U.S. patent application number 13/816381 was filed with the patent office on 2013-06-06 for atherosclerosis inhibition via modulation of monocyte-macrophage phenotype using apo a-i milano gene transfer.
This patent application is currently assigned to CEDARS-SINAI MEDICAL CENTER. The applicant listed for this patent is Prediman K. Shah, Behrooz Sharifi. Invention is credited to Prediman K. Shah, Behrooz Sharifi.
Application Number | 20130142760 13/816381 |
Document ID | / |
Family ID | 45605636 |
Filed Date | 2013-06-06 |
United States Patent
Application |
20130142760 |
Kind Code |
A1 |
Shah; Prediman K. ; et
al. |
June 6, 2013 |
ATHEROSCLEROSIS INHIBITION VIA MODULATION OF MONOCYTE-MACROPHAGE
PHENOTYPE USING APO A-I MILANO GENE TRANSFER
Abstract
A method of changing the phenotype of monocytes and macrophages
from a pro inflammatory MI phenotype to an anti-inflammatory M2
phenotype is disclosed. The method can comprises providing a
composition comprising a recombinant adeno-associated virus (rAAV)
vector comprising an exogenous gene encoding ApoA-1 Milano or a
fragment thereof, and administering the composition to mammal in
need thereof to change the phenotype of monocytes or macrophages
from a pro inflammatory M1 phenotype to an anti inflammatory M2
phenotype. By changing the phenotype of monocytes or macrophages
from a pro-inflammatory M1 phenotype to anti-inflammatory M2
phenotype, atherosclerosis can be treated. A method of monitoring
macrophage phenotypic switching and a method of assessing the
efficacy of the treatment of atherosclerosis are also
described.
Inventors: |
Shah; Prediman K.; (Los
Angeles, CA) ; Sharifi; Behrooz; (Woodland Hills,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Shah; Prediman K.
Sharifi; Behrooz |
Los Angeles
Woodland Hills |
CA
CA |
US
US |
|
|
Assignee: |
CEDARS-SINAI MEDICAL CENTER
Los Angeles
CA
|
Family ID: |
45605636 |
Appl. No.: |
13/816381 |
Filed: |
August 16, 2011 |
PCT Filed: |
August 16, 2011 |
PCT NO: |
PCT/US11/47940 |
371 Date: |
February 11, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61374900 |
Aug 18, 2010 |
|
|
|
61410806 |
Nov 5, 2010 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/6.12 |
Current CPC
Class: |
C12Q 1/686 20130101;
C12N 2799/025 20130101; A61K 48/00 20130101; A61K 48/005 20130101;
A61P 9/10 20180101; C07K 14/775 20130101; A61K 38/1709
20130101 |
Class at
Publication: |
424/93.2 ;
435/6.12 |
International
Class: |
A61K 38/17 20060101
A61K038/17; A61K 48/00 20060101 A61K048/00; C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method, comprising: providing a composition comprising a
recombinant adeno-associated virus (rAAV) vector comprising an
exogenous gene encoding ApoA-I Milano, or fragment thereof; and
administering the composition to a mammal in need of changing the
phenotype of a monocyte or macrophage from a proinflammatory M1
phenotype to an anti-inflammatory M2 phenotype to change the
phenotype of the monocyte or macrophage from the proinflammatory M1
phenotype to the anti-inflammatory M2 phenotype.
2. The method of claim 1, further comprising monitoring monocyte or
macrophage phenotypic switching in the mammal.
3. The method of claim 1, further comprising assessing the efficacy
of a treatment for atherosclerosis in the mammal.
4. The method of claim 1, wherein the rAAV vector is rAAV8 vector
comprising an exogenous gene encoding ApoA-I Milano or a fragment
thereof.
5. The method of claim 4, wherein the rAAV8 is produced by
co-transfecting a host cell with a first plasmid and a second
plasmid, wherein the first plasmid genome for the rAAV8 is derived
from AAV serotype 2 and the second plasmid is derived from AAV
serotypes 2 and 8 (Rep2Cap8).
6. The method of claim 1, wherein the rAAV vector is rAAV2 vector
comprising an exogenous gene encoding ApoA-I Milano or a fragment
thereof.
7. The method of claim 6, wherein the rAAV2 is produced by
co-transfecting a host cell with a first plasmid and a second
plasmid, wherein the first plasmid genome for the rAAV2 is derived
from AAV serotype 2 and the second plasmid is derived from AAV
serotype 2 (Rep2Cap2).
8. The method of claim 1, wherein the monocyte or macrophage is a
circulating monocyte or macrophage.
9. The method of claim 1, wherein the monocyte or macrophage is a
peritoneal monocyte or macrophage.
10. The method of claim 1, wherein changing the phenotype of the
monocyte or macrophage from the proinflammatory M1 phenotype to the
anti-inflammatory M2 phenotype inhibits or treats
atherosclerosis.
11. The method of claim 1, wherein changing the phenotype of the
monocyte or macrophage from the proinflammatory M1 phenotype to the
anti-inflammatory M2 phenotype reduces atherosclerosis.
12. The method of claim 11, wherein the atherosclerosis is reduced
in a whole aorta, an aortic sinus, an inominate artery or
combinations thereof.
13. The method of claim 1, wherein changing the phenotype of the
monocyte or macrophage from the proinflammatory M1 phenotype to the
anti-inflammatory M2 phenotype reduces plaque lipid content in an
aortic sinus, an innominate artery, or both.
14. The method of claim 1, wherein changing the phenotype of the
monocyte or macrophage from the proinflammatory M1 phenotype to the
anti-inflammatory M2 phenotype reduces plaque macrophage content in
an aortic sinus, an innominate artery or both.
15. The method of claim 1, wherein the rAAV vector is produced by
providing a first plasmid comprising ApoA-I Milano or a fragment
thereof; providing a second plasmid complimentary to the first
plasmid and which comprises components for rescue and packaging;
co-transfecting the first plasmid and the second plasmid into a
host cell; and generating a quantity of the rAAV vector from the
co-transfected host cell.
16. The method of claim 15, wherein the pair of the first plasmid
and the second plasmid is selected such that the rAAV vector is
targeted for delivery to a specific tissue type.
17. The method of claim 15, wherein the second plasmid further
comprises AAV rescue and packaging components derived from an AAV
serotype selected from the group consisting of AAV1, AAV2, AAV5,
AAV7, AAV8, AAV9, AAV10 and combinations thereof.
18. A method, comprising: measuring the expression level of one or
more markers selected from the group consisting of MCP-1, IL-6,
TNF-a, Arg-1, Ym-1 and CD206 to monitor monocyte or macrophage
phenotypic switching in a mammal in need thereof; and determining
the presence of a phenotypic switch from a proinflammatory M1
macrophage to an anti-inflammatory M2 macrophage when MCP-1, IL-6
and/or TNF-.alpha. is down-regulated, and/or Arg-1, Ym-1 and/or
CD206 is up-regulated, or determining the absence of a phenotypic
switch from the proinflammatory M1 macrophage to the
anti-inflammatory M2 macrophage when MCP-1, IL-6 and/or TNF-a is
not down-regulated, and/or Arg-1, Ym-1 and/or CD206 is not
up-regulated, or determining the presence of a phenotypic switch
from an anti-inflammatory M2 macrophage to a proinflammatory M1
macrophage when MCP-1, IL-6 and/or TNF is up-regulated, and/or
Arg-1 and/or CD206 is down-regulated, or determining the presence
of a phenotypic switch from a proinflammatory M1 macrophage to an
anti-inflammatory M2 macrophage when MCP-1, IL-6 and/or TNF-a is
down-regulated, and/or when, Arg-1, Ym-1 and/or CD206 is not
up-regulated.
19. A method for assessing the efficacy of a treatment for
atherosclerosis in a mammalian subject in need thereof, comprising:
determining the phenotype of the macrophages in the mammalian
subject; and making a determination that a treatment is providing
beneficial results to a mammalian subject if a phenotypic switch
from proinflammatory M1 macrophage to anti-inflammatory M2
macrophage is detected, or making a determination that a treatment
is not providing beneficial results to the mammalian subject if a
phenotypic switch from anti-inflammatory M2 macrophage to
proinflammatory M1 macrophage is detected.
20. The method of claim 19, wherein the treatment for
atherosclerosis is treatment with ApoA-1 Milano.
Description
FIELD OF INVENTION
[0001] This invention relates to the treatment of vascular
diseases, including atherosclerosis; and to monitoring the
treatment of vascular diseases, including monitoring surface
markers on macrophages.
BACKGROUND
[0002] All publications herein are incorporated by reference to the
same extent as if each individual publication or patent application
was specifically and individually indicated to be incorporated by
reference. The following description includes information that may
be useful in understanding the present invention. It is not an
admission that any of the information provided herein is prior art
or relevant to the presently claimed invention, or that any
publication specifically or implicitly referenced is prior art.
[0003] Atherosclerosis is just one of several types of
arteriosclerosis, which is characterized by thickening and
hardening of artery walls (e.g., coronary arteries, carotid
arteries, aorta, and ileofemoral arteries). Over time, this
material thickens, hardens and may eventually block or severely
narrow the arteries. More than 61 million Americans suffer from
some form of cardiovascular disease, including high blood pressure,
coronary heart disease, stroke, congestive heart failure, and other
conditions. More than 2,600 Americans die every day because of
cardiovascular diseases. Thus, there is a need in the art for
additional strategies for the treatment of atherosclerosis and the
array of related diseases and physiological conditions, as well as
methods to assess the phenotypic switching of macrophages and
methods to monitor the efficacy of atherosclerosis treatment. While
the inventors have observed potent anti-atherogenic effects of Apo
A-I Milano gene transfer using retrovirally transduced bone marrow
in Apo E-/-Apo A-1-/-double knockout mice, further studies to
elucidate the mechanism of action are useful to provide additional
therapeutic options for patients.
SUMMARY OF THE INVENTION
[0004] The following embodiments and aspects thereof are described
and illustrated in conjunction with compositions and methods which
are meant to be exemplary and illustrative, not limiting in
scope.
[0005] Various embodiments of the present invention provide for a
method, comprising: providing a composition comprising a
recombinant adeno-associated virus (rAAV) vector comprising an
exogenous gene encoding ApoA-I Milano, or fragment thereof and
administering the composition to a mammal in need of changing the
phenotype of a monocyte or macrophage from a proinflammatory M1
phenotype to an anti-inflammatory M2 phenotype to change the
phenotype of the monocyte or macrophage from the proinflammatory M1
phenotype to the anti-inflammatory M2 phenotype.
[0006] In various embodiments, the method can further comprise
monitoring monocyte or macrophage phenotypic switching in the
mammal. In various embodiments, the method can further comprise
assessing the efficacy of a treatment for atherosclerosis in the
mammal.
[0007] In various embodiments, the rAAV vector can be a rAAV8
vector comprising an exogenous gene encoding ApoA-I Milano or a
fragment thereof. In certain embodiments, the rAAV8 can be produced
by co-transfecting a host cell with a first plasmid and a second
plasmid, wherein the first plasmid genome for the rAAV8 is derived
from AAV serotype 2 and the second plasmid is derived from AAV
serotypes 2 and 8 (Rep2Cap8).
[0008] In various embodiments, the rAAV vector can be a rAAV2
vector comprising an exogenous gene encoding ApoA-I Milano or a
fragment thereof. In certain embodiments, the rAAV2 can be produced
by co-transfecting a host cell with a first plasmid and a second
plasmid, wherein the first plasmid genome for the rAAV2 is derived
from AAV serotype 2 and the second plasmid is derived from AAV
serotype 2 (Rep2Cap2).
[0009] In various embodiments, the monocyte or macrophage can be a
circulating monocyte or macrophage. In various embodiments, the
monocyte or macrophage can be a peritoneal monocyte or
macrophage.
[0010] In various embodiments, changing the phenotype of the
monocyte or macrophage from the proinflammatory M1 phenotype to the
anti-inflammatory M2 phenotype can inhibit or treat
atherosclerosis. In various embodiments, changing the phenotype of
the monocyte or macrophage from the proinflammatory M1 phenotype to
the anti-inflammatory M2 phenotype can reduce atherosclerosis. In
certain embodiments, the atherosclerosis can be reduced in a whole
aorta, an aortic sinus, an inominate artery or combinations
thereof.
