U.S. patent application number 13/373118 was filed with the patent office on 2013-07-11 for modified factor ix polypeptides and uses thereof.
The applicant listed for this patent is Grant Ellsworth Blouse, Edwin L. Madison, Christopher Thanos. Invention is credited to Grant Ellsworth Blouse, Edwin L. Madison, Christopher Thanos.
Application Number | 20130177541 13/373118 |
Document ID | / |
Family ID | 44936595 |
Filed Date | 2013-07-11 |
United States Patent
Application |
20130177541 |
Kind Code |
A9 |
Madison; Edwin L. ; et
al. |
July 11, 2013 |
Modified factor IX polypeptides and uses thereof
Abstract
Modified Factor IX (FIX) polypeptides and uses thereof are
provided. Such modified FIX polypeptides include FIXa and other
forms of FIX. Among the modified FIX polypeptides provided are
those that have altered activities, typically altered procoagulant
activity, including increased procoagulant activities. Hence, such
modified polypeptides are therapeutics.
Inventors: |
Madison; Edwin L.; (San
Francisco, CA) ; Thanos; Christopher; (San Francisco,
CA) ; Blouse; Grant Ellsworth; (Copenhagen S,
DK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Madison; Edwin L.
Thanos; Christopher
Blouse; Grant Ellsworth |
San Francisco
San Francisco
Copenhagen S |
CA
CA |
US
US
DK |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20120308540 A1 |
December 6, 2012 |
|
|
Family ID: |
44936595 |
Appl. No.: |
13/373118 |
Filed: |
November 3, 2011 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61456298 |
Nov 3, 2010 |
|
|
|
Current U.S.
Class: |
424/93.72 ;
424/93.73; 424/94.64; 435/188; 435/226; 435/320.1; 435/325;
435/352; 435/358; 536/23.2 |
Current CPC
Class: |
A61K 38/4846 20130101;
A61K 48/00 20130101; C12N 9/644 20130101; A61P 7/04 20180101; C12Y
304/21022 20130101 |
Class at
Publication: |
424/93.72 ;
435/226; 435/188; 536/23.2; 435/320.1; 435/325; 435/352; 435/358;
424/94.64; 424/93.73 |
International
Class: |
C12N 9/64 20060101
C12N009/64; C12N 15/57 20060101 C12N015/57; C12N 15/63 20060101
C12N015/63; A61K 35/18 20060101 A61K035/18; C12N 5/10 20060101
C12N005/10; A61K 38/48 20060101 A61K038/48; A61P 7/04 20060101
A61P007/04; A61K 35/14 20060101 A61K035/14; C12N 9/96 20060101
C12N009/96; C12N 15/79 20060101 C12N015/79 |
Claims
1. A modified FIX polypeptide, comprising an amino acid replacement
in an unmodified FIX polypeptide, wherein the amino acid
replacement is selected from among replacement of tyrosine (Y) at
amino acid residue R318 (R318Y), R318E, R318F, R318W, R318D, R318I,
R318K, R318L, R318M, R318S, R318V, S61A, S61C, S61D, S61E, S61F,
S61G, S61I, S61K, S61L, S61P, S61R, S61V, S61W, S61Y, D64A, D64C,
D64F, D64H, D64I, D64L, D64M, D64P, D64R, D64S, D64T, D64W, Y155F,
Y155L, N157D, N157E, N157F, N157I, N157K, N157L, N157M, N157R,
N157V, N157W, N157Y, S158A, S158D, S158E, S158F, S158G, S158I,
S158K, S158L, S158M, S158R, S158V, S158W, S158Y, N167D, N167Q,
N167E, N167F, N167G, N167H, N167I, N167K, N167L, N167M, N167P,
N167R, N167V, N167W, N167Y, T169A, T169D, T169E, T169F, T169G,
T169I, T169K, T169L, T169M, T169P, T169R, T169S, T169V, T169W,
T169Y, T172A, T172D, T172E, T172F, T172G, T172I, T172K, T172L,
T172M, T172P, T172R, T172S, T172V, T172W, T172Y, D203M, D203Y,
D203F, D203H, D203I, D203K, D203L, D203R, D203V, D203W, A204M,
A204Y, A204F, A204I, A204W, E239S, E239R, E239K, E239D, E239F,
E239I, E239L, E239M, E239T, E239V, E239W, E239Y, H257F, H257E,
H257D, H257I, H257K, H257L, H257M, H257Q, H257R, H257V, H257W,
R312Y, R312L, R312C, R312D, R312E, R312F, R312I, R312K, R312M,
R312P, R312S, R312T, R312V, R312W, K316M, K316D, K316F, K316H,
K316I, K316L, K316R, K316V, K316W, K316Y, F342I, F342D, F342E,
F342K, F342L, F342M, F342S, F342T, F342V, F342W, F342Y, T343R,
T343E, T343D, T343F, T343I, T343K, T343L, T343M, T343S, T343V,
T343W, T343Y, N346Y, N346E, N346F, N346H, N346I, N346K, N346L,
N346M, N346Q, N346R, N346V, N346W, K400E, K400C, K400D, K400F,
K400G, K400L, K400M, K400P, K400S, K400T, K400V, K400Y, R403D,
R403F, R403I, R403K, R403L, R403M, R403S, R403V, R403Y, E410D,
E410S, E410A, E410F, E410G, E410I, E410K, E410L, E410M, E410P,
E410R, E410T, E410V, E410W, E410Y, T412A, T412V, T412C, T412D,
T412E, T412F, T412G, T412I, T412M, T412P, T412W and T412Y in a
mature FIX polypeptide having a sequence set forth in SEQ ID NO:3,
or the same replacement at a corresponding amino acid residue in an
unmodified FIX polypeptide, wherein corresponding amino acid
residues are identified by alignment of the unmodified FIX
polypeptide with the polypeptide of SEQ ID NO:3; and provided that
the modified FIX polypeptide does not contain the modifications
F342I/T343R/Y345T.
2. The modified FIX polypeptide of claim 1, comprising an amino
acid replacement selected from among amino acid replacements R318Y,
R318E, R318F, R318W, S61A, D64A, Y155F, Y155L, N157D, S158A, S158D,
S158E, N167D, N167Q, T169A, T172A, D203M, D203Y, A204M, A204Y,
E239S, E239R, E239K, H257F, H257E, R312Y, R312L, K316M, F342I,
T343R, T343E, T343D, N346Y, K400E, R403D, E410D, E410S, E410A,
T412A and T412V, or the same replacement at a corresponding amino
acid residue in an unmodified FIX polypeptide.
3. The modified FIX polypeptide of claim 1, wherein the FIX
polypeptide comprises: an amino acid replacement at R318 or at a
residue corresponding to 318, wherein the amino acid replacement is
selected from among Y, E, F and W; an amino acid replacement T343R,
T343E or T343D or the same replacement at a corresponding amino
acid residue in an unmodified FIX polypeptide; and/or an amino acid
replacement at amino acid position Y155 or at a residue
corresponding to 155 that is selected from F or L.
4. The modified FIX polypeptide of claim 3 that comprises an amino
acid replacement R318Y.
5. The modified FIX polypeptide of 4, comprising: an amino acid
replacement at R338 or at a residue corresponding to 338 in an
unmodified FIX polypeptide; an amino acid replacement at T343 or at
an amino acid residue corresponding to amino acid residue T343 in
an unmodified FIX polypeptide; and/or an amino acid replacement at
E410 or at an amino acid residue corresponding to amino acid
residue E410 in an unmodified FIX polypeptide; and/or an amino acid
replacement at an amino acid residue selected from among D203, F205
and K228, or at an amino acid residue corresponding to amino acid
residue D203, F205 or K228 in an unmodified FIX polypeptide.
6. The modified FIX polypeptide of claim 5, comprising an amino
acid replacement R338D or R338E or the same replacement at a
corresponding amino acid residue in an unmodified FIX
polypeptide.
7. The modified FIX polypeptide of claim 6, comprising the amino
acid replacements R318Y/R338E or the same replacements at
corresponding amino acid residues in an unmodified FIX
polypeptide.
8. The modified FIX polypeptide of claim 5 that comprises an amino
acid replacement T343R.
9. The modified FIX polypeptide of claim 8, comprising the amino
acid replacements R318Y/T343R or the same replacements at
corresponding amino acid residues in an unmodified FIX
polypeptide.
10. The modified FIX polypeptide of claim 5, comprising an amino
acid replacement at residue E410 or at an amino acid residue
corresponding to 410 in an unmodified FIX polypeptide that is N or
S.
11. The modified FIX polypeptide of claim 10, comprising amino acid
replacements R318Y/E410N or the same replacements at corresponding
amino acid residues in an unmodified FIX polypeptide.
12. The modified FIX polypeptide of claim 4, comprising an amino
acid replacement R318Y and an amino acid replacement at an amino
acid residue selected from among residues 338, 343, 403 and 410 of
a mature FIX polypeptide having a sequence set forth in SEQ ID NO:3
or at amino acid residues corresponding to residues 338, 343, 403
or 410 in an unmodified FIX polypeptide.
13. The modified FIX polypeptide of claim 12, comprising an amino
acid replacement selected from among R338E, T343R, R403E and E410N
in a mature FIX polypeptide having a sequence set forth in SEQ ID
NO:3 or the same replacements at corresponding amino acid residues
in an unmodified FIX polypeptide.
14. The modified FIX polypeptide of claim 13 that comprises amino
acid replacements selected from among replacements
R318Y/R338E/R403E/E410N, R318Y/R338E/T343R/R403E/E410N,
R318Y/R338E/T343R/E410N, Y155F/R318Y/R338E/T343R/R403E,
Y155F/K228N/K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/T343R/R403E,
K247N/N249S/R318Y/R338E/T343R/R403E, R318Y/R338E/T343R,
Y155F/K247N/N249S/R318Y/R338E/T343R,
K228N/R318Y/R338E/T343R/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/T343R/R403E,
R318Y/R338E/T343R/R403E/E410S, Y155F/K247N/N249S/R318Y/R338E,
K247N/N249S/R318Y/R338E/T343R, R318Y/T343R/E410N,
Y155F/R318Y/R338E/R403E, R318Y/R338E/R403E, R318Y/R338E/E410N,
K228N/R318Y/E410N, R318Y/R403E/E410N, D203N/F205T/R318Y/E410N,
A103N/N105S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/R338E/R403E/E410N, K228N/R318Y/R338E/R403E/E410N,
I251S/R318Y/R338E/R403E/E410N,
D104N/K106S/I251S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/R338E/E410N, I251S/R318Y/E410N/R338E,
D104N/K106S/I251S/R318Y/R338E/E410N,
A103N/N105S/K247N/N249S/R318Y/R338E/R403E/E410N,
D104N/K106S/K247N/N249S/R318Y/R338E/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/R403E/E410N,
A103N/N105S/Y155F/R318Y/R338E/R403E/E410N,
D104N/K106S/Y155F/R318Y/R338E/R403E/E410N,
Y155F/K228N/R318Y/R338E/R403E/E410N,
Y155F/I251S/R318Y/R338E/R403E/E410N,
K247N/N249S/R318Y/R338E/R403E/E410N, Y155F/R318Y/R338E/R403E/E410N,
K247N/N249S/R318Y/R338E/E410N, Y155F/R318Y/R338E/E410N,
Y155F/K247N/N249S/R318Y/R338E/E410N, R318Y/R338E/R403E/E410S,
R318Y/R338E/R403E/E410N/T412V, R318Y/R338E/R403E/E410N/T412A,
R318Y/R338E/R403E/T412A, R318Y/R338E/E410S, R318Y/R338E/T412A,
R318Y/R338E/E410N/T412V, D85N/K228N/R318Y/R338E/R403E/E410N, N260
S/R318Y/R338E/R403E/E410N, R318Y/R338E/N346D/R403E/E410N,
Y155F/R318Y/R338E/N346D/R403E/E410N,
K247N/N249S/N260S/R318Y/R338E/R403E/E410N,
D104N/K106S/N260S/R318Y/R338E/R403E/E410N,
Y155F/N260S/R318Y/R338E/R403E/E410N,
Y155F/R318Y/R338E/T343R/R403E/E410N,
D104N/K106S/Y155F/K247N/N249S/R318Y/R338E/R403E/E410N,
D104N/K106S/K228N/K247N/N249S/R318Y/R338E/R403E/E410N,
Y155F/K228N/K247N/N249S/R318Y/R338E/R403E/E410N,
Y155F/K247N/N249S/N260S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/R338E/T343R/R403E/E410N,
R318Y/R338E/N346Y/R403E/E410N, R318Y/R338E/T343R/N346Y/R403E/E410N,
R318Y/R338E/T343R/N346D/R403E/E410N, R318Y/R338E/Y345A/R403E/E410N,
K228N/I251S/R318Y/R338E/R403E/E410N,
R318Y/R338E/Y345A/N346D/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/R403E, K247N/N249S/R318Y/R338E/R403E,
Y155F/K247N/N249S/R318Y/R403E/E410N, K247N/N249S/R318Y/R403E/E410N,
R318Y/R338E/T343R/R403E, Y155F/R318Y/R338E/T343R/E410N,
R318Y/T343R/R403E/E410N, Y155F/R318Y/T343R/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
Y155F/K228N/I251S/R318Y/R338E/R403E/E410N,
N260S/R318Y/R338E/T343R/R403E/E410N,
Y155F/N260S/R318Y/R338E/T343R/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
Y155F/K247N/N249S/R318Y/R403E, Y155F/K247N/N249S/R318Y/E410N,
K247N/N249S/R318Y/R338E/T343R/E410N,
Y155F/K247N/N249S/R318Y/R338E/T343R/E410N,
Y155F/K247N/N249S/R318Y/T343R/R403E/E410N,
K247N/N249S/R318Y/T343R/R403E/E410N,
Y155F/K247N/N249S/R318Y/T343R/R403E, K247N/N249S/R318Y/T343R/R403E,
Y155F/K247N/N249S/R318Y/T343R/E410N, K247N/N249S/R318Y/T343R/E410N,
Y155F/R318Y/R338E/T343R, Y155F/R318Y/T343R/R403E,
Y155F/R318Y/T343R/E410N, K228N/K247N/N249S/R318Y/R338E/T343R/E410N,
Y155F/K247N/N249S/R318Y/T343R,
Y155F/K247N/N249S/R318Y/R338E/R403E/E410N,
K228N/K247N/N249S/R318Y/T343R/R403E/E410N and
Y155F/R318Y/R403E/E410N, or the same replacements at corresponding
amino acid residues in an unmodified FIX polypeptide.
15. The modified FIX polypeptide of claim 14, comprising an amino
acid replacement R318Y/R338E/R403E/E410N,
R318Y/R338E/T343R/R403E/E410N, R318Y/R338E/T343R/E410N,
Y155F/R318Y/R338E/T343R/R403E,
Y155F/K228N/K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/T343R/R403E,
K247N/N249S/R318Y/R338E/T343R/R403E, R318Y/R338E/T343R,
Y155F/K247N/N249S/R318Y/R338E/T343R,
K228N/R318Y/R338E/T343R/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/T343R/R403E,
R318Y/R338E/T343R/R403E/E410S, Y155F/K247N/N249S/R318Y/R338E,
K247N/N249S/R318Y/R338E/T343R, R318Y/T343R/E410N or
Y155F/R318Y/R338E/R403E.
16. The modified FIX polypeptide of claim 14, comprising amino acid
replacements R318Y/R338E/R403E/E410N, R318Y/R338E/T343R/R403E/E410N
or R318Y/R338E/T343R/E410N.
17. The modified FIX polypeptide of claim 5, comprising the amino
acid replacement D203N/F205T/R318Y or K228N/R318Y, or the same
replacements at a corresponding amino acid residue in an unmodified
FIX polypeptide.
18. The modified FIX polypeptide of claim 3, comprising the amino
acid replacement Y155F or the same replacement at a corresponding
amino acid residue in an unmodified FIX polypeptide.
19. The modified FIX polypeptide of claim 18, comprising: an amino
acid replacement at residue 103, 104, 105, 106, 228, 251, 260 or
346 of a mature FIX polypeptide having a sequence set forth in SEQ
ID NO:3, or at an amino acid residue corresponding to 103, 104,
105, 106, 228, 251, 260 or 346 in an unmodified FIX polypeptide;
and/or an amino acid replacement at a residue selected from among
338, 403 and 410 of a mature FIX polypeptide having a sequence set
forth in SEQ ID NO:3, or at an amino acid residue corresponding to
338, 403 or 410 in an unmodified FIX polypeptide.
20. The modified FIX polypeptide of claim 19, comprising an amino
acid replacement selected from among A103N, D104N, N105S, K106S,
K228N, I251S, N260S and N346D, or the same replacement at a
corresponding amino acid residue in an unmodified FIX
polypeptide.
21. The modified FIX polypeptide of claim 20, comprising amino acid
replacements selected from among Y155F/K228N, Y155F/I251S,
D104N/K106S/Y155F/K228N, Y155F/N346D, Y155F/N260S,
Y155F/N260S/N346D, D104N/K106S/Y155F/N260S,
D104N/K106S/Y155F/K228N, A103N/N105S/Y155F and D104N/K106S/Y155F,
or the same replacements at corresponding amino acid residues in an
unmodified FIX polypeptide.
22. The modified FIX polypeptide of claim 19, comprising an amino
acid replacement selected from among R338E, R403E and E410N, or the
same replacement at a corresponding amino acid residue in an
unmodified FIX polypeptide.
23. The modified FIX polypeptide of claim 22, comprising amino acid
replacements selected from among Y155F/R338E/T343R/R403E/E410N,
Y155F/R338E/T343R/R403E, Y155F/R338E/T343R/R403E/E410S,
Y155F/N260S/R338E/T343R/R403E, Y155F/T343R/R403E/E410N,
Y155F/R338E/T343R/E410N and Y155F/R338E/R403E/E410N.
24. The modified FIX polypeptide of claim 18, comprising the amino
acid replacement Y155F and amino acid replacements at amino acid
positions 247 and/or 249 of a mature FIX polypeptide having a
sequence set forth in SEQ ID NO:3.
25. The modified FIX polypeptide of claim 24, comprising the amino
acid replacement Y155F/K247N/N249S.
26. The modified FIX polypeptide of claim 25, comprising amino acid
replacements Y155F/K247N/N249S/R338E/R403E/E410N,
D104N/K106S/Y155F/K228N/K247N/N249S, D104N/K106S/Y155F/K247N/N249S,
Y155F/K228N/K247N/N249S, Y155F/K247N/N249S/N260S,
D104N/K106S/Y155F/K247N/N249S/N260S, D104N/K106S/Y155F/K247N/N249S,
Y155F/K247N/N249S/T343R/R403E,
Y155F/K247N/N249S/R338E/T343R/R403E/E410N,
Y155F/K247N/N249S/R338E/R403E, Y155F/K247N/N249S/R338E/T343R,
Y155F/K247N/N249S/R338E/E410N, Y155F/K247N/N249S/R338E/T343R/R403E,
Y155F/K247N/N249S/R338E/T343R/E410N,
Y155F/K247N/N249S/T343R/R403E/E410N, Y155F/K247N/N249S/T343R/E410N
and Y155F/K247N/N249S/R403E/E410N, or the same replacements at
corresponding amino acid residues in an unmodified FIX
polypeptide.
27. The modified FIX polypeptide of claim 26, comprising amino acid
replacements Y155F/K247N/N249S/R338E/R403E/E410N.
28. The modified FIX polypeptide of claim 3, comprising an amino
acid replacement T343R or the same replacement at a corresponding
amino acid residue in an unmodified FIX polypeptide.
29. The modified FIX polypeptide of 28, comprising: an amino acid
replacement at an amino acid residue selected from among R338, Y345
and N346, or at the corresponding amino acid residue in an
unmodified FIX polypeptide; and/or an amino acid replacement at an
amino acid residue selected from among K247, N249, R403 and E410,
or at an amino acid residue corresponding to amino acid residue
K247, N249, R403 or E410 in an unmodified FIX polypeptide.
30. The modified FIX polypeptide of claim 29, comprising an amino
acid replacement R338E, Y345T, N346Y or N346D, or the same
replacement at a corresponding amino acid residue in an unmodified
FIX polypeptide.
31. The modified FIX polypeptide of claim 30, comprising amino acid
replacements T343R/Y345T, T343R/N346D, T343R/N346Y or R338E/T343R,
or the same replacements at a corresponding amino acid residue in
an unmodified FIX polypeptide.
32. The modified FIX polypeptide of claim 31, comprising amino acid
replacements K247N/N249S/R338E/T343R/R403E/E410N,
R338E/T343R/E410N, Y155F/I251S/R338E/T343R/R403E,
R338E/T343R/R403E/E410N, R338E/T343R/R403E,
K247N/N249S/R338E/T343R/R403E or K247N/N249S/R338E/T343R/E410N.
33. The modified FIX polypeptide of claim 32, comprising amino acid
replacements K247N/N249S/R338E/T343R/R403E/E410N, R338E/T343R/E410N
or Y155F/I251S/R338E/T343R/R403E.
34. The modified FIX polypeptide of claim 30, comprising an amino
acid replacement selected from among K247N, N249S, R403E and E410N
or the same replacement at a corresponding amino acid residue in an
unmodified FIX polypeptide.
35. The modified FIX polypeptide of claim 34, comprising the amino
acid replacement K247N/N249S/T343R/R403E/E410N.
36. The modified FIX polypeptide of claim 1, comprising amino acid
replacements at one or more positions corresponding to 1, 5, 53,
61, 64, 85, 103, 104, 105, 106, 108, 148, 155, 157, 158, 159, 167,
169, 172, 179, 202, 202, 203, 204, 205, 228, 239, 241, 243, 247,
249, 251, 257, 259, 260, 262, 265, 284, 293, 312, 314, 315, 316,
317, 318, 319, 320, 321, 333, 338, 343, 345, 346, 392, 394, 400,
403, 410, 412 and 413 of a mature FIX polypeptide having a sequence
set forth in SEQ ID NO:3, or to a corresponding position in an
unmodified FIX polypeptide.
37. The modified FIX polypeptide of claim 36, comprising an amino
acid replacement selected from among Y1N, K5A, S53A, S61A, D64A,
D64N, D85N, A103N, D104N, N105S, N105T, K106N, K106S, K106T, V108S,
V108T, T148A, Y155F, Y155H, N157D, N157Q, S158A, S158D, S158E,
T159A, N167D, N167Q, T169A, T172A, T179A, V202M, V202Y, D203M,
D203Y, D203N, A204M, A204Y, F205S, F205T, K228N, E239N, E239S,
E239A, E239R, E239K, T241N, H243S, H243T, K247N, N249S, N249T,
I251S, H257F, H257Y, H257E, H257S, N260S, A262S, A262T, Y284N,
K293E, K293A, R312Q, R312A, R312Y, R312L, F314N, H315S, K316S,
K316T, K316M, G317N, R318E, R318Y, R318N, R318A, S319N, A320S,
L321N, L321S, L321T, R333A, R333E, R338A, R338E, F342I, T343R,
T343E, T343Q, Y345A, Y345T, N346D, N346T, K392N, K394S, K394T,
K400A, K400E, R403A, R403E, E410Q, E410S, E410N, E410A, E410D,
T412V, T412A and K413N, or the same replacement at a corresponding
amino acid residue in an unmodified FIX polypeptide.
38. The modified FIX polypeptide of claim 37, comprising amino acid
replacements selected from replacements R318E/R403E, E410N/T412A or
E410N/T412V or the same replacements at corresponding amino acid
residues in an unmodified FIX polypeptide.
39. A modified Factor IX (FIX) polypeptide, comprising two amino
acid replacements in unmodified FIX polypeptide, wherein: the first
amino acid replacement is at an amino acid residue selected from
among 53, 61, 64, 85, 103, 104, 105, 106, 108, 155, 158, 159, 167,
169, 172, 179, 202, 203, 204, 205, 228, 239, 241, 243, 247, 249,
251, 257, 259, 260, 262, 265, 284, 293, 312, 314, 315, 316, 317,
318, 319, 321, 333, 338, 343, 345, 346, 392, 394, 400, 403, 410,
412 and 413 in a mature FIX polypeptide having a sequence set forth
in SEQ ID NO:3; or a corresponding amino acid residue in an
unmodified FIX polypeptide, wherein corresponding amino acid
residues are identified by alignment of the unmodified FIX
polypeptide with the polypeptide of SEQ ID NO:3; and the second
amino acid replacement is at an amino acid residue selected from
among 5, 53, 61, 64, 85, 155, 158, 159, 167, 239, 260, 284, 293,
312, 318, 333, 338, 346, 400, 403, 410, 412 and 413 in a mature FIX
polypeptide having a sequence set forth in SEQ ID NO:3, or a
corresponding amino acid residue in an unmodified FIX polypeptide,
wherein corresponding amino acid residues are identified by
alignment of the unmodified FIX polypeptide with the polypeptide of
SEQ ID NO:3.
40. The modified FIX polypeptide of claim 39, wherein the first
amino acid replacement is selected from among S53A, S61A, D64A,
D64N, D85N, A103N, D104N, N105S, K106S, K106N, V108S, Y155F, Y155H,
Y155Q, S158A, S158D, S158E, T159A, N167D, N167Q, T169A, T172A,
T179A, V202M, V202Y, D203M, D203Y, A204M, A204Y, K228N, E239A,
E239N, E239S, E239R, E239K, T241N, H243S, K247N, N249S, I251S,
H257F, H257E, H257F, H257Y, H257S, Y259S, N260S, A262S, K265T,
Y284N, K293E, K293A, R312Q, R312A, R312Y, R312L, F314N, H315S,
K316S, K316N, K316A, K316E, K316S, K316M, G317N, R318A, R318E,
R318Y, R318N, S319N, A320S, L321S, K321N, R333A, R333E, R333S,
R338A, R338E, R338L, F342I, T343R, T343E, T343Q, Y345A, Y345T,
N346D, N346Y, K392N, K394S, K400A, K400E, R403A, R403E, E410Q,
E410N, E410D, E410S, E410A, T412A, T412V and K413N, or a
conservative amino acid replacement or the same replacement at a
corresponding amino acid residue in an unmodified FIX polypeptide;
and the second amino acid replacement is selected from among K5A,
S53A, S61A, D64A, D64N, D85N, Y155F, Y155H, Y155Q, S158A, S158D,
S158E, T159A, N167D, N167Q, E239A, E239N, E239S, E239R, E239K,
N260S, Y284N, K293E, K293A, R312Q, R312A, R312Y, R312L, R318A,
R318E, R318Y, R318N, R333A, R333E, R333S, R338A, R338E, R338L,
N346D, N346Y, K400A, K400E, R403A, R403E, E410Q, E410N, E410D,
E410S, E410A, T412A, T412V and K413N, or a conservative amino acid
replacement or the same replacement at a corresponding amino acid
residue in an unmodified FIX polypeptide.
41. The modified FIX polypeptide of claim 39, wherein the first
amino acid replacement is at a position selected from among 318,
155, 247, 249, 338, 403 and 410 or at a corresponding amino acid
residue in an unmodified FIX polypeptide; and the second amino acid
replacement is at a position selected from among 338, 155, 247,
249, 318, 403 and 410, or is at a corresponding amino acid residue
in an unmodified FIX polypeptide.
42. The modified FIX polypeptide of claim 41, wherein the first
amino acid replacement is selected from among R318Y, Y155F, K247N,
N249S, R338E, R403E and E410N or is the same amino acid replacement
at a corresponding amino acid residue in an unmodified FIX
polypeptide; and the second amino acid replacement is selected from
among R338E, Y155F, K247N, N249S, R318Y, R403E and E410N or is the
same replacement at a corresponding amino acid residue.
43. The modified FIX polypeptide of claim 42, comprising amino acid
replacements selected from among amino acid replacements
K400E/R403E, D85N/K228N, D85N/I251S, K400A/R403A, R338A/R403A,
R338E/R403E, K293A/R403A, K293E/R403E, R318A/R403A, R338E/E410N,
K228N/E410N, K228N/R338E, K228N/R338A and R403E/E410N, or the same
replacements at corresponding amino acid residues in an unmodified
FIX polypeptide.
44. The modified FIX polypeptide of claim 39, comprising a further
amino acid replacement at a position selected from among 53, 61,
64, 85, 103, 104, 105, 106, 108, 155, 158, 159, 167, 169, 172, 179,
202, 203, 204, 205, 228, 239, 241, 243, 247, 249, 251, 257, 259,
260, 262, 265, 284, 293, 312, 314, 315, 316, 317, 318, 319, 321,
333, 338, 343, 346, 345, 392, 394, 400, 403, 410, 412 and 413 in a
mature FIX polypeptide having a sequence set forth in SEQ ID
NO:3.
45. The modified FIX polypeptide of claim 44, wherein a further
amino acid replacement corresponds to an amino acid replacement
selected from among Y1N, Y5A, S53A, S61A, D64A, D64N, D85N, A103N,
D104N, N105S, K106S, K106N, V108S, Y155F, Y155H, Y155Q, S158A,
S158D, S158E, T159A, N167D, N167Q, T169A, T172A, T179A, V202M,
V202Y, D203M, D203Y, A204M, A204Y, K228N, E239A, E239N, E239S,
E239R, E239K, T241N, H243S, K247N, N249S, I251S, H257F, H257E,
H257Y, H257S, Y259S, N260S, A262S, K265T, Y284N, K293E, K293A,
R312Q, R312A, R312Y, R312L, F314N, H315S, K316S, K316N, K316A,
K316E, K316S, K316M, G317N, R318A, R318E, R318Y, R318N, S319N,
A320S, L321S, R333A, R333E, R333S, R338A, R338E, R338L, F342I,
T343R, T343E, T343Q, Y345A, Y345T, N346D, N346Y, K392N, K394S,
K400A, K400E, R403A, R403E, E410Q, E410N, E410D, E410S, E410A,
T412A, T412V and K413N, or the same replacements at corresponding
amino acid residues in an unmodified FIX polypeptide.
46. The modified FIX polypeptide of claim 45, comprising ammo acid
replacements selected from among amino acid replacements
corresponding to replacements D85N/D203N/F205T,
D85N/D104N/K106S/I251S, K293A/R338A/R403A, K293E/R338E/R403E,
R338E/R403E/E410N, D203N/F205T/K228N, D203N/F205T/E410N,
D203N/F205T/R338E, D203N/F205T/R338A, D203N/F205T/R338E/R403E,
K228N/R338E/R403E, K247N/N249S/N260S, D104N/K106S/N260S,
D104N/K106S/K228N/K247N/N249S, A103N/N105S/K228N,
D104N/K106S/K228N, A103N/N105S/I251S, D104N/K106S/I251S,
A103N/N105S/K247N/N249S, D104N/K106S/K247N/N249S,
K228N/K247N/N249S, D104N/K106S/N260S, Y259F/K265T/Y345T,
D104N/K106S/K247N/N249S/N260S and
K247N/N249S/R338E/R403E/E410N.
47. The modified FIX polypeptide of claim 1, wherein the modified
FIX polypeptide exhibits a property or activity selected from
among: increased resistance to antithrombin III and/or heparin
compared with the unmodified FIX polypeptide; increased catalytic
activity compared with the unmodified FIX polypeptide; improved
pharmacokinetic properties compared with the unmodified FIX
polypeptide; and increased procoagulant activity compared with the
unmodified FIX polypeptide.
48. The modified FIX polypeptide of claim 1, wherein the unmodified
FIX polypeptide comprises a sequence of amino acids set forth in
any of SEQ ID NOS: 2, 3, 20 or 325, or a sequence having at least
60% sequence identity with the FIX polypeptide set forth in any of
SEQ ID NOS: 2, 3, 20 or 325, or a sequence that is an active
fragment of a FIX polypeptide set forth in any SEQ ID NOS: 2, 3, 20
or 325.
49. The modified FIX polypeptide of claim 39, wherein the
unmodified FIX polypeptide comprises a sequence of amino acids set
forth in any of SEQ ID NOS: 2, 3, 20 or 325, or a sequence having
at least 60% sequence identity with the FIX polypeptide set forth
in any of SEQ ID NOS: 2, 3, 20 or 325, or a sequence that is an
active fragment of a FIX polypeptide set forth in any SEQ ID NOS:
2, 3, 20 or 325.
50. A modified FIX polypeptide, comprising a sequence of amino
acids set forth in any of SEQ ID NOS: 76, 84-87, 90-91, 95-97, 100,
102, 104-105, 113, 121-122, 125-126, 129-134, 138, 146-173,
175-176, 178-185, 188, 193-194, 196-198, 200, 202-206, 208-210,
212, 215-272, 326-41 and 413-417, or a sequence of amino acids that
exhibits at least 60% amino acid sequence identity with a sequence
of amino acids set forth in any of SEQ ID NOS: 76, 84-87, 90-91,
95-97, 100, 102, 104-105, 113, 121-122, 125-126, 129-134, 138,
146-173, 175-176, 178-185, 188, 193-194, 196-198, 200, 202-206,
208-210, 212, 215-272, 326-41 and 413-417.
51. The modified FIX polypeptide of claim 1, further comprising a
chemical modification or a post-translational modification, wherein
the modified FIX polypeptide is glycosylated, carboxylated,
hydroxylated, sulfated, phosphorylated, albuminated, or conjugated
to a polyethylene glycol (PEG) moiety.
52. A nucleic acid molecule, comprising a sequence of nucleotides
encoding a modified FIX polypeptide of claim 1.
53. A vector, comprising the nucleic acid molecule of claim 52.
54. The vector of claim 53, wherein the vector is a prokaryotic
vector, viral vector, or a eukaryotic vector.
55. A cell, comprising the vector of claim 53.
56. The cell of claim 55, that is a eukaryotic cell.
57. The cell of claim 56, wherein the eukaryotic cell is a
mammalian cell.
58. The cell of claim 57, wherein the mammalian cell is selected
from among baby hamster kidney cells (BHK-21) or 293 cells or CHO
cells.
59. A pharmaceutical composition, comprising a modified FIX
polypeptide of claim 1, in a pharmaceutically acceptable
vehicle.
60. The pharmaceutical composition of claim 59 that is formulated
for local, systemic, or topical administration.
61. The pharmaceutical composition of claim 59 that is formulated
for oral, nasal, pulmonary, buccal, transdermal, subcutaneous,
intraduodenal, enteral, parenteral, intravenous, or intramuscular
administration.
62. The pharmaceutical composition of claim 59 that is formulated
for controlled-release.
63. The pharmaceutical composition of claim 59 that is formulated
for single-dosage administration.
64. A method, comprising treating a subject by administering the
pharmaceutical composition of claim 59, wherein the subject has a
disease or condition that is treated by administration of FIX or a
procoagulant.
65. The method of claim 64, wherein the disease or condition is
treated by administration of active FIX (FIXa).
66. The method of claim 64, wherein treatment with the
pharmaceutical composition ameliorates or alleviates the symptoms
associated with the disease or condition.
67. The method of claim 64, further comprising monitoring the
subject for changes in the symptoms associated with disease or
condition that is treated by administration of FIX or a
procoagulant.
68. The method of claim 64, wherein the disease or condition to be
treated is selected from among blood coagulation disorders,
hematologic disorders, hemorrhagic disorders, hemophilias, and
bleeding disorders.
69. The method of claim 68, wherein the hemophilia is hemophilia
B.
70. The method of claim 64, further comprising administering one or
more additional coagulation factors.
71. The method of claim 70, wherein the one or more additional
coagulation factors are selected from among plasma purified or
recombinant coagulation factors, procoagulants, such as vitamin K,
vitamin K derivative and protein C inhibitors, plasma, platelets,
red blood cells and corticosteroids.
72. An article of manufacture, comprising packaging material and
the pharmaceutical composition of claim 59 contained within the
packaging material.
73. A kit, comprising the pharmaceutical composition of claim 59, a
device for administration of the composition and, optionally,
instructions for administration.
Description
RELATED APPLICATIONS
[0001] Benefit of priority is claimed to U.S. Provisional
Application Ser. No. 61/456,298, entitled "MODIFIED FACTOR IX
POLYPEPTIDES AND USES THEREOF," filed on Nov. 3, 2010, to Edwin
Madison, Christopher Thanos and Grant Ellsworth Blouse.
[0002] This application also is related to corresponding
International Application No. [Attorney Docket No.
33328.04918.WO02/4918PC], filed the same day herewith, entitled
"MODIFIED FACTOR IX POLYPEPTIDES AND USES THEREOF," which also
claims priority to U.S. Provisional Application Ser. No.
61/456,298.
[0003] The subject matter of each of the above-referenced
applications is incorporated by reference in its entirety.
Incorporation by Reference of Sequence Listing Provided on Compact
Discs
[0004] An electronic version on compact disc (CD-R) of the Sequence
Listing is filed herewith in duplicate (labeled Copy #1 and Copy
#2), the contents of which are incorporated by reference in their
entirety. The computer-readable file on each of the aforementioned
compact discs, created on Nov. 3, 2011, is identical, 1.07
megabytes in size, and titled 4918SEQ.001.txt.
FIELD OF INVENTION
[0005] Provided are modified FIX polypeptides. The FIX polypeptides
are modified to exhibit improved properties, such as increased
coagulant activity compared to unmodified FIX polypeptides. Also
provided are nucleic acid molecules encoding these polypeptides,
and methods of using the modified FIX polypeptides.
BACKGROUND
[0006] Recombinantly produced Factor IX (FIX) polypeptides have
been approved for treatment of hemophilia, in particular hemophilia
B. Also of therapeutic interest are FIX polypeptides that exhibit
anticoagulant activities useful in the treatment of thrombolytic
diseases. Hence, FIX, like other coagulation factors, are important
therapeutic agents for procoagulant and anticoagulation therapies.
There is a need for FIX polypeptides for therapeutic use.
Therefore, among the objects herein, it is an object to provide
modified FIX polypeptides that are designed to have improved
therapeutic properties.
SUMMARY
[0007] Provided are modified FIX polypeptides. The modified FIX
polypeptides provided have improved procoagulant therapeutic
properties compared to an unmodified FIX polypeptide. For example,
among the modified FIX polypeptides provided herein are those that
exhibit increased coagulant activity, increased catalytic activity,
increased resistance to AT-III, heparin and/or the AT-III/heparin
complex, and/or improved pharmacokinetic properties, such as i)
decreased clearance, ii) altered (e.g. increased or decreased)
volume of distribution, iii) enhanced in vivo recovery, iv)
enhanced total protein exposure in vivo (i.e., AUC), v) increased
serum half-life (.alpha.-, .beta.-, and/or .gamma.-phase), and/or
vi) increased mean resonance time (MRT). In some examples, the
improved pharmacokinetic properties are a result of increased
glycosylation and/or decreased binding to the low-density
lipoprotein receptor-related protein (LRP). Also provided are
nucleic acids encoding the modified FIX polypeptides and methods of
using the modified FIX polypeptides, such as for treatment of
bleeding disorders.
[0008] Provided herein are modified FIX polypeptides containing an
amino acid replacement in an unmodified FIX polypeptide, wherein
the amino acid replacement can be one or more of replacement of
tyrosine (Y) at amino acid residue R318 (R318Y), R318E, R318F,
R318W, R318D, R318I, R318K, R318L, R318M, R318S, R318V, S61A, S61C,
S61D, S61E, S61F, S61G, S61I, S61K, S61L, S61P, S61R, S61V, S61W,
S61Y, D64A, D64C, D64F, D64H, D64I, D64L, D64M, D64P, D64R, D64S,
D64T, D64W, Y155F, Y155L, N157D, N157E, N157F, N157I, N157K, N157L,
N157M, N157R, N157V, N157W, N157Y, S158A, S158D, S158, S158F,
S158G, S158I, S158K, S158L, S158M, S158R, S158V, S158W, S158Y,
N167D, N167Q, N167E, N167F, N167G, N167H, N167I, N167K, N167L,
N167M, N167P, N167R, N167V, N167W, N167Y, T169A, T169D, T169E,
T169F, T169G, T169I, T169K, T169L, T169M, T169P, T169R, T169S,
T169V, T169W, T169Y, T172A, T172D, T172E, T172F, T172G, T172I,
T172K, T172L, T172M, T172P, T172R, T172S, T172V, T172W, T172Y,
D203M, D203Y, D203F, D203H, D203I, D203K, D203L, D203R, D203V,
D203W, A204M, A204Y, A204F, A204I, A204W, E239S, E239R, E239K,
E239D, E239F, E239I, E239L, E239M, E239T, E239V, E239W, E239Y,
H257F, H257E, H257D, H257I, H257K, H257L, H257M, H257Q, H257R,
H257V, H257W, R312Y, R312L, R312c, R312D, R312E, R312F, R312I,
R312K, R312M, R312P, R312S, R312T, R312V, R312W, K316M, K316D,
K316F, K316H, K316I, K316L, K316R, K316V, K316W, K316Y, F342I,
F342D, F342E, F342K, F342L, F342M, F342S, F342T, F342V, F342W,
F342Y, T343R, T343E, T343D, T343F, T343I, T343K, T343L, T343M,
T343S, T343V, T343W, T343Y, N346Y, N346E, N346F, N346H, N346I,
N346K, N346L, N346M, N346Q, N346R, N346V, N346W, K400E, K400C,
K400D, K400F, K400G, K400L, K400M, K400P, K400S, K400T, K400V,
K400Y, R403D, R403F, R403I, R403K, R403L, R403M, R403S, R403V,
R403Y, E410D, E410S, E410A, E410F, E410G, E410I, E410K, E410L,
E410M, E410P, E410R, E410T, E410V, E410W, E410Y, T412A, T412V,
T412C, T412D, T412E, T412F, T412G, T412I, T412M, T412P, T412W or
T412Y in a mature FIX polypeptide having a sequence set forth in
SEQ ID NO:3, or the same replacement at a corresponding amino acid
residue in an unmodified FIX polypeptide, wherein corresponding
amino acid residues are identified by alignment of the unmodified
FIX polypeptide with the polypeptide of SEQ ID NO:3; and provided
that the modified FIX polypeptide does not contain the
modifications F342I/T343R/Y345T. In particular, provided herein are
modified FIX polypeptides containing amino acid replacements
R318Y/R338E/R403E/E410N, R318Y/R338E/T343R/R403E/E410N,
R318Y/R338E/T343R/E410N, Y155F/R318Y/R338E/T343R/R403E,
Y155F/K228N/K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/T343R/R403E,
K247N/N249S/R318Y/R338E/T343R/R403E, R318Y/R338E/T343R,
Y155F/K247N/N249S/R318Y/R338E/T343R,
K228N/R318Y/R338E/T343R/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/T343R/R403E,
R318Y/R338E/T343R/R403E/E410S, Y155F/K247N/N249S/R318Y/R338E,
K247N/N249S/R318Y/R338E/T343R, R318Y/T343R/E410N,
Y155F/R318Y/R338E/R403E, Y155F/R338E/T343R/R403E/E410N,
Y155F/K247N/N249S/R338E/R403E/E410N,
K247N/N249S/R338E/T343R/R403E/E410N or R338E/T343R/E410N.
[0009] Among the modified FIX polypeptides provided herein are
those containing two amino acid replacements in unmodified FIX
polypeptide, wherein the first amino acid replacement is at a
position corresponding to a position selected from among 53, 61,
64, 85, 103, 104, 105, 106, 108, 155, 158, 159, 167, 169, 172, 179,
202, 203, 204, 205, 228, 239, 241, 243, 247, 249, 251, 257, 259,
260, 262, 265, 284, 293, 312, 314, 315, 316, 317, 318, 319, 321,
333, 338, 343, 346, 345, 392, 394, 400, 403, 410, 412 and 413 in a
mature FIX polypeptide having a sequence set forth in SEQ ID NO:3,
and the second amino acid replacement is at a position
corresponding to a position selected from among 5, 53, 61, 64, 85,
155, 158, 159, 167, 239, 260, 284, 293, 312, 318, 333, 338, 346,
400, 403, 410, 412 and 413 in a mature FIX polypeptide having a
sequence set forth in SEQ ID NO:3.
[0010] In some examples, the first or the second amino acid
replacement is replacement with an amino acid residue selected from
among alanine (Ala, A); arginine (Arg, R); asparagine (Asn, N);
aspartic acid (Asp, D); cysteine (Cys, C); glutamic acid (Glu, E);
glutamine (Gln, Q); glycine (Gly, G); histidine (His, H);
isoleucine (Ile, I); leucine (Leu, L); lysine (Lys, K); methionine
(Met, M); phenylalanine (Phe, F); proline (Pro, P); serine (Ser,
S); threonine (Thr, T); tryptophan (Trp, W); tyrosine (Tyr, Y); and
valine (Val, V), providing the replacing amino acid is not the same
as the amino acid it replaces. In particular examples, the first
amino acid replacement is replacement with an amino acid residue
selected from among alanine; asparagine; aspartic acid, glutamic
acid; glutamine; histidine; isoleucine; leucine; lysine;
methionine; phenylalanine; serine; threonine; tyrosine and valine.
For example, exemplary amino acid replacements include S53A, S61A,
D64A, D64N, D85N, A103N, D104N, 105S, K106S, K106N, V108S, Y155F,
Y155H, Y155Q, S158A, S158D, S158E, T159A, N167D, N167Q, T169A,
T172A, T179A, V202M, V202Y, D203M, D203Y, A204M, A204Y, K228N,
E239A, E239N, E239S, E239R, E239K, T241N, H243S, K247N, N249S,
I251S, H257F, H257E, H257F, H257Y, H257S, Y259S, N260S, A262S,
K265T, Y284N, K293E, K293A, R312Q, R312A, R312Y, R312L, F314N,
H315S, K316S, K316N, K316A, K316E, K316S, K316M, G317N, R318A,
R318E, R318Y, R318N, S319N, A320S, L321S, R333A, R333E, R333S,
R338A, R338E, R338L, T343R, T343E, T343Q, F342I, Y345A, Y345T,
N346D, N346Y, K392N, K394S, K400A, K400E, R403A, R403E, E410Q,
E410N, E410D, E410S, E410A, T412A, T412V or K413N. Other exemplary
amino acid replacements are conservative amino acid
replacements.
[0011] In some instances, the second amino acid replacement is
replacement with an amino acid residue selected from among alanine;
arginine; asparagine; aspartic acid; glutamic acid; glutamine;
histidine; leucine; lysine; phenylalanine; serine; threonine;
tyrosine; or valine. For example, exemplary amino acid replacements
include K5A, S53A, S61A, D64A, D64N, D85N, Y155F, Y155H, Y155Q,
S158A, S158D, S158E, T159A, N167D, N167Q, E239A, E239N, E239S,
E239R, E239K, N260S, Y284N, K293E, K293A, R312Q, R312A, R312Y,
R312L, R318A, R318E, R318Y, R318N, R333A, R333E, R333S, R338A,
R338E, R338L, N346D, N346Y, K400A, K400E, R403A, R403E, E410Q,
E410N, E410D, E410S, E410A, T412A, T412V or K413N. Other exemplary
amino acid replacements are conservative amino acid
replacements.
[0012] In particular examples, the first amino acid replacement is
at a position corresponding to a position selected from among 155,
247, 249, 318, 338, 403 and 410, such as, for example, Y155F,
K247N, N249S, R318Y, R338E, R403E and E410N. In further examples,
the second amino acid replacement is at a position corresponding to
a position selected from among 155, 247, 249, 318, 338, 403 and
410, such as, for example, Y155F, K247N, N249S, R318Y, R338E, R403E
and E410N.
[0013] Among the modified FIX polypeptides provided herein are
those containing amino acid replacements selected from among amino
acid replacements corresponding to K400E/R403E, R318E/R403E,
R318Y/E410N, K228N/R318Y, Y155F/K228N, Y155F/I251S, Y155F/N346D,
Y155F/N260S, R338E/T343R, E410N/T412A, E410N/T412V, R318Y/R338E,
D85N/K228N, D85N/I251S, K400A/R403A, R338A/R403A, R338E/R403E,
K293A/R403A, K293E/R403E, R318A/R403A, R338E/E410N, K228N/E410N,
K228N/R338E, K228N/R338A and R403E/E410N.
[0014] In some examples, the modified FIX polypeptides contain one
or more further amino acid replacements, such as one or more at a
position selected from among 53, 61, 64, 85, 103, 104, 105, 106,
108, 155, 158, 159, 167, 169, 172, 179, 202, 203, 204, 205, 228,
239, 241, 243, 247, 249, 251, 257, 259, 260, 262, 265, 284, 293,
312, 314, 315, 316, 317, 318, 319, 321, 333, 338, 343, 346, 345,
392, 394, 400, 403, 410, 412 and 413 in a mature FIX polypeptide
having a sequence set forth in SEQ ID NO:3. For example, the
modified FIX polypeptides can contain a further amino acid
replacement selected from among Y5A, S53A, S61A, D64A, D64N, D85N,
A103N, D104N, N105S, K106S, K106N, V108S, Y155F, Y155H, Y155Q,
S158A, S158D, S158E, T159A, N167D, N167Q, T169A, T172A, T179A,
V202M, V202Y, D203M, D203Y, A204M, A204Y, K228N, E239A, E239N,
E239S, E239R, E239K, T241N, H243S, K247N, N249S, I251S, H257F,
H257E, H257F, I257Y, H257S, Y259S, N260S, A262S, K265T, Y284N,
K293E, K293A, R312Q, R312A, R312Y, R312L, F314N, H315S, K316S,
K316N, K316A, K316E, K316S, K316M, G317N, R318A, R318E, R318Y,
R318N, S319N, A320S, L321S, R333A, R333E, R333S, R338A, R338E,
R338L, T343R, T343E, T343Q, F342I, Y345A, Y345T, N346D, N346Y,
K392N, K394S, K400A, K400E, R403A, R403E, E410Q, E410N, E410D,
E410S, E410A, T412A, T412V and K413N, or a conservative amino acid
replacement.
[0015] In some examples, the modified FIX polypeptides provided
herein contain amino acid replacements selected from among amino
acid replacements corresponding to R318Y/R338E/R403E,
D203N/F205T/R318Y, R318Y/R338E/E410N, K228N/R318Y/E410N,
R318Y/R403E/E410N, R318Y/R338E/R403E/E410N,
D203N/F205T/R318Y/E410N, A103N/N105S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/R338E/R403E/E410N, K228N/R318Y/R338E/R403E/E410N,
I251S/R318Y/R338E/R403E/E410N,
D104N/K106S/I251S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/E410N/R338E, I251S/R318Y/E410N/R338E,
D104N/K106S/I251S/R318Y/E410N/R338E, A103N/N105S/Y155F,
D104N/K106S/Y155F, Y155F/K247N/N249S,
A103N/N105S/K247N/N249S/R318Y/R338E/R403E/E410N,
D104N/K106S/K247N/N249S/R318Y/R338E/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/R403E/E410N,
A103N/N105S/Y155F/R318Y/R338E/R403E/E410N,
D104N/K106S/Y155F/R318Y/R338E/R403E/E410N,
Y155F/K228N/R318Y/R338E/R403E/E410N,
Y155F/I251S/R318Y/R338E/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/R403E/E410N,
K247N/N249S/R318Y/R338E/R403E/E410N, Y155F/R318Y/R338E/R403E/E410N,
K247N/N249S/R318Y/R338E/E240N, Y155F/R318Y/R338E/E410N,
Y155F/K247N/N249S/R318Y/R338E/E410N,
D104N/K106S/Y155F/K228N/K247N/N249S, D104N/K106S/Y155F/K247N/N249S,
D104N/K106S/Y155F/K228N, Y155F/K228N/K247N/N249S,
R318Y/R338E/R403E/E410S, R318Y/R338E/R403E/E410N/T412V,
R318Y/R338E/R403E/E410N/T412A, R318Y/R338E/R403E/T412A,
R318Y/R338E/E410S, R318Y/R338E/T412A, R318Y/R338E/E410N/T412V,
D85N/K228N/R318Y/R338E/R403E/E410N, N260S/R318Y/R338E/R403E/E410N,
R318Y/R338E/N346D/R403E/E410N, Y155F/R318Y/R338E/N346D/R403E/E410N,
Y155F/N260S/N346D, K247N/N249S/N260S/R318Y/R338E/R403E/E410N,
D104N/K106S/N260S/R318Y/R338E/R403E/E410N,
Y155F/N260S/R318Y/R338E/R403E/E410N, R318Y/R338E/T343R/R403E/E410N,
D104N/K106S/Y155F/N260S, Y155F/K247N/N249S/N260S,
D104N/K106S/Y155F/K247N/N249S/N260S, D104N/K106S/Y155F/K228N,
D104N/K106S/Y155F/K247N/N249S, D85N/D203N/F205T,
D85N/D104N/K106S/I251S, K293A/R338A/R403A, K293E/R338E/R403E,
R338E/R403E/E410N, D203N/F205T/K228N, D203N/F205T/E410N,
D203N/F205T/R338E, D203N/F205T/R338A, D203N/F205T/R338E/R403E,
K228N/R338E/R403E, K247N/N249S/N260S, D104N/K106S/N260S,
K228N/K247N/N249S/D104N/K106S, A103N/N105S/K228N,
D104N/K106S/K228N, A103N/N105S/I251S, D104N/K106S/I251S,
A103N/N105S/K247N/N249S, D104N/K106S/K247N/N249S,
K228N/K247N/N249S, D104N/K106S/K228N/K247N/N249S,
K247N/N249S/N260S, D104N/K106S/N260S, Y259F/K265T/Y345T and
D104N/K106S/K247N/N249S/N260S.
[0016] Also provided herein are modified FIX polypeptides
containing a modification in an unmodified FIX polypeptide, wherein
the modification is selected from among modifications corresponding
to amino acid replacements S61A, D64A, Y155F, N157D, S158A, S158D,
S158E, N167D, N167Q, T169A, T172A, D203M, D203Y, A204M, A204Y,
E239S, E239R, E239K, H257F, H257E, R312Y, R312L, K316M, R318E,
R318Y, T343R, T343E, F342I, N346Y, K400E, E410D, E410S, E410A,
T412A and T412V in a mature FIX polypeptide having a sequence set
forth in SEQ ID NO:3. In some examples, the modified FIX
polypeptide contains two or more of the amino acid
replacements.
[0017] In particular instances, the modified FIX polypeptide
contains the mutation Y155F. For example, provided are modified FIX
polypeptides that contain Y155F and a modification at an amino acid
position selected from among positions corresponding to 247, 249,
338, 403 and 410 of a mature FIX polypeptide having a sequence set
forth in SEQ ID NO:3. In one example, the modified FIX contains
Y155F/K247N/N249S. In further instances, the modified FIX
polypeptide contains the mutation R318Y. For example, provided are
modified FIX polypeptides containing R318Y and a modification at an
amino acid position selected from positions corresponding to 338,
403 and 410 of a mature FIX polypeptide having a sequence set forth
in SEQ ID NO:3, such as, for example, R338E, R403E or E410N.
[0018] In some example, the modified FIX polypeptides contain one
or more further modifications at an amino acid position selected
from among positions corresponding to 5, 53, 61, 64, 85, 103, 104,
105, 106, 108, 148, 155, 157, 158, 159, 167, 169, 172, 179, 202,
202, 203, 204, 205, 228, 239, 241, 243, 247, 249, 251, 257, 259,
260, 262, 265, 284, 293, 312, 314, 315, 316, 317, 318, 319, 320,
321, 333, 338, 343, 345, 346, 392, 394, 400, 403, 410, 412 and 413
of a mature FIX polypeptide having a sequence set forth in SEQ ID
NO:3. Exemplary modification(s) are selected from among
modifications corresponding to amino acid replacements K5A, S53A,
S61A, D64A, D64N, D85N, A103N, D104N, N105S, N105T, K106N, K106N,
K106T, V108S, V108T, T148A, Y155F, Y155H, N157D, N157Q, S158A,
S158D, S158E, T159A, N167D, N167Q, T169A, T172A, T179A, V202M,
V202Y, D203M, D203Y, D203N, A204M, A204Y, F205S, F205T, K228N,
E239N, T241N, E239S, E239A, E239R, E239K, H243S, H243T, K247N,
N249S, N249T, I251S, I251T, H257F, H257Y, H257E, H257S, N260S,
A262S, A262T, Y284N, K293E, K293A, R312Q, R312A, R312Y, R312L,
F314N, H315S, K316S, K316T, K316M, G317N, R318E, R318Y, R318N,
R318A, S319N, A320S, L321N, L321S, L321T, R333A, R333E, R338A,
R338E, T343R, T343E, T343Q, F342I, Y345A, Y345T, N346D, N346T,
K392N, K394S, K394T, K400A, K400E, R403A, R403E, E410Q, E410S,
E410N, E410A, E410D, T412V, T412A and K413N.
[0019] Thus, provided herein are modified FIX polypeptides
containing modifications selected from among modifications
corresponding to amino acid replacements K400E/R403E, R318E/R403E,
R318Y/E410N, R318Y/R338E/R403E, D203N/F205T/R318Y, K228N/R318Y,
R318Y/R338E/E410N, K228N/R318Y/E410N, R318Y/R403E/E410N,
R318Y/R338E/R403E/E410N, D203N/F205T/R318Y/E410N,
A103N/N105S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/R338E/R403E/E410N, K228N/R318Y/R338E/R403E/E410N,
I251S/R318Y/R338E/R403E/E410N,
D104N/K106S/I251S/R318Y/R338E/R403E/E410N,
D104N/K106S/R318Y/E410N/R338E, I251S/R318Y/E410N/R338E,
D104N/K106S/I251S/R318Y/E410N/R338E, A103N/N105S/Y155F,
D104N/K106S/Y155F, Y155F/K228N, Y155F/I251S, Y155F/K247N/N249S,
A103N/N105S/K247N/N249S/R318Y/R338E/R403E/E410N,
D104N/K106S/K247N/N249S/R318Y/R338E/R403E/E410N,
K228N/K247N/N249S/R318Y/R338E/R403E/E410N,
A103N/N105S/Y155F/R318Y/R338E/R403E/E410N,
D104N/K106S/Y155F/R318Y/R338E/R403E/E410N,
Y155F/K228N/R318Y/R338E/R403E/E410N,
Y155F/I251S/R318Y/R338E/R403E/E410N,
Y155F/K247N/N249S/R318Y/R338E/R403E/E410N,
K247N/N249S/R318Y/R338E/R403E/E410N, Y155F/R318Y/R338E/R403E/E410N,
K247N/N249S/R318Y/R338E/E240N, Y155F/R318Y/R338E/E410N,
Y155F/K247N/N249S/R318Y/R338E/E410N,
D104N/K106S/Y155F/K228N/K247N/N249S, D104N/K106S/Y155F/K247N/N249S,
D104N/K106S/Y155F/K228N, Y155F/K228N/K247N/N249S,
R318Y/R338E/R403E/E410S, R318Y/R338E/R403E/E410N/T412V,
R318Y/R338E/R403E/E410N/T412A, R318Y/R338E/R403E/T412A,
R318Y/R338E/E410S, R318Y/R338E/T412A, R318Y/R338E/E410N/T412V,
D85N/K228N/R318Y/R338E/R403E/E410N, N260S/R318Y/R338E/R403E/E410N,
R318Y/R338E/N346D/R403E/E410N, Y155F/N346D,
Y155F/R318Y/R338E/N346D/R403E/E410N, Y155F/N260S,
Y155F/N260S/N346D, K247N/N249S/N260S/R318Y/R338E/R403E/E410N,
D104N/K106S/N260S/R318Y/R338E/R403E/E410N,
Y155F/N260S/R318Y/R338E/R403E/E410N, R318Y/R338E/T343R/R403E/E410N,
D104N/K106S/Y155F/N260S, Y155F/K247N/N249S/N260S, R338E/T343R and
D104N/K106S/Y155F/K247N/N249S/N260S, D104N/K106S/Y155F/K228N,
D104N/K106S/Y155F/K247N/N249S, T343R/Y345T, E410N/T412A,
R410N/T412V and R318Y/R338E. In particular examples, the modified
FIX polypeptides contain modifications corresponding to amino acid
replacements R318Y/R338E/R403E/E410N or
Y155F/K247N/N249S/R318Y/R338E/R403E/E410N.
[0020] In some instances, the unmodified FIX polypeptide contains a
sequence of amino acids set forth in any of SEQ ID NOS: 2, 3, 20 or
325, or is a species variant thereof, or a variant having at least
60% sequence identity with the FIX of any of SEQ ID NOS: 2, 3, 20
or 325, or is an active fragment of a FIX polypeptide that
comprises a sequence of amino acids set forth in any SEQ ID NOS: 2,
3, 20 or 325. For example, the species variant can have sequence of
amino acids set forth in any of SEQ ID NOS: 4-18. In other
examples, the variant having at least 60% sequence identity with
the FIX of any of SEQ ID NOS: 2, 3, 20 or 325, has a sequence of
amino acids set forth in any of SEQ ID NOS: 75-272. In further
examples, the modified FIX polypeptide is an active fragment of an
unmodified FIX polypeptide; and the modified FIX polypeptide
contains the modification(s).
[0021] Any of the modified FIX polypeptides provided herein of can
contain one or more modifications that introduces and/or eliminates
one or more glycosylation sites compared to the unmodified FIX
polypeptide. In some examples, the glycosylation sites are selected
from among, N-, O- and S-glycosylation sites. In one example, one
or more N-glycosylation sites are introduced compared to the
unmodified FIX polypeptide. In some examples, the N-glycosylation
site is introduced at an amino acid positions corresponding to
positions selected from among Y1, S3, G4, K5, L6, E7, F9, V10, Q11,
G12, L14, E15, R16, M19, E20, K22, S24, F25, E26, E27, A28, R29,
E30, V31, F32, E33, T35, E36, R37, T39, E40, F41, W42, K43, Q44,
Y45, V46, D47, G48, D49, Q50, E52, S53, N54, L57, N58, G59, S61,
K63, D65, I66, N67, S68, Y69, E70, W72, P74, F77, G79, K80, N81,
E83, L84, D85, V86, T87, N89, 190, K91, N92, R94, K100, N101, S102,
A103, D104, N105, K106, V108, S110, E113, G114, R116, E119, N120,
Q121, K122, K123, E125, P126, V128, P129, F130, R134, V135, S136,
S138, Q139, T140, S141, K142, A146, E147, A148, V149, F150, P151,
D152, V153, D154, Y155, V156, S158, T159, E160, A161, E162, T163,
I164, L165, D166, I168, T169, Q170, S171, T172, Q173, S174, F175,
N176, D177, F178, T179, R180, G183, E185, D186, K188, P189, K20I,
V202, D203, E213, E224, T225, G226, K228, E239, E240, T241, H243,
K247, N249, I251, R252, I253, P255, H257, N258, N260, A261, A262,
I263, N264, K265, A266, D276, E277, P278, V280, N282, S283, Y284,
D292, K293, E294, N297, I298, K301, F302, G303, S304, Y306, R312,
F314, H315, K316, G317, R318, S319, L32I, V322, Y325, R327, P329,
L330, D332, R333, A334, T335, L337, R338, K341, F342, T343, Y345,
N346, H354, E355, G357, R358, Q362, E372, E374, G375, E388, M391,
K392, G393, K394, R403, N406, K409, E410, K411, and K413 of the
mature FIX polypeptide set forth in SEQ ID NO:3.
[0022] Exemplary modifications that introduce a glycosylation
include those selected from among modification corresponding to
amino acid replacements YIN, Y1N+S3T, S3N+K5S/T, G4T, G4N+L6S/T,
K5N+E7T, L6N+E8T, E7N+F9T, F9N+Q11S/T, V10N+G12S/T, Q11N+N13T,
G12N+L14S/T, L14N+R16T, E15T, E15N+E17T; R16N+C18S/T, M19N+E21T;
E20N+K22T, K22N, S24N+E26T; F25N+E27T; E26N+A28T; E27N+R29T;
A28N+E30T; R29N+V31S/T, E30N+F32T; V31N+E33T; F32N+N34T, E33N,
T35N+R37S/T, E36T; E36N; R37N, T39N+F41 S/T, E40N+W42T,
F41N+K43S/T, W42N+Q44S/T, K43N+Y45T; Q44N+V46S/T, Y45N+D47T,
V46N+G48S/T, D47N+D49S/T, G48N+Q50S/T, D49N+C51S/T, Q50N+E52S/T,
E52N+N54T, S53N+P55S/T, C56S/T, L57N+G59S/T, G59N+S61T; G60S/T,
S61N+K63S/T, K63N+D65S/T, D65N+N67S/T, I66N+S68S/T, Y69S/T,
Y69N+C71S/T, S68N+E70S/T, E70N+W72S/T, W72N+P74S/T, P74N+G76S/T,
F75N, G76N+E78T, E78N+K80T, F77T, F77N+G79S/T, G79N+N81S/T,
K80N+C82S/T, E83S/T, E83N+D85S/T, L84N+V86S/T, D85N, V86A,
V86N+C88S/T, T87N+N89S/T, I90N+N92S/T, K91S/T, I90N+N92S/T,
K91N+G93S/T, R94S/T, R94N+E96S/T, K100N, A103S/T, S102N+D104S/T,
A103N+N105S/T, D104N+K106S/T, V107S/T, K106N+V108S/T,
V108N+V110S/T, S111N, E113N+Y115S/T, G114N+R116S/T, R116N+A118S/T,
E119N+Q121S/T, K122S/T, Q121N+S123S/T, K122N+C124S/T S123N+E125S/T,
E125N+A125S/T, P126N+V128S/T, A127N+P129T, V128N+F130S/T,
P129N+P131S/T, F130N+C132S/T, R134N, V135N+V137S/T, S136N, S138N,
V137N+Q139T; Q139N, T140N+L142S/T, S141N+L143S/T, K142N,
A146N+A148S/T, E147N+V149S/T, T148N+F150S/T, V149N+P151S/T,
F150N+D152S/T, P151N+V153S/T, D152N+D154S/T, V153N+Y155S/T,
D154N+V156S/T, Y155N+N157S/T, V156N, S158N+E160S/T, T159N+A161S/T,
E160N+E162S/T, A161N, E162N+I164S/T, T163N+L165S/T, I164N+D166S/T,
L165N+N167S/T, D166N+I168S/T, I168N+Q170S/T, T169N, Q170N,
S171N+Q173S/T, T172N, Q173N+F175S/T, S174N+N176S/T, F175N+D177S/T,
F178S/T, D177N, D177E, F178N+R180S/T, T179N+V181S/T, R180N+V182S/T,
G183+E185S/T, G184N+D186T, E185N+A187S/T, D186N+K188S/T,
A187N+P189T, K188N+G190S/T, P189N+Q181S/T, G200N+V202T,
K201N+D203S/T, K201T, V202N+A204S/T, D203N+F205S/T, E213N+W215S/T,
K214T, V223T, E224N+G226S/T, T225N+V227S/T, G226N+K228S/T,
V227N+I229T, K228N, H236N+I238T; I238N+E240T; E239N, E240N+E242S/T,
E242N, T241N+H243S/T, H243N+E245S/T, K247N+N249S/T, V250N+R252T,
I251S/T, I251N+I253S/T, R252N+I254S/T, I253N+P255S/T,
P255N+H257S/T, H257N+Y259S/T, N260S/T, A262S/T, A261N+I263S/T,
A262N+N264S/T, I263N+K265S/T, K265N+N267S/T, A266N+H268S/T,
D276N+P278S/T, P278N+V280S/T, E277N+L279S/T, V280N+N282S/T,
Y284S/T, S283N+V285S/T, Y284N, D292N+K294S/T, K293N+Y295S/T, E294N,
F299S/T, I298N+L300S/T, K301N+G303S/T, F302N, G303N+G305S/T,
S304N+Y306S/T, Y306N+S308S/T, R312N+F314S/T, V313N+H315T,
F314N+K316S/T, H315N+G317S/T, K316N+R138S/T, G317N, R318N+A320S/T,
S319N+L321S/T, A320N+V322T, L321N+L323S/T, V322N+Q324S/T,
Y325N+R327S/T, R327N+P329S/T, P329N+V331S/T, L330N+D332S/T,
D332N+A334S/T, R333N, A334N+C336S/T, T335N+L337S/T, L337N, R338N,
S339N+K341T, T340N+F342T; K341N, F342N+I344S/T, T343N+Y345S/T,
Y345N+N347S/T, M348S/T, G352N+H354T, F353N, F353N+E355T,
H354N+G356S/T, H354V, H354I, E355T, E355N+G357S/T, G356N+R358T,
G357N+D359S/T, R358N, Q362N+D364S/T, V370N; T371V; T371I; E372T,
E372N+E374S/T, E374N, G375N, W385N+E387T; G386N+E388T,
E388N+A390S/T, A390N+K392T, M391N+G393S/T, K392N+K394S/T, K392V,
G393T, G393N+Y395S/T, K394N+G396S/T, R403N+V405S/T, I408S/T,
K409N+K411S/T, E410N, K411N+K413S/T, and K413N. In some examples,
1, 2, 3, 4, 5, 6, 7, 8 or more glycosylation sites are
introduced.
[0023] Also provided herein are modified FIX polypeptides
containing one or more modifications that eliminates one or more
N-glycosylation sites compared to the unmodified FIX polypeptide.
For example, N-glycosylation sites at an amino acid positions
corresponding to N157 or N167 of the mature FIX polypeptide set
forth in SEQ ID NO:3 can be eliminated. Exemplary modifications
that eliminate an N-glycosylation site include those selected from
among modifications corresponding to amino acid replacements N157D,
N157Q, N167D and N167Q. In further examples, the FIX polypeptide
contain one or more modifications that eliminates one or more
O-glycosylation sites compared to the unmodified FIX polypeptide.
For example, O-glycosylation sites that can be eliminated include
those an amino acid positions corresponding to positions selected
from among S53, S61, T159 and T169 of the mature FIX polypeptide
set forth in SEQ ID NO:3. Exemplary modifications that eliminate an
N-glycosylation site include those selected from among
modifications corresponding to amino acid replacements S53A, S61A,
T159A and T169A.
[0024] Also provided are modified FIX polypeptides containing one
or more modifications that introduces and/or eliminates one or more
sulfation sites compared to the unmodified FIX polypeptide. In one
example, the modified FIX polypeptides contain a modification that
eliminates a sulfation site at an amino acid position corresponding
to position Y155 of the mature FIX polypeptide set forth in SEQ ID
NO:3. Exemplary of such modifications are those that correspond to
amino acid replacements Y155H, Y155F and Y155Q.
[0025] Provided are modified FIX polypeptides containing one or
more modifications that introduces and/or eliminates one or more
phosphorylation sites compared to the unmodified FIX polypeptide.
In one example, the modified FIX polypeptide contains a
modification that eliminates a phosphorylation site at an amino
acid position corresponding to position S158 of the mature FIX
polypeptide set forth in SEQ ID NO:3. Exemplary of such
modifications are those that correspond to amino acid replacements
S158A, S158D and S158E. Also provided are FIX polypeptides
containing one or more modifications that introduces and/or
eliminates one or more O-hydroxylation sites compared to the
unmodified FIX polypeptide. In one instance, the modified FIX
polypeptides contain a modification that eliminates a
f3-hydroxylation site at an amino acid position corresponding to
position D64 of the mature FIX polypeptide set forth in SEQ ID
NO:3. Exemplary of such modifications are those that correspond to
amino acid replacements D64N and D64A.
Any of the modified FIX polypeptides provided herein can contain
any other mutations known in the art, such as, for example, one or
more modifications selected from among amino acid replacements Y1A,
Y1C, Y1D, Y1E, Y1G, Y1H, Y1K, Y1N, Y1P, Y1Q, Y1R, Y1S, Y1T, S3T,
K5A, K5L, K5L, K5F, K5E, L6A, L6C, L6D, L6E, L6G, L6H, L6K, L6N,
L6P, L6Q, L6R, L6S, L6T, L6M, F9A, F9C, F9D, F9E, F9G, F9H, F9K,
F9N, F9P, F9Q, F9R, F9S, F9T, F9I, F9M, F9W, V10A, V10C, V10D,
V10E, V10G, V10H, V10K, V10N, V10P, V10Q, V10R, V10S, V10T, V10F,
V10I, V10K, V10M, V10W, V10Y, Q11E, Q11D, Q11A, Q11C, Q11G, Q11P,
G12D, G12E, G12G, G12H, G12K, G12N, G12P, G12Q, G12R, G12S, G12T,
N13A, N13C, N13G, N13H, N13P, N13T, L14A, L14C, L14D, L14E, L14G,
L14H, L14K, L14N, L14P, L14Q, L14R, L14S, L14T, L14F, L14I, L14M,
L14V, L14W, L14Y, E15D, E15H, E15P, R16E, R16A, R16c, R16G, R16P,
R16T, E17A, E17C, E17G, E17P, E17T, C18D, C18E, C18G, C18H, C18K,
C18N, C18P, C18Q, C18R, C18S, C18T, M19A, M19C, M19D, M19E, M19G,
M19H, M19K, M19N, M19P, M19Q, M19R, M19S, M19T, M19F, M191, M19M,
M19V, M19W, M19Y, E20A, E20C, E20G, E20P, E20T, E21A, E21C, E21G,
E21P, K22H, K22P, K22T, S24H, S24P, F25A, F25C, F25D, F25E, F25G,
F25H, F25K, F25N, F25P, F25Q, F25R, F25S, F25T, F25I, F25M, F25W,
F25Y, E26A, E26C, E26G, E26P, E27A, E27C, E27G, E27H, E27P, E27S,
E27T, A28C, A28D, A28E, A28G, A28H, A28K, A28N, A28P, A28Q, A28R,
A28S, A28T, R29A, R29c, R29G, R29P, R29F, E30D, E30H, E30P, V31A,
V31C, V31D, V31E, V31G, V31H, V31K, V31N, V31P, V31Q, V31R, V31S,
V31T, V31F, V31I, V31W, V31Y, F32A, F32C, F32D, F32E, F32G, F32H,
F32K, F32N, F32P, F32Q, F32R, F32S, F32T, E33H, E33N, E33P, E33Q,
E33S, E33T, N34E, N34D, N34F, N34I, N34L, T35D, T35E, T35A, T35C,
T35G, T35P, F41A, F41C, F41 D, F41E, F41G, F41H, F41K, F41N, F41P,
F41Q, F41R, F41S, F41T, F41M, F41W, F41Y, W42A, W42C, W42D, W42E,
W42G, W42H, W42K, W42N, W42P, W42Q, W42R, W42S, W42T, K43A, K43C,
K43G, K43P, Q44P, Q44T, Q44, Y45A, Y45C, Y45D, Y45E, Y45G, Y45H,
Y45K, Y45N, Y45P, Y45Q, Y45R, Y45S, Y45T, V46A, V46C, V46D, V46E,
V46G, V46H, V46K, V46N, V46P, V46Q, V46R, V46S, V46T, V46F, V46I,
V46M, V46W, V46Y, D47A, D47C, D47G, D47H, D47P, D47T, G48D, G48E,
G48P, G48T, D49H, D49P, D49Q, D49T, Q50A, Q50C, Q50D, Q50G, Q50H,
Q50P, Q50T, C51D, C51E, C51G, C51H, C51K, C51N, C51P, C51Q, C51R,
C51S, C51T, E52P, E52T, S53A, S53C, S53G, S53H, S53P, S53T, N54H,
N54P, N54T, L57A, L57C, L57D, L57E, L57G, L57H, L57K, L57N, L57P,
L57Q, L57R, L57S, L57T, L57F, L571, L57M, L57W, L57Y, G60C, G60D,
G60H, G60P, G60T, C62D, C62H, C62P, K63T, D65H, D65T, I66A, I66C,
I66D, I66E, I66G, I66H, I66K, I66N, I66P, I66Q, I66R, I66S, I66T,
I66M, I66W, I66Y, Y69A, Y69C, Y69D, Y69E, Y69G, Y69H, Y69K, Y69N,
Y69P, Y69Q, Y69R, Y69S, Y69T, C71H, C71P, W72A, W72C, W72D, W72E,
W72G, W72H, W72K, W72N, W72P, W72Q, W72R, W72S, W72T, W721, W72Y,
F75A, F75C, F75D, F75E, F75G, F75H, F75K, F75N, F75P, F75Q, F75R,
F75S, F75T, F77A, F77C, F77D, F77E, F77G, F77H, F77K, F77N, F77P,
F77Q, F77R, F77S, F77T, L84A, L84C, L84D, L84E, L84G, L84H, L84K,
L84N, L84P, L84Q, L84R, L84S, L84T, L84M, L84W, L84Y, V86I, V86L,
V86M, V86F, V86W, V86Y, V86A, V86C, V86D, V86E, V86G, V86H, V86K,
V86N, V86P, V86Q, V86R, V86S, V86T, I90A, I90C, I90D, I90E, I90G,
I90H, I90K, I90N, I90P, I90Q, I90R, I90S, I90T, I90M, I90W, K91A,
K91C, K91G, K91P, N92A, N92C, N92G, N92P, N92T, G93D, G93E, G93H,
G93K, G93N, G93P, G93Q, G93R, G93S, G93T, R94A, R94c, R94G, R94P,
C95D, C95E, C95G, C95H, C95K, C95N, C95P, C95Q, C95R, C95S, C95T,
E96P, E96T, Q97A, Q97C, Q97G, Q97P, F98A, F98C, F98D, F98E, F98G,
F98H, F98K, F98N, F98P, F98Q, F98R, F98S, F98T, F98M, F98W, F98Y,
K100A, K100C, K100G, K100P, N101H, N101T, A103D, A103E, A103H,
A103K, A103N, A103P, A103Q, A103R, A103S, A103T, D104T, K106H,
K106P, K106T, V107A, V107C, V107D, V107E, V107G, V107H, V107K,
V107N, V107P, V107Q, V107R, V107S, V107T, V108A, V108C, V108D,
V108E, V108G, V108H, V108K, V108N, V108P, V108Q, V108R, V108S,
V108T, V108F, V108M, V108W, V108Y, S110A, S110C, S110G, S110P,
C111D, C111E, C111H, C111K, C111N, C111P, C111Q, C111R, C111S,
C111T, T112A, T112C, T112G, T112P, E113D, E113H, E113P, G114D,
G114E, G114H, G114K, G114N, G114P, G114Q, G114R, G114S, G114T,
Y115A, Y115C, Y115D, Y115E, Y115G, Y115H, Y115K, Y115N, Y115P,
Y115Q, Y115R, Y115S, Y115T, Y115M, Y115W, R116P, R116T, L117A,
L117C, L117D, L117E, L117G, L117H, L117K, L117N, L117P, L117Q,
L117R, L117S, L117T, A118D, A118E, A118H, A118K, A118N, A118P,
A118Q, A118R, A118S, A118T, N120D, N120H, N120P, Q121T, S123H,
S123T, V128A, V128C, V128D, V128E, V128G, V128H, V128K, V128N,
V128P, V128Q, V128R, V128S, V128T, F130A, F130C, F130D, F130E,
F130G, F130H, F130K, F130N, F130P, F130Q, F130R, F130S, F130T,
V135A, V135C, V135D, V135E, V135G, V135H, V135K, V135N, V135P,
V135Q, V135R, V135S, V135T, V135W, V135Y, V137A, V137C, V137D,
V137E, V137G, V137H, V137K, V137N, V137P, V137Q, V137R, V137S,
V137T, V137M, V137W, V137Y, S138H, S138T, T140D, T140H, S141T,
K142H, K142P, L143A, L143C, L143D, L143E, L143G, L143H, L143K,
L143N, L143P, L143Q, L143R, L143S, L143T, L143F, L143I, L143M,
L143V, L143W, L143Y, R145H, R145P, R145T, A146P, A146T, T148H,
T148P, V149A, V149C, V149D, V149E, V149G, V149H, V149K, V149N,
V149P, V149Q, V149R, V149S, V149T, V149F, V149I, V149M, V149W,
V149Y, F150A, F150C, F150D, F150E, F150G, F150H, F150K, F150N,
F150P, F150Q, F150R, F150S, F150T, F150M, F150W, F150Y, D152A,
D152C, D152G, D152P, D152S, D152T, V153A, V153C, V153D, V153E,
V153G, V153H, V153K, V153N, V153P, V153Q, V153R, V153S, V153T,
V153F, V153I, V153M, V153W, V153Y, D154A, D154C, D154G, D154P,
D154Q, D154S, Y155A, Y155C, Y155D, Y155E, Y155G, Y155H, Y155K,
Y155N, Y155P, Y155Q, Y155R, Y155S, Y155T, Y155M, Y155V, Y155W,
V156A, V156C, V156D, V156E, V156G, V156H, V156K, V156N, V156P,
V156Q, V156R, V156S, V156T, V156I, V156M, V156W, V156Y, N157A,
N157C, N157G, N157H, N157P, N157Q, N157T, S158H, S158P, S158T,
T159A, T159C, T159G, T159P, E160A, E160C, E160G, E160P, A161C,
A161D, A161E, A161H, A161K, A161N, A161P, A161Q, A161R, A161S,
A161T, E162P, E162T, T163A, T163C, T163G, T163P, I164A, I164C,
I164D, I164E, I164G, I164H, I164K, I164N, I164P, I164Q, I164R,
I164S, I164T, L165A, L165C, L165D, L165E, L165G, L165H, L165K,
L165N, L165P, L165Q, L165R, L165S, L165T, L165M, L165W, L165Y,
I168A, I168C, I168D, I168E, I168G, I168H, I168K, I168N, I168P,
I168Q, I168R, I168S, I168T, F175A, F175C, F175D, F175E, F175G,
F175H, F175K, F175N, F175P, F175Q, F175R, F175S, F175T, F178A,
F178C, F178D, F178E, F178G, F178H, F178K, F178N, F178P, F178Q,
F178R, F178S, F178T, F178M, F178W, F178Y, T179A, T179C, T179G,
T179P, R180A, R180c, R180D, R180G, R180H, R180P, V181A, V181C,
V181D, V181E, V181G, V181H, V181K, V181N, V181P, V181Q, V181R,
V181S, V181T, V181F, V181I, V181M, V181W, V181Y, V182A, V182C,
V182D, V182E, V182G, V182H, V182K, V182N, V182P, V182Q, V182R,
V182S, V182T, V182F, V182I, V182M, V182W, V182Y, G183D, G183E,
G183H, G183K, G183N, G183P, G183Q, G183S, G183T, G184D, G184E,
G184H, G184K, G184N, G184P, G184Q, G184R, G184S, G184T, E185A,
E185C, E185G, E185H, E185P, E185T, D186A, D186C, D186G, D186H,
D186P, D186T, A187C, A187D, A187E, A187G, A187H, A187K, A187N,
A187P, A187Q, A187R, A187S, A187T, K188A, K188C, K188G, K188H,
K188P, K188T, G190D, G190E, G190H, G190K, G190N, G190P, G190Q,
G190R, G190S, G190T, F192A, F192C, F192D, F192E, F192G, F192H,
F192K, F192N, F192P, F192Q, F192R, F192S, F192T, F192W, F192Y,
W194A, W194C, W194D, W194E, W194G, W194H, W194K, W194N, W194P,
W194Q, W194R, W194S, W194T, Q195H, Q195P, Q195T, V196A, V196C,
V196D, V196E, V196G, V196H, V196K, V196N, V196P, V196Q, V196R,
V196S, V196T, V196F, V196I, V196M, V196W, V196Y, V197A, V197C,
V197D, V197E, V197G, V197H, V197K, V197N, V197P, V197Q, V197R,
V197S, V197T, V197F, V197I, V197M, V197W, V197Y, L198A, L198C,
L198D, L198E, L198G, L198H, L198K, L198N, L198P, L198Q, L198R,
L198S, L198T, L198I, L198Y, N199A, N199C, N199G, N199H, N199P,
N199S, N199T, G200P, G200T, K201A, K201C, K201D, K201E, K201G,
K201H, K201N, K201P, K201Q, K201S, K201T, V202A, V202C, V202D,
V202E, V202G, V202H, V202K, V202N, V202P, V202Q, V202R, V202S,
V202T, V202F, V202I, V202M, V202W, V202Y, D203A, D203C, D203G,
D203P, D203T, A204C, A204D, A204E, A204G, A204H, A204K, A204N,
A204P, A204Q, A204R, A204S, A204T, F205A, F205C, F205D, F205E,
F205G, F205H, F205K, F205N, F205P, F205Q, F205R, F205S, F205T,
F205M, F205V, F205W, F205Y, G207H, G207P, G208C, G208D, G208E,
G208H, G208K, G208N, G208P, G208Q, G208R, G208S, G208T, S209A,
S209C, S209G, S209P, I210A, I210C, I210D, I210E, I210G, I210H,
I210K, I210N, I210P, I210Q, I210R, I210S, I210T, I210F, I210W,
I210Y, V211A, V211C, V211D, V211E, V211G, V211H, V211K, V211N,
V211P, V211Q, V211R, V211S, V211T, V211F, V211I, V211M, V211W,
N212A, N212C, N212G, N212P, E213H, E213P, E213S, E213T, K214T,
W215A, W215C, W215D, W215E, W215G, W215H, W215K, W215N, W215P,
W215Q, W215R, W215S, W215T, I216A, I216C, I216D, I216E, I216G,
I216H, I216K, I216N, I216P, I216Q, I216R, I216S, I216T, V217A,
V217C, V217D, V217E, V217G, V217H, V217K, V217N, V217P, V217Q,
V217R, V217S, V217T, V217I, V217Y, A219H, A219P, A219T, V223A,
V223C, V223D, V223E, V223G, V223H, V223K, V223N, V223P, V223Q,
V223R, V223S, V223T, V223M, V223W, V223Y, G226P, V227A, V227C,
V227D, V227E, V227G, V227H, V227K, V227N, V227P, V227Q, V227R,
V227S, V227T, V227F, V227I, V227M, V227W, V227Y, K228A, K228C,
K228G, K228H, K228P, I229A, I229C, I229D, I229E, I229G, I229H,
I229K, I229N, I229P, I229Q, I229R, I229S, I229T, I229M, I229W,
I229Y, T230A, T230C, T230G, T230P, V231A, V231C, V231D, V231E,
V231G, V231H, V231K, V231N, V231P, V231Q, V231R, V231S, V231T,
V232A, V232C, V232D, V232E, V232G, V232H, V232K, V232N, V232P,
V232Q, V232R, V232S, V232T, V232F, V232I, V232M, V232W, V232Y,
A233C, A233D, A233E, A233G, A233H, A233K, A233N, A233P, A233Q,
A233R, A233S, A233T, A233V, G234D, G234E, G234H, G234K, G234N,
G234P, G234Q, G234R, G234S, G234T, E235H, E235N, E235P, E235Q,
E235S, E235T, H236A, H236C, H236G, H236P, N237A, N237C, N237G,
N237P, N237T, I238A, I238C, I238D, I238E, I238G, I238H, I238K,
I238N, I238P, I238Q, I238R, I238S, I238T, E239A, E239C, E239G,
E239P, E240H, E240T, V250A, V250C, V250D, V250E, V250G, V250H,
V250K, V250N, V250P, V250Q, V250R, V250S, V250T, V250M, V250W,
V250Y, I251A, I251C, I251D, I251E, I251G, I251H, I251K, I251N,
I251P, I251Q, I251R, I251S, I251T, I253A, I253C, I253D, I253E,
I253G, I253H, I253K, I253N, I253P, I253Q, I253R, I253S, I253T,
I253M, I253W, I253Y, I254A, I254C, I254D, I254E, I254G, I254H,
I254K, I254N, I254P, I254Q, I254R, I254S, I254T, P255H, H256P,
H256T, H257A, H257C, H257G, H257P, N258P, N258T, Y259A, Y259C,
Y259D, Y259E, Y259G, Y259H, Y259K, Y259N, Y259P, Y259Q, Y259R,
Y259S, Y259T, Y259M, Y259W, Y259F, N260A, N260C, N260G, N260P,
A261D, A261E, A261H, A261K, A261N, A261P, A261Q, A261R, A261S,
A261T, A262C, A262D, A262E, A262G, A262H, A262K, A262N, A262P,
A262Q, A262R, A262S, A262T, I263A, I263C, I263D, I263E, I263G,
I263H, I263K, I263N, I263P, I263Q, I263R, I263S, I263T, I263M,
I263V, I263W, I263Y, N264A, N264C, N264D, N264G, N264H, N264P,
K265A, K265C, K265G, K265H, K265P, K265T, Y266A, Y266C, Y266D,
Y266E, Y266G, Y266H, Y266K, Y266N, Y266P, Y266Q, Y266R, Y266S,
Y266T, Y266M, Y266W, N267A, N267C, N267G, N267H, N267P, N267T,
H268P, D269A, D269C, D269E, D269G, D269H, D269N, D269P, D269Q,
D269S, D269T, I270A, I270C, I270D, I270E, I270G, I270H, I270K,
I270N, I270P, I270Q, I270R, I270S, I270T, I270M, I270W, A271C,
A271D, A271E, A271G, A271H, A271K, A271N, A271P, A271Q, A271R,
A271S, A271T, L272A, L272C, L272D, L272E, L272G, L272H, L272K,
L272N, L272P, L272Q, L272R, L272S, L272T, L272F, L273A, L273C,
L273D, L273E, L273G, L273H, L273K, L273N, L273P, L273Q, L273R,
L273S, L273T, L273F, L273I, L273M, L273V, L273W, L273Y, E274A,
E274C, E274G, E274P, E274T, L275A, L275C, L275D, L275E, L275G,
L275H, L275K, L275N, L275P, L275Q, L275R, L275S, L275T, L275W,
L275Y, D276P, D276S, D276T, E277A, E277C, E277G, E277P, E277V,
E277N, E277D, E277E, E277Q, E277H, E277I, E277L, E277M, E277F,
E277S, E277T, E277W, E277Y, P278T, L279A, L279C, L279D, L279E,
L279G, L279H, L279K, L279N, L279P, L279Q, L279R, L279S, L279T,
L279I, L279Y, V280A, V280C, V280D, V280E, V280G, V280H, V280K,
V280N, V280P, V280Q, V280R, V280S, V280T, V280F, V280I, V280W,
V280Y, L281A, L281C, L281D, L281E, L281G, L281H, L281K, L281N,
L281P, L281Q, L281R, L281S, L281T, L281F, L281I, L281V, L281W,
L281Y, S283A, S283C, S283G, S283P, Y284A, Y284C, Y284D, Y284E,
Y284G, Y284H, Y284K, Y284N, Y284P, Y284Q, Y284R, Y284S, Y284T,
Y284M, V285A, V285C, V285D, V285E, V285G, V285H, V285K, V285N,
V285P, V285Q, V285R, V285S, V285T, V285M, V285W, V285Y, T286A,
T286C, T286G, T286P, I288A, I288C, I288D, I288E, I288G, I288H,
I288K, I288N, I288P, I288Q, I288R, I288S, I288T, C289D, C289H,
C289P, I290A, I290C, I290D, I290E, I290G, I290H, I290K, I290N,
I290P, I290Q, I290R, I290S, I290T, I290Y, A291D, A291E, A291H,
A291K, A291N, A291P, A291Q, A291R, A291S, A291T, D292A, D292C,
D292G, D292P, D292T, K293H, K293P, K293T, Y295A, Y295C, Y295D,
Y295E, Y295G, Y295H, Y295K, Y295N, Y295P, Y295Q, Y295R, Y295S,
Y295T, Y295W, T296A, T296C, T296G, T296P, N297A, N297C, N297G,
N297P, I298A, I298C, I298D, I298E, I298G, I298H, I298K, I298N,
I298P, I298Q, I298R, I298S, I298T, F299A, F299C, F299D, F299E,
F299G, F299H, F299K, F299N, F299P, F299Q, F299R, F299S, F299T,
L300A, L300C, L300D, L300E, L300G, L300H, L300K, L300N, L300P,
L300Q, L300R, L300S, L300T, L300F, L300I, L300M, L300V, L300W,
L300Y, K301A, K301C, K301G, K301P, K301T, F302A, F302C, F302D,
F302E, F302G, F302H, F302K, F302N, F302P, F302Q, F302R, F302S,
F302T, G303H, G303P, G303T, S304A, S304C, S304G, S304P, S304T,
G305D, G305E, G305H, G305N, G305P, G305Q, G305S, G305T, Y306A,
Y306C, Y306D, Y306E, Y306G, Y306H, Y306K, Y306N, Y306P, Y306Q,
Y306R, Y306S, Y306T, V307A, V307C, V307D, V307E, V307G, V307H,
V307K, V307N, V307P, V307Q, V307R, V307S, V307T, S308P, S308T,
W310A, W310C, W310D, W310E, W310G, W310H, W310K, W310N, W310P,
W310Q, W310R, W310S, W310T, G311H, V313A, V313C, V313D, V313E,
V313G, V313H, V313K, V313N, V313P, V313Q, V313R, V313S, V313T,
F314A, F314C, F314D, F314E, F314G, F314H, F314K, F314N, F314P,
F314Q, F314R, F314S, F314T, F314M, F314W, F314Y, H315A, H315C,
H315G, H315P, K316A, K316C, K316G, K316P, G317C, G317D, G317E,
G317H, G317K, G317N, G317P, G317Q, G317R, G317S, G317T, R318A,
R318c, R318G, R318P, S319D, S319H, S319N, S319P, S319Q, A320C,
A320D, A320E, A320G, A320H, A320K, A320N, A320P, A320Q, A320R,
A320S, A320T, L321A, L321C, L321D, L321E, L321G, L321H, L321K,
L321N, L321P, L321Q, L321R, L321S, L321T, V322A, V322C, V322D,
V322E, V322G, V322H, V322K, V322N, V322P, V322Q, V322R, V322S,
V322T, V322W, V322Y, L323A, L323C, L323D, L323E, L323G, L323H,
L323K, L323N, L323P, L323Q, L323R, L323S, L323T, L323F, L323I,
L323M, L323V, L323W, L323Y, Q324A, Q324C, Q324G, Q324P, Y325A,
Y325C, Y325D, Y325E, Y325G, Y325H, Y325K, Y325N, Y325P, Y325Q,
Y325R, Y325S, Y325T, Y325W, L326A, L326C, L326D, L326E, L326G,
L326H, L326K, L326N, L326P, L326Q, L326R, L326S, L326T, L326F,
L326I, L326M, L326V, L326W, L326Y, R327A, R327c, R327G, R327H,
R327P, V328A, V328C, V328D, V328E, V328G, V328H, V328K, V328N,
V328P, V328Q, V328R, V328S, V328T, V328F, V328I, V328M, V328W,
V328Y, L330A, L330C, L330D, L330E, L330G, L330H, L330K, L330N,
L330P, L330Q, L330R, L330S, L330T, L330F, L330I, L330V, L330W,
L330Y, V331A, V331C, V331D, V331E, V331G, V331H, V331K, V331N,
V331P, V331Q, V331R, V331S, V331T, V331F, V331I, V331M, V331W,
V331Y, D332A, D332C, D332G, D332P, R333A, R333c, R333D, R333E,
R333G, R333H, R333N, R333P, R333Q, R333R, R333S, R333T, A334C,
A334D, A334E, A334G, A334H, A334K, A334N, A334P, A334Q, A334R,
A334S, A334T, T335A, T335C, T335G, T335P, C336D, C336E, C336H,
C336K, C336N, C336P, C336Q, C336R, C336S, C336T, L337A, L337C,
L337D, L337E, L337G, L337H, L337K, L337N, L337P, L337Q, L337R,
L337S, L337T, R338A, R338E, R338V, R338T, R338c, R338G, R338P,
R338I, R338F, R338W, R338S, S339P, S339T, K341A, K341C, K341G,
K341P, F342A, F342C, F342D, F342E, F342G, F342H, F342K, F342N,
F342P, F342Q, F342R, F342S, F342T, F342M, F342W, T343A, T343C,
T343G, T343P, I344A, I344C, I344D, I344E, I344G, I344H, I344K,
I344N, I344P, I344Q, I344R, I344S, I344T, Y345F, Y345A, Y345C,
Y345D, Y345E, Y345G, Y345H, Y345K, Y345N, Y345P, Y345Q, Y345R,
Y345S, Y345T, Y345M, Y345W, N346A, N346C, N346G, N346P, N347H,
N347P, M348A, M348C, M348D, M348E, M348G, M348H, M348K, M348N,
M348P, M348Q, M348R, M348S, M348T, F349A, F349C, F349D, F349E,
F349G, F349H, F349K, F349N, F349P, F349Q, F349R, F349S, F349T,
F349I, F349M, F349W, F349Y, C350D, C350H, C350P, C350T, A351E,
A351H, A351N, A351P, A351Q, A351R, A351S, A351T, G352A, G352C,
G352P, F353A, F353C, F353D, F353E, F353G, F353H, F353K, F353N,
F353P, F353Q, F353R, F353S, F353T, F353I, F353M, F353W, H354A,
H354C, H354G, H354P, E355A, E355C, E355D, E355G, E355H, E355K,
E355N, E355P, E355Q, E355S, E355T, G356D, G356E, G356H, G356K,
G356N, G356P, G356Q, G356R, G356S, G356T, G357D, G357E, G357H,
G357K, G357N, G357P, G357Q, G357R, G357S, G357T, R358D, R358E,
R358H, R358K, R358N, R358P, R358Q, R358R, R358S, R358T, D359A,
D359C, D359G, D359P, D359Q, D359S, D359T, S360A, S360C, S360G,
S360P, C361D, C361E, C361H, C361K, C361N, C361P, C361Q, C361R,
C361S, C361T, V370A, V370C, V370D, V370E, V370G, V370H, V370K,
V370N, V370P, V370Q, V370R, V370S, V370T, V370W, V370Y, V373A,
V373C, V373D, V373E, V373G, V373H, V373K, V373N, V373P, V373Q,
V373R, V373S, V373T, V373F, V373I, V373M, V373W, E374A, E374C,
E374G, E374P, G375H, S377A, S377C, S377G, S377P, F378A, F378C,
F378D, F378E, F378G, F378H, F378K, F378N, F378P, F378Q, F378R,
F378S, F378T, F378W, L379A, L379C, L379D, L379E,
L379G, L379H, L379K, L379N, L379P, L379Q, L379R, L379S, L379T,
L379I, L379M, L379W, L379Y, T380A, T380C, T380G, T380P, G381D,
G381E, G381H, G381K, G381N, G381P, G381Q, G381R, G381S, G381T,
I382A, I382C, I382D, I382E, I382G, I382H, I382K, I382N, I382P,
I382Q, I382R, I382S, I382T, I382M, I382W, I382Y, I383A, I383C,
I383D, I383E, I383G, I383H, I383K, I383N, I383P, I383Q, I383R,
I383S, I383T, I383V, S384A, S384C, S384G, S384P, W385A, W385C,
W385D, W385E, W385G, W385H, W385K, W385N, W385P, W385Q, W385R,
W385S, W385T, W385M, E387A, E387C, E387G, E387H, E387P, E387T,
E388H, E388N, E388G, E388P, E388Q, E388T, A390C, A390D, A390E,
A390G, A390H, A390K, A390N, A390P, A390Q, A390R, A390S, M391A,
M391C, M391D, M391E, M391G, M391H, M391K, M391N, M391P, M391Q,
M391R, M391S, M391T, M391F, M391I, M391W, M391Y, K392A, K392C,
K392G, K392P, G393C, G393D, G393E, G393H, G393K, G393N, G393P,
G393Q, G393R, G393S, G393T, Y395A, Y395C, Y395D, Y395E, Y395G,
Y395H, Y395K, Y395N, Y395P, Y395Q, Y395R, Y395S, Y395T, Y398A,
Y398C, Y398D, Y398E, Y398G, Y398H, Y398K, Y398N, Y398P, Y398Q,
Y398R, Y398S, Y398T, K400H, V401A, V401C, V401D, V401E, V401G,
V401H, V401K, V401N, V401P, V401Q, V401R, V401S, V401T, V401F,
V401I, V401M, V401W, V401Y, S402A, S402C, S402G, S402P, R403A,
R403c, R403G, R403P, R403T, Y404A, Y404C, Y404D, Y404E, Y404G,
Y404H, Y404K, Y404N, Y404P, Y404Q, Y404R, Y404S, Y404T, V405A,
V405C, V405D, V405E, V405G, V405H, V405K, V405N, V405P, V405Q,
V405R, V405S, V405T, V405W, V405Y, N406F, N406H, N406I, N406L,
N406P, N406W, N406Y, W407D, W407E, W407F, W407H, W407I, W407K,
W407N, W407P, W407Q, W407R, W407S, W407T, W407Y, I408D, I408E,
I408H, I408K, I408N, I408P, I408Q, I408R, I408S, I408T, K409F,
K409H, K409I, K409P, K409T, K409V, K409W, K409Y, E410H, K411A,
K411C, K411G, K411I, K411P, K411T, K411V, K411W, K411Y, K413T, Y1I,
S3Q, S3H, S3N, G4Q, G4H, G4N, K5N, K5Q, L6I, L6V, E7Q, E7H, E7N,
E8Q, E8H, E8N, F9V, E15Q, E15N, R16H, R16Q, E17Q, E17H, E17N, E20Q,
E20H, E20N, E21Q, E21H, E21N, K22N, K22Q, S24Q, S24N, F25V, E26Q,
E26H, E26N, E27Q, E27N, R29H, R29Q, E30Q, E30N, F32I, F32V, T35Q,
T35H, T35N, E36Q, E36H, E36N, R37H, R37Q, T38Q, T38H, T38N, T39Q,
T39H, T39N, E40Q, E40H, E40N, F41I, F41V, K43N, K43Q, Y451, D47N,
D47Q, G48Q, G48H, G48N, D49N, E52Q, E52H, E52N, S53Q, S53N, P55A,
P55S, L57V, N58Q, N58S, G59Q, G59H, G59N, G60Q, G60N, S61Q, S61H,
S61N, K63N, K63Q, D64N, D64Q, D65N, D65Q, S68Q, S68H, S68N, Y69I,
E70Q, E70H, E70N, P74A, P74S, F75I, F75V, G76Q, G76H, G76N, F77I,
F77V, E78Q, E78H, E78N, G79Q, G79H, G79N, K80N, K80Q, E83Q, E83H,
E83N, L84I, L84V, D85N, D85Q, T87Q, T87H, T87N, K91N, K91Q, N92I,
N92S, R94H, R94Q, E96Q, E96H, E96N, F981, F98V, K100N, K100Q,
S102Q, S102H, S102N, D104N, D104Q, K106N, K106Q, S110Q, S110H,
S110N, T112Q, T112H, T112N, E113Q, E113N, Y115I, R116H, R116Q,
L117I, L117V, E119Q, E119H, E119N, K122N, K122Q, S123Q, S123N,
E125Q, E125H, E125N, P126A, P126S, A127Q, A127H, A127N, P129A,
P129S, P131A, P131S, G133Q, G133H, G133N, R134H, R134Q, S136Q,
S136H, S136N, S138Q, S138N, T140Q, T140N, S141Q, S141H, S141N,
K142N, K142Q, T144Q, T144H, T144N, R145Q, A146Q, A146H, A146N,
E147Q, E147H, E147N, T148Q, T148N, P151A, P151S, D152N, D152Q,
D154N, Y155I, S158Q, S158N, T159Q, T159H, T159N, E160Q, E160H,
E160N, E162Q, E162H, E162N, T163Q, T163H, T163N, L165I, L165V,
D166N, D166Q, T169Q, T169H, T169N, S171Q, S171H, S171N, T172Q,
T172H, T172N, S174Q, S174H, S174N, F175I, F175V, D177N, D177Q,
F178I, F178V, T179Q, T179H, T179N, R180Q, E185Q, E185N, D186N,
D186Q, K188N, K188Q, P189A, P189S, F192I, F192V, F192H, P193A,
P193S, W194I, L198V, N199Q, G200Q, G200H, G200N, D203N, D203Q,
F205I, G207Q, G207N, S209Q, S209H, S209N, E213Q, E213N, K214N,
K214Q, T218Q, T218H, T218N, A219Q, A219N, A220Q, A220H, A220N,
E224Q, E224H, E224N, T225Q, T225H, T225N, G226Q, G226H, G226N,
K228N, K228Q, T230Q, T230H, T230N, E239Q, E239H, E239N, E240Q,
E240N, T241Q, T241H, T241N, E242Q, E242H, E242N, T244Q, T244H,
T244N, E245Q, E245H, E245N, K247N, K247Q, R248H, R248Q, R252H,
R252Q, P255A, P255S, Y259I, K265N, K265Q, Y266I, L272I, L272V,
E274Q, E274H, E274N, L275I, L275V, D276N, D276Q, E277Q, E277H,
E277N, P278A, P278S, L279V, S283Q, S283H, S283N, Y284I, T286Q,
T286H, T286N, P287A, P287S, D292N, D292Q, K293N, K293Q, E294Q,
E294H, E294N, Y295I, T296Q, T296H, T296N, F299I, F299V, K301N,
K301Q, F302I, F302V, G303Q, G303N, S304Q, S304H, S304N, Y306I,
S308Q, S308H, S308N, G309Q, G309H, G309N, G311Q, G311N, R312H,
R312Q, F314I, F314V, K316N, K316Q, R318H, R318Q, L321I, L321V,
Y325I, R327Q, P329A, P329S, D332N, D332Q, T335Q, T335H, T335N,
L337I, L337V, R338H, R338Q, S339Q, S339H, S339N, T340Q, T340H,
T340N, K341N, K341Q, F342I, F342V, T343Q, T343H, T343N, Y345I,
M348I, M348V, F349V, G352Q, G352H, G352N, F353V, D359N, S360Q,
S360H, S360N, G363Q, G363H, G363N, D364N, D364Q, S365Q, S365H,
S365N, G366Q, G366H, G366N, G367Q, G367H, G367N, P368A, P368S,
T371Q, T371H, T371N, E372Q, E372H, E372N, E374Q, E374H, E374N,
G375Q, G375N, T376Q, T376H, T376N, S377Q, S377H, S377N, F378I,
F378V, L379V, T380Q, T380H, T380N, S384Q, S384H, S384N, G386Q,
G386H, G386N, E387Q, E387N, M391V, K392N, K392Q, K394N, K394Q,
Y395I, G396Q, G396H, G396N, I397Q, I397H, I397N, Y398I, T399Q,
T399H, T399N, K400N, K400Q, S402Q, S402H, S402N, R403H, R403Q,
Y404I, K409N, K409Q, E410Q, E410N, K411N, K411Q, T412Q, T412H,
T412N, K413N, K413Q, L414I, L414V, T415Q, T415H, T415N, R252A,
H268A, K293A, K400A, R403A, R403E and K411A.
[0027] In some instances, the modified FIX polypeptides provided
herein exhibit increased resistance to antithrombin III, heparin
and/or the AT-III/heparin complex compared with the unmodified FIX
polypeptide. For example, the modified FIX polypeptides can exhibit
at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, 100%, 200%, 300%, 400%, 500% or more increased
resistance to antithrombin III and/or heparin compared with the
unmodified FIX polypeptide. In further instances, the modified FIX
polypeptides exhibit increased catalytic activity compared with the
unmodified FIX polypeptide. This can be in the presence or absence
of FVIIIa. For example, the modified FIX polypeptides can exhibit
at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, 100%, 200%, 300%, 400%, 500% or more catalytic
activity compared to an unmodified FIX polypeptide.
[0028] The modified FIX polypeptides further can exhibit improved
pharmacokinetic properties compared with the unmodified FIX
polypeptide, such as, for example, decreased clearance (e.g. at
least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98% or 99% of the clearance of an unmodified FIX polypeptide),
altered volume of distribution (e.g. decreased by at least or about
1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the
volume of distribution of an unmodified FIX polypeptide, or
increased by at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%,
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500% or more of
the volume of distribution of an unmodified FIX polypeptide),
increased in vivo recovery (e.g. by at least or about 1%, 2%, 3%,
4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 200%, 300%,
400%, 500% or more of the in vivo recovery of an unmodified FIX
polypeptide), increased total modified FIX polypeptide exposure in
vivo (e.g. increased by at least or about 1%, 2%, 3%, 4%, 5%, 6%,
7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500% or
more of the total exposure in vivo an unmodified FIX polypeptide),
increased serum half-life (e.g. by at least or about 1%, 2%, 3%,
4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 200%, 300%,
400%, 500% or more of the serum half-life an unmodified FIX
polypeptide), and/or increased mean resonance time (MRT) compared
to the unmodified FIX polypeptide (e.g. increased by at least or
about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%,
100%, 200%, 300%, 400%, 500% or more of the MRT in vivo an
unmodified FIX polypeptide). In some instances, wherein the
improved pharmacokinetic property increased serum half-life, the
serum half life is .alpha., .beta. or .gamma. phase.
[0029] In some instances, the modified FIX polypeptides provided
herein exhibit increased procoagulant activity compared with the
unmodified FIX polypeptide, such as, for example, at least or about
1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%,
200%, 300%, 400%, 500% or more than the procoagulant activity of an
unmodified FIX polypeptide.
[0030] In some examples, the unmodified FIX polypeptide has a
sequence of amino acids set forth in SEQ ID NO:3. Thus, provided
herein are modified FIX polypeptides having a sequence of amino
acids set forth in any of SEQ ID NOS: 75-272). In other examples,
the unmodified FIX polypeptide is a variant of the polypeptide set
forth in SEQ ID NO:3, such as an allelic or species variant having
40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, or 99% sequence identity to the polypeptide set forth in SEQ
ID NO: 3, excluding the modification(s).
[0031] In some instances, the provided modified FIX polypeptides
are human polypeptides. In other instances, they are non-human
polypeptides. In further examples, the modified FIX polypeptides
are mature polypeptide. Also provided are single chain and
two-chain FIX polypeptides, and active or activated FIX
polypeptides. In some examples, activation is effected by
proteolytic cleavage by Factor IX (FIXa) or the Tissue
Factor/Factor VIIa complex.
[0032] In some examples, the provided modified FIX polypeptides
have only the primary sequence modified. In other examples, a
chemical modification or a post-translational modification is
contained (e.g. the modified FIX polypeptides are glycosylated,
carboxylated, hydroxylated, sulfated, phosphorylated, aluminated,
or conjugated to a polyethylene glycol (PEG) moiety). Also provided
are chimeric and fusion FIX polypeptides.
[0033] The modified FIX polypeptides provided herein can contain 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, or 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 20, 30, 40, 50 or 60 or more modifications, so long
as the polypeptide retains at least one FIX activity (e.g. Factor
VIIIa binding, Factor X binding, phospholipid binding, and/or
coagulant activity) of the unmodified FIX polypeptide. For example,
the modified FIX polypeptide can retain at least about or 1%, 2%,
3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%,
97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more of an activity
of the unmodified FIX polypeptide. In some examples, the activities
that are retained are increased compared to the unmodified FIX
polypeptide. In other examples, the activities that are retained
are decreased compared to the unmodified FIX polypeptide. The
activities can be measured in vitro, ex vivo or in vivo.
[0034] Provided herein are nucleic acid molecules containing a
sequence of nucleotides encoding any of the provided modified FIX
polypeptides. Also provided are vectors containing the nucleic acid
molecules. The vector can be, for example, a prokaryotic vector,
viral vector (e.g. an adenovirus, an adeno-associated-virus, a
retrovirus, a herpes virus, a lentivirus, a poxvirus, or a
cytomegalovirus), or a eukaryotic vector (e.g. a mammalian vector).
Also provided are cells containing these vectors. The cell can be,
for example, a eukaryotic cell, such as a mammalian cell (e.g. baby
hamster kidney cells (BHK-21) or 293 cells or CHO cells).
Typically, the cell expresses the modified FIX polypeptide. Thus,
also provided are modified FIX polypeptides that are produced by
any of the cells provided herein.
[0035] Provided are pharmaceutical composition, containing a
therapeutically effective concentration or amount of a modified FIX
polypeptide provided herein, in a pharmaceutically acceptable
vehicle. In some examples, the pharmaceutical composition is
formulated for local, systemic, or topical administration, such as
oral, nasal, pulmonary, buccal, transdermal, subcutaneous,
intraduodenal, enteral, parenteral, intravenous, or intramuscular
administration. In further examples, it is formulated for
controlled-release or for single-dosage administration.
[0036] Provided are methods in which a subject is treated by
administering the provided pharmaceutical compositions, wherein the
subject has a disease or condition that is treated by
administration of FIX or a procoagulant. In some instances, the
disease or condition is treated by administration of active FIX
(FIXa) or FIX that is not activated. In some examples, treatment
with the pharmaceutical composition ameliorates or alleviates the
symptoms associated with the disease or condition. Also provided
are methods that contain a step of monitoring the subject for
changes in the symptoms associated with disease or condition that
is treated by administration of FIX or a procoagulant.
[0037] The disease or condition to be treated using the methods can
be selected from among blood coagulation disorders, hematologic
disorders, hemorrhagic disorders, hemophilias, and bleeding
disorders. In some examples, the hemophilia is hemophilia B. The
methods also can involve administering one or more additional
coagulation factors, such as, for example, plasma purified or
recombinant coagulation factors, procoagulants, such as vitamin K,
vitamin K derivative and protein C inhibitors, plasma, platelets,
red blood cells or corticosteroids.
[0038] Also provided are articles of manufacture, containing
packaging material and a pharmaceutical composition containing a
provided modified FIX polypeptide contained within the packaging
material. The modified FIX polypeptide is effective for treatment
of a disease treatable by administration of FIX or a procoagulant,
and the packaging material includes a label that indicates that the
modified FIX polypeptide is used for treatment of a disease
treatable by administration of FIX or a procoagulant.
[0039] Kits containing any of the pharmaceutical compositions
provided herein, a device for administration of the composition
and, optionally, instructions for administration also are
provided.
BRIEF DESCRIPTION OF THE FIGURES
[0040] FIG. 1 depicts the coagulation cascade. The figure shows the
intrinsic pathway and the extrinsic pathway of coagulation for the
independent production of FXa and convergence of the pathways to a
common pathway to generate thrombin and fibrin for the formation of
a clot. These pathways are interconnected. The figure depicts the
order of molecules involved in the activation cascade in which a
zymogen is converted to an activated protease by cleavage of one or
more peptide bonds. The activated protease then serves as the
activating protease for the next zymogen molecule in the cascade,
ultimately resulting in clot formation.
[0041] FIG. 2 depicts the cell based model of coagulation (see e.g.
Hoffman et al. (2001) Thromb Haemost 85:958-965). The figure
depicts the coagulation events as being separated into three
phases, where initiation of coagulation is effected by the
activation of FX to FXa by the TF/FVIIa complex on the TF-bearing
cell, resulting in the generation of a small amount of thrombin
after activation by FXa/FVa. Amplification takes place when
thrombin binds to and activates the platelets, and initiates the
activation of sufficient quantities of the appropriate coagulation
factors to form the FVIIIa/FIXa and FVa/FXa complexes. Propagation
of coagulation occurs on the surface of large numbers of activated
platelets at the site of injury, resulting in a burst of thrombin
generation that is sufficiently large to generate enough fibrin
from fibrinogen to establish a clot at the site of injury.
