U.S. patent application number 13/302819 was filed with the patent office on 2013-07-18 for methods and/or use of oligonucleotide conjugates having varied degrees of labeling for assays and detections.
This patent application is currently assigned to The University of Chicago. The applicant listed for this patent is William B. Busa, Amy Catherine Flor, Stephen J. Kron, David A. Schwartz, Jimmy Williams, Chunfang Zhao, Xinfang Zhao. Invention is credited to William B. Busa, Amy Catherine Flor, Stephen J. Kron, David A. Schwartz, Jimmy Williams, Chunfang Zhao, Xinfang Zhao.
Application Number | 20130184184 13/302819 |
Document ID | / |
Family ID | 46146396 |
Filed Date | 2013-07-18 |
United States Patent
Application |
20130184184 |
Kind Code |
A1 |
Schwartz; David A. ; et
al. |
July 18, 2013 |
Methods and/or Use of Oligonucleotide Conjugates Having Varied
Degrees of Labeling for Assays and Detections
Abstract
The present disclosure is directed to methods and/or uses of
oligonucleotide conjugates having varied degrees of labeling for
assays and detections and related systems and/or kits. Certain
methods are directed to a method for detecting one or more
biological targets of a sample in a detection assay, comprising:
providing a molecular probe, comprising a binding moiety and an
oligonucleotide sequence, to a sample comprising one or more
biological targets; binding the one or more biological targets with
the binding moiety; providing a detectable component to the sample,
wherein the detectable component comprises a signal generating
moiety conjugated to an oligonucleotide sequence complementary to
the oligonucleotide sequence of the molecular probe; hydridizing
the oligonucleotide sequence of the target-bound molecular probe to
the detectable component; and detecting a signal generated from the
hydridized detectable component. Various other embodiments,
applications etc. are disclosed herein.
Inventors: |
Schwartz; David A.;
(Encinitas, CA) ; Williams; Jimmy; (Santee,
CA) ; Zhao; Xinfang; (San Diego, CA) ; Zhao;
Chunfang; (San Diego, CA) ; Busa; William B.;
(Bahama, NC) ; Kron; Stephen J.; (Oak Park,
IL) ; Flor; Amy Catherine; (Chicago, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Schwartz; David A.
Williams; Jimmy
Zhao; Xinfang
Zhao; Chunfang
Busa; William B.
Kron; Stephen J.
Flor; Amy Catherine |
Encinitas
Santee
San Diego
San Diego
Bahama
Oak Park
Chicago |
CA
CA
CA
CA
NC
IL
IL |
US
US
US
US
US
US
US |
|
|
Assignee: |
The University of Chicago
Chicago
IL
SoluLink, Inc.
San Diego
CA
|
Family ID: |
46146396 |
Appl. No.: |
13/302819 |
Filed: |
November 22, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61344931 |
Nov 22, 2010 |
|
|
|
61483186 |
May 6, 2011 |
|
|
|
Current U.S.
Class: |
506/16 ;
435/6.11; 506/18 |
Current CPC
Class: |
C07H 21/00 20130101;
C12Q 1/6804 20130101; C12Q 2565/113 20130101; C12Q 1/6834 20130101;
C12Q 1/6804 20130101 |
Class at
Publication: |
506/16 ; 506/18;
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with Government support under Grant
number 5R43AI091340-02 awarded by National Institutes of Health.
The government has certain rights in the invention.
Claims
1. A tunable detection system, comprising: i) a molecular probe
prepared by conjugating a first oligonucleotide sequence to a
binding moiety; and ii) a series of detectable components,
comprising a range of signal generating moieties conjugated to a
second oligonucleotide sequence, wherein the range of signal
generating moieties generates a range of signal intensities, and
wherein the second oligonucleotide sequence is complementary to the
first oligonucleotide sequence; wherein the range of signal
intensities generated can be tuned over a range from the limit of
self-quenching to the intensity of a single signal generating
moiety.
2. A tunable detection system, comprising: i) a molecular probe
prepared by conjugating a first oligonucleotide sequence to a
binding moiety; and ii) a series of detectable components,
comprising a range of signal generating moieties conjugated to a
second oligonucleotide sequence, wherein the range of signal
generating moieties generates a range of signal intensities; and
iii) a universal adapter, comprising a first oligonucleotide
sequence segment complementary to the first oligonucleotide
sequence and a second oligonucleotide sequence segment
complementary to the second oligonucleotide sequence; wherein the
range of signal intensities generated can be tuned over a range
from the limit of self-quenching to intensity of a single signal
generating moiety.
3. The tunable detection system of claim 1, wherein the detectable
component or the hybridized detectable component comprises one or
more signal generating moieties, comprising one or more of the
following: a directly detectable signal generating moiety, an
indirectly detectable signal generating moiety, a fluorescent dye,
a fluorophore, a fluorochrome, a chromophore, a biofluorescent
protein, a luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations thereof.
4. The tunable detection system of claim 1, wherein the detectable
component comprises a scaffold conjugated to the second
oligonucleotide sequence, and wherein said scaffold comprises the
one or more signal generating moieties.
5. The tunable detection system of claim 1, wherein: i) the tunable
detection system comprises a singleplex or multiplex tunable
detection system; and ii) the tunable detection system detects,
measures, or quantifies the level of binding and/or amount of one
or more targets present in a sample from the generated signal by
one or more of the following: flow cytometry, immunomagnetic
cellular depletion, immunomagnetic cell capture, array, bead array,
multiplex bead array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, immunoturbidity, latex
agglutination, gold particle agglutination, visual inspection, a
change in light transmittance through said sample, increased light
transmittance through said sample, a blotting method, a Western
blot, a Southern blot, a Southwestern blot, labeling inside an
electrophoresis system, labeling on a surface, labeling on an
array, PCR amplification, elongation followed by PCR amplification,
immunoprecipitation, co-immunoprecipitation, chromatin
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
6. A tunable detection system, comprising: i) a plurality of
molecular probes comprising: 1) at least a first molecular probe
prepared by conjugating a first oligonucleotide sequence to a first
binding moiety; and 2) at least a second molecular probe prepared
by conjugating a second oligonucleotide sequence to a second
binding moiety; and ii) a plurality of detectable components
comprising: 1) at least a first detectable component comprising a
range of first signal generating moieties conjugated to a
oligonucleotide sequence complementary to said first
oligonucleotide sequence, wherein the range of first signal
generating moieties generates a range of signal intensities; and 2)
at least a second detectable component comprising a range of second
signal generating moieties conjugated to a oligonucleotide sequence
complementary to said second oligonucleotide sequence, wherein the
range of second signal generating moieties generates a range of
signal intensities; wherein the range of signal intensities
generated from the at least first detectable component and the at
least second detectable component can be individually tuned over a
range from the limit of self-quenching to intensity of the single
first signal generating moiety or the second signal generating
moiety, respectively.
7. The tunable detection system of claim 6, wherein: i) the first
signal generated is from at least a first target in a sample bound
by the at least first molecular probe that is hybridized to the at
least first detectable component; and ii) the second signal
generated is from at least a second target in the sample bound by
the at least second molecular probe that is hybridized to the at
least second detectable component.
8. The tunable detection system of claim 6, wherein the plurality
of detectable components, the at least first hybridized detectable
component, and/or the at least second hybridized detectable
component comprise one or more signal generating moieties, wherein
said one or more signal generating moieties comprises one or more
of the following: a directly detectable signal generating moiety,
an indirectly detectable signal generating moiety, a fluorescent
dye, a fluorophore, a fluorochrome, a chromophore, a biofluorescent
protein, a luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations thereof.
9. The tunable detection system of claim 6, wherein the at least
first hybridized detectable component comprises a first scaffold
conjugated to the first oligonucleotide sequence and/or the at
least second hybridized detectable component comprises a second
scaffold conjugated to the second oligonucleotide sequence.
10. The tunable detection system of claim 6, wherein the first
scaffold and/or the second scaffold comprises a dendrimer, a
polysaccharide molecule, a dextran, a protein, a peptide, an
additional oligonucleotide sequence, a portion of the first or
second oligonucleotide sequence that is not complementary to the
first or second oligonucleotide sequence of the at least first or
second molecular probe, a polymer, a hydrophilic polymer, a bead, a
nanoparticle, or combinations or derivatives thereof.
11. The tunable detection system of claim 6, wherein the first
scaffold and/or the second scaffold has one or more signal
generating moieties.
12. The tunable detection system of claim 6, wherein: i) the
tunable detection system comprises a singleplex or multiplex
tunable detection system; and ii) the tunable detection system
detects, measures, or quantifies the level of binding and/or amount
of one or more targets present in a sample from the signal
generated from the at least first detectable component and/or the
signal generated from the at least second detectable component by
one or more of the following: flow cytometry, immunomagnetic
cellular depletion, immunomagnetic cell capture, array, bead array,
multiplex bead array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, immunoturbidity, latex
agglutination, gold particle agglutination, visual inspection, a
change in light transmittance through said sample, increased light
transmittance through said sample, a blotting method, a Western
blot, a Southern blot, a Southwestern blot, labeling inside an
electrophoresis system, labeling on a surface, labeling on an
array, PCR amplification, elongation followed by PCR amplification,
immunoprecipitation, co-immunoprecipitation, chromatin
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
13. The tunable detection system of claim 6, wherein the tunable
detection system minimizes signal spillover by varying one or more
of the following: the identity of the first signal generating
moiety, the number of the first signal generating moieties on the
at least first detectable component, the identity of the second
signal generating moiety, the number of the second signal
generating moieties on the at least second detectable
component.
14. The tunable detection system of claim 1, wherein the sample
comprises a plurality of targets.
15. The tunable detection system of claim 1, wherein the tunable
detection system comprises one or more of the following: i) the
plurality of molecular probes comprises the plurality of binding
moieties independently conjugated to a plurality of oligonucleotide
sequences, comprising: 1) at least a first molecular probe
comprising the first binding moiety conjugated to a first
oligonucleotide sequence; and 2) at least a second molecular probe
comprising the second binding moiety conjugated to a second
oligonucleotide sequence; and ii) the plurality of detectable
components comprising the range of first signal generating moieties
independently conjugated to the universal oligonucleotide sequence,
comprising: 1) at least a first detectable component comprising the
range of first signal generating moieties conjugated to the
universal oligonucleotide sequence, wherein the range of first
signal generating moieties generates a range of signal intensities;
and 2) at least a second detectable component comprising the range
of second signal generating moieties conjugated to the universal
oligonucleotide sequence, wherein the range of second signal
generating moieties generates a range of signal intensities; and
iii) a plurality of universal adapters, comprising a plurality of
oligonucleotide sequence segments complementary to the plurality of
oligonucleotide sequence of the plurality of molecular probes
independently paired with a second oligonucleotide sequence segment
complementary to the universal oligonucleotide sequence.
16. The tunable detection system of claim 1, wherein the tunable
detection system comprises an automated system or robotic
system.
17. The tunable detection system of claim 1, wherein the tunable
detection system further comprises removing the hybridized
detectable component or plurality of detectable components from the
bound target or plurality of targets, respectively, wherein said
removal is by a washing or stripping process.
18. The tunable detection system of claim 17, wherein the tunable
detection system further comprises re-probing with a second
detectable component or second plurality of detectable components,
respectively, wherein said second detectable component comprises at
least one second signal generating moieties conjugated to a second
oligonucleotide sequence or a complementary second oligonucleotide
sequence, or said second plurality of detectable components are
prepared by independently pairing, via conjugation, a second
plurality of signal generating moieties and a second plurality of
second oligonucleotide sequences or a second plurality of
complementary second oligonucleotide sequences.
19. The tunable detection system of claim 1, wherein the intensity
of the signal generated can be tuned over a range 2 to
10.times..
20. The tunable detection system of claim 1, wherein the binding
moiety comprises an antibody, a monoclonal antibody, a polyclonal
antibody, an enzyme, a protein, a peptide, a carbohydrate, a
nuclear receptor, a small molecule, an aptamer, a chelator, or
combinations or derivatives thereof.
Description
CROSS-REFERENCE
[0001] Each of the following documents are incorporated herein by
reference in its entirety: U.S. Pat. Nos. 7,462,689; 6,800,728;
7,173,125; 6,686,461; 7,102,024; 6,911,535; 6,217,845; 5,753,520;
5,420,285; 5,679,778; and 5,206,370. U.S. patent application Ser.
No. 11,787,932, filed on Apr. 18, 2007, now U.S. Patent Publication
No. 2008/0221343, published Sep. 11, 2008. U.S. Patent Application
No. 61/282,434, filed on Feb. 12, 2010. International Application
No. PCT/US2001/09252, filed on Mar. 22, 2001, now World Publication
No. WO 2001/70685; International Application No. PCT/US2001/023775,
filed on Jul. 27, 2001, now World Publication No. WO 2002/010432;
International Application No. PCT/US2002/001161, filed on Jan. 16,
2002, now World Publication No. WO 2002/057422. SoluLink manual,
entitled "Antibody-Oligonucleotide All-in-One Conjugation Kit User
Manual", Catalog No. A-9201-001, January 2010. In addition, each of
the following provisional applications is incorporated herein by
reference in its entirety: U.S. Patent Application Nos. 61/344,931,
filed Nov. 22, 2010, and 61/483,186, filed May 6, 2011.
FIELD
[0003] The present disclosure relates to and may be applied to the
methods and/or uses of oligonucleotide conjugates having varied
degrees of labeling for assays and detections and related systems
and/or kits.
BACKGROUND
[0004] Current diagnostic tools fail to satisfy certain desired
requirements for diagnostic assays. For example, current diagnostic
tools do not readily diagnose diseases at earlier stages, yield the
information required to direct clinicians to treat patients safely
with advanced therapeutics, quantify the effectiveness of the new
multi-pathogen/component vaccines, correlate information from gene
sequencing with the protein expression in cells, aid drug
developers to better understand the activities and toxicities of
drugs in development from pre-clinical to Phase III, allow
scientists to study and understand intra- and inter-cellular
interactions, and a wide range of other research-based biological
and clinical assays.
[0005] One of the bottlenecks of current tools is their limit in
the number of assays that can be performed simultaneously or
substantially simultaneously. For example, in most cases, current
protein diagnostic assays only detect 1-10 protein biomarkers
simultaneously, or substantially simultaneously. In the clinic, for
example, the prostate cancer PSA assay measures only a single
protein, the prostate-specific antigen protein, and the breast
cancer Hercept Test measures only a single receptor, the Her2
receptor. However, a multitude of interactions and pathways occur
continuously in the cell and many of these interactions and
pathways are altered in diseased cells. Therefore, in order to more
fully understand the functioning of a cell, including the
multi-variant processes conducted within and between normal
healthy-cells, as well as the alterations of these cellular
processes in various disease states, new technologies are needed to
track and correlate a greater numbers of genetic, protein, and
other cellular component changes. Access to this greater amount of
information will allow the development of higher content assays,
thereby resulting in more informed clinical decisions and improved
patient outcomes.
[0006] Bioconjugates have been employed in a wide variety of
molecular biology applications. For example, bioconjugates are used
in biochemical assays and diagnostic assays to improve assay
sensitivity. Bioconjugates, such as oligonucleotides conjugated to
antibodies or enzymes, have been used as hybridization probes in
immunoassays or as probes in the development of sensitive nucleic
acid-based diagnostic assays. Such conjugates may be prepared by a
variety of methods, such as glutaraldehyde crosslinking,
maleimide-thiol coupling, isothiocyanate-amine coupling, hydrazone
coupling, oxime coupling, and Schiff base formation/reduction.
[0007] Despite the promise that bioconjugates hold in the area of
biomedical research, such as improving assay sensitivity,
simplifying nucleic acid detection schemes, clinical studies,
development of both in vitro and in vivo diagnostic assays as well
as in vivo therapies, and the like, bioconjugates have not yet
achieved their desired potential in these molecular biology,
biomedical and diagnostic applications. This deficiency is due, in
part, to the inefficient and less than quantitative preparation of
bioconjugates, which may involve multiple steps and may require,
for example, the protein, the oligonucleotide, or both, to be
modified with the appropriate linking moiety and then purified
before being combined and reacted with each other. Often the
modification reaction may have a lengthy reaction time and may
result in forming an unstable protein or oligomer intermediate that
must be purified and used immediately. For these and other reasons,
the yields to prepare these bioconjugates are highly variable, and
are greatly dependent on what techniques are used. In addition,
another issue is that conventional conjugation chemistries lack the
flexiability to cost effectively supply the large number of various
conjugates users need.
[0008] Another reason that has hindered the widespread use of
bioconjugates is the methods used to purify and isolate
bioconjugates. Because of the inefficiencies in the conjugation
chemistries used to prepare bioconjugates, often the resulting
bioconjugate product may require several purification steps to
obtain a purified bioconjugate, which can have a detrimental effect
on the stability or activity of the final bioconjugate, its yield
as well as be time consuming and expensive to prepare and/or
purify.
[0009] Up to this point, the purification of bioconjugates has been
accomplished using, for example, size exclusion chromatography, or
occasionally, ion exchange chromatography. The requirement for
chromatography for purification of bioconjugates has been a
significant barrier for the routine use of bioconjugates, such as
antibody-oligonucleotide bioconjugates in diagnostic assays. For
these and other reasons, the costs of preparing and purifying
bioconjugates have been expensive and have been difficult to make
with reproducible results.
[0010] Developments in conjugation chemistry have improved the
efficiency of preparing bioconjugates. For example, SoluLink.TM.
has developed conjugation chemistry that can be used to prepare a
biomolecule-oligonucleotide conjugate, such as
antibody-oligonucleotide bioconjugate, with at least 80%
efficiency. Accordingly, the preparation of bioconjugates using
efficient conjugation chemistries has allowed for the ability to
explore efficient, mild, robust, simple, high yielding purification
or combinations thereof methods to provide bioconjugates, for
example, biomolecule-oligonucleotide conjugates, such as
antibody-oligonucleotide bioconjugates, in high yield having high
purity to facilitate their use in molecular biology, biomedical,
and diagnostic research and application.
[0011] There still remains a need for methods, systems and or kits
that provide a more efficient, robust, mild, simple, high-yielding
purification or combinations thereof of such bioconjugates to
provide high purity bioconjugates for use in biomedical research
and diagnostic assays. There is also a need for methods, systems
and/or kits that increase the number of assays that can be
performed simultaneously or substantially simultaneously. The
present disclosure is directed to address one or more of these
problems as well as other problems not addressed in this
background.
SUMMARY
[0012] Certain embodiments provide for methods of detecting one or
more molecular targets in a sample using
biomolecule-oligonucleotide conjugates, comprising: i) forming
biomolecule-oligonucleotide conjugates at greater than 80%
efficiency from at least one or more modified biomolecules and at
least one or more modified oligonucleotides, wherein the formed
biomolecule-oligonucleotide conjugates comprise one or more
detectable components; ii) combining the formed
biomolecule-oligonucleotide conjugates with the sample comprising
the one or more molecular targets; iii) contacting the one or more
molecular targets in the sample with the formed
biomolecule-oligonucleotide conjugates; and iv) detecting the
contacted one or more molecular targets.
[0013] Certain embodiments provide methods for isolating
biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, or peptide-oligonucleotide conjugates, comprising: i)
introducing a modified biomolecule into a buffered solution; ii)
conjugating the modified biomolecules with at least one modified
oligonucleotide at greater than 80% efficiency to form
biomolecule-oligonucleotide conjugates and iii) isolating the
biomolecule-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder. As an
alternative to using an immobilized binder other isolation
techniques may also be used, for example, chromatography, affinity
chromatography, size exclusion chromatography, HPLC, reverse-phase
chromatography, electrophoresis, capillary electrophoresis,
polyacrylamide gel electrophoresis, agarose gel electrophoresis,
free flow electrophoresis, differential centrifugation, thin layer
chromatography, immunoprecipitation, hybridization, solvent
extraction, dialysis, filtration, diafiltration, tangential flow
filtration, ion exchange chromatography, hydrophobic interaction
chromatography, or combinations thereof.
[0014] In certain embodiments, detecting a contacted one or more
molecular targets, for example, a biomolecule-oligonucleotide
conjugate contacted one or more molecular targets, may comprise
using one or more of the following, comprising: flow cytometry;
immunomagnetic cellular depletion; immunomagnetic cell capture;
multiplex bead arrays; microarrays, including antibody arrays, bead
arrays, and cellular arrays; solution phase capture;
chemiluminescence detection; infrared detection; microspcopy,
imaging; high content screening (HCS); immunohistochemistry (IHC);
immunocytochemistry (ICC); in situ hybridization (ISH); enzyme
immuno-assays (EIA); enzyme linked immuno-assays (ELISA); ELISpot;
blotting methods, such as a Western blot, Southern blot, and/or
Southwestern blot; labeling inside electrophoresis systems,
labeling on surfaces, and/or labeling on arrays; PCR amplification;
elongation followed by PCR amplification; immunoprecipitation, such
as co-immunoprecipitation or chromatin immunoprecipitation;
pretargeting imaging or therapeutic agents and/or combinations
thereof. In certain embodiments, a kit and/or system for detecting
one or more molecular targets in a sample, may comprise one or more
prepared, purified and/or isolated molecular probes, such as one or
more biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, or peptide-oligonucleotide conjugates, one or more
prepared, purified and/or isolated universal adapters, and/or one
or more prepared, purified and/or isolated detectable components,
wherein each of the molecular probes, universal adapters, and/or
detectable components may comprise one or more spacer groups. In
certain embodiments, the kit and/or system for detecting one or
more molecular targets in a sample may be used in a method of
detecting one or more molecular targets in a sample.
[0015] In certain aspects, the immobilized binder may comprise a
metal ion wherein the metal ion is a divalent metal ion, a
transition metal ion, a divalent transition metal ion, or
combinations thereof. In certain aspects, the transition metal ion
is selected from the group comprising: nickel ion, zinc ion, copper
ion, iron ion and cobalt ion. In certain aspects, the modified
antibody may include a histidine-rich region.
[0016] In certain aspects, the immobilized binder may further
comprise an organic chelator selected from the group comprising:
iminodiacetic acid, nitrilotriacetic acid and bicinchoninic acid.
In certain aspects, the immobilized binder may comprise an
immobilized antibody.
[0017] In certain aspects, the modified biomolecule, for example, a
modified antibody, modified protein, or modified peptide, may
comprise a molecular tag incorporated using protein engineering
techniques. In certain aspects, the molecular tag may be selected
from the group comprising: poly-histidine tag; Flag Tag; Myc-Tag;
S-tag; a peptide tag; and/or combinations or derivatives thereof.
In certain aspects, the immobilized antibody may be complementary
to the molecular tag that is bound to the modified biomolecule. In
certain aspects, the immobilized antibody may be raised against the
molecular tag that is bound to the modified biomolecule. The
molecular tag may be a peptide tag. In certain aspects, the
immobilized binder may be an antibody raised against the
conjugative linker joining the modified biomolecule to the at least
one modified oligonucleotide.
[0018] In certain embodiments, the conjugating efficiency of
forming a molecular probe, such as a biomolecule-oligonucleotide
conjugate, is greater than about 80%, 85%, 90%, 92%, 95%, 96%, 97%,
98%, 98.5%, or 99%. In certain embodiments, the conjugating
efficiency of forming a molecular probe, such as a
biomolecule-oligonucleotide conjugate, is at least about 85%, 90%,
92%, 95%, 96%, 97%, 98%, 98.5%, or 99%.
[0019] In certain embodiments, the conjugating efficiency of
forming a detectable component, comprising one or more signal
generating moieties conjugated directly to an oligonucleotide
sequence complementary to the oligonucleotide sequence of a
molecular probe or an oligonucleotide sequence complementary to the
oligonucleotide sequence of a universal adapter, is greater than
about 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, 98.5%, 99%. In
certain embodiments, the conjugating efficiency of forming a
detectable component, comprising one or more signal generating
moieties and an oligonucleotide sequence complementary to the
oligonucleotide sequence of a molecular probe or an oligonucleotide
sequence complementary to the oligonucleotide sequence of a
universal adapter, is at least about 85%, 90%, 92%, 95%, 96%, 97%,
98%, 98.5%, or 99%. In certain embodiments, the conjugating
efficiency of forming a detectable component, comprising one or
more signal generating moieties conjugated indirectly, via a
scaffold, to an oligonucleotide sequence complementary to the
oligonucleotide sequence of a molecular probe or an oligonucleotide
sequence complementary to the oligonucleotide sequence of a
universal adapter, is greater than about 80%, 85%, 90%, 92%, 95%,
96%, 97%, 98%, 98.5%, or 99%. In certain embodiments, the
conjugating efficiency of forming a detectable component,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated directly to an oligonucleotide sequence
complementary to the oligonucleotide sequence of a molecular probe
or an oligonucleotide sequence complementary to the oligonucleotide
sequence of a universal adapter, is greater than about 80%, 85%,
90%, 92%, 95%, 96%, 97%, 98%, 98.5%, or 99%.
[0020] In certain embodiments, the biomolecule-oligonucleotide
conjugates, such as antibody-oligonucleotide conjugates or
protein-oligonucleotide conjugates, comprises on average at least
0.5 modified oligonucleotides per biomolecule. For example, the
modified antibody (e.g. biomolecule-oligonucleotide conjugate) is
prepared from an IgG, IgA, IgE, or IgM type antibody. In certain
aspects, the modified antibody comprises an antibody that has been
prepared by attaching at least one moiety comprising a reactive
linker capable of conjugating to a modified oligonucleotide. This
at least one moiety may be attached by a covalent bond.
Furthermore, the at least one moiety may comprise a spacer group,
for example, a polymerized ethylene oxide, such as PEG or PEO.
[0021] In certain aspects, the modified biomolecules, for example,
the modified antibodies, modified proteins, or modified peptides
may be prepared by attaching at least one moiety comprising a
reactive linker capable of conjugating to a modified
oligonucleotide. This at least one moiety may be attached by a
covalent bond. The modified biomolecules may further comprise a
molecular tag. Furthermore, the at least one moiety may comprise a
spacer group, for example, a polymerized ethylene oxide, such as
PEG or PEO.
[0022] In certain embodiments, the at least one moiety comprising a
reactive linker may be HyNic (6-HydrazinoNicotinamide). In certain
aspects, the modified biomolecule, for example, modified antibody,
modified protein, or modified peptide may comprise a HyNic-modified
biomolecule (i.e., covalently modified to display a
hydrazinonicotinate reactive moiety). The modified oligonucleotide
may also comprise a 4-FB-modified oligonucleotide (i.e., covalently
modified to display a 4-formylbenzamide moiety). In certain
aspects, the modified biomolecule may be a biomolecule that has
been modified by attaching at least one moiety that is a reactive
linker capable of conjugating to a modified oligonucleotide. The
modified biomolecule may further comprise a molecular tag. In
certain aspects, the modified biomolecule may comprise an antibody
that has been further modified by attaching a biotin that may bind
to an avidin or a hapten or peptide that may bind to an antibody or
a histidine fusion peptide capable of chelating a metal ion.
[0023] In certain embodiments, the conjugate may be formed with a
covalent linkage. The covalent linkage may be selected from the
group comprising: an amide, an oxime, a hydrazone, a sulfide, an
ether, an enol ether, a thiol ether, an ester, a triazole and/or a
disulfide. The covalent linkage may comprise a hydrazone. The
hydrazone may be a bis-arylhydrazone. Furthermore, the covalent
linkage may be UV-traceable.
[0024] In certain embodiments, the methods of preparing conjugates
and the methods of detecting molecular targets disclosed herein may
be mild, robust, more efficient, cost effective, simple, and/or
combinations thereof as compared to conventional methods. In
addition, such methods may provide high purity bioconjugates for
use in biomedical applications and/or diagnostic assays.
[0025] In certain embodiments, the biomolecule-oligonucleotide
conjugates, for example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates may comprise at least one modified oligonucleotide. In
certain embodiments, the biomolecule-oligonucleotide conjugates may
comprise a composition of biomolecule-oligonucleotide conjugates
having on average between 1.0 and 5, or between 1 and 2.5 modified
oligonucleotides conjugated to the biomolecule. In certain
embodiments, the methods disclosed yield at least between about
30-80%, 40-80%, 40-70%, 60-80% or 70-80% of an isolated
biomolecule-oligonucleotide conjugates, with respect to starting
modified biomolecule.
[0026] In certain embodiments, the biomolecule-oligonucleotide
conjugates, for example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates may comprise at least one or more detectable
fluorophores. For example, at least one or at least two detectable
fluorophores. The biomolecule-oligonucleotide conjugates may also
comprise at least one or more detectable poly-fluorophores.
[0027] In certain embodiments, the least a portion of the
biomolecule-oligonucleotide conjugates may comprise at least one or
more different modified oligonucleotides, such as two different
modified oligonucleotides.
[0028] Certain embodiments provide methods for isolating
biomolecule-oligonucleotide conjugates comprising: i) conjugating a
modified biomolecule with at least one modified oligonucleotide to
form biomolecule-oligonucleotide conjugates, wherein greater than
80% of the modified biomolecules are conjugated; ii) adding the
conjugation reaction mixture to a column having a stationary phase
comprising a binder that has been immobilized to the stationary
phase; iii) binding the biomolecule-oligonucleotide conjugates
selectively to the immobilized binder; iv) eluting reaction
components away from the bound biomolecule-oligonucleotide
conjugates and v) isolating the biomolecule-oligonucleotide
conjugates by releasing the bound, biomolecule-oligonucleotide
conjugates with a displacing agent selective for the binder. As an
alternative to using an immobilized binder other isolation
techniques may also be used, for example, chromatography, affinity
chromatography, size exclusion chromatography, HPLC, reverse-phase
chromatography, electrophoresis, capillary electrophoresis,
polyacrylamide gel electrophoresis, agarose gel electrophoresis,
free flow electrophoresis, differential centrifugation, thin layer
chromatography, immunoprecipitation, hybridization, solvent
extraction, dialysis, filtration, diafiltration, tangential flow
filtration, ion exchange chromatography, hydrophobic interaction
chromatography, or combinations thereof.
[0029] The preparation methods may be used as part of a kit and/or
system of preparing, purifying and/or isolating
biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, or peptide-oligonucleotide conjugates. In certain
embodiments, the conjugating efficiency is greater than about 80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, 98.5%, or 99%. In certain
embodiments, the methods disclosed yield at least between about
30-80%, 40-80%, 40-70%, 60-80% or 70-80% of an isolated
biomolecule-oligonucleotide conjugates, with respect to starting
modified biomolecule.
[0030] In certain embodiments, the isolation methods may be used as
part of a kit and/or system of preparing, purifying and/or
isolating biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, or peptide-oligonucleotide conjugates. In certain
embodiments, the conjugating efficiency is greater than about 80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, 98.5%, or 99%. In certain
embodiments, the methods disclosed yields of at least between about
30-80%, 40-80%, 40-70%, 60-80% or at least between about 70-80% of
an isolated biomolecule-oligonucleotide conjugates, with respect to
starting modified biomolecule.
[0031] In certain embodiments, the detection methods may be used as
part of a kit and/or system of preparing, purifying and/or
isolating biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, or peptide-oligonucleotide conjugates, followed by
further utilizing the prepared, purified and/or isolated,
biomolecule-oligonucleotide conjugates in an assay, for example, in
a detection assay, such as in a singleplex or multiplex assay, for
example, a singleplex or multiplex immunodetection assay, for
detecting one or more biological targets in a sample. In certain
embodiments, the conjugating efficiency is greater than about 80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, 98.5%, or 99%. In certain
embodiments, the methods disclosed yield at least between about
30-80%, 40-80%, 40-70%, 60-80% or at least between about 70-80% of
an isolated biomolecule-oligonucleotide conjugates, with respect to
starting modified biomolecule.
[0032] In certain embodiments, the modified biomolecule, for
example, a modified antibody, modified protein, or modified
peptide, may include a histidine-rich region.
[0033] In certain embodiments, the stationary phase used may
comprise a water insoluble support. For example, the stationary
phase may be agarose, other inert natural, synthetic polymeric
materials and/or magnetic.
[0034] In certain aspects, the immobilized binder may comprise an
immobilized antibody. In certain aspects, the modified biomolecule
may further comprise a molecular tag. Furthermore, the immobilized
antibody may be selective for the molecular tag that is bound to
the modified biomolecule.
[0035] In certain embodiments, modified biomolecules are provided.
These compounds are prepared, for example, by reaction of a
biomolecule of interest with one of the functionalities of a
bifunctional reagent. The modified biomolecules are available for
conjugation or immobilization using the remaining functional group.
Biomolecules for use herein include, but are not limited to,
proteins including antibodies, glycoproteins, peptides,
oligonucleotides, RNA and/or DNA.
[0036] In certain embodiments, modified solid supports, or
substantially solid supports, are also provided, including, but not
limited to, synthetic polymers, beads, glass, slides, metals and/or
particles that have been modified by reaction with a bifunctional
reagent to afford modified synthetic polymers, beads, latex, glass,
slides, metals, including colloidal metals and/or particles that
possess a hydrazino or oxyamino group. Combinations of modified
solid supports, or substantially solid supports, are also
contemplated. For example, these modified solid, or substantially
solid, supports are useful in immobilization of biomolecules that
possess or are modified to possess a carbonyl group. The
immobilized biomolecules may also be used indiagnostic and/or
therapeutic applications.
[0037] In certain embodiments, methods for purifying conjugates of
biomolecules (for example, biomolecule-oligonucleotide conjugates)
may involve metal chelation chromatography that utilizes the
interaction of a metal ion, for example, Ni.sup.+2 ion, Zn.sup.+2
ion, Cu.sup.+2 ion, Fe.sup.+2 ion, or Co.sup.+2 ion and the
antibody. For example, an aqueous mixture of
biomolecule-oligonucleotide conjugates and free, or substantially
free, modified-oligonucleotide, may be contacted with a water
insoluble stationary phase which has the metal ion chelated to the
phase. In certain embodiments, the conjugate chelates with the
metal ion whereas neither of the specified free
modified-oligonucleotide chelate. In certain embodiments,
subsequent washing of the phase with a mild buffer may remove, or
substantially remove, the unbound modified-oligonucleotide. In
certain embodiments, the biomolecule-oligonucleotide conjugates may
then be eluted from the phase and recovered in a form free,
sufficiently free, or substantially free, of unconjugated
modified-oligonucleotide.
[0038] In certain embodiments, the biomolecule-oligonucleotide
conjugates, for example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates, may be used in diagnostic and/or therapeutic
applications.
[0039] Other embodiments, aspects, features, and/or advantages of
this technology will become apparent from the following detailed
description when taken in conjunction with the accompanying
drawings, which are a part of this disclosure and which illustrate,
by way of example, certain principles of the disclosed
technology.
BRIEF DESCRIPTION OF THE FIGURES
[0040] In order to facilitate a more detailed understanding of the
nature of certain embodiments disclosed herein, exemplary
embodiments of processes, systems, kits, preparations, methods,
purifications, or combinations thereof, will now be described in
further detail, by way of example only, with reference to the
accompanying figures in which:
[0041] FIG. 1 is a gel electrophoresis loading 400 ng of antibody
with SYBR stain, containing the following lanes: Marker (lane 1);
SFB-H1A (lane 2); HyNic-Bovine IgG (lane 3); Bovine IgG/H1A crude
(lane 4) and Bovine IgG/H1A purified (lane 5), in accordance with
certain embodiments.
[0042] FIG. 2 is a gel electrophoresis loading 400 ng of antibody
with Lumitein stain, containing the following lanes: Marker (lane
1); SFB-H1A (lane 2); HyNic-Bovine IgG (lane 3); Bovine IgG/H1A
crude (lane 4) and Bovine IgG/H1A purified (lane 5), in accordance
with certain embodiments.
[0043] FIG. 3 is a gel electrophoresis loading 500 ng of antibody
with Commassie stain, containing the following lanes: Marker (lane
1); SFB-H1A (lane 2); HyNic-Bovine IgG (lane 3); Bovine IgG/H1A
crude (lane 4) and Bovine IgG/H1A purified (lane 5), in accordance
with certain embodiments.
[0044] FIG. 4 is a gel electrophoresis with Lumitein stain,
containing the following lanes: Marker (lane 1); HyNic-MS anti-FITC
150 ng (lane 2); MS anti-FITC/H1A crude 300 ng (lane 3); MS
anti-FITC/H1A purified 300 ng (lane 4) and MS anti-FITC/H1A
purified 450 ng (lane 5), in accordance with certain
embodiments.
[0045] FIG. 5 is a gel electrophoresis loading 300 ng of antibody
with DNA Silver stain containing the following lanes: Marker (lane
1); 4FB-H1A (lane 2); Bovine IgG/H1A crude (lane 3); Bovine IgG/H1A
purified with Diafiltration spin column 100K (lane 4) and Bovine
IgG/H1A purified Zinc-His-tag-magnetic-bead (lane 5), in accordance
with certain embodiments.
[0046] FIG. 6 is a gel electrophoresis loading Loading 300 ng of
antibody with Silver stain containing the following lanes: Marker
(lane 1); 4FB-46mer 4FB-oligonucleotide (lane 2); 1:5 MS
anti-FITC/46mer 4FB-oligonucleotide crude (lane 3); 1:5 MS
anti-FITC/46mer 4FB-oligonucleotide purified (lane 4); 1:3 MS
anti-FITC/46mer 4FB-oligonucleotide crude (lane 5); 1:3 MS
anti-FITC/46mer 4FB-oligonucleotide purified (lane 6); 1:5 MS
anti-FITC/36mer 4FB-oligonucleotide crude (lane 7); 1:5 MS
anti-FITC/36mer 4FB-oligonucleotide purified (lane 8); 1:3 MS
anti-FITC/36mer 4FB-oligonucleotide crude (lane 9) and 1:3 MS
anti-FITC/36mer 4FB-oligonucleotide purified (lane 10), in
accordance with certain embodiments.
[0047] FIG. 7 is a gel electrophoresis loading 300 ng of antibody
with Silver stain, containing the following lanes: Marker (lane 1);
SFB-H1A (lane 2); 20.times. Bovine IgG/DG2A crude (lane 3);
20.times. Bovine IgG/DG2A purified (lane 4); 30.times. Bovine
IgG/DG2A crude (lane 5); 30.times. Bovine IgG/DG2A purified (lane
6); 40.times. Bovine IgG/DG2A crude (lane 7); 40.times. Bovine
IgG/DG2A purified (lane 8); 50.times. Bovine IgG/DG2A crude (lane
9) and 50.times. Bovine IgG/DG2A purified (lane 10), in accordance
with certain embodiments.
[0048] FIG. 8 is a gel electrophoresis of 1.0 .mu.g of antibody
with Commassie stain, containing the following lanes: Marker (lane
1); HyNic-MS anti-FITC (lane 2); Purified MS anti-FITC/V3B 19 bp
(lane 3); Purified MS anti-FITC/H1A 35 bp (Ab 4 mg/ml) (lane 4);
Purified MS anti-FITC/Amino-40 40 bp (lane 5); Purified MS
anti-FITC/Amino-40 40 bp (lane 6); Purified MS anti-FITC/DG2A 46 bp
(lane 7) and Purified MS anti-FITC/Amino-60 60 bp (lane 8), in
accordance with certain embodiments.
[0049] FIG. 9: Conjugation of HyNic-modified antibody with
4FB-oligonucleotide, in accordance with certain embodiments.
[0050] FIG. 10: Magnetic affinity purification of
antibody-oligonucleotide conjugate, in accordance with certain
embodiments.
[0051] FIG. 11: Stage 1: Modification of the oligonucleotide to
form a modified oligonucleotide, in accordance with certain
embodiments.
[0052] FIG. 12: Stage 2: Modification of the antibody to form a
modified antibody, in accordance with certain embodiments.
[0053] FIG. 13: Stage 3: Formation of the antibody-oligonucleotide
conjugate. Stage 4: Purification of the antibody-oligonucleotide
conjugate, in accordance with certain embodiments.
[0054] FIG. 14: is a scheme presenting the HyNic/4FB chemistry used
to conjugate oligonucleotides (oligonucleotide barcode tags) to
antibodies and results, in accordance with certain embodiments.
[0055] FIG. 15: is a scheme presenting steps used to prepare
purified bis-arlyhydrazone based antibody-oligonucleotide
conjugates and results, in accordance with certain embodiments.
[0056] FIG. 16: is a scheme presenting preparation of 1:1
antibody-oligonucleotide conjugate via a controlled reduction of
disulfide bonds in the hinge region of an antibody, followed by
reaction of a resultant thiol with a thiol-reactive aromatic
hydrazine, MHPH, to form a hydrazine containing adduct, and then
conjugated with a 4FB-oligonucleotide in the presence of aniline
catalyst to form the 1:1 antibody-oligonucleotide conjugate, in
accordance with certain embodiments.
[0057] FIG. 17: is a scheme presenting the preparation of a
conjugate between an oligonucleotide and a cysteine-containing
engineered protein, formed by reacting a cysteine-containing
engineered protein with a thiol-reactive aromatic hydrazine, MHPH,
to form a hydrazine-containing adduct, and then conjugated with a
4FB-oligonucleotide in the presence of aniline catalyst to form the
engineered protein-oligonucleotide conjugate, in accordance with
certain embodiments.
[0058] FIG. 18: is a general scheme presenting the preparation of
oligonucleotide-signal generators using a HyNic-4FB coupling, in
accordance with certain embodiments.
[0059] FIG. 19: is a scheme presenting the preparation of a
complementary oligonucleotide-dextran-polyfluor conjugate with 1:1
oligonucleotide to dextran stoichiometry, in accordance with
certain embodiments.
[0060] FIG. 20: (Left) is a schematic representation of the
hybridization of an antibody-oligonucleotide conjugate (A), with a
complementary oligonucleotide-fluorescently labeled scaffold (B),
to form the hybridization product (C). (Right) Polyacrylamide gel
results demonstrating the hybridization of two oligonucleotide
conjugates (lanes 3 and 5) as compared to their respective
complementary oligonucleotide-dextran scaffold conjugates (lanes 4
and 6), in accordance with certain embodiments.
[0061] FIG. 21: is a schematic representation of conjugate self
assembly, wherein a series of antibody-oligonucleotides (A), and a
series of complementary oligonucleotide-signal generators (B),
self-assemble via hybridization to form hybridrization products
(C), in accordance with certain embodiments.
[0062] FIG. 22: is a schematic representation of a two-plex flow
cytometry experiment mediated by self assembly by hybridization of
antibody-oligonucleotide conjugates bound to their respective
antigens (Probe) followed by hybridization to their complementary
oligonucleotide-signal generator conjugates (Detect), in accordance
with certain embodiments.
[0063] FIG. 23: is flow cytometry results demonstrating detection
of CD4 on living cells using .alpha.-CD4 antibody-HyLk1
conjugate+HyLk1'-R-phycoerythrin conjugate, in accordance with
certain embodiments.
[0064] FIG. 24: is flow cytometry results demonstrating detection
of CD4 on living cells using .alpha.-CD4 antibody-HyLk1
conjugate+HyLk1'-allophycocyanin conjugate, in accordance with
certain embodiments.
[0065] FIG. 25: is flow cytometry results demonstrating detection
of CD4 on living cells using .alpha.-CD4 antibody-HyLk1
conjugate+HyLk1'-poly-Dy490 conjugate, in accordance with certain
embodiments.
[0066] FIG. 26: is comparing flow cytometry detection results of
either an .alpha.-CD4 antibody (A) or an .alpha.-CD8 antibody (B)
on living cells, wherein the .alpha.-CD4 or .alpha.-CD8 antibodies
are directly labeled with FITC or are labeled via antibody-HyLk1
conjugate and HyLk1'-poly-Dy490 conjugates, in accordance with
certain embodiments.
[0067] FIG. 27: in both (A) and (B) are results demonstrating
absense of crosstalk between antibody-oligonucleotide conjugates
and non-complementary oligonucleotide fluorophore conjugates, in
accordance with certain embodiments.
[0068] FIG. 28: is results demonstrating a time course experiment
(A)-(E) of labeling by hybridization between an
antibody-oligonucleotide conjugate and complementary
oligonucleotide-polyfluor conjugate, with graph (F) showing the
results of (A)-(E) superimposed, in accordance with certain
embodiments.
[0069] FIG. 29: is results of an experiment (A)-(D) titrating the
amount of complementary oligonucleotide-R-phycoerythrin conjugate
sufficient to produce a desired signal, in accordance with certain
embodiments.
[0070] FIG. 30: (Top; A-B) is flow cytometry results demonstrating
detection of CD19 on living cells using .alpha.-CD19 antibody-HyLk3
conjugate+HyLk3'-poly-DY591 and (Bottom; C-D) results demonstrating
detection of CD8 on living cells using .alpha.-CD8 antibody-HyLk2
conjugate+HyLk2'-poly-DY549, in accordance with certain
embodiments.
[0071] FIG. 31: is a 5-Plex flow cytometry experiment (A)-(D) using
5 commercially available antibody-fluorophore conjugates (Directly
Labeled Antibody conjugates). In this experiment, the same panel of
antibodies was used as in FIG. 32 as a reference example to compare
the performance of each panel, in accordance with certain
embodiments.
[0072] FIG. 32: is a 5-Plex flow cytometry experiment (A)-(D) using
5 different oligonucleotide-antibody conjugates (Molecular Probes)
followed by addition of the complementary oligonucleotide-polyfluor
conjugates (Detectable Components), in accordance with certain
embodiments. The pattern of immune reactivity is to be compared
with the panel in FIG. 31 for the same antibodies but using direct
fluorescent conjugates.
[0073] FIG. 33: is a scheme presenting hybridization-mediated
immunomagnetic separation of CD4.sup.+ cells, with (A) a binding of
.alpha.-CD4-oligonucleotide conjugate and (B) a hybridization to a
complementary oligonucleotide-immobilized paramagnetic bead and
attraction by a magnet, in accordance with certain embodiments.
[0074] FIG. 34: is a scheme presenting hybridization-mediated
immunomagnetic separation of CD4.sup.+ cells and their release by
strand displacement of the hybridization by a displacement
oligonucleotide such as a peptide nucleic acid (PNA) or a locked
nucleic acid (LNA), in accordance with certain embodiments.
[0075] FIG. 35: is a schematic representation of isolation of an
epithelial cell, such as a circulating cancer cell, in a
microfluidic device using .alpha.-Epithelial Cell adhesion molecule
antibody-oligonucleotide conjugates and their complementary
oligonucleotides immobilized in a microfluidic channel while
allowing lymphocytes to escape, in accordance with certain
embodiments.
[0076] FIG. 36: (Left) is a schematic representation of detection
of an antigen in a Western Blot experiment using an
antibody-oligonucleotide conjugate/complementary
oligonucleotide-signal generator pair. (Right) Results comparing a
classical Western Blot experiment detecting tubulin and a likely
non-specific band using a primary .alpha.-tubulin
antibody/secondary antibody-HRP conjugate to a Western Blot
prepared using an .alpha.-tubulin antibody-oligonucleotide
conjugate and complementary oligonucleotide-HRP conjugate, in
accordance with certain embodiments.
[0077] FIG. 37: is a schematic representation of an Universal
Adapter protocol, wherein each antibody is conjugated to
oligonucleotides of the same Universal sequence, but each is then
hybridized to a distinct Universal Adaptor prior to their use in a
multiplexed experiment, to allow them to be differentiated, and
then performing a detection experiment, wherein the signal
generator is linked to the 5'-end of the oligonucleotide-signal
generator conjugate, in accordance with certain embodiments.
[0078] FIG. 38: is a schematic representation of a Universal
Adapter protocol, wherein each antibodies is conjugated to
oligonucleotides of the same Universal sequence, but each is then
hybridized to a distinct Universal Adaptor prior to their use in a
multiplexed experiment, to allow them to be differentiated, and
then performing a detection experiment, wherein the signal
generator is linked to the 3'-end of the oligonucleotide-signal
generator conjugate, in accordance with certain embodiments.
[0079] FIG. 39: is infrared fluorescent Western Blot detection
results performed using an .alpha.-tubulin antibody then detected
by an IR800-dye labeled secondary anti-immunoglobulin antibody
compared to using an .alpha.-tubulin antibody-HyLk1 oligonucleotide
conjugate an HyLk2' oligonucleotide-dextran-poly-IR800 dye
conjugate mediated by hybridization to an HyLk1'-HyLk2 adaptor
oligonucleotide as presented in FIG. 32, in accordance with certain
embodiments.
[0080] FIG. 40: is flow cytometry results demonstrating the use of
an adapter method, showing (A) a positive control: Binding of a
molecular probe and then hybridization with its complement
detectable component, in the absence of an adapter; (B) use of an
adapter: Binding of a molecular probe, hybridization with a
complementary sequence on an adapter, and then hybridization of a
second sequence on the adapter with complementary sequence on a
detectable component; and (C) a negative control: Binding of a
molecular probe and addition of an adapter having a
non-complementary sequence to the detectable component, showing no
signal when analyzed by flow cytometry; in accordance with certain
embodiments.
[0081] FIG. 41: is a schematic representing steps in an
antibody-oligonucleotide directed multiplex bead array protocol,
wherein (A) the antigen is captured by an antibody-oligonucleotide
conjugate, (B) complementary oligonucleotide-beads are added and
the antigen/antibody-oligonucleotide complex is captured by
hybridization, (C) a biotinylated detector antibody conjugate is
added followed by (D) addition of Streptavidin-R-PE conjugate
signal detector, to form the resulting capture adduct (E), in
accordance with certain embodiments.
[0082] FIG. 42: is a schematic representation of a multiplex
antibody-oligonucleotide/complementary oligonucleotide-bead
conjugate self-assembly, in accordance with certain embodiments,
such as in FIG. 41.
[0083] FIG. 43: is a scheme representing steps in an
antibody-oligonucleotide directed bead array protocol, wherein (A)
the antigen is captured by two molecular probes, comprising an
antibody-oligonucleotide conjugate for detection and an
antibody-oligonucleotide conjugate for capture to form a "sandwich
immune complex," (B) a complementary oligonucleotide-bead is added
and the sandwich immune complex is captured by hybridization with
the oligonucleotide barcode sequence from the
antibody-oligonucleotide conjugate for capture, (C) addition of a
detectable component comprising an oligonucleotide sequence
complementary to the antibody-conjugate for detection, resulting in
(D) the hybridized formation of a fully captured and detectable
complex, in accordance with certain embodiments.
[0084] FIG. 44: is a scheme representing steps in an
antibody-oligonucleotide directed bead array protocol, to
simultaneously, or substantially simultaneously, detect and
quantify auto-antibodies from a sample and detect and quantify the
isotype response in a serology assay, wherein (A) an antigen
conjugate and an anti-isotype specific antibody conjugate are added
to a sample wherein the anti-antigen antibody is captured by both
oligonucleotide conjugates and (B) added to mixture are
complementary detectable components (distinct bead conjugates)
resulting in the capture of the complex by hybridization to the
captured antigen, (C) the complex is detected by the addition of
complementary detectable components, in accordance with certain
embodiments.
[0085] FIG. 45: is a scheme representing the steps in an
antigen-oligonucleotide directed bead array protocol wherein (A)
the anti-antigen antibody is captured by its cognate
antigen-oligonucleotide conjugate, (B) complementary
oligonucleotide-beads are added and the anti-antigen
antibody/antigen-oligonucleotide complex ("immune complex") is
captured by hybridization, (C) a biotinylated detector antibody
conjugate is added followed by (D) addition of Streptavidin-R-PE
conjugate signal detector, resulting in (E) the formation of a
captured and detectable complex, in accordance with certain
embodiments.
[0086] FIG. 46: is a schematic representation of a multiplex
antigen-oligonucleotide/complementary oligonucleotide-bead
conjugate self-assembly, in accordance with certain embodiments,
such as in FIGS. 43, 44 and 45.
[0087] FIG. 47: is a schematic representing the steps in an
antigen-oligonucleotide directed bead array protocol wherein (A)
the anti-antigen antibody or antibodies, i.e., IgG, IgM, IgA, or
IgE, is captured by its cognate antigen-oligonucleotide conjugate,
(B) complementary oligonucleotide-beads are added and the
anti-antigen antibody/antigen-oligonucleotide complex ("immune
complex") is captured by hybridization, (C)
antibody-oligonucleotide conjugates specific for the anti-antigen
antibodies ("anti-antigen antibody detectors") are added followed
by (D) the addition of complementary oligonucleotide-signal
detector conjugates that recognize their respective oligonucleotide
sequences on the anti-antigen antibody detectors allowing
identification of the antibody isotype response, in accordance with
certain embodiments.
[0088] FIG. 48: is a schematic representation of the use of
antibody-oligonucleotide conjugate/complementary oligo bead
conjugates in an Immunoturbidity assay, wherein (A) a pair of
antibody-oligonucleotide conjugates ("capture antibody-conjugates")
directed to independent epitopes of an antigen are added to a
sample, (B) allowed to bind to form an "immune complex," (C) the
mixture is added to beads conjugated to oligonucleotides
complementary to the oligonucleotides on the capture
antibody-conjugates, and (4) allowed to hybridize leading to
crosslinking by hybridization, in accordance with certain
embodiments.
[0089] FIG. 49: is a schematic representing steps in an
antibody-oligonucleotide directed ELISA or planar array protocol
wherein (A) an oligonucleotide is immobilized (e.g., on a 96-well
plate or planar array surface), (B) the antigen is captured by an
antibody-oligonucleotide conjugate, (C) the sample containing the
antigen/antibody-oligonucleotide complex is incubated with the
surface and captured by hybridization, (D) a biotinylated detector
antibody conjugate is added to bind the captured antigen, followed
by (E) addition of Streptavidin-HRP conjugate signal detector, in
accordance with certain embodiments.
[0090] FIG. 50: is a schematic representing steps in an
antigen-oligonucleotide directed ELISA or planar array protocol
wherein (A) an oligonucleotide is conjugated to BSA and the
oligonucleotide-BSA conjugate is immobilized (e.g., on a 96-well
plate or planar array surface), (B) the antibody is captured by an
antigen-oligonucleotide conjugate, (C) the sample containing the
antibody/antigen-oligonucleotide complex is incubated with the
surface and captured by hybridization, (D) a biotinylated detector
antibody conjugate is added to bind the captured antibody, followed
by (E) addition of Streptavidin-HRP conjugate signal detector, in
accordance with certain embodiments.
[0091] FIG. 51: is a schematic representing similar steps as those
in FIG. 50, but wherein the steps are directed to an ELISA or
planar array protocol in a serology-based assay to detect
anti-antigen antibodies, in accordance with certain
embodiments.
[0092] FIG. 52: is showing results of an immunocytochemistry
experiment to examine tubulin distribution in cells, wherein an
.alpha.-tubulin HyLk1 oligonucleotide conjugate molecular probe is
imaged using an HyLk1' complementary oligonucleotide-poly-Dy490
fluorophore detector and the fluorescein channel of an
epifluorescence microscope as in (A) while the HyLk1'-poly-Dy490
probe alone yields no similar image, according to certain
embodiments.
[0093] FIG. 53: is showing imaging results of the distribution of
tubulin and the distribution of phosphotyrosine-containing proteins
using antibody-oligonucleotide conjugates and their respective
complementary detectors applied in mixtures, wherein a mixture of
an .alpha.-tubulin-HyLk1 probe and .alpha.-phosphotyrosine-HyLk2
probe are applied and then detected by a mixture of
HyLk1'-poly-Dy490 and HyLk2'-poly-Dy549, allowing their
distribution in (A) cells imaged in brightfield to be distinguished
as in (B) using a fluorescein filter set and (C) using a rhodamine
filter set, according to certain embodiments.
[0094] FIG. 54: is a schematic representation of the process of
preassembly using pairs of complementary oligonucleotides in which
a plurality of molecular probes and a plurality of detectable
components are hybridized, i.e., preassembled, to form a plurality
of preassembled molecular probe-detectable component hybrids, prior
to contacting with a sample comprising one or more molecular
targets. The preassembly process may be completed by individual
preassembly, followed by pooling, then contacting with the sample,
or alternatively, may be completed by pooling the plurality of
molecular probes and plurality of detectable components,
preassembling by hybridization, and then contacting the pooled
preassembled hybrids with the sample.
[0095] FIG. 55: Are flow cytometry results demonstrating the
process of preassembly on mouse splenocytes, as compared to
sequential assembly in which the probes are applied in a first step
and then the detectors in a second step. The flow cytometry dot
plots on the left (labeled "sequential 5-plex"), illustrate the
sequence of using the .alpha.CD4-HyLk1, .alpha.CD8-HyLk2,
.alpha.CD19-HyLk3, .alpha.CD43-HyLk4 and .alpha.CD62L-HyLk5
antibody-oligonucleotide conjugates as applied to the mouse
splenocytes, followed by washing, then hybridizing with the
HyLk1'-Dy490, HyLk2'-Dy549, HyLk3'-Dy591, HyLk4'-Dy649 and
HyLk5'-Dy405 detectors, and then analyzed by flow cytometry. The
flow cytometry dot plots on the right (labeled "Preassembled 5-plex
(in pool)"), illustrate the combining the single pool of
antibody-oligonucleotide conjugates comprising .alpha.CD4-HyLk1,
.alpha.CD8-HyLk2, .alpha.CD19-HyLk3, .alpha.CD43-HyLk4 and
.alpha.CD62L-HyLk5, preassembling via hybridization with the
complementary polyfluor signal generating moiety conjugates
HyLk1'-Dy490, HyLk2'-Dy549, HyLk3'-Dy591, HyLk4'-Dy649 and
HyLk5'-Dy405, then contacting the preassembled hybrids with mouse
splenocytes as a pooled mixture, followed by binding, washing, and
then analyzed by flow cytometry.
[0096] FIG. 56: is results comparing the use of two alternative
methods of preassembly, the left (labeled "Preassemble in pool,
then add to cells"), and the right (labeled "Preassemble
one-by-one, pool, add to cells"). The comparable results of the two
alternative methods of preassembly suggest that either these
alternatives, or other preassembly protocols, may be followed with
similar success.
[0097] FIG. 57: illustrates several schemes that may be considered
to address and/or decrease the potential for cross-talk, such as in
panel A, by hybridizing the oligonucleotide sequence of a
non-hybridized molecular probe with an unconjugated complementary
oligonucleotide, or as illustrated in panel B, by hybridizing the
complementary oligonucleotide sequence of a non-hybridized
detectable component with an unconjugated oligonucleotide, or as
illustrated in panel C, stabilizing the duplexes formed by the
preassembly hybridization of the molecular probe(s) and the
detectable component(s) with natural or synthetic minor groove
binding agents or with natural or synthetic intercalating
agents.
[0098] FIG. 58: illustrates a preassembly process utilizing a
universal oligonucleotide conjugated to a panel of molecular probes
that are individually combined with a universal oligonucleotide
complement conjugated to a panel of signal generating moieties. The
preassembled molecular probe-signal generating moiety hybrids may
then be stabilized with unconjugated oligonucleotides or duplex
stabilizers, followed by contacting with a sample comprising one or
more molecular targets or analytes to perform one or more
assays.
[0099] FIG. 59: illustrates the stabilizing and then pooling of a
panel of individually preassembled antibody-signal generating
moiety hybrids, followed by contacting with a sample comprising one
or more molecular targets or analytes to perform an assay.
[0100] FIG. 60: illustrates a preassembly process utilizing a
universal oligonucleotide conjugated to a panel of molecular
probes, such as a panel of monoclonal antibodies that are
individually combined with a universal oligonucleotide complement
conjugated to a panel of barcoded particles, that may be used in a
flow cytometry-based multiplexed immunodetection assays. The
preassembled antibody-bead hybrids may then be stabilized with
unconjugated oligonucleotides or duplex stabilizers. The individual
stabilized preassembled antibody-bead hybrids may then be contacted
with a sample comprising one or more molecular targets or analytes
to perform one or more assays.
[0101] FIG. 61: illustrates the stabilizing and then pooling of a
panel of individually preassembled antibody-bead hybrids, followed
by contacting with a sample comprising one or more molecular
targets or analytes to perform an assay.
[0102] FIG. 62: illustrates the preassembly of barcoded
oligonucleotide detectable components, comprising a first
oligonucleotide sequence, such as a 20-oligonucleotide universal
sequence, comprising an oligonucleotide sequence complementary to a
universal oligonucleotide conjugated to a molecular probe, and a
second oligonucleotide sequence, such as a 20-oligonucleotide
unique sequence, comprising a sequence that is unique to that
detectable component.
[0103] FIG. 63: illustrates the pooling of the individually
preassembled molecular probe-barcoded oligonucleotide detectable
component hybrids, contacting with a sample comprising one or more
molecular targets or analytes, followed by washing, disassociation
of the hybrids, elution, and analysis.
[0104] FIG. 64: illustrates the process of preassembly with the use
of one or more universal adapters.
[0105] FIG. 65: illustrates the use of detectable components that
comprise an oligonucleotide sequence that has been chemically
modified with fluorescent moieties to enable detection by
fluorescence resonance energy transfer (FRET).
[0106] FIG. 66: illustrates the preassembly of one or more
molecular probes with one or more supports to form a preassembled
affinity matrix or material. The preassembled affinity matrix or
material may then be used, for example, to affinity capture,
purify, and then release one or more molecular targets, such as one
or more biomolecular targets, each as a complex bound to the
particular molecular probe.
[0107] FIG. 67: illustrates a molecular probe conjugated to a
universal oligonucleotide may be combined with a sample comprising
one or more molecular targets to bind the one or more targets,
which may then be captured by a complementary oligonucleotide
conjugated to a support via hybridization.
[0108] FIG. 68 illustrates the Flow cytometric results of the
evaluation of complementary oligonucleotide-dextran-polyfluor
conjugate detectors with increasing number of fluors/dextran
scaffold, according to certain embodiments.
[0109] FIG. 69 illustrates an exemplary scheme for the
incorporation of 4FB-moiety using a 4FB-phosphoamidite (X) on the
5'-end of an oligonucleotide during its solid phase synthesis,
according to certain embodiments.
[0110] FIG. 70 illustrates an exemplary schematic representation of
the process used to purify 4FB-oligonucleotides, according to
certain embodiments.
[0111] FIG. 71A shows results for conjugation of a 4FB-20mer
oligonucleotide (4 mol equiv) to a HyNic-modified antibody,
according to certain embodiments.
[0112] FIG. 71B shows results for a crude a 4FB-20mer
oligonucleotide (5 mol equiv) to a HyNic-modified antibody,
according to certain embodiments.
[0113] FIG. 72 shows a PAGE gel of the conjugation of a 20mer
4FB-oligonucleotide purified (Lane 2) to a HyNic-Peg2-9mer peptide
(1.5 mol equiv (Lane 3) and 3.0 mol equiv (Lane 4)), according to
certain embodiments.
[0114] FIG. 73 shows the flow cytometric results analyzing
antibody-oligonucleotide conjugates hybridized to its complementary
oligonucleotide/dextran/poly-Dy490 detector with respect to the
number of oligonucleotides conjugated to the antibody, according to
certain embodiments.
[0115] FIG. 74 shows Immunoturbidity assay results per certain
embodiments.
[0116] FIG. 75 shows the flow cytometry results of the capture and
detection of .alpha.-BSA antibody using BSA-HyLk1 conjugate
immobilized on Compel-HyLk1' beads from 366 to 0.36 ng.
[0117] FIG. 76 illustrates an exemplary step wise protocol that may
be used to capture and detect an antigen from a biological sample,
according to certain embodiments.
[0118] FIG. 77 illustrates an exemplary schematic representation of
self assembly, according to certain embodiments.
[0119] FIG. 78 illustrates an exemplary schematic representation of
preassembly, according to certain embodiments.
[0120] FIG. 79 presents the flow cytometry results of the binding
of .alpha.-CD8 20, 30 and 40mer hybrids to CD8+ splenocytes,
according to certain embodiments.
[0121] FIG. 80 is an exemplary scheme presenting
hybridization-mediated immunomagnetic separation of Her2+ cells
from a complex mixture of cell, by (A) a binding of a
herceptin-oligonucleotide conjugate and (B) a hybridization to a
complementary oligonucleotide-immobilized paramagnetic bead and
attraction by a magnet, in accordance with certain embodiments.
[0122] FIG. 81 is the flow cytometric results of the isolation of
Her2+ cells from a complex mixture of cells using Herceptin
directly immobilized on magnetic beads to a
herceptin-oligonucleotide conjugate followed by addition of
magnetic beads immobilized with the complementary oligonucleotide,
according to certain embodiments.
[0123] FIG. 82 is an exemplary scheme presenting
hybridization-mediated immunomagnetic separation of CD4.sup.+ cells
and their release by strand displacement of the hybridization by a
displacement oligonucleotide such as a peptide nucleic acid (PNA)
or a locked nucleic acid (LNA), in accordance with certain
embodiments.
[0124] FIG. 83: is a schematic representation of isolation of an
epithelial cell, such as a circulating cancer cell, in a
microfluidic device using a Herceptin antibody-oligonucleotide
conjugate and its complementary oligonucleotide immobilized in a
microfluidic channel while allowing lymphocytes to escape, in
accordance with certain embodiments.
DETAILED DESCRIPTION
[0125] The following description is provided in relation to several
embodiments which may share common characteristics and features. It
is to be understood that one or more features of one embodiment may
be combinable with one or more features of the other embodiments.
In addition, a single feature or combination of features in certain
embodiments may constitute additional embodiments.
[0126] In this specification, the word "comprising" is to be
understood in its "open" sense, that is, in the sense of
"including", and thus not limited to its "closed" sense, that is
the sense of "consisting only of". A corresponding meaning is to be
attributed to the corresponding words "comprise", "comprised" and
"comprises" where they appear.
[0127] The subject headings used in the detailed description are
included only for the ease of reference of the reader and should
not be used to limit the subject matter found throughout the
disclosure or the claims. The subject headings should not be used
in construing the scope of the claims or the claim limitations.
CERTAIN TERMS AND DEFINITIONS
[0128] The term "molecular probe" may refer to a conjugate, for
example, a bioconjugate, comprising a binding moiety and an
oligonucleotide, for example a binding moiety conjugated to an
oligonucleotide. The molecular probe may comprise a biomolecule
conjugated to an oligonucleotide, for example, a
biomolecule-oligonucleotide conjugate, such as an
antibody-oligonucleotide conjugate, an (antibody
fragment)-oligonucleotide conjugate, a protein-oligonucleotide
conjugate, or a peptide-oligonucleotide conjugate. The molecular
probe may comprise a binding moiety, such as a biomolecule,
conjugated to one or more oligonucleotides, for example, conjugated
to two oligonucleotides, three oligonucleotides, or four
oligonucleotides.
[0129] The term "binding moiety" may refer to a moiety, molecule,
or substance that binds at least one target in a sample. For
example, a binding moiety may comprise a biomolecule, a synthetic
molecule, a biopolymer, or a portion of the biomolecule, synthetic
molecule, or biopolymer. Suitable binding moiety may include, but
is not limited to, an antibody, antibody-fragment, such as a single
chain variable fragment ("scFv"), genetically-modified antibody,
genetically-modified antibody-fragment, antigen, a protein, a
peptide, a carbohydrate, a nuclear receptor, a small molecule, a
drug or drug-like molecule, or combinations or derivatives thereof.
The binding moiety may be capable of recognizing and binding a
target. The binding moiety may also comprise a specific binding
affinity for a target. The binding moiety may comprise one or more
oligonucleotides, for example, may be conjugated to one or more
oligonucleotides. The binding moiety may comprise a spacer group.
The binding moiety may also comprise a universal adapter.
[0130] The term "biomolecule" may refer to a compound found in
nature, a derivative of a compound found in nature, a synthetically
modified analog of a compound found in nature, a genetically
engineered analog of a compound found in nature, a genetically
engineered modified analog of a compound found in nature. For
example, biomolecules may be and/or include, but are not limited
to, proteins; antibodies; antibody-fragments; haptens;
glycoproteins; cell-membrane proteins; enzymes, such as alkaline
phosphatase, .beta.-galactosidase, horseradish peroxidase, or
urease; peptides; peptide nucleic acids (PNAs); locked nucleic
acids (LNAs); genetically engineered peptides; genetically
engineered proteins; genetically engineered antibodies; genetically
engineered antibody-fragments; oligonucleotides; RNA; DNA;
saccharide-containing molecules; monosaccharides; disaccharides;
trisaccharides; oligosaccharides; polysaccharides, such as dextran;
small molecules, including drug-like molecules; drugs; antigens,
such as tumor antigens; pathogens; toxins; polymers, including
biopolymers and/or dendrimers; nuclear receptors; nuclear receptor
substrates and/or ligands; cytokines; epitopes, including peptide
epitopes, antigen epitopes, and/or pathogen epitopes; enzyme
substrates; and/or combinations or derivatives thereof.
[0131] The term "biopolymer" may refer to a compound found in
nature, a derivative of a compound found in nature, a synthetically
modified analog of a compound found in nature, a genetically
engineered analog of a compound found in nature, a genetically
engineered modified analog of a compound found in nature, wherein
the biopolymer may be made up of monomeric units. For example,
biopolymers may be and/or include, but are not limited to,
oligonucleotides, RNA, DNA, peptides, peptide nucleic acids (PNAs),
locked nucleic acids (LNAs), derivatized forms of nucleic acids,
proteins including antibodies, glycoproteins, enzymes,
oligosaccharides, and/or derivatives thereof. Examples of monomeric
units include, but are not limited to, nucleotides, nucleosides,
amino acids, PNA monomers, monosaccharides, and derivatives
thereof.
[0132] The term "molecular tag" may refer to a peptide sequence
that is attached to a molecule. For example, the molecular tag may
be a peptide sequence that is recognized as an antigen by an
antibody. The molecular tag may include, but is not limited to, a
poly-histidine tag, for example, a Flag Tag, a Myc-Tag, an S-tag, a
StrepTag, a calmodulin tag, or a peptide tag that an antibody has
been raised against. The molecular tag may be attached to a
molecule by synthetic means, by utilization of recombinant
methodologies, genetic engineering, or combinations thereof. The
molecular tag may be a cloned short stretch of polyhistidines that
is attached either onto the amino or carboxy terminus of a protein.
The molecular tag may be recognized by an antibody. The molecular
tag may form a chelate with a metal ion. For example, the molecular
tag may be a poly-histidine tag or a tetra-cysteine tag that may
form a chelate with a metal ion. Alternatively, the molecular tag
may be a protein domain or other folded peptide domain or domains.
For example, the molecular tag may be a glutathione-S-transferase
tag, a HaloTag.RTM., a maltose binding protein-tag, a monomeric
avidin domain, a protein A immunoglobulin-binding Z domain, a green
fluorescent protein-tag, or a thioredoxin-tag. The protein domain
may bind to another protein, a peptide or a ligand, by non-covalent
or by covalent means.
[0133] The term "modified" may refer to a modification of a
molecule, such as a biomolecule or a biopolymer, either by chemical
synthesis, bio-engineering, or the like. The molecule may be
modified by the attachment of a moiety, for example by a covalent
bond, onto the molecule, such that once attached, the now modified
molecule is capable of reacting with another molecule to form a
conjugate. The moiety may attach to the molecule to form the
modified molecule includes a reactive group, or a linkable group
available to link, i.e., conjugate, to another complementary
reactive group attached to another molecule. The modified molecule
may comprise a reactive group that is protected, and requires
deprotection before being available to link, i.e., conjugate, to
another reactive group attached to another molecule. The
modification of a molecule may further comprise attaching a spacer
group, a molecular tag, a fusion protein comprising a histidine
rich region, or combinations thereof.
[0134] The term "bioconjugate" may refer to a conjugate of at least
two biomolecules, of at least two biopolymers, or at least one
biomolecule and at least one biopolymer. The bioconjugate may also
include one or more linkages between the individual components that
have been conjugated. The bioconjugate may also include one or more
spacer groups between the one or more linkages joining the one or
more individual components, or the spacer group may be between the
individual component and the linkage. For example, the spacer group
may include, but is not limited to an ethyleneoxide moiety, a
polymer formed from repeating--(--CH.sub.2--CH.sub.2O--)--
moieties, PEG, or PEO.
[0135] The term "conjugate" may represent a compound containing at
least two components linked together. The individual components may
be linked directly through one or more covalent bonds, or one or
more ionic bonds, or by chelation, or mixtures thereof. The
linkage, or conjugation, may include one or more spacer groups
between the one or more linkages joining the one or more individual
components, or may be between the individual component and the
linkage. The individual components that may be linked together may
include, but is not limited to biologically derived biopolymers,
modified biopolymers, biologically derived biomolecules, and
synthetically derived molecules. For example, the conjugate may
comprise a first component, such as a protein, that may be linked,
i.e., conjugated, directly through one or more covalent bonds to a
second component, such as an oligonucleotide, to form a conjugate.
The conjugate and/or the linkage of the conjugate may be stable to
thermolysis, stable to hydrolysis, may be biocompatible, or
combinations thereof.
[0136] The term "hybrid" may refer to a multicomponent composition
formed by bringing together at least two conjugates, formed as
disclosed herein and comprised of at least one probe conjugate and
at least one detector conjugate. A probe conjugate, for example,
may be comprised of an antibody, binding protein, nucleic acid
aptamer, ligand, chemical compound and/or other molecule specific
to a target. In certain embodiments, a hybrid would typically be
comprised of a single probe and a single detector wherein the
oligonucleotide component of the probe is complementary to the
oligonucleotide component of the detector. Certain embodiments are
directed to when the probe conjugate is an antibody conjugated to
two or three oligonucleotides. Alternatively, the probe conjugate
may be an antibody conjugated to one, one to two, two to three, two
to four, three to five, four to seven, or five or more
oligonucleotides. Alternatively, the probe conjugate may be an
antibody conjugated to one oligonucleotide sequence, two sequences,
three sequences or three or more sequences. In certain embodiments,
a detector is comprised of a detectable component, inclusive of a
scaffold, a nucleic acid, and/or other chemical compounds, to which
is appended fluorescent or other optically active chemical groups,
or binding moieties such as biotin or digoxigenin, or peptides such
as epitopes, or proteins such as avidin or phycoerythrin or
enzymes, or particles such as quantum dots, or colloidal gold, or
latex beads, or surfaces such as glass or polymers or plastics. In
certain embodiments, the detector is a dextran or other scaffold
covalently modified with multiple fluorophores and a single
oligonucleotide. In other embodiments, the detector is an enzyme,
fluorescent protein, or other protein conjugated to a single
oligonucleotide. Further, a hybrid is formed when complementary
oligonucleotides on a probe conjugate and a detector conjugate are
allowed to anneal or hybridize, based on complementary and base
pairing, to form a double-stranded nucleic acid linkage between the
probe component and the detector component. In certain embodiments
a small volume, around 10, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70,
80, 90 microliters or less, of a solution of an
antibody-oligonucleotide probe conjugate, wherein the antibody
molecule bears two or three oligonucleotides, and then to add a
specific volume, around 50, 75, 100, 125, 150, 200, 225, 250, 300,
or 400 microliters or less, of a solution of a fluorescent dextran
bearing a single complementary oligonucleotide. In certain
embodiments, the concentrations of the first oligonucleotide and
the second complementary oligonucleotide in the final solution
would be approximately equal based on moles of bases that are
available to base pair, allowing nearly complete formation of
double stranded hybridization products. The resulting hybrid would
thus comprise a single antibody linked to one, two or three dextran
scaffolds, where the linker is comprised of a double stranded
nucleic acid. Alternatively, in certain embodiments, a hybrid might
contain a greater number of detectors linked to each probe, thereby
achieving greater sensitivity. In certain embodiments, an antibody
linked to one or more oligonucleotides would be combined with a
detector comprised of a particle or bead or surface coated with a
complementary oligonucleotide. Here, the hybrid would comprise the
particle or bead or surface coated with the probe, linked by
double-stranded nucleic acids. In certain embodiments, an antibody
is joined to a fluorescent dextran in solution, the resulting
hybrid is functionally equivalent, or substantially equivalent, to
an antibody which has been covalently labeled with a fluorophore
and may be used for biological tests in the same manner as a
labeled or tagged antibody, as for direct labeling. In certain
embodiments, the probe is allowed to bind to its target prior to
formation of the hybrid. Here, in certain embodiments, an antigen
is exposed to an antibody-oligonucleotide conjugate as a probe.
Then, a detector, such as the complementary oligonucleotide
covalently linked to a fluorescent dextran or a fluorescent protein
or an enzyme would be introduced. Herein, the annealing or
hybridization of the complementary sequences would then bring the
detector into proximity with the target via its interaction with
the probe. In these embodiments, the hybrid is formed in situ, to
perform indirect labeling. In certain embodiments, where the probe
is an antibody conjugated to one or more than one oligonucleotide,
and the probe is allowed to contact the target, and then, where the
detector is a particle or bead or surface coated with the
complementary oligonucleotide, and the detector is combined with
the target and probe, a hybrid can be formed to capture the target
and probe onto the solid material, by hybridization and formation
of double stranded nucleic acid linkers between the probe and
detector components.
[0137] The term "preassembly" or "preassembly hybridization" or
preassembled hybrids" may refer to assembly via hybridization of
oligonucleotide sequence containing components prior to contacting
a sample or binding a target. For example, a molecular probe and a
detectable component may be preassembled via hybridization prior to
either the molecular probe, the detectable component, or both,
contacting the sample, or prior to the molecular probe recognizing
or binding a target. In certain embodiments, a molecular probe and
a universal adapter may be preassembled via hybridization prior to
either the molecular probe, the universal adapter, or both,
contacting the sample, or prior to the molecular probe recognizing
or binding a target. In certain embodiments, a detectable component
and a universal adapter may be preassembled via hybridization prior
to either the detectable component, the universal adapter, or both,
contacting the sample, or prior to the molecular probe recognizing
or binding a target. In certain embodiments, a molecular probe and
a detectable component and a universal adapter may be preassembled
via hybridization prior to either the molecular probe, the
detectable component, the universal adapter, or combinations
thereof, contacting the sample, or prior to the molecular probe
recognizing or binding a target.
[0138] The term "linkage" may refer to the connection between two
molecules, for example, the connection between two modified
molecules. The linkage may be formed by the formation of a covalent
bond. Suitable covalent linkage may include, but is not limited to
the formation of an amide bond, an oxime bond, a hydrazone bond, a
triazole bond, a sulfide bond, an ether bond, an enol ether bond,
an ester bond, or a disulfide bond. The hydrazone bond may be, for
example, a bis-arylhydrazone bond. The linkage may provide a
UV-traceable characteristic that may be used to detect or quantify
the amount of conjugate formed.
[0139] The term "spacer group" may refer to a molecular moiety or
molecular segment that may join atoms, molecules, or functional
groups together through chemical bonds. Suitable spacer groups may
be of sufficient length or size such that the steric hindrance or
steric clashes between the joined components may be minimized. In
certain embodiments, a molecular probe, such as a
biomolecule-oligonucleotide conjugate may comprise a spacer group
located between the biomolecule and the oligonucleotide. The spacer
group may, for example, minimize steric hindrance between two or
more oligonucleotides on a single biomolecule, such as an antibody;
may minimize steric hindrance between a signal generating moiety
conjugated to an oligonucleotide; and/or may minimize steric
hindrances between multiple signal generating moieties on a single
detectable component and the oligonucleotide on said detectable
component. The spacer group may increase the solubility of the
detectable component or the molecular probe; may reduce steric
hindrance and thereby improve detection efficiency; may prevent
unwanted interactions by shielding the joined components; may
provide a general and significant lower non-specific background for
the detection method and/or system; may reduce steric hindrance and
thereby increase the binding affinity of the molecular probe and/or
the binding moiety for a particular target; may reduce steric
hindrance and thereby decrease the level of the background and risk
of false positive detection signals; may reduce steric hindrance
and thereby increase the hybridization of the molecular probe with
the detectable component and/or universal adapter; may prevent or
minimize the reduction of signal that is generated from a
detectable component when the detectable component is in close
proximity to another detectable component, such as when one signal
generating moiety in close proximity to another signal generating
moiety; or combinations thereof. The spacer may be stable to
thermolysis, stable to hydrolysis, may be biocompatible, or
combinations thereof. Suitable spacer groups may include, but are
not limited to an ethyleneoxide moiety, a polymer formed from
repeating--(--CH.sub.2--CH.sub.2O--)-- moieties, such as
polymerized ethylene oxide, for example, polyethylene glycol (PEG);
polyethylene oxide (PEO); 6-amino-hexanoic acid; succimidyl
4-(N-malemidomethyl)cylohexane-1-carboxylate (SMCC). The spacer
group may also be a homobifunctional spacer group, such as divinyl
sulfone (DVS), glutaric dialdehyde, hexane di-isocyanate,
dimethylapimidate, 1,5-difluoro-2,4-dinitrobenzene. In certain
embodiments, the spacer group may be a heterobifunctional spacer
group, such as N-gamma-maleimidobytyroloxy succinimide ester
(GMBS). The spacer group may be a zero length spacer groups, such
as 1-ethyl-3-(3-dimethylaminopropyl)cabodiimide.
[0140] The term "complementary reactive groups" may represent those
groups that, when reacted together, form a covalent linkage. For
example, a hydrazino group may be complementary to a carbonyl
derivative. For example, an oxyamino group may also be
complementary to a carbonyl derivative. For example, an amino
reactive group may refer to moieties that may react directly with
amine moieties forming amide bonds. For example, a thiol reactive
group may refer to moieties that may react directly with sulfhydryl
groups forming stable sulfide bonds.
[0141] The term "derivative of a compound" may include, for
example, a salt, ester, enol ether, enol ester, solvate or hydrate
thereof that may be prepared. Salts may include, but are not
limited to, pharmaceutically acceptable salts; amine salts; alkali
metal salts, such as but not limited to lithium, potassium and
sodium; alkali earth metal salts, such as but not limited to
barium, calcium and magnesium; transition metal salts, such as but
not limited to nickel, zinc, copper, cobalt, and iron; and other
metal salts, such as but not limited to sodium hydrogen phosphate
and disodium phosphate; and also may include, but is not limited
to, salts of mineral acids, such as but not limited to
hydrochlorides and sulfates; and salts of organic acids, such as
but not limited to acetates, lactates, malates, tartrates,
citrates, ascorbates, succinates, butyrates, valerates and
fumarates. For example, esters may include, but are not limited to,
alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, heteroaralkyl,
cycloalkyl and heterocyclyl esters of acidic groups, including, but
not limited to, carboxylic acids, phosphoric acids, phosphinic
acids, sulfonic acids, sulfinic acids and boronic acids. Enol
ethers may include, but are not limited to, derivatives of formula
C.dbd..dbd.C(OR) where R is hydrogen, alkyl, alkenyl, alkynyl,
aryl, heteroaryl, aralkyl, heteroaralkyl, cycloalkyl or
heterocyclyl. Enol esters may include, but are not limited to,
derivatives of formula C.dbd..dbd.C(OC(O)R) where R is hydrogen,
alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, heteroaralkyl,
cycloalkyl or heterocyclyl. Solvates and hydrates are complexes of
a compound with one or more solvent or water molecule, for example,
1 to about 100, 1 to about 10, 1 to about 2, 3 or 4, solvent or
water molecules.
[0142] The term "amino acid" may refer to .alpha.-amino acids which
are racemic, or of either the D- or L-configuration. The
designation "d" preceding an amino acid designation (e.g., dAla,
dSer, dVal, etc.) refers to the D-isomer of the amino acid. The
designation "dl" preceding an amino acid designation (e.g., dlPip)
refers to a mixture of the L- and D-isomers of the amino acid.
[0143] The term "synthetic molecule" may refer to a small molecule
or polymer that is not naturally derived.
[0144] In certain embodiments, the compounds provided herein may
contain chiral centers. Such chiral centers may be of either the
(R) or (S) configuration, or may be mixtures thereof. For example,
the compounds provided herein may be enantiomerically pure,
diastereomerically pure, or stereoisomerically pure. The compounds
provided herein may also be stereoisomeric mixtures or
diastereomeric mixtures. For example, in the case of amino acid
residues, each residue may be of either the L or D form. The
preferred configuration for naturally occurring amino acid residues
is L.
[0145] The term "oligonucleotide" or "oligonucleotide sequence" or
"oligo" or "oligonucleotide-barcode tag" or "oligo-barcode tag" may
refer to a nucleic acid, including, but not limited to, a
ribonucleic acid (RNA); a deoxyribonucleic acid (DNA); a mixed
ribonucleotide-deoxyribonucleotide, i.e., the oligonucleotide may
include ribose or deoxyribose sugars or a mixture of both; and
analogs thereof; of various lengths; including chromosomes and
genomic material, such as PCR products or sequencing reaction
products, for example, DNA including double and single stranded
forms. Single stranded forms of the oligonucleotides are also
provided. Alternatively, the oligonucleotide may include other
5-carbon or 6-carbon sugars, such as, for example, arabinose,
xylose, glucose, galactose, or deoxy derivatives thereof or other
mixtures of sugars. In certain embodiments, the oligonucleotide may
refer to nucleic acid molecules of 2-2000 nucleosides in length. In
certain embodiments, the oligonucleotide sequence and/or an
oligonucleotide sequence complementary to the oligonucleotide
sequence, may comprise a 3'-oligonucleotide, a 5'-oligonucleotide,
a phosphorothioate, an LNA, a PNA, a morpholino, other alternative
backbones, or combinations or derivatives thereof. Suitable
oligonucleotide may be composed of naturally occurring nucleosides
adenosine, guanosine, cytidine, thymidine and uridine, modified
nucleosides, substituted nucleosides or unsubstituted nucleosides,
purine or pyrimidine base, or combinations thereof. Such purine and
pyrimidine bases include, but are not limited to, natural purines
and pyrimidines such as adenine, cytosine, thymine, guanine,
uracil, or other purines and pyrimidines, such as isocytosine,
6-methyluracil, 4,6-di-hydroxypyrimidine, hypoxanthine, xanthine,
2,6-diaminopurine, 5-azacytosine, 5-methyl cystosine, and the like.
The nucleosides may also be unnatural nucleosides. The nucleosides
may be joined by naturally occurring phosphodiester linkages or
modified linkages. The nucleosides may also be joined by
phosphorothioate linkages or methylphosphonate linkages.
[0146] The term "nucleobase" may refer to a heterocyclic moiety
that is found in naturally occurring oligonucleotides, including
ribonucleic acids (RNA) and deoxyribonucleic acids (DNA), and
analogs thereof, including deaza analogs. The nucleobase may
include, but is not limited to, cytosines, uracils, adenines,
guanines and thymines, and analogs thereof including deaza
analogs.
[0147] The term "nucleotide analog" may refer to a peptide nucleic
acid (PNA) and/or locked nucleic acid (LNA).
