U.S. patent application number 13/691856 was filed with the patent office on 2013-06-06 for methods and compositions for improved cattle longevity and milk production.
This patent application is currently assigned to WISCONSIN ALUMNI RESEARCH FOUNDATION. The applicant listed for this patent is Wisconsin Alumni Research Foundation. Invention is credited to Wen Huang, Hasan Khatib.
Application Number | 20130143758 13/691856 |
Document ID | / |
Family ID | 40626450 |
Filed Date | 2013-06-06 |
United States Patent
Application |
20130143758 |
Kind Code |
A1 |
Khatib; Hasan ; et
al. |
June 6, 2013 |
METHODS AND COMPOSITIONS FOR IMPROVED CATTLE LONGEVITY AND MILK
PRODUCTION
Abstract
A single nucleotide polymorphic site at position 10793 of the
bovine POU1F1 gene is associated with improved longevity and milk
product traits. Disclosed are nucleic acid molecules, kits, methods
of genotyping and marker assisted bovine breeding methods.
Inventors: |
Khatib; Hasan; (Madison,
WI) ; Huang; Wen; (Madison, WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Wisconsin Alumni Research Foundation; |
Madison |
WI |
US |
|
|
Assignee: |
WISCONSIN ALUMNI RESEARCH
FOUNDATION
MADISON
WI
|
Family ID: |
40626450 |
Appl. No.: |
13/691856 |
Filed: |
December 3, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12267104 |
Nov 7, 2008 |
8338098 |
|
|
13691856 |
|
|
|
|
60986241 |
Nov 7, 2007 |
|
|
|
Current U.S.
Class: |
506/9 ;
435/287.2; 435/6.11; 506/16; 536/23.5 |
Current CPC
Class: |
C12Q 1/6883 20130101;
C12Q 1/6876 20130101; A61D 19/02 20130101; C12Q 2600/156 20130101;
C12Q 1/6888 20130101; C12Q 2600/172 20130101 |
Class at
Publication: |
506/9 ; 536/23.5;
506/16; 435/287.2; 435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
GOVERNMENT INTEREST
[0001] This invention was made with United States government
support awarded by the following agencies: USDA/CSREES
05-CRHF-0-6055. The United States government has certain rights in
this invention.
Claims
1. An isolated nucleic acid molecule comprising a polymorphic site
at position 10793 and at least 15 contiguous bases of SEQ ID NO: 1
adjacent to the polymorphic site, wherein the nucleic acid molecule
comprises an adenine base at position 10793, or a nucleic acid
molecule that is fully complementary to the nucleic acid
molecule.
2. A nucleic acid molecule according to claim 1, which comprises at
least 17 contiguous bases of SEQ ID NO: 1 adjacent to the
polymorphic site.
3. A nucleic acid molecule according to claim 1, which comprises at
least 20 contiguous bases of SEQ ID NO: 1 adjacent to the
polymorphic site.
4. An isolated nucleic acid molecule according to claim 1, which
comprises not more than 150 nt.
5. An isolated nucleic acid molecule according to claim 1, which
comprises not more than 100 nt.
6. An isolated nucleic acid molecule according to claim 1, which
comprises not more than 50 nt.
7. A nucleic acid molecule according to claim 1, wherein the
polymorphic site is within 4 nucleotides of the center of the
nucleic acid molecule.
8. A nucleic acid molecule according to claim 7, wherein the
polymorphic site is at the center of the nucleic acid molecule.
9. A nucleic acid molecule according to claim 1, wherein the
polymorphic site is at the 3'-end of the nucleic acid molecule.
10. An array of nucleic acid molecules comprising at least two
nucleic acid molecules according to claim 8.
11. A kit comprising a nucleic acid molecule of claim 1, and a
suitable container.
12. A method for detecting single nucleotide polymorphism (SNP) in
bovine POU1F1 gene, wherein the PI gene have a nucleic acid
sequence of SEQ ID NO: 1, the method comprising determining the
identity of a nucleotide at position 10793, and comparing the
identity to the nucleotide identity at a corresponding position of
SEQ ID NO: 1.
13. A method for genotyping a bovine cell, comprising obtaining a
nucleic acid sample from said cell and determining the identity of
the nucleotide of a position of 10793 of the bovine POU1F1 gene
according to claim 12.
14. A method according to claim 13, wherein the bovine cell is an
adult cell, an embryo cell, a sperm, an egg, a fertilized egg, or a
zygote.
15. A method according to claim 13, wherein the identity of the
nucleotide is determined by sequencing the PI gene, or a relevant
fragment thereof, isolated from the cell.
16. A method according to claim 16, wherein the gene or a relevant
fragment thereof is isolated from the cell via amplification by the
polymerase chain reaction (PCR) of genomic DNA of the cell, or by
RT-PCR of the mRNA of the cell.
17. A method according to claim 15, wherein both copies of the gene
in the cell are genotyped.
18. A method for progeny testing of cattle, the method comprising
collecting a nucleic acid sample from said progeny, and genotyping
said nucleic sample according to claim 13.
19-25. (canceled)
Description
FIELD OF THE INVENTION
[0002] The present invention relates to a method of cattle progeny
testing using molecular genetic methods by assaying for the
presence of at least one genetic marker which is indicative of
longevity and improved milk production.
BACKGROUND OF THE INVENTION
[0003] Dairy cows are significant investments for dairy farmers,
and enormous efforts, such as animal breeding and artificial
insemination, have been and continue to be invested in ensuring
that the animals have high and sustained productivity, and that the
milk produced are of high quality. Traditional breeding techniques
involve the studying of sire progenies, and evaluating their traits
including milk production ratings (transmitting abilities) to guide
further breeding. This standard technique is time consuming and
costly, requiring years to evaluate the true genetic value by
progeny testing each bull. Many cows must be bred and give birth to
offspring. The females must be raised, bred, allowed to give birth
and finally milked for a length of time to measure their phenotypic
traits.
[0004] Furthermore, selection based purely on phenotypic
characteristics does not efficiently take into account genetic
variability caused by complex gene action and interactions, and the
effect of the environmental and developmental variants. There is
thus a need for a method of genetically evaluating cattle to enable
breeders to more accurately select animals at both the phenotypic
and the genetic level.
[0005] Marker-assisted selection can lower the high cost of progeny
testing currently used to improve sires, since young bull progeny
could be evaluated immediately after birth, and young bulls that
are determined by genetic testing to have undesirable markers would
never be progeny tested. Testing may even be conducted prior to
birth, for the presence/absence of the marker. Therefore, there is
also a need for genetic markers for improved milk production
traits.
[0006] POU1F1 is a member of the tissue specific POU (Pit, Oct,
Unc) homeobox transcription factor DNAbinding protein family that
is found in all mammals studied so far (Bastos et al., 2006;
Ingraham et al., 1988; Ingraham et al., 1990). The pituitary
specific expression of POU1F1 is required for the activation of
growth hormone (GH), prolactin (PRL), and thyroid stimulating
hormone (TSH) (Li et al., 1990). These genes are involved in a
variety of signaling pathways that are important for many
developmental and physiological processes, including pituitary
gland development (Li et al., 1990, Mullis, 2007), mammary gland
development and growth (Svennersten-Sjaunja and Olsson, 2005), milk
protein expression (Akers, 2006), and milk production and secretion
(Svennersten-Sjaunja and Olsson, 2005). Moreover, binding of GH and
PRL to their receptors on the cell membrane triggers a cascade of
signaling events including the JAK/STAT pathway, which has been
shown to be required for adult mammary gland development and
lactogenesis (Liu et al., 1997).
[0007] Mutations in POU1F1 often result in severe GH deficiency as
well as defects in development (Mullis, 2007). In a dwarf mouse
model, mutations in POU1F1 lead to the loss of three pituitary cell
types--somatotropes, lactotropes and thyrotropes--(Li et al.,
1990). Lactotropes produce prolactin, which is necessary for
mammary gland development and lactation.
[0008] Several genes in the same pathway of POU1F1 have been
reported to be associated with different milk production and health
traits. For example, growth hormone receptor (GHR) and prolactin
receptor (PRLR) have shown associations with milk yield and
composition (Viitala et al., 2006). Also, the signal transducer and
activator of transcription 1 (STAT1) and osteopontin (OPN) genes
have been shown to have significant effects on milk yield and milk
protein and fat yields in Holstein dairy cattle (Cobanoglu et al.,
2006; Leonard et al., 2005; Schnabel et al., 2005). The uterine
milk protein (UTMP) is another gene in the pathway of POU1F1 that
has been found to be associated with productive life in dairy
cattle (Khatib et al., 2007b).
[0009] POU1F1 is located on bovine chromosome region BTA1q21-22
(Woollard et al., 2000), where multiple quantitative trait loci
(QTL) affecting milk production traits have been identified
(Georges et al., 1995; Nadesalingam et al., 2001). In previous
studies, POU1F1 variants have been reported to be associated with
milk yield and conformation traits (Renaville et al., 1997; Tuggle
and Freeman, 1994). Taken together, the biological functions of
POU1F1 and associations with production traits of genes in the same
pathway of POU1F1 suggest that this gene could be functionally
involved in milk yield and composition traits.
SUMMARY OF THE INVENTION
[0010] The present inventors investigated the effects of POU1F1 on
health and milk composition traits in two independent North
American Holstein cattle populations. A pooled DNA sequencing
approach was used to identify single nucleotide polymorphisms (SNP)
in the gene. A SNP(C/A) in exon 3 of POU1F1 that changes a proline
to a histidine was identified. A total of 2141 individuals from two
independent North American Holstein cattle populations were
genotyped for this SNP using a modified PCR-RFLP method. The
frequencies of allele A were 14.9% and 16.8% in the two examined
populations respectively. Statistical analysis revealed significant
association of POU1F1 variants with milk yield and productive life,
which makes POU1F1a strong candidate for marker assisted selection
in dairy cattle breeding programs.
[0011] Based on the results, the present invention provides an
isolated nucleic acid molecule comprising a polymorphic site of
position 10793 ("SNP 10793") of SEQ ID NO: 1 and at least 17
contiguous nucleotides or bases of SEQ ID NO: 1 adjacent to the
polymorphic site, wherein the nucleic acid molecule comprises an
adenine base at position 10793 of SEQ ID NO: 1. It is recognized
that SEQ ID NO: 1 is already known, and the nucleic acid molecule
therefore does not encompass one that consists of SEQ ID NO: 1.