[0042] FIG. 3 is an alignment of various Factor IX polypeptides,
including species variants and modified Factor IX polypeptides (SEQ
ID NOS:2-5, 14, 20, 172, 267, 247, 325, 346-347, 360, 365-366,
406). Also included are SEQ ID NO:6 from U.S. Pat. No. 7,700,734
containing mutations V86A/E277A/R338A and SEQ ID NO:2 from U.S.
Pat. No. 7,125,841. A "*" means that the residues or nucleotides in
that column are identical in all sequences in the alignment, a ":"
means that conserved substitutions have been observed, and a "."
means that semi-conserved substitutions are observed. As described
herein, residues corresponding to positions in SEQ ID NO:3 can be
determined by alignment with SEQ ID NO:3. Residues corresponding to
Y155, R318, R338, T343, R403 and E410 are indicated in boxed
text.
DETAILED DESCRIPTION
[0043] Outline
[0044] A. Definitions
[0045] B. Hemostasis and Role of Factor IX Therein [0046] 1.
Platelet adhesion and aggregation [0047] 2. Coagulation cascade
[0048] a. Initiation [0049] b. Amplification [0050] c. Propagation
[0051] 3. Regulation of Coagulation
[0052] C. Factor IX (FIX) Structure and Function [0053] 1. FIX
structure [0054] 2. FIX post-translational modification [0055] 3.
FIX activation [0056] 4. FIX function [0057] 5. FIX as a
biopharmaceutical
[0058] D. Modified FIX polypeptides [0059] 1. Exemplary Amino Acid
Replacements [0060] a. Altered glycosylation [0061] i. Advantages
of glycosylation [0062] ii. Exemplary modified FIX polypeptides
with altered glycosylation [0063] (a). Introduction of non-native
glycosylation site(s) [0064] (b). Elimination of native
glycosylation sites [0065] b. Increased resistance to AT-III and
heparin [0066] i. AT-III [0067] ii. Heparin [0068] iii. Exemplary
FIX polypeptides with increased resistance to AT-III and heparin
[0069] c. Mutations to increase catalytic activity [0070] d.
Mutations to decrease LRP binding [0071] e. Other mutations to
alter posttranslational modification [0072] 2. Combination
modifications [0073] a. Modifications to increase activity [0074]
b. Modifications that increase affinity for phospholipids or reduce
binding to collagen [0075] c. Additional modifications to increase
resistance to inhibitors [0076] d. Additional modifications to
alter glycosylation [0077] e. Modifications to increase resistance
to proteases [0078] f. Modifications to reduce immunogenicity
[0079] g. Exemplary combination modifications [0080] 3. Conjugates
and fusion proteins
[0081] E. Production of FIX polypeptides [0082] 1. Vectors and
Cells [0083] 2. Expression systems [0084] a. Prokaryotic expression
[0085] b. Yeast [0086] c. Insects and insect cells [0087] d.
Mammalian cells [0088] e. Plants [0089] 2. Purification [0090] 3.
Fusion Proteins [0091] 4. Polypeptide modification [0092] 5.
Nucleotide sequences
[0093] F. Assessing modified FIX polypeptide activities [0094] 1.
In vitro assays [0095] a. Glycosylation [0096] b. Other
post-translational modifications [0097] c. Proteolytic activity
[0098] d. Coagulation activity [0099] e. Binding to and/or
inhibition by other proteins and molecules [0100] e. Phospholipid
affinity [0101] 2. Non-human animal models [0102] 3. Clinical
Assays
[0103] G. Formulation and Administration [0104] 1. Formulations
[0105] a. Dosages [0106] b. Dosage forms [0107] 2. Administration
of modified FIX polypeptides [0108] 3. Administration of nucleic
acids encoding modified FIX polypeptides (gene therapy)
[0109] H. Therapeutic Uses [0110] Hemophilia [0111] a. Hemophilia B
[0112] b. Hemophilia A
[0113] J. Combination Therapies
[0114] K. Articles of manufacture and kits
[0115] L. Examples
A. DEFINITIONS
[0116] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which the invention(s) belong. All patents,
patent applications, published applications and publications,
Genbank sequences, databases, websites and other published
materials referred to throughout the entire disclosure herein,
unless noted otherwise, are incorporated by reference in their
entirety. In the event that there are a plurality of definitions
for terms herein, those in this section prevail. Where reference is
made to a URL or other such identifier or address, it is understood
that such identifiers can change and particular information on the
internet can come and go, but equivalent information can be found
by searching the internet. Reference thereto evidences the
availability and public dissemination of such information.
[0117] As used herein, coagulation pathway or coagulation cascade
refers to the series of activation events that leads to the
formation of an insoluble fibrin clot. In the coagulation cascade
or pathway, an inactive protein of a serine protease (also called a
zymogen) is converted to an active protease by cleavage of one or
more peptide bonds, which then serves as the activating protease
for the next zymogen molecule in the cascade. In the final
proteolytic step of the cascade, fibrinogen is proteolytically
cleaved by thrombin to fibrin, which is then crosslinked at the
site of injury to form a clot.
[0118] As used herein, "hemostasis" refers to the stopping of
bleeding or blood flow in an organ or body part. The term
hemostasis can encompass the entire process of blood clotting to
prevent blood loss following blood vessel injury to subsequent
dissolution of the blood clot following tissue repair.
[0119] As used herein, "clotting" or "coagulation" refers to the
formation of an insoluble fibrin clot, or the process by which the
coagulation factors of the blood interact in the coagulation
cascade, ultimately resulting in the formation of an insoluble
fibrin clot.
[0120] As used herein, a "protease" is an enzyme that catalyzes the
hydrolysis of covalent peptidic bonds. These designations include
zymogen forms and activated single-, two- and multiple-chain forms
thereof. For clarity, reference to proteases refer to all forms.
Proteases include, for example, serine proteases, cysteine
proteases, aspartic proteases, threonine and metallo-proteases
depending on the catalytic activity of their active site and
mechanism of cleaving peptide bonds of a target substrate.
[0121] As used herein, serine proteases or serine endopeptidases
refers to a class of peptidases, which are characterized by the
presence of a serine residue in the active site of the enzyme.
Serine proteases participate in a wide range of functions in the
body, including blood clotting and inflammation, as well as
functioning as digestive enzymes in prokaryotes and eukaryotes. The
mechanism of cleavage by serine proteases is based on nucleophilic
attack of a targeted peptidic bond by a serine. Cysteine, threonine
or water molecules associated with aspartate or metals also can
play this role. Aligned side chains of serine, histidine and
aspartate form a catalytic triad common to most serine proteases.
The active site of serine proteases is shaped as a cleft where the
polypeptide substrate binds.
[0122] As used herein, a "factor IX" or FIX polypeptide refers to
any factor IX polypeptide including, but not limited to, a
recombinantly produced polypeptide, a synthetically produced
polypeptide and a factor IX polypeptide extracted or isolated from
cells or tissues including, but not limited to, liver and blood.
Alternative names that are used interchangeably for factor IX
include Factor 9, Christmas factor, plasma thromboplastin component
(PTC), coagulation factor IX, and serum factor IX. Abbreviations
for factor IX include FIX and F9. Factor IX includes related
polypeptides from different species including, but not limited to
animals of human and non-human origin. Human factor IX (hFIX)
includes factor IX, allelic variant isoforms (such as the allelic
variant having a T148A (SEQ ID NO:20 or 325) or T412P mutation),
synthetic molecules from nucleic acids, protein isolated from human
tissue and cells, and modified forms thereof. Exemplary unmodified
mature human factor IX polypeptides include, but are not limited
to, unmodified and wild-type native factor IX polypeptides (such as
the polypeptide containing a sequence set forth in SEQ ID NO:3) and
the unmodified and wild-type precursor factor IX polypeptide that
includes a propeptide and/or a signal peptide (such as, the
precursor FIX polypeptide that has the sequence set forth in SEQ ID
NO:2). One of skill in the art would recognize that the referenced
positions of the mature factor IX polypeptide (SEQ ID NO:3) differ
by 46 amino acid residues when compared to the precursor FIX
polypeptide SEQ ID NO:2, which is the factor IX polypeptide
containing the signal peptide and propeptide sequences Thus, the
first amino acid residue of SEQ ID NO:3 "corresponds to" the
forty-seventh (47.sup.th) amino acid residue of SEQ ID NO:2.
[0123] The term "factor IX" also encompasses the activated form of
the factor IX polypeptide, called factor IXa (FIXa), containing the
FIX light chain (corresponding to amino acids 47-191 of SEQ ID
NO:2, and amino acids 1-145 of SEQ ID NO:3) and FIX heavy chain
(corresponding to amino acids 227-461 of SEQ ID NO:2, and amino
acids 181-415 of SEQ ID NO:3) linked by a disulfide bond between
residues 132C and 289C (corresponding to the mature FIX polypeptide
set forth in SEQ ID NO:3). FIXa is produced from a mature FIX
polypeptide (e.g. that set forth in SEQ ID NO:3) by proteolytic
cleavage after amino acid residues R145 and R180. Proteolytic
cleavage can be carried out, for example, by activated factor XI
(FXIa) or the tissue factor/activated factor VII (TF/FVIIa)
complex. The FIX polypeptides provided herein can be further
modified, such as by chemical modification or post-translational
modification. Such modifications include, but are not limited to,
glycosylation, pegylation, albumination, farnesylation,
carboxylation, hydroxylation, phosphorylation, and other
polypeptide modifications known in the art.
[0124] Factor IX includes factor IX from any species, including
human and non-human species. FIX polypeptides of non-human origin
include, but are not limited to, murine, canine, feline, leporine,
avian, bovine, ovine, porcine, equine, piscine, ranine, and other
primate factor IX polypeptides. Exemplary FIX polypeptides of
non-human origin include, for example, chimpanzee (Pan troglodytes,
SEQ ID NO:4), rhesus macaque (Macaca mulatta, SEQ ID NO:5), mouse
(Mus musculus, SEQ ID NO:6), rat (Rattus norvegicus, SEQ ID NO:7),
Guinea pig (Cavia porcellus, SEQ ID NO:8), pig (Sus scrofa, SEQ ID
NO:9), dog (Canis familiaris, SEQ ID NO:10), cat (Felis catus, SEQ
ID NO:11), rabbit (Oryctolagus cuniculus, SEQ ID NO:12), chicken
(Gallus gallus, SEQ ID NO:13), cow (Bos Taurus, SEQ ID NO:14),
sheep (Ovis aries, SEQ ID NO:15), frog (Xenopus tropicalis, SEQ ID
NO:16), zebrafish (Danio rerio, SEQ ID NO:17), Japanese pufferfish
(Takifugu rubripes, SEQ ID NO:18).
[0125] Reference to FIX polypeptides also includes precursor
polypeptides and mature FIX polypeptides in single-chain or
two-chain forms, truncated forms thereof that have activity, and
includes allelic variants and species variants, variants encoded by
splice variants, and other variants, including polypeptides that
have at least 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, 96%, 97%, 98%, 99% or more sequence identity to the precursor
polypeptide set forth in SEQ ID NO:2 or the mature form thereof
(SEQ ID NO:3). Included are modified FIX polypeptides, such as
those of SEQ ID NOS:75-272 and 326-417 and variants thereof. Also
included are those that retain at least an activity of a FIX, such
as FVIIIa binding, factor X binding, phospholipid binding, and/or
coagulant activity of a FIX polypeptide. By retaining activity, the
activity can be altered, such as reduced or increased, as compared
to a wild-type FIX so long as the level of activity retained is
sufficient to yield a detectable effect. FIX polypeptides include,
but are not limited to, tissue-specific isoforms and allelic
variants thereof, synthetic molecules prepared by translation of
nucleic acids, proteins generated by chemical synthesis, such as
syntheses that include ligation of shorter polypeptides, through
recombinant methods, proteins isolated from human and non-human
tissue and cells, chimeric FIX polypeptides and modified forms
thereof. FIX polypeptides also include fragments or portions of FIX
that are of sufficient length or include appropriate regions to
retain at least one activity (upon activation if needed) of a
full-length mature polypeptide. FIX polypeptides also include those
that contain chemical or posttranslational modifications and those
that do not contain chemical or posttranslational modifications.
Such modifications include, but are not limited to, pegylation,
albumination, glycosylation, farnesylation, carboxylation,
hydroxylation, phosphorylation, and other polypeptide modifications
known in the art.
[0126] As used herein, corresponding residues refers to residues
that occur at aligned loci. Related or variant polypeptides are
aligned by any method known to those of skill in the art. Such
methods typically maximize matches, and include methods such as
using manual alignments and by using the numerous alignment
programs available (for example, BLASTP) and others known to those
of skill in the art. By aligning the sequences of polypeptides, one
skilled in the art can identify corresponding residues, using
conserved and identical amino acid residues as guides. For example,
by aligning the sequences of factor IX polypeptides, one of skill
in the art can identify corresponding residues, using conserved and
identical amino acid residues as guides. For example, the tyrosine
in amino acid position 1 (Y1) of SEQ ID NO:3 (mature factor IX)
corresponds to the tyrosine in amino acid position 47 (Y47) of SEQ
ID NO:2. In other instances, corresponding regions can be
identified. For example, the Gla domain corresponds to amino acid
positions Y1 through V46 of SEQ ID NO:3, and to amino acid
positions Y47 through V92 of SEQ ID NO:2. One skilled in the art
also can employ conserved amino acid residues as guides to find
corresponding amino acid residues between and among human and
non-human sequences. For example, amino acid residues Q11 and P74
of SEQ ID NO:3 (human) correspond to R11 and Q74 of SEQ ID NO:14
(bovine). Corresponding positions also can be based on structural
alignments, for example by using computer simulated alignments of
protein structure. In other instances, corresponding regions can be
identified.
[0127] As used herein, the same, with reference to an amino acid
replacement, refers to the identical replacement at the reference
amino acid position in SEQ ID NO:3 in a corresponding position in
another Factor IX polypeptide. For example, the same replacement
with reference to the replacement of tyrosine at amino acid residue
R318 in SEQ ID NO:3 is the replacement of tyrosine at amino acid
residue R319 in SEQ ID NO:14 (see, for example, FIG. 3). For
example, the same replacement with reference to the replacement of
asparagine at amino acid residue E410 in SEQ ID NO:3 is the
replacement of asparagine at amino acid residue S410 in SEQ ID
NO:366. It is understood that reference to replacement of the same
amino acid refers to replacement of amino acid residues that differ
at the corresponding position from the replaced residue.
[0128] As used herein, a "proregion," "propeptide," or "pro
sequence," refers to a region or a segment that is cleaved to
produce a mature protein. This can include segments that function
to suppress proteolytic activity by masking the catalytic machinery
and thus preventing formation of the catalytic intermediate (i.e.,
by sterically occluding the substrate binding site). A proregion is
a sequence of amino acids positioned at the amino terminus of a
mature biologically active polypeptide and can be as little as a
few amino acids or can be a multidomain structure.
[0129] As used herein, "mature factor IX" refers to a FIX
polypeptide that lacks a signal sequence and a propeptide sequence.
Typically, a signal sequence targets a protein for secretion via
the endoplasmic reticulum (ER)-golgi pathway and is cleaved
following insertion into the ER during translation. A propeptide
sequence typically functions in post-translational modification of
the protein and is cleaved prior to secretion of the protein from
the cell. Thus, a mature FIX polypeptide is typically a secreted
protein. In one example, a mature human FIX polypeptide is set
forth in SEQ ID NO:3. The amino acid sequence set forth in SEQ ID
NO:3 differs from that of the precursor polypeptide set forth in
SEQ ID NO:2 in that SEQ ID NO:3 is lacking the signal sequence,
which corresponds to amino acid residues 1-28 of SEQ ID NO:2, and
also lacks the propeptide sequence, which corresponds to amino acid
residues 29-46 of SEQ ID NO:2. Reference to a mature FIX
polypeptide encompasses the single-chain zymogen form and the
two-chain form. Thus, reference to a mature FIX polypeptide also
refers to the two chain form containing the heavy chain and light
chain (without the activation peptide corresponding to amino acids
192-226 of SEQ ID NO:2) joined by disulfide bonds.
[0130] As used herein, "wild-type" or "native" with reference to
FIX refers to a FIX polypeptide encoded by a native or naturally
occurring FIX gene, including allelic variants, that is present in
an organism, including a human and other animals, in nature.
Reference to wild-type factor IX without reference to a species is
intended to encompass any species of a wild-type factor IX.
Included among wild-type FIX polypeptides are the encoded precursor
polypeptide, fragments thereof, and processed forms thereof, such
as a mature form lacking the signal peptide as well as any pre- or
post-translationally processed or modified forms thereof. Also
included among native FIX polypeptides are those that are
post-translationally modified, including, but not limited to,
modification by glycosylation, carboxylation and hydroxylation.
Native FIX polypeptides also include single-chain and two-chain
forms. For example, humans express native FIX. The amino acid
sequence of exemplary wild-type human FIX are set forth in SEQ ID
NOS:2 and 3 and allelic variants thereof. Other animals produce
native FIX, including, but not limited to, chimpanzee (Pan
troglodytes, SEQ ID NO:4), rhesus macaque (Macaca mulatta, SEQ ID
NO:5), mouse (Mus musculus, SEQ ID NO:6), rat (Rattus norvegicus,
SEQ ID NO:7), Guinea pig (Cavia porcellus, SEQ ID NO:8), pig (Sus
scrofa, SEQ ID NO:9), dog (Canis familiaris, SEQ ID NO:10), cat
(Felis catus, SEQ ID NO:11), rabbit (Oryctolagus cuniculus, SEQ ID
NO:12), chicken (Gallus gallus, SEQ ID NO:13), cow (Bos Taurus, SEQ
ID NO:14), sheep (Ovis aries, SEQ ID NO:15), frog (Xenopus
tropicalis, SEQ ID NO:16), zebrafish (Danio rerio, SEQ ID NO:17),
Japanese pufferfish (Takifugu rubripes, SEQ ID NO:18).
[0131] As used herein, species variants refer to variants in
polypeptides among different species, including different mammalian
species, such as mouse and human.
[0132] As used herein, allelic variants refer to variations in
proteins among members of the same species.
[0133] As used herein, a splice variant refers to a variant
produced by differential processing of a primary transcript of
genomic DNA that results in more than one type of mRNA.
[0134] As used herein, a zymogen refers to a protease that is
activated by proteolytic cleavage, including maturation cleavage,
such as activation cleavage, and/or complex formation with other
protein(s) and/or cofactor(s). A zymogen is an inactive precursor
of a proteolytic enzyme. Such precursors are generally larger,
although not necessarily larger, than the active form. With
reference to serine proteases, zymogens are converted to active
enzymes by specific cleavage, including catalytic and autocatalytic
cleavage, or by binding of an activating co-factor, which generates
an active enzyme. For example, generally, zymogens are present in a
single-chain form. Zymogens, generally, are inactive and can be
converted to mature active polypeptides by catalytic or
autocatalytic cleavage at one or more proteolytic sites to generate
a multi-chain, such as a two-chain, polypeptide. A zymogen, thus,
is an enzymatically inactive protein that is converted to a
proteolytic enzyme by the action of an activator. Cleavage can be
effected by autoactivation. A number of coagulation proteins are
zymogens; they are inactive, but become cleaved and activated upon
the initiation of the coagulation system following vascular damage.
With reference to FIX, the FIX polypeptides exist in the blood
plasma as zymogens until cleavage by proteases, such as for
example, activated FXI (FXIa) or FVIIa (in association with TF) to
produce the two-chain form of FIX (FIXa).
[0135] As used herein, an activation sequence refers to a sequence
of amino acids in a zymogen that is the site required for
activation cleavage or maturation cleavage to form an active
protease. Cleavage of an activation sequence can be catalyzed
autocatalytically or by activating partners.
[0136] As used herein, activation cleavage is a type of maturation
cleavage, which induces a conformation change that is required for
the development of full enzymatic activity. This is a classical
activation pathway, for example, for serine proteases in which a
cleavage generates a new N-terminus that interacts with the
conserved regions of the protease, such as Asp194 in chymotrypsin,
to induce conformational changes required for activity. Activation
can result in production of multi-chain forms of the proteases. In
some instances, single chain forms of the protease can exhibit
proteolytic activity.
[0137] As used herein, "activated Factor IX" or "FIXa" refers to
any two-chain form of a FIXa polypeptide. A two-chain form
typically results from proteolytic cleavage, but can be produced
synthetically. Activated Factor IX, thus, includes the zymogen-like
two-chain form with low coagulant activity, a fully activated form
that occurs upon binding to FVIIIa and FX, and mutated forms that
exist in a fully activated two-chain form or undergo conformational
change to a fully activated form. For example, a single-chain form
of FIX polypeptide (see, e.g., SEQ ID NO:3) is proteolytically
cleaved after amino acid residues R145 and R180 of the mature FIX
polypeptide. The cleavage products, FIX heavy chain and FIX light
chain, which are held together by a disulfide bond (between amino
acid residues 132C and 289C in the FIX of SEQ ID NO:3), form the
two-chain activated FIX enzyme. Proteolytic cleavage can be carried
out, for example, by activated factor XIa (FXIa), and activated
factor VIIa (FVIIa) in complex with TF.
[0138] As used herein, a "property" of a FIX polypeptide refers to
a physical or structural property, such three-dimensional
structure, pI, half-life, conformation and other such physical
characteristics.
[0139] As used herein, an "activity" of a FIX polypeptide refers to
any activity exhibited by a factor IX polypeptide. Such activities
can be tested in vitro and/or in vivo and include, but are not
limited to, coagulation or coagulant activity, pro-coagulant
activity, proteolytic or catalytic activity such as to effect
factor X (FX) activation; antigenicity (ability to bind to or
compete with a polypeptide for binding to an anti-FIX antibody);
ability to bind factor VIIIa or factor X; and/or ability to bind to
phospholipids. Activity can be assessed in vitro or in vivo using
recognized assays, for example, by measuring coagulation in vitro
or in vivo. The results of such assays indicate that a polypeptide
exhibits an activity that can be correlated to activity of the
polypeptide in vivo, in which in vivo activity can be referred to
as biological activity. Assays to determine functionality or
activity of modified forms of FIX are known to those of skill in
the art. Exemplary assays to assess the activity of a FIX
polypeptide include prothromboplastin time (PT) assay or the
activated partial thromboplastin time (aPTT) assay to assess
coagulant activity, or chromogenic assays using synthetic
substrates to assess catalytic or proteolytic activity.
[0140] As used herein, "exhibits at least one activity" or "retains
at least one activity" refers to the activity exhibited by a
modified FIX polypeptide as compared to an unmodified FIX
polypeptide of the same form and under the same conditions. For
example, a modified FIX polypeptide in a two-chain form is compared
with an unmodified FIX polypeptide in a two-chain form, under the
same experimental conditions, where the only difference between the
two polypeptides is the modification under study. In another
example, a modified FIX polypeptide in a single-chain form is
compared with an unmodified FIX polypeptide in a single-chain form,
under the same experimental conditions, where the only difference
between the two polypeptides is the modification under study.
Typically, a modified FIX polypeptide that retains or exhibits at
least one activity of an unmodified FIX polypeptide of the same
form retains a sufficient amount of the activity such that, when
administered in vivo, the modified FIX polypeptide is
therapeutically effective as a procoagulant therapeutic. Generally,
for a modified FIX polypeptide to retain therapeutic efficacy as a
procoagulant, the amount of activity that is retained is or is
about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%,
I4%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 100%, 200%, 300%, 400%, 500% or more of the activity of an
unmodified FIX polypeptide of the same form that displays
therapeutic efficacy as a procoagulant. The amount of activity that
is required to maintain therapeutic efficacy as a procoagulant can
be empirically determined, if necessary. Typically, retention of
0.5% to 20%, 0.5% to 10%, 0.5% to 5% of an activity is sufficient
to retain therapeutic efficacy as a procoagulant in vivo.
[0141] It is understood that the activity being exhibited or
retained by a modified FIX polypeptide can be any activity,
including, but not limited to, coagulation or coagulant activity,
pro-coagulant activity; proteolytic or catalytic activity such as
to effect factor X (FX) activation; antigenicity (ability to bind
to or compete with a polypeptide for binding to an anti-FIX
antibody); ability to bind factor VIIIa or factor X; and/or ability
to bind to phospholipids. In some instances, a modified FIX
polypeptide can retain an activity that is increased compared to an
unmodified FIX polypeptide. In some cases, a modified FIX
polypeptide can retain an activity that is decreased compared to an
unmodified FIX polypeptide. Activity of a modified FIX polypeptide
can be any level of percentage of activity of the unmodified
polypeptide, where both polypeptides are in the same form,
including but not limited to, 1% of the activity, 2%, 3%, 4%, 5%,
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%,
99%, 100%, 200%, 300%, 400%, 500%, or more activity compared to the
polypeptide that does not contain the modification at issue. For
example, a modified FIX polypeptide can exhibit increased or
decreased activity compared to the unmodified FIX polypeptide in
the same form. For example, it can retain at least about or 1%, 2%,
3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 95%, 96%, 97%, 98% or at least 99% of the activity of the
unmodified FIX polypeptide. In other embodiments, the change in
activity is at least about 2 times, 3 times, 4 times, 5 times, 6
times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40
times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times,
200 times, 300 times, 400 times, 500 times, 600 times, 700 times,
800 times, 900 times, 1000 times, or more times greater than
unmodified FIX. The particular level to be retained is a function
of the intended use of the polypeptide and can be empirically
determined. Activity can be measured, for example, using in vitro
or in vivo assays such as those described herein.
[0142] As used herein, "coagulation activity" or "coagulant
activity" or "pro-coagulant activity" refers to the ability of a
polypeptide to effect coagulation. Assays to assess coagulant
activity are known to those of skill in the art, and include
prothrombin time (PT) assay or the activated partial thromboplastin
time (aPTT) assay.
[0143] As used herein, "catalytic activity" or "proteolytic
activity" with reference to FIX refers to the ability of a FIX
protein to catalyze the proteolytic cleavage of a substrate, and
are used interchangeably. Assays to assess such activities are
known in the art. For example, the proteolytic activity of FIX can
be measured using chromogenic substrates such as
Mes-D-CHD-Gly-Arg-AMC, where cleavage of the substrate is monitored
by absorbance and the rate of substrate hydrolysis determined by
linear regression.
[0144] As used herein, domain (typically a sequence of three or
more, generally 5 or 7 or more amino acids) refers to a portion of
a molecule, such as proteins or the encoding nucleic acids, that is
structurally and/or functionally distinct from other portions of
the molecule and is identifiable. For example, domains include
those portions of a polypeptide chain that can form an
independently folded structure within a protein made up of one or
more structural motifs and/or that is recognized by virtue of a
functional activity, such as proteolytic activity. A protein can
have one, or more than one, distinct domains. For example, a domain
can be identified, defined or distinguished by homology of the
sequence therein to related family members, such as homology to
motifs that define a protease domain or a gla domain. In another
example, a domain can be distinguished by its function, such as by
proteolytic activity, or an ability to interact with a biomolecule,
such as DNA binding, ligand binding, and dimerization. A domain
independently can exhibit a biological function or activity such
that the domain independently or fused to another molecule can
perform an activity, such as, for example proteolytic activity or
ligand binding. A domain can be a linear sequence of amino acids or
a non-linear sequence of amino acids. Many polypeptides contain a
plurality of domains. Such domains are known, and can be identified
by those of skill in the art. For exemplification herein,
definitions are provided, but it is understood that it is well
within the skill in the art to recognize particular domains by
name. If needed appropriate software can be employed to identify
domains.
[0145] As used herein, a protease domain is the catalytically
active portion of a protease. Reference to a protease domain of a
protease includes the single, two- and multi-chain forms of any of
these proteins. A protease domain of a protein contains all of the
requisite properties of that protein required for its proteolytic
activity, such as for example, the catalytic center. In reference
to FIX, the protease domain shares homology and structural feature
with the chymotrypsin/trypsin family protease domains, including
the catalytic triad. For example, in the mature FIX polypeptide set
forth in SEQ ID NO:3, the protease domain corresponds to amino acid
positions 181 to 412.
[0146] As used herein, a gamma-carboxyglutamate (Gla) domain refers
to the portion of a protein, for example a vitamin K-dependent
protein, that contains post-translational modifications of
glutamate residues, generally most, but not all of the glutamate
residues, by vitamin K-dependent carboxylation to form Gla. The Gla
domain is responsible for the high-affinity binding of calcium ions
and binding to negatively-charged phospholipids. Typically, the Gla
domain starts at the N-terminal extremity of the mature form of
vitamin K-dependent proteins and ends with a conserved aromatic
residue. In a mature FIX polypeptide the Gla domain corresponds to
amino acid positions 1 to 46 of the exemplary polypeptide set forth
in SEQ ID NO:3. Gla domains are well known and their locus can be
identified in particular polypeptides. The Gla domains of the
various vitamin K-dependent proteins share sequence, structural and
functional homology, including the clustering of N-terminal
hydrophobic residues into a hydrophobic patch that mediates
interaction with negatively charged phospholipids on the cell
surface membrane. Exemplary other Gla-containing polypeptides
include, but are not limited to, FVII, FX, prothrombin, protein C,
protein S, osteocalcin, matrix Gla protein, Growth-arrest-specific
protein 6 (Gas6), and protein Z.
[0147] As used herein, an epidermal growth factor (EGF) domain
(EGF-1 or EGF-2) refers to the portion of a protein that shares
sequence homology to a specific 30 to 40 amino acid portion of the
epidermal growth factor (EGF) sequence. The EGF domain includes six
cysteine residues that have been shown (in EGF) to be involved in
disulfide bonds. The main structure of an EGF domain is a
two-stranded beta-sheet followed by a loop to a C-terminal short
two-stranded sheet. FIX contains two EGF domains: EGF-1 and EGF-2.
These domains correspond to amino acid positions 47-83, and 84-125,
respectively, of the mature FIX polypeptide set forth in SEQ ID
NO:3.
[0148] As used herein, "unmodified polypeptide" or "unmodified FIX"
and grammatical variations thereof refer to a starting polypeptide
that is selected for modification as provided herein. The starting
polypeptide can be a naturally-occurring, wild-type form of a
polypeptide. In addition, the starting polypeptide can be altered
or mutated, such that it differs from a native wild type isoform
but is nonetheless referred to herein as a starting unmodified
polypeptide relative to the subsequently modified polypeptides
produced herein. Thus, existing proteins known in the art that have
been modified to have a desired increase or decrease in a
particular activity or property compared to an unmodified reference
protein can be selected and used as the starting unmodified
polypeptide. For example, a protein that has been modified from its
native form by one or more single amino acid changes and possesses
either an increase or decrease in a desired property, such as a
change in a amino acid residue or residues to alter glycosylation,
can be a target protein, referred to herein as unmodified, for
further modification of either the same or a different property.
Exemplary modified FIX polypeptides known in the art include any
FIX polypeptide described in, for example, Schuettrumpf et al.,
(2005) Blood 105(6):2316-23; Melton et al., (2001) Blood Coagul.
Fibrinolysis 12(4):237-43; Cheung et al., (1992) J. Biol. Chem.
267:20529-20531; Cheung et al., (1996) Proc. Natl. Acad. Sci.
U.S.A. 93:11068-11073; Hopfner et al., (1997) EMBO J. 16:6626-6635;
Sichler et al., (2003) J. Biol. Chem. 278:4121-4126; Begbie et al.,
(2005) Thromb. Haemost. 94(6):1138-47; Chang, J. et al., (1998) J.
Biol. Chem. 273(20):12089-94; Yang, L. et al., (2002) J. Biol.
Chem. 277(52):50756-60; Yang, L. et al., (2003) J. Biol. Chem.
278(27):25032-8; U.S. Pat. Nos. 5,969,040, 5,621,039, 6,423,826,
7,125,841, 6,017,882, 6,531,298; U.S. Patent Publication Nos.
20030211094, 20070254840, 20080188414, 2008000422, 20080050772,
20080146494, 20080050772, 20080187955, 20040254106, 20050147618,
20080280818, 20080102115, 20080167219 and 20080214461; and
International Patent Publication Nos. WO2007112005, WO2007135182,
WO2008082613, WO2008119815, WO2008119815, WO2007149406,
WO2007112005 and WO2004101740.
[0149] As used herein, "modified factor IX polypeptides" and
"modified factor IX" refer to a FIX polypeptide that has one or
more amino acid differences compared to an unmodified factor IX
polypeptide. The one or more amino acid differences can be amino
acid mutations such as one or more amino acid replacements
(substitutions), insertions or deletions, or can be insertions or
deletions of entire domains, and any combinations thereof.
Typically, a modified FIX polypeptide has one or more modifications
in primary sequence compared to an unmodified FIX polypeptide. For
example, a modified FIX polypeptide provided herein can have 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
30, 40, 50 or more amino acid differences compared to an unmodified
FIX polypeptide. Any modification is contemplated as long as the
resulting polypeptide exhibits at least one FIX activity associated
with a native FIX polypeptide, such as, for example, catalytic
activity, proteolytic activity, the ability to bind FVIIIa or the
ability to bind phospholipids.
[0150] As used herein, "antithrombin III" or "AT-III" is a serine
protease inhibitor (serpin). AT-III is synthesized as a precursor
protein containing 464 amino acid residues (SEQ ID NO:21) that is
cleaved during secretion to release a 432 amino acid mature
antithrombin (SEQ ID NO:22).
[0151] As used herein, "heparin" refers to a heterogeneous group of
straight-chain highly sulfated glycosaminoglycans having
anticoagulant properties. Heparin can bind to to form the
AT-III/heparin complex.
[0152] As used herein, "increased resistance to AT-III and/or
heparin" refers to any amount of decreased sensitivity of a
polypeptide, such as a modified FIX polypeptide, to the inhibitory
effects of AT-III alone, heparin alone and/or the AT-III/heparin
complex compared with a reference polypeptide, such as an
unmodified FIX polypeptide. Increased resistance to AT-III,
heparin, and/or an AT-III/heparin complex can be assayed by
assessing the binding of a modified FIX polypeptide to AT-III,
heparin, and/or an AT-III complex. Increased resistance also can be
assayed by measuring inhibition of the catalytic or coagulant
activity of a FIX polypeptide in the presence of AT-III, heparin,
or an AT-III/heparin complex. Assays to determine the binding of a
polypeptide to an inhibitor or the inhibition of enzymatic activity
of a polypeptide by an inhibitor are known in the art. For covalent
inhibitors, such as, for example, AT-III or an AT-III/heparin
complex, a second order rate constant for inhibition can be
measured. For non-covalent inhibitors, such as, for example,
heparin, a k.sub.i can be measured. In addition, surface plasma
resonance, such as on a BIAcore biosensor instrument, also can be
used to measure the binding of FIX polypeptides to AT-III, heparin,
and/or an AT-III/heparin complex using one or more defined
conditions. However, for covalent inhibitors such as AT-III or an
AT-III/heparin complex, only an on-rate can be measured using
BIAcore; for non-covalent inhibitors such as heparin, both the
on-rate and off-rate can be measured. Assays to determine the
inhibitory effect of, for example, AT-III/heparin on FIX coagulant
activity also are known in the art. For example, the ability of a
modified FIX polypeptide to cleave its substrate FX in the presence
or absence of AT-III/heparin can be measured, and the degree to
which AT-III/heparin inhibits the reaction determined. This can be
compared to the ability of an unmodified FIX polypeptide to cleave
its substrate FX in the presence or absence of AT-III.
Alternatively, the second order rate constant for inhibition of a
FIX polypeptide can be measured and compared to the second order
rate constant for inhibition of an unmodified FIX polypeptide. When
comparing second order rate constants for inhibition, increased
resistance to inhibition means a decreased second order rate
constant of inhibition. A modified polypeptide that exhibits
increased resistance to AT-III and/or heparin exhibits, for
example, an increase of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500%, or more
resistance to the effects of AT-III, heparin, and/or an
AT-III/heparin complex, respectively, compared to an unmodified
polypeptide.
[0153] As used herein, cofactors refer to proteins or molecules
that bind to other specific proteins or molecules to form an active
complex. In some examples, binding to a cofactor is required for
optimal proteolytic activity. For example, FVIIIa is a cofactor of
FIXa. Binding of FVIIIa to FIXa induces conformational changes that
result in increased proteolytic activity of FIXa for its substrate,
FX.
[0154] As used herein, a glycosylation site refers to an amino
position in a polypeptide to which a carbohydrate moiety can be
attached. Typically, a glycosylated protein contains one or more
amino acid residues, such as asparagine or serine, for the
attachment of the carbohydrate moieties.
[0155] As used herein, a native glycosylation site refers to the
position of an amino acid to which a carbohydrate moiety is
attached in a wild-type polypeptide. There are six native
glycosylation sites in FIX; two N-glycosylation sites at N157 and
N167, and six O-glycosylation sites at S53, S61, T159, T169, T172
and T179, corresponding to amino acid positions in the mature FIX
polypeptide set forth in SEQ ID NO:3.
[0156] As used herein, a non-native glycosylation site refers to
the position of an amino acid to which a carbohydrate moiety is
attached in a modified polypeptide that is not present in a
wild-type polypeptide. Non-native glycosylation sites can be
introduced into a FIX polypeptide by amino acid replacement.
O-glycosylation sites can be created, for example, by amino acid
replacement of a native residue with a serine or threonine.
N-glycosylation sites can be created, for example, by establishing
the motif Asn-Xaa-Ser/Thr/Cys, where Xaa is not proline. Creation
of this consensus sequence by amino acid modification can involve,
for example, a single amino acid replacement of a native amino acid
residue with an asparagine, a single amino acid replacement of a
native amino acid residue with a serine, threonine or cysteine, or
a double amino acid replacement involving a first amino acid
replacement of a native residue with an asparagine and a second
amino acid replacement of native residue with a serine, threonine
or cysteine.
[0157] As used herein, "increased levels of glycosylation" and any
grammatical variations thereof, refers to an increased amount of
carbohydrate linked to a polypeptide as compared with a reference
polypeptide or protein. The carbohydrate can be N-linked, O-linked,
C-linked or be attached by any other linkage. The level of
glycosylation can be increased by at least about 1%, 2%, 3%, 4%,
5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
100%, 200%, 300%, 400%, 500%, or more compared to the level of
glycosylation of an unmodified polypeptide. Assays to determine the
level of glycosylation (i.e. amount of carbohydrate) of a
polypeptide are known in the art. For example, the carbohydrate
content or level of glycosylation can be assessed by high pH anion
exchange chromatography, fluorophoreassisted carbohydrate
electrophoresis (FACE), sequential exoglycosidase digestions, mass
spectrometry, NMR, gel electrophoresis or any other method
described herein or known in the art.
[0158] As used herein, "biological activity" refers to the in vivo
activities of a compound or physiological responses that result
upon in vivo administration of a compound, composition or other
mixture. Biological activity, thus, encompasses therapeutic effects
and pharmaceutical activity of such compounds, compositions and
mixtures. Biological activities can be observed in in vitro systems
designed to test or use such activities. Thus, for purposes herein
a biological activity of a FIX polypeptide encompasses the
coagulant activity.
[0159] As used herein, a pharmacokinetic property refers to a
property related to the action of a drug or agent, such as a FIX
polypeptide, in the body and in particular the rate at which drugs
are absorbed, distributed, metabolized, and eliminated by the body.
Pharmacokinetics can be assessed by various parameters. These
include, but are not limited to, clearance, volume of distribution,
in vivo recovery, total modified FIX polypeptide exposure in vivo,
serum half-life, and mean resonance time (MRT). Pharmacokinetic
properties of polypeptide can be assessed using methods well known
in the art, such as, for example, administering the polypeptide to
a human or animal model and assessing the amount of FIX in the body
at various time points. The various parameters, such as clearance,
volume of distribution, in vivo recovery, total modified FIX
polypeptide exposure in vivo, serum half-life, and mean resonance
time (MRT), are assessed using calculations well known in the art
and described herein.
[0160] As used herein, "improved pharmacokinetic properties" refers
to a desirable change in a pharmacokinetic property of a
polypeptide, such as a modified FIX polypeptide, compared to, for
example, an unmodified FIX polypeptide. The change can be an
increase or a decrease.
[0161] As used herein, clearance refers to the removal of an agent,
such as a polypeptide, from the body of a subject following
administration. Clearance can be assessed using methods well known
in the art, such as those described in Example 6. For example,
assays in which a FIX polypeptide is administered to mice can be
performed, and the clearance of the polypeptide from the body
assessed by measuring the amount of FIX in the plasma at various
time points and calculating the clearance as Dose/AUC.sub.0-inf.
Improved clearance of a modified FIX polypeptide compared to an
unmodified FIX polypeptide refers to a decrease in clearance of a
modified FIX polypeptide compared to an unmodified FIX polypeptide.
The clearance of a modified FIX polypeptide can be decreased by at
least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98% or 99% compared to an unmodified FIX polypeptide.
[0162] As used herein, mean resonance time (MRT) refers to the
amount of time a FIX polypeptide resides in the body following
administration. MRT can be assessed using methods well known in the
art, such as those described in Example 6. For example, assays in
which a FIX polypeptide is administered to mice can be performed,
and the MRT of the polypeptide assessed by measuring the amount of
FIX in the plasma at various time points and calculating the MRT as
AUMC.sub.0-last/AUC where AUC.sub.0-last is total area under the
curve and AUMC.sub.0-last is the total area under the first
moment-versus-time curve. Improved MRT of a modified FIX
polypeptide compared to an unmodified FIX polypeptide refers to an
increase in MRT of a modified FIX polypeptide compared to an
unmodified FIX polypeptide. The MRT of a modified FIX polypeptide
can be increased by at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%,
8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, 100%, 200%, 300%, 400%, 500% or more
compared to an unmodified FIX polypeptide.
[0163] As used herein, in vivo recovery refers to the percentage of
FIX polypeptide detectable in the circulation after a period of
time following administration in relation to the total amount of
FIX polypeptide administered. In vivo recovery can be assessed
using methods well known in the art, such as those described in
Example 6. For example, assays in which a FIX polypeptide is
administered to mice can be performed, and the in vivo recovery of
the polypeptide assessed by measuring the amount of FIX in the
plasma at C.sub.max and comparing it to the amount of FIX
administered. Improved in vivo recovery of a modified FIX
polypeptide compared to an unmodified FIX polypeptide refers to an
increase in in vivo recovery of a modified FIX polypeptide compared
to an unmodified FIX polypeptide. The in vivo recovery of a
modified FIX polypeptide can be increased by at least or about 1%,
2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 200%,
300%, 400%, 500% or more compared to an unmodified FIX
polypeptide.
[0164] As used herein, plasma half-life (t.sub.1/2) refers the
elimination half-life of a FIX polypeptide, or the time at which
the plasma concentration of the FIX polypeptide has reached one
half of its initial or maximal concentration following
administration. Reference to plasma half-life includes plasma
half-life during the .alpha.-, .beta.-, and/or .gamma.-phase.
Plasma half-life can be assessed using methods well known in the
art, such as those described in Example 6. For example, assays in
which a FIX polypeptide is administered to mice can be performed,
and the plasma half-life of the polypeptide assessed by measuring
the amount of FIX in the plasma at various time points. The
T.sub.1/2.beta., for example, is calculated as -ln 2 divided by the
negative slope during the terminal phase of the log-linear plot of
the plasma FIX concentration-versus-time curve. Improved plasma
half-life of a modified FIX polypeptide compared to an unmodified
FIX polypeptide refers to an increase in plasma half-life of a
modified FIX polypeptide compared to an unmodified FIX polypeptide.
The plasma half-life of a modified FIX polypeptide can be increased
by at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99%, 100%, 200%, 300%, 400%, 500% or more compared to an
unmodified FIX polypeptide.
[0165] As used herein, exposure in vivo refers to the amount of FIX
polypeptide in the circulation following administration in relation
to the plasma area under the concentration-time curve, or AUC, of
FIX polypeptide administered. Exposure in vivo can be assessed
using methods well known in the art, such as those described in
Example 6. For example, assays in which a FIX polypeptide is
administered to mice can be performed, and the in vivo recovery of
the polypeptide assessed by measuring the amount of FIX in the
plasma at various time points (i.e., AUC) and comparing it to the
amount of FIX administered. Improved exposure in vivo of a modified
FIX polypeptide compared to an unmodified FIX polypeptide refers to
an increase in exposure in vivo of a modified FIX polypeptide
compared to an unmodified FIX polypeptide. The exposure in vivo of
a modified FIX polypeptide can be increased by at least or about
1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%,
70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%,
200%, 300%, 400%, 500% or more compared to an unmodified FIX
polypeptide.
[0166] As used herein, volume of distribution refers to the
distribution of a FIX polypeptide between plasma and the rest of
the body following administration. It is defined as the volume in
which the amount of polypeptide would need to be uniformly
distributed to produce the observed concentration of polypeptide in
the plasma. Volume of distribution can be assessed using methods
well known in the art, such as those described in Example 6. For
example, V.sub.ss, which is the steady state volume of distribution
(calculated as MRT*Cl) and V.sub.z, which is the volume of
distribution based on the terminal elimination constant (.beta.)
(calculated as Cl/(ln 2/T.sub.1/2 .beta.), can be assessed in
assays in which a FIX polypeptide is administered to mice, and the
concentration of the FIX in the plasma is determined at various
time points. Improved volume of distribution of a modified FIX
polypeptide compared with an unmodified FIX polypeptide, depending
on the protein's mechanism of clearance and safety profile, can
refer to either an increase or a decrease in the volume of
distribution of a modified FIX polypeptide. For example, in cases
where the polypeptide is distributed among multiple compartments, a
decreased volume of distribution of a modified FIX polypeptide
could result in significantly increased drug exposure and activity
in the compartment of interest (e.g., the vascular compartment
versus an extravascular compartment) compared with an unmodified
FIX polypeptide. In other cases, for example, when drug safety is
limited by C.sub.max, redistribution into other compartments (e.g.,
binding to the surface of endothelial cells) can result in a longer
terminal half life and/or duration of action within the compartment
of interest and an superior safety profile compared to the
unmodified FIX polypeptide. The volume of distribution of a
modified FIX polypeptide can be decreased by at least or about 1%,
2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% compared to
an unmodified FIX polypeptide. In other examples, the volume of
distribution of the modified FIX polypeptide is increased by at
least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99%, 100%, 200%, 300%, 400%, 500% or more of the volume of
distribution of an unmodified FIX polypeptide.
[0167] As used herein the term "assess", and grammatical variations
thereof, is intended to include quantitative and qualitative
determination in the sense of obtaining an absolute value for the
activity of a polypeptide, and also of obtaining an index, ratio,
percentage, visual or other value indicative of the level of the
activity. Assessment can be direct or indirect. For example,
detection of cleavage of a substrate by a polypeptide can be by
direct measurement of the product, or can be indirectly measured by
determining the resulting activity of the cleaved substrate.
[0168] As used herein, "chymotrypsin numbering" refers to the amino
acid numbering of a mature bovine chymotrypsin polypeptide of SEQ
ID NO:19. Alignment of a protease domain of another protease, such
as for example the protease domain of factor IX, can be made with
chymotrypsin. In such an instance, the amino acids of factor IX
that correspond to amino acids of chymotrypsin are given the
numbering of the chymotrypsin amino acids. Corresponding positions
can be determined by such alignment by one of skill in the art
using manual alignments or by using the numerous alignment programs
available (for example, BLASTP). Corresponding positions also can
be based on structural alignments, for example by using computer
simulated alignments of protein structure. Recitation that amino
acids of a polypeptide correspond to amino acids in a disclosed
sequence refers to amino acids identified upon alignment of the
polypeptide with the disclosed sequence to maximize identity or
homology (where conserved amino acids are aligned) using a standard
alignment algorithm, such as the GAP algorithm. The corresponding
chymotrypsin numbers of amino acid positions 181 to 415 of the FIX
polypeptide set forth in SEQ ID NO:3 are provided in Table 1. The
amino acid positions relative to the sequence set forth in SEQ ID
NO:3 are in normal font, the amino acid residues at those positions
are in bold, and the corresponding chymotrypsin numbers are in
italics. For example, upon alignment of the mature factor IX (SEQ
ID NO:3) with mature chymotrypsin (SEQ ID NO:19), the valine (V) at
amino acid position 181 in factor IX is given the chymotrypsin
numbering of V16. Subsequent amino acids are numbered accordingly.
In one example, a glutamic acid (E) at amino acid position 213 of
the mature factor IX (SEQ ID NO:3) corresponds to amino acid
position E49 based on chymotrypsin numbering. Where a residue
exists in a protease, but is not present in chymotrypsin, the amino
acid residue is given a letter notation. For example, A95a and A95b
by chymotrypsin numbering correspond to A261 and A262,
respectively, by numbering relative to the mature factor IX
sequence (SEQ ID NO:3).
TABLE-US-00001 TABLE 1 Chymotrypsin numbering of factor IX 181 182
183 184 185 186 187 188 189 190 191 192 193 194 195 V V G G E D A K
P G Q F P W Q 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 196 197
198 199 200 201 202 203 204 205 206 207 208 209 210 V V L N G K V D
A F C G G S I 31 32 33 34 35 37 38 39 40 41 42 43 44 45 46 211 212
213 214 215 216 217 218 219 220 221 222 223 224 225 V N E K W I V T
A A H C V E T 47 48 49 50 51 52 53 54 55 56 57 58 59 60 60A 226 227
228 229 230 231 232 233 234 235 236 237 238 239 240 G V K I T V V A
G E H N I E E 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 241 242
243 244 245 246 247 248 249 250 251 252 253 254 255 T E H T E Q K R
N V I R I I P 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 256 257
258 259 260 261 262 263 264 265 266 267 268 269 270 H H N Y N A A I
N K Y N H D I 91 92 93 94 95 95A 95B 96 97 98 99 100 101 102 103
271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 A L L E
L D E P L V L N S Y V 104 105 106 107 108 109 110 111 112 113 114
115 116 117 118 286 287 288 289 290 291 292 293 294 295 296 297 298
299 300 T P I C I A D K E Y T N I F L 119 120 121 122 123 124 125
126 127 128 129 129A 129B 130 131 301 302 303 304 305 306 307 308
309 310 311 312 313 314 315 K F G S G Y V S G W G R V F H 132 133
134 135 136 137 138 139 140 141 142 143 144 145 147 316 317 318 319
320 321 322 323 324 325 326 327 328 329 330 K G R S A L V L Q Y L R
V P L 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 V D R A
T C L R S T K F T I Y 163 164 165 166 167 168 169 170 171 172 173
174 175 176 177 346 347 348 349 350 351 352 353 354 355 356 357 358
359 360 N N M F C A G F H E G G R D S 178 179 180 181 182 183 184
184A 185 186 187 188 188A 189 190 361 362 363 364 365 366 367 368
369 370 371 372 373 374 375 C Q G D S G G P H V T E V E G 191 192
193 194 195 196 197 198 199 200 201 202 203 204 205 376 377 378 379
380 381 382 383 384 385 386 387 388 389 390 T S F L T G I I S W G E
E C A 206 207 208 209 210 211 212 213 214 215 216 217 219 220 221
391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 M K G K
Y G I Y T K V S R Y V 221A 222 223 224 225 226 227 228 229 230 231
232 233 234 235 406 407 408 409 410 411 412 413 414 415 N W I K E K
T K L T 236 237 328 239 240 241 242 243 244 245
[0169] As used herein, nucleic acids include DNA, RNA and analogs
thereof, including peptide nucleic acids (PNA) and mixtures
thereof. Nucleic acids can be single or double-stranded. When
referring to probes or primers, which are optionally labeled, such
as with a detectable label, such as a fluorescent or radiolabel,
single-stranded molecules are contemplated. Such molecules are
typically of a length such that their target is statistically
unique or of low copy number (typically less than 5, generally less
than 3) for probing or priming a library. Generally a probe or
primer contains at least 14, 16 or 30 contiguous nucleotides of
sequence complementary to or identical to a gene of interest.
Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids
long.
[0170] As used herein, a peptide refers to a polypeptide that is
from 2 to 40 amino acids in length.
[0171] As used herein, the amino acids that occur in the various
sequences of amino acids provided herein are identified according
to their known, three-letter or one-letter abbreviations (Table 2).
The nucleotides which occur in the various nucleic acid fragments
are designated with the standard single-letter designations used
routinely in the art.
[0172] As used herein, an "amino acid" is an organic compound
containing an amino group and a carboxylic acid group. A
polypeptide contains two or more amino acids. For purposes herein,
amino acids include the twenty naturally-occurring amino acids,
non-natural amino acids and amino acid analogs (i.e., amino acids
wherein the .alpha.-carbon has a side chain).
[0173] In keeping with standard polypeptide nomenclature described
in J. Biol. Chem., 243:3557-3559 (1968), and adopted 37 C.F.R.
.sctn..sctn.1.821-1.822, abbreviations for the amino acid residues
are shown in Table 2A:
TABLE-US-00002 TABLE 2A Table of Correspondence SYMBOL 1-Letter
3-Letter AMINO ACID Y Tyr Tyrosine G Gly Glycine F Phe
Phenylalanine M Met Methionine A Ala Alanine S Ser Serine I Ile
Isoleucine L Leu Leucine T Thr Threonine V Val Valine P Pro Proline
K Lys Lysine H His Histidine Q Gln Glutamine E Glu Glutamic acid Z
Glx Glu and/or Gln W Trp Tryptophan R Arg Arginine D Asp Aspartic
acid N Asn Asparagine B Asx Asn and/or Asp C Cys Cysteine X Xaa
Unknown or other
[0174] It should be noted that all amino acid residue sequences
represented herein by formulae have a left to right orientation in
the conventional direction of amino-terminus to carboxyl-terminus.
In addition, the phrase "amino acid residue" is broadly defined to
include the amino acids listed in the Table of Correspondence
(Table 2) and modified and unusual amino acids, such as those
referred to in 37 C.F.R. .sctn..sctn.1.821-1.822, and incorporated
herein by reference. Furthermore, it should be noted that a dash at
the beginning or end of an amino acid residue sequence indicates a
peptide bond to a further sequence of one or more amino acid
residues, to an amino-terminal group such as NH.sub.2 or to a
carboxyl-terminal group such as COOH.
[0175] As used herein, "naturally occurring amino acids" refer to
the 20 L-amino acids that occur in polypeptides.
[0176] As used herein, "non-natural amino acid" refers to an
organic compound containing an amino group and a carboxylic acid
group that is not one of the naturally-occurring amino acids listed
in Table 2. Non-naturally occurring amino acids thus include, for
example, amino acids or analogs of amino acids other than the 20
naturally-occurring amino acids and include, but are not limited
to, the D-isostereomers of amino acids. Exemplary non-natural amino
acids are known to those of skill in the art and can be included in
a modified factor IX polypeptide.
[0177] For purposes herein, conservative amino acid substitutions
may be made in any of polypeptides and domains thereof provided
that the resulting protein exhibits an activity of a FIX.
Conservative amino acid substitutions, such as those set forth in
Table 2B, are those that do not eliminate proteolytic activity.
Suitable conservative substitutions of amino acids are known to
those of skill in this art and may be made generally without
altering the biological activity of the resulting molecule. Those
of skill in this art recognize that, in general, single amino acid
substitutions in non-essential regions of a polypeptide do not
substantially alter biological activity (see, e.g., Watson et al.
Molecular Biology of the Gene, 4th Edition, 1987, The
Benjamin/Cummings Pub. co., p. 224). Also included within the
definition, is the catalytically active fragment of an MTSP,
particularly a single chain protease portion. Conservative amino
acid substitutions are made, for example, in accordance with those
set forth in Table 2B as follows:
TABLE-US-00003 TABLE 2B Original residue Conservative substitution
Ala (A) Gly; Ser, Abu Arg (R) Lys, orn Asn (N) Gln; His Cys (C) Ser
Gln (Q) Asn Glu (E) Asp Gly (G) Ala; Pro His (H) Asn; Gln Ile (I)
Leu; Val; Met; Nle; Nva Leu (L) Ile; Val; Met; Nle; Nv Lys (K) Arg;
Gln; Glu Met (M) Leu; Tyr; Ile; NLe Val Ornithine Lys; Arg Phe (F)
Met; Leu; Tyr Ser (S) Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) Trp; Phe
Val (V) Ile; Leu; Met; Nle; Nv
Other substitutions are also permissible and may be determined
empirically or in accord with known conservative substitutions.
[0178] As used herein, a DNA construct is a single or double
stranded, linear or circular DNA molecule that contains segments of
DNA combined and juxtaposed in a manner not found in nature. DNA
constructs exist as a result of human manipulation, and include
clones and other copies of manipulated molecules.
[0179] As used herein, a DNA segment is a portion of a larger DNA
molecule having specified attributes. For example, a DNA segment
encoding a specified polypeptide is a portion of a longer DNA
molecule, such as a plasmid or plasmid fragment, which, when read
from the 5' to 3' direction, encodes the sequence of amino acids of
the specified polypeptide.
[0180] As used herein, the term polynucleotide means a single- or
double-stranded polymer of deoxyribonucleotides or ribonucleotide
bases read from the 5' to the 3' end. Polynucleotides include RNA
and DNA, and can be isolated from natural sources, synthesized in
vitro, or prepared from a combination of natural and synthetic
molecules. The length of a polynucleotide molecule is given herein
in terms of nucleotides (abbreviated "nt") or base pairs
(abbreviated "bp"). The term nucleotides is used for single- and
double-stranded molecules where the context permits. When the term
is applied to double-stranded molecules it is used to denote
overall length and will be understood to be equivalent to the term
base pairs. It will be recognized by those skilled in the art that
the two strands of a double-stranded polynucleotide can differ
slightly in length and that the ends thereof can be staggered; thus
all nucleotides within a double-stranded polynucleotide molecule
can not be paired. Such unpaired ends will, in general, not exceed
20 nucleotides in length.
[0181] As used herein, "primary sequence" refers to the sequence of
amino acid residues in a polypeptide.
[0182] As used herein, "similarity" between two proteins or nucleic
acids refers to the relatedness between the sequence of amino acids
of the proteins or the nucleotide sequences of the nucleic acids.
Similarity can be based on the degree of identity and/or homology
of sequences of residues and the residues contained therein.
Methods for assessing the degree of similarity between proteins or
nucleic acids are known to those of skill in the art. For example,
in one method of assessing sequence similarity, two amino acid or
nucleotide sequences are aligned in a manner that yields a maximal
level of identity between the sequences. "Identity" refers to the
extent to which the amino acid or nucleotide sequences are
invariant. Alignment of amino acid sequences, and to some extent
nucleotide sequences, also can take into account conservative
differences and/or frequent substitutions in amino acids (or
nucleotides). Conservative differences are those that preserve the
physico-chemical properties of the residues involved. Alignments
can be global (alignment of the compared sequences over the entire
length of the sequences and including all residues) or local (the
alignment of a portion of the sequences that includes only the most
similar region or regions).
[0183] As used herein, the terms "homology" and "identity" are used
interchangeably, but homology for proteins can include conservative
amino acid changes. In general to identify corresponding positions
the sequences of amino acids are aligned so that the highest order
match is obtained (see, e.g.: Computational Molecular Biology,
Lesk, A. M., ed., Oxford University Press, New York, 1988;
Biocomputing: Informatics and Genome Projects, Smith, D. W., ed.,
Academic Press, New York, 1993; Computer Analysis of Sequence Data,
Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New
Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje,
G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov,
M. and Devereux, J., eds., M Stockton Press, New York, 1991;
Carillo et al. (1988) SIAM J Applied Math 48:1073).
[0184] As use herein, "sequence identity" refers to the number of
identical amino acids (or nucleotide bases) in a comparison between
a test and a reference polypeptide or polynucleotide. Homologous
polypeptides refer to a pre-determined number of identical or
homologous amino acid residues. Homology includes conservative
amino acid substitutions as well identical residues. Sequence
identity can be determined by standard alignment algorithm programs
used with default gap penalties established by each supplier.
Homologous nucleic acid molecules refer to a pre-determined number
of identical or homologous nucleotides. Homology includes
substitutions that do not change the encoded amino acid (i.e.,
"silent substitutions") as well identical residues. Substantially
homologous nucleic acid molecules hybridize typically at moderate
stringency or at high stringency all along the length of the
nucleic acid or along at least about 70%, 80% or 90% of the
full-length nucleic acid molecule of interest. Also contemplated
are nucleic acid molecules that contain degenerate codons in place
of codons in the hybridizing nucleic acid molecule. (For
determination of homology of proteins, conservative amino acids can
be aligned as well as identical amino acids; in this case,
percentage of identity and percentage homology varies). Whether any
two nucleic acid molecules have nucleotide sequences (or any two
polypeptides have amino acid sequences) that are at least 80%, 85%,
90%, 95%, 96%, 97%, 98% or 99% "identical" can be determined using
known computer algorithms such as the "FAST A" program, using for
example, the default parameters as in Pearson et al. Proc. Natl.
Acad. Sci. USA 85: 2444 (1988) (other programs include the GCG
program package (Devereux, J., et al., Nucleic Acids Research
12(I): 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F., et al.,
J. Molec. Biol. 215:403 (1990); Guide to Huge Computers, Martin J.
Bishop, ed., Academic Press, San Diego (1994), and Carillo et al.
SIAM J Applied Math 48: 1073 (1988)). For example, the BLAST
function of the National Center for Biotechnology Information
database can be used to determine identity. Other commercially or
publicly available programs include DNAStar "MegAlign" program
(Madison, Wis.) and the University of Wisconsin Genetics Computer
Group (UWG) "Gap" program (Madison Wis.)). Percent homology or
identity of proteins and/or nucleic acid molecules can be
determined, for example, by comparing sequence information using a
GAP computer program (e.g., Needleman et al. J. Mol. Biol. 48: 443
(1970), as revised by Smith and Waterman (Adv. Appl. Math. 2: 482
(1981)). Briefly, a GAP program defines similarity as the number of
aligned symbols (i.e., nucleotides or amino acids) which are
similar, divided by the total number of symbols in the shorter of
the two sequences. Default parameters for the GAP program can
include: (1) a unary comparison matrix (containing a value of 1 for
identities and 0 for non identities) and the weighted comparison
matrix of Gribskov et al. Nucl. Acids Res. 14: 6745 (1986), as
described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence
and Structure, National Biomedical Research Foundation, pp. 353-358
(1979); (2) a penalty of 3.0 for each gap and an additional 0.10
penalty for each symbol in each gap; and (3) no penalty for end
gaps.
[0185] Therefore, as used herein, the term "identity" represents a
comparison between a test and a reference polypeptide or
polynucleotide. In one non-limiting example, "at least 90%
identical to" refers to percent identities from 90 to 100% relative
to the reference polypeptides. Identity at a level of 90% or more
is indicative of the fact that, assuming for exemplification
purposes a test and reference polynucleotide length of 100 amino
acids are compared, no more than 10% (i.e., 10 out of 100) of amino
acids in the test polypeptide differs from that of the reference
polypeptides. Similar comparisons can be made between a test and
reference polynucleotides. Such differences can be represented as
point mutations randomly distributed over the entire length of an
amino acid sequence or they can be clustered in one or more
locations of varying length up to the maximum allowable, e.g.,
10/100 amino acid difference (approximately 90% identity).
Differences are defined as nucleic acid or amino acid
substitutions, insertions or deletions. At the level of homologies
or identities above about 85-90%, the result should be independent
of the program and gap parameters set; such high levels of identity
can be assessed readily, often without relying on software.
[0186] As used herein, it also is understood that the terms
"substantially identical" or "similar" varies with the context as
understood by those skilled in the relevant art, but that those of
skill can assess such.
[0187] As used herein, an aligned sequence refers to the use of
homology (similarity and/or identity) to align corresponding
positions in a sequence of nucleotides or amino acids. Typically,
two or more sequences that are related by 50% or more identity are
aligned. An aligned set of sequences refers to 2 or more sequences
that are aligned at corresponding positions and can include
aligning sequences derived from RNAs, such as ESTs and other cDNAs,
aligned with genomic DNA sequence.
[0188] As used herein, "specifically hybridizes" refers to
annealing, by complementary base-pairing, of a nucleic acid
molecule (e.g. an oligonucleotide) to a target nucleic acid
molecule. Those of skill in the art are familiar with in vitro and
in vivo parameters that affect specific hybridization, such as
length and composition of the particular molecule. Parameters
particularly relevant to in vitro hybridization further include
annealing and washing temperature, buffer composition and salt
concentration. Exemplary washing conditions for removing
non-specifically bound nucleic acid molecules at high stringency
are 0.1.times.SSPE, 0.1% SDS, 65.degree. C., and at medium
stringency are 0.2.times.SSPE, 0.1% SDS, 50.degree. C. Equivalent
stringency conditions are known in the art. The skilled person can
readily adjust these parameters to achieve specific hybridization
of a nucleic acid molecule to a target nucleic acid molecule
appropriate for a particular application.
[0189] As used herein, isolated or purified polypeptide or protein
or biologically-active portion thereof is substantially free of
cellular material or other contaminating proteins from the cell of
tissue from which the protein is derived, or substantially free
from chemical precursors or other chemicals when chemically
synthesized. Preparations can be determined to be substantially
free if they appear free of readily detectable impurities as
determined by standard methods of analysis, such as thin layer
chromatography (TLC), gel electrophoresis and high performance
liquid chromatography (HPLC), used by those of skill in the art to
assess such purity, or sufficiently pure such that further
purification would not detectably alter the physical and chemical
properties, such as proteolytic and biological activities, of the
substance. Methods for purification of the compounds to produce
substantially chemically pure compounds are known to those of skill
in the art. A substantially chemically pure compound, however, can
be a mixture of stereoisomers. In such instances, further
purification might increase the specific activity of the
compound.
[0190] The term substantially free of cellular material includes
preparations of proteins in which the protein is separated from
cellular components of the cells from which it is isolated or
recombinantly-produced. In one embodiment, the term substantially
free of cellular material includes preparations of protease
proteins having less that about 30% (by dry weight) of non-protease
proteins (also referred to herein as a contaminating protein),
generally less than about 20% of non-protease proteins or 10% of
non-protease proteins or less that about 5% of non-protease
proteins. When the protease protein or active portion thereof is
recombinantly produced, it also is substantially free of culture
medium, i.e., culture medium represents less than, about, or equal
to 20%, 10% or 5% of the volume of the protease protein
preparation.
[0191] As used herein, the term substantially free of chemical
precursors or other chemicals includes preparations of protease
proteins in which the protein is separated from chemical precursors
or other chemicals that are involved in the synthesis of the
protein. The term includes preparations of protease proteins having
less than about 30% (by dry weight), 20%, 10%, 5% or less of
chemical precursors or non-protease chemicals or components.
[0192] As used herein, production by recombinant methods by using
recombinant DNA methods refers to the use of the well known methods
of molecular biology for expressing proteins encoded by cloned
DNA.
[0193] As used herein, vector (or plasmid) refers to discrete
elements that are used to introduce heterologous nucleic acid into
cells for either expression or replication thereof. The vectors
typically remain episomal, but can be designed to effect
integration of a gene or portion thereof into a chromosome of the
genome. Also contemplated are vectors that are artificial
chromosomes, such as bacterial artificial chromosomes, yeast
artificial chromosomes and mammalian artificial chromosomes.
Selection and use of such vehicles are well known to those of skill
in the art.
[0194] As used herein, expression refers to the process by which
nucleic acid is transcribed into mRNA and translated into peptides,
polypeptides, or proteins. If the nucleic acid is derived from
genomic DNA, expression can, if an appropriate eukaryotic host cell
or organism is selected, include processing, such as splicing of
the mRNA.
[0195] As used herein, an expression vector includes vectors
capable of expressing DNA that is operatively linked with
regulatory sequences, such as promoter regions, that are capable of
effecting expression of such DNA fragments. Such additional
segments can include promoter and terminator sequences, and
optionally can include one or more origins of replication, one or
more selectable markers, an enhancer, a polyadenylation signal, and
the like. Expression vectors are generally derived from plasmid or
viral DNA, or can contain elements of both. Thus, an expression
vector refers to a recombinant DNA or RNA construct, such as a
plasmid, a phage, recombinant virus or other vector that, upon
introduction into an appropriate host cell, results in expression
of the cloned DNA. Appropriate expression vectors are well known to
those of skill in the art and include those that are replicable in
eukaryotic cells and/or prokaryotic cells and those that remain
episomal or those which integrate into the host cell genome.
[0196] As used herein, vector also includes "virus vectors" or
"viral vectors." Viral vectors are engineered viruses that are
operatively linked to exogenous genes to transfer (as vehicles or
shuttles) the exogenous genes into cells.
[0197] As used herein, an adenovirus refers to any of a group of
DNA-containing viruses that cause conjunctivitis and upper
respiratory tract infections in humans.
[0198] As used herein, naked DNA refers to histone-free DNA that
can be used for vaccines and gene therapy. Naked DNA is the genetic
material that is passed from cell to cell during a gene transfer
processed called transformation or transfection. In transformation
or transfection, purified or naked DNA that is taken up by the
recipient cell will give the recipient cell a new characteristic or
phenotype.
[0199] As used herein, operably or operatively linked when
referring to DNA segments means that the segments are arranged so
that they function in concert for their intended purposes, e.g.,
transcription initiates in the promoter and proceeds through the
coding segment to the terminator.
[0200] As used herein, an agent that modulates the activity of a
protein or expression of a gene or nucleic acid either decreases or
increases or otherwise alters the activity of the protein or, in
some manner, up- or down-regulates or otherwise alters expression
of the nucleic acid in a cell.
[0201] As used herein, a "chimeric protein" or "fusion protein"
refers to a polypeptide operatively-linked to a different
polypeptide. A chimeric or fusion protein provided herein can
include one or more FIX polypeptides, or a portion thereof, and one
or more other polypeptides for any one or more of a
transcriptional/translational control signals, signal sequences, a
tag for localization, a tag for purification, part of a domain of
an immunoglobulin G, and/or a targeting agent. A chimeric FIX
polypeptide also includes those having their endogenous domains or
regions of the polypeptide exchanged with another polypeptide.
These chimeric or fusion proteins include those produced by
recombinant means as fusion proteins, those produced by chemical
means, such as by chemical coupling, through, for example, coupling
to sulfhydryl groups, and those produced by any other method
whereby at least one polypeptide (i.e. FIX), or a portion thereof,
is linked, directly or indirectly via linker(s) to another
polypeptide.
[0202] As used herein, operatively-linked when referring to a
fusion protein refers to a protease polypeptide and a non-protease
polypeptide that are fused in-frame to one another. The
non-protease polypeptide can be fused to the N-terminus or
C-terminus of the protease polypeptide.
[0203] As used herein, a targeting agent, is any moiety, such as a
protein or effective portion thereof, that provides specific
binding to a cell surface molecule, such a cell surface receptor,
which in some instances can internalize a bound conjugate or
portion thereof. A targeting agent also can be one that promotes or
facilitates, for example, affinity isolation or purification of the
conjugate; attachment of the conjugate to a surface; or detection
of the conjugate or complexes containing the conjugate.
[0204] As used herein, derivative or analog of a molecule refers to
a portion derived from or a modified version of the molecule.
[0205] As used herein, "disease or disorder" refers to a
pathological condition in an organism resulting from cause or
condition including, but not limited to, infections, acquired
conditions, genetic conditions, and characterized by identifiable
symptoms. Diseases and disorders of interest herein are those
involving coagulation, including those mediated by coagulation
proteins and those in which coagulation proteins play a role in the
etiology or pathology. Diseases and disorders also include those
that are caused by the absence of a protein such as in hemophilia,
and of particular interest herein are those disorders where
coagulation does not occur due to a deficiency of defect in a
coagulation protein.
[0206] As used herein, "procoagulant" refers to any substance that
promotes blood coagulation.
[0207] As used herein, "anticoagulant" refers to any substance that
inhibits blood coagulation
[0208] As used herein, "hemophilia" refers to a bleeding disorder
caused by a deficiency in a blood clotting factors. Hemophilia can
be the result, for example, of absence, reduced expression, or
reduced function of a clotting factor. The most common type of
hemophilia is hemophilia A, which results from a deficiency in
factor VIII. The second most common type of hemophilia is
hemophilia B, which results from a deficiency in factor IX.
Hemophilia C, also called FXI deficiency, is a milder and less
common form of hemophilia.
[0209] As used herein, "congenital hemophilia" refers to types of
hemophilia that are inherited. Congenital hemophilia results from
mutation, deletion, insertion, or other modification of a clotting
factor gene in which the production of the clotting factor is
absent, reduced, or non-functional. For example, hereditary
mutations in clotting factor genes, such as factor VIII and factor
IX result in the congenital hemophilias, Hemophilia A and B,
respectively.
[0210] As used herein, "acquired hemophilia" refers to a type of
hemophilia that develops in adulthood from the production of
autoantibodies that inactivate
[0211] As used herein, "bleeding disorder" refers to a condition in
which the subject has a decreased ability to control bleeding.
Bleeding disorders can be inherited or acquired, and can result
from, for example, defects or deficiencies in the coagulation
pathway, defects or deficiencies in platelet activity, or vascular
defects.
[0212] As used herein, "acquired bleeding disorder" refers to
bleeding disorders that results from clotting deficiencies caused
by conditions such as liver disease, vitamin K deficiency, or
coumadin (warfarin) or other anti-coagulant therapy.
[0213] As used herein, "treating" a subject having a disease or
condition means that a polypeptide, composition or other product
provided herein is administered to the subject.
[0214] As used herein, a therapeutic agent, therapeutic regimen,
radioprotectant, or chemotherapeutic mean conventional drugs and
drug therapies, including vaccines, which are known to those
skilled in the art. Radiotherapeutic agents are well known in the
art.
[0215] As used herein, treatment means any manner in which the
symptoms of a condition, disorder or disease are ameliorated or
otherwise beneficially altered. Hence treatment encompasses
prophylaxis, therapy and/or cure. Treatment also encompasses any
pharmaceutical use of the compositions herein. Treatment also
encompasses any pharmaceutical use of a modified FIX and
compositions provided herein.
[0216] As used herein, amelioration of the symptoms of a particular
disease or disorder by a treatment, such as by administration of a
pharmaceutical composition or other therapeutic, refers to any
lessening, whether permanent or temporary, lasting or transient, of
the symptoms that can be attributed to or associated with
administration of the composition or therapeutic.
[0217] As used herein, prevention or prophylaxis refers to methods
in which the risk of developing disease or condition is reduced.
Prophylaxis includes reduction in the risk of developing a disease
or condition and/or a prevention of worsening of symptoms or
progression of a disease or reduction in the risk of worsening of
symptoms or progression of a disease.
[0218] As used herein an effective amount of a compound or
composition for treating a particular disease is an amount that is
sufficient to ameliorate, or in some manner reduce the symptoms
associated with the disease. Such amount can be administered as a
single dosage or can be administered according to a regimen,
whereby it is effective. The amount can cure the disease but,
typically, is administered in order to ameliorate the symptoms of
the disease. Typically, repeated administration is required to
achieve a desired amelioration of symptoms.
[0219] As used herein, "therapeutically effective amount" or
"therapeutically effective dose" refers to an agent, compound,
material, or composition containing a compound that is at least
sufficient to produce a therapeutic effect. An effective amount is
the quantity of a therapeutic agent necessary for preventing,
curing, ameliorating, arresting or partially arresting a symptom of
a disease or disorder.
[0220] As used herein, "patient" or "subject" to be treated
includes humans and or non-human animals, including mammals.
Mammals include primates, such as humans, chimpanzees, gorillas and
monkeys; domesticated animals, such as dogs, horses, cats, pigs,
goats, cows; and rodents such as mice, rats, hamsters and
gerbils.
[0221] As used herein, a combination refers to any association
between two or among more items. The association can be spatial or
refer to the use of the two or more items for a common purpose.
[0222] As used herein, a composition refers to any mixture of two
or more products or compounds (e.g., agents, modulators,
regulators, etc.). It can be a solution, a suspension, liquid,
powder, a paste, aqueous or non-aqueous formulations or any
combination thereof.
[0223] As used herein, an "article of manufacture" is a product
that is made and sold. As used throughout this application, the
term is intended to encompass modified protease polypeptides and
nucleic acids contained in articles of packaging.
[0224] As used herein, fluid refers to any composition that can
flow. Fluids thus encompass compositions that are in the form of
semi-solids, pastes, solutions, aqueous mixtures, gels, lotions,
creams and other such compositions.
[0225] As used herein, a "kit" refers to a packaged combination,
optionally including reagents and other products and/or components
for practicing methods using the elements of the combination. For
example, kits containing a modified protease polypeptide or nucleic
acid molecule provided herein and another item for a purpose
including, but not limited to, administration, diagnosis, and
assessment of a biological activity or property are provided. Kits
optionally include instructions for use.
[0226] As used herein, antibody includes antibody fragments, such
as Fab fragments, which are composed of a light chain and the
variable region of a heavy chain.
[0227] As used herein, a receptor refers to a molecule that has an
affinity for a particular ligand. Receptors can be
naturally-occurring or synthetic molecules. Receptors also can be
referred to in the art as anti-ligands.
[0228] As used herein, animal includes any animal, such as, but not
limited to; primates including humans, gorillas and monkeys;
rodents, such as mice and rats; fowl, such as chickens; ruminants,
such as goats, cows, deer, sheep; ovine, such as pigs and other
animals. Non-human animals exclude humans as the contemplated
animal. The proteases provided herein are from any source, animal,
plant, prokaryotic and fungal.
[0229] As used herein, gene therapy involves the transfer of
heterologous nucleic acid, such as DNA, into certain cells, target
cells, of a mammal, particularly a human, with a disorder or
condition for which such therapy is sought. The nucleic acid, such
as DNA, is introduced into the selected target cells, such as
directly or in a vector or other delivery vehicle, in a manner such
that the heterologous nucleic acid, such as DNA, is expressed and a
therapeutic product encoded thereby is produced. Alternatively, the
heterologous nucleic acid, such as DNA, can in some manner mediate
expression of DNA that encodes the therapeutic product, or it can
encode a product, such as a peptide or RNA that in some manner
mediates, directly or indirectly, expression of a therapeutic
product. Genetic therapy also can be used to deliver nucleic acid
encoding a gene product that replaces a defective gene or
supplements a gene product produced by the mammal or the cell in
which it is introduced. The introduced nucleic acid can encode a
therapeutic compound, such as a protease or modified protease, that
is not normally produced in the mammalian host or that is not
produced in therapeutically effective amounts or at a
therapeutically useful time. The heterologous nucleic acid, such as
DNA, encoding the therapeutic product can be modified prior to
introduction into the cells of the afflicted host in order to
enhance or otherwise alter the product or expression thereof.
Genetic therapy also can involve delivery of an inhibitor or
repressor or other modulator of gene expression.
[0230] As used herein, heterologous nucleic acid is nucleic acid
that is not normally produced in vivo by the cell in which it is
expressed or that is produced by the cell but is at a different
locus or expressed differently or that mediates or encodes
mediators that alter expression of endogenous nucleic acid, such as
DNA, by affecting transcription, translation, or other regulatable
biochemical processes. Heterologous nucleic acid is generally not
endogenous to the cell into which it is introduced, but has been
obtained from another cell or prepared synthetically. Heterologous
nucleic acid can be endogenous, but is nucleic acid that is
expressed from a different locus or altered in its expression.
Generally, although not necessarily, such nucleic acid encodes RNA
and proteins that are not normally produced by the cell or in the
same way in the cell in which it is expressed. Heterologous nucleic
acid, such as DNA, also can be referred to as foreign nucleic acid,
such as DNA. Thus, heterologous nucleic acid or foreign nucleic
acid includes a nucleic acid molecule not present in the exact
orientation or position as the counterpart nucleic acid molecule,
such as DNA, is found in a genome. It also can refer to a nucleic
acid molecule from another organism or species (i.e.,
exogenous).
[0231] Any nucleic acid, such as DNA, that one of skill in the art
would recognize or consider as heterologous or foreign to the cell
in which the nucleic acid is expressed is herein encompassed by
heterologous nucleic acid; heterologous nucleic acid includes
exogenously added nucleic acid that also is expressed endogenously.
Examples of heterologous nucleic acid include, but are not limited
to, nucleic acid that encodes traceable marker proteins, such as a
protein that confers drug resistance, nucleic acid that encodes
therapeutically effective substances, such as anti-cancer agents,
enzymes and hormones, and nucleic acid, such as DNA, that encodes
other types of proteins, such as antibodies. Antibodies that are
encoded by heterologous nucleic acid can be secreted or expressed
on the surface of the cell in which the heterologous nucleic acid
has been introduced.
[0232] As used herein, a therapeutically effective product for gene
therapy is a product that is encoded by heterologous nucleic acid,
typically DNA, that, upon introduction of the nucleic acid into a
host, a product is expressed that ameliorates or eliminates the
symptoms, manifestations of an inherited or acquired disease or
that cures the disease. Also included are biologically active
nucleic acid molecules, such as RNAi and antisense.
[0233] As used herein, recitation that a polypeptide "consists
essentially" of a recited sequence of amino acids means that only
the recited portion, or a fragment thereof, of the full-length
polypeptide is present. The polypeptide can optionally, and
generally will, include additional amino acids from another source
or can be inserted into another polypeptide
[0234] As used herein, the singular forms "a," "an" and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to compound, comprising "an
extracellular domain" includes compounds with one or a plurality of
extracellular domains.
[0235] As used herein, ranges and amounts can be expressed as
"about" a particular value or range. About also includes the exact
amount. Hence "about 5 bases" means "about 5 bases" and also "5
bases."
[0236] As used herein, "optional" or "optionally" means that the
subsequently described event or circumstance does or does not
occur, and that the description includes instances where said event
or circumstance occurs and instances where it does not. For
example, an optionally substituted group means that the group is
unsubstituted or is substituted.
[0237] As used herein, the abbreviations for any protective groups,
amino acids and other compounds, are, unless indicated otherwise,
in accord with their common usage, recognized abbreviations, or the
IUPAC-IUB Commission on Biochemical Nomenclature (see, (1972)
Biochem. 11:1726).
B. HEMOSTASIS AND ROLE OF FACTOR IX THEREIN
[0238] Provided herein are modified Factor IX (FIX) polypeptides,
including modified FIXa polypeptides and catalytically active
fragments thereof. Factor IX polypeptides play a role in the
regulation of and process of hemostasis, and hence can be used as
therapeutic agents. Effective delivery of therapeutic proteins such
as FIX for clinical use is a major challenge to pharmaceutical
science. Once in the blood stream, these proteins are constantly
eliminated from circulation within a short time by different
physiological processes, involving metabolism as well as clearance
using normal pathways for protein elimination, such as (glomerular)
filtration in the kidneys or proteolysis in blood. Once in the
luminal gastrointestinal tract, these proteins are constantly
digested by luminal proteases. The latter can be a limiting process
affecting the half-life of proteins used as therapeutic agents in
intravenous injection. Additionally, inhibitors in the blood can
specifically inhibit the activity of the therapeutic protein. For
example, antithrombin (AT-III), heparin, and the AT-III/heparin
complex, can inhibit the coagulant activity of FIX. More
efficacious variants of FIX with improved properties, including
improved pharmacokinetic and pharmacodynamic properties, increased
catalytic activity, and/or increased resistance to inhibitors, are
needed.
[0239] The modified FIX polypeptides provided herein exhibit
improved properties, including improved pharmacokinetic properties,
such as increased serum half-life; increased resistance to
inhibitors, such as antithrombin III (AT-III), heparin and the
AT-III/heparin complex; increased catalytic activity; or any
combination thereof. Hence, provided are modified FIX polypeptides
that have increased coagulant activity. Accordingly, these
polypeptides have a variety of uses and applications, for example,
as therapeutics for modulating hemostasis. The following discussion
provides a review of the coagulation process and the role of Factor
IX in this process, before a discussion of factor IX, and
modifications thereof.
[0240] Hemostasis is the physiological mechanism that stems the
bleeding that results from injury to the vasculature. Normal
hemostasis depends on cellular components and soluble plasma
proteins, and involves a series of signaling events that ultimately
leads to the formation of a blood clot. Coagulation is quickly
initiated after an injury occurs to the blood vessel and
endothelial cells are damaged. In the primary phase of coagulation,
platelets are activated to form a haemostatic plug at the site of
injury. Secondary hemostasis follows involving plasma coagulation
factors, which act in a proteolytic cascade resulting in the
formation of fibrin strands which strengthen the platelet plug.
[0241] Upon vessel injury, the blood flow to the immediate injured
area is restricted by vascular constriction allowing platelets to
adhere to the newly-exposed fibrillar collagen on the
subendothelial connective tissue. This adhesion is dependent upon
the von Willebrand factor (vWF), which binds to the endothelium
within three seconds of injury, thereby facilitating platelet
adhesion and aggregation. Activation of the aggregated platelets
results in the secretion of a variety of factors, including ADP,
ATP, thromboxane and serotonin. Adhesion molecules, fibrinogen,
vWF, thrombospondin and fibronectin also are released. Such
secretion promotes additional adhesion and aggregation of
platelets, increased platelet activation and blood vessel
constriction, and exposure of anionic phospholipids on the platelet
surface that serve as platforms for the assembly of blood
coagulation enzyme complexes. The platelets change shape leading to
pseudopodia formation, which further facilitates aggregation to
other platelets resulting in a loose platelet plug.
[0242] A clotting cascade of peptidases (the coagulation cascade)
is simultaneously initiated. The coagulation cascade involves a
series of activation events involving proteolytic cleavage. In such
a cascade, an inactive protein of a serine protease (also called a
zymogen) is converted to an active protease by cleavage of one or
more peptide bonds, which then serves as the activating protease
for the next zymogen molecule in the cascade, ultimately resulting
in clot formation by the cross-linking of fibrin. For example, the
cascade generates activated molecules such as thrombin (from
cleavage of prothrombin), which further activates platelets, and
also generates fibrin from cleavage of fibrinogen. Fibrin then
forms a cross-linked polymer around the platelet plug to stabilize
the clot. Upon repair of the injury, fibrin is digested by the
fibrinolytic system, the major components of which are plasminogen
and tissue-type plasminogen activator (tPA). Both of these proteins
are incorporated into polymerizing fibrin, where they interact to
generate plasmin, which, in turn, acts on fibrin to dissolve the
preformed clot. During clot formation, coagulation factor
inhibitors also circulate through the blood to prevent clot
formation beyond the injury site. The interaction of the system,
from injury to clot formation and subsequent fibrinolysis, is
described below.
[0243] 1. Platelet Adhesion and Aggregation
[0244] The clotting of blood is actively circumvented under normal
conditions. The vascular endothelium supports vasodilation,
inhibits platelet adhesion and activation, suppresses coagulation,
enhances fibrin cleavage and is anti-inflammatory in character.
Vascular endothelial cells secrete molecules such as nitrous oxide
(NO) and prostacyclin, which inhibit platelet aggregation and
dilate blood vessels. Release of these molecules activates soluble
guanylate cyclases (sGC) and cGMP-dependent protein kinase I (cGKT)
and increases cyclic guanosine monophosphate (cGMP) levels, which
cause relaxation of the smooth muscle in the vessel wall.
Furthermore, endothelial cells express cell-surface ADPases, such
as CD39, which control platelet activation and aggregation by
converting ADP released from platelets into adenine nucleotide
platelet inhibitors. The endothelium also plays an important role
in the regulation of the enzymes in the fibrinolytic cascade.
Endothelial cells directly promote the generation of plasmin
through the expression of receptors of plasminogen (annexin II) and
urokinase, as well as the secretion of tissue-type and urokinase
plasminogen activators, all of which promote clot clearance. In a
final layer of prothrombotic regulation, endothelial cells play an
active role in inhibiting the coagulation cascade by producing
heparan sulfate, which increases the kinetics of antithrombin III
inhibition of thrombin and other coagulation factors.
[0245] Under acute vascular trauma, however, vasoconstrictor
mechanisms predominate and the endothelium becomes prothrombotic,
procoagulatory and proinflammatory in nature. This is achieved by a
reduction of endothelial dilating agents: adenosine, NO and
prostacyclin; and the direct action of ADP, serotonin and
thromboxane on vascular smooth muscle cells to elicit their
contraction (Becker, Heindl et al. 2000). The chief trigger for the
change in endothelial function that leads to the formation of
haemostatic thrombus is the loss of the endothelial cell barrier
between blood and extracellular matrix (ECM) components (Ruggeri
(2002) Nat Med 8:1227-1234). Circulating platelets identify and
discriminate areas of endothelial lesions and adhere to the exposed
sub endothelium. Their interaction with the various thrombogenic
substrates and locally-generated or released agonists results in
platelet activation. This process is described as possessing two
stages, 1) adhesion: the initial tethering to a surface, and 2)
aggregation: the platelet-platelet cohesion (Savage et al. (2001)
Curr Opin Hematol 8:270-276).
[0246] Platelet adhesion is initiated when the circulating
platelets bind to exposed collagen through interaction with
collagen binding proteins on the cell surface, and through
interaction with vWF, also present on the endothelium. vWF protein
is a multimeric structure of variable size, secreted in two
directions by the endothelium; basolaterally and into the
bloodstream. vWF also binds to factor VIII, which is important in
the stabilization of factor VIII and its survival in the
circulation.
[0247] Platelet adhesion and subsequent activation is achieved when
vWF binds via its A1 domain to GPIb (part of the platelet
glycoprotein receptor complex GPIb-IX-V). The interaction between
vWF and GPIb is regulated by shear force such that an increase in
the shear stress results in a corresponding increase in the
affinity of vWF for GPIb. Integrin .alpha.1.beta.2, also known on
leukocytes as VLA-2, is the major collagen receptor on platelets,
and engagement through this receptor generates the intracellular
signals that contribute to platelet activation. Binding through
.alpha.1.beta.2 facilitates the engagement of the lower-affinity
collagen receptor, GP VI. This is part of the immunoglobulin
superfamily and is the receptor that generates the most potent
intracellular signals for platelet activation. Platelet activation
results in the release of adenosine diphosphate (ADP), which is
converted to thromboxane A2.
[0248] Platelet activation also results in the surface expression
of platelet glycoprotein IIIb-IIIa (GP IIb-IIIa) receptors, also
known as platelet integrin .alpha.IIb.beta.3. GP IIb-IIa receptors
allow the adherence of platelets to each other (i.e. aggregation)
by virtue of fibrinogen molecules linking the platelets through
these receptors. This results in the formation of a platelet plug
at the site of injury to help prevent further blood loss, while the
damaged vascular tissue releases factors that initiate the
coagulation cascade and the formation of a stabilizing fibrin mesh
around the platelet plug.
[0249] 2. Coagulation Cascade
[0250] The coagulation pathway is a proteolytic pathway where each
enzyme is present in the plasma as a zymogen, or inactive form.
Cleavage of the zymogen is regulated to release the active form
from the precursor molecule. The pathway functions as a series of
positive and negative feedback loops that control the activation
process, where the ultimate goal is to produce thrombin, which can
then convert soluble fibrinogen into fibrin to form a clot. The
coagulation factors, and other proteins, participate in blood
coagulation through one or more of the intrinsic, extrinsic or
common pathway of coagulation. As discussed below, these pathways
are interconnected, and blood coagulation likely occurs through a
cell-based model of activation.
[0251] The generation of thrombin has historically been divided
into three pathways, the intrinsic (suggesting that all components
of the pathway are intrinsic to plasma) and extrinsic (suggesting
that one or more components of the pathway are extrinsic to plasma)
pathways that provide alternative routes for the generation of
activated factor X (FXa), and the final common pathway which
results in thrombin formation (FIG. 1). These pathways participate
together in an interconnected and interdependent process to effect
coagulation. A cell-based model of coagulation was developed that
describes these pathways (FIG. 2) (Hoffman et al. (2001) Thromb
Haemost 85:958-965). In this model, the "extrinsic" and "intrinsic"
pathways are effected on different cell surfaces; the tissue factor
(TF)-bearing cell and the platelet, respectively. The process of
coagulation is separated into distinct phases, initiation,
amplification and propagation, during which the extrinsic and
intrinsic pathways function at various stages to produce the large
burst of thrombin required to convert sufficient quantities of
fibrinogen to fibrin for clot formation.
[0252] a. Initiation
[0253] FVII is considered to be the coagulation factor responsible
for initiating the coagulation cascade, which initiation is
dependent on its interaction with TF. TF is a transmembrane
glycoprotein expressed by a variety of cells such as smooth muscle
cells, fibroblasts, monocytes, lymphocytes, granulocytes, platelets
and endothelial cells. Myeloid cells and endothelial cells only
express TF when they are stimulated, such as by proinflammatory
cytokines. Smooth muscle cells and fibroblasts, however, express TF
constitutively. Accordingly, once these cells come in contact with
the bloodstream following tissue injury, the coagulation cascade is
rapidly initiated by the binding of TF with factor VII or FVIIa in
the plasma. TF/FVIIa complexes can be formed by the direct binding
of FVIIa to TF, or by the binding of FVII to TF and then the
subsequent activation of FVII to FVIIa by a plasma protease, such
as FXa, FIXa, FXIIa, or FVIIa itself. The TF/FVIIa complex remains
anchored to the TF-bearing cell where it activates small amounts FX
into FXa in what is known as the "extrinsic pathway" of
coagulation.
[0254] The TF/FVIIa complex also cleaves small amounts of FIX into
FIXa. FXa associates with its cofactor FVa to also form a complex
on the TF-bearing cell that can then covert prothrombin to
thrombin. The small amount of thrombin produced is, however,
inadequate to support the required fibrin formation for complete
clotting. Additionally, any active FXa and FIXa are inhibited in
the circulation by antithrombin III (AT-III) and other serpins,
which are discussed in more detail below. This would normally
prevent clot formation in the circulation. In the presence of
injury, however, damage to the vasculature results in platelet
aggregation and activation at this site of thrombin formation,
thereby allowing for amplification of the coagulation signal.
[0255] b. Amplification
[0256] Amplification takes place when thrombin binds to and
activates the platelets. The activated platelets release FV from
their alpha granules, which is activated by thrombin to FVa.
Thrombin also releases and activates FVIII from the FVIII/vWF
complex on the platelet membrane, and cleaves FXI into FXIa. These
reactions generate activated platelets that have FVa, FVIIIa and
FIXa on their surface, which set the stage for a large burst of
thrombin generation during the propagation stage.
[0257] c. Propagation
[0258] Propagation of coagulation occurs on the surface of large
numbers of platelets at the site of injury. As described above, the
activated platelets have FXIa, FVIIIa and FVa on their surface. It
is here that the extrinsic pathway is effected. FXIa activates FIX
to FIXa, which can then bind with FVIIIa. This process, in addition
to the small amounts of FIXa that is generated by cleavage of FIX
by the TF/FVIIa complex on the TF-bearing cell, generates a large
amount FIXa in complex with its cofactor, FVIIIa, calcium and a
suitable phospholipid surface. This complex is termed the tenase or
Xase complex, and it cleaves and activates the Factor X (FX) to
Factor Xa (FXa). The FXa molecules bind to FVa to generate the
prothrombinase complexes that activate prothrombin to thrombin.
Thrombin acts in a positive feedback loop to activate even more
platelets and again initiates the processes described for the
amplification phase.
[0259] Very shortly, there are sufficient numbers of activated
platelets with the appropriate complexes to generate the burst of
thrombin that is large enough to generate sufficient amounts of
fibrin from fibrinogen to form a hemostatic fibrin clot. Fibrinogen
is a dimer soluble in plasma which, when cleaved by thrombin,
releases fibrinopeptide A and fibrinopeptide B. Fibrinopeptide B is
then cleaved by thrombin, and the fibrin monomers formed by this
second proteolytic cleavage spontaneously forms an insoluble gel.
The polymerized fibrin is held together by noncovalent and
electrostatic forces and is stabilized by the transamidating enzyme
factor XIIIa (FXIIIa), produced by the cleavage of FXIII by
thrombin. Thrombin also activates TAFI, which inhibits fibrinolysis
by reducing plasmin generation at the clot surface. Additionally,
thrombin itself is incorporated into the structure of the clot for
further stabilization. These insoluble fibrin aggregates (clots),
together with aggregated platelets (thrombi), block the damaged
blood vessel and prevent further bleeding.
[0260] 3. Regulation of Coagulation
[0261] During coagulation, the cascade is regulated by constitutive
and stimulated processes to inhibit further clot formation.
Regulation is important to a) limit ischemia of tissues by fibrin
clot formation, and b) prevent widespread thrombosis by localizing
the clot formation only to the site of tissue injury.
[0262] Regulation is achieved by the actions of several inhibitory
molecules. For example, antithrombin III (AT-III) and tissue factor
pathway inhibitor (TFPI) work constitutively to inhibit factors in
the coagulation cascade. TFPI predominantly inhibits FXa and
FVIIa/TF complex. In contrast, which is a serine protease inhibitor
(serpin), predominantly inhibits thrombin, FXa, and FIXa. The
inhibition of these coagulation factors by AT-III is enhanced
greatly by heparin, which binds AT-III to induce an activating
conformational change that accelerates the inhibitory reaction.
Heparin also can inhibit the activity of the FIXa/FVIIIa complex in
an AT-III-independent manner (Yuan et al., (2005) Biochemistry
44:3615-3625). An additional factor, Protein C, which is stimulated
via platelet activation, regulates coagulation by proteolytic
cleavage and inactivation of FVa and FVIIIa. Protein S enhances the
activity of Protein C. Further, another factor which contributes to
coagulation inhibition is the integral membrane protein
thrombomodulin, which is produced by vascular endothelial cells and
serves as a receptor for thrombin. Binding of thrombin to
thrombomodulin inhibits thrombin procoagulant activities and also
contributes to protein C activation.
[0263] Fibrinolysis, the breakdown of the fibrin clot, also
provides a mechanism for regulating coagulation. The crosslinked
fibrin multimers in a clot are broken down to soluble polypeptides
by plasmin, a serine protease. Plasmin can be generated from its
inactive precursor plasminogen and recruited to the site of a
fibrin clot in two ways: by interaction with tissue plasminogen
activator (tPA) at the surface of a fibrin clot, and by interaction
with urokinase plasminogen activator (uPA) at a cell surface. The
first mechanism appears to be the major one responsible for the
dissolution of clots within blood vessels. The second, although
capable of mediating clot dissolution, can play a major role in
tissue remodeling, cell migration, and inflammation.
[0264] Clot dissolution also is regulated in two ways. First,
efficient plasmin activation and fibrinolysis occur only in
complexes formed at the clot surface or on a cell membrane, while
proteins free in the blood are inefficient catalysts and are
rapidly inactivated. Second, plasminogen activators and plasmin are
inactivated by molecules such as plasminogen activator inhibitor
type 1 (PAI-1) and PAI-2 which act on the plasminogen activators,
and .alpha.2-antiplasmin and .beta.2-macroglobulin that inactivate
plasmin. Under normal circumstances, the timely balance between
coagulation and fibrinolysis results in the efficient formation and
clearing of clots following vascular injury, while simultaneously
preventing unwanted thrombotic or bleeding episodes.
C. FACTOR IX (FIX) STRUCTURE AND FUNCTION
[0265] Provided herein are modified FIX polypeptides with improved
activities or functions. FIX is a polypeptide that is involved in
the coagulation cascade. The role of FIX in the coagulation cascade
is related to its structure and mechanism of activation. It is
understood that the modulation of coagulation by modified FIX
polypeptides provided herein also is linked to its structure and
mechanism of activation. These features can be the same as an
unmodified FIX polypeptide. In other cases, these features can be
modified in a FIX polypeptide provided herein, thus resulting in a
polypeptide with altered or improved activities or properties. For
example, modification of a FIX polypeptide can alter one or more
activities of a FIX polypeptide. For example, provided are modified
FIX polypeptides that exhibit increased levels of glycosylation
compared to a wild-type FIX polypeptide. The modified FIX
polypeptides can thus exhibit improved pharmacokinetic properties,
such as reduced clearance and increased serum half-life compared to
a wild-type FIX polypeptide, when tested using in vivo assays. Also
provided are modified FIX polypeptides that exhibit increased
resistance to inhibitors, such as AT-III, heparin and the
AT-III/heparin complex; and/or increased catalytic activity. Thus,
provided are modified FIX polypeptides that exhibit improved
therapeutic properties compared to an unmodified FIX polypeptide. A
summary of structural and functional features of FIX polypeptides
and modified FIX polypeptides are described below.
[0266] Factor IX is a vitamin K-dependent serine protease and is an
important coagulation factor in hemostasis. It is synthesized as a
single chain zymogen in the liver and circulates in the blood in
this inactivated state until activated as part of the coagulation
cascade. Following activation from the FIX zymogen to activated FIX
(FIXa) by FXIa or the TF/FVIIa complex, FIXa binds it's cofactor,
FVIIIa. The resulting FIXa/FVIIIa complex binds and activates FX to
FXa, thus continuing the coagulation cascade described above to
establish hemostasis. The concentration of FIX in the blood is
approximately 4-5 .mu.g/mL, and it has a half-life of approximately
18-24 hours.
[0267] Hemophilia B, also known as Christmas disease or factor IX
deficiency, is caused by a deficiency or dysfunction of FIX
resulting from any one or more of a variety of mutations in the FIX
gene. While less prevalent than Hemophilia A, Hemophilia B remains
a significant disease in which recurrent joint bleeds can lead to
synovial hypertrophy, chronic synovitis, with destruction of
synovium, cartilage, and bone leading to chronic pain, stiffness of
the joints, and limitation of movement because of progressive
severe joint damage. Recurrent muscle bleeds also produce acute
pain, swelling, and limitation of movement, while bleeding at other
sites can contribute to morbidity and mortality. Treatment is
typically by replacement therapy with recombinant FIX (rFIX).
Provided herein are modified FIX polypeptides that are designed to
have increased coagulation activity upon activation, and that can
serve as improved therapeutics to treat diseases and conditions
amenable to factor IX therapy, such as Hemophilia B.
[0268] 1. FIX Structure
[0269] The human FIX gene is located on the X chromosome and is
approximately 34 kb long with eight exons. The human FIX transcript
is 2803 nucleotides and contains a short 5' untranslated region, an
open reading frame (including stop codon) of 1383 nucleotides and a
3' untranslated region. The 1383 nucleotide open reading frame (or
FIX mRNA; SEQ ID NO:1) encodes a 461 amino acid precursor
polypeptide (Swiss-Prot accession no. P00740; SEQ ID NO:2)
containing a 28 amino acid N-terminal signal peptide (amino acids
1-28 of SEQ ID NO:2) that directs the factor IX polypeptide to the
cellular secretory pathway. In addition the hydrophobic signal
peptide, the FIX precursor polypeptide also contains an 18 amino
acid propeptide (aa 29-46 of SEQ ID NO:2) that, when cleaved,
releases the 415 amino acid mature polypeptide (SEQ ID NO:3) that
circulates in the blood as a zymogen until activation to FIXa. In
addition to the signal peptide and propeptide, the FIX precursor
also contains the following segments and domains: a Gla domain (aa
47-92 of SEQ ID NO:2, corresponding to aa 1-46 of the mature FIX
protein set forth in SEQ ID NO:3), epidermal growth factor
(EGF)-like domain 1 (EGF1; aa 93-129 of SEQ ID NO:2, corresponding
to aa 47-83 of the mature FIX protein set forth in SEQ ID NO:3),
EGF2 (aa 130-171 of SEQ ID NO:2, corresponding to aa 84-125 of the
mature FIX protein set forth in SEQ ID NO:3), a light chain (aa
47-191 of SEQ ID NO:2, corresponding to aa 1-145 of the mature FIX
protein set forth in SEQ ID NO:3), an activation peptide (aa
192-226 of SEQ ID NO:2, corresponding to aa 146-180 of the mature
FIX protein set forth in SEQ ID NO:3), a heavy chain (aa 227-461 of
SEQ ID NO:2, corresponding to aa 181-415 of the mature FIX protein
set forth in SEQ ID NO:3) and a serine protease domain (aa 227-459
of SEQ ID NO:2, corresponding to aa 181-413 of the mature FIX
protein set forth in SEQ ID NO:3).
[0270] Like other vitamin K-dependent proteins, such as
prothrombin, coagulation factors VII and X, and proteins C, S, and
Z, the Gla domain of FIX is a membrane binding motif which, in the
presence of calcium ions, interacts with the phospholipid membranes
of cells. The vitamin K-dependent proteins require vitamin K for
the posttranslational synthesis of .gamma.-carboxyglutamic acid, an
amino acid clustered in the Gla domain of these proteins. The FIX
Gla domain has 12 glutamic residues, each of which are potential
carboxylation sites. Many of them are, therefore, modified by
carboxylation to generate .gamma.-carboxyglutamic acid residues.
There are a total of eight Ca.sup.2+ binding sites, of both high
and low affinity, in the FIX Gla domain that, when occupied by
calcium ions, facilitate correct folding of the Gla domain to
expose hydrophobic residues in the FIX polypeptide that are
inserted into the lipid bilayer to effect binding to the
membrane.
[0271] In addition to the Gla domain, the FIX polypeptide also
contains two EGF-like domains. Each EGF-like domain contains six
highly conserved cysteine residues that form three disulphide bonds
in each domain in the same pattern observed in the EGF protein. The
first EGF-like domain (EGF1) is a calcium-binding EGF domain
containing a high affinity Ca.sup.2+ binding site (Rao et al.,
(1995) Cell 82:131-141) that, when occupied by a calcium ion,
contributes to the correct folding of the molecule and promotes
biological activity. The second EGF domain (EGF2) does not contain
a calcium binding site.
[0272] The serine protease domain, or catalytic domain, of FIX is
the domain responsible for the proteolytic activity of FIXa. Like
other serine proteases, FIX contains a serine protease catalytic
triad composed of H221, D269 and S365 (corresponding to H57, D102
and S195 by chymotrypsin numbering).
[0273] Activation of mature FIX to FIXa is effected by proteolytic
cleavage of the R145-A146 bonds and R180-V181 bonds (numbering
relative to the mature FIX polypeptide set forth in SEQ ID NO:3),
releasing the activation peptide that corresponds to aa 146-180 of
the mature FIX protein set forth in SEQ ID NO:3. Thus, following
activation, FIXa consists of two chains; the light chain and heavy
chain. The light chain contains the Gla domain, EGF1 and EGF2
domains, and the heavy chain contains the protease domain. The two
chains are held together by a single disulphide bond between C132
and C289.
[0274] 2. FIX Post-Translational Modification
[0275] The Factor IX precursor polypeptide undergoes extensive
posttranslational modification to become the mature zymogen that is
secreted into the blood. Such posttranslation modifications include
.gamma.-carboxylation, .beta.-hydroxylation, cleavage of the signal
peptide and propeptide, O- and N-linked glycosylation, sulfation
and phosphorylation. The N-terminal signal peptide directs the
polypeptide to the endoplasmic reticulum (ER), after which it is
cleaved. Immediately prior to secretion from the cell, the
propeptide is cleaved by processing proteases, such as, for
example, PACE/furin, that recognize at least two arginine residues
within four amino acids prior to the cleavage site.
[0276] A single enzyme, vitamin K-dependent gamma-carboxylase,
catalyzes the .gamma.-carboxylation FIX in the ER (Berkner (2000)
J. Nutr. 130:1877-80). In the carboxylation reaction, the
.gamma.-carboxylase binds to the FIX propeptide and catalyzes a
second carboxylation on the .gamma.-carbon of the glutamic acid
residues (i.e. Glu to .gamma.-carboxyglutamyl or Gla) in the Gla
domain of the polypeptide. Assuming all glutamic acid residues are
.gamma.-carboxylated, FIX contains 12 Gla residues, where the first
10 are at homologous positions of other vitamin K-dependent
proteins. The Gla domain of FIX then processively carboxylates all
glutamates in the cluster before releasing the substrate (Morris et
al. 1995; Berkner 2000; Stenina et al. 2001).
[0277] FIX also is partially .beta.-hydroxylated. This modification
is performed by a dioxygenase, which hydroxylates the .beta.-carbon
of D64 (corresponding to the mature FIX polypeptide set forth in
SEQ ID NO:3) in EGF1. Approximately one third of human FIX
polypeptides are .beta.-hydroxylated. Although D64 contributes to
the high affinity Ca.sup.2+ binding site in the EGF1 domain of FIX,
the hydroxylation of this residue does not appear to be necessary
for Ca.sup.2+ binding, nor for biological activity (Derian et al.,
(1989) J. Biol. Chem. 264:6615-6618, Sunnerhagen et al., (1993) J.
Biol. Chem. 268: 23339-23344). Additional post-translational
modifications include sulfonation at the tyrosine at position 155,
and phosphorylation at the serine residue at position 158. These
post-translational modifications of Factor IX have been implicated
in contributing to in vivo recovery of FIX (Kaufman (1998) Thromb.
Haemost. 79:1068-1079, U.S. Pat. No. 7,575,897).
[0278] FIX is N-linked glycosylated at asparagine residues in the
activation peptide corresponding to N157 and N167 of the mature FIX
polypeptide set forth in SEQ ID NO:3. Post-translational
modification also results in the serine residue at position 53
(corresponding to the mature FIX polypeptide set forth in SEQ ID
NO:3) having O-linked disaccharides and trisaccharides, while the
serine residue at position 61 contains an O-linked tetrasaccharide.
(Nishimura et al., (1989) J Biol. Chem. 264:20320-20325, Harris et
al., (1993) Biochemistry 32:6539-6547). Additionally, the threonine
residues at amino acid positions 159 and 169 (corresponding to the
mature FIX polypeptide set forth in SEQ ID NO:3) are O-glycosylated
(Agarwala et al., (1994) Biochemistry 33:5167-5171). The threonine
residues at amino acid positions 172 and 179 also may be
O-glycosylated.
[0279] 3. FIX Activation
[0280] Factor IX circulates predominantly as a zymogen with minimal
proteolytic activity until it is activated by proteolytic cleavage.
Activation can be effected by the TF/FVIIa complex or Factor XIa.
Activation by TF/FVIIa is through the intrinsic pathway, while
activation by FXIa is through the extrinsic pathway, described
above. The process of activation appears to be sequential with
initial cleavage of the Arg145-Ala146 bond, followed by cleavage of
the Arg180-Vail 81 bond (Schmidt et al. (2003) Trends Cardio. Med.
13:39-45). The proteolytic cleavage releases the activation
peptide, forming the two-chain FIXa molecule containing the light
chain (corresponding to amino acid positions 1-145 of SEQ ID NO:3)
and heavy chain (corresponding to amino acid positions 181-415 of
SEQ ID NO:3) held together by a disulphide bond between the two
cysteines at amino acid positions 132 and 289 (numbering
corresponding to the mature FIX polypeptide set forth in SEQ ID
NO:3).
[0281] At least two exosites in FX appear to be involved in binding
to TF in the TF/FVIIa complex to form the FIX/TF/FVIIa ternary
complex (Chen et al., (2002) Thromb. Haemost. 88:74-82). Studies
suggest that the EGF1 domain of FIX is required for FIX activation
by the TF/FVIIa complex. For example, mutation of G48 (relative to
the mature FIX polypeptide set forth in SEQ ID NO:3) in the EGF1
domain of FIX reduces its activation by TF/FVIIa (Wu et al., (2000)
Thromb. Haemost. 84:626-634). Further, the EGF1 domain of FIX has
been shown to interact with TF in the TF/FVIIa complex (Zhong et
al., (2002) J. Biol. Chem. 277:3622). In contrast, however, the
EGF1 domain does not appear to be required for FIX activation by
FXIa. The Gla domain also is involved in binding to the TF/FVIIa
complex and, therefore, in activation. The Gla domain of FIX
interacts with the same region in TF as FX, which also is activated
by the TF/FVIIa complex (Kirchhofer et al., (2000) Biochem.
39:7380-7387).
[0282] Following cleavage and release of the activation peptide, a
new amino terminus at V181 (corresponding to the mature FIX
polypeptide set forth in SEQ ID NO:3; V16 by chymotrypsin
numbering) is generated. Release of the activation peptide
facilitates a conformational change whereby the amino group of V
181 inserts into the active site and forms a salt bridge with the
side chain carboxylate of D364. Such a change is required for
conversion of the zymogen state to an active state, as the change
converts the hydroxyl side chain of S365 to a reactive species that
is able to hydrolyze the cleavage site of its substrate, FX. The
activated FIXa polypeptide remains in a zymogen-like conformation
until additional conformational changes are induced, such as by
binding with FVIIIa, to generate a FIXa polypeptide with maximal
catalytic activity.
[0283] 4. FIX Function
[0284] FIX plays an important role in the coagulation pathway and a
deficiency or absence of FIX activity leads to hemophilia B. Once
activated from FIX to FIXa, FIXa in turn functions to activate the
large amounts of FX to FXa that are required for coagulation. To do
so, FIXa must first bind to its cofactor, Factor VIIIa, to form the
FIXa/FVIIIa complex, also called the intrinsic tenase complex, on
the phospholipid surface of the activated platelet. Both the Gla
domain and EGF2 domain of FIX are important for stable binding to
phospholipids. The FIXa/FVIIIa complex then binds FX to cleave this
coagulation factor to form FIXa.
[0285] FIXa is virtually inactive in the absence of its cofactor,
FVIIIa, and physiologic substrate, FX. Experimental studies
indicate that this can be attributed mainly to the 99-loop. When
FIXa is not bound by its cofactor, Y177 locks the 99-loop in an
inactive conformation in which the side chains of Y99 and K98 (by
chymotrypsin numbering, corresponding to Y266 and K265 of the
mature FIX polypeptide set forth in SEQ ID NO:3) impede substrate
binding. Binding of FVIIIa to FIXa unlocks and releases this
zymogen-like conformation, and FX is then able to associate with
the FIXa/FVIIIa complex and rearrange the unlocked 99-loop,
subsequently binding to the active site cleft (Sichler et al.,
(2003) J. Biol. Chem. 278:4121-4126). The binding of FIXa to
phospholipids and the presence of Ca.sup.2+ further enhances the
reaction.
[0286] Several models of the FIXa/FVIIIa interaction have been
proposed (see e.g. Autin et al., (2005) J. Thromb. Haemost.
3:2044-2056, Stoilova-McPhie et al., (2002) Blood 99: 1215-1223,
Bajaj et al., (2001) J. Biol. Chem. 276:16302-16309, Schmidt et
al., (2003) Trends Cardiovasc. Med. 13:39-45). FIXa binds to FVIIIa
in an interaction involving more than one domain of the FIXa
polypeptide. FVIIIa is a heterodimer composed of three
noncovalently associated chains: A1, A2 and A3-C.sub.1-C.sub.2.
A3-C.sub.1-C.sub.2 also is referred to as the light chain. The
protease domain of FIXa appears to interact with the A2 subunit of
FVIIIa. Studies suggest that the 293-helix (126-helix by
chymotrypsin numbering), 330-helix (162-helix by chymotrypsin
numbering) and N346 (N178) by chymotrypsin numbering) of FIXa are
involved in the interaction with the A2 subunit of FVIIIa. The
EGF1/EGF2 domains of FIXa interact with the A3 subunit of FVIIIa.
Further, it is postulated that the Gla domain of FIXa interacts
with the C2 domain of FVIIIa. Calcium ions and phospholipids also
contribute to binding of FIXa and FVIIIa. For example, the presence
of phospholipids increases the binding of FIXa to FVIIIa by
approximately 2000-fold (Mathur et al., (1997) J. Biol. Chem. 272).
