U.S. patent application number 13/439841 was filed with the patent office on 2013-07-18 for methods of diagnosing acute cardiac disorders using bnp-sp.
The applicant listed for this patent is Michael Gary NICHOLLS, Christopher Joseph PEMBERTON, Arthur Mark RICHARDS, Timothy Grant YANDLE. Invention is credited to Michael Gary NICHOLLS, Christopher Joseph PEMBERTON, Arthur Mark RICHARDS, Timothy Grant YANDLE.
Application Number | 20130183683 13/439841 |
Document ID | / |
Family ID | 39157469 |
Filed Date | 2013-07-18 |
United States Patent
Application |
20130183683 |
Kind Code |
A1 |
PEMBERTON; Christopher Joseph ;
et al. |
July 18, 2013 |
METHODS OF DIAGNOSING ACUTE CARDIAC DISORDERS USING BNP-SP
Abstract
The invention provides methods for predicting, diagnosing or
monitoring acute cardiac disorders, cardiac transplant rejection,
or distinguishing acute cardiac disorders from pulmonary disorders,
by measuring BNP signal peptide levels in a sample taken from a
subject shortly after onset of, or presentation with the disorder
or transplant rejection.
Inventors: |
PEMBERTON; Christopher Joseph;
(Broomfield, NZ) ; RICHARDS; Arthur Mark;
(Merivale, NZ) ; NICHOLLS; Michael Gary;
(Merivale, NZ) ; YANDLE; Timothy Grant; (Merivale,
NZ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PEMBERTON; Christopher Joseph
RICHARDS; Arthur Mark
NICHOLLS; Michael Gary
YANDLE; Timothy Grant |
Broomfield
Merivale
Merivale
Merivale |
|
NZ
NZ
NZ
NZ |
|
|
Family ID: |
39157469 |
Appl. No.: |
13/439841 |
Filed: |
April 4, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12381100 |
Mar 6, 2009 |
8298772 |
|
|
13439841 |
|
|
|
|
PCT/NZ2007/000265 |
Sep 7, 2007 |
|
|
|
12381100 |
|
|
|
|
60842649 |
Sep 7, 2006 |
|
|
|
Current U.S.
Class: |
435/7.4 ;
436/501 |
Current CPC
Class: |
G01N 33/6887 20130101;
G01N 2800/52 20130101; G01N 33/74 20130101; G01N 2800/32 20130101;
G01N 33/6893 20130101; C07K 14/58 20130101; G01N 2333/58 20130101;
G01N 2800/324 20130101; C07K 16/26 20130101 |
Class at
Publication: |
435/7.4 ;
436/501 |
International
Class: |
G01N 33/74 20060101
G01N033/74 |
Claims
1. An assay method for diagnosing an acute cardiac disorder in a
subject, the method comprising: a. obtaining a biological sample
from the subject; b. contacting the sample with a BNP-SP fragment
binding agent; c. determining the level of a BNP-SP fragment in the
biological sample obtained from the subject; and d. comparing the
level of said BNP-SP fragment in the sample with the level of said
BNP-SP fragment in a control or reference value, wherein a level of
BNP-SP fragment in the sample that is higher than the control level
is diagnostic of an acute cardiac disorder.
2. A method according to claim 1, wherein said method is used to
evaluate or monitor a response to treatment of an acute cardiac
disorder, wherein said assay method is carried out on one or more
biological samples from said subject and a change in the measured
level of BNP-SP fragment from said control or reference value is
determined, said method further comprising the step of determining
whether to adjust treatment for said acute cardiac disorder based
on a change in the measured level of BNP-SP fragment from the
control or reference value and, optionally, adjusting said
treatment.
3. A method according to claim 1, which further comprises the step
of providing therapy to the subject for treatment of an acute
cardiac disorder.
4. A method according to claim 1 that further comprises the step of
evaluating one more risk factors and/or test results in conjunction
with determining the level of BNP-SP fragment in the sample.
5. A method according to claim 1, wherein the control is an
individual or group from which BNP-SP fragment samples are obtained
and a mean BNP-SP fragment level is determined.
6. A method according to claim 5, wherein the individual or group
comprises normal healthy individuals or a group of individuals not
known to be suffering from an acute cardiac disorder.
7. A method according to claim 5, wherein the control BNP-SP
fragment levels are between 0 to 15 pmol/L.
8. A method according to claim 5, wherein the control or reference
value is derived from BNP-SP fragment level in a cardiac control
population.
9. A method according to claim 8, wherein the BNP-SP fragment level
in the cardiac control population is in the order of 1.5 to 3, 2 to
3, or 2.5 to 3 times higher than BNP-SP fragment levels in a normal
control population.
10. A method according to claim 1, wherein repeat BNP-SP fragment
level determinations are carried out on separate samples from the
subject.
11. A method according to claim 1 wherein a sample level of BNP-SP
fragment in the range of any of 20 to 300 pmol/L, 25 to 250 pmol/L,
20 to 180 pmol/L, 30 to 180 pmol/L, 35 to 150 pmol/L, 40 to 130
pmol/L, 40 to 120 pmol/L, 40 to 90 pmol/L, 45 to 80 pmol/L, 45 to
160 pmol/L, 50 to 100 pmol/L and 50 to 200 pmol/L is diagnostic of
an acute cardiac disorder.
12. A method according to claim 1, wherein a level of BNP-SP
fragment in the sample which is five to eight times higher, or four
to ten times higher, than the control or reference level is
diagnostic of acute cardiac disorder.
13. A method according to claim 1, wherein the acute cardiac
disorder is unstable angina.
14. A method according to claim 1, wherein the acute cardiac
disorder is an acute myocardial infarction.
15. A method according to claim 14, wherein the acute myocardial
infarction is an acute myocardial infarction with ST-elevation on
presenting ECG.
16. A method according to claim 14, wherein the acute cardiac
disorder is non-ST elevated myocardial infarction.
17. A method as claimed in claim 1 wherein the acute cardiac
disorder is acute cardiac ischemia.
18. A method according to claim 1, wherein the acute cardiac
disorder is an acute cardiac injury, acute cardiac damage resulting
from acute drug toxicity, an acute cardiomyopathy or a cardiac
transplant rejection episode.
19. A method according to claim 1, wherein the biological sample is
a blood.
20. A method according to claim 1, wherein the biological sample is
plasma.
21. A method according to claim 1, wherein the level of the BNP-SP
fragment in the biological sample is determined by immunoassay.
22. A method according to claim 21, wherein the immunoassay is a
competitive binding assay, a non-competitive assay, a sandwich
assay, a fluoroimmunoassay, a immunofluorometric assay, an
immunoradiometric assay, a luminescence assay or a
chemiluminescence assay.
23. A method according to claim 21, wherein the immunoassay is a
quantitative immunoassay.
24. A method according to claim 21, wherein the immunoassay
comprises an antibody or an antibody binding fragment.
25. A method according to claim 24, wherein the antibody or
antibody binding fragment is attached to a solid phase.
26. A method according to claim 21, wherein the immunoassay
comprises a labeled antibody or a labeled antibody binding
fragment.
27. A method according to claim 1, wherein the BNP-SP fragment
level is evaluated by mass spectroscopy.
28. A method according to claim 1, wherein the BNP-SP fragment is
BNP-SP (17-26) (SEQ ID NO:19).
29. A method according to claim 1, wherein the BNP-SP fragment is
selected from the group consisting of BNP-SP (1-10) (SEQ ID NO:13),
BNP-SP (1-17) (SEQ ID NO:15) and BNP-SP (12-23) (SEQ ID NO:17).
30. A method according to claim 1, wherein the assay method is
carried out using a device for sample analysis comprising a
disposable testing cartridge.
31. A method according to claim 1, which further comprises the step
of determining the level of one or more non-BNP-SP markers
associated with an acute cardiac disorder.
32. A method according to claim 31 wherein the non-BNP-SP marker is
selected from the group consisting of troponin, troponin T,
troponin I, creatine kinase-MB, myoglobin, BNP, NT-BNP, and H-FABP.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of commonly owned,
co-pending U.S. patent application Ser. No. 12/381,100, filed 6
Mar. 2009, which is a U.S. national stage application based on
commonly owned PCT application no. PCT/NZ2007/000265, filed on 7
Sep. 2007 and published on 13 Mar. 2008 as WIPO publication no.
WO/2008/030122, which is based on commonly owned U.S. provisional
patent application Ser. No. 60/842,649, filed on 7 Sep. 2006. This
application claims the benefit of and priority to each of the
foregoing patent applications for any and all purposes, and each of
them is hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] This invention relates to BNP signal peptide (BNP-SP) and
its use in the prognosis, diagnosis and monitoring of acute cardiac
disorders including acute coronary syndromes in a subject resulting
in releasing of biomarker into the circulation. More particularly,
the invention relates to methods of predicting, diagnosing or
monitoring and acute a cardiac disorder in a subject by measuring
BNP-SP levels in a sample taken shortly after onset of, or at
clinical presentation with the disorder.
BACKGROUND
[0003] Acute cardiac disorders including acute coronary syndromes
(ACS) encompass a wide spectrum of cardiac ischemic events ranging
from unstable angina through to acute myocardial infarction (AMI).
AMI presents as the most serious of these events and therefore
requires rapid and accurate diagnosis. Patients who present with
two or more of the described features (a history of ischemic chest
discomfort, evolutionary changes on serial electrocardiogram (ECG)
traces and a rise and fall in plasma cardiac biomarkers) are
clearly identified as undergoing AMI..sup.1 However, a significant
proportion of patients (40%-50%) who present with suspected AMI do
not have serial changes on ECG, or typical symptoms thus placing
heavy emphasis on circulating biomarker concentrations for accurate
diagnosis..sup.2-4
[0004] Accurate early diagnosis of myocardial infarction
facilitates prompt introduction of reperfusion treatment, including
effective percutaneous or thrombolytic revascularization and
adjunctive at reducing mortality and morbidity with each hour of
delay in diagnosis and management..sup.2-4 Given the need for
accelerated decision-making in this clinical situation, there is
considerable interest in the identification of circulating
biomarkers providing an early and specific diagnosis of acute
cardiac disorders, particularly AMI.
[0005] A number of biomarkers have been proposed for this purpose,
including creatine kinase-MB (CK-MB), troponin T (TnT), troponin I
(TnI) and myoglobin, but there are limitations to their use. Time
to detectable or abnormal elevation of plasma cardiac biomarkers
can be 6 hours (myoglobin, CK-MB) to 12 hours (TnT, TnI) with peak
levels not occurring until 24-48 hours after onset of injury,
imposing a window of delay upon precise diagnosis and
treatment..sup.1-4 Furthermore, both myoglobin and CK-MB are
non-specific and can be secreted from extra-cardiac sources;
especially during trauma or surgery..sup.1 Other biomarkers useful
for this purpose are BNP (preproBNP 103-134) and N-BNP (preproBNP
(27-134) which is also known as NT-proBNP (see FIG. 1). Both
peptides are secreted into the circulation.
[0006] Measurement of plasma concentrations of BNP and N-BNP early
post-AMI has powerful prognostic value.sup.2,6,7 and incorporation
of plasma concentrations of these peptides into treatment regimes
can significantly improve clinical outcomes of patients with heart
failure..sup.8 This is particularly true of N-BNP which has a
half-life some 14-fold longer than BNP.sup.5 and thus provides
additional important information regarding long term cardiac
performance after AMI.
[0007] As with the cardiac biomarkers above, BNP and N-BNP may not
reach detectable or abnormal levels for 6 to 12 hours after onset
of injury, with peak levels not occurring until 24 to 48 hours
after onset. The long term diagnostic/predictive powers of BNP and
N-BNP therefore lack the accompanying power of a specific marker
providing early specific diagnosis of acute cardiac disorders such
as acute cardiac injury within the first few hours of clinical
presentation. A need thereof exists for such an early marker.
[0008] More recently, it has been suggested that BNP-SP may be
useful in diagnosing heart disease (US 2005/0244904, WO
2005/052593). It is generally indicated that levels of BNP-SP will
be higher in heart failure patients than normal patients. No time
course information as to when to measure BNP-SP levels is provided.
It is stated that BNP-SP levels are elevated in conjunction with
N-BNP.
[0009] It is an object of the present invention to go some way
towards fulfilling the need for an early marker of acute cardiac
disorders, and/or to at least provide the public with a useful
choice.
SUMMARY OF THE INVENTION
[0010] Human B-type natriuretic signal peptide (BNP-SP) or
preproBNP (1-26) is a 26 amino acid peptide cleaved from preproBNP
(1-134) SEQ ID NO: 1. BNP-SP is shown separately in SEQ ID
NO:21.
[0011] The applicants have surprisingly discovered that the
circulating concentration of BNP-SP is highest in the first few
hours following onset of, or at clinical presentation with
suspected acute coronary syndromes (ACS). Peaks are in the order of
four to ten times higher, commonly five to eight times higher than
normal control populations in these first hours.
[0012] Accordingly, in a first aspect the present invention
provides a method for predicting, diagnosing or monitoring an acute
cardiac disorder (ACD) in a subject, the method comprising:
[0013] measuring the level of BNP-SP in a biological sample
obtained from the subject within two hours of onset of the ACD, or
within two hours of presentation with the ACD; and comparing the
level of said BNP-SP with the BNP-SP level from a control wherein a
measured level of BNP-SP higher than the control level is
indicative of ACD.
[0014] The invention also provides a method for monitoring a
response to treatment of an acute cardiac disorder (ACD) in a
subject, the method comprising measuring the level of BNP-SP in a
biological sample obtained from the subject within two hours of
onset of the ACD or within two hours of presentation with the ACD;
and comparing the level of said BNP-SP with the BNP-SP level from a
control, wherein a change in the measured level of BNP-SP from the
control level is indicative of a response to the treatment.
[0015] In another aspect, the invention also provides a method for
predicting, diagnosing or monitoring a cardiac transplant rejection
episode in a subject, the method comprising measuring the level of
BNP-SP in a biological sample obtained from a subject within two
hours of heart transplant and comparing the level of said BNP-SP
with the BNP-SP level from a control, wherein a measured level of
BNP-SP higher than the control level is indicative of transplant
rejection.
[0016] The invention also provides a method of distinguishing
between a pulmonary disorder and an acute cardiac disorder (ACD) in
a subject, the method comprising measuring the level of BNP-SP in a
biological sample obtained from a subject within two hours of
presentation with the disorder; and comparing the level of said
BNP-SP with the BNP-SP level from a control wherein a measured
level of BNP-SP higher than the control level is indicative of
ACD.
[0017] The invention also provides a method for predicting,
diagnosing or monitoring an acute cardiac disorder (ACD), cardiac
transplant rejection, or ACD/pulmonary disorder in a subject, the
method comprising measuring the level of BNP-SP in a biological
sample obtained from the subject within the first two hours of
onset of, or clinical presentation with ACD, cardiac transplant
rejection or ACD/pulmonary disorder.
[0018] Preferably, the measured level of BNP-SP is compared with
the BNP-SP level from a control wherein a measured level of BNP-SP
higher than the control level is indicative of ACD or cardiac
transplant rejection.
[0019] Preferably, the methods of the invention are in vitro
methods.
[0020] In one embodiment, the measurement of BNP-SP levels is
carried out within one hour, of onset or clinical presentation,
preferably within 30 minutes.
[0021] Preferably, the biological sample is blood, saliva,
interstitial fluid, plasma, urine, serum or heart tissue.
[0022] In one embodiment, the measuring step comprises detecting
binding between BNP-SP and a binding agent that selectively binds
BNP-SP. The binding agent is preferably an antibody or antibody
fragment. Most commonly, the antibody is a monoclonal, polyclonal
or humanized antibody. Monoclonal antibodies are preferred
[0023] In an alternate embodiment, the levels of BNP-SP are
measured using mass spectroscopy.
[0024] The BNP-SP which is selectively bound by the antibody is the
full length human BNP-SP molecule (SEQ ID NO:21) or an antigenic
variant or fragment thereof. Preferably, the fragment is at least
five amino acids in length. Desirably, the antibody binds the
N-terminus or the C-terminus of BNP-SP.
[0025] Specific antigenic peptides which the binding agent
selectively binds include human BNP-SP (1-10) (SEQ ID NO:13),
BNP-SP (1-17) (SEQ ID NO:15), BNP-SP (3-15) (SEQ ID NO:23), BNP-SP
(17-26) (SEQ ID NO:19), BNP-SP (12-23) (SEQ ID NO:17) and BNP-SP
(1-26) (SEQ ID NO:21) or variants thereof.
[0026] Binding of BNP-SP is preferably measured using antibodies or
antibody fragments that are immobilised on a solid phase.
[0027] Levels of BNP-SP may usefully be measured with an assay
selected from MA, ELISA, fluoroimmunoassay, immunofluorometric
assay, mass spectrometry and immunoradiometric assay.
[0028] Accordingly, the invention also provides an assay for BNP-SP
in a biological sample obtained from a subject within two hours
from onset of, or within two hours of clinical presentation with
ACD, cardiac transplant rejection, or ACD/pulmonary disorder, the
assay comprising detecting and measuring the level of BNP-SP in the
sample using any known methods.
[0029] Preferably, the assay is an in vitro assay.
[0030] The methods of the invention may further comprise measuring
the level of one or more non-BNP-SP Markers of said ACD, or cardiac
transplant rejection, or ACD/pulmonary disorder and comparing the
levels against marker levels from a control wherein a deviation in
the measured level from the control level of non-BNP-SP marker,
together with a measured level of BNP-SP which is higher than the
control level of BNP-SP, is predictive or diagnostic of the ACD, or
can be used to monitor said ACD, cardiac transplant rejection or
ACD/pulmonary disorder.
