U.S. patent application number 13/808092 was filed with the patent office on 2013-07-04 for treatment of t-cell mediated immune disorders.
This patent application is currently assigned to MESOBLAST, INC.. The applicant listed for this patent is Silviu Itescu, Michael David Schuster. Invention is credited to Silviu Itescu, Michael David Schuster.
Application Number | 20130171099 13/808092 |
Document ID | / |
Family ID | 45401240 |
Filed Date | 2013-07-04 |
United States Patent
Application |
20130171099 |
Kind Code |
A1 |
Itescu; Silviu ; et
al. |
July 4, 2013 |
TREATMENT OF T-CELL MEDIATED IMMUNE DISORDERS
Abstract
A method for suppressing T cell activation which comprises
contacting a cell population comprising T cells in vitro or ex viva
with an effective amount of STRO-1.sup.+ cells and/or soluble
factors derived therefrom to suppress cell activation.
Inventors: |
Itescu; Silviu; (Melbourne,
AU) ; Schuster; Michael David; (New York,
NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Itescu; Silviu
Schuster; Michael David |
Melbourne
New York |
NY |
AU
US |
|
|
Assignee: |
MESOBLAST, INC.
New York
NY
|
Family ID: |
45401240 |
Appl. No.: |
13/808092 |
Filed: |
July 4, 2011 |
PCT Filed: |
July 4, 2011 |
PCT NO: |
PCT/AU2011/000841 |
371 Date: |
March 14, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61398950 |
Jul 2, 2010 |
|
|
|
Current U.S.
Class: |
424/85.2 ;
424/130.1; 424/184.1; 424/577; 424/93.71; 435/325; 435/377 |
Current CPC
Class: |
A61K 35/28 20130101;
C12N 5/0663 20130101; A61P 37/02 20180101; A61K 2035/122
20130101 |
Class at
Publication: |
424/85.2 ;
424/93.71; 424/577; 424/184.1; 424/130.1; 435/377; 435/325 |
International
Class: |
A61K 35/28 20060101
A61K035/28; A61K 45/06 20060101 A61K045/06 |
Claims
1. A method for suppressing T cell activation which comprises
contacting a cell population comprising T cells in vitro or ex vivo
with an effective amount of STRO-1.sup.+ cells and/or soluble
factors derived therefrom to suppress T cell activation.
2. A method according to claim 2, wherein the cell population is a
peripheral blood mononuclear cell sample.
3. A method according to claim 2, wherein the cell population
comprise CD25.sup.+ CD4.sup.+ T cells of a naive phenotype
(CD45RA.sup.+).
4. A method according to claim 1 which comprises contacting the
cell population comprising T cells in vitro or ex vivo with an
effective amount of STRO-1.sup.+cells and/or soluble factors
derived therefrom and one or more factors which induce formation of
regulatory T cells.
5. A method according to claim 4, wherein the one or more factors
which induce formation of regulatory T cells is selected from the
group consisting of .alpha.-melanocyte-stimulating hormone
(.alpha.-MSH), transforming growth factor-.beta.2 (TGF-.beta.2),
vitamin D3 and/or Dexamethasone.
6. A method according to claim 1 which further comprises contacting
the cell population comprising T cells with one or more agents
selected from the group consisting of interleukins, antigens,
antigen presenting cells, lectins, and antibodies or specific
ligands for a cell surface receptors or combinations thereof.
7. The method according to claim 6, wherein the interleukin is
IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11,
IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18 or combinations
thereof.
8. A composition of T cells obtained by the method of claim 1.
9. A composition comprising T cells, STRO-1.sup.+ cells and/or
soluble factors derived therefrom, one or more factors which induce
formation of regulatory T cells and a pharmaceutically acceptable
carrier.
10. A method for treating an autoimmune disorder in a subject in
need thereof comprising treating a cell population comprising T
cells in vitro or ex vivo with an effective amount of STRO-1.sup.+
cells and/or soluble factors derived therefrom to suppress T cell
activation and administering the treated cells to the subject.
11. A method for treating or preventing a disorder caused by
excessive or aberrant T cell activation comprising administering to
a subject in need thereof an amount of STRO-1.sup.+ cells and/or
soluble factors derived therefrom effective to suppress T-cell
activation in the patient.
12. The method of claim 10, comprising administering between
0.1.times.10.sup.6 to 5.times.10.sup.6 STRO-1.sup.+ cells and/or
progeny thereof.
13. The method of claim 12, comprising administering between
0.3.times.10.sup.6 to 2.times.10.sup.6 STRO-1.sup.+ cells and/or
progeny thereof.
14. The method of claim 10 comprising administering a low dose of
STRO-1.sup.+ cells and/or progeny thereof.
15. The method of claim 14, wherein the low dose of STRO-1.sup.+
cells and/or progeny thereof comprises between 0.1.times.10.sup.5
and 0.5.times.10.sup.6 STRO-1.sup.+ cells and/or progeny
thereof.
16. The method of claim 14, wherein the low dose of STRO-1.sup.+
cells and/or progeny thereof comprises about 0.3.times.10.sup.6
STRO-1.sup.+ cells and/or progeny thereof.
17. A method according to claim 10 which further comprises
administering to the subject one or more agents selected from the
group consisting of interleukins, antigens, antigen presenting
cells, lectins, and antibodies or specific ligands for a cell
surface receptors or combinations thereof.
18. The method according to claim 17 wherein the interleukin is
IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11,
IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18 or combinations
thereof.
19. The method according to claim 10, further comprising
administering an immunosuppressive drug to the subject.
20. A method according to claim 1, wherein the STRO-1.sup.+ cells
are enriched for STRO-1.sup.bright cells.
21. A method according to claim 1, wherein the STRO-1.sup.bright
cells and/or progeny thereof are allogeneic.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a .sctn.371 national stage of PCT
International Application No. PCT/AU2011/000841, filed Jul. 4,
2011, claiming the benefit of U.S. Provisional Application No.
61/398,950, filed Jul. 2, 2010, the contents of each of which are
hereby incorporated by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0002] This application incorporates-by-reference nucleotide and/or
amino acid sequences which are present in the file named
"130102.sub.--2251.sub.--81809_B_PCT_US_Sequence_Listing_BI.txt,"
which is 7.21 kilobytes in size, and which was created Jan. 2, 2013
in the IBM-PC machine format, having an operating system
compatibility with MS-Windows, which is contained in the text file
filed Jan. 2, 2013 as part of this application.
FIELD
[0003] The present disclosure provides methods and compositions for
suppressing T cell activation ex vivo or in vivo. The methods and
compositions are useful in the treatment of disorders caused by
excessive or aberrant T cell activation, such as autoimmune
diseases.
BACKGROUND
[0004] The CD4.sup.+ T-lymphocyte (herein referred to as the
CD4.sup.+ T-cell) is the central player in the immune system
because of the "help" it provides to other leukocytes in fighting
off infection and potential cancerous cells. CD4.sup.+ T-cells play
essential roles in both humoral and cell-mediated immunity and
additionally they act during parasite infection to promote the
differentiation of eosinophils and mast cells. If the CD4.sup.+
T-cell population is deleted (as is the case in AIDS patients) the
host is rendered susceptible to a number of pathogens and tumors
that do not ordinarily pose a threat to the host.
[0005] While CD4.sup.+ T-cells thus play an important beneficial
role in disease prevention, the aberrant function of these cells
can produce serious problems. In some individuals, the aberrant
function of CD4.sup.+ T-cells leads to autoimmunity and other
disease states. Autoimmune diseases in which CD4.sup.+ T-cells have
been implicated include multiple sclerosis, rheumatoid arthritis
and autoimmune uveitis. In essence these diseases involve an
aberrant immune response in which the immune system is subverted
from its normal role of attacking invading pathogens and instead
attacks the host body tissues, leading to illness and even death.
The targeted host tissues vary between autoimmune diseases, for
example, in multiple sclerosis the immune system attacks the white
matter of the brain and spinal cord, in rheumatoid arthritis the
immune system attacks the synovial lining of the joints. Activated
CD4.sup.+ T-cells have also been implicated in other illnesses,
including rejection of transplant tissues and organs and in the
development of CD4.sup.+ T-cell lymphomas.
[0006] Investigations into conditions caused by aberrant CD4.sup.+
T-cells activity are focussed on several animal models, and in
particular on a number of experimentally induced autoimmune
diseases. Research on these experimentally induced diseases in
animals is premised on the idea that they will provide information
useful in the treatment of the corresponding human diseases. In
pursuit of this goal, it has been shown that CD4.sup.+ T-cells are
responsible for several experimentally induced autoimmune diseases
in animals, including experimental autoimmune encephalomyelitis
(EAE), collagen induced arthritis (CIA), and experimental
autoimmune uveitis (EAU).
[0007] EAE is induced by autoimmunizing animals against myelin
basic protein (MBP, a component of the white matter of the brain
and the spinal cord) and produces the same clinical symptoms
observed in multiple sclerosis: demyelination and paralysis. Proof
of the value of the EAE model as a comparative model for multiple
sclerosis has been provided by evidence showing that these
conditions share a causative nexus: Steinman and co-workers showed
that the predominant cell type found in the brain lesions of
multiple sclerosis patients is CD4.sup.+ T-cells (Oksenberg et al.,
1990, Nature 345:344-345) and that the T-cell receptor (the
molecule responsible for antigen recognition) associated with the
cells in these brain lesions had the same 3 amino acid binding
motif for antigen recognition as on the CD4.sup.+ T-cells
responsible for causing experimental autoimmune encephalomyelitis
(EAE) (Oksenberg et al., 1993, Nature 362:68-70). The evidence thus
suggests that the EAE model will be useful in testing therapies for
disorders caused by aberrant CD4.sup.+ T-cell activity.
[0008] While it appears that therapeutic approaches that destroy
the CD4.sup.+ T-cell population might be effective in ameliorating
these autoimmune diseases, this approach has one very major
drawback. The treatment not only destroys those CD4.sup.+ T-cells
that are antigen reactive and thus involved in the autoimmune
disease process, but also the CD4.sup.+ T-cells that are quiescent
and not involved in the disease. Since CD4.sup.+ T-cells are
important in the general immune response (protecting the body
against infectious agents), destruction of the entire CD4.sup.+
T-cells population leaves the patient severely immunocompromised
and hence highly susceptible to infection. A preferable approach
would be to suppress activation of CD4.sup.+ T-cells in cases of
excessive or aberrant CD4.sup.+ T-cell activity.
SUMMARY
[0009] The present disclosure provides a method for suppressing T
cell activation which comprises contacting a cell population
comprising T cells in vitro or ex vivo with an effective amount of
STRO-1.sup.+ cells and/or soluble factors derived therefrom to
suppress T cell activation.
[0010] In one example the STRO-1.sup.+ cells and/or soluble factors
derived therefrom suppress T cell receptor activation.
[0011] In one example the cell population is a peripheral blood
mononuclear cell sample.
[0012] In another example the cell population comprise CD25.sup.+
CD4.sup.+ T cells of a naive phenotype (CD45RA.sup.+).
[0013] In another example the method comprises contacting the cell
population comprising T cells in vitro or ex vivo with an effective
amount of STRO-1.sup.+ cells and/or soluble factors derived
therefrom and one or more factors which induce formation of
regulatory T cells.
[0014] The one or more factors which induce formation of regulatory
T cells may be selected from the group consisting of
.alpha.-melanocyte-stimulating hormone (.alpha.-MSH), transforming
growth factor-.beta.2 (TGF-.beta.2), vitamin D3 and/or
Dexamethasone.
[0015] In another example the method further comprises contacting
the cell population comprising T cells with one or more agents
selected from the group consisting of interleukins, antigens,
antigen presenting cells, lectins, and antibodies or specific
ligands for a cell surface receptors or combinations thereof.
[0016] The interleukin may be selected from the group consisting of
IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11,
IL-12, IL-13,1L-14, IL-15, IL-16, IL-17, IL-18 or combinations
thereof.
[0017] The present disclosure also provides a composition of T
cells obtained by a method described herein.
[0018] The present disclosure also provides a composition
comprising T cells, STRO-1.sup.+ cells and/or soluble factors
derived therefrom, one or more factors which induce formation of
regulatory T cells and a pharmaceutically acceptable carrier.
[0019] The present disclosure also provides a method for treating
an autoimmune disorder in a subject in need thereof comprising
treating a cell population comprising T cells in vitro or ex vivo
with an effective amount of STRO-1.sup.+ cells and/or soluble
factors derived therefrom to suppress T cell activation and
administering the treated cells to the subject.
[0020] The present disclosure also provides a method for treating
or preventing a disorder caused by excessive or aberrant T cell
activation comprising administering to a subject in need thereof an
amount of STRO-1.sup.+ cells and/or soluble factors derived
therefrom effective to suppress T-cell activation in the
patient.
[0021] The method may further comprise administering to the subject
one or more agents selected from the group consisting of
interleukins, antigens, antigen presenting cells, lectins, and
antibodies or specific ligands for a cell surface receptors or
combinations thereof. The interleukin may be selected from the
group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18
or combinations thereof.
[0022] Additional active agents that may be conjointly administered
with treated T cells or STRO-1.sup.+ cells and/or soluble factors
derived therefrom include, but are not limited to,
beta-interferons, corticosteroids, non-steroid anti-inflammatory
drugs, tumor necrosis alpha blockers, antimalarial drugs,
cyclosporines, tumor necrosis alpha inhibitors, immunosuppressants,
immunomodulators, antibody therapeutics, cell-based therapies and T
cell epitopes (e.g., ToleroTrans Transplant Rejection Therapy by
Circassia, etc.).
[0023] In some examples the Stro-1.sup.+ cells and/or progeny cells
thereof and/or soluble factors derived therefrom are genetically
engineered to express a molecule to block co-stimulation of
T-cells.
[0024] In some examples of the methods of the disclosure the
STRO-1.sup.+ cells are enriched for STRO-1.sup.bright cells.
[0025] The STRO-1.sup.+ cells may be autogeneic or allogeneic. In
one example, the STRO-1.sup.bright cells are allogeneic.
[0026] In another example of this method, the STRO-1.sup.+ cells
and/or progeny cells thereof have been expanded in culture prior to
obtaining the soluble factors.
[0027] In another example of this method the STRO-1.sup.+ cells
and/or progeny cells thereof are administered in a dosage ranging
from 10.sup.5 to 10.sup.10 cells.