[0011] In various embodiments, changing the phenotype of the
monocyte or macrophage from the proinflammatory M1 phenotype to the
anti-inflammatory M2 phenotype can reduce plaque lipid content in
an aortic sinus, an innominate artery, or both. In various
embodiments, changing the phenotype of the monocyte or macrophage
from the proinflammatory M1 phenotype to the anti-inflammatory M2
phenotype can reduce plaque macrophage content in an aortic sinus,
an innominate artery or both.
[0012] In various embodiments, the rAAV vector can be produced by
providing a first plasmid comprising ApoA-I Milano or a fragment
thereof; providing a second plasmid complimentary to the first
plasmid and which comprises components for rescue and packaging;
co-transfecting the first plasmid and the second plasmid into a
host cell; and generating a quantity of the rAAV vector from the
co-transfected host cell. In various embodiments, the pair of the
first plasmid and the second plasmid can be selected such that the
rAAV vector is targeted for delivery to a specific tissue type. In
various embodiments, the second plasmid can further comprise AAV
rescue and packaging components derived from an AAV serotype
selected from the group consisting of AAV1, AAV2, AAV5, AAV7, AAV8,
AAV9, AAV10 and combinations thereof.
[0013] Embodiments of the present invention provide for a method,
comprising: measuring the expression level of one or more markers
selected from the group consisting of MCP-1, IL-6, TNF-.alpha.,
Arg-1, Ym-1, and CD206 to monitor monocyte or macrophage phenotypic
switching in a mammal in need thereof; and determining the presence
of a phenotypic switch from a proinflammatory M1 macrophage to an
anti-inflammatory M2 macrophage when MCP-1, IL-6 and/or TNF-.alpha.
is down-regulated, and/or Arg-1, Ym-1 and/or CD206 is up-regulated,
or determining the absence of a phenotypic switch from the
proinflammatory M1 macrophage to the anti-inflammatory M2
macrophage when MCP-1, IL-6 and/or TNF-a is not down-regulated,
and/or Arg-1, Ym-1 and/or CD206 is not up-regulated, or determining
the presence of a phenotypic switch from an anti-inflammatory M2
macrophage to a proinflammatory M1 macrophage when MCP-1, IL-6
and/or TNF is up-regulated, and/or Arg-1 and/or CD206 is
down-regulated, or determining the presence of a phenotypic switch
from a proinflammatory M1 macrophage to an anti-inflammatory M2
macrophage when MCP-1, IL-6 and/or TNF-a is down-regulated, and/or
when, Arg-1, Ym-1 and/or CD206 is not up-regulated.
[0014] Embodiments of the present invention provide for a method
for assessing the efficacy of a treatment for atherosclerosis in a
mammalian subject in need thereof, comprising: determining the
phenotype of the macrophages in the mammalian subject; and making a
determination that a treatment is providing beneficial results to a
mammalian subject if a phenotypic switch from proinflammatory M1
macrophage to anti-inflammatory M2 macrophage is detected, or
making a determination that a treatment is not providing beneficial
results to the mammalian subject if a phenotypic switch from
anti-inflammatory M2 macrophage to proinflammatory M1 macrophage is
detected. In various embodiments, the treatment for atherosclerosis
is treatment with ApoA-1 Milano.
[0015] Other features and advantages of the invention will become
apparent from the following detailed description, taken in
conjunction with the accompanying drawings, which illustrate, by
way of example, various features of embodiments of the
invention.
BRIEF DESCRIPTION OF THE FIGURES
[0016] FIG. 1 depicts expression of apo A1 Milano in the mice with
rAAV in accordance with various embodiments of the present
invention. Serum Levels of apo A1 Milano at 4, 12, 24 weeks after
injection virus and a group of mice with the empty vector is used
as a control. The data represent mean.+-.SD from 12 mice per group.
These data, analyzed by Student's unpaired t-test, show there was
statistically significant difference among AAV8 apo A1 Milano and
another three groups. P-Value rAAV8/Apo A1 Milano vs rAAV8 Control:
<0.001; rAAV2/Apo A1 Milano vs rAAV2 control:
<0.001:rAAV8/Apo A1 Milano vs rAAV2 Apo A1 Milano:
<0.001.
[0017] FIG. 2 depicts the comparison of serum levels of apo A1
Milano between mice with rAAV8 and rAAV2 at 4, 12, 24 weeks after
IV injection virus in accordance with various embodiments of the
present invention. The data represent mean.+-.SD from 12 mice per
group. These data show there was statistically significant
difference between rAAV8apo A1 Milano and rAAV2 apo A1 Milano.
P-Value: rAAV8 apo A1 Milano vs rAAV2 apo A1 Milano at 4, 12 and 20
weeks: P<0.001.
[0018] FIG. 3 depicts the expression of apo A1 Milano in the mice
with rAAV in accordance with various embodiments of the present
invention. Serum levels of apo A1 Milano at 4, 12, 24 weeks after
IM injection virus are shown. The data represent mean.+-.SD from 10
mice per group. These data show there was no statistically
significant difference between rAAV2 apo A1 Milano and rAAV2 vector
control.
[0019] FIG. 4 depicts serum levels of apo A1 Milano in mice from IM
and IV delivery with rAAV2 in accordance with various embodiments
of the present invention. These data show there was statistically
significant difference among AAV2apo A1 Milano IM and AAV2apo A1
Milano IV groups in 4 w, 12 w as well as 20 w (p<0.001).
[0020] FIG. 5 depicts real-time PCR Quantitative analysis of apoA1
Milano mRNA expression in mice tissues in accordance with various
embodiments of the present invention. Values were normalized
against GAPDH mRNA. Data showed a significantly higher level of apo
A1 Milano. rAAV8 mediated transgene expression compared to rAAV2 in
the brain (11.85.+-.2.4 vs 0.95.+-.0, p<0.05), heart
(102.3.+-.24.20 vs 0.9.+-.0.5, p<0.001), Liver (32.14.+-.14.56
vs 1.37.+-.0.22, p=0.05), lung (16.49.+-.10.75 vs 1.86.+-.1.8,
p=0.25), spleen (5.41.+-.1.59 vs 3.39.+-.1.69, p=0.22) and kidney
(1.96.+-.0.8 vs 0.81.+-.0.18, p=0.119).
[0021] FIG. 6A shows that the mean aortic lesion areas were reduced
by 42% in rAAV8 apo A1 Milano vector compared to control vector
(7.7.+-.0.6% vs. 13.5.+-.1.1%, p=0.0002) in accordance with various
embodiments of the present invention. However, the differences in
the mean lesional area between recipient of rAAV2 apo A1 Milano
vector and control vector was insignificant (p=0.1193) compared to
rAAV2 apo A1 Milano vector, rAAV8 apo A1 Milano vector reduced
lesion areas by 27% (p=0.006).
[0022] FIG. 6B depicts the extent of the atherosclerotic lesions in
the total aorta were quantified after Oil Red 0 staining in
accordance with various embodiments of the present invention.
[0023] FIG. 7 shows that in the intramuscular group, the
differences in the mean lesional area between recipient of rAAV2
apo A1 Milano vector and control vector was significant
(9.34.+-.1.01 vs 14.6.+-.2.2, N=7), reflecting a 36% reduction
(p=0.04) in accordance with various embodiments of the present
invention.
[0024] FIG. 8 depicts the average percent lesion areas in
accordance with various embodiments of the present invention in
innominate artery (A) and aortic sinus (B) in rAAV8 vector control,
rAAV8 apoA1 Milano and rAAV2 vector control; rAAV2 apo A1 Milano
are shown. Mice treated with rAAV8 apo A1 Milano had significantly
smaller lesion areas compared with vector control mice
(P<0.05).
[0025] FIG. 9 depicts the lipid content determined in innominate
artery and aortic sinus atheromatous plaque by Oil-Red 0 staining
in accordance with various embodiments of the present invention.
The lipid content was significantly lower in mice treated with
rAAV8 apo A1 Milano compared with vector control or rAAV2 apo A1
Milano.
[0026] FIG. 10 depicts quantitative data of macrophage
immunoreactivity in the innominate artery lesions (A) and aotic
sinus lesions (B) in accordance with various embodiments of the
present invention. The macrophage immunoreactive area was
significantly lower in mice treated with rAAV8 apo A1 Milano
compared with vector control or rAAV2 apo A1 Milano. (C) To assess
macrophage infiltration into atherosclerotic plaques,
immunostaining is used.
[0027] FIG. 11 shows that M1 and M2 macrophage marker are expressed
in monocyte in mice treated with rAAV2 by IM (n=4) in accordance
with various embodiments of the present invention. mRNA levels were
measured by real-time PCR. Numbers indicate the average of the
group and P value (unpaired Student's t test).
[0028] FIG. 12 shows that M1 and M2 macrophage marker are expressed
in peritoneal macrophage in mice treated with rAAV2 by IM (n=4) in
accordance with various embodiments of the present invention. mRNA
levels were measured by real-time PCR. Numbers indicate the average
of the group and P value. (unpaired Student's t test).
[0029] FIG. 13 shows that M1 and M2 macrophage marker are expressed
in liver in mice treated with rAAV2 by IM (n=4) in accordance with
various embodiments of the present invention. mRNA levels were
measured by real-time PCR. Numbers indicate the average of the
group and p value (unpaired Student's t test).
[0030] FIG. 14 shows that M1 and M2 macrophage marker are expressed
in liver in mice treated with rAAV8 by IV (n=4) in accordance with
various embodiments of the present invention. mRNA levels were
measured by real-time PCR. Numbers indicate the average of the
group and P value (unpaired Student's t test).
[0031] FIG. 15 shows that M1 and M2 Macrophage number are expressed
in monocytes in mice treated with rAAV8 (n=4), mRNA levels were
measured by Real-time PCR. Numbers indicate the average of the
group and p value (unpaired Student's t test).
DESCRIPTION OF THE INVENTION
[0032] All references cited herein are incorporated by reference in
their entirety as though fully set forth. Unless defined otherwise,
technical and scientific terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art to which
this invention belongs. Singleton et al., Dictionary of
Microbiology and Molecular Biology 3.sup.rd ed., J. Wiley &
Sons (New York, N.Y. 2001); March, Advanced Organic Chemistry
Reactions, Mechanisms and Structure 5.sup.th ed., J. Wiley &
Sons (New York, N.Y. 2001); and Sambrook and Russel, Molecular
Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory
Press (Cold Spring Harbor, N.Y. 2001), provide one skilled in the
art with a general guide to many of the terms used in the present
application.
[0033] One skilled in the art will recognize many methods and
materials similar or equivalent to those described herein, which
could be used in the practice of the present invention. Indeed, the
present invention is in no way limited to the methods and materials
described. For purposes of the present invention, the following
terms are defined below.
[0034] "Beneficial results" may include, but are in no way limited
to, lessening or alleviating the severity of the disease condition,
preventing the disease condition from worsening, reducing the
likelihood of the disease condition worsening, curing the disease
condition and prolonging a patient's life or life expectancy.
[0035] "Gene transfer" or "gene delivery" refers to methods or
systems for reliably inserting foreign DNA into host cells. Such
methods can result in transient expression of non-integrated
transferred DNA, extrachromosomal replication and expression of
transferred replicons (e.g., episomes), or integration of
transferred genetic material into the genomic DNA of host cells.
Gene transfer provides a unique approach for the treatment of
acquired and inherited diseases. A number of systems have been
developed for gene transfer into mammalian cells. See, e.g., U.S.
Pat. No. 5,399,346.
[0036] "Vector" refers to any genetic element, such as a plasmid,
phage, transposon, cosmid, chromosome, virus, virion, etc., which
is capable of replication when associated with the proper control
elements and which can transfer gene sequences between cells. Thus,
the term includes cloning and expression vehicles, as well as viral
vectors.
