U.S. patent application number 13/812149 was filed with the patent office on 2013-05-23 for drug-ligand conjugates, synthesis thereof, and intermediates thereto.
The applicant listed for this patent is John Kane, Thomas M. Lancaster, Todd C. Zion. Invention is credited to John Kane, Thomas M. Lancaster, Todd C. Zion.
Application Number | 20130131310 13/812149 |
Document ID | / |
Family ID | 45530661 |
Filed Date | 2013-05-23 |
United States Patent
Application |
20130131310 |
Kind Code |
A1 |
Kane; John ; et al. |
May 23, 2013 |
DRUG-LIGAND CONJUGATES, SYNTHESIS THEREOF, AND INTERMEDIATES
THERETO
Abstract
The present invention relates to methods for synthesizing
compounds of formula I or pharmaceutically acceptable salts
thereof: (I) wherein each of X, Alk, and W are as defined and
described herein.
Inventors: |
Kane; John; (Salem, MA)
; Lancaster; Thomas M.; (Stoneham, MA) ; Zion;
Todd C.; (Marblehead, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Kane; John
Lancaster; Thomas M.
Zion; Todd C. |
Salem
Stoneham
Marblehead |
MA
MA
MA |
US
US
US |
|
|
Family ID: |
45530661 |
Appl. No.: |
13/812149 |
Filed: |
July 22, 2011 |
PCT Filed: |
July 22, 2011 |
PCT NO: |
PCT/US11/44961 |
371 Date: |
January 25, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61368598 |
Jul 28, 2010 |
|
|
|
61392666 |
Oct 13, 2010 |
|
|
|
Current U.S.
Class: |
530/303 ;
536/17.9; 560/180; 562/564; 562/590 |
Current CPC
Class: |
A61K 38/28 20130101;
A61K 47/549 20170801; C07K 14/62 20130101; C07C 237/12
20130101 |
Class at
Publication: |
530/303 ;
536/17.9; 560/180; 562/564; 562/590 |
International
Class: |
C07C 237/12 20060101
C07C237/12 |
Claims
1. A method for preparing a compound of formula I: ##STR00061##
wherein: each occurrence of X is independently a ligand; each
occurrence of Alk is independently a C.sub.1-C.sub.12 alkylene
chain, wherein one or more methylene units is optionally replaced
by --O-- or --S--; and W is a drug; comprising the steps of: (a)
providing a compound of formula A: ##STR00062## wherein: each
occurrence of X is independently a ligand; each occurrence of Alk
is independently a C.sub.1-C.sub.12 alkylene chain, wherein one or
more methylene units is optionally replaced by --O-- or --S--; and
LG.sup.1 is a suitable leaving group; and (b) reacting said
compound of formula A with an amine-containing drug to form a
compound of formula I.
2. A method for preparing a compound of formula II: ##STR00063##
wherein: each occurrence of X is independently a ligand; and each
occurrence of Alk is independently a C.sub.1-C.sub.12 alkylene
chain, wherein one or more methylene units is optionally replaced
by --O-- or --S--; comprising the steps of: (a) providing a
compound of formula A: ##STR00064## wherein: each occurrence of X
is independently a ligand; each occurrence of Alk is independently
a C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and LG.sup.1 is a
suitable leaving group; and (b) reacting said compound of formula A
with an insulin molecule to form a compound of formula II.
3. The method of claim 2, wherein each occurrence of X is the same
ligand.
4. The method of claim 2, wherein LG.sup.1 is --OSu.
5. The method of claim 2, wherein the compound of formula II is
selected from those depicted in FIG. 1.
6. A method for preparing a compound of formula A: ##STR00065##
wherein: each occurrence of X is independently a ligand; each
occurrence of Alk is independently a C.sub.1-C.sub.12 alkylene
chain, wherein one or more methylene units is optionally replaced
by --O-- or --S--; and LG.sup.1 is a suitable leaving group;
comprising the steps of: (a) providing a compound of formula B:
##STR00066## wherein: each occurrence of X is independently a
ligand; and each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and (b) activating
the carboxylic acid of said compound of formula B to form a
compound of formula A.
7. The method of claim 6 wherein the compound of formula B:
##STR00067## wherein: each occurrence of X is independently a
ligand; and each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; is prepared in a
method comprising the steps of: (a) providing a compound of formula
C: ##STR00068## wherein: each occurrence of X is independently a
ligand; each occurrence of Alk is independently a C.sub.2-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; PG.sup.1 is a carboxylic acid
protecting group; and (b) deprotecting the compound of formula C to
form a compound of formula B.
8. The method of claim 7 wherein the compound of formula C:
##STR00069## wherein: each occurrence of X is independently a
ligand; each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and PG.sup.1 is a carboxylic acid
protecting group; comprising the steps of: (a) providing a compound
of formula D: ##STR00070## wherein: PG.sup.1 is a carboxylic acid
protecting group; and Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; and (b) reacting the compound of formula D with an
amine-containing ligand H.sub.2N--X (E) to form a compound of
formula C.
9. The method of claim 8 wherein the compound of formula D:
##STR00071## wherein: PG.sup.1 is a carboxylic acid protecting
group; and Alk is a C.sub.1-C.sub.12 alkylene chain, wherein one or
more methylene units is optionally replaced by --O-- or --S--; is
prepared in a method comprising the steps of: (a) providing a
compound of formula F: ##STR00072## wherein: Alk.sub.1 is a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and (b) protecting
a carboxylic acid moiety of compound F to afford a compound of
formula D.
10. The method of claim 6 wherein the compound of formula A:
##STR00073## wherein: each occurrence of X is independently a
ligand; each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and LG.sup.1 is a suitable leaving
group; is prepared in a method comprising the steps of: (a)
providing a compound of formula F: ##STR00074## wherein: Alk is a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; (b) protecting a
carboxylic acid moiety of compound F to afford a compound of
formula D: ##STR00075## wherein: Alk is a C.sub.1-C.sub.12 alkylene
chain, wherein one or more methylene units is optionally replaced
by --O-- or --S--; and PG.sup.1 is a carboxylic acid protecting
group; (c) reacting the compound of formula D with an
amine-containing ligand H.sub.2N--X (E) to form a compound of
formula C: ##STR00076## wherein: each occurrence of X is
independently a ligand; each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and PG.sup.1 is a
carboxylic acid protecting group; (d) deprotecting the compound of
formula C to form a compound of formula B: ##STR00077## wherein:
each occurrence of X is independently a ligand; and each occurrence
of Alk is independently a C.sub.1-C.sub.12 alkylene chain, wherein
one or more methylene units is optionally replaced by --O-- or
--S--; and (e) activating the carboxylic acid of said compound of
formula B to form a compound of formula A.