[0148] The term "universal adapter" may refer to a substance that
may be capable of linking, for example, by hybridization, a
molecular probe to a detectable component. For example, a universal
adapter may comprise at least two oligonucleotide sequence
segments. The universal adapter may further comprise at least one
polymer and/or at least one spacer group. A universal adapter
comprising the at least two oligonucleotide sequence segments, may,
for example, specifically hybridize a first oligonucleotide
sequence segment of the at least two oligonucleotide sequence
segments to a molecular probe, and specifically hybridize a second
oligonucleotide sequence segment of the at least two
oligonucleotide sequence segments to a detectable component. A
universal adapter may comprise more than two oligonucleotide
sequence segments, for example, multiple segments of the same
oligonucleotide sequence or multiple different oligonucleotide
sequences. The universal adapter may further be used to link one
type of molecular probe to one or more than one different
detectable components, or vice versa. The universal adapter may
also function as "master template" to link a molecular probe to
several different detectable components. A universal adapter may
link detectable component to one or more different kinds of
molecular probes. A universal adapter may enhance and/or increase
the signal generated, and subsequently detected, from a hybridized
molecular probe comprising a bound target and one or more
detectable components, one or more signal generating moieties,
and/or combinations thereof. In certain embodiments, the universal
adapter comprising one or more of the same oligonucleotide sequence
segments may specifically hybridize to one or more detectable
components, which may increase the number of signal generating
moieties linked to a given molecular probe bound to a target in a
sample, wherein the molecular probe is hybridized to said universal
adapter.
[0149] The term "detectable component" may refer to a molecule
comprising one or more signal generating moieties and at least one
oligonucleotide sequence that allow for the detection of the
presence of a target, such as a biological target, in a sample, in
certain embodiments. The at least one oligonucleotide sequence may
be capable of linking or binding, such as by hybridization,
directly to a molecular probe or indirectly to a molecular probe
through an optional universal adaptor. The detectable component may
comprise a signal generating moiety conjugated directly to an
oligonucleotide sequence. The detectable component may comprise one
or more signal generating moieties and an oligonucleotide sequence,
for example, one or more signal generating moieties conjugated
directly to an oligonucleotide sequence. The detectable component
may comprise one or more signal generating moieties and an
oligonucleotide sequence, for example, one or more signal
generating moieties conjugated indirectly to an oligonucleotide
sequence. The detectable component may comprise one or more signal
generating moieties, an oligonucleotide sequence, and a scaffold,
for example, one or more signal generating moieties conjugated
directly scaffold comprising an oligonucleotide sequence, for
example, a scaffold conjugated to an oligonucleotide sequence. For
example, the oligonucleotide sequence may be conjugated directly to
a scaffold, for example a dextran or another hydrophilic polymer or
a dendrimer, comprising one or more signal generating moieties. The
oligonucleotide sequence of the detectable component may be a
complementary oligonucleotide sequence, for example, the
oligonucleotide sequence of the detectable component may be
complementary to an oligonucleotide sequence of a molecular
probe.
[0150] The term "signal generating moiety" may refer to a molecule
which may be detected directly or indirectly so as to reveal the
presence of a target in the sample. In certain embodiments, a
signal generating moiety may be "directly detectable" such that it
may be detected without the need of an additional molecule; for
example, a directly detectable signal generating moiety may be a
fluorescent dye, a luminescent species, a phosphorescent species, a
radioactive substance, a nanoparticle, a diffracting particle, a
raman particle, a metal particle, a magnetic particle, a bead, an
RFID tag, or a microbarcode particle or other combinations thereof.
In certain embodiments, a signal generating moiety may be
"indirectly detectable" such that it may require the employment of
one or more additional molecules to be detected; for example, an
indirectly detectable signal generating moiety may be an enzyme
that effects a color change in a suitable substrate, as well as
other molecules that may be specifically recognized by another
substance carrying a label or react with a substance carrying a
label, an antibody, an antigen, a nucleic acid or nucleic acid
analog, a ligand, a substrate, or a hapten. In certain embodiments,
a signal generating moiety may be a fluorophore, sometimes called a
fluorochrome (a fluorescent compound); chromophores; biofluorescent
proteins, such as phycoerythrin (R-PE), allophycocyanin (APC) and
Peridinin Chlorophyll Protein Complex (PerCP); fluorophore labeled
DNA dendrimers; Quantum Dots or other fluorescent crystalline
nanoparticles; tandem dyes, such as a FRET dye; a chemiluminescent
compound, a electrochemiluminescent label, a bioluminescent label,
a polymer; a polymer particle; a bead or other solid surface; a
Raman particle; a heavy metal chelate; gold or other metal
particles or heavy atoms; a spin label; a radioactive isotope; a
secondary reporter; a hapten; aminohexyl; pyrene; a nucleic acid or
nucleic acid analog; a protein; a peptide ligand or substrate; a
receptor; an enzyme; an enzyme that catalyzes a color change in a
substrate; an enzyme substrate; an antibody; an antibody fragment;
an antigen; or combinations or derivatives thereof.
[0151] The term "scaffold" may comprise a polymer, such as a
hydrophilic polymer, a biopolymer or a biologically inspired
polymer, for example, an acrylate polymer; a substituted polyether;
a substituted polystyrene; a polyethylene oxide; a nucleic acid; a
polysaccharide molecule, such as a dextran; a linear polymer; a
branched polymer; a dendrimer; or combinations or derivatives
thereof. The scaffold, such as a dendrimer, may be labeled by
standard techniques, for example, by the use of fluorochromes (or
fluorescent compounds), enzymes (e.g., alkaline phosphatase and
horseradish peroxidase), heavy metal chelates, secondary reporters
or radioactive isotopes.
[0152] The term "sample" may refer to a composition potentially
containing a target, such as a biological target.
[0153] The term "complex sample" may refer to a sample of material
to be analyzed that has multiple targets. For example, the sample
may contain at least 2, 5, 10, 15, 20, 30, 50, 75, 100, 500, 1000,
5000, 10,000, 50,000, or 100,000 targets. In certain embodiments,
the range of targets may be between 5 to 50, to 100, 25 to 100, 50
to 250, 50 to 5000, 500 to 10,000, 250 to 50,000, 50 to 100,000, 15
to 500, 15 to 1000, 15 to 10,000, or 20 to 10,000. This sample
could be heterogeneous or homogeneous mixture. The complex sample
may also include those described in the term "sample" provided
herein.
[0154] The terms "targets" or "biological targets" may refer to one
or more substances potentially present in a sample that are capable
of detection.
[0155] The term "detection assay" or "detection method" or "method
of detection" or "method for detection" may refer to a singleplex
detection assay or multiplex detection assay.
Molecular Probes, Antibodies and/or Biomolecule-Oligonucleotide
Conjugates
[0156] A suitable molecular probe may comprise, for example, a
monoclonal antibody, polyclonal antibody, antibody fragment, or a
protein fragment, may be conjugated to an oligonucleotide, which
may be detected by a detectable component, comprising a
complementary oligonucleotide sequence and one or more signal
generating moieties, by hybridizing the oligonucleotide of the
molecular probe to the complementary oligonucleotide sequence of
the detectable component. In certain embodiments, the complementary
oligonucleotide may be conjugated to one or more signal generating
moieties. The complementary oligonucleotide may be conjugated to a
scaffold, such as a dendrimer or a dextran, comprising the one or
more signal generating moieties, such as fluorophors, secondary
reporters, for example, a biotin, an enzyme, a heavy metal chelate,
or a radioactive isotope, wherein the one or more signal generating
moieties may be detected. The one or more signal generating
moieties may comprise combinations of different signal generating
moieties. In certain embodiments, the molecular probe may comprise
a binding moiety conjugated to a hapten, wherein the hapten is
further bound to a receptor-oligonucleotide conjugate, for example,
antibody-biotin conjugate, wherein the biotin is further bound to a
Streptavidin-oligonucleotide conjugate, or for example, an
antibody-peptide conjugate, wherein the peptide is further bound to
an anti-peptide-antibody-oligonucleotide conjugate.
[0157] A suitable molecular probe may comprise a binding moiety and
an oligonucleotide, for example, a biomolecule-oligonucleotide
conjugate, such as an antibody-oligonucleotide conjugate, an
(antibody fragment)-oligonucleotide conjugate, a
protein-oligonucleotide conjugate, a (protein
fragment)-oligonucleotide conjugate, a peptide-oligonucleotide
conjugate, may have a molecular weight of between about 15,000
Daltons and about 450,000 Daltons. For example, the molecular
probe, may have a molecular weight of between about 25,000 and
about 400,000 Daltons, about 30,000 and about 350,000 Daltons;
about 15,000 and about 300,000 Daltons; 50,000 and about 250,000
Daltons; about 50,000 and about 200,000 Daltons; about 15,000 and
about 75,000 Daltons; or about 15,000 and about 50,000 Daltons. The
molecular probe, may have a molecular weight of less than or about
450,000 Daltons, 400,000 Daltons, 350,000 Daltons, 300,000 Daltons,
275,000 Daltons, 225,000 Daltons, 200,000 Daltons, 175,000 Daltons,
150,000 Daltons, 120,000 Daltons, 100,000 Daltons, 80,000 Daltons,
60,000 Daltons, 50,000 Dalton, 40,000 Daltons, 30,000 Daltons; or
20,000 Daltons. The molecular weight of the molecular probe may
affect the specific binding affinity to a target.
[0158] As used herein "specific binding" or "specifically binding"
or "binding affinity" in certain embodiments may mean having a
binding affinity as measured by dissociation constant for a
specific target at less than 10.sup.-4 molar (M), 10.sup.-5 M,
10.sup.-6 M, 10.sup.-7 M, 10.sup.-8 M, 10.sup.-9 M, 10.sup.-12 M,
or 10.sup.-15 M.
[0159] As used herein the amount of false positives generated by
the detection methods may mean, in certain embodiments, events
wherein the binding moiety binds to an unintended target in
addition to binding to the desired target. Similarly, as used
herein the amount of false negatives generated by the detection
methods may mean, in certain embodiments, events wherein the
binding moiety binds to an unintended target at the expense of
binding to the desired target. For example, unintended binding of
aggregates, debris, contaminants, plastic, glass or metal contact
surfaces, particles, containers, tubes, filters, and/or pippette
tips. Another example would be an antibody binding to an antigen
for which it has no binding affinity or substantially no binding
affinity. In certain embodiments, the amount of false positives may
be less than 10%, 7%, 5%, 3% or 1% of the true positives. In
certain embodiments, the amount of false positives generated by the
detection methods may be less than those of secondary antibody
detection methods. In certain embodiments, the amount of false
negatives may be less than 10%, 7%, 5%, 3% or 1% of the true
positives. In certain embodiments, the amount of false negatives
generated by the detection methods may be less than those of
secondary antibody detection methods.
[0160] As used herein the solubility of a molecular probe,
comprising a binding moiety conjugated to one or more
oligonucleotides, in certain embodiments may mean a molecular probe
having solubility greater than, the same solubility, substantially
the same solubility, or at least 98%, 95%, 93%, 90%, 85%, 75%, 65%,
or 50% of the solubility of the unconjugated binding moiety. In
certain embodiments, the solubility of the molecular probe may be
sufficient to minimize the non-specific binding to a target. The
solubility of the molecular probe may affect the specific binding
affinity to a target. For example, to one or more biological
targets.
[0161] As used herein neutral charge in certain embodiments may
mean wherein the solubility of a molecular probe does not need to
be enhanced by the addition of a polycharged species. For example,
neutral charge may mean wherein the molecular probe is sufficiently
soluble such that further modification of the molecular probe to
enhance its solubility is unnecessary. In certain embodiments,
neutral charge may mean wherein the molecular probe is sufficiently
soluble to be utilized to be provided to the sample such that
further modification of the molecular probe to enhance its
solubility is unnecessary.
[0162] A suitable antibody or immunoglobulin may comprise, for
example, natural antibodies, artificial antibodies, genetically
engineered antibodies, monovalent antibodies, polyvalent
antibodies, monoclonal antibodies, polyclonal antibodies, camelids,
monobodies, scFvs and/or fragments or derivatives thereof. In
certain applications, the antibody or immunoglobulin molecules may
be monoclonal, polyclonal, monospecific, polyspecific, humanized,
single-chain, chimeric, camelid single domain, shark single domain,
synthetic, recombinant, hybrid, mutated, CDR-grafted antibodies,
and/or fragments or derivatives thereof. In certain embodiments,
antibodies may be derived from mammal species, for example, rat,
mouse, goat, guinea pig, donkey, rabbit, horse, lama, camel, or
avian species, such as chicken or duck. The origin of the antibody
is defined by the genomic sequence irrespective of the method of
production. The antibodies may be of various isotypes, e.g., IgG,
IgM, IgA, IgD, IgE or subclasses, e.g., IgG1, IgG2, IgG3, IgG4. The
antibodies may be produced recombinantly, or by other means, which
may include antibody fragments which can still bind antigen, for
example, an Fab, an F(ab).sub.2, Fv, scFv, VhH, and/or V-NAR. The
antibody, including an antibody fragment, may be recombinantly
engineered to include an epitope, for example, a peptide. In
certain embodiments, the epitope may be a Myc tag, a FLAG tag, an
HA tag, an S tag, a Streptag, an His tag, a V5 tag. In certain
embodiments, the peptide tag may serve as a FlAsh tag, a
biotinylation tag, Sfp tag, or other peptide subject to covalent
modification. The antibody may be chemically modified to include a
hapten, for example a small molecule or a peptide. The hapten may
be a nitrophenyl group, a dinitrophenyl group, a digoxygenin, a
biotin, a Myc tag, a FLAG tag, an HA tag, an S tag, a Streptag, a
His tag, a V5 tag, a ReAsh tag, a FlAsh tag, a biotinylation tag,
Sfp tag, or other chemical or peptide tag subject to covalent
modification. Inclusion of an epitope or hapten in an antibody or
antibody fragment may facilitate subsequent binding of a molecular
probe, detectable component, binding moiety, or signal generating
moiety. In certain embodiments, peptide tag haptens chemically
conjugated to protein binders can be used in conjunction with
anti-peptide tag antibody-signal detector conjugates in singleplex
and multiplex immundetection assays, such as immunohistochemistry
(IHC), flow cytometry, microscopy, imaging, high content screening
(HCS), immunocytochemistry (ICC), immunomagnetic cellular
depletion, immunomagnetic cell capture, in situ hybridization
(ISH), enzyme immuno-assay (EIA), enzyme linked immuno-assay
(ELISA), ELISpot, arrays including bead arrays, multiplex bead
array, microarray, antibody array, cellular array, solution phase
capture, chemiluminescence detection, infrared detection, blotting
method, a Western blot, a Southern blot, a Southwestern blot,
labeling inside an electrophoresis system, labeling on a surface,
labeling on an array, PCR amplification, elongation followed by PCR
amplification, immunoprecipitation, co-immunoprecipitation,
chromatin immunoprecipitation, pretargeting imaging, therapeutic
agent, or combinations thereof. The antibody may include, for
example, hybrid antibodies having at least two antigen or epitope
binding sites, single polypeptide chain antibodies, bispecific
recombinant antibodies (e.g. quadromes, triomes), interspecies
hybrid antibodies, and molecules that have been chemically modified
and may be regarded as derivatives of such molecules and which may
be prepared either by methods of antibody production or by DNA
recombination, using hybridoma techniques or antibody engineering
or synthetically or semisynthetically.
[0163] A suitable polyclonal antibody may be produced through a
variety of methods. For example, various animals may be immunized
for this purpose by injecting them with an antigen, for example the
target biological molecule, or another molecule sharing an epitope
of the target biological molecule. Such antigen molecules may be of
natural origin or obtained by DNA recombination or synthetic
methods, or fragments thereof and the desired polyclonal antibodies
are obtained from the resulting sera and may be purified.
Alternatively, intact cells that array the target biological
molecule may be used. Various adjuvants may also be used for
increasing the immune response to the administration of antigen,
depending on the animal selected for immunization. Examples of
these adjuvants include Freund's adjuvant, mineral gels such as
aluminum hydroxide, surfactant substances such as polyanions,
peptides, oil emulsions, haemocyanins, dinitrophenol or
lysolecithin.
[0164] A suitable primary antibody may contain an antigen binding
region which can specifically bind to an antigen target in a
sample, such as an immunohistochemistry sample, may be employed.
For example, a primary antibody may be comprised within a primary
binding moiety or a primary molecular probe. A suitable secondary
antibody may contain an antigen binding region which can
specifically bind to the primary antibody, for example, the
constant region of the primary antibody. The secondary antibody may
be conjugated to a polymer. The polymer may be conjugated with
between about 2-20 secondary antibodies, or may be conjugated with
between about 1-5 tertiary antibodies, such as 1, 2, 3, 4, or 5
tertiary antibodies. The secondary antibody may act as a secondary
binding moiety, while in other embodiments, the secondary antibody
may act as molecular probe, recognizing the target, such as an
antigen, indirectly through a primary antibody. A suitable tertiary
antibody may contain an antigen binding region which can
specifically bind to the secondary antibody, for example, a
constant region of the secondary antibody, or a hapten linked to
the secondary antibody or a polymer conjugated to the secondary
antibody. For example, the tertiary antibody may be conjugated to a
polymer, such as between about 1-20 tertiary antibodies. The
polymer may be conjugated with between about 1-5 tertiary
antibodies, such as 1, 2, 3, 4, or 5 tertiary antibodies. The
tertiary antibody may act as a tertiary binding moiety. In other
embodiments, the tertiary antibody may act as molecular probe,
recognizing the target, such as an antigen, indirectly through a
primary antibody and a secondary antibody.
[0165] The stoichiometry of the conjugation reaction to form the
biomolecule-oligonucleotide conjugates, for example, the
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, (protein fragment)-oligonucleotide conjugates, or
peptide-oligonucleotide conjugates, may comprise one equivalent of
modified biomolecule and at least 0.5 equivalents of modified
oligonucleotide. Other examples are at least 1.0 equivalent, at
least 1.5 equivalents, at least 2.0 equivalents, at least 2.5
equivalents, at least 3.0 equivalents, at least 3.5 equivalents, or
at least 4.0 equivalents of modified oligonucleotide. The
stoichiometry of the conjugation reaction to form the
biomolecule-oligonucleotide conjugates, may comprise one equivalent
of modified biomolecule and between about 0.5 and about 2.0 of
modified oligonucleotide, for example, between about 1.5 and about
2.5 equivalents, between about 2.0 and about 2.5 equivalents,
between about 2.0 and about 3.0 equivalents, between about 2.5 and
about 3.5 equivalents, between about 3.0 and about 3.5 equivalents,
between about 3.0 and about 4.0 equivalents, or between about 3.5
and about 4.5 equivalents modified oligonucleotide. In certain
embodiments, the stoichiometry of the conjugation reaction may be
adjusted to form biomolecule-oligonucleotide conjugates, for
example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates, that retain sufficient immunoreactivity of the
biomolecule, such as an antibody, that has been conjugated.
[0166] Suitable molecular probes, such as
biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, (protein fragment)-oligonucleotide conjugates, or
peptide-oligonucleotide conjugates, may be the conjugation product
of one modified biomolecule and on average between 1.0 and 2.0
modified oligonucleotides that have conjugated to the modified
biomolecule. For example, the biomolecule-oligonucleotide
conjugates may be the conjugation product of one modified
biomolecule and on average between 1.0 and 2.0, between 1.5 and
2.5, between 2.0 and 2.5, between 2.0 and 3.0, between 2.5 and 3.5,
between 2.5 and 3.0, between 3.0 and 4.0, between 3.0 and 3.5, or
between 3.5 and 4.5 modified oligonucleotides that have conjugated
to the modified biomolecule.
[0167] Suitable molecular probes, such as
biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, (protein fragment)-oligonucleotide conjugates, or
peptide-oligonucleotide conjugates, may comprise on average a molar
ratio of about 1:1 to about 1:4.5, about 1:1 to about 1:4, about
1:1 to about 1:3.5, about 1:1 to about 1:3, about 1:1 to about
1:2.5, about 1:1 to about 1:2 or about 1:1 to about 1:1.5
biomolecule to oligonucleotides. In certain embodiments, the
molecular probes may comprise on average a molar ratio of about
1:1, 1:2, 1:3, or 1:4 biomolecule to oligonucleotides.
[0168] A suitable molecular probe may comprise a binding
specificity for an analyte, such as a target and/or biological
target, for example, a binding specificity of about 10.sup.-4 M to
about 10.sup.-15 M, about 10.sup.-5 M to about 10.sup.-15 M, about
10.sup.-6 M to about 10.sup.-15 M, about 10.sup.-7 M to about
10.sup.-15 M, about 10.sup.-9 M to about 10.sup.-15 M, or about
10.sup.-12 M to about 10.sup.-15 M for an analyte.
[0169] The biomolecule-oligonucleotide conjugates may be a mixture
of biomolecule-oligonucleotide conjugates having modified
oligonucleotides that have been conjugated to the modified
biomolecule, but wherein the linkage points of the oligonucleotides
to the biomolecule are not uniformly identical across the entire
sample. For example, a prepared, purified and isolated
biomolecule-oligonucleotide conjugates sample may have one
biomolecule-oligonucleotide conjugate that has one set of linkage
points for each of the oligonucleotides conjugated to the
biomolecule, and the same sample may have a different
biomolecule-oligonucleotide conjugate that has a similar number of
oligonucleotides conjugated to that biomolecule, but having a
different set of linkage points for each of those oligonucleotides
conjugated.
[0170] Suitable molecular probes may specifically bind to a
molecule expressed by diseased cells and another molecular probe
may specifically bind to another molecule expressed by disease
cells. For example, such embodiments may be useful for diagnosing a
disease in a subject where the disease may be better diagnosed by
detecting a combination of two or more markers in a sample. In
these embodiments, one or more molecular probes that specifically
bind to a cell type specific marker also can be utilized. The
sample may be from various sources, and may be a particular set of
cells or group of cells from a subject or patient.
[0171] Suitable molecular probes may specifically bind to a
molecule expressed by a particular organism and another molecular
probe may specifically bind to another molecule expressed by the
organism. These embodiments may be useful for detecting an organism
in a sample where the organism may be better detected by
identifying two or more markers in a sample. In certain
embodiments, the one or more molecular probes may specifically bind
to a cell type specific marker. Such embodiments may be useful for
detecting a particular strain of organism in a sample (e.g., a
biological sample, a sample from animal meat for human consumption,
or an environmental sample), where the strain is specifically
detected by a combination of a genus-associated molecule and a
species-associated molecule, for example. Such embodiments may be
useful for detecting a pathogenic organism in a biological sample
for diagnosing a disease caused by the organism (e.g., hepatitis C
infection in a human blood sample), and for detecting a particular
organism in an environmental sample for agricultural and
anti-bioterrorism applications. For example, a molecular probe may
be used to detect the presence, absence or levels of beneficial
bacteria in soil to determine suitability for growing crops, and
for detecting a pathogenic organism such as anthrax in soil or
water samples for combating bioterrorism.
[0172] Suitable modified biomolecules may be prepared by reaction
of a biomolecule of interest with one of the functionalities of a
bifunctional reagent. The modified biomolecules are then available
for conjugation or immobilization using the remaining functional
group. In certain embodiments, the modified biomolecule may
comprise one or more of the following, comprising a modified
protein; a modified peptide; a modified antibody; a modified
glycoprotein; a modified monosaccharide; a modified disaccharide; a
modified trisaccharide; a modified polysaccharide; a modified
dextran; a modified drug-like molecule; a modified drug; a modified
small molecule; a modified pathogen; a modified toxin; a modified
polymer; a modified biopolymer; a modified dendrimer; a modified
nuclear receptor; a modified nuclear receptor ligand; a modified
cytokine; a modified epitope; a modified peptide epitope; a
modified antigen epitope; a modified pathogen epitope; a modified
enzyme; a modified enzyme substrate; a modified cell-membrane
protein; and/or combinations or derivatives thereof.
[0173] As used herein the efficiency of the hybridization of a
conjugated oligonucleotide sequence to a conjugated complementary
oligonucleotide sequence in certain embodiments may mean a
conjugated oligonucleotide sequence and conjugated complementary
oligonucleotide sequence having a hybridization efficiency of at
least 98%, 95%, 93%, 90%, 85%, 75%, 65%, or 50% of the
hybridization efficiency of the unconjugated oligonucleotide. In
certain embodiments, hybridization of at least 98% of a conjugated
oligonucleotide sequence to a conjugated complementary
oligonucleotide sequence may be obtained by equimolar concentration
of the conjugated complementary oligonucleotide sequence. In some
embodiments, hybridization of at least 98% of a conjugated
oligonucleotide sequence to a conjugated complementary
oligonucleotide sequence may be obtained by providing an excess of
the conjugated complementary oligonucleotide sequence, one and one
tenth fold, one and one half fold, two fold, five fold, ten fold,
one hundred fold, or one thousand fold.
Detection--Multiplex, Signal Generating Moiety
[0174] The oligonucleotide sequence on the detectable component may
be a unique, distinguishable, and/or specifically designed
oligonucleotide sequence complementary to the oligonucleotide
sequence of the selected molecular probe. The oligonucleotide
sequence on the molecular probe may be a unique, distinguishable,
and/or specifically designed oligonucleotide sequence complementary
to the oligonucleotide sequence of the selected detectable
component. For example, a sample having a first and a second target
may be detected by a first molecular probe binding to a first
target that is specifically hybridized with a first detectable
component having a specifically designed complementary
oligonucleotide sequence to the first molecular probe, and a second
molecular probe binding to a second target is specifically
hybridized with a second detectable component having a specifically
designed complementary oligonucleotide sequence to the second
molecular probe. This flexibility to design the oligonucleotide
sequences of the molecular probes and the detectable components
permits the detection of multiple targets in a sample. For example,
this permits the specific design of a multi-plex detection system
wherein the target-bound molecular probe may be detected with a
choice of a great number of signal generating moieties, as compared
to a directly labeled binding moiety, such as a labeled secondary
antibody. This flexibility permits the specific design of a
multi-plex detection system wherein the binding affinity of the
molecular probe for the particular target is maintained and
unperturbed, as compared to a directly labeled binding moiety, such
as a labeled secondary antibody, which may be altered by the
presence of one or more signal generating moieties.
[0175] Enhanced signal, in certain embodiments, may mean wherein
the enhancement of the signal may be related to the structure and
nature of the detectable component, such as the structure and
nature of the scaffold conjugated to the oligonucleotide. For
example, the enhancement of the signal may be related to the number
of signal generating moieties. The one or more detectable
components may provide an enhanced signal that minimizes detection
errors from background noise. The one or more signal generating
moieties may provide an enhanced signal that minimizes detection
errors from background noise. In certain embodiments, the enhanced
signal may be at least twice the signal of a detectable component
comprising a single signal generating moiety conjugated to an
oligonucleotide, such as at least 3.times., 4.times., 5.times.,
7.times., 9.times., or 10.times.. In certain embodiments, the
amount of enhanced signal may be higher, for example, at least
20.times., 30.times., 50.times., 100.times., 500.times.,
1000.times., 10,000.times., and 100,000.times. the signal of a
detectable component comprising a single signal generating moiety
conjugated to an oligonucleotide. By enhancing the signal this may
have the advantage of reducing or further minimizing detection
errors from background noise. For example, in certain embodiments,
the detections errors may be reduced or further minimized by at
least 5%, 7%, 9%, 10%, or 15%.
[0176] A suitable detectable component may comprise one or more
universal adapters; may comprise at least one polymer and/or at
least one spacer groups; or combinations thereof. In certain
embodiments, the detectable component may be used to detect one or
more targets, at least two targets, at least 3 targets; at least 4;
at least 5; at least 10; at least 15; at least 20; at least 25; at
least 30; at least 35; at least 40; at least 45; at least 50; at
least 75; at least 100; at least 125; at least 150; at least 200;
at least 400; at least 1,000; at least 4,000; at least 10,000; or
detect at least 50,000 targets within a sample. In certain
embodiments, multiple targets in a sample may not be expressed in
equal amounts, which may require differential amplification.
[0177] A suitable detectable component may comprise one or more
signal generating moieties, for example, a detectable component may
comprise an average of between about 1 to about 100,000, about 1 to
about 10,000, about 1 to about 1,000, about 1 to about 500, about 1
to about 100, about 1 to about 50, about 1 to about 20, about 1 to
about 10, about 1 to about 5, about 5 to about 50,000, about 5 to
about 5,000, about 5 to about 1,000, about 5 to about 100, about 5
to about 50, about 5 to about 20; or about 5 to about 10 signal
generating moieties.
[0178] The stoichiometry of the conjugation reaction to form the
detectable components, for example, a complementary
oligonucleotide-signal generating moiety conjugate, or a
complementary oligonucleotide-scaffold conjugate, wherein the
scaffold comprises one or more signal generating moieties, may
comprise one equivalent of modified signal generating moiety and at
least 0.5 equivalents of modified complementary oligonucleotide or
may comprise one equivalent of modified scaffold, comprising one or
more signal generating moieties, and at least 0.5 equivalents of
modified complementary oligonucleotide. For example, the
stoichiometry of the conjugation reaction to form the detectable
components, comprising a complementary oligonucleotide-signal
generating moiety conjugate, may comprise one equivalent of
modified signal generating moiety and at least 1.0 equivalents, 1.5
equivalents, 2.0 equivalents, 2.5 equivalents, 3.0 equivalents, 3.5
equivalents, or 4.0 equivalents of modified complementary
oligonucleotide. For example, the stoichiometry of the conjugation
reaction to form the detectable components, comprising a
complementary oligonucleotide-scaffold conjugate, wherein the
scaffold comprises one or more signal generating moieties, may
comprise one equivalent of modified scaffold and at least 1.0
equivalents, 1.5 equivalents, 2.0 equivalents, 2.5 equivalents, 3.0
equivalents, 3.5 equivalents, or 4.0 equivalents of modified
complementary oligonucleotide.
[0179] Suitable detectable components, may comprise a molar ratio
of about 1:1 complementary oligonucleotide to signal generating
moiety. For example, the detectable component, may comprise a molar
ratio of about 1:1 complementary oligonucleotide to scaffold,
wherein the scaffold, such as dextran, comprises one or more signal
generating moieties, such as one or more fluorophors. In certain
embodiments, the number of signal generating moieties may be
adjusted depending on the length of the scaffold, such as dextran
or dendrimer that is utilized. For example, longer scaffolds, such
as longer dextrans, may be utilized to increase the number of
signal generating moieties on a detectable component. In certain
embodiments, adjusting the number of signal generating moieties,
for example, increasing the number, may adjust the sensitivity of
detection, such increase the sensitivity of detection.
[0180] In certain embodiments, one or more complementary detectors
wherein the fluorophores are directly conjugated to the
oligonucleotide. These multi-fluor detectors may be prepared from
an oligonucleotide of 15-70 bases wherein 2-10 fluorophores are
directly conjugated to 2-10 bases modified with reactive linker
groups, e.g., amino groups, attached to the base wherein the
hydrogen bonding of the base is substantial not affected (or not
affected), i.e., on its minor groove side, and the fluorophores are
spaced apart such that FRET does not occur or is minimized. In
certain embodiments, the number of bases may vary, for example, 10
to 30, 15 to 20, 15 to 30, 20 to 60, 40 to 70, etc. In certain
embodiments, the number of fluorophores may vary, for example, 2 to
5, 3 to 8, 2 to 8, 4 to 10, 5 to 9, etc. FIG. 78 schematically
presents the (A) preparation of the multi-fluor oligonucleotide,
(B) its hybridization to an antibody-complementary oligonucleotide
conjugate and (C) it binding to an antigen on a cell membrane,
according to certain embodiments. It is recognized that the order
of assembly may be changed wherein the antibody-oligonucleotide
conjugate is added to the cell, allowed to bind, washed and then
the multi-fluor hybrid is added and allowed to hybridized. FIG. 77
is a schematic presentation, according to certain embodiments, of
the use of antibody-oligonucleotide conjugates and complementary
oligonucleotides to which fluorophores are directly conjugated
wherein the antibody-oligonucleotide conjugate is added to the
biological sample and allowed to bind and subsequently detected by
the addition of the complementary oligonucleotide to which
fluorophores are directly conjugated.
[0181] A suitable signal generating moiety may be detected by the
presence of a color, or a change in color in the sample. In certain
embodiments, more than one type of signal generating moiety may be
used, for example, by attaching distinguishable signal generating
moiety to a single detectable component or by using more than one
detectable component, each carrying a different and distinguishable
signal generating moiety.
[0182] A suitable signal generating moiety may be a protein, such
as an enzyme, for example, alkaline phosphatase (AP); Horseradish
Peroxidase (HRP); beta-galactosidase (.beta.GAL);
glucose-6-phosphate dehydrogenase; beta-N-acetylglucosaminidase;
beta-glucuronidase; invertase; Xanthine Oxidase; firefly
luciferase; or glucose oxidase (GO). Substrates that may be used
for horse radish peroxidase (HRP) may include 3,3'-diaminobenzidine
(DAB); diaminobenzidine with nickel enhancement;
3-amino-9-ethylcarbazole (AEC); benzidine dihydrochloride (BDHC);
Hanker-Yates reagent (HYR); lndophane blue (IB);
tetramethylbenzidine (TMB); 4-chloro-1-naphtol (CN);
.alpha.-naphtol pyronin (.alpha.-NP); o-dianisidine (OD);
5-bromo-4-chloro-3-indolylphosphate (BCIP); Nitro blue tetrazolium
(NBT); 2-(p-iodophenyl)-3-p-nitrophenyl-5-phenyl tetrazolium
chloride (INT); tetranitro blue tetrazolium (TNBT); or
.delta.-bromo-chloro-5-indoxyl-beta-D-galactoside/ferro-ferricyanide
(BCIG/FF). Substrates that may be used for Alkaline Phosphatase may
include Naphthol-AS-B 1-phosphate/fast red TR (NABP/FR);
Naphthol-AS-MX-phosphate/fast red TR (NAMP/FR); Naphthol-AS-B
1-phosphate/fast red TR (NABP/FR); Naphthol-AS-MX-phosphate/fast
red TR (NAMP/FR); Naphthol-AS-B1-phosphate/new fuschin (NABP/NF);
bromochloroindolyl phosphate/nitroblue tetrazolium (BCIP/NBT); or
5-Bromo-4-chloro-3-indolyl-.beta.-.delta.-galactopyranoside
(BCIG).
[0183] Other suitable signal generating moieties may be a heavy
metal chelate, for example, europium, lanthanum, yttrium, gold; a
dendrimer of heavy metal chelates; gold particles; or coated gold
particles, which may be converted by silver stains. Other suitable
signal generating moieties may be a stable isotope bound to a
chelator, for example, a polymer-based heavy metal chelates
conjugated to antibodies and/or other binders may be used to
multiplex protein analysis using a technique named CyTOF (CYtometry
Time Of Flight). Heavy metal isotopes of Ru, Rh, Pd, Ag, In, La,
Hf, Re, Ir, Pt, Au, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb
and/or Lu may be used. In certain embodiments, a signal generating
moiety may be a radioactive isotope, for example, .sup.125I,
.sup.131I, .sup.3H, .sup.14C, .sup.35S, a radioactive isotop
cobalt; a radioactive isotope of selenium; or a radioactive isotope
of phosphorous. In certain embodiments, a signal generating moiety
may be a secondary reporter, for example, biotin, streptavidin,
avidin, digoxigenin, dinitrophenyl. In certain embodiments, the
signal generating moiety, such as a hapten, may be conjugated to a
fluorophore, peptide, nitrotyrosine, biotin, avidin, strepavidin,
2,4-dinitrophenyl, digoxigenin, bromodeoxy uridine, sulfonate,
acetylaminoflurene, mercury trintrophonol, or estradiol. In certain
embodiments, a signal generating moiety may be a polymer particle;
micro particle; a bead; a latex particle of polystyrene, PMMA or
silica. In certain embodiments, a signal generating moiety may be a
particle embedded with specific isotopes of heavy metals in defined
relative abundance as a barcode. In certain embodiments, a signal
generating moiety may be a particle embedded with fluorescent dyes,
or polymer micelles or capsules which may contain dyes, enzymes or
substrates. In certain embodiments, a signal generating moiety may
be luminol, isoluminol, acridinium esters, 1,2-dioxetanes,
pyridopyridazines, and/or ruthenium derivatives.
[0184] For example, a signal generating moiety may be a
fluorophore. Fluorescence generally refers to the physical process
in which light is emitted from the compound after a short interval
following absorption of radiation. Generally, the emitted light is
of lower energy and longer wavelength than that absorbed. In
certain embodiments, the energy may be transferred from one
fluorophore to another prior to emission of light. In certain
embodiments, the fluorescence of the fluorophores used herein can
be detected using standard techniques to measure fluorescence. The
fluorophore may be, for example, fluorescein, or its derivatives,
such as fluorescein-5-isothiocyanate (FITC), 5-(and
6)-carboxyfluorescein, 5- or 6-carboxyfluorescein,
6-(fluorescein)-5-(and 6)-carboxamido hexanoic acid, fluorescein
isothiocyanate; rhodamine, or its derivatives, such as
tetramethylrhodamine and
tetramethylrhodamine-5-(and-6)-isothiocyanate (TRITC). In certain
embodiments, the fluorophore may comprise coumarin dyes, such as
(diethyl-amino)coumarin or 7-amino-4-methylcoumarin-3-acetic acid,
succinimidyl ester (AMCA); sulforhodamine 101 sulfonyl chloride,
TexasRed.TM., TexasRed.TM. sulfonyl chloride;
5-(and-6)-carboxyrhodamine 101, succinimidyl ester, also known as
5-(and-6)-carboxy-X-rhodamine, succinimidyl ester (CXR); lissamine
or lissamine derivatives such as lissamine rhodamine B sulfonyl
Chloride (LisR); 5-(and-6)-carboxyfluorescein, succinimidyl ester
(CFI); fluorescein-5-isothiocyanate (FITC);
7-diethylaminocoumarin-3-carboxylic acid, succinimidyl ester
(DECCA); 5-(and-6)-carboxytetramethylrhodamine, succinimidyl ester
(CTMR); 7-hydroxycoumarin-3-carboxylic acid, succinimidyl ester
(HCCA); 6-fluorescein-5-(and-6)-carboxamidolhexanoic acid (FCHA);
N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-3-indacenepropionic
acid, succinimidyl ester; also known as 5,7-dimethyl BODIPY.TM.
propionic acid, succinimidyl ester (DMBP); "activated fluorescein
derivative" (FAP), available from Molecular Probes, Inc.;
eosin-5-isothiocyanate (EITC); erythrosin-5-isothiocyanate (ErITC);
and Cascade.TM. Blue acetylazide (CBAA) (the O-acetylazide
derivative of 1-hydroxy-3,6,8-pyrenetrisulfonic acid). In certain
embodiments, the fluorophore may comprise fluorescent proteins such
as phycoerythrin, allophycocyanin, green fluorescent protein and
its analogs or derivatives, fluorescent amino acids such as
tyrosine and tryptophan and their analogs, fluorescent nucleosides,
and other fluorescent molecules such as organic dyes, including
Cy2, Cy3, Cy 3.5, Cy5, Cy5.5, Cy 7, IR dyes, Dyomics dyes, Oregon
green 488, pacific blue, rhodamine green, and Alexa dyes. In
certain embodiments, the fluorophore may take advantage of
fluorescence energy transfer and comprise conjugates of
R-phycoerythrin or allophycocyanin to organic dyes, such as Cy2,
Cy3, Cy 3.5, Cy5, Cy5.5, Cy 7, Dyomics dyes, or Alexa dyes. In
certain embodiments, the fluorophore may comprise an inorganic
fluorescent colloidal particle such as a quantum dot or other
fluorescent nanoparticle, such as particles based on semiconductor
material like CdS-coated CdSe nanocrystallites.
[0185] In certain embodiments, the signal generating moiety may be
linked to the oligonucleotide sequence by a covalent attachment or
a non-covalent attachment. The signal generating moiety may also be
linked to the oligonucleotide sequence before, during, or after the
hybridization event.
[0186] In certain embodiments, a molecular probe, universal
adaptor, and/or detectable component may be pre-hybridized prior to
bringing the composition into contact with a sample, comprising one
or more molecular targets. For example, three or more, four or
more, five or more molecular probes, universal adapters, and/or
detectable components, may be pre-hybridized prior to bringing the
composition into contact with a sample comprising one or more
molecular targets. In certain embodiments, two or more molecular
probes, universal adapters, and/or detectable components, each of
which may comprise one or more spacer groups, may be pre-hybridized
prior to bringing the composition into contact with a sample,
comprising one or more molecular targets.
Samples and/or Targets
[0187] A suitable sample may comprise one or more targets, such as
one or more of a protein; a peptide; a carbohydrate; a nucleic
acid; a lipid; a small molecule; a toxin; a drug or drug-like
molecule, or derivatives thereof; or may comprise a combination of
targets that may be proteins; peptides; carbohydrates; nucleic
acids; lipids; small molecules; toxins; drugs or drug-like
molecules, or derivatives thereof. For example, a sample may
comprise a defined combination of natural and/or chemically
synthesized species. In certain embodiments, the composition of a
sample may not be fully known. The sample may include a cell, a
group of cells, may be prepared from a cell or group of cells, may
be a purified fraction from a cell preparation, may be a purified
molecule. For example, the sample may comprise cells, such as
mammalian cells (e.g., human cells); insect cells; yeast cells;
fungal cells; and/or bacterial cells. The cells, for example, may
be from multicellular organism (e.g., insects and mammals) derived
from specific portions of the organism (e.g., specific tissues,
organs, or fluids). Cells may be contacted by hybrids in vitro or
in vivo, and may be contacted by hybrids when in suspension or when
attached to a solid surface. Cells may not be significantly
modified during the process, may be fixed to a solid support,
and/or may be made permeable using standard methods. The sample may
include cells, products produced by cells, cellular components,
and/or mixtures thereof. The sample may include cellular
components, such as a nucleus, cytoplasm, plasma cell membrane,
nucleolus, mitochondria, vacuoles, subcellular organelles,
endoplasmic reticulum and/or Golgi apparatus. The sample may
include cells, tissue samples, and/or organs, such as molecular
antigens produced from groups of cells, tissue samples, and/or
organs. In certain embodiments, the sample may comprise or be
derived from, but not limited to, clinical, industrial,
agricultural and environmental samples. For example, sample
material often may be of medical, veterinary, environmental,
nutritional or industrial significance, and include body fluids,
such as blood, serum, plasma, cerebrospinal fluid, synovial fluid,
saliva, milk, sputum, lung aspirates, mucus, teardrops, exudates,
secretions, urine, and fecal matter; microbial culture fluids;
aerosols; crop materials; animal meat (e.g., for human consumption
or animal feed); and soils and ground waters. In certain
embodiments, the sample may comprise, but is not limited to,
molecules in pathogens, viruses, bacteria, yeast, fungi, amoebae
and insects; molecules in diseased or non-diseased pest animals
such as mice and rats; molecules in diseased and non-diseased
domestic animals, such as domestic equines, bovines, porcines,
caprines, canines, felines, avians and fish; and molecules in
diseased and non-diseased humans. In certain embodiments, the
sample may comprise, but is not limited to, biological samples
derived from a human or other animal source (such as, for example,
body fluids, such as blood, serum, plasma, cerebrospinal fluid,
synovial fluid, saliva, milk, sputum, lung aspirates, mucus,
teardrops, exudates, secretions, urine, a biopsy sample, a
histology tissue sample, a PAP smear, a mole, a wart, etc.)
including samples derived from a bacterial or viral preparation, as
well as other samples (such as, for example, agricultural products,
waste or drinking water, milk or other processed foodstuff, air,
etc.). In certain embodiments, the sample may comprise one or more
of the following: tissue cells, cells cultured in vitro,
recombinant cells, infected cells, cells from laboratory animals,
cells from mammal patients, cells from human patients, mesenchemal
stem cells, stem cells, immuno-competent cells, adipose cells,
fibroblasts, natural-killer cells (NK-cells), monocytes,
lymphocytes, lymph node cells, T-cells, B-cells, exudate cells,
effusion cells, cancer cells, blood cells, red blood cells,
leukocytes, white blood cells, organ cells, skin cells, liver
cells, splenocytes, kidney cells, intestinal cells, lung cells,
heart cells, or neuronal cells.
[0188] Suitable samples may comprise a range of analytes, such as
targets and/or biological targets, having a wide range of binding
specificities, for example, about 10.sup.-4 M to about 10.sup.-15
M, about 10.sup.-5 M to about 10.sup.-15 M, about 10.sup.-6 M to
about 10.sup.-15 M, about 10.sup.-7 M to about 10.sup.-15 M, about
10.sup.-9 M to about 10.sup.-15 M, or about 10.sup.-12 M to about
10.sup.-15M.
[0189] As used herein homogeneous in certain embodiments may mean a
sample having substantially the same class of targets, or the same
class of targets, for example, at least 60% 70%, 80%, 90%, 95%, or
98% of the same class of targets. For example, classes of targets
may include, but are not limited to the class of proteins, the
class of sugar-containing compounds, the class of antibodies, the
class of peptides, the class of toxins, the class of pathogens, or
the class of antigens.
[0190] A suitable target or biological target may include, but is
not limited to, an antigen; an antibody; an enzyme; an enzyme
substrate; a nuclear receptor; a nuclear receptor ligand; a
co-factor; a pathogen; a toxin; a protein, such as a glycoprotein,
a lipoprotein, a phosphoprotein, an acetylated protein, an
hydroxylated protein, a sulfonated protein, a nitrosylated protein,
or a methylated protein; a protein fragment, such as a peptide, a
polypeptide or a modified polypeptide; a nucleic acid, such as a
nucleic acid molecule, a nucleic acid segment, a nucleic acid
molecule of a pathogen or tumor cell, a mutated nucleic acid, a
variant nucleic acid, a modified nucleic acid, a methylated nucleic
acid, or an oxidatively damaged nucleic acid; an epitope; a lipid;
a glyco-lipid; a sugar; a carbohydrate-containing molecule, such as
disaccharide, oligosaccharide, or a polysaccharide; a starch; a
drug or drug-like molecule; a small molecule; a salt; an ion; or
one of a variety of other organic and inorganic substances; which
may be free in solution or bound to another substance; or
combinations or derivatives thereof. The target may be recognized
by, for example, a suitable molecular probe, comprising a binding
moiety. The recognition may be direct, while in other embodiments,
the recognition may be indirect, via another binding moiety, such
as by at least one primary, secondary, or higher order binding
moiety. The target may be expressed on the surface of the sample,
such as on a membrane, cell-membrane, or interface. The target may
be contained in the interior of the sample. In the case of a cell
sample, for example, an interior target may comprise a target
located within the cell membrane, periplasmic space, cytoplasm, or
nucleus, or within an intracellular compartment or organelle. The
target may include viral particles, or portions thereof, for
example, a nucleic acid segment or a protein. The viral particle
may be a free viral particle, i.e., not associated with another
molecule, or it may be associated with a sample described above.
The target may include products derived from DNA damage, an
infective agent (e.g., a virus, bacterium, or fungus), a nucleotide
analog or derivative (e.g., bromodeoxyuridine (BrdU)) or a modified
nucleotide (e.g., a biotinylated nucleotide)); a small organic or
inorganic compound; an antisense nucleic acid (e.g., a PNA); a
catalytic nucleic acid (e.g., a ribozyme); an inhibitory nucleic
acid (e.g., a short inhibitory RNA (siRNA)); a polypeptide (e.g a
cytokine or growth factor); an antibody or a peptide mimetic. For
example, small organic or inorganic compounds may have a molecular
weight of 10,000 g/mol or less, 5,000 g/mol or less, 1,000 g/mol or
less, or 500 g/mol or less. Compounds may be obtained using
combinatorial library methods, such as spatially addressable
parallel solid phase or solution phase libraries; synthetic library
methods requiring deconvolution; "one-bead one-compound" library
methods; and synthetic library methods using affinity
chromatography selection. The libraries may include siRNA molecule
libraries or peptide mimetic libraries.
[0191] Other suitable targets may include a molecular antigen,
which may be a peptide or protein or may comprise a portion of a
peptide or protein. For example, the target may be an antigen, such
as a subregion of a protein, such as in the N-terminus, C-terminus,
extracellular region, intracellular region, transmembrane region,
active site (e.g., nucleotide binding region or a substrate binding
region), a domain (e.g., an SH2 or SH3 domain) or a
post-translationally modified region (e.g., phosphorylated,
glycosylated, methylated, acetylated, nitrosylated, sulfated,
farnesylated, myristoylated, palitoylated, sumoylated or
ubiquinylated region). The target may be an antigen, comprising a
modification moiety or a portion thereof (e.g., the glycosyl group
or a portion thereof) or may be a modification moiety in
conjunction with amino acids of the protein or peptide to which it
is linked (e.g., a phosphoryl group in combination with one or more
amino acids of the protein or peptide). The protein may be a signal
transduction factor, cell proliferation factor, apoptosis factor,
angiogenesis factor, senescence factor, or cell interaction factor.
Suitable examples of cell interaction factors may include, but are
not limited to, cadherins (e.g., cadherins E, N, BR, P, R, and M;
desmocollins; desmogleins; and protocadherins); connexins;
integrins; proteoglycans; immunoglobulins, cell adhesion molecules
(e.g., ALCAM, NCAM-1 (CD56), ICAM-1 and ICAM-2, CD44, LFA-1, LFA-2,
LFA-3, LECAM-1, VLA-4, ELAM and N-CAM); selectins (e.g., L-selectin
(CD62L), E-selectin (CD62e), and P-selectin (CD62P)); agrin; CD34;
and a cell surface protein that is cyclically internalized or
internalized in response to ligand binding. Examples of signal
transduction factors may include, but are not limited to, protein
kinases (e.g., mitogen activated protein (MAP) kinase and protein
kinases that directly or indirectly phosphorylate it, Janus kinase
(JAK1), cyclin dependent kinases, epidermal growth factor (EGF)
receptor, platelet-derived growth factor (PDGF) receptor,
fibroblast-derived growth factor receptor (FGF), insulin receptor
and insulin-like growth factor (IGF) receptor); protein
phosphatases (e.g., PTPIB, PP2A and PP2C); GDP/GTP binding proteins
(e.g., Ras, Raf, ARF, Ran and Rho); GTPase activating proteins
(GAFs); guanine nucleotide exchange factors (GEFs); proteases
(e.g., caspase 3, 8 and 9), ubiquitin ligases (e.g., MDM2, an E3
ubiquitin ligase), acetylation and methylation proteins (e.g.,
p300/CBP, a histone acetyl transferase) and tumor suppressors
(e.g., p53, which is activated by factors such as oxygen tension,
oncogene signaling, DNA damage and metabolite depletion). The
protein may be a nucleic acid-associated protein (e.g., histone,
transcription factor, activator, repressor, co-regulator,
polymerase or origin recognition complex (ORC) protein), which
directly binds to a nucleic acid or binds to another protein bound
to a nucleic acid.
Detection Assay
[0192] A suitable detection assay may comprise or may be used in
connection with singleplex and multiplex assays, such as
immunoassays, protein detection assays, immunodetection, enzyme
linked immuno-assays (ELISA), immunomagnetic cellular depletion,
immunomagnetic cell capture, flow cytometry, immunohistochemistry
(IHC), immunocytochemistry (ICC), in situ hybridization (ISH),
ELISpot, enzyme immuno-assays (EIA), blotting methods (e.g.
Western, Southern, Southwestern, and Northern), arrays, bead
arrays, multiplex bead array, microarray, antibody array, cellular
array, solution phase capture, chemiluminescence detection,
infrared detection, labeling inside electrophoresis systems or on
surfaces or arrays, PCR amplification, elongation followed by PCR
amplification, precipitation, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, nucleic acid hybridization assays,
microspcopy, imaging, high content screening (HCS), other assay or
detection formats, for example, that are useful in research as well
as in diagnosing diseases or conditions, or combinations or
derivatives thereof. In certain embodiments, the assay may analyze
expression patterns of genes or levels of proteins within a sample.
In certain embodiments, the IHC, ISH and cytological techniques may
be performed in a matrix of tissue, cell and proteins which may be
partly cross-linked and very inhomogeneous in nature. In certain
embodiments, the assay may be an IHC method of detecting targets
using either direct labeling or secondary antibody-based or
hapten-based labeling, such as EnVision.TM. (DakoCytomation),
Powervision.RTM. (Immunovision, Springdale, Ariz.), the NBA.TM. kit
(Zymed Laboratories Inc., South San Francisco, Calif.),
HistoFine.RTM. (Nichirei Corp, Tokyo, Japan). In certain
embodiments, the methods disclosed herein may provide an enhanced
signal or an increased flexibility in IHC detection platforms.
Isolating Biomolecule-Oligonucleotide Conjugates and/or Modified
Oligonucleotide
[0193] In certain embodiments, methods for isolating
biomolecule-oligonucleotide conjugates may comprise: i) introducing
a modified biomolecule into a buffered solution; ii) conjugating
the modified biomolecules with at least one modified
oligonucleotide at greater than about 80% efficiency to form
biomolecule-oligonucleotide conjugates; and iii) isolating the
biomolecule-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder. The
methods may comprise conjugation at greater than about 85%, greater
than 90%, greater than 95%, or greater than about 98% efficiency to
form biomolecule-oligonucleotide conjugates. In certain
embodiments, other isolation techniques may be used, for example,
size exclusion chromatography. In certain embodiments, the
isolation technique may be selected from one or more of the
following: chromatography, affinity chromatography, size exclusion
chromatography, HPLC, reverse-phase chromatography,
electrophoresis, capillary electrophoresis, polyacrylamide gel
electrophoresis, agarose gel electrophoresis, free flow
electrophoresis, differential centrifugation, thin layer
chromatography, immunoprecipitation, hybridization, solvent
extraction, dialysis, filtration, diafiltration, tangential flow
filtration, ion exchange chromatography, or hydrophobic interaction
chromatography.
[0194] For example, the modified oligonucleotide may be prepared by
reacting with a bifunctional molecular reagent containing a first
reactive component that forms a covalent bond with the
oligonucleotide, and a second reactive component that may form a
linkage with a complementary reactive component on a modified
biomolecule or a tagged biomolecule. In certain embodiments, the
second reactive component may be protected such that it will not
react until removed following incorporation onto the
oligonucleotide.
[0195] A suitable modified oligonucleotide may be prepared by
incorporating amino groups either 3', 5' or internally using other
methods and reagents. For example, the modified oligonucleotide may
be prepared by reacting with a moiety that is a bifunctional
molecular reagent, such as an aromatic aldehyde or ketone, aromatic
hydrazino or oxyamino modification reagent, to incorporate a
hydrazino or oxyamino function respectively.
[0196] A suitable modified oligonucleotide may be prepared by
post-synthetically modification of oligonucleotides prepared via
polymerases or reverse transcriptases with nucleoside triphosphates
possessing an aromatic aldehyde, aromatic hydrazine, oxyamino, or
an amino group. For example, the modified oligonucleotide may be
prepared by post-synthetically modification of oligonucleotides by
incorporation of an aromatic aldehyde or ketone, aromatic hydrazino
or oxyamino group, using a moiety that is a bifunctional molecular
reagent, such as an aromatic aldehyde or ketone, aromatic hydrazino
or oxyamino reagent.
[0197] The modified biomolecules, such as, modified antibodies,
modified proteins, or modified peptides, may be prepared from
biomolecules that are derived from eukaryotic cells. The modified
biomolecules may also be prepared from biomolecules that are
derived from prokaryotic cells. The modified biomolecule may
include a molecular tag. The modified biomolecule may be modified
antibody, wherein the modified antibody may be prepared from an
antibody that contains a histidine rich sequence near the hinge
region. In certain embodiments, the modified biomolecule may be
modified antibody, wherein the modified antibody may be exclusive
of, i.e., do not contain, a histidine rich sequence near the hinge
region.
[0198] In certain embodiments, the phosphorus-containing moieties
of the modified oligonucleotides may contain, for example, a
phosphate, phosphonate, alkylphosphonate, aminoalkyl phosphonate,
thiophosphonate, phosphoramidate, phosphorodiamidate,
phosphorothioate, phosphorothionate, phosphorothiolate,
phosphoramidothiolate, and phosphorimidate. The
phosphorus-containing moieties of the modified oligonucleotides may
be modified with a cationic, anionic, or zwitterionic moiety. The
modified oligonucleotides may also contain backbone linkages which
do not contain phosphorus, such as carbonates, carboxymethyl
esters, acetamidates, carbamates, acetals, and the like or
derivatives thereof.
[0199] A suitable modified biomolecule may be a modified antibody,
comprising an antibody that includes a histidine-rich region, for
example, an antibody having a histidine-rich region near the hinge
region of the antibody. The modified antibody may comprise an
antibody that is exclusive of having a histidine-rich region. The
modified antibody may comprise an antibody that is of the IgG type
antibody or the IgM type antibody. The modified antibody may
comprise one or more molecular tags, for example, but not limited
to, a poly-histidine tag, a Flag Tag, a Myc tag, or a peptide tag
that an antibody has been raised against. The modified antibody may
comprise a poly-histidine fusion protein. The modified antibody may
comprise one or more spacer groups, for example, such as a
polyethylene glycol (PEG) or a polyethylene oxide group (PEO). The
modified antibody may comprise one or moieties that include a
reactive group, for example, a reactive group that may form a
covalent bond when reacted with a complementary reactive group that
may be part of a modified oligonucleotide. The modified antibody
may be, for example, a HyNic or 4FB-modified antibody.
[0200] A suitable modified biomolecule may be a modified protein or
a modified peptide, comprising a protein that includes a
histidine-rich region, for example, a protein having a
histidine-rich region incorporated during solid phase synthesis.
For example, the modified protein may comprise a protein that is
exclusive of having a histidine-rich region. In certain
embodiments, the modified protein may comprise one or more
molecular tags, for example, but not limited to, a poly-histidine
tag, a Flag Tag, a Myc tag, or a peptide tag that an antibody has
been raised against. The modified protein may comprise a
poly-histidine fusion protein. The modified protein may comprise
one or more spacer groups, for example, such as a polyethylene
glycol (PEG) or a polyethylene oxide group (PEO). The modified
protein may comprise one or moieties that include a reactive group,
for example, a reactive group that may form a covalent bond when
reacted with a complementary reactive group that may be part of a
modified oligonucleotide. The modified protein may be, for example,
a HyNic or 4FB-modified protein.
[0201] In certain embodiments, at least one modified
oligonucleotide may comprise one or more oligonucleotides that have
been modified, for example, at least two modified oligonucleotides,
at least three, at least four modified oligonucleotides. The at
least one modified oligonucleotide may comprise two different
modified oligonucleotides, for example, three different modified
nucleotides or four different modified oligonucleotides. The at
least one modified oligonucleotide may comprise one or more spacer
groups, for example, a PEG or PEO group. The modified
oligonucleotide may comprise one or moieties that include a
reactive group, for example, a reactive group that may form a
covalent bond when reacted with a complementary reactive group that
may be part of a modified antibody. The modified oligonucleotide
may be, for example, a 4-FB-modified oligonucleotide.
[0202] In certain embodiments, the biomolecule-oligonucleotide
conjugates, for example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, (protein
fragment)-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates, may be purified and/or isolated by binding to an
immobilized binder. A suitable immobilized binder may comprise a
metal ion, for example, a divalent metal ion, such as a transition
metal ion. The metal ion may include, but is not limited to, a
nickel ion, a zinc ion, a copper ion, an iron ion, or a cobalt ion.
The metal ion may be immobilized by chelation to a stationary phase
in a column. A suitable stationary phase may comprise an organic
chelator that immobilizes and/or binds the metal ion. For example,
the organic chelator may be selected from the group that includes,
but is not limited to, iminodiacetic acid, nitrilotriacetic acid,
and/or bicinchoninic acid. The stationary phase may be a water
insoluble support, for example, the stationary phase may be
agarose.
[0203] A suitable immobilized binder may comprise an immobilized
antibody. The immobilized antibody may recognize and bind a portion
of the modified biomolecule, such as a modified antibody, and/or a
portion of the biomolecule-oligonucleotide conjugates, such as an
antibody-oligonucleotide conjugate. The immobilized antibody may
recognize and bind a modified biomolecule comprising a molecular
tag, wherein the immobilized antibody is an antibody that has been
raised to include that particular molecular tag. The immobilized
antibody may recognize and bind the linkage formed during the
conjugation reaction of the modified biomolecules, such as modified
antibodies, modified proteins, or modified peptides, and the
modified oligonucleotide, wherein the immobilized antibody is an
antibody that has been raised to include that particular
conjugation linkage.
[0204] Other suitable biomolecule-oligonucleotide conjugates, for
example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, (protein
fragment)-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates, may be purified and/or isolated by adding the
conjugation reaction mixture to a column having a stationary phase
comprising a binder that has been immobilized, or substantially
immobilized, to the stationary phase. The immobilized binder may
comprise an immobilized antibody bound to the stationary phase. The
immobilized binder may comprise a metal ion, for example, a
divalent metal ion, such as a transition metal ion. The metal ion
may be immobilized by chelation to a stationary phase in a column.
The metal ion may include, but is not limited to, a nickel ion, a
zinc ion, a copper ion, an iron ion, or a cobalt ion.
Preparing, Purifying, and/or Isolating the
Biomolecule-Oligonucleotide Conjugates
[0205] A suitable method of preparing, purifying, and/or isolating
the biomolecule-oligonucleotide conjugates may be by selectively
binding the conjugates to a binder that is immobilized, or
substantially immobilized, on a stationary phase, eluting the
reaction components away from the bound conjugate, and then
releasing the biomolecule-oligonucleotide conjugates by adding a
displacing agent that is selective for the immobilized binder. The
method for isolating biomolecule-oligonucleotide conjugates, may
comprise: i) conjugating a modified biomolecule with at least one
modified oligonucleotide to form biomolecule-oligonucleotide
conjugates, wherein greater than 80% of the modified biomolecules
are conjugated; ii) adding the conjugation reaction mixture to a
column having a stationary phase comprising a binder that has been
immobilized to the stationary phase; iii) binding the
biomolecule-oligonucleotide conjugates selectively to the
immobilized binder; iv) eluting reaction components away from the
bound biomolecule-oligonucleotide conjugates; and v) isolating the
biomolecule-oligonucleotide conjugates by releasing the bound
biomolecule-oligonucleotide conjugates with a displacing agent
selective for the binder. The immobilized binder may be a metal ion
and the displacing agent may be a solution comprising a chelator
for the metal, for example, EDTA. The immobilized binder may be an
immobilized antibody and the displacing agent may be a solution
comprising a molecular tag that is recognized by the immobilized
antibody.
[0206] In certain embodiments, the method of preparing, purifying,
and/or isolating the molecular probes, such as
biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, (protein fragment)-oligonucleotide conjugates, or
peptide-oligonucleotide conjugates, may be mild, robust, simple,
high yielding or combinations thereof. For example, the method may
yield at least about 30% isolated molecular probes, for example,
biomolecule-oligonucleotide conjugates, with respect to starting
modified biomolecule. In other methods, the yield may be at least
40%, 50%, 65%, 70%, 75%, 80%, 85%, 90%, or at least 95% isolated
molecular probe, such as, biomolecule-oligonucleotide conjugates,
with respect to starting modified biomolecule. In other methods,
the purity of the prepared, purified, and/or isolated molecular
probe may be at least 40%, 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95%,
97%, 98%, or 99%.
[0207] In certain embodiments, the method of preparing, purifying,
and/or isolating the biomolecule-oligonucleotide conjugates may
provide more than one process by which to bind and release the
biomolecule-oligonucleotide conjugates. For example, the formed
biomolecule-oligonucleotide conjugates may be
antibody-oligonucleotide conjugates, that may comprise a
histindine-rich region included in the hinge region of the
biomolecule, for example, antibody, which may be bound by chelating
to a metal ion immobilized on a column, and the formed
biomolecule-oligonucleotide conjugates, such as
antibody-oligonucleotide conjugates, may further comprise a
molecular tag that is recognized and may be bound by an antibody,
for example, an antibody immobilized on a stationary phase. For
example, the formed biomolecule-oligonucleotide conjugates may be
antibody-oligonucleotide conjugates, that may comprise a
biomolecule, for example, an antibody, that is exclusive of, i.e.,
does not include a histidine-rich region, and the formed
biomolecule-oligonucleotide conjugates, such as
antibody-oligonucleotide conjugates, may further comprise a
molecular tag that is recognized and may be bound by an antibody,
for example, an antibody immobilized on a stationary phase, and
wherein the molecular tag may also be bound by chelating to a metal
ion. For example, the molecular tag may be a histidine-rich His-6
tag.
[0208] In certain embodiments, the biomolecule-oligonucleotide
conjugates, for example, antibody-oligonucleotide conjugates,
protein-oligonucleotide conjugates, (protein
fragment)-oligonucleotide conjugates, or peptide-oligonucleotide
conjugates, may comprise one or more detectable fluorophores, two
or more detectable fluorophores, or three or more detectable
fluorophores. In certain embodiments, the
biomolecule-oligonucleotide conjugates may comprise two or more
different modified oligonucleotides, for example, three or more
different modified oligonucleotides, that have conjugated to the
biomolecule, where in each modified oligonucleotide comprises a
different fluorophore. The formation of the
biomolecule-oligonucleotide conjugates may form an additional
fluorophore and/or chromophore during the conjugation reaction.
[0209] In certain embodiments, the method of preparing, purifying,
and/or isolating a detectable component may be simple, high
yielding or combinations thereof. For example, the method may yield
at least 30% 40%, 50%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%
isolated detectable component. In other methods, the purity of the
prepared, purified, and/or isolated detectable component may be at
least 40%, 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or
99%.
Detection
[0210] Suitable methods of detection may also include direct and/or
indirect detection of the oligonucleotide or oligonucleotides of
the molecular probe. For example by the use of DNA hybridization or
DNA sequence analysis or DNA sequence amplification. In certain
embodiments, the oligonucleotide or oligonucleotides may be
detected by hybridization to an array of complementary
oligonucleotides. In certain embodiments, the oligonucleotide or
oligonucleotides may be detected by polymerization of complementary
DNA sequence. In certain embodiments, detection may be by the use
of immuno-PCR, a hybrid of PCR and immunoassay systems, which
combines the versatile molecular recognition of antibodies with the
amplification potential of DNA replication. The technique of
immuno-PCR involves the in-situ assembly of the labeled
DNA-antibody complex during the assay, creating variable
stoichiometry in both the attachment of the DNA label, and the
assembly of the components. For example, the purified, labeled DNA
may be added to a hybridization solution containing denatured
nucleic acids (RNA or DNA) from a sample to be tested. The aqueous
conditions of the hybridization solution may be adjusted to allow
nucleic acid hybridization or reannealing, thereby allowing the
labeled molecules to hybridize with unlabeled, complementary
sequence counterparts. Duplex formation can be monitored by
digestion with single strand-specific nucleases (such as S1
nuclease). Recovery and quantitation of the resistant, i.e.,
double-stranded, reannealed material provides a measure of the
nucleic acid sequence tested for. The amount of hybridization may
be a function of the initial concentration of DNA and the time
allowed for reannealing. Therefore, increased initial DNA
concentrations can lead to substantially reduced hybridization
times. This technique may be an additional means to monitor the
presence of a target in a sample, such as an antigen, of interest
in a detection method, such as a Western blot assay.
[0211] A suitable method of detection may comprise a multiplex
assay, utilizing one or more molecular probes, one or more
detectable components, and one or more universal adapters, wherein
the one or more molecular probes may comprise identical
oligonucleotide sequences that are complementary to a first
oligonucleotide sequence segment of the one or more universal
adapters. In certain embodiments, the method of detecting may
comprise a multiplex assay, utilizing one or more molecular probes,
one or more universal adapters, and one or more detectable
components, wherein the one or more molecular probes comprise one
or more biomolecules conjugated to identical oligonucleotide
sequences, wherein the one or more universal adapters comprise
identical first oligonucleotide sequence segments complementary to
the oligonucleotide sequences of the one or more molecular probes
and a second, unique oligonucleotide sequence segment complementary
to the oligonucleotide sequence of the one or more detectable
components, and wherein the one or more detectable components
comprise unique oligonucleotide sequences complementary to the
second, unique oligonucleotide sequence segment of the one or more
universal adapters.
[0212] A suitable method of detection of one or more molecular
targets in a sample may provide using one or more detectable
components comprising one or more signal generating moieties. For
example, the method of detecting one or more molecular targets in a
sample may provide using one or more molecular probes, one or more
detectable components, one or more universal adapters, and/or one
or more spacer groups, or combinations thereof. In certain
embodiments, the method of detecting one or more molecular targets
in a sample, comprising using one or more molecular probes, one or
more detectable components, one or more universal adapters, and/or
one or more spacer groups, may be provided in multiple layers to
increase the flexibility of a detection system, to enhance and/or
increase the signal from the one or more molecular targets, such as
to enhance and/or increase the signal generated from the one or
more molecular probe bound targets, to enhance and/or increase the
efficiency of the signal generated from the one or more molecular
probe bound targets, to enhance and/or increase the efficiency of
the molecular probe binding the one or more molecular targets. The
method of detecting may be compatible with one or more detection
systems, such as, for example, singleplex and multiplex assays,
such as immunoassays, protein detection assays, immunodetection,
enzyme linked immuno-assays (ELISA), immunomagnetic cellular
depletion, immunomagnetic cell capture, flow cytometry,
immunohistochemistry (IHC), immunocytochemistry (ICC), in situ
hybridization (ISH), ELISpot, enzyme immuno-assays (EIA), blotting
methods (e.g. Western, Southern, Southwestern, and Northern),
arrays, bead arrays, multiplex bead array, microarray, antibody
array, cellular array, solution phase capture, chemiluminescence
detection, infrared detection, labeling inside electrophoresis
systems or on surfaces or arrays, PCR amplification, elongation
followed by PCR amplification, precipitation, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, nucleic acid hybridization assays,
microspcopy, imaging, high content screening (HCS), other assay or
detection formats, for example, that are useful in research as well
as in diagnosing diseases or conditions, or combinations or
derivatives thereof. In certain embodiments, the method of
detecting may be compatible with one or more different types of
molecular targets, molecular probes, detectable components,
universal adapters, and/or spacer groups. The method of detecting
one or more molecular targets in a sample may be provided by an
increased and/or enhanced signal generated from the one or more
molecular probe bound targets, by, for example, increasing the
number of detectable components utilized to detect each molecular
target, and/or by amplification of the signal by the
instrumentation utilized. The method of detecting one or more
molecular targets in a sample, may be provided by an increased
and/or enhanced signal generated from the one or more molecular
probe bound targets, for example, molecular probes comprising
antibodies, for example, molecular targets comprising antigens,
wherein the signal generated and detected may be amplified by the
antibody-antigen complex.
[0213] In certain embodiments, a method of detection of one or more
molecular targets in a complex sample using one or more detectable
components and one or more molecular probes, may comprise a
multiplex assay, such as a multiplex immundection assay. The time
of conducting the method of detection from the start of preparation
of the hybrids to the end of detection may be about 0.5-10, 1-9,
1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-5, 2-4 or 2-3 hours.
[0214] In certain embodiments, a method of detection of one or more
molecular targets in a sample may utilize one or more detectable
components and one or more molecular probes, comprising
biomolecule-oligonucleotide conjugates, comprising: i) forming the
molecular probes at greater than 80% efficiency from at least one
or more modified biomolecules and at least one or more modified
oligonucleotides; ii) forming the detectable components at greater
than 80% efficiency from a modified oligonucleotide and least one
or more signal generating moieties, wherein the modified
oligonucleotide is complementary to the modified oligonucleotide of
the formed molecular probe; iii) providing the formed biomolecular
probes to the sample comprising the one or more molecular targets;
iv) contacting the one or more molecular targets in the sample with
the formed molecular probes; iv) providing the detectable component
to the sample comprising the contacted molecular probes; v)
hybridizing the complementary oligonucleotide of the detectable
component with the oligonucleotide of the contacted molecular
probe; vi) detecting the one or more signal generating moieties of
the hybridized molecular probes contacted to the one or more
molecular targets.
[0215] A suitable method for detection of one or more target
molecules may comprise extending the oligonucleotide by PCR methods
prior to detection. For example, the method of detection may
comprise determining the amount of hybridization product or
extension product, for example, determining a quantified amount of
hybridization product or extension product. The one or more
molecular probes may comprise a nucleic acid binding protein
identical to, or substantially identical to, a lac repressor
protein or fragment thereof, which binds to a functional lacO
subsequence in a hybrid nucleic acid, hybridization product or
extension product. The nucleic acid binding agent may comprise one
or more signal generating moities.
[0216] A suitable method for detection of one or more target
molecules may comprise detecting disease-specific molecules,
identifying whether a certain cell type in a sample carries a
disease-specific marker, and/or determining progression of a
disease or condition. For example, disease specific markers may be
molecules expressed by diseased cells, such as cancer cells, but
not by non-diseased cells. A disease specific marker may be a
molecule expressed by a pathogenic organism but not the host
organism invades, and sometimes is a molecule expressed by a cell
invaded by a pathogenic organism and not by host cells not invaded
by the organism. A molecular probe may specifically bind to a
cancer-specific molecule, such as a marker specific for
hepatocarcinoma cells. A molecular probe may specifically bind to
molecules expressed specifically by liver, colon, uterus, and
kidney cells. Certain embodiments may be useful for determining
cell types and organs that are diseased, and are useful for
determining the extent to which a disease has spread. A molecular
probe may specifically bind to a molecule specific for a
progressive stage of a disease and may be included in the
diagnostic, such as a molecular probe that specifically binds to a
molecule specific for metastatic cells but not non-metastatic
cells. A molecular probe may specifically bind to a molecular
marker specific to a cell type, diseased cell, or organism, and
various markers specific to a cell type, diseased cell, or organism
may be selected as a target for these diagnostic applications. For
examples, specific markers may include, but are not limited to,
EBNAI a viral nuclear antigen found in EBV infected B-cells; S100P,
S100A4, prostate stem cell antigen, lipocalin 2, claudins 3 and 4,
and trefoil factors 1 and 2 in pancreatic adenocarcinoma; CD
antigens, microphthalmia transcription factor (MITF), and members
of the Bcl-2 family in neoplastic mast cells; a cell surface
marker, such as CDs, HLAs; or intracellular markers such as actins
and tubulins as a healthy cell marker. In certain embodiments,
hybridization products or extension products may be detected using
various methods described herein.
[0217] Suitable methods of detection of one or more molecular
targets, including the utilization of kits and/or systems, may be
useful for therapeutic applications. In certain therapeutic
embodiments, one or more molecular probes, one or more detectable
components, may be provided to an in vitro or ex vivo sample from a
patient or administered to a patient in vivo. In certain
therapeutic embodiments, the provided, or administered one or more
molecular probes and one or more detectable components, may further
comprise a universal adapter. One or molecular targets may be bound
by the one or more molecular probes, and detected upon
hybridization with the one or more detectable components and/or
universal adapters and one or more detectable components. The
detectable components may comprise one or more signal generating
moieties. The hybridized product may be extended by endogenous
enzymes present in the sample or subject, and sometimes is extended
by exogenous components delivered to the sample or subject (e.g., a
polymerase and/or nucleotides, such as a PCR method).
[0218] A suitable method for identifying a disease or condition in
a subject may comprise delivering a first molecular probe and a
second molecular probe to a subject, wherein the first molecular
probe comprises a first binding moiety partner and a first
oligonucleotide and the second molecular probe comprises a second
binding moiety partner and a second oligonucleotide. The method may
further comprise a universal adapter. The first binding moiety
partner and second binding moiety partner specifically bind to a
first binding region or second binding region in a target molecule,
or a first target molecule and a second target molecule, where each
target molecule may be independently selected from a target
molecule specifically expressed by a diseased cell, a target
molecule specifically expressed by a pathogenic organism, and a
target molecule specifically expressed by a certain cell type. The
first oligonucleotide may comprise a first oligonucleotide sequence
complementary to a second oligonucleotide sequence in the second
oligonucleotide and may be capable of forming a hybridized product
with the second oligonucleotide when the first hybrid is bound to
the first target molecule or first target molecular region and the
second hybrid is bound to the second target molecule or second
target molecular region, and the first target molecule and the
second target molecule are in proximity or the first target
molecular region and second target molecular region are in
proximity. The hybridized product may be extended by delivering
exogenous components that extend the hybridized product (e.g., a
polymerase and/or nucleotides, such as a PCR method), and a
targeting component that may specifically bind to an
oligonucleotide sequence in the hybridized product or extension
product may be delivered. The targeting component may comprise one
or more signal generating moieties, and the targeting component may
be detected by delivering a secondary agent, such as a secondary
antibody, that specifically binds to the targeting component and
comprises one or more signal generating moieties. The hybrids,
targeting component, and other diagnostic components may be
delivered in an amount effective to identify the disease or
condition in the subject and/or patient.
[0219] A suitable kit for detection of one or more molecular
targets in a sample may comprise preparing, purifying, and/or
isolating, one or more molecular probes, one or more universal
adapters, and/or one or more detectable components, each of which
may comprise one or more spacer groups, and providing to the sample
the prepared, purified, and/or isolated one or more molecular
probes, one or more universal adapters, and/or one or more
detectable components, each of which may comprise one or more
spacer groups. For example, the kit for detecting one or more
molecular targets in a sample may be utilized in a method of
detection. A suitable kit and/or system for detecting one or more
molecular targets in a sample, may comprise one or more prepared,
purified and/or isolated molecular probes, such as one or more
biomolecule-oligonucleotide conjugates, for example,
antibody-oligonucleotide conjugates, protein-oligonucleotide
conjugates, or peptide-oligonucleotide conjugates, one or more
prepared, purified and/or isolated universal adapters, and/or one
or more prepared, purified and/or isolated detectable components,
wherein each of the molecular probes, universal adapters, and/or
detectable components may comprise one or more spacer groups. The
kit and/or system for detecting one or more molecular targets in a
sample may be used in a method of detecting one or more molecular
targets in a sample. For example, the method of detecting the one
or more molecular targets may comprise utilizing one or more of the
following detection techniques and/or methods, including, but is
not limited to: singleplex and multiplex assays, such as
immunoassays, protein detection assays, immunodetection, enzyme
linked immuno-assays (ELISA), immunomagnetic cellular depletion,
immunomagnetic cell capture, flow cytometry, immunohistochemistry
(IHC), immunocytochemistry (ICC), in situ hybridization (ISH),
ELISpot, enzyme immuno-assays (EIA), blotting methods (e.g.
Western, Southern, Southwestern, and Northern), arrays, bead
arrays, multiplex bead array, microarray, antibody array, cellular
array, solution phase capture, chemiluminescence detection,
infrared detection, labeling inside electrophoresis systems or on
surfaces or arrays, PCR amplification, elongation followed by PCR
amplification, precipitation, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, nucleic acid hybridization assays,
microspcopy, imaging, high content screening (HCS), other assay or
detection formats, for example, that are useful in research as well
as in diagnosing diseases or conditions, or combinations or
derivatives thereof and/or combinations thereof. The kit for
detecting one or more molecular targets in a sample may further
comprise one or more binding moieties. The kit for detecting one or
more molecular targets in a sample may further comprise one or more
signal generating moieties. The kit for detecting one or more
molecular targets in a sample may further comprise one or more
scaffolds, wherein the one or more scaffolds may comprise one or
more signal generating moieties.
[0220] In certain embodiments, a plurality of molecular probes,
comprising binding moieties conjugated to oligonucleotides, and a
plurality of detectable components, comprising signal generating
moieties conjugated to complementary oligonucleotides, may be
preassembled, i.e., combined and allowed to hybridize to form a
composition comprising a plurality of hybridized molecular
probe-detectable components, that may then be followed by
contacting the preassembled composition with a sample, comprising
one or more molecular targets. In certain embodiments, the
preassembled composition, comprising a plurality of hybridized
molecular probe-detectable components, may then be used in an assay
to perform both recognition and detection functions. In certain
embodiments, the plurality of molecular probes may comprise one or
more antibodies. In certain embodiments, the plurality of
detectable components may comprise one or more signal generating
moieties. The plurality of molecular probes and/or the plurality of
detectable components may comprise one or more spacer groups. The
plurality of molecular probes may comprise, for example, 2 or more
molecular probes, such as 3 or more, 4 or more, 5 or more, 10 or
more, 25 or more, 100 or more molecular probes. Similarly, the
plurality of detectable components may comprise, for example, 2 or
more detectable components, such as 3 or more, 4 or more, 5 or
more, 10 or more, 25 or more, 100 or more detectable
components.
[0221] In certain embodiments, the oligonucleotides of the
plurality of molecular probes and the plurality of detectable
components may not be complementary, for example, the plurality of
detectable components may comprise signal generating moieties
conjugated to oligonucleotides that are not complementary to the
oligonucleotides of the plurality of molecular probes. When the
plurality of molecular probes and the plurality of detectable
components comprise oligonucleotides that are non-complementary,
these may be combined together along with a plurality of adaptor
oligonucleotides. The plurality of adaptor oligonucleotides may
comprise oligonucleotides sequence segments that may be
complementary to the plurality of molecular probes and
oligonucleotides sequence segments that may be complementary to the
plurality of detectable components. The plurality of molecular
probes, the plurality of detectable components, and the plurality
of adaptor oligonucleotides, may then be allowed to preassemble,
i.e., hybridize to form a composition comprising a plurality of
molecular probe-adapter-detectable components, that may then be
followed by contacting the composition with a sample, comprising
one or more molecular targets.
[0222] In certain embodiments, a molecular probe may be combined
with a plurality of detectable components, for example, 2 or more
detectable components, such as 3 or more, 4 or more, 5 or more, 10
or more, 25 or more, 100 or more detectable components, to allow
for detection in a plurality of assays, such as in a plurality of
fluorescent channels, or alternatively, in a plurality of assay
formats, such a fluorescent assay and an enzymatic activity assay.
Similarly, a plurality of molecular probes, for example, 2 or more
molecular probes, such as 3 or more, 4 or more, 5 or more, 10 or
more, 25 or more, 100 or more molecular probes, may be combined
with a detectable component, to allow for detection in a
fluorescent channel for samples containing a plurality of
targets.
Preassembly Hybridization
[0223] In certain embodiments, the process of conducting the
preassembly hybridization prior to contacting a sample, may be
advantageous for certain applications, assays, and/or methods, and
may lend itself to creating novel formats, tests, assays, and/or
classes of products. Preassembly may allow the formation of the
molecular probe-detectable components, and their purification
and/or validation, in a different time or place from their actual
use or application in an assay, which may be of significant value.
The process of preassembly may be performed, for example, by the
end-user immediately prior to its use in an assay, or separately
for example, by a commercial supplier which may then be provided to
the end user.
[0224] Advantageously, the process of preassembly may allow for the
use of a strategy for multiplexed detection, wherein one or more
molecular probes may be combined with one or more detectable
components on an as-needed basis. For example, with a selection of
one or more detectable components available, such as 2 or more
detectable components, such as 3 or more, 4 or more, 5 or more, 10
or more, 25 or more, 100 or more detectable components available,
it may be possible to select a specific detectable component to be
associated with one or more molecular probes, such as in an assay
comprised of a plurality of molecular probes to be contacted with a
complex sample comprising one or more molecular targets. In certain
embodiments, a plurality of detectable components may be prepared
by conjugating a unique oligonucleotide to a plurality of signal
generating moieties, for example a plurality of scaffolds
comprising unique organic fluorophores, such that the plurality of
detectable components correspond to a plurality of channels of a
commercial flow cytometer. Then, to match a specific binding
moiety, such as an antibody, to a particular channel, a molecular
probe and the detectable component bearing the appropriate
fluorophore would be preassembled. By conducting the process of
preassembly, appropriately matching particular binding moieties to
particular detectable components, a panel of unique tests may be
prepared in advance to allow for a multiplexed assay, for example a
multiplexed assay of a pattern of immunoreactivities on a
population of cells, such as would be used in immunophenotyping by
flow cytometry. In addition, in certain embodiments, based on the
results of a first multiplexed assay, a second panel of hybrids may
be preassembled to further characterize the sample. In certain
embodiments, one or more panels of preassembled hybrids may be used
to characterize a sample comprising one or more molecular targets,
such as 2 or more panels, for example, 3 or more, 4 or more, 5 or
more, 10 or more, 25 or more, 100 or more panels.
[0225] In certain embodiments, the process of preassembly may be
readily adaptable to automation. For example, a plurality of
molecular probes, such as 2 or more, 3 or more, 4 or more, 5 or
more, 10 or more, 25 or more, 100 or more, 1,000 or more, or 10,000
or more molecular probes, may be placed into individual containers
or wells that may then be addressed individually by a robotic tool.
Similarly, a plurality of detectable components, such as 2 or more,
3 or more, 4 or more, 5 or more, 10 or more, 25 or more, 100 or
more, 1,000 or more, or 10,000 or more detectable components may be
placed into individual containers or wells that may then be
addressed individually by a robotic tool. From these pluralities of
individual molecular probes and individual detectable components, a
plurality of predetermined combinations, for example predetermined
by a table or a computation, may be preassembled. For example, a
plurality of unique combinations or sets of molecular probes and
detectable components may be brought together by combining an
aliquot of a specific molecular probe and an aliqout of a specific
detectable component, in another container or well to allow their
hybridization to form a complex, wherein the amounts employed
provide the appropriate ratios of oligonucleotides to allow proper
stoichiometry. In certain embodiments, the automated system may
perform the steps of mixing to match the specific binding moiety,
such as an antibody, to a particular fluorescence channel, to form
a panel or set under the control of a user. Alternatively, the
automated system might select the specific binding moiety, such as
an antibody, and match it to a particular fluorescence channel, to
form a panel or set according to an algorithm. In certain
embodiments, the automated system may perform the steps of mixing
to match each specific binding moiety, such as an antibody, to a
particular fluorescence channel, to form a panel or set under the
control of a user. Alternatively, the automated system might select
each specific binding moiety, such as an antibody, and match it to
a particular channel, to form a panel or set according to an
algorithm. Using a preassembly format, a plurality of these sets,
such as two or more sets, three or more, four or more, five or
more, ten or more, twenty or more, fifty or more, one hundred or
more, one thousand or more, or ten thousand or more sets may be
preassembled on an as-needed basis to then be used, for example
used in an assay. Advantageously, use of unique preassembled sets
of molecular probes and detectable components, automated
multiplexed immunodetection assays, such as in flow cytometry,
imaging, microscopy, high content screening (HCS), ELISA, ELISpot,
or immunohistochemistry, to examine populations and subpopulations
of circulating lymphocytes, may be accomplished rapidly,
cost-effectively and/or with a minimal selection of reagents. Such
an automated system may be able to perform a series of preassembly
steps, to create a panel of multiplexed sets that perform a defined
or adaptive sequence of tests to characterize a sample. In certain
embodiments, the automated system may perform, for example,
immunophenotyping by subjecting the sample to analysis by multiple
sets, formed in order by the process of preassembly, that are
defined by a defined protocol. Alternatively, an automated system
may select at least in part the constituents of one or more sets to
be used for immunophenotyping based at least in part on the results
of one or more previous sets, by applying an algorithm that
incorporates at least in part the one or more prior results to
determine at least in part one or more subsequent set, and then
using the principles of preassembly, to form one or more additional
sets as needed, thereby achieving speed and specificity that exceed
what can be obtained by other techniques.
