U.S. patent application number 13/764200 was filed with the patent office on 2013-06-13 for inhibitors of the unfolded protein response and methods for their use.
This patent application is currently assigned to The Board of Trustees of the Leland Stanford Junior University. The applicant listed for this patent is The Board of Trustees of the Leland Stanford Junior University. Invention is credited to Douglas E. Feldman, Albert C. Koong.
Application Number | 20130150399 13/764200 |
Document ID | / |
Family ID | 38459802 |
Filed Date | 2013-06-13 |
United States Patent
Application |
20130150399 |
Kind Code |
A1 |
Koong; Albert C. ; et
al. |
June 13, 2013 |
INHIBITORS OF THE UNFOLDED PROTEIN RESPONSE AND METHODS FOR THEIR
USE
Abstract
Compounds that are inhibitors of the unfolded protein response
and endonuclease IRE1 are provided, together with compositions
comprising such compounds, and methods for their use in the
treatment of various disorders, such as cancer, autoimmune
disorders, and diabetes. Also provided are packaged pharmaceuticals
comprising these compositions. The compositions may be administered
in combination with another therapeutic agent.
Inventors: |
Koong; Albert C.; (Los
Altos, CA) ; Feldman; Douglas E.; (Mountain View,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Board of Trustees of the Leland Stanford Junior
University; |
Palo Alto |
CA |
US |
|
|
Assignee: |
The Board of Trustees of the Leland
Stanford Junior University
Palo Alto
CA
|
Family ID: |
38459802 |
Appl. No.: |
13/764200 |
Filed: |
February 11, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12280793 |
Jan 9, 2009 |
8372861 |
|
|
PCT/US2007/062917 |
Feb 27, 2007 |
|
|
|
13764200 |
|
|
|
|
60777458 |
Feb 27, 2006 |
|
|
|
Current U.S.
Class: |
514/299 |
Current CPC
Class: |
A61P 35/00 20180101;
A61P 37/06 20180101; A61K 31/00 20130101; A61K 31/435 20130101;
C07D 417/12 20130101; C07D 495/04 20130101; C07D 221/04 20130101;
G01N 33/5011 20130101; A61K 45/00 20130101; G01N 33/5041
20130101 |
Class at
Publication: |
514/299 |
International
Class: |
A61K 31/435 20060101
A61K031/435; A61K 45/00 20060101 A61K045/00 |
Goverment Interests
STATEMENT OF GOVERNMENTAL SUPPORT
[0001] This invention was made with government support under
contract 1R01CA112108-01A1, awarded by the National Institutes of
Health. The government has certain rights in the invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application is a divisional application of U.S. patent
application Ser. No. 12/280,793 filed on Jan. 9, 2009, which is
U.S. Pat. No. 8,372,861, which is a national stage application of
PCT International Application No. PCT/US07/062,917, filed Feb. 27,
2007, which claims priority of U.S. Provisional Application No.
60/777,458, filed Feb. 27, 2006, all of the preceding disclosures
of which are hereby incorporated by reference in their
entirety.
REFERENCE TO SEQUENCE LISTING, COMPUTER PROGRAM, OR COMPACT
DISK
[0003] In accordance with "Legal Framework for EFS-Web," (6 Apr.
11) Applicants submit herewith a sequence listing as an ASCII text
file. The text file will serve as both the paper copy required by
37 CFR 1.821(c) and the computer readable form (CRF) required by 37
CFR 1.821(e). The date of creation of the file was Feb. 11, 2013,
named 3815.sub.--69.sub.--2_seq_list.txt, and the size of the ASCII
text file in bytes is 9,520. Applicants incorporate the contents of
the sequence listing by reference in its entirety.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] The present invention relates generally to compounds,
compositions, and packaged pharmaceuticals useful in the treatment
of disorders characterized by cell growth in hypoxic conditions,
such as cancers, in particular solid tumors. More specifically, the
invention relates to compounds, compositions, and packaged
pharmaceuticals that inhibit the activity of IRE1. The invention
also relates to methods for inhibiting the unfolded protein
response, for inhibiting IRE1, and for treating or preventing
disorders associated with the unfolded protein response.
[0006] 2. Related Art
[0007] Presented below is background information on certain aspects
of the present invention as they may relate to technical features
referred to in the detailed description, but not necessarily
described in detail. The discussion below should not be construed
as an admission as to the relevance of the information to the
claimed invention or the prior art effect of the material
described.
[0008] A defining feature of solid tumors is their capacity to
divide aggressively and disseminate metastases under conditions of
nutrient deprivation and limited oxygen availability. These severe
stresses arise from inadequate perfusion as the primary tumor
rapidly outgrows its initial blood supply, and from dramatic
structural abnormalities of tumor vessels that can lead to
disturbed microcirculation (Hockel and Vaupel, Semin. Oncol. 28(2
Suppl 8):36-41, 2001; Vaupel, et al. Med. Oncol. 18:243-59, 2001).
As a result, regions of low O.sub.2 tension, or hypoxia, are
heterogeneously distributed within the tumor mass. While tumor
hypoxia is a physiological barrier to cell survival, it
paradoxically drives malignant progression by imposing a powerful
selective pressure for cells that can best adapt to this stress and
subsequently resume cell division.
[0009] Tumor hypoxia also correlates with a more aggressive disease
course and increased failure following radiation and chemotherapy.
The presence of hypoxia has been demonstrated in a wide variety of
human cancers, including cervix, breast, lung, brain, pancreas,
head and neck, and prostate (Evans S., & Koch C. Cancer Lett.
195:1-16, 2003). Many of these tumors contained regions of severe
hypoxia (<5 mmHg oxygen). Clinically, the duration of disease-
and progression-free survival correlates inversely with the degree
of tumor hypoxia. For example, in patients with squamous carcinoma
of the head and neck, the one year disease-free survival was 78%
for patients with median tumor pO2 >10 mm Hg but only 22% for
median pO2 <10 mm (Brizel, et al., Int. J. Radiat. Oncol. Biol.
Phys. 38:285-9, 1997). Hypoxic cells also exhibit increased
resistance to standard radiation and chemotherapy treatment
programs, as these cells are relatively isolated from the blood
supply and because radiation and chemotherapy preferentially kill
rapidly dividing cell populations. Collectively, these findings
provide strong evidence that hypoxia has a profound impact on tumor
growth and clinical outcome.
[0010] Hypoxia dramatically reshapes cellular physiology, causing
cell cycle arrest, a shift in energy production to glycolysis,
elevated secretion of survival and pro-angiogenic factors,
expression of genes involved in drug resistance, and increased cell
motility and invasion. A watershed discovery linking these profound
changes to the control of gene expression was made with the
identification of hypoxia-inducible factor (HIF), a heterodimeric
transcription factor that exerts control over a broad range of
cellular pathways including glycolysis, angiogenesis and
erythropoiesis (Semenza, Trends Mol. Med. 2002 8(4 Suppl):S62-7,
2002; Semenza, Nat. Rev. Cancer 3:721-32, 2003).
[0011] While HIF controls the expression of more than 60 genes and
constitutes a key node in cellular stress signaling, HIF activation
alone cannot account for the full repertoire of changes that occur
intracellularly as oxygen becomes limiting. The hypoxic cell also
elicits additional, HIF-1-independent, adaptive responses that
contribute to increased survival under low oxygen conditions. For
example, an immediate reaction to hypoxia is a reduction in the
rates of global protein synthesis, which reduces energy demands
when oxygen and ATP levels are low (Hochachka et al., Proc. Natl.
Acad. Sci. USA, 93:9493-8, 1996). Further, hypoxia causes a sharp
increase in the expression of molecular chaperones, which assist in
protein refolding and in the degradation of terminally misfolded
conformers. Underlying these changes is a coordinated cellular
program called the unfolded protein response (UPR) that serves as a
master regulator of cellular homeostasis and which plays a
fundamental cytoprotective role during cellular stresses such as
hypoxia.
[0012] The endoplasmic reticulum (ER) is an extensive intracellular
membrane network that extends throughout the cytoplasm and
functions primarily to process newly synthesized secretory and
transmembrane proteins. Accumulation of unfolded proteins in this
compartment causes ER stress, with prolonged ER stress resulting in
cell death. The cellular response to ER stress consists of at least
two coordinated pathways: 1) rapid translational arrest mediated by
PERK (pancreatic ER kinase or PKR-like ER kinase); and 2)
transcriptional activation of unfolded protein response (UPR)
target genes (Ron D. J. Clin. Invest. 110:1383-1388, 2002; Harding
H., et al. Annu. Rev. Cell. Dev. Biol. 18:575-599, 2002; Feldman D.
E., et al. Mol. Cancer. Res. 3:597-605, 2005). In addition to solid
tumors, the UPR has been implicated in diseases such as
conformational diseases, diabetes, cardiovascular disease,
atherosclerosis, viral infection, and cerebrovascular disease
(Schroder M., et al. Mutat. Res. 569:29-63, 2005; Kaufman R. J.
Clin. Invest. 110:1389-1398, 2002).
[0013] During normal embryonic development, activation of the UPR
is essential for the maturation of secretory cells in the liver and
pancreas, and drives an expansion of the ER in antibody-secreting B
lymphocytes to accommodate increased secretory load. Iwakoshi et
al., Immunological Reviews 194: 29-38 (2003); Harding et al.,
Molecular Cell 5: 897-904 (2000); Shaffer et al., Immunity 21:
81-93 (2004); Reimold et al., Genes Dev 14: 152-157 (2000). Several
lines of evidence have also implicated the UPR in various disease
processes, such as diabetes and cardiovascular disease, and as a
survival mechanism underlying tumor growth and the adaptation of
malignant cells to hypoxic stress. Ma and Hendershot, Nat Rev
Cancer 4: 966-977 (2004); Feldman et al., Mol Cancer Res 3: 597-605
(2005); Koumenis, Curr Mol Med 6: 55-69 (2006).
[0014] A critical feature of malignant tumors is their capacity to
survive and seed distant metastases under conditions of nutrient
deprivation and limited oxygen availability. Hockel and Vaupel,
Seminars in Oncology 28: 36-41 (2001); Vaupel et al., Methods in
Enzymology 381: 335-354 (2004); Subarsky and Hill, Clin Exp
Metastasis 20: 237-250 (2003). Intratumoral hypoxia arises solid
tumors through severe structural abnormalities of tumor vasculature
and disturbed microcirculation, resulting in tissue regions of
extremely low O.sub.2 partial pressures distributed heterogeneously
within the tumor mass. Vaupel et al., Methods in Enzymology 381:
335-354 (2004); Hockel and Vaupel, Journal of the National Cancer
Institute 93: 266-276 (2001); Vaupel et al., Medical Oncology 18:
243-259 (2001). Since the delivery of oxygen and nutrients to the
tumor is determined by fluctuating blood flow, different regions of
the tumor must constantly adjust to varying degrees of nutrient
deprivation. The tumor microenvironment thus imposes a strong
selective pressure for cells best adapted for survival under these
stresses. Adaptation to hypoxia contributes to the diminished
apoptotic potential of tumor cells and accounts for many of the
clinical consequences of malignant progression, including
locoregional tumor recurrence and distant metastases. Evans and
Koch, Cancer Letters 195: 1-16 (2003); Le et al., Cancer Metastasis
Rev 23: 293-310 (2004). Hypoxia-mediated clonal expansion of cells
with diminished apoptotic potential has been demonstrated in vitro,
and hypoxic cells exhibit increased metastatic potential. Erler et
al., Nature 440: 1222-1226 (2006); Graeber et al., Nature 379:
88-91 (1996). Importantly, depletion of molecular oxygen or glucose
impairs the posttranslational modification and oxidative folding of
secretory proteins, providing a direct biochemical link between
nutrient deprivation in tumors and activation of the UPR. Tu et
al., Science 290: 1571-1574 (2000); Koumenis et al., Molecular
& Cellular Biology 22: 7405-7416 (2002).
[0015] PERK, an ER transmembrane protein, was first identified as
regulating translational attenuation during ER stress through the
phosphorylation of translation initiation factor eIF2.alpha.. While
most mRNA translation is repressed following phosphorylation of
eIF2.alpha., activating transcription factor 4 (ATF4) is
selectively translated during ER stress leading to increased
expression of chaperones, foldases, and downstream targets such as
CHOP/GADD153, a pro-apoptotic gene. Koumenis et al demonstrated
that translational control of protein synthesis during hypoxia also
occurs through the activation of PERK. These investigators showed
that PERK-/- MEFs where unable to phosphorylate eIF2.alpha. and had
decreased survival after exposure to hypoxia compared to the
wild-type MEFs. They concluded that PERK plays an important role in
hypoxia-induced translation attenuation, further supporting a role
for hypoxia in the development of ER stress (Koumenis et al., Mol.
Cell. Biol. 22:7405-7416 (2002)). A rapid decrease in de novo
protein synthesis upon exposure to hypoxia has also been observed
(Chen et al., Cancer Res. 64:7302-7310 (2004)). Downstream of PERK,
ATF4 is also activated by hypoxia in a HIF-1 independent manner.
One consequence of ATF4 activation is induction of a GADD34 which
feeds back to desphosphorylate eIF2.alpha. and release cells from
translational inhibition.
[0016] In coordination with the inhibition of protein synthesis,
the UPR is also responsible for the transcriptional activation of a
discrete set of genes. These genes function to increase the
cellular folding capacity through the induction of ER chaperone
proteins and folding enzymes. The UPR is a conserved stress
response and many of its downstream target genes have been
characterized in yeast and mammalian cells. In mammalian cells,
activating transcription factor 6 (ATF6) and X-box binding protein
(XBP1) are critical regulators of the transcriptional response to
ER stress.
[0017] The ER resident transmembrane protein IRE1 is conserved in
throughout eukaryotic phylogeny and functions as both a proximal
sensor of ER stress and as a critical UPR signal transducer via its
dual cytoplasmic kinase and endoribonuclease domains. Tirasophon et
al., Genes Dev 12: 1812-1824 (1998). Mammalian IRE1.alpha., the
major functional homolog of yeast IRE1.alpha., excises a
26-nucleotide intron from the mRNA encoding the bZIP transcription
factor XBP-1. This introduces a translational frame shift
downstream of the splice site to generate XBP-1s, a potent
transcription factor. Yoshida et al., Cell 107: 881-891 (2001);
Calfon et al., Nature 415: 92-96 (2002); Lee et al., Genes &
Development 16: 452-466 (2002). XBP-1s drives an expansion of ER
capacity through the increased expression of molecular chaperones
and components of the ER-associated protein degradation (ERAD)
machinery that is required for the clearance of terminally
misfolded proteins. Schroder and Kaufman, Mutation Research 569:
29-63 (2005); Lee et al., Molecular & Cellular Biology 23:
7448-7459 (2003). IRE1.alpha. is extensively activated in hypoxic
regions of human tumor xenografts throughout tumorigenesis (Feldman
et al., Mol Cancer Res 3: 597-605 (2005)), and transformed mouse
fibroblasts genetically deleted for XBP-1 exhibit increased
sensitivity to hypoxia and fail to grow as tumors when implanted
into immune-deficient mice (Romero-Ramirez et al., Cancer Research
64: 5943-5947 (2004)). Activation of IRE1.alpha. by ER stress
triggers multiple signaling outputs that extend beyond the
splice-activation of XBP-1, including IRE1.alpha.
endonuclease-mediated cleavage of a subset of mRNAs encoding
secretory proteins (Hollien and Weissman, Science 313: 104-107
(2006)), and activation of autophagy and apoptosis pathways through
the IRE1.alpha. kinase domain and its downstream effectors
caspase-12, ASK1, and JNK1 (Ogata et al., Mol Cell Biol (2006);
Urano et al., Science 287: 664-666 (2000)). Thus IRE1.alpha. may
participate in both cytoprotective and pro-apoptotic pathways.
[0018] A schematic of the UPR pathway is shown in FIG. 1. In this
model, GRP78 regulates each of the major branches of the UPR by
direct association with ATF6, IRE1 and PERK. Given its importance
in regulating the UPR, GRP78 levels can be increased by downstream
signaling from each of these pathways, indicating that significant
overlap occurs in activation of the UPR.
[0019] The functional link between the UPR and hypoxia was found
through studies on GRP78, a critical regulator of the UPR.
Expression of the glucose regulated family of proteins (GRPs)
within solid tumors was recognized more than a decade ago. These
experiments indicate that glucose starvation and hypoxia were
physiologically relevant stresses occurring during the growth of
solid tumors (Cai J., et al., J. Cell. Physiol. 154:229-237, 1993).
Furthermore, cells in which GRP78 expression was inhibited through
an antisense strategy exhibited increased sensitivity to hypoxia
compared to the parental wild-type cell line (Koong A., et al.,
Int. J. Radiat. Oncol. Biol. Phys. 28:661-666, 1994).
[0020] Other UPR regulated genes such as GRP94 and protein
disulfide isomerase (PDI) have also been implicated in mediating
neuronal survival after ischemia/reperfusion injury (Sullivan D.,
et al., J. Biol. Chem. 278:47079-47088, 2003; Bando Y., et al.,
Eur. J. Neurosci. 18, 2003.). Similarly, oxygen regulated protein
150 kDal (ORP150, also known as GRP170), another ER chaperone
protein, protected neurons from ischemic stress in a cell culture
model and reduced the cerebral infarct area after middle cerebral
artery occlusion in a transgenic mouse model (Tamatani M., et al.,
Nat. Med. 7:317-323, 2001).
[0021] These studies indicate that the UPR has a broad range of
functions during hypoxia including promotion of cell survival and
regulation of angiogenesis. Given its role in regulating survival
under hypoxia and its requirement for tumor growth, targeting XBP-1
may be an effective therapeutic strategy. However, there are
currently few examples of anti-cancer drugs that can effectively
inhibit transcription factor activation. There thus remains a need
for compositions that may be employed to inhibit the activity of
XBP-1 and thereby prevent or inhibit tumor growth.
[0022] Identification of compounds capable of inhibiting the
activity of XBP-1 and thereby capable of preventing or inhibiting
tumor growth would be facilitated by assays suitable for use in
high throughput screens. Direct measurement of XBP-1 levels in
cells is not easily automated. Convenient and easily detectable
substrates for the endonuclease or kinase activities of IRE1 are
currently unavailable. US Patent Application No. 2003/0224428
reports methods purportedly useful in screening inhibitors of
IRE1-mediated processing of untranslatable XBP-1 mRNA. The reported
methods are limited to the screening of plasma cells or
virus-infected cells, however, and are therefore unsuitable for
identifying compounds useful in the treatment or prevention of
disorders in more general cell types and tissues. The methods also
fail to account for the effects of tumor microenvironment, such as,
for example, hypoxia, on the activity of potential therapeutic
compounds. The methods also lack steps to counterscreen for
compounds causing non-specific effects on the detectable marker and
for compounds that are toxic to cells even in the absence of ER
stress. The methods would therefore falsely identify compounds that
have nothing to do with the UPR and that would be unsuitable for
therapeutic use. Furthermore, the methods have not been shown to be
suitable for use in high throughput screening assays.
[0023] Due to the importance of the unfolded protein response in
cellular metabolism, and, in particular, in pathological processes,
there is great interest in developing inhibitors with defined
specificities against this process. Such inhibitors can help to
identify target enzymes in cells, particularly where the cells are
associated with particular indications, and can provide new drug
candidates. There is thus a need for inhibitors of the unfolded
protein response and novel methods of inhibiting this pathway, as
well as methods of treating or preventing disorders of the unfolded
protein response and methods of identifying novel inhibitors of the
pathway.
Claims
1. A method for inhibiting an unfolded protein response in a
mammalian host, comprising administering to the mammalian host in
need thereof a therapeutically-effective amount of a pharmaceutical
composition comprising a compound represented by structural formula
(I): ##STR00096## or a pharmacuetically acceptable salt thereof,
wherein: X is S; Y is O or S; Z.sub.1, Z.sub.2, Z.sub.3, and
Z.sub.4 are each C(R.sub.6)(R.sub.6'); n is 0; R.sub.1, R.sub.1',
R.sub.6, and R.sub.6' are independently hydrogen, alkyl, halo, or
cyano; R.sub.2 is alkyl or cyano; R.sub.3 is alkyl or haloalkyl and
is optionally substituted with 1-3 J groups; R.sub.4 is hydrogen;
R.sub.4' is selected from the group consisting of ##STR00097## and
J is one of alkyl or halo and a pharmaceutically acceptable
carrier.
2. A method for inhibiting IRE1 in a mammalian host, comprising
administering to the mammalian host in need thereof a
therapeutically-effective amount of the pharmaceutical composition
comprising a compound represented by structural formula (I) as set
forth in claim 1.
3. A method for treating or preventing a disorder associated with
the unfolded protein response in a mammalian host, comprising
administering to the mammalian host in need thereof a
therapeutically-effective amount of the pharmaceutical composition
comprising a compound represented by structural formula (I) as set
forth in claim 1.
4. The method of claim 3, wherein the disorder is characterized by
uncontrolled cell growth under conditions of hypoxia or ER
stress.
5. The method of claim 3, wherein the disorder is selected from the
group consisting of cancer, autoimmune disorders, and diabetes.
6. The method of claim 5, wherein the cancer is selected from the
group consisting of multiple myeloma, cervical cancer, brain
cancer, pancreatic cancer, head and neck cancers, prostate cancer,
breast cancer, soft tissue sarcomas, primary and metastatic liver
cancer, primary and metastatic lung cancer, esophageal cancer,
colorectal cancer, lymphoma, and leukemia.
7. The method of claim 5, wherein the cancer is a solid tumor.
8. The method of claim 7, wherein the solid tumor is a sarcoma, a
carcinoma, or a lymphoma.
9. The method of claim 5, wherein the autoimmune disorder is
selected from the group consisting of: diabetes, lupus, rheumatoid
arthritis, psoriasis, multiple sclerosis, and inflammatory bowel
disease.
10. The method of claim 9, wherein the inflammatory bowel disease
is selected from the group consisting of: ulcerative colitis and
Crohn's disease.
11. The method of claim 9, wherein the autoimmune disorder is
rheumatoid arthritis.
12. The method of claim 5, wherein the disorder is cancer and
wherein the method further comprises administration of a
chemotherapeutic agent.
13. The method of claim 12, wherein the chemotherapeutic agent is
selected from the group consisting of bevacizumab, bortezomib,
cetuximab, erlotinib, gemcitabine, cisplatin, oxaliplatin,
etoposide, adriamycin, taxol, and thalidomide.
14. A packaged pharmaceutical comprising a pharmaceutical
composition of a compound of Formula I and instructions for using
the composition to inhibit the unfolded protein response in a
mammalian host, wherein Formula I is as follows: ##STR00098## or a
pharmacuetically acceptable derivative or prodrug thereof, wherein:
X is O, S, or N--R.sub.4''; Y is O or S; Z.sub.1, Z.sub.2, Z.sub.3,
and Z.sub.4 are independently C(R.sub.6)(R.sub.6') or NR.sub.4'',
provided that only one of Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 at
a time is N--R.sub.4''; n is 0-2; R.sub.1, R.sub.1', R.sub.6, and
R.sub.6' are independently hydrogen, alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and are optionally substituted
with 1-3 J groups; R.sub.2 is alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; R.sub.3 is alkyl, alkenyl, alkynyl, aralkyl,
alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl, cycloalkoxy,
haloalkyl, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; R.sub.1, R.sub.1', and R.sub.2 taken together
may form ##STR00099## wherein R.sub.5 is hydrogen, alkyl, alkenyl,
alkynyl, aryl, aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl,
cycloalkenyl, cycloalkoxy, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, hydroxy, thio, amino,
alkylamino, alkanoylamino, aroylamino, aralkanoylamino, carboxy,
carbonate, carbamate, guanidinyl, urea, halo, cyano, nitro, formyl,
acyl, phosphoryl, sulfonyl, or sulfonamido and is optionally
substituted with 1-3 J groups; R.sub.4, R.sub.4', and R.sub.4'' are
independently hydrogen, alkyl, alkenyl, alkynyl, aryl, aralkyl,
aralkenyl, cycloalkyl, cycloalkenyl, cycloalkoxy, heterocyclyl,
heterocyclylalkyl, heteroaryl, heteroaralkyl, formate, formamide,
acyl, phosphoryl, sulfonyl, or sulfonamido and are optionally
substituted with 1-3 J groups, wherein R.sub.4 and R.sub.4' taken
together with the N atom to which they are attached complete a
cyclic structure having from 4 to 8 atoms in the ring; J is alkyl,
alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, aralkoxy,
cycloalkyl, cycloalkoxy, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, keto, hydroxy, thio,
amino, alkylamino, alkanoylamino, aroylamino, aralkanoylamino,
carboxy, carbonate, carbamate, guanidinyl, urea, halo, cyano,
nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido and is
optionally substituted with 1-3 J' groups; and J' is alkyl,
alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, heterocyclyl,
heterocyclyloxy, keto, hydroxy, thio, amino, alkanoylamino,
aroylamino, carboxy, carbonate, carbamate, guanidinyl, urea, halo,
cyano, nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido;
and a pharmaceutically acceptable carrier.
