U.S. patent application number 13/621260 was filed with the patent office on 2013-06-27 for sequential lateral flow capillary device for analyte determination.
This patent application is currently assigned to LIFE TECHNOLOGIES CORPORATION. The applicant listed for this patent is Ari Gargir, Eugene Semenov. Invention is credited to Ari Gargir, Eugene Semenov.
Application Number | 20130164193 13/621260 |
Document ID | / |
Family ID | 46964070 |
Filed Date | 2013-06-27 |
United States Patent
Application |
20130164193 |
Kind Code |
A1 |
Semenov; Eugene ; et
al. |
June 27, 2013 |
SEQUENTIAL LATERAL FLOW CAPILLARY DEVICE FOR ANALYTE
DETERMINATION
Abstract
Disclosed is a lateral flow capillary device and uses thereof
comprising a unipath capillary flow matrix and a plurality of
reservoirs each in fluid communication with the capillary flow
matrix. The device includes one or more pressure delivery systems
configured to urge capillary flow matrix toward a portion of the
housing in which it resides, such that a substantially uniform
pressure is applied over a portion of the capillary flow
matrix.
Inventors: |
Semenov; Eugene; (Petah
Tikva, IL) ; Gargir; Ari; (Rishpon, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Semenov; Eugene
Gargir; Ari |
Petah Tikva
Rishpon |
|
IL
IL |
|
|
Assignee: |
LIFE TECHNOLOGIES
CORPORATION
Carlsbad
CA
|
Family ID: |
46964070 |
Appl. No.: |
13/621260 |
Filed: |
September 16, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61578969 |
Dec 22, 2011 |
|
|
|
Current U.S.
Class: |
422/507 |
Current CPC
Class: |
B01L 3/50273 20130101;
B01L 2300/0825 20130101; B01L 2200/026 20130101; B01L 3/5023
20130101; B01L 2200/16 20130101; G01N 1/28 20130101; B01L 2200/12
20130101; B01L 2400/0406 20130101 |
Class at
Publication: |
422/507 |
International
Class: |
B01L 3/00 20060101
B01L003/00 |
Claims
1. A lateral flow capillary device comprising: a housing having a
proximal end and a distal end, said housing comprising and upper
portion coupled to a lower portion, said upper and lower portions
defining a cavity; a capillary flow matrix residing in the cavity;
and at least a first pressure delivery system configured to apply a
pressure to the capillary flow matrix.
2. The device of claim 1, wherein the first pressure delivery
system is configured to apply a pressure of between about 5 kg to
about 50 kg to capillary flow matrix.
3. The device of claim 1, wherein the first pressure delivery
system is configured to apply a pressure of between about 6 kg to
about 40 kg to capillary flow matrix.
4. The device of claim 1, wherein the first pressure delivery
system is configured to apply a pressure of between about 7 kg to
about 30 kg to capillary flow matrix.
5. The device of claim 1, wherein the first pressure delivery
system is configured to apply a pressure of between about 8 kg to
about 25 kg to capillary flow matrix.
6. The device of claim 1, wherein the first pressure delivery
system is configured to apply a pressure of between about 9 kg to
about 20 kg to capillary flow matrix.
7. The device of claim 1, wherein the first pressure delivery
system is configured to apply a pressure of about 20 kg to
capillary flow matrix.
8. The device of claim 1, wherein said upper housing portion and
said lower housing portion are reversibly engageable.
9. The device of claim 1, wherein the capillary flow matrix
comprises a proximal flow portion and a distal absorption
portion.
10. The device of claim 9, wherein capillary flow matrix is
positioned in the cavity of the housing such that the proximal flow
portion is positioned toward the proximal end of the housing and
the distal absorption portion of the capillary flow matrix is
positioned toward the distal end of the housing.
11. The device of claim 10, wherein the first pressure delivery
system is positioned at the distal end of the housing and is
configured to apply the pressure on the distal absorption portion
of the capillary flow matrix.
12. The device of claim 1, wherein the capillary flow matrix is
constrained within the cavity in the housing.
13. The device of claim 1, wherein the first pressure delivery
system is positioned at the distal end of the housing.
14. The device of claim 1, wherein said capillary flow matrix is
substantially compressible.
15. The device of claim 1, wherein said capillary flow matrix is
substantially comprised of glass fibers.
16. The device of claim 1, wherein said capillary flow matrix is
coupled to a substantially impermeable backing.
17. The device of claim 1, wherein the pressure delivery system is
a spring system.
18. The device of claim 17, wherein the spring system is configured
to urge the capillary flow matrix toward the upper portion of the
housing.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the field of biology and
detection of analytes from environmental and biological fluids,
mainly at points-of-care more particularly, to an improved lateral
flow capillary device and methods for using lateral flow capillary
devices, for example for performing specific binding assays.
BACKGROUND
[0002] The use of specific binding assays is of great value in a
variety of clinical and other applications, see for example PCT
patent application US2004/031220 published as WO 2005/031355.
Specific binding assays involve the detection and preferably
quantitative determination of an analyte in a sample where the
analyte is a member of a specific binding pair consisting of a
ligand and a receptor. The ligand and the receptor constituting a
specific binding pair are related in that the receptor and ligand
specifically mutually bind. Specific binding assays include
immunological assays involving reactions between antibodies and
antigens, hybridization reactions of DNA and RNA, and other
specific binding reactions such as those involving hormone and
other biological receptors. Specific binding assays may be
practiced according to a variety of methods known to the art. Such
assays include competitive binding assays, "direct" and "indirect"
sandwich assays as described, for example, in U.S. Pat. No.
4,861,711; U.S. Pat. No. 5,120,643; U.S. Pat. No. 4,855,240 or EP
284,232.
[0003] Because the complex formed of by a specific binding reaction
is generally not directly observable various techniques have been
devised for labeling one member of the specific binding pair in
order that the binding reaction may be observed. Known labels
include radiolabels, chromophores and fluorophores and enzymes the
presence of which may be detected by means of radiation detectors,
spectrophotometers or the naked eye. When a member of a specific
binding pair is tagged with an enzyme label, a complex may be
detected by the enzymatic activation of a reaction system including
a signal generating substrate/cofactor group wherein a compound
such as a dyestuff, is activated to produce a detectable
signal.
[0004] Lateral flow capillary devices, such as lateral flow
capillary device 10 depicted in FIG. 1, are well known in the
fields of analysis and detection and are often used for quick and
simple implementation of specific binding assay of analyte in a
liquid sample 12. Sample 12 is placed in lateral flow capillary
device 10 through a reservoir 14 to contact a liquid receiving zone
16 of a bibulous capillary flow matrix 18. Receiving zone 16
includes a soluble labeled reagent configured to bind to the
analyte which present in the sample 12. Sample 12 including the
analyte bound to the labeled reagent, migrates by capillary flow to
fill all of capillary flow matrix 18 and to migrate further into
liquid drain 23. During the capillary flow of sample 12 from liquid
receiving zone 16 towards liquid drain 23, sample 12 passes
reaction zone 20 which is observable through an observation window
22. Reaction zone 20 comprises an anti-analyte that together with
the analyte constitutes a specific binding pair. Analyte in sample
20 forms a complex with the anti analyte and is thus captured at
reaction zone 20. As the labeled reagent is bound to the analyte,
and as the analyte is concentrated at reaction zone 20, an
observable signal is produced at the reaction zone 20, where the
intensity of the observable signal is related to the amount of
analyte in the sample.
[0005] Lateral flow capillary devices such as device 10 are
extremely useful as these are simple to operate even by an
unskilled person or under non-laboratory conditions and are
relatively cheap to produce.
[0006] One drawback of known lateral flow capillary devices such as
device 10 is that a sample evenly spreads in all directions until a
border to capillary flow is encountered, such as an edge of the
capillary flow matrix. Thus, sample and any analyte therein are
distributed within the entire volume of the capillary flow matrix
and wasted. It would be advantageous to be able to enable transport
of all of a sample added to a capillary flow matrix to the vicinity
of a respective reaction zone.
[0007] An additional drawback of known lateral flow capillary
devices is that these are not configured for multistep reactions.
To perform a multistep binding assay using a lateral flow capillary
device such as device 10, reagent liquids are added serially. For
example, a device 10 is provided where a liquid receiving zone 16
does not include a labeled reagent.
[0008] First, a sample 12 including analyte is added through
reservoir 14, passes into capillary flow matrix 18 through liquid
receiving zone 16 and is transported by capillary flow to drain 23.
When sample 12 passes through reaction zone 20, analyte in sample
20 forms a complex with the anti analyte located at reaction zone
and is thus captured at reaction zone 20.
[0009] When all of sample 12 has drained into capillary flow matrix
18, a first reagent liquid containing a labeled reagent configured
to bind to the analyte is added through reservoir 14, passes into
capillary flow matrix 18 through liquid receiving zone 16 and is
transported by capillary flow to drain 23. When the first reagent
liquid passes through reaction zone 20, labeled reagent in the
first reagent liquid binds to analyte captured at the reaction
zone.
[0010] When labeled reagent includes an enzyme, then when all of
the first reagent liquid has drained into capillary flow matrix 18,
a second reagent liquid containing an enzyme substrate is added
through reservoir 14, passes into capillary flow matrix 18 through
liquid receiving zone 16 and is transported by capillary flow to
drain 23. When the second reagent liquid passes through reaction
zone 20, the enzyme substrate therein reacts with the enzyme label,
producing a strong observable signal at the reaction zone 20, where
the intensity of the observable signal is related to the amount of
analyte in the sample.
[0011] It is known that multistep binding assays are significantly
more sensitive and accurate than single step binding assays. Thus,
there is a desire to perform multi step binding assays as described
above. It is clear, however, that it is very difficult if not
impossible to achieve accurate and repeatable results for such a
complex process without the use of an expensive robotic system
located in a laboratory. Even with the use of a robotic system,
since any succeeding liquid is added onto a liquid receiving zone
16 already wet with a preceding liquid, mixing of the two liquids
invariably occurs, leading to unpredictable result, adversely
affecting duration of any given step, preventing performance of a
truly sequential reaction, and affecting repeatability and
accuracy.
[0012] In U.S. Pat. No. 5,198,193 is taught a flow capillary device
with multiple capillary paths leading towards a single reaction
zone, each path having a different length and/or a valve to allow
variation of timing of arrival of a liquid to the reaction zone.
Such a device is ineffective as at each intersection of capillary
paths including two different liquids, parallel flows are produced,
analogous to the produced when a succeeding liquid is added onto an
already wet capillary flow matrix as discussed above. Further, the
valves described in such a lateral flow capillary device are
difficult to fabricate.
[0013] In European Patent No. EP 1044372 is taught a lateral flow
capillary device where sample and reagent liquids are added at two
or more adjacent positions along a capillary flow matrix that is
substantially a strip of bibulous material, e.g., 8 micron pore
size polyester backed nitrocellulose. N+1 narrow (e.g., 1 mm)
spacers, impermeable hydrophobic strips of material (mylar or
polyester sticky tape) are placed perpendicularly to the flow
direction to define N broad (e.g., 5 mm) liquid receiving zones
upstream of a reaction zone located upstream of a liquid drain.
When liquids are added simultaneously to the liquid receiving zones
a portion of each liquid is absorbed through the upper surface of
the capillary flow matrix at the liquid receiving zone. Liquid that
is not immediately absorbed remains as drops on the surface of a
respective liquid receiving zone, where adjacent drops are
prevented from mixing or flowing along the surface of the capillary
flow matrix by the spacers. In cases where the liquids are added
simultaneously an interface between the two liquids is formed in
the volume of the matrix underneath the spacer, while excess liquid
remains on the surface of a liquid receiving zone. Liquid from a
first, most downstream, liquid receiving zone is transported
downstream by capillary flow past the reaction zone to the liquid
drain. When all the liquid in the first liquid receiving zone is
exhausted, the second liquid receiving zone is transported
downstream by capillary flow past the reaction zone to the liquid
drain.
[0014] Seemingly the teachings of EP 1044372 provide the ability to
perform multistep reactions using a lateral flow capillary device,
but practically the teachings are severely limited by limitations
imposed by the structure of the lateral flow capillary device.
[0015] A first limitation is that the amount of liquid added to a
liquid receiving zone is limited. The liquid is added as a drop
resting on a liquid receiving zone. If the surface tension of the
liquid is insufficient, for example due to size or due to
detergents in the liquid, if the capillary flow matrix is highly
hydrophillic or if the lateral flow capillary device is perturbed,
the drop collapses and spills from the lateral flow capillary
device.
[0016] A second limitation is that the liquids must be added
simultaneously. If liquids are added non-simultaneously, a liquid
added to a first liquid receiving zone flows into a second,
adjacent, liquid receiving zone. When a second liquid is added to
the second liquid receiving zone, the second liquid flows into a
volume of the matrix from the top through dry parts of the second
liquid receiving zone while the second liquid flows into the same
volume laterally. The two liquids mix, and as discussed above,
leads to unpredictable result, adversely affects duration of a
given step, prevents performance of a truly sequential reaction,
and affects both repeatability and accuracy of the results.
[0017] A third limitation is that the teachings of EP 1044372 may
lead to the formation of a multiple capillary paths. As noted
above, a spacer is a strip of smooth material attached using
adhesive to the top surface of the matrix that has micron scale
features. As a result, capillary paths are formed in the space
between a spacer and the capillary flow matrix through which two
liquids in adjacent liquid receiving zones may be mixed and as
discussed above, leads to unpredictable result, adversely affects
duration of a given step, prevents performance of a truly
sequential reaction, and affects both repeatability and accuracy of
the results.
[0018] An additional disadvantage of the teachings of EP 1044372 is
the reliance on adhesives for securing the spacers to the capillary
flow matrix. In the art it is known that adhesives, especially
non-polymerizing adhesives, are attracted by and over time migrate
into bibulous materials such as nitrocellulose that are suitable
for use as capillary flow matrices (see, for example, Kevin Jones;
Anne Hopkins, Effect of adhesive migration in lateral flow assays;
IVD Technology, September 2000). Thus, after a period of storage,
the adhesive securing a spacer to a capillary flow matrix of a
device made in accordance with the teachings of EP 1044372 would
migrate into the pores of the capillary flow matrix in the region
where the liquid-liquid interface is to form. The presence of a
hydrophobic adhesive in the matrix blocks pores or modify the
capillary properties of the pores so that an interface formed
between liquids is indefinite and not clear, leading to mixing of
the two liquids of the interface and concomitant negative effects.
Another disadvantage of using adhesives is the possible detachment
of the spacers from the matrix during prolonged storage.
