, particularly
preferably 60 mM to 110 mM in sodium chloride (NaCl), from 0.01 mM
to 100 mM, preferably from 0.5 mM to 80 mM, more preferably from
1.5 mM to 40 mM in calcium chloride (CaCl.sub.2) and optionally
from 3 mM to 500 mM, preferably from 4 mM to 300 mM, more
preferably from 5 mM to 200 mM in potassium chloride (KCl). Organic
anions can also occur as further anions in addition to the
abovementioned inorganic anions, for example halides, sulfates or
carbonates. Among these there maybe mentioned succinate,
lactobionate, lactate, malate, maleate etc., which can also be
present in combination.
[0130] An injection buffer optionally contained in the
pharmaceutical composition according to the invention preferably
contains lactate. If it contains an organic anion, such an
injection buffer particularly preferably contains exclusively
lactate as the organic anion. Lactate in the context of the
invention can be any desired lactate, for example L-lactate and
D-lactate. Lactate salts which occur in connection with the present
invention are typically sodium lactate and/or calcium lactate,
especially if the injection buffer contains only Na.sup.+ as a
monovalent cation and Ca.sup.2+ as a divalent cation. An injection,
buffer optionally used in the pharmaceutical composition according
to the invention and as described above preferably contains, with
respect to the total pharmaceutical composition, from 15 mM to 500
mM, more preferably from 15 mM to 200 mM, and even more preferably
from 15 mM to 100 mM lactate. In this context, it has been found
that the use of an injection buffer with the components described
above, optionally with or without lactate (in the following: "RL
injection buffer" if it does not contain the component lactate, or
"RL injection buffer with lactate" if it does contain the component
lactate) for RNA injection solutions (i.e. injection solutions
which contain RNA and are suitable for injection of this RNA)
significantly increases both the transfer and the translation of
the RNA into/in the cells/tissue of a host organism (mammal)
compared with other injection buffers conventionally used in the
prior art.
[0131] According to a particular embodiment, the pharmaceutical
composition used here can also be provided as a passive vaccine
(for passive immunization). In the present invention, without being
restricted to a theory, passive immunization is based on the
introduction of an antibody-coding (modified) RNA as described here
into an organism, in particular into a cell, the coded antibody
then being expressed, i.e. translated. As a result, binding of such
molecules, e.g. nucleic acids or antigens, for which the coded
antibody is specific can take place. Passive vaccines in connection
with the present invention typically comprise a composition as
described above for a pharmaceutical composition, the composition
of such passive vaccines used being determined in particular by the
mode in which they are administered. Preferably, the passive
vaccines according to the invention are administered systemically
or in some cases non-systemically. Administration routes of such
passive vaccines according to the invention typically include
transdermal, oral, parenteral, including subcutaneous, intravenous,
or intraarterial injections, topical and/or intranasal routes.
Passive vaccines according to the invention are therefore
preferably formulated in a liquid or solid form.
[0132] According to further preferred subject matter of the present
invention, the antibody-coding (modified) RNA according to the
invention or a pharmaceutical composition according to the
invention is used for treatment of indications mentioned by way of
example in the following. Without being limited thereto, diseases
or states, for example, such as e.g. cancer or tumour diseases
chosen from melanomas, malignant melanomas, colon carcinomas,
lymphomas, sarcomas, blastomas, kidney carcinomas, gastrointestinal
tumours, gliomas, prostate tumours, bladder cancer, rectal tumours,
stomach cancer, oesophageal cancer, pancreatic cancer, liver
cancer, mammary carcinomas (=breast cancer), uterine cancer,
cervical cancer, acute myeloid leukaemia (AML), acute lymphoid
leukaemia (ALL), chronic myeloid leukaemia (CML), chronic
lymphocytic leukaemia (CLL), hepatomas, diverse virus-induced
tumours, such as e.g. papilloma virus-induced carcinomas (e.g.
cervix carcinoma=cervical cancer), adenocarcinomas, herpes
virus-induced tumours (e.g. Burkitt's lymphoma, EBV-induced B cell
lymphoma), hepatitis B-induced tumours (hepatocell carcinomas),
HTLV-1- and HTLV-2-induced lymphomas, acusticus neurinoma, lung
carcinomas (=lung cancer=bronchial carcinoma), small cell lung
carcinomas, throat cancer, anal carcinoma, glioblastoma, rectum
carcinoma, astrocytoma, brain tumours, retinoblastoma, basalioma,
brain metastases, medulloblastomas, vaginal cancer, testicular
cancer, thyroid carcinoma, Hodgkin's syndrome, meningeomas,
Schneeherger's disease, pituitary tumour, mycosis fungoides,
carcinoids, neurinoma, spinalioma, Burkitt's lymphoma, laryngeal
cancer, kidney cancer, thymoma, corpus carcinoma, bone cancer,
non-Hodgkin's lymphomas, urethral cancer, CUP syndrome, head/neck
tumours, oligodendroglioma, vulval cancer, intestinal cancer, colon
carcinoma, oesophageal carcinoma (=oesophageal cancer), wart
conditions, small intestine tumours, craniopharyngeomas, ovarian
carcinoma, soft tissue tumours (sarcomas), ovarian cancer (=ovarian
carcinoma), pancreatic carcinoma (=pancreatic cancer), endometrium
carcinoma, liver metastases, penis cancer, tongue cancer,
gallbladder cancer, leukaemia, plasmocytoma, lid tumour, prostate
cancer (=prostate tumours) etc., or infectious diseases such as,
for example, influenza, malaria, SARS, yellow fever, AIDS, Lyme
borreliosis, leishmaniasis, anthrax, meningitis, can be treated
with the pharmaceutical composition described.
[0133] The antibody-coding (modified) RNA according to the
invention or a pharmaceutical composition according to the
invention can likewise be used for treatment of, for example, viral
infectious diseases chosen from, without being limited thereto,
AIDS, condyloma acuminata, molluscum contagiosum, dengue fever,
three-day fever, Ebola virus, colds, early summer
meningoencephalitis (ESME), influenza, shingles, hepatitis, herpes
simplex type I, herpes simplex type II, herpes zoster, influenza,
Japanese encephalitis, Lassa fever, Marburg virus, measles, foot
and mouth disease, mononucleosis, mumps, Norwalk virus infection,
Pfeiffer's glandular fever, smallpox, polio (poliomyelitis),
pseuodcroup, infectious erythema, rabies, warts. West Nile fever,
chicken-pox, cytomegalovirus (CMV), caused by viruses chosen from,
without being limited thereto, e.g. HIV, orthopox variola virus,
orthopox alastrim virus, parapox ovis virus, molluscum contagiosum
virus, herpes simplex virus 1, herpes simplex virus 2, herpes B
virus, varicella zoster virus, pseudorabies virus, human cytomegaly
virus, human herpes virus 6, human herpes virus 7, Epstein-Bart
virus, human herpes virus 8, hepatitis B virus, chikungunya virus,
O'nyong'nyong virus, rubivirus, hepatitis C virus, GB virus C, West
Nile virus, dengue virus, yellow fever virus, louping ill virus,
St, Louis encephalitis virus, Japan B encephalitis virus, Powassan
virus, FSME virus, SARS-associated corona virus, human corona virus
229E, human corona virus Oc43, Torovirus, human T cell lymphotropic
virus type I, human T cell lymphotropic virus type II, human
immunodeficiency virus type 1, human immunodeficiency virus type 2,
Lassa virus, lymphocytic choriomeningitis virus, Tacaribe virus,
Junin virus. Machupo virus, Borna disease virus, Bunyamwera virus,
California encephalitis virus, Rift Valley fever virus, sand fly
fever virus, Toscana virus, Crimean-Congo haemorrhagic fever virus,
Hazara virus, Khasan virus, Hantaan virus, Seoul virus, Prospect
Hill virus, Puumala virus, Dobrava Belgrade virus, Tula virus, sin
nombre virus, Lake Victoria Marburg virus, Zaire Ebola virus, Sudan
Ebola virus, Ivory Coast Ebola virus, influenza virus A, influenza
virus S, influenza viruses C, parainfluenza virus, measles virus,
mumps virus, respiratory syncytial virus, human metapneumovirus,
vesicular stomatitis Indiana virus, rabies virus, Mokola virus,
Duvenhage virus, European bat lyssavirus 1+2, Australian bat
lyssavirus, adenoviruses A-F, human papilloma viruses, condyloma
virus 6, condyloma virus 11, polyoma viruses, adeno-associated
virus 2, rotaviruses, or orbiviruses etc.,
[0134] or bacterial infections diseases, such as abortion
(infectious, septic), prostatitis (prostate inflammation), anthrax,
appendicitis (inflammation of the caecum), borreliosis, botulism,
Campylobacter, Chlamydia trachomatis (inflammation of the urethra,
conjunctiva), cholera, diphtheria, donavonosis, epiglottitis,
louse-borne typhus, typhoid fever, gas gangrene, gonorrhoea, hare
plague, Helicobacter pylori, whooping-cough, climatic bubo,
osteomyelitis, legionnaires' disease, leprosy, listeriosis,
pneumonia, meningitis, bacterial meningitis, anthrax, inflammation
of the middle ear, Mycoplasma hominis, neonatal sepsis
(chorioamnionitis), noma, paratyphoid fever, plague, Reiter's
syndrome, Rocky Mountain spotted fever. Salmonella paratyphoid
fever, Salmonella typhoid fever, scarlet fever, syphilis, tetanus,
gonorrhoea, tsutsugamushi fever, tuberculosis, typhus, vaginitis
(colpitis), soft chancre and infectious diseases caused by
parasites, protozoa or fungi, such as amoebic dysentery,
bilharziosis, Chagas' disease, Echinococcus, fish tapeworm,
ichthyotoxism (ciguatera), fox tapeworm, mycosis pedis, dog
tapeworm, candiosis, ptyriasis, the itch (scabies), cutaneous
leishmaniasis, lamblian dysentery (giadiasis), lice, malaria,
onchocercosis (river blindness), fungal diseases, beef tapeworm,
schistosomiasis, sleeping sickness, pork tapeworm, toxoplasmosis,
trichomoniasis, trypanosomiasis (sleeping sickness), visceral
leishmaniasis, nappy dermatitis or dwarf tapeworm.
[0135] The antibody-coding (modified) RNA according to the
invention or a pharmaceutical composition, according to the
invention can also be used for treatment of cardiovascular diseases
chosen from, without being limited thereto, coronary heart disease,
arteriosclerosis, apoplexy and hypertension, and neuronal diseases
chosen from Alzheimer's disease, amyotrophic lateral sclerosis,
dystonia, epilepsy, multiple sclerosis and Parkinson's disease
etc.
[0136] The antibody-coding (modified) RNA according to the
invention or a pharmaceutical composition according to the
invention can furthermore be used for treatment of autoimmune
diseases chosen from, without being limited thereto, autoimmune
type I diseases or autoimmune type II diseases or autoimmune type
III diseases or autoimmune type IV diseases, such as, for example,
multiple sclerosis (MS), rheumatoid arthritis, diabetes, diabetes
type I (diabetes mellitus), systemic lupus erythematosus (SLE),
chronic polyarthritis, Basedow's disease, autoimmune forms of
chronic hepatitis, colitis ulcerosa, allergy type I diseases,
allergy type II diseases, allergy type III diseases, allergy type
IV diseases, fibromyalgia, hair loss, Bechterew's disease, Crohn's
disease, myasthenia gravis, neurodermatitis, polymyalgia
rheumatica, progressive systemic sclerosis (PSS), psoriasis,
Reiter's syndrome, rheumatic arthritis, psoriasis, vasculitis etc.,
or diabetes type II.
[0137] Diseases in the context of the present invention likewise
include mono-genetic diseases, i.e. (hereditary) diseases which are
caused by an individual gene defect and are inherited according to
Mendel's rules. Monogenetic diseases in the context of the present
invention are preferably chosen from the group consisting of
autosomally recessive hereditary diseases, such as, for example,
adenosine deaminase deficiency, familial hypercholesterolaemia,
Canavan's syndrome, Gaucher's disease, Fanconi's anaemia, neuronal
ceroid lipofuscinoses, mucoviscidosis (cystic fibrosis), sickle
cell anaemia, phenylketonuria, alcaptonuria, albinism,
hypothyroidism, galactosemia, alpha-1 antitrypsin deficiency,
xeroderma pigmentosum, Ribbing's syndrome, mucopolysaccharidoses,
cleft lip, jaw, palate, Laurence-Moon-Biedl-Bardet syndrome, short
rib polydactyly syndrome, cretinism, Joubert's syndrome, progeria
type II, brachydactyly, adrenogenital syndrome, and X chromosomal
hereditary diseases, such as, for example, colour blindness, e.g.
red-green blindness, fragile X syndrome, muscular dystrophy
(Duchenne and Becker-Kiener type), haemophilia A and B, G6PD
deficiency, Fabry's disease, mucopolysaccharidosis, Norrie's
syndrome, retinitis pigmentosa, septic granulomatosis, X-SCID,
ornithine transcarbamylase deficiency, Lesch-Nyhan syndrome, or
from autosomally dominant hereditary diseases, such, as, for
example, hereditary angioedema, Marfan's syndrome,
neurofibromatosis, progeria type I, osteogenesis imperfecta,
Klippel-Trenaunay syndrome, Sturge-Weber syndrome, Hippel-Lindau
syndrome and tuberous sclerosis. RNA according to the invention
which encodes an antibody as described here can be used on
monogenetic diseases in the context of the present invention, the
coded antibody being able to intervene in a regulatory manner, and
also as a therapy, for example by regulation of undesirable
metabolism products, trapping of specific gene products,
interference with undesired certain interactions of proteins, e.g.
inhibiting certain undesired ligand/receptor interactions etc.
[0138] A (modified) RNA according to the invention which encodes an
antibody can be employed in various ways for treatment of the
abovementioned indications. Thus, cancer diseases, for example, can
be treated by immunotherapy in addition or as an alternative to
known therapies. For this, for example, an RNA according to the
invention which codes for a bispecific antibody can be employed,
the antibody recognizing on the one band a surface antigen, such as
e.g. CD3, on T cells and on the other hand a tumour antigen, such
as e.g. Her2/neu, C20, EGFR or CA-125. As a result, T cells which
are positive in respect of certain surface antigens and tumour
cells which express the tumour antigen are brought spatially close,
which improves the recognition of the tumour cells by the immune
system and therefore increases the destruction of the tumour
cells.
[0139] Furthermore, e.g. in cardiac infarction cases, for example,
it is possible to employ an RNA according to the invention which
codes for a bispecific antibody which recognizes on the one hand a
stem cell antigen, such as e.g. CD45, and on the other hand an
antigen of the target tissue, such as e.g. myosin light chain, in
order to increase the concentration of stem cells in the heart
muscle (see also Reusch et al. Anti-CB3 x anti-epidermal growth
factor receptor (EGFR) bispecific antibody redirects T-cell
cytolytic activity to EGFR-positive cancers in vitro and in an
animal model. Clin Cancer Res. 2006).
[0140] Furthermore, by using RNA according to the invention which
codes bispecific antibodies, e.g. two different cell types can be
brought into contact or spatially close by the coded antibodies.
This is advantageous, for example, in order to concentrate a cell
in a tissue or to bring two proteins, e.g. antigens, into contact
with or spatially close to one another, e.g. ligand and receptor or
proteins which must dimerize/oligomerize in order to become
activated.