Preparation, Purification and/or Isolation
[0226] In certain embodiments, the antibody-oligonucleotide
conjugates may be purified as depicted in FIG. 10. For example, the
conjugation reaction mixture, comprising antibody-oligonucleotide
conjugates and excess modified oligonucleotide may be purified by
binding the antibody-oligonucleotide conjugates to a column
comprising agarose and metal ions immobilized within the stationary
phase of the column (which may be called "magnetic agarose" or
"magnetic affinity beads"). The prepared antibody-oligonucleotide
conjugates may include moieties, such as a histidine rich region,
that may bind to metal ions that are immobilized on the stationary
phase of the column--which may now be separated from the excess
modified oligonucleotide, which do not have functionality that may
bind to the metal ions in a similar chelating fashion. Once the
excess modified oligonucleotide has been washed by a series of
elutions, the bound antibody-oligonucleotide conjugates may be
released by eluting with a displacing agent, such as another
chelating moiety, for example, EDTA.
[0227] In certain embodiments, the modified oligonucleotides may be
prepared as depicted in FIG. 11. For example, in Stage 1, the
modified oligonucleotides may be prepared by resuspending an
amino-oligonucleotide in a buffer (Buffer A). The oligonucleotide
concentration (OD260/.mu.L) may be determined by spectrophotometer
measurement. Once the concentration has been determined, the buffer
solution may exchanged by sequential centrifuge spin down and
resuspension of the resulting pellet in Buffer B to prepare for
reacting with the modifying reagent, followed by measuring the
oligonucleotide concentration (OD260/.mu.L) in Buffer B by
spectrophotometer measurement. Modification of the oligonucleotide
may be conducted, for example, with S-4FB, using dimethylformamide
(DMF) as a cosolvent. Once the reaction has completed, the reaction
mixture may be spun down and the Buffer C exchanged into the
system. Finally, the modified-oligonucleotide (4FB-modified
oligonucleotide) concentration can be measured (OD260/.mu.L) by
spectrophotometer measurement, now in Buffer C.
[0228] In certain embodiments, the modified oligonucleotide may be
prepared by solid phase synthesis. The solid phase synthesis may
also include the direct incorporation of a linker during the solid
phase oligonucleotide synthesis. The solid phase synthesis may also
include the direct incorporation of a linker during the solid phase
modified oligonucleotide synthesis.
[0229] In certain embodiments, the modified antibody may be
prepared as depicted in FIG. 12. For example, in Stage 2, the
modified antibodies may be prepared by resuspending the antibody in
a buffer (for example 100 .mu.g antibody at 1 mg/mL concentration).
The antibody concentration (A280) may be determined by
spectrophotometer measurement. Once the concentration has been
determined, the buffer solution may exchanged by sequential
centrifuge spin down and resuspension of the resulting pellet in
Buffer B to prepare for reacting with the modifying reagent, for
example, with S-HyNic. Once the reaction to modify the antibody has
been completed, the reaction mixture may be spun down and the
modified antibody, for example a S-HyNic-modified antibody, may be
exchanged into Buffer C. Finally, the modified-antibody
concentration, for example, the S-HyNic-modified antibody
concentration, may be measured by a spectrophotometer measurement,
now in Buffer C.
[0230] In certain embodiments, the conjugation of a modified
antibody with a modified oligonucleotide may be conducted as
depicted in Stage 3 in FIG. 13. For example, in Stage 3, the
modified-antibody, a S-HyNic-modified antibody, may be reacted with
an excess of the modified-oligonucleotide (4FB-modified
oligonucleotide), to form antibody-oligonucleotide conjugates
having at least one oligonucleotide conjugated to each
modified-antibody. The reaction mixture will also have unreacted
modified-oligonucleotide (4FB-modified oligonucleotide).
[0231] In certain embodiments, the purification and isolation of
antibody-oligonucleotide conjugates may be conducted as depicted in
Stage 4 in FIG. 13. For example, in Stage 4, the conjugation
reaction mixture, comprising antibody-oligonucleotide conjugates
and excess unreacted modified-oligonucleotides (4FB-modified
oligonucleotide), may be placed in contact with "magnetic affinity
beads," for example, beads having metal ions immobilized that are
available to be bound selectively, by chelation, with the product
antibody-oligonucleotide conjugates but not with the unreacted
modified-oligonucleotides. Once the antibody-oligonucleotide
conjugates have been bound to the magnetic affinity beads, the
beads are washed to remove the remaining reaction components other
than the bound antibody-oligonucleotide conjugates. The
antibody-oligonucleotide conjugates are then released with a
displacing agent, such as Buffer D, which then is buffered
exchanged with Buffer E via sequential spin down and resuspension
series, to provide purified antibody-oligonucleotide
conjugates.
[0232] In certain embodiments, the protein-oligonucleotide
conjugates may be prepared or purified, or both, as depicted in
FIGS. 9, 10, 12 and 13, where a protein is modified rather than an
antibody, and utilizing modified oligonucleotides as depicted in
FIGS. 9, 10, 11 and 13.
[0233] In certain embodiments, an antibody such as a monoclonal
antibody directed against a specific antigen of interest may be
conjugated to an oligonucleotide to form a conjugate. In FIG. 14,
the process for forming an antibody-oligonucleotide conjugate is
presented diagrammatically. Here, the conjugation takes advantage
of the chemical reaction between the HyNic and 4FB moieties to
promote full conversion of the antibody to conjugate. (A)
represents a post-synthetic chemical modification method to prepare
a 4FB modified oligonucleotide. Here, an amino-oligonucleotide, for
example, a C.sub.6-amino-oligonucleotide, that encodes a specific
barcode tag sequence is prepared by solid phase phosphoramidite
chemistry. Then, using the N-hydroxysuccinimide reactivity of
sulfo-succinimidyl activated 4-formyl benzoate (S-4FB), the
oligonucleotide is modified and activated. Alternatively, in (B),
the oligonucleotide is synthesized by solid phase phosphoramidite
chemistry with a terminal 4FB phosphoramidite monomer. The
oligonucleotide may be of a number of different lengths to
incorporate one or more barcodes, chemistries to incorporate
alternative backbones, bases, or inert linkers, or geometries, such
as tandem repeats or branched dendrimers to allow incorporation of
multiple copies of the barcode sequence, as can readily be formed
by standard means. Further, the 4FB moiety might be incorporated by
a number of alternative chemistries or by biochemical means using
enzymes. Further, a 4FB moiety might be placed at either the 3' or
5' end, or in the middle or close to either end of an
oligonucleotide. In parallel, in (C), the antibody or other
protein, biomolecule, or other probe would be reacted to
incorporate one or more HyNic moieties as via reaction of the
N-hydroxysuccinimide reactivity of sulfo-succinimidyl activated
6-hydrazinopyridine-3-carboxylate (S-HyNic) with a primary amine,
such as a Lysine amino acid epsilon amino group which are prevalent
on the surface of proteins. Five mole equivalents of S-HyNic to
each mole equivalent of antibody might be used. Other chemical or
biochemical means could be used to modify the antibody or other
probe molecule to display one or more HyNic moieties. Then, after
purifying the 4FB-modified oligonucleotide and HyNic-modified
antibody, they can be brought together, typically with a molar
excess of the oligonucleotide to the antibody. Via the formation of
the bisarylhydrazone bond, the antibody-oligonucleotide conjugate
(D) is formed. As shown in (E), non-denaturing polyacrylamide gel
electrophoresis of the HyNic modified antibody formed in (C) in
Lane 2 reveals a single prominent band at approximately 200 kD
apparent mass. In Lane 3, the antibody-oligonucleotide conjugate
formed in (D) demonstrates multiple bands indicating multiple
molecular forms. Here the one mole equivalent of HyNic-antibody was
combined with approximately three mole equivalents of
4FB-oligonucleotide. As indicated by the numbering, the bands are
consistent with the conjugation of 0, 1, 2, or 3 oligonucleotides
to the antibody. Thus, this process yields a mixture of
HyNic-modified antibody, 4FB-oligonucleotide and
antibody-oligonucleotide conjugates with one or more
oligonucleotides coupled to each antibody. By varying the mole
ratio of S-HyNic to antibody and of 4FB-modified oligonucleotide to
HyNic-modified antibody, essentially all, or nearly all, of the
antibody can be converted to oligonucleotide conjugate.
[0234] In certain embodiments, the purification and isolation of
antibody-oligonucleotide conjugates obtained by the reaction of
HyNic-modified antibody with a mole excess of 4FB-modified
oligonucleotide may be desirable, as shown in FIG. 15. A chemical
separation may be conducted in order to isolate the
antibody-oligonucleotide conjugate away from unincorporated
oligonucleotide. For example the conjugation reaction mixture (A),
comprising antibody-oligonucleotide conjugates and excess unreacted
4FB-modified-oligonucleotides, may be placed in contact with
"magnetic affinity beads," for example, beads having metal ions
immobilized by chelation that are available to be bound selectively
with a binding site on the antibody. Thus, the product
antibody-oligonucleotide conjugates will be substantially captured
onto the beads and the unreacted 4FB modified-oligonucleotides will
not. Once the antibody-oligonucleotide conjugates have been bound
to the magnetic affinity beads, the beads are washed to remove the
remaining reaction components other than the bound
antibody-oligonucleotide conjugates. The antibody-oligonucleotide
conjugates are then released with a displacing agent, such as
Buffer D, which then is buffer-exchanged with storage Buffer E by
applying the solution to a centrifugal desalting column
pre-equilibrated with Buffer E. The eluent after centrifugation
yields the purified antibody-oligonucleotide conjugate.
Immunodetection Assays and/or Detection
[0235] In certain embodiments, 1/1 antibody-oligonucleotide
conjugates may be required for immunodetection assays. Site
specific 1/1 antibody-oligonucleotides conjugates can be prepared
as schematically presented in FIG. 16 wherein antibodies are
reduced under controlled conditions to reduce two exposed disulfide
bonds in the hinge region, followed by quenching of the reduced
protein with MHPH, a thiol reactive aromatic hydrazine bifunctional
modification reagent, followed by desalting and conjugation to a
4FB-modified oligonucleotide in the presence of aniline catalysis.
In a non-site selective procedure, the antibody is controllably
modified with S-HyNic to incorporate <3 HyNic moieties followed
by conjugation to 0.75 or less mole equivalents of a
4FB-oligonucleotide in the presence or absence of aniline catalyst,
the unconjugated oligonucleotide is removed by size exclusion
chromatography, the unconjugated antibody is removed by ion
exchange chromatography and the conjugate released from the
cationic support to isolate the pure antibody-oligonucleotide
conjugate.
[0236] In certain embodiments, protein binders other than full
antibodies including Fab', Fab'-2 that possess free cysteine
moities, protein binders such as scFvs, monobodies, nanobodies,
diabodies and camelids engineered to incorporate a single cysteine,
or proteins engineered to incorporate unnatural amino acids such as
acetyl-phenylalanine incorporated using engineered tRNAs, and
aptamers can be barcoded with oligonucletotides and employed in
immunodetection assays. FIG. 17 presents schematically a procedure
to incorporate a single oligonucleotide barcode on a protein
containing a single cysteine using the HyNic/4FB couple to produce
an 1/1 protein-oligonucleotide conjugate mediated by an
bis-arylhydrazone bond.
[0237] In certain embodiments, a variety of signal generators can
be conjugated to the complementary oligonucleotide.
Oligonucleotide-signal generator conjugates can also be prepared
using the HyNic-4FB couple. FIG. 18 presents schematically a method
wherein an amino-substituted signal generator is modified to
incorporate a HyNic moiety and is conjugated to a
4FB-oligonucleotide in the presence or absence of aniline catalyst.
Other methods may also be employed. Signal generators that may be
incorporated on complementary oligonucleotides, such as those of
FIG. 18, include but are not limited to, fluorescent protein;
fluorophore; fluorosphere; quantum dot; enzyme; nucleic acid;
scaffold; dendrimer; hydrogel; buckyballs; nanoparticles; nanogold;
colloidal gold; microparticle; magnetic particle; bead; microarray;
microfluidic device; wetted surface; biological cells; or
derivatives or combinations thereof.
[0238] In certain embodiments, complementary detectors can be
prepared wherein the detector construct is prepared such that the
stoichiometry of the construct is 1 oligonucleotide conjugated to a
single scaffold to which multiple signal generators are covalently
bound. FIG. 19 presents the scheme described in the examples that
was used. The complementary detector was prepared in the following
multi-step protocol: (A) amino-dextran, a 50,000 mean molecular
weight polysaccharide bearing 40 to 50 amine groups per molecule,
was modified by reaction with sulfo-succinimidyl activated
6-hydrazinopyridine-3-carboxylate (S-HyNic) to incorporate 2-3
HyNic groups per molecule; (B) to each mole equivalent of
HyNic-amino-dextran was added 0.5 mole equivalents of complementary
4FB-modified oligonucleotide; (C) unconjugated 4FB-oligonucleotide
was removed by size exclusion column chromatography; (D)
unconjugated dextran was removed by ion exchange column
chromatography in which the oligonucleotide-amino-dextran conjugate
was adsorbed on the cationic support, the unconjugated dextran was
washed away and the oligonucleotide-amino dextran conjugate was
eluted from the support; (E) the oligonucleotide-amino dextran
conjugate was exchanged into pH 7.4 phosphate buffer and remaining
amino groups on the dextran component of the oligonucleotide-amino
dextran conjugate were then modified by combining for each mole
equivalent of oligonucleotide-dextran conjugate, 5 mole equivalents
of an N-hydroxysuccinimide-modified fluorescent organic dye; and
the resulting oligonucleotide-dextran-fluorophore conjugate was
purified by dialysis.
[0239] In certain embodiments, the antibody-oligonucleotide
conjugates or other oligonucleotide modified materials bearing a
specific oligonucleotide sequence that serves as a specific
barcode, may be combined with detector conjugate composed of a
complementary oligonucleotide sequence that serves as the
anti-barcode, chemically linked to a signal generator, such as an
oligonucleotide-dextran-fluorophore conjugate. Given the principles
of hybridization of complementary sequences, this interaction will
result in DNA-directed self assembly, leading to formation of a
complex where the antibody is stably associated with the signal
generator via a double stranded oligonucleotide linker. FIG. 20
presents a schematic presentation of the process of mixing (A), an
antibody-oligonucleotide conjugate formed by the reaction of
HyNic-modified antibody to a 4FB-modified oligonucleotide barcode,
with (B), a complementary anti-barcode oligonucleotide similarly
conjugated to a signal generator. The interaction of the two
oligonucleotides forms (C), a complex comprising an antibody now
labeled with a signal generator, linked by the hybridized
oligonucleotides. This interaction is documented by a native
polyacrylamide gel electrophoresis analysis, (D). In Lanes 3 and 5,
two distinct antibody-oligonucleotide conjugates each demonstrate a
range of species of characteristic mobility, e.g. A.sup.1 and
A.sup.2. As shown in Lanes 4 and 6, upon the addition of a
complementary oligonucleotide-dextran-fluorophore conjugate, the
two antibodies appear in a new form with greatly decreased
mobility, e.g. C.sup.1 and C.sup.2. Here greater than 95% of each
antibody-oligonucleotide conjugate has hybridized to the detector
as indicated by the nearly quantitative shift of the product to the
slower mobility form.
Self-Assembly
[0240] In certain embodiments, the principle of self-assembly
directed by hybridization between pairs of complementary
oligonucleotides can be used to facilitate the independent
formation of multiple complexes where each species represents a
specific signal generator linked by a double stranded
oligonucleotide to a specific antibody. As diagrammed in FIG. 21,
in (A), multiple antibodies denoted Ab.sub.1, Ab.sub.2, Ab.sub.3,
Ab.sub.4, etc., each conjugated to a different barcode
oligonucleotide denoted HyLk1, HyLk2, HyLk3, HyLk4, etc., might be
applied as probes to interrogate a complex biological sample. By
the principle of binding of antibodies to their cognate antigen
epitopes, the different antibody-oligonucleotide conjugates might
interact with the sample to form distinct immune complexes that
might distribute to distinct locations or be associated with
distinct features, for example. Then, in (B), a set of anti-barcode
oligonucleotides comprising the complementary sequences, denoted as
HyLk1', HyLk2', HyLk3', HyLk4', etc., and conjugated to different
signal generators, denoted as SG.sub.1, SG.sub.2, SG.sub.3,
SG.sub.4, etc., can be added. Then, in (C), by the principle of DNA
directed self-assembly, each barcode antibody would hybridize to
its anti-barcode signal generator to form complexes. This would
bring each signal generator into the distribution of each antibody,
so that e.g. the distribution of Ab.sub.1 could be determined by
the distribution of SG.sub.1, distribution of Ab.sub.2 could be
determined by the distribution of SG.sub.2, etc.
[0241] In certain embodiments, the principle of self-assembly
directed by hybridization between pairs of complementary
oligonucleotides can be used to facilitate the independent
formation of multiple complexes where each species represents a
specific signal generator linked by a double stranded
oligonucleotide to a specific antibody. Thus, mixtures of
antibody-oligonucleotide conjugates can be used to detect one or
more antigens present on the surface of a living cell and then
mixtures of detectors comprising the complementary oligonucleotide
conjugated to readily distinguished signal generators, in this case
each a dextran scaffold modified with fluorophores of specific
spectral properties, can be applied to allow detection of the
binding of each antibody independently in a single experiment,
using the methodologies of flow cytometry. As diagrammed in FIG.
22, a sample of cells to be characterized, such as mouse
splenocytes, are treated with a mixture of antibody-oligonucleotide
probes, such as a mouse monoclonal antibody directed against the
mouse T helper cell surface glycoprotein CD4 (.alpha.CD4)
conjugated to deoxyribose oligonucleotide HyLk1 and a mouse
monoclonal antibody against the CD43 sialophorin characteristic of
T cells (.alpha.CD43) conjugated to deoxyribose oligonucleotide
HyLk2. After allowing time for binding, the cells are washed so
that the solution is free of unbound antibody-oligonucleotide
conjugates. Then a mixture of complementary oligonucleotide
detectors which are conjugated to fluorescent proteins or
fluorescent dextrans, here a HyLk1' conjugated to signal generator
1 (SG.sup.1) and HyLk2' conjugated to signal generator 2
(SG.sup.2), are added to detect the bound antibodies. The resulting
hybridization of HyLk1 to HyLk1' and HyLk2 to HyLk2' then links
SG.sup.1 to cells presenting CD4 and SG.sup.2 to cells presenting
CD43. As shown here, the cell indicated would be identified by flow
cytometry as displaying fluorescence from both signal generators
SG.sup.1 and SG.sup.2, which would then lead to the conclusion that
this cells is potentially a CD4.sup.+ CD43.sup.+ T cell.
Detectors Comprising the Complementary Oligonucleotide
[0242] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a complementary
oligonucleotide HyLk1' conjugated by bisarylhydrazone linkage to
R-phycoerythrin (R-PE), a biofluorescent protein, can be used to
detect the CD4 cell surface protein on splenocytes in flow
cytometry. FIG. 23 compares a set of two dimensional flow cytometry
plots, where each cell that is detected is indicated by a dot
representing its specific forward scatter. FSC denoted on the
Y-axis, and its specific fluorescence in the R-PE channel, denoted
by R-PE on the X axis. The dots represent approximately 10,000
individual cells examined in a single experiment. As shown in plot
(A) in the upper left, when splenocytes are gated to select for
lymphocytes, they demonstrate a characteristic forward scatter of
approximately 300 FSC Units, and display approximately a
fluorescence intensity in the R-PE fluorescence channel of 5 R-PE
Units. Here, the value of 5 R-PE Units represents the background
due to endogenous fluorescence, limitations of the instrumentation
and other features. In the flow cytometry plot (B) on the upper
right, addition of 30 ng of HyLk1' conjugated to R-PE detector to
the splenocytes causes the lymphocytes to display increased
fluorescence in the R-PE channel, with a median intensity of
approximately 10 R-PE Units. This control experiment reveals the
detector background signal, which may be ascribed to non-specific
binding of the detectors to the lymphocytes. For the experiment, in
plot (C) in the lower panel, 0.1 .mu.g of .alpha.CD4 conjugated by
bisarylhydrazone chemistry to HyLk1 was first added to the
splenocytes and allowed to bind. Then the cells were washed and
treated with 30 ng of HyLk1'-R-PE. The cells were then analyzed by
flow cytometry as before. Note that two populations of cells are
detected, one with a median intensity of 20 R-PE Units and a second
with a median intensity of 3000 R-PE Units. The 3000 R-PE Unit
population represents the subset of splenocytes that would be
considered as CD4 positive (CD4.sup.+) by this assay, which
normally identifies presumptive T helper cells. The 20 R-PE Unit
population represents the cells that bound low levels of the
antibody and/or the detector and are considered CD4 negative
(CD4.sup.-), and represents the non-specific background in the
experiment. A proxy for the signal to background (S/B) of this
experiment can be estimated as the ratio of the median intensity of
the CD4.sup.+ and CD4.sup.- populations,
CD4.sup.+.sub.i/CD4.sup.-.sub.i, which here would be calculated as
greater than (>) 100. It is common to consider that a S/B>100
is a characteristic of a high quality biochemical assay.
[0243] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a complementary
oligonucleotide conjugated to the biofluorescent protein
allophycocyanin (APC), can be used to detect biomarker in flow
cytometry. As shown in FIG. 24, the plot (A) in the upper left
indicates the background fluorescence for lymphocytes, which has a
median value of approximately 5 APC Units. The plot (B) in the
upper right indicates that after addition of 10 ng of HyLk1'
conjugated by bisarylhydrazone chemistry to APC (HyLk1'-APC), the
median fluorescence does not increase appreciably and remains at 5
APC Units, indicating that the non-specific binding of the detector
is negligible. The lower plot (C) indicates the results when
splenocytes were treated with 2 .mu.g of .alpha.CD4 conjugated to
HyLk1, washed, treated with 10 ng of HyLk1'-APC and analyzed by
flow cytometry. Here, the two populations indicate a CD4.sup.-
population of cells at approximately 10 APC Units and a CD4.sup.+
population at 100 APC Units. The S/B here is estimated at
approximately 20.
[0244] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a complementary
oligonucleotide conjugated to a dextran scaffold to which multiple
DyLite 490 fluorophores have been coupled, can be used to detect
biomarker in flow cytometry. As shown in FIG. 25, the plot (A) in
the upper left indicates the background fluorescence for
lymphocytes, which has a median value of approximately 5 Dy490
Units. The plot (B) in the upper right indicates that after
addition of 10 ng of HyLk1' conjugated by bisarylhydrazone
chemistry to dextran which was then labeled with DyLite 490
(HyLk1'-poly-Dy490), the median fluorescence increases to 10 Dy490
Units, indicating measurable non-specific binding of the detector.
The lower plot (C) indicates the results when splenocytes were
treated with 2 .mu.g of .alpha.CD4 conjugated to HyLk1, washed,
treated with 10 ng of HyLk1'-poly-Dy490 and analyzed by flow
cytometry. Here, the two populations indicate a CD4.sup.-
population of cells at approximately 10 Dy490 Units and a CD4.sup.+
population at 500 Dy490 Units. The S/B here is estimated at
approximately 50.
Flow Cytometry, Western Blot, Library of Monoclonal Antibodies,
Beads, ELISA
[0245] A limiting feature for success of flow cytometry analysis to
detect antigens present in or on individual cells is the
sensitivity and specificity of detection of that antigen. In
general, antibodies are commonly used as probes, given their
properties as sensitive and specific detection reagents. When the
antibodies are rendered fluorescent, they may be detected by flow
cytometry. Direct fluorescent labeling of antibodies to form
stable, covalent antibody-fluorophore conjugates such as FITC
conjugates, R-PE conjugates, APC conjugates or others allows their
facile use in flow cytometry, but may alter the favorable
properties of the antibody as a detection reagent. In particular,
conjugation to multiple small organic fluorophores may inactivate a
significant fraction of antibodies or alter solubility. Conjugation
to fluorescent proteins R-PE or APC may impair accessibility of the
antibody combining site to antigen epitopes. An
antibody-oligonucleotide conjugate may be used for flow cytometry
as an alternative to an antibody-fluorophore conjugate. The
detectors may comprise the complementary oligonucleotide conjugated
to a signal generator. These may comprise a scaffold molecule
conjugated to multiple small organic fluorophores, such as HyLk1'
conjugated by bisarylhydrazone chemistry to dextran which was then
labeled with DyLite 490 (HyLk1'-poly-Dy490). As shown in FIG. 26, a
comparison of commercially available antibody-fluorophore
conjugates to antibody-oligonucleotide conjugates recognizing
surface antigens CD4, a T helper cell surface antigen, and CD8, a
cytotoxic T cell surface antigen, was performed. Alternatively,
.alpha.CD4:FITC or .alpha.CD8:FITC were applied under standard
conditions to splenocytes and the sample subjected to flow
cytometry. Then, a .alpha.CD4-HyLk1 conjugate or a .alpha.CD8-HyLk1
conjugate were applied to the splenocytes and the sample subjected
to flow cytometry. The graphs represent histograms summarizing the
flow cytometry data, gated to detect lymphocytes, obtained from
(A), unstained splenocytes or stained using the .alpha.CD4:FITC or
stained using the .alpha.CD4-HyLk1/HyLk1'-poly-Dy490 couple, and
(B), unstained splenocytes or stained using .alpha.CD8:FITC or
stained using the .alpha.CD8-HyLk1/HyLk1'-poly-Dy490 couple. The
Y-axis represents the relative abundance of cells that displayed a
specific intensity of fluorescence in the FITC channel, as
distributed on the X-axis. As shown in A and B, the .alpha.CD4:FITC
and .alpha.CD8:FITC reagents displayed the favorable property of a
small fluorescence background with respect to cells that would be
considered CD4.sup.+ or CD8.sup.+, respectively. By comparison, as
shown in A and B, applying either the
.alpha.CD4-HyLk1/HyLk1'-poly-Dy490 couple or the
.alpha.CD8-HyLk1/HyLk1'-poly-Dy490 couple caused a shift of the
cells to increased signal in the FITC channel, including those that
would be considered CD4.sup.+ or CD8.sup.+, respectively. This
would be interpreted as non-specific background, a potentially
unfavorable feature. As shown in A, a similar fraction of cells in
each population demonstrated a high staining level when treated
with .alpha.CD4:FITC or .alpha.CD4-HyLk1/HyLk1'-poly-Dy490,
representing CD4.sup.+ cells. Similarly, as shown in B, a similar
fraction of cells in each population demonstrated a high staining
level when treated with .alpha.CD8:FITC or
.alpha.CD8-HyLk1/HyLk1'-poly-Dy490, representing CD8.sup.+ cells.
The median intensity of CD4.sup.+ cells as detected by
.alpha.CD4:FITC is significantly less than those detected by
.alpha.CD4-HyLk1/HyLk1'-poly-Dy490. Similarly, the median intensity
of CD8.sup.+ cells as detected by .alpha.CD8:FITC is significantly
less than those detected by .alpha.CD8-HyLk1/HyLk1'-poly-Dy490. The
higher intensity of cells that display positive staining would be
interpreted as signal, a favorable feature. As a measure of
sensitivity and specificity and the quality of the assay, examining
the ratio of median intensity of the CD4.sup.+ to CD4.sup.- cells
or the CD8.sup.+ to CD8.sup.- cells offers a measurement of signal
to background (S/B). Here, the commercial reagents display a S/B of
.about.10 for .alpha.CD4:FITC and .about.50 for .alpha.CD8:FITC.
Here, the oligonucleotide conjugates display a S/B of .about.50 for
.alpha.CD4-HyLk1/HyLk1'-poly-Dy490 and .about.100 for
.alpha.CD8-HyLk1/HyLk1'-poly-Dy490. These data suggest that the
prototype olignucleotide conjugates and complementary
oligonucleotide detectors compare well to existing commercialized
reagents as detection reagents.
[0246] In certain embodiments, more than one
antibody-oligonucleotide conjugates will be brought into contact
with detectors comprising one complementary oligonucleotide
conjugated to a signal generator as well as one or more
non-complementary oligonucleotides conjugated to signal generators,
as an alternative to multiple conventional antibody-fluorophore
conjugates used together to analyze multiple antigens in a single
experiment. An advantage of the direct conjugation of the
fluorescence signal generator to the antibody is the high potential
for correct identification of an antibody based on a fluorescence
signal alone. Under conditions where multiple
antibody-oligonucleotide conjugates are used along with multiple
oligonucleotide-signal generator conjugates, it may be desirable to
have no appreciable interaction between non-complementary pairs. As
such, a consideration in evaluating the antibody-oligonucleotide
conjugates and oligonucleotide-signal generators is to investigate
the potential for interactions between pairs of non-complementary
oligonucleotides leading to false positive signals, commonly
described as crosstalk. Toward testing crosstalk between
noncomplementary pairs, splenocytes were stained and analyzed by
flow cytometry to compare the fluorescence of lymphocytes that were
treated with no antibody, or with .alpha.CD8-HyLk2, and then
treated with the non-complementary probe HyLk1'-poly-Dy490 or
HyLk1'-R-PE. In FIG. 27, the results of flow cytometry are
displayed as plots of the relative incidence of cells on the Y-axis
that display a fluorescence intensity as indicated on the X-axis
for the indicated fluorescence channel, FITC or R-PE. In graph (A),
the presence or absence of .alpha.CD8-HyLk2 has no appreciable
effect on the median fluorescence after treatment with
HyLk1'-poly-Dy490. Similarly, in (B), the presence or absence of
.alpha.CD8-HyLk2 has no appreciable effect on the median
fluorescence after treatment with HyLk1'-R-PE. These results
suggest that cross-talk is not a significant feature of
non-specific background in experiments using
antibody-oligonucleotide conjugates.
[0247] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a scaffold modified
with multiple fluorophores, can be used to detect cell surface
antigens by flow cytometry as an alternative to conventional
antibody-fluorophore conjugates. Another perceived advantage of
direct conjugation of antibodies to fluorophores is that the
binding of antibody to the antigen simultaneously, or substantially
simultaneously, achieves the fluorescent labeling step, potentially
saving time. Toward examining the speed of interaction of
antibody-oligonucleotide conjugates and complementary
oligonucleotides conjugated to dextran scaffolds modified by
fluorophores, an experiment was conducted where splenocytes stained
with .alpha.CD8-HyLk2 were washed and then contacted with
HyLk2'-poly-Dy549 for specific times and then immediately
introduced into the flow cytometer. The graphs (A) through (E) in
FIG. 28 represent two-dimensional flow cytometry plots of the
experiment where (A) demonstrates the background signal prior to
addition of the HyLk2'-poly-Dy549 detector and then (B), (C), (D)
and (E) represent the staining and detection of CD8.sup.+ cells at
1 minute, 5 minutes, 10 minutes and 15 minutes after addition of
the HyLk2'-poly-Dy549 detector. The data from (A) to (E) are
superimposed in (F) plotted as a histogram of relative abundance of
cells at each fluorescence intensity, allowing direct comparison.
As can be seen, the addition of HyLk2'-poly-Dy549 causes a shift of
the CD8.sup.- cells within one minute from a median value of
.about.3 Units to .about.7 Units. These cells do not become
appreciably more fluorescent over the subsequent incubation. At 1
minute, the CD8.sup.+ cells form a distinct population, indicated
by the arrow in (B), that displays a median intensity of .about.100
Units. At 5 minutes in (C), the CD8.sup.+ population displays
increased fluorescence to .about.200 Units. At 10 minutes in (D),
the CD8.sup.+ population displays increased fluorescence to
.about.300 Units and at 15 minutes in (E), the fluorescence is
.about.400 Units. These results indicate, in certain embodiments,
that incubation times as short as 1 to 15 minutes are sufficient
for hybridization of the oligonucleotides conjugated to dextran
scaffolds modified by fluorophores to the antibody-oligonucleotide
conjugates to permit detection of antigens with high signal to
background.
[0248] Depending on the particular application incubation times to
permit sufficent detection may vary. In certain embodiments,
incubation times to permit sufficient detection may include
overnight, 1 minute to 1 hour, 5 minutes to 20 minutes, 30 minutes
to 1 hour, 20 minutes to 2 hours, 1 to 4 hours, 3 to 8 hours, or 6
to 12 hours.
[0249] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a scaffold modified
with multiple fluorophores, can be used to detect cell surface
markers in flow cytometry to further characterize a cellular sample
by exploiting alternative fluorophores that can be detected
independently from another reference fluorophore. Here, each pair
of antibody-oligonucleotide conjugates and complementary
oligonucleotide conjugated to a signal generator may need to be
examined to obtain the optimal signal to background, in a process
of optimization. As shown in FIG. 29 an anti-CD19 antibody
recognizing the CD 19 B lymphocyte surface antigen, conjugated to
HyLk3 was added to splenocytes, allowed to bind, washed and
subsequently the complementary HyLk3' oligonucleotide coupled to a
dextran scaffold modified with Dy591 was added and the cells
analyzed by flow cytometry. Shown are a set of four two-dimensional
flow cytometry plots, where each cell that is detected is indicated
by a dot representing its specific side scatter, SSC denoted on the
Y-axis, and its specific fluorescence in the channel detecting
Dy591 on the X-axis. In A), the splenocytes were left unstained and
gated for lymphocytes, demonstrating a single distribution of cells
that display a median intensity of .about.3 Dy591 intensity units.
In B), C) and D), the splenocytes were treated with 0.1 .mu.g of
.alpha.CD19-HyLk3 before washing and treating with 0.3 .mu.g, 0.1
.mu.g or 0.03 .mu.g of HyLk3'-poly-Dy591, respectively. Two
subpopulations stained cells can be distinguished in B) and C),
that represent CD19.sup.+ and CD19.sup.- cells. In B), the
CD19.sup.+ cells display a median intensity of 100 units, while the
CD 19.sup.- cells are shifted due to non-specific background to a
median intensity of .about.20 units, yielding a S/B or .about.5.
Here, the detector reagent would be considered to be present in
excess to an optimal amount. In C) the CD19.sup.+ cells display a
median intensity of .about.50 units, while the CD19.sup.- cells are
not appreciably shifted due to non-specific background, yielding a
S/B or .about.10. Here, the detector would be considered to be
close to an optimal amount. In D), the presumptive CD 19.sup.+
cells cannot be reliably distinguished from the CD19.sup.- cells.
Here, the detector would be considered to be below the optimal
amount.
[0250] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a scaffold modified
with multiple fluorophores, can be used to detect detect cell
surface markers in flow cytometry to characterize a cellular
sample. As shown in FIG. 30, a splenocyte preparation was examined
to independently determine the proportion of cells that might be CD
19.sup.+ or CD8.sup.+, based on binding of antibody-oligonucleotide
conjugates. In plots A and B, the optimal conditions determined
above of 0.1 .mu.g of .alpha.CD19-HyLk3 and then 0.1 .mu.g of
HyLk3'-poly-Dy591 were applied, yielding plot B. Note that the
median fluorescence intensity of the CD19.sup.- fraction is only
slightly greater than the unstained control in plot A. In plots C
and D, 0.1 .mu.g of an anti-CD8 antibody conjugated to HyLk2,
.alpha.CD8-HyLk2, was added to splenocytes, allowed to bind, washed
and subsequently 0.1 .mu.g of the complementary HyLk2'
oligonucleotide conjugated to the dextran scaffold and modified
with Dy549, HyLk2'-poly-Dy549, was added and the cells analyzed by
flow cytometry, yielding plot D. Note that the median fluorescence
intensity of the CD19.sup.- fraction is only slightly greater than
the unstained control in plot C.
[0251] It is common in flow cytometry of complex cellular samples
to detect two or more surface antigens in a multiplex experiment,
as a method to distinguish between cells with overlapping patterns
of surface antigen expression. FIG. 31 demonstrates an experiment
wherein 5 commercially sourced antibody-fluorophore are used to
perform a multiplex flow cytometry experiment on mouse splenocytes.
The antibodies recognize CD4 (T cell receptor co-receptor MHC class
II restricted, HIV receptor, T helper cell antigen), CD8 (T cell
receptor co-receptor, cytotoxic T cell antigen), CD19 (B lymphocyte
surface antigen), CD43 (sialophorin, characteristic of both T and B
lymphocytes), and CD62L (L-selectin, characteristic of T and B
lymphocytes). In each of the two-dimensional flow cytometry plots
shown, cells gated to display only lymphocytes are represented by
dots and their position with respect to the X-axis represents the
intensity of the staining of each cell by the .alpha.CD4-APC.Cy7
tandem conjugate. In plot (A), the Y-axis displays the staining
with .alpha.CD8-PE. As shown, many lymphocytes are unstained by
either probe (lower left quadrant) and score as CD4.sup.-
CD8.sup.-, likely representing primarily B lymphocytes. Some
lymphocytes can be identified as CD4.sup.+ (lower right quadrant)
and some CD8.sup.+ (upper left quadrant) but few, if any, are
identified as CD4.sup.+ CD8.sup.+ (upper right quadrant). These
surface antigens are often restricted to different classes of T
cells. In turn, a similar analysis applies to (B), where the Y-axis
represents staining with .alpha.CD19-APC. These results show an
apparent lack of CD4.sup.+ CD 19.sup.+ cells, recognizing that CD4
is a T cell antigen and CD19 is a B cell antigen. The cells in the
lower left quadrant are likely to represent primarily CD8.sup.+ T
cells. In (C), where the Y-axis represents staining with
.alpha.CD43-FITC, some cells are scored as CD4.sup.+ CD43.sup.+,
insofar as CD43 is a characteristic antigen of T cells, including
CD4.sup.+ T cells. In (D), where the Y-axis represents staining
with .alpha.CD62L-AF700, most CD4.sup.+ cells are also CD62L.sup.+,
as are most of the CD4.sup.- cells including the CD8.sup.+ T cells
and the B cells.
[0252] In certain embodiments, multiple antibody-oligonucleotide
conjugates and their complementary detectors can be used
simultaneously, or substantially simultaneously, to detect two or
more protein biomarkers in a multiplex experiment, as a method to
distinguish between cells with overlapping patterns of surface
antigen expression. Here, the potential of antibody-oligonucleotide
conjugates and complementary oligonucleotide detectors in such an
assay is evaluated. As shown in FIG. 32, .alpha.CD4-HyLk1,
.alpha.CD8-HyLk2, .alpha.CD19-HyLk3, .alpha.CD43-HyLk4 and
.alpha.CD62L-HyLk5 conjugates were added simultaneously to
lymphocytes, allowed to bind and washed. Subsequently, the five
complementary oligo-dextran-fluorophore conjugates,
HyLk1'-poly-Dy490, HyLk2'-poly-Dy549, HyLk3'-poly-Dy591,
HyLk4'-poly-Dy649 and HyLk5'-poly-Dy405 were added simultaneously,
allowed to hybridize and the fluorescent signals were detected by
flow cytometry. Here, the flow cytometry data are represented by a
series of two dimensional plots, where each cell is represented by
a dot at the position of its intensity in the Dy490 (FITC)
fluorescence channel as indicated on the X-axis and by intensity of
the indicated fluorescence channel on the Y-axis. In (A), the
Y-axis represents .alpha.CD8 binding by Dy549 fluorescence
intensity. Both CD4.sup.+ and CD8.sup.+ cells are detected, but not
CD4.sup.+ CD8.sup.+ cells. In (B), the Y-axis represents
.alpha.CD19 binding by Dy591 fluorescence intensity, demonstrating
the capability to distinguish CD 19.sup.+ B cells from CD4.sup.+ T
cells. In (C), .alpha.CD43 binding is represented by Dy649
fluorescence on the Y-axis, demonstrating the result that some
CD43.sup.+ cells are CD4.sup.+ and that some CD4.sup.+ cells are
CD43.sup.+. Finally, in (D), the binding of .alpha.CD62L is
represented by Dy405 fluorescence on the Y-axis, demonstrating the
result that most CD4.sup.+ cells are also CD62L.sup.+. Comparison
of the distributions of the ability to distinguish markers and
relative numbers of cells between the results using commercial
conjugates shown in FIG. 31 to using DNA directed assembly to form
complexes between antibody-oligonucleotide conjugates and
complementary oligonucleotide detectors shown in FIG. 32 reveals
similar results.
[0253] In certain embodiments, antibody-oligonucleotide conjugates
can be used to bind to a cell surface antigen on a specific cell or
type of cell that may or may not be present in a mixture of cells
and other biological components such as blood or another in a
biological fluid, and these cells can be captured by hybridization
to the complementary oligonucleotide immobilized on a magnetic bead
or other solid surface. Then, using a magnetic field, these cells
can be removed from the rest of the sample such as other cells,
plasma, or other sample components. In some embodiments, the sample
such as blood, depleted of the captured cells, can then be used for
a purpose such as transfusion. Here, the method would be used for
negative selection. In other embodiments, the isolated cells can
then be used for some purpose such as transplantation, culture or
subjected to analysis. Here, the method would be used for positive
selection or cell enrichment. FIG. 33 illustrates this concept.
Here an .alpha.-CD4-HyLk1 conjugate is added to the sample and the
conjugates selectively binds to the CD4.sup.+ T helper cell shown
but not to other lymphocytes or other blood cells such as
monocytes, granulocytes, platelets or other blood cells.
Subsequently HyLk1'-magnetic beads are added to the sample and the
CD4.sup.+ cells bound to the magnetic bead are isolated away from
the other cells by application of a magnet.
[0254] In certain embodiments, the sample, depleted of the captured
cells, may then be used for a purpose such as transfusion. Here,
the method would be used for negative selection. In other
embodiments, the method would be used for positive selection or
cell enrichment, with the enriched population being used for
downstream analysis. FIG. 80 illustrates the depletion/enrichment
concept, in which (A) Her2 antibody (Herceptin.RTM., Genentech,
California) conjugated to oligo HyLk1 is added to a complex blood
sample. The Herceptin-HyLk1 conjugate selectively binds to
Her2.sup.+ tumor cells, but not to Her2.sup.- blood cells,
including leukocytes, monocytes, granulocytes, and platelets.
HyLk1'-magnetic particles are added to the sample (B), and
HyLk1-antibody labeled Her2.sup.+ cells bound by hybridization to
the magnetic particles are isolated from Her2.sup.- cells by
application of a magnet (C), resulting in a Her2-depleted sample
and a Her2-enriched sample. In FIG. 82, depletion of human Her2+
tumor cells from a sample of cultured leukocytes is illustrated
using certain methods described herein. 10% Her2- overexpressing
human breast adenocarcinoma cells were spiked into a culture of
human leukocyte cells. The sample was (A) undepleted, (B, C)
subjected to `mock` depletion methods without one or more necessary
components, (D) Her2-depleted using conventional methods, (E) Her2-
depleted using conventional methods, modified with the 2-step
approach included in the HybriLink strategy disclosed herein but
without the use of oligos; or (F) Her2-depleted using HybriLink
strategy disclosed herein. Following treatment, the samples were
stained with fluorescent antibodies against tumor cell markers Her2
(PE conjugate) and EpCAM (APC conjugate) to distinguish leukocytes
(Her2-EpCAM-) from tumor cells (Her2+ EpCAM+). EpCAM was used as a
secondary tumor cell marker to confirm depletion of tumor cells,
given that binding of Herceptin during cellular labeling prior to
magnetic depletion potentially interferes with downstream Her2
staining, should the Her2 antibodies target the same protein
epitope, thereby giving a false positive indication of successful
depletion. Double-staining with .alpha.EpCAM provides a control
against false depletion staining. Following
.alpha.Her2:PE/.alpha.EpCAM:APC staining, cells were analyzed using
a BD LSRII cytometer equipped with 561 nm and 633 nm lasers and
appropriate optical fluorochrome filters. Raw data files were
visualized using FlowJo software (TreeStar, Inc., Ashland, Oregon).
Positive staining gates were established based on fluorescent
intensity of cells stained with host IgG isotype-fluorochrome
controls (Data not shown). In undepleted cell population (A), 9.95%
of cells are Her2+EpCAM+ tumor cells, and 68.5% are Her2- EpCAM-,
for a tumor cell:leukocyte ratio of 1:6.9. Samples subjected to
"mock" depletion, in either the absence of complementary oligo
HyLk1' on magnetic beads (panel B) or in the absence of both
oligo:IgG and complementary HyLk1' oligo on beads (panel C) did not
exhibit successful depletion, indicating that beads unlabeled by
complementary oligo have no nonspecific affinity for tumor cells,
HyLk1 oligonucleotide, or Herceptin antibody conjugates, any of
which would interfere with successful depletion. Samples depleted
using current state-of-the-art methods (panel C), in which
biotinylated Herceptin was immobilized on to streptavidin-surfaced
magnetic nanospheres and applied to cells, showed a 56% depletion
of tumor cells, a 1:18.3 tumor cell/leukocyte ratio, and a
depletion ratio of 2.7.times.. A modified state-of-the-art method,
in which cells were labeled by Herceptin-biotin, and then isolated
using streptavidin surfaced nanospheres, was less successful than
conventional methods, resulting in 32.2% (1.8.times.) Her2
depletion. However, samples depleted using the HybriLink depletion
method described herein exhibited a tumor cell depletion of 77.9%,
with a tumor cell/leukocyte ratio of 1:39.0, or 5.7.times.
depletion ratio. The remaining tumor cell population was just 2.2%.
Panel G summarizes statistical data contained herein. Example 31
describes experimental methodology.
[0255] In certain embodiments, it may be necessary to both capture
a specific cell type by immunomagnetic protocols and subsequently
release the cell for further analyses. Cells isolated by
hybridization using oligonucleotides prepared from natural nucleic
acids as presented in FIG. 34, can be released from the magnetic
beads by strand displacement of the hybrid formed between the
antibody-oligonucleotide conjugate bound to the cell surface and
the complementary oligonucleotide on the bead. Here,
oligonucleotides based on peptide nucleic acid (PNAs), locked
nucleic acid (LNAs), morpholino or other oligonucleotide analogs
that are capable of strand invasion of DNA duplexes will be
designed to hybridize to the strand coupled to the magnetic bead
releasing the cell from the bead. The isolated cells would
subsequently be available for transplantation, culture, or analysis
by flow cytometry, imaging, microscopy, high content screening
(HCS), ELISA, ELISpot, or immunohistochemistry, or other assays. In
certain embodiments, one or multiple antibody-oligonucleotide
conjugates and their complementary detector-signal generator
conjugates can be used to capture cells in a microfluidic device in
which complementary oligonucleotides are immobilized in specific
spots or on specific posts. Here, as presented diagrammatically in
FIG. 35, using the example of the capture of circulating
EpCam.sup.+ cancer cells, (A) anti-EpCam antibody-HyLk1 conjugate
is added to a blood sample, allowed to bind and (B) the sample is
allowed to flow through a microfluidic channel containing posts to
which HyLk1' is immobilized and the anti-EpCam antibody-HyLk1
conjugate/EpCam.sup.+ cell complex are captured by hybridization.
Other cells, such as lymphocytes may flow through the microfluidic
device.
[0256] In certain embodiments, cells may be released from the
magnetic particles by strand displacement of the hybrid formed
between the antibody-oligonucleotide conjugate bound to the cell
surface and the complementary oligonucleotide on the bead. Here,
oligonucleotides based on peptide nucleic acid (PNAs), locked
nucleic acid (LNAs), morpholino or other oligonucleotide analogs
that are capable of strand invasion of DNA duplexes may designed to
hybridize to the strand coupled to the magnetic bead releasing the
cell from the bead. The isolated cells would subsequently be
available for transplantation, culture, or analysis by flow
cytometry, imaging, microscopy, high content screening (HCS),
ELISA, ELISpot, immunohistochemistry (IHC), or other assays. In
certain embodiments, one or multiple antibody-oligonucleotide
conjugates and their complementary detector-signal generator
conjugates may be used to capture cells in a microfluidic device in
which complementary oligonucleotides are immobilized in specific
spots or on specific posts. Here, as presented diagrammatically in
FIG. 83, using the example of the capture of Her2.sup.+ cancer
cells circulating in a complex whole blood sample, (A) Her2
antibody-HyLk1 conjugate is added to the sample, allowed to bind,
and (B) the sample is allowed to flow through a microfluidic
channel containing posts to which HyLk1' is immobilized; thereby,
HyLk1-Her2 antibody-Her2.sup.+ cell complexes are captured by
hybridization, while Her2.sup.- blood cells, such as leukocytes,
monocytes, granulocytes, and platelets, may flow through the
microfluidic device.
[0257] In certain embodiments, one or multiple
antibody-oligonucleotide conjugates and their complementary
detector-signal generator conjugates can be used individually or
simultaneously to detect one or more protein biomarkers in a single
or multiplex Western blot experiment. The potential of
antibody-oligonucleotide conjugates and complementary
oligonucleotide detectors in such an assay is evaluated. The
protocol as shown schematically in FIG. 36 (left) wherein total
protein from a cell lysate is electrophoresed, transferred to a
nitrocellulose membrane, and detected in two steps by initially
incubating the membrane with an antibody-oligonucleotide conjugate
followed by incubation with a complementary oligonucleotide-signal
generator conjugate. As an example, the signal generator might be a
horseradish peroxidase conjugate which can be localized on the blot
by standard chemi-luminescent detection. This method was
exemplified in a Western Blot assay using a human cancer cell line,
A431, that was untreated or treated with epidermal growth factor
(EGF). The cells were lysed and the protein fraction was
electrophoresed, transferred to a nitrocellulose membrane. As a
control experiment, the cytoskeletal protein tubulin was detected
either by standard Western Blot conditions using a rat monoclonal
anti-tubulin antibody followed by incubation with an anti-rat
immunoglobulin secondary antibody-HRP conjugate and developed using
standard chemiluminescent methods. A separate blot was incubated
successively with the same rat monoclonal anti-tubulin conjugated
to HyLk1, washed, incubated with a HyLk1'-HRP conjugate and
developed using standard chemiluminescent methods. The results
documented in FIG. 36 (right) show that both methods detect tubulin
and a non-specific band to a similar degree with respect to
sensitivity and specificity.
[0258] In certain embodiments, it will be advantageous to have a
method whereby various single antibody-oligonucleotide conjugates
can be linked by hybridization to a choice of
oligonucleotide-signal generator conjugates. Such an application
may allow a large catalog of antibodies, such as a library of
monoclonal antibodies with different specificities to antigens, to
be used together in multiplexed experiments. Here, assigning a
single barcode to each antibody would be impractical. Instead,
conjugating a single common oligonucleotide to each antibody would
be preferable. To accomplish this, as schematically represented in
FIG. 37, a Universal Sequence (U) that can be conjugated to an
antibody was specified. Thereafter, a set of adapter
oligonucleotides that incorporate two sequences, one that
hybridizes to the Universal Sequence (U') and the second that is
complementary to the sequence on an oligonucleotide-signal
generator conjugate (A', B', etc.) may be designed. The complement
to the Universal Sequence may be linked to the sequence that
hybridizes to the signal generator via several non-hybridized bases
or a polyethylene glycol chain or other non-nucleic acid
hydrophilic linker such as a dendrimer to form individual adapters,
e.g. U'-A', U'-B', and so on. Then, each antibody-Universal
Sequence conjugate would be mixed individually to an adapter and
allowed to hybridize as in Step 1. Then, in Step 2, the
antibody-Universal Sequence conjugate/adapter complexes can be used
individually or mixed together in an experiment to probe a
biological sample. When the cognate oligonucleotide-signal
generator conjugates are applied, as in Step 3, each hybridizes to
the specific antibody carrying its complementary adapter. As can be
recognized, a panel of such adapter oligonucleotides each
comprising one sequence complementary to the Universal Sequence and
a second sequence complementary to an oligonucleotide-signal
generator conjugate would allow a mix and match method to readily
incorporate by hybridization a panel of different signal generators
onto a panel of antibody-Universal Sequence oligonucleotide
conjugates.
[0259] In certain embodiments, a signal generator may be
incorporated on the 5'-end of the oligonucleotide-signal generator
conjugate as shown in FIG. 38 or internally in the sequence.
[0260] In certain embodiments, an adapter can be used in an
immunodection assay to allow a series of alternative signal
generators to be used with a single antibody-oligonucleotide
conjugate. Here, two Western blots identical to those shown in FIG.
36 were probed for analysis by infrared imaging by a LI-COR
instrument. In FIG. 39, the conventional approach of using an
anti-rat immunoglobulin antibody conjugated to LI-COR IR800 dye is
shown in A. In B, the rat anti-tubulin-oligonucleotide conjugate
was initially hybridized to an oligonucleotide designed to
incorporate HyLk1' and HyLk2 in tandem. This complex was then
incubated with the nitrocellulose membrane and washed. Then, a
HyLk2'-poly-IR800 dye signal generator conjugate was applied.
LI-COR imaging reveals similar fluorescent detection of the tubulin
band and the non-specific background band documents the results
showing that the standard primary antibody/secondary antibody-IR800
conjugate method and the Universal Adapter method both detect
tubulin.
[0261] The adapter method can also be used in flow cytometry as
shown in FIG. 40. Here as a positive control .alpha.-CD4
antibody-HyLk1 conjugate was added to splenocytes, allowed to bind
and washed. Subsequently, complementary HyLk1'-poly-Dy490 was
added, allowed to hybridize and detected by flow cytometry, which
showed that 24% of the cells were CD4.sup.+ (A). In the adapter
method, .alpha.-CD4 antibody-HyLk1 conjugate was added to
lymphocytes, allowed to bind and washed. In (B), this was followed
by addition of an adapter oligonucleotide designed to incorporate
HyLk1' and HyLk4 in tandem. The adapter was allowed to hybridize to
the HyLk1 conjugated to .alpha.-CD4 antibody and then washed.
Subsequently, complementary HyLk4'-poly-Dy649 was added allowed to
hybridize and was detected by flow cytometry, which showed that 26%
of the cells were CD4.sup.+ (B). In a negative control experiment
(C), the .alpha.-CD4-HyLk1 probe was added to lymphocytes, then the
HyLk1 ':HyLk4 adapter and then the HyLk1'-poly-Dy490 detector. If
the adapter hybridizes, and thereby occludes access of the detector
to the .alpha.-CD4-HyLk1 probe, flow cytometry may reveal no
CD4.sup.+ cells.
[0262] In certain embodiments, multiple antibody-oligonucleotide
conjugates may be used simultaneously, or substantially
simultaneously, to detect two or more protein biomarkers in a
multiplex bead array experiment. Here, the detection uses
solid-phase sandwich immunoassays with matched pairs of antibodies,
wherein a capture antibody tethers an antigen to a surface and the
subsequent binding of a detector antibody that recognizes a
distinct epitope on the antigen confirms detection. The method is
schematically presented in FIG. 41 wherein (A) an
antibody-oligonucleotide conjugate formed from a capture antibody
is added to a sample containing the antigen and allowed to bind,
then (B) coded non-magnetic or magnetic beads conjugated to the
complementary oligonucleotide are added to the sample wherein the
antigen/antibody-oligonucleotide complex hybridizes to the bead.
Then, in (C), a biotinylated detector antibody is added and allowed
to bind and in (D) streptavidin/R-phycoerythrin (SAPE) is added.
The resulting labeling of the bead by SAPE as in (E) allows the
presence of antigen to be detected by, for example, flow cytometry.
In general, the relative intensity of R-PE fluorescence will
correspond to the relative abundance of the antigen when multiple
samples are compared by this assay.
[0263] FIG. 42 presents schematically the self assembly of
multiplex bead arrays for analysis of multiple antigens in a single
sample, as an extension of the principle described in FIG. 41. As
an illustrative example, the diagram shows four
antibody-oligonucleotide conjugates assembling with four bead sets,
such as non-magnetic or magnetic fluorescently coded beads,
conjugated to their respective complementary oligonucleotides.
Here, multiple antibody-oligonucleotide conjugates (Ab.sub.X-HyLkX)
might be added to a biological sample and each could bind its
target antigen (Ag.sub.X), as shown in (A). Thus, Ab.sub.1-HyLk1
might bind Ag.sub.1, Ab.sub.2-HyLk2 might bind Ag.sub.2, and so on.
Then, as in (B), a mixture of multiple sets of fluorescently coded
beads, each bearing a different oligonucleotide
(HyLkX'-Bead.sub.X), would be added. Using DNA directed assembly
this allows self assembly of each antibody-oligonucleotide
conjugate onto the cognate fluorescently coded bead as in (C).
Then, not shown, addition of a mixture of biotinylated detector
antibodies specific to each antigen, or biotinylated detector
antibodies that might detect a common feature such as
phosphorylation of tyrosine, to form a sandwich complex, followed
by washing, and then detection by SAPE and washing, followed by
analysis by, for example, flow cytometry. As such, the abundance of
Ag.sub.1 in the sample could be determined by the SAPE signal
associated with Bead.sub.1, abundance of Ag.sub.2 could be
determined by the SAPE signal associated with Bead.sub.2, etc.
Repeating this process with greater numbers of matched pairs of
antibodies and beads sets, and then performing the analysis on
multiple samples may provide for substantially straightforward
multiplexed quantitation of the relative abundance of multiple
antigens, or relative phosphorylation, or other features, in
multiple samples.
[0264] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator, in this case a scaffold modified
with multiple fluorophores, can be used in a multiplex bead array
assay to simultaneously, or substantially simultaneously, detect
multiple analytes from a sample. FIG. 43 schematically presents the
method wherein two antibody-oligonucleotide conjugates, Ab-HyLk1
and Ab-HyLk2, against a single protein target prepared from either
two monoclonal antibodies to different epitopes on the target
analyte that have been conjugated to the two different
oligonucleotides or from a polyclonal antibody that has been split
into two parts and conjugated to the two different
oligonucleotides, then (A) the antibody-oligonucleotide pairs
(comprising an antibody-oligonucleotide conjugate for detection and
an antibody-oligonucleotide conjugate for capture) are added to a
sample wherein the analyte is captured to form a sandwich immune
complex, (B) fluorescently coded beads conjugated to the HyLk
oligonucleotide complementary to the capture antibody-HyLk1
oligonucleotide conjugate are added to the sample wherein the
sandwich immune complex hybridizes to the bead, then (C) a HyLk2'
complementary oligonucleotide-signal generator conjugate where the
SG.sup.X represents one or more signal generators, such as a
biofluorescent protein such as R-PE or a polyfluor conjugate, is
added and allowed to hybridize to the detector antibody-HyLk2
oligonucleotide conjugate, tethering the fluorescent signal
generator to the bead as in (D), allowing steps of washing and
detection as, for example, by flow cytometry. As described, this
scheme presents the method of a single-plex assay. However, by
using the scheme as provided in FIG. 42, the design of the assay
allows facile use of multiplexing with multiple sets of matched
pairs for sandwich immunoassay, via capture
antibody-oligonucleotide conjugates hybridizing to their
complementary fluorescently coded bead sets, and detection of the
detector antibody-oligonucleotide complexes by hybridization to
complementary oligonucleotides conjugated to fluorescence signal
generators such as R-PE. In certain embodiments, the order of
assembly and addition to a sample might be varied, so that the
capture antibodies might be combined with the beads prior to
contact with the sample or after, and the detector antibodies might
be added to the sample prior to or along with the capture
antibodies, or might be added after forming the antigen-capture
antibody complex on the beads and washing, or in other sequences as
might be possible.
[0265] In certain embodiments, antigen-oligonucleotide conjugates
and anti-isotype specific antibody-oligonucleotide conjugates and
their complementary oligonucleotide conjugated to a signal
generator, in this case a scaffold modified with multiple
fluorophores, can be used in a multiplex bead array assay to
simultaneously, or substantially simultaneously, detect and
quantify antigen-specific antibodies such as auto-antibodies,
antibodies generated from a vaccination or other isotype specific
antibodies such as IgE from a sample and detect and quantify the
isotype response in a serology assay. FIG. 44 schematically
presents a self-assembly-based method wherein (A) an antigen-HyLk1
conjugate and an anti-isotype specific antibody-HyLk2 conjugate are
added to the blood sample wherein the anti-antigen antibody is
captured by both oligonucleotide conjugates and (B) added to
mixture are HyLk1 '-fluorescently distinct bead conjugates
resulting in the capture of the complex by hybridization to HyLk1
conjugated to the antigen, (C) the complex is detected by the
addition of a HyLk2'-signal generator conjugate. As described, this
scheme presents the method of a single plex assay. However, the
design of the assay allows facile use of multiplexing with multiple
antigen-oligonucleotide conjugates and their complementary bead
sets along with multiple anti-isotype antibody-oligonucleotide
complexes and complementary oligonucleotide signal generators each
conjugated to a different signal generator. However, in certain
embodiments, the order of assembly and addition to a sample might
be varied, so that the capture antibodies might be combined with
the beads prior to contact with the sample or after, and the
detector antibodies might be added to the sample prior to or along
with the capture antibodies, or might be added after forming the
antigen-capture antibody complex on the beads and washing, or in
other sequences as might be possible.
[0266] In certain embodiments, in a pre-assembly-based assay
antigen-oligonucleotide conjugates may be hybridized to their
complementary oligonucleotide immobilized on a bead or a bead
encoded with for example a fluorophore to be distinct from other
beads, added to the biological sample to bind the cognate antigen,
washed and detected with an -antibody antibody (see exemplary FIG.
76). Example 24 exemplifies the detection of a rabbit-BSA antibody
that was captured by a BSA-HyLk1 conjugate pre-hybridized to a bead
immobilized to complementary HyLk1', followed by detection with a
biotinylated goat---rabbit antibody subsequently labeled with a
streptavidin-phycoerythrin conjugate (SAPE) and analyzed by flow
cytometry. The flow cytometry results (FIG. 75) presents the
results of the capture and detection of -BSA antibody using
BSA-HyLk1 conjugate immobilized on Compel-HyLk1' beads from 366 to
0.36 ng. However, in certain embodiments, the order of assembly and
addition to a sample might be varied, so that the capture
antibodies might be combined with sample prior to addition of the
beads, and the detector antibodies might be added to the sample
prior to or along with the capture antibodies, or might be added
after forming the antigen-capture antibody complex on the beads and
washing, or in other sequences as might be possible.
[0267] In certain embodiments, it will be useful to determine the
level and/or type of immune response to antigens such as viruses,
bacterial carbohydrates, viral proteins, protein therapeutics.
Antigen-oligonucleotide conjugates and their complementary
detectors may be used to simultaneously, or substantially
simultaneously, detect for example their cognate antibodies in a
multiplex experiment to detect and titer the amount of antibody
present in a biological sample. This would allow for example
multiplex detection and quantification of the level of antibodies
produced following immunization with a multiple antigen (e.g.,
combination) vaccine. FIG. 45 schematically presents the procedure
wherein (A) an antigen-HyLk1 oligonucleotide conjugate added to a
biological sample is bound by immunoglobulins present in the
sample, (B) complementary HyLk1' oligonucleotide conjugated onto a
fluorescently coded bead is added and the
antigen-oligonucleotide/antibody complex hybridizes to the bead,
(C) the antibody analyte is detected by addition of a biotinylated
anti-immunoglobulin detector antibody, (D) addition of a
streptavidin/R-PE (SAPE) conjugate tethers the fluorescent detector
to the bead (E) to permit detection using, for example, a flow
cytometer. In certain embodiments, the order of assembly and
addition to a sample might be varied, so that the capture
antibodies might be combined with the beads prior to contact with
the sample or after, and the detector antibodies might be added to
the sample prior to or along with the capture antibodies, or might
be added after forming the antigen-capture antibody complex on the
beads and washing, or in other sequences as might be possible.
[0268] In certain embodiments, antigen-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator can be used in a multiplex bead
array assay to simultaneously, or substantially simultaneously,
detect multiple immunoglobulin specificities from a single sample.
FIG. 46 presents schematically the self assembly of multiplex bead
arrays for analysis of multiple antibody specificities in a single
sample, as an extension of the principle described in FIG. 45. As
an illustrative example, the diagram shows four
antigen-oligonucleotide conjugates assembling with four bead sets,
such as non-magnetic or magnetic fluorescently coded beads,
conjugated to their respective complementary oligonucleotides.
Here, multiple antigen-oligonucleotide conjugates (Ag.sub.X-HyLkX)
might be prepared so that each could be bound by a different
immunoglobulin as in (A). Then, as in (B), a mixture of multiple
sets of fluorescently coded beads, each bearing a different
oligonucleotide (HyLkX'-Bead.sub.X), would be added. Using DNA
directed assembly this allows self assembly of each
antigen-oligonucleotide conjugate onto the cognate fluorescently
coded bead as in (C). Then, not shown, these complexes could be
added to a serum sample to allow binding of immunglobulins. After
washing, addition of biotinylated detector anti-immunoglobulin
antibodies to form a sandwich complex, followed by washing, and
then detection by SAPE and washing, followed by analysis by, for
example, flow cytometry. As such, the abundance of immunoglobulin
reactive to Ag.sub.1 in the sample could be determined by the SAPE
signal associated with Bead.sub.1, reactivity to Ag.sub.e could be
determined by the SAPE signal associated with Bead.sub.2, etc.
Repeating this process with greater numbers of antigens and beads
sets, and then performing the analysis on multiple samples may
provide for substantially straightforward serology for multiple
antigens in multiple serum samples. In certain embodiments, the
order of assembly and addition to a sample might be varied, so that
the capture antibodies might be combined with the beads prior to
contact with the sample or after, and the detector antibodies might
be added to the sample prior to or along with the capture
antibodies, or might be added after forming the antigen-capture
antibody complex on the beads and washing, or in other sequences as
might be possible.
[0269] In certain embodiments, the principle of self-assembly
directed by hybridization between pairs of complementary
oligonucleotides can be used to facilitate the independent
formation of multiple complexes. Thus in a bead array format,
mixtures of antigen-oligonucleotide conjugates can be used to
detect and quantify one or more anti-antigen antibodies in a
serology assay and using pairs of anti-isotypic
antibody-oligonucleotide conjugates with complementary
oligonucleotide-signal generators will be able to specifically
detect and quantify the isotype response. However, in certain
embodiments, the order of assembly and addition to a sample might
be varied, so that the capture antibodies might be combined with
the beads prior to contact with the sample or after, and the
detector antibodies might be added to the sample prior to or along
with the capture antibodies, or might be added after forming the
antigen-capture antibody complex on the beads and washing, or in
other sequences as might be possible.
[0270] The steps of self-assembly are illustrated in FIG. 47. Here
(A) antigen-HyLk1 conjugate is added to the serum sample binding to
its cognate antibodies, (B) coded beads immobilized with HyLk1' is
added to the sample wherein the antibody/antigen-HyLk1 complex
hybridizes to the HyLk1' bead, (C) here for example an anti-IgG
antibody conjugated to HyLk2 and an anti-IgE antibody conjugated to
HyLk3 are added and allowed to bind to its their targets, (D)
HyLk2'-SG.sup.1 and HyLk3'-SG.sup.2 fluorescent detectors are
added, allowed to hybridize and (E) detected by, for example, a
flow cytometer.
[0271] In certain embodiments, antibody-oligonucleotide conjugates
and beads conjugated to their respective complementary
oligonucleotide can be used in an immunoturbidity assay, which may
be automated. FIG. 48 schematically presents one iteration,
according to certain embodiments, of this assay wherein two
antibody-oligonucleotide conjugates against a single protein target
prepared from two monoclonal antibodies to different epitopes on
the target analyte are conjugated to two different
oligonucleotides, Hylk3 and HyLk4, are added (A) to a sample
containing the cognate antigen, (B) allowed to bind, (C) combined
with a mixture of two sets of the latex beads or gold particles
immobilized to their respective, HyLk3' or HyLk4' complementary
oligonucleotides, of a size that they are in suspension in
hybridization buffer. As shown in (D) in FIG. 46, contact with the
immune complex formed by the two antibodies binding as a sandwich
to the antigen permits crosslinking between beads by hybridization,
leading to agglutination of the beads in the tube. In general, the
degree of agglutination will be in proportion to the abundance of
antigen, and is detected, for example, visually or using a standard
immunoturbidity reader. In an alternate iteration a polyclonal
antibody against a biomarker target is conjugated to an
oligonucleotide. Also prepared is its complementary oligonucleotide
immobilized on latex beads or gold particles of a size that they
are in suspension in hybridization buffer. These conjugates are
processed as described herein and the amount of agglutination may
be determined on, for example, an immunotubidity reader to measure
the abundance of the biomarker target in the sample. The order of
assembly and/or addition to a sample may be varied, for example, so
that the antibody-oligonucleotide conjugate(s) may be combined with
the beads prior to contact with the sample or after, or may be
added after forming the antigen-capture antibody complex. FIG. 48
schematically presents the method wherein two
antibody-oligonucleotide conjugates against a single protein target
prepared from either two monoclonal antibodies to different
epitopes on the target analyte are conjugated to two different
oligonucleotides, Hylk3 and HyLk4, or from a polyclonal antibody
that has been split into two parts and conjugated to the two
different oligonucleotides are added (A) to a sample containing the
cognate antigen, (B) allowed to bind, (C) added to a tube
containing two sets of latex beads, of a size that they are in
suspension in hybridization buffer, each conjugated to one of the
two complementary oligonucleotides HyLk3' or HyLk4'. As shown in
(D), contact with the immune complex formed by the two antibodies
binding as a sandwich to the antigen permits crosslinking among
beads by hybridization, leading to agglutination of the beads in
the tube. In general, the degree of agglutination will be in
proportion to the abundance of antigen, and is detected, for
example, using a standard immunoturbidity reader. Here, for
example, a polyclonalantibody that has been raised against a
biomarker target is divided and one half is conjugated to HyLk3 and
one half is conjugated to HyLk4. Also prepared are two sets of
beads conjugated to HyLk3' and HyLk4' respectively. These
conjugates are processed as described herein and the amount of
agglutination may be determined on an immunotubidity reader to
measure the abundance of the biomarker target in the sample.
However, in certain embodiments, the order of assembly and addition
to a sample might be varied, so that the capture antibodies might
be combined with the beads prior to contact with the sample or
after, and the detector antibodies might be added to the sample
prior to or along with the capture antibodies, or might be added
after forming the antigen-capture antibody complex on the beads and
washing, or in other sequences as might be possible.
[0272] In certain embodiments, antibody-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator can be used in an ELISA-based
assay using either fluorescent or enzyme-based detection. As
presented in FIG. 49, (A) HyLk1' oligonucleotides are immobilized
by covalent attachment on a solid surface such as a plastic 96 well
plate, and in the sample to be analyzed, (B) a capture
antibody-HyLk1 oligonucleotide conjugate binds to its cognate
antigen where present, (C) the sample is then added to the
oligonucleotide-coated surface and the
antibody-oligonucleotide/antigen complex hybridizes to the HyLk1',
tethering the immune complex, (D) a biotinylated detector antibody
specific to that antigen is added and (E) detected using a
streptavidin-signal generator conjugate such as an enzyme or
biofluorescent protein. However, in certain embodiments, the order
of assembly and addition to a sample might be varied, so that the
capture antibodies might be combined with the beads prior to
contact with the sample or after, and the detector antibodies might
be added to the sample prior to or along with the capture
antibodies, or might be added after forming the antigen-capture
antibody complex on the beads and washing, or in other sequences as
might be possible.
[0273] The method of FIG. 50 is similar to FIG. 49 except that the
oligonucleotide is initially conjugated to a carrier protein such
as bovine serum albumin (BSA) and thereby immobilized to the
surface. Here, (A) oligonucleotides are immobilized on a solid
surface such as a plastic 96 well plate but via covalent attachment
or non-covalent adsorption of BSA-HyLk1' conjugate, and in the
sample to be analyzed, (B) a capture antibody-HyLk1 oligonucleotide
conjugate binds to its cognate antigen where present, (C) the
sample is then added to the BSA-HyLk1-coated surface and the
antibody-oligonucleotide/antigen complex hybridizes to HyLk1',
tethering the immune complex, (D) a biotinylated detector antibody
specific to that antigen is added and (E) detected using a
streptavidin-signal generator conjugate such as an enzyme or
biofluorescent protein. Use of this indirect immobilization method
may be advantageous as: (i) the BSA may prevent non-specific
binding to the plastic surface, (ii) the attachment to a protein
linker may better present the oligonucleotide for hybridization
(iii), less oligonucleotide would be required as conjugation to
protein is more efficient than immobilization on plastic, and (iv)
BSA will better anchor the oligonucleotide to the plate by
multi-point contact. In certain embodiments, the order of assembly
and addition to a sample might be varied, so that the capture
antibodies might be combined with the beads prior to contact with
the sample or after, and the detector antibodies might be added to
the sample prior to or along with the capture antibodies, or might
be added after forming the antigen-capture antibody complex on the
beads and washing, or in other sequences as might be possible.
[0274] In certain embodiments, antigen-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator can be used in an ELISA format in
a serology-based assay to detect anti-antigen antibodies. FIG. 51
schematically presents a protocol to accomplish this wherein an (A)
a HyLk1' complementary oligonucleotide has been immobilized by
attachment or adsorption of a BSA-HyLk1' conjugate, (B) an
antigen-oligonucleotide conjugate is mixed with the biological
sample capturing the anti-antigen immunoglobulin, (C) the resulting
immune complex is captured by hybridization, (D) a biotinylated
anti-antibody is added and (E) detected using a streptavidin-signal
generator conjugated to an enzyme or biofluorescent protein.
Similar schemes may be used with complementary oligonucleotides
directly conjugated to the surface of the ELISA plate.
[0275] The bead-based examples illustrated herein may be applicable
to both self-assembly, i.e. wherein the capture-oligonucleotide
conjugates are added to the biological sample and then captured on
beads, as well as pre-assembly, wherein the capture-oligonucleotide
conjugate is pre-hybridized to its bead then mixtures of beads are
combined and added to the biological sample. In certain
embodiments, the order of assembly and addition to a sample might
be varied, so that the capture antibodies might be combined with
the beads prior to contact with the sample or after, and the
detector antibodies might be added to the sample prior to or along
with the capture antibodies, or might be added after forming the
antigen-capture antibody complex on the beads and washing, or in
other sequences as might be possible.
Immunocytochemistry
[0276] In certain embodiments, antigen-oligonucleotide conjugates
and detectors comprising the complementary oligonucleotide
conjugated to a signal generator may be used in immunocytochemistry
and related methods to determine the abundance and localization of
one or more specific antigens within cells. Where the signal
generators can be distinguished, as is readily achieved by using
fluorophores with distinct fluorescence properties, it would be
straightforward to independently determine and then compare the
localizations of multiple antigens within a single cell. After
applying the probes and detectors, the sample would be subjected to
microscopic imaging using optical means to illuminate the sample at
each of the different fluorescence excitation bands and record the
image at the corresponding emission bands, using sets of optical
filters or other means. To determine the relative distributions,
the images could then be compared to registration images such as a
phase contrast or other brightfield image and then compared to each
other to evaluate the distributions of intensity of fluorescence.
Determination of cellular abundance and distribution of antigens
might commonly be pursued to examine cells grown in the laboratory
to pursue an experiment, or toward diagnosis, to examine cells
obtained from a biological sample such as blood or other
cell-containing fluid or extracted from a solid tissue as via a
fine-needle biopsy, tissue print or other common method. As an
example, as shown in FIG. 52 and FIG. 53, growing human cancer
cells adhering to a glass surface were permeabilized with a
detergent, and fixed and dehydrated with methanol. The cells were
rehydrated and incubated with BSA to block nonspecific binding of
probes and detectors. Then, a mixture of two probes, a rat
anti-tubulin monoclonal antibody-HyLk1 conjugate and a mouse
anti-phosphotyrosine monoclonal antibody-HyLk2 conjugate were
applied. Then, the free probes were washed away and a mixture of
HyLk1'-poly-Dy490 and HyLk2'-poly-Dy549, both oligonucleotide
conjugates to fluorescently labeled amino dextrans, were applied.
Then excess detector conjugates were washed away and the cells were
imaged by epifluorescence microscopy. As shown in FIG. 52, the
characteristic distribution of tubulin in cells can be appreciated,
particularly in those cells indicated by the white arrows that may
be performing mitosis, a step in cell division where the
microtubules align in the cell to mediate separation of
chromosomes. In (A), both the anti-tubulin-oligonucleotide
conjugate probe and complementary oligonucleotide-fluorescence
scaffold detector were applied. Here, one infers that the
distribution of fluorescence in the image corresponds to the
distribution of tubulin in the cells insofar as the control
experiment shown in (B), where only the fluorescent detector was
applied, demonstrates a lower fluorescent signal and displays no
subcellular distribution.
Differential Interference Contrast Brightfield
[0277] In FIG. 53, in (A), a single field of cells is shown imaged
by Differential Interference Contrast brightfield, and in (B) and
(C), respectively, the same field imaged using two fluorescent
filter sets, the FITC filters to detect Dy490 distribution and the
rhodamine filters to detect Dy549 distribution. The three images
allow independent evaluation and comparison of the shape of the
cells, the distribution of tubulin and the distribution of
phosphotyrosine-containing proteins. The independent nature of the
detection can be appreciated at the position indicated by the white
arrows in each image. The arrows indicate two cells apparently
performing mitosis, based on the pattern of distribution of
tubulin. However, in the region of concentrated tubulin staining,
staining for phosphotyrosine appears to be absent.
Preassembly
[0278] FIG. 54 diagrammatically presents the process of preassembly
using pairs of complementary oligonucleotides in which a plurality
of molecular probes, here a series of antibody-oligonucleotide
conjugates, and a plurality of detectable components, here a series
of signal generating moieties-complementary oligonucleotide
conjugates, are hybridized, i.e., preassembled, to form a plurality
of preassembled molecular probe-detectable component hybrids. The
unique pairing of the molecular probes and the detectable
components, may be predefined, as in this scheme, based on the
complementarities of the oligonucleotides conjugated to the binding
moiety and signal generating moieties, respectively. In one
embodiment, the preassembly process may be completed by first
mixing a plurality of antibody-oligonucleotide conjugates together
to form a pool of the antibody-oligonucleotide conjugates, and then
second, and separately, mixing a plurality of signal generating
moiety-complementary oligonucleotide conjugates together to form a
pool of the signal generating moiety-complementary oligonucleotide
conjugates. Subsequently, the pool of the antibody-oligonucleotide
conjugates and the pool of the signal generating
moiety-complementary oligonucleotide conjugates are then mixed
together, allowing for the hybridization of the complementary
oligonucleotide sequences to form the plurality of preassembled
antibody-signal generating moiety hybrids. In certain embodiments,
an individual molecular probe, such as an individual
antibody-oligonucleotide, may be combined and preassembled with its
complementary detectable component comprising a complementary
oligonucleotide sequence, one at a time, each combination allowed
to preassemble (i.e., hybridize). In certain embodiments, the
individually preassembled molecular probe-detectable component
hybrids may be mixed and pooled together. In certain embodiments,
the preassembled molecular probe-detectable component hybrids,
either individual sets or a plurality of sets may then be brought
into contact with a sample comprising one or more molecular
targets.
[0279] FIG. 55 presents results from an experiment demonstrating
the process of preassembly as applied to a flow cytometry
experiment on mouse splenocytes, and compares these results to
sequential assembly in which the probes are applied in a first step
and then the detectors in a second step. In the four flow cytometry
dot plots on the left (labeled "sequential 5-plex"), the experiment
was performed according to Example 10-B, wherein the CD4-HyLk1,
CD8-HyLk2, CD19-HyLk3, CD43-HyLk4 and CD62L-HyLk5
antibody-oligonucleotide conjugates were applied to the mouse
splenocytes for 30 minutes at 4.degree. C., followed by washing,
and then the HyLk1'-Dy490, HyLk2'-Dy549, HyLk3'-Dy591, HyLk4'-Dy649
and HyLk5'-Dy405 detectors were applied 15 minutes at room
temperature, followed by washing and flow cytometry. In the example
on the right (labeled "Preassembled 5-plex (in pool)"), the
CD4-HyLk1, CD8-HyLk2, CD19-HyLk3, CD43-HyLk4 and CD62L-HyLk5 were
combined in equal amounts in a single tube to form a pool of
antibody-oligonucleotide conjugates. Then, the complementary
polyfluor signal generating moiety conjugates HyLk1'-Dy490,
HyLk2'-Dy549, HyLk3'-Dy591, HyLk4'-Dy649 and HyLk5'-Dy405 were
added in molar excess and allowed to hybridize for 15 minutes at
room temperature. The preassembled antibody-signal generating
moiety hybrids were then added to mouse splenocytes as a pooled
mixture, allowed to bind 30 minutes at 4.degree. C., washed, and
then analyzed by flow cytometry. Qualitatively similar results were
obtained by each method, indicating that the order of assembly is
not critical to the use of nucleic acid hybridization to form
hybrids between molecular probes and detectable components to
enable detection of multiple analytes, for example multiple
biological targets in a sample.
[0280] FIG. 56 presents results comparing the use of two
alternative methods of preassembly. In the example on the left
(labeled "Preassemble in pool, then add to cells"), the CD4-HyLk1,
CD8-HyLk2, CD19-HyLk3, CD43-HyLk4 and CD62L-HyLk5 were combined to
form a pool, the complementary polyfluor signal generating moiety
conjugates HyLk1'-Dy490, HyLk2'-Dy549, HyLk3'-Dy591, HyLk4'-Dy649
and HyLk5'-Dy405 were added in molar excess, incubated, and the
mixture was then added to mouse splenocytes before analysis by flow
cytometry as in FIG. 55. On the right (labeled "Preassemble
one-by-one, pool, add to cells"), the CD4-HyLk1, CD8-HyLk2,
CD19-HyLk3, CD43-HyLk4 and CD62L-HyLk5 were each individually
combined with their complementary polyfluor signal generating
moiety conjugates HyLk1'-Dy490, HyLk2'-Dy549, HyLk3'-Dy591,
HyLk4'-Dy649 and HyLk5'-Dy405 in separate tubes, incubated to
permit preassembly hybridization, added individually to the
splenocytes, allowed to bind 30 minutes at 4.degree. C., washed,
and then analyzed by flow cytometry. The comparable results of the
two alternative methods of preassembly suggest that either these
alternatives, or other preassembly protocols, may be followed with
similar success.
[0281] The examples illustrated herein may be applicable to both
self-assembly, i.e., wherein the capture-oligonucleotide conjugates
are added to the biological sample and then captured on beads, as
well as pre-assembly, wherein the capture-oligonucleotide conjugate
is pre-hybridized to its bead then mixtures of beads are combined
and added to the biological sample. In certain embodiments, the
order of assembly and addition to a sample might be varied, so that
the capture antibodies might be combined with the beads prior to
contact with the sample or after, and the detector antibodies might
be added to the sample prior to or along with the capture
antibodies, or might be added after forming the antigen-capture
antibody complex on the beads and washing, or in other sequences as
might be possible.
Cross-Talk
[0282] Several schemes, such as those exemplified in FIG. 57 may be
considered to address and/or decrease the potential for cross-talk,
e.g., non-specific labeling or background, such that a molecular
probe may be falsely detected or obscured, due to a natural process
of oligonucleotide dissociation and hybridization. Some processes
that may be used to address the concern regarding cross-talk
include, for example, as illustrated in panel A, wherein the
oligonucleotide sequence of a non-hybridized molecular probe (i.e.,
not hybridized to a complementary detectable component, may be
hybridized with an unconjugated complementary oligonucleotide.
Similarly, in the process illustrated in panel B, the complementary
oligonucleotide sequence of a non-hybridized detectable component
may be hybridized to an unconjugated oligonucleotide. In other
embodiments, such as those shown in panel C, the duplexes that are
formed by preassembly hybridization of the molecular probe(s) and
the detectable component(s) may be stabilized to prevent
dissociation, for example, by the addition of natural or synthetic
minor groove binding agents, such as distamycin or Hoechst 33258,
or of natural or synthetic intercalating agents, such as daunomycin
or ethidium bromide.
Universal Oligonucleotide Sequence
[0283] In certain embodiments, one or more binding moieties, such
as one or more antibodies, may be conjugated to a universal
oligonucleotide sequence, i.e., a single, common oligonucleotide
that serves as a universal tag, to provide one or more molecular
probes differing in the identity of the binding moiety conjugated
to the universal oligonucleotide sequence. Similarly, one or more
signal generating moieties, such as one or more scaffolds
comprising one or more organic fluorophores, may be conjugated to a
universal complementary oligonucleotide sequence (i.e., an
oligonucleotide sequence complementary that serves as a universal
tag) to provide one or more detectable components to facilitate
detection in one or more channels and/or formats, such as one or
more fluorescent channels, detection via one or more enzymes
through enzymatic reactivity, or one or more particles. Using the
process of preassembly, forming preassembled molecular
probe-detectable component hybrids by selecting the molecular
probes to be used and individually hybridizing these to selected
detectable components in their own tubes, thereby forming the
selected pairings individually, provides a method that avoids or
substantially avoids indiscriminate hybridization events between
molecular probes and detectable components that are all combined at
once so that the specificity would be lost via cross-talk. The
individually preassembled hybrids of the process disclosed herein,
may then be stabilized. In certain embodiments, the stabilized
preassembled hybrids may then be pooled together, and may then be
subsequently contacted with a sample comprising one or more
molecular targets, to perform a multiplexed assay.
[0284] In FIG. 58 is diagrammed an example wherein a universal
oligonucleotide is conjugated to a panel of molecular probes and a
universal oligonucleotide complement is conjugated to a panel of
signal generating moieties. For example, a panel of
antibody-universal oligonucleotide conjugates are individually
combined (i.e., preassembled) with a panel complementary universal
oligonucleotide-signal generating moieties in separate tubes to
form preassembled antibody-signal generating moiety hybrids prior
to stabilization. The preassembled hybrids may be stabilized and
then may be contacted with a sample comprising one or more
molecular targets or analytes to perform an assay. In certain
embodiments, as illustrated in FIG. 59, the stabilized preassembled
hybrids may first be combined or mixed together to form a pool of
stabilized preassembled hybrids, and then the pool of stabilized
preassembled hybrids may then be contacted with a sample comprising
one or more molecular targets or analytes to perform an assay.