[0012] Preferably, the nucleic acid molecule which comprises at
least 15, more preferably at least 20, still more preferably at
least 25, contiguous bases of SEQ ID NO: 1 adjacent to the
polymorphic site. In one embodiment, the isolated nucleic acid
molecule comprises not more than 1,500 nt, preferably not more than
1000 nt, more preferably not more than 900 nt, more preferably not
more than 800 nt, more preferably not more than 700 nt, preferably
not more than 600 nt, more preferably not more than 500 nt,
preferably not more than 400 nt, more preferably not more than 300
nt, more preferably not more than 150 nt., preferably not more than
100 nt., still more preferably not more than 50 nt.
[0013] The nucleic acid molecule preferably contains the
polymorphic site which is within 4 nucleotides of the center of the
nucleic acid molecule. Preferably, the polymorphic site is at the
center of the nucleic acid molecule.
[0014] In another embodiment, the nucleic acid molecule contains
the polymorphic site which is at the 3'-end of the nucleic acid
molecule.
[0015] The present invention also provides an array of nucleic acid
molecules comprising at least two nucleic acid molecules described
above.
[0016] The present invention further provides a kit comprising a
nucleic acid molecule described above, and a suitable
container.
[0017] Also provided is a method for detecting single nucleotide
polymorphism (SNP) in bovine POU1F1 gene, wherein the POU1F1 gene
has a nucleic acid sequence of SEQ ID NO: 1, the method comprising
determining the identity of a nucleotide at position 10793, and
comparing the identity to the nucleotide identity at a
corresponding position of SEQ ID NO: 1.
[0018] In another embodiment, the present invention provides a
method for genotyping a bovine cell, using the method above.
Suitable bovine cell may be an adult cell, an embryo cell, a sperm,
an egg, a fertilized egg, or a zygote. The identity of the
nucleotide may be determined by sequencing the POU1F 1 gene, or a
relevant fragment thereof, isolated from the cell. The POU1F1gene
or a relevant fragment thereof is isolated from the cell via
amplification by the polymerase chain reaction (PCR) of genomic DNA
of the cell, or by RT-PCR of the mRNA of the cell. Preferably, the
PCR or RT-PCR is conducted with a pair of primers having the
following sequences:
TABLE-US-00001 (SEQ ID NO: 2)
CAAATGGTCCTTTTCTTGTTGTTACAGGGAGCTTAAGGC (SEQ ID NO: 3)
CTTTAAACTCATTGGCAAACTTTTC.
[0019] In a further embodiment, the present invention provides a
method for progeny testing of cattle, the method comprising
collecting a nucleic acid sample from the progeny, and genotyping
said nucleic sample as described above.
[0020] Further provided is a method for selectively breeding cattle
using a multiple ovulation and embryo transfer procedure (MOET),
the method comprising superovulating a female animal, collecting
eggs from said superovulated female, in vitro fertilizing said eggs
from a suitable male animal, implanting said fertilized eggs into
other females allowing for an embryo to develop, genotyping the
developing embryo, and terminating pregnancy if the developing
embryo does not have adenine (A) at position 10793. Preferably,
pregnancy is terminated if the embryo is homozygously A at position
10793.
[0021] In a preferred embodiment, the method is used for
selectively breeding dairy cattles, comprising selecting a bull
that is hemizygously or homozygously A at position 10793 of its
POU1F1 gene, and using its semen for fertilizing a female animal.
Preferably the bull is homozygously A at position 10793. More
preferably, the female animal is also hemizygously or homozygously
A at position 107931, preferably homozygously A. MOET procedure may
be preferably used for the selective breeding.
[0022] The present invention also provides a method for testing a
dairy cattle for longevity or its milk production trait, or both,
comprising genotyping its cells, wherein a cattle being
homozygously A at position 107931 indicates that the cattle has
desirable longevity or milk production trait.
DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 shows the POU1F1 gene sequence (SEQ ID NO: 1) where
the relevant polymorphic site is shown.
[0024] FIG. 2 shows the protein sequence alignment of POU1F1 from
mammalian species. Protein sequences of POU1F1 from mouse, rat,
human, chimpanzee, bovine, and dog were aligned using the multiple
alignment algorithm ClustalW and visualized with Jalview (EBI).
Numbers on the top are the relative positions of amino acids. The
position of the Pro76H is mutation is indicated by the arrow.
DETAILED DESCRIPTION OF THE INVENTION
[0025] It has been found that a specific site, i.e. position 10793
(see FIG. 1), in the POU1F1 gene sequence is polymorphic. The term
"polymorphism" as used herein refers to the occurrence of two or
more alternative genomic sequences or alleles between or among
different genomes or individuals. "Polymorphic" refers to the
condition in which two or more variants of a specific genomic
sequence can be found in a population. A "polymorphic site" is the
locus at which the variation occurs. Polymorphisms generally have
at least two alleles, each occurring at a significant frequency in
a selected population. A polymorphic locus may be as small as one
base pair. The first identified allelic form is arbitrarily
designated as the reference form, and other allelic forms are
designated as alternative or variant alleles. The allelic form
occurring most frequently in a selected population is sometimes
referred to as the wild type form. Diploid organisms may be
homozygous or heterozygous for allelic forms. A biallelic
polymorphism has two forms, and a triallelic polymorphism has three
forms, and so on.
[0026] Polymorphisms may result in functional differences, through
changes in the encoded polypeptide, changes in mRNA stability,
binding of transcriptional and translation factors to the DNA or
RNA, and the like. Polymorphisms are often used to detect genetic
linkage to phenotypic variation.
[0027] One type of polymorphism, single nucleotide polymorphisms
(SNPs), has gained wide use for the detection of genetic linkage
recently. SNPs are generally biallelic systems, that is, there are
two alleles that an individual may have for any particular SNP
marker. In the instant case, SNPs are used for determining the
genotypes of the POU1F1 gene, which are found to have strong
correlation to longevity and milk production traits.
[0028] In the context of the present specification, the provided
sequences also encompass the complementary sequence, including
those corresponding to the provided polymorphisms. In order to
provide an unambiguous identification of the specific polymorphic
site the numbering of the original POU1F1 sequence in the GenBank
is shown in FIG. 1 and is used.
[0029] The present invention provides nucleic acid based genetic
markers for identifying bovine animals with superior longevity and
milk production traits. In general, for use as markers, nucleic
acid fragments, preferably DNA fragments, will be of at least 12
nucleotides (nt), preferably at least 15 nt, usually at least 20
nt, often at least 50 nt. Such small DNA fragments are useful as
primers for the polymerase chain reaction (PCR), and probes for
hybridization screening, etc.
[0030] The term primer refers to a single-stranded oligonucleotide
capable of acting as a point of initiation of template-directed DNA
synthesis under appropriate conditions (i.e., in the presence of
four different nucleoside triphosphates and an agent for
polymerization, such as, DNA or RNA polymerase or reverse
transcriptase) in an appropriate buffer and at a suitable
temperature. The appropriate length of a primer depends on the
intended use of the primer but typically ranges from 15 to 30
nucleotides. Short primer molecules generally require cooler
temperatures to form sufficiently stable hybrid complexes with the
template. A primer need not reflect the exact sequence of the
template but must be sufficiently complementary to hybridize with a
template. The term primer site, or priming site, refers to the area
of the target DNA to which a primer hybridizes. The term primer
pair means a set of primers including a 5' upstream primer that
hybridizes with the 5' end of the DNA sequence to be amplified and
a 3', downstream primer that hybridizes with the complement of the
3' end of the sequence to be amplified.
[0031] The term "probe" or "hybridization probe" denotes a defined
nucleic acid segment (or nucleotide analog segment) which can be
used to identify by hybridization a specific polynucleotide
sequence present in samples, said nucleic acid segment comprising a
nucleotide sequence complementary of the specific polynucleotide
sequence to be identified. "Probes" or "hybridization probes" are
nucleic acids capable of binding in a base-specific manner to a
complementary strand of nucleic acid.
[0032] An objective of the present invention is to determine which
embodiment of the polymorphisms a specific sample of DNA has. For
example, it is desirable to determine whether the nucleotide at a
particular position is A or C. An oligonucleotide probe can be used
for such purpose. Preferably, the oligonucleotide probe will have a
detectable label, and contains an A at the corresponding position.
Experimental conditions can be chosen such that if the sample DNA
contains an A at the polymorphic site, a hybridization signal can
be detected because the probe hybridizes to the corresponding
complementary DNA strand in the sample, while if the sample DNA
contains a G, no hybridization signal is detected.
[0033] Similarly, PCR primers and conditions can be devised,
whereby the oligonucleotide is used as one of the PCR primers, for
analyzing nucleic acids for the presence of a specific sequence.
These may be direct amplification of the genomic DNA, or RT-PCR
amplification of the mRNA transcript of the POU1F1 gene. The use of
the polymerase chain reaction is described in Saiki et al. (1985)
Science 230:1350-1354. Amplification may be used to determine
whether a polymorphism is present, by using a primer that is
specific for the polymorphism. Alternatively, various methods are
known in the art that utilize oligonucleotide ligation as a means
of detecting polymorphisms, for examples see Riley et al (1990)
Nucleic Acids Res. 18:2887-2890; and Delahunty et al (1996) Am. J.
Hum. Genet. 58:1239-1246. The detection method may also be based on
direct DNA sequencing, or hybridization, or a combination thereof.
Where large amounts of DNA are available, genomic DNA is used
directly. Alternatively, the region of interest is cloned into a
suitable vector and grown in sufficient quantity for analysis. The
nucleic acid may be amplified by PCR, to provide sufficient amounts
for analysis.
[0034] Hybridization may be performed in solution, or such
hybridization may be performed when either the oligonucleotide
probe or the target polynucleotide is covalently or noncovalently
affixed to a solid support. Attachment may be mediated, for
example, by antibody-antigen interactions, poly-L-Lys, streptavidin
or avidin-biotin, salt bridges, hydrophobic interactions, chemical
linkages, UV cross-linking baking, etc. Oligonucleotides may be
synthesized directly on the solid support or attached to the solid
support subsequent to synthesis. Solid-supports suitable for use in
detection methods of the invention include substrates made of
silicon, glass, plastic, paper and the like, which may be formed,
for example, into wells (as in 96-well plates), slides, sheets,
membranes, fibers, chips, dishes, and beads. The solid support may
be treated, coated or derivatized to facilitate the immobilization
of the allele-specific oligonucleotide or target nucleic acid. For
screening purposes, hybridization probes of the polymorphic
sequences may be used where both forms are present, either in
separate reactions, spatially separated on a solid phase matrix, or
labeled such that they can be distinguished from each other.