[0141] RNAs according to the invention as described here which code
for intrabodies can also be employed for use on the abovementioned
diseases, in particular infectious diseases, autoimmune diseases
and neuronal diseases and also on monogenetic diseases. Thus,
intrabodies can be used in order to inhibit, as e.g. bispecific
intracellularly expressed antibodies, cytoplasmic proteins (be it
proteins originating from the pathogenic organism or be it proteins
from the host organism), as described above. For example, RNAs
according to the invention which code for intrabodies can be
employed in order to inhibit IL-2R (receptor of IL-2) or ErbB2
(Her2/neu) by the coded antibodies. RNAs according to the invention
which code for intrabodies are also suitable for use on virus
diseases, such as e.g. HIV-1. It has furthermore been possible to
demonstrate e.g. that infection of mice with scrapie, a prion
disease, can be prevented by expression of an scFv fragment against
the prion protein (Vertrugno et al., KDEL-tagged anti-prion
intrabodies impair PrP lysosomal, degradation, and inhibit scrapie
infectivity. Biochem Biophys Res Commun. 2005; Marasco W A,
Intrabodies: turning the humoral immune system outside in for
intracellular immunization, Gene Therapy (1997) 4: 11-15). RNAs
according to the invention which code for intrabodies can
furthermore be employed in order to bind and preferably to
neutralize, by the coded antibodies, intracellularly expressed
factors as described here, such as e.g. antigens, nucleic acids
etc. (see above).
[0142] In this connection, the Invention therefore also provides
the use of an antibody-coding (modified) RNA according to the
invention or of a pharmaceutical composition according to the
invention, e.g. a passive vaccine according to the invention, for
treatment of indications and diseases described here. This also
includes, in particular, the use of the antibody-coding (modified)
RNA according to the invention for passive immunization and,
respectively, the use of the pharmaceutical composition described
according to the invention as a passive vaccine. The use of the
antibody-coding (modified) RNA according to the invention for the
preparation of a pharmaceutical composition or a passive vaccine,
as described here, for treatment of the indications described here
is likewise included. The use of the antibody-coding (modified) RNA
according to the invention for the preparation of a passive
vaccine, as described here, for passive immunization against the
abovementioned indications is also included.
[0143] In this connection, the invention therefore likewise
provides the use of an antibody-coding (modified) RNA according to
the invention, of the antibody thereby coded, of the pharmaceutical
composition described here or of the passive vaccine according to
the invention for therapeutic use or for inhibition/neutralization
of a protein function in one of the indications described here. In
this context, a protein function is preferably suppressed
(neutralizing antibodies). In principle, any of the antibodies
coded by the RNA according to the invention and described here
simultaneously also has a neutralizing action by binding of its
specific substrate. Examples include e.g. anti-CD4 antibodies for
prevention of rejection of transplants, Avastin (see above),
Herceptin (see above) etc.
[0144] In this connection, the invention therefore also furthermore
provides the use of an antibody-coding (modified) RNA according to
the invention, of the antibody thereby coded or of the
pharmaceutical composition described here for therapeutic use for
passive immunization by triggering an immunological effector
function in the sense of a monoclonal antibody. In this context,
e.g. therapy of tumour cells or pathogens, such as viruses or
bacteria, in the indications as described here is rendered possible
by expression and secretion of the antibody or antibody fragment.
Hereby, the immune defense of the host is supported by the
inventive RNA by triggering the innate, cellular or humoral immune
system. Antibodies may be directed against immune suppressing
factors or they may simulate the function of certain
immunologically active cytokines by e.g. activating cytokine
receptors.
[0145] Furthermore, in this connection an antibody-coding
(modified) RNA according to the invention or the pharmaceutical
composition according to the invention described here or the
passive vaccine according to the invention can also be used as an
immunosuppressant in the indications described above. For example,
it has been possible to demonstrate that it was possible for
antibodies against the CD40 ligand (CD154) or against CD3 to
prevent or reduce the rejection of transplants. Such (modified)
RNAs according to the invention which encode an antibody, the coded
antibodies of which, can bind to surface antigens or generally to
surface factors of cells, such as e.g. MHC class I molecules, MHC
class II molecules, T cell receptors, LMP2 molecules, LMP7
molecules, CD1, CD2, CD3, CD4, CD5, CD11, CD28, CD30, CD31, CD40,
CD50, CD54, CD56, CD58, CD80, CD86, CD95, CD153, CD154, CD178,
CD3=TCR (T cell receptor) etc, are therefore preferably employed
for use as immunosuppressants.
[0146] In this connection, the invention also additionally provides
the use of an antibody-coding (modified) RNA according to the
invention or of the pharmaceutical composition described, here for
therapeutic use for expansion of (certain) cells in vitro or in
vivo. For example, CD4- and CD25-positive cells and regulatory T
cells can be stimulated to expansion by expression of the
superantagonisitc CD28 antibody. Regulatory T cells which can be
multiplied by expression of the superantagonistic CD28 antibody
play a role above all in autoimmune diseases (Beyersdorf N, Hanke
T, Kerkau T, Hunig . Superagonistic anti-CD28 antibodies; potent
activators of regulatory T cells for the therapy of autoimmune
diseases. Ann Rheum Dis. 2005 November; 64).
[0147] An antibody-coding (modified) RNA according to the invention
or the pharmaceutical composition described here can likewise be
used on rheumatoid arthritis for prevention of inflammation
reactions by antibodies against e.g. TNF.alpha. or other factors
exacerbating the undesired immune response against e.g. the
patients' proteins, as for the treatment of autoimmune
diseases.
[0148] A (modified) RNA according to the invention which encodes
anti-CD18 antibodies or the pharmaceutical composition described
here or the passive vaccine according to the invention can
furthermore also be used for reduction of inflammations by
inhibition of leukocytes, e.g. in the abovementioned
indications.
[0149] The present invention furthermore also provides a method for
treatment and/or prevention of the above-mentioned diseases and,
respectively, for (preventive) passive immunization against the
abovementioned diseases, which comprises administration of the
pharmaceutical composition according to the invention described,
the passive vaccine according to the invention or, respectively,
the RNA according to the invention to a patient, in particular a
human. Such methods also relate to treatment of indications which
are connected with the intra- and extracellular processes described
above, with neutralization functions of antibodies, the
abovementioned inhibition of certain (cell) functions by antibodies
etc.
[0150] The present invention also provides an in vitro
transcription method tor the preparation of an antibody-coding
(modified) RNA, comprising the following steps: [0151] a) provision
of a nucleic acid, in particular a cDNA, which codes for an
antibody as described above; [0152] b) addition of the nucleic
acid, in particular a cDNA, which codes for an antibody to an in
vitro transcription medium comprising an RNA polymerase, a suitable
buffer, a nucleic acid mix comprising one or more optionally
modified nucleotides as described above in exchange for one or more
of the naturally occurring nucleotides A, G, C or U, and optionally
one or more naturally occurring nucleotides A, G, C or U, if not
all the naturally occurring nucleotides A, G, C or U are to be
exchanged, and optionally an RNase inhibitor; [0153] c) incubation
of the nucleic acid, in particular a cDNA, which codes for an
antibody in the in vitro transcription medium and in vitro
transcription of the nucleic acid to give an antibody-coding
optionally modified RNA according to the invention; [0154] d)
optionally purification of the antibody-coding (modified) RNA
according to the invention and removal of the non-incorporated
nucleotides from the in vitro transcription medium.
[0155] A nucleic acid as described in step a) of the in vitro
transcription method according to the invention can be any nucleic
acid as described here (for example single- or double-stranded DNA,
cDNA etc.) which encodes an antibody as described here. DNA
sequences, e.g. genomic DNA or fragments thereof, or plasmids which
encode an antibody as described here, preferably in linearized
form, are typically employed for this. The in vitro transcription
can conventionally be carried out using a vector which has an RNA
polymerase binding site. Any (expression) vectors known in the
prior art, e.g. commercially obtainable (expression) vectors, can
be used for this. Preferred (expression) vectors are, for example,
those which have an SP6 or a T7 or T3 binding site upstream and/or
downstream of the cloning site. The nucleic acid sequences used can
thus be transcribed later as desired, depending on the RNA
polymerase chosen. A nucleic acid sequence which is used for the in
vitro transcription and codes for an antibody as described here is
typically cloned into the (expression) vector, e.g. via a multiple
cloning site of the vector used. Before the transcription, the
(expression) vector is typically cleaved with restriction enzymes
at the site at which the future 3' end of the RNA is to be found,
using a suitable restriction enzyme, and the fragment is purified.
This excludes the transcribed RNA from containing vector sequences,
and an RNA transcript of defined length is obtained. In this
context, preferably no restriction enzymes which generate
overhanging ends (such as e.g. Aat II, Apa I, Ban II, Bgl I, Bsp
1286, BstX I, Cfo I, Hae II, HgiA I, Hha I, Kpn I, Pst I, Pvu I,
Sac I, Sac II, Sfi I, Sph I etc.) are used. Should such restriction
enzymes nevertheless be used, the overhanging 3' end is preferably
filled up, e.g. with Klenow or T4DNA polymerase.
[0156] As an alternative for step a) the nucleic acid can also be
prepared as a transcription template by a polymerase chain reaction
(PCR). For this, one of the primers used typically contains the
sequence of an RNA polymerase binding site. Furthermore, the 5' end
of the primer used preferably contains an extension of about 10-50
further nucleotides, more preferably of from 15 to 30 further
nucleotides and most preferably of about 20 nucleotides.
[0157] Before the in vitro transcription, the nucleic acid, e.g.
the DNA or cDNA, template is typically purified and freed from
RNase in order to ensure a high yield. Purification can be carried
out with the aid of any method known in the prior art, for example
using a caesium chloride gradient, ion exchange methods or by
purification via agarose gel electrophoresis.
[0158] According to method step b), the nucleic acid (used as the
transcription template) is added to an in vitro transcription
medium. A suitable in vitro transcription medium initially
comprises a nucleic acid as provided under step a), for example
about 0.1-10 .mu.g, preferably about 1-5 .mu.g, more preferably 2.5
.mu.g and most preferably about 1 .mu.g of such a nucleic acid. A
suitable in vitro transcription medium furthermore optionally
comprises a reducing agent, e.g. DTT, more preferably about 1-20
.mu.50 mM DTT, even more preferably about 5 .mu.50 mM DTT. The in
vitro transcription medium furthermore comprises nucleotides, e.g.
a nucleotide mix, in the case of the present invention comprising a
mixture of (modified) nucleotides as defined here (typically about
0.1-10 mM per nucleotide, preferably 0.1 to 1 mM per nucleotide
(preferably about 4 mM in total)) and optionally non-modified
nucleotides. If modified nucleotides as defined here (about 1 mM
per nucleotide, preferably about 4 mM in total), e.g. psendouridine
5'-triphosphate, 5-methylcytidine 5'-triphosphate etc., are
employed, they are typically added in an amount such that the
modified or base-modified nucleotides is completely replaced by the
natural nucleotide. However, it is also possible to employ mixtures
of one or more modified or base-modified nucleotides and one or
more naturally occurring nucleotides instead of a particular
nucleotide, i.e. it is thus possible to employ one or more modified
nucleotides as described above in exchange for one or more of the
naturally occurring nucleotides A, G, C or U, and optionally
additionally one or more naturally occurring nucleotides A, G, C or
if, if not all the naturally occurring nucleotides A, G, C or U are
to be exchanged. Conversely, it is also possible to use only
natural nucleotides. By selective addition of the desired
nucleotide to the in vitro transcription medium the content, i.e.
the occurrence and the amount, of the desired modification of
nucleotides in the transcribed antibody-coding (modified) RNA
sequence can therefore be controlled. A suitable in vitro
transcription medium likewise comprises an RNA polymerase, e.g. T7
RNA polymerase (for example T7-Opti mRNA Kit, CureVac, Tubingen,
Germany), T3 RNA polymerase or SP6, typically about 10 to 500 U,
preferably about 25 to 250 U, more preferably about 50 to 150 U,
and most preferably about 100 U of RNA polymerase. The in vitro
transcription medium is furthermore preferably kept free from RNase
in order to avoid degradation of the transcribed RNA. A suitable in
vitro transcription medium therefore optionally additionally
comprises an RNase inhibitor.
[0159] The nucleic acid is incubated in the in vitro transcription
medium in a step c) and is transcribed to an antibody-coding
(modified) RNA. The incubation times are typically about 30 to 240
minutes, preferably about 40 to 120 minutes and most preferably
about 90 minutes. The incubation temperatures are typically about
30-45.degree. C., preferably 37-42.degree. C. The incubation
temperature depends on the RNA polymerase used, e.g. for T7 RNA
polymerase it is about 37.degree. C. The RNA obtained by the
transcription is preferably an mRNA. The yields obtained in the in
vitro transcription are, for the stated starting amounts employed
in step b), typically in the region of about 30 .mu.g of RNA per
.mu.g of template DNA used. In the context of the present
invention, the yields obtained in the in vitro transcription can be
increased by linear no seating. For this, the stated starting
amounts employed in step b) are preferably increased according to
the yields required, e.g. by a multiplication factor of 5, 10, 50,
100, 300, 1,000, 5,000, 10,000, 50,000, 100,000 etc.
[0160] After the incubation, a purification of the transcribed
antibody-coding (modified) RNA can optionally take place in step d)
of the in vitro transcription method according to the invention.
Any suitable method known in the prior art, e.g. chromatographic
purification methods, e.g. affinity chromatography, gel filtration
etc., can be used for this. By the purification, non-incorporated,
i.e. excess nucleotides and template DNA can be removed from the in
vitro transcription medium and a clean (modified) RNA can be
obtained. For example, after the transcription the reaction mixture
containing the transcribed RNA can typically be digested with DNase
in order to remove the DNA template still contained in the reaction
mixture. The transcribed RNA can be subsequently or alternatively
precipitated with LiCl. Purification of the transcribed RNA can
then take place via IP RP-HPLC. This renders it possible in
particular to separate longer and shorter fragments from one
another effectively.
[0161] Preferably, its this context the purification takes place
via a method for purification of RNA on a preparative scale, which
is distinguished in that the RNA is purified by means of HPLC using
a porous reverse phase as the stationary phase (PURE Messenger).
For example, for the purification in step d) of the in vitro method
according to the invention, a reverse phase can be employed as the
stationary phase for the HPLC purification. For the chromatography
with reverse phases, a non-polar compound typically serves as
stationary phase, and a polar solvent, such as mixtures of water,
which is usually employed in the form of buffers, with acetonitrile
and/or methanol, serves as the mobile phase for the elution.
Preferably, the porous reverse phase has a particle size of
8.0.+-.2 .mu.m, preferably .+-.1 .mu.m, more preferably +/-0.5
.mu.m. The reverse phase material can be in the form of beads. The
purification can be carried out in a particularly favourable manner
with a porous reverse phase having this panicle size, optionally in
the form of beads, particularly good separation results being
obtained. The reverse phase employed is preferably porous since
with stationary reverse phases which are not porous, such as are
described e.g. by Azarani A. and Hecker K. H., pressures which axe
too high are built up, so that preparative purification of the RNA
is possible, if at all, only with great difficulty. The reverse
phase preferably has a pore size of from 200 .ANG. to 5,000 .ANG.,
in particular a pore size of from 300 .ANG. to 4,000 .ANG..
