U.S. patent application number 13/654243 was filed with the patent office on 2013-06-20 for methods and compositions for the diagnosis of cancer susceptibilities and defective dna repair mechanisms and treatment thereof.
This patent application is currently assigned to Oregon Health and Science University. The applicant listed for this patent is Dana-Farber Cancer Institute, Inc., Oregon Health and Science University. Invention is credited to Alan D. D'Andrea, Edward A. Fox, Markus Grompe, Toshiyasu Taniguchi, Cynthia Timmers.
Application Number | 20130157294 13/654243 |
Document ID | / |
Family ID | 46150144 |
Filed Date | 2013-06-20 |
United States Patent
Application |
20130157294 |
Kind Code |
A1 |
D'Andrea; Alan D. ; et
al. |
June 20, 2013 |
Methods and Compositions for the Diagnosis of Cancer
Susceptibilities and Defective DNA Repair Mechanisms and Treatment
Thereof
Abstract
Methods and compositions for the diagnosis of cancer
susceptibilities, defective DNA repair mechanisms and treatments
thereof are provided. Among sequences provided here, the FANCD2
gene has been identified, and probes and primers are provided for
screening patients in genetic-based tests and for diagnosing
Fanconi Anemia and cancer. The FANCD2 gene can be targeted in vivo
for preparing experimental mouse models for use in screening new
therapeutic agents for treating conditions involving defective DNA
repair. The FANCD2 polypeptide has been sequenced and has been
shown to exist in two isoforms identified as FANCD2-S and the
monoubiquinated FANCD-L form. Antibodies including polyclonal and
monoclonal antibodies have been prepared that distinguish the two
isoforms and have been used in diagnostic tests to determine
whether a subject has an intact Fanconi Anemia/BRCA pathway.
Inventors: |
D'Andrea; Alan D.;
(Winchester, MA) ; Taniguchi; Toshiyasu; (Boston,
MA) ; Fox; Edward A.; (Boston, MA) ; Timmers;
Cynthia; (Columbus, OH) ; Grompe; Markus;
(Portland, OR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dana-Farber Cancer Institute, Inc.;
Oregon Health and Science University; |
Boston
Portland |
MA
OR |
US
US |
|
|
Assignee: |
Oregon Health and Science
University
Portland
OR
Dana-Farber Cancer Institute, Inc.
Boston
MA
|
Family ID: |
46150144 |
Appl. No.: |
13/654243 |
Filed: |
October 17, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12749419 |
Mar 29, 2010 |
|
|
|
13654243 |
|
|
|
|
10165099 |
Jun 6, 2002 |
|
|
|
12749419 |
|
|
|
|
09998027 |
Nov 2, 2001 |
|
|
|
10165099 |
|
|
|
|
60245756 |
Nov 3, 2000 |
|
|
|
Current U.S.
Class: |
435/7.92 ;
435/29; 435/7.1 |
Current CPC
Class: |
C12Q 2600/158 20130101;
C12Q 1/025 20130101; G01N 2500/00 20130101; G01N 2800/52 20130101;
A01K 2217/05 20130101; G01N 33/6893 20130101; C07K 14/47 20130101;
C12Q 2600/156 20130101; C07K 16/18 20130101; A01K 2217/075
20130101; G01N 33/57484 20130101; G01N 33/5091 20130101; C12Q
1/6886 20130101; G01N 2333/47 20130101; G01N 33/574 20130101; G01N
33/5011 20130101 |
Class at
Publication: |
435/7.92 ;
435/7.1; 435/29 |
International
Class: |
G01N 33/68 20060101
G01N033/68; C12Q 1/02 20060101 C12Q001/02 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The work described herein was supported by the National
Institute of Health, NIH Grant No. Health grants RO1HL52725-04,
RO1DK43889-09, 1PO1HL48546, and PO1HL54785-04. The US Government
has certain rights to the claimed invention.
Claims
1.-41. (canceled)
42. A method of determining the response of a cell from a subject
to an agent capable of inducing DNA damage, comprising: a)
providing a tissue sample from said subject; b) inducing DNA damage
in the cells of said tissue sample; and c) detecting FANCD2
ubiquitination or FANCD2 foci formation in said cells, wherein a
low level of FANCD2 ubiquitination or FANCD2 foci formation
detected in c) as compared to the level of FANCD2 ubiquitination or
FANCD2 foci formation in a control cell indicates that said cell
will respond to said agent.
43. The method of claim 42, wherein said cell is a cancer cell.
44. The method of claim 43, wherein said cancer is breast cancer,
ovarian cancer, or prostate cancer.
45. The method of claim 42, wherein DNA damage is induced in said
control cell before FANCD2 ubiquitination or FANCD2 foci formation
is detected in said control cell.
46. The method of claim 42, wherein said DNA damage in b) is
induced by an agent selected from the group consisting of ethidium
bromide, acridine orange, free radicals, ionizing radiation, and UV
radiation.
47. The method of claim 42, wherein said detection in c) comprises
an immunological method.
48. The method of claim 47, wherein said immunological method is
immunohistochemistry, immunofluorescence, or immunoblotting.
49. The method of claim 42, wherein said agent is cisplatin.
50. The method of claim 43, wherein said ubiquitination is
monoubiquitination.
51. A method of detecting a ubiquitinated FANCD2, comprising: a)
providing one or more cells from a subject; b) inducing DNA damage
in said cells; and c) detecting said ubiquitinated FANCD2 in said
cells by an immunological assay.
52. The method of claim 51, wherein said immunological assay is
immunohistochemistry, immunofluorescence, or immunoblotting.
53. The method of claim 51, wherein said ubiquitinated FANCD2 is a
monoubiquitinated.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 12/749,419, filed Mar. 29, 2010, pending, which is a
continuation of U.S. application Ser. No. 10/165,099, filed Jun. 6,
2002, abandoned, which is a continuation-in-part of U.S.
application Ser. No. 09/998,027, filed Nov. 2, 2001, abandoned,
which in turn claims priority from U.S. Provisional Application No.
60/245,756, filed Nov. 3, 2000. The entire contents of each of the
above applications are incorporated herein by reference.
INCORPORATION BY REFERENCE
[0003] The contents of the text file named
"20363.sub.--201C01US_ST25.txt", which was created on Oct. 29, 2002
and is 132 KB in size, are hereby incorporated by reference in
their entirety.
BACKGROUND
[0004] The present invention relates to the diagnosis of cancer
susceptibilities in subjects having a defect in the FANCD2 gene and
the determination of suitable treatment protocols for those
subjects who have developed cancer. Animal models with defects in
the FANCD2 gene can be used to screen for therapeutic agents.
[0005] Fanconi Anemia (FA) is an autosomal recessive cancer
susceptibility syndrome characterized by birth defects, bone marrow
failure and cancer predisposition. Cells from FA patients display a
characteristic hypersensitivity to agents that produce interstrand
DNA crosslinks such as mitomycin C or diepoxybutane. FA patients
develop several types of cancers including acute myeloid leukemias
and cancers of the skin, gastrointestinal; and gynecological
systems. The skin and gastrointestinal tumors are usually squamous
cell carcinomas. At least 20% of patients with FA develop cancers.
The average age of patients who develop cancer is 15 years for
leukemia, 16 years for liver tumors and 23 years for other tumors.
(D'Andrea et al., Blood, (1997) Vol. 90, p. 1725, Garcia-Higuera et
al., Curr. Opin. Hematol., (1999) Vol. 2, pp. 83-88 and Heijna et
al., Am. J. Hum. Genet. Vol. 66, pp. 1540-1551).
[0006] FA is genetically heterogeneous. Somatic cell fusion studies
have identified at least seven distinct complementation groups
(Joenje et al., (1997) Am. J. Hum. Genet., Vol. 61, pp. 940-944 and
Joenje et al., (2000) Am. J. Hum. Genet, Vol. 67, pp. 759-762).
This observation has resulted in the hypothesis that the FA genes
define a multicomponent pathway involved in cellular responses to
DNA cross-links. Five of the FA genes (FANCA, FANCC, FANCE, FANCF
and FANCG) have been cloned and the FANCA, FANCC and FANCG proteins
have been shown to form a molecular complex with primarily nuclear
localization. FANCC also localizes in the cytoplasm. Different FA
proteins have few or no known sequence motifs with no strong
homologs of the FANCA, FANCC, FANCE, FANCF, and FANCG proteins in
non-vertebrate species. FANCF has weak homology of unknown
significance to an E. Coli RNA binding protein. The two most
frequent complementation groups are FA-A and FA-C which together
account for 75%-80% of FA patients. Multiple mutations have been
recognized in the FANCA gene that span 80 kb and consists of at
least 43 exons. FANCC has been found to have 14 exons and spans
approximately 80 kb. A number of mutations in the FANCC gene have
been identified which are correlated with FA of differing degrees
of severity. FA-D has been identified as a distinct but rare
complementation group. Although FA-D patients are phenotypically
distinguishable from patients from other subtypes, the FA protein
complex assembles normally in FA-D cells (Yamashita et al., (1998)
P.N.A.S., Vol. 95, pp. 13085-13090).
[0007] The cloned FA proteins encode orphan proteins with no
sequence similarity to each other or to other proteins in GenBank
and no functional domains are apparent in the protein sequence.
Little is known regarding the cellular or biochemical function of
these proteins.
[0008] Diagnosis of FA is complicated by the wide variability in FA
patient phenotype. Further confounding diagnosis, approximately 33%
of patients with FA have no obvious congenital abnormalities.
Moreover, existing diagnostic tests do not differentiate FA
carriers from the general population. The problems associated with
diagnosis are described in D'Andrea et al., (1997). Many cellular
phenotypes have been reported in FA cells but the most consistent
is hypersensitivity to bifunctional alkylating agents such as
mitomycin C or diepoxybutane. These agents produce interstrand DNA
cross-links (an important class of DNA damage).
[0009] Diagnosing cancer susceptibility is complicated because of
the large number of regulatory genes and biochemical pathways that
have been implicated in the formation of cancers. Different cancers
depending on how they arise and the genetic lesions involved may
determine how a subject responds to any particular therapeutic
treatments. Genetic lesions that are associated with defective
repair mechanisms may give rise to defective cell division and
apoptosis which in turn may increase a patient's susceptibility to
cancer. FA is a disease condition in which multiple pathological
outcomes are associated with defective repair mechanisms in
addition to cancer susceptibility.
[0010] An understanding of the molecular genetics and cell biology
of Fanconi Anemia pathway can provide insights into prognosis,
diagnosis and treatment of particular classes of cancers and
conditions relating to defects in DNA repair mechanisms that arise
in non-FA patients as well as FA patients.
SUMMARY OF THE INVENTION
[0011] The invention features a method of diagnosing or determining
if a patient has cancer or is at increased risk of cancer, where
the method includes testing a Fanconi Anemia/BRCA pathway gene for
the presence of a cancer-associated defect, where said presence of
one or more cancer-associated defects is indicative of cancer or an
increased risk of cancer in said patient. The cancer can be breast,
ovarian, or prostate cancer, or other forms of cancer. The
cancer-associated defect can be one which results in a reduction in
the ratio of FANC D2-L relative to FANC D2-S as compared to the
ratio in a patient without one or more cancer-associated defects in
a Fanconi Anemia/BRCA pathway gene.
[0012] The invention also features a method of diagnosing or
determining if a patient has cancer or is at increased risk of
cancer, where the method includes testing a Fanconi Anemia/BRCA
pathway protein for the presence of a cancer-associated defect,
where said presence of a cancer-associated defect is indicative of
cancer or an increased risk of cancer in said patient. The cancer
can be breast, ovarian, or prostate cancer, or other forms of
cancer.
[0013] An another aspect, the invention features a method of
diagnosing or determining if a patient is at increased risk of
developing cancer, where the method includes the steps of (a)
providing a tissue sample from said patient; (b) inducing DNA
damage in the cells of said tissue sample; and (c) assaying for the
presence of FANC D2-S and FANC D2-L proteins in said cells; wherein
a reduction in the ratio of FANC D2-L to FANC D2-S is indicative
that said patient is at increased risk of developing cancer. The
cancer can be breast, ovarian, or prostate cancer, or other forms
of cancer. The patient can be known or not known to have any
previously-known cancer-associated defects in the BRCA-1 or BRCA-2
genes. A plurality of such tissue samples can be distributed on or
in an array.
[0014] An another aspect, the invention features a method of
determining if a patient has cancer, or is at increased risk of
developing cancer, where the patient has no known cancer causing
defect in the BRCA 1 or BRCA-2 genes, where the method comprises
the steps of: (a) providing a DNA sample from said patient; (b)
amplifying the FANC D2 gene from said patient with the FANC D2
gene-specific polynucleotide primers of SEQ ID NOs:115-186; (c)
sequencing the amplified FANC D2 gene; and (d) comparing the FANC
D2 gene sequence from said patient to a reference FANC D2 gene
sequence, where a discrepancy between the two gene sequences
indicates the presence of a cancer-associated defect; where the
presence of one or more cancer-associated defects indicates said
patient has cancer or is at an increased risk of developing cancer.
The cancer can be breast, ovarian, or prostate cancer, or other
forms of cancer. The patient can be known or not known to have any
previously-known cancer-associated defects in the BRCA-1 or
FANC-D1/BRCA-2 genes. A plurality of such tissue samples can be
distributed on or in an array. SEQ ID NOs: 115-186 are matched sets
of primers, as shown in Table 7, with the odd-numbered primers
being forward primers, and the even-numbered primers being reverse
primers. Primers can also be used from different pairs, to make new
pairings of primers, e.g., SEQ ID NO:115 can be used with SEQ ID
NO:118, etc. By "discrepancy" is meant a difference between the two
sequences, where the difference is know to be associated with
cancer.
[0015] In a further aspect, the invention features a method of
screening for a chemosensitizing agent, where the method comprises
the steps of: (a) providing a potential inhibitor of the Fanconi
Anemia/BRCA pathway; (b) providing a tumor cell line that is
resistant to one or more anti-neoplastic agents; (c) contacting
said tumor cell line and said potential inhibitor of the Fanconi
Anemia/BRCA pathway and said one or more anti-neoplastic agents;
and (d) measuring the growth rate of said tumor cell line in the
presence of said inhibitor of the Fanconi Anemia/BRCA pathway and
said anti-neoplastic agent; where a reduced growth rate of the
tumor cell line, relative to cells of the tumor cell line in the
presence of the anti-neoplastic agent and the absence of said
inhibitor of the Fanconi Anemia/BRCA pathway, is indicative that
the potential inhibitor is a chemosensitizing agent. The potential
inhibitors of the Fanconi Anemia/BRCA pathway can be screened on a
microarray, where the microarray contains addresses containing one
or more cells that are resistant to one or more anti-neoplastic
agents. The potential inhibitor of the Fanconi Anemia/BRCA pathway
can be an inhibitor of the ubiquitination of the FANC D2 protein.
The anti-neoplastic agent can be cisplatin. The tumor cell line can
be an ovary cancer cell line.
[0016] In another aspect, the invention features a method of
treating a patient having a cancer, where the cancer is resistant
to a anti-neoplastic agent, where the method comprises the step of
administering a therapeutically effective amount of an inhibitor of
the Fanconi Anemia/BRCA pathway together with said anti-neoplastic
agent. The anti-neoplastic agent can be cisplatin. The potential
inhibitor of the Fanconi Anemia/BRCA pathway can be an inhibitor of
the ubiquitination of the FANC D2 protein. The tumor cell line can
be an ovary cancer cell line.
[0017] In an additional aspect, the invetion features a method for
screening for a cancer therapeutic, where the method comprises the
steps of: (a) providing one or more cells containing a Fanconi
Anemia/BRCA pathway gene having one or more cancer associated
defects; (b) growing said cells in the presence of a potential
cancer therapeutic; and (c) determining the rate of growth of said
cells in the presence of said potential cancer therapeutic relative
to the rate of growth of equivalent cells grown in the absence of
said potential cancer therapeutic; where a reduced rate of growth
of said cells in the presence of said potential cancer therapeutic,
relative to the rate of growth of equivalent cells grown in the
absence of said potential cancer therapeutic, indicates that the
potential cancer then is a cancer therapeutic. The cells can
contain a Fanconi Anemia/BRCA pathway gene having one or more
cancer associated defects are distributed in a array, or several
such genes.
[0018] The invention also features a method of predicting the
efficacy of a therapeutic agent in a cancer patient, where the
method comprises the steps of: (a) providing a tissue sample from
said cancer patient who is being treated with said therapeutic
agent; (b) inducing DNA damage in the cells of said tissue sample;
and (c) detecting the presence of FANC D2-L protein in said cells;
where the presence of FANC D2-L is indicative of a reduced efficacy
of said therapeutic agent in said cancer patient. The therapeutic
agen can be an anti-neoplastic agent, e.g., can be cisplatin.
Alternatively, in step (c), one can detect both FANC-D2-S and
FANC-D2-L, where a reduction in the ratio of FANC D2-L relative to
FANC D2-S as compared to the ratio in a non-cancer patient
indicates reduced efficacy.
[0019] The invention also features a method of determining
resistance of tumor cells to an anti-neoplastic agent, comprising
the steps of (a) providing a tissue sample from a patient who is
being treated with an anti-neoplastic agent; (b) inducing DNA
damage in the cells of said tissue sample; and (c) determining the
methylation state of a Fanconi Anemia BRCA pathway gene; where
methylation of a Fanconi Anemia/BRCA gene is indicative of
resistance of the tumor cells to an anti-neoplastic agent. The
Fanconi Anemia/BRCA gene can be the FANC F gene. The
anti-neoplastic agent can be cisplatin.
[0020] The invention also features a kit for detecting defects in
the FANC D2 gene, comprising a polynucleotide primer pair specific
for the FANC D2 gene, a reference FANC D2 gene sequence and
packaging materials therefore.
[0021] The invention also features a kit for detecting the presence
of FANC D2-L, comprising a FANC D2-L-specific antibody and
packaging materials therefore.
[0022] The invention also features a kit for determining the
methylation state of a Fanconi Anemia/BRCA pathway gene, comprising
FANC D2 polynucleotide primer pairs and probes, a control
unmethylated reference FANC D2 gene sequence and packaging
materials therefore.
[0023] The invention also features a kit for screening for a
chemosensitizing agent, comprising a tumor cell line that is
resistant to one or more anti-neoplastic agents and packaging
materials therefore. The tumor cell line can be an ovary tumor cell
line, e.g., a cisplatin resistant ovary tumor cell line. The
anti-neoplastic agent can be cisplatin.
[0024] The invention also features a microarray containing one or
more nucleic acid sequences from one or more Fanconi Anemia/BRCA
pathway genes. The genes can be on 15 selected from the group
consisting of: ATM, FANC A, FANC B, FANC C, FANC D1, FANC D2, FANC
E, FANC F and FANC G.
[0025] The invention also features the use of such a microarray in
a method of determining if a patient has cancer, or is at increased
risk of developing cancer, where the method comprises the steps of
(a) providing the microarray; (b) providing a nucleic acid sample
from said patient; (c) hybridizing said nucleic acid sample to said
nucleic acid sequences from the Fanconi Anemia/BRCA pathway on said
microarray; and (d) detecting the presence of mutations in the
Fanconi Anemia/BRCA pathway genes in the nucleic acid sample from
said patient; where detecting the presence of mutations is
indicative of a patient who has cancer, or is at increased risk of
developing cancer.
[0026] In a one embodiment of the invention there is provided an
isolated nucleic acid molecule that includes a polynucleotide
selected from (a) a nucleotide sequence encoding a polypeptide
having an amino acid sequence as shown in SEQ ID NO:4; (b) a
nucleotide sequence at least 90% identical to the polynucleotide of
(b); (c) a nucleotide sequence complementary to the polynucleotide
of (b); (d) a nucleotide sequence at least 90% identical to the
nucleotide sequence shown in SEQ ID NO:5-8, 187-188; and (e) a
nucleotide sequence complementary to the nucleotide sequence of
(d). The polynucleotide may be an RNA molecule or a DNA molecule,
such as a cDNA.
[0027] In another embodiment of the invention, an isolated nucleic
acid molecule is provided that consists essentially of a nucleotide
sequence encoding a polypeptide having an amino acid sequence
sufficiently similar to that of SEQ ID NO:4 to retain the
biological property of conversion from a short form to a long form
of FANCD2 in the nucleus of a cell for facilitating DNA repair.
Alternately, the isolated nucleic acid molecule consists
essentially of a polynucleotide having a nucleotide sequence at
least 90% identical to SEQ ID NO:9-191 or complementary to a
nucleotide sequence that is at least 90% identical to SEQ ID
NO:9-191.
[0028] In an embodiment, a method is provided for making a
recombinant vector that includes inserting any of the isolated
nucleic acid molecules described above into a vector. A recombinant
vector product may be made by this method and the vector may be
introduced to form a recombinant host cell into a host cell.
[0029] In an embodiment of the invention, a method is provided for
making an FA-D2 cell line, that includes (a) obtaining cells from a
subject having a biallelic mutation in a complementation group
associated with FA-D2; and (b) infecting the cells with a
transforming virus to make the FA-D2 cell line where the cells may
be selected from fibroblasts and lymphocytes and the transforming
virus selected from Epstein Barr virus and retrovirus. The FA-D2
cell line may be characterized by determining the presence of a
defective FANDC2 in the cell line for example by performing a
diagnostic assay selected from (i) a Western blot or nuclear
immunofluorescence using an antibody specific for FANCD2 and (ii) a
DNA hybridization assay.
[0030] In an embodiment of the invention, a recombinant method is
provided for producing a polypeptide, that includes culturing a
recombinant host cell wherein the host cell includes any of the
isolated nucleic acid molecules described above.
[0031] In an embodiment of the invention, an isolated polypeptide,
including an amino acid sequence selected from (a) SEQ ID NO:4; (b)
an amino acid sequence at least 90% identical to (a); (c) an amino
acid sequence which is encoded by a polynucleotide having a
nucleotide sequence which is at least 90% identical to at least one
of SEQ ID NO:5-8, 187-188; (d) an amino acid sequence which is
encoded by a polynucleotide having a nucleotide sequence which is
at least 90% identical to a complementary sequence to at least one
of SEQ ID NO:5-8, 187-188; and (e) a polypeptide fragment of
(a)-(d) wherein the fragment is at least 50 aminoacids in
length.
[0032] The isolated polypeptide may be encoded by a DNA having a
mutation selected from nt 376A to G, nt 3707G to A, nt 904C to T
and nt 958C to T. Alternatively, the polypeptide may be
characterized by a polymorphism in DNA encoding the polypeptide,
the polymorphism being selected from nt 1122A to 0, nt 1440T to C,
nt 1509C to T, nt 2141C to T, nt 2259T to C, nt 4098T to G, nt
4453G to A. Alternatively, the polypeptide may be characterized by
a mutation at amino acid 222 or amino acid 561.
[0033] In an embodiment of the invention, an antibody preparation
is described having a binding specificity for a FANCD2 protein
where the antibody may be a monoclonal antibody or a polyclonal
antibody and wherein the FANCD2 may be FANCD2-S or FANCD2-L.
[0034] In an embodiment of the invention, a diagnostic method is
provided for measuring FANCD2 isoforms in a biological sample where
the method includes (a) exposing the sample to a first antibody for
forming a first complex with FANCD2-L and optionally a second
antibody for forming a second complex with FANCD2-S; and (b)
detecting with a marker, the amount of the first complex and the
second complex in the sample. The sample may be intact cells or
lysed cells in a lysate. The biological sample may be from a human
subject with a susceptibility to cancer or having the initial
stages of cancer. The sample may be from a cancer in a human
subject, wherein the cancer is selected from melanoma, leukemia,
astocytoma, glioblastoma, lymphoma, glioma, Hodgkins lymphoma,
chronic lymphocyte leukemia and cancer of the pancreas, breast,
thyroid, ovary, uterus, testis, pituitary, kidney, stomach,
esophagus and rectum. The biological sample may be from a human
fetus or from an adult human and may be derived from any of a blood
sample, a biopsy sample of tissue from the subject and a cell line.
The biological sample may be derived from heart, brain, placenta,
liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate,
testis, uterus, small intestine, colon, peripheral blood or
lymphocytes. The marker may be a fluorescent marker, the
fluorescent marker optionally conjugated to the FANCD2-L antibody,
a chemiluminescent marker optionally conjugated to the FANCD2-L
antibody and may bind the first and the second complex to a third
antibody conjugated to a substrate. Where the sample is a lysate,
it may be subjected to a separation procedure to separate FANCD2
isoforms and the separated isoforms may be identified by
determining binding to the first or the second FANCD2 antibody.
[0035] In an embodiment of the invention, a diagnostic test is
provided for identifying a defect in the Fanconi Anemia pathway in
a cell population from a subject, that includes selecting an
antibody to FANCD2 protein and determining whether the amount of an
FAND2-L isoform is reduced in the cell population compared with
amounts, in a wild type cell population; such that if the amount of
the FANCD2-L protein is reduced, then determining whether an amount
of any of FANCA, FANCB, FANCC, FANCD1, FANCE, FANCF or FANCG
protein is altered in the cell population compared with the wild
type so as to identify the defect in the Fanconi Anemia pathway in
the cell population. In one example, the amount of an isoform
relies on a separation of the FANCD2-L and FANCD2-S isoforms where
the separation may be achieved by gel electrophoresis or by a
migration binding banded test strip.
[0036] In an embodiment of the invention, a screening assay for
identifying a therapeutic agent, is provided that includes
selecting a cell population in which FAND2-L is made in reduced
amounts; exposing the cell population to individual members of a
library of candidate therapeutic molecules; and identifying those
individual member molecules that cause the amount of FANCD2-L to be
increased in the cell population. In one example, the cell
population is an in vitro cell population. In another example, the
cell population is an in vivo cell population, the in vivo
population being within an experimental animal, the experimental
animal having a mutant FANCD2 gene. In a further example, the
experimental animal is a knock-out mouse in which the mouse FAND2
gene has been replaced by a human mutant FANCD2 gene. In another
example, a chemical carcinogen is added to the cell population in
which FANCD2 is made in reduced amounts, to determine if any member
molecules can cause the amount of FANCD2-L to be increased so as to
protect the cells form the harmful effects of the chemical
carcinogen.
[0037] In an embodiment of the invention, an experimental animal
model is provided in which the animal FANCD2 gene has been removed
and optionally replaced by any of the nucleic acid molecules
described above.
[0038] In an embodiment of the invention, a method is provided for
identifying in a cell sample from a subject, a mutant FANCD2
nucleotide sequence in a suspected mutant FANCD2 allele which
comprises comparing the nucleotide sequence of the suspected mutant
FANCD2 allele with the wild type FANCD2 nucleotide sequence wherein
a difference between the suspected mutant and the wild type
sequence identifies a mutant FANCD2 nucleotide sequence in the cell
sample. In one example, the suspected mutant allele is a germline
allele. In another example, identification of a mutant FANCD2
nucleotide sequence is diagnostic for a predisposition for a cancer
in the subject or for an increased risk of the subject bearing an
offspring with Fanconi Anemia. In another example, the suspected
mutant allele is a somatic allele in a tumor type and identifying a
mutant FANCD2 nucleotide sequence is diagnostic for the tumor type.
In another example, the nucleotide sequence of the wild type and
the suspected mutant FANCD2 nucleotide sequence is selected from a
gene, a mRNA and a cDNA made from a mRNA. In another example,
comparing the polynucleotide sequence of the suspected mutant
FANCD2 allele with the wild type FANCD2 polynucleotide sequence,
further includes selecting a FANCD2 probe which specifically
hybridizes to the mutant FANCD2 nucleotide sequence, and detecting
the presence of the mutant sequence by hybridization with the
probe. In another example, comparing the polynucleotide sequence of
the suspected mutant FANCD2 allele with the wild type FANCD2
polynucleotide sequence, further comprises amplifying all or part
of the FANCD2 gene using a set of primers specific for wild type
FANCD2 DNA to produce amplified FANCD2 DNA and sequencing the
FANCD2 DNA so as to identify the mutant sequence. In another
example, where the mutant FANCD2 nucleotide sequence is a germline
alteration in the FANCD2 allele of the human subject, the
alteration is selected from the alterations set forth in Table 3
and where the mutant FANCD2 nucleotide sequence is a somatic
alteration, in the FANCD2 allele of the human subject, the
alteration is selected from the alterations set forth in Table
3.
[0039] In an embodiment of the invention, a method is provided for
diagnosing a susceptibility to cancer in a subject which comprises
comparing the germline sequence of the FANCD2 gene or the sequence
of its mRNA in a tissue sample from the subject with the germline
sequence of the FANCD2 gene or the sequence of its mRNA wherein an
alteration in the germline sequence of the FANCD2 gene or the
sequence of its mRNA of the subject indicates the susceptibility to
the cancer. An alteration may be detected in a regulatory region of
the FANCD2 gene. An alteration in the germline sequence may be
determined by an assay selected from the group consisting of (a)
observing shifts in electrophoretic mobility of single-stranded DNA
on non-denaturing polyacrylamide gels, (b) hybridizing a FANCD2
gene probe to genomic DNA isolated from the tissue sample, (c)
hybridizing an allele-specific probe to genomic DNA of the tissue
sample, (d) amplifying all or part of the FANCD2 gene from the
tissue sample to produce an amplified sequence and sequencing the
amplified sequence, (e) amplifying all or part of the FANCD2 gene
from the tissue sample using primers for a specific FANCD2 mutant
allele, (f) molecularly cloning all or part of the FANCD2 gene from
the tissue sample to produce a cloned sequence and sequencing the
cloned sequence, (g) identifying a mismatch between (i) a FANCD2
gene or a FANCD2 mRNA isolated from the tissue sample, and (ii) a
nucleic acid probe complementary to the human wild-type FANCD2 gene
sequence, when molecules (i) and (ii) are hybridized to each other
to form a duplex, (h) amplification of FANCD2 gene sequences in the
tissue sample and hybridization of the amplified sequences to
nucleic acid probes which comprise wild-type FANCD2 gene sequences,
(i) amplification of FANCD2 gene sequences in the tissue sample and
hybridization of the amplified sequences to nucleic acid probes
which comprise mutant FANCD2 gene sequences, (j) screening for a
deletion mutation in the tissue sample, (k) screening for a point
mutation in the tissue sample, (l) screening for an insertion
mutation in the tissue sample, and (m) in situ hybridization of the
FANCD2 gene of said tissue sample with nucleic acid probes which
comprise the FANCD2 gene.
[0040] In an embodiment of the invention, a method is provided for
diagnosing a susceptibility for cancer in a subject, includes: (a)
accessing genetic material from the subject so as to determine
defective DNA repair; (b) determining the presence of mutations in
a set of genes, the set comprising FAND2 and at least one of FANCA,
FANCB, FANCC, FANCD1, FANCDE, FANDF, FANDG, BRACA1 and ATM; and (c)
diagnosing susceptibility for cancer from the presence of
mutations, in the set of genes.
[0041] In an embodiment of the invention, a method is provided for
detecting a mutation in a neoplastic lesion at the FANCD2 gene in a
human subject which includes: comparing the sequence of the FANCD2
gene or the sequence of its mRNA in a tissue sample from a lesion
of the subject with the sequence of the wild-type FANCD2 gene or
the sequence of its mRNA, wherein an alteration in the sequence of
the FANCD2 gene or the sequence of its mRNA of the subject
indicates a mutation at the FANCD2 gene of the neoplastic lesion. A
therapeutic protocol may be provided for treating the neoplastic
lesion according to the mutation at the FANCD2 gene of the
neoplastic lesion.
[0042] In an embodiment of the invention, a method is provided for
confirming the lack of a FANCD2 mutation in a neoplastic lesion
from a human subject which comprises comparing the sequence of the
FANCD2 gene or the sequence of its mRNA in a tissue sample from a
lesion of said subject with the sequence of the wild-type FANCD2
gene or the sequence of its RNA, wherein the presence of the
wild-type sequence in the tissue sample indicates the lack of a
mutation at the FANCD2 gene.
[0043] In an embodiment of the invention, a method is provided for
determining a therapeutic protocol for a subject having a cancer,
that includes (a) determining if a deficiency in FANCD2-L occurs in
a cell sample from the subject by measuring FANCD2 isoforms using
specific antibodies; (b) if a deficiency is detected in (a), then
determining whether the deficiency is a result of genetic defect in
non-cancer cells; and (c) if (b) is positive, reducing the use of a
therapeutic protocol that causes increased DNA damage so as to
protect normal tissue in the subject and if (b) is negative, and
the deficiency is contained within a genetic defect in cancer cells
only, then increasing the use of a therapeutic protocol that causes
increased DNA damage so as to adversely affect the cancer
cells.
[0044] In an embodiment of the invention, a method of treating a FA
pathway defect in a cell target is provided that includes:
administering an effective amount of FANCD2 protein or an exogenous
nucleic acid to the target. The FA pathway defect may be a
defective FANCD2 gene and the exogenous nucleic acid vector may
further include introducing a vector according to those described
above. The vector may be selected from a mutant herpes virus, a
E1/E4 deleted recombinant adenovirus, a mutant retrovirus, the
viral vector being defective in respect of a viral gene essential
for production of infectious new virus particles. The vector may be
contained in a lipid micelle.
[0045] In an embodiment of the invention, a method is provided for
treating a patient with a defective FANCD2 gene, that includes
providing a polypeptide described in SEQ ID NO:4, for functionally
correcting a defect arising from a condition arising from the
defective FANCD2 gene.
[0046] In an embodiment of the invention, a cell based assay for
detecting a FA pathway defect is provided that includes obtaining a
cell sample from a subject; exposing the cell sample to DNA
damaging agents; and detecting whether FANCD2-L is upregulated, the
absence of upregulation being indicative of the FA pathway defect.
In the cell-based assay, amounts of FANCD2 may be measured by an
analysis technique selected from: immunoblotting for detecting
nuclear foci; Western blots to detect amounts of FANCD2 isoforms
and quantifying mRNA by hybridizing with DNA probes.
[0047] In an embodiment of the invention, a kit is provided for use
in detecting a cancer cell in a biological sample, that includes
(a) primer pair which binds under high stringency conditions to a
sequence in the FANCD2 gene, the primer pair being selected to
specifically amplify an altered nucleic acid sequence described in
Table 7; and containers for each of the primers.
[0048] As used herein, the "Fanconi Anemia/BRCA pathway" or
"Fanconi Anemia Pathway" refers to the genes within the 7
complementation groups (FA-A to FA-G), the BRCA-1 gene and the ATM
gene and their respective proteins that interact in a pathway
referred herein as the Fanconi Anemia/BRCA pathway and regulate the
cellular response to DNA damage (see FIG. 22).
[0049] The genes of the Fanconi Anemia/BRCA pathway are: [0050] 1)
FANC-A (e.g., Genbank Accession No.: NM.sub.--000135) [0051] 2)
FANC-B (not yet cloned) [0052] 3) FANC-C (e.g., Genbank Accession
No.: NM.sub.--000136) [0053] 4) FANC-D1/(e.g., Genbank Accession
No.: U43746) BRCA-2 [0054] 5) FANC-D2 (e.g., Genbank Accession No.:
NM.sub.--033084) [0055] 6) FANC-E (e.g., Genbank Accession No.:
NM.sub.--021922) [0056] 7) FANC-F (e.g., Genbank Accession No.:
NM.sub.--022725) [0057] 8) FANC-G (e.g., Genbank Accession No.:
BC000032) [0058] 9) BRCA-1 (e.g., Genbank Accession No.: U14680)
[0059] 10) ATM (e.g., Genbank Accession No.: U33841)
[0060] As used herein, "testing a Fanconi Anemia/BRCA pathway
protein for the presence of a cancer-associated defect" refers to
the method of determining if a protein encoded by a Fanconi
Anemia/BRCA pathway gene, as defined herein, harbors a defect, as
defined herein, that can cause or is associated with a cancer in a
patient.
[0061] As used herein, the term "defect" refers to any alteration
of a gene or protein within the Fanconi Anemia/BRCA pathway, and/or
proteins, with respect to any unaltered gene or protein within the
Fanconi Anemia/BRCA pathway.
[0062] "Alteration" of a gene includes, but is not limited to: a)
alteration of the DNA sequence itself, i.e., DNA mutations,
deletions, insertions, substitutions; b) DNA modifications
affecting the regulation of gene expression such as regulatory
region mutations, modification in associated chromatin, modications
of intron sequences affecting mRNA splicing, modification affecting
the methylation/demethylation state of the gene sequence; c) mRNA
modications affecting protein translation or mRNA transport or mRNA
splicing.
[0063] "Alteration" of a protein includes, but is not limited to,
amino acid deletions, insertions, substitutions; modification
affecting protein phosphorylation or glycosylation; modifications
affecting protein transport or localization; modifications
affecting the ability to form protein complexes with one or more
associated proteins or changes in the amino acid sequence caused by
changes in the DNA sequence encoding the amino acid.
[0064] As used herein, the term "increased risk" or "elevated risk"
refers to the greater incidence of cancer in those patients having
altered Fanconi Anemia/BRCA genes or proteins as compared to those
patients without alterations in the Fanconi Anemia/BRCA pathway
genes or proteins. "Increased risk" also refers to patients who are
already diagnosed with cancer and may have an increased incidence
of a different cancer form. According to the invention, "increased
risk" of cancer refers to cancer-associated defects in a Fanconi
Anemia/BRCA pathway gene that contributes to a 50%, preferably 90%,
more preferably 99% or more increase in the probability of
acquiring cancer relative to patients who do not have a
cancer-associated defect in a Fanconi Anemia/BRCA pathway gene.
[0065] As used herein, an "inhibitor of the Fanconi Anemia/BRCA
pathway", according to the invention, refers to any compound that
disrupts FANC D2-L protein function either directly or indirectly.
Disruption of FANC D2-L protein function can be achieved either
through disruption of any of the other FANC proteins upstream of
the FANC D2 protein within the pathway, inhibition of the
ubiquitination of the FANC D2-S to the FANC D2-L isoform,
inhibition of subsequent nuclear transport of the FANC D2-L protein
or disrupton of the association of the FANC D2-L protein with the
nuclear BRCA DNA repair protein complex. An "inhibitor" according
to the invention can be nucleic acids (anti-sense RNA or DNA
oligonucleotides), proteins (humanized antibodies), peptides or
small molecule drugs that specifically bind to FANC D2-L and
disrupt FANC D2-L protein function. In a most preferred embodiment,
the inhibitor of the Fanconi Anemia/BRCA pathway is a small
molecule inhibitor of the mono-ubiquitination of the FANC D2
protein.
[0066] As used herein, a "reduction in the ratio of FANC D2-L
relative to FANC D2-S" refers to a decrease in the percentage of
the total amount of FANC D2 protein that is in the FANC D2-L
isoform. In a preferred embodiment, the total amount of FANC D2
protein that is in the FANC D2-L isoform is at most 25%, preferably
10%, more preferably 1% and most preferably 0%. Such a reduction
indicates a defect in one or more genes or proteins of the Fanconi
Anemia/BRCA pathway, as defined herein.
[0067] As used herein, "testing a Fanconi Anemia/BRCA pathway
protein for the presence of a cancer-associated defect" refers to
the method of determining if a protein encoded within the 7
complementation groups (A, B, C, D, E, F and G) that comprise the
Fanconi Anemia/BRCA gene pathway, harbor a defect or other
mutation, as defined herein, that can cause or contribute to a
cancer in a patient.
[0068] As used herein, the term "inducing DNA damage" refers to
both chemical and physical methods of damaging DNA. Chemicals that
damage DNA include, but are not limited to, acids/bases and various
mutagens, such as ethidium bromide, acridine orange, as well as
free radicals. Physical methods include, but are not limited to,
ionizing radiation, such as X rays and gamma rays, and ultraviolet
(UV) radiation. Both methods of "inducing DNA damage" can result in
DNA mutations that typically include, but are not limited to,
single-strand breaks, double-strand breaks, alterations of bases,
insertions, deletions or the cross-linking of DNA strands.
[0069] As used herein, the term "tissue biopsy" refers to a
biological material, which is isolated from a patient. The term
"tissue", as used herein, is an aggregate of cells that perform a
particular function in an organism and encompasses cell lines and
other sources of cellular material including, but not limited to, a
biological fluid for example, blood, plasma, sputum, urine,
cerebrospinal fluid, lavages, and leukophoresis samples.
[0070] As used herein, the term "amplifying", when applied to a
nucleic acid sequence, refers to a process whereby one or more
copies of a particular nucleic acid sequence is generated from a
template nucleic acid, preferably by the method of polymerase chain
reaction (Mullis and Faloona, 1987, Methods Enzymol., 155:335).
"Polymerase chain reaction" or "PCR" refers to an in vitro method
for amplifying a specific nucleic acid template sequence. The PCR
reaction involves a repetitive series of temperature cycles and is
typically performed in a volume of 50-100 .mu.l. The reaction mix
comprises dNTPs (each of the four deoxynucleotides dATP, dCTP,
dGTP, and dTTP), primers, buffers, DNA polymerase, and nucleic acid
template. The PCR reaction comprises providing a set of
polynucleotide primers wherein a first primer contains a sequence
complementary to a region in one strand of the nucleic acid
template sequence and primes the synthesis of a complementary DNA
strand, and a second primer contains a sequence complementary to a
region in a second strand of the target nucleic acid sequence and
primes the synthesis of a complementary DNA strand, and amplifying
the nucleic acid template sequence employing a nucleic acid
polymerase as a template-dependent polymerizing agent under
conditions which are permissive for PCR cycling steps of (i)
annealing of primers required for amplification to a target nucleic
acid sequence contained within the template sequence, (ii)
extending the primers wherein the nucleic acid polymerase
synthesizes a primer extension product. "A set of polynucleotide
primers" or "a set of PCR primers" can comprise two, three, four or
more primers.
[0071] Other methods of amplification include, but are not limited
to, ligase chain reaction (LCR), polynucleotide-specific base
amplification (NSBA), or any other method known in the art.
[0072] As used herein, the term "polynucleotide primer" refers to a
DNA or RNA molecule capable of hybridizing to a nucleic acid
template and acting as a substrate for enzymatic synthesis under
conditions in which synthesis of a primer extension product which
is complementary to a nucleic acid template is catalyzed to produce
a primer extension product which is complementary to the target
nucleic acid template. The conditions for initiation and extension
include the presence of four different deoxyribonucleoside
triphosphates and a polymerization-inducing agent such as DNA
polymerase or reverse transcriptase, in a suitable buffer ("buffer"
includes substituents which are cofactors, or which affect pH,
ionic strength, etc.) and at a suitable temperature. The primer is
preferably single-stranded for maximum efficiency in amplification.
"Primers" useful in the present invention are generally between
about 10 and 35 nucleotides in length, preferably between about 15
and 30 nucleotides in length, and most preferably between about 18
and 25 nucleotides in length.
[0073] As defined herein, "a tumor" is a neoplasm that may either
be malignant or non-malignant. Tumors of the same tissue type
originate in the same tissue, and may be divided into different
subtypes based on their biological characteristics.
[0074] As used herein, the term "cancer" refers to a malignant
disease caused or characterized by the proliferation of cells which
have lost susceptibility to normal growth control. "Malignant
disease" refers to a disease caused by cells that have gained the
ability to invade either the tissue of origin or to travel to sites
removed from the tissue of origin.