[0028] Exemplary dosages of the cells include between
0.1.times.10.sup.6 to 5.times.10.sup.6 STRO-1.sup.+ cells and/or
progeny thereof. For example, the method comprises administering
between 0.3.times.10.sup.6 to 2.times.10.sup.6 STRO-1.sup.+ cells
and/or progeny thereof.
[0029] One form of the method involves administering a low dose of
STRO-1.sup.+ cells and/or progeny thereof. Such a low dose is, for
example, between 0.1.times.10.sup.5 and 0.5.times.10.sup.6
STRO-1.sup.+ cells and/or progeny thereof, such as about
0.3.times.10.sup.6 STRO-1.sup.+ cells and/or progeny thereof.
[0030] The present disclosure also contemplates numerous
administrations of the cells and/or soluble factors. For example,
such a method can involve administering the cells and monitoring
the subject to determine when one or more symptoms of an autoimmune
disorder occurs or recurs and administering a further dose of the
cells and/or soluble factors. Suitable methods for assessing
symptoms of autoimmune disorders will be apparent to the skilled
artisan and/or described herein.
[0031] In one example, the population enriched for STRO-1.sup.+
cells and/or progeny thereof and/or soluble factors derived
therefrom are administered once weekly or less often, such as, once
every four weeks or less often.
[0032] In another embodiment, the population of cells enriched for
STRO-1.sup.bright cells and/or progeny cells thereof and/or soluble
factors derived therefrom is administered systemically. For
example, the population of cells enriched for STRO-1.sup.bright
cells and/or progeny cells thereof and/or soluble factors derived
therefrom may be administered intravenously, intra-arterially,
intramuscularly, subcutaneously, into an aorta, into an atrium or
ventricle of the heart or into a blood vessel connected to an
organ, e.g., an abdominal aorta, a superior mesenteric artery, a
pancreaticoduodenal artery or a splenic artery.
[0033] In another example the methods of the disclosure further
comprise administering an immunosuppressive agent. The
immunosuppressive agent may be administered for a time sufficient
to permit said transplanted cells to be functional. In one example,
the immunosuppressive agent is cyclosporine. The cyclosporine may
be administered at a dosage of from 5 to 40 mg/kg body wt.
[0034] Throughout this specification the word "comprise", or
variations such as "comprises" or "comprising", will be understood
to imply the inclusion of a stated element, integer or step, or
group of elements, integers or steps, but not the exclusion of any
other element, integer or step, or group of elements, integers or
steps.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1. Co-expression of TNAP (STRO-3) and the Mesenchymal
Precursor Cell Marker, STRO-1.sup.bright by Adult Human BMMNC.
Dual-color immunofluorescence and flow cytometry was performed by
incubation of STRO-1 MACS-selected BMMNC and indirectly labelled
with a goat anti-murine IgM antibody coupled to FITC (x axis), and
STRO-3 mAb (murine IgG1) indirectly labelled with a goat
anti-murine IgG coupled to PE (y axis). The dot plot histogram
represents 5.times.104 events collected as listmode data. The
vertical and horizontal lines were set to the reactivity levels of
<1.0% mean fluorescence obtained with the isotype-matched
control antibodies, 1B5 (IgG) and 1A6.12 (IgM) treated under the
same conditions. The results demonstrate that a minor population of
STRO-1.sup.bright cells co-expressed TNAP (upper right quadrant)
while the remaining STRO-1+ cells failed to react with the STRO-3
mAb.
[0036] FIG. 2. Gene expression profile of STRO-1.sup.bright or
STRO-1.sup.dim progeny of cultured and expanded STRO-1.sup.bright
MPC. Single cell suspensions of ex vivo expanded bone marrow MPC
were prepared by trypsin/EDTA treatment. Cells were stained with
the STRO-1 antibody which was subsequently revealed by incubation
with goat-anti murine IgM-fluorescein isothiocyanate. Total
cellular RNA was prepared from purified populations of
STRO-1.sup.dim or STRO-1.sup.bright expressing cells, following
fluorescence activated cell sorting (A). Using RNAzolB extraction
method, and standard procedures, total RNA was isolated from each
subpopulation and used as a template for cDNA synthesis. The
expression of various transcripts was assessed by PCR
amplification, using a standard protocol as described previously
(Gronthos et al. J Cell Sci. 116:1827-1835, 2003). Primers sets
used in this study are shown in Table 2. Following amplification,
each reaction mixture was analysed by 1.5% agarose gel
electrophoresis, and visualised by ethidium bromide staining (B).
Relative gene expression for each cell marker was assessed with
reference to the expression of the house-keeping gene, GAPDH, using
ImageQant software (C).
[0037] FIG. 3. STRO-1.sup.bright progeny of cultured and expanded
STRO-1.sup.+ MPC express high levels of SDF-1, STRO-1.sup.dim
progeny do not. (A) MACS-isolated preparations of STRO-1.sup.+
BMMNCs were partitioned into different STRO-1 subsets according to
the regions, STRO-1.sup.bright and STRO-1.sup.dim/dull using FACS.
Total RNA was prepared from each STRO-1 subpopulation and used to
construct a STRO-1.sup.bright subtraction hybridization library
(B-C). Replicate nitrocellulose filters, which have been blotted
with representative PCR products amplified from bacterial clones
transformed with STRO-1.sup.bright subtracted cDNA. The filters
were then probed with either [.sup.32P] deoxycytidine triphosphate
(dCTP)-labeled STRO-1.sup.bright (B) or STRO-1.sup.dim/dull (C)
subtracted cDNA. The arrows indicate differential expression of 1
clone containing a cDNA fragment corresponding to human SDF-1. (D)
Reverse transcriptase (RT)-PCR analysis demonstrating the relative
expression of SDF-1 and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) transcripts in total RNA prepared from freshly
MACS/FACS-isolated BMMNC STRO-1 populations prior to culture. bp
indicates base pair.
[0038] FIG. 4. Comparative efficiency of STRO-1 negative MSC
(preparation A) and STRO-1.sup.bright MPC (preparation B) for
inhibition of T cell proliferation. PBMC were stimulated with
CD3/CD28 coated beads for 4 days in the absence or presence of
preparations A or B. T cell proliferation was measured by
.sup.3H-Tdr incorporation as counts per minute (cpm).
[0039] FIG. 5. Comparative efficiency of STRO-1 negative MSC
(preparation A) and STRO-1.sup.bright MPC (preparation B) for
inhibition of T cell proliferation. PBMC were stimulated with
CD3/CD28 coated beads for 4 days in the presence of different
concentrations of preparations A or B. T cell proliferation in the
various cultures were was measured by .sup.3H-Tdr incorporation and
reported as percentage of the control T cell proliferation in which
PBMC were stimulated in the absence of MSC.
[0040] FIG. 6. STRO-1.sup.bright MPC reduce or prevent T cell
immune response to a specific antigen. Splenocytes were obtained
from MPC treated mice and controls on day 36 after MOG.sub.35-55
immunization. Splenocytes were cultured in vitro and restimulated
with MOG35-55 and T-cell proliferative responses were measured
through [.sup.3H]-thymidine incorporation.
[0041] FIG. 7. STRO-3 immunoselected and culture expanded human
MPCs inhibit PHA activation of T cells. PMBC were stimulated with
phytohemagglutinin (PHA) to illicit lymphocyte proliferation.
STRO-3 selected MPCs were able to significantly suppress PMBC
T-cell proliferation over a range of concentrations.
[0042] FIG. 8. STRO-3 immunoselected and culture expanded ovine
STRO-1.sup.bright cells (MPCs) induce very low levels of alloimmune
responses, and inhibit PHA activation of T cells. Ovine MPCs did
not directly induce lymphcyte proliferation when used at a
stimulator cell at 1%, 5%, 10% 20% or 50% dilutions and were able
to significantly inhibit levels of alloimmune responses to ovine
PBMCs stimulated with PHA.
[0043] FIG. 9. Dose dependent immunosuppressive effects of ovine
STRO-3 immunoselected and culture expanded STRO-1.sup.bright cells
(MPCs) on PHA-mediated lymphocyte proliferation. Ovine MPCs were
able to suppress lymphocyte proliferation in a dose dependent
manner when used as stimulators against ovine PBMCs or purified
ovine T cells (selected using Miltenyi T cell isolation kit).
DETAILED DESCRIPTION
[0044] The present disclosure demonstrates that STRO-1.sup.+ cells
inhibit T cell activation via antigen and non-antigen specific
mechanisms. For example, the present disclosure demonstrates that
STRO-1.sup.+ cells inhibit MOG-specific T cell proliferative
responses in vivo. The present disclosure also demonstrates that
STRO-1.sup.+ cells inhibit anti-CD3 mediated T cell proliferative
responses in vitro. This disclosure therefore provides new
therapeutic approaches for treating or preventing diseases where
aberrations in regulatory T cell number and/or function have been
observed (e.g., in autoimmune disorders).
Definitions
[0045] As used herein, the terms "treatment", "treating", and the
like, refer to obtaining a desired pharmacologic and/or physiologic
effect. The effect may be prophylactic in terms of completely or
partially preventing a disorder or symptom thereof and/or may be
therapeutic in terms of a partial or complete cure for a disorder
(e.g., autoimmune disease) and/or adverse affect attributable to
the disorder. "Treatment", as used herein, covers any treatment of
a disease in a mammal, particularly in a human, and includes: (a)
increasing survival time; (b) decreasing the risk of death due to
the disease; (c) preventing the disease from occurring in a subject
which may be predisposed to the disease but has not yet been
diagnosed as having it; (d) inhibiting the disease, i.e., arresting
its development (e.g., reducing the rate of disease progression);
and (e) relieving the disease, i.e., causing regression of the
disease.
[0046] As used herein, a therapeutic that "prevents" a disorder or
condition refers to a compound that, in a statistical sample,
reduces the occurrence of the disorder or condition in the treated
sample relative to an untreated control sample, or delays the onset
or reduces the severity of one or more symptoms of the disorder or
condition relative to the untreated control sample.
[0047] As used herein the terms "subject" and "patient" refer to
animals including mammals, including humans. The term "mammal"
includes primates, domesticated animals including dogs, cats,
sheep, cattle, horses, goats, pigs, mice, rats, rabbits, guinea
pigs, captive animals such as zoo animals, and wild animals.
Treatment Methods
[0048] The present disclosure provides methods for suppressing T
cell activation that can be effected in vitro or in vivo.
[0049] In some embodiments the method for suppressing T cell
activation comprises contacting a cell population comprising T
cells in vitro or ex vivo with an effective amount of STRO-1.sup.+
cells and/or soluble factors derived therefrom for a period of time
sufficient to suppress T cell activation.
[0050] In some embodiments, the method comprises obtaining a cell
population that comprises T cells (e.g., CD4.sup.+ cells) and
contacting the T cells with STRO-1.sup.+ cells and/or soluble
factors derived therefrom for a period of time sufficient to
suppress T cell receptor activation.
[0051] In one embodiment the STRO-1.sup.+ cells and/or soluble
factors derived therefrom stimulate formation or expansion of
regulatory T cells within the cell population. Regulatory T cells
are a subset of T cells that suppress the activity of effector T
cells and are characterized by the markers CD4.sup.+ CD25.sup.+. In
some embodiments, the regulatory T cells are FoxP3.sup.+ and/or
IL-10 producing regulatory T cells.
[0052] Accordingly, in a further embodiment the method of the
disclosure comprises culturing the cell population comprising T
cells in vitro or ex vivo with an effective amount of STRO-1.sup.+
cells and/or soluble factors derived therefrom and one or more
factors that stimulate formation of regulatory T cells, such as
.alpha.-melanocyte-stimulating hormone (.alpha.-MSH) and/or
transforming growth factor-.beta.2 (TGF-.beta.2). In some aspects,
the culture also contain vitamin D3 and/or Dexamethasone, which
have demonstrated to promote the generation of IL-10-producing
regulatory T cells (Barrat et al. J. Exp. Med. 195(5): 2002,
603-616).
[0053] In some embodiments, the T cells are isolated from a
mammalian sample prior to exposure to STRO-1.sup.+ cells and/or
soluble factors derived therefrom.
[0054] The term "isolated" with respect to T cells refers to cell
population preparation in a form that has at least 70, 80, 90, 95,
99, or 100% T cells. In some aspects, a desired cell population is
isolated from other cellular components, in some instances to
specifically exclude other cell types that may "contaminate" or
interfere with the study of the cells in isolation. It is to be
understood, however, that such an "isolated" cell population may
incorporate additional cell types that are necessary for cell
survival or to achieve the desired results provided by the
disclosure. For example, antigen presenting cells, such as
monocytes (macrophages) or dendritic cells, may be present in an
"isolated" cell population of T cells or added to a population of
isolated T cells for generation of regulatory T cells. In some
aspects, these antigen presenting cells may be activated monocytes
or dendritic cells.
[0055] Cell populations comprising T cells for use in the methods
of the disclosure may be isolated from a biological sample taken
from a mammalian subject. The sample may originate from a number of
sources, including, but not limited to peripheral blood,
leukapheresis blood product, apheresis blood product, bone marrow,
thymus, tissue biopsy, tumor, lymph node tissue, gut associated
lymphoid tissue, mucosa associated lymphoid tissue, liver, sites of
immunologic lesions (e.g., synovial fluid), pancreas, and
cerebrospinal fluid. The donor subject is preferably human, and can
be fetal, neonatal, child, adult, and may be normal, diseased, or
susceptible to a disease of interest.
[0056] In some embodiments, the T cell sample comprises peripheral
blood mononuclear cells (PBMCs) from a blood sample. By "peripheral
blood mononuclear cells" or "PBMCs" is meant lymphocytes (including
T-cells, B-cells, NK cells, etc.) and monocytes. In general, PBMCs
are isolated from a patient using standard techniques. In some
embodiments, only PBMCs are taken, either leaving or returning
substantially all of the red blood cells and polymorphonuclear
leukocytes to the donor. PBMCs may be isolated using methods known
in the art, such as leukophoresis. In general, a 5 to 7 liter
leukophoresis step is performed, which essentially removes PBMCs
from a patient, returning the remaining blood components.
Collection of the sample is preferably performed in the presence of
an anticoagulant (e.g., heparin).
[0057] The T cell-containing sample comprising PBMCs or isolated T
cells can be pretreated using various methods before treatment with
STRO-1.sup.+ cells and/or soluble factors derived therefrom.