Particularly preferred pore sizes for the reverse phases are
200-400 .ANG., 800-1,200 .ANG. and 3,500-4,500 .ANG.. With a
reverse phase having these pore sixes, particularly good results
are achieved in respect of the purification of the RNA in process
step d). The material for the reverse phase is preferably a
polystyrene-divinylbenzene, and non-alkylated
polystyrene-divinylbenzenes can be employed in particular.
Stationary phases with polystyrene-divinylbenzene are known per se.
For the purification in method step d), the
polystyrene-divinylbenzenes which are known per se and already
employed for HPLC methods and are commercially obtainable can be
used. A non-alkylated porous polystyrene-divinylbenzene which in
particular has a particle size of 8.0.+-.0.5 .mu.m and a pore size
of 250-300 .ANG., 900-1,100 .ANG. or 3,500-4,500 .ANG. is very
particularly preferably used for the purification in method step
d). The advantages described above can be achieved in a
particularly favourable manner with this material for the reverse
phases. The HPLC purification can be earned out by the ion pair
method, an ion having a positive charge being added to the mobile
phase as a counter-ion to the negatively charged RNA. An ion pair
having a lipophilic character, which is slowed down by the
non-polar stationary phase of the reverse phase system, is formed
in this manner. In practices, the precise conditions for the ion
pair method must be worked out empirically for each concrete
separation problem. The size of the counter-ion, its concentration
and the pH of the solution contribute greatly towards the result of
the separation. In a favourable manner, alkylammonium salts, such
as triethylammonium acetate and/or tetraalkylammonium compounds,
such as tetrabutylammonium, are added to the mobile phase.
Preferably, 0.1 M triethylammonium acetate is added and the pH is
adjusted to about 7. The choice of mobile phase depends on the
nature of the desired separation. This means that the mobile phase
found for a specific separation, such as can be known, for example,
from the prior art, cannot be transferred readily to another
separation problem with adequate prospect of success. The ideal
elution conditions, in particular the mobile phase used, must be
determined for each separation problem by empirical experiments. A
mixture of an aqueous solvent and an organic solvent can be
employed as the mobile phase for elation of the RNA by the HPLC
method. In this context, it is favourable if a buffer which has, in
particular, a pH of about 7, for example 6.5-7.5, e.g. 7.0, is used
as the aqueous solvent; preferably, the buffer triethylammonium
acetate is used, particularly preferably a 0.1 M triethylammonium
acetate buffer which, as described above, also acts as a
counter-ion to the RNA in the ion pair method. The organic solvent
employed in the mobile phase can be acetonitrile, methanol or a
mixture of these two, very particularly preferably acetonitrile.
The purification of the RNA in method step d) using an HPLC method
as described is carried out in a particularly favourable manner
with these organic solvents. The mobile phase is particularly
preferably a mixture of 0.1 M triethylammonium acetate, pH 7, and
acetonitrile. It has emerged to be likewise particularly favourable
if the mobile phase contains 5.0 vol. % to 20.0 vol. % of organic
solvent, based on the mobile phase, and the remainder to make up
100 vol. % is the aqueous solvent. It is very particularly
favourable for the method according to the invention if the mobile
phase contains 9.5 vol. % to 14.5 vol. % of organic solvent, based
on the mobile phase, and the remainder to make up 100 vol. % is the
aqueous solvent. Elution of the RNA can subsequently be carried out
isocratically or by means of a gradient separation. In the case of
an isocratic separation, elution of the RNA is carried out with a
single eluting agent or a mixture of several elating agents which
remains constant, it being possible for the solvents describes
above in detail to be employed as the eluting agent.
[0162] The present invention also provides an in vitro
transcription and translation method for expression of an antibody,
comprising the following steps: [0163] a) provision of a nucleic
acid, in particular a cDNA, which encodes an antibody as described
above; [0164] b) addition of the nucleic acid to an to vitro
transcription medium comprising an RNA polymerase, a suitable
buffer, a nucleic acid mix comprising one or more (modified)
nucleotides as described above in exchange for one or more of the
naturally occurring nucleotides A, G, C or U, and optionally one or
more naturally occurring nucleotides A, G, C or U, if not all the
naturally occurring nucleotides A, G, C or U are to be exchanged,
and optionally an RNase inhibitor; [0165] c) incubation of the
nucleic acid, in particular a cDNA, in the in vitro transcription
medium and in vitro transcription of the nucleic acid to give an
antibody-coding (modified) RNA according to the invention; [0166]
d) optionally purification of the antibody-coding (modified) RNA
according to the invention and removal of the non-incorporated
nucleotides from the in vitro transcription medium; [0167] e)
addition of the (modified) RNA obtained in step c) (and optionally
in step d) to an in vitro translation medium; [0168] f) incubation
of the (modified) RNA in the in vitro translation medium and in
vitro translation of the antibody coded by the (modified) RNA;
[0169] g) optionally purification of the antibody translated is
step f).
[0170] Steps a), b), c) and d) of the in vitro transcription and
translation method according to the invention for expression of an
antibody are identical to steps a), b), c) and d) of the in vitro
transcription method according to the invention described here.
[0171] In step e) of the in vitro transcription and translation
method according to the invention for expression of an antibody,
the (modified) RNA transcribed in step c) (and optionally purified
in step d) is added to a suitable to in vitro translation medium. A
suitable in vitro translation medium comprises, for example,
reticulocyte lysate, wheat germ extract etc. Such a medium
conventionally furthermore comprises an amino acid mix. The amino
acid mix typically comprises (all) naturally occurring amino acids
and optionally modified amino acids, e.g. .sup.35S-methionine (for
example for monitoring the translation efficiency via
autoradiography). A suitable in vitro translation medium
furthermore comprises a reaction buffer. In vitro translation media
are described, for example, in Krieg and Melton (1987) (P. A. Krieg
and D. A. Melton (1987) in vitro RNA synthesis with SF6 RNA
polymerase; Methods Enzymol 155:397-415), the disclosure content of
which in this respect is included in its full scope in the present
invention.
[0172] In a step f) of the in vitro transcription and translation
method according to the invention for expression of an antibody,
the (modified) nucleic acid is incubated in the in vitro
translation medium and the antibody coded by the (modified) nucleic
acid is translated in vitro. The incubation typically lasts about
30 to 240 minutes, preferably about 40 to 120 minutes and most
preferably about 90 minutes. The incubation temperature is
typically in a range of about 20-40.degree. C., preferably about 25
to 35.degree. C. and most preferably about 30.degree. C.
[0173] Steps b) to f) of the in vitro transcription and translation
method according to the invention for expression of an antibody or
individual steps of steps b) to f) can be combined with one
another, i.e. can be carried out together. In this context, all the
necessary components are preferably added to the reaction medium
together at the start or successively during the reaction in
accordance with the sequence of the steps b) to f) described.
[0174] The translated antibody obtained in step f) can be purified
in an optional step g). A purification can be carried out with
methods which are known to a person skilled in the art from the
prior art, e.g. chromatography, such as, for example, affinity
chromatography (HPLC, FPLC, etc.), ion exchange chromatography, gel
chromatography, size exclusion chromatography, gas chromatography,
or antibody detection, or biophysical methods, such as e.g. NMR
analyses, etc. (see e.g. Maniatis et al. (2001) supra).
Chromatography methods, including affinity chromatography methods,
can employ tags in a suitable manner for the purification, as
described above, e.g. a hexahistinine tag (His tag, polyhistidine
tag), a streptavidin tag (Strep tag), an SBP tag
(streptavidin-binding tag), a GST (glutathione S transferase) tag
etc. The purification can furthermore be carried out via an
antibody epitope (antibody-binding tag), e.g. a Myc tag, as Swa11
epitope, a FLAG tag, an HA tag etc., i.e. via recognition of the
epitope via a corresponding (immobilized) antibody. The
purification can likewise be carried out via the immobilized
substrate of the specific antibody, i.e. by binding of the antibody
to an immobilized antigen which is recognized and, respectively,
bound specifically by the translated antibody.
[0175] The present invention also provides an in vitro
transcription and translation method for expression of an antibody
in a host cell, comprising the following steps: [0176] a) provision
of a nucleic acid, in particular a cDNA, which encodes an antibody
as described above; [0177] b) addition of the nucleic acid to an in
vitro transcription medium comprising an RNA polymerase, a suitable
buffer, one or more (modified) nucleotides as described above in
exchange for one or more of the naturally occurring nucleotides A,
G, C or U and optionally one or more naturally occurring
nucleotides A, G, C or U, if not all the naturally occurring
nucleotides A, G, C or U are to be exchanged; [0178] c) incubation
of the nucleic acid, its particular a cDNA, in the in vitro
transcription medium and in vitro transcription of the nucleic acid
to give an antibody-coding (modified) RNA according to the
invention; [0179] d) optionally purification of the antibody-coding
(modified) RNA according to the invention and removal of the
non-incorporated nucleotides from the in vitro transcription
medium; [0180] e') transfection of the (modified) RNA obtained in
step c) (and optionally d)) into a host cell; [0181] f') incubation
of the (modified) nucleic acid in the host cell and translation of
the antibody coded by the (modified) RNA in the host cell; [0182]
g') optionally isolation and/or purification of the antibody
translated in step f').
[0183] Steps a), b), c) and d) of the in vitro transcription and
translation method according to the invention for expression of an
antibody in a host cell are identical to steps a), b), c) and d) of
the in vitro transcription method according to the invention
described here and of the in vitro transcription and translation
method according to the invention described here for expression of
an antibody.
[0184] According to step e') of the in vitro transcription and
translation method according to the invention, transfection of the
(modified) RNA obtained in step c) (and optionally in step d)) into
a host cell is carried out. The transfection is in general carried
out via transfection methods known in the prior art (see, for
example, Maniatis et al. (2001) Molecular Cloning: A laboratory
manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.). Suitable transfection methods in the context of the present
invention include, without being limited thereto, e.g.
electroporation methods, including modified electroporation methods
(e.g. nucleofection), calcium phosphate methods, e.g. the calcium
coprecipitation method, the DEAE-dextran method, the lipofection
method, e.g. the transferrin-mediated lipofection method, polyprene
transfection, particle bombardment, nanoplexes, e.g. PLGA,
polyplexes, e.g. PEI, protoplast fusion and the microinjection
method, the lipofection method having emerged in particular as a
suitable method. In this context, the (modified) RNA according to
the invention can be in the naked or completed form, as described
above for the (modified) RNA according to the invention.
[0185] In connection with the present invention and with step e')
of the in vitro transcription and translation method according to
the invention for expression of an antibody in a host cell, a
(suitable) host cell includes any cell which allows expression of
the antibody coded by the (modified) RNA according to the
invention, preferably any cultured eukaryotic cell (e.g. yeast
cells, plant cells, animal cells and human cells) or prokaryotic
cell (e.g. bacteria cells etc.). Cells of multicellular organisms
are preferably chosen for expression of the antibody coded by the
(modified) RNA according to the invention if postranslational
modifications, e.g. glycosylation of the coded protein, are
necessary (N- and/or O-coupled). In contrast to prokaryotic cells,
such (higher) eukaryotic cells render possible postranslational
modification of the protein synthesized. The person skilled in the
art knows a large number of such higher eukaryotic cells or cell
lines, e.g. 293T (embryonal kidney cell line), HeLa (human cervix
carcinoma cells), CHO (cells from the ovaries of the Chinese
hamster) and further cell lines, including such cells and cell
lines developed for laboratory purposes, such as, for example,
hTERT-MSC, HEK293, Sf9 or COS cells. Suitable eukaryotic cells
furthermore include cells or cell lines which are impaired by
diseases or infections, e.g. cancer cells, in particular cancer
cells of any of the types of cancer mentioned here in the
description, cells impaired by HIV, and/or cells of the immune
system or of the central nervous system (CNS). Human cells or
animal cells, e.g. of animals as mentioned here, are particularly
preferred as eukaryotic cells. Suitable host cells can likewise be
derived from eukaryotic microorganisms, such as yeast, e.g.
Saccharomyces cerevisiae (Stinchcomb et al., Nature, 282:39,
(199)), Schizosaccharomyces pombe, Candida, Pichia, and filamentous
fungi of the genera Aspergillus, Penicillium, etc. Suitable host
cells likewise include prokaryotic cells, such as e.g. bacteria
cells, e.g. from Escherichia coli or from bacteria of the geuera
Bacillus, Lactococcus, Lactobacillus, Pseudomonas, Streptomyces,
Streptococcus, Staphylococcus, preferably E. coli, etc.
[0186] In step f') of the in vitro transcription and translation
method according to the invention for expression of an antibody in
a host cell, incubation of the (modified) RNA in the host cell and
translation of the antibody coded by the (modified) RNA in the host
cell are carried out. Expression mechanisms intrinsic to the host
cell are preferably used for this, e.g. by translation of the RNA
in the host cell via fibosomes and tRNAs. The incubation
temperatures used in this context depend on the particular host
cell systems used.
[0187] In an optional step g'), the translated antibody obtained in
step f') can be isolated and/or purified. In this context, an
isolation of the translated (expressed) antibody typically
comprises separating off the antibody from reaction constituents,
and can be carried out by methods which are known to a person
skilled in the art, for example by cell lysis, breakdown by
ultrasound, or similar methods, including the abovementioned
methods. A purification can therefore also be carried out by
methods as described for step e) of the in vitro transcription and
translation method according to the invention for expression of an
antibody.
[0188] For purification of (recombinant) antibodies from a host
cell in step g') of the method described above, a different choice
of the host cells described above is necessary, depending on the
use. Thus, the production of recombinant antibodies in E. coli
typically is possible to only a limited extent, since the
antibodies coded by a (modified) RNA according to the invention are
very complex, require complicated folding mechanisms and are
conventionally modified posttranslationally for use in
multicellular organisms or beings. These mechanisms conventionally
cannot be implemented in the cytoplasm of E. coli. Periplasmic
production in E. coli, in which correct folding and modification of
the antibody fragments is possible, can therefore be used. In this
context, the purification usually requires an involved breakdown of
the bacteria and a difficult separating off of all the bacterial
constituents which can act as endotoxins during a therapeutic use.
To bypass these purification problems, expression systems for
yeasts, insect cells, mammalian cells and plants can be employed
according to the invention in such cases, the production preferably
being carried out in suitable mammalian cells, such as e.g. hamster
cells (CHO), as described here.
[0189] Regardless of steps (a) to (d), the antibody coded by the
(modified) RNA according to the invention can also be expressed by
an in vitro translation method of steps (e') to (g'), which is also
subject matter of the present invention as such.
[0190] The present invention also provides an in vitro
transcription and in vivo translation method for expression of an
antibody in an organism, comprising the following steps: [0191] a)
provision of a nucleic acid, in particular a cDNA, which encodes an
antibody as described above; [0192] b) addition of the nucleic acid
to an in vitro transcription medium comprising an RNA polymerase, a
suitable buffer, a nucleic acid mix comprising one or more
(modified) nucleotides as described above in exchange for one or
more of the naturally occurring nucleotides A, G, C or U, and
optionally one or more naturally occurring nucleotides A, G, C or
U, if not all the naturally occurring nucleotides A, G, C or U are
to be exchanged, and optionally an RNase inhibitor; [0193] c)
incubation of the nucleic acid, in particular a cDNA, in the in
vitro transcription medium and in vitro transcription of the
nucleic acid to give a (modified) RNA according to the invention as
described here; [0194] d) optionally purification and removal of
the non-incorporated nucleotides from the in vitro transcription
medium; [0195] e'') transfection of the (modified) RNA obtained in
step c) (and optionally in step d)) into a host cell and
transplanting of the transfected host cell into an organism; [0196]
f'') translation of the antibody coded by the (modified) RNA in the
organism.