[0019] In U.S. Pat. No. 4,981,786 is taught a lateral flow
capillary device with two reservoirs. The provision of a lateral
flow capillary device with two or more reservoirs allows addition
of two or more succeeding liquids without mutual contamination:
once a liquid has been added to a first reservoir, remnants of the
liquid remain on the walls of the reservoir. Any liquid added
through the same reservoir will be contaminated with the remnants.
In a first lateral flow capillary device taught in U.S. Pat. No.
4,981,786, two or three distinct reservoirs are in fluid
communication with a capillary flow matrix through distinct and
physically separated liquid receiving zones. Located at one of the
liquid receiving zones is a reaction zone including a trapping
reagent. A liquid drain is in capillary communication with
capillary flow matrix downstream from the two reservoirs. Although
not entirely clear from the description, it is understood that the
use of the first lateral flow capillary device includes adding a
small volume of sample through a reservoir to provide a spot of
sample at the reaction zone on the capillary flow matrix and
subsequently to add one or more reagents, each reagent through a
different reservoir.
[0020] In a second lateral flow capillary device taught in U.S.
Pat. No. 4,981,786, two distinct reservoirs are in fluid
communication with a capillary flow matrix through distinct and
physically separated liquid receiving zones. In capillary
communication with the upstream edge of the capillary flow matrix
is a liquid reservoir that may be activated to release a reagent
liquid that subsequently migrates downstream. A reaction zone is
located downstream from the two reservoirs. A liquid drain is in
capillary communication with capillary flow matrix downstream from
the reaction zone.
[0021] In both lateral flow capillary devices are taught a number
of structural features to keep a capillary flow matrix in place but
make only minimal contact therewith. Further, it is noted that
there is little or no contact between a reservoirs and the
capillary flow matrix at a respective liquid receiving zone, and if
there is contact it is only light contact resulting from swelling
of the capillary flow matrix upon wetting. Such features preclude
the use of the lateral flow capillary devices as effective devices
for multistep reactions in a manner analogous to the disclosed in
EP 1044372. When a first liquid is added to a first reservoir and
simultaneously a second liquid is added to a second adjacent
upstream reservoir, the first and second liquids both flow into the
capillary flow matrix through a respective liquid receiving zone.
When the two liquids meet, an interface is formed and the first
liquid begins to flow downstream. Uncontrollably, liquid begins to
leak from the capillary flow matrix at any point where an alternate
capillary path exists, for example down the supporting structures
on which the capillary flow matrix rests or along the laterally
disposed walls that hold the capillary flow matrix in place. Liquid
also climbs up any object contacting the upper surface of the
capillary flow matrix, for example where a reservoir contacts the
capillary flow matrix. As a result, liquid leaks away from all
liquid receiving zones through any alternative capillary path,
filling the lateral flow capillary device with liquid and rendering
results of an experiment useless.
[0022] It would be highly advantageous to have a lateral flow
capillary device or methods for using lateral flow capillary
devices for the performance of multistep reactions in the fields of
biology and medicine, particularly for diagnosis not having at
least some of the disadvantages of the prior art.
SUMMARY
[0023] Embodiments of the present invention successfully address at
least some of the shortcomings of the prior art by providing a
lateral flow capillary device and a method including the use of a
lateral flow capillary device allowing performance of multistep
reactions. Embodiments of the present invention allow performance
of multistep reactions such as multistep binding assays accurately
and repeatably even in non-laboratory conditions and even by less
skilled operators.
[0024] According to the teachings of the present invention there is
provided a lateral flow capillary device comprising: a) a unipath
bibulous capillary flow matrix having an upstream end and a
downstream end defining a flow direction; b) at least two
reservoirs in fluid communication with the capillary flow matrix
each through at least one respective liquid receiving zone; wherein
a reservoir contacts a respective liquid receiving zone through an
opening constituting a hollow conduit having a rim pressing the
matrix and wherein a portion of the capillary flow matrix between
the two rims is an interface creation zone.
[0025] In embodiments of the present invention, the pressing is
such that liquid-induced swelling of the matrix is constrained,
that is when the matrix is wet and swells, the rims apply pressure
resisting the swelling.
[0026] In embodiments of the present invention, the rims press the
matrix when the matrix is dry. In embodiments of the present
invention the rims are pressed into the matrix when the matrix is
dry.
[0027] In embodiments of the present invention, the rims are
substantially parallel to the flow direction.
[0028] In embodiments of the present invention, pressure applied by
a rim is substantially uniform about the entire surface of the
rim.
[0029] In embodiments of the present invention, the matrix is
substantially compressible, that is does not break under pressure
which leads to a reduction in volume of the matrix yet
substantially retains structural integrity. In embodiments of the
present invention, the internal surface-area volume.sup.-1 of the
matrix proximate to a rim is higher than distant from the rim.
[0030] In embodiments of the present invention, the matrix
comprises or even essentially consists of glass fibers and/or
nitrocellulose and/or porous polyethylene.
[0031] In embodiments of the present invention, opposite each rim
is disposed a supporting component supporting the matrix against
the pressing.
[0032] In embodiments of the present invention, the matrix is
suspended between the rims and the supporting components.
[0033] In embodiments of the present invention the matrix is
attached to a substantially impermeable backing. In embodiments of
the present invention, the impermeable backing contacts at least
one supporting component supporting the impermeable backing against
the pressing. In embodiments of the present invention, opposite
each rim is disposed a supporting component supporting the matrix
against the pressing. In embodiments of the present invention, the
matrix is suspended between the rims and the supporting
components.
[0034] In embodiments of the present invention, the lateral flow
capillary device further comprises downstream from at least one
liquid receiving zone, a reaction zone comprising at least one
capturing entity (e.g., a member of a specific binding pair)
configured to capture a material (e.g., an analyte or a product of
a reaction involving the analyte) flowing through the capillary
flow matrix. In embodiments, the reaction zone is in a liquid
receiving zone of a reservoir.
[0035] In embodiments of the present invention, the lateral flow
capillary device further comprises downstream from at least two
liquid receiving zones, a reaction zone comprising at least one
capturing entity configured to capture a material flowing through
the capillary flow matrix.
[0036] In embodiments of the present invention, the lateral flow
capillary device further comprises a liquid drain in fluid
communication with the capillary flow matrix downstream from at
least two of the at least two reservoirs.
[0037] In embodiments of the present invention, the fluid
communication through the liquid receiving zones is non-capillary
communication.
[0038] In embodiments of the present invention, the interface
creation zone is a volume of matrix with a length in the flow
direction, and of a width and height substantially of the capillary
flow matrix, that is the interface creation zone corresponds to a
cross section of the matrix with a finite length. In embodiments of
the present invention, the interface creation zone has a length of
at least about 50%, at least about 75%, at least about 100%, even
at least about 150%, and even at least about 400% of a dimension of
a liquid receiving zone in the flow direction.
[0039] In embodiments of the device of the present invention,
liquid induced swelling of the interface creation zone is
unconstrained.
[0040] In embodiments of the present invention, a reservoir is
substantially a container.
[0041] In embodiments of the present invention, the device further
comprises a housing containing the capillary flow matrix. In
embodiments of the present invention, sides of the capillary flow
matrix are substantially devoid of contact with the housing.
[0042] According to the teachings of the present invention there is
also provided a device useful for preparation of lateral flow
capillary device, comprising: a) a first component, including a
reservoir with at least one wall configured to hold liquids and a
lowest area, the lowest area defined by a non-capillary opening
defining a hollow conduit with a rim and at least one extension
protruding from an outer surface of the wall; and b) a second
component, including a body with a counter-support platform at a
top-end and at least one extension protruding from the body wherein
an extension of the first component and a extension of the second
component are configured to mutually engage so that the rim and the
counter-support platform are spaced apart and substantially
parallel.
[0043] In embodiments of the present invention, the opening is a
non-capillary opening, that is of dimensions that are not conducive
to capillary flow therethrough.
[0044] In embodiments of the present invention, the opening has a
cross-sectional area of at least about 1 mm.sup.2, of at least
about 3 mm.sup.2 or even a cross-sectional area of at least about 7
mm.sup.2.
[0045] In embodiments of the present invention, the first component
and the second component each comprise at least two extensions.
[0046] In embodiments of the present invention, at least one first
component extension and at least one second component extension
together define a hinge when engaged.
[0047] In embodiments of the present invention, the mutual engaging
includes interlocking, for example, by snapping together.
[0048] According to the teachings, of the present invention there
is also provided a kit for assembly of a lateral flow capillary
device, comprising: a) a unipath bibulous capillary flow matrix
having a thickness; and b) at least two devices as described above,
wherein the distance is sufficient so that a rim contacts the
matrix when the two components are engaged about the matrix. In
embodiments of the present invention, the distance is sufficient to
clamp the matrix so as to press the rim into the matrix
perpendicularly to the thickness when the two components are
engaged. In embodiments of the present invention, the matrix is
substantially a strip of material, for example comprising glass
fiber.
[0049] In embodiments of the present invention, the matrix is
attached to a substantially impermeable backing. In embodiments of
the present invention, the backing is substantially planar. In
embodiments of the present invention, the matrix together with the
backing are substantially a strip.
[0050] In embodiments of the present invention, the capillary flow
matrix includes a reaction zone comprising at least one capturing
entity (e.g., a member of a specific binding pair) configured to
capture a material (e.g., an analyte or a product of a reaction
involving the analyte) flowing through the capillary flow
matrix.
[0051] According to the teachings of the present invention there is
also provided a method of performing a reaction comprising: a)
providing a lateral flow capillary device as described above; b)
adding a first amount of a first liquid to a first reservoir so
that the first liquid flows into the capillary flow matrix through
the respective liquid receiving zone; and c) adding a second amount
of a second liquid to a second the reservoir so that a second
liquid flows into the capillary flow matrix through a respective
liquid receiving zone; so that a static liquid-liquid interface is
formed between the first liquid and a liquid in an interface
creation zone; wherein the first amount and the second amount are
such that first liquid substantially remains in the first reservoir
and second liquid substantially remains in the second reservoir
subsequent to formation of the static interface; and wherein the
interface begins to move only subsequent to exhaustion of a liquid
from a reservoir. Generally, the interface moves downstream upon
exhaustion of the more downstream reservoir.
[0052] Generally, the static liquid-liquid interface is formed
between the first liquid and the second liquid in the interface
creation zone between the respective reservoirs to which the two
liquids were added.
[0053] In embodiments, the static liquid-liquid interface is formed
between the first liquid and a liquid in the matrix that is located
between the liquid receiving zone associated with the first
reservoir and the liquid receiving zone associated with the second
reservoir. Such a situation occurs, for example when using a device
provided with three reservoirs and three respective liquid
receiving zones where in the reservoir associated with the most
downstream liquid receiving zone is added an amount of the first
liquid and in the reservoir associated with the most upstream
liquid receiving zone is added an amount of the second liquid so
that in neither case does all the liquid enter the matrix, but in
the reservoir of the middle receiving zone is added an amount of a
third liquid that entirely enters the matrix. In such a case two
interfaces are formed: one between the first liquid and the third
liquid and one between the third liquid and the second liquid.
[0054] In embodiments of the present invention, the first liquid
and the second liquid are substantially identical, e.g., both are
analyte containing sample. In embodiments of the present invention,
the first liquid and the second liquid are substantially different,
for example one is an analyte containing sample and one is a
reagent liquid (e.g., a solution including signal producing
label).
[0055] In embodiments of the present invention, the first amount
and the second amount are substantially different. In embodiments
of the present invention, the first amount and the second amount
are substantially equal.
[0056] In embodiments of the present invention, adding of the
second amount is subsequent to the adding of the first amount. In
embodiments of the present invention, adding of the first amount
and of the second amount is substantially simultaneous.
[0057] According to the teachings of the present invention there is
also provided a method of performing a reaction comprising: a)
providing a lateral flow capillary device as described above
including: i) on the capillary flow matrix, a first liquid
receiving zone in fluid communication with a first reservoir; ii)
on the capillary flow matrix upstream of the first liquid receiving
zone, a second liquid receiving zone in fluid communication with a
second reservoir; iii) a first reagent disposed at a location
inside the first reservoir and/or in the capillary flow matrix in
proximity to the first liquid receiving zone or downstream
therefrom; iv) a second reagent disposed at a location inside the
second reservoir and/or in the capillary flow matrix in proximity
to the second liquid receiving zone; b) adding a first amount of a
first liquid to the first reservoir so that the first liquid flows
into the capillary flow matrix through the first liquid receiving
zone to contact the first reagent; c) adding a second amount of a
second liquid to the second reservoir so that the second liquid
flows into the capillary flow matrix through the second liquid
receiving zone to contact the second reagent; so that a static
interface is formed between the first liquid and the second liquid
in the interface creation zone; wherein the first amount and the
second amount are such that liquid substantially remains in the
first reservoir and in the second reservoir subsequent to formation
of the static interface; and wherein the interface begins to move
only subsequent to exhaustion of the liquid from a reservoir.
[0058] In embodiments of the present invention, the first liquid
and the second liquid are substantially identical, e.g., both are
analyte containing sample. In embodiments of the present invention,
the first liquid and the second liquid are substantially different,
for example one is an analyte containing sample and one is a
reagent liquid (e.g., a solution including signal producing
label).
[0059] In embodiments of the present invention, the first amount
and the second amount are substantially different. In embodiments
of the present invention, the first amount and the second amount
are substantially equal.
[0060] In embodiments of the present invention, downstream of the
first liquid receiving zone on the capillary flow matrix is a
reaction zone comprising at least one capturing entity configured
to capture a material flowing through the capillary flow
matrix.
[0061] In embodiments of the present invention, adding of the
second amount and the adding of the first amount is sequential. In
embodiments of the present invention, adding of the first amount
and of the second amount is substantially simultaneous.
BRIEF DESCRIPTION OF DRAWINGS
[0062] The invention is herein described, by way of example only,
with reference to the accompanying drawings. With specific
reference now to the drawings in detail, it is stressed that the
particulars shown are by way of example and for purposes of
illustrative discussion of the preferred embodiments of the present
invention only, and are presented in the cause of providing what is
believed to be the most useful and readily understood description
of the principles and conceptual aspects of the invention. In this
regard, no attempt is made to show structural details of the
invention in more detail than is necessary for a fundamental
understanding of the invention.