11. The method of claim 1 wherein the compound of formula I:
##STR00078## wherein: each occurrence of X is independently a
ligand; each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and W is a drug; is prepared in a
method comprising the steps of: (a) providing a compound of formula
F: ##STR00079## wherein: Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; (b) protecting a carboxylic acid moiety of compound F to
afford a compound of formula D: ##STR00080## wherein: Alk is a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and PG.sup.1 is a
carboxylic acid protecting group; (c) reacting the compound of
formula D with an amine-containing ligand H.sub.2N--X (E) to form a
compound of formula C: ##STR00081## wherein: each occurrence of X
is independently a ligand; each occurrence of Alk is independently
a C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and PG.sup.1 is a
carboxylic acid protecting group; (d) deprotecting the compound of
formula C to form a compound of formula B: ##STR00082## wherein:
each occurrence of X is independently a ligand; and each occurrence
of Alk is independently a C.sub.1-C.sub.12 alkylene chain, wherein
one or more methylene units is optionally replaced by --O-- or
--S--; (e) activating the carboxylic acid of said compound of
formula B to form a compound of formula A: ##STR00083## wherein:
each occurrence of X is independently a ligand; each occurrence of
Alk is independently a C.sub.1-C.sub.12 alkylene chain, wherein one
or more methylene units is optionally replaced by --O-- or --S--;
and LG.sup.1 is a suitable leaving group; and (f) reacting the
compound of formula A with an amine-containing drug to form a
compound of formula I.
12. The method of claim 6 wherein the compound of formula II:
##STR00084## wherein: each occurrence of X is independently a
ligand; and each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; is prepared in a
method comprising the steps of: (a) providing a compound of formula
F: ##STR00085## wherein: Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; (b) protecting a carboxylic acid moiety of compound F to
afford a compound of formula D: ##STR00086## wherein: Alk is a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and PG.sup.1 is a
carboxylic acid protecting group; (c) reacting the compound of
formula D with an amine-containing ligand H.sub.2N--X (E) to form a
compound of formula C: ##STR00087## wherein: each occurrence of X
is independently a ligand; each occurrence of Alk is independently
a C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and PG.sup.1 is a
carboxylic acid protecting group; (d) deprotecting the compound of
formula C to form a compound of formula B: ##STR00088## wherein:
each occurrence of X is independently a ligand; and each occurrence
of Alk is independently a C.sub.1-C.sub.12 alkylene chain, wherein
one or more methylene units is optionally replaced by --O-- or
--S--; (e) activating the carboxylic acid of said compound of
formula B to form a compound of formula A: ##STR00089## wherein:
each occurrence of X is independently a ligand; each occurrence of
Alk is independently a C.sub.1-C.sub.12 alkylene chain, wherein one
or more methylene units is optionally replaced by --O-- or --S--;
and LG.sup.1 is a suitable leaving group; and (f) reacting the
compound of formula A with an insulin molecule to form a compound
of formula II.
13. A compound of formula F: ##STR00090## wherein: Alk is a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
groups may be substituted by --O-- or --S--; a compound of formula
D: ##STR00091## wherein: Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene groups may be substituted by --O-- or
--S--; and PG.sup.1 is a carboxylic acid protecting group; a
compound of formula C: ##STR00092## wherein: each occurrence of X
is independently a ligand; each occurrence of Alk is independently
a C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
groups may be substituted by --O-- or --S--; and PG.sup.1 is a
carboxylic acid protecting group; a compound of formula B:
##STR00093## wherein: each occurrence of X is independently a
ligand; and each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
groups may be substituted by --O-- or --S--; a compound of formula
B: ##STR00094## wherein: each occurrence of X is independently a
ligand; and each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
groups may be substituted by --O-- or --S--; or a compound of
formula A: ##STR00095## wherein: each occurrence of X is
independently a ligand; each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
groups may be substituted by --O-- or --S--; and LG.sup.1 is a
suitable leaving group.
14. A compound of formula ##STR00096## ##STR00097##
15-23. (canceled)
Description
BACKGROUND OF THE INVENTION
[0001] International Application No. PCT/US2010/22268 describes
conjugate-based systems, methods for their preparation, and use of
these conjugates, e.g., as therapeutics. Alternative synthetic
methods for drug-ligand conjugates are desired.
SUMMARY OF THE INVENTION
[0002] As described herein, the present invention provides methods
for preparing drug-ligand conjugates capable of controlling the
pharmacokinetic (PK) and/or pharmacodynamic (PD) profiles of a drug
such as insulin in a manner that is responsive to the systemic
concentrations of a saccharide such as glucose. Such conjugates
include those of formula I:
##STR00001## [0003] or a pharmaceutically acceptable salt thereof,
wherein: [0004] each occurrence of X is independently a ligand;
[0005] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0006] W is a drug.
[0007] The present invention also provides synthetic intermediates
useful for preparing such conjugates. In certain embodiments, an
exemplary useful intermediate in the preparation of a drug-ligand
conjugate is a compound of formula A:
##STR00002##
wherein X, Alk, and LG.sup.1 are as defined and described in
embodiments herein.
[0008] The present invention also provides methods for preparing
conjugates that include a detectable label instead of a drug as
W.
DEFINITIONS
[0009] Definitions of specific functional groups, chemical terms,
and general terms used throughout the specification are described
in more detail below. For purposes of this invention, the chemical
elements are identified in accordance with the Periodic Table of
the Elements, CAS version, Handbook of Chemistry and Physics,
75.sup.th Ed., inside cover, and specific functional groups are
generally defined as described therein. Additionally, general
principles of organic chemistry, as well as specific functional
moieties and reactivity, are described in Organic Chemistry, Thomas
Sorrell, University Science Books, Sausalito, 1999; Smith and March
March's Advanced Organic Chemistry, 5.sup.th Edition, John Wiley
& Sons, Inc., New York, 2001; Larock, Comprehensive Organic
Transformations, VCH Publishers, Inc., New York, 1989; Carruthers,
Some Modern Methods of Organic Synthesis, 3.sup.rd Edition,
Cambridge University Press, Cambridge, 1987.