[0197] Steps a), b), c) and d) of the in vitro transcription and in
vivo translation method according to the invention for expression
of an antibody in an organism are identical to steps a), b), c) and
d) of the in vitro transcription method according to the invention
described here, of the in vitro transcription and translation
method, according to the invention described here for expression of
an antibody and of the in vitro transcription and translation
method according to the invention described here for expression of
an antibody in a host cell.
[0198] Host cells in the context of the present invention, and in
particular in step e''), can also include autologous cells, i.e.
cells which are taken from a patient and returned again (endogenous
cells). Such autologous cells reduce the risk of rejection by the
immune system in the case of in vivo uses. In the case of
autologous cells, (healthy or diseased) cells from the affected
body regions/organs of the patient are preferably employed.
Transfection methods are preferably those as described above for
step e). In step e''), transplanting of the host cell into an
organism is carried out, additionally to step e). An organism or a
being in connection with the present invention typically means
mammals, i.e. animals, including cattle, pig, dog, cat, donkey,
monkey, including rodents, e.g. mouse, hamster, rabbit etc., and
humans. As an alternative to step e'') and f''), the isolation
and/or purification can be carried out according to steps f)/f')
and/or g/g') and the translated (therapeutically active) protein
can be administered subsequently to the being. The administration
can be carried out as described for pharmaceutical
compositions.
[0199] In step f''), translation of the antibody coded by the
(modified) RNA is carried out in the organism. In this context, the
translation is preferably carried out by means of systems specific
to the host cell, depending on the host cell used.
[0200] Regardless of steps (a) to (d), the transcribed (modified)
RNA according to the invention can also be expressed by an in vitro
translation method of steps (e'') to (g''), which is also subject
matter of the present invention as such.
[0201] As an alternative to the methods described above, according
to a particularly preferred embodiment in a further step e''') a
(modified) RNA according to the invention transcribed according to
steps a) to d) can be administered directly into the organism, e.g.
human, e.g. by administration of the naked or complexed RNA
according to the invention, for example using the transfection
methods described above, optionally using certain stabilizing
factors described here. In this context, after uptake the RNA is
preferably transported into the cells, e.g. with localization or
signal sequences as described here, and preferably translated into
the coded antibody in the cells.
Advantages of the Invention
[0202] The present invention describes in particular an
antibody-coding RNA according to the invention. This can be
modified or non-modified, where the definition of "modification" is
to be understood in the broadest sense. A native RNA covalently
bonded to another group, for example a lipid or a sugar residue, is
modified in the context of this invention. An RNA which contains
non-natively occurring constituents, for example non-native
nucleotides, or an RNA which is modified with respect to its
precursor by exchange of nucleotides, regardless of whether these
are native or non-native, is also modified in the context of the
invention. The great advantage of such RNAs is that these do not
have the negative actions of RNA transfections (with stable
incorporation into the genome). In the case of modified
antibody-coding RNAs, the limited stability of the RNA coding for
the antibodies or antibody fragments is moreover improved.
According to the invention, after administration to patients, in
particular mammals, above all humans, the antibodies are therefore
thus expressed in vivo for only an estimatable time beyond the
treatment and therefore do not lead to harmful effects. In
contrast, the conventional intrabody DNAs can be integrated into
the genome in a stable manner or at least expressed persistently,
which can lead to uncontrollable events. The great advantage
compared with administration of monoclonal antibodies in vivo is
furthermore that with the use of an antibody-coding (modified) RNA
as described here, no antibodies have to be prepared and purified
in an involved manner and they are therefore considerably less
expensive to prepare. The most essential advantage of the present
invention is, however, that intracellularly expressed proteins can
also be achieved with the antibodies coded by (modified) RNAs
according to the invention, which is not possible with monoclonal
antibodies known hitherto from the prior art.
[0203] The following FIGS. and examples are intended to explain in
more detail and illustrate the above description, without being
limited thereto.
FIGURES
[0204] FIG. 1 illustrates the structure of an IgG antibody. IgG
antibodies are built up from in each case two identical light and
two heavy protein chains which are bonded to one another via
disulfide bridges. The light chain comprises the N-terminal
variable domain V.sub.L and the C-terminal constant domain C.sub.L.
The heavy chain of an IgG antibody can be divided into an
N-terminal variable domain V.sub.H and three constant domains
C.sub.H1, C.sub.H2, and C.sub.H3.
[0205] FIG. 2 shows the gene cluster for the light and the heavy
chains of an antibody: [0206] (A): Gene cluster for the light chain
.kappa.. [0207] (B): Gene cluster for the light chain .lamda..
[0208] (C): and (D): Gene cluster for the heavy chain. [0209] In
this context, the variable region of a heavy chain is composed of
three different gene segments. In addition to the V and J segments,
additional D segments are also found here. The V.sub.H, D.sub.H and
J.sub.H segments can likewise be combined with one another
virtually as desired to form the variable region of the heavy
chain.
[0210] FIG. 3 illustrates in the form of a diagram the differences
in the light and heavy chains of murine (i.e. obtained in the mouse
host organism), chimeric, humanized and human antibodies.
[0211] FIG. 4 shows an overview of the structure of various
antibody fragments. The constituents of the antibody fragments are
shows on a dark grey background.
[0212] FIG. 5 shows various variants of antibodies and antibody
fragments in FIGS. 5A, 5B and 5C; [0213] (A) shows a diagram of an
IgG antibody of two light and two heavy chains. [0214] (B) shows an
Fab fragments from the variable and a constant domain in each case
of a light and a heavy chain. The two chains are bonded to one
another via a disulfide bridge. [0215] (C) shows an scFv fragment
from the variable domain of the light and the heavy chain, which
are bonded to one another via an artificial polypeptide linker.
[0216] FIG. 6 shows a presentation of an antibody-coding (modified)
RNA according to the invention as an expression construct. In this:
[0217] V.sub.H=variable domain of the heavy chain; [0218]
C.sub.H=constant domain of the heavy chain; [0219] V.sub.L=variable
domain of the light chain; [0220] C.sub.L=constant domain of the
light chain; [0221] SIRES=internal ribosomal entry site (IRES,
superIRES) [0222] muag=mutated form of the 3' UTR of the
alpha-globin gene; and [0223] A70C30=polyA-polyC tail.
[0224] FIG. 7 shows a diagram of the detection of an antibody coded
by an RNA according to the invention by means of ELISA on the
example of the antigen Her2.
[0225] FIG. 8 shows the wild-type DNA sequence of the heavy chain
of the antibody rituximab (=Rituxan, MabThera) (wild-type: GC
content: 56.5%, length: 1,344) (SEQ ID NO: 1).
[0226] FIG. 9 shows the GC-optimized DNA sequence of the heavy
chain of the antibody rituximab (=Rituxan, MabThera) (GC content;
65.9%, length: 1,344) (SEQ ID NO: 2).
[0227] FIG. 10 shows the wild-type DNA sequence of the light chain
of the antibody rituximab (=Rituxan, MabThera) (wild-type: GC
content: 58.5%, length: 633) (SEQ ID NO: 3).
[0228] FIG. 11 shows the GC-optimized DNA sequence of the light
chain, of the antibody rituximab (=Rituxan, MabThera) (GC content:
67.2% length: 633) (SEQ ID NO: 4).
[0229] FIG. 12 shows the total construct of the GC-optimized DNA
sequence of the antibody rituximab (=Rituxan, MabThera) with the
light and heavy chains (SEQ ID NO: 5). The total construct contains
the following sequences and cleavage sites (see also alternative
cleavage sites of FIG. 25, SEQ ID No. 51):
TABLE-US-00004 ACC linker for an optimum Kozak sequence AAGCTT
HindIII TGA stop codon ACTAGT SpeI AGATCT BgIII ATGCAT Nsil
CATCATCATCATCATCAT His tag Signal peptide, HLA-A*0201: GC-rich
ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGGCGCCC
TCGCCCTGACGCAGACCTGGGCCGGG.
[0230] The coding region of the heavy chain sequence starts with
the signal peptide as given above (italic). This region is G/C
enriched as well. The subsequent sequence starting with CAG
represents the actual antibody coding sequence (see FIG. 9) for the
heavy chain, which ends with AAG and is followed by the above
described His tag sequence. Finally, the open reading frame for the
heavy chain ends with the stop codon TGA ( . . . ). The coding
region for the light chain sequence starts 3' upstream with the
signal peptide's ATG as gives above followed by the light chain's
coding region for the light chain starting with CAG running to the
stop codon TGA ( . . . ) (see FIG. 11). Both coding regions for the
light and the heavy chain are separated by an IRES element ( . . .
). The inventive RNA coded by the construct given in FIG. 12 may or
may not contain a (His) tag sequence and may contain a signal
peptide sequence different from the above peptide sequence or may
even have no signal peptide sequence. Accordingly, the inventive
RNA molecule contains preferably the coding region (with or without
a signal peptide sequence at its beginning) of the heavy and/or the
light chain (e.g. as shown in FIG. 12), preferably in combination
with as least one ribosomal entry site.
[0231] FIG. 13 shows the wild-type DNA sequence of the heavy chain
of the antibody cetuximab (=Erbitux) (wild-type: GC content: 56.8%,
length: 1,359) (SEQ ID NO: 6).
[0232] FIG. 14 shows the GC-optimized DNA sequence of the heavy
chain of the antibody cetuximab (=Erbitux) (GC content: 65.9%,
length: 1,359) (SEQ ID NO: 7).
[0233] FIG. 15 shows the wild-type DNA sequence of the light chain,
of the antibody cetuximab (=Erbitux) (wild-type: GC content: 58.2%,
length: 642) (SEQ ID NO: 8).
[0234] FIG. 16 shows the GC-optimized DNA sequence of the light
chain of the antibody cetuximab (=Erbitux) (GC content: 65.7%,
length: 642) (SEQ ID NO: 9).
[0235] FIG. 17 shows the total construct of the GC-optimized DNA
sequence of the antibody cetuximab (=Erbitux) with the light and
heavy chains (SEQ ID NO: 10). The total construct contains the
following sequences and cleavage sites (see also alternative
cleavage sites of FIG. 26, SEQ ID No 52):
TABLE-US-00005 ACC linker for an optimum Kozak sequence AAGCTT
HindIII TGA stop codon ACTAGT SpeI AGATCT BgIII ATGCAT NsiI
CATCATCATCATCATCAT His tag Signal peptide, HLA-A*0201: GC-rich
ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGGCGCCC
TCGCCCTGACGCAGACCTGGGCCGGG.
[0236] The coding region of the heavy chain sequence starts with
the signal peptide as given above (italic). This region is G/C
enriched as well. The subsequent sequence starting with CAG
represents the actual antibody coding sequence (see FIG. 14) for
the heavy chain, which ends with AAG and is followed by the above
described His tag sequence. Finally, the open reading frame for the
heavy chain ends with the stop codon TGA ( . . . ). The coding
region for the light chain sequence starts 3' upstream with the
signal peptide's ATG as given above followed by the light chain's
coding region for the light chain starting wish GAC running to the
stop codon TGA ( . . . ) (see FIG. 16). Both coding regions for the
light and the heavy chain are separated by an IRES element ( . . .
). The inventive RNA coded by the construct given in FIG. 17 may or
may not contain a (His) tag sequence and may contain a signal
peptide sequence different from the above peptide sequence or may
even have no signal peptide sequence. Accordingly, the inventive
RNA molecule contains preferably the coding region (with or without
a signal peptide sequence at its beginning) of the heavy and/or the
light chain (e.g. as shown in FIG. 17), preferably in combination
with at least one ribosomal entry site.
[0237] FIG. 18 shows the wild-type DNA sequence of the heavy chain
of the antibody trastuzumab (=Herceptin) (wild-type: GC content:
57.8%, length: 1,356) (SEQ ID NO: 11).
[0238] FIG. 19 shows the GC-optimized DNA sequence of the heavy
chain of the antibody trastuzumab (=Herceptin) (GC consent: 67.0%,
length: 1,356) (SEQ ID NO: 12).
[0239] FIG. 20 shows the wild-type DNA sequence of the light chain
of the antibody trastuzumab (=Herceptin) (wild-type: GC content:
56.9% length: 645) (SEQ ID NO: 13).
[0240] FIG. 21 shows the GC-optimized DNA sequence of the light
chain of the antibody trastuzumab (=Herceptin) (GC content: 66.4%,
length: 645) (SEQ ID NO: 14).
[0241] FIG. 22 shows the total construct of the GD-optimized DNA
sequence of the antibody trastuzumab (=Herceptin) with the light
and heavy chains (SEQ ID NO: 15). The total construct contains the
following sequences and cleavage sites (see also alternative
cleavage sites of FIG. 27, SEQ ID No. 53):
TABLE-US-00006 ACC linker for an optimum Kozak sequence AAGCTT
HindIII TGA stop codon ACTAGT SpeI AGATCT BgIII ATGCAT NsiI
CATCATCATCATCATCAT His tag Signal peptide, HLA-A*0201: GC-rich
ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGGCGCCC
TCGCCCTGACGCAGACCTGGGCCGGG.
[0242] The coding region of the heavy chain sequence starts with
the signal peptide as given above (italic). This region is G/C
enriched as well. The subsequent sequence starting with GAG
represents the actual antibody ceding sequence (see FIG. 19) for
the heavy chain, which ends with AAG and is followed by the above
described His tag sequence. Finally, the open reading frame for the
heavy chain ends with the stop codon TGA ( . . . ). The coding
region for the light chain sequence starts 3' upstream with the
signal peptide's ATG as given above followed by the light chain's
coding region for the light chain starting with GAC running to the
stop codon TGA ( . . . ) (see FIG. 21). Both coding regions for the
light and the heavy chain are separated by an IRES element ( . . .
). The inventive RNA coded by the construct given in FIG. 22 mayor
may not contain a (His) tag sequence and may contain a signal
peptide sequence different from the above peptide sequence or may
even have no signal peptide sequence. Accordingly, the inventive
RNA molecule contains preferably the coding region (with or without
a signal peptide sequence at its beginning) of the heavy and/or the
light chain (e.g. as shown in FIG. 22), preferably in combination
wish at least one ribosomal entry site.
[0243] FIG. 23 shows RNA-mediated antibody expression in cell
culture. CHO or BHK cells were transfected with 20 .mu.g of
antibody-encoding mRNA according to the invention which was
produced (RNA, G/C enriched, see above) or mock-transfected. 24
hours after transfection protein synthesis was analysed by Western
blotting of cell lysates. Cells harboured about 0.5 .mu.g of
protein as assessed by Western Blot analysis. Each lane represents
10% of total lysate. Humanised antibodies served as control and for
a rough estimate of protein levels. The detection antibody
recognises both heavy and light chains; moreover, it shows some
unspecific staining with cell lysates (three distinct bands
migrating much slower than those of the antibodies). A comparison
with control antibodies clearly demonstrates that heavy and light
chains were produced in equal amounts.