[0075] As used herein, the term "antibody" refers to an
immunoglobulin having the capacity to specifically bind a given
antigen. The term "antibody" as used herein is intended to include
whole antibodies of any isotype (IgG, IgA, IgM, IgE, etc), and
fragments thereof which are also specifically reactive with a
vertebrate, e.g., mammalian, protein. Antibodies can be fragmented
using conventional techniques and the fragments screened for
utility in the same manner as whole antibodies. Thus, the term
includes segments of proteolytically-cleaved or
recombinantly-prepared portions of an antibody molecule that are
capable of selectively reacting with a certain protein.
Non-limiting examples of such proteolytic and/or recombinant
fragments include Fab, F(ab')2, Fab, Fv, and single chain
antibodies (scFv) containing a V[L] and/or V[H] domain joined by a
peptide linker. The scFv's may be covalently or non-covalently
linked to form antibodies having two or more binding sites.
Antibodies may be labeled with detectable moieties by one of skill
in the art. In some embodiments, the antibody that binds to an
entity one wishes to measure (the primary antibody) is not labeled,
but is instead detected by binding of a labeled secondary antibody
that specifically binds to the primary antibody.
[0076] A patient is "treated" according to the invention if one or
preferably more symptoms of cancer as described herein are
eliminated or reduced in severity, or prevented from progressing or
developing further.
[0077] As used herein, the term "therapeutically effective amount"
means the total amount of each active component of the
pharmaceutical composition or method that is sufficient to show a
meaningful patient benefit, i.e., treatment, healing, prevention or
amelioration of the relevant medical condition, or an increase in
rate of treatment, healing, prevention or amelioration of such
conditions.
[0078] As used herein, the term "cancer therapeutic" refers to a
compound that prevents the onset or progression of cancer or
prevents cancer metastasis or reduces, delays, or eliminates the
symptoms of cancer.
[0079] As used herein, the term "inhibitor of the
mono-ubiquitination" refers to a compound that prevents or inhibits
the ubiquitination of the FANC D2 gene. "Ubiquitination" is defined
as the covalent linkage of ubiquitin to a protein by a E3
mono-ubiquitin ligase. In a preferred embodiment, the "inhibitor of
the mono-ubiquitination" refers to any inhibitor of a FANC protein
complex with E3 FANC D2 monoubiquitin ligase activity such that
FANC D2 monoubiquitin ligase activity is inhibited.
[0080] As used herein, the term "cisplatin" refers to an agent with
the following chemical structure:
##STR00001##
[0081] Cisplatin, also called cis-diamminedichloroplatinum(II), is
one of the most frequently used anticancer drugs. It is an
effective component of several different combination drug protocols
used to treat a variety of solid tumors. These drugs are used in
the treatment of testicular cancer (with bleomycin and
vinblastine), bladder cancer, head and neck cancer (with bleomycin
and fluorouracil), ovarian cancer (with cyclophosphamide or
doxorubicin) and lung cancer (with etoposide). Cisplatin has been
found to be the most active single agent against most of these
tumors. Cisplatin is commercially available as `Platinol` from
Bristol Myers Squibb Co. Cisplatin, is one of a number of platinum
coordination complexes with antitumor activity. The platinum
compounds are DNA cross-linking agents similar to but not identical
to the alkylating agents. The platinum compounds exchange chloride
ions for nucleophilic groups of various kinds. Both the cis and
trans isomers do this but the trans isomer is known to be
bioligically inactive for reasons not completely understood. To
possess antitumor activity a platinum compound must have two
relatively labile cis-oriented leaving groups. The principal sites
of reaction are the N7 atoms of guanine and adenine. The main
interaction is formation of intrastrand cross links between the
drug and neighboring guanines. Intrastrand cross linking has been
shown to correlate with clinical response to cisplatin therapy.
DNA/protein cross linking also occurs but this does not correlate
with cytotoxicity. Cross-resistance between the two groups of drugs
is usually not seen indicating that the mechanisms of action are
not identical. The types of cross linking with DNA may differ
between the platinum compounds and the typical alkylating
agents.
[0082] As used herein, "resistance to one or more anti-neoplastic
agents" refers the ability of cancer cells to develop resistance to
anticancer drugs. Mechanisms of drug resistance include decreased
intracellular drug levels caused by an increased drug efflux or
decreased inward transport, increased drug inactivation, decreased
conversion of drug to an active form, altered amount of target
enzyme or receptor (gene amplification), decreased affinity of
target enzyme or receptor for drug, enhanced repair of the
drug-induced defect, decreased activity of an enzyme required for
the killing effect (topoisomerase II). In a preferred embodiment of
the invention, drug resistance refers to the enhanced repair of DNA
damage induced by one or more anti-neoplastic agents. In another
preferred embodiment of the invention, the enhanced repair of DNA
damage induced by one or more anti-neoplastic agents is due to a
constitutively active Fanconi Anemia/BRCA DNA repair pathway.
[0083] As used herein, the term "anti-neoplastic agent" refers to a
compound that is used to treat cancer. According to the invention,
an "anti-neoplastic agent" encompasses chemotherapy compounds as
well as other anti-cancer agents known in the art. In a preferred
embodiment, the "anti-neoplastic agent" is cisplatin.
Anti-neoplastic agents according to the invention also include
cancer therapy protocols using chemotherapy compounds in
conjunction with radiation therapy and/or surgery. Radiation
therapy relies on the local destruction of cancer cells through
ionizing radiation that disrupts cellular DNA. Radiation therapy
can be externally or internally originated, high or low dose, and
delivered with computer-assisted accuracy to the site of the tumor.
Brachytherapy, or interstitial radiation therapy, places the source
of radiation directly into the tumor as implanted "seeds."
[0084] As used herein, the term "a reduced growth rate" refers to a
decrease of 50%, preferably 90%, more preferably 99% and most
preferably 100% in the rate of cellular proliferation of a tumor
cell line that is being treated with a potential inhibitor of the
Fanconi Anemia/BRCA pathway and one or more chemotherapy compounds
relative to cells of a tumor cell line that is not being treated
with a potential inhibitor of the Fanconi Anemia/BRCA pathway and
one or more chemotherapy compounds.
[0085] As used herein, the term "chemosensitizing agent" refers to
any compound that renders a cell or cell population sensitive to a
chemotherapy compound and results in a "reduced growth rate" as
defined herein. A chemosensitizing agent is a compound that is
generally not cytotoxic in itself, but modifies the host or tumor
cells to enhance anticancer therapy. According to the invention,
cellular resistance to a chemotherapy compound is reversed in the
presence of a chemosensitizing agent. In a preferred embodiment,
the chemosensitizing agent is an inhibitor of the Fanconi
Anemia/BRCA pathway. In a most preferred embodiment, the
chemosensitizing agent is an inhibitor of the mono-ubiquitination
of the FANC D2 protein.
[0086] As used herein, the "methylation state of a Fanconi
Anemia/BRCA pathway gene" refers to the presence of one or more
methylated cytosines (5m-C) within a Fanconi Anemia/BRCA pathway
gene and results in a decrease or inhibition of gene expression of
90%, 99% or preferably 100% relative to a gene that is not
methylated. In a preferred embodiment, the methylated cytosines
reside within CpG islands. According to the invention, a gene is
said to be "methylated" when one or more of CpG residues is
methylated.
[0087] As used herein, "microarray", or "array", refers to a
plurality of unique biomolecules attached to one surface of a solid
support. Preferably, a biomolecule of the invention a potential
inhibitor of the Fanconi Anemia/BRCA pathway as described herein.
In this embodiment, the microarray of the invention comprises
nucleic acids, proteins, polypeptides, peptides, fusion proteins or
small molecules that are immobilised on a solid support, generally
at high density. Each of the biomolecules is attached to the
surface of the solid support in a pre-selected region. Suitable
solid supports are available commercially, and will be apparent to
the skilled person. The supports may be manufactured from materials
such as glass, ceramics, silica and silicon. The supports usually
comprise a flat (planar) surface, or at least an array in which the
molecules to be interrogated are in the same plane. In one
embodiment, the array is on microbeads. In one embodiment, the
array comprises at least 10, 500, 1000, 10,000 different
biomolecules attached to one surface of the solid support.
BRIEF DESCRIPTION OF THE DRAWINGS
[0088] The foregoing features of the invention will be more readily
understood by reference to the following detailed description,
taken with reference to the accompanying drawings, in which:
[0089] FIG. 1A provides a Western blot demonstrating that the
Fanconi Anemia protein complex is required for the
monoubiquitination of FANCD2. Normal (WT) cells (lane 1) express
two isoforms of the FANCD2 protein, a low molecular weight isoform
(FANCD2-S) (155 kD) and a high molecular weight isoform (FANCD2-L)
(162 kD). Lanes 3, 7, 9, 11 show that FA cell lines derived from
type A, C, G, and F patients only express the FANCD2-S isoform.
Lanes 4, 8, 10, 12 show the restoration of the high molecular
weight isoform FANCD2-L following transfection of cell lines with
corresponding FAcDNA.
[0090] FIG. 1B shows a Western blot obtained after HeLa cells were
transfected with a cDNA encoding HA-ubiquitin. After transfection,
cells were treated with the indicated dose of mitomycin C (MMC).
Cellular proteins were immunoprecipitated with a polyclonal
antibody (E35) to FANCD2, as indicated. FANCD2 was
immunoprecipitated, and immune complexes were blotted with
anti-FANCD2 or anti-HA monoclonal antibody.
[0091] FIG. 1C shows a Western blot obtained after HeLa cells were
transfected with a cDNA encoding HA-ubiquitin. After transfection,
cells were treated with the indicated dose of ionizing radiation
(IR). FANCD2 was immunoprecipitated, and immune complexes were
blotted with anti-FANCD2 or anti-HA monoclonal antibody.
[0092] FIG. 1D shows a Western blot obtained after PA-G fibroblast
line (FAG326SV) or corrected cells (FAG326SV plus FANCG cDNA) were
transfected with the HA-Ub cDNA, FANCD2 was immunoprecipitated, and
immune complexes were blotted with anti-FANCD2 or anti-HA
antisera.
[0093] FIG. 1E shows a Western blot obtained after treatment of
HeLa cells with 1 mM hydroxyurea for 24 hours. HeLa cell lysates
were extracted and incubated at the indicated temperature for the
indicated time period with or without 2.5 .mu.M ubiquitin aldehyde.
The FANCD2 protein was detected by immunoblot with monoclonal
anti-FANCD2 (F117).
[0094] FIG. 2 demonstrates that the Fanconi Anemia pathway is
required for the formation of FANCD2 nuclear foci. Top panel shows
anti-FANCD2 immunoblots of SV40 transformed fibroblasts prepared as
whole cell extracts. Panels a-h show immunofluorescence with the
affinity-purified anti-FANCD2 antiserum. The uncorrected (mutant,
M) FA fibroblasts were FA-A (GM6914), FA-G (FAG326SV), FA-C(PD426),
and FA-D (PD20F). The FA-A, FA-G, and FA-C fibroblasts were
functionally complemented with the corresponding FA cDNA. The FA-D
cells were complemented with neomycin-tagged human chromosome 3p
(Whitney et al., 1995).
[0095] FIG. 3 shows the cell cycle dependent expression of the two
isoforms of the FANCD2 protein. (a) HeLa cells, SV40 transformed
fibroblasts from an FA-A patient (GM6914), and GM6914 cells
corrected with FANCA cDNA were synchronized by the double thymidine
block method. Cells corresponding to the indicated phase of the
cell cycle were lysed, and processed for FANCD2 immunoblotting (b)
Synchrony by nocodazole block (c) Synchrony by mimosine block (d)
HeLa cells were synchronized in the cell cycle using nocodazole or
(e) mimosine, and cells corresponding to the indicated phase of the
cell cycle were immunostained with the anti-FANCD2 antibody and
analyzed by immunofluorescence.
[0096] FIG. 4 shows the formation of activated FANCD2 nuclear foci
following cellular exposure to MMC, Ionizing Radiation, or
Ultraviolet Light. Exponentially-growing HeLa cells were either
untreated or exposed to the indicated DNA damaging agents, (a)
Mitomycin C (MMC), (b) .gamma.-irradiation (IR), or (c) Ultraviolet
Light (UV), and processed for FANCD2 immunoblotting or FANCD2
immunostaining. (a) Cells were continuously exposed to 40 ng/ml MMC
for 0-72 hours as indicated, or treated for 24 hours and fixed for
immunofluorescence. (b) and (c) Cells were exposed to
.gamma.-irradiation (10 Gy, B) or UV light (60 J/m2 C) and
collected after the indicated time (upper panels) or irradiated
with the indicated doses and harvested one hour later (lower
panels). For immunofluorescence analysis cells were fixed 8 hours
after treatment (B, 10 Gy, C, 60 J/m2). (d) The indicated
EBV-transformed lymphoblast lines from a normal individual (PD7) or
from various Fanconi Anemia patients were either treated with 40
ng/ml of Mitomycin C continuously (lanes 1-21) or exposed to 15 Gy
of .gamma.-irradiation (lanes 22-33) and processed for FANCD2
immunoblotting. The upregulation of FANCD-L after MMC or IR
treatment was seen in PD7 (lanes 2-5) and in the corrected FA-A
cells (lanes 28-33), but was not observed in any of the mutant
Fanconi Anemia cell lines. Similarly, IR-induced FANCD2 nuclear
foci were not detected in PA fibroblasts (FA-G+IR) but were
restored after functional complementation (PA-G+FANCG).
[0097] FIG. 5 shows co-localization of activated FANCD2 and BRCA1
in Discrete Nuclear Foci following DNA damage. HeLa cells were
untreated or exposed to Ionizing Radiation (10 Gy) as indicated,
and fixed 8 hours later. (a) Cells were double-stained with the D-9
monoclonal anti-BRCA1 antibody (green, panels a, d, g, h) and the
rabbit polyclonal anti-FANCD2 antibody (red, panels b, e, h, k),
and stained cells were analyzed by immunofluorescence. Where green
and red signals overlap (Merge, panels c, f, i, l) a yellow pattern
is seen, indicating co-localization of BRCA1 and FANCD2. (b)
Co-immunoprecipitation of FANCD2 and BRCA1. HeLa cells were
untreated (IR) or exposed to 15 Gy of .gamma.-irradiation (+IR) and
collected 12 hours later. Cell lysates were prepared, and cellular
proteins were immunoprecipitated with either the monoclonal FANCD2
antibody (FI-17, lanes 9-10), or any one of three
independently-derived monoclonal antibodies to human BRCA1 (lanes
3-8): D-9 (Santa Cruz), Ab-1 and Ab-3 (Oncogene Research Products).
The same amount of purified mouse IgG (Sigma) was used in control
samples (lanes 1-2). Immune complexes were resolved by SDS-PAGE and
were immunoblotted with anti-FANCD2 or anti-BRCA1 antisera. The
FANCD-L isoform preferentially coimmunoprecipitated with BRCA1.
[0098] FIG. 6 shows the co-localization of activated FANCD2 and
BRCA1 in discrete nuclear foci during S phase. (a) HeLa cells were
synchronized in late G1 with mimosine and released into S phase. S
phase cells were double-stained with the monoclonal anti-BRCA1
antibody (green, panels a, d) and the rabbit polyclonal anti-FANCD2
antibody (red, panels b, e), and stained cells were analyzed by
immunofluorescence. Where green and red signals overlap (merge,
panels c, f), a yellow pattern is seen, indicating co-localization
of BRCA1 and FANCD2. (b) HeLa cells synchronized in S phase were
either untreated (a, b, k, l) or exposed to IR (50 Gy, panels c, d,
m, n), MMC (20 .mu.g/ml, panels c, f, o, p), or UV (100 j/m2,
panels g, h, q, r) as indicated and fixed 1 hour later. Cells were
subsequently immunostained with an antibody specific for FANCD2 or
BRCA1.
[0099] FIG. 7 shows that FANCD2 forms foci on synaptonemal
complexes that can co-localize with BRCA1 during meiosis I in mouse
spermatocytes. (a) Anti-SCP3 (white) and anti-FANCD2 (red) staining
of synaptonemal complexes in a late pachytene mouse nucleus. (b)
SCP3 staining of late pachytene chromosomes. (c) Staining of this
spread with preimmune serum for the anti-FANCD2 E35 antibody. (d)
Anti-SCP3 staining of synaptonemal complexes in a mouse diplotene
nucleus. (e) Costaining of this spread with E35 anti-FANCD2
antibody. Note staining of both the unpaired sex chromosomes and
the telomeres of the autosomes with anti-FANCD2. (f) Costaining of
this spread with anti-BRCA1 antibody. The sex chromosomes are
preferentially stained. (g) Anti-FANCD2 staining of late pachytene
sex chromosome synaptonemal complexes. (h) Anti-BRCA1 staining of
the same complexes. (i) Anti-FANCD2 (red) and anti-BRCA1 (green)
co-staining (co-localization reflected by yellow areas).
[0100] FIG. 8 provides a schematic interaction of the FA proteins
in a cellular pathway. The FA proteins (A, C, and G) bind in a
functional nuclear complex. Upon activation of this complex, by
either S phase entry or DNA damage, this complex enzymatically
modifies (monoubiquitinates) the D protein. According to this
model, the activated D protein is subsequently targeted to nuclear
foci where it interacts with the BRCA1 protein and other proteins
involved in DNA repair.
[0101] FIG. 9 shows a Northern blot of cells from heart, brain,
placenta, liver, skeletal muscle, kidney, pancreas, spleen, thymus,
prostate, testis, uterus, small intestine, colon and peripheral
blood lymphocytes from a human adult and brain, lung, liver and
kidney from a human fetus probed with a full-length FANCD2 cDNA and
exposed for 24 hours.
[0102] FIG. 10 shows allele specific assays for mutation analysis
of 2 FANCD2 families where the family pedigrees (a, d) and panels
b, c, e and f are vertically aligned such that the corresponding
mutation analysis is below the individual in question. Panels a-c
depict the PD20 and panels d-f the VU008 family. Panels b and e
show the segregation of the maternal mutations as detected by the
creation of a new MspI site (PD20) or DdeI site (VU008). The
paternally inherited mutations in both families were detected with
allele specific oligonucleotide hybridization (panels c and f).
[0103] FIG. 11 shows a Western blot analysis of the FANCD2 protein
in human Fanconi Anemia cell lines. Whole cell lysates were
generated from the indicated fibroblast and lymphoblast lines.
Protein lysates (70 g) were probed directly by immunoblotting with
the anti-FANCD2 antiserum. The FANCD2 proteins (155 kD and 162 kD)
are indicated by arrows. Other bands in the immunoblot are
non-specific. (a) Cell lines tested included wild-type cells (lanes
1,7), PD20 Fibroblasts (lane 2), PD20 lymphoblasts (lane 4),
revertant MMC-resistant PD20 lymphoblasts (lane 5, 6), and
chromosome 3p complemented PD20 fibroblasts (lane 3). Several other
FA group D cell lines were analyzed including HSC62 (lane 8) and
VU008 (lane 9). FA-A cells were HSC72 (lane 10), FA-C cells were
PD4 (lane 11), and FA-G cells were EUFA316 (lane 12). (b)
Identification of a third FANCD2 patient. FANCD2 protein was
readily detectable in wild-type and FA group G cells but not in
PD733 cells. (c) Specificity of the antibody. PD20i cells
transduced with a retroviral FANCD2 expression vector displayed
both isoforms of the FANCD2 protein (lane 4) in contrast to empty
vector controls (lane 3) and untransfected PD20i cells (lane 2). In
wild-type cells the endogenous FANCD2 protein (two isoforms) was
also immunoreactive with the antibody (lane 1).
[0104] FIG. 12 shows functional complementation of FA-D2 cells with
the cloned FANCD2 cDNA. The SV40-transformed FA-D2 fibroblast line,
PD20i, was transduced with pMMP-puro (PD20+vector) or pMMP-FANCD2
(PD20+FANCD2 wt). Puromycin-selected cells were subjected to MMC
sensitivity analysis. Cells analyzed were the parental PD20F cells
(.DELTA.), PD20 corrected with human chromosome 3p (.largecircle.),
and PD20 cells transduced with either pMMP-puro or
pMMP-FANCD2(wt)-puro (.diamond-solid.).
[0105] FIG. 13 shows a molecular basis for the reversion of PD20
Lymphoblasts. (a) PCR primers to exons 5 and 6 were used to amplify
cDNA. Control samples (right lane) yielded a single band of 114 bp,
whereas PD20 cDNA (left lane) showed 2 bands, the larger reflecting
the insertion of 13 bp of intronic sequence into the maternal
allele. Reverted, MMC resistant lymphoblasts (middle lane) from
PD20 revealed a third, inframe splice variant of 114+36 bp (b)
Schematic representation of splicing at the FANCD2 exon 5/intron 5
boundary. In wild-type cDNA 100% of splice events occur at the
proper exon/intron boundary (SEQ ID NO:189), whereas the maternal
A->G mutation (indicated by arrow) leads to aberrant splicing,
also in 100% (SEQ ID NO:190). In the reverted cells all cDNAs with
the maternal mutation also had a second sequence change (fat arrow)
and showed a mixed splicing pattern with insertion of either 13 bp
(.about.40% of mRNA) or 36 bp (.about.60% of mRNA) (SEQ ID
NO:191).
[0106] FIG. 14 shows an FANCD2 Western blot of cancer cell lines
derived from patients with ovarian cancer.
[0107] FIG. 15 shows a sequence listing for amino acid sequence of
human FANCD2 (SEQ ID NO:1) and alignment with fly (SEQ ID NO:2) and
plant (SEQ ID NO:3) homologues using the BEAUTY algorithm (Worley
et al., (1995) Genome Res. Vol. 5, pp. 173-184). Black boxes
indicate amino acid identity and gray similarity. The best
alignment scores were observed with hypothetical proteins in D
melanogaster (p=8.4.times.10-58, accession number AAF55806) and A
thaliana (p=9.4.times.10-45, accession number B71413).
[0108] FIG. 16 is the FANCD cDNA sequence -63 to 5127 nucleotides
(SEQ ID NO:5) and polypeptide encoded by this sequence from amino
acid 1 to 1472 (SEQ ID NO:4).
[0109] FIG. 17 is the nucleotide sequence for FANCD-S.ORF (SEQ ID
NO:187) compared with FANCD cDNA (SEQ ID NO:188).
[0110] FIG. 18 is the nucleotide sequence for human FANCD2-L (SEQ
ID NO:6).
[0111] FIG. 19 is the nucleotide sequence for human FANCD2-S (SEQ
ID NO:7).
[0112] FIG. 20 is the nucleotide sequence for mouse FANCD2 (SEQ ID
NO:8).
[0113] FIG. 21 depicts protocol used to analyze the methylation
state of the FANC F gene.
[0114] FIG. 22 depicts the Fanconi Anemia/BRCA pathway.
DETAILED DESCRIPTION
[0115] "FANCD2-L therapeutic agent" shall mean any of a protein
isoform, and includes a peptide, a peptide derivative, analogue or
isomer of the FANCD2-L protein and further include any of a small
molecule derivative, analog, isomer or agonist that is functionally
equivalent to FANCD2-L. Also included in the definition is a
nucleic acid encoding FANCD2 which may be a full length or partial
length gene sequence or cDNA or may be a gene activating nucleic
acid or a nucleic acid binding molecule including an aptamer of
antisense molecule which may act to modulate gene expression.
[0116] "Nucleic acid encoding FANCD-2" shall include the complete
cDNA or genomic sequence of FANCD2 or portions thereof for
expressing FANCD2-L protein as defined above. The nucleic acid may
further be included in a nucleic acid carrier or vector and
includes nucleic acid that has been suitably modified for effective
delivery to the target site.
[0117] "Stringent conditions of hybridization" will generally
include temperatures in excess of 30.degree. C., typically in
excess of 37.degree. C., and preferably in excess of 45.degree. C.
Stringent salt conditions will ordinarily be less than 1000 mM,
typically less than 500 mM, and preferably less than 200 mM.
[0118] "Substantial homology or similarity" for a nucleic acid is
when a nucleic acid or fragment thereof is "substantially
homologous" (or "substantially similar") to another if, when
optimally aligned (with appropriate nucleotide insertions or
deletions) with the other nucleic acid (or its complementary
strand), there is nucleotide sequence identity in at least about
60% of the nucleotide bases, usually at least about 70%, more
usually at least about 80.
[0119] "Antibodies" includes polyclonal and/or monoclonal
antibodies and fragments thereof including single chain antibodies
and including single chain antibodies and Fab fragments, and
immunologic binding equivalents thereof, which have a binding
specificity sufficient to differentiate isoforms of a protein.
These antibodies will be useful in assays as well as
pharmaceuticals.
[0120] "Isolated" is used to describe a protein, polypeptide or
nucleic acid which has been separated from components which
accompany it in its natural state. An "isolated" protein or nucleic
acid is substantially pure when at least about 60 to 75% of a
sample exhibits a single amino acid or nucleotide sequence.
[0121] "Regulatory sequences" refers to those sequences normally
within 100 kb of the coding region of a locus, but they may also be
more distant from the coding region, which affect the expression of
the gene (including transcription of the gene, and translation,
splicing, stability or the like of the messenger RNA).
[0122] "Polynucleotide" includes RNA, cDNA, genomic DNA, synthetic
forms, and mixed polymers, both sense and antisense strands, and
may be chemically or biochemically modified or may contain
non-natural or derivatized nucleotide bases, as will be readily
appreciated by those skilled in the art. Such modifications
include, for example, labels, methylation, substitution of one or
more of the naturally occurring nucleotides with an analog,
internucleotide modifications such as uncharged linkages (e.g.,
methyl phosphonates, phosphotriesters, phosphoamidates, carbamates,
etc.), charged linkages (e.g., phosphorothioates,
phosphorodithioates, etc.), pendent moieties (e.g., polypeptides),
and modified linkages (e.g., alpha anomeric nucleic acids, etc.).
Also included are synthetic molecules that mimic nucleic acids in
their ability to bind to a designated sequence via hydrogen bonding
and other chemical interactions.
[0123] "Mutation" is a change in nucleotide sequence within a gene,
or outside the gene in a regulatory sequence compared to wild type.
The change may be a deletion, substitution, point mutation,
mutation of multiple nucleotides, transposition, inversion, frame
shift, nonsense mutation or other forms of aberration that
differentiate the nucleic acid or protein sequence from that of a
normally expressed gene in a functional cell where expression and
functionality are within the normally occurring range.
[0124] "Subject" refers to an animal including mammal, including
human.
[0125] "Wild type FANCD2" refers to a gene that encodes a protein
or an expressed protein capable of being monoubiquinated to form
FANCD2-L from FANCD-S within a cell.
[0126] We have found that some Fanconi Anemia has similarities with
a group of syndromes including ataxia telangiectasia (AT),
Xeroderma pigmentosum (XP), Cockayne syndrome (CS), Bloom's
syndrome, myelodysplastic syndrome, aplastic anemia, cancer
susceptibility syndromes and HNPCC (see Table 2). These syndromes
have an underlying defect in DNA repair and are associated with
defects in maintenance of chromosomal integrity. Defects in
pathways associated with DNA repair and maintenance of chromosomal
integrity result in genomic instability, and cellular sensitivity
to DNA damaging agents such as bifunctional alkylating agents that
cause intrastrand crosslinking. Moreover, deficiencies in DNA
repair mechanisms appear to substantially increase the probability
of initiating a range of cancers through genetic rearrangements.
This observation is pertinent with regard to the clinical use of
DNA cross-linking drugs including mitomycin C, cisplatin,
cyclophosphamide, psoralen and UVA irradiation.
[0127] Although Fanconi Anemia is a rare disease, the pleiotropic
effects of FA indicate the importance of the wild type function of
FA proteins in the pathway for diverse cellular processes including
genome stability, apoptosis, cell cycle control and resistance to
DNA crosslinks. The cellular abnormalities in FA include
sensitivity to cross-linking agents, prolongation of G2 phase of
cell cycle, sensitivity to oxygen including poor growth at ambient
O2, overproduction of O2 radicals, deficient O2 radical defense,
deficiency in superoxide dismutase; sensitivity to ionizing
radiation (G2 specific); overproduction of tumor necrosis factor,
direct defects in DNA repair including accumulations of DNA
adducts, and defects in repair of DNA cross-links, genomic
instability including spontaneous chromosome breakage, and
hypermutability by deletion mechanism, increased aptosis, defective
p53 induction, intrinsic stem cell defect, including decreased
colony growth in vitro; and decreased gonadal stem cell
survival.
[0128] These features are reflective of the involvement of FA in
maintenance of hematopoietic and gonadal stem cells, as well as the
normal embryonic development of many different structures,
including the skeleton and urogenital systems. Cell samples from
patients were analyzed to determine defects in the FA
complementation group D. Lymphoblasts from one patient gave rise to
the PD20 cell line which was found to be mutated in a different
gene from HSC62 derived from another patient with a defect in the D
complementation group Mutations from both patients mapped to the D
complementation group but to different genes hence the naming of
two FANCD proteins-FANCD1 (HSC62) and FANCD2 (PD20) (Timmers et
al., (2001) Molecular Cell, Vol. 7, pp. 241-248). We have shown
that FANCD2 is the endpoint of the FA pathway and is not part of
the FA nuclear complex nor required for its assembly or stability
and that FANCD2 exists in two isoforms, FANCD2-S and FANCD2-L. We
have also shown that transformation of the protein short form
(FAND2-S) to the protein long form (FANCD2-L) occurs in response to
the FA complex (FIG. 8). Defects in particular proteins associated
with the FA pathway result in failure to make an important post
translationally modified form of FANCD2 identified as FANCD2-L. The
two isoforms of FANCD2 are identified as the short form and the
long form.
[0129] Failure to make FANCD2-L correlates with errors in DNA
repair and cell cycle abnormalities associated with diseases listed
above.
[0130] To understand more about the role of FANCD2 in the
aforementioned syndromes, we cloned the FANCD2 gene and determined
the protein sequence. The FANCD2 gene has an open reading frame of
4,353 base pairs and forty four exons which encodes a novel 1451
amino acid nuclear protein, with a predicted molecular weight of
166 kD. Western blot analysis revealed the existence of 2 protein
isoforms of 162 and 155 kD. The sequence corresponding to the 44
Intron/Exon Junctions are provided in Table 6 (SEQ ID NO:9-94).
[0131] Unlike previously cloned FA proteins, FANCD2 proteins from
several nonvertebrate eukaryotes showed highly significant
alignment scores with proteins in D. melanogaster, A. thaliana, and
C. elegans. The drosophila homologue, has 28% amino acid identity
and 50% similarity to FANCD2 (Figure and SEQ ID NO:1-3) and no
functional studies have been carried out in the respective species.
No proteins similar to FANCD2 were found in E. coli or S.
cerevisiae.
[0132] We obtained the FANCD2 DNA sequence (SEQ ID NO:5) by
analyzing the chromosome 3p locus in PD20 and VU008, two FA cell
lines having biallelic mutations in the FANCD2 gene (FIG. 10). The
cell lines were assigned as complementation group D because
lymphoblasts from the patients failed to complement HSC62, the
reference cell line for group D. FANCD2 mutations were not detected
in this group D reference cell line which indicates that the gene
mutated in HSC62 is the gene encoding FANCD1 and in PD20 and VU008
is FANCD2 (FIG. 11). Microcell mediated chromosome transfer was
used to identify the mutations (Whitney et al., Blood, (1995) Vol.
88, 49-58). Detailed analysis of five microcell hybrids containing
small overlapping deletions encompassing the locus narrowed the
candidate region of the FANCD2 gene to 200 kb. The FANCD2 gene was
isolated as follows: Three candidate ESTs were localized in or near
this FANCD2 critical region. Using 5' and 3' RACE to obtain
full-length cDNAs, the genes were sequenced, and the expression
pattern of each was analyzed by northern blot. EST SCC34603 had
ubiquitous and low level expression of a 5 kb and 7 kb mRNA similar
to previously cloned FA genes. Open reading frames were found for
TIGR-A004X28, AA609512 and SGC34603 and were 234, 531 and 4413 bp
in length respectively. All 3 were analyzed for mutations in PD20
cells by sequencing cloned RT-PCR products. Whereas no sequence
changes were detected in TIGR-A004X28 and AA609512, five sequence
changes were found in SGC34603. Next, we determined the structure
of the SGC34603 gene by using cDNA sequencing primers on BAC 177N7
from the critical region.
[0133] Based on the genomic sequence information, PCR primer pairs
were designed (Table 7), the exons containing putative mutations
were amplified, and allele-specific assays were developed to screen
the PD20 family as well as 568 control chromosomes. Three of the
alleles were common polymorphisms; however, 2 changes were not
found in the controls and thus represented potential mutations
(Table 3). The first was a maternally inherited A->G change at
nt 376. In addition to changing an amino acid (S126G), this
alteration was associated with mis-splicing and insertion of 13 bp
from intron 5 into the mRNA. 43/43 (100%) independently cloned
RT-PCR products with the maternal mutation contained this
insertion, whereas only 3% ( 1/31) of control cDNA clones displayed
mis-spliced mRNA. The 13 bp insertion generated a frame-shift and
predicts a severely truncated protein only 180 aminoacids in
length. The second alteration was a paternally inherited missense
change at position 1236 (R1236H). The segregation of the mutations
in the PD20 core family is depicted in FIG. 10. Because the
SGC34603 gene of PD20 contained both a maternal and a paternal
allele not present on 568 control chromosomes and because the
maternal mutation was associated with mis-splicing in 100% of cDNAs
analyzed, we concluded that SGC34603 is the FANCD2 gene.
[0134] The protein encoded by FANCD2 is absent in PD20: To further
confirm the identity of SGC34603 as FANCD2, an antibody was raised
against the protein, and Western blot analysis was performed (FIG.
11). The specificity of the antibody was shown by retroviral
transduction and stable expression FANCD2 in PD20 cells (FIG. 11).
In wild-type cells this antibody detected two bands (155 and 162
kD) which we call FANCD2-S and -L (best seen in FIG. 11). FANCD2
protein levels were markedly diminished in all MMC-sensitive cell
lines from patient PD20 (FIG. 11a, lanes 2, 4) but present in all
wild-type cell lines and FA cells from other complementation
groups. Furthermore, PD20 cells corrected by microcell-mediated
transfer of chromosome 3 also made normal amounts of protein (FIG.
11a, lane 3).
[0135] Functional complementation of FA-D2 cells with the FANCD2
cDNA: We next assessed the ability of the cloned FANCD2 cDNA to
complement the MMC sensitivity of FA-D2 cells (FIG. 12). The full
length FANCD2 cDNA was subcloned into the retroviral expression
vector, pMMP-puro, as previously described (Pulsipher et al.
(1998), Mol. Med., Vol. 4, pp. 468-479). The transduced PD-20 cells
expressed both isoforms of the FANCD2 protein, FANCD2-S and
FANCD2-L (FIG. 12c). Transduction of PA-D2 (PD20) cells with
pMMP-FANCD2 corrected the MMC sensitivity of the cells. These
results further show that the cloned FANCD2 cDNA encodes the
FANCD2-S protein, which can be post-translationally-modified to the
FANCD2-L isoform. This important modification is discussed in
greater detail below.
[0136] Analysis of a phenotypically reverted PD20 clone: We next
generated additional evidence demonstrating that the sequence
variations in PD20 cells were not functionally neutral
polymorphisms. Towards this end we performed a molecular analysis
of a revertant lymphoblast clone (PD20-c1.1) from patient PD20
which was no longer sensitive to MMC. Phenotypic reversion and
somatic mosaicism are frequent findings in FA and have been
associated with intragenic events such as mitotic recombination or
compensatory frame-shifts. Indeed, -60% of maternally derived
SGC34603 cDNAs had a novel splice variant inserting 36 bp of intron
5 sequence rather than the usually observed 13 bp (FIG. 13). The
appearance of this in-frame splice variant correlated with a de
novo base change at position IVS5+6 from G to A (FIG. 13) and
restoration of the correct reading frame was confirmed by Western
blot analysis. In contrast to all MMC sensitive fibroblasts and
lymphoblasts from patient PD20, PD20-c1.1 produced readily
detectable amounts of FANCD2 protein of slightly higher molecular
weight than the normal protein.
[0137] Analysis of cell lines from other "FANCD" patients: The
antibody was also used to screen additional FA patient cell lines,
including the reference cell line for FA group D, HSC and 2 other
cell lines identified as group D by the European Fanconi Anemia
Registry (EUFAR). VU008 did not express the FANCD2 protein and was
found to be a compound heterozygote, with a missense and nonsense
mutation, both in exon 12, and not found on 370 control chromosomes
(Table 3, FIG. 11). The missense mutation appears to destabilize
the FANCD2 protein, as there is no detectable FANCD2 protein in
lysates from VU008 cells. A third patient PD733 also lacked FANCD2
protein (FIG. 11b, lane 3) and a splice mutation leading to absence
of exon 17 and an internal deletion of the protein was found. The
correlation of the mutations with the absence of FANCD2 protein in
cell lysates derived from these patients substantiates the identity
of FANCD2 as a FA gene. In contrast, readily detectable amounts of
both isoforms of the FANCD2 protein were found in HSC62 (FIG. 11a,
lane 8) and VU423 cDNA and genomic DNA from both cell lines were
extensively analyzed for mutations, and none were found. In
addition, a whole cell fusion between VU423 and PD20 fibroblasts
showed complementation of the chromosome breakage phenotype (Table
5). Taken together these data show that FA group D are genetically
heterogeneous and that the gene(s) defective in HSC62 and VU423 are
distinct from FANCD2.
[0138] The identification and sequencing of the FANCD2 gene and
protein provides a novel target for therapeutic development,
diagnostic tests and screening assays for diseases associated with
failure of DNA repair and cell cycle abnormalities including but
not limited to those listed in Table 2.
[0139] The following description provides novel and useful insights
into the biological role of FANCD2 in the FA pathway which provides
a basis for diagnosis and treatment of the aforementioned
syndromes.
[0140] Evidence that FA cells have an underlying molecular defect
in cell cycle regulation include the following: (a) FA cells
display a cell cycle delay with 4N DNA content which is enhanced by
treatment with chemical crosslinking agents, (b) the cell cycle
arrest and reduced proliferation of FA cells can be partially
corrected by overexpression of a protein, SPHAR, a member of the
cyclin family of proteins and (c) caffeine abrogates the G2 arrest
of FA cells. Consistent with these results, caffeine constitutively
activates cdc2 and may override a normal G2 cell cycle checkpoint
in FA cells. Finally, the FANCC protein binds to the cyclin
dependent kinase, cdc2. We propose that the FA complex may be a
substrate or modulator of the cyclinB/cdc2 complex.
[0141] Additionally, evidence that FA cells have an underlying
defect in DNA repair is suggested by (a) FA cells that are
sensitive to DNA cross-linking agents and ionizing radiation (IR),
suggesting a specific defect in the repair of cross-linked DNA or
double strand breaks; (b) DNA damage of FA cells which results in a
hyperactive p53 response, suggesting the presence of defective
repair yet intact checkpoint activities; and (c) FA cells with a
defect in the fidelity of non-homologous end joining and an
increased rate of homologous recombination (Garcia-Higuera et al.,
Mol. Cell., (2001) Vol. 7, pp. 249-262), (Grompe et al., Hum. Mol.
Genet., (2001) Vol. 10, pp. 1-7).
[0142] Despite these general abnormalities in cell cycle and DNA
repair, the mechanism by which FA pathway regulates these
activities has remained elusive. Here we show that the FANCD2
protein functions downstream of the FA protein complex. In the
presence of the assembled FA protein complex, the FANCD2 protein is
activated to a high molecular weight, monoubiquitinated isoform
which appears to modulate an S phase specific DNA repair response.
The activated FANCD2 protein accumulates in nuclear foci in
response to DNA damaging agents and co-localizes and
coimmunoprecipitates with a known DNA repair protein, BRCA1 These
results resolve previous conflicting models of the FA pathway
(D'Andrea et al., 1997) and demonstrate that the FA proteins
cooperate in a cellular response to DNA damage.
[0143] The FA pathway includes the formation of the FA multisubunit
nuclear complex which in addition to A/C/G, we have shown also
includes FANCF as a subunit of the complex (FIG. 8). The FA pathway
becomes "active" during the S phase to provide S phase specific
repair response or checkpoint response. The normal activation of
the FA pathway which relies on the FA multisubunit complex results
in the regulated monoubiquitination of the phosphoprotein-FANCD2
via a phosphorylation step to a high molecular weight activated
isoform identified as FANCD-2L (FIG. 1). Monoubiquitination is
associated with cell trafficking. FANCD2-L appears to modulate an S
phase specific DNA repair response (FIG. 3). The failure of FA
cells to activate the S phase specific activation of FANCD2 is
associated with cell cycle specific abnormalities. The activated
FANCD2 protein accumulates in nuclear foci in response to the DNA
damaging agents, MMC and IR, and co-localizes and
co-immunoprecipitates with a known DNA repair protein, BRCA1 (FIGS.
4-6). These results resolve previous conflicting models of FA
protein function (D'Andrea et al., 1997) and strongly support a
role of the FA pathway in DNA repair.
[0144] We have identified for the first time, an association
between FANCD2 isoforms with respect to the FA pathway and proteins
that are known diagnostic molecules for various cancers. A similar
pathway with respect to DNA damage for the BRCA1 protein which is
activated to a high molecular weight, post-translationally-modified
isoform in S phase or in response to DNA damage suggests that
activated FANCD2 protein interacts with BRCA1. More particularly,
the regulated monoubiquitination of FANCD2 appears to target the
FANCD2 protein to nuclear foci containing BRCA1. FANCD2
co-immunoprecipitates with BRCA1, and may further bind with other
"dot" proteins, such as RAD50, Mre11, NBS, or RAD51. Recent studies
demonstrate that BRCA1 foci are composed of a large (2 Megadalton)
multi-protein complex (Wang et al., Genes Dev., (2001) Vol. 14, pp.
927-939). This complex includes ATM, ATM substrates involved in DNA
repair functions (BRCA1), and ATM substrates involved in checkpoint
functions (NBS). It is further suggested that damage recognition
and activation of the FA pathway involve kinases which respond to
DNA damage including ATM, ATR, CHK1, or CHK2.
[0145] We have found that the DNA damaging reagents, IR and MMC,
activate independent post-translational modifications of FANCD2
result in distinct functional consequences. IR activates the
ATM-dependent phosphorylation of FANCD2 at Serine 222 resulting in
an S phase checkpoint response. MMC activates the BRACA-1 dependent
and FA pathway dependent monoubiquitination of FANCD2 at lysine
561, resulting in the assembly of FANCD2/BRCA1 nuclear foci and MMC
resistance. FANCD2 therefore has two independent functional roles
in the maintenance of chromosomal stability resulting from two
discrete post-translational modifications provide a link between
two additional cancer susceptibility genes (ATM and BRCA1) in a
common pathway. Several additional lines of evidence support an
interaction between FANCD2 and BRCA1. First, the BRCA1 (-/-) cell
line, HCC1937 (Scully et al., Mol. Cell, (1999) Vol. 4, pp.
1093-1099) has a "Fanconi Anemia-like" phenotype, with chromosome
instability and increased tri-radial and tetra-radial chromosome
formations. Second, although FA cells form BRCA1 foci (and RAD51
foci) normally in response to IR, BRCA1 (-/-) cells have no
detectable BRCA1 foci and a greatly decreased number of FANCD2 foci
compared to normal cells. Functional complementation of BRCA1 (-/-)
cells restored BRCA1 foci and FANCD2 foci to normal levels, and
restored normal MMC resistance.