Description
BRIEF SUMMARY OF THE INVENTION
[0024] The following brief summary is not intended to include all
features and aspects of the present invention, nor does it imply
that the invention must include all features and aspects discussed
in this summary.
[0025] The present invention addresses these problems by providing
novel inhibitors of the unfolded protein response, compositions,
packaged pharmaceuticals, and methods of use thereof.
[0026] In one aspect, the invention provides compounds represented
by structural formula (I):
##STR00001##
[0027] or a pharmacuetically acceptable derivative or prodrug
thereof, wherein: [0028] X is O, S, or N--R.sub.4''; [0029] Y is O
or S; [0030] Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 are
independently C(R.sub.6)(R.sub.6') or NR.sub.4'', provided that
only one of Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 at a time is
N--R.sub.4''; [0031] n is 0-2; [0032] R.sub.1, R.sub.1', R.sub.6,
and R.sub.6' are independently hydrogen, alkyl, alkenyl, alkynyl,
aryl, aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and are optionally substituted
with 1-3 J groups; [0033] R.sub.2 is alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0034] R.sub.3 is alkyl, alkenyl, alkynyl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, haloalkyl, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, hydroxy, thio, amino,
alkylamino, alkanoylamino, aroylamino, aralkanoylamino, carboxy,
carbonate, carbamate, guanidinyl, urea, halo, cyano, nitro, formyl,
acyl, phosphoryl, sulfonyl, or sulfonamido and is optionally
substituted with 1-3 J groups; [0035] R.sub.1, R.sub.1', and
R.sub.2 taken together may form
##STR00002##
[0035] wherein R.sub.5 is hydrogen, alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0036] R.sub.4, R.sub.4', and R.sub.4'' are
independently hydrogen, alkyl, alkenyl, alkynyl, aryl, aralkyl,
aralkenyl, cycloalkyl, cycloalkenyl, cycloalkoxy, heterocyclyl,
heterocyclylalkyl, heteroaryl, heteroaralkyl, formate, formamide,
acyl, phosphoryl, sulfonyl, or sulfonamido and are optionally
substituted with 1-3 J groups, wherein R.sub.4 and R.sub.4' taken
together with the N atom to which they are attached complete a
cyclic structure having from 4 to 8 atoms in the ring; [0037] J is
alkyl, alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, aralkoxy,
cycloalkyl, cycloalkoxy, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, keto, hydroxy, thio,
amino, alkylamino, alkanoylamino, aroylamino, aralkanoylamino,
carboxy, carbonate, carbamate, guanidinyl, urea, halo, cyano,
nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido and is
optionally substituted with 1-3 J' groups; and [0038] J' is alkyl,
alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, heterocyclyl,
heterocyclyloxy, keto, hydroxy, thio, amino, alkanoylamino,
aroylamino, carboxy, carbonate, carbamate, guanidinyl, urea, halo,
cyano, nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido;
[0039] provided that when X is S and Y is O; [0040] R.sub.1 and
R.sub.1' are hydrogen and R.sub.2 is CN or R.sub.1, R.sub.1', and
R.sub.2 together form
[0040] ##STR00003## [0041] Z.sub.1, Z.sub.3, and Z.sub.4 are
CH.sub.2, and Z.sub.2 is CH.sub.2, NC(O)CH.sub.3, CHCH.sub.3,
CHCH.sub.2CH.sub.3, CHCH(CH.sub.3).sub.2,
CHCH.sub.2CH(CH.sub.3).sub.2, or CH-phenyl; [0042] and R.sub.3 is
CH.sub.3, CF.sub.3, i-Bu, Br, C(O)OEt, or CH.dbd.CH-phenyl; [0043]
then R.sub.4 and R.sub.4' are not both hydrogen or ethyl; R.sub.4
and R.sub.4' taken together with the N atom to which they are
attached do not form a tetrahydroisoquinoline or
N-methylpiperazine; and when R.sub.4 is hydrogen, R.sub.4' is not
C.sub.1-4 alkyl; CH.sub.2COOH; unsubstituted cyclohexyl;
unsubstituted naphthyl; unsubstituted adamantyl;
##STR00004## ##STR00005## ##STR00006##
[0044] In some embodiments of the invention, Z.sub.1, Z.sub.2,
Z.sub.3, and Z.sub.4 are C(R.sub.6)(R.sub.6'), and n is 0 or 1.
[0045] In some embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0046] In some embodiments, X is S.
[0047] In some embodiments, Y is O.
[0048] In some embodiments, R.sub.3 is alkyl or haloalkyl.
[0049] In other embodiments, R.sub.3 is CF.sub.3.
[0050] In some embodiments, R.sub.1 and R.sub.1' are both
hydrogen.
[0051] In some embodiments, R.sub.1 and R.sub.1' are both hydrogen,
and R.sub.2 is CN.
[0052] In some embodiments, R.sub.1, R.sub.1', and R.sub.2 together
form
##STR00007##
and in more specific embodiments, R.sub.5 is NH.sub.2.
[0053] In some embodiments, R.sub.4 is hydrogen, and R.sub.4' is an
optionally substituted aryl, heteroaryl, aralkyl, or
heteroaralkyl.
[0054] In specific embodiments, R.sub.4' is an optionally
substituted
##STR00008##
pyridinyl, phenyl, or benzyl.
[0055] In even more specific embodiments, R.sub.4' is substituted
with one or two CH.sub.3, CH.sub.2CH.sub.3, CN, OCH.sub.3, or
phenyl groups.
[0056] In still more specific embodiments, R.sub.4' is
##STR00009##
[0057] In even more specific embodiments, R.sub.4' is
##STR00010##
[0058] In some embodiments, R.sub.4 and R.sub.4' are both
alkyl.
[0059] In more specific embodiments, R.sub.4 and R.sub.4' are both
ethyl.
[0060] In some embodiments, Z.sub.2 is NR.sub.4''; and R.sub.4'' is
C(O)CH.sub.3.
[0061] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.1 and
R.sub.1' are hydrogen, R.sub.2 is CN, and R.sub.3 is CF.sub.3.
[0062] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0063] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.1,
R.sub.1', and R.sub.2 together form
##STR00011##
R.sub.3 is CF.sub.3, and R.sub.5 is NH.sub.2.
[0064] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0065] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.3 is
CF.sub.3, R.sub.4 is hydrogen, and R.sub.4' is
##STR00012##
[0066] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0067] In some embodiments, R.sub.1, R.sub.1', R.sub.2, R.sub.3,
R.sub.4, R.sub.4', R.sub.4'', R.sub.5, J, and J' each independently
contains 10 or fewer non-hydrogen atoms.
[0068] In specific embodiments, R.sub.1, R.sub.1', R.sub.2,
R.sub.3, R.sub.4, R.sub.4', R.sub.4'', R.sub.5, J, and J' each
independently contains 6 or fewer non-hydrogen atoms.
[0069] In another aspect, the invention provides a pharmaceutical
composition comprising a compound represented by structural formula
(I):
##STR00013##
[0070] or a pharmacuetically acceptable derivative or prodrug
thereof, wherein: [0071] X is O, S, or N--R.sub.4''; [0072] Y is O
or S; [0073] Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 are
independently C(R.sub.6)(R.sub.6') or NR.sub.4'', provided that
only one of Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 at a time is
N--R.sub.4''; [0074] n is 0-2; [0075] R.sub.1, R.sub.1', R.sub.6,
and R.sub.6' are independently hydrogen, alkyl, alkenyl, alkynyl,
aryl, aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and are optionally substituted
with 1-3 J groups; [0076] R.sub.2 is alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0077] R.sub.3 is alkyl, alkenyl, alkynyl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, haloalkyl, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, hydroxy, thio, amino,
alkylamino, alkanoylamino, aroylamino, aralkanoylamino, carboxy,
carbonate, carbamate, guanidinyl, urea, halo, cyano, nitro, formyl,
acyl, phosphoryl, sulfonyl, or sulfonamido and is optionally
substituted with 1-3 J groups; [0078] R.sub.1, R.sub.1', and
R.sub.2 taken together may form
##STR00014##
[0078] wherein R.sub.5 is hydrogen, alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0079] R.sub.4, R.sub.4', and R.sub.4'' are
independently hydrogen, alkyl, alkenyl, alkynyl, aryl, aralkyl,
aralkenyl, cycloalkyl, cycloalkenyl, cycloalkoxy, heterocyclyl,
heterocyclylalkyl, heteroaryl, heteroaralkyl, formate, formamide,
acyl, phosphoryl, sulfonyl, or sulfonamido and are optionally
substituted with 1-3 J groups, wherein R.sub.4 and R.sub.4' taken
together with the N atom to which they are attached complete a
cyclic structure having from 4 to 8 atoms in the ring; [0080] J is
alkyl, alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, aralkoxy,
cycloalkyl, cycloalkoxy, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, keto, hydroxy, thio,
amino, alkylamino, alkanoylamino, aroylamino, aralkanoylamino,
carboxy, carbonate, carbamate, guanidinyl, urea, halo, cyano,
nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido and is
optionally substituted with 1-3 J' groups; and [0081] J' is alkyl,
alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, heterocyclyl,
heterocyclyloxy, keto, hydroxy, thio, amino, alkanoylamino,
aroylamino, carboxy, carbonate, carbamate, guanidinyl, urea, halo,
cyano, nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido;
and a pharmaceutically acceptable carrier.
[0082] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are C(R.sub.6)(R.sub.6'), and n is 0 or 1.
[0083] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0084] In other embodiments, X is S.
[0085] In other embodiments, Y is O.
[0086] In other embodiments, R.sub.3 is alkyl or haloalkyl.
[0087] In specific embodiments, R.sub.3 is CF.sub.3.
[0088] In other embodiments, R.sub.1 and R.sub.1' are both
hydrogen.
[0089] In other embodiments, R.sub.1 and R.sub.1' are both
hydrogen, and R.sub.2 is CN.
[0090] In still other embodiments, R.sub.1, R.sub.1', and R.sub.2
together form
##STR00015##
[0091] In specific embodiments, R.sub.5 is NH.sub.2.
[0092] In some embodiments, R.sub.4 is hydrogen; and R.sub.4' is an
optionally substituted aryl, heteroaryl, aralkyl, or
heteroaralkyl.
[0093] In specific embodiments, R.sub.4' is an optionally
substituted
##STR00016##
pyridinyl, phenyl, or benzyl.
[0094] In more specific embodiments, R.sub.4' is substituted with
one or two CH.sub.3, CH.sub.2CH.sub.3, CN, OCH.sub.3, or phenyl
groups.
[0095] In even more specific embodiments, R.sub.4' is
##STR00017##
[0096] In still more specific embodiments, R.sub.4' is
##STR00018##
[0097] In some embodiments, R.sub.4 and R.sub.4' are both
alkyl.
[0098] In some embodiments, R.sub.4 and R.sub.4' are both
ethyl.
[0099] In some embodiments, R.sub.1 and R.sub.1' are both
hydrogen.
[0100] In some embodiments, Z.sub.2 is NR.sub.4'', and R.sub.4'' is
C(O)CH.sub.3.
[0101] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.1 and
R.sub.1' are hydrogen, R.sub.2 is CN, and R.sub.3 is CF.sub.3.
[0102] In some embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0103] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.1,
R.sub.1', and R.sub.2 together form
##STR00019##
R.sub.3 is CF.sub.3, and R.sub.5 is NH.sub.2.
[0104] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0105] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.3 is
CF.sub.3, R.sub.4 is hydrogen, and R.sub.4' is
##STR00020##
[0106] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0107] In some embodiments of the pharmaceutical composition of the
invention, the compound is selected from the group consisting
of:
##STR00021##
[0108] In some embodiments, R.sub.1, R.sub.1', R.sub.2, R.sub.3,
R.sub.4, R.sub.4', R.sub.4'', R.sub.5, J, and J' each independently
contains 10 or fewer non-hydrogen atoms.
[0109] In specific embodiments, R.sub.1, R.sub.1', R.sub.2,
R.sub.3, R.sub.4, R.sub.4', R.sub.4'', R.sub.5, J, and J' each
independently contains 6 or fewer non-hydrogen atoms.
[0110] In another aspect, the invention provides a packaged
pharmaceutical comprising any of the above pharmaceutical
compositions and instructions for using the composition to inhibit
the unfolded protein response in a mammalian host.
[0111] In still another aspect, the invention provides methods for
inhibiting the unfolded protein response in a mammalian host,
comprising administering to the mammalian host in need thereof a
therapeutically-effective amount of a pharmaceutical composition of
the invention.
[0112] In another aspect, the invention provides methods for
inhibiting IRE1 in a mammalian host, comprising administering to
the mammalian host in need thereof a therapeutically-effective
amount of a pharmaceutical composition of the invention.
[0113] In yet another aspect, the invention provides methods for
treating or preventing a disorder associated with the unfolded
protein response in a mammalian host, comprising administering to
the mammalian host in need thereof a therapeutically-effective
amount of a pharmaceutical composition of the invention.
[0114] In some embodiments, the disorder is characterized by
uncontrolled cell growth under conditions of hypoxia or ER
stress.
[0115] In some embodiments, the disorder is selected from the group
consisting of cancer, autoimmune disorders, and diabetes.
[0116] In some specific embodiments, the cancer is selected from
the group consisting of multiple myeloma, cervical cancer, brain
cancer, pancreatic cancer, head and neck cancers, prostate cancer,
breast cancer, soft tissue sarcomas, primary and metastatic liver
cancer, primary and metastatic lung cancer, esophageal cancer,
colorectal cancer, lymphoma, and leukemia.
[0117] In some embodiments, the cancer is a solid tumor.
[0118] In some specific embodiments, the solid tumor is a sarcoma,
a carcinoma, or a lymphoma.
[0119] In some specific embodiments, the autoimmune disorder is
selected from the group consisting of diabetes, lupus, rheumatoid
arthritis, psoriasis, multiple sclerosis, and inflammatory bowel
disease.
[0120] In some specific embodiments, the inflammatory bowel disease
is selected from the group consisting of ulcerative colitis and
Crohn's disease.
[0121] In some embodiments, the autoimmune disorder is rheumatoid
arthritis.
[0122] In some embodiments, the disorder is cancer, and the method
further comprises administration of a chemotherapeutic agent.
[0123] In some specific embodiments, the chemotherapeutic agent is
selected from the group consisting of bevacizumab, bortezomib,
cetuximab, erlotinib, gemcitabine, cisplatin, oxaliplatin,
etoposide, adriamycin, taxol, and thalidomide.
[0124] The details of various aspects of the invention are set
forth in the accompanying drawings and the description below. Other
features, objects, and advantages of the invention will be apparent
from the description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0125] FIG. 1 is a schematic of the unfolded protein response (UPR)
signaling pathway.
[0126] FIG. 2A is a schematic of a fusion protein in which
unspliced XBP-1 is fused in frame with luciferase. Under hypoxia or
ER stress, IRE1 splices a 26 nt sequence in XBP-1 causing a
translational frameshift that allows read through of a stop codon,
resulting in the production of an XBP-1-luciferase fusion protein.
FIG. 2B shows the fold change in luciferase activity (RLU),
detected after 24 hours of exposure to hypoxia, when HT1080 cells
stably expressing the IRE1 reporter are allowed to reoxygenate.
[0127] FIG. 3 is a schematic of an initial screen of a 66,000 small
molecule library for specific inhibitors of XBP-1.
[0128] FIG. 4 shows a "heat map" view of a single plate from the
primary screen for inhibitors of XBP-1.
[0129] FIG. 5A shows examples of individual compounds tested at 1
uM, 2 uM and 6 uM for inhibition of tunicamycin-(Tm) induced
transactivation of a 5 repeat XBP-1 promoter element
(5.times.-UPRE)-luciferase reporter construct transiently
transfected into HT1080 cells. FIG. 5B shows individual compounds
tested for inhibition of hypoxia (48 hours) induced transactivation
of the same UPRE-luciferase report construct transiently
transfected into HT1080 cells.
[0130] FIG. 6A shows XBP-1 expression as determined by RT-PCR in
HT1080 cells treated with hypoxia in the presence of various
candidate inhibitors compounds. FIG. 6B shows the inhibition of
XBP-luciferase reporter activity in hypoxia by the inventive
irestatins. HT1080 fibrosarcoma cells stably expressing the
Xbp-luciferase reporter were treated with 1 .mu.M of each Irestatin
or left untreated, and incubated in hypoxia (0.01% of oxygen) for
48 hours at 37.degree. C. Cells were harvested, lysed in reporter
lysis buffer, and assayed for luminescence using a luminometer.
[0131] FIGS. 7A and B show the hypoxia-specific cytotoxicity of
candidate IRE1 inhibitors on HT1080 sarcoma cells and MiaPACA-2
cells, respectively, as determined in a clonogenic survival assay.
FIG. 7C shows the inhibition of hypoxia survival of human tumor
cells by candidate IRE1 inhibitors.
[0132] FIG. 8 shows the inhibition of IRE1-mediated XBP-1 splicing
in hypoxia by the inventive irestatins.
[0133] FIGS. 9A-D illustrate the effects of administration of two
different potential irestatins to nude mice implanted with HT1080
cells stably expressing XBP-1s-luciferase. FIG. 9A shows
bioluminescent activity prior to injection, FIG. 9B shows activity
8 hours after injection, FIG. 9C shows activity 24 hours after
injection, and FIG. 9D shows activity 8 hours after a second
injection of the potential irestatins.
[0134] FIG. 10 shows the ability of the inventive irestatins to
inhibit tumor growth in vivo in a mouse model. Dose: 60 mg/kg ip
bolus injection every 48 hours. 5 total doses. 5-7 tumors per
group. PANC1 pancreatic adenocarcinoma cell line.
[0135] FIGS. 11A-H show the inhibitory effects of Irestatin 9389 on
the IRE1.alpha./XBP-1 pathway.
[0136] FIGS. 12A-G show the inhibitory effects of Irestatin 9389 on
the endonuclease function of IRE1.alpha..
[0137] FIGS. 13A-I show that exposure to irestatin 9389 induces
apoptosis and impairs cell survival under hypoxia and ER
stress.
[0138] FIGS. 14A-D show the in vivo antitumor activity of irestatin
9389.
[0139] FIG. 15 shows expression of XBP-1s in human pancreas tissue
specimens.
[0140] FIG. 16 shows histopathological analysis of mouse pancreas
and liver tissues.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
Definitions
[0141] Before further description of the invention, certain terms
employed in the specification, examples and appended claims are,
for convenience, collected here.
[0142] The term "alkoxy" refers to an alkyl group, in certain
specific embodiments, a lower alkyl group, having an oxygen
attached thereto. Representative alkoxy groups include methoxy,
ethoxy, propoxy, tert-butoxy, and the like.
[0143] The term "alkenyl", as used herein, refers to an aliphatic
group containing at least one double bond and is intended to
include both "unsubstituted alkenyls" and "substituted alkenyls",
the latter of which refers to alkenyl moieties having substituents
replacing a hydrogen on one or more carbons of the alkenyl group.
Such substituents may occur on one or more carbons that are
included or not included in one or more double bonds. Moreover,
such substituents include all those contemplated for alkyl groups,
as discussed below, except where stability is prohibitive. For
example, substitution of alkenyl groups by one or more alkyl,
cycloalkyl, heterocyclyl, aryl, or heteroaryl groups is
contemplated.
[0144] The term "alkyl" refers to the radical of saturated
aliphatic groups, including straight-chain alkyl groups,
branched-chain alkyl groups, cycloalkyl (alicyclic) groups,
alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted
alkyl groups. In some embodiments, a straight chain or branched
chain alkyl has 30 or fewer carbon atoms in its backbone (e.g.,
C.sub.1-C.sub.30 for straight chains, C.sub.3-C.sub.30 for branched
chains), and more specifically 20 or fewer. Likewise, some
cycloalkyls have from 3-10 carbon atoms in their ring structure,
and more specifically have 5, 6 or 7 carbons in the ring
structure.
[0145] Moreover, the term "alkyl" (or "lower alkyl") as used
throughout the specification, examples, and claims is intended to
include both "unsubstituted alkyls" and "substituted alkyls", the
latter of which refers to alkyl moieties having substituents
replacing a hydrogen on one or more carbons of the hydrocarbon
backbone. Such substituents can include, for example, a halo, a
hydroxyl, a carbonyl (such as a keto, a carboxy, an alkoxycarbonyl,
a formyl, or an acyl), a thiocarbonyl (such as a thioester, a
thioacetate, or a thioformate), an alkoxyl, a phosphoryl, a
phosphate, a phosphonate, a phosphinate, an amino, an amido, an
amidine, an imine, a cyano, a nitro, an azido, a thio, an
alkylthio, a sulfate, a sulfonate, a sulfamoyl, a sulfonamido, a
sulfonyl, a heterocyclyl, an aralkyl, or an aromatic or
heteroaromatic moiety. It will be understood by those skilled in
the art that the moieties substituted on the hydrocarbon chain can
themselves be substituted, if appropriate. For instance, the
substituents of a substituted alkyl may include substituted and
unsubstituted forms of amino, azido, imino, amido, phosphoryl
(including phosphonate and phosphinate), sulfonyl (including
sulfate, sulfonamido, sulfamoyl and sulfonate), and silyl groups,
as well as ethers, alkylthios, carbonyls (including ketones,
aldehydes, carboxylates, and esters), --CF.sub.3, --CN and the
like. Exemplary substituted alkyls are described below. Cycloalkyls
can be further substituted with alkyls, alkenyls, alkoxys,
alkylthios, aminoalkyls, carbonyl-substituted alkyls, --CF.sub.3,
--CN, and the like.
[0146] The term "C.sub.x-y" when used in conjunction with a
chemical moiety, such as, acyl, acyloxy, alkyl, alkenyl, alkynyl,
or alkoxy is meant to include groups that contain from x to y
carbons in the chain. For example, the term "C.sub.x-yalkyl" refers
to substituted or unsubstituted saturated hydrocarbon groups,
including straight-chain alkyl and branched-chain alkyl groups that
contain from x to y carbons in the chain, including haloalkyl
groups such as trifluoromethyl and 2,2,2-trifluoroethyl, etc.
"C.sub.0-alkyl" indicates a hydrogen where the group is in a
terminal position, or is a bond if internal. The terms
"C.sub.2-y-alkenyl" and "C.sub.2-y-alkynyl" refer to substituted or
unsubstituted unsaturated aliphatic groups analogous in length and
possible substitution to the alkyls described above, but that
contain at least one double or triple bond, respectively.
[0147] The term "alkylamino", as used herein, refers to an amino
group substituted with at least one alkyl group.
[0148] The term "alkylthio", as used herein, refers to a thiol
group substituted with an alkyl group and may be represented by the
general formula alkyl-S--.
[0149] The term "alkynyl", as used herein, refers to an aliphatic
group containing at least one triple bond and is intended to
include both "unsubstituted alkynyls" and "substituted alkynyls",
the latter of which refers to alkynyl moieties having substituents
replacing a hydrogen on one or more carbons of the alkynyl group.
Such substituents may occur on one or more carbons that are
included or not included in one or more triple bonds. Moreover,
such substituents include all those contemplated for alkyl groups,
as discussed above, except where stability is prohibitive. For
example, substitution of alkynyl groups by one or more alkyl,
cycloalkyl, heterocyclyl, aryl, or heteroaryl groups is
contemplated.
[0150] The term "amide", as used herein, refers to a group
##STR00022##
wherein R.sup.x and R.sup.y each independently represent a hydrogen
or hydrocarbyl group, or R.sup.x and R.sup.y taken together with
the N atom to which they are attached complete a heterocycle having
from 4 to 8 atoms in the ring structure.
[0151] The terms "amine" and "amino" are art-recognized and refer
to both unsubstituted and substituted amines and salts thereof,
e.g., a moiety that can be represented by
##STR00023##
wherein R.sup.x, R.sup.y, and R.sub.z each independently represent
a hydrogen or a hydrocarbyl group, or R.sup.x and R.sup.y taken
together with the N atom to which they are attached complete a
heterocycle having from 4 to 8 atoms in the ring structure.
[0152] The term "aminoalkyl", as used herein, refers to an alkyl
group substituted with an amino group.
[0153] The term "aralkyl", as used herein, refers to an alkyl group
substituted with an aryl group.
[0154] The term "aryl" as used herein includes substituted or
unsubstituted single-ring aromatic groups in which each atom of the
ring is carbon. In certain embodiments, the ring is a 5- to
7-membered ring, and in more specific embodiments is a 6-membered
ring. The term "aryl" also includes polycyclic ring systems having
two or more cyclic rings in which two or more carbons are common to
two adjoining rings wherein at least one of the rings is aromatic,
e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls,
cycloalkynyls, aryls, heteroaryls, and/or heterocyclyls. Aryl
groups include benzene, naphthalene, phenanthrene, phenol, aniline,
and the like.
[0155] The term "carbamate" is art-recognized and refers to a
group
##STR00024##
wherein R.sup.x and R.sup.y independently represent hydrogen or a
hydrocarbyl group, or R.sup.x and R.sup.y taken together with the
atoms to which they are attached complete a heterocycle having from
4 to 8 atoms in the ring structure.