[0244] FIG. 24 shows that RNA-mediated antibody expression gives
rise to a functional protein (antibody). Functional antibody
formation was addressed by FACS staining of antigen-expressing
target cells. In order to examine the production of functional
antibodies, cell culture supernatants of RNA-transfected (20 .mu.g
of Ab-RNA as defined above in Example 1) cells were collected after
48 to 96 hours. About 8% of total supernatant was used to stain
target cells expressing the respective antigen. Humanised
antibodies served as control and for a rough estimate of protein
levels. Primary antibody used for cell staining: a) humanised
antibody; b) none; c,d) supernatant from RNA-transfected cells
expressing the respective antibody; e) supernatant from
mock-transfected CHO cells. Calculations on the basis of the
analysis shown in FIG. 24 reveal that cells secreted more than
12-15 .mu.g of functional antibody within 48-96 hours. Accordingly,
the present invention proves that RNA encoding antibodies may enter
into cell, may be expressed within the cell and considerable
amounts of RNA encoded antibodies are then secreted by the cell
into the surrounding medium/extracellular space. Cell transfection
in vivo or in vitro by the inventive RNA may therefore be used to
provide antibodies acting e.g. therapeutically in the extracellular
space.
[0245] FIG. 25 shows an alternative sequence of the construct of
FIG. 12 (antibody rituximab), wherein the restriction sites have
been modified as compared to SEQ ID No. 5 of FIG. 12 (SEQ ID No.:
51). For closer information with regard to the description of
various sequence elements it is referred to FIG. 12.
[0246] FIG. 26 shows an alternative sequence of the construct of
FIG. 17 (antibody cetuximab), wherein the restriction sites have
been modified as compared to SEQ ID No. 10 of FIG. 17 (SEQ ID No.:
52). For closer information with regard to the description of
various sequence elements it is referred to FIG. 17.
[0247] FIG. 27 shows an alternative sequence of the construct of
FIG. 22 (antibody trastuzumab), wherein the restriction sites have
been modified as compared to SEQ ID No. 15 of FIG. 22 (SEQ ID No.:
53). For closer information with regard to the description of
various sequence elements it is referred to FIG. 22.
[0248] The following examples explain the present invention in more
detail, without limiting it.
EXAMPLES
1. Example
1.1 Cell Lines and Cell Culture Conditions Used
[0249] The cell lines HeLa (human cervix carcinoma cell line;
Her2-positive), HER293 (human embryonal kidney; Her2-negative) and
BHK21 (Syrian hamster kidney; Her2-negative) were obtained from the
DMSZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH)
in Braunschweig and cultured in RPMI medium enriched with 2 mM
L-glutamine (Bio Whittaker) and 10 .mu.g/ml streptomycin and 10
U/ml of penicillin at 37.degree. C. under 5% CO.sub.2.
1.2 Preparation of Expression Vectors for Modified RNA Sequences
According to the Invention
[0250] For the production of modified RNA sequences according to
the invention, the GC-enriched and translation-optimized DNA
sequences which code for a heavy chain and a light chain of an
antibody (e.g. cetuximab (Erbitux), trastuzumab (Herceptin) and
rituximab (Rituxan), cf. SEQ ID NO: 1-15, where SEQ ID NO: 1, 3, 6,
8, 11 and 13 represent the particular coding sequences which are
not GC-optimized of the heavy and the light chains of these
antibodies and SEQ ID NO: 2,4, 5, 7, 9, 10, 12,14 and 15 represent
the coding GC-enriched sequences (see above)) were cloned into the
pCV19 vector (CureVac GmbH) by standard molecular biology methods.
To ensure equimolar expression of the two chains, an IRES (internal
ribosoroal entry site) was introduced. The mutated 3' UTR
(untranslated region) of the alpha-globin gene and a polyA-polyC
tail at the 3' end serve for additional stabilizing of the mRNA.
The signal peptide of the HLA-A*0201 gene is coded for secretion of
the antibody expressed. A His tag was additionally introduced for
detection of the antibody. FIG. 6 shows the expression constructs
used.
1.3 Preparation of the G/C-Enriched and Translation-Optimized
Antiboy-Coding mRNA
[0251] An in vitro transcription was carried out by means of T7
polymerase (T7-Opti mRNA Kit, CureVac, Tubingen, Germany), followed
by purification with Pure Messenger.TM. (CureVac, Tubingen,
Germany). For this, a DNase digestion was first carried out,
followed by an LiCl precipitation and thereafter an HFLC using a
porous reverse phase as the stationary phase (PURE Messenger).
1.4 Detection of RNA-Antibody by Means of Flow Cytometry
[0252] 1 million cells were transfected with the mRNA according to
one of SEQ ID NO: 5, 10 or 15 (see above), which codes for an
antibody as described above, by means of electroporation and were
then cultured in the medium for 16 h. The antibody expressed was
detected by means of an FITC-coupled His tag antibody.
Alternatively, the secreted antibody from the supernatant of
transfected cells was added to non-transfected, antigen-expressing
cells and, after incubation, detected by the same method.
1.5 In vitro Detection of an Antibody Coded by an RNA According to
the Invention by Means of ELISA
[0253] A microtitre plate, was loaded with a murine antibody (1)
against a first antigen (HER-2). Cell lysate of antigen-expressing
cells was then added to the plate. The antigen was bound here by
the murine antigen-specific antibody (1). The supernatant of cells
which were transfected with a modified mRNA according to the
invention which codes for an HER-2-specific antibody was then added
to the microtitre plate. The HER-2-specific antibody (2) contained
in the supernatant likewise binds to the antibody-bound antigen,
the two antibodies recognizing different domains of the antigen.
For detection of the bound antibody (2), anti-human IgG coupled to
horseradish peroxidase (3-HRP) was added, the substrate TMB being
converted and the result determined photometrically.
1.6 In vivo Detection of an Antibody Coded by an RNA According to
the Invention
[0254] An antibody-coding (m)RNA according to the invention as
described above was injected intradermally or intramuscularly into
BALB/c mice. 24 h thereafter, the corresponding tissues were
removed and protein extracts were prepared. The expression of the
antibody was detected by means of ELISA as described here.
1.7 Detection of an Antibody Coded by an RNA According to the
Invention by Means of Western Blotting
[0255] The expressed antibodies from the supernatant of cells which
were transfected with a modified mRNA which codes for an antibody
as described above were separated by means of a polyacrylamide gel
electrophoresis and then transferred to a membrane. After
incubation with anti-His tag antibody and a second antibody coupled
to horseradish peroxidase, the antibody expressed was detected by
means of chemoluminescence.
1.8 Tumour Model
[0256] SKOV-3 cells were injected subcutaneously into BALB/c mice.
Within the following 28 days, eight portions of 10 .mu.g of a
modified mRNA which codes for an antibody as described above were
injected into the tail vein of the mice. The tumour growth was
monitored over a period of 5 weeks.
2. Example
2.1 Cell Lines
[0257] RNA-based expression of humanised antibodies was done in
either CHO-K1 or BHK-21 cells. The tumour cell lines BT-474, A-431
and Raji strongly expressing HER2, EGFR and CD20, respectively,
were used to record antibody levels. All cell lines except CHO were
maintained in RPMI supplemented with FCS and glutamine according to
the supplier's information. CHO cells were grown in Ham's F12
supplemented with 10% FCS. All cell lines were obtained from the
German collection of cell cultures (DSMZ).
2.2 Antibody Expression
[0258] Various amounts of antibody-RNA (G/C enriched as defined by
FIGS. 12, 17, 22, 25, 26, 27) encoding the humanised antibodies
Herceptin, Erbitux, and Rituxan, respectively, (see the description
given above for Example 1) were transfected into either CHO or BHK
cells by electroporation. Conditions were as follows: 300 V, 450
.mu.F for CHO and 300 V, 150 .mu.F for BHK. After transaction,
cells were seeded onto 24-well cell culture plates at a density of
2-400,000 cells per well. For collection of secreted protein,
medium was replaced by 250 .mu.l of fresh medium after cell
attachment to the plastic surface. Secreted protein was collected
for 24-96 hours and stored at 4.degree. C. In addition, cells were
harvested into 50 .mu.l of phosphate buffered saline containing
0.5% BSA and broken an by three freeze-thaw cycles. Cell lysates
were cleared by centrifugation and stored at -80.degree. C.
2.3 Western Blot Analysis
[0259] In order to detect translation of transfected RNA, proteins
from either cell culture supernatants or cell lysates were
separated by a 12% SDS-PAGE and blotted onto a nitrocellulose
membrane. Humanised antibodies Herceptin (Roche), Erbitux (Merck
KGAA), and Mabthera=Rituxan (Roche) were used as controls. After
blotting was completed, membranes were consecutively incubated with
biotinylated goat anti-human IgG (Dianova), streptavidin coupled to
horseradish peroxidase (BD), and a chemiluminescent substrate
(SuperSignal West Pico, Pierce). Staining was detected with a Fuji
LAS-1000 chemiluminescence camera.
2.4 FACS Analysis
[0260] 200.000 target cells expressing the respective antigen were
incubated with either control antibodies (Herceptin, Erbitux,
Mabthera) or cell culture supernatants. For detection of bound
antibodies, cells were stained with biotinylated goat anti-human
IgG (Dianova) and PE-labelled streptavidin (Invitrogen). Cells were
analysed on a FACSCalibur (BD).
Sequence CWU 1
1
6211344DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 1caggcgtatc tgcagcagag cggcgcggaa
ctggtgcgcc cgggcgcgag cgtgaaaatg 60agctgcaaag cgagcggcta tacctttacc
agctataaca tgcattgggt gaaacagacc 120ccgcgccagg gcctggaatg
gattggcgcg atttatccgg gcaacggcga taccagctat 180aaccagaaat
ttaaaggcaa agcgaccctg accgtggata aaagcagcag caccgcgtat
240atgcagctga gcagcctgac cagcgaagat agcgcggtgt atttttgcgc
gcgcgtggtg 300tattatagca acagctattg gtattttgat gtgtggggca
ccggcaccac cgtgaccgtg 360agcggcccga gcgtgtttcc gctggcgccg
agcagcaaaa gcaccagcgg cggcaccgcg 420gcgctgggct gcctggtgaa
agattatttt ccggaaccgg tgaccgtgag ctggaacagc 480ggcgcgctga
ccagcggcgt gcataccttt ccggcggtgc tgcagagcag cggcctgtat
540agcctgagca gcgtggtgac cgtgccgagc agcagcctgg gcacccagac
ctatatttgc 600aacgtgaacc ataaaccgag caacaccaaa gtggataaaa
aagcggaacc gaaaagctgc 660gataaaaccc atacctgccc gccgtgcccg
gcgccggaac tgctgggcgg cccgagcgtg 720tttctgtttc cgccgaaacc
gaaagatacc ctgatgatta gccgcacccc ggaagtgacc 780tgcgtggtgg
tggatgtgag ccatgaagat ccggaagtga aatttaactg gtatgtggat
840ggcgtggaag tgcataacgc gaaaaccaaa ccgcgcgaag aacagtataa
cagcacctat 900cgcgtggtga gcgtgctgac cgtgctgcat caggattggc
tgaacggcaa agaatataaa 960tgcaaagtga gcaacaaagc gctgccggcg
ccgattgaaa aaaccattag caaagcgaaa 1020ggccagccgc gcgaaccgca
ggtgtatacc ctgccgccga gccgcgatga actgaccaaa 1080aaccaggtga
gcctgacctg cctggtgaaa ggcttttatc cgagcgatat tgcggtggaa
1140tgggaaagca acggccagcc ggaaaacaac tataaaacca ccccgccggt
gctggatagc 1200gatggcagct tttttctgta tagcaaactg accgtggata
aaagccgctg gcagcagggc 1260aacgtgttta gctgcagcgt gatgcatgaa
gcgctgcata accattatac ccagaaaagc 1320ctgagcctga gcccgggcaa ataa
134421344DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 2caggcctacc tgcagcagag cggcgcggag