[0146] The amount of FANCD2-L is determined in part by the amount
of FAND2-S that is synthesized from the fancd2 gene and in part by
the availability of the FA complex to monoubiquinated FANCD2-S to
form FANCD2-L. The association of FANCD2-L with nuclear foci
including BRCA and ATM and determining the role of FANCD2-L in DNA
repair make this protein a powerful target for looking at potential
cancer development in patients for a wide range of cancers. Such
cancers include those that arise through lesions on chromosome 3p
as well as cancers on other chromosomes such that mutations result
in interfering with production of upstream members of the FA
pathway such as FANCG, FANCC or FANCA. Cancer lines and primary
cells from cancer patients including tumor biopsies are being
screened for FANCD-L and abnormal levels of this protein is
expected to correlate with early diagnosis of disease. Because
FANCD2 protein is a final step in a pathway to DNA repair, it is
envisaged that any abnormality in a protein in the one or more
pathways that lead to the conversion of FANCD2-S to FANCD-L will be
readily detected by measuring levels of FANCD2. Moreover, levels of
FANCD2 affect how other proteins such as BRCA and ATM functionally
interact in the nucleus with consequences for the patient. Analysis
of levels of FANCD2 in a patient is expected to aid a physician in
a clinical decision with respect to understanding the class of
cancer presented by the patient. For instance, if a cancer cell
fails to generate the monoubiquinated FANCD2-L isoform, the cell
may have increased chromosome instability and perhaps increased
sensitivity to irradiation or chemotherapeutic agents. This
information will assist the physician in procedure improved
treatment for the patient.
[0147] Fanconi Anemia is associated not only with a broad spectrum
of different cancers but also with congenital abnormalities.
Development of the fetus is a complex but orderly process. Certain
proteins have a particularly broad spectrum of effects because they
disrupt this orderly progression of development. The FA pathway
plays a significant role in development and disruption of the FA
pathway results in a multitude of adverse effects. Errors in the FA
pathway are detectable through the analysis of the FAND2-L protein
from fetal cells. FANCD2 represents a diagnostic marker for normal
fetal development and a possible target for therapeutic
intervention.
[0148] Consistent with the above, we have shown that FANCD2 plays a
role in the production of viable sperm. FANCD2 forms foci on the
unpaired axes of chromosomes XY bivalents in late pachytene and in
diplotene murine spermatocytes (FIG. 7). Interestingly, FANCD2 foci
are also seen at the autosomal telomeres in diplonema. Taken
together with the known fertility defects in FA patients and FA-C
knockout mice, our observations suggest that activated FANCD2
protein is required for normal progression of spermatocytes through
meiosis I. Most of the FANCD2 foci seen on the XY axes were found
to co-localize with BRCA1 foci, suggesting that the two proteins
may function together in meiotic cells. Like BRCA1, FANCD2 was
detected on the axial (unsynapsed) elements of developing
synaptonemal complexes. Since recombination occurs in synapsed
regions, FANCD2 may function prior to the initiation of
recombination, perhaps to help prepare chromosomes for synapsis or
to regulate subsequent recombinational events. The relatively
synchronous manner in which FANCD2 assembles on meiotic
chromosomes, and forms dot structures in mitotic cells, suggests a
role of FANCD2 in both mitotic and meiotic cell cycle control.
[0149] Embodiments of the invention are directed to the use of the
post translationally modified isoform: FANCD-2L as a diagnostic
target for determining the integrity of the FA pathway.
Ubiquitination of FANCD2 and the formation of FANCD2 nuclear foci
are downstream events in the FA pathway, requiring the function of
several FA genes. We have found that biallelic mutations of any of
the upstream FA genes (FANCA, FANCB, FANCC, FANCE, FANCF and FANCG)
block the posttranslational modification of FANCD2 the
unubiquitinated FANCD2 (FANCD2-S) form to the ubiquitinated
(FANCD2-L). Any of these upstream defects can be overridden by
transfecting cells with FANCD2 cDNA (FIG. 1a).
[0150] We have demonstrated for the first time the existence of
FANCD2 and its role in the FA pathway. We have shown that FANCD2
accumulates in nuclear foci in response to DNA damaging agents
where it is associated with other DNA repair proteins such as BRCA1
and ATM. We have also demonstrated that FANCD2 exists in two
isoforms in cells where a reduction in one of the two isoforms,
FANCD2-L is correlated with Fanconi Anemia and with increased
cancer susceptibility. We have used these findings to propose a
number of diagnostic tests for use in the clinic that will assist
with patient care.
[0151] These tests include: (a) genetic and prenatal counseling for
parents concerned about inherited Fanconi Anemia in a future
offspring or in an existing pregnancy; (b) genetic counseling and
immunodiagnostic tests for adult humans to determine increased
susceptibility to a cancer correlated with a defective FA pathway;
and (c) diagnosing an already existing cancer in a subject to
provide an opportunity for developing treatment protocols that are
maximally effective for the subject while minimizing side
effects.
[0152] The diagnostic tests described herein rely on standard
protocols known in the art for which we have provided novel
reagents to test for FANCD2 proteins and nucleotide sequences.
These reagents include antibodies specific for FANCD2 isoforms,
nucleotide sequences from which vectors, probes and primers have
been derived for detecting genetic alterations in the FANCD2 gene
and cells lines and recombinant cells for preserving and testing
defects in the FA pathway.
[0153] We have prepared monoclonal and polyclonal antibody
preparations as described in Example 1 that are specific for
FANCD2-L and FANCD2-S proteins. In addition, FANCD2 isoform
specific antibody fragments and single chain antibodies may be
prepared using standard techniques. We have used these antibodies
in wet chemistry assays such as immunoprecipitation assays, for
example Western blots, to identify FANCD2 isoforms in biological
samples (FIG. 1). Conventional immunoassays including enzyme linked
immunosorbent assays (ELISA), radioimmune assays (RIA),
immunoradiometric assays (IRMA) and immunoenzymatic assays (IEMA)
and further including sandwich assays may also be used. Other
immunoassays may utilize a sample of whole cells or lysed cells
that are reacted with antibody in solution and optionally analyzed
in a liquid state within a reservoir. Isoforms of FANCD2 can be
identified in situ in intact cells including cell lines, tissue
biopsies and blood by immunological techniques using for example
fluorescent activated cell sorting, and laser or light microscopy
to detect immunofluorescent cells (FIGS. 1-7, 9-14). For example,
biopsies of tissues or cell monolayers, prepared on a slide in a
preserved state such as embedded in paraffin or as frozen tissue
sections can be exposed to antibody for detecting FANCD2-L and then
examined by fluorescent microscopy.
[0154] In an embodiment of the invention, patient-derived cell
lines or cancer cell lines are analyzed by immunoblotting and
immunofluorescence to provide a novel simple diagnostic test for
detecting altered amounts of FANCD2 isoforms. The diagnostic test
also provides a means to screen for upstream defects in the FA
pathway and a practical alternative to the currently employed
DEB/MMC chromosome breakage test for FA, because individuals with
upstream defects in the FA pathway are unable to ubiquitinate
FANCD2. Other assays may be used including assays that combine
retroviral gene transfer to form transformed patient derived cell
lines (Pulsipher et al., Mol. Med., (1998) Vol. 4, pp. 468-79)
together with FANCD2 immunoblotting to provide a rapid subtyping
analysis of newly diagnosed patients with any of the syndromes
described in Table 2, in particular, that of FA.
[0155] The above assays may be performed by diagnostic
laboratories, or, alternatively, diagnostic kits may be
manufactured and sold to health care providers or to private
individuals for self-diagnosis. The results of these tests and
interpretive information are useful for the healthcare provider in
diagnosis and treatment of a patient's condition.
[0156] Genetic tests can provide for a subject, a rapid reliable
risk analysis for a particular condition against an epidemiological
baseline. Our data suggests that genetic heterogeneity occurs in
patients with FA within the FANCD2 complementation group. We have
found a correlation between genetic heterogeneity and disease as
well as genetic heterogeneity and abnormal post-translational
modifications that result in the presence or absence of FANCD2-L.
This correlation provides the basis for prognostic tests as well as
diagnostic tests and treatments for any of the syndromes
characterized by abnormal DNA repair. For example, nucleic acid
from a cell sample obtained from drawn blood or from other cells
derived from a subject can be analyzed for mutations in the FANCD2
gene and the subject may be diagnosed to have an increased
susceptibility to cancer.
[0157] We have located the FANCD2 gene at 3p25.3 on chromosome 3p
in a region which correlates to a high frequency of cancer.
Cytogenetic and loss of heterozygosity (LOH) studies have
demonstrated that deletions of chromosome 3p occur at a high
frequency in all forms of lung cancer (Todd et al., Cancer Res.
Vol. 57, pp. 1344-52). For example, homozygous deletions were found
in three squamous cell lines within a region of 3p21. Homozygous
deletions were also found in a small cell tumor at 3p12 and a
3p14.2. (Franklin et al., Cancer Res. (1997), Vol. 57, pp.
1344-52). The present mapping of FANCD2 is supportive of the theory
that this chromosomal region contains important tumor suppressor
genes. Further support for this has been provided by a recent
publication of Sekine et al., Human Molecular Genetics, (2001) Vol.
10, pp. 1421-1429, who reported localization of a novel
susceptibility gene for familial ovarian cancer to chromosome
3p22-p25. The reduction or absence of FANCD2-L is here proposed to
be diagnostic for increased risk of tumors resulting from mutations
not only at the FANCD2 site (3p25.3) but also at other sites in the
chromosomes possibly arising from defects in DNA repair following
cell damage arising from exposure to environmental agents and
normal aging processes.
[0158] As more individuals and families are screened for genetic
defects in the FANCD2 gene, a data base will be developed in which
population frequencies for different mutations will be gathered and
correlations made between these mutations and health profile for
the individuals so that the predictive value of genetic analysis
will continually improve. An example of an allele specific pedigree
analysis for FANCD2 is provided in FIG. 10 for two families.
[0159] Diagnosis of a mutation in the FANCD2 gene may initially be
detected by a rapid immunological assay for detecting reduced
amounts of FANCD2-L proteins. Positive samples may then be screened
with available probes and primers for defects in any of the genes
in the PA pathway. Where a defect in the FANCD2 gene is implicated,
primers or probes such as provided in Table 7 may be used to detect
a mutation. In those samples, where a mutation is not detected by
such primers or probes, the entire FANCD2 gene may be sequenced to
determine the presence and location of the mutation in the
gene.
[0160] Nucleic acid screening assays for use in identifying a
genetic defect in the FANCD2 gene locus may include PCR and non PCR
based assays to detect mutations. There are many approaches to
analyzing cell genomes for the presence of mutations in a
particular allele. Alteration of a wild-type FANCD2 allele,
whether, for example, by point mutation, deletion or insertions can
be detected using standard methods employing probes (U.S. Pat. No.
6,033,857). Standard methods include: (a) fluorescent in situ
hybridization (FISH) which may be used on whole intact cells; and
(b) allele specific oligonucleotides (ASO) may be used to detect
mutations using hybridization techniques on isolated nucleic acid
(Conner et al., Hum. Genet., (1989) Vol. 85, pp. 55-74). Other
techniques include (a) observing shifts in electrophoretic mobility
of single-stranded DNA on non-denaturing polyacrylamide gels, (b)
hybridizing a FANCD2 gene probe to genomic DNA isolated from the
tissue sample, (c) hybridizing an allele-specific probe to genomic
DNA of the tissue sample, (d) amplifying all or part of the FANCD2
gene from the tissue sample to produce an amplified sequence and
sequencing the amplified sequence, (e) amplifying all or pant of
the FANCD2 gene from the tissue sample using primers for a specific
FANCD2 mutant allele, (f) molecular cloning all or part of the
FANCD2 gene from the tissue sample to produce a cloned sequence and
sequencing the cloned sequence, (g) identifying a mismatch between
(i) a FANCD2 gene or a FANCD2 mRNA isolated from the tissue sample,
and (ii) a nucleic acid probe complementary to the human wild-type
FANCD2 gene sequence, when molecules (i) and (ii) are hybridized to
each other to form a duplex, (h) amplification of FANCD2 gene
sequences in the tissue sample and hybridization of the amplified
sequences to nucleic acid probes which comprise wild-type FANCD2
gene sequences, (i) amplification of FANCD2 gene sequences in the
tissue sample and hybridization of the amplified sequences to
nucleic acid probes which comprise mutant FANCD2 gene sequences,
(j) screening for a deletion mutation in the tissue sample, (k)
screening for a point mutation in the tissue sample, (l) screening
for an insertion mutation in the tissue sample, and (m) in situ
hybridization of the FANCD2 gene of the tissue sample with nucleic
acid probes which comprise the FANCD2 gene.
[0161] It is often desirable to scan a relatively short region of a
gene or genome for point mutations: The large numbers of
oligonucleotides needed to examine all potential sites in the
sequence can be made by efficient combinatorial methods (Southern,
E. M et al., Nucleic Acids Res., (1994) Vol. 22, pp. 1368-1373).
Arrays may be used in conjunction with ligase or polymerase to look
for mutations at all sites in the target sequence (U.S. Pat. No.
6,307,039). Analysis of mutations by hybridization can be performed
for example by means of gels, arrays or dot blots.
[0162] The entire gene may be sequenced to identify mutations (U.S.
Pat. No. 6,033,857). Sequencing of the FANCD2 locus can be achieved
using oligonucleotide tags from a minimally cross hybridizing set
which become attached to their complements on solid phase supports
when attached to target sequence (U.S. Pat. No. 6,280,935).
[0163] Other approaches to detecting mutations in the FANCD2 gene
include those described in U.S. Pat. No. 6,297,010, U.S. Pat. No.
6,287,772 and U.S. Pat. No. 6,300,076. It is further contemplated
that the assays may employ nucleic acid microchip technology or
analysis of multiple samples using laboratories on chips.
Correlation of these mutations with the results of genetic studies
on breast, ovarian or prostate cancer patients can then be used to
determine if an identified defect within the FANC D2 gene is a
cancer-associated defect according to the invention.
[0164] A subject who has developed a tumor maybe screened using
nucleic acid diagnostic tests or antibody based tests to detect a
FANCD2 gene mutation or a deficiency in FANCD2-L protein. On the
basis of such screening samples may be obtained from subjects
having a wide range of cancers including melanoma, leukemia,
astocytoma, glioblastoma, lymphoma, glioma, Hodgkins lymphoma,
chronic lymphocyte leukemia and cancer of the pancreas, breast,
thyroid, ovary, uterus, testis, pituitary, kidney, stomach,
esophagus and rectum. The clinician has an improved ability to
select a suitable treatment protocol for maximizing the treatment
benefit for the patient. In particular, the presence of a genetic
lesion or a deficiency in FANCD2-L protein may be correlated with
responsiveness to various existing chemotherapeutic drugs and
radiation therapies.
[0165] New therapeutic treatments may be developed by screening for
molecules that modulate the monoubiquitination of FANCD2-S to give
rise to FANCD2-L in cell assays (Examples 11-12) and in knock-out
mouse models (Example 10). Such molecules may include those that
bind directly to FANCD2 or to molecules such as BRACA-2 that
appears to interact with BRACA-1 which in turn appears to be
activated by FANCD2.
[0166] In addition to screening assays that rely on defects in the
FANCD2 gene or protein, an observed failure of the ubiquitination
reaction that is necessary for the formation of FANCD2-L may result
from a defect in the FA pathway at any point preceding the post
translational modification of FANCD2 including FANCD2-S itself.
Knowing the terminal step in the reactions, enables a screening
assay to be formulated in which small molecules are screened in
cells containing "broken FA pathway" or in vitro until a molecule
is found to repair the broken pathway. This molecule can then be
utilized as a probe to identify the nature of the defect. It may
further be used as a therapeutic agent to repair the defect. For
example, we have shown that cell cycle arrest and reduced
proliferation of FA cells can be partially corrected by
overexpression of a protein, SPHAR, a member of the cyclin family
of proteins. This can form the basis of an assay which is suitable
as a screen for identifying therapeutic small molecules.
[0167] Cells which are deficient in the posttranslational modified
FANCD2 are particularly sensitive to DNA damage. These cells may
serve as a sensitive screen for determining whether a compound
(including toxic molecules) has the capability for damaging DNA.
Conversely, these cells also serve as a sensitive screen for
determining whether a compound can protect cells against DNA
damage.
[0168] FA patients and patients suffering from syndromes associated
with DNA repair defects die from complications of bone marrow
failure. Gene transfer is a therapeutic option to correct the
defect. Multiple defects may occur throughout the FA pathway. We
have shown that the terminal step is critical to proper functioning
of the cell and the organism. In an embodiment of the invention,
correction of defects anywhere in the FA pathway may be
satisfactorily achieved by gene therapy or by therapeutic agents
that target the transformation of FANCD2-S to FANCD2-L so that this
transformation is successfully achieved.
[0169] Gene therapy may be carried out according to generally
accepted methods, for example, as described by Friedman in "Therapy
for Genetic Disease," T. Friedman, ed., Oxford University Press
(1991), pp. 105-121. Targeted tissues for ex vivo or in vivo gene
therapy include bone marrow for example, hematopoietic stem cells
prior to onset of anemia and fetal tissues involved in
developmental abnormalities. Gene therapy can provide wild-type
FAND2-L function to cells which carry mutant FANCD2 alleles.
Supplying such a function should suppress neoplastic growth of the
recipient cells or ameliorate the symptoms of Fanconi Anemia.
[0170] The wild-type FANCD-2 gene or a part of the gene may be
introduced into the cell in a vector such that the gene remains
extrachromosomal. In such a situation, the gene may be expressed by
the cell from the extrachromosomal location. If a gene portion is
introduced and expressed in a cell carrying a mutant FANCD-2
allele, the gene portion may encode a part of the FANCD-2 protein
which is required for non-neoplastic growth of the cell.
Alternatively, the wild-type FANCD-2 gene or a part thereof may be
introduced into the mutant cell in such a way that it recombines
with the endogenous mutant FANCD-2 gene present in the cell.
[0171] Viral vectors are one class of vectors for achieving gene
therapy. Viral-mediated gene transfer can be combined with direct
in vivo gene transfer using liposome delivery, allowing one to
direct the viral vectors to the tumor cells and not into the
surrounding nondividing cells. Alternatively, a viral vector
producer cell line can be injected into tumors (Culver et al.,
1992). Injection of producer cells would then provide a continuous
source of vector particles. This technique has been approved for
use in humans with inoperable brain tumors.
[0172] The vector may be injected into the patient, either locally
at the site of the tumor or systemically (in order to reach any
tumor cells that may have metastasized to other sites). If the
transfected gene is not permanently incorporated into the genome of
each of the targeted tumor cells, the treatment may have to be
repeated periodically.
[0173] Vectors for introduction of genes both for recombination and
for extrachromosomal maintenance are known in the art (for example
as disclosed in U.S. Pat. No. 5,252,479 and PCT 93/07282, and U.S.
Pat. No. 6,303,379) and include viral vectors such as retroviruses,
herpes viruses (U.S. Pat. No. 6,287,557) or adenoviruses (U.S. Pat.
No. 6,281,010) or a plasmid vector containing the FANCD2-L.
[0174] A vector carrying the therapeutic gene sequence or the DNA
encoding the gene or piece of the gene may be injected into the
patient either locally at the site of a tumor or systemically so as
to reach metastasized tumor cells. Targeting may be achieved
without further manipulation of the vector or the vector may be
coupled to a molecule having a specificity of binding for a tumor
where such molecule may be a receptor agonist or antagonist and may
further include a peptide, lipid (including liposomes) or
saccharide including an oligopolysaccharide or polysaccharide) as
well as synthetic targeting molecules. The DNA may be conjugated
via polylysine to a binding ligand. If the transfected gene is not
permanently incorporated into the genome of each of the targeted
tumor cells, the treatment may have to be repeated
periodically.
[0175] Methods for introducing DNA into cells prior to introduction
into the patient may be accomplished using techniques such as
electroporation, calcium phosphate coprecipitation and viral
transduction as described in the art (U.S. Pat. No. 6,033,857), and
the choice of method is within the competence of the routine
experimenter.
[0176] Cells transformed with the wild-type FANCD2 gene or mutant
FANCD2 gene can be used as model systems to study remission of
diseases resulting from defective DNA repair and drug treatments
which promote such remission.
[0177] As generally discussed above, the FANCD2 gene or fragment,
where applicable, may be employed in gene therapy methods in order
to increase the amount of the expression products of such genes in
abnormal cells. Such gene therapy is particularly appropriate for
use in pre-cancerous cells, where the level of FANCD2-L polypeptide
may be absent or diminished compared to normal cells and where
enhancing the levels of FANCD2-L may slow the accumulation of
defects arising from defective DNA repair and hence postpone
initiation of a cancer state. It may also be useful to increase the
level of expression of the FANCD2 gene even in those cells in which
the mutant gene is expressed at a "normal" level, but there is a
reduced level of the FANCD2-L isoform. The critical role of
FANCD2-L in normal DNA repair provides an opportunity for
developing therapeutic agents to correct a defect that causes a
reduction in levels of FANCD2-L. One approach to developing novel
therapeutic agents is through rational drug design. Rational drug
design can provide structural analogs of biologically active
polypeptides of interest or of small molecules with which they
interact (e.g., agonists, antagonists, inhibitors or enhancers) in
order to fashion more active or stable forms of the polypeptide, or
to design small molecules which enhance or interfere with the
function of a polypeptide in vivo (Hodgson, 1991). Rational drug
design may provide small molecules or modified polypeptides which
have improved FANCD2-L activity or stability or which act as
enhancers, inhibitors, agonists or antagonists of FANCD2-L
activity. By virtue of the availability of cloned FANCD2 sequences,
sufficient amounts of the FANCD2-L polypeptide may be made
available to perform such analytical studies as x-ray
crystallography. In addition, the knowledge of the FANCD2-L protein
sequence provided herein will guide those employing computer
modeling techniques in place of, or in addition to x-ray
crystallography.
[0178] Peptides or other molecules which have FANCD2-L activity can
be supplied to cells which are deficient in the protein in a
therapeutic formulation. The sequence of the FANCD2-L protein is
disclosed for several organisms (human, fly and plant) (SEQ ID
NO:1-3). FANCD2 could be produced by expression of the cDNA
sequence in bacteria, for example, using known expression vectors
with additional posttranslational modifications. Alternatively,
FANCD2-L polypeptide can be extracted from FANCD2-L-producing
mammalian cells. In addition, the techniques of synthetic chemistry
can be employed to synthesize FANCD2-L protein. Other molecules
with FANCD2-L activity (for example, peptides, drugs or organic
compounds) may also be used as a therapeutic agent. Modified
polypeptides having substantially similar function are also used
for peptide therapy.
[0179] Similarly, cells and animals which carry a mutant FANCD2
allele or make insufficient levels of FANCD2-L can be used as model
systems to study and test for substances which have potential as
therapeutic agents. The cells which may be either somatic or
germline can be isolated from individuals with reduced levels of
FANCD2-L. Alternatively, the cell line can be engineered to have a
reduced levels of FANCD2-L, as described above. After a test
substance is applied to the cells, the DNA repair impaired
transformed phenotype of the cell is determined.
[0180] The efficacy of novel candidate therapeutic molecules can be
tested in experimental animals for efficacy and lack of toxicity.
Using standard techniques, animals can be selected after
mutagenesis of whole animals or after genetic engineering of
germline cells or zygotes to form transgenic animals. Such
treatments include insertion of mutant FANCD2 alleles, usually from
a second animal species, as well as insertion of disrupted
homologous genes. Alternatively, the endogenous FANCD2 gene of the
animals may be disrupted by insertion or deletion mutation or other
genetic alterations using conventional techniques (Capecchi,
Science, (1989) Vol. 244, pp. 1288-1292) (Valancius and Smithies,
1991). After test substances have been administered to the animals,
the growth of tumors must be assessed. If the test substance
prevents or suppresses pathologies arising from defective DNA
repair, then the test substance is a candidate therapeutic agent
for the treatment of the diseases identified herein.
[0181] The subject invention provides for Fanconi Anemia/BRCA-based
diagnostic assays to determine if a patient has cancer or is at an
increased risk of cancer. The invention also features screening
methods for the discovery of novel cancer therapeutics that are
inhibitors of the Fanconi Anemia/BRCA pathway. Finally, the
invention provides methods for the chemosensitization of tumor
cells that have become resistant to one or more chemotherapy
compounds as well as assays to determine the efficacy of
chemotherapy drugs.
[0182] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
cell biology, microbiology and recombinant DNA techniques, which
are within the skill of the art. Such techniques are explained
fully in the literature. See, e.g., Sambrook, Fritsch &
Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second
Edition; Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Nucleic
Acid Hybridization (B. D. Harnes & S. J. Higgins, eds., 1984);
A Practical Guide to Molecular Cloning (B. Perbal, 1984); (Harlow,
E. and Lane, D.) Using Antibodies: A Laboratory Manual (1999) Cold
Spring Harbor Laboratory Press; and a series, Methods in Enzymology
(Academic Press, Inc.); Short Protocols In Molecular Biology,
(Ausubel et al., ed., 1995). All patents, patent applications, and
publications mentioned herein, both supra and infra, are hereby
incorporated by reference in their entirety.
Tissue Biopsies
[0183] The invention provides for the preparation of cellular
extracts from tissue biopsies of patients including, but not
limited to brain, heart, lung, lymph nodes, eyes, joints, skin and
neoplasms associated with these organs. "Tissue biopsy" also
encompasses the collection of biological fluids including but not
limited to blood, plasma, sputum, urine, cerebrospinal fluid,
lavages, and leukophoresis samples. In a preferred embodiment,
"tissue biopsies" according to the invention are taken from tumors
of the breast, ovary or prostate. "Tissue biopsies" are obtained
using techniques well known in the art including needle aspiration
and punch biopsy of the skin.
Cisplatin
[0184] Cisplatin has been widely used to treat cancers such as
metastatic testicular or ovarian carcinoma, advanced bladder
cancer, head or neck cancer, cervical cancer, lung cancer or other
tumors. Cisplatin can be used alone or in combination with other
agents, with efficacious doses used in clinical applications of
15-20 mg/m2 for 5 days every three weeks for a total of three
courses. Exemplary doses may be 0.50 mg/m2, 1.0 mg/m2, 1.50 mg/m2,
1.75 mg/m2, 2.0 mg/m2, 3.0 mg/m2, 4.0 mg/m2, 5.0 mg/m2, 10 mg/m2.
Of course, all of these dosages are exemplary, and any dosage
in-between these points is also expected to be of use in the
invention. Cisplatin is not absorbed orally and must therefore be
delivered via injection intravenously, subcutaneously,
intratumorally or intraperitoneally. Procedures for proper handling
and disposal of anticancer drugs should be considered. Several
guidelines on this subject have been published and are known by
those in the art.
[0185] For example, PLATINOL-AQ, (cisplatin injection) NDC
0015-3220-22 (Bristol Myers Squibb) is supplied as a sterile,
multidose vial without preservatives. Each multidose vial contains
50 mg of cisplatin NDC 0015-3221-22 and should be stored at
15.degree. C.-25.degree. C. and protected from light. The cisplatin
remaining in the amber vial following initial entry is stable for
28 days protected from light or for 7 days under fluorescent room
light.
[0186] The prescribing information for PLATINOL-AQ, (cisplatin
injection) NDC 0015-3220-22 is available from Bristol Myers Squibb.
The plasma concentrations of cisplatin decay monoexponentially with
a half-life of about 20 to 30 minutes following bolus
administrations of 50 or 100 mg/m2 doses. Monoexponential decay and
plasma half-lives of about 0.5 hour are also seen following two
hour or seven hour infusions of 100 mg/m2. After the latter, the
total-body clearances and volumes of distribution at steady-state
for cisplatin are about 15 to 16 L/h/m2 and 11 to 12 L/m2.
Dosage and Administration of Cisplatin
[0187] The dosage and administration of cisplatin for the treatment
of cancer is known in the art. The prescribing information of
PLATINOL-AQ (Bristol Myers Squibb) recommends the following
guidelines for dosage and administration: "Needles or intravenous
sets containing aluminum parts that may come in contact with
PLATINOL-AQ should not de used for preparation or administration.
Aluminum reacts with PLATINOL-AQ, causing precipitate formation and
a loss of potency".
[0188] Metastatic Testicular Tumors: The usual PLATINOL-AQ dose for
the treatment of testicular cancer in combination with other
approved chemotherapeutic agents is 20 mg/m2 I.V. daily for 5 days
per cycle.
[0189] Metastatic Ovarian Tumors: The usual PLATINOL-AQ dose for
the treat-ment of metastatic ovarian tumors in combination with
CYTOXAN (cy-clophosphamide) is 75-100 mg/m2 I.V. per cycle once
every 4 weeks, (Day 1). The dose of CYTOXAN when used in
combination with PLATINOL-AQ is 600 mg/m2 I.V. once every 4 weeks,
(Day 1). For directions for the administration of CYTOXAN, refer to
the CYTOXAN package insert. In combination therapy, PLATINOL-AQ and
CYTOXAN are administered sequentially. As a single agent,
PLATINOL-AQ should be administered at a dose of 100 mg/m2 I.V. per
cycle once every 4 weeks.
[0190] Advanced Bladder Cancer: PLATINOL-AQ (cisplatin injection)
should be administered as a single agent at a dose of 50-70 mg/m2
I.V. per cycle once every 3 to 4 weeks depending on the extent of
prior exposure to radiation therapy and/or prior chemotherapy. For
heavily pretreated patients an initial dose of 50 mg/m2 per cycle
repeated every four weeks is recommended. Pretreatment hydration
with 1 to 2 liters of fluid infused for 8 to 12 hours prior to a
PLATINOL-AQ dose is recommended. The drug is then diluted in 2
liters of 5% Dextrose in 1/2 or 1/3 normal saline containing 37.5 g
of mannitol, and infused over a 6- to 8-hour period. If diluted
solution is not to be used within 6 hours, protect solution from
light. Do not dilute PLATINOL-AQ in just 5% Dextrose Injection.
Adequate hydration and urinary output must be maintained during the
following 24 hours. A repeat course of PLATINOL-AQ should not be
given until the serum creatinine is below 1.5 mg/100 mL, and/or the
BUN is below 25 mg/100 mL. A repeat course should not be given
until circulating blood elements are at an acceptable level
(platelets >100,000/mm2, WBC >4,000/mm2). Subsequent doses of
PLATINOL-AQ should not be given until an audiometric analysis
indicates that auditory acuity is within normal limits. As with
other potentially toxic compounds, caution should be exercised in
handling the aqueous solution. Skin reactions associated with
accidental exposure to cisplatin may occur. The use of gloves is
recommended. The aqueous solution should be used intravenously only
and should be administered by I.V. infusion over a 6- to 8-hour
period.
Dosage and Administration of a Chemosensitizing Agent
[0191] Methods of cancer chemosensitization are reported in U.S.
Pat. No. 5,776,925, which is incorporated herein in its entirety.
Cancer treatment according to the present invention envisions the
use of one or more anti-neoplastic agents in conjunction with
compounds that are not necessarily cytotoxic in themselves, but
modify the host or tumor so as to enhance anticancer therapy. Such
agents are called chemosensitizers.
[0192] Treatment with a chemosensitizing agent is therapeutically
effective in a cancer patient, according to the invention, if tumor
size is decreased by 10%, preferably 25%, preferably 50%, more
preferably 75%, most preferably 100% in the presence of an
antineoplastic agent and corresponding chemosensitizing agent as
compared to tumor size after treatment with the anti-neoplastic
agent but in the absence of the corresponding chemosenziting
agent.
[0193] The present invention provides for pharmaceutical
compositions comprising a therapeutically effective amount of a
chemosensitizing agent, as disclosed herein, in combination with a
pharmaceutically acceptable carrier or excipient. The
chemosensitizers in accordance with the invention, may be
administered to a patient locally or in any systemic fashion,
whether intravenous, subcutaneous, intramuscular, parenteral,
intraperitoneal or oral. Preferably, administration will be
systemic in conjunction with or before the administration of one or
more anti-neoplastic agents. In a preferred embodiment, the
anti-neoplastic agent is cisplatin that is administered according
to protocols well known in the art and as described herein.
[0194] For oral administration, the chemosensitizing agents useful
in the invention will generally be provided in the form of tablets
or capsules, as a powder or granules, or as an aqueous solution or
suspension. Tablets for oral use may include the active ingredients
mixed with pharmaceutically acceptable excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavouring agents, colouring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract.
[0195] Capsules for oral use include hard gelatin capsules in which
the active ingredient is mixed with a solid diluent, and soft
gelatin capsules wherein the active ingredients is mixed with water
or an oil such as peanut oil, liquid paraffin or olive oil.
[0196] For subcutaneous and intravenous use, the chemosensitizing
agents of the invention will generally be provided in sterile
aqueous solutions or suspensions, buffered to an appropriate pH and
isotonicity. Suitable aqueous vehicles include Ringer's solution
and isotonic sodium chloride. Aqueous suspensions according to the
invention may include suspending agents such as cellulose
derivatives, sodium alginate, polyvinyl-pyrrolidone and gum
tragacanth, and a wetting agent such as lecithin. Suitable
preservatives for aqueous suspensions include ethyl and n-propyl
p-hydroxybenzoate.
[0197] The chemosensitizing agents useful according to the
invention may also be presented as liposome formulations.
[0198] In general a suitable dose will be in the range of 0.01 to
100 mg per kilogram body weight of the recipient per day,
preferably in the range of 0.2 to 10 mg per kilogram body weight
per day. The desired dose is preferably presented once daily, but
may be dosed as two, three, four, five, six or more sub-doses
administered at appropriate intervals throughout the day. These
sub-doses may be administered in unit dosage forms, for example,
containing 10 to 1500 mg, preferably 20 to 1000 mg, and most
preferably 50 to 700 mg of active ingredient per unit dosage form.
Dosages of chemosensitizing agents useful according to the
invention will vary depending upon the condition to be treated or
prevented and on the identity of the chemosensitizing agent being
used. Estimates of effective dosages and in vivo half-lives for the
individual compounds encompassed by the invention can be made on
the basis of in vivo testing using an animal model, such as the
mouse model described herein or an adaptation of such method to
larger mammals.
[0199] In addition to their administration singly, the compounds
useful according to the invention can be administered in
combination with other known chemosensitizing agents and
anti-neoplastic agents, as described herein. In any event, the
administering physician can adjust the amount and timing of drug
administration on the basis of results observed using standard
measures of cancer activity known in the art.
Anti-Neoplastic Agents
[0200] Nonlimiting examples of anti-neoplastic agents include,
e.g., antimicrotubule agents, topoisomerase inhibitors,
antimetabolites, mitotic inhibitors, alkylating agents,
intercalating agents, agents capable of interfering with a signal
transduction pathway, agents that promote apoptosis, radiation, and
antibodies against other tumor-associated antigens (including naked
antibodies, immunotoxins and radioconjugates). Examples of the
particular classes of anti-cancer agents are provided in detail as
follows: antitubulin/antimicrotubule, e.g., paclitaxel,
vincristine, vinblastine, vindesine, vinorelbin, taxotere;
topoisomerase I inhibitors, e.g., topotecan, camptothecin,
doxorubicin, etoposide, mitoxantrone, daunorubicin, idarubicin,
teniposide, amsacrine, epirubicin, merbarone, piroxantrone
hydrochloride; antimetabolites, e.g., 5-fluorouracil (5-FU),
methotrexate, 6-mercaptopurine, 6-thioguanine, fludarabine
phosphate, cytarabine/Ara-C, trimetrexate, gemcitabine, acivicin,
alanosine, pyrazofurin, N-Phosphoracetyl-L-Asparate, i.e., PALA,
pentostatin, 5-azacitidine, 5-Aza 2'-deoxycytidine, ara-A,
cladribine, 5-fluorouridine, FUDR, tiazofurin,
N-[5-[N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-ylmethyl)-N-methylamino]--
2-thenoyl]-L-glutamic acid; alkylating agents, e.g., cisplatin,
carboplatin, mitomycin C, BCNU, i.e., Carmustine, melphalan,
thiotepa, busulfan, chlorambucil, plicamycin, dacarbazine,
ifosfamide phosphate, cyclophosphamide, nitrogen mustard, uracil
mustard, pipobroman, 4-ipomeanol; agents acting via other
mechanisms of action, e.g., dihydrolenperone, spiromustine, and
desipeptide; biological response modifiers, e.g., to enhance
anti-tumor responses, such as interferon; apoptotic agents, such as
actinomycin D; and anti-hormones, for example anti-estrogens such
as tamoxifen or, for example antiandrogens such as
4'-cyano-3-(4-fluorophenylsulphonyl)-2-hydroxy-2-methyl-3'-(trifluorometh-
yl)propionanilide.
[0201] An anti-neoplastic agent is therapeutic in a cancer patient,
according to the invention, if tumor size is decreased by 10%,
preferably 25%, preferably 50%, more preferably 75%, most
preferably 100% when compared to tumor size prior to the initiation
of treatment with an anti-neoplastic agent.
[0202] In a further embodiment, an anti-neoplastic agent, according
to the invention, is therapeutically effective if the cancer
patient remains cancer free, i.e., without any detectable tumors,
for preferably 6 months, preferably 1 year, more preferably 2 years
and most preferably 5 years or more after initiation of cancer
therapy.
Inhibitors of the Fanconi Anemia/BRCA Pathway According to the
Invention
[0203] Potential inhibitors of the Fanconi Anemia/BRCA pathway
include, but are not limited to, biomolecules that disrupt the
expression or function of Fanconi Anemia/BRCA pathway genes or
proteins as defined herein. Potential inhibitors of the Fanconi
Anemia/BRCA pathway include, but are not limited, to Fanconi
Anemia/BRCA pathway gene antisense nucleic acids (antisense Fanconi
Anemia/BRCA pathway gene RNAs, oligonucleotides, modified
oligonucleotides, RNAi), dominant negative mutants of the Fanconi
Anemia/BRCA pathway gene pathway as well as inhibitors of Fanconi
Anemia/BRCA pathway gene transcription, mRNA processing, mRNA
transport, protein translation, protein modification, protein
transport, nuclear transport and Fanconi Anemia/BRCA protein
complex formation.
[0204] In a most preferred embodiment, the present invention
provides for small molecule inhibitors of the FANC-D2 ubiquitin E3
ligase.
[0205] Microarrays According to the Invention
[0206] To identify cancer therapeutics or chemosensitizing agents,
the invention provides for the use of microarrays.
[0207] In one embodiment, the microarray of the invention is used
to identify chemosensitizing agents.
[0208] In another embodiment, the microarray of the invention is
used to test tissue biopsy samples for the presence of
cancer-associated defects within the Fanconi Anemia/BRCA pathway
genes.
[0209] In another embodiment, the microarrays of the invention are
used to screen for inhibitors of the Fanconi Anemia/BRCA gene
pathway.
[0210] In another embodiment, the microarrays of the invention are
to be used to screen for inhibitors of the FANC-D2 ubiquitin E3
ligase.
[0211] In another embodiment, the invention provides for tissue
microarrays comprising tissue biopsy samples from patients who have
a cancer or who may be at risk of cancer that are screening for the
presence of cancer associated defects within Fanconi Anemia/BRCA
gene pathway as defined herein. In a preferred embodiment, the
tissue microarrays of the present invention are used to screen for
the presence of mon-ubiqutinated FANC D2-L.
[0212] In another embodiment, the invention provides for tissue
microarrays comprising tissue biopsy samples from patients having
BRCA-1 and BRCA-2/FANC D-1 cancer-associated defects.
[0213] In another embodiment, the invention provides for tissue
microarrays comprising tissue biopsy samples from patients that do
not have BRCA-1 and BRCA-2/FANC D-1 cancer-associated defects.
[0214] A "sequencing array" contains regions of the entire open
reading frame of the genes in question, in order to look for
mutations in the clincial sample. A "transcriptional profiling
array" can have sequences from the 3' end of the genes in
questions, in order to determine the expression of mRNAs in the
clinical sample.
[0215] A transcriptional profiling array will be used to look at
mRNA levels corresponding to each of the genes in the pathway. For
instance, a breast or ovarian cancer which has a decrease in one of
the transcripts, e.g., corresponding to FANC F would show that
there is a defect in the Fanconi Anemia/BRCA pathway, due to
decreased FANCF expression.
Construction of a Microarray
Substrate of the Microarray
[0216] In one embodiment of the invention, the microarray or array
comprises a substrate to facilitate handling of the microarray
through a variety of molecular procedures. As used herein,
"molecular procedure" refers to contact of the microarray with a
test reagent or molecular probe such as an antibody, nucleic acid
probe, enzyme, chromagen, label, and the like. In one embodiment, a
molecular procedure comprises a plurality of hybridizations,
incubations, fixation steps, changes of temperature (from
-4.degree. C. to 100.degree. C.), exposures to solvents, and/or
wash steps.
[0217] In a further embodiment of the invention, the microarray
comprises a substrate to facilitate exposure of tissue biopsy
samples to different potential inhibitors of the Fanconi
Anemia/BRCA pathway, cancer therapeutics or chemosensitizing
agents.
[0218] In one embodiment of the invention, the microarray substrate
is solvent resistant. In another embodiment of the invention, the
substrate is transparent. The substrate may be biological,
non-biological, organic, inorganic, or a combination of any of
these, existing as particles, strands, precipitates, gels, sheets,
tubing, spheres, beads, containers, capillaries, pads, slices,
films, plates, slides, chips, etc. The substrate is preferably flat
or planar but may take on a variety of alternative surface
configurations. The substrate may be a polymerized Langmuir
Blodgett film, functionalized glass, Si, Ge, GaAs, GaP, SiO2, SIN4,
modified silicon, or other nonporous substrate, plastic, such as
polyolefin, polyamide, polyacarylamide, polyester, polyacrylic
ester, polycarbonate, polytetrafluoroethylene, polyvinyl acetate,
and a plastic composition containing fillers (such as glass
fillers), extenders, stabilizers, and/or antioxidants; celluloid,
cellophane or urea formaldehyde resins or other synthetic resins
such as cellulose acetate ethylcellulose, or other transparent
polymer. Other substrate materials will be readily apparent to
those of skill in the art upon review of this disclosure.
[0219] In one embodiment, the microarray substrate is rigid;
however, in another embodiment, the profile array substrate is
semi-rigid or flexible (e.g., a flexible plastic comprising
polycarbonate, cellular acetate, polyvinyl chloride, and the like).
In a further embodiment, the array substrate is optically opaque
and substantially non-fluorescent. Nylon or nitrocellulose
membranes can also be used as array substrates and include
materials such as polycarbonate, polyvinylidene fluoride (PVDF),
polysulfone, mixed esters of cellulose and nitrocellulose, and the
like.
[0220] The size and shape of the substrate may generally be varied.
The substrate may have any convenient shape, such as a disc,
square, sphere, circle, etc. However, preferably, the substrate
fits entirely on the stage of a microscope. In one embodiment, the
profile array substrate is planar. In one embodiment of the
invention, the microarray substrate is 1 inch by 3 inches,
77.times.50 mm, or 22.times.50 mm. In another embodiment of the
invention, the microarray substrate is at least 10-200
mm.times.10-200 mm.