[0063] In the drawings:
[0064] FIG. 1 (prior art) depicts a one reservoir lateral flow
capillary device;
[0065] FIG. 2 schematically depicts an embodiment of a lateral flow
capillary device of the present invention including three liquid
reservoirs and a capillary flow matrix without a backing, in cross
section;
[0066] FIG. 3 schematically depicts the formation of standing
columns of liquid in a lateral flow capillary device in accordance
with the method of the present invention;
[0067] FIG. 4 schematically depicts an embodiment of a lateral flow
capillary device of the present invention including four liquid
reservoirs and a capillary flow matrix with a backing, in cross
section;
[0068] FIG. 5A schematically depicts an embodiment of a device of
the present invention useful for preparing a lateral flow capillary
device;
[0069] FIG. 5B schematically depicts a top view of a lateral flow
capillary device made of an assembled kit of the present invention
including two devices of FIG. 5A and a capillary flow matrix of
plastic backed glass fiber;
[0070] FIG. 5C schematically depicts a side view of a lateral flow
capillary device made of an assembled kit of the present invention
including two devices of FIG. 5A and capillary flow matrix of
plastic backed glass fiber;
[0071] FIG. 6A schematically depicts an embodiment of a lateral
flow capillary device of the present invention, exploded in cross
section to show components;
[0072] FIG. 6B schematically depicts of a capillary flow matrix of
the lateral flow capillary device of FIG. 6A;
[0073] FIG. 6C is a schematic depiction of the lateral flow
capillary device of FIG. 6A, assembled in cross section;
[0074] FIG. 7 are results of experiment 2 described below,
comparing detection of an analyte in accordance with the teachings
set forth in the description of Experiment 2 below, in which FIG.
7A depicts the result obtained with the first lateral flow
capillary device, FIG. 7B depicts the result obtained with the
second lateral flow capillary device, and FIG. 7C depicts the
result obtained with the third lateral flow capillary;
[0075] FIG. 8 are results of experiment 3 described below,
comparing detection of an analyte in accordance with the teachings
of the present invention (8A and 8B) and using a single reservoir
lateral flow capillary device (8C and 8D);
[0076] FIG. 9 are results of experiment 4 described below, a
calibration curve for 11-dehydro-TxB2--competition assay acquired
in accordance with the teachings of the present invention; and
[0077] FIG. 10 are results of experiment 10 described below,
showing the correlation between the intensity of fluorescence
emitted by a reaction zone of a lateral flow capillary device of
the present invention and the total volume of liquid added.
[0078] FIGS. 11a and 11b show perspective views of a lateral flow
capillary device according to an alternative embodiment.
[0079] FIGS. 12a and 12b show perspective views of a lateral flow
capillary device according to an alternative embodiment.
[0080] FIG. 13 shows an exploded perspective view of a lateral flow
capillary device according to an alternative embodiment.
[0081] FIG. 14 shows an exploded perspective view of the base of a
lateral flow capillary device according to an alternative
embodiment.
[0082] FIGS. 15a, 15b and 15c are longitudinal cross sectional
views of a lateral flow capillary device according an alternative
embodiment.
[0083] FIGS. 16a and 16b are transverse cross sectional views of
the proximal end of a lateral flow capillary device according to an
embodiment.
[0084] FIGS. 17a and 17b are transverse cross sectional views of
the distal end of a lateral flow capillary device according to an
embodiment.
PREFERRED EMBODIMENTS OF THE INVENTION
[0085] The present invention is of a lateral flow capillary device
and methods of using the lateral flow capillary device. The present
invention allows performance of effective and repeatable multistep
reactions such as multistep specific binding assays for example for
serological testing.
[0086] In the description the embodiments are directed to an
analytical method for detecting an analyte that is a biomarker such
as an antigen, antibody, metabolite, toxicant or other detectable
material from human or other living source such as blood, urine,
tissue, or from a non-living source such as an environmental source
like water, soil or sewage. In the description the embodiments are
directed to binding the analyte to an anti-analyte immobilized at a
reaction zone on the capillary flow matrix which together with the
analyte constitutes a specific binding pair such as an antibody,
antigen, DNA or other specific binding pair (sbp) member and that
the bound analyte is then detected directly or by a labeled reagent
producing a detectable signal or that produces a detectable signal
after being exposed to a third reagent which reacts with the
labeled reagent and produces a detectable signal that can be
visualized or measured by reading instrument.
[0087] The principles, uses and implementations of the teachings of
the present invention may be better understood with reference to
the accompanying description, figures and examples, perusal of
which allows one skilled in the art to implement the teachings of
the present invention without undue effort or experimentation. In
the figures, like reference numerals refer to like parts
throughout.
[0088] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not limited
in its application to the details set forth herein. The invention
can be implemented with other embodiments and can be practiced or
carried out in various ways. It is also understood that the
phraseology and terminology employed herein is for descriptive
purpose and should not be regarded as limiting.
[0089] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include techniques
from the fields of biology, diagnostics engineering, material
science and physics. Such techniques are thoroughly explained in
the literature.
[0090] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention belongs. In
addition, the descriptions, materials, methods and examples are
illustrative only and not intended to be limiting. Methods and
materials similar or equivalent to those described herein can be
used in the practice or testing of the present invention.
[0091] As used herein, the terms "comprising" and "including" or
grammatical variants thereof are to be taken as specifying the
stated features, integers, steps or components but do not preclude
the addition of one or more additional features, integers, steps,
components or groups thereof. This term encompasses the terms
"consisting of" and "consisting essentially of".
[0092] The phrase "consisting essentially of" or grammatical
variants thereof when used herein are to be taken as specifying the
stated features, integers, steps or components but do not preclude
the addition of one or more additional features, integers, steps,
components or groups thereof but only if the additional features,
integers, steps, components or groups thereof do not materially
alter the basic and novel characteristics of the claimed
composition, device or method.
[0093] The term "method" refers to manners, means, techniques and
procedures for accomplishing a given task including, but not
limited to, those manners, means, techniques and procedures either
known to, or readily developed from known manners, means,
techniques and procedures by practitioners of the relevant arts.
Implementation of the methods of the present invention involves
performing or completing selected tasks or steps manually,
automatically, or a combination thereof.
[0094] Herein, the term "analyte" refers to the compound or
composition to be detected or quantitatively analyzed and which has
at least one epitope or binding site. An analyte can be any
substance for which there exist a naturally occurring analyte
specific binding member or for which an analyte-specific binding
member can be prepared. e.g., carbohydrate and lectin, hormone and
receptor, complementary nucleic acids, and the like. Further,
possible analytes include virtually any compound, composition,
aggregation, or other substance which may be immunological
detected. That is, the analyte, or portion thereof, will be
antigenic or haptenic having at least one determinant site, or will
be a member of a naturally occurring binding pair.
[0095] Analytes include, but are not limited to, toxins, organic
compounds, proteins, peptides, microorganisms, bacteria, viruses,
amino acids, nucleic acids, carbohydrates, hormones, steroids,
vitamins, drugs (including those administered for therapeutic
purposes as well as those administered for illicit purposes),
pollutants, pesticides, and metabolites of or antibodies to any of
the above substances.
[0096] Generally an analyte is found in a "sample" and the
teachings of the present invention are applied to the sample to
determine the presence of or an amount of analyte present in a
sample.
[0097] Herein the term "sample" refers to anything which may
contain an analyte for which an analyte assay is desired. The
sample may be a biological sample, such as a biological fluid or a
biological tissue. Examples of biological fluids include urine,
blood, plasma, serum, saliva, semen, stool, sputum, cerebral spinal
fluid, tears, mucus, amniotic fluid or the like. Biological tissues
are aggregate of cells, usually of a particular kind together with
their intercellular substance that form one of the structural
materials of a human, animal, plant, bacterial, fungal or viral
structure, including connective, epithelium, muscle and nerve
tissues. Examples of biological tissues also include organs,
tumors, lymph nodes, arteries and individual cell(s). In addition,
a solid material suspected of containing the analyte can be used as
the test sample once it is modified to form a liquid medium or to
release the--analyte. Pretreatment may involve preparing plasma
from blood, diluting viscous fluids, and the like. Methods of
treatment can involve filtration, distillation, separation,
concentration, inactivation of interfering components, and the
addition of reagents. Besides physiological fluids, other samples
can be used such as water, food products, soil extracts, and the
like for the performance of industrial, environmental, or food
production assays as well as diagnostic assays. The selection and
pretreatment of biological, industrial, and environmental samples
prior to testing is well known in the art and need not be described
further.
[0098] As used herein, the term "specifically binds" refers to the
binding specificity of a "Specific binding pair member" which is a
member of a specific binding pair, i.e., two different molecules
wherein one of the molecules specifically binds with the second
molecule through chemical or physical means. The two molecules are
related in the sense that their binding with each other is such
that they are capable of distinguishing their binding partner from
other assay constituents having similar characteristics. The
members of the specific binding pair are referred to as ligand and
receptor (anti ligand), sbp member and sbp partner, and the like. A
molecule may also be a sbp member for an aggregation of molecules;
for example an antibody raised against an immune complex of a
second antibody and its corresponding antigen may be considered to
be an sbp member for the immune complex.
[0099] In addition to antigen and antibody specific binding pair
members, other specific binding pairs include, as examples without
limitation, biotin and avidin, carbohydrates and lectins,
complementary nucleotide sequences, complementary peptide
sequences, effector and receptor molecules, enzyme cofactors and
enzymes, enzyme inhibitors and enzymes, a peptide sequence and an
antibody specific for the sequence or the entire protein, polymeric
acids and bases, dyes and protein binders, peptides and specific
protein binders (e.g., ribonuclease, S-peptide and ribonuclease
S-protein), metals and their chelators, and the like. Furthermore,
specific binding pairs can include members that are analogs of the
original specific binding member, for example an analyte-analog or
a specific binding member made by recombinant techniques or
molecular engineering.
[0100] A sbp member is analogous to another sbp member if they are
both capable of binding to another identical complementary sbp
member. Such a sbp member may, for example, be either a ligand or a
receptor that has been modified by the replacement of at least one
hydrogen atom by a group to provide, for example, a labeled ligand
or labeled receptor. The sbp members can be analogous to or
complementary to the analyte or to an sbp member that is
complementary to the analyte. If the specific binding member is an
immunoreactant it can be, for example, an antibody, antigen,
hapten, or complex thereof. If an antibody is used, it can be a
monoclonal or polyclonal antibody, a recombinant protein or
antibody, a chimeric antibody, a mixture(s) or fragment (s)
thereof, as well as a mixture of an antibody and other specific
binding members. The details of the preparation of such antibodies
and their suitability for use as specific binding members are known
to those skilled in the art.
[0101] "Labeled reagent" refers to a substance comprising a
detectable label attached with a specific binding member. The
attachment may be covalent or non-covalent binding, but the method
of attachment is not critical to the present invention. The label
allows the label reagent to produce a detectable signal that is
related to the presence of analyte in the sample. The specific
binding member component of the label reagent is selected to
directly bind to the analyte or to indirectly bind the analyte by
means of an ancillary specific binding member, which is described
in greater detail hereinafter.
[0102] In addition, the specific binding member may be labeled
before or during, the performance of the assay by means of a
suitable attachment method.
[0103] "Label" refers to any substance which is capable of
producing a signal that is detectable by visual or instrumental
means. Various labels suitable for use in the present invention
include labels which produce signals through either chemical or
physical means. Such labels can include enzymes, fluorescent
compounds, chemiluminescent compounds, and radioactive labels.
Other suitable labels include particulate labels such as colloidal
metallic particles such as gold, colloidal non-metallic particles
such as selenium, dyed or colored particles such as a dyed plastic
or a stained microorganism, organic polymer latex particles and
liposomes, colored beads, polymer microcapsules, sacs,
erythrocytes, erythrocyte ghosts, or other vesicles containing
directly visible substances, and the like. Typically, a visually
detectable label is used as the label component of the label
reagent, thereby providing for the direct visual or instrumental
readout of the presence or amount of the analyte in the test sample
without the need for additional signal producing, components at the
detection sites.
[0104] The selection of a particular label is not critical to the
present invention, but the label will be capable of generating a
detectable signal either by itself, or be instrumentally
detectable, or be detectable in conjunction with one or more
additional signal producing components.
[0105] A variety of different label reagents can be formed by
varying either the label or the specific binding member component
of the label reagent; it will be appreciated by one skilled in the
art that the choice involves consideration of the analyte to be
detected and the desired means of detection. As discussed below, a
label may also be incorporated used in a control system for the
assay.
[0106] For example, one or more signal producing components can be
reacted with the label to generate a detectable signal. If the
label is an enzyme, then amplification of the detectable signal is
obtained by reacting the enzyme with one or more substrates or
additional enzymes and substrates to produce a detectable reaction
product.
[0107] Labeled enzymes used in the field include, for example,
Alkaline phosphatase, Horseradish peroxidase, Glucose oxidase and
Urease.
[0108] In an alternative signal producing system, the label can be
a fluorescent compound where no enzymatic manipulation of the label
is required to produce the detectable signal. Fluorescent molecules
include, for example, fluorescein, phycobiliprotein, rhodamine and
their derivatives and analogs are suitable for use as labels in
such a system.
[0109] The use of dyes for staining biological materials, such as
proteins, carbohydrates, nucleic acids, and whole organisms is
documented in the literature. It is known that certain dyes stain
particular materials preferentially based on compatible chemistries
of dye and ligand. For example, Coomassie Blue and Methylene Blue
for proteins, periodic acid-Schiffs reagent for carbohydrates,
Crystal Violet, SafraninO, and Trypan Blue for whole cell stains,
Ethidium bromide and Acridine Orange.
[0110] "Signal producing component" refers to any substance capable
of reacting directly or indirectly with the labeled reagent to
produce signal that is detectable by visual or instrumental mean.
The component may be substrate catalyzed by the labeled enzyme or
dyes that may react chemically with the label reagent
(dsDNA/Acridine Orange), enzymes substrate such as: BCIP/NBT;
Azonaphtol phosphate; 3-AEC; 4-chloronaphyhol; tetrazolium
salt/PMS; Urea/PH indicators.
[0111] In embodiments of the present invention, a capillary flow
matrix includes at least one reaction zone. A reaction zone is a
region or volume of the matrix comprising at least one capturing
entity configured to capture a material flowing through the
capillary flow matrix in defined regions for conducting the assay
reaction including a test line and a control line. A "test line" Is
the region in the reaction zone, in which the analytical assay is
performed. The region comprises specific binding pair (sbp) member
which is immobilized to the matrix of the capillary path. The sbp
member can be an antibody or antigen nucleic acid or modifications
of the above. It may by proteins like avidin and its derivatives or
saccharides such has lectins. Which are part of binding pair being
capable of binding directly or indirectly the analyte of interest.
Several test line may be in the reaction zone each of a distinct
specific binding pair for different analytes. A "control line" Is
the region in the reaction zone, in which a reaction for confirming
the validity of the assay is performed; the control line may also
be a calibration line or lines for correction of the assay signals
(results) obtained in the test line. The control line comprise of
immobilized spb member with binding abilities to one or more of the
reagents participating in the reaction or compounds existing in the
sample.