[0035] Hybridization may also be performed with nucleic acid arrays
and subarrays such as described in WO 95/11995. The arrays would
contain a battery of allele-specific oligonucleotides representing
each of the polymorphic sites. One or both polymorphic forms may be
present in the array, for example the polymorphism of position
10793 may be represented by either, or both, of the listed
nucleotides. Usually such an array will include at least 2
different polymorphic sequences, i.e. polymorphisms located at
unique positions within the locus, and may include all of the
provided polymorphisms. Arrays of interest may further comprise
sequences, including polymorphisms, of other genetic sequences,
particularly other sequences of interest. The oligonucleotide
sequence on the array will usually be at least about 12 nt in
length, may be the length of the provided polymorphic sequences, or
may extend into the flanking regions to generate fragments of 100
to 200 nt in length. For examples of arrays, see Ramsay (1998) Nat.
Biotech. 16:4044; Hacia et al.
[0036] (1996) Nature Genetics 14:441-447; Lockhart et al. (1996)
Nature Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature
Genetics 14:457-460.
[0037] The identity of polymorphisms may also be determined using a
mismatch detection technique, including but not limited to the
RNase protection method using riboprobes (Winter et al., Proc.
Natl. Acad. Sci. USA 82:7575, 1985; Meyers et al., Science
230:1242, 1985) and proteins which recognize nucleotide mismatches,
such as the E. coli mutS protein (Modrich, P. Ann. Rev. Genet.
25:229-253, 1991). Alternatively, variant alleles can be identified
by single strand conformation polymorphism (SSCP) analysis (Orita
et al., Genomics 5:874-879, 1989; Humphries et al., in Molecular
Diagnosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or
denaturing gradient gel electrophoresis (DGGE) (Waitell et al.,
Nucl. Acids Res. 18:2699-2706, 1990; Sheffield et al., Proc. Natl.
Acad. Sci. USA 86:232-236, 1989).
[0038] A polymerase-mediated primer extension method may also be
used to identify the polymorphism(s). Several such methods have
been described in the patent and scientific literature and include
the "Genetic Bit Analysis" method (WO92/15712) and the
ligase/polymerase mediated genetic bit analysis (U.S. Pat. No.
5,679,524). Related methods are disclosed in WO91/02087,
WO90/09455, WO95/17676, U.S. Pat. Nos. 5,302,509, and 5,945,283.
Extended primers containing a polymorphism may be detected by mass
spectrometry as described in U.S. Pat. No. 5,605,798. Another
primer extension method is allele-specific PCR (Ruao et al., Nucl.
Acids Res. 17:8392, 1989; Ruao et al., Nucl. Acids Res. 19,
6877-6882, 1991; WO 93/22456; Turki et al., J. Clin. Invest.
95:1635-1641, 1995). In addition, multiple polymorphic sites may be
investigated by simultaneously amplifying multiple regions of the
nucleic acid using sets of allele-specific primers as described in
Wallace et al. (WO 89/10414).
[0039] A detectable label may be included in an amplification
reaction. Suitable labels include fluorochromes, e.g. fluorescein
isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin,
allophycocyanin, 6-carboxyfluorescein (6-FAM),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE),
6-carboxy-X-rhodamine (ROX),
6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX),
5-carboxyfluorescein (5-FAM) or
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive
labels, e.g. .sup.32P, .sup.35S, .sup.3H; etc. The label may be a
two stage system, where the amplified DNA is conjugated to biotin,
haptens, etc. having a high affinity binding partner, e.g. avidin,
specific antibodies, etc., where the binding partner is conjugated
to a detectable label. The label may be conjugated to one or both
of the primers. Alternatively, the pool of nucleotides used in the
amplification is labeled, so as to incorporate the label into the
amplification product.
[0040] It is readily recognized by those ordinarily skilled in the
art that in order to maximize the signal to noise ratio, in probe
hybridization detection procedure, the polymorphic site should be
at the center of the probe fragment used, whereby a mismatch has a
maximum effect destabilizing the hybrid molecule; and in a PCR
detection procedure, the polymorphic site should be placed at the
very 3'-end of the primer, whereby a mismatch has the maximum
effect on preventing a chain elongation reaction by the DNA
polymerase. The location of nucleotides in a polynucleotide with
respect to the center of the polynucleotide are described herein in
the following manner. When a polynucleotide has an odd number of
nucleotides, the nucleotide at an equal distance from the 3' and 5'
ends of the polynucleotide is considered to be "at the center" of
the polynucleotide, and any nucleotide immediately adjacent to the
nucleotide at the center, or the nucleotide at the center itself is
considered to be "within 1 nucleotide of the center." With an odd
number of nucleotides in a polynucleotide any of the five
nucleotides positions in the middle of the polynucleotide would be
considered to be within 2 nucleotides of the center, and so on.
When a polynucleotide has an even number of nucleotides, there
would be a bond and not a nucleotide at the center of the
polynucleotide. Thus, either of the two central nucleotides would
be considered to be "within 1 nucleotide of the center" and any of
the four nucleotides in the middle of the polynucleotide would be
considered to be "within 2 nucleotides of the center," and so
on.
[0041] In some embodiments, a composition contains two or more
differently labeled oligonucleotides for simultaneously probing the
identity of nucleotides or nucleotide pairs at two or more
polymorphic sites. It is also contemplated that primer compositions
may contain two or more sets of allele-specific primer pairs to
allow simultaneous targeting and amplification of two or more
regions containing a polymorphic site.
[0042] Alternatively, the relevant portion of the POU1F1 gene of
the sample of interest may be amplified via PCR and directly
sequenced, and the sequence be compared to the wild type sequence
shown in FIG. 1. It is readily recognized that, other than those
disclosed specifically herein, numerous primers can be devised to
achieve the objectives. PCR and sequencing techniques are well
known in the art and reagents and equipments are readily available
commercially.
[0043] DNA markers have several advantages; segregation is easy to
measure and is unambiguous, and DNA markers are co-dominant, i.e.,
heterozygous and homozygous animals can be distinctively
identified. Once a marker system is established selection decisions
could be made very easily, since DNA markers can be assayed any
time after a blood sample can be collected from the individual
infant animal, or even earlier by testing embryos in vitro if very
early embryos are collected. The use of marker assisted genetic
selection will greatly facilitate and speed up cattle breeding
problems. For example, a modification of the multiple ovulation and
embryo transfer (MOET) procedure can be used with genetic marker
technology. Specifically, females are superovulated, eggs are
collected, in vitro fertilized using semen from superior males and
implanted into other females allowing for use of the superior
genetics of the female (as well as the male) without having to wait
for her to give birth to one calf at a time. Developing blastomeres
at the 4-8 cell stage may be assayed for presence of the marker,
and selection decisions made accordingly.
[0044] In one embodiment of the invention an assay is provided for
detection of presence of a desirable genotype using the
markers.
[0045] The term "genotype" as used herein refers to the identity of
the alleles present in an individual or a sample. In the context of
the present invention a genotype preferably refers to the
description of the polymorphic alleles present in an individual or
a sample. The term "genotyping" a sample or an individual for a
polymorphic marker refers to determining the specific allele or the
specific nucleotide carried by an individual at a polymorphic
marker.
[0046] The present invention is suitable for identifying a bovine,
including a young or adult bovine animal, an embryo, a semen
sample, an egg, a fertilized egg, or a zygote, or other cell or
tissue sample therefrom, to determine whether said bovine possesses
the desired genotypes of the present invention, some of which are
indicative of improved milk production traits.
[0047] Further provided is a method for genotyping the bovine
POU1F1 gene, comprising determining for the two copies of the
POU1F1 gene present the identity of the nucleotide pair at position
10793.
[0048] One embodiment of a genotyping method of the invention
involves examining both copies of the POU1F1 gene, or a fragment
thereof, to identify the nucleotide pair at the polymorphic site in
the two copies to assign a genotype to the individual. In some
embodiments, "examining a gene" may include examining one or more
of: DNA containing the gene, mRNA transcripts thereof, or cDNA
copies thereof. As will be readily understood by the skilled
artisan, the two "copies" of a gene, mRNA or cDNA, or fragment
thereof in an individual may be the same allele or may be different
alleles. In another embodiment, a genotyping method of the
invention comprises determining the identity of the nucleotide pair
at the polymorphic site.
[0049] The present invention further provides a kit for genotyping
a bovine sample, the kit comprising in a container a nucleic acid
molecule, as described above, designed for detecting the
polymorphism, and optionally at least another component for
carrying out such detection. Preferably, a kit comprises at least
two oligonucleotides packaged in the same or separate containers.
The kit may also contain other components such as hybridization
buffer (where the oligonucleotides are to be used as a probe)
packaged in a separate container. Alternatively, where the
oligonucleotides are to be used to amplify a target region, the kit
may contain, preferably packaged in separate containers, a
polymerase and a reaction buffer optimized for primer extension
mediated by the polymerase, such as PCR.
[0050] In one embodiment the present invention provides a breeding
method whereby genotyping as described above is conducted on bovine
embryos, and based on the results, certain cattle are either
selected or dropped out of the breeding program.
[0051] Through use of the linked marker loci, procedures termed
"marker assisted selection" (MAS) may be used for genetic
improvement within a breeding nucleus; or "marker assisted
introgression" for transferring useful alleles from a resource
population to a breeding nucleus (Soller 1990; Soller 1994).
[0052] The present invention discloses the association between
POU1F1 and milk production and longevity in a total of 2141
individuals from two independent Holstein dairy cattle populations.
SNP10793 allele A was associated with a significant increase in PTA
for milk yield in the CDDR granddaughter design population but not
in the daughter design UW resource population. Although the
granddaughter design has more power than the daughter design for
detecting QTL (Weller et al., 1990), the use of PTA values in the
CDDR population may limit the detection of epistasis and dominance
effects. Thus, to test whether there is any genetic interaction
between the A and C alleles of SNP10793, genotypic effects were
estimated in the UW population using the YD data. Genotype AA was
found to be associated with an increase in milk yield and
productive life compared to the CC and AC genotypes. This is an
indication for complete dominance of the C allele over the A allele
in determining the phenotypic value of productive life and milk
yield. Also, this could explain the lack of significant association
between POU1F1 and productive life when PTAs were used in the
allele substitution model.