Generally, once collected, the cells can be additionally
concentrated, if this was not done simultaneously with collection
or to further purify and/or concentrate the cells. For example,
PBMCs can be partially purified by density gradient centrifugation
(e.g., through a Ficoll-Hypaque gradient). Cells isolated from a
donor sample are normally washed to remove serum proteins and
soluble blood components, such as autoantibodies, inhibitors, etc.,
using techniques well known in the art. Generally, this involves
addition of physiological media or buffer, followed by
centrifugation. This may be repeated as necessary. The cells can
then be counted, and in general, from 1.times.10.sup.9 to
2.times.10.sup.9 white blood cells are collected from a 5-7 liter
leukapheresis. The purified cells can be resuspended in suitable
media or buffer to maintain viability. Suitable solutions for
resuspension will generally be a balanced salt solution (e.g.,
normal saline, PBS, Hank's balanced salt solution, etc.) optionally
supplemented with fetal calf serum, BSA, HSA, normal goat serum,
and/or other naturally occurring factors, in conjunction with an
acceptable buffer at low concentration, generally from 5-50 mM.
Convenient buffers include, but are not limited to HEPES, phosphate
buffers, lactate buffers, etc,
[0058] A specific cell type (e.g., effector T cells, regulatory T
cells, etc.) can be separated from a complex mixture of cells using
techniques that enrich for cells having the desired characteristic
(e.g., CD4.sup.+, FoxP3.sup.+, etc.). Most standard separation
methods use affinity purification techniques to obtain a
substantially isolated cell population. Techniques for affinity
separation may include, but are not limited to, magnetic separation
(e.g., using antibody-coated magnetic beads), affinity
chromatography, cytotoxic agents joined to a monoclonal antibody
(e.g., complement and cytotoxins), and "panning" with antibody
attached to a solid matrix. Techniques providing accurate
separation include fluorescence activated cell sorting, which can
have varying degrees of sophistication, such as multiple color
channels, impedance channels, etc. The living cells may be selected
against dead cells by employing dyes that associate with dead cells
(e.g., propidium iodide, LDS, etc.). Any technique may be used that
is not unduly detrimental to the viability of the selected
cells.
[0059] The affinity reagents used may be specific receptors or
ligands for cell surface molecules (e.g., CD4, CD25, etc.).
Antibodies may be monoclonal or polyclonal and may be produced by
transgenic animals, immunized animals, immortalized B-cells, and
cells transfected with DNA vectors encoding the antibody. Details
of the preparation of antibodies and their suitability for use as
specified binding members are well-known to those skilled in the
art. In addition to antibody reagents, peptide-MHC antigen and T
cell receptor pairs may be used, as well as peptide ligands,
effector and receptor molecules.
[0060] Antibodies used as affinity reagents for purification are
generally conjugated with a label for use in separation. Labels may
include magnetic beads (which allow for direct separation), biotin
(which can be removed with avidin or streptavidin bound to a
support), fluorochromes (which can be used with a fluorescence
activated cell sorter), or other such labels that allow for ease of
separation of the particular cell type. Fluorochromes may include
phycobiliproteins, such as phycoerythrin and allophycocyanins,
fluorescein and Texas red. Frequently, each antibody is labeled
with a different fluorochrome to permit independent sorting for
each marker.
[0061] For purification of a desired cell population, cell-specific
antibodies are added to a suspension of cells and incubated for a
period of time sufficient to bind the available cell surface
antigens. The incubation will usually be at least about 5 minutes
and usually less than about 30 minutes. It is desirable to have a
sufficient concentration of antibodies in the reaction mixture,
such that the efficiency of the separation is not limited by lack
of antibody (i.e., using a saturating amount of antibody). The
appropriate concentration can also be determined by titration. The
medium in which the cells are separated will be any medium that
maintains the viability of the cells. A preferred medium is
phosphate buffered saline containing from 0.1% to 0.5% BSA. Various
media are commercially available and may be used according to the
nature of the cells, including Dulbecco's Modified Eagle Medium,
Hank's Basic Salt Solution, Dulbecco's phosphate buffered saline,
RPMI, Iscove's medium, PBS with 5 mM EDTA, etc., optionally
supplemented with fetal calf serum, BSA, HSA, etc.
[0062] The staining intensity of cells can be monitored by flow
cytometry, where lasers detect the quantitative levels of
fluorochrome (which is proportional to the amount of cell surface
antigen bound by the antibodies). Flow cytometry, or fluorescent
activated cell sorting (FACS), can also be used to separate cell
populations based on the intensity of antibody staining, as well as
other parameters such as cell size and light scatter. Although the
absolute level of staining may differ with a particular
fluorochrome and antibody preparation, the data can be normalized
to a control.
[0063] The labeled cells are then separated as to the expression of
designated marker (e.g., CD4, CD25, etc.). The separated cells may
be collected in any appropriate medium that maintains the viability
of the cells, usually having a cushion of serum at the bottom of
the collection tube. Various media are commercially available and
may be used according to the nature of the cells, including dMEM,
HBSS, dPBS, RPMI, Iscove's medium, etc., frequently supplemented
with fetal calf serum.
[0064] Cell populations highly enriched for a desired
characteristic (e.g., CD4.sup.+ T cells, CD4.sup.+CD25.sup.+
regulatory T cells, etc.) are achieved in this manner. The desired
population will be at or about 70% or more of the cell composition,
and usually at or about 90% or more of the cell composition, and
may be as much as about 95% or more of the cell population. The
enriched cell population may be used immediately. Cells can also be
frozen, although it is preferable to freeze cells prior to the
separation procedure. Alternatively, cells may be frozen at liquid
nitrogen temperatures and stored for long periods of time, being
thawed and capable of being reused. The cells will usually be
stored in DMSO and/or FCS, in combination with medium, glucose,
etc. Once thawed, the cells may be expanded by use of growth
factors, antigen, stimulation, antigen presenting cells (e.g.,
dendritic cells), etc. for proliferation and differentiation.
[0065] Once the PBMCs or isolated T cells have undergone any
necessary pre-treatment, the cells are treated with STRO-1.sup.+
cells and/or soluble factors derived therefrom. By "treated" herein
is meant that the cells are incubated in a suitable nutrient medium
with STRO-1.sup.+ cells and/or soluble factors derived therefrom
for a time period sufficient to produce regulatory T cells having
the capacity to inhibit immune responses mediated by effector T
cells. In some embodiments, the first culture is diluted with about
an equal volume of nutrient medium. In other aspects, a first cell
culture is divided into two or more portions that are then diluted
with nutrient medium. The advantage of culture division is that the
cell clusters formed in the first culture (thousands of cells) are
mechanically disrupted and form smaller cell clusters (tens to
hundreds of cells) during division of the first culture. These
small clusters are then able to grow into larger clusters during
the next growth period. A cell culture produced in this fashion may
be subcultured two or more times using a similar method.
[0066] A cell population may be grown in vitro under various
culture conditions. Culture medium may be liquid or semi-solid
(e.g., containing agar, methylcellulose, etc.) The cell population
may be conveniently suspended in any appropriate nutrient medium,
including but not limited to Iscove's modified Dulbecco's medium,
or RPMI-1640, normally supplemented with fetal calf serum (about
5-10%), L-glutamine, and antibiotics (e.g., penicillin and
streptomycin).
[0067] The cell culture may contain growth factors to which the
cells are responsive. Growth factors, as defined herein, are
molecules capable of promoting survival, growth and/or
differentiation of cells, either in culture or in the intact
tissue, through specific effects on a transmembrane receptor.
Growth factors include polypeptides and non-polypeptide factors.
Specific growth factors that may be used in culturing the subject
cells include the interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15,
IL-16, IL-17, IL-18, etc.) and antigens (e.g., peptide antigens,
protein antigens such as alloantigens) preferably in combination
with antigen presenting cells, lectins, non-specific stimuli (e.g.,
Con A; LPS; etc.). The culture may also contain antibodies (e.g.
anti-CD3), or specific ligands (in the form of purified ligand, Fc
fusion proteins, or other recombinant tagged forms like leucine
zipper forms) for cell surface receptors that may stimulate
regulatory T cell activity. For example, mAb or ligands that bind
TNFR or other co-stimulatory molecules on regulatory T cells and
could stimulate and increase regulatory T cell activity.
[0068] The T cell population may be co-cultured with immature or
mature dendritic cells, as well as other antigen presenting cells
(e.g., monocytes, B cells, macrophages, etc.) prior to, during, or
after treatment STRO-1.sup.+ cells and/or soluble factors derived
therefrom.
[0069] In some aspects, the present methods are useful for ex vivo
generation of regulatory T cells for transplantation into a patient
or development of in vitro models and assays for regulatory T cell
function. The regulatory T cell cultures serve as a valuable source
of novel regulatory factors and pharmaceuticals.
[0070] Methods for adoptive transfer of T cells are well described
in the art, for example, see US Patent Applications 2006/0115899,
2005/0196386, 2003/0049696, 2006/0292164, and 2007/0172947 (the
contents of which are hereby incorporated by reference). Therefore,
a skilled practitioner would easily be able to transplant or
reintroduce the treated T cells populations obtained by the methods
of the present disclosure into a patient in need thereof.
Transplanted T cells may originate from a T cell-containing sample
obtained from the patient himself or from another donor not
receiving treatment. This is generally done as is known in the art
and usually comprises injecting, or other methods of introducing,
the treated cells back into the patient via intravenous
administration. For example, the cells may be placed in a 50 ml
Fenwall infusion bag by injection using sterile syringes or other
sterile transfer mechanisms. The cells can then be immediately
infused via IV administration over a period of time, into a free
flow IV line into the patient. In some aspects, additional reagents
such as buffers or salts may be added as well.
[0071] Another aspect of the disclosure provides methods for
treating autoimmune-related disorders by conjoint administration of
treated T cells obtained by a method of the present disclosure and
at least one additional active agent. In some embodiments, the
additional active agent is a therapeutic agent used to treat or
prevent an autoimmune disease. Active agents of the invention may
include, but are not limited to beta-interferons, corticosteroids,
non-steroid anti-inflammatory drugs, tumor necrosis blockers,
antimalarial drugs, cyclosporines, tumor necrosis alpha inhibitors,
immunosuppressants, immunomodulators, cytokines,
anti-graft-rejection therapeutics, vitamin D3, Dexamethasone,
antibody therapeutics, and T cell epitopes (e.g., ToleroTrans
Transplant Rejection Therapy by Circassia, etc.). Cytokines
suitable for conjoint administration may include, but are not
limited to IL-2, IL-4, IL-7, IL-10, TGF-.beta., IL-15 and/or IL-17.
In some embodiments the additional active agent may be a cell
population comprising other cell types than regulatory T cells. For
example, the treated T cells may be conjointly administered to a
patient in need thereof with one or more antigen presenting cell
types, such as monocytes or dendritic cells. In some aspects, these
antigen presenting cells may be activated monocytes or dendritic
cells.
[0072] After transplanting the cells into the patient, the effect
of the treatment may be evaluated, if desired. One of skill in the
art would recognize there are many methods of evaluating
immunological manifestations of an autoimmune disease (e.g.,
quantification of total antibody titers or of specific
immunoglobulins, renal function tests, tissue damage evaluation,
etc.). Tests of T cells function such as T cell numbers, phenotype,
activation state and ability to respond to antigens and/or mitogens
also may be done.
[0073] One aspect of the disclosure provides methods for treating
or preventing a disorder caused by excessive T cell activation,
such as an autoimmune disorder or condition, in a patient by
administering to a patient in need thereof an amount of
STRO-1.sup.+ cells and/or soluble factors derived therefrom
effective to suppress T-cell activation in the patient.
[0074] The examples of the disclosure demonstrate that
administration of STRO-1.sup.+ cells and/or soluble factors derived
therefrom to a mouse model resulted in suppression of effector T
cell activity.
[0075] In one embodiment the present disclosure provides methods of
administering STRO-1.sup.+ cells and/or soluble factors derived
therefrom to promote regulatory T cell-mediated suppression of
autoimmune disorders or conditions.
[0076] While the method of the invention can be used to treat
patients afflicted with an autoimmune disorder, in some
embodiments, the methods are also applied to patients who do not
have, but are at risk of developing an autoimmune response.
[0077] The present disclosure provides methods for treating
autoimmune-related disorders by conjoint administration of
STRO-1.sup.+ cells and/or soluble factors derived therefrom and at
least one additional active agent. Active agents of the invention
may include, but are not limited to beta-interferons,
corticosteroids, non-steroid anti-inflammatory drugs, tumor
necrosis blockers, antimalarial drugs, cyclosporines, tumor
necrosis alpha inhibitors, immunosuppressants, immunomodulators,
cytokines, anti-graft-rejection therapeutics, cell-based
therapeutics, vitamin D3, dexamethasone and antibody therapeutics.
Cytokines suitable for conjoint administration may include, but are
not limited to IL-2, IL-4, IL-10, TGF-13, IL-15 and/or IL-17. In
some embodiments, the additional active agent is a therapeutic
agent used to treat or prevent an autoimmune disease.
[0078] The pathogenesis of a number of autoimmune diseases is
believed to be caused by autoimmune T cell responses to
self-antigens present in the organism. For example, autoreactive T
cells have been implicated in the pathogenesis of: type I diabetes,
multiple sclerosis, rheumatoid arthritis, psoriatic arthritis,
autoimmune myocarditis, pemphigus, celiac disease, myasthenia
gravis, Hashimoto's thyroiditis, Graves' disease, Addison's
disease, autoimmune hepatitis, chronic Lyme arthritis, familial
dilated cardiomyopathy, juvenile dermatomyositis, polychondritis,
Sjogren's syndrome, psoriasis, juvenile idiopathic arthritis,
inflammatory bowel disease, systemic lupus erythematosus, and
graft-versus-host disease.
[0079] As used herein, the term "soluble factors" shall be taken to
mean any molecule, e.g., protein, peptide, glycoprotein,
glycopeptide, lipoprotein, lipopeptide, carbohydrate, etc. produced
by STRO-1.sup.+ cells and/or progeny thereof that are water
soluble. Such soluble factors may be intracellular and/or secreted
by a cell. Such soluble factors may be a complex mixture (e.g.,
supernatant) and/or a fraction thereof and/or may be a purified
factor. In one embodiment of the present invention soluble factors
are or are contained within supernatant. Accordingly, any
embodiment herein directed to administration of one or more soluble
factors shall be taken to apply mutatis mutandis to the
administration of supernatant.