[0037] "AAV vector" refers to any vector derived from any
adeno-associated virus serotype, including, without limitation,
AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, AAV-8, AAV-9, and AAV-10
and the like. AAV vectors can have one or more of the AAV wild-type
genes deleted in whole or in part, preferably the Rep and/or Cap
genes, but retain functional flanking ITR sequences. Functional ITR
sequences are generally necessary for the rescue, replication,
packaging and potential chromosomal integration of the AAV genome.
Thus, an AAV vector is defined herein to include at least those
sequences required in cis for replication and packaging (e.g.,
functional ITRs) of the virus. The ITRs need not be the wild-type
nucleotide sequences, and may be altered (e.g., by the insertion,
deletion or substitution of nucleotides) so long as the sequences
provide for functional rescue, replication and packaging.
[0038] "Recombinant virus" refers to a virus that has been
genetically altered (e.g., by the addition or insertion of a
heterologous nucleic acid construct into the particle).
[0039] "AAV virion" refers to a complete virus particle, such as a
wild-type ("wt") AAV virus particle (i.e., including a linear,
single-stranded AAV nucleic acid genome associated with an AAV
capsid protein coat). In this regard, single-stranded AAV nucleic
acid molecules of either complementary sense (i.e., "sense" or
"antisense" strands) can be packaged into any one AAV virion; both
strands are equally infectious. In addition, the AAV capsid protein
coat can be from any of the various AAV serotypes depending on the
target of the AAV virion.
[0040] A "recombinant AAV virion" or "rAAV virion" is defined
herein as an infectious, replication-defective virus composed of an
AAV protein shell, encapsidating a heterologous DNA molecule of
interest (e.g., genes encoding ApoA-I Milano) which is flanked on
both sides by AAV ITRs. A rAAV virion may be produced in a suitable
host cell which has had an AAV vector, AAV Rep and Cap functions
and helper virus functions introduced therein. In this manner, the
host cell is rendered capable of producing AAV replication and
capsid proteins that are required for replicating and packaging the
AAV vector (i.e., containing a recombinant nucleotide sequence of
interest) into recombinant virion particles for subsequent gene
delivery. The complete transgene may consist of a promoter, the
coding sequences, usually a cDNA and a polyadenylation signal. A
transgene may also include regulatory sequences and intron regions.
Promoters that would regulate transgene expression may include
constitutive, inducible and tissue-specific promoters.
[0041] The term "transfection" is used herein to refer to the
uptake of foreign DNA by a cell. A cell has been "transfected" when
exogenous DNA has been introduced inside the cell membrane. A
number of transfection techniques are generally known in the art.
See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al.
(1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor
Laboratories, New York, Davis et al. (1986) Basic Methods in
Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197.
Such techniques can be used to introduce one or more exogenous DNA
moieties, such as a plasmid vector and other nucleic acid
molecules, into suitable host cells. The term refers to both stable
and transient uptake of the genetic material.
[0042] The term "transduction" denotes the delivery of a DNA
molecule to a recipient cell either in vivo or in vitro, via any
method of gene delivery, including replication-defective viral
vectors, such as via a rAAV.
[0043] The term "heterologous," as it relates to nucleic acid
sequences such as gene sequences and control sequences, denotes
sequences that are not normally joined together and/or are not
normally associated with a particular virus. Allelic variation or
naturally occurring mutational events do not give rise to
heterologous DNA, as used herein.
[0044] "DNA" is meant to refer to a polymeric form of
deoxyribonucleotides (i.e., adenine, guanine, thymine and cytosine)
in double-stranded or single-stranded form, either relaxed or
supercoiled. This term refers only to the primary and secondary
structure of the molecule, and does not limit it to any particular
tertiary forms. Thus, this term includes single- and
double-stranded DNA found, inter alia, in linear DNA molecules
(e.g., restriction fragments), viruses, plasmids, and chromosomes.
In discussing the structure of particular DNA molecules, sequences
may be described herein according to the normal convention of
giving only the sequence in the 5' to 3' direction along the
non-transcribed strand of DNA (i.e., the strand having the sequence
homologous to the mRNA). The term captures molecules that include
the four bases adenine, guanine, thymine and cytosine, as well as
molecules that include base analogues which are known in the
art.
[0045] A "gene" or "coding sequence" or a sequence which "encodes"
a particular protein is a nucleic acid molecule that is transcribed
(in the case of DNA) and translated (in the case of mRNA) into a
polypeptide in vitro or in vivo when placed under the control of
appropriate regulatory sequences; although one of skill in the art
will readily appreciate that various polynucleotides do not operate
in this fashion (e.g., antisense RNA, siRNA, ribozymes, wherein the
RNA transcript is the product). With respect to protein products
(i.e., not RNA products), the boundaries of the coding sequence are
determined by a start codon at the 5' (i.e., amino) terminus and a
translation stop codon at the 3' (i.e., carboxy) terminus. A gene
can include, but is not limited to, cDNA from prokaryotic or
eukaryotic mRNA, genomic DNA sequences from prokaryotic or
eukaryotic DNA, and even synthetic DNA sequences. A transcription
termination sequence will usually be located 3' to the gene
sequence. Moreover, a "gene" (i) starts with a promoter region
containing multiple regulatory elements, possibly including
enhancers, for directing transcription of the coding region
sequences; (ii) includes coding sequences, which start at the
transcriptional start site that is located upstream of the
translational start site and ends at the transcriptional stop site,
which may be quite a bit downstream of the stop codon (a
polyadenylation signal is usually associated with the
transcriptional stop site and is located upstream of the
transcriptional stop); and (iii) may contain introns and other
regulatory sequences to modulate expression and improve stability
of the RNA transcript.
[0046] The term "control elements" refers collectively to promoter
regions, polyadenylation signals, transcription termination
sequences, upstream regulatory domains, origins of replication,
internal ribosome entry sites ("IRES"), enhancers, and the like,
which collectively provide for the replication, transcription and
translation of a coding sequence in a recipient cell. Not all of
these control elements need always be present, so long as the
selected coding sequence is capable of being replicated,
transcribed and translated in an appropriate host cell.
[0047] The term "promoter region" is used herein in its ordinary
sense to refer to a nucleotide region including a DNA regulatory
sequence, wherein the regulatory sequence is derived from a gene
which is capable of binding RNA polymerase and initiating
transcription of a downstream (3'-direction) coding sequence.
[0048] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, control elements operably linked to a
coding sequence are capable of effecting the expression of the
coding sequence. The control elements need not be contiguous with
the coding sequence, so long as they function to direct the
expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence
and the coding sequence and the promoter sequence can still be
considered "operably linked" to the coding sequence.
[0049] For the purpose of describing the relative position of
nucleotide sequences in a particular nucleic acid molecule
throughout the instant application, such as when a particular
nucleotide sequence is described as being situated "upstream,"
"downstream," "5'," or "3'" relative to another sequence, it is to
be understood that it is the position of the sequences in the
non-transcribed strand of a DNA molecule that is being referred to
as is conventional in the art.
[0050] "Homology" and "homologous" as used herein refer to the
percent of identity between two polynucleotide or two polypeptide
moieties. The correspondence between the sequences from one moiety
to another can be determined by techniques known in the art. For
example, homology can be determined by a direct comparison of the
sequence information between two polypeptide molecules by aligning
the sequence information and using readily available computer
programs. Alternatively, homology can be determined by
hybridization of polynucleotides under conditions which form stable
duplexes between homologous regions, followed by digestion with
single-stranded-specific nuclease(s), and size determination of the
digested fragments. Two DNA or two polypeptide sequences are
"substantially homologous" to each other when at least about 80%,
preferably at least about 90%, and most preferably at least about
95% of the nucleotides or amino acids, respectively, match over a
defined length of the molecules, as determined using the methods
above.
[0051] "Isolated" as used herein when referring to a nucleotide
sequence, vector, etc., refers to the fact that the indicated
molecule is present in the substantial absence of other biological
macromolecules of the same type. Thus, an "isolated nucleic acid
molecule which encodes a particular polypeptide" refers to a
nucleic acid molecule that is substantially free of other nucleic
acid molecules that do not encode the subject polypeptide.
Likewise, an "isolated vector" refers to a vector that is
substantially free of other vectors that differ from the subject
vector. However, the subject molecule or vector may include some
additional bases or moieties that do not deleteriously affect the
basic characteristics of the composition.
[0052] "Purified" as used herein when referring to a vector, refers
to a quantity of the indicated vector that is present in the
substantial absence of other biological macromolecules. Thus, a
"purified vector" refers to a composition that includes at least
80% subject vector, preferably at least 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98% or 99% subject vector with respect to other
components of the composition
[0053] "Mammal" as used herein refers to any member of the class
Mammalia, including, without limitation, humans and nonhuman
primates such as chimpanzees and other apes and monkey species;
farm animals such as cattle, sheep, pigs, goats and horses;
domestic mammals such as dogs and cats; laboratory animals
including rodents such as mice, rats and guinea pigs, and the like.
The term does not denote a particular age or sex. Thus, adult and
newborn subjects, as well as fetuses, whether male or female, are
intended to be included within the scope of this term.
[0054] Described herein, the inventors evaluated the effects of
intravenously administered rAAV8 encoding Apo A-I Milano on aortic
and innominate artery atherosclerosis, plaque composition and
phenotype of circulating mononuclear cells in Apo E-/-Apo
A1-/-mice.
[0055] The inventors found that rAAV8 mediated Apo A-I Milano gene
transfer reduces all plaques; for example, plaque in whole aorta,
aortic sinuses and innominate arteries. The plaque that remains is
more table and less likely to rupture and trigger a blood clot.
Further, the inventors evaluated the effects of rAAV2 mediated Apo
A-I Milano gene transfer using a single intramuscular injection, on
murine atherosclerosis and macrophage phenotype. The inventors also
found that a single intramuscular injection of rAAV2-Milano
significantly reduces aortic atherosclerosis despite absence of
detectable levels of circulating transgene; these effects are
associated with adoption of an anti-inflammatory phenotype in
macrophages. As such, various embodiments of the present invention
are based, at least in part, upon these findings.
[0056] Various embodiments of the present invention provide for a
method of changing the phenotype of monocytes and macrophages from
a proinflammatory M1 phenotype to an anti-inflammatory M2
phenotype. In various embodiments, the method comprises providing a
composition comprising a recombinant adeno-associated virus (rAAV)
vector comprising an exogenous gene encoding ApoA-I Milano or a
fragment thereof; and administering the composition to a mammal in
need thereof to change the phenotype of monocytes or macrophages
from a proinflammatory M1 phenotype to an anti-inflammatory M2
phenotype.
[0057] In various embodiments, the method further comprises
monitoring monocyte or macrophage phenotypic switching in the
mammal. In other embodiments, the method further comprises
assessing the efficacy of a treatment for atherosclerosis in the
mammal.
[0058] In various embodiments the rAAV vector is produced by the
process of: (i) providing a first plasmid that comprises ApoA-I
Milano or a fragment thereof, (ii) providing a second plasmid that
is complementary to the first plasmid and which comprises
components for rescue and packaging, (iii) co-transfecting the
first and second plasmids into a host cell, and (iv) generating a
quantity of said rAAV vector from said co-transfected host cell,
wherein the pair of said first and second plasmids is selected such
that said rAAV vector is targeted for delivery to a specific tissue
type.
[0059] In various embodiments, the second plasmid further comprises
AAV rescue and packaging components derived from an AAV serotype
selected from the group consisting of AAV1, AAV2, AAV5, AAV7, AAV8,
AAV9, AAV10 and combinations thereof.
[0060] In various embodiments, the recombinant adeno-associated
virus (rAAV) vector, comprising an exogenous gene encoding ApoA-I
Milano or a fragment thereof is rAAV8 vector comprising an
exogenous gene encoding ApoA-I Milano or a fragment thereof. In
various embodiments the recombinant adeno-associated virus (rAAV)
vector, comprising an exogenous gene encoding ApoA-I Milano or a
fragment thereof is rAAV2 vector comprising an exogenous gene
encoding ApoA-I Milano or a fragment thereof.