[0031] Markers for use in the context of acute coronary syndrome
include troponin T, troponin I, creatine kinase MB, myoglobin, BNP,
NT-BNP, LDH, aspartate aminotransferase, and heart specific fatty
acid binding protein (H-FABP).
[0032] In another aspect, the present invention also provides a
BNP-SP binding agent that selectively binds BNP-SP or an antigenic
fragment or variant thereof for use in predicting, diagnosing or
monitoring an acute cardiac disorder (ACD), cardiac transplant
rejection or ACD/pulmonary disorder in a subject, wherein the ACD,
cardiac transplant rejection or ACD/pulmonary disorder is
characterised by the appearance of BNP-SP in a biological sample
obtained from the subject within two hours of onset of, or within
two hours of clinical presentation with ACD, cardiac transplant
rejection or ACD/pulmonary disorder.
[0033] In one embodiment, the binding agent is preferably an
antibody or fragment thereof.
[0034] In another embodiment, the binding agent is any solid or
non-solid material capable of binding BNP-SP.
[0035] The invention is also directed to the use of BNP-SP binding
agent in the manufacture of a prognostic, diagnostic or monitoring
tool for assessing an acute cardiac disorder (ACD), cardiac
transplant rejection or ACD/pulmonary disorder in a subject,
wherein assessment is carried out within two hours of onset of, or
within two hours of clinical presentation with ACD, cardiac
transplant rejection or ACD/pulmonary disorder.
[0036] The invention also relates to a use of the invention wherein
the prognostic, diagnostic or monitoring tool is calibrated to
measure BNP-SP levels in the range of from 0.1 to 500 pmol/L,
preferably 1 to 400 pmol/L, preferably 10 to 350 pmol/L, preferably
20 to 300 pmol/L, preferably 25 to 250 pmol/L, preferably 30 to 180
pmol/L, preferably 35 to 150 pmol/L, and preferably 40 to 120
pmol/L.
[0037] In another aspect, the invention provides a kit for
predicting, diagnosing or monitoring an acute cardiac disorder
(ACD), cardiac transplant rejection or ACD/pulmonary disorder
comprising a BNP-SP binding agent of the invention, wherein the kit
is for use with a biological sample obtained from a subject within
two hours of onset of, or clinical presentation with ACD, cardiac
transplant rejection or ACD/pulmonary disorder.
[0038] The invention also provides a kit for predicting, diagnosing
or monitoring an acute cardiac disorder (ACD) comprising a binding
agent of the invention, wherein the kit is calibrated to measure
BNP-SP levels in the range of 0.1 to 500 pmol/L, preferably 1 to
400 pmol/L, preferably 10 to 350 pmol/L, preferably 20 to 300
pmol/L, preferably 25 to 250 pmol/L, preferably 30 to 180 pmol/L,
preferably 35 to 150 pmol/L, and preferably 40 to 120 pmol/L.
[0039] Preferably, the kit also includes instructions for
predicting, diagnosing or monitoring ACD, cardiac transplant
rejection, or ACD/pulmonary disorder in a subject within two hours
of onset, or clinical presentation, from the BNP-SP level measured
in the biological sample obtained within two hours of onset or
clinical presentation.
[0040] In another aspect, the invention relates to a nucleic acid
molecule encoding a BNP-SP of the invention wherein said nucleic
acid is selected from [0041] (a) SEQ ID NO:14; [0042] (b) SEQ ID
NO:16; [0043] (c) SEQ ID NO:18; [0044] (d) SEQ ID NO:20; [0045] (e)
a complement of any one of (a) to (d); [0046] (f) a sequence of at
least 15 nucleotides in length, capable of hybridising to the
sequence of any one of (a) to (e) under stringent conditions with
the proviso that the sequence is not ccagtgcacaagctgcttggggaggcgaga
or SEQ ID NO: 22.
[0047] The invention also provides a genetic construct comprising a
nucleic acid molecule of the invention, a vector comprising the
genetic construct, a host cell comprising the genetic construct or
vector, a polypeptide encoded by a nucleic acid molecule of the
invention, an antibody which selectively binds a polypeptide of the
invention, and a method for recombinantly producing a polypeptide
of the invention.
[0048] Accordingly, in another aspect the invention provides an
isolated BNP-SP polypeptide selected from [0049] (a) SEQ ID NO:13;
[0050] (b) SEQ ID NO:15; [0051] (c) SEQ ID NO:17; and [0052] (d)
SEQ ID NO:19.
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] The invention will now be described with reference to the
figures in the accompanying drawings in which
Figures
[0054] FIG. 1 is a schematic diagram outlining the processing of
human preproBNP resulting in generation of free signal, N-BNP and
BNP peptides;
[0055] FIG. 2A is a single letter notation format of preproBNP
sequences in seven species. The signal peptide region is in bold
and underlined;
[0056] FIG. 2B is a Clustal W version 1.83 JALVIEW multiple
sequence alignment of the prepoBNP signal peptide sequences. The
default Clustal W parameters were used in this alignment as
follows: DNA Gap Open Penalty=15.0; DNA Gap Extension Penalty=6.66;
DNA matrix=Identity; Protein Gap Open Penalty=10.0; Protein Gap
Extension Penalty=0.2; Protein Matrix=Gonnet; Protein/DNA
ENDGAP=-1; Protein/DNA GAPDIST=4. The amino acids were submitted in
the Pearson (fasta) format..sup.9
[0057] FIG. 3 shows the results of a radioimmunoassay with human
plasma extracts (open squares) dilute in parallel with the BNP-SP
standard curve (filled circles);
[0058] FIG. 4 shows the results of a radioimmunoassay demonstrating
that plasma concentrations of BNP-SP in healthy humans do not show
any correlation with age;
[0059] FIG. 5 shows the results of a radioimmunoassay demonstrating
that plasma levels of BNP and N-BNP in normal healthy humans (n=13)
show close correlation (left panel) whereas BNP-SP concentrations
do not correlate with N-BNP (right panel);
[0060] FIG. 6 shows the results of a radioimmunoassay SEHPLC (top
panel) and RPHPLC bottom panel) analysis of BNP-SP in human plasma
which suggests BNP-SP elutes close to synthetic BNP-SP (downward
arrow, bottom panel);
[0061] FIG. 7. Radioimmunoassay results showing Upper panel:
Concentrations of BNP-SP (open hexagon), BNP (filled circles) and
N-BNP (open squares) in plasma drawn from AME patients (n=10) at
the times shown from hospital admission. In contrast with BNP and
N-BNP levels which peaked at 24 hours post-admission, highest
levels of BNP-SP were seen at admission, being some 7-fold higher
on average than levels measured in normal healthy individuals (open
circle). Lower panel: matched, time course concentration profiles
of CK-MB, myoglobin and TnT in the same patients in upper
panel;
[0062] FIG. 8. Shows a table of cross reactivity data of BNP-SP
antiserum; and
[0063] FIG. 9. Is a bar graph showing circulating BNP-SP
concentrations in patients are derived from a cardiac source.
DEFINITIONS
[0064] Acute Cardiac Disorder (ACD), includes but is not limited
to: acute coronary syndromes: (AMI) with ST-elevation on presenting
ECG, unstable angina, and acute non ST-elevated MI; cardiac
ischemia; acute cardiac injury; acute cardiac damage resulting from
acute drug toxicity, acute cardiomyopathies, and cardiac transplant
rejection. Full descriptive, definitions of these disorders are
found in reference 1.
[0065] ACD/pulmonary disorder refers to a subject with an
undiagnosed, or suspected ACD or pulmonary disorder.
[0066] Acute coronary syndromes (ACS) encompasses a wide spectrum
of cardiac ischemia events including unstable angina, acute
myocardial infarct with ST-elevation on presenting
electrocardiogram (ECG), and acute myocardial infarction without
ST-segment elevation on ECG.
[0067] The term "antibody" refers to an immunoglobulin molecule
having a specific structure that interacts (binds) specifically
with a molecule comprising the antigen used for synthesizing the
antibody or with an antigen closely related to it. An antibody
binds selectively or specifically to a BNP-SP polypeptide of the
invention if the antibody binds preferentially to the BNP-SP e.g.
has less than 25%, preferably less than 10%, preferably less than
1% cross-reactivity with a non-BNP-SP polypeptides. Usually, the
antibody will have a binding affinity (dissociation constant (Kd)
value), for the antigen of no more than 10.sup.-7M, preferably less
than about 10.sup.-8M, preferably less than about 10.sup.-9M.
Binding affinity may be assessed using surface plasma
resonance.
[0068] Biological sample as used herein means any sample derived
from a subject to be screened. The sample may be any sample known
in the art in which the BNP-SP can be detected. Included are any
body fluids such as plasma, blood, saliva, interstitial fluid,
serum, urine, synovial, cerebrospinal, lymph, seminal, amniotic,
pericardial fluid and ascites, as well as tissues such as cardiac
tissues but not limited thereto. Also included are samples from
normal healthy subjects with no clinical history of acute cardiac
disorders.
[0069] The term BNP-SP refers to the complete 26 amino acid BNP
signal peptide for the human prepro BNP sequence (SEQ ID NO: 1)
BNP-SP is shown separately in SEQ ID NO:21. Also encompassed within
the term BNP-SP is a variant or fragment of BNP-SP.
[0070] The term "comprising" as used in this specification and
claims means "consisting at least in part of"; that is to say when
interpreting statements in this specification and claims which
include "comprising", the features prefaced by this term in each
statement all need to be present but other features can also be
present. Related terms such as "comprise" and "comprised" are to be
interpreted in similar manner.
[0071] The term "polynucleotide(s)," as used herein, means a single
or double-stranded deoxyribonucleotide or ribonucleotide polymer of
any length, and include as non-limiting examples, coding and
non-coding sequences of a gene, sense and antisense sequences,
exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA,
miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and
purified naturally occurring DNA or RNA sequences, synthetic RNA
and DNA sequences, nucleic acid probes, primers, fragments, genetic
constructs, vectors and modified polynucleotides. Reference to a
nucleic acid molecule is to be similarly understood.
[0072] A "fragment" of a polynucleotide sequence provided herein is
a subsequence of contiguous nucleotides that is capable of specific
hybridization to a target of interest, e.g., a sequence that is at
least 10 nucleotides in length. The fragments of the invention
comprise 10, preferably 15 nucleotides, preferably 16, preferably
17, preferably 18, preferably 19, preferably 21, preferably 22,
preferably 23, preferably 24, preferably 25, preferably 26,
preferably 27, preferably 28, preferably 29, preferably 30,
preferably 31, preferably 32, preferably 33, preferably 34,
preferably 35, preferably 36, preferably 37, preferably 38,
preferably 39, preferably 40, preferably 41, preferably 42,
preferably 43, preferably 44, preferably 45, preferably 46,
preferably 47, preferably 48, preferably 49, preferably 50,
preferably 51, preferably 52, preferably 53, preferably 54,
preferably 55, preferably 56, preferably 57, preferably 58,
preferably 59, preferably 60, preferably 61, preferably 62,
preferably 63, preferably 64, preferably 65, preferably 66,
preferably 67, preferably 68, preferably 69, preferably 70,
preferably 71, preferably 72, preferably 73, preferably 74,
preferably 75, preferably 76, preferably 77 contiguous nucleotides
of a polynucleotide of SEQ ID NO:22. A fragment of a polynucleotide
sequence can be used as a primer, a probe, included in a
microarray, or used in polynucleotide-based selection methods
herein.
[0073] The term "primer" refers to a short polynucleotide, usually
having a free 3'0H group, that is hybridized to a template and used
for priming polymerization of a polynucleotide complementary to the
target.
[0074] The term "probe" refers to a short polynucleotide that is
used to detect a polynucleotide sequence, that is complementary to
the probe, in a hybridization-based assay. The probe may consist of
a "fragment" of a polynucleotide as defined herein.
[0075] The term "polypeptide", as used herein, encompasses amino
acid chains of any length, but preferably at least 5 amino acids,
preferably at least 6, preferably at least 7, preferably at least
8, preferably at least 9, preferably at least 10, preferably at
least 11, 12, preferably at least 13, preferably at least 4'4,
preferably at least 15, preferably at least 16, preferably at least
17, preferably at least 18, preferably at least 19, preferably at
least 20, preferably at least 21, preferably at least 22,
preferably at least 23, preferably at least 24, preferably at least
25, and preferably all 26 amino acids of the full-length BNP-SP
protein (SEQ ID NO:21), in which amino acid residues are linked by
covalent peptide bonds. Polypeptides useful in the present
invention may be purified natural products, or may be produced
partially or wholly using recombinant or synthetic techniques. The
term may refer to a polypeptide, an aggregate of a polypeptide such
as a dimer or other multimer, a fusion polypeptide, a polypeptide
fragment, a polypeptide variant, or derivative thereof.
[0076] A "fragment" of a polypeptide is a subsequence of the
polypeptide that performs a function that is required for the
biological activity or binding and/or provides three dimensional
structure of the polypeptide. The term may refer to a polypeptide,
an aggregate of a polypeptide such as a dimer or other multimer, a
fusion polypeptide, a polypeptide fragment, a polypeptide variant,
or derivative thereof capable of performing the above signal
peptide activity.
[0077] The term "isolated" as applied to the polynucleotide or
polypeptide sequences disclosed herein is used to refer to
sequences that are removed from their natural cellular environment.
An isolated molecule may be obtained by any method or combination
of methods including biochemical, recombinant, and synthetic
techniques. The polynucleotide or polypeptide sequences may be
prepared by at least one purification step.
[0078] The term "recombinant" refers to a polynucleotide sequence
that is removed from sequences that surround it in its natural
context and/or is recombined with sequences that are not present in
its natural context.
[0079] A "recombinant" polypeptide sequence is produced by
translation from a "recombinant" polynucleotide sequence.
[0080] As used herein, the term "variant" refers to polynucleotide
or polypeptide sequences different from the specifically identified
sequences, wherein one or more nucleotides or amino acid residues
is deleted, substituted, or added. Variants may be naturally
occurring allelic variants, or non-naturally occurring variants.
Variants may be from the same or from other species and may
encompass homologues, paralogues and orthologues. In certain
embodiments, variants of the polypeptides useful in the invention
and biological activities that are the same or similar to those of
the parent polypeptides or polynucleotides. The term "variant" with
reference to polynucleotides and polypeptides encompasses all forms
of polynucleotides and polypeptides as defined herein.
[0081] Variant polynucleotide sequences preferably exhibit at least
50%, at least 60%, preferably at least 70%, preferably at least
71%, preferably at least 72%, preferably at least 73%, preferably
at least 74%, preferably at least 75%, preferably at least 76%,
preferably at least 77%, preferably at least 78%, preferably at
least 79%, preferably at least 80%, preferably at least 81%,
preferably at least 82%, preferably at least 83%, preferably at
least 84%, preferably at least 85%, preferably at least 86%,
preferably at least 87%, preferably at least 88%, preferably at
least 89%, preferably at least 90%, preferably at least 91%,
preferably at least 92%, preferably at least 93%, preferably at
least 94%, preferably at least 95%, preferably at least 96%,
preferably at least 97%, preferably at least 98%, and preferably at
least 99% identity to a sequence of the present invention. Identity
is found over a comparison window of at least 10 nucleotide
positions, preferably at least 15 nucleotide positions, preferably
at least 20 nucleotide positions, preferably at least 27 nucleotide
positions, preferably at least 40 nucleotide positions, preferably
at least 50 nucleotide positions, and most preferably over the
entire length of a polynucleotide of the invention.
[0082] Polynucleotide sequence identity may be calculated over the
entire length of the overlap between a candidate and subject
polynucleotide sequences using global sequence alignment programs
(e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48,
443-453). A full implementation of the Needleman-Wunsch global
alignment algorithm is found in the needle program in the EMBOSS
package (Rice, P. Longden, I. and Bleasby, A. EMBOSS: The European
Molecular Biology Open Software Suite, Trends in Genetics June
2000, vol 16, No 6. pp. 276-277) which can be obtained from
http://www.hgmp.mre.ac.uk/Software/EMBOSS/. The European
Bioinformatics Institute server also provides the facility to
perform EMBOSS-needle global alignments between two sequences on
line at http:/www.ebi.ac.uk/emboss/align/.
[0083] Alternatively the GAP program may be used which computes an
optimal global alignment of two sequences without penalizing
terminal gaps. GAP is described in the following paper: Huang, X.
(1994) On Global Sequence Alignment. Computer Applications in the
Biosciences 10, 227-235.
[0084] Polynucleotide variants also encompass those which exhibit a
similarity to one or more of the specifically identified sequences
that is likely to preserve the functional equivalence of those
sequences and which could not reasonably be expected to have
occurred by random chance. This program finds regions of similarity
between the sequences and for each such region reports an "E value"
which is the expected number of times one could expect to see such
a match by chance in a database of a fixed reference size
containing random sequences. The size of this database is set by
default in the bl2seq program. For small E values, much less than
one, the E value is approximately the probability of such a random
match.
[0085] Variant polynucleotide sequences preferably exhibit an E
value of less than 1.times.10.sup.-5, more preferably less than
1.times.10.sup.-6, more preferably less than 1.times.10.sup.-9,
more preferably less than 1.times.10.sup.-12, more preferably less
than 1.times.10.sup.-15, more preferably less than
1.times.10.sup.-18 and most preferably less than 1.times.10.sup.-21
when compared with any one of the specifically identified
sequences.
[0086] Use of BLASTN is preferred for use in the determination of
sequence identity for polynucleotide variants according to the
present invention.
[0087] The identity of polynucleotide sequences may be examined
using the following UNIX command line parameters:
[0088] bl2seq -i nucleotideseq1 -j nucleotideseq2 -F F -p
blastn
[0089] The parameter -F F turns off filtering of low complexity
sections. The parameter -p selects the appropriate algorithm for
the pair of sequences. The bl2seq program reports sequence identity
as both the number and percentage of identical nucleotides in a
line "Identities=".