ctcgtgcggc cgggggcctc ggtcaagatg 60agctgcaagg ccagcggcta caccttcacg
agctacaaca tgcactgggt gaagcagacc 120ccgcgccagg ggctggagtg
gatcggcgcc atctaccccg ggaacggcga caccagctac 180aaccagaagt
tcaagggcaa ggcgaccctg acggtggaca agtcgagcag caccgcctac
240atgcagctca gcagcctgac ctcggaggac agcgccgtct acttctgcgc
ccgggtggtg 300tactacagca acagctactg gtacttcgac gtctggggga
ccggcacgac cgtgaccgtg 360agcgggccca gcgtcttccc cctggccccc
tcgagcaaga gcaccagcgg cggcacggcg 420gccctcgggt gcctggtgaa
ggactacttc cccgagcccg tgaccgtcag ctggaactcg 480ggcgccctga
ccagcggggt gcacaccttc ccggccgtgc tccagagcag cggcctgtac
540agcctgagct cggtcgtgac ggtgcccagc agcagcctcg ggacccagac
ctacatctgc 600aacgtcaacc acaagcccag caacaccaag gtggacaaga
aggcggagcc caagtcgtgc 660gacaagacgc acacctgccc gccctgcccc
gcccccgagc tgctgggcgg cccgagcgtg 720ttcctcttcc cgcccaagcc
caaggacacc ctgatgatca gccgcacccc cgaggtcacg 780tgcgtggtgg
tcgacgtgag ccacgaggac cccgaggtga agttcaactg gtacgtcgac
840ggggtggagg tgcacaacgc caagaccaag ccccgggagg agcagtacaa
cagcacctac 900cgcgtcgtga gcgtgctgac cgtcctccac caggactggc
tgaacggcaa ggagtacaag 960tgcaaggtgt cgaacaaggc cctgccggcc
cccatcgaga agacgatcag caaggcgaag 1020gggcagcccc gggagcccca
ggtgtacacc ctcccgccca gccgcgacga gctgaccaag 1080aaccaggtca
gcctgacctg cctcgtgaag ggcttctacc ccagcgacat cgccgtggag
1140tgggagtcga acgggcagcc cgagaacaac tacaagacga ccccgcccgt
cctggacagc 1200gacggcagct tcttcctgta cagcaagctc accgtggaca
agagccggtg gcagcagggc 1260aacgtgttca gctgctcggt catgcacgag
gccctgcaca accactacac ccagaagagc 1320ctgagcctca gccccgggaa gtga
13443633DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 3cagattgtgc tgagccagag cccggcgatt
ctgagcgcga gcccgggcga aaaagtgacc 60atgacctgcc gcgcgagcag cagcgtgagc
tatatgcatt ggtatcagca gaaaccgggc 120agcagcccga aaccgtggat
ttatgcgccg agcaacctgg cgagcggcgt gccggcgcgc 180tttagcggca
gcggcagcgg caccagctat agcctgacca ttagccgcgt ggaagcggaa
240gatgcggcga cctattattg ccagcagtgg agctttaacc cgccgacctt
tggcgcgggc 300accaaactgg aactgaaacg caccgtggcg gcgccgagcg
tgtttatttt tccgccgagc 360gatgaacagc tgaaaagcgg caccgcgagc
gtggtgtgcc tgctgaacaa cttttatccg 420cgcgaagcga aagtgcagtg
gaaagtggat aacgcgctgc agagcggcaa cagccaggaa 480agcgtgaccg
aacaggatag caaagatagc acctatagcc tgagcagcac cctgaccctg
540agcaaagcgg attatgaaaa acataaagtg tatgcgtgcg aagtgaccca
tcagggcctg 600agcagcccgg tgaccaaaag ctttaaccgc taa
6334633DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 4cagatcgtgc tgagccagtc gccggccatc
ctcagcgcga gccccggcga gaaggtcacc 60atgacgtgcc gggccagcag ctcggtgagc
tacatgcact ggtaccagca gaagcccggg 120agcagcccca agccgtggat
ctacgccccc agcaacctgg cctcgggcgt gcccgcgcgc 180ttcagcggga
gcggcagcgg gaccagctac agcctgacca tctcgcgggt cgaggccgag
240gacgccgcca cctactactg ccagcagtgg agcttcaacc cgcccacgtt
cggcgccggc 300accaagctcg agctgaagcg caccgtggcg gcccccagcg
tgttcatctt cccgcccagc 360gacgagcagc tgaagagcgg gaccgcctcg
gtcgtgtgcc tcctgaacaa cttctacccc 420cgggaggcca aggtgcagtg
gaaggtcgac aacgcgctgc agagcggcaa cagccaggag 480agcgtgacgg
agcaggacag caaggacagc acctactcgc tcagcagcac cctgaccctg
540agcaaggccg actacgagaa gcacaaggtg tacgcctgcg aggtcacgca
ccaggggctc 600agctcgcccg tgaccaagag cttcaaccgc tga
63352269DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 5aagcttacca tggccgtgat ggcgccgcgg
accctggtcc tcctgctgag cggcgccctc 60gccctgacgc agacctgggc cgggcaggcc
tacctgcagc agagcggcgc ggagctcgtg 120cggccggggg cctcggtcaa
gatgagctgc aaggccagcg gctacacctt cacgagctac 180aacatgcact
gggtgaagca gaccccgcgc caggggctgg agtggatcgg cgccatctac
240cccgggaacg gcgacaccag ctacaaccag aagttcaagg gcaaggcgac
cctgacggtg 300gacaagtcga gcagcaccgc ctacatgcag ctcagcagcc
tgacctcgga ggacagcgcc 360gtctacttct gcgcccgggt ggtgtactac
agcaacagct actggtactt cgacgtctgg 420gggaccggca cgaccgtgac
cgtgagcggg cccagcgtct tccccctggc cccctcgagc 480aagagcacca
gcggcggcac ggcggccctc gggtgcctgg tgaaggacta cttccccgag
540cccgtgaccg tcagctggaa ctcgggcgcc ctgaccagcg gggtgcacac
cttcccggcc 600gtgctccaga gcagcggcct gtacagcctg agctcggtcg
tgacggtgcc cagcagcagc 660ctcgggaccc agacctacat ctgcaacgtc
aaccacaagc ccagcaacac caaggtggac 720aagaaggcgg agcccaagtc
gtgcgacaag acgcacacct gcccgccctg ccccgccccc 780gagctgctgg
gcggcccgag cgtgttcctc ttcccgccca agcccaagga caccctgatg
840atcagccgca cccccgaggt cacgtgcgtg gtggtcgacg tgagccacga
ggaccccgag 900gtgaagttca actggtacgt cgacggggtg gaggtgcaca
acgccaagac caagccccgg 960gaggagcagt acaacagcac ctaccgcgtc
gtgagcgtgc tgaccgtcct ccaccaggac 1020tggctgaacg gcaaggagta
caagtgcaag gtgtcgaaca aggccctgcc ggcccccatc 1080gagaagacga
tcagcaaggc gaaggggcag ccccgggagc cccaggtgta caccctcccg
1140cccagccgcg acgagctgac caagaaccag gtcagcctga cctgcctcgt
gaagggcttc 1200taccccagcg acatcgccgt ggagtgggag tcgaacgggc
agcccgagaa caactacaag 1260acgaccccgc ccgtcctgga cagcgacggc
agcttcttcc tgtacagcaa gctcaccgtg 1320gacaagagcc ggtggcagca
gggcaacgtg ttcagctgct cggtcatgca cgaggccctg 1380cacaaccact
acacccagaa gagcctgagc ctcagccccg ggaagcatca tcatcatcat
1440cattgaccag atctttctga catttctgac atttctgaca tttctgacat
ttctgacatt 1500tctgacattt ctgacatttc tgacatttct gacatttctg
acatatgcat accatggccg 1560tgatggcgcc gcggaccctg gtcctcctgc
tgagcggcgc cctcgccctg acgcagacct 1620gggccgggca gatcgtgctg
agccagtcgc cggccatcct cagcgcgagc cccggcgaga 1680aggtcaccat
gacgtgccgg gccagcagct cggtgagcta catgcactgg taccagcaga
1740agcccgggag cagccccaag ccgtggatct acgcccccag caacctggcc
tcgggcgtgc 1800ccgcgcgctt cagcgggagc ggcagcggga ccagctacag
cctgaccatc tcgcgggtcg 1860aggccgagga cgccgccacc tactactgcc
agcagtggag cttcaacccg cccacgttcg 1920gcgccggcac caagctcgag
ctgaagcgca ccgtggcggc ccccagcgtg ttcatcttcc 1980cgcccagcga
cgagcagctg aagagcggga ccgcctcggt cgtgtgcctc ctgaacaact
2040tctacccccg ggaggccaag gtgcagtgga aggtcgacaa cgcgctgcag
agcggcaaca 2100gccaggagag cgtgacggag caggacagca aggacagcac
ctactcgctc agcagcaccc 2160tgaccctgag caaggccgac tacgagaagc
acaaggtgta cgcctgcgag gtcacgcacc 2220aggggctcag ctcgcccgtg
accaagagct tcaaccgctg accactagt 226961359DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
6caggtgcagc tgaaacagag cggcccgggc ctggtgcagc cgagccagag cctgagcatt
60acctgcaccg tgagcggctt tagcctgacc aactatggcg tgcattgggt gcgccagagc
120ccgggcaaag gcctggaatg gctgggcgtg atttggagcg gcggcaacac
cgattataac 180accccgttta ccagccgcct gagcattaac aaagataaca
gcaaaagcca ggtgtttttt 240aaaatgaaca gcctgcagag caacgatacc
gcgatttatt attgcgcgcg cgcgctgacc 300tattatgatt atgaatttgc
gtattggggc cagggcaccc tggtgaccgt gagcgcggcg 360agcaccaaag
gcccgagcgt gtttccgctg gcgccgagca gcaaaagcac cagcggcggc
420accgcggcgc tgggctgcct ggtgaaagat tattttccgg aaccggtgac
cgtgagctgg 480aacagcggcg cgctgaccag cggcgtgcat acctttccgg
cggtgctgca gagcagcggc 540ctgtatagcc tgagcagcgt ggtgaccgtg
ccgagcagca gcctgggcac ccagacctat 600atttgcaacg tgaaccataa
accgagcaac accaaagtgg ataaacgcgt ggaaccgaaa 660agcccgaaaa
gctgcgataa aacccatacc tgcccgccgt gcccggcgcc ggaactgctg
720ggcggcccga gcgtgtttct gtttccgccg aaaccgaaag ataccctgat
gattagccgc 780accccggaag tgacctgcgt ggtggtggat gtgagccatg
aagatccgga agtgaaattt 840aactggtatg tggatggcgt ggaagtgcat
aacgcgaaaa ccaaaccgcg cgaagaacag 900tataacagca cctatcgcgt
ggtgagcgtg ctgaccgtgc tgcatcagga ttggctgaac 960ggcaaagaat
ataaatgcaa agtgagcaac aaagcgctgc cggcgccgat tgaaaaaacc
1020attagcaaag cgaaaggcca gccgcgcgaa ccgcaggtgt ataccctgcc
gccgagccgc 1080gatgaactga ccaaaaacca ggtgagcctg acctgcctgg
tgaaaggctt ttatccgagc 1140gatattgcgg tggaatggga aagcaacggc
cagccggaaa acaactataa aaccaccccg 1200ccggtgctgg atagcgatgg
cagctttttt ctgtatagca aactgaccgt ggataaaagc 1260cgctggcagc
agggcaacgt gtttagctgc agcgtgatgc atgaagcgct gcataaccat
1320tatacccaga aaagcctgag cctgagcccg ggcaaataa
135971359DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 7caggtgcagc tgaagcagag cggcccgggg
ctcgtccagc cctcgcagag cctgagcatc 60acctgcacgg tgagcggctt cagcctgacc
aactacgggg tgcactgggt ccggcagtcg 120cccggcaagg ggctcgagtg
gctgggcgtg atctggagcg gcgggaacac cgactacaac 180acccccttca
cgagccgcct gagcatcaac aaggacaaca gcaagtcgca ggtgttcttc
240aagatgaaca gcctccagag caacgacacc gccatctact actgcgcgcg
ggccctgacc 300tactacgact acgagttcgc ctactggggc caggggaccc
tggtcacggt gagcgccgcg 360agcaccaagg gcccgagcgt gttccccctc
gccccctcga gcaagagcac cagcggcggg 420accgccgccc tgggctgcct
ggtcaaggac tacttccccg agccggtgac ggtgagctgg 480aactcggggg
ccctcaccag cggcgtccac accttccccg cggtgctgca gagcagcggg
540ctgtacagcc tcagctcggt ggtcaccgtg cccagcagca gcctgggcac
gcagacctac 600atctgcaacg tgaaccacaa gcccagcaac accaaggtcg
acaagcgcgt ggagccgaag 660tcgcccaaga gctgcgacaa gacccacacg
tgcccgccct gccccgcccc cgagctgctc 720ggcgggccca gcgtgttcct
gttcccgccc aagcccaagg acaccctgat gatcagccgg 780acccccgagg
tcacctgcgt ggtggtcgac gtgagccacg aggacccgga ggtgaagttc
840aactggtacg tcgacggcgt ggaggtgcac aacgccaaga cgaagccccg
cgaggagcag 900tacaacagca cctaccgggt cgtgtcggtg ctcaccgtcc
tgcaccagga ctggctgaac 960gggaaggagt acaagtgcaa ggtgagcaac
aaggccctcc ccgcgcccat cgagaagacc 1020atcagcaagg ccaagggcca
gccgcgcgag ccccaggtgt acacgctgcc ccccagccgg 1080gacgagctga
ccaagaacca ggtcagcctc acctgcctgg tgaaggggtt ctacccgtcg
1140gacatcgccg tggagtggga gagcaacggc cagcccgaga acaactacaa
gaccacgccc 1200ccggtcctgg acagcgacgg cagcttcttc ctctacagca
agctgaccgt ggacaagagc 1260cgctggcagc aggggaacgt gttctcgtgc
agcgtcatgc acgaggccct gcacaaccac 1320tacacccaga agagcctcag
cctgagcccc ggcaagtga 13598642DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 8gatattctgc tgacccagag
cccggtgatt ctgagcgtga gcccgggcga acgcgtgagc 60tttagctgcc gcgcgagcca
gagcattggc accaacattc attggtatca gcagcgcacc 120aacggcagcc
cgcgcctgct gattaaatat gcgagcgaaa gcattagcgg cattccgagc
180cgctttagcg gcagcggcag cggcaccgat tttaccctga gcattaacag
cgtggaaagc 240gaagatattg cggattatta ttgccagcag aacaacaact
ggccgaccac ctttggcgcg 300ggcaccaaac tggaactgaa acgcaccgtg
gcggcgccga gcgtgtttat ttttccgccg 360agcgatgaac agctgaaaag
cggcaccgcg agcgtggtgt gcctgctgaa caacttttat 420ccgcgcgaag
cgaaagtgca gtggaaagtg gataacgcgc tgcagagcgg caacagccag
480gaaagcgtga ccgaacagga tagcaaagat agcacctata gcctgagcag
caccctgacc 540ctgagcaaag cggattatga aaaacataaa gtgtatgcgt
gcgaagtgac ccatcagggc 600ctgagcagcc cggtgaccaa aagctttaac
cgcggcgcgt aa 6429642DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 9gacatcctgc tcacccagag
cccggtgatc ctgtcggtca gccccggcga gcgggtgagc 60ttcagctgcc gcgccagcca
gtcgatcggg acgaacatcc actggtacca gcagcggacc 120aacggcagcc
cccgcctgct catcaagtac gcgagcgaga gcatcagcgg gatcccctcg
180cggttcagcg gcagcgggag cggcaccgac ttcaccctga gcatcaacag
cgtggagtcg 240gaggacatcg ccgactacta ctgccagcag aacaacaact
ggccgacgac cttcggcgcc 300gggaccaagc tggagctcaa gcgcaccgtc
gccgcgccca gcgtgttcat cttcccgccc 360agcgacgagc agctgaagag
cggcacggcc agcgtggtct gcctgctcaa caacttctac 420ccccgggagg
ccaaggtgca gtggaaggtg gacaacgccc tgcagtcggg gaacagccag
480gagagcgtca ccgagcagga cagcaaggac agcacctaca gcctgtcgag
caccctcacg 540ctgagcaagg ccgactacga gaagcacaag gtgtacgcgt
gcgaggtgac ccaccagggc 600ctgagcagcc ccgtcaccaa gtcgttcaac
cgcggcgcct ga 642102293DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 10aagcttacca
tggccgtgat ggcgccgcgg accctggtcc tcctgctgag cggcgccctc 60gccctgacgc
agacctgggc cgggcaggtg cagctgaagc agagcggccc ggggctcgtc
120cagccctcgc agagcctgag catcacctgc acggtgagcg gcttcagcct
gaccaactac 180ggggtgcact gggtccggca gtcgcccggc aaggggctcg
agtggctggg cgtgatctgg 240agcggcggga acaccgacta caacaccccc
ttcacgagcc gcctgagcat caacaaggac 300aacagcaagt cgcaggtgtt
cttcaagatg aacagcctcc agagcaacga caccgccatc 360tactactgcg
cgcgggccct gacctactac gactacgagt tcgcctactg gggccagggg
420accctggtca cggtgagcgc cgcgagcacc aagggcccga gcgtgttccc
cctcgccccc 480tcgagcaaga gcaccagcgg cgggaccgcc gccctgggct
gcctggtcaa ggactacttc 540cccgagccgg tgacggtgag ctggaactcg