[0061] In various embodiments, the monocyte or macrophage is a
circulating monocyte or macrophage. In other embodiments, the
monocyte or macrophage is a peritoneal monocyte or macrophage. In
various embodiments, very low levels of circulating transgene
product are present. In various embodiments, changing monocyte or
macrophage phenotype inhibits atherosclerosis.
[0062] In certain embodiments, changing the phenotype of monocytes
or macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces atherosclerosis. In
particular embodiments, changing the phenotype of monocytes or
macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces atherosclerosis in whole
aorta. In particular embodiments, changing the phenotype of
monocytes or macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces atherosclerosis in aortic
sinuses. In particular embodiments, changing the phenotype of
monocytes or macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces atherosclerosis in the
innominate artery.
[0063] In various embodiments changing the phenotype of monocytes
or macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces plaque.
[0064] In various embodiments, changing the phenotype of monocytes
or macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces plaque lipid content in
aortic sinuses. In various embodiments, changing the phenotype of
monocytes or macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype reduces plaque lipid content in the
innominate artery. In various embodiments, changing the phenotype
of monocytes or macrophages from a proinflammatory M1 phenotype to
an anti-inflammatory M2 phenotype reduces plaque macrophage content
in aortic sinuses. In various embodiments, changing the phenotype
of monocytes or macrophages from a proinflammatory M1 phenotype to
an anti-inflammatory M2 phenotype reduces plaque macrophage content
in innominate arteries.
[0065] Various embodiments of the present invention provide for
monitoring macrophage phenotypic switching in a mammalian subject
in need thereof. In various embodiments, the phenotypic switch is
between a proinflammatory M1 macrophage and an anti-inflammatory M2
macrophage. In various embodiments, the mammalian subject has
atherosclerosis. In various embodiments, the mammalian subject is
or has been treated with apo A1 Milano. In various embodiments, the
method comprises measuring the expression level of one or more
markers selected from the group consisting of MCP-1, IL-6, TNF-a,
Arg-1, Ym-1 and CD206; and (a) determining the presence of a
phenotypic switch from proinflammatory M1 macrophage to
anti-inflammatory M2 macrophage when MCP-1, IL-6 and/or TNF-a is
down-regulated, and/or Arg-1, Ym-1 and/or CD206 is up-regulated, or
(b) determining the absence of a phenotypic switch from
proinflammatory M1 macrophage to anti-inflammatory M2 macrophage
when MCP-1, IL-6 and/or TNF-a is not down-regulated, and/or Arg-1,
Ym-1 and/or CD206 is not up-regulated, or (c) determining the
presence of a phenotypic switch from anti-inflammatory M2
macrophage to proinflammatory M1 macrophage when MCP-1, IL-6 and/or
TNF is up-regulated, and/or Arg-1, Ym-1 and/or CD206 is
down-regulated. Measuring the expression level of the one or more
markers can be performed by any method known in the art.
[0066] Various embodiments of the present invention provide for
assessing the efficacy of the treatment of atherosclerosis in a
mammalian subject in need thereof. In various embodiments, the
treatment of atherosclerosis is treatment with apo A1 Milano. The
method comprises: determining the phenotype of the macrophages in
the mammalian subject; and (a) making a determination that the
treatment is providing beneficial results to the mammalian subject
if a phenotypic switch from proinflammatory M1 macrophage to
anti-inflammatory M2 macrophage is detected, or (b) making a
determination that the treatment is not providing beneficial
results to the mammalian subject if a phenotypic switch from
anti-inflammatory M2 macrophage to proinflammatory M1 macrophage is
detected.
[0067] In various embodiments, the treatment with apo A1 Milano may
be provided in variety of ways known in the art. Examples include,
but are not limited to IM or IV rAAV gene transfer (e.g., rAAV
serotype 2, rAAV serotype 8), administration of a composition
comprising apo A1 Milano protein, administration of a composition
comprising apo A1 Milano protein via a drug eluting stent.
[0068] In various embodiments, the vectors of the present invention
are based on the vector described in U.S. Pat. No. 5,474,935, with
the transgene being ApoA-I Milano or a fragment thereof, for
changing the phenotype of monocytes and macrophages from a
proinflammatory M1 phenotype to an anti-inflammatory M2 phenotype
and the treatment of atherosclerosis. Preparation of rAAV vectors
can be as described in Chatterjee, S. & K. K. Wong,
Adeno-associated virus vectors for the delivery of ribozymes. In
"Intracellular Ribozyme Applications: Principles and Protocols," J
J Rossi and L. Couture (Eds.), Horizon Scientific Press, pp.
189-215 (2000); Chatterjee, S. et al., "Transduction of primitive
human marrow and cord blood-derived hematopoietic progenitor cells
with adeno-associated virus vector," Blood, Vol. 93, pp. 1882-1894
(1999). Transgene delivery systems have frequently included the use
of the CMV immediate early promoter (Fitzsimons, H. L. et al.,
"Promoters and regulatory elements that improve adeno-associated
virus transgene expression in the brain," Methods, Vol. 28, pp.
227-36 (2002); Phillips, M. I., "Gene therapy for hypertension:
sense and antisense strategies," Expert Opin Biol Ther, Vol. 1, pp.
655-62 (2001); Smith, L. C. et al., "Advances in plasmid gene
delivery and expression in skeletal muscle," Curr Opin Mol Ther,
Vol. 2, pp. 1504 (2000); Keating, A. et al., "Effect of different
promoters on expression of genes introduced into hematopoietic and
marrow stromal cells by electroporation," Exp Hematol, Vol. 18, pp.
99-102 (1990); Muller, S. R. et al., "Efficient transfection and
expression of heterologous genes in PC12 cells," DNA Cell Biol,
Vol. 9, pp. 221-9 (1990)) since it is one of the most active
promoters among viral and eukaryotic species without a specific
host cell type requirement. However, any number of promoters may be
used in constructing the rAAV vectors of the present invention as
will be recognized by one of skill in the art. For example, the
rAAV-5 vector used in the present invention incorporates a CBA
promoter.
[0069] The construction of the vectors of the present invention can
be completed by widely recognized means for manufacturing AAV
virions, which entails co-transfection of a host cell with two
different, yet complementing plasmids. One of these contains the
therapeutic or reporter transgene sandwiched between the two cis
acting AAV ITRs. The AAV components that are needed for rescue and
subsequent packaging of progeny recombinant genomes are provided in
trans by a second plasmid encoding the viral open reading frames
for rep and cap proteins. However, any number of other techniques
for construction of the vectors of the present invention may be
used as will be recognized by one of skill in the art. See, e.g.
Gao, G. (2002) Proc Natl Acad Sci USA 99:11854-11859; Hauck, B.
(2003) Journal of Virology 77(4):2768-2774; Gao, G. (2004) Journal
of Virology 78(12):6381-6388. Still other methods may be used for
construction of the vectors of the present invention, for example,
U.S. Pat. No. 5,658,776 refers to packaging systems and processes
for packaging AAV vectors that replace the AAV P5 promoter with a
heterologous promoter. Alternatively, U.S. Pat. No. 5,622,856
refers to constructs and methods for AAV vector production, which
provide constructs formed by moving the homologous P5 promoter to a
position 3' to the rep genes, and optionally flanking the rep-cap
and repositioned P5 promoter with FRT sequences.
[0070] Furthermore, in various embodiments of the invention, the
ITRs and portions of the genome of the first plasmid and the rep
and cap proteins of the second plasmid can be derived from any
serotype of AW vector. In this way, the rAAV virions of the present
invention can be specifically tailored to target a subject tissue
with greater specificity. It is well known in the art that AAV
serotype has a significant impact on tissue-specific gene
expression (Hauck, B. et al., "Generation and characterization of
chimeric recombinant AAV vectors," Mol Ther, Vol. 7, pp. 419-25
(2003); Chao, H. et al., "Several log increase in therapeutic
transgene delivery by distinct adeno-associated viral serotype
vectors," Mol Ther, Vol. 2, pp. 619-23 (2000); Xiao, W. et al.,
"Gene therapy vectors based on adeno-associated virus type 1," J
Virol, Vol. 73, pp. 3994-4003 (1999); Rabinowitz, J. E. et al.,
"Cross-packaging of a single adeno-associated virus (AAV) type 2
vector genome into multiple AAV serotypes enables transduction with
broad specificity," J Virol, Vol. 76, pp. 791-801 (2002); Alisky,
J. M. et al., "Transduction of murine cerebellar neurons with
recombinant FIV and AAV5 vectors," Neuroreport, Vol. 11, pp.
2669-73 (2000); Chiorini, J. A. et al., "Cloning and
characterization of adeno-associated virus type 5," J Virol, Vol.
73, pp. 1309-19 (1999); Davidson, B. L. et al., "Recombinant
adeno-associated virus type 2, 4, and 5 vectors: transduction of
variant cell types and regions in the mammalian central nervous
system," Proc Nat Acad Sci USA, Vol. 97, pp. 3428-32 (2000);
Rutledge, E. A. et al., "Infectious clones and vectors derived from
adeno-associated virus (AAV) serotypes other than AAV type 2," J
Virol, Vol. 72, pp. 309-19 (1998)). For example, the DNA element of
the first plasmid may be derived from one AAV serotype, the rep
proteins may be derived from another AAV serotype, and the cap
proteins may be derived from still another AAV serotype. In
particular, the AAV vector genome can be pseudotyped by packaging
with capsids from different AAV serotypes, which has been effective
in directing rAAV gene therapies to specific tissues (Weitzman, M.
et al., "Breaking the barriers to global gene delivery," Nature
Biotechnology, Vol. 23, Issue 3, pp. 305-306 (2005); Wang, Z. et
al., "Adeno-associated virus serotype 8 efficiently delivers genes
to muscle and heart," Nature Biotechnology, Vol. 23, Issue 3, pp.
321-328 (2005); Wang, L. et al., "Sustained correction of disease
in naive and AAV2-pretreated hemophilia B dogs: AAV2/8-mediated,
liver-directed gene therapy," Gene Therapy, Vol. 105, Issue 8, pp.
3079-3086 (2005)). In various embodiments of the present invention,
capsids derived from AAV serotypes 1, 8, 9 and 10 may be
particularly effective in intramuscular injections. Further,
capsids derived from AAV serotypes 1, 7 and 8 may be particularly
effective for hematopoietic stem cell transduction. Still further,
capsids derived from AAV serotype 8 may be particularly effective
targeting the liver.
[0071] Various embodiments of the present invention also relate to
the treatment, prevention, inhibition, stabilization and/or
induction of regression of atherosclerosis, as well as the
treatment, prevention, inhibition and/or stabilization of any
disease or physiological condition in which atherosclerosis (or
atherogenesis) plays a role. Furthermore, the methods of the
present invention may be particularly useful in treating
atherosclerosis when caused by invasive techniques, such as
percutaneous transluminal coronary angioplasty ("PTCA"); insertion
of a bypass graft or stent insertion; treatment of restenosis
following stent placement; or as a result of bypass graft
insertion. Each of the aforementioned applications is contemplated
as being within the scope of the present invention. Still further,
other diseases and physiological conditions that may benefit from
the methods of the present invention will be readily apparent to
those of skill in the art, and are also contemplated as being
within the ambit of the present invention.
[0072] Various embodiments of the present invention are also based
on a gene therapeutic approach to the treatment of coronary heart
disease and/or vascular disease. In some embodiments of the
invention, rAAV virions including heterologous DNA corresponding to
an ApoA-I Milano coding sequence are generated by any conventional
technique known in the art. By way of example, the recombinant AAV
virions of the present invention, including the ApoA-I Milano DNA
of interest, can be produced by a standard methodology that
generally involves the steps of: (1) introducing an AAV vector
plasmid into a host cell; (2) introducing an AAV helper construct
into the host cell, where the helper construct includes AAV coding
regions capable of being expressed in the host cell to complement
AAV helper functions missing from the AAV vector; (3) introducing
one or more helper viruses and/or accessory function vectors into
the host cell, wherein the helper virus and/or accessory function
vectors provide accessory functions capable of supporting efficient
rAAV virion production in the host cell; and (4) culturing the host
cell to produce rAAV virions. The AAV vector, AAV helper construct
and the helper virus or accessory function vector(s) can be
introduced into the host cell either simultaneously or serially,
using standard transfection techniques. Any number of other
approaches may also be used, as will be readily recognized by one
of skill in the art.