[0080] The methods of the invention may involve administration of
population of cells enriched for STRO-1.sup.+ cells and/or progeny
cells thereof alone, and/or soluble factors derived therefrom. The
methods of the invention may also involve administration of progeny
cells alone, or soluble factors derived from the progeny cells. The
methods of the invention may also involve administration of a mixed
population of STRO-1.sup.bri cells and progeny cells thereof, or
soluble factors from a mixed culture of STRO-1.sup.bri cells and
progeny cells thereof.
[0081] It is further contemplated that only a single treatment with
the STRO-1.sup.+ cells and/or progeny cells thereof and/or soluble
factors derived therefrom of the present invention may be required,
eliminating the need for chronic immunosuppressive drug therapy.
Alternatively, multiple administrations of STRO-1.sup.+ cells
and/or progeny cells thereof and/or soluble factors derived
therefrom may be employed.
[0082] The dosage of the STRO-1.sup.+ cells and/or progeny cells
thereof and/or soluble factors derived therefrom varies within wide
limits and will, of course be fitted to the individual requirements
in each particular case. In general, in the case of parenteral
administration, it is customary to administer from about 0.01 to
about 5 million cells per kilogram of recipient body weight. The
number of cells used will depend on the weight and condition of the
recipient, the number of or frequency of administrations, and other
variables known to those of skill in the art
[0083] Exemplary dosages of the cells include between
0.1.times.10.sup.6 to 5.times.10.sup.6 STRO-1.sup.+ cells and/or
progeny thereof. For example, the method comprises administering
between 0.3.times.10.sup.6 to 2.times.10.sup.6 STRO-1.sup.+ cells
and/or progeny thereof.
[0084] One form of the method involves administering a low dose of
STRO-1.sup.+ cells and/or progeny thereof. Such a low dose is, for
example, between 0.1.times.10.sup.5 and 0.5.times.10.sup.6
STRO-1.sup.+ cells and/or progeny thereof, such as about
0.3.times.10.sup.6 STRO-1.sup.+ cells and/or progeny thereof.
[0085] The cells can be suspended in an appropriate diluent, at a
concentration of from about 0.01 to about 5.times.10.sup.6
cells/ml. Suitable excipients for injection solutions are those
that are biologically and physiologically compatible with the cells
and with the recipient, such as buffered saline solution or other
suitable excipients. The composition for administration is
preferably formulated, produced and stored according to standard
methods complying with proper sterility and stability.
[0086] The following examples further illustrate aspects of the
present invention. However, they are in no way a limitation of the
teachings or disclosure of the present invention as set forth
herein.
STRO-1.sup.+ Cells or Progeny Cells, and Supernatant or One or More
Soluble Factors Derived Therefrom
[0087] STRO-1.sup.+ cells are cells found in bone marrow, blood,
dental pulp cells, adipose tissue, skin, spleen, pancreas, brain,
kidney, liver, heart, retina, brain, hair follicles, intestine,
lung, lymph node, thymus, bone, ligament, tendon, skeletal muscle,
dermis, and periosteum; and are capable of differentiating into
germ lines such as mesoderm and/or endoderm and/or ectoderm.
[0088] In one embodiment, the STRO-1.sup.+ cells are multipotential
cells which are capable of differentiating into a large number of
cell types including, but not limited to, adipose, osseous,
cartilaginous, elastic, muscular, and fibrous connective tissues.
The specific lineage-commitment and differentiation pathway which
these cells enter depends upon various influences from mechanical
influences and/or endogenous bioactive factors, such as growth
factors, cytokines, and/or local microenvironmental conditions
established by host tissues. STRO-1.sup.+ multipotential cells are
thus non-hematopoietic progenitor cells which divide to yield
daughter cells that are either stem cells or are precursor cells
which in time will irreversibly differentiate to yield a phenotypic
cell.
[0089] In one example, the STRO-1.sup.+ cells are enriched from a
sample obtained from a subject, e.g., a subject to be treated or a
related subject or an unrelated subject (whether of the same
species or different). The terms `enriched`, `enrichment` or
variations thereof are used herein to describe a population of
cells in which the proportion of one particular cell type or the
proportion of a number of particular cell types is increased when
compared with an untreated population of the cells (e.g., cells in
their native environment).
[0090] In one example, the cells used in the present disclosure
express one or more markers individually or collectively selected
from the group consisting of TNAP.sup.+, VCAM-1.sup.+, THY-1.sup.+,
STRO-4.sup.+ (HSP-90.beta.), STRO-2.sup.+, CD45.sup.+, CD146.sup.+,
3G5.sup.+ or any combination thereof.
[0091] By "individually" is meant that the disclosure encompasses
the recited markers or groups of markers separately, and that,
notwithstanding that individual markers or groups of markers may
not be separately listed herein the accompanying claims may define
such marker or groups of markers separately and divisibly from each
other.
[0092] By "collectively" is meant that the disclosure encompasses
any number or combination of the recited markers or groups of
peptides, and that, notwithstanding that such numbers or
combinations of markers or groups of markers may not be
specifically listed herein the accompanying claims may define such
combinations or sub-combinations separately and divisibly from any
other combination of markers or groups of markers.
[0093] In one example, the STRO-1.sup.+ cells are STRO-1.sup.bright
(syn. STRO-1.sup.bri). In one example, the Stro-1.sup.bri cells are
preferentially enriched relative to STRO-1.sup.dim or
STRO-1.sup.intermediate cells.
[0094] In one example, the STRO-1.sup.bright cells are additionally
one or more of TNAP.sup.+, VCAM-1.sup.+, THY-1.sup.+ STRO-4.sup.+
(HSP-90.beta.), STRO-2.sup.+ and/or CD146.sup.+.
[0095] In one example, the mesenchymal precursor cells are
perivascular mesenchymal precursor cells as defined in WO
2004/85630.
[0096] A cell that is referred to as being "positive" for a given
marker it may express either a low (lo or dim) or a high (bright,
bri) level of that marker depending on the degree to which the
marker is present on the cell surface, where the terms relate to
intensity of fluorescence or other marker used in the sorting
process of the cells. The distinction of lo (or dim or dull) and
bri will be understood in the context of the marker used on a
particular cell population being sorted. A cell that is referred to
as being "negative" for a given marker is not necessarily
completely absent from that cell. This term means that the marker
is expressed at a relatively very low level by that cell, and that
it generates a very low signal when detectably labeled or is
undetectable above background levels, e.g., levels detected suing
an isotype control antibody.
[0097] The term "bright", when used herein, refers to a marker on a
cell surface that generates a relatively high signal when
detectably labeled. Whilst not wishing to be limited by theory, it
is proposed that "bright" cells express more of the target marker
protein (for example the antigen recognized by STRO-1) than other
cells in the sample. For instance, STRO-1.sup.bri cells produce a
greater fluorescent signal, when labeled with a FITC-conjugated
STRO-1 antibody as determined by fluorescence activated cell
sorting (FACS) analysis, than non-bright cells
(STRO-1.sup.dull/dim). In one example, "bright" cells constitute at
least about 0.1% of the most brightly labeled bone marrow
mononuclear cells contained in the starting sample. In other
examples, "bright" cells constitute at least about 0.1%, at least
about 0.5%, at least about 1%, at least about 1.5%, or at least
about 2%, of the most brightly labeled bone marrow mononuclear
cells contained in the starting sample. In an example,
STRO-1.sup.bright cells have 2 log magnitude higher expression of
STRO-1 surface expression relative to "background", namely cells
that are STRO-1.sup.-. By comparison, STRO-1.sup.dim and/or
STRO-1.sup.intermediate cells have less than 2 log magnitude higher
expression of STRO-1 surface expression, typically about 1 log or
less than "background".
[0098] As used herein the term "TNAP" is intended to encompass all
isoforms of tissue non-specific alkaline phosphatase. For example,
the term encompasses the liver isoform (LAP), the bone isoform
(BAP) and the kidney isoform (KAP). In an example, the TNAP is BAP.
In an example, TNAP as used herein refers to a molecule which can
bind the STRO-3 antibody produced by the hybridoma cell line
deposited with ATCC on 19 Dec. 2005 under the provisions of the
Budapest Treaty under deposit accession number PTA-7282.
[0099] Furthermore, in an example, the STRO-1.sup.+ cells are
capable of giving rise to clonogenic CFU-F.
[0100] In one example, a significant proportion of the STRO-1.sup.+
multipotential cells are capable of differentiation into at least
two different germ lines. Non-limiting examples of the lineages to
which the multipotential cells may be committed include bone
precursor cells; hepatocyte progenitors, which are multipotent for
bile duct epithelial cells and hepatocytes; neural restricted
cells, which can generate glial cell precursors that progress to
oligodendrocytes and astrocytes; neuronal precursors that progress
to neurons; precursors for cardiac muscle and cardiomyocytes,
glucose-responsive insulin secreting pancreatic beta cell lines.
Other lineages include, but are not limited to, odontoblasts,
dentin-producing cells and chondrocytes, and precursor cells of the
following: retinal pigment epithelial cells, fibroblasts, skin
cells such as keratinocytes, dendritic cells, hair follicle cells,
renal duct epithelial cells, smooth and skeletal muscle cells,
testicular progenitors, vascular endothelial cells, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma, cardiac
muscle, smooth muscle, skeletal muscle, pericyte, vascular,
epithelial, glial, neuronal, astrocyte and oligodendrocyte
cells.
[0101] In another example, the STRO-1.sup.+ cells are not capable
of giving rise, upon culturing, to hematopoietic cells.
[0102] In one example, the cells are taken from the subject to be
treated, cultured in vitro using standard techniques and used to
obtain supernatant or soluble factors or expanded cells for
administration to the subject as an autologous or allogeneic
composition. In an alternative example, cells of one or more of the
established human cell lines are used. In another useful example of
the disclosure, cells of a non-human animal (or if the patient is
not a human, from another species) are used.
[0103] The present disclosure also contemplates use of supernatant
or soluble factors obtained or derived from STRO-1.sup.+ cells
and/or progeny cells thereof (the latter also being referred to as
expanded cells) which are produced from in vitro culture. Expanded
cells of the disclosure may a have a wide variety of phenotypes
depending on the culture conditions (including the number and/or
type of stimulatory factors in the culture medium), the number of
passages and the like. In certain examples, the progeny cells are
obtained after about 2, about 3, about 4, about 5, about 6, about
7, about 8, about 9, or about 10 passages from the parental
population. However, the progeny cells may be obtained after any
number of passages from the parental population.
[0104] The progeny cells may be obtained by culturing in any
suitable medium. The term "medium", as used in reference to a cell
culture, includes the components of the environment surrounding the
cells. Media may be solid, liquid, gaseous or a mixture of phases
and materials. Media include liquid growth media as well as liquid
media that do not sustain cell growth. Media also include
gelatinous media such as agar, agarose, gelatin and collagen
matrices. Exemplary gaseous media include the gaseous phase that
cells growing on a petri dish or other solid or semisolid support
are exposed to. The term "medium" also refers to material that is
intended for use in a cell culture, even if it has not yet been
contacted with cells. In other words, a nutrient rich liquid
prepared for bacterial culture is a medium. A powder mixture that
when mixed with water or other liquid becomes suitable for cell
culture may be termed a "powdered medium".
[0105] In an example, progeny cells useful for the methods of the
disclosure are obtained by isolating TNAP.sup.+ STRO-1.sup.+ cells
from bone marrow using magnetic beads labeled with the STRO-3
antibody, and then culture expanding the isolated cells (see
Gronthos et al. Blood 85: 929-940, 1995 for an example of suitable
culturing conditions).
[0106] In one example, such expanded cells (progeny) (for example,
at least after 5 passages) can be TNAP.sup.-, CC9.sup.+, HLA class
I.sup.-, HLA class II.sup.-, CD14-, CD19.sup.-, CD3.sup.-,
CD11a.sup.-c.sup.-, CD31.sup.-, CD86.sup.-, CD34.sup.- and/or
CD80.sup.-. However, it is possible that under different culturing
conditions to those described herein that the expression of
different markers may vary. Also, whilst cells of these phenotypes
may predominate in the expended cell population it does not mean
that there is a minor proportion of the cells do not have this
phenotype(s) (for example, a small percentage of the expanded cells
may be CC9.sup.-). In one example, expanded cells still have the
capacity to differentiate into different cell types.
[0107] In one example, an expended cell population used to obtain
supernatant or soluble factors, or cells per se, comprises cells
wherein at least 25%, such as at least 50%, of the cells are
CC9.sup.+.
[0108] In another example, an expanded cell population used to
obtain supernatant or soluble factors, or cells per se, comprises
cells wherein at least 40%, such as at least 45%, of the cells are
STRO-1.sup.+.
[0109] In a further example, the expanded cells may express one or
more markers collectively or individually selected from the group
consisting of LFA-3, THY-1, VCAM-1, ICAM-1, PECAM-1, P-selectin,
L-selectin, 3G5, CD49a/CD49b/CD29, CD49c/CD29, CD49d/CD29, CD 90,
CD29, CD18, CD61, integrin beta 6-19, thrombomodulin, CD10, CD13,
SCF, PDGF-R, EGF-R, NGF-R, FGF-R, Leptin-R (STRO-232 Leptin-R),
RANKL, STRO-1.sup.bright and CD146 or any combination of these
markers.
[0110] In one example, the progeny cells are Multipotential
Expanded STRO-1.sup.+ Multipotential cells Progeny (MEMPs) as
defined and/or described in WO 2006/032092. Methods for preparing
enriched populations of STRO-1.sup.+ multipotential cells from
which progeny may be derived are described in WO 01/04268 and WO
2004/085630. In an in vitro context STRO-1.sup.+ multipotential
cells will rarely be present as an absolutely pure preparation and
will generally be present with other cells that are tissue specific
committed cells (TSCCs). WO 01/04268 refers to harvesting such
cells from bone marrow at purity levels of about 0.1% to 90%. The
population comprising MPCs from which progeny are derived may be
directly harvested from a tissue source, or alternatively it may be
a population that has already been expanded ex vivo.
[0111] For example, the progeny may be obtained from a harvested,
unexpanded, population of substantially purified STRO-1.sup.+
multipotential cells, comprising at least about 0.1, 1, 5, 10, 20,
30, 40, 50, 60, 70, 80 or 95% of total cells of the population in
which they are present. This level may be achieved, for example, by
selecting for cells that are positive for at least one marker
individually or collectively selected from the group consisting of
TNAP, STRO-1.sup.bright, 3G5.sup.+, VCAM-1, THY-1, CD146 and
STRO-2.