[0285] The process of preassembly using a universal oligonucleotide
and its complement has particular value in assembling assays on
barcoded particles, for example with flow cytometry-based
multiplexed immunodetection assays. As shown in FIG. 60, a panel of
monoclonal antibodies (or other affinity agents that form the
capture reagents for sandwich immunoassays) may be conjugated to a
universal oligonucleotide. Similarly, a panel of barcoded particles
may be conjugated to the complementary universal oligonucleotide. A
multiplexed immunoassay array may be assembled by individually
preassembling (combining) an antibody-universal conjugate, such as
a monoclonal antibody-universal conjugate, with a barcoded
particle, such as a bead-complementary universal oligonucleotide
conjugate, to allow for hybridization to form a preassembled
antibody-bead hybrid. The preassembled antibody-bead hybrids may
then be stabilized with unconjugated oligonucleotides or duplex
stabilizers. The individual stabilized preassembled antibody-bead
hybrids may then be contacted with a sample comprising one or more
molecular targets or analytes to perform one or more assays.
Alternatively, as illustrated in FIG. 61, the individual stabilized
preassembled antibody-bead hybrids may be combined with other
preassembled sets of stabilized preassembled antibody-bead hybrids
to form a pool, that may then be contacted with a sample comprising
one or more molecular targets or analytes to perform one or more
assays. Once the one or more molecular targets or analytes are
bound, the remaining unbound sample may be washed away and the one
or more bound targets or analytes may be detected, for example, by
the addition of detector reagents, such as polyclonal antibodies,
or polyclonal antibodies in a biotinylated form. After washing away
unbound detectors, binding of the barcoded particles may be
detected, for example by a streptavidin-based probe or other
means.
Barcode
[0286] In certain embodiments, the detectable component may be a
nucleic acid, such as an oligonucleotide, or a sequence thereof.
Oligonucleotides may be readily applied as detectable components if
they include a sequence barcode, called herein as "barcoded
oligonucleotide detectable components," that may be recognized by
either the binding of other detectable components, for example, a
complementary oligonucleotide sequence conjugated to one or more
fluorescent signal generating moieties or other signal generating
moiety tags, or by hybridization to an array, or by sequence
analysis, or by combinations or derivatives thereof. In certain
embodiments, the barcoded oligonucleotide detectable component may
comprise a first oligonucleotide sequence, such as a
20-oligonucleotide universal sequence, comprising a complementary
oligonucleotide sequence that permits hybridization to a universal
oligonucleotide conjugated to a molecular probe, and a second
oligonucleotide sequence, such as a 20-oligonucleotide unique
sequence, comprising a sequence that is unique to that detectable
component, and optionally other sequences that may be used to
enable detection. The barcoded oligonucleotide detectable
components may then be readily adapted to the process of
preassembly by assigning the individual sequences of the barcoded
oligonucleotide detectable components to particular molecular
probes, as shown in FIG. 62. The hybrids may be individually formed
by selecting a molecular probe, combining it with a barcoded
oligonucleotide detectable component, allowing for hybridization to
occur, followed by stabilization of the preassembled molecular
probe-barcoded oligonucleotide detectable component hybrid. In
certain embodiments, the stabilized preassembled molecular
probe-barcoded oligonucleotide detectable component hybrids may be
pooled, as shown in FIG. 63, and then contacted with a sample
comprising one or more molecular targets or analytes. After washing
to remove unbound sample, the barcoded oligonucleotide detectable
components that have been retained and/or bound to the sample may
then be assayed, for example, by dissociating the hybridized
barcoded oligonucleotide detectable components away from their
respective molecular probes, such as by denaturing the duplexes.
The de-hydybridized barcoded oligonucleotide detectable components
may then be eluted and analyzed, either qualitatively for the
presence of, or quantitatively for the abundance of, each barcoded
oligonucleotide detectable component. In certain embodiments, the
process may be combined with a DNA sequencing technology, wherein
such a combination may enable very high levels of multiplexing,
such as tens, hundreds, or thousands, and may offer accurate
quantitation, broad dynamic range, low background and/or high
specificity.
Preassembly
[0287] As shown in FIG. 64, the process of preassembly is
compatible with the use of one or more universal adapters,
comprising a common, universal oligonucleotide sequence that is
complementary to a universal oligonucleotide sequence conjugated to
a molecular probe and a unique oligonucleotide sequence that is
complementary to a unique detectable component, wherein the unique
detectable component comprises a unique oligonucleotide sequence
conjugated to a particular signal generating moiety. The one or
more universal adapters may comprise 45-mer sequences, wherein the
universal sequence may be a 20-mer oligonucleotide sequence, and
the unique oligonucleotide sequence may be a 20-mer oligonucleotide
sequence. In certain embodiments, one or more molecular probes
conjugated to universal oligonucleotides may be preassembled with
one or more universal adapters, comprising a complementary
universal oligonucleotide sequence and a unique oligonucleotide
sequence, by individually mixing a particular molecular probe with
a particular universal adapter, thereby allowing hybridization to
occur to form a preassembled molecular probe-universal adapter
hybrid. In certain embodiments, the preassembled molecular
probe-universal adapter hybrid may be stabilized, may then be
pooled with the other the stabilized preassembled molecular
probe-universal adapter hybrids. The pooled stabilized preassembled
hybrids may then be contacted with a sample, comprising one or more
molecular targets or analytes, followed by binding of the one or
more molecular targets with the one or more pooled stabilized
preassembled molecular probes. In certain embodiments, one or more
detectable components, comprising one or more signal generating
moieties conjugated to unique oligonucleotide sequences
complementary to particular unique sequences of the one or more
universal adapters may be added to label the one or more bound
targets in the sample, thereby facilitating detection of the one or
more targets. In certain embodiments, this process may be used to
combine the processes of preassembly and ordered assembly in cases
where there might be advantages to both.
[0288] As diagrammed in FIG. 65, the detectable components may be
designed to comprise a first oligonucleotide sequence that is
complementary to an oligonucleotide sequence of a molecular probe
and a second oligonucleotide sequence that comprises a sequence
that has been chemically modified with fluorescent moieties. In
certain embodiments, the complementary oligonucleotide sequence of
a molecular probe is hybridized, i.e., preassembled, with the first
oligonucleotide sequence of a detectable component to form a
preassembled hybrid comprising an non-hybridized second
oligonucleotide sequence that comprises a sequence that has been
chemically modified with fluorescent moieties. The preassembled
hybrid may then be combined with an oligonucleotide sequence
complementary to the second oligonucleotide sequence, comprising an
oligonucleotide sequence modified with other fluorescent moieties,
thereby forming a hybridized ternary complex. In certain
embodiments, the second oligonucleotide sequence may be labeled
with fluorescent groups that can perform fluorescence resonance
energy transfer (FRET) with fluorescent groups on the
oligonucleotide sequence complementary to the second
oligonucleotide sequence. FRET may result in a shift in fluorescent
emission wavelength and/or to quenching of fluorescence. In certain
embodiments, the hybridization of the second oligonucleotide
sequence may be detected by a FRET signal, thereby allowing for a
means of qualitatively, or possible quantitatively, detecting the
presence of a specific molecular probe and/or the formation of a
particular molecular probe-target complex.
[0289] In certain embodiments, one or more molecular probes may be
preassembled with one or more supports, such as a solid support,
particle, or gel support, conjugated to oligonucleotide sequences
complementary to the molecular probe oligonucleotide sequence. The
supports may be but are not limited to, for example, agarose or
magnetic beads. In certain embodiments, the one or more molecular
probes may be combined, as a plurality or individually with the one
or more supports conjugated to complementary oligonucleotide
sequences, followed by hybridization, to form a preassembled
affinity matrix or material. The preassembled affinity matrix or
material may then be used, for example, to affinity capture,
purify, and then release one or more molecular targets, such as one
or more biomolecular targets, each as a complex bound to the
particular molecular probe. For example, as diagrammed in FIG. 66,
a molecular probe conjugated to a universal oligonucleotide
sequence may be combined with the complementary oligonucleotide
conjugated to a support to allow for preassembly hybridization and
thereby form an affinity matrix. In certain embodiments, the
affinity matrix may then be washed to remove free molecular probe.
The affinity matrix may be, for example, combined with a sample
comprising one or more molecular targets to enable binding and
capture of the one or more targets. In certain embodiments, the
unbound components of the sample may then be washed away. In
certain embodiments, it may be useful to use a displacement
oligonucleotide or to denature the hybridization complex to release
the bound target-molecular probe complex from the support for
further analysis. The displacement oligonucleotide may be, for
example, another oligonucleotide sequence, an LNA, or a PNA, or
combinations or derivatives thereof.
[0290] Alternatively, as diagrammed in FIG. 67, a molecular probe
conjugated to a universal oligonucleotide may be combined with a
sample comprising one or more molecular targets to bind the one or
more targets. The bound target-molecular probe complex may then be
captured by a complementary oligonucleotide conjugated to a support
via hybridization. In certain embodiments, the other components of
the sample may be washed away. In certain embodiments, it may be
useful to use a displacement oligonucleotide or to denature the
hybridization complex to release the bound target-molecular probe
complex from the support for further analysis. The displacement
oligonucleotide may be, for example, another oligonucleotide
sequence, an LNA, or a PNA, or combinations or derivatives thereof.
The examples illustrated herein may be applicable to both
self-assembly, i.e. wherein the capture-oligonucleotide conjugates
are added to the biological sample and then captured on beads, as
well as pre-assembly, wherein the capture-oligonucleotide conjugate
is pre-hybridized to its bead then mixtures of beads are combined
and added to the biological sample. In certain embodiments, the
order of assembly and addition to a sample might be varied, so that
the capture antibodies might be combined with the beads prior to
contact with the sample or after, and the detector antibodies might
be added to the sample prior to or along with the capture
antibodies, or might be added after forming the antigen-capture
antibody complex on the beads and washing, or in other sequences as
might be possible.
Minimizing Complexity for Antibody Labeling Choice
[0291] Certain embodiments are directed to methods and/or systems
for reducing to a manageable proportions the number of catalog
products a vendor of labeled antibodies (or other bio-molecules
used as binding detectors) must manufacture, stock, market, and/or
distribute in order to fully satisfy customers' needs for a
substantially complete choice of label alternatives for a
substantial portion of the antibodies in the catalog. In certain
aspects, a complete choice of label alternatives for any given
antibody in the catalog.
[0292] Antibodies--biological proteins exhibiting high-affinity
binding of single target molecules--are widely employed throughout
biological research, clinical diagnostics, pharmaceutical drug
discovery, and other disciplines to enable immunoassays to detect
and quantify molecules of interest (`analytes`). Commonly, an
antibody employed in immunoassays must be labeled with another
molecule to render them detectable; frequently, the labels employed
are fluorescent molecules (or `fluors`), which emit light over
characteristic wavelength ranges (or `colors`). Approximately 36
different fluors are commercially available today as antibody
labels, covering the color gamut from deep red to violet. In
`multiplexed` assays, which aim to detect two or more different
analytes in the same sample, two or more different antibodies are
typically employed together (for example, one for each analyte,
although other variations are possible), and typically the
antibodies are labeled with a different colored fluor to enable
them to be detected individually. Multiplexed assays are
increasingly common in flow cytometry, where as many as sixteen
different analytes may be detected simultaneously or substantially
simultaneously. This creates a need for antibodies labeled in a
wide range of colors (i.e., at least 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, or more).
[0293] As it is conventionally practiced, labeling an antibody with
a fluor is a highly skilled task beyond the means of most users, so
antibody vendors market antibodies pre-labeled with fluors. This
presents the vendor with a `combinatorial explosion` problem:
offering X different antibodies each labeled in Y different colors
requires the vendor to manufacture, stock, market, and distribute a
total of X*Y individual products. For example, one leading vendor
offers approximately 529 different anti-human antibodies suitable
for flow cytometry, labeled with any of 16 different fluors, thus
requiring 16*529=8,464 different products in order to offer
customers a complete selection (not counting products available in
multiple unit sizes). Large numbers such as these prove impractical
in practice, so vendors commonly offer only a very few of their
most popular antibodies in a wide range of label colors, and offer
the rest of their antibodies labeled with typically no more than
two or three colors (and frequently only one). This trade-off
reduces the complexity (in the case of one leading vendor reducing
the product offerings to approximately 1,511) at the expense of
reducing the likelihood of being able to satisfy a users' need for
a particular antibody labeled with a particular color (in the
present example, 82% of all possible antibody/color combinations
are not available from one leading vendor). Antibody vendors
compete among themselves, in part, by offering antibody/color
combinations different from those of their competitors, so users
frequently rely upon a combination of several vendors to meet their
full range of needs. Thus, a company which does not offer a full
range of antibody/color combinations loses business to its
competitors.
[0294] Certain disclosed embodiments make antibody labeling simple
enough for users to perform at point of use (see Example 22). In
certain embodiments one or more antibodies are conjugated with one
or more short oligonucleotides A, and one or more fluors are
conjugated with one or more short complementary oligonucleotide A'.
When such one or more antibodies and such one or more fluors are
mixed in solution, the complementary oligonucleotides bind one
another, yielding one or more fluorescently-labeled antibody via
formation of the A:A' hybrid. In certain embodiments, each antibody
is conjugated with a short oligonucleotide A, and each fluor is
conjugated with a short complementary oligonucleotide A'. When such
an antibody and such a fluor are mixed in solution, the
complementary oligonucleotides bind one another, yielding a
fluorescently-labeled antibody via formation of the A:A'
hybrid.
[0295] Certain embodiments are directed to methods and/or systems
that simply and effectively reduce the complexity of vendors
offering a complete collection of antibody/color combinations to
their customers. A substantial portion or each of the X antibodies
in the vendor's catalog is offered conjugated to oligonucleotide A,
and a substantial portion or each of the Y fluors in the vendor's
catalog is offered conjugated to oligonucleotide A'. A customer or
user requiring a given antibody labeled with a given fluor then
need only purchase the two oligonucleotide-conjugated products (one
fluor and one antibody), and mix them at point of use. Thus, the
vendor offers customers or users a complete choice, or a
substantially more complete choice, of the possible antibody/color
combinations while significantly reducing the complexity by
offering X+Y products, as opposed to X*Y products. In the example
of the leading vendor's catalog discussed herein a total of
16+529=545 products would offer customers a substantially complete
or complete range of antibody/color choices while reducing the
number of products required by (8,464-545)/8,464=94%.
[0296] Currently, some vendors attempt to at least partially
accommodate customers' needs for a wide choice of labels by
offering antibodies conjugated with biotin, a small molecule
vitamin, and fluors conjugated with streptavidin, a bacterial
protein which binds biotin with high affinity. In principle, a
customer can purchase a biotin-conjugated antibody, a
streptavidin-conjugated fluor, and mix these together to label any
antibody with any fluor. Some of the disadvantages of this
conventional approach include one or more of the following: [0297]
Streptavidin is a relatively large protein (66 kDa in its active
tetrameric form), potentially presenting steric hindrance problems
in labeling analytes. [0298] Streptavidin is a somewhat `sticky`
protein which may bind non-specifically to sample components,
producing high backgrounds. [0299] Because biotin is a common
biological molecule, endogenous biotin can cause background and
specificity issues when performing assays with certain biotin-rich
tissues such as brain and liver. [0300] Samples containing
endogenous biotin-binding proteins, such as eggs or bacteria, pose
specificity and background problems. [0301] Harsh conditions are
required to break the streptavidin-biotin bonds in order to strip
and re-probe samples. [0302] Streptavidin-conjugated fluors are
subject to proteolysis, thermal denaturation, and other causes of
product degradation [0303] Because streptavidin is tetrameric (has
four biotin binding sites) it can crosslink multiple biotinylated
antibodies
[0304] These disadvantages render the biotin/streptavidin
technology an unfavored choice for most users. Another technology
which is known in the art involves a technology, in which IgG
antibody can be labeled by the user with a fluorophore-labeled Fab
fragment directed against the Fc portion of that IgG. In practice,
this technology has proven problematic. The antibody/Fab complex is
stable for only minutes. Additionally, this technology is
applicable only to the labeling of IgG antibodies. Finally,
fluorophore-conjugated Fab fragments are expensive, complicated,
and time-consuming to produce.
[0305] In contrast, certain disclosed embodiments have one or more
of the following advantages. In certain aspects, the
oligonucleotide hybrid is stable for an extended period of time. In
certain aspects, the technology disclosed herein can be used to
label a large range of antibody isotypes. In certain aspects, the
technology disclosed herein is simple to use and/or more economical
to manufacture. The oligonucleotides employed, in certain aspects,
are small (about 6 kDa) compared to streptavidin, and thus present
less steric hindrance. In certain aspects, smaller oligonucleotides
demonstrate substantially less stickiness and substantially little
non-specific binding. In certain aspects, a properly chosen
oligonucleotide sequence will not find endogenous complementary
sequences in biological samples, or at least reduce endogenous
complementary sequences in biological samples, thus avoiding, or
substantially reducing, higher background staining. In certain
aspects, relatively mild conditions can be employed to disassemble
the oligonucleotide hybrids for strip and re-probe techniques.
Generally, oligonucleotide-conjugated fluors are not subject to
significant proteolysis and/or significant thermal denaturation as
potential sources of product degradation. In certain aspects,
complementary oligonucleotides hybrize in a strict 1:1 ratio;
accordingly they are least likely to or cannot crosslink multiple
antibodies.
[0306] Certain embodiments are directed to methods and/or systems
comprising: i) a first series of molecular probes prepared by
independently conjugating a first oligonucleotide sequence to at
least 10 binding moieties; and ii) a second series of detectable
components prepared by independently conjugating a second
oligonucleotide sequence to at least 3 signal generating moieties,
wherein the second oligonucleotide sequence is complementary to the
first oligonucleotide sequence; wherein: a) an appropriate amount
of a molecular probe from the first series may be mixed with an
appropriate amount of a detectable component from the second series
to produce a hybridized molecular probe-detectable component; and
b) at least 90% of possible combinations of said first and second
series may be produced. In certain aspects, a substantial portion,
at least a majority, at least 60%, 70%, 75%, 80%, 85%, 92%, 96%,
98%, 99% or 100% of possible combinations of said first and second
series may be produced. In certain aspects, the first series of
molecular probes may be prepared by independently conjugating the
first oligonucleotide sequence to at least 3 binding moieties, for
example, at least 5, 8, 15, 20, 25, 30, 50, 100, 150, 200, 250,
300, 350, 400, 450, 500, 750, or at least 1000 binding moieties, or
between 3-10, 4-9, 5-12, 6-14, 7-16, 8-19, 9-20, 10-25, 12-30,
25-50, 40-70, 50-80, 75-100, 80-125, 115-150, 130-200, 150-250,
175-300, 200-400, 300-500, 350-750, 400-800, or 500-1000 binding
moieties. In certain aspects, the second series of detectable
components may be prepared by independently conjugating the second
oligonucleotide sequence to at least 3 signal generating moieties,
for example at least 2 signal generating moieties, at least 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 20, 25, or 30 signal
generating moieties, or between 2-5, 3-5, 3-6, 4-7, 4-9, 5-8, 5-10,
5-12, 6-14, 7-15, 8-13, 9-16, 10-17, 11-18, 12-19, 15-20, 10-25,
12-30, or 25-50 signal generating moieties. Certain embodiments are
directed to methods and/or systems for reducing to manageable
proportions the number of catalog products a vendor of labeled
molecular probes must manufacture, stock, market, and distribute,
comprising: i) a first series of customizable molecular probes
prepared by conjugating a first oligonucleotide sequence to at
least 10 binding moieties; and ii) a second series of customizable
detectable components prepared by conjugating a second
oligonucleotide sequence to at least 3 signal generating moieties,
wherein the second oligonucleotide sequence is complementary to the
first oligonucleotide sequence; wherein: a) an appropriate amount
of a customized molecular probe from the first series may be mixed
with an appropriate amount of a customized detectable component
from the second series to produce a hybridized molecular
probe-detectable component; and b) at least 90% of possible
combinations of said first and second series may be produced. In
certain aspects, a substantial portion, at least a majority, at
least 60%, 70%, 75%, 80%, 85%, 92%, 96%, 98%, 99% or 100% of
possible combinations of said first and second series may be
produced. In certain aspects, the first series of customizable
molecular probes may be prepared by independently conjugating the
first oligonucleotide sequence to at least 3 binding moieties, for
example, at least 5, 8, 15, 20, 25, 30, 50, 100, 150, 200, 250,
300, 350, 400, 450, 500, 750, or at least 1000 binding moieties, or
between 3-10, 4-9, 5-12, 6-14, 7-16, 8-19, 9-20, 10-25, 12-30,
25-50, 40-70, 50-80, 75-100, 80-125, 115-150, 130-200, 150-250,
175-300, 200-400, 300-500, 350-750, 400-800, or 500-1000 binding
moieties. In certain aspects, the second series of customizable
detectable components may be prepared by independently conjugating
the second oligonucleotide sequence to at least 3 signal generating
moieties, for example at least 2 signal generating moieties, at
least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 20, 25, or 30
signal generating moieties, or between 2-5, 3-5, 3-6, 4-7, 4-9,
5-8, 5-10, 5-12, 6-14, 7-15, 8-13, 9-16, 10-17, 11-18, 12-19,
15-20, 10-25, 12-30, or 25-50 signal generating moieties.
[0307] Certain embodiments are directed to methods and/or systems
comprising: i) a first series of molecular probes prepared by
independently conjugating a first oligonucleotide sequence to at
least 10 binding moieties; and ii) a second series of detectable
components prepared by conjugating a second oligonucleotide
sequence to at least 3 scaffolds having one or more signal
generating moieties, wherein the second oligonucleotide sequence is
complementary to the first oligonucleotide sequence; wherein: a) an
appropriate amount of a molecular probe from the first series may
be mixed with an appropriate amount of a detectable component from
the second series to produce a hybridized molecular
probe-detectable component; and b) at least 90% of possible
combinations of said first and second series may be produced. In
certain aspects, a substantial portion, at least a majority, at
least 60%, 70%, 75%, 80%, 85%, 92%, 96%, 98%, 99% or 100% of
possible combinations of said first and second series may be
produced. In certain aspects, the first series of molecular probes
may be prepared by independently conjugating the first
oligonucleotide sequence to at least 3 binding moieties, for
example, at least 5, 8, 15, 20, 25, 30, 50, 100, 150, 200, 250,
300, 350, 400, 450, 500, 750, or at least 1000 binding moieties, or
between 3-10, 4-9, 5-12, 6-14, 7-16, 8-19, 9-20, 10-25, 12-30,
25-50, 40-70, 50-80, 75-100, 80-125, 115-150, 130-200, 150-250,
175-300, 200-400, 300-500, 350-750, 400-800, or 500-1000 binding
moieties. In certain aspects, the second series of detectable
components may be prepared by independently conjugating the second
oligonucleotide sequence to the one or more scaffolds, for example,
at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 scaffolds, or between 2-5,
3-6, 4-7, 5-8, 6-9, 7-10, or 8-15 scaffolds, wherein the one or
more scaffolds comprises at least 3 signal generating moieties, for
example at least 2 signal generating moieties, at least 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 17, 20, 25, or 30 signal generating
moieties, or between 2-5, 3-5, 3-6, 4-7, 4-9, 5-8, 5-10, 5-12,
6-14, 7-15, 8-13, 9-16, 10-17, 11-18, 12-19, 15-20, 10-25, 12-30,
or 25-50 signal generating moieties. In certain aspects, the
scaffolds may be selected from a bead, a dendrimer, a
polysaccharide molecule, a dextran, a protein, a peptide, a second
oligonucleotide sequence, a portion of the oligonucleotide sequence
that is not complementary to the oligonucleotide sequence of the
molecular probe, a polymer, a hydrophilic polymer, a nanoparticle,
or combinations or derivatives thereof.
[0308] Certain embodiments are directed to methods comprising: i)
preparing a first series of molecular probes by independently
conjugating a first oligonucleotide sequence to at least 10 binding
moieties; and ii) preparing a second series of detectable
components by independently conjugating a second oligonucleotide
sequence to at least 3 signal generating moieties, wherein the
second oligonucleotide sequence is complementary to the first
oligonucleotide sequence; and iii) mixing, independently and in a
matrix or semi-matrix fashion, an appropriate amount of a molecular
probe from the first series with an appropriate amount of a
detectable component from the second series to produce a plurality
of hybridized molecular probe-detectable components; wherein at
least 90% of possible combinations of said first and second series
may be produced. In certain aspects, a substantial portion, at
least a majority, at least 60%, 70%, 75%, 80%, 85%, 92%, 96%, 98%,
99% or 100% of possible combinations of said first and second
series may be produced. In certain aspects, the first series of
molecular probes may be prepared by independently conjugating the
first oligonucleotide sequence to at least 3 binding moieties, for
example, at least 5, 8, 15, 20, 25, 30, 50, 100, 150, 200, 250,
300, 350, 400, 450, 500, 750, or at least 1000 binding moieties, or
between 3-10, 4-9, 5-12, 6-14, 7-16, 8-19, 9-20, 10-25, 12-30,
25-50, 40-70, 50-80, 75-100, 80-125, 115-150, 130-200, 150-250,
175-300, 200-400, 300-500, 350-750, 400-800, or 500-1000 binding
moieties. In certain aspects, the second series of detectable
components may be prepared by independently conjugating the second
oligonucleotide sequence to at least 3 signal generating moieties,
for example at least 2 signal generating moieties, at least 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 20, 25, or 30 signal
generating moieties, or between 2-5, 3-5, 3-6, 4-7, 4-9, 5-8, 5-10,
5-12, 6-14, 7-15, 8-13, 9-16, 10-17, 11-18, 12-19, 15-20, 10-25,
12-30, or 25-50 signal generating moieties.
[0309] Certain embodiments are to a catalog, comprising: i) a first
series of at least 10 customizable antibodies, comprising at least
one first oligonucleotide sequence conjugated to the antibodies;
and ii) a second series of at least 3 customizable detectable
components, comprising at least one second oligonucleotide sequence
conjugated to the detectable components, wherein the second
oligonucleotide sequence is complementary to the first
oligonucleotide sequence; wherein: a) an appropriate amount of a
antibody from the first series may be mixed with an appropriate
amount of a detectable component from the second series to produce
a hybridized antibody-detectable component; and b) at least 90% of
possible combinations of said first and second series may be
produced. In certain aspects, a substantial portion, at least a
majority, at least 60%, 70%, 75%, 80%, 85%, 92%, 96%, 98%, 99% or
100% of possible combinations of said first and second series may
be in the catalog. In certain aspects, the first series of
customizable antibodies may be prepared by independently
conjugating the first oligonucleotide sequence to at least 3
antibodies, for example, at least 5, 8, 15, 20, 25, 30, 50, 100,
150, 200, 250, 300, 350, 400, 450, 500, 750, or at least 1000
antibodies, or between 3-10, 4-9, 5-12, 6-14, 7-16, 8-19, 9-20,
10-25, 12-30, 25-50, 40-70, 50-80, 75-100, 80-125, 115-150,
130-200, 150-250, 175-300, 200-400, 300-500, 350-750, 400-800, or
500-1000 antibodies. In certain aspects, the second series of
customizable detectable components may be prepared by independently
conjugating the second oligonucleotide sequence to at least 3
signal generating moieties, for example at least 2 signal
generating moieties, at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 17, 20, 25, or 30 signal generating moieties, or between 2-5,
3-5, 3-6, 4-7, 4-9, 5-8, 5-10, 5-12, 6-14, 7-15, 8-13, 9-16, 10-17,
11-18, 12-19, 15-20, 10-25, 12-30, or 25-50 signal generating
moieties
[0310] Certain embodiments are directed to methods and/or systems
further comprising a third series of universal adapters prepared by
independently selecting and pairing a complementary first
oligonucleotide sequence segment to the first oligonucleotide
sequence of the first series with a complementary second
oligonucleotide sequence segment to the second oligonucleotide
sequence of the second series. Certain embodiments are to a
catalog, further comprising a third series of universal adapters
prepared by independently selecting and pairing a complementary
first oligonucleotide sequence segment to the first oligonucleotide
sequence of the first series with a complementary second
oligonucleotide sequence segment to the second oligonucleotide
sequence of the second series. In certain aspects, at least 90% of
possible combinations of said complementary first oligonucleotide
sequence segment and said complementary second oligonucleotide
sequence segment may be produced. In certain aspects, a substantial
portion, at least a majority, at least 60%, 70%, 75%, 80%, 85%,
92%, 96%, 98%, 99% or 100% of possible combinations of said
complementary first oligonucleotide sequence segment and said
complementary second oligonucleotide sequence segment may be
produced. In certain aspects, the third series of universal
adapters may be prepared by independently selecting and pairing at
least 3 of the complementary first oligonucleotide sequence
segments with at least 3 said complementary second oligonucleotide
sequence segments, for example, at least 5, 8, 15, 20, 25, 30, 50,
100, 150, 200, 250, 300, 350, 400, 450, 500, 750, or at least 1000,
or between 3-10, 4-9, 5-12, 6-14, 7-16, 8-19, 9-20, 10-25, 12-30,
25-50, 40-70, 50-80, 75-100, 80-125, 115-150, 130-200, 150-250,
175-300, 200-400, 300-500, 350-750, 400-800, or 500-1000, of the
complementary first oligonucleotide sequence segments may be
prepared by independently selected and paired with at least 5, 8,
15, 20, 25, 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500,
750, or at least 1000, or between 3-10, 4-9, 5-12, 6-14, 7-16,
8-19, 9-20, 10-25, 12-30, 25-50, 40-70, 50-80, 75-100, 80-125,
115-150, 130-200, 150-250, 175-300, 200-400, 300-500, 350-750,
400-800, or 500-1000, of the complementary second oligonucleotide
sequence segments.
Optimization of Antibody Degree of Labeling
[0311] Certain embodiments are directed to systems and/or methods
for optimization of antibody degree of labeling. Certain
embodiments provide systems and/or methods that allow users to
choose one or more optimal degrees of labeling for one or more
antibodies, thereby avoiding spillover errors in multiplexed
immunoassays. For example, for use in multiplexed flow
cytometry.
[0312] Antibodies--biological proteins exhibiting high-affinity
binding of single target molecules--are widely employed throughout
biological research, clinical diagnostics, pharmaceutical drug
discovery, and other disciplines to enable immunoassays to detect
and quantify molecules of interest (`antigens`). Typically, an
antibody employed in immunoassays must be labeled with another
molecule to render them detectable; frequently, the labels employed
are fluorescent molecules (or `fluors`), which emit light over
characteristic wavelength ranges (or `colors`). Approximately 36
different fluors are commercially available today as antibody
labels, covering the color gamut from deep red to violet. In
`multiplexed` assays, which aim to detect two or more different
analytes in the same sample, two or more different antibodies are
typically employed together, the two more different antibodies are
labeled with different colored fluors to allow them to be detected
individually. Multiplexed assays are increasingly common in flow
cytometry, where multiply different analytes may be detected in the
assay.
[0313] A substantially number of the fluors used to label
antibodies have relatively broad emission spectra (the range of
wavelengths over which they emit fluorescent light), so that in
multiplexed studies employing antibodies labeled with, for example,
two fluors (1 and 2) the flow cytometer detection channel dedicated
to detection of fluor l's emission may also "see" a relatively
small amount of the light emitted by fluor 2. This is often
referred to as spillover. Some flow cytometers provide so-called
`compensation` mechanisms to correct for this spillover either
electronically or via software, but compensation often lacks
sufficient accuracy and, in the case of a very bright signal from
fluor 1 spilling over into a channel observing a comparatively dim
signal from fluor 2 the unavoidable consequence of compensation is
often an increase in the coefficient of variation of the fluor 2
signal, which presents as a broadening of the apparent intensity
distribution of fluor 2's signal. This broadening of fluor 2's
intensity distribution constitutes an artifact which it is
desirable to avoid in many instances, as the artifact makes it
difficult and sometime impossible, to determine the percentage of
cells in the sample which express the antigen reported by the fluor
2-labeled antibody with sufficient accuracy. Certain embodiments of
the present disclosure are directed to allowing flow cytometrists
to optimize, or substantial optimize, improve or fine tune the
brightness of a first labeled antibody fluor 1's fluorescence to
minimize, substantially minimize or reduce its spillover into the
detection channel for a second labeled antibody fluor2. This may
also be accomplished in assays that have 3, 4, 5, 6, 7, 8, 9, or
more fluors that may be affected by the spillover of one or more
other fluors.
[0314] Certain disclosed embodiments provide methods and/or systems
that allow the user to adjust the brightness of a primary-labeled
antibody. In certain embodiments one or more antibodies are
conjugated with one or more short oligonucleotides A, and one or
more Certain disclosed embodiments provide methods and/or systems
that allow the user to adjust the brightness of a primary-labeled
antibody. In certain embodiments one or more antibodies are
conjugated with one or more short oligonucleotides A, and one or
more fluors are conjugated with one or more short complementary
oligonucleotide A'. When such one or more antibodies and such one
or more fluors are mixed in solution, the complementary
oligonucleotides bind one another, yielding one or more
fluorescently-labeled antibody via formation of the A:A' hybrid. In
certain embodiments fluors are conjugated with one or more short
complementary oligonucleotide A'. When such one or more antibodies
and such one or more fluors are mixed in solution, the
complementary oligonucleotides bind one another, yielding one or
more fluorescently-labeled antibody via formation of the A:A'
hybrid. In certain embodiments, each antibody is conjugated with a
short oligonucleotide A, and each fluor is conjugated with a short
complementary oligonucleotide A'. When such an antibody and such a
fluor are mixed in solution, the complementary oligonucleotides
bind one another, yielding a fluorescently-labeled antibody via
formation of the A:A' hybrid.
[0315] Certain embodiments are directed to kits that can be used
for adjusting the brightness a fluorescently-labeled antibody.
These kits make this adjustment substantially easier for the user.
For example, certain embodiments are directed to a kit comprising
one or more oligonucleotide-conjugated antibodies and two or more
vials of complementary oligonucleotide-conjugated fluors, wherein
the two or more oligonucleotide-conjugated fluors bear the same
fluorescent reporter molecule, substantially the same fluorescent
reporter molecule or a similar fluorescent reporter molecule, but
at two or more different degrees of labeling, or `brightness` (for
example without limitation, four fluors per conjugate in a first
vial, and 8 fluors per conjugate in a second vial), thus providing
`dimmer and `brighter` labels for the end-user to choose from. In
the example of the previous section, the user might choose to
minimize or even eliminate the c.v. broadening artifact by labeling
antibody fluor 1 with a dimmer label (lower degree of labeling) and
antibody fluor 2 with a brighter label (higher degree of labeling).
Due to the physics of fluorescence, spillover is rarely reciprocal
between two fluors, because many fluorophores' emission spectra are
asymmetrical.
[0316] Due, in part, to the `combinatorial explosion` problem faced
by labeled antibody vendors as discussed herein, vendors have
encountered difficulties in readily providing an antibody labeled
in a variety of degrees of labeling. Consequently, rather than
making all permutations available or customizing particular
antibodies with specified degrees of labeling, the vendors must
pre-determine what antibodies are to be made available, and
typically only with the highest feasible degree of labeling. Thus,
end-users are unable to systematically adjust degree of labeling in
order to minimize compensation artifacts. Instead, users sometimes
may choose different labels where spillover is a problem, using an
inherently dim fluor to minimize spillover. However many antibodies
are not commercially available labeled with a large variety of
possible fluors, so an appropriate dim fluor may not be available,
in which case the user is forced to accept the compensation
artifact.
[0317] In the prior art, the only practical means to optimize
labeling brightness (for example, to achieve dimmer labeling) is
for the user to perform his own antibody labeling in-house (or to
contract with a vendor for custom labeling), adjusting the labeling
protocol to yield a lower degree of labeling. This is a
time-consuming and highly skilled task which is beyond the ability
of most users, and custom labeling contracts are expensive and have
long lead times. Additionally, conventional covalent labeling
protocols are difficult or impossible to control sufficiently to
achieve a pre-determined precise degree of labeling. In contrast,
certain kits, methods, and or systems of the present disclosure
make it simple and quick for the user to achieve precisely the
degree of labeling required (as illustrated in Example 21).
[0318] Certain embodiments are directed to a tunable detection
method, kit and/or system, comprising: i) a molecular probe
prepared by conjugating a first oligonucleotide sequence to a
binding moiety; ii) a series of detectable components, comprising
different amounts of a signal generating moiety conjugated to a
second oligonucleotide sequence, wherein the different amounts of
the signal generating moiety provides a range of intensities of the
signal generated, and wherein the second oligonucleotide sequence
is complementary to the first oligonucleotide sequence; wherein: a)
the intensity of the signal generated can be tuned over a range
1.25 to 2.times., 1.5 to 3.times., 2 to 4.times., 1.25 to
1.75.times., 2 to 6.times., 3 to 5.times., 3 to 6.times., or 2 to
10.times. by selecting the detectable component having a greater or
lesser intensity. In certain embodiments, the intensity of the
signal generated can be tuned over a range extending from the limit
of self-quenching to the intensity of a single signal generating
moiety.
[0319] Certain embodiments are directed to a tunable detection
method, kit and/or system, comprising: i) a molecular probe
prepared by conjugating a first oligonucleotide sequence to a
binding moiety; ii) a series of detectable components, comprising
different amounts of a signal generating moiety conjugated to a
second oligonucleotide sequence, wherein the different amounts of
the signal generating moiety provides a range of intensities of the
signal generated, and wherein the second oligonucleotide sequence
is complementary to the first oligonucleotide sequence; wherein: a)
the intensity of the signal generated from a target-bound molecular
probe that is hybridized to a detectable component can be tuned
over a range greater than an order of magnitude by selecting the
detectable component having a greater or lesser intensity.
Simplifying Development of Multiplexed Flow Cytometry Assays
[0320] Certain embodiments are directed to systems and/or methods
for simplifying development of multiplexed flow cytometry assays.
These methods and/or systems may also be used for simplifying other
multiplexed assays as well, for example immunohistochemistry,
microarray-based assays, bead-based assays, immunosorbant assays,
etc. Multiplexed flow cytometry assays employ cocktails of two or
more antibodies, wherein the two or more antibodies are typically
labeled with a different-colored fluorophore, to analyze, for
example, the sub-populations of cells in a cell sample where one or
more of those sub-populations are distinguished from other
sub-population(s) within the sample by the co-occurrence (or lack
of co-occurrence) of two or more protein markers on or in the cells
of the sub-population of interest. In certain embodiments
multiplexed flow cytometry assays employ cocktails of two or more
antibodies, wherein the two or more antibodies are each labeled
with a different-colored fluorophore, to analyze, for example, the
sub-populations of cells in a cell sample where one or more of
those sub-populations are distinguished from other
sub-population(s) within the sample by the co-occurrence (or lack
of co-occurrence) of two or more protein markers on or in the cells
of the sub-population of interest. As an example without
limitation, consider the following hypothetical cell sample
comprised of (at least) three different cell types, wherein the
cell types are defined by the specified collection of protein
markers indicated in Table 10-A.
TABLE-US-00001 TABLE 10-A Marker X Marker Y Marker Z Cell Type 1 +
+ - Cell Type 2 + - + Cell Type 3 + + + Cell Type 4 - + +
[0321] Table 10-A shows a collection of protein markers identifying
4 distinct cell types in a hypothetical sample. "+" indicates the
presence of the indicated marker on the indicated cell type,
whereas "-" indicates its absence.
[0322] In the example, no single marker can enable the unambiguous
identification of the four cell types. Similarly, no combination of
just two markers can identify the three cell types (because cell
types 1 and 3 are both X+/Y+, cell types 2 and 3 are both X+/Z+,
and cell types 3 and 4 are both Y+/Z+). Only the combination of the
markers X, Y, and Z permits a unique immunophenotype to be assigned
to each of the four cell types. It is therefore necessary to employ
a cocktail of three distinct antibodies (Abs)--Ab-X, Ab-Y, and Ab-Z
(which bind exclusively to markers X, Y, and Z, respectively)--in
order to separately enumerate the number of cells of each of these
four cell types occurring in this sample.
[0323] Examples of such multiplexed flow cytometry assays are
common in blood analysis (where a single blood sample may contain
5, 10, 15, 20 or more different cell types), immunology (where 4,
5, 6, 7 or more distinguishable cell types may be present in a
sample), and stem cell research (where the total number of
distinguishable cell types in a sample still frequently remains
undefined at present)
[0324] The example of Table 10-A assumes that the distinct
immunophenotypes of the four cell types of interest has already
been defined. In early stages of research, the effort to define
such distinguishing immunophenotypes may require multiplexing a
much larger number of antibodies in order to identify
distinguishing combinations. It has been estimated that the human
genome encodes approximately 1,000 different cell surface
proteins.
[0325] In order for the 3 antibodies in this example to be
separately distinguished by a flow cytometer it is necessary to
separately label them with 3 distinct fluors, (Fl-1, Fl-2, and
Fl-3, respectively) whose fluorescence emission spectra do not
substantially overlap.
[0326] Further to the present example, if Ab-X, Ab-Y, and Ab-Z are
commercially available labeled with Fl-1, Fl-2, and Fl-3,
respectively, then the cytometrist may conduct the assay by
purchasing the three labeled reagents Ab-X:Fl-1, Ab-Y:Fl-2, and
Ab-Z:Fl-3. In contrast, if (for example) Ab-Y and Ab-Z are both
commercially available only labeled with Fl-2, then the assay
cannot be performed using commercial reagents. This situation is
not infrequent. A review of the labeled antibody offerings of
numerous commercial vendors indicates that the median number of
fluor colors in which a commercial primary-labeled antibody is
available is around 2.
[0327] There therefore exists a need for systems and/or methods for
antibodies to be quickly and easily labeled by cytometrists with
the desired fluor (approximately 3 or more distinct fluors are used
in flow cytometry), in order to facilitate the development and
conduct of multiplexed assays. Using certain disclosed embodiments
this may be accomplished as discussed herein. One exemplary
approached is discussed in Example 29. The advantages of using the
disclosed embodiments include one or more of the following: time
savings (as users avoid complicated planning tasks to determine
which antibodies can be accommodated in which detector channels);
flexibility (when a new antibody is added to an existing multiplex
panel it may be added in the available detector channel without
further modification of the existing panel, since the colors are
made available by certain embodiments of the present disclosure);
and the ability to optimize panels by minimizing spectral
spill-over from a channel measuring a high-abundance marker into a
channel measuring a low-abundance marker.
Automation
[0328] Many assays employing antibodies or other probes to detect
multiple targets or analytes within samples or complex samples are
often performed by skilled personnel who select the targets to be
investigated, perform extensive manipulation of the sample and of
the assay reagents, or combinations thereof to obtain useful data.
When multiple targets or analytes are examined in a single sample
by performing multiple assays in parallel without substantially
reducing reliability and/or reproducibility, this has the potential
to offer one or more advantages such as in speed and/or confidence
in results. Speed is obtained by increasing the number of targets
examined in substantially the same time. Confidence is increased by
permitting the experimentor to embed positive and/or negative
controls that validate the experiment. Nonetheless, while such
multiplexed assays are desirable, they are difficult to perform by
comparison to simple assays of single targets or analytes. One or
more limitations of the current methods serve as barriers to
development of multiplexed assays. For example, one or more of the
following: the ability to label individual probes with readily
distinguishable detectors is particularly poorly matched to this
task; the common methods and chemistries for labeling probes such
as antibodies with detectors such as fluorescent groups may require
optimization of each reaction for each pair; a similar situation is
also found to attach a probe such as an antibody to a particle. As
a result, except for assays that will be performed multiple times
and/or will be utilized by multiple experimentors, the effort to
develop and validate a multiplexed assay is generally considered
impractical. Alternatively, once a multiplexed assay panel is
developed, it is not readily amenable to adaptation. For example,
adding and/or exchanging one antibody probe for another may lead to
loss of reliability and/or reproducibility for the whole panel.
Certain of the disclosed embodiments are directed to increase the
number of assays that can be performed simultaneously or
substantially simultaneously and to address one or more of these
problems in the art and other problems addressed herein.
[0329] For example, panels of antibodies are often used in flow
cytometry such as in the use of flow cytometry to examine the
relative abundance of cells in a sample that bear distinct patterns
of surface antigens, as may be performed in immunophenotyping, by
employing panels of antibodies that are labeled with fluorophores.
These fluorophores are often selected so that one or more
antibodies may be detected in a different fluorescence channel and
the one or more antibodies may need to be compared to different
controls. Current methods for labeling antibodies with fluorescent
groups are poorly matched to facile development of panels. The
modification of each antibody with each fluorescent group is
relatively inefficient and must be optimized. Further, the
resulting fluorescent conjugate must typically be purified before
use. Further, extensive prior experience is required to obtain
reliable and/or reproducible results. Even then, the difficulty of
designing and validating each panel creates a high barrier. Certain
embodiments are directed to creating such a panel of fluorescently
labeled antibodies to detect multiple targets on cells with high
reliability and/or reproducibility. This reduces the high barrier
to development of new panels and/or modification of existing
panels.
[0330] Another example, as disclosed herein, is the use of bead
arrays or microarrays as panels of immunoassays to examine multiple
targets in a soluble sample. Also disclosed herein is the use of
multiple antibodies, often called capture antibodies that will bind
a particular soluble target or analyte that may or may not be in a
sample. Then, a second antibody, the detector, may bind to another
site on the target to form a sandwich. Alternatively, a competitor
target or analyte might bind to the capture antibody left unbound.
This second binding can then be detected by fluorescent or other
tags. A scanning device is then used to record the results by
matching. To multiplex this sandwich immunoassay, the one or more
capture antibodies would be bound to a different particle type,
distinguishable by one or more fluorescent or other barcode, or
tethered to a distinct position on a surface. A scanning device may
then be used to record the results by examining the bead type or
microarray position. Alternatively, multiple antigens might be
selected as probes to determine the presence of antibodies, as in
the detection of humoral immune responses. Again, to perform a
multiplexed experiment, the one or more antigens may be bound to
one or more different particle types or positions in a surface
array. Similarly, current methods are poorly matched to simple and
straightforward coating of particles or surfaces with antibodies or
antigens. The attachment of antibodies or antigens is
unpredictable, typically requiring optimization and then careful
washing to remove unbound probe and/or blocking to passivate or
otherwise decrease nonspecific binding of uncoated surfaces of
beads or arrays. Certain embodiments are directed to creating such
a bead array or microarray bearing multiple different antibody or
antigen probes to detect multiple targets or analytes with high
reliability and/or reproducibility. Similarly, this reduces the
high barrier to development of new panels and/or modification of
existing panels.
[0331] It is well appreciated that automated systems can be of
great advantage in performing immunoassays, particularly if they
are able to rapidly and reliably perform multiplexed assays based
on panels of tests. Further, an automated system might be of
particular advantage if it could assemble panels in many
combinations, allowing use of a wide range of antibodies or
antigens, matched to a broad collection of fluorescent groups or
fluorescent particles, and providing the panels on an as-needed
basis. However, current methods, as described herein, are poorly
matched to automation where assembly of a multiplexed assay would
require new combinations of one or more antibodies with different
fluorescent groups or of one or more antibodies and/or antigens
with different fluorescent particles. The inefficient chemistry
currently used is incompatible with simple and rapid assembly of
such pairs on an as-needed basis. As disclosed herein, certain
embodiments are directed to applying automation to combine
antibodies with fluorescent groups or to bind antibodies to beads
and thereby obtain reliable and/or reproducible panels on demand.
This results in great advantages of multiplexing for increased
speed and/or greater confidence. Certain embodiments disclosed
herein are directed to automated systems and take into account the
design and/or operational features of such devices. For example,
devices and/or systems that analyze flow cytometry samples and/or
bead arrays gain advantages from application of the methods and/or
systems described herein. Certain embodiments make the selection of
optimal combinations of antibody probes and/or fluorescent
detectors or fluorescent beads much easier. Thus, the operator need
only define the panel of targets to be assayed and the automated
system may design and/or form the multiplexed panel. Furthermore,
certain embodiments are directed to automated systems that
incorporate algorithms to allow the results of a prior assay for
one panel of targets to help choose the targets to be tested in a
subsequent panel of assays, thereby allowing the system to perform
a series of tests with or without direct supervision or input of
the operator. The systems and/or methods disclosed herein permit an
increase in the number of different targets that may be examined
within one or more panels, and thereby perform multiple assays with
high reliability and/or reproducibility. This provides significant
advantages. Certain embodiments are directed to increasing the
ability of an automated system able to match a much larger number
of antibodies, antigens, other probes or combinations thereof with
individual or multiple members of a larger set of fluorescent
groups or set of fluorescent beads to create a much larger range of
multiplexed panels that may be performed with greater speed and
higher confidence.
[0332] The following examples are provided by way of illustration,
and are not intended to be limiting of the present disclosure.
While certain embodiments have been disclosed, it will be
understood that each is capable of further modification and that
this application is intended to cover variations, uses, or
adaptations of the disclosure embodiments.
EXAMPLES
[0333] The following examples and protocols are given as particular
embodiments of the disclosure and to demonstrate the advantages
thereof. It is understood that the examples and protocols are given
by way of illustration and are not intended to limit the
specification or the claims that follow. Additional information is
also found in the attached SoluLink manual, entitled
Antibody-Oligonucleotide All-in-One Conjugation Kit User Manual,
Catalog No. A-9201-001.
[0334] The conjugation examples below include a (1) HyNic antibody
modification step, (2) conversion of an amino-oligonucleotide to a
4FB-oligonucleotide and (3) and conjugation step. Following are
common procedures used in the Examples that follow.
[0335] Antibody-HyNic Modification: The antibody is exchanged into
Modification Buffer (100 mM phosphate, 150 mM NaCl, pH 7.4) and a
solution of S-HyNic in anhydrous DMF (X equivalents as described
below) are mixed and incubated at room temperature for 1.5 h. The
HyNic-antibody is purified to remove excess modification reagent
and simultaneously buffer exchanged into Conjugation Buffer (100 mM
phosphate, 150 mM NaCl, pH 6.0) using a Zeba desalting column
(ThermoPierce, Rockford, Ill.).
[0336] 4FB-oligonucleotide preparation: 3'- or 5'-amino-modified
oligonucleotide is exchanged into Modification Buffer and the
concentration is adjusted between 0.2 and 0.5 OD/.mu.L. To the
volume of amino-oligonucleotide is added a 1/2 volume of DMF
followed by addition of S-4FB (20 equivalents in DMF). The reaction
is incubated at room temperature for 1.5 hours, diluted to 400
.mu.L with Conjugation Buffer (100 mM phosphate, 150 mM NaCl, pH
6.0) and desalted using a 5K MWCO Vivaspin diafiltration apparatus.
The 4FB-modified oligonucleotide is washed with Conjugation Buffer
(3.times.400 .mu.L), the OD/.mu.L of the purified oligonucleotide
is determined and used directly in the following conjugation
reaction.
[0337] HyNic-antibody/4FB-oligonucleotide conjugation: To the
HyNic-antibody (1 mol equiv) in conjugation buffer is added
4FB-oligonucleotide (3-5 equiv as described in the experiments). To
the reaction mixture is added 1/10.sup.th volume TurboLink Buffer
(100 mM aniline, 100 mM phosphate and 150 mM NaCl, pH 6.0. The
reactions are incubated for 2 hours and purified as described
below.
[0338] The gel data in the Figures were run on 4-12% Novex Bis-tris
gels (Invitrogen, Carlsbad, Calif.) using MOPS Running Buffer
(Invitrogen). Samples were loaded using NuPage LDS Sample Buffer
(Invitrogen) without DTT or heating prior to loading.
[0339] Gels were developed as indicated with Coomassie blue for
visual protein detection, Lumetein protein stain (Biotium, Hayward,
Calif.) or DNA DNA Silver Stain (GE Healthcare, Piscataway,
N.J.).
Example 1
[0340] In this Example a polyclonal antibody (bovine IgG (bIgG))
and a mouse monoclonal antibody (anti-FITC monoclonal antibody;
Jackson ImmunoResearch (Chadds Ford, Pa.)) were modified at 4 mg/mL
with S-HyNic (20 equivalents). Following desalting into Conjugation
Buffer the HyNic-antibodies were treated with a 35mer 5'-4FB
oligonucleotide (5 equivalents). The conjugates were purified using
USY-20 size exclusion Ultrafiltration Units (Advantec MFS, Inc.,
Dublin, Calif.). The DNA Silver stained PAGE results for
conjugation to bIgG are presented in FIG. 1. The loading, stain and
samples in each lane are:
[0341] Loading: 400 ng antibody
[0342] Visualization/stain: Sybr Gold stain
[0343] Lane 1. Marker
[0344] Lane 2. 4FB-35mer oligonucleotide
[0345] Lane 3. HyNic-Bovine IgG
[0346] Lane 4. Bovine IgG/4FB-35mer oligonucleotide crude
[0347] Lane 5. Bovine IgG/4FB-35mer oligonucleotide purified
[0348] The Lumetein stained PAGE results for conjugation to b-IgG
are presented in FIG. 2. As shown in the gel in FIG. 2, there is
significant conversion of antibody to conjugate. Lane 4 presents
the shift of the product band to higher molecular weight and minor
amounts of starting antibody as compared to Lane 3. In that the
sensitivity of Lumetein fluorescent protein stain is 1 ng this
result would indicate greater than 90% conversion of antibody to
conjugate as 400 ng of antibody were loaded in each lane. The
loading, stain and samples in each lane are:
[0349] Loading: 400 ng antibody
[0350] Visualization/stain: Lumetein stain (Biotium; Hayward,
Calif.)
[0351] Lane 1. Marker
[0352] Lane 2. 4FB-35mer oligonucleotide
[0353] Lane 3. HyNic-Bovine IgG
[0354] Lane 4. Bovine IgG/4FB-35mer oligonucleotide crude
[0355] Lane 5. Bovine IgG/4FB-35mer oligonucleotide purified
[0356] The Lumetein stained PAGE results for conjugation to
anti-FITC monoclonal antibody are presented in FIG. 3. No
unconjugated antibody is seen in lanes 3, 4 and 5 therefore based
on the efficiency of conversion of antibody to conjugate is greater
than 95% based on the sensitivity of the Lumetein stain. The
loading, stain and samples in each lane are:
[0357] Loading: 150 ng antibody
[0358] Visualization/stain: Lumetein stain
[0359] Lane 1. Marker
[0360] Lane 2. HyNic-MS anti-FITC 150 ng
[0361] Lane 3. MS anti-FITC/4FB-35mer oligonucleotidecrude 300
ng
[0362] Lane 4. MS anti-FITC/4FB-35mer oligonucleotide purified 300
ng
[0363] Lane 5. MS anti-FITC/4FB-35mer oligonucleotide purified 450
ng
[0364] The DNA Silver stained PAGE results for conjugation to
anti-FITC monoclonal antibody are presented in FIG. 4. Unconjugated
oligo can be seen in both lanes 4 and 5 demonstrating the
inefficiency in removing excess oligonucleotide using the USY 20
diafiltration filter. The sensitivity of DNA Silver Stain is
.about.50 pg oligo.
[0365] The loading, stain and samples in each lane are:
[0366] Loading: 150 ng antibody
[0367] Visualization/stain: Lumetein stain
[0368] Lane 1. Marker
[0369] Lane 2. HyNic-MS anti-FITC 150 ng
[0370] Lane 3. MS anti-FITC/4FB-35mer oligonucleotide crude 300
ng
[0371] Lane 4. MS anti-FITC/4FB-35mer oligonucleotide purified 300
ng
[0372] Lane 5. MS anti-FITC/4FB-35mer oligonucleotide purified 450
ng
Example 2
[0373] This experiment compares purification of
antibody-oligonucleotide conjugates by diafiltration and adsorbing
the conjugate on a Zinc-chelate modified magnetic bead, washing the
beads with buffer to remove excess 4FB-oligonucleotide and eluting
the conjugate from the bead with imidazole-based eluting
buffer.
[0374] Crude conjugate mixture prepared in Example 1 was purified
by either a 100 kD MWCO Vivaspin diafiltration spin column or
Zinc-magnetic-bead to remove free oligo: [0375] (A) Diafiltration
purification: Conjugate was diluted into PBS (400 .mu.L) placed in
the diafiltration apparatus and concentrated. The retentate was
diluted with PBS and concentrated 3 more times. [0376] (B)
Zinc-chelate-magnetic-bead purification: Added crude conjugated
antibody/oligo mixture to Zn SepFast Mag (Biotoolmics, UK) and bind
for 30-40 mM. The beads were washed (0.4 mL) with 25 mM sodium
phosphate, 300 mM sodium chloride, 0.05% Tween-20, pH 7.5 4 times.
The conjugate was eluted from the beads with 2 5 mM EDTA, 300 mM
NaCl, 250 mM Imidazole, 75 ug/mL HIS-6 peptide, pH 6.0, 4 times.
The purified conjugate was exchanged into 10 mM sodium phosphate,
149 mM sodium chloride, 1 mM EDTA, 0.05% sodium azide, pH 7.2.
[0377] As shown in FIG. 5, loading 300 ng of antibody and
developing with DNA Silver stain demonstrated near quantitative
removal of excess oligonucleotide by adsorbing Ab-oligonucleotide
conjugate on Zinc magnetic beads followed by release as no excess
oligo is present in Lane 5 while oligo can be seen in Lane 4. The
loading, stain and samples in each lane are:
[0378] Loading 300 ng of antibody
[0379] Stain: DNA Silver stain
[0380] Lane 1. Marker
[0381] Lane 2. 4FB-34FB-35mer oligonucleotide
[0382] Lane 3. Bovine IgG/34FB-35mer oligonucleotidecrude
[0383] Lane 4. Bovine IgG/4FB-35mer oligonucleotide purified with
Diafiltration spin column 100K
[0384] Lane 5. Bovine IgG/4FB-35mer oligonucleotide purified
Zinc-magnetic-bead
[0385] Based on the sensitivity of DNA Silver Stain greater than
98% of the excess is removed using this method.
Example 3
[0386] This experiment was designed to determine the optimal number
of equivalents of 4FB-oligonucleotide to be reacted with 1 mol
equivalent HyNic-antibody to yield greater than 90% conjugate. To
that end a 46mer and a 35mer 4FB oligonucleotide were added to
HyNic-anti-FITC antibody at both 3 and 5 mol equiv/mol antibody.
The conjugates were purified by adsorption/desorption on
Zn-magnetic beads as described in Example 2. The loading, stain and
samples in each lane are:
[0387] Loading: 300 ng of antibody
[0388] Stain: DNA Silver stain
[0389] Lane 1. Marker
[0390] Lane 2. 4FB-46mer 4FB-oligonucleotide
[0391] Lane 3. 1:5 MS anti-FITC/4FB-46mer oligonucleotide crude
[0392] Lane 4. 1:5 MS anti-FITC/4FB-46mer oligonucleotide
purified
[0393] Lane 5. 1:3 MS anti-FITC/4FB-46mer oligonucleotide crude
[0394] Lane 6. 1:3 MS anti-FITC/4FB-46mer oligonucleotide
purified
[0395] Lane 7. 1:5 MS anti-FITC/4FB-35mer oligonucleotide crude
[0396] Lane 8. 1:5 MS anti-FITC/4FB-35mer oligonucleotide
purified
[0397] Lane 9. 1:3 MS anti-FITC/4FB-35mer oligonucleotide crude
[0398] Lane 10. 1:3 MS anti-FITC/4FB-35mer oligonucleotide
purified
[0399] The DNA Silver stained PAGE results are presented in FIG. 6,
include crude reaction and purified product samples demonstrating
that 5 equivalents yielded a conjugate with more
oligonucleotides/antibody as deduced by the darker bands in the
samples where 5 equivalents of oligonucleotide were added.
Example 4
[0400] This experiment was designed to determine the optimal number
of equivalents of S-HyNic to be added to the antibody at 1 mg/mL to
yield greater than 90% conversion to conjugate. In one experiment
bIgG was reacted with 20.times., 30.times., 40.times. and 50.times.
equivalents of S-HyNic and reacted with 5 equivalents of a 46mer
4FB-oligonucleotide. The DNA Silver stained PAGE results are
presented in FIG. 7, showing excellent conversion to conjugate in
the reactions as evidenced by the dark bands in each lane and as
the number of equivalents of S-HyNic are increased the number of
oligonucleotides/antibody increases as the conjugate bands
penetrate the gel less as the number of equivalents of S-HyNic
increases resulting in the conjugation of more
oligonucleotides/antibody. The loading, stain and samples in each
lane are:
[0401] Loading 300 ng of antibody
[0402] Stain: DNA Silver stain
[0403] Lane 1. Marker
[0404] Lane 2. 4FB-35mer oligonucleotide
[0405] Lane 3. 20.times. Bovine IgG/4FB-46mer oligonucleotide
crude
[0406] Lane 4. 20.times. Bovine IgG/4FB-46mer oligonucleotide
purified
[0407] Lane 5. 30.times. Bovine IgG/4FB-46mer oligonucleotide
crude
[0408] Lane 6. 30.times. Bovine IgG/4FB-46mer oligonucleotide
purified
[0409] Lane 7. 40.times. Bovine IgG/4FB-46mer oligonucleotide
crude
[0410] Lane 8. 40.times. Bovine IgG/4FB-46mer oligonucleotide
purified
[0411] Lane 9. 50.times. Bovine IgG/4FB-46mer oligonucleotide
crude
[0412] Lane 10. 50.times. Bovine IgG/4FB-46mer oligonucleotide
purified
Example 5
[0413] To determine the effect of length of oligonucleotide on
conjugation efficiency 5 mol equivalents of 19mer, 39mer, 40mer,
46mer and 60mer 4FB-modified oligonucleotides were reacted with a
anti-Fitc monoclonal antibody that had been modified with 30
equivalents S-HyNic at 1 mg/mL antibody concentration. The DNA
Silver stained PAGE results of the purified conjugates are
presented in FIG. 8, showing equivalent band density in each lane
indicating that 4FB-oligonucletodes for length 19mer to 60mer
conjugate with equal efficiency. The loading, stain and samples in
each lane are:
[0414] Loading 1.0 ug of antibody
[0415] Stain: Commassie blue
[0416] Lane 1. Marker
[0417] Lane 2. HyNic-MS anti-FITC
[0418] Lane 3. Purified MS anti-FITC/4FB 19mer 4FB
oligonucleotide
[0419] Lane 4. Purified MS anti-FITC/4FB-35mer oligonucleotide
[0420] Lane 5. Purified MS anti-FITC/4FB-40mer oligonucleotide
[0421] Lane 6. Purified MS anti-FITC/4FB-40mer oligonucleotide
[0422] Lane 7. Purified MS anti-FITC/4FB-46mer oligonucleotide
[0423] Lane 8. Purified MS anti-FITC/4FB-60mer oligonucleotide
[0424] The yields of the reactions based on BCA Protein Assay
(ThermoPierce, Rockford, Ill.) were 55%, 52%, 50%, 50%, 47% and 50%
for the 19mer, 39mer, 40mer, 46mer and 60mer 4FB-modified
oligonucleotides conjugations respectively.
Example 6
[0425] this Example a polyclonal antibody (bovine IgG (bIgG)) and a
mouse monoclonal antibody (anti-FITC monoclonal antibody; Jackson
ImmunoResearch (Chadds Ford, Pa.)) were modified at 4 mg/mL with
S-HyNic (20 equivalents). Following desalting into Conjugation
Buffer the HyNic-antibodies were treated with a 35mer 5'-4FB
oligonucleotide (5 equivalents). The conjugates were purified using
USY-20 size exclusion Ultrafiltration Units (Advantec MFS, Inc.,
Dublin, Calif.). The DNA Silver stained PAGE results for
conjugation to bIgG are presented in FIG. 1. The loading, stain and
samples in each lane are: This example presents the preparation and
purification of an oligonucleotide/antibody conjugate using the
optimized conditions as determined in the Examples above. In this
experiment 40mer and 60 mer 5'-amino-oligonucleotides as shown in
TABLE 1 were 4FB-modified and conjugated to an antibody that was
reacted with 30 equivalents of S-HyNic at 1 mg/mL then purified
using the Zn-magnetic bead adsorption/desorption method.
TABLE-US-00002 TABLE 1 # Base # Pairs MW Ext Coeff Oligonucleotide
Sequence Oligo-1 40 12451.2 374000 5'-G ACT GAC GAA CCG CTT TGC CTG
ACT GAT CGC TAA ATC GTG-NH.sub.2 Oligo-2 60 18557.1 550200 5'-TTG
CAT CGC CCT TGG ACT ACG ACT GAC GAA CCG CTT TGC CTG ACT GAT CGC TAA
ATC GTG-NH.sub.2
[0426] First, a stock solution of bovine IgG (bIgG) 5 mg/mL in
modification buffer (100 mM phosphate, 150 mM NaCl, pH 7.4; Sigma
(St. Louis, Mo.)) was prepared. bIgG stock solution (20 .mu.L; 100
ug bIgG) was diluted with modification buffer (80 .mu.L) to prepare
a 1 mg/mL solution and was exchanged into modification buffer
(using a 0.5 mL Zeba 7K Desalting columns (ThermoPierce, Rockville,
Ill.)) pre-equilibrated with modification buffer. A stock solution
of S-HyNic (1.0 mg dissolved in anhydrous DMF (200 .mu.L); SoluLink
Biosciences (San Diego, Calif.)) was prepared. To the bIgG in
modification buffer was added S-HyNic/DMF solution (1.12 .mu.L; 30
mol equivalents). The mixture was mixed thoroughly by pipette and
incubated at room temperature for 2.0 h. Using a 0.5 mL Zeba column
the reaction mixture was desalted and buffer exchanged into
conjugation buffer (100 mM phosphate, 150 mM NaCl, pH 6.0). This
HyNic-antibody was used directly in the conjugation reaction.
[0427] A 3'-Amino-modified 40mer Oligo-1 (11.1 ODs; Eurogentec (San
Diego, Calif.)) was dissolved in 50 mM NaOH (30 .mu.L) and was
buffer exchanged into modification buffer using a 0.5 mL Zeba
desalting column pre-equilibrated in modification buffer. The
OD/.mu.L of the final oligo solution was determined to be 0.33
OD/.mu.L. A stock solution of S-4FB (1.0 mg; SoluLink Biosciences)
in anhydrous DMF (25 .mu.L) was prepared. To the desalted oligo was
added DMF (15 .mu.L) followed by S-4FB/DMF solution (3.7 .mu.L; 20
mol equivalents). The reaction mixture was thoroughly mixed and
allowed to incubate at room temperature for 2 h. The reaction
mixture was exchanged into conjugation buffer (100 mM phosphate,
150 mM NaCl, pH 6.0) using a 0.5 mL Zeba desalting column
pre-equilibrated with conjugation buffer and the OD/.mu.L was
determined. This prepared a 4FB modified 5'-amino-modified
oligonucleotide that was used directly in the conjugation step.
[0428] 3'-4FB-40mer Oligo-1 (30.8 .mu.L; 5 mol equivalents) was
added followed by addition of TurboLink.TM. Catalyst (14 .mu.L (
1/10 volume); 100 mM aniline, 100 mM phosphate, 150 mM NaCl, pH
6.0). The reaction mixture was incubated at room temperature for 2
hours.
[0429] The IMAC Zn SepFast MAG Media (120 .mu.L of a 50% slurry,
Biotoolmics, UK) was prepped by addition of the beads 1.5 mL
microcentrifuge tube, magnetizing the beads on a magnetic stand and
the supernatant was removed. The beads were washed three times with
binding buffer (200 .mu.L; 100 mM phosphate, 150 mM NaCl; pH 6.0).
Following removal of the final wash the entire volume (.about.110
.mu.L) of the completed antibody-oligonucleotide conjugation
reaction was added directly onto the bead pellet. The reaction/bead
mixture was carefully mixed by swirling with a pipette tip for 30
seconds. The beads were allowed to settle for 15 min at room
temperature (18-25.degree. C.). The slurry was mixed again by
swirling and allowed to settle for an additional 15 min. The tube
was placed on a magnetic stand for 1 min to pellet the beads and
the supernatant was gently removed and discarded. The bead pellet
was washed three more times with 400 .mu.L wash buffer discarding
the supernatant each time.
[0430] The conjugate was then eluted and removed from the beads by
adding 50 .mu.L bead elution buffer (300 mM imidazole, 300 mM NaCl,
50 mM EDTA, 70 .mu.g/mL (83.3 .mu.M) (His).sub.6 peptide to the
bead pellet. The slurry was gently mixed by swirling with a pipette
tip for 30 sec and incubate the settled slurry for 15 minutes
mixing gently at 5 minute intervals. The tube was placed into the
magnetic stand to allow the beads to pellet for 1 min. The
supernatant containing the affinity purified
antibody-oligonucleotide conjugate was transferred into a new 1.5
mL tube. The beads were eluted three more times with 50 .mu.L
elution buffer to obtain the maximum conjugate recovery. The
combined eluants were buffer exchanged into storage buffer (PBS, 1
mM EDTA). Oligonucleotide concentration was determined
spectrophotometrically by determining the conjugate's absorbance at
260 nm. Antibody concentration was determined using the BCA assay
(ThermoPierce, Rockville, Ill.). Typical yields are 30-50% based on
protein BCA assay. The molar substitution ratio is 2.0-2.5
oligonucleotides/antibody. The conjugates were further analyzed by
gel electrophoresis using 12% Bis-Tris Gel (Invitrogen (Carlsbad,
Calif.)) and visualized by UV-backshadowing followed by Coomassie
Blue or DNA Silver Stain (GE HealthCare (Piscataway, N.J.)).
Example 7
[0431] Protocol for preparation of an antibody/oligonucleotide
conjugate on a solid phase support (Prospective).
[0432] MAC Zn SepFast MAG Media (120 .mu.L of a 50% slurry,
Biotoolmics, UK) can be prepped by addition of the beads 1.5 mL
microcentrifuge tube, magnetizing the beads on a magnetic stand and
the supernatant can be removed. The beads can be washed three times
with Binding Buffer (200 .mu.L; 100 mM phosphate, 150 mM NaCl; pH
6.0). Antibody (100 ug) in 100 .mu.L in Binding Buffer is added to
the beads. The antibody/bead mixture can be carefully mixed by
swirling with a pipette tip for 30 seconds. The beads can be
allowed to settle for 15 min at room temperature (18-25.degree.
C.). The slurry can be mixed again by swirling and allowed to
settle for an additional 15 min. The tube can be placed on a
magnetic stand for 1 min to pellet the beads and the supernatant
can be gently removed and discarded. The bead pellet can be washed
three more times with 400 .mu.L Modification Buffer discarding the
supernatant each time. To the bead slurry can be added a 20 mg/mL
solution sulfo-S-HyNic (20-50 mol equivalents) in Modification
Buffer. The beads can be swirled and allowed to incubate at room
temperature for 2 h. The bead reaction mixture can be diluted to
400 .mu.L with Conjugation Buffer swirled and allowed to stand for
15 min. The tube can be placed on a magnetic stand for 1 min to
pellet the beads and the supernatant can be gently removed and
discarded. The bead pellet can be washed three more times with 400
.mu.L Conjugation Buffer discarding the supernatant each time. To
the beads can be added 4FB-oligonucleotide (3-5 equivalents) and a
1/10 volume of TurboLink buffer. The reaction mixture can be
swirled and allowed to incubate at room temperature for 1-16 h. The
tube can be placed on a magnetic stand for 1 min to pellet the
beads and the supernatant can be gently removed and discarded. The
beads can be washed with 25 mM sodium phosphate, 300 mM sodium
chloride, 0.05% Tween-20, pH 7.5 for 4 times. The conjugate can be
eluted from the beads with 2 5 mM EDTA, 300 mM NaCl, 250 mM
Imidazole, 75 .mu.g/mL HIS-6 peptide, pH 6.0, 4 times. The purified
conjugate can be exchanged into 10 mM sodium phosphate, 149 mM
sodium chloride, 1 mM EDTA, 0.05% sodium azide, pH 7.2.
Example 8
[0433] Protocol for Preparation and Purification of
Protein/Oligonucleotide Conjugate (Prospective):
[0434] For example, a Streptavidin/oligonucleotide conjugate can be
prepared and purified using the following protocol.
[0435] Step 1: To a solution of streptavidin (1000 .mu.L of a 5
mg/mL solution; Roche Biosciences) in modification buffer can be
added a solution of S-4FB (9.7 .mu.L of a 10 mg/mL solution in
anhydrous DMF; 10 mol equiv.). The reaction mixture can be gently
vortexed and allowed to stand at room temperature for 1.5 h. The
reaction mixture can be desalted into conjugation buffer using a 2
mL Zeba column pre-equilibrated with conjugation buffer.
[0436] Step 2: His-tag conjugation: To 4FB-streptavidin prepared in
step 1 can be added HyNic-Peg2-His6-NH.sub.2 (SoluLink Biosciences;
4.2 .mu.L of a 20 mg/mL solution in conjugation buffer; 0.75 mol
equivalent). The His6-StAv conjugate can be purified by adsorption
of the conjugate using His-Tag Purification Chelating Agarose Beads
(Agarose Bead Technologies (Tampa, Fla.) followed by washing to
remove unconjugated streptavidin. The conjugate can be eluted off
the beads using imidazole/EDTA buffer. The isolated
HyNic-Peg2-streptavidin conjugate can be desalted into conjugation
buffer using a 5 MWCO diafiltration apparatus to both desalt and
remove unconjugated HyNic-Peg2-His6-NH.sub.2.
[0437] Step 3: Preparation of HyNic-oligonucleotide: A
5'-amino-modified 38mer oligonucleotide can be exchanged and
concentrated into modification buffer (100 mM phosphate, 150 mM
NaCl, pH 7.4) using a 5K MWCO Vivaspin column (Sartorius Stedim,
Purchase, N.Y.). The final concentration can be adjusted to 0.3
OD/. To the oligo in modification buffer (33.4 .mu.L; 30 nmol) is
added DMF (16.7 .mu.L) and S-HyNic (11 .mu.L of a 10 mg/mL solution
in DMF; 15 equivalents; SoluLink Biosciences). The reaction mixture
can be vortexed and allowed to stand at room temperature for 1.5
hours). The reaction mixture can be desalted into conjugation
buffer (100 mM phosphate, 150 mM NaCl, pH 6.0) using a 5 KDa MWCO
VivaSpin column. Resuspension into conjugation buffer and
concentration can be repeated 3 times. The oligo concentration can
be adjusted to 0.25 OD/.mu.L.
[0438] Step 4: Oligo conjugation and conjugate purification: To the
4FB-StAv-His-tag conjugate in Conjugation Buffer prepared in Step 2
(1 mol equivalent) can be added HyNic-38mer oligonucleotide (2.0
mol equiv) in conjugation and 1/10 volume TurboLink catalyst. The
reaction mixture can be incubated at room temperature for 2 hours
and the 38mer oligonucleotide-StAv-His-tag conjugate can be
purified by addition of the reaction mixture to Zinc-His-tag
magnetic beads and incubated for 30 min to allow the conjugate to
bind to the beads. The supernatant can be removed and the buffer
(0.4 mL) can be added to the beads and the mixture can be gently
mixed using a pipette, incubated for 5 min and supernatant can be
removed. This washing procedure can be repeated 3 more times. The
conjugate can be eluted from the beads by adding elution buffer
(100 mM imidazole; EDTA; buffer) incubating for 15 minutes. The
supernatant can be removed and collected in a separate tube. The
elution procedure can be repeated three more times. The combined
eluants can be exchanged into 5 mM EDTA, PBS using a 0.5 mL
pre-equilibrated Zeba column.
Example 9
[0439] General reagents and buffers: Modification Buffer (MB)-100
mM phosphate, 150 mM NaCl, pH 7.4: Conjugation Buffer (CB)-100 mM
phosphate, 150 mM NaCl, pH 6.0.
[0440] General procedure to prepare 5'-4FB-oligonucleotides from
5'-amino-HyLk oligonucleotides (see Table 2): 5'-amino-HyLk
oligonucleotides (synthesized at Eurogentec, San Diego, Calif.)
were dissolved in Modification Buffer (500 .mu.L) and desalted
using 5K MWCO VivaSpin diafiltration devices (SartoriusStedim,
Purchase, N.Y.). The oligonucleotides were diluted to 190-250
.mu.mol/.mu.L. A solution of S-4FB (38.11 mg) in anhydrous DMF (500
.mu.L) was prepared. In a specific example- to amino-HyLk2' (50-150
ODs) in Modification Buffer was added DMF (1/2 vol) followed by
S-4FB/DMF solution containing 20 mol equiv. S-4FB. The reaction
mixture was incubated at room temperature for 2 h diluted to 500
.mu.L with nuclease free water and concentrated and washed three
times with nuclease free water using 5K MWCO VivaSpin diafiltration
devices. The concentration of the recovered oligonucleotide was
determined. The degree of 4FB incorporation was determined by a
colorimetric assay wherein the 4FB-oligonucleotides were incubated
with 2-hydrazinopyridine to form a chromophoric bis-arylhydrazone
that absorbs at A345 with molar extinction coefficient of 24500.
This was performed by adding 4FB-oligonucleotide (2 .mu.L) to a 50
.mu.M solution of 2-hydrazinopyridine dihydrochloride in 100 mM
MES, pH 5.0 (18 .mu.L; SigmaAldrich; St. Louis, Mo.) and incubated
at 37.degree. C. for 30 min followed by determination of the A345
absorbance using a NanoDrop spectrophotometer (ThermoFisher). The
degree of modification was calculated using the following formula
(measured A350/measured A280)/(hydrazone molar extinction
coefficient (24500)/theoretical oligonucleotide molar extinction
coefficient). Here, the degree of labeling was 0.67-0.96.
TABLE-US-00003 TABLE 2 HyLk Sequences HyLk-1
5'-amino-cctgcgtcgtttaaggaagtac HyLk-1'
5'-amino-gtacttccttaaacgacgcagg HyLk-2
5'-amino-ggtccggtcataaagcgataag HyLk-2'
5'-amino-cttatcgctttatgaccggacc HyLk-3
5'-amino-gtggaaagtggcaatcgtgaag HyLk-3'
5'-amino-cttcacgattgccactttccac HyLk-4
5'-amino-gctgacatagagtgcgatac HyLk-4' 5'-amino-gtatcgcactctatgtcagc
HyLk-5 5'-amino-tgtgctcgtctctgcatact HyLk-5'
5'-amino-agtatgcagagacgagcaca HyLk-6 5'-amino-atgtacgtgagatgcagcag
HyLk-6' 5'-amino-ctgctgcatctcacgtacat
Example 10
[0441] General procedure to conjugate 4FB-HyLk oligonucleotides to
HyNic-modified antibodies: The following example is representative
of the protocol used to prepare the antibody/oligonucleotide
conjugates used.
[0442] Step 1) S-HyNic/antibody modification: anti-GK1.5 was
concentrated to .about.5 mg/mL using a 30 kD MWCO VivaSpin
diafiltration apparatus followed by desalting into Modification
Buffer using a 0.5 mL Zeba desalting device. Anti GK1.5
concentration was determined using the BCA protein assay
(ThermoPierce). A solution of S-HyNic (8.4 mg/mL) in anhydrous DMF
was prepared. To anti-GK1.5 (0.5 mg; 167 .mu.L of a 3 mg/mL
solution) was added S-HyNic/DMF solution (2.3 .mu.L; 20 mol equiv).
The reaction mixture was incubated at room temperature for 2.5
hours then desalted into Conjugation Buffer using Zeba desalting
columns. The concentration of the HyNic-modified protein was
determined to be 2.45 mg/mL.
[0443] Step 2) 4FB-oligonucleotide/HyNic antibody conjugation: To
the solution of HyNic-anti-GK 1.5 prepared in step 1 (0.5 mg; 3.27
nmol) was added 4FB-HyLk-1 (3 mol equiv) and incubated at room
temperature overnight. The conjugate was purified by size exclusion
chromatography using a SuperDex 200 column (GE HealthCare) eluting
with 100 mM phosphate, 150 mM NaCl, pH 7.2 at 0.5 mL/min. The
protein concentration of the conjugate was determined to be 0.122
mg/mL using the BCA assay.
TABLE-US-00004 TABLE 3 below lists the conjugates prepared and
their respective data: Conjugate Antibody Clone Isotype GK1.5
(.alpha.-CD4) - HyLk1 .alpha.-CD4 (rat anti-mouse) GK1.5 1gG2a
145-2C11 .alpha.-CD3e (hamster 145-2C11 1gG (.alpha.-CD3) - HyLk2
anti-mouse) 145-2C11 .alpha.-CD3e (hamster 145-2C11 1gG
(.alpha.-CD3) - HyLk3 anti-mouse) 2.43.1 (.alpha.-CD8) - HyLk1
.alpha.-CD8 (rat anti-mouse) 2.43.1 1gG2b 2.43.1 (.alpha.-CD8) -
HyLk2 .alpha.-CD8 (rat anti-mouse) 2.43.1 1gG2b 1D3 (.alpha.-CD19)
- HyLk3 .alpha.-CD19 (rat anti-mouse) 1D3 1gG1
Example 10-B
[0444] Pre-Assembly of Antibody-Oligonucleotide Conjugates to
Complementary Oligonucleotide-Dextran-Polyfluorophore
Conjugates.
[0445] Oligonucleotide sequences are detailed in Example 9, Table
2.
[0446] Antibody clone and isotype information is detailed in
Example 10, Table 3.
[0447] Antibody:oligonucleotide labeling conjugates were prepared
as described in Example 10.
[0448] Complementary oligonucleotide-dextran-polyfluorochrome
detector conjugates were prepared as described in Example 10.
[0449] Antibody:oligonucleotide conjugates and complementary
oligonucleotide:dextran:polyfluorochrome conjugates matched to
create preassembled labeling constructs are shown in Table 3B.
TABLE-US-00005 TABLE 3B Conjugated used to prepare preassembled
labeling constructs: Antibody-Oligonucleotide
Oligonucleotide:Dextran:Polyfluorochrome Labeling Conjugate
Detector Conjugate .alpha.-CD4:HyLk1 HyLk1':Dextran:Dy490
.alpha.-CD8:HyLk2 HyLk2':Dextran:Dy549 .alpha.-CD19:HyLk3
HyLk3':Dextran:Dy591 .alpha.-CD43:HyLk4 HyLk4':Dextran:Dy649
.alpha.-CD62L:HyLk5 HyLk5':Dextran:Dy405
[0450] Preassembly procedure: Antibody-oligonucleotide labeling
conjugates were aliquoted at 0.1 .mu.g (=6.67 pmol) IgG/sample.
Each conjugate was determined by A260 assay to have a molar
substitution ratio of oligonucleotide/antibody of approximately
2.0, as described in Example 6. Therefore, each sample of antibody
conjugate contains 2.0.times.6.67=13.3 pmol of conjugated
oligonucleotide. Complementary
oligonucleotide-dextran-polyfluorochrome detector conjugates were
added at a 1:1 oligonucleotide ratio. Each detector conjugate was
determined to have a component ratio of 1 mol complementary
oligonucleotide:1 mol dextran:5 mol fluorochrome, as described in
Example 6. Therefore one sample of preassembled labeling construct
contains the following components: 6.67 pmol IgG, 13.3 pmol
oligonucleotide; 13.3 pmol complementary oligonucleotide, 13.3 pmol
dextran, 66.5 pmol fluorochrome. For constructs prepared
singly--one labeling conjugate combined with one detector
conjugate--elements were mixed in 40 .mu.L final volume of 1%
BSA-DPBS buffer and incubated with rotation for 15 minutes at
24.degree. C. For constructs prepared "in cocktail", as a mixture
of five labeling conjugates and five detector conjugates, elements
were combined in 200 .mu.L final volume of 1% BSA-DPBS buffer and
incubated with rotation for 15 minutes at 24.degree. C.
[0451] Cell staining by preassembled labeling constructs: Spleen
from a C57BL/6 normal mouse was processed into a single cell
suspension, and red blood cells were lysed by hypotonic solution.
Splenic leukocytes were aliquoted at a concentration of
1.2.times.10.sup.6 cells/sample, washed once in a buffer of 1% BSA
in 1.times. Ca- and Mg-free DPBS, and resuspended for 20 minutes in
50 .mu.L of .alpha.FcR hybridoma culture supernatant to block
non-specific binding of antibody IgG to cells. Preassembled
labeling constructs were then added to blocked leukocytes. Singly
preassembled constructs were pooled and then added to cells;
constructs assembled in "cocktail" were directly added to cells.
For either method, final IgG concentration was 0.5 .mu.g/250 .mu.L
or 2 .mu.g/mL. Cells were stained for 30 minutes at 4.degree. C.,
followed by one wash in 500 .mu.L 1% BSA-DPBS to remove excess
labeling construct.
[0452] Flow cytometric analysis: Samples were analyzed using a BD
LSRII flow cytometer equipped with lasers and optical detectors
suitable for excitation of Dyomics fluorochromes and capture of
emission spectra. 10,000 events were taken per sample. Cell debris
and macrophage/granulocyte populations were excluded by gating
lymphocytes based on cell size on FSC vs. SSC dot plots. Analysis
of lympocyte population subsets CD4+, CD8+, CD19+, CD43+ and CD62L+
was performed using FlowJo software (Tree Star, Inc). Results are
presented in FIG. 56.
Example 11
[0453] Biofluor-oligonucleotide conjugate synthesis:
Biofluor-oligonucleotide conjugates were prepared using the
following 3-step general procedure (1) biofluor modification with
S-HyNic, (2) preparation of 4FB-oligonucleotide by modification of
an amino-oligonucleotide with S-4FB (see above general procedure)
and (3) conjugation of the HyNic-biofluor to
4FB-oligonucleotide.
[0454] Step 1) Biofluor modification procedure: R-Phycoerythrin
(Febico, Taiwan) was exchanged into Modification Buffer (100 mM
phosphate, 150 mM NaCl, pH 7.4) by dialysis. To a solution of R-PE
(0.20 mg; 35 .mu.L of 5.6 mg/mL solution) in Conjugation Buffer was
added S-HyNic (0.77 .mu.L of a 6.0 mg/mL solution in anhydrous DMF;
20 mol equiv). The reaction mixture was gently vortexed and allowed
to react for 2.5 h at room temperature. HyNic-R-PE was purified by
desalting on a 0.5 mL Zeba desalting column (ThermoPierce, Rockford
Ill.) pre-equilibrated with Conjugation Buffer (100 mM phosphate,
150 mM NaCl, pH 6.0).
[0455] Step 3) Conjugate formation: To a solution of HyNic-R-PE
(175 ug of a 2.0 mg/mL solution in Conjugation Buffer) was added
4FB-HyLk2' (15 ug of a 0.32 OD/.mu.L solution in Conjugation
Buffer: 3 mol equiv) and TurboLink buffer (1.8 .mu.L; 100 mM
aniline, 100 mM phosphate, 150 mM NaCl, pH 6.0; Solulink
Biosciences, San Diego, Calif.) The reaction mixture was incubated
at room temperature for 4 h at room temperature and at 4.degree. C.
for 16 h. The conjugate was purified by size exclusion
chromatography on a SuperDex 200 column (GE HealthCare, Piscataway,
N.J.) to remove excess oligonucleotide. The conjugate was
characterized by gel electrophoresis.