[0073] AAV vectors are constructed using known techniques to at
least provide, as operatively linked components in the direction of
transcription, (a) control elements including a transcriptional
initiation region, (b) the ApoA-I Milano DNA of interest and (c) a
transcriptional termination region. Moreover, any coding sequence
sufficiently homologous to the ApoA-I Milano coding sequence so as
to exhibit functional properties substantially similar to the
ApoA-I Milano coding sequence may be used in connection with
alternate embodiments of the present invention. The control
elements are selected to be functional in the targeted cell(s). The
resulting construct, which contains the operatively linked
components, may be bounded (5' and 3') with functional AAV ITR
sequences. The nucleotide sequences of AAV ITR regions are known.
See, e.g., Kotin, R. M. (1994) Human Gene Therapy 5:793-801; Berns,
K. I., "Parvoviridae and their Replication" in Fundamental
Virology, 2.sup.nd Edition, (B. N. Fields and D. M. Knipe, eds.)
for the AAV-2 sequence. AAV ITRs used in the vectors of the
invention need not have a wild-type nucleotide sequence, and may be
altered (e.g., by the insertion, deletion or substitution of
nucleotides). Additionally, AAV ITRs may be derived from any of
several AAV serotypes, including, without limitation, AAV-1, AAV-2,
AAV-3, AAV-4, AAV-5, AAV-7, AAV-8, AAV-9, AAV-10 and the like. See,
e.g. Gao et al., J. Virol. 2004 June; 78(12):6381-8; Weitzman, M.
et al. (2005); Wang, Z. et al. (2005); and Wang, L. et al. (2005).
Furthermore, 5' and 3' ITRs that flank a selected nucleotide
sequence in an AAV expression vector need not necessarily be
identical or derived from the same AAV serotype or isolate, so long
as they function as intended (i.e., to allow for excision and
replication of the bounded ApoA-I Milano nucleotide sequence of
interest).
[0074] The rAAV genome encoding the ApoA-I Milano transgenes within
AAV ITRs may be packaged in virion capsids derived from any AAV
serotype including AAV-1, AAV-2, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8,
AAV-9, AAV-10 and the like. See, e.g. Gao et al. (2004); Weitzman,
M. et al. (2005); Wang, Z. et al. (2005); and Wang, L. et al.
(2005).
[0075] The virions described above are useful for changing the
phenotype of monocytes and macrophages from a proinflammatory M1
phenotype to an anti-inflammatory M2 phenotype, for treating
atherosclerosis, for reducing plaque, as well as for preventing and
treating coronary heart disease and/or vascular disease and thus
are useful for the manufacture of pharmaceutical compositions which
contain an effective amount of rAAV-ApoA-I Milano vectors in
admixture with inorganic or organic, solid or liquid,
pharmaceutically acceptable carriers. Thus, another aspect of this
invention is a composition for changing the phenotype of monocytes
and macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype, for treating atherosclerosis, for
reducing plaque, as well as for preventing and treating coronary
heart disease and/or vascular disease described herein in
combination with a pharmaceutically acceptable excipient.
[0076] The pharmaceutical compositions according to the invention
are those which are suitable for oral, transdermal, topical, or
parenteral, such as intramuscular or intravenous, administration to
humans, and which contain the pharmacologically active rAAV
transfected vectors together with a pharmaceutically acceptable
carrier. The dosage depends on various factors such as the age,
weight, severity of vascular condition, and other factors a doctor
might identify.
[0077] In certain embodiments, the therapeutic compositions are
administered via suppository, or in tablet or capsule formulations
for oral delivery. Oral formulations usually include such normally
employed additives such as binders, fillers, carriers,
preservatives, stabilizing agents, emulsifiers, buffers and
excipients as, for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharin, cellulose,
magnesium carbonate, and the like. These compositions take the form
of solutions, suspensions, tablets, pills, capsules, enterics,
sustained release formulations, powders, and the like. Oral
formulations for gene therapy are known in the art. See, e.g. Chen,
J. et al. (2004) World J. Gastroenterol 10(1):112-116. Further,
other oral formulations are contemplated for use in the present
invention as will be recognized by one of skill in the art.
[0078] Additional formulations which are suitable for other modes
of administration, such as transdermal and topical administration,
include salves, tinctures, creams, lotions, transdermal patches,
transplanted skin, genetically engineered skin, stent coatings and
suppositories. For salves and creams, traditional binders, carriers
and excipients may include, for example, polyalkylene glycols or
triglycerides. In certain embodiments, a transdermal patch may be
used for delivering therapeutics. See, e.g. U.S. Pat. No.
4,638,043. Transdermal and topical formulations for gene therapy
are known in the art. See, e.g. Jensen, T G (2004) Expert Opin Biol
Ther. 4(5):677-82. Further, other transdermal and topical
formulations are contemplated for use in the present invention as
will be recognized by one of skill in the art.
[0079] Particularly suitable dosage forms for parenteral
administration are sterile aqueous solutions of the
pharmacologically active rAAV transfected vectors in water-soluble
form, for example, a water-soluble salt, or sterile aqueous
injection suspensions which contain substances increasing the
viscosity, for example, sodium, carboxymethyl cellulose, sorbitol
and/or dextran, and optionally stabilizers. In addition, the
pharmacologically active rAAV transfected vectors, with or without
adjuvants, can also be in lyophilized form and brought into
solution prior to parenteral administration by the addition of
suitable solvents.
[0080] Generally, an injectable composition of the invention may be
a solution that is ready for injection, or a dry soluble
composition that is ready to be combined with a solvent just prior
to use, or a liquid concentrate ready for dilution prior to
administration. In preparing a composition for injection strict
attention must be paid to tonicity adjustment to avoid
irritation.
[0081] The vehicle normally has no therapeutic activity and is
nontoxic, but presents the pharmacologically active rAAV
transfected vectors to the body tissues or circulation in a form
appropriate for absorption. Absorption normally will occur most
rapidly and completely when the pharmacologically active rAAV
transfected vectors is presented as an aqueous solution. However,
modification of the vehicle with water-miscible liquids or
substitution with water-immiscible liquids can affect the rate of
absorption. In preparing the compositions which are suitable for
subcutaneous injection, one can use aqueous vehicles,
water-miscible vehicles, and nonaqueous vehicles. Certain aqueous
vehicles are recognized officially because of their valid use in
parenterals generally.
[0082] Water-miscible vehicles are also useful in the formulation
of the parenteral composition of this invention. These solvents are
used primarily to affect the solubility of the pharmacologically
active rAAV transfected vectors. These solvents may include, for
example, ethyl alcohol, polyethylene glycol and propylene
glycol.
[0083] Additional substances may be included in the injectable
compositions of this invention to improve or safeguard the quality
of the composition. Thus, an added substance may affect solubility,
provide for patient comfort, enhance the chemical stability, or
protect preparation against the growth of microorganisms. Thus, the
composition may include an appropriate solubilizer, substances to
make a solution isotonic, substances to act as antioxidants, and
substances that act as a preservative to prevent the growth of
microorganisms. These substances will be present in an amount that
is appropriate for their function, but will not adversely affect
the action of the composition as a treatment for disease conditions
as contemplated herein.
[0084] Generally, the sterile, parenterally injectable composition
of this invention and other therapeutic formulations suitable for
delivery to a mammal in accordance with various embodiments of the
present invention can be readily prepared by routine
experimentation by the skilled artisan. Guidance as to suitable
pharmaceutical formulations is provided by Remington: The Science
and Practice of Pharmacy 19.sup.th Ed.
[0085] In accordance with an embodiment of the invention, the rAAV
virions encoding ApoA-I Milano are delivered to a mammal in a
sufficient quantity and by a sufficient delivery route so as to
effect gene transfer. As described in the ensuing Examples, this
provides an effective way for changing the phenotype of monocytes
and macrophages from a proinflammatory M1 phenotype to an
anti-inflammatory M2 phenotype, for treating atherosclerosis, for
reducing plaque, and an effective treatment for atherosclerosis in
mammals. In various embodiments, a sufficient and therapeutic
quantity may be from about 1.times.10.sup.10 vector genome/kg to
about 1.times.10.sup.14 vector genome/kg of rAAV-ApoA-I Milano
vectors in vivo. In one embodiment of the present invention, the
ApoA-I Milano vector may be delivered to a subject by first
transducing multipotent stem cells (e.g., bone marrow cells, blood
stem cells, stromal cells, mesenchymal stem cells, etc.) with a
quantity of the rAAV-ApoA-I Milano vector, and then transplanting
these cells into a mammal. In an alternate embodiment, the
rAAV-ApoA-I Milano vector may be introduced into a mammal by direct
intramuscular or intravenous injection, or directly into the artery
at the site of PTCA or stent placement by any conventional
methodology, as will be readily appreciated by one of skill in the
art. This results in secretion of ApoA-I Milano either directly
into the circulation or locally in atherosclerotic plaque areas.
Further, the rAAV virions of the present invention can be delivered
as a single administration or as a treatment regimen, e.g., daily,
weekly, or at any other suitable time interval, as will be readily
recognized by one of skill in the art. In another embodiment of the
present invention, one serotype of rAAV virion can be delivered as
a single administration followed by delivery of a different
serotype of rAAV virion.
[0086] The present invention is also directed to a kit for changing
the phenotype of monocytes and macrophages from a proinflammatory
M1 phenotype to an anti-inflammatory M2 phenotype, for treating
atherosclerosis, for reducing plaque, and for the treatment of
atherosclerosis and related disease conditions in a subject. The
kit is an assemblage of materials or components, including at least
one means of effecting gene transfer of ApoA-I Milano in a subject
in accordance with various embodiments of the present invention.
The exact nature of the components configured in the inventive kit
depends on its intended purpose and on the particular methodology
that is employed. For example, some embodiments of the kit are
configured for changing the phenotype of monocytes and macrophages
from a proinflammatory M1 phenotype to an anti-inflammatory M2
phenotype. Other embodiments of the kit are configured for the
purpose of treating atherosclerosis and/or related disease
conditions in a mammalian subject. Still other embodiments are
configured for the purpose of preventing the onset of
atherosclerosis that is the result of another therapy, e.g.,
angioplasty or stent placement. In one embodiment, the kit is
configured particularly for the purpose of treating human
subjects.
[0087] Instructions for use may be included with the kit.
"Instructions for use" typically include a tangible expression
describing the preparation of virions and/or at least one method
parameter, such as the relative amounts of rAAV-ApoA-I Milano
vector genome, dosage requirements and administration instructions,
and the like, typically for an intended purpose. Optionally, the
kit also contains other useful components, such as, diluents,
buffers, pharmaceutically acceptable carriers, specimen containers,
syringes, stents, catheters, and pipetting or measuring tools.
[0088] The materials or components assembled in the kit can be
provided to the practitioner stored in any convenient and suitable
ways that preserve their operability and utility. For example the
components can be in dissolved, dehydrated, or lyophilized form;
they can be provided at room, refrigerated, or frozen temperatures.
The components are typically contained in suitable packaging
material(s). As employed herein, the phrase "packaging material"
refers to one or more physical structures used to house the
contents of the kit. The packaging material is constructed by well
known methods, preferably to provide a sterile, contaminant-free
environment. The packaging materials employed in the kit are those
customarily utilized in the field. As used herein, the term
"package" refers to a suitable solid matrix or material such as
glass, plastic, paper, foil, and the like, capable of holding the
individual kit components. Thus, for example, a package can be a
glass vial used to contain suitable quantities of a composition
containing a volume of rAAV-ApoA-I Milano vector. The packaging
material generally has an external label which indicates the
contents and/or purpose of the kit and/or its components.