[0090] Polynucleotide sequence identity and similarity can also be
determined in the following manner. The subject polynucleotide
sequence is compared to a candidate polynucleotide sequence using
sequence alignment algorithms and sequence similarity search tools
such as in Genbank, EMBL, Swiss-PROT and other databases. Nucleic
Acids Res 29:1-10 and 11-16, 2001 provides examples of online
resources. BLASTN (from the BLAST suite of programs, version 2.2.13
Mar. 2007 in bl2seq (Tatiana A. et al, FEMS Microbiol Lett.
174:247-250 (1999), Altschul et al., Nuc. Acid Res 25:3389-3402,
(1997)), which is publicly available from NCBI
(ftp://ftp.ncbi.nih.gov/blast/) or from NCBI at Bethesda, Md., USA.
The default parameters of bl2seq are utilized except that filtering
of low complexity parts should be turned off.
[0091] Alternatively, variant polynucleotides hybridize to the
specified polynucleotide sequence, or a complement thereof under
stringent conditions.
[0092] The term "hybridize under stringent conditions", and
grammatical equivalents thereof, refers to the ability of a
polynucleotide molecule to hybridize to a target polynucleotide
molecule (such as a target polynucleotide molecule immobilized on a
DNA or RNA blot, such as a Southern blot or Northern blot) under
defined conditions of temperature and salt concentration. The
ability to hybridize under stringent hybridization conditions can
be determined by initially hybridizing under less stringent
conditions then increasing the stringency to the desired
stringency.
[0093] With respect to polynucleotide molecules greater than about
100 bases in length, typical stringent hybridization conditions are
no more than 25 to 30.degree. C. (for example, 10.degree. C.) below
the melting temperature (Tm) of the native duplex (see generally,
Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual,
2nd Ed. Cold Spring Harbor Press; Ausubel et al., 1987, Current
Protocols in Molecular Biology, Greene Publishing, incorporated
herein by reference). Tm for polynucleotide molecules greater than
about 100 bases can be calculated by the formula Tm=81.5+0.41%
(G+C-log(Na+) (Sambrook et al., Eds, 1987, Molecular Cloning, A
Laboratory Manual, 2nd Ed. Gold Spring Harbor Press; Bolton and
McCarthy, 1962, PNAS 84:1390). Typical stringent conditions for a
polynucleotide of greater than 100 bases in length would be
hybridization conditions such as prewashing in a solution of
6.times.SSC, 0.2% SDS; hybridizing at 65.degree. C., 6.times.SSC,
0.2% SDS overnight; followed by two washes of 30 minutes each in
1.times.SSC, 0.1% SDS at 65.degree. C. and two washes of 30 minutes
each in 0.2.times.SSC, 0.1% SDS at 65.degree. C.
[0094] In one embodiment stringent conditions use 50% formamide,
5.times.SSC, 50 mM sodium phosphate (pH 6.8), 0.1% sodium
pyrophosphate, 5.times.Denhardt's solution, sonicated salmon sperm
DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran sulphate at 42.degree.
C., with washes at 42.degree. C. in 0.2.times.SSC and 50% formamide
at 55.degree. C., followed by a wash comprising of 0.1.times.SSC
containing EDTA at 55.degree. C.
[0095] With respect to polynucleotide molecules having a length
less than 100 bases, exemplary stringent hybridization conditions
are 5 to 10.degree. C. below Tm. On average, the Tm of a
polynucleotide molecule of length less than 100 bp is reduced by
approximately (500/oligonucleotide length).degree. C.
[0096] With respect to the DNA mimics known as peptide nucleic
acids (PNAs) (Nielsen et al., Science. 1991 Dec. 6;
254(5037):1497-500) Tm values are higher than those for DNA-DNA or
DNA-RNA hybrids, and can be calculated using the formula described
in Giesen et al., Nucleic Acids Res. 1998 Nov. 1; 26(21):5004-6.
Exemplary stringent hybridization conditions for a DNA-PNA hybrid
having a length less than 100 bases are 5 to 10.degree. C. below
the Tm.
[0097] Variant polynucleotides also encompasses polynucleotides
that differ from the sequences of the invention but that, as a
consequence of the degeneracy of the genetic code, encode a
polypeptide having similar, activity to a polypeptide encoded by a
polynucleotide of the present invention. A sequence alteration that
does not change the amino acid sequence of the polypeptide is a
"silent variation". Except for ATG (methionine) and TGG
(tryptophan), other codons for the same amino acid may be changed
by art recognized techniques, e.g., to optimize codon expression in
a particular host organism.
[0098] Polynucleotide sequence alterations resulting in
conservative substitutions of one or several amino acids in the
encoded polypeptide sequence without significantly altering its
biological activity are also included in the invention. A skilled
artisan will be aware of methods for making phenotypically silent
amino acid substitutions (see, e.g., Bowie et al., 1990, Science
247, 1306).
[0099] Variant polynucleotides due to silent variations and
conservative substitutions in the encoded polypeptide sequence may
be determined using the bl2seq program via the tblastx algorithm as
described above.
[0100] The term "variant" with reference to polypeptides also
encompasses naturally occurring, recombinantly and synthetically
produced polypeptides. Variant polypeptide sequences preferably
exhibit at least 50%, preferably at least 60%, preferably at least
70%, preferably at least 71%, preferably at least 72%, preferably
at least 73%, preferably at least 74%, preferably at least 75%,
preferably at least 76%, preferably at least 77%, preferably at
least 78%, preferably at least 79%, preferably at least 80%,
preferably at least 81%, preferably at least 82%, preferably at
least 83%; preferably at least 84%, preferably at least 85%,
preferably at least 86%, preferably at least 87%, preferably at
least 88%, preferably at least 89%, preferably at least 90%,
preferably at least 91%, preferably at least 92%, preferably at
least 93%, preferably at least 94%, preferably at least 95%,
preferably at least 96%, preferably at least 97%, preferably at
least 98%, and preferably at least 99% identity to a sequence of
the present invention. Identity is found over a comparison window
of at least 5 amino acid positions, preferably at least 7 amino
acid positions, preferably at least 10 amino acid positions,
preferably at least 15 amino acid positions, preferably at least 20
amino acid positions and most preferably over the entire length of
a polypeptide used in the invention.
[0101] Polypeptide variants also encompass those which exhibit a
similarity to one or more of the specifically identified sequences
that is likely to preserve the functional equivalence of those
sequences and which could not reasonably be expected to have
occurred by random chance.
[0102] Polypeptide sequence identity and similarity can be
determined in the following manner. The subject polypeptide
sequence is compared to a candidate polypeptide sequence using
BLASTP (from the BLAST suite of programs, version 2.2.14 [May
2006]) in bl2seq, which is publicly available from NCBI
(ftp://ftp.ncbi.nih.gov/blast/). The default parameters of bl2seq
are utilized except that filtering of low complexity regions should
be turned off.
[0103] The similarity of polypeptide sequences may be examined
using the following UNIX command line parameters: [0104] bl2seq
peptideseq1 -j peptideseq2 -F F -p blastp
[0105] Variant polypeptide sequences preferably exhibit an E value
of less than 1.times.10.sup.-5, more preferably less than
1.times.10.sup.-6, more preferably less than 1.times.10.sup.-9,
more preferably less than 1.times.10.sup.-12, more preferably less
than 1.times.10.sup.-15, more preferably less than
1.times.10.sup.-18 and most preferably less than 1.times.10.sup.-21
when compared with any one of the specifically identified
sequences.
[0106] The parameter -F F turns off filtering of low complexity
sections. The parameter -p selects the appropriate algorithm for
the pair of sequences. This program finds regions of similarity
between the sequences and for each such region reports an "E value"
which is the expected number of times one could expect to see such
a match by chance in a database of a fixed reference size
containing random sequences. For small &values, much less than
one, this is approximately the probability of such a random
match.
[0107] Polypeptide sequence identity may also be calculated over
the entire length of the overlap between a candidate and subject
polypeptide sequences using global sequence alignment programs.
EMBOSS-needle (available at http:/www.ebi.ac.uk/emboss/align/) and
GAP (Huang, X. (1994) On Global Sequence Alignment. Computer
Applications in the Biosciences 10, 227-235.) as discussed above
are also suitable global sequence alignment programs for
calculating polypeptide sequence identity.
[0108] Use of BLASTP as described above is preferred for use in the
determination of polypeptide variants according to the present
invention.
[0109] Preferred variants include peptides who's sequence differs
from the human BNP-SP (1-26) herein by one or more conservative
amino acid substitutions, deletions, additions or insertions which
do not affect the biological activity of the peptide. Conservative
substitutions typically include the substitution of one amino acid
for another with similar characteristics, e.g., substitutions
within the following groups: valine, glycine; glycine, alanine;
valine, isoleucine, leucine; aspartic acid, glutamic acid;
asparagines, glutamine; serine, threonine; lysine, arginine; and
phenylalanine, tyrosine. Example 8 of conservative substations can
also be found in the sequences of BNP-SP in FIGS. 2A and 2B whereby
the substitutions in different mammalian species compared to the
human sequence are shown. Other conservative substitutions can be
taken from Table 1 below.
TABLE-US-00001 TABLE 1 Exemplary Preferred Original Residue
Substitutions Substitution Ala (A) val; leu; ile val Arg (R) lys;
gln; asn lys Asn (N) gln; his; lys; arg gln Asp (D) glu glu Cys (C)
ser ser Gln (Q) asn asn Glu (E) asp asp Gly (G) pro; ala ala His
(H) asn; gln; lys; arg arg Ile (I) leu; val; met; ala; leu phe;
norleucine Leu (L) norleucine; ile; ile val; met; ala; phe Lys (K)
arg; gln; asn arg Met (M) leu; phe; ile leu Phe (F) leu; val; ile;
ala; leu tyr Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp
(W) tyr; phe tyr Tyr (Y) trp; phe; thr; ser phe Val (V) ile; leu;
met; phe; leu ala; norleucine
[0110] Naturally occurring residues are divided into groups based
on common side-chain properties:
[0111] (1) hydrophobic: norleucine, met, ala, val, leu, ile;
[0112] (2) neutral hydrophilic: cys, ser, thr;
[0113] (3) acidic: asp, glu;
[0114] (4) basic: asn, gin, his, lys, arg:
[0115] (5) residues that influence chain orientation: gly, pro;
and
[0116] (6) aromatic: trp, tyr, phe.
[0117] Non-conservative substitutions will entail exchanging a
member of one of these classes for a member of another class. See
for example R being substituted with H at BNP-SP 25.
[0118] Other variants include peptides with modifications which
influence peptide stability. Such analogs may contain, for example,
one or more non-peptide bonds (which replace the peptide bonds) in
the peptide sequence. Also included are analogs that include
residues other than naturally occurring L-amino acids, e.g. D-amino
acids or non-naturally occurring synthetic amino acids, e.g. beta
or gamma amino acids and cyclic analogs.
[0119] Substitutions, deletions, additions or insertions may be
made by mutagenesis methods known in the art. A skilled worker will
be aware of methods for making phenotypically silent amino acid
substitutions. See for example Bowie et al., 1990, Science 247,
1306..sup.10
[0120] Also included within the polypeptides of the invention are
those which have been modified during or after synthesis for
example by biotinylation, benzylation, glycosylation,
phosphorylation, amidation, by derivatization using
blocking/protecting groups and the like. Such modifications may
increase stability or activity of the polypeptide.
[0121] The term "genetic construct" refers to a polynucleotide
molecule, usually double-stranded DNA, which may have inserted into
it another polynucleotide molecule (the insert polynucleotide
molecule) such as, but not limited to, a cDNA molecule. A genetic
construct may contain the necessary elements that permit
transcribing the insert polynucleotide molecule, and, optionally,
translating the transcript into a polypeptide. The insert
polynucleotide molecule may be derived from the host cell, or may
be derived from a different cell or organism and/or may be a
recombinant polynucleotide. Once inside the host cell the genetic
construct may become integrated in the host chromosomal DNA. The
genetic construct may be linked to a vector.
[0122] The term "vector" refers to a polynucleotide molecule,
usually double stranded DNA, which is used to transport the genetic
construct into a host cell. The vector may be capable of
replication in at least one additional host system, such as E.
coli.
[0123] The term "expression construct" refers to a genetic
construct that includes the necessary elements that permit
transcribing the insert polynucleotide molecule, and, optionally,
translating the transcript into a polypeptide. An expression
construct typically comprises in a 5' to 3' direction: [0124] a) a
promoter functional in the host cell into which the construct will
be transformed, [0125] b) the polynucleotide to be expressed, and
[0126] c) a terminator functional in the host cell into which the
construct will be transformed.
[0127] The term "coding region" or "open reading frame" (ORF)
refers to the sense strand of a genomic DNA sequence or a cDNA
sequence that is capable of producing a transcription product
and/or a polypeptide under the control of appropriate regulatory
sequences. The coding sequence is identified by the presence of a
5' translation start codon and a 3' translation stop codon. When
inserted into a genetic construct, a "coding sequence" is capable
of being expressed when it is operably linked to promoter and
terminator sequences and/or other regulatory elements.
[0128] "Operably-linked" means that the sequence to be expressed is
placed under the control of regulatory elements that include
promoters, transcription control sequences, translation control
sequences, origins of replication, tissue-specific regulatory
elements, temporal regulatory elements, enhancers, polyadenylation
signals, repressors and terminators.
[0129] The term "noncoding region" refers to untranslated sequences
that are upstream of the translational start site and downstream of
the translational stop site. These sequences are also referred to
respectively as the 5' UTR and the 3' UTR. These regions include
elements required for transcription initiation and termination and
for regulation of translation efficiency.
[0130] Terminators are sequences, which terminate transcription,
and are found in the 3' untranslated ends of genes downstream of
the translated sequence. Terminators are important determinants of
mRNA stability and in some cases have been found to have spatial
regulatory functions.
[0131] The term "promoter" refers to nontranscribed cis-regulatory
elements upstream of the coding region that regulate gene
transcription. Promoters comprise cis-initiator elements which
specify the transcription initiation site and conserved boxes such
as the TATA box, and motifs that are bound by transcription
factors.
[0132] The terms "to alter expression of" and "altered expression"
of a polynucleotide or polypeptide of the invention, are intended
to encompass the situation where genomic DNA corresponding to a
polynucleotide of the invention is modified thus leading to altered
expression of a polynucleotide or polypeptide of the invention.
Modification of the genomic DNA may be through genetic
transformation or other methods known in the art for inducing
mutations. The "altered expression" can be related to an increase
or decrease in the amount of messenger RNA and/or polypeptide
produced and may also result in altered activity of a polypeptide
due to alterations in the sequence of a polynucleotide and
polypeptide produced.
[0133] "Subject" as used herein is preferably a mammal and includes
human, and non-human mammals such as cats, dogs, horses, cows,
sheep, deer, mice, rats, primates (including gorillas, rhesus
monkeys and chimpanzees), possums and other domestic farm or zoo
animals. Preferably, the mammal is human.
[0134] The term "presentation" as used herein refers to
presentation of a subject at a medical facility such as a clinic or
hospital.
[0135] The term "treat", "treating" or "treatment" and "preventing"
refer to therapeutic or prophylactic measures which alleviate,
ameliorate, manage, prevent, restrain, stop or reverse progression
of ACD, or cardiac transplant rejection or effects thereof,
particularly of ACS. The subject may show observable or measurable
(statistically significant) reduction in one or more of TnI, BNP,
N-BNP, and other usual clinical markers known to those skilled in
the art, indicating improvement.
[0136] It is intended that reference to a range of numbers
disclosed herein (for example 1 to 10) also incorporates reference
to all related numbers within that range (for example, 1, 1.1, 2,
3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of
rational numbers within that range (for example 2 to 8, 1.5 to 5.5
and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges
expressly disclosed herein are expressly disclosed. These are only
examples of what is specifically intended and all possible
combinations of numerical values between the lowest value and the
highest value enumerated are to be considered to be expressly
stated in this application in a similar manner.
DETAILED DESCRIPTION OF THE INVENTION
[0137] Human B-type natriuretic peptide (BNP) is a member of the
cardiac natriuretic peptide family. As shown in FIG. 1, preproBNP
is a 134 amino acid molecule. The signal peptide BNP-SP (1-26) is
cleaved to give preproBNP (27-134). PreproBNP (27-134) is in turn
further processed to give bioactive forms preproBNP (103-134) and
prepro BNP (27-102). It is likely that BNP-SP is degraded into
smaller fragments by signal peptidase (SPP); usually near the
hydrophobic central region of the BNP-SP (1-26) sequence.
[0138] It has long been thought that the functional role of the
BNP-SP is limited to controlling the trafficking of BNP in the
endoplasmic reticulum. Once this is achieved it has been assumed
that the signal peptide is then degraded without ever being
secreted from the cell.
[0139] Very recently, it has been found that BNP-SP appears in the
circulation (WO 2005/052593; US 2005/0244904). Based on this
finding BNP-SP has been suggested for use as a circulating
biomarker for cardiac disease. The present applicants have made a
further and highly unexpected finding. In patients with acute
myocardial infarction (AMI) the circulating concentration of BNP-SP
is highest in the first few hours following the onset of the
patient's symptoms--in fact, at the time of presentation to the
hospital or clinic. This is contrary to expectations that BNP-SP
levels would be correlated with N-BNP levels and could therefore be
expected to reach their peak 12 to 24 hours from onset of, or
clinical presentation with ACD, cardiac transplant rejection, or
with an undiagnosed or suspected ACD or pulmonary disorder. Levels
observed in the first few hours are surprisingly very high often
reaching a peak some four to ten, commonly five to eight fold
higher than levels in a normal control population.