[0010] Acyl--As used herein, the term "acyl," refers to a group
having the general formula --C(.dbd.O)R.sup.X1,
--C(.dbd.O)OR.sup.X1, --C(.dbd.O)--O--C(.dbd.O)R.sup.X1,
--C(.dbd.O)SR.sup.X1, --C(.dbd.O)N(R.sup.X1).sub.2,
--C(.dbd.S)R.sup.X1, --C(.dbd.S)N(R.sup.X1).sub.2, and
--C(.dbd.S)S(R.sup.X1), --C(.dbd.NR.sup.X1)R.sup.X1,
--C(.dbd.NR.sup.X1)OR.sup.X1, --C(.dbd.NR.sup.X1)SR.sup.X1, and
--C(.dbd.NR.sup.X1)N(R.sup.X1).sub.2, wherein R.sup.X1 is hydrogen;
halogen; substituted or unsubstituted hydroxyl; substituted or
unsubstituted thiol; substituted or unsubstituted amino;
substituted or unsubstituted acyl; cyclic or acyclic, substituted
or unsubstituted, branched or unbranched aliphatic; cyclic or
acyclic, substituted or unsubstituted, branched or unbranched
heteroaliphatic; cyclic or acyclic, substituted or unsubstituted,
branched or unbranched alkyl; cyclic or acyclic, substituted or
unsubstituted, branched or unbranched alkenyl; substituted or
unsubstituted alkynyl, substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy,
heteroaryloxy, aliphaticthioxy, heteroaliphaticthioxy, alkylthioxy,
heteroalkylthioxy, arylthioxy, heteroarylthioxy, mono- or
di-aliphaticamino, mono- or di-heteroaliphaticamino, mono- or
di-alkylamino, mono- or di-heteroalkylamino, mono- or di-arylamino,
or mono- or di-heteroarylamino; or two R.sup.X1 groups taken
together form a 5- to 6-membered heterocyclic ring. Exemplary acyl
groups include aldehydes (--CHO), carboxylic acids (--CO.sub.2H),
ketones, acyl halides, esters, amides, imines, carbonates,
carbamates, and ureas. Acyl substituents include, but are not
limited to, any of the substituents described herein, that result
in the formation of a stable moiety (e.g., aliphatic, alkyl,
alkenyl, alkynyl, heteroaliphatic, heterocyclic, aryl, heteroaryl,
acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo, aliphaticamino, heteroaliphaticamino,
alkylamino, heteroalkylamino, arylamino, heteroarylamino,
alkylaryl, arylalkyl, aliphaticoxy, heteroaliphaticoxy, alkyloxy,
heteroalkyloxy, aryloxy, heteroaryloxy, aliphaticthioxy,
heteroaliphaticthioxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and the like, each of which may or may
not be further substituted).
[0011] Aliphatic--As used herein, the term "aliphatic" or
"aliphatic group" denotes an optionally substituted hydrocarbon
moiety that may be straight-chain (i.e., unbranched), branched, or
cyclic ("carbocyclic") and may be completely saturated or may
contain one or more units of unsaturation, but which is not
aromatic. Unless otherwise specified, aliphatic groups contain 1-12
carbon atoms. In some embodiments, aliphatic groups contain 1-6
carbon atoms. In some embodiments, aliphatic groups contain 1-4
carbon atoms, and in yet other embodiments aliphatic groups contain
1-3 carbon atoms. Suitable aliphatic groups include, but are not
limited to, linear or branched, alkyl, alkenyl, and alkynyl groups,
and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl
or (cycloalkyl)alkenyl.
[0012] Alkenyl--As used herein, the term "alkenyl" denotes an
optionally substituted monovalent group derived from a straight- or
branched-chain aliphatic moiety having at least one carbon-carbon
double bond by the removal of a single hydrogen atom. In certain
embodiments, the alkenyl group employed in the invention contains
2-6 carbon atoms. In certain embodiments, the alkenyl group
employed in the invention contains 2-5 carbon atoms. In some
embodiments, the alkenyl group employed in the invention contains
2-4 carbon atoms. In another embodiment, the alkenyl group employed
contains 2-3 carbon atoms. Alkenyl groups include, for example,
ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, and the
like.
[0013] Alkyl--As used herein, the term "alkyl" refers to optionally
substituted saturated, straight- or branched-chain hydrocarbon
radicals derived from an aliphatic moiety containing between 1-6
carbon atoms by removal of a single hydrogen atom. In some
embodiments, the alkyl group employed in the invention contains 1-5
carbon atoms. In another embodiment, the alkyl group employed
contains 1-4 carbon atoms. In still other embodiments, the alkyl
group contains 1-3 carbon atoms. In yet another embodiment, the
alkyl group contains 1-2 carbons. Examples of alkyl radicals
include, but are not limited to, methyl, ethyl, n-propyl,
isopropyl, n-butyl, iso-butyl, sec-butyl, sec-pentyl, iso-pentyl,
tert-butyl, n-pentyl, neopentyl, n-hexyl, sec-hexyl, n-heptyl,
n-octyl, n-decyl, n-undecyl, dodecyl, and the like.
[0014] Alkynyl--As used herein, the term "alkynyl" refers to an
optionally substituted monovalent group derived from a straight- or
branched-chain aliphatic moiety having at least one carbon-carbon
triple bond by the removal of a single hydrogen atom. In certain
embodiments, the alkynyl group employed in the invention contains
2-6 carbon atoms. In certain embodiments, the alkynyl group
employed in the invention contains 2-5 carbon atoms. In some
embodiments, the alkynyl group employed in the invention contains
2-4 carbon atoms. In another embodiment, the alkynyl group employed
contains 2-3 carbon atoms. Representative alkynyl groups include,
but are not limited to, ethynyl, 2-propynyl (propargyl),
1-propynyl, and the like.
[0015] Aryl--As used herein, the term "aryl" used alone or as part
of a larger moiety as in "aralkyl", "aralkoxy", or "aryloxyalkyl",
refers to an optionally substituted monocyclic and bicyclic ring
systems having a total of five to 10 ring members, wherein at least
one ring in the system is aromatic and wherein each ring in the
system contains three to seven ring members. The term "aryl" may be
used interchangeably with the term "aryl ring". In certain
embodiments of the present invention, "aryl" refers to an aromatic
ring system which includes, but not limited to, phenyl, biphenyl,
naphthyl, anthracyl and the like, which may bear one or more
substituents.
[0016] Arylalkyl--As used herein, the term "arylalkyl" refers to an
alkyl group substituted with an aryl group (e.g., an aromatic or
heteroaromatic group).
[0017] Alkylene chain--As used herein, the term "alkylene chain"
(also referred to as simply "alkylene") is a polymethylene group,
i.e., --(CH.sub.2).sub.z--, wherein z is a positive integer from 1
to 30, from 1 to 20, from 1 to 12, from 1 to 8, from 1 to 6, from 1
to 4, from 1 to 3, from 1 to 2, from 2 to 30, from 2 to 20, from 2
to 10, from 2 to 8, from 2 to 6, from 2 to 4, or from 2 to 3. A
substituted bivalent hydrocarbon chain is a polymethylene group in
which one or more methylene hydrogen atoms are replaced with a
substituent. Suitable substituents include those described below
for a substituted aliphatic group. A methylene unit --CH.sub.2--
may also be optionally replaced by other bivalent groups, such as
--O--, --S--, --NH--, --NHC(O)--, --C(O)NH--, --C(O)--, --S(O)--,
--S(O).sub.2--, and the like.
[0018] Carbonyl--As used herein, the term "carbonyl" refers to a
monovalent or bivalent moiety containing a carbon-oxygen double
bond. Non-limiting examples of carbonyl groups include aldehydes,
ketones, carboxylic acids, ester, amide, enones, acyl halides,
anhydrides, ureas, carbamates, carbonates, thioesters, lactones,
lactams, hydroxamates, isocyanates, and chloroformates.