[0112] In the present invention, a capillary flow matrix is
bibulous, that is comprises a bibulous, porous or other cavity
shaped material allowing capillary transport of liquids
therethrough, that is the pores define a continuous system of
capillary flow channels. Generally, for aqueous liquids capillary
transport requires a continuous path of pores of less than about 2
mm in size, generally in the range of 0.05 microns to 100 microns.
As is described herein, a suitable capillary flow matrix is
substantially compressible, that is to say, retains structural
integrity and does not break under applied pressure which leads to
a reduction in volume, for example pressure applied by the
reservoir rims. In embodiments, pressure applied to a capillary
flow matrix perpendicularly by a reservoir rim compresses the
capillary flow matrix to substantially same extent through the
entire height of the capillary flow matrix. In embodiments, a
matrix is thick enough and soft enough so that compression caused
by applied pressure is local to the pressing. In embodiments,
pressure applied by a rim to a capillary flow matrix substantially
compresses the matrix and reduces the internal surface-area
volume.sup.-1 to a depth of no more than 40% of the thickness.
[0113] "Bibulous material" include but are not limited to materials
composed of glass fiber paper or derivatized glass fiber paper,
cellulose and its derivatives, nylons, PVDF, polysulfones, PTFE and
polypropylene, paper and derivatized paper, see Eric Jallerat and
Volkmar Thom, "Filter membranes and bioseparation equipment and
supplies" by IVD Technology (2004) or catalogues of manufacturers
such as Millipor Corp. (Bedford, Mass., USA), Watman Inc. (New
Jersey, USA) or Ahlstrom Corp. (Helsiniki, Finland).
[0114] Typically, the bibulous member consists of a series of
fibers drawn together in parallel to form an open wick with some
mechanical integrity due to bonding between the fibers, with the
space between the fibers acting to form channels, which draw up
liquid. Suitable fibers include polyester, polyamides such as
nylons, and bicomponent fibers such as polyethylene/polyester,
nylon/polyester and the like. Bicomponent polyethylene/polyester
fibers typically comprise a polyester central core with an external
sheath of polyethylene. Inherently hydrophobic fibers such as
polypropylenes can also be used provided they are water wettable
or, if necessary, are rendered water wettable by other components
such as surfactants or hydrophilic polymers. In principle any
wettable fiber is suitable.
[0115] Fibers can be formed into a bibulous member by a variety of
processes, such as annealing to partially melt the surface/sheath
region and cause interpenetration of the polymer chains, which set
on cooling see. Alternatively, adhesives, such as latex adhesives,
may be used.
[0116] Capillary matrices of embodiments of the invention are of
various forms including but not limited to sheets, columns,
membranes, and compressed fibers. Suitable materials include but
are not limited to porous materials and fibrous materials,
including woven, rationally oriented and randomly oriented fibrous
materials. Suitable materials include polymeric materials such as
porous polymers including porous polyethylene, polypropylene,
polytetrafluoroethylene (PTFE), ethylene vinyl acetate (EVA),
polyether sulfone (PS), thermoplastic urethane (TPU), polyamide
(e.g., Nylon 6) and copolymers thereof such as porous polymers
manufactured by the Porex Corporation, Fairburn Ga., USA. Suitable
materials include fibrous materials such as cellulose, cellulosic
materials, cellulose derivatives, glass fibers, paper, filter
paper, chromatographic paper, synthetic or modified naturally
occurring polymers, such as nitrocellulose, cellulose acetate and
cotton.
[0117] In embodiments, a bibulous capillary flow matrix of the
present invention is a uniform structure such as strip of paper or
a combination of several materials comprising a unipath structure.
In embodiments a capillary flow matrix of the present invention is
attached to a substantially impermeable backing material, for
example as is known in the field of thin-layer chromatography where
porous fibrous matter is bound to a solid impermeable backing. For
example, generally a backing is of the same dimensions as the
capillary flow matrix: when smaller or larger then the interface
between the matrix and backing may produce a capillary path
parallel to the capillary path defined by the capillary flow
matrix. Suitable materials from which to form a backing include but
are not limited to polyethylene, polypropylene,
poly(4-methylbutene), polystyrene, polymethacrylate, poly(ethylene
terephthalate), nylon, poly(vinyl butyrate), glass, ceramics,
metals, polyurethane, neoprene, latex and silicone rubber.
[0118] A material exceptionally suitable for preparing a capillary
flow matrix of the present invention is glass fiber especially
plastic backed glass fiber, including glass fiber derivative such
as glass fiber/cellulose/polyester matrices. Glass fiber membranes
are relatively thick, (typically up to 2 mm), have pore sizes of
1-40 micron and a relatively high water flow rate (when compared to
typical nitrocellulose matrix) allowing large sample and reagent
flow through. An additional advantage of glass fiber, as noted
above, is that glass fiber is relatively thick, soft and
compressible so that when pressure is applied in accordance with
the teachings of the present invention, compression is local to the
point of pressure.
[0119] A material exceptionally suitable for preparing a capillary
flow matrix of the present invention is nitrocellulose, especially
plastic backed nitrocellulose, especially having a pore size of
between 0.45 and 15 micron.
[0120] A material exceptionally suitable for preparing a capillary
flow matrix of the present invention is porous polyethylene,
especially having a pore size of between 0.2 and 20 micron,
preferably between 1 and 12 micron, available from the Porex
Corporation, Fairburn Ga., USA.
[0121] The actual physical size of a capillary flow matrix of a
lateral flow capillary device of the present invention is
determined by many factors especially the material from which the
matrix is made and the specific use or uses for which the lateral
flow capillary device is intended. That said, in some embodiments a
lateral flow capillary device of the present invention is a
manually operated lateral flow capillary device. In some
illustrative though non-limiting embodiments of the present
invention, it is generally preferred that the length of a capillary
flow matrix be convenient for manual use and storage of a lateral
flow capillary device, which is to say generally but not
necessarily at least about 1 cm, and generally not greater than
about 30 cm, not greater than about 15 cm and even not greater than
about 10 cm.
[0122] In some illustrative though non-limiting embodiments of the
present invention, it is generally preferred that the width of a
capillary flow matrix be sufficiently narrow to allow concentration
of a material producing a signal in a small area to increase the
contrast of a signal produced and reduce the liquid capacity of the
capillary flow matrix, but also sufficiently wide to allow simple
observation of the signal by a user, which is to say generally but
not necessarily between about 1 mm and 20 mm.
[0123] In embodiments of the present invention, it is generally
preferred that the capillary flow matrix be relatively thick to
allow a high liquid capacity and flow rate and also ensure that the
pressure applied by the rims compresses the matrix only locally.
Preferably the capillary flow matrix is up to about 2 mm thick, up
to about 1 mm thick, and preferably between about 0.05 and about
0.5 mm thick.
[0124] In embodiments of the present invention a capillary flow
matrix is in capillary communication with a liquid drain. A liquid
drain is generally a component made of a bibulous material and
having a liquid absorbing capacity that is significantly larger
than that of a respective capillary flow matrix. In embodiments of
the present invention, a liquid drain is integrally formed with a
respective capillary flow matrix. In embodiments of the present
invention, a liquid drain constitutes at least one component
distinct from a respective capillary flow matrix. In embodiments of
the present invention, a liquid drain is of a shape or of material
that allows a faster rate of capillary movement than through a
respective capillary flow matrix. Suitable materials from which to
fashion a drain are described, for example, in U.S. Pat. No.
4,632,901, such as, for example, fibrous materials such as
cellulose acetate fibers, cellulose or cellulose derivatives,
polyester, or polyolefins.
[0125] In embodiments of the present invention, reservoirs are of
any suitable shape or size. As a joint between two faces may define
a capillary channel, in embodiments, the inner surface of a
reservoir in contact with or immediate proximity with a liquid
receiving zone is continuous, for example circular, oval or
otherwise curved. The volume of a given reservoir is determined by
many factors and the exact implementation of a respective lateral
flow capillary device. That said, a typical reservoir of a lateral
flow capillary device of the present invention generally has a
capacity of at least about 5 microliter, at least about 20
microliter or even at least about 50 microliter and generally no
greater than about 5000 microliter, no greater than about 1000
microliter and even no greater than about 300 microliter.
Lateral Flow Capillary Device of the Present Invention
[0126] An embodiment of a lateral flow capillary device of the
present invention, 24 is depicted in FIG. 2. Lateral flow capillary
device 24 includes a unipath bibulous capillary flow matrix 18
having an upstream end 26 and a downstream end 28 defining a flow
direction 30. Capillary flow matrix 18 of lateral flow capillary
device 24 is substantially porous membrane of enforced
nitrocellulose devoid of a backing layer.
[0127] Three reservoirs, a downstream reservoir 32a, a middle
reservoir 32b and an upstream reservoir 32c constituting
open-topped containers, are in non-capillary fluid communication
(to preserve the unipath of lateral flow capillary device 24) with
capillary flow matrix 18 each through a respective liquid receiving
zone 34a, 34b and 34c. The distance between the edges of liquid
receiving zones 34a, 34b and 34c is at least 50% of the dimension
of such a liquid receiving zone in flow direction 30, although in
embodiments is substantially larger. The capillary matrix between
any two receiving zones is defined as an interface creation zone.
Interface creation zone 35a is found between liquid receiving zones
34a and 34b. Interface creation zone 35b is found between liquid
receiving zones 34b and 34c.
[0128] Each reservoir 32a, 32b or 32c contacts a respective liquid
receiving zone 34a, 34b and 34c through an opening at the bottom of
the reservoir constituting a hollow conduit having a rim 36a, 36b
and 36c. Opposite each rim 36a, 36b and 36c are disposed supporting
components 38a, 38b and 38c respectively. Rims 36a, 36b and 36c
press into capillary flow matrix 18, even when capillary flow
matrix is dry while supporting components 38a, 38b and 38c support
capillary flow matrix 18 against the pressing so that capillary
flow matrix 18 is substantially suspended between rims 36a, 36b and
36c and supporting components 38a, 38b and 38c Rims 36a, 36b and
36c and the upper surfaces of supporting components 38a, 38b and
38c are substantially parallel to flow direction 30, ensuring that
pressure applied by a rim 36a, 36b or 36c is substantially uniform
about the entire surface of that rim.
[0129] As capillary flow matrix 18 is substantially compressible,
the internal surface-area per unit volume of matrix 18 proximate to
a rim 36a, 36b or 36c is higher than distant from a rim 36a, 36b or
36c. The presumed significance of this difference is discussed
hereinbelow. The matrix material in interface creation zones 35a
and 35b is unconstrained for liquid-induced swelling.
[0130] Capillary flow matrix 18 is provided with a reaction zone 20
including at least one capturing entity configured to capture a
material such as an analyte or a product of a reaction involving
the analyte flowing through capillary flow matrix 18 downstream
from liquid receiving zones 34a, 34b and 34c.
[0131] In proximity of downstream end 28, capillary flow matrix 18
is in fluid communication with liquid drain 23.
[0132] Capillary flow matrix 18 and liquid drain 23 are
substantially contained within a housing 40 such that all sides of
capillary flow matrix 18 are substantially devoid of contact with
housing 40. Through housing 40 above reaction zone 20 is an
observation window 22 which in embodiments is simply a gap through
housing 40.
[0133] For use, in accordance with the method of the present
invention, a first amount of a first liquid, for example sample
containing analyte is placed in downstream reservoir 32a, flows
into capillary flow matrix 18 through liquid receiving zone 34a and
spreads both upstream and downstream from liquid receiving zone
34a. A second amount of a second liquid, for example labeled
reagent, is placed in middle reservoir 32b, flows into capillary
flow matrix 18 through liquid receiving zone 34b and spreads both
upstream and downstream from liquid receiving zone 34b. A third
amount of a third liquid, for example signal producing component,
is placed in upstream reservoir 32c, flows into capillary flow
matrix 18 through liquid receiving zone 34c and spreads both
upstream and downstream from liquid receiving zone 34c.
[0134] The third liquid flows upstream until all of capillary
matrix 18 upstream of liquid receiving zone 34c becomes saturated
with third liquid. Third liquid flows downstream from liquid
receiving zone 34c until encountering second liquid flowing
upstream from liquid receiving zone 34b forming a static interface
42b (see FIG. 3) somewhere in interface creation zone 35b
wherethrough there is substantially no mixing of liquids. Once
interface 42b is formed, and assuming that the amount of second and
third liquids added is sufficient so as not to be entirely absorbed
into capillary flow matrix 18, a standing column of third liquid is
formed in upstream reservoir 32c as third liquid is prevented from
flowing downstream by pressure applied by second liquid in middle
reservoir 32b.
[0135] Second liquid flows downstream from liquid receiving zone
34b until encountering first liquid flowing upstream from liquid
receiving zone 34a forming a static interface 42a somewhere in
interface creation zone 35a wherethrough there is substantially no
mixing of liquids. Once interface 42a is formed, and assuming that
the amount of first and second liquids added is sufficient so as
not to be entirely absorbed into capillary flow matrix 18, a
standing column of second liquid is formed in middle reservoir 32b,
the second liquid prevented from flowing downstream by pressure
applied by first liquid in downstream reservoir 32a.
[0136] First liquid from downstream reservoir 32a drains down
through liquid receiving zone 34a and flows downstream in flow
direction 30 past reaction zone 20 on which sbp member (receptor)
is immobilized. Analyte if present in the sample is captured by the
sbp member while liquid is absorbed into liquid drain 23.
[0137] When all first liquid is drained from downstream reservoir
32a, the first liquid/second liquid interface begins to move
downstream in flow direction 30 as second liquid from middle
reservoir 32b drains down through liquid receiving zone 34b and
flows downstream in flow direction 30. During this time, the second
liquid/third liquid interface remains static. Labeled reagent
present in the second liquid binds to complex formed at reaction
zone 20, if present.
[0138] When all second liquid is drained from middle reservoir 32b,
the second liquid/third liquid interface begins to move downstream
in flow direction 30 as third liquid from upstream reservoir 32c
drains down through liquid receiving zone 34c and flows downstream
in flow direction 30. Signal producing component present in the
third liquid reacts with the labeled reagent bound to complex, to
generate an observable signal.
[0139] As discussed in the introduction, efforts have previously
been made to implement methods that resemble the method of the
present invention but have failed. In the prior art attempts, an
interface between two liquids is formed but no standing columns of
liquid is produced in a reservoir. Rather, liquids invariably leak
from various locations on the capillary flow matrix, generally
anywhere the capillary flow matrix makes contact with a physical
object thus forming an alternate capillary pathway. For example, in
a multireservoir lateral flow capillary device such as disclosed in
U.S. Pat. No. 4,981,786 leakage occurs along support components on
which the capillary flow matrix rests, along laterally disposed
support components that hold the capillary flow in place and up the
contact points of reservoirs with the capillary flow matrix,
producing a flow of liquid on the top surface of the capillary flow
matrix.