[0140] The level of BNP-SP remains up to three times higher than
BNP-SP levels in a control population for at least 6 weeks from
first measurement on clinical presentation. These findings suggest
BNP-SP is useful as a very clear early stage marker of cardiac
transplant rejection, ACD including acute coronary syndromes (ACS)
such as AMI, particularly non-ST elevated MI, acute cardiac
ischemia and may be used to distinguish ACD from pulmonary
disorders.
[0141] Based on these surprising findings, the applicants have
determined for the first time, that it would be useful to screen
for circulating BNP-SP or variants or fragments thereof, as well as
nucleotide sequences encoding BNP-SP or the variants and fragments
thereof in a biological sample taken from a subject within two
hours of onset of, or at clinical presentation with the
disorder.
[0142] Useful in the invention are antigenic fragments or variants
of BNP-SP which are least 5 amino acids in length. Particularly
useful fragments are the N-terminus or C-terminus of BNP-SP.
Examples of specific antigenic peptides are BNP-SP (1-10) (SEQ ID
NO:13), BNP-SP (1-17) (SEQ ID NO:15), BNP-SP (12-23) (SEQ ID
NO:17), and BNP-SP (17-26) (SEQ ID NO:19). Corresponding nucleotide
sequences are given in SEQ ID NOs: 14, 16, 18 and 20 respectively.
These sequences are provided by the applicants for the first time.
Both the nucleic acid molecules and peptides form aspects of the
invention.
[0143] Accordingly, in a first aspect, the invention provides a
nucleic acid molecule encoding a BNP-SP of the invention selected
from [0144] (a) SEQ ID NO:14; [0145] (b) SEQ ID NO:16; [0146] (c)
SEQ ID NO:18; [0147] (d) SEQ ID NO:20; [0148] (e) a complement of
any one of (a) to (d); [0149] (f) a sequence of at least 15
nucleotides in length, capable of hybridising to the sequence of
any one of (a) to (e) under stringent conditions with the proviso
that the sequence is not ccagtgcacaagctgatggggaggcgaga or SEQ ID
NO: 22.
[0150] The invention also provides isolated BNP-SP polypeptides
encoded by a nucleic acid molecule of the invention.
[0151] Specific polypeptides of the invention include polypeptides
having the amino acid sequences of SEQ ID NOs: 13, 15, 17 and 19
all as set forth in the accompanying sequence listing. Also
contemplated are functionally equivalent variants and fragments of
these polypeptides as defined herein.
[0152] The nucleic acid molecules of the invention or otherwise
described herein are preferably isolated. They can be isolated from
a biological sample using a variety of techniques known to those of
ordinary skill in the art. By way of example, such polynucleotides
can be isolated through use of the polymerase chain reaction (PCR)
described in Mullis et al., Eds. 1994 The Polymerase Chain
Reaction, Birkhauser. The nucleic acid molecules of the invention
can be amplified using primers, as defined herein, derived from the
polynucleotide sequences of the invention.
[0153] Further methods for isolating polynucleotides include use of
all, or portions of, the polynucleotide of the invention,
particularly a polynucleotide having the sequence set forth in SEQ
ID NO:19 as hybridization probes. The technique of hybridizing
labeled polynucleotide probes to polynucleotides immobilized on
solid supports such as nitrocellulose filters or nylon membranes,
can be used to screen genomic or cDNA libraries. Similarly, probes
may be coupled to beads and hybridized to the target sequence.
Isolation can be effected using known art protocols such as
magnetic separation. Exemplary stringent hybridization and wash
conditions are as given above.
[0154] Polynucleotide fragments may be produced by techniques
well-known in the art such as restriction endonuclease digestion
and oligonucleotide synthesis.
[0155] A partial polynucleotide sequence may be used as a probe, in
methods well-known in the art to identify the corresponding full
length polynucleotide sequence in a sample. Such methods include
PCR-based methods, 5'RACE (Methods Enzymol. 218: 340-56 (1993);
Sambrook et al., Supra) and hybridization-based method,
computer/database-based methods. Detectable labels such as
radioisotopes, fluorescent, chemiluminescent and bioluminescent
labels may be used to facilitate detection. Inverse PCR also
permits acquisition of unknown sequences, flanking the
polynucleotide sequences disclosed herein, starting with primers
based on a known region (Triglia et al., Nucleic Acids Res 16,
8186, (1998)) The method uses several restriction enzymes to
generate a suitable fragment in the known region of a gene. The
fragment is then circularized by intramolecular ligation and used
as a PCR template. Divergent primers are designed from the known
region. In order to physically assemble full-length clones,
standard molecular biology approaches can be utilized (Sambrook et
al., Supra). Primers and primer pairs which allow amplification of
polynucleotides of the invention, also form a further aspect of
this invention.
[0156] Variants (including orthologues) may be identified by the
methods described. Variant polynucleotides may be identified using
PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain
Reaction, Birkhauser). Typically, the polynucleotide sequence of a
primer, useful to amplify variants of polynucleotide molecules by
PCR, may be based on a sequence encoding a conserved region of the
corresponding amino acid sequence.
[0157] Further methods for identifying variant polynucleotides
include use of all, or portions of, the specified polynucleotides
as hybridization probes to screen genomic or cDNA libraries as
described above. Typically probes based on a sequence encoding a
conserved region of the corresponding amino acid sequence may be
used. Hybridisation conditions may also be less stringent than
those used when screening for sequences identical to the probe.
[0158] The variant sequences, including both polynucleotide and
polypeptide variants, may also be identified by the computer-based
methods discussed above.
[0159] Multiple sequence alignments of a group of related sequences
can be carried out with CLUSTALW (Thompson, et al., Nucleic Acids
Research, 22:4673-4680 (1994),
http://www-igbmc.u-strasbg.fr/BioInfo/ClustalW/Top.html) or
T-COFFEE (Cedric Notredame et al., J. Mol. Biol. 302: 205-217
(2000))) or PILEUP, which uses progressive, pairwise alignments.
(Feng et al., J. Mol. Evol. 25, 351 (1987)).
[0160] Pattern recognition software applications are available for
finding motifs or signature sequences. For example, MEME (Multiple
Em for Motif Elicitation) finds motifs and signature sequences in a
set of sequences, and MAST (Motif Alignment and Search Tool) uses
these motifs to identify similar or the same motifs in query
sequences. The MAST results are provided as a series of alignments
with appropriate statistical data and a visual overview of the
motifs found. MEME and MAST were developed at the University of
California, San Diego.
[0161] PROSITE (Bairoch et al., Nucleic Acids Res. 22, 3583 (1994);
Hofmann et al., Nucleic Acids Res. 27, 215 (1999)) is a method of
identifying the functions of uncharacterized proteins translated
from genomic or cDNA sequences. The PROSITE database
(www.expasy.org/prosite) contains biologically significant patterns
and profiles and is designed so that it can be used with
appropriate computational tools to assign a new sequence to a known
family of proteins or to determine which known domain(s) are
present in the sequence (Falquet et al., Nucleic Acids Res. 30, 235
(2002)). Prosearch is a tool that can search SWISS-PROT and EMBL
databases with a given sequence pattern or signature.
[0162] Proteins can be classified according to their sequence
relatedness to other proteins in the same genome (paralogues) or a
different genome (orthologues). Orthologous genes are genes that
evolved by speciation from a common ancestral gene and normally
retain the same function as they evolve. Paralogous genes are genes
that are duplicated within a genome and genes may acquire new
specificities or modified functions which may be related to the
original one. Phylogenetic analysis methods are reviewed in Tatusov
et al., Science 278, 631-637, 1997).
[0163] In addition to the computer/database methods described
above, polypeptide variants may be identified by physical methods,
for example by screening expression libraries using antibodies
raised against polypeptides of the invention (Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor
Press, 1987) by recombinant DNA techniques also described by
Sambrook et al. or by identifying polypeptides from natural sources
with the aid of such antibodies.
[0164] Polypeptides, including variant polypeptides, may be
prepared using peptide synthesis methods well known in the art such
as direct peptide synthesis using solid phase techniques (e.g.
Merrifield, 1963, in J. Am. Chem. Soc. 85, 2149; Stewart et al.,
1969, in Solid-Phase Peptide Synthesis, WH Freeman Co, San
Francisco Calif.; Matteucci et al. J. Am. Chem. Soc. 103:3185-3191,
1981) or automated synthesis, for example using a Synthesiser from
Applied Biosystems (California, USA). Mutated forms of the
polypeptides may also be produced using synthetic methods such as
site-specific mutagensis of the DNA encoding the amino acid
sequence as described by Adelmen et al; DNA 2, 183 (1983).
[0165] The polypeptides and variant polypeptides herein are
preferably isolated. They may be isolated or purified from natural
sources using a variety of techniques that are well known in the
art (e.g. Deutscher, 1990, Ed, Methods in Enzymology, Vol. 182,
Guide to Protein Purification). Technologies include HPLC,
ion-exchange chromatography, and immunochromatography but are not
limited thereto.
[0166] Alternatively the polypeptides and variant polypeptides may
be expressed recombinantly in suitable host cells and separated
from the cells as discussed below. The polypeptides and variants
have utility in generating antibodies, and generating ligands
amongst other uses.
[0167] The genetic constructs described herein may comprise one or
more of the disclosed polynucleotide sequences and/or
polynucleotides encoding the disclosed polypeptides, of the
invention and may be useful for transforming, for example,
bacterial, fungal, insect, mammalian or plant organisms. The
genetic constructs of the invention are intended to include
expression constructs as herein defined. Included are vectors (such
as pBR322, pUC18, pU19, Mp18, Mp19, ColE1, PCR1 and pKRC), phages
(such as lambda gt10), and M13 plasmids (such as pBR322, pACYC184,
pT127, RP4, p13101, SV40 and BPV), cosmids, YACS, BACs shuttle
vectors such as pSA3, PAT28 transposons (such as described in U.S.
Pat. No. 5,792,294) and the like.
[0168] The constructs may conveniently include a selection gene or
selectable marker. Typically an antibiotic resistance marker such
as ampicillin, methotrexate, or tetracycline is used.
[0169] Promoters useful in the constructs include .beta.-lactamase,
alkaline phosphatase, tryptophan, and tac promoter systems which
are all well known in the art. Yeast promoters include
3-phosphoglycerate kinase, enolase, hexokinase, pyruvate
decarboxylase, glucokinase, and glyceraldehydrate-3-phosphanate
dehydrogenase but are not limited thereto.
[0170] Enhancers may also be employed to act on the promoters to
enhance transcription. Suitable enhancers for use herein include
SV40 enhancer, cytomeglovirus early promoter enhancer, globin,
albumin, insulin and the like.
[0171] Methods for producing and using genetic constructs and
vectors are well known in the art and are described generally in
Sambrook et al., (supra), and Ausubel et al., Current Protocols in
Molecular Biology, Greene Publishing, 0.1987. Methods for
transforming selected host cells with the vectors are also known,
for example, the calcium chloride treatment described by Cohen, S
N; PNAS 69, 2110, 1972.
[0172] Host cells comprising the genetic constructs and vectors
described may be derived from prokaryotic or eukaryotic sources,
for example yeast, bacteria, fungi, insect (eg baculovirus),
animal, mammalian or plant organisms. In one embodiment the host
cells are isolated host cells. Prokaryotes most commonly employed
as host cells are strains of E. coli. Other prokaryotic hosts
include Pseudomonas, Bacillus, Serratia, Klebsiella, Streptomyces,
Listeria, Saccharomyces, Salmonella and Mycobacteria but are not
limited thereto.
[0173] Eukaryotic cells for expression of recombinant protein
include but arenot limited to Vero cells, HeLa, CHO (Chinese
Hamster ovary cells), 293, BHK cells, MDCK cells, and COS cells as
well as prostate cancer cell lines such as PrEC, LNCaP, Du 145 and
RWPE-2. The cells are available from ATCC, Virginia, USA.
[0174] Prokaryotic promoters compatible with expression of nucleic
acid molecules of the invention include known art constitutive
promoters (such as the int promoter of bacteriophage lamda and the
bla promoter of the beta-lactamase gene sequence of pBR322) and
regulatable promoters (such as lacZ, recA and gal). A ribosome
binding site upstream of the coding sequence may also be required
for expression.
[0175] Host cells comprising genetic constructs, such as expression
constructs, are useful in methods for recombinant production of
polypeptides. Such methods are well known in the art (see for
example Sambrook et al. supra). The methods commonly involve the
culture of host cells in an appropriate medium in conditions
suitable for or conducive to, expression and selection of a
polypeptide of the invention. Cells with a selectable marker may
additionally be grown on medium appropriate for selection of host
cells expressing a polypeptide of the invention. Transformed host
cells expressing a polypeptide of the invention are selected and
cultured under conditions suitable for expression of the
polypeptide. The expressed recombinant polypeptide, may be
separated and purified from the culture medium using methods well
known in the art including ammonium sulfate precipitation, ion
exchange chromatography, gel filtration, affinity chromatography,
electrophoresis and the like (e.g. Deutscher, Ed, 1990, Methods in
Enzymology, Vol 182, Guide to Protein Purification). Host cells may
also be useful in methods for production of a product generated by
an expressed polypeptide of the invention.
[0176] In another aspect, the present invention provides a method
for predicting, diagnosing or monitoring an acute cardiac disorder
(ACD) in a subject, the method comprising: measuring the level of
BNP-SP in a biological sample obtained from the subject within two
hours of onset of the ACD, or within two hours of presentation with
ACD; and comparing the level of said BNP-SP with the BNP-SP level
from a control wherein a measured level of BNP-SP higher than the
control level is indicative of ACD.
[0177] In another aspect the invention provides a method for
monitoring a response to treatment of a an acute cardiac disorder
(ACD) in a subject, the method comprising measuring the level of
BNP-SP in a biological sample obtained from the subject within two
hours of onset of the ACD, or within two hours of presentation with
the ACD; and comparing the level of said BNP-SP with the BNP-SP
level from a control, wherein a change in the measured level of
BNP-SP from the control level is indicative of a response to the
treatment.
[0178] It is known in the art that BNP precursors such as
proBNP27-102 proBNP27-47, can be used in predicting or diagnosing a
cardiac transplant rejection episode and to distinguish between
pulmonary and cardiovascular causes of dyspnea (shortness of
breath). See US 2005/0244902. Accordingly, it is similarly
predictable that BNP-SP can be used as an early marker of cardiac
transplant rejection based on cardiac tissue analysis, and to
distinguish pulmonary from acute cardiac disorders.
[0179] Accordingly, the invention also provides a method for
predicting, diagnosing or monitoring a cardiac transplant rejection
episode in a subject, the method comprising measuring the level of
BNP-SP in a biological sample obtained from a subject within two
hours of heart transplant and comparing the level of said BNP-SP
with the BNP-SP level from a control, wherein a measured level of
BNP-SP higher than the control level is indicative of transplant
rejection.
[0180] The invention also provides a method of distinguishing
between a pulmonary disorder and an acute cardiac disorder (ACD) in
a subject, the method comprising measuring the level of BNP-SP in a
biological sample obtained from a subject within two hours of
presentation with the disorder; and comparing the level of said
BNP-SP with the BNP-SP level from a control wherein a measured
BNP-SP level higher than the control level is indicative of
ACD.
[0181] In one embodiment, the invention provides a method for
predicting, diagnosing or monitoring an acute cardiac disorder
(ACD), cardiac transplant rejection, or ACD/pulmonary disorder in a
subject, the method comprising measuring the level of BNP-SP in a
biological sample obtained from the subject within the first two
hours of onset of, or clinical presentation with ACD, transplant
rejection or ACD/pulmonary disorder.
[0182] Preferably, the measured level of BNP-SP is compared with
the BNP-SP level from a control wherein a measured level of BNP-SP
higher than the control level is indicative of ACD or transplant
rejection.
[0183] The skilled reader will appreciate that for evaluation
purposes, marker requires correlation with a reference valve or
control value.
[0184] As used herein a control can be an individual or group from
which BNP-SP samples are taken and a mean BNP-SP level determined.
Usually, the individual or group will comprise normal healthy
individuals or a group of individuals not known to be suffering
from ACD, cardiac transplant rejection or ACD/pulmonary disorder.
BNP-SP levels in most individuals are between 0-15 pmol/L, and the
mean control level is about 10 pmol/L. Alternatively, the control
level may be assessed based on a plurality of readings from
previously tested individuals or groups. Another example of a
control level is a ratiometric measure between BNP-SP and BNP
levels in cardiac tissue. The subject's BNP-SP level can be
compared to the mean BNP-SP level for that control population. The
BNP-SP level in the cardiac control population may be in the order
of 1.5 to 3, commonly 2 to 3 or 2.5 to 3 times higher than BNP-SP
levels in the normal control population. Alternatively, the control
may be one or more readings or the mean of such readings taken from
the same subject at an earlier time. Ascertaining appropriate
controls and control levels for particular methods is well known in
the art.
[0185] The term within two hours of onset or clinical presentation
includes from 1 minute up to and including 120 minutes from onset
of, or presentation at a medical facility with ACD, cardiac
transplant rejection or an undiagnosed or suspected ACD/pulmonary
disorder. Preferably measurements are made within 1 hour (from 1
minute up to and including 60 minutes) from onset or presentation,
preferably within 5 to 45 minutes, preferably 15 to 40 minutes,
preferably 20 to 35 minutes, and optimally within 25 to 30 minutes
of onset or presentation.