Following binding of FX by the FIXa/FVIIIa complex, the protease
domain (or catalytic domain) of FIXa is responsible for cleavage of
FX at R194-1195 to form FXa.
[0287] The activity of FIXa is regulated by inhibitory molecules,
such as the AT-III/heparin complex, as discussed above, and other
clearance mechanisms, such as the low-density lipoprotein
receptor-related protein (LRP). LRP is a membrane glycoprotein that
is expressed on a variety of tissues, including liver, brain,
placenta and lung. LRP binds a wide range of proteins and complexes
in addition to FIXa, including, but not limited to,
apolipoproteins, lipases, proteinases, proteinase-inhibitor
complexes, and matrix proteins. The zymogen or inactive form of FIX
does not bind LRP. Rather, upon activation, an LRP-binding site is
exposed (Neels et al., (2000) Blood 96:3459-3465). This binding
site is located in a loop in the protease domain spanning residues
342 to 346 of the mature FIX polypeptide set forth in SEQ ID NO:3
(Rohlena et al., (2003) J. Biol. Chem. 278:9394-9401).
[0288] 5. FIX as a Biopharmaceutical
[0289] Factor IX is integrally involved in the blood coagulation
process, where, in it's activated form (FIXa), it forms a tenase
complex with FVIIIa and activates FX to FXa. FXa, in conjunction
with phospholipids, calcium and FVa, converts prothrombin to
thrombin, which in turn cleaves fibrinogen to fibrin monomers, thus
facilitating the formation of a rigid mesh clot. Many studies have
demonstrated the ability of exogenous FIX to promote blood clotting
in patients with hemophilia. For example, hemophilia B patients,
who are deficient in FIX, can be treated by replacement therapy
with exogenous FIX. Early replacement therapies utilized plasma
purified FIX, such as therapeutics marketed as MonoNine.RTM. Factor
IX and Alpha-nine-SD.RTM. Factor IX. Plasma purified FIX complex
therapeutics also have been used, including Bebulin.RTM. VH, a
purified concentrate of FIX with FX and low amounts of FVII;
Konyne.RTM. 80 (Bayer), a purified concentrate of FIX, with FII,
FX, and low levels of FVII; PROPLEX.RTM. T (Baxter International),
a heat treated product prepared from pooled normal human plasma
containing FIX with FII, FVII, and FX; and Profilnine SD.RTM.
(Alpha Therapeutic Corporation). More recently, however, a human
recombinant Factor IX (BeneFIX.RTM. Coagulation Factor IX
(Recombinant), Wyeth) has been approved for use in the control and
prevention of bleeding episodes in hemophilia B patients, including
control and prevention of bleeding in surgical settings.
BeneFIX.RTM. Coagulation Factor IX (Recombinant) has an amino acid
sequence set forth in SEQ ID NO:20, and is identical to the Ala148
allelic form of plasma-derived Factor IX. Thus, compared to the
wild-type FIX polypeptide set forth in SEQ ID NO:3, BeneFIX.RTM.,
Coagulation Factor IX (Recombinant) contains a T148A mutation.
[0290] In addition to its use as a procoagulant, inactive forms of
FIX, or forms with reduced catalytic activity, can be used as an
anticoagulant, such as in the treatment of thrombotic diseases and
conditions.
[0291] Typically, FIX is administered intravenously, but also can
be administered orally, systemically, buccally, transdermally,
intramuscularly and subcutaneously. FIX can be administered once or
multiple times. Generally, multiple administrations are used in
treatment regimens with FIX to effect coagulation.
[0292] As discussed herein below, modified FIX polypeptides
provided herein also can be used in any treatment or pharmaceutical
method in which an unmodified or wildtype or other therapeutically
active FIX polypeptide is known to be used. In such uses, methods
and processes, the modified FIX polypeptides provided herein
exhibit improved properties compared to a wildtype or the
unmodified FIX polypeptide.
D. MODIFIED FIX POLYPEPTIDES
[0293] Provided herein are modified factor IX polypeptides. The FIX
polypeptides can be modified by deletions, insertions or
replacement (substitution) of one or more amino acid residues in
the primary sequence of a wildtype or unmodified FIX polypeptide.
The resulting modified polypeptides exhibit improved properties or
activities compared to the unmodified or wildtype FIX polypeptide.
For example, the modified factor IX polypeptides, including
modified FIXa polypeptides and fragments of modified factor IX and
factor IXa polypeptides, can have altered posttranslational
modification, such as altered glycosylation, including
hyperglycosylation, and/or altered phosphorylation or sulfation,
such as decreased phosphorylation or sulfation; increased
resistance to inhibitors, such as AT-III and/or heparin; decreased
binding to LRP; increased catalytic activity; improved
pharmacokinetic properties, including decreased clearance and
increased serum half-life in vivo; increased coagulant activity; or
any combination thereof. Typically, the modified FIX polypeptides
exhibit procoagulant activity. Thus, provided herein are modified
FIX polypeptides that exhibit increased coagulant activity upon
activation from their single-chain zymogen form and subsequent
binding to the cofactor, FVIIIa. Such modified FIX polypeptides can
be administered to patients with diseases or conditions
characterized by insufficient coagulation, such as, for example,
hemophilia B.
[0294] In some examples, the modified FIX polypeptides provided
herein exhibit increased resistance to inhibitors, including
AT-III, heparin and the AT-III/heparin complex, compared to an
unmodified FIX polypeptide. Such modified FIX polypeptides can
exhibit increased coagulant activity compared to an unmodified FIX
polypeptide. In further examples, the modified factor IX
polypeptides provided herein exhibit altered posttranslation
modification, such as altered glycosylation levels and/or altered
types of glycosylation compared to an unmodified FIX
polypeptide.
[0295] In some examples, the modified FIX polypeptides provided
herein exhibit increased glycosylation compared to an unmodified
FIX polypeptide. Thus, provided herein are hyperglycosylated FIX
polypeptides. The modified FIX polypeptides can exhibit increased
glycosylation by virtue of the incorporation of at least one
non-native glycosylation site (i.e. a glycosylation site that is
not found in the unmodified or wild-type FIX polypeptide) to which
a carbohydrate moiety is linked. Such modified FIX polypeptides can
exhibit improved pharmacokinetic properties in vivo, including
decreased clearance and increased serum half-life. The introduction
of a non-native glycosylation site and subsequent carbohydrate
moiety can further improve the activity of the modified FIX
polypeptide by sterically hindering the interaction of the FIX
polypeptide with one or more other proteins. For example, a
glycosylation site can be introduced such that when a carbohydrate
moiety is attached at this site, it sterically hinders the
interaction of the modified FIX polypeptide with the AT-III/heparin
complex, resulting in a polypeptide with increased resistance to
AT-III/heparin. This can further reduce clearance of the
polypeptide from the circulation. Thus, the effects of the
introduction of a new glycosylation site can be several-fold if the
carbohydrate moiety also sterically hinders an interaction with
another protein(s), such as the AT-III/heparin complex.
[0296] For example, the modified FIX polypeptides provided herein
can contain one or more modifications that introduce one or more
non-native glycosylation sites compared to the unmodified FIX
polypeptide. For example, 1, 2, 3, 4, 5, 6, or more non-native
glycosylation sites can be introduced. Glycosylation sites that can
be introduced include, but are not limited to, N-glycosylation
sites, O-glycosylation sites, or a combination thereof. Thus, when
produced in a cell that facilitates glycosylation, or following in
vitro glycosylation, the modified FIX polypeptides provided herein
can contain 1, 2, 3, 4, 5, 6 or more carbohydrate moieties, each
linked to different non-native glycosylation sites, in addition to
the carbohydrate moieties linked to the native glycosylation sites
(e.g. the native glycosylation sites corresponding to S53, S61,
N157, N167, T159, T169, T172 and T179 of the mature FIX polypeptide
set forth in SEQ ID NO:3). In a particular example, the modified
FIX polypeptides provided herein contain one or more non-native
N-glycosylation sites. Thus, the modified FIX polypeptides can
exhibit increased levels of N-glycosylation compared to an
unmodified FIX polypeptide.
[0297] The modified FIX polypeptides with increased glycosylation
also can exhibit, for example, increased solubility, increased
AT-III/heparin resistance, increased serum half-life, decreased
immunogenicity and/or increased coagulant activity compared to an
unmodified FIX polypeptide. Such modified FIX polypeptides can be
used in the treatment of bleeding disorders or events, such as
hemophilias or injury, where the FIX polypeptides can function to
promote blood coagulation. In some instances, the modified FIX
polypeptides provided herein that exhibit increased glycosylation
also can contain one or more modifications that render the protein
inactive, or mostly inactive. Such polypeptides, therefore, can
exhibit increased anti-coagulant activity and can be used in the
treatment of thrombotic events, conditions or diseases. Typically,
however, the modified FIX polypeptides provided herein are
procoagulants.
[0298] The modified FIX polypeptides provided herein also can
exhibit other activities and/or properties. For example, some of
the modified FIX polypeptides contain one or more modifications
that increase catalytic activity. In other examples, the modified
FIX polypeptides contain one or more modifications that decrease
phosphorylation, sulfation, hydroxylation and/or glycosylation. In
further examples, the modified FIX polypeptides contain
modifications that interfere with the interaction between FIX and
LRP. By interrupting the binding of FIX to LRP, the clearance of
FIX from circulation can be decreased. Hence, modifications that
reduce the binding of FIX to LRP can improve the pharmacokinetic
properties of FIX in vivo.
[0299] The modifications, such as amino acid replacements,
described herein, such as those modifications that introduce one or
more non-native glycosylation sites or increase resistance to
inhibitors, can be made in any FIX polypeptide (e.g. unmodified or
wildtype FIX polypeptide), including a precursor FIX polypeptide
with a sequence set forth in SEQ ID NO:2, a mature FIX polypeptide
set forth in SEQ ID NO:3, or in a FIX polypeptide having a sequence
of amino acids that exhibits at least 40%, 50%, 60%, 70%, 80%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to
the FIX polypeptide set forth in SEQ ID NOS:2 or SEQ ID NO:3. It is
understood that reference herein to amino acid residues is with
respect to the numbering of the mature FIX polypeptide set forth in
SEQ ID NO:3. It is within the level of one of skill in the art to
identify a corresponding amino acid residue in another FIX
polypeptide of any form, such as a precursor, mature or other
active form, by alignment of the sequence of the other FIX
polypeptide with SEQ ID NO:3 (see e.g. FIG. 3). Any amino acid
replacement provided herein can be made at a corresponding amino
acid residue that differs or is not the same as the replacement
amino acid residue. It is within the level of one of skill in the
art to test any resulting modified FIX polypeptide for activity or
property as described herein.
[0300] For example, the modifications, such as an amino acid
replacement, can be made in any species, allelic or modified
variant, such as those described in the art. Allelic variants of
FIX include, but are not limited to, T148A and T412P. Any of the
amino acid replacements provided herein can be an Factor IX that
contains mutations T148A or T412P. For example, the modifications
such as any amino acid replacement, can be made in a FIX
polypeptide set forth in SEQ ID NO:325 or SEQ ID NO:20. Exemplary
species variants for modification herein include, but are not
limited to, human and non-human polypeptides including FIX
polypeptides from chimpanzee, rhesus macaque, mouse, rat, guinea
pig, pig, dog, cat, rabbit, chicken, cow, sheep, frog, zebrafish
and Japanese pufferfish FIX polypeptides, whose sequences are set
forth in SEQ ID NOS:4-18, respectively. Modifications in a FIX
polypeptide can be made to a FIX polypeptide that also contains
other modifications, such as those described in the art, including
modifications of the primary sequence and modifications not in the
primary sequence of the polypeptide (see e.g. Section D.6, which
describes exemplary modified FIX polypeptides to which the amino
modifications described herein can be made).
[0301] In other examples, the modifications, such as an amino acid
replacement, can be made in any active fragment of a FIX
polypeptide, such as an active fragment of SEQ ID NO:2 or SEQ ID
NO:3, or an active fragment of a species, allelic or modified
variant, such as those described in the art, The active fragment
contains a contiguous sequence of amino acids containing the
catalytically active domain of the polypeptide or a catalytically
active portion thereof containing the amino acid modifications,
such as amino acid replacements describes herein. The active
fragment exhibit at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or
more of the activity of the mature form of the polypeptide, such as
the FIX polypeptide set forth in SEQ ID NO:3.
[0302] Modification of FIX polypeptides also include modification
of polypeptides that are hybrids of different FIX polypeptides and
also synthetic FIX polypeptides prepared recombinantly or
synthesized or constructed by other methods known in the art based
upon the sequence of known polypeptides. For example, based on
alignment of FIX with other coagulation factor family members,
including, but not limited to, factor FVII (FVII) and factor X
(FX), homologous domains among the family members are readily
identified. Chimeric variants of FIX polypeptides can be
constructed where one or more amino acids or entire domains are
replaced in the FIX amino acid sequence using the amino acid
sequence of the corresponding family member. Additionally, chimeric
FIX polypeptides include those where one or more amino acids or
entire domains are replaced in the human FIX amino acid sequence
using the amino acid sequence of a different species. Such chimeric
proteins can be used as the starting, unmodified FIX polypeptide
herein.
[0303] Modifications provided herein of a starting, unmodified
reference polypeptide include amino acid replacements or
substitution, additions or deletions of amino acids, or any
combination thereof. For example, modified FIX polypeptides include
those with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 30, 40, 50 or more modified positions. In some
examples, a modification that is made to alter one activity or
property of FIX also can, or instead, affect one more other
activities or properties. For example, a modification made to
increase resistance to inhibitors also, or instead, can increase
catalytic activity. In another example, a modification made to
introduce a new glycosylation site also can result in increased
resistance to inhibitors and/or increased catalytic activity. In a
further example, a modification made to decrease binding to LRP can
also, or instead, increase resistance to an inhibitor, such as
AT-III/heparin. Thus, although the modifications described herein
typically are described in relation to their intended affect on FIX
activities or properties, it is understood that any of the
modifications described herein, alone or in conjunction with one or
more other modifications, can result in changes in other,
unpredicted, activities or properties.
[0304] Any modification provided herein can be combined with any
other modification known to one of skill in the art. Typically, the
resulting modified FIX polypeptide exhibits increased coagulation
activity when it is in its two-chain form. The activities or
properties that can be altered as a result of modification include,
but are not limited to, coagulation or coagulant activity;
pro-coagulant activity; proteolytic or catalytic activity such as
to effect factor X (FX) activation; antigenicity (ability to bind
to or compete with a polypeptide for binding to an anti-FIX
antibody); ability to bind FVIIIa, antithrombin HI, heparin and/or
factor X; ability to bind to phospholipids; three-dimensional
structure; pI; and/or conformation. Included among the modified FIX
polypeptides provided herein are those that have increased
resistance to antithrombin III (AT-III), increased resistance to
heparin, altered glycosylation, such as increased glycosylation,
increased catalytic activity, and improved pharmacokinetic
properties, such as i) decreased clearance, ii) altered volume of
distribution, iii) enhanced in vivo recovery, iv) enhanced total
protein exposure in vivo (i.e., AUC), v) increased serum half-life
(.alpha.-, .beta.-, and/or .gamma.-phase), and/or vi) increased
mean resonance time (MRT).
[0305] In some examples, a modification can affect two or more
properties or activities of a FIX polypeptide. For example, a
modification can result in increased AT-III resistance and
increased catalytic activity of the modified FIX polypeptide
compared to an unmodified FIX polypeptide. In another example, a
modification that introduces a non-native N-glycosylation site and,
thus, can increase the glycosylation levels of the polypeptide when
expressed in an appropriate cell, such as a mammalian cell, also
can result in increased catalytic activity of the modified FIX
polypeptide compared to an unmodified FIX polypeptide. Modified FIX
polypeptides provided herein can be assayed for each property and
activity to identify the range of effects of a modification. Such
assays are known in the art and described below. Typically, changes
to the properties and/or activities of the modified FIX
polypeptides provided herein are made while retaining other FIX
activities or properties, such as, but not limited to, binding to
FVIIIa and/or binding and activation of FX. Hence, modified FIX
polypeptides provided herein retain FVIIIa binding and/or FX
binding and activation as compared to a wild-type or starting form
of the FIX polypeptide. Typically, such activity is substantially
unchanged (less than 1%, 5% or 10% changed) compared to a wild-type
or starting protein. In other examples, the activity of a modified
FIX polypeptide is increased or is decreased as compared to a
wild-type or starting FIX polypeptide. Activity can be assessed in
vitro or in vivo and can be compared to the unmodified FIX
polypeptide, such as for example, the mature, wild-type native FIX
polypeptide (SEQ ID NO:3), the wild-type precursor FIX polypeptide
(SEQ ID NO:2), or any other FIX polypeptide known to one of skill
in the art that is used as the starting material.
[0306] The modifications provided herein can be made by standard
recombinant DNA techniques such as are routine to one of skill in
the art. Any method known in the art to effect mutation of any one
or more amino acids in a target protein can be employed. Methods
include standard site-directed mutagenesis of encoding nucleic acid
molecules, or by solid phase polypeptide synthesis methods.
[0307] Other modifications that are or are not in the primary
sequence of the polypeptide also can be included in a modified FIX
polypeptide, or conjugate thereof, including, but not limited to,
the addition of a carbohydrate moiety, the addition of a
polyethylene glycol (PEG) moiety, the addition of an Fc domain, a
serum albumin and/or other protein. For example, such additional
modifications can be made to increase the stability or half-life of
the protein.
[0308] The resulting modified FIX polypeptides include those that
are single-chain zymogen polypeptides and those that are two-chain
zymogen-like polypeptides (i.e. FIXa polypeptides that are not
bound to the cofactor, FVIIIa). Any modified FIX polypeptide
provided herein that is a single-chain polypeptide can be activated
to generate a modified FIXa (i.e. a two-chain form). The activities
of a modified FIX polypeptide are typically exhibited in its
two-chain form.
[0309] 1. Exemplary Amino Acid Replacements
[0310] Provided herein are modified FIX polypeptides that contain
one or more amino acid replacements as described herein below with
numbering of residues with respect to the numbering of SEQ ID NO:3.
The same amino acid replacements can be made in corresponding amino
acid residues in another FIX polypeptide (see e.g. FIG. 3 for
exemplification of identification of corresponding amino acid
residues). The amino acid replacements confer altered glycosylation
(e.g. by introduction of non-native glycosylation sites or
elimination of native glycosylation sites), increased resistance to
AT-III and/or heparin, increased catalytic activity, decreased LRP
binding and/or alter posttranslational modifications. The resulting
modified FIX polypeptides exhibit improved therapeutic efficacy,
for example, due to improved pharmacodynamic or pharmacokinetic
activity.
[0311] In particular, non-limiting examples of amino acid
replacements in modified FIX polypeptides provided herein below are
at any one or more amino acid residues 155, 318, 338, 343, 403
and/or 410 with numbering with respect to the mature FIX
polypeptide set forth in SEQ ID NO:3 (corresponding to amino acid
residues [155], 150, 170, 175, 233 and/or 240, respectively, by
chymotrypsin numbering). The residues corresponding to any of 155,
318, 338, 343, 403 and/or 410 in other FIX polypeptides can be
determined by sequence alignment with SEQ ID NO:3 (see e.g. FIG.
3). It is understood that the amino acid replacements provided
herein at any of amino acid residues 155, 318, 338, 343, 403 and/or
410 with numbering with respect to SEQ ID NO:3 can be made in other
FIX polypeptides as described elsewhere herein. It is also
understood that residues corresponding to any of the other amino
acid replacements provided herein also can be identified in other
FIX polypeptides as exemplified herein (e.g. FIG. 3).
[0312] In particular, provided herein are amino acid replacement of
tyrosine at amino acid residue Y155 (Y155F), Y155L, Y155H, R318A,
R318Y, R318E, R318F, R318W, R318D, R318I, R318K, R318L, R318M,
R318N, R318S, R318V, R318Y, R338A, R338E, T343R, T343E, T343D,
T343F, T343I, T343K, T343L, T343M, T343Q, T343S, T343V, T343W,
T343Y, R403A, R403E, E410Q, E410S, E410N, E410A, E410D, or a
conservative amino acid replacement (see e.g. Table 2B). In some
examples, the amino acid replacement is Y155F, R318Y, R318E, R338E,
T343R, R403E and/or E410N or conservative amino acid replacements
thereof.
[0313] For example, as shown by the data herein, amino acid
replacement at position R318 with reference to SEQ ID NO:3 (150 by
chymotrypsin numbering) confers resistance to inhibition by the
AT-III/heparin complex. An amino acid replacement at position R338
(R170 by chymotrypsin numbering) also confers resistance to
inhibition by the AT-III/heparin complex. In this respect, the
amino acid position R338 is the site of a natural mutation (R170L)
that has been reported to exhibit 5-10 fold enhanced clotting
activity in an in vitro clotting assay (International Pat. Pub. No.
WO 2010029178). The assay as described was performed with
conditioned media rather than purified protein and the protein
concentration was measured using an ELISA assay. Consequently,
these data could reflect a higher fraction of active material in
the R338L (R170L) preparation as compared to the wildtype
comparator preparation or a higher level of contaminants that are
active in a clotting assay. Nevertheless, as shown herein, there is
a 3.5- to 4-fold increased efficiency for FX activation by variants
containing A, E and L at position 338 (170). As found herein, the
R338E mutation, in addition, exhibited an approximately 88-fold
resistance to inhibition by the heparin/AT-III complex as well as
2-fold enhanced binding to the co-factor, FVIIIa.
[0314] A 4 amino acid thrombin loop swap mutation into FIX, from
positions 342-345 (174-177 by chymotrypsin numbering) has been
reported to reduce the binding of FIXa to sLRP (see, Rohlena et
al., (2003) J. Biol. Chem. 9394-9401). Mutation of the residue at
position T343 (T175 by chymotrypsin numbering) did not confer any
significant affect on the pharmacokinetic (PK) properties of FIX.
It is found herein that the mutation T343R (T175R by chymotrypsin
numbering), however, increases the catalytic efficacy for
activation of FX by a factor of about 3.1, produces an
approximately 5.6-fold resistance to the heparin/AT-III complex,
and increases the affinity for FVIIIa by a factor of approximately
1.6-fold.
[0315] Also as shown herein, mutations at position R403 (R233 by
chymotrypsin numbering) confer resistance to inhibition by the
heparin/AT-III complex. Mutations at position E410 (E240 by
chymotrypsin numbering), such as E410N, produce a significant,
heretofore unobserved, 1.3- to 2.8-fold increase in the catalytic
efficacy for activation of FX.
[0316] Also, as shown therein, there is a synergy in mutations at
R338 and T343 (R170 and T175 by chymotrypsin numbering),
particularly R338E and T343R in enhanced binding to the co-factor
FVIII. Synergy also was observed between mutations at positions
R338 and E410 (R170 and E240 by chymotrypsin numbering),
particularly R338E and E410N. The two double mutants, exemplified
herein, R338E/T343R and R338E/E410N exhibit 24- to 28-fold improved
binding to FVIIIa while each of the single mutations alone enhance
binding by 1.6-2,2-fold each.
[0317] Other exemplary amino acid replacements in a FIX polypeptide
provided herein found to confer an altered property or activity as
described below can be at any amino acid residue from among 1, 5,
53, 61, 64, 85, 103, 104, 105, 106, 108, 148, 157, 158, 159, 167,
169, 172, 179, 202, 203, 204, 205, 228, 239, 241, 243, 247, 249,
251, 257, 259, 260, 262, 284, 293, 312, 314, 315, 316, 317, 319,
320, 321, 333, 342, 345, 346, 392, 394, 400, 412, or 413 with
reference to SEQ ID NO:3 or at a corresponding amino acid residue.
For example, exemplary amino acid replacements in a FIX polypeptide
provided herein also include, but are not limited to, Y1N, K5A,
S53A, S61A, S61C, S61D, S61E, S61F, S61G, S61I, S61K, S61L, S61P,
S61R, S61V, S61W, S61Y, D64A, D64C, D64F, D64H, D641, D64L, D64M,
D64N, D64P, D64R, D64S, D64T, D64W, D85N, A103N, D104N, N105S,
N105T, K106N, K106S, K106T, V108S, V108T, T148A, N157D, N157E,
N157F, N157I, N157K, N157L, N157M, N157Q, N157R, N157V, N157W,
N157Y, S158A, S158D, S158E, S158F, S158G, S158I, S158K, S158L,
S158M, S158R, S158V, S158W, S158Y, T159A, N167D, N167Q, N167E,
N167F, N167G, N167H, N167I, N167K, N167L, N167M, N167P, N167R,
N167V, N167W, N167Y, T169A, T169D, T169E, T169F, T169G, T169I,
T169K, T169L, T169M, T169P, T169R, T169S, T169V, T169W, T169Y,
T172A, T172D, T172E, T172F, T172G, T172I, T172K, T172L, T172M,
T172P, T172R, T172S, T172V, T172W, T172Y, T179A, V202M, V202Y,
D203N, D203M, D203Y, D203F, D203H, D203I, D203K, D203L, D203R,
D203V, D203W, A204M, A204Y, A204F, A204I, A204W, F205S, F205T,
K228N, E239A, E239S, E239R, E239K, E239D, E239F, E239I, E239L,
E239M, E239N, E239T, E239V, E239W, E239Y, T241N, H243S, H243T,
K247N, N249S, N249T, I251S, H257F, H257E, H257D, H257I, H257K,
H257L, H257M, H257Q, H257R, H257S, H257V, H257W, H257Y, N260S,
A262S, A262T, Y284N, K293E, K293A, R312A, R312Y, R312L, R312c,
R312D, R312E, R312F, R312I, R312K, R312L, R312M, R312P, R312Q,
R312S, R312T, R312V, R312W, R312Y, F314N, H315S, K316M, K316D,
K316F, K316H, K316I, K316L, K316M, K316R, K316S, K316T, K316V,
K316W, K316Y, G317N, S319N, A320S, L321N, L321S, L321T, R333A,
R333E, F342I, F342D, F342E, F342K, F342L, F342M, F342S, F342T,
F342V, F342W, F342Y, Y345A, Y345T, N346D, N346Y, N346E, N346F,
N346H, N346I, N346K, N346L, N346M, N346Q, N346R, N346T, N346V,
N346W, K392N, K394S, K394T, K400A, K400E, K400C, K400D, K400F,
K400G, K400L, K400M, K400P, K400S, K400T, K400V, K400Y, T412A,
T412V, T412C, T412D, T412E, T412F, T412G, T412I, T412M, T412P,
T412W, T412Y, K413N in a mature FIX polypeptide having a sequence
set forth in SEQ ID NO:3 or the same replacement in a corresponding
amino acid residue position.
[0318] For example, exemplary properties and actives that are
altered by the modifications (e.g. amino acid replacements)
provided herein are described as follows.
[0319] a. Altered Glycosylation
[0320] The modified factor IX polypeptides provided herein can
exhibit altered glycosylation levels and/or altered types of
glycosylation compared to an unmodified FIX polypeptide. In some
examples, the modified FIX polypeptides provided herein exhibit
increased glycosylation compared to an unmodified FIX polypeptide.
Thus, among the modified FIX polypeptides described herein are
hyperglycosylated FIX polypeptides.
[0321] i. Advantages of Glycosylation
[0322] Many mammalian proteins are glycosylated with variable
numbers of carbohydrate chains, each of which can have differing
carbohydrate structures. Such carbohydrates can have an important
role in the stability, solubility, activity, serum half-life and
immunogenicity of the protein. Thus, the properties and activities
of a protein can be altered by modulating the amount and/or type of
glycosylation. For example, glycosylation can increase
serum-half-life of polypeptides by increasing the stability,
solubility, and reducing the immunogenicity of a protein. This is
of particular interest for therapeutic polypeptides, where
increased solubility, serum half-life and stability of the
therapeutic polypeptide can result in increased therapeutic
efficacy.
[0323] Oligosaccharides are important in intra- and inter-cell
events such as a recognition, signaling and adhesion. Carbohydrates
also assist in the folding of secreted proteins. Glycosylation
sites provide a site for attachment of monosaccharides and
oligosaccharides to a polypeptide via a glycosidic linkage, such
that when the polypeptide is produced, for example, in a eukaryotic
cell capable of glycosylation, it is glycosylated. There are
several types of protein glycosylation. N-linked and O-linked
glycosylation are the major classes, in which an asparagine
residue, or a serine or threonine residue, respectively, is
modified. Other types of glycans include, glycosaminoglycans and
glycosylphophatidylinositol (GPI)-anchors. Glycosaminoglycans are
attached to the hydroxy oxygen of serine, while GPI anchors attach
a protein to a hydrophobic lipid anchor, via a glycan chain.
C-glycosylation also can occur at the consensus sequence
Trp-X-X-Trp, where the indol side chain of the first tryptophan
residue in the sequences is modified with an .alpha.-mannopyranosyl
group (Furmanek et al., (2000) Acta Biochim. Pol. 47:781-789).
[0324] The presence of a potential glycosylation site does not,
however, ensure that the site will be glycosylated during
post-translational processing in the ER. Furthermore, the level of
glycosylation can vary at any given site, as can the glycan
structures. The differences in levels and types of glycosylation at
particular sites can be attributed, at least in part, to the
sequence context and secondary structure around the potential
glycosylation site.
[0325] O-linked glycosylation involves the attachment of the sugar
units, such as N-acetylgalactosamine, via the hydroxyl group of
serine, threonine, hydroxylysine or hydroxyproline residues. It is
initiated by the attachment of one monosaccharide, following which
others are added to form a mature O-glycan structure. There is no
known motif for O-glycosylation, although O-glycosylation is more
probable in sequences with a high proportion of serine, threonine
and proline residues. Further, secondary structural elements such
as an extended (3 turn also may promote O-glycosylation.
O-glycosylation lacks a common core structure. Instead, several
types of glycans can be attached at the selected O-glycosylation
sites, including O--N-acetylgalactosamine (O-GalNAc),
O--N-acetylglucosamine (O-GlcNAc), O-fucose and O-glucose.
[0326] In contrast to O-glycosylation, the N-linked glycosylation
consensus sequence motif is well characterized. During N-linked
glycosylation, a 14-residue oligosaccharide is transferred to the
asparagine residue in the Asn-X-Ser/Thr/Cys consensus motif, where
X is any amino acid except Pro. Glycosyltransferases then
enzymatically trim the saccharide and attach additional sugar units
to the mannose residues. The sequence adjacent to the consensus
motif also can affect whether or not glycosylation occurs at the
consensus sequence. Thus, the presence of the Asn-X-Ser/Thr/Cys
consensus sequence is required but not necessarily sufficient for
N-linked glycosylation to occur. In some instances, changes to the
adjacent sequence results in glycosylation at the consensus motif
where there previously was none (Elliot et al., (2004) J. Biol.
Chem. 279:16854-16862).
[0327] N-linked oligosaccharides share a common core structure of
GlcNAc.sub.2Man.sub.3. There are three major types of N-linked
saccharides in mammals: high-mannose oligosaccharides, complex
oligosaccharides and hybrid oligosaccharides. High-mannose
oligosaccharides essentially contain two N-acetylglucosamines with
several mannose residues. In some instances, the final N-linked
high-mannose oligosaccharide contains as many mannose residues as
the precursor oligosaccharide before it is attached to the protein.
Complex oligosaccharides can contain almost any number of mannose,
N-acetylglucosamines and fucose saccharides, including more than
the two N-acetylglucosamines in the core structure.
[0328] Glycosylation can increase the stability of proteins by
reducing the proteolysis of the protein and can protect the protein
from thermal degradation, exposure to denaturing agents, damage by
oxygen free radicals, and changes in pH. Glycosylation also can
allow the target protein to evade clearance mechanisms that can
involve binding to other proteins, including cell surface
receptors. The sialic acid component of carbohydrate in particular
can enhance the serum half-life of proteins. Sialic acid moieties
are highly hydrophilic and can shield hydrophobic residues of the
target protein. This increases solubility and decreases aggregation
and precipitation of the protein. Decreased aggregation reduces the
likelihood of an immune response being raised to the protein.
Further, carbohydrates can shield immunogenic sequences from the
immune system, and the volume of space occupied by the carbohydrate
moieties can decrease the available surface area that is surveyed
by the immune system. These properties can lead to the reduction in
immunogenicity of the target protein.
[0329] Modifying the level and/or type of glycosylation of a
therapeutic polypeptide can affect the in vivo activity of the
polypeptide. By increasing the level of glycosylation, recombinant
polypeptides can be made more stable with increased serum
half-life, reduced serum clearance and reduced immunogenicity. This
can increase the in vivo activity of the polypeptide, resulting in
reduced doses and/or frequency of dosing to achieve a comparable
therapeutic effect. For example, a hyperglycosylated form of
recombinant human erythropoietin (rHuEPO), called Darbepoetin alfa
(DA), has increased in vivo activity and prolonged duration of
action. The increased carbohydrate and sialic acid content of the
hyperglycosylated DA polypeptide results in a serum half-life that
is three times greater than that of the unmodified rHuEPO. This
increased serum half-life results in increased bioavailability and
reduced clearance, which can allow for less frequent dosing and/or
lower dosages, with associated increased convenience for the
patient, reduced risk of adverse effects and improved patient
compliance.
[0330] ii. Exemplary Modified FIX Polypeptides with Altered
Glycosylation
[0331] Provided herein are modified FIX polypeptides that are
modified to exhibit altered glycosylation compared to an unmodified
FIX polypeptide. The modified FIX polypeptides can exhibit
increased or decreased glycosylation, such as by the incorporation
of non-native glycosylation sites or the deletion of native
glycosylation sites, respectively. For example, the modified FIX
polypeptides can contain 1, 2, 3, 4 or more non-native
N-glycosylation sites. The non-native N-glycosylation sites can be
introduced by amino acid replacement(s) (or substitution(s)),
insertion(s) or deletion(s), or any combination thereof, wherein
the amino acid replacement(s), insertion(s) and/or deletion(s)
result in the establishment of the glycosylation motif
Asn-Xaa-Ser/Thr/Cys, where Xaa is not proline. In other examples,
the modified FIX polypeptides provided herein can have a reduced
number of glycosylation sites compared to an unmodified FIX
polypeptide, typically resulting in a reduced level of
glycosylation compared to the unmodified FIX polypeptide. In
further examples, the modified FIX polypeptides exhibit the same
levels of glycosylation as wild-type FIX, but exhibit different
types of glycosylation. For example, a modified FIX polypeptide can
exhibit the same number of glycosylation sites and the same level
of glycosylation as an unmodified
[0332] FIX polypeptide, but can have different types of
glycosylation, such as, for example, different relative amounts of
N- and O-glycosylation compared to an unmodified FIX
polypeptide.
[0333] (a). Introduction of Non-Native Glycosylation Site(s)
[0334] In particular examples, a non-native N-glycosylation site is
introduced by amino acid replacement. In some instances, the
creation of a non-native N-glycosylation site by amino acid
replacement requires only one amino acid replacement. For example,
if the unmodified FIX polypeptide contains a Gly-Ala-Ser sequence,
then an N-glycosylation site can be created by a single amino acid
substitution of the glycine with an asparagine, to create a
Asn-Ala-Ser N-glycosylation motif. In another example, if the
unmodified FIX polypeptide contains a Asn-Trp-Met sequence, then an
N-glycosylation site can be created by a single amino acid
substitution of the methionine with a cysteine (or threonine or
serine). In other instances, the creation of a non-native
N-glycosylation site by amino acid replacement requires more than
one amino acid replacement. For example, if the unmodified FIX
polypeptide contains a Gly-Arg-Phe sequence, then an
N-glycosylation site can be created by two amino acid replacements:
an amino acid substitution of the glycine with an asparagine, and
an amino acid substitution of the phenylalanine with a cysteine (or
threonine or serine), to create a Asn-Arg-Ser/Thr/Cys
N-glycosylation motif. Thus, one of skill in the art can introduce
one or more non-native N-glycosylation sites at any position in the
FIX polypeptide.
[0335] The position at which a non-native glycosylation site is
introduced into the FIX polypeptide to generate the modified FIX
polypeptides provided herein is typically selected so that any
carbohydrate moieties linked at that site do not adversely
interfere with the structure, function and/or procoagulant activity
of the FIX polypeptide, or that the amino acid modification(s) made
to the polypeptide to introduce the non-native glycosylation site
do not adversely interfere with the structure, function or activity
of the FIX polypeptide. Thus, a non-native glycosylation site can
be introduced into any position in a FIX polypeptide provided the
resulting modified FIX polypeptide retains at least one activity of
the wild type or unmodified FIX polypeptide. Conversely, one or
more non-native glycosylation sites can be introduced into the
modified FIX polypeptide at sites that may be involved in the
interaction of FIX with an inhibitory molecule. The carbohydrate
moiety that is linked to the new glycosylation site can sterically
hinder the interaction between the inhibitory molecule and the
modified FIX. Such steric hindrance can result in a modified FIX
polypeptide with increased coagulant activity. For example, a
carbohydrate moiety that is linked to a non-native glycosylation
site contained in the modified FIX polypeptides provided herein can
sterically hinder the interaction of the modified FIX with the
AT-III/heparin complex. This can result in increased resistance of
the modified FIX polypeptide to the inhibitory effects of
AT-III/heparin.
[0336] Thus, a non-native glycosylation site can be introduced into
the Gla domain, EGF1 domain, EGF2 domain, activation peptide and/or
the protease domain, provided the resulting modified FIX
polypeptide retains at least one activity of the wild type or
unmodified FIX polypeptide. In other examples, a non-native
glycosylation site is introduced into the EGF2 domain or the
protease domain. The resulting modified FIX polypeptide retains at
least one activity of the unmodified FIX polypeptide. In some
examples, the modified FIX polypeptide retains at least 5%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the
catalytic activity of the unmodified FIX polypeptide. In other
examples, the modified FIX polypeptide retains at least 5%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the binding
activity for FX of the unmodified FIX polypeptide. In other
examples, the modified FIX polypeptide retains at least 5%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the binding
activity for FVIIIa of the unmodified FIX polypeptide. In some
assays and/or under some conditions, the modified FIX polypeptides
can exhibit increased activity compared with the unmodified FIX
protein (e.g., pharmacodynamic activity in vivo, and/or catalytic
activity in the presence of ATIII/heparin or plasma)
[0337] Table 3 provides non-limiting examples of exemplary amino
acid replacements, corresponding to amino acid positions of a
mature FIX polypeptide as set forth in SEQ ID NO:3, that are
included in a modified FIX polypeptide to increase glycosylation
levels by introducing a non-native N-glycosylation site. In
reference to such'mutations, the first amino acid (one-letter
abbreviation) corresponds to the amino acid that is replaced, the
number corresponds to the position in the mature FIX polypeptide
sequence with reference to SEQ ID NO:3, and the second amino acid
(one-letter abbreviation) corresponds to the amino acid selected
that replaces the first amino acid at that position. The amino acid
positions for mutation also are referred to by the chymotrypsin
numbering scheme where appropriate (i.e., when the mutation is
located within the FIX protease domain). In instances where a
modified amino acid position does not have a corresponding
chymotrypsin number (i.e. is not within amino acid positions 181 to
415 corresponding to a mature FIX polypeptide set forth in SEQ ID
NO:3, and is not set forth in Table 1, above), the position is
denoted in brackets using mature FIX numbering. For example, A103N
does not have a corresponding chymotrypsin number and is set forth
as A[103]N when referring to chymotrypsin numbering. In Table 3
below, the sequence identifier (SEQ ID NO) is identified in which
exemplary amino acid sequences of the modified FIX polypeptide are
set forth. Also identified in Table 3 are the positions of the
non-native glycosylation sites generated by the modifications.
[0338] In some instances, only one amino acid replacement is
required to create a non-native N-glycosylation site. For example,
the aspartic acid (Asp, D) at position 85 (corresponding to the
mature FIX polypeptide set forth in SEQ ID NO:3) can be replaced
with an asparagine (Asn, N) to generate a non-native glycosylation
site in the EGF2 domain at amino acid position 85 in the resulting
modified FIX polypeptide. In another example, the isoleucine (He,
I) at position 251 (corresponding to the mature FIX polypeptide set
forth in SEQ ID NO:3) can be replaced with a serine (Ser, S) to
generate a non-native N-glycosylation site in the protease domain
at amino acid position 249 in the resulting modified FIX
polypeptide. In other instances, two amino acid replacements are
required to create a new glycosylation site. For example, the
alanine (Ala, A) at position 103 (based on numbering of a mature
FIX set forth in SEQ ID NO:3) can be replaced with an asparagine
(Asn, N), and the asparagine at position 105 can be replaced with a
serine (Ser; S) to create a non-native N-glycosylation site in the
EGF2 domain at amino acid position 103 in the resulting modified
FIX polypeptide. In another example, the threonine (Thr, T) at
position 241 is replaced with an asparagine and the histidine (His,
H) at position 243 is replaced with a serine to create a non-native
N-glycosylation site in the protease domain at amino acid position
243.
TABLE-US-00004 TABLE 3 Non-native Non-native glycosylation
glycosylation Modification Modification site site SEQ (mature FIX
(chymotrypsin (mature FIX (chymotrypsin ID numbering) numbering)
numbering) numbering) NO A103N/N105S A[103]N/N[105]S N103 N[103] 77
D104N/K106S D[104]N/K[106]S N104 N[104] 78 K106N/V108S
K[106]N/V[108]S N106 N[106] 79 D85N D[85]N N85 N[85] 80 D203N/F205T
D39N/F41T N203 N39 99 K228N K63N N228 N63 101 I251S I86S N249 N84
103 A262S A95bS N260 N95 106 K413N K243N N413 N243 107 E410N E240N
N410 N240 108 E239N E74N N239 N74 109 T241N/H243S T76N/H78S N241
N76 110 K247N/N249S K82N/N84S N247 N82 111 L321N L153N N321 N153
112 K392N/K394S K222N/K224S N392 N222 114 N260S N95S N258 N93 116
S319N/L321S S151N/L153S N319 N151 115 Y284N Y117N N284 N117 117
G317N G149N N317 N149 118 R318N/A320S R150N/A152S N318 N150 119
F314N/K316S F145N/K148S N314 N145 177
[0339] The modified FIX polypeptides provided herein can contain
modifications that result in the introduction of two or more
non-native N-glycosylation sites. For example, the modifications
set forth in Table 3 can be combined, resulting in a modified FIX
polypeptide that contains 2, 3, 4, 5, 6 or more non-native
N-glycosylation sites. Any two or more of the modifications set
forth in Table 3 can be combined. For example, included among the
modified FIX polypeptides provided herein are modified FIX
polypeptides that contain the amino acid substitutions
D104N/K106S/K228N, resulting in a FIX polypeptide with two
non-native glycosylation sites at amino acid positions 104 and 228,
respectively (numbering corresponding to the mature FIX polypeptide
set forth in SEQ ID NO:3). In another example, a modified FIX
polypeptide can contain amino acid substitutions
D85N/K247N/N249S/K392N/K394S, resulting in a FIX polypeptide with
three non-native glycosylation sites at amino acid positions 85,
247 and 392, respectively (numbering corresponding to the mature
FIX polypeptide set forth in SEQ ID NO:3). Table 4 sets forth
exemplary FIX polypeptides having two or more non-native
N-glycosylation sites.
TABLE-US-00005 TABLE 4 Non- native glycosy- lation site Non-native
(mature glycosylation Modifications Modifications FIX site SEQ
(mature FIX (chymotrypsin number- (chymotrypsin ID numbering)
numbering) ing) numbering) NO. D85N/I251S D[85]N/I86S N85 and N[85]
and N84 104 N149 D85N/D203N/ D[85]N/D39N/F41T N85 and N[85] and N39
100 F205T N203 D85N/K228N D[85]N/K63N N85 and N[85] and N63 102
N228 D85N/D104N/ D[85]N/D[104N]/ N85, N[85], N[104] 105 K106S/I251S
K[106]6/I86S N104 and N84 and N249 A103N/N105S/ A[103]N/N[105]S/
N103 and N[103] and 178 K247N/N249S K82N/N84S N247 N82 D104N/K106S/
D[104]N/K[106]S/ N104 and N[104] and 179 K247N/N249S K82N/N84S N247
N82 K228N/I251S K63N/I86S N228 and N63 and N84 180 N249
A103N/N105S/ A[103]N/N[105]S/ N103 and N[103] and 181 I251S I86S
N249 N84 D104N/K106S/ D[104]N/K[106]S/ N104 and N[104] and 182
I251S I86S N249 N84 K228N/ K63N/K82N/N84S N228 and N63 and N82 183
K247N/N249S N247 K228N/ K63N/K82N/N84S/ N228, N63, N82 and 184
K247N/N249S/ D[104]N/K[106]S N247 N[104] D104N/K106S and N104,
D104N/K106S/ D[104]N/K[106]S/ N104 and N[104] and 185 N260S N95S
N258 N93
[0340] The modified FIX polypeptides provided herein can contain
one or more non-native glycosylation sites, such as one or more
non-native N-glycosylation sites. Thus, when expressed in a cell
that facilitates glycosylation, or when glycosylated using in vitro
techniques well know in the art, the modified FIX polypeptides can
exhibit increased levels of glycosylation compared to an unmodified
FIX polypeptide. The level of glycosylation can be increased by at
least or at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%,
500%, or more compared to the level of glycosylation of unmodified
or wild-type FIX polypeptide.
[0341] The modifications described herein to introduce one or more
non-native glycosylation sites can be combined with any other
mutation described herein or known in the art. Typically, the
resulting modified FIX polypeptide exhibits increased coagulant
activity compared to an unmodified FIX polypeptide. For example,
one or more modifications that introduce one or more non-native
glycosylation sites can be combined with modification(s) that
increase resistance to an inhibitor, such as AT-III and/or heparin,
increase catalytic activity, increase intrinsic activity, increase
binding to phospholipids, decrease binding to LRP and/or improve
pharmacokinetic and/or pharmacodynamic properties.
[0342] The modified FIX polypeptides provided herein that contain
one or more non-native glycosylation sites and have altered
glycosylation, such as increased levels of glycosylation, retain at
least one activity of FIX, such as, for example, catalytic activity
for its substrate, FX. Typically, the modified FIX polypeptides
provided herein retain at least or at least about 5%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the catalytic
activity exhibited by an unmodified FIX polypeptide. Increased
levels of glycosylation can improve the pharmacokinetic properties
of the modified FIX polypeptides by endowing the variant with one
or more of the following properties: i) decreased clearance, ii)
altered volume of distribution, iii) enhanced in vivo recovery, iv)
enhanced total protein exposure in vivo (i.e., AUC), v) increased
serum half-life (.alpha., .beta., and/or .gamma. phase), and/or vi)
increased mean resonance time (MRT) compared to an unmodified FIX.
The coagulant activity of the modified FIX polypeptides with
altered glycosylation can be increased by at least or at least
about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%,
60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, or more compared
to the coagulation activity of unmodified or wild-type FIX
polypeptide either in vivo or in vitro.
[0343] (b). Elimination of Native Glycosylation Sites
[0344] The modified FIX polypeptides provided herein can have a
reduced number of glycosylation sites compared to an unmodified FIX
polypeptide. Typically, a reduction in the number of glycosylation
sites results in a reduced level of glycosylation compared to the
unmodified FIX polypeptide. The native glycosylation sites that can
be removed include, for example, native N-glycosylation sites at
amino acid positions corresponding to positions 157 and 167 of the
mature FIX set forth in SEQ ID NO:3, and native O-glycosylation
sites at amino acid positions corresponding to positions 53, 61,
159, 169, 172 and 179 of the mature FIX set forth in SEQ ID
NO:3.
[0345] Any one or more native glycosylation sites can be removed by
amino acid replacement(s), insertion(s) or deletion(s), or any
combination thereof. For example, an amino acid replacement,
deletion and/or insertion can be made to destroy the
Asn/Xaa/Ser/Thr/Cys motif (where Xaa is not a proline), thereby
removing an N-glycosylation site at position 157 or 167. In other
examples, O-glycosylation sites are removed, such as by amino acid
replacement or deletion of the serine residues at positions 53 or
61, or amino acid replacement or deletion of the threonine residues
at positions 159 or 169. The resulting modified FIX polypeptide
retains at least one activity of the unmodified FIX polypeptide. In
some examples, the modified FIX polypeptide retains at least 5%,
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the
catalytic activity of the unmodified FIX polypeptide. In other
examples, the modified FIX polypeptide retains at least 5%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the binding
activity for FX of the unmodified FIX polypeptide. In other
examples, the modified FIX polypeptide retains at least 5%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the binding
activity for FVIIIa of the unmodified FIX polypeptide. In some
assays and/or under some conditions, the modified FIX polypeptides
can exhibit enhanced properties compared with unmodified FIX (e.g.,
including but not limited to, increased in vivo recovery, increased
AUC in vivo, and/or decreased clearance in vivo).
[0346] Table 5 provides non-limiting examples of exemplary amino
acid replacements, corresponding to amino acid positions of a
mature FIX polypeptide as set forth in SEQ ID NO:3, that are
included in a modified FIX polypeptide to decrease glycosylation
levels by removing or eliminating a native N-glycosylation site. In
Table 5 below, the sequence identifier (SEQ ID NO) is identified in
which exemplary amino acid sequences of the modified FIX
polypeptide are set forth.
TABLE-US-00006 TABLE 5 Mutation (Mature FIX Mutation SEQ ID
Numbering) (Chymotrypsin Numbering) NO S53A S[53]A 88 S61A S[61]A
87 N157D N[157]D 75 N157Q N[157]Q 98 T159A T[159]A 89 N167D N[167]D
85 N167Q N[167]Q 86 T169A T[169]A 90 T172A T[172]A 91 T179A T[179]A
92
[0347] The modifications described herein to eliminate one or more
native glycosylation sites can be combined with any other mutation
described herein or known in the art. Typically, the resulting
modified FIX polypeptide exhibits increased coagulant activity
compared to an unmodified FIX polypeptide. For example, one or more
modifications that eliminate one or more native glycosylation sites
can be combined with modification(s) that introduce a non-native
glycosylation site, increase resistance to an inhibitor, such as
AT-III and/or heparin, increase catalytic activity, increase
intrinsic activity, increase binding to phospholipids, or improve
pharmacokinetic and/or pharmacodynamic properties.
[0348] The modified FIX polypeptides provided herein that eliminate
one or more native glycosylation sites retain at least one activity
of FIX, such as, for example, catalytic activity for its substrate,
FX. Typically, the modified FIX polypeptides provided herein retain
at least or at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 95% or more of the catalytic activity exhibited by an
unmodified FIX polypeptide. In some instances, the coagulant
activity of the modified FIX polypeptides with altered
glycosylation can be increased by at least or at least about 1%,
2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 100%, 200%, 300%, 400%, 500%, or more compared to the
coagulation activity of unmodified or wild-type FIX polypeptide
either in vivo or in vitro.
[0349] b. Increased Resistance to AT-III and Heparin
[0350] The activity of FIX can be inhibited by factors in the blood
as part of the regulation of the coagulation process. Thus,
provided herein are modified FIX polypeptides that exhibit
increased resistance to the inhibitory effects of inhibitors,
including AT-III and heparin. In some examples, the modified FIX
polypeptides provided herein exhibit reduced binding affinity for
heparin and/or a decreased second order rate constant for
inhibition by AT-III alone and/or the AT-III/heparin complex. In
further examples, the modified FIX polypeptides exhibit increased
resistance to the AT-III alone, or heparin alone. Thus, provided
herein are modified FIX polypeptides that exhibit increased
resistance to AT-III, the AT-III/heparin complex and/or
heparin.
[0351] i. AT-III
[0352] Antithrombin III (also known as antithrombin or AT-III) is
an important anticoagulant serpin (serine protease inhibitor).
AT-III is synthesized as a precursor protein containing 464 amino
acid residues (SEQ ID NO:21). In the course of secretion a 32
residue signal peptide is cleaved to generate a 432 amino acid
mature human antithrombin (SEQ ID NO:22). The 58 kDa AT-III
glycoprotein circulates in the blood and functions as a serine
protease inhibitor (serpin) to inhibit a large number of serine
proteases of the coagulation system. The principal targets of
AT-III are thrombin, factor Xa and factor IXa, although AT-III also
has been shown to inhibit the activities of FXIa, FXIIa and, to a
lesser extent, FVIIa.
[0353] The action of is greatly enhanced by glycosaminoglycans,
such as the naturally occurring heparan sulphate or the various
tissue-derived heparins that are widely used as anticoagulants in
clinical practice. Unlike other serpins, which typically are
effective without binding a secondary molecule, the reaction of
AT-III in the absence of heparin with is target coagulations
factors is unusually slow. In the absence of heparin, the reactive
loop sequence of AT-III provides the determinants of the slow
reactivity. Mutagenesis of the conserved P2-P1' residues in the
reactive loop center of AT-III, for example, affects the
interaction of AT-III with proteases in the absence but not the
presence of heparin.
[0354] AT-III binds in a highly specific manner to a unique
pentasaccharide sequence in heparin that induces a conformational
change in the reactive center loop. In such a conformation, the
reactive center loop of AT-III can more efficiently interact with
the reactive site of the serine protease, and effect inhibition.
Evidence suggests that binding of heparin to AT-III generates new
exosites that promote the interaction of FIXa, thrombin and FXa
with AT-III. The tyrosine at position 253 and the glutamic acid at
position 255, for example, have been shown to be key determinants
of an exosite on that is generated by heparin binding, and that
promotes the rapid, increased inhibition of FIXa by compared to the
inhibition observed with AT-III alone (Izaguirre et al., (2006) J.
Bio Chem 281:13424-13432).
[0355] Mutational studies also have given some indication of which
residues in Factor IXa are involved in the interaction with
AT-III/heparin. For example, modification of the arginine at
position 318 of the mature FIX polypeptide (corresponding to
position 150 by chymotrypsin numbering) reduces the reactivity of
this mutant with AT-III/heparin by 33-fold to 70-fold (Yang, L. et
al., (2003) J. Biol. Chem. 278(27):25032-8). The impairment of the
reactivity between the FIXa mutant and AT-III is not as noticeable
when AT-III is not bound to heparin, however, indicating that the
interaction between the arginine at position 318 of the mature FIXa
polypeptide and AT-III is effected when AT-III is in the
heparin-activated conformation.
[0356] ii. Heparin
[0357] Heparin can inhibit the activity of FIXa in the intrinsic
tenase complex in both an AT-III-dependent manner, as discussed
above, and an AT-III-independent manner. Studies indicate that the
AT-III-independent inhibition of FIXa activity by heparin is the
result of oligosaccharide binding to an exosite on FIXa that
disrupts the FVIIIa-FIXa interaction (Yuan et al., (2005) Biochem.
44:3615-3625, Misenheimer et al., (2007) Biochem. 46:7886-7895,
Misenheimer et al. (2010) Biochem. 49:9977-10005). The
heparin-binding exosite is in the Factor aa protease domain, in an
electropositive region extending from the arginine at position 338
(corresponding to position 170 by chymotrypsin numbering) to at
least the arginine at position 403 (corresponding to position 233
by chymotrypsin numbering). This exosite overlaps with a region of
FIXa that is critical to the interaction of FIXa with its cofactor,
FVIIIa. Thus, binding of heparin to FIXa inhibits the interaction
of FIXa with FVIIIa, thus reducing the intrinsic tenase
activity.
[0358] iii. Exemplary FIX Polypeptides with Increased Resistance to
AT-III and Heparin
[0359] Modifications can be made to a FIX polypeptide that increase
its resistance to AT-III, heparin and/or the AT-III/heparin
complex. Generally, such modified FIX polypeptides retain at least
one activity of a FIX polypeptide. Typically, such modifications
include one or more amino acid substitutions at any position of the
FIX polypeptide that is involved in the interaction of FIXa with
AT-III, heparin an/or the AT-III/heparin complex. Such
modifications can, for example, result in a reduced rate of
interaction of the modified FIXa polypeptide with AT-III alone, a
reduced rate of interaction of the modified FIXa polypeptide to the
AT-III/heparin complex, and/or a reduced binding affinity of the
modified FIXa polypeptide for heparin alone. In some examples, the
modification(s) introduces one or more non-native glycosylation
sites. The carbohydrate moiety that is linked to the new
glycosylation site can sterically hinder the interaction of the
modified FIX with the AT-III/heparin complex, resulting in
increased resistance of the modified FIX polypeptide to the
inhibitory effects of AT-III/heparin. The modified FIXa
polypeptides therefore exhibit increased resistance to the
naturally inhibitory effects of AT-III, AT-III/heparin and/or
heparin with respect to intrinsic tenase activity. When evaluated
in an appropriate in vitro assay, or in vivo, such as following
administration to a subject as a pro-coagulant therapeutic, the
modified FIX polypeptides display increased coagulant activity as
compared with unmodified FIX polypeptides.
[0360] As described herein below, one of skill in the art can
empirically or rationally design modified FIXa polypeptides that
display increased resistance to AT-III, AT-III/heparin and/or
heparin. Such modified FIX polypeptides can be tested in assays
known to one of skill in the art to determine if the modified FIX
polypeptides display increased resistance to AT-III, AT-M/heparin
and/or heparin. For example, the modified FIX polypeptides can be
tested for binding to AT-III, AT-III/heparin and/or heparin.
Generally, a modified FIX polypeptide that has increased resistance
to AT-III, AT-III/heparin and/or heparin will exhibit decreased
binding and/or decreased affinity for heparin and/or a decreased
rate of interaction with AT-III and/or AT-III/heparin. Typically,
such assays are performed with the activated form of FIX (FIXa),
and in the presence or absence of the cofactor, FVIIIa, and
phospholipids.
[0361] Provided herein are modified FIX polypeptides exhibiting
increased resistance to AT-III, AT-III/heparin and/or heparin. FIX
polypeptide variants provided herein have been modified at one or
more of amino acid positions 202, 203, 204, 205, 228, 239, 257,
260, 293, 312, 316, 318, 319, 321, 333, 338, 342, 346, 400, 403 or
410 (corresponding to amino acid positions 38, 39, 40, 41, 63, 74,
92, 95, 126, 143, 145, 148, 150, 151, 153, 165, 170, 174, 178, 230,
233 and 240 respectively, by chymotrypsin numbering). These amino
acid residues can be modified such as by amino acid replacement,
deletion or substitution. The identified residues can be replaced
or substituted with any another amino acid. Alternatively, amino
acid insertions can be used to alter the conformation of a targeted
amino acid residue or the protein structure in the vicinity of a
targeted amino acid residue.
[0362] Any amino acid residue can be substituted for the endogenous
amino acid residue at the identified positions. Typically, the
replacement amino acid is chosen such that it interferes with the
interaction between FIX and AT-III or heparin. For example,
modifications can be made at amino acid positions 260, 293, 333,
338, 346, 400 and 410 (corresponding to amino acid positions 95,
126, 165, 170, 178, 230, 233 and 240, respectively, by chymotrypsin
numbering) to interfere with the interaction of the FIX polypeptide
with heparin. In other examples, modifications are made at amino
acid positions 203, 204, 205, 228, 239, 312, 314, 316, 318, 319,
321 and 342 (corresponding to amino acid positions 39, 40, 41, 63,
74, 143, 145, 148, 150, 151, 153 and 174, respectively, by
chymotrypsin numbering) to interfere with the interaction of the
FIX polypeptide with AT-ILL
[0363] In some examples, a new glycosylation site is introduced by
amino acid replacement. The carbohydrate moiety that is linked to
the new glycosylation site can sterically hinder the interaction of
the modified FIX with the AT-III/heparin complex, resulting in
increased resistance of the modified FIX polypeptide to the
inhibitory effects of AT-III/heparin. For example, the glutamic
acid (Glu, E) at position 410 (corresponding to position 240 by
chymotrypsin numbering) can be replaced with an asparagine (Asn, N)
to introduce a new glycosylation site at position 410. In other
examples, the glutamic acid (Glu, E) at position 239 (corresponding
to position 74 by chymotrypsin numbering) is replaced with an
asparagine (Asn, N) to introduce a new glycosylation site at
position 239. Other mutations that introduce a new glycosylation
site to increase resistance to AT-III/heparin include, for example,
D203N/F205T, R318N/A320S, N260S and F314N/K316S (corresponding to
D39N/F41T, R150N/A152S, N95S and F145N/K148S by chymotrypsin
numbering).
[0364] In other examples in which modifications are made to
increase resistance to AT-III, AT-III/heparin and/or heparin, the
valine residue at position 202 (corresponding to position 38 by
chymotrypsin numbering) is replaced with a methionine (Met, M) or
tyrosine (Tyr, Y); the aspartic acid (Asp, D) at position 203
(corresponding to position 39 by chymotrypsin numbering) is
replaced with a methionine (Met, M) or tyrosine (Tyr, Y); the
alanine (Ala, A) at position 204 (corresponding to position 40 by
chymotrypsin numbering) is replaced with a methionine (Met, M) or
tyrosine (Tyr, Y); the glutamic acid at position 239 (corresponding
to position 74 by chymotrypsin numbering) is replaced with serine
(Ser, S), alanine (Ala, A), arginine (Arg, R), or lysine (Lys, K);
the histidine at position 257 (corresponding to position 92 by
chymotrypsin numbering) is replaced with phenylalanine (Phe, F),
tyrosine (Tyr, Y), glutamic acid (Glu, E) or serine (Ser, S); the
lysine (Lys, K) at position 293 (corresponding to position 143 by
chymotrypsin numbering) is replaced with alanine (Ala, A) or
glutamine (Gln, Q); the arginine (Arg, R) at position 312
(corresponding to position 143 by chymotrypsin numbering) is
replaced with alanine (Ala, A) or glutamine (Gln, Q); the lysine at
position 316 (corresponding to 148 by chymotrypsin numbering) is
replaced with asparagine (Asn, N), alanine (Ala, A), glutamic acid
(Glu, E), serine (Ser, S) or methionine (Met, M); the arginine
(Arg, R) at position 318 (corresponding to position 150 by
chymotrypsin numbering) is replaced with alanine (Ala, A), glutamic
acid (Glu, E) tyrosine (Tyr, Y), phenylalanine (Phe, F) or
tryptophan (Trp, W); the arginine (Arg, R) at position 333
(corresponding to position 165 by chymotrypsin numbering) is
replaced with alanine (Ala, A) or glutamic acid (Glu, E); the
arginine (Arg, R) at position 338 (corresponding to position 170 by
chymotrypsin numbering) is replaced with alanine (Ala, A) or
glutamic acid (Glu, E); the lysine (Lys, K) at position 400
(corresponding to position 230 by chymotrypsin numbering) is
replaced with alanine (Ala, A) or glutamic acid (Glu, E); and/or
the arginine (Arg, R) at position 403 (corresponding to position
233 by chymotrypsin numbering) is replaced with alanine (Ala, A),
glutamic acid (Glu, E) or aspartic acid (Asp, D).
[0365] Provided herein are modified FIX polypeptides that contains
an amino acid replacement at residue R318 or at a residue in a FIX
polypeptide corresponding to 318 that is a tyrosine, e.g., R318Y,
or is a conservative amino acid replacement thereof. For example,
conservative amino acid residues for tyrosine include, but are not
limited to, phenylalanine (F) or tryptophan (W). Also provided are
modified FIX polypeptides that contains an amino acid replacement
at residue R403 or at a residue in a FIX polypeptide corresponding
to 403 that is a glutamic acid, e.g., R403E, or is a conservative
amino acid replacement thereof. For example, conservative amino
acid residues for glutamic acid include, but are not limited to,
aspartic acid (D).
[0366] In a further embodiment, combination mutants can be
generated. Included among such combination mutants are those having
two or more mutations at amino acid positions 202, 203, 204, 257,
239, 293, 312, 316, 318, 333, 338, 400, 403 and 410 (corresponding
to amino acid positions 38, 39, 40, 74, 92, 126, 143, 148, 150,
165, 170, 230, 233 and 240, respectively, by chymotrypsin
numbering). For example, a modified FIX polypeptide can possess
amino acid substitutions at 2, 3, 4, 5 or more of the identified
positions. Hence, a modified polypeptide can display 1, 2, 3, 4, 5
or more mutations that can result in increased resistance of the
modified FIX polypeptide to the inhibitory effects of AT-III,
AT-III/heparin and/or heparin. Any one or more of the mutations
described herein to increase resistance of the modified FIX
polypeptide to the inhibitory effects of AT-III, AT-III/heparin
and/or heparin can be combined.
[0367] Table 6 provides non-limiting examples of exemplary amino
acid replacements at the identified residues, corresponding to
amino acid positions of a mature FIX polypeptide as set forth in
SEQ ID NO:3. Included amongst these are exemplary combination
mutations. As noted, such FIX polypeptides are designed to increase
resistance to AT-III, AT-III/heparin and/or heparin, and therefore
have increased coagulant activity in vivo, ex vivo, or in in vitro
assays that include ATIII, heparin/ATIII, heparin, plasma, serum,
or blood. In reference to such mutations, the first amino acid
(one-letter abbreviation) corresponds to the amino acid that is
replaced, the number corresponds to the position in the mature FIX
polypeptide sequence with reference to SEQ ID NO:3, and the second
amino acid (one-letter abbreviation) corresponds to the amino acid
selected that replaces the first amino acid at that position. The
amino acid positions for mutation also are referred to by the
chymotrypsin numbering scheme. In Table 6 below, the sequence
identifier (SEQ ID NO) is identified in which exemplary amino acid
sequences of the modified FIX polypeptide are set forth.
TABLE-US-00007 TABLE 6 Mutation (Mature FIX Mutation SEQ ID
Numbering) (Chymotrypsin Numbering) NO R318A R150A 120 R318E R150E
121 R318Y R150Y 122 R318F R150F 413 R318W R150W 414 R312Q R143Q 123
R312A R143A 124 R312Y R143Y 125 R312L R143L 126 V202M V38M 127
V202Y V38Y 128 D203M D39M 129 D203Y D39Y 130 A204M A40M 131 A204Y
A40Y 132 K400A/R403A K230A/R233A 133 K400E/R403E K230E/R233E 134
R403A R233A 135 R403E R233E 136 R403D R233D 417 K400A K230A 137
K400E K230E 138 K293E K126E 139 K293A K126A 140 R333A R165A 141
R333E R165E 142 R333S R165S 186 R338A R170A 143 R338E R170E 144
R338L R170L 187 R338A/R403A R170A/R233A 145 R338E/R403E R170E/R233E
146 K293A/R403A K126A/R233A 147 K293E/R403E K126E/R233E 148
K293A/R338A/R403A K126A/R170A/R233A 149 K293E/R338E/R403E
K126E/R170E/R233E 150 R318A/R403A R150A/R233A 151 R318E/R403E
R150E/R233E 152 R318Y/R338E/R403E R150Y/R170E/R233E 156 R318Y/R338E
R150Y/R170E 188 R318N/A320S R150N/A152S 119 K316N K148N 189 K316A
K148A 190 K316E K148E 191 K316S K148S 192 K316M K148M 193 E239N
E74N 109 E239S E74S 194 E239A E74A 195 E239R E74R 196 E239K E74K
197 H257F H92F 198 H257Y H92Y 199 H257E H92E 200 H257S H92S 201
E410N E240N 108 N260S N95S 116 F314N/K316S F145N/K148S 113
[0368] The modifications described herein to increase resistance to
an inhibitor, such as AT-III and/or heparin, can be combined with
any other mutation described herein or known in the art. Typically,
the resulting modified FIX polypeptide exhibits increased coagulant
activity compared to an unmodified FIX polypeptide. For example,
one or more modifications that increase resistance to an inhibitor,
such as AT-III and/or heparin, can be combined with modification(s)
that introduce a non-native glycosylation site, eliminate one or
more native glycosylation sites, eliminate one or more of the
native sulfation, phosphorylation or hydroxylation sites, increase
catalytic activity, increase intrinsic activity, increase binding
to phospholipids, or improve pharmacokinetic and/or pharmacodynamic
properties. The resulting modified FIX polypeptide typically
exhibits increased coagulant activity compared to an unmodified FIX
polypeptide.
[0369] Modified FIX polypeptides that have increased resistance for
AT-III alone, the AT-III/heparin complex and/or heparin alone, can
exhibit a reduction in the affinity for heparin, the extent of
inhibition under specified conditions, or in the second order rate
constant for inhibition by ATM or heparin/ATIII at least or at
least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90%, 95%, 99% or more compared to the affinity,
extent of inhibition, or the second order rate constant for
inhibition of unmodified or wild-type FIX polypeptide either in
vivo or in vitro. Thus, the modified FIX polypeptides can exhibit
increased resistance to AT-III alone, the AT-III/heparin complex
and/or heparin alone that is at least or at least about 1%, 2%, 3%,
4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 100%, 200%, 300%, 400%, 500%, or more of the resistance
exhibited by an unmodified FIX polypeptide. Increased resistance to
AT-III, the AT-III/heparin complex and/or heparin by such modified
FIX polypeptides also can be manifested as increased coagulation
activity or improved duration of coagulation activity in vivo or in
vitro in the presence of AT-III, the AT-III/heparin complex,
heparin, blood, plasma, or serum. The coagulation activity of the
modified FIX polypeptides can be increased by at least about 1%,
2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
80%, 90%, 100%, 200%, 300%, 400%, 500%, or more compared to the
coagulation activity of unmodified or wild-type FIX polypeptide
either in vivo or in vitro. Modified FIX polypeptides containing
modifications that increase resistance to AT-III, the
heparin/AT-III complex, and/or heparin also can exhibit an enhanced
therapeutic index compared with unmodified FIXa.
[0370] c. Mutations to Increase Catalytic Activity
[0371] The modified FIX polypeptides provided herein can contain
one or more modifications to increase the catalytic activity of the
polypeptide compared to an unmodified FIX. For example,
modifications can be made to the amino acids that are involved in
the interaction of FIX with its cofactor, FVIIIa, such that the
resulting modified FIX polypeptide has increased affinity for
FVIIIa, and thereby displays increased activity toward FX under
conditions in which FVIIIa is not present at saturating
concentrations. Modifications also can be made to the protease
domain of the FIX polypeptide, such that the activity or catalytic
efficiency of the modified FIX polypeptide for activation of FX, in
the presence and/or absence of the co-factor FVIIIa, is increased
compared to the activity or catalytic efficiency of the unmodified
polypeptide.
[0372] Exemplary modifications that can be included in the modified
FIX polypeptides provided herein include amino acid replacements at
positions 259, 265, 345, 410 and 412 (corresponding to 94, 98, 177,
240 and 242 by chymotrypsin numbering). The amino acids at these
positions can be replaced by any other amino acid residue. In some
examples, the tyrosine at position 259 is replaced with a
phenylalanine; the lysine at position 265 is replaced with a
threonine; and for the tyrosine at position 345 is replaced with a
threonine. In further example, the glutamic acid at position 410 is
replaced with a glutamine, serine, alanine or aspartic acid. In one
example, the threonine at position 412 is replaced with a valine or
an alanine.
[0373] The above mentioned modifications are exemplary only. Many
other modifications described herein also result in increased
catalytic activity. For example, modifications that are introduced
into the FIX polypeptide to increase resistance to an inhibitor,
such as AT-III and/or heparin, introduce a non-native glycosylation
site, eliminate one or more native glycosylation sites, eliminate
one or more of the native sulfation, phosphorylation or
hydroxylation sites, increase intrinsic activity, increase binding
to phospholipids, decrease binding to LRP, and/or improve
pharmacokinetic and/or pharmacodynamic properties, can also result
in a modified FIX polypeptide that exhibits increased activity.
[0374] Table 7 provides non-limiting examples of exemplary amino
acid replacements at the identified residues, corresponding to
amino acid positions of a mature FIX polypeptide as set forth in
SEQ ID NO:3. In reference to such mutations, the first amino acid
(one-letter abbreviation) corresponds to the amino acid that is
replaced, the number corresponds to the position in the mature FIX
polypeptide sequence with reference to SEQ ID NO:3, and the second
amino acid (one-letter abbreviation) corresponds to the amino acid
selected that replaces the first amino acid at that position. The
amino acid positions for mutation also are referred to by the
chymotrypsin numbering scheme. In Table 7 below, the sequence
identifier (SEQ ID NO) is identified in which exemplary amino acid
sequences of the modified FIX polypeptide are set forth.
TABLE-US-00008 TABLE 7 Mutation (Mature FIX Mutation SEQ ID
Numbering) (Chymotrypsin Numbering) NO T412A T242A 202 T412V T242V
203 E410Q E240Q 174 E410S E240S 175 E410A E240A 176 E410D E240D 206
Y259F/K265T/Y345T Y94F/K98T/Y177T 216
[0375] The modifications described herein to increase catalytic
activity can be combined with any other mutation described herein
or known in the art. Typically, the resulting modified FIX
polypeptide exhibits increased coagulant activity compared to an
unmodified FIX polypeptide. For example, one or more modifications
that increase catalytic activity can be combined with
modification(s) that increase resistance to an inhibitor, such as
AT-III and/or heparin, introduce a non-native glycosylation site,
eliminate one or more native glycosylation sites, eliminate one or
more of the native sulfation, phosphorylation or hydroxylation
sites, increase intrinsic activity, increase binding to
phospholipids, or improve pharmacokinetic and/or pharmacodynamic
properties. The resulting modified FIX polypeptide typically
exhibits increased coagulant activity compared to an unmodified FIX
polypeptide.
[0376] Modified FIX polypeptides that have increased catalytic
activity can exhibit at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%,
8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or
more activity compared to the catalytic activity of unmodified or
wild-type FIX polypeptide either in vivo or in vitro. Increased
catalytic activity of such modified FIX polypeptides also can be
manifested as increased coagulation activity, duration of
coagulation activity and/or enhanced therapeutic index. The
coagulation activity of the modified FIX polypeptides can be
increased by at least or at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%,
8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%,
300%, 400%, 500%, or more compared to the coagulation activity of
unmodified or wild-type FIX polypeptide either in vivo or in
vitro.
[0377] d. Mutations to Decrease LRP Binding
[0378] FIXa can be cleared from systemic circulation by binding the
low-density lipoprotein receptor-related protein (LRP), which is a
membrane glycoprotein that is expressed on a variety of tissues,
including liver, brain, placenta and lung. Thus, provided herein
are modified FIX polypeptides that exhibit decreased binding to the
LRP. This can result in improved pharmacokinetic properties of the
modified FIX polypeptide, including, for example, i) decreased
clearance, ii) altered volume of distribution, iii) enhanced in
vivo recovery, iv) enhanced total protein exposure in vivo (i.e.,
AUC), v) increased serum half-life (.alpha., .beta., and/or .gamma.
phase), and/or vi) increased mean resonance time (MRT). Such
modified FIX polypeptides can exhibit increased coagulant
activity.
[0379] The modified FIX polypeptide provided herein can contain one
or more modifications in the LRP-binding site. This binding site is
postulated to be located in a loop in the protease domain spanning
residues 342 to 346 of the mature FIX polypeptide set forth in SEQ
ID NO:3. Modification of one or more of the residues at positions
342-346 (corresponding to positions 174-178 by chymotrypsin
numbering), such as by amino acid replacement, insertion or
deletion, can interfere with the interaction between the modified
FIX polypeptide and LRP, resulting in decreased binding affinity.
The binding of the modified FIX polypeptides to LRP can be tested
using assays known to one of skill in the art (see, e.g. Rohlena et
al., (2003) J. Biol. Chem. 278:9394-9401). The resulting improved
pharmacokinetic properties also can be tested using well known in
vivo assays, including those described below.
[0380] Exemplary modifications that can be included in the modified
FIX polypeptides provided herein include amino acid replacements at
positions 343, 344, 345 and 346 (corresponding to 175, 176, 177 and
178 by chymotrypsin numbering). The amino acids at these positions
can be replaced by any other amino acid residue. In some examples,
the threonine at position 343 is replaced with a glutamine,
glutamic acid, aspartic acid or arginine; the phenylalanine at
position 344 is replaced with an isoleucine; the tyrosine at
position 345 is replaced with a threonine, alanine or an alanine;
and/or the asparagine at position 346 is replaced with an aspartic
acid or a tyrosine. Any one or more of these exemplary amino acid
replacements can be combined with each other or with other
modifications described herein.
[0381] Provided herein are modified FIX polypeptides that contains
an amino acid replacement at residue T343 or at a residue in a FIX
polypeptide corresponding to 343 that is an arginine, e.g., T343R,
or is a conservative amino acid replacement thereof. For example,
conservative amino acid residues for arginine include, but are not
limited to, lysine (K).
[0382] Table 8 provides non-limiting examples of exemplary amino
acid replacements at the identified residues, corresponding to
amino acid positions of a mature FIX polypeptide as set forth in
SEQ ID NO:3. In reference to such mutations, the first amino acid
(one-letter abbreviation) corresponds to the amino acid that is
replaced, the number corresponds to the position in the mature FIX
polypeptide sequence with reference to SEQ ID NO:3, and the second
amino acid (one-letter abbreviation) corresponds to the amino acid
selected that replaces the first amino acid at that position. The
amino acid positions for mutation also are referred to by the
chymotrypsin numbering scheme. In Table 8 below, the sequence
identifier (SEQ ID NO) is identified in which exemplary amino acid
sequences of the modified FIX polypeptide are set forth.
TABLE-US-00009 TABLE 8 Mutation (Mature FIX Mutation SEQ ID
Numbering) (Chymotrypsin Numbering) NO N346D N178D 207 N346Y N178Y
208 T343R T175R 209 T343E T175E 210 T343D T175D 416 T343Q T175Q 211
F342I F174I 212 Y345A Y177A 213 Y345T Y177T 214 T343R/Y345T
T175R/Y177T 215 T343R/N346D T175R/N178D 409 T343R/N346Y T175R/N178Y
410
[0383] The modifications described herein to decrease binding to
LRP can be combined with any other mutation described herein or
known in the art. Typically, the resulting modified FIX polypeptide
exhibits increased coagulant activity compared to an unmodified FIX
polypeptide. For example, one or more modifications that decrease
binding to LRP can be combined with modification(s) that increase
resistance to an inhibitor, such as AT-III and/or heparin, increase
catalytic activity, introduce a non-native glycosylation site,
eliminate one or more native glycosylation sites, eliminate one or
more of the native sulfation, phosphorylation or hydroxylation
sites, increase activity in the presence and/or absence of FVIIIa,
increase binding to phospholipids, or improve pharmacokinetic
and/or pharmacodynamic properties. The resulting modified FIX
polypeptide typically exhibits increased coagulant activity
compared to an unmodified FIX polypeptide.
[0384] Modified FIX polypeptides that have decreased binding to LRP
can exhibit at a decrease of at least or about 1%, 2%, 3%, 4%, 5%,
6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
99% or more compared to the binding of unmodified or wild-type FIX
polypeptide to LRP in vitro. Decreased binding to LRP by such
modified FIX polypeptides can result in improved pharmacokinetic
properties, such as i) decreased clearance, ii) altered volume of
distribution, iii) enhanced in vivo recovery, iv) enhanced total
protein exposure in vivo (i.e., AUC), v) increased serum half-life
(.alpha..gamma., .beta., and/or .gamma. phase), and/or vi)
increased mean resonance time (MRT). Further, such alterations can
result in increased coagulant activity, duration of coagulation
activity and/or enhanced therapeutic index. The coagulation
activity of the modified FIX polypeptides can be increased by at
least or at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%,
500%, or more compared to the coagulation activity of unmodified or
wild-type FIX polypeptide either in vivo or in vitro.
[0385] e. Other Mutations to Alter Posttranslational
Modification
[0386] Wild-type FIX is post translationally modified upon
expression in mammalian cells. The Factor IX precursor polypeptide
undergoes extensive posttranslational modification to become the
mature zymogen that is secreted into the blood. Such
posttranslational modifications include .gamma.-carboxylation,
.beta.-hydroxylation, O- and N-linked glycosylation, sulfation and
phosphorylation. As discussed above, the levels of glycosylation
can be altered by, for example, introducing new non-native
glycosylation sites and/or eliminating native glycosylation sites.
Similarly, other posttranslational modifications can be altered,
such as by introducing and/or eliminating .gamma.-carboxylation,
.beta.-hydroxylation, sulfation and/or phosphorylation sites.
[0387] Any one or more of the native .gamma.-carboxylation,
.beta.-hydroxylation, sulfation or phosphorylation sites can be
eliminated, such as by amino acid replacement or deletion. For
example, unmodified FIX polypeptides can be modified by amino acid
replacement of any one or more of the twelve glutamic acid residues
(corresponding to positions 7, 8, 15, 17, 20, 21, 26, 27, 30, 33,
36 and 40 of the mature FIX set forth in SEQ ID NO:3) in the Gla
domain. These residues typically are .gamma.-carboxylated to
.gamma.-carboxyglutamyl (or Gla) in wild-type FIX. Thus, removal of
the glutamic acid residues, such as by amino acid substitution or
deletion, can reduce the level of .gamma.-carboxylation in a
modified FIX polypeptide compared to the unmodified FIX
polypeptide. Similarly, the aspartic acid residue at position 64,
which normally is .beta.-hydroxylated in wild-type FIX, can be
removed, such as by amino acid substitution or deletion. Additional
post-translational modification sites that can be eliminated
include, for example, the tyrosine at position 155, which typically
is sulfated in wild-type FIX, and the serine residue at position
158, which typically is phosphorylated in wild-type FIX.
[0388] In other examples, non-native post-translational
modification sites can be introduced, such as by amino acid
replacement or insertion. For example, additional glutamic acid
residues can be introduced into the Gla domain. Such glutamic acid
residues could be .gamma.-carboxylated to .gamma.-carboxyglutamyl
(or Gla) in the modified FIX polypeptide upon expression in, for
example, a mammalian cell. Similarly, one or more non-native
.beta.-hydroxylation, sulfation or phosphorylation sites can be
introduced.
[0389] Provided herein are modified FIX polypeptides that have one
or more of the native posttranslational modification sites
eliminated. The modified FIX polypeptides that have been modified
to eliminate one or more post-translational modification sites,
including .gamma.-carboxylation, .beta.-hydroxylation, sulfation
and/or phosphorylation sites, retain at least one activity of the
unmodified FIX polypeptide. In some examples, the modified FIX
polypeptide retains at least or at least about 5%, 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the catalytic activity
of the unmodified FIX polypeptide. In other examples, the modified
FIX polypeptide retains at least or at lest about 5%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the binding
activity for FVIIIa of the unmodified FIX polypeptide. In some
assays and/or under some conditions, the modified FIX polypeptides
can exhibit increased activity compared with the unmodified FIX
protein (e.g., increased pharmacodynamic activity in vivo, and/or
activity in the presence of AT-III/heparin or plasma).
[0390] Provided herein are modified FIX polypeptides that contains
an amino acid replacement at residue Y155 or at a residue in a FIX
polypeptide corresponding to 155 that is a phenylalanine, e.g.,
Y155F, or is a conservative amino acid replacement thereof. For
example, conservative amino acid residues for phenylalanine
include, but are not limited to, methionine (M), leucine (L) or
tyrosine (Y).
[0391] Table 9 provides non-limiting examples of exemplary amino
acid replacements, corresponding to amino acid positions of a
mature FIX polypeptide as set forth in SEQ ID NO:3, that are
included in a modified FIX polypeptide to eliminate a native
.beta.-hydroxylation, sulfation and/or phosphorylation sites at
positions 64, 155 and 158, respectively. In Table 9 below, the
sequence identifier (SEQ ID NO) is identified in which exemplary
amino acid sequences of the modified FIX polypeptide are set
forth.
TABLE-US-00010 TABLE 9 Mutation (Mature FIX Mutation SEQ ID
Numbering) (Chymotrypsin Numbering) NO D64N D[64]N 83 D64A D[64]A
84 Y155F Y[155]F 76 Y155H Y[155]H 93 Y155Q Y[155]Q 94 T155L Y[155]L
415 S158A S[158]A 95 S158D S[158]D 96 S158E S[158]E 97
[0392] The modifications described herein to eliminate
.beta.-hydroxylation, sulfation and/or phosphorylation sites can be
combined with any other mutation described herein or known in the
art. Typically, the resulting modified FIX polypeptide exhibits
increased coagulant activity compared to an unmodified FIX
polypeptide. For example, one or more modifications that eliminate
one or more native .beta.-hydroxylation, sulfation and/or
phosphorylation sites can be combined with modification(s) that
increase resistance to an inhibitor, such as AT-III and/or heparin,
alter glycosylation, such as increase glycosylation, increase
catalytic activity, increase intrinsic activity, increase binding
to phospholipids, or improve pharmacokinetic and/or pharmacodynamic
properties.
[0393] The modified FIX polypeptides provided herein that eliminate
one or more native .beta.-hydroxylation, sulfation and/or
phosphorylation sites retain at least one activity of FIX, such as,
for example, catalytic activity for its substrate, FX, or binding
to the co-factor, FVIIIa. Typically, the modified FIX polypeptides
provided herein retain at least or at least about 5%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the catalytic
activity exhibited by an unmodified FIX polypeptide. In some
instances, the coagulant activity of the modified FIX polypeptides
is increased by at least or at least about 1%, 2%, 3%, 4%, 5%, 6%,
7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%,
200%, 300%, 400%, 500%, or more compared to the coagulation
activity of unmodified or wild-type FIX polypeptide either in vivo
or in vitro.
[0394] 2. Combination Modifications
[0395] The modified FIX polypeptides provided herein that contain
one or more non-native glycosylation sites, have one or more native
glycosylation sites eliminated, have one or more native
.beta.-hydroxylation, sulfation and/or phosphorylation sites
eliminated, or that have modifications that can result in increased
resistance to inhibitors, such as AT-III, AT-III/heparin and/or
heparin, compared to a wild-type FIX polypeptide, also can contain
other modifications. In some examples, the modified FIX
polypeptides contain modifications that introduce one or more
non-native glycosylation sites and also contain modifications that
interfere with the interaction between FIX and inhibitors, such as
AT-III, the AT-III/heparin complex and/or and heparin. In other
examples, modifications that eliminate one or more native
.beta.-hydroxylation, sulfation and/or phosphorylation sites can be
combined with modifications that increase resistance to inhibitors,
and/or modifications that introduce one or more glycosylation
sites. Thus, one or more of the mutations set forth in Tables 3-9
above, can be combined with any of the other mutations set forth in
Tables 3-9 above. Thus, included among the modified FIX
polypeptides provided herein are those that exhibit increased
glycosylation, such as N-glycosylation; increased resistance to
AT-III, AT-III/heparin, and/or heparin; decreased
.beta.-hydroxylation, sulfation and/or phosphorylation; and/or
increased catalytic activity compared with an unmodified FIX
polypeptide.
[0396] Further, any of the modified FIX polypeptides provided
herein can contain any one or more additional modifications. In
some examples, the additional modifications result in altered
properties and/or activities compared to an unmodified FIX
polypeptide. Typically, such additional modifications are those
that themselves result in an increased coagulant activity of the
modified polypeptide and/or increased stability of the polypeptide.
Accordingly, the resulting modified FIX polypeptides typically
exhibit increased coagulant activity.
[0397] The additional modifications can include, for example, any
amino acid substitution, deletion or insertion known in the art,
typically any that increases the coagulant activity and/or
stability of the FIX polypeptide. Any modified FIX polypeptide
provided herein can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20 or more additional amino acid
modifications. Typically, the resulting modified FIX polypeptide
retains at least one activity of the wild-type or unmodified
polypeptide, such as, for example, catalytic activity, or binding
to the co-factor, FVIIIa.
[0398] Additional modifications in the primary sequence can be made
to the FIX polypeptide to effect post-translational modifications.
For example, the modified FIX polypeptides provided herein can
contain non-native glycosylation sites including and other than
those described above, such as any of those described in the art,
including non-native O-linked or S-linked glycosylation sites
described in U.S. Patent Publication No. 20080280818, or the
non-native glycosylation sites described in International Patent
Publication Nos. WO20091300198 and WO2009137254.
[0399] In other examples, the additional modification can be made
to the FIX polypeptide sequence such that its interaction with
other factors, molecules and proteins is altered. For example, the
amino acid residues that are involved in the interaction with
Factor X can be modified such that the affinity and/or binding of
the modified FIX polypeptide to FX is increased. Other
modifications include, but are not limited to, modification of
amino acids that are involved in interactions with FVIIIa, heparin,
antithrombin III and phospholipids.
[0400] Additional modifications also can be made to a modified FIX
polypeptide provided herein that alter the conformation or folding
of the polypeptide. These include, for example, the replacement of
one or more amino acids with a cysteine such that a new disulphide
bond is formed, or modifications that stabilize an .alpha.-helix
conformation, thereby imparting increased activity to the modified
FIX polypeptide.
[0401] Modifications also can be made to introduce amino acid
residues that can be subsequently linked to a moiety, such as one
that acts to increase stability of the modified FIX polypeptide.
For example, cysteine residues can be introduced to facilitate
conjugation to a polymer, such polyethylene glycol (PEG)
(International Pat. Pub. No. WO2009140015). The stability of a FIX
polypeptide also can be altered by modifying potential proteolytic
sites, such as removing potential proteolytic sites, thereby
increasing the resistance of the modified FIX polypeptide to
proteases (see e.g. US Pat. Pub. No. 20080102115).
[0402] Additionally, amino acids substitutions, deletions or
insertions can be made in the endogenous Gla domain such that the
modified FIX polypeptide displays increased binding and/or affinity
for phospholipid membranes. Such modifications can include single
amino acid substitution, deletions and/or insertions, or can
include amino acid substitution, deletion or insertion of multiple
amino acids. For example, all or part of the endogenous Gla domain
can be replaced with all or part of a heterologous Gla domain. In
other examples, the modified FIX polypeptides provided herein can
display deletions in the endogenous Gla domain, or substitutions in
the positions that are normally gamma-carboxylated. Alternatively,
amino acid substitutions can be made to introduce additional,
potential gamma-carboxylation sites.
[0403] The following sections describe non-limiting examples of
exemplary modifications described in the art to effect increased
stability and/or coagulant activity of a FIX polypeptide. As
discussed above, such modifications also can be additionally
included in any modified FIX polypeptide provided herein. The amino
acid positions referenced below correspond to the mature FIX
polypeptide as set forth in SEQ ID NO:3. Corresponding mutations
can be made in other FIX polypeptides, such as allelic, species or
splice variants of the mature FIX polypeptide set forth in SEQ ID
NO:3.
[0404] a. Modifications to Increase Activity
[0405] In one example, additional modifications can be made to a
modified factor IX polypeptide provided herein that result in
increased catalytic activity toward factor X. For example,
modifications can be made to the amino acids that are involved in
the interaction with its cofactor, FVIIIa, such that the resulting
modified FIX polypeptide has increased affinity for FVIIIa, and
thereby displays increased activity toward FX under conditions in
which FVIIIa is not saturating. Modifications can also be made in
FIX that increase the catalytic efficiency of FIXa polypeptides
and/or the FIXa/FVIIIa complex, compared to the activity of the
unmodified FIXa polypeptide or FIXa/FVIIIa complex, for activation
of the substrate FX.
[0406] Examples of additional modifications that can be included in
the modified FIX polypeptides provided herein to increase the
intrinsic activity of the modified FIX polypeptide include, but are
not limited to, those described in Hopfner et al., (1997) EMBO J.
16:6626-6635; Kolkman et al., (2000) Biochem. 39:7398-7405; Sichler
et al., (2003) J. Biol. Chem. 278:4121-4126; Begbie et al., (2005)
Thromb. Haemost. 94(6):1138-47; U.S. Pat. No. 6,531,298 and U.S.
Patent Publication Nos. 20080167219 and 20080214461. Non-limiting
examples of exemplary amino acid modifications described in the art
that can result in increased intrinsic activity of the modified FIX
polypeptide include any one or more of V86A, V86N, V86D, V86E,
V86Q, V86G, V86H, V86I, V86L, V86M, V86F, V86S, V86T, V86W, V86Y,
Y259F, A261K, K265T, E277V, E277A, E277N, E277D, E277Q, E277G,
E277H, E277I, E277L, E277M, E277F, E277S, E277T, E277W, E277Y,
R338A, R338V, R338I, R338F, R338W, R338S, R338T, Y345F, I383V,
E388G. For example, a modified FIX polypeptide provided herein can
contain the amino acid substitutions Y259F/K265T,
Y259F/K265T/Y345F, Y259F/A261K/K265T/Y345F,
Y259F/K265T/Y345F/I383V/E388G or
Y259F/A261K/K265T/Y345F/I383V/E388G. In another example, the
modified FIX polypeptides provided herein can contain modifications
that remove the activation peptide (.DELTA.155-177) (see, e.g.
Begbie et al., (2005) Thromb. Haemost. 94(6):1138-47), which can
both increase activity and decrease clearance in vivo.
[0407] b. Modifications that Increase Affinity for Phospholipids or
Reduce Binding to Collagen
[0408] The modified FIX polypeptides provided herein also can
contain one or more additional modifications to increase affinity
for phospholipids. The coagulant activity of FIX can be enhanced by
increasing the binding and/or affinity of the polypeptide for
phospholipids, such as those expressed on the surface of activated
platelets. This can be achieved, for example, by modifying the
endogenous FIX Gla domain. Modification can be effected by amino
acid substitution at one or more positions in the Gla domain of a
FIX polypeptide that result in a modified FIX polypeptide with
increased ability to bind phosphatidylserine and other negatively
charged phospholipids. Examples of additional modifications to
increase phospholipid binding and/or affinity and that can be made
to a modified FIX polypeptide provided herein, include, but are not
limited to, those described in U.S. Pat. No. 6,017,882. For
example, a modified FIX polypeptide provided herein can contain one
or more modifications at amino acid positions 11, 12, 29, 33 and/or
34 (corresponding to a mature FIX polypeptide set forth in SEQ ID
NO:3). Exemplary of such modifications are amino acid substitutions
K5I, K5L, K5F, K5E, Q11E, Q11D, R16E, R29F and/or N34E, N34D, N34F,
N34I, N34L, T35D and T35E.
[0409] In another aspect, the modified FIX polypeptides provided
herein also can contain one or more additional modifications to
reduce affinity for collagen. The coagulant activity of FIX can be
enhanced by reducing the binding and/or affinity of the polypeptide
for collagen IV, which is present on the surface of the
extracellular matrix on endothelial cells. A reduced binding to
collagen IV can result in increased circulation of the modified FIX
polypeptides and, thus, increased coagulant activity in vivo. This
can be achieved, for example, by modifying the FIX Gla domain at
amino acid residues 3 to 11 of a mature FIX polypeptide set forth
in SEQ ID NO:3, which are responsible for the interaction with
collagen IV (Cheung et al., (1992) J. Biol. Chem. 267:20529-20531;
Cheung et al., (1996) Proc. Natl. Acad. Sci. U.S.A.
93:11068-11073). Modification can be effected by amino acid
substitution at one or more positions in the Gla domain of a FIX
polypeptide that result in a modified FIX polypeptide with
decreased ability to bind collagen N. Examples of additional
modifications to increase phospholipid binding and/or affinity and
that can be made to a modified FIX polypeptide provided herein,
include, but are not limited to, those described in Schuettrumpf et
al., (2005) Blood 105(6):2316-23; Melton et al., (2001) Blood
Coagul. Fibrinolysis 12(4):237-43; and Cheung et al., (1996) Proc.
Natl. Acad. Sci. U.S.A. 93:11068-11073. For example, a modified FIX
polypeptide provided herein can contain are amino acid
substitutions K5A and/or V10K.
[0410] c. Additional Modifications to Increase Resistance to
Inhibitors
[0411] Additional modifications can be included that increase the
activity of the FIX polypeptide by increasing the resistance of the
modified FIX polypeptide to inhibitors, such as, for example,
inhibition by antithrombin III (AT-III)/heparin. Typically, this
can be achieved by modifying one or more residues that are involved
in the interaction with AT-III, heparin or the AT-III/heparin
complex. Exemplary of such modifications include those described,
for example, in U.S. Pat. No. 7,125,841; U.S. Pat. Pub. No
20040110675; Int. Pat. Pub. No. WO2002040544; Chang, J. et al.,
(1998) J. Biol. Chem. 273(20):12089-94; Yang, L. et al., (2002) J.
Biol. Chem. 277(52):50756-60; Yang, L. et al., (2003) J. Biol.
Chem. 278(27):25032-8; Rohlena et al., (2003) J. Biol. Chem.
278(11):9394-401; Sheehan et al., (2006) Blood 107(10):3876-82;
Buyue et al. (2008) Blood 112:3234-3241. Non-limiting examples of
modifications that can be included to decrease inhibition by AT-III
and/or heparin, include, but are not limited to, modifications at
amino acid positions corresponding to amino acid positions R252,
H256, H257, K265, H268, K293, R318, R333, R338, K400, R403, K409 or
K411 of a mature FIX polypeptide set forth in SEQ ID NO:3. For
example, the FIX polypeptides provided herein can contain the amino
acid substitutions R252A, H257A, H268A, K293A, R318A, R333A, R338A,
K400A, R403A, R403E and/or K411A.
[0412] d. Additional Modifications to Alter Glycosylation
[0413] Modifications, in addition to those described above can be
incorporated into the modified FIX polypeptides provided herein to
alter the glycosylation of the modified FIX polypeptides compared
to an unmodified FIX polypeptide. For example, the modified FIX
polypeptides can contain one or more modifications that introduce
one or more non-native glycosylation sites into the modified FIX
polypeptide. Thus, when expressed in an appropriate system, the
modified FIX polypeptides can exhibit altered glycosylation
patterns compared to an unmodified FIX polypeptide. In some
examples, the modified FIX polypeptides exhibit increased
glycosylation compared to an unmodified FIX polypeptide, such as
increased N-glycosylation or increased O-glycosylation
[0414] Examples of additional modifications that can be included in
the modified FIX polypeptides provided herein to alter the
glycosylation profile of a FIX polypeptide include, but are not
limited to, those described in International Published Application
Nos. WO2009130198, WO2009051717 and WO2009137254. Exemplary
modifications that can be included in a modified FIX polypeptide
provided herein to increase glycosylation include, but are not
limited to, Y1N, Y1N+S3T, S3N+K5S/T, G4T, G4N+L6S/T, K5N+E7T,
L6N+E8T, E7N+F9T, F9N+Q11S/T, V10N+G12S/T, Q11N+N13T, G12N+L14S/T,
L14N+R16T, E15T, E15N+E17T; R16N+C18S/T, M19N+E21T; E20N+K22T,
K22N, S24N+E26T; F25N+E27T; E26N+A28T; E27N+R29T; A28N+E30T;
R29N+V31S/T, E30N+F32T; V31N+E33T; F32N+N34T, E33N, T35N+R37S/T,
E36T; E36N; R37N, T39N+F41 S/T, E40N+W42T, F41N+K43S/T,
W42N+Q44S/T, K43N+Y45T; Q44N+V46S/T, Y45N+D47T, V46N+G48S/T,
D47N+D49S/T, G48N+Q50S/T, D49N+C51S/T, Q50N+E52S/T, E52N+N54T,
S53N+P55S/T, C56S/T, L57N+G59S/T, G59N+S61T; G60S/T, S61N+K63S/T,
K63N+D65S/T, D65N+N67S/T, I66N+S68S/T, Y69S/T, Y69N+C71S/T,
S68N+E70S/T, E70N+W72S/T, W72N+P74S/T, P74N+G76S/T, F75N,
G76N+E78T, E78N+K80T, F77T, F77N+G79S/T, G79N+N81S/T, K80N+C82S/T,
E83S/T, E83N+D85S/T, L84N+V86S/T, D85N, V86A, V86N+C88S/T,
T87N+N89S/T, 190N+N92S/T, K91S/T, I90N+N92S/T, K91N+G93S/T, R94S/T,
R94N+E96S/T, K100N, A103S/T, S102N+D104S/T, A103N+N105S/T,
D104N+K106S/T, V107S/T, K106N+V108S/T, V108N+V110S/T, S111N,
E113N+Y115S/T, G114N+R116S/T, R116N+A118S/T, E119N+Q121S/T,
K122S/T, Q121N+S123S/T, K122N+C124S/T S123N+E125S/T, E125N+A125S/T,
P126N+V128S/T, A127N+P129T, V128N+F130S/T, P129N+P131S/T,
F130N+C132S/T, R134N, V135N+V137S/T, S136N, S138N, V137N+Q139T;
Q139N, T140N+L142S/T, S141N+L143S/T, K142N, A146N+A148S/T,
E147N+V149S/T, T148N+F150S/T, V149N+P151S/T, F150N+D152S/T,
P151N+V153S/T, D152N+D154S/T, V153N+Y155S/T, D154N+V156S/T,
Y155N+N157S/T, V156N, S158N+E160S/T, T159N+A161S/T, E160N+E162S/T,
A161N, E162N+I164S/T, T163N+L165S/T, I164N+D166S/T, L165N+N167S/T,
D166N+I168S/T, I168N+Q170S/T, T169N, Q170N, S171N+Q173S/T, T172N,
Q173N+F175S/T, S174N+N176S/T, F175N+D177S/T, F178S/T, D177N, D177E,
F178N+R180S/T, T179N+V181S/T, R180N+V182S/T, G183+E185S/T,
G184N+D186T, E185N+A187S/T, D186N+K188S/T, A187N+P189T,
K188N+G190S/T, P189N+Q181S/T, G200N+V202T, K201N+D203S/T, K201T,
V202N+A204S/T, D203N+F205S/T, E213N+W215S/T, K214T, V223T,
E224N+G226S/T, T225N+V227S/T, G226N+K228S/T, V227N+I229T, K228N,
H236N+I238T; I238N+E240T; E239N, E240N+E242S/T, E242N,
T241N+H243S/T, H243N+E245S/T, K247N+N249S/T, V250N+R252T, I251 S/T,
I251N+I253S/T, R252N+I254S/T, I253N+P255S/T, P255N+H257S/T,
H257N+Y259S/T, N260S/T, A262S/T, A261N+I263S/T, A262N+N264S/T,
I263N+K265S/T, K265N+N267S/T, A266N+H268S/T, D276N+P278S/T,
P278N+V280S/T, E277N+L279S/T, V280N+N282S/T, Y284S/T,
S283N+V285S/T, Y284N, D292N+K294S/T, K293N+Y295S/T, E294N, F299S/T,
I298N+L300S/T, K301N+G303S/T, F302N, G303N+G305S/T, S304N+Y306S/T,
Y306N+S308S/T, R312N+F314S/T, V313N+H315T, F314N+K316S/T,
H315N+G317S/T, K316N+R138S/T, G317N, R318N+A320S/T, S319N+L321S/T,
A320N+V322T, L321N+L323S/T, V322N+Q324S/T, Y325N+R327S/T,
R327N+P329S/T, P329N+V331S/T, L330N+D332S/T, D332N+A334S/T, R333N,
A334N+C336S/T, T335N+L337S/T, L337N, R338N, S339N+K341T,
T340N+F342T; K341N, F342N+I344S/T, T343N+Y345S/T, Y345N+N347S/T,
M348S/T, G352N+H354T, F353N, F353N+E355T, H354N+G356S/T, H354V,
H354I, E355T, E355N+G357S/T, G356N+R358T, G357N+D359S/T, R358N,
Q362N+D364S/T, V370N; T371V; T371I; E372T, E372N+E374S/T, E374N,
G375N, W385N+E387T; G386N+E388T, E388N+A390S/T, A390N+K392T,
M391N+G393S/T, K392N+K394S/T, K392V, G393T, G393N+Y395S/T,
K394N+G396S/T, R403N+V405S/T, I408S/T, K409N+K411S/T, E410N,
K411N+K413S/T, and K413N.
[0415] e. Modifications to Increase Resistance to Proteases
[0416] Modified FIX polypeptides provided herein also can contain
additional modifications that result in increased resistance of the
polypeptide to proteases. For example, amino acid substitutions can
be made that remove one or more potential proteolytic cleavage
sites. The modified FIX polypeptides can thus be made more
resistant to proteases, thereby increasing the stability and
half-life of the modified polypeptide.
[0417] Examples of additional modifications that can be included in
the modified FIX polypeptides provided herein to increase
resistance to proteases include, but are not limited to, those
described in U.S. Patent Publication No. 20080102115 and
International Published Application No. WO2007149406. Exemplary
modifications that can be included in a modified FIX polypeptide
provided herein to increase protease resistance include, but are
not limited to, Y1H, Y1I, S3Q, S3H, S3N, G4Q, G4H, G4N, K5N, K5Q,
L61, L6V, E7Q, E7H, E7N, E8Q, E8H, E8N, F9I, F9V, V10Q, V10H, V10N,
G12Q, G12H, G12N, L14I, L14V, E15Q, E15H, E15N, R16H, R16Q, E17Q,
E17H, E17N, M19I, M19V, E20Q, E20H, E20N, E21Q, E21H, E21N, K22N,
K22Q, S24Q, S24H, S24N, F25I, F25V, E26Q, E26H, E26N, E27Q, E27H,
E27N, A28Q, A28H, A28N, R29H, R29Q, E30Q, E30H, E30N, V31Q, V31H,
V31N, F32I, F32V, E33Q, E33H, E33N, T35Q, T35H, T35N, E36Q, E36H,
E36N, R37H, R37Q, T38Q, T381I, T38N, T39Q, T39H, T39N, E40Q, E40H,
E40N, F41I, F41V, W42S, W42H, K43N, K43Q, Y45H, Y45I, V46Q, V46H,
V46N, D47N, D47Q, G48Q, G48H, G48N, D49N, D49Q, E52Q, E52H, E52N,
S53Q, S53H, S53N, P55A, P55S, L571, L57V, N58Q, N58S, G59Q, G59H,
G59N, G60Q, G60H, G60N, S61Q, S61H, S61N, K63N, K63Q, D64N, D64Q,
D65N, D65Q, I66Q, I66H, I66N, S68Q, S681I, S68N, Y691I, Y69I, E70Q,
E70H, E70N, W72S, W72H, P74A, P74S, F75I, F75V, G76Q, G76H, G76N,
F771, F77V, E78Q, E78H, E78N, G79Q, G79H, G79N, K80N, K80Q, E83Q,
E83H, E83N, L841, L84V, D85N, D85Q, V86Q, V86H, V86N, T87Q, T87H,
T87N, 190Q, I90H, I90N, K91N, K91Q, N92Q, N92S, G93Q, G93H, G93N,
R94H, R94Q, E96Q, E96H, E96N, F98I, F98V, K100N, K100Q, S102Q,
S102H, S102N, A103Q, A103H, A103N, D104N, D104Q, K106N, K106Q,
V107Q, V107H, V107N, V108Q, V108H, V108N, S110Q, S110H, S110N,
T112Q, T112H, T112N, E113Q, E113H, E113N, G114Q, G114H, G114N,
Y115H, Y115I, R116H, R116Q, L117I, L117V, A118Q, A118H, A118N,
E119Q, E119H, E119N, K122N, K122Q, S123Q, S123H, S123N, E125Q,
E125H, E125N, P126A, P126S, A127Q, A127H, A127N, V128Q, V128H,
V128N, P129A, P129S, P131A, P131S, G133Q, G133H, G133N, R134H,
R134Q, V135Q, V135H, V135N, S136Q, S136H, S136N, V137Q, V137H,
V137N, S138Q, S138H, S138N, T140Q, T140H, T140N, S141Q, S141H,
S141N, K142N, K142Q, L143I, L143V, T144Q, T144H, T144N, R145H,
R145Q, A146Q, A146H, A146N, E147Q, E147H, E147N, T148Q, T148H,
T148N, V149Q, V149H, V149N, P151A, P151S, D152N, D152Q, V153Q,
V153H, V153N, D154N, D154Q, Y155H, Y155I, V156Q, V156H, V156N,
S158Q, S158H, S158N, T159Q, T159H, T159N, E160Q, E160H, E160N,
A161Q, A161H, A161N, E162Q, E162H, E162N, T163Q, T163H, T163N,
I164Q, I164H, I164N, L165I, L165V, L165Q, L165H, D166N, D166Q,
I168Q, I168H, I168N, T169Q, T169H, T169N, S171Q, S171H, S171N,
T172Q, T172H, T172N, S174Q, S174H, S174N, F175I, F175V, F175H,
D177N, D177Q, F178I, F178V, F178H, T179Q, T179H, T179N, R180H,
R180Q, V181Q, V181H, V181N, V182Q, V182H, V182N, G183Q, G183H,
G183N, G184Q, G184H, G184N, E185Q, E185H, E185N, D186N, D186Q,
A187Q, A187H, A187N, K188N, K188Q, P189A, P189S, G190Q, G190H,
G190N, F192I, F192V, F192H, P193A, P193S, W194S, W194H, W194I,
V196Q, V196H, V196N, V197Q, V197H, V197N, L198I, L198V, L198Q,
L198H, N199Q, N199S, G200Q, G200H, G200N, K201N, K201Q, V202Q,
V202H, V202N, D203N, D203Q, A204Q, A204H, A204N, F205I, F205V,
G207Q, G207H, G207N, G208Q, G208H, G208N, S209Q, S209H, S209N,
I210Q, I210H, I210N, V211Q, V211H, V211N, E213Q, E213H, E213N,
K214N, K214Q, W215S, W215H, I216Q, I216H, I216N, V217Q, V217H,
V217N, T218Q, T218H, T218N, A219Q, A219H, A219N, A220Q, A220H,
A220N, V223Q, V223H, V223N, E224Q, E224H, E224N, T225Q, T225H,
T225N, G226Q, G226H, G226N, V227Q, V227H, V227N, K228N, K228Q,
I229Q, I229H, I229N, T230Q, T230H, T230N, V231Q, V231H, V231N,
V232Q, V232H, V232N, A233Q, A233H, A233N, G234Q, G234H, G234N,
E235Q, E235H, E235N, I238Q, I238H, I238N, E239Q, E239H, E239N,
E240Q, E240H, E240N, T241Q, T241H, T241N, E242Q, E242H, E242N,
T244Q, T244H, T244N, E245Q, E245H, E245N, K247N, K247Q, R248H,
R248Q, V250Q, V250H, V250N, I251Q, I251H, I251N, R252H, R252Q,
I253Q, I253H, I253N, I254Q, I254H, I254N, P255A, P255S, Y259H,
Y259I, A261Q, A261H, A261N, A262Q, A262H, A262N, I263Q, I263H,
I263N, K265N, K265Q, Y266H, Y266I, D269N, D269Q, I270Q, I270H,
I270N, A271Q, A271H, A271N, L272I, L272V, L273I, L273V, E274Q,
E274H, E274N, L275I, L275V, D276N, D276Q, E277Q, E277H, E277N,
P278A, P278S, L279I, L279V, V280Q, V280H, V280N, L281I, L281V,
S283Q, S283H, S283N, Y284H, Y284I, V285Q, V285H, V285N, T286Q,
T286H, T286N, P287A, P287S, I288Q, I288H, I288N, I290Q, I290H,
I290N, A291Q, A291H, A291N, D292N, D292Q, K293N, K293Q, E294Q,
E294H, E294N, Y295H, Y295I, T296Q, T296H, T296N, I298Q, I298H,
I298N, F299I, F299V, L300I, L300V, K301N, K301Q, F302I, F302V,
G303Q, G303H, G303N, S304Q, S304H, S304N, G305Q, G305H, G305N,
Y306H, Y306I, V307Q, V307H, V307N, S308Q, S308H, S308N, G309Q,
G309H, G309N, W310S, W310H, G311Q, G311H, G311N, R312H, R312Q,
V313Q, V313H, V313N, F314I, F314V, K316N, K316Q, G317Q, G317H,
G317N, R318H, R318Q, S319Q, S319H, S319N, A320Q, A320H, A320N,
L321I, L321V, V322Q, V322H, V322N, L323I, L323V, Y325H, Y325I,
L326I, L326V, R327H, R327Q, V328Q, V328H, V328N, P329A, P329S,
L330I, L330V, V331Q, V331H, V331N, D332N, D332Q, R333H, R333Q,
A334Q, A334H, A334N, T335Q, T335H, T335N, L337I, L337V, R338H,
R338Q, S339Q, S339H, S339N, T340Q, T340H, T340N, K341N, K341Q,
F342I, F342V, T343Q, T343H, T343N, I344Q, I344H, I344N, Y345H,
Y345I, M348I, M348V, F349I, F349V, A351Q, A351H, A351N, G352Q,
G352H, G352N, F353I, F353V, E355Q, E355H, E355N, G356Q, G356H,
G356N, G357Q, G357H, G357N, R358H, R358Q, D359N, D359Q, S360Q,
S360H, S360N, G363Q, G363H, G363N, D364N, D364Q, S365Q, S365H,
S365N, G366Q, G366H, G366N, G367Q, G367H, G367N, P368A, P368S,
V370Q, V370H, V370N, T371Q, T371H, T371N, E372Q, E372H, E372N,
V373Q, V373H, V373N, E374Q, E374H, E374N, G375Q, G375H, G375N,
T376Q, T376H, T376N, S377Q, S377H, S377N, F378I, F378V, L379I,
L379V, T380Q, T380H, T380N, G381Q, G381H, G381N, I382Q, I382H,
I382N, I383Q, I383H, I383N, S384Q, S384H, S384N, W385S, W385H,
G386Q, G386H, G386N, E387Q, E387H, E387N, E388Q, E388H, E388N,
A390Q, A390H, A390N, M391I, M391V, K392N, K392Q, G393Q, G393H,
G393N, K394N, K394Q, Y395H, Y395I, G396Q, G396H, G396N, I397Q,
I397H, I397N, Y398H, Y398I, T399Q, T399H, T399N, K400N, K400Q,
V401Q, V401H, V401N, S402Q, S402H, S402N, R403H, R403Q, Y404H,
Y404I, V405Q, V405H, V405N, W407S, W407H, I408Q, I408H, I408N,
K409N, K409Q, E410Q, E410H, E410N, K411N, K411Q, T412Q, T412H,
T412N, K413N, K413Q, L414I, L414V, T415Q, T415H, and T415N
(numbering corresponding to a mature FIX polypeptide set forth in
SEQ ID NO:3).
[0418] f. Modifications to Reduce Immunogenicity
[0419] Further modifications to a modified FIX polypeptide provided
herein can include modifications of at least one amino acid residue
resulting in a substantial reduction in activity of or elimination
of one or more T cell epitopes from the protein, i.e.
deimmunization of the polypeptide. One or more amino acid
modifications at particular positions within any of the MHC class
II ligands can result in a deimmunized FIX polypeptide with reduced
immunogenicity when administered as a therapeutic to a subject,
such as for example, a human subject. For example, any one or more
modifications disclosed in U.S. Patent Publication No. 20040254106
can be included in the modified FIX polypeptide provided herein to
reduce immunogenicity.