[0053] A different SNP located in exon 6 of POU1F1 has been
reported to be associated with milk yield (Tuggle and Freeman,
1994; Renaville et al., 1997). The population size used in those
studies was relatively small (115 and 98, respectively) compared to
a total of 2141 individuals from two independent populations
investigated in the current study. In addition, the SNP reported in
the current study is a missense mutation compared to a synonymous
mutation SNP reported in Tuggle and Freeman (1994) and Renaville et
al. (1997).
[0054] The candidate gene approach has been widely and successfully
used in medical and agricultural studies to identify underlying
genes responsible for complex traits such as susceptibility to
diseases and production traits. We have used this approach and
identified a number of genes including OLR1 (Khatib et al., 2006,
Khatib et al., 2007a), PI (Khatib et al., 2005), OPN (Leonard et
al., 2005), STAT1 (Cobanoglu et al., 2006), and UTMP (Khatib et
al., 2007b) that are associated with milk production and health
traits. In addition to the functional candidate gene approach,
positional information about the investigated gene is usually
incorporated into this approach to identify candidate genes.
However, production traits are very complex by nature and
determined by multiple factors including single gene effects,
interaction between genes, and environmental factors. Therefore, in
addition to positional and functional information of the single
gene, functional information of the signaling pathway and
regulatory network in which the candidate gene is involved should
be incorporated to aid the identification of candidate genes. In
light of this notion, POU1F1 was chosen as a candidate gene for
milk production traits. First, POU1F1 is a transcription factor
that controls the expression of GH and PRL, two important genes in
mammary gland development and milk production and secretion.
Second, genes that are downstream of the POU1F1 signaling pathway
(e.g. STAT1, OPN, UTMP) have been reported to be associated milk
production and health traits. Third, the amino acid proline is
highly conserved among mammalian species; as such mutations at this
position could change the function of the protein.
[0055] In summary, based on the positional, functional, and
regulatory information, POU1F1 was chosen as a candidate gene for
investigation of association with milk production and health
traits. We identified SNP10793, a C to A nucleotide change that
changes a proline to a histidine in the protein. The rarer AA
genotype was associated with a significant increase in productive
life and milk yield. These results suggest that POU1F1 could be
used in marker assisted selection programs in dairy cattle.
[0056] The following examples are intended to illustrate preferred
embodiments of the invention and should not be interpreted to limit
the scope of the invention as defined in the claims.
EXAMPLES
Materials and Methods
[0057] Cattle Population and Phenotypic Data
[0058] Semen samples from 31 Holstein sires and their 1299 sons
were obtained from the Cooperative Dairy DNA Repository (CDDR) of
the USDA Bovine Functional Genomics Laboratory (Beltsville, Md.).
Blood samples (n=842) were obtained from the University of
Wisconsin (UW) resource population (Gonda et al., 2006; Cobanoglu
et al., 2006; Khatib et al., 2007b). Phenotypic data including
predicted transmitting abilities (PTAs) and yield deviations (YDs)
for milk yield, fat yield, protein yield, productive life, and SCS
score were obtained from the USDA Animal Improvement Program
Laboratory (Beltsville, Md.).
[0059] Single Nucleotide Polymorphism (SNP) Identification
[0060] SNP were identified in POU1F1 using the pooled DNA
sequencing approach as described in Leonard et al. (2005). Briefly,
genomic DNA was extracted form 30 individuals, quantified using a
spectrophotometer, then equal amounts of DNA from each individual
were pooled together and subjected to PCR amplification using
different pairs of primers designed in POU1F1. PCR products were
sequenced using forward and reverse primers and SNP were identified
by visual inspection of the chromatograms. To validate SNP
identified in the pools, individuals composing these pools were
also sequenced.
[0061] SNP Genotyping
[0062] Genotyping of the identified SNP was done by a
PCR-restriction fragment length polymorphism (PCR-RFLP) based
method. To genotype SNP3699, primers (forward: atactcatcagagaactgcc
and reverse: cattaaccctgttggtatgg) were used to amplify a 771 bp
genomic fragment of POU1F1. The PCR products were digested with the
restriction enzyme TaqI. Depending on the availability of
restriction enzymes and suitability of the sequence, a PCR primer
can be designed to change the nucleotide sequence near the SNP to
create a restriction site. For SNP10793, primers (forward:
caaatggtccttttcttgttgttacagggagcttaaggc and reverse:
ctttaaactcattggcaaacttttc) were designed to amplify a PCR product
of 234 bp. Two Cs were mutated to Gs at positions 2 and 3
nucleotides upstream of the SNP in order to create a recognition
site for the restriction enzyme StuI.
[0063] A touchdown PCR program was used as follows: initial
denaturing at 94.degree. C. for 5 min, followed by 33 cycles of
94.degree. C. for 45 s, touchdown annealing for 45 s (from
63.degree. C. to 50.degree. C., stay at 50.degree. C. for 25
cycles), and 72.degree. C. for 45 s, and final extension at
72.degree. C. for 7 min. The PCR products were subjected to TaqI or
StuI (Promega, Madison, Wis.) digestion according to manufacturer's
instructions, followed by 2% agarose gel electrophoresis. The A
allele of SNP3699 was indicted by two bands of 338 and 433 bp, and
the G allele was indicated by three bands of 84, 254, and 433 bp.
For SNP10793, the C allele was indicated by two bands of 38 and 198
bp, while the A allele was indicted by a single band of 234 bp.
[0064] Statistical Analysis
[0065] For the CDDR population, association analysis between number
of alleles at the POU1F1 locus and productive traits was carried
out through a weighted least square allele substitution model of
the following form:
y.sub.ij=.mu.+sire.sub.i+.beta.x.sub.ij+.epsilon..sub.ij
where y.sub.ij is the PTAs of the trait considered, vi represents a
general constant, sire.sub.i is the fixed effect of the i.sup.th
sire, .beta. represents half of the allele substitution effect
(.alpha./2), x.sub.ij is the number of A alleles (0, 1, 2) at
SNP3699 or SNP10793, and .epsilon..sub.ij is the residual term.
[0066] For the UW resource population, association of POU1F1
polymorphism with production traits was evaluated with the
following mixed effect model:
y.sub.ijklm=.mu.+h.sub.i+s.sub.j+mgs.sub.k+d.sub.ijkl.tau.+p.sub.m+.epsi-
lon..sub.ijklm
[0067] where y.sub.ijklm represents in turn the yield deviation for
milk protein and fat or productive life of daughter l of sire j and
maternal grandsire k; .tau. represents an effect associated with M.
Paratubercolosis infectious status; d.sub.ijkl is an indicator
variable assuming values 0 or 1 for non infected and infected cows
respectively; p.sub.m represents the effect of POU1F1 (1=AA, AG,
GG). Herd h, sire s and maternal grand sire mgs effects were fitted
in the model as random. In the analysis, correlation between
individuals was not accounted for and therefore variance structure
for sire and maternal grand sire effect had form, I{circle around
(x)}.sigma..sub.s.sup.2 and I{circle around
(x)}.sigma..sup.2.sub.mgs respectively. Variance structure for herd
effect was I{circle around (x)}.sigma..sup.2.sub.h. Standard
assumptions were made for the residual term .epsilon..sub.ijklm.
Additive genetic effect was estimated as half of the difference
between the two homozygotes groups and dominant genetic effect was
computed as the difference between heterozygote and the average of
two homozygotes. Degree of dominance was estimated as the ratio of
dominant effect over additive effect (Falconer and Mackay, 1996)
with values approaching 1 indicating complete dominance (same
effect for heterozygote and homozygote). All statistical analyses
procedures were implemented using "lm" and "lme" of the freely and
publicly available R software v. 2.5.1.
Example 1
Identification of SNP
[0068] Sequencing of 30 grandsires from the CDDR populations and of
the pooled DNA samples revealed four SNP identified in protein
coding exons of POU1F1. An A/G SNP at position 3699 (GenBank
accession number NW 001501776) was identified in exon 2, and 3 SNP
were identified in exon 3: SNP A/C at position 10793, SNP C/T at
position 10822, and SNP A/G at position 10863. Importantly, SNP3699
(exon 2), SNP10822 (exon 3), and SNP10863 (exon 3) were found to be
in complete linkage disequilibrium (LD), therefore only SNP3699 was
used for genotyping. SNP10793 (exon 3) was not in LD with other
SNPs, therefore it was genotyped independently. SNP3699, SNP10822,
and SNP10863 are synonymous mutations whereas SNP10793 is a
missense mutation in which the change from a C to an A (minor
allele) changes amino acid 76 of the POU1F1 protein from proline
(Pro) to histidine (His). Alignment of protein sequences of POU1F1
from mouse, rat, human, chimpanzee, bovine, and dog using the
multiple alignment algorithm ClustalW, revealed that proline is
highly conserved among these species (FIG. 2).
Example 2
Association of POU1F1 with Milk Production and Health Traits
[0069] The allele and genotype frequencies of SNP3699 and SNP10793
and the corresponding chi square test of Hardy-Weinberg equilibrium
(HWE) are listed in Table 1. The genotype frequencies were
consistent with those expected of a population in Hardy-Weinberg
equilibrium. Association testing of SNP3699 in the CDDR population
did not show significance with any of the examined traits (data not
shown), so this SNP was not investigated in the UW resource
population.
[0070] In contrast to SNP3699, SNP10793 was found to be
significantly associated (P=0.027) with milk yield in the CDDR
population using the allele substitution model (Table 2). PTAs
analysis in the UW population did not detect association of milk
yield with POU1F1 locus. However, in the YD analysis, AA genotype
was found to be associated with higher milk yield (Table 3). The AA
genotype was also found to be positively associated with productive
life. Because of PTAs additivity assumptions, dominance effects
were estimated in the UW population using yield deviation data
(Table 3). For both, yield and productive life, the ratio of
dominant effect over additive was close to 1, suggesting complete
dominance. Frequencies of the allele A of SNP10793 were 15% and 17%
in the CDDR and UW populations, respectively (Table 1).