[0156] The term "cycloalkyl", as used herein, refers to a
non-aromatic saturated or unsaturated ring in which each atom of
the ring is carbon. In certain embodiments, a cycloalkyl ring
contains from 3 to 10 atoms, and in more specific embodiments from
5 to 7 atoms.
[0157] The term "carbonate" is art-recognized and refers to a group
--OCO.sub.2--R.sup.4, wherein R.sup.4 represents a hydrocarbyl
group.
[0158] The term "carboxy", as used herein, refers to a group
represented by the formula --CO.sub.2H.
[0159] The term "ester", as used herein, refers to a group
--C(O)OR.sup.x wherein R.sup.x represents a hydrocarbyl group.
[0160] The term "ether", as used herein, refers to a hydrocarbyl
group linked through an oxygen to another hydrocarbyl group.
Accordingly, an ether substituent of a hydrocarbyl group may be
hydrocarbyl-O--. Ethers may be either symmetrical or unsymmetrical.
Examples of ethers include, but are not limited to,
heterocycle-O-heterocycle and aryl-O-heterocycle. Ethers include
"alkoxyalkyl" groups, which may be represented by the general
formula alkyl-O-alkyl.
[0161] The term "guanidinyl" is art-recognized and may be
represented by the general formula
##STR00025##
wherein R.sup.x and R.sup.y independently represent hydrogen or a
hydrocarbyl.
[0162] The terms "halo" and "halogen" as used herein mean halogen
and include chloro, fluoro, bromo, and iodo.
[0163] The terms "hetaralkyl" and "heteroaralkyl", as used herein,
refer to an alkyl group substituted with a hetaryl group.
[0164] The terms "heteroaryl" and "hetaryl" include substituted or
unsubstituted aromatic single ring structures, in certain specific
embodiments 5- to 7-membered rings, more specifically 5- to
6-membered rings, whose ring structures include at least one
heteroatom, in some embodiments one to four heteroatoms, and in
more specific embodiments one or two heteroatoms. The terms
"heteroaryl" and "hetaryl" also include polycyclic ring systems
having two or more cyclic rings in which two or more carbons are
common to two adjoining rings wherein at least one of the rings is
heteroaromatic, e.g., the other cyclic rings can be cycloalkyls,
cycloalkenyls, cycloalkynyls, aryls, heteroaryls, and/or
heterocyclyls. Heteroaryl groups include, for example, pyrrole,
furan, thiophene, imidazole, oxazole, thiazole, pyrazole, pyridine,
pyrazine, pyridazine, and pyrimidine, and the like.
[0165] The term "heteroatom" as used herein means an atom of any
element other than carbon or hydrogen. Typical heteroatoms are
nitrogen, oxygen, and sulfur.
[0166] The terms "heterocyclyl", "heterocycle", and "heterocyclic"
refer to substituted or unsubstituted non-aromatic ring structures,
in certain specific embodiments 3- to 10-membered rings, more
specifically 3- to 7-membered rings, whose ring structures include
at least one heteroatom, in some embodiments one to four
heteroatoms, and in more specific embodiments one or two
heteroatoms. The terms "heterocyclyl" and "heterocyclic" also
include polycyclic ring systems having two or more cyclic rings in
which two or more carbons are common to two adjoining rings wherein
at least one of the rings is heterocyclic, e.g., the other cyclic
rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls,
heteroaryls, and/or heterocyclyls. Heterocyclyl groups include, for
example, piperidine, piperazine, pyrrolidine, morpholine, lactones,
lactams, and the like.
[0167] The term "heterocyclylalkyl", as used herein, refers to an
alkyl group substituted with a heterocycle group.
[0168] The term "hydrocarbyl", as used herein, refers to a group
that is bonded through a carbon atom that does not have a .dbd.O or
.dbd.S substituent, and typically has at least one carbon-hydrogen
bond and a primarily carbon backbone, but may optionally include
heteroatoms. Thus, groups like methyl, ethoxyethyl, 2-pyridyl, and
trifluoromethyl are considered to be hydrocarbyl for the purposes
herein, but substituents such as acetyl (which has a .dbd.O
substituent on the linking carbon) and ethoxy (which is linked
through oxygen, not carbon) are not. Hydrocarbyl groups include,
but are not limited to aryl, heteroaryl, carbocycle, heterocycle,
alkyl, alkenyl, alkynyl, and combinations thereof.
[0169] The term "hydroxyalkyl", as used herein, refers to an alkyl
group substituted with a hydroxy group.
[0170] The term "lower" when used in conjunction with a chemical
moiety, such as, acyl, acyloxy, alkyl, alkenyl, alkynyl, or alkoxy
is meant to include groups where there are ten or fewer
non-hydrogen atoms in the substituent, and in certain embodiments,
six or fewer. A "lower alkyl", for example, refers to an alkyl
group that contains ten or fewer carbon atoms, and in specific
embodiments six or fewer carbon atoms. In certain embodiments, the
acyl, acyloxy, alkyl, alkenyl, alkynyl, and alkoxy substituents
defined herein are respectively lower acyl, lower acyloxy, lower
alkyl, lower alkenyl, lower alkynyl, and lower alkoxy, whether they
appear alone or in combination with other substituents, such as in
the recitations hydroxyalkyl and aralkyl (in which case, for
example, the atoms within the aryl group are not counted when
counting the carbon atoms in the alkyl substituent).
[0171] The terms "polycyclyl", "polycycle", and "polycyclic" refer
to two or more rings (e.g., cycloalkyls, cycloalkenyls,
cycloalkynyls, aryls, heteroaryls, and/or heterocyclyls) in which
two or more atoms are common to two adjoining rings, e.g., the
rings are "fused rings". Each of the rings of the polycycle can be
substituted or unsubstituted. In certain embodiments, each ring of
the polycycle contains from 3 to 10 atoms in the ring, more
specifically from 5 to 7.
[0172] The term "substituted" refers to moieties having
substituents replacing a hydrogen on one or more carbons of the
backbone. It will be understood that "substitution" or "substituted
with" includes the implicit proviso that such substitution is in
accordance with permitted valence of the substituted atom and the
substituent, and that the substitution results in a stable
compound, e.g., a compound that does not spontaneously undergo
transformation such as by rearrangement, cyclization, elimination,
etc., under conditions in which the compound is to be used. As used
herein, the term "substituted" is contemplated to include all
permissible substituents of organic compounds. In a broad aspect,
the permissible substituents include acyclic and cyclic, branched
and unbranched, carbocyclic and heterocyclic, aromatic and
non-aromatic substituents of organic compounds. The permissible
substituents can be one or more and the same or different for
appropriate organic compounds. For purposes of this invention, the
heteroatoms such as nitrogen may have hydrogen substituents and/or
any permissible substituents of organic compounds described herein
which satisfy the valences of the heteroatoms. Substituents may
include any substituents described herein, for example, a halogen,
a hydroxyl, a carbonyl (such as a keto, a carboxy, an
alkoxycarbonyl, a formyl, or an acyl), a thiocarbonyl (such as a
thioester, a thioacetate, or a thioformate), an alkoxyl, a
phosphoryl, a phosphate, a phosphonate, a phosphinate, an amino, an
amido, an amidine, an imine, a cyano, a nitro, an azido, a
sulfhydryl, an alkylthio, a sulfate, a sulfonate, a sulfamoyl, a
sulfonamido, a sulfonyl, a heterocyclyl, an aralkyl, or an aromatic
or heteroaromatic moiety. It will be understood by those skilled in
the art that the moieties substituted on the hydrocarbon chain may
themselves be substituted, if appropriate.
[0173] Unless specifically described as "unsubstituted", references
to chemical moieties herein are understood to include substituted
variants. For example, reference to an "aryl" group or moiety
implicitly includes both substituted and unsubstituted
variants.
[0174] The term "sulfate" is art-recognized and refers to the group
--OSO.sub.3H, or a pharmaceutically acceptable salt thereof.
[0175] The term "sulfonamide" is art-recognized and refers to the
group represented by the general formulae
##STR00026##
wherein R.sup.x and R.sup.y independently represent hydrogen or
hydrocarbyl.
[0176] The term "sulfoxide" is art-recognized and refers to the
group --S(O)--R.sup.x, wherein R.sup.x represents a
hydrocarbyl.
[0177] The term "sulfonate" is art-recognized and refers to the
group SO.sub.3H, or a pharmaceutically acceptable salt thereof.
[0178] The term "sulfone" is art-recognized and refers to the group
--S(O).sub.2-R.sup.x, wherein R.sup.x represents a hydrocarbyl.
[0179] The term "thioalkyl", as used herein, refers to an alkyl
group substituted with a thiol group.
[0180] The term "thioester", as used herein, refers to a group
--C(O)SR.sup.x or --SC(O)R.sup.x wherein R.sup.x represents a
hydrocarbyl.
[0181] The term "thioether", as used herein, is equivalent to an
ether, wherein the oxygen is replaced with a sulfur.
[0182] The term "urea" is art-recognized and may be represented by
the general formula
##STR00027##
wherein R.sup.x and R.sup.y independently represent hydrogen or a
hydrocarbyl.
[0183] As outlined above, the present invention provides compounds
that are inhibitors of the unfolded protein response, in particular
of IRE1 activity, together with compositions comprising such
compounds and methods for their use in the treatment of various
disorders. Without intending to be bound by theory, IRE1 is
responsible for splicing XBP-1 into its active form and therefore
reduction of IRE1 activity will in turn lead to a reduction in
XBP-1 activity. Conversely, activation of IRE1 will lead to an
increase in XBP-1 activity. IRE1 is activated by dimerization and
autophosphorylation through its kinase domain. The endonuclease
activity of IRE1 depends upon having an intact kinase domain, and
to date, XBP-1 is the only described substrate for the endonuclease
function of IRE1.
Overview
[0184] Inhibitors of the Unfolded Protein Response and/or IRE1
[0185] In one aspect, the present invention provides novel
inhibitor compounds, including inhibitors of the unfolded protein
response and/or IRE1 activity, referred to herein as irestatins. In
certain embodiments, the compounds are represented by structural
formula (I):
##STR00028##
[0186] or a pharmacuetically acceptable derivative or prodrug
thereof, wherein: [0187] X is O, S, or N--R.sub.4''; [0188] Y is O
or S; [0189] Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 are
independently C(R.sub.6)(R.sub.6') or NR.sub.4'', provided that
only one of Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 at a time is
N--R.sub.4''; [0190] n is 0-2; [0191] R.sub.1, R.sub.1', R.sub.6,
and R.sub.6' are independently hydrogen, alkyl, alkenyl, alkynyl,
aryl, aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and are optionally substituted
with 1-3 J groups; [0192] R.sub.2 is alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0193] R.sub.3 is alkyl, alkenyl, alkynyl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, haloalkyl, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, hydroxy, thio, amino,
alkylamino, alkanoylamino, aroylamino, aralkanoylamino, carboxy,
carbonate, carbamate, guanidinyl, urea, halo, cyano, nitro, formyl,
acyl, phosphoryl, sulfonyl, or sulfonamido and is optionally
substituted with 1-3 J groups; [0194] R.sub.1, R.sub.1', and
R.sub.2 taken together may form
##STR00029##
[0194] wherein R.sub.5 is hydrogen, alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0195] R.sub.4, R.sub.4', and R.sub.4'' are
independently hydrogen, alkyl, alkenyl, alkynyl, aryl, aralkyl,
aralkenyl, cycloalkyl, cycloalkenyl, cycloalkoxy, heterocyclyl,
heterocyclylalkyl, heteroaryl, heteroaralkyl, formate, formamide,
acyl, phosphoryl, sulfonyl, or sulfonamido and are optionally
substituted with 1-3 J groups, wherein R.sub.4 and R.sub.4' taken
together with the N atom to which they are attached complete a
cyclic structure having from 4 to 8 atoms in the ring; [0196] J is
alkyl, alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, aralkoxy,
cycloalkyl, cycloalkoxy, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, keto, hydroxy, thio,
amino, alkylamino, alkanoylamino, aroylamino, aralkanoylamino,
carboxy, carbonate, carbamate, guanidinyl, urea, halo, cyano,
nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido and is
optionally substituted with 1-3 J' groups; and [0197] J' is alkyl,
alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, heterocyclyl,
heterocyclyloxy, keto, hydroxy, thio, amino, alkanoylamino,
aroylamino, carboxy, carbonate, carbamate, guanidinyl, urea, halo,
cyano, nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido;
[0198] provided that when X is S and Y is O; [0199] R.sub.1 and
R.sub.1' are hydrogen and R.sub.2 is CN or R.sub.1, R.sub.1', and
R.sub.2 together form
[0199] ##STR00030## [0200] Z.sub.1, Z.sub.3, and Z.sub.4 are
CH.sub.2, and Z.sub.2 is CH.sub.2, NC(O)CH.sub.3, CHCH.sub.3,
CHCH.sub.2CH.sub.3, CHCH(CH.sub.3).sub.2,
CHCH.sub.2CH(CH.sub.3).sub.2, or CH-phenyl; [0201] and R.sub.3 is
CH.sub.3, CF.sub.3, i-Bu, Br, C(O)OEt, or CH.dbd.CH-phenyl; [0202]
then R.sub.4 and R.sub.4' are not both hydrogen or ethyl; R.sub.4
and R.sub.4' taken together with the N atom to which they are
attached do not form a tetrahydroisoquinoline or
N-methylpiperazine; and when R.sub.4 is hydrogen, R.sub.4' is not
C.sub.1 alkyl; CH.sub.2COOH; unsubstituted cyclohexyl;
unsubstituted naphthyl; unsubstituted adamantyl;
##STR00031## ##STR00032## ##STR00033##
[0203] In some embodiments of the invention, Z.sub.1, Z.sub.2,
Z.sub.3, and Z.sub.4 are C(R.sub.6)(R.sub.6'), and n is 0 or 1.
[0204] In some embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0205] In some embodiments, X is S.
[0206] In some embodiments, Y is O.
[0207] In some embodiments, R.sub.3 is alkyl or haloalkyl.
[0208] In other embodiments, R.sub.3 is CF.sub.3.\
[0209] In some embodiments, R.sub.1 and R.sub.1' are both
hydrogen.
[0210] In some embodiments, R.sub.1 and R.sub.1' are both hydrogen,
and R.sub.2 is CN.
[0211] In some embodiments, R.sub.1, R.sub.1', and R.sub.2 together
form
##STR00034##
and in more specific embodiments, R.sub.5 is NH.sub.2.
[0212] In some embodiments, R.sub.4 is hydrogen, and R.sub.4' is an
optionally substituted aryl, heteroaryl, aralkyl, or
heteroaralkyl.
[0213] In specific embodiments, R.sub.4' is an optionally
substituted
##STR00035##
pyridinyl, phenyl, or benzyl.
[0214] In even more specific embodiments, R.sub.4' is substituted
with one or two CH.sub.3, CH.sub.2CH.sub.3, CN, OCH.sub.3, or
phenyl groups.
[0215] In still more specific embodiments, R.sub.4' is
##STR00036##
[0216] In even more specific embodiments, R.sub.4' is
##STR00037##
[0217] In some embodiments, R.sub.4 and R.sub.4' are both
alkyl.
[0218] In more specific embodiments, R.sub.4 and R.sub.4' are both
ethyl.
[0219] In some embodiments, Z.sub.2 is NR.sub.4''; and R.sub.4'' is
C(O)CH.sub.3.
[0220] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.1 and
R.sub.1' are hydrogen, R.sub.2 is CN, and R.sub.3 is CF.sub.3.
[0221] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0222] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.1,
R.sub.1', and R.sub.2 together form
##STR00038##
R.sub.3 is CF.sub.3, and R.sub.5 is NH.sub.2.
[0223] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0224] In some embodiments, Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4
are CR.sub.6R.sub.6', n is 0 or 1, X is S, Y is O, R.sub.3 is
CF.sub.3, R.sub.4 is hydrogen, and R.sub.4' is
##STR00039##
[0225] In specific embodiments, R.sub.6 and R.sub.6' are both
hydrogen.
[0226] In some embodiments, R.sub.1, R.sub.1', R.sub.2, R.sub.3,
R.sub.4, R.sub.4', R.sub.4'', R.sub.5, J, and J' each independently
contains 10 or fewer non-hydrogen atoms.
[0227] In specific embodiments, R.sub.1, R.sub.1', R.sub.2,
R.sub.3, R.sub.4, R.sub.4', R.sub.4'', R.sub.5, J, and J' each
independently contains 6 or fewer non-hydrogen atoms.
[0228] In certain embodiments, the compounds of the invention do
not include the following compounds:
##STR00040## ##STR00041##
[0229] When a particular sterochemical or geometric isomer is
specified in a structure, or when a particular isomeric purity is
indicated, the particular form can be obtained by asymmetric
synthesis, synthesis from optically pure precursors, or by
resolution of racemates or other mixtures of stereochemical or
geometric isomers. Resolution of racemates or other mixtures may
also be accomplished, for example, by conventional methods such as
crystallization in the presence of a resolving agent, or
chromatography, using, for example a chiral HPLC column.
[0230] As used herein, the compounds of the invention are defined
to include pharmaceutically acceptable derivatives or prodrugs
thereof. A "pharmaceutically acceptable derivative or prodrug"
means any pharmaceutically acceptable salt, ester, salt of an
ester, or other derivative or compounds of this invention, which,
upon administration to a recipient, is capable of providing or
provides (directly or indirectly) a compound of the invention.
[0231] Accordingly, this invention also provides prodrugs of the
compounds of the invention, which are derivatives that are designed
to enhance biological properties such as oral absorption,
clearance, metabolism, or compartmental distribution. Such
derivations are well known in the art.
[0232] As the skilled practitioner realizes, the compounds of the
invention may be modified by appending appropriate functionalities
to enhance selective biological properties. Such modifications are
known in the art and include those which increase biological
penetration into a given biological compartment (e.g., blood,
lymphatic system, central nervous system), increase oral
availability, increase solubility to allow administration by
injection, alter metabolism, or alter rate of excretion.
[0233] Certain derivatives and prodrugs are those that increase the
bioavailability of the compounds of the invention when such
compounds are administered to an individual (e.g., by allowing an
orally administered compound to be more readily absorbed into the
blood), have more favorable clearance rates or metabolic profiles,
or enhance delivery of the parent compound to a biological
compartment (e.g., the brain or lymphatic system) relative to the
parent species. Examples of prodrugs include derivatives in which a
group that enhances aqueous solubility or active transport through
the gut membrane is appended to the structure.
[0234] In some embodiments, the compounds of the invention are
provided in the form of pharmaceutically acceptable salts.
Compounds containing an amine may be basic in nature and
accordingly may react with any number of inorganic and organic
acids to form pharmaceutically acceptable acid addition salts.
Acids commonly employed to form such salts include inorganic acids
such as hydrochloric, hydrobromic, hydriodic, sulfuric and
phosphoric acid, as well as organic acids such as
para-toluenesulfonic, methanesulfonic, oxalic,
para-bromophenylsulfonic, carbonic, succinic, citric, benzoic and
acetic acid, and related inorganic and organic acids. Such
pharmaceutically acceptable salts thus include sulfate,
pyrosulfate, bisulfate, sulfite, bisulfite, phosphate,
monohydrogenphosphate, dihydrogenphosphate, metaphosphate,
pyrophosphate, chloride, bromide, iodide, acetate, propionate,
decanoate, caprylate, acrylate, formate, isobutyrate, caprate,
heptanoate, propiolate, oxalate, malonate, succinate, suberate,
sebacate, fumarate, maleate, butyne-1,4-dioate, hexyne-1,6-dioate,
benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate,
hydroxybenzoate, methoxybenzoate, phthalate, terephathalate,
sulfonate, xylenesulfonate, phenylacetate, phenylpropionate,
phenylbutyrate, citrate, lactate, .beta.-hydroxybutyrate,
glycollate, maleate, tartrate, methanesulfonate, propanesulfonates,
naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate,
hippurate, gluconate, lactobionate, and the like salts. In certain
specific embodiments, pharmaceutically acceptable acid addition
salts include those formed with mineral acids such as hydrochloric
acid and hydrobromic acid, and those formed with organic acids such
as fumaric acid and maleic acid.
[0235] Compounds of the instant invention that are acidic in nature
may accordingly react with any number of inorganic and organic
bases to form pharmaceutically acceptable base salts. Specific
bases include the mineral bases, such as NaOH and KOH, but one of
skill in the art would appreciate that other bases may also be
used. See Ando et al., Remington: The Science and Practice of
Pharmacy, 20th ed. 700-720 (Alfonso R. Gennaro ed.), 2000.
[0236] The pharmaceutically acceptable addition salts of the
compounds of the invention may also exist as various solvates, such
as with water, methanol, ethanol, dimethylformamide, and the like.
Mixtures of such solvates may also be prepared. The source of such
solvate may be from the solvent of crystallization, inherent in the
solvent of preparation or crystallization, or adventitious to such
solvent.
Synthesis of the Inhibitors of the Unfolded Protein Response
[0237] The compounds of the invention may be synthesized using
conventional synthetic chemical techniques. Advantageously, these
compounds are synthesized from readily available starting
materials. Compound 9389 (Table 1), and structurally-related
compounds, may be synthesized using, for example, the following
synthetic scheme:
##STR00042## [0238] See, e.g., J. Am. Chem. Soc. 75:4753 (1953);
Russian Chemical Bulletin 50(4):669-672 (2001); Khimiya
Geterotsiklicheskikh Soedinenii (9)1233-7 (1987); Awad et al.,
Phosphorus, Sulfur and Silicon and the Related Elements
57(3-4):293-301 (1991); Geronikaki et al., Molecules 8(6):472-9
(2003).
[0239] Variants of the above structure may be synthesized, for
example, using the following commercially available amines:
##STR00043##
[0240] Similar approaches may be used to introduce the following
exemplary groups at the R.sub.4' position of formula (I):
##STR00044##
[0241] Further variation in the bicyclic ring of compound 9389 and
structurally-related compounds is provided, for example, by
substitution of
##STR00045##
in the above reaction scheme with other suitable reagents.
Variation at the position of --CF.sub.3 in compound 9389 and
structurally-related compounds may likewise be provided by
appropriate substitution of starting materials, as would be
understood by the skilled artisan.
[0242] Ring closure of compound 9389 and structurally-related
compounds according to the following scheme provides compound 5500
and structurally-related compounds:
##STR00046##
[0243] Further variation in these compounds may be provided, for
example, by chemical modification of the extracyclic amino group of
compound 5500.
[0244] As can be appreciated by the skilled artisan, the synthetic
methods disclosed herein are not intended to comprise a
comprehensive list of all means by which the compounds described
and claimed in this application may be synthesized. Further methods
will be evident to those of ordinary skill in the art.
Additionally, the various synthetic steps described above may be
performed in an alternate sequence or order to give the desired
compounds. Synthetic chemistry transformations and methodologies
useful in synthesizing the inhibitor compounds described herein are
known in the art and include, for example, those described in R.
Larock, Comprehensive Organic Transformations (1989); T. W. Greene
and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed.
(1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for
Organic Synthesis (1994); and L. Paquette, ed., Encyclopedia of
Reagents for Organic Synthesis (1995). The compounds may be
synthesized using solution-phase or solid-phase techniques. See,
for example, Merrifield, J. Am. Chem. Soc. 85:2149-2154 (1963).
Pharmaceutical Compositions
[0245] In another aspect, the compounds of the invention may be
administered as a pharmaceutical compositions containing, for
example, a compound of structural formula (I) and a
pharmaceutically acceptable carrier, wherein formula (I) is:
##STR00047##
[0246] or a pharmacuetically acceptable derivative or prodrug
thereof, wherein: [0247] X is O, S, or N--R.sub.4''; [0248] Y is O
or S; [0249] Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 are
independently C(R.sub.6)(R.sub.6') or NR.sub.4'', provided that
only one of Z.sub.1, Z.sub.2, Z.sub.3, and Z.sub.4 at a time is
N--R.sub.4''; [0250] n is 0-2; [0251] R.sub.1, R.sub.1', R.sub.6,
and R.sub.6' are independently hydrogen, alkyl, alkenyl, alkynyl,
aryl, aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and are optionally substituted
with 1-3 J groups; [0252] R.sub.2 is alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0253] R.sub.3 is alkyl, alkenyl, alkynyl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, haloalkyl, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, hydroxy, thio, amino,
alkylamino, alkanoylamino, aroylamino, aralkanoylamino, carboxy,
carbonate, carbamate, guanidinyl, urea, halo, cyano, nitro, formyl,
acyl, phosphoryl, sulfonyl, or sulfonamido and is optionally
substituted with 1-3 J groups; [0254] R.sub.1, R.sub.1', and
R.sub.2 taken together may form
##STR00048##
[0254] wherein R.sub.5 is hydrogen, alkyl, alkenyl, alkynyl, aryl,
aralkyl, alkoxy, aryloxy, aralkoxy, cycloalkyl, cycloalkenyl,
cycloalkoxy, heterocyclyl, heterocyclyloxy, heterocyclylalkyl,
heteroaryl, heteroaralkyl, hydroxy, thio, amino, alkylamino,
alkanoylamino, aroylamino, aralkanoylamino, carboxy, carbonate,
carbamate, guanidinyl, urea, halo, cyano, nitro, formyl, acyl,
phosphoryl, sulfonyl, or sulfonamido and is optionally substituted
with 1-3 J groups; [0255] R.sub.4, R.sub.4', and R.sub.4'' are
independently hydrogen, alkyl, alkenyl, alkynyl, aryl, aralkyl,
aralkenyl, cycloalkyl, cycloalkenyl, cycloalkoxy, heterocyclyl,
heterocyclylalkyl, heteroaryl, heteroaralkyl, formate, formamide,
acyl, phosphoryl, sulfonyl, or sulfonamido and are optionally
substituted with 1-3 J groups, wherein R.sub.4 and R.sub.4' taken
together with the N atom to which they are attached complete a
cyclic structure having from 4 to 8 atoms in the ring; [0256] J is
alkyl, alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, aralkoxy,
cycloalkyl, cycloalkoxy, heterocyclyl, heterocyclyloxy,
heterocyclylalkyl, heteroaryl, heteroaralkyl, keto, hydroxy, thio,
amino, alkylamino, alkanoylamino, aroylamino, aralkanoylamino,
carboxy, carbonate, carbamate, guanidinyl, urea, halo, cyano,
nitro, formyl, acyl, phosphoryl, sulfonyl, or sulfonamido and is
optionally substituted with 1-3 J' groups; and [0257] J' is alkyl,
alkenyl, alkynyl, aryl, aralkyl, alkoxy, aryloxy, heterocyclyl,
heterocyclyloxy, keto, hydroxy, thio, amino, alkanoylamino,
aroylamino, carboxy, carbonate, carbamate, guanidinyl, urea, halo,
cyano, nitro, formyl, acyl, phosphoryl, sulfonyl, or
sulfonamido;
[0258] and a pharmaceutically acceptable carrier.