[0420] Exemplary amino acid modifications that can contribute to
reduced immunogenicity of a FIX polypeptide include any one or more
amino acid modifications corresponding to any one or more of the
following modifications: Y1A, Y1C, Y1D, Y1E, Y1G, Y1H, Y1K, Y1N,
Y1P, Y1Q, Y1R, Y1S, Y1T, S3T, L6A, L6C, L6D, L6E, L6G, L6H, L6K,
L6N, L6P, L6Q, L6R, L6S, L6T, L6M, F9A, F9C, F9D, F9E, F9G, F9H,
F9K, F9N, F9P, F9Q, F9R, F9S, F9T, F9I, F9M, F9W, V10A, V10C, V10D,
V10E, V10G, V10H, V10K, V10N, V10P, V10Q, V10R, V10S, V10T, V10F,
V10I, V10M, V10W, V10Y, Q11A, Q11C, Q11G, Q11P, G12D, G12E, G12G,
G12H, G12K, G12N, G12P, G12Q, G12R, G12S, G12T, N13A, N13C, N13G,
N13H, N13P, N13T, L14A, L14C, L14D, L14E, L14G, L14H, L14K, L14N,
L14P, L14Q, L14R, L14S, L14T, L14F, L141, L14M, L14V, L14W, L14Y,
E15D, E15H, E15P, R16A, R16c, R16G, R16P, R16T, E17A, E17C, E17G,
E17P, E17T, C18D, C18E, C18G, C18H, C18K, C18N, C18P, C18Q, C18R,
C18S, C18T, M19A, M19C, M19D, M19E, M19G, M19H, M19K, M19N, M19P,
M19Q, M19R, M19S, M19T, M19F, M19I, M19M, M19V, M19W, M19Y, E20A,
E20C, E20G, E20P, E20T, E21A, E21C, E21G, E21P, K22H, K22P, K22T,
S24H, S24P, F25A, F25C, F25D, F25E, F25G, F25H, F25K, F25N, F25P,
F25Q, F25R, F25S, F25T, F25I, F25M, F25W, F25Y, E26A, E26C, E26G,
E26P, E27A, E27C, E27G, E27H, E27P, E27S, E27T, A28C, A28D, A28E,
A28G, A28H, A28K, A28N, A28P, A28Q, A28R, A28S, A28T, R29A, R29c,
R29G, R29P, E30D, E30H, E30P, V31A, V31C, V31D, V31E, V31G, V31H,
V31K, V31N, V31P, V31Q, V31R, V31S, V31T, V31F, V31I, V31W, V31Y,
F32A, F32C, F32D, F32E, F32G, F32H, F32K, F32N, F32P, F32Q, F32R,
F32S, F32T, E33H, E33N, E33P, E33Q, E33S, E33T, T35A, T35C, T35G,
T35P, F41A, F41C, F41D, F41E, F41G, F41H, F41K, F41N, F41P, F41Q,
F41R, F41S, F41T, F41M, F41W, F41Y, W42A, W42C, W42D, W42E, W42G,
W42H, W42K, W42N, W42P, W42Q, W42R, W42S, W42T, K43A, K43C, K43G,
K43P, Q44P, Q44T, Q44, Y45A, Y45C, Y45D, Y45E, Y45G, Y45H, Y45K,
Y45N, Y45P, Y45Q, Y45R, Y45S, Y45T, V46A, V46C, V46D, V46E, V46G,
V46H, V46K, V46N, V46P, V46Q, V46R, V46S, V46T, V46F, V46I, V46M,
V46W, V46Y, D47A, D47C, D47G, D47H, D47P, D47T, G48D, G48E, G48P,
G48T, D49H, D49P, D49Q, D49T, Q50A, Q50C, Q50D, Q50G, Q50H, Q50P,
Q50T, C51D, C51E, C51G, C51H, C51K, C51N, C51P, C51Q, C51R, C51S,
C51T, E52P, E52T, S53A, S53C, S53G, S53H, S53P, S53T, N54H, N54P,
N54T, L57A, L57C, L57D, L57E, L57G, L57H, L57K, L57N, L57P, L57Q,
L57R, L57S, L57T, L57F, L571, L57M, L57W, L57Y, G60C, G60D, G60H,
G60P, G60T, C62D, C62H, C62P, K63T, D65H, D65T, I66A, I66C, I66D,
I66E, I66G, I66H, I66K, I66N, 166P, I66Q, I66R, 166S, I66T, I66M,
I66W, I66Y, Y69A, Y69C, Y69D, Y69E, Y69G, Y69H, Y69K, Y69N, Y69P,
Y69Q, Y69R, Y69S, Y69T, C71H, C71P, W72A, W72C, W72D, W72E, W72G,
W72H, W72K, W72N, W72P, W72Q, W72R, W72S, W72T, W721, W72Y, F75A,
F75C, F75D, F75E, F75G, F75H, F75K, F75N, F75P, F75Q, F75R, F75S,
F75T, F77A, F77C, F77D, F77E, F77G, F77H, F77K, F77N, F77P, F77Q,
F77R, F77S, F77T, L84A, L84C, L84D, L84E, L84G, L84H, L84K, L84N,
L84P, L84Q, L84R, L84S, L84T, L84M, L84W, L84Y, V86A, V86C, V86D,
V86E, V86G, V86H, V86K, V86N, V86P, V86Q, V86R, V86S, V86T, I90A,
I90C, I90D, I90E, I90G, I90H, I90K, I90N, I90P, I90Q, I90R, I90S,
I90T, I90M, I90W, K91A, K91C, K91G, K91P, N92A, N92C, N92G, N92P,
N92T, G93D, G93E, G93H, G93K, G93N, G93P, G93Q, G93R, G93S, G93T,
R94A, R94c, R94G, R94P, C95D, C95E, C95G, C95H, C95K, C95N, C95P,
C95Q, C95R, C95S, C95T, E96P, E96T, Q97A, Q97C, Q97G, Q97P, F98A,
F98C, F98D, F98E, F98G, F98H, F98K, F98N, F98P, F98Q, F98R, F98S,
F98T, F98M, F98W, F98Y, K100A, K100C, K100G, K100P, N101H, N101T,
A103D, A103E, A103H, A103K, A103N, A103P, A103Q, A103R, A103S,
A103T, D104T, K106H, K106P, K106T, V107A, V107C, V107D, V107E,
V107G, V107H, V107K, V107N, V107P, V107Q, V107R, V107S, V107T,
V108A, V108C, V108D, V108E, V108G, V108H, V108K, V108N, V108P,
V108Q, V108R, V108S, V108T, V108F, V108M, V108W, V108Y, S110A,
S110C, S110G, S110P, C111D, C111E, C111H, C111K, C111N, C111P,
C111Q, C111R, C111S, C111T, T112A, T112C, T112G, T112P, E113D,
E113H, E113P, G114D, G114E, G114H, G114K, G114N, G114P, G114Q,
G114R, G114S, G114T, Y115A, Y115C, Y115D, Y115E, Y115G, Y115H,
Y115K, Y115N, Y115P, Y115Q, Y115R, Y115S, Y115T, Y115M, Y115W,
R116P, R116T, L117A, L117C, L117D, L117E, L117G, L117H, L117K,
L117N, L117P, L117Q, L117R, L117S, L117T, A118D, A118E, A118H,
A118K, A118N, A118P, A118Q, A118R, A118S, A118T, N120D, N120H,
N120P, Q121T, S123H, S123T, V128A, V128C, V128D, V128E, V128G,
V128H, V128K, V128N, V128P, V128Q, V128R, V128S, V128T, F130A,
F130C, F130D, F130E, F130G, F130H, F130K, F130N, F130P, F130Q,
F130R, F130S, F130T, V135A, V135C, V135D, V135E, V135G, V135H,
V135K, V135N, V135P, V135Q, V135R, V135S, V135T, V135W, V135Y,
V137A, V137C, V137D, V137E, V137G, V137H, V137K, V137N, V137P,
V137Q, V137R, V137S, V137T, V137M, V137W, V137Y, S138H, S138T,
T140D, T140H, S141T, K142H, K142P, L143A, L143C, L143D, L143E,
L143G, L143H, L143K, L143N, L143P, L143Q, L143R, L143S, L143T,
L143F, L143I, L143M, L143V, L143W, L143Y, R145H, R145P, R145T,
A146P, A146T, T148H, T148P, V149A, V149C, V149D, V149E, V149G,
V149H, V149K, V149N, V149P, V149Q, V149R, V149S, V149T, V149F,
V149I, V149M, V149W, V149Y, F150A, F150C, F150D, F150E, F150G,
F150H, F150K, F150N, F150P, F150Q, F150R, F150S, F150T, F150M,
F150W, F150Y, D152A, D152C, D152G, D152P, D152S, D152T, V153A,
V153C, V153D, V153E, V153G, V153H, V153K, V153N, V153P, V153Q,
V153R, V153S, V153T, V153F, V153I, V153M, V153W, V153Y, D154A,
D154C, D154G, D154P, D154Q, D154S, Y155A, Y155C, Y155D, Y155E,
Y155G, Y155H, Y155K, Y155N, Y155P, Y155Q, Y155R, Y155S, Y155T,
Y155M, Y155V, Y155W, V156A, V156C, V156D, V156E, V156G, V156H,
V156K, V156N, V156P, V156Q, V156R, V156S, V156T, V156I, V156M,
V156W, V156Y, N157A, N157C, N157G, N157H, N157P, N157Q, N157T,
S158H, S158P, S158T, T159A, T159C, T159G, T159P, E160A, E160C,
E160G, E160P, A161C, A161D, A161E, A161H, A161K, A161N, A161P,
A161Q, A161R, A161S, A161T, E162P, E162T, T163A, T163C, T163G,
T163P, I164A, I164C, I164D, I164E, I164G, I164H, I164K, I164N,
I164P, I164Q, I164R, I164S, I164T, L165A, L165C, L165D, L165E,
L165G, L165H, L165K, L165N, L165P, L165Q, L165R, L165S, L165T,
L165M, L165W, L165Y, I168A, I168C, I168D, I168E, I168G, I168H,
I168K, I168N, I168P, I168Q, I168R, I168S, I168T, F175A, F175C,
F175D, F175E, F175G, F175H, F175K, F175N, F175P, F175Q, F175R,
F175S, F175T, F178A, F178C, F178D, F178E, F178G, F178H, F178K,
F178N, F178P, F178Q, F178R, F178S, F178T, F178M, F178W, F178Y,
T179A, T179C, T179G, T179P, R180A, R180c, R180D, R180G, R180H,
R180P, V181A, V181C, V181D, V181E, V181G, V181H, V181K, V1'81N,
V181P, V181Q, V181R, V181S, V181T, V181F, V181I, V181M, V181W,
V181Y, V182A, V182C, V182D, V182E, V182G, V182H, V182K, V182N,
V182P, V182Q, V182R, V182S, V182T, V182F, V182I, V182M, V182W,
V182Y, G183D, G183E, G183H, G183K, G183N, G183P, G183Q, G183S,
G183T, G184D, G184E, G184H, G184K, G184N, G184P, G184Q, G184R,
G184S, G184T, E185A, E185C, E185G, E185H, E185P, E185T, D186A,
D186C, D186G, D186H, D186P, D186T, A187C, A187D, A187E, A187G,
A187H, A187K, A187N, A187P, A187Q, A187R, A187S, A187T, K188A,
K188C, K188G, K188H, K188P, K188T, G190D, G190E, G190H, G190K,
G190N, G190P, G190Q, G190R, G190S, G190T, F192A, F192C, F192D,
F192E, F192G, F192H, F192K, F192N, F192P, F192Q, F192R, F192S,
F192T, F192W, F192Y, W194A, W194C, W194D, W194E, W194G, W194H,
W194K, W194N, W194P, W194Q, W194R, W194S, W194T, Q195H, Q195P,
Q195T, V196A, V196C, V196D, V196E, V196G, V196H, V196K, V196N,
V196P, V196Q, V196R, V196S, V196T, V196F, V196I, V196M, V196W,
V196Y, V197A, V197C, V197D, V197E, V197G, V197H, V197K, V197N,
V197P, V197Q, V197R, V197S, V197T, V197F, V197I, V197M, V197W,
V197Y, L198A, L198C, L198D, L198E, L198G, L198H, L198K, L198N,
L198P, L198Q, L198R, L198S, L198T, L198I, L198Y, N199A, N199C,
N199G, N199H, N199P, N199S, N199T, G200P, G200T, K201A, K201C,
K201D, K201E, K201G, K201H, K201N, K201P, K201Q, K201S, K201T,
V202A, V202C, V202D, V202E, V202G, V202H, V202K, V202N, V202P,
V202Q, V202R, V202S, V202T, V202F, V202I, V202M, V202W, V202Y,
D203A, D203C, D203G, D203P, D203T, A204C, A204D, A204E, A204G,
A204H, A204K, A204N, A204P, A204Q, A204R, A204S, A204T, F205A,
F205C, F205D, F205E, F205G, F205H, F205K, F205N, F205P, F205Q,
F205R, F205S, F205T, F205M, F205V, F205W, F205Y, G207H, G207P,
G208C, G208D, G208E, G208H, G208K, G208N, G208P, G208Q, G208R,
G208S, G208T, S209A, S209C, S209G, S209P, I210A, I210C, I210D,
I210E, I210G, I210H, I210K, I210N, I210P, I210Q, I210R, I210S,
I210T, I210F, I210W, I210Y, V211A, V211C, V211D, V211E, V211G,
V211H, V211K, V211N, V211P, V211Q, V211R, V211S, V211T, V211F,
V211I, V211M, V211W, N212A, N212C, N212G, N212P, E213H, E213P,
E213S, E213T, K214T, W215A, W215C, W215D, W215E, W215G, W215H,
W215K, W215N, W215P, W215Q, W215R, W215S, W215T, I216A, I216C,
I216D, I216E, I216G, I216H, I216K, I216N, I216P, I216Q, I216R,
I216S, I216T, V217A, V217C, V217D, V217E, V217G, V217H, V217K,
V217N, V217P, V217Q, V217R, V217S, V217T, V217I, V217Y, A219H,
A219P, A219T, V223A, V223C, V223D, V223E, V223G, V223H, V223K,
V223N, V223P, V223Q, V223R, V223S, V223T, V223M, V223W, V223Y,
G226P, V227A, V227C, V227D, V227E, V227G, V227H, V227K, V227N,
V227P, V227Q, V227R, V227S, V227T, V227F, V227I, V227M, V227W,
V227Y, K228A, K228C, K228G, K228H, K228P, I229A, I229C, I229D,
I229E, I229G, I229H, I229K, I229N, I229P, I229Q, I229R, I229S,
I229T, I229M, I229W, I229Y, T230A, T230C, T230G, T230P, V231A,
V231C, V231D, V231E, V231G, V231H, V231K, V231N, V231P, V231Q,
V231R, V231S, V231T, V232A, V232C, V232D, V232E, V232G, V232H,
V232K, V232N, V232P, V232Q, V232R, V232S, V232T, V232F, V232I,
V232M, V232W, V232Y, A233C, A233D, A233E, A233G, A233H, A233K,
A233N, A233P, A233Q, A233R, A233S, A233T, A233V, G234D, G234E,
G234H, G234K, G234N, G234P, G234Q, G234R, G234S, G234T, E235H,
E235N, E235P, E235Q, E235S, E235T, H236A, H236C, H236G, H236P,
N237A, N237C, N237G, N237P, N237T, I238A, I238C, I238D, I238E,
I238G, I238H, I238K, I238N, I238P, I238Q, I238R, I238S, I238T,
E239A, E239C, E239G, E239P, E240H, E240T, V250A, V250C, V250D,
V250E, V250G, V250H, V250K, V250N, V250P, V250Q, V250R, V250S,
V250T, V250M, V250W, V250Y, I251A, I251C, I251D, I251E, I251G,
I251H, I251K, I251N, I251P, I251Q, I251R, I251S, I251T, I253A,
I253C, I253D, I253E, I253G, I253H, I253K, I253N, I253P, I253Q,
I253R, I253S, I253T, I253M, I253W, I253Y, I254A, I254C, I254D,
I254E, I254G, I254H, I254K, I254N, I254P, I254Q, I254R, I254S,
I254T, P255H, H256P, H256T, H257A, H257C, H257G, H257P, N258P,
N258T, Y259A, Y259C, Y259D, Y259E, Y259G, Y259H, Y259K, Y259N,
Y259P, Y259Q, Y259R, Y259S, Y259T, Y259M, Y259W, N260A, N260C,
N260G, N260P, A261D, A261E, A261H, A261K, A261N, A261P, A261Q,
A261R, A261S, A261T, A262C, A262D, A262E, A262G, A262H, A262K,
A262N, A262P, A262Q, A262R, A262S, A262T, I263A, I263C, I263D,
I263E, I263G, I263H, I263K, I263N, I263P, I263Q, I263R, I263S,
I263T, I263M, I263V, I263W, I263Y, N264A, N264C, N264D, N264G,
N264H, N264P, K265A, K265C, K265G, K265H, K265P, Y266A, Y266C,
Y266D, Y266E, Y266G, Y266H, Y266K, Y266N, Y266P, Y266Q, Y266R,
Y266S, Y266T, Y266M, Y266W, N267A, N267C, N267G, N267H, N267P,
N267T, H268P, D269A, D269C, D269E, D269G, D269H, D269N, D269P,
D269Q, D269S, D269T, I270A, I270C, I270D, I270E, I270G, I270H,
I270K, I270N, I270P, I270Q, I270R, I270S, I270T, I270M, I270W,
A271C, A271D, A271E, A271G, A271H, A271K, A271N, A271P, A271Q,
A271R, A271S, A271T, L272A, L272C, L272D, L272E, L272G, L272H,
L272K, L272N, L272P, L272Q, L272R, L272S, L272T, L272F, L273A,
L273C, L273D, L273E, L273G, L273H, L273K, L273N, L273P, L273Q,
L273R, L273S, L273T, L273F, L273I, L273M, L273V, L273W, L273Y,
E274A, E274C, E274G, E274P, E274T, L275A, L275C, L275D, L275E,
L275G, L275H, L275K, L275N, L275P, L275Q, L275R, L275S, L275T,
L275W, L275Y, D276P, D276S, D276T, E277A, E277C, E277G, E277P,
P278T, L279A, L279C, L279D, L279E, L279G, L279H, L279K, L279N,
L279P, L279Q, L279R, L279S, L279T, L279I, L279Y, V280A, V280C,
V280D, V280E, V280G, V280H, V280K, V280N, V280P, V280Q, V280R,
V280S, V280T, V280F, V280I, V280W, V280Y, L281A, L281C, L281D,
L281E, L281G, L281H, L281K, L281N, L281P, L281Q, L281R, L281S,
L281T, L281F, L281I, L281V, L281W, L281Y, S283A, S283C, S283G,
S283P, Y284A, Y284C, Y284D, Y284E, Y284G, Y284H, Y284K, Y284N,
Y284P, Y284Q, Y284R, Y284S, Y284T, Y284M, V285A, V285C, V285D,
V285E, V285G, V285H, V285K, V285N, V285P, V285Q, V285R, V285S,
V285T, V285M, V285W, V285Y, T286A, T286C, T286G, T286P, I288A,
I288C, I288D, I288E, I288G, I288H, I288K, I288N, I288P, I288Q,
I288R, I288S, I288T, C289D, C289H, C289P, I290A, I290C, I290D,
I290E, I290G, I290H, I290K, I290N, I290P, I290Q, I290R, I290S,
I290T, I290Y, A291D, A291E, A291H, A291K, A291N, A291P, A291Q,
A291R, A291S, A291T, D292A, D292C, D292G, D292P, D292T, K293H,
K293P, K293T, Y295A, Y295C, Y295D, Y295E, Y295G, Y295H, Y295K,
Y295N, Y295P, Y295Q, Y295R, Y295S, Y295T, Y295W, T296A, T296C,
T296G, T296P, N297A, N297C, N297G, N297P, I298A, I298C, I298D,
I298E, I298G, I298H, I298K, I298N, I298P, I298Q, I298R, I298S,
I298T, F299A, F299C, F299D, F299E, F299G, F299H, F299K, F299N,
F299P, F299Q, F299R, F299S, F299T, L300A, L300C, L300D, L300E,
L300G, L300H, L300K, L300N, L300P, L300Q, L300R, L300S, L300T,
L300F, L300I, L300M, L300V, L300W, L300Y, K301A, K301C, K301G,
K301P, K301T, F302A, F302C, F302D, F302E, F302G, F302H, F302K,
F302N, F302P, F302Q, F302R, F302S, F302T, G303H, G303P, G303T,
S304A, S304C, S304G, S304P, S304T, G305D, G305E, G305H, G305N,
G305P, G305Q, G305S, G305T, Y306A, Y306C, Y306D, Y306E, Y306G,
Y306H, Y306K, Y306N, Y306P, Y306Q, Y306R, Y306S, Y306T, V307A,
V307C, V307D, V307E, V307G, V307H, V307K, V307N, V307P, V307Q,
V307R, V307S, V307T, S308P, S308T, W310A, W310C, W310D, W310E,
W310G, W310H, W310K, W310N, W310P, W310Q, W310R, W310S, W310T,
G311H, V313A, V313C, V313D, V313E, V313G, V313H, V313K, V313N,
V313P, V313Q, V313R, V313S, V313T, F314A, F314C, F314D, F314E,
F314G, F314H, F314K, F314N, F314P, F314Q, F314R, F314S, F314T,
F314M, F314W, F314Y, H315A, H315C, H315G, H315P, K316A, K316C,
K316G, K316P, G317C, G317D, G317E, G317H, G317K, G317N, G317P,
G317Q, G317R, G317S, G317T, R318A, R318c, R318G, R318P, S319D,
S319H, S319N, S319P, S319Q, A320C, A320D, A320E, A320G, A320H,
A320K, A320N, A320P, A320Q, A320R, A320S, A320T, L321A, L321C,
L321D, L321E, L321G, L321H, L321K, L321N, L321P, L321Q, L321R,
L321S, L321T, V322A, V322C, V322D, V322E, V322G, V322H, V322K,
V322N, V322P, V322Q, V322R, V322S, V322T, V322W, V322Y, L323A,
L323C, L323D, L323E, L323G, L323H, L323K, L323N, L323P, L323Q,
L323R, L323S, L323T, L323F, L323I, L323M, L323V, L323W, L323Y,
Q324A, Q324C, Q324G, Q324P, Y325A, Y325C, Y325D, Y325E, Y325G,
Y325H, Y325K, Y325N, Y325P, Y325Q, Y325R, Y325S, Y325T, Y325W,
L326A, L326C, L326D, L326E, L326G, L326H, L326K, L326N, L326P,
L326Q, L326R, L326S, L326T, L326F, L326I, L326M, L326V, L326W,
L326Y, R327A, R327c, R327G, R327H, R327P, V328A, V328C, V328D,
V328E, V328G, V328H, V328K, V328N, V328P, V328Q, V328R, V328S,
V328T, V328F, V328I, V328M, V328W, V328Y, L330A, L330C, L330D,
L330E, L330G, L330H, L330K, L330N, L330P, L330Q, L330R, L330S,
L330T, L330F, L330I, L330V, L330W, L330Y, V331A, V331C, V331D,
V331E, V331G, V331H, V331K, V331N, V331P, V331Q, V331R, V331S,
V331T, V331F, V331I, V331M, V331W, V331Y, D332A, D332C, D332G,
D332P, R333A, R333c, R333D, R333E, R333G, R333H, R333N, R333P,
R333Q, R333R, R333S, R333T, A334C, A334D, A334E, A334G, A334H,
A334K, A334N, A334P, A334Q, A334R, A334S, A334T, T335A, T335C,
T335G, T335P, C336D, C336E, C336H, C336K, C336N, C336P, C336Q,
C336R, C336S, C336T, L337A, L337C, L337D, L337E, L337G, L337H,
L337K, L337N, L337P, L337Q, L337R, L337S, L337T, R338A, R338c,
R338G, R338P, S339P, S339T, K341A, K341C, K341G, K341P, F342A,
F342C, F342D, F342E, F342G, F342H, F342K, F342N, F342P, F342Q,
F342R, F342S, F342T, F342M, F342W, T343A, T343C, T343G, T343P,
I344A, I344C, I344D, I344E, I344G, I344H, I344K, I344N, I344P,
I344Q, I344R, I344S, I344T, Y345A, Y345C, Y345D, Y345E, Y345G,
Y345H, Y345K, Y345N, Y345P, Y345Q, Y345R, Y345S, Y345T, Y345M,
Y345W, N346A, N346C, N346G, N346P, N347H, N347P, M348A, M348C,
M348D, M348E, M348G, M348H, M348K, M348N, M348P, M348Q, M348R,
M348S, M348T, F349A, F349C, F349D, F349E, F349G, F349H, F349K,
F349N, F349P, F349Q, F349R, F349S, F349T, F349I, F349M, F349W,
F349Y, C350D, C350H, C350P, C350T, A351E, A351H, A351N, A351P,
A351Q, A351R, A351S, A351T, G352A, G352C, G352P, F353A, F353C,
F353D, F353E, F353G, F353H, F353K, F353N, F353P, F353Q, F353R,
F353S, F353T, F353I, F353M, F353W, H354A, H354C, H354G, H354P,
E355A, E355C, E355D, E355G, E355H, E355K, E355N, E355P, E355Q,
E355S, E355T, G356D, G356E, G356H, G356K, G356N, G356P, G356Q,
G356R, G356S, G356T, G357D, G357E, G357H, G357K, G357N, G357P,
G357Q, G357R, G357S, G357T, R358D, R358E, R358H, R358K, R358N,
R358P, R358Q, R358R, R358S, R358T, D359A, D359C, D359G, D359P,
D359Q, D359S, D359T, S360A, S360C, S360G, S360P, C361D, C361E,
C361H, C361K, C361N, C361P, C361Q, C361R, C361S, C361T, V370A,
V370C, V370D, V370E, V370G, V370H, V370K, V370N, V370P, V370Q,
V370R, V370S, V370T, V370W, V370Y, V373A, V373C, V373D, V373E,
V373G, V373H, V373K, V373N, V373P, V373Q, V373R, V373S, V373T,
V373F, V373I, V373M, V373W, E374A, E374C, E374G, E374P, G375H,
S377A, S377C, S377G, S377P, F378A, F378C, F378D, F378E, F378G,
F378H, F378K, F378N, F378P, F378Q, F378R, F378S, F378T, F378W,
L379A, L379C, L379D, L379E, L379G, L379H, L379K, L379N, L379P,
L379Q, L379R, L379S, L379T, L379I, L379M, L379W, L379Y, T380A,
T380C, T380G, T380P, G381D, G381E, G381H, G381K, G381N, G381P,
G381Q, G381R, G381S, G381T, I382A, I382C, I382D, I382E, I382G,
I382H, I382K, I382N, I382P, I382Q, I382R,
I382S, I382T, I382M, I382W, I382Y, I383A, I383C, I383D, I383E,
I383G, I383H, I383K, I383N, I383P, I383Q, I383R, I383S, I383T,
S384A, S384C, S384G, S384P, W385A, W385C, W385D, W385E, W385G,
W385H, W385K, W385N, W385P, W385Q, W385R, W385S, W385T, W385M,
E387A, E387C, E387G, E387H, E387P, E387T, E388H, E388N, E388P,
E388Q, E388T, A390C, A390D, A390E, A390G, A390H, A390K, A390N,
A390P, A390Q, A390R, A390S, M391A, M391C, M391D, M391E, M391G,
M391H, M391K, M391N, M391P, M391Q, M391R, M391S, M391T, M391F,
M391I, M391W, M391Y, K392A, K392C, K392G, K392P, G393C, G393D,
G393E, G393H, G393K, G393N, G393P, G393Q, G393R, G393S, G393T,
Y395A, Y395C, Y395D, Y395E, Y395G, Y395H, Y395K, Y395N, Y395P,
Y395Q, Y395R, Y395S, Y395T, Y398A, Y398C, Y398D, Y398E, Y398G,
Y398H, Y398K, Y398N, Y398P, Y398Q, Y398R, Y398S, Y398T, K400H,
V401A, V401C, V401D, V401E, V401G, V401H, V401K, V401N, V401P,
V401Q, V401R, V401S, V401T, V401F, V401I, V401M, V401W, V401Y,
S402A, S402C, S402G, S402P, R403A, R403c, R403G, R403P, R403T,
Y404A, Y404C, Y404D, Y404E, Y404G, Y404H, Y404K, Y404N, Y404P,
Y404Q, Y404R, Y404S, Y404T, V405A, V405C, V405D, V405E, V405G,
V405H, V405K, V405N, V405P, V405Q, V405R, V405S, V405T, V405W,
V405Y, N406F, N406H, N406I, N406L, N406P, N406W, N406Y, W407D,
W407E, W407F, W407H, W407I, W407K, W407N, W407P, W407Q, W407R,
W407S, W407T, W407Y, I408D, I408E, I408H, I408K, I408N, I408P,
I408Q, I408R, I408S, I408T, K409F, K409H, K409I, K409P, K409T,
K409V, K409W, K409Y, E410H, K411A, K411C, K411 G, K411I, K411P,
K411T, K411V, K411 W, K411Y or K413T, with numbering corresponding
to a mature FIX polypeptide set forth in SEQ ID NO: 3.
[0421] g. Exemplary Combination Modifications
[0422] Provided herein are modified FIX polypeptides that have two
or more modifications designed to affect one or more properties or
activities of an unmodified FIX polypeptide. In some examples, the
two or more modifications alter two or more properties or
activities of the FIX polypeptide. The modifications can be made to
the FIX polypeptides such that one or more of glycosylation,
resistance to AT-III, resistance to AT-III/heparin, resistance to
heparin, catalytic activity, binding to LRP, intrinsic activity,
phospholipid binding and/or affinity, resistance to proteases,
half-life and interaction with other factors or molecules, such as
FVIIIa and FX, is altered. Typically, the two or more modifications
are combined such that the resulting modified FIX polypeptide has
increased coagulant activity, increased duration of coagulant
activity, and/or an enhanced therapeutic index compared to an
unmodified FIX polypeptide. The modifications can include amino
acid substitution, insertion or deletion. The increased coagulant
activity, increased duration of coagulant activity, and/or an
enhanced therapeutic index of the modified FIX polypeptide
containing two or more modifications can be increased by at least
or at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, I40%,
150%, 160%, 170%, 180%, I90%, 200%, 300%, 400%, 500%, or more
compared to the activity of the starting or unmodified FIXa
polypeptide.
[0423] Provided herein are modified FIX polypeptides that contain
two or more modifications that are introduced into an unmodified
FIX polypeptide to alter one, two or more activities or properties.
The modified FIX polypeptides can contain 2, 3, 4, 5, 6 or more
modifications. For example, a modified FIX polypeptide provided
herein can contain the modifications to increase glycosylation by
incorporating a non-native glycosylation site into the primary
sequence, such as amino acid substitutions D203N and F205T to
introduce a non-native glycosylation site at position 203, and a
modification to increase resistance to AT-III/heparin, such as
R338E (residues corresponding to a mature FIX polypeptide set forth
in SEQ ID NO:3).
[0424] Modified FIX polypeptides provided herein can have two or
more modifications selected solely from those set forth in Tables
3-9. In other examples, the modified FIX polypeptide contains two
or more modifications where one or more modifications are selected
from those set forth in Tables 3-9 and one or more modifications
are additional modifications that are not set forth in Tables 3-9,
such as, for example, modifications described in the art. In some
examples, the one or more additional modifications can be selected
from those set forth in Section D.3.a-f, above, such as those that
result in increased catalytic activity, increased resistance to
inhibitors, increased affinity and/or binding to platelets and
phospholipids, increased protease resistance, decreased
immunogenicity, and those that facilitate conjugation to moieties,
such as PEG moieties.
[0425] Non-limiting exemplary combination modifications are
provided in Table 10. These exemplary combination modifications
include two or more modifications that are designed to alter two or
more activities or properties of a FIX polypeptide, including, but
not limited to, increased resistance to AT-III, increased
resistance to AT-III/heparin, increased resistance to heparin,
increased catalytic activity and altered glycosylation. Modified
FIX polypeptides containing such combination modifications can have
increased coagulant activity, increased duration of coagulant
activity, and/or an enhanced therapeutic index. In Table 10 below,
the sequence identifier (SEQ ID NO) is identified in which
exemplary amino acid sequences of the modified FIX polypeptide are
set forth.
TABLE-US-00011 TABLE 10 Mutation Mutation SEQ (Mature FIX
Numbering) (Chymotrypsin Numbering) ID NO R318Y/E410N R150Y/E240N
153 R338E/E410N R170E/E240N 154 R338E/R403E/E410N R170E/R233E/E240N
155 D203N/F205T/K228N D39N/F41T/K63N 157 D203N/F205T/E410N
D39N/F41T/E240N 158 D203N/F205T/R338E D39N/F41T/R170E 159
D203N/F205T/R338A D39N/F41T/R170A 160 D203N/F205T/R318Y
D39N/F41T/R150Y 161 D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E
162 K228N/E410N K63N/E240N 163 K228N/R338E K63N/R170E 164
K228N/R338A K63N/R170A 165 K228N/R318Y K63N/R150Y 166
K228N/R338E/R403E K63N/R170E/R233E 167 R403E/E410N R233E/E240N 168
R318Y/R338E/E410N R150Y/R170E/E240N 169 K228N/R318Y/E410N
K63N/R150Y/E240N 170 R318Y/R403E/E410N R150Y/R233E/E240N 171
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N 172
D203N/F205T/R318Y/E410N D39N/F41T/R150Y/E240N 173 F314N/K316S
F145N/K148S 177 A103N/N105S/K228N A[103]N/N[105]S/K63N 217
D104N/K106S/K228N D[104]N/K[106]S/K63N 218 K228N/I251S K63N/I86S
180 A103N/N105S/I251S A[103]N/N[105]S/I86S 181 D104N/K106S/I251S
D[104]N/K[106]S/I86S 182 A103N/N105S/R318Y/R338E/R403E/
A[103]N/N[105]S/R150Y/R170E/ 219 E410N R233E/E240N
D104N/K106S/R318Y/R338E/R403E/ D[104]N/K[106]S/R150Y/R170E/ 220
E410N R233E/E240N K228N/R318Y/R338E/R403E/E410N
K63N/R150Y/R170E/R233E/E240N 221 I251S/R318Y/R338E/R403E/E410N
I86S/R150Y/R170E/R233E/E240N 222 D104N/K106S/I251S/R318Y/R338E/
D[104]N/K[106]S/I86S/R150Y/ 223 R403E/E410N R170E/R233E/E240N
D104N/K106S/R318Y/R338E/E410N D[104]N/K[106]S/R150Y/R170E/ 224
E240N I251S/R318Y/R338E/E410N I86S/R150Y/R170E/E240N 225
D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/R150Y/R170E/ 226
R338E/E410N E240N A103N/N105S/K247N/N249S A[103]N/N[105]S/K82N/N84S
178 D104N/K106S/K247N/N249S D[104]N/K[106]S/K82N/N84S 179
K228N/K247N/N249S K63N/K82N/N84S 183 A103N/N105S/Y155F
A[103]N/N[105]S/Y[155]F 227 D104N/K106S/Y155F
D[104]N/K[106]S/Y[155]F 228 Y155F/K228N Y[155]F/K63N 229
Y155F/I251S Y[155]F/I86S 230 Y155F/K247N/N249S Y[155]F/K82N/N84S
231 A103N/N105S/K247N/N249S/R318Y/ A[103]N/N[105]S/K82N/N84S/R150Y/
232 R338E/R403E/E410N R170E/R233E/E240N D104N/K106S/K247N/N249S/
D[104]N/K[106]S/K82N/N84S/R150Y/ 233 R318Y/R338E/R403E/E410N
R170E/R233E/E240N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/ 234 R403E/E410N R233E/E240N
A103N/N105S/Y155F/R318Y/R338E/ A[103]N/N[105]S/Y[155]F/R150Y/ 235
R403E/E410N R170E/R233E/E240N D104N/K106S/Y155F/R318Y/R338E/
D[104]N/K[106]S/Y[155]F/R150Y/ 236 R403E/E410N R170E/R233E/E240N
Y155F/K228N/R318Y/R338E/R403E/ Y[155]F/K63N/R150Y/R170E/R233E/ 237
E410N E240N Y155F/I251S/R318Y/R338E/R403E/
Y[155]F/I86S/R150Y/R170E/R233E/ 238 E410N E240N
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 239
R403E/E410N R233E/E240N K247N/N249S/R318Y/R338E/R403E/
K82N/N84S/R150Y/R170E/R233E/ 240 E410N E240N
Y155F/R318Y/R338E/R403E/E410N Y[155]F/R150Y/R170E/R233E/E240N 241
K247N/N249S/R318Y/R338E/E410N K82N/N84S/R150Y/R170E/E240N 242
Y155F/R318Y/R338E/E410N Y[155]F/R150Y/R170E/E240N 243
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 244
E410N E240N D104N/K106S/Y155F/K228N/K247N/
D[104]N/K[106]S/Y[155]F/K63N/ 245 N249S K82N/N84S
D104N/K106S/Y155F/K247N/N249S D[104]N/K[106]S/Y[155]F/K82N/ 246
N84S D104N/K106S/Y155F/K228N D[104]N/K[106]S/Y[155]F/K63N 247
Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 248
D104N/K106S/K228N/K247N/N249S D[104]N/K[106]S/K63N/K82N/N84S 184
R318Y/R338E/R403E/E410S R150Y/R170E/R233E/E240S 249
R318Y/R338E/R403E/E410N/T412V R150Y/R170E/R233E/E240N/T242V 250
R318Y/R338E/R403E/E410N/T412A R150Y/R170E/R233E/E240N/T242A 251
R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 252
R318Y/R338E/E410S R150Y/R170E/E240S 253 R318Y/R338E/T412A
R150Y/R170E/T242A 254 R318Y/R338E/E410N/T412V
R150Y/R170E/E240N/T242V 255 D85N/K228N/R318Y/R338E/R403E/
D[85]N/K63N/R150Y/R170E/R233E/ 256 E410N E240N
N260S/R318Y/R338E/R403E/E410N N95S/R150Y/R170E/R233E/E240N 257
R318Y/R338E/N346D/R403E/E410N R150Y/R170E/N178D/R233E/E240N 258
Y155F/N346D Y[155]F/N178D 259 Y155F/R318Y/R338E/N346D/R403E/
Y[155]F/R150Y/R170E/N178D/R233E/ 260 E410N E240N Y155F/N260S/N346D
Y[155]F/N95S/N178D 261 K247N/N249S/N260S K82N/N84S/N95S 262
Y155F/N260S Y[155]F/N95S 263 K247N/N249S/N260S/R318Y/R338E/
K82N/N84S/N95S/R150Y/R170E/R233E/ 264 R403E/E410N E240N
D104N/K106S/N260S/R318Y/R338E/ D[104]N/K[106]S/N95S/R150Y/R170E/
265 R403E/E410N R233E/E240N Y155F/N260S/R318Y/R338E/R403E/
Y[155]F/N95S/R150Y/R170E/R233E/ 266 E410N E240N
R318Y/R338E/T343R/R403E/E410N R150Y/R170E/T175R/R233E/E240N 267
R338E/T343R R170E/T175R 268 D104N/K106S/Y155F/N260S
D[104]N/K[106]S/Y[155]F/N95S 269 Y155F/K247N/N249S/N260S
Y[155]F/K82N/N84S/N95S 270 D104N/K106S/K247N/N249S/N260S
D[104]N/K[106]S/K82N/N84S/N95S 271 D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/ 272 N260S N84S/N95S D104N/K106S/N260S
D[104]N/K[106]S/N95S 185 T343R/Y345T T175R/Y177T 215 R318Y/R338E
R150Y/R170E 188 Y259F/K265T/Y345T Y94F/K98T/Y177T 216
D104N/K106S/Y155F/K247N/N249S/ D[104]N/K[106]S/Y[155]F/K82N/ 326
R318Y/R338E/R403E/E410N N84S/R150Y/R170E/R233E/E240N
D104N/K106S/K228N/K247N/N249S/ D[104]N/K[106]S/K63N/K82N/N84S/ 327
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
Y155F/K228N/K247N/N249S/R318Y/ Y[155]F/K63N/K82N/N84S/R150Y/ 328
R338E/R403E/E410N R170E/R233E/E240N Y155F/K247N/N249S/N260S/R318Y/
Y[155]F/K82N/N84S/N95S/R150Y/ 329 R338E/R403E/E410N
R170E/R233E/E240N Y155F/R318Y/R338E/T343R/R403E/
Y[155]F/R150Y/R170E/T175R/R233E/ 330 E410N E240N
D104N/K106S/R318Y/R338E/T343R/ D[104]N/K[106]S/R150Y/R170E/ 331
R403E/E410N T175R/R233E/E240N T343R/N346Y T175R/N178Y 332
R318Y/R338E/N346Y/R403E/E410N R150Y/R170E/N178Y/R233E/E240N 333
R318Y/R338E/T343R/N346Y/R403E/ R150Y/R170E/T175R/N178Y/R233E/ 334
E410N E240N T343R/N346D T175R/N178D 335
R318Y/R338E/T343R/N346D/R403E/ R150Y/R170E/T175R/N178D/R233E/ 336
E410N E240N R318Y/R338E/Y345A/R403E/E410N
R150Y/R170E/Y177A/R233E/E240N 337 R318Y/R338E/Y345A/N346D/R403E/
R150Y/R170E/Y177A/N178D/R233E/ 338 E410N E240N
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 339
R403E R233E K247N/N249S/R318Y/R338E/R403E
K82N/N84S/R150Y/R170E/R233E 340 Y155F/K247N/N249S/R318Y/R403E/
Y[155]F/K82N/N84S/R150Y/R233E/ 341 E410N E240N
K247N/N249S/R318Y/R403E/E410N K82N/N84S/R150Y/R233E/E240N 342
Y155F/K247N/N249S/R338E/R403E/ Y[155]F/K82N/N84S/R170E/R233E/ 343
E410N E240N K247N/N249S/R338E/R403E/E410N
K82N/N84S/R170E/R233E/E240N 344 R318Y/R338E/T343R/R403E
R150Y/R170E/T175R/R233E 345 Y155F/R318Y/R338E/T343R/R403E
Y[155]F/R150Y/R170E/T175R/R233E 346 R318Y/R338E/T343R/E410N
R150Y/R170E/T175R/E240N 347 Y155F/R318Y/R338E/T343R/E410N
Y[155]F/R150Y/R170E/T175R/E240N 348 R318Y/T343R/R403E/E410N
R150Y/T175R/R233E/E240N 349 Y155F/R318Y/T343R/R403E/E410N
Y[155]F/R150Y/T175R/R233E/E240N 350 R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N 351 Y155F/R338E/T343R/R403E/E410N
Y[155]F/R170E/T175R/R233E/E240N 352 Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 353 T343R/R403E/E410N
T175R/R233E/E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/ 354 R403E/E410N R233E/E240N
K228N/I251S/R318Y/R338E/R403E/ K63N/I86S/R150Y/R170E/R233E/ 355
E410N E240N Y155F/K228N/I251S/R318Y/R338E/
Y[155]F/K63N/I86S/R150Y/R170E/ 356 R403E/E410N R233E/E240N
N260S/R318Y/R338E/T343R/R403E/ N95S/R150Y/R170E/T175R/R233E/ 357
E410N E240N Y155F/N260S/R318Y/R338E/T343R/
Y[155]F/N95S/R150Y/R170E/T175R/ 358 R403E/E410N R233E/E240N
K228N/K247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/ 359
T343R/R403E/E410N T175R/R233E/E240N Y155F/K228N/K247N/N249S/R318Y/
Y[155]F/K63N/K82N/N84S/R150Y/ 360 R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N Y155F/R338E/T343R/R403E
Y[155]F/R170E/T175R/R233E 361 R338E/T343R/R403E R170E/T175R/R233E
362 Y155F/R338E/T343R/R403E/E410S Y[155]F/R170E/T175R/R233E/E240S
363 Y155F/N260S/R338E/T343R/R403E Y[155]F/N95S/R170E/T175R/R233E
364 Y155F/I251S/R338E/T343R/R403E Y[155]F/I86S/R170E/T175R/R233E
365 R318Y/R338E/T343R/R403E/E410S R150Y/R170E/T175R/R233E/E240S 366
Y155F/K247N/N249S/T343R/R403E Y[155]F/K82N/N84S/T175R/R233E 367
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 368
T343R/R403E T175R/R233E K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/ 369 R403E R233E
Y155F/K247N/N249S/R338E/T343R/ Y[155]F/K82N/N84S/R170E/T175R/ 370
R403E/E410N R233E/E240N K247N/N249S/R338E/T343R/R403E/
K82N/N84S/R170E/T175R/R233E/ 371 E410N E240N
Y155F/K247N/N249S/R318Y/R338E Y[155]F/K82N/N84S/R150Y/R170E 372
Y155F/K247N/N249S/R318Y/T343R Y[155]F/K82N/N84S/R150Y/T175R 373
Y155F/K247N/N249S/R318Y/R403E Y[155]F/K82N/N84S/R150Y/R233E 374
Y155F/K247N/N249S/R318Y/E410N Y[155]F/K82N/N84S/R150Y/E240N 375
Y155F/K247N/N249S/R338E/R403E Y[155]F/K82N/N84S/R170E/R233E 376
Y155F/K247N/N249S/R338E/T343R Y[155]F/K82N/N84S/R170E/T175R 377
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 378
T343R/E410N T175R/E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/ 379 E410N E240N
Y155F/K247N/N249S/R318Y/T343R/ Y[155]F/K82N/N84S/R150Y/T175R/ 380
R403E/E410N R233E/E240N K247N/N249S/R318Y/T343R/R403E/
K82N/N84S/R150Y/T175R/R233E/ 381 E410N E240N
Y155F/K247N/N249S/R338E/E410N Y[155]F/K82N/N84S/R170E/E240N 382
Y155F/K247N/N249S/R318Y/T343R/ Y[155]F/K82N/N84S/R150Y/T175R/ 383
R403E R233E K247N/N249S/R318Y/T343R/R403E
K82N/N84S/R150Y/T175R/R233E 384 Y155F/K247N/N249S/R318Y/T343R/
Y[155]F/K82N/N84S/R150Y/T175R/ 385 E410N E240N
K247N/N249S/R318Y/T343R/E410N K82N/N84S/R150Y/T175R/E240N 386
Y155F/K247N/N249S/R338E/T343R/ Y[155]F/K82N/N84S/R170E/T175R/ 387
R403E R233E K247N/N249S/R338E/T343R/R403E
K82N/N84S/R170E/T175R/R233E 388 Y155F/K247N/N249S/R338E/T343R/
Y[155]F/K82N/N84S/R170E/T175R/ 389 E410N E240N
K247N/N249S/R338E/T343R/E410N K82N/N84S/R170E/T175R/E240N 390
Y155F/K247N/N249S/T343R/R403E/ Y[155]F/K82N/N84S/T175R/R233E/ 391
E410N E240N K247N/N249S/T343R/R403E/E410N
K82N/N84S/T175R/R233E/E240N 392 Y155F/R318Y/R338E/T343R
Y[155]F/R150Y/R170E/T175R 393 R318Y/R338E/T343R R150Y/R170E/T175R
394 Y155F/R318Y/T343R/R403E Y[155]F/R150Y/T175R/R233E 395
Y155F/T343R/R403E/E410N Y[155]F/T175R/R233E/E240N 396
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 397
T343R T175R K247N/N249S/R318Y/R338E/T343R
K82N/N84S/R150Y/R170E/T175R 398 Y155F/K247N/N249S/T343R/E410N
Y[155]F/K82N/N84S/T175R/E240N 399 Y155F/K247N/N249S/R403E/E410N
Y[155]F/K82N/N84S/R233E/E240N 400 Y155F/R338E/T343R/E410N
Y[155]F/R170E/T175R/E240N 401 R338E/T343R/E410N R170E/T175R/E240N
402 Y155F/R318Y/T343R/E410N Y[155]F/R150Y/T175R/E240N 403
R318Y/T343R/E410N R150Y/T175R/E240N 404
K228N/R318Y/R338E/T343R/R403E/ K63N/R150Y/R170E/T175R/R233E/ 405
E410N E240N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/ 406 T343R/R403E T175R/R233E
K228N/K247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/ 407
T343R/E410N T175R/E240N K228N/K247N/N249S/R318Y/T343R/
K63N/K82N/N84S/R150Y/T175R/ 408 R403E/E410N R233E/E240N
Y155F/R338E/R403E/E410N Y[155]F/R170E/R233E/E240N 409
Y155F/R318Y/R338E/R403E Y[155]F/R150Y/R170E/R233E 410
Y155F/R318Y/R403E/E410N Y[155]F/R150Y/R233E/E240N 411
[0426] 3. Conjugates and Fusion Proteins
[0427] The modified FIX polypeptides provided herein can be
conjugated or fused to another polypeptide or other moiety, such as
a polymer. In some instances, the conjugation or fusion is effected
to increase serum half-life. Exemplary polypeptides to which the
modified FIX polypeptides provided herein can be fused include, but
are not limited to, serum albumin, Fc, FcRn and tranferrin (see,
e.g., Sheffield, W. P. et al., (2004) Br. J. Haematol.
126(4):565-73; U.S. Patent Publication No. 20050147618;
International Patent Publication Nos. WO2007112005 and
WO2004101740).
[0428] The modified FIX polypeptides provided herein can be
conjugated to a polymer, such as dextran, a polyethylene glycol
(pegylation(PEG)) or sialyl moiety, or other such polymers, such as
natural or sugar polymers. In one example, the polypeptides are
conjugated to dextrans, such as described elsewhere (Zambaux et
al., (1998) J. Protein Chem. 17(3):279-84). Various methods of
modifying polypeptides by covalently attaching (conjugating) a PEG
or PEG derivative (i.e. "PEGylation") are known in the art (see
e.g., US20060104968, U.S. Pat. No. 5,672,662, U.S. Pat. No.
6,737,505 and US20040235734). Techniques for PEGylation include,
but are not limited to, specialized linkers and coupling
chemistries (see e.g., Harris, Adv. Drug Deliv. Rev. 54:459-476,
2002), attachment of multiple PEG moieties to a single conjugation
site (such as via use of branched PEGs; see e.g., Veronese et al.,
Bioorg. Med. Chem. Lett. 12:177-180, 2002), site-specific
PEGylation and/or mono-PEGylation (see e.g., Chapman et al., Nature
Biotech. 17:780-783, 1999), site-directed enzymatic PEGylation (see
e.g., Sato, Adv. Drug Deliv. Rev., 54:487-504, 2002), and
glycoPEGylation (U.S. Patent Publication Nos. 20080050772,
20080146494, 20080050772, 20080187955 and 20080206808). Methods and
techniques described in the art can produce proteins having 1, 2,
3, 4, 5, 6, 7, 8, 9, 10 or more PEG or PEG derivatives attached to
a single protein molecule (see e.g., U.S. 2006/0104968). Thus, the
modified FIX polypeptide provided herein can be pegylated,
including glycopegylated, using any method known in the art, such
as any described in U.S. Pat. Nos. 5,969,040, 5,621,039, 6,423,826,
U.S. Patent Publication Nos. 20030211094, 20070254840, 20080188414,
2008000422, 20080050772, 20080146494, 20080050772, 20080187955 and
20080206808, International Patent Publication Nos. WO2007112005,
WO2007135182, WO2008082613, WO2008119815, WO2008119815.
[0429] In some instances, the modified FIX polypeptides include
amino acid replacements to facilitate conjugation to another
moiety. For example, cysteine residues can be incorporated into the
FIX polypeptide to facilitate conjugation to polymers. Exemplary
amino acid replacement modifications for this purpose include, but
are not limited to, D47C, Q50C, S53C, L57C, I66C, N67C, S68C, E70C,
W72C, P74C, K80C, L84C, V86C, N89C, I90C, K91C, R94c, K100C, N101C,
S102C, A103C, D104C, N105C, K106C, V108C, E114C, R116c, E119C,
N120C, Q121C, S123C, E125C, P129C, S138C, T140C, S141C, K142C,
A146C, E147C, E162C, T163C, I164C, L165C, D166C, N167C, I168C,
T169C, Q170C, S171C, T172C, Q173C, S174C, F175C, N176C, D177C,
F178C, T179C, R180c, E185C, D186C, K188C, P189C, K201C, V202C,
D203C, E224C, T225C, K228C, E239C, E240C, T241C, H243C, K247C,
N249C, R252c, H257C, N260C, A261C, A262C, I263C, K265C, E277C,
F314C, R318c, L321C, K341C, E372C, E374C, M391C, K392C, N406C,
K413C and T415C (corresponding to a mature FIX polypeptide set
forth in SEQ ID NO:3).
E. PRODUCTION OF FIX POLYPEPTIDES
[0430] FIX polypeptides, including modified FIX polypeptides, or
domains thereof, of FIX can be obtained by methods well known in
the art for protein purification and recombinant protein
expression. Any method known to those of skill in the art for
identification of nucleic acids that encode desired genes can be
used. Any method available in the art can be used to obtain a full
length (i.e., encompassing the entire coding region) cDNA or
genomic DNA clone encoding a FIX polypeptide or other vitamin-K
polypeptide, such as from a cell or tissue source, such as for
example from liver. Modified FIX polypeptides can be engineered as
described herein, such as by site-directed mutagenesis.
[0431] FIX can be cloned or isolated using any available methods
known in the art for cloning and isolating nucleic acid molecules.
Such methods include PCR amplification of nucleic acids and
screening of libraries, including nucleic acid hybridization
screening, antibody-based screening and activity-based
screening.
[0432] Methods for amplification of nucleic acids can be used to
isolate nucleic acid molecules encoding a FIX polypeptide,
including for example, polymerase chain reaction (PCR) methods. A
nucleic acid containing material can be used as a starting material
from which a FIX-encoding nucleic acid molecule can be isolated.
For example, DNA and mRNA preparations, cell extracts, tissue
extracts (e.g. from liver), fluid samples (e.g. blood, serum,
saliva), samples from healthy and/or diseased subjects can be used
in amplification methods. Nucleic acid libraries also can be used
as a source of starting material. Primers can be designed to
amplify a FIX-encoding molecule. For example, primers can be
designed based on expressed sequences from which a FIX is
generated. Primers can be designed based on back-translation of a
FIX amino acid sequence. Nucleic acid molecules generated by
amplification can be sequenced and confirmed to encode a FIX
polypeptide.
[0433] Additional nucleotide sequences can be joined to a
FIX-encoding nucleic acid molecule, including linker sequences
containing restriction endonuclease sites for the purpose of
cloning the synthetic gene into a vector, for example, a protein
expression vector or a vector designed for the amplification of the
core protein coding DNA sequences. Furthermore, additional
nucleotide sequences specifying functional DNA elements can be
operatively linked to a FIX-encoding nucleic acid molecule.
Examples of such sequences include, but are not limited to,
promoter sequences designed to facilitate intracellular protein
expression, and secretion sequences designed to facilitate protein
secretion. Additional nucleotide sequences such as sequences
specifying protein binding regions also can be linked to
FIX-encoding nucleic acid molecules. Such regions include, but are
not limited to, sequences to facilitate uptake of FIX into specific
target cells, or otherwise enhance the pharmacokinetics of the
synthetic gene.
[0434] The identified and isolated nucleic acids can then be
inserted into an appropriate cloning vector. A large number of
vector-host systems known in the art can be used. Possible vectors
include, but are not limited to, plasmids or modified viruses, but
the vector system must be compatible with the host cell used. Such
vectors include, but are not limited to, bacteriophages such as
lambda derivatives, or plasmids such as pBR322 or pUC plasmid
derivatives or the Bluescript vector (Stratagene, La Jolla,
Calif.). The insertion into a cloning vector can, for example, be
accomplished by ligating the DNA fragment into a cloning vector
which has complementary cohesive termini. Insertion can be effected
using TOPO cloning vectors (Invitrogen, Carlsbad, Calif.). If the
complementary restriction sites used to fragment the DNA are not
present in the cloning vector, the ends of the DNA molecules can be
enzymatically modified. Alternatively, any site desired can be
produced by ligating nucleotide sequences (linkers) onto the DNA
termini; these ligated linkers can contain specific chemically
synthesized oligonucleotides encoding restriction endonuclease
recognition sequences. In an alternative method, the cleaved vector
and FIX protein gene can be modified by homopolymeric tailing.
Recombinant molecules can be introduced into host cells via, for
example, transformation, transfection, infection, electroporation
and sonoporation, so that many copies of the gene sequence are
generated.
[0435] In specific embodiments, transformation of host cells with
recombinant DNA molecules that incorporate the isolated FIX protein
gene, cDNA, or synthesized DNA sequence enables generation of
multiple copies of the gene. Thus, the gene can be obtained in
large quantities by growing transformants, isolating the
recombinant DNA molecules from the transformants and, when
necessary, retrieving the inserted gene from the isolated
recombinant DNA.
[0436] 1. Vectors and Cells
[0437] For recombinant expression of one or more of the FIX
proteins, the nucleic acid containing all or a portion of the
nucleotide sequence encoding the FIX protein can be inserted into
an appropriate expression vector, i.e., a vector that contains the
necessary elements for the transcription and translation of the
inserted protein coding sequence. Exemplary of such a vector is any
mammalian expression vector such as, for example, pCMV. The
necessary transcriptional and translational signals also can be
supplied by the native promoter for a FIX genes, and/or their
flanking regions.
[0438] Also provided are vectors that contain nucleic acid encoding
the FIX or modified FIX. Cells containing the vectors also are
provided. The cells include eukaryotic and prokaryotic cells, and
the vectors are any suitable for use therein.
[0439] Prokaryotic and eukaryotic cells, including endothelial
cells, containing the vectors are provided. Such cells include
bacterial cells, yeast cells, fungal cells, Archea, plant cells,
insect cells and animal cells. The cells are used to produce a FIX
polypeptide or modified FIX polypeptide thereof by growing the
above-described cells under conditions whereby the encoded FIX
protein is expressed by the cell, and recovering the expressed FIX
protein. For purposes herein, the FIX can be secreted into the
medium.
[0440] In one embodiment, vectors containing a sequence of
nucleotides that encodes a polypeptide that has FIX activity and
contains all or a portion of the FIX polypeptide, or multiple
copies thereof, are provided. The vectors can be selected for
expression of the FIX polypeptide or modified FIX polypeptide
thereof in the cell or such that the FIX protein is expressed as a
secreted protein. When the FIX is expressed the nucleic acid is
linked to nucleic acid encoding a secretion signal, such as the
Saccharomyces cerevisiae .alpha.-mating factor signal sequence or a
portion thereof, or the native signal sequence.
[0441] A variety of host-vector systems can be used to express the
protein coding sequence. These include but are not limited to
mammalian cell systems infected with virus (e.g. vaccinia virus,
adenovirus and other viruses); insect cell systems infected with
virus (e.g. baculovirus); microorganisms such as yeast containing
yeast vectors; or bacteria transformed with bacteriophage, DNA,
plasmid DNA, or cosmid DNA. The expression elements of vectors vary
in their strengths and specificities. Depending on the host-vector
system used, any one of a number of suitable transcription and
translation elements can be used.
[0442] Any methods known to those of skill in the art for the
insertion of DNA fragments into a vector can be used to construct
expression vectors containing a chimeric gene containing
appropriate transcriptional/translational control signals and
protein coding sequences. These methods can include in vitro
recombinant DNA and synthetic techniques and in vivo recombinants
(genetic recombination). Expression of nucleic acid sequences
encoding a FIX polypeptide or modified FIX polypeptide, or domains,
derivatives, fragments or homologs thereof, can be regulated by a
second nucleic acid sequence so that the genes or fragments thereof
are expressed in a host transformed with the recombinant DNA
molecule(s). For example, expression of the proteins can be
controlled by any promoter/enhancer known in the art. In a specific
embodiment, the promoter is not native to the genes for a FIX
protein. Promoters which can be used include but are not limited to
the SV40 early promoter (Bemoist and Chambon, Nature 290:304-310
(1981)), the promoter contained in the 3' long terminal repeat of
Rous sarcoma virus (Yamamoto et al. Cell 22:787-797 (1980)), the
herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad.
Sci. USA 78:1441-1445 (1981)), the regulatory sequences of the
metallothionein gene (Minster et al., Nature 296:39-42 (1982));
prokaryotic expression vectors such as the .beta.-lactamase
promoter (Jay et al., (1981) Proc. Natl. Acad. Sci. USA 78:5543) or
the tac promoter (DeBoer et al., Proc. Natl. Acad. Sci. USA
80:21-25 (1983)); see also "Useful Proteins from Recombinant
Bacteria": in Scientific American 242:79-94 (1980)); plant
expression vectors containing the nopaline synthetase promoter
(Herrara-Estrella et al., Nature 303:209-213 (1984)) or the
cauliflower mosaic virus 35S RNA promoter (Garder et al, Nucleic
Acids Res. 9:2871 (1981)), and the promoter of the photosynthetic
enzyme ribulose bisphosphate carboxylase (Herrera-Estrella et al.,
Nature 310:115-120 (1984)); promoter elements from yeast and other
fungi such as the Gal4 promoter, the alcohol dehydrogenase
promoter, the phosphoglycerol kinase promoter, the alkaline
phosphatase promoter, and the following animal transcriptional
control regions that exhibit tissue specificity and have been used
in transgenic animals: elastase I gene control region which is
active in pancreatic acinar cells (Swift et al., Cell 38:639-646
(1984); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol.
50:399-409 (1986); MacDonald, Hepatology 7:425-515 (1987)); insulin
gene control region which is active in pancreatic beta cells
(Hanahan et al., Nature 315:115-122 (1985)), immunoglobulin gene
control region which is active in lymphoid cells (Grosschedl et
al., Cell 38:647-658 (1984); Adams et al., Nature 318:533-538
(1985); Alexander et al., Mol. Cell. Biol. 7:1436-1444 (1987)),
mouse mammary tumor virus control region which is active in
testicular, breast, lymphoid and mast cells (Leder et al., Cell
45:485-495 (1986)), albumin gene control region which is active in
liver (Pinkert et al., Genes and Devel. 1:268-276 (1987)),
alpha-fetoprotein gene control region which is active in liver
(Krumlauf et al., Mol. Cell. Biol. 5:1639-1648 (1985); Hammer et
al., Science 235:53-58 1987)), alpha-1 antitrypsin gene control
region which is active in liver (Kelsey et al., Genes and Devel.
1:161-171 (1987)), beta globin gene control region which is active
in myeloid cells (Magram et al., Nature 315:338-340 (1985); Kollias
et al., Cell 46:89-94 (1986)), myelin basic protein gene control
region which is active in oligodendrocyte cells of the brain
(Readhead et al., Cell 48:703-712 (1987)), myosin light chain-2
gene control region which is active in skeletal muscle (Shani,
Nature 314:283-286 (1985)), and gonadotrophic releasing hormone
gene control region which is active in gonadotrophs of the
hypothalamus (Mason et al., Science 234:1372-1378 (1986)).
[0443] In a specific embodiment, a vector is used that contains a
promoter operably linked to nucleic acids encoding a FIX
polypeptide or modified FIX polypeptide, or a domain, fragment,
derivative or homolog, thereof, one or more origins of replication,
and optionally, one or more selectable markers (e.g., an antibiotic
resistance gene). Vectors and systems for expression of FIX
polypeptides include the well known Pichia vectors (available, for
example, from Invitrogen, San Diego, Calif.), particularly those
designed for secretion of the encoded proteins. Exemplary plasmid
vectors for expression in mammalian cells include, for example,
pCMV. Exemplary plasmid vectors for transformation of E. coli
cells, include, for example, the pQE expression vectors (available
from Qiagen, Valencia, Calif.; see also literature published by
Qiagen describing the system). pQE vectors have a phage T5 promoter
(recognized by E. coli RNA polymerase) and a double lac operator
repression module to provide tightly regulated, high-level
expression of recombinant proteins in E. coli, a synthetic
ribosomal binding site (RBS II) for efficient translation, a
6.times.His tag coding sequence, t.sub.0 and T1 transcriptional
terminators, ColE1 origin of replication, and a beta-lactamase gene
for conferring ampicillin resistance. The pQE vectors enable
placement of a 6.times.His tag at either the N- or C-terminus of
the recombinant protein. Such plasmids include pQE 32, pQE 30, and
pQE 31 which provide multiple cloning sites for all three reading
frames and provide for the expression of N-terminally
6.times.His-tagged proteins. Other exemplary plasmid vectors for
transformation of E. coli cells, include, for example, the pET
expression vectors (see, U.S. Pat. No. 4,952,496; available from
NOVAGEN, Madison, Wis.; see, also literature published by Novagen
describing the system). Such plasmids include pET 11a, which
contains the T7 lac promoter, T7 terminator, the inducible E. coli
lac operator, and the lac repressor gene; pET 12a-c, which contains
the T7 promoter, T7 terminator, and the E. coli ompT secretion
signal; and pET 15b and pET19b (NOVAGEN, Madison, Wis.), which
contain a His-Tag.TM. leader sequence for use in purification with
a His column and a thrombin cleavage site that permits cleavage
following purification over the column, the T7-lac promoter region
and the T7 terminator.
[0444] 2. Expression Systems
[0445] FIX polypeptides (modified and unmodified) can be produced
by any methods known in the art for protein production including in
vitro and in vivo methods such as, for example, the introduction of
nucleic acid molecules encoding FIX into a host cell, host animal
and expression from nucleic acid molecules encoding FIX in vitro.
FIX and modified FIX polypeptides can be expressed in any organism
suitable to produce the required amounts and forms of a FIX
polypeptide needed for administration and treatment. Expression
hosts include prokaryotic and eukaryotic organisms such as E. coli,
yeast, plants, insect cells, mammalian cells, including human cell
lines and transgenic animals. Expression hosts can differ in their
protein production levels as well as the types of
post-translational modifications that are present on the expressed
proteins. The choice of expression host can be made based on these
and other factors, such as regulatory and safety considerations,
production costs and the need and methods for purification.
[0446] Expression in eukaryotic hosts can include expression in
yeasts such as Saccharomyces cerevisiae and Pichia pastoris, insect
cells such as Drosophila cells and lepidopteran cells, plants and
plant cells such as tobacco, corn, rice, algae, and lemna.
Eukaryotic cells for expression also include mammalian cells lines
such as Chinese hamster ovary (CHO) cells or baby hamster kidney
(BHK) cells. Eukaryotic expression hosts also include production in
transgenic animals, for example, including production in serum,
milk and eggs. Transgenic animals for the production of wild-type
FIX polypeptides are known in the art (U.S. Patent Publication Nos.
2002-0166130 and 2004-0133930) and can be adapted for production of
modified FIX polypeptides provided herein.
[0447] Many expression vectors are available and known to those of
skill in the art for the expression of FIX. The choice of
expression vector is influenced by the choice of host expression
system. Such selection is well within the level of skill of the
skilled artisan. In general; expression vectors can include
transcriptional promoters and optionally enhancers, translational
signals, and transcriptional and translational termination signals.
Expression vectors that are used for stable transformation
typically have a selectable marker which allows selection and
maintenance of the transformed cells. In some cases, an origin of
replication can be used to amplify the copy number of the vectors
in the cells.
[0448] FIX or modified FIX polypeptides also can be utilized or
expressed as protein fusions. For example, a fusion can be
generated to add additional functionality to a polypeptide.
Examples of fusion proteins include, but are not limited to,
fusions of a signal sequence, a tag such as for localization, e.g.
a his.sub.6 tag or a myc tag, or a tag for purification, for
example, a GST fusion, and a sequence for directing protein
secretion and/or membrane association.
[0449] In one embodiment, the FIX polypeptide or modified FIX
polypeptides can be expressed in an active form, whereby activation
is achieved by incubation of the polypeptide activated factor XI
(FXIa) following secretion. In another embodiment, the protease is
expressed in an inactive, zymogen form.
[0450] Methods of production of FIX polypeptides can include
coexpression of one or more additional heterologous polypeptides
that can aid in the generation of the FIX polypeptides. For
example, such polypeptides can contribute to the post-translation
processing of the FIX polypeptides. Exemplary polypeptides include,
but are not limited to, peptidases that help cleave FIX precursor
sequences, such as the propeptide sequence, and enzymes that
participate in the modification of the FIX polypeptide, such as by
glycosylation, hydroxylation, carboxylation, or phosphorylation,
for example. An exemplary peptidase that can be coexpressed with
FIX is PACE/furin (or PACE-SOL), which aids in the cleavage of the
FIX propeptide sequence. An exemplary protein that aids in the
carboxylation of the FIX polypeptide is the warfarin-sensitive
enzyme vitamin K 2,3-epoxide reductase (VKOR), which produces
reduced vitamin K for utilization as a cofactor by the vitamin
K-dependent .gamma.-carboxylase (Wajih et al., J. Biol. Chem.
280(36)31603-31607). A subunit of this enzyme, VKORC1, can be
coexpressed with the modified FIX polypeptide to increase the
.gamma.-carboxylation The one or more additional polypeptides can
be expressed from the same expression vector as the FIX polypeptide
or from a different vector.
[0451] a. Prokaryotic Expression
[0452] Prokaryotes, especially E. coli, provide a system for
producing large amounts of FIX (see, for example, Platis et al.
(2003) Protein Exp. Purif. 31(2): 222-30; and Khalilzadeh et al.
(2004) J. Ind. Microbiol. Biotechnol. 31(2): 63-69). Transformation
of E. coli is a simple and rapid technique well known to those of
skill in the art. Expression vectors for E. coli can contain
inducible promoters that are useful for inducing high levels of
protein expression and for expressing proteins that exhibit some
toxicity to the host cells. Examples of inducible promoters include
the lac promoter, the trp promoter, the hybrid tac promoter, the T7
and SP6 RNA promoters and the temperature regulated .lamda.P.sub.L
promoter.
[0453] FIX can be expressed in the cytoplasmic environment of E.
coli. The cytoplasm is a reducing environment and for some
molecules, this can result in the formation of insoluble inclusion
bodies. Reducing agents such as dithiothreitol and
.beta.-mercaptoethanol and denaturants (e.g., such as guanidine-HCl
and urea) can be used to resolubilize the proteins. An alternative
approach is the expression of FIX in the periplasmic space of
bacteria which provides an oxidizing environment and
chaperonin-like and disulfide isomerases leading to the production
of soluble protein. Typically, a leader sequence is fused to the
protein to be expressed which directs the protein to the periplasm.
The leader is then removed by signal peptidases inside the
periplasm. Examples of periplasmic-targeting leader sequences
include the pelB leader from the pectate lyase gene and the leader
derived from the alkaline phosphatase gene. In some cases,
periplasmic expression allows leakage of the expressed protein into
the culture medium. The secretion of proteins allows quick and
simple purification from the culture supernatant. Proteins that are
not secreted can be obtained from the periplasm by osmotic lysis.
Similar to cytoplasmic expression, in some cases proteins can
become insoluble and denaturants and reducing agents can be used to
facilitate solubilization and refolding. Temperature of induction
and growth also can influence expression levels and solubility.
Typically, temperatures between 25.degree. C. and 37.degree. C. are
used. Mutations also can be used to increase solubility of
expressed proteins. Typically, bacteria produce aglycosylated
proteins. Thus, for the production of the hyperglycosylated FIX
polypeptides provided herein, glycosylation can be added in vitro
after purification from host cells.
[0454] b. Yeast
[0455] Yeasts such as Saccharomyces cerevisiae, Schizosaccharomyces
pombe, Yarrowia lipolytica, Kluyveromyces lactis, and Pichia
pastoris are useful expression hosts for FIX (see for example,
Skoko et al. (2003) Biotechnol. Appl. Biochem. 38(Pt3):257-65).
Yeast can be transformed with episomal replicating vectors or by
stable chromosomal integration by homologous recombination.
Typically, inducible promoters are used to regulate gene
expression. Examples of such promoters include GAL1, GAL7, and GAL5
and metallothionein promoters such as CUP1. Expression vectors
often include a selectable marker such as LEU2, TRP1, HIS3, and
URA3 for selection and maintenance of the transformed DNA. Proteins
expressed in yeast are often soluble and co-expression with
chaperonins, such as Bip and protein disulfide isomerase, can
improve expression levels and solubility. Additionally, proteins
expressed in yeast can be directed for secretion using secretion
signal peptide fusions such as the yeast mating type alpha-factor
secretion signal from Saccharomyces cerevisiae and fusions with
yeast cell surface proteins such as the Aga2p mating adhesion
receptor or the Arxula adeninivorans glucoamylase. A protease
cleavage site (e.g., the Kex-2 protease) can be engineered to
remove the fused sequences from the polypeptides as they exit the
secretion pathway. Yeast also is capable of glycosylation at
Asn-X-Ser/Thr motifs.
[0456] c. Insects and Insect Cells
[0457] Insects and insect cells, particularly using a baculovirus
expression system, are useful for expressing polypeptides such as
FIX or modified forms thereof (see, for example, Muneta et al.
(2003) J. Vet. Med. Sci. 65(2):219-23). Insect cells and insect
larvae, including expression in the haemolymph, express high levels
of protein and are capable of most of the post-translational
modifications used by higher eukaryotes. Baculoviruses have a
restrictive host range which improves the safety and reduces
regulatory concerns of eukaryotic expression. Typically, expression
vectors use a promoter such as the polyhedrin promoter of
baculovirus for high level expression. Commonly used baculovirus
systems include baculoviruses such as Autographa californica
nuclear polyhedrosis virus (AcNPV), and the Bombyx mori nuclear
polyhedrosis virus (BmNPV) and an insect cell line such as Sf9
derived from Spodoptera frugzperda, Pseudaletia unipuncta (A7S) and
Danaus plexippus (DpN1). For high level expression, the nucleotide
sequence of the molecule to be expressed is fused immediately
downstream of the polyhedrin initiation codon of the virus.
Mammalian secretion signals are accurately processed in insect
cells and can be used to secrete the expressed protein into the
culture medium. In addition, the cell lines Pseudaletia unipuncta
(A7S) and Danaus plexippus (DpN1) produce proteins with
glycosylation patterns similar to mammalian cell systems.
[0458] An alternative expression system in insect cells is the use
of stably transformed cells. Cell lines such as the Schnieder 2
(S2) and Kc cells (Drosophila melanogaster) and C7 cells (Aedes
albopictus) can be used for expression. The Drosophila
metallothionein promoter can be used to induce high levels of
expression in the presence of heavy metal induction with cadmium or
copper. Expression vectors are typically maintained by the use of
selectable markers such as neomycin and hygromycin.
[0459] d. Mammalian Cells
[0460] Mammalian expression systems can be used to express FIX
polypeptides. Expression constructs can be transferred to mammalian
cells by viral infection such as adenovirus or by direct DNA
transfer such as liposomes, calcium phosphate, DEAE-dextran and by
physical means such as electroporation and microinjection.
Expression vectors for mammalian cells typically include an mRNA
cap site, a TATA box, a translational initiation sequence (Kozak
consensus sequence) and polyadenylation elements. Such vectors
often include transcriptional promoter-enhancers for high level
expression, for example the SV40 promoter-enhancer, the human
cytomegalovirus (CMV) promoter, and the long terminal repeat of
Rous sarcoma virus (RSV). These promoter-enhancers are active in
many cell types. Tissue and cell-type promoters and enhancer
regions also can be used for expression. Exemplary
promoter/enhancer regions include, but are not limited to, those
from genes such as elastase I, insulin, immunoglobulin, mouse
mammary tumor virus, albumin, alpha-fetoprotein, alpha
1-antitrypsin, beta-globin, myelin basic protein, myosin light
chain-2, and gonadotropic releasing hormone gene control.
Selectable markers can be used to select for and maintain cells
with the expression construct. Examples of selectable marker genes
include, but are not limited to, hygromycin B phosphotransferase,
adenosine deaminase, xanthine-guanine phosphoribosyl transferase,
aminoglycoside phosphotransferase, dihydrofolate reductase and
thymidine kinase. Fusion with cell surface signaling molecules such
as TCR-.zeta. and Fc.sub..epsilon.RI-.gamma. can direct expression
of the proteins in an active state on the cell surface.
[0461] Many cell lines are available for mammalian expression
including mouse, rat human, monkey, and chicken and hamster cells.
Exemplary cell lines include, but are not limited to, BHK (i.e.
BHK-21 cells), 293-F, CHO, CHO Express (CHOX; Excellgene),
Balb/3T3, HeLa, MT2, mouse NS0 (non-secreting) and other myeloma
cell lines, hybridoma and heterohybridoma cell lines, lymphocytes,
fibroblasts, Sp2/0, COS, NIH3T3, HEK293, 293S, 293T, 2B8, and HKB
cells. Cell lines also are available adapted to serum-free media
which facilitates purification of secreted proteins from the cell
culture media. One such example is the serum free EBNA-1 cell line
(Pham et al., (2003) Biotechnol. Bioeng. 84:332-42). Expression of
recombinant FIX polypeptides exhibiting similar structure and
post-translational modifications as plasma-derived FIX are known in
the art. Methods of optimizing vitamin K-dependent protein
expression are known. For example, supplementation of vitamin K in
culture medium or co-expression of vitamin K-dependent
.gamma.-carboxylases (Wajih et al., J. Biol. Chem.
280(36)31603-31607) can aid in post-translational modification of
vitamin K-dependent proteins, such as FIX polypeptides.
[0462] e. Plants
[0463] Transgenic plant cells and plants can be used for the
expression of FIX. Expression constructs are typically transferred
to plants using direct DNA transfer such as microprojectile
bombardment and PEG-mediated transfer into protoplasts, and with
agrobacterium-mediated transformation. Expression vectors can
include promoter and enhancer sequences, transcriptional
termination elements, and translational control elements.
Expression vectors and transformation techniques are usually
divided between dicot hosts, such as Arabidopsis and tobacco, and
monocot hosts, such as corn and rice. Examples of plant promoters
used for expression include the cauliflower mosaic virus promoter,
the nopaline synthase promoter, the ribose bisphosphate carboxylase
promoter and the ubiquitin and UBQ3 promoters. Selectable markers
such as hygromycin, phosphomannose isomerase and neomycin
phosphotransferase are often used to facilitate selection and
maintenance of transformed cells. Transformed plant cells can be
maintained in culture as cells, aggregates (callus tissue) or
regenerated into whole plants. Because plants have different
glycosylation patterns than mammalian cells, this can influence the
choice to produce FIX in these hosts. Transgenic plant cells also
can include algae engineered to produce proteins (see, for example,
Mayfield et al. (2003) Proc Natl Acad Sci USA 100:438-442). Because
plants have different glycosylation patterns than mammalian cells,
this can influence the choice to produce FIX in these hosts.
[0464] 2. Purification
[0465] Methods for purification of FIX polypeptides from host cells
depend on the chosen host cells and expression systems. For
secreted molecules, proteins are generally purified from the
culture media after removing the cells. For intracellular
expression, cells can be lysed and the proteins purified from the
extract. When transgenic organisms such as transgenic plants and
animals are used for expression, tissues or organs can be used as
starting material to make a lysed cell extract. Additionally,
transgenic animal production can include the production of
polypeptides in milk or eggs, which can be collected, and if
necessary further the proteins can be extracted and further
purified using standard methods in the art.
[0466] FIX can be purified using standard protein purification
techniques known in the art including but not limited to, SDS-PAGE,
size fraction and size exclusion chromatography, ammonium sulfate
precipitation, chelate chromatography and ionic exchange
chromatography. For example, FIX polypeptides can be purified by
anion exchange chromatography, such as described in Example 1,
below. Exemplary of a method to purify FIX polypeptides is by using
an ion exchange column that permits binding of any polypeptide that
has a functional Gla domain, followed by elution in the presence of
calcium. Affinity purification techniques also can be used to
improve the efficiency and purity of the preparations. For example,
antibodies, receptors and other molecules that bind FIX can be used
in affinity purification. Expression constructs also can be
engineered to add an affinity tag such as a myc epitope, GST fusion
or His.sub.6 and affinity purified with myc antibody, glutathione
resin, and Ni-resin, respectively, to a protein. Purity can be
assessed by any method known in the art including gel
electrophoresis and staining and spectrophotometric techniques.
[0467] The FIX polypeptide can be expressed and purified to be in
an inactive form (zymogen form) or alternatively the expressed
protease can be purified into an active form, such as by
autocatalysis. For example, FIX polypeptides that have been
activated via proteolytic cleavage after R145 and R180 can be
prepared in vitro (i.e. FIXa; two-chain form). The FIX polypeptides
can be first prepared by any of the methods of production described
herein, including, but not limited to, production in mammalian
cells followed by purification. Cleavage of the FIX polypeptides
into the active protease form, FIXa, can be accomplished by
incubation with factor XIa. In some examples, this is performed in
the presence of calcium and phospholipids.
[0468] 3. Fusion Proteins
[0469] Fusion proteins containing a modified FIX polypeptide and
one or more other polypeptides also are provided. Pharmaceutical
compositions containing such fusion proteins formulated for
administration by a suitable route are provided. Fusion proteins
are formed by linking in any order the modified FIX polypeptide and
an agent, such as an antibody or fragment thereof, growth factor,
receptor, ligand, and other such agent for the purposes of
facilitating the purification of a FIX polypeptide, altering the
pharmacodynamic properties of a FIX polypeptide by directing, for
example, by directing the polypeptide to a targeted cell or tissue,
and/or increasing the expression or secretion of the FIX
polypeptide. Typically any FIX fusion protein retains at least
about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% coagulant activity
compared with a non-fusion FIX polypeptide, including 96%, 97%,
98%, 99% or greater coagulant activity compared with a non-fusion
polypeptide.
[0470] Linkage of a FIX polypeptide with another polypeptide can be
effected directly or indirectly via a linker. In one example,
linkage can be by chemical linkage, such as via heterobifunctional
agents or thiol linkages or other such linkages. Fusion also can be
effected by recombinant means. Fusion of a FIX polypeptide to
another polypeptide can be to the N- or C-terminus of the FIX
polypeptide. Non-limiting examples of polypeptides that can be used
in fusion proteins with a FIX polypeptide provided herein include,
for example, a GST (glutathione S-transferase) polypeptide, Fc
domain from immunoglobulin G, albumin, or a heterologous signal
sequence. The fusion proteins can contain additional components,
such as E. coli maltose binding protein (MBP) that aid in uptake of
the protein by cells (see, International PCT application No. WO
01/32711).
[0471] A fusion protein can be produced by standard recombinant
techniques. For example, DNA fragments coding for the different
polypeptide sequences can be ligated together in-frame in
accordance with conventional techniques, e.g., by employing
blunt-ended or stagger-ended termini for ligation, restriction
enzyme digestion to provide for appropriate termini, filling-in of
cohesive ends as appropriate, alkaline phosphatase treatment to
avoid undesirable joining, and enzymatic ligation. In another
embodiment, the fusion gene can be synthesized by conventional
techniques including automated DNA synthesizers. Alternatively, PCR
amplification of gene fragments can be carried out using anchor
primers that give rise to complementary overhangs between two
consecutive gene fragments that can subsequently be annealed and
reamplified to generate a chimeric gene sequence (see, e.g.,
Ausubel et al. (eds.) Current Protocols in Molecular Biology, John
Wiley & Sons, 1992). Moreover, many expression vectors are
commercially available that already encode a fusion moiety (e.g., a
GST polypeptide). A FIX-encoding nucleic acid can be cloned into
such an expression vector such that the fusion moiety is linked
in-frame to the protease protein.
[0472] 4. Polypeptide Modification
[0473] Modified FIX polypeptides can be prepared as unmodified (or
naked) polypeptide chains or as posttranslationally modified
polypeptides. For some applications, it can be desirable to prepare
modified FIX in a "naked" form without post-translational or other
chemical modifications. Naked polypeptide chains can be prepared in
suitable hosts that do not post-translationally modify FIX. Such
polypeptides also can be prepared in in vitro systems and using
chemical polypeptide synthesis. For other applications, particular
modifications can be desired. In particular, for the purposes
herein, glycosylation of the modified FIX polypeptides to produce
hyperglycosylated FIX polypeptides is preferred. Such glycosylation
can be performed in vivo using an appropriate expression system,
such as a mammalian expression system, in vitro (see e.g. Mikami et
al. (2006) J. Biotechnol. 127:65-78), or a combination of in vivo
and in vitro methods in which, for example, the FIX polypeptide is
expressed in prokaryotic cells and further modified in vitro using
enzymatic transglycosylation (see e.g. Schwarz et al., (2010)
Nature Chem. Biol. 6:264-266). Additionally, pegylation,
albumination, carboxylation, hydroxylation, phosphorylation, or
other known modifications can be desired. Modifications can be made
in vitro or, for example, by producing the modified FIX in a
suitable host that produces such modifications.
[0474] 5. Nucleotide Sequences
[0475] Nucleic acid molecules encoding FIX or modified FIX
polypeptides are provided herein. Nucleic acid molecules include
allelic variants or splice variants of any encoded FIX polypeptide.
Exemplary of nucleic acid molecules provided herein are any that
encode a modified FIX polypeptide provided herein, such as any
encoding a polypeptide set forth in any of SEQ ID NOS:75-272. In
one embodiment, nucleic acid molecules provided herein have at
least 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, or 99%
sequence identity or hybridize under conditions of medium or high
stringency along at least 70% of the full-length of any nucleic
acid encoding a FIX polypeptide provided herein. For example, the
nucleic acid molecules provided herein have at least or at least
about 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, or 99%
sequence identity to the nucleic acid sequence set forth in SEQ ID
NO:1. In another embodiment, a nucleic acid molecule can include
those with degenerate codon sequences encoding any of the FIX
polypeptides provided herein.
F. ASSESSING MODIFIED FIX POLYPEPTIDE ACTIVITIES
[0476] The activities and properties of FIX polypeptides can be
assessed in vitro and/or in vivo. Assays for such assessment are
known to those of skill in the art and are known to correlate
tested activities and results to therapeutic and in vivo
activities. In one example, FIX variants can be assessed in
comparison to unmodified and/or wild-type FIX. Such assays can be
performed in the presence or absence of FVIIIa, phospholipids
and/or calcium. In vitro assays include any laboratory assay known
to one of skill in the art, such as for example, cell-based assays
including coagulation assays, binding assays, protein assays, and
molecular biology assays. In vivo assays include FIX assays in
animal models as well as administration to humans. In some cases,
activity of FIX polypeptides in vivo can be determined by assessing
blood, serum, or other bodily fluid for assay determinants. FIX
variants, such as those provided herein, also can be tested in vivo
to assess an activity or property, such as therapeutic effect.
[0477] Typically, assays described herein are with respect to the
two-chain activated form of FIX, i.e. FIXa. FIX polypeptides that
have been activated via proteolytic cleavage after R145 and R180
can be prepared in vitro. The FIX polypeptides can be first
prepared by any of the methods of production described herein,
including, but not limited to, production in mammalian cells
followed by purification. Cleavage of the FIX polypeptides into the
active protease form of FIX can be accomplished by incubation with
activated factor XI (FXIa). The activated polypeptides can be used
in any of the assays to measure FIX activities described herein.
Such assays also can be performed with the single chain zymogen
form. For example, a single chain zymogen FIX polypeptide can
provide a negative control since such a form typically does not
exhibit the proteolytic or catalytic activity required for the
coagulant activity of FIX. In addition, such assays also can be
performed in the presence of cofactors, such as FVIIIa, and other
molecules, such as phospholipids and/or calcium, which in can
augment the activity of FIX.
[0478] 1. In Vitro Assays
[0479] Exemplary in vitro assays include assays to assess
polypeptide modification and activity. Modifications can be
assessed using in vitro assays that assess glycosylation,
.gamma.-carboxylation and other post-translational modifications,
protein assays and conformational assays known in the art. Assays
for activity include, but are not limited to, measurement of FIX
interaction with other coagulation factors, such as FVIIIa and
factor X, proteolytic assays to determine the proteolytic activity
of FIX polypeptides, assays to determine the binding and/or
affinity of FIX polypeptides for phosphatidylserines and other
phospholipids, and cell based assays to determine the effect of FIX
polypeptides on coagulation.
[0480] Concentrations of modified FIX polypeptides can be assessed
by methods well-known in the art, including but not limited to,
enzyme-linked immunosorbant assays (ELISA), SDS-PAGE; Bradford,
Lowry, BCA methods; UV absorbance, and other quantifiable protein
labeling methods, such as, but not limited to, immunological,
radioactive and fluorescent methods and related methods. Assessment
of cleavage products of proteolysis reactions, including cleavage
of FIX polypeptides or products produced by FIX protease activity,
can be performed using methods including, but not limited to,
chromogenic substrate cleavage, HPLC, SDS-PAGE analysis, ELISA,
Western blotting, immunohistochemistry, immunoprecipitation,
NH.sub.2-terminal sequencing, fluorescence, and protein
labeling.
[0481] Structural properties of modified FIX polypeptides can also
be assessed. For example, X-ray crystallography, nuclear magnetic
resonance (NMR), and cryoelectron microscopy (cryo-EM) of modified
FIX polypeptides can be performed to assess three-dimensional
structure of the FIX polypeptides and/or other properties of FIX
polypeptides, such as Ca.sup.2+ or cofactor binding.
[0482] Additionally, the presence and extent of FIX degradation can
be measured by standard techniques such as sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE), and Western blotting
of electrophoresed FIX-containing samples. FIX polypeptides that
have been exposed to proteases also can be subjected to N-terminal
sequencing to determine location or changes in cleavage sites of
the modified FIX polypeptides.
[0483] a. Glycosylation
[0484] FIX polypeptides can be assessed for the presence of
glycosylation using methods well known in the art. Glycosylation of
a polypeptide can been characterized from its enzymatically or
chemically released carbohydrate pool, using a wide variety of
methods, such as high pH anion exchange chromatography (Townsend et
al., (1991) Glycobiology 1:139-147), or fluorophore-assisted
carbohydrate electrophoresis (FACE) (Kumar et al., (1996)
Biotechnol. Appl. Biochem. 24:207-214.), sequential exoglycosidase
digestions (Watzlawick et al., (1992) Biochemistry 31:12198-12203;
Tyagarajan et al., (1996) Glycobiology, 6:83-93), mass spectrometry
(Gillece-Castro et al., (1990) Meth. Enzymol. 193: 689-712; Duffin
et al., (1992) Anal. Chem. 64:1440-1448; Papac et al., (1997) in
Techniques in Glycobiology (Townsend R. R. and Hotchkiss A. T.
eds.) Marcel Decker, Inc., New York, pp. 33-52; Fu et al., (1994)
Carbohydr. Res. 261:173-186) and NMR (Fu et al., (1994) Carbohydr.
Res. 261:173-186).
[0485] For example, chemical release can be effected by
hydrazinolysis, which releases N- and O-linked glycans from
glycoproteins by incubation with anhydrous hydrazine. Enzymatic
release can be effected by the endoglycosidases peptide
N-glycosidase F (PNGase F), which removes unaltered most of the
common N-linked carbohydrates from the polypeptide while
hydrolyzing the originally glycosylated Asn residue to Asp.
Hydrazinolysis or endoglycosidase treatment of FIX polypeptides
generates a reducing terminus that can be tagged with a fluorophore
or chromophore label. Labeled FIX polypeptides can be analyzed by
fluorophore-assisted carbohydrate electrophoresis (FACE). The
fluorescent tag for glycans also can be used for monosaccharide
analysis, profiling or fingerprinting of complex glycosylation
patterns by HPLC. Exemplary HPLC methods include hydrophilic
interaction chromatography, electronic interaction, ion-exchange,
hydrophobic interaction, and size-exclusion chromatography.
Exemplary glycan probes include, but are not limited to,
3-(acetylamino)-6-aminoacridine (AA-Ac) and 2-aminobenzoic acid
(2-AA). Carbohydrate moieties can also be detected through use of
specific antibodies that recognize the glycosylated FIX
polypeptide.
[0486] In one method, mass spectrometry is used to assess
site-specific carbohydrate heterogeneity. This can involve
matrix-assisted laser desorption ionization mass spectrometry of
collected HPLC-fractions (Sutton et al., (1994) Anal. Biochem.
218:34-46; Ploug et al., (1998) J. Biol. Chem. 273:13933-13943), or
reversed phase HPLC directly coupled with electrospray ionization
mass spectrometry (LC/ESIMS) (see, e.g., Huddleston et al., (1993)
Anal. Chem. 65:877-884; Medzihradsky et al., (2008) Methods Mol.
Biol. 446:293-316). In one example, glycosylation at potential
N-glycosylation sites, such as an asparagine residue within an
Asn-X-Ser/Thr/Cys motif, is assessed by LC/ESIMS. The potential
N-glycosylation sites in a FIX polypeptide can be identified, and a
proteolytic enzyme can be selected that would separate these sites
on individual peptides. The digestion mixture is then analyzed by
LC/ESIMS, a method that generates diagnostic carbohydrate ions by
collisional activation (33). These diagnostic carbohydrate ions
include, for example, characteristic nonreducing end oxonium ions
at m/z 204, 274 and 292, 366, and 657, which indicate the presence
of N-acetylhexosamine, neuraminic (sialic) acid,
hexosyl-N-acetylhexosamine, and sialyl-hexosyl-Nacetylhexosamine,
respectively. In addition to identifying the presence of these ions
by selective ion monitoring (SIM), the LC/ESIMS method also
analyzes the peptide to assess the molecular weight, which can be
used to indicate which peptide, and, therefore, which potential
N-glycosylation site, contains the carbohydrate.
[0487] b. Other Post-Translational Modifications
[0488] FIX polypeptides can be assessed for the presence of
post-translational modifications other than glycosylation. Such
assays are known in the art and include assays to measure
hydroxylation, sulfation, phosphorylation and carboxylation. An
exemplary assay to measure .beta.-hydroxylation comprises reverse
phase HPLC analysis of FIX polypeptides that have been subjected to
alkaline hydrolysis (Przysiecki et al. (1987) PNAS 84:7856-7860).
Carboxylation and .gamma.-carboxylation of FIX polypeptides can be
assessed using mass spectrometry with matrix-assisted laser
desorption ionization time-of-flight (MALDI-TOF) analysis, as
described for other vitamin K-dependent polypeptides (se, e.g.
Harvey et al. J Biol Chem 278:8363-8369, Maun et al. Prot Sci
14:1171-1180). The interaction of a FIX polypeptide containing the
propeptide (pro-FIX) with the carboxylase responsible for
post-translational .gamma.-carboxylate modification also can be
assessed. The dissociation constant (K.sub.d) following incubation
of carboxylase with flourescein-labeled pro-FIX polypeptides can be
measured by determining the amount of bound carboxylase by
anisotropy (Lin et al. (2004) J Biol Chem 279:6560-6566). Other
exemplary assays to measure carboxylation include reverse phase
HPLC analysis of FIX polypeptides that have been subjected to
alkaline hydrolysis (Przysiecki et al. (1987) PNAS 84:
7856-7860).
[0489] Exemplary assays to measure phosphorylation include use of
phosphospecific antibodies to phospho-serine and/or -tyrosine amino
acid residues or to a serine-phosphorylated FIX polypeptide.
.sup.32P metabolic labeling of cells that produce the FIX
polypeptide also can be used to assess phosphorylation, wherein the
labeled FIX polypeptide can be purified and analyzed for
incorporation of radioactive phosphate. An exemplary assay for
tyrosine sulfation includes .sup.35S labeling of cells that produce
the FIX polypeptide. In such method, cells are incubated with
either .sup.35S--S.sub.2SO.sub.4 or .sup.35S-methionine and
incorporation of the .sup.35S is determined by normalization to the
.sup.35S-methionine sample.
[0490] c. Proteolytic Activity
[0491] Modified FIX polypeptides can be tested for proteolytic
activity towards both synthetic substrates and it's natural
substrate, Factor X. Activated forms of the modified FIX
polypeptides (FIXa) typically are used in the assay. Assays using a
synthetic substrate, such as a CH.sub.3SO.sub.2-LGR-pNA peptide,
can be employed to measure enzymatic cleavage activity of the FIXa
polypeptides. Hydrolysis of CH.sub.3SO.sub.2-LGR-pNA in the
presence of FIXa can be measured by assessing the production of
p-nitroanaline (pNA) from the cleavage reaction sample. The amount
of pNA in the sample is proportional to the absorbance of the
sample at 405 nm and thus indicates the extent of proteolytic
activity in the FIXa sample. Additional exemplary fluorogenic
substrates that can be used to assess FIXa cleavage activity
include, but are not limited to, Mes-D-CHD-Gly-Arg-AMC (Pefafluor
FIXa10148) and H-D-Leu-PHG-Arg-AMC (Pefafluor FIXa3688), wherein
cleavage is assessed by release of AMC, and the fluorogenic ester
substrate, 4-methylumbelliferyl p'-guanidinobenzoate (MUGB), where
cleavage is assessed by the release of 4-methylumbelliferone
fluorophore (4-MU) (see e.g. Example 3). Molecules that enhance
FIXa catalytic activity, such as ethylene glycol, can be employed
in such assays (Sturzebecher et al. (1997) FEBS Lett. (412)
295-300).
[0492] Proteolytic activity of FIXa also can be assessed by
measuring the conversion of factor X (FX) into activated factor X
(FXa), such as described in Example 4, below. FIXa polypeptides,
including the modified FIX polypeptides provided herein, can be
incubated with FX polypeptides in the presence of FVIIIa,
phospholipids vesicles (phosphatidylserine and/or
phosphatidylcholine) and Ca.sup.2+, and cleavage of FX to produce
FXa can be assayed using a fluorogenic substrate, such as
Spectrafluor FXa (CH.sub.3SO.sub.2-D-CHA-Gly-Arg-AMC), or a
chromogenic substrate, such as S2222 or S2765 (Chromogenics AB,
Molndal, Sweden), which are specifically cleaved by FXa.
[0493] d. Coagulation Activity
[0494] FIX polypeptides can be tested for coagulation activity by
using assays well known in the art. For example, some of the assays
include, but are not limited to, a two stage clotting assay
(Liebman et al., (1985) PNAS 82:3879-3883); the prothrombin time
assay (PT, which can measure TF-dependent activity of FIXa in the
extrinsic pathway); assays which are modifications of the PT test;
the activated partial thromboplastin time (aPTT, which can measure
TF-independent activity of FIXa); activated clotting time (ACT);
recalcified activated clotting time; the Lee-White Clotting time;
or thromboelastography (TEG) (Pusateri et al. (2005) Critical Care
9:S15-S24). For example, coagulation activity of a modified FIX
polypeptide can be determined by a PT-based assay where FIX is
diluted in FIX-deficient plasma, and mixed with prothrombin time
reagent (recombinant TF with phospholipids and calcium), such as
that available as Innovin.TM. from Dade Behring. Clot formation is
detected optically and time to clot is determined and compared
against FIX-deficient plasma alone. In vivo coagulation assays in
animal models, such as those described below, also can be performed
to assess the coagulation activity of FIX polypeptides.
[0495] e. Binding to and/or Inhibition by Other Proteins and
Molecules
[0496] Inhibition assays can be used to measure resistance of
modified FIX polypeptides to FIX inhibitors, such as, for example,
antithrombin III (AT-III), heparain, AT-III/heparin complex,
p-aminobenzamidine, serine protease inhibitors, and FIX-specific
antibodies. Assessment of inhibition to other inhibitors also can
be tested and include, but are not limited to, other serine
protease inhibitors. Inhibition can be assessed by incubation of
the inhibitor with FIX polypeptides that have been preincubated
with and/or without FVIIIa. The activity of FIX can then be
measured using any one or more of the activity or coagulation
assays described above, and inhibition by the inhibitor can be
assessed by comparing the activity of FIX polypeptides incubated
with the inhibitor, with the activity of FIX polypeptides that were
not incubated with the inhibitor. For example, the inhibition of
modified FIX polypeptides by AT-III/heparin can be assessed as
described in Example 5, below. Inhibition of wild-type FIXa or FIXa
variants by the AT-III/heparin complex is assessed by incubating
AT-III/heparin with FIXa and the measuring the catalytic activity
of FIXa towards a small molecule substrate, Mesyl-D-CHG-Gly-Arg-AMC
(Pefafluor FIXa; Pentapharm). Such assays can be performed in the
presence or absence of FVIIIa.
[0497] FIX polypeptides also can be tested for binding to other
coagulation factors and inhibitors. For example, FIX direct and
indirect interactions with cofactors, such as FVIIIa, substrates,
such as FX and FIX, and inhibitors, such as antithrombin III and
heparin, can be assessed using any binding assay known in the art,
including, but not limited to, immunoprecipitation, column
purification, non-reducing SDS-PAGE, BIAcore.RTM. assays, surface
plasmon resonance (SPR), fluorescence resonance energy transfer
(FRET), fluorescence polarization (FP), isothermal titration
calorimetry (ITC), circular dichroism (CD), protein fragment
complementation assays (PCA), Nuclear Magnetic Resonance (NMR)
spectroscopy, light scattering, sedimentation equilibrium,
small-zone gel filtration chromatography, gel retardation,
Far-western blotting, fluorescence polarization, hydroxyl-radical
protein footprinting, phage display, and various two-hybrid
systems.
[0498] e. Phospholipid Affinity
[0499] Modified FIX polypeptide binding and/or affinity for
phosphatidylserine (PS) and other phospholipids can be determined
using assays well known in the art. Highly pure phospholipids (for
example, known concentrations of bovine PS and egg
phosphatidylcholine (PC), which are commercially available, such as
from Sigma, in organic solvent can be used to prepare small
unilamellar phospholipid vesicles. FIX polypeptide binding to these
PS/PC vesicles can be determined by relative light scattering at
90.degree. to the incident light. The intensity of the light
scatter with PC/PS alone and with PC/PS/FIX is measured to
determine the dissociation constant (Harvey et al., (2003) J. Biol.
Chem. 278:8363-8369). Surface plasma resonance, such as on a
BIAcore biosensor instrument, also can be used to measure the
affinity of FIX polypeptides for phospholipid membranes (Sun et
al., (2003) Blood 101:2277-2284).
[0500] 2. Non-Human Animal Models
[0501] Non-human animal models can be used to assess activity and
stability of modified FIX polypeptides. For example, non-human
animals can be used as models for a disease or condition. Non-human
animals can be injected with disease and/or phenotype-inducing
substances prior to administration of FIX variants to monitor the
effects on disease progression. Genetic models also are useful.
Animals, such as mice, can be generated which mimic a disease or
condition by the overexpression, underexpression or knock-out of
one or more genes. Such animals can be generated by transgenic
animal production techniques well-known in the art or using
naturally-occurring or induced mutant strains. Examples of useful
non-human animal models of diseases associated with FIX include,
but are not limited to, models of bleeding disorders, in particular
hemophilia. These non-human animal models can be used to monitor
activity of FIX variants compared to a wild type FIX
polypeptide.
[0502] Animal models also can be used to monitor stability,
half-life, clearance, and other pharmacokinetic and pharmacodynamic
properties of modified FIX polypeptides. Such assays are useful for
comparing modified FIX polypeptides and for calculating doses and
dose regimens for further non-human animal and human trials. For
example, a modified FIX polypeptide can be injected into the tail
vein of mice. Blood samples are then taken at time-points after
injection (such as minutes, hours and days afterwards) and then the
pharmacokinetic and pharmacodynamic properties of the modified FIX
polypeptides assessed, such as by monitoring the serum or plasma at
specific time-points for FIXa activity and protein concentration by
ELISA or radioimmunoassay (see e.g. Example 6). Blood samples also
can be tested for coagulation activity in methods, such as the aPTT
assay (see e.g.
Example 6
[0503] Modified FIX polypeptides can be tested for therapeutic
effectiveness using animal models for hemophilia. In one
non-limiting example, an animal model such as a mouse can be used.
Mouse models of hemophilia are available in the art and include FIX
deficient mice (such as those utilized in Example 7, below) and
mice expressing mutant FIX polypeptides, and can be employed to
test modified FIX polypeptides (Wang et al., (1997) PNAS
94:11563-11566; Lin et al., (1997) Blood 90:3962-3966; Kundu et
al., (1998) Blood 92: 168-174; Sabatino et al., (2004) Blood
104(9):2767-2774; and Jin et al., (2004) Blood 104:1733-1739; see
also Example 7).
[0504] Other models of FIX deficiencies include hemophilic dogs
that express defective FIX or that have been hepatectomized (Evans
et al., (1989) PNAS 86:10095; Mauser et al., (1996) Blood 88:3451;
and Kay et al., (1994) PNAS 91:2353-2357).
[0505] 3. Clinical Assays
[0506] Many assays are available to assess activity of FIX for
clinical use. Such assays can include assessment of coagulation,
protein stability, and half-life in vivo and phenotypic assays.
Phenotypic assays and assays to assess the therapeutic effect of
FIX treatment include assessment of blood levels of FIX (such as
measurement of serum FIX prior to administration and time-points
following administrations including, after the first
administration, immediately after last administration, and
time-points in between, correcting for the body mass index (BMI)),
phenotypic response to FIX treatment including amelioration of
symptoms over time compared to subjects treated with an unmodified
and/or wild type FIX or placebo. Examples of clinical assays to
assess FIX activity can be found such as in Franchini et al.,
(2005) Thromb Haemost. 93(6):1027-1035; Shapiro et al., (2005)
Blood 105(2):518-525; and White et al., (1997) Thromb. Haemost.
78(1):261-265. Patients can be monitored regularly over a period of
time for routine or repeated administrations, following
administration in response to acute events, such as hemorrhage,
trauma, or surgical procedures.
G. FORMULATION AND ADMINISTRATION
[0507] Compositions for use in treatment of bleeding disorders are
provided herein. Such compositions contain a therapeutically
effective amount of a Factor IX polypeptide as described herein.
Effective concentrations of FIX polypeptides or pharmaceutically
acceptable derivatives thereof are mixed with a suitable
pharmaceutical carrier or vehicle for systemic, topical or local
administration. Compounds are included in an amount effective for
treating the selected disorder. The concentration of active
compound in the composition will depend on absorption,
inactivation, excretion rates of the active compound, the dosage
schedule, and amount administered as well as other factors known to
those of skill in the art.
[0508] Pharmaceutical carriers or vehicles suitable for
administration of the compounds provided herein include any such
carriers known to those skilled in the art to be suitable for the
particular mode of administration. Pharmaceutical compositions that
include a therapeutically effective amount of a FIX polypeptide
described herein also can be provided as a lyophilized powder that
is reconstituted, such as with sterile water, immediately prior to
administration.
[0509] 1. Formulations
[0510] Pharmaceutical compositions containing a modified FIX can be
formulated in any conventional manner by mixing a selected amount
of the polypeptide with one or more physiologically acceptable
carriers or excipients. Selection of the carrier or excipient is
within the skill of the administering profession and can depend
upon a number of parameters. These include, for example, the mode
of administration (i.e., systemic, oral, nasal, pulmonary, local,
topical, or any other mode) and disorder treated. The
pharmaceutical compositions provided herein can be formulated for
single dosage (direct) administration or for dilution or other
modification. The concentrations of the compounds in the
formulations are effective for delivery of an amount, upon
administration, that is effective for the intended treatment.
Typically, the compositions are formulated for single dosage
administration. To formulate a composition, the weight fraction of
a compound or mixture thereof is dissolved, suspended, dispersed,
or otherwise mixed in a selected vehicle at an effective
concentration such that the treated condition is relieved or
ameliorated.
[0511] The modified FIX polypeptides provided herein can be
formulated for administration to a subject as a two-chain FIXa
protein. The modified FIX polypeptides can be activated by any
method known in the art prior to formulation. For example, FIX can
be activated by incubation with FXIa, such as FXIa immobilized on
beads. Calcium can be included in these processes to ensure full
activation and correct folding of the modified FIXa protein. The
modified FIX polypeptides provided herein also can be formulated
for administration as a single chain protein. The modified FIX
polypeptides provided herein can be formulated such that the
single-chain and two-chain forms are contained in the
pharmaceutical composition, in any ratio by appropriate selection
of the medium to eliminate or control autoactivation.
[0512] The compound can be suspended in micronized or other
suitable form or can be derivatized to produce a more soluble
active product. The form of the resulting mixture depends upon a
number of factors, including the intended mode of administration
and the solubility of the compound in the selected carrier or
vehicle. The resulting mixtures are solutions, suspensions,
emulsions and other such mixtures, and can be formulated as an
non-aqueous or aqueous mixture, creams, gels, ointments, emulsions,
solutions, elixirs, lotions, suspensions, tinctures, pastes, foams,
aerosols, irrigations, sprays, suppositories, bandages, or any
other formulation suitable for systemic, topical or local
administration. For local internal administration, such as,
intramuscular, parenteral or intra-articular administration, the
polypeptides can be formulated as a solution suspension in an
aqueous-based medium, such as isotonically buffered saline or are
combined with a biocompatible support or bioadhesive intended for
internal administration. The effective concentration is sufficient
for ameliorating the targeted condition and can be empirically
determined. To formulate a composition, the weight fraction of
compound is dissolved, suspended, dispersed, or otherwise mixed in
a selected vehicle at an effective concentration such that the
targeted condition is relieved or ameliorated.
[0513] Generally, pharmaceutically acceptable compositions are
prepared in view of approvals for a regulatory agency or other
prepared in accordance with generally recognized pharmacopeia for
use in animals and in humans. Pharmaceutical compositions can
include carriers such as a diluent, adjuvant, excipient, or vehicle
with which an isoform is administered. Such pharmaceutical carriers
can be sterile liquids, such as water and oils, including those of
petroleum, animal, vegetable or synthetic origin, such as peanut
oil, soybean oil, mineral oil, and sesame oil. Water is a typical
carrier when the pharmaceutical composition is administered
intravenously. Saline solutions and aqueous dextrose and glycerol
solutions also can be employed as liquid carriers, particularly for
injectable solutions. Compositions can contain along with an active
ingredient: a diluent such as lactose, sucrose, dicalcium
phosphate, or carboxymethylcellulose; a lubricant, such as
magnesium stearate, calcium stearate and talc; and a binder such as
starch, natural gums, such as gum acacia, gelatin, glucose,
molasses, polyinylpyrrolidine, celluloses and derivatives thereof,
povidone, crospovidones and other such binders known to those of
skill in the art. Suitable pharmaceutical excipients include
starch, glucose, lactose, sucrose, gelatin, malt, rice, flour,
chalk, silica gel, sodium stearate, glycerol monostearate, talc,
sodium chloride, dried skim milk, glycerol, propylene, glycol,
water, and ethanol. A composition, if desired, also can contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents, for example, acetate, sodium citrate, cyclodextrine
derivatives, sorbitan monolaurate, triethanolamine sodium acetate,
triethanolamine oleate, and other such agents. These compositions
can take the form of solutions, suspensions, emulsion, tablets,
pills, capsules, powders, and sustained release formulations.
Capsules and cartridges of e.g., gelatin for use in an inhaler or
insufflator can be formulated containing a powder mix of a
therapeutic compound and a suitable powder base such as lactose or
starch. A composition can be formulated as a suppository, with
traditional binders and carriers such as triglycerides. Oral
formulation can include standard carriers such as pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, and other such agents.
Preparations for oral administration also can be suitably
formulated with protease inhibitors, such as a Bowman-Birk
inhibitor, a conjugated Bowman-Birk inhibitor, aprotinin and
camostat. Examples of suitable pharmaceutical carriers are
described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
Such compositions will contain a therapeutically effective amount
of the compound, generally in purified form, together with a
suitable amount of carrier so as to provide the form for proper
administration to a subject or patient.
[0514] The formulation should suit the mode of administration. For
example, the modified FIX can be formulated for parenteral
administration by injection (e.g., by bolus injection or continuous
infusion). The injectable compositions can take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles.
The sterile injectable preparation also can be a sterile injectable
solution or suspension in a non-toxic parenterally-acceptable
diluent or solvent, for example, as a solution in 1,4-butanediol.
Sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose any bland fixed oil can be
employed, including, but not limited to, synthetic mono- or
diglycerides, fatty acids (including oleic acid), naturally
occurring vegetable oils like sesame oil, coconut oil, peanut oil,
cottonseed oil, and other oils, or synthetic fatty vehicles like
ethyl oleate. Buffers, preservatives, antioxidants, and the
suitable ingredients, can be incorporated as required, or,
alternatively, can comprise the formulation.
[0515] The polypeptides can be formulated as the sole
pharmaceutically active ingredient in the composition or can be
combined with other active ingredients. The polypeptides can be
targeted for delivery, such as by conjugation to a targeting agent,
such as an antibody. Liposomal suspensions, including
tissue-targeted liposomes, also can be suitable as pharmaceutically
acceptable carriers. These can be prepared according to methods
known to those skilled in the art. For example, liposome
formulations can be prepared as described in U.S. Pat. No.
4,522,811. Liposomal delivery also can include slow release
formulations, including pharmaceutical matrices such as collagen
gels and liposomes modified with fibronectin (see, for example,
Weiner et al., (1985) J. Pharm. Sci. 74(9):922-5). The compositions
provided herein further can contain one or more adjuvants that
facilitate delivery, such as, but are not limited to, inert
carriers, or colloidal dispersion systems. Representative and
non-limiting examples of such inert carriers can be selected from
water, isopropyl alcohol, gaseous fluorocarbons, ethyl alcohol,
polyvinyl pyrrolidone, propylene glycol, a gel-producing material,
stearyl alcohol, stearic acid, spermaceti, sorbitan monooleate,
methylcellulose, as well as suitable combinations of two or more
thereof.
[0516] The active compound is included in the pharmaceutically
acceptable carrier in an amount sufficient to exert a
therapeutically useful effect in the absence of undesirable side
effects on the subject treated. The therapeutically effective
concentration can be determined empirically by testing the
compounds in known in vitro and in vivo systems, such as the assays
provided herein.
[0517] a. Dosages
[0518] The precise amount or dose of the therapeutic agent
administered depends on the particular FIX polypeptide, the route
of administration, and other considerations, such as the severity
of the disease and the weight and general state of the subject.
Local administration of the therapeutic agent will typically
require a smaller dosage than any mode of systemic administration,
although the local concentration of the therapeutic agent can, in
some cases, be higher following local administration than can be
achieved with safety upon systemic administration. If necessary, a
particular dosage and duration and treatment protocol can be
empirically determined or extrapolated. For example, exemplary
doses of recombinant and native FIX polypeptides can be used as a
starting point to determine appropriate dosages. For example, a
recombinant FIX (rFIXa) polypeptide that has been activated to
rFIXa, BeneFIX.RTM. Factor IX has been administered to patients
with hemophilia B for the treatment of hemorrhage as well as in
prophylactic and surgical settings at various doses. Dosage and
duration of treatment with recombinant FIX depends on the severity
of the factor IX deficiency, the location and extent of bleeding,
and the patient's clinical condition, age and recovery of factor
IX. For example, patients with severe Hemophilia B (FIX activity of
<1 IU/dL; 1% of normal activity (where 1 IU represents the
activity of Factor IX in 1 mL of normal, pooled plasma) will
require more transfused FIX than patients with moderate (FIX
activity of 1-5 IU/dL; 1-5% of normal activity), or mild (FIX
activity of >5-<40 IU/mL; >5-<40% of normal activity)
hemophilia B. The initial estimated dose of BeneFIX.RTM. Factor IX
can be determined using the following formula: Required units=body
weight (kg) x desired factor IX increase (IU/dL or % of normal) x
reciprocal of observed recovery (IU/kg per IU/dL). In clinical
studies with adult and pediatric (<15 years) patients, one IU of
BeneFIX per kilogram of body weight increased the circulating
activity of factor 1.times. as follows: Adults: 0.8.+-.0.2 IU/dL
[range 0.4 to 1.2 IU/dL]; Pediatric: 0.7.+-.0.3 IU/dL [range 0.2 to
2.1 IU/dL].
Thus, for adult patients:
the number of Factor IX IU required(IU)=body
weight(kg).times.desired factor IX increase(% or
IU/dL).times.1.3(IU/kg per IU/dL),
and, for pediatric patients:
the number of Factor IX IU required(IU)=body
weight(kg).times.desired factor IX increase(% or
IU/dL).times.1.4(IU/kg per IU/dL).