[0186] A level "higher" than a control, or a change or deviation
from a control is preferably statistically significant. A higher
level, deviation from, or change from a control level or mean
control level can be considered to exist if the level differs from
the control level by 5% or more, by 10% or more, preferably by 20%
ore more, more preferably by 50% or more compared to the control
level. Statistically significant may alternatively be calculated as
P.ltoreq.0.05. In a further alternative, higher levels, deviation
and changes can be determined by recourse to assay reference limits
or reference intervals. These can be calculated from intuitive
assessment or non-parametric methods. Overall, these methods
calculate the 0.025, and 0.975 fractiles as 0.025*(n+1) and 0.975
(n+1). Such methods are well known in the art..sup.23,24 Presence
of a marker absent in a control, is also contemplated as a higher
level, deviation or change.
[0187] It will be appreciated that the step of measuring BNP-SP
levels in a sample may be a single measurement on a single sample,
or repeated measurements on a number of samples. Accordingly,
measurement may comprise 1 to 20 measurements of BNP-SP, preferably
1 to 10, preferably 1 to 5, preferably 1 to 3, preferably 1 or 2,
preferably 2 or 3 measurements, in samples taken at different times
within the first two hours, preferably within one hour of, onset of
or clinical presentation. Single, or repeated measurements outside
the two hour period may also be taken to establish whether the
BNP-SP level has fallen to the normal control level, or cardiac
control level.
[0188] In one preferred embodiment, the method comprises measuring
BNP-SP levels in 1 or 2 samples taken within the first hour of
onset or presentation, followed by measuring BNP-SP levels in 1 or
2 samples taken within two to four hours of onset or presentation,
or initial measurement of the BNP-SP level, preferably within two
to three hours.
[0189] As noted above, BNP-SP levels measured within the first two
hours of onset or presentation are usually four to ten times
higher, commonly five to eight times higher than BNP-SP levels
measured in a normal control. As stated above, also included within
the ranges are the specific ranges 4 to 9, 4 to 8, 4 to 7, 4 to 6,
4 to 5, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6, 6 to 10, 6 to 9, 6
to 8, 6 to 7, 7 to 10, 7 to 9, 7 to 8, 8 to 10, 8 to 9, and 9 to 10
times.
[0190] In another embodiment, a level of BNP-SP in the sample in
the range 20 to 300 pmol/L, preferably 25 to 250 pmol/L, preferably
30 to 180 pmol/L, preferably 35 to 150 pmol/L, preferably 40 to 120
pmol/L, preferably 40 to 90 pmol/L, and preferably 45 to 80 pmol/L
is indicative of ACD, cardiac transplant rejection, or
distinguishes ACD from a pulmonary disorder.
[0191] As stated above, the ranges also include any values within
the range such as 20 to 180 pmol/L, 50 to 200 pmol/L, 40 to 130
pmol/L, 50 to 100 pmol/L, 45 to 160 pmol/L, and the like.
[0192] The biological sample can be any biological material in
which BNP-SP can be located or secreted. This includes any tissue
or bodily fluid such as blood, saliva, interstitial fluid, serum,
plasma, urine, pericardial fluid and cerebrospinal fluid but is not
limited thereto. Preferably the biological sample is a circulatory
biological sample, for example blood, serum or plasma. In one
embodiment, the biological sample is cardiac tissue.
[0193] The presence of the markers and their level of expression in
the sample may be determined according to methods known in the art
such as Southern Blotting, Northern Blotting, FISH or quantative
PCR to quantitate the transcription of mRNA [(Thomas, Pro. NAH,
Acad. Sci. USA 77: 5201-5205 1980), (Jain K K., Med Device Technol.
2004 May; 15(4):14-7)], dot blotting, (DNA analysis) or in situ
hybridization using an appropriately labelled probe, based on the
marker sequences provided herein.
[0194] Accordingly, the invention also provides an assay for
detecting the presence of a nucleic acid molecule of the invention,
in a sample, the method comprising: [0195] (a) contacting the
sample with a polynucleotide probe which hybridises to the nucleic
acid sequence under stringent hybridisation conditions; and [0196]
(b) detecting the presence of a hybridisation complex in the
sample.
[0197] Preferably the hybridisation probe is a labelled probe.
Examples of labels include fluorescent, chemiluminescent,
radioenzyme and biotin-avidin labels. Labelling and visualisation
of labelled probes is carried out according to known art methods
such as those above.
[0198] For convenience the nucleic acid probe may be immobilized on
a solid support including resins (such as polyacrylamides),
carbohydrates (such as sepharose), plastics (such as
polycarbonate), and latex beads.
[0199] As discussed above the nucleic acid molecule probe may
preferably be an RNA, cDNA or DNA molecule. Preferred probes
include SEQ ID NOs: 14, 16, 18, 20 and 22.
[0200] Stringent hybridisation conditions are as discussed
above.
[0201] The expression level of the nucleic acid marker may be
determined using known art techniques such as RT-PCR and
electrophoresis techniques including SDS-PAGE. Using these
techniques the DNA or cDNA sequence of a nucleic acid molecule of
the invention, in a subject sample is amplified, and the level of
DNA or cDNA or RNA measured.
[0202] In an alternate method the DNA, cDNA or RNA level may be
measured directly in the sample without amplification.
[0203] A currently preferred method is Northern blot hybridization
analysis. Probes for use in Northern blot hybridization analysis
may be prepared based on the marker sequences identified herein. A
probe preferably includes at least 12, at least 15, at least 18, at
least 24, at least 30, at least 36, preferably at least 42,
preferably at least 51, preferably at least 60, preferably at least
70 or more contiguous nucleotides of a reference sequence.
[0204] Alternatively, the expression level may be measured using
reverse transcription based PCR(RT-PCR) assays using primers
specific for the nucleic acid sequences. If desired, comparison of
the level of the marker in the sample can be made with reference to
a control nucleic acid molecule the expression of which is
independent of the parameter or condition being measured. A control
nucleic acid molecule refers to a molecule in which the level does
not differ between the disorder or transplant rejection state and
the healthy state. Levels of the control molecule can be used to
normalise levels in the compared populations. An example of such a
control molecule is GAP-DH. The markers of the invention will
change levels with the disorder.
[0205] In one embodiment the measuring step comprises detecting
binding between BNP-SP and a binding agent that selectively binds
BNP-SP or a fragment or variant thereof. Preferably, the binding
agent has low cross-reactivity with other markers of biological
events, and more particularly BNP or NT-BNP. The binding agent is
preferably an antibody or fragment thereof.
[0206] The present invention also relates to such antibodies, or
fragments of the antibodies. An antibody that binds to BNP-SP or a
fragment or variant thereof may be in any form, including all
classes of polyclonal, monoclonal, single chain, human, humanized
antibodies and chimeric antibodies produced by genetic
recombination. Also included is antiserum obtained by immunizing an
animal such as a mouse, rat or rabbit with BNP-SP or a fragment or
variant thereof.
[0207] A fragment of an antibody or a modified antibody may also be
used herein so long as it binds BNP-SP or a fragment or variant
thereof. The antibody fragment may be Fab, F(ab'), F(ab'), and Fc
or Fv fragment or single chain Fv (scFv), in which Fv fragments
from H and L chains are ligated by an appropriate linker (Huston et
al. Proc. Natl. Acad. Sci. USA 85:5879-83 (1988)). The "Fc" portion
of an antibody refers to that portion of an immunoglobulin heavy
chain that comprises one or more heavy chain constant region
domains; CH1, CH2 and CH3, but does not include the heavy chain
variable region.
[0208] Methods for preparing antibodies are well known in the art
(see for example Harlow and Lane (1998)..sup.11 Most commonly used
antibodies are produced by immunizing a suitable host mammal.
Fusion proteins comprising BNP-SP may also be used as
immunogens.
[0209] An antibody may be modified by conjugation with a variety of
molecules, such as polyethylene glycol (PEG). The modified antibody
can be obtained by chemically modifying an antibody. These
modification methods are conventional in the field.
[0210] Alternatively, an antibody may be obtained as a chimeric
antibody, between a variable region derived from nonhuman antibody
and the constant region derived from human antibody, or as a
humanized antibody, comprising the complementarity determining
region (CDR) derived from nonhuman antibody, the frame work region
(FR) derived from human antibody, and the constant region. Such
antibodies can be prepared using known art methods.
[0211] In brief, methods of preparing polyclonal antibodies are
known to the skilled artisan. Polyclonal antibodies can be raised
in a mammal, for example, by one or more injections of an
immunizing agent and, if desired, an adjuvant. Typically, the
immunizing agent and/or adjuvant will be injected in the mammal by
multiple subcutaneous or intraperitoneal injections. The immunizing
agent may include BNP-SP or a fragment or variant thereof or a
fusion protein thereof. It may be useful to conjugate the
immunizing agent to a protein known to be immunogenic in the mammal
being immunized. Examples of such immunogenic proteins include but
are not limited to keyhole limpet hemocyanin, bovine serum albumin,
bovine thyroglobulin, and soybean trypsin inhibitor. Examples of
adjuvants which may be employed include Freund's complete adjuvant
and MPL TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose
dicorynomycolate). The immunization protocol may be selected by one
skilled in the art without undue experimentation.
[0212] Monoclonal antibodies may be prepared using hybridoma
methods well known in the art. See for example Kohler and Milstein,
1975.sup.12 and U.S. Pat. No. 4,196,265. The hybridoma cells may be
cultured in a suitable culture medium, alternatively, the hybridoma
cells may be grown in vivo as ascites in a mammal. Preferred
immortalized cell lines are murine myeloma lines, which can be
obtained, for example, from the American Type Culture Collection,
Virginia, USA. Immunoassays may be used to screen for immortalized
cell lines which secrete the antibody of interest. Sequences of
BNP-SP or fragments or variants thereof may be used in
screening.
[0213] Accordingly, also contemplated herein ate hybridomas which
are immortalized cell lines capable of secreting a BNP-SP specific
monoclonal antibody.
[0214] Well known means for establishing binding specificity of
monoclonal antibodies produced by the hybridoma cells include
immunoprecipitation, radiolinked immunoassay (MA), enzyme-linked
immunoabsorbent assay (ELISA) and Western blot. (Lutz et al., Exp.
Cell. Res. 175:109-124 (1988)). Samples from immunised animals may
similarly be screened for the presence of polyclonal
antibodies.
[0215] To facilitate detection, antibodies and fragments herein may
be labelled with detectable markers such as fluorescent,
bioluminescent, and chemiluminescent compounds, as well as
radioisotopes, magnetic beads and affinity labels (e.g biotin and
avidin). Examples of labels which permit indirect measurement of
binding include enzymes where the substrate may provide for a
coloured fluorescent product, suitable enzymes include horseradish
peroxidase, alkaline phosphatase, malate dehydrogenase and the
like. Fluorochromes (e.g Texas Red, fluorescein, phycobiliproteins,
and phycoerythrin) can be used with a fluorescence activated cell
sorter. Labelling techniques are well known in the art.
[0216] The monoclonal antibodies secreted by the cells may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxyapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0217] The monoclonal antibodies or fragments may also be produced
by recombinant DNA means (see for example U.S. Pat. No. 4,816,567).
DNA modifications such as substituting the coding sequence for
human heavy and light chain constant domains in place of the
homologous murine sequences (U.S. Pat. No. 4,816,567 above) are
also possible. The antibodies may be monovalent antibodies. Methods
for preparing monovalent antibodies are well known in the art.
Production of chimeric bivalent antibodies are also contemplated
herein.
[0218] The antibodies of the invention may further comprise
humanized antibodies or human antibodies. Humanized antibodies
include human immunoglobulins in which residues from a
complementary determining region (CDR) of the recipient are
replaced by residues from a CDR of a non-human species. The
production of humanized antibodies from non-human sources such as
rabbit, rat and mouse are well known..sup.13,14,15
[0219] Human antibodies can also be produced using various
techniques known in the art, including phage display
libraries.sup.16; and transgenic methods, see, for example
Neuberger 1996.sup.17; and Vaughan et al, 1998.sup.18.
[0220] Bispecific antibodies may also be useful. These antibodies
are monoclonal, preferably human or humanized, antibodies that have
binding specificities for at least two different antigens. For
example BNP-SP or a variant or fragment thereof, and an antigen
selected from the group including preproBNP, BNP, CK-MB, TnT, TnI,
and myoglobin. Antibodies with greater than two specificities for
example trispecific antibodies are also contemplated herein.
[0221] Methods for making bispecific antibodies are known in the
art. See for example Milstein and Cuello 1983.sup.19, Suresh et
al., 1986.sup.20 and Brennan et al., 1985.sup.21.
[0222] The BNP-SP which is selectively bound by the antibody is
BNP-SP or an antigenic variant or fragment thereof as discussed
above.
[0223] Desirably, the antibody binds the N-terminus or C-terminus
of BNP-SP. Examples of specific antigenic peptides which the
binding agent selectively binds include BNP-SP(1-10) SEQ ID NO:13,
BNP-SP (1-17) SEQ ID NO:15, BNP-SP (12-23) (SEQ ID NO:17),
BNP-SP(17-26) SEQ ID NO:19, and BNP-SP(1-26) SEQ ID NO:21.
[0224] Binding of BNP-SP can be detected by any means known in the
art including specific (antibody based) and non specific (such as
HPLC solid phase). Most commonly, antibodies herein are detected
using an assay such as ELISA or RIA as noted above. Competitive
binding assays, sandwich assays, non-competitive assays,
fluoroimmunoassay, immunofluorometric assay, or immunoradiometric
assays, luminescence assays, chemiluniescence assays and mass
spectrometry analysis such a surface-enhanced laser desorption and
ionization (SELDI) electrospray ionization (ESI), matrix assisted
laser-desorption ionization (MALDI), fourier transform Ion
cyclotron resonance mass spectroscopy (FTICR) alone or in
combination with non-specific binding agents such as chromatography
formats are also feasible.
[0225] Conveniently, an antibody can be fixed to a solid substrate
to facilitate washing and isolation of the BNP-SP/antibody complex.
Binding of antibodies to a solid support can be achieved using
known art techniques. See for example Handbook of Experimental
Immunology, 4th edition, Blackwell Scientific Publications, Oxford
(1986). Useful solid substrates for antibodies include glass,
nylon, paper and plastics. Similarly, BNP-SP can be adsorbed onto a
solid substrate such as adsorbent silica, or resin particles, or
silicon chips optionally coated or derivatised with ion exchange,
reverse phase (eg C18 coating) or other materials. The substrate
may be in the form of beads, plates, tubes, sticks or biochips.
Biochips or plates with addressable locations and discreet
microtitre plates are particularly useful. Also preferred for use
are multiple systems where beads containing antibodies directed to
multiple analytes are used to measure levels of the analytes in a
single sample. Analytes to be measured may include other cardiac
markers as well as BNP-SP or variants or fragments thereof. One
example of a suitable multiplex bead system for use herein is the
Luminex Fluorokine Multianalyte Profiling system.
[0226] Antibody assay methods are well known in the art see for
example U.S. Pat. No. 5,221,685, U.S. Pat. No. 5,310,687, U.S. Pat.
No. 5,480,792, U.S. Pat. No. 5,525,524, U.S. Pat. No. 5,679,526,
U.S. Pat. No. 5,824,799, U.S. Pat. No. 5,851,776, U.S. Pat. No.
5,885,527, U.S. Pat. No. 5,922,615, U.S. Pat. No. 5,939,272, U.S.
Pat. No. 5,647,124, U.S. Pat. No. 5,985,579, U.S. Pat. No.
6,019,944, U.S. Pat. No. 6,113,855, U.S. Pat. No. 6,143,576 and for
unlabelled assays U.S. Pat. No. 5,955,377, and U.S. Pat. No.
5,631,171 see also Zola, Monoclonal Antibodies: A Manual of
Techniques pp 147-158 (CRC Press, Inc 1987), Harlow and Lane (1998)
Antibodies, A Laboratory Manual, Cold Spring Harbour Publications,
New York, and US 2005/0064511 for a description of assay formats
and conditions all of the above references are incorporated herein
by reference in their entirety.
[0227] Immunoassay analysers are also well known and include
Beckman Acess, Abbott AxSym, Roche ElecSys and Dade Behring Status
systems amongst others which are well described.sup.22.
[0228] Binding of BNP-SP and an antibody to form a complex can be
detected directly or indirectly. Direct detection is carried out
using labels such as fluorescence, luminescence, radionuclides,
metals, dyes and the like. Indirect detection includes binding
detectable labels such as digoxin or enzymes such as horseradish
peroxidase and alkaline phosphatase to form a labelled BNP-SP
antibody followed by a step of detecting the label by addition of
detection reagents.
[0229] Horseradish peroxidase for example can be incubated with
substrates such as o-Phenylenediamine Dihyhydrochloride (OPD) and
peroxide to generate a coloured product whose absorbance can be
measured, or with luminol and peroxide to give chemiluminescent
light which can be measured in a luminometer as is known in the
art. Biotin or digoxin can be reacted with binding agents that bind
strongly to them. For example, the proteins avidin and streptavidin
will bind strongly to biotin. A further measurable label is then
covalently bound or linked thereto either by direct reaction with
the protein, or through the use of commonly available crosslinking
agents such as MCS and carbodiimide, or by addition of chelating
agents.
[0230] Generally, the complex is separated from the uncomplexed
reagents for example by centrifugation. If the antibody is
labelled, the amount of complex will be reflected by the amount of
label detected. Alternatively, a BNP-SP may be labelled by binding
to an, antibody and detected in a competitive assay by measuring a
reduction in bound labelled BNP-SP when the
antibody-labelled-BNP-SP is incubated with a biological sample
containing unlabelled BNP-SP. Other immunoassays may be used for
example a sandwich assay.