TABLE-US-00006 TABLE 4 Biofluor-oligonucleotide conjugates made by
above protocol: Biofluor Oligonucleotide R-PE HyLk-2' APC HyLk-1'
PerCP HyLk-3'
Example 11-B
[0456] Following the protocol of Example 11, the following is a
standard procedure to prepare an oligonucleotide-tandem dye
conjugate: An oligonucleotide-biofluor protein, e.g. R-PE,
crosslinked APC or PerCP, as prepared above is concentrated using a
diafiltration apparatus to 1-2 mg/mL biofluor concentration and
buffer exchanged into Modification Buffer. A 20 mg/mL solution of
second dye, e.g. Cy2, Cy3, Cy 3.5, Cy5, Cy5.5, Cy 7, Dyomics dyes,
or Alexa dyes, in anhydrous DMF is prepared. To a solution of the
oligonucleotide-biofluor conjugate is added 10-30 equivalents of
dye to incorporate sufficient dye to quench the donor fluorescence
nearly completely, i.e. degree of modification 4-8. The resulting
phycobiliprotein conjugate is excited at 488 nm and the
fluorescence emission is compared to that of unmodified R-PE
excited at the same wavelength. Highly efficient energy transfer
(>99%) occurs from the protein to the fluorescent dye.
Example 12-A
[0457] Complementary Oligonucleotide-dextran-polyfluorophore
Preparation: The procedure reported below was designed to prepare
1/1 oligonucleotide/amino-dextran conjugates by conjugating <0.5
oligonucleotide/dextran and isolating the heterodimer by (1)
removal of excess oligonucleotide by size exclusion chromatography
followed by (2) removal of excess amino-dextran by ion exchange
chromatography. Subsequently the 1/1 oligonucleotide/dextran
conjugate was modified with dye-N-hydroxysuccinimide esters to
incorporate the desired dyes/dextran. This method can be used with
amino-dextrans of various molecular weights and the level of dye
incorporation can be increased with increasing amino-dextran
molecular weight. Furthermore this method could be used with other
polymeric or dendrimeric scaffolds such as PANAM dendrimers
(SigmaAldrich).
[0458] Step 1) Amino-dextran desalting: 70 kD amino-dextran (14.3
mg; Invitrogen; Carlsbad, Calif.) was dissolved in modification
buffer (1.0 mL), vortexed and heated at 55.degree. C. to complete
dissolution of the amino-dextran. The solution was desalted into
Modification Buffer using a 5 mL Zeba desalting column (Thermo
Pierce; Rockford, Ill.). Volume after desalting was 1.27 mL and
theoretical recovery was 11.26 mg/mL.
[0459] Step 2A) HyNic incorporation on amino-dextran: To a solution
of amino-dextran in Modification Buffer (0.24 umol; 14.3 mg; 1.27
mL of a 11.26 mg/mL solution) was treated with a solution of
S-HyNic (11.32 .mu.L of a 26.2 mg/mL solution in anhydrous DMF; 5
mol equiv) and the solution was incubated at room temperature for
2.5 h and desalted into Conjugation Buffer using a 5 mL Zeba
desalting column using a 250 .mu.L buffer stacker. The volume after
desalting was 1.65 mL and a theoretical concentration based on 100%
recovery of 8.67 mg/mL.
[0460] Step 2B) HyNic incorporation quantification: A 100 mM
solution of 2-sulfo-benzaldehyde (2-SB;) SigmaAldrich; St. Louis,
Mo.) in 100 mM MES, pH 6.0 was prepared. HyNic-dextran as prepared
above (2 .mu.L) was added to the 2-SB solution (18 .mu.L). A blank
reaction wherein water (2 .mu.L) was added to 2-SB (18 .mu.L) was
also prepared. The solutions were incubated at 40.degree. C. for 30
min followed by determination of the absorbance of the solution at
A345. The concentration of the chromophoric hydrazone product was
determined using its extinction coefficient of 28000. The HyNic
substitution ratio, i.e. the average number of HyNic
groups/dextran, was determined by dividing the hydrazone
concentration by the dextran concentration. In this reaction the
MSR was 3.36.
[0461] Step 3A) To a solution of HyNic-dextran as prepared in 2A
(3.0 mg; 43 nmol) was added 4FB-HyLkX'-oligonucleotide (0.5 equiv)
and the reaction was incubated at room temperature for 15 h. To
remove excess oligonucleotide from the conjugate the solutions were
purified by size exclusion chromatography on a SuperDex 200 column
(GE HealthCare) using Loading Buffer (20 mM HEPES, 25 mM NaCl; pH
7.00) as eluant at 1 mg/mL flow rate. The initial % of the first
peak was collected and concentrated to <800 .mu.L using 5K MWCO
VivaSpin columns and the conjugates were diluted to 800 .mu.L with
Loading Buffer. UV spectra of the conjugates were nearly identical
with respect to A350/A280 ratios. The A350 absorbance measures the
bis-arylhydrazone conjugate bond. To isolate
oligonucleotide/dextran conjugate the solutions were passed through
Vivapure Q Mini H devices using Loading Buffer in two 400 .mu.L
aliquots. The filter devices were washed with Loading Buffer
(2.times.400 .mu.L) to remove free dextran. The
HyLkX'-oligonucleotide/dextran conjugates were eluted from the
support with 90 mM, 450 mM, and 750 mM NaCl in Loading Buffer. Most
of the conjugate eluted in the 450 and 750 mM fractions. These two,
along with the 90 mM elution, were pooled to afford conjugate in
1200 .mu.L total volume. The pools were concentrated down to
approximately 150 .mu.L, split, and desalted into Modification
Buffer over two 0.5 mL Zebas with 30 .mu.L stacker.
[0462] Step 3B) General example of fluorophore incorporation on
oligonucleotide-amino-dextran heterodimer conjugates: A solution of
Dy490 (1.0 mg; Dyomics, Germany) was dissolved in anhydrous DMF
(100 .mu.L). To a solution of oligonucleotide-dextran heterodimer
(1.06 mg; 14.1 umol) in Modification Buffer was added Dy490/DMF
solution (12 .mu.L; 10.7 mol equiv) and the reaction mixture was
allowed to incubate for 2 h at room temperature than overnight at
4.degree. C. The reaction mixture was diluted with Modification
Buffer (1 mL) and loaded into a 10 kD dialysis cassette
(ThermoPierce) and dialyzed against PBS (700 mL) overnight and a
further 700 mL for 6 h. TABLE 5: The following
oligonucleotide/dextran/dye conjugates were prepared by the above
method:
TABLE-US-00007 TABLE 5 Oligo Dye HyLk-1' Dy-490 HyLk-1' LI-COR
680LT HyLk-2' LI-COR 800CW HyLk-5' Dy-405 HyLk-6' Dy-681 HyLk-1'
Dy490 HyLk-2' Dy549 HyLk-3' Dy591 HyLk-4' Dy649 HyLk-5' Dy405
HyLk-6' Dy681
Example 12-B
[0463] Preparation of Oligonucleotide-Dextran-Polyfluors with
increasing numbers of fluors/dextran:
[0464] The following procedure was used to prepare
oligonucleotide-dextran-polyfluors of increasing numbers of
fluors/dextran: Solutions of Dy490, Dy591 and Dy649 in anhydrous
DMF (20 mg/mL) were prepared. To solutions of 20mer
HyLk1'/amino-dextran heterodimer (1.0 mg at 1.0 mg/mL based on
dextran as determined using the resorcinol assay) in Modification
Buffer as prepared in Example 12-A (Step 3A) were added aliquots of
dyes as listed in Table 5-B. The reactions were incubated at room
temperature for 3 h and transferred to Pierce Slide-A-Lyzer MINI
Dialysis Units, 20K MWCO and dialyzed against 0.1M sodium
phosphate, 0.15M NaCl, pH 7.2 for 8 h and the buffer was changed
and dialysis was continued for 4 h. The final conjugates were
diluted to 1.0 mL with buffer. The degree of fluor incorporation
was determined using a NanoDrop 1000 Spectrophotometer using each
dye's respective absorbance maximum and molar extinction
coefficient. Results are present in Table 5-B. Equivalents added
were calculated by directly dissolving the dye in the vial from the
vendor. The vials may have been overfilled therefore more dye than
expected was added to the reaction.
TABLE-US-00008 TABLE 5-B Dy490 Dy591 Dy649 equiv equiv equiv equiv
equiv equiv added incorp added incorp added incorp 5.10 3.55 9.38
2.88 4.00 3.29 8.50 5.63 11.80 4.64 6.67 5.69 11.90 7.60 16.50 6.53
9.33 8.04 17.10 10.57 23.50 9.22 13.33 12.58 25.50 14.37 35.30
13.62 20.00 21.64
[0465] Flow Cytometer Procedure to test these conjugates:
anti-CD4-HyLk1 conjugate (oligo/antibody ratio 4/1) on splenocytes
from a C57BL/6 mouse were used to test these conjugates as
described in Example 13. FIG. 68 presents the flow cytometric
results of the testing of this panel of conjugates. FIG. 68
illustrates the evaluation of complementary
oligonucleotide-dextran-polyfluor conjugate detectors with
increasing number of fluors/dextran scaffold. The detectors were
pre-assembled on .alpha.-CD4-HyLk1 antibodies, allowed to
hybridize, added to cells, washed and fluorescence intensity of
bound hybrid was detected by flow cytometry.
Example 13
[0466] Complementary-oligonucleotide-HRP Conjugate Preparation:
[0467] Step 1) HyNic-modification of HRP: To a solution of HRP
previously desalted into Modification Buffer (8.4 mg; 1.16 mL of a
7.27 mg/mL) was added sulfo-S-HyNic (Solulink Biosciences; 200
.mu.L of a 11.25 mg/mL solution in Modification Buffer; 30 mol
equivalents). The reaction mixture was gently vortexed then allowed
to stand at room temperature for 2 h then at 4.degree. C. for 16 h.
The reaction mixture was desalted into Conjugation Buffer using a 2
mL Zeba column.
[0468] Step 2) HyNic-HRP/4FB-oligonucleotide conjugation: To a
solution of HyNic-HRP (113 .mu.L of a 6.45 mg/mL solution in
Conjugation Buffer; 0.73 mg) was added 5'-4FB-HyLnk1' (73.5 .mu.L
of a 0.215 OD/.mu.L solution in Conjugation Buffer) and aniline to
a final concentration of 20 mM. The reaction was incubated
overnight at 4.degree. C. and the HRP-HyLnk1' conjugate was
isolated by size exclusion chromatography on a SuperDex 200 column
(GE HealthCare) eluting with PBS. EDTA to a final concentration of
1% was added to the conjugate to protect against nucleases. The
final concentration of the conjugate was determined by measuring
the absorbance at 403 nm and calculating the concentration using
E1%, 403 nm=17.2.
Example 14
[0469] Flow cytometry Procedure:
[0470] Antibodies used for conjugation to HyLk oligonucleotide
sequences: .alpha.-CD4 (GK1.5), .alpha.-CD8 (2.43.1), and
.alpha.-CD19 (1D3) were used to differentiate T and B cell
populations. .alpha.-CD43 (S7) and .alpha.-CD62L (MEL-14), which
recognize adhesion molecules, were used to define sub-populations
of these cell types. These antibodies were conjugated to HyLk
sequences as listed in Table 3.
[0471] Cell staining for flow cytometry analysis: Spleen from a
C57BL/6 mouse was processed into a single cell suspension, and red
blood cells were lysed by hypotonic solution. Splenocytes were used
at a concentration of 0.3.times.10.sup.6 cells/tube, and washed
once in Facs buffer which consist of PBS with 0.2% BSA and 0.012%
Sodium Azide. To block non-specific binding of antibodies to
Fc.alpha.R, cells were first incubated with 20 .mu.L of a 2.4G2
hybridoma supernatant for 10 minutes at room temperature. Without
washing the cells, 10 .mu.L of primary Ab:HyLk oligonucleotide
conjugates were added at their appropriate concentrations (Ab:HyLk
pairs were titrated and used at 0.1-1.0 .mu.g/sample). Cells were
stained for 30 minutes at 4.degree. C., and then washed two times
with FACS buffer to remove free antibody. Complementary
HyLkX':Dyomics-dye conjugates were then added, using 10 .mu.L of
the appropriate dilutions (the HyLkX'-Dy-dyes were titrated and
used at 0.03-0.3 .mu.g/sample). Cells were incubated for 15 minutes
in the dark, at room temperature, and then washed two times with
Facs buffer. Cells were resuspended in 350 .mu.L of Facs buffer and
run on an LSRII flow cytometer. For staining analysis, the
lymphocyte population was selected by cell size on FSC vs. SSC dot
plots. Analysis was performed using FlowJo software (Tree Star,
Inc). Results are presented in FIG. 32.
Example 15
[0472] Western Blot Procedure: Chemiluminescent Detection of
Tubulin by Western Blot Using HybriLink Antibody-Oligonucleotide
Conjugates.
[0473] Methods:
[0474] Step 1) Cell culture and EGF-stimulation. A431 human
epidermoid carcinoma cells (ATCC) were cultured in Dulbecco's
Modified Essential Medium (High Glucose "DMEM-HI", from HyClone).
DMEM was supplemented with 4 mM L-glutamine (Gemini BioProducts)
and 10% fetal bovine serum (FBS, also from Gemini)
[0475] Cultures were grown to confluence (.about.1.5.times.10.sup.7
cells); supplemented media was removed from cultures by pipette,
monolayers washed once with sterile D-PBS 1.times. (Sigma-Aldrich),
and serum-free "starvation" DMEM was added to cultures for 24 hours
to ensure complete metabolism of supplemental constituents.
[0476] Following treatment, cultures were harvested by manual
dissociation (cell scraper) and transferred to conical tubes, in
which they were pelleted by centrifugation for 5 minutes at 2000
RPM.
[0477] Step 2) Cell lysis and SDS-PAGE sample preparation: Lysis
buffer ("Phospho-Safe", EMD) was supplemented with 1.times. each
protease and phosphatase inhibitor cocktails, plus 5 mM EDTA
(HALT.TM. by Pierce Protein Research Products.)
[0478] 1 mL of ice-cold supplemented lysis buffer was added to each
pellet, and cells were resuspended by vigorous pipetting for one
minute. Suspensions were incubated on ice for 20 minutes with brief
vortexing at 5-minute intervals. Lysates were clarified by
high-speed centrifugation (16,500.times.g for 10 minutes at
4.degree. C.).
[0479] Clarified supernatants were transferred to new sample tubes
and an aliquot of the sample was analyzed for protein concentration
by colorimetric analysis at 562 nm (BCA Assay Kit, Pierce).
[0480] To prepare samples for electrophoresis (SDS-PAGE), a
concentrated Tris-glycerol buffer containing SDS as a denaturant,
.beta.-mercaptoethanol (BME) as a reducing agent, and Bromophenol
Blue as a sample tracking dye, was diluted to 1.times. in clarified
lysate. (All components obtained from Sigma-Aldrich.) Samples were
heated at 95.degree. C. for 5 minutes.
[0481] Step 3) SDS-PAGE and Electrotransfer: 20 .mu.g of protein
lysate was added in duplicate to lanes of a pre-cast polyacrylamide
gel (7% Tris-Acetate, Novex.TM., Invitrogen.) 20 .mu.g of untreated
lysate was loaded side-by-side as a control. Samples were
electrophoresed for 60 minutes at 150 volts in the presence of
tris-acetate electrophoresis buffer (Invitrogen).
[0482] Gels were immobilized on PVDF membrane (Immobilon-P.TM.,
Millipore) by electrotransfer at 30V for 2 hours. Successful
transfer was confirmed by reversible protein stain (Memcode.RTM.,
Pierce).
[0483] Step 4) Membrane Preparation: The membrane was immersed in
99% methanol (Ricca) for 15 seconds and dried on the benchtop for
one hour to fix proteins. It was then rehydrated by brief methanol
immersion followed by soaking in ultrapure water for 2 minutes.
[0484] A membrane blocking solution of 1% BSA in 1.times.
Tris-Buffered Saline plus 0.05% Tween-20 detergent (TBS-T) was
applied to the hydrated membrane for one hour at room temperature
with gentle agitation. (BSA, United States Biological; TBS-T,
prepared from components obtained from Sigma-Aldrich).
[0485] Excess blocking solution was subsequently washed away with
3.times.5 minute rinses of TBS-T. The sample membrane was cut into
identical halves at this point to facilitate comparison of antibody
detection strategies.
[0486] Step 5) Antibody Detection of Immobilized Tubulin: Purified
rat IgG antibody against tubulin was obtained from a commercial
source (Millipore).
[0487] .alpha.-tubulin:HyLk1 conjugate was prepared as described in
Example 10. The conjugate was evaluated against unconjugated
antibody control in a side-by-side Western blot comparison.
[0488] Blots were incubated in 2 .mu.g/mL of either conjugated or
unconjugated .alpha.-tubulin for 1 hour in 5 mL of blocking buffer,
at room temperature with gentle agitation. Excess antibody was
washed away by 3.times.5 minute rinses of TBS-T.
[0489] Step 6) Chemiluminescent Visualization of Anti-Tubulin:
Complementary `secondary` conjugates to the enzyme horseradish
peroxidase (HRP) was added to each membrane for detection by a
chemiluminescent substrate (SuperSignal West.RTM. Pico.TM. ECL
assay kit, Pierce).
[0490] In the method of a standard western blot protocol,
.alpha.-rat IgG:HRP (GE Healthcare) was added to the membrane strip
previously incubated with the unconjugated rat .alpha.-tubulin. For
the HybriLink.TM. western blot, oligonucleotide 1'-HRP conjugate
was added to the membrane previously labeled with
.alpha.-tubulin-HyLk1'.
[0491] HRP-conjugates were added at 100 ng/mL in 20 mL of blocking
buffer and incubated with membranes at room temperature with
rotation. The standard .alpha.-Rat IgG:HRP was incubated according
to manufacturer's protocol for one hour, while the HybriLink
secondary was incubated only briefly (for 15 minutes) in accordance
with the goal of the project, which is to achieve comparable
substrate detection in significantly less time than traditional
methods.
[0492] Excess secondary conjugate was washed away with 3.times.5
minute rinses of TBS-T.
[0493] Chemiluminescent substrate was added to both membranes
according to manufacturer's specifications, for 5 minutes at room
temperature. Excess substrate was blotted away with filter paper
(Whatman) and blots were visualized by exposure to autoradiography
film (Phenix). Film was processed using a Konica developer and
converted to digital image by a Canon document scanner. Results are
presented in FIG. 36.
Example 16
[0494] Adaptor Design: The adapter design is shown in FIG. 37
wherein the Universal sequence is conjugated to the primary
antibody at the 5'-end of the oligonucleotide. The Signal Generator
(AG) is conjugated to the 5'-end of the complementary
oligonucleotide. The adapter's sequence is constructed 5'- to 3'-
to be complementary to the oligonucleotides on both the antibody
and the signal generator. As demonstrated the alternate adapters as
shown in FIG. 38 in which the signal generator is conjugated to the
5'-end of the oligonucleotide can be used. Table 6 below presents
the adapters prepared and tested.
TABLE-US-00009 TABLE 6 HyLk-Universal
Antibody-5'-cctgcgtcgtttaaggaagtac-3' Ab-U/HyLk2'-SG
Antibody-5'-cctgcgtcgtttaaggaagtac-3'//SG-
5'-cttatcgctttatgaccggacc-3' Splint: U'- HyLk 2
5'-ggtccggtcataaagcgataatgTTAATTgtacttccttaaacgacgcagg-3'
Ab-U/HyLk3'-SG Antibody-5'-cctgcgtcgtttaaggaagtac-3'//SG-5'-
cttcacgattgccactttccac-3' Splint: U'- HyLk 3
5'-gtggaaagtggcaatcgtgaagTTAATTgtacttccttaaacgacgcagg-3'
Ab-U/HyLk4'-SG Antibody-5'-cctgcgtcgtttaaggaagtac-3'//SG-5'-
gtatcgcactctatgtcagc-3' Splint: U'/ HyLk 4
5'-gctgacatagqgtgcgatacTTAATTgtacttccttaaacgacgcagg-3'
Ab-U/HyLk5'-SG Antibody-5'-cctgcgtcgtttaaggaagtac-3'//SG-5'-
agtatgcagagacgagcaca-3' Splint: U'- HyLk 5
5'-tgtgctcgtctctgcatactTTAATTgtacttccttaaacgacgcagg-3'
Ab-U/HyLk6'-SG Antibody-5'-cctgcgtcgtttaaggaagtac-3'//SG-5'-
ctgctgcatctcacgtacat-3' Splint: U'- HyLk 6
5'-atgtacgtgatgcagcagTTAATTgtacttccttaaacgacgcagg-3' Table Notes:
CODE: U = Universal; Ab = antibody; HyLk = oligonucleotide name; SG
= signal generator; TTAATT = linker sequence
Example 17
[0495] Infrared Detection of Tubulin by Western Blot Using Antibody
Oligonucleotide Conjugates, adapter oligonucleotides and
complementary oligonucleotide-poly-IR dye conjugates
[0496] Methods:
[0497] A. Cell culture and EGF-stimulation.
[0498] A431 human epidermoid carcinoma cells (ATCC) were cultured
in Dulbecco's Modified Essential Medium (High Glucose "DMEM-HI",
from HyClone.) DMEM was supplemented with 4 mM L-glutamine (Gemini
BioProducts) and 10% fetal bovine serum (FBS, also from Gemini)
[0499] Cultures were grown to confluence (-1.5.times.10.sup.7
cells); supplemented media was removed from cultures by pipette,
monolayers washed once with sterile D-PBS 1.times. (Sigma-Aldrich),
and serum-free "starvation" DMEM was added to cultures for 24 hours
to ensure complete metabolism of supplemental constituents.
[0500] Cultures were then treated with (or without) Epidermal
Growth Factor (EGF, Invitrogen) to stimulate tyrosine
phosphorylation throughout the proteome. EGF was added at 100 ng/mL
in serum-free DMEM containing 1% bovine serum albumin (BSA, United
States Biological) for 7.5 minutes. Mock cultures were incubated
with serum-free media plus 1% BSA without EGF.
[0501] Following treatment, cultures were harvested by manual
dissociation (cell scraper) and transferred to conical tubes, in
which they were pelleted by centrifugation for 5 minutes at 2000
RPM.
[0502] B. Cell lysis and SDS-PAGE sample preparation.
[0503] Lysis buffer ("Phospho-Safe", EMD) was supplemented with
1.times. each protease and phosphatase inhibitor cocktails, plus 5
mM EDTA (HALT.TM. by Pierce Protein Research Products.)
[0504] 1 mL of ice-cold supplemented lysis buffer was added to each
pellet, and cells were resuspended by vigorous pipetting for one
minute. Suspensions were incubated on ice for 20 minutes with brief
vortexing at 5-minute intervals. Lysates were clarified by
high-speed centrifugation (16,500.times.g for 10 minutes at
4.degree. C.).
[0505] Clarified supernatants were transferred to new sample tubes
and an aliquot of each sample (EGF-treated vs. untreated) was
analyzed for protein concentration by colorimetric analysis at 562
nm (BCA Assay Kit, Pierce).
[0506] To prepare samples for electrophoresis (SDS-PAGE), a
concentrated Tris-glycerol buffer containing SDS as a denaturant,
.beta.-mercaptoethanol (BME) as a reducing agent, and Bromophenol
Blue as a sample tracking dye, was diluted to 1.times. in clarified
lysate. (All components obtained from Sigma-Aldrich.) Samples were
heated at 95.degree. C. for 5 minutes.
[0507] C. SDS-PAGE and Electrotransfer.
[0508] 20 .mu.g of protein from EGF-treated lysate was added in
duplicate to lanes of a pre-cast polyacrylamide gel (7%
Tris-Acetate, Novex.TM., Invitrogen.) 20 .mu.g of untreated lysate
was loaded side-by-side as a control. Samples were electrophoresed
for 60 minutes at 150 volts in the presence of tris-acetate
electrophoresis buffer (Invitrogen).
[0509] Gels were immobilized on PVDF membrane (Immobilon-P.TM.,
Millipore) by electrotransfer at 30V for 2 hours. Successful
transfer was confirmed by reversible protein stain (Memcode.RTM.,
Pierce).
[0510] D. Membrane Preparation.
[0511] The membrane was immersed in 99% methanol (Ricca) for 15
seconds and dried on the benchtop for one hour to fix proteins. It
was then rehydrated by brief methanol immersion followed by soaking
in ultrapure water for 2 minutes.
[0512] A membrane blocking solution of 1% BSA in 1.times.
Tris-Buffered Saline plus 0.05% Tween-20 detergent (TBS-T) was
applied to the hydrated membrane for one hour at room temperature
with gentle agitation. (BSA, United States Biological; TBS-T,
prepared from components obtained from Sigma-Aldrich.)
[0513] Excess blocking solution was subsequently washed away with
3.times.5 minute rinses of TBS-T. The sample membrane was cut into
identical halves at this point to facilitate comparison of antibody
detection strategies.
[0514] E. Antibody Detection of Immobilized Tubulin.
[0515] Purified tubulin antibody from rat .alpha.-tubulin, clone
YL1/2) was obtained from a commercial source (Millipore).
[0516] .alpha.-tubulin-HyLk1 conjugate was prepared as described in
Example 10. The .alpha.-tubulin-HyLk1 conjugate was evaluated
against unconjugated antibody control by side-by-side western blot
comparison.
[0517] Blots were incubated in 2 .mu.g/mL of either conjugated or
unconjugated .alpha.-tubulin for 1 hour at room temperature in 5 mL
of blocking buffer, with gentle agitation. Excess antibody was
washed away by 3.times.5 minute rinses of TBS-T.
[0518] F. Visualization of Tubulin using Infrared Dye-Conjugated
Secondary Detectors.
[0519] Infrared detection of tubulin at 800 nm was conducted using
either unconjugated control antibodies and anti-host infrared
secondary detectors, or oligo-conjugated antibodies and
oligo-infrared dye conjugate secondary probes.
[0520] Procedure was conducted as described in (A)-(E), except that
the blotting membranes used for infrared detection were blocked in
a proprietary buffer (Odyssey.RTM. Blocking Buffer, LI-COR
Biosciences) rather than in 1% BSA-TBST. The membranes were blocked
for one hour at room temperature, regardless of buffer.
[0521] Tubulin antibodies were applied as described in (E).
[0522] Infrared-dye conjugated host IgG antibodies (LI-COR
Bioscience) were applied to control membranes labeled by
unconjugated antibodies. IR800 dye (LI-COR Bioscience) conjugated
to oligo sequence HyLk1' was applied to membranes labeled by
.alpha.-tubulin-HyLk1.
[0523] Secondary conjugates were diluted at 1:10,000 in appropriate
blocking buffer, supplemented with 0.2% Tween and 0.02% SDS, per
manufacturer protocol. Blots were incubated for one hour at room
temperature, and excess detector was removed by 3 washes of
TBS-T.
[0524] Imaging was conducted using the Odyssey.RTM. Infrared
Imaging System (LI-COR Bioscience).
[0525] G. Using Oligonucleotide Adapter Sequences to Visualize
Tubulin Using Nonspecific Secondary Detectors.
[0526] Infrared detection of tubulin was conducted as described in
Sections (A)-(G), except that the tubulin antibody used was
conjugated to HyLk1 rather than HyLk2.
[0527] Oligonucleotide sequence adapter [HyLk1'-HyLk2] was applied
after antibody labeling with .alpha.-tubulin-HyLk1. Adapter was
diluted at 100 ng/mL in blocking buffer and incubated on the
membrane for 15 minutes at room temperature. Excess oligo adapter
was removed by 3.times.5 minute washes of TBS-T.
[0528] Detector conjugate HyLk2'-poly-IR800CW was applied as
described in (G). Labeled tubulin was imaged at 800 nm using the
Odyssey.RTM. Infrared Imaging System. Results are presented in FIG.
39.
Example 18
[0529] Flow cytometry Using Oligonucleotide Adapters to Facilitate
Staining of Antibody-Oligo Conjugates by Non-Complementary
Oligo-Dye Detectors.
[0530] Methods:
[0531] A. Splenic leukocyte sample preparation.
[0532] Spleen from a B6 mouse was processed into a single cell
suspension. Erythrocytes were lysed by hypotonic solution.
Leukocytes were counted and suspended overnight in a culture medium
consisting of DMEM (HyClone) with 5% fetal bovine serum
(Invitrogen), 1% HEPES (Sigma-Aldrich), 1% non-essential amino
acids solution (Sigma-Aldrich), 1% penicillin/streptomycin
antibiotic (Invitrogen), and 0.00033% .beta.-mercaptoethanol (GE
Healthcare).
[0533] Samples were prepared the following day at a density of
6.0.times.10.sup.5 cells/mL. Culture medium was removed by washing
2.times. in FACS buffer (D-PBS 1.times. with 0.2% BSA and 0.012%
sodium azide). (Buffer components obtained from Sigma-Aldrich.)
[0534] Throughout this procedure, wash steps were conducted by
centrifugation of samples for 5 minutes at 2000.times.g, followed
by resuspension in 5000 .mu.L of FACS buffer.
[0535] B. Antibody labeling.
[0536] Antibody against T-cell co-receptor CD4 (clone GK1.5) was
purified from mouse hybridoma supernatant and supplied in a buffer
of dialyzed PBS (University of Chicago, Fitch Monoclonal Antibody
Facility).
[0537] .alpha.-CD4 antibody-HyLk1 conjugate was prepared as
described in Example 12-A.
[0538] Prior to addition of .alpha.-CD4HyLk1 conjugate to leukocyte
samples, non-specific binding of IgG to the Fc.delta. receptor was
blocked by the addition of 20 .mu.L supernatant from an
.alpha.-Fc.delta.R producing hybridoma culture, clone 2.4G2
(University of Chicago, Fitch Monoclonal Antibody Facility.)
[0539] Antibody-oligonucleotide conjugate was then added at 1
.mu.g/sample in 500 .mu.L of FACS buffer and incubated for 30
minutes at 4.degree. C.
[0540] Excess antibody conjugate was removed by 2 washes of FACS
buffer.
[0541] C. Use of oligonucleotide adapters to facilitate cell
staining.
[0542] Samples to be stained by non-complementary HyLk4':Dy649 were
first incubated with an oligonucleotide adapter of the structure
[HyLk1':TTAATT: HyLk4].
[0543] Forward (5'->3') and reverse (3'->5') adapters were
used in a 1:1 ratio to ensure a variety of structural orientations
of the free HyLk4 sequence for detection by HyLk4':Dy649.
[0544] The adapter was applied at 2 .mu.g/sample in 100 .mu.L of
FACS buffer for 15 minutes at room temperature.
[0545] Excess adapter was removed by 2 washes of FACS buffer.
[0546] D. Cell staining with oligonucleotide-poly-fluorochrome
detector conjugates.
[0547] Following incubation with or without adapters, the samples
were stained by oligonucleotide-poly-fluorochrome detector
conjugates. Control samples were stained with complementary
detector HyLk1':Dy490. Adapter-modified samples were stained with
non-complementary detector HyLk4':Dy649.
[0548] Detectors were added at 30 ng/sample in 100 .mu.L FACS
buffer and incubated for 15 minutes at room temperature in the
dark.
[0549] Excess detector was removed by 2 washes of FACS buffer.
Samples were transferred to sterile, 12.times.75 mm tubes for flow
cytometry (BD Falcon.RTM.) at a final suspension of approximately
3.times.10.sup.5 cells in 5000 .mu.L FACS buffer.
[0550] E. Analysis by flow cytometry.
[0551] Samples were analyzed using a FACScanto.TM. flow cytometer,
raw data files were acquired with FACSDiva.TM. software (BD), and
files were interpreted using FlowJo software (TreeStar). Results
are presented in FIG. 40.
Example 19
[0552] Immunocytochemical visualization of microtubules using
HybriLink.TM. oligonucleotide conjugates
[0553] Methods.
[0554] A. Cell culture.
[0555] Human epidermoid carcinoma cell line A431 (American Type
Culture Collection) is an adherent cell line exhibiting normal
microtubule function throughout the cell cycle.
[0556] Cells were cultured in a medium consisting of DMEM (HyClone)
with 10% fetal bovine serum (Invitrogen) supplemented with 4 mM
stabilized L-glutamine (Gemini BioSciences).
[0557] After being grown to log phase, the culture monolayer was
dissociated by 0.25% trypsin--53 mM EDTA (Invitrogen) in Hank's
balanced salt solution (HBSS, Invitrogen). After recovery of cells
by centrifugation, approximately 1.8.times.10.sup.4 cells in 100
.mu.L culture medium were added to each well of an optical-glass
based, culture treated, black 96-well plate (Corning
CoStar.RTM.).
[0558] Plated cells were incubated overnight to allow complete
adherence to the glass surface.
[0559] B. Sample preparation for labeling.
[0560] After one wash to remove culture medium in Dulbecco's Ca-
and Mg-free PBS (DPBS, Sigma-Aldrich), cells were prepared for
antibody labeling.
[0561] Microtubules were stabilized by a 30 second extraction in a
buffer consisting of 80 mM PIPES, 5 mM EGTA, 1 mM MgCl.sub.2, and
0.5% Triton-X-100 (components from Sigma-Aldrich). Cells were
washed once in DPBS, and fixed by 5 minute incubation in ice-cold
methanol (Ricca Chemical).
[0562] Fixed cells were rehydrated by 3.times.5 minute washes of
Tris-buffered saline with 0.05% Tween.RTM.-20 (TBS-T,
Sigma-Aldrich).
[0563] Non-specific binding of antibody was blocked by incubating
for one hour in 1% BSA-DPBS at room temperature (BSA Fraction V, US
Biological).
[0564] C. Target labeling with antibody.
[0565] To label microtubules, a rat IgG antibody against .alpha.-
and .beta.-tubulin (Millipore) was used. The antibody was
conjugated to HyLk1 using the chemistry described in herein.
[0566] Cells were labeled by anti-tubulin-HyLk1 conjugate at a
concentration of 10 .mu.g/mL in 1% BSA-DPBS for two hours at room
temperature.
[0567] Excess antibody conjugate was removed by 3.times.5 minute
washes of DPBS.
[0568] D. Antibody detection by oligonucleotide:dye conjugate.
[0569] Detector HyLk1'-poly-Dy490 prepared as described in Example
12-A was applied to anti-tubulin-HyLk1 labeled cells at a
concentration of 2 .mu.g/mL in 1% BSA-DPBS for 30 minutes at room
temperature in the dark.
[0570] After 3.times.5 minute washes of DPBS, cell nuclei were
counterstained for 5 minutes in a solution of 0.5 .mu.g/mL DAPI
(Sigma-Aldrich) and post-fixed for 15 minutes in 10%
neutral-buffered formalin (Sigma-Aldrich) to preserve dye stability
for long-term sample viewing.
[0571] E. Observation.
[0572] Labeled microtubules were observed at 40.times.
magnification with a FITC filter set on an AxioVert 40 CFL
fluorescence-DIC microscope (Zeiss). Whole cells were viewed at
40.times. magnification by brightfield DIC microscopy. Images were
acquired with AxioVision.RTM. software (Zeiss). Results are
presented in FIGS. 52 and 53.
Example 20
[0573] Immunocytochemical visualization of microtubules using
HybriLink.TM. oligonucleotide conjugates.
[0574] Methods.
[0575] A. Cell culture. Human epidermoid carcinoma cell line A431
(American Type Culture Collection) is an adherent cell line
exhibiting normal microtubule function throughout the cell cycle.
Cells were cultured in a medium consisting of DMEM (HyClone) with
10% fetal bovine serum (Invitrogen) supplemented with 4 mM
stabilized L-glutamine (Gemini BioSciences). After being grown to
log phase, the culture monolayer was dissociated by 0.25%
trypsin-53 mM EDTA (Invitrogen) in Hank's balanced salt solution
(HBSS, Invitrogen). After recovery of cells by centrifugation,
approximately I.8.times.I 04 cells in I 00 f. 1L culture medium
were added to each well of an optical-glass based, culture treated,
black 96-well plate (Corning CoStar.RTM.). Plated cells were
incubated overnight to allow complete adherence to the glass
surface.
[0576] B. Sample preparation for labeling. After one wash to remove
culture medium in Dulbecco's Ca- and Mg-free PBS (DPBS,
Sigma-Aldrich), cells were prepared for antibody labeling.
Microtubules were stabilized by a 30 second extraction in a buffer
consisting of 80 mM PIPES, 5 mM EGTA, 1 mM MgCh, and 0.5%
Triton-X-100 (components from SigmaAldrich). Cells were washed once
in DPBS, and fixed by 5 minute incubation in ice-cold methanol
(Ricca Chemical). Fixed cells were rehydrated by 3.times.5 minute
washes of Tris-buffered saline with 0.05% Tween.RTM.-20 (TBS-T,
Sigma-Aldrich). Non-specific binding of antibody was blocked by
incubating for one hour in 1% BSADPBS at room temperature (BSA
Fraction V, US Biological).
[0577] C. Target labeling with antibody. To label microtubules, a
rat IgG antibody against a- and .about.-tubulin (Millipore) was
used. The antibody was conjugated to HyLk 1 using the chemistry
described in herein. Cells were labeled by anti-tubulin-HyLk I
conjugate at a concentration of 10 flg/mL in 1% BSA-DPBS for two
hours at room temperature. Excess antibody conjugate was removed by
3.times.5 minute washes of DPBS.
[0578] D. Antibody detection by oligonucleotide:dye conjugate.
Detector HyLk1'-poly-Dy490 prepared as described in Example 12 was
applied to anti-tubulin-HyLk1 labeled cells at a concentration of 2
flg/mL in 1% BSA-DPBS for 30 minutes at room temperature in the
dark. After 3.times.5 minute washes of DPBS, cell nuclei were
counterstained for 5 minutes in a solution of 0.5 .about.tg/mL DAPI
(Sigma-Aldrich) and post-fixed for 15 minutes in 10%
neutralbuffered formalin (Sigma-Aldrich) to preserve dye stability
for long-term sample viewing.
[0579] E. Observation. Labeled microtubules were observed at
40.times. magnification with a FITC filter set on an AxioVert 40
CFL fluorescence-Die microscope (Zeiss). Whole cells were viewed at
40.times. magnification by brightfield DIC microscopy. Images were
acquired with AxioVision.RTM. software (Zeiss). Results are
presented in FIGS. 52 and 53.
Example 21
[0580] Prophetic Example of Brightness Tuning
[0581] In the development of a flow cytometry assay it is desired
to detect and quantify two biological targets, Target A and Target
B, employing two spectrally adjacent detection channels,
Channel
[0582] A and Channel B, respectively, where Target A is highly
abundant in the sample and Target B is of significantly lower
abundance, such that when employing two maximally labeled
antibodies, anti-A and anti-B, spillover of the optical signal from
anti-A into Channel B artifactually reduces the detectability of
Target B. Since the intensity of the signal from anti-A is more
than sufficient in this assay, reducing the degree of labeling
(number of fluorophores per antibody molecule) of anti-A--and,
optionally, increasing the degree of labeling of anti-B--can
improve the detectability of Target B without significantly
affecting the detectability of Target A.
[0583] A collection of separately contained reagents is provided to
determine the degrees of labeling of anti-A and anti-B which best
optimizes the detectability of Target B without unacceptably
reducing the detectability of Target A. This collection comprises a
tube of anti-A conjugated to an oligonucleotide, a tube of anti-B
conjugated to the same oligonucleotide, three tubes each containing
the complementary oligonucleotide conjugated to two, six, or ten
Pacific Blue fluorophore moieties (PB-2, PB-6, and PB-10,
respectively), and three tubes each containing the complementary
oligonucleotide conjugated to two, six, or ten FITC fluorophore
moieties (FITC-2, FITC-6, and FITC-10, respectively).
[0584] In separately contained reactions, three aliquots of anti-A
are hybridized with aliquots of PB-2, PB-6, and PB-10,
respectively, yielding the molecular probes anti-A:PB-2,
anti-A:PB-6, and anti-A:PB-10 (hereinafter referred to for the sake
of brevity as A:2, A:6, and A:10), and three aliquots of anti-B are
hybridized with aliquots of FITC-2, FITC-6, and FITC-10,
respectively, yielding the molecular probes anti-B:FITC-2,
anti-B:FITC-6, and anti-B:FITC-10 (hereinafter referred to as B:2,
B:6, and B:10).
[0585] Nine identical aliquots of a sample of the cells of interest
are labeled with each of the nine possible two-way combinations of
the molecular probes (A:2+B:2, A:2+B:6, . . . , A:10:B10), and the
nine labeled cell aliquots are then separated evaluated via flow
cytometry to determine the one two-way combination of molecular
probes which optimally detects and quantifies the abundances of
Target A and Target B in the sample.
[0586] Subsequent to this assay development study, the optimal
two-way combination of the two molecular probes thus identified is
employed in assays to determine the presence and abundance of
Targets A and B in samples comprising this cell type.
Example 22
[0587] Prophetic Example of Labeled Antibody Catalog
Simplification:
[0588] A vendor of primary-labeled antibodies whose catalog
includes 800 antibodies and 30 fluorophores wishes to provide
customers with the widest possible choice of antibody-fluorophore
combinations without the necessity of manufacturing and marketing
800.times.30=24,000 different products. The vendor therefore
manufactures and markets each of its 800 antibodies as conjugates
with a first oligonucleotide, and each of its 30 fluorophores as
conjugates with a second, complementary oligonucleotide, for a
total of 830 products. A customer may purchase any antibody-oligo
product in the vendor's catalog, any fluorophore-oligo product in
the vendor's catalog, and assemble them via hybridization into any
arbitrary fluorophore:antibody combination via a simple
hybridization reaction.
Example 23
[0589] In standard solid phase oligonucleotide synthesis the purity
of the crude oligonucleotide, either deoxy, RNA or modified
backbone-based oligonucleotides, may be approximately 80-90%
depending in part on the length of the oligonucleotide as the yield
of each step approximately 98-99%. The amount of failure sequences
may increase as the length of the oligonucleotide increases.
Chromatographic purification of the oligonucleotide, by either
reverse phase (RP) or ion exchange (IEX), is used to increase the
purity of the oligonucleotide however due to their poor resolution
only marginally increase the purity at significant loss of yield.
The yield of the oligonucleotide following chromatographic
purification is typically 30-70% and methods are laborious and
require expensive chromatographic equipment. There is a need to
prepare oligonucleotides of high purity inexpensively and in high
yields without the use of chromatographic equipment.
[0590] In most conjugation reaction it would be advantageous to
have a linkable oligonucleotide that is of 90% or greater purity so
that a higher proportion of oligonucleotide conjugates to the
biomolecule or surface being modified resulting in a product that
contains less unconjugated oligonucleotide. This would allow easier
purification of the product or in some assays where unconjugated
oligonucleotide does not substantially interfere with the assay a
crude product can be used directly. Certain embodiments disclosed
herein are directed to the situation where the linkable group
incorporated on the oligonucleotide is an aromatic aldehyde
derivative, 4-formylbenzaldehyde (4FB). FIG. 69 presents an
exemplary synthetic scheme that may be used to prepare 4FB-modified
oligonucleotides.
[0591] In this example, we demonstrate methods in which
4FB-oligonucleotides can be purified by immobilization on
hydrazide-beads, washing away the failure sequences and releasing
the 4FB-oligonucleotide from the hydrazide-beads using acidic
buffer containing, sulfo-benzaldehyde and aniline (see FIG. 70).
The highly purified 5'-4FB oligonucleotide is prepared by (1)
immobilizing the 5'-4FB-oligonucleotide on hydrazide beads using
acidic buffer, pH 5-6, including 25 to 100 mM, for example 50 mM
aniline, (2) wash the beads to remove failure sequences, (3)
release the 5'-4-FB-oligonucleotide from the bead using a solution
of sulfo-benzaldehdye and aniline in buffer, pH 6.0 and (4)
exchanging the oligonucleotide into buffer of choice by
diafiltration, dialysis or other methods known to those skilled in
the art. In certain applications, the aniline may be replaced by
other acceptable amino-benzene derivatives. The overall purity of
the oligonucleotide isolated by this process is equal to or greater
than 93% and the yield of highly purified oligonucleotide is
approximately 70-80% based on total oligonucleotide loaded on the
beads. This method is generally applicable to aromatic
aldehydes-modified oligonucleotides or other aromatic
aldehyde-modified biomolecules, surfaces, polymers, molecules or
combinations thereof.
[0592] Example 23 illustrates procedures using purified
4FB-oligonucleotides that result in 90% or greater conjugation of
input oligonucleotide on HyNic-modified antibodies. FIGS. 71A
(purified 4FB-oligo) and 71B (crude 4FB-oligo) presents results
demonstrating the efficiency of the conjugation of
4FB-oligonucleotides to a HyNic-modified antibody and FIG. 72
presents results of linking and a 4FB-oligonucleotide to a
HyNic-modified peptide.
[0593] 4FB-Oligonucleotide Purification:
[0594] Oligo 5'-4FB-CLINK20-A (61 mg; MW 6443; sequence
5'-4FB-GGAAGCGGTGCTATCCATCT) was dissolved in Conjugation Buffer
(100 mM phosphate, 150 mM NaCl, pH 6.0; 3 mL; final concentration
0.491 OD/uL). Carbolink Beads (1 mL; ThermoPierce, Rockford, Ill.)
were prewashed with Conjugation Buffer (3.times.5 mL). To the
washed Carbolink beads was added 5'-4FB-CLINK20-A (200 ODs) and the
mixture was placed in a 40.degree. C. water bath for 2 h with
shaking every 30 minutes then allowed to stand overnight at room
temperature. The beads were washed with Conjugation Buffer
(5.times.5 mL; the combined washes were retained) The immobilized
oligonucleotide was dissociated from the bead by three treatments
with a solution of 50 mM sulfo-benzaldehyde and 120 mM aniline in
Conjugation Buffer (.times.mL) and incubation at 40.degree. C. for
2 h and a final incubation overnight at room temperature. The
combined washings were concentrated using a 3K MWCO Vivaspin
diafiltration device (Sartorius Stedim) and washed with water.
Table 7 presents the yields for the recovered unbound and bound and
released oligonucleotides.
TABLE-US-00010 TABLE 7 % ODs 4FB-MSR recovered Initial 200.0 0.85
Unbound recovered 18.1 0.05 8.1 Bound and released 157.8 1.03 79.0
recovered
[0595] Conjugation of Purified 4FB-Oligonucleotide to
HyNic-Modified IgG:
[0596] IgG (100 ug at 1 mg/mL) was buffered exchanged into
Modification Buffer (100 mM phosphate; 150 mM NaCl, pH 8.0) using a
0.5 mL 40K MWCO Zeba Spin Desalting Column (ThermoPierce, Rockland,
Ill.). The recovered protein concentration was confirmed by
determining its A280 absorbance using a NanoDrop 1100
spectrophotometer. To the antibody solution was added S-HyNic (35
mol equivalents) in DMF (xx uL) and incubated at room temperature
for 3 h. The HyNic-modified IgG was desalted into Conjugation
Buffer (100 mM phosphate, 150 mM NaCl, pH 5.0) containing 25 mM
aniline using a 0.5 mL 40K MWCO Zeba column pre-equilibrated with
the Conjugation Buffer/aniline buffer. To the HyNic-IgG was added
purified 4-FB-CLINK20-A oligonucleotide in x uL water and incubated
at room temperature for 3 h. The product was desalted into PBS, pH
7.2 containing 1 mM EDTA and 0.05% azide using a 0.5 mL 40K MWCO
Zeba column. Table 8 presents the results of three modifications
with three different antibodies. The protein concentration was
determined by Bradford protein assay. The MSR and the number of
oligos/antibody were determined by AUC of analytical SEC
chromatogram (see, for example, FIGS. 71A and 71B) using
SuperDex200 column (GE Healthcare, Piscataway, N.J.).
TABLE-US-00011 TABLE 8 Conc Amount Free Oligo Conjugated Conc Yield
Antibody (mg/mL) (ug) (%) (%) MSR (mg/mL) (%) Herceptin 1.0 100 4.0
96.0 3.84 0.89 89 CD4 1.0 100 6.9 91.2 3.65 0.80 80 CD8 1.0 100 7.0
93.0 3.72 0.87 87
[0597] FIG. 69 illustrates a scheme for the incorporation of
4FB-moiety using a 4FB-phosphoamidite (A) on the 5'-end of an
oligonucleotide during its solid phase synthesis. FIG. 70
illustrates a schematic representation of the process used to
purify 4FB-oligonucleotides as described in Example 23. Results are
shown in FIG. 71A for conjugation of a 4FB-20mer oligonucleotide (4
mol equiv) to a HyNic-modified antibody (FIG. 71A) and in FIG. 71B
for a crude 4FB-20mer oligonucleotide (5 mol equiv) to a
HyNic-modified antibody using the method described herein.
[0598] Conjugation of Purified 4FB-Oligonucleotide to
HyNic-Peptide:
[0599] To two separate tubes containing 20 mer 5'-5-4FB-GGA AGC GGT
GCT ATC CAT CT-3' (100 ug; 3.01 OD; 0.15 OD/uL) in Conjugation
Buffer (20.04 uL; 100 mM phosphate, 150 mM NaCl. pH 6.0) was added
HyNic-Peg2-c-Myc peptide (Solulink Biosciences, San Diego, Calif.)
1.5 and 3.0 mol equivalents at 4 mg/mL in water respectively
followed by the addition of 1/10 volume of TurboLink Buffer (100 mM
aniline, 100 mM phosphate, 150 mM NaCl, pH 6.0; Solulink
Biosciences). The reactions were incubated at room temperature for
2 h then 48 h at 4.degree. C. The reactions were analyzed by PAGE
and the results are shown in FIG. 72. FIG. 72 shows a PAGE gel of
the conjugation of a 20mer 4FB-oligonucleotide purified (Lane 2) to
a HyNic-Peg2-9mer peptide (1.5 mol equiv (Lane 3) and 3.0 mol equiv
(Lane 4)). This gel was developed using Sybr gold.
Example 24
[0600] Amino-oligonucleotide-HyNic Modification:
[0601] FIG. 76 illustrates an exemplary step wise protocol that may
be used to capture and detect an antigen from a biological sample,
according to certain embodiments, wherein an antibody
oligonucleotide conjugate is preassembled on a bead immobilized
with its complementary oligo. The amino-oligonucleotide was
desalted into SE Modification Buffer (100 mM Phosphate, 150 mM
NaCl, 100 mM Sodium Sulfate, 10 mM EDTA, pH 7.4) using a 3 KD MWCO
VivaSpin column (4.times.), the concentration was adjusted between
0.2-0.5 OD/ul. To the volume of amino-oligonucleotide was added a
1/2 volume of DMF followed by addition of S-HyNic (25 equivalents
in DMF). The reaction was incubated at room temperature for 2
hours, diluted to 400 ul with SE Conjugation Buffer (100 mM
Phosphate, 150 mM NaCl, 100 mM Sodium Sulfate, 10 mM EDTA, pH 6.0)
and desalted using 3 KD MWCO VivaSpin column (4.times.). The MSR of
HyNic-modified oligonucleotide was determined by mixing
HyNic-oligonucleotide with 2-sulfo-benzaldhyde (SBA) reagent (0.5
mM 2-SBA in 0.1M MES buffer) and incubating at 40.degree. C. for 1
hour, hydrazone formed between HyNic and 2-SBA forms a chromophoric
hydrazone that absorbs at 350 nm with a molar extinction
coefficient of 24500, and 260 nm (oligonucleotide) on a
Spectrophotometer (NanoDrop, ND-1000) are measured and MSR
calculated are shown in Table 1 (MSR of HyNic modified
oligonucleotides). The OD/ul of the purified HyNic-oligonucleotide
is measured and used directly in the following conjugation
reaction.
TABLE-US-00012 TABLE 9 MSR Name (M1/M2) HyNic-HyLk1' 0.92
HyNic-HyLk2' 0.73 HyNic-HyLk3' 0.75
[0602] 4FB-Compel beads preparation: Compel beads (Bangs
Laboratories Inc., 6.3 um) (100 mg in 2.04 ml) were washed with 8
ml MES Activation Buffer (0.1M MES, 0.5 M NaCl, pH 6.0) (2.times.)
using a magnetic rack. 41.39 mg of EDC (Quanta Bio, Cat #10025, lot
#BV34012) was weighed and dissolved in 300 ul HyClone H2O. 43.98 mg
of Sulfo-NHS is dissolved into 1.5 ml of 1.times.MES Buffer (0.1M
MES, pH 5.0). To Compel beads was added EDC and Sulfo-NHS solutions
prepared as above and reaction incubated at room temperature for
about 20 minutes on a rotator followed by washing with 10 ml of MES
Activation Buffer (4.times.). To the washed beads was added 9 ml of
0.5 Methylenediamine in Borate Buffer (0.1M Borate Buffer, pH 8.0)
and the reaction was incubated at room temperature for about 2
hours on the rotator followed by washing with 10 ml of Modification
Buffer (100 mM Phosphate, 150 mM NaCl, pH 7.4) containing 0.05%
Tween-20 (3.times.), Hyclone H2O 2O (3.times.), and Modification
Buffer only (3.times.). To the washed beads was added Sulfo-4FB
solution (53.37 mg in 944.3 ul Modification Buffer), the reaction
was mixed by vortex and incubated at room temperature for about 2
hours on rotator followed by washing with 10 ml Conjugation Buffer
(100 mM Phosphate, 150 mM NaCl, pH 6.0)/0.05% Tween-20 (3.times.),
then Conjugation Buffer alone (6.times.), the concentration of the
beads was subsequently determined. Serial dilutions were prepared
from native Compel beads at the following concentrations: 1250,
625, 312, 156 and 78 ug/ml in Hyclone H2O, 200 ul of each solution
was added to each well, standards in single well and sample in
duplicate, OD at 600 nm was recorded and concentration of beads
determined according to standards using SOFTmaxpro software (6.8
mg/ml). To measure the 4FB-binding capacity of modified beads, 44.1
uM 4-hydrazino-stibazole (SigmaAldrich) solution was prepared in
0.1M MES Buffer/0.25 M NaCl and 100 ul was added to 100 ug of
4FB-Compel beads and native Compel beads, the reactions were
incubated at room temperature for about one hour on a shaker and
supernatant collected following centrifugation at 14,000 g for 4
minutes. 4-Hydrazino-stibazole binds to 4FB on beads to form a
hydrazone (absorbance 350 nm, molar extinction coefficient 28500).
Based on the reduction of 4-hydrazino-stibazole in the supernatant,
4FB-binding capacity of Compel beads was calculated to be 7.2
nmole/mg. These 4FB-Compel beads were used in the following
experiments.
[0603] HyNic-oligonucleotide/4FB-compel beads conjugation: To the 3
mg 4FB-Compel beads was added HyNic-oligonucleotide (5.725 nmol/mg
beads) in SE Conjugation Buffer followed by the addition of 1/10 of
volume of TurboLink Buffer (100 mM aniline, 100 mm phosphate, 150
mM NaCl, pH 6.0). The reactions were incubated for 16 hours on a
shaker. Unconjugated oligonucleotides were removed from Compel
beads by washing with PBS-T (10 mM phosphate, 150 mM NaCl, pH
7.4)/0.05% Tween-20) (3.times.) and PBS (1.times.) and re-suspended
into PBS at 3 mg/ml. The immobilized oligonucleotides on beads were
quantified as following:
[0604] General procedure to quantify the amount of oligonucleotide
immobilized on beads: The following example is representative of
the protocol used.
[0605] Step 1) Complementary oligonucleotide/Dy490 modification.
Amino-HyLk1 was desalted (4.times.) using a 3 KD MWCO VivaSpin
column into Modification Buffer followed by adjusting the
concentration to 0.5-0.6 OD/ul. To Amino-HyLk1 (10.5 OD in 18.6 ul;
0.56 OD/ul) was added a solution of Dy490 in anhydrous DMF (0.75 mg
in 10 ul; 15 mol equiv) as shown in Table 10. The reaction mixture
was incubated at room temperature for about 3 hours then desalted
into PBS buffer using a 3 KD MWCO column (9.times.) until the flow
through was clear of fluorescence. The % Dy490 incorporation on the
oligonucleotides was determined by OD readings at 490 nm and 260 nm
on a Spectrophotomemter (NanoDrop, ND-1000), as a peak is formed by
modified Dy490 at 490 nm (OD 260 nm correction factor 0.235). The
MSR of Dy490-modified oligonucleotides are listed in Table 10
(Oligonucleotides modified with Dy490). The OD/ul is determined and
adjusted to 0.2 OD/ul and used in the following hybridization
procedure.
TABLE-US-00013 TABLE 10 Oligo MSR HyLk1 1.06 HyLk2 1.03 HyLk3
0.98
[0606] Step 2) Hybridization of Compel beads-HyLkX' with
Dy490-HyLkX: 50 ug Compel-HyLkX' beads were washed with PBS-T
(1.times.) then PBS (1.times.), centrifuged at 5000 g for 5 minutes
to remove the supernatant. A 400 nM Dy490-HyLkX solution was
prepared in PBS. To the Compel-HyLkX' beads the Dy490-HyLkX
solution was added. The Dy490-HyLkX solution in the absence of
beads or that received 4FB-compel beads without oligonucleotide
conjugated were included as controls. The hybridization reaction
was incubated at room temperature for 30-60 minutes on a shaker.
Following centrifugation at 5000 g for 5 minutes, supernatant was
collected for measuring fluorescence in solution and beads were
washed with PBS/0.05% Tween-20 (2.times.) and PBS (1.times.) and
subjected to FACS acquisition.
[0607] Step 3) Creation of a Dy490 standard curve using Dy490 NHS
Ester: A 0.5 mg/ml solution of Dy490 in DMF was prepared. A 4000 nM
Dy490 NHS Ester solution was prepared in PBS and 1:1 serial
dilutions were prepared at the following concentrations: 4000,
2000, 1000, 500, 250, 125 and 62.5 nM. Each concentration was read
on a fluorescence spectrophotometer (NanoDrop 3300) five times to
create a linear standard curve for Dy490 fluorescence.
[0608] Step 4) The amount of HyLkX-Dy490 hybridized to the beads
was determined using the following procedure: The fluorescence of
the supernatant was measured and subtraction of concentration of
each sample from the concentration of Dy490-HyLkX solution in the
absence of beads to obtain the reduction of Dy490-HyLkX in each
sample, yielded the amount of oligonucleotides being hybridized
onto the beads, based on the fact that 50 ug beads in each sample
are tested, immobilized oligonucleotides on beads in nmol/mg were
calculated and listed in Table 11 (Oligonucleotides immobilized on
Compel beads).
TABLE-US-00014 TABLE 11 Compels Immobilized oligonucleotides Name
Beads (mg) (nmol/mg) HyLk1' 3 1.09 HyLk2' 3 1.02 HyLk3' 3 0.79
[0609] Step 5) Quantification of immobilized oligonucleotides on
beads by FACS. Hybridized Compel beads were subjected to FACS
acquisition after washing and 20,000 events collected under an
appropriate setting. Results were analyzed as peak appeared on FL1
and "mean fluorescence intensity" (MFI) of each beads sample
compared.
[0610] Protocol for preparation of a protein/oligonucleotide.
[0611] Step 1) BSA-HyNic modification: BSA (Jackson Immuno
Research) solution was prepared at 10 mg/ml initial concentration
and desalted to modification buffer using a 5 ml 7 KD MWCO Zeba
column, the concentration was adjusted to 5 mg/ml after desalting.
To the solution of BSA (3.6 ml of a 5 mg/ml solution) was added a
solution of S-HyNic (71.4 ul of a 22.6 mg/ml solution in anhydrous
DMF; 20 mol equiv). The reaction was gently vortexed and then
incubated at room temperature for about 3 hours. The reaction
mixture was desalted into conjugation buffer using a 10 ml 40 KD
MWCO Zeba column and the concentration of BSA determined by BCA
assay. The MSR of BSA-HyNic was 10.4.
[0612] Step 2) BSA-HyLkX conjugation using BSA-HyLk1 as the
example: To HyNic-BSA (1.6 ml of 3.37 mg/ml in conjugation buffer)
prepared in Step 1 was added 4FB-HyLk1 (Trilink, 4FB MSR 0.51) (158
ul of 0.642 OD/ul in conjugation buffer; 3 functional mole
equivalent) and a 1/10 of volume of TurboLink Buffer (100 mM
aniline, 100 mM phosphate, 150 mM NaCl, pH 6.0) was added. The
reaction was mixed and incubated at room temperature for about 2
hours then 4.degree. C. for about 16 hours. BSA-HyLk 1 conjugate
was purified by size exclusion chromatography (Superdex200; GE
HealthCare) using PBS as eluant at 0.5 ml/min (75 min run) and the
conjugate product collected between 15-26 min. The MSR of BSA-HyLk
X were determined by area under the curve of the chromatograms and
shown in Table 12 (MSR (oligos/BSA) of BSA-oligonucleotide
conjugated).
TABLE-US-00015 TABLE 12 Conjugate MSR BSA-HyLk1 2.96 BSA-HyLk2 2.95
BSA-HyLk3 3.00
[0613] Biotin/anti-rabbit IgG modification: Anti-rabbit IgG
(Jackson ImmunoResearch) was desalted into Modification Buffer
using a 2 ml 7 KD MWCO Zeba Column and concentration determined
(2.15 mg/ml) by NanoDrop (E1%=13.6). A solution of Sulfo-ChromaLink
Biotin (Solulink) (18.4 mg/ml) in anhydrous DMF was prepared. To
anti-rabbit IgG (0.84 mg; 391 ul of a 2.15 mg/ml solution) was
added Sulfo-ChromaLink Biotin (4.2 ul; 15 mol equiv). The reaction
mixture was incubated at room temperature for about 3 hours then
desalted into PBS using a 2 ml 40 KDMWCO Zeba Column and the
concentration determined to be 1.35 mg/ml by BCA assay and biotin
incorporation of 5.34 biotins/antibody was determined
spectrophotometrically using chromophoric bis-arylhydrazone linker
of ChromaLink Biotin (A354, extinction coefficient 29,000).
[0614] Flow cytometric analysis of capturing antibody (anti-BSA) in
solution by antigen (BSA) hybridized on beads through
oligonucleotide and detected by biotin-2.sup.nd antibody followed
by Streptavidin-RPE: HyLk1'-compel beads (50 ug/test; 17 ul of 3
mg/ml) were washed with PBS/T (PBS/0.05% Tween-20) followed by
adding a 50 ul of PBS solution containing HyLk1-BSA conjugate (644
ng; 23 ul of 2.8 mg/ml). The hybridization reaction was incubated
on a shaker at room temperature for about 45 minutes. The beads
were washed with PBS/T (3.times.) by centrifugation at 5000 g for 5
minutes each time. Serial dilutions of anti-BSA (Fitzgerald) were
prepared as the following: 366, 36.6, 3.66, 0.366, 0.0366 ng into
50 ul of PBS from 1 mg/ml solution and into which 50 ug beads
re-suspended. The beads were incubated on the shaker at room
temperature for about 1 hour followed by PBS/T wash (3.times.). To
beads 50 ul of biotin modified anti-rabbit IgG (0.2 ug; 50 ul of 4
ug/ml) solution in PBS was added and incubated on the shaker at
room temperature for about one hour followed by PBS/T wash
(3.times.). To beads 50 ul of Streptavidin-R-Phycoerythrin (SAPE)
(Invitrogen) (0.03 ug; 50 ul of 0.68 ug/ml) solution in PBS was
prepared and added and the beads were incubated on the shaker at
room temperature for around 30 minutes followed by PBS/T wash
(3.times.). The beads were finally re-suspended into 300 ul PBS and
subjected to acquisition on FACSCalibur, 20,000 events were
collected per sample. Debris and clumps of beads were excluded by
gating based on FSC vs. SSC dot plots. Analysis of PE+ beads
population was performed using FlowJo software (Tree Star, Inc).
Flow results are presented in FIG. 75.
Example 25
[0615] Preparation of Antibody-oligonucleotides conjugates of
increasing oligonucleotide/antibody ratios using size exclusion
chromatograph.
[0616] To .alpha.-CD4 antibody (3.42 mg at 4.94 mg/mL in
Modification Buffer) was added S-HyNic (300 uL of 20 mg/mL solution
in anhydrous DMF; 21 mol equiv). The reaction mixture was incubated
at room temperature for 3 hours and desalted into Conjugation
Buffer using 2.times.2 mL 7K MWCO Zeba columns. The protein
concentration (BCA assay) was determined to be 3.83 mg/mL and the
HyNic substitution ratio was 7.3 HyNic/.alpha.-CD4. The
HyNic-modified .alpha.-CD4 antibody was divided into five tubes
each containing 0.63 mg (165 uL). A solution of a 20mer
5'-4FB-oligonucleotide (MW 6312; 0.463 OD/uL) in nuclease free
water was prepared. To the five aliquots of HyNic-.alpha.-CD4 were
added 2.27, 3.98, 5.68, 7.95, 11.36 and 15.0 mol equiv of
5'-4FB-oligonucleotide followed by the addition of 1/10 volume of
TurboLink Buffer (100 mL phosphate, 150 mM NaCl, 100 mM aniline, pH
6.0; Solulink Biosciences, San Diego, Calif.). The conjugates were
purified by size exclusion chromatography using a Superdex200
column (GE Healthcare). Table 13 presents the data characterizing
the .alpha.-CD4-oligonucleotide conjugate products.
TABLE-US-00016 TABLE 13 Equiv 4FB- Equiv 4FB-oligo oligo added
incorporated mg/mL 2.27 1.92 0.113 3.98 3.34 0.112 5.68 4.64 0.113
7.95 5.52 0.107 11.36 6.49 0.123 15.00 7.87 0.109
[0617] Flow cytometric analyses of .alpha.-CD-oligonucleotide
conjugates of increasing oligonucleotide/antibody ratios: The
conjugates prepared as discussed herein were hybridized to their
complementary oligonucleotide/dextran/Dy490 detector in 1/1 mole
ratio based on incorporated oligonucleotides for 15 min at room
temperature, added to cells for 30 min at 4.degree. C., washed
twice with PB. The conjugates were added to normal B6 mouse
splenocytes as in Example 14 and analyzed on a FACS Canto using a
488 laser with a FITC filter. Results are presented in FIG. 73.
FIG. 73 shows the flow cytometric results analyzing
antibody-oligonucleotide conjugates hybridized to its complementary
oligonucleotide/dextran/poly-Dy490 detector with respect to the
number of oligosnucleotides conjucated to the antibody. Here an
.alpha.-CD4-antibody conjugated to increasing ratios of
oligonucleotide/antibody hybridized to its detector complement were
incubated with B6 mouse cells and analyzed by flow cytometry as
described in Example 14.
Example 26
[0618] Prophetic Example Imaging:
[0619] A researcher wishing to determine the percentage of cells
bearing a molecular target in a fixed, adherent cultured cell
sample in a dish labels the sample first with a DNA-binding first
fluorophore to label cell nuclei, then washes the sample to remove
unbound DNA-binding dye, then labels the sample with a molecular
probe comprising an antibody recognizing the target of interest
conjugated to a first oligonucleotide hybridized to a second,
complementary oligonucleotide conjugated to a second fluorophore
using certain embodiments disclosed herein. After washing the
sample to remove unbound molecular probe the sample is imaged in a
fluorescence microscope and two fluorescent images are
electronically recorded--one at the emission wavelength of the
first fluorophore (labeling cellular nuclei), and one at the
emission wavelength of the second fluorophore (labeling cells
positive for the molecular target). Employing conventional image
analysis algorithms the total number of cells in the field is
counted, the number of cells positive for the molecular target is
counted, and the percentage of cells bearing the molecular target
is calculated.
Example 27
[0620] Prophetic Example Imaging:
[0621] A histologist wishing to detect cells positive for a
molecular target in a sectioned tissue specimen labels the tissue
section with a molecular probe comprising an antibody recognizing
the target of interest conjugated to a first oligonucleotide
hybridized to a second, complementary oligonucleotide conjugated to
either a fluorophore such as FITC or a chromophore-generating
enzyme such as horseradish peroxidase using certain embodiments
disclosed herein. The tissue section is next counter-stained with
hematoxylin. The labeled tissue specimen is then observed
microscopically (employing transmitted light microscopy in the case
of a chromophore-labeled sample or fluorescence microscopy in the
case of a fluorophore-labeled sample) and is manually and/or
automatically scored for the presence/absence, abundance,
distribution of label or combinations thereof.
Example 28
[0622] Prophetic Example Strip and Re-Probe:
[0623] A researcher desiring to identify a sub-population of cells
in a chemically fixed adherent cell sample which contains six
targets, Target A through Target F, uses a fluorescence microscope
with only three available optical channels, Channels A, B, and C.
It is therefore not possible for the researcher to measure the six
targets simultaneously, or substantially simultaneously, using
antibodies labeled with six different-colored fluorophores. The
researcher therefore adopts the following `strip-and-reprobe`
experimental strategy.
[0624] The researcher first labels the cell sample with a cocktail
comprising antibodies A, B, and C (Ab-A, Ab-B, and Ab-C,
recognizing Targets A, B, and C, respectively) conjugated to
oligonucleotides 1, 2 and 3, respectively, and hybridized with
complementary oligonucleotides 1', 2', and 3' respectively,
conjugated to fluorophores X, Y, and Z respectively using certain
disclosed embodiments. The researcher then images the labeled
adherent cell sample and records the locations on the dish of the
cells positive for the Targets A, B, and C simultaneously or
substantially simultaneously.
[0625] Next, the researcher strips the fluorescent signal moieties
from the molecular probes bound to the cells by subjecting the
sample to conditions of temperature and ionic conditions sufficient
to dehybridize the molecular probes' oligonucleotide pairs, and
washes away the dehybridized signal moieties using certain
disclosed embodiments. After visually confirming the completeness
of stripping (observing no residual fluorescent signals), the
researcher next re-probes the cell sample (under temperature and
ionic conditions sufficient to maintain oligonucleotide
hybridization) by labeling it with a cocktail comprising antibodies
D, E, and F, recognizing Targets D, E, and F, respectively,
conjugated to oligonucleotides 1, 2 and 3, respectively, and
hybridized with complementary oligonucleotides 1', 2', and 3'
respectively, conjugated to fluorophores X, Y, and Z respectively
using certain disclosed embodiments. The researcher then images the
labeled adherent cell sample (observing the same fields observed in
the first round of staining) and records the locations on the dish
of the cells positive for the Targets D, E, and F simultaneously or
substantially simultaneously. Cells marked in the first round of
labeling as simultaneously, or substantially simultaneously,
positive for Targets A, B, and C and marked in the second round of
labeling as simultaneously, or substantially simultaneously,
positive for Targets D, E, and F are therefore simultaneously, or
substantially simultaneously, positive for Targets A, B, C, D, E
and F. thereof.
Example 29
[0626] Prophetic Example Panel Optimization:
[0627] In the development of a flow cytometry assay it is desired
to detect, distinguish, quantify or combinations thereof three
separate sub-populations of cells in a sample, employing a reagent
cocktail of three differently fluorescently labeled antibodies,
Ab-A, Ab-B, and Ab-C, against three targets, Target A, Target B and
Target C, respectively. After ruling out several possible
fluorophores for practical considerations, the assay developer may,
in principle, choose from among four remaining fluorophores (Fl-1
through Fl-4) to label the three antibodies, but faces a multitude
of issues impacting the best choice of three from among these four,
as well as the best choice of which fluor to place on which
antibody, including at least one or more of the following
considerations regarding spillover of signal between detection
channels, different degrees of non-specific binding of the
fluorophores to the cells, differential sensitivities of the
fluorophores to photobleaching, and the differing intrinsic
brightness's of the fluors due to their different quantum
yields.
[0628] A collection of separately contained reagents is provided,
comprising three tubes of Ab-A, Ab-B, and Ab-C, respectively, each
conjugated to a first oligonucleotide, and four tubes of Fl-1
through Fl-4, respectively, each conjugated to a second
oligonucleotide complementary to the first oligonucleotide using
certain disclosed embodiments. In 12 separately contained reactions
each antibody is hybridized to each fluorophore, respectively,
yielding the molecular probes Ab-A:Fl-1, Ab-A:Fl-2, . . . ,
Ab-C:Fl-4 using certain disclosed embodiments. Into separate tubes
these molecular probes are next combined in the 24 possible 3-way
combination cocktails (Ab-A:Fl-1+Ab-B:Fl-2+Ab-C:Fl-3,
Ab-A:Fl-1+Ab-B:Fl-2+Ab-C:Fl-4, . . . ,
Ab-A:Fl-4+Ab-B:Fl-3+Ab-C:Fl-2).
[0629] Twenty-four identical, or substantially identical, aliquots
of a sample of the cells of interest are labeled with each of the
24 cocktails, respectively, and the 24 labeled cell aliquots are
then separated evaluated via flow cytometry to identify the one
cocktail composition which optimally detects, differentiates, and
quantifies the sample's three sub-populations.
[0630] Subsequent to this assay development study, the optimal
three-component cocktail thus identified is employed in assays to
determine the presence and abundance of the three sub-populations
of cells in samples using certain disclosed embodiments.
Example 30
[0631] Immunoturbidity:
[0632] 4FB-OptiLink bead preparation: Carboxy-modified OptiLink
beads as supplied (750 mg; 7.5 mL; Thermo Scientific Cat
#83000550100290, 2.07 um in diameter) were dialyzed into 100 mM MES
buffer pH 6.0 by injecting the suspension of beads into a Pierce
Slide-A-Lyzer dialysis cassette (3.5 kD MWCO) and placing the
cassette in 2 L 100 mM MES buffer pH 6.0 with gentle magnetic
stirring for 6-16 hours (3.times.). The bead suspension was
transferred to a 50 mL conical tube with a syringe. 819 mg of EDC
(Quanta Bio, Cat #10025) was dissolved in 4 mL HyClone molecular
biology grade water (cat #SH30538.03). 854 mg Sulfo-NHS (Solulink
cat #S-4020) was dissolved in 15 mL MES buffer. Both of these
solutions were added to the OptiLink beads, which were incubated at
room temperature for 30 minutes on a rotator. The bead suspension
was dialyzed again as described above and then transferred to 50 mL
conical vials. A solution of ethylenediamine in Borate Buffer (0.5
M in 0.1M borate, pH 8.0) was added to the beads and the reaction
was incubated at room temperature for 12 hours on the rotator. The
bead suspension was then dialyzed as described above into
modification buffer (100 mM Phosphate, 150 mM NaCl, pH 7.4) and
transferred into 50 mL conical vials. 1.453 g Sulfo-S-4FB was
weighed and dissolved in 30 mL modification buffer. This solution
was added to the beads, which were then incubated at RT for 16
hours on a rotator. The bead suspension was then dialyzed as
described above in conjugation buffer (100 mM Phosphate, 150 mM
NaCl, pH 6.0).
[0633] The concentration of the beads was subsequently determined.
Serial dilutions were prepared from native OptiLink beads at the
following concentrations: 197.6, 98.8, 49.4, 24.7 and 12.35 ug/ml
in PBS (10 mM phosphate, 150 mM NaCl, pH 7.4). Similarly, a 2 uL
aliquot of 4FB-OptiLInk beads was diluted into 998 uL PBS (in
duplicate). OD at 600 nm was recorded and concentration of beads
determined (32.33 mg/mL) according to the standard curve generated
from OD600 readings of the native beads. To measure the 4FB-binding
capacity of the modified beads, a 246 uM S-Tag HyNic peptide
solution was prepared in conjugation buffer. 100 uL of this
solution was added to 0.5 mg 4FB-OptiLink beads (in duplicates) and
0.5 mg native OptiLink beads (in duplicates). The reactions were
incubated at room temperature for 1 h on a shaker and supernatant
collected following centrifugation at 10,000.times.g for 10
minutes. Based on the reduction of S-Tag HyNic peptide supernatant
(as measured by OD 280), the 4FB-binding capacity of the OptiLink
beads were calculated to be 28.0 nmol/mg. These 4FB-OptiLink beads
are used in the following experiments.
[0634] Amino-oligonucleotide-HyNic Modification: The
amino-oligonucleotides (HyLk-4' and HyLk-5') were desalted into
Modification Buffer (100 mM Phosphate, 150 mM NaCl, pH 7.4) using a
3 kD MWCO VivaSpin column and centrifuging at 15,000.times.g for 10
minutes (4.times.). The concentration was adjusted between 0.3-0.5
OD/uL. To the volume of amino-oligonucleotide was added a 1/2
volume of DMF followed by addition of S-HyNic (20 mg/mL in DMF; 25
equivalents). The reaction was gently vortexed for 5 seconds and
then incubated at room temperature for 2 hours. The solution was
then diluted to 400 uL with Conjugation Buffer (100 mM Phosphate,
150 mM NaCl, pH 6.0) and desalted using 3 kD MWCO VivaSpin column
by centrifuging at 15,000.times.g for 10 minutes (4.times.). A280
measurements of HyNic-HyLk-4' and -5' were measured to determine
their final concentrations.
[0635] HyNic-oligonucleotide immobilization onto 4FB-OptiLink
beads: To three aliquots of 4FB-OptiLink beads were added
HyNic-oligonucleotide at 3 different equivalents for each oligo
(14, 1.4, and 0.14 nmol/mg beads) in Conjugation Buffer followed by
the addition of 1/10 of volume of TurboLink Buffer (100 mM aniline,
100 mm phosphate, 150 mM NaCl, pH 6.0). The reactions were
incubated for 16 hours on a shaker. Unconjugated oligonucleotides
were removed from the beads by washing with PBS (10 mM phosphate,
150 mM NaCl, pH 7.4) after centrifuging the beads at 5,000.times.g
for 10 minutes (4.times.). The beads were re-suspended in PBS at 10
mg/ml. Table 14 shows Oligonucleotides immobilized on OptiLink
beads.
TABLE-US-00017 TABLE 14 Functional Equiv of Aniline Total reaction
OptiLink beads oligonucleotide con. volume Oligo (mg) (nmol/mg)
(mM) (uL) HyLk4' 5 14, 1.4, 0.14 10 100 HyLk5' 5 14, 1.4, 0.14 10
100
[0636] .alpha.-bIgG-HyNic modification: Rabbit Anti-Bovine IgG
(H+L) (.alpha.-bIgG) (Jackson Immuno Research, cat #301-005-003)
solution was prepared at 2.4 mg/ml initial concentration and
desalted to modification buffer using a 2 mL 7 kD MWCO zeba column.
To the solution of .alpha.-bIgG (443.1 ug; 210 uL of a 2.11 mg/ml
solution) was added a solution of S-HyNic (3.58 uL of a 4.8 mg/ml
solution in anhydrous DMF; 20 mol equiv). The reaction was gently
vortexed for 5 seconds and then incubated at room temperature for 3
hours. The reaction mixture was desalted into conjugation buffer
using a 2 mL 40 kD MWCO zeba column and the concentration of
.alpha.-bIgG determined by BCA assay.
[0637] .alpha.-bIgG-HyLkX conjugation (using IgG-HyLk4 as the
example): To HyNic-.alpha.-bIgG (210 ug; 210 uL of 2.00 mg/mL in
conjugation buffer) prepared in Step 4 was added 4FB-HyLk4 (IDT,
4FB-MSR=0.33) (2.789 uL of 0.91 OD/uL in conjugation buffer; 3
functional mole equivalents) and a 1/10 of volume of TurboLink
Buffer (100 mM aniline, 100 mM phosphate, 150 mM NaCl, pH 6.0) was
added. The reaction was mixed and incubated at room temperature for
4 hours and then 4.degree. C. for 16 hours. .alpha.-bIgG-HyLk4
conjugate was purified by size exclusion chromatography
(Superdex200; GE HealthCare) using PBS as eluent at 0.5 ml/min (45
min run) and the conjugate product collected between 11-17 min. The
MSR of the conjugate (number of oligos per .alpha.-bIgG) was
determined by the area under the curve of the chromatograms from
the HPLC trace. .alpha.-bIgG-HyLk conjugates were then concentrated
to approximately 100 ug/mL with 10 kD MWCO Amicon filter units
(Millipore cat #UFC801024). Concentrations of the conjugates were
determined by BCA assay. Table 15 shows the MSR
(oligos/.alpha.-bIgG) of .alpha.-bIgG-oligo conjugate.
TABLE-US-00018 TABLE 15 Conjugate Functional 4-FB oligo added
(equiv) MSR .alpha.-bIgG-HyLk4 3 2.98 .alpha.-bIgG-HyLk5 3 2.95
[0638] Preparation of control .alpha.-bIgG-OptiLink beads via EDC
coupling: 9 mg (1 mL of a 9 mg/mL suspension) of OptiLink amino
beads was washed with 1 mL 100 mM MES buffer, pH 5.0 (3.times.).
Beads were vortexed for 20 seconds and sonicated for 20 seconds
during each wash; beads were centrifuged at 10,000.times.g for 10
minutes to form a pellet from which the supernatant could be
decanted. The beads were then suspended in 0.5 mL 100 mM MES buffer
pH 5.0. To this suspension, a freshly prepared solution of 10.73 mg
of EDC dissolved in 0.5 mL 100 mM MES buffer, pH 6.0 was added.
Beads were then spun on a rotator at RT for 20 minutes. Beads were
then washed as described above 3 times, and resuspended in 0.5 mL
100 mM MES buffer, pH 6.0. 309 ug of .alpha.-bIgG (140 uL of a 2.21
mg/mL solution of .alpha.-bIgG desalted into 100 mM MES buffer pH
5.0 with a 2 mL 7K MWCO zeba column) was then added to the beads.
The beads were then spun on a rotator for 4 hours at RT. Beads were
then washed 3 times as previously described, and were finally
resuspended in 0.5 mL PBS (10 mM phosphate, 150 mM NaCl, pH
7.4).
[0639] Bovine IgG preparation: Bovine IgG (Sigma Aldrich
.gamma.-Globulins from bovine blood cat #G7516) (BIgG) was desalted
using a 7 kD MWCO zeba column into modification buffer. This
solution was concentrated to 1 mg/mL as determined by BCA assay.
Dilutions were made into modification buffer to the following
levels: 1 mg/mL, 100 ug/mL, 10 ug/mL, 1 ug/mL, 100 ng/mL, 50 ng/mL,
10 ng/mL, and 5 ng/mL.
Agglutination: Samples of PBS, HyLkX'-modified
beads/HyLkX-.alpha.-bIgG conjugate or EDC-coupled OptiLink-anti
Bovine IgG beads were prepared and added to a 96-well plate. Serial
dilutions by half were made starting with 109.68 ug beads per well
down to 0.86 ug beads per well. The plate was then placed on a
shaker at RT for 45 minutes to allow for hybridization and
therefore immobilization of the aBIgG to the HyLk-OptiLink beads. A
volume of the appropriate solution of .alpha.-bIgG solution was
then added to the appropriate wells. Amounts of 100 ng, 10 ng, and
1 ng of .alpha.-bIgG were added to each amount of beads. The degree
of agglutination was monitored both visually and by OD600. Results
of the test are summarized in table 16 and are shown in FIG. 74.
Table 16 provides the results of agglutination test with
HyLk5'-OptiLink beads and the results shown in Table 16 indicate
that the same level of antigen can be detected with 16 times fewer
HybriLink-coupled beads when compared to the traditional
EDC-coupled beads.
TABLE-US-00019 TABLE 16 EDC Beads HybriLink Beads 0 ng 10 ng 1 ng 0
ng 100 ng 10 ng 1 ng Ag Ag Ag Ag Ag Ag Ag 1 2 3 4 5 6 7 8 9 10 11
12 A - + + + + - + + + + + + B - + + + + - + + + + + + C - - - - -
- + + + + + + D - - - - - - + + + + + + E - - - - - - + + + + + + F
- - - - - - + + + + + + G - - - - - - - - - - - - H - - - - - - - -
- - - -
Example 31
[0640] This example is directed to a method for detecting one or
more biological targets of a complex sample in a detection assay
using complementary detectors to which the fluor or signal
generation moiety are directly conjugated. A-CD4 and .alpha.-CD8a
were conjugated to the 20, 30 and 40mer amino-oligonucleotides
listed in the Table 17 using the protocol described in Example 1.
Table 17 also lists the MSR (oligonucleotides/antibody).
TABLE-US-00020 TABLE 17 Antibody Sequences MSR .alpha.-CD4 (Clone
GK1.5) (20 mer) 5'-C6-amino-GGA AGC GGT GCT ATC CAT CT 3.0 (30 mer)
5'- C6-amino-CAC CCA GCC GAT GAC CTC TTA 2.9 GTT TCA CGC -3 (40
mer) 5'- C6-amino-CAC CCA GCC GAT GAC CTC TTA 3.1 GTT TCA CGC AAA
GCA CAC G -3' .alpha. -CD8a (Clone 53-6.7) (20 mer) 5'-
C6-amino-GGA AGC GGT GCT ATC CAT CT 2.8 (30 mer) 5'- C6-amino-CAC
CCA GCC GAT GAC CTC TTA 3.0 GTT TCA CGC -3 (40 mer) 5'-
C6-amino-CAC CCA GCC GAT GAC CTC TTA 3.0 GTT TCA CGC AAA GCA CAC G
-3'
[0641] Fluorophore labeling of complementary amino-modified
oligonucleotides: The complementary 20, 30 and 40mer
multi-amino-modified oligonucleotides (Table 18) were conjugated to
Dy490 and Dy649 dyes using protocols described in Example 12-A;
Step 3B. The amino-modified thymidines in the sequences are denoted
by (T*) in the Table 18. The MSR (dyes/oligonucleotide) are also
listed in the Table 18.
TABLE-US-00021 TABLE 14 Complementary Multi-fluor Sequences
Fluor(s) SR (20 mer) 5'-C6-amino-AGA TGG A(T*)A GCA CCG CTT CC-
C3-amino -3' Dy490 .1 (30 mer) 5'-C6-amino- Dy490 .6
GCGTGAAAC(T*)AAGAGGTCA(T*)CGGCTGGGTG-C6-amino -3' Dy649 .6 (40 mer)
5'- (C6-NH2)- Dy490 .5
CGTGTGCTT(T*)GCGTGAAAC(T*)AAGAGGTCA(T*)CGGCTGGGTG-C6-amino) -3'
Dy649 .4
[0642] Bovine Flow cytometry results: The
antibody-oligonucleotide/multi-fluor complementary oligonucleotide
conjugate hybrids were prepared by incubating the
antibody-oligonucleotide (1 mol equiv) with multi-fluor
complementary oligonucleotide conjugate (4 mol equiv) for about 1 h
at room temperature. The hybrids (500 ng) were added to splenocytes
(1,000,000) and incubated at 4.degree. C. for about 30 min, washed
and analyzed by flow cytometry. FIG. 79 presents the flow cytometry
results of the binding of .alpha.-CD8 20, 30 and 40mer hybrids to
CD8.sup.+ splenocytes.