Table 11 sets forth the typical dosing used for various bleeding
episodes.
TABLE-US-00012 TABLE 11 Circulating FIX Dosing Duration of activity
required Interval Therapy Type of Hemorrhage (% or IU/dL) (hours)
(days) Minor: 20-30 12-24 1-2 Uncomplicated hemarthroses,
superficial muscle, or soft tissue Moderate: 25-50 12-24 Treat
until Intramuscle or soft tissue bleeding stops with dissection,
and healing mucous membranes, begins, about dental extractions, 2
to 7 days or hematuria Major: 50-100 12-24 7-10 Pharynx,
retropharynx, retroperitoneum, CNS, surgery
[0519] The modified FIX polypeptides provided herein can be
effective at reduced dosage amounts and/or reduced frequencies
compared to native recombinant FIX. For example, the modified FIX
polypeptides provided herein can be administered at less frequent
dosing intervals, such as 24 hours, 36 hours, 48 hours, 60 hours or
more. In other examples, fewer doses of the modified FIX
polypeptides can be administered. For example, the modified FIX
polypeptides provided herein can be administered just once to
achieve coagulation. In some embodiments, the dosages of modified
FIX are reduced compared to native FIX. For example, the dosages
can be less than or about 1 IU/kg, 2 IU/kg, 3 IU/kg, 4 IU/kg, 5
IU/kg, 6 IU/kg, 7 IU/kg, 8 IU/kg, 9 IU/kg, 10 IU/kg, 20 IU/kg, 30
IU/kg, 40 IU/kg or 50 IU/kg, 60 IU/kg, 70 IU/kg, 80 IU/kg, 90
IU/kg, or 100 IU/kg. The dose, duration of treatment and the
interval between injections will vary with the severity of the
bleed and the response of the patient to the treatment, and can be
adjusted accordingly. Factors such as the level of activity and
half-life of the modified FIX in comparison to the unmodified FIX
can be taken into account when making dosage determinations.
Particular dosages and regimens can be empirically determined. For
example, a modified FIX polypeptide that exhibits a longer
half-life than an unmodified FIX polypeptide can be administered at
lower doses and/or less frequently than the unmodified FIX
polypeptide. Similarly, the dosages required for therapeutic effect
using a modified FIX polypeptide that displays increased coagulant
activity compared with an unmodified FIX polypeptide can be reduced
in frequency and amount. Particular dosages and regimens can be
empirically determined by one of skill in the art.
[0520] b. Dosage Forms
[0521] Pharmaceutical therapeutically active compounds and
derivatives thereof are typically formulated and administered in
unit dosage forms or multiple dosage forms. Formulations can be
provided for administration to humans and animals in dosage forms
that include, but are not limited to, tablets, capsules, pills,
powders, granules, sterile parenteral solutions or suspensions,
oral solutions or suspensions, and oil water emulsions containing
suitable quantities of the compounds or pharmaceutically acceptable
derivatives thereof. Each unit dose contains a predetermined
quantity of therapeutically active compound sufficient to produce
the desired therapeutic effect, in association with the required
pharmaceutical carrier, vehicle or diluent. Examples of unit dose
forms include ampoules and syringes and individually packaged
tablets or capsules. In some examples, the unit dose is provided as
a lyophilized powder that is reconstituted prior to administration.
For example, a FIX polypeptide can be provided as lyophilized
powder that is reconstituted with a suitable solution to generate a
single dose solution for injection. In some embodiments, the
lyophilized powder can contain the FIX polypeptide and additional
components, such as salts, such that reconstitution with sterile
distilled water results in a FIX polypeptide in a buffered or
saline solution. Unit dose forms can be administered in fractions
or multiples thereof. A multiple dose form is a plurality of
identical unit dosage forms packaged in a single container to be
administered in segregated unit dose form. Examples of multiple
dose forms include vials, bottles of tablets or capsules or bottles
of pints or gallons. Hence, multiple dose form is a multiple of
unit doses that are not segregated in packaging.
[0522] 2. Administration of Modified Fix Polypeptides
[0523] The FIX polypeptides provided herein (i.e. active compounds)
can be administered in vitro, ex vivo, or in vivo by contacting a
mixture, such as a body fluid or other tissue sample, with a FIX
polypeptide. For example, when administering a compound ex vivo, a
body fluid or tissue sample from a subject can be contacted with
the FIX polypeptides that are coated on a tube or filter, such as
for example, a tube or filter in a bypass machine. When
administering in vivo, the active compounds can be administered by
any appropriate route, for example, orally, nasally, pulmonary,
parenterally, intravenously, intradermally, subcutaneously,
intraarticularly, intracisternally, intraocularly,
intraventricularly, intrathecally, intramuscularly,
intraperitoneally, intratracheally or topically, as well as by any
combination of any two or more thereof, in liquid, semi-liquid or
solid form and are formulated in a manner suitable for each route
of administration. The modified FIX polypeptides can be
administered once or more than once, such as twice, three times,
four times, or any number of times that are required to achieve a
therapeutic effect. Multiple administrations can be effected via
any route or combination of routes, and can be administered hourly,
every 2 hours, every three hours, every four hours or more.
[0524] The most suitable route for administration will vary
depending upon the disease state to be treated, for example the
location of the bleeding disorder. Generally, the FIX polypeptides
will be administered by intravenous bolus injection, with an
administration (infusing) time of approximately 2-5 minutes. In
other examples, desirable blood levels of FIX can be maintained by
a continuous infusion of the active agent as ascertained by plasma
levels. It should be noted that the attending physician would know
how to and when to terminate, interrupt or adjust therapy to lower
dosage due to toxicity, or bone marrow, liver or kidney
dysfunctions. Conversely, the attending physician would also know
how to and when to adjust treatment to higher levels if the
clinical response is not adequate (precluding toxic side effects).
In other examples, the location of the bleeding disorder might
indicate that the FIX formulation is administered via alternative
routes. For example, local administration, including administration
into the brain (e.g., intraventricularly) might be performed when
the patient is experiencing bleeding in this region. Similarly, for
treatment of bleeding in the joints, local administration by
injection of the therapeutic agent into the joint (i.e.,
intraarticularly, intravenous or subcutaneous means) can be
employed. In other examples, topical administration of the
therapeutic agent to the skin, for example formulated as a cream,
gel, or ointment, or administration to the lungs by inhalation or
intratracheally, might be appropriate when the bleeding is
localized to these areas.
[0525] The instances where the modified FIX polypeptides are be
formulated as a depot preparation, the long-acting formulations can
be administered by implantation (for example, subcutaneously or
intramuscularly) or by intramuscular injection. Thus, for example,
the therapeutic compounds can be formulated with suitable polymeric
or hydrophobic materials (for example as an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0526] The compositions, if desired, can be presented in a package,
in a kit or dispenser device, that can contain one or more unit
dosage forms containing the active ingredient. The package, for
example, contains metal or plastic foil, such as a blister pack.
The pack or dispenser device can be accompanied by instructions for
administration. The compositions containing the active agents can
be packaged as articles of manufacture containing packaging
material, an agent provided herein, and a label that indicates the
disorder for which the agent is provided.
[0527] 3. Administration of Nucleic Acids Encoding Modified FIX
Polypeptides (Gene Therapy)
[0528] Also provided are compositions of nucleic acid molecules
encoding the modified FIX polypeptides and expression vectors
encoding them that are suitable for gene therapy. Rather than
deliver the protein, nucleic acid can be administered in vivo, such
as systemically or by other route, or ex vivo, such as by removal
of cells, including lymphocytes, introduction of the nucleic
therein, and reintroduction into the host or a compatible
recipient.
[0529] Modified FIX polypeptides can be delivered to cells and
tissues by expression of nucleic acid molecules. Modified FIX
polypeptides can be administered as nucleic acid molecules encoding
modified FIX polypeptides, including ex vivo techniques and direct
in vivo expression. Nucleic acids can be delivered to cells and
tissues by any method known to those of skill in the art. The
isolated nucleic acid sequences can be incorporated into vectors
for further manipulation. As used herein, vector (or plasmid)
refers to discrete elements that are used to introduce heterologous
DNA into cells for either expression or replication thereof.
Selection and use of such vehicles are well within the skill of the
artisan.
[0530] Methods for administering modified FIX polypeptides by
expression of encoding nucleic acid molecules include
administration of recombinant vectors. The vector can be designed
to remain episomal, such as by inclusion of an origin of
replication or can be designed to integrate into a chromosome in
the cell. Modified FIX polypeptides also can be used in ex vivo
gene expression therapy using non-viral vectors. For example, cells
can be engineered to express a modified FIX polypeptide, such as by
integrating a modified FIX polypeptide encoding-nucleic acid into a
genomic location, either operatively linked to regulatory sequences
or such that it is placed operatively linked to regulatory
sequences in a genomic location. Such cells then can be
administered locally or systemically to a subject, such as a
patient in need of treatment.
[0531] Viral vectors, include, for example adenoviruses,
adeno-associated viruses (AAV), poxviruses, herpes viruses,
retroviruses and others designed for gene therapy can be employed.
The vectors can remain episomal or can integrate into chromosomes
of the treated subject. A modified FIX polypeptide can be expressed
by a virus, which is administered to a subject in need of
treatment. Viral vectors suitable for gene therapy include
adenovirus, adeno-associated virus (AAV), retroviruses,
lentiviruses, vaccinia viruses and others noted above. For example,
adenovirus expression technology is well-known in the art and
adenovirus production and administration methods also are well
known. Adenovirus serotypes are available, for example, from the
American Type Culture Collection (ATCC, Rockville, Md.). Adenovirus
can be used ex vivo, for example, cells are isolated from a patient
in need of treatment, and transduced with a modified FIX
polypeptide-expressing adenovirus vector. After a suitable
culturing period, the transduced cells are administered to a
subject, locally and/or systemically. Alternatively, modified FIX
polypeptide-expressing adenovirus particles are isolated and
formulated in a pharmaceutically-acceptable carrier for delivery of
a therapeutically effective amount to prevent, treat or ameliorate
a disease or condition of a subject. Typically, adenovirus
particles are delivered at a dose ranging from 1 particle to
10.sup.14 particles per kilogram subject weight, generally between
10.sup.6 or 10.sup.8 particles to 10.sup.12 particles per kilogram
subject weight. In some situations it is desirable to provide a
nucleic acid source with an agent that targets cells, such as an
antibody specific for a cell surface membrane protein or a target
cell, or a ligand for a receptor on a target cell. FIX also can be
targeted for delivery into specific cell types. For example,
adenoviral vectors encoding FIX polypeptides can be used for stable
expression in nondividing cells, such as liver cells (Margaritis et
al. (2004) J Clin Invest 113:1025-1031). In another example, viral
or nonviral vectors encoding FIX polypeptides can be transduced
into isolated cells for subsequent delivery. Additional cell types
for expression and delivery of FIX might include, but are not
limited to, fibroblasts and endothelial cells.
[0532] The nucleic acid molecules can be introduced into artificial
chromosomes and other non-viral vectors. Artificial chromosomes,
such as ACES (see, Lindenbaum et al., (2004) Nucleic Acids Res.
32(21):e172) can be engineered to encode and express the isoform.
Briefly, mammalian artificial chromosomes (MACs) provide a means to
introduce large payloads of genetic information into the cell in an
autonomously replicating, non-integrating format. Unique among
MACs, the mammalian satellite DNA-based Artificial Chromosome
Expression (ACE) can be reproducibly generated de novo in cell
lines of different species and readily purified from the host
cells' chromosomes. Purified mammalian ACEs can then be
re-introduced into a variety of recipient cell lines where they
have been stably maintained for extended periods in the absence of
selective pressure using an ACE System. Using this approach,
specific loading of one or two gene targets has been achieved in
LMTK(-) and CHO cells.
[0533] Another method for introducing nucleic acids encoding the
modified FIX polypeptides is a two-step gene replacement technique
in yeast, starting with a complete adenovirus genome (Ad2; Ketner
et al. (1994) PNAS 91: 6186-6190) cloned in a Yeast Artificial
Chromosome (YAC) and a plasmid containing adenovirus sequences to
target a specific region in the YAC clone, an expression cassette
for the gene of interest and a positive and negative selectable
marker. YACs are of particular interest because they permit
incorporation of larger genes. This approach can be used for
construction of adenovirus-based vectors bearing nucleic acids
encoding any of the described modified FIX polypeptides for gene
transfer to mammalian cells or whole animals.
[0534] The nucleic acids can be encapsulated in a vehicle, such as
a liposome, or introduced into a cells, such as a bacterial cell,
particularly an attenuated bacterium or introduced into a viral
vector. For example, when liposomes are employed, proteins that
bind to a cell surface membrane protein associated with endocytosis
can be used for targeting and/or to facilitate uptake, e.g. capsid
proteins or fragments thereof tropic for a particular cell type,
antibodies for proteins which undergo internalization in cycling,
and proteins that target intracellular localization and enhance
intracellular half-life.
[0535] For ex vivo and in vivo methods, nucleic acid molecules
encoding the modified FIX polypeptide is introduced into cells that
are from a suitable donor or the subject to be treated. Cells into
which a nucleic acid can be introduced for purposes of therapy
include, for example, any desired, available cell type appropriate
for the disease or condition to be treated, including but not
limited to epithelial cells, endothelial cells, keratinocytes,
fibroblasts, muscle cells, hepatocytes; blood cells such as T
lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils,
eosinophils, megakaryocytes, granulocytes; various stem or
progenitor cells, in particular hematopoietic stem or progenitor
cells, e.g., such as stem cells obtained from bone marrow,
umbilical cord blood, peripheral blood, fetal liver, and other
sources thereof.
[0536] For ex vivo treatment, cells from a donor compatible with
the subject to be treated or the subject to be treated cells are
removed, the nucleic acid is introduced into these isolated cells
and the modified cells are administered to the subject. Treatment
includes direct administration, such as, for example, encapsulated
within porous membranes, which are implanted into the patient (see,
e.g., U.S. Pat. Nos. 4,892,538 and 5,283,187 each of which is
herein incorporated by reference in its entirety). Techniques
suitable for the transfer of nucleic acid into mammalian cells in
vitro include the use of liposomes and cationic lipids (e.g.,
DOTMA, DOPE and DC-Chol) electroporation, microinjection, cell
fusion, DEAE-dextran, and calcium phosphate precipitation methods.
Methods of DNA delivery can be used to express modified FIX
polypeptides in vivo. Such methods include liposome delivery of
nucleic acids and naked DNA delivery, including local and systemic
delivery such as using electroporation, ultrasound and
calcium-phosphate delivery. Other techniques include
microinjection, cell fusion, chromosome-mediated gene transfer,
microcell-mediated gene transfer and spheroplast fusion.
[0537] In vivo expression of a modified FIX polypeptide can be
linked to expression of additional molecules. For example,
expression of a modified FIX polypeptide can be linked with
expression of a cytotoxic product such as in an engineered virus or
expressed in a cytotoxic virus. Such viruses can be targeted to a
particular cell type that is a target for a therapeutic effect. The
expressed modified FIX polypeptide can be used to enhance the
cytotoxicity of the virus.
[0538] In vivo expression of a modified FIX polypeptide can include
operatively linking a modified FIX polypeptide encoding nucleic
acid molecule to specific regulatory sequences such as a
cell-specific or tissue-specific promoter. Modified FIX
polypeptides also can be expressed from vectors that specifically
infect and/or replicate in target cell types and/or tissues.
Inducible promoters can be use to selectively regulate modified FIX
polypeptide expression. An exemplary regulatable expression system
is the doxycycline-inducible gene expression system, which has been
used to regulate recombinant FIX expression (Srour et al., (2003)
Thromb. Haemost. 90(3):398-405).
[0539] Nucleic acid molecules, as naked nucleic acids or in
vectors, artificial chromosomes, liposomes and other vehicles can
be administered to the subject by systemic administration, topical,
local and other routes of administration. When systemic and in
vivo, the nucleic acid molecule or vehicle containing the nucleic
acid molecule can be targeted to a cell.
[0540] Administration also can be direct, such as by administration
of a vector or cells that typically targets a cell or tissue. For
example, tumor cells and proliferating can be targeted cells for in
vivo expression of modified FIX polypeptides. Cells used for in
vivo expression of an modified FIX polypeptide also include cells
autologous to the patient. Such cells can be removed from a
patient, nucleic acids for expression of an modified FIX
polypeptide introduced, and then administered to a patient such as
by injection or engraftment.
H. THERAPEUTIC USES
[0541] The modified FIX polypeptides and nucleic acid molecules
provided herein can be used for treatment of any condition for
which unmodified FIX is employed. Thus, for example, the modified
FIX polypeptides can be used as procoagulants for the treatment of
bleeding disorders, including congenital and acquired bleeding
disorders, such as hemophilia. Typically, therefore, the modified
FIX polypeptides provided herein are procoagulants that are used in
the treatment of bleeding disorders. In other particular examples,
however, the modified FIX polypeptides can be used as
anticoagulants. For example, a hyperglycosylated modified FIX
polypeptide that also contains one or more modifications that
result in a lack of catalytic activity for it's substrate, FX, can
be used as an anticoagulant to treat thrombotic disorders.
[0542] The modified FIX polypeptides provided herein have
therapeutic activity alone or in combination with other agents. The
modified polypeptides provided herein are designed to retain
therapeutic activity but exhibit modified properties, such as
improved pharmacokinetic and pharmacodynamic properties, increased
resistance to inhibitors and/or improved catalytic activity. Such
modified properties and activities, for example, can improve the
therapeutic effectiveness of the polypeptides. The modified FIX
polypeptides and encoding nucleic acid molecules provided herein
can be used for treatment of any condition for which unmodified FIX
is employed. This section provides exemplary uses of and
administration methods. These described therapies are exemplary
only and do not limit the applications of modified FIX
polypeptides.
[0543] The modified FIX polypeptides provided herein can be used in
various therapeutic as well as diagnostic methods in which FIX is
employed. Such methods include, but are not limited to, methods of
treatment of physiological and medical conditions described and
listed below. Modified FIX polypeptides provided herein can exhibit
improvement of in vivo activities and therapeutic effects compared
to wild-type FIX, including lower dosage to achieve the same
effect, a more sustained therapeutic effect and other improvements
in administration and treatment.
[0544] The modified FIX polypeptides described herein can exhibit
improved pharmacokinetic and pharmacodynamic properties, increased
catalytic activity, increased resistance to inhibitors and/or
increased coagulant activity compared to an unmodified FIX
polypeptide. Such polypeptides can be used as procoagulants for the
treatment of, for example, bleeding disorders, including congenital
bleeding disorders and acquired bleeding disorders. In some
examples, the modified FIX polypeptides provided herein that have
non-native glycosylation sites also contain modifications that
result in a modified FIX polypeptide that inhibits coagulation,
such that the modified FIX polypeptide is an anti-coagulant and can
be used to treat, for example, thrombotic diseases and disorders.
The modified FIX polypeptides provided herein can be used to
deliver longer-lasting, more stable therapies. Examples of
therapeutic improvements using modified FIX polypeptides include,
but are not limited to, lower dosages, fewer and/or less frequent
administrations, decreased side effects and increased therapeutic
effects.
[0545] Typically, the modified FIX polypeptides provided herein are
procoagulants and can be used to treat bleeding disorders,
including congenital bleeding disorders and acquired bleeding
disorders. In particular examples, modified FIX polypeptides are
intended for use in therapeutic methods in which other modified and
unmodified FIX polypeptides have been used for treatment. Exemplary
diseases and disorders that can be treated with the modified FIX
polypeptides, alone or in combination with other agents, including
other procoagulants, include, but are not limited to, blood
coagulation disorders, hematologic diseases, hemorrhagic disorders,
hemophilias, in particular hemophilia B, and acquired blood
disorders, including bleeding associated with trauma and surgery.
In some embodiments, the bleedings to be treated by FIX
polypeptides occur in organs such as the brain, inner ear region,
eyes, liver, lung, tumor tissue, gastrointestinal tract. In other
embodiments, the bleeding is diffuse, such as in hemorrhagic
gastritis and profuse uterine bleeding.
[0546] Patients with bleeding disorders, such as hemophilia, are
often at risk for hemorrhage and excessive bleeding during surgery,
including dental extraction, or trauma. Such patients often have
acute haemarthroses (bleedings in joints), chronic hemophilic
arthropathy, haematomas, (such as, muscular, retroperitoneal,
sublingual and retropharyngeal), bleedings in other tissue,
haematuria (bleeding from the renal tract), cerebral hemorrhage,
and gastrointestinal bleedings (such as, UGI bleeds), that can be
treated with modified FIX polypeptides. Thus, inc some examples,
the modified FIX polypeptides are used to treat bleeding episodes
due to trauma or surgery, or lowered count or activity of
platelets, in a subject. Exemplary methods for patients undergoing
surgery include treatments to prevent hemorrhage and treatments
before, during, or after surgeries.
[0547] Although typically the modified FIX polypeptides provided
herein exhibit improved coagulant activity compared to a modified
FIX polypeptide, in some examples, the modified FIX polypeptides
provided herein can contain one or more non-native glycosylation
sites and also lack functional peptidase activity. Such modified
FIX polypeptides can be used in therapeutic methods to inhibit
blood coagulation (see e.g., U.S. Pat. No. 6,315,995). Modified FIX
polypeptides that inhibit blood coagulation can be used in
anticoagulant methods of treatment for ischemic and thrombotic
disorders. In surgical patients with an increased risk of excessive
clotting, such as patients with deep vein thrombosis (DVT) or
superficial vein thrombosis (SVT), the modified FIX polypeptides
provided herein that are anticoagulants can be administered to
prevent excessive clotting in surgeries. In some cases treatment is
performed with FIX alone. In some cases, FIX is administered in
conjunction with additional anticoagulation factors as required by
the condition or disease to be treated.
[0548] Treatment of diseases and conditions with modified FIX
polypeptides can be effected by any suitable route of
administration using suitable formulations as described herein
including, but not limited to, injection, pulmonary, oral and
transdermal administration. If necessary, a particular dosage and
duration and treatment protocol can be empirically determined or
extrapolated. For example, exemplary doses of recombinant and
native FIX polypeptides, such as recommended dosages of
BeneFIX.RTM. Coagulation Factor LX (Recombinant) as described
above, can be used as a starting point to determine appropriate
dosages. Modified FIX polypeptides that are hyperglycosylated and
have an increased half-life in vivo, or that have increased
resistance to inhibitors, or have increased catalytic activity, can
be effective at reduced dosage amounts and/or frequencies. Dosages
and dosage regimens for unmodified FIX polypeptides can be used as
guidance for determining dosages for the modified FIX polypeptides
provided herein. Factors such as the half-life and level of
activity of the modified FIX in comparison to the unmodified FIX
can be used in making such determinations. Particular dosages and
regimens can be empirically determined
[0549] Dosage levels and regimens can be determined based upon
known dosages and regimens, and, if necessary can be extrapolated
based upon the changes in properties of the modified polypeptides
and/or can be determined empirically based on a variety of factors.
Such factors include body weight of the individual, general health,
age, the activity of the specific compound employed, sex, diet,
time of administration, rate of excretion, drug combination, the
severity and course of the disease, and the patient's disposition
to the disease and the judgment of the treating physician. The
active ingredient, the polypeptide, typically is combined with a
pharmaceutically effective carrier. The amount of active ingredient
that can be combined with the carrier materials to produce a single
dosage form or multi-dosage form can vary depending upon the host
treated and the particular mode of administration.
[0550] The effect of the FIX polypeptides on the clotting time of
blood can be monitored using any of the clotting tests known in the
art including, but not limited to, whole blood partial
thromboplastin time (PTT), the activated partial thromboplastin
time (OTT), the activated clotting time (ACT), the recalcified
activated clotting time, or the Lee-White Clotting time.
[0551] Upon improvement of a patient's condition, a maintenance
dose of a compound or compositions can be administered, if
necessary; and the dosage, the dosage form, or frequency of
administration, or a combination thereof can be modified. In some
cases, a subject can require intermittent treatment on a long-term
basis upon any recurrence of disease symptoms or based upon
scheduled dosages. In other cases, additional administrations can
be required in response to acute events such as hemorrhage, trauma,
or surgical procedures.
[0552] Hemophilia
[0553] Hemophilia is a bleeding disorder that is caused by a
deficiency in one or more blood coagulation factors. It is
characterized by a decreased ability to form blood clots at sites
of tissue damage. Congenital X-linked hemophilias include
hemophilia A and hemophilia B, or Christmas disease, which are
caused by deficiencies in FVIII and FIX, respectively. Hemophilia A
occurs at a rate of 1 out of 10,0000 males, while hemophilia B
occurs in 1 out of 50,000 males.
[0554] Patients with hemophilia suffer from recurring joint and
muscle bleeds, which can be spontaneous or in response to trauma.
The bleeding can cause severe acute pain, restrict movement, and
lead to secondary complications including synovial hypertrophy.
Furthermore, the recurring bleeding in the joints can cause chronic
synovitis, which can cause joint damage, destroying synovium,
cartilage, and bone.
[0555] The modified FIX polypeptides provided herein and the
nucleic acids encoding the modified FIX polypeptides provided
herein can be used in therapies for hemophilia, including treatment
of bleeding conditions associated with hemophilia. The modified FIX
polypeptides provided herein can be used, for example, to control
or prevent spontaneous bleeding episodes or to control or prevent
bleeding in response to trauma or surgical procedures.
[0556] The modified FIX polypeptides herein can exhibit improved
pharmacokinetic and pharmacodynamic properties, such as improved
serum half-life, increased resistance to inhibitors, increased
catalytic activity, and/or increased coagulant activity. Thus,
modified FIX polypeptides can be used to deliver longer lasting or
otherwise improved therapies for hemophilia. Examples of
therapeutic improvements using modified FIX polypeptides include
for example, but are not limited to, lower dosages, fewer and/or
less frequent administrations, decreased side effects, and
increased therapeutic effects.
[0557] Modified FIX polypeptides can be tested for therapeutic
effectiveness, for example, by using animal models. For example
FIX-deficient mice, or any other known disease model for
hemophilia, can be treated with modified FIX polypeptides.
Progression of disease symptoms and phenotypes is monitored to
assess the effects of the modified FIX polypeptides. Modified FIX
polypeptides also can be administered to animal models as well as
subjects such as in clinical trials to assess in vivo effectiveness
in comparison to placebo controls and/or controls using unmodified
FIX.
[0558] a. Hemophilia B
[0559] Hemophilia B can be effectively managed with administration
of FIX therapeutics. Patients with severe Hemophilia B have an FIX
activity of <1 IU/dL (1% of normal activity), patients with
moderate Hemophilia B have a FIX activity of 1-5 IU/dL (1-5% of
normal activity) and patients with mild hemophilia B have a FIX
activity of >5-<40 IU/mL (>5-<40% of normal activity).
With proper prophylactic replacement therapy and/or treatment of
particular bleeding episodes with an appropriate amount of FIX,
patients often can achieve normal life span. Administration of FIX
can aid in controlling bleeding during surgery, trauma, during
dental extraction, or to alleviate bleeding associated with
hemarthroses, hematuria, mucocutaneous bleeding, such as epistaxis
or gastrointestinal tract bleeding, cystic lesions in subperiosteal
bone or soft tissue, or hematomas, which cause neurological
complications such as intracranial bleeding, spinal canal bleeding.
Death in patients with hemophilia is often the result of bleeding
in the central nervous system. Other serious complications in
hemophilic patients include development of inhibitors to
coagulation factor therapeutics and disease.
[0560] The most frequent alterations in the FIX gene in hemophilia
B patients are point mutations, in particular missense mutations.
Most of the identified FIX mutations occur in amino acid residues
in the coding region of the FIX gene, often affecting
evolutionarily conserved amino acids. The severity of the
hemophilia depends upon the nature of the mutation. Mutations in
the coding region can affect a number of different properties or
activities of the FIX polypeptide including alteration of protease
activity, cofactor binding, signal peptide or propeptide cleavage,
post-translational modifications, and inhibition of cleavage of FIX
into its activated form. Other types of point mutations include
nonsense mutations that produce an unstable truncated FIX
polypeptide, and frameshift mutations (small deletions and
insertions) that result in a terminally aberrant FIX molecule. In
addition, FIX point mutations can be found in the promoter region,
which can disrupt the recognition sequences for several specific
gene regulatory proteins, resulting in reduced transcription of
coagulation factor IX. Decreased FIX as a result of transcriptional
abnormalities is called Hemophilia B Leyden. An exemplary mutation
in the promoter region includes disruption of the HNF-4 binding
site, which affect regulation of FIX transcription by the androgen
receptor. The severity of this type of hemophilia is governed by
the levels of androgen in the blood, which increase during puberty
and partially alleviate the FIX transcriptional deficiency (Kurachi
et al. (1995)). Other missense nucleotide changes affect the
processing of factor IX primary RNA transcript. For example, some
mutations occur at evolutionarily conserved donor-splice (GT), and
acceptor-splice (AG) consensus sequences, which can create cryptic
splice junctions and disrupt assembly of spliceosomes. Some severe
cases of hemophilia (approximately 10%) present with large
deletions in the FDC gene.
[0561] Treatment of FIX deficiency, and thus hemophilia B, most
often involves administration of FIX, including recombinant forms
of FIX, purified plasma FIX preparations or purified plasma
concentrates. Thus, similarly, the modified FIX polypeptides
herein, and nucleic acids encoding modified FIX polypeptides, can
be used for treatment of hemophilia B. The modified FIX
polypeptides herein can exhibit improved pharmacokinetic and
pharmacodynamic properties, such as improved serum half-life,
increased resistance to inhibitors, increased catalytic activity,
and/or increased coagulant activity. Thus, modified FIX
polypeptides can be used to deliver improved therapies for
hemophilia. Examples of therapeutic improvements using modified FIX
polypeptides include for example, but are not limited to, lower
dosages, fewer and/or less frequent administrations, decreased side
effects, and increased therapeutic effects.
[0562] b. Hemophilia A
[0563] Hemophilia A, which accounts for approximately 85% of all
cases of hemophilia, results from mutations(s) in the factor VIII
gene on the X chromosome, leading to a deficiency or dysfunction of
the FVIII protein. Typically, treatment of hemophilia A with native
FIX polypeptides, including recombinant FIX polypeptides such as
BeneFIX.RTM. Coagulation Factor IX (Recombinant), or
plasma-purified FIX polypeptides is not recommended because the
native FIX polypeptide requires FVIIIa for catalytic activity to
effect coagulation. Modified FIX polypeptides, however, such as
those described herein, that contain one or more modifications to
increase the FIX intrinsic activity, can be used in the treatment
of hemophilia B. Such polypeptides have FVIII-independent activity,
and thus can function as a coagulant in hemophilia A patients. For
example, the modified FIX polypeptides described above, such as
those that contain one or more modifications to introduce or
eliminate one or more non-native glycosylation sites, and/or one or
more modifications to increase resistance to AT-III and/or heparin,
and that also contain and one or more modifications to increase
activity of the modified FIX polypeptide in the absence of FVIIIa,
can be used to treat bleeding episodes in patients with Hemophilia
A.
[0564] Modifications to increase intrinsic activity of a FIX
polypeptide such that it can act in a FVIIIa-independent manner are
described above and elsewhere (see e.g. Hopfner et al., (1997) EMBO
J. 16:6626-6635; Kolkman et al., (2000) Biochem. 39:7398-7405;
Sichler et al., (2003) J. Biol. Chem. 278:4121-4126; Begbie et al.,
(2005) Thromb Haemost. 94(6):1138-47, U.S. Pat. No. 6,531,298 and
U.S. Patent Publication Nos. 20080167219 and 20080214461), and
include, but are not limited to, amino acid replacements V86A,
V86N, V86D, V86E, V86Q, V86G, V86H, V86I, V86L, V86M, V86F, V86S,
V86T, V86W, V86Y, Y259F, A261K, K265T, E277V, E277A, E277N, E277D,
E277Q, E277G, E277H, E277I, E277L, E277M, E277F, E277S, E277T,
E277W, E277Y, R338A, R338V, R338I, R338F, R338W, R338S, R338T,
Y345F, I383V and E388G. For example, a modified FIX polypeptide
provided herein can contain the amino acid substitutions
Y259F/K265T, Y259F/K265T/Y345F, Y259F/A261K/K265T/Y345F,
Y259F/K265T/Y345F/1383V/E388G or
Y259F/A261K/K265T/Y345F/1383V/E388G and can exhibit increased
intrinsic activity. Such modified FIX polypeptides can be used,
therefore, in the treatment of Hemophilia A.
J. COMBINATION THERAPIES
[0565] Any of the modified FIX polypeptides, and nucleic acid
molecules encoding modified FIX polypeptides described herein can
be administered in combination with, prior to, intermittently with,
or subsequent to, other therapeutic agents or procedures including,
but not limited to, other biologics, small molecule compounds and
surgery. For any disease or condition, including all those
exemplified above, for FIX is indicated or has been used and for
which other agents and treatments are available, FIX can be used in
combination therewith. Hence, the modified FIX polypeptides
provided herein similarly can be used. Depending on the disease or
condition to be treated, exemplary combinations include, but are
not limited to combination with other plasma purified or
recombinant coagulation factors, procoagulants, anticoagulants,
anti-coagulation antibodies, glycosaminoglycans, heparins,
heparinoids, heparin derivatives, heparin-like drugs, coumarins,
such as warfarin and coumarin derivatives. Additional procoagulants
that can be used in combination therapies with modified FIX
polypeptides provided herein that have procoagulant properties
include, but are not limited to, vitamin K, vitamin K derivatives,
other coagulation factors, and protein C inhibitors. Additional
anticoagulants that can be used in combination therapies with
modified FIX polypeptides provided herein that have anticoagulant
properties include, but are not limited to, .beta.2 adrenoreceptor
antagonists, neuropeptide V2 antagonists, prostacyclin analogs,
thromboxane synthase inhibitors, calcium agonists, elastase
inhibitors, non-steroidal anti-inflammatory molecules, thrombin
inhibitors, lipoxygenase inhibitors, FVIIa inhibitors, FXa
inhibitors, phosphodiesterase III inhibitors, fibrinogen, vitamin K
antagonists, and glucoprotein IIb/IIIa antagonists.
K. ARTICLES OF MANUFACTURE AND KITS
[0566] Pharmaceutical compounds of modified FIX polypeptides for
nucleic acids encoding modified FIX polypeptides, or a derivative
or a biologically active portion thereof can be packaged as
articles of manufacture containing packaging material, a
pharmaceutical composition which is effective for treating a
FIX-mediated disease or disorder, and a label that indicates that
modified FIX polypeptide or nucleic acid molecule is to be used for
treating a FIX-mediated disease or disorder.
[0567] The articles of manufacture provided herein contain
packaging materials. Packaging materials for use in packaging
pharmaceutical products are well known to those of skill in the
art. See, for example, U.S. Pat. Nos. 5,323,907, 5,033,252 and
5,052,558, each of which is incorporated herein in its entirety.
Examples of pharmaceutical packaging materials include, but are not
limited to, blister packs, bottles, tubes, inhalers, pumps, bags,
vials, containers, syringes, bottles, and any packaging material
suitable for a selected formulation and intended mode of
administration and treatment. A wide array of formulations of the
compounds and compositions provided herein are contemplated as are
a variety of treatments for any FIX-mediated disease or
disorder.
[0568] Modified FIX polypeptides and nucleic acid molecules also
can be provided as kits. Kits can include a pharmaceutical
composition described herein and an item for administration. For
example a modified FIX can be supplied with a device for
administration, such as a syringe, an inhaler, a dosage cup, a
dropper, or an applicator. The kit can, optionally, include
instructions for application including dosages, dosing regimens and
instructions for modes of administration. Kits also can include a
pharmaceutical composition described herein and an item for
diagnosis. For example, such kits can include an item for measuring
the concentration, amount or activity of FIX or a FIX regulated
system of a subject.
[0569] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
L. EXAMPLES
Example 1
Cloning and expression of Factor IX polypeptides
A. Cloning of FIX Gene
[0570] The nucleic acid encoding the 461 amino acid human FIX
precursor polypeptide (P00740; set forth in SEQ ID NO:1) was cloned
into the mammalian expression vector, pFUSE-hIgG1-Fc2 (abbreviated
here as pFUSE) (InvivoGen; SEQ ID NO:23), which contains a
composite promoter, hEF1-HTLV, comprising the Elongation
Factor-1.alpha. (EF-1.alpha.) core promoter and the R segment and
part of the U5 sequence (R-U5') of the human T-Cell Leukemia Virus
(HTLV) Type 1 Long Terminal Repeat. The In-Fusion CF Dry-Down PCR
Cloning Kit (Clontech) was used according to the conditions
specified by the supplier.
[0571] For the In-Fusion process, plasmid pFUSE without the human
immunoglobulin 1 (hIgG1) Fc portion was linearized using polymerase
chain reaction (PCR) with the pFUSE-Acc-F1 forward primer:
GTGCTAGCTGGCCAGACATGATAAG (SEQ ID NO:24) and the pFUSE-Acc-R3
reverse primer: CATGGTGGCCCTCCTTCGCCGGTGATC (SEQ ID NO:25), and was
used as Acceptor DNA. The full-length coding sequence of FIX was
amplified by PCR using human FIX cDNA (Origene) as template with
the FIX-wtsp-Invivo-F1 forward primer:
CGAAGGAGGGCCACCATGCAGCGCGTGAACATGATC (SEQ ID NO:26) and
FIX-Invivo-R1 reverse primer:
TGTCTGGCCAGCTAGCACTTAAGTGAGCTTGTTTTTTCC (SEQ ID NO:27). For two FIX
Donor amplification primer sequences set forth above, both FIX
`ATG` start and complementary sequence of `TAA` stop codons are
underlined in the forward and reverse primer sequences,
respectively. The 18-nt long homology regions, a non-annealing 5'
primer tail for In-Fusion, are shown in bold. Standard PCR reaction
and thermocycling conditions were used in conjunction with the
Fusion High-Fidelity Master Mix Kit (New England Biolabs), as
recommended by the manufacturer. Both Acceptor and Donor PCR
products were then digested with DpnI restriction enzyme to remove
E. coli-derived dam methylated PCR template backgrounds. They were
then mixed together, and the In-Fusion reaction was run using
conditions specified by the supplier. The reaction mix was
transformed into E. coli XL1Blue supercompetent cells (Stratagene).
Colonies were selected on 2xYT agar plates supplemented with 25 ppm
Zeocin (InvivoGen). Plasmid DNA was isolated from selected clones,
and sequenced to verify correct cloning.
B. Generation of FIX Variants
[0572] FIX variants were generated using the QuikChange Lightning
Site-Directed Mutagenesis Kit (Stratagene) according to
manufacturer's instructions with specifically designed
oligonucleotides that served as primers to incorporate designed
mutations into the newly synthesized DNA. Complementary primers
that include the desired mutations were extended during cycling
using purified, double-stranded super-coiled pFUSE plasmid DNA that
contained the cloned FIX cDNA sequence as a template. Extension of
the primers resulted in incorporation of the mutations of interest
into the newly synthesized strands, and resulted in a mutated
plasmid with staggered nicks. Following amplification, the
mutagenesis product was digested with DpnI restriction enzyme to
remove dam methylated parental strands of the E. coli-derived pFUSE
DNA. The DNA was then transformed into E. coli XL1Blue
supercompetent cells (Stratagene) followed by selection on 2xYT
agar plates supplemented with 25 ppm Zeocin (InvivoGen). Plasmid
DNA was isolated from selected clones, and sequenced to verify for
incorporation of mutation(s) at the desired location(s) on the FIX
gene.
[0573] The nucleotide sequence of one of the oligonucleotides from
each complementary primer pair used to generate the FIX variants is
provided in Table 12. The nucleotide triplet sequences that encode
a substituted amino acid are shown in uppercase. For example, to
generate a FIX variant containing the substitutions A103N/N105S
(A[103]N/N[105]S by chymotrypsin numbering; SEQ ID NO:77), the
A103N/N105S-Forward primer, and a primer that is complementary to
A103N/N105S-Forward, were used to replace a 9-bp
`GCTgatAAC`wild-type sequence with a 9-bp `AATgatAGC` mutant
sequence (changed nucleotide triplets are denoted by upper
case).
[0574] Table 12 below sets forth the oligonucleotide primers used
for FIX mutagenesis. The mutant triplets are shown in upper case,
and primer names correspond to the mutation, by chymotrypsin
numbering, produced as a result of the mutagenesis using the
primer.
TABLE-US-00013 TABLE 12 SEQ ID Primer Name Primer Sequence (5' to
3') NO. F9-A[103]N/ gtaaaaatagtAATgatAGCaaggtggtttg 28 N[105]S-For
F9-D[104]N/ gtaaaaatagtgctAATaacAGTgtggtttgctcctgtactg 29
K[106]S-For F9-K[106]N/ gtgctgataacAATgtgAGTtgctcctgtactg 30
V[108]S-For F9-D[85]N-For gaactgtgaattaAATgtaacatgtaac 31
F9-T[148]A-For ctcacccgtgctgagGCTgtttttcctgatgtg 32
F9-D39N/F41T-For gaatggtaaagttAATgcaACCtgtggaggctctatc 33
F9-K63N-For gaaactggtgttAACattacagttgtcgc 34 F9-I86S-For
gcgaaatgtgAGTcgaattattcctc 35 F9-A95bS-For
caactacaatgcaAGTattaataagtacaac 36 F9-K243N-For
aaggaaaaaacaAATctcacttaagtgctagctg 37 F9-E240N-For
ctggattaagAATaaaacaaagctc 38 F9-E74N-For
caggtgaacataatattAACgagacagaacatacag 39 F9-T76N/H78S-For
gaacataatattgaggagAACgaaAGTacagagcaaaag 40 F9-K82N/N84S-For
cagaacatacagagcaaAATcgaTCTgtgattcgaattattc 41 F9-L153N-For
gggagatcagctAATgttcttcagtac 42 F9-F145N/H147S-For
ctggggaagagtcAACTCCaaagggagatcag 43 F9-K222N/K224S-For
gagtgtgcaatgAACggcTCAtatggaatatatac 44 F9-S151N/L153S-For
cttccacaaagggagaAATgctTCAgttcttca 45 F9-N95S-For
cctcaccacaactacAGTgcagctattaataagtacaacc 46 F9-Y117N-For
cttagtgctaaacagcAACgttacacctatttgc 47 F9-G149N-For
ggaagagtcttccacaaaAACagatcagctttagttc 48 F9-R150N/A152S-For
gtcttccacaaagggAACtcaTCTttagttcttcagtac 49 F9-R150A-For
gtcttccacaaagggGCAtcagctttagttcttcag 50 F9-R150E-For
gtcttccacaaagggGAAtcagctttagttcttcag 51 F9-R150Y-For
gtcttccacaaagggTACtcagctttagttcttcag 52 F9-R143Q-For
gtaagtggctggggaCAAgtcttccacaaaggg 53 F9-R143A-For
gtaagtggctggggaGCAgtcttccacaaaggg 54 F9-R143Y-For
gtaagtggctggggaTACgtcttccacaaaggg 55 F9-R143L-For
gtaagtggctggggaCTGgtcttccacaaaggg 56 F9-V38M-For
gttttgaatggtaaaATGgatgcattctgtggaggc 57 F9-V38Y-For
gttttgaatggtaaaTACgatgcattctgtggaggc 58 F9-D39M-For
gttttgaatggtaaagttATGgcattctgtggaggc 59 F9-D39Y-For
gttttgaatggtaaagttTACgcattctgtggaggc 60 F9-A40M-For
gttttgaatggtaaagttgatATGttctgtggaggctctatc 61 F9-A40Y-For
gttttgaatggtaaagttgatTACttctgtggaggctctatc 62 F9-R233A/K230A-For
caaatatggaatatataccGCAgtatccGCAtatgtcaactg 63 gattaag
F9-R233E/K230E-For caaatatggaatatataccGAAgtatccGAAtatgtcaactg 64
gattaag F9-R233A-For gaatatataccaaggtatccGCAtatgtcaactggattaag 65
F9-R233E-For gaatatataccaaggtatccGAAtatgtcaactggattaag 66
F9-K230A-For caaatatggaatatataccGCAgtatcccggtatgtc 67 F9-K230E-For
caaatatggaatatataccGAAgtatcccggtatgtc 68 F9-K126E-For
cctatttgcattgctgacGAAgaatacacgaacatc 69 F9-K126A-For
cctatttgcattgctgacGCAgaatacacgaacatc 70 F9-R165A-For
gttccacttgttgacGCAgccacatgtcttcgatct 71 F9-R165E-For
gttccacttgttgacGAAgccacatgtcttcgatct 72 F9-R170A-For
cgagccacatgtcttGCAtctacaaagttcacc 73 F9-R170E-For
cgagccacatgtcttGAAtctacaaagttcacc 74 F9-D[64]N-For
ggcggcagttgcaagAACgacattaattcctatG 273 F9-D[64]A-For
ggcggcagttgcaagGCTgacattaattcctatG 274 F9-N[157]Q-For
cctgatgtggactatgtaCAGtctactgaagctgaaacc 275 F9-N[157]D-For
cctgatgtggactatgtaGACtctactgaagctgaaacc 276 F9-N[167]Q-For
gaaaccattttggatCAGatcactcaaagcacc 277 F9-N[167]D-For
gaaaccattttggatGACatcactcaaagcacc 278 F9-S[61]A-For
ccatgtttaaatggcggcGCTtgcaaggatgacattaattcc 279 F9-S[53]A-For
gatggagatcagtgtgagGCTaatccatgtttaaatggc 280 F9-T[159]A-For
gtggactatgtaaattctGCTgaagctgaaaccattttg 281 F9-T[169]A-For
CattttggataacatcGCTcaaagcacccaatcatttaatgac 282 F9-T[172]A-For
gataacatcactcaaagcGCTcaatcatttaatgac 283 F9-T[179]A-For
caatcatttaatgacttcGCTcgggttgttggtggagaaG 284 F9-Y[155]F-For
gtttttcctgatgtggacTTCgtaaattctactgaagctG 285 F9-Y[155]H-For
gtttttcctgatgtggacCACgtaaattctactgaagctG 286 F9-Y[155]Q-For
gtttttcctgatgtggacCAGgtaaattctactgaagctG 287 F9-S[158]A-For
gtggactatgtaaatGCTactgaagctgaaacc 288 F9-S[158]D-For
gtggactatgtaaatGACactgaagctgaaacc 289 F9-S[158]E-For
gtggactatgtaaatGAGactgaagctgaaacc 290 F9-R165S-For
gttccacttgttgacAGCgccacatgtcttcgatct 291 F9-R170L-For
cgagccacatgtcttCTGtctacaaagttcacc 292 F9-K148N-For
ggaagagtcttccacAACgggagatcagctttaG 293 F9-K148A-For
ggaagagtcttccacGCTgggagatcagctttaG 294 F9-K148E-For
ggaagagtcttccacGAGgggagatcagctttaG 295 F9-K148S-For
ggaagagtcttccacAGCgggagatcagctttaG 296 F9-K148M-For
ggaagagtcttccacATGgggagatcagctttaG 297 F9-E74S-For
ggtgaacataatattAGCgagacagaacatacaG 298 F9-E74A-For
ggtgaacataatattGCTgagacagaacatacaG 299 F9-E74R-For
ggtgaacataatattAGGgagacagaacatacaG 300 F9-E74K-For
ggtgaacataatattAAGgagacagaacatacaG 301 F9-H92F-For-Corr
cgaattattcctcacTTCaactacaatgcaGC 302 F9-H92Y-For-Corr
cgaattattcctcacTACaactacaatgcaGC 303 F9-H92E-For-Corr
cgaattattcctcacGAAaactacaatgcaGC 304 F9-H92S-For-Corr
cgaattattcctcacAGCaactacaatgcaGC 305 F9-T242A-For
CtggattaaggaaaaaGCTaagctcacttaagtg 306 F9-T242V-For
CtggattaaggaaaaaGTGaagctcacttaagtg 307 F9-E240N/T242A-For
gtcaactggattaagAACaaaGCTaagctcacttaagtg 308 F9-E240N/T242V-For
gtcaactggattaagAACaaaGTGaagctcacttaagtg 309 F9-E240Q-For
gtcaactggattaagCAGaaaacaaagctcacttaaG 310 F9-E240S-For
gtcaactggattaagAGCaaaacaaagctcacttaaG 311 F9-E240A-For
gtcaactggattaagGCTaaaacaaagctcacttaaG 312 F9-E240D-For
gtcaactggattaagGACaaaacaaagctcacttaaG 313 F9-N178D-For
CAaagttcaccatctatGACaacatgttctgtgctggc 314 F9-N178Y-For
CAaagttcaccatctatTACaacatgttctgtgctggc 315 F9-Y177A-For
CTacaaagttcaccatcGCTaacaacatgttctgtGC 316 F9-Y177T-For
CTacaaagttcaccatcACCaacaacatgttctgtGC 317 F9-T175R-For
cttcgatctacaaagttcAGGatctataacaacatgttc 318 F9-T175E-For
cttcgatctacaaagttcGAAatctataacaacatgttc 319 F9-T175Q-For
cttcgatctacaaagttcCAGatctataacaacatgttc 320 F9-F174I-For
GTcttcgatctacaaagATCaccatctataacaacatg 321 F9-T175R/Y177T-For
cgatctacaaagttcAGGatcACCaacaacatgttctgtG 322 F9-Y94F/K98T-For
GAattattcctcaccacaacTTCaatgcagctattaatACCt 323 acaaccatgacattG
F9-F145N/K148S-For ggctggggaagagtcAACcacAGCgggagatcagctttaG 324
[0575] Table 13 below sets forth the FIX variants that were
generated, with the mutations indicated using numbering relative to
the mature FIX polypeptide set forth in SEQ ID NO:3, and also
chymotrypsin numbering.
TABLE-US-00014 TABLE 13 FIX variants SEQ ID Mutation (Mature FIX
Numbering) Mutation (Chymotrypsin Numbering) NO. Catalyst
Biosciences WT Catalyst Biosciences WT 3 N157D N[157]D 75 Y155F
Y[155]F 76 A103N/N105S A[103]N/N[105]S 77 D104N/K106S
D[104]N/K[106]S 78 K106N/V108S K[106]N/V[108]S 79 D85N D[85]N 80
T148A T[148]A 81 K5A K[5]A 82 D64N D[64]N 83 D64A D[64]A 84 N167D
N[167]D 85 N167Q N[167]Q 86 S61A S[61]A 87 S53A S[53]A 88 T159A
T[159]A 89 T169A T[169]A 90 T172A T[172]A 91 T179A T[179]A 92 Y155H
Y[155]H 93 Y155Q Y[155]Q 94 S158A S[158]A 95 S158D S[158]D 96 S158E
S[158]E 97 N157Q N[157]Q 98 D203N/F205T D39N/F41T 99
D85N/D203N/F205T D[85]N/D39N/F41T 100 K228N K63N 101 D85N/K228N
D[85]N/K63N 102 I251S I86S 103 D85N/I251S D[85]N/I86S 104
D85N/D104N/K106S/I251S D[85]N/D[104]N/K[106]S/I86S 105 A262S A95bS
106 K413N K243N 107 E410N E240N 108 E239N E74N 109 T241N/H243S
T76N/H78S 110 K247N/N249S K82N/N84S 111 L321N L153N 112 F314N/H315S
F145N/H147S 113 K392N/K394S K222N/K224S 114 S319N/L321S S151N/L153S
115 N260S N95S 116 Y284N Y117N 117 G317N G149N 118 R318N/A320S
R150N/A152S 119 R318A R150A 120 R318E R150E 121 R318Y R150Y 122
R312Q R143Q 123 R312A R143A 124 R312Y R143Y 125 R312L R143L 126
V202M V38M 127 V202Y V38Y 128 D203M D39M 129 D203Y D39Y 130 A204M
A40M 131 A204Y A40Y 132 K400A/R403A K230A/R233A 133 K400E/R403E
K230E/R233E 134 R403A R233A 135 R403E R233E 136 K400A K230A 137
K400E K230E 138 K293E K126E 139 K293A K126A 140 R333A R165A 141
R333E R165E 142 R338A R170A 143 R338E R170E 144 R338A/R403A
R170A/R233A 145 R338E/R403E R170E/R233E 146 K293A/R403A K126A/R233A
147 K293E/R403E K126E/R233E 148 K293A/R338A/R403A K126A/R170A/R233A
149 K293E/R338E/R403E K126E/R170E/R233E 150 R318A/R403A R150A/R233A
151 R318E/R403E R150E/R233E 152 R318Y/E410N R150Y/E240N 153
R338E/E410N R170E/E240N 154 R338E/R403E/E410N R170E/R233E/E240N 155
R318Y/R338E/R403E R150Y/R170E/R233E 156 D203N/F205T/K228N
D39N/F41T/K63N 157 D203N/F205T/E410N D39N/F41T/E240N 158
D203N/F205T/R338E D39N/F41T/R170E 159 D203N/F205T/R338A
D39N/F41T/R170A 160 D203N/F205T/R318Y D39N/F41T/R150Y 161
D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E 162 K228N/E410N
K63N/E240N 163 K228N/R338E K63N/R170E 164 K228N/R338A K63N/R170A
165 K228N/R318Y K63N/R150Y 166 K228N/R338E/R403E K63N/R170E/R233E
167 R403E/E410N R233E/E240N 168 R318Y/R338E/E410N R150Y/R170E/E240N
169 K228N/R318Y/E410N K63N/R150Y/E240N 170 R318Y/R403E/E410N
R150Y/R233E/E240N 171 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 172 D203N/F205T/R318Y/E410N
D39N/F41T/R150Y/E240N 173 R333S R165S 186 R338L R170L 187 K316N
K148N 189 K316A K148A 190 K316E K148E 191 K316S K148S 192 K316M
K148M 193 E239S E74S 194 E239A E74A 195 E239R E74R 196 E239K E74K
197 H257F H92F 198 H257Y H92Y 199 H257E H92E 200 H257S H92S 201
T412A T242A 202 T412V T242V 203 E410N/T412A E240N/T242A 204
E410N/T412V E240N/T242V 205 E410Q E240Q 174 E410S E240S 175 E410A
E240A 176 E410D E240D 206 N346D N178D 207 N346Y N178Y 208
F314N/K316S F145N/K148S 177 A103N/N105S/K228N A[103]N/N[105]S/K63N
217 D104N/K106S/K228N D[104]N/K[106]S/K63N 218 K228N/I251S
K63N/I86S 180 A103N/N105S/I251S A[103]N/N[105]S/I86S 181
D104N/K106S/I251S D[104]N/K[106]S/I86S 182
A103N/N105S/R318Y/R338E/R403E/ A[103]N/N[105]S/R150Y/R170E/ 219
E410N R233E/E240N D104N/K106S/R318Y/R338E/R403E/
D[104]N/K[106]S/R150Y/R170E/ 220 E410N R233E/E240N
K228N/R318Y/R338E/R403E/E410N K63N/R150Y/R170E/R233E/E240N 221
I251S/R318Y/R338E/R403E/E410N I86S/R150Y/R170E/R233E/E240N 222
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/ 223
R403E/E410N R170E/R233E/E240N D104N/K106S/R318Y/E410N/R338E
D[104]N/K[106]S/R150Y/E240N/ 224 R170E I251S/R318Y/E410N/R338E
I86S/R150Y/E240N/R170E 225 D104N/K106S/I251S/R318Y/R338E/
D[104]N/K[106]S/I86S/R150Y/ 226 E410N/ R170E/E240N
A103N/N105S/K247N/N249S A[103]N/N[105]S/K82N/N84S 178
D104N/K106S/K247N/N249S D[104]N/K[106]S/K82N/N84S 179
K228N/K247N/N249S K63N/K82N/N84S 183 A103N/N105S/Y155F
A[103]N/N[105]S/Y[155]F 227 D104N/K106S/Y155F
D[104]N/K[106]S/Y[155]F 228 Y155F/K228N Y[155]F/K63N 229
Y155F/I251S Y[155]F/I86S 230 Y155F/K247N/N249S Y[155]F/K82N/N84S
231 A103N/N105S/K247N/N249S/R318Y/ A[103]N/N[105]S/K82N/N84S/ 232
R338E/R403E/E410N R150Y/R170E/R233E/E240N D104N/K106S/K247N/N249S/
D[104]N/K[106]S/K82N/N84S/ 233 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/ 234 R403E/E410N R233E/E240N
A103N/N105S/Y155F/R318Y/R338E/ A[103]N/N[105]S/Y[155]F/R150Y/ 235
R403E/E410N R170E/R233E/E240N D104N/K106S/
D[104]N/K[106]S/Y[155]F/R150Y/ 236 Y155F/R318Y/R338E/R403E/E410N
R170E/R233E/E240N Y155F/K228N/R318Y/R338E/R403E/
Y[155]F/K63N/R150Y/R170E/ 237 E410N R233E/E240N
Y155F/I251S/R318Y/R338E/R403E/ Y[155]F/I86S//R150Y/R170E/ 238 E410N
R233E/E240N Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 239 R403E/E410N R233E/E240N
K247N/N249S/R318Y/R338E/R403E/ K82N/N84S/R150Y/R170E/R233E/ 240
E410N E240N Y155F/R318Y/R338E/R403E/E410N
Y[155]F/R150Y/R170E/R233E/E240N 241 K247N/N249S/R318Y/R338E/E410N
K82N/N84S/R150Y/R170E/E240N 242 Y155F/R318Y/R338E/E410N
Y[155]F/R150Y/R170E/E240N 243 Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 244 E410N E240N
D104N/K106S/Y155F/K228N/K247N/N249S D[104]N/K[106]S/Y[155]F/ 245
K63N/K82N/N84S D104N/K106S/Y155F/K247N/N249S
D[104]N/K[106]S/Y[155]F/K82N/N84S 246 D104N/K106S/Y155F/K228N/
D[104]N/K[106]S/Y[155]F/K63N 247 Y155F/K228N/K247N/N249S
Y[155]F/K63N/K82N/N84S 248 D104N/K106S/K228N/K247N/N249S
D[104]N/K[106]S/K63N/K82N/N84S 184 R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 249 R318Y/R338E/R403E/E410N/T412V
R150Y/R170E/R233E/E240N/T242V 250 R318Y/R338E/R403E/E410N/T412A
R150Y/R170E/R233E/E240N/T242A 251 R318Y/R338E/R403E/T412A
R150Y/R170E/R233E/T242A 252 R318Y/R338E/E410S R150Y/R170E/E240S 253
R318Y/R338E/T412A R150Y/R170E/T242A 254 R318Y/R338E/E410N/T412V
R150Y/R170E/E240N/T242V 255 D85N/K228N/R318Y/R338E/R403E/
D[85]N/K63N/R150Y/R170E/R233E/E240N 256 E410N
N260S/R318Y/R338E/R403E/E410N N95S/R150Y/R170E/R233E/E240N 257
R318Y/R338E/N346D/R403E/E410N R150Y/R170E/N178D/R233E/E240N 258
Y155F/N346D Y[155]F/N178D 259 Y155F/R318Y/R338E/N346D/R403E/E410N
Y[155]F/R150Y/R170E/N178D/ 260 R233E/E240N Y155F/N260S/N346D/
Y[155]F/N95S/N178D 261 K247N/N249S/N260S K82N/N84S/N95S 262
D104N/K106S/N260S D[104]N/K[106]S/N95S 185 Y155F/N260S Y[155]F/N95S
263 K247N/N249S/N260S/R318Y/R338E/ K82N/N84S/N95S/R150Y/R170E/ 264
R403E/E410N R233E/E240N D104N/K106S/N260S/R318Y/R338E/
D[104]N/K[106]S/N95S/R150Y/ 265 R403E/E410N R170E/R233E/E240N
Y155F/N260S/R318Y/R338E/R403E/ Y[155]F/N95S/R150Y/R170E/ 266 E410N
R233E/E240N R318Y/R338E/T343R/R403E/E410N
R150Y/R170E/T175R/R233E/E240N 267 R338E/T343R R170E/T175R 268
D104N/K106S/Y155F/N260S D[104]N/K[106]S/Y[155]F/N95S 269
Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 270
D104N/K106S/K247N/N249S/N260S D[104]N/K[106]S/K82N/N84S/N95S 271
D104N/K106S/Y155F/K247N/N249S/N260S D[104]N/K[106]S/Y[155]F/ 272
K82N/N84S/N95S Y345A Y177A 213 Y345T Y177T 214 T343R T175R 209
T343E T175E 210 T343Q T175Q 211 F342I F174I 212 T343R/Y345T
T175R/Y177T 215 R318Y/R338E R150Y/R170E 188 Y259F/K265T/Y345T
Y94F/K98T/Y177T 216 D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/ 326 R318Y/R338E/R403E/E410N
N84S/R150Y/R170E/R233E/E240N D104N/K106S/K228N/K247N/N249S/
D[104]N/K[106]S/K63N/K82N/N84S/R150Y/ 327 R318Y/R338E/R403E/E410N
R170E/R233E/E240N Y155F/K228N/K247N/N249S/R318Y/
Y[155]F/K63N/K82N/N84S/R150Y/ 328 R338E/R403E/E410N
R170E/R233E/E240N Y155F/K247N/N249S/N260S/R318Y/
Y[155]F/K82N/N84S/N95S/R150Y/ 329 R338E/R403E/E410N
R170E/R233E/E240N Y155F/R318Y/R338E/T343R/R403E/
Y[155]F/R150Y/R170E/T175R/R233E/E240N 330 E410N
D104N/K106S/R318Y/R338E/T343R/ D[104]N/K[106]S/R150Y/R170E/ 331
R403E/E410N T175R/R233E/E240N T343R/N346Y T175R/N178Y 332
R318Y/R338E/N346Y/R403E/E410N R150Y/R170E/N178Y/R233E/E240N 333
R318Y/R338E/T343R/N346Y/R403E/ R150Y/R170E/T175R/N178Y/R233E/ 334
E410N E240N T343R/N346D T175R/N178D 335
R318Y/R338E/T343R/N346D/R403E/ R150Y/R170E/T175R/N178D/R233E/ 336
E410N E240N R318Y/R338E/Y345A/R403E/E410N
R150Y/R170E/Y177A/R233E/E240N 337 R318Y/R338E/Y345A/N346D/R403E/
R150Y/R170E/Y177A/N178D/R233E/E240N 338 E410N
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/
339
R403E R233E K247N/N249S/R318Y/R338E/R403E
K82N/N84S/R150Y/R170E/R233E 340 Y155F/K247N/N249S/R318Y/R403E/
Y[155]F/K82N/N84S/R150Y/R233E/ 341 E410N E240N
K247N/N249S/R318Y/R403E/E410N K82N/N84S/R150Y/R233E/E240N 342
Y155F/K247N/N249S/R338E/R403E/ Y[155]F/K82N/N84S/R170E/R233E/ 343
E410N E240N K247N/N249S/R338E/R403E/E410N
K82N/N84S/R170E/R233E/E240N 344 R318Y/R338E/T343R/R403E
R150Y/R170E/T175R/R233E 345 Y155F/R318Y/R338E/T343R/R403E
Y[155]F/R150Y/R170E/T175R/R233E 346 R318Y/R338E/T343R/E410N
R150Y/R170E/T175R/E240N 347 Y155F/R318Y/R338E/T343R/E410N
Y[155]F/R150Y/R170E/T175R/E240N 348 R318Y/T343R/R403E/E410N
R150Y/T175R/R233E/E240N 349 Y155F/R318Y/T343R/R403E/E410N
Y[155]F/R150Y/T175R/R233E/E240N 350 R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N 351 Y155F/R338E/T343R/R403E/E410N
Y[155]F/R170E/T175R/R233E/E240N 352 Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 353 T343R/R403E/E410N
T175R/R233E/E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/ 354 R403E/E410N R233E/E240N
K228N/I251S/R318Y/R338E/R403E/ K63N/I86S/R150Y/R170E/R233E/ 355
E410N E240N Y155F/K228N/I251S/R318Y/R338E/
Y[155]F/K63N/I86S/R150Y/R170E/ 356 R403E/E410N R233E/E240N
N260S/R318Y/R338E/T343R/R403E/ N95S/R150Y/R170E/T175R/R233E/ 357
E410N E240N Y155F/N260S/R318Y/R338E/T343R/
Y[155]F/N95S/R150Y/R170E/T175R/R233E/ 358 R403E/E410N E240N
K228N/K247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/ 359
T343R/R403E/E410N T175R/R233E/E240N Y155F/K228N/K247N/N249S/R318Y/
Y[155]F/K63N/K82N/N84S/R150Y/ 360 R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N Y155F/R338E/T343R/R403E
Y[155]F/R170E/T175R/R233E 361 R338E/T343R/R403E R170E/T175R/R233E
362 Y155F/R338E/T343R/R403E/E410S Y[155]F/R170E/T175R/R233E/E240S
363 Y155F/N260S/R338E/T343R/R403E Y[155]F/N95S/R170E/T175R/R233E
364 Y155F/I251S/R338E/T343R/R403E Y[155]F/I86S/R170E/T175R/R233E
365 R318Y/R338E/T343R/R403E/E410S R150Y/R170E/T175R/R233E/E240S 366
Y155F/K247N/N249S/T343R/R403E Y[155]F/K82N/N84S/T175R/R233E 367
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 368
T343R/R403E T175R/R233E K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/ 369 R403E R233E
Y155F/K247N/N249S/R338E/T343R/ Y[155]F/K82N/N84S/R170E/T175R/ 370
R403E/E410N R233E/E240N K247N/N249S/R338E/T343R/R403E/
K82N/N84S/R170E/T175R/R233E/ 371 E410N E240N
Y155F/K247N/N249S/R318Y/R338E Y[155]F/K82N/N84S/R150Y/R170E 372
Y155F/K247N/N249S/R318Y/T343R Y[155]F/K82N/N84S/R150Y/T175R 373
Y155F/K247N/N249S/R318Y/R403E Y[155]F/K82N/N84S/R150Y/R233E 374
Y155F/K247N/N249S/R318Y/E410N Y[155]F/K82N/N84S/R150Y/E240N 375
Y155F/K247N/N249S/R338E/R403E Y[155]F/K82N/N84S/R170E/R233E 376
Y155F/K247N/N249S/R338E/T343R Y[155]F/K82N/N84S/R170E/T175R 377
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 378
T343R/E410N T175R/E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/ 379 E410N E240N
Y155F/K247N/N249S/R318Y/T343R/ Y[155]F/K82N/N84S/R150Y/T175R/ 380
R403E/E410N R233E/E240N K247N/N249S/R318Y/T343R/R403E/
K82N/N84S/R150Y/T175R/R233E/ 381 E410N E240N
Y155F/K247N/N249S/R338E/E410N Y[155]F/K82N/N84S/R170E/E240N 382
Y155F/K247N/N249S/R318Y/T343R/ Y[155]F/K82N/N84S/R150Y/T175R/ 383
R403E R233E K247N/N249S/R318Y/T343R/R403E
K82N/N84S/R150Y/T175R/R233E 384 Y155F/K247N/N249S/R318Y/T343R/
Y[155]F/K82N/N84S/R150Y/T175R/ 385 E410N E240N
K247N/N249S/R318Y/T343R/E410N K82N/N84S/R150Y/T175R/E240N 386
Y155F/K247N/N249S/R338E/T343R/ Y[155]F/K82N/N84S/R170E/T175R/ 387
R403E R233E K247N/N249S/R338E/T343R/R403E
K82N/N84S/R170E/T175R/R233E 388 Y155F/K247N/N249S/R338E/T343R/
Y[155]F/K82N/N84S/R170E/T175R/ 389 E410N E240N
K247N/N249S/R338E/T343R/E410N K82N/N84S/R170E/T175R/E240N 390
Y155F/K247N/N249S/T343R/R403E/ Y[155]F/K82N/N84S/T175R/R233E/ 391
E410N E240N K247N/N249S/T343R/R403E/E410N
K82N/N84S/T175R/R233E/E240N 392 Y155F/R318Y/R338E/T343R
Y[155]F/R150Y/R170E/T175R 393 R318Y/R338E/T343R R150Y/R170E/T175R
394 Y155F/R318Y/T343R/R403E Y[155]F/R150Y/T175R/R233E 395
Y155F/T343R/R403E/E410N Y[155]F/T175R/R233E/E240N 396
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 397
T343R T175R K247N/N249S/R318Y/R338E/T343R
K82N/N84S/R150Y/R170E/T175R 398 Y155F/K247N/N249S/T343R/E410N
Y[155]F/K82N/N84S/T175R/E240N 399 Y155F/K247N/N249S/R403E/E410N
Y[155]F/K82N/N84S/R233E/E240N 400 Y155F/R338E/T343R/E410N
Y[155]F/R170E/T175R/E240N 401 R338E/T343R/E410N R170E/T175R/E240N
402 Y155F/R318Y/T343R/E410N Y[155]F/R150Y/T175R/E240N 403
R318Y/T343R/E410N R150Y/T175R/E240N 404
K228N/R318Y/R338E/T343R/R403E/ K63N/R150Y/R170E/T175R/R233E/ 405
E410N E240N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/ 406 T343R/R403E T175R/R233E
K228N/K247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/ 407
T343R/E410N T175R/E240N K228N/K247N/N249S/R318Y/T343R/
K63N/K82N/N84S/R150Y/T175R/ 408 R403E/E410N R233E/E240N
Y155F/R338E/R403E/E410N Y[155]F/R170E/R233E/E240N 409
Y155F/R318Y/R338E/R403E Y[155]F/R150Y/R170E/R233E 410
Y155F/R318Y/R403E/E410N Y[155]F/R150Y/R233E/E240N 411 Y1N Y[1]N
412
C. Expression and Purification of FIX Polypeptides
[0576] Wild-type and variant FIX polypeptides were expressed in
CHO-Express (CHOX) cells (Excellgene). CHO Express (CHOX) cells
were maintained in DM204B Complete medium (Irvine Scientific) and
used to inoculate production seed cultures. Seed cultures were
grown in the same media to approximately 1.4.times.10.sup.7 viable
cells (vc)/mL and approximately 100 mL used to inoculate
approximately 1.0 L of DM204B Complete media, so that the
inoculation density was 1.2.times.10.sup.6 vc/mL. This culture was
grown for 3 days to reach 13-16.times.10.sup.6 vc/mL on the day of
transfection. A transfection complex was formed by mixing FIX
plasmid DNA (3.2 mg) with Polyethylenimine "MAX" (PEI-20.5 mg
(Polysciences)) and diluting to 1.0 L with serum-free TfMAX2
transfection medium (Mediatech). This mixture was then added to the
1.0 L production culture. 1.0 L aliquots of the cells plus
transfection mix were split into 2.times.3 L baffled Fernback
Flasks and allowed to express for 4 days before harvesting the
crude FIX. Culture supernatants were then harvested by filtration
and FIX was purified.
[0577] Larger-scale cultures of 10 L or greater were produced in
WAVE bioreactors (GE Healthcare). 20 L wave bags were inoculated
with approximately 400 mL of seed culture, grown as described
above, with 4.6 L of DM204B Complete media to a seeding density of
1.2.times.10.sup.6 vc/mL. The WAVE bioreactor was set to a rocking
angle of 6 degrees, rocking rate of 24 rpm at 37.1.degree. C. in
order to allow the cells to reach a cell density of
13-16.times.10.sup.6 vc/mL 3 days later. 16 mg of FIX plasmid DNA
and 102.5 mg of PEI were combined to form a transfection complex,
which was diluted in 5.0 L of TfMAX2 prior to addition to the
culture on the WAVE bioreactor, 3 days after the initial seeding.
While the Transfection complex plus TfMAX media was added to the
wave bag, the rocking angle of the WAVE Bioreactor was set to 8
degrees and the temperature to 33.degree. C., while the other
settings remained the same. The culture was allowed to express for
4 days before harvesting the crude FIX. The contents of the wave
bags were allowed to settle for 3 hrs at 4.degree. C. prior to
harvesting the culture supernatant through a CUNO depth filter and
then the FIX was purified.
[0578] FIX polypeptides were purified using a Capto Q column (GE
Healthcare), to which FIX polypeptides with functional Gla domains
adsorb, followed by a calcium elution step. Typically, EDTA (10
mM), Tris (25 mM, pH 8.0), and Tween-80 (0.001%) were added to the
culture supernatant from the transfected cells. The samples were
loaded onto a Capto Q column that had been pre-equilibrated with
Buffer B (25 mM Tris pH 8, 1 M NaCl, 0.001% Tween-80), followed by
equilibration with Buffer A (25 mM Tris pH 8, 0.15 M NaCl, 0.001%
Tween-80). Immediately following completion of sample loading, the
column was washed with 14% Buffer B (86% Buffer A) for 20 column
volumes. Buffer C (25 mM Tris pH 8, 0.2 M NaCl, 0.001% Tween-80, 10
mM CaCl.sub.2) was then applied to the column to elute the FIX
polypeptides that were collected as a pool.
[0579] The eluted pool was further purified using a Q Sepharose HP
column (GE Healthcare). The sample was prepared for application by
diluting with 2 volumes of Buffer D (25 mM Tris pH 8, 0.001%
Tween-80). The diluted sample was loaded onto a Q Sepharose HP
column that had been pre-equilibrated with Buffer F (25 mM Tris pH
8, 1 M NaCl, 2.5 mM CaCl.sub.2, 0.001% Tween-80), followed by
Buffer E (25 mM Tris pH 8, 2.5 mM CaCl.sub.2, 0.001% Tween-80).
After washing with 4% Buffer F (96% Buffer E), a gradient from
4-40% Buffer F was applied to the column and fractions were
collected. Fractions containing FIX polypeptides were then
pooled.
D. Purification to Enrich for Glycosylated Polypeptides.
[0580] The extent of glycosylation of the modified FIX polypeptides
was estimated using SDS-polyacrylamide gel electrophoresis.
Hyperglycosylation was assessed by comparison of the migration
pattern of the modified FIX polypeptide with a wild type FIX,
Benefix.RTM.Coagulation FIX. Hyperglycosylated forms of the enzyme
migrated slower, exhibiting a higher apparent molecular weight,
than the wild type polypeptide. It was observed that the
polypeptides containing the E240N mutation, which introduces a
non-native N-glycosylation site at position 240, were only
partially glycosylated (approximately 20% glycosylation). To enrich
for the hyperglycosylated form, a modification of the purification
process described above was performed.
[0581] The first step of purification was performed using the Capto
Q column, as described above. The eluted pool from this column was
diluted with 2 volumes of Buffer D (as above) and the sample was
loaded onto a Heparin Sepharose column that had been
pre-equilibrated with Buffer F (as above), followed by Buffer E (as
above). The column was then developed with a gradient from 0% to
70% Buffer F and fractions were collected. The hyperglycosylated
form of the E410N variant eluted from the column in approximately
35% Buffer F, whereas the non-hyperglycosylated form eluted in
approximately 50% Buffer F. Each collected pool was further
purified on the Q Sepharose HP column as described above. By this
method a pool containing approximately 80% hyperglycosylated form
of the E410N variant was obtained. The extent of hyperglycosylation
was estimated by visual inspection of SDS-polyacrylamide gel
electrophoresis.
Example 2
Activation of FX and Determination of the Catalytically Active
Protease (FXa) Concentration using the Active Site Titrant
Fluorescein-mono-p'-Guanidinobenzoate (FMGB)
[0582] The concentration of Factor X (FX) in a stock of FX that can
become catalytically active was determined. This stock of FX was
then used in subsequent studies to calculate the catalytic activity
of FIX variants for FX. Following activation of FX to FXa, the
active site titration assay was carried out essentially as
described by Bock et al. (Archives of Biochemistry and Biophysics
(1989) 273:375-388) using the fluorogenic ester substrate
fluorescein-mono-p'-guanidinobenzoate (FMGB), with a few minor
modifications. FMGB readily reacts with FXa, but not FX or inactive
protease, to form an effectively stable acyl-enzyme intermediate
under conditions in which the concentration of FMGB is saturating
and deacylation is especially slow and rate limiting for catalysis.
Under these conditions, the FXa protease undergoes a single
catalytic turnover to release the fluorescein fluorophore. When the
initial burst of fluorescence is calibrated to an external
concentration standard curve of fluorescein fluorescence, the
concentration of active sites can be calculated.
A. Activation of FX to FXa
[0583] The concentration of FX in a stock solution that is able to
become catalytically active was determined by activation of FX
samples with Russell's Viper Venom, followed by titrating the
active FX (FXa) with FMGB. FX zymogen stocks were first pre-treated
by the supplier with DFP (diisopropylfluorophosphate) and EGR-cmk
to reduce the background FXa activity. FXa activation reactions
were prepared with a final concentration of 10 .mu.M FX (based on
the A.sub.280 absorbance and an extinction coefficient of 1.16) in
a final volume of 50-100 .mu.L in a reaction buffer containing 100
mM Tris, 50 mM NaCl, 5 mM CaCl.sub.2, 0.1% PEG 8000, pH 8.1.
Activation was initiated by the addition of Russell's Viper Venom
(RVV-Xase; Heamatologic Technologies, Inc.) to a final
concentration of 5 pg/mL (5 .mu.L of a 98 .mu.g/mL dilution per 100
.mu.L reaction or 2.5 .mu.L per 50 .mu.L reaction) at 37.degree. C.
for 45-60 min of activation time (previously determined to
represent complete activation by collecting samples every 15 min
and testing the increase in cleavage of Spectrafluor FXa
fluorogenic substrate). Reactions were quenched with 1/10 volume of
quench buffer containing 100 mM Tris, 50 mM NaCl, 5 mM, 100 mM
EDTA, 0.1% PEG 8000, pH 8.1.
B. Active Site Titration.
[0584] The active site titration assays were performed with a 1 mL
reaction volume in a 0.4 cm.times.1 cm quartz cuvette under
continuous stirring. Reactions contained 100-400 nM of the freshly
activated FXa and 5 .mu.M FMGB in an assay buffer containing 30 mM
Hepes, 135 mM NaCl, 1 mM EDTA and 0.1% PEG 8000, pH 7.4. FMGB was
prepared at a stock concentration of 0.01 M in DMF based on the dry
weight and the concentration confirmed by absorbance spectroscopy
at 452 nm using an extinction coefficient of 19,498 M.sup.-3
cm.sup.-1 in Phosphate Buffered Saline (PBS), pH 7.2. Assays were
initiated by adding 5 .mu.L of 1 mM FMGB (5 .mu.M final
concentration) to 1 mL of 1.times. assay buffer and first measuring
the background hydrolysis of FMGB for .about.150-200 seconds before
the addition of FXa to a final concentration of .about.100-400 nM.
The release of fluorescein fluorescence in the burst phase of the
reaction was followed for an additional 3600 seconds.
[0585] The amount of fluorescein released following catalysis of
FMGB by FXa was determined using a standard curve of free
fluorescein. The fluorescein standard solution was freshly prepared
at a stock concentration of .about.70-150 mM in DMF and the
accurate concentration was confirmed by absorbance spectroscopy
under standard conditions at 496 nm using an extinction coefficient
of 89,125 cm.sup.-1 in 0.1 N NaOH. A standard curve of free
fluorescein was then prepared by titration of the
absorbance-calibrated fluorescein standard into 1.times. assay
buffer in 20 nM steps to a final concentration of 260-300 nM.
[0586] For data analysis, reaction traces were imported into the
Graphpad Prism software package and the contribution of background
hydrolysis was subtracted from the curve by extrapolation of the
initial measured rate of spontaneous FMGB hydrolysis, which was
typically less than 5% of the total fluorescence burst. The
corrected curve was fit to a single exponential equation with a
linear component (to account for the slow rate of deacylation) of
the form .DELTA.Fluorescence=Amp(1-e.sup.kt)+Bt, where Amp=the
amplitude of the burst phase under the saturating assay conditions
outline above, k is the observed first order rate constant for
acyl-enzyme formation and B is a bulk rate constant associated with
complete turnover of FMGB. The concentration of active FXa protease
was calculated by comparison of the fit parameter for amplitude to
the fluorescein standard curve. The values from multiple assays
were measured, averaged and the standard deviation determined. The
amount of active FXa in the preparation directly represents the
concentration of FX in a stock preparation that can be activated by
FIXa. This active site titrated value was employed when calculating
the concentration of FX to be used in an indirect assay, such as
the cofactor-dependent assay described in Example 4, below.
Example 3
Activation of FIX and Determination of the Catalytically Active
Protease (FIXa) Concentration using the Active Site Titrant
4-methylumbelliferyl p'-guanidinobenzoate (MUGB)
[0587] The concentration of Factor IX (FIX) in a stock solution of
the FIX zymogen that is able to become catalytically active was
determined by activation of FIX samples, including FIX variants,
with Factor XIa (FXIa; Heamatologic Technologies, Inc.) followed by
titrating the active Factor IX (FIXa) with 4-methylumbelliferyl
p'-guanidinobenzoate (MUGB).
A. Activation of FIX to FIXa
[0588] Total protein concentrations in the FIX polypeptide
preparations were determined by the A.sub.280 absorbance using an
extinction coefficient unique for each variant (i.e.
.epsilon..sub.280=number of Tyr residues.times.1490+number Trp
residues.times.5500+number Cys residues.times.125). Activation
reactions of FIX to FIXa were prepared at a final concentration of
10 .mu.M FIX in a final volume of 200-500 .mu.L in a reaction
buffer containing 100 mM Tris, 50 mM NaCl, 5 mM CaCl.sub.2, 0.1%
PEG 8000, pH 8.1. Activations were initiated by the addition of
FXIa or biotinylated FXIa to a final concentration of 20 nM at
37.degree. C. for 60 min of activation time. A 60 minute activation
time was previously determined to represent complete activation by
collecting samples every 15 min and assaying for total cleavage by
SDS-PAGE.
[0589] The free FXIa or biotinylated FXIa used in the activation
reaction was then removed from the samples using one of two methods
that produce equivalent results, each removing greater than 95-97%
of the catalytic FXIa. In the first method, which was used to
remove free FXIa, activation reactions initiated with FXIa were
mixed with an anti-FXIa monoclonal antibody (Abeam 20377) to a
final concentration of 50 nM for 60 min at 37.degree. C. Antibody
capture of free FXIa was followed by the addition of washed protein
G Dynal Beads (30 mg/mL; Invitrogen) to a final concentration of
25% vol:vol for an additional 120 min at room temperature. The
Dynal Beads were removed from the solution per the manufacturer's
instructions. In the second method, which was used to removed
biotinylated FXIa, activation reactions using biotinylated FXIa
were mixed with Streptavidin Dynal Beads (10 mg/mL; Invitrogen) to
a final concentration of 10% vol:vol for 60 min at room
temperature. The Dynal Beads were then removed per the
manufacturer's instructions. Following removal of the FXIa, the
total protein concentrations of activated FIXa samples were
determined by A.sub.280 absorbance using an extinction coefficient
unique for each variant (as described above).
B. Active Site Titration of FIXa
[0590] The concentration of catalytically active FIXa in an
activated stock solution was determined by titrating the FIXa
samples with a fluorogenic ester substrate, 4-methylumbelliferyl
p'-guanidinobenzoate (MUGB). The principle titration assay was
carried out essentially as described by Payne et al. (Biochemistry
(1996) 35:7100-7106) with a few minor modifications to account for
the slower reactivity of MUGB with FIXa. MUGB readily reacts with
FIXa, but not FIX or inactive protease, to form an effectively
stable acyl-enzyme intermediate under conditions in which the
concentration of MUGB is saturating and deacylation is especially
slow and rate limiting for catalysis. Under these conditions, the
FIXa protease undergoes a single catalytic turnover to release the
4-methylumbelliferone fluorophore (4-MU). When the initial burst of
fluorescence is calibrated to an external concentration standard
curve of 4-MU fluorescence, the concentration of active sites can
be calculated.
[0591] Assays were performed with a 1 mL reaction volume in a 0.4
cm.times.1 cm quartz cuvette, under continuous stirring with an
assay buffer containing 50 mM Hepes, 100 mM NaCl, 5 mM CaCl.sub.2
and 0.1% PEG 8000, pH 7.6. MUGB was prepared at a stock
concentration of 0.04 M in DMSO based on the dry weight and diluted
to a working concentration of 2 mM in DMSO. Titration assays were
initiated by adding 4 .mu.L of 2 mM MUGB to a final concentration
of 8 .mu.M in 1.times. assay buffer and first measuring the
background hydrolysis of MUGB for .about.200-300 seconds before the
addition of the FIXa or FIXa variant to a final concentration of
100-200 nM based on the total protein concentration determined for
the activation reaction after removal of FXIa. The release of 4-MU
fluorescence in the burst phase of the reaction was followed for a
total of 2 hours in order to acquire sufficient data from the
initial burst and subsequent steady state phases.
[0592] The amount of 4-MU released following catalysis of MUGB by
FIXa was determined using a standard curve of 4-MU. A 4-MU standard
solution was prepared at a stock concentration of 0.5 M in DMSO and
the concentration confirmed by absorbance spectroscopy at 360 nm
using an extinction coefficient of 19,000 M.sup.-1 cm.sup.-1 in 50
mM Tris buffer, pH 9.0. The standard curve of free 4-MU was
prepared by titration of the absorbance-calibrated 4-MU into
1.times. assay buffer in 20 nM steps to a final concentration of
260-300 nM 4-MU.
[0593] For data analysis, reaction traces were imported into the
Graphpad Prism software package and the contribution of background
hydrolysis was subtracted from the curve by extrapolation of the
initial measured rate of spontaneous MUGB hydrolysis, which was
typically less than 5% of the total fluorescence burst. The
corrected curve was fit to a single exponential equation with a
linear component (to account for the slow rate of deacylation in
the steady state phase) of the form
.DELTA.Fluorescence=Amp(1-e.sup.-kt)+Bt, where Amp=the amplitude of
the burst phase under the saturating assay conditions outline
above, k is the observed first order rate constant for acyl-enzyme
formation and B is a bulk rate constant associated with complete
turnover of MUGB. The concentration of active FIXa protease is
calculated by comparison of the fit parameter for amplitude to the
4-MU standard curve. The values from multiple assays were measured,
averaged and the standard deviation determined. The concentration
of FIX zymogen, which may become activated, in a stock solution was
then determined by multiplying the A.sub.280 determined total
concentration of the FIX zymogen by the experimentally determined
fraction active value for the fully activated sample (concentration
of active FIXa/total concentration of FIXa).
Example 4
Determination of the Catalytic Activity of FIXa for its Substrate,
Factor X
[0594] The catalytic activity of the FIXa variants for the
substrate, Factor X (FX), was assessed indirectly in a fluorogenic
assay by assaying for the activity of FXa, generated upon
activation by FIXa, on the synthetic substrate Spectrafluor FXa. A
range of FX concentrations were used to calculate the kinetic rate
constants where the substrate protease (FX) was in excess by at
least a 1000-fold over the concentration of the activating protease
(FIXa). Briefly, activated and active site titrated FIXa was
incubated in a calcium containing buffer with recombinant FVIII,
phospholipid vesicles and alpha-thrombin (to activate FVIII to
FVIIIa), forming the tenase (Xase) complex. The activity of
alpha-thrombin was then quenched by the addition of a highly
specific thrombin inhibitor, hirudin, prior to initiating the
assay. FIXa variants (as part of the Xase complex) were
subsequently mixed with various concentrations of FX and the
fluorescent substrate, Spectrafluor FXa
(CH.sub.3SO.sub.2-D-CHA-Gly-Arg-AMC) to initiate the assay. The
release of the free fluorophore, AMC (7-amino-4-methylcoumarin)
following catalysis of Spectrafluor FXa by FXa was then assessed
continuously over a time period, and the kinetic rate constants of
the FIXa variants determined
A. Assay Protocol
[0595] For assays evaluating the kinetic rate of FX activation by
FIXa in the presence of FVIIIa and phospholipids, recombinant FVIII
(Kogenate FS.RTM.; Bayer healthcare) was first resuspended in 5 mL
of the provided diluent according to the manufacturer's
instructions. The molar concentration of FVIII was then determined
by absorbance at 280 nm using an extinction coefficient of 1.567
mg.sup.-1 mL cm.sup.-1 and a molecular weight of 163.6 kDa. The FIX
variants were expressed, purified, activated and active site
titrated as described in Examples 1-3, above. FIXa variants were
then serially diluted to a concentration of 16 pM in a 200 .mu.L
volume of 1.times. Buffer A (20 mM Hepes/150 mM NaCl/5 mM
CaCl.sub.2/0.1% BSA/0.1% PEG-8000, pH 7.4). In preparation for
activation of FVIII to FVIIIa in the presence of FIXa and
phospholipids, alpha-thrombin (Heamatologic Technologies, Inc.) and
hirudin (American Diagnostica) were each diluted in a 1.0 mL volume
of 1.times. Buffer A to 64 nM and 640 nM, respectively.
Reconstituted FVIII was further diluted to a concentration of 267
nM in a 10 mL volume of 1.times. Buffer A containing 267 .mu.M
freshly resuspended phospholipids (75% phosphatidylcholine (PC)/25%
phosphatidylserine (PS); PS/PC vesicles .about.120 nm in diameter;
Avanti Polar Lipids). FVIII was activated to FVIIIa by mixing 600
.mu.L of the above FVIII/PC/PS solution with 100 .mu.L of the 16
.mu.M wild-type FIXa or FIXa variant dilution and 50 .mu.L of the
64 nM alpha-thrombin solution followed by 15 minutes of incubation
at 25.degree. C. Activation reactions were subsequently quenched by
the addition of 50 .mu.L of the above 640 nM hirudin solution for 5
min at 25.degree. C. prior to initiating the kinetic assay for FX
activation. The final concentration of reagents in the 800 .mu.L
Xase complex solutions was as follows: 2 pM FIXa variant, 200 nM
FVIIIa, 200 .mu.M PC/PS vesicles, 4 nM alpha-thrombin (inhibited)
and 40 nM hirudin.
[0596] A total of 25 .mu.L of each Xase complex solution
(FIXa/FVIIIa/Phospholipids/Ca.sup.2+) was aliquoted into a 96-well
half-area black assay plate according to a predefined plate map (4
FIXa variants/plate). A solution of 900 nM active site titrated and
DFP/EGR-cmk treated FX (see Example 2, above) was prepared in 5.6
mL of 1.times. Buffer A containing 1.0 mM Spectrafluor Xa
substrate. This represented the highest concentration of FX tested
and a sufficient volume for 4 assays. The FX/Spectrafluor Xa
solution was then serially diluted 1.8-fold in an 8-channel
deep-well polypropylene plate with a final volume of 2.5 mL
1.times. Buffer A that contains 1.0 mM Spectrafluor Xa, resulting
in final dilutions of 900 nM, 500 nM, 277.8 nM, 154.3 nM, 85.7 nM,
47.6 nM, 25.6 nM and 0 nM FX. Alternatively in some assays, the
FX/Specrafluor Xa solution was then serially diluted 1.5-fold in a
12-channel deep-well polypropylene plate with a final volume of 2.5
mL 1.times. Buffer A that contains 1.0 mM Spectrafluor Xa,
resulting in final dilutions of 900 nM, 600 nM, 400 nM, 266.7 nM,
177.8 nM, 118.5 nM, 79.0 nM, 52.7 nM, 35.1 nM, 23.4 nM, 15.6 nM and
0 nM FX. Assay reactions were typically initiated using a BioMek FX
liquid handling system programmed to dispense 25 .mu.l of the
FX/Spectrafluor Xa dilutions into 4 assay plates containing 25
.mu.L of each FIXa variant (Xase complex). The final concentrations
of the reagents in the assay were as follows: 1 .mu.M FIXa, 100 nM
FVIIIa, 100 .mu.M PC/PS vesicles, 0.5 mM Spectrafluor Xa, 2 nM
alpha-thrombin (inhibited), 20 nM hirudin and FX dilutions of 0 nM
to 450 nM. Reactions were monitored in a SpectraMax fluorescence
plate reader for 30 mM at 37.degree. C. A standard curve of free
AMC served as the conversion factor for RFU to .mu.M in the
subsequent data analysis calculations using a dose range that
covered 0 .mu.M to 100 .mu.M AMC.
B. Data Analysis
[0597] All equations used to determine the steady-state kinetics of
the catalysis of FX by FIXa are based on those described in the
reference "Zymogen-Activation Kinetics: Modulatory effects of
trans-4-(aminomethyl)cyclohexane-1-carboxylic acid and
poly-D-lysine on plasminogen activation" in Petersen, et al. (1985)
Biochem. J. 225:149-158. The theory for the steady-state kinetics
of the system described by Scheme A (see below) is described by the
expression of equation (1) that represents a parabolic accumulation
of product.
##STR00001##
[0598] According to the mechanism of Scheme A, a.sub.0 is the
concentration of activating protease (FIXa), z.sub.0 is the
concentration of zymogen (FX), k.sub.a and K.sub.z represent the
k.sub.cat and K.sub.M for the activator-catalyzed conversion of
zymogen to active enzyme (FXa), whereas k.sub.e and K.sub.s
represent the k.sub.cat and K.sub.M for conversion of substrate to
product by FXa over a given time t:
p = a 0 k a [ z 0 ] K z + [ z 0 ] * k e [ S 0 ] K s + [ S 0 ] * t 2
2 Equation ( 1 ) ##EQU00001##
[0599] For analysis of progress curves, equation (1) was re-cast in
the form of equation (2) where the steady-state kinetics of FXa
hydrolysis of the fluorogenic substrate were determined
independently and replaced by the compound constant k.sub.2.
p = a 0 k a [ z 0 ] K z + [ z 0 ] * k 2 * t 2 2 Equation ( 2 )
##EQU00002##
[0600] The FXa activity on Spectrofluor FXa in 1.times. Buffer A
was independently determined to have a K.sub.M of 313.0 .mu.M and a
k.sub.cat value of 146.4 s.sup.-1. Substitution of these values
into equation (3) gave a k.sub.2 correction factor of 90
s.sup.-1.
k 2 = k e [ S 0 ] K M + [ S 0 ] Equation ( 3 ) ##EQU00003##
[0601] To determine the degree of FIXa catalytic activity, raw data
collected with the SoftMax Pro application (Molecular Devices) were
exported as .XML files or .TXT files. Further non-linear data
analyses were performed with XLfit4, a software package for
automated curve fitting and statistical analysis within the
Microsoft Excel spreadsheet environment (IDBS Software) or directly
within the ActivityBase software package using the XE Runner data
analysis module (IDBS Software). The spreadsheet template was set
up to automatically fit the parabolic reaction velocities
(.mu.M/sec.sup.2) of the tested FIXa variants at each FX
concentration to the function of a standard rectangular hyperbola
(i.e. Michaelis Menten equation) given by equation (4) to yield the
fit values for V.sub.max and K.sub.M.
Reaction Velocity ( M / sec 2 ) = V max [ S 0 ] K M + [ S 0 ]
Equation ( 4 ) ##EQU00004##
[0602] The k.sub.cat value for the tested FIXa variant was then
calculated from the fit value for V.sub.max (.mu.M/sec.sup.2) by
equation (5).
k cat = V max [ FIXa ] * 0.5 * k 2 Equation ( 5 ) ##EQU00005##
[0603] The specificity constant K.sub.cat/K.sub.M was calculated
directly from the fit value of K.sub.M and the calculated k.sub.cat
that arose from evaluation of equation (5) above.
[0604] Tables 14-19 set forth the catalytic activity for each of
the FIXa variants assayed. Also assayed were recombinant wild-type
FIXa (termed Catalyst Biosciences WT; generated as described above
in Example 1), plasma purified FIXa (Haematologic Technologies,
Inc.), and BeneFIX.RTM. (Coagulation Factor IX (Recombinant);
Wyeth). Tables 14-15 present the results expressed as the kinetic
constant for catalytic activity, k.sub.cat/K.sub.M
(M.sup.-1s.sup.-1), and also as the percentage of the activity of
the wild-type FIXa, wherein the activity is catalytic activity,
k.sub.cat/K.sub.M (M.sup.-1s.sup.-1) of each FIXa variant for its
substrate, FX. The individual rate constants k.sub.cat and K.sub.M
are provided in Tables 16-17 and 18-19, respectively. Tables 15, 17
and 19 reflect data for additional FIXa variants and provide new
overall averages calculated to include additional experimental
replicates (n) for FIXa variants in Tables 14, 16 and 18. Where the
activity of the FIXa variant was compared to wild-type FIXa, it was
compared to a recombinant wild-type FIXa polypeptide that was
expressed and purified using the same conditions as used for the
variant FIXa polypeptides to ensure that any differences in
activity were the result of the mutation(s), and not the result of
differences in, for example, post-translational modifications
associated with different expression systems. Thus, the wild-type
FIXa polypeptide used for comparison was the recombinant wild-type
FIXa generated from cloning the FIX gene set forth in SEQ ID NO:1
and expressed from CHOX cells as a polypeptide with an amino acid
sequence set forth in SEQ ID NO:3, as described in Example 1 (i.e.
Catalyst Biosciences WT FIX polypeptide). The standard deviation
(S.D.), coefficient of variation (as a percentage; % CV) and the
number of assays performed (n) also are provided for each kinetic
parameter.
[0605] The observed catalytic activities of the FIXa variants
ranged from no detectable Xase activity in a few variants (e.g.
FIXa-F314N/H315S, FIXa-G317N, FIXa-R318N/A320S and
FIXa-K400E/R403E) to a greater than 10-fold increase in
k.sub.cat/K.sub.M for the activation of FX compared to wild-type
FIXa. Some of the variants displayed markedly increased catalytic
activity compared to the wild-type FIXa, including FIXa-R338E,
FIXa-R338A, FIXa-T343R, FIXa-E410N and combinations thereof such as
FIXa-R318Y/R338E/E410N, FIXa-R318Y/R338E/R402E/E410N,
FIXa-R318Y/R338E/T343R/R402E/E410N, FIXa-R318Y/R338E/T343R/E410N
and FIXa-R338E/T343R displayed some of the greatest increases in
catalytic activity. Although several FIXa variants with single or
multiple additional glycosylation sites demonstrated close to
wild-type activity (e.g. FIXa-I251 S, FIXa-D85N/1251S, FIXa-K63N,
FIXa-K247N/N249S and FIXa-K63N/K247N/N249S) or improved activity
when combined with other mutations (e.g.
FIXa-K247N/N249S/R338E/T343R/R403E and
FIXa-K247N/N249S/R318Y/R338E/T343R/R403E/E410N), others showed
reduced catalytic activity. The augmented catalytic activity was
due to improvements in k.sub.cat or K.sub.M or most often, both
parameters.