[0112] MEMPS can be distinguished from freshly harvested
STRO-1.sup.+ multipotential cells in that they are positive for the
marker STRO-1.sup.bri and negative for the marker Alkaline
phosphatase (ALP). In contrast, freshly isolated STRO-1.sup.+
multipotential cells are positive for both STRO-1.sup.bri and ALP.
In an example of the present disclosure, at least 15%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, 90% or 95% of the administered cells have
the phenotype STRO-1.sup.bri, ALIT. In one example the MEMPS are
positive for one or more of the markers Ki67, CD44 and/or
CD49c/CD29, VLA-3, .alpha.3.beta.1. In yet a further example the
MEMPs do not exhibit TERT activity and/or are negative for the
marker CD18.
[0113] The STRO-1.sup.+ cell starting population may be derived
from any one or more tissue types set out in WO 01/04268 or WO
2004/085630, namely bone marrow, dental pulp cells, adipose tissue
and skin, or perhaps more broadly from adipose tissue, teeth,
dental pulp, skin, liver, kidney, heart, retina, brain, hair
follicles, intestine, lung, spleen, lymph node, thymus, pancreas,
bone, ligament, bone marrow, tendon and skeletal muscle.
[0114] It will be understood that in performing the present
disclosure, separation of cells carrying any given cell surface
marker can be effected by a number of different methods, however,
some methods rely upon binding a binding agent (e.g., an antibody
or antigen binding fragment thereof) to the marker concerned
followed by a separation of those that exhibit binding, being
either high level binding, or low level binding or no binding. The
most convenient binding agents are antibodies or antibody-based
molecules, such as monoclonal antibodies or based on monoclonal
antibodies because of the specificity of these latter agents.
Antibodies can be used for both steps, however other agents might
also be used, thus ligands for these markers may also be employed
to enrich for cells carrying them, or lacking them.
[0115] The antibodies or ligands may be attached to a solid support
to allow for a crude separation. The separation techniques
preferably maximize the retention of viability of the fraction to
be collected. Various techniques of different efficacy may be
employed to obtain relatively crude separations. The particular
technique employed will depend upon efficiency of separation,
associated cytotoxicity, ease and speed of performance, and
necessity for sophisticated equipment and/or technical skill.
Procedures for separation may include, but are not limited to,
magnetic separation, using antibody-coated magnetic beads, affinity
chromatography and "panning" with antibody attached to a solid
matrix. Techniques providing accurate separation include but are
not limited to FACS. Methods for performing FACS will be apparent
to the skilled artisan.
[0116] Antibodies against each of the markers described herein are
commercially available (e.g., monoclonal antibodies against STRO-1
are commercially available from R&D Systems, USA), available
from ATCC or other depositary organization and/or can be produced
using art recognized techniques.
[0117] The method for isolating STRO-1.sup.+ cells, for example,
comprises a first step being a solid phase sorting step utilizing
for example magnetic activated cell sorting (MACS) recognizing high
level expression of STRO-1. A second sorting step can then follow,
should that be desired, to result in a higher level of precursor
cell expression as described in patent specification WO 01/14268.
This second sorting step might involve the use of two or more
markers.
[0118] The method obtaining STRO-1.sup.+ cells might also include
the harvesting of a source of the cells before the first enrichment
step using known techniques. Thus the tissue will be surgically
removed. Cells comprising the source tissue will then be separated
into a so called single cells suspension. This separation may be
achieved by physical and or enzymatic means.
[0119] Once a suitable STRO-1.sup.+ cell population has been
obtained, it may be cultured or expanded by any suitable means to
obtain MEMPs.
[0120] In one example, the cells are taken from the subject to be
treated, cultured in vitro using standard techniques and used to
obtain supernatant or soluble factors or expanded cells for
administration to the subject as an autologous or allogeneic
composition. In an alternative example, cells of one or more of the
established human cell lines are used to obtain the supernatant or
soluble factors. In another useful example of the disclosure, cells
of a non-human animal (or if the patient is not a human, from
another species) are used to obtain supernatant or soluble
factors.
[0121] The disclosure can be practiced using cells from any
non-human animal species, including but not limited to non-human
primate cells, ungulate, canine, feline, lagomorph, rodent, avian,
and fish cells. Primate cells with which the disclosure may be
performed include but are not limited to cells of chimpanzees,
baboons, cynomolgus monkeys, and any other New or Old World
monkeys. Ungulate cells with which the disclosure may be performed
include but are not limited to cells of bovines, porcines, ovines,
caprines, equines, buffalo and bison. Rodent cells with which the
disclosure may be performed include but are not limited to mouse,
rat, guinea pig, hamster and gerbil cells. Examples of lagomorph
species with which the disclosure may be performed include
domesticated rabbits, jack rabbits, hares, cottontails, snowshoe
rabbits, and pikas. Chickens (Gallus gallus) are an example of an
avian species with which the disclosure may be performed.
[0122] Cells useful for the methods of the disclosure may be stored
before use, or before obtaining the supernatant or soluble factors.
Methods and protocols for preserving and storing of eukaryotic
cells, and in particular mammalian cells, are known in the art
(cf., for example, Pollard, J. W. and Walker, J. M. (1997) Basic
Cell Culture Protocols, Second Edition, Humana Press, Totowa, N.J.;
Freshney, R. I. (2000) Culture of Animal Cells, Fourth Edition,
Wiley-Liss, Hoboken, N.J.). Any method maintaining the biological
activity of the isolated stem cells such as mesenchymal
stem/progenitor cells, or progeny thereof, may be utilized in
connection with the present disclosure. In one example, the cells
are maintained and stored by using cryo-preservation.
Genetically-Modified Cells
[0123] In one embodiment, the STRO-1.sup.+ cells and/or progeny
cells thereof are genetically modified, e.g., to express and/or
secrete a protein of interest, e.g., a protein providing a
therapeutic and/or prophylactic benefit, e.g., insulin, glucagon,
somatostatin, trypsinogen, chymotrypsinogen, elastase,
carboxypeptidase, pancreatic lipase or amylase or a polypeptide
associated with or causative of enhanced angiogenesis or a
polypeptide associated with differentiation of a cell into a
pancreatic cell or a vascular cell.
[0124] Methods for genetically modifying a cell will be apparent to
the skilled artisan. For example, a nucleic acid that is to be
expressed in a cell is operably-linked to a promoter for inducing
expression in the cell. For example, the nucleic acid is linked to
a promoter operable in a variety of cells of a subject, such as,
for example, a viral promoter, e.g., a CMV promoter (e.g., a CMV-IE
promoter) or a SV-40 promoter. Additional suitable promoters are
known in the art and shall be taken to apply mutatis mutandis to
the present embodiment of the invention.
[0125] Preferably, the nucleic acid is provided in the form of an
expression construct. As used herein, the term "expression
construct" refers to a nucleic acid that has the ability to confer
expression on a nucleic acid (e.g. a reporter gene and/or a
counter-selectable reporter gene) to which it is operably
connected, in a cell. Within the context of the present invention,
it is to be understood that an expression construct may comprise or
be a plasmid, bacteriophage, phagemid, cosmid, virus sub-genomic or
genomic fragment, or other nucleic acid capable of maintaining
and/or replicating heterologous DNA in an expressible format.
[0126] Methods for the construction of a suitable expression
construct for performance of the invention will be apparent to the
skilled artisan and are described, for example, in Ausubel et al
(In: Current Protocols in Molecular Biology. Wiley Interscience,
ISBN 047 150338, 1987) or Sambrook et al (In: Molecular Cloning:
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratories, New York, Third Edition 2001). For example, each of
the components of the expression construct is amplified from a
suitable template nucleic acid using, for example, PCR and
subsequently cloned into a suitable expression construct, such as
for example, a plasmid or a phagemid.
[0127] Vectors suitable for such an expression construct are known
in the art and/or described herein. For example, an expression
vector suitable for the method of the present invention in a
mammalian cell is, for example, a vector of the pcDNA vector suite
supplied by Invitrogen, a vector of the pCI vector suite (Promega),
a vector of the pCMV vector suite (Clontech), a pM vector
(Clontech), a pSI vector (Promega), a VP 16 vector (Clontech) or a
vector of the pcDNA vector suite (Invitrogen).
[0128] The skilled artisan will be aware of additional vectors and
sources of such vectors, such as, for example, Invitrogen
Corporation, Clontech or Promega.
[0129] Means for introducing the isolated nucleic acid molecule or
a gene construct comprising same into a cell for expression are
known to those skilled in the art. The technique used for a given
organism depends on the known successful techniques. Means for
introducing recombinant DNA into cells include microinjection,
transfection mediated by DEAE-dextran, transfection mediated by
liposomes such as by using lipofectamine (Gibco, MD, USA) and/or
cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake,
electroporation and microparticle bombardment such as by using
DNA-coated tungsten or gold particles (Agracetus Inc., WI, USA)
amongst others.
[0130] Alternatively, an expression construct of the invention is a
viral vector. Suitable viral vectors are known in the art and
commercially available. Conventional viral-based systems for the
delivery of a nucleic acid and integration of that nucleic acid
into a host cell genome include, for example, a retroviral vector,
a lentiviral vector or an adeno-associated viral vector.
Alternatively, an adenoviral vector is useful for introducing a
nucleic acid that remains episomal into a host cell. Viral vectors
are an efficient and versatile method of gene transfer in target
cells and tissues. Additionally, high transduction efficiencies
have been observed in many different cell types and target
tissues.
[0131] For example, a retroviral vector generally comprises
cis-acting long terminal repeats (LTRs) with packaging capacity for
up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are
sufficient for replication and packaging of a vector, which is then
used to integrate the expression construct into the target cell to
provide long term expression. Widely used retroviral vectors
include those based upon murine leukemia virus (MuLV), gibbon ape
leukemia virus (GaLV), simian immunodeficiency virus (SrV), human
immunodeficiency virus (HIV), and combinations thereof (see, e.g.,
Buchscher et al., J Virol. 56:2731-2739 (1992); Johann et al, J.
Virol. 65:1635-1640 (1992); Sommerfelt et al, Virol. 76:58-59
(1990); Wilson et al, J. Virol. 63:274-2318 (1989); Miller et al.,
J. Virol. 65:2220-2224 (1991); PCT/US94/05700; Miller and Rosman
BioTechniques 7:980-990, 1989; Miller, A. D. Human Gene Therapy
7:5-14, 1990; Scarpa et al Virology 75:849-852, 1991; Burns et al.
Proc. Natl. Acad. Sci USA 90:8033-8037, 1993).
[0132] Various adeno-associated virus (AAV) vector systems have
also been developed for nucleic acid delivery. AAV vectors can be
readily constructed using techniques known in the art. See, e.g.,
U.S. Pat. Nos. 5,173,414 and 5,139,941; International Publication
Nos. WO 92/01070 and WO 93/03769; Lebkowski et al. Molec. Cell.
Biol. 5:3988-3996, 1988; Vincent et al. (1990) Vaccines 90 (Cold
Spring Harbor Laboratory Press);Carter Current Opinion in
Biotechnology 5:533-539, 1992; Muzyczka. Current Topics in
Microbiol, and Immunol. 158:97-129, 1992; Kotin, Human Gene Therapy
5:793-801, 1994; Shelling and Smith Gene Therapy 7:165-169, 1994;
and Zhou et al. J Exp. Med. 179:1867-1875, 1994.
[0133] Additional viral vectors useful for delivering an expression
construct of the invention include, for example, those derived from
the pox family of viruses, such as vaccinia virus and avian
poxvirus or an alphavirus or a conjugate virus vector (e.g. that
described in Fisher-Hoch et al., Proc. Natl Acad. Sci. USA
56:317-321, 1989).
[0134] Assaying Therapeutic/Prophylactic Potential of Cells and
Soluble Factors
[0135] Methods for determining the ability of soluble factors
derived from STRO-1.sup.bright cells to suppress T-cell activation
will be apparent to the skilled artisan.
[0136] For example, suitable in vitro tests for determining
immunosuppressive activity of the soluble factors are described in
Examples 5 and 8 herein.
[0137] In another example, efficacy of cells and/or soluble factors
described herein is assessed in an in vivo model of experimental
inflammatory encephalomyelitis (EAE) as described in Example 6
herein.
[0138] It will be apparent to the skilled artisan from the
foregoing that the present disclosure also provides a method for
identifying or isolating a soluble factor for suppressing T cell
activation, the method comprising:
[0139] (i) administering a soluble factor to a test subject
suffering from EAE and assessing progression of EAE in the
subject;
[0140] (ii) comparing level of EAE in the subject at (i) to the
level EAE in a control subject suffering from EAE to which the
soluble factor has not been administered,
wherein reduced EAE in the test subject compared to the control
subject indicates that the soluble factor treats, prevents or
delays EAE.
Cellular Compositions
[0141] In one embodiment of the present invention STRO-1.sup.+
cells and/or progeny cells thereof are administered in the form of
a composition. Preferably, such a composition comprises a
pharmaceutically acceptable carrier and/or excipient.
[0142] The terms "carrier" and "excipient" refer to compositions of
matter that are conventionally used in the art to facilitate the
storage, administration, and/or the biological activity of an
active compound (see, e.g., Remington's Pharmaceutical Sciences,
16th Ed., Mac Publishing Company (1980). A carrier may also reduce
any undesirable side effects of the active compound. A suitable
carrier is, for example, stable, e.g., incapable of reacting with
other ingredients in the carrier. In one example, the carrier does
not produce significant local or systemic adverse effect in
recipients at the dosages and concentrations employed for
treatment.
[0143] Suitable carriers for this invention include those
conventionally used, e.g., water, saline, aqueous dextrose,
lactose, Ringer's solution, a buffered solution, hyaluronan and
glycols are preferred liquid carriers, particularly (when isotonic)
for solutions. Suitable pharmaceutical carriers and excipients
include starch, cellulose, glucose, lactose, sucrose, gelatin,
malt, rice, flour, chalk, silica gel, magnesium stearate, sodium
stearate, glycerol monostearate, sodium chloride, glycerol,
propylene glycol, water, ethanol, and the like.