[0259] In specific embodiments, the substituents of formula (I) are
defined as described above.
[0260] In more specific embodiments, the compositions of the
invention comprise the following compounds:
##STR00049## ##STR00050##
[0261] Pharmaceutically acceptable carriers are well known in the
art and include, for example, aqueous solutions such as water or
physiologically buffered saline or other solvents or vehicles such
as glycols, glycerol, oils such as olive oil or injectable organic
esters. In a specific embodiment, when such pharmaceutical
compositions are for human administration, the aqueous solution is
pyrogen free, or substantially pyrogen free. The excipients may be
chosen, for example, to effect delayed release of an agent or to
selectively target one or more cells, tissues or organs. The
pharmaceutical composition may be in dosage unit form such as
tablet, capsule, sprinkle capsule, granule, powder, syrup,
suppository, injection or the like. The composition may also be
present in a transdermal delivery system, e.g., a skin patch.
[0262] A pharmaceutically acceptable carrier may contain
physiologically acceptable agents that act, for example, to
stabilize or to increase the absorption of a compound of the
instant invention. Such physiologically acceptable agents include,
for example, carbohydrates, such as glucose, sucrose or dextrans,
antioxidants, such as ascorbic acid or glutathione, chelating
agents, low molecular weight proteins or other stabilizers or
excipients. The choice of a pharmaceutically acceptable carrier,
including a physiologically acceptable agent, depends, for example,
on the route of administration of the composition. The
pharmaceutical composition also may comprise a lipo some or other
polymer matrix, which may have incorporated therein, for example, a
compound of the invention. Liposomes, for example, which consist of
phospholipids or other lipids, are nontoxic, physiologically
acceptable and metabolizable carriers that are relatively simple to
make and administer.
[0263] The phrase "pharmaceutically acceptable" is employed herein
to refer to those compounds, materials, compositions, and/or dosage
forms that are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and
animals without excessive toxicity, irritation, allergic response,
or other problem or complication, commensurate with a reasonable
benefit/risk ratio.
[0264] The phrase "pharmaceutically acceptable carrier" as used
herein means a pharmaceutically acceptable material, composition,
or vehicle, such as a liquid or solid filler, diluent, excipient,
solvent, or encapsulating material, involved in carrying or
transporting the subject compounds from one organ, or portion of
the body, to another organ, or portion of the body. Each carrier
must be "acceptable" in the sense of being compatible with the
other ingredients of the formulation and not injurious to the
patient. Some examples of materials that can serve as
pharmaceutically acceptable carriers include: (1) sugars, such as
lactose, glucose and sucrose; (2) starches, such as corn starch and
potato starch; (3) cellulose, and its derivatives, such as sodium
carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4)
powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8)
excipients, such as cocoa butter and suppository waxes; (9) oils,
such as peanut oil, cottonseed oil, safflower oil, sesame oil,
olive oil, corn oil and soybean oil; (10) glycols, such as
propylene glycol; (11) polyols, such as glycerin, sorbitol,
mannitol and polyethylene glycol; (12) esters, such as ethyl oleate
and ethyl laurate; (13) agar; (14) buffering agents, such as
magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16)
pyrogen-free water; (17) isotonic saline; (18) Ringer's solution;
(19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other
non-toxic compatible substances employed in pharmaceutical
formulations. See Remington: The Science and Practice of Pharmacy,
20th ed. (Alfonso R. Gennaro ed.), 2000.
[0265] A pharmaceutical composition containing a compound of the
instant invention may be administered to a host by any of a number
of routes of administration including, for example, orally (for
example, drenches as in aqueous or non-aqueous solutions or
suspensions, tablets, boluses, powders, granules, pastes for
application to the tongue); sublingually; anally, rectally, or
vaginally (for example, as a pessary, cream, or foam); parenterally
(including intramuscularly, intravenously, subcutaneously, or
intrathecally as, for example, a sterile solution or suspension);
nasally; intraperitoneally; subcutaneously; transdermally (for
example as a patch applied to the skin); or topically (for example,
as a cream, ointment or spray applied to the skin). The compound
may also be formulated for inhalation. In certain embodiments, a
compound of the instant invention may be simply dissolved or
suspended in sterile water. Details of appropriate routes of
administration and compositions suitable for same can be found in,
for example, U.S. Pat. Nos. 6,110,973; 5,763,493; 5,731,000;
5,541,231; 5,427,798; 5,358,970; and 4,172,896, as well as in
patents cited therein.
[0266] The formulations of the present invention may conveniently
be presented in unit dosage form and may be prepared by any methods
well known in the art of pharmacy. The amount of active ingredient
that can be combined with a carrier material to produce a single
dosage form will vary depending upon the host being treated and the
particular mode of administration. The amount of active ingredient
that can be combined with a carrier material to produce a single
dosage form will generally be that amount of the compound that
produces a therapeutic effect. Generally, out of one hundred
percent, this amount will range from about 1 percent to about 99
percent of active ingredient, in some embodiments from about 5
percent to about 70 percent, and in more specific embodiments from
about 10 percent to about 30 percent.
[0267] Methods of preparing these formulations or compositions
include the step of bringing into association a compound of the
present invention with the carrier and, optionally, one or more
accessory ingredients. In general, the formulations are prepared by
uniformly and intimately bringing into association a compound of
the present invention with liquid carriers, or finely divided solid
carriers, or both, and then, if necessary, shaping the product.
[0268] Formulations of the invention suitable for oral
administration may be in the form of capsules, cachets, pills,
tablets, lozenges (using a flavored basis, usually sucrose and
acacia or tragacanth), powders, granules, or as a solution or a
suspension in an aqueous or non-aqueous liquid, or as an
oil-in-water or water-in-oil liquid emulsion, or as an elixir or
syrup, or as pastilles (using an inert base, such as gelatin and
glycerin, or sucrose and acacia) and/or as mouth washes and the
like, each containing a predetermined amount of a compound of the
present invention as an active ingredient. A compound of the
present invention may also be administered as a bolus, electuary,
or paste.
[0269] In solid dosage forms of the invention for oral
administration (capsules, tablets, pills, dragees, powders,
granules and the like), the active ingredient is mixed with one or
more pharmaceutically acceptable carriers, such as sodium citrate
or dicalcium phosphate, and/or any of the following: (1) fillers or
extenders, such as starches, lactose, sucrose, glucose, mannitol,
and/or silicic acid; (2) binders, such as, for example,
carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone,
sucrose and/or acacia; (3) humectants, such as glycerol; (4)
disintegrating agents, such as agar-agar, calcium carbonate, potato
or tapioca starch, alginic acid, certain silicates, and sodium
carbonate; (5) solution retarding agents, such as paraffin; (6)
absorption accelerators, such as quaternary ammonium compounds; (7)
wetting agents, such as, for example, cetyl alcohol and glycerol
monostearate; (8) absorbents, such as kaolin and bentonite clay;
(9) lubricants, such a talc, calcium stearate, magnesium stearate,
solid polyethylene glycols, sodium lauryl sulfate, and mixtures
thereof; and (10) coloring agents. In the case of capsules, tablets
and pills, the pharmaceutical compositions may also comprise
buffering agents. Solid compositions of a similar type may also be
employed as fillers in soft and hard-filled gelatin capsules using
such excipients as lactose or milk sugars, as well as high
molecular weight polyethylene glycols and the like.
[0270] The tablets, and other solid dosage forms of the
pharmaceutical compositions of the present invention, such as
dragees, capsules, pills and granules, may optionally be scored or
prepared with coatings and shells, such as enteric coatings and
other coatings well known in the pharmaceutical-formulating art.
They may also be formulated so as to provide slow or controlled
release of the active ingredient therein using, for example,
hydroxypropylmethyl cellulose in varying proportions to provide the
desired release profile, other polymer matrices, liposomes and/or
microspheres. They may be sterilized by, for example, filtration
through a bacteria-retaining filter, or by incorporating
sterilizing agents in the form of sterile solid compositions that
can be dissolved in sterile water, or some other sterile injectable
medium immediately before use. These compositions may also
optionally contain opacifying agents and may be of a composition
that they release the active ingredient(s) only, or preferentially,
in a certain portion of the gastrointestinal tract, optionally, in
a delayed manner. Examples of embedding compositions that may be
used include polymeric substances and waxes. The active ingredient
may also be in micro-encapsulated form, if appropriate, with one or
more of the above-described excipients.
[0271] Liquid dosage forms for oral administration of the compounds
of the invention include pharmaceutically acceptable emulsions,
microemulsions, solutions, suspensions, syrups and elixirs. In
addition to the active ingredient, the liquid dosage forms may
contain inert diluents commonly used in the art, such as, for
example, water or other solvents, solubilizing agents and
emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, oils (in particular,
cottonseed, groundnut, corn, germ, olive, castor and sesame oils),
glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty
acid esters of sorbitan, and mixtures thereof.
[0272] Besides inert diluents, the oral compositions may also
include adjuvants such as wetting agents, emulsifying and
suspending agents, sweetening, flavoring, coloring, perfuming, and
preservative agents.
[0273] Suspensions, in addition to the active compounds, may
contain suspending agents as, for example, ethoxylated isostearyl
alcohols, polyoxyethylene sorbitol and sorbitan esters,
microcrystalline cellulose, aluminum metahydroxide, bentonite,
agar-agar, and tragacanth, and mixtures thereof.
[0274] Formulations of the pharmaceutical compositions of the
invention for rectal, vaginal, or urethral administration may be
presented as a suppository, which may be prepared by mixing one or
more compounds of the invention with one or more suitable
nonirritating excipients or carriers comprising, for example, cocoa
butter, polyethylene glycol, a suppository wax or a salicylate, and
which is solid at room temperature, but liquid at body temperature
and, therefore, will melt in the rectum or vaginal cavity and
release the active compound.
[0275] Alternatively or additionally, compositions may be
formulated for delivery via a catheter, stent, wire, or other
intraluminal device. Delivery via such devices may be especially
useful for delivery to the bladder, urethra, ureter, rectum, or
intestine.
[0276] Formulations of the present invention which are suitable for
vaginal administration also include pessaries, tampons, creams,
gels, pastes, foams, or spray formulations containing such carriers
as are known in the art to be appropriate.
[0277] Dosage forms for the topical or transdermal administration
of a compound of this invention include powders, sprays, ointments,
pastes, creams, lotions, gels, solutions, patches, and inhalants.
The active compound may be mixed under sterile conditions with a
pharmaceutically acceptable carrier, and with any preservatives,
buffers, or propellants that may be required.
[0278] The ointments, pastes, creams, and gels may contain, in
addition to an active compound of this invention, excipients, such
as animal and vegetable fats, oils, waxes, paraffins, starch,
tragacanth, cellulose derivatives, polyethylene glycols, silicones,
bentonites, silicic acid, talc and zinc oxide, or mixtures
thereof.
[0279] Powders and sprays may contain, in addition to a compound of
this invention, excipients such as lactose, talc, silicic acid,
aluminum hydroxide, calcium silicates, and polyamide powder, or
mixtures of these substances. Sprays may additionally contain
customary propellants, such as chlorofluorohydrocarbons and
volatile unsubstituted hydrocarbons, such as butane and
propane.
[0280] Transdermal patches have the added advantage of providing
controlled delivery of a compound of the present invention to the
body. Such dosage forms may be made by dissolving or dispersing the
compound in the proper medium. Absorption enhancers may also be
used to increase the flux of the compound across the skin. The rate
of such flux may be controlled by either providing a rate
controlling membrane or dispersing the compound in a polymer matrix
or gel.
[0281] Ophthalmic formulations, eye ointments, powders, solutions,
and the like, are also contemplated as being within the scope of
this invention.
[0282] The phrases "parenteral administration" and "administered
parenterally" as used herein means modes of administration other
than enteral and topical administration, usually by injection, and
includes, without limitation, intravenous, intramuscular,
intraarterial, intrathecal, intracapsular, intraorbital,
intracardiac, intradermal, intraperitoneal, transtracheal,
subcutaneous, subcuticular, intraarticular, subcapsular,
subarachnoid, intraspinal, and intrasternal injection and
infusion.
[0283] Pharmaceutical compositions of this invention suitable for
parenteral administration comprise one or more compounds of the
invention in combination with one or more pharmaceutically
acceptable sterile isotonic aqueous or nonaqueous solutions,
dispersions, suspensions, or emulsions, or sterile powders which
may be reconstituted into sterile injectable solutions or
dispersions just prior to use, which may contain antioxidants,
buffers, bacteriostats, solutes which render the formulation
isotonic with the blood of the intended recipient or suspending or
thickening agents.
[0284] Examples of suitable aqueous and nonaqueous carriers that
may be employed in the pharmaceutical compositions of the invention
include water, ethanol, polyols (such as glycerol, propylene
glycol, polyethylene glycol, and the like), and suitable mixtures
thereof, vegetable oils, such as olive oil, and injectable organic
esters, such as ethyl oleate. Proper fluidity may be maintained,
for example, by the use of coating materials, such as lecithin, by
the maintenance of the required particle size in the case of
dispersions, and by the use of surfactants.
[0285] These compositions may also contain adjuvants such as
preservatives, wetting agents, emulsifying agents, and dispersing
agents. Prevention of the action of microorganisms may be ensured
by the inclusion of various antibacterial and antifungal agents,
for example, paraben, chlorobutanol, phenol sorbic acid, chelators
and the like. It may also be desirable to include isotonic agents,
such as sugars, sodium chloride, and the like into the
compositions. In addition, prolonged absorption of the injectable
pharmaceutical form may be brought about by the inclusion of agents
that delay absorption such as aluminum monostearate and
gelatin.
[0286] In some cases, in order to prolong the effect of a drug, it
is desirable to slow the absorption of the drug from subcutaneous
or intramuscular injection. This may be accomplished by the use of
a liquid suspension of crystalline or amorphous material having
poor water solubility. The rate of absorption of the drug then
depends upon its rate of dissolution, which, in turn, may depend
upon crystal size and crystalline form. Alternatively, delayed
absorption of a parenterally administered drug form is accomplished
by dissolving or suspending the drug in an oil vehicle.
[0287] Injectable depot forms are made by forming microencapsuled
matrices of the subject compounds in biodegradable polymers such as
polylactide-polyglycolide. Depending on the ratio of drug to
polymer, and the nature of the particular polymer employed, the
rate of drug release can be controlled. Examples of other
biodegradable polymers include poly(orthoesters) and
poly(anhydrides). Depot injectable formulations are also prepared
by entrapping the drug in liposomes or microemulsions that are
compatible with body tissue.
[0288] Methods of introduction may also be provided by rechargeable
or biodegradable devices. Various slow release polymeric devices
have been developed and tested in vivo in recent years for the
controlled delivery of drugs. A variety of biocompatible polymers
(including hydrogels), including both biodegradable and
non-degradable polymers, may be used to form an implant for the
sustained release of a compound at a particular target site.
[0289] In certain embodiments, the present invention provides
compositions comprising at least one compound provided in Table 1
below, or an analog, derivative, or functional equivalent thereof.
As detailed below, the compounds shown in Table 1, and others, have
been found to be inhibitors of IRE1 activity and to possess potent,
hypoxia-specific, cytotoxicity. As further detailed below, the
inventive compositions may also comprise, or may be used in
combination with, one or more known cytotoxic, vascular targeting
agents or chemotherapeutic agents including, but not limited to,
Xeloda.TM. (capecitabine), Paclitaxel.TM., FUDR (fluorouridine)
Fludara.TM. (fludarabine phosphate), Gemzar.TM. (gemcitabine),
methotrexate, cisplatin, carboplatin, adriamycin, avastin, tarceva,
taxol, tamoxifen, Femora, temezolamide, cyclophosphamide, Erbitux,
and Sutent.
[0290] In certain embodiments, the inventive compositions comprise
at least one compound having a structure shown in Table 1 below,
together with analogs of such compounds. As described in detail
below, the inventors have demonstrated that these and related
compounds (referred to herein as irestatins) may be effectively
employed to inhibit the activity of the unfolded protein response
and/or IRE1. As described above, and as will be appreciated by
those of skill in the art, the structures of Table 1, and analogs
thereof, may be synthesized using techniques known in the art, for
example using variations of the synthetic schemes described
above.
TABLE-US-00001 TABLE 1 Compound identifi- cation no. Structure 0953
##STR00051## 1401 ##STR00052## 6149 ##STR00053## 6159 ##STR00054##
0222 ##STR00055## 0824 ##STR00056## 3281 ##STR00057## 5500
##STR00058## 2614 ##STR00059## 3611 ##STR00060## 9389 ##STR00061##
7546 ##STR00062## 9255 ##STR00063## 9337 ##STR00064## 5116
##STR00065## 2880 ##STR00066## 8710 ##STR00067## 8731
##STR00068##
Packaged Pharmaceuticals
[0291] The pharmaceutical compositions of the invention may
usefully be provided as packaged pharmaceuticals. The compositions
are thus included in a container, package, or dispenser, either
alone or as part of a kit with labels and instructions for
administration. The packaged pharmaceuticals may in some cases
further comprise additional therapeutics for use in combination
with the provided composition. Such theurapeutics may include,
e.g., one or more chemotherapeutic agents.
Use of the Compounds and Compositions
[0292] The invention further provides methods for using the
compounds and compositions described herein. In one aspect, the
pharmaceutical compositions of the invention are used in methods
for inhibiting the unfolded protein response and/or IRE1 in a
mammalian host. Accordingly, the methods comprise administering to
the mammalian host in need thereof a therapeutically-effective
amount of a pharmaceutical composition as described above.
[0293] The host receiving treatment according to the disclosed
methods is any mammal in need of such treatment. Such mammals
include, e.g., humans, ovines, bovines, equines, porcines, canines,
felines, non-human primate, mice, and rats. In certain specific
embodiments, the host is a human. In certain other specific
embodiments, the host is a non-human mammal. In some embodiments,
the host is a farm animal. In other embodiments, the host is a
pet.
[0294] In yet another aspect, the pharmaceutical compositions of
the invention are used in methods for treating or preventing a
disease associated with the unfolded protein response in a
mammalian host. Such methods may comprise, for example,
administering to the mammalian host in need thereof a
therapeutically-effective amount of a pharmaceutical composition as
described above.
[0295] By "therapeutically effective amount" is meant the
concentration of a compound that is sufficient to elicit the
desired therapeutic effect (e.g., treatment or prevention of a
disorder associated with the unfolded protein response, etc.). It
is generally understood that the effective amount of the compound
will vary according to the weight, gender, age, and medical history
of the host. Other factors that influence the effective amount may
include, but are not limited to, the severity of the patient's
condition, the disorder being treated, the stability of the
compound, and, if desired, another type of therapeutic agent being
administered with the compound of the invention. A larger total
dose may be delivered by multiple administrations of the agent.
Methods to determine efficacy and dosage are known to those skilled
in the art. See, e.g., Roden, Harrison's Principles of Internal
Medicine, Ch. 3, McGraw-Hill, 2004.
[0296] Actual dosage levels of the active ingredients in the
pharmaceutical compositions of the invention may be varied so as to
obtain an amount of the active ingredient that is effective to
achieve the desired therapeutic response for a particular patient,
composition, and mode of administration, without being toxic to the
patient.
[0297] A physician or veterinarian having ordinary skill in the art
can readily determine and prescribe the effective amount of the
pharmaceutical composition required. For example, the physician or
veterinarian could start doses of the compounds of the invention
employed in the pharmaceutical composition at levels lower than
that required in order to achieve the desired therapeutic effect
and gradually increase the dosage until the desired effect is
achieved.
[0298] In general, a suitable daily dose of a compound of the
invention will be that amount of the compound that is the lowest
dose effective to produce a therapeutic effect. Such an effective
dose will generally depend upon the factors described above.
[0299] If desired, the effective daily dose of the active compound
may be administered as one, two, three, four, five, six, or more
sub-doses administered separately at appropriate intervals
throughout the day, optionally, in unit dosage forms. In certain
embodiments of the present invention, the active compound may be
administered two or three times daily. In specific embodiments, the
active compound is administered once daily.
[0300] The preferred frequency of administration and effective
dosage will vary from one individual to another and will depend
upon the particular disease being treated and may be determined by
one skilled in the art. However, it is contemplated that effective
dosages of the inventive inhibitors may range from as low as about
1 mg per day to as high as about 1000 mg per day, including all
intermediate dosages therebetween. More preferably, effective
dosages may range from about 10 mg per day to about 100 mg per day,
including all intermediate dosages therebetween. The inventive
compositions may be administered in a single dosage, or in
multiple, divided dosages.
[0301] In yet another aspect, the pharmaceutical compositions of
the invention are used in methods for treating or preventing
particular disorders. The methods comprise, for example,
administering to the mammalian host in need thereof a
therapeutically-effective amount of a pharmaceutical composition as
described above. In this regard, the disorder may include, for
example, cancer, autoimmune disorders, and diabetes.
[0302] Compositions that contain one or more of the disclosed
inhibitors may be effectively employed in the treatment of cancers,
particularly those cancers characterized by the presence of
moderate to severe hypoxia. Non-limiting examples of such cancers
include solid tumors and secretory cell malignancies, including
multiple myeloma. Cancers that may be effectively treated employing
the inventive compositions include, for example, cervix, brain,
pancreas, breast, head and neck, and prostate cancers, and soft
tissue sarcomas. Other disorders that may be effectively treated
employing the inventive compositions include, but are not limited
to, B cell autoimmune disorders (such as rheumatoid arthritis) and
diabetes. In particular embodiments, the cancer is selected from
the group consisting of multiple myeloma, cervical cancer, brain
cancer, pancreatic cancer, head and neck cancers, prostate cancer,
breast cancer, soft tissue sarcomas, primary and metastatic liver
cancer, primary and metastatic lung cancer, esophageal cancer,
colorectal cancer, lymphoma, and leukemia.
[0303] In other particular embodiments, the cancer is a solid
tumor, such as, for example, a sarcoma, a carcinoma, or a
lymphoma.
[0304] In some embodiments, the disorder is an autoimmune disorder
selected, for example, from the group consisting of diabetes,
lupus, rheumatoid arthritis, psoriasis, multiple sclerosis, and
inflammatory bowel disease.
[0305] In some embodiments, the disorder is an inflammatory bowel
disease selected, for example, from the group consisting of
ulcerative colitis and Crohn's disease.
[0306] In some embodiments, the disorder is rheumatoid
arthritis.
[0307] The present invention also provides methods for inhibiting
IRE1 activity and/or XBP-1 expression in a cell, together with
methods for modulating (for example inhibiting) cell survival,
growth and/or proliferation under hypoxic conditions. For example,
such methods may be employed to inhibit the growth, survival and/or
proliferation of tumor cells, such as cells in solid tumors. Such
methods, which comprise contacting the cell with one or more of the
compounds disclosed herein, may be carried out in vitro, in vivo or
ex vivo.
[0308] In one aspect, the invention provides a composition
comprising a small molecule compound that is capable of inhibiting
IRE1 activity.
[0309] In another aspect, the invention provides a composition
comprising at least one compound selected from the group consisting
of:
[0310] (a) compounds having a structure provided in Table 1;
[0311] (b) compounds that are salts of the structures provided in
Table 1;
[0312] (c) compounds that are analogs or a compound of (a) or
(b).
[0313] In some embodiments, the composition further comprises a
physiologically acceptable carrier.
[0314] In some embodiments, the composition is formulated for
administration by injection.
[0315] In some embodiments, the composition further comprises a
known chemotherapeutic agent.