TABLE-US-00015 TABLE 14 Catalytic activity of FIXa variants
(k.sub.cat/K.sub.M) % of Mutation (Mature FIX Mutation
(Chymotrypsin k.sub.cat/K.sub.M .+-.S.D. WT Numbering) Numbering)
(M.sup.-1s.sup.-1) (M.sup.-1s.sup.-1) % CV k.sub.cat/K.sub.M n
BeneFIX Benefix .RTM. BeneFIX Benefix .RTM. 4.1E+07 2.1E+07 51% 91%
125 Coagulation FIX (T148A) Coagulation FIX (T[148]A) Plasma
Purified FIXa Plasma Purified FIXa 5.2E+07 2.2E+07 41% 117% 120
Catalyst Biosciences WT Catalyst Biosciences WT 4.5E+07 2.5E+07 56%
100% 31 N157D N[157]D 2.9E+07 8.1E+06 28% 64% 2 Y155F Y[155]F
4.1E+07 1.3E+05 0% 93% 2 A103N/N105S/Y155F A[103]N/N[105]S/Y[155]F
3.9E+07 1.4E+06 4% 88% 2 D104N/K106S/Y155F D[104]N/K[106]S/Y[155]F
3.6E+07 1.0E+06 3% 81% 2 A103N/N105S A[103]N/N[105]S 3.7E+07
1.4E+07 38% 82% 9 D104N/K106S D[104]N/K[106]S 3.8E+07 1.3E+07 34%
86% 9 K106NN108S K[106]NN[108]S 2.8E+07 6.7E+06 24% 62% 7 D85N
D[85]N 7.3E+07 2.8E+07 38% 164% 15 T148A T[148]A 4.0E+07 2.5E+07
62% 89% 30 T148A.dagger. T[148]A.dagger. 2.3E+07 7.6E+06 33% 52% 7
K5A K[5]A 5.6E+07 4.5E+06 8% 125% 2 D64N D[64]N 1.0E+07 1.9E+06 19%
22% 2 D64A D[64]A 2.5E+06 1.1E+06 47% 5% 2 N167D N[167]D 3.1E+07
1.1E+07 34% 69% 2 N167Q N[167]Q 3.5E+07 1.9E+07 53% 79% 4 S61A
S[61]A 4.8E+07 2.5E+07 52% 108% 4 S53A S[53]A 3.5E+07 1.7E+07 48%
78% 3 T159A T[159]A 3.7E+07 1.2E+07 33% 82% 3 T169A T[169]A 4.7E+07
2.0E+07 43% 106% 3 T172A T[172]A 5.0E+07 2.6E+07 52% 112% 3 T179A
T[179]A 5.5E+07 1.3E+07 23% 122% 3 Y155H Y[155]H 5.0E+07 1.4E+07
27% 113% 3 Y155Q Y[155]Q 5.4E+07 2.0E+07 36% 121% 3 S158A S[158]A
3.6E+07 1.1E+06 3% 81% 2 S158D S[158]D 4.0E+07 9.3E+05 2% 89% 2
S158E S[158]E 3.7E+07 3.5E+06 9% 82% 2 N157Q N[157]Q 3.2E+07
2.8E+06 9% 72% 2 D203N/F205T D39N/F41T 2.2E+07 1.2E+07 53% 50% 12
D85N/D203N/F205T D[85]N/D39N/F41T 3.0E+07 6.4E+06 22% 66% 5 K228N
K63N 3.6E+07 1.7E+07 49% 80% 13 D85N/K228N D[85]N/K63N 4.6E+07
1.5E+07 32% 104% 6 A103N/N105S/K228N A[103]N/N[105]S/K63N 2.9E+07
1.0E+07 35% 64% 3 D104N/K106S/K228N D[104]N/K[106]S/K63N 2.6E+07
7.6E+06 29% 59% 3 Y155F/K228N Y[155]F/K63N 4.5E+07 2.4E+06 5% 101%
2 DIO4N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 5.9E+07 1.1E+07 19%
132% 2 K228N K63N 1251 S I86S 5.9E+07 1.2E+07 21% 132% 13
D85N/I251S D[85]N/I86S 5.6E+07 1.1E+07 20% 124% 5
D85N/D104N/K106S/I251S D[85]N/D[104]N/K[106]S/ 3.3E+07 6.4E+06 19%
75% 5 I86S A103N/N105S/I251S A[103]N/N[105]S/I86S 3.9E+07 2.6E+07
67% 87% 3 D104N/K106S/I251S D[104]N/K[106]S/I86S 2.9E+07 1.1E+06 4%
66% 2 Y155F/1251S Y[155]F/I86S 6.7E+07 5.9E+06 9% 149% 2 A262S
A95bS 2.4E+07 1.0E+07 42% 54% 8 K413N K243N 2.9E+07 1.7E+07 58% 64%
5 E410N E240N 1.3E+08 8.6E+07 65% 297% 21 E410N* E240N* 3.0E+07
1.1E+07 36% 66% 11 E239N E74N 2.0E+07 1.1E+07 58% 44% 9 T241N/H243S
T76N/H78S 1.9E+07 5.7E+05 3% 42% 2 K247N/N249S K82N/N84S 5.4E+07
1.7E+07 32% 122% 11 Y155F/K247N/N249S Y[155]F/K82N/N84S 5.1E+07
9.6E+06 19% 113% 4 A103N/N105S/K247N/ A[103]N/N[105]S/K82N/ 4.0E+07
5.2E+06 13% 90% 6 N249S N84S D104N/K106S/K247N/
D[104]N/K[106]S/K82N/ 3.2E+07 3.3E+06 100/0 72% 2 N249S N84S
D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 3.2E+07 1.1E+07 36% 71%
3 K247N/N249S K82N/N84S L321N L153N 1.6E+07 2.0E+06 13% 35% 2
F314N/H315S F145N/H147S No n.d. n.d. 0% 4 Activity S319N/L321S
S151N/L153S 2.8E+07 2.2E+07 78% 64% 3 N260S N95S 1.8E+07 1.2E+07
66% 39% 13 D104N/K106S/N260S D[104]N/K[106]S/N95S 1.3E+07 6.6E+06
51% 29% 2 Y155F/N260S Y[155]F/N95S 1.9E+07 1.6E+07 83% 43% 2
D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 4.3E+06 2.0E+06 46% 10%
2 N260S N95S Y284N Y117N 3.5E+07 1.5E+07 42% 78% 8 G317N G149N No
n.d. n.d. 0% 5 Activity R318N/A320S R150N/A152S No n.d. n.d. 0% 8
Activity R318A R150A 4.9E+07 7.4E+06 15% 108% 3 R318E R150E 1.7E+07
4.2E+06 25% 38% 3 R318Y R150Y 7.0E+07 7.0E+06 10% 156% 3 R312Q
R143Q 1.1E+07 1.8E+06 17% 23% 3 R312A R143A 4.6E+06 9.3E+05 20% 10%
2 R312Y R143Y 1.2E+07 4.2E+06 36% 27% 2 R312L R143L 2.4E+07 9.4E+06
39% 54% 2 V202M V38M 6.6E+07 2.6E+07 39% 148% 2 V202Y V38Y 2.5E+07
1.6E+06 6% 56% 2 D203M D39M 4.5E+07 1.9E+07 42% 101% 5 D203Y D39Y
3.0E+07 2.8E+06 9% 67% 4 A204M A40M 1.8E+07 1.2E+07 67% 40% 5 A204Y
A40Y 4.6E+07 7.6E+06 16% 103% 2 K400A/R403A K230A/R233A 5.3E+06
6.9E+05 13% 12% 2 K400E/R403E K230E/R233E No n.d. n.d. 0% 4
Activity R403A R233A 1.4E+07 3.0E+06 22% 31% 7 R403E R233E 5.5E+06
1.5E+06 28% 12% 6 K400A K230A 2.0E+07 3.1E+06 16% 44% 2 K400E K230E
9.5E+06 1.1E+06 12% 21% 2 K293E K126E 8.1E+06 5.4E+05 7% 18% 2
K293A K126A 2.1E+07 4.4E+06 21% 46% 2 R333A R165A No n.d. n.d. 0% 2
Activity R333E R165E No n.d. n.d. 0% 2 Activity R338A R170A 1.6E+08
2.5E+07 15% 361% 2 R338E R170E 1.8E+08 8.3E+07 45% 408% 10
R338A/R403A R170A/R233A 5.3E+07 1.3E+07 24% 119% 6 R338E/R403E
R170E/R233E 6.2E+07 8.8E+06 14% 138% 2 K293A/R403A K126A/R233A
5.7E+06 1.4E+06 25% 13% 2 K293E/R403E K126E/R233E 1.3E+06 8.5E+04
6% 3% 2 K293A/R338A/R403A K126A/R170A/R233A 2.5E+07 9.5E+06 39% 55%
2 K293E/R338E/R403E K 126E/R170E/R233E 1.7E+07 5.7E+05 3% 37% 2
R318A/R403A R150A/R233A 1.5E+07 1.3E+06 9% 33% 2 R318E/R403E
R150E/R233E 1.2E+06 3.8E+05 33% 3% 2 R318Y/E410N R150Y/E240N
7.5E+07 2.7E+07 35% 168% 21 R338E/E410N R170E/E240N 4.6E+08 1.7E+08
38% 1018% 8 R338E/R403E/E410N R170E/R233E/E240N 7.8E+07 3.7E+07 47%
175% 7 R318Y/R338E/R403E R150Y/R170E/R233E 6.5E+07 4.6E+06 7% 145%
2 D203N/F205T/K228N D39N/F41T/K63N 1.4E+07 2.5E+06 18% 31% 2
D203N/F205T/E410N D39N/F4IT/E240N 4.2E+07 1.7E+07 40% 94% 6
D203N/F205T/R338E D39N/F41T/R170E 1.0E+08 2.3E+07 22% 234% 2
D203N/F205T/R338A D39N/F41T/R170A 6.2E+07 1.4E+07 22% 139% 3
D203N/F205T/R318Y D39N/F41T/R150Y 2.0E+07 2.5E+06 12% 45% 4
D203N/F205T/R338E/ D39N/F41T/R170E/R233E 1.9E+07 4.8E+06 25% 42% 2
R403E K228N/E410N K63N/E240N 8.5E+07 3.4E+07 40% 190% 10
K228N/R338E K63N/R170E 2.1E+08 6.1E+07 29% 469% 2 K228N/R338A
K63N/R170A 2.1E+08 4.6E+07 22% 473% 2 K228N/R318Y K63N/R150Y
4.7E+07 6.5E+06 14% 105% 5 K228N/R338E/R403E K63N/R170E/R233E
4.8E+07 8.6E+06 18% 108% 2 R403E/E410N R233E/E240N 2.1E+07 1.7E+06
8% 47% 2 R318Y/R338E/E410N R150Y/R170E/E240N 3.4E+08 1.4E+08 39%
770% 26 D104N/K106S/R318Y/ D[104]N/K[106]S/R150Y/ 2.6E+08 5.9E+07
23% 581% 4 R338E/E410N R170E/E240N Y155F/R3I8Y/R338E/
Y[155]F/R150Y/R170E/ 3.7E+08 1.3E+08 33% 835% 5 E410N E240N
K228N/R318Y/E410N K63N/R150Y/E240N 1.2E+08 2.6E+07 22% 272% 4
R318Y/R403E/E410N R150Y/R233E/E240N 2.7E+07 3.8E+06 14% 59% 3
R318Y/R338E/R403E/ R150Y/R170E/R233E/E240N 1.2E+08 8.1E+07 69% 262%
14 E410N A103N/N105S/R318Y/ A[103]N/N[105]S/R150Y/ 1.5E+08 7.3E+07
50% 327% 5 R338E/R403E/E410N R170E/R233E/E240N D104N/K106S/R318Y/
D[104]N/K[106]S/R150Y/ 1.7E+08 7.9E+07 47% 377% 3 R338E/R403E/E410N
R170E/R233E/E240N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 1.9E+08
5.0E+07 27% 418% 4 R403E/E410N R233E/E240N A103N/N105S/Y155F/R31
A[103]N/N[105]S/Y[155]F/R 1.3E+08 1.8E+06 1% 283% 2
8Y/R338E/R403E/E410N 150Y/R170E/R233E/E240N D104N/K106S/Y I55F/R31
D[104]N/K[106]S/Y[155]F/R 1.8E+08 9.1E+06 5% 394% 2
8Y/R338E/R403E/E410N 150Y/R170E/R233E/E240N D203N/F205T/R318Y/
D39N/F41T/R150Y/E240N 3.9E+07 2.0E+07 52% 88% 6 E410N R333S R165S
1.1E+05 5.5E+04 51% 0.2% 3 R338L R170L 2.0E+08 2.3E+07 11% 444% 3
K316N K148N 6.2E+06 4.2E+06 69% 14% 3 K316A K148A 6.1E+06 8.2E+05
13% 14% 3 K316E K I48E 7.1E+05 1.4E+05 19% 2% 3 K316S K148S 3.9E+06
6.2E+05 16% 9% 3 K316M K148M 3.1E+07 1.4E+07 46% 70% 3 E239S E74S
3.4E+07 1.8E+07 52% 75% 3 E239A E74A 4.9E+07 6.2E+06 13% 110% 3
E239R E74R 5.6E+07 1.1E+07 19% 126% 3 E239K E74K 5.1E+07 5.1E+06
10% 114% 3 H257F H92F 4.8E+07 6.6E+06 14% 108% 3 H257Y H92Y 3.4E+07
9.1E+06 27% 75% 3 H257E H92E 2.7E+07 1.5E+07 57% 60% 3 H257S H92S
3.5E+07 1.3E+07 36% 78% 3 T412A T242A 4.6E+07 2.8E+07 62% 103% 5
T412V T242V 5.8E+07 3.2E+07 55% 130% 8 E410N/T412A E240N/T242A
8.0E+07 1.7E+07 21% 178% 4 E410N/T412V E240N/T242V 8.8E+07 2.7E+07
30% 197% 4 E410Q E240Q 1.2E+08 7.6E+07 63% 269% . 4 E410S E240S
1.1E+08 6.6E+07 60% 246% 12 E410A E240A 1.1E+08 5.6E+07 50% 248% 10
E410D E240D 6.0E+07 1.6E+07 27% 134% 4 N346D N178D 1.9E+07 8.5E+06
44% 43% 4 Y155F/N346D Y[155]F/N178D 1.3E+07 6.8E+06 53% 29% 2 N346Y
NI 78Y 9.8E+07 2.3E+07 24% 218% 8 Y345A Y177A 1.5E+07 6.3E+06 43%
32% 4 Y345T Y177T 5.0E+07 2.5E+07 50% 112% 4 T343R T175R 1.7E+08
1.1E+08 66% 372% 9 T343E T175E 4.0E+07 2.3E+07 58% 88% 4 T343Q
T175Q 7.1E+07 2.2E+07 30% 159% 3 F342I F174I 5.4E+07 2.9E+07 54%
121% 3 T343R/Y345T T175R/Y177T 9.3E+07 1.8E+07 19% 208% 3
R318Y/R338E R150Y/R170E 1.5E+08 5.3E+07 36% 331% 4
Y259F/K265T/Y345T Y94F/K98T/Y177T 5.6E+07 1.2E+07 21% 126% 2
K228N/1251S K63N/186S 2.2E+07 5.7E+05 3% 50% 2 K228N/R318Y/R338E/
K63N/R150Y/R170E/R233E/ 1.6E+08 6.1E+07 39% 349% 3 R403E/E410N
E240N Y155F/K228N/R318Y/ Y[155]F/K63N/R150Y/R170E 2.0E+08 9.3E+06
5% 453% 2 R338E/R403E/E410N /R233E/E240N D85N/K228N/R318Y/
D[85]N/K63N/R150Y/R170E/ 1.6E+08 2.3E+07 15% 346% 2
R338E/R403E/E410N R233E/E240N 1251S/R318Y/R338E/
186S/R150Y/R170E/R233E/ 1.5E+08 4.2E+07 27% 344% 4 R403E/E410N
E240N D104N/K106S/1251S/R318 D[104]N/K[106]S/186S/R150 1.2E+08
2.0E+07 16% 271% 8 Y/R338E/R403E/E410N Y/R170E/R233E/E240N
Y155F/1251S/R318Y/ Y[155]F/186S/R150Y/R170E/ 1.7E+08 9.2E+06 6%
374% 2 R338E/R403E/E410N R233E/E240N 1251S/R318Y/R338E/
186S/R150Y/R170E/E240N 3.8E+08 6.1E+07 16% 851% 7 E410N
D104N/K106S/1251 S/ D[104]N/K[106]S/186S/R150 1.3E+08 3.2E+07 24%
300% 3 R318Y/R338E/E410N Y/R170E/E240N F314N/K316S F145N/K148S
8.8E+04 8.2E+04 94% 0.2% 2 K247N/N249S/R318Y/
K82N/N84S/R150Y/R170E/ 1.5E+08 4.7E+07 30% 341% 6 R338E/R403E/E410N
R233E/E240N Y155F/K247N/N249S/R31 Y[155]F/K82N/N84S/R150Y/ 1.8E+08
6.1E+07 33% 408% 6 8Y/R338E/R403E/E410N R170E/R233E/E240N
A103N/N105 S/K247N/ A[103]N/N[105]S/K82N/ N249S/R318Y/R338E/
N84S/R150Y/R170E/R233E/ 1.0E+08 7.6E+06 7% 232% 2 R403E/E410N E240N
D104N/K106S/K247N/ D[104]N/K[106]S/K82N/ 8.8E+07 6.5E+06 7% 197% 2
N249S/R318Y/R338E/ N84S/R150Y/R170E/R233E/ R403E/E410N E240N
K247N/N249S/R318Y/ K82N/N84S/R150Y/R170E/ 2.3E+08 6.6E+07 28% 516%
6 R338E/E410N E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R150Y/
3.0E+08 1.3E+08 42% 674% 7 R318Y/R338E/E410N R170E/E240N
R318Y/R338E/R403E/ R150Y/R170E/R233E/E240S 1.8E+08 6.2E+07 34% 401%
4 E410S R318Y/R338E/E410S R150Y/R170E/E240S 3.3E+08 1.2E+08 37%
730% 8 K228N/K247N/N249S K63N/K82N/N84S 3.8E+07 1.2E+07 32% 86% 2
D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 6.3E+07 3.3E+06 5% 142%
2 K228N/K247N/N249S K63N/K82N/N84S D104N/K106S/K228N/
D[104]N/K[106]S/K63N/ 2.3E+07 1.1E+07 48% 51% 5 K247N/N249S
K82N/N84S Y155F/K228N/K247N/ Y[155]F/K63N/K82N/N84S 5.3E+07 5.5E+06
10% 118% 2 N249S K228N/K247N/N249S/R31 K63N/K82N/N84S/R150Y/
1.2E+08 3.8E+07 33% 258% 3 8Y/R338E/R403E/E410N R170E/R233E/E240N
R318Y/R338E/R403E/ R150Y/R170E/R233E/E240N/ 1.9E+08 5.0E+07 26%
424% 4 E410N/T412V T242V R318Y/R338E/R403E/
R150Y/R170E/R233E/E240N/ 2.6E+08 7.4E+07 29% 577% 4 E410N/T412A
T242A R318Y/R338E/R403E/ R150Y/R170E/R233E/T242A 8.0E+07 3.4E+07
42% 178% 4 T412A R318Y/R338E/T412A R150Y/R170E/T242A 3.0E+08
8.3E+07 28% 661% 6 R318Y/R338E/E410N/ R150Y/R170E/E240N/T242V
2.4E+08 1.4E+08 60% 536% 4
T412V N260S/R318Y/R338E/ N95S/R150Y/R170E/R233E/ 5.3E+07 6.6E+05 1%
117% 2 R403E/E410N E240N D104N/K106S/N260S/R31
D[104]N/K[106]S/N95S/ 8.8E+07 7.9E+06 9% 196% 2
8Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N Y155F/N260S/R318Y/
Y[155]F/N95S/R150Y/R170E/ 7.0E+07 2.4E+07 35% 156% 2
R338E/R403E/E410N R233E/E240N R318Y/R338E/N346D/
R150Y/R170E/N178D/R233E/ 3.1E+07 9.1E+06 30% 68% 2 R403E/E410N
E240N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 6.2E+07 1.8E+07 30%
139% 2 N346D/R403E/E410N N178D/R233E/E240N K247N/N249S/N260S
K82N/N84S/N95S 2.9E+07 2.6E+06 9% 64% 2 Y155F/K247N/N249S/
Y[155]F/K82N/N84S/N95S 1.9E+07 4.2E+06 22% 43% 2 N260S
D104N/K106S/K247N/ D[104]N/K[106]S/K82N/ 9.8E+06 3.0E+06 30% 22% 2
N249S/N260S N84S/N95S D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/
8.2E+06 3.9E+06 47% 18% 2 K247N/N249S/N260S K82N/N84S/N95S
K247N/N249S/N260S/R31 K82N/N84S/N95S/R150Y/ 9.7E+07 8.7E+06 9% 217%
2 8Y/R338E/R403E/E410N R170E/R233E/E240N Y155F/N260S/N346D
Y[155]F/N95S/N178D 2.2E+06 7.4E+05 34% 5% 2 R318Y/R338E/T343R/
R150Y/R170E/T175R/R233E/ 5.4E+08 1.6E+08 29% 1217% 3 R403E/E410N
E240N R338E/T343R R170E/T175R 6.0E+08 1.7E+08 29% 1329% 4
.dagger.produced in BHK-21 cells; *80% glycosylated form of
E410N
TABLE-US-00016 TABLE 15 Catalytic activity of FIXa variants
(k.sub.cat/K.sub.M) % of Mutation (Mature FIX Mutation
(Chymotrypsin k.sub.cat/K.sub.M .+-.S.D. WT Numbering) Numbering)
(M.sup.-1s.sup.-1) (M.sup.-1s.sup.-1) % CV k.sub.cat/K.sub.M n
BeneFIX Benefix .RTM. BeneFIX Benefix .RTM. 4.3E+07 2.3E+07 54% 92%
140 Coagulation FIX (T148A) Coagulation FIX (T[148]A) Plasma
Purified FIXa Plasma Purified FIXa 5.6E+07 2.6E+07 46% 122% 200
Catalyst Biosciences WT Catalyst Biosciences WT 4.6E+07 2.5E+07 54%
100% 33 N157D N[157]D 2.9E+07 8.1E+06 28% 62% 2 Y155F Y[155]F
4.1E+07 1.3E+05 0% 90% 2 A103N/N105S/Y155F A[103]N/N[105]S/Y[155]F
3.9E+07 1.4E+06 4% 85% 2 D104N/K106S/Y155F D[104]N/K[106]S/Y[155]F
3.6E+07 1.0E+06 3% 78% 2 A103N/N105S A[103]N/N[105]S 3.7E+07
1.4E+07 38% 80% 9 D104N/K106S D[104]N/K[106]S 3.8E+07 1.3E+07 34%
83% 9 K106N/V108S K[106]N/V[108]S 2.8E+07 6.7E+06 24% 60% 7 D85N
D[85]N 7.0E+07 2.7E+07 39% 153% 17 T148A T[148]A 4.0E+07 2.2E+07
54% 88% 44 T148A.dagger. T[148]A.dagger. 2.3E+07 7.6E+06 33% 50% 7
K5A K[5]A 5.5E+07 9.3E+06 17% 120% 4 D64N D[64]N 1.0E+07 1.9E+06
19% 22% 2 D64A D[64]A 2.5E+06 1.1E+06 47% 5% 2 N167D N[167]D
3.1E+07 1.1E+07 34% 67% 2 N167Q N[167]Q 3.5E+07 1.9E+07 53% 76% 4
S61A S[61]A 4.8E+07 2.5E+07 52% 105% 4 S53A S[53]A 3.5E+07 1.7E+07
48% 76% 3 T159A T[159]A 3.7E+07 1.2E+07 33% 80% 3 T169A T[169]A
4.7E+07 2.0E+07 43% 103% 3 T172A T[172]A 5.0E+07 2.6E+07 52% 109% 3
T179A T[179]A 5.5E+07 1.3E+07 23% 119% 3 Y155H Y[155]H 5.0E+07
1.4E+07 27% 109% 3 Y155Q Y[155]Q 5.4E+07 2.0E+07 36% 117% 3 S158A
S[158]A 3.6E+07 1.1E+06 3% 79% 2 S158D S[158]D 4.0E+07 9.3E+05 2%
86% 2 S158E S[158]E 3.7E+07 3.5E+06 9% 80% 2 N157Q N[157]Q 3.2E+07
2.8E+06 9% 70% 2 D203N/F205T D39N/F41T 2.2E+07 1.2E+07 53% 49% 12
D85N/D203N/F205T D[85]N/D39N/F41T 3.0E+07 6.4E+06 22% 64% 5 K228N
K63N 3.6E+07 1.7E+07 49% 77% 13 D85N/K228N D[85]N/K63N 4.6E+07
1.5E+07 32% 101% 6 A103N/N105S/K228N A[103]N/N[105]S/K63N 2.9E+07
1.0E+07 35% 63% 3 D104N/K106S/K228N D[104]N/K[106]S/K63N 2.6E+07
7.6E+06 29% 57% 3 Y155F/K228N Y[155]F/K63N 4.5E+07 2.4E+06 5% 98% 2
D104N/K106S/Y155F/K228N D[104]N/K[106]S/Y[155]F/K63N 5.9E+07
1.1E+07 19% 129% 2 I251S I86S 5.9E+07 1.2E+07 21% 128% 13
D85N/I251S D[85]N/I86S 5.6E+07 1.1E+07 20% 121% 5
D85N/D104N/K106S/I251S D[85]N/D[104]N/K[106]S/ 3.3E+07 6.4E+06 19%
73% 5 I86S A103N/N105S/I251S A[103]N/N[105]S/I86S 3.9E+07 2.6E+07
67% 84% 3 D104N/K106S/I251S D[104]N/K[106]S/I86S 2.9E+07 1.1E+06 4%
64% 2 Y155F/I251S Y[155]F/I86S 6.7E+07 5.9E+06 9% 145% 2 A262S
A95bS 2.4E+07 1.0E+07 42% 52% 8 K413N K243N 2.8E+07 1.4E+07 51% 60%
7 E410N E240N 1.3E+08 7.7E+07 60% 277% 27 E410N* E240N* 3.0E+07
1.1E+07 36% 65% 10 E239N E74N 2.0E+07 1.1E+07 58% 43% 9 T241N/H243S
T76N/H78S 1.9E+07 5.7E+05 3% 41% 2 K247N/N249S K82N/N84S 5.4E+07
1.7E+07 32% 118% 11 Y155F/K247N/N249S Y[155]F/K82N/N84S 5.1E+07
9.6E+06 19% 110% 4 A103N/N105S/K247N/ A[103]N/N[105]S/K82N/ 4.0E+07
5.2E+06 13% 87% 6 N249S N84S D104N/K106S/K247N/
D[104]N/K[106]S/K82N/ 3.2E+07 3.3E+06 10% 69% 2 N249S N84S
D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 3.2E+07 1.1E+07 36% 69%
3 K247N/N249S K82N/N84S L321N L153N 1.6E+07 2.0E+06 13% 34% 2
F314N/H315S F145N/H147S 4.4E+05 3.7E+04 8% 1% 2 K392N/K394S
K222N/K224S 0.0E+00 n.d. n.d. 0% 0 S319N/L321S S151N/L153S 2.8E+07
2.2E+07 78% 62% 3 N260S N95S 1.8E+07 1.2E+07 66% 38% 13
D104N/K106S/N260S D[104]N/K[106]S/N95S 1.3E+07 6.6E+06 51% 28% 2
Y155F/N260S Y[155]F/N95S 1.9E+07 1.6E+07 83% 42% 2
D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 4.3E+06 2.0E+06 46% 9%
2 N260S N95S Y284N Y117N 3.5E+07 1.5E+07 42% 76% 8 G317N G149N
4.6E+04 n.d. n.d. 0% 1 R318N/A320S R150N/A152S 2.3E+05 2.1E+05 89%
1% 3 R318A R150A 4.5E+07 6.4E+06 14% 98% 2 R318E R150E 1.7E+07
4.2E+06 25% 37% 3 R318Y R150Y 7.0E+07 7.0E+06 10% 151% 3 R312Q
R143Q 1.1E+07 1.8E+06 17% 23% 3 R312A R143A 4.6E+06 9.3E+05 20% 10%
2 R312Y R143Y 1.2E+07 4.2E+06 36% 26% 2 R312L R143L 2.4E+07 9.4E+06
39% 53% 2 V202M V38M 6.6E+07 2.6E+07 39% 143% 2 V202Y V38Y 2.5E+07
1.6E+06 6% 55% 2 D203M D39M 4.5E+07 1.9E+07 42% 98% 5 D203Y D39Y
3.0E+07 2.8E+06 9% 65% 4 A204M A40M 1.8E+07 1.2E+07 67% 39% 5 A204Y
A40Y 4.6E+07 7.6E+06 16% 100% 2 K400A/R403A K230A/R233A 5.3E+06
6.9E+05 13% 12% 2 K400E/R403E K230E/R233E 4.3E+05 3.1E+04 7% 1% 3
R403A R233A 1.4E+07 3.0E+06 22% 30% 7 R403E R233E 5.5E+06 1.5E+06
28% 12% 6 K400A K230A 2.0E+07 3.1E+06 16% 43% 2 K400E K230E 9.5E+06
1.1E+06 12% 21% 2 K293E K126E 8.1E+06 5.4E+05 7% 17% 2 K293A K126A
2.1E+07 4.4E+06 21% 45% 2 R333A R165A 1.6E+05 1.1E+04 7% 0% 2 R333E
R165E 1.3E+04 n.d. n.d. 0% 1 R338A R170A 1.6E+08 2.5E+07 15% 350% 2
R338E R170E 1.8E+08 8.3E+07 45% 396% 10 R338A/R403A R170A/R233A
5.3E+07 1.3E+07 24% 115% 6 R338E/R403E R170E/R233E 6.2E+07 8.8E+06
14% 134% 2 K293A/R403A K126A/R233A 5.7E+06 1.4E+06 25% 12% 2
K293E/R403E K126E/R233E 1.3E+06 8.5E+04 6% 3% 2 K293A/R338A/R403A
K126A/R170A/R233A 2.5E+07 9.5E+06 39% 53% 2 K293E/R338E/R403E
K126E/R170E/R233E 1.7E+07 5.7E+05 3% 36% 2 R318A/R403A R150A/R233A
1.5E+07 1.3E+06 9% 32% 2 R318E/R403E R150E/R233E 1.2E+06 3.8E+05
33% 3% 2 R318Y/E410N R150Y/E240N 7.5E+07 2.7E+07 35% 163% 21
R338E/E410N R170E/E240N 4.4E+08 1.5E+08 33% 950% 12
R338E/R403E/E410N R170E/R233E/E240N 1.9E+08 1.4E+08 72% 411% 17
Y155F/R338E/R403E/ Y[155]F/R170E/R233E/ 1.8E+08 6.0E+07 32% 401% 2
E410N E240N R318Y/R338E/R403E R150Y/R170E/R233E 6.2E+07 6.3E+06 10%
134% 3 Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 8.7E+07 5.1E+07 58%
189% 2 R403E R233E D203N/F205T/K228N D39N/F41T/K63N 1.4E+07 2.5E+06
18% 30% 2 D203N/F205T/E410N D39N/F41T/E240N 4.2E+07 1.7E+07 40% 91%
6 D203N/F205T/R338E D39N/F41T/R170E 1.0E+08 2.3E+07 22% 228% 2
D203N/F205T/R338A D39N/F41T/R170A 6.2E+07 1.4E+07 22% 135% 3
D203N/F205T/R318Y D39N/F41T/R150Y 2.0E+07 2.5E+06 12% 44% 4
D203N/F205T/R338E/ D39N/F41T/R170E/R233E 1.9E+07 4.8E+06 25% 41% 2
R403E K228N/E410N K63N/E240N 8.5E+07 3.4E+07 40% 184% 10
K228N/R338E K63N/R170E 2.1E+08 6.1E+07 29% 455% 2 K228N/R338A
K63N/R170A 2.1E+08 4.6E+07 22% 459% 2 K228N/R318Y K63N/R150Y
4.7E+07 6.5E+06 14% 102% 5 K228N/R338E/R403E K63N/R170E/R233E
4.8E+07 8.6E+06 18% 105% 2 R403E/E410N R233E/E240N 2.1E+07 1.7E+06
8% 46% 2 R318Y/R338E/E410N R150Y/R170E/E240N 3.4E+08 1.2E+08 37%
727% 42 D104N/K106S/R318Y/ D[104]N/K[106]S/R150Y/ 2.6E+08 5.9E+07
23% 564% 4 R338E/E410N R170E/E240N Y155F/R318Y/R338E/
Y[155]F/R150Y/R170E/ 3.7E+08 1.3E+08 33% 810% 5 E410N E240N
K228N/R318Y/E410N K63N/R150Y/E240N 1.2E+08 2.6E+07 22% 264% 4
R318Y/R403E/E410N R150Y/R233E/E240N 2.5E+07 4.7E+06 19% 54% 5
Y155F/R318Y/R403E/ Y[155]F/R150Y/R233E/ 3.6E+07 2.9E+07 82% 78% 2
E410N E240N R318Y/R338E/R403E/ R150Y/R170E/R233E/E240N 1.5E+08
8.2E+07 56% 320% 26 E410N A103N/N105S/R318Y/ A[103]N/N[105]S/R150Y/
1.5E+08 7.3E+07 50% 318% 5 R338E/R403E/E410N R170E/R233E/E240N
D104N/K106S/R318Y/ D[104]N/K[106]S/R150Y/ 1.7E+08 7.9E+07 47% 366%
3 R338E/R403E/E410N R170E/R233E/E240N Y155F/R318Y/R338E/
Y[155]F/R150Y/R170E/ 1.9E+08 5.0E+07 27% 406% 4 R403E/E410N
R233E/E240N A103N/N105S/Y155F/R318Y/ A[103]N/N[105]S/Y[155]F/
1.3E+08 1.8E+06 1% 274% 2 R338E/R403E/E410N R150Y/R170E/R233E/E240N
D104N/K106S/Y155F/R318Y/ D[104]N/K[106]S/Y[155]F/ 1.8E+08 9.1E+06
5% 382% 2 R338E/R403E/E410N R150Y/R170E/R233E/E240N
D203N/F205T/R318Y/ D39N/F41T/R150Y/E240N 3.9E+07 2.0E+07 52% 85% 6
E410N R333S R165S 1.1E+05 5.5E+04 51% 0% 3 R338L R170L 2.0E+08
2.3E+07 11% 431% 3 K316N K148N 6.2E+06 4.2E+06 69% 13% 3 K316A
K148A 6.1E+06 8.2E+05 13% 13% 3 K316E K148E 7.1E+05 1.4E+05 19% 2%
3 K316S K148S 3.9E+06 6.2E+05 16% 9% 3 K316M K148M 3.1E+07 1.4E+07
46% 68% 3 E239S E74S 3.4E+07 1.8E+07 52% 73% 3 E239A E74A 4.9E+07
6.2E+06 13% 107% 3 E239R E74R 5.6E+07 1.1E+07 19% 122% 3 E239K E74K
5.1E+07 5.1E+06 10% 111% 3 H257F H92F 4.8E+07 6.6E+06 14% 105% 3
H257Y H92Y 3.4E+07 9.1E+06 27% 73% 3 H257E H92E 2.7E+07 1.5E+07 57%
58% 3 H257S H92S 3.5E+07 1.3E+07 36% 76% 3 T412A T242A 4.6E+07
2.8E+07 62% 100% 5 T412V T242V 5.8E+07 3.2E+07 55% 126% 8
E410N/T412A E240N/T242A 8.0E+07 1.7E+07 21% 173% 4 E410N/T412V
E240N/T242V 8.8E+07 2.7E+07 30% 192% 4 E410Q E240Q 1.2E+08 7.6E+07
63% 261% 4 E410S E240S 1.1E+08 6.6E+07 60% 239% 12 E410A E240A
1.1E+08 5.6E+07 50% 241% 10 E410D E240D 6.0E+07 1.6E+07 27% 130% 4
N346D N178D 1.9E+07 8.5E+06 44% 42% 4 Y155F/N346D Y[155]F/N178D
1.3E+07 6.8E+06 53% 28% 2 N346Y N178Y 9.8E+07 2.3E+07 24% 212% 8
Y345A Y177A 1.5E+07 6.3E+06 43% 32% 4 Y345T Y177T 5.0E+07 2.5E+07
50% 108% 4 T343R T175R 1.4E+08 1.0E+08 70% 313% 12 T343E T175E
4.0E+07 2.3E+07 58% 86% 4 T343Q T175Q 7.1E+07 2.2E+07 30% 154% 3
F342I F174I 5.4E+07 2.9E+07 54% 118% 3 T343R/Y345T T175R/Y177T
9.3E+07 1.8E+07 19% 202% 3 R318Y/R338E R150Y/R170E 1.5E+08 5.3E+07
36% 322% 4 Y259F/K265T/Y345T Y94F/K98T/Y177T 5.6E+07 1.2E+07 21%
122% 2 K228N/I251S K63N/I86S 2.2E+07 5.7E+05 3% 48% 2
K228N/R318Y/R338E/ K63N/R150Y/R170E/R233E/ 1.6E+08 6.1E+07 39% 339%
3 R403E/E410N E240N Y155F/K228N/R318Y/ Y[155]F/K63N/R150Y/R170E/
1.6E+08 4.1E+07 25% 356% 5 R338E/R403E/E410N R233E/E240N
D85N/K228N/R318Y/ D[85]N/K63N/R150Y/R170E/ 1.6E+08 2.3E+07 15% 336%
2 R338E/R403E/E410N R233E/E240N I251S/R318Y/R338E/
I86S/R150Y/R170E/R233E/ 1.5E+08 4.2E+07 27% 334% 4 R403E/E410N
E240N D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/ 1.2E+08
2.0E+07 16% 263% 8 R338E/R403E/E410N R150Y/R170E/R233E/E240N
Y155F/I251S/R318Y/ D[104]N/K[106]S/I86S/ 1.7E+08 9.2E+06 6% 363% 2
R338E/R403E/E410N R150Y/R170E/R233E/E240N I251S/R318Y/R338E/
I86S/R150Y/R170E/E240N 3.9E+08 7.4E+07 19% 849% 10 E410N
D104N/K106S/I251S/ D[104]N/K[106]S/I86S/ 1.3E+08 3.2E+07 24% 291% 3
R318Y/R338E/E410N R150Y/R170E/E240N F314N/K316S F145N/K148S 8.8E+04
8.2E+04 94% 0% 2 K247N/N249S/R318Y/ K82N/N84S/R150Y/R170E/ 1.5E+08
4.7E+07 30% 331% 6 R338E/R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 1.9E+08 5.7E+07
30% 405% 10 R338E/R403E/E410N R170E/R233E/E240N A103N/N105S/K247N/
A[103]N/N[105]S/K82N/ 1.5E+08 4.2E+07 28% 324% 6 N249S/R318Y/R338E/
N84S/R150Y/R170E/R233E/ R403E/E410N E240N D104N/K106S/K247N/
D[104]N/K[106]S/K82N/ 8.8E+07 6.5E+06 7% 192% 2 N249S/R318Y/R338E/
N84S/R150Y/R170E/R233E/ R403E/E410N E240N D104N/K106S/Y155F/
D[104]N/K[106]S/Y[155]F/ 1.3E+08 7.3E+07 54% 292% 6
K247N/N249S/R318Y/ K82N/N84S/R150Y/R170E/ R338E/R403E/E410N
R233E/E240N K247N/N249S/R318Y/ K82N/N84S/R150Y/R170E/E240N 2.3E+08
6.6E+07 28% 501% 6 R338E/E410N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R150Y/ 3.3E+08 1.3E+08 39% 717% 9
R318Y/R338E/E410N R170E/E240N R318Y/R338E/R403E/
R150Y/R170E/R233E/E240S 2.1E+08 6.1E+07 29% 458% 7 E410S
R318Y/R338E/E410S R150Y/R170E/E240S 3.3E+08 1.2E+08 37% 708% 8
K228N/K247N/N249S K63N/K82N/N84S 3.8E+07 1.2E+07 32% 83% 2
D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 6.3E+07 3.3E+06 5% 137%
2 K228N/K247N/N249S K63N/K82N/N84S D104N/K106S/K228N/
D[104]N/K[106]S/K63N/ 2.3E+07 1.1E+07 48% 49% 5 K247N/N249S
K82N/N84S Y155F/K228N/K247N/ Y[155]F/K63N/K82N/N84S 5.3E+07 5.5E+06
10% 115% 2 N249S K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/
1.6E+08 8.4E+07 51% 352% 17 R338E/R403E/E410N R170E/R233E/E240N
D104N/K106S/K228N/ D[104]N/K[106]S/K63N/ 1.1E+08 4.4E+07 40% 239% 7
K247N/N249S/R318Y/ K82N/N84S/R150Y/R170E/ R338E/R403E/E410N
R233E/E240N Y155F/K228N/K247N/ Y[155]F/K63N/K82N/N84S/ 1.2E+08
5.3E+07 44% 263% 5
N249S/R318Y/R338E/ R150Y/R170E/R233E/E240N R403E/E410N
R318Y/R338E/R403E/ R150Y/R170E/R233E/E240N/ 1.6E+08 6.3E+07 40%
342% 6 E410N/T412V T242V R318Y/R338E/R403E/
R150Y/R170E/R233E/E240N/ 2.5E+08 9.2E+07 37% 538% 6 E410N/T412A
T242A R318Y/R338E/R403E/ R150Y/R170E/R233E/T242A 8.0E+07 3.4E+07
42% 173% 4 T412A R318Y/R338E/T412A R150Y/R170E/T242A 3.0E+08
8.3E+07 28% 642% 6 R318Y/R338E/E410N/ R150Y/R170E/E240N/T242V
2.6E+08 1.2E+08 46% 571% 11 T412V N260S/R318Y/R338E/
N95S/R150Y/R170E/R233E/ 5.3E+07 6.6E+05 1% 114% 2 R403E/E410N E240N
D104N/K106S/N260S/R318Y/ D[104]N/K[106]S/N95S/R150Y/ 8.8E+07
7.9E+06 9% 190% 2 R338E/R403E/E410N R170E/R233E/E240N
Y155F/N260S/R318Y/ Y[155]F/N95S/R150Y/R170E/ 7.0E+07 2.4E+07 35%
152% 2 R338E/R403E/E410N R233E/E240N R318Y/R338E/N346D/
R150Y/R170E/N178D/R233E/ 3.1E+07 9.1E+06 30% 66% 2 R403E/E410N
E240N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 6.2E+07 1.8E+07 30%
135% 2 N346D/R403E/E410N N178D/R233E/E240N K247N/N249S/N260S
K82N/N84S/N95S 2.9E+07 2.6E+06 9% 62% 2 Y155F/K247N/N249S/
Y[155]F/K82N/N84S/N95S 1.9E+07 4.2E+06 22% 42% 2 N260S
D104N/K106S/K247N/ D[104]N/K[106]S/K82N/ 9.8E+06 3.0E+06 30% 21% 2
N249S/N260S N84S/N95S D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/
8.2E+06 3.9E+06 47% 18% 2 K247N/N249S/N260S K82N/N84S/N95S
K247N/N249S/N260S/R318Y/ K82N/N84S/N95S/R150Y/ 6.7E+07 2.6E+07 38%
145% 6 R338E/R403E/E410N R170E/R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/N95S/ 5.7E+07 3.6E+07 64% 124% 5
N260S/R318Y/R338E/ R150Y/R170E/R233E/E240N R403E/E410N
Y155F/N260S/N346D Y[155]F/N95S/N178D 2.2E+06 7.4E+05 34% 5% 2
R318Y/R338E/T343R/ R150Y/R170E/T175R/R233E/ 4.2E+08 1.4E+08 33%
907% 13 R403E/E410N E240N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/
3.0E+08 8.3E+07 28% 640% 4 T343R/R403E/E410N T175R/R233E/E240N
D104N/K106S/R318Y/R338E/ D[104]N/K[106]S/R150Y/ 2.2E+08 1.2E+08 52%
487% 5 T343R/R403E/E410N R170E/T175R/R233E/E240N R338E/T343R
R170E/T175R 5.2E+08 1.6E+08 31% 1120% 7 T343R/N346Y T175R/N178Y
9.6E+07 4.4E+07 46% 208% 11 R318Y/R338E/N346Y/
R150Y/R170E/N178Y/R233E/ 1.2E+08 2.1E+07 16% 270% 3 R403E/E410N
E240N R318Y/R338E/T343R/ R150Y/R170E/T175R/N178Y/ 3.1E+08 1.1E+08
37% 663% 5 N346Y/R403E/E410N R233E/E240N T343R/N346D T175R/N178D
1.6E+07 2.6E+06 16% 36% 2 R318Y/R338E/T343R/
R150Y/R170E/T175R/N178D/ 8.2E+07 3.2E+06 4% 177% 2
N346D/R403E/E410N R233E/E240N R318Y/R338E/Y345A/
R150Y/R170E/Y177A/R233E/ 8.3E+07 3.6E+07 44% 180% 6 R403E/E410N
E240N R318Y/R338E/Y345A/ R150Y/R170E/Y177A/N178D/ 2.3E+07 7.6E+06
33% 49% 3 N346D/R403E/E410N R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R150Y/ 9.5E+07 6.6E+07 69% 206% 5
R318Y/R338E/R403E R170E/R233E K247N/N249S/R318Y/
K82N/N84S/R150Y/R170E/ 2.3E+08 1.6E+08 71% 496% 2 R338E/R403E R233E
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R150Y/ 1.0E+07 4.5E+06 45% 22%
3 R318Y/R403E/E410N R233E/E240N K247N/N249S/R318Y/
K82N/N84S/R150Y/R233E/ 2.7E+07 1.2E+07 44% 58% 10 R403E/E410N E240N
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R170E/ 1.1E+08 2.4E+07 23%
229% 3 R338E/R403E/E410N R233E/E240N K247N/N249S/R338E/
K82N/N84S/R170E/R233E/ 1.9E+08 2.9E+07 15% 422% 2 R403E/E410N E240N
R318Y/R338E/T343R/ R150Y/R170E/T175R/R233E 1.6E+08 7.4E+07 45% 357%
4 R403E Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 2.6E+08 1.7E+08 65%
563% 4 T343R/R403E T175R/R233E R318Y/R338E/T343R/
R150Y/R170E/T175R/E240N 3.4E+08 1.6E+08 48% 728% 16 E410N
Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 3.7E+08 1.2E+08 32% 794% 4
T343R/E410N T175R/E240N R318Y/T343R/R403E/ R150Y/T175R/R233E/E240N
5.8E+07 1.8E+07 31% 125% 3 E410N Y155F/R318Y/T343R/
Y[155]F/R150Y/T175R/ 2.6E+08 5.0E+07 19% 571% 2 R403E/E410N
R233E/E240N R338E/T343R/R403E/ R170E/T175R/R233E/E240N 3.0E+08
8.2E+07 27% 650% 2 E410N Y155F/R338E/T343R/ Y[155]F/R170E/T175R/
2.4E+08 1.0E+08 42% 524% 4 R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 4.0E+08 1.5E+08
37% 864% 11 R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N
K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 3.8E+08 1.5E+08 40%
824% 5 T343R/R403E/E410N T175R/R233E/E240N K228N/I251S/R318Y/
K63N/I86S/R150Y/R170E/ 2.1E+08 7.2E+07 34% 463% 7 R338E/R403E/E410N
R233E/E240N Y155F/K228N/I251S/R318Y/ Y[155]F/K63N/I86S/R150Y/
1.4E+08 5.0E+07 37% 296% 5 R338E/R403E/E410N R170E/R233E/E240N
N260S/R318Y/R338E/ N95S/R150Y/R170E/T175R/ 2.9E+08 1.1E+08 38% 638%
7 T343R/R403E/E410N R233E/E240N Y155F/N260S/R318Y/R338E/
Y[155]F/N95S/R150Y/R170E/ 1.5E+08 6.0E+07 39% 335% 5
T343R/R403E/E410N T175R/R233E/E240N K228N/K247N/N249S/
K63N/K82N/N84S/R150Y/ 4.1E+08 1.4E+08 34% 880% 12
R318Y/R338E/T343R/ R170E/T175R/R233E/E240N R403E/E410N
Y155F/K228N/K247N/ Y[155]F/K63N/K82N/N84S/ 3.0E+08 1.1E+08 37% 646%
5 N249S/R318Y/R338E/ R150Y/R170E/T175R/R233E/ T343R/R403E/E410N
E240N Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 2.0E+08 7.7E+07 39%
429% 5 R403E R233E R338E/T343R/R403E R170E/T175R/R233E 3.1E+08
9.6E+07 31% 663% 2 Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 2.9E+08
1.0E+08 35% 629% 6 R403E/E410S R233E/E240S Y155F/N260S/R338E/
Y[155]F/N95S/R170E/T175R/ 9.4E+07 3.1E+07 33% 203% 6 T343R/R403E
R233E Y155F/I251S/R338E/ Y[155]F/I86S/R170E/T175R/ 3.0E+08 1.6E+07
5% 651% 2 T343R/R403E R233E R318Y/R338E/T343R/
R150Y/R170E/T175R/R233E/ 4.4E+08 1.7E+08 39% 962% 14 R403E/E410S
E240S Y155F/K247N/N249S/ Y[155]F/K82N/N84S/T175R/ 8.5E+07 2.7E+07
31% 184% 4 T343R/R403E R233E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 2.9E+08 5.0E+06 2% 630% 2
R338E/T343R/R403E R170E/T175R/R233E K247N/N249S/R318Y/
K82N/N84S/R150Y/R170E/ 4.1E+08 2.2E+08 55% 886% 4 R338E/T343R/R403E
T175R/R233E Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/
3.7E+08 1.1E+07 3% 805% 2 T343R/R403E/E410N T175R/R233E/E240N
K247N/N249S/R338E/ K82N/N84S/R170E/T175R/ 4.3E+08 1.2E+07 3% 930% 2
T343R/R403E/E410N R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R150Y/ 2.9E+08 4.1E+07 14% 632% 2 R318Y/R338E
R170E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R150Y/ 2.5E+08 9.4E+07
37% 549% 4 R318Y/T343R T175R Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R150Y/ 1.6E+07 5.4E+06 35% 34% 3 R318Y/R403E
R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R150Y/ 7.2E+07 2.5E+07
35% 155% 3 R318Y/E410N E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R170E/ 1.4E+08 5.7E+07 41% 299% 2 R338E/R403E
R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R170E/ 7.3E+08 2.6E+08
36% 1579% 2 R338E/T343R T175R Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 5.0E+08 2.8E+08 57% 1091% 4
R338E/T343R/E410N R170E/T175R/E240N K247N/N249S/R318Y/
K82N/N84S/R150Y/R170E/ 3.2E+08 1.6E+08 50% 687% 6 R338E/T343R/E410N
T175R/E240N Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/
1.6E+08 6.2E+07 38% 350% 2 T343R/R403E/E410N T175R/R233E/E240N
K247N/N249S/R318Y/ K82N/N84S/R150Y/T175R/ 1.3E+08 3.9E+07 30% 279%
7 T343R/R403E/E410N R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R170E/ 4.7E+08 3.1E+08 66% 1009% 8 R338E/E410N
E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R150Y/ 1.3E+08 5.1E+07
40% 276% 2 R318Y/T343R/R403E T175R/R233E K247N/N249S/R318Y/
K82N/N84S/R150Y/T175R/ 3.9E+07 2.2E+07 57% 84% 9 T343R/R403E R233E
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R150Y/ 3.1E+08 2.1E+08 67%
668% 4 R318Y/T343R/E410N T175R/E240N K247N/N249S/R318Y/
K82N/N84S/R150Y/T175R/ 2.0E+08 1.6E+08 77% 439% 4 T343R/E410N E240N
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R170E/ 5.9E+08 5.8E+07 10%
1269% 2 R338E/T343R/R403E T175R/R233E K247N/N249S/R338E/
K82N/N84S/R170E/T175R/ 5.6E+08 8.8E+07 16% 1215% 2 T343R/R403E
R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/R170E/ 1.8E+08 1.1E+07
6% 391% 2 R338E/T343R/E410N T175R/E240N K247N/N249S/R338E/
K82N/N84S/R170E/T175R/ 3.1E+08 1.0E+08 33% 676% 5 T343R/E410N E240N
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/T175R/ 2.9E+08 8.8E+07 30%
635% 2 T343R/R403E/E410N R233E/E240N K247N/N249S/T343R/
K82N/N84S/T175R/R233E/ 1.3E+08 1.7E+07 13% 285% 2 R403E/E410N E240N
Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 3.6E+08 1.5E+08 41% 771% 7
T343R T175R R318Y/R338E/T343R R150Y/R170E/T175R 1.5E+08 3.3E+07 22%
324% 2 Y155F/R318Y/T343R/ Y[155]F/R150Y/T175R/ 7.1E+07 1.4E+07 20%
154% 2 R403E R233E Y155F/T343R/R403E/ Y[155]F/T175R/R233E/ 1.5E+08
2.4E+07 17% 321% 2 E410N E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R150Y/ 3.6E+08 1.6E+08 45% 772% 7
R318Y/R338E/T343R R170E/T175R K247N/N249S/R318Y/
K82N/N84S/R150Y/R170E/ 3.9E+08 1.6E+08 43% 840% 4 R338E/T343R T175R
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/T175R/ 2.8E+08 1.1E+08 38%
599% 5 T343R/E410N E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R233E/ 2.4E+07 1.4E+07 59% 53% 7 R403E/E410N
E240N Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 3.5E+08 2.2E+08 62%
761% 6 E410N E240N R338E/T343R/E410N R170E/T175R/E240N 9.3E+07
2.8E+07 30% 201% 2 Y155F/R318Y/T343R/ Y[155]F/R150Y/T175R/ 1.5E+08
6.6E+07 44% 326% 4 E410N E240N R318Y/T343R/E410N R150Y/T175R/E240N
6.2E+07 1.1E+07 17% 135% 2 K228N/R318Y/R338E/
K63N/R150Y/R170E/T175R/ 2.7E+08 8.8E+07 32% 593% 3
T343R/R403E/E410N R233E/E240N K228N/K247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/ 2.9E+08 1.3E+08 46% 636% 3 R338E/T343R/R403E
R170E/T175R/R233E K228N/247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/
1.3E+08 4.5E+07 35% 278% 2 R338E/T343R/E410N R170E/T175R/E240N
K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/ 7.1E+07 3.3E+07 46%
153% 3 T343R/R403E/E410N T175R/R233E/E240N .dagger.produced in
BHK-21 cells; *80% glycosylated form of E410N
TABLE-US-00017 TABLE 16 Catalytic activity of FIXa variants
(k.sub.cat) Mutation (Mature FIX Mutation (Chymotrypsin k.sub.cat
.+-.S.D. Numbering) Numbering) (s.sup.-1) (s.sup.-1) % CV n BeneFIX
Benefix .RTM. BeneFIX Benefix .RTM. 2.8 1.1 39% 125 Coagulation FIX
(T148A) Coagulation FIX (T[148]A) Plasma Purified FIXa Plasma
Purified FIXa 3.6 1.2 34% 120 Catalyst Biosciences WT Catalyst
Biosciences WT 3.1 1.4 46% 31 N157D N[157]D 3.3 0.5 16% 2 Y155F
Y[155]F 3.7 0.4 11% 2 A103N/N105S/Y155F A[103]N/N[105]S/Y[155]F 3.2
0.0 0% 2 D104N/K106S/Y155F D[104]N/K[106]S/Y[155]F 2.9 0.1 4% 2
A103N/N105S A[103]N/N[105]S 3.1 1.0 31% 9 D104N/K106S
D[104]N/K[106]S 3.1 1.1 34% 9 K106N/V108S K[106]N/V[108]S 2.5 0.5
21% 7 D85N D[85]N 4.2 0.8 19% 15 T148A T[148]A 2.2 0.9 42% 30
T148A.dagger. T[148]A.dagger. 1.6 0.2 14% 7 K5A K[5]A 3.1 0.2 8% 2
D64N D[64]N 1.2 0.4 31% 2 D64A D[64]A 0.3 0.2 70% 2 N167D N[167]D
2.9 0.8 27% 2 N167Q N[167]Q 2.3 0.7 32% 4 S61A S[61]A 3.6 1.5 41% 4
S53A S[53]A 3.7 1.7 44% 3 T159A T[159]A 3.7 1.2 34% 3 T169A T[169]A
4.6 1.6 36% 3 T172A T[172]A 4.4 1.5 34% 3 T179A T[179]A 5.1 0.6 12%
3 Y155H Y[155]H 4.6 0.9 18% 3 Y155Q Y[155]Q 4.4 1.0 24% 3 S158A
S[158]A 3.9 0.1 3% 2 S158D S[158]D 3.5 0.3 8% 2 S158E S[158]E 3.5
0.2 5% 2 N157Q N[157]Q 3.5 0.1 4% 2 D203N/F205T D39N/F41T 1.6 0.6
40% 12 D85N/D203N/F205T D[85]N/D39N/F41T 1.2 0.5 40% 5 K228N K63N
2.7 1.2 43% 13 D85N/K228N D[85]N/K63N 2.7 0.8 29% 6
A103N/N105S/K228N A[103]N/N[105]S/K63N 2.1 0.5 22% 3
D104N/K106S/K228N D[104]N/K[106]S/K63N 2.4 0.1 6% 3 Y155F/K228N
Y[155]F/K63N 3.3 0.3 10% 2 D104N/K106S/Y155F/K228N
D[104]N/K[106]S/Y[155]F/ 4.6 1.2 27% 2 K63N I251S I86S 3.8 1.1 30%
13 D85N/I251S D[85]N/I86S 2.8 0.6 22% 5 D85N/D104N/K106S/I251S
D[85]N/D[104]N/K[106]S/I86S 1.5 0.3 19% 5 A103N/N105S/I251S
A[103]N/N[105]S/I86S 2.9 1.0 36% 3 D104N/K106S/I251S
D[104]N/K[106]S/I86S 2.9 0.5 18% 2 Y155F/I251S Y[155]F/I86S 3.7 0.8
22% 2 A262S A95bS 2.3 0.7 32% 8 K413N K243N 2.6 0.5 19% 5 E410N
E240N 5.0 2.2 45% 21 E410N* E240N* 2.2 0.5 25% 11 E239N E74N 1.4
0.5 36% 9 T241N/H243S T76N/H78S 2.0 0.0 0% 2 K247N/N249S K82N/N84S
3.9 1.0 26% 11 Y155F/K247N/N249S Y[155]F/K82N/N84S 3.3 0.7 21% 4
A103N/N105S/K247N/N249S A[103]N/N[105]S/K82N/N84S 3.4 0.5 15% 6
D104N/K106S/K247N/N249S D[104]N/K[106]S/K82N/N84S 3.3 1.1 32% 2
D104N/K106S/Y155F/K247N/ D[104]N/K[106]S/Y[155]F/ 2.8 1.1 40% 3
N249S K82N/N84S L321N L153N 1.9 0.1 4% 2 F314N/H315S F145N/H147S No
n.d. n.d. 4 Activity S319N/L321S S151N/L153S 1.4 0.9 61% 3 N260S
N95S 1.3 0.5 42% 13 D104N/K106S/N260S D[104]N/K[106]S/N95S 1.2 0.7
58% 2 Y155F/N260S Y[155]F/N95S 1.9 0.6 32% 2
D104N/K106S/Y155F/N260S D[104]N/K[106]S/Y[155]F/ 0.4 0.1 28% 2 N95S
Y284N Y117N 2.0 0.9 45% 8 G317N G149N No n.d. n.d. 5 Activity
R318N/A320S R150N/A152S No n.d. n.d. 8 Activity R318A R150A 2.4 0.8
32% 3 R318E R150E 0.6 0.2 35% 3 R318Y R150Y 2.9 0.7 26% 3 R312Q
R143Q 0.3 0.1 26% 3 R312A R143A 0.3 0.0 8% 2 R312Y R143Y 0.4 0.3
73% 2 R312L R143L 0.7 0.3 41% 2 V202M V38M 2.6 1.0 37% 2 V202Y V38Y
1.8 0.2 10% 2 D203M D39M 1.8 0.8 42% 5 D203Y D39Y 1.7 0.5 27% 4
A204M A40M 0.6 0.5 84% 5 A204Y A40Y 1.9 0.8 42% 2 K400A/R403A
K230A/R233A 0.3 0.0 5% 2 K400E/R403E K230E/R233E No n.d. n.d. 4
Activity R403A R233A 0.6 0.2 24% 7 R403E R233E 0.4 0.1 25% 6 K400A
K230A 1.4 0.2 14% 2 K400E K230E 0.6 0.0 4% 2 K293E K126E 0.5 0.1
15% 2 K293A K126A 1.4 0.4 28% 2 R333A R165A No n.d. n.d. 2 Activity
R333E R165E No n.d. n.d. 2 Activity R338A R170A 5.4 0.3 5% 2 R338E
R170E 4.7 1.0 21% 10 R338A/R403A R170A/R233A 3.8 0.9 24% 6
R338E/R403E R170E/R233E 3.3 1.2 37% 2 K293A/R403A K126A/R233A 0.4
0.0 9% 2 K293E/R403E K126E/R233E 0.1 0.0 37% 2 K293A/R338A/R403A
K126A/R170A/R233A 1.6 0.7 41% 2 K293E/R338E/R403E K126E/R170E/R233E
0.8 0.2 27% 2 R318A/R403A R150A/R233A 0.7 0.1 12% 2 R318E/R403E
R150E/R233E 0.1 0.0 35% 2 R318Y/E410N R150Y/E240N 3.5 0.9 27% 21
R338E/E410N R170E/E240N 5.2 0.8 16% 8 R338E/R403E/E410N
R170E/R233E/E240N 3.3 1.3 39% 7 R318Y/R338E/R403E R150Y/R170E/R233E
3.5 0.4 11% 2 D203N/F205T/K228N D39N/F41T/K63N 0.6 0.2 27% 2
D203N/F205T/E410N D39N/F41T/E240N 1.7 0.3 16% 6 D203N/F205T/R338E
D39N/F41T/R170E 2.5 0.0 2% 2 D203N/F205T/R338A D39N/F41T/R170A 2.3
0.5 23% 3 D203N/F205T/R318Y D39N/F41T/R150Y 0.9 0.1 13% 4
D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E 0.9 0.0 5% 2
K228N/E410N K63N/E240N 3.5 0.9 27% 10 K228N/R338E K63N/R170E 4.8
0.8 17% 2 K228N/R338A K63N/R170A 6.5 0.5 7% 2 K228N/R318Y
K63N/R150Y 2.9 0.6 19% 5 K228N/R338E/R403E K63N/R170E/R233E 2.8 0.3
9% 2 R403E/E410N R233E/E240N 2.0 0.2 9% 2 R318Y/R338E/E410N
R150Y/R170E/E240N 4.6 1.3 29% 26 D104N/K106S/R318Y/R338E/
D[104]N/K[106]S/R150Y/R170E/ 4.8 0.6 12% 4 E410N E240N
Y155F/R318Y/R338E/E410N Y[155]F/R150Y/R170E/E240N 5.6 1.4 25% 5
K228N/R318Y/E410N K63N/R150Y/E240N 5.0 0.5 10% 4 R318Y/R403E/E410N
R150Y/R233E/E240N 2.3 0.3 15% 3 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 5.0 3.1 63% 14 A103N/N105S/R318Y/R338E/
A[103]N/N[105]S/R150Y/R170E/ 5.4 0.9 16% 5 R403E/E410N R233E/E240N
D104N/K106S/R318Y/R338E/ D[104]N/K[106]S/R150Y/R170E/ 5.7 1.1 20% 3
R403E/E410N R233E/E240N Y155F/R318Y/R338E/R403E/
Y[155]F/R150Y/R170E/R233E/ 5.3 0.7 12% 4 E410N E240N
A103N/N105S/Y155F/R318Y/ A[103]N/N[105]S/Y[155]F/ 6.4 0.5 7% 2
R338E/R403E/E410N R150Y/R170E/R233E/E240N D104N/K106S/Y155F/R318Y/
D[104]N/K[106]S/Y[155]F/ 8.5 0.8 10% 2 R338E/R403E/E410N
R150Y/R170E/R233E/E240N D203N/F205T/R318Y/E410N
D39N/F41T/R150Y/E240N 1.6 0.6 36% 6 R333S R165S 0.05 0.01 22% 3
R338L R170L 9.5 1.9 21% 3 K316N K148N 0.3 0.1 39% 3 K316A K148A 0.3
0.1 21% 3 K316E K148E 0.1 0.0 9% 3 K316S K148S 0.2 0.0 10% 3 K316M
K148M 0.7 0.1 15% 3 E239S E74S 0.7 0.1 19% 3 E239A E74A 2.8 1.2 43%
3 E239R E74R 3.4 1.4 42% 3 E239K E74K 3.0 1.1 36% 3 H257F H92F 3.0
1.4 46% 3 H257Y H92Y 2.0 1.1 55% 3 H257E H92E 1.3 0.4 28% 3 H257S
H92S 1.8 0.3 18% 3 T412A T242A 2.6 0.3 13% 5 T412V T242V 2.6 0.6
25% 8 E410N/T412A E240N/T242A 2.9 0.4 13% 4 E410N/T412V E240N/T242V
2.9 0.5 16% 4 E410Q E240Q 6.0 2.8 46% 4 E410S E240S 4.9 1.6 32% 12
E410A E240A 4.8 1.6 32% 10 E410D E240D 4.0 0.7 19% 4 N346D N178D
0.8 0.2 29% 4 Y155F/N346D Y[155]F/N178D 1.3 0.5 41% 2 N346Y N178Y
2.6 0.2 9% 8 Y345A Y177A 0.7 0.6 83% 4 Y345T Y177T 1.3 0.3 27% 4
T343R T175R 4.3 1.2 27% 9 T343E T175E 1.0 0.7 72% 4 T343Q T175Q 2.5
0.3 11% 3 F342I F174I 1.3 0.2 16% 3 T343R/Y345T T175R/Y177T 2.4 0.3
14% 3 R318Y/R338E R150Y/R170E 3.4 0.5 14% 4 Y259F/K265T/Y345T
Y94F/K98T/Y177T 1.7 0.1 5% 2 K228N/I251S K63N/I86S 2.7 1.1 41% 2
K228N/R318Y/R338E/R403E/ K63N/R150Y/R170E/R233E/ 5.1 0.7 14% 3
E410N E240N Y155F/K228N/R318Y/R338E/ Y[155]F/K63N/R150Y/R170E/ 9.7
1.6 16% 2 R403E/E410N R233E/E240N D85N/K228N/R318Y/R338E/
D[85]N/K63N/R150Y/R170E/ 6.0 0.6 10% 2 R403E/E410N R233E/E240N
I251S/R318Y/R338E/R403E/ I86S/R150Y/R170E/R233E/ 4.8 0.6 12% 4
E410N E240N D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/R150Y/
5.5 0.9 17% 8 R338E/R403E/E410N R170E/R233E/E240N
Y155F/I251S/R318Y/R338E/ Y[155]F/I86S/R150Y/R170E/ 7.2 0.8 11% 2
R403E/E410N R233E/E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/E240N 6.2 1.2 20% 7 D104N/K106S/I251S/R318Y/
D[104]N/K[106]S/I86S/R150Y/ 3.1 0.6 19% 3 R338E/E410N R170E/E240N
F314N/K316S F145N/K148S 0.0 0.0 7% 2 K247N/N249S/R318Y/R338E/
K82N/N84S/R150Y/R170E/ 5.8 1.1 19% 6 R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 6.5 1.1 17% 6
R338E/R403E/E410N R170E/R233E/E240N A103N/N105S/K247N/N249S/
A[103]N/N[105]S/K82N/N84S/ 4.1 0.8 18% 2 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N D104N/K106S/K247N/N249S/
D[104]N/K[106]S/K82N/N84S/ 5.2 0.3 6% 2 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N K247N/N249S/R318Y/R338E/
K82N/N84S/R150Y/R170E/ 3.8 1.6 41% 6 E410N E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 4.3 1.4 33% 7
R338E/E410N R170E/E240N R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 5.8 0.6 10% 4 R318Y/R338E/E410S
R150Y/R170E/E240S 5.1 1.7 33% 8 K228N/K247N/N249S K63N/K82N/N84S
3.5 0.1 4% 2 D104N/K106S/Y155F/K228N/ D[104]N/K[106]S/Y[155]F/ 4.7
1.4 30% 2 K247N/N249S K63N/K82N/N84S D104N/K106S/K228N/K247N/
D[104]N/K[106]S/K63N/K82N/ 1.7 0.9 54% 5 N249S N84S
Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 4.3 1.9 44% 2
K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/R170E/ 6.1 0.7 12% 3
R338E/R403E/E410N R233E/E240N R318Y/R338E/R403E/E410N/
R150Y/R170E/R233E/E240N/ 7.9 2.1 26% 4 T412V T242V
R318Y/R338E/R403E/E410N/ R150Y/R170E/R233E/E240N/ 8.4 1.5 18% 4
T412A T242A R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 5.1 1.1
21% 4 R318Y/R338E/T412A R150Y/R170E/T242A 7.0 2.8 39% 6
R318Y/R338E/E410N/T412V R150Y/R170E/E240N/T242V 6.3 2.3 37% 4
N260S/R318Y/R338E/R403E/ N95S/R150Y/R170E/R233E/ 3.8 1.1 29% 2
E410N E240N D104N/K106S/N260S/R318Y/ D[104]N/K[106]S/N95S/R150Y/
5.4 0.5 9% 2 R338E/R403E/E410N R170E/R233E/E240N
Y155F/N260S/R318Y/R338E/ Y[155]F/N95S/R150Y/R170E/ 5.8 1.7 30% 2
R403E/E410N R233E/E240N R318Y/R338E/N346D/R403E/
R150Y/R170E/N178D/R233E/ 2.5 1.3 54% 2 E410N E240N
Y155F/R318Y/R338E/N346D/ Y[155]F/R150Y/R170E/N178D/ 6.4 2.8 44% 2
R403E/E410N R233E/E240N K247N/N249S/N260S K82N/N84S/N95S 3.3 0.3 9%
2 Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 1.8 0.3 16% 2
D104N/K106S/K247N/N249S/ D[104]N/K[106]S/K82N/N84S/ 0.6 0.0 7% 2
N260S N95S D104N/K106S/Y155F/K247N/ D[104]N/K[106]S/Y[155]F/ 0.5
0.0 2% 2 N249S/N260S K82N/N84S/N95S K247N/N249S/N260S/R318Y/
K82N/N84S/N95S/R150Y/R170E/ 6.0 0.5 9% 2 R338E/R403E/E410N
R233E/E240N Y155F/N260S/N346D Y[155]F/N95S/N178D 0.3 0.1 29% 2
R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/ 11.8 2.4 20% 3
E410N E240N
R338E/T343R R170E/T175R 7.7 1.3 17% 4 .dagger.produced in BHK-21
cells; *80% glycosylated form of E410N
TABLE-US-00018 TABLE 17 Catalytic activity of FIXa variants
(k.sub.cat) k.sub.cat .+-.S.D. Mutation (Mature FIX Numbering)
Mutation (Chymotrypsin Numbering) (s.sup.-1) (s.sup.-1) % CV n
BeneFIX Benefix .RTM. Coagulation FIX BeneFIX Benefix .RTM.
Coagulation FIX 2.9 1.1 39% 140 (T148A) (T[148]A) Plasma Purified
FIXa Plasma Purified FIXa 3.7 1.3 36% 200 Catalyst Biosciences WT
Catalyst Biosciences WT 3.1 1.4 46% 33 N157D N[157]D 3.3 0.5 16% 2
Y155F Y[155]F 3.7 0.4 11% 2 A103N/N105S/Y155F
A[103]N/N[105]S/Y[155]F 3.2 0.0 0% 2 D104N/K106S/Y155F
D[104]N/K[106]S/Y[155]F 2.9 0.1 4% 2 A103N/N105S A[103]N/N[105]S
3.1 1.0 31% 9 D104N/K106S D[104]N/K[106]S 3.1 1.1 34% 9 K106N/V108S
K[106]N/V[108]S 2.5 0.5 21% 7 D85N D[85]N 4.1 0.8 20% 17 T148A
T[148]A 2.5 1.0 39% 44 T148A.dagger. T[148]A.dagger. 1.6 0.2 14% 7
K5A K[5]A 3.5 0.8 23% 4 D64N D[64]N 1.2 0.4 31% 2 D64A D[64]A 0.3
0.2 70% 2 N167D N[167]D 2.9 0.8 27% 2 N167Q N[167]Q 2.3 0.7 32% 4
S61A S[61]A 3.6 1.5 41% 4 S53A S[53]A 3.7 1.7 44% 3 T159A T[159]A
3.7 1.2 34% 3 T169A T[169]A 4.6 1.6 36% 3 T172A T[172]A 4.4 1.5 34%
3 T179A T[179]A 5.1 0.6 12% 3 Y155H Y[155]H 4.6 0.9 18% 3 Y155Q
Y[155]Q 4.4 1.0 24% 3 S158A S[158]A 3.9 0.1 3% 2 S158D S[158]D 3.5
0.3 8% 2 S158E S[158]E 3.5 0.2 5% 2 N157Q N[157]Q 3.5 0.1 4% 2
D203N/F205T D39N/F41T 1.6 0.6 40% 12 D85N/D203N/F205T
D[85]N/D39N/F41T 1.2 0.5 40% 5 K228N K63N 2.7 1.2 43% 13 D85N/K228N
D[85]N/K63N 2.7 0.8 29% 6 A103N/N105S/K228N A[103]N/N[105]S/K63N
2.1 0.5 22% 3 D104N/K106S/K228N D[104]N/K[106]S/K63N 2.4 0.1 6% 3
Y155F/K228N Y[155]F/K63N 3.3 0.3 10% 2 D104N/K106S/Y155F/K228N
D[104]N/K[106]S/Y[155]F/K63N 4.6 1.2 27% 2 I251S I86S 3.8 1.1 30%
13 D85N/I251S D[85]N/I86S 2.8 0.6 22% 5 D85N/D104N/K106S/I251S
D[85]N/D[104]N/K[106]S/I86S 1.5 0.3 19% 5 A103N/N105S/I251S
A[103]N/N[105]S/I86S 2.9 1.0 36% 3 D104N/K106S/I251S
D[104]N/K[106]S/I86S 2.9 0.5 18% 2 Y155F/I251S Y[155]F/I86S 3.7 0.8
22% 2 A262S A95bS 2.3 0.7 32% 8 K413N K243N 2.5 0.5 19% 7 E410N
E240N 4.9 2.0 41% 27 E410N* E240N* 2.3 0.5 22% 10 E239N E74N 1.4
0.5 36% 9 T241N/H243S T76N/H78S 2.0 0.0 0% 2 K247N/N249S K82N/N84S
3.9 1.0 26% 11 Y155F/K247N/N249S Y[155]F/K82N/N84S 3.3 0.7 21% 4
A103N/N105S/K247N/N249S A[103]N/N[105]S/K82N/N84S 3.4 0.5 15% 6
D104N/K106S/K247N/N249S D[104]N/K[106]S/K82N/N84S 3.3 1.1 32% 2
D104N/K106S/Y155F/K247N/N249S D[104]N/K[106]S/Y[155]F/K82N/N84S 2.8
1.1 40% 3 L321N L153N 1.9 0.1 4% 2 F314N/H315S F145N/H147S 0.0 0.0
7% 2 K392N/K394S K222N/K224S 0.0 n.d. n.d. 0 S319N/L321S
S151N/L153S 1.4 0.9 61% 3 N260S N95S 1.3 0.5 42% 13
D104N/K106S/N260S D[104]N/K[106]S/N95S 1.2 0.7 58% 2 Y155F/N260S
Y[155]F/N95S 1.9 0.6 32% 2 D104N/K106S/Y155F/N260S
D[104]N/K[106]S/Y[155]F/N95S 0.4 0.1 28% 2 Y284N Y117N 2.0 0.9 45%
8 G317N G149N 0.0 n.d. n.d. 1 R318N/A320S R150N/A152S 0.0 0.0 95% 3
R318A R150A 2.7 0.9 32% 2 R318E R150E 0.6 0.2 35% 3 R318Y R150Y 2.9
0.7 26% 3 R312Q R143Q 0.3 0.1 26% 3 R312A R143A 0.3 0.0 8% 2 R312Y
R143Y 0.4 0.3 73% 2 R312L R143L 0.7 0.3 41% 2 V202M V38M 2.6 1.0
37% 2 V202Y V38Y 1.8 0.2 10% 2 D203M D39M 1.8 0.8 42% 5 D203Y D39Y
1.7 0.5 27% 4 A204M A40M 0.6 0.5 84% 5 A204Y A40Y 1.9 0.8 42% 2
K400A/R403A K230A/R233A 0.3 0.0 5% 2 K400E/R403E K230E/R233E 0.1
0.0 50% 3 R403A R233A 0.6 0.2 24% 7 R403E R233E 0.4 0.1 25% 6 K400A
K230A 1.4 0.2 14% 2 K400E K230E 0.6 0.0 4% 2 K293E K126E 0.5 0.1
15% 2 K293A K126A 1.4 0.4 28% 2 R333A R165A 0.1 0.0 35% 2 R333E
R165E 0.0 n.d. n.d. 1 R338A R170A 5.4 0.3 5% 2 R338E R170E 4.7 1.0
21% 10 R338A/R403A R170A/R233A 3.8 0.9 24% 6 R338E/R403E
R170E/R233E 3.3 1.2 37% 2 K293A/R403A K126A/R233A 0.4 0.0 9% 2
K293E/R403E K126E/R233E 0.1 0.0 37% 2 K293A/R338A/R403A
K126A/R170A/R233A 1.6 0.7 41% 2 K293E/R338E/R403E K126E/R170E/R233E
0.8 0.2 27% 2 R318A/R403A R150A/R233A 0.7 0.1 12% 2 R318E/R403E
R150E/R233E 0.1 0.0 35% 2 R318Y/E410N R150Y/E240N 3.5 0.9 27% 21
R338E/E410N R170E/E240N 5.2 1.1 22% 12 R338E/R403E/E410N
R170E/R233E/E240N 5.8 3.0 52% 17 Y155F/R338E/R403E/E410N
Y[155]F/R170E/R233E/E240N 5.9 0.4 7% 2 R318Y/R338E/R403E
R150Y/R170E/R233E 3.6 0.4 10% 3 Y155F/R318Y/R338E/R403E
Y[155]F/R150Y/R170E/R233E 5.1 1.0 19% 2 D203N/F205T/K228N
D39N/F41T/K63N 0.6 0.2 27% 2 D203N/F205T/E410N D39N/F41T/E240N 1.7
0.3 16% 6 D203N/F205T/R338E D39N/F41T/R170E 2.5 0.0 2% 2
D203N/F205T/R338A D39N/F41T/R170A 2.3 0.5 23% 3 D203N/F205T/R318Y
D39N/F41T/R150Y 0.9 0.1 13% 4 D203N/F205T/R338E/R403E
D39N/F41T/R170E/R233E 0.9 0.0 5% 2 K228N/E410N K63N/E240N 3.5 0.9
27% 10 K228N/R338E K63N/R170E 4.8 0.8 17% 2 K228N/R338A K63N/R170A
6.5 0.5 7% 2 K228N/R318Y K63N/R150Y 2.9 0.6 19% 5 K228N/R338E/R403E
K63N/R170E/R233E 2.8 0.3 9% 2 R403E/E410N R233E/E240N 2.0 0.2 9% 2
R318Y/R338E/E410N R150Y/R170E/E240N 4.4 1.2 27% 42
D104N/K106S/R318Y/R338E/E410N D[104]N/K[106]S/R150Y/R170E/E240N 4.8
0.6 12% 4 Y155F/R318Y/R338E/E410N Y[155]F/R150Y/R170E/E240N 5.6 1.4
25% 5 K228N/R318Y/E410N K63N/R150Y/E240N 5.0 0.5 10% 4
R318Y/R403E/E410N R150Y/R233E/E240N 2.3 0.3 11% 5
Y155F/R318Y/R403E/E410N Y[155]F/R150Y/R233E/E240N 2.9 0.6 20% 2
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N 5.8 2.8 48% 26
A103N/N105S/R318Y/R338E/R403E/ A[103]N/N[105]S/R150Y/R170E/R233E/
5.4 0.9 16% 5 E410N E240N D104N/K106S/R318Y/R338E/R403E/
D[104]N/K[106]S/R150Y/R170E/R233E/ 5.7 1.1 20% 3 E410N E240N
Y155F/R318Y/R338E/R403E/E410N Y[155]F/R150Y/R170E/R233E/E240N 5.3
0.7 12% 4 A103N/N105S/Y155F/R318Y/R338E/
A[103]N/N[105]S/Y[155]F/R150Y/R170E/ 6.4 0.5 7% 2 R403E/E410N
R233E/E240N D104N/K106S/Y155F/R318Y/R338E/
D[104]N/K[106]S/Y[155]F/R150Y/R170E/ 8.5 0.8 10% 2 R403E/E410N
R233E/E240N D203N/F205T/R318Y/E410N D39N/F41T/R150Y/E240N 1.6 0.6
36% 6 R333S R165S 0.1 0.0 22% 3 R338L R170L 9.5 1.9 21% 3 K316N
K148N 0.3 0.1 39% 3 K316A K148A 0.3 0.1 21% 3 K316E K148E 0.1 0.0
9% 3 K316S K148S 0.2 0.0 10% 3 K316M K148M 0.7 0.1 15% 3 E239S E74S
0.7 0.1 19% 3 E239A E74A 2.8 1.2 43% 3 E239R E74R 3.4 1.4 42% 3
E239K E74K 3.0 1.1 36% 3 H257F H92F 3.0 1.4 46% 3 H257Y H92Y 2.0
1.1 55% 3 H257E H92E 1.3 0.4 28% 3 H257S H92S 1.8 0.3 18% 3 T412A
T242A 2.6 0.3 13% 5 T412V T242V 2.6 0.6 25% 8 E410N/T412A
E240N/T242A 2.9 0.4 13% 4 E410N/T412V E240N/T242V 2.9 0.5 16% 4
E410Q E240Q 6.0 2.8 46% 4 E410S E240S 4.9 1.6 32% 12 E410A E240A
4.8 1.6 32% 10 E410D E240D 4.0 0.7 19% 4 N346D N178D 0.8 0.2 29% 4
Y155F/N346D Y[155]F/N178D 1.3 0.5 41% 2 N346Y N178Y 2.6 0.2 9% 8
Y345A Y177A 0.7 0.6 83% 4 Y345T Y177T 1.3 0.3 27% 4 T343R T175R 4.1
1.1 27% 12 T343E T175E 1.0 0.7 72% 4 T343Q T175Q 2.5 0.3 11% 3
F342I F174I 1.3 0.2 16% 3 T343R/Y345T T175R/Y177T 2.4 0.3 14% 3
R318Y/R338E R150Y/R170E 3.4 0.5 14% 4 Y259F/K265T/Y345T
Y94F/K98T/Y177T 1.7 0.1 5% 2 K228N/I251S K63N/I86S 2.7 1.1 41% 2
K228N/R318Y/R338E/R403E/E410N K63N/R150Y/R170E/R233E/E240N 5.1 0.7
14% 3 Y155F/K228N/R318Y/R338E/R403E/
Y[155]F/K63N/R150Y/R170E/R233E/E240N 6.7 3.0 45% 5 E410N
D85N/K228N/R318Y/R338E/R403E/ D[85]N/K63N/R150Y/R170E/R233E/E240N
6.0 0.6 10% 2 E410N I251S/R318Y/R338E/R403E/E410N
I86S/R150Y/R170E/R233E/E240N 4.8 0.6 12% 4
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/R170E/
5.5 0.9 17% 8 R403E/E410N R233E/E240N
Y155F/I251S/R318Y/R338E/R403E/ D[104]N/K[106]S/I86S/R150Y/R170E/
7.2 0.8 11% 2 E410N R233E/E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/E240N 6.4 2.0 31% 10
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/R170E/
3.1 0.6 19% 3 E410N E240N F314N/K316S F145N/K148S 0.0 0.0 7% 2
K247N/N249S/R318Y/R338E/R403E/ K82N/N84S/R150Y/R170E/R233E/E240N
5.8 1.1 19% 6 E410N Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/R233E/ 6.2 1.0 16% 10 R403E/E410N
E240N A103N/N105S/K247N/N249S/R318Y/
A[103]N/N[105]S/K82N/N84S/R150Y/ 3.9 0.4 11% 6 R338E/R403E/E410N
R170E/R233E/E240N D104N/K106S/K247N/N249S/R318Y/
D[104]N/K[106]S/K82N/N84S/R150Y/ 5.2 0.3 6% 2 R338E/R403E/E410N
R170E/R233E/E240N D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/N84S/ 6.9 4.7 67% 6
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
K247N/N249S/R318Y/R338E/E410N K82N/N84S/R150Y/R170E/E240N 3.8 1.6
41% 6 Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/E240N 4.5 1.3 28% 9 E410N
R318Y/R338E/R403E/E410S R150Y/R170E/R233E/E240S 7.4 2.3 31% 7
R318Y/R338E/E410S R150Y/R170E/E240S 5.1 1.7 33% 8 K228N/K247N/N249S
K63N/K82N/N84S 3.5 0.1 4% 2 D104N/K106S/Y155F/K228N/K247N/
D[104]N/K[106]S/Y[155]F/K63N/K82N/ 4.7 1.4 30% 2 N249S N84S
D104N/K106S/K228N/K247N/N249S D[104]N/K[106]S/K63N/K82N/N84S 1.7
0.9 54% 5 Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 4.3 1.9
44% 2 K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/R233E/ 7.1 2.2 31% 17 R403E/E410N E240N
D104N/K106S/K228N/K247N/N249S/
D[104]N/K[106]S/K63N/K82N/N84S/R150Y/ 6.1 3.7 61% 7
R318Y/R338E/R403E/E410N R170E/R233E/E240N
Y155F/K228N/K247N/N249S/R318Y/ Y[155]F/K63N/K82N/N84S/R150Y/R170E/
5.1 1.8 34% 5 R338E/R403E/E410N R233E/E240N
R318Y/R338E/R403E/E410N/T412V R150Y/R170E/R233E/E240N/T242V 7.0 2.1
30% 6 R318Y/R338E/R403E/E410N/T412A R150Y/R170E/R233E/E240N/T242A
7.8 1.6 20% 6 R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 5.1
1.1 21% 4 R318Y/R338E/T412A R150Y/R170E/T242A 7.0 2.8 39% 6
R318Y/R338E/E410N/T412V R150Y/R170E/E240N/T242V 5.2 1.7 33% 11
N260S/R318Y/R338E/R403E/E410N N95S/R150Y/R170E/R233E/E240N 3.8 1.1
29% 2 D104N/K106S/N260S/R318Y/R338E/
D[104]N/K[106]S/N95S/R150Y/R170E/ 5.4 0.5 9% 2
R403E/E410N R233E/E240N Y155F/N260S/R318Y/R338E/R403E/
Y[155]F/N95S/R150Y/R170E/R233E/E240N 5.8 1.7 30% 2 E410N
R318Y/R338E/N346D/R403E/E410N R150Y/R170E/N178D/R233E/E240N 2.5 1.3
54% 2 Y155F/R318Y/R338E/N346D/R403E/
Y[155]F/R150Y/R170E/N178D/R233E/ 6.4 2.8 44% 2 E410N E240N
K247N/N249S/N260S K82N/N84S/N95S 3.3 0.3 9% 2
Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 1.8 0.3 16% 2
D104N/K106S/K247N/N249S/N260S D[104]N/K[106]S/K82N/N84S/N95S 0.6
0.0 7% 2 D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/N84S/ 0.5 0.0 2% 2 N260S N95S
K247N/N249S/N260S/R318Y/R338E/ K82N/N84S/N95S/R150Y/R170E/R233E/
3.4 2.1 62% 6 R403E/E410N E240N Y155F/K247N/N249S/N260S/R318Y/
Y[155]F/K82N/N84S/N95S/R150Y/R170E/ 3.6 1.2 33% 5 R338E/R403E/E410N
R233E/E240N Y155F/N260S/N346D Y[155]F/N95S/N178D 0.3 0.1 29% 2
R318Y/R338E/T343R/R403E/E410N R150Y/R170E/T175R/R233E/E240N 9.7 2.6
27% 13 Y155F/R318Y/R338E/T343R/R403E/
Y[155]F/R150Y/R170E/T175R/R233E/ 7.8 1.9 24% 4 E410N E240N
D104N/K106S/R318Y/R338E/T343R/ D[104]N/K[106]S/R150Y/R170E/T175R/
5.7 2.3 41% 5 R403E/E410N R233E/E240N R338E/T343R R170E/T175R 7.1
1.4 20% 7 T343R/N346Y T175R/N178Y 2.3 0.5 21% 11
R318Y/R338E/N346Y/R403E/E410N R150Y/R170E/N178Y/R233E/E240N 3.4 0.3
9% 3 R318Y/R338E/T343R/N346Y/R403E/
R150Y/R170E/T175R/N178Y/R233E/E240N 4.6 1.2 26% 5 E410N T343R/N346D
T175R/N178D 1.9 0.4 21% 2 R318Y/R338E/T343R/N346D/R403E/
R150Y/R170E/T175R/N178D/R233E/E240N 5.4 2.0 36% 2 E410N
R318Y/R338E/Y345A/R403E/E410N R150Y/R170E/Y177A/R233E/E240N 1.4 0.5
36% 6 R318Y/R338E/Y345A/N346D/R403E/
R150Y/R170E/Y177A/N178D/R233E/E240N 1.2 0.3 26% 3 E410N
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/R233E
5.7 3.2 55% 5 R403E K247N/N249S/R318Y/R338E/R403E
K82N/N84S/R150Y/R170E/R233E 10.5 3.6 34% 2
Y155F/K247N/N249S/R318Y/R403E/ Y[155]F/K82N/N84S/R150Y/R233E/E240N
1.2 0.5 40% 3 E410N K247N/N249S/R318Y/R403E/E410N
K82N/N84S/R150Y/R233E/E240N 2.9 1.6 55% 10
Y155F/K247N/N249S/R338E/R403E/ Y[155]F/K82N/N84S/R170E/R233E/E240N
5.0 0.6 13% 3 E410N K247N/N249S/R338E/R403E/E410N
K82N/N84S/R170E/R233E/E240N 4.8 0.8 17% 2 R318Y/R338E/T343R/R403E
R150Y/R170E/T175R/R233E 6.7 1.6 24% 4 Y155F/R318Y/R338E/T343R/R403E
Y[155]F/R150Y/R170E/T175R/R233E 8.2 4.1 50% 4
R318Y/R338E/T343R/E410N R150Y/R170E/T175R/E240N 4.9 1.2 24% 16
Y155F/R318Y/R338E/T343R/E410N Y[155]F/R150Y/R170E/T175R/E240N 9.2
3.1 33% 4 R318Y/T343R/R403E/E410N R150Y/T175R/R233E/E240N 5.3 0.9
17% 3 Y155F/R318Y/T343R/R403E/E410N Y[155]F/R150Y/T175R/R233E/E240N
8.8 0.3 4% 2 R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N 9.8
1.4 15% 2 Y155F/R338E/T343R/R403E/E410N
Y[155]F/R170E/T175R/R233E/E240N 5.7 1.1 20% 4
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/T175R/
9.7 3.4 35% 11 T343R/R403E/E410N R233E/E240N
K247N/N249S/R318Y/R338E/T343R/ K82N/N84S/R150Y/R170E/T175R/R233E/
10.6 3.6 34% 5 R403E/E410N E240N K228N/I251S/R318Y/R338E/R403E/
K63N/I86S/R150Y/R170E/R233E/E240N 7.5 3.3 44% 7 E410N
Y155F/K228N/I251S/R318Y/R338E/ Y[155]F/K63N/I86S/R150Y/R170E/R233E/
5.3 1.9 36% 5 R403E/E410N E240N N260S/R318Y/R338E/T343R/R403E/
N95S/R150Y/R170E/T175R/R233E/E240N 8.9 3.6 40% 7 E410N
Y155F/N260S/R318Y/R338E/T343R/
Y[155]F/N95S/R150Y/R170E/T175R/R233E/ 5.8 1.6 28% 5 R403E/E410N
E240N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/T175R/ 9.9 3.2 32% 12 T343R/R403E/E410N
R233E/E240N Y155F/K228N/K247N/N249S/R318Y/
Y[155]F/K63N/K82N/N84S/R150Y/R170E/ 9.4 2.3 25% 5
R338E/T343R/R403E/E410N T175R/R233E/E240N Y155F/R338E/T343R/R403E
Y[155]F/R170E/T175R/R233E 5.2 0.9 18% 5 R338E/T343R/R403E
R170E/T175R/R233E 6.9 0.3 4% 2 Y155F/R338E/T343R/R403E/E410S
Y[155]F/R170E/T175R/R233E/E240S 6.8 2.4 34% 6
Y155F/N260S/R338E/T343R/R403E Y[155]F/N95S/R170E/T175R/R233E 6.4
3.8 59% 6 Y155F/I251S/R338E/T343R/R403E
Y[155]F/I86S/R170E/T175R/R233E 5.9 0.7 12% 2
R318Y/R338E/T343R/R403E/E410S R150Y/R170E/T175R/R233E/E240S 7.6 1.7
22% 14 Y155F/K247N/N249S/T343R/R403E Y[155]F/K82N/N84S/T175R/R233E
4.7 0.2 5% 4 Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/T175R/ 10.6 0.8 8% 2 T343R/R403E
R233E K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/R233E 9.2 3.3 36% 4 R403E
Y155F/K247N/N249S/R338E/T343R/ Y[155]F/K82N/N84S/R170E/T175R/R233E/
9.8 0.7 8% 2 R403E/E410N E240N K247N/N249S/R338E/T343R/R403E/
K82N/N84S/R170E/T175R/R233E/E240N 10.8 1.6 15% 2 E410N
Y155F/K247N/N249S/R318Y/R338E Y[155]F/K82N/N84S/R150Y/R170E 7.5 1.5
20% 2 Y155F/K247N/N249S/R318Y/T343R Y[155]F/K82N/N84S/R150Y/T175R
10.3 3.3 32% 4 Y155F/K247N/N249S/R318Y/R403E
Y[155]F/K82N/N84S/R150Y/R233E 1.7 0.7 42% 3
Y155F/K247N/N249S/R318Y/E410N Y[155]F/K82N/N84S/R150Y/E240N 3.4 0.9
26% 3 Y155F/K247N/N249S/R338E/R403E Y[155]F/K82N/N84S/R170E/R233E
5.3 0.6 11% 2 Y155F/K247N/N249S/R338E/T343R
Y[155]F/K82N/N84S/R170E/T175R 10.6 1.1 10% 2
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/T175R/
7.7 2.3 30% 4 T343R/E410N E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/E240N 8.8 4.4 50% 6 E410N
Y155F/K247N/N249S/R318Y/T343R/ Y[155]F/K82N/N84S/R150Y/T175R/R233E/
9.0 0.4 5% 2 R403E/E410N E240N K247N/N249S/R318Y/T343R/R403E/
K82N/N84S/R150Y/T175R/R233E/E240N 9.5 1.6 17% 7 E410N
Y155F/K247N/N249S/R338E/E410N Y[155]F/K82N/N84S/R170E/E240N 7.3 3.5
48% 8 Y155F/K247N/N249S/R318Y/T343R/
Y[155]F/K82N/N84S/R150Y/T175R/R233E 7.5 2.1 28% 2 R403E
K247N/N249S/R318Y/T343R/R403E K82N/N84S/R150Y/T175R/R233E 3.7 1.6
44% 9 Y155F/K247N/N249S/R318Y/T343R/
Y[155]F/K82N/N84S/R150Y/T175R/E240N 8.1 4.1 51% 4 E410N
K247N/N249S/R318Y/T343R/E410N K82N/N84S/R150Y/T175R/E240N 6.1 2.6
42% 4 Y155F/K247N/N249S/R338E/T343R/
Y[155]F/K82N/N84S/R170E/T175R/R233E 14.6 0.2 1% 2 R403E
K247N/N249S/R338E/T343R/R403E K82N/N84S/R170E/T175R/R233E 14.6 0.4
3% 2 Y155F/K247N/N249S/R338E/T343R/
Y[155]F/K82N/N84S/R170E/T175R/E240N 4.8 1.0 20% 2 E410N
K247N/N249S/R338E/T343R/E410N K82N/N84S/R170E/T175R/E240N 7.9 1.4
18% 5 Y155F/K247N/N249S/T343R/R403E/
Y[155]F/K82N/N84S/T175R/R233E/E240N 15.0 3.0 20% 2 E410N
K247N/N249S/T343R/R403E/E410N K82N/N84S/T175R/R233E/E240N 8.0 2.8
36% 2 Y155F/R318Y/R338E/T343R Y[155]F/R150Y/R170E/T175R 7.9 3.0 38%
7 R318Y/R338E/T343R R150Y/R170E/T175R 4.5 1.2 27% 2
Y155F/R318Y/T343R/R403E Y[155]F/R150Y/T175R/R233E 5.0 1.1 22% 2
Y155F/T343R/R403E/E410N Y[155]F/T175R/R233E/E240N 6.6 1.4 21% 2
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/T175R
8.5 3.3 39% 7 T343R K247N/N249S/R318Y/R338E/T343R
K82N/N84S/R150Y/R170E/T175R 8.0 1.7 22% 4
Y155F/K247N/N249S/T343R/E410N Y[155]F/K82N/N84S/T175R/E240N 7.9 1.6
20% 5 Y155F/K247N/N249S/R403E/E410N Y[155]F/K82N/N84S/R233E/E240N
2.7 1.4 52% 7 Y155F/R338E/T343R/E410N Y[155]F/R170E/T175R/E240N 6.0
2.2 37% 6 R338E/T343R/E410N R170E/T175R/E240N 3.1 0.5 16% 2
Y155F/R318Y/T343R/E410N Y[155]F/R150Y/T175R/E240N 5.0 1.3 25% 4
R318Y/T343R/E410N R150Y/T175R/E240N 3.2 0.4 13% 2
K228N/R318Y/R338E/T343R/R403E/ K63N/R150Y/R170E/T175R/R233E/E240N
10.5 0.7 6% 3 E410N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/T175R/ 10.9 1.4 13% 3 T343R/R403E R233E
K228N/K247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/T175R/
4.7 0.4 8% 2 T343R/E410N E240N K228N/K247N/N249S/R318Y/T343R/
K63N/K82N/N84S/R150Y/T175R/R233E/ 8.1 2.1 26% 3 R403E/E410N E240N
.dagger.produced in BHK-21 cells; *80% glycosylated form of
E410N
TABLE-US-00019 TABLE 18 Catalytic activity of FIXa variants
(K.sub.M) Mutation (Mature FIX Mutation (Chymotrypsin K.sub.M
.+-.S.D. Numbering) Numbering) (nM) (nM) % CV n BeneFIX Benefix
.RTM. Coagulation BeneFIX Benefix .RTM. 76.9 27.5 36% 125 FIX
(T148A) Coagulation FIX (T[148]A) Plasma Purified FIXa Plasma
Purified FIXa 74.5 25.5 34% 120 Catalyst Biosciences WT Catalyst
Biosciences WT 74.7 23.1 31% 31 N157D N[157]D 121.8 53.0 44% 2
Y155F Y[155]F 90.3 10.3 11% 2 A103N/N105S/Y155F
A[103]N/N[105]S/Y[155]F 80.4 2.5 3% 2 D104N/K106S/Y155F
D[104]N/K[106]S/Y[155]F 81.5 5.2 6% 2 A103N/N105S A[103]N/N[105]S
88.0 22.5 26% 9 D104N/K106S D[104]N/K[106]S 83.2 18.2 22% 9
K106N/V108S K[106]N/V[108]S 91.9 20.2 22% 7 D85N D[85]N 64.5 23.1
36% 15 T148A T[148]A 64.5 25.1 39% 30 T148A.dagger. T[148]A.dagger.
74.6 16.1 22% 7 K5A K[5]A 55.0 0.3 1% 2 D64N D[64]N 121.4 58.8 48%
2 D64A D[64]A 129.4 36.3 28% 2 N167D N[167]D 94.6 7.0 7% 2 N167Q
N[167]Q 77.1 35.8 46% 4 S61A S[61]A 84.6 35.6 42% 4 S53A S[53]A
109.9 11.6 11% 3 T159A T[159]A 100.9 1.2 1% 3 T169A T[169]A 99.7
10.8 11% 3 T172A T[172]A 96.2 22.1 23% 3 T179A T[179]A 94.5 16.7
18% 3 Y155H Y[155]H 93.9 15.8 17% 3 Y155Q Y[155]Q 87.6 29.8 34% 3
S158A S[158]A 107.7 0.4 0% 2 S158D S[158]D 87.0 9.0 10% 2 S158E
S[158]E 96.0 14.1 15% 2 N157Q N[157]Q 107.8 5.5 5% 2 D203N/F205T
D39N/F41T 74.3 19.5 26% 12 D85N/D203N/F205T D[85]N/D39N/F41T 40.6
9.1 22% 5 K228N K63N 72.5 25.5 35% 13 D85N/K228N D[85]N/K63N 60.1
13.4 22% 6 A103N/N105S/K228N A[103]N/N[105]S/K63N 76.5 15.8 21% 3
D104N/K106S/K228N D[104]N/K[106]S/K63N 96.8 21.2 22% 3 Y155F/K228N
Y[155]F/K63N 73.7 3.7 5% 2 D104N/K106S/Y155F/K228N
D[104]N/K[106]S/Y[155]F/K63N 76.2 6.4 8% 2 I251S I86S 64.3 13.3 21%
13 D85N/I251S D[85]N/I86S 51.5 15.3 30% 5 D85N/D104N/K106S/I251S
D[85]N/D[104]N/K[106]S/I86S 46.4 19.0 41% 5 A103N/N105S/I251S
A[103]N/N[105]S/I86S 90.9 41.2 45% 3 D104N/K106S/I251S
D[104]N/K[106]S/I86S 97.5 13.8 14% 2 Y155F/I251S Y[155]F/I86S 56.4
17.5 31% 2 A262S A95bS 99.2 19.9 20% 8 K413N K243N 109.6 41.0 37% 5
E410N E240N 46.2 21.5 47% 21 E410N* E240N* 83.3 36.9 44% 11 E239N
E74N 78.3 29.5 38% 9 T241N/H243S T76N/H78S 104.5 3.5 3% 2
K247N/N249S K82N/N84S 75.0 15.4 21% 11 Y155F/K247N/N249S
Y[155]F/K82N/N84S 67.1 23.6 35% 4 A103N/N105S/K247N/N249S
A[103]N/N[105]S/K82N/N84S 84.0 9.7 12% 6 D104N/K106S/K247N/N249S
D[104]N/K[106]S/K82N/N84S 102.3 23.0 23% 2
D104N/K106S/Y155F/K247N/N249S D[104]N/K[106]S/Y[155]F/K82N 89.3
10.3 12% 3 N84S L321N L153N 118.5 10.6 9% 2 F314N/H315S F145N/H147S
No n.d. n.d. 4 Activity S319N/L321S S151N/L153S 54.2 14.8 27% 3
N260S N95S 83.4 27.5 33% 13 D104N/K106S/N260S D[104]N/K[106]S/N95S
94.3 6.8 7% 2 Y155F/N260S Y[155]F/N95S 130.6 78.1 60% 2
D104N/K106S/Y155F/N260S D[104]N/K[106]S/Y[155]F/N95S 107.7 74.8 69%
2 Y284N Y117N 59.8 23.5 39% 8 G317N G149N No n.d. n.d. 5 Activity
R318N/A320S R150N/A152S No n.d. n.d. 8 Activity R318A R150A 52.8
25.8 49% 3 R318E R150E 33.6 10.3 31% 3 R318Y R150Y 40.7 7.6 19% 3
R312Q R143Q 29.9 5.0 17% 3 R312A R143A 61.6 16.9 27% 2 R312Y R143Y
27.2 11.4 42% 2 R312L R143L 28.8 0.6 2% 2 V202M V38M 40.2 1.0 2% 2
V202Y V38Y 70.6 2.3 3% 2 D203M D39M 40.6 7.9 19% 5 D203Y D39Y 58.0
19.5 34% 4 A204M A40M 34.0 9.2 27% 5 A204Y A40Y 39.5 10.3 26% 2
K400A/R403A K230A/R233A 56.7 10.0 18% 2 K400E/R403E K230E/R233E No
n.d. n.d. 4 Activity R403A R233A 46.4 5.2 11% 7 R403E R233E 67.0
19.4 29% 6 K400A K230A 74.6 22.1 30% 2 K400E K230E 61.3 9.3 15% 2
K293E K126E 63.2 13.9 22% 2 K293A K126A 73.7 35.2 48% 2 R333A R165A
No n.d. n.d. 2 Activity R333E R165E No n.d. n.d. 2 Activity R338A
R170A 33.7 3.7 11% 2 R338E R170E 28.7 9.0 31% 10 R338A/R403A
R170A/R233A 73.6 18.1 25% 6 R338E/R403E R170E/R233E 51.9 11.9 23% 2
K293A/R403A K126A/R233A 69.2 10.2 15% 2 K293E/R403E K126E/R233E
104.1 31.0 30% 2 K293A/R338A/R403A K126A/R170A/R233A 65.4 1.3 2% 2
K293E/R338E/R403E K126E/R170E/R233E 50.0 15.1 30% 2 R318A/R403A
R150A/R233A 45.7 1.6 3% 2 R318E/R403E R150E/R233E 75.3 47.7 63% 2
R318Y/E410N R150Y/E240N 49.6 14.3 29% 21 R338E/E410N R170E/E240N
12.6 4.2 33% 8 R338E/R403E/E410N R170E/R233E/E240N 45.5 12.8 28% 7
R318Y/R338E/R403E R150Y/R170E/R233E 53.7 1.9 4% 2 D203N/F205T/K228N
D39N/F41T/K63N 39.9 3.8 9% 2 D203N/F205T/E410N D39N/F41T/E240N 45.5
12.0 26% 6 D203N/F205T/R338E D39N/F41T/R170E 24.1 5.6 23% 2
D203N/F205T/R338A D39N/F41T/R170A 38.5 9.9 26% 3 D203N/F205T/R318Y
D39N/F41T/R150Y 47.5 6.4 13% 4 D203N/F205T/R338E/R403E
D39N/F41T/R170E/R233E 51.1 10.7 21% 2 K228N/E410N K63N/E240N 44.3
13.0 29% 10 K228N/R338E K63N/R170E 23.1 3.0 13% 2 K228N/R338A
K63N/R170A 31.2 4.5 14% 2 K228N/R318Y K63N/R150Y 61.3 5.4 9% 5
K228N/R338E/R403E K63N/R170E/R233E 59.2 4.9 8% 2 R403E/E410N
R233E/E240N 93.7 1.0 1% 2 R318Y/R338E/E410N R150V/R170E/E240N 14.2
4.3 30% 26 D104N/K106S/R318Y/R338E/E410N
D[104]N/K[106]S/R150Y/R170E/ 18.9 4.1 22% 4 E240N
Y155F/R318Y/R338E/E410N Y[155]F/R150Y/R170E/E240N 16.0 4.8 30% 5
K228N/R318Y/E410N K63N/R150Y/E240N 42.0 4.7 11% 4 R318Y/R403E/E410N
R150Y/R233E/E240N 88.3 12.4 14% 3 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 45.5 12.2 27% 14
A103N/N105S/R318Y/R338E/R403E/ A[103]N/N[105]S/R150Y/R170E/ 44.7
20.9 47% 5 E410N R233E/E240N D104N/K106S/R318Y/R338E/R403E/
D[104]N/K[106]S/R150Y/R170E/ 38.5 16.1 42% 3 E410N R233E/E240N
Y155F/R318Y/R338E/R403E/E410N Y[155]F/R150Y/R170E/R233E/ 30.4 10.5
35% 4 E240N A103N/N105S/Y155F/R318Y/R338E/
A[103]N/N[105]S/Y[155]F/R150Y/ 50.7 4.5 9% 2 R403E/E410N
R170E/R233E/E240N D104N/K106S/Y155F/R318Y/R338E/
D[104]N/K[106]S/Y[155]F/R150Y/ 48.0 2.1 4% 2 R403E/E410N
R170E/R233E/E240N D203N/F205T/R318Y/E410N D39N/F41T/R150Y/E240N
45.7 13.4 29% 6 R333S R165S 605.9 317.5 52% 3 R338L R170L 47.9 9.0
19% 3 K316N K148N 62.5 15.6 25% 3 K316A K148A 55.2 4.1 7% 3 K316E
K148E 110.5 25.1 23% 3 K316S K148S 57.3 4.6 8% 3 K316M K148M 26.0
16.7 64% 3 E239S E74S 28.5 19.2 67% 3 E239A E74A 55.4 18.4 33% 3
E239R E74R 58.3 13.9 24% 3 E239K E74K 59.2 25.5 43% 3 H257F H92F
62.0 30.1 49% 3 H257Y H92Y 59.3 25.0 42% 3 H257E H92E 59.7 39.6 66%
3 H257S H92S 56.0 24.7 44% 3 T412A T242A 76.1 44.7 59% 5 T412V
T242V 51.2 18.9 37% 8 E410N/T412A E240N/T242A 37.2 3.6 10% 4
E410N/T412V E240N/T242V 33.3 4.9 15% 4 E410Q E240Q 56.1 18.0 32% 4
E410S E240S 50.0 11.9 24% 12 E410A E240A 47.7 11.7 24% 10 E410D
E240D 71.9 26.9 37% 4 N346D N178D 45.7 7.8 17% 4 Y155F/N346D
Y[155]F/N178D 104.4 14.5 14% 2 N346Y N178Y 27.4 4.2 15% 8 Y345A
Y177A 50.8 32.4 64% 4 Y345T Y177T 28.6 7.9 28% 4 T343R T175R 31.3
10.9 35% 9 T343E T175E 27.3 10.0 37% 4 T343Q T175Q 37.0 9.1 25% 3
F342I F174I 30.0 19.1 64% 3 T343R/Y345T T175R/Y177T 26.5 6.8 26% 3
R318Y/R338E R150Y/R170E 24.6 5.5 22% 4 Y259F/K265T/Y345T
Y94F/K98T/Y177T 30.9 4.8 16% 2 K228N/I251S K63N/I86S 122.6 53.5 44%
2 K228N/R318Y/R338E/R403E/E410N K63N/R150Y/R170E/R233E/ 36.1 14.0
39% 3 E240N Y155F/K228N/R318Y/R338E/R403E/
Y[155]F/K63N/R150Y/R170E/ 48.0 9.8 21% 2 E410N R233E/E240N
D85N/K228N/R318Y/R338E/R403E/ D[85]N/K63N/R150Y/R170E/ 39.3 9.8 25%
2 E410N R233E/E240N I251S/R318Y/R338E/R403E/E410N
I86S/R150Y/R170E/R233E/E240N 33.4 10.2 30% 4
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/ 46.2 7.7
17% 8 R403E/E410N R170E/R233E/E240N Y155F/I251S/R318Y/R338E/R403E/
Y[155]F/I86S/R150Y/R170E/ 43.3 7.0 16% 2 E410N R233E/E240N
I251S/R318Y/R338E/E410N I86S/R150Y/R170E/E240N 16.2 1.8 11% 7
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/ 24.3 8.6
35% 3 E410N R170E/E240N F314N/K316S F145N/K148S 635.1 569.9 90% 2
K247N/N249S/R318Y/R338E/R403E/ K82N/N84S/R150Y/R170E/R233E/ 39.2
8.3 21% 6 E410N E240N Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/ 39.1 14.7 38% 6 R403E/E410N
R170E/R233E/E240N A103N/N105S/K247N/N249S/R318Y/
A[103]N/N[105]S/K82N/N84S/ 39.7 4.5 11% 2 R338E/R403E/E410N
R150Y/R170E/R233E/E240N D104N/K106S/K247N/N249S/R318Y/
D[104]N/K[106]S/K82N/N84S/ 59.0 0.6 1% 2 R338E/R403E/E410N
R150Y/R170E/R233E/E240N K247N/N249S/R318Y/R338E/E410N
K82N/N84S/R150Y/R170E/E240N 16.6 3.7 22% 6
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/ 15.3 4.1
27% 7 E410N R170E/E240N R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 35.1 12.4 35% 4 R318Y/R338E/E410S
R150Y/R170E/E240S 16.4 4.0 25% 8 K228N/K247N/N249S K63N/K82N/N84S
94.5 27.0 29% 2 D104N/K106S/Y155F/K228N/K247N/
D[104]N/K[106]S/Y[155]F/K63N/ 75.3 26.4 35% 2 N249S K82N/N84S
D104N/K106S/K228N/K247N/N249S D[104]N/K[106]S/K63N/K82N/ 77.1 18.3
24% 5 N84S Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 79.2 27.6
35% 2 K228N/K247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/
55.8 15.8 28% 3 R403E/E410N R233E/E240N
R318Y/R338E/R403E/E410N/T412V R150Y/R170E/R233E/E240N/ 44.3 19.2
43% 4 T242V R318Y/R338E/R403E/E410N/T412A R150Y/R170E/R233E/E240N/
33.5 4.8 14% 4 T242A R318Y/R338E/R403E/T412A
R150Y/R170E/R233E/T242A 67.5 11.6 17% 4 R318Y/R338E/T412A
R150Y/R170E/T242A 23.5 5.3 22% 6 R318Y/R338E/E410N/T412V
R150Y/R170E/E240N/T242V 29.7 10.9 37% 4
N260S/R318Y/R338E/R403E/E410N N95S/R150Y/R170E/R233E/ 72.4 20.2 28%
2 E240N D104N/K106S/N260S/R318Y/R338E/ D[104]N/K[106]S/N95S/R150Y/
61.1 0.0 0% 2 R403E/E410N R170E/R233E/E240N
Y155F/N260S/R318Y/R338E/R403E/ Y[155]F/N95S/R150Y/R170E/ 83.9 4.4
5% 2 E410N R233E/E240N R318Y/R338E/N346D/R403E/E410N
R150Y/R170E/N178D/R233E/ 77.7 20.9 27% 2 E240N
Y155F/R318Y/R338E/N346D/R403E/ Y[155]F/R150Y/R170E/N178D/ 100.0
15.6 16% 2 E410N R233E/E240N K247N/N249S/N260S K82N/N84S/N95S 114.1
0.0 0% 2 Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 96.5 5.5 6%
2 D104N/K106S/K247N/N249S/N260S D[104]N/K[106]S/K82N/N84S/ 61.2
14.1 23% 2 N95S D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/ 68.5 33.2 49%
2 N260S N84S/N95S K247N/N249S/N260S/R318Y/R338E/
K82N/N84S/N95S/R150Y/R170E/ 62.2 0.0 0% 2 R403E/E410N R233E/E240N
Y155F/N260S/N346D Y[155]F/N95S/N178D 127.9 6.2 5% 2
R318Y/R338E/T343R/R403E/E410N R150Y/R170E/T175R/R233E/ 22.3 5.0 23%
3 E240N R338E/T343R R170E/T175R 13.6 3.7 27% 4 .dagger.produced in
BHK-21 cells; *80% glycosylated form of E410N
TABLE-US-00020 TABLE 19 Catalytic activity of FIXa variants
(K.sub.M) Mutation (Mature FIX Mutation (Chymotrypsin K.sub.M
.+-.S.D. Numbering) Numbering) (nM) (nM) % CV n BeneFIX Benefix
.RTM. Coagulation FIX BeneFIX Benefix .RTM. Coagulation FIX 75.8
27.2 36% 140 (T148A) (T[148]A) Plasma Purified FIXa Plasma Purified
FIXa 73.3 26.8 37% 200 Catalyst Biosciences WT Catalyst Biosciences
WT 72.3 24.3 34% 33 N157D N[157]D 121.8 53.0 44% 2 Y155F Y[155]F
90.3 10.3 11% 2 A103N/N105S/Y155F A[103]N/N[105]S/Y[155]F 80.4 2.5
3% 2 D104N/K106S/Y155F D[104]N/K[106]S/Y[155]F 81.5 5.2 6% 2
A103N/N105S A[103]N/N[105]S 88.0 22.5 26% 9 D104N/K106S
D[104]N/K[106]S 83.2 18.2 22% 9 K106N/V108S K[106]N/V[108]S 91.9
20.2 22% 7 D85N D[85]N 64.5 21.9 34% 17 T148A T[148]A 70.1 26.9 38%
44 T148A.dagger. T[148]A.dagger. 74.6 16.1 22% 7 K5A K[5]A 65.4
26.8 41% 4 D64N D[64]N 121.4 58.8 48% 2 D64A D[64]A 129.4 36.3 28%
2 N167D N[167]D 94.6 7.0 7% 2 N167Q N[167]Q 77.1 35.8 46% 4 S61A
S[61]A 84.6 35.6 42% 4 S53A S[53]A 109.9 11.6 11% 3 T159A T[159]A
100.9 1.2 1% 3 T169A T[169]A 99.7 10.8 11% 3 T172A T[172]A 96.2
22.1 23% 3 T179A T[179]A 94.5 16.7 18% 3 Y155H Y[155]H 93.9 15.8
17% 3 Y155Q Y[155]Q 87.6 29.8 34% 3 S158A S[158]A 107.7 0.4 0% 2
S158D S[158]D 87.0 9.0 10% 2 S158E S[158]E 96.0 14.1 15% 2 N157Q
N[157]Q 107.8 5.5 5% 2 D203N/F205T D39N/F41T 74.3 19.5 26% 12
D85N/D203N/F205T D[85]N/D39N/F41T 40.6 9.1 22% 5 K228N K63N 72.5
25.5 35% 13 D85N/K228N D[85]N/K63N 60.1 13.4 22% 6
A103N/N105S/K228N A[103]N/N[105]S/K63N 76.5 15.8 21% 3
D104N/K106S/K228N D[104]N/K[106]S/K63N 96.8 21.2 22% 3 Y155F/K228N
Y[155]F/K63N 73.7 3.7 5% 2 D104N/K106S/Y155F/K228N
D[104]N/K[106]S/Y[155]F/K63N 76.2 6.4 8% 2 I251S I86S 64.3 13.3 21%
13 D85N/I251S D[85]N/I86S 51.5 15.3 30% 5 D85N/D104N/K106S/I251S
D[85]N/D[104]N/K[106]S/I86S 46.4 19.0 41% 5 A103N/N105S/I251S
A[103]N/N[105]S/I86S 90.9 41.2 45% 3 D104N/K106S/I251S
D[104]N/K[106]S/I86S 97.5 13.8 14% 2 Y155F/I251S Y[155]F/I86S 56.4
17.5 31% 2 A262S A95bS 99.2 19.9 20% 8 K413N K243N 106.3 40.4 38% 7
E410N E240N 45.9 19.1 42% 27 E410N* E240N* 85.2 38.1 45% 10 E239N
E74N 78.3 29.5 38% 9 T241N/H243S T76N/H78S 104.5 3.5 3% 2
K247N/N249S K82N/N84S 75.0 15.4 21% 11 Y155F/K247N/N249S
Y[155]F/K82N/N84S 67.1 23.6 35% 4 A103N/N105S/K247N/N249S
A[103]N/N[105]S/K82N/N84S 84.0 9.7 12% 6 D104N/K106S/K247N/N249S
D[104]N/K[106]S/K82N/N84S 102.3 23.0 23% 2
D104N/K106S/Y155F/K247N/N249S D[104]N/K[106]S/Y[155]F/K82N/N84S
89.3 10.3 12% 3 L321N L153N 118.5 10.6 9% 2 F314N/H315S F145N/H147S
93.0 14.3 15% 2 K392N/K394S K222N/K224S 0.0 n.d. n.d. 0 S319N/L321S
S151N/L153S 54.2 14.8 27% 3 N260S N95S 83.4 27.5 33% 13
D104N/K106S/N260S D[104]N/K[106]S/N95S 94.3 6.8 7% 2 Y155F/N260S
Y[155]F/N95S 130.6 78.1 60% 2 D104N/K106S/Y155F/N260S
D[104]N/K[106]S/Y[155]F/N95S 107.7 74.8 69% 2 Y284N Y117N 59.8 23.5
39% 8 G317N G149N 104.6 n.d. n.d. 1 R318N/A320S R150N/A152S 84.5
21.2 25% 3 R318A R150A 62.3 28.2 45% 2 R318E R150E 33.6 10.3 31% 3
R318Y R150Y 40.7 7.6 19% 3 R312Q R143Q 29.9 5.0 17% 3 R312A R143A
61.6 16.9 27% 2 R312Y R143Y 27.2 11.4 42% 2 R312L R143L 28.8 0.6 2%
2 V202M V38M 40.2 1.0 2% 2 V202Y V38Y 70.6 2.3 3% 2 D203M D39M 40.6
7.9 19% 5 D203Y D39Y 58.0 19.5 34% 4 A204M A40M 34.0 9.2 27% 5
A204Y A40Y 39.5 10.3 26% 2 K400A/R403A K230A/R233A 56.7 10.0 18% 2
K400E/R403E K230E/R233E 137.1 68.4 50% 3 R403A R233A 46.4 5.2 11% 7
R403E R233E 67.0 19.4 29% 6 K400A K230A 74.6 22.1 30% 2 K400E K230E
61.3 9.3 15% 2 K293E K126E 63.2 13.9 22% 2 K293A K126A 73.7 35.2
48% 2 R333A R165A 406.7 117.5 29% 2 R333E R165E 437.3 n.d. n.d. 1
R338A R170A 33.7 3.7 11% 2 R338E R170E 28.7 9.0 31% 10 R338A/R403A
R170A/R233A 73.6 18.1 25% 6 R338E/R403E R170E/R233E 51.9 11.9 23% 2
K293A/R403A K126A/R233A 69.2 10.2 15% 2 K293E/R403E K126E/R233E
104.1 31.0 30% 2 K293A/R338A/R403A K126A/R170A/R233A 65.4 1.3 2% 2
K293E/R338E/R403E K126E/R170E/R233E 50.0 15.1 30% 2 R318A/R403A
R150A/R233A 45.7 1.6 3% 2 R318E/R403E R150E/R233E 75.3 47.7 63% 2
R318Y/E410N R150Y/E240N 49.6 14.3 29% 21 R338E/E410N R170E/E240N
12.6 3.5 28% 12 R338E/R403E/E410N R170E/R233E/E240N 36.7 12.2 33%
17 Y155F/R338E/R403E/E410N Y[155]F/R170E/R233E/E240N 33.6 8.6 26% 2
R318Y/R338E/R403E R150Y/R170E/R233E 59.7 10.4 17% 3
Y155F/R318Y/R338E/R403E Y[155]F/R150Y/R170E/R233E 67.1 27.9 42% 2
D203N/F205T/K228N D39N/F41T/K63N 39.9 3.8 9% 2 D203N/F205T/E410N
D39N/F41T/E240N 45.5 12.0 26% 6 D203N/F205T/R338E D39N/F41T/R170E
24.1 5.6 23% 2 D203N/F205T/R338A D39N/F41T/R170A 38.5 9.9 26% 3
D203N/F205T/R318Y D39N/F41T/R150Y 47.5 6.4 13% 4
D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E 51.1 10.7 21% 2
K228N/E410N K63N/E240N 44.3 13.0 29% 10 K228N/R338E K63N/R170E 23.1
3.0 13% 2 K228N/R338A K63N/R170A 31.2 4.5 14% 2 K228N/R318Y
K63N/R150Y 61.3 5.4 9% 5 K228N/R338E/R403E K63N/R170E/R233E 59.2
4.9 8% 2 R403E/E410N R233E/E240N 93.7 1.0 1% 2 R318Y/R338E/E410N
R150Y/R170E/E240N 13.9 4.0 29% 42 D104N/K106S/R318Y/R338E/E410N
D[104]N/K[106]S/R150Y/R170E/E240N 18.9 4.1 22% 4
Y155F/R318Y/R338E/E410N Y[155]F/R150Y/R170E/E240N 16.0 4.8 30% 5
K228N/R318Y/E410N K63N/R150Y/E240N 42.0 4.7 11% 4 R318Y/R403E/E410N
R150Y/R233E/E240N 94.2 21.1 22% 5 Y155F/R318Y/R403E/E410N
Y[155]F/R150Y/R233E/E240N 111.4 74.7 67% 2 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 43.2 13.8 32% 26
A103N/N105S/R318Y/R338E/R403E/ A[103]N/N[105]S/R150Y/R170E/R233E/
44.7 20.9 47% 5 E410N E240N D104N/K106S/R318Y/R338E/R403E/
D[104]N/K[106]S/R150Y/R170E/R233E/ 38.5 16.1 42% 3 E410N E240N
Y155F/R318Y/R338E/R403E/E410N Y[155]F/R150Y/R170E/R233E/E240N 30.4
10.5 35% 4 A103N/N105S/Y155F/R318Y/R338E/
A[103]N/N[105]S/Y[155]F/R150Y/R170E/ 50.7 4.5 9% 2 R403E/E410N
R233E/E240N D104N/K106S/Y155F/R318Y/R338E/
D[104]N/K[106]S/Y[155]F/R150Y/R170E/ 48.0 2.1 4% 2 R403E/E410N
R233E/E240N D203N/F205T/R318Y/E410N D39N/F41T/R150Y/E240N 45.7 13.4
29% 6 R333S R165S 605.9 317.5 52% 3 R338L R170L 47.9 9.0 19% 3
K316N K148N 62.5 15.6 25% 3 K316A K148A 55.2 4.1 7% 3 K316E K148E
110.5 25.1 23% 3 K316S K148S 57.3 4.6 8% 3 K316M K148M 26.0 16.7
64% 3 E239S E74S 28.5 19.2 67% 3 E239A E74A 55.4 18.4 33% 3 E239R
E74R 58.3 13.9 24% 3 E239K E74K 59.2 25.5 43% 3 H257F H92F 62.0
30.1 49% 3 H257Y H92Y 59.3 25.0 42% 3 H257E H92E 59.7 39.6 66% 3
H257S H92S 56.0 24.7 44% 3 T412A T242A 76.1 44.7 59% 5 T412V T242V
51.2 18.9 37% 8 E410N/T412A E240N/T242A 37.2 3.6 10% 4 E410N/T412V
E240N/T242V 33.3 4.9 15% 4 E410Q E240Q 56.1 18.0 32% 4 E410S E240S
50.0 11.9 24% 12 E410A E240A 47.7 11.7 24% 10 E410D E240D 71.9 26.9
37% 4 N346D N178D 45.7 7.8 17% 4 Y155F/N346D Y[155]F/N178D 104.4
14.5 14% 2 N346Y N178Y 27.4 4.2 15% 8 Y345A Y177A 50.8 32.4 64% 4
Y345T Y177T 28.6 7.9 28% 4 T343R T175R 34.5 11.8 34% 12 T343E T175E
27.3 10.0 37% 4 T343Q T175Q 37.0 9.1 25% 3 F342I F174I 30.0 19.1
64% 3 T343R/Y345T T175R/Y177T 26.5 6.8 26% 3 R318Y/R338E
R150Y/R170E 24.6 5.5 22% 4 Y259F/K265T/Y345T Y94F/K98T/Y177T 30.9
4.8 16% 2 K228N/I251S K63N/I86S 122.6 53.5 44% 2
K228N/R318Y/R338E/R403E/E410N K63N/R150Y/R170E/R233E/E240N 36.1
14.0 39% 3 Y155F/K228N/R318Y/R338E/R403E/
Y[155]F/K63N/R150Y/R170E/R233E/ 40.8 15.0 37% 5 E410N E240N
D85N/K228N/R318Y/R338E/R403E/ D[85]N/K63N/R150Y/R170E/R233E/ 39.3
9.8 25% 2 E410N E240N I251S/R318Y/R338E/R403E/E410N
I86S/R150Y/R170E/R233E/E240N 33.4 10.2 30% 4
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/R170E/
46.2 7.7 17% 8 R403E/E410N R233E/E240N
Y155F/I251S/R318Y/R338E/R403E/ D[104]N/K[106]S/I86S/R150Y/R170E/
43.3 7.0 16% 2 E410N R233E/E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/E240N 16.1 2.7 17% 10
D104N/K106S/I251S/R318Y/R338E/ D[104]N/K[106]S/I86S/R150Y/R170E/
24.3 8.6 35% 3 E410N E240N F314N/K316S F145N/K148S 635.1 569.9 90%
2 K247N/N249S/R318Y/R338E/R403E/ K82N/N84S/R150Y/R170E/R233E/E240N
39.2 8.3 21% 6 E410N Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 36.3 12.8 35% 10 R403E/E410N
R233E/E240N A103N/N105S/K247N/N249S/R318Y/
A[103]N/N[105]S/K82N/N84S/R150Y/ 28.0 9.5 34% 6 R338E/R403E/E410N
R170E/R233E/E240N D104N/K106S/K247N/N249S/R318Y/
D[104]N/K[106]S/K82N/N84S/R150Y/ 59.0 0.6 1% 2 R338E/R403E/E410N
R170E/R233E/E240N D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/N84S/ 51.8 16.7 32% 6
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
K247N/N249S/R318Y/R338E/E410N K82N/N84S/R150Y/R170E/E240N 16.6 3.7
22% 6 Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/
14.7 3.9 27% 9 E410N E240N R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 36.4 9.5 26% 7 R318Y/R338E/E410S
R150Y/R170E/E240S 16.4 4.0 25% 8 K228N/K247N/N249S K63N/K82N/N84S
94.5 27.0 29% 2 D104N/K106S/Y155F/K228N/K247N/
D[104]N/K[106]S/Y[155]F/K63N/K82N/ 75.3 26.4 35% 2 N249S N84S
D104N/K106S/K228N/K247N/N249S D[104]N/K[106]S/K63N/K82N/N84S 77.1
18.3 24% 5 Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 79.2 27.6
35% 2 K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/R233E/ 49.7 15.6 31% 17 R403E/E410N
E240N D104N/K106S/K228N/K247N/N249S/
D[104]N/K[106]S/K63N/K82N/N84S/ 53.3 12.2 23% 7
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
Y155F/K228N/K247N/N249S/R318Y/ Y[155]F/K63N/K82N/N84S/R150Y/R170E/
45.4 17.7 39% 5 R338E/R403E/E410N R233E/E240N
R318Y/R338E/R403E/E410N/T412V R150Y/R170E/R233E/E240N/T242V 48.3
16.2 33% 6 R318Y/R338E/R403E/E410N/T412A
R150Y/R170E/R233E/E240N/T242A 34.4 10.0 29% 6
R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 67.5 11.6 17% 4
R318Y/R338E/T412A R150Y/R170E/T242A 23.5 5.3 22% 6
R318Y/R338E/E410N/T412V R150Y/R170E/E240N/T242V 23.6 12.3 52%
11
N260S/R318Y/R338E/R403E/E410N N95S/R150Y/R170E/R233E/E240N 72.4
20.2 28% 2 D104N/K106S/N260S/R318Y/R338E/
D[104]N/K[106]S/N95S/R150Y/R170E/ 61.1 0.0 0% 2 R403E/E410N
R233E/E240N Y155F/N260S/R318Y/R338E/R403E/
Y[155]F/N95S/R150Y/R170E/R233E/ 83.9 4.4 5% 2 E410N E240N
R318Y/R338E/N346D/R403E/E410N R150Y/R170E/N178D/R233E/E240N 77.7
20.9 27% 2 Y155F/R318Y/R338E/N346D/R403E/
Y[155]F/R150Y/R170E/N178D/R233E/ 100.0 15.6 16% 2 E410N E240N
K247N/N249S/N260S K82N/N84S/N95S 114.1 0.0 0% 2
Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 96.5 5.5 6% 2
D104N/K106S/K247N/N249S/N260S D[104]N/K[106]S/K82N/N84S/N95S 61.2
14.1 23% 2 D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/N84S/ 68.5 33.2 49% 2 N260S N95S
K247N/N249S/N260S/R318Y/R338E/ K82N/N84S/N95S/R150Y/R170E/R233E/
47.4 12.1 26% 6 R403E/E410N E240N Y155F/K247N/N249S/N260S/R318Y/
Y[155]F/K82N/N84S/N95S/R150Y/R170E/ 95.4 73.0 77% 5
R338E/R403E/E410N R233E/E240N Y155F/N260S/N346D Y[155]F/N95S/N178D
127.9 6.2 5% 2 R318Y/R338E/T343R/R403E/E410N
R150Y/R170E/T175R/R233E/E240N 24.7 7.2 29% 13
Y155F/R318Y/R338E/T343R/R403E/ Y[155]F/R150Y/R170E/T175R/R233E/
27.2 5.7 21% 4 E410N E240N D104N/K106S/R318Y/R338E/T343R/
D[104]N/K[106]S/R150Y/R170E/T175R/ 26.6 5.0 19% 5 R403E/E410N
R233E/E240N R338E/T343R R170E/T175R 14.3 3.6 25% 7 T343R/N346Y
T175R/N178Y 26.0 7.3 28% 11 R318Y/R338E/N346Y/R403E/E410N
R150Y/R170E/N178Y/R233E/E240N 28.1 7.5 27% 3
R318Y/R338E/T343R/N346Y/R403E/ R150Y/R170E/T175R/N178Y/R233E/ 15.8
4.0 25% 5 E410N E240N T343R/N346D T175R/N178D 118.5 42.9 36% 2
R318Y/R338E/T343R/N346D/R403E/ R150Y/R170E/T175R/N178D/R233E/ 67.0
26.8 40% 2 E410N E240N R318Y/R338E/Y345A/R403E/E410N
R150Y/R170E/Y177A/R233E/E240N 18.8 8.8 47% 6
R318Y/R338E/Y345A/N346D/R403E/ R150Y/R170E/Y177A/N178D/R233E/ 56.5
16.1 28% 3 E410N E240N Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 67.3 17.7 26% 5 R403E R233E
K247N/N249S/R318Y/R338E/R403E K82N/N84S/R150Y/R170E/R233E 53.6 22.1
41% 2 Y155F/K247N/N249S/R318Y/R403E/ Y[155]F/K82N/N84S/R150Y/R233E/
125.4 9.1 7% 3 E410N E240N K247N/N249S/R318Y/R403E/E410N
K82N/N84S/R150Y/R233E/E240N 110.9 29.5 27% 10
Y155F/K247N/N249S/R338E/R403E/ Y[155]F/K82N/N84S/R170E/R233E/E240N
48.7 11.4 23% 3 E410N K247N/N249S/R338E/R403E/E410N
K82N/N84S/R170E/R233E/E240N 25.0 7.9 31% 2 R318Y/R338E/T343R/R403E
R150Y/R170E/T175R/R233E 44.3 11.0 25% 4
Y155F/R318Y/R338E/T343R/R403E Y[155]F/R150Y/R170E/T175R/R233E 34.0
8.7 26% 4 R318Y/R338E/T343R/E410N R150Y/R170E/T175R/E240N 16.4 5.9
36% 16 Y155F/R318Y/R338E/T343R/E410N
Y[155]F/R150Y/R170E/T175R/E240N 25.6 5.4 21% 4
R318Y/T343R/R403E/E410N R150Y/T175R/R233E/E240N 93.9 14.0 15% 3
Y155F/R318Y/T343R/R403E/E410N Y[155]F/R150Y/T175R/R233E/E240N 34.0
7.7 23% 2 R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N 34.7 14.3
41% 2 Y155F/R338E/T343R/R403E/E410N Y[155]F/R170E/T175R/R233E/E240N
25.9 8.2 32% 4 Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/R170E/ 25.7 8.4 33% 11 T343R/R403E/E410N
T175R/R233E/E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/R233E/ 29.2 7.9 27% 5 R403E/E410N E240N
K228N/I251S/R318Y/R338E/R403E/ K63N/I86S/R150Y/R170E/R233E/E240N
36.4 10.8 30% 7 E410N Y155F/K228N/I251S/R318Y/R338E/
Y[155]F/K63N/I86S/R150Y/R170E/R233E/ 39.3 7.3 19% 5 R403E/E410N
E240N N260S/R318Y/R338E/T343R/R403E/
N95S/R150Y/R170E/T175R/R233E/E240N 32.1 10.3 32% 7 E410N
Y155F/N260S/R318Y/R338E/T343R/ Y[155]F/N95S/R150Y/R170E/T175R/ 40.2
11.6 29% 5 R403E/E410N R233E/E240N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/T175R/ 25.1 5.4 21% 12 T343R/R403E/E410N
R233E/E240N Y155F/K228N/K247N/N249S/R318Y/
Y[155]F/K63N/K82N/N84S/R150Y/R170E/ 36.8 18.8 51% 5
R338E/T343R/R403E/E410N T175R/R233E/E240N Y155F/R338E/T343R/R403E
Y[155]F/R170E/T175R/R233E 28.9 9.1 31% 5 R338E/T343R/R403E
R170E/T175R/R233E 23.5 6.5 28% 2 Y155F/R338E/T343R/R403E/E410S
Y[155]F/R170E/T175R/R233E/E240S 23.9 3.1 13% 6
Y155F/N260S/R338E/T343R/R403E Y[155]F/N95S/R170E/T175R/R233E 69.2
27.8 40% 6 Y155F/I251S/R338E/T343R/R403E
Y[155]F/I86S/R170E/T175R/R233E 19.6 3.4 17% 2
R318Y/R338E/T343R/R403E/E410S R150Y/R170E/T175R/R233E/E240S 19.0
6.4 33% 14 Y155F/K247N/N249S/T343R/R403E
Y[155]F/K82N/N84S/T175R/R233E 59.6 20.3 34% 4
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 36.5
3.5 10% 2 T343R/R403E T175R/R233E K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/R233E 28.4 17.8 63% 4 R403E
Y155F/K247N/N249S/R338E/T343R/ Y[155]F/K82N/N84S/R170E/T175R/R233E/
26.4 1.3 5% 2 R403E/E410N E240N K247N/N249S/R338E/T343R/R403E/
K82N/N84S/R170E/T175R/R233E/E240N 25.1 3.0 12% 2 E410N
Y155F/K247N/N249S/R318Y/R338E Y[155]F/K82N/N84S/R150Y/R170E 26.3
8.8 33% 2 Y155F/K247N/N249S/R318Y/T343R
Y[155]F/K82N/N84S/R150Y/T175R 42.1 12.8 30% 4
Y155F/K247N/N249S/R318Y/R403E Y[155]F/K82N/N84S/R150Y/R233E 108.6
22.3 21% 3 Y155F/K247N/N249S/R318Y/E410N
Y[155]F/K82N/N84S/R150Y/E240N 48.8 12.8 26% 3
Y155F/K247N/N249S/R338E/R403E Y[155]F/K82N/N84S/R170E/R233E 40.9
12.9 31% 2 Y155F/K247N/N249S/R338E/T343R
Y[155]F/K82N/N84S/R170E/T175R 15.3 4.0 26% 2
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 17.7
6.0 34% 4 T343R/E410N T175R/E240N K247N/N249S/R318Y/R338E/T343R/
K82N/N84S/R150Y/R170E/T175R/E240N 32.8 22.9 70% 6 E410N
Y155F/K247N/N249S/R318Y/T343R/ Y[155]F/K82N/N84S/R150Y/T175R/ 60.6
26.0 43% 2 R403E/E410N R233E/E240N K247N/N249S/R318Y/T343R/R403E/
K82N/N84S/R150Y/T175R/R233E/E240N 80.5 31.3 39% 7 E410N
Y155F/K247N/N249S/R338E/E410N Y[155]F/K82N/N84S/R170E/E240N 17.7
7.6 43% 8 Y155F/K247N/N249S/R318Y/T343R/
Y[155]F/K82N/N84S/R150Y/T175R/ 60.5 7.5 12% 2 R403E R233E
K247N/N249S/R318Y/T343R/R403E K82N/N84S/R150Y/T175R/R233E 105.3
25.8 25% 9 Y155F/K247N/N249S/R318Y/T343R/
Y[155]F/K82N/N84S/R150Y/T175R/ 38.1 29.6 78% 4 E410N E240N
K247N/N249S/R318Y/T343R/E410N K82N/N84S/R150Y/T175R/E240N 40.1 25.9
64% 4 Y155F/K247N/N249S/R338E/T343R/
Y[155]F/K82N/N84S/R170E/T175R/R233E 25.1 2.8 11% 2 R403E
K247N/N249S/R338E/T343R/R403E K82N/N84S/R170E/T175R/R233E 26.3 3.5
13% 2 Y155F/K247N/N249S/R338E/T343R/
Y[155]F/K82N/N84S/R170E/T175R/E240N 27.0 7.1 26% 2 E410N
K247N/N249S/R338E/T343R/E410N K82N/N84S/R170E/T175R/E240N 27.5 11.1
40% 5 Y155F/K247N/N249S/T343R/R403E/
Y[155]F/K82N/N84S/T175R/R233E/E240N 52.0 5.4 10% 2 E410N
K247N/N249S/T343R/R403E/E410N K82N/N84S/T175R/R233E/E240N 60.0 13.9
23% 2 Y155F/R318Y/R338E/T343R Y[155]F/R150Y/R170E/T175R 24.2 8.8
36% 7 R318Y/R338E/T343R R150Y/R170E/T175R 30.0 1.5 5% 2
Y155F/R318Y/T343R/R403E Y[155]F/R150Y/T175R/R233E 72.7 29.5 41% 2
Y155F/T343R/R403E/E410N Y[155]F/T175R/R233E/E240N 44.6 1.9 4% 2
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/R170E/ 27.6
13.2 48% 7 T343R T175R K247N/N249S/R318Y/R338E/T343R
K82N/N84S/R150Y/R170E/T175R 24.4 13.5 55% 4
Y155F/K247N/N249S/T343R/E410N Y[155]F/K82N/N84S/T175R/E240N 34.4
20.0 58% 5 Y155F/K247N/N249S/R403E/E410N
Y[155]F/K82N/N84S/R233E/E240N 131.3 53.1 40% 7
Y155F/R338E/T343R/E410N Y[155]F/R170E/T175R/E240N 22.4 13.8 62% 6
R338E/T343R/E410N R170E/T175R/E240N 35.5 15.9 45% 2
Y155F/R318Y/T343R/E410N Y[155]F/R150Y/T175R/E240N 40.3 22.9 57% 4
R318Y/T343R/E410N R150Y/T175R/E240N 52.3 2.4 5% 2
K228N/R318Y/R338E/T343R/R403E/ K63N/R150Y/R170E/T175R/R233E/E240N
40.3 9.6 24% 3 E410N K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/T175R/ 44.4 23.7 53% 3 T343R/R403E R233E
K228N/247N/N249S/R318Y/R338E/ K63N/K82N/N84S/R150Y/R170E/T175R/
38.1 10.4 27% 2 T343R/E410N E240N K228N/K247N/N249S/R318Y/T343R/
K63N/K82N/N84S/R150Y/T175R/R233E/ 125.1 36.4 29% 3 R403E/E410N
E240N .dagger.produced in BHK-21 cells; *80% glycosylated form of
E410N
Example 5
Determination of the Inhibition of FIXa by the Antithrombin/heparin
Complex
[0606] Inhibition of wild-type FIXa or FIXa variants by the
Antithrombin/heparin complex (AT-III/heparin) was assessed by
measuring the level of inhibition by various concentrations of
AT-III/heparin on the catalytic activity of FIXa towards a small
molecule substrate, Mesyl-D-CHG-Gly-Arg-AMC (Pefafluor FIXa;
Pentapharm). A K.sub.0.5 value is determined for each FIXa variant
tested, which corresponds to the molar concentration of AT-III that
was required for 50% inhibition (IC.sub.50) of the catalytic
activity of a FIXa variant under the predefined conditions of the
assay. Inhibition reactions were performed in the presence of low
molecular weight heparin (LMWH; Calbiochem) or full-length
unfractionated heparin (UFH; Calbiochem), the latter requiring
modified protocol conditions to account for an increase in the rate
of inhibition. The apparent second-order rate constant (k.sub.app)
for the inhibition of wild-type FIXa or FIXa variants by the
AT-III/UFH complex was also directly evaluated using a modified
protocol, in which the time of incubation with the AT-III/UFH
complex was varied.