Additional Features of the Substrate
[0221] In one embodiment of the invention, the substrate comprises
a location for placing an identifier (e.g., a wax pencil or crayon
mark, an etched mark, a label, a bar code, a microchip for
transmitting radio or electronic signals, and the like). In one
embodiment, the location comprises frosted glass. In one
embodiment, the microchip communicates with a processor which
comprises or can access stored information relating to the identity
and address of sublocations on the array, and/or including
information regarding the individual from whom the tissue was
taken, e.g., prognosis, diagnosis, medical history, family medical
history, drug treatment, age of death and cause of death, and the
like.
Sublocations
[0222] The microarray comprises a plurality of sublocations. Each
sublocation comprises a tissue stably associated therewith (e.g.,
able to retain its position relative to another sublocation after
exposure to at least one molecular procedure). In one embodiment,
the tissue is a tissue which has morphological features
substantially intact which can be at least viewed under a
microscope to distinguish subcellular features (e.g., such as a
nucleus, an intact cell membrane, organells, and/or other
cytological features), i.e., the tissue is not lysed.
[0223] In one embodiment of the invention, the microarray comprises
from 2-1000 sublocations. In another embodiment, the microarray
comprises 2, 5, 10, 20, 25, 30, 45, 50, 55, 60, 65, 75, 100, 150,
200, 250, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000
or more sublocations. In one embodiment of the invention, each
sublocation is from 2-10 mm apart. In another embodiment of the
invention, each sublocation comprises at least one dimension which
is 20-600 mm. The sublocations can be organized in any pattern, and
each sublocation can be generally any shape (square, circular,
oval, elliptical, disc shaped, rectangular, triangular, and the
like).
[0224] In a preferred embodiment, the sublocations are positioned
in a regular repeating pattern (e.g., rows and columns) such that
the identification of each sublocation as to tissue type can be
ascertained by the use of an array locator. In one embodiment, the
array locator is a template having a plurality of shapes, each
shape corresponding to the shape of each sublocation in the array,
and maintaining the same relationships as each sublocation on the
array. The array locator is marked by coordinates, allowing the
user to readily identify a sublocation on the array by virtue of
unique coordinates. In one embodiment of the invention, the array
locator is a transparent sheet (e.g., plastic, acetate, and the
like). In another embodiment of the invention, the array locator is
a sheet comprising a plurality of holes, each hole corresponding in
shape and location to each sublocation on the array.
[0225] In one aspect, the invention provides for arrays wherein the
compounds comprising the array are spotted onto a solid support,
e.g., spotted using a robotic GMS 417 arrayer (Affymetrix, Calif.).
Alternatively, spotting may be carried out using contact printing
technology or other methods known in the art.
Types of Microarrays According to the Invention
Small Molecule Arrays
[0226] In the small molecule microarrays or arrays of the
invention, the small molecules are stably associated with the
surface of a solid support, wherein the support may be a flexible
or rigid solid support. By "stably associated" is meant that each
small molecule maintains a unique position relative to the solid
support under binding and washing conditions. As such, the samples
are non-covalently or covalently stably associated with the support
surface. Examples of non-covalent association include non-specific
adsorption, binding based on electrostatic interactions (e.g., ion
pair interactions), hydrophobic interactions, hydrogen bonding
interactions, specific binding through a specific binding pair
member covalently attached to the support surface, and the like.
Examples of covalent binding include covalent bonds formed between
the small molecules and a functional group present on the surface
of the rigid support (e.g., --OH), where the functional group may
be naturally occurring. The surface of the substrate can be
preferably provided with a layer of linker molecules, although it
will be understood that the linker molecules are not required
elements of the invention. The linker molecules are preferably of
sufficient length to permit small molecules of the invention and on
a substrate to bind to small molecules and to interact freely with
molecules exposed to the substrate.
[0227] The amount of small molecule present in each composition
will be sufficient to provide for adequate binding and detection of
target small molecules during the assay in which the array is
employed. Generally, the amount of each small molecule stably
associated with the solid support of the array is at least about
0.1 pg, preferably at least about 0.5 pg and more preferably at
least about 1 pg, where the amount may be as high as 1000 pg or
higher, but will usually not exceed about 100 pg. In a preferred
embodiment, the microarray has a density exceeding 1, 2, 5, 7, 10,
15 or 20 or more small molecules/cm2.
Tissue Microarrays
[0228] In a preferred embodiment of the invention, the microarrays
or arrays comprise human tissue samples. The microarrays according
to the invention comprise a plurality of sublocations, each
sublocation comprising a tissue sample having at least one known
biological characteristic (e.g., such as tissue type). In a
preferred embodiment of the invention, the plurality of
sublocations comprise cancerous tissue at different neoplastic
stages.
[0229] In one embodiment of the invention, the cancerous cells at
individual sublocations are from an individual with an underlying
cancer or predisposition to having a cancer.
[0230] In one embodiment of the invention, the cancerous cells at
individual sublocations are from an individual with
cancer-associated defects in the BRCA-1 and/or FANC D1/BRCA-2
genes.
[0231] In one embodiment, the microarray comprises at least one
sublocation comprising cancerous cells from a single patient and
comprises a plurality of sublocations comprising cells from other
tissues and organs from the same patient. In a different
embodiment, a microarray is provided comprising cells from a
plurality of individuals who have all died from the same pathology,
or from individuals being treated with the same drug (including
those who recovered from the disease and/or those who did not).
[0232] In another embodiment of the invention, the microarray
comprises a plurality of sublocations comprising cells from
individuals sharing a trait in addition to cancer. In one
embodiment of the invention, the trait shared is gender, age, a
pathology, predisposition to a pathology, exposure to an infectious
disease (e.g., HIV), kinship, death from the same illness,
treatment with the same drug, exposure to chemotherapy or
radiotherapy, exposure to hormone therapy, exposure to surgery,
exposure to the same environmental condition, the same genetic
alteration or group of alterations, expression of the same gene or
sets of genes.
[0233] In a further embodiment of the invention, each sublocation
of the microarray comprises cells from different members of a
pedigree sharing a family history of cancer (e.g., selected from
the group consisting of sibs, twins, cousins, mothers, fathers,
grandmothers, grandfathers, uncles, aunts, and the like). In
another embodiment of the invention, the "pedigree microarray"
comprises environment-matched controls (e.g., husbands, wives,
adopted children, stepparents, and the like). In still a further
embodiment of the invention, the microarray is a reflection of a
plurality of traits representing a particular patient demographic
group of interest, e.g., overweight smokers, diabetics with
peripheral vascular disease, individuals having a particular
predisposition to disease (e.g., sickle cell Anemia, Tay Sachs,
severe combined immunodeficiency), wherein individuals in each
group have cancer.
[0234] In a preferred embodiment of the invention, the microarrays
comprise human tissue biopsies.
[0235] FANC D2-/- as disclosed herein. In one embodiment, the
microarray comprises multiple tissues from such a mouse. In another
embodiment of the invention, the microarray comprises tissues from
mice that are FANC D2-/- as disclosed herein, and which have been
treated with a cancer therapy (e.g., drugs, antibodies, protein
therapies, gene therapies, antisense therapies, and the like).
Screening of Chemosensitizing Agents and Novel Cancer
Therapeutics
[0236] The microarrays of the invention are used to screen for
chemosensitizing agents and cancer therapeutics. The screening
procedures used are disclosed in Examples 15 and 16.
Measurement of Resistance to a Chemotherapy Agent
[0237] Methylation of the FANC F gene within tumor cells that are
treated with cisplatin results in the repression of FANC F gene
expression and thereby causes a disruption in the tumor cell's DNA
damage repair mechanisms and resulting in resistance to cisplatin.
The invention therefore provides for the determination of the
methylation state of any of the Fanconi Anemia/BRCA pathway genes
(see Example 19). In a preferred embodiment, the invention provides
microarrays of tissue biopsy samples from patients being treated
with one or more chemotherapy compounds for the determination of
the methylation state of the Fanconi Anemia/BRCA genes as a
measurement of the degree of a tumor's resistance to one or more
chemotherapy compounds. Methods of measuring DNA methylation of
genes are well known in the art (see U.S. Pat. Nos. 6,200,756;
6,331,393; 6,251,594).
Kits According to the Invention
[0238] The invention provides for kits useful for screening for
chemosensitizers and cancer therapeutics, as well as kits useful
for diagnosis of cancer or predisposition toward cancer involving
cancer-associated defects in the Fanconi Anemia/BRCA gene pathway.
Kits useful according to the invention include isolated FANC D2
polynucleotide primer pairs, probes, inhibitors of the Fanconi
Anemia/BRCA pathway and a FANC D2-specific antibody. In addition,
kits can contain control unmethylated FANC D2 genes. In a further
embodiment, a kit according to the invention can contain an ovary
cancer tumor cell line. All kits according to the invention will
comprise the stated items or combinations of items and packaging
materials therefore. Kits will also include instructions for
use.
[0239] The present invention is described by reference to the
following Examples, which are offered by way of illustration and
are not intended to limit the invention in any manner. Standard
techniques well known in the art or the techniques specifically
described below were utilized.
EXAMPLES
Example 1
Experimental Protocols Used in Examples 2-8
[0240] Cell Lines and Culture Conditions. Epstein-Barr virus (EBV)
transformed lymphoblasts were maintained in RPMI media supplemented
with 15% heat-inactivated fetal calf serum (FCS) and grown in a
humidified 5% CO2-containing atmosphere at 37.degree. C. A control
lymphoblast line (PD7) and FA lymphoblast lines (FA-A (HSC72),
FA-C(PD-4), FA-D (PD-20), FA-F (EUFA121), and FA-G (EUFA316)) have
been previously described (de Winter et al., Nat. Genet., (1998)
Vol. 20, pp. 281-283) (Whitney et al., Nat. Genet., (1995) Vol. 11,
pp. 341-343) (Yamashita et al., P.N.A.S., (1994) Vol. 91, pp.
6712-6716) (de Winter et al., Am. J. Hum. Genet., (2001), Vol. 57,
pp. 1306-1308). PD81 is a lymphoblast cell line from an FA-A
patient. The SV40-transformed FA fibroblasts, GM6914, PD426,
FAG326SV and PD20F, as well as HeLa cells, were grown in DMEM
supplemented with 15% FCS. FA cells (both lymphoblasts and
fibroblasts) were functionally complemented with pMMP retroviral
vectors containing the corresponding FANC cDNAs, and functional
complementation was confirmed by the MMC assay (Garcia-Higuera et
al., Mol. Cell. Biol., (1999) Vol. 19, pp. 4866-4873) (Kuang et
al., Blood, (2000), Vol. 96, pp. 1625-1632).
[0241] Cell Cycle Synchronization. HeLa cells, GM6914 cells, and
GM6914 cells corrected with the pMMP-FANCA retrovirus were
synchronized by the double thymidine block method as previously
described, with minor modifications (Kupfer et al., Blood, (1997)
Vol. 90, pp. 1047-1054). Briefly, cells were treated with 2 mM
thymidine for 18 hours, thymidine-free media for 10 hours, and
additional 2 mM thymidine for 18 hours to arrest the cell cycle at
the G1/S boundary. Cells were washed twice with PBS and then
released in DMEM+15% FCS and analyzed at various time
intervals.
[0242] Alternatively, HeLa cells were treated with 0.5 mM mimosine
(Sigma) for 24 hours for synchronization in late G1 phase (Krude,
1999), washed twice with PBS, and released into DMEM+15% FCS. For
synchronization in M phase, a nocodazole block was used (Ruffner et
al., Mol. Cell. Biol., (1999) Vol. 19, pp. 4843-4854). Cells were
treated with 0.1 .mu.g/ml nocodazole (Sigma) for 15 hours, and the
non-adherent cells were washed twice with PBS and replated in
DMEM+15%.
[0243] Cell Cycle Analysis. Trypsinized cells were resuspended in
0.5 ml of PBS and fixed by adding 5 ml of ice-cold ethanol. Cells
were next washed twice with PBS with 1% bovine serum albumin
fractionV (1% BSA/PBS) (Sigma), and resuspended in 0.24 ml of 1%
BSA/PBS. After adding 30 .mu.l of 500 g/ml propidium iodide (Sigma)
in 38 mM sodium citrate (pH7.0) and 30 .mu.l of 10 mg/ml DNase free
RNaseA (Sigma), samples were incubated at 37.degree. C. for 30 min.
DNA content was measured by FACScan (Beckton Dickinson), and data
were analyzed by the CellQuest and Modfit LT program (Becton
Dickinson).
[0244] Generation of an anti-FANCD2 antiserum. A rabbit polyclonal
antiserum against FANCD2 was generated using a GST-FANCD2
(N-terminal) fusion protein as an antigen source. A 5' fragment was
amplified by polymerase chain reaction (PCR) from the full length
FANCD2 cDNA with the primers (SEQ ID NO:95) DF4EcoRI (5'
AGCCTCgaattcGTTTCCAA AAGAAGACTGTCA-3') and (SEQ ID NO:96) DR816Xh
(5'-GGTATCctcgagTCAAGACGA CAACTTATCCATCA-3'). The resulting PCR
product of 841 bp, encoding the amino-terminal 272 amino acids of
the FANCD2 polypeptide was digested with EcoRI/XhoI and subcloned
into the EcoRI/XhoI sites of the plasmid pGEX4T-1 (Pharmacia). A
GST-FANCD2 (N-terminal) fusion protein of the expected size (54 kD)
was expressed in E. coli strain DH5.gamma., purified over
glutathione-S-sepharose, and used to immunize a New Zealand White
rabbit. An FANCD2-specific immune antiserum was affinity-purified
by passage over an AminoLink Plus column (Pierce) loaded with GST
protein and by passage over an AminoLink Plus column loaded with
the GST-FANCD2 (N-terminal) fusion protein.
[0245] Generation of anti-FANCD2 MoAbs. Two anti-FANCD2 monoclonal
antibodies were generated as follows. Balb/c mice were immunized
with a GST-FANCD2 (N-terminal) fusion protein, which was the same
fusion protein used for the generation of the rabbit polyclonal
antiserum (E35) against FANCD2. Animals were boosted with immunogen
for the four days before fusion, splenocytes were harvested, and
hybridization with myeloma cells was performed. Hybridoma
supernatants were collected and assayed using standard ELISA assay
as the initial screen and immunoblot analysis of FANCD2 as the
secondary screen.
[0246] Two anti-human FANCD2 monoclonal antibodies (MoAbs) (FI17
and FI14) were selected for further study. Hybridoma supernatants
from the two positive cell lines were clarified by centrifugation.
Supernatants were used as MoAbs for western blotting. MoAbs were
purified using an affinity column for IgG. MoAbs were stored as 0.5
mg/ml stocks in phosphate buffered saline (PBS). Anti-HA antibody
(HA.11) was from Babco.
[0247] Immunoblotting. Cells were lysed with 1.times. sample buffer
(50 mM Tris-HCl pH6.8, 86 mM 2-mercaptoethanol, 2% sodium dodecyl
sulfate (SDS), boiled for 5 min, and subjected to 7.5%
polyacrylamide SDS gel electrophoresis. After electrophoresis,
proteins were transferred to nitrocellulose using a submerged
transfer apparatus (BioRad) filled with 25 mM Tris base, 200 mM
glycine, 20% methanol. After blocking with 5% non-fat dried milk in
TBS-T (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20) the
membrane was incubated with the primary antibody diluted in TBS-T
(1:1000 dilution for the affinity-purified anti-FANCD2 polyclonal
antibody (E35) or anti-HA (HA.11), 1:200 dilution for the
anti-FANCD2 mouse monoclonal antibody FI17), washed extensively and
incubated with the appropriate horseradish peroxidase-linked
secondary antibody (Amersham). Chemiluminescence was used for
detection.
[0248] Generation of DNA Damage. Gamma irradiation was delivered
using a Gamma cell 40 apparatus. UV exposure was achieved using a
Stratalinker (Stratagene) after gently aspirating the culture
medium. For Mitomycin C treatment cells were continuously exposed
to the drug for the indicated time. Hydroxyurea (Sigma) was added
to a final concentration of 1 mM for 24 hours.
[0249] Detection of Monoubiquitinated FANCD2. HeLa cells (or the
FA-G fibroblasts, FAG326SV) were transfected using FuGENE6 (Roche),
following the manufacturer's protocol. HeLa cells were plated onto
15 cm tissue culture dishes and were transfected with 15 .mu.g of a
HA-tagged ubiquitin expression vector (pMT 123) (Treier et al.,
Cell, (1994) Vol. 78, pp. 787-798) per dish. Twelve hours following
transfection, cells were treated with the indicated concentration
of MMC (0, 10, 40, 160 ng/ml) or the indicated dose of IR (0, 5,
10, 10, 20 Gy). After 24 hour-incubation with MMC, or two hours
after IR treatment, whole cell extracts were prepared in Lysis
Buffer (50 mM TrisHCl pH 7.4, 150 mM NaCl, 1% (v/v) Triton X-100)
supplemented with protease inhibitors (1 .mu.g/ml leupeptin and
pepstatin, 2 .mu.g/ml aprotinin, 1 mM phenylmethylsulfonylfluoride)
and phosphatase inhibitors (1 mM sodium orthovanadate, 10 mM sodium
fluoride). Using the polyclonal antibody to FANCD2 (E35),
immunoprecipitation (IP) was performed essentially as described
(Kupfer et al., 1997) except that each IP was normalized to contain
4 mg of protein. As a negative control, preimmune serum from the
same rabbit was used in IP reaction. Immunoblotting was done using
anti-HA (HA.11), or anti-FANCD2 (FI17) monoclonal antibody.
[0250] Ubiquitin Aldehyde Treatment. HeLa cells were treated with 1
mM hydroxyurea for 24 hours, and whole cell extracts were prepared
in Lysis Buffer supplemented with protease inhibitors and
phosphatase inhibitors. 200 pg of cell lysate in 67 .mu.l of
reaction with 6.7 .mu.l of 25 .mu.M ubiquitin aldehyde
(BostonBiochem) in DMSO or with 6.7 .mu.l of DMSO were incubated at
30.degree. C. or at 37.degree. C. for the indicated periods.
Sixty-seven microliters of 2.times. sample buffer was added to each
sample, and the samples were boiled for 5 min, separated by 7.5%
SDS-PAGE, and immunoblotted for FANCD2 using the FI17 monoclonal
anti-human FANCD2 antibody.
[0251] Immunofluorescence Microscopy. Cells were fixed with 2%
paraformaldehyde in PBS for 20 min, followed by permeabilization
with 0.3% Triton-X-100 in PBS (10 min). After blocking in 10% goat
serum, 0.1% NP-40 in PBS (blocking buffer), specific antibodies
were added at the appropriate dilution in blocking buffer and
incubated for 2-4 hours at room temperature. FANCD2 was detected
using the affinity-purified E35 polyclonal antibody (1/100). For
BRCA1 detection, we used a commercial monoclonal antibody (D-9,
Santa Cruz) at 2 .mu.g/ml. Cells were subsequently washed three
times in PBS+0.1% NP-40 (10-15 min each wash) and species-specific
fluorescein or Texas red-conjugated secondary antibodies (Jackson
Immunoresearch) were diluted in blocking buffer (anti-mouse 1/200,
anti-rabbit 1/1000) and added. After 1 hour at room temperature
three more 10-15 min washes were applied and the slides were
mounted in Vectashield (Vector laboratories). Images were captured
on a Nikon microscope and processed using Adobe Photoshop
software.
[0252] Meiotic Chromosome Staining. Surface spreads of pachytene
and diplotene spermatocytes from male mice between the ages of 16
and 28 days old were prepared as described by (Peters et al.,
1997). A polyclonal goat antibody to the mouse SCP3 protein was
used to visualize axial elements and synaptonemal complexes in the
meiotic preparations. The M118 mouse monoclonal antibody against
mouse BRCA1 was generated by standard techniques, by immunizing
mice with murine BRCA1 protein. The affinity-purified E35 rabbit
polyclonal antibody was used in 1:200 dilution to detect FANCD.
Antibody incubation and detection procedures were a modification of
the protocol of (Moens et al., J. Cell. Biol., (1987) Vol. 105, pp.
93-103) as described by (Keegan et al., Genes Dev., (1996) Vol. 10,
pp. 2423-2437). Combinations of donkey-anti mouse
IgG-FITC-congugated, Donkey-anti rabbit IgG-TRITC-congugated, and
Donkey-anti goat IgGCy5-congugated secondary antibodies were used
for detection (Jackson ImmunoResearch Laboratories). All
preparations were counterstained with 4',6' diamino-2-phenylindole
(DAPI, Sigma) and mounted in a DABCO (Sigma) antifade solution. The
preparations were examined on a Nikon E1000 microscope
(60.times.CFI Plan Apochromat and 100.times. CR Plan Fluor
oil-immersion objectives). Each fluorochrome (FITC, TRITC, Cy5 and
DAPI) image was captured separately as an 800.times.1000 pixel
12-bit source image via IPLab software (Scanalytics) controlling a
cooled-CCD camera (Princeton Instruments MicroMax) and the separate
12 bit grey scale images were resampled, 24-bit pseudocolored and
merged using Adobe Photoshop.
Example 2
The FA Genes Interact in a Common Cellular Pathway
[0253] Normal lymphoblasts express two isoforms of the FANCD2
protein, a short form (FANCD2-S, 155 kD) and a long form (FANCD2-L,
162 kD). FIG. 1 shows what happened when whole cell extracts were
prepared from a lymphoblast line and cellular proteins were
immunoprecipitated with an anti-FANCD2 antiserum. Normal wild type
cells expressed two isoforms of the FANCD2 protein--a low molecular
weight isoform FANCD2-S (155 kD isoform) and a high molecular
weight isoform (FANCD2-L) (162 kD isoform). FANCD2-S is the primary
translation product of the cloned FANCD2 cDNA. We next evaluated a
large series of FA lymphoblasts and fibroblasts for expression of
the FANCD2 isoforms (Table 5). Correction of these FA cell lines
with the corresponding FA cDNA resulted in functional
complementation and restoration of the high molecular weight
isoform, FANCD2-L.
[0254] As previously described, FA cells are sensitive to the DNA
crosslinking agent, MMC, and in some cases, to ionizing radiation
(IR). Interestingly, FA cells from multiple complementation groups
(A, C, G, and F) only expressed the FANCD2-S isoform (FIG. 1A,
lanes 3, 7, 9, 11). FA cells from complementation groups B and E
also express only the FANCD2-S. Functional correction of the MMC
and IR sensitivity of these FA cells with the corresponding FANC
cDNA restored the FA protein complex (Garcia-Higuera et al., 1999)
and restored the high molecular weight isoform (FANCD2-L) (FIG. 1A,
lanes 4, 8, 10, 12). Taken together, these results demonstrate that
the FA protein complex, containing FANCA, FANCC, FANCF, and FANCG,
directly or indirectly regulates the expression of the two isoforms
of FANCD2. The six cloned FA genes therefore appear to interact in
a common pathway.
Example 3
The FA Protein Complex is Required for the Monoubiquitination of
FANCD2
[0255] The high molecular weight isoform of FANCD2 could result
from one or more mechanisms, including alternative splicing of the
FANCD2 mRNA or post-translational modification(s) of the FANCD2
protein. Treatment with phosphatase did not convert FANCD2-L to
FANCD2-S, demonstrating that phosphorylation alone does not account
for the observed difference in their molecular mass.
[0256] In order to identify other possible post-translational
modifications of FANCD2, we initially sought cellular conditions
which regulate the conversion of FANCD2-S to FANCD2-L (FIGS. 1B,
C). Since FA cells are sensitive to MMC and IR, we reasoned that
these agents might regulate the conversion of FANCD2-S to FANCD2-L
in normal cells. Interestingly, HeLa cells treated with MMC (FIG.
1B, lanes 1-6) or IR (FIG. 1C, lanes 1-6) demonstrated a
dose-dependent increase in the expression of the FANCD2-L
isoform.
[0257] To determine whether FANCD2-L is a ubiquitinated isoform of
FANCD2-S, we transfected HeLa cells with a cDNA encoding
HA-ubiquitin (Treier et al., 1994). Cellular exposure to MMC (FIG.
1B, lanes 7-10) or IR (FIG. 1C, lanes 7-10) resulted in a
dose-dependent increase in the HA-ubiquitin conjugation of FANCD2.
Only the FANCD2-L isoform, and not the FANCD2-S isoform, was
immunoreactive with an anti-HA antibody. Although FANCD2 was not
ubiquinated in FA cells, FANCD2 ubiquination was restored upon
functional complementation of these cells. Although FANCD2 was not
ubiquitinated in FA cells, FANCD2 ubiquitination was restored upon
functional complementation of these cells. Since the FANCD2-S and
FANCD2-L isoforms differ by 7 kD, the FANCD2-L probably contains a
single ubiquitin moiety (76 amino acids) covalently bound by an
amide linkage to an internal lysine residue of FANCD2.
[0258] To confirm the monoubiquitination, we isolated FANCD2-L
protein from HeLa cells and analyzed its tryptic fragments by mass
spectrometry (Wu et al., Science, (2000), Vol. 289, p. 11a).
Ubiquitin tryptic fragments were unambiguously identified, and a
site of monoubiquitination (K561 of FANCD2) was also identified.
Interestingly, this lysine residue is conserved among FANCD2
sequences from human, Drosophila, and C. elegans, suggesting that
the ubiquitination of this site is critical to the FA pathway in
multiple organisms. Mutation of this lysine residue, FANCD2
(K561R), resulted in loss of FANCD2 monoubiquitination.
Example 4
Formation of Nuclear Foci Containing FANCD2 Requires an Intact FA
Pathway
[0259] We examined the immunofluorescence pattern of the FANCD2
protein in uncorrected, MMC-sensitive FA fibroblasts and
functionally-complemented fibroblasts (FIG. 2).
[0260] The corrected FA cells expressed both the FANCD2-S and
FANCD2-L isoforms (FIG. 2A, lanes 2, 4, 6, 8). The endogenous
FANCD2 protein was observed exclusively in the nucleus of human
cells, and no cytoplasmic staining was evident (FIG. 2B, a-h). The
PD-20 (FA-D) cells have decreased nuclear immunofluorescence (FIG.
2B, d), consistent with the decreased expression of FANCD2 protein
in these cells by immunoblot (FIG. 2A, lane 7). In PD20 cells
functionally-corrected with the FANCD2 gene by chromosome transfer,
the FANCD2 protein stained in two nuclear patterns. Most corrected
cells had a diffuse nuclear pattern of staining, and a minor
fraction of cells stained for nuclear foci (see dots, panel h).
Both nuclear patterns were observed with three
independently-derived anti-FANCD2 antisera (1 polyclonal, 2
monoclonal antisera). FA fibroblasts from subtypes A, G, and C
showed only the diffuse pattern of FANCD2 nuclear
immunofluorescence. Functional complementation of these cells with
the FANCA, FANCG, or FANCC cDNA, respectively, restored the MMC
resistance of these cells (Table 6), and restored the nuclear foci
in some cells. The presence of the high molecular weight FANCD2-L
isoform therefore correlates with the presence of FANCD2 nuclear
foci, suggesting that only the monoubiquitinated FANCD2-L isoform
is selectively localized to these foci.
Example 5
The FANCD2 Protein is Localized to Nuclear Foci During S Phase of
the Cell Cycle
[0261] Since only a fraction of the asynchronous
functionally-complemented cells contained FANCD2 nuclear foci, we
reasoned that these foci might assemble at discrete times during
the cell cycle. To test this hypothesis, we examined the formation
of the FANCD2-L isoform and FANCD2 nuclear foci in synchronized
cells (FIG. 3). HeLa cells were synchronized at the G1/S boundary,
released into S phase, and analyzed for formation of the FANCD2-L
isoform (FIG. 3A). The FANCD2-L isoform was expressed specifically
during late G1 phase and throughout S phase. Synchronized,
uncomplemented FA cells (FA-A fibroblasts, GM6914) expressed normal
to increased levels of FANCD2-S protein but failed to express
FANCD2-L at any time during the cell cycle. Functional
complementation of these FA-A cells by stable transfection with the
FANCA cDNA restored S phase-specific expression of FANCD2-L. The S
phase specific expression of the FANCD2-L isoform was confirmed
when HeLa cells were synchronized by other methods, such as
nocodazole arrest (FIG. 3B) or mimosine exposure (FIG. 3B). Cells
arrested in mitosis did not express FANCD2-L, suggesting that the
FANCD2-L isoform is removed or degraded prior to cell division
(FIG. 3B, mitosis). Taken together, these results demonstrate that
the monoubiquitination of the FANCD2 protein is highly regulated
during the cell cycle, and that this modification requires an
intact FA pathway.
[0262] The cell cycle dependent expression of the FANCD2-L isoform
also correlated with the formation of FANCD2 nuclear foci (FIG.
3C). Nocodazole arrested (mitotic) cells express no FANCD2-L
isoform and exhibit no FANCD2 nuclear foci (FIG. 3C, 0 hour). When
these synchronized cells were allowed to traverse S phase (15 to 18
hours), an increase in FANCD2 nuclear foci was observed.
Example 6
The FANCD2 Protein is Localized to Nuclear Foci in Response to DNA
Damage
[0263] We examined the accumulation of the FANCD2-L isoform and
FANCD2 nuclear foci in response to DNA damage (FIG. 4). Previous
studies have shown that FA cells are sensitive to agents which
cause DNA interstrand crosslinks (MMC) or double strand breaks (IR)
but are relatively resistant to ultraviolet light (UV) and
monofunctional alkylating agents. MMC activated the conversion of
FANCD2-S to FANCD2-L in asynchronous HeLa cells (FIG. 4A). Maximal
conversion to FANCD2-L occurred 12-24 hours after MMC exposure,
correlating with the time of maximal FANCD2 nuclear focus
formation. There was an increase in FANCD2 nuclear foci
corresponding to the increase in FANCD2-L. Ionizing radiation also
activated a time-dependent and dose-dependent increase in FANCD2-L
in HeLa cells, with a corresponding increase in FANCD2 foci (FIG.
4B). Surprisingly, ultraviolet (UV) light activated a
time-dependent and dose-dependent conversion of FANCD2-S to
FANCD2-L, with a corresponding increase in FANCD2 foci (FIG.
4C).
[0264] We tested the effect of DNA damage on FA cells (FIG. 4D). FA
cells from multiple complementation groups (A, C, and G) failed to
activate the FANCD2-L isoform and failed to activate FANCD2 nuclear
foci in response to MMC or IR exposure. These data suggest that the
cellular sensitivity of FA cells results, at least in part, from
their failure to activate FANCD2-L and FANCD2 nuclear foci.
Example 7
Co-Localization of Activated FANCD2 and BRCA1 Protein
[0265] Like FANCD2, the breast cancer susceptibility protein,
BRCA1, is upregulated in proliferating cells and is activated by
post-translational modifications during S phase or in response to
DNA damage. BRCA has a carboxy terminus 20 amino acids which
contain a highly acidic HMG-like domain suggesting a possible
mechanism for chromatin repair. The BRCA1 protein co-localizes in
IR-inducible foci (IRIFs) with other proteins implicated in DNA
repair, such as RAD51 or the NBS/Mre11/RAD50 complex. Cells with
biallelic mutations in BRCA1 have a defect in DNA repair and are
sensitive to DNA damaging agents such as IR and MMC (Table 5).
Taken together, these data suggest a possible functional
interaction between the FANCD2 and BRCA1 proteins. BRCA foci are
large (2mDa) multiprotein complexes including ATM and ATM
substrates involved in DNA repair (BRCA1) and checkpoint functions
(NBS).
[0266] In order to determine whether the activated FANCD2 protein
co-localizes with the BRCA1 protein, we performed double
immunolabeling of HeLa cells (FIG. 5). In the absence of ionizing
radiation, approximately 30-50% of cells contained BRCA1 nuclear
foci (FIG. 5A). In contrast, only rare cells traversing S phase
contained FANCD2 dots (b, e). These nuclear foci were also
immunoreactive with antisera to both BRCA1 and FANCD2 (c, f).
Following IR exposure, there was an increase in the number of cells
containing nuclear foci and the number of foci per cell. These
nuclear foci were larger and more fluorescent than foci observed in
the absence of IR. Again, these foci contained both BRCA1 and
FANCD2 protein (1,1). An interaction of FANCD2-L and BRCA1 was
further confirmed by coimmunoprecipitation of the proteins (FIG.
5B) from exponentially growing HeLa cells exposed to IR.
[0267] We examined the effect of BRCA1 expression on the formation
of FANCD2-L and nuclear foci (FIG. 6). The BRCA1 (-/-) cell line,
HCC1937, expresses a mutant form of the BRCA1 protein with a
carboxy terminal truncation. Although these cells expressed a low
level of FANCD2-L (FIG. 6A), IR failed to activate an increase in
FANCD2-L levels. Also, these cells had a decreased number of
IR-inducible FANCD2 foci (FIG. 6B, panels c, d). Correction of
these BRCA1 (-/-) cells by stable transfection with the BRCA1 cDNA
restored IR-inducible FANCD2 ubiquitination and nuclear foci (FIG.
6B, panels k, 1). These data suggest that the wild-type BRCA1
protein is required as an "organizer" for IR-inducible FANCD2 dot
formation and further suggests a functional interaction between the
proteins.
Example 8
Co-Localization of FANCD2 and BRCA10n Meiotic Chromosomes
[0268] The association of FANCD2 and BRCA1 in mitotic cells
suggested that these proteins might also co-localize during meiotic
prophase. Previous studies have demonstrated that the BRCA1 protein
is concentrated on the unsynapsed/axial elements of human
synaptonemal complexes in zygotene and pachytene spermatocytes. To
test for a possible colocalization of FANCD2 and BRCA1 in meiotic
cells, we examined surface spreads of late pachytene and early
diplotene mouse spermatocytes for the presence of FANCD2 and BRCA1
protein (FIG. 7). We found that the rabbit polyclonal anti-FANCD2
antibody E35 specifically stained the unpaired axes of the X and Y
chromosomes in late pachynema (FIG. 7a) and in diplonema (FIGS. 7d,
7e and 7g). Under the same experimental conditions, preimmune serum
did not stain synaptonemal complexes (FIGS. 7b and 7c). The M118
anti-BRCA1 antibody stained the unpaired sex chromosomes in mouse
pachytene and diplotene spermatocytes (FIGS. 7f and 7h). FANCD2 Ab
staining of the unsynapsed axes of the sex chromosomes was
interrupted, giving a beads-on-a-string appearance (FIG. 7g). A
consecutive examination of 20 pachytene nuclei indicated that most
(.about.65%) of these anti-FANCD2 foci co-localized with regions of
intense anti-BRCA1 staining, further supporting an interaction
between these proteins (FIGS. 7g, 7h, and 7i). These results
provide the first example of a FANC protein (activated FANCD2)
which binds to chromatin.
Example 9
Experimental Protocols for Obtaining and Analyzing the DNA and
Protein Sequence for FANCD2
[0269] Northern Hybridizations. Human adult and fetal multi-tissue
mRNA blots were purchased from Clontech (Palo Alto, Calif.). Blots
were probed with 32P labeled DNA from EST clone SGC34603. Standard
hybridization and washing conditions were used. Equal loading was
confirmed by re-hybridizing the blot with an actin cDNA probe.
[0270] Mutation Analysis. Total cellular RNA was reverse
transcribed using a commercial kit (Gibco/BRL). The 5' end section
of FANCD2 was amplified from the resulting patient and control cDNA
with a nested PCR protocol. The first round was performed with
primers (SEQ ID NO:97) MG471 5'-AATCGAAAACTACGGGCG-3' and (SEQ ID
NO:98) MG457 5'-GAGAACACATGAATGAACGC-3'. The PCR product from this
round was diluted 1:50 for a subsequent round using primers (SEQ ID
NO:99) MG492 5'-GGCGACGGCTTCTCGG AAGTAATTTAAG-3' and (SEQ ID
NO:100) MG472 5'-AGCGGCAGGAGGTTTATG-3'. The PCR conditions were as
follows: 94.degree. C. for 3 min, 25 cycles of 94.degree. C. for 45
sec, 50.degree. C. for 45 sec, 72.degree. C. for 3 min and 5 min of
72.degree. C. at the end. The 3' portion of the gene was amplified
as described above but with primers, (SEQ ID NO:101) MG474
5'-TGGCGGCAGACAGAAG TG-3' and (SEQ ID NO:102) MG475
5'TGGCGGCAGACAGAAGTG-3'. The second round of PCR was performed with
(SEQ ID NO:103) MG491 5'-AGAGAGCCAACCTGAGCGA TG-3' and (SEQ ID
NO:104) MG476 5'-GTGCCAGACTCTGGTGGG-3'. The PCR products were
gel-purified, cloned into the pT-Adv vector (Clontech) and
sequenced using internal primers.
[0271] Allele specific assays. Allele specific assays were
performed in the PD20 family and 290 control samples (=580
chromosomes). The PD20 family is of mixed Northern European descent
and VU008 is a Dutch family. Control DNA samples were from
unrelated individuals in CEPH families (n=95), samples from
unrelated North American families with either ectodermal dysplasia
(n=95) or Fanconi Anemia (n=94). The maternal nt376a.fwdarw.g
mutation in the PD20 family created a novel MspI restriction site.
For genomic DNA, the assay involved amplifying genomic DNA using
the primers (SEQ ID NO:105) MG792 5'-AGGAGACACCCTTCCTATCC-3'
located in exon 4 and (SEQ ID NO:106) M0803 5'-GAAGTTGGCAAAACAGAC
TG-3' which is in intron 5. The size of the PCR product was 340 bp,
yielding two fragments of 283 bp and 57 bp upon Mspl digestion if
the mutation was present. For analysis of the reverted cDNA clones,
PCR was performed using primers (SEQ ID NO:107) MG924 5'-TGTCTTGTGA
GCGTCTGCAGG-3' and (SEQ ID NO:108) MG753 5'-AGGTT
TTGATAATGGCAGGC-3'. The paternal exon 37 mutation (R1236H) in PD20
and exon 12 missense mutation (R302W) in VU008 were tested by
allele specific oligonucleotide (ASO) hybridization (Wu et al.,
DNA, (1989) Vol. 8, pp. 135-142). For the exon 12 assay, genomic
DNA was amplified with primers (SEQ ID NO:109) MG979
5'-ACTGGACTGTGCCTACCCACTATG-3' and (SEQ ID NO:110) MG984
5'-CCTGTGTGAGGATGAGCTCT-3'. Primers (SEQ ID NO:171) MG818
5'-AGAGGTAGGGAAGGAAGCTAC-3' and (SEQ ID NO:172) MG813 5'-CCAAAGTCCA
CTTCTTGAAG-3' were used for exon 37. Wild-type (SEQ ID NO:111)
(5'-TTCTCCCGAAG CTCAG-3' for R302W and (SEQ ID NO:112)
5'-TTTCTTCCGTGTGATGA-3' for R1236H and mutant SEQ ID NO:351
(5'-TTCTCCCAAAGCTGAG-3' R302W and SEQ ID NO:352
(5'-TYTCTTCCATGTGATGA-3' for R1236H) oligonucleotides were
end-labeled with .gamma.32P-[ATP] and hybridized to dot-blotted
target PCR products as previously ss novel DdeI site. The wild-type
PCR product digests into a 117 and 71 bp product, whereas the
mutant allele yields three fragments of 56, 61 and 71 bps in
length. PCR in all of the above assays was performed with 50 ng of
genomic DNA for 37 cycles of 94.degree. C. for 25 sec, 50.degree.
C. for 25 sec and 72.degree. C. for 35 sec.
[0272] Generation of an anti-FANCD2 antiserum. A rabbit polyclonal
antiserum against FANCD2 was generated using a GST-FANCD2
(N-terminal) fusion protein as an antigen source. A 5' fragment was
amplified by polymerase chain reaction (PCR) from the full length
FANCD2 cDNA with the primers (SEQ ID NO:113) DF4EcoRJ
(5'-AGCCTCgaattcGUTCC AAAAGAAGACTGTCA-3') and (SEQ ID NO:114)
DR816Xh (5'-GGTATCctcgagTCAAGA CGACAACTTATCCATCA-3'). The resulting
PCR product of 841 bp, encoding the amino-terminal 272 amino acids
of the FANCD2 polypeptide was digested with EcoRI/XhoI and
subcloned into the EcoRI/XhoI sites of the plasmid pGEX4T-1
(Pharmacia). A GST-FANCD2 (N-terminal) fusion protein of the
expected size (54 kD) was expressed in E. coli strain DH5.alpha.,
purified over glutathione-S-sepharose, and used to immunize a New
Zealand White rabbit. An FANCD2-specific immune antiserum was
affinity-purified over an AminoLink Plus column (Pierce) loaded
with GST protein and over an AminoLink Plus column loaded with the
GST-FANCD2 (N-terminal) fusion protein.
Immunoblotting is as in Example 1.
[0273] Cell Lines and Transfections. PD20i is an immortalized and
PD733 a primary FA fibroblast cell line generated by the Oregon
Health Sciences Fanconi Anemia cell repository (Jakobs et al.,
Somet. Cell. Mol. Genet., (1996), Vol. 22, pp. 151-157). PD20
lymphoblasts were derived from bone marrow samples. VU008 is a
lymphoblast and VU423 a fibroblast line generated by the European
Fanconi Anemia Registry (EUFAR). VU423i was an immortalized line
derived by transfection with SV40 T-antigen (Jakobs et al., 1996)
and telomerase (Bodnar et al., Science, (1998) Vol. 279, pp.
349-352). The other FA cell lines have been previously described.
Human fibroblasts were cultured in MEM and 20% fetal calf serum.
Transformed lymphoblasts were cultured in RPMI 1640 supplemented
with 15% heat-inactivated fetal calf serum.
[0274] To generate FANCD2 expression constructs, the full-length
cDNA was assembled from cloned RT-PCR products in pBluescript and
the absence of PCR induced mutations was confirmed by sequencing.
The expression vectors pIRES-Neo, pEGFP-N1, pRevTRE and pRevTet-off
were from ClonTech (Palo Alto, Calif.). The FANCD2 was inserted
into the appropriate multi-cloning site of these vectors.
Expression constructs were electroporated into cell line PD20 and a
normal control fibroblast cell line, GM639 using standard
conditions (van den Hoff et al., 1992). Neomycin selection was
carried out with 400 .mu.g/ml active G418 (Gibco).
[0275] Whole cell fusions. For the whole cell fusion experiments, a
PD20 cell line (PD20i) resistant to hygromycin B and deleted for
the HPRT locus was used (Jakobs et al., Somat. Cell. Mol. Genet.,
(1997) Vol. 23, pp. 1-7). Controls included PD24 (primary
fibroblasts from affected sibling of PD20) and PD319i (Jakobs et
al., 1997) (immortal fibroblasts from a non-A, C, D or G FA
patient). 2.5.times.105 cells from each cell line were mixed in a
T25 flask and allowed to recover for 24 hours. The cells were
washed with serum-free medium and then fused with 50% PEG for 1
min. After removal of the PEG, the cells were washed 3.times. with
serum-free medium and allowed to recover overnight in complete
medium without selection. The next day, cells were split 1:10 into
selective medium containing 400 .mu.g/ml hygromycin B (Roche
Molecular) and 1.times.HAT. After the selection was complete,
hybrids were passaged once and then analyzed as described
below.