[0019] Cycloaliphatic--As used herein, the terms "cycloaliphatic",
"carbocycle", or "carbocyclic", used alone or as part of a larger
moiety, refer to an optionally substituted saturated or partially
unsaturated cyclic aliphatic monocyclic or bicyclic ring systems,
as described herein, having from 3 to 10 members. Cycloaliphatic
groups include, without limitation, cyclopropyl, cyclobutyl,
cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl,
cycloheptenyl, cyclooctyl, cyclooctenyl, and cyclooctadienyl. In
some embodiments, the cycloalkyl has 3-6 carbons.
[0020] Halogen--As used herein, the terms "halo" and "halogen"
refer to an atom selected from fluorine (fluoro, --F), chlorine
(chloro, --Cl), bromine (bromo, --Br), and iodine (iodo, --I).
[0021] Heteroaliphatic--As used herein, the terms "heteroaliphatic"
or "heteroaliphatic group", denote an optionally substituted
hydrocarbon moiety having, in addition to carbon atoms, from one to
five heteroatoms, that may be straight-chain (i.e., unbranched),
branched, or cyclic ("heterocyclic") and may be completely
saturated or may contain one or more units of unsaturation, but
which is not aromatic. Unless otherwise specified, heteroaliphatic
groups contain 1-6 carbon atoms wherein 1-3 carbon atoms are
optionally and independently replaced with heteroatoms selected
from oxygen, nitrogen and sulfur. In some embodiments,
heteroaliphatic groups contain 1-4 carbon atoms, wherein 1-2 carbon
atoms are optionally and independently replaced with heteroatoms
selected from oxygen, nitrogen and sulfur. In yet other
embodiments, heteroaliphatic groups contain 1-3 carbon atoms,
wherein 1 carbon atom is optionally and independently replaced with
a heteroatom selected from oxygen, nitrogen and sulfur. Suitable
heteroaliphatic groups include, but are not limited to, linear or
branched, heteroalkyl, heteroalkenyl, and heteroalkynyl groups.
[0022] Heteroaralkyl--As used herein, the term "heteroaralkyl"
refers to an alkyl group substituted by a heteroaryl, wherein the
alkyl and heteroaryl portions independently are optionally
substituted.
[0023] Heteroaryl--As used herein, the term "heteroaryl" used alone
or as part of a larger moiety, e.g., "heteroaralkyl", or
"heteroaralkoxy", refers to an optionally substituted group having
5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10,
or 14.pi. electrons shared in a cyclic array; and having, in
addition to carbon atoms, from one to five heteroatoms. Heteroaryl
groups include, without limitation, thienyl, furanyl, pyrrolyl,
imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl,
oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl,
pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl,
naphthyridinyl, and pteridinyl. The terms "heteroaryl" and
"heteroar-", as used herein, also include groups in which a
heteroaromatic ring is fused to one or more aryl, carbocyclic, or
heterocyclic rings, where the radical or point of attachment is on
the heteroaromatic ring. Non limiting examples include indolyl,
isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl,
benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl,
phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl,
carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl,
tetrahydroquinolinyl, and tetrahydroisoquinolinyl. A heteroaryl
group may be mono- or bicyclic. The term "heteroaryl" may be used
interchangeably with the terms "heteroaryl ring", "heteroaryl
group", or "heteroaromatic", any of which terms include rings that
are optionally substituted.
[0024] Heteroatom--As used herein, the term "heteroatom" refers to
nitrogen, oxygen, or sulfur, and includes any oxidized form of
nitrogen or sulfur, and any quaternized form of a basic nitrogen.
The term "nitrogen" also includes a substituted nitrogen.
[0025] Heterocyclic--As used herein, the terms "heterocycle",
"heterocyclyl", "heterocyclic radical", and "heterocyclic ring" are
used interchangeably and refer to a stable optionally substituted
5- to 7-membered monocyclic or 7- to 10-membered bicyclic
heterocyclic moiety that is either saturated or partially
unsaturated, and having, in addition to carbon atoms, one or more
heteroatoms, as defined above. A heterocyclic ring can be attached
to its pendant group at any heteroatom or carbon atom that results
in a stable structure and any of the ring atoms can be optionally
substituted. Examples of such saturated or partially unsaturated
heterocyclic radicals include, without limitation,
tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, pyrrolidonyl,
piperidinyl, pyrrolinyl, tetrahydroquinolinyl,
tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl,
piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl,
thiazepinyl, morpholinyl, and quinuclidinyl. The terms
"heterocycle", "heterocyclyl", "heterocyclyl ring", "heterocyclic
group", "heterocyclic moiety", and "heterocyclic radical", are used
interchangeably herein, and also include groups in which a
heterocyclyl ring is fused to one or more aryl, heteroaryl, or
carbocyclic rings, such as indolinyl, 3H-indolyl, chromanyl,
phenanthridinyl, or tetrahydroquinolinyl, where the radical or
point of attachment is on the heterocyclyl ring. A heterocyclyl
group may be mono- or bicyclic. The term "heterocyclylalkyl" refers
to an alkyl group substituted by a heterocyclyl, wherein the alkyl
and heterocyclyl portions independently are optionally
substituted.
[0026] Unsaturated--As used herein, the term "unsaturated", means
that a moiety has one or more double or triple bonds.
[0027] Partially unsaturated--As used herein, the term "partially
unsaturated" refers to a ring moiety that includes at least one
double or triple bond. The term "partially unsaturated" is intended
to encompass rings having multiple sites of unsaturation, but is
not intended to include aryl or heteroaryl moieties, as herein
defined.
[0028] Optionally substituted--As described herein, compounds of
the invention may contain "optionally substituted" moieties. In
general, the term "substituted", whether preceded by the term
"optionally" or not, means that one or more hydrogens of the
designated moiety are replaced with a suitable substituent. Unless
otherwise indicated, an "optionally substituted" group may have a
suitable substituent at each substitutable position of the group,
and when more than one position in any given structure may be
substituted with more than one substituent selected from a
specified group, the substituent may be either the same or
different at every position. Combinations of substituents
envisioned by this invention are preferably those that result in
the formation of stable or chemically feasible compounds. The term
"stable", as used herein, refers to compounds that are not
substantially altered when subjected to conditions to allow for
their production, detection, and, in certain embodiments, their
recovery, purification, and use for one or more of the purposes
disclosed herein.