A. Inhibition of FIXa by the Antithrombin/LMWH Complex
[0607] For inhibition reactions in the presence of LMWH, a 200 nM
solution of AT-III/LMWH (final 2 .mu.M LMWH) was prepared by
dilution of a 20 .mu.M stock of plasma purified human AT-III
(Molecular Innovations) into a solution of 2 .mu.M LMWH in a 1.2 mL
volume of 1.times. Buffer A (50 mM Tris, 1001nM NaCl, 10 mM
CaCl.sub.2, 0.01% Tween-20, pH 7.4). This solution of AT-III/LMWH
was for use as the highest concentration in the assay. AT-III/LMWH
solutions were incubated for at least 30 minutes at room
temperature and then serially diluted 1.5-fold in a 96 deep-well
polypropylene plate with a final volume of 400 .mu.L 1.times.
Buffer A that contained 2 .mu.M LMWH, resulting in dilutions of 200
nM, 133.3, nM 88.9 nM, 59.3 nM, 39.5 nM, 26.3 nM, 17.6 nM and 0 nM
(i.e. rows A-H). A total of 25 .mu.L was aliquoted into their
respective rows of a 96-well V-bottom storage plate to fill all
columns (i.e. 1-12). FIXa variants were initially diluted to 100 nM
in 1.times. Buffer A. Subsequently, 36 .mu.L of each 100 nM FIXa
variant was diluted to a concentration of 1.8 nM in 2.0 mL of
1.times. Buffer A and then 60 .mu.L of this solution was aliquoted
into a 96-well V-bottom storage plate according to a predefined
plate map (4 FIXa variants per plate).
[0608] Assay reactions were initiated using a BioMek FX liquid
handling system programmed to dispense 25 .mu.l. of the FIXa
solutions into the plates containing 25 .mu.l of each dilution of
AT-III/LMWH per well for a total of two duplicate assay plates for
each FIXa variant. The final inhibition assay conditions were: 0.9
nM FIXa and AT-III dilutions ranging from 0 to 100 nM in 1 .mu.M
LMWH Inhibition reactions were further incubated for 1 minute at
room temperature (-25.degree. C.) before a 25 .mu.L aliquot of the
reaction was transferred by the BioMek FX to a 96-well black
half-area plate containing 25 .mu.L of 1.6 mM
Mesyl-D-CHG-Gly-Arg-AMC per well in assay Buffer B (50 mM Tris, 100
mM NaCl, 10 mM CaCl.sub.2, 0.01% Tween-20, pH 7.4, 60% ethylene
glycol). Polybrene (hexadimethrine bromide) at a final
concentration of 5 mg/mL was added in Buffer B to quench the
AT-III/LMWH reaction. Residual activity of FIXa was assessed by
following the initial rates of substrate cleavage for 60 minutes in
a fluorescence reader set to 25.degree. C. The final assay
conditions for determination of residual activity are 0.45 nM FIXa
variant, 0.8 mM Mesyl-D-CHG-Gly-Arg-AMC, 30% ethylene glycol and 5
mg/mL polybrene in 50 mM Tris, 100 mM NaCl, 10 mM CaCl.sub.2, 0.01%
Tween-20, pH 7.4.
[0609] To determine the degree of inhibition by AT-III/LMWH for
FIXa or FIXa variants, raw data collected with the SoftMax Pro
application (Molecular Devices) were exported as .XML files.
Further non-linear data analyses were performed with XLfit4, a
software package for automated curve fitting and statistical
analysis within the Microsoft Excel spreadsheet environment (IDBS
Software) or directly within the ActivityBase software package
using the XE Runner data analysis module (IDBS Software). The
template was used to calculate the AT-III dilution series, ratio of
AT-III to FIXa, and the Vi/Vo ratios for each FIXa replicate at
each experimental AT-III concentration. The spreadsheet template
was used to calculate the AT-III dilution series, ratio of AT-III
to FIXa, and the Vi/Vo ratios for each FIXa replicate at each
experimental AT-III concentration. Non-linear regression analyses
of residual FIXa activity (expressed as Vi/Vo) versus AT-III
concentration was processed using XLfit4 and a hyperbolic
inhibition equation of the form ((C+(Amp*(1-(X/(K.sub.0.5+X)))));
where C=the offset (fixed at 0 to permit extrapolation of data sets
that did not reach 100% inhibition during the course of the assay),
Amp=the amplitude of the fit and K.sub.0.5, which corresponds to
the concentration of AT-III required for half-maximal inhibition
under the assay conditions. For several FIXa variants, AT-III/LMWH
inhibited less than 10-15% of the total protease activity at the
highest tested concentration of AT-III, representing an upper limit
of detection for the assay under standard screening conditions.
Variants with less than 10% maximal inhibition were therefore
assigned a lower limit K.sub.0.5 value of 999 nM and in most cases
are expected to have AT-III resistances much greater than the
reported value.
[0610] Table 20 provides the results of the assays that were
performed using AT-III/LMWH. The results are presented both as the
fitted K.sub.0.5 parameter and as a representation of the extent of
AT-III resistance for each variant compared to the wild-type FIXa
expressed as a ratio of their fitted K.sub.0.5 values (K.sub.0.5
variant/K.sub.0.5 wild-type). Where the K.sub.0.5 parameter of the
FIXa variant was compared to wild-type FIXa, it was compared to a
recombinant wild-type FIXa polypeptide that was expressed and
purified using the same conditions as used for the variant FIXa
polypeptides to ensure that any differences in activity were the
result of the mutation(s), and not the result of differences in,
for example, post-translational modifications associated with
different expression systems. Thus, the wild-type FIXa polypeptide
used for comparison was the recombinant wild-type FIXa generated
from cloning the FIX gene set forth in SEQ ID NO:1 and expressed
from CHOX cells as a polypeptide with an amino acid sequence set
forth in SEQ ID NO:3, as described in Example 1 (i.e. Catalyst
Biosciences WT FIX polypeptide). Several FIXa variants exhibited
greater than 20-fold increased resistance to compared to wild-type
FIXa (Catalyst Biosciences WT FIXa). For example, FIXa-R318A/R403A,
FIXa-R318E/R340E, FIXa-R318A, FIXa-R318E, FIXa-K400E,
FIXa-R338E/R403E and FIXa-K400A/R403A are among the group that
exhibited significant resistance to AT-III.
TABLE-US-00021 TABLE 20 Inhibition of FIXa variants by AT-III/LMWH
Mutation Mutation K.sub.0.5 .+-.S.D. K.sub.0.5-mut/ (Mature FIX
Numbering) (Chymotrypsin Numbering) (nM) (nM) % CV K.sub.0.5-wt n
Plasma Purified FIXa Plasma Purified FIXa 20.2 6.7 33% 0.7 3
BeneFIX (T148A) BeneFIX (T[148]A) 27.3 4.7 17% 0.9 2 Catalyst
Biosciences WT Catalyst Biosciences WT 29.4 7.3 25% 1.0 10
A103N/N105S A[103]N/N[105]S 31.1 n/a n/a 1.1 1 D104N/K106S
D[104]N/K[106]S 26.1 n/a n/a 0.9 1 K106N/V108S K[106]N/V[108]S 47.7
n/a n/a 1.6 1 D85N D[85]N 33.1 n/a n/a 1.1 1 T148A T[148]A 22.9 1.7
8% 0.8 4 D203N/F205T D39N/F41T 154.1 50.1 33% 5.2 4 I251S I86S 22.6
n/a n/a 0.8 1 D85N/I251S D[85]N/I86S 28.3 n/a n/a 1.0 1
D85N/D104N/K106S/I251S D[85]N/D[104]N/K[106]S/I86S 32.1 n/a n/a 1.1
1 A262S A95bS 25.3 n/a n/a 0.9 1 K413N K243N 34.2 n/a n/a 1.2 1
E410N E240N 24.8 7.8 31% 0.8 3 E239N E74N 191.8 61.0 32% 6.5 3
T241N/H243S T76N/H78S 35.4 n/a n/a 1.2 1 K247N/N249S K82N/N84S 23.1
n/a n/a 0.8 1 L321N L153N 39.0 n/a n/a 1.3 1 F314N/H315S
F145N/H147S 191.8 59.8 31% 6.5 3 S319N/L321S S151N/L153S 113.4 n/a
n/a 3.9 1 N260S N95S 64.6 n/a n/a 2.2 1 Y284N Y117N 36.7 n/a n/a
1.2 1 R318A R150A 896.2 189.2 21% 30.5 2 R318E R150E 861.1 21.8 3%
29.3 2 R318Y R150Y 395.1 6.3 2% 13.5 2 R312Q R143Q 52.7 5.1 10% 1.8
2 R312A R143A 51.9 1.3 3% 1.8 2 R312Y R143Y 323.0 13.7 4% 11.0 2
R312L R143L 25.5 2.9 11% 0.9 2 V202M V38M 20.3 5.1 25% 0.7 2 V202Y
V38Y 27.2 6.9 25% 0.9 2 D203M D39M 18.6 6.9 37% 0.6 2 D203Y D39Y
31.1 0.3 1% 1.1 2 A204M A40M 45.8 11.1 24% 1.6 2 A204Y A40Y 43.4
22.3 51% 1.5 2 K400A/R403A K230A/R233A 585.0 160.5 27% 19.9 2
K400E/R403E K230E/R233E 299.0 206.5 69% 10.2 2 R403A R233A 164.3
88.7 54% 5.6 2 R403E R233E 264.2 80.9 31% 9.0 2 K400A K230A 384.0
121.1 32% 13.1 2 K400E K230E 614.8 71.4 12% 20.9 2 K293E K126E
290.2 42.1 15% 9.9 2 K293A K126A 194.1 38.0 20% 6.6 2 R333A R165A
225.7 72.7 32% 7.7 2 R333E R165E 345.6 1.7 0% 11.8 2 R338.ANG.
R170A 56.2 8.4 15% 1.9 2 R338E R170E 238.4 n/a n/a 8.1 1
R338A/R403A R170A/R233A 418.5 150.9 36% 14.2 2 R338E/R403E
R170E/R233E 601.6 241.5 40% 20.5 2 K293A/R403A K126A/R233A 486.3
114.9 24% 16.6 2 K293E/R403E K126E/R233E 342.0 4.9 1% 11.6 2
K293A/R338A/R403A K126A/R170A/R233A 497.1 85.9 17% 16.9 2
K293E/R338E/R403E K126E/R170E/R233E 418.5 150.9 36% 14.2 2
R318A/R403A R150A/R233A 999.0 n/a n/a 34.0 2 R318E/R403E
R150E/R233E 999.0 n/a n/a 34.0 2 A K.sub.0.5 value of 999 nM
indicates the lower limit value for those variants with less than
10% inhibition under the conditions of the assay.
B. Inhibition of FIXa by the Antithrombin/UFH Complex
[0611] Additional experiments were performed to assess the
inhibition of FIXa variants by AT-III/UFH (unfractionated
full-length heparin) using the same assay as described above with
minor modifications. Full-length, unfractionated heparin
(Calbiochem) was used instead of low molecular weight heparin
(LMWH) to observe the effects of FIXa variant mutations on the
increased rate of the inhibition reaction due to the "templating"
effect provided by longer heparin chains (see e.g., Olson et al.
(2004) Thromb Haemost 92(5), 929-939).
[0612] For inhibition reactions in the presence of UFH, a 70 nM,
600 nM, 2000 nM, 6000 or 10000 nM solutions of AT-III/UFH (final 1
.mu.M UFH) were prepared by dilution of a 20 .mu.M stock of plasma
purified human AT-III (Molecular Innovations) into a solution of
excess UFH (2 to 20 .mu.M) in a 1.4 mL volume of 1.times. Buffer A
(50 mM Tris, 100 mM NaCl, 10 mM CaCl.sub.2, 0.01% Tween-20, pH
7.4). AT-III/UFH solutions were also incubated for 30 minutes at
room temperature before being serially diluted 1.5-fold in a 96
deep-well polypropylene plate with a final volume of 460 .mu.L
1.times. Buffer A containing 1 .mu.M UFH. The final dilutions of
AT-III for the modified assay were dependent on the starting
concentration of AT-III and ranged from 70 nM-0 nM, 600 nM-0 nM,
100 nM-0 nM or 5000 nM-0 nM (i.e. rows A-H). Those variants, which
showed increased resistance to AT-III inhibition under the standard
conditions, were further tested using higher concentrations of
AT-III. A total of 35 .mu.L of each AT-III dilution was aliquoted
into their respective rows of a 96-well V-bottom storage plate to
fill all columns (i.e. 1-12). FIXa variants were initially diluted
to 100 nM in 1.times. Buffer A. Subsequently, 15 .mu.l of each 100
nM FIXa variant was diluted to a concentration of 0.6 nM in 2.0 mL
of 1.times. Buffer A and then 70 .mu.L of this solution was
aliquoted into a 96-well V-bottom storage plate according to the
same predefined plate map (4 FIXa variants per plate).
[0613] Assay reactions were initiated using a BioMek FX liquid
handling system programmed to dispense 35 .mu.L of the FIXa
solutions into the plates containing 35 .mu.L of each dilution of
AT-III/heparin per well for a total of two duplicate assay plates
for each FIXa variant. The final inhibition assay conditions were:
0.3 nM FIXa and AT-III dilutions ranging from 35 nM to 0 nM, 300 nM
to 0 nM, 1000 nM to 0 nM, 3000 nM to 0 nM or 5000 nM to 0 nM in UFH
ranging from 1 .mu.M to 10 .mu.M, depending of the highest AT-III
concentration so that the heparin remained in excess Inhibition
reactions were further incubated for 10 seconds at room temperature
(.about.25.degree. C.) before a 40 .mu.L aliquot of the reaction
was transferred by the BioMek FX to a 96-well black half-area plate
containing 20 .mu.L of 2.5 mM Mesyl-D-CHG-Gly-Arg-AMC per well in
assay Buffer C (50 mM Tris, 100 mM NaCl, 10 mM CaCl.sub.2, 0.01%
Tween-20, pH 7.4, 82% ethylene glycol and 5 mg/mL polybrene).
Polybrene (hexadimethrine bromide) at a final concentration of 5
mg/mL was added to Buffer C to quench the AT-III/UFH reaction.
Residual activity of FIXa was assessed by following the initial
rates of substrate cleavage for 60 minutes in a fluorescence reader
set to 25.degree. C. The final assay conditions for determination
of residual activity were 0.2 nM FIXa variant, 0.83 mM
Mesyl-D-CHG-Gly-Arg-AMC, 30% ethylene glycol and 5 mg/mL polybrene
in 50 mM Tris, 100 mM NaCl, 10 mM CaCl.sub.2, 0.01% Tween-20, pH
7.4. Data analyses were performed as described above for
AT-III/LMWH inhibition assays.
[0614] As found with LMWH, AT-III/UFH inhibited less than 10-15% of
the of the total protease activity for a number of FIXa variants at
the highest tested concentrations of AT-III, thus representing an
upper limit of detection for the assay under standard screening
conditions. These variants with less than 10% maximal inhibition
were therefore assigned a lower limit K.sub.0.5 value of 999 nM and
in most cases are expected to have AT-III resistances much greater
than the reported value. Several FIXa variants that were initially
given a K.sub.0.5 value of 999 nM were retested at higher AT-III
concentrations, expanding the sensitivity of the assay and
providing clear levels of AT-III resistance. If these variants
still maintained less than 10% maximal inhibition at the highest
test AT-III concentrations (1000 nM to 5000 nM) a lower limit
K.sub.0.5 value of 9999 nM was assigned, thus these variants are
expected to have AT-III resistances much greater than the reported
value.
[0615] Tables 21-22 provide the results of the assays that were
performed using AT-III/UFH. Table 22 reflects data for additional
FIXa variants and provide new overall averages calculated to
include additional experimental replicates (n) for FIXa variants in
Table 21. The results are presented both as the fitted K.sub.0.5
parameter and as a representation of the extent of AT-III
resistance for each variant compared to the wild-type FIXa
expressed as a ratio of their fitted K.sub.0.5 values (K.sub.0.5
variant/K.sub.0.5 wild-type). Several FIXa variants exhibited
greater than 100 to 500-fold increased resistance to AT-III
compared to wild-type FIXa. For example, FIXa-R318A/R403A,
FIXa-R318A, FIXa-R318Y, FIXa-R338A/R403A FIXa-D203N/F205T/R318Y,
FIXa-R318Y/R338E/R403E, FIXa-R318Y/R338E/R403E,
FIXa-R318Y/R338E/E410N, R318Y/R338E/T343R/N346Y/R403E/E410N and
FIXa-R318Y/R403E/E410N are among this group, which exhibited
significant resistance to AT-III.
TABLE-US-00022 TABLE 21 Inhibition of FIXa variants by AT-III/UFH
Mutation Mutation K.sub.0.5 .+-.S.D. K.sub.0.5-mut/ (Mature FIX
Numbering) (Chymotrypsin Numbering) (nM) (nM) % CV K.sub.0.5-wt n
BeneFIX Benefix .RTM. BeneFIX Benefix .RTM. 18 8 44% 0.9 51
Coagulation FIX (T148A) Coagulation FIX (T[148]A) Plasma Purified
FIXa Plasma Purified FIXa 30 4 14% 1.6 5 Catalyst Biosciences WT
Catalyst Biosciences WT 19 7 34% 1.0 15 N157D N[157]D 17 4 23% 0.9
2 Y155F Y[155]F 13 0 1% 0.7 2 A103N/N105S/Y155F
A[103]N/N[105]S/Y[155]F 11 6 49% 0.6 2 D104N/K106S/Y155F
D[104]N/K[106]S/Y[155]F 6 2 33% 0.3 2 A103N/N105S A[103]N/N[105]S
20 3 14% 1.0 2 D104N/K106S D[104]N/K[106]S 20 2 9% 1.0 2
K106N/V108S K[106]N/V[108]S 24 0 1% 1.2 2 D85N D[85]N 17 3 15% 0.9
4 T148A T[148]A 21 8 39% 1.1 10 K5A K[5]A 22 3 15% 1.2 2 D64N
D[64]N 18 0 1% 0.9 2 D64A D[64]A 16 2 12% 0.8 2 N167D N[167]D 12 2
14% 0.6 2 N167Q N[167]Q 12 1 8% 0.6 2 S61A S[61]A 19 3 18% 1.0 2
S53A S[53]A 27 4 16% 1.4 2 T159A T[159]A 33 7 23% 1.7 2 T169A
T[169]A 17 6 36% 0.9 2 T172A T[172]A 16 3 21% 0.8 2 T179A T[179]A
24 2 7% 1.2 2 Y155H Y[155]H 25 4 15% 1.3 2 Y155Q Y[155]Q 23 0 1%
1.2 2 S158A S[158]A 20 1 5% 1.0 2 S158D S[158]D 15 2 16% 0.8 2
S158E S[158]E 14 1 10% 0.7 2 N157Q N[157]Q 16 2 11% 0.8 2
D203N/F205T D39N/F41T 271 51 19% 14.0 5 D85N/D203N/F205T
D[85]N/D39N/F41T 587 65 11% 30.3 2 K228N K63N 29 13 46% 1.5 6
D85N/K228N D[85]N/K63N 34 3 7% 1.7 2 A103N/N105S/K228N
A[103]N/N[105]S/K63N 46 17 36% 2.4 2 D104N/K106S/K228N
D[104]N/K[106]S/K63N 41 21 52% 2.1 2 Y155F/K228N Y[155]F/K63N 15
n.d. n.d. 0.8 1 D104N/K106S/Y155F/K228N
D[104]N/K[106]S/Y[155]F/K63N 49 5 9% 2.5 2 I251S I86S 28 8 28% 1.4
4 D85N/I251S D[85]N/I86S 19 6 30% 1.0 2 D85N/D104N/K106S/I251S
D[85]N/D[104]N/K[106]S/I86S 28 11 41% 1.4 2 A103N/N105S/I251S
A[103]N/N[105]S/I86S 42 14 33% 2.2 3 D104N/K106S/I251S
D[104]N/K[106]S/I86S 32 5 16% 1.6 2 Y155F/I251S Y[155]F/I86S 18 3
19% 0.9 2 A262S A95bS 25 5 21% 1.3 2 K413N K243N 27 13 48% 1.4 2
E410N E240N 9 2 27% 0.5 4 E239N E74N 132 21 16% 6.8 2 T241N/H243S
T76N/H78S 21 12 56% 1.1 2 K247N/N249S K82N/N84S 22 4 18% 1.1 4
Y155F/K247N/N249S Y[155]F/K82N/N84S 13 3 24% 0.7 4
A103N/N105S/K247N/N249S A[103]N/N[105]S/K82N/N84S 53 29 55% 2.7 4
D104N/K106S/K247N/N249S D[104]N/K[106]S/K82N/N84S 19 2 9% 1.0 2
D104N/K106S/Y155F/K247N/ D[104]N/K[106]S/Y[155]F/K82N/ 27 2 9% 1.4
2 N249S N84S L321N L153N 25 6 25% 1.3 2 F314N/H315S F145N/H147S 104
27 26% 5.4 4 S319N/L321S S151N/L153S 65 11 17% 3.4 2 N260S N95S 312
283 91% 16.1 13 D104N/K106S/N260S D[104]N/K[106]S/N95S 228 82 36%
11.8 2 Y155F/N260S Y[155]F/N95S 77 16 21% 4.0 2
D104N/K106S/Y155F/N260S D[104]N/K[106]S/Y[155]F/N95S 292 37 13%
15.1 2 Y284N Y117N 41 25 63% 2.1 5 R318N/A320S R150N/A152S 999 0 0%
51.7 2 R318A R150A 4145 1297 31% 214.3 2 R318E R150E 10000 0 0%
517.0 2 R318Y R150Y 1976 430 22% 102.2 2 R312Q R143Q 33 9 26% 1.7 2
R312A R143A 31 0 1% 1.6 2 R312Y R143Y 2499 350 14% 129.2 2 R312L
R143L 17 1 5% 0.9 2 V202M V38M 14 2 14% 0.7 2 V202Y V38Y 18 3 14%
0.9 2 D203M D39M 11 0 1% 0.6 2 D203Y D39Y 16 3 21% 0.8 2 A204M A40M
29 3 9% 1.5 2 A204Y A40Y 24 1 3% 1.2 2 K400A/R403A K230A/R233A 999
0 0% 51.7 2 K400E/R403E K230E/R233E 999 0 0% 51.7 2 R403A R233A 190
34 18% 9.8 4 R403E R233E 731 14 2% 37.8 2 K400A K230A 114 3 3% 5.9
2 K400E K230E 301 27 9% 15.6 2 K293E K126E 187 25 13% 9.7 2 K293A
K126A 82 1 1% 4.2 2 R333A R165A 235 54 23% 12.1 2 R333E R165E 999 0
0% 51.7 2 R338A R170A 33 3 10% 1.7 2 R338E R170E 222 124 56% 11.5 8
R338A/R403A R170A/R233A 328 106 32% 17.0 6 R338E/R403E R170E/R233E
6000 1089 18% 310.2 2 K293A/R403A K126A/R233A 999 0 0% 51.7 2
K293E/R403E K126E/R233E 999 0 0% 51.7 2 K293A/R338A/R403A
K126A/R170A/R233A 999 0 0% 51.7 2 K293E/R338E/R403E
K126E/R170E/R233E 999 0 0% 51.7 2 R318A/R403A R150A/R233A 999 0 0%
51.7 2 R318E/R403E R150E/R233E 999 0 0% 51.7 2 R318Y/E410N
R150Y/E240N 607 164 27% 31.4 4 R338E/E410N R170E/E240N 92 14 15%
4.7 4 R338E/R403E/E410N R170E/R233E/E240N 2351 168 7% 121.5 2
R318Y/R338E/R403E R150Y/R170E/R233E 10000 0 0% 517.0 7
D203N/F205T/K228N D39N/F41T/K63N 822 69 8% 42.5 2 D203N/F205T/E410N
D39N/F41T/E240N 377 20 5% 19.5 2 D203N/F205T/R338E D39N/F41T/R170E
1170 180 15% 60.5 2 D203N/F205T/R338A D39N/F41T/R170A 423 61 14%
21.9 2 D203N/F205T/R318Y D39N/F41T/R150Y 7226 133 2% 373.6 2
D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E 1520 162 11% 78.6 2
K228N/E410N K63N/E240N 36 7 20% 1.9 2 K228N/R338E K63N/R170E 108 8
7% 5.6 2 K228N/R338A K63N/R170A 51 7 14% 2.7 2 K228N/R318Y
K63N/R150Y 3414 73 2% 176.5 2 K228N/R338E/R403E K63N/R170E/R233E
1679 239 14% 86.8 2 R403E/E410N R233E/E240N 279 26 9% 14.4 2
R318Y/R338E/E410N R150Y/R170E/E240N 3458 1033 30% 178.8 5
D104N/K106S/R318Y/R338E/ D[104]N/K[106]S/R150Y/R170E/ 6328 4241 67%
327.2 4 E410N E240N Y155F/R318Y/R338E/E410N
Y[155]F/R150Y/R170E/E240N 1098 1095 100% 56.8 7 K228N/R318Y/E410N
K63N/R150Y/E240N 475 83 17% 24.6 2 R318Y/R403E/E410N
R150Y/R233E/E240N 7072 1387 20% 365.6 2 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 5881 4757 81% 304.1 4
A103N/N105S/R318Y/R338E/ A[103]N/N[105]S/R150Y/R170E/ 9193 1037 11%
475.3 4 R403E/E410N R233E/E240N D104N/K106S/R318Y/R338E/
D[104]N/K[106]S/R150Y/R170E/ 10000 0 0% 517.0 2 R403E/E410N
R233E/E240N Y155F/R318Y/R338E/R403E/ Y[155]F/R150Y/R170E/R233E/
10000 0 0% 517.0 2 E410N E240N A103N/N105S/Y155F/R318Y/
A[103]N/N[105]S/Y[155]F/R150Y/ 10000 0 0% 517.0 2 R338E/R403E/E410N
R170E/R233E/E240N D104N/K106S/Y155F/R318Y/
D[104]N/K[106]S/Y[155]F/R150Y/ 10000 0 0% 517.0 2 R338E/R403E/E410N
R170E/R233E/E240N D203N/F205T/R318Y/E410N D39N/F41T/R150Y/E240N
1280 220 17% 66.2 2 R333S R165S 720 67 9% 37.2 2 R338L R170L 121 6
5% 6.3 2 K316N K148N 56 2 4% 2.9 2 K316A K148A 63 15 24% 3.2 2
K316E K148E 183 2 1% 9.5 2 K316S K148S 77 15 19% 4.0 2 K316M K148M
9 2 24% 0.5 2 E239S E74S 101 12 12% 5.2 2 E239A E74A 30 14 47% 1.6
3 E239R E74R 65 17 26% 3.3 2 E239K E74K 19 4 22% 1.0 2 H257F H92F
12 1 11% 0.6 2 H257Y H92Y 20 2 12% 1.0 2 H257E H92E 25 12 48% 1.3 3
H257S H92S 23 21 89% 1.2 3 T412A T242A 25 3 14% 1.3 4 T412V T242V
23 4 16% 1.2 4 E410N/T412A E240N/T242A 10 1 7% 0.5 2 E410N/T412V
E240N/T242V 11 3 24% 0.6 2 E410Q E240Q 24 14 60% 1.2 4 E410S E240S
26 16 63% 1.3 7 E410A E240A 42 24 58% 2.2 6 E410D E240D 41 2 5% 2.1
2 N346D N178D 222 176 79% 11.5 5 Y155F/N346D Y[155]F/N178D 223 102
46% 11.5 2 N346Y N178Y 36 2 7% 1.9 4 Y345A Y177A 96 87 90% 5.0 13
Y345T Y177T 16 0 0% 0.8 2 T343R T175R 7 1 10% 0.4 2 T343E T175E 55
8 15% 2.8 2 T343Q T175Q 13 3 25% 0.7 2 F342I F174I 98 10 11% 5.1 2
T343R/Y345T T175R/Y177T 6 0 4% 0.3 2 R318Y/R338E R150Y/R170E 397 50
12% 20.5 2 Y259F/K265T/Y345T Y94F/K98T/Y177T 6 0 2% 0.3 2
K228N/I251S K63N/I86S 73 16 22% 3.8 2 K228N/R318Y/R338E/R403E/
K63N/R150Y/R170E/R233E/E240N 10000 0 0% 517.0 2 E410N
Y155F/K228N/R318Y/R338E/ Y[155]F/K63N/R150Y/R170E/ 10000 0 0% 517.0
2 R403E/E410N R233E/E240N D85N/K228N/R318Y/R338E/
D[85]N/K63N/R150Y/R170E/ 10000 0 0% 517.0 2 R403E/E410N R233E/E240N
I251S/R318Y/R338E/R403E/ I86S/R150Y/R170E/R233E/E240N 10000 0 0%
517.0 2 E410N D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/R150Y/
10000 0 0% 517.0 3 R338E/R403E/E410N R170E/R233E/E240N
Y155F/I251S/R318Y/R338E/ Y[155]F/I86S/R150Y/R170E/R233E/ 10000 0 0%
517.0 2 R403E/E410N E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/E240N 5855 3889 66% 302.7 7
D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/R150Y/ 8985 1436 16%
464.5 2 R338E/E410N R170E/E240N F314N/K316S F145N/K148S 1221 505
41% 63.1 4 K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/R233E/
8076 2967 37% 417.6 9 R403E/E410N E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/R170E/ 10000 0 0% 517.0 3 R338E/R403E/E410N
R233E/E240N A103N/N105S/K247N/N249S/ A[103]N/N[105]S/K82N/N84S/
2497 772 31% 129.1 4 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N D104N/K106S/K247N/N249S/
D[104]N/K[106]S/K82N/N84S/ 10000 0 0% 517.0 2
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/E240N 1514 631 42%
78.3 3 E410N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/R170E/ 3875 846 22% 200.4 2 R338E/E410N
E240N R318Y/R338E/R403E/E410S R150Y/R170E/R233E/E240S 10000 0 0%
517.0 2 R318Y/R338E/E410S R150Y/R170E/E240S 5402 2785 52% 279.3 5
K228N/K247N/N249S K63N/K82N/N84S 85 19 22% 4.4 2
D104N/K106S/Y155F/K228N/ D[104]N/K[106]S/Y[155]F/K63N/ 32 12 37%
1.6 4 K247N/N249S K82N/N84S D104N/K106S/K228N/K247N/
D[104]N/K[106]S/K63N/K82N/ 41 18 45% 2.1 10 N249S N84S
Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 27 6 22% 1.4 2
K228N/K247N/N249S/R318Y K63N/K82N/N84S/R150Y/R170E/ 10000 0 0%
517.0 2 R338E/R403E/E410N R233E/E240N R318Y/R338E/R403E/E410N/
R150Y/R170E/R233E/E240N/ 10000 0 0% 517.0 2 T412V T242V
R318Y/R338E/R403E/E410N/ R150Y/R170E/R233E/E240N/ 10000 0 0% 517.0
2 T412A T242A R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 10000
0 0% 517.0 2 R318Y/R338E/T412A R150Y/R170E/T242A 7661 3243 42%
396.1 9 R318Y/R338E/E410N/T412V R150Y/R170E/E240N/T242V 10000 0 0%
517.0 2 N260S/R318Y/R338E/R403E/ N95S/R150Y/R170E/R233E/E240N 10000
0 0% 517.0 2 E410N D104N/K106S/N260S/R318Y/
D[104]N/K[106]S/N95S/R150Y/ 10000 0 0% 517.0 3 R338E/R403E/E410N
R170E/R233E/E240N Y155F/N260S/R318Y/R338E/
Y[155]F/N95S/R150Y/R170E/ 9696 527 5% 501.3 3 R403E/E410N
R233E/E240N R318Y/R338E/N346D/R403E/ R150Y/R170E/N178D/R233E/ 10000
0 0% 517.0 2 E410N E240N Y155F/R318Y/R338E/N346D/
Y[155]F/R150Y/R170E/N178D/ 10000 0 0% 517.0 2 R403E/E410N
R233E/E240N K247N/N249S/N260S K82N/N84S/N95S 157 38 24% 8.1 3
Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 152 39 26% 7.9 3
D[104]N/K[106]S/K247N/N249S D[104]N/K[106]S/K82N/N84S/ 1262 40 3%
65.3 2 N260S N95S D[104]N/K[106]S/Y[155]F/K247N/
D[104]N/K[106]S/Y[155]F/K82N/ 692 84 12% 35.8 2 N249S/N260S
N84S/N95S K247N/N249S/N260S/R318Y/ K82N/N84S/N95S/R150Y/R170E/ 5560
3872 70% 287.5 3 R338E/R403E/E410N R233E/E240N Y155F/N260S/N346D
Y[155]F/N95S/N178D 1382 477 35% 71.4 2 R318Y/R338E/T343R/R403E/
R150Y/R170E/T175R/R233E/ 10000 0 0% 517.0 2
E410N E240N R338E/T343R R170E/T175R 16 6 38% 0.8 2 A K.sub.0.5
value of 999 nM indicates the lower limit value for those variants
with less than 10% inhibition under the conditions of the standard
assay (35 nM-0 nM AT-III). Variants with >50% of WT
k.sub.cat/K.sub.M (see Example 4, Table 14) and initially given a
K.sub.0.5 value of 999 nM were retested at higher AT-III
concentrations, expanding in the sensitivity of the assay. A
K.sub.0.5 value of 9999 nM indicates the lower limit value for
those variants with less than 10% inhibition under the conditions
of the expanded sensitivity assay (1000 nM-0 nM AT-III and 5000-0
nM AT-III).
TABLE-US-00023 TABLE 22 Inhibition of FIXa variants by AT-III/UFH
Mutation Mutation K.sub.0.5 .+-.S.D. K.sub.0.5-mut/ (Mature FIX
Numbering) (Chymotrypsin Numbering) (nM) (nM) % CV K.sub.0.5-wt n
BeneFIX Benefix .RTM. Coagulation BeneFIX Benefix .RTM. 17 8 47%
0.9 55 FIX (T148A) Coagulation FIX (T[148]A) Plasma Purified FIXa
Plasma Purified FIXa 30 4 14% 1.6 5 Catalyst Biosciences WT
Catalyst Biosciences WT 19 7 34% 1.0 15 N157D N[157]D 17 4 23% 0.9
2 Y155F Y[155]F 13 0 1% 0.7 2 A103N/N105S/Y155F
A[103]N/N[105]S/Y[155]F 11 6 49% 0.6 2 D104N/K106S/Y155F
D[104]N/K[106]S/Y[155]F 6 2 33% 0.3 2 A103N/N105S A[103]N/N[105]S
20 3 14% 1.0 2 D104N/K106S D[104]N/K[106]S 20 2 9% 1.0 2
K106N/V108S K[106]N/V[108]S 24 0 1% 1.2 2 D85N D[85]N 17 3 15% 0.9
4 T148A T[148]A 17 10 56% 0.9 13 K5A K[5]A 22 3 15% 1.2 2 D64N
D[64]N 18 0 1% 0.9 2 D64A D[64]A 16 2 12% 0.8 2 N167D N[167]D 12 2
14% 0.6 2 N167Q N[167]Q 12 1 8% 0.6 2 S61A S[61]A 19 3 18% 1.0 2
S53A S[53]A 27 4 16% 1.4 2 T159A T[159]A 33 7 23% 1.7 2 T169A
T[169]A 17 6 36% 0.9 2 T172A T[172]A 16 3 21% 0.8 2 T179A T[179]A
24 2 7% 1.2 2 Y155H Y[155]H 25 4 15% 1.3 2 Y155Q Y[155]Q 23 0 1%
1.2 2 S158A S[158]A 20 1 5% 1.0 2 S158D S[158]D 15 2 16% 0.8 2
S158E S[158]E 14 1 10% 0.7 2 N157Q N[157]Q 16 2 11% 0.8 2
D203N/F205T D39N/F41T 271 51 19% 14.0 5 D85N/D203N/F205T
D[85]N/D39N/F41T 587 65 11% 30.3 2 K228N K63N 29 13 46% 1.5 6
D85N/K228N D[85]N/K63N 34 3 7% 1.7 2 A103N/N105S/K228N
A[103]N/N[105]S/K63N 46 17 36% 2.4 2 D104N/K106S/K228N
D[104]N/K[106]S/K63N 41 21 52% 2.1 2 Y155F/K228N Y[155]F/K63N 15
n.d. n.d. 0.8 1 D104N/K106S/Y155F/K228N
D[104]N/K[106]S/Y[155]F/K63N 49 5 9% 2.5 2 I251S I86S 28 8 28% 1.4
4 D85N/I251S D[85]N/I86S 19 6 30% 1.0 2 D85N/D104N/K106S/I251S
D[85]N/D[104]N/K[106]S/I86S 28 11 41% 1.4 2 A103N/N105S/I251S
A[103]N/N[105]S/I86S 42 14 33% 2.2 3 D104N/K106S/I251S
D[104]N/K[106]S/I86S 32 5 16% 1.6 2 Y155F/I251S Y[155]F/I86S 18 3
19% 0.9 2 A262S A95bS 25 5 21% 1.3 2 K413N K243N 27 13 48% 1.4 2
E410N E240N 8 2 25% 0.4 6 E239N E74N 132 21 16% 6.8 2 T241N/H243S
T76N/H78S 21 12 56% 1.1 2 K247N/N249S K82N/N84S 22 4 18% 1.1 4
Y155F/K247N/N249S Y[155]F/K82N/N84S 13 3 24% 0.7 4
A103N/N105S/K247N/N249S A[103]N/N[105]S/K82N/N84S 53 29 55% 2.7 4
D104N/K106S/K247N/N249S D[104]N/K[106]S/K82N/N84S 19 2 9% 1.0 2
D104N/K106S/Y155F/K247N/N249S D[104]N/K[106]S/Y[155]F/K82N/ 27 2 9%
1.4 2 N84S L321N L153N 25 6 25% 1.3 2 F314N/H315S F145N/H147S 104
27 26% 5.4 4 S319N/L321S S151N/L153S 65 11 17% 3.4 2 N260S N95S 312
283 91% 16.1 13 D104N/K106S/N260S D[104]N/K[106]S/N95S 228 82 36%
11.8 2 Y155F/N260S Y[155]F/N95S 77 16 21% 4.0 2
D104N/K106S/Y155F/N260S D[104]N/K[106]S/Y[155]F/N95S 292 37 13%
15.1 2 Y284N Y117N 41 25 63% 2.1 5 R318N/A320S R150N/A152S 999 0 0%
51.7 2 R318A R150A 4145 1297 31% 214.3 2 R318E R150E 9999 0 0%
517.0 2 R318Y R150Y 1976 430 22% 102.2 2 R312Q R143Q 33 9 26% 1.7 2
R312A R143A 31 0 1% 1.6 2 R312Y R143Y 2499 350 14% 129.2 2 R312L
R143L 17 1 5% 0.9 2 V202M V38M 14 2 14% 0.7 2 V202Y V38Y 18 3 14%
0.9 2 D203M D39M 11 0 1% 0.6 2 D203Y D39Y 16 3 21% 0.8 2 A204M A40M
29 3 9% 1.5 2 A204Y A40Y 24 1 3% 1.2 2 K400A/R403A K230A/R233A 999
0 0% 51.7 2 K400E/R403E K230E/R233E 999 0 0% 51.7 2 R403A R233A 190
34 18% 9.8 4 R403E R233E 731 14 2% 37.8 2 K400A K230A 114 3 3% 5.9
2 K400E K230E 301 27 9% 15.6 2 K293E K126E 187 25 13% 9.7 2 K293A
K126A 82 1 1% 4.2 2 R333A R165A 235 54 23% 12.1 2 R333E R165E 999 0
0% 51.7 2 R338A R170A 33 3 10% 1.7 2 R338E R170E 222 124 56% 11.5 8
R338A/R403A R170A/R233A 328 106 32% 17.0 6 R338E/R403E R170E/R233E
6000 1089 18% 310.2 2 K293A/R403A K126A/R233A 999 0 0% 51.7 2
K293E/R403E K126E/R233E 999 0 0% 51.7 2 K293A/R338A/R403A
K126A/R170A/R233A 999 0 0% 51.7 2 K293E/R338E/R403E
K126E/R170E/R233E 999 0 0% 51.7 2 R318A/R403A R150A/R233A 999 0 0%
51.7 2 R318E/R403E R150E/R233E 999 0 0% 51.7 2 R318Y/E410N
R150Y/E240N 607 164 27% 31.4 4 R338E/E410N R170E/E240N 92 14 15%
4.7 4 R338E/R403E/E410N R170E/R233E/E240N 2351 168 7% 121.5 2
R318Y/R338E/R403E R150Y/R170E/R233E 10000 0 0% 517.0 7
D203N/F205T/K228N D39N/F41T/K63N 822 69 8% 42.5 2 D203N/F205T/E410N
D39N/F41T/E240N 377 20 5% 19.5 2 D203N/F205T/R338E D39N/F41T/R170E
1170 180 15% 60.5 2 D203N/F205T/R338A D39N/F41T/R170A 423 61 14%
21.9 2 D203N/F205T/R318Y D39N/F41T/R150Y 7226 133 2% 373.6 2
D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E 1520 162 11% 78.6 2
K228N/E410N K63N/E240N 36 7 20% 1.9 2 K228N/R338E K63N/R170E 108 8
7% 5.6 2 K228N/R338A K63N/R170A 51 7 14% 2.7 2 K228N/R318Y
K63N/R150Y 3414 73 2% 176.5 2 K228N/R338E/R403E K63N/R170E/R233E
1679 239 14% 86.8 2 R403E/E410N R233E/E240N 279 26 9% 14.4 2
R318Y/R338E/E410N R150Y/R170E/E240N 3458 1033 30% 178.8 5
D104N/K106S/R318Y/R338E/E410N D[104]N/K[106]S/R150Y/R170E/ 6328
4241 67% 327.2 4 E240N Y155F/R318Y/R338E/E410N
Y[155]F/R150Y/R170E/E240N 1098 1095 100% 56.8 7 K228N/R318Y/E410N
K63N/R150Y/E240N 475 83 17% 24.6 2 R318Y/R403E/E410N
R150Y/R233E/E240N 7072 1387 20% 365.6 2 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 5881 4757 81% 304.1 4
A103N/N105S/R318Y/R338E/R403E/ A[103]N/N[105]S/R150Y/R170E/ 9193
1037 11% 475.3 4 E410N R233E/E240N D104N/K106S/R318Y/R338E/R403E/
D[104]N/K[106]S/R150Y/R170E/ 10000 0 0% 517.0 2 E410N R233E/E240N
Y155F/R318Y/R338E/R403E/E410N Y[155]F/R150Y/R170E/R233E/ 10000 0 0%
517.0 2 E240N A103N/N105S/Y155F/R318Y/R338E/
A[103]N/N[105]S/Y[155]F/R150Y/ 10000 0 0% 517.0 2 R403E/E410N
R170E/R233E/E240N D104N/K106S/Y155F/R318Y/R338E/
D[104]N/K[106]S/Y[155]F/R150Y/ 10000 0 0% 517.0 2 R403E/E410N
R170E/R233E/E240N D203N/F205T/R318Y/E410N D39N/F41T/R150Y/E240N
1280 220 17% 66.2 2 R333S R165S 720 67 9% 37.2 2 R338L R170L 121 6
5% 6.3 2 K316N K148N 56 2 4% 2.9 2 K316A K148A 63 15 24% 3.2 2
K316E K148E 183 2 1% 9.5 2 K316S K148S 77 15 19% 4.0 2 K316M K148M
9 2 24% 0.5 2 E239S E74S 101 12 12% 5.2 2 E239A E74A 30 14 47% 1.6
3 E239R E74R 65 17 26% 3.3 2 E239K E74K 19 4 22% 1.0 2 H257F H92F
12 1 11% 0.6 2 H257Y H92Y 20 2 12% 1.0 2 H257E H92E 25 12 48% 1.3 3
H257S H92S 23 21 89% 1.2 3 T412A T242A 25 3 14% 1.3 4 T412V T242V
23 4 16% 1.2 4 E410N/T412A E240N/T242A 10 1 7% 0.5 2 E410N/T412V
E240N/T242V 11 3 24% 0.6 2 E410Q E240Q 24 14 60% 1.2 4 E410S E240S
26 16 63% 1.3 7 E410A E240A 42 24 58% 2.2 6 E410D E240D 41 2 5% 2.1
2 N346D N178D 222 176 79% 11.5 5 Y155F/N346D Y[155]F/N178D 223 102
46% 11.5 2 N346Y N178Y 36 2 7% 1.9 4 Y345A Y177A 96 87 90% 5.0 13
Y345T Y177T 16 0 0% 0.8 2 T343R T175R 7 1 10% 0.4 2 T343E T175E 55
8 15% 2.8 2 T343Q T175Q 13 3 25% 0.7 2 F342I F174I 98 10 11% 5.1 2
T343R/Y345T T175R/Y177T 6 0 4% 0.3 2 R318Y/R338E R150Y/R170E 397 50
12% 20.5 2 Y259F/K265T/Y345T Y94F/K98T/Y177T 6 0 2% 0.3 2
K228N/I251S K63N/I86S 73 16 22% 3.8 2 K228N/R318Y/R338E/R403E/E410N
K63N/R150Y/R170E/R233E/ 10000 0 0% 517.0 2 E240N
Y155F/K228N/R318Y/R338E/R403E/ Y[155]F/K63N/R150Y/R170E/ 10000 0 0%
517.0 2 E410N R233E/E240N D85N/K228N/R318Y/R338E/R403E/
D[85]N/K63N/R150Y/R170E/ 10000 0 0% 517.0 2 E410N R233E/E240N
I251S/R318Y/R338E/R403E/E410N I86S/R150Y/R170E/R233E/E240N 10000 0
0% 517.0 2 D104N/K106S/I251S/R318Y/R338E/
D[104]N/K[106]S/I86S/R150Y/ 10000 0 0% 517.0 3 R403E/E410N
R170E/R233E/E240N Y155F/I251S/R318Y/R338E/R403E/
D[104]N/K[106]S/I86S/R150Y/ 10000 0 0% 517.0 2 E410N
R170E/R233E/E240N I251S/R318Y/R338E/E410N I86S/R150Y/R170E/E240N
5855 3889 66% 302.7 7 D104N/K106S/I251S/R318Y/R338E/
D[104]N/K[106]S/I86S/R150Y/ 8985 1436 16% 464.5 2 E410N R170E/E240N
F314N/K316S F145N/K148S 1221 505 41% 63.1 4
K247N/N249S/R318Y/R338E/R403E/ K82N/N84S/R150Y/R170E/R233E/ 8076
2967 37% 417.6 9 E410N E240N Y155F/K247N/N249S/R318Y/R338E/
Y[155]F/K82N/N84S/R150Y/ 10000 0 0% 517.0 3 R403E/E410N
R170E/R233E/E240N A103N/N105S/K247N/N249S/R318Y/
A[103]N/N[105]S/K82N/N84S/ 2497 772 31% 129.1 4 R338E/R403E/E410N
R150Y/R170E/R233E/E240N D104N/K106S/K247N/N249S/R318Y/
D[104]N/K[106]S/K82N/N84S/ 10000 0 0% 517.0 2 R338E/R403E/E410N
R150Y/R170E/R233E/E240N K247N/N249S/R318Y/R338E/E410N
K82N/N84S/R150Y/R170E/E240N 1514 631 42% 78.3 3
Y155F/K247N/N249S/R318Y/R338E/ Y[155]F/K82N/N84S/R150Y/ 3875 846
22% 200.4 2 E410N R170E/E240N R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 10000 0 0% 517.0 2 R318Y/R338E/E410S
R150Y/R170E/E240S 5402 2785 52% 279.3 5 K228N/K247N/N249S
K63N/K82N/N84S 85 19 22% 4.4 2 D104N/K106S/Y155F/K228N/K247N/
D[104]N/K[106]S/Y[155]F/K63N/ 32 12 37% 1.6 4 N249S K82N/N84S
D104N/K106S/K228N/K247N/ D[104]N/K[106]S/K63N/K82N/ 41 18 45% 2.1
10 N249S N84S Y155F/K228N/K247N/N249S Y[155]F/K63N/K82N/N84S 27 6
22% 1.4 2 K228N/K247N/N249S/R318Y/R338E/
K63N/K82N/N84S/R150Y/R170E/ 10000 0 0% 517.0 2 R403E/E410N
R233E/E240N R318Y/R338E/R403E/E410N/T412V R150Y/R170E/R233E/E240N/
10000 0 0% 517.0 2 T242V R318Y/R338E/R403E/E410N/T412A
R150Y/R170E/R233E/E240N/ 10000 0 0% 517.0 2 T242A
R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 10000 0 0% 517.0 2
R318Y/R338E/T412A R150Y/R170E/T242A 7661 3243 42% 396.1 9
R318Y/R338E/E410N/T412V R150Y/R170E/E240N/T242V 4871 4173 86% 251.8
9 N260S/R318Y/R338E/R403E/E410N N95S/R150Y/R170E/R233E/ 10000 0 0%
517.0 2 E240N D104N/K106S/N260S/R318Y/R338E/
D[104]N/K[106]S/N95S/R150Y/ 10000 0 0% 517.0 3 R403E/E410N
R170E/R233E/E240N Y155F/N260S/R318Y/R338E/R403E/
Y[155]F/N95S/R150Y/R170E/ 9696 527 5% 501.3 3 E410N R233E/E240N
R318Y/R338E/N346D/R403E/E410N R150Y/R170E/N178D/R233E/ 10000 0 0%
517.0 2 E240N Y155F/R318Y/R338E/N346D/R403E/
Y[155]F/R150Y/R170E/N178D/ 10000 0 0% 517.0 2 E410N R233E/E240N
K247N/N249S/N260S K82N/N84S/N95S 157 38 24% 8.1 3
Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 152 39 26% 7.9 3
D104N/K106S/K247N/N249S/N260S D[104]N/K[106]S/K82N/N84S/ 1262 40 3%
65.3 2 N95S D104N/K106S/Y155F/K247N/N249S/
D[104]N/K[106]S/Y[155]F/K82N/ 692 84 12% 35.8 2 N260S N84S/N95S
K247N/N249S/N260S/R318Y/R338E/ K82N/N84S/N95S/R150Y/R170E/ 5560
3872 70% 287.5 3 R403E/E410N R233E/E240N Y155F/N260S/N346D
Y[155]F/N95S/N178D 1382 477 35% 71.4 2
R318Y/R338E/T343R/R403E/E410N R150Y/R170E/T175R/R233E/ 10000 0 0%
517.0 4 E240N R338E/T343R R170E/T175R 12 6 46% 0.6 4 T343R/N346Y
T175R/N178Y 3 1 32% 0.1 4 R318Y/R338E/N346Y/R403E/E410N
R150Y/R170E/N178Y/R233E/ 10000 0 0% 517.0 2 E240N
R318Y/R338E/T343R/N346Y/R403E/ R150Y/R170E/T175R/N178Y/ 10000 0 0%
517.0 2 E410N R233E/E240N T343R/N346D T175R/N178D 22 4 18% 1.1 2
R318Y/R338E/T343R/N346D/R403E/ R150Y/R170E/T175R/N178D/ 10000 0 0%
517.0 2 E410N R233E/E240N R318Y/R338E/Y345A/R403E/E410N
R150Y/R170E/Y177A/R233E/ 10000 0 0% 517.0 2 E240N
R318Y/R338E/Y345A/N346D/R403E/ R150Y/R170E/Y177A/N178D/ 10000 0 0%
517.0 2 E410N R233E/E240N A K.sub.0.5 value of 999 nM indicates the
lower limit value for those variants with less than 10% inhibition
under the conditions of the standard assay (35 nM-0 nM AT-III).
Variants with >50% of WT k.sub.cat/K.sub.M (see Example 4, Table
14) and initially given a K.sub.0.5 value of 999 nM were retested
at higher AT-III concentrations, expanding in the sensitivity of
the assay. A K.sub.0.5 value of 10000 nM indicates the lower limit
value for those variants with less than 10% inhibition under the
conditions of the expanded sensitivity assay (1000 nM-0 nM AT-III
and 5000-0 nM AT-III).
C. Determination of the Second-Order Rate Constant (k.sub.app) for
Inhibition of FIXa by the Antithrombin/UFH Complex
[0616] Additional experiments were performed to measure the
second-order rate constant for inhibition (k.sub.app) of FIXa
variants by AT-III/UFH using the same assay as described above in
Example 5B with minor modifications. This method is more amenable
to evaluating the second-order rate constants for multiple variants
concurrently than the traditional competitive kinetic or
discontinuous methods (see e.g., Olson et al. (2004) Thromb Haemost
92(5), 929-939).
[0617] For inhibition reactions in the presence of UFH, a 1000 nM
solution of AT-III/UFH were prepared by dilution of a 20 .mu.M
stock of plasma purified human AT-III (Molecular Innovations) into
a solution of excess UFH (2 .mu.M) in a 1.0 mL volume of 1.times.
Buffer A (50 mM Tris, 100 mM NaCl, 10 mM CaCl.sub.2, 0.01%
Tween-20, pH 7.4). AT-III/UFH solutions were incubated for 30
minutes at room temperature prior to being serially diluted
2.0-fold in a 96 deep-well polypropylene plate with a final volume
of 500 .mu.L 1.times. Buffer A containing 2 .mu.M UFH. The final
dilutions of AT-III for the modified k.sub.app assay ranged from
500 nM-0 nM (i.e. rows A-H). A total of 35 .mu.L of each AT-III
dilution was aliquoted into their respective rows of a 96-well
V-bottom storage plate to fill all columns (i.e. 1-12). FIXa
variants were initially diluted to 100 nM in 1.times. Buffer A.
Subsequently, 50 .mu.L of each 100 nM FIXa variant was diluted to a
concentration of 2.0 nM in 2.5 mL of 1.times. Buffer A and then 70
.mu.L of this solution was aliquoted into a 96-well V-bottom
storage plate according to the same predefined plate map as above
(4 FIXa variants per plate).
[0618] Assay reactions were initiated using a BioMek FX liquid
handling system programmed to dispense 35 .mu.L of the FIXa
solutions into the plates containing 35 .mu.L of each dilution of
AT-III/UFH per well for a total of two duplicate assay plates for
each FIXa variant. The final inhibition assay conditions were: 1.0
nM FIXa and AT-III dilutions ranging from 500 nM to 0 nM in 1 .mu.M
UFH so that the heparin remained in excess Inhibition reactions
were further incubated for various times at room temperature
(.about.25.degree. C.) depending on the expected inhibition rate
constant and adjusted so that >90% inhibition could be reached
at the highest concentration of AT-III in the assay (500 nM).
Typical incubation times were determined specifically for each
variant, or class of variants, but generally followed the
incubation times outlined in Table 23.
TABLE-US-00024 TABLE 23 Assay Incubation Times Based on Expected
k.sub.app Values Expected k.sub.app (M.sup.-1s.sup.-1) FIXa/ATIII
Incubation (sec) 1.0E-07 10 1.0E-06 30 1.0E-05 120 1.0E-04 600
1.0E-03 3600 1.0E-02 7200
[0619] Following the desired incubation time a 40 .mu.L aliquot of
the reaction was transferred by the BioMek FX to a 96-well black
half-area plate containing 20 .mu.L of 2.5 mM
Mesyl-D-CHG-Gly-Arg-AMC per well in assay Buffer C (50 mM Tris, 100
mM NaCl, 10 mM CaCl.sub.2, 0.01% Tween-20, pH 7.4, 82% ethylene
glycol and 5 mg/mL polybrene). Polybrene (hexadimethrine bromide)
at a final concentration of 5 mg/mL was added to Buffer C to quench
the AT-III/UFH reaction. Residual activity of FIXa was assessed by
following the initial rates of substrate cleavage for 60 minutes in
a fluorescence reader set to 25.degree. C. The final assay
conditions for determination of residual activity were 0.67 nM FIXa
variant, 0.83 mM Mesyl-D-CHG-Gly-Arg-AMC, 30% ethylene glycol and 5
mg/mL polybrene in 50 mM Tris, 100 mM NaCl, 10 mM CaCl.sub.2, 0.01%
Tween-20, pH 7.4. Data analyses to calculate the K.sub.0.5 value
were performed in a similar manner as that described above for
AT-III/UFH inhibition assays in Example B using the ActivityBase
software package and the XE Runner data analysis module (IDBS
Software). Using the assay set-up outlined in Example 5B under
psuedo-1st-order conditions and testing various incubation times it
is thus possible to calculate the apparent second-order rate
constant for inhibition by AT-III (k.sub.app) using the following
equations:
k app = k obs ( [ AT - III ] S . I . ) Equation ( 1 ) k obs = ln (
2 ) t 1 / 2 Equation ( 2 ) ##EQU00006##
[0620] Given that the fit value for K.sub.0.5=[AT-III] at t.sub.1/2
(defined by the time of the assay) all the necessary values are
available to calculate k.sub.obs and thus the k.sub.app for
inhibition of a given FIXa variant by AT-HI. The calculated
k.sub.app value does not take into account any potential effects of
changes in the stoichiometry of inhibition (S.I.), which is given a
constant value of 1.2 in the present calculations as this value
reflects what is typically reported in the literature (see e.g.,
Olson et al. (2004) Thromb Haemost 92(5), 929-939).
[0621] Table 24 provides the results of the second-order rate
assays that were performed using AT-III/UFH. The results are
presented both as the fitted k.sub.app parameter and as a
representation of the extent of AT-III resistance for each variant
compared to the wild-type FIXa expressed as a ratio of their fitted
k.sub.app values (k.sub.app wild-type/k.sub.app variant). Several
FIXa variants exhibited greater than 10,000-20,000 fold increased
resistance to AT-III compared to wild-type FIXa. For example,
FIXa-R318A, FIXa-R318Y, FIXa-R338A/R403A, FIXa-R318Y/R338E/R403E,
FIXa-R318Y/R338E/R403E, FIXa-K247N/N249S/R318Y/R338E/R403E,
FIXa-R318Y/R338E/R403E, FIXa-K228N/1251S/R318Y/R338E/R403E/E410N,
FIXa-R318Y/R338E/E410N and FIXa-R318Y/R338E/R403E/E410N are among
this group, which exhibited significant resistance to AT-III.
TABLE-US-00025 TABLE 24 Second-Order Rate Constant for Inhibition
by AT-III/UFH Mutation Mutation (Chymotrypsin k.sub.app .+-.S.D.
k.sub.app-wt/ (Mature FIX Numbering) Numbering) (M.sup.-1s.sup.-1)
(M.sup.-1s.sup.-1) % CV k.sub.app-mut n BeneFIX Benefix .RTM.
BeneFIX Benefix .RTM. 1.6E+07 1.7E+07 105% 1 8 Coagulation FIX
(T148A) Coagulation FIX (T[148]A) Catalyst Biosciences WT Catalyst
Biosciences WT 2.4E+07 8.0E+06 33% 1 4 T148A T[148]A 1.6E+07
1.1E+07 69% 1 4 D203N/F205T D39N/F41T 8.1E+05 5.3E+05 66% 30 3
D85N/D203N/F205T D[85]N/D39N/F41T 2.7E+06 4.5E+05 17% 9 2 N260S
N95S 1.1E+06 2.1E+04 2% 21 2 D104N/K106S/N260S D[104]N/K[106]S/N95S
7.0E+06 1.9E+06 27% 3 3 R318A R150A 6.9E+05 5.6E+04 8% 35 2 R318E
R150E 1.6E+04 1.2E+03 7% 1,452 2 R318Y R150Y 6.4E+05 3.5E+05 55% 37
5 R312Y R143Y 2.3E+05 4.5E+04 19% 102 3 R403A R233A 1.4E+06 3.1E+05
23% 18 2 R403E R233E 1.1E+05 2.4E+04 21% 209 2 K400E K230E 4.1E+05
3.3E+04 8% 58 2 K293E K126E 1.2E+06 8.4E+04 7% 20 2 R338E R170E
2.7E+05 1.7E+05 64% 88 3 R338A/R403A R170A/R233A 8.4E+05 4.6E+04 5%
28 2 R338E/R403E R170E/R233E 6.8E+04 1.9E+04 28% 353 2 K293A/R403A
K126A/R233A 8.1E+04 1.5E+04 18% 294 2 K293A/R338A/R403A
K126A/R170A/R233A 4.7E+04 7.9E+03 17% 511 2 K293E/R338E/R403E
K126E/R170E/R233E 3.1E+04 6.3E+03 20% 768 2 R318A/R403A R150A/R233A
1.7E+04 4.7E+03 27% 1,390 2 R318Y/E410N R150Y/E240N 1.1E+06 7.9E+03
1% 22 2 R338E/E410N R170E/E240N 6.3E+06 7.4E+06 117% 4 10
R338E/R403E/E410N R170E/R233E/E240N 1.3E+05 1.5E+05 115% 180 14
Y155F/R338E/R403E/E410N Y[155]F/R170E/R233E/E240N 3.2E+04 1.7E+03
5% 755 2 R318Y/R338E/R403E R150Y/R170E/R233E 1.2E+03 9.9E+02 80%
19,396 7 Y155F/R318Y/R338E/R403E Y[155]F/R150Y/R170E/R233E 1.0E+03
5.4E+01 5% 23,242 2 D203N/F205T/K228N D39N/F41T/K63N 1.1E+06
3.7E+05 33% 21 2 D203N/F205T/E410N D39N/F41T/E240N 2.0E+06 2.1E+05
10% 12 2 D203N/F205T/R338E D39N/F41T/R170E 3.6E+05 2.8E+04 8% 66 2
D203N/F205T/R338A D39N/F41T/R170A 8.6E+05 1.6E+05 18% 28 2
D203N/F205T/R318Y D39N/F41T/R150Y 6.1E+04 2.0E+04 33% 391 2
D203N/F205T/R338E/R403E D39N/F41T/R170E/R233E 2.0E+03 n.d. n.d.
12,250 1 K228N/R318Y K63N/R150Y 1.2E+06 2.1E+05 17% 19 2
K228N/R338E/R403E K63N/R170E/R233E 4.2E+04 1.3E+04 31% 567 2
R403E/E410N R233E/E240N 4.8E+06 2.5E+06 53% 5 5 R318Y/R338E/E410N
R150Y/R170E/E240N 2.8E+05 2.4E+05 85% 84 8 D104N/K106S/R318Y/R338E/
D[104]N/K[106]S/R150Y/R170E/ 2.1E+05 4.2E+04 20% 113 2 E410N E240N
Y155F/R318Y/R338E/E410N Y[155]F/R150Y/R170E/E240N 4.5E+05 6.9E+04
15% 53 2 K228N/R318Y/E410N K63N/R150Y/E240N 1.9E+06 n.d. n.d. 12 1
R318Y/R403E/E410N R150Y/R233E/E240N 2.8E+04 1.8E+04 63% 856 6
Y155F/R318Y/R403E/E410N Y[155]F/R150Y/R233E/E240N 8.1E+03 1.4E+02
2% 2,963 2 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N 3.2E+03
2.0E+03 63% 7,385 6 A103N/N105S/R318Y/R338E/
A[103]N/N[105]S/R150Y/R170E/ 2.6E+03 1.7E+02 7% 9,060 2 R403E/E410N
R233E/E240N D104N/K106S/R318Y/R338E/ D[104]N/K[106]S/R150Y/R170E/
3.9E+03 1.6E+01 0% 6,154 2 R403E/E410N R233E/E240N
Y155F/R318Y/R338E/R403E/ Y[155]F/R150Y/R170E/R233E/ 3.2E+03 8.1E+02
25% 7,464 3 E410N E240N A103N/N105S/Y155F/R318Y/
A[103]N/N[105]S/Y[155]F/ 3.2E+03 6.7E+00 0% 7,531 2
R338E/R403E/E410N R150Y/R170E/R233E/E240N D104N/K106S/Y155F/R318Y/
D[104]N/K[106]S/Y[155]F/ 2.9E+03 1.8E+02 6% 8,147 2
R338E/R403E/E410N R150Y/R170E/R233E/E240N D203N/F205T/R318Y/E410N
D39N/F41T/R150Y/E240N 5.3E+04 5.8E+03 11% 454 3 N346D N178D 3.4E+06
1.6E+06 48% 7 4 Y155F/N346D Y[155]F/N178D 4.0E+06 5.4E+05 13% 6 2
N346Y N178Y 8.4E+05 n.d. n.d. 28 1 Y345T Y177T 1.8E+06 7.8E+03 0%
13 2 T343R T175R 4.2E+06 1.0E+04 0% 6 2 T343Q T175Q 2.1E+06 5.4E+05
25% 11 2 T343R/Y345T T175R/Y177T 5.0E+06 1.8E+05 4% 5 2 R318Y/R338E
R150Y/R170E 6.2E+05 5.4E+04 9% 39 2 K228N/R318Y/R338E/R403E/
K63N/R150Y/R170E/R233E/ 2.9E+03 2.2E+02 7% 8,212 2 E410N E240N
Y155F/K228N/R318Y/R338E/ Y[155]F/K63N/R150Y/R170E/ 4.6E+03 6.1E+02
13% 5,161 2 R403E/E410N R233E/E240N D85N/K228N/R318Y/R338E/
D[85]N/K63N/R150Y/R170E/ 3.0E+03 3.2E+02 11% 7,932 2 R403E/E410N
R233E/E240N I251S/R318Y/R338E/R403E/ I86S/R150Y/R170E/R233E/
3.0E+03 3.5E+02 12% 7,940 2 E410N E240N D104N/K106S/I251S/R318Y/
D[104]N/K[106]S/I86S/R150Y/ 5.7E+03 8.4E+02 15% 4,225 2
R338E/R403E/E410N R170E/R233E/E240N Y155F/I251S/R318Y/R338E/
D[104]N/K[106]S/I86S/R150Y/ 3.3E+03 1.4E+02 4% 7,306 2 R403E/E410N
R170E/R233E/E240N I251S/R318Y/R338E/E410N I86S/R150Y/R170E/E240N
2.4E+05 2.1E+05 89% 100 6 D104N/K106S/I251S/R318Y/
D[104]N/K[106]S/I86S/R150Y/ 3.2E+03 4.5E+02 14% 7,567 2 R338E/E410N
R170E/E240N K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 2.0E+03
1.0E+03 53% 12,122 2 R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 1.6E+03 5.9E+02
37% 15,058 4 R338E/R403E/E410N R170E/R233E/E240N
A103N/N105S/K247N/N249S/ A[103]N/N[105]S/K82N/N84S/ 1.7E+03 2.4E+02
14% 14,063 3 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/ E240N
D104N/K106S/K247N/N249S/ D[104]N/K[106]S/K82N/N84S/ 3.1E+03 7.6E+02
24% 7,646 3 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/ E240N
D104N/K106S/Y155F/K247N/ D[104]N/K[106]S/Y[155]F/ 1.0E+03 2.8E+02
28% 23,776 6 N249S/R318Y/R338E/R403E/ K82N/N84S/R150Y/R170E/ E410N
R233E/E240N K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 8.6E+05
1.2E+05 14% 28 2 E410N E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 1.8E+05 2.2E+04 13% 136 2 R338E/E410N
R170E/E240N R318Y/R338E/R403E/E410S R150Y/R170E/R233E/E240S 1.6E+03
1.1E+03 64% 14,483 7 R318Y/R338E/E410S R150Y/R170E/E240S 7.2E+05
4.8E+05 66% 33 2 K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/
1.1E+03 4.5E+02 41% 21,766 12 R338E/R403E/E410N R170E/R233E/E240N
D104N/K106S/K228N/K247N/ D[104]N/K[106]S/K63N/K82N/ 6.8E+02 3.3E+02
48% 35,018 4 N249S/R318Y/R338E/R403E/ N84S/R150Y/R170E/R233E/ E410N
E240N Y155F/K228N/K247N/N249S/ Y[155]F/K63N/K82N/N84S/ 1.1E+03
3.9E+01 4% 21,856 4 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
R318Y/R338E/R403E/E410N/ R150Y/R170E/R233E/E240N/ 2.9E+03 5.4E+02
19% 8,296 5 T412V T242V R318Y/R338E/R403E/E410N/
R150Y/R170E/R233E/E240N/ 3.8E+03 1.2E+03 31% 6,322 5 T412A T242A
R318Y/R338E/R403E/T412A R150Y/R170E/R233E/T242A 1.6E+03 3.8E+02 23%
14,529 2 R318Y/R338E/T412A R150Y/R170E/T242A 3.5E+05 7.2E+04 21% 69
3 R318Y/R338E/E410N/T412V R150Y/R170E/E240N/T242V 3.9E+05 2.6E+04
7% 61 2 N260S/R318Y/R338E/R403E/ N95S/R150Y/R170E/R233E/ 4.4E+03
8.5E+02 19% 5,407 2 E410N E240N D104N/K106S/N260S/R318Y/
D[104]N/K[106]S/N95S/R150Y/ 2.1E+03 3.9E+02 18% 11,173 2
R338E/R403E/E410N R170E/R233E/E240N Y155F/N260S/R318Y/R338E/
Y[155]F/N95S/R150Y/R170E/ 2.1E+03 2.4E+02 11% 11,456 2 R403E/E410N
R233E/E240N R318Y/R338E/N346D/R403E/ R150Y/R170E/N178D/R233E/
1.1E+03 5.5E+02 49% 21,504 6 E410N E240N Y155F/R318Y/R338E/N346D/
Y[155]F/R150Y/R170E/N178D/ 1.6E+03 6.6E+02 41% 14,831 3 R403E/E410N
R233E/E240N D104N/K106S/K247N/N249S/ D[104]N/K[106]S/K82N/N84S/
1.7E+06 8.7E+04 5% 14 2 N260S N95S D104N/K106S/Y155F/K247N/
D[104]N/K[106]S/Y[155]F/ 3.2E+06 2.1E+05 6% 7 2 N249S/N260S
K82N/N84S/N95S K247N/N249S/N260S/R318Y/ K82N/N84S/N95S/R150Y/
1.3E+03 3.8E+02 30% 18,567 2 R338E/R403E/E410N R170E/R233E/E240N
Y155F/K247N/N249S/N260S/ Y[155]F/K82N/N84S/N95S/ 4.3E+02 3.8E+00 1%
55,342 4 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/ 3.2E+04 2.2E+04
69% 749 6 E410N E240N Y155F/R318Y/R338E/T343R/
Y[155]F/R150Y/R170E/T175R/ 8.6E+03 5.4E+03 63% 2,774 6 R403E/E410N
R233E/E240N D104N/K106S/R318Y/R338E/ D[104]N/K[106]S/R150Y/R170E/
9.1E+03 2.4E+03 27% 2,636 4 T343R/R403E/E410N T175R/R233E/E240N
R338E/T343R R170E/T175R 3.4E+06 4.8E+05 14% 7 2 T343R/N346Y
T175R/N178Y 4.2E+06 4.0E+06 95% 6 4 R318Y/R338E/N346Y/R403E/
R150Y/R170E/N178Y/R233E/ 2.8E+03 4.4E+02 16% 8,498 2 E410N E240N
R318Y/R338E/T343R/N346Y/ R150Y/R170E/T175R/N178Y/ 1.1E+04 4.3E+03
37% 2,086 4 R403E/E410N R233E/E240N T343R/N346D T175R/N178D 1.3E+06
2.3E+05 18% 18 2 R318Y/R338E/T343R/N346D/ R150Y/R170E/T175R/N178D/
5.1E+03 3.7E+01 1% 4,726 2 R403E/E410N R233E/E240N
R318Y/R338E/Y345A/R403E/ R150Y/R170E/Y177A/R233E/ 7.9E+03 1.2E+03
16% 3,015 2 E410N E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 8.1E+02 1.6E+02 20% 29,512 4 R338E/R403E
R170E/R233E K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 3.1E+02
2.1E+02 67% 76,373 4 R403E R233E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 7.3E+03 2.0E+01 0% 3,291 2 R403E/E410N
R233E/E240N K247N/N249S/R318Y/R403E/ K82N/N84S/R150Y/R233E/ 2.7E+03
9.3E+02 35% 8,942 6 E410N E240N Y155F/K247N/N249S/R338E/
Y[155]F/K82N/N84S/R170E/ 4.2E+04 4.3E+02 1% 572 2 R403E/E410N
R233E/E240N K247N/N249S/R338E/R403E/ K82N/N84S/R170E/R233E/ 2.1E+04
1.5E+03 7% 1,148 2 E410N E240N R318Y/R338E/T343R/R403E
R150Y/R170E/T175R/R233E 5.8E+03 8.6E+02 15% 4,118 2
Y155F/R318Y/R338E/T343R/ Y[155]F/R150Y/R170E/T175R/ 2.8E+03 3.8E+02
14% 8,515 6 R403E R233E R318Y/R338E/T343R/E410N
R150Y/R170E/T175R/E240N 5.4E+05 3.2E+05 58% 44 8
Y155F/R318Y/R338E/T343R/ Y[155]F/R150Y/R170E/T175R/ 7.8E+05 6.1E+05
79% 31 4 E410N E240N R318Y/T343R/R403E/E410N
R150Y/T175R/R233E/E240N 9.3E+04 1.2E+04 13% 257 2
Y155F/R318Y/T343R/R403E/ Y[155]F/R150Y/T175R/R233E/ 5.5E+04 7.8E+03
14% 436 4 E410N E240N R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N 3.4E+05 2.7E+03 1% 70 2
Y155F/R338E/T343R/R403E/ Y[155]F/R170E/T175R/R233E/ 2.8E+05 1.7E+04
6% 85 4 E410N E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 8.7E+03 1.9E+03 22% 2,733 8
R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N
K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 9.6E+03 2.4E+03 25%
2,499 4 T343R/R403E/E410N T175R/R233E/E240N
K228N/I251S/R318Y/R338E/ K63N/I86S/R150Y/R170E/ 9.0E+02 2.2E+02 25%
26,598 4 R403E/E410N R233E/E240N Y155F/K228N/I251S/R318Y/
Y[155]F/K63N/I86S/R150Y/ 1.3E+03 2.8E+02 21% 17,778 6
R338E/R403E/E410N R170E/R233E/E240N N260S/R318Y/R338E/T343R/
N95S/R150Y/R170E/T175R/ 2.6E+03 5.6E+02 22% 9,317
4 R403E/E410N R233E/E240N Y155F/N260S/R318Y/R338E/
Y[155]F/N95S/R150Y/R170E/ 2.6E+03 6.6E+02 25% 9,148 4
T343R/R403E/E410N T175R/R233E/E240N K228N/K247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/ 5.3E+03 1.8E+03 34% 4,468 10
R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N
Y155F/K228N/K247N/N249S/ Y[155]F/K63N/K82N/N84S/ 2.2E+03 1.4E+03
62% 10,758 4 R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/
E410N E240N Y155F/R338E/T343R/R403E Y[155]F/R170E/T175R/R233E
9.3E+04 1.2E+04 13% 257 4 R338E/T343R/R403E R170E/T175R/R233E
1.9E+05 7.1E+02 0% 125 2 Y155F/R338E/T343R/R403E/
Y[155]F/R170E/T175R/R233E/ 2.2E+05 2.6E+04 12% 110 6 E410S E240S
Y155F/N260S/R338E/T343R/ Y[155]F/N95S/R170E/T175R/ 4.0E+04 7.6E+03
19% 601 4 R403E R233E Y155F/I251S/R338E/T343R/
Y[155]F/I86S/R170E/T175R/ 1.6E+05 1.5E+04 9% 146 2 R403E R233E
R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/ 9.9E+03 2.9E+03
30% 2,417 22 E410S E240S Y155F/K247N/N249S/T343R/
Y[155]F/K82N/N84S/T175R/ 1.4E+05 2.3E+04 16% 168 4 R403E R233E
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 2.3E+03 1.7E+02
8% 10,415 2 R338E/T343R/R403E R170E/T175R/R233E
K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 1.7E+03 2.0E+02 12%
14,156 4 T343R/R403E T175R/R233E Y155F/K247N/N249S/R338E/
Y[155]F/K82N/N84S/R170E/ 8.9E+04 1.1E+04 13% 268 4
T343R/R403E/E410N T175R/R233E/E240N K247N/N249S/R338E/T343R/
K82N/N84S/R170E/T175R/ 8.6E+04 1.1E+04 13% 276 4 R403E/E410N
R233E/E240N Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/
2.7E+04 1.4E+04 50% 889 4 R338E R170E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 4.0E+05 2.9E+05 72% 60 8 T343R T175R
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 2.1E+03 5.3E+01
2% 11,125 2 R403E R233E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 1.3E+05 9.5E+04 75% 188 6 E410N E240N
Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/ 1.3E+04 1.0E+03
8% 1,819 2 R403E R233E Y155F/K247N/N249S/R338E/
Y[155]F/K82N/N84S/R170E/ 1.2E+07 6.2E+06 51% 2 4 T343R T175R
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 2.2E+05 1.0E+05
45% 107 4 R338E/T343R/E410N R170E/T175R/E240N
K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 2.1E+05 8.2E+04 39%
114 4 T343R/E410N T175R/E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 2.8E+04 5.6E+03 20% 842 4
T343R/R403E/E410N T175R/R233E/E240N K247N/N249S/R318Y/T343R/
K82N/N84S/R150Y/T175R/ 2.5E+04 8.0E+03 32% 962 6 R403E/E410N
R233E/E240N Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/
2.9E+06 2.2E+06 77% 8 6 E410N E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 1.2E+04 1.0E+03 9% 2,011 4 T343R/R403E
T175R/R233E K247N/N249S/R318Y/T343R/ K82N/N84S/R150Y/T175R/ 9.8E+03
2.5E+03 26% 2,430 12 R403E R233E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 3.6E+05 1.2E+05 32% 66 4 T343R/E410N
T175R/E240N K247N/N249S/R318Y/T343R/ K82N/N84S/R150Y/T175R/ 4.9E+04
6.5E+03 13% 487 4 E410N E240N Y155F/K247N/N249S/R338E/
Y[155]F/K82N/N84S/R170E/ 4.4E+04 1.1E+04 26% 549 4 T343R/R403E
T175R/R233E K247N/N249S/R338E/T343R/ K82N/N84S/R170E/T175R/ 5.0E+04
1.7E+04 35% 482 4 R403E R233E K247N/N249S/R338E/T343R/
K82N/N84S/R170E/T175R/ 1.4E+07 7.2E+06 53% 2 5 E410N E240N
Y155F/K247N/N249S/T343R/ Y[155]F/K82N/N84S/T175R/ 6.2E+05 5.6E+04
9% 39 4 R403E/E410N R233E/E240N K247N/N249S/T343R/R403E/
K82N/N84S/T175R/R233E/ 4.2E+05 8.1E+04 19% 58 4 E410N E240N
Y155F/R318Y/R338E/T343R Y[155]F/R150Y/R170E/T175R 4.4E+05 1.9E+05
43% 55 6 R318Y/R338E/T343R R150Y/R170E/T175R 1.8E+06 8.6E+05 48% 13
4 Y155F/R318Y/T343R/R403E Y[155]F/R150Y/T175R/R233E 1.1E+04 9.1E+02
8% 2,114 2 Y155F/T343R/R403E/E410N Y[155]F/T175R/R233E/E240N
8.8E+05 3.3E+03 0% 27 2 Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 3.7E+05 1.1E+05 28% 64 6 R338E/T343R
R170E/T175R K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 3.2E+05
1.4E+05 44% 74 6 T343R T175R Y155F/K247N/N249S/T343R/
Y[155]F/K82N/N84S/T175R/ 3.5E+06 4.8E+05 14% 7 2 E410N E240N
Y155F/K247N/N249S/R403E/ Y[155]F/K82N/N84S/R233E/ 1.3E+05 3.3E+04
26% 191 14 E410N E240N Y155F/R338E/T343R/E410N
Y[155]F/R170E/T175R/E240N 1.3E+07 1.0E+07 78% 2 6 R338E/T343R/E410N
R170E/T175R/E240N 2.0E+07 6.3E+06 31% 1 4 Y155F/R318Y/T343R/E410N
Y[155]F/R150Y/T175R/E240N 2.0E+05 5.9E+04 29% 118 4
R318Y/T343R/E410N R150Y/T175R/E240N 1.2E+06 1.1E+05 9% 20 2
K228N/R150Y/R338E/T343R/ K63N/R150Y/R170E/T175R/ 7.1E+03 3.3E+02 5%
3,343 2 R403E/E410N R233E/E240N K228N/K247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/ 1.0E+03 2.3E+02 22% 23,389 2
R338E/T343R/R403E R170E/T175R/R233E K228N/247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/ 6.3E+05 1.0E+05 17% 38 2 R338E/T343R/E410N
R170E/T175R/E240N K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/
1.7E+04 2.4E+03 14% 1,422 2 T343R/R403E/E410N T175R/R233E/E240N
Example 6
Pharmacokinetic and Pharmacodynamic Analysis of FIXa
Polypeptides
[0622] The pharmacokinetic (PK) and pharmacodynamic (PD) properties
of the FIXa variant polypeptides were assessed by measuring the
amount of variant FIX in mouse plasma at various timepoints
following intravenous administration. Two assays were used to
quantify FIXa in plasma. An ELISA was used to quantify total FIX
protein in mouse plasma to assess the pharmacokinetic properties,
and a FIX-dependant clotting assay (activated partial
thromboplastin time (aPTT) assay using FIX-depleted plasma) was
used to quantify the coagulant activity of the FIX polypeptides in
plasma, thus assessing the pharmacodynamic properties.
[0623] Animals.
[0624] Male CD-1 mice (30-40 gm), supplied by Charles River
Laboratories (Hollister, Calif.) were quarantined for at least 3
days before treatment. For serial PK studies, male CD-1 mice (30-37
gm) were fitted with an indwelling jugular vein cannula. Filtered
tap water and food was available ad libitum prior to use in PD or
PK experiments.
A. Dosing and Blood Collection
[0625] Mice (N=3 per time point) were administered the FIX
polypeptides intravenously (.about.1.4 mg/kg for PK studies and
.about.400 IU/kg for PD studies, dose volume 2 ml/kg) via the tail
vein. At the appropriate time after dosing, animals were
anesthetized and blood was drawn (0.5-1 mL) using terminal cardiac
puncture into syringes containing citrate. In some experiments
where insufficient amount of protein was available, a total of only
4-6 animals were used for serial bleeding at staggered time points;
two mice were used for each full time course in order to collect
all time points without removing excess blood volume. Blood was
sampled in restrained conscious animals by first removing a small
amount of blood into a 0.1 mL syringe containing 0.9% saline. A
syringe containing 4.5 .mu.l of 0.1M sodium citrate was then
attached and 0.05 mL blood was withdrawn into the syringe and the
blood was transferred to a 1.5 mL tube. The initial syringe was
reattached and 0.07 mL of saline pushed back through the cannula.
The cannula was capped until the next time point, when the process
was repeated. For all studies, blood samples were centrifuged
within 15 minutes of collection (9000 rpm, 8 minutes, 4.degree. C.)
and the plasma removed and immediately flash frozen in liquid
nitrogen and then stored frozen (-70.degree. C.) pending
analysis.
A. PK Assessment.
[0626] Citrated blood samples were collected at various times up to
1440 min post dose (i.e., Predose, 2, 4, 10, 30, 60, 120, 240, 360,
480, 960 and 1440 min) by cardiac puncture for terminal experiments
or indwelling catheter for serial experiments. Plasma
concentrations of rFIX were determined using a factor IX specific
ELISA utilizing a matched pair of detection and capture antibodies
(#FIX-EIA, Affinity Biologicals, Ancaster, ON). Briefly, an
affinity purified polyclonal antibody to FIX is coated onto the
wells of a plate. The plates are washed and plasma samples
containing FIX are applied. Plasma samples are diluted 1:750 and
1:1500 on the plate. After washing the plate to remove unbound
material, a peroxidase conjugated detection antibody to FIX is
added to the plate to bind to the captured FIX. After washing the
plate to remove unbound conjugated antibody, the peroxidase
activity is expressed by incubation with chemiluminescent substrate
and read at 425 nM on an EnVision plate reader. The standard curve
is linear over the entire concentration range and spans the
concentrations of 0.82 pg/ml to 30 ng/ml. The FIX variant itself is
used for the standard curve to eliminate differences in the
antibody affinity. Each sample is measured on two separate assay
plates and those measurements within the range of the standard
curve are used to calculate the concentration of FIX variants in
the plasma sample.
[0627] PD Assessment.
[0628] The plasma pharmacodynamic activity of rFIX was quantified
using an activated partial thromboplastin time (aPTT) assay and FIX
deficient human plasma (STACLOT C.K. PREST kit, Diagnostica Stago,
Asnieres, France) per the manufacturer's instructions. Briefly, the
aPTT assay involves the recalcification of plasma in the presence
of cephalin (platelet substitute) and activator (koalin). Using FIX
deficient human plasma, the aPTT assay is specific for FDC. The
aPTT assay was performed as described in the manufacturers' product
insert. Briefly, citrated blood samples were collected at the same
time points described for PK assessment. Plasma samples were
diluted 1:100 in Tris buffered saline containing 0.1% bovine serum
albumin (Probumin, Millipore, Billerica, Mass.). Diluted plasma or
standard was combined with FIX deficient human plasma and
cephalin/kaolin reagent and incubated for 180 seconds. Coagulation
was initiated by the addition of calcium (CaCl.sub.2). Coagulation
time in seconds was measured using an STArt4 instrument
(Diagnostica Stago, Asnieres, France). Using a standard curve made
from known concentrations of rFIX, plasma FIX concentrations were
interpolated from the log concentration VS. log time standard curve
plot and then background FIX activity (from pre dose animals) was
subtracted. The lower limit of quantification for factor IX
activity was .about.10 ng/mL.
[0629] PD and PK Data Analysis.
[0630] PD (aPTT) and PK (ELISA) parameters from mouse studies with
rFIX variants were calculated using non compartmental analysis in
WinNonLin (v5.1, Pharsight Corp., Mountain View, Calif.). Both the
PD and PK of rFIX variants followed apparent biexponential plasma
decay. Select parameters for each variant tested are provided in
Table 25 for PD (using the aPTT assay) and Tables 26-27 for PK
(using the ELISA assay). Table 26 reflects data for additional FIXa
variants and provide new overall averages calculated to include
additional experimental replicates (n) for FIXa variants in Table
26. The PD parameters included half-life (terminal, min), MRT
(MRT.sub.0-inf, min), Area under the curve (AUC) O-last
(min.mu.g/mL)/Dose (mg/kg); Maximal concentration (C.sub.max;
(.mu.g/mL)/Dose (.mu.g/kg), Vd (mL/kg) and Clearance (Cl,
mL/min/kg).
[0631] Definitions and Formulae Used to Calculate Pharmacokinetic
Parameters.
[0632] Plasma half-life (the half life of the FIX polypeptide
during the terminal phase of plasma FIX concentration-versus-time
profile; T.sub.1/2 .beta. (calculated as -ln 2 divided by the
negative slope during the terminal phase of the log-linear plot of
the plasma FIX concentration-versus-time curve); MRT.sub.0-last is
the mean time the FIX polypeptide resides in body; calculated as
AUMC.sub.0-last/AUC.sub.0-last, where AUMC.sub.0-last is the total
area under the first moment-versus-time curve and AUC as described
subsequently); AUC.sub.0-last/Dose is calculated as
[AUC.sub.(0-t)], where t is the last time point with measurable
plasma concentration of the FIX polypeptide divided by the IV dose
(mg/kg); AUC.sub.0-inf/Dose is calculated as [AUC.sub.(0-t)+Ct/(ln
2/T.sub.1/2 .beta.)], where t is the last time point with
measurable plasma concentration of the FIX polypeptide divided by
the IV dose (mg/kg); C./Dose (ug/mL per mg/kg), where C.sub.max is
the time post dose corresponding to the maximal measured plasma FIX
concentration; Cl is systemic clearance calculated as
(Dose/AUC.sub.0-inf); V.sub.ss is the steady state volume of
distribution; calculated as MRT*Cl; and V.sub.z is the volume of
distribution based on the terminal elimination constant (.beta.);
calculated as Cl/(ln 2/T.sub.1/2 .beta.).
TABLE-US-00026 TABLE 25 PD properties of FIX variants assessed by
aPTT assay Mutation (Mature FIX C.sub.max/ numbering) N
T.sub.1/2.beta. MRT.sub.0-inf dose AUC.sub.0-inf Cl Vz Vss BeneFIX
.RTM. Coagulation FIX 2 296 354 19.3 2641 0.41 169 142 (T148A)
TABLE-US-00027 TABLE 26 PK properties of FIX variants assessed by
ELISA AUC/ AUC/ MRT Cmax/ Dose Dose Mutation N T1/2.sub..beta.
0-inf Dose 0-last 0-inf Vz Cl BeneFIX .RTM. Coagulation FIX 3 314
.+-. 128 366 .+-. 105 9.1 .+-. 1.5 1298 .+-. 298 1522 .+-. 158 308
.+-. 160 0.74 .+-. 0.06 (T148A) T148A 8 383 .+-. 109 435 .+-. 128
10.2 .+-. 2.1 1620 .+-. 195 1747 .+-. 234 317 .+-. 82 0.58 .+-.
0.08 Catalyst Biosciences WT 2 329 360 11.9 2036 2121 229 0.48
A103N/N105S 2 375 481 12.5 2841 3068 177 0.33 D104N/K106S 2 428 558
13.9 3379 3786 164 0.26 K106N/V108S 2 510 629 12.8 2748 3202 234
0.32 D85N 2 528 607 9.5 1798 2046 372 0.49 D64N 2 447 519 11.8 1933
2152 304 0.47 D64A 2 364 372 11.5 1351 1466 359 0.68 N167D 2 334
318 8.9 1129 1176 410 0.85 N167Q 3 337 .+-. 8.8 323 .+-. 4.2 8.2
.+-. 1.2 1495 .+-. 258 1554 .+-. 268 318 .+-. 42 0.66 .+-. 0.10
S61A 2 397 412 10.0 1685 1800 325 0.57 S53A 2 382 462 11.2 2146
2321 238 0.43 T159A 2 232 227 10.5 1036 1048 315 0.97 T169A 2 348
319 8.3 836 889 567 1.15 T172A 3 494 .+-. 187 571 .+-. 214 11.2
.+-. 2.9 2055 .+-. 408 2366 .+-. 676 295 .+-. 31 0.45 .+-. 0.13
T179A 2 377 431 12.5 2291 2458 223 0.42 Y155H 2 465 552 11.6 2365
2638 253 0.38 Y155Q 1 552 645 13.6 2583 3045 262 0.33 S158E 2 433
471 14.5 2029 2222 291 0.46 N157Q 2 335 352 11.3 1185 1238 395 0.83
N157D 2 290 265 9.9 1166 1211 393 0.93 Y155F 2 443 567 18.1 3941
4375 149 0.23 A103N/N105S/Y155F 2 562 619 13.1 2427 2496 325 0.40
D104N/K106S/Y155F 3 514 .+-. 80 581 .+-. 81 13.8 .+-. 1.0 3057 .+-.
1032 3181 .+-. 989 243 .+-. 47 0.34 .+-. 0.13 D203N/F205T 3 481
.+-. 69 566 .+-. 29 9.4 .+-. 1.9 2028 .+-. 448 2289 .+-. 489 314
.+-. 91 0.45 .+-. 0.09 D203N/F205T/D85N 1 291 406 12.4 1538 2044
205 0.49 K228N/D85N 2 459 565 11.3 2616 2926 227 0.35
K228N/A103N/N105S 2 583 701 14.4 3032 3301 255 0.30
K228N/D104N/K106S 2 801 913 13.6 2050 2238 513 0.45 K228N/Y155F 2
626 679 8.6 2073 2149 431 0.47 K228N/D104N/K106S/Y155F 2 551 614
14.0 3730 3822 211 0.27 I251S 2 565 718 10.1 2646 3137 260 0.32
I251S/A103N/N105S 2 444 542 14.3 2445 2719 241 0.38
I251S/D104N/K106S 2 692 802 13.9 2533 2664 375 0.38 I251S/Y155F 2
572 660 12.2 2591 2790 291 0.37 A262S 3 373 .+-. 87 453 .+-. 91
14.4 .+-. 3.8 2716 .+-. 732 2926 .+-. 908 188 .+-. 29 0.36 .+-.
0.10 E410N* 2 439 551 7.4 893 1365 469 0.75 E239N 2 338 416 10.7
1657 1908 257 0.54 K247N/N249S 6 627 .+-. 174 734 .+-. 244 10.8
.+-. 3.4 2196 .+-. 737 2545 .+-. 795 387 .+-. 154 0.42 .+-. 0.11
Y155F/K247N/N249S 2 538 608 10.6 1752 1880 420 0.53
K247N/N249S/A103N/N105S 2 736 852 21.5 4369 4699 226 0.21
K247N/N249S/D104N/K106S/ 2 603 714 16.8 3744 3889 233 0.27 Y155F
S319N/L321S 2 351 427 11.4 2270 2409 210 0.42 N260S 3 496 .+-. 157
619 .+-. 170 11.5 .+-. 3.8 3364 .+-. 1300 3687 .+-. 1457 231 .+-.
156 0.30 .+-. 0.11 D104N/K106S/N260S 2 805 1001 16.1 4736 5248 220
0.20 Y155F/N260S 2 607 682 18.4 3408 3530 257 0.27 Y284N 2 400 478
9.0 2052 2210 270 0.46 R318Y/E410N 1 428 474 6.1 575 686 900 1.46
R338E/E410N 2 334 376 6.2 718 844 570 1.18 R338E/R403E/E4100N 5 436
.+-. 24 507 .+-. 29 13.4 .+-. 2.0 3052 .+-. 522 3302 .+-. 656 196
.+-. 49 0.31 .+-. 0.06 D203N/F205T/E240N 2 600 679 6.8 671 799 1080
1.25 D203N/F205T/R338E 2 307 419 9.3 1186 1586 281 0.63
D203N/F205T/R338A 2 317 403 9.0 1063 1397 327 0.72
D203N/F205T/R318Y 2 258 286 8.7 508 601 732 1.91
D203N/F205T/R338E/R403E 2 303 419 11.3 2105 2804 156 0.36
K228N/E410N 2 373 479 6.0 721 1025 522 0.98 K228N/R338E 2 248 340
10.4 1403 1736 207 0.58 R318Y/R338E/E410N 5 424 .+-. 306 515 .+-.
378 5.8 .+-. 1.6 645 .+-. 310 774 .+-. 454 778 .+-. 272 1.6 .+-.
0.73 R318Y/R338E/E410N/D104N/ 2 502 531 8.9 2008 2041 355 0.49
K106S R318Y/R338E/E410N/Y155F 2 555 584 6.5 678 721 1136 1.53
K228N/R318Y/E410N 1 304 408 6.0 686 906 485 1.10
R318Y/R338E/R403E/E410N 5 442 .+-. 22 534 .+-. 28 16.4 .+-. 3.7
3902 .+-. 867 4232 .+-. 996 157 .+-. 38 0.25 .+-. 0.05
A103N/N105S/R318Y/R338E/ 2 421 527 16.2 3605 3935 157 0.26
R403E/E410N D104N/K106S/R318Y/R338E/ 2 417 517 15.1 3114 3392 183
0.30 R403E/E410N Y155F/R318Y/R338E/R403E/ 2 565 649 12.4 3687 3772
226 0.27 E410N R318Y/R338E/R403E/E410N/ 3 669 .+-. 145 819 .+-. 223
17.2 .+-. 2.0 5844 .+-. 1064 6204 .+-. 1393 156 .+-. 8.7 0.17 .+-.
0.04 A103N/N105S/Y155F R318Y/R338E/R403E/E410N/ 2 472 575 14.4 5885
5967 114 0.17 D104N/K106S/Y155F D203N/F205T/R318Y/E410N 1 431 475
8.0 637 761 816 1.31 R338L 2 368 377 11.2 1761 1861 285 0.54 K316M
2 527 665 7.9 1846 2142 356 0.47 E239S 2 462 542 11.3 2184 2416 278
0.41 E239A 2 538 544 13.1 1973 2209 353 0.45 E239R 2 431 709 8.9
1668 2020 307 0.50 E239K 2 400 370 14.4 2107 2222 278 0.48 H257F 2
328 357 10.3 1689 1820 273 0.70 H257Y 2 352 353 13.6 1971 2063 245
0.49 H257E 2 491 520 10.9 2185 2411 294 0.42 H257S 2 435 511 8.2
1630 1769 358 0.57 T412A 2 473 539 7.1 1561 1756 379 0.58 T412V 2
579 665 8.3 1258 1454 565 0.69 E410N/T412A 2 461 514 2.8 364 398
1679 2.51 E410N/T412V 2 340 390 3.7 431 487 906 2.27 E410Q 2 276
283 7.2 445 484 836 2.19 E410S 2 310 286 7.2 753 775 587 1.32 E410A
2 363 328 8.6 528 554 946 1.81 E410D 2 348 377 9.2 1473 1596 320
0.63 N346D 2 349 395 13.3 2817 2956 170 0.34 Y155F/N346D 2 472 478
17.0 3934 3986 176 0.26 N346Y 2 329 325 11.7 1246 1297 365 0.77
Y345T 2 359 453 6.1 1124 1200 438 0.85 T343R 2 402 504 6.5 1143
1234 487 0.85 T343E 2 414 461 12.6 1740 1877 318 0.53 T343Q 2 434
442 9.0 1626 1737 408 0.63 F342I 2 400 476 8.3 1133 1224 491 0.88
T343R/Y345T 2 325 324 9.1 1094 1130 422 0.90 R318Y/R338E 2 340 313
11.2 1402 1452 336 0.69 K228N/I251S 2 586 657 11.3 1473 1588 551
0.65 K228N/R318Y/R338E/R403E/ 2 476 647 9.1 2400 2726 261 0.37
E410N K228N/R318Y/R338E/R403E/ 3 615 .+-. 135 750 .+-. 191 18.6
.+-. 2.1 5496 .+-. 2044 5970 .+-. 2260 158 .+-. 50 0.18 .+-. 0.06
E410N/Y155F K228N/R318Y/R338E/R403E/ 2 587 713 24.8 6153 6725 125
0.15 E410N/D85N I251S/R318Y/R338E/R403E/ 3 412 .+-. 140 542 .+-.
181 15.7 .+-. 4.9 2306 .+-. 884 2636 .+-. 1261 242 .+-. 89 0.44
.+-. 0.17 E410N D104N/K106S/I251S/R318Y/ 4 687 .+-. 60 874 .+-. 82
17.2 .+-. 2.2 7653 .+-. 456 8127 .+-. 520 122 .+-. 10 0.12 .+-.
0.01 R338E/R403E/E410N I251S/R318Y/R338E/R403E/ 2 492 620 19.9 5704
6510 110 0.15 E410N/Y155F I251S/R318Y/R338E/E410N 2 591 630 7.5
1245 1292 664 0.78 D104N/K106S/D104N/K106S/ 2 726 819 16.4 1512
1612 650 0.62 I251S/R318Y/R338E/E410N/ K247N/N249S/R318Y/R338E/ 2
637 807 15.4 5283 5541 170 0.18 R403E/E410N
Y155F/K247N/N249S/R318Y/ 2 613 758 13.8 5335 5549 160 0.18
R338E/R403E/E410N A103N/N105S/K247N/N249S/ 2 615 783 18.6 7319 7612
117 0.13 R318Y/R338E/R403E/E410N D104N/K106S/K247N/N249S/ 2 626 754
19.4 6332 6580 140 0.15 R318Y/R338E/R403E/E410N
K228N/N84S/R318Y/R338E/ 2 512 539 18.1 1925 1967 396 0.54 E410N
Y155F/K228N/N84S/R318Y/ 2 617 685 8.1 1170 1221 745 0.83
R338E/E410N R318Y/R338E/R403E/E410S 2 382 395 14.7 2897 2971 184
0.34 R318Y/R338E/E410S 2 356 326 7.7 488 511 1066 2.08
K228N/K247N/N249S 2 662 753 19.6 3390 3578 268 0.28
K228N/K247N/N249S/D104N/ 3 781 .+-. 55 939 .+-. 48 18.5 .+-. 3.8
6111 .+-. 1900 6606 .+-. 1949 183 .+-. 63 0.16 .+-. 0.04
K106S/Y155F K228N/K247N/N249S/D104N/ 2 758 838 17.9 3792 4035 271
0.25 K106S K228N/K247N/N249S/Y155F 2 549 643 17.2 3002 3269 246
0.31 I251S/R318Y/R338E/R403E/ 3 599 .+-. 89 753 .+-. 121 21.7 .+-.
3.2 8567 .+-. 2834 9233 .+-. 2860 96.6 .+-. 15.4 0.11 .+-. 0.03
E410N/Y155F R318Y/R338E/R403E/E410N/ 2 424 456 20.0 4730 4892 124
0.20 T412V R318Y/R338E/R403E/E410N/ 2 380 439 17.5 4994 5115 107
0.20 T412A R318Y/R338E/R403E/T412A 3 399 .+-. 88 477 .+-. 108 19.7
.+-. 0.7 4320 .+-. 2385 4505 .+-. 2357 144 .+-. 48 0.27 .+-. 0.15
R318Y/R3380E/T412A 2 462 401 13.6 1674 1691 398 0.60
N260S/R318Y/R338E/R403E/ 2 583 743 23.9 6821 7488 111 0.13 E410N
D104N/K106S/N260S/R318Y/ 2 779 999 17.2 7100 7728 145 0.12
R338E/R403E/E410N Y155F/N260S/R318Y/R338E/ 2 628 758 21.4 5214 5465
167 0.21 R403E/E410N R318Y/R338E/N346D/R403E/ 2 474 575 25.2 7623
8140 86 0.12 E410N Y155F/R318Y/R338E/N346D/ 2 540 641 18.2 5039
5172 154 0.20 R403E/E410N K247N/N249S/N260S 2 549 632 17.4 4156
4262 186 0.23 Y155F/K247N/N249S/N260S 2 691 814 24.0 3857 4085 244
0.22 D104N/K106S/K247N/N249S/ 2 712 859 16.5 4187 4458 235 0.23
N260S D104N/K106S/Y155F/K247N/ 2 680 856 23.3 7026 7423 134 0.14
N249S/N260S K247N/N249S/N260S/R318Y/ 2 691 875 18.9 6353 6737 149
0.13 R338E/R403E/E410N R318Y/R338E/T343R/R403E/ 2 531 560 20.5 3766
3862 200 0.27 E410N R338E/T343R 2 534 453 12.8 798 813 949 1.23
*80% glycosylated form of E410N
TABLE-US-00028 TABLE 27 PK properties of FIX variants assessed by
ELISA Mutation Mutation AUC/ AUC/ (Mature FIX (Chymotrypsin
Terminal Dose Dose MRT Cmax/ Numbering) Numbering) N T1/2 (0-last)
(0-inf) (0-inf) Dose Vz Cl N157D N[157]D 2 290 1166 1211 265 9.9
393 0.93 Y155F Y[155]F 2 443 3941 4375 567 18.1 149 0.23
A103N/N105S/ A[103]N/N[105]S/ 2 562 2427 2496 619 13.1 325 0.40
Y155F Y[155]F D104N/K106S/ D[104]N/K[106]S/ 3 514 .+-. 79.8 3060
.+-. 1030 3180 .+-. 989 581 .+-. 81.0 13.8 .+-. 1.02 243 .+-. 47.4
0.341 .+-. 0.128 Y155F Y[155]F WT Catalyst 2 329 2036 2121 360 11.9
229 0.48 Biosciences WT A103N/N105S A[103]N/N[105]S 2 375 2841 3068
481 12.5 177 0.33 D104N/K106S D[104]N/K[106]S 2 428 3379 3786 558
13.9 164 0.26 K106N/V108S K[106]N/V[108]S 2 510 2748 3202 629 12.8
234 0.32 D85N D[85]N 4 575 .+-. 89.3 1530 .+-. 321 1680 .+-. 83.3
623 .+-. 83.3 9.10 .+-. 0.518 528 .+-. 184 0.619 .+-. 0.156 T148A
BeneFIX, 3 314 .+-. 128 1300 .+-. 298 1520 .+-. 158 366 .+-. 105
9.12 .+-. 1.52 308 .+-. 160 0.662 .+-. 0.071 T[148]A T148A T[148]A
8 383 .+-. 109 1620 .+-. 195 1750 .+-. 234 435 .+-. 128 10.2 .+-.