[0231] In one example, following contact with the antibody, usually
overnight for 18 to 25 hours at 4.degree. C., or for 1 to 2 to 4
hours at 25.degree. C. to 40.degree. C., the labelled BNP-SP bound
to the binding agent (antibody) is separated from the unbound
labelled BNP-SP. In solution phase assays, the separation may be
accomplished by addition of an anti gamma globulin antibody
(second-antibody) coupled to solid phase particles such as
cellulose, or magnetic material. The second-antibody is raised in a
different species to that used for the primary antibody and binds
the primary antibody. All primary antibodies are therefore bound to
the solid phase via the second antibody. This complex is removed
from solution by centrifugation or magnetic attraction and the
bound labelled peptide measured using the label bound to it. Other
options for separating bound from free label include formation of
immune complexes, which precipitate from solution, precipitation of
the antibodies by polyethyleneglycol or binding free labelled
peptide to charcoal and removal from solution by centrifugation of
filtration. The label in the separated bound or free phase is
measured by an appropriate method such as those presented
above.
[0232] Competitive binding assays can also be configured as solid
phase assays that are easier to perform and are therefore
preferable to those above. This type of assay uses plates with
wells (commonly known as ELISA or immunoassay plates), solid beads
or the surfaces of tubes. The primary antibody is either adsorbed
or covalently bound to the surface of the plate, bead or tube, or
is bound indirectly through a second anti gamma globulin or anti Fc
region antibody adsorbed or covalently bound to the plate. Sample
and labelled peptide (as above) are added to the plate either
together or sequentially and incubated under conditions allowing
competition for antibody binding between BNP-SP in the sample and
the labelled peptide. Unbound labelled peptide can subsequently be
aspirated off and the plate rinsed leaving the antibody bound
labelled peptide attached to the plate. The labelled peptide can
then be measured using techniques described above.
[0233] Sandwich type assays are more preferred for reasons of
specificity, speed and greater measuring range. In this type of
assay an excess of the primary antibody to BNP-SP is attached to
the well of an ELISA plate, bead or tube via adsorption, covalent
coupling, or an anti Fc or gamma globulin antibody, as described
above for solid phase competition binding assays. Sample fluid or
extract is contacted with the antibody attached to the solid phase.
Because the antibody is in excess this binding reaction is usually
rapid. A second antibody to BNP-SP is also incubated with the
sample either simultaneously or sequentially with the primary
antibody. This second antibody is chosen to bind to a site on
BNP-SP that is different from the binding site of the primary
antibody. These two antibody reactions result in a sandwich with
the BNP-SP from the sample sandwiched between the two antibodies.
The second antibody is usually labelled with a readily measurable
compound as detailed above for competitive binding assays.
Alternatively a labelled third antibody which binds specifically to
the second antibody may be contacted with the sample. After washing
away the unbound material the bound labelled antibody can be
measured and quantified by methods outlined for competitive binding
assays.
[0234] A dipstick type assay may also be used. These assays are
well known in the art. They may for example, employ small particles
such as gold or coloured latex particles with specific antibodies
attached. The liquid sample to be measured may be added to one end
of a membrane or paper strip preloaded with the particles and
allowed to migrate along the strip. Binding of the antigen in the
sample to the particles modifies the ability of the particles to
bind to trapping sites, which contain binding agents for the
particles such as antigens or antibodies, further along the strip.
Accumulation of the coloured particles at these sites results in
colour development are dependent on the concentration of competing
antigen in the sample. Other dipstick methods may employ antibodies
covalently bound to paper or membrane strips to trap antigen in the
sample. Subsequent reactions employing second antibodies coupled to
enzymes such as horse radish peroxidase and incubation with
substrates to produce colour, fluorescent or chemiluminescent light
output will enable quantitation of antigen in the sample.
[0235] As discussed in the following examples, radioimmunoassay
(RIA) is a currently preferred laboratory technique. In one RIA a
radiolabelled antigen and unlabelled antigen are employed in
competitive binding with an antibody. Common radiolabels include
.sup.125I, .sup.131I, .sup.3H and .sup.14C.
[0236] Radioimmunoassays involving precipitation of BNP-SP with a
specific antibody and radolabelled antibody binding protein can
measure the amount of labelled antibody in the precipitate as
proportional to the amount of BNP-SP in the sample. Alternatively,
a labelled BNP-SP is produced and an unlabelled antibody binding
protein is used. A biological sample to be tested is then added.
The decrease in counts from the labelled BNP-SP is proportional to
the amount of BNP-SP in the sample.
[0237] In RIA it is also feasible to separate bound BNP-SP from
free BNP-SP. This may involve precipitating the BNP-SP/antibody
complex with a second antibody. For example, if the BNP-SP antibody
complex contains rabbit antibody then donkey anti-rabbit antibody
can be used to precipitate the complex and the amount of label
counted. For example in an LKB, Gammamaster counter. See Hunt et
al..sup.22
[0238] The methods of the invention further comprise measuring the
levels of one or more non-BNP-SP markers of the ACD, cardiac
transplant rejection, or ACD/pulmonary disorder. The level of the
other marker or markers can be compared to mean control levels from
a control population. A deviation in the measured level from the
mean control level is predictive or diagnostic of ACD or cardiac
transplant rejection.
[0239] While the methods of the invention have been described with
respect to a higher level or increase in BNP-SP levels being
indicative of ACD, or cardiac transplant rejection, it is also
possible that in some events or disorders the levels of BNP-SP will
fall. Measuring deviations below a control level are also
contemplated.
[0240] Other markers which are particularly useful herein include
troponin T, troponin I, creatin kinase MB, myoglobin, BNP, NT-BNP
LDH, aspartate aminotransferase, H-FABP, endothelin,
adrenomedullin, rennin and angiotensin II.sup.1. These markers are
all implicated in cardiac dysfunction or disease. Correlating the
level of BNP-SP with other markers can increase the predictive,
diagnostic or monitoring value of BNP-SP. In the case of ACD,
cardiac transplant rejection or ACD/pulmonary disorder combining
BNP-SP marker levels with known cardiac markers can increase the
predictive or diagnostic value of a patient outcome.
[0241] Analysis of a number of peptide markers can be carried out
simultaneously or separately using a single test sample.
Simultaneous, two or multi-site format assays are preferred.
Multiplex bead, microassay or biochip systems are particularly
useful. The beads, assays or chips can have a number of discreet,
often addressable locations, comprising an antibody to one or more
markers including BNP-SP. The one or more markers include more than
one BNP-SP marker. For example, it may be useful to assay for
N-terminal and C-terminal BNP-SP fragments and combine the assay
results. Many other such marker combinations are feasible.
US2005/0064511 provides a description of chips and techniques
useful in the present invention. Luminex provides a multiplex bead
system useful in the present invention.
[0242] Where a subject is to be monitored, a number of biological
samples may be taken over time. Serial sampling allows changes in
marker levels, particular BNP-SP to be measured over time. Sampling
can provide information on the approximate onset time of an event,
the severity of the event, which therapeutic regimes may be
appropriate, response to therapeutic regimes employed, and long
term prognosis. Analysis may be carried out at points of care such
as in ambulances, doctors offices, on clinical presentation, during
hospital stays, in outpatients, or during routine health
screening.
[0243] The methods of the invention may also be performed in
conjunction with an analysis of one or more risk factors such as
but not limited to age, weight, sex and family history of events
such as cardiac events. Test results can also be used in
conjunction with the methods of the invention. For example, ECG
results and clinical examination. A statistically significant
increase in circulating level of BNP-SP, together with one or more
additional risk factors or test results may be used to more
accurately diagnose or prognose the subject's condition.
[0244] The methods herein can also be used as a guide to therapy.
For example what therapies to initiate and when, therapy
monitoring, detection of positive or adverse effects of therapy,
for example heart toxicity of antimitotic drugs, and adjustment of
therapeutic regimes if and when required dependent on results. This
can improve short, medium and long term outcomes for patients. For
a guide to treatments see Troughton et al..sup.8
[0245] Acute Cardiac Disorders
[0246] The applicants have shown that concentrations of the
full-length BNP-SP molecule (1-26) and various fragments thereof
are correlated with acute cardiac disorders. Moreover, BNP-SP
levels are at their highest upon clinical presentation in the case
of patients presenting with suspected acute myocardial infarction
(AMI). Patients presenting with acute cardiac disorders, and in
particular acute cardiac ischemia may or may not experience
subsequent myocardial infarction (MI). The group which does not
experience MI can not be readily diagnosed using current clinical
techniques and markers. For the first time, the applicants have
therefore provided a useful early and specific marker for
myocardial damage associated with MI. This may allow the early
diagnosis of myocardial damage due to adverse events (AEs) and
allow a physician to distinguish such cases from other acute
coronary syndromes as well as from other causes of a chest pain.
For example angina, gastro-intestinal disease, lung/pleural
disorders and the like. This significantly shortens the window of 6
hours to 12 hours currently experienced waiting for elevation of
levels of current cardiac biomarkers such as myoglobin, CK-MB, TnT
and TnI. A more precise diagnosis and treatment can `therefore be
effected` earlier, reducing morbidity and mortality and giving
better prognostic outcomes.
[0247] The invention has particular application in monitoring
reperfusion treatment in cardiac patients. Reperfusion treatment
commonly includes percutaneous coronary intervention (eg
angioplasty) and/or pharmacological treatment. Thrombolytic drugs
for revascularisation are commonly employed in pharmacological
treatment. Adjunctive therapies include anticoagulant and
anti-platelet therapies. Reperfusion treatment is most effective
when employed as soon as possible after diagnosis. BNP-SP testing
to accelerate diagnosis allows prompt introduction of reperfusion
treatment. Effectiveness of treatment can also be monitored by
repeat testing, and therapy adjusted as appropriate. For a
comprehensive discussion of reperfusion treatment see Braunwald et
al herein.sup.1.
[0248] Cardiac Disease
[0249] The methods of the invention can also be used to diagnose or
predict cardiac disease in a subject.
[0250] The applicants have shown that in patients with acute
cardiac disorders the levels of BNP-SP remain elevated for at least
6 weeks after a cardiac event. It is similarly predictable that
patients with cardiac disease or at risk of same will exhibit a
higher level of BNP-SP than mean control levels in a control
population. Unlike BNP, the applicants have shown that levels of
BNP-SP are not affected by the age of the population. This suggests
BNP-SP has broad applications as a marker of cardiac disease.
[0251] Cardiac Transplant Rejection
[0252] The invention also has applications in monitoring heart
transplant, commonly a cardiac allograft transplant, rejection
through regular tissue biopsy during and after transplant using
BNP-SP measurements. An increase in BNP-SP levels measured within
two hours of heart transplant relative to a control level may be
predictive or diagnostic of a rejection episode.
[0253] The present invention also provides an assay for BNP-SP in a
biological sample obtained from a subject within two hours from
onset of, or within two hours of clinical presentation with ACD,
cardiac transplant rejection or ACD/pulmonary disorder, the assay
comprising detecting and measuring the level of BNP-SP in the
sample using any known methods. Preferably, the assay is an in
vitro assay. Such methods include all of the known assay techniques
discussed above as well as gel electrophoresis techniques, Western
blot, gas phase spectroscopy, atomic force microscopy, surface
plasmon resonance, mass spectroscopy but not limited
thereto.sup.23.
[0254] In one embodiment the assay comprises one or more nucleic
acid sequences which bind to one or more of the BNP-SP nucleic acid
sequences of the invention. A large range of sense and antisense
probes and primers can be designed from the nucleic acid sequences
herein. The expression level of the BNP-SP sequence is identified
using known art techniques discussed above. The array can be a
solid substrate e.g., a "chip" as described in U.S. Pat. No.
5,744,305 or a nitrocellulose membrane.
[0255] Proteins expressed by the BNP-SP marker herein may also be
used in assays, and results compared to expression levels of the
same protein expressed in a normal control sample. Protein presence
and quantity may be assessed using assay formats known in the art
and discussed herein.
[0256] The presence of BNP-SP is preferably detected in the sample
by binding BNP-SP to a binding agent such as an antibody of the
invention and measuring the presence of the amount of bound
BNP-SP.
[0257] As noted above, antibodies selective for BNP-SP including
variants and fragments thereof form a further aspect of the
invention and the antibodies may be prepared by the techniques
discussed above. The antibodies are useful in the methods and assay
of the invention.
[0258] In a further aspect, the invention provides a kit for
predicting, diagnosing or monitoring acute cardiac disorder (ACD),
cardiac transplant rejection, or ACD/pulmonary disorder, comprising
a BNP-SP binding agent of the invention, wherein the kit is for use
with a biological sample obtained from a subject within two hours
of onset of, or clinical presentation with ACD, cardiac transplant
rejection, or ACD/pulmonary disorder.
[0259] The invention also provides a kit for predicting, diagnosing
or monitoring an acute cardiac disorder (ACD), cardiac transplant
rejection, or an ACD/pulmonary disorder comprising a binding agent
of the invention, wherein the kit is calibrated to measure BNP-SP
levels in the range of 0.1 to 500 pmol/L, preferably 1 to 400
pmol/L, preferably 10 to 350 pmol/L, preferably 20 to 300 pmol/L,
preferably 25 to 250 pmol/L, preferably 30 to 180 pmol/L,
preferably 35 to 150 pmol/L, preferably 40 to 120 pmol/L.
[0260] Calibration of assays can be effected according to known art
techniques, for example using blood samples with known levels of
BNP-SP, or a set of calibrates with different known levels of
BNP-SP in each. Test strips for use in diagnostic kits are commonly
calibrated during manufacture. See for example U.S. Pat. No.
6,780,645. The kit is useful for measuring the level of BNP-SP in a
biological sample. The detection reagents may be oligonucleotide
sequences complementary to BNP-SP or a fragment of the BNP-SP
marker, or antibodies which bind to the polypeptides encoded by the
marker. The reagents may be bound to a solid matrix as discussed
above or packaged with reagents for binding them to the matrix. The
solid matrix or substrate may be in the form of beads, plates,
tubes, dip sticks, strips or biochips all as discussed above.
[0261] Detection reagents include wash reagents and reagents
capable of detecting bound antibodies (such as labelled secondary
antibodies), or reagents capable of reacting with the labelled
antibody.
[0262] The kit will also conveniently include a control reagent
(positive and/or negative) and/or a means for detecting the nucleic
acid or antibody. Instructions for use may also be included with
the kit, such as taking a biological sample from a subject within
two hours of onset or presentation with ACD, cardiac transplant
rejection or ACD/pulmonary disorder, measuring the level of BNP-SP
in the sample, comparing same to a control level and associating
the result with cardiac status. Generally an increase in the BNP-SP
marker level from a control is indicative of ACD or cardiac
transplant rejection, or ACD as opposed to a pulmonary
disorder.
[0263] Most usually, the kits will be formatted for assays known in
the art, and more usually for PCR, Northern hybridization or
Southern ELISA assays, as are known in the art.
[0264] The kits may also include one or more additional markers for
ACD, transplant rejection, or ACD/pulmonary disorders. In the case
of ACS the additional marker may include one or more of troponin T,
troponin I, creatin kinase MB, myoglobin, BNP, NT-BNP, LDH,
aspartate aminotransferase, H-FABP, endothelin, adrenomedullin,
rennin and ongrotensin II. In one embodiment all of the markers are
included in the kit.
[0265] The kit will be comprised of one or more containers and may
also include collection equipment, for example, bottles, bags (such
as intravenous fluids bags), vials, syringes, and test tubes. At
least one container holds a product which is effective for
predicting, diagnosing, or monitoring ACD (particularly ACS),
transplant rejection, or ACD/pulmonary disorder. The product is
usually a nucleic acid molecule, polypeptide or a binding agent of
the invention, or a composition comprising any of these. In a
preferred embodiment, an instruction or label on, or associated
with, the container indicates that the composition is used for
predicting, diagnosing, or monitoring ACD (particularly ACS),
transplant rejection, or ACD/pulmonary disorders. Other components
may include needles, diluents and buffers. Usefully, the kit may
include at least one container comprising a
pharmaceutically-acceptable buffer, such as phosphate-buffered
saline, Ringer's solution and dextrose solution.
[0266] Binding agents that selectively bind BNP-SP are desirably
included in the kit. Preferably, the binding agent is an antibody.
The antibody used in the assays and kits may be monoclonal or
polyclonal and may be prepared in any mammal as discussed above.
The antibodies are preferably prepared against a native peptide
encoded or indicated by a BNP-SP nucleic acid sequence of the
invention, BNP-SP (1-26), or a synthetic peptide based on same, or
may be raised against an exogenous sequence fused to a nucleic acid
sequence encoding a BNP-SP peptide of the invention.
[0267] In one kit embodiment a BNP-SP detection reagent is
immobilized on a solid matrix such as a porous strip to form at
least one BNP-SP detection site. The measurement or detection
region of the porous strip may include a plurality of detection
sites, such detection sites containing a BNP-SP detection reagent.
The sites may be arranged in a bar, cross or dot or other
arrangement. A test strip may also contain sites for negative
and/or positive controls. The control sites may alternatively be on
a different strip. The different detection sites may contain
different amounts of immobilized nucleic acids or antibodies eg, a
higher amount in the first detection site and lower amounts in
subsequent sites. Upon the addition of a test biological sample the
number of sites displaying a detectable signal provides a
quantitative indication of the amount of BNP-SP present in the
sample.
[0268] Also included in the kit may be a device for sample analysis
comprising a disposable testing cartridge with appropriate
components (markers, antibodies and reagents) to carry out sample
testing. The device will conveniently include a testing zone and
test result window. Immunochromatographic cartridges are examples
of such devices. See for example U.S. Pat. No. 6,399,398; U.S. Pat.
No. 6,235,241 and U.S. Pat. No. 5,504,013.
[0269] Alternatively, the device may be an electronic device which
allows input, storage and evaluation of levels of the measured
marker against control levels and other marker levels. US
2006/0234315 provides examples of such devices.