[0029] Suitable monovalent substituents on a substitutable carbon
atom of an "optionally substituted" group are independently
halogen; --(CH.sub.2).sub.0-4R.sup.o; --(CH.sub.2).sub.0-4OR.sup.o;
--O--(CH.sub.2).sub.0-4C(O)OR.sup.o;
--(CH.sub.2).sub.0-4CH(OR.sup.o).sub.2;
--(CH.sub.2).sub.0-4SR.sup.o; --(CH.sub.2).sub.0-4Ph, which may be
substituted with R.sup.o;
--(CH.sub.2).sub.0-4--O--(CH.sub.2).sub.0-1Ph which may be
substituted with R.sup.o; --CH.dbd.CHPh, which may be substituted
with R.sup.o; --NO.sub.2; --CN; --N.sub.3;
--(CH.sub.2).sub.0-4N(R.sup.o).sub.2;
--(CH.sub.2).sub.0-4N(R.sup.o)C(O)R; --N(R.sup.o)C(S)R.sup.o;
--(CH.sub.2).sub.0-4N(R.sup.o)C(O)NR.sup.o.sub.2;
--N(R.sup.o)C(S)NR.sup.o.sub.2;
--(CH.sub.2).sub.0-4N(R.sup.o)C(O)OR.sup.o;
--N(R.sup.o)N(R.sup.o)C(O)R.sup.o; --N(R--)N(R.sup.o)C(O)NR.sup.2;
--N(R.sup.o)N(R.sup.o)C(O)OR.sup.o;
--(CH.sub.2).sub.0-4C(O)R.sup.o; --C(S)R.sup.o;
--(CH.sub.2).sub.0-4C(O)OR.sup.o; --(CH.sub.2).sub.0-4C(O)SR.sup.o;
--(CH.sub.2).sub.0-4C(O)OSiR.sup.o.sub.3;
--(CH.sub.2).sub.0-4OC(O)R.sup.o; --OC(O)(CH.sub.2).sub.0-4SR--,
SC(S)SR.sup.o; --(CH.sub.2).sub.0-4SC(O)R.sup.o;
--(CH.sub.2).sub.0-4C(O)NR.sup.o.sub.2; --C(S)NR.sup.o.sub.2;
--C(S)SR.sup.o; --SC(S)SR.sup.o,
--(CH.sub.2).sub.0-4OC(O)NR.sup.o.sub.2; --C(O)N(OR)R.sup.o;
--C(O)C(O)R.sup.o; --C(O)CH.sub.2C(O)R; --C(NOR.sup.o)R.sup.o;
--(CH.sub.2).sub.0-4SSR; --(CH.sub.2).sub.0-4S(O).sub.2R.sup.o;
--(CH.sub.2).sub.0-4S(O).sub.2OR.sup.o;
--(CH.sub.2).sub.0-4OS(O).sub.2R.sup.o; --S(O).sub.2NR.sup.o.sub.2;
--(CH.sub.2)-4S(O)R.sup.o; --N(R.sup.o)S(O).sub.2NR.sup.o.sub.2;
--N(R.sup.o)S(O).sub.2R.sup.o; --N(OR.sup.o)R.sup.o;
--C(NH)NR.sup.o.sub.2; --P(O).sub.2R.sup.o; --P(O)R.sup.o.sub.2;
--OP(O)R.sup.o.sub.2; --OP(O)(OR.sup.o).sub.2; SiR.sup.o.sub.3;
--(C.sub.1-4 straight or branched alkylene)O--N(R.sup.o).sub.2; or
--(C.sub.1-4 straight or branched alkylene)C(O)O--N(R.sup.o).sub.2,
wherein each R.sup.o may be substituted as defined below and is
independently hydrogen, C.sub.1-6 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur, or, notwithstanding the
definition above, two independent occurrences of R.sup.o, taken
together with their intervening atom(s), form a 3-12-membered
saturated, partially unsaturated, or aryl mono- or bicyclic ring
having 0-4 heteroatoms independently selected from nitrogen,
oxygen, or sulfur, which may be substituted as defined below.
[0030] Suitable monovalent substituents on R.sup.o (or the ring
formed by taking two independent occurrences of R.sup.o together
with their intervening atoms), are independently halogen,
--(CH.sub.2).sub.0-2R.sup..cndot., -(haloR.sup..cndot.),
--(CH.sub.2).sub.0-2OH, --(CH.sub.2).sub.0-2OR.sup..cndot.,
--(CH.sub.2).sub.0-2CH(OR.sup..cndot.).sub.2;
--O(haloR.sup..cndot.), --CN, --N.sub.3,
--(CH.sub.2).sub.0-2C(O)R.sup..cndot., --(CH.sub.2).sub.0-2C(O)OH,
--(CH.sub.2).sub.0-2C(O)OR.sup..cndot.,
--(CH.sub.2).sub.0-2SR.sup..cndot., --(CH.sub.2).sub.0-2SH,
--(CH.sub.2).sub.0-2NH.sub.2, --(CH.sub.2).sub.0-2NHR.sup..cndot.,
--(CH.sub.2).sub.0-2NR.sup..cndot..sub.2, --NO.sub.2,
--SiR.sup..cndot..sub.3, --OSiR.sup..cndot..sub.3,
--C(O)SR.sup..cndot., --(C.sub.1-4 straight or branched
alkylene)C(O)OR.sup..cndot., or --SSR.sup..cndot. wherein each
R.sup..cndot. is unsubstituted or where preceded by "halo" is
substituted only with one or more halogens, and is independently
selected from C.sub.1-4 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. Suitable divalent
substituents on a saturated carbon atom of R.sup.o include .dbd.O
and .dbd.S.
[0031] Suitable divalent substituents on a saturated carbon atom of
an "optionally substituted" group include the following: .dbd.O,
.dbd.S, .dbd.NNR*.sub.2, .dbd.NNHC(O)R*, .dbd.NNHC(O)OR*,
.dbd.NNHS(O).sub.2R*, .dbd.NR*, .dbd.NOR*,
--O(C(R*.sub.2)).sub.2-3O--, or --S(C(R*.sub.2)).sub.2-3S--,
wherein each independent occurrence of R* is selected from
hydrogen, C.sub.1-6 aliphatic which may be substituted as defined
below, or an unsubstituted 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur. Suitable divalent
substituents that are bound to vicinal substitutable carbons of an
"optionally substituted" group include: --O(CR*.sub.2).sub.2-3O--,
wherein each independent occurrence of R* is selected from
hydrogen, C.sub.1-6 aliphatic which may be substituted as defined
below, or an unsubstituted 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0032] Suitable substituents on the aliphatic group of R* include
halogen, --R.sup..cndot., -(haloR.sup..cndot.), --OH,
--OR.sup..cndot., --O(haloR.sup..cndot.), --CN, --C(O)OH,
--C(O)OR.sup..cndot., --NH.sub.2, --NHR.sup..cndot.,
--NR.sup..cndot..sub.2, or --NO.sub.2, wherein each R.sup..cndot.
is unsubstituted or where preceded by "halo" is substituted only
with one or more halogens, and is independently C.sub.1-4
aliphatic, --CH.sub.2Ph, --O(CH.sub.2).sub.0-1Ph, or a 5-6-membered
saturated, partially unsaturated, or aryl ring having 0-4
heteroatoms independently selected from nitrogen, oxygen, or
sulfur.