Example 32
[0643] Immunomagnetic Depletion Procedure:
[0644] Step 1) Preparation of Oligonucleotide and Antibody
Conjugates. Biotinylated HyLk1' oligonucleotides were commercially
synthesized (IDT, Coralville, Iowa). Oligonucleotides were
biotinylated at the 5' end, with either no "spacer" sequence
between the biotin group and the HybriLink sequence
(5'-BIO:GTACTTCCTTAAACGACGCAGG-3'), or having a 44-base repeating
TTAA spacer inserted between the biotin modified end and the HyLk1'
sequence
(5'-BIO:TTAATTAATTAATTAATTAATTTTAATTAATTAATTAATTAATTGTACTTCCTTAAACGAC
GCAGG-3'. Her2 antibody (Herceptin.RTM., Genentech, California) was
either conjugated to oligo HyLk1 as previously described
(Herceptin:HyLk1), or biotinylated (Herceptin:Biotin) and affinity
purified by SoluLink Biosciences.
[0645] Step 2) Preparation of HyLk1' oligo- or Herceptin
IgG-conjugated magnetic nanoparticles. Streptavidin (STV)-coated
magnetic nanoparticles (0.8 .mu.m, NanoLink.TM., SoluLink
Biosciences) were transferred at 1 mg/mL into wash buffer (50 mM
Tris-HCl, 150 mM NaCl, with 0.05% Tween-20, pH 8.0.) Washed
nanospheres were separated from solution using a magnetic stand. To
prepare antibody labeled beads, nanospheres were blocked at 1 mg/mL
for 30 m at 24.degree. C. in a blocking buffer of sterile-filtered
casein-TBS (Blocker.TM., Pierce Protein Research Products.) Blocked
nanospheres were washed 3.times. in TBS-T prior to the addition of
antibody. Nanospheres to which oligonucleotides were conjugated
were left unblocked per manufacturer protocol. Conjugation of
biotinylated oligonucleotide was conducted as follows:
Oligonucleotides were solubilized in sterile H20 to 1 nmol/.mu.L
and combined in equal portions of (BIO:H1'):(BIO:44:H1'). The mixed
oligo solution was diluted to 10.4 nmol/mL into wash buffer and
immediately applied to washed nanospheres at 250 .mu.L/mg beads
(=2.6 nmol/mg). Conjugation was allowed to proceed for 30 m at
24.degree. C. with rotation. Conjugation of biotinylated antibody
(.alpha.Her2:BIO) was conducted as follows: Protein content of
Herceptin-biotin was confirmed by BCA assay (Pierce Protein
Research Products). Antibody was applied at 40 .mu.g/mL in 250
.mu.L TBS-T/mg nanospheres. Conjugation was allowed to proceed for
30 m at 24.degree. C. with rotation. Following conjugation,
supernatants from both sets of nanospheres (oligo- or
antibody-labeled) were analyzed for remaining conjugate, either by
A260 assay (oligo supernatant) or BCA assay (Herceptin
supernatant). Oligo-conjugated nanospheres were determined to have
290 pmol HyLk1'/mg solids. Antibody-conjugated nanospheres were
determined to have 30 .mu.g IgG/mg solids. Conjugated nanospheres
were stored overnight in TBS-T at 4.degree. C. and used for
immunomagnetic depletion the following day.
[0646] Step 3) Cell culture and tumor cell "spiking". SKBR-3 human
adenocarcinoma cells (ATCC) were cultured in McCoy's 5A growth
medium supplemented with 10% fetal bovine serum (FBS, Gemini
BioSciences), 4 mM L-glutamine (Gemini), and 1 KU/1 KU
penicillin/streptomycin solution (`pen/strep`, Invitrogen).
CCRF-CEM human T-cell lymphocytes were cultured in RPMI-1640
culture medium supplemented with 10% FBS and 1 KU/1 KU pen/strep.
All cultures were grown in sterile, culture treated flasks in a
humidified, 37.degree. C. incubator maintained at 5% CO2. Just
prior to immunodepletion, adherent SKBR-3 cells were harvested by
trypsinization of the monolayer, followed by transfer to conical
tubes. Non-adherent CCRF-CEM cells were transferred to conical
tubes without trypsinization. Both cultures were pelleted by
centrifugation for 5 min at 800.times.g, and resuspended in a
buffer of 0.2% bovine serum albumin in phosphate buffered saline
(BSA-PBS). After counting cells per mL, 10% tumor cells were added
("spiked") into CCRF-CEM lymphocytes. Samples for immunodepletion
were aliquoted at 1.times.10.sup.6 cells/mL prior to downstream
handling.
[0647] Step 4) Herceptin labeling of spiked cell preparations.
Prior to Herceptin labeling, 1.times.10.sup.6 `spiked` cells were
blocked for 30 m at 24.degree. C. in 100 .mu.L of 0.2% BSA-PBS
buffer containing 10 .mu.L human Fc receptor antibodies (.alpha.FcX
"TruStain", BioLegend, San Diego, Calif.) Without washing, 15 .mu.g
of Herceptin:HyLk1 or 15 .mu.g of Herceptin:Biotin was added to
blocked cells. Labeling was allowed to proceed for 60 m at
4.degree. C. with rotation. Cells were washed 2.times. in 0.2%
BSA-PBS prior to magnetic depletion.
[0648] Step 5) Immunomagnetic depletion. Conjugated magnetic
nanospheres were washed 3.times. in 1 mL PBS/mg solids to remove
traces of Tween-20 detergent. 500 .mu.g nanospheres were added to
washed, labeled or unlabeled cells. For HyLk1' conjugated
nanospheres, 500 .mu.g solids at 290 nmol oligo/mg solids presented
145 nmol HyLk1' per sample. According to current literature
reporting 2.times.10.sup.6 Her2 molecules per SKBR-3 tumor
cell.times.0.1.times.10.sup.6 tumor cells per
sample=2.times.10.sup.11 Her2 molecules=333 fmol Her2 per sample.
Assuming 100% antibody binding, and a molar substitution ratio of
4.0 oligos per IgG molecule, this translates to 1.3 pmol oligo per
labeled cell sample. 145 nmol HyLk1' immobilized on beads thus
represents >100.times. excess of available complementary oligo
to hybridize to labeled cells. For Herceptin:biotin conjugated
nanospheres, 500 .mu.g presents 15 .mu.g IgG per sample, the same
amount of Herceptin used to label cells in the HybriLink test
group. Following addition of 500 .mu.g nanospheres per sample,
immunomagnetic capture (depletion) of Her2+ cells was allowed to
proceed for 60 m at 4.degree. C. with rotation. The microspheres
were then isolated from cell suspension by magnetic separation.
Cellular supernatants were placed on ice. Spheres were washed in
2.times.500 .mu.L of 0.2% BSA-PBS and sample washes were combined
with sample supernatants for analysis by flow cytometry of depleted
cellular preparations.
[0649] Description of sample groups. Samples included the following
preparations: (A) Unlabeled cells without nanospheres (undepleted
sample). (B) Herceptin-HyLk1 labeled cells plus unlabeled
nanospheres (mock control 1). (C) Unlabeled cells plus unlabeled
nanospheres (mock control 2). (D) Unlabeled cells plus
Herceptin:Biotin conjugated nanospheres (conventional,
state-of-the-art method). (E) Herceptin:Biotin-labeled cells, plus
streptavidin nanospheres (modification of conventional method). (F)
Herceptin:HyLk cells plus HyLk1' labeled nanospheres (HybriLink
novel method). See FIG. 81.
[0650] Step 6) Fluorescent staining of depleted cell samples.
Fluorescent-conjugated, monoclonal antibodies against Her2
(.alpha.Her2:PE, BioLegend) and tumor cell antigen EpCAM
(.alpha.EpCAM:APC, BioLegend) were applied to cells in a staining
cocktail of 125 ng .alpha.Her2:PE plus 30 ng .alpha.EpCAM:APC in
100 .mu.L of 0.2% BSA-PBS for 60 m at 4.degree. C. with rotation.
Samples were pelleted by centrifugation for 5 m at 800.times.g,
resuspended in 250 .mu.L 0.2% BSA-PBS, and immediately analyzed by
cytometer. Undepleted, spiked cell samples were also stained with
fluorescent host isotype controls (mouse IgG1:PE and mouse
IgG2b:APC) to determine background levels of cellular staining,
known to be high in most lymphocytes. Undepleted, unstained spiked
cells were also prepared as an additional background control.
[0651] Step 7) Flow cytometric analysis. Samples were analyzed
using an LSRII cytometer equipped with appropriate lasers and
fluorescent emission detectors. 10,000 events were recorded per
sample. Raw data files (.fcs) were exported to FlowJo software
(TreeStar, Ashland, Oreg.). 2D `dot plots` were visualized as PE
signal vs. APC signal. Quadrants were gated based on
isotype-control background levels (data not shown). Her2+ cells
were defined as those having relative fluorescence intensity
(RFI)>8000 PE units. EpCAM+ cells were defined as those having
RFI>1000 APC units. Her2+/EpCAM+ cells were defined as "tumor
cells" meeting both fluorescence intensity criteria. Her2-/EpCAM-
cells were defined as "leukocytes" meeting neither positive
criteria. Experimental results are shown in FIG. 81 and Table
19.
TABLE-US-00022 TABLE 19 Her2+ Her2- leukocytes: depletion Panel
depletion conditions EpCAM+ % D EpCAM- % D tumor cells ratio A
undepleted 9.95 n/a 68.5 n/a 6.9 n/a B -HyLk1' 12.6 26.6 71.3 4.1
5.7 0.8 C -Herceptin -HyLk1' 12.1 21.6 74.9 9.3 6.2 0.9 D
conventional method 4.4 -56.0 80.2 17.1 18.3 2.7 E modified
conventional 6.8 -32.2 82.8 20.9 12.3 1.8 F HybriLink method 2.2
-77.9 85.9 25.4 39.0 5.7
[0652] In the following, further embodiments are explained with the
help of subsequent examples starting at Example 20A.
Example 20A
[0653] A method for detecting one or more biological targets of a
sample in a detection assay, comprising: i) providing a molecular
probe, comprising a binding moiety and an oligonucleotide sequence,
to a sample comprising one or more biological targets; ii) binding
the one or more biological targets with the binding moiety; iii)
providing a detectable component to the sample, wherein the
detectable component comprises a signal generating moiety
conjugated to an oligonucleotide sequence complementary to the
oligonucleotide sequence of the molecular probe; v) hydridizing the
oligonucleotide sequence of the target-bound molecular probe to the
detectable component; and v) detecting a signal generated from the
hydridized detectable component; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the signal generating moiety, comprise a covalent bond linkage,
comprising a hydrazone, oxime, triazine, or other bond, wherein the
formation of the conjugates are at least 90% efficient; b) the
binding moiety comprises a binding affinity of less than 10.sup.-4
M for the one or more biological targets.
Example 21A
[0654] The method of Example 20A, wherein sample is a complex
sample.
Example 22A
[0655] The method of one or more of Examples 20A-21A, wherein the
hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%.
Example 23A
[0656] The method of one or more of Examples 20A-22A, wherein the
molecular probe has substantially the same solubility as the
binding moiety.
Example 24A
[0657] The method of any one of Examples 20A-23A, wherein the
molecular probe comprises a molecular weight of between about
15,000 Daltons to about 450,000 Daltons.
Example 25A
[0658] The method of one or more of Examples 20A-24A, wherein the
method of detection generates less false positives than secondary
antibody detection methods.
Example 26A
[0659] The method of one or more of Examples 20A-25A, wherein the
method further comprises: i) preparing: a) a molecular probe,
comprising a binding moiety conjugated to an oligonucleotide
sequence; and b) a detectable component, comprising a signal
generating moiety conjugated to an oligonucleotide sequence
complementary to the oligonucleotide sequence of the molecular
probe; wherein the prepared molecular probe and prepared detectable
component have at least 90% purity.
Example 27A
[0660] The method of one or more of Examples 20A-26A, wherein the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets.
Example 28A
[0661] The method of one or more of Examples 20A-27A, wherein the
sample is homogeneous or heterogenous mixture;
Example 29A
[0662] The method of one or more of Examples 20A-28A, wherein the
sample comprises biological fluids or fluidized biological
tissue.
Example 30A
[0663] The method of one or more of Examples 20A-29A, wherein the
sample comprises cells, membranes, biological molecules,
metabolites, or disease biomarkers.
Example 31A
[0664] The method of one or more of Examples 20A-30A, wherein the
sample comprises a range of analytes having a wide range of binding
specificities.
Example 32A
[0665] The method of one or more of Examples 20A-31A, wherein the
time of conducting the method, from the start of preparation to the
end of detection is between about 2-3 hours.
Example 33A
[0666] The method of one or more of Examples 20A-32A, wherein the
molecular probe is neutral in charge.
Example 34A
[0667] The method of one or more of Examples 20A-33A, wherein the
method further comprises preparing and isolating a molecular probe,
comprising a binding moiety conjugated to an oligonucleotide
sequence, comprising: i) introducing a modified binding moiety into
a buffered solution;
[0668] ii) conjugating the modified binding moieties with at least
one modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and iii) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support.
Example 35A
[0669] The method of one or more of Examples 20A-34A, wherein the
method further comprises preparing and isolating a detectable
component, comprising a signal generating moiety conjugated to an
oligonucleotide sequence complementary to the oligonucleotide
sequence of the molecular probe, comprising: i) introducing a
modified signal generating moiety into a buffered solution; ii)
conjugating the modified signal generating moieties with at least
one modified complementary oligonucleotide at greater than 90%
efficiency to form signal generating moiety-complementary
oligonucleotide conjugates; and iii) isolating the signal
generating moiety-complementary oligonucleotide conjugates from the
conjugation solution by binding the conjugates to an immobilized
binder, removing the unconjugated oligonucleotide in a wash step
followed by release of the bound conjugate from the solid
support.
Example 36A
[0670] The method of one or more of Examples 20A-35A, wherein the
method further comprises preparing and isolating a detectable
component, comprising a scaffold, comprising one or more signal
generating moieties, conjugated to an oligonucleotide sequence
complementary to the oligonucleotide sequence of the molecular
probe, comprising: i) introducing a modified scaffold, comprising
the one or more signal generating moieties, into a buffered
solution; ii) conjugating the modified scaffold with at least one
modified complementary oligonucleotide at greater than 90%
efficiency to form scaffold-complementary oligonucleotide
conjugates; and iii) isolating the scaffold-complementary
oligonucleotide conjugates from the conjugation solution by binding
the conjugates to an immobilized binder, removing the unconjugated
oligonucleotide in a wash step followed by release of the bound
conjugate from the solid support.
Example 37A
[0671] The method of one or more of Examples 20A-36A, wherein the
scaffold comprises a dendrimer, polysaccharide, or a dextran.
Example 38A
[0672] The method of one or more of Examples 20A-37A, wherein the
one or more molecular probes comprise a range of specificities for
the one or more biological targets.
Example 39A
[0673] The method of one or more of Examples 20A-38A, wherein the
detection assay comprises a singleplex or multiplex detection
assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof.
Example 40A
[0674] The method of one or more of Examples 20A-39A, wherein the
binding moiety comprises an antibody, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, or combinations
or derivatives thereof.
Example 41A
[0675] The method of one or more of Examples 20A-40A, wherein the
one or more biological target comprises an antigen, a pathogen, a
protein, a peptide, an epitope, a carbohydrate-containing molecule,
a small molecule, or combinations or derivatives thereof.
Example 42A
[0676] The method of one or more of Examples 20A-41A, wherein the
one or more signal generating moieties, comprise one or more
fluorophors, biofluorescent proteins, quantum dots, Raman
particles, or combinations or derivatives thereof.
Example 43A
[0677] The method of one or more of Examples 20A-42A, wherein the
one or more signal generating moieties provides an enhanced signal
that minimizes detection errors from background noise.
Example 44A
[0678] The method of one or more of Examples 20A-43A, wherein the
one or more molecular probes and/or the one or more detectable
components further comprise a spacer group, comprising a
polymerized ethylene oxide, a PEG, or a PEO.
Example 45A
[0679] The method of one or more of Examples 20A-44A, wherein the
modified binding moiety, the modified scaffold, the oligonucleotide
sequence, and/or the complementary oligonucleotide sequence
comprise HyNic or 4-FB.
Example 46A
[0680] The method of one or more of Examples 20A-45A, wherein the
one or more molecular probes comprise unique, distinguishable,
and/or specifically designed oligonucleotide sequences.
Example 47A
[0681] The method of one or more of Examples 20A-46A, wherein the
one or more detectable components comprise unique, distinguishable,
and/or specifically designed complementary oligonucleotide
sequences.
Example 48A
[0682] The method of one or more of Examples 20A-47A, wherein the
oligonucleotide sequences of the one or more molecular probes are
uniquely and specifically designed to hybridize to the
complementary oligonucleotide sequence of the one or more
detectable components.
Example 49A
[0683] The method of one or more of Examples 20A-48A, wherein the
oligonucleotide sequences and/or complementary oligonucleotide
sequences, comprise 3'-oligonucleotides, 5'-oligonucleotides, LNAs,
PNAs, or combinations or derivatives thereof.
Example 50A
[0684] The method of one or more of Examples 20A-49A, wherein the
method further comprises: i) provides a universal adapter to the
complex sample, wherein the universal adapter comprised an
oligonucleotide sequence having a first sequence segment
complementary to the oligonucleotide sequence of the molecular
probe and a second sequence segment complementary to the
oligonucleotide sequence of the detectable component; ii)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the first oligonucleotide sequence
segment of the universal adapter; iii) providing the one or more
detectable components to the complex sample; iv) hydridizing the
oligonucleotide sequences of the one or more detectable components
to the second oligonucleotide sequence segment of the universal
adapter; and v) detecting one or more signals generated from the
hydridized one or more detectable components.
Example 51A
[0685] The method of one or more of Examples 20A-50A, wherein the
method further comprises: i) providing at least a first molecular
probe and a second molecular probe, comprising a first binding
moiety conjugated to a first oligonucleotide sequence and a second
binding moiety conjugated to a second oligonucleotide sequence,
respectively, to the complex sample comprising the one or more
biological targets; ii) specifically binding the one or more
biological targets with the binding moiety of the first molecular
probe and the binding moiety of the second molecular probe; iii)
providing the one or more detectable components to the complex
sample; iv) hydridizing the first oligonucleotide sequence of the
first target-bound molecular probe to a complementary
oligonucleotide sequence conjugated to a bead; v) hydridizing the
second oligonucleotide sequence of the second target-bound
molecular probe to the complementary oligonucleotide sequences of
the one or more detectable components; and vi) detecting one or
more signals generated from the one or more hydridized detectable
components.
Example 52A
[0686] The method of one or more of Examples 20A-51A, wherein the
method further comprises i) providing at least a first molecular
probe and a second molecular probe, comprising a first binding
moiety conjugated to a first oligonucleotide sequence and a second
binding moiety conjugated to a second oligonucleotide sequence,
respectively, to the complex sample comprising the one or more
biological targets; ii) specifically binding the one or more
biological targets with the binding moiety of the first molecular
probe and the binding moiety of the second molecular probe; iii)
providing a universal adapter to the complex sample, wherein the
universal adapter comprised an oligonucleotide sequence having a
first sequence segment complementary to the oligonucleotide
sequence of the molecular probe and a second sequence segment
complementary to the oligonucleotide sequence of the detectable
component; iv) hydridizing the first oligonucleotide sequence of
the first target-bound molecular probe to a first portion of the
first oligonucleotide sequence segment of the universal adapter; v)
hydridizing the second oligonucleotide sequence of the second
target-bound molecular probe to a second portion of the first
oligonucleotide sequence segment of the universal adapter; vi)
providing the one or more detectable components to the complex
sample; vii) hydridizing the oligonucleotide sequences of the one
or more detectable components to the first and second portions of
the second oligonucleotide sequence segment of the universal
adapter; and viii) detecting one or more signals generated from the
hydridized one or more detectable components.
Example 53A
[0687] A method for detecting one or more biological targets in a
detection assay, comprising: i) providing at least a first and a
second molecular probe, each comprising a binding moiety conjugated
to an oligonucleotide sequence, to a sample comprising the one or
more biological targets; ii) binding the one or more biological
targets with the binding moiety of the first molecular probe and
the binding moiety of the second molecular probe; iii) optionally
hydridizing the oligonucleotide sequence of the first target-bound
molecular probe to a complementary oligonucleotide sequence
conjugated to a bead; iv) hydridizing the oligonucleotide sequence
of the second target-bound molecular probe to a complementary
oligonucleotide sequence conjugated to a detectable component; and
v) detecting a signal generated from the hydridized detectable
component; wherein: a) each binding moiety has a binding affinity
for the one or more biological targets; and b) the conjugation
between the respective oligonucleotide or complementary
oligonucleotide sequences and the binding moiety of the first
molecular probe, the binding moiety of the second molecular probe,
the bead, or the detectable component, comprises a covalent bond
linkage, comprising a hydrazone, oxime, triazine, or other bond,
wherein the formation of the conjugate is at least 90%
efficient.
Example 54A
[0688] A method for detecting one or more biological targets in a
detection assay, comprising: i) providing a first molecular probe,
comprising a first binding moiety conjugated to a first
oligonucleotide sequence, to a sample comprising the one or more
biological targets; ii) binding the one or more biological targets
via the first binding moiety of the first molecular probe; iii)
providing a second molecular probe, comprising a second binding
moiety conjugated to a second oligonucleotide sequence, to the
sample comprising the one or more biological targets; iv) binding
the one or more biological targets via the second binding moiety of
the second molecular probe; v) optionally hydridizing the first
oligonucleotide sequence of the first target-bound molecular probe
to a complementary oligonucleotide sequence conjugated to a bead;
vi) hydridizing the second oligonucleotide sequence of the second
target-bound molecular probe to a complementary oligonucleotide
sequence conjugated to a detectable component; and vii) detecting a
signal generated from the hydridized detectable component; wherein:
a) each binding moiety has a binding affinity for the one or more
biological targets; b) the conjugation between the respective
oligonucleotide or complementary oligonucleotide sequences and the
first binding moiety, the second binding moiety, the bead, or the
detectable component, comprises a covalent bond linkage, comprising
a hydrazone, oxime, triazine, or other bond, wherein the formation
of the conjugate is at least 90% efficient.
Example 55A
[0689] A method for detecting one or more biological targets of a
sample in a detection assay, comprising: i) providing a molecular
probe, comprising a binding moiety and an oligonucleotide sequence,
to a sample comprising one or more biological targets; ii) binding
the one or more biological targets with the binding moiety; iii)
providing a detectable component to the sample, wherein the
detectable component comprises a signal generating moiety
conjugated to an oligonucleotide sequence complementary to the
oligonucleotide sequence of the molecular probe; iv) hydridizing
the oligonucleotide sequence of the target-bound molecular probe to
the detectable component; and v) detecting a signal generated from
the hydridized detectable component; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the signal generating moiety, comprise a covalent bond linkage,
comprising a hydrazone, oxime, triazine, or other bond, wherein the
formation of the conjugates are at least 90% efficient; b) the
binding moiety comprises a binding affinity of less than 10.sup.-4
M for the one or more biological targets.
Example 56A
[0690] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) providing a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence, to the complex sample comprising the one
or more biological targets; ii) specifically binding the one or
more biological targets with the binding moiety; iii) providing a
detectable component to the complex sample, wherein the detectable
component comprising a signal generating moiety conjugated to an
oligonucleotide sequence complementary to the oligonucleotide
sequence of the molecular probe; iv) hydridizing the
oligonucleotide sequence of the target-bound molecular probe to the
complementary oligonucleotide sequence of the detectable component;
and v) detecting a signal generated from the hydridized detectable
component; wherein: a) the conjugation between the oligonucleotide
sequence and the binding moiety and conjugation between the
complementary oligonucleotide sequence and the signal generating
moiety, comprises a covalent bond linkage, comprising a hydrazone,
oxime, triazine, or other bond, wherein the formation of the
conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; and c) the hydridization efficiency of
the oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%.
Example 57A
[0691] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) providing a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence, to the complex sample comprising the one
or more biological targets; ii) specifically binding the one or
more biological targets with the binding moiety; iii) providing a
detectable component to the complex sample, wherein the detectable
component comprising a signal generating moiety conjugated to an
oligonucleotide sequence complementary to the oligonucleotide
sequence of the molecular probe; iv) hydridizing the
oligonucleotide sequence of the target-bound molecular probe to the
complementary oligonucleotide sequence of the detectable component;
and v) detecting a signal generated from the hydridized detectable
component; wherein: a) the conjugation between the oligonucleotide
sequence and the binding moiety and conjugation between the
complementary oligonucleotide sequence and the signal generating
moiety, comprises a covalent bond linkage, comprising a hydrazone,
oxime, triazine, or other bond, wherein the formation of the
conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; and d) the molecular probe has
substantially the same solubility as the binding moiety.
Example 58A
[0692] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) providing a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence, to the complex sample comprising the one
or more biological targets; ii) specifically binding the one or
more biological targets with the binding moiety; iii) providing a
detectable component to the complex sample, wherein the detectable
component comprising a signal generating moiety conjugated to an
oligonucleotide sequence complementary to the oligonucleotide
sequence of the molecular probe; iv) hydridizing the
oligonucleotide sequence of the target-bound molecular probe to the
complementary oligonucleotide sequence of the detectable component;
and v) detecting a signal generated from the hydridized detectable
component; wherein: a) the conjugation between the oligonucleotide
sequence and the binding moiety and conjugation between the
complementary oligonucleotide sequence and the signal generating
moiety, comprises a covalent bond linkage, comprising a hydrazone,
oxime, triazine, or other bond, wherein the formation of the
conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the molecular probe has substantially
the same solubility as the binding moiety; and e) the molecular
probe comprises a molecular weight of between about 15,000 Daltons
to about 450,000 Daltons.
Example 59A
[0693] In certain embodiments, the method for detecting one or more
biological targets of a complex sample in a detection assay,
comprising: i) providing a molecular probe, comprising a binding
moiety conjugated to an oligonucleotide sequence, to the complex
sample comprising the one or more biological targets; ii)
specifically binding the one or more biological targets with the
binding moiety; iii) providing a detectable component to the
complex sample, wherein the detectable component comprising a
signal generating moiety conjugated to an oligonucleotide sequence
complementary to the oligonucleotide sequence of the molecular
probe; iv) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and v) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; and f)
the method of detection generates less false positives than
secondary antibody detection methods.
Example 60A
[0694] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; and g) the prepared molecular probe and
prepared detectable component have at least 90% purity.
Example 61A
[0695] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets.
Example 62A
[0696] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; and i) the sample is
homogeneous or heterogenous mixture.
Example 63A
[0697] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; i) the sample is homogeneous or
heterogenous mixture; and j) the sample comprises biological fluids
or fluidized biological tissue.
Example 64A
[0698] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; i) the sample is homogeneous or
heterogenous mixture; j) the sample comprises biological fluids or
fluidized biological tissue; and k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers.
Example 65A
[0699] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; 1) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; i) the sample is homogeneous or
heterogenous mixture; j) the sample comprises biological fluids or
fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; and l) the sample comprises a range of analytes having
a wide range of binding specificities.
Example 66A
[0700] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; i) the sample is homogeneous or
heterogenous mixture; j) the sample comprises biological fluids or
fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; and m) the time of conducting
the method, from the start of preparation to the end of detection
is between about 2-3 hours.
Example 67A
[0701] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing: a) a
molecular probe, comprising a binding moiety conjugated to an
oligonucleotide sequence; and b) a detectable component, comprising
a signal generating moiety conjugated to an oligonucleotide
sequence complementary to the oligonucleotide sequence of the
molecular probe; ii) providing the molecular probe to the complex
sample comprising the one or more biological targets; iii)
specifically binding the one or more biological targets with the
binding moiety; iv) providing the detectable component to the
complex sample; v) hydridizing the oligonucleotide sequence of the
target-bound molecular probe to the complementary oligonucleotide
sequence of the detectable component; and vi) detecting a signal
generated from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared molecular probe and
prepared detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; i) the sample is homogeneous or
heterogenous mixture; j) the sample comprises biological fluids or
fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; and n) the molecular probe is neutral in
charge.
Example 68A
[0702] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating a molecular probe, comprising a binding moiety conjugated
to an oligonucleotide sequence, comprising: a) introducing a
modified binding moiety into a buffered solution; b) conjugating
the modified binding moieties with at least one modified
oligonucleotide at greater than 90% efficiency to form binding
moiety-oligonucleotide conjugates; and c) isolating the binding
moiety-oligonucleotide conjugates from the conjugation solution by
binding the conjugates to an immobilized binder, removing the
unconjugated oligonucleotide in a wash step followed by release of
the bound conjugate from the solid support; and ii) preparing and
isolating a detectable component, comprising a signal generating
moiety conjugated to an oligonucleotide sequence complementary to
the oligonucleotide sequence of the molecular probe, comprising: a)
introducing a modified signal generating moiety into a buffered
solution; b) conjugating the modified signal generating moieties
with at least one modified complementary oligonucleotide at greater
than 90% efficiency to form signal generating moiety-complementary
oligonucleotide conjugates; and c) isolating the signal generating
moiety-complementary oligonucleotide conjugates from the
conjugation solution by binding the conjugates to an immobilized
binder, removing the unconjugated oligonucleotide in a wash step
followed by release of the bound conjugate from the solid support;
and iii) providing the molecular probe to the complex sample
comprising the one or more biological targets; iv) specifically
binding the one or more biological targets with the binding moiety;
v) providing the detectable component to the complex sample; vi)
hydridizing the oligonucleotide sequence of the target-bound
molecular probe to the complementary oligonucleotide sequence of
the detectable component; and vii) detecting a signal generated
from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the signal generating moiety, comprises a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond, wherein the formation of the conjugates are at least 90%
efficient; b) the binding moiety comprises a binding affinity of
less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the
molecular probe has substantially the same solubility as the
binding moiety; e) the molecular probe comprises a molecular weight
of between about 15,000 Daltons to about 450,000 Daltons; f) the
method of detection generates less false positives than secondary
antibody detection methods; g) the prepared and isolated molecular
probe and prepared and isolated detectable component have at least
90% purity; h) the solubility of the molecular probe minimizes
non-specific binding to the one or more biological targets; i) the
sample is homogeneous or heterogenous mixture; j) the sample
comprises biological fluids or fluidized biological tissue; k) the
sample comprises cells, membranes, biological molecules,
metabolites, or disease biomarkers; l) the sample comprises a range
of analytes having a wide range of binding specificities; m) the
time of conducting the method, from the start of preparation to the
end of detection is between about 2-3 hours; and n) the molecular
probe is neutral in charge.
Example 69A
[0703] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating a molecular probe, comprising a binding moiety conjugated
to an oligonucleotide sequence, comprising: a) introducing a
modified binding moiety into a buffered solution; b) conjugating
the modified binding moieties with at least one modified
oligonucleotide at greater than 90% efficiency to form binding
moiety-oligonucleotide conjugates; and c) isolating the binding
moiety-oligonucleotide conjugates from the conjugation solution by
binding the conjugates to an immobilized binder, removing the
unconjugated oligonucleotide in a wash step followed by release of
the bound conjugate from the solid support; and ii) preparing and
isolating a detectable component, comprising a scaffold, comprising
one or more signal generating moieties, conjugated to an
oligonucleotide sequence complementary to the oligonucleotide
sequence of the molecular probe, comprising: a) introducing a
modified scaffold, comprising the one or more signal generating
moieties, into a buffered solution; b) conjugating the modified
scaffold with at least one modified complementary oligonucleotide
at greater than 90% efficiency to form scaffold-complementary
oligonucleotide conjugates; and c) isolating the
scaffold-complementary oligonucleotide conjugates from the
conjugation solution by binding the conjugates to an immobilized
binder, removing the unconjugated oligonucleotide in a wash step
followed by release of the bound conjugate from the solid support;
and iii) providing the molecular probe to the complex sample
comprising the one or more biological targets; iv) specifically
binding the one or more biological targets with the binding moiety;
v) providing the detectable component to the complex sample; vi)
hydridizing the oligonucleotide sequence of the target-bound
molecular probe to the complementary oligonucleotide sequence of
the detectable component; and vii) detecting a signal generated
from the hydridized detectable component; wherein: a) the
conjugation between the oligonucleotide sequence and the binding
moiety and conjugation between the complementary oligonucleotide
sequence and the scaffold, comprises a covalent bond linkage,
comprising a hydrazone, oxime, triazine, or other bond, wherein the
formation of the conjugates are at least 90% efficient; b) the
binding moiety comprises a binding affinity of less than 10.sup.-4
M for the one or more biological targets; c) the hydridization
efficiency of the oligonucleotide sequence to the complementary
oligonucleotide sequence is at least 50%; d) the molecular probe
has substantially the same solubility as the binding moiety; e) the
molecular probe comprises a molecular weight of between about
15,000 Daltons to about 450,000 Daltons; f) the method of detection
generates less false positives than secondary antibody detection
methods; g) the prepared and isolated molecular probe and prepared
and isolated detectable component have at least 90% purity; h) the
solubility of the molecular probe minimizes non-specific binding to
the one or more biological targets; i) the sample is homogeneous or
heterogenous mixture; j) the sample comprises biological fluids or
fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the molecular probe is neutral in
charge; and o) the scaffold comprises a dendrimer, polysaccharide,
or a dextran.
Example 70A
[0704] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; and p) the one or more molecular
probes comprise a range of specificities for the one or more
biological targets.
Example 71A
[0705] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; and q) the detection assay comprises a singleplex or
multiplex detection assay, comprising immunodetection, flow
cytometry, immunohistochemistry, microspcopy, imaging, high content
screening (HCS), ELISA, ELISpot, arrays, bead arrays, or
combinations or derivatives thereof.
Example 72A
[0706] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof.
Example 73A
[0707] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; and s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof.
Example 74A
[0708] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; and t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof.
Example 75A
[0709] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; and u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise.
Example 76A
[0710] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; and v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO.
Example 77A
[0711] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO; and w) the modified binding moiety, the
modified scaffold, the oligonucleotide sequence, and/or the
complementary oligonucleotide sequence comprise HyNic or 4-FB.
Example 78A
[0712] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO; w) the modified binding moiety, the
modified scaffold, the oligonucleotide sequence, and/or the
complementary oligonucleotide sequence comprise HyNic or 4-FB; and
x) the one or more molecular probes comprise unique,
distinguishable, and/or specifically designed oligonucleotide
sequences.
Example 79A
[0713] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO; w) the modified binding moiety, the
modified scaffold, the oligonucleotide sequence, and/or the
complementary oligonucleotide sequence comprise HyNic or 4-FB; x)
the one or more molecular probes comprise unique, distinguishable,
and/or specifically designed oligonucleotide sequences; and y) the
one or more detectable components comprise unique, distinguishable,
and/or specifically designed complementary oligonucleotide
sequences.
Example 80A
[0714] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO; w) the modified binding moiety, the
modified scaffold, the oligonucleotide sequence, and/or the
complementary oligonucleotide sequence comprise HyNic or 4-FB; x)
the one or more molecular probes comprise unique, distinguishable,
and/or specifically designed oligonucleotide sequences; y) the one
or more detectable components comprise unique, distinguishable,
and/or specifically designed complementary oligonucleotide
sequences; and z) the oligonucleotide sequences of the one or more
molecular probes are uniquely and specifically designed to
hybridize to the complementary oligonucleotide sequence of the one
or more detectable components.
Example 81A
[0715] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing the one or more molecular probes to the
complex sample comprising the one or more biological targets; iv)
specifically binding the one or more biological targets with the
binding moieties of the one or more molecular probes; v) providing
the one or more detectable components to the complex sample; vi)
hydridizing the oligonucleotide sequences of the one or more
target-bound molecular probes to the complementary oligonucleotide
sequences of the one or more detectable components; and vii)
detecting one or more signals generated from the one or more
hydridized detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO; w) the modified binding moiety, the
modified scaffold, the oligonucleotide sequence, and/or the
complementary oligonucleotide sequence comprise HyNic or 4-FB; x)
the one or more molecular probes comprise unique, distinguishable,
and/or specifically designed oligonucleotide sequences; y) the one
or more detectable components comprise unique, distinguishable,
and/or specifically designed complementary oligonucleotide
sequences; z) the oligonucleotide sequences of the one or more
molecular probes are uniquely and specifically designed to
hybridize to the complementary oligonucleotide sequence of the one
or more detectable components; and a2) the oligonucleotide
sequences and/or complementary oligonucleotide sequences, comprise
3'-oligonucleotides, 5'-oligonucleotides, LNAs, PNAs, or
combinations or derivatives thereof.
Example 82A
[0716] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified scaffold, comprising the one or more signal
generating moieties, into a buffered solution; b) conjugating the
modified scaffold with at least one modified oligonucleotide at
greater than 90% efficiency to form scaffold-oligonucleotide
conjugates; and c) isolating the scaffold-oligonucleotide
conjugates from the conjugation solution by binding the conjugates
to an immobilized binder, removing the unconjugated oligonucleotide
in a wash step followed by release of the bound conjugate from the
solid support; and iii) providing the one or more molecular probes
to the complex sample comprising the one or more biological
targets; iv) specifically binding the one or more biological
targets with the binding moieties of the one or more molecular
probes; v) providing a universal adapter to the complex sample,
wherein the universal adapter comprised an oligonucleotide sequence
having a first sequence segment complementary to the
oligonucleotide sequence of the molecular probe and a second
sequence segment complementary to the oligonucleotide sequence of
the detectable component; vi) hydridizing the oligonucleotide
sequences of the one or more target-bound molecular probes to the
first oligonucleotide sequence segment of the universal adapter;
vii) providing the one or more detectable components to the complex
sample; viii) hydridizing the oligonucleotide sequences of the one
or more detectable components to the second oligonucleotide
sequence segment of the universal adapter; and ix) detecting one or
more signals generated from the hydridized one or more detectable
components; wherein: a) the conjugation between the oligonucleotide
sequence and the binding moiety and conjugation between the
complementary oligonucleotide sequence and the scaffold, comprises
a covalent bond linkage, comprising a hydrazone, oxime, triazine,
or other bond, wherein the formation of the conjugates are at least
90% efficient; b) the binding moiety comprises a binding affinity
of less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the one
or more molecular probes have substantially the same solubility as
the one or more binding moieties, respectively; e) the one or more
molecular probes comprise molecular weights of between about 15,000
Daltons to about 450,000 Daltons; f) the method of detection
generates less false positives than secondary antibody detection
methods; g) the prepared and isolated one or more molecular probes
and one or more detectable components have at least 90% purity; h)
the solubility of the one or more molecular probes minimizes
non-specific binding to the one or more biological targets; i) the
sample is homogeneous or heterogenous mixture; j) the sample
comprises biological fluids or fluidized biological tissue; k) the
sample comprises cells, membranes, biological molecules,
metabolites, or disease biomarkers; l) the sample comprises a range
of analytes having a wide range of binding specificities; m) the
time of conducting the method, from the start of preparation to the
end of detection is between about 2-3 hours; n) the one or more
molecular probes are neutral in charge; o) the scaffold comprises a
dendrimer, polysaccharide, or a dextran; p) the one or more
molecular probes comprise a range of specificities for the one or
more biological targets; q) the detection assay comprises a
singleplex or multiplex detection assay, comprising
immunodetection, flow cytometry, immunohistochemistry, microspcopy,
imaging, high content screening (HCS), ELISA, ELISpot, arrays, bead
arrays, or combinations or derivatives thereof; r) the binding
moiety comprises an antibody, a protein, a peptide, a carbohydrate,
a nuclear receptor, a small molecule, or combinations or
derivatives thereof; s) the one or more biological target comprises
an antigen, a pathogen, a protein, a peptide, an epitope, a
carbohydrate-containing molecule, a small molecule, or combinations
or derivatives thereof; t) the one or more signal generating
moieties, comprise one or more fluorophors, biofluorescent
proteins, quantum dots, Raman particles, or combinations or
derivatives thereof; u) the one or more signal generating moieties
provides an enhanced signal that minimizes detection errors from
background noise; v) the one or more molecular probes and/or the
one or more detectable components further comprise a spacer group,
comprising a polymerized ethylene oxide, a PEG, or a PEO; w) the
modified binding moiety, the modified scaffold, the oligonucleotide
sequence, and/or the complementary oligonucleotide sequence
comprise HyNic or 4-FB; x) the one or more molecular probes
comprise unique, distinguishable, and/or specifically designed
oligonucleotide sequences; y) the one or more detectable components
comprise unique, distinguishable, and/or specifically designed
complementary oligonucleotide sequences; z) the oligonucleotide
sequences of the one or more molecular probes are uniquely and
specifically designed to hybridize to the complementary
oligonucleotide sequence of the one or more detectable components;
and a2) the oligonucleotide sequences and/or complementary
oligonucleotide sequences, comprise 3'-oligonucleotides,
5'-oligonucleotides, LNAs, PNAs, or combinations or derivatives
thereof.
Example 83A
[0717] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence complementary
to the oligonucleotide sequence of the molecular probe, comprising:
a) introducing a modified scaffold, comprising the one or more
signal generating moieties, into a buffered solution; b)
conjugating the modified scaffold with at least one modified
complementary oligonucleotide at greater than 90% efficiency to
form scaffold-complementary oligonucleotide conjugates; and c)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation solution by binding the conjugates to an
immobilized binder, removing the unconjugated oligonucleotide in a
wash step followed by release of the bound conjugate from the solid
support; and iii) providing at least a first molecular probe and a
second molecular probe, comprising a first binding moiety
conjugated to a first oligonucleotide sequence and a second binding
moiety conjugated to a second oligonucleotide sequence,
respectively, to the complex sample comprising the one or more
biological targets; iv) specifically binding the one or more
biological targets with the binding moiety of the first molecular
probe and the binding moiety of the second molecular probe; v)
providing the one or more detectable components to the complex
sample; vi) hydridizing the first oligonucleotide sequence of the
first target-bound molecular probe to a complementary
oligonucleotide sequence conjugated to a bead; vii) hydridizing the
second oligonucleotide sequence of the second target-bound
molecular probe to the complementary oligonucleotide sequences of
the one or more detectable components; and viii) detecting one or
more signals generated from the one or more hydridized detectable
components; wherein: a) the conjugation between the oligonucleotide
sequence and the binding moiety and conjugation between the
complementary oligonucleotide sequence and the scaffold, comprises
a covalent bond linkage, comprising a hydrazone, oxime, triazine,
or other bond, wherein the formation of the conjugates are at least
90% efficient; b) the binding moiety comprises a binding affinity
of less than 10.sup.-4 M for the one or more biological targets; c)
the hydridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50%; d) the one
or more molecular probes have substantially the same solubility as
the one or more binding moieties, respectively; e) the one or more
molecular probes comprise molecular weights of between about 15,000
Daltons to about 450,000 Daltons; f) the method of detection
generates less false positives than secondary antibody detection
methods; g) the prepared and isolated one or more molecular probes
and one or more detectable components have at least 90% purity; h)
the solubility of the one or more molecular probes minimizes
non-specific binding to the one or more biological targets; i) the
sample is homogeneous or heterogenous mixture; j) the sample
comprises biological fluids or fluidized biological tissue; k) the
sample comprises cells, membranes, biological molecules,
metabolites, or disease biomarkers; l) the sample comprises a range
of analytes having a wide range of binding specificities; m) the
time of conducting the method, from the start of preparation to the
end of detection is between about 2-3 hours; n) the one or more
molecular probes are neutral in charge; o) the scaffold comprises a
dendrimer, polysaccharide, or a dextran; p) the one or more
molecular probes comprise a range of specificities for the one or
more biological targets; q) the detection assay comprises a
singleplex or multiplex detection assay, comprising
immunodetection, flow cytometry, immunohistochemistry, microspcopy,
imaging, high content screening (HCS), ELISA, ELISpot, arrays, bead
arrays, or combinations or derivatives thereof; r) the binding
moiety comprises an antibody, a protein, a peptide, a carbohydrate,
a nuclear receptor, a small molecule, or combinations or
derivatives thereof; s) the one or more biological target comprises
an antigen, a pathogen, a protein, a peptide, an epitope, a
carbohydrate-containing molecule, a small molecule, or combinations
or derivatives thereof; t) the one or more signal generating
moieties, comprise one or more fluorophors, biofluorescent
proteins, quantum dots, Raman particles, or combinations or
derivatives thereof; u) the one or more signal generating moieties
provides an enhanced signal that minimizes detection errors from
background noise; v) the one or more molecular probes and/or the
one or more detectable components further comprise a spacer group,
comprising a polymerized ethylene oxide, a PEG, or a PEO; w) the
modified binding moiety, the modified scaffold, the oligonucleotide
sequence, and/or the complementary oligonucleotide sequence
comprise HyNic or 4-FB; x) the one or more molecular probes
comprise unique, distinguishable, and/or specifically designed
oligonucleotide sequences; y) the one or more detectable components
comprise unique, distinguishable, and/or specifically designed
complementary oligonucleotide sequences; z) the oligonucleotide
sequences of the one or more molecular probes are uniquely and
specifically designed to hybridize to the complementary
oligonucleotide sequence of the one or more detectable components;
a2) the oligonucleotide sequences and/or complementary
oligonucleotide sequences, comprise 3'-oligonucleotides,
5'-oligonucleotides, LNAs, PNAs, or combinations or derivatives
thereof.
Example 84A
[0718] A method for detecting one or more biological targets of a
complex sample in a detection assay, comprising: i) preparing and
isolating one or more molecular probes, comprising a binding moiety
conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified binding moiety into a buffered solution; b)
conjugating the modified binding moieties with at least one
modified oligonucleotide at greater than 90% efficiency to form
binding moiety-oligonucleotide conjugates; and c) isolating the
binding moiety-oligonucleotide conjugates from the conjugation
solution by binding the conjugates to an immobilized binder,
removing the unconjugated oligonucleotide in a wash step followed
by release of the bound conjugate from the solid support; and ii)
preparing and isolating one or more detectable components,
comprising a scaffold, comprising one or more signal generating
moieties, conjugated to an oligonucleotide sequence, comprising: a)
introducing a modified scaffold, comprising the one or more signal
generating moieties, into a buffered solution; b) conjugating the
modified scaffold with at least one modified oligonucleotide at
greater than 90% efficiency to form scaffold-oligonucleotide
conjugates; and c) isolating the scaffold-oligonucleotide
conjugates from the conjugation solution by binding the conjugates
to an immobilized binder, removing the unconjugated oligonucleotide
in a wash step followed by release of the bound conjugate from the
solid support; and iii) providing at least a first molecular probe
and a second molecular probe, comprising a first binding moiety
conjugated to a first oligonucleotide sequence and a second binding
moiety conjugated to a second oligonucleotide sequence,
respectively, to the complex sample comprising the one or more
biological targets; iv) specifically binding the one or more
biological targets with the binding moiety of the first molecular
probe and the binding moiety of the second molecular probe; v)
providing a universal adapter to the complex sample, wherein the
universal adapter comprised an oligonucleotide sequence having a
first sequence segment complementary to the oligonucleotide
sequence of the molecular probe and a second sequence segment
complementary to the oligonucleotide sequence of the detectable
component; vi) hydridizing the first oligonucleotide sequence of
the first target-bound molecular probe to a first portion of the
first oligonucleotide sequence segment of the universal adapter;
vii) hydridizing the second oligonucleotide sequence of the second
target-bound molecular probe to a second portion of the first
oligonucleotide sequence segment of the universal adapter; viii)
providing the one or more detectable components to the complex
sample; ix) hydridizing the oligonucleotide sequences of the one or
more detectable components to the first and second portions of the
second oligonucleotide sequence segment of the universal adapter;
and x) detecting one or more signals generated from the hydridized
one or more detectable components; wherein: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the scaffold, comprises a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond, wherein the formation of
the conjugates are at least 90% efficient; b) the binding moiety
comprises a binding affinity of less than 10.sup.-4 M for the one
or more biological targets; c) the hydridization efficiency of the
oligonucleotide sequence to the complementary oligonucleotide
sequence is at least 50%; d) the one or more molecular probes have
substantially the same solubility as the one or more binding
moieties, respectively; e) the one or more molecular probes
comprise molecular weights of between about 15,000 Daltons to about
450,000 Daltons; f) the method of detection generates less false
positives than secondary antibody detection methods; g) the
prepared and isolated one or more molecular probes and one or more
detectable components have at least 90% purity; h) the solubility
of the one or more molecular probes minimizes non-specific binding
to the one or more biological targets; i) the sample is homogeneous
or heterogenous mixture; j) the sample comprises biological fluids
or fluidized biological tissue; k) the sample comprises cells,
membranes, biological molecules, metabolites, or disease
biomarkers; l) the sample comprises a range of analytes having a
wide range of binding specificities; m) the time of conducting the
method, from the start of preparation to the end of detection is
between about 2-3 hours; n) the one or more molecular probes are
neutral in charge; o) the scaffold comprises a dendrimer,
polysaccharide, or a dextran; p) the one or more molecular probes
comprise a range of specificities for the one or more biological
targets; q) the detection assay comprises a singleplex or multiplex
detection assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof; r) the binding moiety comprises an antibody, a
protein, a peptide, a carbohydrate, a nuclear receptor, a small
molecule, or combinations or derivatives thereof; s) the one or
more biological target comprises an antigen, a pathogen, a protein,
a peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof; t) the one or
more signal generating moieties, comprise one or more fluorophors,
biofluorescent proteins, quantum dots, Raman particles, or
combinations or derivatives thereof; u) the one or more signal
generating moieties provides an enhanced signal that minimizes
detection errors from background noise; v) the one or more
molecular probes and/or the one or more detectable components
further comprise a spacer group, comprising a polymerized ethylene
oxide, a PEG, or a PEO; w) the modified binding moiety, the
modified scaffold, the oligonucleotide sequence, and/or the
complementary oligonucleotide sequence comprise HyNic or 4-FB; x)
the one or more molecular probes comprise unique, distinguishable,
and/or specifically designed oligonucleotide sequences; y) the one
or more detectable components comprise unique, distinguishable,
and/or specifically designed complementary oligonucleotide
sequences; z) the oligonucleotide sequences of the one or more
molecular probes are uniquely and specifically designed to
hybridize to the complementary oligonucleotide sequence of the one
or more detectable components; and a2) the oligonucleotide
sequences and/or complementary oligonucleotide sequences, comprise
3'-oligonucleotides, 5'-oligonucleotides, LNAs, PNAs, or
combinations or derivatives thereof.
Example 85A
[0719] A method for detecting one or more biological targets in a
detection assay, comprising: i) providing at least a first and a
second molecular probe, each comprising a binding moiety conjugated
to an oligonucleotide sequence, to a sample comprising the one or
more biological targets; ii) binding the one or more biological
targets with the binding moiety of the first molecular probe and
the binding moiety of the second molecular probe; iii) optionally
hydridizing the oligonucleotide sequence of the first target-bound
molecular probe to a complementary oligonucleotide sequence
conjugated to a bead; iv) hydridizing the oligonucleotide sequence
of the second target-bound molecular probe to a complementary
oligonucleotide sequence conjugated to a detectable component; and
v) detecting a signal generated from the hydridized detectable
component; wherein: a) each binding moiety has a binding affinity
for the one or more biological targets; and b) the conjugation
between the respective oligonucleotide or complementary
oligonucleotide sequences and the binding moiety of the first
molecular probe, the binding moiety of the second molecular probe,
the bead, or the detectable component, comprises a covalent bond
linkage, comprising a hydrazone, oxime, triazine, or other bond,
wherein the formation of the conjugate is at least 90%
efficient.
Example 86A
[0720] A method for detecting one or more biological targets in a
detection assay, comprising: i) providing a first molecular probe,
comprising a first binding moiety conjugated to a first
oligonucleotide sequence, to a sample comprising the one or more
biological targets; ii) binding the one or more biological targets
via the first binding moiety of the first molecular probe; iii)
providing a second molecular probe, comprising a second binding
moiety conjugated to a second oligonucleotide sequence, to the
sample comprising the one or more biological targets; iv) binding
the one or more biological targets via the second binding moiety of
the second molecular probe; v) optionally hydridizing the first
oligonucleotide sequence of the first target-bound molecular probe
to a complementary oligonucleotide sequence conjugated to a bead;
vi) hydridizing the second oligonucleotide sequence of the second
target-bound molecular probe to a complementary oligonucleotide
sequence conjugated to a detectable component; and vii) detecting a
signal generated from the hydridized detectable component; wherein:
a) each binding moiety has a binding affinity for the one or more
biological targets; b) the conjugation between the respective
oligonucleotide or complementary oligonucleotide sequences and the
first binding moiety, the second binding moiety, the bead, or the
detectable component, comprises a covalent bond linkage, comprising
a hydrazone, oxime, triazine, or other bond, wherein the formation
of the conjugate is at least 90% efficient.
Example 87A
[0721] A method for crosslinking, comprising: i) introducing to a
sample comprising one or more targets: a) one or more first
antibody-oligonucleotide conjugates, comprising a first antibody
conjugated to a first oligonucleotide sequence; and b) one or more
second antibody-oligonucleotide conjugates, comprising a second
antibody conjugated to a second oligonucleotide sequence; ii)
binding the one or more targets with the first antibody of the one
or more first antibody-oligonucleotide conjugates and with the
second antibody of the one or more second antibody-oligonucleotide
conjugates to form one or more sandwich-complexes; iii) contacting
the one or more sandwich-complexes with: a) one or more first
bead-oligonucleotide conjugate, comprising a first bead conjugated
to a complementary first oligonucleotide sequence; and b) one or
more second bead-oligonucleotide conjugate, comprising a second
bead conjugated to a complementary second oligonucleotide sequence;
iv) crosslinking the one or more sandwich-complexes by: a)
hybridizing the first oligonucleotide sequences of the one or more
sandwich-complexes with the complementary first oligonucleotide
sequences of the one or more first bead-oligonucleotide conjugates;
and b) hybridizing the second oligonucleotide sequences of the one
or more sandwich-complexes with the complementary second
oligonucleotide sequences of the one or more second
bead-oligonucleotide conjugates.
Example 88A
[0722] The crosslinking method of Example 87A, wherein the
formation of the crosslinked one or more sandwich-complexes forms
an agglutination.
Example 89A
[0723] The crosslinking method of one or more of Examples 87A-88A,
wherein the method further comprises detecting and/or measuring the
degree of the formed agglutination to determine the amount of the
one or more targets in the sample.
Example 90A
[0724] The crosslinking method of one or more of Examples 87A-89A,
wherein the first antibody or the second antibody comprise a
monoclonal antibody or a polyclonal antibody.
Example 91A
[0725] The crosslinking method of one or more of Examples 87A-90A,
wherein the first antibody comprises a first monoclonal antibody
and the second antibody comprises a second monoclonal antibody.
Example 92A
[0726] The crosslinking method of Example 91A, wherein the first
monoclonal antibody is raised against a first epitope of the target
and the second monoclonal antibody is raised against a second
epitope of the target.
Example 93A
[0727] The crosslinking method of one or more of Examples 87A-92A,
wherein the first antibody comprises a first polyclonal antibody
and the second antibody comprises a second polyclonal antibody.
Example 94A
[0728] The crosslinking method of Example 93A, wherein a first
portion of the first polyclonal antibody binds to a first epitope
of the target and a second portion of the second polyclonal
antibody binds to a second epitope of the target.
Example 95A
[0729] The crosslinking method of one or more of Examples 89A-94A,
wherein the detection comprises a singleplex or multiplex
detection, comprising: immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof.
Example 96A
[0730] A method of preparing a detectable component having one or
more signal-generating moieties, comprising: i) modifying a
scaffold with S-HyNic to form a HyNic-modified scaffold; ii)
conjugating a 4FB-modified oligonucleotide to the HyNic-modified
scaffold, wherein the conjugation is at least 90% efficient; and
iii) modifying the scaffold of the oligonucleotide-scaffold
conjugate with one or more signal-generating moieties to form the
detectable component.
Example 97A
[0731] A method of preparing one or more components, comprising: i)
modifying one or more scaffolds; ii) conjugating one or more
modified oligonucleotides to the one or more modified scaffolds,
wherein the conjugation is at least 90% efficient; and iii)
modifying the scaffold of the one or more oligonucleotide-scaffold
conjugates with one or more signal-generating moieties to form one
or more components; wherein the conjugation between the one or more
modified-oligonucleotides and the one or more modified scaffolds
comprises a covalent bond linkage, comprising a hydrazone, oxime,
triazine, or other bond.
Example 98A
[0732] The preparation method of Example 97A, wherein the one or
more scaffolds comprises: a hydrophilic polymer, a dendrimer, a
bead, or combinations thereof.
Example 99A
[0733] The preparation method of one or more of Examples 97A-98A,
wherein the hydrophilic polymer comprises a polysaccharide
molecule.
Example 100A
[0734] The preparation method of Example 99A wherein the
polysaccharide molecule comprises a dextran or an
amino-dextran.
Example 101A
[0735] The preparation method of one or more of Examples 97A-100A,
wherein the one or more signal-generating moieties comprises a
directly detectable signal-generating moiety or an indirectly
detectable signal-generating moiety.
Example 102A
[0736] The preparation method of Example 101A, wherein the directly
detectable signal-generating moiety comprises: a fluorescent dye; a
luminescent species; a phosphorescent species; a radioactive
substance; a nanoparticle; a diffracting particle; a raman
particle; a metal particle; a magnetic particle; a bead; an RFID
tag; a microbarcode particle; or combinations thereof.
Example 103A
[0737] The preparation method of one or more of Examples 101A-102A,
wherein the indirectly detectable signal-generating moiety
comprises: an enzyme; an antibody; an antigen; a nucleic acid; a
nucleic acid analog; a ligand; a substrate; a hapten; or
combinations thereof.
Example 104A
[0738] The preparation method of one or more of Examples 97A-103A,
wherein the one or more scaffolds signal-generating moieties
comprise: a fluorophore; a chromophore; a biofluorescent protein; a
fluorophore labeled DNA dendrimer; a Quantum Dot; a
chemiluminescent compound; a electrochemiluminescent label; a
bioluminescent label; a polymer; a polymer particle; a bead; a
Raman particle; a heavy metal chelate; gold or other metal
particles or heavy atoms; a spin label; a radioactive isotope; a
secondary reporter; a hapten; a nucleic acid or nucleic acid
analog; a protein; a peptide ligand or substrate; a receptor; an
enzyme; an enzyme substrate; an antibody; an antibody fragment; an
antigen; or combinations or derivatives thereof. In addition, the
preparation methods of one or more of Examples 97A-103A, wherein
the one or more scaffolds signal-generating moieties may also
comprise: polymer-based heavy metal chelates conjugated to
antibodies and other binders may also be used to multiplex protein
analysis using a technique named CyTOF (CYtometry Time Of Flight).
Heavy metal isotopes of Ru, Rh, Pd, Ag, In, La, Hf, Re, Ir, Pt, Au,
Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb and Lu can be
used.
Example 105A
[0739] A method for binding, comprising: i) providing at least a
first molecular probe and a second molecular probe to a sample
comprising a plurality of cells, wherein the first binding moiety
is conjugated to a first oligonucleotide sequence and a second
binding moiety is conjugated to a second oligonucleotide sequence;
ii) specifically binding a first target of a first cell and a
second target of a second cell of the plurality of cells,
comprising: a) binding the first target with the first binding
moiety of the first molecular probe; and b) binding the second
target with the second binding moiety of the second molecular
probe; iii) providing to the sample one or more detectable
components, comprising: a) a first detectable component, comprising
one or more signal generating moieties conjugated to a first
oligonucleotide complementary to the first oligonucleotide sequence
of the first molecular probe; and b) a second detectable component,
comprising one or more signal generating moieties conjugated to a
second oligonucleotide complementary to the second oligonucleotide
sequence of the second molecular probe; iv) hybridizing the first
oligonucleotide sequence of the first bound molecular probe to the
complementary first oligonucleotide sequence of the first
detectable component; v) hybridizing the second oligonucleotide
sequence of the second bound molecular probe to the complementary
second oligonucleotide sequence of the second detectable component;
and vi) detecting by flow cytometry the one or more signals
generated from the first hybridized detectable component and the
second hybridized detectable component; wherein:
[0740] a) the conjugation of the first molecular probe and the
second molecular probe and the conjugation of the first detectable
component and the second detectable component comprise a covalent
bond linkage, comprising a hydrazone, oxime, triazine, or other
bond; b) the formation of the conjugates are at least 90%
efficient; and c) the first binding moiety has a binding affinity
for the first target of less than 10.sup.-4 M and the second
binding moiety has a binding affinity for the second target of less
than 10.sup.-4 M.
Example 106A
[0741] The binding method of Example 105A, wherein the first target
comprises a first biomarker of the first cell and the second target
comprises a second biomarker of the second cell.
Example 107A
[0742] The binding method of one or more of Examples 105A-106A,
wherein the first biomarker comprises a protein biomarker and the
second biomarker comprises a protein biomarker.
Example 108A
[0743] The binding method of one or more of Examples 106A-107A,
wherein the first biomarker comprises an adhesion molecule and the
second biomarker comprises an adhesion molecule.
Example 109A
[0744] The binding method of one or more of Examples 105A-108A,
wherein the plurality of cells comprises spleenocytes.
Example 110A
[0745] The binding method of one or more of Examples 105-109,
wherein the first cell is a T-cell and the second cell is a
B-cell.
Example 111A
[0746] A method for binding, comprising: i) electrophoresing
material derived from lysing a plurality of cells; ii) transferring
the electrophoresed material to a membrane; iii) incubating the
membrane with at least one molecular probe, comprising a binding
moiety conjugated to an oligonucleotide sequence; iv) specifically
binding at least one target of the electrophoresed material with
the binding moiety of the at least one molecular probe; v) further
incubating the membrane with at least one detectable component,
comprising one or more signal generating moieties conjugated to an
oligonucleotide complementary to the oligonucleotide sequence of
the at least one molecular probe; and vi) hybridizing the
oligonucleotide sequence of the at least one bound molecular probe
to the complementary oligonucleotide sequence of the at least one
detectable component; wherein: a) the conjugation of the at least
one molecular probe and the conjugation of the at least one
detectable component comprise a covalent bond linkage, comprising a
hydrazone, oxime, triazine, or other bond; b) the formation of the
conjugates are at least 90% efficient; and c) the binding moiety of
the at least one molecular probe has a binding affinity for the at
least one target of less than 10.sup.-4 M.
Example 112A
[0747] The binding method of Example 111, wherein the membrane
comprises a PVDF membrane.
Example 113A
[0748] The binding method of one or more of Examples 111A-112A,
wherein the one or more signal generating moieties of the at least
one detectable component comprises horseradish peroxidase.
Example 114A
[0749] The binding method of one or more of Examples 111A-113A,
wherein the electrophoresing of the lysate comprises a Western
Blot.
Example 115A
[0750] The binding method of one or more of Examples 111A-114A,
wherein the method comprises detecting the at least one signal
generated from the one or more signal generating moieties on the at
least one hybridized detectable component.
Example 116A
[0751] The binding method of one or more of Examples 111A-115A,
wherein the detection comprises a singleplex or multiplex
detection, comprising: immunodetection, flow cytometry,
chemiluminescence detection, infrared detection,
immunohistochemistry, ELISA, ELISpot, arrays, bead arrays, or
combinations or derivatives thereof.
Example 117A
[0752] A method of binding one or more targets, comprising: i)
preparing a plurality molecular probes, comprising at least: a)
conjugating a universal oligonucleotide sequence to a first binding
moiety to form a first molecular probe; and b) conjugating a
universal oligonucleotide sequence to a second binding moiety to
form a second molecular probe; ii) hybridizing the plurality of
formed molecular probes with a plurality of universal adapters,
comprising: a) introducing a first universal adapter to the first
molecular probe, wherein the first universal adapter comprises an
oligonucleotide sequence comprising: i) a complementary universal
sequence segment; and ii) a first sequence segment; b) hybridizing
the universal oligonucleotide sequence of the first molecular probe
to the complementary universal sequence segment of the first
universal adapter; c) introducing a second universal adapter to the
second molecular probe, wherein the second universal adapter
comprises an oligonucleotide sequence comprising: i) a
complementary universal sequence segment; and ii) a second sequence
segment; d) hybridizing the universal oligonucleotide sequence of
the second molecular probe to the complementary universal sequence
segment of the second universal adapter; and iii) introducing the
plurality of hybridized molecular probes to a sample comprising one
or more targets; iv) binding the one or more targets with the
plurality of hybridized molecular probes, comprising: a) binding a
first target of the one or more targets with the first binding
moiety of the first hybridized molecular probe; b) binding a second
target of the one or more targets with the second binding moiety of
the second hybridized molecular probe; v) introducing to the sample
a plurality of detectable components, comprising: a) a first
detectable component comprising one or more signal generating
moieties conjugated to a first oligonucleotide sequence
complementary to the first sequence segment of the first universal
adapter; and b) a second detectable component comprising one or
more signal generating moieties conjugated to a second
oligonucleotide sequence complementary to the second sequence
segment of the second universal adapter; and vi) hybridizing the
plurality of bound molecular probes with the plurality of
detectable components, comprising: a) hybridizing the first
sequence segment of the first bound molecular probe to the
complementary first oligonucleotide sequence of the first
detectable component; and b) hybridizing the second sequence
segment of the second bound molecular probe to the complementary
second oligonucleotide sequence of the second detectable component;
wherein: a) the conjugation of the plurality of molecular probes
and the conjugation of the plurality of the detectable components
comprise a covalent bond linkage, comprising a hydrazone, oxime,
triazine, or other bond; b) the formation of the conjugates are at
least 90% efficient; and c) the first binding moiety has a binding
affinity for the first target of less than 10.sup.-4 M and the
second binding moiety has a binding affinity for the second target
of less than 10.sup.-4 M.
Example 118A
[0753] The binding method of Example 117A, wherein the method
further comprises detecting a signal generated from the hybridized
detectable component.
Example 119A
[0754] The binding method of one or more of Examples 117A-118A,
wherein the detectable component comprises a scaffold comprising
one or more signal generating moieties.
Example 120A
[0755] The binding method of Example 119A, wherein the scaffold is
conjugated to the oligonucleotide sequence.
Example 121A
[0756] The binding method of one or more of Examples 117A-120A,
wherein the method comprises a singleplex or multiplex detection
assay, comprising immunodetection, flow cytometry,
immunohistochemistry, microspcopy, imaging, high content screening
(HCS), ELISA, ELISpot, arrays, bead arrays, or combinations or
derivatives thereof.
Example 122A
[0757] The binding method of Example 121A, wherein the target
comprises cells and/or cellular components.
Example 123A
[0758] The binding method of Example 122A, wherein the cells are
attached to a bead or a plate.
Example 124A
[0759] A method for binding one or more targets, comprising: i)
forming at least one molecular probe by conjugating a universal
oligonucleotide sequence to one or more binding moieties; ii)
hybridizing the formed at least one molecular probe with at least
one universal adapter, comprising: a) introducing the at least one
universal adapter to the formed at least one molecular probe,
wherein the at least one universal adapter comprises an
oligonucleotide sequence comprising: i) a complementary universal
sequence segment; and ii) a first sequence segment; and b)
hybridizing the universal oligonucleotide sequence of the formed at
least one molecular probe to the complementary universal sequence
segment of the at least one universal adapter; iii) introducing the
hybridized at least one molecular probe to a sample comprising the
one or more targets; iv) binding at least one of the one or more
targets with the binding moiety of the hybridized at least one
molecular probe; v) introducing to the sample at least one
detectable component comprising one or more signal generating
moieties conjugated to an oligonucleotide sequence complementary to
the first sequence segment of the at least one universal adapter;
and vi) hybridizing the first sequence segment of the bound at
least one molecular probe to the complementary oligonucleotide
sequence of the at least one detectable component; wherein: a) the
conjugation of the at least one molecular probe and the conjugation
of the at least one detectable component comprise a covalent bond
linkage, comprising a hydrazone, oxime, triazine, or other bond; b)
the formation of the conjugates are at least 90% efficient; and c)
the binding moiety has a binding affinity for the target of less
than 10.sup.-4 M.
Example 125A
[0760] The binding method of Example 124A, wherein the one or more
targets comprises cells, cellular components, biomarkers,
biological components, or combinations thereof.
Example 126A
[0761] The binding method of Example 125A, wherein the cells are
attached to a bead or a plate.
Example 127A
[0762] The binding method of one or more of Examples 125A-126A,
wherein the cellular components comprises tubulin.
Example 128A
[0763] The binding method of one or more of Examples 124A-127A,
wherein the at least one detectable component comprises a scaffold
comprising one or more signal generating moieties.
Example 129A
[0764] The binding method of one or more of Examples 124A-128A,
wherein the hybridized at least one detectable component generates
a signal.
Example 130A
[0765] The binding method of Example 129A, wherein signal generated
by the hybridized at least one detectable component is
detected.
Example 131A
[0766] The binding method of Example 130A, wherein the method
comprises a singleplex or multiplex detection assay, comprising
immunodetection, flow cytometry, immunohistochemistry, microspcopy,
imaging, high content screening (HCS), ELISA, ELISpot, arrays, bead
arrays, or combinations or derivatives thereof.
Example 132A
[0767] A method for detecting a target, comprising: i) conjugating
a binding moiety to an oligonucleotide sequence to form a molecular
probe; ii) introducing the molecular probe to a universal adapter,
wherein the universal adapter comprises an oligonucleotide sequence
having: a) a first sequence segment complementary to the
oligonucleotide sequence of the molecular probe; and b) a second
sequence segment; iii) hybridizing the oligonucleotide sequence of
the molecular probe to the complementary first sequence segment of
the universal adapter; iv) introducing the hybridized molecular
probe to a sample comprising the target; v) binding the target with
the binding moiety of the hybridized molecular probe; vi)
introducing to the sample comprising the bound molecular probe a
detectable component, wherein the detectable component comprises a
complementary oligonucleotide sequence to the second sequence
segment conjugated to one or more signal generating moieties; vii)
hybridizing the second sequence segment of the molecular probe to
the complementary oligonucleotide sequence of the detectable
component; and viii) detecting signal generated from the hybridized
detectable component; wherein: a) the conjugation of the molecular
probe and the detectable component independently comprise a
covalent bond linkage, comprising a hydrazone, oxime, triazine, or
other bond; b) the formation of the conjugates are at least 90%
efficient; and c) the binding moiety has a binding affinity for the
biological target of less than 10.sup.-4 M.
Example 133A
[0768] A method for detecting one or more targets, comprising: i)
providing at least a first molecular probe and a second molecular
probe to a sample comprising the one or more targets,
[0769] wherein the first binding moiety is conjugated to a first
oligonucleotide sequence and a second binding moiety is conjugated
to a second oligonucleotide sequence; ii) specifically binding a
first target and a second target of the one or more targets,
comprising: a) binding the first target with the first binding
moiety of the first molecular probe; and b) binding the second
target with the second binding moiety of the second molecular
probe; iii) providing to the sample one or more detectable
components, comprising: a) a first detectable component, comprising
a first bead, having one or more signal generating moieties,
conjugated to a first oligonucleotide complementary to the first
oligonucleotide sequence of the first molecular probe; and b) a
second detectable component, comprising a second bead, having one
or more signal generating moieties conjugated to a second
oligonucleotide complementary to the second oligonucleotide
sequence of the second molecular probe; iv) hybridizing the first
oligonucleotide sequence of the first bound molecular probe to the
complementary first oligonucleotide sequence of the first
detectable component; v) hybridizing the second oligonucleotide
sequence of the second bound molecular probe to the complementary
second oligonucleotide sequence of the second detectable component;
and vi) detecting the one or more signals generated from at least
the first hybridized detectable component and the second hybridized
detectable component; wherein: a) the conjugation of the plurality
of molecular probes and the conjugation of the plurality of the
detectable components comprise a covalent bond linkage, comprising
a hydrazone, oxime, triazine, or other bond; b) the formation of
the conjugates are at least 90% efficient; and c) the first binding
moiety has a binding affinity for the first target of less than
10.sup.-4 M and the second binding moiety has a binding affinity
for the second target of less than 10.sup.-4 M.
Example 134A
[0770] A method for detecting one or more targets, comprising: i)
providing at least a first molecular probe and a second molecular
probe to a sample comprising the one or more targets, wherein the
first binding moiety is conjugated to a first oligonucleotide
sequence and a second binding moiety is conjugated to a second
oligonucleotide sequence; ii) specifically binding a first target
and a second target of the one or more targets, comprising: a)
binding the first target with the first binding moiety of the first
molecular probe; and b) binding the second target with the second
binding moiety of the second molecular probe; iii) providing to the
sample one or more detectable components, comprising: a) a first
detectable component, comprising a first bead, having one or more
signal generating moieties, conjugated to a first oligonucleotide
complementary to the first oligonucleotide sequence of the first
molecular probe; and b) a second detectable component, comprising
one or more signal generating moieties conjugated to a second
oligonucleotide complementary to the second oligonucleotide
sequence of the second molecular probe; iv) hybridizing the first
oligonucleotide sequence of the first bound molecular probe to the
complementary first oligonucleotide sequence of the first
detectable component; v) hybridizing the second oligonucleotide
sequence of the second bound molecular probe to the complementary
second oligonucleotide sequence of the second detectable component;
and vi) detecting the one or more signals generated from at least
the first hybridized detectable component and the second hybridized
detectable component; wherein: a) the conjugation of the plurality
of molecular probes and the conjugation of the plurality of the
detectable components comprise a covalent bond linkage, comprising
a hydrazone, oxime, triazine, or other bond; b) the formation of
the conjugates are at least 90% efficient; and c) the first binding
moiety has a binding affinity for the first target of less than
10.sup.-4 M and the second binding moiety has a binding affinity
for the second target of less than 10.sup.-4 M.
Example 135A
[0771] The binding method of Example 134A, wherein the second
detectable component comprises a scaffold comprising the one or
more signal generating moieties.
Example 136A
[0772] The binding method of Example 135A, wherein the scaffold is
conjugated to the complementary second oligonucleotide
sequence.
Example 137A
[0773] The method of one or more of Examples 87A-136A, wherein the
oligonucleotide sequences and/or complementary oligonucleotide
sequences, comprise 3'-oligonucleotides, 5'-oligonucleotides, LNAs,
PNAs, or combinations or derivatives thereof.
Example 1B
[0774] A purification method, comprising: i) providing a sample
comprising at least one of the following: a) a carbonyl
modified-molecule; and b) a carbonyl modified-biomolecule; ii)
contacting the sample with a solid support comprising an acyl
hydrazide group; iii) binding the carbonyl modified-molecule or the
carbonyl modified-biomolecule to the acyl hydrazide group of the
solid support; and iv) recovering a purified carbonyl
modified-molecule or carbonyl modified-biomolecule by contacting
the bound-carbonyl modified-molecule or the bound-carbonyl
modified-biomolecule with a mixture comprising an aromatic or
aliphatic carbonyl molecule and an aniline-containing compound.
Example 2B
[0775] The purification method of Example 1B, wherein the binding
step comprises chemoselectively binding the carbonyl
modified-molecule or the carbonyl modified-biomolecule to the acyl
hydrazide group of the solid support.
Example 3B
[0776] The purification method of Examples 1B or 2B, wherein the
method further comprises removing unmodified-molecule or
unmodified-biomolecule from the bound-carbonyl modified-molecule or
the bound-carbonyl modified-biomolecule by washing the solid
support.
Example 4B
[0777] The purification method of any one of Examples 1B-3B,
wherein the recovering step comprises releasing the
chemoselectively bound-carbonyl modified-molecule or the
chemoselectively bound-carbonyl modified-biomolecule from the solid
support.
Example 5B
[0778] The purification method of any one of Examples 1B-4B,
wherein the contacting with a mixture comprising an aromatic or
aliphatic carbonyl molecule and an aniline-containing compound
comprises incubating.
Example 6B
[0779] The purification method of any one of Examples 1B-5B,
wherein the carbonyl modified-molecule is an aromatic carbonyl
modified-molecule.
Example 7B
[0780] The purification method of any one of Examples 1B-6B,
wherein the carbonyl modified-biomolecule is an aromatic carbonyl
modified-biomolecule.
Example 8B
[0781] The purification method of any one of Examples 1B-7B,
wherein the carbonyl moiety is an aromatic aldehyde.
Example 9B
[0782] The purification method of any one of Examples 1B-8B,
wherein the carbonyl modified-molecule or the carbonyl
modified-biomolecule is a 4FB-oligonucleotide.
Example 10B
[0783] The purification method of any one of Examples 1B-9B,
wherein the aromatic aldehyde is 4-formylbenzamide
Example 11B
[0784] The purification method of any one of Examples 1B-10B,
wherein the acyl hydrazide group is immobilized or bound to the
solid support.
Example 12B
[0785] The purification method of any one of Examples 1B-11B,
wherein the immobilized hydrazide moiety of the acyl hydrazide
group is an aliphatic hydrazide.
Example 13B
[0786] The purification method of any one of Examples 1B-12B,
wherein the immobilized hydrazide moiety of the acyl hydrazide
group is an aromatic hydrazide.
Example 14B
[0787] The purification method of any one of Examples 1B-13B,
wherein the releasing aromatic carbonyl molecule is
2-sulfo-benzaldehyde.
Example 15B
[0788] The purification method of any one of Examples 1B-14B,
wherein the mixture utilized to conduct the releasing step
comprises an aqueous buffer.
Example 16B
[0789] The purification method of any one of Examples 1B-15B,
wherein the mixture utilized to conduct the releasing step
comprises an aqueous buffer having an approximate pH 2.0-8.0.
Example 17B
[0790] The purification method of any one of Examples 1B-16B,
wherein the method further comprises exchanging the release buffer
for a suitable buffer or water.
Example 18B
[0791] The purification method of any one of Examples 1B-17B,
wherein the mixture utilized to conduct the releasing step
comprises the aromatic carbonyl molecule in a solution of 1-300 mM
aniline.
Example 19B
[0792] The purification method of any one of Examples 1B-18B,
wherein the mixture utilized to conduct the releasing step
comprises the aromatic carbonyl molecule in a solution of 1-300 mM
aniline in an aqueous buffer.
Example 20B
[0793] The purification method of any one of Examples 1B-19B,
wherein the mixture utilized to conduct the releasing step
comprises the aromatic carbonyl molecule in a solution of 1-300 mM
aniline in an aqueous buffer having an approximate pH 2.0-8.0.
Example 21B
[0794] The purification method of any one of Examples 1B-20B,
wherein the release buffer comprises 100 mM phosphate.
Example 22B
[0795] The purification method of any one of Examples 1B-21B,
wherein the release buffer comprises 150 mM NaCl.
Example 23B
[0796] The purification method of any one of Examples 1B-22B,
wherein the release buffer comprises a pH of about 5.0.
Example 24B
[0797] The purification method of any one of Examples 1B-23B,
wherein the release buffer comprises 25 mM aniline.
Example 25B
[0798] The purification method of any one of Examples 1B-24B,
wherein the carbonyl modified-molecule comprises a detectable
component.
Example 26B
[0799] The purification method of any one of Examples 1B-25B,
wherein the carbonyl modified-molecule comprises a detectable
component comprising an oligonucleotide conjugated to one or more
signal generating moieties.
Example 27B
[0800] The purification method of any one of Examples 1B-26B,
wherein the carbonyl modified-molecule comprises a detectable
component comprising an oligonucleotide conjugated to at least one
scaffold comprising one or more signal generating moieties.
Example 28B
[0801] The purification method of any one of Examples 1B-27B,
wherein the scaffold comprises a dendrimer, a polysaccharide, a
dextran, a protein, a peptide, a further oligonucleotide sequence,
a polymer, a hydrophilic polymer, a bead, a nanoparticle, or
combinations or derivatives thereof.
Example 29B
[0802] The purification method of any one of Examples 1B-28B,
wherein one or more signal generating moieties comprises one or
more of the following: a directly detectable signal generating
moiety, an indirectly detectable signal generating moiety, a
fluorescent dye, a fluorophore, a fluorochrome, a chromophore, a
biofluorescent protein, a luminescent species, a chemiluminescent
compound, a electrochemiluminescent label, a bioluminescent label,
a phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, a bead, an RFID tag, a microbarcode particle, an enzyme,
an enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations thereof.
Example 30B
[0803] The purification method of any one of Examples 1B-29B,
wherein the carbonyl modified-biomolecule comprises molecular
probe.
Example 31B
[0804] The purification method of any one of Examples 1B-30B,
wherein the carbonyl modified-biomolecule comprises molecular probe
comprising a binding moiety conjugated to at least one
oligonucleotide.
Example 32B
[0805] The purification method of any one of Examples 1B-31B,
wherein the binding moiety comprises an antibody, a monoclonal
antibody, a polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 33B
[0806] The purification method of any one of Examples 1B-32B,
wherein the molecular probe and/or the detectable component further
comprises a spacer group, comprising a polymerized ethylene oxide,
a PEG, a PEO, a protein, a peptide, a DNA, an RNA, an
oligonucleotide sequence, or a dextran.
Example 34B
[0807] The purification method of any one of Examples 1B-33B,
wherein the purification method purifies a genetically engineered
protein.
Example 35B
[0808] The purification method of any one of Examples 1B-34B,
wherein the genetically engineered protein comprises an
incorporated an aliphatic or aromatic carbonyl group.
Example 36B
[0809] The purification method of any one of Examples 1B-35B,
wherein the genetically engineered protein has been produced to
incorporate an aliphatic or aromatic carbonyl group.
Example 1C
[0810] An assay method, comprising: i) providing to a sample
comprising a plurality of targets: a) at least a first molecular
probe comprising a first oligonucleotide sequence conjugated to a
first binding moiety having an affinity for at least a first target
of the plurality of targets; and b) at least a first particle,
bead, or other surface, comprising a complementary second
oligonucleotide sequence conjugated to said at least particle,
bead, or other surface; wherein the amount of the second
complementary oligonucleotide sequence is greater that the amount
of the first oligonucleotide sequence; and iii) mixing or
maintaining contact between said at least first molecular probe and
said at least first particle, bead, or other surface, to hybridize
all or substantially all of the first oligonucleotide sequence of
the at least first molecular probe with the second complementary
oligonucleotide sequence conjugated to said at least first
particle, bead, or other surface.
Example 2C
[0811] The method of Example 1C, wherein the mode of addition
comprises: i) the at least first molecular probe and the at least
first particle, bead, or other surface, are combined together and
hybridized prior to contacting the sample; ii) the at least first
molecular probe is combined with the sample prior to the addition
of the at least first particle, bead, or other surface; or iii) the
at least first particle, bead, or other surface, is combined with
the sample prior to the addition of the at least first molecular
probe.
Example 3C
[0812] The method of Examples 1C or 2C, wherein the method
comprises: i) the at least first molecular probe binding the target
prior to hybridizing with the at least first particle, bead, or
other surface; or ii) the at least first molecular probe
hybridizing with the at least first particle, bead, or other
surface, prior to binding the target.
Example 4C
[0813] An assay method, comprising: i) providing to a sample
comprising a plurality of targets: a) at least a first molecular
probe comprising a first oligonucleotide sequence conjugated to a
first binding moiety having an affinity for at least a first target
of the plurality of targets; b) at least a first particle, bead, or
other surface, comprising a second oligonucleotide sequence
conjugated to said at least particle, bead, or other surface;
wherein the amount of the second oligonucleotide sequence is
greater that the amount of the first oligonucleotide sequence; and
c) at least a first universal adapter, comprising an
oligonucleotide sequence having a first sequence segment
complementary to the first oligonucleotide sequence of the at least
first molecular probe and a second sequence segment complementary
to the second oligonucleotide sequence of the at least first
particle, bead, or other surface; and iii) mixing or maintaining
contact between said at least first molecular probe, said at least
first particle, bead, or other surface, and said at least first
universal adapter, to hybridize all or substantially all of: a) the
first oligonucleotide sequence of the at least first molecular
probe with the first complementary oligognucleotide sequence
segment of the at least first universal adapter; and b) the second
oligognucleotide sequence of the at least first particle, bead, or
other surface, with the second complementary oligognucleotide
sequence segment of the at least first universal adapter.
Example 5C
[0814] The method of Example 4C, wherein the mode of addition
comprises: i) the at least first molecular probe, the at least
first universal adapter, and the at least first particle, bead, or
other surface, are combined together and hybridized prior to
contacting the sample; ii) the at least first molecular probe and
the at least first universal adapter are combined together and
hybridized prior to contacting the sample; iii) the at least first
particle, bead, or other surface, and the at least first universal
adapter are combined together and hybridized prior to contacting
the sample; iv) the at least first molecular probe, alone or in
combination with the at least first particle, bead, or other
surface, is combined with the sample prior to the addition of the
at least first universal adapter; or v) the at least first
universal adapter is combined with the sample prior to the addition
of the at least first molecular probe and/or the at least first
particle, bead, or other surface.
Example 6C
[0815] The method of Examples 4C or 5C, wherein the method
comprises: i) the at least first molecular probe hybridizing with
the at least first universal adapter prior to said at least first
molecular probe binding the target; ii) the at least first
molecular probe hybridizing with the at least first universal
adapter after said at least first molecular probe binds the target;
iii) the at least first particle, bead, or other surface,
hybridizing with the at least first universal adapter prior to the
at least first molecular probe binding the target; iv) the at least
first particle, bead, or other surface, hybridizing with the at
least first universal adapter after the at least first molecular
probe binds the target; v) the at least first universal adapter
hybridizing with the at least first molecular probe and hybridizing
with the at least first particle, bead, or other surface, prior to
said at least first molecular probe binding the target; or vi) the
at least first universal adapter hybridizing with the at least
first molecular probe and hybridizing with the at least first
particle, bead, or other surface, after said at least first
molecular probe binds the target.
Example 7C
[0816] The method of any one of Examples 1C-6C, wherein the sample
further comprises a plurality of non-target materials comprising at
least a first non-target material.
Example 8C
[0817] The method of any one of Examples 1C-7C, wherein the at
least first non-target material comprises one or more of the
following: non-target antigens, non-target cells, or non-target
cellular components.
Example 9C
[0818] The method of any one of Examples 1C-8C, wherein the at
least first molecular probe is added in an excess amount as
compared to the amount of the at least first target present in the
sample.
Example 10C
[0819] The method of any one of Examples 1C-9C, wherein the at
least first molecular probe recognizes the at least first target of
the plurality of targets in the presence of the at least first
non-target material.