TABLE-US-00002 TABLE 1 Allele and genotype frequencies and tests
HWE of the identified SNPs of POU1F1 in the CDDR and UW resource
Holstein cattle populations Population MAF.sup.a Genotype X
.sup.2(DF = 1).sup.b CDDR SNP3699 0.18 n(AA) = 12, n(AG) = 149,
1.228 (n = 480).sup.c n(GG) = 319 SNP10793 0.15 n(AA) = 31, n(AC) =
325, 0.227 (n = 1299) n(CC) = 943 UW SNP10793 0.17 n(AA) = 26,
n(AC) = 231, 0.300 (n = 842) n(CC) = 585 .sup.aMAF: minor allele
frequency, A allele in SNP3699 and A allele in SNP10793. .sup.bFor
degree of freedom of 1, the 5% significance level for X .sup.2 is
3.84. .sup.cn = number of individuals genotyped
TABLE-US-00003 TABLE 2 Estimates of the allele substitution effects
and standard errors (SE) of SNP10793.sup.a for production trait PTA
values in the CDDR and UW Holstein cattle populations CDDR UW
Traits .alpha./2 .+-. SE .alpha./2 .+-. SE Milk yield 72.24 .+-.
32.64* 37.11 .+-. 35.02 Fat yield 1.69 .+-. 1.23 1.59 .+-. 1.34 Fat
percentage -0.362 .+-. 0.500 0.052 .+-. 0.482 Protein yield 1.22
.+-. 0.835 0.792 .+-. 0.936 Protein percentage -0.353 .+-. 0.229
-0.101 .+-. 0.231 Productive life -0.520 .+-. 0.684 0.028 .+-.
0.047 .sup.aThe effect of substituting allele C with allele A. *P
< 0.05.
TABLE-US-00004 TABLE 3 Estimates of the genotypic effects, standard
errors (SE), and additive and dominance effects of SNP10793 in the
UW resource Holstein cattle population Effect Milk yield P value
Productive life P value Genotype effect.sup.a AC -13.26 .+-. 150.88
0.9301 0.46 .+-. 0.87 0.5973 AA 722.55 .+-. 378.80 0.0592 5.17 .+-.
2.25 0.0240 Dominance effect.sup.a -374.54 .+-. 220.66 0.0926 -2.12
.+-. 1.30 0.1065 Additive effect 361.28 .+-. 189.40 0.0592 2.58
.+-. 1.12 0.0240 Degree of 1.04 0.82 dominance.sup.b
.sup.aEstimates of yield deviations from the UW population, the
effect of genotype CC was arbitrarily set to zero .sup.bDegree of
dominance was estimated as the ratio of dominance effect over
additive effect
REFERENCES
[0071] Akers, R. M. 2006. Major advances associated with hormone
and growth factor regulation of mammary growth and lactation in
dairy cows. J. Dairy Sci. 89(4):1222-1234. [0072] Bastos, E., I.
Santos, I. Parmentier, J. L. Castrillo, A. Cravador, H.
Guedes-Pinto, and R. Renaville. 2006. Ovis aries POU1F1 gene:
cloning, characterization and polymorphism analysis. Genetica
126(3):303-314. [0073] Cobanoglu, O., I. Zaitoun, Y. M. Chang, G.
E. Shook, and H. Khatib. 2006. Effects of the signal transducer and
activator of transcription 1 (STAT1) gene on milk production traits
in Holstein dairy cattle. J. Dairy Sci. 89(11):4433-4437. [0074]
Falconer, D. S, and T. F. C. Mackay. 1996. Introduction to
Quantitative Genetics. 4th ed. Addison Wesley Longman Limited,
England. [0075] Georges, M., D. Nielsen, M. Mackinnon, A. Mishra,
R. Okimoto, A. T. Pasquino, L. S. Sargeant, A. Sorensen, M. R.
Steele, X. Zhao, and et al. 1995. Mapping quantitative trait loci
controlling milk production in dairy cattle by exploiting progeny
testing. Genetics 139(2):907-920. [0076] Gonda, M. G., Y. M. Chang,
G. E. Shook, M. T. Collins, and B. W. Kirkpatrick. 2006. Genetic
variation of Mycobacterium avium ssp. paratuberculosis infection in
US Holsteins. J. Dairy Sci 89(5):1804-1812. [0077] Ingraham, H. A.,
R. P. Chen, H. J. Mangalam, H. P. Elsholtz, S. E. Flynn, C. R. Lin,
D. M. Simmons, L. Swanson, and M. G. Rosenfeld. 1988. A
tissue-specific transcription factor containing a homeodomain
specifies a pituitary phenotype. Cell 55(3):519-529. [0078]
Ingraham, H. A., S. E. Flynn, J. W. Voss, V. R. Albert, M. S.
Kapiloff, L. Wilson, and M. G. Rosenfeld. 1990. The POU-specific
domain of Pit-1 is essential for sequence-specific, high affinity
DNA binding and DNA-dependent Pit-1-Pit-1 interactions. Cell
61(6):1021-1033. [0079] Khatib, H., E. Heifetz, and J. C. Dekkers.
2005. Association of the protease inhibitor gene with production
traits in Holstein dairy cattle. J. Dairy Sci 88(3):1208-1213.
[0080] Khatib, H., S. D. Leonard, V. Schutzkus, W. Luo, and Y. M.
Chang. 2006. Association of the OLR1 gene with milk composition in
Holstein dairy cattle. J. Dairy Sci. 89(5):1753-1760. [0081]
Khatib, H., G. J. Rosa, K. Weigel, F. Schiavini, E. Santus, and A.
Bagnato. 2007a. Additional support for an association between OLR1
and milk fat traits in cattle. Anim. Genet. 38(3):308-310. [0082]
Khatib, H., V. Schutzkus, Y. M. Chang, and G. J. Rosa. 2007b.
Pattern of expression of the uterine milk protein gene and its
association with productive life in dairy cattle. J. Dairy Sci.
90(5):2427-2433. [0083] Leonard, S., H. Khatib, V. Schutzkus, Y. M.
Chang, and C. Maltecca. 2005. Effects of the osteopontin gene
variants on milk production traits in dairy cattle. J. Dairy Sci.
88(11):4083-4086. [0084] Li, S., E. B. Crenshaw, 3rd, E. J. Rawson,
D. M. Simmons, L. W. Swanson, and M. G. Rosenfeld. 1990. Dwarf
locus mutants lacking three pituitary cell types result from
mutations in the POU-domain gene pit-1. Nature 347(6293):528-533.
[0085] Liu, X., G. W. Robinson, K. U. Wagner, L. Garrett, A.
Wynshaw-Boris, and L. Hennighausen. 1997. Stat5a is mandatory for
adult mammary gland development and lactogenesis. Genes Dev.
11(2):179-186. [0086] Mullis, P. E. 2007. Genetics of growth
hormone deficiency. Endocrinol. Metab. Clin. North Am. 36(1):17-36.
[0087] Nadesalingam, J., Y. Plante, and J. P. Gibson. 2001.
Detection of QTL for milk production on Chromosomes 1 and 6 of
Holstein cattle. Mamm. Genome 12(1):27-31. [0088] Renaville, R., N.
Gengler, E. Vrech, A. Prandi, S. Massart, C. Corradini, C.
Bertozzi, F. Mortiaux, A. Burny, and D. Portetelle. 1997. Pit-1
gene polymorphism, milk yield, and conformation traits for Italian
Holstein-Friesian bulls. J. Dairy Sci. 80(12):3431-3438. [0089]
Schnabel, R. D., J. J. Kim, M. S. Ashwell, T. S. Sonstegard, C. P.
Van Tassell, E. E. Connor, and J. F. Taylor. 2005. Fine-mapping
milk production quantitative trait loci on BTA6: analysis of the
bovine osteopontin gene. Proc. Natl. Acad. Sci. USA
102(19):6896-6901. [0090] Svennersten-Sjaunja, K. and K. Olsson.
2005. Endocrinology of milk production. Domest Anim. Endocrinol
29(2):241-258. [0091] Tuggle, C. K. and A. E. Freeman, Inventors.
1994. Genetic marker for improved milk production traits in cattle.
Iowa State University Research Foundation, Inc., assignee. U.S.
Pat. No. 5,614,364. [0092] Viitala, S., J. Szyda, S. Blott, N.
Schulman, M. Lidauer, A. Maki-Tanila, M. Georges, and J. Vilkki.
2006. The role of the bovine growth hormone receptor and prolactin
receptor genes in milk, fat and protein production in Finnish
Ayrshire dairy cattle. Genetics 173(4):21.51-2164. [0093] Weller,
J. I., Y. Kashi, and M. Soller. 1990. Power of daughter and
granddaughter designs for determining linkage between marker loci
and quantitative trait loci in dairy cattle. J. Dairy Sci
73(9):2525-2537. [0094] Woollard, J., C. K. Tuggle, and F. A. Ponce
de Leon. 2000. Rapid communication: localization of POU1F1 to
bovine, ovine, and caprine 1q21-22. J. Anim. Sci 78(1):242-243.