[0033] Suitable substituents on a substitutable nitrogen of an
"optionally substituted" group include --R.sup..dagger.,
--NR.sup..dagger..sub.2, --C(O)R.sup..dagger.,
--C(O)OR.sup..dagger., --C(O)C(O)R.sup..dagger.,
--C(O)CH.sub.2C(O)R.sup..dagger., --S(O).sub.2R.sup..dagger.,
--S(O).sub.2NR.sup..dagger..sub.2, --C(S)NR.sup..dagger..sub.2,
--C(NH)NR.sup..dagger..sub.2, or
--N(R.sup..dagger.)S(O).sub.2R.sup..dagger.; wherein each
R.sup..dagger. is independently hydrogen, C.sub.1-6 aliphatic which
may be substituted as defined below, unsubstituted --OPh, or an
unsubstituted 5-6-membered saturated, partially unsaturated, or
aryl ring having 0-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur, or, notwithstanding the definition
above, two independent occurrences of R.sup..dagger., taken
together with their intervening atom(s) form an unsubstituted
3-12-membered saturated, partially unsaturated, or aryl mono- or
bicyclic ring having 0-4 heteroatoms independently selected from
nitrogen, oxygen, or sulfur.
[0034] Suitable substituents on the aliphatic group of
R.sup..dagger. are independently halogen, --R.sup..dagger.,
-(haloR.sup..dagger.), --OH, --OR.sup..dagger.,
--O(haloR.sup..dagger.), --CN, --C(O)OH, --C(O)OR.sup..dagger.,
--NH.sub.2, --NHR.sup..dagger., --NR.sup..dagger..sub.2, or
--NO.sub.2, wherein each R.sup..dagger. is unsubstituted or where
preceded by "halo" is substituted only with one or more halogens,
and is independently C.sub.1-4 aliphatic, --CH.sub.2Ph,
--O(CH.sub.2).sub.0-1Ph, or a 5-6-membered saturated, partially
unsaturated, or aryl ring having 0-4 heteroatoms independently
selected from nitrogen, oxygen, or sulfur.
[0035] Suitable protecting group--As used herein, the term
"suitable protecting group," refers to carboxylic acid protecting
groups and includes those described in detail in Protecting Groups
in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3.sup.rd
edition, John Wiley & Sons, 1999.
[0036] Suitable carboxylic acid protecting groups include silyl-,
alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids.
Examples of suitable silyl groups include trimethylsilyl,
triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl,
triisopropylsilyl, and the like. Examples of suitable alkyl groups
include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl,
trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl
groups include allyl. Examples of suitable aryl groups include
optionally substituted phenyl, biphenyl, or naphthyl. Examples of
suitable arylalkyl groups include optionally substituted benzyl
(e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl,
p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl),
and 2- and 4-picolyl.
[0037] In any case where a chemical variable (e.g., an R group) is
shown attached to a bond that crosses a bond of ring, this means
that one or more such variables are optionally attached to the ring
having the crossed bond. Each R group on such a ring can be
attached at any suitable position, this is generally understood to
mean that the group is attached in place of a hydrogen atom on the
parent ring. This includes the possibility that two R groups can be
attached to the same ring atom. Furthermore, when more than one R
group is present on a ring, each may be the same or different than
other R groups attached thereto, and each group is defined
independently of other groups that may be attached elsewhere on the
same molecule, even though they may be represented by the same
identifier.
[0038] Biomolecule--As used herein, the term "biomolecule" refers
to molecules (e.g., polypeptides, amino acids, polynucleotides,
nucleotides, polysaccharides, sugars, lipids, nucleoproteins,
glycoproteins, lipoproteins, steroids, metabolites, etc.) whether
naturally-occurring or artificially created (e.g., by synthetic or
recombinant methods) that are commonly found in cells and tissues.
Specific classes of biomolecules include, but are not limited to,
enzymes, receptors, neurotransmitters, hormones, cytokines, cell
response modifiers such as growth factors and chemotactic factors,
antibodies, vaccines, haptens, toxins, interferons, ribozymes,
anti-sense agents, plasmids, DNA, and RNA.
[0039] Drug--As used herein, the term "drug" refers to small
molecules or biomolecules that alter, inhibit, activate, or
otherwise affect a biological event. For example, drugs may
include, but are not limited to, anti-AIDS substances, anti-cancer
substances, antibiotics, anti-diabetic substances,
immunosuppressants, anti-viral substances, enzyme inhibitors,
neurotoxins, opioids, hypnotics, anti-histamines, lubricants,
tranquilizers, anti-convulsants, muscle relaxants and
anti-Parkinson substances, anti-spasmodics and muscle contractants
including channel blockers, miotics and anti-cholinergics,
anti-glaucoma compounds, anti-parasite and/or anti-protozoal
compounds, modulators of cell-extracellular matrix interactions
including cell growth inhibitors and anti-adhesion molecules,
vasodilating agents, inhibitors of DNA, RNA or protein synthesis,
anti-hypertensives, analgesics, anti-pyretics, steroidal and
non-steroidal anti-inflammatory agents, anti-angiogenic factors,
anti-secretory factors, anticoagulants and/or anti-thrombotic
agents, local anesthetics, ophthalmics, prostaglandins,
anti-depressants, anti-psychotic substances, anti-emetics, and
imaging agents. A more complete listing of exemplary drugs suitable
for use in the present invention may be found in "Pharmaceutical
Substances: Syntheses, Patents, Applications" by Axel Kleemann and
Jurgen Engel, Thieme Medical Publishing, 1999; the "Merck Index: An
Encyclopedia of Chemicals, Drugs, and Biologicals", edited by Susan
Budavari et al., CRC Press, 1996, and the United States
Pharmacopeia-25/National Formulary-20, published by the United
States Pharmcopeial Convention, Inc., Rockville Md., 2001.
[0040] Exogenous--As used herein, an "exogenous" molecule is one
which is not present at significant levels in a patient unless
administered to the patient. In certain embodiments the patient is
a mammal, e.g., a human, a dog, a cat, a rat, a minipig, etc. As
used herein, a molecule is not present at significant levels in a
patient if normal serum for that type of patient includes less than
0.1 mM of the molecule. In certain embodiments normal serum for the
patient may include less than 0.08 mM, less than 0.06 mM, or less
than 0.04 mM of the molecule.
[0041] Normal serum--As used herein, "normal serum" is serum
obtained by pooling approximately equal amounts of the liquid
portion of coagulated whole blood from five or more non-diabetic
patients. A non-diabetic human patient is a randomly selected 18-30
year old who presents with no diabetic symptoms at the time blood
is drawn.
[0042] Polymer--As used herein, a "polymer" or "polymeric
structure" is a structure that includes a string of covalently
bound monomers. A polymer can be made from one type of monomer or
more than one type of monomer. The term "polymer" therefore
encompasses copolymers, including block-copolymers in which
different types of monomer are grouped separately within the
overall polymer. A polymer can be linear or branched.