[0276] Retroviral Transduction of FA-D2 cells and complementation
analysis. The full length FANCD2 cDNA was subcloned into the
vector, pMMP-puro (Pulsipher et al., 1998). Retroviral supernatants
were used to transduce PD20F, and puromycin resistant cells were
selected. Cells were analyzed for MMC sensitivity by the crystal
violet assay (Naf et al., 1998).
[0277] Chromosome Breakage Analysis. Chromosome breakage analysis
was performed by the Cytogenetics Core Lab at OHSU (Portland,
Oreg.). For the analysis (Cohen et al., 1982) cells were plated
into T25 flasks, allowed to recover and then treated with 300 ng/ml
of DEB for two days. After treatment, the cells were exposed to
colcemid for 3 hours and harvested using 0.075 M KCl and 3:1
methanol:acetic acid. Slides were stained with Wright's stain and
50-100 metaphases were scored for radials.
Example 10
Mouse Models for FA for Use in Screening Potential Therapeutic
Agents
[0278] Murine models of FANCD2 can be made using homologous
recombination in embryonic stem cells or targeted disruption as
described in D'Andrea et al., (1997) 90:1725-1736, and Yang et al.,
Blood, (2001) Vol. 98, pp. 1-6. The knockout of FANCD2 locus in
mice is not a lethal mutation. These knock-out animals have
increased susceptibility to cancer and furthermore display other
symptoms characteristic of FA. It is expected that administering
certain therapeutic agents to the knock-out mice will reduce their
susceptibility to cancer. Moreover, it is expected that certain
established chemotherapeutic agents will be identified that are
more effective for treating knock-out mice who have developed
cancers as a result of the particular genetic defect and this will
also be useful in treating human subjects with susceptibility to
cancer or who have developed cancers as a result of a mutation in
the FANCD2 locus.
[0279] We can generate experimental mice models with targeted
disruptions of FANCD2 using for example the approach described by
Chen et al, Nat. Genet., (1996) Vol. 12, pp. 448-451, for FANCC who
created a disruption in an exon of the gene, and by Whitney et al.,
(1996) Vol. 88, pp. 49-58, who used homologous recombination to
create a disruption of an exon of the gene. In both animal models,
spontaneous chromosome breakage and an increase in chromosome
breaks in splenic lymphocytes in response to bifunctional
alkylating agents are observed. In both models, FANCD2-/- mice have
germ cell defects and decreased fertility. The FANCD2 murine
knockout model is useful in examining (1) the role of the FANCD2
gene in the physiologic response of hematopoietic cells to DNA
damage, (2) the in vivo effects of inhibitory cytokines on FA
marrow cells, and (3) the efficacy of gene therapy and (4) for
screening candidate therapeutic molecules.
[0280] The availability of other FA gene disruptions will allow the
generation and characterization of mice with multiple FA gene
knockouts. For instance, if 2 FA genes function exclusively in the
same cellular pathway, a double knockout should have the same
phenotype as the single FA gene knockout.
[0281] The murine FANCD2 gene can be disrupted by replacing exons
with an FRT-flanked neomycin cassette via homologous recombination
in 129/SvJae embryonic stem cells. Mice homozygous for the FANCD2
mutation within a mixed genetic background of 129/Sv and C57BL can
be generated following standard protocols. Mouse tail genomic DMA
can be prepared as previously described and used as a template for
polymerase chain reaction (PCR) genotyping.
[0282] Splenocytes can be prepared from 6-week-old mice of known
FANCD2 genotype. The spleen is dissected, crushed in RPMI medium
into a single-cell suspension, and filtered through a 70 .mu.m
filter. Red cells are lysed in hypotonic ammonium chloride. The
remaining splenic lymphocytes are washed in phosphate-buffered
saline and resuspended in RPMI/10% fetal bovine serum plus
phytohemagglutinin. Cells are tested for viability by the trypan
blue exclusion assay. Cells are cultured for 24 hours in media and
exposed to MMC or DEB for an additional 48 hours. Alternatively,
cells are cultured for 50 hours, exposed to IR (2 or 4 Gy, as
indicated), and allowed to recover for 12 hours before chromosome
breakage or trypan blue exclusion (viability) analysis.
[0283] Mononuclear cells can be isolated from the femurs and tibiae
of 4- to 6-week-old FANCD2+/- or FANCD2-/- mice, as previously
described. A total of 2.times.104 cells were cultured in 1 mL of
MethoCult M343 media (StemCell Technologies, Vancouver, BC) with or
without MMC treatment. Colonies are scored at day 7, when most of
the colonies belong to the granulocyte-macrophage colony-forming
unit or erythroid burst-forming unit lineages. Each number are
averaged from duplicate plates, and the data derived from 2
independent experiments.
[0284] Lymphocytes isolated from thymus, spleen, and peripheral
lymph nodes are stained for T- or B-lymphocyte surface molecules
with fluorescein isothiocyanate-conjugated anti-CD3, CD4, and CD19
and PE-conjugated anti-CD8, CD44, CD 45B, immunoglobulin M, and
B220 (BD PharMingen, Calif.). Stained cells were analyzed on a
Counter Epics XL flow cytometry system.
[0285] Mice ovaries and testes were isolated and fixed in 4%
paraformaldehyde and further processed by the core facility of the
Department of Pathology at Massachusetts General Hospital.
Example 11
Screening Assays Using Antibody Reagents for Detecting Increased
Cancer Susceptibility in Human Subjects
[0286] Blood samples or tissue samples can be taken from subjects
for testing for the relative amounts of FANCD2-S compared to
FANCD2-L and the presence or absence of FANCD2-L. Using antibody
reagents specific for FANCD2-S and FANCD2-L proteins (Example 1),
positive samples can be identified on Western blots as shown in
FIG. 14. Other antibody assays may be utilized such as, for
example, one step migration binding banded assays described in U.S.
Pat. Nos. 5,654,162 and 5,073,484. Enzyme linked immunosorbent
assays (ELISA), sandwich assays, radioimmune assays and other
immunodiagnostic assays known in the art may be used to determine
relative binding concentrations of FANCD2-S and FANCD2-L.
The feasibility of this approach is illustrated by the
following:
FANCD2 Diagnostic Western Blot for Screening Human Cancer Cell
Lines
[0287] Human cancer cell lines were treated with or without
ionizing radiation (as indicated in FIG. 14) and total cell
proteins were electrophoresed, transferred to nitrocellulose and
immunoblotted with the anti-FANCD2 monoclonal antibody of Example
1. Ovarian cancer cell line (TOV21G) expressed FANCD2-S but not
FANCD2-L (see lanes 9, 10). This cell line has a deletion of human
chromosome 3p overlapping the FANCD2 gene and is hemizygous for
FANCD2 and is predicted to have a mutation in the second FANCD2
allele which therefore fails to be monoubiquinated by the PA
complex hence no FANCD2-L (lanes 9, 10). This example demonstrates
that antibody based tests are suited for determining lesions in the
FANCD2 gene which lead to increased cancer susceptibility.
Example 12
Screening Assays Using Nucleic Acid Reagents for Detecting
Increased Cancer Susceptibility in Human Subjects
[0288] Blood samples or tissue samples can be taken from subjects
and screened using sequencing techniques or nucleic acid probes to
determine the size and location of the genetic lesion if any in the
genome of the subject. The screening method may include sequencing
the entire gene or by using sets of probes or single probes to
identify lesions. It is expected that a single lesion may
predominant in the population but that other lesions may arise
throughout the gene with low frequency as is the case for other
genetic conditions such as cystic fibrosis and the P53 tumor
suppressor gene.
The feasibility of this approach is illustrated by the
following:
[0289] Peripheral blood lymphocytes are isolated from the patient
using standard Ficoll-Hypaque gradients and genomic DNA is isolated
from these lymphocytes. We use genomic PCR to amplify 44 exons of
the human FANCD2 gene (see primer Table 7) and sequence the two
FANCD2 alleles to identify mutations. Where such mutations are
found, we distinguish these from benign polymorphisms by their
ability to ablate the functional complementation of an FA-D2
indicator cell line.
Example 13
Measurement of Mono-Ubiquitinated FANC D2-L in Tissue Biopsies
[0290] Tissue biopsies were obtained by needle aspiration or skin
punch biopsy. Cells, resuspended in appropriate culture media in
microtiter plates are then treated with the indicated concentration
of MMC (0, 10, 40, 160 ng/ml) or the indicated dose of IR (0, 5,
10, 10, 20 Gy). After 24 hour-incubation with MMC, or two hours
after IR treatment, whole cell extracts were prepared in Lysis
Buffer (50 mM TrisHCl pH 7.4, 150 mM NaCl, 1% (v/v) Triton X-100)
supplemented with protease inhibitors (1 .mu.g/ml leupeptin and
pepstatin, 2 .mu.g/ml aprotinin, 1 mM phenylmethylsulfonylfluoride)
and phosphatase inhibitors (1 mM sodium orthovanadate, 10 mM sodium
fluoride). Samples are then tested for the presence of the FANC
D2-L isoform using the anti-FANCD2-L-specific monoclonal antibody,
as disclosed herein, and conventional immunoassays such as the
enzyme linked immunosorbent assay (ELISA) that are commonly used to
quantitate the levels of proteins in cell samples (see Harlow, E.
and Lane, D. Using Antibodies: A Laboratory Manual (1999) Cold
Spring Harbor Laboratory Press).
Example 14
Diagnosis of Cancer Associated Defects in a Fanconi Anemia/BRCA
Gene or Protein
[0291] PCR Amplification and Sequencing of the Human FANCD2
Gene--cDNA and Genomic DNA Templates
[0292] Genomic DNA Sequencing
[0293] In the course of sequencing the FANCD2 gene, it became
apparent that there are at least eight pseudogene sequences for
FANCD2 in the human genome, all located on human chromosome 3p (see
attached Table 8). Accordingly, it was important to design a
specific genomic PCR assay, designed to specifically amplify the
FANCD2 sequence and to exclude the pseudogenes. It is not possible
to design PCR primers close to exons 1, 2, 3, 7-14, 19-22, 23-29,
30-32, 33-36 and 43-44 of the functional FANCD2 gene that do not
also amplify one or more of the non-functional copies of those
exons. By first generating large PCR products that are unique to
these regions of the functional gene, then using those unique
products as templates in subsequent amplification reactions to
produce exonic PCR products with primers that are not unique to the
functional gene, a vast excess of the PCR products from the
functional gene over the PCR products from the copies was
generated. In this manner, mutations in the functional gene are
made detectable.
[0294] Superamplicon PCR
[0295] As indicated above, the purpose of these PCR reactions is to
generate large amplicons (superamplicons) that are unique to
certain regions of the functional FANCD2 gene. The components of
the PCR are: 60 mM Tris-SO.sub.4 (pH8.9), 18 mM
(NH.sub.4)2SO.sub.4, 2.0 mM MgSO.sub.4, 0.2 mM in each of dATP,
dCTP, dGTP, TTP, 0.1 .mu.M of each primer, 5 ng/.mu.l DNA, 0.05
units/.mu.l Platinum Taq DNA Polymerase High Fidelity (GIBCO BRL,
Gaithersburg, Md.).
[0296] The thermocycling conditions are: 94.degree. C., 4 min,
followed by 11 cycles, each with a denaturing step at 94.degree. C.
for 20 seconds and an extension step at 72.degree. C. for 300
seconds, and with a 20 second annealing step that decreased
1.degree. C./cycle, beginning at 64.degree. C. in the first cycle
and decreasing to 54.degree. C. in the eleventh cycle; the eleventh
cycle was then repeated 25 times; a 6 minute incubation at
72.degree. C. followed by a 4.degree. C. soak completed the
program.
The primer identities are as follows (the primer sequences are in
the table 9):
TABLE-US-00001 Amplicon Amplicon Exons FwdPrimer RevPrimer Length
Name x1-x2 exon 2 F super-1-2 R 2097 1 super exon 1 F super-1-2 R
4346 2 super x3 super-3-F exon 3 R 2323 3 super x7-x14 exon-10-F
super-7-14-R 5635 4 super super-7-14-F exon-9-R 4595 5 super
x19-x22 exon-21-F super-19-22 R 1015 6 super super-19-22-F
exon-20-R 2749 7 super x23-x29 exon-27 F super-23-29 R 3371 9 super
super-23-29 F exon 26 R 3252 10 super x30-x32 exon 31 F super-30-32
R 2895 11 super super-30-32 F exon 30 R 299 12 super x33-36 exon 35
F super-33-36 R 2186 13 super super-33-36 F exon 34 R 3457 14 super
x43-x44 exon 44 F super-43-44 R 464 15 super super-43-44 F exon 43a
R 2040 16 super
[0297] Exonic PCR
[0298] These PCR's are of 2 types: (1) the superamplicon PCR is
used as the DNA template; exons 1-3, 7-14, 19-22, 23-29, 30-32,
33-36 and 43-44 are in this group, and (2) unamplified genomic DNA
is used as the DNA template; exons 4-6, 15-18 and 37-42 are in this
group.
[0299] One primer (designated "-F") in each pair was synthesized
with an 18 base M13-21 forward sequence (SEQ ID NO:
192)(TGTAAAACGACGGCCAGT) at its 5' end, and the other primer
(designated "-R") was synthesized with an 18 base M13-28 reverse
sequence (SEQ ID NO: 193) (CAGGAAACAGCTATGACC) at its 5' end. For
exon 15, two overlapping amplicons were designed.
[0300] The components of the 10 ul PCR reaction are: 20 mM
Tris-HCl(pH8.4), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.1 mM in each of
dATP, dCTP, dGTP, TTP, 0.1 .mu.M of each primer, either 1 ul of a
1:100 dilution of the superamplicon PCR or 5 ng/ul of unamplified
genomic DNA, 0.05 units/.mu.l Taq polymerase (Taq Platinum, GIBCO
BRL, Gaithersburg, Md.). The thermocycling conditions are:
94.degree. C., 4 min, followed by 11 cycles, each with a denaturing
step at 94.degree. C. for 30 seconds and an extension step at
72.degree. C. for 20 seconds, and with a 20 second annealing step
that decreased 1.degree. C./cycle, beginning at 60.degree. C. in
the first cycle and decreasing to 50.degree. C. in the eleventh
cycle; the eleventh cycle was then repeated 25 times; a 6 minute
incubation at 72.degree. C. followed by a 4.degree. C. soak
completed the program.
[0301] cDNA Sequencing
[0302] Two micrograms of total RNA is converted into cDNA using
Superscript First-Strand Synthesis System for RT-PCR (GIBCO/BRL)
according to the manufacturer's instructions. One twentieth of the
RT-PCR reaction is used as the DNA template in each of 18 PCR
reactions; these PCR reactions amplify the coding region of the
cDNA in overlapping fragments. The primers are shown in the table
below.
[0303] One primer (designated "-F") in each pair was synthesized
with an 18 base M13-21 forward sequence (TGTAAAACGACGGCCAGT) at its
5' end, and the other primer (designated "-R") was synthesized with
an 18 base M13-28 reverse sequence(CAGGAAACAGCTATGACC) at its 5'
end.
[0304] The components of the 10 ul PCR reaction are: 20 mM
Tris-HCl(pH8.4), 50 mM KCl, 1.5 mM MgCl.sub.2, 0.1 mM in each of
dATP, dCTP, dGTP, TTP, 0.1 .mu.M of each primer, either 1 ul of a
1:100 dilution of the superamplicon PCR or 5 ng/.mu.l of
unamplified genomic DNA, 0.05 units/.mu.l Taq polymerase (Taq
Platinum, GIBCO BRL, Gaithersburg, Md.).
[0305] The thermocycling conditions are: 94.degree. C., 4 min,
followed by 11 cycles, each with a denaturing step at 94.degree. C.
for 30 seconds and an extension step at 72.degree. C. for 20
seconds, and with a 20 second annealing step that decreased
1.degree. C./cycle, beginning at 60.degree. C. in the first cycle
and decreasing to 50.degree. C. in the eleventh cycle; the eleventh
cycle was then repeated 25 times; a 6 minute incubation at
72.degree. C. followed by a 4.degree. C. soak completed the
program.
TABLE-US-00002 Primer 5' Position Sequence (5' to 3') Length (bp)
D1F 24 TGTAAAACGACGGCCAGT CGACGGCTTCTCGGAAGTAA SEQ ID NO: 194 D1R
408 AGGAAACAGCTATGACCAT GCAGACGCTCACAAGACAAA 407 SEQ ID NO: 195 D2F
322 TGTAAAACGACGGCCAGT GACACCCTTCCTATCCCAAAA SEQ ID NO: 196 D2R 689
AGGAAACAGCTATGACCAT CAGGTTCTCTGGAGCAATAC 368 SEQ ID NO: 197 D3F 612
TGTAAAACGACGGCCAGT TGGCTTGACAGAGTTGTGGAT SEQ ID NO: 198 D3R 1019
AGGAAACAGCTATGACCAT CTGTAACCGTGATGGCAAAAC 408 SEQ ID NO: 199 D4F
855 TGTAAAACGACGGCCAGT CGCCAGTTGGTGATGGATAAG SEQ ID NO: 200 D4R
1223 AGGAAACAGCTATGACCAT AAGCATCACCAGGTCAAACAC 369 SEQ ID NO: 201
D5F 1081 TGTAAAACGACGGCCAGT GCGGTCAGAGCTGTATTATTC SEQ ID NO: 202
D5R 1461 AGGAAACAGCTATGACCAT CTGCTGGCAGTACGTGTCAA 401 SEQ ID NO:
203 D6F 1377 TGTAAAACGACGGCCAGT TCGCTGGCTCAGAGTTTGCTT SEQ ID NO:
204 D6R 1765 AGGAAACAGCTATGACCAT GTGCTAGAGAGCTGCTTTCTT 389 SEQ ID
NO: 205 D7F 1641 TGTAAAACGACGGCCAGT CCCCTCAGCAAATACGAAAAC SEQ ID
NO: 206 D7R 2065 AGGAAACAGCTATGACCAT ACTACGAAGGCATCCTGGAAA 424 SEQ
ID NO: 207 D8F 1947 TGTAAAACGACGGCCAGT GCCTCTGCACTTTACTATGATG SEQ
ID NO: 208 D8R 2301 AGGAAACAGCTATGACCAT CTCCTCCAAGTTTCCGTTATG 375
SEQ ID NO: 209 D9F 2210 TGTAAAACGACGGCCAGT GGTGACCTCACAGGAATCAG SEQ
ID NO: 210 D9R 2573 AGGAAACAGCTATGACCAT TTTCCAAGAGGAGGGACATAG 384
SEQ ID NO: 211 D10F 2438 TGTAAAACGACGGCCAGT CAACTGGTTCCGAGAGATTGT
SEQ ID NO: 212 D10R 2859 AGGAAACAGCTATGACCAT CAATGTCCAGCTCTCGGAAAAA
422 SEQ ID NO: 213 D11F 2746 TGTAAAACGACGGCCAGT
GTGACCCTACGCCATCTCATA SEQ ID NO: 214 D11R 3138 AGGAAACAGCTATGACCAT
ACATTGGGGTCAGCAGTTGAA 393 SEQ ID NO: 215 D12F 3027
TGTAAAACGACGGCCAGT AGAGTCCCCTTTCTCAAGAACA SEQ ID NO: 216 D12R 3413
AGGAAACAGCTATGACCAT GACGCTCTGGCTGAGTAGTT 387 SEQ ID NO: 217 D13F
3334 TGTAAAACGACGGCCAGT CAGCCCTCCATGTCCTTAGT SEQ ID NO: 218 D13R
3742 AGGAAACAGCTATGACCAT AGGGAATGTGGAGGAAGATG 407 SEQ ID NO: 219
D14F 3637 TGTAAAACGACGGCCAGT TGGAGCACACAGAGAGCATT SEQ ID NO: 220
D14R 4010 AGGAAACAGCTATGACCAT GTCTAGGAGCGGCATACATT 374 SEQ ID NO:
221 D15F 3830 TGTAAAACGACGGCCAGT AGCAGACTCGCAGCAGATTCA SEQ ID NO:
222 D15R 4225 AGGAAACAGCTATGACCAT AGCCAGAAAGCCTCTCTACA 396 SEQ ID
NO: 223 D16F 4117/4112 TGTAAAACGACGGCCAGT ACACGAGACTCACCCAACAT SEQ
ID NO: 224 D16R-L 4477 AGGAAACAGCTATGACCAT GGGAATGGAAATGGGCATAGA
361 SEQ ID NO: 225 D16R-S 4451 AGGAAACAGCTATGACCAT
GACACAGAAGCAGGCAACAA 340 SEQ ID NO: 226 D17F-(L) 4333
TGTAAAACGAGGGCCAGT AGAGCAAAGCCACTGAGGTAT SEQ ID NO: 227 D17R-(L)
4768 AGGAAACAGCTATGACCAT GACTCTGTGCTTTGGCTTTCA 436 SEQ ID NO:
228
DNA Sequencing
[0306] An aliquot of each PCR reaction was diluted 1:10 with water.
The diluted PCR product was sequenced on both strands using an M13
Forward and an M13 Reverse Big Dye Primer kit (Applied Biosystems,
Foster City, Calif.) according to the manufacturer's
recommendations. The sequencing products were separated on a
fluorescent sequencer (model 377 from Applied Biosystems, Foster
City, Calif.). Base calls were made by the instrument software, and
reviewed by visual inspection. Each sequence was compared to the
corresponding normal sequence using Sequencher 3.0 software
(LifeCodes).
Example 15
Method of Screening for a Chemosensitizing Agent
[0307] As shown in the model of the FA/BRCA pathway, the enzymatic
monoubiquitination of FANCD2 is a critical regulatory event. This
event requires an intact FA protein complex (A/C/E/F/G complex) and
requires BRCA1 and BRCA2. While the actual catalytic subunit
required for FANCD2 monoubiquitination remains unknown, it still
remains possible to screen for antagonists of monoubiquitination.
As described elsewhere in this text, an inhibitor of the FA pathway
could, in principal, function as a chemosensitizer of cisplatin in
the treatment of ovarian cancer or other cancers. The screening of
an inhibitor of FANCD2 monoubiquitination can be performed as a
simple mammalian cell-based screen. A mammalian tissue culture cell
line, e.g., Hela calls are first preincubated with random candidate
small molecules. Cell clones are then screened using anti-FANCD2
western blots. An inhibitor (antagonist) of the FA pathway will
block FANCD2 monoubiquitination.
[0308] As described in Garcia-Higuera et al, 2001, BRCA1 may in
fact be the enzyme which monoubiquitinates FANCD2. Accordingly,
BRCA1 has a ubiquitin ligase (Ring Finger) catalytic domain.
Therefore, an in vitro assay will be devised to screen for
BRCA1-mediated monoubiquitination of FANCD2. An inhibitor will be
screened directly for its ability to inhibit this in vitro
reaction. Once inhibitors are identified, such drugs could be used
in animal studies or phase 1 human studies to determine their
functions as cisplatin sensitizers.
Example 16
Method of Screening for a Potential Cancer Therapeutic
[0309] Cells and animals which carry a Fanconi Anemia/BRCA pathway
gene having one or more cancer associated defects can be used as
model systems to study and test for substances which have potential
as therapeutic agents. The cells are typically cultured epithelial
cells. These may be isolated from individuals with Fanconi
Anemia/BRCA pathway gene having one or more cancer associated
defects, either somatic or germline. Alternatively, the cell line
can be engineered to carry the mutation in a gene of the Fanconi
Anemia/BRCA pathway gene having one or more cancer associated
defects.
[0310] After a test substance is applied to the cells, the
neoplastically transformed phenotype of the cell is determined. Any
trait of neoplastically transformed cells can be assessed,
including anchorage-independent growth, tumorigenicity in nude
mice, invasiveness of cells, and growth factor dependence. Assays
for each of these traits are known in the art.
[0311] Animals for testing therapeutic agents can be selected after
mutagenesis of whole animals or after treatment of germline cells
or zygotes. Such treatments include insertion of mutant Fanconi
Anemia/BRCA pathway genes having one or more cancer associated
defects, usually from a second animal species, as well as insertion
of disrupted homologous genes. Alternatively, the endogenous
Fanconi Anemia/BRCA pathway gene(s) of the animals may be disrupted
by insertion or deletion mutation or other genetic alterations
using conventional techniques (Capecchi, 1989; Valancius and
Smithies, 1991; Hasty et al., 1991; Shinkai et al., 1992; Mombaerts
et al., 1992; Philpott et al., 1992; Snouwaert et al., 1992;
Donehower et al., 1992) as outlined in Example 10. After test
substances have been administered to the animals, the growth of
tumors must be assessed. If the test substance prevents or
suppresses the growth of tumors, then the test substance is a
candidate therapeutic agent for the treatment of the cancers
identified herein.
Example 17
Method of Treatment of a Cancer that is Resistant to an
Anti-Neoplastic Agent
[0312] The present example describes the treatment of a patient
with a cancer that is resistant to an anti-neoplastic agent such as
cisplatin. The protocol provides for the administration of
cisplatin as described herein with an increasing dosage of an
inhibitor of the ubiquitination of the FANC D2 protein as a
chemosensitizing agent. Cisplatin and the chemosensitizing agent
can be administered intravenously, subcutaneously, intratumorally
or intraperitoneally. The administering physician can adjust the
amount and timing of drug administration on the basis of results
observed using standard measures of cancer activity known in the
art. Suppression of tumor growth and metastasis is indicative of
effective treatment of the cancer.
Example 18
A Method of Measuring the Future Efficacy of a Therapeutic
Agent
[0313] Tissue biopsies of neoplasms from cancer patients being
treated with a therapeutic agent are obtained by needle aspiration
or skin punch biopsy. Cells, resuspended in appropriate culture
media in microtiter plates are then treated with the indicated
concentration of MMC (0, 10, 40, 160 ng/ml) or the indicated dose
of IR (0, 5, 10, 10, 20 Gy). After 24 hour-incubation with MMC, or
two hours after IR treatment, it induce DNA damage, whole cell
extracts were prepared in Lysis Buffer (50 mM TrisHCl pH 7.4, 150
mM NaCl, 1% (v/v) Triton X-100) supplemented with protease
inhibitors (1 .mu.g/ml leupeptin and pepstatin, 2 .mu.g/ml
aprotinin, 1 mM phenylmethylsulfonylfluoride) and phosphatase
inhibitors (1 mM sodium orthovanadate, 10 mM sodium fluoride).
Samples are then tested for the presence of the FANC D2-L isoform
using the anti-FANCD2-L-specific monoclonal antibody, as disclosed
herein, and conventional immunoassays such as the enzyme linked
immunosorbent assay (ELISA) that are commonly used to quantitate
the levels of proteins in cell samples (see Harlow, E. and Lane, D.
Using Antibodies: A Laboratory Manual (1999) Cold Spring Harbor
Laboratory Press). Detection of the mono-ubiquitinated FANC D2-L
isoform is considered indicative of a reduced efficacy of the
therapeutic agent being used to treat the cancer patient.
Example 19
A Method of Determining Resistance to a Chemotherapy Agent
[0314] A flow chart describing the protocol used to determine the
methylation state of the Fanconi Anemia/BRCA pathway genes is
depicted in FIG. 21.
Analysis of FANCF Methylation.
[0315] DNA methylation patterns in FANCF gene were determined by
methylation specific PCR or PCR-based HpaII restriction enzyme
assay. Genomic DNA was isolated from indicated cell lines using
QIAamp DNA Blood Mini Kit (QIAGEN).
PCR-Based HpaII Restriction Enzyme Assay
[0316] 250 ng of genomic DNA was digested with 30 unit of HpaII or
MspI for 12 hr at 37.degree. C. 12.5 ng of DNA from each digest was
analyzed by PCR in 10 .mu.l reactions containing 1.times.PCR
buffer, 200 .mu.M each of the four deoxynucleotide triphosphates,
0.5 units of AmpliTaq DNA polymerase (Roche), and 0.2 .mu.M of each
primer. PCR was run for 33 cycles, and each cycle constituted
denaturation (45 sec at 94.degree. C., first cycle 4 min 45 sec),
annealing (1 min at 61 20.degree. C.), and extension (2 min at
72.degree. C., last cycle 9 min) PCR reaction was subjected to
electrophoresis on a 1.2% agarose gel containing ethidium bromide.
Primers used were (SEQ ID NO:229) FPF6
(5'-GCACCTCATGGAATCCCTTC-3')(forward) and (SEQ ID NO:230) FR343
(5'-GTTGCTGCACCAGGTGGTAA-3')(reverse). These primers were designed
using nt -6-14 for the forward primer and nt 403-432 for the
reverse primer.
Methylation-Specific PCR.
[0317] Bisulfite modification of genomic DNA was performed as
previously described (Herman J G et al. Proc Natl Acad Sci USA 93
(18) 9821-6 (1996)). The bisuffite-treated DNA was amplified with
either a methylation-specific or unmethylation-specific primer set.
PCR was run for 40 cycles, and each cycle constituted denaturation
(45 sec at 94.degree. C., first cycle 4 min 45 sec), annealing (1
min at 65.degree. C.), and extension (2 min at 72.degree. C., last
cycle 9 min) PCR reaction was subjected to electrophoresis on a 3%
Separide (Gibco) gel containing ethidium bromide. The
methylation-specific primers were FF280M (SEQ ID NO:231)
(5'-TTTTTGCGTTTGTTGGAGAATCGGGTTTTC -3') (forward) and FR432M (SEQ
ID NO:232) (5'-ATACACCGCAAACCGCCGACGAACAAAACG-3') (reverse). The
unmethylation-specific primers were FF280U (SEQ ID NO:233)
(5'-TTTTTGTGTTTGTTGGAGAATTGGGTTTTT -3') (forward) and FR432U (SEQ
ID NO:234) (5'-ATACACCACAAACCACCAACAAACAAAACA -3')(reverse). These
primers were designed using nt 280-309 for the forward primers and
nt 403-432 for the reverse primers.
TABLE-US-00003 TABLE 1 Complementation Groups and Responsible Genes
of Fanconi Anemia Estimated Number Sub- percentage Responsible
Chromosome of Protein type of patients gene location exons product
A 66% FANCA 16q24.3 43 163 Kd B 4.3% FANCB -- -- -- C 12.7% FANCC
9q22.3 14 63 Kd D1 rare FANCD1 -- -- -- D2 rare FANCD2 3p25.3 44
155,162 kD E 12.7% FANCE 6p21.2-21.3 10 60 kD F rare FANCF 11p15 1
42 kD G rare FANCG 9p13 14 68 kD (XRCC9)
TABLE-US-00004 TABLE 2 Diseases of Genomic Instability Disease
Damaging Agent Neoplasm Function FA Cross-linking agents Acute
Unknown leukemia, hepatic, myeloblastic gastroinstestinal, and
gynecological tumors XP UV light Squamous cell Excision carcinomas
repair AT Ionizing radiation Lymphoma Afferent pathway to p53
Bloom's Alkylating agents Acute Cell-cycle Syndrome lymphoblastic
regulation leukemia Cockayne's UV light Basal cell Transcription
Syndrome carcinoma repair coupled Hereditary non- Unknown
Adenocarcinoma DNA polyposis colon of colon, mismatch cancer
(HNPCC) ovarian cancer repair
TABLE-US-00005 TABLE 3 FANCD2 Sequence Alterations Mutations PD20
nt376a.fwdarw.g S126G/splice nt3707g.fwdarw.a R1236H VU008
nt904c.fwdarw.t R302W nt958c.fwdarw.t Q320X PD733 deletion of exon
17 Polymorphisms nt1122a.fwdarw.g V374V nt1440t.fwdarw.c* H480H
nt1509c.fwdarw.t.sup..dagger. N503N nt2141c.fwdarw.t*.sup..dagger.
L714P nt2259t.fwdarw.c D753D nt4098t.fwdarw.g*.sup..dagger. L1366L
nt4453g.fwdarw.a.sup..dagger. 3UTR *PD20 is heterozygous;
.sup..dagger.VU008 is heterozygous.
TABLE-US-00006 TABLE 4 Chromosome Breakage Analysis of Whole-cell
Fusions Cell DEB MMC % of Cells line/hybrids (ng/ml) (ng/ml) with
radials Phenotype PD20i 300 58 S PD24p 300 na* S VU423p 300 na* S
PD319i 300 52 S PD20i/VU423p 300 6 R PD20i/PD24p 300 30 S
PD20i/PD319i 300 0 R PD20i 40 48 S VU423i 40 78 S PD20i/VU423i 40
10 R VU423i + chr. 3, 40 74 S clone 1 VU423i + chr. 3, 40 68 S
clone 2 VU423i + chr. 3, 40 88 S clone 3 PD20i + empty vector 0 0 2
40 24 S 200 62 S PD20i + FANCD2 vector 0 0 0 40 2 R 200 10 R Groups
of experiments are separated by line spaces. S, cross-linker
sensitive; R, cross-linker-resistant; i = immortal fibroblast line;
p = primary fibroblasts. *Cell viability at this concentration was
too low to score for radial formation, indicating the exquisite
sensitivity of primary fibroblasts to interstrand
DNA-crosslinks.
TABLE-US-00007 TABLE 5 FA IR/ protein MMC Bleomycin FA complex
sensitivity sensitivity Cell line/plasmid Group (1) (2) (3) Lym-
PD7 Wt + R R phoblasts HSC72 A - S HSC72 + A A + R PD4 C - S PD4 +
C C + R EUFA316 G - S EUFA316 + G G + R EUFA121 F - S S EUFA121 + F
F + R R PD20 D + S S PD20(R) D + R R Fibro- GM0637 Wt + R R blasts
GM6914 A - S S GM694 + A A + R R PD426 C - S PDF426 + C C + R
FAG326SV G - S FAG326SV + G G + R PD20F D + S S 20-3-15(+D) D + R R
NBS (-/-) NBS + S S ATM (-/-) ATM + S S BRCA1 (-/-) BRCA1 + S S 1)
The presence of the FA protein complex (FANCA/FANCG/FANCC) was
determined as previously described (Garcia-Higuera et al., MCB
19:4866-4873, 1999) 2) MMC sensitivity for determined by the XTT
assay for lymphoblasts or by the crystal violet assay for
fibroblasts. 3) IR/Bleomycin sensitivity was determined by analysis
of chromosome breakage. (See Materials and Methods).