[0144] In another example, a carrier is a media composition, e.g.,
in which a cell is grown or suspended. Preferably, such a media
composition does not induce any adverse effects in a subject to
whom it is administered.
[0145] Preferred carriers and excipients do not adversely affect
the viability of a cell and/or the ability of a cell to reduce,
prevent or delay pancreatic dysfunction.
[0146] In one example, the carrier or excipient provides a
buffering activity to maintain the cells and/or soluble factors at
a suitable pH to thereby exert a biological activity, e.g., the
carrier or excipient is phosphate buffered saline (PBS). PBS
represents an attractive carrier or excipient because it interacts
with cells and factors minimally and permits rapid release of the
cells and factors, in such a case, the composition of the invention
may be produced as a liquid for direct application to the blood
stream or into a tissue or a region surrounding or adjacent to a
tissue, e.g., by injection.
[0147] STRO-1.sup.+ cells and/or progeny cells thereof can also be
incorporated or embedded within scaffolds that are
recipient-compatible and which degrade into products that are not
harmful to the recipient. These scaffolds provide support and
protection for cells that are to be transplanted into the recipient
subjects. Natural and/or synthetic biodegradable scaffolds are
examples of such scaffolds.
[0148] A variety of different scaffolds may be used successfully in
the practice of the invention. Preferred scaffolds include, but are
not limited to biological, degradable scaffolds. Natural
biodegradable scaffolds include collagen, fibronectin, and laminin
scaffolds. Suitable synthetic material for a cell transplantation
scaffold should be able to support extensive cell growth and cell
function. Such scaffolds may also be resorbable. Suitable scaffolds
include polyglycolic acid scaffolds, e.g., as described by Vacanti,
et al. J. Ped. Surg. 23:3-9 1988; Cima, et al. Biotechnol. Bioeng.
38:145 1991; Vacanti, et al. Plast. Reconstr. Surg. 88:753-9 1991;
or synthetic polymers such as polyanhydrides, polyorthoesters, and
polylactic acid.
[0149] In another example, the cells may be administered in a gel
scaffold (such as Gelfoam from Upjohn Company).
[0150] The cellular compositions useful for the present invention
may be administered alone or as admixtures with other cells. Cells
that may be administered in conjunction with the compositions of
the present invention include, but are not limited to, other
multipotent or pluripotent cells or stem cells, or bone marrow
cells. The cells of different types may be admixed with a
composition of the invention immediately or shortly prior to
administration, or they may be co-cultured together for a period of
time prior to administration.
[0151] Preferably, the composition comprises an effective amount or
a therapeutically or prophylactically effective amount of cells.
For example, the composition comprises about 1.times.10.sup.5
STRO-1.sup.+ cells/kg to about 1.times.10.sup.7 STRO-1.sup.+
cells/kg or about 1.times.10.sup.6 STRO-1.sup.+ cells/kg to about
5.times.10.sup.6 STRO-1.sup.+ cells/kg. The exact amount of cells
to be administered is dependent upon a variety of factors,
including the age, weight, and sex of the patient, and the extent
and severity of the pancreatic dysfunction.
[0152] In some embodiments, cells are contained within a chamber
that does not permit the cells to exit into a subject's
circulation, however that permits factors secreted by the cells to
enter the circulation. In this manner soluble factors may be
administered to a subject by permitting the cells to secrete the
factors into the subject's circulation. Such a chamber may equally
be implanted at a site in a subject to increase local levels of the
soluble factors, e.g., implanted in or near a transplanted
organ.
[0153] In some embodiments of the invention, it may not be
necessary or desirable to immunosuppress a patient prior to
initiation of therapy with cellular compositions. Accordingly,
transplantation with allogeneic, or even xenogeneic, Stro-1.sup.bri
cells or progeny thereof may be tolerated in some instances.
[0154] However, in other instances it may be desirable or
appropriate to pharmacologically immunosuppress a patient prior to
initiating cell therapy. This may be accomplished through the use
of systemic or local immunosuppressive agents, or it may be
accomplished by delivering the cells in an encapsulated device. The
cells may be encapsulated in a capsule that is permeable to
nutrients and oxygen required by the cell and therapeutic factors
the cell is yet impermeable to immune humoral factors and cells.
Preferably the encapsulant is hypoallergenic, is easily and stably
situated in a target tissue, and provides added protection to the
implanted structure. These and other means for reducing or
eliminating an immune response to the transplanted cells are known
in the art. As an alternative, the cells may be genetically
modified to reduce their immunogenicity.
Compositions of Soluble Factors
[0155] In one embodiment of the present invention, STRO-1.sup.+
cell-derived and/or progeny cell-derived supernatant or soluble
factors are administered in the form of a composition, e.g.,
comprising a suitable carrier and/or excipient. Preferably, the
carrier or excipient does not adversely affect the biological
effect of the soluble factors or supernatant.
[0156] In one embodiment, the composition comprises a composition
of matter to stabilize a soluble factor or a component of
supernatant, e.g., a protease inhibitor. Preferably, the protease
inhibitor is not included in an amount sufficient to have an
adverse effect on a subject.
[0157] Compositions comprising STRO-1.sup.+ cell-derived and/or
progeny cell-derived supernatant or soluble factors may be prepared
as appropriate liquid suspensions, e.g., in culture medium or in a
stable carrier or a buffer solution, e.g., phosphate buffered
saline. Suitable carriers are described herein above. In another
example, suspensions comprising STRO-1.sup.+ cell-derived and/or
progeny cell-derived supernatant or soluble factors are oily
suspensions for injection. Suitable lipophilic solvents or vehicles
include fatty oils such as sesame oil; or synthetic fatty acid
esters, such as ethyl oleate or triglycerides; or liposomes.
Suspensions to be used for injection may also contain substances
which increase the viscosity of the suspension, such as sodium
carboxymethyl cellulose, sorbitol, or dextran. Optionally, the
suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions.
[0158] Sterile injectable solutions can be prepared by
incorporating the supernatant or soluble factors in the required
amount in an appropriate solvent with one or a combination of
ingredients described above, as required, followed by filtered
sterilization.
[0159] Generally, dispersions are prepared by incorporating the
supernatant or soluble factors into a sterile vehicle that contains
a basic dispersion medium and the required other ingredients from
those enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum drying and freeze-drying which yields a
powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof. In
accordance with an alternative aspect of the invention, the
supernatant or soluble factors may be formulated with one or more
additional compounds that enhance its solubility.
[0160] Other exemplary carriers or excipients are described, for
example, in Hardman, et a (2001) Goodman and Gilman's The
Pharmacological Basis of Therapeutics, McGraw-Hill, New York, N.Y.;
Gennaro (2000) Remington: The Science and Practice of Pharmacy,
Lippincott, Williams, and Wilkins, New York, N.Y.; Avis, et al.
(eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications,
Marcel Dekker, NY;
[0161] Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms:
Tablets, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990)
Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY;
Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel
Dekker, Inc., New York, N.Y.
[0162] Therapeutic compositions typically should be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
liposome, or other ordered structure. The carrier can be a solvent
or dispersion medium containing, for example, water, ethanol,
polyol (for example, glycerol, propylene glycol, and liquid
polyethylene glycol, and the like), and suitable mixtures thereof.
The proper fluidity can be maintained, for example, by the use of a
coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. In many cases, it will be preferable to include
isotonic agents, for example, sugars, polyalcohols such as
mannitol, sorbitol, or sodium chloride in the composition.
Prolonged absorption of the injectable compositions can be brought
about by including in the composition an agent which delays
absorption, for example, monostearate salts and gelatin. Moreover,
the soluble factors may be administered in a time release
formulation, for example in a composition which includes a slow
release polymer. The active compounds can be prepared with carriers
that will protect the compound against rapid release, such as a
controlled release formulation, including implants and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters,
polylactic acid and polylactic, polyglycolic copolymers (PLG). Many
methods for the preparation of such formulations are patented or
generally known to those skilled in the art.
[0163] The supernatant or soluble factors may be administered in
combination with an appropriate matrix, for instance, to provide
slow release of the soluble factors.
Modes of Administration
[0164] The STRO-1.sup.+ cell-derived supernatant or soluble
factors, STRO-1.sup.+ cells or progeny thereof may be surgically
implanted, injected, delivered (e.g., by way of a catheter or
syringe), or otherwise administered directly or indirectly to the
site in need of repair or augmentation, e.g., an organ or into the
blood system of a subject.
[0165] Preferably, the STRO-1.sup.+ cell-derived supernatant or
soluble factors, STRO-1.sup.+ cells or progeny thereof is delivered
to the blood stream of a subject. For example, the Stro-1.sup.bri
cell-derived supernatant or soluble factors, STRO-1.sup.+ cells or
progeny thereof are delivered parenterally. Exemplary routes of
parenteral administration include, but are not limited to,
intravenous, intramuscular, subcutaneous, intra-arterial,
intraperitoneal, intraventricular, intracerebroventricular,
intrathecal. Preferably, the STRO-1.sup.+ cell-derived supernatant
or soluble factors, STRO-1.sup.+ cells or progeny thereof are
delivered intra-arterially, into an aorta, into an atrium or
ventricle of the heart or into a blood vessel connected to a
pancreas, e.g., an abdominal aorta, a superior mesenteric artery, a
pancreaticoduodenal artery or a splenic artery.
[0166] In the case of cell delivery to an atrium or ventricle of
the heart, it is preferred that cells are administered to the left
atrium or ventricle to avoid complications that may arise from
rapid delivery of cells to the lungs.
[0167] Preferably, the STRO-1.sup.+ cell-derived supernatant or
soluble factors, STRO-1.sup.+ cells or progeny thereof are injected
into the site of delivery, e.g., using a syringe or through a
catheter or a central line.
[0168] Selecting an administration regimen for a therapeutic
formulation depends on several factors, including the serum or
tissue turnover rate of the entity, the level of symptoms, and the
immunogenicity of the entity. Preferably, an administration regimen
maximizes the amount of therapeutic compound delivered to the
patient consistent with an acceptable level of side effects.
Accordingly, the amount of formulation delivered depends in part on
the particular entity and the severity of the condition being
treated.
[0169] In one embodiment, STRO-1.sup.+ cell-derived supernatant or
soluble factors, STRO-1.sup.+ cells or progeny thereof are
delivered as a single bolus dose. Alternatively, STRO-1.sup.+
cell-derived supernatant or soluble factors, STRO-1.sup.+ cells or
progeny thereof are administered by continuous infusion, or by
doses at intervals of, e.g., one day, one week, or 1-7 times per
week. A preferred dose protocol is one involving the maximal dose
or dose frequency that avoids significant undesirable side effects.
A total weekly dose depends on the type and activity of the
compound being used. Determination of the appropriate dose is made
by a clinician, e.g., using parameters or factors known or
suspected in the art to affect treatment or predicted to affect
treatment. Generally, the dose begins with an amount somewhat less
than the optimum dose and is increased by small increments
thereafter until the desired or optimum effect is achieved relative
to any negative side effects. Important diagnostic measures include
those of symptoms of diabetes.
EXAMPLES
Example 1
MSC Preparation
[0170] MSCs are generated de novo from bone marrow as described in
U.S. Pat. No. 5,837,539. Approximately 80-100 ml of marrow was
aspirated into sterile heparin-containing syringes and taken to the
MDACC Cell Therapy Laboratory for MSC generation. The bone marrow
mononuclear cells were isolated using ficoll-hypaque and placed
into two T175 flask with 50 ml per flask of MSC expansion medium
which includes alpha modified MEM (.alpha.MEM) containing
gentamycin, glutamine (2 mM) and 20% (v/v) fetal bovine serum (FBS)
(Hyclone).
[0171] The cells were cultured for 2-3 days in 37.degree. C., 5%CO2
at which time the non-adherent cells were removed; the remaining
adherent cells were continually cultured until the cell confluence
reached 70% or higher (7-10 days), and then the cells were
trypsinized and replaced in six T175 flasks with MSC expansion
medium (50 ml of medium per flask). As described in Table 5 of U.S.
Pat. No. 5,837,539, MSCs isolated and expanded in this manner are
STRO-1 negative.
Example 2
Immunoselection of MPCs by Selection of STRO-3+ Cells
[0172] Bone marrow (BM) is harvested from healthy normal adult
volunteers (20-35 years old), in accordance with procedures
approved by the Institutional Ethics Committee of the Royal
Adelaide Hospital. Briefly, 40 ml of BM is aspirated from the
posterior iliac crest into lithium-heparin anticoagulant-containing
tubes. BMMNC are prepared by density gradient separation using
Lymphoprep.TM. (Nycomed Pharma, Oslo, Norway) as previously
described (Zannettino, A. C. et al. (1998) Blood 92: 2613-2628).
Following centrifugation at 400.times.g for 30 minutes at 4.degree.
C., the buffy layer is removed with a transfer pipette and washed
three times in "HHF", composed of Hank's balanced salt solution
(HBSS; Life Technologies, Gaithersburg, Md.), containing 5% fetal
calf serum (FCS, CSL Limited, Victoria, Australia).
[0173] STRO-3.sup.+ (or TNAP.sup.+) cells were subsequently
isolated by magnetic activated cell sorting as previously described
(Gronthos et al. (2003) Journal of Cell Science 116: 1827-1835;
Gronthos, S. and Simmons, P. J. (1995) Blood 85: 929-940). Briefly,
approximately 1-3.times.10.sup.8 BMMNC are incubated in blocking
buffer, consisting of 10% (v/v) normal rabbit serum in HHF for 20
minutes on ice. The cells are incubated with 200 .mu.l of a 10
.mu.g/ml solution of STRO-3 mAb in blocking buffer for 1 hour on
ice. The cells are subsequently washed twice in HI-IF by
centrifugation at 400.times.g. A 1/50 dilution of goat anti-mouse
.gamma.-biotin (Southern Biotechnology Associates, Birmingham, UK)
in HHF buffer is added and the cells incubated for 1 hour on ice.
Cells are washed twice in MACS buffer (Ca.sup.2+- and
Mn.sup.2+-free PBS supplemented with 1% BSA, 5 mM EDTA and 0.01%
sodium azide) as above and resuspended in a final volume of 0.9 ml
MACS buffer.