Example 11C
[0820] The method of any one of Examples 1C-10C, wherein the at
least first recognized-target is an antigen, an antigen on a cell
surface, a cellular component, or a cell; wherein in said
recognition is in the presence of one or more non-target
materials.
Example 12C
[0821] The method of any one of Examples 1C-11C, wherein the at
least first molecular probe binds the at least first target of the
plurality of targets in the presence of the at least first
non-target material.
Example 13C
[0822] The method of any one of Examples 1C-12C, wherein the at
least first bound-target is an antigen, an antigen on a cell
surface, a cellular component, or a cell; wherein in said binding
is in the presence of one or more non-target materials.
Example 14C
[0823] The method of any one of Examples 1C-13C, wherein the at
least first target is a biological target.
Example 15C
[0824] The method of any one of Examples 1C-14C, wherein the at
least first target is a biological target comprising an antigen, a
pathogen, a protein, a peptide, an epitope, a
carbohydrate-containing molecule, a small molecule, or combinations
or derivatives thereof.
Example 16C
[0825] The method of any one of Examples 1C-15C, wherein the at
least first target is an antigen.
Example 17C
[0826] The method of any one of Examples 1C-16C, wherein the first
binding moiety comprises an antibody, a monoclonal antibody, a
polyclonal antibody, an enzyme, a protein, a peptide, a nuclear
receptor, or an aptamer.
Example 18C
[0827] The method of any one of Examples 1C-17C, wherein the method
is a cell depletion method.
Example 19C
[0828] The method of any one of Examples 1C-18C, wherein the method
is an immunoprecipitation method.
Example 20C
[0829] The method of any one of Examples 1C-19C, wherein the
complementary second oligonucleotide sequence is tethered to the at
least first particle, bead, or other surface.
Example 21C
[0830] The method of any one of Examples 1C-20C, wherein said at
least first particle, bead, or other surface, comprises at least
one of the following: i) a magnetic bead, a paramagnetic bead, or a
superparamagnetic bead; ii) a dense object, a buoyant object, or a
stationary object; iii) a gel particle or a matrix, said gel
particle or matrix comprising an agarose bead or a sepharose bead;
and iv) a filter or a mesh.
Example 22C
[0831] The method of any one of Examples 1C-21C, wherein said at
least first particle, bead, or other surface enables at least one
of the following: i) magnetic separation; ii) mechanical
separation; iii) chromatographic separation; and iv) filtration
separation.
Example 23C
[0832] The method of any one of Examples 1C-22C, wherein the
magnetic bead, a paramagnetic bead, or a superparamagnetic bead
enables magnetic separation.
Example 24C
[0833] The method of any one of Examples 1C-23C, wherein the dense
object, a buoyant object, or a stationary object enables mechanical
separation.
Example 25C
[0834] The method of any one of Examples 1C-24C, wherein the gel
particle or the matrix enables chromatographic separation.
Example 26C
[0835] The method of any one of Examples 1C-25C, wherein the filter
or mesh enables filtration separation.
Example 27C
[0836] The method of any one of Examples 1C-26C, wherein the at
least first bound-target is captured by separating said at least
first particle, bead, or other surface from the mixture containing
the non-target materials.
Example 28C
[0837] The method of any one of Examples 1C-27C, wherein the
separation removes or excludes the mixture containing the
non-target materials.
Example 29C
[0838] The method of any one of Examples 1C-28C, wherein the
separation removes or excludes the at least first bound-target from
the mixture containing the non-target materials.
Example 30C
[0839] The method of any one of Examples 1C-29C, wherein the
separated at least first bound-target is further washed to remove
residual non-target materials.
Example 31C
[0840] The method of any one of Examples 1C-30C, wherein the
non-target materials are further washed to collect residual at
least first bound-target.
Example 32C
[0841] The method of any one of Examples 1C-31C, wherein the method
comprises a series of sequential or parallel steps to capture or
exclude one or more targets in a sample comprising the plurality of
targets.
Example 33C
[0842] The method of any one of Examples 1C-32C, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
further comprises detecting, measuring, or quantifying the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, immunomagnetic cellular
depletion, immunomagnetic cell capture, array, bead array,
multiplex bead array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, immunoturbidity, latex
agglutination, gold particle agglutination, visual inspection, a
change in light transmittance through said sample, increased light
transmittance through said sample, a blotting method, a Western
blot, a Southern blot, a Southwestern blot, labeling inside an
electrophoresis system, labeling on a surface, labeling on an
array, PCR amplification, elongation followed by PCR amplification,
immunoprecipitation, co-immunoprecipitation, chromatin
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
Example 34C
[0843] The method of any one of Examples 1C-33C, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
further comprises detecting, measuring, or quantifying the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, microscopy, imaging, high
content screening (HCS), multiplex bead array, microarray, antibody
array, cellular array, immunohistochemistry (IHC),
immunocytochemistry (ICC), in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot, or
a blotting method.
Example 35C
[0844] The method of any one of Examples 1C-34C, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
further comprises detecting, measuring, or quantifying the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, mass cytometry, lateral
flow immunoassay, immunohistochemistry (IHC), immunocytochemistry
(ICC), immunoprecipitation, pretargeting imaging, therapeutic
agent, or combinations thereof.
Example 36C
[0845] The method of any one of Examples 1C-35C, wherein the sample
is characterized as at least one or more of the following: i) a
complex sample; and ii) a homogeneous or a heterogeneous mixture;
wherein said sample comprises at least one or more of the
following: a) one or more analytes having substantially the same or
substantially different binding specificities; b) one or more of
the following biologic components, comprising: cells, membranes,
biological molecules, metabolites, or disease biomarkers; and c) a
biological fluid or a fluidized biological tissue.
Example 37C
[0846] The method of any one of Examples 1C-36C, wherein the method
comprises one or more of the following: i) the hybridization
efficiency of the first oligonucleotide sequence to the second
oligonucleotide sequence is at least 50% with respect to the at
least first particle, bead, or other surface, under the
hybridization conditions employed; ii) the hybridization efficiency
of the first oligonucleotide sequence to the complementary first
oligonucleotide sequence segment is at least 50% with respect to
the at least first molecular probe, under the hybridization
conditions employed; or iii) the hybridization efficiency of the
second oligonucleotide sequence to the complementary second
oligonucleotide sequence segment is at least 50% with respect to
the at least first particle, bead, or other surface, under the
hybridization conditions employed.
Example 38C
[0847] The method of any one of Examples 1C-37C, wherein the at
least first molecular probe, the at least first particle, bead, or
other surface, and/or at least first universal adapter further
comprises a spacer group, comprising a polymerized ethylene oxide,
a PEG, a PEO, a protein, a peptide, a DNA, an RNA, an
oligonucleotide sequence, or a dextran.
Example 39C
[0848] The method of any one of Examples 1C-38C, wherein the
conjugation of the first binding moiety to the first
oligonucleotide sequence comprises a HyNic or a 4-FB residue; and
wherein the conjugation of the at least first particle, bead, or
other surface, to the second oligonucleotide sequence comprises a
HyNic or a 4-FB residue.
Example 40C
[0849] The method of any one of Examples 1C-39C, wherein the first
oligonucleotide sequence, second oligonucleotide sequence, and/or
oligonucleotide sequence segment comprising an oligonucleotide
sequence conjugated at the 3'-position, an oligonucleotide sequence
conjugated at the 5'-position, linear oligonucleotide sequences,
branched oligonucleotide sequences, LNAs, PNAs, oligonucleotide
sequences optionally covalently attached to other moieties, or
combinations or derivatives thereof.
Example 41C
[0850] The method of any one of Examples 1C-40C, wherein a
plurality of molecular probes and a plurality of particles, beads,
or other surfaces, are provided to the sample.
Example 42C
[0851] The method of any one of Examples 1C-41C, wherein a
plurality of universal adapters are provided to the sample.
Example 43C
[0852] The method of any one of Examples 1C-42C, wherein the
binding affinity for the at least first target is 10.sup.-4 M or
less.
Example 44C
[0853] The method of any one of Examples 1C-43C, wherein the method
comprises an automated system or robotic system.
Example 45C
[0854] The method of any one of Examples 1C-44C, wherein the other
surface comprises a scaffold, a plate, or solid array.
Example 46C
[0855] The method of any one of Examples 1C-44C, wherein the
scaffold comprises a dendrimer, a polysaccharide, a dextran, a
protein, a peptide, a further oligonucleotide sequence, a portion
of the second oligonucleotide sequence that is not complementary to
the first oligonucleotide sequence of the molecular probe, a
polymer, a hydrophilic polymer, a bead, a nanoparticle, or
combinations or derivatives thereof.
Example 1D
[0856] A method for assaying a target of a sample, comprising: i)
providing to the sample: 1) a first molecular probe, comprising a
first binding moiety conjugated to a first oligonucleotide
sequence; and 2) a first bead conjugate, comprising a first bead
conjugated to a second oligonucleotide sequence that is
complementary to the first oligonucleotide sequence of the first
molecular probe, wherein the first bead comprises or is encoded
with one or more signal generating moieties; ii) binding the target
in the sample with the first binding moiety of the first molecular
probe; iii) hybridizing the first oligonucleotide sequence of the
first molecular probe with the second oligonucleotide sequence of
the first bead conjugate; and iv) providing to the sample a second
binding moiety comprising one or more signal generating moieties;
v) further binding the target of the first binding moiety-bound
target with the second binding moiety to form a sandwich-complex;
vi) detecting a signal generated from the sandwich complex;
[0857] wherein the method is characterized by one or more of the
following: a) the conjugation between the first oligonucleotide
sequence and the first binding moiety and conjugation between the
complementary second oligonucleotide sequence and the first bead
conjugate, comprises one or more covalent bond linkages, comprising
a hydrazone, oxime, triazine, or other covalent bond, wherein the
formation of the conjugates are at least 90% efficient; and b) the
first binding moiety and the second binding moiety comprise strong
binding affinities for the target.
Example 2D
[0858] The method of Example 1D, wherein the mode of addition
comprises: i) the first molecular probe and the first bead
conjugate are combined together and hybridized prior to contacting
the sample; ii) the first molecular probe is combined with the
sample prior to the addition of the first bead conjugate; or iii)
the first bead conjugate is combined with the sample prior to the
addition of the first molecular probe.
Example 3D
[0859] The method of any one of Examples 1D-2D, wherein the method
comprises: i) the first molecular probe binding the target prior to
hybridizing with the first bead conjugate; or ii) the first
molecular probe hybridizing with the first bead conjugate prior to
binding the target.
Example 4D
[0860] A method for assaying a target of a sample, comprising: i)
providing to the sample: 1) a first molecular probe, comprising a
first binding moiety conjugated to a first oligonucleotide
sequence; 2) a first bead conjugate, comprising a first bead
conjugated to a second oligonucleotide sequence, wherein the first
bead comprises or is encoded with one or more signal generating
moieties; and 3) a first universal adapter, comprising an
oligonucleotide sequence having a first sequence segment
complementary to the first oligonucleotide sequence of the first
molecular probe and a second sequence segment complementary to the
second oligonucleotide sequence of the first bead conjugate; ii)
binding the target in the sample with the first binding moiety of
the first molecular probe; iii) hybridizing the first
oligonucleotide sequence of the first molecular probe to the first
oligonucleotide sequence segment of the first universal adapter;
iv) hybridizing the second oligonucleotide sequence of the first
bead conjugate to the complementary second oligonucleotide sequence
segment of the first universal adapter; and v) providing to the
sample a second binding moiety comprising one or more signal
generating moieties; iv) further binding the target of the first
binding moiety-bound target with the second binding moiety to form
a sandwich-complex; vi) detecting a signal generated from the
sandwich complex; wherein the method is characterized by one or
more of the following: a) the conjugation between the first
oligonucleotide sequence and the first binding moiety and
conjugation between the complementary second oligonucleotide
sequence and the first bead conjugate, comprises one or more
covalent bond linkages, comprising a hydrazone, oxime, triazine, or
other covalent bond, wherein the formation of the conjugates are at
least 90% efficient; and b) the first binding moiety and the second
binding moiety comprise strong binding affinities for the
target.
Example 5D
[0861] The method of Example 4D, wherein the mode of addition
comprises: i) the first molecular probe, the first universal
adapter, and the first bead conjugate are combined together and
hybridized prior to contacting the sample; ii) the first molecular
probe and the first universal adapter are combined together and
hybridized prior to contacting the sample; iii) the first bead
conjugate and the first universal adapter are combined together and
hybridized prior to contacting the sample; iv) the first molecular
probe, alone or in combination with the first bead conjugate, is
combined with the sample prior to the addition of the first
universal adapter; or v) the first universal adapter is combined
with the sample prior to the addition of the first molecular probe
and/or the first bead conjugate.
Example 6D
[0862] The method of Example 4D or 5D, wherein the method
comprises: i) the first molecular probe hybridizing with the first
universal adapter prior to said first molecular probe binding the
target; ii) the first molecular probe hybridizing with the first
universal adapter after said first molecular probe binds the
target; iii) the first bead conjugate hybridizing with the first
universal adapter prior to the first molecular probe binding the
target; iv) the first bead conjugate hybridizing with the first
universal adapter after the first molecular probe binds the target;
v) the first universal adapter hybridizing with the first molecular
probe and hybridizing with the first bead conjugate prior to said
first molecular probe binding the target; or vi) the first
universal adapter hybridizing with the first molecular probe and
hybridizing with the first bead conjugate after said first
molecular probe binds the target.
Example 7D
[0863] A method for crosslinking, comprising: i) introducing to a
sample comprising one or more targets: a) one or more first
antibody-oligonucleotide conjugates, comprising a first antibody
conjugated to a first oligonucleotide sequence; and b) one or more
second antibody-oligonucleotide conjugates, comprising a second
antibody conjugated to a second oligonucleotide sequence; ii)
binding at least a first target of the one or more targets with the
first antibody of the one or more first antibody-oligonucleotide
conjugates and with the second antibody of the one or more second
antibody-oligonucleotide conjugates to form one or more
sandwich-complexes; iii) contacting the one or more
sandwich-complexes with: a) one or more first bead-oligonucleotide
conjugate, comprising a first bead conjugated to a complementary
first oligonucleotide sequence; and b) one or more second
bead-oligonucleotide conjugate, comprising a second bead conjugated
to a complementary second oligonucleotide sequence; iv)
crosslinking the one or more sandwich-complexes by: a) hybridizing
the first oligonucleotide sequences of the one or more
sandwich-complexes with the complementary first oligonucleotide
sequences of the one or more first bead-oligonucleotide conjugates;
and b) hybridizing the second oligonucleotide sequences of the one
or more sandwich-complexes with the complementary second
oligonucleotide sequences of the one or more second
bead-oligonucleotide conjugates.
Example 8D
[0864] The crosslinking method of Example 7D, wherein the formation
of the crosslinked one or more sandwich-complexes forms an
agglutination.
Example 9D
[0865] The crosslinking method of Examples 7D or 8D, wherein the
method further comprises detecting, measuring, and/or quantifying
the degree of the formed agglutination to determine the amount of
the one or more targets in the sample.
Example 10D
[0866] The crosslinking method of any one of Examples 7D-9D,
wherein the first antibody or the second antibody comprise a
monoclonal antibody or a polyclonal antibody.
Example 11D
[0867] The crosslinking method of any one of Examples 7D-10,
wherein: i) the first antibody comprises a first polyclonal
antibody and the second antibody comprises a second polyclonal
antibody; ii) the first antibody comprises a first monoclonal
antibody and the second antibody comprises a second monoclonal
antibody; iii) the first antibody comprises a first monoclonal
antibody and the second antibody comprises a first polyclonal
antibody; or iv) the first antibody comprises a first polyclonal
antibody and the second antibody comprises a first monoclonal
antibody.
Example 12D
[0868] The crosslinking method of Example 11D, wherein the first
monoclonal antibody is raised against a first epitope of the target
and the second monoclonal antibody is raised against a second
epitope of the target.
Example 13D
[0869] The crosslinking method of any one of Examples 7D-12D,
wherein the first antibody comprises a first polyclonal antibody
and the second antibody comprises a second polyclonal antibody.
Example 14D
[0870] The crosslinking method of Example 13D, wherein a first
portion of the first polyclonal antibody binds to a first epitope
of the target and a second portion of the second polyclonal
antibody binds to a second epitope of the target.
Example 15D
[0871] The crosslinking method of any one of Examples 7D-12D,
wherein the first antibody comprises a first monoclonal antibody
and the second antibody comprises a second monoclonal antibody.
Example 16D
[0872] The crosslinking method of any one of Examples 7D-12D,
wherein the first antibody comprises a first monoclonal antibody
and the second antibody comprises a first polyclonal antibody.
Example 17D
[0873] The method of any one of Examples 1D-16D, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample.
Example 18D
[0874] The method of any one of Examples 1D-17D, wherein method
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: immunoturbidity, latex agglutination, gold particle
agglutination, visual inspection, a change in light transmittance
through said sample, increased light transmittance through said
sample, flow cytometry, immunomagnetic cellular depletion,
immunomagnetic cell capture, array, bead array, multiplex bead
array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, a blotting method, a
Western blot, a Southern blot, a Southwestern blot, labeling inside
an electrophoresis system, labeling on a surface, labeling on an
array, PCR amplification, elongation followed by PCR amplification,
immunoprecipitation, co-immunoprecipitation, chromatin
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
Example 19D
[0875] The method of any one of Examples 1D-18D, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: immunoturbidity, latex agglutination, gold particle
agglutination, visual inspection, a change in light transmittance
through said sample, increased light transmittance through said
sample, lateral flow immunoassay, immunodetection, flow cytometry,
microscopy, imaging, high content screening (HCS), multiplex bead
array, microarray, antibody array, cellular array,
immunohistochemistry (IHC), immunocytochemistry (ICC), in situ
hybridization (ISH), enzyme immuno-assay (EIA), enzyme linked
immuno-assay (ELISA), ELISpot, or a blotting method.
Example 20D
[0876] The method of any one of Examples 1D-19D, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: immunoturbidity, latex agglutination, gold particle
agglutination, visual inspection, a change in light transmittance
through said sample, increased light transmittance through said
sample, lateral flow immunoassay, immunodetection, flow cytometry,
microscopy, imaging, high content screening (HCS), mass cytometry,
lateral flow immunoassay, immunohistochemistry (IHC),
immunocytochemistry (ICC), immunoprecipitation, pretargeting
imaging, therapeutic agent, or combinations thereof.
Example 21D
[0877] The method of any one of Examples 1D-20D, wherein the sample
is characterized as at least one or more of the following: i) a
complex sample; and ii) a homogeneous or a heterogeneous mixture;
wherein said sample comprises at least one or more of the
following: a) one or more analytes having substantially the same or
substantially different binding specificities; b) one or more of
the following biologic components, comprising: cells, membranes,
biological molecules, metabolites, or disease biomarkers; and c) a
biological fluid or a fluidized biological tissue.
Example 22D
[0878] The method of any one of Examples 1D-21D, wherein the
hybridization efficiency of the first oligonucleotide sequence to
the second oligonucleotide sequence is at least 50% with respect to
the first bead, under the hybridization conditions employed.
Example 23D
[0879] The method of any one of Examples 1D-22D, wherein the first
molecular probe comprises one or more of the following properties:
i) a molecular weight of between about 15,000 Daltons to about
450,000 Daltons; ii) a solubility that is substantially the same as
that of the unconjugated first binding moiety; iii) a solubility
that minimizes non-specific binding to the target; iv) the first
oligonucleotide sequence of the first molecular probe does not
adversely affect the solubility of the first binding moiety; v)
interacts and binds to the target via interactions other than
exclusively electrostatic; vi) a unique, distinguishable, and/or
specifically designed first oligonucleotide sequence; and vii) the
first oligonucleotide sequence of the first molecular probe is
uniquely and specifically designed to hybridize to the second
oligonucleotide sequence of the first bead.
Example 24D
[0880] The method of any one of Examples 1D-23D, wherein the method
of detection generates less false positives than secondary antibody
detection methods.
Example 25D
[0881] The method of any one of Examples 1D-24D, wherein the method
further comprises: i) preparing the first molecular probe; ii)
preparing the first bead conjugate; and iii) optionally preparing
the first universal adapter; wherein the prepared first molecular
probe, prepared first bead conjugate, and optionally prepared first
universal adapter, have at least 90% purity.
Example 26D
[0882] The method of any one of Examples 1D-25D, wherein the method
further comprises preparing and isolating the first molecular
probe, comprising: i) providing the first binding moiety; ii)
conjugating the first binding moiety with at least one first
oligonucleotide sequence at greater than 90% efficiency to form
first binding moiety-oligonucleotide conjugates; and iii) isolating
the first binding moiety-oligonucleotide conjugates from the
conjugation mixture by binding, retaining, and/or retarding a
substantial portion of: a) the conjugates, removing a substantial
portion of the unconjugated first oligonucleotide sequence in a
wash step followed by release of the bound, retained, and/or
retarded conjugates; or b) the unconjugated first oligonucleotide
sequences, followed by collecting a substantial portion of the
non-bound, non-retained, and/or non-retarded conjugates in a wash
step.
Example 27D
[0883] The method of any one of Examples 1D-26D, wherein the method
further comprises preparing and isolating the first bead conjugate,
comprising: i) providing the first bead; ii) conjugating the second
oligonucleotide sequence with the first bead at greater than 90%
efficiency to form first bead-second oligonucleotide conjugates;
and iii) isolating the first bead-second oligonucleotide conjugates
from the conjugation mixture by binding, retaining, and/or retarded
a substantial portion of: a) the conjugates, removing a substantial
portion of the unconjugated second oligonucleotide sequences in a
wash step followed by release of the bound, retained, and/or
retarded conjugates; or b) the unconjugated second oligonucleotide
sequences, followed by collecting a substantial portion of the
non-bound, non-retained, and/or non-retarded conjugates in a wash
step.
Example 28D
[0884] The method of any one of Examples 1D-27D, wherein the first
bead conjugate further comprises a scaffold conjugated to the
second oligonucleotide sequence, and wherein said scaffold
comprises one or more signal generating moieties.
Example 29D
[0885] The method of Example 28D, wherein the scaffold comprises a
dendrimer, a polysaccharide, a dextran, a protein, a peptide, a
further oligonucleotide sequence, a portion of the second
oligonucleotide sequence that is not complementary to the first
oligonucleotide sequence of the molecular probe, a polymer, a
hydrophilic polymer, a bead, a nanoparticle, or combinations or
derivatives thereof.
Example 30D
[0886] The method of any one of Examples 1D-29D, wherein the method
further comprises preparing and isolating the first bead conjugate
further comprising a scaffold conjugated to the second
oligonucleotide sequence, wherein the scaffold comprises one or
more signal generating moieties, said method comprising: i)
providing a plurality of the scaffolds comprising the one or more
signal generating moieties; ii) conjugating the second
oligonucleotide sequence with at least one of the plurality of
scaffolds at greater than 90% efficiency to form scaffold-second
oligonucleotide conjugates; and iii) isolating the scaffold-second
oligonucleotide conjugates from the conjugation mixture by binding,
retaining, and/or retarding a substantial portion of: a) the
conjugates, removing a substantial portion of the unconjugated
second oligonucleotide sequences in a wash step followed by release
of the bound, retained, and/or retarded conjugates; or b) the
unconjugated second oligonucleotide sequences, followed by
collecting a substantial portion of the non-bound, non-retained,
and/or non-retarded conjugates in a wash step.
Example 31D
[0887] The method of any one of Examples 26D-30D, wherein the
isolation step utilizes an immobilized binder, chromatography,
affinity chromatography, size exclusion chromatography, HPLC,
reverse-phase chromatography, electrophoresis, capillary
electrophoresis, polyacrylamide gel electrophoresis, agarose gel
electrophoresis, free flow electrophoresis, differential
centrifugation, thin layer chromatography, immunoprecipitation,
hybridization, solvent extraction, dialysis, filtration,
diafiltration, tangential flow filtration, ion exchange
chromatography, hydrophobic interaction chromatography, or
combinations thereof.
Example 32D
[0888] The method of any one of Examples 26D-30D, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, electrophoresis,
differential centrifugation, immunoprecipitation, hybridization,
solvent extraction, dialysis, filtration, diafiltration, ion
exchange chromatography, hydrophobic interaction chromatography, or
combinations thereof.
Example 33D
[0889] The method of any one of Examples 26D-30D, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, differential
centrifugation, dialysis, filtration, hydrophobic interaction
chromatography, or combinations thereof.
Example 34D
[0890] The method of any one of Examples 1D-33D, wherein the
binding moiety comprises an antibody, a monoclonal antibody, a
polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 35D
[0891] The method of any one of Examples 1D-34D, wherein the sample
comprises one or more targets.
Example 36D
[0892] The method of any one of Examples 1D-35D, wherein the target
is a biological target.
Example 37D
[0893] The method of Example 36D, wherein the biological target
comprises an antigen, a pathogen, a protein, a peptide, an epitope,
a carbohydrate-containing molecule, a small molecule, or
combinations or derivatives thereof.
Example 38D
[0894] The method of any one of Examples 1D-37D, wherein the signal
generating moiety or the one or more signal generating moieties of
the first bead conjugate, the hybridized first bead conjugate, the
second binding moiety, or of the scaffold, comprises one or more of
the following: a directly detectable signal generating moiety, an
indirectly detectable signal generating moiety, a fluorescent dye,
a fluorophore, a fluorochrome, a chromophore, a biofluorescent
protein, a luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations or derivatives thereof.
Example 39D
[0895] The method of any one of Examples 1D-38D, wherein the one or
more signal generating moieties provides an enhanced signal that
minimizes detection errors from background noise, relative to
conventionally labeled binding moieties.
Example 40D
[0896] The method of any one of Examples 1D-39D, wherein the
molecular probe, the first bead conjugate, and/or universal adapter
further comprises a spacer group, comprising a polymerized ethylene
oxide, a PEG, a PEO, a protein, a peptide, a DNA, an RNA, an
oligonucleotide sequence, or a dextran.
Example 41D
[0897] The method of any one of Examples 1D-40D, wherein the
binding moiety, the first bead, the scaffold, the first
oligonucleotide sequence, and/or the second oligonucleotide
sequence comprise HyNic or 4-FB.
Example 42D
[0898] The method of any one of Examples 1D-41D, wherein the first
bead conjugate comprises a unique, distinguishable, and/or
specifically designed second oligonucleotide sequence.
Example 43D
[0899] The method of any one of Examples 1D-42D, wherein the first
oligonucleotide sequence, second oligonucleotide sequence, and/or
oligonucleotide sequence segment comprising an oligonucleotide
sequence conjugated at the 3'-position, an oligonucleotide sequence
conjugated at the 5'-position, linear oligonucleotide sequences,
branched oligonucleotide sequences, LNAs, PNAs, oligonucleotide
sequences optionally covalently attached to other moieties, or
combinations or derivatives thereof.
Example 44D
[0900] The method of any one of Examples 1D-43D, wherein the sample
comprises one or more targets.
Example 45D
[0901] The method of any one of Examples 1D-44D, wherein a
plurality of molecular probes and a plurality of bead conjugates
are provided to the sample.
Example 46D
[0902] The method of any one of Examples 1D-45D, wherein a
plurality of universal adapters are provided to the sample.
Example 47D
[0903] The method of any one of Examples 1D-46D, wherein the
binding affinity of the first binding moiety and/or of the second
binding moiety for the target is 10.sup.-4 M or less.
Example 48D
[0904] The method of any one of Examples 1D-47D, wherein the
binding affinity of the first binding moiety and/or of the second
binding moiety for the at least first target is 10.sup.-4 M or
less.
Example 49D
[0905] The method of any one of Examples 1D-48D, wherein the
binding affinity of the first binding moiety and/or of the second
binding moiety for the at least second target is 10.sup.-4 M or
less.
Example 50D
[0906] The method of any one of Examples 1D-49D, wherein the method
comprises an automated system or robotic system.
Example 51D
[0907] The method of any one of Examples 1D-50D, wherein the first
bead conjugate comprises or is encoded with one or more of the
following: a directly detectable signal generating moiety, an
indirectly detectable signal generating moiety, a fluorescent dye,
a fluorophore, a fluorochrome, a chromophore, a biofluorescent
protein, a luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations or derivatives thereof.
Example 52D
[0908] The method of any one of Examples 1D-50D, wherein the first
bead conjugate comprises or is encoded with one or more of the
following: a fluorescent dye, a fluorophore, a fluorochrome, a
fluorescent protein, a biofluorescent protein, a luminescent
species, a chemiluminescent compound, a electrochemiluminescent
label, a fluorophore labeled DNA dendrimer, Quantum Dot, a
secondary reporter, a hapten, an enzyme, an antibody, a
nanoparticle, a light scattering nanoparticle or microsphere, a
bioluminescent label, a tandem dye, a FRET dye, a diffracting
particle, a polymer particle, a bead, a solid surface, a metal
particle, a molecule specifically recognized by another substance
carrying a label or reacts with a substance carrying a label, a
nucleic acid, a nucleic acid analog, oligonucleotide,
oligonucleotide analog, complementary oligonucleotide,
complementary oligonucleotide analog.
Example 53D
[0909] A method for assaying one or more targets of a sample,
comprising: i) providing to the sample: 1) a plurality of molecular
probes, comprising: A) at least a first molecular probe having a
first binding moiety conjugated to a first oligonucleotide
sequence; and B) at least a second molecular probe having a second
binding moiety conjugated to a second oligonucleotide sequence; and
2) a plurality of detectable components, comprising: A) at least a
first detectable component, comprising a first bead conjugated to a
complementary first oligonucleotide sequence, wherein the first
bead comprises one or more signal generating moieties; B) at least
a second detectable component, comprising a second bead conjugated
to a complementary second oligonucleotide sequence, wherein the
second bead comprises one or more signal generating moieties; ii)
binding the one or more targets, comprising at least one of the
following: 1) binding at least a first target of the one or more
targets in the sample with the first binding moiety of the at least
first molecular probe; and 2) binding at least a second target of
the one or more targets in the sample with the second binding
moiety of the at least second molecular probe; iii) hybridizing the
plurality of molecular probes and the plurality of detectable
components, comprising at least one of the following: 1)
hybridizing the first oligonucleotide sequence of at least first
molecular probe to the first complementary oligonucleotide sequence
segment of the at least first detectable component; and 2)
hybridizing the second oligonucleotide sequence of at least second
molecular probe to the second complementary oligonucleotide
sequence segment of the at least second detectable component; and
iv) detecting one or more signals generated from at least one of
the following: 1) the at least first hybridized detectable
component; and 2) the at least second hybridized detectable
component; wherein the method is characterized by one or more of
the following: a) the conjugation between the first oligonucleotide
sequence and the first binding moiety, between the second
oligonucleotide sequence and the second binding moiety, between the
first complementary oligonucleotide sequence and the first bead,
and between the second complementary oligonucleotide sequence and
the second bead, comprises one or more covalent bond linkages,
comprising a hydrazone, oxime, triazine, or other covalent bond,
wherein the formation of the conjugates are at least 90% efficient;
and b) the first binding moiety comprises a strong binding affinity
for the at least first target of the one or more targets and the
second binding moiety comprises a strong binding affinity for the
at least second target of the one or more targets.
Example 54D
[0910] A method for assaying one or more targets of a sample,
comprising: i) providing to the sample: a) a plurality of molecular
probes, comprising: a first oligonucleotide sequence independently
paired, via conjugation, to a plurality of binding moieties
comprising at least a first binding moiety and at least a second
binding moiety; b) a plurality of detectable components,
comprising: a plurality of second oligonucleotide sequences
independently paired, via conjugation, to a plurality of beads
having one or more signal generating moieties comprising at least a
first bead and at least a second bead; and c) a plurality of
universal adapters, comprising: a first oligonucleotide sequence
segment, complementary to the first oligonucleotide sequence of
said plurality of molecular probes, independently paired with a
plurality of second oligonucleotide sequence segments complementary
to the plurality of second oligonucleotide sequences of said
plurality of detectable components; ii) binding the one or more
targets, comprising at least one of the following: a) binding at
least a first target of the one or more targets in the sample with
the first binding moiety of the at least first molecular probe; and
b) binding at least a second target of the one or more targets in
the sample with the second binding moiety of the at least second
molecular probe; iii) hybridizing the plurality of molecular probes
and the plurality of detectable components with the plurality of
universal adapters; and iv) detecting one or more signals generated
from at least one of the following: a) the at least first
hybridized detectable component; and b) the at least second
hybridized detectable component; wherein the method is
characterized by one or more of the following: A) the conjugation
between the first oligonucleotide sequence and the first binding
moiety, between the second oligonucleotide sequence and the second
binding moiety, between the first complementary oligonucleotide
sequence and the first bead, and between the second complementary
oligonucleotide sequence and the second bead, comprises one or more
covalent bond linkages, comprising a hydrazone, oxime, triazine, or
other covalent bond, wherein the formation of the conjugates are at
least 90% efficient; and B) the first binding moiety comprises a
strong binding affinity for the at least first target of the one or
more targets and the second binding moiety comprises a strong
binding affinity for the at least second target of the one or more
targets.
Example 1E
[0911] A tunable detection system, comprising: i) a molecular probe
prepared by conjugating a first oligonucleotide sequence to a
binding moiety; and ii) a series of detectable components,
comprising a range of signal generating moieties conjugated to a
second oligonucleotide sequence, wherein the range of signal
generating moieties generates a range of signal intensities, and
wherein the second oligonucleotide sequence is complementary to the
first oligonucleotide sequence; wherein the range of signal
intensities generated can be tuned over a range from the limit of
self-quenching to the intensity of a single signal generating
moiety.
Example 2E
[0912] A tunable detection system, comprising: i) a molecular probe
prepared by conjugating a first oligonucleotide sequence to a
binding moiety; and ii) a series of detectable components,
comprising a range of signal generating moieties conjugated to a
second oligonucleotide sequence, wherein the range of signal
generating moieties generates a range of signal intensities; and
iii) a universal adapter, comprising a first oligonucleotide
sequence segment complementary to the first oligonucleotide
sequence and a second oligonucleotide sequence segment
complementary to the second oligonucleotide sequence; wherein the
range of signal intensities generated can be tuned over a range
from the limit of self-quenching to intensity of a single signal
generating moiety.
Example 3E
[0913] The tunable detection system of Examples 1E or 2E, wherein
the signal generated is from a target in a sample bound by the
molecular probe that is hybridized to the detectable component.
Example 4E
[0914] The tunable detection system of any one of Examples 1E-3E,
wherein the detectable component or the hybridized detectable
component comprises one or more signal generating moieties,
comprising one or more of the following: a directly detectable
signal generating moiety, an indirectly detectable signal
generating moiety, a fluorescent dye, a fluorophore, a
fluorochrome, a chromophore, a biofluorescent protein, a
luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations thereof.
Example 5E
[0915] The tunable detection system of any one of Examples 1E-4E,
wherein the detectable component comprises a scaffold conjugated to
the second oligonucleotide sequence, and wherein said scaffold
comprises the one or more signal generating moieties.
Example 6E
[0916] The tunable detection system of any one of Examples 1E-5E,
wherein the scaffold comprises a dendrimer, a polysaccharide
molecule, a dextran, a protein, a peptide, a second oligonucleotide
sequence, a portion of the oligonucleotide sequence that is not
complementary to the oligonucleotide sequence of the molecular
probe, a polymer, a hydrophilic polymer, a bead, a nanoparticle, or
combinations or derivatives thereof.
Example 7E
[0917] The tunable detection system of any one of Examples 1E-6E,
wherein the tuning of the signal intensities generated is
determined by selecting the identity of the detectable component or
by having a greater or lesser number of signal generating
moieties.
Example 8E
[0918] The tunable detection system of any one of Examples 1E-7E,
wherein: i) the tunable detection system comprises a singleplex or
multiplex tunable detection system; and ii) the tunable detection
system detects, measures, or quantifies the level of binding and/or
amount of one or more targets present in a sample from the
generated signal by one or more of the following: flow cytometry,
immunomagnetic cellular depletion, immunomagnetic cell capture,
array, bead array, multiplex bead array, microarray, antibody
array, cellular array, chemiluminescence, infrared, microscopy,
imaging, high content screening (HCS), mass cytometry, lateral flow
immunoassay, immunodetection, immunohistochemistry (IHC),
immunocytochemistry (ICC), in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot,
immunoturbidity, latex agglutination, gold particle agglutination,
visual inspection, a change in light transmittance through said
sample, increased light transmittance through said sample, a
blotting method, a Western blot, a Southern blot, a Southwestern
blot, labeling inside an electrophoresis system, labeling on a
surface, labeling on an array, PCR amplification, elongation
followed by PCR amplification, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, or combinations thereof.
Example 9E
[0919] The tunable detection system of any one of Examples 1E-8E,
wherein the tunable detection system minimizes signal
spillover.
Example 10E
[0920] A tunable detection system, comprising: i) a plurality of
molecular probes comprising: 1) at least a first molecular probe
prepared by conjugating a first oligonucleotide sequence to a first
binding moiety; and 2) at least a second molecular probe prepared
by conjugating a second oligonucleotide sequence to a second
binding moiety; and ii) a plurality of detectable components
comprising: 1) at least a first detectable component comprising a
range of first signal generating moieties conjugated to a
oligonucleotide sequence complementary to said first
oligonucleotide sequence, wherein the range of first signal
generating moieties generates a range of signal intensities; and 2)
at least a second detectable component comprising a range of second
signal generating moieties conjugated to a oligonucleotide sequence
complementary to said second oligonucleotide sequence, wherein the
range of second signal generating moieties generates a range of
signal intensities; wherein the range of signal intensities
generated from the at least first detectable component and the at
least second detectable component can be individually tuned over a
range from the limit of self-quenching to intensity of the single
first signal generating moiety or the second signal generating
moiety, respectively.
Example 11E
[0921] A tunable detection system, comprising: i) a plurality of
molecular probes comprising a plurality of binding moieties
independently conjugated to a universal oligonucleotide sequence,
comprising: 1) at least a first molecular probe comprising a first
binding moiety conjugated to a universal oligonucleotide sequence;
and 2) at least a second molecular probe comprising a second
binding moiety conjugated to a universal oligonucleotide sequence;
and ii) a plurality of detectable components comprising a range of
first signal generating moieties independently conjugated to a
plurality of oligonucleotide sequences, comprising: 1) at least a
first detectable component comprising a range of first signal
generating moieties conjugated to first oligonucleotide sequence,
wherein the range of first signal generating moieties generates a
range of signal intensities; and 2) at least a second detectable
component comprising a range of second signal generating moieties
conjugated to a second oligonucleotide sequence,
[0922] wherein the range of second signal generating moieties
generates a range of signal intensities; and iii) a plurality of
universal adapters, comprising a first oligonucleotide sequence
segment complementary to the universal oligonucleotide sequence
independently paired with a plurality of oligonucleotide sequence
segments complementary to the plurality of oligonucleotide sequence
of the plurality of detectable components; wherein the range of
signal intensities generated from the at least first detectable
component and the at least second detectable component can be
individually tuned over a range from the limit of self-quenching to
intensity of the single first signal generating moiety or the
second signal generating moiety, respectively.
Example 12E
[0923] The tunable detection system of Examples 10E or 11E,
wherein: i) the first signal generated is from at least a first
target in a sample bound by the at least first molecular probe that
is hybridized to the at least first detectable component; and ii)
the second signal generated is from at least a second target in the
sample bound by the at least second molecular probe that is
hybridized to the at least second detectable component.
Example 13E
[0924] The tunable detection system of any one of Examples 10E-12E,
wherein the plurality of detectable components, the at least first
hybridized detectable component, and/or the at least second
hybridized detectable component comprise one or more signal
generating moieties, wherein said one or more signal generating
moieties comprises one or more of the following: a directly
detectable signal generating moiety, an indirectly detectable
signal generating moiety, a fluorescent dye, a fluorophore, a
fluorochrome, a chromophore, a biofluorescent protein, a
luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations thereof.
Example 14E
[0925] The tunable detection system of any one of Examples 10E-13E,
wherein the at least first hybridized detectable component
comprises a first scaffold conjugated to the first oligonucleotide
sequence and/or the at least second hybridized detectable component
comprises a second scaffold conjugated to the second
oligonucleotide sequence.
Example 15E
[0926] The tunable detection system of any one of Examples 10E-14E,
wherein the first scaffold and/or the second scaffold comprises a
dendrimer, a polysaccharide molecule, a dextran, a protein, a
peptide, an additional oligonucleotide sequence, a portion of the
first or second oligonucleotide sequence that is not complementary
to the first or second oligonucleotide sequence of the at least
first or second molecular probe, a polymer, a hydrophilic polymer,
a bead, a nanoparticle, or combinations or derivatives thereof.
Example 16E
[0927] The tunable detection system of any one of Examples 10E-15E,
wherein the first scaffold and/or the second scaffold has one or
more signal generating moieties.
Example 17E
[0928] The tunable detection system of any one of Examples 10E-16E,
wherein: i) the tunable detection system comprises a singleplex or
multiplex tunable detection system; and ii) the tunable detection
system detects, measures, or quantifies the level of binding and/or
amount of one or more targets present in a sample from the signal
generated from the at least first detectable component and/or the
signal generated from the at least second detectable component by
one or more of the following: flow cytometry, immunomagnetic
cellular depletion, immunomagnetic cell capture, array, bead array,
multiplex bead array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, immunoturbidity, latex
agglutination, gold particle agglutination, visual inspection, a
change in light transmittance through said sample, increased light
transmittance through said sample, a blotting method, a Western
blot, a Southern blot, a Southwestern blot, labeling inside an
electrophoresis system, labeling on a surface, labeling on an
array, PCR amplification, elongation followed by PCR amplification,
immunoprecipitation, co-immunoprecipitation, chromatin
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
Example 18E
[0929] The tunable detection system of any one of Examples 10E-17E,
wherein the tunable detection system detects, measures, or
quantifies the level of binding and/or amount of one or more
targets present in a sample from the generated signal by one or
more of the following: flow cytometry, microscopy, imaging, high
content screening (HCS), multiplex bead array, microarray, antibody
array, cellular array, immunohistochemistry (IHC),
immunocytochemistry (ICC), in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot, or
blotting method
Example 19E
[0930] The tunable detection system of any one of Examples 10E-18E,
wherein the tunable detection system minimizes signal spillover by
varying one or more of the following: the identity of the first
signal generating moiety, the number of the first signal generating
moieties on the at least first detectable component, the identity
of the second signal generating moiety, the number of the second
signal generating moieties on the at least second detectable
component.
Example 20E
[0931] The tunable detection system of any one of Examples 1E-19E,
wherein the sample comprises a plurality of targets.
Example 21E
[0932] The tunable detection system of any one of Examples 1E-20E,
wherein the tunable detection system comprises one or more of the
following: i) the plurality of molecular probes comprises the
plurality of binding moieties independently conjugated to a
plurality of oligonucleotide sequences, comprising: 1) at least a
first molecular probe comprising the first binding moiety
conjugated to a first oligonucleotide sequence; and 2) at least a
second molecular probe comprising the second binding moiety
conjugated to a second oligonucleotide sequence; and ii) the
plurality of detectable components comprising the range of first
signal generating moieties independently conjugated to the
universal oligonucleotide sequence, comprising: 1) at least a first
detectable component comprising the range of first signal
generating moieties conjugated to the universal oligonucleotide
sequence, wherein the range of first signal generating moieties
generates a range of signal intensities; and 2) at least a second
detectable component comprising the range of second signal
generating moieties conjugated to the universal oligonucleotide
sequence, wherein the range of second signal generating moieties
generates a range of signal intensities; and iii) a plurality of
universal adapters, comprising a plurality of oligonucleotide
sequence segments complementary to the plurality of oligonucleotide
sequence of the plurality of molecular probes independently paired
with a second oligonucleotide sequence segment complementary to the
universal oligonucleotide sequence.
Example 22E
[0933] The tunable detection system of any one of Examples 1E-21E,
wherein the plurality of targets comprises substantially similar or
substantially different targets.
Example 23E
[0934] The tunable detection system of any one of Examples 1E-22E,
wherein at least a first target of the plurality of targets is
different among the plurality of targets.
Example 24E
[0935] The tunable detection system of any one of Examples 1E-23E,
wherein the tunable detection system comprises an automated system
or robotic system.
Example 25E
[0936] The tunable detection system of any one of Examples 1E-24E,
wherein the tunable detection system further comprises removing the
hybridized detectable component or plurality of detectable
components from the bound target or plurality of targets,
respectively, wherein said removal is by a washing or stripping
process.
Example 26E
[0937] The tunable detection system of Example 25E, wherein the
removal comprises de-hybridizing the detectable component or the
plurality of detectable components, respectively.
Example 27E
[0938] The tunable detection system of Examples 25E or 26E, wherein
the tunable detection system further comprises re-probing with a
second detectable component or second plurality of detectable
components, respectively, wherein said second detectable component
comprises at least one second signal generating moieties conjugated
to a second oligonucleotide sequence or a complementary second
oligonucleotide sequence, or said second plurality of detectable
components are prepared by independently pairing, via conjugation,
a second plurality of signal generating moieties and a second
plurality of second oligonucleotide sequences or a second plurality
of complementary second oligonucleotide sequences.
Example 28E
[0939] The tunable detection system of any one of Examples 1E-27E,
wherein the range of different signals generated from the signal
generating moieties or plurality of signal generating moieties
comprises between 2-20.
Example 29E
[0940] The tunable detection system of any one of Examples 1E-28E,
wherein the range of different signals generated from the signal
generating moieties or plurality of signal generating moieties
comprises between 2-10.
Example 30E
[0941] The tunable detection system of any one of Examples 1E-29E,
wherein the intensity of the signal generated can be tuned over a
range 1.25 to 2.times..
Example 31E
[0942] The tunable detection system of any one of Examples 1E-30E,
wherein the intensity of the signal generated can be tuned over a
range 1.5 to 3.times..
Example 32E
[0943] The tunable detection system of any one of Examples 1E-31E,
wherein the intensity of the signal generated can be tuned over a
range 2 to 4.times..
Example 33E
[0944] The tunable detection system of any one of Examples 1E-32E,
wherein the intensity of the signal generated can be tuned over a
range 1.25 to 1.75.times..
Example 34E
[0945] The tunable detection system of any one of Examples 1E-33E,
wherein the intensity of the signal generated can be tuned over a
range 2 to 6.times..
Example 35E
[0946] The tunable detection system of any one of Examples 1E-34E,
wherein the intensity of the signal generated can be tuned over a
range 3 to 5.times..
Example 36E
[0947] The tunable detection system of any one of Examples 1E-35E,
wherein the intensity of the signal generated can be tuned over a
range 2 to 10.times..
Example 37E
[0948] The tunable detection system of any one of Examples 1E-36E,
wherein the binding moiety comprises an antibody, a monoclonal
antibody, a polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 1F
[0949] A manufacturing system, comprising: i) a first series,
comprising a plurality of molecular probes, said first series
prepared by independently pairing, via conjugation, a plurality of
first oligonucleotide sequences to a plurality of binding moieties;
and ii) a second series, comprising a plurality of detectable
components, said second series prepared by independently pairing,
via conjugation, a plurality of second oligonucleotide sequences to
a plurality of signal generating moieties or to a plurality of
scaffolds having one or more of the plurality of signal generating
moieties, wherein the plurality of second oligonucleotide sequences
are complementary to the plurality of first oligonucleotide
sequences; wherein the manufacturing system is characterized by one
or more of the following: a) the first series and the second series
are made available for one or more users to combine the first
series and the second series to produce one or more hybridized
molecular probes; b) at least a portion of preassembled
combinations of the first series and the second series are produced
and made available for one or more users; c) the first series and
the second series are made available for one or more users to
combine the first series, the second series, and a sample
potentially having one or more targets, to produce one or more
hybridized target-bound molecular probes; d) the time in which to
produce the possible combinations of said first series and said
second series is less than that of conventional preparations; and
e) the time in which to hybridize and detect of the target-bound
hybrids formed from said first series and said second series is
less than conventional conjugation and detection.
Example 2F
[0950] The manufacturing system of Example 1F, wherein the
manufacturing system is further characterized by one or more of the
following: i) the first series and/or second series is provided to
one or more end users as a customized matrix or semi-matrix of the
first series and the second series as independently selected and
paired by said one or more end users, wherein the customized matrix
or semi-matrix comprises an assay useful amount of said first
series and said second series which are capable of producing a
plurality of hybridized molecular probe-detectable components; ii)
the manufacturing system reduces to manageable proportions the
number of catalog products a vendor of labeled molecular probes
must manufacture, stock, market, and distribute; and iii) at least
90% of the possible hybridized combinations of said first series
and second series can be produced in 10 hours or less.
Example 3F
[0951] A manufacturing system, comprising: i) a first series,
comprising a plurality of molecular probes, said first series
prepared by independently pairing, via conjugation, a plurality of
first oligonucleotide sequences to a plurality of binding moieties;
ii) a second series, comprising a plurality of detectable
components, said second series prepared by independently pairing,
via conjugation, a plurality of second oligonucleotide sequences to
a plurality of signal generating moieties or to a plurality of
scaffolds having one or more of the plurality of signal generating
moieties; and iii) a third series, comprising a plurality of
universal adapters comprising a plurality of complementary first
oligonucleotide sequence segments independently paired with a
plurality of complementary second oligonucleotide sequence
segments; wherein the manufacturing system is characterized by one
or more of the following: a) the first series, the second series,
and the third series, are made available for one or more users to
combine the first series, the second series, and the third series,
to produce one or more hybridized molecular probes; b) at least a
portion of preassembled combinations of the first series, the
second series, and the third series, are produced and made
available for one or more users; c) the first series, the second
series, and the third series, are made available for one or more
users to combine the first series, the second series, the third
series, and a sample potentially having one or more targets, to
produce one or more hybridized target-bound molecular probes; d)
the time in which to produce the possible combinations of said
first series, said second series, and said third series, is less
than that of conventional preparations; and e) the time in which to
hybridize and detect of the target-bound hybrids formed from said
first series, said second series, and said third series, is less
than conventional conjugation and detection.
Example 4F
[0952] The manufacturing system of Example 3F, wherein the
manufacturing system is further characterized by one or more of the
following: i) the first series, second series, and/or third series
is provided to one or more end users as a customized matrix or
semi-matrix of the first series, the second series, and the third
series, as independently selected and paired by said one or more
end users, wherein the customized matrix or semi-matrix comprises
an assay useful amount of said first series, said second series,
and said third series which are capable of producing a plurality of
hybridized molecular probe-detectable components; ii) the
manufacturing system reduces to manageable proportions the number
of catalog products a vendor of labeled molecular probes must
manufacture, stock, market, and distribute; and iii) at least 90%
of the possible hybridized combinations of said first series,
second series, and third series can be produced in 10 hours or
less.
Example 5F
[0953] The manufacturing system of any one of Examples 1F-4F,
wherein the first series comprises a plurality of between 2-50
different molecular probes.
Example 6F
[0954] The manufacturing system of any one of Examples 1F-5F,
wherein the first series comprises a plurality of between 2-25
different molecular probes.
Example 7F
[0955] The manufacturing system of any one of Examples 1F-6F,
wherein the first series comprises: i) a plurality of different
first oligonucleotide sequences; or ii) a plurality of identical
first oligonucleotide sequences.
Example 8F
[0956] The manufacturing system of any one of Examples 1F-7F,
wherein the second series comprises a plurality of between 2-50
different detectable components.
Example 9F
[0957] The manufacturing system of any one of Examples 1F-8F,
wherein the second series comprises a plurality of between 2-25
different detectable components.
Example 10F
[0958] The manufacturing system of any one of Examples 1F-9F,
wherein the second series comprises a plurality of scaffolds
independently paired, via conjugation, with the plurality of second
oligonucleotide sequences, wherein said plurality of scaffolds
comprise one or more signal generating moieties.
Example 11F
[0959] The manufacturing system of any one of Examples 1F-10F,
wherein the second series comprises: i) a plurality of different
second oligonucleotide sequences; or ii) a plurality of identical
second oligonucleotide sequences.
Example 12F
[0960] The manufacturing system of any one of Examples 3F-11F,
wherein the third series comprises a plurality of between 2-50
different universal adapters.
Example 13F
[0961] The manufacturing system of any one of Examples 3F-12F,
wherein the third series comprises a plurality of between 2-25
different universal adapters.
Example 14F
[0962] The manufacturing system of any one of Examples 3F-13F,
wherein the third series comprises: i) a plurality of different
complementary first oligonucleotide sequence segments; and. ii) a
plurality of identical complementary second oligonucleotide
sequence segments.
Example 15F
[0963] The manufacturing system of any one of Examples 3F-14F,
wherein the third series comprises: i) a plurality of identical
complementary first oligonucleotide sequence segments; and. ii) a
plurality of different complementary second oligonucleotide
sequence segments.
Example 16F
[0964] The manufacturing system of any one of Examples 1F-15F,
wherein the manufacturing system produces at least one or more of
the following: i) a customized first series; and ii) a customized
second series; wherein the manufacturing system reduces to
manageable proportions the number of catalog products a vendor of
labeled molecular probes and/or detectable components to
manufacture, stock, market, and/or distribute.
Example 17F
[0965] The manufacturing system of Example 16F, wherein the
manufacturing system further produces a customized third
series.
Example 18F
[0966] The manufacturing system of any one of Examples 1F-17F,
wherein the manufacturing system enables a manufacturer to provide
at least one or more of the following: i) a plurality of
customizable molecular probes, comprising a plurality of first
oligonucleotide sequences conjugated to a plurality of binding
moieties; and ii) a plurality of customizable detectable
components, comprising a plurality of second oligonucleotide
sequences conjugated to a plurality of signal generating
moieties.
Example 19F
[0967] The manufacturing system of Example 18F, wherein the
manufacturing system further enables a manufacturer to provide a
plurality of customizable universal adapters, comprising a
plurality of first complementary oligonucleotide sequence segments
independently paired with a plurality of second complementary
oligonucleotide sequence segments.
Example 20F
[0968] The manufacturing system of any one of Examples 1F-19F,
wherein the manufacturing system enables either the manufacturer or
the end user to produce the plurality of customizable molecular
probes and/or the plurality of customizable detectable components
in a time at least 10% less, 20%, 30%, 40%, 50%, 75%, 100%, 200%,
300%, or 500% less than as required by conventional conjugations to
prepare the directly labeled binding moieties.
Example 21F
[0969] The manufacturing system of Example 20F, wherein the
manufacturing system further enables either the manufacturer or the
end user to produce the plurality of customizable molecular probes,
the plurality of customizable detectable components, and/or the
plurality of customizable universal adapters in a time at least 10%
less, 20%, 30%, 40%, 50%, 75%, 100%, 200%, 300%, or 500% less than
as required by conventional conjugations to prepare the directly
labeled binding moieties.
Example 22F
[0970] The manufacturing system of any one of Examples 1F-21F,
wherein the manufacturing system enables either the manufacturer or
the end user to hybridize the plurality of customizable molecular
probes and the plurality of customizable detectable components to
form a plurality of hybridized combinations in a time at least 10%
less, 20%, 30%, 40%, 50%, 75%, 100%, 200%, 300%, or 500% less than
as required by conventional conjugations to prepare the directly
labeled binding moieties
Example 23F
[0971] The manufacturing system of Example 22F, wherein the
manufacturing system further enables either the manufacturer or the
end user to hybridize the plurality of customizable molecular
probes, the plurality of customizable detectable components, and
the plurality of customizable universal adapters to form a
plurality of hybridized combinations in a time at least 10% less,
20%, 30%, 40%, 50%, 75%, 100%, 200%, 300%, or 500% less than as
required by conventional conjugations to prepare the directly
labeled binding moieties.
Example 24F
[0972] The manufacturing system of any one of Examples 1F-23F,
wherein, prior to contacting a sample comprising one or more
targets, the manufacturing system enables the end user to hybridize
the plurality of customizable molecular probes and the plurality of
customizable detectable components, to form a plurality of
hybridized combinations a time at least 10% less, 20%, 30%, 40%,
50%, 75%, 100%, 200%, 300%, or 500% less than as required by
conventional conjugations to prepare the directly labeled binding
moieties.
Example 25F
[0973] The manufacturing system of Example 24F, wherein, prior to
contacting a sample comprising one or more targets, the
manufacturing system further enables the end user to hybridize the
plurality of customizable molecular probes, the plurality of
customizable detectable components, and the plurality of
customizable universal adapters to form a plurality of hybridized
combinations in a time at least 10% less, 20%, 30%, 40%, 50%, 75%,
100%, 200%, 300%, or 500% less than as required by conventional
conjugations to prepare the directly labeled binding moieties.
Example 26F
[0974] The manufacturing system of any one of Examples 1F-23F,
wherein the manufacturing system enables the end user, after
contacting a sample comprising one or more targets with either: i)
the plurality of customizable molecular probes; or ii) the
plurality of customizable detectable components; to hybridize the
plurality of customizable molecular probes, either bound or
non-bound to at least one of the one or more targets, and the
plurality of customizable detectable components in the presence of
the sample to form a plurality of hybridized combinations and/or a
plurality of target-bound hybridized combinations in a time at
least 10% less, 20%, 30%, 40%, 50%, 75%, 100%, 200%, 300%, or 500%
less than as required by conventional conjugations to prepare the
directly labeled binding moieties.
Example 27F
[0975] The manufacturing system of Example 26F, wherein the
manufacturing system further enables the end user, after contacting
a sample comprising one or more targets with either: i) the
plurality of customizable molecular probes; ii) the plurality of
customizable detectable components; or iii) the plurality of
customizable universal adapters; to hybridize the plurality of
customizable molecular probes, either bound or non-bound to at
least one of the one or more targets, and the plurality of
customizable detectable components and the plurality of
customizable universal adapters in the presence of the sample to
form a plurality of hybridized combinations and/or a plurality of
target-bound hybridized combinations a time at least 10% less, 20%,
30%, 40%, 50%, 75%, 100%, 200%, 300%, or 500% less than as required
by conventional conjugations to prepare the directly labeled
binding moieties.
Example 28F
[0976] The manufacturing system of any one of Examples 1F-27F,
wherein the manufacturing system enables the end user to choose the
mode of addition of the first series and the second series to the
sample comprising one or more targets.
Example 29F
[0977] The manufacturing system of any one of Examples 3F-28F,
wherein the manufacturing system enables the end user to choose the
mode of addition of the first series, the second series, and the
third series to the sample comprising one or more targets.
Example 30F
[0978] The manufacturing system of any one of Examples 1F-29F,
wherein the manufacturing system enables the end user to
pre-assemble, via hybridization, prior to contacting the sample, in
a time at least 10% less, 20%, 30%, 40%, 50%, 75%, 100%, 200%,
300%, or 500% less than as required by conventional conjugations to
prepare the directly labeled binding moieties.
Example 31F
[0979] The manufacturing system of any one of Examples 1F-30F,
wherein the manufacturing system enables either the manufacturer or
the end user to produce a complete or semi-complete matrix of
combination of said first series and said second series, in a time
at least 10% less, 20%, 30%, 40%, 50%, 75%, 100%, 200%, 300%, or
500% less than as required by conventional conjugations to prepare
the directly labeled binding moieties.
Example 32F
[0980] The manufacturing system of Example 31F, wherein the
manufacturing system further enables either the manufacturer or the
end user to produce a complete or semi-complete matrix of
combination of said first series, said second series, and said
third series, in a time at least 10% less, 20%, 30%, 40%, 50%, 75%,
100%, 200%, 300%, or 500% less than as required by conventional
conjugations to prepare the directly labeled binding moieties
Example 33F
[0981] The manufacturing system of any one of Examples 1F-32F,
wherein the manufacturing system enables a vendor or manufacturer
to reduce to manageable proportions the number of products the
vendor or the manufacturer of molecular probes, detectable
components, and/or universal detectors, must produce, stock,
market, and/or distribute, than vendors or manufacturers using
conventional conjugations systems to prepare the directly labeled
binding moieties.
Example 34F
[0982] The manufacturing system of any one of Examples 1F-33F,
wherein the manufacturing system enables a vendor or manufacturer
to offer a greater variety of molecular probes, detectable
components, and/or universal detectors, than vendors or
manufacturers using conventional conjugations systems to prepare
the directly labeled binding moieties.
Example 35F
[0983] The manufacturing system of any one of Examples 3F-34F,
wherein the manufacturing system enables a vendor or manufacturer
to prepare a larger number and/or a more diverse set of molecular
probes, detectable components, and/or universal detectors, than
vendors or manufacturers using conventional conjugations systems to
prepare the directly labeled binding moieties.
Example 36F
[0984] The manufacturing system of any one of Examples 1F-35F,
wherein the manufacturing system enables a vendor or manufacturer
to produce a customizable catalog of molecular probes, detectable
components, and universal detectors, as compared to vendors or
manufacturers using conventional conjugations systems to prepare
the directly labeled binding moieties.
Example 37F
[0985] The manufacturing system of any one of Examples 1F-36F,
wherein the manufacturing system enables a vendor or manufacturer
to rapidly, reproducibly, and on demand, produce molecular probes
having, on average, between about 1-4 oligonucleotide sequences
conjugated onto a binding moiety.
Example 38F
[0986] The manufacturing system of any one of Examples 1F-37F,
wherein the manufacturing system enables a vendor or manufacturer
to rapidly, reproducibly, and on demand, produce detectable
components having a predetermined number of signal generating
moieties conjugated to the complementary second oligonucleotide
sequences or the second oligonucleotide sequences.
Example 39F
[0987] The manufacturing system of any one of Examples 1F-38F,
wherein the manufacturing system enables a vendor or manufacturer
to rapidly, reproducibly, and on demand, produce detectable
components having a predetermined number of scaffolds conjugated to
the complementary second oligonucleotide sequences or the second
oligonucleotide sequences, wherein the scaffolds comprise a
plurality of signal generating moieties.
Example 40F
[0988] The manufacturing system of any one of Examples 1F-39F,
wherein the manufacturing system enables a vendor or manufacturer
to rapidly, reproducibly, and on demand, produce universal adapters
having either: i) a complementary first oligonucleotide sequence
segment independently paired with a plurality of different
complementary second oligonucleotide sequence segments; or ii) a
plurality of different complementary first oligonucleotide sequence
segments independently paired with a complementary second
oligonucleotide sequence segment.
Example 41F
[0989] The manufacturing system of any one of Examples 1F-40F,
wherein the conjugation of least one of the following: i) between
the first oligonucleotide sequence and the binding moiety of the
first series; ii) between the second complementary oligonucleotide
sequence and the signal generating moiety or the scaffold
comprising the signal generating moieties of the second series; and
ii) between the second oligonucleotide sequence and the signal
generating moiety or the scaffold comprising the signal generating
moieties of the second series when the third series is employed;
comprises one or more covalent bond linkages, comprising a
hydrazone, oxime, triazine, or other covalent bond, wherein the
formation of the conjugates are at least 90% efficient.
Example 42F
[0990] The manufacturing system of any one of Examples 1F-41F,
wherein manufacturing system enables the end user to prepare and
utilize an assay comprising: i) a singleplex or multiplex assay;
and ii) the assay detects, measures, or quantifies the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, immunomagnetic cellular
depletion, immunomagnetic cell capture, array, bead array,
multiplex bead array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunoturbidity, latex agglutination, gold
particle agglutination, visual inspection, a change in light
transmittance through said sample, increased light transmittance
through said sample, immunohistochemistry (IHC),
immunocytochemistry (ICC), in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot, a
blotting method, a Western blot, a Southern blot, a Southwestern
blot, labeling inside an electrophoresis system, labeling on a
surface, labeling on an array, PCR amplification, elongation
followed by PCR amplification, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, or combinations thereof.
Example 43F
[0991] The manufacturing system of any one of Examples 1F-42F,
wherein manufacturing system enables the end user to prepare and
utilize an assay comprising: i) a singleplex or multiplex assay;
and ii) the assay detects, measures, or quantifies the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, microscopy, imaging, high
content screening (HCS), multiplex bead array, microarray, antibody
array, cellular array, immunohistochemistry (IHC),
immunocytochemistry (ICC), in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot, or
a blotting method.
Example 44F
[0992] The manufacturing system of any one of Examples 1F-43F,
wherein manufacturing system enables the end user to prepare and
utilize an assay comprising: i) a singleplex or multiplex assay;
and ii) the assay detects, measures, or quantifies the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, mass cytometry, lateral
flow immunoassay, immunohistochemistry (IHC), immunocytochemistry
(ICC), immunoprecipitation, pretargeting imaging, therapeutic
agent, or combinations thereof.
Example 45F
[0993] The manufacturing system of any one of Examples 1F-44F,
wherein manufacturing system enables the end user to analyze a
sample characterized as at least one or more of the following: i) a
complex sample; and ii) a homogeneous or a heterogeneous mixture;
wherein said sample comprises at least one or more of the
following: a) one or more analytes having substantially the same or
substantially different binding specificities; b) one or more of
the following biologic components, comprising: cells, membranes,
biological molecules, metabolites, or disease biomarkers; and c) a
biological fluid or a fluidized biological tissue.
Example 46F
[0994] The manufacturing system of any one of Examples 1F-45F,
wherein at least one of the molecular probes produced by the
manufacturing system comprises one or more of the following
properties: i) a molecular weight of between about 15,000 Daltons
to about 450,000 Daltons; ii) a solubility that is substantially
the same as that of the unconjugated binding moiety; iii) a
solubility that minimizes non-specific binding to the target; iv)
the first oligonucleotide sequence of the molecular probe does not
adversely affect the solubility of the binding moiety; v) interacts
and binds to the target via interactions other than exclusively
electrostatic; vi) a unique, distinguishable, and/or specifically
designed oligonucleotide sequence; and vii) the first
oligonucleotide sequence of the molecular probe is uniquely and
specifically designed to hybridize to the second oligonucleotide
sequence of the detectable component.
Example 47F
[0995] The manufacturing system of any one of Examples 1F-46F,
wherein the manufacturing system wherein the prepared molecular
probes and prepared detectable components have at least 90%
purity.
Example 48F
[0996] The manufacturing system of any one of Examples 3F-47F,
wherein the manufacturing system wherein the prepared universal
adapters have at least 90% purity.
Example 49F
[0997] The manufacturing system of any one of Examples 1F-48F,
wherein the preparation further comprises an isolation step
utilizing an immobilized binder, chromatography, affinity
chromatography, size exclusion chromatography, HPLC, reverse-phase
chromatography, electrophoresis, capillary electrophoresis,
polyacrylamide gel electrophoresis, agarose gel electrophoresis,
free flow electrophoresis, differential centrifugation, thin layer
chromatography, immunoprecipitation, hybridization, solvent
extraction, dialysis, filtration, diafiltration, tangential flow
filtration, ion exchange chromatography, hydrophobic interaction
chromatography, or combinations thereof.
Example 50F
[0998] The manufacturing system of Example 49F, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, electrophoresis,
differential centrifugation, immunoprecipitation, hybridization,
solvent extraction, dialysis, filtration, diafiltration, ion
exchange chromatography, hydrophobic interaction chromatography, or
combinations thereof.
Example 51F
[0999] The manufacturing system of Example 49F, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, differential
centrifugation, dialysis, filtration, hydrophobic interaction
chromatography, or combinations thereof.
Example 52F
[1000] The manufacturing system of any one of Examples 1F-51F,
wherein the binding moiety comprises an antibody, a monoclonal
antibody, a polycolonal antibody, an enzyme, a protein, a peptide,
a carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 53F
[1001] The manufacturing system of any one of Examples 1F-52F,
wherein the scaffold comprises a dendrimer, a polysaccharide, a
dextran, a protein, a peptide, a further oligonucleotide sequence,
a portion of the second oligonucleotide sequence that is not
complementary to the first oligonucleotide sequence of the
molecular probe, a polymer, a hydrophilic polymer, a bead, a
nanoparticle, or combinations or derivatives thereof.
Example 54F
[1002] The manufacturing system of any one of Examples 1F-53F,
wherein the signal generating moiety or the one or more signal
generating moieties of the detectable component or the hybridized
detectable component, comprises one or more of the following: a
directly detectable signal generating moiety, an indirectly
detectable signal generating moiety, a fluorescent dye, a
fluorophore, a fluorochrome, a chromophore, a biofluorescent
protein, a luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations or derivatives thereof.
Example 55F
[1003] The manufacturing system of any one of Examples 1F-54F,
wherein the one or more signal generating moieties provides an
enhanced signal that minimizes detection errors from background
noise, relative to conventionally labeled binding moieties.
Example 56F
[1004] The manufacturing system of any one of Examples 1F-66F,
wherein the molecular probe, the detectable component, and/or
universal adapter further comprises a spacer group, comprising a
polymerized ethylene oxide, a PEG, a PEO, a protein, a peptide, a
DNA, an RNA, an oligonucleotide sequence, or a dextran.
Example 57F
[1005] The manufacturing system of any one of Examples 1F-56F,
wherein the binding moiety, the scaffold, the first oligonucleotide
sequence, and/or the second oligonucleotide sequence comprise HyNic
or 4-FB.
Example 58F
[1006] The manufacturing system of any one of Examples 1F-57F,
wherein the detectable component comprises a unique,
distinguishable, and/or specifically designed second
oligonucleotide sequence.
Example 59F
[1007] The manufacturing system of any one of Examples 1F-58F,
wherein the first oligonucleotide sequence, second oligonucleotide
sequence, and/or oligonucleotide sequence segment comprising an
oligonucleotide sequence conjugated at the 3'-position, an
oligonucleotide sequence conjugated at the 5'-position, linear
oligonucleotide sequences, branched oligonucleotide sequences,
LNAs, PNAs, oligonucleotide sequences optionally covalently
attached to other moieties, or combinations or derivatives
thereof.
Example 60F
[1008] The manufacturing system of any one of Examples 1F-58F,
wherein the manufacturing system enables the end user to analyze a
sample comprising one or more targets.
Example 61F
[1009] The manufacturing system of Example 59F, wherein at least
one target of the one or more targets is a biological target.
Example 62F
[1010] The manufacturing system of Example 61F, wherein the
biological target comprises an antigen, a pathogen, a protein, a
peptide, an epitope, a carbohydrate-containing molecule, a small
molecule, or combinations or derivatives thereof.
Example 63F
[1011] The manufacturing system of any one of Examples 1F-62F,
wherein the manufacturing system comprises an automated system or
robotic system to prepare at least one of the following: the first
series, the second series, and the third series.
Example 64F
[1012] The manufacturing system of any one of Examples 1F-62F,
wherein the manufacturing system enables an end user to utilize an
automated system or robotic system to prepare hybridized
combinations of at least one of the following: i) the first series
and the second series; ii) the first series and the third series;
iii) the second series and the third series; and iv) the first
series, the second series, and the third series.
Example 65F
[1013] The manufacturing system of Example 64F, wherein the
hybridized combinations are prepared prior to contacting the sample
or prepared while in contact with the sample.
Example 66F
[1014] The manufacturing system of any one of Examples 1F-65F,
wherein the manufacturing system further enables the end user to
remove the hybridized detectable component or plurality of
detectable components from the bound target or plurality of
targets, respectively, wherein said removal is by a washing or
stripping process.
Example 67F
[1015] The manufacturing system of Example 66F, wherein the removal
comprises de-hybridizing the detectable component or the plurality
of detectable components, respectively.
Example 68F
[1016] The manufacturing system of Examples 66F or 67F, wherein the
manufacturing system further enables re-probing with a second
detectable component or second plurality of detectable components,
respectively, wherein said second detectable component comprises at
least one second signal generating moieties conjugated to a second
oligonucleotide sequence or a complementary second oligonucleotide
sequence, or said second plurality of detectable components are
prepared by independently pairing, via conjugation, a second
plurality of signal generating moieties and a second plurality of
second oligonucleotide sequences or a second plurality of
complementary second oligonucleotide sequences.
Example 69F
[1017] A manufacturing method, comprising: i) a first series,
comprising a plurality of molecular probes, said first series
prepared by independently pairing, via conjugation, a plurality of
first oligonucleotide sequences to a plurality of binding moieties;
and ii) a second series, comprising a plurality of detectable
components, said second series prepared by independently pairing,
via conjugation, a plurality of second oligonucleotide sequences to
a plurality of signal generating moieties or to a plurality of
scaffolds having one or more of the plurality of signal generating
moieties, wherein the plurality of second oligonucleotide sequences
are complementary to the plurality of first oligonucleotide
sequences; wherein the manufacturing system is characterized by one
or more of the following: a) the first series and the second series
are made available for one or more users to combine the first
series and the second series to produce one or more hybridized
molecular probes; b) at least a portion of preassembled
combinations of the first series and the second series are produced
and made available for one or more users; c) the first series and
the second series are made available for one or more users to
combine the first series, the second series, and a sample
potentially having one or more targets, to produce one or more
hybridized target-bound molecular probes; d) the time in which to
produce the possible combinations of said first series and said
second series is less than that of conventional preparations; and
e) the time in which to hybridize and detect of the target-bound
hybrids formed from said first series and said second series is
less than conventional conjugation and detection.
Example 70F
[1018] The manufacturing method of Example 69F, wherein the method
further comprises providing to one or more end users a customized
matrix or semi-matrix of the first series and the second series as
independently selected and paired by said one or more end users,
wherein the customized matrix or semi-matrix comprises an assay
useful amount of said first series and said second series which are
capable of producing a plurality of hybridized molecular
probe-detectable components; wherein: a) the manufacturing method
reduces to manageable proportions the number of catalog products a
vendor of labeled molecular probes must manufacture, stock, market,
and distribute; and b) at least 90% of the possible hybridized
combinations of said first series and second series can be produced
in 10 hours or less.
Example 71F
[1019] A manufacturing method, comprising: i) preparing a first
series, comprising a plurality of molecular probes, said first
series prepared by independently pairing, via conjugation, a
plurality of first oligonucleotide sequences to a plurality of
binding moieties; ii) preparing a second series, comprising a
plurality of detectable components, said second series prepared by
independently pairing, via conjugation, a plurality of second
oligonucleotide sequences to a plurality of signal generating
moieties or to a plurality of scaffolds having one or more of the
plurality of signal generating moieties; and iii) preparing a third
series, comprising a plurality of universal adapters comprising a
plurality of complementary first oligonucleotide sequence segments
independently paired with a plurality of complementary second
oligonucleotide sequence segments; wherein the method is
characterized by one or more of the following: a) the prepared
first series, the prepared second series, and the prepared third
series, are made available for one or more users to combine the
prepared first series, the prepared second series, and the prepared
third series, to produce one or more hybridized molecular probes;
b) at least a portion of preassembled combinations of the prepared
first series, the prepared second series, and the prepared third
series, are produced and made available for one or more users; c)
the prepared first series, the prepared second series, and the
prepared third series, are made available for one or more users to
combine the prepared first series, the prepared second series, the
prepared third series, and a sample potentially having one or more
targets, to produce one or more hybridized target-bound molecular
probes; d) the time in which to produce the possible combinations
of said prepared first series, said prepared second series, and
said prepared third series, is less than that of conventional
preparations; and e) the time in which to hybridize and detect of
the target-bound hybrids formed from said prepared first series,
said prepared second series, and said prepared third series, is
less than conventional conjugation and detection.
Example 72F
[1020] The manufacturing method of Example 71F, wherein the method
further comprises providing to one or more end users a customized
matrix or semi-matrix of the first series, the second series, and
the third series, as independently selected and paired by said one
or more end users, wherein the customized matrix or semi-matrix
comprises an assay useful amount of said first series, said second
series, and said third series which are capable of producing a
plurality of hybridized molecular probe-detectable components;
wherein: a) the manufacturing method reduces to manageable
proportions the number of catalog products a vendor of labeled
molecular probes must manufacture, stock, market, and distribute;
and b) at least 90% of the possible hybridized combinations of said
first series, second series, and third series can be produced in 10
hours or less.
Example 73F
[1021] A method of offering detectable molecular probes,
comprising: i) offering to one or more users a first series,
comprising a plurality of molecular probes, said first series
prepared by independently pairing, via conjugation, a plurality of
first oligonucleotide sequences to a plurality of binding moieties;
ii) offering to one or more users a second series, comprising a
plurality of detectable components, said second series prepared by
independently pairing, via conjugation, a plurality of second
oligonucleotide sequences to a plurality of signal generating
moieties or to a plurality of scaffolds having one or more of the
plurality of signal generating moieties, wherein the plurality of
second oligonucleotide sequences are complementary to the plurality
of first oligonucleotide sequences; and iii) providing the first
series and the second series to the one or more users, to combine
the first series, the second series, and a sample having one or
more targets, at an appropriate time, and in an appropriate amount,
to produce one or more hybridized target-bound molecular probes;
wherein the method is characterized by one or more of the
following: a) the first series and the second series are made
available for one or more users to combine the first series and the
second series to produce one or more hybridized molecular probes;
b) at least a portion of preassembled combinations of the first
series and the second series are produced and made available for
one or more users; c) the first series and the second series are
made available for one or more users to combine the first series,
the second series, and a sample potentially having one or more
targets, to produce one or more hybridized target-bound molecular
probes; d) the time in which to produce the possible combinations
of said first series and said second series is less than that of
conventional preparations; and e) the time in which to hybridize
and detect of the target-bound hybrids formed from said first
series and said second series is less than conventional conjugation
and detection.
Example 74F
[1022] The method of Example 73F, wherein: i) the first series
and/or second series is provided to the one or more end users as a
customized matrix or semi-matrix of the first series and the second
series, independently selected and paired by said one or more end
users, wherein the customized matrix or semi-matrix comprises an
assay useful amount of said first series and said second series
which are capable of producing a plurality of hybridized molecular
probe-detectable components; ii) the method reduces to manageable
proportions the number of catalog products a vendor of labeled
molecular probes must manufacture, stock, market, and distribute;
and iii) at least 90% of the possible hybridized combinations of
said first series and second series can be produced in 10 hours or
less.
Example 75F
[1023] A method of offering detectable molecular probes,
comprising: i) offering to one or more users a first series,
comprising a plurality of molecular probes, said first series
prepared by independently pairing, via conjugation, a plurality of
first oligonucleotide sequences to a plurality of binding moieties;
ii) offering to one or more users a second series, comprising a
plurality of detectable components, said second series prepared by
independently pairing, via conjugation, a plurality of second
oligonucleotide sequences to a plurality of signal generating
moieties or to a plurality of scaffolds having one or more of the
plurality of signal generating moieties; and iii) offering to one
or more users a third series, comprising a plurality of universal
adapters comprising a plurality of complementary first
oligonucleotide sequence segments independently paired with a
plurality of complementary second oligonucleotide sequence
segments; iii) providing the first series, the second series, and
the third series to the one or more users, to combine the first
series, the second series, the third series and a sample having one
or more targets, at an appropriate time, and in an appropriate
amount, to produce one or more hybridized target-bound molecular
probes; wherein the method is characterized by one or more of the
following: a) the first series and the second series are made
available for one or more users to combine the first series and the
second series to produce one or more hybridized molecular probes;
b) at least a portion of preassembled combinations of the first
series and the second series are produced and made available for
one or more users; c) the first series and the second series are
made available for one or more users to combine the first series,
the second series, and a sample potentially having one or more
targets, to produce one or more hybridized target-bound molecular
probes; d) the time in which to produce the possible combinations
of said first series and said second series is less than that of
conventional preparations; and e) the time in which to hybridize
and detect of the target-bound hybrids formed from said first
series and said second series is less than conventional conjugation
and detection.
Example 76F
[1024] The method of Example 75F, wherein: i) the first series, the
second series, and/or the third series is provided to the one or
more end users as a customized matrix or semi-matrix of the first
series, the second series, and the third series, as independently
selected and paired by said one or more end users, wherein the
customized matrix or semi-matrix comprises an assay useful amount
of said first series, said second series, and said third series
which are capable of producing a plurality of hybridized molecular
probe-detectable components; ii) the method reduces to manageable
proportions the number of catalog products a vendor of labeled
molecular probes must manufacture, stock, market, and distribute;
and iii) at least 90% of the possible hybridized combinations of
said first series, said second series, and said third series can be
produced in 10 hours or less.
Example 1G
[1025] A flow cytometry method for assaying a target of a sample,
comprising: i) providing to the sample: 1) a molecular probe,
comprising a binding moiety conjugated to a first oligonucleotide
sequence; and 2) a detectable component, comprising a signal
generating moiety conjugated to a second oligonucleotide sequence
that is complementary to the first oligonucleotide sequence of the
molecular probe; ii) binding the target in the sample with the
binding moiety of the molecular probe; iii) hybridizing the first
oligonucleotide sequence of the molecular probe with the second
oligonucleotide sequence of the detectable component; and iv)
detecting a signal generated from the hybridized detectable
component using flow cytometry; wherein the method is characterized
by one or more of the following: a) the conjugation between the
first oligonucleotide sequence and the binding moiety and
conjugation between the second oligonucleotide sequence and the
signal generating moiety, comprises one or more covalent bond
linkages, comprising a hydrazone, oxime, triazine, or other
covalent bond, wherein the formation of the conjugates are at least
90% efficient; and b) the binding moiety comprises a strong binding
affinity for the target.
Example 2G
[1026] The method of Example 1G, wherein the mode of addition
comprises: i) the molecular probe and the detectable component are
combined together and hybridized prior to contacting the sample;
ii) the molecular probe is combined with the sample prior to the
addition of the detectable component; or iii) the detectable
component is combined with the sample prior to the addition of the
molecular probe.
Example 3G
[1027] The method of any one of Examples 1G-2G, wherein the method
comprises: i) the molecular probe binding the target prior to
hybridizing with the detectable component; or ii) the molecular
probe hybridizing with the detectable component prior to binding
the target.
Example 4G
[1028] A flow cytometry method for assaying a target of a sample,
comprising: i) providing to the sample: 1) a molecular probe,
comprising a binding moiety conjugated to a first oligonucleotide
sequence; 2) a detectable component, comprising a signal generating
moiety conjugated to a second oligonucleotide sequence; and 3) a
universal adapter, comprising an oligonucleotide sequence having a
first sequence segment complementary to the first oligonucleotide
sequence of the molecular probe and a second sequence segment
complementary to the second oligonucleotide sequence of the
detectable component; ii) binding the target in the sample with the
binding moiety of the molecular probe; iii) hybridizing the first
oligonucleotide sequence of the molecular probe to the first
oligonucleotide sequence segment of the universal adapter; iv)
hybridizing the second oligonucleotide sequence of the detectable
component to the second oligonucleotide sequence segment of the
universal adapter; and v) detecting a signal generated from the
hybridized detectable component using flow cytometry; wherein the
method is characterized by one or more of the following: a) the
conjugation between the first oligonucleotide sequence and the
binding moiety and conjugation between the second complementary
oligonucleotide sequence and the signal generating moiety,
comprises one or more covalent bond linkages, comprising a
hydrazone, oxime, triazine, or other covalent bond, wherein the
formation of the conjugates are at least 90% efficient; and b) the
binding moiety comprises a strong binding affinity for the
target.
Example 5G
[1029] The method of Example 4G, wherein the mode of addition
comprises: i) the molecular probe, the universal adapter, and the
detectable component are combined together and hybridized prior to
contacting the sample; ii) the molecular probe and the universal
adapter are combined together and hybridized prior to contacting
the sample; iii) the detectable component and the universal adapter
are combined together and hybridized prior to contacting the
sample; iv) the molecular probe, alone or in combination with the
detectable component, is combined with the sample prior to the
addition of the universal adapter; or v) the universal adapter is
combined with the sample prior to the addition of the molecular
probe and/or the detectable component.
Example 6G
[1030] The method of Example 4G or 5G, wherein the method
comprises: i) the molecular probe hybridizing with the universal
adapter prior to said molecular probe binding the target; ii) the
molecular probe hybridizing with the universal adapter after said
molecular probe binds the target; iii) the detectable component
hybridizing with the universal adapter prior to the molecular probe
binding the target; iv) the detectable component hybridizing with
the universal adapter after the molecular probe binds the target;
v) the universal adapter hybridizing with the molecular probe and
hybridizing with the detectable component prior to said molecular
probe binding the target; or vi) the universal adapter hybridizing
with the molecular probe and hybridizing with the detectable
component after said molecular probe binds the target.
Example 7G
[1031] The method of any one of Examples 1G-6G, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with flow cytometry.
Example 8G
[1032] The method of any one of Examples 1G-7G, wherein method
further comprises detecting, measuring, or quantifying the level of
binding and/or amount of the target present in the sample with one
or more of the following: immunomagnetic cellular depletion,
immunomagnetic cell capture, array, bead array, multiplex bead
array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunoturbidity, latex agglutination, gold
particle agglutination, visual inspection, a change in light
transmittance through said sample, increased light transmittance
through said sample, immunohistochemistry (IHC),
immunocytochemistry (ICC), in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot, a
blotting method, a Western blot, a Southern blot, a Southwestern
blot, labeling inside an electrophoresis system, labeling on a
surface, labeling on an array, PCR amplification, elongation
followed by PCR amplification, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, or combinations thereof.
Example 9G
[1033] The method of any one of Examples 1G-8G, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: flow cytometry, microscopy, imaging, high content
screening (HCS), multiplex bead array, microarray, antibody array,
cellular array, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, or a blotting
method.
Example 10G
[1034] The method of any one of Examples 1G-9G, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: flow cytometry, mass cytometry, lateral flow
immunoassay, immunohistochemistry (IHC), immunocytochemistry (ICC),
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
Example 11G
[1035] The method of any one of Examples 1G-10G, wherein the sample
is characterized as at least one or more of the following: i) a
complex sample; and ii) a homogeneous or a heterogeneous mixture;
wherein said sample comprises at least one or more of the
following: a) one or more analytes having substantially the same or
substantially different binding specificities; b) one or more of
the following biologic components, comprising: cells, membranes,
biological molecules, metabolites, or disease biomarkers; and c) a
biological fluid or a fluidized biological tissue.
Example 12G
[1036] The method of any one of Examples 1G-11G, wherein the
hybridization efficiency of the first oligonucleotide sequence to
the second oligonucleotide sequence is at least 50% with respect to
the first detectable component, under the hybridization conditions
employed.
Example 13G
[1037] The method of any one of Examples 1G-12G, wherein the
molecular probe comprises one or more of the following properties:
i) a molecular weight of between about 15,000 Daltons to about
450,000 Daltons; ii) a solubility that is substantially the same as
that of the unconjugated binding moiety; iii) a solubility that
minimizes non-specific binding to the target; iv) the first
oligonucleotide sequence of the molecular probe does not adversely
affect the solubility of the binding moiety; v) interacts and binds
to the target via interactions other than exclusively
electrostatic; vi) a unique, distinguishable, and/or specifically
designed oligonucleotide sequence; and vii) the first
oligonucleotide sequence of the molecular probe is uniquely and
specifically designed to hybridize to the second oligonucleotide
sequence of the detectable component.