[0316] In another aspect, the invention provides a method for
inhibiting the activity of IRE1 in a cell, comprising contacting
the cell with any one of the above compositions.
[0317] In another aspect, the invention provides a method for
inhibiting the growth and/or proliferation of a tumor cell
comprising contacting the cell with any one of the above
compositions.
[0318] In still another aspect, the invention provides a method for
the treatment of a disorder in a patient, comprising administering
to the patient any one of the above compositions.
[0319] In some of the method embodiments, the disorder is
characterized by unwanted cell growth under conditions of hypoxia
or ER stress.
[0320] In some of the method embodiments, the disorder is selected
from the group consisting of cancer; autoimmune disorders; and
diabetes.
[0321] In some of the method embodiments, the disorder is a cancer
selected from the group consisting of multiple myeloma; cervical
cancer; brain cancer; pancreatic cancer; head and neck cancers;
prostate cancer; breast cancer; and soft tissue sarcomas.
[0322] In some of the method embodiments, the disorder is
rheumatoid arthritis.
[0323] In some of the method embodiments, the composition is
administered in combination with a known therapeutic agent.
[0324] The inventive compounds also encompass analogs of the
structures provided in Table 1 and other structures. In certain
embodiments, such analogs comprise structural modifications that
increase potency and stability, and/or reduce unwanted side effects
in mammals. Such analogs will generally possess substantially the
same inhibitory properties and/or substantially the same
therapeutic activity as the corresponding structure shown in Table
1 and other structures. Preferably such analogs possess an ability
to inhibit the unfolded protein response and/or IRE1 activity at a
level that is at least 90%, more preferably 95% and preferably 100%
of the level of the corresponding structure of Table 1. In certain
embodiments, such analogs demonstrate at least 95% inhibition of
IRE1 reporter activation as determined in the assay described
below.
[0325] The inventive compositions comprising inhibitors of the
unfolded protein response and/or IRE1 activity may be employed to
inhibit abnormal cell proliferation in a patient. For example, the
instant compositions may be used to effectively treat, or prevent,
disorders such as, but not limited to, cancers, including: solid
tumors, such as cervix, brain, pancreas, head and neck, breast, and
prostate cancers; soft tissue sarcomas; secretory cell
malignancies, including multiple myeloma; B cell autoimmune
disorders, such as rheumatoid arthritis; and diabetes. Such methods
involve administering an effective amount of one or more of the
inventive compositions to a patient in need thereof.
[0326] As used herein, a "patient" refers to any warm-blooded
animal, including, but not limited to, a human. Such a patient may
be afflicted with disease or may be free of detectable disease. In
other words, the inventive methods may be employed for the
prevention or treatment of disease. The inventive methods may be
employed in conjunction with other known therapies, such as those
currently employed for the treatment of cancer. For example, the
inventive compositions may be administered before, during or after,
radiotherapy, photodynamic therapy, surgery and/or treatment with
known chemotherapeutic agents such as, but not limited to, those
discussed above.
[0327] In general, the inventive compositions may be administered
by injection (e.g., intradermal, intramuscular, intravenous,
intratumoral or subcutaneous), intranasally (e.g., by aspiration),
orally, transdermally or epicutaneously (applied topically onto
skin). In one embodiment, the compositions of the present invention
are injected into a tumor.
[0328] As described above, for use in therapeutic methods, the
inventive compositions may additionally contain a physiologically
acceptable carrier, such as a buffer, solvent, diluent or aqueous
medium. While any suitable carrier known to those of ordinary skill
in the art may be employed in the compositions of this invention,
the type of carrier will vary depending on the mode of
administration. For parenteral administration, such as
subcutaneous, intravenous, intravascular or intraperitoneal
injection, the carrier preferably comprises water, saline, alcohol,
a fat, a wax or a buffer. For oral administration, the inventive
compositions may be formulated, for example in a tablet,
time-release capsule or other solid form, and any of the above
carriers or a solid carrier, such as mannitol, lactose, starch,
magnesium stearate, sodium saccharine, talcum, cellulose, glucose,
sucrose and magnesium carbonate, may be employed. Other components,
such as buffers, stabilizers, antibacterial and antifungal agents,
isotonic and absorption delaying agents, and the like, may be
included in the inventive compositions. The inventive compositions
may be provided in single dose or multi-dose containers.
[0329] Such compositions may be prepared using techniques well
known to those of skill in the art. In certain embodiments, the
inventive compositions are prepared as sterile injectables, either
as liquid solutions or suspensions; solid forms suitable for use in
preparing solutions or suspensions upon the addition of a liquid
prior to injection; or as emulsions.
[0330] The compounds of the present invention may also be
formulated into a composition in a neutral or salt form.
Pharmaceutically acceptable salts include the acid addition salts
(formed, for example with any free amino groups present), which are
formed with inorganic acids such as, hydrochloric or phosphoric
acids, or such organic acids as acetic, oxalic, tartaric, or
mandelic acids and the like. Salts formed with any free carboxyl
groups can also be derived from inorganic bases, such as sodium,
potassium, ammonium, calcium or ferric hydroxides, and such organic
bases as isopropylamine, trimethylamine, histidine, procaine and
the like.
[0331] As described above, the methods of the invention may in some
embodiments be used for treating or preventing cancer. Such methods
may, in certain embodiments, further comprise administration of a
chemotherapeutic agent. Chemotherapeutic agents that may be
coadministered with pharmaceutical compositions of the instant
invention include: alemtuzumab, aminoglutethimide, amsacrine,
anastrozole, asparaginase, bcg, bevacizumab, bicalutamide,
bleomycin, bortezomib, buserelin, busulfan, campothecin,
capecitabine, carboplatin, carmustine, CeaVac, cetuximab,
chlorambucil, cisplatin, cladribine, clodronate, colchicine,
cyclophosphamide, cyproterone, cytarabine, dacarbazine, daclizumab,
dactinomycin, daunorubicin, dienestrol, diethylstilbestrol,
docetaxel, doxorubicin, edrecolomab, epirubicin, epratuzumab,
erlotinib, estradiol, estramustine, etoposide, exemestane,
filgrastim, fludarabine, fludrocortisone, fluorouracil,
fluoxymesterone, flutamide, gemcitabine, gemtuzumab, genistein,
goserelin, huJ591, hydroxyurea, ibritumomab, idarubicin,
ifosfamide, IGN-101, imatinib, interferon, irinotecan, ironotecan,
letrozole, leucovorin, leuprolide, levamisole, lintuzumab,
lomustine, MDX-210, mechlorethamine, medroxyprogesterone,
megestrol, melphalan, mercaptopurine, mesna, methotrexate,
mitomycin, mitotane, mitoxantrone, mitumomab, nilutamide,
nocodazole, octreotide, oxaliplatin, paclitaxel, pamidronate,
pentostatin, pertuzumab, plicamycin, porfimer, procarbazine,
raltitrexed, rituximab, streptozocin, sunitinib, suramin,
tamoxifen, temozolomide, teniposide, testosterone, thalidomide,
thioguanine, thiotepa, titanocene dichloride, topotecan,
tositumomab, trastuzumab, tretinoin, vatalanib, vinblastine,
vincristine, vindesine, and vinorelbine.
[0332] Other useful chemotherapeutic agents for combination with
the compounds of the present invention include MDX-010; MAb, AME;
ABX-EGF; EMD 72 000; apolizumab; labetuzumab; ior-t1; MDX-220; MRA;
H-11 scFv; Oregovomab; huJ591 MAb, BZL; visilizumab; TriGem; TriAb;
R3; MT-201; G-250, unconjugated; ACA-125; Onyvax-105; CDP-860;
BrevaRex MAb; AR54; IMC-1C11; GlioMAb-H; ING-1; Anti-LCG MAbs;
MT-103; KSB-303; Therex; KW-2871; Anti-HMI.24; Anti-PTHrP; 2C4
antibody; SGN-30; TRAIL-RI MAb, CAT; Prostate cancer antibody;
H22xKi-4; ABX-MA1; Imuteran; and Monopharm-C.
[0333] These chemotherapeutic agents may be categorized by their
mechanism of action into, for example, the following groups:
anti-metabolites/anti-cancer agents, such as pyrimidine analogs
(e.g., 5-fluorouracil, floxuridine, capecitabine, gemcitabine and
cytarabine) and purine analogs, folate antagonists and related
inhibitors (e.g., mercaptopurine, thioguanine, pentostatin and
2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic
agents including natural products such as vinca alkaloids (e.g.,
vinblastine, vincristine, and vinorelbine), microtubule disruptors
such as taxane (paclitaxel, docetaxel), vincristin, vinblastin,
nocodazole, epothilones and navelbine, epidipodophyllotoxins
(teniposide), DNA damaging agents (e.g., actinomycin, amsacrine,
anthracyclines, bleomycin, busulfan, camptothecin, carboplatin,
chlorambucil, cisplatin, cyclophosphamide, cytoxan, dactinomycin,
daunorubicin, docetaxel, doxorubicin, epirubicin,
hexamethylmelamineoxaliplatin, iphosphamide, melphalan,
merchlorethamine, mitomycin, mitoxantrone, nitrosourea, paclitaxel,
plicamycin, procarbazine, teniposide, triethylenethiophosphoramide
and etoposide (VP16)); antibiotics such as dactinomycin
(actinomycin D), daunorubicin, doxorubicin (adriamycin),
idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin
(mithramycin) and mitomycin; enzymes (e.g., L-asparaginase, which
systemically metabolizes L-asparagine and deprives cells which do
not have the capacity to synthesize their own asparagine);
antiplatelet agents; antiproliferative/antimitotic alkylating
agents such as nitrogen mustards (e.g., mechlorethamine,
cyclophosphamide and analogs, melphalan, chlorambucil),
ethylenimines and methylmelamines (e.g., hexamethylmelamine and
thiotepa), alkyl sulfonates-busulfan, nitrosoureas (e.g.,
carmustine (BCNU) and analogs, streptozocin),
trazenes-dacarbazinine (DTIC); antiproliferative/antimitotic
antimetabolites such as folic acid analogs (e.g., methotrexate);
platinum coordination complexes (e.g., cisplatin, carboplatin),
procarbazine, hydroxyurea, mitotane, aminoglutethimide; hormones,
hormone analogs (e.g., estrogen, tamoxifen, goserelin,
bicalutamide, nilutamide) and aromatase inhibitors (e.g.,
letrozole, anastrozole); anticoagulants (e.g., heparin, synthetic
heparin salts and other inhibitors of thrombin); fibrinolytic
agents (such as tissue plasminogen activator, streptokinase and
urokinase), aspirin, COX-2 inhibitors, dipyridamole, ticlopidine,
clopidogrel, abciximab; antimigratory agents; antisecretory agents
(e.g., breveldin); immunosuppressives (e.g., cyclosporine,
tacrolimus (FK-506), sirolimus (rapamycin), azathioprine,
mycophenolate mofetil); anti-angiogenic compounds (e.g., TNP-470,
genistein) and growth factor inhibitors (e.g., vascular endothelial
growth factor (VEGF) inhibitors, fibroblast growth factor (FGF)
inhibitors, epidermal growth factor (EGF) inhibitors); angiotensin
receptor blocker; nitric oxide donors; anti-sense oligonucleotides;
antibodies (e.g., trastuzumab and others listed above); cell cycle
inhibitors and differentiation inducers (e.g., tretinoin); mTOR
inhibitors, topoisomerase inhibitors (e.g., doxorubicin
(adriamycin), amsacrine, camptothecin, daunorubicin, dactinomycin,
eniposide, epirubicin, etoposide, idarubicin, irinotecan (CPT-11)
and mitoxantrone, topotecan, irinotecan), corticosteroids (e.g.,
cortisone, dexamethasone, hydrocortisone, methylpednisolone,
prednisone, and prenisolone); growth factor signal transduction
kinase inhibitors; mitochondrial dysfunction inducers and caspase
activators; chromatin disruptors.
[0334] The pharmaceutical compositions of the instant invention may
be coadministered with chemotherapeutic agents either singly or in
combination. Many combinatorial therapies have been developed,
including but not limited to those listed in Table 2.
TABLE-US-00002 TABLE 2 Exemplary combinatorial therapies for the
treatment of cancer. Name Therapeutic agents ABV Doxorubicin,
Bleomycin, Vinblastine ABVD Doxorubicin, Bleomycin, Vinblastine,
Dacarbazine AC (Breast) Doxorubicin, Cyclophosphamide AC (Sarcoma)
Doxorubicin, Cisplatin AC (Neuroblastoma) Cyclophosphamide,
Doxorubicin ACE Cyclophosphamide, Doxorubicin, Etoposide Ace
Cyclophosphamide, Doxorubicin AD Doxorubicin, Dacarbazine AP
Doxorubicin, Cisplatin ARAC-DNR Cytarabine, Daunorubicin B-CAVe
Bleomycin, Lomustine, Doxorubicin, Vinblastine BCVPP Carmustine,
Cyclophosphamide, Vinblastine, Procarbazine, Prednisone BEACOPP
Bleomycin, Etoposide, Doxorubicin, Cyclophosphamide, Vincristine,
Procarbazine, Prednisone, Filgrastim BEP Bleomycin, Etoposide,
Cisplatin BIP Bleomycin, Cisplatin, Ifosfamide, Mesna BOMP
Bleomycin, Vincristine, Cisplatin, Mitomycin CA Cytarabine,
Asparaginase CABO Cisplatin, Methotrexate, Bleomycin, Vincristine
CAF Cyclophosphamide, Doxorubicin, Fluorouracil CAL-G
Cyclophosphamide, Daunorubicin, Vincristine, Prednisone,
Asparaginase CAMP Cyclophosphamide, Doxorubicin, Methotrexate,
Procarbazine CAP Cyclophosphamide, Doxorubicin, Cisplatin CaT
Carboplatin, Paclitaxel CAV Cyclophosphamide, Doxorubicin,
Vincristine CAVE ADD CAV and Etoposide CA-VP16 Cyclophosphamide,
Doxorubicin, Etoposide CC Cyclophosphamide, Carboplatin CDDP/VP-16
Cisplatin, Etoposide CEF Cyclophosphamide, Epirubicin, Fluorouracil
CEPP (B) Cyclophosphamide, Etoposide, Prednisone, with or without/
Bleomycin CEV Cyclophosphamide, Etoposide, Vincristine CF
Cisplatin, Fluorouracil or Carboplatin Fluorouracil CHAP
Cyclophosphamide or Cyclophosphamide, Altretamine, Doxorubicin,
Cisplatin ChlVPP Chlorambucil, Vinblastine, Procarbazine,
Prednisone CHOP Cyclophosphamide, Doxorubicin, Vincristine,
Prednisone CHOP-BLEO Add Bleomycin to CHOP CISCA Cyclophosphamide,
Doxorubicin, Cisplatin CLD-BOMP Bleomycin, Cisplatin, Vincristine,
Mitomycin CMF Methotrexate, Fluorouracil, Cyclophosphamide CMFP
Cyclophosphamide, Methotrexate, Fluorouracil, Prednisone CMFVP
Cyclophosphamide, Methotrexate, Fluorouracil, Vincristine,
Prednisone CMV Cisplatin, Methotrexate, Vinblastine CNF
Cyclophosphamide, Mitoxantrone, Fluorouracil CNOP Cyclophosphamide,
Mitoxantrone, Vincristine, Prednisone COB Cisplatin, Vincristine,
Bleomycin CODE Cisplatin, Vincristine, Doxorubicin, Etoposide COMLA
Cyclophosphamide, Vincristine, Methotrexate, Leucovorin, Cytarabine
COMP Cyclophosphamide, Vincristine, Methotrexate, Prednisone Cooper
Regimen Cyclophosphamide, Methotrexate, Fluorouracil, Vincristine,
Prednisone COP Cyclophosphamide, Vincristine, Prednisone COPE
Cyclophosphamide, Vincristine, Cisplatin, Etoposide COPP
Cyclophosphamide, Vincristine, Procarbazine, Prednisone CP (Chronic
lymphocytic Chlorambucil, Prednisone leukemia) CP (Ovarian Cancer)
Cyclophosphamide, Cisplatin CT Cisplatin, Paclitaxel CVD Cisplatin,
Vinblastine, Dacarbazine CVI Carboplatin, Etoposide, Ifosfamide,
Mesna CVP Cyclophosphamide, Vincristine, Prednisome CVPP Lomustine,
Procarbazine, Prednisone CYVADIC Cyclophosphamide, Vincristine,
Doxorubicin, Dacarbazine DA Daunorubicin, Cytarabine DAT
Daunorubicin, Cytarabine, Thioguanine DAV Daunorubicin, Cytarabine,
Etoposide DCT Daunorubicin, Cytarabine, Thioguanine DHAP Cisplatin,
Cytarabine, Dexamethasone DI Doxorubicin, Ifosfamide DTIC/Tamoxifen
Dacarbazine, Tamoxifen DVP Daunorubicin, Vincristine, Prednisone
EAP Etoposide, Doxorubicin, Cisplatin EC Etoposide, Carboplatin EFP
Etoposie, Fluorouracil, Cisplatin ELF Etoposide, Leucovorin,
Fluorouracil EMA 86 Mitoxantrone, Etoposide, Cytarabine EP
Etoposide, Cisplatin EVA Etoposide, Vinblastine FAC Fluorouracil,
Doxorubicin, Cyclophosphamide FAM Fluorouracil, Doxorubicin,
Mitomycin FAMTX Methotrexate, Leucovorin, Doxorubicin FAP
Fluorouracil, Doxorubicin, Cisplatin F-CL Fluorouracil, Leucovorin
FEC Fluorouracil, Cyclophosphamide, Epirubicin FED Fluorouracil,
Etoposide, Cisplatin FL Flutamide, Leuprolide FZ Flutamide,
Goserelin acetate implant HDMTX Methotrexate, Leucovorin Hexa-CAF
Altretamine, Cyclophosphamide, Methotrexate, Fluorouracil ICE-T
Ifosfamide, Carboplatin, Etoposide, Paclitaxel, Mesna IDMTX/6-MP
Methotrexate, Mercaptopurine, Leucovorin IE Ifosfamide, Etoposie,
Mesna IfoVP Ifosfamide, Etoposide, Mesna IPA Ifosfamide, Cisplatin,
Doxorubicin M-2 Vincristine, Carmustine, Cyclophosphamide,
Prednisone, Melphalan MAC-III Methotrexate, Leucovorin,
Dactinomycin, Cyclophosphamide MACC Methotrexate, Doxorubicin,
Cyclophosphamide, Lomustine MACOP-B Methotrexate, Leucovorin,
Doxorubicin, Cyclophosphamide, Vincristine, Bleomycin, Prednisone
MAID Mesna, Doxorubicin, Ifosfamide, Dacarbazine m-BACOD Bleomycin,
Doxorubicin, Cyclophosphamide, Vincristine, Dexamethasone,
Methotrexate, Leucovorin MBC Methotrexate, Bleomycin, Cisplatin MC
Mitoxantrone, Cytarabine MF Methotrexate, Fluorouracil, Leucovorin
MICE Ifosfamide, Carboplatin, Etoposide, Mesna MINE Mesna,
Ifosfamide, Mitoxantrone, Etoposide mini-BEAM Carmustine,
Etoposide, Cytarabine, Melphalan MOBP Bleomycin, Vincristine,
Cisplatin, Mitomycin MOP Mechlorethamine, Vincristine, Procarbazine
MOPP Mechlorethamine, Vincristine, Procarbazine, Prednisone
MOPP/ABV Mechlorethamine, Vincristine, Procarbazine, Prednisone,
Doxorubicin, Bleomycin, Vinblastine MP (multiple myeloma)
Melphalan, Prednisone MP (prostate cancer) Mitoxantrone, Prednisone
MTX/6-MO Methotrexate, Mercaptopurine MTX/6-MP/VP Methotrexate,
Mercaptopurine, Vincristine, Prednisone MTX-CDDPAdr Methotrexate,
Leucovorin, Cisplatin, Doxorubicin MV (breast cancer) Mitomycin,
Vinblastine MV (acute myelocytic Mitoxantrone, Etoposide leukemia)
M-VAC Methotrexate Vinblastine, Doxorubicin, Cisplatin MVP
Mitomycin Vinblastine, Cisplatin MVPP Mechlorethamine, Vinblastine,
Procarbazine, Prednisone NFL Mitoxantrone, Fluorouracil, Leucovorin
NOVP Mitoxantrone, Vinblastine, Vincristine OPA Vincristine,
Prednisone, Doxorubicin OPPA Add Procarbazine to OPA. PAC
Cisplatin, Doxorubicin PAC-I Cisplatin, Doxorubicin,
Cyclophosphamide PA-CI Cisplatin, Doxorubicin PC Paclitaxel,
Carboplatin or Paclitaxel, Cisplatin PCV Lomustine, Procarbazine,
Vincristine PE Paclitaxel, Estramustine PFL Cisplatin,
Fluorouracil, Leucovorin POC Prednisone, Vincristine, Lomustine
ProMACE Prednisone, Methotrexate, Leucovorin, Doxorubicin,
Cyclophosphamide, Etoposide ProMACE/cytaBOM Prednisone,
Doxorubicin, Cyclophosphamide, Etoposide, Cytarabine, Bleomycin,
Vincristine, Methotrexate, Leucovorin, Cotrimoxazole PRoMACE/MOPP
Prednisone, Doxorubicin, Cyclophosphamide, Etoposide,
Mechlorethamine, Vincristine, Procarbazine, Methotrexate,
Leucovorin Pt/VM Cisplatin, Teniposide PVA Prednisone, Vincristine,
Asparaginase PVB Cisplatin, Vinblastine, Bleomycin PVDA Prednisone,
Vincristine, Daunorubicin, Asparaginase SMF Streptozocin,
Mitomycin, Fluorouracil TAD Mechlorethamine, Doxorubicin,
Vinblastine, Vincristine, Bleomycin, Etoposide, Prednisone TCF
Paclitaxel, Cisplatin, Fluorouracil TIP Paclitaxel, Ifosfamide,
Mesna, Cisplatin TTT Methotrexate, Cytarabine, Hydrocortisone
Topo/CTX Cyclophosphamide, Topotecan, Mesna VAB-6 Cyclophosphamide,
Dactinomycin, Vinblastine, Cisplatin, Bleomycin VAC Vincristine,
Dactinomycin, Cyclophosphamide VACAdr Vincristine,
Cyclophosphamide, Doxorubicin, Dactinomycin, Vincristine VAD
Vincristine, Doxorubicin, Dexamethasone VATH Vinblastine,
Doxorubicin, Thiotepa, Flouxymesterone VBAP Vincristine,
Carmustine, Doxorubicin, Prednisone VBCMP Vincristine, Carmustine,
Melphalan, Cyclophosphamide, Prednisone VC Vinorelbine, Cisplatin
VCAP Vincristine, Cyclophosphamide, Doxorubicin, Prednisone VD
Vinorelbine, Doxorubicin VelP Vinblastine, Cisplatin, Ifosfamide,
Mesna VIP Etoposide, Cisplatin, Ifosfamide, Mesna VM Mitomycin,
Vinblastine VMCP Vincristine, Melphalan, Cyclophosphamide,
Prednisone VP Etoposide, Cisplatin V-TAD Etoposide, Thioguanine,
Daunorubicin, Cytarabine 5 + 2 Cytarabine, Daunorubicin,
Mitoxantrone 7 + 3 Cytarabine with/, Daunorubicin or Idarubicin or
Mitoxantrone "8 in 1" Methylprednisolone, Vincristine, Lomustine,
Procarbazine, Hydroxyurea, Cisplatin, Cytarabine, Dacarbazine
[0335] In addition to conventional chemotherapeutics, the
inhibitors described herein may also be used with antisense RNA,
RNAi, or other polynucleotides to inhibit the expression of the
cellular components that contribute to unwanted cellular
proliferation that are targets of conventional chemotherapy. Such
targets are, merely to illustrate, growth factors, growth factor
receptors, cell cycle regulatory proteins, transcription factors,
or signal transduction kinases.
[0336] Combination therapies comprising the inhibitors of the
instant invention and a conventional chemotherapeutic agent may be
advantageous over combination therapies known in the art because
the combination allows the conventional chemotherapeutic agent to
exert greater effect at lower dosage. In a specific embodiment, the
effective dose (ED.sub.50) for a chemotherapeutic agent, or
combination of conventional chemotherapeutic agents, when used in
combination with an epoxide inhibitor of the instant invention is
at least 2 fold less than the ED.sub.50 for the chemotherapeutic
agent alone, and even more preferably at 5-fold, 10-fold, or even
25-fold less. Conversely, the therapeutic index (TI) for such
chemotherapeutic agent or combination of such chemotherapeutic
agent when used in combination with an epoxide inhibitor of the
instant invention can be at least 2-fold greater than the TI for
conventional chemotherapeutic regimen alone, and even more
preferably at 5-fold, 10-fold, or even 25-fold greater.
[0337] It will be readily apparent to one of ordinary skill in the
relevant arts that other suitable modifications and adaptations to
the methods and applications described herein may be made without
departing from the scope of the invention or any embodiment
thereof. Having now described the present invention in detail, the
same will be more clearly understood by reference to the following
Examples, which are included herewith for purposes of illustration
only and are not intended to be limiting of the invention.