[0174] One hundred .mu.l streptavidin microbeads (Miltenyi Biotec;
Bergisch Gladbach, Germany) are added to the cell suspension and
incubated on ice for 15 minutes. The cell suspension is washed
twice and resuspended in 0.5 ml of MACS buffer and subsequently
loaded onto a mini MACS column (MS Columns, Miltenyi Biotec), and
washed three times with 0.5 ml MACS buffer to retrieve the cells
which did not bind the STRO-3 mAb (deposited on 19 December 2005
with American Type Culture Collection (ATCC) under accession number
PTA-7282--see International Publication No. WO 2006/108229). After
addition of a further 1 ml MACS buffer, the column is removed from
the magnet and the TNAP.sup.+ cells are isolated by positive
pressure. An aliquot of cells from each fraction can be stained
with streptavidin-FITC and the purity assessed by flow
cytometry.
Example 3
Cells Selected by STRO-3 mAb are STRO-1.sup.bright cells
[0175] Experiments were designed to confirm the potential of using
STRO-3 mAb as a single reagent for isolating cells
STRO-1.sup.bright cells.
[0176] Given that STRO-3 (IgG1) is a different isotype to that of
STRO-1 (IgM), the ability of STRO-3 to identify clonogenic CFU-F
was assessed by two-colour FACS analysis based on its co-expression
with STRO-1.sup.+ cells isolated using the MACS procedure (FIG. 1).
The dot plot histogram represents 5.times.10.sup.4 events collected
as listmode data. The vertical and horizontal lines were set to the
reactivity levels of <1.0% mean fluorescence obtained with the
isotype-matched control antibodies, 1B5 (IgG) and 1A6.12 (1 gM)
treated under the same conditions. The results demonstrate that a
minor population of STRO-1bright cells co-expressed TNAP (upper
right quadrant) while the remaining STRO-1.sup.+ cells failed to
react with the STRO-3 mAb. Cells isolated by FACS from all four
quadrants were subsequently assayed for the incidence of CFU-F
(Table 1).
TABLE-US-00001 TABLE 1 Enrichment of human bone marrow cells by
dual-colour FACS analysis based on the co-expression of the cell
surface markers STRO-1 and TNAP (refer to Figure 1). FACS sorted
cells were cultured under standard clonogenic conditions in alpha
MEM supplemented with 20% FCS. The data represents the mean number
of day 14 colony- forming cells (CFU-F) per 10.sup.5 cells plated
.+-. SE (n = 3 different bone marrow aspirates). These data suggest
that human MPC are exclusively restricted to the TNAP positive
fraction of BM which co-express the STRO-1 antigen brightly. Bone
Marrow Fraction Frequency of CFU-F/10.sup.5 Cells Enrichment (Fold
Increase) Unfractionated BMMNC 11.0 .+-. 2.2 1.0 TNAP+/STRO-1bright
4,511 .+-. 185 410 TNAP+/STRO-1dull 0.0 0.0
Example 4
Relative Gene and Surface Protein Expression of Stro-1.sup.dull and
Stro-1.sup.bright Cells
[0177] In the first series of experiments, semi-quantitative RT-PCR
analysis was employed to examine the gene expression profile of
various lineage-associated genes expressed by STRO-1.sup.dull or
STRO-1.sup.bright populations, isolated by fluorescence activated
cell sorting (FIG. 2A). In the second series of experiments, flow
cytometry and mean channel fluorescence analysis was employed to
examine the surface protein xpression profile of various
lineage-associated proteins expressed by STRO-1.sup.dull or
STRO-1.sup.bright populations, isolated by fluorescence activated
cell sorting.
[0178] Total cellular RNA was prepared from either 2.times.10.sup.6
STRO-1.sup.bright or STRO-1.sup.dull sorted primary cells,
chondrocyte pellets and other induced cultures and lysed using
RNAzoIB extraction method (Biotecx Lab. Inc., Houston, Tex.),
according to the manufacturer's recommendations. RNA isolated from
each subpopulation was then used as a template for cDNA synthesis,
prepared using a First-strand cDNA synthesis kit (Pharmacia
Biotech, Uppsala, Sweden). The expression of various transcripts
was assessed by PCR amplification, using a standard protocol as
described previously (Gronthos et al., J. Bone and Min. Res.
14:48-57, 1999). Primer sets used in this study are shown in Table
2. Following amplification, each reaction mixture was analysed by
1.5% agarose gel electrophoresis, and visualised by ethidium
bromide staining. RNA integrity was assessed by the expression of
GAPDH.
[0179] Relative gene expression for each cell marker was assessed
with reference to the expression of the house-keeping gene, GAPDH,
using ImageQant software (FIG. 2B, C). In addition, dual-colour
flow cytometric analysis was used to examine the protein expression
profile of ex vivo expanded MPC based on their expression of a
wider range of cell lineage-associated markers in combination with
the STRO-1 antibody. A summary of the general phenotype based on
the gene and protein expression of STRO-1.sup.dull and
STRO-1.sup.bright cultured cells is presented in Table 3. The data
indicate that ex vivo expanded STRO-1.sup.bright MPC exhibit
differentially higher expression of markers associated with
perivascular cells, including angiopoietin-1, VCAM-1, SDF-1,
IL-1.sub..beta., TNF.alpha., and RANKL. Comparisons between the
protein and gene expression profiles of STRO-1.sup.dull and
STRO-1.sup.bri cultured cells are summarised in Tables 3 and 4.
[0180] Subtractive hybridization studies were also performed in
order to identify genes uniquely expressed by STRO-1.sup.bright
cells. Briefly, STRO-1.sup.dull and STRO-1.sup.bright were isolated
as described above (see FIG. 3A). Total RNA was prepared from
STRO-1.sup.dull and STRO-1.sup.bright cells pooled from 5 different
marrow samples using the RNA STAT-60 system (TEL-TEST).
First-strand synthesize was performed using the SMART cDNA
synthesis kit (Clontech Laboratories). The resultant
mRNA/single-stranded cDNA hybrid was amplified by long-distance PCR
(Advantage 2 PCR kit; Clontech) using specific primer sites at the
3' and 5' prime ends formed during the initial RT process according
to the manufacturer's specifications. Following RsaI digestion of
the STRO-1bright cDNA, 2 aliquots were used to ligate different
specific adaptor oligonucleotides using the Clontech PCR-Select
cDNA Subtraction Kit. Two rounds of subtractive hybridization were
performed using STRO-1.sup.bright (tester) and STRO-1.sup.dull
(driver) cDNA, and vice versa, according to the manufacturer's
protocol. This procedure was also performed in reverse using
STRO-1.sup.dull tester cDNA hybridized against STRO-1.sup.bright
driver cDNA.
[0181] To identify genes uniquely expressed by STRO-1.sup.bright
population, STRO-1.sup.bright-subtracted cDNA was used to construct
replicate low-density microarray filters comprising 200 randomly
selected bacterial clones transformed with the STRO-1.sup.bri
subtracted cDNAs ligated into a T/A cloning vector. The microarrays
were subsequently probed with either [.sup.32P] dCTP-labeled
STRO-1.sup.bri or STRO-1.sup.dull subtracted cDNA (FIG. 3B-C).
Differential screening identified a total of 44 clones, which were
highly differentially expressed between the STRO-1.sup.dull and
STRO-1.sup.bright subpopulations. DNA sequencing of all the
differentially expressed clones revealed that only 1 clone was
representative of a known stromal cell mitogen; namely,
platelet-derived growth factor (PDGF) (Gronthos and Simmons, Blood,
85: 929-940, 1995). Interestingly, 6 of the 44 clones were found to
contain DNA inserts corresponding to the chemokine, stromal-derived
factor-1 (SDF-1). The high abundance of SDF-1 transcripts in human
STRO-1.sup.bright cells was confirmed by semiquantitative RT-PCR of
total RNA prepared from freshly sorted STRO-1.sup.bright,
STRO-1.sup.dull, and STRO-1.sup.negative bone marrow subpopulations
(FIG. 3D and Table 3).
TABLE-US-00002 TABLE 2 RT-PCR primers and conditions for the
specific amplification of human mRNA Target Sense/Antisense (5'-3')
Product Gene Primer Sequences Size SEQ ID GAPDH
CACTGACACGTTGGCAGTGG/ 417 SEQ ID NO: 1 CATGGAGAAGGCTGGGGCTC SEQ ID
NO: 2 SDF-1 GAGACCCGCGCTCGTCCGCC/ 364 SEQ ID NO: 3
GCTGGACTCCTACTGTAAGGG SEQ ID NO: 4 IL-1.beta.
AGGAAGATGCTGGTTCCCTCTC/ 151 SEQ ID NO: 5 CAGTTCAGTGATCGTACAGGTGC
SEQ ID NO: 6 FLT-1 TCACTATGGAAGATCTGATTTCTTACAGT/ 380 SEQ ID NO: 7
GGTATAAATACACATGTGCTTCTAG SEQ ID NO: 8 TNF-.alpha.
TCAGATCATCTTCTCGAACC/ 361 SEQ ID NO: 9 CAGATAGATGGGCTCATACC SEQ ID
NO: 10 KDR TATAGATGGTGTAACCCGGA/ 450 SEQ ID NO: 11
TTTGTCACTGAGACAGCTTGG SEQ ID NO: 12 RANKL AACAGGCCTTTCAAGGAGCTG/
538 SEQ ID NO: 13 TAAGGAGGGGTTGGAGACCTCG SEQ ID NO: 14 Leptin
ATGCATTGGGAACCCTGTGC/ 492 SEQ ID NO: 15 GCACCCAGGGCTGAGGTCCA SEQ ID
NO: 16 CBFA-1 GTGGACGAGGCAAGAGTTTCA/ 632 SEQ ID NO: 17
TGGCAGGTAGGTGTGGTAGTG SEQ ID NO: 18 PPAR.gamma.2
AACTGCGGGGAAACTTGGGAGATTCTCC/ 341 SEQ ID NO: 19
AATAATAAGGTGGAGATGCAGGCTCC SEQ ID NO: 20 OCN ATGAGAGCCCTCACACTCCTC/
289 SEQ ID NO: 21 CGTAGAAGCGCCGATAGGC SEQ ID NO: 22 MyoD
AAGCGCCATCTCTTGAGGTA/ 270 SEQ ID NO: 23 GCGAGAAACGTGAACCTAGC SEQ ID
NO: 24 SMMHC CTGGGCAACGTAGTAAAACC/ 150 SEQ ID NO: 25
TATAGCTCATTGCAGCCTCG SEQ ID NO: 26 GFAP CTGTTGCCAGAGATGGAGGTT/ 370
SEQ ID NO: 27 TCATCGCTCAGGAGGTCCTT SEQ ID NO: 28 Nestin
GGCAGCGTTGGAACAGAGGTTGGA/ 460 SEQ ID NO: 29
CTCTAAACTGGAGTGGTCAGGGCT SEQ ID NO: 30 SOX9 CTCTGCCTGTTTGGACTTTGT/
598 SEQ ID NO: 31 CCTTTGCTTGCCTTTTACCTC SEQ ID NO: 32 Collagen
AGCCAGGGTTGCCAGGACCA/ 387 SEQ ID NO: 33 type X TTTTCCCACTCCAGGAGGGC
SEQ ID NO: 34 Aggrecan CACTGTTACCGCCACTTCCC/ 184 SEQ ID NO: 35
ACCAGCGGAAGTCCCCTTCG SEQ ID NO: 36
TABLE-US-00003 TABLE 3 Summary of the Relative Gene Expression in
STRO-1.sup.Bri and STRO-1.sup.Dull populations. A list of genes
which displayed measurable and differential expression between the
STRO-1.sup.Bri and STRO-1.sup.Dull populations as determined by
reverse transcription-PCR are presented. Values represent the
relative gene expression with reference to the house-keeping gene,
GAPDH. Gene Expression relative to GAPDH Tissue Marker
STRO-1.sup.Bri STRO-1.sup.Dull Neurons GFAP (Glial Fibrillary
Acidic 0.1 0.7 Protein) Bone OCN (Osteocalcin) 1.1 2.5 OSX
(Osterix) 0.4 1.3 CBFA-1 (Core Factor Binding 0.3 0.6 Protein-1)
Immunoregulatory RANKL (Receptor Activator of 1.6 0.3 Nuclear
Factor .kappa. B) SDF-I-alpha (Stromal Derived 3.2 0.1
factor-1-alpha) Fat Leptin 3.1 4.2 Cardiomyocytes GATA-4 1.1 2.9
Endothelial cells Ang-1 (Angiopoietin-1) 1.5 0.8 Chondrocytes Sox 9
0.3 1.1 COL X (Collagen X) 3.5 2.8 Pro-inflammatory TNF-alpha
(Tumour 1.7 0.9 Cytokines necrosis alpha)
[0182] To correlate protein surface expression with density of
STRO-1 expression, single cell suspensions of ex vivo expanded
cells derived bone marrow MPC were prepared by trypsin/EDTA
detachment and subsequently incubated with the STRO-1 antibody in
combination with antibodies identifying a wide range of cell
lineage-associated markers. STRO-1 was identified using a goat
anti-murine IgM-fluorescein isothiocyanate while all other markers
were identified using either a goat anti-mouse or anti-rabbit
IgG-phycoerythrin. For those antibodies identifying intracellular
antigens, cell preparations were first labelled with the STRO-1
antibody, fixed with cold 70% ethanol to permeabilize the cellular
membrane and then incubated with intracellular antigen-specific
antibodies. Isotype matched control antibodies were used under
identical conditions. Dual-colour flow cytometric analysis was
performed using a COULTER EPICS flow cytometer and list mode data
collected. The dot plots represent 5,000 listmode events indicating
the level of fluorescence intensity for each lineage cell marker
(y-axis) and STRO-1 (x-axis). The vertical and horizontal quadrants
were established with reference to the isotype matched negative
control antibodies.