Example 14G
[1038] The method of any one of Examples 1G-13G, wherein the method
of detection generates less false positives than secondary antibody
detection methods.
Example 15G
[1039] The method of any one of Examples 1G-14G, wherein the method
further comprises: i) preparing the molecular probe; and ii)
preparing the detectable component; wherein the prepared molecular
probe and prepared detectable component have at least 90%
purity.
Example 16G
[1040] The method of any one of Examples 1G-15G, wherein the method
further comprises preparing and isolating the molecular probe,
comprising: i) providing the binding moiety; ii) conjugating the
binding moiety with at least one first oligonucleotide sequence at
greater than 90% efficiency to form binding moiety-oligonucleotide
conjugates; and iii) isolating the binding moiety-oligonucleotide
conjugates from the conjugation mixture by binding, retaining,
and/or retarding a substantial portion of: a) the conjugates,
removing a substantial portion of the unconjugated first
oligonucleotide sequence in a wash step followed by release of the
bound, retained, and/or retarded conjugates; or b) the unconjugated
first oligonucleotide sequences, followed by collecting a
substantial portion of the non-bound, non-retained, and/or
non-retarded conjugates in a wash step.
Example 17G
[1041] The method of any one of Examples 1G-16G, wherein the method
further comprises preparing and isolating the detectable component,
comprising: i) providing a plurality of the signal generating
moiety; ii) conjugating the second oligonucleotide sequence with at
least one of the plurality of the signal generating moiety at
greater than 90% efficiency to form signal generating moiety-second
oligonucleotide conjugates; and iii) isolating the signal
generating moiety-second oligonucleotide conjugates from the
conjugation mixture by binding, retaining, and/or retarded a
substantial portion of: a) the conjugates, removing a substantial
portion of the unconjugated second oligonucleotide sequences in a
wash step followed by release of the bound, retained, and/or
retarded conjugates; or b) the unconjugated second oligonucleotide
sequences, followed by collecting a substantial portion of the
non-bound, non-retained, and/or non-retarded conjugates in a wash
step.
Example 18G
[1042] The method of any one of Examples 1G-17G, wherein the
detectable component comprises a scaffold conjugated to the second
oligonucleotide sequence, and wherein said scaffold comprises one
or more signal generating moieties.
Example 19G
[1043] The method of Example 18G, wherein the scaffold comprises a
dendrimer, a polysaccharide, a dextran, a protein, a peptide, a
further oligonucleotide sequence, a portion of the second
oligonucleotide sequence that is not complementary to the first
oligonucleotide sequence of the molecular probe, a polymer, a
hydrophilic polymer, a bead, a nanoparticle, or combinations or
derivatives thereof.
Example 20G
[1044] The method of any one of Examples 1G-19G, wherein the method
further comprises preparing and isolating a detectable component
comprising a scaffold conjugated to the second oligonucleotide
sequence, wherein the scaffold comprises one or more signal
generating moieties, said method comprising: i) providing a
plurality of the scaffolds comprising the one or more signal
generating moieties; ii) conjugating the second oligonucleotide
sequence with at least one of the plurality of scaffolds at greater
than 90% efficiency to form scaffold-second oligonucleotide
conjugates; and iii) isolating the scaffold-second oligonucleotide
conjugates from the conjugation mixture by binding, retaining,
and/or retarding a substantial portion of: a) the conjugates,
removing a substantial portion of the unconjugated second
oligonucleotide sequences in a wash step followed by release of the
bound, retained, and/or retarded conjugates; or b) the unconjugated
second oligonucleotide sequences, followed by collecting a
substantial portion of the non-bound, non-retained, and/or
non-retarded conjugates in a wash step.
Example 21G
[1045] The method of any one of Examples 16G-20G, wherein the
isolation step utilizes an immobilized binder, chromatography,
affinity chromatography, size exclusion chromatography, HPLC,
reverse-phase chromatography, electrophoresis, capillary
electrophoresis, polyacrylamide gel electrophoresis, agarose gel
electrophoresis, free flow electrophoresis, differential
centrifugation, thin layer chromatography, immunoprecipitation,
hybridization, solvent extraction, dialysis, filtration,
diafiltration, tangential flow filtration, ion exchange
chromatography, hydrophobic interaction chromatography, or
combinations thereof.
Example 22G
[1046] The method of any one of Examples 16G-20G, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, electrophoresis,
differential centrifugation, immunoprecipitation, hybridization,
solvent extraction, dialysis, filtration, diafiltration, ion
exchange chromatography, hydrophobic interaction chromatography, or
combinations thereof.
Example 23G
[1047] The method of any one of Examples 16G-20G, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, differential
centrifugation, dialysis, filtration, hydrophobic interaction
chromatography, or combinations thereof.
Example 24G
[1048] The method of any one of Examples 1G-23G, wherein the
binding moiety comprises an antibody, a monoclonal antibody, a
polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 25G
[1049] The method of any one of Examples 1G-24G, wherein the sample
comprises one or more targets.
Example 26G
[1050] The method of any one of Examples 1G-25G, wherein the target
is a biological target.
Example 27G
[1051] The method of Example 26G, wherein the biological target
comprises an antigen, a pathogen, a protein, a peptide, an epitope,
a carbohydrate-containing molecule, a small molecule, or
combinations or derivatives thereof.
Example 28G
[1052] The method of any one of Examples 1G-27G, wherein the signal
generating moiety or the one or more signal generating moieties of
the detectable component or the hybridized detectable component,
comprises one or more of the following: a directly detectable
signal generating moiety, an indirectly detectable signal
generating moiety, a fluorescent dye, a fluorophore, a
fluorochrome, a chromophore, a biofluorescent protein, a
luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations or derivatives thereof.
Example 29G
[1053] The method of any one of Examples 1G-28G, wherein the one or
more signal generating moieties provides an enhanced signal that
minimizes detection errors from background noise, relative to
conventionally labeled binding moieties.
Example 30G
[1054] The method of any one of Examples 1G-29G, wherein the
molecular probe, the detectable component, and/or universal adapter
further comprises a spacer group, comprising a polymerized ethylene
oxide, a PEG, a PEO, a protein, a peptide, a DNA, an RNA, an
oligonucleotide sequence, or a dextran.
Example 31G
[1055] The method of any one of Examples 1G-30G, wherein the
binding moiety, the scaffold, the first oligonucleotide sequence,
and/or the second oligonucleotide sequence comprise HyNic or
4-FB.
Example 32G
[1056] The method of any one of Examples 1G-31G, wherein the
detectable component comprises a unique, distinguishable, and/or
specifically designed second oligonucleotide sequence.
Example 33G
[1057] The method of any one of Examples 1G-32G, wherein the first
oligonucleotide sequence, second oligonucleotide sequence, and/or
oligonucleotide sequence segment comprising an oligonucleotide
sequence conjugated at the 3'-position, an oligonucleotide sequence
conjugated at the 5'-position, linear oligonucleotide sequences,
branched oligonucleotide sequences, LNAs, PNAs, oligonucleotide
sequences optionally covalently attached to other moieties, or
combinations or derivatives thereof.
Example 34G
[1058] The method of any one of Examples 1G-33G, wherein the sample
comprises one or more targets comprising at least a first target
and at least a second target.
Example 35G
[1059] The method of any one of Examples 1G-34G, wherein a
plurality of molecular probes and a plurality of detectable
components are provided to the sample.
Example 36G
[1060] The method of any one of Examples 1G-35G, wherein a
plurality of universal adapters are provided to the sample.
Example 37G
[1061] The method of any one of Examples 1G-36G, wherein the
binding affinity for the target is 10.sup.-4 M or less.
Example 38G
[1062] The method of any one of Examples 1G-37G, wherein the
binding affinity for the at least first target is 10.sup.-4 M or
less.
Example 39G
[1063] The method of any one of Examples 1G-38G, wherein the
binding affinity for the at least second target is 10.sup.-4 M or
less.
Example 40G
[1064] The method of any one of Examples 1G-39G, wherein the method
comprises an automated system or robotic system.
Example 41G
[1065] The method of any one of Examples 1G-41G, wherein the method
further comprises removing the hybridized detectable component or
plurality of detectable components from the bound target or
plurality of targets, respectively, wherein said removal is by a
washing or stripping process.
Example 41G
[1066] The method of Example 41G, wherein the removal comprises
de-hybridizing the detectable component or the plurality of
detectable components, respectively.
Example 42G
[1067] The method of Examples 40G or 41G, wherein the method
further comprises re-probing with a second detectable component or
second plurality of detectable components, respectively, wherein
said second detectable component comprises at least one second
signal generating moieties conjugated to a second oligonucleotide
sequence or a complementary second oligonucleotide sequence, or
said second plurality of detectable components are prepared by
independently pairing, via conjugation, a second plurality of
signal generating moieties and a second plurality of second
oligonucleotide sequences or a second plurality of complementary
second oligonucleotide sequences.
Example 43G
[1068] A flow cytometry method for assaying one or more targets of
a sample, comprising: i) providing to the sample: 1) a plurality of
molecular probes, comprising: A) at least a first molecular probe
having a first binding moiety conjugated to a first oligonucleotide
sequence; and B) at least a second molecular probe having a second
binding moiety conjugated to a second oligonucleotide sequence; and
2) a plurality of detectable components, comprising: A) at least a
first detectable component having a first signal generating moiety
conjugated to a first complementary oligonucleotide sequence; and
B) at least a second detectable component having a second signal
generating moiety conjugated to a second complementary
oligonucleotide sequence; ii) binding the one or more targets,
comprising at least one of the following: 1) binding at least a
first target of the one or more targets in the sample with the
first binding moiety of the at least first molecular probe; and 2)
binding at least a second target of the one or more targets in the
sample with the second binding moiety of the at least second
molecular probe; iii) hybridizing the plurality of molecular probes
and the plurality of detectable components, comprising at least one
of the following: 1) hybridizing the first oligonucleotide sequence
of at least first molecular probe to the first complementary
oligonucleotide sequence segment of the at least first detectable
component; and 2) hybridizing the second oligonucleotide sequence
of at least second molecular probe to the second complementary
oligonucleotide sequence segment of the at least second detectable
component; and iv) detecting, using flow cytometry, one or more
signals generated from at least one of the following: 1) the at
least first hybridized detectable component; and 2) the at least
second hybridized detectable component; wherein the method is
characterized by one or more of the following: a) the conjugation
between the first oligonucleotide sequence and the first binding
moiety, between the second oligonucleotide sequence and the second
binding moiety, between the first complementary oligonucleotide
sequence and the first signal generating moiety, and between the
second complementary oligonucleotide sequence and the second signal
generating moiety, comprises one or more covalent bond linkages,
comprising a hydrazone, oxime, triazine, or other covalent bond,
wherein the formation of the conjugates are at least 90% efficient;
and b) the first binding moiety comprises a strong binding affinity
for the at least first target of the one or more targets and the
second binding moiety comprises a strong binding affinity for the
at least second target of the one or more targets.
Example 44G
[1069] A flow cytometry method for assaying one or more targets of
a sample, comprising: i) providing to the sample: a) a plurality of
molecular probes, comprising: a first oligonucleotide sequence
independently paired, via conjugation, to a plurality of binding
moieties comprising at least a first binding moiety and at least a
second binding moiety; b) a plurality of detectable components,
comprising: a plurality of second oligonucleotide sequences
independently paired, via conjugation, to a plurality of one or
more signal generating moieties comprising at least a first signal
generating moiety and at least a second signal generating moiety;
and c) a plurality of universal adapters, comprising: a first
oligonucleotide sequence segment, complementary to the first
oligonucleotide sequence of said plurality of molecular probes,
independently paired with a plurality of second oligonucleotide
sequence segments complementary to the plurality of second
oligonucleotide sequences of said plurality of detectable
components; ii) binding the one or more targets, comprising at
least one of the following: a) binding at least a first target of
the one or more targets in the sample with the first binding moiety
of the at least first molecular probe; and b) binding at least a
second target of the one or more targets in the sample with the
second binding moiety of the at least second molecular probe; iii)
hybridizing the plurality of molecular probes and the plurality of
detectable components with the plurality of universal adapters; and
iv) detecting, using flow cytometry, one or more signals generated
from at least one of the following: a) the at least first
hybridized detectable component; and b) the at least second
hybridized detectable component; wherein the method is
characterized by one or more of the following: A) the conjugation
between the first oligonucleotide sequence and the first binding
moiety, between the second oligonucleotide sequence and the second
binding moiety, between the first complementary oligonucleotide
sequence and the first signal generating moiety, and between the
second complementary oligonucleotide sequence and the second signal
generating moiety, comprises one or more covalent bond linkages,
comprising a hydrazone, oxime, triazine, or other covalent bond,
wherein the formation of the conjugates are at least 90% efficient;
and B) the first binding moiety comprises a strong binding affinity
for the at least first target of the one or more targets and the
second binding moiety comprises a strong binding affinity for the
at least second target of the one or more targets.
Example 1H
[1070] A method for assaying a target of a sample, comprising: i)
providing to the sample: 1) a molecular probe, comprising a binding
moiety conjugated to a first oligonucleotide sequence; and 2) a
detectable component, comprising a signal generating moiety
conjugated to a second oligonucleotide sequence that is
complementary to the first oligonucleotide sequence of the
molecular probe; ii) binding the target in the sample with the
binding moiety of the molecular probe; iii) hybridizing the
oligonucleotide sequence of the molecular probe with the second
oligonucleotide sequence of the detectable component; and iv)
detecting a signal generated from the hybridized detectable
component using one or more of the following systems: microscopy,
imaging, high content screening (HCS), mass cytometry, lateral flow
immunoassay, immunodetection, immunohistochemistry (IHC),
immunocytochemistry (ICC), or combinations thereof; wherein the
method is characterized by one or more of the following: a) the
conjugation between the first oligonucleotide sequence and the
binding moiety and conjugation between the second oligonucleotide
sequence and the signal generating moiety, comprises one or more
covalent bond linkages, comprising a hydrazone, oxime, triazine, or
other covalent bond, wherein the formation of the conjugates are at
least 90% efficient; and b) the binding moiety comprises a strong
binding affinity for the target.
Example 2H
[1071] The method of Example 1H, wherein the mode of addition
comprises: i) the molecular probe and the detectable component are
combined together and hybridized prior to contacting the sample;
ii) the molecular probe is combined with the sample prior to the
addition of the detectable component; or iii) the detectable
component is combined with the sample prior to the addition of the
molecular probe.
Example 3H
[1072] The method of any one of Examples 1H-2H, wherein the method
comprises: i) the molecular probe binding the target prior to
hybridizing with the detectable component; or ii) the molecular
probe hybridizing with the detectable component prior to binding
the target.
Example 4H
[1073] The method of any one of Examples 1H-3H, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with the one or more of
following systems: microscopy, imaging, high content screening
(HCS), mass cytometry, lateral flow immunoassay, immunodetection,
immunohistochemistry (IHC), immunocytochemistry (ICC), or
combinations thereof.
Example 5H
[1074] A method for assaying a target of a sample, comprising: i)
providing to the sample: 1) a molecular probe, comprising a binding
moiety conjugated to a first oligonucleotide sequence; 2) a
detectable component, comprising a signal generating moiety
conjugated to a second oligonucleotide sequence; and 3) a universal
adapter, comprising an oligonucleotide sequence having a first
sequence segment complementary to the first oligonucleotide
sequence of the molecular probe and a second sequence segment
complementary to the second oligonucleotide sequence of the
detectable component; ii) binding the target in the sample with the
binding moiety of the molecular probe; iii) hybridizing the first
oligonucleotide sequence of the molecular probe to the first
oligonucleotide sequence segment of the universal adapter; iv)
hybridizing the second oligonucleotide sequence of the detectable
component to the second oligonucleotide sequence segment of the
universal adapter; and v) detecting a signal generated from the
hybridized detectable component using one or more of the following
systems: microscopy, imaging, high content screening (HCS), mass
cytometry, lateral flow immunoassay, immunodetection,
immunohistochemistry (IHC), immunocytochemistry (ICC), or
combinations thereof; wherein the method is characterized by one or
more of the following: a) the conjugation between the first
oligonucleotide sequence and the binding moiety and conjugation
between the second complementary oligonucleotide sequence and the
signal generating moiety, comprises one or more covalent bond
linkages, comprising a hydrazone, oxime, triazine, or other
covalent bond, wherein the formation of the conjugates are at least
90% efficient; and b) the binding moiety comprises a strong binding
affinity for the target.
Example 6H
[1075] The method of Example 5H, wherein the mode of addition
comprises: i) the molecular probe, the universal adapter, and the
detectable component are combined together and hybridized prior to
contacting the sample; ii) the molecular probe and the universal
adapter are combined together and hybridized prior to contacting
the sample; iii) the detectable component and the universal adapter
are combined together and hybridized prior to contacting the
sample; iv) the molecular probe, alone or in combination with the
detectable component, is combined with the sample prior to the
addition of the universal adapter; or v) the universal adapter is
combined with the sample prior to the addition of the molecular
probe and/or the detectable component.
Example 7H
[1076] The method of Examples 5H or 6H, wherein the method
comprises: i) the molecular probe hybridizing with the universal
adapter prior to said molecular probe binding the target; ii) the
molecular probe hybridizing with the universal adapter after said
molecular probe binds the target; iii) the detectable component
hybridizing with the universal adapter prior to the molecular probe
binding the target; iv) the detectable component hybridizing with
the universal adapter after the molecular probe binds the target;
v) the universal adapter hybridizing with the molecular probe and
hybridizing with the detectable component prior to said molecular
probe binding the target; or vi) the universal adapter hybridizing
with the molecular probe and hybridizing with the detectable
component after said molecular probe binds the target.
Example 8H
[1077] The method of any one of Examples 1H-7H, wherein method
further comprises detecting, measuring, or quantifying the level of
binding and/or amount of the target present in the sample with one
or more of the following: flow cytometry, immunomagnetic cellular
depletion, immunomagnetic cell capture, array, bead array,
multiplex bead array, microarray, antibody array, cellular array,
chemiluminescence, infrared, immunoturbidity, latex agglutination,
gold particle agglutination, visual inspection, a change in light
transmittance through said sample, increased light transmittance
through said sample, in situ hybridization (ISH), enzyme
immuno-assay (EIA), enzyme linked immuno-assay (ELISA), ELISpot, a
blotting method, a Western blot, a Southern blot, a Southwestern
blot, labeling inside an electrophoresis system, labeling on a
surface, labeling on an array, PCR amplification, elongation
followed by PCR amplification, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, or combinations thereof.
Example 9H
[1078] The method of any one of Examples 1H-8H, wherein the method
carries out the detecting, measuring, or quantifying via
microscopy, imaging, high content screening (HCS), or combinations
thereof.
Example 10H
[1079] The method of any one of Examples 1H-9H, wherein the method
carries out the detecting, measuring, or quantifying via mass
cytometry, lateral flow immunoassay, immunodetection,
immunohistochemistry (IHC), immunocytochemistry (ICC), or
combinations thereof.
Example 11H
[1080] The method of any one of Examples 1H-10H, wherein the sample
is characterized as at least one or more of the following: i) a
complex sample; and ii) a homogeneous or a heterogeneous mixture;
wherein said sample comprises at least one or more of the
following: a) one or more analytes having substantially the same or
substantially different binding specificities; b) one or more of
the following biologic components, comprising: cells, membranes,
biological molecules, metabolites, or disease biomarkers; and c) a
biological fluid or a fluidized biological tissue.
Example 12H
[1081] The method of any one of Examples 1H-11H, wherein the
hybridization efficiency of the oligonucleotide sequence to the
second oligonucleotide sequence is at least 50% with respect to the
detectable component, under the hybridization conditions
employed.
Example 13H
[1082] The method of any one of Examples 1H-12H, wherein the
molecular probe comprises one or more of the following properties:
i) a molecular weight of between about 15,000 Daltons to about
450,000 Daltons; ii) a solubility that is substantially the same as
that of the unconjugated binding moiety; iii) a solubility that
minimizes non-specific binding to the target; iv) the
oligonucleotide sequence of the molecular probe does not adversely
affect the solubility of the binding moiety; v) interacts and binds
to the target via interactions other than exclusively
electrostatic; vi) a unique, distinguishable, and/or specifically
designed oligonucleotide sequence; and vii) the first
oligonucleotide sequence of the molecular probe is uniquely and
specifically designed to hybridize to the second oligonucleotide
sequence of the detectable component or to the complementary first
oligonucleotide sequence segment of the universal adapter.
Example 14H
[1083] The method of any one of Examples 1H-13H, wherein the method
of detection generates less false positives than secondary antibody
detection methods.
Example 15H
[1084] The method of any one of Examples 1H-14H, wherein the method
further comprises: i) preparing the molecular probe; and ii)
preparing the detectable component; wherein the prepared molecular
probe and prepared detectable component have at least 90%
purity.
Example 16H
[1085] The method of any one of Examples 1H-15H, wherein the method
further comprises preparing and isolating the molecular probe,
comprising: i) providing the binding moiety; ii) conjugating the
binding moiety with at least one first oligonucleotide sequence at
greater than 90% efficiency to form binding moiety-oligonucleotide
conjugates; and iii) isolating the binding moiety-oligonucleotide
conjugates from the conjugation mixture by binding, retaining,
and/or retarding a substantial portion of: a) the conjugates,
removing a substantial portion of the unconjugated first
oligonucleotide sequence in a wash step followed by release of the
bound, retained, and/or retarded conjugates; or b) the unconjugated
first oligonucleotide sequences, followed by collecting a
substantial portion of the non-bound, non-retained, and/or
non-retarded conjugates in a wash step.
Example 17H
[1086] The method of any one of Examples 1H-16H, wherein the method
further comprises preparing and isolating the detectable component,
comprising: i) providing a plurality of the signal generating
moiety; ii) conjugating the second oligonucleotide sequence with at
least one of the plurality of the signal generating moiety at
greater than 90% efficiency to form signal generating moiety-second
oligonucleotide conjugates; and iii) isolating the signal
generating moiety-second oligonucleotide conjugates from the
conjugation mixture by binding, retaining, and/or retarding a
substantial portion of: a) the conjugates, removing a substantial
portion of the unconjugated second oligonucleotide sequences in a
wash step followed by release of the bound, retained, and/or
retarded conjugates; or b) the unconjugated second oligonucleotide
sequences, followed by collecting a substantial portion of the
non-bound, non-retained, and/or non-retarded conjugates in a wash
step.
Example 18H
[1087] The method of any one of Examples 1H-17H, wherein the
detectable component comprises a scaffold conjugated to the second
oligonucleotide sequence, and wherein said scaffold comprises one
or more signal generating moieties.
Example 19H
[1088] The method of Example 18H, wherein the scaffold comprises a
dendrimer, a polysaccharide, a dextran, a protein, a peptide, a
further oligonucleotide sequence, a portion of the second
oligonucleotide sequence that is not complementary to the first
oligonucleotide sequence of the molecular probe, a polymer, a
hydrophilic polymer, a bead, a nanoparticle, or combinations or
derivatives thereof.
Example 20H
[1089] The method of any one of Examples 1H-19H, wherein the method
further comprises preparing and isolating a detectable component
comprising a scaffold conjugated to the second oligonucleotide
sequence, wherein the scaffold comprises one or more signal
generating moieties, said method comprising: i) providing a
plurality of the scaffolds comprising the one or more signal
generating moieties; ii) conjugating the second oligonucleotide
sequence with at least one of the plurality of scaffolds at greater
than 90% efficiency to form scaffold-second oligonucleotide
conjugates; and iii) isolating the scaffold-second oligonucleotide
conjugates from the conjugation mixture by binding, retaining,
and/or retarding a substantial portion of: a) the conjugates,
removing a substantial portion of the unconjugated second
oligonucleotide sequences in a wash step followed by release of the
bound, retained, and/or retarded conjugates; or b) the unconjugated
second oligonucleotide sequences, followed by collecting a
substantial portion of the non-bound, non-retained, and/or
non-retarded conjugates in a wash step.
Example 21H
[1090] The method of any one of Examples 16-20H, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, HPLC, reverse-phase
chromatography, electrophoresis, capillary electrophoresis,
polyacrylamide gel electrophoresis, agarose gel electrophoresis,
free flow electrophoresis, differential centrifugation, thin layer
chromatography, immunoprecipitation, hybridization, solvent
extraction, dialysis, filtration, diafiltration, tangential flow
filtration, ion exchange chromatography, hydrophobic interaction
chromatography, or combinations thereof.
Example 22H
[1091] The method of any one of Examples 16H-20H, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, electrophoresis,
differential centrifugation, immunoprecipitation, hybridization,
solvent extraction, dialysis, filtration, diafiltration, ion
exchange chromatography, hydrophobic interaction chromatography, or
combinations thereof.
Example 23H
[1092] The method of any one of Examples 16H-20H, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, differential
centrifugation, dialysis, filtration, hydrophobic interaction
chromatography, or combinations thereof.
Example 24H
[1093] The method of any one of Examples 1H-23H, wherein the
binding moiety comprises an antibody, a monoclonal antibody, a
polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 25H
[1094] The method of any one of Examples 1H-24H, wherein the sample
comprises one or more targets.
Example 26H
[1095] The method of any one of Examples 1H-25H, wherein the target
is a biological target.
Example 27H
[1096] The method of Example 26H, wherein the biological target
comprises an antigen, a pathogen, a protein, a peptide, an epitope,
a carbohydrate-containing molecule, a small molecule, or
combinations or derivatives thereof.
Example 28H
[1097] The method of any one of Examples 1H-27H, wherein the signal
generating moiety or the one or more signal generating moieties of
the detectable component or the hybridized detectable component,
comprises one or more of the following: a directly detectable
signal generating moiety, an indirectly detectable signal
generating moiety, a fluorescent dye, a fluorophore, a
fluorochrome, a chromophore, a biofluorescent protein, a
luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, an RFID tag, a microbarcode particle, an enzyme, an
enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations or derivatives thereof.
Example 29H
[1098] The method of any one of Examples 1H-28H, wherein the one or
more signal generating moieties provides an enhanced signal that
minimizes detection errors from background noise, relative to
conventionally labeled binding moieties.
Example 30H
[1099] The method of any one of Examples 1H-29H, wherein the
molecular probe, the detectable component, and/or universal adapter
further comprises a spacer group, comprising a polymerized ethylene
oxide, a PEG, a PEO, a protein, a peptide, a DNA, an RNA, an
oligonucleotide sequence, or a dextran.
Example 31H
[1100] The method of any one of Examples 1H-30H, wherein the
binding moiety, the scaffold, the oligonucleotide sequence, and/or
the complementary oligonucleotide sequence comprise HyNic or
4-FB.
Example 32H
[1101] The method of any one of Examples 1H-31H, wherein the
detectable component comprises a unique, distinguishable, and/or
specifically designed complementary oligonucleotide sequence.
Example 33H
[1102] The method of any one of Examples 1H-32H, wherein the
oligonucleotide sequence, complementary oligonucleotide sequence,
and/or oligonucleotide sequence segment comprises an
oligonucleotide sequence conjugated at the 3'-position, an
oligonucleotide sequence conjugated at the 5'-position, linear
oligonucleotide sequences, branched oligonucleotide sequences,
LNAs, PNAs, oligonucleotide sequences optionally covalently
attached to other moieties, or combinations or derivatives
thereof.
Example 34H
[1103] The method of any one of Examples 1H-33H, wherein the sample
comprises one or more targets.
Example 35H
[1104] The method of any one of Examples 1H-34H, wherein a
plurality of molecular probes and a plurality of detectable
components are provided to the sample.
Example 36H
[1105] The method of any one of Examples 1H-35H, wherein a
plurality of universal adapters are provided to the sample.
Example 37H
[1106] The method of any one of Examples 1H-36H, wherein the
binding affinity for the target is 10.sup.-4 M or less.
Example 38H
[1107] The method of any one of Examples 1H-37H, wherein the
binding affinity for the at least first target is 10.sup.-4M or
less.
Example 39H
[1108] The method of any one of Examples 1H-38H, wherein the
binding affinity for the at least second target is 10.sup.-4 M or
less.
Example 40H
[1109] The method of any one of Examples 1H-39H, wherein the method
comprises an automated system or robotic system.
Example 41H
[1110] The method of any one of Examples 1H-41H, wherein the method
further comprises removing the hybridized detectable component or
plurality of detectable components from the bound target or
plurality of targets, respectively, wherein said removal is by a
washing or stripping process.
Example 41H
[1111] The method of Example 41H, wherein the removal comprises
de-hybridizing the detectable component or the plurality of
detectable components, respectively.
Example 42H
[1112] The method of Examples 40H or 41H, wherein the method
further comprises re-probing with a second detectable component or
second plurality of detectable components, respectively, wherein
said second detectable component comprises at least one second
signal generating moieties conjugated to a second oligonucleotide
sequence or a complementary second oligonucleotide sequence, or
said second plurality of detectable components are prepared by
independently pairing, via conjugation, a second plurality of
signal generating moieties and a second plurality of second
oligonucleotide sequences or a second plurality of complementary
second oligonucleotide sequences.
Example 43H
[1113] A method for assaying one or more targets of a sample,
comprising: i) providing to the sample: 1) a plurality of molecular
probes, comprising: A) at least a first molecular probe having a
first binding moiety conjugated to a first oligonucleotide
sequence; and B) at least a second molecular probe having a second
binding moiety conjugated to a second oligonucleotide sequence; and
2) a plurality of detectable components, comprising: A) at least a
first detectable component having a first signal generating moiety
conjugated to a first complementary oligonucleotide sequence; and
B) at least a second detectable component having a second signal
generating moiety conjugated to a second complementary
oligonucleotide sequence; ii) binding the one or more targets,
comprising at least one of the following: 1) binding at least a
first target of the one or more targets in the sample with the
first binding moiety of the at least first molecular probe; and 2)
binding at least a second target of the one or more targets in the
sample with the second binding moiety of the at least second
molecular probe; iii) hybridizing the plurality of molecular probes
and the plurality of detectable components, comprising at least one
of the following: 1) hybridizing the first oligonucleotide sequence
of at least first molecular probe to the first complementary
oligonucleotide sequence segment of the at least first detectable
component; and 2) hybridizing the second oligonucleotide sequence
of at least second molecular probe to the second complementary
oligonucleotide sequence segment of the at least second detectable
component; and iv) detecting one or more signals generated from the
at least first hybridized detectable component and/or the at least
second hybridized detectable component using one or more of the
following systems: microscopy, imaging, high content screening
(HCS), mass cytometry, lateral flow immunoassay, immunodetection,
immunohistochemistry (IHC), immunocytochemistry (ICC), or
combinations thereof; wherein the method is characterized by one or
more of the following: a) the conjugation between the first
oligonucleotide sequence and the first binding moiety, between the
second oligonucleotide sequence and the second binding moiety,
between the first complementary oligonucleotide sequence and the
first signal generating moiety, and between the second
complementary oligonucleotide sequence and the second signal
generating moiety, comprises one or more covalent bond linkages,
comprising a hydrazone, oxime, triazine, or other covalent bond,
wherein the formation of the conjugates are at least 90% efficient;
and b) the first binding moiety comprises a strong binding affinity
for the at least first target of the one or more targets and the
second binding moiety comprises a strong binding affinity for the
at least second target of the one or more targets.
Example 44H
[1114] A method for assaying one or more targets of a sample,
comprising: i) providing to the sample: a) a plurality of molecular
probes, comprising: a first oligonucleotide sequence independently
paired, via conjugation, to a plurality of binding moieties
comprising at least a first binding moiety and at least a second
binding moiety; b) a plurality of detectable components,
comprising: a plurality of second oligonucleotide sequences
independently paired, via conjugation, to a plurality of one or
more signal generating moieties comprising at least a first signal
generating moiety and at least a second signal generating moiety;
and c) a plurality of universal adapters, comprising: a first
oligonucleotide sequence segment, complementary to the first
oligonucleotide sequence of said plurality of molecular probes,
independently paired with a plurality of second oligonucleotide
sequence segments complementary to the plurality of second
oligonucleotide sequences of said plurality of detectable
components; ii) binding the one or more targets, comprising at
least one of the following: a) binding at least a first target of
the one or more targets in the sample with the first binding moiety
of the at least first molecular probe; and b) binding at least a
second target of the one or more targets in the sample with the
second binding moiety of the at least second molecular probe; iii)
hybridizing the plurality of molecular probes and the plurality of
detectable components with the plurality of universal adapters; and
iv) detecting one or more signals generated from the at least first
hybridized detectable component and/or the at least second
hybridized detectable component using one or more of the following
systems: microscopy, imaging, high content screening (HCS), mass
cytometry, lateral flow immunoassay, immunodetection,
immunohistochemistry (IHC), immunocytochemistry (ICC), or
combinations thereof; wherein the method is characterized by one or
more of the following: A) the conjugation between the first
oligonucleotide sequence and the first binding moiety, between the
second oligonucleotide sequence and the second binding moiety,
between the first complementary oligonucleotide sequence and the
first signal generating moiety, and between the second
complementary oligonucleotide sequence and the second signal
generating moiety, comprises one or more covalent bond linkages,
comprising a hydrazone, oxime, triazine, or other covalent bond,
wherein the formation of the conjugates are at least 90% efficient;
and B) the first binding moiety comprises a strong binding affinity
for the at least first target of the one or more targets and the
second binding moiety comprises a strong binding affinity for the
at least second target of the one or more targets.
Example 1I
[1115] A panel development system, comprising: i) a first panel
comprising a plurality of molecular probes, said plurality of
molecular probes prepared by independently pairing, via
conjugation, a plurality of binding moieties and a plurality of
oligonucleotide sequences; ii) a second panel comprising a
plurality of detectable components, said plurality of detectable
components prepared by independently pairing, via conjugation, a
plurality of signal generating moieties and a plurality of
complementary oligonucleotide sequences; iii) contacting a sample
comprising a plurality of targets with the first panel and the
second panel, wherein: a) at least a first target having one or
more distinct bindings sites is bound by one or more molecular
probes from the first panel; and b) one or more detectable
components from the second panel independently hybridize with the
one or more molecular probes bound to the at least first target;
iv) detecting the presence of the at least first hybridized-target
in said sample; v) determining a characteristic panel of molecular
probes and detectable components from said first and second panels
that identifies the at least first target among the plurality of
targets in said sample.
Example 2I
[1116] The panel development system of Example 1I, wherein the
plurality of oligonucleotide sequences in said first panel
comprises between 2-40 different oligonucleotide sequences among
the plurality of oligonucleotide sequences.
Example 3I
[1117] The panel development system of Example 1I or 2I, wherein
the plurality of complementary oligonucleotide sequences in said
second panel comprises between 2-40 different complementary
oligonucleotide sequences among the plurality of complementary
oligonucleotide sequences.
Example 4I
[1118] The panel development system of any one of Examples 1I-3I,
wherein the panel development system further comprises a re-probe
panel comprising a second plurality of detectable components, said
second plurality of detectable components prepared by independently
pairing, via conjugation, a second plurality of signal generating
moieties and a second plurality of complementary oligonucleotide
sequences.
Example 5I
[1119] A panel development system, comprising: i) a first panel
comprising a plurality of molecular probes, said plurality of
molecular probes prepared by independently pairing, via
conjugation, a plurality of binding moieties and a plurality of
first oligonucleotide sequences; ii) a second panel comprising a
plurality of detectable components, said plurality of detectable
components prepared by independently pairing, via conjugation, a
plurality of signal generating moieties and a plurality of second
oligonucleotide sequences; iii) a third panel comprising a
plurality of universal adapters, said plurality of universal
adapters comprising oligonucleotide sequences having independently
paired a plurality of oligonucleotide sequence segments
complementary to the plurality of first oligonucleotide sequences
and a plurality of oligonucleotide sequence segments complementary
to the plurality of second oligonucleotide sequences; iii)
contacting a sample comprising a plurality of targets with the
first panel and the second panel, wherein: a) at least a first
target having one or more distinct bindings sites is bound by one
or more molecular probes from the first panel; and b) one or more
detectable components from the second panel independently hybridize
with the one or more molecular probes bound to the at least first
target; iv) detecting the presence of the at least first
hybridized-target in said sample; v) determining a characteristic
panel of molecular probes and detectable components from said first
and second panels that identifies the at least first target among
the plurality of targets in said sample.
Example 6I
[1120] The panel development system of Example 5I, wherein the
panel development system is characterized by one or more of the
following: i) the plurality of first oligonucleotide sequences are
identical oligonucleotide sequences; ii) the plurality of first
oligonucleotide sequence segments are identical oligonucleotide
sequence segments; iii) the plurality of second oligonucleotide
sequences comprises different oligonucleotide sequences; and iv)
the plurality of second oligonucleotide sequence segments comprises
oligonucleotide sequence segments complementary to the plurality of
different second oligonucleotide sequences.
Example 7I
[1121] The panel development system of Example 5I or 6I, wherein
the panel development system is characterized by one or more of the
following: i) the plurality of first oligonucleotide sequences
comprises different oligonucleotide sequences; ii) the plurality of
first oligonucleotide sequence segments comprises oligonucleotide
sequence segments complementary to the plurality of different first
oligonucleotide sequences; iii) the plurality of second
oligonucleotide sequences are identical oligonucleotide sequences;
and iv) the plurality of second oligonucleotide sequence segments
are identical oligonucleotide sequence segments.
Example 8I
[1122] The panel development system of any one of Examples 5I-7I,
wherein the plurality of first oligonucleotide sequences in said
first panel comprises between 2-40 different oligonucleotide
sequences among the plurality of first oligonucleotide
sequences.
Example 9I
[1123] The panel development system of any one of Examples 5I-8I,
wherein the plurality of second oligonucleotide sequences in said
second panel comprises between 2-40 different second
oligonucleotide sequences among the plurality of second
oligonucleotide sequences.
Example 10I
[1124] The panel development system of any one of Examples 5I-9I,
wherein the panel development system further comprises a re-probe
panel comprising a second plurality of detectable components, said
second plurality of detectable components prepared by independently
pairing, via conjugation, a second plurality of signal generating
moieties and a second plurality of second oligonucleotide
sequences.
Example 11I
[1125] The panel development system of any one of Examples 1I-10I,
wherein the panel development system further comprises removing the
hybridized plurality of detectable components from the bound
plurality of targets, wherein said removal is by a washing or
stripping process.
Example 12I
[1126] The panel development system of any one of Examples 1I-11I,
wherein the panel development system further comprises a re-probing
step comprising the contacting of the washed plurality of bound
targets with said re-probe panel, followed by an additional
detection step and determination of a characteristic panel of
molecular probes and detectable components from said first, second,
and re-probe panels that identifies the at least first target among
the plurality of targets in said sample.
Example 13I
[1127] The panel development system of any one of Examples 1I-12I,
wherein the plurality of binding moieties in said first panel
comprises between 2-40 different binding moieties among the
plurality of binding moieties.
Example 14I
[1128] The panel development system of any one of Examples 1I-13I,
wherein the plurality of signal generating moieties in said second
panel comprises between 2-40 different signal generating moieties
among the plurality of signal generating moieties.
Example 15I
[1129] The panel development system of any one of Examples 1I-14,
wherein: i) the panel development system develops a singleplex or
multiplex assay; and ii) the panel development system and the assay
developed by the panel development system detects, measures, or
quantifies the level of binding and/or amount of the target present
in the sample with one or more of the following systems: flow
cytometry, immunomagnetic cellular depletion, immunomagnetic cell
capture, array, bead array, multiplex bead array, microarray,
antibody array, cellular array, chemiluminescence, infrared,
microscopy, imaging, high content screening (HCS), mass cytometry,
lateral flow immunoassay, immunodetection, immunohistochemistry
(IHC), immunocytochemistry (ICC), in situ hybridization (ISH),
enzyme immuno-assay (EIA), enzyme linked immuno-assay (ELISA),
ELISpot, immunoturbidity, latex agglutination, gold particle
agglutination, visual inspection, a change in light transmittance
through said sample, increased light transmittance through said
sample, a blotting method, a Western blot, a Southern blot, a
Southwestern blot, labeling inside an electrophoresis system,
labeling on a surface, labeling on an array, PCR amplification,
elongation followed by PCR amplification, immunoprecipitation,
co-immunoprecipitation, chromatin immunoprecipitation, pretargeting
imaging, therapeutic agent, or combinations thereof.
Example 16I
[1130] The panel development system of any one of Examples 1I-15I,
wherein the panel development system is a multiplexed panel
development.
Example 17I
[1131] The panel development system of any one of Examples 1I-16I,
wherein the sample comprises a plurality of cells or cell types,
comprising tissue cells, cells cultured in vitro, recombinant
cells, infected cells, cells from laboratory animals, cells from
mammal patients, cells from human patients, mesenchemal stem cells,
stem cells, immuno-competent cells, adipose cells, fibroblasts,
natural-killer cells (NK-cells), monocytes, lymphocytes, lymph node
cells, T-cells, B-cells, exudate cells, effusion cells, cancer
cells, blood cells, red blood cells, leukocytes, white blood cells,
organ cells, skin cells, liver cells, splenocytes, kidney cells,
intestinal cells, lung cells, heart cells, or neuronal cells.
Example 18I
[1132] The panel development system of any one of Examples 1I-17I,
wherein the sample comprises a plurality of cells having 2 or more
different cell types.
Example 19I
[1133] The panel development system of any one of Examples 1I-18I,
wherein the sample comprises a plurality of cells having 2-50
different cell types.
Example 20I
[1134] The panel development system of any one of Examples 1I-17I,
wherein the system identifies a sub-population by assigning an
immunophenotype resulting from signal pattern generated.
Example 21I
[1135] The panel development system of any one of Examples 1I-20I,
wherein the system further analyzes a sub-population of the
plurality of cells.
Example 22I
[1136] The panel development system of any one of Examples 1I-21I,
wherein the sample comprises a plurality of different targets or
different target types.
Example 23I
[1137] The panel development system of any one of Examples 1I-22I,
wherein the sample comprises a plurality of similar targets or
similar target types.
Example 24I
[1138] The panel development system of any one of Examples 1I-23I,
wherein among a plurality of different targets in the sample at
least a first target having one or more distinct bindings sites is
bound by one or more molecular probes from the first panel.
Example 25I
[1139] The panel development system of any one of Examples 1I-24I,
wherein the targets or target types comprises cells and/or cell
types.
Example 26I
[1140] The panel development system of any one of Examples 1I-25I,
wherein the one or more distinct binding sites are distinct
markers.
Example 27I
[1141] The panel development system of any one of Examples 1I-26I,
wherein the one or more distinct binding sites are biomarkers.
Example 28I
[1142] The panel development system of any one of Examples 1I-27I,
wherein the system identifies a sub-population of targets within
the sample.
Example 29I
[1143] The panel development system of any one of Examples 1I-28I,
wherein the system further comprises at least one of the following:
a) measuring the amount of the at least first target in said
sample; b) quantifying the level of the at least first target in
said sample; and c) identifying the type of the at least first
target in said sample.
Example 30I
[1144] The panel development system of any one of Examples 1I-29I,
wherein one or more of the plurality of signal generating moieties
comprises one or more of the following: a directly detectable
signal generating moiety, an indirectly detectable signal
generating moiety, a fluorescent dye, a fluorophore, a
fluorochrome, a chromophore, a biofluorescent protein, a
luminescent species, a chemiluminescent compound, a
electrochemiluminescent label, a bioluminescent label, a
phosphorescent species, a fluorophore labeled DNA dendrimer,
Quantum Dot, a tandem dye, a FRET dye, a heavy atom, a spin label,
a radioactive isotope, a nanoparticle, a light scattering
nanoparticle or microsphere, a diffracting particle, a polymer, a
polymer particle, a bead, a solid surface, a Raman particle, a
metal particle, a stable isotope, a heavy metal chelate, a magnetic
particle, a bead, an RFID tag, a microbarcode particle, an enzyme,
an enzyme substrate, a molecule specifically recognized by another
substance carrying a label or reacts with a substance carrying a
label, an antibody, an antibody fragment, an antigen, a nucleic
acid, a nucleic acid analog, oligonucleotide, oligonucleotide
analog, complementary oligonucleotide, complementary
oligonucleotide analog, a ligand, a protein, a peptide ligand, a
protein substrate, a receptor; a substrate, a secondary reporter, a
hapten, or combinations thereof.
Example 31I
[1145] The panel development system of any one of Examples 1I-30I,
wherein the second panel comprises a plurality of detectable
components, said plurality of detectable components prepared by
independently pairing, via conjugation, a plurality of scaffolds
and a plurality of complementary oligonucleotide sequences, wherein
said plurality of scaffolds comprises a plurality of signal
generating moieties.
Example 32I
[1146] The panel development system of any one of Examples 1I-31I,
wherein the scaffold comprises a dendrimer, a polysaccharide
molecule, a dextran, a protein, a peptide, a second oligonucleotide
sequence, a portion of the oligonucleotide sequence that is not
complementary to the oligonucleotide sequence of the molecular
probe, a bead, a polymer, a hydrophilic polymer, a bead, a
nanoparticle, or combinations or derivatives thereof.
Example 33I
[1147] The panel development system of any one of Examples 1I-32I,
wherein the first panel comprises at least two different molecular
probes.
Example 34I
[1148] The panel development system of any one of Examples 1I-33I,
wherein the first panel comprises at least 2-10 different molecular
probes.
Example 35I
[1149] The panel development system of any one of Examples 1I-34I,
wherein the binding moiety comprises an antibody, a monoclonal
antibody, a polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 36I
[1150] The panel development system of any one of Examples 1I-35I,
wherein the second panel comprises at least two different
detectable components.
Example 37I
[1151] The panel development system of any one of Examples 1I-36I,
wherein the second panel comprises at least 2-10 different
detectable components.
Example 38I
[1152] The panel development system of any one of Examples 1I-37I,
wherein the sample comprises at least two different targets.
Example 39I
[1153] The panel development system of any one of Examples 1I-38I,
wherein the sample comprises at least 2-50 different targets.
Example 40I
[1154] The panel development system of any one of Examples 1I-39I,
wherein the panel development system comprises an automated system
or robotic system.
Example 41I
[1155] A multiplexed flow cytometry assay method, comprising: i)
contacting a sample comprising a plurality of cells with a first
series of molecular probes and a second series of detectable
components, wherein the plurality of cells comprises at least 5
different cell types; ii) binding protein markers on the plurality
of cells with said first series; iii) hybridizing the first series
or the protein marker-bound first series with the second series;
and iv) optionally, identifying the cell types in the sample by
assigning of immunophenotypes resulting from the hybridization of
said protein marker-bound first series and said second series.
Example 42I
[1156] The method of Example 41, further comprising: i) preparing
said first series, wherein said first series comprises at least 4
different molecular probes, by independently pairing, via
conjugation, at least 4 different binding moieties and at least 4
different oligonucleotide sequences; and ii) preparing said second
series, wherein said second series comprises at least 4 different
detectable components, by independently pairing, via conjugation,
at least 4 different signal generating moieties and at least 4
different oligonucleotide sequences complementary to the sequences
conjugated the binding moieties.
Example 43I
[1157] A panel development system, comprising: i) a plurality of
molecular probes comprising: a) at least a first molecular probe
comprising a first binding moiety conjugated to a first
oligonucleotide sequence; and b) at least a second molecular probe
comprising a second binding moiety conjugated to a second
oligonucleotide sequence; ii) a plurality of detectable components,
comprising: a) at least a first detectable component comprising a
first signal generating moiety conjugated to a first complementary
oligonucleotide sequence; and b) at least a second detectable
component comprising a second signal generating moiety conjugated
to a second complementary oligonucleotide sequence; and iii)
providing a sample comprising a plurality of targets having at
least a first target and at least a second target; iv) binding the
at least a first target and the at least a second target of the
plurality of targets with the first binding moiety of the at least
first molecular probe and the second binding moiety of the at least
second molecular probe, respectively; v) hybridizing the at least
first molecular probe with the at least first detectable component
and the at second molecular probe with the at least second
detectable component, respectively; vi) detecting the at least
first bound-target and the at least second bound-target in said
sample, said detection comprising at least one of the following: a)
detecting the presence of the at least first target and/or the at
least second target in said sample; b) measuring the amount of the
at least first target and/or the at least second target in said
sample; c) quantifying the level of the at least first target
and/or the at least second target in said sample; and d)
identifying the type of the at least first target and/or the at
least second target in said sample; and vii) assigning the
phenotypes of the at least first target and the at least second
target in said sample.
Example 44I
[1158] A panel development system, comprising: i) a panel of
molecular probes comprising a plurality of molecular probes, said
plurality of molecular probes comprising: a) a plurality of binding
moieties comprising at least a first binding moiety and at least a
second binding moiety; b) a plurality of oligonucleotide sequences
comprising at least a first oligonucleotide sequence and at least a
second oligonucleotide sequence; and c) preparing the panel of
plurality of molecular probes, by independently pairing, via
conjugation, the plurality of binding moieties and the plurality of
oligonucleotide sequences; ii) a panel of detectable components
comprising a plurality of detectable components, comprising: a) a
plurality of signal generating moieties comprising at least a first
signal generating moiety and at least a second signal generating
moiety; b) a plurality of complementary oligonucleotide sequences
comprising at least a first oligonucleotide sequence complementary
to the at least first oligonucleotide sequence of the plurality of
molecular probes and at least a second oligonucleotide sequence
complementary to the at least second oligonucleotide sequence of
the plurality of molecular probes; and c) preparing the panel of
plurality of detectable components, by independently pairing, via
conjugation, the plurality of signal generating moieties and the
plurality of complementary oligonucleotide sequences; iii)
providing a sample comprising a plurality of targets having at
least a first target and at least a second target; iv) binding the
at least a first target and the at least a second target of the
plurality of targets with the at least first binding moiety and the
at least second binding moiety of the panel of plurality of
molecular probes, respectively; v) hybridizing the target-bound
plurality of molecular probes with the panel of plurality of
detectable components; vi) detecting the presence of the at least
first bound-target and/or the at least second bound-target in said
sample, said detection optionally further comprising at least one
of the following: a) measuring the amount of the at least first
target and/or the at least second target in said sample; b)
quantifying the level of the at least first target and/or the at
least second target in said sample; and c) identifying the type of
the at least first target and/or the at least second target in said
sample; vii) assigning the phenotype of the at least first target
and the at least second target, respectively, in said sample; and
viii) from the assigned phenotypes, selecting at least one of the
following: a) the series of molecular probes from the plurality of
molecular probes and the series of detectable components from the
plurality of detectable components that distinguish the at least
first target from the at least second target in said plurality of
targets; and b) the series of molecular probes from the plurality
of molecular probes and the series of detectable components from
the plurality of detectable components that distinguish the at
least second target the at least first target in said plurality of
targets.
Example 45I
[1159] A panel development system, comprising: i) a first panel
comprising a plurality of molecular probes, said plurality of
molecular probes prepared by independently pairing, via
conjugation, a plurality of binding moieties and a plurality of
oligonucleotide sequences; ii) a second panel comprising a
plurality of detectable components, said plurality of detectable
components prepared by independently pairing, via conjugation, a
plurality of signal generating moieties and a plurality of
complementary oligonucleotide sequences; iii) providing a sample
comprising a plurality of targets having at least a first target;
iv) binding the at least a first target of the plurality of targets
with at least a first binding moiety from the first panel; v)
hybridizing the at least first target-bound molecular probe with
the second panel; vi) detecting the presence of the at least first
hybridized-target in said sample, said detection optionally further
comprising at least one of the following: a) measuring the amount
of the at least first target in said sample; b) quantifying the
level of the at least first target in said sample; and c)
identifying the type of the at least first target in said sample;
vii) assigning the phenotype of the at least first target in said
sample; and viii) from the assigned phenotype, selecting the series
of molecular probes from the first panel and the series of
detectable components from the second panel that distinguish the at
least first target from the plurality of targets.
Example 46I
[1160] A panel development system, comprising: i) a first panel
comprising a plurality of molecular probes, said plurality of
molecular probes prepared by independently pairing, via
conjugation, a plurality of binding moieties and a plurality of
oligonucleotide sequences; ii) a second panel comprising a
plurality of detectable components, said plurality of detectable
components prepared by independently pairing, via conjugation, a
plurality of signal generating moieties and a plurality of
complementary oligonucleotide sequences; iii) providing a sample
comprising a plurality of targets having at least a first target
and at least a second target; iv) binding the at least a first
target and the at least a second target of the plurality of targets
with at least a first binding moiety and at least a second binding
moiety, respectively, of the first panel; v) hybridizing the at
least first target-bound molecular probe and the at least second
target-bound molecular probe of the plurality of target-bound
molecular probes with the second panel; vi) detecting the presence
of the at least first hybridized-target and/or the at least second
hybridized-target in said sample, said detection optionally further
comprising at least one of the following: a) measuring the amount
of the at least first target and/or the at least second target in
said sample; b) quantifying the level of the at least first target
and/or the at least second target in said sample; and c)
identifying the type of the at least first target and/or the at
least second target in said sample; vii) assigning the phenotype of
the at least first target and/or the at least second target,
respectively, in said sample; and viii) from the assigned
phenotypes, selecting at least one of the following: a) the series
of molecular probes from the first panel and the series of
detectable components from the second panel that distinguish the at
least first target from the at least second target in said
plurality of targets; and b) the series of molecular probes from
the first panel and the series of detectable components from the
second panel that distinguish the at least second target the at
least first target in said plurality of targets.
Example 1J
[1161] A method for assaying a target of a sample, comprising: i)
providing to the sample: 1) a molecular probe, comprising a binding
moiety conjugated to an oligonucleotide sequence; and 2) a
detectable component, comprising a signal generating moiety
conjugated to an oligonucleotide sequence complementary to the
oligonucleotide sequence of the molecular probe; ii) binding the
target in the sample with the binding moiety of the molecular
probe; iii) hybridizing the oligonucleotide sequence of the
molecular probe with the complementary oligonucleotide sequence of
the detectable component; and iv) detecting a signal generated from
the hybridized detectable component; wherein the method is
characterized by one or more of the following: a) the conjugation
between the oligonucleotide sequence and the binding moiety and
conjugation between the complementary oligonucleotide sequence and
the signal generating moiety, comprises one or more covalent bond
linkages, comprising a hydrazone, oxime, triazine, or other
covalent bond, wherein the formation of the conjugates are at least
90% efficient; and b) the binding moiety comprises a binding
affinity of less than 10.sup.-4 M for the target.
Example 2J
[1162] The method of Example 1J, wherein the mode of addition
comprises: i) the molecular probe and the detectable component are
combined together and hybridized prior to contacting the sample;
ii) the molecular probe is combined with the sample prior to the
addition of the detectable component; or iii) the detectable
component is combined with the sample prior to the addition of the
molecular probe.
Example 3J
[1163] The method of any one of Examples 1I-2J, wherein the method
comprises: i) the molecular probe binding the target prior to
hybridizing with the detectable component; or ii) the molecular
probe hybridizing with the detectable component prior to binding
the target.
Example 4J
[1164] A method for assaying a target of a sample, comprising: i)
providing to the sample: 1) a molecular probe, comprising a binding
moiety conjugated to a first oligonucleotide sequence; 2) a
detectable component, comprising a signal generating moiety
conjugated to a second oligonucleotide sequence; and 3) a universal
adapter, comprising an oligonucleotide sequence having a first
sequence segment complementary to the first oligonucleotide
sequence of the molecular probe and a second sequence segment
complementary to the second oligonucleotide sequence of the
detectable component; ii) binding the target in the sample with the
binding moiety of the molecular probe; iii) hybridizing the first
oligonucleotide sequence of the molecular probe to the first
oligonucleotide sequence segment of the universal adapter; iv)
hybridizing the second oligonucleotide sequence of the detectable
component to the second oligonucleotide sequence segment of the
universal adapter; and v) detecting a signal generated from the
hybridized detectable component; wherein the method is
characterized by one or more of the following: a) the conjugation
between the first oligonucleotide sequence and the binding moiety
and conjugation between the second complementary oligonucleotide
sequence and the signal generating moiety, comprises one or more
covalent bond linkages, comprising a hydrazone, oxime, triazine, or
other covalent bond, wherein the formation of the conjugates are at
least 90% efficient; and b) the binding moiety comprises a binding
affinity of less than 10.sup.-4 M for the target.
Example 5J
[1165] The method of Example 4J, wherein the mode of addition
comprises: i) the molecular probe, the universal adapter, and the
detectable component are combined together and hybridized prior to
contacting the sample; ii) the molecular probe and the universal
adapter are combined together and hybridized prior to contacting
the sample; iii) the detectable component and the universal adapter
are combined together and hybridized prior to contacting the
sample; iv) the molecular probe, alone or in combination with the
detectable component, is combined with the sample prior to the
addition of the universal adapter; or v) the universal adapter is
combined with the sample prior to the addition of the molecular
probe and/or the detectable component.
Example 6J
[1166] The method of Examples 4J or 5J, wherein the method
comprises: i) the molecular probe hybridizing with the universal
adapter prior to said molecular probe binding the target; ii) the
molecular probe hybridizing with the universal adapter after said
molecular probe binds the target; iii) the detectable component
hybridizing with the universal adapter prior to the molecular probe
binding the target; iv) the detectable component hybridizing with
the universal adapter after the molecular probe binds the target;
v) the universal adapter hybridizing with the molecular probe and
hybridizing with the detectable component prior to said molecular
probe binding the target; or vi) the universal adapter hybridizing
with the molecular probe and hybridizing with the detectable
component after said molecular probe binds the target.
Example 7J
[1167] The method of any one of Examples 1I-6J, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: flow cytometry, immunomagnetic cellular depletion,
immunomagnetic cell capture, array, bead array, multiplex bead
array, microarray, antibody array, cellular array,
chemiluminescence, infrared, microscopy, imaging, high content
screening (HCS), mass cytometry, lateral flow immunoassay,
immunodetection, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, immunoturbidity, latex
agglutination, gold particle agglutination, visual inspection, a
change in light transmittance through said sample, increased light
transmittance through said sample, a blotting method, a Western
blot, a Southern blot, a Southwestern blot, labeling inside an
electrophoresis system, labeling on a surface, labeling on an
array, PCR amplification, elongation followed by PCR amplification,
immunoprecipitation, co-immunoprecipitation, chromatin
immunoprecipitation, pretargeting imaging, therapeutic agent, or
combinations thereof.
Example 8J
[1168] The method of any one of Examples 1J-7J, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with one or more of the
following: flow cytometry, microscopy, imaging, high content
screening (HCS), multiplex bead array, microarray, antibody array,
cellular array, immunohistochemistry (IHC), immunocytochemistry
(ICC), in situ hybridization (ISH), enzyme immuno-assay (EIA),
enzyme linked immuno-assay (ELISA), ELISpot, or a blotting
method.
Example 9J
[1169] The method of any one of Examples 1J-8J, wherein: i) the
assay comprises a singleplex or multiplex assay; and ii) the assay
detects, measures, or quantifies the level of binding and/or amount
of the target present in the sample with flow cytometry.
Example 10J
[1170] The method of any one of Examples 1J-9J, wherein the sample
is characterized as at least one or more of the following: i) a
complex sample; and ii) a homogeneous or a heterogeneous mixture;
and wherein said sample comprises at least one or more of the
following: a) a range of analytes having a wide range of binding
specificities; b) a cell, a membrane, a biological molecule, a
metabolite, or a disease biomarker; and c) a biological fluid or a
fluidized biological tissue.
Example 11J
[1171] The method of any one of Examples 1J-10J, wherein the
hybridization efficiency of the oligonucleotide sequence to the
complementary oligonucleotide sequence is at least 50% with respect
to the detectable component, under the hybridization conditions
employed.
Example 12J
[1172] The method of any one of Examples 1J-11J, wherein the
molecular probe comprises one or more of the following properties:
i) a molecular weight of between about 15,000 Daltons to about
450,000 Daltons; ii) a solubility that is substantially the same as
that of the unconjugated binding moiety; iii) a solubility that
minimizes non-specific binding to the target; iv) the
oligonucleotide sequence of the molecular probe does not adversely
affect the solubility of the binding moiety; v) interacts and binds
to the target via interactions other than exclusively
electrostatic; vi) a unique, distinguishable, and/or specifically
designed oligonucleotide sequence; and vii) the oligonucleotide
sequence of the molecular probe is uniquely and specifically
designed to hybridize to the complementary oligonucleotide sequence
of the detectable component.
Example 13J
[1173] The method of any one of Examples 1J-12J, wherein the method
of detection generates less false positives than secondary antibody
detection methods.
Example 14J
[1174] The method of any one of Examples 1I-13J, wherein the method
further comprises: i) preparing the molecular probe; and ii)
preparing the detectable component; wherein the prepared molecular
probe and prepared detectable component have at least 90%
purity.
Example 15J
[1175] The method of any one of Examples 1J-14J, wherein the method
further comprises preparing and isolating the molecular probe,
comprising: i) providing the binding moiety; ii) conjugating the
binding moiety with at least one oligonucleotide at greater than
90% efficiency to form binding moiety-oligonucleotide conjugates;
and iii) isolating the binding moiety-oligonucleotide conjugates
from the conjugation mixture by binding, retaining, and/or
retarding a substantial portion of: a) the conjugates, removing a
substantial portion of the unconjugated oligonucleotide in a wash
step followed by release of the bound, retained, and/or retarded
conjugates; or b) the unconjugated oligonucleotides, followed by
collecting a substantial portion of the non-bound, non-retained,
and/or non-retarded conjugates in a wash step.
Example 16J
[1176] The method of any one of Examples 1J-15J, wherein the method
further comprises preparing and isolating the detectable component,
comprising: i) providing a plurality of the signal generating
moiety; ii) conjugating the complementary oligonucleotide with at
least one of the plurality of the signal generating moiety at
greater than 90% efficiency to form signal generating
moiety-complementary oligonucleotide conjugates; and iii) isolating
the signal generating moiety-complementary oligonucleotide
conjugates from the conjugation mixture by binding, retaining,
and/or retarding a substantial portion of: a) the conjugates,
removing a substantial portion of the unconjugated oligonucleotide
in a wash step followed by release of the bound, retained, and/or
retarded conjugates; or b) the unconjugated oligonucleotides,
followed by collecting a substantial portion of the non-bound,
non-retained, and/or non-retarded conjugates in a wash step.
Example 17J
[1177] The method of any one of Examples 1J-16J, wherein the
detectable component comprises a scaffold conjugated to the
complementary oligonucleotide sequence, and wherein said scaffold
has one or more signal generating moieties.
Example 18J
[1178] The method of Example 17J, wherein the scaffold comprises a
dendrimer, a polysaccharide, a dextran, a protein, a peptide, a
second oligonucleotide sequence, a portion of the oligonucleotide
sequence that is not complementary to the oligonucleotide sequence
of the molecular probe, a polymer, a hydrophilic polymer, a bead, a
nanoparticle, or combinations or derivatives thereof.
Example 19J
[1179] The method of any one of Examples 1J-18J, wherein the method
further comprises preparing and isolating a detectable component
comprising a scaffold conjugated to the oligonucleotide sequence
complementary to the oligonucleotide sequence of the molecular
probe, wherein the scaffold comprises one or more signal generating
moieties, said method comprising: i) providing a plurality of the
scaffold comprising the one or more signal generating moieties; ii)
conjugating the complementary oligonucleotide with at least one of
the plurality of scaffolds at greater than 90% efficiency to form
scaffold-complementary oligonucleotide conjugates; and iii)
isolating the scaffold-complementary oligonucleotide conjugates
from the conjugation mixture by binding, retaining, and/or
retarding a substantial portion of: a) the conjugates, removing a
substantial portion of the unconjugated oligonucleotide in a wash
step followed by release of the bound, retained, and/or retarded
conjugates; or b) the unconjugated oligonucleotides, followed by
collecting a substantial portion of the non-bound, non-retained,
and/or non-retarded conjugates in a wash step.
Example 20J
[1180] The method of any one of Examples 15J-19J, wherein the
isolation step utilizes an immobilized binder, affinity
chromatography, size exclusion chromatography, HPLC, reverse-phase
chromatography, electrophoresis, capillary electrophoresis,
polyacrylamide gel electrophoresis, agarose gel electrophoresis,
free flow electrophoresis, differential centrifugation, thin layer
chromatography, immunoprecipitation, hybridization, solvent
extraction, dialysis, filtration, diafiltration, tangential flow
filtration, ion exchange chromatography, hydrophobic interaction
chromatography, or combinations thereof.
Example 21J
[1181] The method of any one of Examples 15J-19J, wherein the
isolation step utilizes an immobilized binder, chromatography, or
size exclusion chromatography.
Example 22J
[1182] The method of any one of Examples 1J-21J, wherein the
binding moiety comprises an antibody, a monoclonal antibody, a
polyclonal antibody, an enzyme, a protein, a peptide, a
carbohydrate, a nuclear receptor, a small molecule, an aptamer, a
chelator, or combinations or derivatives thereof.
Example 23J
[1183] The method of any one of Examples 1J-22J, wherein the sample
comprises one or more targets.
Example 24J
[1184] The method of any one of Examples 1J-23J, wherein the target
is a biological target.
Example 25J
[1185] The method of Example 24J, wherein the biological target
comprises an antigen, a pathogen, a protein, a peptide, an epitope,
a carbohydrate-containing molecule, a small molecule, or
combinations or derivatives thereof.
Example 26J
[1186] The method of any one of Examples 1J-25J, wherein the one or
more signal generating moieties, comprise one or more of the
following: a directly detectable signal generating moiety, an
indirectly detectable signal generating moiety, a fluorescent dye,
a fluorophore, a fluorochrome, a chromophore, a fluorescent
protein, a biofluorescent protein, a luminescent species, a
chemiluminescent compound, a electrochemiluminescent label, a
bioluminescent label, a phosphorescent species, a fluorophore
labeled DNA dendrimer, Quantum Dot, a Raman particle, a tandem dye,
a FRET dye, a heavy atom, a spin label, a radioactive isotope, a
nanoparticle, a light scattering nanoparticle or microsphere, a
diffracting particle, a polymer, a polymer particle, a bead, a
solid surface, a metal particle, a stable isotope, a heavy metal
chelate, a magnetic particle, an RFID tag, a microbarcode particle,
an enzyme, an enzyme substrate, a molecule specifically recognized
by another substance carrying a label or reacts with a substance
carrying a label, an antibody, an antibody fragment, an antigen, a
nucleic acid, a nucleic acid analog, oligonucleotide,
oligonucleotide analog, complementary oligonucleotide,
complementary oligonucleotide analog, a ligand, a protein, a
peptide ligand, a protein substrate, a receptor; a substrate, a
secondary reporter, a hapten, or combinations or derivatives
thereof.
Example 27J
[1187] The method of any one of Examples 1J-26J, wherein the one or
more signal generating moieties provides an enhanced signal that
minimizes detection errors from background noise, relative to
conventionally labeled binding moieties.
Example 28J
[1188] The method of any one of Examples 1J-27J, wherein the
molecular probe, the detectable component, and/or universal adapter
further comprises a spacer group, comprising a polymerized ethylene
oxide, a PEG, a PEO, a protein, a peptide, a DNA, an RNA, an
oligonucleotide sequence, or a dextran.
Example 29J
[1189] The method of any one of Examples 1J-28J, wherein the
binding moiety, the scaffold, the oligonucleotide sequence, and/or
the complementary oligonucleotide sequence comprise HyNic or
4-FB.
Example 30J
[1190] The method of any one of Examples 1J-29J, wherein the
detectable component comprises a unique, distinguishable, and/or
specifically designed complementary oligonucleotide sequence.
Example 31J
[1191] The method of any one of Examples 1J-30J, wherein the
oligonucleotide sequence, complementary oligonucleotide sequence,
and/or oligonucleotide sequence segment comprises an
oligonucleotide sequence conjugated at the 3'-position, an
oligonucleotide sequence conjugated at the 5'-position, linear
oligonucleotide sequences, branched oligonucleotide sequences,
LNAs, PNAs, oligonucleotide sequences optionally covalently
attached to other moieties, or combinations or derivatives
thereof.
Example 32J
[1192] The method of any one of Examples 1J-31J, wherein the sample
comprises one or more targets, and to sample is provided: i) a
plurality of molecular probes, comprising at least a first
molecular probe and at least a second molecular probe; and ii) a
plurality of detectable components, comprising at least a first
detectable component and at least a second detectable
component.
Example 33J
[1193] The method of any one of Examples 1J-32J, wherein the method
further comprises binding the one or more targets, comprising at
least one of the following: i) binding at least a first target of
the one or more targets in the sample with the first binding moiety
of the at least first molecular probe; and ii) binding at least a
second target of the one or more targets in the sample with the
second binding moiety of the at least second molecular probe.
Example 34J
[1194] The method of any one of Examples 1J-33J, wherein the method
further comprises hybridizing the plurality of molecular probes and
the plurality of detectable components, comprising at least one of
the following: i) hybridizing the first oligonucleotide sequence of
at least first molecular probe to the first complementary
oligonucleotide sequence segment of the at least first detectable
component; and ii) hybridizing the second oligonucleotide sequence
of at least second molecular probe to the second complementary
oligonucleotide sequence segment of the at least second detectable
component.
Example 35J
[1195] The method of any one of Examples 1J-34J, wherein the method
further comprises detecting one or more signals generated from at
least one of the following: i) the at least first hybridized
detectable component; and ii) the at least second hybridized
detectable component.
Example 36J
[1196] The method of any one of Examples 1J-35J, wherein the
conjugation between the first oligonucleotide sequence and the
first binding moiety, between the second oligonucleotide sequence
and the second binding moiety, between the first complementary
oligonucleotide sequence and the first signal generating moiety,
and between the second complementary oligonucleotide sequence and
the second signal generating moiety, comprises one or more covalent
bond linkages, comprising a hydrazone, oxime, triazine, or other
covalent bond, wherein the formation of the conjugates are at least
90% efficient.
Example 37J
[1197] The method of any one of Examples 1J-36J, wherein the first
binding moiety comprises a binding affinity of less than 10.sup.-4
M for the at least first target of the one or more targets and the
second binding moiety comprises a binding affinity of less than
10.sup.-4 M for the at least second target of the one or more
targets.
Example 38J
[1198] The method of any one of Examples 1I-37J, wherein the
detectable component comprises a bead conjugated to the second
oligonucleotide sequence or the complementary second
oligonucleotide sequence, and wherein said bead comprises one or
more signal generating moieties.
Example 39J
[1199] The method of any one of Examples 1J-38J, wherein: i) the at
least first detectable component comprises a first bead; and/or ii)
the at least second detectable component comprises a second bead;
wherein said first bead and second bead comprise one or more signal
generating moieties.
Example 40J
[1200] A method for crosslinking, comprising: i) introducing to a
sample comprising one or more targets: a) one or more first
antibody-oligonucleotide conjugates, comprising a first antibody
conjugated to a first oligonucleotide sequence; and b) one or more
second antibody-oligonucleotide conjugates, comprising a second
antibody conjugated to a second oligonucleotide sequence; ii)
binding the one or more targets with the first antibody of the one
or more first antibody-oligonucleotide conjugates and with the
second antibody of the one or more second antibody-oligonucleotide
conjugates to form one or more sandwich-complexes; iii) contacting
the one or more sandwich-complexes with: a) one or more first
bead-oligonucleotide conjugate, comprising a first bead conjugated
to a complementary first oligonucleotide sequence; and b) one or
more second bead-oligonucleotide conjugate, comprising a second
bead conjugated to a complementary second oligonucleotide sequence;
iv) crosslinking the one or more sandwich-complexes by: a)
hybridizing the first oligonucleotide sequences of the one or more
sandwich-complexes with the complementary first oligonucleotide
sequences of the one or more first bead-oligonucleotide conjugates;
and b) hybridizing the second oligonucleotide sequences of the one
or more sandwich-complexes with the complementary second
oligonucleotide sequences of the one or more second
bead-oligonucleotide conjugates.
Example 41J
[1201] The crosslinking method of Example 40J, wherein the
formation of the crosslinked one or more sandwich-complexes forms
an agglutination.
Example 42J
[1202] The crosslinking method of Examples 40J or 41J, wherein the
method further comprises detecting, measuring, and/or quantifying
the degree of the formed agglutination to determine the amount of
the one or more targets in the sample.
Example 43J
[1203] The crosslinking method of any one of Examples 40J-42J,
wherein the first antibody or the second antibody comprise a
monoclonal antibody or a polyclonal antibody.
Example 44J
[1204] The crosslinking method of any one of Examples 40J-43J,
wherein: i) the first antibody comprises a first polyclonal
antibody and the second antibody comprises a second polyclonal
antibody; ii) the first antibody comprises a first monoclonal
antibody and the second antibody comprises a second monoclonal
antibody; iii) the first antibody comprises a first monoclonal
antibody and the second antibody comprises a first polyclonal
antibody; or iv) the first antibody comprises a first polyclonal
antibody and the second antibody comprises a first monoclonal
antibody.
Example 45J
[1205] The crosslinking method of any one of Examples 40J-44J,
wherein the first antibody comprises a first monoclonal antibody
and the second antibody comprises a second monoclonal antibody.
Example 46J
[1206] The crosslinking method of any one of Examples 40J-44J,
wherein the first antibody comprises a first polyclonal antibody
and the second antibody comprises a second polyclonal antibody.
Example 47J
[1207] The crosslinking method of any one of Examples 40J-44J,
wherein the first antibody comprises a first monoclonal antibody
and the second antibody comprises a first polyclonal antibody.
Example 48J
[1208] The crosslinking method of any one of Examples 40J-47J,
wherein the detection comprises a singleplex or multiplex
detection, comprising: immunodetection, immunoturbidity, latex
agglutination, gold particle agglutination, visual inspection, a
change in light transmittance through said sample, increased light
transmittance through said sample, flow cytometry, microscopy,
imaging, high content screening (HCS), immunohistochemistry, ELISA,
ELISpot, arrays, bead arrays, or combinations or derivatives
thereof.
Example 49J
[1209] A method of preparing a detectable component having one or
more signal-generating moieties, comprising: i) modifying a
scaffold with S-HyNic to form a HyNic-modified scaffold; ii)
conjugating a 4FB-modified oligonucleotide to the HyNic-modified
scaffold, wherein the conjugation is at least 90% efficient; and
iii) modifying the scaffold of the oligonucleotide-scaffold
conjugate with one or more signal-generating moieties to form the
detectable component.
Example 50J
[1210] A method of preparing one or more detectable components,
comprising: i) modifying one or more scaffolds; ii) conjugating one
or more modified oligonucleotides to the one or more modified
scaffolds, wherein the conjugation is at least 90% efficient; and
iii) modifying the scaffold of the one or more
oligonucleotide-scaffold conjugates with one or more
signal-generating moieties to form one or more components; wherein
the conjugation between the one or more modified-oligonucleotides
and the one or more modified scaffolds comprises one or more
covalent bond linkages, comprising a hydrazone, oxime, triazine, or
other covalent bond.
Example 51J
[1211] The preparation method of Examples 49J or 50J, wherein the
one or more scaffolds comprises: a hydrophilic polymer, a
dendrimer, a polysaccharide, a dextran, a protein, a peptide, a
second oligonucleotide sequence, a portion of the oligonucleotide
sequence that is not complementary to the oligonucleotide sequence
of the molecular probe, a bead, a nanoparticle, or combinations
thereof.
Example 52J
[1212] The preparation method of any one of Examples 49J-51J,
wherein the hydrophilic polymer comprises a polysaccharide
molecule.
Example 53J
[1213] The preparation method of Example 52J, wherein the
polysaccharide molecule comprises a dextran or an
amino-dextran.
Example 54J
[1214] The preparation method of any one of Examples 49J-53J,
wherein the one or more signal-generating moieties comprises a
directly detectable signal-generating moiety or an indirectly
detectable signal-generating moiety.
Example 55J
[1215] The preparation method of Example 54J, wherein the directly
detectable signal-generating moiety comprises: a fluorescent dye; a
luminescent species; a phosphorescent species; a radioactive
substance; a nanoparticle; a diffracting particle; a raman
particle; a metal particle; a magnetic particle; a bead; an RFID
tag; a microbarcode particle; or combinations thereof.
Example 56J
[1216] The preparation method of any one of Examples 49J-55J,
wherein the indirectly detectable signal-generating moiety
comprises: an enzyme; an antibody; an antigen; a nucleic acid; a
nucleic acid analog; oligonucleotide; oligonucleotide analog;
complementary oligonucleotide; complementary oligonucleotide
analog; a ligand; a substrate; a hapten; or combinations
thereof.
Example 57J
[1217] The preparation method of any one of Examples 49J-56J,
wherein the one or more scaffolds signal-generating moieties
comprise: a fluorophore; a chromophore; a biofluorescent protein; a
fluorophore labeled DNA dendrimer; a Quantum Dot; a
chemiluminescent compound; a electrochemiluminescent label; a
bioluminescent label; a polymer; a polymer particle; a bead; a
Raman particle; a heavy metal chelate; gold or other metal
particles or heavy atoms; a spin label; a radioactive isotope; a
secondary reporter; a hapten; a nucleic acid or nucleic acid
analog; oligonucleotide; oligonucleotide analog; complementary
oligonucleotide; complementary oligonucleotide analog; a protein; a
peptide ligand or substrate; a receptor; an enzyme; an enzyme
substrate; an antibody; an antibody fragment; an antigen; or
combinations or derivatives thereof.
Example 58J
[1218] The method of any one of Examples 1J-57J, wherein the
plurality of targets comprises a plurality of cells, said plurality
of cells comprising at least a first cell and at least a second
cell.
Example 59J
[1219] The method of any one of Examples 1J-58J, wherein at least a
first target comprises a first biomarker of the at least first cell
and at least a second target comprises a second biomarker of the at
least second cell.
Example 60J
[1220] The method of any one of Examples 1J-59J, wherein the first
biomarker comprises a protein biomarker and the second biomarker
comprises a protein biomarker.
Example 61J
[1221] The method of any one of Examples 1J-60J, wherein the first
biomarker comprises an adhesion molecule and the second biomarker
comprises an adhesion molecule.
Example 62J
[1222] The method of any one of Examples 1J-61J, wherein the
plurality of cells comprises immuno-competent cells.
Example 63J
[1223] The method of any one of Examples 1J-62J, wherein the
plurality of cells comprises at least one of the following: tissue
cells, cells cultured in vitro, recombinant cells, infected cells,
cells from laboratory animals, cells from mammal patients, cells
from human patients, mesenchemal stem cells, stem cells,
immuno-competent cells, adipose cells, fibroblasts, natural-killer
cells (NK-cells), monocytes, lymphocytes, lymph node cells,
T-cells, B-cells, exudate cells, effusion cells, cancer cells,
blood cells, red blood cells, leukocytes, white blood cells, organ
cells, skin cells, liver cells, splenocytes, kidney cells,
intestinal cells, lung cells, heart cells, or neuronal cells.
Example 64J
[1224] The method of any one of Examples 1J-63J, wherein the first
cell is a T-cell and the second cell is a B-cell.
Example 65J
[1225] A method for binding, comprising: i) incubating a plurality
of cells or material derived from the plurality of cells with: a)
at least one molecular probe, comprising a binding moiety
conjugated to an oligonucleotide sequence; and b) at least one
detectable component, comprising one or more signal generating
moieties conjugated to a complementary oligonucleotide sequence;
iii) binding at least one target from the plurality of cells with
the binding moiety of the at least one molecular probe; and iv)
hybridizing the oligonucleotide sequence of the at least one bound
molecular probe to the complementary oligonucleotide sequence of
the at least one detectable component; wherein the method is
characterized by one or more of the following: a) the conjugation
of the at least one molecular probe and the conjugation of the at
least one detectable component comprises one or more covalent bond
linkages, comprising a hydrazone, oxime, triazine, or other
covalent bond; b) the formation of the conjugates are at least 90%
efficient; and c) the binding moiety of the at least one molecular
probe has a binding affinity for the at least one target of less
than 10.sup.-4 M.
Example 66J
[1226] The method of Examples 65J, wherein the method further
comprises the addition of at least one universal adapter comprising
a first oligonucleotide sequence segment complementary to the first
oligonucleotide sequence of the at least first molecular probe and
a second oligonucleotide sequence segment complementary to the
second oligonucleotide sequence of the at least first detectable
component; wherein the first oligonucleotide sequence of the at
least first molecular probe and the second oligonucleotide sequence
of the at least first detectable component are
non-complementary.
Example 67J
[1227] The method of Examples 65J or 66J, wherein the at least one
target from the plurality of cells is derived by lysing the
plurality of cells.
Example 68J
[1228] The method of any one of Examples 65J-67J, wherein the at
least one target from the plurality of cells or from the material
derived from the plurality of cells is derived by at least one of
the following: electrophoresing material derived from lysing the
plurality of cells, secretion by the plurality of cells, biological
fluids, extracellular matrix proteins, cell culture media,
genetically engineered proteins or nucleic acids produced by the
plurality of cells, or food stuffs.
Example 69J
[1229] The method of any one of Examples 65J-68J, wherein the at
least one molecular probe and the at least one detectable component
are hybridized prior to incubating.
Example 70J
[1230] The method of any one of Examples 65J-69J, wherein the at
least one molecular probe and the at least one detectable component
are hybridized prior to incubating with the electrophoresed
material.
Example 71J
[1231] The method of any one of Examples 65J-70J, wherein the
method further comprises transferring the electrophoresed material
to a membrane.
Example 72J
[1232] The method of any one of Examples 65J-71J, wherein the
electrophoresing of the lysate comprises a Western Blot.
Example 73J
[1233] The method of any one of Examples 65J-72J, wherein the
membrane comprises a PVDF membrane, a nitrocellulose membrane, or a
nylon membrane.
Example 74J
[1234] The method of any one of Examples 1J-73J, wherein the one or
more signal generating moieties of the at least one detectable
component comprises horseradish peroxidase.
Example 75J
[1235] The method of any one of Examples 1J-74J, wherein the method
comprises detecting the at least one signal generated from the one
or more signal generating moieties on the at least one hybridized
detectable component.
Example 76J
[1236] The method of any one of Examples 1J-75J, wherein the
detection comprises a singleplex or multiplex detection,
comprising: immunodetection, flow cytometry, chemiluminescence
detection, colormetric detection, fluorescence detection,
light-scattering detection, line-scanning, infrared detection,
microscopy, imaging, high content screening (HCS),
immunohistochemistry, ELISA, ELISpot, arrays, bead arrays,
immunoturbidity, latex agglutination, gold particle agglutination,
visual inspection, a change in light transmittance through said
sample, increased light transmittance through said sample, or
combinations or derivatives thereof.
Example 77J
[1237] The method of any one of Examples 1J-76J, wherein the target
or the one or more targets comprises cells, cellular components,
biomarkers, biological components, or combinations thereof.
Example 78J
[1238] The method of any one of Examples 1J-77J, wherein the cells
are attached to a bead or a plate.
Example 79J
[1239] The method of any one of Examples 1J-78J, wherein the
cellular components comprises tubulin.
Example 80J
[1240] A method of bead crosslinking or agglutination, comprising:
i) hybridizing a plurality of antibody-oligonucleotide conjugates
with a plurality of bead-complementary oligonucleotide conjugates
to form a plurality of hybridized antibody-bead conjugates; ii)
introducing the plurality of hybridized antibody-bead conjugates to
a sample comprising one or more targets; iii) binding at least one
target of the one or more targets with at least one hybridized
antibody-bead conjugate of the plurality of hybridized
antibody-bead conjugates; iv) forming a crosslinking or
agglutination of the at least one target-bound hybridized
antibody-bead conjugate; and v) analyzing the agglutination to
detect, measure, and/or quantify the presence or amount of the at
least one target by at least one of the following: a) visual
inspection; and b) decreased absorption.
Example 81J
[1241] The method of Example 80J, wherein the sample is a
biological sample.
Example 82J
[1242] The method of Example 81J, wherein the least one target of
the plurality of targets comprises a biological target.
Example 83J
[1243] The method of Example 82J, wherein the biological target
comprises an antigen, a pathogen, a protein, a peptide, an epitope,
a carbohydrate-containing molecule, a small molecule, or
combinations or derivatives thereof.
[1244] The foregoing description of certain exemplary embodiments
has been presented for purposes of illustration and description. It
is not intended to be exhaustive of, or to limit, the disclosure to
the precise form disclosed, and modification and variations are
possible in light of the teachings herein or may be acquired from
practice of the disclosed embodiments. The embodiments shown and
described in order to explain the principles of the inventions and
its practical application to enable one skilled in the art to
utilize various embodiments and with various modifications as are
suited to the particular application contemplated. Accordingly,
such modifications and embodiments are intended to be included
within the scope of the disclosure. Other substitutions,
modifications, changes and omissions may be made in the design,
operating conditions, and arrangement of the exemplary embodiment
without departing from the spirit of the present disclosure.
Sequence CWU 1
1
2716PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 6xHis tag 1His His His His His His1 5240DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 2gactgacgaa ccgctttgcc tgactgatcg ctaaatcgtg
40360DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 3ttgcatcgcc cttggactac gactgacgaa
ccgctttgcc tgactgatcg ctaaatcgtg 60422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4cctgcgtcgt ttaaggaagt ac 22522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5gtacttcctt aaacgacgca gg 22622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6ggtccggtca taaagcgata ag 22722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7cttatcgctt tatgaccgga cc 22822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8gtggaaagtg gcaatcgtga ag 22922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9cttcacgatt gccactttcc ac 221020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 10gctgacatag agtgcgatac 201120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 11gtatcgcact ctatgtcagc 201220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 12tgtgctcgtc tctgcatact 201320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 13agtatgcaga gacgagcaca 201420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14atgtacgtga gatgcagcag 201520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 15ctgctgcatc tcacgtacat 201651DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 16ggtccggtca taaagcgata atgttaattg tacttcctta
aacgacgcag g 511750DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 17gtggaaagtg gcaatcgtga
agttaattgt acttccttaa acgacgcagg 501848DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18gctgacatag agtgcgatac ttaattgtac ttccttaaac
gacgcagg 481948DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 19tgtgctcgtc tctgcatact
ttaattgtac ttccttaaac gacgcagg 482046DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 20atgtacgtga tgcagcagtt aattgtactt ccttaaacga
cgcagg 462120DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 21ggaagcggtg ctatccatct
202230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 22cacccagccg atgacctctt agtttcacgc
302340DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 23cacccagccg atgacctctt agtttcacgc
aaagcacacg 402420DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 24agatggatag caccgcttcc
202530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 25gcgtgaaact aagaggtcat cggctgggtg
302640DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 26cgtgtgcttt gcgtgaaact aagaggtcat
cggctgggtg 402766DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 27ttaattaatt aattaattaa
ttttaattaa ttaattaatt aattgtactt ccttaaacga 60cgcagg 66
* * * * *