[0089] The tools, kits, and methods of the present invention may be
implemented in connection with a gene therapeutic approach for
treating atherosclerosis and related disease conditions, or in
connection with monitoring phenotypic switches. The various
embodiments of the present invention may therefore provide a means
for prevention or reduction of the likelihood of the aforementioned
disease conditions. The embodiments of the invention are also
suitable for use in connection with monitoring the success of
ongoing or completed therapeutic intervention. For instance, a
subject's serum may be tested prior to treatment to screen for
circulating levels of ApoA-I Milano; during the course of treatment
(e.g., to enhance a physician's ability to implement an effective
treatment regimen); and/or following the completion of an
intervention to determine a level of success (e.g., lifestyle
changes, angioplasty and bypass surgery).
EXAMPLES
[0090] The following examples are provided to better illustrate the
claimed invention and are not to be interpreted as limiting the
scope of the invention. To the extent that specific materials are
mentioned, it is merely for purposes of illustration and is not
intended to limit the invention. One skilled in the art may develop
equivalent means or reactants without the exercise of inventive
capacity and without departing from the scope of the invention.
Example 1
[0091] Mice received one intravenous injection of
1.2.times.10.sup.12 vector genome copies of rAAV8-Milano or
rAAV8-Control (12 mice per group). Four weeks after injection, mice
were placed on high fat diet. Twenty weeks later mice were
euthanized and the extent of atherosclerosis in the en fasse aorta,
aortic sinuses and innominate artery was measured. Oil-red 0
staining and Moma-2 staining were used to measure lipid content and
macrophage content of the plaques respectively. Quantitative PCR
(qPCR) was used to analyze phenotype of macrophages.
Example 2
[0092] Compared to vector control, rAAV 8 Milano recipients had
less atherosclerosis in whole aorta (13.4.+-.1.1% vs. 7.7.+-.0.06%,
p=0.001), in aortic sinuses (77.1.+-.9.6 vs 44.8.+-.2.3, p=0.01)
and in the innominate artery (12.4.+-.2.4 vs 4.4.+-.2.1 mm.sup.2;
p<0.05). These effects were associated with reduced plaque lipid
content in aortic sinuses (20.3.+-.vs 12.8.+-.2.3%, p=0.03) and in
innominate artery (14.4.+-.2.5 vs 5.3.+-.1.6%; p=0.001) and reduced
plaque macrophage content in aortic sinuses (20.9.+-.2.1 vs
11.7.+-.2.4%, p=0.02) and in innominate arteries (8.3.+-.1.5 vs
3.1.+-.1.1% p=0.01). Compared to vector control, the rAAV8 Milano
recipients showed reduced expression of MCP-1 and TNF-.alpha. mRNAs
(M1 markers) and increased expression of Arg-1 (M2 marker) in
circulating mononuclear cells.
Example 3
[0093] ApoE-/-ApoA-/-double knockout received one intramuscular
injection of 1.2.times.10.sup.12 vector genome copies of
rAAV2-Milano or rAAV2-Control (10 mice per group). Four weeks after
intramuscular injection, mice were placed on high fat diet. Twenty
weeks later, mice were euthanized and the expression of Apo A-I
Milano mRNA in liver was measured by quantitative PCR (qPCR). In
addition, the phenotype of macrophages in the liver, peritoneal
macrophages, and peripheral blood mononuclear cells (PBMC) were
determined by qPCR. The quantitative extent of total aorta plaques
was evaluated by oil-red O staining ELISA analysis was performed to
measure serum level of the Apo A-I Milano.
Example 4
[0094] Serum Apo A-I Milano levels were not detectable in mice
receiving rAAV2 Milano and in Controls; however surprisingly,
significant difference was found in the extent of atherosclerosis
between the two groups: 14.6.+-.2.1 for rAAV2 control group vs.
9.3.+-.1.0 for the rAAV2-Milano group (P=0.04). qPCR analysis of
PBMC revealed that the relative expression level of MCP1, IL-6, and
TNF-.alpha. mRNAs were lower and the expression level of Arg-1 as
well as YM1 mRNA were higher in the rAVV2-Milano group compared to
the Control group. Similarly, the level of MCP-1, IL-6, and
TNF-.alpha. mRNA were lower and YM1 was higher in the liver of
rAAV-2 Milano group. Likewise, the expression of MCP-1, IL-6, and
TNF-.alpha. mRNAs was lower and those of YM1 and Arg-1 were higher
in the peritoneal macrophages of mice injected with rAAV2-Milano
compared to the Control group.
Example 5
Construction of Recombinant Adeno-Associated Virus Vectors
[0095] The construction of the rAAV vectors of the present
invention are completed by co-transfecting a host cell with two
different plasmids. rAAV virions are prepared with the plasmids
derived from various AAV serotypes. In each of the first plasmids,
ApoA-I Milano is sandwiched between the two cis acting AAV ITRs.
The AAV rep and cap proteins are provided in trans by a second
plasmid encoding the viral open reading frames for rep and cap
proteins of AAV. In one virion, rAAV2, the first plasmid genome is
derived from AAV serotype 2 and the second plasmid is derived from
AAV serotype 2 (Rep2Cap2). In a second virion, rAAV5, the first
plasmid genome is derived from AAV serotype 5 and the second
plasmid is derived from AAV serotype 5 (Rep5Cap5). In a third
virion, rAAV1, the first plasmid genome is derived from AAV
serotype 2 and the second plasmid is derived from AAV serotypes 2
and 1 (Rep2Cap1). In a fourth virion, rAAV7, the first plasmid
genome is derived from AAV serotype 2 and the second plasmid is
derived from AAV serotypes 2 and 7 (Rep2Cap7). In a fifth virion,
rAAV8, the first plasmid genome is derived from AAV serotype 2 and
the second plasmid is derived from AAV serotypes 2 and 8
(Rep2Cap8). In a sixth virion, rAAV9, the first plasmid genome is
derived from AAV serotype 2 and the second plasmid is derived from
AAV serotypes 2 and 9 (Rep2Cap9). Other virions may be readily
implemented as part of the present invention, as will be recognized
by one of skill in the art.
Example 6
Production of Recombinant Adeno-Associated Virus (rAAV)
Vectors:
[0096] A rAAV viral vector plasmid was constructed based on vectors
previously constructed and utilized in the inventors' laboratory
for the purpose of apo A1 Milano expression. [1] The specific rAAV
vector serotypes used in this study contain each AAV serotype 2 and
8 viral capsid and a single-stranded DNA containing AAV2 inverted
terminal repeat and encoding the human apo A1 Milano gene cDNA
driven by a cytomegalovirus (CMV) immediate-early
promoter/enhancer. In addition, the enhanced green fluorescent
protein (EGFP) marker gene was also included in the constructs to
simplify the monitoring procedure for transgene detection.
Cultured Cells:
[0097] NautCells.TM. (Microbix Biosystems Inc. Canada), a reliable
and traceable 293 human embryo kidney (HEK) cell clone producing a
high titre of rAAV vectors, were grown and maintained in high
glucose DMEM (Invitrogen) culture medium containing 10% fetal
bovine serum, 100 units/ml-100 mg/ml penicillin-streptomycin in 5%
CO.sub.2 at 37.degree. C.
Transfection of rAAV Using Effecten Transfection Reagent
(Qiagen):
[0098] Subcultured actively growing NautCells.TM. were placed in 15
cm culture dishes with high glucose DMEM and incubated in 5%
CO.sub.2 at 37.degree. C. overnight. The medium was changed the
next day and used for transfection 2-4 h. A plasmid mixture
consisting of 4 ug of rAAV vector (individual constructs), 4 ug of
AAV packging plasmid XX2(AAV rep2 and cap2) or p5E18-VD287(AAV rep2
and cap8), and 12 mg of adenovirus helper plasmid XX6-80 were mixed
with EC buffer (Qiagen Inc., Valencia, Calif.) to a final volume of
700 ul. Enhancer (120 ul; Qiagen Inc.) was added to each tube and
vortexed immediately for 10 s. The tubes were placed at room
temperature for 10 min. Fresh DMEM culture medium (4 ml) was added
to each individual tube and mixed by pipetting up and down three
times. The medium was then laid drop-wise onto NautCell.TM. while
the dish was gently swirled. Transfected NautCells.TM. were scraped
with a cell lifter at 66-72 h post-transfection in the presence of
medium. The cells from five dishes were combined in a 50 ml
disposable centrifuge tube, collected by spinning in Sorvall TC
centrifuge at 1,000 rpm for 8 min at RT. The media are discarded,
and the cell pellets were stored at -80.degree. C. for later
use.
Purification of rAAV Virus Using Discontinuous Iodixanol Density
Gradients:
[0099] The cell pellets were resuspended in 1.5 ml of 150 mM NaCl,
50 mM Tris-HCl, pH 8.5. The cells subjected to five cycles of
freezing (dry ice-ethanol bath) and thawing (37.degree. C. water
bath) with vortexing for 30 s after each thawing. The lysed cells
were incubated with 0.5% deoxycholate (Fluka) in the presence of 50
u/ml Benzonase (Sigma) at 37.degree. C. for 30 min. The lysate was
clarified and recovered by centrifugation at 4500 g at 4.degree. C.
for 20 min. Purification of rAAV particles was accomplished by
discontinuous iodixanol density gradient centrifugation method as
previously described by Muzyczka et al. [2]. The virus was
concentrated and desalted by centrifugation through the Amicon
ultre-15 centrifugal filter devices (Millipore 100K NMWL
device).
Dot Blot Hybridization for Determining rAAV Vector Genome (vg)
Titers and rAAV Transduction Assay for Determining Transducing
Units (Tu):
[0100] rAAV vector genome titers were determined by dot-blot assay
using RNA Detector Northern Blotting Kit (KPL) according to the
manufacturer's instructions, and the titers were rAAV2/2
6.2.times.10e12 genome copies/ml, rAAV2/8 5.6.times.19e12 genome
copies/ml. Viral transducing units (Tu) were measured by
transduction of 293 cells in the presence of adenovirus helper with
MOI followed by FACS.
Example 7
Animal Procedures and Study Design
Animal Procedures:
[0101] The apo A-1/apoE double-knockout mice on C57BL/6 background
were kindly provided by Dr. Linda Curtiss (Department of
Immunology, The Scripps Research Institute, La Jolla, Calif.) and
maintained as a breeding colony. Mice 6-8 weeks old weighing 15-21
g were used for this study and males and females were equally
represented. The animals were randomly divided into 6 groups (Table
1) and injected virus at a doses of 1.2.times.10e12 genome copies
in 320 ul PBS (IV) 150 ul PBS (IM) per mouse, tail vein injection
and intramuscular injection into the hind leg. Animals injected
viruses four weeks later were placed on a high fat diet (HFD)
containing 15.8% fat and 1.25% cholesterol for 24 weeks thereafter
and were then sacrificed. Blood samples were periodically collected
from the retro-orbital plexus at least four times before and at
designated time-points after gene transfer. The use of experimental
animals was in accordance with the guidelines of the CSHS
Institutional Animal Care and Uses Committee.
Study Design
TABLE-US-00001 [0102] TABLE 1 Experimental design No. of Serotype
Transgene Route of injection mice tested rAAV8 EGFP-apo A1 Milano
IV tail-vein 12 rAAV8 EGFP IV tail-vein 12 rAAV2 EGFP-apo A1 Milano
IV tail-vein 12 rAAV2 EGFP IV tail-vein 12 rAAV2 EGFP-apo A1 Milano
IM hind leg 12 rAAV2 EGFP IM hind leg 12 IV: intravenous IM:
intramuscular
[0103] rAAV vector administration into apoE/apoA1 double KO mice.
Serotypes 8 and 2 expressing EGFP-apo A1 Milano and EGFP (vector
control) cDNA were evaluated in mice. Details of the total number
of mice tested, routes of vector administration are listed.