[0270] In this specification where reference has been made to
patent specifications, other external documents, or other sources
of information, this is generally for the purpose of providing a
context for discussing the features of the invention. Unless
specifically stated otherwise, reference to such external documents
is not to be construed as an admission that such documents; or such
sources of information, in any jurisdiction, are prior art, or form
part of the common general knowledge in the art.
[0271] The invention will now be illustrated in a non-limiting way
be reference to the following examples.
Example 1
Methods
[0272] All human protocols were approved by the Upper South
Regional Ethics Committee of the Ministry of Health, New Zealand
and were performed in accord with the Declaration of Helsinki.
[0273] Chemicals
[0274] Synthetic human BNP signal peptides BNP-SP (1-10),
BNP-SP(17-26) and BNP-SP(1-26) (SEQ ID NO:1) were synthesised by
Mimotopes (Australia). All buffer reagents were purchased from BDH
and/or Sigma. BNP-SP (17-26) was synthesised with the C-terminal
extended with cysteine for directional carrier coupling. BNP-SP
(17-26) was also C-terminally extended with a tyrosyl residue for
tracer preparation on the same peptide.
[0275] Human Studies
[0276] For the healthy volunteer reference range study, blood
samples were obtained from 13 healthy volunteers (6 woman, average
age 43.+-.12 years (range 22-60 years), BMF 24.4.+-.3.9 kg/m.sup.2)
after an overnight fast.
[0277] For analysis of BNP-SP concentrations in acute cardiac
injury, we studied 10 consecutive patients (4 woman, average age
70.+-.8 years (range 59-79 years)), presenting to the Coronary Care
Unit at Christchurch Hospital within 6 h of the onset of chest pain
and clear evidence of ST-elevation acute MI, together with a rise
then fall in plasma troponin T (TnT). Patients with cardiogenic
shock were excluded. Five patients had previously documented
hyperlipidaemia, four had hypertension, one had an earlier MI, one
was being treated for cardiac failure and two had diabetes
mellitus. Medications on admission were diuretics (two patients),
angiotensin-converting enzyme inhibitors (two patients), aspirin
(seven patients), .beta.-blockers (two patients). One patient had
primary percutaneous transluminal coronary angioplasty (PTCA for
anterior MI), nine patients received thrombolysis. Seven patients
had an ECG during the hospital stay. Across all patients, the
average ejection fraction was 54% (range, 24-75%). Average hospital
stay was 6.6 days (range, 3-15 days). The time between the onset of
chest pain and drawing of the baseline (time 0) venous sample was
3.9.+-.0.3 h. An 18-gauge intravenous cannula was inserted into a
forearm vein for blood sampling. Venous samples (10 ml) were drawn
on admission to the Coronary Care Unit (time 0) and thereafter at
0.5, 1, 4, 8, 12, 24 and 72 h as in-patients, and at 1, 6 and 12
weeks as out-patients. Samples were taken into tubes on ice and
centrifuged at +4.degree. C. at 2700 g for 5 min and the plasma
stored at -80.degree. C. until analysed.
[0278] Plasma Extraction
[0279] All plasma samples were extracted on SepPak manufacturer
waters, USA cartridges as previously described.sup.22, dried and
stored at -20.degree. C. prior to RIA and HPLC.
[0280] Hormone Concentration Analysis
[0281] Plasma samples were assayed for TnT, CK-MB and myoglobin
using heterogeneous immunoassays on an Elecsys 2010 using
ruthenium-labelled biotinylated antibodies according to standard
manufacturers' protocols, Roche Diagnostics..sup.18 Immunoreactive
(IR) BNP and N-BNP concentrations were measured using our
previously described assays..sup.6-8 BNP-SP was measured by
specific RIA as follows:
[0282] BNP-SP RIA
[0283] For the measurement of putative human BNP-SP IR peptides, we
generated a novel and specific RIA directed against amino acids
17-26 of the human preproBNP(1-26) signal sequence (SEQ ID
NO:1)
[0284] Antibody Generation
[0285] preproBNPCys.sup.25 (17-26) was coupled to malemide treated
N-e-maleimidocaproyloxy succinimide ester (EMCS) derivatised BSA in
PBS (pH 7.0) by gentle mixing at room temperature. Coupled peptide
was emulsified with Freund's adjuvant and injected subcutaneously
in 2 New Zealand white rabbits over 4-5 sites at monthly intervals.
Rabbits were bled 12 days after injection to assess antibody titres
until adequate levels were achieved. For RIA, BNP-SP IR was
determined using antiserum at a final dilution of 1:6,000. This
antiserum has no detectable cross reactivity with human
proBNP(1-13), proBNP(1-76), proANP(1-30), ANP, BNP, endothelin 1,
Angiotensin II, Angiotensin(1-7), urotensin. II, CNP, proCNP(1-15),
adrenomedullin, urocortin I and urocortin II (all <0.01%).
[0286] Iodination and Assay Method
[0287] preproBNP Tyr.sup.25 (17-26) was iodinated via the
Chloramine T method and purified on reverse phase HPLC as
previously described.sup.22 All samples, standards, radioactive
traces and antiserum solutions were diluted in potassium based
assay buffer..sup.22 The assay incubate consisted of 100 .mu.L
sample or standard (0-640 pmol human preproBNP(17-26) combined with
100 .mu.L antiserum which was vortexed and incubated at 4.degree.
C. for 24 hours. 1004 of trace (4000-5000 cpm) was then added and
further incubated for 24 hours at 4.degree. C. Free and bound
immunoreactivities were finally separated by solid phase second
antibody method (donkey anti-rabbit Sac-Cel) and counted in a
Gammamaster counter (LKB, Uppsala, Sweden).
[0288] High Performance Liquid Chromatography (HPLC)
[0289] Plasma extracts were subjected to size-exclusion HPLC
(SE-HPLC) at room temperature on a TSK-Gel G2000SW peptide column
(Toyosoda, Tokyo, Japan) using isocratic conditions of 60%
acetonitrile/0.1% trifluoroacetic acid (TFA) at a flow rate of
0.25/ml/minute. Fractions were collected at 1 minute intervals and
subjected to BNP-SP RIA. The SE-HPLC column was calibrated using
dextran blue (Vo), cytochrome C (.about.Mr 12,400), rat BNP45
(.about.Mr 5,000), angiotensin II (.about.Mr 1,045) and glycine
(Vt). BNP-SP IR identified by SE-HPLC/RIA were then further
characterised on a Brownlee C.sub.18 reverse phase HPLC(RP-HPLC)
column (Applied Biosystems, CA) with a linear eluting gradient from
12%-48% acetonitrile/0.1% TFA over 40 minutes, at a flow rate 1
ml/minute. One minute fractions were collected, dried under an air
stream and subjected to specific RIA as for SE-HPLC. RP-HPLC was
calibrated using synthetic preproBNP(17-26).
[0290] Statistical Analysis
[0291] All results are presented as mean.+-.SEM. Time-course data
were analysed using two-way ANOVA for repeated measurements
followed by least significant difference post-hoc testing.
Correlation analysis of plasma hormone concentrations was carried
out using a general linear regression model. In all analyses, a
P-value <0.05 was considered significant.
[0292] Results
[0293] To determine if the 26 amino acid SP of BNP, or fragments
derived from it, are present in circulation of humans, we developed
a specific radioimmunoassay (RIA) directed against residues 17-26
of preproBNP(1-26) (BNP-SP, FIG. 2). Dilution of plasma extracts
demonstrate parallelism with the standard curve (FIG. 3) and plasma
concentrations of BNP-SP in healthy humans were 9.6.+-.2.2 pmol/L
(n=13). In healthy humans, concentrations of BNP-SP IR in blood do
not show a significant correlation with age (FIG. 4). However,
while plasma BNP-SP levels are similar to those of its sibling
peptides BNP and N-BNP, they do not correlate with either peptide
(FIG. 5).
[0294] Biochemical analysis of IR plasma BNP-SP by reverse phase
(RP) and size exclusion (SE) high performance liquid chromatography
(HPLC) suggest that our specific RIA detects fragment(s) of BNP-SP
that elute with an approximate Mr 1,000-2,000 on SE-HPLC and close
to the elution time of synthetic BNP-SP on RP-HPLC (FIG. 6).
[0295] Having established that IR BNP-SP peptides are present in
human plasma we then measured serial concentrations of IR BNP-SP in
patients with documented AMI (n=10, FIG. 7). Highest concentrations
of IR BNP-SP were observed at hospital admission and slowly dropped
to stable levels over 6 weeks. Importantly, average peak levels at
admission were 7-fold higher (range 4-12) than levels in normal
healthy volunteers and remained 3-fold higher up to 6 weeks. This
pattern stands in contrast to that of BNP and N-BNP whose peaks
levels do not occur until 24 hours post-admission (FIG. 7). Peak
concentrations of myoglobin occurred 1-2 hours after hospital
admission, whereas peak TnT and CK-MB levels were not attained
until 8-12 hours after admission.
Example 2
[0296] Thirty two patients with clinically stable suspected ACS
were catheterized and blood samples from multiple organ sites:
these were the femoral artery (FA), hepatic vein (HV, inferior vena
cava (IVC), cardiac coronary sinus vein (CS) and pulmonary artery
(PA). Blood was collected into chilled EDTA tubes, prepared from
plasma by centrifugation and the plasma submitted to BNP-SP RIA.
FIG. 9 clearly shows that the highest site of BNP-SP concentration
is the CS, the vein draining the heart, especially the ventricles.
This is strong evidence that the heart is the predominant site of
BNP-SP secretion and is consistent with the known gene expression
pattern of BNP, being highest in the heart.
CONCLUSION
[0297] Circulating BNP-SP concentrations in clinically stable
patients are derived from cardiac sources. The significant cardiac
secretion, is consistent with BNP-SP being a cardiac hormone.
DISCUSSION
[0298] This evidence is the first to document the signal peptide of
preproBNP as being present in the circulation and extracellular
space within two hours of a patient presenting with ACD or within
two hours of the onset of ACD. We show in the first instance that
the measurement of BNP-SP in blood has potential as a rapid
biomarker of acute cardiac ischemia and/or subsequent injury and in
the second instance, that measurement of BNP-SP after the event has
potential merit as a marker of long term prognosis and outcome.
[0299] Those skilled in the art will of course appreciate that the
above description is provided by way of example and that the
invention is not limited thereto.
REFERENCES
[0300] 1. Braunwald E, Zipes D P, Libby P. Acute myocardial
infarction Chp. 35 Heart disease: a textbook of cardiovascular
medicine, 6.sup.th ed. 2001. pgs. 1114-1231. [0301] 2. Richards A
M, Nicholls M G, Yandle T G, Frampton C, Espiner E A, Turner J G,
Buttimore R C, Lainchbury J G, Elliott J M, Ikram H, Crozier I G,
Smyth D W. Plasma N-terminal pro-brain natriuretic peptide and
adrenomedullin: new neurohormonal predictors of left ventricular
function and prognosis after myocardial infarction. Circulation
1998 97:1921-1929. [0302] 3. Jemberg T, Stridsberg M, Venge P,
Lindahl B. N-terminal pro Brain Natriuretic Peptide on admission
for early risk stratification of patients with chest pain and no
ST-segment elevation. J. Am. Coll. Cardiology 2002 40:437-445.
[0303] 4. Omland T, Persson A, Ng L, O'Brien R, Karlsson T, Herlitz
J, Hartford M, Caidahl K. N-terminal pro-B-type natriuretic peptide
and long-term mortality in acute coronary syndromes. Circulation.
2002 106:2913-2918. [0304] 5. Pemberton C J, Johnson M L, Yandle T
G, Espiner E A. Deconvolution Analysis of the Secretion and
Elimination of Cardiac Natriuretic Peptides During Acute Volume
Overload. Hypertension 2000; 36: 355-359. [0305] 6. Richards A M,
Nicholls M G, Troughton R W, Lainchbury 3G, Elliott J, Frampton C,
Espiner E A, Crozier I G, Yandle T G, Turner J. Antecedent
hypertension and heart failure after myocardial infarction. J. Am.
Coll. Cardiology. 2002 39: 1182-1188. [0306] 7. Troughton R W,
Prior D L, Pereira J J, Martin M, Fogarty A, Morehead A, Yandle T
G, Richards A M, Starling R C, Young J B, Thomas J D, Klein A L.
Plasma type natriuretic peptide levels in systolic heart failure:
importance of left ventricular diastolic function and right
ventricular systolic function. J Am Coll Cardiol. 2004 43:416-422.
[0307] 8. Troughton R W, Frampton C M, Yandle T G, Espiner E A,
Nicholls M G, Richards A M. Treatment of heart failure guided by
plasma amino-terminal brain natriuretic peptide (N-BNP)
concentrations. Lancet 2000 355: 1126.1130. [0308] 9. Multiple
Sequence Alignment with the Clustal series of programs Nucleic
Acids Res (2003) 31 (13): 3497-500. [0309] 10. Bowie, J. U. et al.,
(1990). Decipeing the message in Protein Sequences: Tolerance to
Amino Acid Substitutions. Science 247, 1306-1310. [0310] 11.
Harbour and Lane 1998. Antibodies: A Laboratory Manual, Cold Spring
Harbour Press New York..sup.27 [0311] 12. Kohler and Milstein 1975.
continuous Cultures of Fused Cells Secreting Antibody of Predefined
Specficity. Nature, 256, 495-497. [0312] 13. Verhoeyen M. C
Milstein, and G Winter Reshaping human antibodies: [0313] grafting
an antilysozyme activity. Science 1988 Mar. 25; 239(4847):1534-6.
[0314] 14. Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S,
and Winter, G. "Replacing the complementarity-determining regions
in a human antibody with those from a mouse." Nature (1986) 321:
522-525. [0315] 15. Riechmarm L, Clark M, Waldmann H, Winter G.
Reshaping human antibodies for therapy. Nature. 1988 Mar. 24;
332(6162):323-7. [0316] 16. Hoogenboom H R, Winter G (1992) Human
antibodies from synthetic repertoires of germline VH gene segments
rearranged in vitro. J Mol. Biol. 1992 Sep. 20; 227 (2):381-8.
[0317] 17. Michael Neuberger (1996) Generating high-avidity human
Mabs in mice Nature Biotechnology 14, 826 [0318] 18. Tristan J.
Vaughan, Jane K. Osboum & Philip R. Tempest (1998) Human
antibodies by design. Nature Biotechnology 16, 535-539 [0319] 19.
Milstein and Cuello (1983) The co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities, Nature, 305:537-539. [0320] 20. Suresh, M.
R., Cuello, A. C. and Milstein, C. (1986) Bi-specific monoclonal
antibodies from hybrid hybridomas. Methods in Enzymology, 121:
210-228. [0321] 21. Brennan et al., "Preparation of bispecific
antibodies by chemical recombination of monoclonal immunoglobulin
G1 fragments" Science 229:81-83 (1985). [0322] 22. Hunt P J,
Richards A M, Nicholls M G, Yandle T G, Doughty R N, Espiner E A.
Immunoreactive amino terminal pro brain natriuretic peptide
(NT-proBNP): a new marker of cardiac impairment. Clin. Endocrinol.
1997 47:287-296. [0323] 23. The Immunoassay Handbook. 3.sup.rd
edition, ed. David Wild. Elsevier Ltd, 2005. [0324] 24. Solber H.
Approved recommendation (1987) on the theory of reference values.
Part 5. Statistical treatment of collected reference values.
Determination of reference limits. Journal of clinical Chemistry
and Clinical Biochemistry 1987 25:645-656. [0325] 25. Braud V M,
Allan D S, O'Callaghan C A, Soderstrom K, D'Andrea A, Ogg G S,
Lazetic S, Young N T, Bell J I, Phillips J H, Lanier L L, McMichael
A J. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and
C. Nature 1998 391:795-799.
[0326] All references and citations in this list and throughout the
specification including patent specifications are hereby
incorporated in their entirety.