Sequence CWU 1
1
11115952DNABos taurus 1ttctccgttt ctattctttt gtgggaatga gttgccaacc
ttttacttcg actgatacct 60ttatacctct gaattctgag tcttctgcaa ctctgcctct
gataatgcat cccagtgctg 120cggagtgcct accggtctcc aaccacgcca
ccaacgtgat gtccacaggt actaacttca 180ataacagtct acatgcggct
gcgccttaag atatcaggat gggtgctttg aatcttgcta 240gtttagaatc
tcattttaaa aaaaatttta atgtgtatta agttaaatat tcaggatatt
300aaagaagaca aaatgcctaa gaaaatattc aagaaatatt agtaagtgta
gtaatttcaa 360gtattgttga ttttattata aaacctgtct tctatacaag
taaacagtga gtctgaaaac 420cactctatgc aaacatgtat gcataaagag
taaaactaaa aaaatagtgt aaaataattt 480aaaaggtgat tttttttcct
cttagagatt tatttggttt ttagattaca tttactacca 540tgtctaaaaa
atgccgtaca cctctgagta aacacaactg aatgattcct gataccaaca
600acagtgggtt tcaaagaata aaataattag atgtttaaat acactttatt
cagatggtaa 660agaatctccc tacaatgcag gagacccagg tctgatccct
gggtcaggaa gatcccatgg 720agaagggaat ggcaacccac tccactattt
ttgcctggcg aagtccaagg acagaggagc 780ctggcaggtt acagtccatg
gggttgcaaa gagtcggaca caactgaacg actaacactt 840tcactttaaa
tacacttaac ttctttagaa taattaaaaa ctcagaaacc aagtctagag
900gcaatataat atttatttgt ttatttttaa aactttttat tttatattgg
agtatagcca 960gttaacaatg ttgtgatatt ttcagatgga cagcagagga
attcagccat acatacacta 1020tatccttttt tacccaaact cccctcccat
ctaggctaga ggcaatataa tatttagaat 1080ccatgaactg atttgaatct
tttcaagatt tagttctgaa gagatttcaa cctttaatca 1140agtttttata
ttttcttata taactttctt agatgaaaat taaaattaat tcaaatatat
1200tgtctcaaac acaaccaagt aaataaatat gttttgttaa tgtgtctaat
ttttactcag 1260taacaaaggg ttttgattaa taaacaatgt cttgggtaaa
tgtctgttta atagcacttt 1320tcacttgtaa agcaatctaa atatgagcta
aattttataa atttaaaaat caatttgagt 1380tgacacattt atatgccaat
ttaaaatatt ttagccttat attttgttaa aattaagcag 1440ctttgaaagt
tatatgtaag tttggtatta atctttaaca gaattttcaa atatctgaag
1500atcatattat ctagatttgg ggaaaattat taatgtagag atgtttttta
tctactgaag 1560agtctcagaa tttaattaaa catatgctga tgcaaatatc
ctcaaacatg gttttaaaaa 1620aaagtaataa agtattttta tgaagaggtg
tggtataaat aaatttaaac aattatcaca 1680tattgttgta ttgttcagtc
gctaagtctg aactctgcaa ctctttgcaa ccccatggac 1740tgcagcatgc
cagacttccc tgtccttcac tatctcctgg actcttccca tacaattatc
1800acatagctaa ttgtgtattt taaataatgg acatttaaat agattgagaa
tgagaaggat 1860agtgcatttt tgcataatat actgtatgtg gatagtattt
ggctagaata aaaattggaa 1920ttgaggttaa aattaagcag gtttaagctc
aaaaccctat ttatttaaaa aaaaataaaa 1980gtaaataaat aatgtatcta
gtaaattagc ttgtcattta tatgacttcc ccaaatcagc 2040aaaacaaaag
aatttaaacc ttggaggtaa aaaaattcat aattagtaac aatgtcctaa
2100atggctattg ttattgtttt aaatagcaat agcattgatt ctataatttc
tccatcaaat 2160tgtaaccgta tatatctaat tgtctaggta aagaattaga
aatgattata atgagaggga 2220aatggcaacc cactccagtg tttttgcctg
gagaatccca gggacggggg agcctggtgg 2280gctgctgtct atggggtcac
acagagttgg acacgactga agcgacttag caacagcagc 2340agcataatga
gaggagcagt tggatattca atgcgtttca tgtttcttta attttggaat
2400gcatagaaat tattataaca caaaattatt tcagttctat gtgtcagttg
taaaatgaaa 2460atttatacag atactttaaa atattaaaaa tgagttatag
ttagagaaaa tgttttactt 2520tatgtcttta attgatagac tacatatttt
caaaaaggac tataaatctc ttctaatatc 2580tcatattatt caagaagata
caattatatt tttgaaaatc caccactcta ttcaggacat 2640aatgggaaaa
agtataaaat aagatataaa agaaaacatt gattagtgat tttattgtta
2700gtagttcatt gtgattcatg ttgaaagctt gatagaagtt aagtaattca
aatttaattt 2760caaaatacac cttaattcaa tgatacttgt agctatttat
aaatgaagtt aagttatatg 2820ctggactcaa cctttataaa cctctagtta
ctcagtgatc aatgaattta ttttttgacc 2880agcttcatca ttagaattgt
tcaattaatt gtgtgcatgc agaaaatcta caagctcatg 2940gtttcaatac
cagcctaaat acattgcaca ttgtcacaga gtttttgtaa gcctctgaat
3000ttaatggagt tttatgatca tacccaataa aaggctagtg gctctgccac
ttcctctttg 3060atggaagaaa tttgttaggt gaatgagcag aagtaaaagt
aaagacccat gaagagttga 3120tttctgtatt cattgctcca gcaaaagaca
attttatggt accatgttat acgagaattt 3180taagagacta ttctctggtc
agttctttgc aaagtctaca ttgggtgaaa cctgcaagaa 3240aactgcagct
tccagttgtg tgcgtgtgct cagtcactca gtcatgtctg acacttggca
3300acctcatgga ctgtagccca ccaaggttaa aactggtcag tcacgccaac
ccagaacact 3360ggatataatt aatgaaggct ctagtccact gtgatgattc
atgaactcgt tacttgggaa 3420aaatgtcaac ccctagtttt agcatactca
tcagagaact gcccccaaat gagaacaaat 3480tattggcata taactttaag
aatagcataa atgtgtacat ttgaaatgaa acgaatgtgt 3540cttgaatcct
catacatttt cttaccagtc ccgtctattt tgtctttgat ccaaactcct
3600aaatgtttgt gcacatgttt tgtggtgaca atgctgggaa acacagcaac
aggacttcat 3660tattctgttc cttcctgtca ttatggaaac cagtcatcga
cctatggcgt gatggcaggt 3720aagaaaaatt gtctttacat gtaagattga
gtttggggac gcttggatgc attttctggg 3780tcgaagggaa tcttgaccag
agtgtatcat gaaattcaga tctcctaacc ttagaaattg 3840ctgctaaatc
caccacttac tataatggtc cctgatctgt aacgccttca gagatcataa
3900tagttatacc tgatcactgc tgttctccac atgcctgaaa tgaactgcta
tgcttcttaa 3960cgcctgtgtt tgctttgtat gatttttatt ctaattctct
gttgccaaac tgctaattgt 4020cacttgctta tgccattggt gggcttgcct
ccagtaataa taaggtagct gctagcctta 4080tgtaactatt taaatttaaa
agtaaattaa ctaaaataag gtcagattta aaattcctca 4140gttgccaaca
gtgagcaagt cagcaaaagc tttaaatgac ttcattgccc gcctccatac
4200caacagggtt aatgattatg aggtacggaa cttaatagtc atcatttccc
ttgagatttt 4260ggctgttcct tcagttcctg aatttaaaat aaaacaggaa
agtgcttaat aatcttttgt 4320ggctaccaaa gcagatagac taacttatag
agcatattcc tcatcacagt atttcttttg 4380gccatttggt ctgtaaagat
aaataagaca ttgaaggcta agagagattt gcagcaactt 4440tagccatagt
tgaatccttg gcagccctgt ctgagatgct ctgagtcttg gataagattg
4500aaatagtata agttacatac ttatttccct ctggataaag aaagcatcac
tatatcaaga 4560taaactatct tgtttgctga cacttaaatg aaagtattgt
tagcaacttt cttaagggaa 4620agaaaatctg acgtaagaga tccactcatc
acaaaattta tgacttaatt ttagaccatg 4680gctatacagt aatttttttg
tgcacagaaa ttatttagaa atctcaatct tttatattta 4740tttctgcagc
aagaaataat ttcagtgaca ataaactact aatgttctat gtgaaaaata
4800taaacgtgtg tgtgtgcatg ctcgtgtaat agttgttatc caagtaggta
attaaaaaat 4860caaacataga tttatgccta taaatttgaa attaaattga
acaaagaatt tagttcacca 4920acctttaatt tctaaaaatt tctcaaattt
acactaaata aaacattaaa actttaaaat 4980aatatattct agaacaaatt
agcttttcct acattctgtt agagagcatt ctgaataaac 5040ttatatcctc
acctttatga tgaagtgaaa actgatgttc ttaatggtta cctttaaatc
5100ttaatgtctc tcttcaataa ttaaaaaata aggaaagtca tatttttctt
cctctgtgaa 5160aacggaccgt ttatgattcg tgtacttagc tgttaatcag
tatccatggt taatgagagg 5220atctctcgtt gaagatgaac tactttcatt
atagaaatag tagaacaatg tgcatttagc 5280cactagcggt gccgctcaaa
tgctttctgt ggcctccacc acacttggat tacagagaca 5340agaaatgatg
agtttataga catgtgctac tctttcttgg aggagagagt ccttgctgtt
5400ccttcacagt agttcccagg aacccacatg caacttaagt catctctgca
cccagcaagg 5460ggcagcaatg agtggaggtt agtgctcaga ccaaacactg
tgagatgatt tttactacta 5520cctccctccc accagatcta ggtagaagct
gctgagttca cagctggcct gagaaacctg 5580acttccttcc tgtttccagg
gttgcaggta acaagcccag gttcacactg agagtccaca 5640ggcaactcag
gttgtgctgg tccaagtttc ctcagcaggc cctcagcaaa ctttcatctc
5700cattagaagt taaaaaggag aggtctttgg aaaaaccttt taaaatgatt
caaagcccag 5760gttggtgata ataatgaaaa aaatggatgt cctaagcttt
ggaggtattg ctgtagtctt 5820aaaccaaaat tacatatatt ttgtcgctga
aagaaaaatt caccatgtca agcatagaga 5880ttatatttga atatttttga
gagggagatc attaaaatgt gatgtgcttt gtaatttgtt 5940acaatgtcac
tattttgaca tatattcagt attagccttt gcatcacggc agatttaatc