[0140] Thus, in contrast to the methods and lateral flow capillary
devices known in the art, the teachings of the present invention
allow performance of multistep reactions using a lateral flow
capillary device where each step is performed with a relatively
precise amount of reagent for a relatively preciseduration. Since
leakage is prevented and since the duration of a reaction step is
accurately determined by the volume of the different liquids added,
many different multistep experiments can be performed to yield
repeatable results. Further, as the volume of liquid is the primary
determinant of duration of a given step, the duration of a given
step is easily modified if required, allowing performance of
kinetic experiments.
[0141] Although, not wishing to be held to any one theory, it is
believed that the reason for the failure of earlier attempts and
the success of the inventor in successfully implementing the
concept of liquid columns in fluid communication with a capillary
flow matrix for use in performing multistep reactions is related to
the forces acting on a liquid inside a capillary flow matrix and
the elimination of potential alternate capillary pathways.
[0142] Water potential .PSI. of the liquid is the potential energy
of water in a given volume (mass) and determines flow direction
from a volume of a higher water potential to a volume with a lower
water potential. The total water potential .PSI. of a volume of
water is the sum of four component potentials: gravitational
(.PSI.g), matrix (.PSI.m), osmotic (.PSI.s), and pressure (.PSI.p).
Gravitational potential depends on the position of the water in a
gravitational field. Matrix potential depends on the adsorptive
forces binding water to a matrix. Osmotic potential depends on the
concentration of dissolved substance in the water (e.g., a solution
having a high salt concentration has a negative value). Pressure
potential depends on the hydrostatic or pneumatic pressure on the
water. Matrix potential is affected by both matrix and liquid
properties. Matrix potential is affected by the attraction of the
liquid to the matrix (hydrophilicity) and the surface area of the
cavities in the matrix.
[0143] In a single reservoir lateral flow capillary device, the
force acting on a liquid inside the capillary flow matrix includes
the force applied by a single column of liquid in a reservoir
contributing to .PSI.p. The attraction of the liquid molecules to
the internal surfaces of the capillary flow matrix (.PSI.m) are
sufficient to prevent leakage of liquid along alternate capillary
paths formed, for example, where some physical object contacts the
capillary flow matrix.
[0144] In a multireservoir lateral flow capillary device, described
herein the force acting on a liquid inside the capillary flow
matrix includes the force applied by two standing columns of liquid
in two reservoirs both contributing to .PSI.p. In such cases,
.PSI.m that is a measure of the attraction between the liquid
molecules and the internal surfaces of the capillary flow matrix
are insufficient to prevent leakage of liquid along alternate
capillary flow paths.
[0145] In embodiments of a lateral flow capillary device of the
present invention, contact points are eliminated except at the rims
of the reservoirs and, if present, at the oppositely disposed
supporting components, which are pressed into the capillary flow
matrix. The pressing of these components locally compresses the
matrix and the pores therein, reducing the volume of the matrix
proximal to these components but not changing the total internal
surface area. Such pressing increases the capillary flow
matrix/liquid interaction energy per unit volume in the vicinity of
the components and therefore increases .PSI.m. This increased
energy is apparently sufficient to compensate for the increased
force applied by the two columns of liquid. In summary, pressing of
the matrix increases the binding energy in the vicinity of the
contact points with the rims or supporting components, reducing the
tendency to leak across the alternative capillary flow path formed
at the contact point.
[0146] In embodiments of the present invention, a given interface
creating zone is relatively wide relative to flanking liquid
receiving zones. An advantage of such embodiments is that the size
of the interface creating zone means that liquid added to one of
the liquid receiving zones requires a significant period of time to
travel through the interface creating zone before arriving at the
neighboring liquid receiving zone. This allows addition of liquids
to different reservoirs to be sequential and to be performed under
more difficult (e.g., non laboratory) conditions, and even by less
skilled operators. An additional advantage of a relatively wide
interface creation zone is to compensate for different absorption
rates of different liquids added. For example, the rate of entry of
a viscous or hydrophobic liquid is relatively slow. A relatively
wide interface creation zone prevents faster matrix entering
liquids from travelling to a liquid receiving zone where a viscous
or hydrophobic liquid is added, allowing the viscous or hydrophobic
liquid to enter the matrix and create a sharp, well-defined
liquid-liquid interface.
[0147] Further, it has been found that the relatively long
interface creating zones leads to the formation of more sharply
defined interfaces that are substantially perpendicular to the flow
direction.
[0148] Many materials used as capillary flow matrices swell upon
contact with water. In lateral flow capillary devices where the
liquid induced swelling of the interface creation zone is
constrained, for example when pressure is applied thereto from
above, the swelling may be inhomogenous and cracks may form in the
matrix, locally modifying the capillary properties of the matrix.
If the interface forms in a volume where the capillary properties
are changed, the interface formed between liquids may be indefinite
and not clear, leading to mixing of the two liquids of the
interface and concomitant negative effects. In embodiments of the
present invention, liquid induced swelling of the interface
creation zone is unconstrained.
[0149] In embodiments of the present invention, the first liquid
and second liquid are added substantially simultaneously to a
respective reservoir.
[0150] In embodiments of the present invention, the first liquid
and second liquid are added sequentially. When the liquids are
added sequentially, the order in which the liquids is added it is
of little significance, as long as a subsequent liquid is added to
a respective reservoir before an earlier added liquid migrates into
the liquid receiving zone of the reservoir of the subsequently
added liquid.
[0151] As noted above, the method of the present invention as
described above is not directed to the transport of liquids through
a capillary flow matrix, but rather allows the performance of
multistep reactions especially multistep specific binding assays,
where each of the two liquids initiates and performs a different
step of a multistep reaction, for example transport of a reagent.
As is clear to one skilled in the art upon perusal of the
description herein, the volume of any given liquid determines to a
large degree the duration of a respective step.
[0152] Depending on the purpose for which lateral flow capillary
device 24 is designed, reaction zone 20 comprises at least one
capturing entity (e.g., a member of a specific binding pair)
configured to capture a material (e.g., an analyte or a product of
a reaction involving the analyte) flowing through the capillary
flow matrix. In embodiments of the present invention, the reaction
zone is in a liquid receiving zone of a respective reservoir.
[0153] In embodiments of the present invention, a lateral flow
capillary device is provided with one or more reagents pre-loaded
onto the capillary flow matrix. Such preloading of reagents is
known in the art of lateral flow capillary devices, for example by
drying reagents onto the matrix, for example by freeze drying,
spray drying, dispensing and air drying.
[0154] In brief, a reagent is loaded onto the capillary flow matrix
in such a way that a liquid added through a specific reservoir will
interact with the reagent. In embodiments, at least one pre-loaded
reagent is configured to react with an added analyte to produce a
reaction product that is subsequently transported downstream along
the capillary flow matrix. In embodiments, at least one pre-loaded
reagent is configured to be solubilized by an added liquid and to
be subsequently transported downstream along the capillary flow
matrix. In embodiments, a preloaded reagent is located
substantially in a liquid receiving zone. In embodiments, a
preloaded reagent is located in the vicinity of a liquid receiving
zone, specifically in an adjacent interface creation zone.
[0155] Embodiments of the present invention allow material to be
preloaded both upstream and downstream of a given liquid receiving
zone, allowing material to be preloaded in a relatively large
region of matrix using simple methods, for example by spray-drying.
Generally, material preloaded downstream from the most downstream
liquid receiving zone is preloaded at any distance from the liquid
receiving zone, generally (but not necessarily) between the liquid
receiving zone and a reaction zone. Material preloaded in the
vicinity of a most upstream liquid receiving zone is generally
loaded downstream from the liquid receiving zone so that all the
material will be used when liquid is introduced into the most
upstream liquid receiving zone. Other preloaded material is
generally preloaded either in the liquid receiving zone or somewhat
upstream or somewhat downstream from the liquid receiving zone, for
example up to about 30% of the length of the adjacent interface
creation zone.
[0156] In embodiments of the present invention, opposite the rims
of the liquid conduits of the reservoirs the matrix is attached to
a substantially impermeable backing material to avoid leakage of
liquids from the capillary flow matrix.
[0157] In FIG. 4 is depicted an embodiment of a lateral flow
capillary device of the present invention, 46.
[0158] In lateral flow capillary device 46, capillary flow matrix
18 is attached to a substantially impermeable backing 48. Together,
capillary flow matrix 18 and impermeable backing 48 constitute a
strip that rests on plateau 50, where backing 48 contacts plateau
50. lateral flow capillary device 46 is provided with four
reservoirs 32a, 32b, 32c and 32d with respective rims 36a, 36b, 36c
and 36d that press the upper surface of capillary flow matrix 18.
Plateau 50 is disposed opposite each rim 36 of each reservoir 32
and thus constitutes a supporting component supporting matrix 18
against the pressing of rims 36.
[0159] Lateral flow capillary device 46 is configured for the
simple performance of four-step reactions.
[0160] A first reagent 52 is preloaded in liquid receiving zone
34a, first reagent 52 being a nutrient configured to cause living
cells contacting first reagent 52 to express certain proteins on
external membranes.
[0161] A second reagent 54 is preloaded to an area of capillary
matrix 18 between liquid receiving zones 34b and 34c, second
reagent 54 being a toxin.
[0162] A third reagent 56 is preloaded to liquid receiving zone
34d, third reagent 56 being an indicator that binds to the certain
protein.
[0163] Reaction zone 20 includes a capture entity configured to
immobilize cells.
[0164] The use of lateral flow capillary device 46 is substantially
similar to the use of lateral flow capillary device 24 as described
above and is clear to one skilled in the art upon perusal of the
description herein.
[0165] A first liquid sample, including living cells is placed in
reservoir 32a, a second liquid placed in reservoir 32b, a third
liquid placed in reservoir 32c and a fourth liquid placed in
reservoir 32d, sequentially or simultaneously. Three liquid
interfaces are formed in the interface creation zones 35a, 35b,
35c, the interface 42a, 42b, 42c. Standing columns of liquid are
produced in reservoirs 32b, 32c and 32d. When the cell-containing
first liquid sample contacts first reagent in liquid receiving zone
34a, the cells begin to produce the specific metabolite. When the
liquid sample reach reaction zone 20 the cells are immobilized.
[0166] When first liquid sample in reservoir 32a is exhausted,
second liquid in reservoir 32b begins to flow through capillary
flow matrix 18, transporting waste and other non-bound material
away from reaction zone 20 towards liquid drain 23.
[0167] When second liquid in reservoir 32b is exhausted, third
liquid in reservoir 32d begins to flow through capillary flow
matrix 18, carrying the second reagent 54. Second reagent 54 is
transported to reaction zone 20, killing immobilized cells.
[0168] When third liquid in reservoir 32c is exhausted, fourth
liquid in reservoir 32d begins to flow through capillary flow
matrix 18, carrying the third reagent 56. Third reagent 56 is
transported to reaction zone 20, producing a visible signal on
cells that expressed the certain proteins on external
membranes.
[0169] Using a plurality of lateral flow capillary devices 46,
substantially identical experiments are performed where only the
amount of second liquid added to reservoir 32b is varied, thus
varying the time between exposure of cells to first reagent 52 and
killing of the cells with exposure to second reagent 54. In such a
way, the kinetics of protein expression is studied.
[0170] In embodiments of the invention is used for applications
other than diagnostic applications including biomolecule extraction
or synthesis, for example, concentration of nucleic acids in a
sample. Nucleic acid absorption particles are attached to a
reaction zone of a capillary flow matrix and a sample containing
nucleic acids is added under binding conditions resulting in
concentration of nucleic acid from the sample. In embodiments the
concentration step is followed by washing, elution and/or analysis
steps.
Methods of Manufacture of a Lateral Flow Capillary Device of the
Present Invention
[0171] In general, manufacture and assembly of a lateral flow
capillary device of the present invention is well within the
ability of one skilled in the art upon perusal of the description
and figures herein using any suitable method with which one skilled
in the art is well acquainted. Suitable methods include methods
that employ one or more techniques including but not limited to
welding, casting, embossing, etching, free-form manufacture,
injection-molding, microetching, micromachining, microplating,
molding, spin coating, lithography or photo-lithography.
[0172] In an aspect of the present invention, a device and a kit
are provided allowing the simple and cheap preparation of a custom
lateral flow capillary device in accordance with the teachings of
the present invention.
[0173] A device 60 of the present invention useful for the
preparation of lateral flow capillary device is depicted in FIG.
5A. Device 60 comprises a first component 62 and a second component
64, connected through protruding extensions 66 and 68 by a hinge
70.
[0174] First component 62 includes a reservoir 32 having one wall
configured to hold liquids. The lowest area of reservoir 32 is a
non-capillary opening 63 defining a hollow conduit with a rim 36.
In embodiments rim 36 is relatively wide, at least about 0.5 mm or
even at least about 1 mm. In embodiments, rim 36 is substantially
planar. To be non-capillary, in embodiments non-capillary opening
63 is relatively large, in embodiments having a cross-sectional
area of at least about 1 mm.sup.2, of at least about 3 mm.sup.2 or
even of at least about 7 mm.sup.2. Opposite extension 66 and also
protruding from reservoir 32 is protrusion 72.
[0175] Second component 64 includes a body 74 with a counter
support platform 76 at the top end of body 74. Opposite extension
68 and also protruding from body 74 is protrusion 78.
[0176] Protrusions 72 and 78 are configured to mutually engage,
interlocking (for example by "snapping together") so as to hold rim
36 and counter support platform 76 substantially parallel spaced
apart at some predetermined distance.
[0177] In device 60, first component 62 is provided with two
extensions 66 and 72 to engage two extensions 68 and 78 of second
component 64. In embodiments, a first component and/or a second
component are provided with only one extension, or with more than
two such extensions each.
[0178] In device 60, extensions 66 and 68 are formed as one piece
to define hinge 70. In embodiments of the present invention,
extensions are configured to be reversibly or irreversibly engaged,
when engaged defining a hinge. In embodiments of the present
invention, extensions are configured to be reversibly or
irreversibly engaged, when engaged not defining a hinge.
[0179] The use of a device of the present invention such as device
60 in the framework of a kit of the present invention, is depicted
in from the top in FIG. 5B and from the side in FIG. 5C. In FIGS.