[0043] Polynucleotide--As used herein, a "polynucleotide" is a
polymer of nucleotides. The terms "polynucleotide", "nucleic acid",
and "oligonucleotide" may be used interchangeably. The polymer may
include natural nucleosides (i.e., adenosine, thymidine, guanosine,
cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine,
and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine,
2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine,
5-methylcytidine, C5-bromouridine, C5-fluorouridine,
C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine,
C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine,
8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine,
4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, dihydrouridine,
methylpseudouridine, 1-methyl adenosine, 1-methyl guanosine,
N6-methyl adenosine, and 2-thiocytidine), chemically modified
bases, biologically modified bases (e.g., methylated bases),
intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, 2'-O-methylcytidine, arabinose, and hexose), or
modified phosphate groups (e.g., phosphorothioates and
5'-N-phosphoramidite linkages).
[0044] Polypeptide--As used herein, a "polypeptide" is a polymer of
amino acids. The terms "polypeptide", "protein", "oligopeptide",
and "peptide" may be used interchangeably. Polypeptides may contain
natural amino acids, non-natural amino acids (i.e., compounds that
do not occur in nature but that can be incorporated into a
polypeptide chain) and/or amino acid analogs as are known in the
art. Also, one or more of the amino acid residues in a polypeptide
may be modified, for example, by the addition of a chemical entity
such as a carbohydrate group, a phosphate group, a farnesyl group,
an isofarnesyl group, a fatty acid group, a linker for conjugation,
functionalization, or other modification, etc. These modifications
may include cyclization of the peptide, the incorporation of
D-amino acids, etc.
[0045] Polysaccharide--As used herein, a "polysaccharide" is a
polymer of saccharides. The terms "polysaccharide", "carbohydrate",
and "oligosaccharide", may be used interchangeably. The polymer may
include natural saccharides (e.g., arabinose, lyxose, ribose,
xylose, ribulose, xylulose, allose, altrose, galactose, glucose,
gulose, idose, mannose, talose, fructose, psicose, sorbose,
tagatose, mannoheptulose, sedoheptulose, octolose, and sialose)
and/or modified saccharides (e.g., 2'-fluororibose, 2'-deoxyribose,
and hexose). Exemplary disaccharides include sucrose, lactose,
maltose, trehalose, gentiobiose, isomaltose, kojibiose,
laminaribiose, mannobiose, melibiose, nigerose, rutinose, and
xylobiose.
[0046] Small molecule--As used herein, the term "small molecule"
refers to molecules, whether naturally-occurring or artificially
created (e.g., via chemical synthesis), that have a relatively low
molecular weight. Typically, small molecules are monomeric and have
a molecular weight of less than about 1500 Da. Preferred small
molecules are biologically active in that they produce a local or
systemic effect in animals, preferably mammals, more preferably
humans. In certain preferred embodiments, the small molecule is a
drug. Preferably, though not necessarily, the drug is one that has
already been deemed safe and effective for use by the appropriate
governmental agency or body. For example, drugs for human use
listed by the FDA under 21 C.F.R. .sctn..sctn.330.5, 331 through
361, and 440 through 460; drugs for veterinary use listed by the
FDA under 21 C.F.R. .sctn..sctn.500 through 589, are all considered
acceptable for use in accordance with the present invention.
[0047] Treat--As used herein, the term "treat" (or "treating",
"treated", "treatment", etc.) refers to the administration of a
conjugate of the present disclosure to a subject in need thereof
with the purpose to alleviate, relieve, alter, ameliorate, improve
or affect a condition (e.g., diabetes), a symptom or symptoms of a
condition (e.g., hyperglycemia), or the predisposition toward a
condition.
BRIEF DESCRIPTION OF THE DRAWINGS
[0048] FIG. 1: Structures of exemplary insulin-conjugates. As
described in the Examples, these conjugates were each prepared with
recombinant wild-type human insulin (see below for the structure of
wild-type human insulin). The symbol "insulin" inside an oval as
shown in FIG. 1 is therefore primarily intended to represent a
wild-type human insulin. As discussed herein, it is to be
understood that the present disclosure also encompasses inter alia
versions of these and other conjugates that include an insulin
molecule other than wild-type human insulin.
[0049] FIG. 2: Plot of serum insulin and blood glucose levels
following subcutaneous injection in non-diabetic, male SD rats
(n=3) at time 0 with TSPE-AEM-3 conjugate II-1 followed by IP
injection of alpha-methyl mannose (left) or saline (right) after 15
minutes. Alpha-methyl mannose is a very high affinity saccharide
which is capable of competing with AEM for binding to lectins such
as Con A. As shown, the change in PK/PD profile that results from
injection of alpha-methyl mannose is significant (p<0.05).
[0050] FIG. 3: Plot of serum insulin and blood glucose levels
following subcutaneous injection in non-diabetic, male SD rats
(n=3) at time 0 with TSPE-AETM-3 conjugate II-2 followed by IP
injection of alpha-methyl mannose (left) or saline (right) after 15
minutes. Alpha-methyl mannose is a very high affinity saccharide
which is capable of competing with AEM for binding to lectins such
as Con A. As shown, the change in PK/PD profile that results from
injection of alpha-methyl mannose is significant (p<0.05).
[0051] FIG. 4: Plot of serum insulin (.diamond-solid.) and blood
glucose (.largecircle.) levels following subcutaneous injection in
non-diabetic, male SD rats (n=3 per dose) at time 0 with
long-acting conjugate formulations followed by IP injection of
glucose (4 g/kg) at 240 minutes. The conjugates are TSPE-AEM-3
(II-1) and TSPE-AETM-3 (II-2).
[0052] FIG. 5: Composition of exemplary insulin conjugates
conjugated at the B29 position. The schematic in FIG. 5 is
primarily intended to represent a wild-type human insulin. As
discussed herein, it is to be understood that the present
disclosure also encompasses inter alia versions of these and other
conjugates that include an insulin molecule other than wild-type
human insulin.
[0053] FIG. 6: Composition of exemplary insulin conjugates
conjugated at the A1 position. The schematic in FIG. 6 is primarily
intended to represent a wild-type human insulin. As discussed
herein, it is to be understood that the present disclosure also
encompasses inter alia versions of these and other conjugates that
include an insulin molecule other than wild-type human insulin.