6000tcagagaatc tgaacctttc tgctgtcatc cccagagaag ctacacaaat
tgagtcataa 6060aacacaggga ttcagaatat tcaggaattc acaaaaggtt
taaaatacac aagagaaacc 6120tgataatgtc atttgaattt tctgagaagt
ctcaggcgtt catcaaatca gccacttcca 6180cacaatccac agaagcgtct
aatcaccaac aacgaaggtt cattgtcaca tactccatat 6240aaaagtgaag
ctgcacaaag agcaatattt caaagggtgt gaaattgctt tatttgaata
6300tggttatttt atccctatac tctgatgctt atatgtagtc tgagcatttc
attaaattaa 6360taactcactg gaaagcaaga gctacagctc atattttaag
ctaaggttgg taggaaggat 6420tctaatcatc agatgaatcc tctgtacctc
atagtccagg tgtggggata tcaaagagaa 6480tgattggtgg ggtgaaatga
attagccaca ccaggaacta attacaaacc tcgttcaagt 6540tagcatctca
aagtgttagt ctcttcacat ccaagttgtg atgggtacca tacatagctc
6600tatctgagtt gagttgtggc agctttctac caacttagcc tggttttctc
cttgatcttc 6660tcttcagata cattcatagt taaatttctt cttctgtttc
ttctctccta agtacttaaa 6720taattcaaca gcctgcagga tggataatag
gaaacaggga attacaaata ctattcaaaa 6780atctcttcta gataaacacg
aaagaaaact aataacaaaa acctttcaaa attctgattt 6840ctgggtatac
aaggtggtgt ctgttctcat ttgtaaagct gggtgaaagt tggaaaacaa
6900acttaatgag ctgtgtacct tgcccgccgt cctgtgtgaa ctgggctaat
cagctacatg 6960gtaatgattg ctaaacccag caaggttatg tgttttaatg
gccacccaag gtgtgcagta 7020agagtccttg attaaaaatt gatcttaaga
ggaaagcaaa atagctgatg ttggaaaatt 7080attcaaggag atgaatgctc
tttttaaatg agatgtgaat aataagaata aaagatgaat 7140atagctaaaa
agtgtctttt ccacctgggc taggacaaga ggtaccagaa atatgtttca
7200catttacata ggcaaacagt ctactttgga ggccatctct tcattcttaa
attgtctttt 7260ttctatttcc tttttttctt ttttgtttta tttagtttta
tttttgcctc acttattctg 7320gatgtgttga cactaaggga aggagtaatt
ctgaccatct tttgcctctg gatcatgaaa 7380ggcgcctgca gtagcatgga
cactgtgtat tattccttaa attatgtagc atctgtctca 7440acttcacaac
tcaaaagcag ctacaggcaa tctgtaaaca aatggccatg gctgtgctcc
7500aaatcaacct aatttacaga actaggcaga agacctgttt atatgtggat
aggatgtagc 7560aatgcacaaa agagaaaaaa aatcacaatt caaatttatg
atttgtttca cattgtcatg 7620catgaacgta aaaaaagaaa ataaatggaa
atatttaaat gaactgtgct gtgcatctct 7680acagcaaggt gggggtattt
tactatatcc ttcttcccct gtttgttctt ttaaagcttc 7740tagctcacaa
cctcagagat gttgtcagtt agcagctgtc tgagccacgt gctgcagaaa
7800agcagtgtgc cctgtatcat gggaccttga atcaggtgcc cgtaaggcat
gctggacctc 7860agcttcccat cttctgcttt taaagattta atctctgttc
ctctccctcc tctgccgtcc 7920agaagtccat gcagagcagt tcagagaggc
tatggtggat taatctgcag ggtgaaaatc 7980catcttggac tgtaaagaat
gtacaaacct ttccaagcta tttaggtgtg cacttgttct 8040aggcttatag
acaagtttgg tttatcagtg ttttggaaaa tattcatgaa acttctgtgg
8100cacacaactt cctgcatctt ttctctccgt gctcaaaccc cgacttctta
atattccagg 8160ctttagaaaa accttttaaa ataccttgtc acatatacca
taccaatcaa tccccatttt 8220ctcccaaata caggatcata taatagaaat
cagtttgtct gaccatgctt gtgactgtcc 8280caaatttctg tttaacatta
gtttcaggaa aactgtgtcc ctgtggataa ttgtggatac 8340tttcagttaa
tgaaaaataa cgcagcacac atcgtgtttt ccttcctcct ctagatgcca
8400aacttttgaa catggtattt cttgtgcact ctttatgaac tcatgttcaa
atttattttc 8460taaatgtcca tttctccaga gtatttataa agtatacact
agctttaaat ttttccataa 8520atagagatgg cacacttcca atatttttgt
aaatatttat aaaacttttg tttgaaagca 8580tttgtttaat gtgaccaaat
atatttaaga tgcagaatct ttgagtcatc tgatttccct 8640gagtacagat
tacctgaaaa atgaactgat tattgatgtg gcctattgag gtattcacag
8700ggcttcactt ctagtttcaa ttgtatagtg aattcatctt agcactcaag
gaacgttatt 8760tgtttttata tgaattttaa attgtggata aaaaaataca
cacttttttc tctgaaaata 8820aaacaaaagt ccttagataa atattaagta
aatgttaaca taaaggtgat aaattttttt 8880atatattagt attttactta
actagtagaa atctaaaact aacattaggc caaaaatgag 8940ctttgttaaa
atgtaacaaa cattaaaaaa attgaatttt gtaataaatt aaaaattgat
9000aaaattgctt tttaaaattg tatctggtct attcaatgta gcacccacta
aagcaaaaag 9060tggatgatta acaataacaa caaaaaactg gatagttttg
atttttgaaa gtaatatgaa 9120ttgctttaga cagaaatagt ttcttttgta
tgttttttat atccatgaaa cagctatact 9180tattttatga tattttgctt
aatttctcac ttgtatgtat tttgtttcag aaacataata 9240gtctactgga
taggggtaca cttcaaaatt atattttctc atataaataa tatgagccaa
9300caacttactg acttgcaata ttctttgctc attacatatt gatatattaa
tttaagattt 9360atatattctg gcaaaataca ctattactca tgtctgattt
ctgactgtat ttatagagaa 9420attataaata gcataaaact gatgtatttt
ttagtaagtt tctaagaatg attactgcct 9480attttctata gtcatttata
tttaatttat actcataaga aaaatgatta attattgaat 9540attttattta
tatcaaaatg tcttggttat acccatgtca tttaatataa agtgaaatcc
9600ttatgaataa aaatgtaata tactgctgaa gaaaacagaa ataaaatgtg
tgggaatttg 9660gcttatacca tcctgtcacc aatactccct gactgagatt
ctctcttctt tccaaatgaa 9720gaatgaaatc tagaagcaat taaacaatta
aatcatgtag ttttttgaga tttctcattt 9780aactaactca atggattcag
tgcttcatca tttatgaggg attatgtatt gtatctcaga 9840gaaggaaatg
gcaactccag tattcttgcc tggagaatcc cagggacaga ggagcctgtt
9900gggctgctgt ccatggggtc gcacagagtc ggacacgact gaagcgactt
agcagcagca 9960gcagcagcat gtatcatatc tagaattgca cccttccttg
acacttaact ttttcttctt 10020aaatagtaat caagaaatga ttccatcata
gtatattttg caagaatctt gttgctgacc 10080ttctaataga tctttaaaag
ttactttttg tcgacatcca tcattaccat taaatctatt 10140taaaccttat
taatgtattt tttgttctca taattttcgt tttacttgcc tttactaaat
10200taagcattta ctgataaaac attggatttc ttaatgctgt aaaatcaatt
tttcaatgct 10260atgaaaattt cccagaatag cacttaacat acaccttgat
tataattaag aaaatataca 10320ttctggtaga gttgaacctc agattcacaa
taacaaatga aaagattttt gtttgttttt 10380ggggagccat gctgaattcc
ataaccagga atcaaaccca tgccctctat actggaagga 10440tgaagtctta
accactggac tgctatggaa gtcttttaag agaaaaacaa tgatggaaaa
10500ctcacacttt tttgaaattt gcttatttct atttaaatta tttgcaagtc
cctggttctt 10560tcctttggct ttgcattatc tttgtttcca ctgctcccag
gaaggtggaa aaaaaagatc 10620ctatttatac taagctacac tgacttctac
ttcagaaaag caaatgtcag gtaacctttt 10680agaactgaga ctggctgtca
cagaacaatc tgatgggcca aaattttcca tgtatcaaaa 10740tgagggataa
ttacaaatgg tccttttctt gttgttacag ggagcttaac cccttgtctt
10800tataagtttc ctgaccacac gttgagtcat ggttttcctc ccatgcatca
gcctctcctt 10860tcagaggacc ccactgccgc tgatttcaag caggagctca
ggcggaaaag caaattggtt 10920gaagagccaa tagacatgga ttctccagaa
atccgagaac ttgaaaagtt tgccaatgag 10980tttaaagtga gaagaattaa
gctaggtagg tgcttgttaa cagctgtggg acacacaact 11040ccgtctgcaa
agtcttactc tattactgtt taatctctta catgctgctc agaagtctaa
11100gacagttctc attctacatc tctactgtgg atgtaagttg aattatgaaa
acctatagca 11160accttcattt ccttgtaaat tcttagcagc aaaaatatat
agatttctaa attaatggtc 11220tccttttcaa acataagttt agaaatacct
ttgttttatt tgaattaata cctttgtgtg 11280attcaaaagc taaaaagctg
tgagaattgt atccctctgc ttatccttcc tgtttatcag 11340tgttattagt
ttctgtgaat ccttctattc tatgcatatt catataagca aattcatgta
11400tttcttcata tagacatttt tcatttgact attttggaga gctttcagta
ttagtttttt 11460agagagctct tctttttaat gcatctctca attccatttt
atgaatatat taccagtctc 11520ctactgatgg aatttagatg gtcttcaatc
ttatgttact gaagacaatg atgcaatgat 11580taacttcata aatagcattt
tgcaccgata aaaatatatg tgcagggaaa gtgttaaaag 11640caaaattgtt
tgattgaaga gcatgtgtat ttgtaatttc agtagatgtc aaattggtct
11700ctatgtaaat tctaacaaat cttattgcca ccatgagtat ctcctttgcc
actcttcaga 11760atatgaattc tgttaaggca gaagtttttt gttttttgtt
tatttccttt gctttctcct 11820taatggcata tcctcagcac ttggaacagt
gactggcatg tagaataaaa aatagttatt 11880gaagggaaaa gatgctatta
atcttttgga cctttgcaaa tcagttaggt gaaagtagca 11940gtttcatttt
aaatttccct tatgagtgaa gagtgaaaga agtttttcat gtgttggaca
12000gtcatttgta attccttttc tgtgagcgat ctgttcatag cctttgctca