5B and 5C, a kit of the present invention comprising two devices 60
and a strip of plastic backed glass fiber as a bibulous capillary
flow matrix 18 is depicted in an assembled state, together
constituting an embodiment of the device of the present
invention.
[0180] For assembly, capillary flow matrix 18 of an appropriate
thickness is cut to size and two devices 60 are closed over an
appropriate area of capillary flow matrix 18. The thickness of
capillary flow matrix 18 and the design of devices 60 is such that,
when extensions 72 and 78 are mutually engaged, capillary flow
matrix 18 is clamped between rim 36 and counter support platform 76
In such a state, non-capillary openings 63 defines a liquid
receiving zone. Further, rim 36 presses into capillary flow matrix
18, in accordance with the teachings of the present invention.
[0181] As is clear to one skilled in the art upon perusal of the
description a lateral flow capillary device, including a lateral
flow capillary device of the present invention is easily custom
built and modified with the use of embodiments of devices of the
present invention and embodiments of kits of the present invention.
For example, application of desired reagents to define a reaction
zone or to preload a reagent onto a capillary matrix is simple to
achieve.
[0182] In the art, for example in U.S. Pat. No. 4,981,786, is
taught the introduction of sample or substrate in a downstream
reservoir and addition of a carrier liquid in an upstream reservoir
to transport an reagent located on a capillary flow matrix
downstream to contact the sample or substrate. In an aspect of the
present invention is taught a method where a sample is also used as
a carrier liquid.
[0183] In the method, a lateral flow capillary device substantially
as described above is used including: a first liquid receiving zone
on the capillary flow matrix in fluid communication with a first
reservoir, a second liquid receiving zone on the capillary flow
matrix in fluid communication with a second reservoir upstream of
the first reservoir, a first reagent preloaded inside the first
reservoir and/or at a location on the capillary flow matrix in
proximity to the first liquid receiving zone or downstream
therefrom; a second reagent preloaded at a location inside the
second reservoir and/or on the capillary flow matrix in proximity
to the second liquid receiving zone.
[0184] A first amount of a liquid (e.g., the sample) is added to
the first reservoir so that the liquid flows into the capillary
flow matrix through the first liquid receiving zone to contact the
first reagent, e.g., to react with the first reagent or to
solublize the first reagent.
[0185] A second amount of a liquid (either the same or different)
is added to the second reservoir so that the liquid flows into the
capillary flow matrix through the second liquid receiving zone to
contact the second reagent. The second amount of liquid is added
before, after or substantially simultaneously with the addition of
the first amount of liquid.
[0186] In accordance with the teachings of the present invention,
when the first amount and the second amounts are such that liquid
substantially remains in the first and second reservoirs
respectively, a static interface is formed between the liquid
contacting the first reagent and the liquid contacting the second
reagent in the interface creation zone between the two liquid
receiving zones. In accordance with the teachings of the present
invention as described above, the interface moves only subsequent
to exhaustion of liquid from the first reservoir. In embodiments,
there is a reaction zone downstream of the first liquid receiving
zone on the capillary flow matrix. In embodiments, there is a
reaction zone in the first liquid receiving zone. As is clear to
one skilled, the advantage of this method is that an assay is made
very simple.
[0187] When the liquid added to the first reservoir is the same as
that added to the second reservoir, only one liquid is added (for
example through a single port in communication with a number of
liquid receiving zones) as in a single reservoir lateral flow
capillary device but performs a multistep reaction with all the
advantages thereof. This reduces the number of steps required to
perform an otherwise complex multistep reaction.
Further Improvements:
[0188] Yet further improvements to a lateral flow capillary device
are described in detail below and are depicted in FIGS. 11 through
17.
[0189] A first improvement to the lateral flow capillary device
described above in the optional inclusion of a water repellant or
water impermeable material along the longitudinal aspect of the
capillary flow matrix to prevent lateral leakage of liquids
therefrom and to promote the unidirectional flow of liquids to the
distal end of the lateral flow capillary device. The material may
be coated along the longitudinal edge of the capillary flow matrix,
or may be impregnated into the capillary flow matrix. A variety of
suitable hydrophobic or water impermeable materials are known in
the art and any such material may be employed in the practice of
the present invention without limitation. In some embodiments, a
silicon paste or gel may be applied or impregnated into the
longitudinal aspect of a capillary flow matrix.
[0190] An additional improve to the lateral flow capillary device
is the inclusion of one, optionally more than one, pressure
delivery systems integral to the capillary flow device, wherein the
pressure delivery systems are configured to apply a substantially
uniform pressure of between about 5 kG to about 50 kg to the
capillary flow matrix to prevent unwanted leakage of a liquid from
the liquid reservoirs and ensure proper sequential, unidirectional
flow of the liquid from the reservoirs into the capillary flow
matrix.
[0191] In an embodiment, a lateral flow device may include at least
a first pressure delivery system at the proximal end thereof, the
first pressure delivery system being configured to apply a
substantially uniform pressure to a capillary flow matrix such that
the capillary flow matrix is substantially pressed to one or more
of the liquid reservoirs. The first pressure delivery system may be
configured to deliver between about 5 kg to about 50 kg, between
about 6 to about 40 kg, between about 7 to about 30 kg, between
about 8 to about 25 kg or between about 9 to about 20 kg pressure
to the capillary flow matrix. Without being bound by any one
particular theory of mechanism of action, it has been found that
the application of a substantially uniform pressure on the
capillary flow matrix creates a seal of the flow matrix in the
reservoirs and ensures proper lateral flow of liquids of each
reservoir into the capillary flow matrix.
[0192] In an embodiment, a lateral flow device may include a first
pressure delivery system at the proximal end thereof, in
combination with at least a second pressure delivery system at the
distal end thereof, the first pressure delivery system being
configured to apply a substantially uniform pressure to a proximal
portion of a capillary flow matrix such that the capillary flow
matrix is substantially pressed to one or more of the liquid
reservoirs and the second pressure delivery system being configured
to apply a substantially uniform pressure to a distal absorbent
portion of a capillary flow matrix. In such an embodiment, the
first pressure delivery system may be configured to deliver between
about 5 kg to about 50 kg, between about 6 to about 40 kg, between
about 7 to about 30 kg, between about 8 to about 25 kg or between
about 9 to about 20 kg pressure to the proximal portion of the
capillary flow matrix and the second pressure delivery system may
be configured to deliver between about 100 g to about 5 kg, between
about 200 g to about 4 kg, between about 500 k to about 3 kg, or
between about 1 kg to about 2 kg of pressure to the distal
absorbent portion of the capillary flow matrix.
[0193] A pressure delivery system may include any suitable means of
applying a substantially uniform pressure to at least a portion of
the capillary flow matrix. In one preferred embodiment, a pressure
delivery system particularly suited to the presently described
capillary flow device may include a substantially rigid plate
mounted over a compressed spring residing in the housing of the
lateral flow device. The substantially rigid plate is laterally
moveable within the housing such that it delivers a substantially
uniform compressive force to a capillary flow matrix positioned
between the rigid plate and the liquid reservoirs, in the case of
the first pressure delivery system, and between the capillary flow
matrix and the device housing in the case of the second pressure
delivery system.
[0194] The substantially rigid plate may be made of any
substantially non-compliant material, such as metal, thermoplastic
or organic polymer. A variety of such materials are well known in
the art and many may be used in the practice of the present
invention without limitation and without departing from the spirit
and scope thereof. Exemplary materials that may be used in the
fabrication of a rigid plate include metals such as aluminum,
stainless steel, chrome and the like, rigid thermoplastics such as
polyether ether ketone (PEEK), polyetherketoneketone (PEKK),
polysulfone, and the like. It is well withitn the skill level of
the practitioner having ordinary skill level in the art to test a
variety of materials for use in the present invention without undue
experimentation.
[0195] Turning now to FIG. 11, an exemplary embodiment of a lateral
flow capillary device is shown. Lateral flow capillary device 1000
may include a housing comprising upper portion 1100 and lower
portion 1200. Both upper portion 1100 and lower portion 1200 will
preferably be made of a substantially rigid material, such as,
e.g., injection molded plastic. In some embodiments, upper portion
1100 may optionally include lid 1110 hingedly attached to the
proximal end 1001 thereof. In some embodiments, lid 1110 may
optionally include a clear plastic window 1115 so that a user may
observe the sequential flow of liquids in each of the reservoirs
into the capillary flow unit. Lid 1110 may further include grasping
means 1112 at the distal end thereof to facilitate opening and
closing of the lid. Finally, latching means 1210 is disposed at the
distal end of upper portion 1100, and reversibly engages upper
portion 1100 to lower portion 1200 of the housing, thereby further
ensuring that the required pressure is exerted on all the
components of the device during use.
[0196] FIG. 11b shows the lateral flow device 1000 in FIG. 11a with
lid 1110 in open configuration but with latching means 1210 engaged
so upper portion 1100 is coupled to lower portion 1200 of capillary
flow device 1000. With lid 1110 in open configuration, reservoirs
1116a, 1116b, 1116c and 1116d are exposed and accessible to the
user to add liquid solution thereto. While it is to be understood
that reservoirs 1116a-d may be sized to accept a variety of volumes
of liquids, as described above, preferred embodiments of the
present invention contemplate reservoirs 1116a-c accepting a liquid
volume in the range of about 1 ml to about 5 ml or about 2 ml to
about 3 ml, or about 2 ml, while reservoir 1116d may accept a
volume in the range of about 5 ml to about 20 ml, about 6 ml to
about 15 ml, about 7 ml to about 10 ml, or about 8 ml to about 9
ml. Upper portion 1100 may optionally include window 1117 through
which a user can visualize a portion of the capillary flow matrix
1118, such as, for example, the central reaction zone as previously
described.
[0197] Turning now to FIG. 12a, latching means 1210 may be
disengaged to that upper portion 1100 may be separated therefrom to
expose cavity 1125 positioned in base 1200 of lateral flow device
1000. Cavity 1125 is sized to accept the capillary flow matrix 1120
comprising proximal flow portion 1118 and distal absorption portion
1119 (also referred to as "liquid drain" above). The capillary flow
matrix may be sized to have any dimension according to the intended
use. In certain illustrative embodiments, capillary flow matrix
1120 may be anywhere in the range of from about 20 mm to about 60
mm wide by about 100 mm to about 250 mm long. In some preferred
embodiments, the dimension of capillary flow matrix may be in the
range of about 40 mm wide by about 180 mm long, about 41 mm wide by
about 179 mm long, about 42 mm wide by about 178 mm long, about 43
mm wide by about 177 mm long or about 44 mm wide by about 176 mm
long.
[0198] In some embodiments, proximal flow portion 1118 may be
between about 0.5 to about 2 mm thick, preferably about 1 mm thick
and may be made of a bibulous capillary flow matrix capable of
supporting unidirectional flow of a liquid therein. Suitable
materials for making a capillary flow matrix have been described
above and are incorporated herein. In one embodiment, proximal flow
portion 1118 may be a glass fiber matrix on a polycarbonate
support.
[0199] In some embodiments, distal absorption portion 1119 may be
comprised of between 5 to 10 sheets of an absorptive material in
fluid communication with the proximal flow portion 1118. Each sheet
comprising the distal absorptive portion may be between about 0.5
mm to about 2 mm, or preferably about 1 mm thick.
[0200] Optionally, the inner aspect of the distal end of upper
portion 1100 may include a plurality of protrusions 1131,
optionally in an arrayed configuration, so as to apply an
additional compressive force on distal absorptive portion 1119 of
capillary flow matrix 1120 during use, when upper portion 1100 and
lower portion 1200 are juxtaposed and latching means 1210 is
engaged.
[0201] In some embodiments, membrane guide 1130 may be positioned
over the proximal flow region 1118 during use and may be sized to
accommodate a blotting membrane, as described above. In FIG. 12a,
membrane guide 1130 is shown coupled to upper portion 1100 and in
FIG. 12b, membrane guide 1130 is shown positioned over the central
reaction zone of proximal flow portion 1118 (see above for
additional discussion). Magnets 1131 may be used to hold membrane
guide 1130 in place in FIG. 12a.
[0202] FIG. 13 shows an exploded view of lateral flow capillary
device 1000, with upper portion 1100 separated from lower portion
1200 and showing placement of capillary flow matrix 1120 and
membrane guide 1130.
[0203] Turning to FIG. 14, lower portion 1200 of lateral capillary
flow device 1000 is shown in an exploded view. In the embodiment
depicted in FIG. 14, lower portion 1200 includes side walls 1210a
and 1210b coupled to the perimeter of base plate 1220. In some
embodiments, base plate 1220 may include raised state 1221, which
supports a portion of capillary flow matrix 1120 during use. Base
plate 1220 may further include a plurality of cavities 1222 at the
proximal and distal ends thereof, said cavities being sized to
accommodate springs 1240. Lower portion 1200 further includes
pressure system 1230. Pressure system 1230 includes at least a
first pressure plate 1235a positioned over springs 1240a, both
being positioned at the proximal end of lower portion 1200.
Pressure plate 1235a and springs 1240a are configured to apply a
pressure of between about 9 kg to about 50 kg, as described above.
Pressure system 1230 may optionally include a second pressure plate
1235b positioned over springs 1240b, both being positioned at the
distal end of lower portion 1200. Pressure plate 1235b and springs
1240b are configured to apply a pressure of between about 100 g to
about 5 kg, as described above and incorporated herein.
[0204] FIG. 15a shows a longitudinal cross sectional view of
lateral flow capillary device 1000 during use in closed
configuration, with latching means 1210 and the proximal and distal
pressure systems engaged. First pressure plate 1235a is urged
upward by the force applied by springs 1240a so that proximal flow
portion 1118 is pressed against reservoirs 1116a-d and second
pressure plate 1235b is urged upward by springs 1240b so that
distal absorbent portion 1119 is pressed against protrusions 1131
(shown in FIG. 12a). FIG. 15b is a perspective view of FIG. 15a. In
FIG. 15c, latching means 1210 is disengaged and upper portion 1100
is hingably separated from lower portion 1200 through hinge 1300.
In the embodiment depicted in FIG. 15c, membrane guide 1130 is
coupled to upper portion 1100, though it may also be resting over
the reaction zone of capillary flow portion 1118.
[0205] FIGS. 16a and 16b are cross-sectional transverse views
through reservoir 1116d of the proximal end of lateral flow
capillary device 1000 in closed configuration showing first
pressure plate 1235a and springs 1240a.
[0206] FIGS. 17a and 17b are cross-sectional transverse views
through the distal end of lateral flow capillary device 1000 in
closed configuration showing second pressure plate 1235b and
springs 1240b, distal absorbent portion 1119 and protrusions
1131.