ggggccctca ccagcggcgt ccacaccttc 600cccgcggtgc tgcagagcag
cgggctgtac agcctcagct cggtggtcac cgtgcccagc 660agcagcctgg
gcacgcagac ctacatctgc aacgtgaacc acaagcccag caacaccaag
720gtcgacaagc gcgtggagcc gaagtcgccc aagagctgcg acaagaccca
cacgtgcccg 780ccctgccccg cccccgagct gctcggcggg cccagcgtgt
tcctgttccc gcccaagccc 840aaggacaccc tgatgatcag ccggaccccc
gaggtcacct gcgtggtggt cgacgtgagc 900cacgaggacc cggaggtgaa
gttcaactgg tacgtcgacg gcgtggaggt gcacaacgcc 960aagacgaagc
cccgcgagga gcagtacaac agcacctacc gggtcgtgtc ggtgctcacc
1020gtcctgcacc aggactggct gaacgggaag gagtacaagt gcaaggtgag
caacaaggcc 1080ctccccgcgc ccatcgagaa gaccatcagc aaggccaagg
gccagccgcg cgagccccag 1140gtgtacacgc tgccccccag ccgggacgag
ctgaccaaga accaggtcag cctcacctgc 1200ctggtgaagg ggttctaccc
gtcggacatc gccgtggagt gggagagcaa cggccagccc 1260gagaacaact
acaagaccac gcccccggtc ctggacagcg acggcagctt cttcctctac
1320agcaagctga ccgtggacaa gagccgctgg cagcagggga acgtgttctc
gtgcagcgtc 1380atgcacgagg ccctgcacaa ccactacacc cagaagagcc
tcagcctgag ccccggcaag 1440catcatcatc atcatcattg accagatctt
tctgacattt ctgacatttc tgacatttct 1500gacatttctg acatttctga
catttctgac atttctgaca tttctgacat ttctgacata 1560tgcataccat
ggccgtgatg gcgccgcgga ccctggtcct cctgctgagc ggcgccctcg
1620ccctgacgca gacctgggcc ggggacatcc tgctcaccca gagcccggtg
atcctgtcgg 1680tcagccccgg cgagcgggtg agcttcagct gccgcgccag
ccagtcgatc gggacgaaca 1740tccactggta ccagcagcgg accaacggca
gcccccgcct gctcatcaag tacgcgagcg 1800agagcatcag cgggatcccc
tcgcggttca gcggcagcgg gagcggcacc gacttcaccc 1860tgagcatcaa
cagcgtggag tcggaggaca tcgccgacta ctactgccag cagaacaaca
1920actggccgac gaccttcggc gccgggacca agctggagct caagcgcacc
gtcgccgcgc 1980ccagcgtgtt catcttcccg cccagcgacg agcagctgaa
gagcggcacg gccagcgtgg 2040tctgcctgct caacaacttc tacccccggg
aggccaaggt gcagtggaag gtggacaacg 2100ccctgcagtc ggggaacagc
caggagagcg tcaccgagca ggacagcaag gacagcacct 2160acagcctgtc
gagcaccctc acgctgagca aggccgacta cgagaagcac aaggtgtacg
2220cgtgcgaggt gacccaccag ggcctgagca gccccgtcac caagtcgttc
aaccgcggcg 2280cctgaccact agt 2293111356DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
11gaagtgcagc tggtggaaag cggcggcggc ctggtgcagc cgggcggcag cctgcgcctg
60agctgcgcgg cgagcggctt taacattaaa gatacctata ttcattgggt gcgccaggcg
120ccgggcaaag gcctggaatg ggtggcgcgc atttatccga ccaacggcta
tacccgctat 180gcggatagcg tgaaaggccg ctttaccatt agcgcggata
ccagcaaaaa caccgcgtat 240ctgcagatga acagcctgcg cgcggaagat
accgcggtgt attattgcag ccgctggggc 300ggcgatggct tttatgcgat
ggattattgg ggccagggca ccctggtgac cgtgagcagc 360gcgagcacca
aaggcccgag cgtgtttccg ctggcgccga gcagcaaaag caccagcggc
420ggcaccgcgg cgctgggctg cctggtgaaa gattattttc cggaaccggt
gaccgtgagc 480tggaacagcg gcgcgctgac cagcggcgtg catacctttc
cggcggtgct gcagagcagc 540ggcctgtata gcctgagcag cgtggtgacc
gtgccgagca gcagcctggg cacccagacc 600tatatttgca acgtgaacca
taaaccgagc aacaccaaag tggataaaaa agtggaaccg 660ccgaaaagct
gcgataaaac ccatacctgc ccgccgtgcc cggcgccgga actgctgggc
720ggcccgagcg tgtttctgtt tccgccgaaa ccgaaagata ccctgatgat
tagccgcacc 780ccggaagtga cctgcgtggt ggtggatgtg agccatgaag
atccggaagt gaaatttaac 840tggtatgtgg atggcgtgga agtgcataac
gcgaaaacca aaccgcgcga agaacagtat 900aacagcacct atcgcgtggt
gagcgtgctg accgtgctgc atcaggattg gctgaacggc 960aaagaatata
aatgcaaagt gagcaacaaa gcgctgccgg cgccgattga aaaaaccatt
1020agcaaagcga aaggccagcc gcgcgaaccg caggtgtata ccctgccgcc
gagccgcgat 1080gaactgacca aaaaccaggt gagcctgacc tgcctggtga
aaggctttta tccgagcgat 1140attgcggtgg aatgggaaag caacggccag
ccggaaaaca actataaaac caccccgccg 1200gtgctggata gcgatggcag
cttttttctg tatagcaaac tgaccgtgga taaaagccgc 1260tggcagcagg
gcaacgtgtt tagctgcagc gtgatgcatg aagcgctgca taaccattat
1320acccagaaaa gcctgagcct gagcccgggc aaataa
1356121356DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 12gaggtgcagc tggtcgagag cggcgggggc
ctcgtgcagc cgggcgggtc gctgcggctg 60agctgcgccg cgagcgggtt caacatcaag
gacacctaca tccactgggt gcgccaggcc 120cccggcaagg gcctcgagtg
ggtcgcccgg atctacccca cgaacgggta cacccgctac 180gccgacagcg
tgaagggccg gttcaccatc agcgcggaca cctcgaagaa cacggcctac
240ctgcagatga acagcctgcg cgccgaggac accgccgtgt actactgcag
ccggtggggc 300ggcgacgggt tctacgccat ggactactgg gggcagggca
ccctcgtcac cgtgagcagc 360gcgtcgacga aggggcccag cgtgttcccg
ctggccccca gcagcaagag caccagcggc 420gggaccgccg ccctgggctg
cctcgtcaag gactacttcc ccgagcccgt gaccgtgtcg 480tggaacagcg
gcgcgctgac gagcggggtc cacaccttcc cggccgtgct gcagagcagc
540ggcctctact cgctgagcag cgtggtcacc gtgcccagca gcagcctggg
gacccagacg 600tacatctgca acgtgaacca caagccctcg aacaccaagg
tcgacaagaa ggtggagccc 660ccgaagagct gcgacaagac ccacacctgc
ccgccctgcc ccgcccccga gctcctgggc 720gggcccagcg tgttcctgtt
cccgcccaag cccaaggaca cgctcatgat cagccgcacc 780cccgaggtca
cctgcgtggt ggtcgacgtg agccacgagg accccgaggt gaagttcaac
840tggtacgtcg acggcgtgga ggtgcacaac gccaagacca agccgcggga
ggagcagtac 900aactcgacgt accgcgtcgt gagcgtgctg accgtcctgc
accaggactg gctcaacggc 960aaggagtaca agtgcaaggt gagcaacaag
gccctgcccg cgcccatcga gaagaccatc 1020agcaaggcca aggggcagcc
ccgggagccg caggtgtaca ccctgccccc cagccgcgac 1080gagctcacga
agaaccaggt cagcctgacc tgcctggtga agggcttcta cccctcggac
1140atcgccgtgg agtgggagag caacgggcag ccggagaaca actacaagac
caccccgccc 1200gtcctcgaca gcgacggcag cttcttcctg tacagcaagc
tgacggtgga caagtcgcgg 1260tggcagcagg gcaacgtgtt cagctgcagc
gtcatgcacg aggccctcca caaccactac 1320acccagaaga gcctgagcct
gagccccggg aagtga 135613645DNAArtificial SequenceDescription of
Artificial Sequence Synthetic polynucleotide 13gatattcaga
tgacccagag cccgagcagc ctgagcgcga gcgtgggcga tcgcgtgacc 60attacctgcc
gcgcgagcca ggatgtgaac accgcggtgg cgtggtatca gcagaaaccg
120ggcaaagcgc cgaaactgct gatttatagc gcgagctttc tgtatagcgg
cgtgccgagc 180cgctttagcg gcagccgcag cggcaccgat tttaccctga
ccattagcag cctgcagccg 240gaagattttg cgacctatta ttgccagcag
cattatacca ccccgccgac ctttggccag 300ggcaccaaag tggaaattaa
acgcaccgtg gcggcgccga gcgtgtttat ttttccgccg 360agcgatgaac
agctgaaaag cggcaccgcg agcgtggtgt gcctgctgaa caacttttat
420ccgcgcgaag cgaaagtgca gtggaaagtg gataacgcgc tgcagagcgg
caacagccag 480gaaagcgtga ccgaacagga tagcaaagat agcacctata
gcctgagcag caccctgacc 540ctgagcaaag cggattatga aaaacataaa
gtgtatgcgt gcgaagtgac ccatcagggc 600ctgagcagcc cggtgaccaa
aagctttaac cgcggcgaat gctaa 64514645DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
14gacatccaga tgacccagag cccgtcgagc ctgagcgcca gcgtgggcga ccgggtcacg
60atcacctgcc gcgcgagcca ggacgtgaac accgccgtgg cctggtacca gcagaagccc
120gggaaggccc ccaagctcct gatctactcg gcgagcttcc tgtacagcgg
cgtccccagc 180cggttcagcg ggtcgcgcag cggcaccgac ttcacgctca
ccatcagcag cctgcagccg 240gaggacttcg ccacctacta ctgccagcag
cactacacca cgccccccac cttcgggcag 300ggcaccaagg tggagatcaa
gcggaccgtg gccgccccca gcgtcttcat cttcccgccc 360agcgacgagc
agctgaagtc gggcacggcc agcgtggtgt gcctcctgaa caacttctac
420ccccgcgagg cgaaggtcca gtggaaggtg gacaacgccc tgcagagcgg
gaacagccag 480gagagcgtga ccgagcagga ctcgaaggac agcacctaca
gcctcagcag caccctgacg 540ctgagcaagg ccgactacga gaagcacaag
gtctacgcct gcgaggtgac ccaccagggg 600ctctcgagcc ccgtgaccaa
gagcttcaac cggggcgagt gctga 645152295DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
15aagcttacca tggccgtgat ggcgccgcgg accctggtcc tcctgctgag cggcgccctc
60gccctgacgc agacctgggc cggggaggtg cagctggtcg agagcggcgg gggcctcgtg
120cagccgggcg ggtcgctgcg gctgagctgc gccgcgagcg ggttcaacat
caaggacacc 180tacatccact gggtgcgcca ggcccccggc aagggcctcg
agtgggtcgc ccggatctac 240cccacgaacg ggtacacccg ctacgccgac
agcgtgaagg gccggttcac catcagcgcg 300gacacctcga agaacacggc
ctacctgcag atgaacagcc tgcgcgccga ggacaccgcc 360gtgtactact
gcagccggtg gggcggcgac gggttctacg ccatggacta ctgggggcag
420ggcaccctcg tcaccgtgag cagcgcgtcg acgaaggggc ccagcgtgtt
cccgctggcc 480cccagcagca agagcaccag cggcgggacc gccgccctgg
gctgcctcgt caaggactac 540ttccccgagc ccgtgaccgt gtcgtggaac
agcggcgcgc tgacgagcgg ggtccacacc 600ttcccggccg tgctgcagag
cagcggcctc tactcgctga gcagcgtggt caccgtgccc 660agcagcagcc
tggggaccca gacgtacatc tgcaacgtga accacaagcc ctcgaacacc
720aaggtcgaca agaaggtgga gcccccgaag agctgcgaca agacccacac
ctgcccgccc 780tgccccgccc ccgagctcct gggcgggccc agcgtgttcc
tgttcccgcc caagcccaag 840gacacgctca tgatcagccg cacccccgag
gtcacctgcg tggtggtcga cgtgagccac 900gaggaccccg aggtgaagtt
caactggtac gtcgacggcg tggaggtgca caacgccaag 960accaagccgc
gggaggagca gtacaactcg acgtaccgcg tcgtgagcgt gctgaccgtc
1020ctgcaccagg actggctcaa cggcaaggag tacaagtgca aggtgagcaa
caaggccctg 1080cccgcgccca tcgagaagac catcagcaag gccaaggggc
agccccggga gccgcaggtg 1140tacaccctgc cccccagccg cgacgagctc
acgaagaacc aggtcagcct gacctgcctg 1200gtgaagggct tctacccctc
ggacatcgcc gtggagtggg agagcaacgg gcagccggag 1260aacaactaca
agaccacccc gcccgtcctc gacagcgacg gcagcttctt cctgtacagc
1320aagctgacgg tggacaagtc gcggtggcag cagggcaacg tgttcagctg
cagcgtcatg 1380cacgaggccc tccacaacca ctacacccag aagagcctga
gcctgagccc cgggaagcat 1440catcatcatc atcattgacc agatctttct
gacatttctg acatttctga catttctgac 1500atttctgaca tttctgacat
ttctgacatt tctgacattt ctgacatttc tgacatatgc 1560ataccatggc
cgtgatggcg ccgcggaccc tggtcctcct gctgagcggc gccctcgccc
1620tgacgcagac ctgggccggg gacatccaga tgacccagag cccgtcgagc
ctgagcgcca 1680gcgtgggcga ccgggtcacg atcacctgcc gcgcgagcca
ggacgtgaac accgccgtgg 1740cctggtacca gcagaagccc gggaaggccc
ccaagctcct gatctactcg gcgagcttcc 1800tgtacagcgg cgtccccagc
cggttcagcg ggtcgcgcag cggcaccgac ttcacgctca 1860ccatcagcag
cctgcagccg gaggacttcg ccacctacta ctgccagcag cactacacca
1920cgccccccac cttcgggcag ggcaccaagg tggagatcaa gcggaccgtg
gccgccccca 1980gcgtcttcat cttcccgccc agcgacgagc agctgaagtc
gggcacggcc agcgtggtgt 2040gcctcctgaa caacttctac ccccgcgagg
cgaaggtcca gtggaaggtg gacaacgccc 2100tgcagagcgg gaacagccag
gagagcgtga ccgagcagga ctcgaaggac agcacctaca 2160gcctcagcag
caccctgacg ctgagcaagg ccgactacga gaagcacaag gtctacgcct
2220gcgaggtgac ccaccagggg ctctcgagcc ccgtgaccaa gagcttcaac
cggggcgagt 2280gctgatgacc actag 22951613RNAArtificial
SequenceDescription of Artificial Sequence Synthetic kozak-sequence
oligonucleotide 16gccgccacca ugg 131715DNAArtificial
SequenceDescription of Artificial Sequence Synthetic generic
stabilizing oligonucleotide 17nccancccnn ucncc 15184PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 18Lys
Asp Glu Leu 1 194PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 19Asp Asp Glu Leu 1 204PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 20Asp
Glu Glu Leu 1 214PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 21Gln Glu Asp Leu 1 224PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 22Arg
Asp Glu Leu 1 237PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 23Pro Lys Lys Lys Arg Lys Val 1 5
247PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 24Pro Gln Lys Lys Ile Lys Ser 1 5
255PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 25Gln Pro Lys Lys Pro 1 5 264PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 26Arg
Lys Lys Arg 1 2712PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 27Arg Lys Lys Arg Arg Gln Arg Arg Arg
Ala His Gln 1 5 10 2816PRTArtificial SequenceDescription of
Artificial Sequence Synthetic peptide 28Arg Gln Ala Arg Arg Asn Arg
Arg Arg Arg Trp Arg Glu Arg Gln Arg 1 5 10 15 2919PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 29Met
Pro Leu Thr Arg Arg Arg Pro Ala Ala Ser Gln Ala Leu Ala Pro 1 5 10
15 Pro Thr Pro 3015PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 30Met Asp Asp Gln Arg Asp Leu Ile Ser
Asn Asn Glu Gln Leu Pro 1 5 10 15 3132PRTArtificial
SequenceDescription of Artificial Sequence Synthetic polypeptide
31Met Leu Phe Asn Leu Arg Xaa Xaa Leu Asn Asn Ala Ala Phe Arg His 1
5 10 15 Gly His Asn Phe Met Val Arg Asn Phe Arg Cys Gly Gln Pro Leu