TABLE-US-00004 TABLE 4 Summary of the Relative Protein Expression
in STRO-1.sup.Bright and STRO-1.sup.Dull populations. A list of
proteins which displayed differential expression between the
STRO-1.sup.Bright and STRO-1.sup.Dull populations as determined by
flow cytometry are presented. Values represent the relative mean
fluorescence intensity of staining. Mean Fluorescence Intensity
Tissue Marker STRO-1.sup.Bright STRO-1.sup.Dull Neurons
Neurofilament 1.7 20.5 Bone ALK PHOS (Alkaline Phophatase) 5.7 44.5
Immunoregulatory RANKL (Receptor Activator of 658.5 31.0 Nuclear
Factor .kappa. B) Epithelial Cells CytoKeratin 10 + 13 1.2 23.3
Cytokeratin 14 1.8 8.8 Smooth Muscle .alpha.-SMA (Alpha Smooth
Muscle Actin ) 318.0 286.0 Chondrocytes Byglycan 84.4 65.9 Basal
Fibroblast Tenascin C 22.2 6.9 Cardiomyocyte Troponin C 2.5
15.0
[0183] These results show that SDF-1alpha and RANKL are highly
expressed by STRO-1.sup.bright cells. This is important because
both of these proteins are known to be involved in up-regulation of
CD4+ CD25+ regulatory T cells which confer protection against
immune disorders such as GVHD (Loser et al., Nature Medicine
12:1372-1379, 2006; Hess, Biol. Blood Marrow Transplant, 12 (1
Suppl 2):13-21, 2006; and Meiron et al., J. Exp. Medicine
205:2643-2655. 2008).
Example 5
In Vitro Immunosuppressive Activity
[0184] To assess immunosuppressive activity of culture-expanded
STRO-1.sup.bright cells (MPC(B)), we used CD3/CD28 stimulation as a
read-out. Results were compared to a population of
culture-expanded, bone marrow-derived STRO-1 negative cells
isolated as in Example 1 (MSC(A)). Human peripheral blood
mononuclear cells (PBMC) were stimulated with CD3/CD28 coated beads
in the presence of 4 escalating concentrations of MSC and MPC
preparations. The proliferation of T cells was measured by 3H-Tdr
incorporation.
[0185] MSC (A) and Stro-1.sup.bright MPCs (B) were tested for their
ability to suppress the response of human peripheral blood
mononuclear cells (PBMC) to CD3/CD28 stimulation. MSC and MPC or
commercially-purchased control human MSC (Lonza) were added at
different ratios to the cultures of PBMC. After 3 days, 3H-Tdr was
added for 18 hours and the cultures then harvested.
[0186] PBMC proliferation in response to CD3/CD28 was inhibited in
a dose dependent fashion by all preparations. However, preparation
B was clearly superior to the effect produced by preparation A as
well as control hMSC (FIG. 4). At a 1:100 MSC:PBMC ratio, MPC B
still inhibited 70% of control T cell proliferation, whilst control
commercially-purchased MSC (Lonza) and MSC A produced a 50% and 60%
inhibition, respectively (FIG. 5).
Example 6
In Vivo Effect of MPCs on T Cell Proliferation
[0187] For the following experiments the myelin oligodendrocyte
glycoprotein (MOG)-induced experimental inflammatory
encephalomyelitis (EAE) in C57B1/6J mice was used. C57B1/6J mice
display similar phenotypic symptoms (progressive paralysis) to that
of MS patients as well as showing extensive inflammation,
demyelination and axonal loss/damage in the CNS. The immunization
procedure for the induction of EAE, assessment of clinical symptoms
and MPC transplantation used is as follows.
Active Induction of EAE
[0188] Mice were immunized with 200 .mu.g recombinant MOG dissolved
in Phosphate Buffered Saline (PBS) and mixed with an equal volume
of Freund's complete adjuvant containing 400 .mu.g of killed
Mycobacterium tuberculosis H37Ra. 0.1 ml of this mixture was
injected subcutaneously into the right and left flank (total 0.2
ml/mouse) using a 25 gauge (G) needle. Mice were also immunized
with 350 ng inactivated Bordetella pertussis toxin in 0.30 ml of
PBS intravenously (i.v.) via tail vein of on day 0 and day 2 using
a 29 G needle. Gentle pressure was applied to the I.V. site for 30
sec after the injection to reduce the risk of bleeding from the
i.v. site.
[0189] Mice were monitored every 2-5 minutes for 10-15 minutes to
ensure there is no active bleeding.
Treatment with MPCs
[0190] MPCs were isolated essentially as described in Example 2. On
days 8, 10 and 12 after disease induction, 2.times.10.sup.5 or
4.times.10.sup.5 MPCs were administered as a single intravenous
(i.v.) injection in a volume of 200 .mu.l PBS (see Table 5).
Controls received i.v. injections of equal volumes of PBS only.
Mice were monitored daily and clinical signs scored according to
the scale described below. Experiments were continued for
approximately 36 days to monitor the course of disease. At
termination of the experiment, brain, spinal cord and optic nerve
were dissected and fixed in formalin solution.
TABLE-US-00005 TABLE 5 Summary of Treatment Regimen No of cells
Total MPC per mouse injected per Number Treatment per injection 20
g mouse of mice PBS I.V. -- -- 12 High dose MPC 4 .times. 10.sup.5
MPC 6 .times. 10.sup.6 MPC/Kg 5 I.V. Low dose MPC 2 .times.
10.sup.5 MPC 3 .times. 10.sup.6 MPC/Kg 5 I.V.
[0191] MPC-treated mice and controls were culled on day 36 after
disease induction (MOG35-55 immunization). Splenocytes were
cultured in vitro with media alone or re-stimulated with
MOG.sub.35-55 and then T-cell proliferative responses were measured
through [.sup.3H]-thymidine incorporation. The specific
proliferative responses to MOG were compared to the matched
splenocytes cultured in media-alone (unstimulated). Splenocytes
cultured in PMA/Ionomycin served to determine the non-specific
(antigen-independent) stimulation of T cell proliferation.
[0192] Data presented in FIG. 6 demonstrate that T cell immune
responses to secondary in vitro antigenic challenge with MOG are
inhibited in comparison to T cells cultured from control
animals.
[0193] These data show that human MPCs reduce or prevent T cell
immune response to a specific antigen (e.g., antigenic stimulation
by MOG), even 24 days after the last administration of MPCs. The
data indicate that STRO-1 enriched MPC induce tolerance to multiple
sclerosis antigens.
Example 7
In Vitro Effects of MPCs
[0194] The immunoregulatory properties of MPC are tested by
proliferation assays, mixed lymphocyte reactions and cytokines
production as described below.
Proliferation Assays and Mixed Lymphocyte Reactions
[0195] Mononuclear cells are collected from the spleens of healthy
C57BL/6 mice, 2D2 transgenic mice or MOG-immunized mice treated
with MPCs or vehicle alone essentially as described in Example 4.
Single cell suspensions are prepared in complete RPMI media
containing 10% FBS, 2 mM L-glutamine, 100 units/ml penicillin, 100
.mu.g/ml streptomycin (all from Invitrogen), 1 mM sodium pyruvate
(Sigma) and 50 .mu.M .beta.-mercaptoethanol (Sigma). Following red
blood cell lysis, cells are washed twice and then seeded in 96-well
flat bottom microtiter plates (Nunc) in triplicate at a
concentration of 2.5.times.10.sup.5 cells per well in the presence
of either 20 .mu.g/ml MOG35-55 (GL Biochem), 800 ng/ml ionomycin
and 20 pg/ml phorbol myristate acetate (PMA) (both from Sigma), or
into wells pre-coated with 10 .mu.g/ml anti-CD3 and 10 .mu.g/ml
anti-CD8 (both from BD). Cells are then incubated at 37.degree. C.
with 5%CO.sub.2 for 72 hours and 1 .mu.Ci/well [3H] thymidine is
added during the last 18 hours of culture. Cells are harvested onto
filter mats and incorporated radioactive nucleic acids counted on a
Top Count Harvester (Packard Biosciences). For experiments
involving inhibition of T-cell proliferation by MPC, concentrations
of MPC ranging from 2.5 to 0.002.times.10.sup.4 cells per well are
seeded prior to the addition of splenocytes.
[0196] In mixed lymphocyte reactions (MLR), 2.times.10.sup.5
splenocytes from C57BU6 mice (responders) are incubated with equal
numbers of irradiated (20Gy) Balb/c stimulators or irradiated MPC
and cultured for a period of 5 days, with the addition of 1
.mu.Ci/well [3H] thymidine during the last 24 hours of culture.
[0197] In MLRs involving T-cell inhibition, 2.times.10.sup.4
irradiated MPC are seeded into the wells prior to the addition of
splenocytes.
Cytokine Production
[0198] Supernatants used for analysis of cytokine production are
obtained from two day co-cultures of 2.5.times.10.sup.6 splenocytes
from 2D2 transgenic mice stimulated with 20 .mu.g/ml MOG.sub.35-55
alone or in the presence of 2.times.10.sup.4 MPC (MPC: splenocyte
ratio of 1:10). Quantitative analysis of cytokines us performed
using a mouse Th1/Th2/Th17 cytometric bead array (CBA) kit (BD)
essentially according to the manufacturer's instructions and
analyzed on a BD FACSCanto II flow cytometer. The following
cytokines are measured: interleukin (IL)-2, IL-4, IL-6, IL-10,
IL-17A, interferon-.gamma. (IFN-.gamma.) and tumor necrosis
factor-.alpha. (TNF-.alpha.).
[0199] The data of this pilot study have consistently shown that
STRO-1.sup.bright MPCs exhibited superior immunosuppressive
capacities as compared to either no treatment or treatment with
STRO-1 negative MSCs. This was evident in the in vitro assay and,
most importantly in the in vivo assay.
Example 8
Effects of MPCs on PHA-Mediated Lymphocyte Proliferation
[0200] PBMC were stimulated with phytohemagglutinin (PHA; 10 ug/ml;
Sigma Chemical Company, St. Louis, Mo.) to illicit lymphocyte
proliferation. STRO-1 bright cells at arrange of concentrations
(see Table 6) were able to significantly suppress PBMC T cell
proliferative responses as shown in FIG. 7.
TABLE-US-00006 TABLE 6 MLR Dilution of STRO-1.sup.bri cells
Responder Cell # Stimulator Cell (STRO-1.sup.bri) # %
STRO-1.sup.bri cells 50,000/0.1 ml 500/0.1 ml 1% 50,000/0.1 ml
2,500/0.1 ml 5% 50,000/0.1 ml 5,000/0.1 ml 10% 50,000/0.1 ml
10,000/0.1 ml 20% 50,000/0.1 ml 25,000/0.1 ml 50% 50,000/0.1 ml
50,000/0.1 ml 100%
[0201] Similar to the human findings ovine MPCs were able to
significantly inhibit levels of alloimmune responses to ovine PBMCs
stimulated with PHA (FIG. 8). Ovine STRO-3 selected cells were also
able to suppress lymphocyte proliferation in a dose dependent
manner when used as stimulators against ovine PBMCs or purified
ovine T cells (selected using Miltenyi T cell isolation kit) (FIG.
9).
[0202] All references cited in this document are incorporated
herein by reference.
[0203] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
invention as shown in the specific embodiments without departing
from the spirit or scope of the invention as broadly described. The
present embodiments are, therefore, to be considered in all
respects as illustrative and not restrictive.
Sequence CWU 1
1
36120DNAArtificial SequenceGAPDH forward primer 1cactgacacg
ttggcagtgg 20220DNAArtificial SequenceGAPDH reverse primer
2catggagaag gctggggctc 20320DNAArtificial SequenceSDF-1 forward
primer 3gagacccgcg ctcgtccgcc 20421DNAArtificial SequenceSDF-1
reverse primer 4gctggactcc tactgtaagg g 21522DNAArtificial
SequenceIL-1? forward primer 5aggaagatgc tggttccctc tc
22623DNAArtificial SequenceL-1? reverse primer 6cagttcagtg
atcgtacagg tgc 23729DNAArtificial SequenceFLT-1 forward primer
7tcactatgga agatctgatt tcttacagt 29825DNAArtificial SequenceFLT-1
reverse primer 8ggtataaata cacatgtgct tctag 25920DNAArtificial
SequenceTNF- forward primer 9tcagatcatc ttctcgaacc
201020DNAArtificial SequenceTNF- reverse primer 10cagatagatg
ggctcatacc 201120DNAArtificial SequenceKDR forward primer
11tatagatggt gtaacccgga 201221DNAArtificial SequenceKDR reverse
primer 12tttgtcactg agacagcttg g 211321DNAArtificial SequenceRANKL
forward primer 13aacaggcctt tcaaggagct g 211422PRTArtificial
SequenceRANKL reverse primer 14Thr Ala Ala Gly Gly Ala Gly Gly Gly
Gly Thr Thr Gly Gly Ala Gly 1 5 10 15 Ala Cys Cys Thr Cys Gly 20
1520DNAArtificial Sequenceleptin forward primer 15atgcattggg
aaccctgtgc 201620DNAArtificial Sequenceleptin reverse primer
16gcacccaggg ctgaggtcca 201721DNAArtificial SequenceCBFA-1 forward
primer 17gtggacgagg caagagtttc a 211821DNAArtificial SequenceCBFA-1
reverse primer 18tggcaggtag gtgtggtagt g 211928DNAArtificial
SequencePPAR 2 forward primer 19aactgcgggg aaacttggga gattctcc
282026DNAArtificial SequencePPAR 2 reverse primer 20aataataagg
tggagatgca ggctcc 262121DNAArtificial SequenceOCN forward primer
21atgagagccc tcacactcct c 212219DNAArtificial SequenceOCN reverse
primer 22cgtagaagcg ccgataggc 192320DNAArtificial SequenceMyoD
forward primer 23aagcgccatc tcttgaggta 202420DNAArtificial
SequenceMyoD reverse primer 24gcgagaaacg tgaacctagc
202520DNAArtificial SequenceSMMHC forward primer 25ctgggcaacg
tagtaaaacc 202620DNAArtificial SequenceSMMHC reverse primer
26tatagctcat tgcagcctcg 202721DNAArtificial SequenceGFAP forward
primer 27ctgttgccag agatggaggt t 212820DNAArtificial SequenceGFAP
reverse primer 28tcatcgctca ggaggtcctt 202924DNAArtificial
Sequencenestin forward primer 29ggcagcgttg gaacagaggt tgga
243024DNAArtificial Sequencenestin reverse primer 30ctctaaactg
gagtggtcag ggct 243121DNAArtificial SequenceSOX9 forward primer
31ctctgcctgt ttggactttg t 213221DNAArtificial SequenceSOX9 reverse
primer 32cctttgcttg ccttttacct c 213320DNAArtificial
Sequencecollagen type X forward primer 33agccagggtt gccaggacca
203420DNAArtificial Sequencecollagen type x reverse primer
34ttttcccact ccaggagggc 203520DNAArtificial Sequenceaggrecan
forward primer 35cactgttacc gccacttccc 203620DNAArtificial
Sequenceaggrecan reverse primer 36accagcggaa gtccccttcg 20
* * * * *