[0207] Reference is now made to the following examples, which
together with the above descriptions, demonstrate the invention in
a non limiting fashion.
Experiment 1
Preparation of an Embodiment of a Lateral Flow Capillary Device of
the Present Invention
[0208] A lateral flow capillary device such as lateral flow
capillary device 80 depicted in FIGS. 6A, 6B and 6C was
prepared.
[0209] A lower housing part 82 and an upper housing part 84
configured to snap together to form a closed shell holding a
capillary flow matrix 18 and two liquid drains 86 and 88 were
fashioned by injection molding of ABS
(acrylonitrile-butadiene-styrene copolymer) plastic. Lower housing
82 was substantially a lidless box having a bottom with a plateau
portion 50 and a recessed portion 90. Upper housing 84 was
substantially a lid for lower housing 82 and was provided with
three reservoirs A, B and C including circular rims 36a, 36b, 36c,
a observation window 22, and four drain-pressing protrusions
92.
[0210] Capillary flow matrix 18, substantially a 50 mm.times.32 mm
porous membrane of GF grade 161 glass fiber from Ahlstrom
Corporation (Helsinki, Finland) attached to 55 m.times.32 mm.times
0.5 mm thick adhesive coated plastic backing (high-impact
polystyrene coated with an adhesive LH-50 from Advanced
Microdevices Pvt. Ltd. Ambala Cantt, India) so that the upstream
end 26 of capillary flow matrix 18 was flush with an end of backing
48 and 5 mm of adhesive-coated backing protruded from upstream end
93 of backing 48.
[0211] A test line 20a and a control line 20b, constituting a
reaction zone 20 were applied as two parallel lines of spots of
materials to capillary flow matrix 18 using a laboratory pipette
see FIG. 6B.
[0212] Test line 20a was applied as a line of spots produced by
applying 1 microliter of 0.7 mg/mL Goat anti Rabbit Ab (Jackson
ImmuonResearch laboratories Inc. 111-005-046) in 0.1 M phosphate
buffer (pH 6.8) and 2% trehalose solution 36 mm from the upstream
end of capillary flow matrix 18.
[0213] Control line 20b was applied as a line of spots produced by
applying 1 microliter of Rabbit Ab 0.1 mg/ml Rabbit anti calf
Alkaline Phosphates (Biogenesis 0300-1024) and 0.4 mg/ml Rabbit IgG
15006 (Sigma-Aldrich, St. Louis, Mo., USA) in 0.1 M phosphate
buffer (pH 6.8) and 2% trehalose solution 42 mm from the upstream
end of capillary flow matrix 18.
[0214] After application of the spots, capillary flow matrix 18 was
dried at 37.degree. C. for 15 minutes, treated with a solution of
0.5% gelatin, 2.5% Bacto-Tryptone, 1% trehalose in PBS and then
dried at 37.degree. C. for an additional 2 hours.
[0215] Two liquid drains 86 and 88 were prepared of highly
absorbent pure cellulose paper with a very high flow rate (190
mm/30 min) Chr. 17 (Whatman). Upper liquid drain 86 was 32
mm.times.36 mm and attached to the adhesive of protruding upstream
end 93 of backing 48 abutting capillary flow matrix 18 so as to
ensure fluid communication therewith. Lower liquid drain 88 was 7.8
mm.times.83 mm.
[0216] As depicted in FIG. 6C, for assembly of lateral flow
capillary device 80, lower liquid drain 88 was laid in recess 90 of
lower housing 82, capillary flow matrix 18 together with upper
liquid drain 86 were placed on plateau 50 of lower housing 82 with
backing 48 making contact with plateau 50. Upper housing 84 was
pressed into place to engage and snap together with lower housing
82 so that rims 36 of reservoirs A, B and C pressed into capillary
flow matrix 18 to define liquid receiving zones 34a, 34b and 34c
and so that drain pressing protrusions 92 pressed the end of upper
liquid drain 86 to contact lower liquid drain 88.
Experiment 2
Use of a Lateral Flow Capillary Device to Study Enzymatic
Reaction
[0217] Three lyophilized reagents were prepared:
Reagent A
[0218] 11-dehydro-TxB2-antiserum reagent--150 ul Rabbit anti
11-dehydro-TXB, 2999-044 (Assay Designs, Inc.) diluted 1:15000 in
1% BSA, 0.25% TWEEN-20, 0.1 mM ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS
buffer pH 7.4 was placed in a vial, cooled to -80.degree. C. and
lyophilized for 24 hours.
Reagent B
[0219] Enzyme labeled 11-dehydro-TxB2 conjugate--150 ul
11-dehydro-TxB2-Alkaline Phosphatase conjugate, 1:80 DCC (Assay
Designs, Inc.) diluted 1:30,000 in 1% BSA, 0.25% TWEEN-20, 0.1 mM
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH 7.4 was placed in a
vial, cooled to -80.degree. C. and lyophilized for 24 hours.
Reagent C
[0220] AP substrate--BCIP/NBT prepared according to manufacturer
instruction: stock preparation--1 tablet BCIP, B0274
(Sigma-Aldrich, St. Louis, Mo. USA) dissolved in 1 ml DMF, 1 tablet
NBT, N55141 (Sigma-Aldrich, St. Louis, Mo., USA) dissolved in 1 ml
water. 300 ul of the combined solution, 33 ul BCIP, 333 .mu.l NBT
stock solutions, in 10 ml 0.1M Tris buffer pH 9.7, were placed in a
vial, cooled to -80.degree. C. and lyophilized for 24 hours.
[0221] Three lateral flow capillary devices were prepared:
[0222] A first lateral flow capillary device was prepared
substantially as described above with dry PBS buffer placed in
reservoir A, reagent B placed in reservoir B and reagent C placed
in reservoir C.
[0223] A second lateral flow capillary device was prepared
substantially as described above with reagent A placed in reservoir
A, dry PBS solution placed in reservoir B and reagent C placed in
reservoir C.
[0224] A third lateral flow capillary device was prepared
substantially as described above with reagent A placed in reservoir
A, reagent B placed in reservoir B and reagent C placed in
reservoir C.
[0225] To each of the three lateral flow capillary devices was
added double distilled water: 150 microliter in reservoir A, 150
microliter in reservoir B and 300 microliter in reservoir C, one
reservoir after the other. A standing column of liquid was seen in
each reservoir and, as described above in accordance with the
teachings of the present invention, the liquid drained first from
reservoir A, then from reservoir B and finally from reservoir C.
When all liquid drained away from reservoir C, the enzymatic
reaction was stopped by the addition of a 120 ul 0.25M sulfuric
acid stop solution to reservoir C.
[0226] The colors of the test lines and control lines were measured
using a PART Pro Reader (LRE Technology Partner GmbH) and depicted
in FIG. 7.
[0227] Turning to FIG. 7, in the first lateral flow capillary
device, shown in FIG. 7A, no color was observed at the test line
and color was observed at the control line; in the second lateral
flow capillary device, shown in FIG. 7B, color was observed at
neither the test line nor at the control line; and in the third
lateral flow capillary device, shown in FIG. 7C, color was observed
at both the test line and at the control line.
[0228] The results indicate that the lateral flow capillary devices
operated as expected.
Experiment 3
TxB2 Detection for Comparing a Multireservoir Lateral Flow
Capillary Device with a Single Reservoir Lateral Flow Capillary
Device for Performing a Multistep Reaction
[0229] Two lateral flow capillary devices A and B were prepared
substantially as described above in Experiment 1 with a 50
mm.times.32 mm capillary flow matrix and two capillary flow
reactors C and D were prepared with a shorter 40 mm.times.32 mm
capillary flow matrix and assembled so that only rim 34a of
reservoir a was in contact with capillary flow matrix 18.
[0230] Five reaction liquids were prepared:
[0231] 1. A diluent solution of 1% BSA, 0.25% TWEEN-20, 0.1 mM
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH 7.4;
[0232] 2. Reagent A of Rabbit anti 111-dehydro-TXB2 (Assay Designs,
Inc. 999-044) diluted 1:15,000 in 1% BSA, 0.25% TWEEN-20, 0.1 mM
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH 7.4;
[0233] 3. Reagent B of 11-dehydro-TxB2--Alkaline Phosphatase
conjugate (Assay Designs, Inc. 1:80 DCC) diluted 1:30,000 in 1%
BSA, 0.25% TWEEN-20, 0.1 mM ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS
buffer pH 7.4;
[0234] 4. Reagent C of BCIP/NBT prepared according to manufacturer
instruction: stock preparation--1 tablet BCIP (Sigma-Aldrich B0274)
dissolving in 1 ml DMF, 1 tablet NBT (Sigma-Aldrich N55141)
dissolving in 1 ml water, final solution: 33 ul BCIP, 333 ul NBT
stock solutions, in 10 ml 0.1M Tris buffer pH 9.7; and
[0235] 5. Reagent D, a stop solution of 0.25M sulfuric acid.
Use of Multireservoir Lateral Flow Capillary Devices
[0236] 150 ul of reagent A, 150 ul of reagent B and 300 ul of
reagent C were simultaneously added to reservoirs A, B, and C
respectively of lateral flow capillary device A.
[0237] 150 ul of diluent solution, 150 ul of reagent B and 300 ul
of reagent C were simultaneously added to reservoirs A, B, and C
respectively of lateral flow capillary device B.
[0238] After complete sequential draining of all three solutions in
the order A, B and C, 120 ul reagent D was added to reservoir
C.
[0239] The colors of the test lines and control lines were measured
using a PART Pro Reader (LRE Technology Partner GmbH) and depicted
in FIGS. 8A and 8B.
Use of Single Reservoir Lateral Flow Capillary Devices
[0240] To reservoir A of lateral flow capillary device C were added
one after the other 150 ul of reagent A, 150 ul of reagent B, 300
ul of reagent C and 120 ul of reagent D, each succeeding liquid
only after the previous liquid had completely drained away from the
reservoir.
[0241] To reservoir A of lateral flow capillary device D were added
one after the other 150 ul of diluent solution, 150 ul of reagent B
and 300 ul of reagent C and 120 ul of reagent D, each succeeding
liquid only after the previous liquid had completely drained away
from the reservoir.
[0242] The colors of the test lines and control lines were measured
using a PART Pro Reader (LRE Technology Partner GmbH) and depicted
in FIGS. 8C and 8D.
[0243] From comparing FIGS. 8A and 8C and FIGS. 8B and 8D it is
seen that the results obtained using a multireservoir lateral flow
capillary flow device when adding all reagents at the beginning of
the experiment are substantially the same as the results obtained
using a single reservoir lateral capillary flow device when adding
the reagents during the experiment.
[0244] The time duration of each reservoir draining was measured
and the flow rat was calculated (minutes for 100 ul liquid to
travel 1 cm through the capillary flow matrix results shown in
Table 1:
TABLE-US-00001 TABLE 1 Flow [minutes for 100 ul to travel 1 cm]
Liquid Resevoir Device A Device B Device C Device D A A 0:00:57
0:00:57 B B 0:01:10 0:01:16 C C 0:01:08 0:01:10 D C 0:01:16 0:01:19
A A 0:00:55 0:00:54 B A 0:01:14 0:01:10 C A 0:01:12 0:01:08 D A
0:01:16 0:01:10
Experiment 4
Calibration Curve for 11-dehydro-TxB2-Competition Assay
[0245] Five lateral flow capillary devices substantially as
described above in experiment 1
[0246] Five reagent liquids were prepared:
[0247] 1. A diluent solution of 1% BSA, 0.25% TWEEN-20, 0.1 mm
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH 7.4;
[0248] 2. Reagent A of Rabbit anti 11-dehydro-TXB2 (Assay Designs,
Inc. 999-044) diluted 1:1,500 in 1% BSA, 0.25% TWEEN-20, 0.1 mM
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH 7.4;
[0249] 3. Reagent B of 11-dehydro-TxB2--Alkaline Phosphatase
conjugate (Assay Designs, Inc. 1:80 DCC) diluted 1:3,000 in 1% BSA,
0.25% TWEEN-20, 0.1 mM ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH
7.4;
[0250] 4. Reagent C of BCIP/NBT was prepared according to
manufacturer instruction: stock preparation--1 tablet BCIP
(Sigma-Aldrich B0274) dissolving in 1 ml DMF, 1 tablet NBT
(Sigma-Aldrich N55141) dissolving in 1 ml water. Final solution: 33
ul BCIP, 333 ul NBT stock solutions, in 10 ml 0.1M Tris buffer pH
9.7; and
[0251] 5. Reagent D, a stop solution of 0.25M sulfuric acid.
[0252] Five sample solutions were prepared containing 5, 1, 0.2,
0.04, 0 ng/ml of 11-dehydro-TxB2 (80-0735) analyte from Assay
Designs, Inc dissolved in 1% BSA, 0.25% TWEEN-20, 0.1 mM
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer solution pH 7.4.
[0253] To the first lateral flow capillary device, 150 ul of a
mixture of 15 ul reagent A and 135 ul sample containing 5 ng/ml
analyte, 150 ul of a mixture of 15 ul reagent B and 135 ul sample
containing 5 ng/ml analyte and 300 ul of reagent C were added to
reservoirs A, B, and C respectively.
[0254] To the second lateral flow capillary device, 150 ul of a
mixture of 15 ul reagent A and 135 ul sample containing 1 ng/ml
analyte, 150 ul of a mixture of 15 ul reagent B and 135 ul sample
containing 1 ng/ml analyte and 300 ul of reagent C were added to
reservoirs A, B, and C.
[0255] To the third lateral flow capillary device, 150 ul of a
mixture of 15 ul reagent A and 135 ul sample containing 0.2 ng/ml
analyte, 150 ul of a mixture of 15 ul reagent B and 135 ul sample
containing 0.2 ng/ml analyte and 300 ul of reagent C were added to
reservoirs A, B, and C.
[0256] To the fourth lateral flow capillary device, 150 ul of a
mixture of 15 ul reagent A and 135 ul sample containing 0.04 ng/ml
analyte, 150 ul of a mixture of 15 ul reagent B and 135 ul sample
containing 0.04 ng/ml analyte and 300 ul of reagent C were added to
reservoirs A, B, and C respectively.
[0257] To the fifth lateral flow capillary device, 150 ul of a
mixture of 15 ul reagent A and 135 ul sample containing 0 ng/ml
analyte, 150 ul of a mixture of 15 ul reagent B and 135 ul sample
containing 0 ng/ml analyte and 300 ul of reagent C were added to
reservoirs A, B, and C respectively.
[0258] After complete draining of all three reservoirs in the order
A, B and C in accordance with the teachings of the present
invention, 120 ul reagent D was added to reservoir C of each of the
lateral flow capillary device.