TABLE-US-00008 TABLE 6 The Intron/Exon Junctions of FANCD SEQ SEQ
ID 5'-Donor ID 3'-Acceptor Exon Size NO. site Score Intron NO. site
Score Exon 1 30 9 TCG 87 52 gtttcccgattttg 85 2 gtgagtaag ctctag
GAA tg 2 97 10 CCA 83 53 gaaaatttttctat 83 3 gtaagtact tttcag AAA
cta 3 141 11 TAG 78 54 ctcttcttttttctg 88 4 gtaatatttta catag CTG 4
68 12 AAA 81 159 55 attttttaaatctcc 78 5 gtatgtatttt ttaag ATA 5
104 13 CAG 86 375 56 gatttctttttttttt 91 6 gtgtggaga acag TAT gg 6
61 14 CAG 89 57 ccctatgtcttctt 86 7 gtaagactg ttttag CCT tc 7 53 15
AAA 87 58 ttctcttcctaaca 80 8 gtaagtggc ttttag CAA gt 8 79 16 AAG
83 364 59 aatagtgtcttcta 85 9 gtaggcttatg ctgcag GAC 9 125 17 CAG
80 60 tctttttctaccatt 86 10 gtggataaa cacag TGA cc 10 88 18 AAG 76
61 tctgtgcttttaatt 85 11 gtagaaaag tttag GTT ac 11 105 19 GAG 80
387 62 ctaatatttactttc 87 12 gtatgctctta tgcag GTA 12 101 20 AAG 85
342 63 ttcctctctgctac 84 13 gtaaagagc ttgtag TTC tc 13 101 21 AAG
89 237 64 actctctcctgttt 92 14 gtgagatcttt tttcag GCA 14 36 22 AAG
82 65 tgcatatttattga 73 15 gtaatgttcat caatag GTG 15 144 23 TTA 80
66 tctactcttcccc 86 16 gtaagtgtc actcaag GTT ag 16 135 24 CAG 85 67
gttgactctcccc 84 17 gtatgttgaaa tgtatag GAA 17 132 25 AAG 77 68
tggcatcatttttt 89 18 gtatcttattg ccacag GGC 18 111 26 CAG 83 69
tcttcatcatctca 87 19 gttagaggc ttgcag GAT aa 19 110 27 CAG 82 70
aaaaaattctttgt 79 20 gtacacgtg ttttag AAG ga 20 61 28 CAG 93 71
attcttcctctttg 93 21 gtgagttcttt ctccag GTG 21 120 29 CTG 81 445 72
tgtttgtttgcttcc 85 22 gtaaagcca tgaag GAA at 22 74 30 AGG 84 300 73
attctggtttttctc 88 23 gtaggtattgt cgcag TGA 23 147 31 AAA 73 74
aatttatttctcctt 89 24 gtcagtata ctcag ATT gt 24 101 32 TAG 84 370
75 aaatgtttgttctc 86 25 gtatgggat tctcag ATT ga 25 116 33 GAG 88 76
atgtaatttgtact 82 26 gtgagcag ttgcag ATT agt 26 109 34 CAG 89 77
cagcctgctgttt 81 27 gtaagagaa gtttcag TCA gt 27 111 35 TAG 90 272
78 ttctctttttaatat 73 29 gtaagtatgtt aaaag AAA 28 110 36 AAG 78 79
ttgctgtgacttc 85 29 gtattggaatg cccatag GAG 29 144 37 GAA 85 80
tcctttcctccatg 84 30 gtaagtgac tgacag GCT ag 30 117 38 AAG 86 81
taactctgcattta 80 31 gttagtgtagg ttatagAAC 31 129 39 CAG 82 118 82
aaaatcatttttatt 79 32 gtcagaagc tttag TGT ct 32 119 40 TTG 85 83
tcttaccttgactt 85 33 gtaagtatgtg ccttag GAG 33 111 41 CAG 90 84
tttttcttgtctcctt 91 34 gtgagtcat acag CCA aa 34 131 42 TTG 73 85
tttgtcttcttttcta 89 35 gtgatgggc acag CTT ct 35 94 43 CTG 84 286 86
atatttgactctca 78 36 gtgagatgttt atgcag TAT 36 123 44 CAG 92 87
atgcttttcccgtc 88 37 gtaaggga ttctag GCA gtt 37 94 45 CAG 92 88
catatatttggct 81 38 gtgagtaag gccccag at ATT 38 72 46 AAG 93 89
cttgtctttcacct 93 39 gtgagtatg ctccag GTA ga 39 39 47 AAG 89 90
agtgtgtctctctt 86 40 gtgagagat cttcag TAT tt 40 75 48 CGG 86 91
tataaacttattgg 77 41 gtaagagct ttatag GAA aa 41 75 49 AAG 91 92
tgttatttatttcca 86 42 gtaagaag ttcag ATT ggg 42 147 50 CAG 91 93
cttggtccattca 80 43 gtaagcctt catttag GGT gg 43 228 CCA taa + 94
attattctttgccc 44 3'UTR cttag GAT 96 51 GAG gtatctctaca 44 72 GAT
tag + 3'UTR
TABLE-US-00009 TABLE 7 PCR Primers to Amplify the 44 Exons of FANCD
Primer SEQ ID Product Annealing Exon Name NO. Primer Sequence
(5'->3') Size (bp) Temp 1 MG914 115 F: CTAGCACAGAACTCTGCTGC 372
54 MG837 116 R: CTAGCACAGAACTCTGCTGC 2 MG746 117 F:
CTTCAGCAACAGCGAAGTA- 422 50 GTCTG MG747 118 R:
ATTCTCAGCACTTGAAAAGC- AGG 3 MG773 119 F: GGACACATCAGTTTTCCTCTC 309
50 MG789 120 R: GAAAACCCATGATTCAGTCC 4-5 MG816 121 F:
TCATCAGGCAAGAAACTTGG 467 50 MG803 122 R: GAAGTTGGCAAAACAGACTG 6
MG804 123 F: GAGCCATCTGCTCATTTCTG 283 50 MG812 124 R:
CCCGCTATTTAGACTTGAGC 7 MG775 125 F: CAAAGTGTTTATTCCAGGAGC 343 50
MG802 126 R: CATCAGGGTACTTTGAACA- TTC 8-9 MG727 127 F:
TTGACCAGAAAGGCTCAGT- 640 50 TCC MG915 128 R: AGATGATGCCAGAGGGTTTA-
TCC 10 MG790 129 F: TGCCCAGCTCTGTTCAAACC 222 50 MG774 130 R:
AGGCAATGACTGACTGACAC 11 MG805 131 F: TGCCCGTCTATTTTTGATGA- 392 50
AGC MG791 132 R: TCTCAGTTAGTCTGGGGACAG 12 MG751 133 F:
TCATGGTAGAGAGACTGGAC- 432 50 TGTGC MG972 134 R:
ACCCTGGAGCAAATGACAACC 13-14 MG973 135 F: ATTTGCTCCAGGGTACATGGC 555
50 MG974 136 R: GAAAGACAGTGGGAAGGCA- AGC 15 MG975 137 F:
GGGAGTGTGTGGAACAAAT- 513 50 GAGC MG976 138 R: AGTTTCTACAGGCTGGTCCT-
ATTCC 16 MG755 139 F: AACGTGGAATCCCATTGATGC 379 48 MG730 140 R:
TTTCTGTGTTCCCTCCTTGC 17 MG794 141 F: GATGGTCAAGTTACACTGGC 382 50
MG778 142 R: CACCTCCCACCAATTATAGT- ATTC 18 MG808 143 F:
CTATGTGTGTCTCTTTTACA- 234 48 GGG MG817 144 R: AATCTTTCCCACCATATTGC
19 MG779 145 F: CATACCTTCTTTTGCTGTGC 199 48 MG795 146 R:
CCACAGAAGTCAGAATCTC- CACG 20 MG731 147 F: TGTAACAAACCTGCACGTTG 632
56 MG732 148 R: TGCTACCCAAGCCAGTAGTT- TCC 21 MG788 149 F:
GAGTTTGGGAAAGATTGGC- 232 50 AGC MG772 150 R: TGTAGTAAAGCAGCTCTCA-
TGC 22-23 MG733 151 F: CAAGTACACTCTGCACTGCC 652 50 MG758 152 R:
TGACTCAACTTCCCCACCAA- GAG 24-25 MG736 153 F: CTCCCTATGTACGTGGAGT-
732 50 AATAC MG737 154 R: GGGAGTCTTGTGGGAACTAAG 26 MG780 155 F:
TTCATAGACATCTCTCAGC- 284 50 TCTG MG759 156 R: GTTTTGGTATCAGGGAAAGC
27-28 MG760 157 F: AGCCATGCTTGGAATTTTGG 653 50 MG781 158 R:
CTCACTGGGATGTCACAAAC 29 MG740 159 F: GGTCTTGATGTGTGACTTGT- 447 50
ATCCC MG741 160 R: CCTCAGTGTCACAGTGTTCTT- TGTG 30 MG809 161 F:
CATGAAATGACTAGGACAT- 281 48 TCC MG797 162 R: CTACCCAGTGACCCAAACAC
31-32 MG761 163 F: CGAACCCTTAGTTTCTGAGA- 503 50 CGC MG742 164 R:
TCAGTGCCTTGGTGACTGTC 33 MG916 165 F: TTGATGGTACAGACTGGAGGC 274 50
MG810 166 R: AAGAAAGTTGCCAATCCTG- TTCC 34 MG762 167 F:
AGCACCTGAAAATAAGGAGG 343 50 MG743 168 R: GCCCAAAGTTTGTAAGTGT- GAG
35-36 MG787 169 F: AGCAAGAATGAGGTCAAGTTC 590 50 MG806 170 R:
GGGAAAAACTGGAGGAAAG- AACTC 37 MG818 171 F: AGAGGTAGGGAAGGAAGCTAC
233 50 MG813 172 R: CCAAAGTCCACTTCTTGAAG 38 MG834 173 F:
GATGCACTGGTTGCTACATC 275 50 MG836 174 R: CCAGGACACTTGGTTTCTGC 39
MG839 175 F: ACACTCCCAGTTGGAATCAG 370 50 MG871 176 R:
CTTGTGGGCAAGAAATTGAG 40 MG829 177 F: TGGGCTGGATGAGACTATTC 223 50
MG870 178 R: CCAAGGSVSYSYVYYVYHS- HVSSC 41 MG820 179 F:
TGATTATCAGCATAGGCTGG 271 50 MG811 180 R: GATCCCCCAATAGGAACTGC 42
MG763 181 F: CATTCAGATTCACCAGGACAC 227 50 MG782 182 R:
CCTTACATGCCATCTGATGC 43 MG764 183 F: AACCTTCTCCCCTATTACCC 435 50
3'UTR MG835 184 R: GGAAAATGAGAGGCTATA- ATGC 44 MG1006 185 F:
TGTATTCCAGAGGTCACCC- 234 50 AGAGC 3'UTR MG1005 186 R:
CCAGTAAGAAAGGCAAACA- GCG
TABLE-US-00010 TABLE 8 FANCD2 LOCI on Human Chromosome 3p Copy Copy
Copy Exon Copy region 1 region 2 region 3 FANCD2 region 4 Copy
region 5 1 201,110 344,395 8,170,539 2 3 4 5 6 7 8 9 10 11 12
6,126,244 8,209,073 13 14 15 16 8,202,791 17 18 19 20 21 22 23 24
18,201,854 25 26 27 28 6,094,448 29 30 31 32 186,164 33 34 35 36
18,178,589 37 38 39 40 41 42 43 44 8,095,780
TABLE-US-00011 TABLE 9 Length of Primer Name Sequence Product SEQ
ID NO: hFANCD2_super_1_2_R GGCCCACAGTTTCCGTTTCT -- SEQ ID NO: 235
hFANGD2_super_1_2_F CAAGGAAGCTAGAAATGAAGAAC SEQ ID NO: 236
hFANCD2_super_3_3_R CTGGGACTACAGACACGTTTT -- SEQ ID NO: 237
hFANCD2_super_3_3_F GTGTCACGTGTCTGTAATCTC SEQ ID NO: 238
hFANCD2_super_7_14_R TTAAGACCCAGCGAGGTATTC -- SEQ ID NO: 239
hFANCD2_super_7_14_F TGGGTTTGGTAGGGTAATGTC SEQ ID NO: 240
hFANCD2_super_19_22_R TGGAAAGTCACTGCGGAGAAA -- SEQ ID NO: 241
hFANCD2_super_19_22_F ACGTAATCACCCCTGTAATCC SEQ ID NO: 242
hFANGD2_super_23_29_R CACTGCAAACTGCTCACTCAA -- SEQ ID NO: 243
hFANCD2_super_23_29_F GGCCTTGTGCTAAGTGCTTTT SEQ ID NO: 244
hFANCD2_super_30_32_R ACCCTGGTGGACATACCTTTT -- SEQ ID NO: 245
hFANCD2_super_30_32_F CCAAAGTACTGGGAGTTTGAG SEQ ID NO: 246
hFANCD2_super_33_36_R TCTGGGCAACAGAACAAGCAA -- SEQ ID NO: 247
hFANCD2_super_33_36_F GAGCAATTTAGCCTGTGGTTTT SEQ ID NO: 248
hFANCD2_super_43_44_R ACCATCTGGCCGACATGGTA -- SEQ ID NO: 249
hFANCD2_super_43_44_F AGGGTCCTGAGACTATATACC SEQ ID NO: 250
hFANCD2_exon1_R TCCCATCTCAGGGCAGATGA 324 SEQ ID NO: 251
hFANCD2_exon1_F TATGCCCGGCTAGCACAGAA SEQ ID NO: 252 hFANCD2_exon2_R
TCTCTCACATGCCTCACACAT 258 SEQ ID NO: 253 hFANCD2_exon2_F
CCCCTCTGATTTTGGATAGAG SEQ ID NO: 254 hFANCD2_exon3_R
AAGATGGATGGCCCTCTGATT 354 SEQ ID NO: 255 hFANCD2_exon3_F
GACACATCAGTTTTCCTCTCAT SEQ ID NO: 256 hFANCD2_exon4_R
AATCATTCTAGCCCACTCAACT 253 SEQ ID NO: 257 hFANCD2_exon4_F
TGGTTTCATCAGGCAAGAAACT SEQ ID NO: 258 hFANCD2_exon5_R
AGCCCCATGAAGTTGGCAAAA 298 SEQ ID NO: 259 hFANCD2_exon5_F
GCTTGTGCCAGCATAACTCTA SEQ ID NO: 260 hFANCD2_exon6_R
GCTGTGCTAAAGCTGCTACAA 341 SEQ ID NO: 261 hFANCD2_exon6_F
GAGCCATCTGCTCATTTCTGT SEQ ID NO: 262 hFANCD2_exon7_R
CAGAGAAACCAATAGTTTTCAG 280 SEQ ID NO: 263 hFANCD2_exon7_F
AATCTCGGCTCACTGCAATCT SEQ ID NO: 264 hFANCD2_exon8_R
AGCTAATGGATGGATGGAAAAG 333 SEQ ID NO: 265 hFANCD2_exon8_F
TAGTGCAGTGCCGAATGCATA SEQ ID NO: 266 hFANCD2_exon9_R
TACTCATGAAGGGGGGTATCA 323 SEQ ID NO: 267 hFANCD2_exon9_F
TTCACACGTAGGTAGTCTTTCT SEQ ID NO: 268 hFANCD2_exon10_R
CATTACTCCCAAGGCAATGAC 229 SEQ ID NO: 269 hFANCD2_exon10_F
GCCCAGCTCTGTTCAAACCA SEQ ID NO: 270 hFANCD2_exon11_R
AGCTCCATTCTCTCCTCTGAA 341 SEQ ID NO: 271 hFANCD2_exon11_F
GTGGGAAGATGGAGTAAGAGA SEQ ID NO: 272 hFANCD2_exon12_R
TCTGACAGTGGGATGTCAGAA 211 SEQ ID NO: 273 hFANCD2_exon12_F
TGCCTACCCACTATGAATGAG SEQ ID NO: 274 hFANCD2_exon13_R
ATGTGTCCATCTGGCAACCAT 321 SEQ ID NO: 275 hFANCD2_exon13_F
CAGGAACTCCGATCTTGTAAG SEQ ID NO: 276 hFANCD2_exon14_R
TGGAGGGGGGAGAAAGAAAG 186 SEQ ID NO: 277 hFANCD2_exon14_F
CGTGTTTCGCTGATGTGTCAT SEQ ID NO: 278 hFANCD2_exon15a_R
GGAAGGCCAGTTTGTCAAAGT 325 SEQ ID NO: 279 hFANCD2_exon15a_F
GTGTTTGACCTGGTGATGCTT SEQ ID NO: 280 hFANCD2_exon15b_R
CTTATTTCTTAGCACCCTGTCAA 204 SEQ ID NO: 281 hFANCD2_exonl5b_F
GTGGAACAAATGAGCATTATCC SEQ ID NO: 282 hFANCD2_exon16_R
TTCCCCTTCAGTGAGTTCCAA 332 SEQ ID NO: 283 hFANCD2_exon16_F
AGGGAGGAGAAGTCTGACATT SEQ ID NO: 284 hFANCD2_exon17_R
GATTAGCCTGTAGGTTAGGTAT 422 SEQ ID NO: 285 hFANCD2_exon17_F
GATGGGTTTGGGTTGATTGTG SEQ ID NO: 286 hFANCD2_exon18_R
CCAGTCTAGGAGACAGAGCT 282 SEQ ID NO: 287 hFANCD2_exon18_F
GGCTATCTATGTGTGTCTCTTT SEQ ID NO: 288 hFANCD2_exon19_R
ACGATTAGAAGGAACATGGAA 328 SEQ ID NO: 289 hFANCD2_exon19_F
CGATATCCATACCTTCTTTTGC SEQ ID NO: 290 hFANCD2_exon20_R
TGACAGAGCGAGACTCTCTAA 239 SEQ ID NO: 291 hFANCD2_exon20_F
CACACCAACATGGCACATGTA SEQ ID NO: 292 hFANCD2_exon21_R
GAGACAGGGTAGGGCAGAAA 339 SEQ ID NO: 293 hFANCD2_exon21_F
AAAGGGGCGAGTGGAGTTTG SEQ ID NO: 294 hFANCD2_exon22_R
GTAACTTCACCAGTGCAACCAA 279 SEQ ID NO: 295 hFANCD2_exon22_F
ATGCACTCTCTCTTTTCTACTT SEQ ID NO: 296 hFANCD2_exon23_R
ACAAGGAATCTGCCCCATTCT 356 SEQ ID NO: 297 hFANCD2_exon23_F
TTCCCTGTAGCCTTGCGTATT SEQ ID NO: 298 hFANCD2_exon24_R
CCCCACATACACCATGTATTG 258 SEQ ID NO: 299 hFANCD2_exon24_F
CTCCCTATGTACGTGGAGTAA SEQ ID NO: 300 hFANCD2_exon25_R
GTGGGACATAACAGCTAGAGA 350 SEQ ID NO: 301 hFANCD2_exon25_F
AGGGGAAAGTAAATAGCAAGGA SEQ ID NO: 302 hFANCD2_exon26_R
TCAGGGATATTGGCCTGAGAT 324 SEQ ID NO: 303 hFANCD2_exon26_F
GACATCTCTCAGCTCTGGATA SEQ ID NO: 304 hFANCD2_exon27_R
CCAATTACTGATGCCATGATAC 324 SEQ ID NO: 305 hFANCD2_exon27_F
GCATTCAGCCATGCTTGGTAA SEQ ID NO: 306 hFANCD2_exon28_R
GATTACTCCAACGCCTAAGAG 354 SEQ ID NO: 307 hFANCD2_exon28_F
TCTACCTCTAGGCAGTTTCCA SEQ ID NO: 308 hFANCD2_exon29_R
TCTCCTCAGTGTCACAGTCTT 384 SEQ ID NO: 309 hFANCD2_exon29_F
CTTGGGCTAGAGGAAGTTGTT SEQ ID NO: 310 hFANCD2_exon30_R
TACCCAGTGACCCAAACACAA 348 SEQ ID NO: 311 hFANCD2_exon30_F
GAGTTCAAGGCTGGAATAGCT SEQ ID NO: 312 hFANCD2_exon31_R
ACCGTGATTCTCACCAGCTAA 341 SEQ ID NO: 313 hFANCD2_exon31_F
CCATTGCGAACCCTTAGTTTC SEQ ID NO: 314 hFANCD2_exon32_R
AGTGCTTGGTGACTGTCAAA 336 SEQ ID NO: 315 hFANCD2_exon32_F
CCACCTGGAGAACATTCACAA SEQ ID NO: 316 hFANCD2_exon33_R
TACTGAAAGACACCCAGGTTAT 340 SEQ ID NO: 317 hFANCD2_exon33_F
CACGCCCGACCTCTCAATTC SEQ ID NO: 318 hFANCD2_exon34_R
TATAGCAAGAGGGCCTATCCA 349 SEQ ID NO: 319 hFANCD2_exon34_F
TTGGGCACGTCATGTGGATTT SEQ ID NO: 320 hFANCD2_exon35_R
GTCCAGTCTCTGACAAACAAC 100 SEQ ID NO: 321 hFANCD2_exon35_F
TTAGACCGGGAACGTCTTAGT SEQ ID NO: 322 hFANCD2_exon36_R
GGCCAAGTGGGTCTCAAAAC 398 SEQ ID NO: 323 hFANCD2_exon36_F
CCTCTGGTTCTGTTTTATACTG SEQ ID NO: 324 hFANCD2_exon37_R
TCTGGGCAACGAACAAGCAA 277 SEQ ID NO: 325 hFANCD2_exon37_F
CTTCCCAGGTAGTTCTAAGCA SEQ ID NO: 326 hFANCD2_exon38_R
AAGCCAGGACACTTGGTTTCT 274 SEQ ID NO: 327 hFANCD2_exon38_F
GCACTGGTTGCTACATCTAAG SEQ ID NO: 328 hFANCD2_exon39_R
GCATCCATTGCCTTCCCTAAA 236 SEQ ID NO: 329 hFANCD2_exon39_F
TGCTCAAAGGAGCAGATCTCA SEQ ID NO: 330 hFANCD2_exon40_R
CAGTCCAATTTGGGGATCTCT 309 SEQ ID NO: 331 hFANCD2_exon40_F
CCTTGGGCTGGATGAGACTA SEQ ID NO: 332 hFANCD2_exon41_R
CCCCAATAGCAACTGCAGATT 214 SEQ ID NO: 333 hFANCD2_exon41_F
GATTGCAAGGGTATCTTGAATC SEQ ID NO: 334 hFANCD2_exon42_R
GCTTAGGTGACCTTCCTTACA 356 SEQ ID NO: 335 hFANCD2_exon42_F
AACATACCGTTGGCCCATACT SEQ ID NO: 336 hFANCD2_exon43a_R
AGCATGATCTCGGCTCACCA 366 SEQ ID NO: 337 hFANCD2_exon43a_F
GTGGCTCATGCTTGTAATCCT SEQ ID NO: 338 hFANCD2_exon43b_R
TCAGTAGAGATGGGGTTTCAC 358 SEQ ID NO: 339 hFANCD2_exon43b_F
CTGCCACCTTAGAGAACTGAA SEQ ID NO: 340 hFANCD2_exon43c_R
CTCAAGCAATCCTCCTACCTT 405 SEQ ID NO: 341 hFANCD2_exon43c_F
TAGAATCACTCCTGAGTATCTC SEQ ID NO: 342 hFANCD2_exon43d_R
CAGCTTCTGACTCTGTGCTTT 367 SEQ ID NO: 343 hFANCD2_exon43d_F
AGTTGGTGGAGCAGAACTTTG SEQ ID NO: 344 hFANCD2_exon43e_R
CTCGAGATACTCAGGAGTGAT 381 SEQ ID NO: 345 hFANCD2_exon43e_F
TCAACCTTCTCCCCTATTACC SEQ ID NO: 346 hFANCD2_exon43f_R
AGTTCTGCTCCACCAACTTAG 306 SEQ ID NO: 347 hFANCD2_exon43f_F
GGTATCCATGTTTGCTGTGTTT SEQ ID NO: 348 hFANCD2_exon44_R
GAAAGGCAAACAGCGGATTTC 213 SEQ ID NO: 349 hFANCD2_exon44_F
CACCCAGAGCAGTAACCTAAA SEQ ID NO: 350
[0318] All patents, patent application, and published references
cited herein are hereby incorporated by reference in their
entirety. While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims.
Sequence CWU 1
1
35211451PRTHomo sapiens 1Met Val Ser Lys Arg Arg Leu Ser Lys Ser
Glu Asp Lys Glu Ser Leu 1 5 10 15 Thr Glu Asp Ala Ser Lys Thr Arg
Lys Gln Pro Leu Ser Lys Lys Thr 20 25 30 Lys Lys Ser His Ile Ala
Asn Ala Val Glu Glu Asn Asp Ser Ile Phe 35 40 45 Val Lys Leu Leu
Lys Ile Ser Gly Ile Ile Leu Lys Thr Gly Glu Ser 50 55 60 Gln Asn
Gln Leu Ala Val Asp Gln Ile Ala Phe Gln Lys Lys Leu Phe 65 70 75 80
Gln Thr Leu Arg Arg His Pro Ser Tyr Pro Lys Ile Ile Glu Glu Phe 85
90 95 Val Ser Gly Leu Glu Ser Tyr Ile Glu Asp Glu Asp Ser Phe Arg
Asn 100 105 110 Cys Leu Leu Ser Cys Glu Arg Leu Gln Asp Glu Glu Ala
Ser Met Gly 115 120 125 Ala Ser Tyr Ser Lys Ser Leu Ile Lys Leu Leu
Leu Gly Ile Asp Ile 130 135 140 Leu Gln Pro Ala Ile Ile Lys Thr Leu
Phe Glu Lys Leu Pro Glu Tyr 145 150 155 160 Phe Phe Glu Asn Arg Asn
Ser Asp Glu Ile Asn Ile Phe Arg Leu Ile 165 170 175 Val Ser Gln Leu
Lys Trp Leu Asp Arg Val Val Asp Gly Lys Asp Leu 180 185 190 Thr Thr
Lys Ile Met Gln Leu Ile Ser Ile Ala Pro Glu Asn Leu Gln 195 200 205
His Asp Ile Ile Thr Ser Lys Pro Glu Ile Leu Gly Asp Ser Gln His 210
215 220 Ala Asp Val Gly Lys Glu Leu Ser Asp Leu Leu Ile Glu Asn Thr
Ser 225 230 235 240 Leu Thr Val Pro Ile Leu Asp Val Leu Ser Ser Leu
Arg Leu Asp Pro 245 250 255 Asn Phe Leu Leu Lys Val Arg Gln Leu Val
Met Asp Lys Leu Ser Ser 260 265 270 Ile Arg Leu Glu Asp Leu Pro Val
Ile Ile Lys Phe Ile Leu His Ser 275 280 285 Val Thr Ala Met Asp Thr
Leu Glu Val Ile Ser Glu Leu Arg Glu Lys 290 295 300 Leu Asp Leu Gln
His Cys Val Leu Pro Ser Arg Leu Gln Ala Ser Gln 305 310 315 320 Val
Lys Leu Lys Ser Lys Gly Arg Ala Ser Ser Ser Gly Asn Gln Glu 325 330
335 Ser Ser Gly Gln Ser Cys Ile Ile Leu Leu Phe Asp Val Ile Lys Ser
340 345 350 Ala Ile Arg Tyr Glu Lys Thr Ile Ser Glu Ala Trp Ile Lys
Ala Ile 355 360 365 Glu Asn Thr Ala Ser Val Ser Glu His Lys Val Phe
Asp Leu Val Met 370 375 380 Leu Phe Ile Ile Val Ser Thr Asn Thr Gln
Thr Lys Lys Tyr Ile Asp 385 390 395 400 Arg Val Leu Arg Asn Lys Ile
Arg Ser Gly Cys Ile Gln Glu Gln Leu 405 410 415 Leu Gln Ser Thr Phe
Ser Val His Tyr Leu Val Leu Lys Asp Met Cys 420 425 430 Ser Ser Ile
Leu Ser Leu Ala Gln Ser Leu Leu His Ser Leu Asp Gln 435 440 445 Ser
Ile Ile Ser Phe Gly Ser Leu Leu Tyr Lys Tyr Ala Phe Lys Phe 450 455
460 Phe Asp Thr Tyr Cys Gln Gln Glu Val Val Gly Ala Leu Val Thr His
465 470 475 480 Ile Cys Ser Gly Asn Glu Ala Glu Val Asp Asp Ala Leu
Asp Val Leu 485 490 495 Leu Glu Leu Val Val Leu Asn Pro Ser Ala Met
Met Met Asn Ala Val 500 505 510 Phe Val Gln Gly Ile Leu Asp Tyr Leu
Asp Asn Ile Ser Pro Gln Gln 515 520 525 Ile Arg Lys Leu Phe Tyr Val
Leu Ser Thr Leu Ala Phe Ser Lys Gln 530 535 540 Asn Glu Ala Ser Ser
His Ile Gln Asp Asp Met His Leu Val Ile Arg 545 550 555 560 Lys Gln
Leu Ser Ser Thr Val Phe Lys Tyr Lys Leu Ile Gly Ile Ile 565 570 575
Gly Ala Val Thr Met Ala Gly Ile Met Ala Ala Asp Arg Ser Glu Ser 580
585 590 Pro Ser Leu Thr Gln Glu Arg Ala Asn Leu Ser Asp Glu Gln Cys
Thr 595 600 605 Gln Val Thr Ser Leu Leu Gln Leu Val His Ser Cys Ser
Glu Gln Ser 610 615 620 Pro Gln Ala Ser Ala Leu Tyr Tyr Asp Glu Phe
Ala Asn Leu Ile Gln 625 630 635 640 His Glu Lys Leu Asp Pro Lys Ala
Leu Glu Trp Val Gly His Thr Ile 645 650 655 Cys Asn Asp Phe Gln Asp
Ala Phe Val Val Asp Ser Cys Val Val Pro 660 665 670 Glu Gly Asp Phe
Pro Phe Pro Val Lys Ala Leu Tyr Gly Leu Glu Glu 675 680 685 Tyr Asp
Thr Gln Asp Gly Ile Ala Ile Asn Leu Leu Pro Leu Leu Phe 690 695 700
Ser Gln Asp Phe Ala Lys Asp Gly Gly Pro Val Thr Ser Gln Glu Ser 705
710 715 720 Gly Gly Lys Leu Val Ser Pro Leu Cys Leu Ala Pro Tyr Phe
Arg Leu 725 730 735 Leu Arg Leu Cys Val Glu Arg Gln His Asn Gly Asn
Leu Glu Glu Ile 740 745 750 Asp Gly Leu Leu Asp Cys Pro Ile Phe Leu
Thr Asp Leu Glu Pro Gly 755 760 765 Glu Lys Leu Glu Ser Met Ser Ala
Lys Glu Ala Ser Phe Met Cys Ser 770 775 780 Leu Ile Phe Leu Thr Leu
Asn Trp Phe Arg Glu Ile Val Asn Ala Phe 785 790 795 800 Cys Gln Glu
Thr Ser Pro Glu Asn Lys Gly Lys Val Leu Thr Arg Leu 805 810 815 Lys
His Ile Val Glu Leu Gln Ile Leu Leu Glu Lys Tyr Leu Ala Val 820 825
830 Thr Pro Asp Tyr Val Pro Pro Leu Gly Asn Phe Asp Val Glu Thr Leu
835 840 845 Asp Ile Thr Pro His Thr Val Thr Ala Ile Ser Ala Lys Ile
Arg Lys 850 855 860 Lys Gly Lys Ile Glu Arg Lys Gln Lys Thr Asp Gly
Ser Lys Thr Ser 865 870 875 880 Ser Ser Asp Thr Leu Ser Glu Glu Lys
Asn Ser Glu Cys Asp Pro Thr 885 890 895 Pro Ser His Arg Gly Gln Leu
Asn Lys Glu Phe Thr Gly Lys Glu Glu 900 905 910 Lys Thr Ser Leu Leu
Leu His Asn Ser His Ala Phe Phe Arg Glu Leu 915 920 925 Asp Ile Glu
Val Phe Ser Ile Leu His Cys Gly Leu Val Thr Lys Phe 930 935 940 Ile
Leu Asp Thr Glu Met His Thr Glu Ala Thr Glu Val Val Gln Leu 945 950
955 960 Gly Pro Pro Glu Leu Leu Phe Leu Leu Glu Asp Leu Ser Gln Lys
Leu 965 970 975 Glu Ser Met Leu Thr Pro Pro Ile Ala Arg Arg Val Pro
Phe Leu Lys 980 985 990 Asn Lys Gly Ser Arg Asn Ile Gly Phe Ser His
Leu Gln Gln Arg Ser 995 1000 1005 Ala Gln Glu Ile Val His Cys Val
Glu Gln Leu Leu Thr Pro Met 1010 1015 1020 Cys Asn His Leu Glu Asn
Ile His Asn Tyr Ile Gln Cys Leu Ala 1025 1030 1035 Ala Glu Asn His
Gly Val Val Asp Gly Pro Gly Val Lys Val Gln 1040 1045 1050 Glu Tyr
His Ile Met Ser Ser Cys Tyr Gln Arg Leu Leu Gln Ile 1055 1060 1065
Phe His Gly Leu Phe Ala Trp Ser Gly Phe Ser Gln Pro Glu Asn 1070
1075 1080 Gln Asn Leu Leu Tyr Ser Ala Leu His Val Leu Ser Ser Arg
Leu 1085 1090 1095 Lys Gln Gly Glu His Ser Gln Pro Leu Glu Glu Leu
Leu Ser Gln 1100 1105 1110 Ser Val His Tyr Leu Gln Asn Phe His Gln
Ser Ile Pro Ser Phe 1115 1120 1125 Gln Cys Ala Leu Tyr Leu Ile Arg
Leu Leu Met Val Ile Leu Glu 1130 1135 1140 Lys Ser Thr Ala Ser Ala
Gln Asn Lys Glu Lys Ile Ala Ser Leu 1145 1150 1155 Ala Arg Gln Phe
Leu Cys Arg Val Trp Pro Ser Gly Asp Lys Glu 1160 1165 1170 Lys Ser
Asn Ile Ser Asn Asp Gln Leu His Ala Leu Leu Cys Ile 1175 1180 1185
Tyr Leu Glu His Thr Glu Ser Ile Leu Lys Ala Ile Glu Glu Ile 1190
1195 1200 Ala Gln Val Gly Val Pro Glu Leu Ile Asn Ser Pro Lys Asp
Ala 1205 1210 1215 Ser Ser Ser Thr Phe Pro Thr Leu Thr Arg His Thr
Pro Val Val 1220 1225 1230 Phe Phe Arg Val Met Met Ala Glu Leu Glu
Lys Ile Val Lys Lys 1235 1240 1245 Ile Glu Pro Gly Thr Ala Ala Asp
Ser Gln Gln Ile His Glu Glu 1250 1255 1260 Lys Leu Leu Tyr Trp Asn
Met Ala Val Arg Asp Phe Ser Ile Leu 1265 1270 1275 Ile Asn Leu Ile
Lys Val Phe Asp Ser His Pro Val Leu His Val 1280 1285 1290 Cys Leu
Lys Val Gly Arg Leu Phe Val Glu Ala Phe Leu Lys Gln 1295 1300 1305
Cys Met Pro Leu Leu Asp Ile Ser Phe Arg Lys His Arg Glu Asp 1310
1315 1320 Val Leu Ser Leu Leu Glu Thr Phe Gln Leu Asp Thr Arg Leu
Leu 1325 1330 1335 His His Leu Cys Gly His Ser Lys Ile His Gln Asp
Thr Arg Leu 1340 1345 1350 Thr Gln His Val Pro Leu Leu Lys Lys Thr
Leu Glu Leu Leu Val 1355 1360 1365 Cys Arg Val Lys Ala Met Leu Thr
Leu Asn Asn Cys Arg Glu Ala 1370 1375 1380 Phe Trp Leu Gly Asn Leu
Lys Asn Arg Asp Leu Gln Gly Glu Glu 1385 1390 1395 Ile Lys Ser Gln
Asn Ser Gln Glu Ser Thr Ala Asp Glu Ser Glu 1400 1405 1410 Asp Asp
Met Ser Ser Gln Ala Ser Lys Ser Lys Ala Thr Glu Asp 1415 1420 1425
Gly Glu Glu Asp Glu Val Ser Ala Gly Glu Lys Glu Gln Asp Ser 1430
1435 1440 Asp Glu Ser Tyr Asp Asp Ser Asp 1445 1450
21269PRTDrosophila melanogaster 2Met Tyr Lys Gln Phe Lys Lys Arg
Ser Lys Lys Pro Leu Asn Thr Ile 1 5 10 15 Asp Glu Asn Ala Thr Ile
Lys Val Pro Arg Leu Ala Glu Thr Thr Thr 20 25 30 Asn Ile Ser Val
Glu Ser Ser Ser Gly Gly Ser Glu Glu Asn Ile Pro 35 40 45 Ala Ser
Gln Glu His Thr Gln Arg Phe Leu Ser Gln His Ser Val Ile 50 55 60
Leu Ala Ala Thr Leu Gly Ala Thr Gly Glu Ser Ser Arg Asp Ile Ala 65
70 75 80 Thr Leu Ser Arg Gln Pro Asn Asn Phe Phe Glu Leu Val Leu
Val Arg 85 90 95 Ala Gly Val Gln Leu Asp Gln Gly Asp Ser Leu Ile
Leu Ala Cys Asp 100 105 110 His Val Pro Ile Val Ser Lys Leu Ala Glu
Ile Phe Thr Ser Ala Ser 115 120 125 Ser Tyr Thr Asp Lys Met Glu Thr
Phe Lys Thr Gly Leu Asn Ala Ala 130 135 140 Met Ala Pro Gly Ser Lys
Leu Val Gln Lys Leu Leu Thr Gly Cys Thr 145 150 155 160 Val Asp Ala
Ala Gly Glu Glu Gln Ile Tyr Gln Ser Gln Asn Ser Met 165 170 175 Phe
Met Asn Phe Leu Met Ile Asp Phe Met Arg Asp Ala Cys Val Glu 180 185
190 Val Leu Leu Asn Lys Ile Glu Glu Val Ala Lys Ser Asp Arg Val Ile
195 200 205 Met Gly Lys Ala Ala Ile Pro Leu Pro Leu Leu Pro Leu Met
Leu Thr 210 215 220 Gln Leu Arg Tyr Leu Thr Ala Ser His Lys Val Glu
Ile Tyr Ser Arg 225 230 235 240 Ile Glu Val Ile Phe Asn Arg Ala Thr
Glu Ser Ala Lys Leu Asp Ile 245 250 255 Ile Ala Asn Ala Glu Leu Ile
Leu Asp Ala Ser Met His Asp Glu Phe 260 265 270 Val Glu Leu Leu Asn
Thr Glu Asp Leu Phe His Met Thr Thr Val Gln 275 280 285 Thr Leu Gly
Asn Leu Ser Leu Ser Asp Arg Thr Gln Ala Lys Leu Arg 290 295 300 Val
Arg Ile Leu Asp Phe Ala Thr Ser Gly Gln Cys Ser Asp Ala Ile 305 310
315 320 Leu Pro His Leu Ile Arg Leu Leu Leu Asn Val Leu Lys Ile Asp
Thr 325 330 335 Asp Asp Ser Val Arg Asp Leu Arg Arg Arg Arg Ile Lys
Leu Glu His 340 345 350 Ile Thr Val Ser Ile Leu Glu Glu Ile Gln His
Tyr Arg His Ile Leu 355 360 365 Glu Gln His Ile Thr Thr Leu Met Asn
Ile Leu His Asp Phe Met Arg 370 375 380 Glu Lys Asn Arg Ile Val Ser
Asp Phe Ala Lys Ser Ser Tyr Ser Ile 385 390 395 400 Leu Phe Lys Ile
Phe Asn Ser Ile Gln Lys Asn Ile Leu Lys Lys Leu 405 410 415 Leu Glu
Leu Thr Cys Asp Lys Ser Ser Pro His Leu Thr Thr His Ala 420 425 430
Leu Glu Leu Leu Arg Glu Leu Gln Arg Lys Ser Ala Lys Asp Val Gln 435
440 445 Asn Cys Ala Thr Leu Leu Ile Pro Met Leu Asp Arg Thr Ser Asp
Leu 450 455 460 Ser Leu Thr Gln Thr Arg Val Ala Met Asp Leu Leu Cys
His Val Ala 465 470 475 480 Phe Pro Asp Pro Asn Leu Ser Pro Cys Leu
Gln Leu Gln Glu Gln Val 485 490 495 Asp Met Val Val Lys Lys Gln Leu
Ile Asn Ser Ile Asp Asn Ile Lys 500 505 510 Lys Gln Gly Ile Ile Gly
Cys Val Gln Leu Ile Asp Ala Met Ala Arg 515 520 525 Ile Ala Asn Asn
Gly Val Asp Arg Asp Phe Phe Ile Ala Ser Val Glu 530 535 540 Asn Val
Asp Ser Leu Pro Asp Gly Arg Gly Lys Met Ala Ala Asn Leu 545 550 555
560 Ile Ile Arg Thr Glu Ala Ser Ile Gly Asn Ser Thr Glu Ser Leu Ala
565 570 575 Leu Phe Phe Glu Glu Leu Ala Thr Val Phe Asn Gln Arg Asn
Glu Gly 580 585 590 Thr Ser Gly Cys Glu Leu Asp Asn Gln Phe Ile Ala
Trp Ala Cys Asp 595 600 605 Leu Val Thr Phe Arg Phe Gln Ala Ser Phe
Val Thr Glu Asn Val Pro 610 615 620 Glu Thr Lys Ala Cys Asp Ser Ile
Tyr Val Leu Ala Pro Leu Phe Asn 625 630 635 640 Tyr Val Arg Val Leu
Tyr Lys His Arg His Gln Asp Ser Leu Glu Ser 645 650 655 Ile Asn Ala
Leu Leu Gly Cys Ala Ile Val Leu Pro Ser Phe Phe Glu 660 665 670 Asp
Asp Asn Tyr Val Ser Val Phe Glu Asn Phe Glu Ala Glu Gln Gln 675 680
685 Lys Asp Ile Leu Ser Ile Tyr Phe His Thr Val Asn Trp Met Arg Val
690 695 700 Ser Ile Ser Ala Phe Ala Ser Gln Arg Asp Pro Pro Thr Arg
Arg Arg 705 710 715 720 Val Leu Ser Arg Leu Gly Glu Leu Ile Arg Ile
Glu Gln Arg Met Lys 725 730 735 Pro Leu Leu Ala Arg Ala Pro Val Asp
Phe Val Ala Pro Pro Tyr Gln 740 745 750 Phe Leu Thr Asn Val Lys Leu
Ser Asn Gln Asn Gln Lys Arg Pro Gly 755 760 765 Pro Lys Pro Ala Ala
Lys Leu Asn Ala Thr Leu Pro Glu Pro Asp Leu 770 775 780 Thr Gly Asn
Gln Pro Ser Ile Ala Asp Phe Thr Ile Lys Val Gly Gln 785 790 795 800
Cys Lys Thr Val Lys Thr Lys Thr Asp Phe Glu Gln Met Tyr Gly Pro 805
810 815 Arg Glu Arg Tyr Arg Pro Met Glu Val Glu Ile Ile Met Leu Leu
Val
820 825 830 Glu Gln Lys Phe Val Leu Asn His Gln Leu Glu Glu Glu Gln
Met Gly 835 840 845 Glu Phe Leu Gly Leu Leu Glu Leu Arg Phe Leu Leu
Glu Asp Val Val 850 855 860 Gln Lys Leu Glu Ala Ala Val Leu Arg His
His Asp Ser Tyr Asp Ala 865 870 875 880 Asp Ser Phe Arg Pro His Leu
Ala Lys Pro Glu Asp Phe Ile Cys Asp 885 890 895 Leu Leu Pro Cys Leu
His Glu Val Asn Asn His Leu Ile Thr Leu Gly 900 905 910 Glu Ala Ile
Asp Asn Gln Leu Thr Glu Val Ser Ser His Val Tyr Ser 915 920 925 Asn
Leu Asp Leu Phe Lys Asp Gln Phe Cys Tyr Ile Lys Ser Cys Phe 930 935
940 Gly Leu Cys Val Arg Leu Phe Ala Leu Tyr Phe Ala Trp Ser Glu Trp
945 950 955 960 Ser Asp Lys Ser Gln Glu Gln Leu Leu His Arg Ile Leu
Cys Gly Thr 965 970 975 Leu Leu Arg Arg Lys Trp Phe His Tyr Ser Gly
Thr Leu Asp Lys Gly 980 985 990 Gly Gln Cys Asn Ile Tyr Leu Asp Glu
Leu Val Lys Gly Phe Leu Lys 995 1000 1005 Lys Ser Asn Ala Lys Ser
Gln Thr Glu Leu Leu Thr Glu Leu Val 1010 1015 1020 Lys Gln Cys Ser
Ile Leu Asn Thr Lys Asp Lys Ala Leu Thr Ser 1025 1030 1035 Phe Pro
Asn Phe Lys Lys Ala Asn Phe Pro Leu Leu Phe Arg Gly 1040 1045 1050
Leu Cys Glu Val Leu Ile His Ser Leu Ser Gly Gln Val Ser Val 1055
1060 1065 Asp Ser Arg Gly Asp Lys Leu Lys Leu Trp Glu Ser Ala Val
Asp 1070 1075 1080 Leu Leu Asn Gly Leu Leu Ser Ile Val Gln Gln Val
Glu Gln Pro 1085 1090 1095 Arg Asn Phe Gly Leu Phe Leu Lys His Ser
Leu Leu Phe Leu Lys 1100 1105 1110 Leu Leu Leu Gln His Gly Met Ser
Ala Leu Glu Ser Ile Val Arg 1115 1120 1125 Glu Asp Pro Glu Arg Leu
Thr Arg Phe Leu His Glu Leu Gln Lys 1130 1135 1140 Val Thr Arg Phe
Leu His Gln Leu Cys Cys His Ser Lys Ser Ile 1145 1150 1155 Lys Asn
Thr Ala Ile Ile Ser Tyr Ile Pro Ser Leu Arg Glu Thr 1160 1165 1170
Ile Glu Thr Leu Val Phe Arg Val Lys Ala Leu Leu Ala Ala Asn 1175
1180 1185 Asn Cys His Ser Ala Phe His Met Gly Asn Met Ile Asn Arg
Asp 1190 1195 1200 Leu His Gly Asp Ser Ile Ile Thr Pro Arg Ser Ser
Phe Ala Gly 1205 1210 1215 Glu Glu Asn Ser Asp Asp Glu Leu Pro Ala
Asp Asp Thr Ser Val 1220 1225 1230 Asp Glu Thr Val Leu Gly Asp Asp
Met Gly Ile Thr Ala Val Ser 1235 1240 1245 Val Ser Thr Arg Pro Ser
Asp Gly Ser Arg Arg Ser Lys Ser Ser 1250 1255 1260 Ser Arg Ser Lys
Cys Phe 1265 31286PRTArabidopsis thaliana 3Met Val Phe Leu Ser Arg
Lys Lys Pro Pro Pro Pro Pro Ser Ser Ser 1 5 10 15 Ser Ala Ala Pro
Ser Leu Lys Ile Pro Gln Pro Gln Lys Glu Ser Val 20 25 30 Glu Phe
Asp Ala Val Glu Lys Met Thr Ala Ile Leu Ala Glu Val Gly 35 40 45
Cys Thr Leu Met Asn Pro Tyr Gly Pro Pro Cys Leu Pro Ser Asp Leu 50
55 60 His Ala Phe Arg Arg Asn Leu Thr Gly Arg Leu Ser Ser Phe Ser
Ala 65 70 75 80 Asn Ser Gly Glu Arg Asp Asn Val Gly Ala Leu Cys Ser
Val Phe Val 85 90 95 Ala Gly Phe Ser Leu Tyr Ile Gln Ser Pro Ser
Asn Leu Arg Arg Met 100 105 110 Leu Ser Ser Ser Ser Thr Thr Lys Arg
Asp Glu Ser Leu Val Arg Asn 115 120 125 Leu Leu Leu Val Ser Pro Ile
Gln Leu Asp Ile Gln Glu Met Leu Leu 130 135 140 Glu Lys Leu Pro Glu
Tyr Phe Asp Val Val Thr Gly Cys Ser Leu Glu 145 150 155 160 Glu Asp
Val Ala Arg Leu Ile Ile Asn His Phe Arg Thr Leu Asp Phe 165 170 175
Ile Val Asn Pro His Val Phe Thr Asp Lys Leu Met Gln Val Leu Ser 180
185 190 Ile Cys Pro Leu Glu Leu Lys Lys Glu Ile Ile Gly Ser Leu Pro
Glu 195 200 205 Ile Ile Gly Asp His Asn Cys Gln Ala Val Val Asp Ser
Leu Glu Lys 210 215 220 Met Leu Gln Glu Asp Ser Ala Val Val Val Ala
Val Leu Asp Ser Phe 225 230 235 240 Ser Asn Leu Asn Leu Asp Asp Gln
Leu Gln Glu Gln Ala Ile Thr Val 245 250 255 Ala Ile Ser Cys Ile Arg
Thr Ile Asp Gly Glu His Met Pro Tyr Leu 260 265 270 Leu Arg Phe Leu
Leu Leu Ala Ala Thr Pro Val Asn Val Arg Arg Ile 275 280 285 Ile Ser
Gln Ile Arg Glu Gln Leu Lys Phe Thr Gly Met Ser Gln Pro 290 295 300
Cys Ala Ser Gln Asn Lys Leu Lys Gly Lys Val Pro Ala Tyr Asn Ala 305
310 315 320 Glu Gly Ser Ile Leu His Ala Leu Arg Ser Ser Leu Arg Phe
Lys Asn 325 330 335 Ile Leu Cys Gln Glu Ile Ile Lys Glu Leu Asn Ser
Leu Glu Lys Pro 340 345 350 Arg Asp Phe Lys Val Ile Asp Val Trp Leu
Leu Ile Asp Met Tyr Met 355 360 365 Asn Gly Asp Pro Val Arg Lys Ser
Ile Glu Lys Ile Phe Lys Lys Lys 370 375 380 Val Val Asp Glu Cys Ile
Gln Glu Ala Leu Leu Asp Gln Cys Ile Gly 385 390 395 400 Gly Asn Lys
Glu Phe Val Lys Ile Leu Gly Ala Leu Val Thr His Val 405 410 415 Gly
Ser Asp Asn Lys Phe Glu Val Ser Ser Val Leu Glu Met Met Thr 420 425
430 Ala Leu Val Lys Lys Tyr Ala Gln Gln Leu Leu Pro Phe Ser Ser His
435 440 445 Ile Asn Gly Ile Ser Gly Thr Cys Ile Leu Asp Tyr Leu Glu
Gly Phe 450 455 460 Thr Ile Asp Asn Leu His Lys Thr Tyr Ser Gln Val
Tyr Glu Val Phe 465 470 475 480 Ser Leu Leu Ala Leu Ser Ala Arg Ala
Ser Gly Asp Ser Phe Arg Ser 485 490 495 Ser Thr Ser Asn Glu Leu Met
Met Ile Val Arg Lys Gln Leu Thr Pro 500 505 510 Ser Cys Leu Val Leu