2.09 317 .+-. 82.3 0.582 .+-. 0.084 K5A K[5]A 2 271 1548 1583 311
10.5 251 0.64 D64N D[64]N 2 447 1933 2152 519 11.8 304 0.47 D64A
D[64]A 2 364 1351 1466 372 11.5 359 0.68 N167D N[167]D 2 334 1129
1176 318 8.9 410 0.85 N167Q N[167]Q 3 337 .+-. 8.75 1500 .+-. 258
1550 .+-. 268 323 .+-. 4.25 8.20 .+-. 1.17 318 .+-. 42.5 0.655 .+-.
0.103 S61A S[61]A 2 397 1685 1800 412 10.0 325 0.57 S53A S[53]A 2
382 2146 2321 462 11.2 238 0.43 T159A T[159]A 2 232 1036 1048 227
10.5 315 0.97 T169A T[169]A 2 348 836 889 319 8.3 567 1.15 T172A
T[172]A 3 494 .+-. 187 2050 .+-. 408 237 .+-. 676 571 .+-. 214 11.2
.+-. 2.89 295 .+-. 31.5 0.447 .+-. 0.132 T179A T[179]A 2 377 2291
2458 431 12.5 223 0.42 Y155H Y[155]H 2 465 2365 2638 552 11.6 253
0.38 Y155Q Y[155]Q 1 552 2583 3045 645 13.6 262 0.33 S158E S[158]E
2 433 2029 2222 471 14.5 291 0.46 N157Q N[157]Q 2 335 1185 1238 352
11.3 395 0.83 D203N/F205T D39N/F41T 3 481 .+-. 69.0 2030 .+-. 448
2290 .+-. 489 566 .+-. 28.6 9.43 .+-. 1.93 314 .+-. 91.3 0.449 .+-.
0.087 D85N/D203N/ D[85]N/ 1 291 1538 2044 406 12.4 205 0.49 F205T
D39N/F41T K228N K63N 3 490 .+-. 57.8 2340 .+-. 519 2570 .+-. 682
570 .+-. 27.9 12.3 .+-. 1.58 296 .+-. 119 0.410 .+-. 0.118
A103N/N105S/ A[103]N/ 2 583 3032 3301 701 14.4 255 0.30 K228N
N[105]S/K63N D104N/K106S/ D[104]N/ 2 801 2050 2238 913 13.6 513
0.45 K228N K[106]S/K63N Y155F/K228N Y[155]F/K63N 2 626 2073 2149
679 8.6 431 0.47 D104N/K106S/ D[104]N/K[106]S/ 2 551 3730 3822 614
14.0 211 0.27 Y155F/K228N Y[155]F/K63N I251S I86S 2 565 2646 3137
718 10.1 260 0.32 A103N/N105S/ A[103]N/ 2 444 2445 2719 542 14.3
241 0.38 I251S N[105]S/I86S D104N/K106S/ D[104]N/ 2 692 2533 2664
802 13.9 375 0.38 I251S K[106]S/I86S Y155F/I251S Y[155]F/I86S 2 572
2591 2790 660 12.2 291 0.37 A262S A95bS 2 373 2716 2926 453 14.4
188 0.36 E410N E240N 2 439 893 1365 551 7.4 469 0.75 E239N E74N 2
338 1657 1908 416 10.7 257 0.54 K247N/N249S K82N/N84S 6 627 .+-.
174 2200 .+-. 737 2540 .+-. 795 734 .+-. 244 10.8 .+-. 3.41 387
.+-. 154 0.420 .+-. 0.106 Y155F/K247N/ Y[155]F/K82N/ 2 538 1752
1880 608 10.6 420 0.53 N249S N84S A103N/N105S/ A[103]N/N[105]S/ 2
736 4369 4699 852 21.5 226 0.21 K247N/N249S K82N/N84S D104N/K106S/
D[104]N/K[106]S/ 2 571 2052 2109 632 16.2 426 0.51 K247N/N249S
K82N/N84S D104N/K106S/ D[104]N/K[106]S/ 2 603 3744 3889 714 16.8
233 0.27 Y155F/K247N/ Y[155]F/ N249S K82N/N84S S319N/L321S
S151N/L153S 2 351 2270 2409 427 11.4 210 0.42 N260S N95S 3 496 .+-.
157 3360 .+-. 1300 3690 .+-. 1460 619 .+-. 170 11.5 .+-. 3.18 231
.+-. 156 0.295 .+-. 0.105 D104N/K106S/ D[104]N/ 2 805 4736 5248
1001 16.1 220 0.20 N260S K[106]S/N95S Y155F/N260S Y[155]F/N95S 2
607 3408 3530 682 18.4 257 0.27 Y284N Y117N 2 400 2052 2210 478 9.0
270 0.46 R318Y/E410N R150Y/E240N 1 428 575 686 474 6.1 900 1.46
R338E/E410N R170E/E240N 2 334 718 844 376 6.2 570 1.18 R338E/R403E/
R170E/R233E/ 5 436 .+-. 24.4 3050 .+-. 522 3300 .+-. 656 507 .+-.
28.9 13.4 .+-. 2.03 196 .+-. 49.2 0.312 .+-. 0.063 E410N E240N
D203N/F205T/ D39N/F41T/ 2 600 671 799 679 6.8 1080 1.25 E410N E240N
D203N/F205T/ D39N/F41T/ 2 307 1186 1586 419 9.3 281 0.63 R338E
R170E D203N/F205T/ D39N/F41T/ 2 317 1063 1397 403 9.0 327 0.72
R338A R170A D203N/F205T/ D39N/F41T/ 2 258 508 601 286 8.7 732 1.91
R318Y R150Y D203N/F205T/ D39N/F41T/ 2 303 2105 2804 419 11.3 156
0.36 R338E/R403E R170E/R233E K228N/E410N K63N/E240N 2 373 721 1025
479 6.0 522 0.98 K228N/R338E K63N/R170E 2 248 1403 1736 340 10.4
207 0.58 R318Y/R338E/ R150Y/E240N/ 5 424 .+-. 306 645 .+-. 310 774
.+-. 454 515 .+-. 378 5.78 .+-. 1.56 778 .+-. 272 1.62 .+-. 0.730
E410N R170E D104N/K106S/ D[104]N/K[106]S/ 2 502 2008 2041 531 8.9
355 0.49 R318Y/R338E/ R150Y/R170E/ E410N E240N/ Y155F/R318Y/
Y[155]F/R150Y/ 2 555 678 721 584 6.5 1136 1.53 R338E/E410N
R170E/E240N K228N/R318Y/ K63N/R150Y/ 1 304 686 906 408 6.0 485 1.10
E410N E240N R318Y/R338E/ R150Y/R170E/ 5 442 .+-. 22.1 3900 .+-. 867
4230 .+-. 996 534 .+-. 28.0 16.4 .+-. 3.72 157 .+-. 38.3 0.246 .+-.
0.051 R403E/E410N R233E/E240N A103N/N105S/ A[103]N/N[105]S/ 2 421
3605 3935 527 16.2 157 0.26 R318Y/R338E/ R150Y/R170E/ R403E/E410N
R233E/E240N D104N/K106S/ D[104]N/K[106]S/ 2 417 3114 3392 517 15.1
183 0.30 R318Y/R338E/ R150Y/R170E/ R403E/E410N R233E/E240N
Y155F/R318Y/ Y[155]F/R150Y/ 2 565 3687 3772 649 12.4 226 0.27
R338E/R403E/ R170E/R233E/ E410N E240N A103N/N105S/ A[103]N/ 3 669
.+-. 145 5840 .+-. 1060 6200 .+-. 1390 819 .+-. 223 17.2 .+-. 2.02
156 .+-. 8.74 0.167 .+-. 0.039 Y155F/R318Y/ N[105]S/Y[155]F/
R338E/R403E/ R150Y/R170E/ E410N R233E/E240N D104N/K106S/ D[104]N/ 2
472 5885 5967 575 14.4 114 0.17 Y155F/R318Y/ K[106]S/Y[155]F/
R338E/R403E/ R150Y/R170E/ E410N R233E/E240N D203N/F205T/ D39N/F41T/
1 431 637 761 475 8.0 816 1.31 R318Y/E410N R150Y/E240N R338L R170L
2 368 1761 1861 377 11.2 285 0.54 K316M K148M 2 527 1846 2142 665
7.9 356 0.47 E239S E74S 2 462 2184 2416 542 11.3 278 0.41 E239A
E74A 2 538 1973 2209 544 13.1 353 0.45 E239R E74R 2 431 1668 2020
709 8.9 307 0.50 E239K E74K 2 400 2107 2222 370 14.4 278 0.48 H257F
H92F 2 328 1689 1820 357 10.3 273 0.70 H257Y H92Y 2 352 1971 2063
353 13.6 245 0.49 H257E H92E 2 491 2185 2411 520 10.9 294 0.42
H257S H92S 2 435 1630 1769 511 8.2 358 0.57 T412A T242A 2 473 1561
1756 539 7.1 379 0.58 T412V T242V 2 579 1258 1454 665 8.3 565 0.69
E410N/T412A E240N/T242A 2 461 364 398 514 2.8 1679 2.51 E410N/T412V
E240N/T242V 2 340 431 487 390 3.7 906 2.27 E410Q E240Q 2 276 445
484 283 7.2 836 2.19 E410S E240S 2 310 753 775 286 7.2 587 1.32
E410A E240A 2 363 528 554 328 8.6 946 1.81 E410D E240D 2 348 1473
1596 377 9.2 320 0.63 N346D N178D 2 349 2817 2956 395 13.3 170 0.34
Y155F/N346D 178D/Y[155]F 2 472 3934 3986 478 17.0 176 0.26 N346Y
N178Y 2 329 1246 1297 325 11.7 365 0.77 Y345T Y177T 2 359 1124 1200
453 6.1 438 0.85 T343R Y175R 2 402 1143 1234 504 6.5 487 0.85 T343E
T175E 2 414 1740 1877 461 12.6 318 0.53 T343Q Y175Q 2 434 1626 1737
442 9.0 408 0.63 F342I F174I 2 400 1133 1224 476 8.3 491 0.88
T343R/Y345T T175R/Y177T 2 325 1094 1130 324 9.1 422 0.90
R318Y/R338E R150Y/R170E 2 340 1402 1452 313 11.2 336 0.69
K228N/I251S K63N/I86S 2 586 1473 1588 657 11.3 551 0.65
K228N/R318Y/ K63N/R150Y/ 2 476 2400 2726 647 9.1 261 0.37
R338E/R403E/ R170E/R233E/ E410N E240N Y155F/K228N/ Y[155]F/K63N/ 3
615 .+-. 135 5500 .+-. 2040 5970 .+-. 2260 750 .+-. 191 18.6 .+-.
2.14 158 .+-. 50.1 0.183 .+-. 0.062 R318Y/R338E/ R150Y/R170E/
R403E/E410N R233E/E240N D85N/K228N/ D[85]N/K63N/ 2 587 6153 6725
713 24.8 125 0.15 R318Y/R338E/ R150Y/R170E/ R403E/E410N R233E/E240N
I251S/R318Y/ I86S/R150Y/ 3 412 .+-. 140 2310 .+-. 884 2640 .+-.
1260 542 .+-. 181 15.7 .+-. 4.89 242 .+-. 89.4 0.438 .+-. 0.171
R338E/R403E/ R170E/R233E/ E410N E240N D104N/K106S/ D[104]N/K[106]S/
4 687 .+-. 60.2 7650 .+-. 456 8130 .+-. 520 874 .+-. 81.7 17.2 .+-.
2.24 122 .+-. 10.1 0.123 .+-. 0.008 I251S/R318Y/ I86S/R150Y/
R338E/R403E/ R170E/R233E/ E410N E240N Y155F/I251S/ Y[155]F/I86S/ 2
492 5704 6510 620 19.9 110 0.15 R318Y/R338E/ R150Y/R170E/
R403E/E410N R233E/E240N I251S/R318Y/ I86S/R150Y/ 2 591 1245 1292
630 7.5 664 0.78 R338E/E410N R170E/E240N D104N/K106S/
D[104]N/K[106]S 2 726 1512 1612 819 16.4 650 0.62 I251S/R318Y/
I86S/R150Y/ R338E/E410N R170E/E240N K247N/N249S/ K82N/N84S/ 2 637
5283 5541 807 15.4 170 0.18 R318Y/R338E/ R150Y/R170E/ R403E/E410N
R233E/E240N Y155F/K247N/ Y[155]F/ 2 613 5335 5549 758 13.8 160 0.18
N249S/R318Y/ K82N/N84S/ R338E/R403E/ R150Y/R170E/ E410N R233E/E240N
A103N/N105S/ A[103]N/N[105]S 2 615 7319 7612 783 18.6 117 0.13
K247N/N249S/ K82N/N84S/ R318Y/R338E/ R150Y/R170E/ R403E/E410N
R233E/E240N/ D104N/K106S/ D[104]N/K[106]S 2 626 6332 6580 754 19.4
140 0.15 K247N/N249S/ K82N/N84S/ R318Y/R338E/ R150Y/R170E/
R403E/E410N R233E/E240N/ D104N/K106S/ D[104]N/K[106]S/ 2 846 8069
8807 1020 18.4 139 0.11 Y155F/K247N/ Y[155]F/K82N/ N249S/R318Y/
N84S/R150Y/ R338E/R403E/ R170E/R233E/ E410N E240N K247N/N249S/
K82N/N84S/ 2 512 1925 1967 539 18.1 396 0.54 R318Y/R338E/
R150Y/R170E/ E410N E240N Y155F/K247N/ Y[155]F/ 2 617 1170 1221 685
8.1 745 0.83 N249S/R318Y/ K82N/N84S/ R338E/E410N R150Y/R170E/
E240N/ R318Y/R338E/ R150Y/R170E/ 2 382 2897 2971 395 14.7 184 0.34
R403E/E410S R233E/E240S R318Y/R338E/ R150Y/R170E/ 2 356 488 511 326
7.7 1066 2.08 E410S E240S K228N/K247N/ K63N/K82N/ 2 662 3390 3578
753 19.6 268 0.28 N249S N84S D104N/K106S/ D[104]N/K[106]S/ 3 781
.+-. 55.2 6110 .+-. 1900 6610 .+-. 1950 939 .+-. 48.2 18.5 .+-.
3.84 183 .+-. 63.3 0.160 .+-. 0.045 Y155F/K228N/ Y[155]F/K63N/
K247N/N249S K82N/N84S D104N/K106S/ D[104]N/K[106]S/ 2 758 3792 4035
838 17.9 271 0.25 K228N/K247N/ K63N/K82N/ N249S N84S Y155F/K228N/
Y[155]F/K63N/ 2 549 3002 3269 643 17.2 246 0.31 K247N/N249S
K82N/N84S K228N/K247N/ Y[155]F/I86S/ 3 599 .+-. 88.6 8570 .+-. 2830
9230 .+-. 2860 753 .+-. 120 21.7 .+-. 3.19 96.6 .+-. 15.4 0.115
.+-. 0.030 N249S/R318Y/ R150Y/R170E/ R338E/R403E/ R233E/E240N/
E410N D104N/K106S/ D[104]N/K[106]S/ 3 806 .+-. 88.6 9330 .+-. 2830
9990 .+-. 2860 912 .+-. 120 24.4 .+-. 3.19 116 .+-. 15.4 0.100 .+-.
0.030 K228N/K247N/ K63N/K82N/ N249S/R318Y/ N84S/R150Y/ R338E/R403E/
R170E/R233E/ E410N E240N Y155F/K228N/ Y[155]F/K63N/ 1 559 10704
11042 710 27.3 73 0.09 K247N/N249S/ K82N/N84S/ R318Y/R338E/
R150Y/R170E/ R403E/E410N R233E/E240N R318Y/R338E/ R150Y/R170E/ 2
424 4730 4892 456 20.0 124 0.20 R403E/E410N/ R233E/E240N/ T412V
T242V R318Y/R338E/ R150Y/R170E/ 2 380 4994 5115 439 17.5 107
0.20
R403E/E410N/ R233E/E240N/ T412A T242A R318Y/R338E/ R150Y/R170E/ 3
399 .+-. 88.1 4320 .+-. 2380 4500 .+-. 2360 477 .+-. 108 19.7 .+-.
0.684 144 .+-. 47.8 0.270 .+-. 0.145 R403E/T412A R233E/T242A
R318Y/R338E/ R150Y/R170E/ 2 462 1674 1691 401 13.6 398 0.60 T412A
T242A R318Y/R338E/ 150Y/R170E/ 2 251 524 555 226 16.3 772 2.31
E410N/T412V E240N/T242V N260S/R318Y/ N95S/R150Y/ 2 583 6821 7488
743 23.9 111 0.13 R338E/R403E/ R170E/R233E/ E410N E240N
D104N/K106S/ D[104]N/K[106]S/ 2 779 7100 7728 999 17.2 145 0.12
N260S/R318Y/ N95S/R150Y/ R338E/R403E/ R170E/R233E/ E410N E240N
Y155F/N260S/ Y[155]F/N95S/ 2 628 5214 5465 758 21.4 167 0.21
R318Y/R338E/ R150Y/R170E/ R403E/E410N R233E/E240N R318Y/R338E/
R150Y/R170E/ 2 474 7623 8140 575 25.2 86 0.12 N346D/R403E/
N178D/R233E/ E410N E240N Y155F/R318Y/ Y[155]F/R150Y/ 2 540 5039
5172 641 18.2 154 0.20 R338E/N346D/ R170E/N178D/ R403E/E410N
R233E/E240N K247N/N249S/ K82N/N84S/ 2 549 4156 4262 632 17.4 186
0.23 N260S N95S Y155F/K247N/ Y[155]F/K82N/ 2 691 3857 4085 814 24.0
244 0.22 N249S/N260S N84S/N95S D104N/K106S/ D[104]N/K[106]S/ 2 712
4187 4458 859 16.5 235 0.23 K247N/N249S/ K82N/N84S/ N260S N95S
D104N/K106S/ D[104]N/K[106]S/ 2 680 7026 7423 856 23.3 134 0.14
Y155F/K247N/ Y[155]F/K82N N249S/N260S N84S/N95S/ K247N/N249S/
K82N/N84S/ 2 691 6353 6737 875 18.9 149 0.13 N260S/R318Y/
N95S/R150Y/ R338E/R403E/ R170E/R233E/ E410N E240N Y155F/K247N/
Y[155]F/K82N/ 1 1038 8401 9376 1068 21.0 160 0.11 N249S/N260S/
N84S/N95S/ R318Y/R338E/ R150Y/R170E/ R403E/E410N R233E/E240N
R318Y/R338E/ T175R/R233E/ 2 531 3766 3862 560 20.5 200 0.27
T343R/R403E/ E240N/R150Y/ E410N R170E Y155F/R318Y/ Y[155]F/R150Y/ 1
182 3223 4335 259 20.5 61 0.23 R338E/T343R/ R170E/T175R/
R403E/E410N R233E/E240N D104N/K106S/ D[104]N/K[106]S/ 3 666 .+-.
89.9 7270 .+-. 729 7550 .+-. 708 699 .+-. 88.0 21.7 .+-. 4.71 128
.+-. 21.1 0.133 .+-. 0.013 R318Y/R338E/ R150Y/R170E/ T343R/R403E/
T175R/R233E/ E410N E240N R338E/T343R R170E/T175R 2 534 798 813 453
12.8 949 1.23 T343R/N346Y T175R/N178Y 3 276 .+-. 19.9 1080 .+-. 331
1100 .+-. 333 228 .+-. 7.76 12.3 .+-. 5.14 394 .+-. 156 0.989 .+-.
0.360 R318Y/R338E/ R150Y/R170E/ 2 324 2394 2487 335 24.7 189 0.40
N346Y/R403E/ N178Y/R233E/ E410N E240N R318Y/R338E/ R150Y/R170E/ 2
303 3569 3691 329 22.2 118 0.27 T343R/N346Y/ T175R/N178Y/
R403E/E410N R233E/E240N T343R/N346D T175R/N178D 2 388 2903 2917 356
17.0 192 0.34 R318Y/R338E/ R150Y/R170E/ 2 450 6645 6717 506 20.7 97
0.15 T343R/N346D/ T175R/N178D/ R403E/E410N R233E/E240N R318Y/R338E/
R150Y/R170E/ 1 475 4989 5058 511 22.3 135 0.20 Y345A/R403E/
Y177A/R233E/ E410N E240N R318Y/R338E/ R150Y/R170E/ 2 492 6249 6347
607 22.1 112 0.16 Y345A/N346D/ Y177A/N178D/ R403E/E410N R233E/E240N
Y155F/K247N/ Y[155]F/K82N/ 2 622 10477 10973 791 26.9 85 0.10
N249S/R318Y/ N84S/R150Y/ R338E/R403E R170E/R233E K247N/N249S/
K82N/N84S/ 2 805 8099 8569 814 20.0 137 0.12 R318Y/R338E/
R150Y/R170E/ R403E R233E Y155F/K247N/ Y[155]F/K82N/ 2 618 9233 9709
801 22.4 92 0.10 N249S/R338E/ N84S/R170E/ R403E/E410N R233E/E240N
R318Y/R338E/ R150Y/R170E/ 2 421 6107 6153 473 19.9 99 0.16
T343R/R403E T175R/R233E R318Y/R338E/ R150Y/R170E/ 2 529 793 815 391
5.6 931 1.23 T343R/E410N T175R/E240N R150Y/T343R/ R150Y/T175R/ 2
431 5020 5060 434 20.7 130 0.21 R403E/E410N R233E/E240N
R170E/T343R/ R170E/T175R/ 2 484 5008 5060 450 19.8 141 0.20
R403E/E410N R233E/E240N Y155F/R338E/ Y[155]F/R170E/ 2 628 5406 5509
521 17.9 164 0.18 T343R/R403E/ T175R/R233E/ E410N E240N
Y155F/K247N/ K82N/N84S/ 2 513 9067 9267 642 24.7 82 0.11
N249S/R318Y/ R150Y/R170E/ R338E/T343R/ T175R/R233E/ R403E/E410N
E240N K247N/N249S/ K82N/N84S/ 2 536 8604 8824 672 24.4 89 0.12
R318Y/R338E/ R150Y/R170E/ T343R/R403E/ T175R/R233E/ E410N E240N
Y155F/K228N/ Y[155]F/K63N/ 2 780 9033 9557 854 20.5 123 0.11
I251S/R318Y/ I86S/R150Y/ R338E/R403E/ R170E/R233E/ E410N E240N
N260S/R318Y/ Y[155]F/N95S/ 2 539 8325 8537 675 24.0 92 0.12
R338E/T343R/ R150Y/R170E/ R403E/E410N T175R/R233E/ E240N
Y155F/N260S/ Y[155]F/N95S/ 1 578 3266 6295 733 20.4 133 0.16
R318Y/R338E/ R150Y/R170E/ T343R/R403E/ T175R/R233E/ E410N E240N
K228N/K247N/ K63N/K82N/ 2 753 8972 9391 757 26.0 117 0.11
N249S/R318Y/ N84S/R150Y/ R338E/T343R/ R170E/T175R/ R403E/E410N
R233E/E240N Y155F/R338E/ Y[155]F/R170E/ 2 503 5350 5412 506 16.7
135 0.19 T343R/R403E T175R/R233E Y155F/R338E/ Y[155]F/R170E/ 2 589
5447 5546 526 22.9 156 0.18 T343R/R403E/ T175R/R233E/ E410S E240S
Y155F/N260S/ Y[155]F/N95S/ 2 485 9590 9749 619 24.0 74 0.10
R338E/T343R/ R170E/T175R/ R403E R233E Y155F/I251S/ Y[155]F/I86S/ 2
732 7531 7926 807 21.0 134 0.13 R338E/T343R/ R170E/T175R/ R403E
R233E R318Y/R338E/ R150Y/R170E/ 2 618 4657 4728 466 19.9 199 0.23
T343R/R403E/ T175R/R233E/ E410S E240S Y155F/K247N/ Y[155]F/K82N/ 2
866 7007 7391 751 18.3 169 0.14 N249S/T343R/ N84S/T175R/ R403E
R233E K247N/N249S/ K82N/N84S/ 2 804 9554 10051 776 20.4 116 0.10
R338E/T343R/ R170E/T175R/ R403E/E410N R233E/E240N Y155F/K247N/
Y[155]F/K82N/ 2 662 2965 3048 578 13.6 313 0.33 N249S/R318Y/
N84S/R150Y/ R338E R170E Y155F/K247N/ Y[155]F/K82N/ 1 717 8404 8790
783 16.9 118 0.11 N249S/R338E/ N84S/R170E/ R403E R233E Y155F/K247N/
Y[155]F/K82N/ 2 676 7455 7702 676 20.3 131 0.13 N249S/R338E/
N84S/R170E/ T343R/R403E T175R/R233E K247N/N249S/ K82N/N84S/ 2 680
7758 8085 747 18.0 122 0.13 T343R/R403E/ T175R/R233E/ E410N
E240N
Example 7
In Vivo Assessment of Fix Polypeptide Procoagulant Activity
[0633] Mouse models of hemophilia B, using mice deficient in FIX
(FIX.sup.-/- mice), were established to assess the procoagulant
activity of FIX polypeptides. The mice were treated with FIX
polypeptide and the amount of blood lost in 20 minutes was measured
to determine the procoagulant activity of the FIX polypeptides.
A. In Vivo Assessment of Wild-Type Fix Procoagulant Activity
[0634] Male FIX.sup.-/- mice were anesthetized by intraperitoneal
administration of a ketamine/xylazine cocktail (45 mg/ml and 3.6
mg/ml in saline) and placed on a heated platform (39.degree. C.) to
ensure there was no drop in body temperature. The procedure room
was kept at a temperature of 82.degree. F. Ten minutes prior to
tail cut the tail was immersed in 10 mL of pre-warmed PBS (15 mL
centrifuge tube; 39.degree. C.). Seven to fifteen mice were
injected with recombinant human FIX (Benefix.RTM. Coagulation
Factor IX (Recombinant), Wyeth) or modified FIX polypeptides
diluted in a buffer that was the same as that of Benefix.RTM.
Coagulation Factor IX (Recombinant) (0.234% sodium chloride, 8 mM
L-histidine, 0.8% sucrose, 208 mM glycine, 0.004% polysorbate 80)
via the tail vein in a single injection. A negative control group
of mice received buffer only. In instances where the injection was
missed, the animal was excluded from the study.
[0635] Injection with FIX polypeptide or buffer was made 5 minutes
prior to tail cut. The tail cut was made using a razor blade 5 mm
from the end of the tail and blood was collected into PBS for a
period of 20 minutes. At the end of the collection period, total
blood loss was assessed. The collection tubes were mixed and a 1 ml
aliquot of each sample was taken and assayed for hemoglobin
content. Triton X-100 was diluted 1 in 4 in sterile water and 100
.mu.L was added to the 1 mL samples to cause hemolysis. The
absorbance of the samples was then measured at a wavelength of 546
nm. To calculate the amount of blood lost, the absorbance was read
against a standard curve generated by measuring the absorbance at
546 nm of known volumes of murine blood, diluted in PBS and
hemolyzed as above with Triton X 100. Values are expressed as
Mean.+-.SEM.
[0636] 1. Dose Response Study Assessing Wild-Type FIX Coagulant
Activity
[0637] Dose response studies to assess the coagulant activity of
Benefix.RTM. Coagulation Factor IX (Recombinant) at 0.03, 0.1, 0.3
and 1 mg/kg in FIX.sup.-/- mice were performed. In this experiment,
the blood loss in the buffer-only group was 835.42.+-.24.55 which
was significantly reduced by Benefix.RTM. Coagulation Factor IX
(Recombinant) treatment at 0.1, 0.3 and 1 mg/kg (to 558.59.+-.56.63
415.81.+-.66.724 and 270.75.+-.57.48 .mu.L; p<0.05 using
Kruskal-Wallis followed by Dunn's post test). At the lowest dose
tested of 0.03 mg/kg the value was 731.66.+-.59.16 .mu.L.
Calculated ED.sub.50 values using non-linear regression are shown
in Table 28 below.
[0638] 2. Dose Response Assessing the Coagulant Activity of
FIXa-R318Y/R338E/R403E/E410N, FIXa-R318Y/R338E/E410N and
FIXa-Y155F/K247N/N249S/R318Y/R338E/R403E/E410N
[0639] Dose response studies were conducted in which the coagulant
activity of FIXa-R318Y/R338E/R403E/E410N(R150Y/R170E/R233E/E240N by
chymotrypsin numbering), FIXa-R318Y/R338E/E410N(R150Y/R170E/E240N
by chymotrypsin numbering) and
FIXa-Y155F/K247N/N249S/R318Y/R338E/R403E/E410N
(Y[155]F/K82N/N84S/R150Y/R170E/R233E/E240N by chymotrypsin
numbering) at different doses were assessed.
[0640] Treatment with FIXa-R318Y/R338E/R403E/E410N resulted in
significant inhibition of blood loss at 0.01, 0.03, 0.1, 0.3 and 1
mg/kg (434.65.+-.73.75 .mu.L, 497.28.+-.50.92 .mu.L,
230.81.+-.39.67 .mu.L, 261.94.+-.58.79 .mu.l and 251.56.+-.41.81
respectively) compared to the buffer-only control (811.45.+-.26.63
.mu.L; p<0.05 using Kruskal-Wallis followed by Dunn's post
test). Reducing the dose to 0.003 mg/kg led to blood loss values
nearer control levels, of 786.83.+-.44.39 .mu.L.
[0641] Treatment with FIXa-R318Y/R338E/E410N also resulted in
significant inhibition of blood loss at 0.03, 0.1, 0.3 and 1 mg/kg
(571.67.+-.50.45 pt, 425.42.+-.43.65 4, 263.47.+-.42.66 .mu.l and
78.19.+-.13.42 4, respectively) compared to the buffer-only control
(845.14.+-.23.63 .mu.L; p<0.05 using Kruskal-Wallis followed by
Dunn's post test). Reducing the dose to 0.001 mg/kg led to blood
loss values nearer control levels, of 777.16.+-.53.72 .mu.L.
[0642] Treatment with
FIXa-Y155F/K247N/N249S/R318Y/R338E/R403E/E410N resulted in the most
significant inhibition of blood loss of the mutants tested:
460.03.+-.74.60 .mu.L, 393.48.+-.75.16 .mu.L and 157.28.+-.28.89
.mu.L at 0.01, 0.03 and 0.1 mg/kg, respectively, compared to the
buffer-only control (851.38.+-.44.25 .mu.L; p<0.05 using
Kruskal-Wallis followed by Dunn's post test). Calculated ED.sub.50
values using non-linear regression are shown in Table 28 below.
TABLE-US-00029 TABLE 28 Blood Loss; Mutation (Mature FIX Mutation
(chymotrypsin n/ n ED50 numbering) numbering group (expts) (mg/kg)
BeneFIX Benefix .RTM. Coagulation BeneFIX Benefix .RTM. 7-20 2 0.2
FIX (T148A) Coagulation FIX (T[148]A) R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 19-38 3 0.02 R318Y/R338E/E410N
R150Y/R170E/E240N 8-42 4 0.06 Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 18-21 2 0.01 R338E/R403E/E410N
R170E/R233E/E240N
[0643] 3. Duration Response Assessing Wild-Type FIX Coagulant
Activity
[0644] Studies were performed to assess the duration of effect of
Benefix.RTM. Coagulation Factor IX (Recombinant) at 0.5 mg/kg in
FIX.sup.-/- mice. Mice were dosed intravenously at 48 hr, 24 hr, 16
hr, 8 hr, 4 hr, 2 hr, 30 min and 5 min prior to tail cut. In this
experiment, inhibition from the control group was determined where
the control group was set at 0% inhibition. Inhibition of blood
loss was 59.7.+-.11.9%, 48.25.+-.12.84%, 57.74.+-.9.10%,
56.04.+-.8.46%, 32.09.+-.7.92%, 12.94.+-.7.33%, 38.75.+-.11.47% and
0.64.+-.11.3% at 5 min, 30 min, 2, 4, 8, 16, 24 and 48 hr,
respectively from vehicle control (Mean and SEM, n=8-33 mice, from
3 experiments).
[0645] 4. Duration Response Assessing FIXa-R318Y/R338E/R403E/E410N
Coagulant Activity
[0646] Studies were performed to assess the duration of effect of
FIXa-R318Y/R338E/R403E/E410N at 0.5 mg/kg in FIX.sup.-/- mice. Mice
were dosed i.v. at 96 hr, 72 hr, 48 hr, 32 hr, 24 hr, 16 hr, 8 hr,
4 hr, 2 hr, 30 min and 5 min prior to tail cut. In this experiment,
inhibition from the control group was determined where the control
group was set at 0% inhibition. Inhibition of blood loss was
93.26.+-.2.04%, 96.30.+-.3.70%, 85.86.+-.6.52%, 69.4.+-.9.92%,
89.05.+-.3.69%, 78.48.+-.8.71%, 63.33.+-.6.70%, 47.97.+-.10.07%,
3.1.+-.8.22%, -13.52.+-.10.59% and -12.82.+-.7.31% at 5 min, 30
min, 2, 4, 8, 16, 24, 32, 48, 72 and 96 hr, respectively from
vehicle control (Mean and SEM, n=8-45 mice, from 4
experiments).
[0647] Note on the FIX.sup.-/- Mice:
[0648] The FIX knockout colony of mice was generated by in vitro
fertilization using cryo-preserved sperm from male FIX knock out
mice. All offspring were genotyped using PCR-based protocols to
select those animals that contained a FIX knock-out allele. Further
crossings of these animals and their offspring (after PCR-based
genotyping) produced FIX knock-out animals (i.e., hemizygous males
and homozygous females because the FIX gene is on the X
chromosome), as confirmed by PCR. After PCR confirmation of the
genotype of all members of this initial FIX colony, PCR
confirmation of all colony offspring was ceased since legitimate
knock-out animals can only produce knock-out offspring. "Retired
breeders" from the colony were, however, genotyped on several
occasions. Approximately 7 months after genotyping of all colony
offspring was ceased, genotyping of retired breeders clearly
indicated the presence of non-knock-out (or wild-type) animals in
the colony. Based on this result, all members of the knock-out
colony were genotyped and any non-knock-out animals were identified
and eliminated from the colony. The results of the colony
genotyping indicated that 19% of the male mice were wild type and
4% of the male animals were ambiguous due to poor DNA preparations.
Both the wild type and "ambiguous" males (and females) were
eliminated from the colony.
[0649] Thus, the FIX knockout colony was contaminated at some point
with one or more non-knock-out animals and therefore contained a
small fraction of non-knock out animals that increased over time
until between 19-23% of the males in the colony contained a wild
type FIX gene (in vivo experiments use male mice only). With
respect to the FIX data generated and reported in this application,
all of the in vitro data is unaffected. With respect to in vivo
data, it is assumed and expected that the contamination affected
all compounds similarly and therefore does not affect either the
rank order of variants or their comparison to BeneFIX. Since the
contaminating animals already had endogenous FIX, they would lose
much less blood in the efficacy and duration experiments than true
hemophilic animals and would benefit much less from administration
of exogenous FIX, therefore increasing the "spread" or variability
of data for all compounds. The contamination also could make all
the compounds appear slightly less potent than they actually are,
but their ratio to BeneFIX should not be altered (i.e., the potency
and duration advantage of our lead molecules should be
unaffected).
B. In Vivo Assessment of Wild-Type FIX Procoagulant Activity--New
Colony Data
[0650] The data described below comes from a new colony, rebuilt
from the confirmed FIX -/- mice described above. Mice were double
confirmed by genotyping before being used as breeders. All data
described below comes from mice born from breeding units where
parents have been double confirmed. All replacement breeders are
also double confirmed as FIX -/- prior to initiation of new
breeding units.
[0651] Male FIX.sup.-/- mice were anesthetized by intraperitoneal
administration of a ketamine/xylazine cocktail (45 mg/ml and 3.6
mg/ml in saline) and placed on a heated platform (39.degree. C.) to
ensure there was no drop in body temperature. The procedure room
was kept at a temperature of 82.degree. F. Ten minutes prior to
tail cut the tail was immersed in 10 mL of pre-warmed PBS (15 mL
centrifuge tube; 39.degree. C.). Seven to fifteen mice were
injected with recombinant human FIX (Benefix.RTM. Coagulation
Factor IX (Recombinant), Wyeth) or modified FIX polypeptides
diluted in a buffer that was the same as that of Benefix.RTM.
Coagulation Factor IX (Recombinant) (0.234% sodium chloride, 8 mM
L-histidine, 0.8% sucrose, 208 mM glycine, 0.004% polysorbate 80)
via the tail vein in a single injection. A negative control group
of mice received buffer only. In instances where the injection was
missed, the animal was excluded from the study.
[0652] Injection with FIX polypeptide or buffer was made 5 minutes
prior to tail cut. The tail cut was made using a razor blade 5 mm
from the end of the tail and blood was collected into PBS for a
period of 20 minutes. At the end of the collection period, total
blood loss was assessed. The collection tubes were mixed and a 1 ml
aliquot of each sample was taken and assayed for hemoglobin
content. Triton X-100 was diluted 1 in 4 in sterile water and 100
was added to the 1 mL samples to cause hemolysis. The absorbance of
the samples was then measured at a wavelength of 546 nm. To
calculate the amount of blood lost, the absorbance was read against
a standard curve generated by measuring the absorbance at 546 nm of
known volumes of murine blood, diluted in PBS and hemolyzed as
above with Triton X 100. Values are expressed as Mean.+-.SEM.
[0653] 1. Dose Response Studies Assessing FIX Coagulant
Activity
[0654] Dose response studies to assess the coagulant activity of
Benefix.RTM. Coagulation Factor IX (Recombinant) and FIX
polypeptides at varying doses in FIX.sup.-/- mice were performed.
In these experiments ED.sub.50 values were calculated using
non-linear regression and are shown in Table 29 below.
TABLE-US-00030 TABLE 29 Dose Response ED.sub.50 values Average
Mutation (Chymotrypsin n/group/ N ED50 Mutation numbering) expt
(expts) (mg/kg) BeneFIX BeneFIX 10-14 2 0.4 WT Catalyst Biosciences
WT 8-15 4 1.6 T148A T[148]A 10-15 2 1.0 R318Y/R338E/E410N
R150Y/R170E/E240N 10-13 2 0.14 R318Y/R403E/E410N R150Y/R233E/E240N
13-15 2 0.095 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N 7-14
6 0.02 D104N/K106S/Y155F/R318Y/ D[104]N/K[106]S/Y[155]F/ 9-14 4
0.05 R338E/R403E/E410N R150Y/R170E/R233E/E240N T343R T175R 9-15 4
0.9 Y155F/K228N/R318Y/R338E/ Y[155]F/K63N/R150Y/R170E/ 10-14 2 0.08
R403E/E410N R233E/E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/E240N 9-18 3 1.0 K247N/N249S/R318Y/R338E/
K82N/N84S/R150Y/R170E/ 9-14 4 0.06 R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 9-15 4 0.03
R338E/R403E/E410N R170E/R233E/E240N A103N/N105S/K247N/N249S/
A[103]N/N[105]S/K82N/N84S/ 8-10 2 0.08 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N D104N/K106S/Y155F/K247N/
D[104]N/K[106]S/Y[155]F/ 12-15 2 0.055 N249S/R318Y/R338E/R403E/
K82N/N84S/R150Y/R170E/ E410N R233E/E240N R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 10-15 2 0.055 D104N/K106S/Y155F/K228N/
D[104]N/K[106]S/Y[155]F/ 10-12 1 1.64 K247N/N249S K63N/K82N/N84S
K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/ 8-15 5 0.08
R338E/R403E/E410N R170E/R233E/E240N D104N/K106S/K228N/K247N/
D[104]N/K[106]S/K63N/K82N/ 13-15 2 0.125 N249S/R318Y/R338E/R403E/
N84S/R150Y/R170E/R233E/ E410N E240N Y155F/K228N/K247N/N249S/
Y[155]F/K63N/K82N/N84S/ 12-15 2 0.035 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N R318Y/R338E/R403E/E410N/
R150Y/R170E/R233E/E240N/ 8-14 3 0.03 T412V T242V
R318Y/R338E/R403E/E410N/ R150Y/R170E/R233E/E240N/ 11-15 2 0.04
T412A T242A K247N/N249S/N260S/R318Y/ K82N/N84S/N95S/R150Y/ 8-15 4
0.26 R338E/R403E/E410N R170E/R233E/E240N Y155F/K247N/N249S/N260S/
Y[155]F/K82N/N84S/N95S/ 13-15 3 0.06 R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N R318Y/R338E/T343R/R403E/
R150Y/R170E/T175R/R233E/ 7-15 5 0.025 E410N E240N
Y155F/R318Y/R338E/T343R/ Y[155]F/R150Y/R170E/T175R/ 10-14 2 0.0045
R403E/E410N R233E/E240N D104N/K106S/R318Y/R338E/
D[104]N/K[106]S/R150Y/R170E/ 10-15 3 0.07 T343R/R403E/E410N
T175R/R233E/E240N R338E/T343R R170E/T175R 11-14 2 0.83
R318Y/R338E/T343R/N346Y/ R150Y/R170E/T175R/N178Y/ 9-13 3 0.03
R403E/E410N R233E/E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 11-15 2 0.145 R338E/R403E R170E/R233E
Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/ 12-15 3 0.08
R403E/E410N R233E/E240N R318Y/R338E/T343R/R403E
R150Y/R170E/T175R/R233E 10-15 2 0.025 Y155F/R318Y/R338E/T343R/
Y[155]F/R150Y/R170E/T175R/ 10-14 2 0.007 R403E R233E
R318Y/R338E/T343R/E410N R150Y/R170E/T175R/E240N 11-15 5 0.13
R318Y/T343R/R403E/E410N R150Y/T175R/R233E/E240N 10-15 2 0.03
Y155F/R318Y/T343R/R403E/ Y[155]F/R150Y/T175R/R233E/ 13-15 2 0.07
E410N E240N R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N 11-15 2
0.045 Y155F/R338E/T343R/R403E/E410N Y[155]F/R170E/T175R/R233E/
10-15 2 0.055 E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 11-15 2 0.04 R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N K247N/N249S/R318Y/R338E/
K82N/N84S/R150Y/R170E/ 11-15 2 0.035 T343R/R403E/E410N
T175R/R233E/E240N K228N/I251S/R318Y/R338E/ K63N/I86S/R150Y/R170E/
10-15 3 0.01 R403E/E410N R233E/E240N Y155F/K228N/I251S/R318Y/
Y[155]F/K63N/I86S/R150Y/ 13-15 2 0.04 R338E/R403E/E410N
R170E/R233E/E240N N260S/R318Y/R338E/T343R/ N95S/R150Y/R170E/T175R/
12-15 2 0.03 R403E/E410N R233E/E240N Y155F/N260S/R318Y/R338E/
Y[155]F/N95S/R150Y/R170E/ 10-15 2 0.02 T343R/R403E/E410N
T175R/R233E/E240N K228N/K247N/N249S/R318Y/ K63N/K82N/N84S/R150Y/
12-15 3 0.03 R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N
Y155F/R338E/T343R/R403E Y[155]F/R170E/T175R/R233E 12-15 1 0.06
R338E/T343R/R403E R170E/T175R/R233E 10-15 2 0.195
Y155F/R338E/T343R/R403E/ Y[155]F/R170E/T175R/R233E/ 12-15 3 0.06
E410S E240S Y155F/N260S/R338E/T343R/ Y[155]F/N95S/R170E/T175R/
12-15 1 0.1 R403E R233E Y155F/I251S/R338E/T343R/
Y[155]F/I86S/R170E/T175R/ 13-15 2 0.145 R403E R233E
R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/ 11-15 2 0.015
E410S E240S Y155F/K247N/N249S/T343R/ Y[155]F/K82N/N84S/T175R/ 12-14
2 0.26 R403E R233E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 10-14 2 0.006 R338E/T343R/R403E
R170E/T175R/R233E K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/
10-13 2 0.009 T343R/R403E T175R/R233E Y155F/K247N/N249S/R338E/
Y[155]F/K82N/N84S/R170E/ 12-13 1 0.2 T343R/R403E/E410N
T175R/R233E/E240N K247N/N249S/R338E/T343R/ K82N/N84S/R170E/T175R/
11-14 1 0.01 R403E/E410N R233E/E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 13-15 2 0.04 R338E R170E
K247N/N249S/R338E/T343R/ K82N/N84S/R170E/T175R/ 10-15 2 0.18
R403E/E410N R233E/E240N Y155F/K247N/N249S/R338E/
Y[155]F/K82N/N84S/R170E/ 12-15 2 0.22 R403E R233E
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 12-15 2 0.12
R338E/T343R/E410N R170E/T175R/E240N K247N/N249S/R318Y/R338E/
K82N/N84S/R150Y/R170E/ 11-14 2 0.12 T343R/E410N T175R/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 10-15 2 0.07
T343R/R403E/E410N T175R/R233E/E240N K247N/N249S/R318Y/T343R/
K82N/N84S/R150Y/T175R/ 14-15 1 0.02 R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 11-14 2 0.065
T343R/R403E T175R/R233E Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 12-15 1 0.25 T343R/E410N T175R/E240N
Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/ 10-15 2 0.125
T343R/R403E T175R/R233E Y155F/K247N/N249S/T343R/
Y[155]F/K82N/N84S/T175R/ 13-14 1 0.1 R403E/E410N R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 13-14 2 0.07
R338E/T343R R170E/T175R Y155F/K247N/N249S/T343R/
Y[155]F/K82N/N84S/T175R/ 11-15 1 0.11 E410N E240N
[0655] 2. Duration Response Assessing Wild-Type FIX Coagulant
Activity
[0656] Studies were performed to assess the duration of effect of
Benefix.RTM. Coagulation Factor IX (Recombinant) at 0.5 mg/kg in
FIX.sup.-/- mice. Mice were dosed intravenously at 48 hr, 32 hr, 24
hr, 16 hr, 8 hr, 4 hr, 2 hr and 5 min prior to tail cut. In this
experiment, inhibition from the control group was determined where
the control group was set at 0% inhibition. Inhibition of blood
loss was 68.6.+-.5.8%, 64.+-.6.98%, 54.7.+-.6.13%, 43.4.+-.6.86%,
13.7.+-.5.53%, 24.9.+-.6.11%, 11.7.+-.4.88% and 5.6.+-.4.17% at 5
min, 2, 4, 8, 16, 24, 32 and 48 hr, respectively from vehicle
control (Mean and SEM, n=10-35 mice, from 3 experiments).
[0657] 3. Duration Response Assessing FIX Polypeptide Procoagulant
Activity
[0658] Studies were performed to assess the duration of effect of
FIX-polypeptides at 0.5 mg/kg in FIX.sup.-/- mice. Mice were dosed
i.v. at 72 hr, 48 hr, 32 hr, 24 hr, 8 hr and 5 min prior to tail
cut, or at 72 hr, 48 hr and 1 hr prior to tail cut. In these
experiments, inhibition from the control group was determined where
the control group was set at 0% inhibition. Inhibition of blood
loss is shown as % inhibition (Mean and SEM) in Table 30.
TABLE-US-00031 TABLE 30 Inhibition of blood loss Mutation
(chymotrypsin n/ N Inhibition (% of vehicle (0) +/- SEM) at each
time point (hrs) numbering) group (expt) 0.08 1 8 24
R150Y/R170E/R233E 24-30 2 85 +/- 3.2 88.8 +/- 2.8 59.5 +/- 7.3
R150Y/R170E/E240N 37-44 3 71.6 +/- 3.9 85.0 +/- 3.8 59.4 +/- 6.8
Y[155]F/R150Y/R170E/E240N 26-29 2 74.2 +/- 6.5 R150Y/R233E/E240N
23-29 2 71.0 +/- 3.7 71.4 +/- 6.6 31.1 +/- 6.1
R150Y/R170E/R233E/E240N 75-86 7 75.9 +/- 2 82.7 +/- 2.6 58 +/- 4.8
Y[155]F/R150Y/R170E/R233E/ 25-30 2 88.5 +/- 1.7 E240N
D[104]N/K[106]S/Y[155]F/ 35-44 3 70.8 +/- 3.0 85.5 +/- 3.5 55.1 +/-
5.4 R150Y/R170E/R233E/E240N T175R 23-28 2 43.7 +/- 6.3 30.9 +/- 6.6
23.8 +/- 3.8 Y[155]F/K63N/R150Y/R170E/ 36-43 3 65.2 +/- 3.0 72.2
+/- 4.5 59.2 +/- 6.5 R233E/E240N K82N/N84S/R150Y/R170E/ 37-41 3
78.7 +/- 2.5 85.9 +/- 2.6 52.5 +/- 5.5 R233E/E240N
Y[155]F/K82N/N84S/R150Y/ 57-65 5 79.1 +/- 2.2 79.5 +/- 2.7 66.7 +/-
4.0 R170E/R233E/E240N D[104]N/K[106]S/Y[155]F/K82N/ 20-29 2 71.2
+/- 4.5 74.2 +/- 6.6 61.2 +/- 7.2 N84S/R150Y/R170E/R233E/ E240N
K82N/N84S/R150Y/R170E/ 23-28 2 76.0 +/- 6.6 E240N
Y[155]F/K82N/N84S/R150Y/ 26-30 2 77.7 +/- 5.1 R170E/E240N
R150Y/R170E/R233E/E240S 35-42 3 79.3 +/- 1.9 75.6 +/- 4.6 51.0 +/-
5.4 K63N/K82N/N84S/R150Y/ 32-38 3 72.6 +/- 2.9 78.6 +/- 3.7 44.2
+/- 7 R170E/R233E/E240N D[104]N/K[106]S/K63N/K82N/ 26-28 2 81.6 +/-
3.5 86.0 +/- 3.6 46.8 +/- 8.0 N84S/R150Y/R170E/R233E/ E240N
Y[155]F/K63N/K82N/N84S/ 23-29 2 85.5 +/- 2.2 75.6 +/- 4.0 70.6 +/-
6.5 R150Y/R170E/R233E/E240N R150Y/R170E/R233E/E240N/ 40-44 3 69.5
+/- 3.2 85.5 +/- 2.6 37.5 +/- 5.1 T242V R150Y/R170E/R233E/E240N/
29-38 3 81.3 +/- 2.5 85.6 +/- 3.3 45.2 +/- 6.2 T242A
K82N/N84S/N95S/R150Y/R170E/ 20-28 2 46.4 +/- 6.6 37.7 +/- 7.5 4.0
+/- 2.6 R233E/E240N Y[155]F/K82N/N84S/N95S/ 37-43 3 72.2 +/- 4.4
69.1 +/- 5.4 47.0 +/- 6.1 R150Y/R170E/R233E/E240N
R150Y/R170E/T175R/R233E/ 32-38 3 80.3 +/- 2.6 78.2 +/- 3.8 68.3 +/-
5.5 E240N Y[155]F/R150Y/R170E/T175R/ 21-27 2 84.8 +/- 2.5 87.8 +/-
2.8 76.6 +/- 4.2 R233E/E240N D[104]N/K[106]S/R150Y/R170E/ 26-30 2
80.4 +/- 2.8 81.5 +/- 4.8 69.5 +/- 7.6 T175R/R233E/E240N
R150Y/R170E/T175R/N178Y/ 35-43 3 76.6 +/- 3.1 85.1 +/- 3.3 43.9 +/-
5.7 R233E/E240N Y[155]F/K82N/N84S/R150Y/ 24-30 2 76.2 +/- 3.0 85.6
+/- 4.7 49.6 +/- 6.5 R170E/R233E K82N/N84S/R150Y/R170E/ 27-29 2
70.0 +/- 5.8 R233E Y[155]F/K82N/N84S/R170E/ 38-44 3 69.8 +/- 4.7
78.4 +/- 4.1 56.4 +/- 5.9 R233E/E240N K82N/N84S/R170E/R233E/ 28-30
2 63.9 +/- 7.2 E240N R150Y/R170E/T175R/R233E 37-43 3 80.0 +/- 2.1
83.5 +/- 3.5 62.1 +/- 5.6 Y[155]F/R150Y/R170E/T175R/ 24-28 2 80.4
+/- 3.0 90.7 +/- 2.1 65.7 +/- 6.6 R233E R150Y/R170E/T175R/E240N
35-44 3 65.5 +/- 4.7 74.1 +/- 5.3 55.8 +/- 5.6
R150Y/T175R/R233E/E240N 29-30 2 74.1 +/- 3.6 77.7 +/- 3.9 55.3 +/-
7.5 Y[155]F/R150Y/T175R/R233E/ 25-29 2 92.7 +/- 2.1 E240N
R170E/T175R/R233E/E240N 26-30 2 67 +/- 5.3 87.4 +/- 4.2 55.9 +/-
8.7 Y[155]F/R170E/T175R/R233E/ 34-43 3 77.8 +/- 4.2 90.8 +/- 2.8
68.6 +/- 5.2 E240N Y[155]F/K82N/N84S/R150Y/ 39-43 3 76.0 +/- 3.0
80.4 +/- 3.3 72.7 +/- 3.8 R170E/T175R/R233E/E240N
K82N/N84S/R150Y/R170E/ 42-44 3 83.0 +/- 2.4 81.0 +/- 2.4 73.8 +/-
5.2 T175R/R233E/E240N K63N/I86S/R150Y/R170E/R233E/ 21-26 2 71.9 +/-
3.6 85.8 +/- 4.0 71.3 +/- 6.8 E240N Y[155]F/K63N/I86S/R150Y/ 26-29
2 82.1 +/- 2.7 83.6 +/- 3.7 65.6 +/- 5.5 R170E/R233E/E240N
N95S/R150Y/R170E/T175R/ 24-29 2 75.5 +/- 4.5 76.6 +/- 4.3 82.2 +/-
5.8 R233E/E240N Y[155]F/N95S/R150Y/R170E/ 21-27 2 85.2 +/- 2.5 89.7
+/- 3.6 46.5 +/- 7.0 T175R/R233E/E240N K63N/K82N/N84S/R150Y/ 34-45
3 83.9 +/- 1.8 79.8 +/- 3.6 75.2 +/- 4.9 R170E/T175R/R233E/E240N
Y[155]F/K63N/K82N/N84S/ 24-26 2 84.6 +/- 3.4
R150Y/R170E/T175R/R233E/ E240N Y[155]F/R170E/T175R/R233E 22-30 2
81.9 +/- 3.6 79.2 +/- 6.2 55.0 +/- 8.0 R170E/T175R/R233E 23-28 2
60.6 +/- 6.4 86.5 +/- 4.3 35.6 +/- 8.3 Y[155]F/R170E/T175R/R233E/
24-27 2 71.2 +/- 4.5 77.8 +/- 5.3 54.6 +/- 8.2 E240S
Y[155]F/N95S/R170E/T175R/ 25-29 2 58.2 +/- 7.9 65.5 +/- 8.3 48.2
+/- 10.0 R233E Y[155]F/I86S/R170E/T175R/ 23-30 2 84.1 +/- 5.1 90.9
+/- 2.7 76.6 +/- 6.4 R233E R150Y/R170E/T175R/R233E/ 27-43 3 80.2
+/- 2.5 87.1 +/- 3.2 76.9 +/- 4.0 E240S Y[155]F/K82N/N84S/T175R/
12-29 2 70.5 +/- 6.9 84.2 +/- 5.4 53.2 +/- 12.3 39.5 +/- 11.1 R233E
Y[155]F/K82N/N84S/R150Y/ 36-41 3 79.6 +/- 3.2 90.5 +/- 2.4 73.8 +/-
4.6 R170E/T175R/R233E K82N/N84S/R150Y/R170E/ 22-28 2 84.3 +/- 3.1
91.8 +/- 1.4 60.1 +/- 6.7 T175R/R233E Y[155]F/K82N/N84S/R170E/
25-30 2 91.1 +/- 1.8 T175R/R233E/E240N K82N/N84S/R170E/T175R/ 25-28
2 82.7 +/- 4.5 R233E/E240N Y[155]F/K82N/N84S/R150Y/ 20-29 2 83.3
+/- 3.9 R170E Y[155]F/K82N/N84S/R150Y/ 24-28 2 43.6 +/- 6.5 T175R
Y[155]F/K82N/N84S/R170E/ 15-30 2 47.2 +/- 8.0 64.7 +/- 9.7 90.8 +/-
4.5 78.4 +/- 7.5 R233E Y[155]F/K82N/N84S/R170E/ 25-27 2 70.5 +/-
7.0 T175R Y[155]F/K82N/N84S/R150Y/ 28-30 2 73.7 +/- 6.7
R170E/T175R/E240N K82N/N84S/R150Y/R170E/ 25-29 2 77.2 +/- 6.0
T175R/E240N Y[155]F/K82N/N84S/R150Y/ 26-28 2 87.6 +/- 2.4
T175R/R233E/E240N K82N/N84S/R150Y/T175R/ 28-30 2 91.3 +/- 2.6
R233E/E240N Y[155]F/K82N/N84S/R170E/ 25-30 2 74.6 +/- 6.4 E240N
Y[155]F/K82N/N84S/R150Y/ 27-30 2 85.2 +/- 4.4 T175R/R233E
K82N/N84S/R150Y/T175R/ 25-30 2 51.9 +/- 8.2 E240N
Y[155]F/K82N/N84S/R170E/ 27-29 2 84.6 +/- 5.0 T175R/R233E
K82N/N84S/R170E/T175R/ 27-29 2 73.0 +/- 6.6 R233E
K82N/N84S/R170E/T175R/ 24-29 2 59.1 +/- 8.0 E240N
Y[155]F/K82N/N84S/T175R/ 28-30 2 86.5 +/- 3.9 R233E/E240N
K82N/N84S/T175R/R233E/ 25-29 2 59.2 +/- 8.2 E240N
Y[155]F/T175R/R233E/E240N 24-28 2 78.7 +/- 4.9
Y[155]F/K82N/N84S/R150Y/ 28-30 2 82.3 +/- 5.4 R170E/T175R
K82N/N84S/R150Y/R170E/ 37-43 3 79.3 +/- 4.2 T175R R170E/T175R/E240N
37-41 3 66.6 +/- 5.9 R150Y/T175R/E240N 24-28 2 83.5 +/- 5.1
K63N/R150Y/R170E/T175R/ 23-29 2 84.5 +/- 3.1 R233E/E240N
K63N/K82N/N84S/R150Y/ 22-28 2 81.9 +/- 4.1 R170E/T175R/R233E
Inhibition (% of vehicle (0) +/- SEM) at Mutation (chymotrypsin
each time point (hrs) numbering) 32 48 72 R150Y/R170E/R233E 71.8
+/- 7.0 40.2 +/- 7.8 7.8 +/- 5.2 R150Y/R170E/E240N 55.3 +/- 6.1
21.0 +/- 6.2 27.7 +/- 7.3 Y[155]F/R150Y/R170E/E240N 56.8 +/- 9.0
15.6 +/- 8.2 R150Y/R233E/E240N 15.8 +/- 4.3 4.8 +/- 5.4 -0.4 +/-
2.9 R150Y/R170E/R233E/E240N 63.6 +/- 4.4 31.1 +/- 4.9 3.5 +/- 2.7
Y[155]F/R150Y/R170E/R233E/ 22.2 +/- 8.2 -17.6 +/- 3.6 E240N
D[104]N/K[106]S/Y[155]F/ 48.3 +/- 7.2 27.3 +/- 5.7 12.1 +/- 3.0
R150Y/R170E/R233E/E240N T175R 12.3 +/- 6.1 14.8 +/- 7.1 3.4 +/- 3.1
Y[155]F/K63N/R150Y/R170E/ 42.4 +/- 8.3 41.2 +/- 7.6 4.7 +/- 5.6
R233E/E240N K82N/N84S/R150Y/R170E/ 49.9 +/- 6.8 31.4 +/- 5.9 5.0
+/- 4.2 R233E/E240N Y[155]F/K82N/N84S/R150Y/ 61.1 +/- 4.8 38.2 +/-
5.2 17.1 +/- 4.0 R170E/R233E/E240N D[104]N/K[106]S/Y[155]F/K82N/
48.7 +/- 8.2 54.1 +/- 7.7 12.3 +/- 6.5 N84S/R150Y/R170E/R233E/
E240N K82N/N84S/R150Y/R170E/ 26.2 +/- 8.7 22.3 +/- 7.1 E240N
Y[155]F/K82N/N84S/R150Y/ 16.0 +/- 7.3 -2.2 +/- 4.3 R170E/E240N
R150Y/R170E/R233E/E240S 48.3 +/- 6.5 12.3 +/- 5.3 -5.6 +/- 2.4
K63N/K82N/N84S/R150Y/ 53.9 +/- 7.1 42.9 +/- 6.9 10.4 +/- 5.4
R170E/R233E/E240N D[104]N/K[106]S/K63N/K82N/ 59.7 +/- 7.7 33.8 +/-
8.3 26.2 +/- 5.8 N84S/R150Y/R170E/R233E/ E240N
Y[155]F/K63N/K82N/N84S/ 58.4 +/- 6.3 27.0 +/- 7.7 14.1 +/- 7.8
R150Y/R170E/R233E/E240N R150Y/R170E/R233E/E240N/ 42.8 +/- 6.2 9.0
+/- 6.6 -3.8 +/- 3.4 T242V R150Y/R170E/R233E/E240N/ 35.6 +/- 6.3
29.3 +/- 6.0 3.7 +/- 3.1 T242A K82N/N84S/N95S/R150Y/R170E/ 16.0 +/-
4.7 0.08 +/- 3.8 -6.1 +/- 2.4 R233E/E240N Y[155]F/K82N/N84S/N95S/
44.3 +/- 6.2 27.0 +/- 6.4 8.1 +/- 5.3 R150Y/R170E/R233E/E240N
R150Y/R170E/T175R/R233E/ 69.4 +/- 6.0 23.2 +/- 7.2 4.9 +/- 5.8
E240N Y[155]F/R150Y/R170E/T175R/ 66.7 +/- 6.6 56.8 +/- 8.0 8.2 +/-
8.0 R233E/E240N D[104]N/K[106]S/R150Y/R170E/ 60.4 +/- 7.9 54.8 +/-
6.7 12.8 +/- 6.3 T175R/R233E/E240N R150Y/R170E/T175R/N178Y/ 47.9
+/- 6.8 14.9 +/- 6.2 -12.1 +/- 2.9 R233E/E240N
Y[155]F/K82N/N84S/R150Y/ 61.1 +/- 7.4 46.0 +/- 6.9 0.4 +/- 4.9
R170E/R233E K82N/N84S/R150Y/R170E/ 18.8 +/- 6.3 2.1 +/- 2.7 R233E
Y[155]F/K82N/N84S/R170E/ 58.4 +/- 5.8 51.1 +/- 6.6 26.9 +/- 5.4
R233E/E240N K82N/N84S/R170E/R233E/ 16.7 +/- 6.3 -7.0 +/- 2.0 E240N
R150Y/R170E/T175R/R233E 62.6 +/- 5.3 50.5 +/- 5.9 1.9 +/- 4.0
Y[155]F/R150Y/R170E/T175R/ 67.2 +/- 7.3 52.2 +/- 8.2 41.1 +/- 8.3
R233E R150Y/R170E/T175R/E240N 53.1 +/- 6.8 46.4 +/- 6.7 34.9 +/-
6.0 R150Y/T175R/R233E/E240N 39.4 +/- 8.1 24.5 +/- 7.6 6.8 +/- 4.8
Y[155]F/R150Y/T175R/R233E/ 29.3 +/- 6.1 7.7 +/- 3.2 E240N
R170E/T175R/R233E/E240N 47.2 +/- 8.6 33.0 +/- 8.4 9.2 +/- 5.3
Y[155]F/R170E/T175R/R233E/ 61.3 +/- 5.8 35.6 +/- 8.3 5.9 +/- 5.0
E240N Y[155]F/K82N/N84S/R150Y/ 64.2 +/- 5.4 51.4 +/- 5.7 33.1 +/-
7.3 R170E/T175R/R233E/E240N K82N/N84S/R150Y/R170E/ 57.1 +/- 5.7
48.5 +/- 6.1 16.9 +/- 6.8 T175R/R233E/E240N
K63N/I86S/R150Y/R170E/R233E/ 54.8 +/- 7.3 40.3 +/- 10.3 23.1 +/-
10.4 E240N Y[155]F/K63N/I86S/R150Y/ 57.2 +/- 7.9 38.4 +/- 8.9 16.5
+/- 7.7 R170E/R233E/E240N N95S/R150Y/R170E/T175R/ 84.7 +/- 3.9 41.6
+/- 8.6 20.1 +/- 6.0 R233E/E240N Y[155]F/N95S/R150Y/R170E/ 63.3 +/-
8.0 41.6 +/- 8.8 9.1 +/- 6.5 T175R/R233E/E240N
K63N/K82N/N84S/R150Y/ 80.9 +/- 3.0 73.0 +/- 4.4 43.8 +/- 6.6
R170E/T175R/R233E/E240N
Y[155]F/K63N/K82N/N84S/ 70.6 +/- 7.5 50.9 +/- 8.6
R150Y/R170E/T175R/R233E/ E240N Y[155]F/R170E/T175R/R233E 44.4 +/-
9.9 26.8 +/- 6.8 -6.5 +/- 2.7 R170E/T175R/R233E 35.8 +/- 8.5 18.9
+/- 6.8 12.1 +/- 6.0 Y[155]F/R170E/T175R/R233E/ 58.3 +/- 8.1 21.9
+/- 7.1 -11.0 +/- 3.4 E240S Y[155]F/N95S/R170E/T175R/ 29.3 +/- 9.3
21.0 +/- 6.7 -14.8 +/- 5.3 R233E Y[155]F/I86S/R170E/T175R/ 62.4 +/-
6.7 55.2 +/- 7.9 23.7 +/- 6.5 R233E R150Y/R170E/T175R/R233E/ 67.9
+/- 5.6 48.3 +/- 5.5 21.0 +/- 5.0 E240S Y[155]F/K82N/N84S/T175R/
18.0 +/- 7.3 17.0 +/- 5.4 -7.4 +/- 3.1 R233E
Y[155]F/K82N/N84S/R150Y/ 75.0 +/- 5.0 74.4 +/- 4.7 27.5 +/- 6.5
R170E/T175R/R233E K82N/N84S/R150Y/R170E/ 54.0 +/- 8.1 43.6 +/- 8.8
35.7 +/- 8.7 T175R/R233E Y[155]F/K82N/N84S/R170E/ 22.7 +/- 6.6 12.8
+/- 6.2 T175R/R233E/E240N K82N/N84S/R170E/T175R/ 67.1 +/- 7.7 21.6
+/- 8.0 R233E/E240N Y[155]F/K82N/N84S/R150Y/ 47.8 +/- 7.0 19.4 +/-
6.2 R170E Y[155]F/K82N/N84S/R150Y/ 4.9 +/- 4.6 7.2 +/- 1.9 T175R
Y[155]F/K82N/N84S/R170E/ 49.2 +/- 11.5 19.7 +/- 7.9 -5.8 +/- 4.2
R233E Y[155]F/K82N/N84S/R170E/ 34.0 +/- 7.4 27.9 +/- 6.4 T175R
Y[155]F/K82N/N84S/R150Y/ 30.1 +/- 8.4 43.1 +/- 7.9
R170E/T175R/E240N K82N/N84S/R150Y/R170E/ 29.5 +/- 7.2 29.0 +/- 5.5
T175R/E240N Y[155]F/K82N/N84S/R150Y/ 42.6 +/- 8.6 14.5 +/- 6.4
T175R/R233E/E240N K82N/N84S/R150Y/T175R/ 52.4 +/- 7.7 6.6 +/- 4.5
R233E/E240N Y[155]F/K82N/N84S/R170E/ 30.1 +/- 7.1 12.4 +/- 6.3
E240N Y[155]F/K82N/N84S/R150Y/ 31.1 +/- 7.8 -7.9 +/- 2.6
T175R/R233E K82N/N84S/R150Y/T175R/ 9.4 +/- 4.9 3.2 +/- 4.5 E240N
Y[155]F/K82N/N84S/R170E/ 26.8 +/- 8.5 10.9 +/- 6.9 T175R/R233E
K82N/N84S/R170E/T175R/ 27.3 +/- 7.7 23.4 +/- 5.6 R233E
K82N/N84S/R170E/T175R/ 29.6 +/- 7.4 12.2 +/- 5.2 E240N
Y[155]F/K82N/N84S/T175R/ 34.6 +/- 8.1 -2.3 +/- 4.0 R233E/E240N
K82N/N84S/T175R/R233E/ 1.0 +/- 4.0 -7.3 +/- 2.8 E240N
Y[155]F/T175R/R233E/E240N -5.7 +/- 2.8 -4.2 +/- 3.7
Y[155]F/K82N/N84S/R150Y/ 64.6 +/- 7.4 41.4 +/- 7.7 R170E/T175R
K82N/N84S/R150Y/R170E/ 47.7 +/- 5.3 20.9 +/- 5.5 T175R
R170E/T175R/E240N 31.5 +/- 6 10.4 +/- 3.6 R150Y/T175R/E240N 36.7
+/- 8.9 20.0 +/- 6.7 K63N/R150Y/R170E/T175R/ 66.3 +/- 7.8 41.2 +/-
8.5 R233E/E240N K63N/K82N/N84S/R150Y/ 62.2 +/- 8.2 28.6 +/- 8.0
R170E/T175R/R233E
Example 8
Determination of the Functional Cofactor Binding (K.sub.D-app) of
FIXa for its Cofactor, Factor VIIIa
[0659] The functional cofactor binding (K.sub.app) of the FIXa
variants for the cofactor Factor VIIIa (FVIIIa) in the presence or
saturating substrate, Factor X (FX), was assessed indirectly in a
fluorogenic assay by assaying for the activity of FXa, generated
upon activation by FIXa, on the synthetic substrate Spectrafluor
FXa. A range of FVIIIa concentrations were used to calculate the
apparent kinetic rate constant (K.sub.D-app) where the cofactor
(FVIIIa) was in excess by at least a 1000-fold over the
concentration of the activating protease (FIXa). The experiment was
designed to be a variation of the assay described in Example 4
(Determination of the Catalytic Activity of FIXa for its Substrate,
Factor X) where the cofactor (FVIIIa) at various concentrations is
preincubated with FIXa in the presence of phospholipid vesicles
forming the tenase (Xase) complex prior to assessing the catalytic
activity with saturating levels of the substrate, FX. Briefly,
activated and active site titrated FIXa was incubated in a
calcium-containing buffer with phospholipid vesicles while
separately recombinant FVIII is activated (to FVIIIa) with
alpha-thrombin. The activity of alpha-thrombin was then quenched by
the addition of a highly specific thrombin inhibitor, hirudin,
prior to initiating the assay. FIXa variants were then mixed with
various concentrations of FVIIIa to form the Xase complex and
subsequently mixed with saturating concentrations of FX and the
fluorescent substrate, Spectrafluor FXa
(CH.sub.3SO.sub.2-D-CHA-Gly-Arg-AMC) to initiate the assay. The
release of the free fluorophore, AMC (7-amino-4-methylcoumarin)
following catalysis of Spectrafluor FXa by FXa was then assessed
continuously over a time period, and the kinetic rate constants of
the FIXa variants determined.
A. Assay Protocol
[0660] For assays evaluating the kinetic rate of FX activation by
FIXa in the presence of various FVIIIa concentrations and
phospholipids, recombinant FVIII (Kogenate FS.RTM.; Bayer
healthcare) was first resuspended in 1 mL of the provided diluent.
The molar concentration of FVIII was then determined by absorbance
at 280 nm using an extinction coefficient of 1.567 mg.sup.-1 mL
cm.sup.-1 and a molecular weight of 163.6 kDa. The FIX variants
were expressed, purified, activated and active site titrated as
described in Examples 1-3, above. FIXa variants were then serially
diluted to a concentration of 8 pM (4.times.) in a 1 mL volume of
1.times. Buffer A (20 mM Hepes/150 mM NaCl/5 mM CaCl.sub.2/0.1%
BSA/0.1% PEG-8000, pH 7.4). In preparation for activation of FVIII
to FVIIIa in the presence phospholipids, alpha-thrombin
(Heamatologic Technologies, Inc.) and hirudin (American
Diagnostica) were each diluted from the manufacturer's stock
concentrations 1:100 in 1.times. Buffer A. Reconstituted FVIII was
further diluted to a concentration of 1600 nM (4.times. of the top
dose) in a 1.6 mL volume of 1.times. Buffer A containing 400 .mu.M
freshly resuspended phospholipids (75% phosphatidylcholine (PC)/25%
phosphatidylserine (PS); PS/PC vesicles .about.120 nm in diameter;
Avanti Polar Lipids). FVIII was activated to FVIIIa by mixing the
above FVIII/PC/PS solution with a final concentration of 15 nM
alpha-thrombin solutions followed by 15 minutes of incubation at
25.degree. C. Activation reactions were subsequently quenched by
the addition of hirudin to a final concentration of 150 nM for 5
min at 25.degree. C. prior to initiating a dilution series of
1.5-fold in a 12-channel deep-well polypropylene plate with a final
volume of 0.5 mL of the activated FVIIIa into 1.times. Buffer A
containing 400 .mu.M PC/PS vesicles. The final concentrations of
FVIIIa (4.times.) were 1600 nM, 1066.7 nM, 711.1 nM, 474.1 nM,
316.1 nM, 210.7 nM, I40.5 nM, 93.6 nM, 62.43 nM, 41.6 nM. 27.8 nM
and 0 nM for a 12-point assay or for an alternative 8-point assay
with a 2-fold dilution series; 1600 nM, 600 nM, 400 nM, 200 nM, 100
nM, 50 nM, 25 nM and 0 nM. The dilution series of FVIIIa was
subsequently mixed 1:1 with the 4.times.FIXa dilutions (12.5 .mu.L
each) in a 96-well half-area black assay plate according to a
predefined plate map (4 FIXa variants/plate) and preincubated 15
min at 25.degree. C. to form Xase complexes with varied
concentrations of FVIIIa. Final 2.times. solutions (25 .mu.L) were
as follows: 4 .mu.M FIXa variant, 1600-0 nM FVIIIa, 200 .mu.M PC/PS
vesicles, 7.5 nM alpha-thrombin (inhibited) and 75 nM hirudin.
[0661] A solution of 1000 nM (2.times.) active site titrated and
DFP/EGR-cmk treated FX (see Example 2, above) was prepared in 20 mL
of 1.times. Buffer A containing 1.0 mM Spectrafluor Xa substrate
providing a sufficient volume for 4 assays. This represented a
2.times. saturating concentration of FX that would be at least
5-20-fold above the K.sub.M values reported in Example 4, Table 16.
Assay reactions were typically initiated using a BioMek FX liquid
handling system programmed to dispense 25 .mu.L of the
FX/Spectrafluor Xa dilutions into 4 assay plates containing 25
.mu.L of each FIXa variant and FVIIIa dilution (Xase complexes).
The final concentrations of the reagents in the assay were as
follows: 2 pM FIXa, 400-0 nM 100 .mu.M PC/PS vesicles, 0.5 mM
Spectrafluor Xa, 3.8 nM alpha-thiombin (inhibited), 38 nM hirudin
and FX at 500 nM. Reactions were monitored in a SpectraMax
fluorescence plate reader for 30 mM at 37.degree. C. A standard
curve of free AMC served as the conversion factor for RFU to .mu.M
in the subsequent data analysis calculations using a dose range
that covered 0 .mu.M to 100 .mu.M AMC.
B. Data Analysis
[0662] To determine functional affinity of FIXa variants for FVIIIa
based on their catalytic activity, raw data collected with the
SoftMax Pro application (Molecular Devices) were exported as .TXT
files. Further non-linear data analyses were performed directly
within the ActivityBase software package using the XE Runner data
analysis module (IDBS Software). Data analyses were essentially as
described in Example 4B with minor modifications. The Abase
template was set up to automatically fit the parabolic reaction
velocities (.mu.M/sec.sup.2) of the tested FIXa variants at each
FVIIIa concentration to the function of a standard rectangular
hyperbola (i.e. Michaelis Menten equation) given by equation (1) to
yield the fit values for V.sub.max and K.sub.D-app.
Reaction Velocity ( M / sec 2 ) = V max [ S 0 ] K D - app + [ S 0 ]
Equation ( 1 ) ##EQU00007##
[0663] Table 31 sets forth the functional affinity (K.sub.D-app)
for each of the FIXa variants assayed. Also assayed were
recombinant wild-type FIXa (termed Catalyst Biosciences WT;
generated as described above in Example 1), plasma purified FIXa
(Haematologic Technologies, Inc.), and BeneFIX.RTM. (Coagulation
Factor IX (Recombinant); Wyeth). Table XX presents the results
expressed as the kinetic constant for affinity, K.sub.D-app (nM),
and also as ratio of the functional affinity of the wild-type FIXa
compared to that of the FIXa variant, wherein the functional
affinity of each FIXa variant is defined by the K.sub.D-app (nM)
value for activation of the substrate, FX. Where the activity of
the FIXa variant was compared to wild-type FIXa, it was compared to
a recombinant wild-type FIXa polypeptide that was expressed and
purified using the same conditions as used for the variant FIXa
polypeptides to ensure that any differences in activity were the
result of the mutation(s), and not the result of differences in,
for example, post-translational modifications associated with
different expression systems. Thus, the wild-type FIXa polypeptide
used for comparison was the recombinant wild-type FIXa generated
from cloning the FIX gene set forth in SEQ ID NO:1 and expressed
from CHOX cells as a polypeptide with an amino acid sequence set
forth in SEQ ID NO:3, as described in Example 1 (i.e. Catalyst
Biosciences WT FIX polypeptide). The standard deviation (S.D.),
coefficient of variation (as a percentage; % CV) and the number of
assays performed (n) also are provided.
[0664] While some variants showed similar to wild-type affinities
or nominal increases in K.sub.D-app (e.g. FIXa-R318Y/R338E and
FIXa-R318Y/R338E/R403E/E410N) several variants showed marked
increases in functional affinity with greater than 6-10 fold
increases in K.sub.D-app. Variants with combinations of the R338E,
T343R and E410N mutations showed the greatest improvements in
functional affinity. For instance, FIXa-R338E/T343R,
FIXa-R318Y/R338E/T343R/E410N, FIXa-R318Y/R338E/E410N,
FIXa-Y155F/K247N/N249S/R318Y/R338E/T343R/R403E/E410N,
FIXa-R338E/E410N and FIXa-K228N/247N/N249S/R318Y/R338E/T343R/E410N
are among this group.
TABLE-US-00032 TABLE 31 Functional Cofactor Affinity of FIXa
variants (K.sub.D-app) Mutation (Mature FIX Mutation (Chymotrypsin
K.sub.D-app .+-.S.D. K.sub.D-WT/ Numbering) Numbering) (nM) (nM) %
CV K.sub.D-mut n BeneFIX Benefix .RTM. Coagulation BeneFIX Benefix
.RTM. Coagulation 90.2 13.5 15% 1.1 4 FIX (T148A) FIX (T[148]A)
Plasma Purified FIXa Plasma Purified FIXa 101.6 5.8 6% 0.9 3
Catalyst Biosciences WT Catalyst Biosciences WT 95.5 4.6 5% 1.0 2
T148A T[148]A 79.7 27.1 34% 1.2 2 D104N/K106S/I251S
D[104]N/K[106]S/I86S 305.5 119.5 39% 0.3 2 A262S A95bS 94.1 18.3
19% 1.0 2 E410N E240N 74.2 0.6 1% 1.3 2 E239N E74N 77.3 40.6 53%
1.2 2 T241N/H243S T76N/H78S 75.5 26.2 35% 1.3 2 S319N/L321S
S151N/L153S 52.4 0.7 1% 1.8 2 R318E R150E 67.0 5.2 8% 1.4 2 R318Y
R150Y 192.0 55.2 29% 0.5 2 R312Q R143Q 45.2 5.6 12% 2.1 2 R312A
R143A 52.9 5.9 11% 1.8 2 R312Y R143Y 85.2 36.5 43% 1.1 2 R312L
R143L 68.9 15.6 23% 1.4 2 V202Y V38Y 61.5 3.5 6% 1.6 2 D203Y D39Y
77.4 11.8 15% 1.2 2 A204M A40M 60.6 9.0 15% 1.6 2 K400A/R403A
K230A/R233A 129.5 13.4 10% 0.7 2 K400E/R403E K230E/R233E 298.0 58.0
19% 0.3 2 R403E R233E 654.0 131.6 20% 0.1 3 K400A K230A 98.9 7.2 7%
1.0 2 K293A K126A 86.6 4.0 5% 1.1 2 R338E R170E 43.0 7.2 17% 2.2 2
R338E/R403E R170E/R233E 183.0 42.4 23% 0.5 2 R338E/E410N
R170E/E240N 4.1 1.4 33% 23.5 3 R338E/R403E/E410N R170E/R233E/E240N
54.9 3.0 6% 1.7 2 R318Y/R338E/R403E R150Y/R170E/R233E 340.0 244.7
72% 0.3 2 R403E/E410N R233E/E240N 910.5 197.3 22% 0.1 2
R318Y/R338E/E410N R150Y/R170E/E240N 7.7 4.6 60% 12.4 17
D104N/K106S/R318Y/R338E/ D[104]N/K[106]S/R150Y/R170E/ 12.4 n.d.
n.d. 7.7 1 E410N E240N R318Y/R338E/R403E/E410N
R150Y/R170E/R233E/E240N 47.0 12.4 26% 2.0 12
D104N/K106S/Y155F/R318Y/ D[104]N/K[106]S/Y[155]F/ 61.6 n.d. n.d.
1.6 1 R338E/R403E/E410N R150Y/R170E/R233E/E240N K316N K148N 66.4
8.3 13% 1.4 2 H257E H92E 81.3 2.5 3% 1.2 2 E410S E240S 99.6 2.0 2%
1.0 2 N346D N178D 126.5 3.5 3% 0.8 2 N346Y N178Y 65.7 n.d. n.d. 1.5
1 Y345A Y177A 29.6 2.3 8% 3.2 2 T343R T175R 58.4 16.2 28% 1.6 3
T343R/Y345T T175R/Y177T 68.1 n.d. n.d. 1.4 1 R318Y/R338E
R150Y/R170E 28.9 n.d. n.d. 3.3 1 Y259F/K265T/Y345T Y94F/K98T/Y177T
115.2 n.d. n.d. 0.8 1 K228N/I251S K63N/I86S 89.7 1.3 1% 1.1 2
Y155F/K228N/R318Y/R338E/ Y[155]F/K63N/R150Y/R170E/ 31.2 4.8 15% 3.1
2 R403E/E410N R233E/E240N I251S/R318Y/R338E/R403E/
I86S/R150Y/R170E/R233E/ 62.7 0.6 1% 1.5 2 E410N E240N
D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/R150Y/ 54.7 19.9 36%
1.7 5 R338E/R403E/E410N R170E/R233E/E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/E240N 5.7 1.1 20% 16.7 3 D104N/K106S/I251S/R318Y/
D[104]N/K[106]S/I86S/R150Y/ 12.4 1.1 9% 7.7 2 R338E/E410N
R170E/E240N K247N/N249S/R318Y/R338E/ K82N/N84S/R150Y/R170E/ 68.6
17.3 25% 1.4 3 R403E/E410N R233E/E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 45.8 4.6 10% 2.1 7 R338E/R403E/E410N
R170E/R233E/E240N A103N/N105S/K247N/N249S/
A[103]N/N[105]S/K82N/N84S/ 93.1 8.4 9% 1.0 2
R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
D104N/K106S/K247N/N249S/ D[104]N/K[106]S/K82N/N84S/ 87.4 10.3 12%
1.1 2 R318Y/R338E/R403E/E410N R150Y/R170E/R233E/E240N
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 7.4 n.d. n.d.
12.8 1 R338E/E410N R170E/E240N R318Y/R338E/R403E/E410S
R150Y/R170E/R233E/E240S 53.1 10.4 20% 1.8 3 R318Y/R338E/E410S
R150Y/R170E/E240S 6.8 0.2 3% 14.1 3 K228N/K247N/N249S
K63N/K82N/N84S 113.0 0.0 0% 0.8 2 K228N/K247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/R170E/ 100.5 n.d. n.d. 0.9 1 R338E/R403E/E410N
R233E/E240N R318Y/R338E/R403E/E410N/ R150Y/R170E/R233E/E240N/ 55.0
n.d. n.d. 1.7 1 T412V T242V R318Y/R338E/E410N/T412V
R150Y/R170E/E240N/T242V 8.9 n.d. n.d. 10.7 1
R318Y/R338E/N346D/R403E/ R150Y/R170E/N178D/R233E/ 109.7 44.3 40%
0.9 2 E410N E240N K247N/N249S/N260S K82N/N84S/N95S 147.0 60.8 41%
0.6 2 Y155F/K247N/N249S/N260S Y[155]F/K82N/N84S/N95S 167.0 97.7 58%
0.6 2 D104N/K106S/K247N/N249S/ D[104]N/K[106]S/K82N/N84S/ 330.0
319.6 97% 0.3 2 N260S N95S D104N/K106S/Y155F/K247N/
D[104]N/K[106]S/Y[155]F/K82N/ 142.0 73.5 52% 0.7 2 N249S/N260S
N84S/N95S K247N/N249S/N260S/R318Y/ K82N/N84S/N95S/R150Y/R170E/ 65.0
10.8 17% 1.5 2 R338E/R403E/E410N R233E/E240N
R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/ 14.5 4.0 28% 6.6
7 E410N E240N R338E/T343R R170E/T175R 3.4 0.6 18% 28.0 2
T343R/N346Y T175R/N178Y 38.6 n.d. n.d. 2.5 1
R318Y/R338E/N346Y/R403E/ R150Y/R170E/N178Y/R233E/ 39.6 n.d. n.d.
2.4 1 E410N E240N R318Y/R338E/T343R/N346Y/ R150Y/R170E/T175R/N178Y/
15.6 0.1 1% 6.1 2 R403E/E410N R233E/E240N T343R/N346D T175R/N178D
78.4 n.d. n.d. 1.2 1 R318Y/R338E/T343R/N346D/
R150Y/R170E/T175R/N178D/ 76.2 n.d. n.d. 1.3 1 R403E/E410N
R233E/E240N R318Y/R338E/T343R/E410N R150Y/R170E/T175R/E240N 6.1
n.d. n.d. 15.7 1 Y155F/R318Y/R338E/T343R/
Y[155]F/R150Y/R170E/T175R/ 7.4 n.d. n.d. 12.8 1 E410N E240N
R318Y/T343R/R403E/E410N R150Y/T175R/R233E/E240N 84.1 17.8 21% 1.1 2
R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N 29.4 n.d. n.d. 3.2
1 Y155F/R338E/T343R/R403E/ Y[155]F/R170E/T175R/R233E/ 28.5 n.d.
n.d. 3.3 1 E410N E240N Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 15.3 1.3 9% 6.3 3 R338E/T343R/R403E/E410N
R170E/T175R/R233E/E240N K228N/K247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/R170E/ 29.1 0.3 1% 3.3 2
R338E/T343R/R403E/E410N T175R/R233E/E240N
Y155F/K228N/K247N/N249S/R318Y/ Y[155]F/K63N/K82N/N84S/R150Y/ 37.0
5.7 16% 2.6 2 R338E/T343R/R403E/E410N R170E/T175R/R233E/E240N
Y155F/R338E/T343R/R403E Y[155]F/R170E/T175R/R233E 72.1 n.d. n.d.
1.3 1 R338E/T343R/R403E R170E/T175R/R233E 55.0 n.d. n.d. 1.7 1
R318Y/R338E/T343R/R403E/ R150Y/R170E/T175R/R233E/ 23.2 n.d. n.d.
4.1 1 E410S E240S Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/
15.4 n.d. n.d. 6.2 1 T343R T175R Y155F/K247N/N249S/R318Y/
Y[155]F/K82N/N84S/R150Y/ 13.9 n.d. n.d. 6.9 1 R338E/T343R/E410N
R170E/T175R/E240N Y155F/K247N/N249S/R338E/ Y[155]F/K82N/N84S/R170E/
24.9 n.d. n.d. 3.8 1 E410N E240N K247N/N249S/R338E/T343R/
K82N/N84S/R170E/T175R/ 14.0 n.d. n.d. 6.8 1 E410N E240N
Y155F/R318Y/R338E/T343R Y[155]F/R150Y/R170E/T175R 8.4 n.d. n.d.
11.3 1 R318Y/R338E/T343R R150Y/R170E/T175R 9.8 n.d. n.d. 9.7 1
Y155F/K247N/N249S/R318Y/ Y[155]F/K82N/N84S/R150Y/ 14.0 n.d. n.d.
6.8 1 R338E/T343R R170E/T175R K247N/N249S/R318Y/R338E/
K82N/N84S/R150Y/R170E/ 14.7 n.d. n.d. 6.5 1 T343R T175R
Y155F/R338E/T343R/E410N Y[155]F/R170E/T175R/E240N 8.5 n.d. n.d.
11.2 1 R338E/T343R/E410N R170E/T175R/E240N 7.5 n.d. n.d. 12.8 1
Y155F/R318Y/T343R/E410N Y[155]F/R150Y/T175R/E240N 38.0 n.d. n.d.
2.5 1 K228N/R150Y/R338E/T343R/ K63N/R150Y/R170E/T175R/ 17.5 n.d.
n.d. 5.4 1 R403E/E410N R233E/E240N K228N/247N/N249S/R318Y/
K63N/K82N/N84S/R150Y/R170E/ 7.8 n.d. n.d. 12.2 1 R338E/T343R/E410N
T175R/E240N
Example 9
Determination of the Clotting Activities of FIX Variants in
Hemophilia B Plasma
[0665] Clotting activities for FIX variants were determine by an
activated partial thromboplastin time (aPTT) assay in human
hemophilia B plasma from a single donor with <1% clotting
activity (George King Bio-Medical, Inc., Overland Park, Kans.) per
the manufacturer's instructions. Briefly, the aPTT assay involves
the recalcification of plasma in the presence of a blend of
purified phospholipids (platelet substitute) and activators (kaolin
and sulphatide). The aPTT assay was performed using the
Dapttin.RTM.TC aPTT reagent (Technoclone GmbH, Vienna, Austria)
essentially as described in the manufacturers' product insert with
FIX variants spiked into the hemophilia B plasma at final
concentrations of 100 nM, 10 nM or 1 nM FIX variant. Briefly, FIX
variants were diluted to 1 .mu.M in 1.times. Buffer A (20 mM
Hepes/150 mM NaCl/0.5% BSA, pH 7.4) based on the active site
titrated zymogen concentration (Example 2). FIX variants were
subsequently serially diluted to 100 nM, 10 nM and 1 nM directly
into citrated human hemophilia B plasma (George King Bio-Medical).
A 100 .mu.L volume of each FIX dilution in plasma was mixed with
100 .mu.L of the Dapttin.RTM.TC aPTT reagent and incubated at
37.degree. C. for 180 seconds. Coagulation was initiated by the
addition of 100 .mu.L of 25 mM calcium (Diagnostica Stago,
Asnieres, France). Coagulation time in seconds was measured using a
STArt4 instrument (Diagnostica Stago, Asnieres, France). Each
experiment represents the average of two independent clotting time
measurements, which typically showed <5% CV.
[0666] Table 32 sets forth the clotting activities for each of the
FIX variants assayed. Also assayed were recombinant wild-type FIX
(termed Catalyst Biosciences WT; generated as described above in
Example 1), and BeneFIX.RTM. (Coagulation Factor IX (Recombinant);
Wyeth). Table XX presents the results expressed as the time to clot
at each of the three tested FIX concentrations; 100 nM, 10 nM and 1
nM, wherein each FIX concentration represents .about.100%,
.about.10% and .about.1% of the normal concentration of FIX in
pooled normal plasma (PNP). Under identical assay conditions, 100%
PNP shows a clotting time of 31.3.+-.2.0 seconds, whereas clotting
times for 10% and 1% dilutions of PNP in hemophilia B plasma are
42.7.+-.1.7 and 55.0.+-.4.7 seconds, respectively (n=4). The time
to clot for the hemophilia B plasma used in these analyses was
evaluated 83.2.+-.9.2 seconds (n=5). A number of tested variants
demonstrated clotting times similar to or slightly prolonged
compared to the wild-type FIXa, where wild-type FIXa polypeptide
used for comparison was the recombinant wild-type FIXa expressed
from CHOX cells as a polypeptide with an amino acid sequence set
forth in SEQ ID NO:3, as described in Example 1 (i.e. Catalyst
Biosciences WT FIX polypeptide). On the other hand, several
variants showed significantly shortened clotting times. Among this
group of variants are FIXa-R318Y/R338E/T343R,
FIXa-R318Y/R338E/E410N, FIXa-R338E/T343R/E410N,
FIXa-R318Y/R338E/T343R/E410N, FIXa-K247N/N249S/R338E/T343R/E410N
and FIXa-K228N/247N/N249S/R318Y/R338E/T343R/E410N.
TABLE-US-00033 TABLE 32 Clotting Activity (aPTT) of FIX Variants in
Hemophilia B Plasma Mutation aPTT aPTT aPTT Mutation (Mature
(Chymotrypsin (100 nM) (10 nM) (1.0 nM) FIX Numbering) Numbering)
(s) .+-.S.D. (s) .+-.S.D. (s) .+-.S.D. n BeneFIX Benefix .RTM.
BeneFIX Benefix .RTM. 35.2 n.d. 47.4 n.d. 63.5 n.d. 1 Coagulation
FIX Coagulation FIX (T148A) (T[148]A) Catalyst Biosciences Catalyst
Biosciences WT 35.5 n.d. 46.9 n.d. 60.6 n.d. 1 WT T148A T[148]A
33.2 n.d. 43.1 n.d. 59.2 n.d. 1 R338E/R403E R170E/R233E 34.3 n.d.
46.2 n.d. 58.8 n.d. 1 R338E/R403E/E410N R170E/R233E/E240N 35.6 n.d.
46.6 n.d. 57.1 n.d. 1 Y155F/R338E/R403E/ Y[155]F/R170E/R233E/ 31.1
n.d. 41.2 n.d. 52.6 n.d. 1 E410N E240N R318Y/R338E/R403E
R150Y/R170E/R233E 41.7 n.d. 52.7 n.d. 68.4 n.d. 1
Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 38.6 n.d. 48.6 n.d. 64.1
n.d. 1 R403E R233E R318Y/R338E/E410N R150Y/R170E/E240N 21.2 n.d.
24.8 n.d. 34.3 n.d. 1 D104N/K106S/R318Y/ D[104]N/K[106]S/R150Y/
24.5 n.d. 30.8 n.d. 40.0 n.d. 1 R338E/E410N R170E/E240N
R318Y/R403E/E410N R150Y/R233E/E240N 46.1 n.d. 61.7 n.d. 78.3 n.d. 1
Y155F/R318Y/R403E/ Y[155]F/R150Y/R233E/ 42.3 n.d. 57.1 n.d. 74.5
n.d. 1 E410N E240N R318Y/R338E/R403E/ R150Y/R170E/R233E/E240N 25.4
1.2 33.0 2.1 43.0 1.1 3 E410N T343R T175R 41.3 2.1 53.3 2.9 67.2
6.2 2 T343R/Y345T T175R/Y177T 46.8 2.8 56.3 9.6 75.5 1.8 2
R318Y/R338E R150Y/R170E 26.7 n.d. 31.5 n.d. 45.3 n.d. 1
Y155F/K228N/R318Y/ Y[155]F/K63N/R150Y/ 35.6 n.d. 45.1 n.d. 60.1
n.d. 1 R338E/R403E/E410N R170E/R233E/E240N D104N/K106S/I251S/R318Y/
D[104]N/K[106]S/I86S/ 36.0 n.d. 46.8 n.d. 61.8 n.d. 1
R338E/R403E/E410N R150Y/R170E/R233E/ E240N I251S/R318Y/R338E/E410N
I86S/R150Y/R170E/ 28.0 n.d. 30.1 n.d. 40.7 n.d. 1 E240N
D104N/K106S/I251S/R318Y/ D[104]N/K[106]S/I86S/ 25.0 n.d. 31.0 n.d.
43.1 n.d. 1 R338E/E410N R150Y/R170E/E240N K247N/N249S/R318Y/
K82N/N84S/R150Y/ 33.7 n.d. 43.8 n.d. 58.4 n.d. 1 R338E/R403E/E410N
R170E/R233E/E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 34.1 n.d.
46.2 n.d. 62.4 n.d. 1 R318Y/R338E/R403E/ R150Y/R170E/R233E/ E410N
E240N A103N/N105S/K247N/ A[103]N/N[105]S/K82N/ 36.1 n.d. 48.1 n.d.
62.6 n.d. 1 N249S/R318Y/R338E/ N84S/R150Y/R170E/ R403E/E410N
R233E/E240N D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 34.8 n.d.
45.6 n.d. 59.3 n.d. 1 K247N/N249S/R318Y/ K82N/N84S/R150Y/
R338E/R403E/E410N R170E/R233E/E240N K247N/N249S/R318Y/
K82N/N84S/R150Y/ 26.1 n.d. 34.3 n.d. 44.7 n.d. 1 R338E/E410N
R170E/E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 24.0 n.d. 29.2
n.d. 41.1 n.d. 1 R318Y/R338E/E410N R150Y/R170E/E240N
R318Y/R338E/R403E/ R150Y/R170E/R233E/ 26.9 n.d. 34.7 n.d. 47.0 n.d.
1 E410S E240S K228N/K247N/N249S K63N/K82N/N84S 44.4 n.d. 57.2 n.d.
70.2 n.d. 1 D104N/K106S/Y155F/ D[104]N/K[106]S/Y[155]F/ 46.9 n.d.
60.0 n.d. 73.6 n.d. 1 K228N/K247N/N249S K63N/K82N/N84S
K228N/K247N/N249S/ K63N/K82N/N84S/ 35.3 5.1 46.1 8.0 60.6 8.9 2
R318Y/R338E/R403E/ R150Y/R170E/R233E/ E410N E240N
D104N/K106S/K228N/ D[104]N/K[106]S/K63N/ 38.4 n.d. 50.1 n.d. 67.1
n.d. 1 K247N/N249S/R318Y/ K82N/N84S/R150Y/ R338E/R403E/E410N
R170E/R233E/E240N Y155F/K228N/K247N/ Y[155]F/K63N/K82N/ 34.9 n.d.
44.7 n.d. 59.1 n.d. 1 N249S/R318Y/R338E/ N84S/R150Y/R170E/
R403E/E410N R233E/E240N R318Y/R338E/R403E/ R150Y/R170E/R233E/ 28.7
n.d. 37.6 n.d. 47.6 n.d. 1 E410N/T412V E240N/T242V
R318Y/R338E/R403E/ R150Y/R170E/R233E/ 30.5 n.d. 40.6 n.d. 52.8 n.d.
1 E410N/T412A E240N/T242A R318Y/R338E/E410N/ R150Y/R170E/E240N/
25.5 n.d. 30.7 n.d. 40.3 n.d. 1 T412V T242V R318Y/R338E/N346D/
R150Y/R170E/N178D/ 42.5 n.d. 54.2 n.d. 68.9 n.d. 1 R403E/E410N
R233E/E240N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 37.8 n.d. 48.9
n.d. 65.2 n.d. 1 N346D/R403E/E410N N178D/R233E/E240N
K247N/N249S/N260S/ K82N/N84S/N95S/ 44.7 n.d. 56.9 n.d. 75.7 n.d. 1
R318Y/R338E/R403E/ R150Y/R170E/R233E/ E410N E240N
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/N95S/ 49.3 n.d. 59.6 n.d. 75.5
n.d. 1 N260S/R318Y/R338E/ R150Y/R170E/R233E/ R403E/E410N E240N
R318Y/R338E/T343R/ R150Y/R170E/T175R/R233E/ 23.7 2.7 29.7 3.3 39.7
6.5 4 R403E/E410N E240N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/
26.2 3.6 32.0 3.9 42.4 1.8 2 T343R/R403E/E410N T175R/R233E/E240N
D104N/K106S/R318Y/ D[104]N/K[106]S/R150Y/ 27.3 n.d. 34.9 n.d. 48.0
n.d. 1 R338E/T343R/R403E/ R170E/T175R/R233E/ E410N E240N
R338E/T343R R170E/T175R 27.9 n.d. 33.8 n.d. 45.1 n.d. 1 T343R/N346Y
T175R/N178Y 40.8 3.8 54.9 0.8 74.9 2.2 2 R318Y/R338E/N346Y/
R150Y/R170E/N178Y/ 28.8 n.d. 41.0 n.d. 54.4 n.d. 1 R403E/E410N
R233E/E240N R318Y/R338E/T343R/ R150Y/R170E/T175R/N178Y/ 24.5 n.d.
32.5 n.d. 41.7 n.d. 1 N346Y/R403E/E410N R233E/E240N T343R/N346D
T175R/N178D 39.9 1.4 51.3 4.8 65.0 4.1 2 R318Y/R338E/T343R/
R150Y/R170E/T175R/ 34.8 n.d. 45.1 n.d. 57.9 n.d. 1
N346D/R403E/E410N N178D/R233E/E240N R318Y/R338E/Y345A/
R150Y/R170E/Y177A/ 41.2 n.d. 47.9 n.d. 61.9 n.d. 1 R403E/E410N
R233E/E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 40.2 n.d. 51.6
n.d. 62.2 n.d. 1 R318Y/R338E/R403E R150Y/R170E/R233E
K247N/N249S/R318Y/ K82N/N84S/R150Y/ 42.0 n.d. 55.6 n.d. 70.3 n.d. 1
R338E/R403E R170E/R233E K247N/N249S/R318Y/ K82N/N84S/R150Y/ 44.6
3.0 57.2 4.2 71.5 6.1 3 R403E/E410N R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 31.0 n.d. 42.1 n.d. 55.6 n.d. 1
R338E/R403E/E410N R170E/R233E/E240N K247N/N249S/R338E/
K82N/N84S/R170E/ 32.7 n.d. 42.2 n.d. 56.2 n.d. 1 R403E/E410N
R233E/E240N R318Y/R338E/T343R/ R150Y/R170E/T175R/ 30.1 n.d. 37.9
n.d. 51.4 n.d. 1 R403E R233E Y155F/R318Y/R338E/
Y[155]F/R150Y/R170E/ 32.0 n.d. 41.5 n.d. 53.7 n.d. 1 T343R/R403E
T175R/R233E R318Y/R338E/T343R/ R150Y/R170E/T175R/E240N 24.7 2.9
27.2 2.9 36.5 3.8 5 E410N Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/
25.9 2.1 28.8 3.5 38.5 4.2 2 T343R/E410N T175R/E240N
R318Y/T343R/R403E/ R150Y/T175R/R233E/ 31.7 n.d. 43.3 n.d. 60.7 n.d.
1 E410N E240N Y155F/R318Y/T343R/ Y[155]F/R150Y/T175R/ 40.3 n.d.
52.0 n.d. 68.7 n.d. 1 R403E/E410N R233E/E240N R338E/T343R/R403E/
R170E/T175R/R233E/ 25.5 n.d. 30.4 n.d. 41.9 n.d. 1 E410N E240N
Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 27.5 n.d. 33.3 n.d. 42.3
n.d. 1 R403E/E410N R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/R150Y/ 24.2 0.9 29.7 1.4 40.5 2.4 5
R318Y/R338E/T343R/ R170E/T175R/R233E/ R403E/E410N E240N
K247N/N249S/R318Y/ K82N/N84S/R150Y/ 28.7 n.d. 36.2 n.d. 50.2 n.d. 1
R338E/T343R/R403E/ R170E/T175R/R233E/ E410N E240N
K228N/I251S/R318Y/ K63N/I86S/R150Y/ 34.5 n.d. 44.9 n.d. 58.2 n.d. 1
R338E/R403E/E410N R170E/R233E/E240N Y155F/K228N/I251S/
Y[155]F/K63N/I86S/ 34.5 n.d. 46.5 n.d. 60.3 n.d. 1
R318Y/R338E/R403E/ R150Y/R170E/R233E/ E410N E240N
N260S/R318Y/R338E/ N95S/R150Y/R170E/T175R/ 31.4 n.d. 41.1 n.d. 55.4
n.d. 1 T343R/R403E/E410N R233E/E240N Y155F/N260S/R318Y/
Y[155]F/N95S/R150Y/ 35.3 0.6 45.3 2.5 59.1 3.2 2 R338E/T343R/R403E/
R170E/T175R/R233E/ E410N E240N K228N/K247N/N249S/
K63N/K82N/N84S/R150Y/ 28.0 2.0 35.5 3.9 47.7 6.0 8
R318Y/R338E/T343R/ R170E/T175R/R233E/ R403E/E410N E240N
Y155F/K228N/K247N/ Y[155]F/K63N/K82N/ 30.7 2.3 40.6 2.0 53.5 2.5 2
N249S/R318Y/R338E/ N84S/R150Y/R170E/ T343R/R403E/E410N
T175R/R233E/E240N Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 29.8 n.d.
37.9 n.d. 50.1 n.d. 1 R403E R233E R338E/T343R/R403E
R170E/T175R/R233E 29.4 n.d. 37.0 n.d. 49.8 n.d. 1
Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 28.3 n.d. 33.3 n.d. 44.4
n.d. 1 R403E/E410S R233E/E240S Y155F/N260S/R338E/
Y[155]F/N95S/R170E/ 40.5 n.d. 52.9 n.d. 70.1 n.d. 1 T343R/R403E
T175R/R233E Y155F/I251S/R338E/T343R/ Y[155]F/I86S/R170E/ 31.9 n.d.
40.1 n.d. 54.5 n.d. 1 R403E T175R/R233E R318Y/R338E/T343R/
R150Y/R170E/T175R/ 27.4 n.d. 34.0 n.d. 43.3 n.d. 1 R403E/E410S
R233E/E240S Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 43.2 n.d. 58.6
n.d. 74.2 n.d. 1 T343R/R403E T175R/R233E Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 32.5 n.d. 41.4 n.d. 55.4 n.d. 1
R318Y/R338E/T343R/ R150Y/R170E/T175R/ R403E R233E
K247N/N249S/R318Y/ K82N/N84S/R150Y/ 30.8 4.2 39.1 6.9 52.5 9.1 2
R338E/T343R/R403E R170E/T175R/R233E Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 27.3 n.d. 34.9 n.d. 47.7 n.d. 1
R338E/T343R/R403E/ R170E/T175R/R233E/ E410N E240N
K247N/N249S/R338E/ K82N/N84S/R170E/ 28.2 n.d. 35.1 n.d. 47.3 n.d. 1
T343R/R403E/E410N T175R/R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 29.6 n.d. 37.4 n.d. 48.7 n.d. 1 R318Y/R338E
R150Y/R170E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 39.6 n.d. 49.7
n.d. 65.0 n.d. 1 R318Y/T343R R150Y/T175R Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 52.2 n.d. 67.9 n.d. 79.9 n.d. 1 R318Y/R403E
R150Y/R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 32.9 n.d. 43.8
n.d. 55.8 n.d. 1 R318Y/E410N R150Y/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 39.2 n.d. 50.4 n.d. 62.6 n.d. 1 R338E/R403E
R170E/R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 27.4 n.d. 31.5
n.d. 41.8 n.d. 1 R338E/T343R R170E/T175R Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 28.7 0.4 32.7 0.1 41.8 0.9 2 R318Y/R338E/T343R/
R150Y/R170E/T175R/ E410N E240N K247N/N249S/R318Y/ K82N/N84S/R150Y/
28.0 0.8 32.7 0.8 42.4 0.3 2 R338E/T343R/E410N R170E/T175R/E240N
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 38.9 n.d. 50.4 n.d. 65.5 n.d.
1 R318Y/T343R/R403E/ R150Y/T175R/R233E/ E410N E240N
K247N/N249S/R318Y/ K82N/N84S/R150Y/ 35.9 4.2 46.6 6.0 60.9 7.8 2
T343R/R403E/E410N T175R/R233E/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 27.1 1.9 31.8 2.0 41.2 0.8 2 R338E/E410N
R170E/E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 44.3 n.d. 60.7
n.d. 75.5 n.d. 1 R318Y/T343R/R403E R150Y/T175R/R233E
K247N/N249S/R318Y/ K82N/N84S/R150Y/ 45.3 n.d. 57.5 n.d. 75.7 n.d. 1
T343R/R403E T175R/R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 44.9
0.1 52.5 3.7 64.9 0.5 2 R318Y/T343R/E410N R150Y/T175R/E240N
K247N/N249S/R318Y/ K82N/N84S/R150Y/ 42.7 n.d. 50.2 n.d. 64.6 n.d. 1
T343R/E410N T175R/E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 31.1
n.d. 40.9 n.d. 56.2 n.d. 1 R338E/T343R/R403E R170E/T175R/R233E
K247N/N249S/R338E/ K82N/N84S/R170E/ 32.0 n.d. 43.2 n.d. 56.1 n.d. 1
T343R/R403E T175R/R233E Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 28.5
n.d. 32.2 n.d. 45.9 n.d. 1 R338E/T343R/E410N R170E/T175R/E240N
K247N/N249S/R338E/ K82N/N84S/R170E/ 25.1 3.9 29.9 5.0 41.1 8.0 2
T343R/E410N T175R/E240N Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 36.7
n.d. 49.3 n.d. 65.4 n.d. 1 T343R/R403E/E410N T175R/R233E/E240N
Y155F/R318Y/R338E/ Y[155]F/R150Y/R170E/ 27.4 1.0 31.4 1.7 40.7 0.4
2 T343R T175R R318Y/R338E/T343R R150Y/R170E/T175R 20.5 n.d. 24.3
n.d. 32.2 n.d. 1 Y155F/R318Y/T343R/ Y[155]F/R150Y/T175R/ 43.4 n.d.
56.1 n.d. 71.3 n.d. 1 R403E R233E Y155F/T343R/R403E/
Y[155]F/T175R/R233E/ 36.1 n.d. 47.5 n.d. 63.0 n.d. 1 E410N E240N
Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 28.0 1.4 32.9 0.8 42.6 0.4 2
R318Y/R338E/T343R R150Y/R170E/T175R K247N/N249S/R318Y/
K82N/N84S/R150Y/ 27.4 1.2 32.7 0.2 42.4 3.1 2 R338E/T343R
R170E/T175R Y155F/K247N/N249S/ Y[155]F/K82N/N84S/ 36.2 4.5 44.8 5.9
54.4 4.2 5 T343R/E410N T175R/E240N Y155F/K247N/N249S/
Y[155]F/K82N/N84S/ 47.2 n.d. 60.7 n.d. 74.2 n.d. 1 R403E/E410N
R233E/E240N Y155F/R338E/T343R/ Y[155]F/R170E/T175R/ 24.9 4.4 27.5
4.4 34.9 4.4 4 E410N E240N R338E/T343R/E410N R170E/T175R/E240N 19.8
n.d. 23.9 n.d. 34.7 n.d. 1 Y155F/R318Y/T343R/ Y[155]F/R150Y/T175R/
41.3 5.7 49.5 6.0 63.4 6.0 2 E410N E240N R318Y/T343R/E410N
R150Y/T175R/E240N 34.5 n.d. 44.8 n.d. 61.0 n.d. 1
K228N/R318Y/R338E/ K63N/R150Y/R170E/T175R/ 23.4 n.d. 28.8 n.d. 38.9
n.d. 1 T343R/R403E/E410N R233E/E240N
K228N/K247N/N249S/ K63N/K82N/N84S/ 28.6 n.d. 37.3 n.d. 47.9 n.d. 1
R318Y/R338E/T343R/ R150Y/R170E/T175R/ R403E R233E K228N/247N/N249S/
K63N/K82N/N84S/R150Y/ 21.4 n.d. 25.8 n.d. 34.3 n.d. 1
R318Y/R338E/T343R/ R170E/T175R/E240N E410N K228N/K247N/N249S/
K63N/K82N/N84S/ 35.4 n.d. 44.0 n.d. 61.4 n.d. 1 R318Y/T343R/R403E/
R150Y/T175R/R233E/ E410N E240N
[0667] Since modifications will be apparent to those of skill in
this art, it is intended that this invention be limited only by the
scope of the appended claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20130177541A9).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20130177541A9).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References