EXAMPLES
Example 1
Involvement of XBP-1 in Hypoxia and Tumor Growth
[0338] We have demonstrated that UPR related genes represent a
major class of genes that are transcriptionally induced under
hypoxia, that XBP-1 is activated during hypoxia in a HIF-1
independent manner, and that cell survival and apoptosis under
hypoxia was mediated by XBP-1 (Romero L., et al. Cancer Res.
64:5943-5947, 2004). We have demonstrated that XBP-1 is essential
for tumor growth. We implanted spontaneously transformed XBP-1
wild-type and knockout mouse embryonic fibroblasts (MEFs) as tumor
xenografts into SCID mice and found that XBP-1 knockout MEFs were
completely unable to grow as tumors. Furthermore, tumor growth was
dependent upon the spliced form of XBP-1. We transfected spliced
XBP-1 (XBP1s) into XBP-1 knockout MEFs and were able to restore the
growth rate of these tumors back to that of the wild-type cells. We
also transfected a mutant form of unspliced XBP-1 (XBP1u) in which
the splice site was deleted. Transfection of this construct
resulted in expression of an "unspliceable" form of XBP-1.
Reintroduction of XBP1u into an XBP-1 null background was not able
to restore tumor growth. These studies indicate that the spliced
(activated) form of XBP-1 is a critical component of tumor growth.
We obtained similar results using HT1080 cells overexpres sing
mutants of IRE1 in which either the kinase domain was deleted
(IRE1.DELTA.C) or both the kinase and endonuclease domain were
deleted (IRE1.DELTA.En). Both of these deletion mutants were found
to be defective in XBP-1 splicing and transactivation of a UPRE
reporter.
[0339] Furthermore, we observed that tumor growth was impaired in
tumor cells expressing IRE1 deletion mutants or an XBP-1 dominant
negative (overexpression of mutant XBP-1 in which the
transactivation domain was deleted). Conversely, hypoxia survival
was increased and tumor growth was accelerated when the spliced
form of XBP-1 was overexpressed. Taken together, these data
strongly indicate that XBP-1 is an important regulator of tumor
growth.
[0340] To further investigate the role of XBP-1 on tumor growth, we
have developed an HT1080 cell line in which XBP-1 expression was
regulated using a tetracycline inducible XBP-1 shRNA expression
vector. In these cells, XBP-1 expression was inhibited in the
presence of doxycycline, allowing us to determine the effect of
inhibiting XBP-1 on an established tumor. In these experiments,
doxycycline was added into the drinking water of tumor bearing mice
when the tumors reached a size of 50-100 mm.sup.3. In the presence
of doxycycline, there was a significant delay in the growth of
these tumors as compared to the controls. We observed even greater
tumor growth delay with constitutive inhibition of XBP-1 by shRNA.
We also obtained similar results when XBP-1 was inhibited in a
dominant negative manner in both an inducible and constitutively
expressed manner. From these experiments, we concluded that XBP-1
plays a critical role in tumor growth and inhibition of XBP-1 is a
may therefore be an effective therapeutic strategy.
[0341] To validate the clinical significance of XBP-1 as a
potential therapeutic target in pancreatic tumors, we performed
immunohistochemical analysis on 30 pancreatic tumor specimens taken
from consecutive surgical specimens, 30 surrounding stroma samples,
29 chronic pancreatitis samples, and twenty normal pancreas
samples. We have previously reported on the oxygenation status of a
subset of these pancreatic tumors and found that they were
extremely hypoxic while the normal adjacent pancreas was
well-oxygenated (Koong A., et al. Int. J. Radiat. Oncol. Biol.
Phys. 48:919-922, 2000). Because they are so profoundly hypoxic,
pancreatic tumors are ideal tumors for the development of hypoxia
targeted therapies. For these studies, we generated an affinity
purified peptide antibody that was specific for the spliced form of
human XBP-1. The strongest XBP1s expression was observed in the
pancreatic tumor with minimal expression in the surrounding stroma
or normal pancreas.
[0342] Collectively, these data demonstrate that the spliced form
of XBP-1 (XBP1s) is essential for tumor growth, important for
survival during hypoxia, and overexpressed in human pancreatic
tumors. These observations strongly indicate that inhibition of
XBP-1 is a promising therapeutic strategy.
Example 2
Identification of Inhibitors of XBP-1 Splicing
[0343] A high throughput screen for small molecule inhibitors of
IRE1 activity was developed as detailed below. The sequence for
XBP-1 is described in, for example, Liou, H-C. et al. Science
247:1581-1584, 1990; and Yoshimura, T. et al. EMBO J. 9:2537-2542,
1990. The amino acid sequence for unspliced XBP-1 protein is
provided in SEQ ID NO: 1, with corresponding cDNA sequence being
provided in SEQ ID NO: 3. The amino acid sequence for the spliced
form is provided in SEQ ID NO: 2.
[0344] As shown in FIG. 2A, we developed a reporter construct in
which luciferase was fused downstream and in frame with the
unspliced form of XBP-1, containing the IRE-1 splice site. In the
unspliced form, no luciferase is translated because of an
endogenous stop codon. However, during hypoxia and ER stress, a 26
nt sequence is spliced out by IRE1 resulting in a frame-shift and
read-through of the stop codon (Iwawaki et al., Nat. Med.
10:98-102, 2004). This results in production of an XBP1-luciferase
fusion protein in which luciferase activity is detected only when
XBP-1 is spliced by IRE1. This construct was stably transfected
into HT1080 cells (human fibrosarcoma cell line). As shown in FIG.
2B, luciferase activity, detected after 24 hours of exposure to
hypoxia, rapidly decreases when the HT1080 cells are allowed to
reoxygenate, demonstrating that XBP-1 splicing is tightly
controlled and largely restricted to hypoxic/ER stress
conditions.
[0345] These tumor cells were used to screen a 66,000 chemically
diverse small molecule library for inhibitors of XBP-1 splicing
(Stanford High Throughput Facility compound library, which contains
compounds from: SPECS & BioSPECS (Wakefield R.I.), Chembridge
(San Diego, Calif.), and ChemRx libraries (Disclovery Partners
International, San Diego, Calif.)). In this screen, we used two
drugs, tunicamycin ("Tm") (which blocks protein glycosylation) and
thapsigargin ("Tg") (an inhibitor of ER Ca-ATPase) that cause ER
stress to activate the IRE1 reporter.
[0346] Specifically, HT1080 fibrosarcoma cells stably transfected
with the unspliced XBP-1-luciferase reporter construct (3000/well)
were plated onto a solid white 384 well microplate with a multidrop
dispenser (40 .mu.L per well). The plates were then placed into an
automated incubator. After 24 hours of growth, a mixture of
tunicamycin (1 .mu.g/ml) and thapsigargin (100 nM) inducers were
added, and candidate compounds were then added to the plates. After
24 hours, luciferase reagent (10 .mu.l) was added to each well and
the plates were read in a Molecular Devices Analyst GT (0.2 second
read per well). Compounds that blocked IRE1 activation showed
reduced levels of luciferase activity compared to control
wells.
[0347] Compounds were selected for further investigation on the
basis of their ability to block IRE1 reporter activation. In order
to be selected, a compound must have demonstrated >95%
inhibition of the reporter. Using this selection criteria, we
selected the top 400 compounds for further testing. In this group,
we performed a secondary screen comparing the ability of these
compounds to inhibit IRE1-regulated luciferase activity without
having an effect on CMV-regulated luciferase activity. From this
analysis, we selected 58 compounds and repeated the IRE1 reporter
screen on each compound individually.
[0348] This resulted in 38 compounds that were then tested
individually in five separate cell based assays including the
following: 1)>95% inhibition of hypoxia-activated
XBP1-luciferase reporter; 2)>95% inhibition of tunicamycin
activated XBP1-luciferase reporter; 3)>95% inhibition of hypoxia
induced UPRE-luciferase reporter (multimer of unfolded protein
response element which XBP-1 can transactivate); 4)>95%
inhibition of tunicamycin induced UPRE-luciferase reporter; and 5)
inhibition of XBP-1 splicing by RT-PCR. To qualify for further
testing, each compound must have satisfied 4/5 of the conditions
described above. A total of 18 compounds, referred to as candidate
irestatins, met these criteria and were identified for further
testing as described below. The structure of each of these
compounds is shown in Table 1, above. A schematic of this screen is
shown in FIG. 3.
[0349] A "heat map" view of a single plate from the primary screen
is shown in FIG. 4. HT1080 cells stably expressing the
XBP1-luciferase construct described above were plated in 384 well
format (4,000 cells/well) and a different compound was added
robotically into each individual well. Compounds were selected for
further testing based upon demonstrating >95% inhibition of
luciferase activity. The two lanes on the far left of FIG. 4 were
negative controls (tunicamycin/thapsigargin alone) and the two
lanes on the far right were positive controls (media alone).
[0350] FIG. 5A shows examples of compounds that were tested
individually at 1 uM, 2 uM and 6 uM for inhibition of a
UPRE-luciferase reporter following exposure to tunicamycin (Tm). In
these studies, the luciferase reporter was under the control of 5
repeats of the XBP-1 promoter element (5.times.-UPRE). FIG. 5B
shows compounds that were tested for inhibition of hypoxia (48
hours) induced transactivation of the same UPRE-luciferase report
construct transiently transfected into HT1080 cells. More
specifically, HT1080 fibrosarcoma cells transiently transfected
with a luciferase reporter under the control of 5 repeats of the
XBP-1 promoter element (5.times.-UPRE) were treated with 1 .mu.M of
each irestatin or left untreated, and incubated in normoxia or
hypoxia (0.1% oxygen) for 48 hrs at 37.degree. C. Cells were
harvested, lysed in reporter lysis buffer, and assayed for
luminescence using a luminometer. Fold induction is calculated as
the luminesence in hypoxia divided by the normoxic luminescence
value. The irestatin used is identified by a four-digit number
below each bar.
[0351] Individual testing of the most promising compounds for
inhibition of endogenous XBP-1 splicing (FIG. 6A) was also
performed. In this assay, HT1080 cells were treated with hypoxia in
the presence of various compounds and XBP-1 was amplified by
RT-PCR. Not every compound inhibited XBP-1 splicing in this assay.
Under aerobic conditions, only the unspliced form of XBP-1 XBP-1u)
was detectable (lane 1). The spliced form of XBP-1 (XBP-1s) was
detectable under hypoxia (lane 2). The ability of each individual
compound to inhibit XBP-1 splicing was variable. In this set of
compounds, only two were effective inhibitors of XBP-1 splicing
(lanes 5 and 7). Interestingly, two compounds (lanes 3 and 4)
resulted in inhibition of both the spliced and unspliced forms of
XBP-1.
[0352] FIG. 6B shows the results of studies in which HT1080
fibrosarcoma cells stably expressing the XBP-luciferase reporter
were treated with 1 uM of each irestatin or left untreated, and
incubated in hypoxia (0.01% oxygen) for 48 hrs at 37.degree. C.
Cells were harvested, lysed in reporter lysis buffer, and assayed
for luminescence using a luminometer.
[0353] Several of the candidate irestatins were tested in a hypoxia
clonogenic survival assay. FIG. 7A is an example of some of the
candidate irestatins that demonstrated selective sensitization of
HT1080 cells to hypoxia. HT1080 fibrosarcoma cells stably were
treated with 1 uM of the indicated irestatin or left untreated, and
incubated in hypoxia (0.01% oxygen) for 48 hrs at 37.degree. C.
Cells were harvested and counted, and allowed to form colonies
under normal oxygen tension. Survival rate is expressed as the
fraction of colonies formed divided by the total number of cells
seeded for each condition. For all experiments, cells were plated
in triplicate, and all experiments were repeated at least three
times. These experiments were repeated using MiaPaCa2 cells in
place of the HT1080 fibrosarcoma cells. As shown in FIG. 7B, the
three compounds shown in FIG. 7A also sensitized MiaPaca2 cells to
hypoxia, indicating that even though the screen was performed in
HT1080 cells, the results may be generalized to other cell
types.
[0354] FIG. 7C shows results of experiments demonstrating that
candidate irestatins inhibit survival of human tumor cells in
hypoxia. PANC1 pancreatic adenocarcinoma cells were treated with 1
uM of the indicated irestatin or left untreated, and incubated in
hypoxia (0.01% oxygen) for 48 hrs at 37.degree. C. Cells were
harvested and counted, and allowed to form colonies under normal
oxygen tension. After 10-11 days, colony formation was analyzed by
staining with crystal violet.
[0355] FIG. 8 shows the results of studies in which HT1080
fibrosarcoma cells were treated with 1 uM of each Irestatin or left
untreated, and incubated in hypoxia (0.01% oxygen) for 24 hrs at
37.degree. C. Cells were harvested, lysed, and analyzed by Western
blot using anti-XBP-1 antisera (lower panel) or anti-HIF-1 antisera
(top panel) to confirm hypoxia exposure. The results confirm that
the tested irestatins inhibit IRE1 signaling and XBP-1 splicing
during hypoxia.
Example 3
Inhibition of XBP-1 Splicing in Tumors by Inhibitors of IRE1
Activity
[0356] Several nude mice were implanted with HT1080 cells stably
expressing a XBP-1s-luciferase construct and XBP-1 activation was
examined using bioluminescence imaging. Imaging was performed using
the In Vivo Imaging System (IVIS, Xenogen Corporation, Alameda,
Calif.) in the Stanford Center for Innovation in In Vivo Imaging
(SCI3). This device consists of a cooled CCD camera mounted on a
light-tight specimen chamber. In these experiments, two different
potential irestatins (3281 & 5500) were injected IP into nude
mice implanted with HT1080 stably expressing XBP1s-luciferase
(described in FIG. 2A). We estimated that injecting mice at a
concentration of 50 mg/kg (no apparent toxicity) was within a
10-fold range of the in vitro drug concentrations used (assuming
uniform distribution and ignoring excretion/metabolism) for the
above described cell culture assays.
[0357] As shown in FIGS. 9A-D, XBP-1 splicing activity was
undetectable 8 hrs after irestatin 3281 injection and became
detectable within 16 hrs later. Following a second injection, XBP-1
splicing was again inhibited after 8 hrs. These data strongly
indicate that this compound had a direct effect on the inhibition
of XBP-1 splicing, and may be effectively employed in the treatment
of solid tumors. A second candidate irestatin (5500) was tested in
the same manner and did not have any affect on XBP-1 splicing, at
least at the time points assayed.
Example 4
Inhibition of Tumor Growth In Vivo by Inhibitors of IRE1
Activity
[0358] The ability of inhibitors of the inventive inhibitors of
IRE1 activity to inhibit tumor growth in vivo was examined in a
mouse model as follows.
[0359] PANC1 pancreatic adenocarcinoma cells were implanted
subcutaneously into nude mice. Mice were then given a bolus
injection of one of the inventive irestatins (1401, 9337, 3611 or
9389) at a dose of 60 mg/kg every 48 hours for a total of 5 doses,
with 5-7 tumors being treated per group. As shown in FIG. 10,
significant tumor growth was observed in untreated mice, but not in
mice treated with the irestatins. These results indicate that the
inventive irestatins may be effectively employed to inhibit tumor
growth in vivo.
Example 5
Identification and Characterization of Potent Inhibitors of the
IRE1.alpha./XBP-1 Pathway
[0360] To date, the contribution of IRE1.alpha. to hypoxia
tolerance and tumorigenesis has not been directly addressed and
remains poorly understood. In this study, we employed a reverse
chemical genetics approach to investigate the role of IRE1.alpha.
in tumor growth. The use of small molecules to study protein
function allows for the rapid and selective targeting of individual
functions of multifunctional proteins, and serves as a powerful
complement to conventional genetic strategies. Soderholm et al.,
Nat Chem Biol 2: 55-58 (2006). Indeed, genetic deletion in mice of
IRE1.alpha. or XBP-1 causes embryonic lethality (Reimold et al.,
Genes Dev 14: 152-157 (2000); Harding et al., Mol Cell 7: 1153-1163
(2001)), and PERK and XBP-1 are required for the correct
development of secretory organs such as the liver, pancreas and
salivary gland (Lee et al., Embo J 24: 4368-4380 (2005); Zhang et
al., Cell Metab 4: 491-497 (2006)). Thus, the UPR is necessary for
the survival of tissues exposed to physiological levels of ER
stress during fetal and postnatal development. The identification
of small-molecule inhibitors provides an alternate strategy to
inactivate IRE1.alpha., enabling a functional analysis of this core
UPR component in diverse cell types, including transformed cells
cultured under hypoxia. This approach can also yield potential drug
leads that may be utilized to address whether inactivation of a
core UPR component can be tolerated in animals and applied as an
antitumor strategy.
Materials and Methods
IRE1.alpha. Inhibitor Screen
[0361] As described above in Example 2, HT1080 fibrosarcoma cells
stably expressing the XBP-luciferase reporter were plated in a 384
well microplate (4000 cells/well). After 24 hours, cells were
treated with a mixture of tunicamycin (4 .mu.g/ml) and thapsigargin
(0.4 .mu.M), followed by the addition of one compound per well (10
.mu.M). We screened a total of 66,000 diverse molecules obtained
from Specs, Chembridge and ChemRX. Twenty-four hours
post-induction, BriteGlo luciferase substrate (10 .mu.l) was added
to each well and the signal intensity determined in a plate reader
(0.2 s read per well). Hits were determined as compounds that
significantly (>75%) inhibited activation of the XBP-luciferase
signal by ER stress. We retested 431 compounds from the initial
screen, and selected 58 compounds for additional analysis,
including calculation of IC50 values and inhibition of a
CMV-luciferase reporter. A total of 12 molecules, including
irestatin 9389, exhibited potent and specific inhibition of
IRE1.alpha. and were further characterized.
Plasmids, Cell Lines, and Antibodies
[0362] The human fibrosarcoma cell line HT1080 and myeloma cell
line RPMI-8226 were obtained from American Type Culture Collection
(ATCC, Manassas, Va.). Cells were maintained at 37.degree. C. with
5% CO.sub.2 in DMEM (HT1080) or RPMI 1640 media (RPMI-8226 cells)
supplemented with 10% fetal bovine serum and 1%
penicillin-streptomycin antibiotics. Rabbit polyclonal antisera
raised against human XBP-1 and phospho-IRE1.alpha. were a gift from
Dr. Fumihiko Urano (University of Massachusetts, Worcester, Mass.).
Additional antibodies were obtained from the following commercial
sources: Grp78 (Stressgen); IRE1.alpha., ATF6, and CHOP/GADD153
(Santa Cruz Biotechnology, Santa Cruz, Calif.); Flag M2 monoclonal
(Sigma, St. Louis, Mo.); cleaved caspase 3, JNK1 and phospho-JNK1
(Cell Signaling Technologies, Danvers, Mass.); HIF-1.alpha. (Novus
Biologicals, Littleton, Colo.); (hypoxyprobe and anti-pimonidazole
antibody kits (Chemicon, Temecula, Calif.).
[0363] To generate the XBP-luciferase reporter, N-terminally
Flag-tagged, unspliced human XBP-1 (amino acids 1-208) was
amplified by PCR using Pfx polymerase (Invitrogen, San Diego,
Calif.). The PCR product was digested with EcoRI and BamHI, and
subcloned into pEGFP-N1 (Clontech, Mountain View, Calif.) to
generate pFlag-XBP1(1-208)-EGFP. This plasmid was subsequently
digested with BamHI and Not I to remove EGFP. Firefly luciferase
containing BamHI and Not I sites was amplified by PCR and subcloned
downstream of XBP-1 such that luciferase is translated only in the
`spliced` reading frame. All constructs were verified by
sequencing.
Immunoblotting
[0364] Cells (2.times.10.sup.6) were cultured in 10-cm dishes,
collected using a cell scraper at 4.degree. C., and lysed by
addition of 150 .mu.l cell lysis buffer [50 mM Tris pH 7.4, 150 mM
NaCl, 10% glycerol, 0.5% Triton X-100. 0.5% NP-40, 2 mM
Na.sub.3VO.sub.4, 20 mM beta-glycerophosphate, 10 mM NaF, 1 mM DTT,
1 mM PMSF). Lysates were centrifuged for 5 min at 10,000.times.g,
and proteins (.about.40 .mu.g) were resolved by SDS-PAGE followed
by semi-dry transfer to nitrocellulose membranes. Membranes were
blocked in TBS-5% milk supplemented with 0.1% Tween-20. The blots
were then probed overnight with relevant antibodies, washed, and
incubated for 2 hours with species-specific secondary antibodies
conjugated to horseradish peroxidase. After washing in block
solution, immunoreactive material was detected by enhanced
chemiluminescence (SuperSignal West Dura Extended, Pierce, Inc.,
Rockville, Ill.).
Reporter Assays
[0365] HT1080 cells stably expressing the XBP-luciferase construct
were grown in 60 mm dishes to 60-70% confluency. Following hypoxia
treatment, cells were washed twice with PBS, lysed in 400 .mu.l
1.times. reporter lysis buffer (RLB) (Promega, Madison Wis.) for 30
min at 24.degree. C. Lysates (100 .mu.l) were mixed with an equal
volume of luciferase substrate (Promega), and assayed using a
luminometer. For 5.times.-UPRE-luciferase reporter assays, cells
were co-transfected with the appropriate reporter plasmid and a
control plasmid (pSV40-beta-gal) using Lipofectamine 2000
(Invitrogen, San Diego, Calif.). Twenty-four hours after
transfection, fresh media was added, and cells were treated with Tm
or shifted to hypoxia. After treatment, cells were lysed in
1.times.RLB and analyzed for luciferase activity as described
above. Beta-galactosidase activity was determined using the
beta-galactosidase enzyme assay system (Promega).
Northern Blots
[0366] Cells were cultured in 10 cm plates, harvested, and total
RNA recovered with Trizol (Invitrogen, San Diego, Calif.). Total
RNA (10 .mu.g) was resolved on a 1% agarose-formaldehyde gel.
.sup.32P-labeled probes were prepared using the Rediprime II
random-prime labeling kit (GE-Amersham, Buckinghamshire, UK). The
primers used to PCR amplify probes are as follows. P58.sup.IPK:
5'GTGGCCCCCGGCTCCGTGACCAGCCGGCTGGGCTCGGTA 3' (SEQ ID NO: 4); 5'
ACGCTTCAGTATTATCATTCTTCAACTTTGACGCAGCTTT 3' (SEQ ID NO: 5). DER-1:
5' GTCGGACATCGGAGACTGGTTCAGGAGCATCCCGGCGAT 3' (SEQ ID NO: 6);
5'TCCTACTGGGCAGCCAGCGGTACAAAAACTGAGGGTGTGG 3' (SEQ ID NO: 7). Blots
were incubated with probe overnight, washed three times in
2.times.SSC/0.2% SDS, dried, and exposed to a phosphorimager screen
overnight. Images were analyzed using ImageQuant software
(Molecular Dynamics).
Ribonuclease Assay
[0367] The in vitro ribonuclease assays were carried out using
purified IRE1.alpha.-cyto essentially as described. Gonzalez and
Walter, Methods Mol Biol 160: 25-36 (2001); Gonzalez et al., Embo J
18: 3119-3132 (1999). For each reaction, 5 .mu.g purified
IRE1.alpha.-cyto was incubated with 300 ng of fluorescein-labeled
RNA stem-loop substrate at 37.degree. C. in a total volume of 300
.mu.l. Aliquots (50 .mu.l) were withdrawn at the indicated times
and mixed with an equal volume of stop solution. Id. Reactions were
analyzed by SDS-PAGE using 10-20% acrylamide gradient gels. The
sequence for the hXBP-1 3' RNA stem-loop substrate is as follows:
[0368] 5'CAGCACUCAGACUACGUGCACCUCUGCAGCAGGUGCAGGCCCAGUUG 3' (SEQ ID
NO: 8). For the RNAse A cleavage assay, 300 ng of labeled XBP-1 RNA
substrate were incubated with 1 ng bovine RNAse A (Sigma) in the
presence of RNAsin (40 units), irestatin 9389 (2 .mu.M) or DMSO
vehicle control at 30.degree. C. for the indicated times.
Mouse Immunohistochemistry and Histopathology
[0369] Tumor-bearing mice were injected i.p. with hypoxyprobe (50
mg/kg) 1 hour prior to sacrifice. Mice were euthanised under
anesthesia by cervical dislocation, and tumors were surgically
resected, embedded in OCT compound (Sakura Tissue Tek), and frozen
at -80.degree. C. Tumors were sectioned at 8 .mu.m, fixed in 4%
paraformaldehyde, and blocked in PBS-4% BSA. Tissue sections were
incubated overnight in block solution containing antisera specific
for hypoxyprobe (1:250) and cleaved caspase-3 (1:400). Slides were
washed three times with block solution and incubated for 2 hours at
room temperature with anti-mouse Alexa 488 or anti-rabbit Alexa 594
(Invitrogen, San Diego, Calif.). Slides were washed five times in
block solution, and coverslips mounted with Permount supplemented
with DAPI.