Example 8
rAAV Biodistribution and Transduction Efficacy In Vivo Though
Detection of Transgene Apo A1 Milano mRNA Expression Using
RT-PCR
[0104] At 24 weeks after administration, a single mouse was killed
for each rAAV vector and dose group. Total RNA (n=3 mice per group)
was extracted from brain, lung, heart, liver, spleen, kidney,
intestine and muscle with TRIzol reagent (Invitrogen) according to
the manufacturer's protocol. First-strand cDNA was synthesized from
2 ug of total RNA in a final volume 20 ul using a Omniscript
Reverse Transcription Kit (Qiagen, Valencia, Calif., USA). The cDNA
was used. Real-time quantitative PCR analysis using an iO5
Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules,
Calif., USA). For real-time PCR, all reactions were performed in
triplicate, in a total reaction volume of 25 ul. The PCR was
performed with the following primer sequences for human apo A1
Milano: 5'-tggatgtgctcaaagacagc-3' sense (SEQ ID NO:1) and
5'-aggccctctgtctccttttc-3' antisense (SEQ ID NO:2). Primers for
mouse GAPDH were as follows: forward, 5' atcactgccacccagaagac-3'
(SEQ ID NO:3); reverse, 5'-cacattgggggtaggaacac-3' (SEQ ID NO:4).
The cycling conditions were an initial denaturation for 3 min at
94.degree. C. followed by 35 cycles of 94.degree. C. for 30 s,
60.degree. C. for 20 s, and 72.degree. C. for 20 s, which concluded
by the melting curve analysis process and run 1.8% agarose gel. The
relative apo A1 Milano mRNA levels were quantified against GAPDH,
using iO5 Optical System Software analysis (Bio-Rad).
Example 9
ELISA for the Detection of Human apoA 1 Milano [3]
[0105] Serum levels of human apo A1-Milano in the mice with rAAVs
were determined by ELISA. ELISA plates were coated with an
antihuman apo A1 monoclonal antibody (Calbiochem) at a
concentration of 4 ug/ml and incubated at 4.degree. C. overnight.
The wells were washed, blocked with 1% fetal bovine serum PBS, and
diluted standards (Calbiochem) or serum samples were added to the
wells and incubated at 4.degree. C. overnight. After washing,
rabbit antihuman apo A1 antibody was added and incubated at room
temperature for 2 hours. After washing, a HRP-conjugated
goat-antirabbit antibody (Santa Cruz) was added and the color was
developed by addition of Substrate Reagent Pack Color Reagent A and
B (R&D). Absorbance was measured at 450 nm on a microplate
reader. Serum human apo A1-Milano levels were calculated by
comparison with the standard curve.
Example 10
Lipoprotein Analysis
[0106] Fasting blood samples were collected from mice which carry
rAAV by retro-orbital venous plexus puncture using heparinized
tubes under isoflurane anesthesia. Total cholesterol was measured
using a Cholesterol Calibrators Reagent Enzymatic Kit (sigma).
Example 11
Atherosclerotic Lesion Analysis
Assessment of Atherosclerosis in the Total Aorta:
[0107] The extent of the atherosclerotic lesions in the total aorta
were quantified after oil red O staining, as described previously
[4, 5]. Briefly, the thoracic cavity was opened; the aortic arch as
well as the aorta were exposed, and were photographed under a
dissecting microscope. After capturing the images, most of the
vascular tree was dissected intact. The luminal surface was
exposed, and then the aortic tissue was fixed with Histo-choice
tissue fixative (Amresco, Solon, Ohio). After tissue fixation, the
adventitial tissue was removed and aortic tissue was stained for
lipids with Oil-Red O. The aortas were pinned to a dark surface,
and images were captured by using a Spot digital camera (Diagnostic
Instruments, Sterling Heights, Mich.). The extent of the
atherosclerotic lesions was quantified using Image-Pro Plus
(version 4, Media Cybernetics, Silver Spring, Md.). Lesions were
reported as percentage of the total aortic area consisting of
thoracic aorta (ending at the final intercostals artery), and
abdominal aorta ending at the iliac difurcation.
Assessment of Atherosclerosis in the Innominate Artery:
[0108] For innominate artery sections, aortic arch was fixed in 4%
paraformaldehyde overnight and then embedded in Optimal Cutting
Temperature (OCT). The frozen tissues were serially sectioned into
8-um sections from the aortic arch using a Leica cryostat and kept
in a -80.degree. C. freezer for <1 month before use. Tissue was
stained with Oil-Red O. The lesion areas were quantified by
Image-Pro Plus using the hematoxylin-stained sections (mean of 6
sections per mouse; 5 mice per group).
Assessment of Atherosclerosis in the Aortic Sinus:
[0109] To determine cross-sectional lesion area, hearts were
embedded in OCT, frozen on dry ice, and then stored at -80.degree.
C. until sectioning. Serial sections 8 um thick were collected on
slides. Cross sections of the aortic sinus and aortic valve were
stained with Oil-Red O. Lesion areas were quantified with Image-Pro
Plus by manual tracing of the lesion, which was identified by a
combination of lipid staining and histologic morphology.
Immunostaining:
[0110] To assess macrophage infiltration into atherosclerotic
plaques, macrophage immunoreactivity was detected by immunostaining
of frozen sections of innominate and aortic sinus with a 1:100
dilution of rat anti-mouse monocyte/macrophage (MOMA-2) monoclonal
antibody (Seiotec). After washing, the sections were incubated with
the goat anti-Rat secondary antibodies (Jacksin Immuno Research
Lab), and then to apply LSAB streptavidin-HRP 25 min followed by
color development. The sections were counterstained with
hematoxyli. Photomicroscopy was performed using an Olympus
microscope. The percentage of plaque area occupied by MOMA-2
staining, reflecting macrophage immunoreactivity, was calculated
from the captured images using the Image-Pro Plus software.
Example 12
Real-Time PCR for Apo A1 Milano Alternatively Activated Macrophage
M1 & M2 Phenotype
[0111] RNA was isolated from peripheral blood mononuclear cell
(PBMC), peritoneal macrophages (3% Brewer thioglycollate medium
activity) and liver using TRIzol.
[0112] The sequences of the primer pairs used in this analysis are
indicated in Table 2. The reaction conditions consisted of one 3
min cycle at 94.degree. C., followed by 40 cycles of 94.degree. C.
for 10 s, 60.degree. C. for 10 s, and 72.degree. C. for 10 s, which
concluded by the melting curve analysis process and run 1.8%
agarose gel.
TABLE-US-00002 TABLE 2 List of primers Gene For/Rev Sequences (5'to
3') SEQ ID NO: TNF-a F TCGTAGCAAACCACCAAGTG 5 R
AGATAGCAAATCGGCTGACG 6 I1-6 F AGACAAAGCCAGAGTCCTTCAG 7 R
TAGGAGAGCATTGGAAATTGG 8 MCP-1 F CCCACTCACCTGCTGCTACT 9 R
TCTGGACCCATTCCTTCTTG 10 Arg-1 F CTCCAAGCCAAAGTCCTTAGAG 11 R
AGGAGCTGTCATTAGGGACATC 12 Ym1 F GGGCATACCTTTATCCTGAG 13 R
CCACTGAAGTCATCCATGTC 14 CD206 F GGCAGGATCTTGGCAACCTAGTA 15 R
GTTTGGATCGGCACACAAAGTC 16 I1-10 F AGCTCCAAGACCAAGGTGTC 17 R CGA
GGTTTTCCAAGGAGTTG 18
Example 13
Tests for Circulating Antibody Against apoA1 Milano (Transgene) by
ELISA
[0113] Plasma samples of KO apoE/apoA1 mice IV or IM injected with
rAAV-apo a1 Milano were tested for the presence of antibodies
against apo A1 Milano using an ELISA. 96 wells plates were coated
with 1 ug/ml human apoA1 in 0.1M NaHCO.sub.3 pH 9.4, 100 ul/well
and then incubated at 4.degree. C. for 12-24 hours. Plates were
washed three times with PBS-0.05% Tween-20, 5 min/time.
[0114] Plates were blocked with 1% BSA in PBS 200 ul/well at R/T 2
h or 4.degree. C., O/N. Plates were washed three times with
PBS-Tween-20, 5 min/time.
[0115] Dilute plasma samples (1:16) were applied in duplicate.
Dilute Anti-human apo A1 Milano cAb to final concentration of 1
ug/ml as positive control. Negative controls included noninjected
and rAAV EGFP injected mice. Plates were incubated 4.degree. C. for
12-24 hours or RT 2 h. Plates were washed three times with
PBS-Tween, 5 min/time.
[0116] Detection Ab: anti-mouse IgG-HRP was added in a dilution of
1:2000. Plates were incubated for 1 hour at RT. Plates were washed
6 times with PBS-0.05% Tween-20, 5 min/time. Absorbance was
measured at 450 nm on a microplate reader. Serum antibody against
human apo A1-Milano levels were calculated by comparison with the
standard curve.
Example 14
Statistical Evaluation
[0117] The Prism 4.0 software (Graphpad, San Diego, Calif.) was
used for all calculations. All data are represented as mean SD.
Values with p<0.05 were considered statistically significant by
a one-tailed Student's t test.
Example 15
Expression of Transgene in Circulating Blood
[0118] To compare the expression levels of the transgene in
differential groups at designated time points over the course of
the stud serum levels of human apo A1 Milano in the gene transfer
mice were determined by ELISA. The inventors compared efficacies of
2 different rAAV serotypes, 2 and 8, expressing the human apo A1
Milano in serum in differential groups. They were administered
intravenous at single dose (1.2.times.10e12 of each vector
genome/mouse, Table 1, FIG. 1, FIG. 2). As expected, apo A1 Milano
was not detected in the serum before injection. Serum apo A1 Milano
levels were significantly higher in rAAV8 apo A1 Milano injected
mice compared to rAAV2 apo A1 Milano injected mice but in none of
the controls. There was significant differences between serotypes,
8 and 2, at 4 weeks (71.+-.31 ng/ml vs. 31.+-.21 ng/ml), at 12
weeks (92.+-.61 ng/ml vs. 30.+-.27 ng/ml), at 24 weeks (45.+-.32
ng/ml vs. 7.6.+-.6 ng/ml) P<0.001 all groups. It was found that
rAAV8 mediated transgene resulted in apo A1 Milano serum levels
that are much higher and for a longer period in vivo than rAAV2.
Furthermore, the rAAV2-mediated transgenes expression by
intravenous and muscles injection were compared at the same dose.
(FIGS. 3, 4) In IM injected mice, apo A1 Milano protein was not
detected at week 4, 20 after vector administration, at weeks 12
post injection with maximal expression of 3.6 ng/ml in only two
mouse (two-tenth), apo A1 Milano Levels were almost similar in the
groups treated with the rAAV2 apo A1 Milano (n=10) compared to
vector control (n=10). In contrast, IV delivery resulted in a
significant increase of the level of circulating apo A1 Milano
protein. There was statistically significant difference among
AAV2apo A1 Milano IM and AAV2apo A1 Milano IV groups at designated
time point.
Example 16
Tissue Biodistribution of Transgene Expression
[0119] Because vector doses were identical among all the groups, a
comparative analysis of rAAV transducer efficacies was possible in
several organs in two serotypes. At 20 weeks after vector
administration, a single mouse was killed for each rAAV vector
group and total RNA was extracted from brain, lung, heart, liver,
spleen, kidney and muscle. The biodistribution of transgene was
performed to compare the extent of apo A1 Milano expression in the
group treated with rAAV8 (n=3) and rAAV2 (n=3) by real-time PCR.
Data showed a significantly higher level of rAAV8 mediated
transgene expression in the brain (11.85.+-.2.4 vs 0.95.+-.0,
p<0.05), heart (102.3.+-.24.20 vs 0.9.+-.0.5, p<0.001), Liver
(32.14.+-.14.56 vs 1.37.+-.0.22, p=0.05), lung (16.49.+-.10.75 vs
1.86.+-.1.8, p=0.25), spleen (5.41.+-.1.59 vs 3.39.+-.1.69, p=0.22)
and kidney (1.96.+-.0.8 vs 0.81.+-.0.18, p=0.119) with rAAV8 apo A1
Milano compared to rAAV2 apo A1 Milano (FIG. 5). This indicated
that rAAV8 treatment elicited higher widespread gene transfer in
differential tissues than rAAV2. The biodistribution of the AAV8
serotype was interesting in that it demonstrated a wide tissue
distribution. Also rAAV8 mediated more efficient apo A1 Milano
expression than rAAV2 with same titer of viral vector.