[0259] The colors of the test lines and control lines were measured
using a PART Pro Reader (LRE Technology Partner GmbH) and the bound
level of the labeled analyte at each analyte concentration was
calculated as the ratio b/b0 between the reflection at each
concentration 5, 1, 0.2, 0.04 ng/ml (b) and the reflection at 0
ng/ml (b0). A calibration curve was made by plotting the results,
FIG. 9.
Experiment 5
Quantitative Determination of 11-dehydro-TxB2 in Urine
[0260] Three lateral flow capillary devices substantially similar
to the third lateral flow capillary device described in Experiment
2 were prepared with lyophilized reagent A in reservoir A,
lyophilized reagent B in reservoir B and lyophilized reagent C in
reservoir C.
[0261] To each of the three lateral flow capillary devices was
added: 150 ul urine sample to reservoir A, 150 ul of the same urine
sample to reservoir B and 300 ul double distilled water to
reservoir C. After complete sequential draining of reservoirs A, B,
and C in accordance with the teachings of the present invention,
120 ul stop solution D was added to reservoir C.
[0262] The colors of the test lines and control lines were measured
using a PART Pro Reader (LRE Technology Partner GmbH) and the
concentration of 11-dehydro-TxB2 analyte in each urine sample
determined with reference to the calibration curve of FIG. 9. The
first urine sample was determined to contain 5251 pg/mL, the second
urine sample 907 pg/ml and the third urine sample 540 pg/ml
11-dehydro-TxB2.
Experiment 6
Sequential Liquid Flow in a Lateral Flow Capillary Device
[0263] A lateral flow capillary device E was prepared substantially
as described above in Experiment 1 with a 50 mm.times.32 mm
capillary flow matrix. A lateral flow capillary device F were
prepared with a shorter 40 mm.times.32 mm capillary flow matrix and
assembled so that only rim 36a of reservoir A was in contact with
capillary flow matrix 18. The capillary flow matrices of both
lateral flow capillary devices E and F were devoid of reaction
zones and only treated with a solution of 0.5% gelatin, 2.5%
Bacto--Tryptone, 1% trehalose in PBS.
[0264] A number of reaction liquids, diluent solution, reagent A
(yellow), reagent B (blue) and reagent C (red) were prepared as
described in Experiment 3
Use of Multireservoir Lateral Flow Capillary Device
[0265] 150 ul of reagent A, 150 ul of reagent B and 300 ul of
reagent C were added, one after the other, to reservoirs A, B, and
C respectively of lateral flow capillary device E. Sequential
draining of reservoirs A, B, and C in accordance with the teachings
of the present invention was observed with a sharp interface that
was observed to move in accordance with the teachings of the
present invention.
Use of Single Reservoir Lateral Flow Capillary Device
[0266] To reservoir A of lateral flow capillary device F were added
one after the other 150 ul of reagent A, 150 ul of reagent B and
300 ul of reagent C each succeeding liquid only after the previous
liquid had completely drained away.
[0267] The draining time for each reservoir was measured and listed
in Table 2:
TABLE-US-00002 TABLE 2 Draining Time Liquid Reservoir Device E
Device F A A 0:3:07 B B 0:10:01 C C 0:25:20 A A 0:03:03 B A 0:08:14
C A 0:18:13
Experiment 7
Detection of HIV 1 Antibodies in Blood Serum Sample
[0268] A lateral flow capillary device was prepared substantially
as described above in Experiment 1 with a control line 20b as
described in Experiment 1 but with a test line 20a applied as a
line of spots produced by applying 1 microliter of 0.7 mg/mL HIV 1
recombinant protein antigen HIV-101 (ProSpec-Tany TechnoGene LTD)
in 0.1M phosphate buffer (pH 6.8) and 2% trehalose solution 36 mm
from the upstream end of capillary flow matrix 18.
[0269] In reservoir A was placed a lyophilized (as described above)
solution of 1 mg/ml biotinylated synthetic gp41 and gp120 peptides
diluted in 1% BSA, 1% fetal bovine serum, 0.5% TWEEN-20 in PBS
buffer pH 7.4.
[0270] In reservoir B was placed a lyophilized (as described above)
solution of Streptavidin-Alkaline Phosphatase conjugate (Jackson
ImmuonResearch laboratories Inc. 003-050-083) diluted in 1% BSA,
0.5% TWEEN-20, 0.1 mM ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH
7.4.
[0271] In reservoir C was placed a lyophilized (as described above)
solution of BCIP/NBT prepared according to the manufacturer
instructions stock preparation--1 tablet BCIP (Sigma-Aldrich B0274)
dissolving in 1 ml DMF, 1 tablet NBT (Sigma-Aldrich N55141)
dissolving in 1 ml water. A final solution: 33 ul BCIP, 333 ul NBT
stock solutions, in 10 ml 0.1M Tris buffer pH 9.7.
[0272] 150 ul of a serum sample, 150 ul of a serum sample and 300
ul of double distilled water were added, one after the other, to
reservoirs A, B, and C respectively of the lateral flow capillary
device. Sequential draining of reservoirs A, B, and C in accordance
with the teachings of the present invention was observed. After the
liquid in reservoir C completely drained away 120 ul reagent D
(0.25 M sulfuric acid stop solution) was added to reservoir C.
[0273] The appearance of two colored dotted lines, one at the test
line and the other at the control line, indicated the presence of
antibodies for HIV 1 in the serum sample.
Experiment 8
Detection of Hepatitis B Surface Antigen in Blood Serum Sample
Using a Two Reservoir Lateral Flow Capillary Device
[0274] A lateral flow capillary device was prepared substantially
as described above in Experiment 1 excepting that the capillary
flow matrix was 45 mm.times.32 mm and the lower liquid drain was
7.8 mm.times.73 mm and with a control line 20b as described in
Experiment 1 but with a test line 20a applied as a line of spots
produced by applying 1 microliter of 0.7 mg/mL mouse monoclonal
anti-HBsAg antibody (Fitzgerald Industries International, Inc.
10-H05) in 0.1 M phosphate buffer (pH 6.8) and 2% trehalose
solution. When assembled in the housing, the rims 34a and 34b of
reservoirs A and B were in contact with capillary flow matrix 18
but the rim 36c of reservoir C was not in contact with the
capillary flow matrix 18.
[0275] In reservoir A was placed a lyophilized (as described above)
solution of rabbit anti-HBsAg Alkaline Phosphatase conjugate
diluted in 1% BSA, 1% fetal bovine serum, 0.5% TWEEN-20, 0.1 mM
ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH 7.4.
[0276] In reservoir B was placed a lyophilized (as described above)
solution of BCIP/NBT prepared according to the manufacturer
instructions stock preparation--1 tablet BCIP (Sigma-Aldrich B0274)
dissolving in 1 ml DMF, 1 tablet NBT (Sigma-Aldrich N55141)
dissolving in 1 ml water. A final solution: 33 ul BCIP, 333 ul NBT
stock solutions, in 10 ml 0.1M Tris buffer pH 9.7.
[0277] 300 ul of a serum sample and 300 ul of double distilled
water were added, one after the other, to reservoirs A and B
respectively of the lateral flow capillary device. Sequential
draining of reservoirs A and B in accordance with the teachings of
the present invention was observed. After the liquid in reservoir B
completely drained away 120 ul 0.25 M sulfuric acid stop solution
was added to reservoir B.
[0278] The appearance of two colored dotted lines, one at the test
line and the other at the control line, indicated the presence of
Hepatitis B Surface Antigen in the serum sample.
Experiment 9
Detection of Fluorescent Signal--High Volume Samples
[0279] Four lateral flow capillary devices were prepared
substantially as described in Experiment 1 where reaction zone 20
included only a test line 20a but no control line.
[0280] A reagent H was prepared of Rabbit anti mouse-cy5 antibody
(Jackson ImmuonResearch laboratories Inc. 515-175-045) diluted in
1% BSA, 1% fetal bovine serum, 0.5% TWEEN-20, 0.1 mM ZnCl.sub.2, 1
mM MgCl.sub.2 in PBS buffer pH 7.4.
[0281] 200 ul of reagent H were added to reservoir C of the first
lateral flow capillary device.
[0282] 200 ul of reagent H were added to reservoirs B and C of the
second lateral flow capillary device.
[0283] 200 ul of reagent H were added to reservoirs A, B and C of
the third lateral flow capillary device.
[0284] 200 ul of reagent H were added to reservoirs A, B and C of
the fourth lateral flow capillary device. After complete draining
of liquid from reservoir C, and additional 200 ul of reagent H were
added to reservoir C.
[0285] There was a linear correlation between the intensity of
fluorescence emitted by a given test line 20b as measured by PART
Immuno Reader (LRE Technology Partner GmbH) and the total volume of
liquid added to the respective lateral flow capillary device, see
the graph in FIG. 10.
Experiment 10
Detection of HPV 16 DNA Sequence
[0286] A lateral flow capillary device were prepared substantially
as described in Experiment 1 where capillary flow matrix 18 was
nitrocellulose Prima 40 (Schleicher & Schuell).
[0287] A reaction zone 20 was prepared by applying a line of spots
36 mm from the upstream end of the capillary flow matrix, each spot
produced by applying 1 microliter of 5 ug/mL oligonucleotide probe
(5'GTTTCAGGACCCACAGGAGCGACCC (nt 106-130)) in 1.5 M NaCl and 0.15M
Na-citrate, pH 7.0 solution. After drying at 37.degree. C. for 15
minutes, capillary flow matrix 18 was irradiated with ultraviolet
light for 5 minutes to fix the DNA to capillary flow matrix 18.
[0288] Cellular DNA from CaSki cells was subjected to 30 PCR
amplification cycles using a first primer (5'AAGGGCGTAACCGAAATCGGT
(nt 26-46)) and a biotinylated second primer (5'GTTGTTTGCAGCTCTGTGC
(nt 150-168)) specific for HPV 16 sequences. PCR was ended with a
denaturation step and fast chilling to 4.degree. C.
[0289] In reservoir A of the lateral flow capillary device was
placed 50 ul of denaturated biotinylated PCR product, diluted 1:10
in ice chilled 0.6 M NaCl, 0.02% Ficoll 400, 0.02% gelatin, 1% PVP,
20 mM phosphate buffer pH 7.5 solution.
[0290] In reservoir B of the lateral flow capillary device was
placed 50 ul of Streptavidin-Alkaline Phosphatase conjugate
(Jackson Immuonresearch laboratories Inc. 003-050-083) diluted in
1% BSA, 0.5% TWEEN 20, 0.1 mM ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS
buffer pH 7.4.
[0291] In reservoir C of the lateral flow capillary device was
placed 150 ul of reagent C, BCIP/NBT was prepared according to
manufacturer instruction: stock preparation--1 tablet BCIP
(Sigma-Aldrich B0274) dissolving in 1 ml DMF, 1 tablet NBT
(Sigma-Aldrich N55141) dissolving in 1 ml water. Final solution: 33
ul BCIP, 333 ul NBT stock solutions, in 10 ml 0.1M Tris buffer pH
9.7.
[0292] Sequential draining of reservoirs A, B, and C in accordance
with the teachings of the present invention was observed. After the
liquid in reservoir C completely drained away, a purple colored
line at the reaction zone indicated the presence of the HPV 16 DNA
sequences.
Experiment 11
Detection of HIV-1 Antibodies Using Lyophilized Conjugate in a
Reaction Zone
[0293] A lateral flow capillary device was prepared substantially
as described above in Experiment 7 except that lyophilized reagents
were placed as follows:
[0294] In the reaction zone was placed lyophilized (as described
above) solution of 1 mg/ml biotinylated synthetic gp41 and gp120
peptides diluted in 1% BSA, 1% fetal bovine serum, 0.5% TWEEN-20 in
PBS buffer pH 7.4
[0295] Reservoir A was kept empty.
[0296] In reservoir B was placed a lyophilized (as described above)
solution of Streptavidin-Alkaline Phosphatase conjugate (Jackson
ImmuonResearch laboratories Inc. 003-050-083) diluted in 1% BSA,
0.5% TWEEN-20, 0.1 mM ZnCl.sub.2, 1 mM MgCl.sub.2 in PBS buffer pH
7.4.
[0297] In reservoir C was placed a lyophilized (as described above)
solution of BCIP/NBT prepared according to the manufacturer
instructions stock preparation--1 tablet BCIP (Sigma-Aldrich B0274)
dissolving in 1 ml DMF, 1 tablet NBT (Sigma-Aldrich N55141)
dissolving in 1 ml water. A final solution: 33 ul BCIP, 333 ul NBT
stock solutions, in 10 ml 0.1M Tris buffer pH 9.7.
[0298] 150 ul of a serum sample were applied to capillary flow
matrix 18 through observation window 22, 150 ul of serum sample
were added to reservoir B and 300 ul of double distilled water were
added to reservoir C. Sequential draining of reservoirs B and C in
accordance with the teachings of the present invention was
observed. After the liquid in reservoir C completely drained away
120 ul 0.25 M sulfuric acid stop solution was added to reservoir
C.
[0299] The appearance of two colored dotted lines, one at the test
line and the other at the control line, indicated the presence of
antibodies for HIV 1 in the serum sample.
[0300] In the experimental section above the teachings of the
present invention were exemplified for the study of enzymatic
reactions and for the detection of specific analytes in a sample.
As is clear to one skilled in the art upon perusal of the
description herein, the teachings of the present invention are
applicable to many different fields where the performance of
multistep reactions are required, including but not limited to
environmental chemistry, cell biology and biochemistry.
[0301] Methods and processes have been described herein as a series
of steps in an order selected as being the easiest to understand.
It must be emphasized that such order is not limiting, and any
method or process described herein may be implemented where the
steps are performed in any reasonable order to achieve the desired
result.
[0302] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, the present invention is
intended to embrace all such alternatives, modifications and
variations that fall within the spirit and broad scope of the
appended claims. For example, the teachings of the present
invention have been described where a reaction takes place at room
temperature. In embodiments of the present invention, a lateral
flow capillary device is maintained in warmer or colder
environment, for example a freezer, a refrigerator, or an incubator
so that a reaction is performed at a temperature that is hotter or
colder than room temperature or to ensure that a specific desired
temperature is maintained. Embodiments in which a lateral flow
capillary device is maintained at a controlled temperature include
during an entire reaction or during only part of a reaction.
[0303] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable
subcombination.
[0304] All publications, patents and patent applications mentioned
in this specification are herein incorporated in their entirety by
reference into the specification, to the same extent as if each
individual publication, patent or patent application was
specifically and individually indicated to be incorporated herein
by reference. In case of conflict, the specification herein,
including definitions, will control. Citation or identification of
any reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention.
* * * * *