[0370] Complete blood counts (CBC's) and clinical chemistry panels
were performed on blood obtained by cardiac puncture after
euthanasia with CO.sub.2 Gross necropsies were performed, all major
viscera were harvested, fixed in 10% buffered neutral formalin,
routinely processed for paraffin embedding, and stained with
hematoxylin and eosin (H&E). Sections were analyzed by a
board-certified veterinary pathologist (DMB).
Clonogenic Survival Assays
[0371] For hypoxia survival assays, cells were grown in 60 mm
dishes until reaching at 50-70% confluence and shifted to hypoxia
(0.1% O.sub.2) for 48 hrs. Cells were trypsinized, counted using a
hemocytometer, and replated in triplicate at 1,000-20,000 cells per
plate in normal culture medium. After 10-12 days of growth under
normal oxygen conditions, colonies were stained with 0.2% crystal
violet in ethanol and counted. Survival values are expressed as the
number of colonies divided by the total number of cells seeded for
each condition, normalized to the plating efficiency under normal
oxygen conditions. At least three independent experiments were
performed.
Tumor Xenografts
[0372] Female 4-6 week-old SCID (B6.CB 17) mice supplied by
Stanford University Animal Facility were housed in the same
facility (American Association of Laboratory Animal Care-approved)
with 12 hour light cycles. Food and water were provided ad libitum.
All experiments were approved by the institutional care and use
committee. The potential toxicities of irestatin 9389 were examined
in SCID mice injected i.p. once daily over 4 consecutive days with
increasing doses of irestatin 9389 or vehicle control. A dosing
regimen of 50-60 mg/kg, equal to 75% of the LD50 value, resulted in
robust inhibition of IRE1.alpha. function without apparent
toxicity. For xenografts, 2.times.10.sup.6 HT1080 fibrosarcoma
cells were resuspended in 50-75 .mu.l PBS and injected s.c. in the
dorsal flanks of host mice. When the implanted tumors reached a
mean volume of .about.150 mm.sup.3, mice were randomly assigned
into different treatment groups. Mice were dosed by i.p. bolus
injection with either vehicle (50% DMSO, 20% cremophor EL, 30%
ethanol) or irestatin 9389 (50 mg/kg). Tumors (6-8 per group) were
measured every 2-4 days with calipers. Tumor volume was calculated
using the formula [(W.sup.2.times.L) 0.52] where W=width and
L=length.
In Vivo Bioluminescence Imaging
[0373] HT1080 fibrosarcoma cells (2.times.10.sup.6) stably
expressing the XBP-luciferase reporter were implanted s.c. into
severe combined immune deficient (SCID) mice. Ten minutes prior to
imaging, mice were injected i.p. with D-luciferin (150 mg/kg)
solubilized in PBS. Optical bioluminescence imaging was performed
using the IVIS charged-coupled device camera system (Caliper Life
Sciences, Hopkinton, Mass.). Mice were imaged for 1-4 minutes per
acquisition scan. Signal intensities were analyzed using Living
Image software (Caliper).
Results and Discussion
[0374] FIG. 11 shows the identification of Irestatin 9389 as a
potent inhibitor of the IRE1.alpha./XBP-1 pathway. A.
XBP-luciferase reporter construct. Firefly luciferase was inserted
downstream of the IRE1.alpha. splice site in human XBP-1 to enable
the conditional translation of luciferase under ER stress in an
IRE1.alpha.-dependent manner. B. Selective inhibition of the
XBP-luciferase reporter by irestatin 9389. HT1080 human
fibrosarcoma cells stably expressing the XBP-luciferase reporter or
CMV-luciferase were cultured in the presence of Tm (4 .mu.g/ml) and
Tg (0.4 .mu.M) and irestatin 9389 at the indicated concentrations.
After 24 hours, luciferase activity was analyzed in an automated
plate reader. For each cell line, values are expressed as the
percent inhibition of the median for Tm/Tg-treated wells, corrected
for background. C. Structure of irestatin 9389. D. XBP-luciferase
reporter assay. HT1080 cells stably expressing the XBP-luciferase
reporter were exposed to Tm (4 .mu.g/ml) for 24 hours or hypoxia
(0.1% oxygen) for 24 or 48 hours, in the presence of DMSO or
irestatin 9389 (1 .mu.M) as indicated. Values are expressed as the
fold increases over uninduced levels. E. 5.times.-UPRE reporter
assay. HT1080 cells were co-transfected with 5.times.-UPRE
luciferase and SV40-beta-gal reporter plasmids, followed by
exposure to Tm or hypoxia as in D. For each condition, luciferase
activity is normalized to beta-galactosidase expression levels as
an internal control for transfection efficiency. F. Western
immunoblot analysis of XBP-1s. HT1080 cells were left untreated
(lane 2) or exposed to Tm (4 .mu.g/ml) for 20 hours in the presence
of DMSO vehicle (lane 1) or the indicated irestatins (2 .mu.M;
lanes 3-6). Cell lysates were resolved by SDS-PAGE and
immunoblotting using antisera specific for XBP-1s (top panel) or
actin and GAPDH (bottom panel) as loading controls. G. Irestatin
9389 blocks the accumulation of XBP-1s under hypoxic conditions.
HT1080 cells were treated with DMSO or exposed to irestatin 9389 (2
.mu.M; lane 3) in normoxia (N) or under hypoxia for 24 hours (H 24;
lanes 2,3). Cells were harvested, lysed, and analyzed by
immunoblotting with antisera specific for HIF-1.alpha. (top),
XBP-1s (middle) or actin (bottom). H. Northern blot analysis of
XBP-1s transcription targets. Cells were exposed to Tm (4 .mu.g/ml)
or hypoxia for 24 hours (H 24) in the absence or presence of
irestatin 9389 (2 .mu.M). Total RNA was analyzed by Northern
blotting using radiolabeled probes specific for P58.sup.IPK or
DER-1. Total rRNA is shown as loading control.
[0375] FIG. 12 shows that irestatin 9389 inhibits the endonuclease
function of IRE1.alpha.. A. Irestatin 9389 does not modulate the
expression of Grp78. HT1080 cells were exposed to DMSO vehicle
(lane 1), irestatin 9389 (2.5 .mu.M; lane 2) for 16 hours or Tm (5
.mu.g/ml; lane 3) for 8 hours. Following treatments, cells were
harvested, lysed, and analyzed by immunoblotting using anti-Grp78
antibody (top) or anti-actin (bottom) as a loading control. B.
Effect of irestatin 9389 on IRE1.alpha. expression and kinase
function. HT1080 cells were preincubated for 16 hours with either
vehicle or irestatin 9389 (2.5 .mu.M), followed by addition of Tm
(5 .mu.g/ml) for the indicated times. Cell lysates were analyzed by
Western immunoblotting using anti-IRE1.alpha. (bottom) or
anti-phospho-IRE1.alpha. antibodies (top). C. Effect of irestatins
on JNK1 activation under ER stress. HT1080 cells were untreated
(lane 1), exposed to TNF-.alpha. (10 ng/ml, 10 min), or Tm (4
.mu.g/ml, 1.5 hrs) (lanes 3-8) following a 2 hour preincubation in
the presence of vehicle (lane 3) or the indicated irestatins (2.5
.mu.M; lanes 4-8). Lysates were analyzed by Western blot using
antisera specific for phospho-JNK1 (top) or total JNK1 (bottom). D.
Purification of IRE1.alpha.-cytosolic.
6.times.-His-IRE1.alpha.-cyto containing the IRE1.alpha. kinase and
endonuclease was expressed in bacteria (lane 1) and isolated by
Nickel resin affinity chromatography to >95% purity (lane 2). E.
IRE1.alpha. endonuclease assay. Fluorescein end-labeled RNA
minisubstrate (300 ng) corresponding to the downstream (3') human
XBP-1 intron-exon cleavage site was incubated in the absence (lanes
1-3) or presence (lanes 4-9) of purified His6-IRE1.alpha.-cyto (5
.mu.g), and exposed to either vehicle or irestatin 9389 (2.5
.mu.M). The reactions were stopped at the indicated times and
reaction aliquots were resolved by SDS-PAGE and visualized by UV
illumination. F. Quantification of RNA cleavage kinetics. Results
represent the mean from 3 independent experiments+/-SEM. G. RNAse A
activity assay. Labeled XBP-1 RNA minisubstrate (300 ng) was
exposed for the indicated times to RNAse A (1 ng) in the presence
of either RNAse inhibitor (40 units), irestatin 9389 (2.5 .mu.M),
or vehicle only for the indicated times. Samples were analyzed as
in (E).
[0376] FIG. 13 shows that exposure to irestatin 9389 induces
apoptosis and impairs cell survival under hypoxia and ER stress. A.
Effect of irestatin 9389 on PERK and ATF6 pathways. HT1080 cells
were treated with vehicle alone (lanes 1-4) or 2.5 .mu.M irestatin
9389 (lanes 5-8) and cultured under aerobic conditions for 18 hours
(N) or shifted to hypoxia for the indicated times. Protein lysates
were analyzed by Western blot analysis using antisera specific for
ATF6 (top), CHOP/GADD153 (middle) or actin (bottom). Arrow
indicates the cleaved, transcriptionally active form of ATF6. B.
Cleavage of caspase-3 in irestatin-treated cells under hypoxia.
HT1080 cells were cultured in normoxia (N) or under hypoxia for 36
hours (H 36) in absence or presence of irestatin 9389 (2.5 .mu.M).
Arrows indicate proteolytically cleaved caspase-3. C. Colony
formation assay. HT1080 cells were treated as in B under normoxia
(N) or hypoxia for 48 hours (H 48). Cells were harvested, counted,
and allowed to grow under normal culture conditions for 11-12 days.
Colonies were visualized with crystal violet staining. D.
Quantification of clonogenic survival assay. Values represent the
mean+/-SEM from at least 4 independent experiments. E. TUNEL
staining of cells treated as in C. F. Quantification of
TUNEL-positive cells. Values represent the mean+/- SEM from at
least 3 experiments. G. HT1080 tet-off Flag-XBP-1s cells were
cultured in the presence or absence of dox (1 .mu.g/ml), followed
by lysis and anti-Flag immunoblot. H. Rescue of irestatin-mediated
cell death by enforced expression of XBP-1s. Tet-off XBP-1s cells
were cultured with or without irestatin 9389 (2.5 .mu.M) in the
absence or presence of dox, under hypoxia for 48 hours (H 48).
Cells were processed as in C, and colonies were visualized with
crystal violet staining. I. Cell proliferation assays. Equal
numbers (1.times.10.sup.5) of HT1080 fibrosarcoma (left) or RPMI
8226 myeloma cells (right) were seeded on day 0, and cultured in
the presence of vehicle control or irestatin 9389 at the indicated
concentrations. Cells were harvested at the indicated times and
counted by hemocytometer. Values represent the mean calculated from
triplicate experiments+/-SEM.
[0377] FIG. 14 shows the in vivo antitumor activity of irestatin
9389. A. Irestatin 9389 impairs IRE1.alpha. activity in implanted
tumor xenografts. Equal numbers (2.times.10.sup.6) of
XBP-luciferase or CMV-luciferase reporter cells were implanted s.c.
into SCID mice. After one week, mice were treated with irestatin
9389 (50 mg/kg), followed by optical bioluminescence imaging. B.
Inhibition of tumor growth by irestatin 9389. HT1080 s.c. tumor
xenografts were established in SCID mice and allowed to reach a
mean volume of 150 mm.sup.3 before treatment. Irestatin 9389 (50
mg/kg) or vehicle control was administered q 2d by i.p. injection
and continued for 2 weeks, for a total of 6 doses. Tumor volumes
were calculated based on caliper measurements taken every 3-5 days.
Data points represent the mean volume calculated from at least 7
tumors per group, with SEM shown in one direction. Mean mouse
weights+/-SEM are shown in bottom graph. C.
[0378] Immunohistochemical analysis of tumor xenografts. Tissue
sections prepared from cryo-preserved tumors following 3 doses with
either vehicle control or irestatin 9389 were immunostained using
hypoxyprobe (pimonidazole) or antisera specific for cleaved
caspase-3. D. Quantification of tumor immunohistochemistry. At
least 8 randomly chosen fields (>300 cells/field) per tumor were
scored for pimonidazole and cleaved caspase-3 staining. A minimum
of 3 tumors (250-300 mm.sup.3 at harvest) were analyzed per
treatment group. Values represent mean++/- SEM.
[0379] FIG. 15 shows the expression of XBP-1s in human pancreas
tissue specimens. Tissues surgically recovered from normal
pancreas, chronic pancreatitis, or pancreatic tumors were sectioned
and stained using antisera specific for XBP-1s (400.times.
magnification). Images were scored on the basis of staining
intensity and quantified as shown in the table.
[0380] FIG. 16 shows the histopathological analysis of mouse
pancreas and liver tissues. Pancreas and liver specimens recovered
from mice treated with three doses of either vehicle (top) or
irestatin 9389 (50 mg/kg; bottom) were sectioned and stained with
hematoxylin and eosin.
[0381] As described above, a HT1080 fibrosarcoma cell line stably
expressing a fusion of unprocessed XBP-1 inserted upstream of
firefly luciferase has been developed to identify small molecule
inhibitors of the IRE1.alpha./XBP-1 signaling module. Under ER
stress conditions, IRE1.alpha. catalyzes the removal of a 26-nt
intronic sequence from the XBP-1 mRNA, introducing a shift in
reading frame that allows for the translation of luciferase (FIG.
11A). We screened a chemical library of 66,000 small molecules for
inhibitors of XBP-luciferase activity stimulated by incubation of
the reporter cell line with a mixture of tunicamycin and
thapsigargin, two mechanistically distinct chemical inducers of ER
stress. We also utilized a counterscreen consisting of HT1080 cells
stably expressing a constitutively-expressed, CMV promoter-driven
luciferase construct to exclude agents that caused non-specific
inhibition of luciferase activity. We identified 12 molecules,
termed irestatins, which consistently inhibited the
IRE1.alpha./XBP-1 signaling module without significantly affecting
the activity of CMV-luciferase. We pursued several of the most
potent irestatins, and describe here in detail our analysis of
irestatin 9389, which inhibited XBP-luciferase activity with mean
inhibitory concentration (IC50) of .about.25 nM (FIG. 11B). The
structure of this molecule is shown in FIG. 11C.
[0382] To determine if irestatin 9389 impairs IRE1.alpha./XBP-1
signaling triggered by oxygen deprivation, we cultured
XBP-luciferase reporter cells for 24 or 48 hours under hypoxia
(<0.1% oxygen) in the absence or presence of irestatin 9389 (1
.mu.M), and then assayed for luciferase activity. As a separate
control, cells were also treated with Tm for 24 hours, which
increased luciferase activity by 60-fold (FIG. 11D). As expected,
exposure to irestatin 9389 inhibited Tm-mediated activation of the
reporter by more than 90%. Exposure to irestatin 9389 also
diminished activation of the XBP-luciferase reporter under hypoxia
for 24 or 48 hours. Whereas control (DMSO-treated) cells increased
XBP-luciferase activity by 95-fold after 48 hours of hypoxia, the
addition of irestatin 9389 robustly inhibited this response (FIG.
11D, right panel).
[0383] Since these assays employed a chimeric XBP-luciferase
substrate, we next determined whether irestatin 9389 could inhibit
the function of endogenous XBP-1s. HT1080 cells were transfected
with a firefly luciferase reporter under the transcriptional
control of 5 tandem repeats of the unfolded protein response
element (5.times.-UPRE), a canonical DNA binding site for XBP-1s
identified in the promoter regions of XBP-1 target genes. Yoshida
et al., Molecular & Cellular Biology 20: 6755-6767 (2000);
Yamamoto et al., Journal of Biochemistry 136: 343-350 (2004).
Following exposure to Tm, luciferase activity increased by
.about.12-fold over untreated cells, while cells exposed to both Tm
and irestatin 9389 exhibited less than a 4-fold induction (FIG.
11E). Irestatin 9389 also robustly inhibited UPRE promoter activity
under hypoxic conditions. After 48 hours of hypoxia,
vehicle-treated cells increased luciferase activity by 170-fold,
while the addition of irestatin 9389 diminished this response by
more than 90% (FIG. 11E, right panel). In support of these
findings, western immunoblot analysis demonstrated that irestatin
9389 blocked the accumulation of XBP-1s following treatment with
Tm, while structurally unrelated irestatin candidates exhibited
little or no effect (FIG. 11F, lanes 3-5). Similarly, irestatin
9389 decreased levels of XBP-1s following 24 hours of hypoxia (FIG.
11G), while the expression of HIF-1.alpha., a hypoxia-inducible
transcription factor that functions independently of the UPR
(Romero-Ramirez et al., Cancer Research 64: 5943-5947 (2004)), was
not affected by irestatin 9389 (FIG. 11G, top panel).
[0384] Gene expression profiling studies have identified several
XBP-1-dependent target genes that are transcriptionally induced
during ER stress. Lee et al., Molecular & Cellular Biology 23:
7448-7459 (2003). These include the DnaJ/Hsp40-like gene
P58.sup.IPK DER-1, a component of the ERAD pathway. Oda et al., J
Cell Biol 172: 383-393 (2006). To analyze the effect of irestatin
9389 on the expression of these genes, HT1080 cells were treated
with Tm or cultured under hypoxia for 24 hours, followed by
isolation of total RNA and Northern blot analysis. Expression of
these key UPR genes increased significantly (>5-fold) under
hypoxia or following treatment with Tm, while the addition of
irestatin 9389 fully inhibited this response (FIG. 11H). We
conclude that irestatin 9389 specifically blocks the production or
accumulation of XBP-1s following ER stress and diminishes the
expression of its downstream effectors.
[0385] We next sought to determine the mechanism by which irestatin
9389 inhibits IRE1.alpha./XBP-1 function. We first examined if
irestatin 9389 deregulates the expression of Grp78, thereby
increasing the fraction of Grp78-bound IRE1.alpha. and raising the
activation threshold for IRE1.alpha.. Liu et al., Journal of
Biological Chemistry 277: 18346-18356 (2002); Zhou et al., Proc
Natl Acad Sci USA 103: 14343-14348 (2006); Bertolotti et al., Nat
Cell Biol 2: 326-332 (2000). HT1080 cells were incubated with
vehicle or irestatin 9389 (2.5 .mu.M) for 16 hours, followed by
western immunoblot analysis using Grp78 antisera. As a positive
control, cells were treated with Tm for 8 hours, which robustly
induced Grp78 (FIG. 12A, lane 3). In contrast, irestatin 9389 had
no effect on Grp78 levels (FIG. 12A) at 16 hours or following
longer treatments of 24 or 36 hours (data not shown). Similarly,
cells incubated in the presence of irestatin 9389 for 16 hours
exhibited no significant changes in the total level of IRE1.alpha.,
as judged by Western immunoblotting (FIG. 12B, lower panel).
[0386] Activation of IRE1.alpha. is preceded by ATP binding and
autophosphorylation, and the IRE1.alpha. kinase is required for
endonuclease activity. Tirasophon et al., Genes & Development
14:2725-2736 (2000). To determine if irestatin 9389 inhibits the
IRE1.alpha. kinase, HT1080 cells were preincubated for 16 hours
with irestatin or vehicle followed by addition of Tm to induce ER
stress. Cells were then harvested at regular intervals, and
activation of the IRE1.alpha. kinase was assessed by immunoblotting
using anti-phospho-IRE1.alpha. antisera. In both control and
irestatin-treated cells, the addition of Tm triggered a rapid
increase in levels of phospho-IRE1.alpha. (FIG. 12B). Preincubation
with irestatin 9389 also failed to block the phosphorylation of
JNK1, a downstream effector of IRE1.alpha. kinase signaling (Urano
et al., Science 287: 664-666 (2000)), during Tm-induced ER stress
(FIG. 12C). Interestingly, several structurally unrelated
irestatins strongly inhibited the IRE1.alpha.-dependent
phosphorylation of JNK1 under ER stress (FIG. 12C, lanes 7-8),
indicating that mechanistically distinct classes of irestatins were
identified by the initial screen.
[0387] Next we determined whether irestatin 9389 inhibited the
endonuclease function of IRE1.alpha.. To monitor endonuclease
activity, we devised an in vitro ribonuclease assay in which a
fluorescein labeled RNA hairpin corresponding to the 3' intron-exon
boundary of human XBP-1 serves as a cleavage substrate for the
IRE1.alpha. nuclease. Because the isolated IRE1.alpha. endonuclease
lacks significant catalytic activity (Dong et al., RNA 7: 361-373
(2001); Nock et al., Methods Enzymol 342: 3-10 (2001); D.F. and
A.K., unpublished data), we expressed in bacteria and purified the
full cytosolic portion of IRE1.alpha. (His6-IRE1.alpha.-cyto)
containing both kinase and endonuclease domains (FIG. 12D). In the
presence of ATP and purified His6-IRE1.alpha.-cyto, the XBP-1
target RNA sequence was efficiently cleaved, with a mean half-life
of .about.25 minutes (FIG. 12E). Addition of irestatin 9389 (2.5
.mu.M) to the reaction strongly inhibited cleavage (FIG. 12E).
However, irestatin is not a general ribonuclease inhibitor, as a
>100-fold molar excess of irestatin 9389 failed to inhibit
degradation of the XBP-1 3' intronic loop by RNAse A (FIG. 11G).
Thus, irestatin 9389 functions as a selective inhibitor of the
IRE1.alpha. endoribonuclease without impairing IRE1.alpha. kinase
function.
[0388] Activation of IRE1.alpha. alleviates ER stress through the
splice-activation of XBP-1 and by the co-translational cleavage of
mRNAs encoding secreted proteins. Hollien and Weissman, Science
313: 104-107 (2006). To assess the impact of inhibiting IRE1.alpha.
signaling on the cellular response to ER stress, we performed a
kinetic analysis of the two other major UPR pathways, ATF6 and
PERK, in hypoxic cells exposed to irestatin 9389. Treatment of
hypoxic cells with irestatin 9389 significantly increased the
proteolytic cleavage of ATF6 into its transcriptionally active 50
kDa form (FIG. 13A, top). Likewise, the expression of CHOP/GADD153,
a downstream target of the PERK-ATF4 signaling module, was
increased in irestatin-treated cells following exposure to hypoxia
for 6-12 hours (FIG. 13A, middle panel). As persistent activation
of the PERK-ATF4-CHOP signaling module triggers apoptotic cell
death (McCullough et al., Molecular & Cellular Biology 21:
1249-1259 (2001); Yamaguchi and Wang, Journal of Biological
Chemistry 279: 45495-45502 (2004); Marciniak et al., Genes &
Development 18: 3066-3077 (2004); Boyce et al., Science 307:
935-939 (2005)), we also examined the activation of caspase-3, the
major apoptotic effector caspase, in irestatin-treated cells.
Whereas vehicle-treated cells exhibited minimal activation of
caspase-3 after 36 hours of hypoxia, exposure to irestatin 9389
stimulated cleavage of caspase-3 (FIG. 13B, lanes 3-4). This effect
was specific to hypoxia-stressed cells, as irestatin 9389 had no
effect on caspase-3 processing in cells cultured under normal
oxygen conditions (FIG. 13B, lanes 1-2). Taken together, these
findings indicate that irestatin 9389 overwhelms the adaptive
capacity of the UPR, leading to initiation of programmed cell
death.
[0389] We corroborated these biochemical findings using colony
formation assays as an indicator of cell viability. Addition of
irestatin 9389 (2.5 .mu.M) to the culture medium had a negligible
effect on the survival of HT1080 cells cultured under normal oxygen
conditions (FIG. 13C). However, in cells cultured under hypoxia for
48 hours, irestatin 9389 strongly inhibited colony formation (FIG.
13D). Exposure of hypoxic cells to irestatin 9389 for a shorter
duration (hours 40-48 of hypoxia) also resulted in a 8-fold
decrease in the rate of colony formation (data not shown).
Consistent with the increased activation of caspase-3, treatment
with irestatin 9389 significantly increased the proportion of
hypoxic cells undergoing programmed cell death, as indicated by
TUNEL-positive cells under hypoxia (FIG. 13E). After 48 hours of
hypoxia, only 6% of vehicle-treated cells were TUNEL-positive, as
compared with 35% of irestatin-treated cells (FIG. 13F).
[0390] To determine if the irestatin-mediated inhibition of
IRE1.alpha./XBP-1s pathway accounts for decreased viability under
hypoxia, we generated a cell line in which Flag-tagged XBP-1s is
expressed under the control of a tetracycline-regulated promoter.
Cells cultured in the presence of doxicycline (dox, 1 .mu.g/ml) do
not express Flag-XBP-1s, while removal of dox restores robust
expression of Flag-XBP-1s (FIG. 13G). In the presence of both dox
and irestatin 9389 (2.5 .mu.M), we again observed a significant
(.about.60 fold) decrease in viability following exposure to
hypoxia for 48 hours. In contrast, the same concentration of
irestatin 9389 had a minimal effect on the survival of hypoxic
cells expressing Flag-XBP-1s (FIG. 13H). Thus, inhibition of the
IRE1.alpha./XBP-1s signaling module, and not an off-pathway effect
of the irestatin, is primarily responsible for the poor survival of
irestatin-treated tumor cells under hypoxia. Importantly, exposure
to irestatin 9389 also strongly inhibited the growth of the myeloma
cell line RPMI 8226, a secretory plasmacytoma, in a dose-dependent
manner (FIG. 13I, right panel). In contrast, exposure to the same
concentrations of irestatin 9389 had a negligible effect on the
growth rate of HT1080 cells cultured under normal conditions (FIG.