Xaa 20 25 30 328PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 32Gly Cys Val Cys Ser Ser Asn Pro 1 5
338PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 33Gly Gln Thr Val Thr Thr Pro Leu 1 5
348PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 34Gly Gln Glu Leu Ser Gln His Glu 1 5
358PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 35Gly Asn Ser Pro Ser Tyr Asn Pro 1 5
368PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 36Gly Val Ser Gly Ser Lys Gly Gln 1 5
378PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 37Gly Gln Thr Ile Thr Thr Pro Leu 1 5
388PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 38Gly Gln Thr Leu Thr Thr Pro Leu 1 5
398PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 39Gly Gln Ile Phe Ser Arg Ser Ala 1 5
408PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 40Gly Gln Ile His Gly Leu Ser Pro 1 5
418PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 41Gly Ala Arg Ala Ser Val Leu Ser 1 5
428PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 42Gly Cys Thr Leu Ser Ala Glu Glu 1 5
438PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 43Gly Gln Asn Leu Ser Thr Ser Asn 1 5
448PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 44Gly Ala Ala Leu Thr Ile Leu Val 1 5
458PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 45Gly Ala Ala Leu Thr Leu Leu Gly 1 5
468PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 46Gly Ala Gln Val Ser Ser Gln Lys 1 5
478PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 47Gly Ala Gln Leu Ser Arg Asn Thr 1 5
488PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 48Gly Asn Ala Ala Ala Ala Lys Lys 1 5
498PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 49Gly Asn Glu Ala Ser Tyr Pro Leu 1 5
508PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 50Gly Ser Ser Lys Ser Lys Pro Lys 1 5
512269DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 51aagcttacca tggccgtgat ggcgccgcgg
accctggtcc tcctgctgag cggcgccctc 60gccctgacgc agacctgggc cgggcaggcc
tacctgcagc agagcggcgc ggagctcgtg 120cggccggggg cctcggtcaa
gatgagctgc aaggccagcg gctacacctt cacgagctac 180aacatgcact
gggtgaagca gaccccgcgc caggggctgg agtggatcgg cgccatctac
240cccgggaacg gcgacaccag ctacaaccag aagttcaagg gcaaggcgac
cctgacggtg 300gacaagtcga gcagcaccgc ctacatgcag ctcagcagcc
tgacctcgga ggacagcgcc 360gtctacttct gcgcccgggt ggtgtactac
agcaacagct actggtactt cgacgtctgg 420gggaccggca cgaccgtgac
cgtgagcggg cccagcgtct tccccctggc cccctcgagc 480aagagcacca
gcggcggcac ggcggccctc gggtgcctgg tgaaggacta cttccccgag
540cccgtgaccg tcagctggaa ctcgggcgcc ctgaccagcg gggtgcacac
cttcccggcc 600gtgctccaga gcagcggcct gtacagcctg agctcggtcg
tgacggtgcc cagcagcagc 660ctcgggaccc agacctacat ctgcaacgtc
aaccacaagc ccagcaacac caaggtggac 720aagaaggcgg agcccaagtc
gtgcgacaag acgcacacct gcccgccctg ccccgccccc 780gagctgctgg
gcggcccgag cgtgttcctc ttcccgccca agcccaagga caccctgatg
840atcagccgca cccccgaggt cacgtgcgtg gtggtcgacg tgagccacga
ggaccccgag 900gtgaagttca actggtacgt cgacggggtg gaggtgcaca
acgccaagac caagccccgg 960gaggagcagt acaacagcac ctaccgcgtc
gtgagcgtgc tgaccgtcct ccaccaggac 1020tggctgaacg gcaaggagta
caagtgcaag gtgtcgaaca aggccctgcc ggcccccatc 1080gagaagacga
tcagcaaggc gaaggggcag ccccgggagc cccaggtgta caccctcccg
1140cccagccgcg acgagctgac caagaaccag gtcagcctga cctgcctcgt
gaagggcttc 1200taccccagcg acatcgccgt ggagtgggag tcgaacgggc
agcccgagaa caactacaag 1260acgaccccgc ccgtcctgga cagcgacggc
agcttcttcc tgtacagcaa gctcaccgtg 1320gacaagagcc ggtggcagca
gggcaacgtg ttcagctgct cggtcatgca cgaggccctg 1380cacaaccact
acacccagaa gagcctgagc ctcagccccg ggaagcatca tcatcatcat
1440cattgaccat gcatttctga catttctgac atttctgaca tttctgacat
ttctgacatt 1500tctgacattt ctgacatttc tgacatttct gacatttctg
acatagatct accatggccg 1560tgatggcgcc gcggaccctg gtcctcctgc
tgagcggcgc cctcgccctg acgcagacct 1620gggccgggca gatcgtgctg
agccagtcgc cggccatcct cagcgcgagc cccggcgaga 1680aggtcaccat
gacgtgccgg gccagcagct cggtgagcta catgcactgg taccagcaga
1740agcccgggag cagccccaag ccgtggatct acgcccccag caacctggcc
tcgggcgtgc 1800ccgcgcgctt cagcgggagc ggcagcggga ccagctacag
cctgaccatc tcgcgggtcg 1860aggccgagga cgccgccacc tactactgcc
agcagtggag cttcaacccg cccacgttcg 1920gcgccggcac caagctcgag
ctgaagcgca ccgtggcggc ccccagcgtg ttcatcttcc 1980cgcccagcga
cgagcagctg aagagcggga ccgcctcggt cgtgtgcctc ctgaacaact
2040tctacccccg ggaggccaag gtgcagtgga aggtcgacaa cgcgctgcag
agcggcaaca 2100gccaggagag cgtgacggag caggacagca aggacagcac
ctactcgctc agcagcaccc 2160tgaccctgag caaggccgac tacgagaagc
acaaggtgta cgcctgcgag gtcacgcacc 2220aggggctcag ctcgcccgtg
accaagagct tcaaccgctg accactagt 2269522293DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
52aagcttacca tggccgtgat ggcgccgcgg accctggtcc tcctgctgag cggcgccctc
60gccctgacgc agacctgggc cgggcaggtg cagctgaagc agagcggccc ggggctcgtc
120cagccctcgc agagcctgag catcacctgc acggtgagcg gcttcagcct
gaccaactac 180ggggtgcact gggtccggca gtcgcccggc aaggggctcg
agtggctggg cgtgatctgg 240agcggcggga acaccgacta caacaccccc
ttcacgagcc gcctgagcat caacaaggac 300aacagcaagt cgcaggtgtt
cttcaagatg aacagcctcc agagcaacga caccgccatc 360tactactgcg
cgcgggccct gacctactac gactacgagt tcgcctactg gggccagggg
420accctggtca cggtgagcgc cgcgagcacc aagggcccga gcgtgttccc
cctcgccccc 480tcgagcaaga gcaccagcgg cgggaccgcc gccctgggct
gcctggtcaa ggactacttc 540cccgagccgg tgacggtgag ctggaactcg
ggggccctca ccagcggcgt ccacaccttc 600cccgcggtgc tgcagagcag
cgggctgtac agcctcagct cggtggtcac cgtgcccagc 660agcagcctgg
gcacgcagac ctacatctgc aacgtgaacc acaagcccag caacaccaag
720gtcgacaagc gcgtggagcc gaagtcgccc aagagctgcg acaagaccca
cacgtgcccg 780ccctgccccg cccccgagct gctcggcggg cccagcgtgt
tcctgttccc gcccaagccc 840aaggacaccc tgatgatcag ccggaccccc
gaggtcacct gcgtggtggt cgacgtgagc 900cacgaggacc cggaggtgaa
gttcaactgg tacgtcgacg gcgtggaggt gcacaacgcc 960aagacgaagc
cccgcgagga gcagtacaac agcacctacc gggtcgtgtc ggtgctcacc
1020gtcctgcacc aggactggct gaacgggaag gagtacaagt gcaaggtgag
caacaaggcc 1080ctccccgcgc ccatcgagaa gaccatcagc aaggccaagg
gccagccgcg cgagccccag 1140gtgtacacgc tgccccccag ccgggacgag
ctgaccaaga accaggtcag cctcacctgc 1200ctggtgaagg ggttctaccc
gtcggacatc gccgtggagt gggagagcaa cggccagccc 1260gagaacaact
acaagaccac gcccccggtc ctggacagcg acggcagctt cttcctctac
1320agcaagctga ccgtggacaa gagccgctgg cagcagggga acgtgttctc
gtgcagcgtc 1380atgcacgagg ccctgcacaa ccactacacc cagaagagcc
tcagcctgag ccccggcaag 1440catcatcatc atcatcattg accatgcatt
tctgacattt ctgacatttc tgacatttct 1500gacatttctg acatttctga
catttctgac atttctgaca tttctgacat ttctgacata 1560gatctaccat
ggccgtgatg gcgccgcgga ccctggtcct cctgctgagc ggcgccctcg
1620ccctgacgca gacctgggcc ggggacatcc tgctcaccca gagcccggtg
atcctgtcgg 1680tcagccccgg cgagcgggtg agcttcagct gccgcgccag
ccagtcgatc gggacgaaca 1740tccactggta ccagcagcgg accaacggca
gcccccgcct gctcatcaag tacgcgagcg 1800agagcatcag cgggatcccc
tcgcggttca gcggcagcgg gagcggcacc gacttcaccc 1860tgagcatcaa
cagcgtggag tcggaggaca tcgccgacta ctactgccag cagaacaaca
1920actggccgac gaccttcggc gccgggacca agctggagct caagcgcacc
gtcgccgcgc 1980ccagcgtgtt catcttcccg cccagcgacg agcagctgaa
gagcggcacg gccagcgtgg 2040tctgcctgct caacaacttc tacccccggg
aggccaaggt gcagtggaag gtggacaacg 2100ccctgcagtc ggggaacagc
caggagagcg tcaccgagca ggacagcaag gacagcacct 2160acagcctgtc
gagcaccctc acgctgagca aggccgacta cgagaagcac aaggtgtacg
2220cgtgcgaggt gacccaccag ggcctgagca gccccgtcac caagtcgttc
aaccgcggcg 2280cctgaccact agt 2293532295DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
53aagcttacca tggccgtgat ggcgccgcgg accctggtcc tcctgctgag cggcgccctc
60gccctgacgc agacctgggc cggggaggtg cagctggtcg agagcggcgg
gggcctcgtg
120cagccgggcg ggtcgctgcg gctgagctgc gccgcgagcg ggttcaacat
caaggacacc 180tacatccact gggtgcgcca ggcccccggc aagggcctcg
agtgggtcgc ccggatctac 240cccacgaacg ggtacacccg ctacgccgac
agcgtgaagg gccggttcac catcagcgcg 300gacacctcga agaacacggc
ctacctgcag atgaacagcc tgcgcgccga ggacaccgcc 360gtgtactact
gcagccggtg gggcggcgac gggttctacg ccatggacta ctgggggcag
420ggcaccctcg tcaccgtgag cagcgcgtcg acgaaggggc ccagcgtgtt
cccgctggcc 480cccagcagca agagcaccag cggcgggacc gccgccctgg
gctgcctcgt caaggactac 540ttccccgagc ccgtgaccgt gtcgtggaac
agcggcgcgc tgacgagcgg ggtccacacc 600ttcccggccg tgctgcagag
cagcggcctc tactcgctga gcagcgtggt caccgtgccc 660agcagcagcc
tggggaccca gacgtacatc tgcaacgtga accacaagcc ctcgaacacc
720aaggtcgaca agaaggtgga gcccccgaag agctgcgaca agacccacac
ctgcccgccc 780tgccccgccc ccgagctcct gggcgggccc agcgtgttcc
tgttcccgcc caagcccaag 840gacacgctca tgatcagccg cacccccgag
gtcacctgcg tggtggtcga cgtgagccac 900gaggaccccg aggtgaagtt
caactggtac gtcgacggcg tggaggtgca caacgccaag 960accaagccgc
gggaggagca gtacaactcg acgtaccgcg tcgtgagcgt gctgaccgtc
1020ctgcaccagg actggctcaa cggcaaggag tacaagtgca aggtgagcaa
caaggccctg 1080cccgcgccca tcgagaagac catcagcaag gccaaggggc
agccccggga gccgcaggtg 1140tacaccctgc cccccagccg cgacgagctc
acgaagaacc aggtcagcct gacctgcctg 1200gtgaagggct tctacccctc
ggacatcgcc gtggagtggg agagcaacgg gcagccggag 1260aacaactaca
agaccacccc gcccgtcctc gacagcgacg gcagcttctt cctgtacagc
1320aagctgacgg tggacaagtc gcggtggcag cagggcaacg tgttcagctg
cagcgtcatg 1380cacgaggccc tccacaacca ctacacccag aagagcctga
gcctgagccc cgggaagcat 1440catcatcatc atcattgacc atgcatttct
gacatttctg acatttctga catttctgac 1500atttctgaca tttctgacat
ttctgacatt tctgacattt ctgacatttc tgacatagat 1560ctaccatggc
cgtgatggcg ccgcggaccc tggtcctcct gctgagcggc gccctcgccc
1620tgacgcagac ctgggccggg gacatccaga tgacccagag cccgtcgagc
ctgagcgcca 1680gcgtgggcga ccgggtcacg atcacctgcc gcgcgagcca
ggacgtgaac accgccgtgg 1740cctggtacca gcagaagccc gggaaggccc
ccaagctcct gatctactcg gcgagcttcc 1800tgtacagcgg cgtccccagc
cggttcagcg ggtcgcgcag cggcaccgac ttcacgctca 1860ccatcagcag
cctgcagccg gaggacttcg ccacctacta ctgccagcag cactacacca
1920cgccccccac cttcgggcag ggcaccaagg tggagatcaa gcggaccgtg
gccgccccca 1980gcgtcttcat cttcccgccc agcgacgagc agctgaagtc
gggcacggcc agcgtggtgt 2040gcctcctgaa caacttctac ccccgcgagg
cgaaggtcca gtggaaggtg gacaacgccc 2100tgcagagcgg gaacagccag
gagagcgtga ccgagcagga ctcgaaggac agcacctaca 2160gcctcagcag
caccctgacg ctgagcaagg ccgactacga gaagcacaag gtctacgcct
2220gcgaggtgac ccaccagggg ctctcgagcc ccgtgaccaa gagcttcaac
cggggcgagt 2280gctgatgacc actag 229554200DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
54cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc
60cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc
120cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc
cccccccccc 180cccccccccc cccccccccc 20055100DNAArtificial
SequenceDescription of Artificial Sequence Synthetic polynucleotide
55cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc cccccccccc
60cccccccccc cccccccccc cccccccccc cccccccccc 1005670DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 56cccccccccc cccccccccc cccccccccc cccccccccc
cccccccccc cccccccccc 60cccccccccc 705760DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 57cccccccccc cccccccccc cccccccccc cccccccccc
cccccccccc cccccccccc 605840DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 58cccccccccc
cccccccccc cccccccccc cccccccccc 40596PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6xHis tag
59His His His His His His 1 5 6018DNAArtificial SequenceDescription
of Artificial Sequence Synthetic oligonucleotide 60catcatcatc
atcatcat 186175DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 61atggccgtga tggcgccgcg
gaccctggtc ctcctgctga gcggcgccct cgccctgacg 60cagacctggg ccggg
7562200DNAArtificial SequenceDescription of Artificial Sequence
Synthetic polynucleotide 62aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 120aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 180aaaaaaaaaa
aaaaaaaaaa 200
* * * * *