Tyr Trp Gln Val Ser His Pro Asp Leu Lys Tyr 515 520 525 Lys Lys Met
Gly Leu Val Gly Ser Leu Arg Ile Val Ser Ser Leu Gly 530 535 540 Asp
Ala Lys Ser Val Pro Asp Phe Ser Ser Ser Gln Val Glu Arg Leu 545 550
555 560 Thr Asn Asp Gly Ser Leu Ala Gly Val Asp Ala Leu Leu Gly Cys
Pro 565 570 575 Leu His Leu Pro Ser Ser Lys Leu Val Gly Ser Leu Trp
Gly Arg Ser 580 585 590 Arg Lys Lys Ser Ser Pro Ser Arg Tyr Ile Met
Leu Gln Thr Gly Tyr 595 600 605 Glu Asn Ser Leu Val Thr Leu Pro Cys
Ile Phe Cys Asp Leu Leu Asn 610 615 620 Ala Phe Ser Ser Gln Ile Asp
Glu Lys Ile Gly Cys Ile Ser Gln Ala 625 630 635 640 Thr Val Lys Asp
Val Thr Thr Lys Leu Leu Lys Arg Leu Arg Asn Leu 645 650 655 Val Phe
Leu Glu Ser Leu Leu Ser Asn Leu Ile Thr Leu Ser Pro Gln 660 665 670
Ser Leu Pro Glu Leu His Pro Tyr Ser Glu Ser His Val Glu His Pro 675
680 685 Arg Lys Lys Asn Glu Lys Arg Lys Leu Asp Asp Asp Ala Ser Gln
Arg 690 695 700 Lys Val Ser Met Lys Asn Asn Leu Lys Lys Ser Lys His
Ser Asp Val 705 710 715 720 Asn Glu Lys Leu Arg Gln Pro Thr Ile Met
Asp Ala Phe Lys Lys Ala 725 730 735 Gly Ala Val Met Ser His Ser Gln
Thr Gln Leu Arg Gly Thr Pro Ser 740 745 750 Leu Pro Ser Met Asp Gly
Ser Thr Ala Ala Gly Ser Met Asp Glu Asn 755 760 765 Cys Ser Asp Asn
Glu Ser Leu Ile Val Lys Ile Pro Gln Val Ser Ser 770 775 780 Ala Leu
Glu Ala Gln Pro Phe Lys Phe Arg Pro Leu Leu Pro Gln Cys 785 790 795
800 Leu Ser Ile Leu Asn Phe Pro Lys Val Leu Ser Gln Asp Met Gly Ser
805 810 815 Pro Glu Tyr Arg Ala Glu Leu Pro Leu Tyr Leu Tyr Leu Leu
His Asp 820 825 830 Leu His Thr Lys Leu Asp Cys Leu Val Pro Pro Gly
Lys Gln His Pro 835 840 845 Phe Lys Arg Gly Ser Ala Pro Gly Tyr Phe
Gly Arg Phe Lys Leu Val 850 855 860 Glu Leu Leu Asn Gln Ile Lys Arg
Leu Phe Pro Ser Leu Asn Ile Lys 865 870 875 880 Leu Asn Ile Ala Ile
Ser Leu Leu Ile Arg Gly Asp Glu Thr Ser Gln 885 890 895 Thr Thr Trp
Arg Asp Glu Phe Ala Leu Ser Gly Asn Pro Asn Thr Ser 900 905 910 Ser
Ile Val Val Ser Glu Ser Leu Val Tyr Thr Met Val Cys Lys Glu 915 920
925 Val Leu Tyr Cys Phe Ser Lys Ile Leu Thr Leu Pro Glu Phe Glu Thr
930 935 940 Asp Lys Ser Leu Leu Leu Asn Leu Leu Glu Ala Phe Gln Pro
Thr Glu 945 950 955 960 Ile Pro Val Ala Asn Phe Pro Asp Phe Gln Pro
Phe Pro Ser Pro Gly 965 970 975 Thr Lys Glu Tyr Leu Tyr Ile Gly Val
Ser Tyr Phe Phe Glu Asp Ile 980 985 990 Leu Asn Lys Gly Asn Tyr Phe
Cys Ser Phe Thr Asp Asp Phe Pro Tyr 995 1000 1005 Pro Cys Ser Phe
Ser Phe Asp Leu Ala Phe Glu Cys Leu Leu Thr 1010 1015 1020 Leu Gln
Leu Val Val Thr Ser Val Gln Lys Tyr Leu Gly Lys Val 1025 1030 1035
Ser Glu Glu Ala Asn Arg Lys Arg Asn Pro Gly His Phe His Gly 1040
1045 1050 Leu Val Pro Asn Leu His Ala Lys Leu Gly Thr Ser Ala Glu
Lys 1055 1060 1065 Leu Leu Arg His Lys Trp Val Asp Glu Ser Thr Asp
Asn Lys Gly 1070 1075 1080 Leu Lys Asn Lys Val Cys Pro Phe Val Ser
Asn Leu Arg Ile Val 1085 1090 1095 Gln Phe Thr Gly Glu Met Val Gln
Thr Ile Leu Arg Ile Tyr Leu 1100 1105 1110 Glu Ala Ser Gly Ser Thr
Ser Asp Leu Leu Asp Glu Leu Ala Cys 1115 1120 1125 Thr Ile Leu Pro
Gln Ala Ser Leu Ser Lys Ser Thr Gly Glu Asp 1130 1135 1140 Asp Asp
Ala Arg Asp His Glu Phe Pro Thr Leu Cys Ala Ala Thr 1145 1150 1155
Phe Arg Gly Trp Tyr Lys Thr Leu Leu Glu Glu Asn Leu Ala Ile 1160
1165 1170 Leu Asn Lys Leu Val Lys Thr Val Ser Ser Glu Lys Arg Gly
Asn 1175 1180 1185 Cys Gln Pro Lys Thr Thr Glu Ala His Leu Lys Asn
Ile Gln Lys 1190 1195 1200 Thr Val Asn Val Val Val Ser Leu Val Asn
Leu Cys Arg Ser His 1205 1210 1215 Glu Lys Val Thr Ile His Gly Met
Ala Ile Lys Tyr Gly Gly Lys 1220 1225 1230 Tyr Val Asp Ser Phe Leu
Lys Gly Ser Leu Lys His Lys Asp Leu 1235 1240 1245 Arg Gly Gln Ile
Val Ser Ser Gln Ala Tyr Ile Asp Asn Glu Ala 1250 1255 1260 Asp Glu
Val Glu Glu Thr Met Ser Gly Glu Glu Glu Pro Met Gln 1265 1270 1275
Glu Asp Glu Leu Pro Leu Thr Pro 1280 1285 41471PRTHomo sapiens 4Met
Val Ser Lys Arg Arg Leu Ser Lys Ser Glu Asp Lys Glu Ser Leu 1 5 10
15 Thr Glu Asp Ala Ser Lys Thr Arg Lys Gln Pro Leu Ser Lys Lys Thr
20 25 30 Lys Lys Ser His Ile Ala Asn Ala Val Glu Glu Asn Asp Ser
Ile Phe 35 40 45 Val Lys Leu Leu Lys Ile Ser Gly Ile Ile Leu Lys
Thr Gly Glu Ser 50 55 60 Gln Asn Gln Leu Ala Val Asp Gln Ile Ala
Phe Gln Lys Lys Leu Phe 65 70 75 80 Gln Thr Leu Arg Arg His Pro Ser
Tyr Pro Lys Ile Ile Glu Glu Phe 85 90 95 Val Ser Gly Leu Glu Ser
Tyr Ile Glu Asp Glu Asp Ser Phe Arg Asn 100 105 110 Cys Leu Leu Ser
Cys Glu Arg Leu Gln Asp Glu Glu Ala Ser Met Gly 115 120 125 Ala Ser
Tyr Ser Lys Ser Leu Ile Lys Leu Leu Leu Gly Ile Asp Ile 130 135 140
Leu Gln Pro Ala Ile Ile Lys Thr Leu Phe Glu Lys Leu Pro Glu Tyr 145
150 155 160 Phe Phe Glu Asn Arg Asn Ser Asp Glu Ile Asn Ile Phe Arg
Leu Ile 165 170 175 Val Ser Gln Leu Lys Trp Leu Asp Arg Val Val Asp
Gly Lys Asp Leu 180 185 190 Thr Thr Lys Ile Met Gln Leu Ile Ser Ile
Ala Pro Glu Asn Leu Gln 195 200 205 His Asp Ile Ile Thr Ser Lys Pro
Glu Ile Leu Gly Asp Ser Gln His 210 215 220 Ala Asp Val Gly Lys Glu
Leu Ser Asp Leu Leu Ile Glu Asn Thr Ser 225 230 235 240 Leu Thr Val
Pro Ile Leu Asp Val Leu Ser Ser Leu Arg Leu Asp Pro 245 250 255 Asn
Phe Leu Leu Lys Val Arg Gln Leu Val Met Asp Lys Leu Ser Ser 260 265
270 Ile Arg Leu Glu Asp Leu Pro Val Ile Ile Lys Phe Ile Leu His Ser
275 280 285 Val Thr Ala Met Asp Thr Leu Glu Val Ile Ser Glu Leu Arg
Glu Lys 290 295 300 Leu Asp Leu Gln His Cys Val Leu Pro Ser Arg Leu
Gln Ala Ser Gln 305 310 315 320 Val Lys Leu Lys Ser Lys Gly Arg Ala
Ser Ser Ser Gly Asn Gln Glu 325 330 335 Ser Ser Gly Gln Ser Cys Ile
Ile Leu Leu Phe Asp Val Ile Lys Ser 340 345 350 Ala Ile Arg Tyr Glu
Lys Thr Ile Ser Glu Ala Trp Ile Lys Ala Ile 355 360 365 Glu Asn Thr
Ala Ser Val Ser Glu His Lys Val Phe Asp Leu Val Met 370 375 380 Leu
Phe Ile Ile Val Ser Thr Asn Thr Gln Thr Lys Lys Tyr Ile Asp 385 390
395 400 Arg Val Leu Arg Asn Lys Ile Arg Ser Gly Cys Ile Gln Glu Gln
Leu 405 410 415 Leu Gln Ser Thr Phe Ser Val His Tyr Leu Val Leu Lys
Asp Met Cys 420 425 430 Ser Ser Ile Leu Ser Leu Ala Gln Ser Leu Leu
His Ser Leu Asp Gln 435 440 445 Ser Ile Ile Ser Phe Gly Ser Leu Leu
Tyr Lys Tyr Ala Phe Lys Phe 450 455 460 Phe Asp Thr Tyr Cys Gln Gln
Glu Val Val Gly Ala Leu Val Thr His 465 470 475 480 Ile Cys Ser Gly
Asn Glu Ala Glu Val Asp Asp Ala Leu Asp Val Leu 485 490 495 Leu Glu
Leu Val Val Leu Asn Pro Ser Ala Met Met Met Asn Ala Val 500 505 510
Phe Val Gln Gly Ile Leu Asp Tyr Leu Asp Asn Ile Ser Pro Gln Gln 515
520 525 Ile Arg Lys Leu Phe Tyr Val Leu Ser Thr Leu Ala Phe Ser Lys
Gln 530 535
540 Asn Glu Ala Ser Ser His Ile Gln Asp Asp Met His Leu Val Ile Arg
545 550 555 560 Lys Gln Leu Ser Ser Thr Val Phe Lys Tyr Lys Leu Ile
Gly Ile Ile 565 570 575 Gly Ala Val Thr Met Ala Gly Ile Met Ala Ala
Asp Arg Ser Glu Ser 580 585 590 Pro Ser Leu Thr Gln Glu Arg Ala Asn
Leu Ser Asp Glu Gln Cys Thr 595 600 605 Gln Val Thr Ser Leu Leu Gln
Leu Val His Ser Cys Ser Glu Gln Ser 610 615 620 Pro Gln Ala Ser Ala
Leu Tyr Tyr Asp Glu Phe Ala Asn Leu Ile Gln 625 630 635 640 His Glu
Lys Leu Asp Pro Lys Ala Leu Glu Trp Val Gly His Thr Ile 645 650 655
Cys Asn Asp Phe Gln Asp Ala Phe Val Val Asp Ser Cys Val Val Pro 660
665 670 Glu Gly Asp Phe Pro Phe Pro Val Lys Ala Leu Tyr Gly Leu Glu
Glu 675 680 685 Tyr Asp Thr Gln Asp Gly Ile Ala Ile Asn Leu Leu Pro
Leu Leu Phe 690 695 700 Ser Gln Asp Phe Ala Lys Asp Gly Gly Pro Val
Thr Ser Gln Glu Ser 705 710 715 720 Gly Gly Lys Leu Val Ser Pro Leu
Cys Leu Ala Pro Tyr Phe Arg Leu 725 730 735 Leu Arg Leu Cys Val Glu
Arg Gln His Asn Gly Asn Leu Glu Glu Ile 740 745 750 Asp Gly Leu Leu
Asp Cys Pro Ile Phe Leu Thr Asp Leu Glu Pro Gly 755 760 765 Glu Lys
Leu Glu Ser Met Ser Ala Lys Glu Ala Ser Phe Met Cys Ser 770 775 780
Leu Ile Phe Leu Thr Leu Asn Trp Phe Arg Glu Ile Val Asn Ala Phe 785
790 795 800 Cys Gln Glu Thr Ser Pro Glu Asn Lys Gly Lys Val Leu Thr
Arg Leu 805 810 815 Lys His Ile Val Glu Leu Gln Ile Leu Leu Glu Lys
Tyr Leu Ala Val 820 825 830 Thr Pro Asp Tyr Val Pro Pro Leu Gly Asn
Phe Asp Val Glu Thr Leu 835 840 845 Asp Ile Thr Pro His Thr Val Thr
Ala Ile Ser Ala Lys Ile Arg Lys 850 855 860 Lys Gly Lys Ile Glu Arg
Lys Gln Lys Thr Asp Gly Ser Lys Thr Ser 865 870 875 880 Ser Ser Asp
Thr Leu Ser Glu Glu Lys Asn Ser Glu Cys Asp Pro Thr 885 890 895 Pro
Ser His Arg Gly Gln Leu Asn Lys Glu Phe Thr Gly Lys Glu Glu 900 905
910 Lys Thr Ser Leu Leu Leu His Asn Ser His Ala Phe Phe Arg Glu Leu
915 920 925 Asp Ile Glu Val Phe Ser Ile Leu His Cys Gly Leu Val Thr
Lys Phe 930 935 940 Ile Leu Asp Thr Glu Met His Thr Glu Ala Thr Glu
Val Val Gln Leu 945 950 955 960 Gly Pro Pro Glu Leu Leu Phe Leu Leu
Glu Asp Leu Ser Gln Lys Leu 965 970 975 Glu Ser Met Leu Thr Pro Pro
Ile Ala Arg Arg Val Pro Phe Leu Lys 980 985 990 Asn Lys Gly Ser Arg
Asn Ile Gly Phe Ser His Leu Gln Gln Arg Ser 995 1000 1005 Ala Gln
Glu Ile Val His Cys Val Glu Gln Leu Leu Thr Pro Met 1010 1015 1020
Cys Asn His Leu Glu Asn Ile His Asn Tyr Ile Gln Cys Leu Ala 1025
1030 1035 Ala Glu Asn His Gly Val Val Asp Gly Pro Gly Val Lys Val
Gln 1040 1045 1050 Glu Tyr His Ile Met Ser Ser Cys Tyr Gln Arg Leu
Leu Gln Ile 1055 1060 1065 Phe His Gly Leu Phe Ala Trp Ser Gly Phe
Ser Gln Pro Glu Asn 1070 1075 1080 Gln Asn Leu Leu Tyr Ser Ala Leu
His Val Leu Ser Ser Arg Leu 1085 1090 1095 Lys Gln Gly Glu His Ser
Gln Pro Leu Glu Glu Leu Leu Ser Gln 1100 1105 1110 Ser Val His Tyr
Leu Gln Asn Phe His Gln Ser Ile Pro Ser Phe 1115 1120 1125 Gln Cys
Ala Leu Tyr Leu Ile Arg Leu Leu Met Val Ile Leu Glu 1130 1135 1140
Lys Ser Thr Ala Ser Ala Gln Asn Lys Glu Lys Ile Ala Ser Leu 1145
1150 1155 Ala Arg Gln Phe Leu Cys Arg Val Trp Pro Ser Gly Asp Lys
Glu 1160 1165 1170 Lys Ser Asn Ile Ser Asn Asp Gln Leu His Ala Leu
Leu Cys Ile 1175 1180 1185 Tyr Leu Glu His Thr Glu Ser Ile Leu Lys
Ala Ile Glu Glu Ile 1190 1195 1200 Ala Gln Val Gly Val Pro Glu Leu
Ile Asn Ser Pro Lys Asp Ala 1205 1210 1215 Ser Ser Ser Thr Phe Pro
Thr Leu Thr Arg His Thr Pro Val Val 1220 1225 1230 Phe Phe Arg Val
Met Met Ala Glu Leu Glu Lys Ile Val Lys Lys 1235 1240 1245 Ile Glu
Pro Gly Thr Ala Ala Asp Ser Gln Gln Ile His Glu Glu 1250 1255 1260
Lys Leu Leu Tyr Trp Asn Met Ala Val Arg Asp Phe Ser Ile Leu 1265
1270 1275 Ile Asn Leu Ile Lys Val Phe Asp Ser His Pro Val Leu His
Val 1280 1285 1290 Cys Leu Lys Val Gly Arg Leu Phe Val Glu Ala Phe
Leu Lys Gln 1295 1300 1305 Cys Met Pro Leu Leu Asp Ile Ser Phe Arg
Lys His Arg Glu Asp 1310 1315 1320 Val Leu Ser Leu Leu Glu Thr Phe
Gln Leu Asp Thr Arg Leu Leu 1325 1330 1335 His His Leu Cys Gly His
Ser Lys Ile His Gln Asp Thr Arg Leu 1340 1345 1350 Thr Gln His Val
Pro Leu Leu Lys Lys Thr Leu Glu Leu Leu Val 1355 1360 1365 Cys Arg
Val Lys Ala Met Leu Thr Leu Asn Asn Cys Arg Glu Ala 1370 1375 1380
Phe Trp Leu Gly Asn Leu Lys Asn Arg Asp Leu Gln Gly Glu Glu 1385
1390 1395 Ile Lys Ser Gln Asn Ser Gln Glu Ser Thr Ala Asp Glu Ser
Glu 1400 1405 1410 Asp Asp Met Ser Ser Gln Ala Ser Lys Ser Lys Ala
Thr Glu Val 1415 1420 1425 Ser Leu Gln Asn Pro Pro Glu Ser Gly Thr
Asp Gly Cys Ile Leu 1430 1435 1440 Leu Ile Val Leu Ser Trp Trp Ser
Arg Thr Leu Pro Thr Tyr Val 1445 1450 1455 Tyr Cys Gln Met Leu Leu
Cys Pro Phe Pro Phe Pro Pro 1460 1465 1470 55189DNAHomo sapiens
5tcgaaaacta cgggcggcga cggcttctcg gaagtaattt aagtgcacaa gacattggtc
60aaaatggttt ccaaaagaag actgtcaaaa tctgaggata aagagagcct gacagaagat
120gcctccaaaa ccaggaagca accactttcc aaaaagacaa agaaatctca
tattgctaat 180gaagttgaag aaaatgacag catctttgta aagcttctta
agatatcagg aattattctt 240aaaacgggag agagtcagaa tcaactagct
gtggatcaaa tagctttcca aaagaagctc 300tttcagaccc tgaggagaca
cccttcctat cccaaaataa tagaagaatt tgttagtggc 360ctggagtctt
acattgagga tgaagacagt ttcaggaact gccttttgtc ttgtgagcgt
420ctgcaggatg aggaagccag tatgggtgca tcttattcta agagtctcat
caaactgctt 480ctggggattg acatactgca gcctgccatt atcaaaacct
tatttgagaa gttgccagaa 540tatttttttg aaaacaagaa cagtgatgaa
atcaacatac ctcgactcat tgtcagtcaa 600ctaaaatggc ttgacagagt
tgtggatggc aaggacctca ccaccaagat catgcagctg 660atcagtattg
ctccagagaa cctgcagcat gacatcatca ccagcctacc tgagatccta
720ggggattccc agcacgctga tgtggggaaa gaactcagtg acctactgat
agagaatact 780tcactcactg tcccaatcct ggatgtcctt tcaagcctcc
gacttgaccc aaacttccta 840ttgaaggttc gccagttggt gatggataag
ttgtcgtcta ttagattgga ggatttacct 900gtgataataa agttcattct
tcattccgta acagccatgg atacacttga ggtaatttct 960gagcttcggg
agaagttgga tctgcagcat tgtgttttgc catcacggtt acaggcttcc
1020caagtaaagt tgaaaagtaa aggacgagca agttcctcag gaaatcaaga
aagcagcggt 1080cagagctgta ttattctcct ctttgatgta ataaagtcag
ctattagata tgagaaaacc 1140atttcagaag cctggattaa ggcaattgaa
aacactgcct cagtatctga acacaaggtg 1200tttgacctgg tgatgctttt
catcatctat agcaccaata ctcagacaaa gaagtacatt 1260gacagggtgc
taagaaataa gattcgatca ggctgcattc aagaacagct gctccagagt
1320acattctctg ttcattactt agttcttaag gatatgtgtt catccattct
gtcgctggct 1380cagagtttgc ttcactctct agaccagagt ataatttcat
ttggcagtct cctatacaaa 1440tatgcattta agttttttga cacgtactgc
cagcaggaag tggttggtgc cttagtgacc 1500catatctgca gtgggaatga
agctgaagtt gatactgcct tagatgtcct tctagagttg 1560gtagtgttaa
acccatctgc tatgatgatg aatgctgtct ttgtaaaggg cattttagat
1620tatctggata acatatcccc tcagcaaata cgaaaactct tctatgttct
cagcacactg 1680gcatttagca aacagaatga agccagcagc cacatccagg
atgacatgca cttggtgata 1740agaaagcagc tctctagcac cgtattcaag
tacaagctca ttgggattat tggtgctgtg 1800accatggctg gcatcatggc
ggcagacaga agtgaatcac ctagtttgac ccaagagaga 1860gccaacctga
gcgatgagca gtgcacacag gtgacctcct tgttgcagtt ggttcattcc
1920tgcagtgagc agtctcctca ggcctctgca ctttactatg atgaatttgc
caacctgatc 1980caacatgaaa agctggatcc aaaagccctg gaatgggttg
ggcataccat ctgtaatgat 2040ttccaggatg ccttcgtagt ggactcctgt
gttgttccgg aaggtgactt tccatttcct 2100gtgaaagcac tgtacggact
ggaagaatac gacactcagg atgggattgc cataaacctc 2160ctgccgctgc
tgttttctca ggactttgca aaagatgggg gtccggtgac ctcacaggaa
2220tcaggccaaa aattggtgtc tccgctgtgc ctggctccgt atttccggtt
actgagactt 2280tgtgtggaga gacagcataa cggaaacttg gaggagattg
atggtctact agattgtcct 2340atattcctaa ctgacctgga gcctggagag
aagttggagt ccatgtctgc taaagagcgt 2400tcattcatgt gttctctcat
atttcttact ctcaactggt tccgagagat tgtaaatgcc 2460ttctgccagg
aaacatcacc tgagatgaag gggaaggtgc tcactcggtt aaagcacatt
2520gtagaattgc aaataatcct ggaaaagtac ttggcagtca ccccagacta
tgtccctcct 2580cttggaaact ttgatgtgga aactttagat ataacacctc
atactgttac tgctatttca 2640gcaaaaatca gaaagaaagg aaaaatagaa
aggaaacaaa aaacagatgg cagcaagaca 2700tcctcctctg acacactttc
agaagagaaa aattcagaat gtgaccctac gccatctcat 2760agaggccagc
taaacaagga gttcacaggg aaggaagaaa agacatcatt gttactacat
2820aattcccatg cttttttccg agagctggac attgaggtct tctctattct
acattgtgga 2880cttgtgacga agttcatctt agatactgaa atgcacactg
aagctacaga agttgtgcaa 2940cttgggcccc ctgagctgct tttcttgctg
gaagatctct cccagaagct ggagagtatg 3000ctgacacctc ctattgccag
gagagtcccc tttctcaaga acaaaggaag ccggaatatt 3060ggattctcac
atctccaaca gagatctgcc caagaaattg ttcattgtgt ttttcaactg
3120ctgaccccaa tgtgtaacca cctggagaac attcacaact attttcagtg
tttagctgct 3180gagaatcacg gtgtagttga tggaccagga gtgaaagttc
aggagtacca cataatgtct 3240tcctgctatc agaggctgct gcagattttt
catgggcttt ttgcttggag tggattttct 3300caacctgaaa atcagaattt
actgtattca gccctccatg tccttagtag ccgactgaaa 3360cagggagaac
acagccagcc tttggaggaa ctactcagcc agagcgtcca ttacttgcag
3420aatttccatc aaagcattcc cagtttccag tgtgctcttt atctcatcag
acttttgatg 3480gttattttgg agaaatcaac agcttctgct cagaacaaag
aaaaaattgc ttcccttgcc 3540agacaattcc tctgtcgggt gtggccaagt
ggggataaag agaagagcaa catctctaat 3600gaccagctcc atgctctgct
ctgtatctac ctggagcaca cagagagcat tctgaaggcc 3660atagaggaga
ttgctggtgt tggtgtccca gaactgatca actctcctaa agatgcatct
3720tcctccacat tccctacact gaccaggcat acttttgttg ttttcttccg
tgtgatgatg 3780gctgaactag agaagacggt gaaaaaaatt gagcctggca
cagcagcaga ctcgcagcag 3840attcatgaag agaaactcct ctactggaac
atggctgttc gagacttcag tatcctcatc 3900aacttgataa aggtatttga
tagtcatcct gttctgcatg tatgtttgaa gtatgggcgt 3960ctctttgtgg
aagcatttct gaagcaatgt atgccgctcc tagacttcag ttttagaaaa
4020caccgggaag atgttctgag cttactggaa accttccagt tggacacaag
gctgcttcat 4080cacctgtgtg ggcattccaa gattcaccag gacacgagac
tcacccaaca tgtgcctctg 4140ctcaaaaaga ccctggaact tttagtttgc
agagtcaaag ctatgctcac tctcaacaat 4200tgtagagagg ctttctggct
gggcaatcta aaaaaccggg acttgcaggg tgaagagatt 4260aagtcccaaa
attcccagga gagcacagca gatgagagtg aggatgacat gtcatcccag
4320gcctccaaga gcaaagccac tgaggtatct ctacaaaacc caccagagtc
tggcactgat 4380ggttgcattt tgttaattgt tctaagttgg tggagcagaa
ctttgcctac ttatgtttat 4440tgtcaaatgc ttctatgccc atttccattc
cctccataac agcttctgtg cttatataat 4500ttttgggacc cagaagaaac
aacgacacaa tcttagaatc actcctgagt atctcgagtt 4560gtggcatttg
ttatagagtt gacaattttc tgcattatag cctctcattt tccatgaatt
4620catatctgaa accattttag aagggagaag tcatcgaagt attttctgag
tgttgagaag 4680aatgagttaa accatttaaa cacatttgaa acatacaaaa
atagaaatgt gaaagcattt 4740ggtgaaagcc aaagcacaga gtcagaagct
gccaccttag agaactgaaa taaaaataga 4800agttcttacg cttttttgtg
gtacagatgc tttcgacaat ttaaagaaag ctaaataaaa 4860atgtagacat
ggctggcgca gtggctcatg cttgtaatcc tagcactttt tgaggccaag
4920gtaggaggat tgcttgagtc cgggagctca aggcaaagct gcacaacata
acaagaccct 4980atctccacaa aaaaaatgaa aaataaacct gggtgcggtg
gctcacacct gtaatcccag 5040cactttggga ggccgatgtg ggcagatcac
aaggtcagga ggtcaagacc agcctggcca 5100acatagtgaa accccatctc
tactgaaaat acaaaaatta gctgggtgtg gtggcacgtg 5160cctgttatct
cagctacttg ggaagctga 518965194DNAHomo sapiens 6tagaatcgaa
aactacgggc ggcgacggct tctcggaagt aatttaagtg cacaagacat 60tggtcaaaat
ggtttccaaa agaagactgt caaaatctga ggataaagag agcctgacag
120aagatgcctc caaaaccagg aagcaaccac tttccaaaaa gacaaagaaa
tctcatattg 180ctaatgaagt tgaagaaaat gacagcatct ttgtaaagct
tcttaagata tcaggaatta 240ttcttaaaac gggagagagt cagaatcaac
tagctgtgga tcaaatagct ttccaaaaga 300agctctttca gaccctgagg
agacaccctt cctatcccaa aataatagaa gaatttgtta 360gtggcctgga
gtcttacatt gaggatgaag acagtttcag gaactgcctt ttgtcttgtg
420agcgtctgca ggatgaggaa gccagtatgg gtgcatctta ttctaagagt
ctcatcaaac 480tgcttctggg gattgacata ctgcagcctg ccattatcaa
aaccttattt gagaagttgc 540cagaatattt ttttgaaaac aagaacagtg
atgaaatcaa catacctcga ctcattgtca 600gtcaactaaa atggcttgac
agagttgtgg atggcaagga cctcaccacc aagatcatgc 660agctgatcag
tattgctcca gagaacctgc agcatgacat catcaccagc ctacctgaga
720tcctagggga ttcccagcac gctgatgtgg ggaaagaact cagtgaccta
ctgatagaga 780atacttcact cactgtccca atcctggatg tcctttcaag
cctccgactt gacccaaact 840tcctattgaa ggttcgccag ttggtgatgg
ataagttgtc gtctattaga ttggaggatt 900tacctgtgat aataaagttc
attcttcatt ccgtaacagc catggataca cttgaggtaa 960tttctgagct
tcgggagaag ttggatctgc agcattgtgt tttgccatca cggttacagg
1020cttcccaagt aaagttgaaa agtaaaggac gagcaagttc ctcaggaaat
caagaaagca 1080gcggtcagag ctgtattatt ctcctctttg atgtaataaa
gtcagctatt agatatgaga 1140aaaccatttc agaagcctgg attaaggcaa
ttgaaaacac tgcctcagta tctgaacaca 1200aggtgtttga cctggtgatg
cttttcatca tctatagcac caatactcag acaaagaagt 1260acattgacag
ggtgctaaga aataagattc gatcaggctg cattcaagaa cagctgctcc
1320agagtacatt ctctgttcat tacttagttc ttaaggatat gtgttcatcc
attctgtcgc 1380tggctcagag tttgcttcac tctctagacc agagtataat
ttcatttggc agtctcctat 1440acaaatatgc atttaagttt tttgacacgt
actgccagca ggaagtggtt ggtgccttag 1500tgacccatat ctgcagtggg
aatgaagctg aagttgatac tgccttagat gtccttctag 1560agttggtagt
gttaaaccca tctgctatga tgatgaatgc tgtctttgta aagggcattt
1620tagattatct ggataacata tcccctcagc aaatacgaaa actcttctat
gttctcagca 1680cactggcatt tagcaaacag aatgaagcca gcagccacat
ccaggatgac atgcacttgg 1740tgataagaaa gcagctctct agcaccgtat
tcaagtacaa gctcattggg attattggtg 1800ctgtgaccat ggctggcatc
atggcggcag acagaagtga atcacctagt ttgacccaag 1860agagagccaa
cctgagcgat gagcagtgca cacaggtgac ctccttgttg cagttggttc
1920attcctgcag tgagcagtct cctcaggcct ctgcacttta ctatgatgaa
tttgccaacc 1980tgatccaaca tgaaaagctg gatccaaaag ccctggaatg
ggttgggcat accatctgta 2040atgatttcca ggatgccttc gtagtggact
cctgtgttgt tccggaaggt gactttccat 2100ttcctgtgaa agcactgtac
ggactggaag aatacgacac tcaggatggg attgccataa 2160acctcctgcc
gctgctgttt tctcaggact ttgcaaaaga tgggggtccg gtgacctcac
2220aggaatcagg ccaaaaattg gtgtctccgc tgtgcctggc tccgtatttc
cggttactga 2280gactttgtgt ggagagacag cataacggaa acttggagga
gattgatggt ctactagatt 2340gtcctatatt cctaactgac ctggagcctg
gagagaagtt ggagtccatg tctgctaaag 2400agcgttcatt catgtgttct
ctcatatttc ttactctcaa ctggttccga gagattgtaa 2460atgccttctg
ccaggaaaca tcacctgaga tgaaggggaa ggtgctcact cggttaaagc
2520acattgtaga attgcaaata atcctggaaa agtacttggc agtcacccca
gactatgtcc 2580ctcctcttgg aaactttgat gtggaaactt tagatataac
acctcatact gttactgcta 2640tttcagcaaa aatcagaaag aaaggaaaaa
tagaaaggaa acaaaaaaca gatggcagca 2700agacatcctc ctctgacaca
ctttcagaag agaaaaattc agaatgtgac cctacgccat 2760ctcatagagg
ccagctaaac aaggagttca cagggaagga agaaaagaca tcattgttac
2820tacataattc ccatgctttt ttccgagagc tggacattga ggtcttctct
attctacatt 2880gtggacttgt gacgaagttc atcttagata ctgaaatgca
cactgaagct acagaagttg 2940tgcaacttgg gccccctgag ctgcttttct
tgctggaaga tctctcccag aagctggaga 3000gtatgctgac acctcctatt
gccaggagag tcccctttct caagaacaaa ggaagccgga 3060atattggatt
ctcacatctc caacagagat ctgcccaaga aattgttcat tgtgtttttc
3120aactgctgac cccaatgtgt aaccacctgg agaacattca caactatttt
cagtgtttag 3180ctgctgagaa tcacggtgta gttgatggac caggagtgaa
agttcaggag taccacataa 3240tgtcttcctg ctatcagagg ctgctgcaga
tttttcatgg gctttttgct tggagtggat 3300tttctcaacc tgaaaatcag
aatttactgt attcagccct ccatgtcctt agtagccgac 3360tgaaacaggg
agaacacagc cagcctttgg aggaactact cagccagagc gtccattact
3420tgcagaattt ccatcaaagc attcccagtt tccagtgtgc tctttatctc
atcagacttt 3480tgatggttat tttggagaaa tcaacagctt ctgctcagaa
caaagaaaaa attgcttccc 3540ttgccagaca attcctctgt
cgggtgtggc caagtgggga taaagagaag agcaacatct 3600ctaatgacca
gctccatgct ctgctctgta tctacctgga gcacacagag agcattctga
3660aggccataga ggagattgct ggtgttggtg tcccagaact gatcaactct
cctaaagatg 3720catcttcctc cacattccct acactgacca ggcatacttt
tgttgttttc ttccgtgtga 3780tgatggctga actagagaag acggtgaaaa
aaattgagcc tggcacagca gcagactcgc 3840agcagattca tgaagagaaa
ctcctctact ggaacatggc tgttcgagac ttcagtatcc 3900tcatcaactt
gataaaggta tttgatagtc atcctgttct gcatgtatgt ttgaagtatg
3960ggcgtctctt tgtggaagca tttctgaagc aatgtatgcc gctcctagac
ttcagtttta 4020gaaaacaccg ggaagatgtt ctgagcttac tggaaacctt
ccagttggac acaaggctgc 4080ttcatcacct gtgtgggcat tccaagattc
accaggacac gagactcacc caacatgtgc 4140ctctgctcaa aaagaccctg
gaacttttag tttgcagagt caaagctatg ctcactctca 4200acaattgtag
agaggctttc tggctgggca atctaaaaaa ccgggacttg cagggtgaag
4260agattaagtc ccaaaattcc caggagagca cagcagatga gagtgaggat
gacatgtcat 4320cccaggcctc caagagcaaa gccactgagg tatctctaca
aaacccacca gagtctggca 4380ctgatggttg cattttgtta attgttctaa
gttggtggag cagaactttg cctacttatg 4440tttattgtca aatgcttcta
tgcccatttc cattccctcc ataacagctt ctgtgcttat 4500ataatttttg
ggacccagaa gaaacaacga cacaatctta gaatcactcc tgagtatctc
4560gagttgtggc atttgttata gagttgacaa ttttctgcat tatagcctct
cattttccat 4620gaattcatat ctgaaaccat tttagaaggg agaagtcatc
gaagtatttt ctgagtgttg 4680agaagaatga gttaaaccat ttaaacacat
ttgaaacata caaaaataga aatgtgaaag 4740catttggtga aagccaaagc
acagagtcag aagctgccac cttagagaac tgaaataaaa 4800atagaagttc
ttacgctttt ttgtggtaca gatgctttcg acaatttaaa gaaagctaaa
4860taaaaatgta gacatggctg gcgcagtggc tcatgcttgt aatcctagca
ctttttgagg 4920ccaaggtagg aggattgctt gagtccggga gctcaaggca
aagctgcaca acataacaag 4980accctatctc cacaaaaaaa atgaaaaata
aacctgggtg cggtggctca cacctgtaat 5040cccagcactt tgggaggccg
atgtgggcag atcacaaggt caggagttca agaccagcct 5100ggccaacata
gtgaaacccc atctctactg aaaatacaaa aattagctgg gtgtggtggc
5160acgtgcctgt tatctcagct acttgggaag ctga 519474455DNAHomo sapiens
7tcgaaaacta cgggcggcga cggcttctcg gaagtaattt aagtgcacaa gacattggtc
60aaaatggttt ccaaaagaag actgtcaaaa tctgaggata aagagagcct gacagaagat
120gcctccaaaa ccaggaagca accactttcc aaaaagacaa agaaatctca
tattgctaat 180gaagttgaag aaaatgacag catctttgta aagcttctta
agatatcagg aattattctt 240aaaacgggag agagtcagaa tcaactagct
gtggatcaaa tagctttcca aaagaagctc 300tttcagaccc tgaggagaca
cccttcctat cccaaaataa tagaagaatt tgttagtggc 360ctggagtctt
acattgagga tgaagacagt ttcaggaact gccttttgtc ttgtgagcgt
420ctgcaggatg aggaagccag tatgggtgca tcttattcta agagtctcat
caaactgctt 480ctggggattg acatactgca gcctgccatt atcaaaacct
tatttgagaa gttgccagaa 540tatttttttg aaaacaagaa cagtgatgaa
atcaacatac ctcgactcat tgtcagtcaa 600ctaaaatggc ttgacagagt
tgtggatggc aaggacctca ccaccaagat catgcagctg 660atcagtattg
ctccagagaa cctgcagcat gacatcatca ccagcctacc tgagatccta
720ggggattccc agcacgctga tgtggggaaa gaactcagtg acctactgat
agagaatact 780tcactcactg tcccaatcct ggatgtcctt tcaagcctcc
gacttgaccc aaacttccta 840ttgaaggttc gccagttggt gatggataag
ttgtcgtcta ttagattgga ggatttacct 900gtgataataa agttcattct
tcattccgta acagccatgg atacacttga ggtaatttct 960gagcttcggg
agaagttgga tctgcagcat tgtgttttgc catcacggtt acaggcttcc
1020caagtaaagt tgaaaagtaa aggacgagca agttcctcag gaaatcaaga
aagcagcggt 1080cagagctgta ttattctcct ctttgatgta ataaagtcag
ctattagata tgagaaaacc 1140atttcagaag cctggattaa ggcaattgaa
aacactgcct cagtatctga acacaaggtg 1200tttgacctgg tgatgctttt
catcatctat agcaccaata ctcagacaaa gaagtacatt 1260gacagggtgc
taagaaataa gattcgatca ggctgcattc aagaacagct gctccagagt
1320acattctctg ttcattactt agttcttaag gatatgtgtt catccattct
gtcgctggct 1380cagagtttgc ttcactctct agaccagagt ataatttcat
ttggcagtct cctatacaaa 1440tatgcattta agttttttga cacgtactgc
cagcaggaag tggttggtgc cttagtgacc 1500catatctgca gtgggaatga
agctgaagtt gatactgcct tagatgtcct tctagagttg 1560gtagtgttaa
acccatctgc tatgatgatg aatgctgtct ttgtaaaggg cattttagat
1620tatctggata acatatcccc tcagcaaata cgaaaactct tctatgttct
cagcacactg 1680gcatttagca aacagaatga agccagcagc cacatccagg
atgacatgca cttggtgata 1740agaaagcagc tctctagcac cgtattcaag
tacaagctca ttgggattat tggtgctgtg 1800accatggctg gcatcatggc
ggcagacaga agtgaatcac ctagtttgac ccaagagaga 1860gccaacctga
gcgatgagca gtgcacacag gtgacctcct tgttgcagtt ggttcattcc
1920tgcagtgagc agtctcctca ggcctctgca ctttactatg atgaatttgc
caacctgatc 1980caacatgaaa agctggatcc aaaagccctg gaatgggttg
ggcataccat ctgtaatgat 2040ttccaggatg ccttcgtagt ggactcctgt
gttgttccgg aaggtgactt tccatttcct 2100gtgaaagcac tgtacggact
ggaagaatac gacactcagg atgggattgc cataaacctc 2160ctgccgctgc
tgttttctca ggactttgca aaagatgggg gtccggtgac ctcacaggaa
2220tcaggccaaa aattggtgtc tccgctgtgc ctggctccgt atttccggtt
actgagactt 2280tgtgtggaga gacagcataa cggaaacttg gaggagattg
atggtctact agattgtcct 2340atattcctaa ctgacctgga gcctggagag
aagttggagt ccatgtctgc taaagagcgt 2400tcattcatgt gttctctcat
atttcttact ctcaactggt tccgagagat tgtaaatgcc 2460ttctgccagg
aaacatcacc tgagatgaag gggaaggtgc tcactcggtt aaagcacatt
2520gtagaattgc aaataatcct ggaaaagtac ttggcagtca ccccagacta
tgtccctcct 2580cttggaaact ttgatgtgga aactttagat ataacacctc
atactgttac tgctatttca 2640gcaaaaatca gaaagaaagg aaaaatagaa
aggaaacaaa aaacagatgg cagcaagaca 2700tcctcctctg acacactttc
agaagagaaa aattcagaat gtgaccctac gccatctcat 2760agaggccagc
taaacaagga gttcacaggg aaggaagaaa agacatcatt gttactacat
2820aattcccatg cttttttccg agagctggac attgaggtct tctctattct
acattgtgga 2880cttgtgacga agttcatctt agatactgaa atgcacactg
aagctacaga agttgtgcaa 2940cttgggcccc ctgagctgct tttcttgctg
gaagatctct cccagaagct ggagagtatg 3000ctgacacctc ctattgccag
gagagtcccc tttctcaaga acaaaggaag ccggaatatt 3060ggattctcac
atctccaaca gagatctgcc caagaaattg ttcattgtgt ttttcaactg
3120ctgaccccaa tgtgtaacca cctggagaac attcacaact attttcagtg
tttagctgct 3180gagaatcacg gtgtagttga tggaccagga gtgaaagttc
aggagtacca cataatgtct 3240tcctgctatc agaggctgct gcagattttt
catgggcttt ttgcttggag tggattttct 3300caacctgaaa atcagaattt
actgtattca gccctccatg tccttagtag ccgactgaaa 3360cagggagaac
acagccagcc tttggaggaa ctactcagcc agagcgtcca ttacttgcag
3420aatttccatc aaagcattcc cagtttccag tgtgctcttt atctcatcag
acttttgatg 3480gttattttgg agaaatcaac agcttctgct cagaacaaag
aaaaaattgc ttcccttgcc 3540agacaattcc tctgtcgggt gtggccaagt
ggggataaag agaagagcaa catctctaat 3600gaccagctcc atgctctgct
ctgtatctac ctggagcaca cagagagcat tctgaaggcc 3660atagaggaga
ttgctggtgt tggtgtccca gaactgatca actctcctaa agatgcatct
3720tcctccacat tccctacact gaccaggcat acttttgttg ttttcttccg
tgtgatgatg 3780gctgaactag agaagacggt gaaaaaaatt gagcctggca
cagcagcaga ctcgcagcag 3840attcatgaag agaaactcct ctactggaac
atggctgttc gagacttcag tatcctcatc 3900aacttgataa aggtatttga
tagtcatcct gttctgcatg tatgtttgaa gtatgggcgt 3960ctctttgtgg
aagcatttct gaagcaatgt atgccgctcc tagacttcag ttttagaaaa
4020caccgggaag atgttctgag cttactggaa accttccagt tggacacaag
gctgcttcat 4080cacctgtgtg ggcattccaa gattcaccag gacacgagac
tcacccaaca tgtgcctctg 4140ctcaaaaaga ccctggaact tttagtttgc
agagtcaaag ctatgctcac tctcaacaat 4200tgtagagagg ctttctggct
gggcaatcta aaaaaccggg acttgcaggg tgaagagatt 4260aagtcccaaa
attcccagga gagcacagca gatgagagtg aggatgacat gtcatcccag
4320gcctccaaga gcaaagccac tgaggatggt gaagaagacg aagtaagtgc
tggagaaaag 4380gagcaagata gtgatgagag ttatgatgac tctgattaga
ccccagataa attgttgcct 4440gcttctgtgt ctcaa 445585516DNAMus musculus
8ggaaagtcga aaacgaaggg aagcaactgg cgggtcccca ggaagtaata taagtggcag
60aagacgttag tcaaaatgat ttccaaaaga cgtcggctag attctgagga taaagaaaac
120ctgacagaag atgcctccaa aaccatgccc ctttccaagc tggcaaagaa
gtctcacaat 180tctcatgaag ttgaagaaaa tggcagtgtc tttgtaaagc
ttcttaaggc ttcaggactc 240actcttaaaa ctggagagaa ccaaaatcag
ctaggtgtgg atcaggtaat cttccaaagg 300aagctctttc aggccttgag
gaagcatcct gcttatccca aagtaataga agagtttgtt 360aatggcctgg
agtcctacac tgaggacagt gagagtctca ggaactgcct gctgtcttgt
420gagcgcctgc aggatgagga agccagcatg ggcacatttt actccaagag
tctgatcaag 480ctacttctgg ggattgacat tttacagcct gccattatca
aaatgttatt tgaaaaagtg 540cctcagtttc tttttgaaag tgagaacaga
gatggaatca acatggccag actcattatc 600aatcaactaa aatggctgga
tagaattgtg gatggcaagg acctcacggc ccagatgatg 660cagttgatca