Sequence CWU 1
1
311134PRTHomo sapiens 1Met Asp Pro Gln Thr Ala Pro Ser Arg Ala Leu
Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu Ala Phe Leu Gly Gly Arg
Ser His Pro Leu Gly Ser Pro 20 25 30 Gly Ser Ala Ser Asp Leu Glu
Thr Ser Gly Leu Gln Glu Gln Arg Asn 35 40 45 His Leu Gln Gly Lys
Leu Ser Glu Leu Gln Val Glu Gln Thr Ser Leu 50 55 60 Glu Pro Leu
Gln Glu Ser Pro Arg Pro Thr Gly Val Trp Lys Ser Arg 65 70 75 80 Glu
Val Ala Thr Glu Gly Ile Arg Gly His Arg Lys Met Val Leu Tyr 85 90
95 Thr Leu Arg Ala Pro Arg Ser Pro Lys Met Val Gln Gly Ser Gly Cys
100 105 110 Phe Gly Arg Lys Met Asp Arg Ile Ser Ser Ser Ser Gly Leu
Gly Cys 115 120 125 Lys Val Leu Arg Arg His 130 2708DNAHomo sapiens
2ccccgcaggc tgagggcagg tgggaagcaa acccggacgc atcgcagcag cagcagcagc
60agcagaagca gcagcagcag cctccgcagt ccctccagag acatggatcc ccagacagca
120ccttcccggg cgctcctgct cctgctcttc ttgcatctgg ctttcctggg
aggtcgttcc 180cacccgctgg gcagccccgg ttcagcctcg gacttggaaa
cgtccgggtt acaggagcag 240cgcaaccatt tgcagggcaa actgtcggag
ctgcaggtgg agcagacatc cctggagccc 300ctccaggaga gcccccgtcc
cacaggtgtc tggaagtccc gggaggtagc caccgagggc 360atccgtgggc
accgcaaaat ggtcctctac accctgcggg caccacgaag ccccaagatg
420gtgcaagggt ctggctgctt tgggaggaag atggaccgga tcagctcctc
cagtggcctg 480ggctgcaaag tgctgaggcg gcattaagag gaagtcctgg
ctgcagacac ctgcttctga 540ttccacaagg ggctttttcc tcaaccctgt
ggccgccttt gaagtgactc atttttttaa 600tgtatttatg tatttatttg
attgttttat ataagatggt ttcttacctt tgagcacaaa 660atttccacgg
tgaaataaag tcaacattat aagctttaaa aaaaaaaa 7083121PRTRattus
norvegicus 3Met Asp Leu Gln Lys Val Leu Pro Gln Met Ile Leu Leu Leu
Leu Phe 1 5 10 15 Leu Asn Leu Ser Pro Leu Gly Gly His Ser His Pro
Leu Gly Ser Pro 20 25 30 Ser Gln Ser Pro Glu Gln Ser Thr Met Gln
Lys Leu Leu Glu Leu Ile 35 40 45 Arg Glu Lys Ser Glu Glu Met Ala
Gln Arg Gln Leu Ser Lys Asp Gln 50 55 60 Gly Pro Thr Lys Glu Leu
Leu Lys Arg Val Leu Arg Ser Gln Asp Ser 65 70 75 80 Ala Phe Arg Ile
Gln Glu Arg Leu Arg Asn Ser Lys Met Ala His Ser 85 90 95 Ser Ser
Cys Phe Gly Gln Lys Ile Asp Arg Ile Gly Ala Val Ser Arg 100 105 110
Leu Gly Cys Asp Gly Leu Arg Leu Phe 115 120 4628DNARattus
norvegicus 4gcgagacaag agagagcagg acaccatcgc agctgcctgg cccatcactt
ctgcagcatg 60gatctccaga aggtgctgcc ccagatgatt ctgctcctgc ttttccttaa
tctgtcgccg 120ctgggaggtc actcccatcc cctgggaagt cctagccagt
ctccagaaca atccacgatg 180cagaagctgc tggagctgat aagagaaaag
tcagaggaaa tggctcagag acagctctca 240aaggaccaag gccctacaaa
agaacttcta aaaagagtcc ttaggtctca agacagcgcc 300ttccggatcc
aggagagact tcgaaattcc aagatggcac atagttcaag ctgctttggg
360cagaagatag accggatcgg cgcagtcagt cgcttgggct gtgacgggct
gaggttgttt 420taggaagacc tcctggctgc agactccggc ttctgactct
gcctgcggct cttctttccc 480cagctctggg accacctctc aagtgatcct
gtttatttat ttgtttattt atttattttt 540atgttgctga ttttctacaa
gactgtttct tatcttccag cacaaacttg ccacagtgta 600ataaacatag
cctatttctt gcttttgg 6285129PRTOvis aries 5Met Asp Pro Gln Lys Ala
Leu Ser Arg Thr Leu Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu Ser
Leu Leu Gly Cys Arg Ser His Pro Leu Gly Gly Pro 20 25 30 Gly Ser
Ala Ser Glu Leu Pro Gly Leu Gln Glu Leu Leu Asp Arg Leu 35 40 45
Arg Asp Arg Val Ser Glu Leu Gln Ala Glu Gln Leu Arg Val Glu Pro 50
55 60 Leu Gln Gln Gly Gln Gly Leu Glu Glu Thr Trp Asp Ser Pro Ala
Ala 65 70 75 80 Ala Pro Ala Gly Phe Leu Gly Pro His His Ser Leu Leu
Gln Ala Leu 85 90 95 Arg Gly Pro Lys Met Met Arg Asp Ser Gly Cys
Phe Gly Arg Arg Leu 100 105 110 Asp Arg Ile Gly Ser Leu Ser Gly Leu
Gly Cys Asn Val Leu Arg Arg 115 120 125 Tyr 62125DNAOvis aries
6gcttgtcttt ctggcaacac cggagttgag gagagcaaga actcttgcgt tggtggctca
60gcgtgatcag aaccacggac agcggtcagc gcgcccgagg gaccggcggt ctggcgcagg
120gcagagttgc aggcttgcgc tcttccaggc ggggtgccga gttccaggcg
gggagggaag 180acgcgctgca gtgatggggt gttggctggg gctgttcttt
gtgagtcacc tcgtgcgccc 240ggcatttgcg tcgagtctct gatcgctggg
gttctctctt ctcaattcag gaatgggggt 300ggggaggaaa gaaaaaaatc
cacgctaatg cccccggcgg ttttgcagga aaggaagcag 360agagagagac
gaaaggctat tggtgtctac ccctccctgc ctacgccccc actcccgcac
420cccacccctc caaacccccc cgccccccac cccgggcgcg cgttccagct
cccggtcagg 480cccatttcta tacaaggcct gctctcccca gcctccaccc
cctcggcgcg gagaggtgca 540ttcccccgcc ctgagctcag cgggtcgggc
cggaatgcgg ccgataaatc agagataacc 600cagagaggca gggccggccc
agctcccagg accagggata aaaggcctct gttgcccaag 660gatccgggag
agcgcccacc gggcactaga aggtgagacg tgaggcgcaa cccagcgaag
720cagccgcggc cgcaacccag gaccagggat aaaaggcctc tgttgcccaa
ggatccggga 780gagcgcccac cgggcactag aaggtgagac gtgaggcgca
acccagcgaa gcagccgcgg 840ccgcaacctc catccgctcc gccagcgaca
tggaccccca gaaggcgctg tcccgaacgc 900tcctgcttct cctcttcttg
cacctgtcgc tgctaggatg tcgttcccac ccgctgggtg 960gccccggctc
ggcttcggaa ctgcctgggt tacaggtgag cgctgctgaa ctgcgtaaac
1020ccggttcgcc aagagggcgc ggacagcagc agttagcggg tccccatccc
ccgaccctcc 1080actcacatcc caagaggtcc ccaccctccc ttgggaatta
gtgataccag aatcagaaag 1140ggaattagaa catggagaga ctgggtgcgg
gaagccggta cccagcgcgg ttggatcgct 1200ttgccgccgt cgagggtggc
tgggcccaag gtgcgggttt ctgaagatgc ggctccccta 1260ccgtgcattg
caggagctgt tggaccgtct acgagacagg gtctcggagc tgcaggcgga
1320gcagctgcgc gtggagcccc tccagcaggg ccagggcctg gaagaaacct
gggactcccc 1380ggcggcagcc cccgcggggt tccttgggcc ccaccacagc
ctcctccagg ccctgcgggg 1440ccccaagatg atgcgcgact cgggctgctt
tggacggagg ctggaccgga tcggctccct 1500cagtggcctg ggctgcaacg
gtgagcgcct atccgcattc ccactgcaca tcaccattag 1560agccacttct
gggtccgatg tctcagggga ccaaattttg aacaaagaac atcactcttc
1620tttgctggca gtcctcaggg ccaaggcatg cctctctggg aatattaaat
ttggacaaca 1680ttcattatca tgtctgggag ccccttctat ccacctcctg
cctctgactg aaaggggcag 1740aatctttagg atgtaattca gtcactgttc
agcaggccct ccttggagca aaaagaatag 1800ttaacatttt tcctcctggt
ttcccctgaa ctgtctaaag ctgcaaaggc agaggggggg 1860gtcaccaggg
ggatggtaat ccctggttta caaggaggat ggggaggtcc ggggagatgg
1920gttattccaa agccccaaac atgcagatga actgaagagg ggggtggcag
gggtggcaca 1980gggtgaggga aagctcagat ccttcctgtc tcccacccca
aagtcatcat caccctctct 2040tttcccccca cagtgctgag gaggtactaa
gaggaggtcc tggctgcaga tatggctgca 2100tctgattctc catcaactcc tgatc
21257131PRTSus scrofa 7Met Gly Pro Arg Met Ala Leu Pro Arg Val Leu
Leu Leu Leu Phe Leu 1 5 10 15 His Leu Leu Leu Leu Gly Cys Arg Ser
Tyr Pro Leu Gly Gly Ala Gly 20 25 30 Leu Ala Ser Glu Leu Pro Gly
Ile Gln Glu Leu Leu Asp Arg Leu Arg 35 40 45 Asp Arg Val Ser Glu
Leu Gln Ala Glu Arg Thr Asp Leu Glu Pro Leu 50 55 60 Arg Gln Asp
Arg Gly Leu Thr Glu Ala Trp Glu Ala Arg Glu Ala Ala 65 70 75 80 Pro
Thr Gly Val Leu Gly Pro Arg Ser Ser Ile Phe Gln Val Leu Arg 85 90
95 Gly Ile Arg Ser Pro Lys Thr Met Arg Asp Ser Gly Cys Phe Gly Arg
100 105 110 Arg Leu Asp Arg Ile Gly Ser Leu Ser Gly Leu Gly Cys Asn
Val Leu 115 120 125 Arg Arg Tyr 130 8670DNASus scrofa 8caggctgcta
ggaagtgaaa agtgaacctg gacccagctc agcggcagca gcagcggcag 60caggcagcag
cctctatcct ctcctccagc cacatgggcc cccggatggc gcttccccgc
120gtgctcctgc tcctgttctt gcacctgttg ctgctaggat gccgttccta
tccactgggt 180ggcgctggcc tggcctcaga actgccaggg atacaggagc
tgctggaccg cctgcgagac 240agggtctccg agctgcaggc ggagcggacg
gacctggagc ccctccggca ggaccgtggc 300ctcacagaag cctgggaggc
gagggaagca gcccccacgg gggttcttgg gccccgcagt 360agcatcttcc
aagtcctccg gggaatacgc agccccaaga cgatgcgtga ctctggctgc
420tttgggcgga ggctggaccg gatcggctcc ctcagcggcc tgggctgcaa
tgtgctcagg 480aggtactgag aagtcctggc tgacaacctc tgtgtccgct
tctccaacgc ccctcccctg 540ctccccttca aagcaactcc tgtttttatt
tatgtattta tttatttatt tatttggtgg 600ttgtatataa gacggttctt
atttgtgagc acattttttc catggtgaaa taaagtcaac 660attagagctc
6709121PRTMus musculus 9Met Asp Leu Leu Lys Val Leu Ser Gln Met Ile
Leu Phe Leu Leu Phe 1 5 10 15 Leu Tyr Leu Ser Pro Leu Gly Gly His
Ser Tyr Pro Leu Gly Ser Pro 20 25 30 Ser Gln Ser Pro Glu Gln Phe
Lys Met Gln Lys Leu Leu Glu Leu Ile 35 40 45 Arg Glu Lys Ser Glu
Glu Met Ala Gln Arg Gln Leu Leu Lys Asp Gln 50 55 60 Gly Leu Thr
Lys Glu His Pro Lys Arg Val Leu Arg Ser Gln Gly Ser 65 70 75 80 Thr
Leu Arg Val Gln Gln Arg Pro Gln Asn Ser Lys Val Thr His Ile 85 90
95 Ser Ser Cys Phe Gly His Lys Ile Asp Arg Ile Gly Ser Val Ser Arg
100 105 110 Leu Gly Cys Asn Ala Leu Lys Leu Leu 115 120 10667DNAMus
musculus 10cgaccaccag tgcacaagct gcttggggag gcgagacaag ggagaacacg
gcatcattgc 60ctggcccatc gcttctgcgg catggatctc ctgaaggtgc tgtcccagat
gattctgttt 120ctgcttttcc tttatctgtc accgctggga ggtcactcct
atcctctggg aagtcctagc 180cagtctccag agcaattcaa gatgcagaag
ctgctggagc tgataagaga aaagtcggag 240gaaatggccc agagacagct
cttgaaggac caaggcctca caaaagaaca cccaaaaaga 300gtccttcggt
ctcaaggcag caccctccgg gtccagcaga gacctcaaaa ttccaaggtg
360acacatatct caagctgctt tgggcacaag atagaccgga tcggatccgt
cagtcgtttg 420ggctgtaacg cactgaagtt gttgtaggaa gacctcctgg
ctgcaggaga ctccagtttc 480tgactctgcc tgggtctctt tccccagctc
tgggaccacc tttgaagtga tcctatttat 540ttatttattt atatttattt
ttatttttat tttttaattt attttgttgt ttttctacaa 600gactgtttct
tatcttggag cacaaacttg ccacaacata ataaacatag cgtatttcct 660gcttttg
66711140PRTCanis familiaris 11Met Glu Pro Cys Ala Ala Leu Pro Arg
Ala Leu Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu Ser Pro Leu Gly
Gly Arg Pro His Pro Leu Gly Gly Arg 20 25 30 Ser Pro Ala Ser Glu
Ala Ser Glu Ala Ser Glu Ala Ser Gly Leu Trp 35 40 45 Ala Val Gln
Glu Leu Leu Gly Arg Leu Lys Asp Ala Val Ser Glu Leu 50 55 60 Gln
Ala Glu Gln Leu Ala Leu Glu Pro Leu His Arg Ser His Ser Pro 65 70
75 80 Ala Glu Ala Pro Glu Ala Gly Gly Thr Pro Arg Gly Val Leu Ala
Pro 85 90 95 His Asp Ser Val Leu Gln Ala Leu Arg Arg Leu Arg Ser
Pro Lys Met 100 105 110 Met His Lys Ser Gly Cys Phe Gly Arg Arg Leu
Asp Arg Ile Gly Ser 115 120 125 Leu Ser Gly Leu Gly Cys Asn Val Leu
Arg Lys Tyr 130 135 140 12132PRTFelis catus 12Met Asp Pro Lys Thr
Ala Leu Leu Arg Ala Leu Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu
Ser Pro Leu Gly Gly Arg Ser His Pro Leu Gly Gly Pro 20 25 30 Gly
Pro Ala Ser Glu Ala Ser Ala Ile Gln Glu Leu Leu Asp Gly Leu 35 40
45 Arg Asp Thr Val Ser Glu Leu Gln Glu Ala Gln Met Ala Leu Gly Pro
50 55 60 Leu Gln Gln Gly His Ser Pro Ala Glu Ser Trp Glu Ala Gln
Glu Glu 65 70 75 80 Pro Pro Ala Arg Val Leu Ala Pro His Asp Asn Val
Leu Arg Ala Leu 85 90 95 Arg Arg Leu Gly Ser Ser Lys Met Met Arg
Asp Ser Arg Cys Phe Gly 100 105 110 Arg Arg Leu Asp Arg Ile Gly Ser
Leu Ser Gly Leu Gly Cys Asn Val 115 120 125 Leu Arg Arg His 130
1310PRTHomo sapiens 13Met Asp Pro Gln Thr Ala Pro Ser Arg Ala 1 5
10 1430DNAHomo sapiens 14ccccgcaggc tgagggcagg tgggaagcaa
301517PRTHomo sapiens 15Met Asp Pro Gln Thr Ala Pro Ser Arg Ala Leu
Leu Leu Leu Leu Phe 1 5 10 15 Leu 1651DNAHomo sapiens 16ccccgcaggc
tgagggcagg tgggaagcaa acccggacgc atcgcagcag c 511712PRTHomo sapiens
17Leu Leu Leu Leu Phe Leu His Leu Ala Phe Leu Gly 1 5 10
1836DNAHomo sapiens 18cggacgcatc gcagcagcag cagcagcagc agaagc
361910PRTHomo sapiens 19Leu His Leu Ala Phe Leu Gly Gly Arg Ser 1 5
10 2030DNAHomo sapiens 20agcagcagca gcagcagaag cagcagcagc
302126PRTHomo sapiens 21Met Asp Pro Gln Thr Ala Pro Ser Arg Ala Leu
Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu Ala Phe Leu Gly Gly Arg
Ser 20 25 2278DNAHomo sapiens 22ccccgcaggc tgagggcagg tgggaagcaa
acccggacgc atcgcagcag cagcagcagc 60agcagaagca gcagcagc
782313PRTHomo sapiens 23Pro Gln Thr Ala Pro Ser Arg Ala Leu Leu Leu
Leu Leu 1 5 10 2439DNAHomo sapiens 24aggctgaggg caggtgggaa
gcaaacccgg acgcatcgc 392530DNAHomo sapiens 25ccagtgcaca agctgcttgg
ggaggcgaga 302626PRTFelis catus 26Met Asp Pro Lys Thr Ala Leu Leu
Arg Ala Leu Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu Ser Pro Leu
Gly Gly Arg Ser 20 25 2726PRTOvis aries 27Met Asp Pro Gln Lys Ala
Leu Ser Arg Thr Leu Leu Leu Leu Leu Phe 1 5 10 15 Leu His Leu Ser
Leu Leu Gly Cys Arg Ser 20 25 2825PRTSus scrofa 28Met Gly Pro Arg
Met Ala Leu Pro Arg Val Leu Leu Leu Leu Phe Leu 1 5 10 15 His Leu
Leu Leu Leu Gly Cys Arg Ser 20 25 2926PRTCanis familiaris 29Met Glu
Pro Cys Ala Ala Leu Pro Arg Ala Leu Leu Leu Leu Leu Phe 1 5 10 15
Leu His Leu Ser Pro Leu Gly Gly Arg Pro 20 25 3026PRTRattus
norvegicus 30Met Asp Leu Gln Lys Val Leu Pro Gln Met Ile Leu Leu
Leu Leu Phe 1 5 10 15 Leu Asn Leu Ser Pro Leu Gly Gly His Ser 20 25
3126PRTMus musculus 31Met Asp Leu Leu Lys Val Leu Ser Gln Met Ile
Leu Phe Leu Leu Phe 1 5 10 15 Leu Tyr Leu Ser Pro Leu Gly Gly His
Ser 20 25
* * * * *
References