13I, left panel). We conclude that irestatin 9389 selectively
impairs the growth and survival of a variety of transformed cell
types subjected to mechanistically distinct forms of ER stress.
[0391] The increased sensitivity of irestatin-treated cells to
hypoxic stress in vitro indicate that selective inhibition of
IRE1.alpha. signaling could impact tumor growth. In support of an
active role for IRE1.alpha. in tumor growth, we found that >50%
(16/30) of surgically resected human pancreatic adenocarcinoma
specimens exhibited moderate or strong immunoreactivity for XBP-1s.
In contrast, XBP-1s was not detected in normal pancreas specimens
(0/20), and infrequently observed in chronic pancreatitis (1/29)
(FIG. 15). To explore the effects to irestatin 9389 in vivo, we
first established animal dosing parameters using real-time
bioluminescence imaging of SCID mice that had been implanted
subcutaneously (s.c.) with tumor cells stably expressing the
XBP-luciferase reporter. Irestatin 9389 administered in single
doses of 50-60 mg/kg robustly inhibited the XBP-luciferase reporter
for 6-8 hours after the injection (FIG. 14A). The XBP-luciferase
signal returned to basal levels by 24 hours after treatment. A
complete blood count and analysis of blood chemistry indicated that
3-4 doses of irestatin 9389 (50 mg/kg), administered every other
day, were well tolerated and did not result in significant
impairment of kidney, liver, or bone marrow function (Table 3).
Although IRE1.alpha. has been implicated in glucose tolerance
(Lipson et al., Cell Metab 4: 245-254 (2006); Ozcan et al., Science
306: 457-461 (2004)), we found no significant difference in fasting
blood glucose levels between irestatin- and vehicle-treated animals
(Table 3). These findings are further supported by
histopathological analysis of all major organs, which revealed no
significant differences between the vehicle and irestatin treatment
groups. (FIG. 16).
TABLE-US-00003 TABLE 3 Analysis of blood chemistry and cell
composition. Vehicle-treated or irestatin-treated nude mice were
euthanized with carbon dioxide, and a terminal cardiac blood draw
performed. Blood was collected using a heparinzed syringe for CBC
and clinical chemistries. Based on comparisons with the vehicle
control mice, the only lesion that may be related to treatment is a
mild leukopenia noted in both treated mice. The degree is mild and
histologically, the bone marrow was not impacted. Vehicle Irestatin
9389 mean SEM mean SEM Chemistry Panel Glucose mg/dL 112.5 20.56696
124.5 7.14 AST IU/L 107.6 22.92408 117.775 14.25 ALT IU/L 30
10.15513 29.4 6.68 Total Bilirubin mg/dL 0.525 0.287228 0.3 0
Cholesterol mg/dL 102.25 8.261356 102 8.8 Electrolyte Panel Sodium
mM 151.5 2.12132 152.25 1.89 Potassium mM 7.875 0.388909 7.5175
0.49 Chloride mM 116 1.414214 116.75 2.22 Carbon Dioxide mM 22.55
0.777817 25.075 0.71 Na/K Ratio mM 19.25 1.202082 20.325 1.36 Anion
Gap mM 20.9 0.565685 17.975 0.71 Complete Blood Count WBC K/uL 5.55
1.340398 5.19 1.23 RBC M/uL 9.8 0.583095 10.375 0.3 HGB gm/dL 13.75
0.818535 14.625 0.59 HCT % 43.9 2.946184 47 1.39 Platelets K/uL
574.5 159.9281 805.5 124.9
[0392] Next, we tested if treatment with irestatin 9389 could have
a direct impact on tumor growth. Equal numbers (2.times.10.sup.6)
of HT1080 cells were injected in the flanks of nude mice and
allowed to grow for 2 weeks until tumors reached a mean volume of
.about.150 mm.sup.3. Mice were then randomly assigned into vehicle
control or irestatin groups, and dosed by intraperitoneal (i.p.)
injection of vehicle or irestatin 9389 (50 mg/kg) every other day
for a total of 6 doses. Although this dosing regimen resulted in a
transient inhibition of IRE1.alpha., significant cytostatic
antitumor effects were soon evident (FIG. 14B). The inhibition of
tumor growth continued even after the final injection of irestatin
9389. One week after the last treatment, the mean volume of
irestatin-treated tumors was significantly less than
vehicle-treated tumors (1790+/-380 mm.sup.3 versus 480+/-210
mm.sup.3; P<0.01) (FIG. 14B). Irestatin-treated mice did not
exhibit significant long-term weight loss compared to
vehicle-treated mice (FIG. 14B, top).
[0393] We further examined tumors from control and
irestatin-treated mice for differences in cell survival. In tumors
treated with three doses of irestatin 9389 (50 mg/kg), we observed
a significant increase in cleaved caspase-3, an indicator of
apoptosis, relative to vehicle-treated controls (FIG. 14C). The
increase in apoptosis was most pronounced in hypoxic tissue regions
of tumors, as determined by co-immunoreactivity for pimonidazole
adducts (FIG. 14C, bottom panel). Quantitative analysis of
immunostained tumor sections indicated that, in vehicle-treated
tumors, less than 15% of hypoxic cells were apoptotic, compared to
nearly 45% in irestatin-treated tumors (FIG. 14D). Interestingly,
some pimonidazole-negative areas also exhibited increased levels of
apoptosis following treatment with irestatin 9389, indicating that
ER stress or sensitivity to irestatin occurs in tissue regions that
are not acutely hypoxic (FIG. 14D). Taken together, these
observations indicate that transient intratumoral inhibition of the
UPR can potentiate cell death and impair tumor growth.
[0394] Severe hypoxia triggers the accumulation of misfolded
proteins in the ER (Koumenis et al., Molecular & Cellular
Biology 22: 7405-7416 (2002)), a potentially lethal condition that
is remedied through the action of the UPR. In this study, we sought
to determine the function of the IRE1.alpha. branch of the UPR in
cellular tolerance to hypoxia and tumor growth. We employed a
chemical genetic strategy to identify inhibitors of this pathway,
and obtained multiple, mechanistically distinct classes of
irestatins, including molecules that selectively target either the
IRE1.alpha. kinase or endonuclease. We found that selective
inactivation of the IRE1.alpha. endonuclease critically
incapacitates the adaptive capacity of the UPR, resulting in
increased ER stress and cell death under hypoxia. Irestatins
therefore define a novel category of ER stress-selective antitumor
agents specifically targeted to the underlying physiological
response of tumor cells to the tumor microenvironment.
[0395] Several reports have demonstrated an essential role for the
UPR in embryonic development, raising the possibility that systemic
application of UPR-targeting molecules could cause severe toxicity
to normal tissues, particularly those with secretory function such
as the pancreas and liver. Iwakoshi et al., Immunological Reviews
194: 29-38 (2003); Reimold et al., Genes Dev 14: 152-157 (2000);
Reimold et al., Nature 412: 300-307 (2001). However, we found that
multiple bioactive doses of irestatin 9389 were well tolerated and
did not result in acute injury to these organ systems, as indicated
by analysis of blood chemistry and organ pathology. Without
intending to be bound by theory, our observations are consistent
with the finding that expression of XBP-1 in the liver rescues the
embryonic lethality of XBP-1 deficient mice, indicating that most
tissues can function adequately in the absence of this key UPR
transcription factor. Lee et al., Embo J 24: 4368-4380 (2005).
Likewise, deletion of PERK results in a multitude of developmental
abnormalities, including hyperglycemia and atrophy of the exocrine
pancreas. Harding et al., Mol Cell 7: 1153-1163 (2001). However,
PERK is necessary for the development of insulin-secreting
pancreatic beta cells specifically during the fetal and early
neonatal period and is not required in adults to maintain beta cell
functions or glucose homeostasis. Zhang et al., Cell Metab 4:
491-497 (2006). Without intending to be bound by theory, these
findings indicate that the major UPR pathways are required in a
subset of secretory tissues during temporally delimited
developmental windows, and that inactivation of core UPR signaling
modules using drug-like molecules can be well tolerated in mature
animals.
[0396] Although individual UPR pathways are dispensable under most
circumstances, we found that pharmacological inhibition of
IRE1.alpha. significantly impaired the growth of implanted tumors.
This finding reinforces the idea that tumors are subjected to
significantly elevated levels of ER stress relative to the
surrounding normal tissues, a condition that may arise through the
distinct contrasts in oxygenation status between normal tissues and
solid tumors. Hockel and Vaupel, Seminars in Oncology 28: 36-41
(2001); Vaupel et al., Methods in Enzymology 381: 335-354 (2004).
Without intending to be bound by theory, the antitumor effects of
irestatin 9389 are consistent with a report demonstrating that
inhibition of UPR target gene expression during glucose-deprivation
can impair tumor growth. Park et al., Journal of the National
Cancer Institute 96: 1300-1310 (2004). Without intending to be
bound by theory, the rate of tumor growth may be naturally
constrained by the severity of ER stress and by the capacity of the
UPR to restore cellular homeostasis. Inhibition of this response
induces proteotoxicity in hypoxic tumor cells, as indicated by the
increased output of parallel UPR pathways downstream of ATF6 and
PERK following treatment with irestatin 9389. In support of this
model, irestatin 9389 potently blocks the induction of the XBP-1
targets DER-1 and P58.sup.IPK, essential components of the ERAD
machinery that mediate clearance of misfolded proteins from the ER.
Ye et al., Nature 429: 841-847 (2004); Oyadomari et al., Cell 126:
727-739 (2006).
[0397] The pharmacological induction of ER proteotoxicity
represents an effective therapeutic strategy in the treatment of
solid tumors or secretory cell malignancies such as multiple
myeloma, in which the UPR sustains cell viability under conditions
of elevated secretory output. Iwakoshi et al., Nat Immunol 4:
321-329 (2003). Without intending to be bound by theory, since
activation of the UPR can confer drug resistance to cancer cells
(Gray et al., Mol Pharmacol 68: 1699-1707 (2005); Li and Lee, Curr
Mol Med 6: 45-54 (2006)), our findings indicate that coordinated
treatment with UPR-targeting agents may potentiate the efficacy of
conventional chemotherapies. Inhibition of the UPR may also
sensitize tumors to vascular targeting agents or anti-angiogenic
drugs, which increase the fraction of hypoxic or nutrient-deprived
tumor tissues (El-Emir et al., Eur J Cancer 41: 799-806 (2005);
Boyle and Travers, Anticancer Agents Med Chem 6: 281-286 (2006);
Dong et al., Cancer Research 65: 5785-5791 (2005)), or to radiation
therapy, which preferentially kills oxygenated cell populations
(Vaupel et al., Medical Oncology 18: 243-259 (2001); Vaupel et al.,
Seminars in Oncology 28: 29-35 (2001)). Likewise, proteasome
inhibitors such as bortezomib (Velcade) have been shown to cause ER
stress, while also inhibiting the UPR. Lee et al., Proceedings of
the National Academy of Sciences of the United States of America
100: 9946-9951 (2003); Nawrocki et al., Cancer Res 65: 11510-11519
(2005); Obeng et al., Blood 107: 4907-4916 (2006). A combination of
an irestatin and one or more proteasome inhibitors may exhaust the
protective capacity of the UPR, pushing tumor cells into a
decompensated state and ultimately cell death.
Example 6
Activity of Irestatins with 9389-Like Structure
[0398] Compounds of the screening library with structural
similarity to compound 9389 (see Table 1) have been identified and
in some cases further assayed for inhibitory activity. See Table 4.
Compounds listed with "IC50" values were assayed secondarily after
initially being identified in the high throughput screen. Each
value represents a separate calculation of reporter inhibition
based upon the high throughput robotic screening platform. The
actual IC50 values are calculated and represent an estimate of the
potency of each compound. This assay is not considered to be
accurate below a concentration of 10 nM. Compounds classified with
"mild" activity inhibited the XBP1-luciferase reporter by 10-30%.
Compounds classified with "moderate" activity inhibited the
XBP1-luciferase reporter by 30-75%. Compounds classified with
"potent" activity inhibited the XBP1-luciferase reporter by
75-100%. Compounds classified with "undetected" activity inhibited
the XBP1-luciferase reporter by less than 10% under the defined
conditions.
[0399] Compounds with activities classified as "undetected" in
Table 4 were identified by manual review of the structures of
compounds reportedly present in the chemical libraries. Compounds
displaying at least some structural similarity to the compounds
with demonstrated activity are shown. The presence of these
compounds in the assays has not been independently confirmed,
however, so a lack of detectable activity may not necessarily be
due to a compound's lack of activity.
TABLE-US-00004 TABLE 4 Activities of compounds having structural
similarity to Compound 9389 IC50 Conc % Activity Compound STRUCTURE
Assay (uM) (uM) Inh Class 1567 ##STR00069## HTS 10 -41.2 undetected
2399 ##STR00070## HTS 10 13.3 mild 3290 ##STR00071## HTS 10 -30.3
undetected 1491 ##STR00072## HTS HTS 10 10 11.0 63.4 mild 1740
##STR00073## HTS HTS 10 10 25.1 5.9 mild 2750 ##STR00074## HTS HTS
10 10 11.7 16.6 mild 4335 ##STR00075## IRE IC50 0.09 20 67.4
moderate IRE IC50 6.30 20 70.4 5500 ##STR00076## IRE IC50 0.06 20
100.4 potent IRE IC50 0.000048 20 104.4 8878 ##STR00077## IRE IC50
0.023 20 72.4 moderate IRE IC50 5.14 20 50.0 2853 ##STR00078## HTS
10 26.5 mild 3371 ##STR00079## IRE IC50 13.90 20 72.6 moderate 3398
##STR00080## HTS 10 -56.2 undetected 4645 ##STR00081## HTS 10 -8.3
undetected 4950 ##STR00082## HTS 10 -6.2 undetected 6392
##STR00083## HTS 10 2.7 undetected 6451 ##STR00084## HTS 10 -55.6
undetected 8233 ##STR00085## HTS 10 -59.6 undetected 8920
##STR00086## HTS 10 25.7 mild 9165 ##STR00087## HTS 10 -6.5
undetected 9388 ##STR00088## HTS 10 -40.8 undetected 9389
##STR00089## IRE IC50 0.0063 20 87.1 potent IRE IC50 0.031 20 100.3
9668 ##STR00090## HTS 10 19.0 mild 9766 ##STR00091## HTS 10 26.7
mild 9787 ##STR00092## HTS 10 -122.3 undetected 0040 ##STR00093##
HTS 10 -4.6 undetected 0069 ##STR00094## HTS 10 -5.4 undetected
6068 ##STR00095## HTS 12.3 5.8 undetected
[0400] From the foregoing, it will be appreciated that, although
specific embodiments of the invention have been described herein
for the purpose of illustration, various modifications may be made
without deviating from the spirit and scope of the invention.
[0401] All references disclosed herein, including patent references
and non-patent references, are hereby incorporated by reference in
their entirety as if each was incorporated individually.
[0402] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, numerous
equivalents to the specific method and reagents described herein.
Such equivalents are considered to be within the scope of this
invention and are covered by the following claims.
CONCLUSION
[0403] The above specific description is meant to exemplify and
illustrate the invention and should not be seen as limiting the
scope of the invention, which is defined by the literal and
equivalent scope of the appended claims. Any patents or
publications mentioned in this specification are indicative of
levels of those skilled in the art to which the patent or
publication pertains as of its date and are intended to convey
details of the invention which may not be explicitly set out but
which would be understood by workers in the field. Such patents or
publications are hereby incorporated by reference to the same
extent as if each was specifically and individually incorporated by
reference, as needed for the purpose of describing and enabling the
method or material to which is referred.
Sequence CWU 1
1
81261PRTHuman 1Met Val Val Val Ala Ala Ala Pro Asn Pro Ala Asp Gly
Thr Pro Lys 1 5 10 15 Val Leu Leu Leu Ser Gly Gln Pro Ala Ser Ala
Ala Gly Ala Pro Ala 20 25 30 Gly Gln Ala Leu Pro Leu Met Val Pro
Ala Gln Arg Gly Ala Ser Pro 35 40 45 Glu Ala Ala Ser Gly Gly Leu
Pro Gln Ala Arg Lys Arg Gln Arg Leu 50 55 60 Thr His Leu Ser Pro
Glu Glu Lys Ala Leu Arg Arg Lys Leu Lys Asn 65 70 75 80 Arg Val Ala
Ala Gln Thr Ala Arg Asp Arg Lys Lys Ala Arg Met Ser 85 90 95 Glu
Leu Glu Gln Gln Val Val Asp Leu Glu Glu Glu Asn Gln Lys Leu 100 105
110 Leu Leu Glu Asn Gln Leu Leu Arg Glu Lys Thr His Gly Leu Val Val
115 120 125 Glu Asn Gln Glu Leu Arg Gln Arg Leu Gly Met Asp Ala Leu
Val Ala 130 135 140 Glu Glu Glu Ala Glu Ala Lys Gly Asn Glu Val Arg
Pro Val Ala Gly 145 150 155 160 Ser Ala Glu Ser Ala Ala Leu Arg Leu
Arg Ala Pro Leu Gln Gln Val 165 170 175 Gln Ala Gln Leu Ser Pro Leu
Gln Asn Ile Ser Pro Trp Ile Leu Ala 180 185 190 Val Leu Thr Leu Gln
Ile Gln Ser Leu Ile Ser Cys Trp Ala Phe Trp 195 200 205 Thr Thr Trp
Thr Gln Ser Cys Ser Ser Asn Ala Leu Pro Gln Ser Leu 210 215 220 Pro
Ala Trp Arg Ser Ser Gln Arg Ser Thr Gln Lys Asp Pro Val Pro 225 230
235 240 Tyr Gln Pro Pro Phe Leu Cys Gln Trp Gly Arg His Gln Pro Ser
Trp 245 250 255 Lys Pro Leu Met Asn 260 2376PRTHuman 2Met Val Val
Val Ala Ala Ala Pro Asn Pro Ala Asp Gly Thr Pro Lys 1 5 10 15 Val
Leu Leu Leu Ser Gly Gln Pro Ala Ser Ala Ala Gly Ala Pro Ala 20 25
30 Gly Gln Ala Leu Pro Leu Met Val Pro Ala Gln Arg Gly Ala Ser Pro
35 40 45 Glu Ala Ala Ser Gly Gly Leu Pro Gln Ala Arg Lys Arg Gln
Arg Leu 50 55 60 Thr His Leu Ser Pro Glu Glu Lys Ala Leu Arg Arg
Lys Leu Lys Asn 65 70 75 80 Arg Val Ala Ala Gln Thr Ala Arg Asp Arg
Lys Lys Ala Arg Met Ser 85 90 95 Glu Leu Glu Gln Gln Val Val Asp
Leu Glu Glu Glu Asn Gln Lys Leu 100 105 110 Leu Leu Glu Asn Gln Leu
Leu Arg Glu Lys Thr His Gly Leu Val Val 115 120 125 Glu Asn Gln Glu
Leu Arg Gln Arg Leu Gly Met Asp Ala Leu Val Ala 130 135 140 Glu Glu
Glu Ala Glu Ala Lys Gly Asn Glu Val Arg Pro Val Ala Gly 145 150 155
160 Ser Ala Glu Ser Ala Ala Gly Ala Gly Pro Val Val Thr Pro Pro Glu
165 170 175 His Leu Pro Met Asp Ser Gly Gly Ile Asp Ser Ser Asp Ser
Glu Ser 180 185 190 Asp Ile Leu Leu Gly Ile Leu Asp Asn Leu Asp Pro
Val Met Phe Phe 195 200 205 Lys Cys Pro Ser Pro Glu Pro Ala Ser Leu
Glu Glu Leu Pro Glu Val 210 215 220 Tyr Pro Glu Gly Pro Ser Ser Leu
Pro Ala Ser Leu Ser Leu Ser Val 225 230 235 240 Gly Thr Ser Ser Ala
Lys Leu Glu Ala Ile Asn Glu Leu Ile Arg Phe 245 250 255 Asp His Ile
Tyr Thr Lys Pro Leu Val Leu Glu Ile Pro Ser Glu Thr 260 265 270 Glu
Ser Gln Ala Asn Val Val Val Lys Ile Glu Glu Ala Pro Leu Ser 275 280
285 Pro Ser Glu Asn Asp His Pro Glu Phe Ile Val Ser Val Lys Glu Glu
290 295 300 Pro Val Glu Asp Asp Leu Val Pro Glu Leu Gly Ile Ser Asn
Leu Leu 305 310 315 320 Ser Ser Ser His Cys Pro Lys Pro Ser Ser Cys
Leu Leu Asp Ala Tyr 325 330 335 Ser Asp Cys Gly Tyr Gly Gly Ser Leu
Ser Pro Phe Ser Asp Met Ser 340 345 350 Ser Leu Leu Gly Val Asn His
Ser Trp Glu Asp Thr Phe Ala Asn Glu 355 360 365 Leu Phe Pro Gln Leu
Ile Ser Val 370 375 31818DNAHuman 3tagtctggag ctatggtggt ggtggcagcc
gcgccgaacc cggccgacgg gacccctaaa 60gttctgcttc tgtcggggca gcccgcctcc
gccgccggag ccccggcggc caggctgccg 120ctcatggtgc cagcccagag
aggggccagc ccggaggcag cgagcggggg gctgccccag 180gcgcgcaagc
gacagcgcct cacgcacctg agccccgagg agaaggcgct gaggaggaaa
240ctgaaaaaca gagtagcagc tcagactgcc agagatcgaa agaaggctcg
aatgagtgag 300ctggaacagc aagtggtaga tttagaagaa gagaaccaaa
aacttttgct agaaaatcag 360cttttacgag agaaaactca tggccttgta
gttgagaacc aggagttaag acagcgcttg 420gggatggatg ccctggttgc
tgaagaggag gcggaagcca aggggaatga agtgaggcca 480gtggccgggt
ctgctgagtc cgcagcactc agactacgtg cacctctgca gcaggtgcag
540gcccagttgt cacccctcca gaacatctcc ccatggattc tggcggtatt
gactcttcag 600attcagagtc tgatatcctg ttgggcattc tggacaactt
ggacccagtc atgttcttca 660aatgcccttc cccagagcct gccagcctgg
aggagctccc agaggtctac ccagaaggac 720ccagttcctt accagcctcc
ctttctctgt cagtggggac gtcatcagcc aagctggaag 780ccattaatga
actaattcgt tttgaccaca tatataccaa gcccctagtc ttagagatac
840cctctgagac agagagccaa gctaatgtgg tagtgaaaat cgaggaagca
cctctcagcc 900cctcagagaa tgatcaccct gaattcattg tctcagtgaa
ggaagaacct gtagaagatg 960acctcgttcc ggagctgggt atctcaaatc
tgctttcatc cagccactgc ccaaagccat 1020cttcctgcct actggatgct
acagtgactg tggatacggg ggttcccttt ccccattcag 1080tgacatgtcc
tctctgcttg gtgtaaacat tcttgggagg acacttttgc caatgaactc
1140tttccccagc tgattagtgt ctaaggaatg atccaatact gttgcccttt
tccttgacta 1200ttacactgcc tggaggatag cagagaagcc tgtctgtact
tcattcaaaa agccaaaata 1260gagagtatac agtcctagag aatccctcta
tttgttcaga tctcatagat gacccccagg 1320tattgccttt tgacatccag
cagtccaagg tattgagaca tattactgga agtaagaaat 1380attactataa
ttgagaacta cagcttttaa gattgtactt ttaagattgt acttttatct
1440taaaagggtg gtagttttcc ctaaaatact tattatgtaa gggtcattag
acaaatgtct 1500tgaagtagac atggaattta tgaatggtct ttatcatttc
tcttccccct ttttggcatc 1560ctggcttgcc tccagtttta ggtcctttag
tttgcttctg caagcaacgg gaacacctgc 1620tgagggggct ctttccctca
tgtatacttc aagtaagatc aagaatcttt tgtgaaatta 1680tagaaattta
ctatgtaaat gcttgatgga attttttcct gctagtgtag cttctgaaag
1740gtgctttctc catttattta aaaactaccc atgcaattaa aaggtacaat
gcaaaaaaaa 1800aaaaaaaaaa attttttt 1818439DNAArtificial
sequenceSynthetic oligonucleotide sequence 4gtggcccccg gctccgtgac
cagccggctg ggctcggta 39540DNAArtificial sequenceSynthetic
oligonucleotide sequence 5acgcttcagt attatcattc ttcaactttg
acgcagcttt 40639DNAArtificial sequenceSynthetic oligonucleotide
sequence 6gtcggacatc ggagactggt tcaggagcat cccggcgat
39740DNAArtificial sequenceSynthetic oligonucleotide sequence
7tcctactggg cagccagcgg tacaaaaact gagggtgtgg 40847RNAArtificial
sequenceSynthetic oligonucleotide sequence 8cagcacucag acuacgugca
ccucugcagc aggugcaggc ccaguug 47
* * * * *