ctttctaggg 12060tgaagtgttt ttaatgtaaa taatcataat aattaacctt
gatttaaatg catgaaatat 12120atttttaatg gattgaactg atagtacaaa
cttctgcatt tgtggactga gccattggta 12180acttttaatg atatcaattg
atgggcatca tatgtaatca ttttatgcat acaggtatat 12240agccttgggc
cctgaattaa tatgtagtta ctgtttgtca taaacacagc agtaggcatc
12300tttatgacat tcattttcaa tttacttttt atatgactgt gaatgtttca
aattctacat 12360tgatgacatt tgtcaactta tattctgaga atgtttgaga
caatctatga aaactttttg 12420cctggagata gaagcattac caaatgatat
aataaatgct tggtgatata cataaaatgt 12480tgtgtgacca aagtctcata
ataagcatgc ttttagggaa agtaaacaca gttcttagtt 12540ttatttgtta
acttcaacat gttgaatttt tcactcttac agctgagata aaaatatttg
12600tgatatatca ccatatagtt tacatattat attttaatat ctatagattt
tgagcatatt 12660tcaacagatg cctaataata atgattagag agaattttta
aatgtcttct aaagtgtgta 12720ttaaggattc cctggtagaa cagctggtaa
agaatccacc tgcaatgcag gacaccccag 12780ttcaattcct gggtcaggaa
gatcagttgg agaagggata ggctacccat tccagtattc 12840ttcggcttcc
cagtggctca gctgttaaag aatctgcctg ctatgaggga gatctggatt
12900cagtccctgg gttgggaaga tcccctggag atgggaacag ctacccactc
cagtattctg 12960gcctggagaa ttccatgtac tgtatagtcc atggggttgc
aaagaatagt ctgactacac 13020ttatattagg ttataaaaat gattcatgta
taattactac agtatatagc acagtggcaa 13080aaaaataaat ctggatacat
taaaaagaat catttcacta ctttatacct atgctacatt 13140gtctagaaac
ttttcttata tatttttgca aagtgtgttt aacacattta tccagtttgg
13200ctaaatatga atggcagatg ttcctatctg aattcttttg gcttctaaaa
tattaactta 13260ttaactagaa ggaatttttt aaaatactag acaattctac
actgcataac cttactgtta 13320ttctaaattg ctaacaaatt tatcgttaaa
agcaatattt aatagttgac aaaaatacta 13380cacaaattta tacaatagtg
gacccaaatc agtgtttctt gcaaaactga agctcatggc 13440ctttgttatt
ctttcacagg atacacccag acaaatgttg gggaagctct ggcagctgtg
13500catggctctg aattcagtca aacaactatc tgccgatttg aaaacctgca
gctcagcttc 13560aaaaatgcat gcaaactaaa agcaatatta tccaaatggc
tggaggaagc cgagcaagta 13620ggaggtacaa aagctgtgtt tctggaaaca
gtgatgtttt aacctaaaaa caatggtttc 13680cctcagttga atttgtacta
aagcaagagg tttgaagttt ggtttgattt ttctctttga 13740catgaaaaat
aagtatcttg tttcatcaca ctatgaagaa aagcaaggcc agtgaaagtg
13800tagaaataaa tttattgaga aggtaaataa tgagagaata aaatatatag
ggaaagtttc 13860tacacaatgt ggcataggtg tgaagtggtg aaatgattct
ttttaatgta tccagatttt 13920ttcctgctgt gctatatact gtagtaatta
ttcatgaatc atttttacaa cctaatataa 13980gtgtagccag agcattcgca
cacaccgttc tttctagtga atagcaagca attgctagat 14040aaacaattta
atgtgataaa aattatctac ttatattaat gtcaaggctg gctaaagagc
14100aagatttgat agcatttaga gcaactgttt caacaaagat agggtatgat
ttaaagacaa 14160ctgttaatat ttataaagtt aatatttttt tctgtgttaa
cattttaatc tagggcttgt 14220aatctaaaat gatgtatact gcaaatattt
aaaacaaaaa tgtatggtaa ttctattttg 14280tattgtttta taaagaaact
ttaaatccaa atctgatagt taaaaaaaaa acctggtttg 14340tttttgtaat
tattcattgt tttcgcatca cagctttata caatgagaaa gttggtgcaa
14400atgaaagaaa aaggaaacgg agaacaacaa tcaggtatac ttttgagata
ttaagagtta 14460gtggagaaga aaatgatatt ttacaaatgg aatgaacatt
tgagtataat atagtttcaa 14520tataacataa aaatgaatag agccaattga
gaaaataggt gaaaaagcac aacattcaat 14580aaattacttc tgagaaacag
ctggaaattt aaaatttgat ggaaaaatat gtattgtttg 14640attcaagaac
agttttgctc tgcaagtttt ggataaaaca gaagctgtac aatcacagct
14700aaaaagaatg actgtttcta ctgtgtcata atgtgttgat ttatgtttag
acataaatct 14760tgctccggga aagaccccat ggactgtagc ctacaggttc
ctctgtccat gggattttcc 14820aggcaagaat aatggagtgg gttgccattt
ccttctccag gagatcttcc cgacccaggg 14880attgaacccg gatctcctac
attgtaggca gatgctttac catctgagcc acaagggaag 14940tcatctatct
atattatttc aaattaacaa aactggtcac tagtatttta gttgcttaaa
15000gttcaaaatg acttctagca tttcaagcca gattgttcat
ttatcttttt gtagtttccg 15060tgaggctcat ggaggaattg ctaatataca
ggttttgttt tggttggtta gttgtacact 15120aaacatttca ataacctgag
ttctggggga catttagaaa tgcatacaga attattttct 15180tctcagtaag
tcagtgccct cttgtggcag aaagtggata aacaatgtcg gggttccctc
15240cttaatttct tcctgtgact ctggtaaaag gagcctacat gagacaagca
tctaaatgtt 15300caaaaaaact tcacatttat tattgttgaa aagctttgaa
ggtgttttca gtgtctttag 15360gtttcctttt tacgttaatg ttagtactaa
tatttaggaa atgtaaccta acttgatttt 15420gatgggccta aaccatcatc
tcccttcttt cctgccaact cctcacctcc cagtattgct 15480gctaaagacg
ccctggagag acactttgga gaacagaata agccttcctc tcaggagatc
15540ctgcggatgg ctgaagaact aaacctggag aaagaagtgg tgagggtttg
gttttgtaac 15600cgaaggcaga gagaaaaacg ggtgaagaca agcctgaatc
agagtttatt tactatttct 15660aaggagcatc tcgaatgcag ataggctctc
ctattgtgta atagcgagtg tttctacttt 15720tcattccttt ctcttctcca
gccaaaatag aaattagtta tttggttagc ttcaaaaaat 15780cacatcagta
atttttgcag aagtgtttct tttctacttt aaaaataaat acaatttaaa
15840ttatgttgat gaattattct cagaaggcac attgtacatt ttaagccaaa
gactaatagg 15900attcaaacaa tgattctgtc cctttcacta tatctttccc
tctatctctc cc 15952239DNAArtificial SequencePCR Primer 1
2caaatggtcc ttttcttgtt gttacaggga gcttaaggc 39325DNAArtificial
SequencePCR Primer 2 3ctttaaactc attggcaaac ttttc 25472PRTMus
musculus 4Ser Ala Ala Glu Cys Leu Pro Ala Ser Asn His Ala Thr Asn
Val Met 1 5 10 15 Ser Thr Ala Thr Gly Leu His Tyr Ser Val Pro Ser
Cys His Tyr Gly 20 25 30 Asn Gln Pro Ser Thr Tyr Gly Val Met Ala
Gly Ser Leu Thr Pro Cys 35 40 45 Leu Tyr Lys Phe Pro Asp His Thr
Leu Ser His Gly Phe Pro Pro Leu 50 55 60 His Gln Pro Leu Leu Ala
Glu Asp 65 70 572PRTRattus rattus 5Asn Ala Ala Glu Gly Leu Pro Ala
Ser Asn His Ala Thr Asn Val Met 1 5 10 15 Ser Thr Ala Thr Gly Leu
His Tyr Ser Val Pro Ser Cys His Tyr Gly 20 25 30 Asn Gln Pro Ser
Thr Tyr Gly Val Met Ala Gly Thr Leu Thr Pro Cys 35 40 45 Leu Tyr
Lys Phe Pro Asp His Thr Leu Ser His Gly Phe Pro Pro Leu 50 55 60
His Gln Pro Leu Leu Ala Glu Asp 65 70 672PRTHomo sapiens 6Ser Ala
Ala Glu Cys Leu Pro Val Ser Asn His Ala Thr Asn Val Met 1 5 10 15
Ser Thr Ala Thr Gly Leu His Tyr Ser Val Pro Ser Cys His Tyr Gly 20
25 30 Asn Gln Pro Ser Thr Tyr Gly Val Met Ala Gly Ser Leu Thr Pro
Cys 35 40 45 Leu Tyr Lys Phe Pro Asp His Thr Leu Ser His Gly Phe
Pro Pro Leu 50 55 60 His Gln Pro Leu Leu Ala Glu Asp 65 70
772PRTChimpanzee 7Ser Ala Ala Glu Cys Leu Pro Val Ser Asn His Ala
Thr Asn Val Met 1 5 10 15 Ser Thr Ala Thr Gly Leu His Tyr Ser Val
Pro Ser Cys His Tyr Gly 20 25 30 Asn Gln Pro Ser Thr Tyr Gly Val
Met Ala Gly Ser Leu Thr Pro Cys 35 40 45 Leu Tyr Lys Phe Pro Asp
His Thr Leu Ser His Gly Phe Pro Pro Leu 50 55 60 His Gln Pro Leu
Leu Ala Glu Asp 65 70 872PRTbos taurus 8Ser Ala Ala Glu Cys Leu Pro
Val Ser Asn His Ala Thr Asn Val Met 1 5 10 15 Ser Thr Ala Thr Gly
Leu His Tyr Ser Val Pro Phe Cys His Tyr Gly 20 25 30 Asn Gln Ser
Ser Thr Tyr Gly Val Met Ala Gly Ser Leu Thr Pro Cys 35 40 45 Leu
Tyr Lys Phe Pro Asp His Thr Leu Ser His Gly Phe Pro Pro Met 50 55
60 His Gln Pro Leu Leu Ser Glu Asp 65 70 972PRTCanis familiaris
9Gly Ala Ala Glu Cys Leu Pro Gly Ser Asn His Ala Thr Asn Val Val 1
5 10 15 Ser Thr Ala Thr Gly Leu His Tyr Ser Val Pro Ser Cys His Tyr
Gly 20 25 30 Asn Gln Pro Ser Thr Tyr Gly Val Met Ala Gly Gly Leu
Thr Pro Cys 35 40 45 Leu Tyr Lys Phe Pro Glu His Gly Leu Gly Pro
Gly Phe Pro Ala Ala 50 55 60 His Gln Pro Leu Leu Ala Glu Gly 65 70
1020DNAArtificial SequencePCR-RFLP primer 1 10atactcatca gagaactgcc
201120DNAArtificial SequencePCR-RFLP primer 2 11cattaaccct
gttggtatgg 20
* * * * *