gtgttgctcc cgtgaactta cagcatgact tcatcacgag ccttcctgaa
720atcctagggg attcccagca tgctaatgtg gggaaagagc ttggcgagct
gctggtgcag 780aatacttccc tgactgttcc aattttggat gtcttttcca
gtctccgact tgaccccaac 840ttcctgtcca agatccgcca gttggtgatg
ggcaagctgt catctgtccg tctagaggat 900ttccctgtga ttgtaaagtt
ccttcttcat tctgtaacag acaccacttc ccttgaggtc 960attgccgagc
ttcgggagaa cttgaacgtc cagcagttta ttttgccgtc acgaattcag
1020gcttcccaaa gcaaattgaa aagtaaagga ctagcaagct cttcaggaaa
tcaagagaac 1080agtgataaag actgtattgt tcttgtcttt gatgtaataa
agtcagccat tagatatgag 1140aaaaccattt cagaggcctg gtttaaggca
attgaacgca ttgagtccgc ggctgaacat 1200aaggctttgg acgtggtcat
gctgctcatc atctacagca ccagcacgca gaccaagaag 1260ggcgtggaga
agctgctgag aaacaagatt cagtcagact gcattcaaga acagctgctt
1320gacagtgcgt tctctacaca ttacctggtt cttaaggata tttgcccatc
tattcttttg 1380ctggctcaga ctttgtttca ctctcaagac cagaggatca
ttttgtttgg cagtcttctg 1440tacaaatatg cttttaagtt ttttgatact
tactgccagc aggaagtggt tggtgcccta 1500gtcacccatg tctgcagtgg
gactgaggct gaagtcgaca ctgcactgga tgtcctcctg 1560gagctgattg
tgctaaacgc ctctgctatg aggctcaatg ctgcttttgt taagggcatc
1620ttagattatt tggaaaatat gtcccctcag caaatacgaa aaatcttctg
tattctcagc 1680actcttgcat ttagccaaca gcccggaacc agcaaccata
tccaggacga catgcacctg 1740gtgatccgga agcagctctc tagcactgtg
ttcaagtaca agctcattgg gatcattggt 1800gcagtcacca tggccggcat
catggcggaa gacagaagtg taccatctaa ctcatcccag 1860aggagcgcca
atgtgagcag tgagcagcgc acacaggtga cttctttgct acaactagtt
1920cattcttgca ctgagcactc tccttgggcc tcttctctgt attatgatga
atttgccaac 1980ctgatccaag aaaggaagtt ggctccaaaa accttggagt
gggttgggca gaccatcttc 2040aatgatttcc aagatgcctt tgtggtagac
ttctgtgctg ctccagaggg tgactttcca 2100tttcctgtga aagcgctcta
tggactggaa gagtacagca ctcaagacgg cattgtcatc 2160aacctcctgc
cgctgttcta tcaggaatgt gcaaaagatg ccagtcgagc gacatcacaa
2220gaatcgagcc agagatcaat gtcttctttg tgcctggctt cccatttccg
gctgctgaga 2280ctttgcgtgg caagacaaca tgatggaaac ttggatgaga
tcgatggtct cttagattgt 2340cccctgttcc tccctgacct ggaacctgga
gagaaactgg agtccatgtc tgctaaagac 2400cgttcgctta tgtgttcgct
cacattccta actttcaact ggttccgaga ggttgtgaat 2460gccttctgcc
aacaaacatc tcctgagatg aagggcaagg ttcttagtcg gctaaaggac
2520cttgtagaac ttcagggaat cctagagaag tacttggcag tcatcccaga
ctatgttccg 2580cctttcgcaa gcgttgactt ggacacttta gatatgatgc
ctaggagcag ttctgctgtt 2640gcagcaaaaa acagaaacaa gggaaagacg
gggggaaaga aacaaaaagc tgatagcaac 2700aaagcatcct gttcggacac
acttctaaca gaagacactt cagagtgtga catggcgcca 2760tctgggagaa
gccacgtaga caaggagtcc acagggaagg aaggaaagac gtttgtgtca
2820ctgcagaatt accgcgcttt tttccgagag ctggacattg aggtcttctc
tattctacat 2880tctggacttg tgaccaagtt catcttagac actgaaatgc
acactgaagc tacagaggtc 2940gtacagctgg ggcctgctga gctgctcttc
ttgctggaag atctttccca gaagctagag 3000aatatgctga ctgctccttt
tgccaagaga atctgctgct ttaagaataa aggaaggcag 3060aatattggct
tctcacatct tcatcagaga tctgtccagg acattgtgca ctgtgtggtt
3120cagctgctaa ccccgatgtg taaccatctg gagaacattc acaacttctt
tcagtgctta 3180ggtgctgagc atctcagtgc agatgacaag gcgagagcga
cagctcagga gcagcacacc 3240atggcctgct gctaccagaa gctgctgcag
gtcttgcacg cgctctttgc gtggaaggga 3300tttactcacc aatcaaagca
ccgcctcctg cactcagccc ttgaggtcct ctcgaaccga 3360ctaaagcaga
tggaacagga ccagcccttg gaggaactgg tcagccagag cttcagttac
3420ttgcagaact tccaccatag tgttcccagt ttccagtgtg gtctctacct
tctcagactt 3480ctgatggccc ttctggagaa gtctgcagta cctaaccaga
agaaagaaaa acttgcctct 3540ctggccaaac agctgctttg ccgagcatgg
cctcatgggg aaaaagagaa gaaccccact 3600tttaatgacc acctgcatga
tgtgctttac atctacttgg agcacacaga caatgttctg 3660aaggccatag
aggagatyac tggtgttggt gtcccagaac tggtcagtgc tccgaaagac
3720gccgcctcct ctacattccc tacgttgacc grgcacacct ttgtcatatt
cttccgtgtg 3780atgatggctg aactcgagaa gacggtgaag ggtctycagg
ctggcacagc agcagattcg 3840cagcaggttc acgaagagaa gctcctctat
tkgaacatgg ctgtccgaga tttcagyatc 3900cttytcaatc tgatgaaagt
atttgacagt tatcctgttc tgcatgtgtg tttaaagtat 3960ggccgtcgct
ttgtggaggc atttctgaag caatgtatgc cactcctcga cttcagcttt
4020agaaagcatc gggaagatgt tctgagcttg ctgcaaaccc ttcagttgaa
cacgaggcta 4080cttcatcacc tttgtggaca ctccaagatt cgccaggaca
caagactcac caagcaygtg 4140cctttactca aaaagtcact ggaactgtta
gtttgcagag tcaaagccat gcttgtcctc 4200aacaactgta gagaggcttt
ctggttgggt actctcaaaa accgagactt acagggtgaa 4260gaaattattt
cccaggatcc ctcttcctca gagagcaatg cagaggacag tgaggatggc
4320gtgacatctc acgtctccag gaacagagca acagaggatg gggaagatga
agcaagtgat 4380gaacagaagg accaggacag tgatgaaagt gacgacagct
ccagttagag ccgagtggca 4440tggctgccct gctcacctct gacagactct
catctctttg gggtttgaag tcagatgtct 4500gtttttctag tcagaagcat
cctgtttgtc catcaagaag gggtgtttat ttaattcccc 4560agtgggtttc
acaggttgtc taacctccag gtccctggtt caggagtcca gtgtagcatc
4620catcgttgac taggaygaac atggctgggc tgcagtgcag tkcagtgcag
gtgccctagc 4680tgggccttgg ggttttgaaa ctaaaattta ggcttataat
agctttgtaa ataaatctgt 4740ttcagagttt tgcctcagct acctttttcc
tcactttaga tgtgattatt caaggatctc 4800attattcaag gattaggtaa
tattgagttg aggtttgtgc aatcgtactg gtggcctaaa 4860agtatgttcc
gtactgttat cttcctggag gaatgaccca actttcttat caatgatcaa
4920gtgtttggtt tggtctgtgt cagggtctct ttacatagtc ctggctggtg
tgttattaga 4980tatgttgacc aggagggtct tgaacattac ttttgaattt
taaacatttt tgtacatatg 5040tgtatgggca tatatgtgcc actgtgcata
tgtgtaggtc agaggatagc ttatgggagt 5100gagctctctc cttccaccat
gtgggttcca gggttcaaac tctagacctt cacctgctca 5160gccaccttac
ccttttaaaa tgtttggtta ttaatatata aaaggaagga agacaacatc
5220aaacatgtgc tggctttgta tgtatatata gtttttattt ccacattaat
ttgaattatg 5280cctataatat atttgtaata atcatacaaa ataattgtaa
tttattagaa atagaacatc 5340aggagttaaa ataggggatt cttctgtctt
ctgccaggaa gcccagtctc agagatgctg 5400ccaggctctt cctcgctgtg
ccattaagat tatttaattt ttgttaatat ttttactcat 5460accggtatta
aagttatgtt ttgttggaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 5516914DNAHomo
sapiens 9tcggtgagta agtg 141014DNAHomo sapiens 10ccagtaagta tcta
141114DNAHomo sapiens 11taggtaatat ttta 141214DNAHomo sapiens
12aaagtatgta tttt 141314DNAHomo sapiens 13caggtgtgga gagg
141414DNAHomo sapiens 14caggtaagac tgtc 141514DNAHomo sapiens
15aaagtaagtg gcgt 141614DNAHomo sapiens 16aaggtaggct tatg
141714DNAHomo sapiens 17caggtggata aacc 141814DNAHomo sapiens
18aaggtagaaa agac 141914DNAHomo sapiens 19gaggtatgct ctta
142014DNAHomo sapiens 20aaggtaaaga gctc 142114DNAHomo sapiens
21aaggtgagat cttt 142214DNAHomo sapiens 22aaggtaatgt tcat
142314DNAHomo sapiens 23ttagtaagtg tcag 142414DNAHomo sapiens
24caggtatgtt gaaa 142514DNAHomo sapiens 25aaggtatctt attg
142614DNAHomo sapiens 26caggttagag gcaa 142714DNAHomo sapiens
27caggtacacg tgga 142814DNAHomo sapiens 28caggtgagtt cttt
142914DNAHomo sapiens 29ctggtaaagc caat 143014DNAHomo sapiens
30agggtaggta ttgt 143114DNAHomo sapiens 31aaagtcagta tagt
143214DNAHomo sapiens 32taggtatggg atga 143314DNAHomo sapiens
33gaggtgagca gagt 143414DNAHomo sapiens 34caggtaagag aagt
143514DNAHomo sapiens 35taggtaagta tgtt 143614DNAHomo sapiens
36aaggtattgg aatg 143714DNAHomo sapiens 37gaagtaagtg acag
143814DNAHomo sapiens 38aaggttagtg tagg 143914DNAHomo sapiens
39caggtcagaa gcct 144014DNAHomo sapiens 40ttggtaagta tgtg
144114DNAHomo sapiens 41caggtgagtc ataa 144214DNAHomo sapiens
42ttggtgatgg gcct 144314DNAHomo sapiens 43ctggtgagat gttt
144414DNAHomo sapiens 44caggtaaggg agtt 144514DNAHomo sapiens
45caggtgagta agat 144614DNAHomo sapiens 46aaggtgagta tgga
144714DNAHomo sapiens 47aaggtgagag attt 144814DNAHomo sapiens
48cgggtaagag ctaa 144914DNAHomo sapiens 49aaggtaagaa gggg
145014DNAHomo sapiens 50caggtaagcc ttgg
145114DNAHomo sapiens 51gaggtatctc taca 145223DNAHomo sapiens
52gtttcccgat tttgctctag gaa 235323DNAHomo sapiens 53gaaaattttt
ctattttcag aaa 235423DNAHomo sapiens 54ctcttctttt ttctgcatag ctg
235523DNAHomo sapiens 55attttttaaa tctccttaag ata 235623DNAHomo
sapiens 56gatttctttt ttttttacag tat 235723DNAHomo sapiens
57ccctatgtct tcttttttag cct 235823DNAHomo sapiens 58ttctcttcct
aacattttag caa 235923DNAHomo sapiens 59aatagtgtct tctactgcag gac
236023DNAHomo sapiens 60tctttttcta ccattcacag tga 236123DNAHomo
sapiens 61tctgtgcttt taatttttag gtt 236223DNAHomo sapiens
62ctaatattta ctttctgcag gta 236323DNAHomo sapiens 63ttcctctctg
ctacttgtag ttc 236423DNAHomo sapiens 64actctctcct gttttttcag gca
236523DNAHomo sapiens 65tgcatattta ttgacaatag gtg 236623DNAHomo
sapiens 66tctactcttc cccactcaag gtt 236723DNAHomo sapiens
67gttgactctc ccctgtatag gaa 236823DNAHomo sapiens 68tggcatcatt
ttttccacag ggc 236923DNAHomo sapiens 69tcttcatcat ctcattgcag gat
237023DNAHomo sapiens 70aaaaaattct ttgtttttag aag 237123DNAHomo
sapiens 71attcttcctc tttgctccag gtg 237223DNAHomo sapiens
72tgtttgtttg cttcctgaag gaa 237323DNAHomo sapiens 73attctggttt
ttctccgcag tga 237423DNAHomo sapiens 74aatttatttc tccttctcag att
237523DNAHomo sapiens 75aaatgtttgt tctctctcag att 237623DNAHomo
sapiens 76atgtaatttg tactttgcag att 237723DNAHomo sapiens
77cagcctgctg tttgtttcag tca 237823DNAHomo sapiens 78ttctcttttt
aatataaaag aaa 237923DNAHomo sapiens 79ttgctgtgac ttccccatag gag
238023DNAHomo sapiens 80tcctttcctc catgtgacag gct 238123DNAHomo
sapiens 81taactctgca tttattatag aac 238223DNAHomo sapiens
82aaaatcattt ttatttttag tgt 238323DNAHomo sapiens 83tcttaccttg
acttccttag gag 238423DNAHomo sapiens 84tttttcttgt ctccttacag cca
238523DNAHomo sapiens 85tttgtcttct tttctaacag ctt 238623DNAHomo
sapiens 86atatttgact ctcaatgcag tat 238723DNAHomo sapiens
87atgcttttcc cgtcttctag gca 238823DNAHomo sapiens 88catatatttg
gctgccccag att 238923DNAHomo sapiens 89cttgtctttc acctctccag gta
239023DNAHomo sapiens 90agtgtgtctc tcttcttcag tat 239123DNAHomo
sapiens 91tataaactta ttggttatag gaa 239223DNAHomo sapiens
92tgttatttat ttccattcag att 239323DNAHomo sapiens 93cttggtccat
tcacatttag ggt 239423DNAHomo sapiens 94atttattctt tgccccttag gat
239533DNAArtificial sequencePrimer 95agcctcgaat tcgtttccaa
aagaagactg tca 339635DNAArtificial sequencePrimer 96ggtatcctcg
agtcaagacg acaacttatc catca 359718DNAArtificial sequencePrimer
97aatcgaaaac tacgggcg 189820DNAArtificial sequencePrimer
98gagaacacat gaatgaacgc 209928DNAArtificial sequencePrimer
99ggcgacggct tctcggaagt aatttaag 2810018DNAArtificial
sequencePrimer 100agcggcagga ggtttatg 1810118DNAArtificial
sequencePrimer 101tggcggcaga cagaagtg 1810218DNAArtificial
sequencePrimer 102tggcggcaga cagaagtg 1810321DNAArtificial
sequencePrimer 103agagagccaa cctgagcgat g 2110418DNAArtificial
sequencePrimer 104gtgccagact ctggtggg 1810520DNAArtificial
sequencePrimer 105aggagacacc cttcctatcc 2010620DNAArtificial
sequencePrimer 106gaagttggca aaacagactg 2010721DNAArtificial
sequencePrimer 107tgtcttgtga gcgtctgcag g 2110820DNAArtificial
sequencePrimer 108aggttttgat aatggcaggc 2010924DNAArtificial
sequencePrimer 109actggactgt gcctacccac tatg 2411020DNAArtificial
sequencePrimer 110cctgtgtgag gatgagctct 2011116DNAArtificial
sequencePrimer 111ttctcccgaa gctcag 1611217DNAArtificial
sequencePrimer 112tttcttccgt gtgatga 1711333DNAArtificial
sequencePrimer 113agcctcgaat tcgtttccaa aagaagactg tca
3311435DNAArtificial sequencePrimer 114ggtatcctcg agtcaagacg
acaacttatc catca 3511520DNAArtificial sequencePrimer 115ctagcacaga
actctgctgc 2011620DNAArtificial sequencePrimer 116ctagcacaga
actctgctgc 2011724DNAArtificial sequencePrimer 117cttcagcaac
agcgaagtag tctg 2411824DNAArtificial sequencePrimer 118gattctcagc
acttgaaaag cagg 2411921DNAArtificial sequencePrimer 119ggacacatca
gttttcctct c 2112020DNAArtificial sequencePrimer 120gaaaacccat
gattcagtcc 2012120DNAArtificial sequencePrimer 121tcatcaggca
agaaacttgg 2012220DNAArtificial sequencePrimer 122gaagttggca
aaacagactg 2012320DNAArtificial sequencePrimer 123gagccatctg
ctcatttctg 2012420DNAArtificial sequencePrimer 124cccgctattt
agacttgagc 2012521DNAArtificial sequencePrimer 125caaagtgttt
attccaggag c 2112622DNAArtificial sequencePrimer 126catcagggta
ctttgaacat tc 2212722DNAArtificial sequencePrimer 127ttgaccagaa
aggctcagtt cc 2212823DNAArtificial sequencePrimer 128agatgatgcc
agagggttta tcc 2312920DNAArtificial sequencePrimer 129tgcccagctc
tgttcaaacc 2013020DNAArtificial sequencePrimer 130aggcaatgac
tgactgacac 2013123DNAArtificial sequencePrimer 131tgcccgtcta
tttttgatga agc 2313221DNAArtificial sequencePrimer 132tctcagttag
tctggggaca g 2113325DNAArtificial sequencePrimer 133tcatggtaga
gagactggac tgtgc 2513421DNAArtificial sequencePrimer 134accctggagc
aaatgacaac c 2113521DNAArtificial sequencePrimer 135atttgctcca
gggtacatgg c 2113622DNAArtificial sequencePrimer 136gaaagacagt
gggaaggcaa gc 2213723DNAArtificial sequencePrimer 137gggagtgtgt
ggaacaaatg agc 2313825DNAArtificial sequencePrimer 138agtttctaca
ggctggtcct attcc 2513921DNAArtificial sequencePrimer 139aacgtggaat
cccattgatg c 2114020DNAArtificial sequencePrimer 140tttctgtgtt
ccctccttgc 2014120DNAArtificial sequencePrimer 141gatggtcaag
ttacactggc 2014224DNAArtificial sequencePrimer 142cacctcccac
caattatagt attc 2414323DNAArtificial sequencePrimer 143ctatgtgtgt
ctcttttaca ggg 2314420DNAArtificial sequencePrimer 144aatctttccc
accatattgc 2014520DNAArtificial sequencePrimer 145cataccttct
tttgctgtgc 2014623DNAArtificial sequencePrimer 146ccacagaagt
cagaatctcc acg 2314720DNAArtificial sequencePrimer 147tgtaacaaac
ctgcacgttg 2014823DNAArtificial sequencePrimer 148tgctacccaa
gccagtagtt tcc 2314922DNAArtificial sequencePrimer 149gagtttggga
aagattggca gc 2215022DNAArtificial sequencePrimer 150tgtagtaaag
cagctctcat gc 2215120DNAArtificial sequencePrimer 151caagtacact
ctgcactgcc 2015223DNAArtificial sequencePrimer 152tgactcaact
tccccaccaa gag 2315324DNAArtificial sequencePrimer 153ctccctatgt
acgtggagta atac 2415421DNAArtificial sequencePrimer 154gggagtcttg
tgggaactaa g 2115523DNAArtificial sequencePrimer 155ttcatagaca
tctctcagct ctg 2315620DNAArtificial sequencePrimer 156gttttggtat
cagggaaagc 2015720DNAArtificial sequencePrimer 157agccatgctt
ggaattttgg 2015820DNAArtificial sequencePrimer 158ctcactggga
tgtcacaaac 2015925DNAArtificial sequencePrimer 159ggtcttgatg
tgtgacttgt atccc 2516025DNAArtificial sequencePrimer 160cctcagtgtc
acagtgttct ttgtg 2516122DNAArtificial sequencePrimer 161catgaaatga
ctaggacatt cc 2216220DNAArtificial sequencePrimer 162ctacccagtg
acccaaacac 2016323DNAArtificial sequencePrimer 163cgaaccctta
gtttctgaga cgc 2316420DNAArtificial sequencePrimer 164tcagtgcctt
ggtgactgtc 2016521DNAArtificial sequencePrimer 165ttgatggtac
agactggagg c 2116623DNAArtificial sequencePrimer 166aagaaagttg
ccaatcctgt tcc 2316720DNAArtificial sequencePrimer 167agcacctgaa
aataaggagg 2016822DNAArtificial sequencePrimer 168gcccaaagtt
tgtaagtgtg ag 2216921DNAArtificial sequencePrimer 169agcaagaatg
aggtcaagtt c 2117024DNAArtificial sequencePrimer 170gggaaaaact
ggaggaaaga actc 2417121DNAArtificial sequencePrimer 171agaggtaggg
aaggaagcta c 2117220DNAArtificial sequencePrimer 172ccaaagtcca
cttcttgaag 2017320DNAArtificial sequencePrimer 173gatgcactgg
ttgctacatc 2017420DNAArtificial sequencePrimer 174ccaggacact
tggtttctgc 2017520DNAArtificial sequencePrimer 175acactcccag
ttggaatcag 2017620DNAArtificial sequencePrimer 176cttgtgggca
agaaattgag 2017720DNAArtificial sequencePrimer 177tgggctggat
gagactattc 2017824DNAArtificial sequencePrimer 178ccaaggacat
atcttctgag caac 2417920DNAArtificial sequencePrimer 179tgattatcag
cataggctgg 2018020DNAArtificial sequencePrimer 180gatcccccaa
tagcaactgc 2018121DNAArtificial sequencePrimer 181cattcagatt
caccaggaca c 2118220DNAArtificial sequencePrimer 182ccttacatgc
catctgatgc 2018320DNAArtificial sequencePrimer 183aaccttctcc
cctattaccc 2018422DNAArtificial sequencePrimer 184ggaaaatgag
aggctataat gc 2218524DNAArtificial sequencePrimer 185tgtattccag
aggtcaccca gagc 2418622DNAArtificial sequencePrimer 186ccagtaagaa
aggcaaacag cg 221871094DNAHomo sapiens 187ggagaacaca gccagccttt
ggaggaacta ctcagccaga gcgtccatta cttgcagaat 60ttccatcaaa gcattcccag
tttccagtgt gctctttatc tcatcagact tttgatggtt 120attttggaga
aatcaacagc ttctgctcag aacaaagaaa aaattgcttc ccttgccaga
180caattcctct gtcgggtgtg gccaagtggg gataaagaga agagcaacat
ctctaatgac 240cagctccatg ctctgctctg tatctacctg gagcacacag
agagcattct gaaggccata 300gaggagattg ctggtgttgg tgtcccagaa
ctgatcaact ctcctaaaga tgcatcttcc 360tccacattcc ctacactgac
caggcatact tttgttgttt tcttccgtgt gatgatggct 420gaactagaga
agacggtgaa aaaaattgag cctggcacag cagcagactc gcagcagatt
480catgaagaga aactcctcta ctggaacatg gctgttcgag acttcagtat
cctcatcaac 540ttgataaagg tatttgatag tcatcctgtt ctgcatgtat
gtttgaagta tgggcgtctc 600tttgtggaag catttctgaa gcaatgtatg
ccgctcctag acttcagttt tagaaaacac 660cgggaagatg ttctgagctt
actggaaacc ttccagttgg acacaaggtg cttcatcacc 720tgtgtgggca
ttccaagatt caccaggaca cgagactcac ccaacatgtg cctctgctca
780aaaagaccct ggaactttta gtttgcagag tcaaagctat gctcactctc
aacaacaatt 840gtagagaggc tttctggctg ggcaatctaa aaaaccggga
cttgcagggt gaagagatta 900agtcccaaaa ttcccaggag agcacagcag
atgagagtga ggatgacatg tcatcccagg 960cctccaagag caaagccact
gaggatggtg aagaagacga agtaagtgct ggagaaaagg 1020agcaagatag
tgatgagagt tatgatgact ctgattagac cccagataaa ttgttgcctg
1080cttctgtgtc tcaa 10941881115DNAHomo sapiens 188ggagaacaca
gccagccttt ggaggaacta ctcagccaga gcgtccatta cttgcagaat 60ttccatcaaa
gcattcccag tttccagtgt gctctttatc tcatcagact tttgatggtt
120attttggaga aatcaacagc ttctgctcag aacaaagaaa aaattgcttc
ccttgccaga 180caattcctct gtcgggtgtg gccaagtggg gataaagaga
agagcaacat ctctaatgac 240cagctccatg ctctgctctg tatctacctg
gagcacacag agagcattct gaaggccata 300gaggagattg ctggtgttgg
tgtcccagaa ctgatcaact ctcctaaaga tgcatcttcc 360tccacattcc
ctacactgac caggcatact tttgttgttt tcttccgtgt gatgatggct
420gaactagaga agacggtgaa aaaaattgag cctggcacag cagcagactc
gcagcagatt 480catgaagaga aactcctcta ctggaacatg gctgttcgag
acttcagtat cctcatcaac 540ttgataaagg tatttgatag tcatcctgtt
ctgcatgtat gtttgaagta tgggcgtctc 600tttgtggaag catttctgaa
gcaatgtatg ccgctcctag acttcagttt tagaaaacac 660cgggaagatg
ttctgagctt actggaaacc ttccagttgg acacaaggtg cttcatcacc
720tgtgtgggca ttccaagatt caccaggaca cgagactcac ccaacatgtg
cctctgctca 780aaaagaccct ggaactttta gtttgcagag tcaaagctat
gctcactctc aacaattgta 840gagaggcttt ctggctgggc aatctaaaaa
accgggactt gcagggtgaa gagattaagt 900cccaaaattc ccaggagagc
acagcagatg agagtgagga tgacatgtca tcccaggcct 960ccaagagcaa
agccactgag gtatctctac aaaacccacc agagtctggc actgatggtt
1020gcattttgtt aattgttcta agttggtgga gcagaacttt gcctacttat
gtttattgtc 1080aaatgcttct atgcccattt ccattccctc cataa
111518952DNAHomo sapiens 189ggaagccagg tgtggagagg aggcatggaa
tcttgctgaa attcagtctg tc 5219052DNAHomo sapiens 190ggaagccggg
tgtggagagg aggcatggaa tcttgctgaa attcagtctg tc 5219152DNAHomo
sapiens 191ggaagccggg tgtgaagagg aggcatggaa tcttgctgaa attcagtctg
tc 5219218DNAArtificial sequencePrimer 192tgtaaaacga cggccagt
1819318DNAArtificial sequencePrimer 193caggaaacag ctatgacc
1819438DNAArtificial sequencePrimer 194tgtaaaacga cggccagtcg
acggcttctc ggaagtaa 3819539DNAArtificial sequencePrimer
195aggaaacagc tatgaccatg cagacgctca caagacaaa 3919639DNAArtificial
sequencePrimer 196tgtaaaacga cggccagtga cacccttcct atcccaaaa
3919739DNAArtificial sequencePrimer 197aggaaacagc tatgaccatc
aggttctctg gagcaatac 3919839DNAArtificial sequencePrimer
198tgtaaaacga cggccagttg gcttgacaga gttgtggat 3919940DNAArtificial
sequencePrimer
199aggaaacagc tatgaccatc tgtaaccgtg atggcaaaac 4020039DNAArtificial
sequencePrimer 200tgtaaaacga cggccagtcg ccagttggtg atggataag
3920140DNAArtificial sequencePrimer 201aggaaacagc tatgaccata
agcatcacca ggtcaaacac 4020239DNAArtificial sequencePrimer
202tgtaaaacga cggccagtgc ggtcagagct gtattattc 3920339DNAArtificial
sequencePrimer 203aggaaacagc tatgaccatc tgctggcagt acgtgtcaa
3920439DNAArtificial sequencePrimer 204tgtaaaacga cggccagttc
gctggctcag agtttgctt 3920540DNAArtificial sequencePrimer
205aggaaacagc tatgaccatg tgctagagag ctgctttctt 4020639DNAArtificial
sequencePrimer 206tgtaaaacga cggccagtcc cctcagcaaa tacgaaaac
3920740DNAArtificial sequencePrimer 207aggaaacagc tatgaccata
ctacgaaggc atcctggaaa 4020840DNAArtificial sequencePrimer
208tgtaaaacga cggccagtgc ctctgcactt tactatgatg 4020940DNAArtificial
sequencePrimer 209aggaaacagc tatgaccatc tcctccaagt ttccgttatg
4021038DNAArtificial sequencePrimer 210tgtaaaacga cggccagtgg
tgacctcaca ggaatcag 3821140DNAArtificial sequencePrimer
211aggaaacagc tatgaccatt ttccaagagg agggacatag 4021239DNAArtificial
sequencePrimer 212tgtaaaacga cggccagtca actggttccg agagattgt
3921341DNAArtificial sequencePrimer 213aggaaacagc tatgaccatc
aatgtccagc tctcggaaaa a 4121439DNAArtificial sequencePrimer
214tgtaaaacga cggccagtgt gaccctacgc catctcata 3921540DNAArtificial
sequencePrimer 215aggaaacagc tatgaccata cattggggtc agcagttgaa
4021640DNAArtificial sequencePrimer 216tgtaaaacga cggccagtag
agtccccttt ctcaagaaca 4021739DNAArtificial sequencePrimer
217aggaaacagc tatgaccatg acgctctggc tgagtagtt 3921838DNAArtificial
sequencePrimer 218tgtaaaacga cggccagtca gccctccatg tccttagt
3821939DNAArtificial sequencePrimer 219aggaaacagc tatgaccata
gggaatgtgg aggaagatg 3922038DNAArtificial sequencePrimer
220tgtaaaacga cggccagttg gagcacacag agagcatt 3822139DNAArtificial
sequencePrimer 221aggaaacagc tatgaccatg tctaggagcg gcatacatt
3922239DNAArtificial sequencePrimer 222tgtaaaacga cggccagtag
cagactcgca gcagattca 3922339DNAArtificial sequencePrimer
223aggaaacagc tatgaccata gccagaaagc ctctctaca 3922438DNAArtificial
sequencePrimer 224tgtaaaacga cggccagtac acgagactca cccaacat
3822540DNAArtificial sequencePrimer 225aggaaacagc tatgaccatg
ggaatggaaa tgggcataga 4022639DNAArtificial sequencePrimer
226aggaaacagc tatgaccatg acacagaagc aggcaacaa 3922739DNAArtificial
sequencePrimer 227tgtaaaacga cggccagtag agcaaagcca ctgaggtat
3922840DNAArtificial sequencePrimer 228aggaaacagc tatgaccatg
actctgtgct ttggctttca 4022920DNAArtificial sequencePrimer
229gcacctcatg gaatcccttc 2023020DNAArtificial sequencePrimer
230gttgctgcac caggtggtaa 2023130DNAArtificial sequencePrimer
231tttttgcgtt tgttggagaa tcgggttttc 3023230DNAArtificial
sequencePrimer 232atacaccgca aaccgccgac gaacaaaacg
3023330DNAArtificial sequencePrimer 233tttttgtgtt tgttggagaa
ttgggttttt 3023430DNAArtificial sequencePrimer 234atacaccaca
aaccaccaac aaacaaaaca 3023520DNAArtificial sequencePrimer
235ggcccacagt ttccgtttct 2023623DNAArtificial sequencePrimer
236caaggaagct agaaatgaag aac 2323721DNAArtificial sequencePrimer
237ctgggactac agacacgttt t 2123821DNAArtificial sequencePrimer
238gtgtcacgtg tctgtaatct c 2123921DNAArtificial sequencePrimer
239ttaagaccca gcgaggtatt c 2124021DNAArtificial sequencePrimer
240tgggtttggt agggtaatgt c 2124121DNAArtificial sequencePrimer
241tggaaagtca ctgcggagaa a 2124221DNAArtificial sequencePrimer
242acgtaatcac ccctgtaatc c 2124321DNAArtificial sequencePrimer
243cactgcaaac tgctcactca a 2124421DNAArtificial sequencePrimer
244ggccttgtgc taagtgcttt t 2124521DNAArtificial sequencePrimer
245accctggtgg acataccttt t 2124621DNAArtificial sequencePrimer
246ccaaagtact gggagtttga g 2124721DNAArtificial sequencePrimer
247tctgggcaac agaacaagca a 2124822DNAArtificial sequencePrimer
248gagcaattta gcctgtggtt tt 2224920DNAArtificial sequencePrimer
249accatctggc cgacatggta 2025021DNAArtificial sequencePrimer
250agggtcctga gactatatac c 2125120DNAArtificial sequencePrimer
251tcccatctca gggcagatga 2025220DNAArtificial sequencePrimer
252tatgcccggc tagcacagaa 2025321DNAArtificial sequencePrimer
253tctctcacat gcctcacaca t 2125421DNAArtificial sequencePrimer
254cccctctgat tttggataga g 2125521DNAArtificial sequencePrimer
255aagatggatg gccctctgat t 2125622DNAArtificial sequencePrimer'
256gacacatcag ttttcctctc at 2225722DNAArtificial sequencePrimer
257aatcattcta gcccactcaa ct 2225822DNAArtificial sequencePrimer
258tggtttcatc aggcaagaaa ct 2225921DNAArtificial sequencePrimer
259agccccatga agttggcaaa a 2126021DNAArtificial sequencePrimer
260gcttgtgcca gcataactct a 2126121DNAArtificial sequencePrimer
261gctgtgctaa agctgctaca a 2126221DNAArtificial sequencePrimer
262gagccatctg ctcatttctg t 2126322DNAArtificial sequencePrimer
263cagagaaacc aatagttttc ag 2226421DNAArtificial sequencePrimer
264aatctcggct cactgcaatc t 2126522DNAArtificial sequencePrimer
265agctaatgga tggatggaaa ag 2226621DNAArtificial sequencePrimer
266tagtgcagtg ccgaatgcat a 2126721DNAArtificial sequencePrimer
267tactcatgaa ggggggtatc a 2126822DNAArtificial sequencePrimer
268ttcacacgta ggtagtcttt ct 2226921DNAArtificial sequencePrimer
269cattactccc aaggcaatga c 2127020DNAArtificial sequencePrimer
270gcccagctct gttcaaacca 2027121DNAArtificial sequencePrimer
271agctccattc tctcctctga a 2127221DNAArtificial sequencePrimer
272gtgggaagat ggagtaagag a 2127321DNAArtificial sequencePrimer
273tctgacagtg ggatgtcaga a 2127421DNAArtificial sequencePrimer
274tgcctaccca ctatgaatga g 2127521DNAArtificial sequencePrimer
275atgtgtccat ctggcaacca t 2127621DNAArtificial sequencePrimer
276caggaactcc gatcttgtaa g 2127720DNAArtificial sequencePrimer
277tggagggggg agaaagaaag 2027821DNAArtificial sequencePrimer
278cgtgtttcgc tgatgtgtca t 2127921DNAArtificial sequencePrimer
279ggaaggccag tttgtcaaag t 2128021DNAArtificial sequencePrimer
280gtgtttgacc tggtgatgct t 2128123DNAArtificial sequencePrimer
281cttatttctt agcaccctgt caa 2328222DNAArtificial sequencePrimer
282gtggaacaaa tgagcattat cc 2228321DNAArtificial sequencePrimer
283ttccccttca gtgagttcca a 2128421DNAArtificial sequencePrimer
284agggaggaga agtctgacat t 2128522DNAArtificial sequencePrimer
285gattagcctg taggttaggt at 2228621DNAArtificial sequencePrimer
286gatgggtttg ggttgattgt g 2128720DNAArtificial sequencePrimer
287ccagtctagg agacagagct 2028822DNAArtificial sequencePrimer
288ggctatctat gtgtgtctct tt 2228922DNAArtificial sequencePrimer
289acgattagaa gggaacatgg aa 2229022DNAArtificial sequencePrimer
290cgatatccat accttctttt gc 2229121DNAArtificial sequencePrimer
291tgacagagcg agactctcta a 2129221DNAArtificial sequencePrimer
292cacaccaaca tggcacatgt a 2129320DNAArtificial sequencePrimer
293gagacagggt agggcagaaa 2029420DNAArtificial sequencePrimer
294aaaggggcga gtggagtttg 2029522DNAArtificial sequencePrimer
295gtaacttcac cagtgcaacc aa 2229622DNAArtificial sequencePrimer
296atgcactctc tcttttctac tt 2229721DNAArtificial sequencePrimer
297acaaggaatc tgccccattc t 2129821DNAArtificial sequencePrimer
298ttccctgtag ccttgcgtat t 2129921DNAArtificial sequencePrimer
299ccccacatac accatgtatt g 2130021DNAArtificial sequencePrimer
300ctccctatgt acgtggagta a 2130121DNAArtificial sequencePrimer
301gtgggacata acagctagag a 2130222DNAArtificial sequencePrimer
302aggggaaagt aaatagcaag ga 2230321DNAArtificial sequencePrimer
303tcagggatat tggcctgaga t 2130421DNAArtificial sequencePrimer
304gacatctctc agctctggat a 2130522DNAArtificial sequencePrimer
305ccaattactg atgccatgat ac 2230621DNAArtificial sequencePrimer
306gcattcagcc atgcttggta a 2130721DNAArtificial sequencePrimer
307gattactcca acgcctaaga g 2130821DNAArtificial sequencePrimer
308tctacctcta ggcagtttcc a 2130921DNAArtificial sequencePrimer
309tctcctcagt gtcacagtgt t 2131021DNAArtificial sequencePrimer
310cttgggctag aggaagttgt t 2131121DNAArtificial sequencePrimer
311tacccagtga cccaaacaca a 2131221DNAArtificial sequencePrimer
312gagttcaagg ctggaatagc t 2131321DNAArtificial sequencePrimer
313accgtgattc tcagcagcta a 2131421DNAArtificial sequencePrimer
314ccattgcgaa cccttagttt c 2131521DNAArtificial sequencePrimer
315agtgccttgg tgactgtcaa a 2131621DNAArtificial sequencePrimer
316ccacctggag aacattcaca a 2131722DNAArtificial sequencePrimer
317tactgaaaga cacccaggtt at 2231820DNAArtificial sequencePrimer
318cacgcccgac ctctcaattc 2031921DNAArtificial sequencePrimer
319tatagcaaga gggcctatcc a 2132021DNAArtificial sequencePrimer
320ttgggcacgt catgtggatt t 2132121DNAArtificial sequencePrimer
321gtccagtctc tgacaaacaa c 2132221DNAArtificial sequencePrimer
322ttagaccggg aacgtcttag t 2132320DNAArtificial sequencePrimer
323ggccaagtgg gtctcaaaac 2032422DNAArtificial sequencePrimer
324cctctggttc tgttttatac tg 2232521DNAArtificial sequencePrimer
325tctgggcaac agaacaagca a 2132621DNAArtificial sequencePrimer
326cttcccaggt agttctaagc a 2132721DNAArtificial sequencePrimer
327aagccaggac acttggtttc t 2132821DNAArtificial sequencePrimer
328gcactggttg ctacatctaa g 2132921DNAArtificial sequencePrimer
329gcatccattg ccttccctaa a 2133021DNAArtificial sequencePrimer
330tgctcaaagg agcagatctc a 2133121DNAArtificial sequencePrimer
331cagtccaatt tggggatctc t 2133220DNAArtificial sequencePrimer
332ccttgggctg gatgagacta 2033321DNAArtificial sequencePrimer
333ccccaatagc aactgcagat t 2133422DNAArtificial sequencePrimer
334gattgcaagg gtatcttgaa tc 2233521DNAArtificial sequencePrimer
335gcttaggtga ccttccttac a 2133621DNAArtificial sequencePrimer
336aacataccgt tggcccatac t 2133720DNAArtificial sequencePrimer
337agcatgatct cggctcacca 2033821DNAArtificial sequencePrimer
338gtggctcatg cttgtaatcc t 2133921DNAArtificial sequencePrimer
339tcagtagaga tggggtttca c 2134021DNAArtificial sequencePrimer
340ctgccacctt agagaactga a 2134121DNAArtificial sequencePrimer
341ctcaagcaat cctcctacct t 2134222DNAArtificial sequencePrimer
342tagaatcact cctgagtatc tc 2234321DNAArtificial sequencePrimer
343cagcttctga ctctgtgctt t 2134421DNAArtificial sequencePrimer
344agttggtgga gcagaacttt g 2134521DNAArtificial sequencePrimer
345ctcgagatac tcaggagtga t 2134621DNAArtificial sequencePrimer
346tcaaccttct cccctattac c 2134721DNAArtificial sequencePrimer
347agttctgctc caccaactta g 2134822DNAArtificial sequencePrimer
348ggtatccatg tttgctgtgt tt 2234921DNAArtificial sequencePrimer
349gaaaggcaaa cagcggattt c 2135021DNAArtificial sequencePrimer
350cacccagagc agtaacctaa a 2135116DNAArtificial sequenceprimer
351ttctcccaaa gctgag 1635217DNAArtificial sequenceprimer
352tytcttccat gtgatga 17
* * * * *