Example 17
Effect on Aortic Atherosclerosis
[0120] Atherosclerosis progression in the total aorta was
determined by Oil-Red 0 staining The mean lesion area of total
aorta in mice treated with rAAV8 apo A1 Milano by IV was
7.7.+-.0.6% (n=11), versus 13.5.+-.1.1% (n=12) in mice receiving
the rAAV8 control vector, reflecting a 42% reduction (p=0.0002)
(FIG. 6 A, B). In contrast, the mean lesion area in the mice
treated with rAAV2 apo A1 Milano by IV was 10.66.+-.0.89 (n=11),
versus 12.66.+-.0.84 (n=12) in mice receiving the rAAV2 control
vector, reflecting a 25% reduction (p=0.119). Aortic
atherosclerosis was significantly less in rAAV8 apo A1 Milano
treated mice than rAAV2 apo A1 Milano treated mice reflecting a 27%
reduction (p=0.006). Mean lesion areas were highly correlated with
plasma levels of human apo A1 Milano in mice which were treated
with rAAV8. However, in rAAV2 intramuscular group the mean lesional
area in total aorta recipient of rAAV2 apo A1 Milano vector was
significantly lower than the control vector (9.34.+-.1.01 vs
14.6.+-.2.2, N=7), reflecting a 36% reduction (p=0.04, FIG. 7).
Example 18
Effect on Innominate Artery and Aortic Sinus Atherosclerosis
[0121] The mean innominate artery lesion area (mm.sup.2) in mice
treated with rAAV8 apo A1 Milano was 4.45.+-.2.2, versus
12.44.+-.2.4 in mice receiving the control vector, reflecting a 62%
reduction (p=0.02) (FIG. 8 a); in contrast, the mean lesion area in
mice treated with rAAV2 apo A1 Milano was 8.3.+-.0.8, versus
12.34.+-.2.0 in mice receiving the control vector, reflecting a 33%
reduction (P=0.05). Compared to rAAV2 apo A1 Milano vector, rAAV8
apo A1 Milano vector reduced lesion areas by 27% (p=0.07). The mean
aortic sinus artery lesion area (mm.sup.2) in mice treated with
rAAV8 apo A1 Milano was 44.84.+-.2.3, versus 77.13.+-.9.6 in mice
receiving the control vector, reflecting a 41% reduction (p=0.01)
(FIG. 8 b); in contrast, the mean lesion area in mice treated with
rAAV2 apo A1 Milano was 57.0.+-.3.0, versus 71.6.+-.10.3 in mice
receiving the control vector, reflecting a 22% reduction (P=0.05).
Compared to rAAV2apo A1 Milano vector, rAAV8 apo A1 Milano vector
reduced lesion areas significantly by 21% (p=0.006).
Example 19
Lipid Content in Innominate Artery and Aortic Sinus Atheromatous
Plaque
[0122] The lipid content was determined by Oil-Red 0 staining. The
lipid content in innominate plaque in mice treated with rAAV8 apo
A1 Milano was 5.4.+-.1.6%, versus 14.41.+-.2.6% in mice receiving
the control vector, reflecting a 62% reduction (p=0.02) (FIG. 9 a).
In contrast, the lipid content in mice treated with rAAV2 apo A1
Milano was 16.73.+-.3.5, versus 17.84.+-.2.3 mice receiving the
control vector, reflecting a 6% reduction (P=0.78). The lipid
content in plaque area was significantly less in mice receiving
rAAV8 apo A1 Milano vector (p=0.009) compared to rAAV2apo A1 Milano
vector. Similarly, the lipid content in aortic sinus plaque in mice
treated with rAAV8 apo A1 Milano was 12.84.+-.2.3%, versus
20.33.+-.1.8% in mice receiving the control vector, reflecting a
58% reduction (p=0.03) (FIG. 9b). In contrast, the lipid content in
mice treated with rAAV2 apo A1 Milano was 15.37.+-.1.6%, versus
19.45.+-.2.3% in mice receiving the control vector, reflecting a
21% reduction (P=0.204). The lipid content in plaque area was lower
in mice receiving rAAV8 apo A1 Milano vector than rAAV2apo A1
Milano vector, reflecting a 16% reduction (p=0.2).
Example 20
Macrophage Content in Innominate Artery and Aortic Sinus
Atheromatous Plaque
[0123] The reduction in lesion size was associated with reduced
macrophage immunoreactivity. The macrophage content in innominate
plaque in mice treated with rAAV8 apo A1 Milano was reduced by 62%
compared with mice receiving the control vector (3.12.+-.1.2%,
versus 8.3.+-.1.5% (p=0.02)) (FIG. 10 A, C). In contrast, the
macrophage content in mice treated with rAAV2 apo A1 Milano was
6.86.+-.1.1%, versus 8.26.+-.2.37% in mice receiving the control
vector, reflecting a 16% reduction (P=0.78). The macrophage content
in innominate plaque area was significantly less in mice receiving
rAAV8 apo A1 Milano vector compared to rAAV2apo A1 Milano vector
(p=0.02). Similarly, the macrophage content in aortic sinus plaque
in mice treated with rAAV8 apo A1 Milano was 11.7.+-.2.5%, versus
20.9.+-.2.1% in mice receiving the control vector, reflecting a 44%
reduction (p=0.01) (FIG. 10 B, C). In contrast, the macrophage
content in mice treated with rAAV2 apo A1 Milano was 15.14.+-.3.1%,
versus 19.43.+-.2.5% in mice receiving the control vector,
reflecting a 22% reduction (P=0.2). The macrophage content in
plaque area was less in mice receiving rAAV8 apo A1 Milano vector
than rAAV2apo A1 Milano vector, reflecting a 22% reduction
(p=0.203).
Example 21
apo A1 Milano Induces a Phenotypic Switch of Macrophages from M1 to
M2
[0124] Previous studies have identified that activated macrophages
acquire a proinflammatory (M1) or anti-inflammatory (M2) phenotype
that influences atherosclerosis. In order to identify the mechanism
of apo A1 Milano that inhibits atherosclerosis progression in mouse
models, the inventors observed whether anti-inflammatory effects of
apo A1 Milano in apoE/apoA1 Milano deficient mice by focusing on
the expression proinflammatory M1 type monocyte/macrophage marker
and anti-inflammatory M2 type monocyte/macrophage marker. To test
whether the cells bear less characteristics of M1 and more
characteristics of M2 cells the inventors subjected monocyte,
macrophage as well as liver from mice treated with rAAV apo A1
Milano to real time PCR analysis using primer pairs (Table 2) for
molecules that have been used classify monocytes/macrophages into
the M1 and M2 subtypes [6, 7]. As shown in FIG. 11, the
proinflammatory M1 marker MCP-1, IL-6 as well as TNF-a were
down-regulated, however anti-inflammatory M2 marker Arg-1 and CD206
up-regelated in primary murine monocytes in mice treated with rAAV2
apo A1 Milano by IM compared to vector control (n=4). Such
anti-inflammatory phenomenon were also evident in peritoneal
macrophage and liver, it was found that mice treated with apoA1
Milano markedly reduced M1 marker MCP-1, IL-6 and TNF-a mRNA
expression and modestly increased M2 Marker Arg-1 and YM1 mRNA
expression in primary macrophages and Liver compared to vector
control (n=4) (FIGS. 12, 13, 14, 15). Mouse GAPDH was measured as a
housekeeping gene for normalization purposes. These findings
demonstrate an important role for apo A1 Milano in the regulation
of macrophage phenotypic switching in atherosclerosis.
REFERENCES
[0125] 1. Behrooz G. Sharifi, Kaijin Wu, Lai Wang, et al. AAV
serotype-dependent apolipoprotein A-1.sub.Milano gene expression.
Atherosclerosis 2005; 181: 261-269 [0126] 2. S Zolotukhin, B J
Byrne, N Muzyczka, et al. Recombinant adeno-associated virus
purification using novel methods improves infectious titer and
yield. Gene Therapy 1999; 6:973-985 [0127] 3. Lai Wang, Behrooz G.
Sharifi, Prediman K. Shah, et al. Bone marrow Transplantation Shows
Superior Atheroprotective Effects of Gene Therapy With
Apolipoprotien A-1 Milano Compared with Wild-Type Apolipoprotein
A-1 in Hyperlipidemic Mice. JACC 2006; 48:1459-1468 [0128] 4. Shah
P K, Nilsson J, Kaul S, et al. Effects of recombinant
apolipoprotein A-1 (Milano) on aortic atherosclerosis in
apolipoprotein E-deficient mice. Circulation 1998; 97:780-5. [0129]
5. Shah P K, Yano J, Reyes O et al. High-dose recombinant
apolipoprotein A-1 Milano mobilizes tissue cholesterol and rapidly
reduces plaque lipid and macrophage content in apolipoprotein
E-deficient mice; potential implications for acute plaque
stabilization. Circulation. 2001; 103:3045-50. [0130] 6. David M.
Mosser, Justin P. Edwards. Exploring the full spectrum of
macrophage activation. Nature reviews immunology 2008; 8:958-969
[0131] 7. Jamila Khallou-Laschet, Aditi Varthaman, Giulia Formasa
et al. Macrophage Plasticity in Experimental Atherosclerosis. PloS
ONE 2010; 5(1):1-10
[0132] Various embodiments of the invention are described above in
the Detailed Description. While these descriptions directly
describe the above embodiments, it is understood that those skilled
in the art may conceive modifications and/or variations to the
specific embodiments shown and described herein. Any such
modifications or variations that fall within the purview of this
description are intended to be included therein as well. Unless
specifically noted, it is the intention of the inventors that the
words and phrases in the specification and claims be given the
ordinary and accustomed meanings to those of ordinary skill in the
applicable art(s).
[0133] The foregoing description of various embodiments of the
invention known to the applicant at this time of filing the
application has been presented and is intended for the purposes of
illustration and description. The present description is not
intended to be exhaustive nor limit the invention to the precise
form disclosed and many modifications and variations are possible
in the light of the above teachings. The embodiments described
serve to explain the principles of the invention and its practical
application and to enable others skilled in the art to utilize the
invention in various embodiments and with various modifications as
are suited to the particular use contemplated. Therefore, it is
intended that the invention not be limited to the particular
embodiments disclosed for carrying out the invention.
[0134] While particular embodiments of the present invention have
been shown and described, it will be obvious to those skilled in
the art that, based upon the teachings herein, changes and
modifications may be made without departing from this invention and
its broader aspects and, therefore, the appended claims are to
encompass within their scope all such changes and modifications as
are within the true spirit and scope of this invention. It will be
understood by those within the art that, in general, terms used
herein are generally intended as "open" terms (e.g., the term
"including" should be interpreted as "including but not limited
to," the term "having" should be interpreted as "having at least,"
the term "includes" should be interpreted as "includes but is not
limited to," etc.).
Sequence CWU 1
1
18120DNAHomo sapiens 1tggatgtgct caaagacagc 20220DNAHomo sapiens
2aggccctctg tctccttttc 20320DNAMurine 3atcactgcca cccagaagac
20420DNAMurine 4cacattgggg gtaggaacac 20520DNAMurine 5tcgtagcaaa
ccaccaagtg 20620DNAMurine 6agatagcaaa tcggctgacg 20722DNAMurine
7agacaaagcc agagtccttc ag 22821DNAMurine 8taggagagca ttggaaattg g
21920DNAMurine 9cccactcacc tgctgctact 201020DNAMurine 10tctggaccca
ttccttcttg 201122DNAMurine 11ctccaagcca aagtccttag ag
221222DNAMurine 12aggagctgtc attagggaca tc 221320DNAMurine
13gggcatacct ttatcctgag 201420DNAMurine 14ccactgaagt catccatgtc
201523DNAMurine 15ggcaggatct tggcaaccta gta 231622DNAMurine
16gtttggatcg gcacacaaag tc 221720DNAMurine 17agctccaaga ccaaggtgtc
201820DNAMurine 18cgaggttttc caaggagttg 20
* * * * *