[0054] FIG. 7: Exemplary conjugation scheme where N-terminal
protecting amino acids were not engineered into the insulin
molecule. L is the proinsulin leader peptide. C is the C-peptide
that connects the C-terminus of the B-peptide and the N-terminus of
the A-peptide. These are cleaved from proinsulin in the first step
using a C-terminal lysine protease or lys-C enzyme (e.g.,
Achromobacter lyticus protease or ALP). The resulting bioactive
insulin molecule (with A- and B-peptides linked via disulfide
bonds) is then conjugated with NHS--R* where R* corresponds to a
prefunctionalized ligand framework and NHS corresponds to an NHS
ester group. Conjugation is shown to occur non-selectively at the
A1, B1 and Lys.sup.B29 positions. The desired Lys.sup.B29 conjugate
is then purified from the mixture of conjugates.
[0055] FIG. 8: Exemplary conjugation scheme where N-terminal
protecting amino acids were engineered into both the A- and
B-peptides of the insulin molecule. The N-terminal protecting amino
acids are illustrated as A0 and B0. After treatment with a
C-terminal lysine protease to cleave the leader peptide and
C-peptide, the insulin molecule is conjugated with NHS--R*.
Conjugation is shown to occur preferentially at the Lys.sup.B29
position but occurs also at the A0 and B0 positions. The N-terminal
protecting amino acids are then cleaved in a final step with
trypsin or trypsin-like protease that is capable of cleaving on the
C-terminus of Arg residues (see FIG. 8B) to collapse the various
insulin conjugate intermediates to the desired Lys.sup.B29
conjugate product.
[0056] FIG. 9: Exemplary conjugation scheme where N-terminal
protecting amino acids were only engineered into the A-peptide of
the insulin molecule. The N-terminal protecting amino acids are
illustrated as A0.
[0057] FIG. 10: Exemplary conjugation scheme where N-terminal
protecting amino acids were only engineered into the B-peptide of
the insulin molecule. The N-terminal protecting amino acids are
illustrated as B0.
[0058] FIG. 11: Unpurified culture supernatant yields from GS115
strain clones grown under buffered (BMMY) and unbuffered (MMY)
conditions. (A) Insulin molecule yield in mg/L from various clones
("Clone#" refers to clones obtained from different geneticin plate
resistance levels) using ELISA analysis (ISO-Insulin ELISA,
Mercodia, Uppsala, Sweden). (B) SDS-PAGE of clones showing the
molecular weights of the produced insulin molecules. Recombinant
human insulin standard (RHI standard) is shown in lane 14 of the
top right gel and in lane 2 of the bottom right gel at 250 mg/L for
yield comparison purposes.
[0059] FIG. 12: Unpurified culture supernatant yields from KM71
strain clones grown under buffered conditions. (A) Insulin molecule
yield in mg/L from various clones ("Clone#" refers to clones
obtained from different geneticin plate resistance levels) using
ELISA analysis (ISO-Insulin ELISA, Mercodia, Uppsala, Sweden). (B)
SDS-PAGE of clones showing the molecular weights of the produced
insulin molecules. Recombinant human insulin standard (RHI
standard) is shown in lanes 15-18 of the top right gel (60-500
mg/L) and in lanes 5-9 of the bottom right gel (30-500 mg/L) for
yield comparison purposes.
[0060] FIG. 13: Unpurified culture supernatant yields from KM71
strain clones grown under unbuffered conditions. (A) Insulin
molecule yield in mg/L from various clones ("Clone#" refers to
clones obtained from different geneticin plate resistance levels)
using ELISA analysis (ISO-Insulin ELISA, Mercodia, Uppsala,
Sweden). (B) SDS-PAGE of clones showing the molecular weights of
the produced insulin molecules. Recombinant human insulin standard
(RHI Standard) is shown in lanes 8 and 9 of the top right gel (250
and 100 mg/L) and in lane 18 of the bottom right gel (250 mg/L) for
yield comparison purposes.
[0061] FIG. 14: Western blot of (A) KM71 RHI-1 A-E broth and (B)
GS115 RHI-1 A-E broth before and after ALP digestion. "-" indicates
no enzyme, "+" indicates with enzyme digestion. Lanes: 1 protein
ladder, 2 peptide ladder, 3 RHI-, 4 RHI+, 5 RHI-1 A-, 6 RHI-1 A+, 7
RHI-1 B-, 8 RHI-1 B+, 9 RHI-1 C-, 10 RHI-1 C+, 11 RHI-1 D-, 12
RHI-1 D+, 13 RHI-1 E-, 14 RHI-1 E+.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0062] The methods and intermediates of the present invention are
useful for preparing conjugates described in International patent
application number PCT/US 10/22268, filed Jan. 27, 2010, the
entirety of which is incorporated herein by reference. In certain
embodiments, the present conjugates are generally prepared
according to Scheme I set forth below:
##STR00003##
Carboxylic Acid Protecting Group (PG.sup.1)
[0063] The PG.sup.1 group of formulae D and C is a suitable
carboxylic acid protecting group. Protected acids are well known in
the art and include those described in detail in Greene (1999).
Examples of suitable carboxylic acid protecting groups include
methyl (Me), ethyl (Et), t-butyl (t-Bu), allyl (All), benzyl (Bn),
trityl (Trt), 2-chlorotrityl (2-Cl-Trt), 2,4-dimethoxybenzyl (Dmb),
2-phenylisopropyl (2-PhiPr), 9-fluorenylmethyl (Fm),
4-(N-[1-(4,4-dimethyl-2,6-dioxocyclohexylidene)-3-methylbutyl]amino)benzy-
l (Dmab), carbamoylmethyl (Cam), p-nitrobenzyl (pNB),
2-trimethylsilylethyl (TMSE), 2-phenyl-(2-trimethylsilyl)ethyl
(PTMSE), 2-(trimethylsilyl)isopropyl (TMSI), 2,2,2-trichloroethyl
(Tce), p-hydroxyphenacyl (pHP), 4,5-dimethoxy-2-nitrobenzyl (Dmnb),
and 1,1-dimethylallyl (Dma). In certain embodiments, PG.sup.1 is
benzyl.
Leaving group (LG.sup.1)
[0064] The LG.sup.1 group of formula A is a suitable leaving group,
making --C(O)LG.sup.1 of formula A an activated ester that is
subject to nucleophilic attack. A suitable "leaving group" that is
"subject to nucleophilic attack" is a chemical group that is
readily displaced by a desired incoming nucleophilic chemical
entity. Suitable leaving groups are well known in the art, e.g.,
see, Smith and March, March's Advanced Organic Chemistry, 5.sup.th
Edition, John Wiley & Sons, Inc., New York, 2001. Such leaving
groups include, but are not limited to, halogen, alkoxy,
--O-succinimide (--OSu), --O-pentafluorophenyl, --O-benzotriazole
(--OBt), or --O-azabenzotriazole (--OAt). An activated ester may
also be an O-acylisourea intermediate generated by treatment of the
corresponding carboxylic acid with a carbodiimide reagent (e.g.,
N,N'-dicyclohexylcarbodiimide (DCC), N,N'-diisopropylcarbodiimide
(DIC), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC)). In
certain embodiments, LG.sup.1 is --OSu.
C.sub.1-C.sub.12 alkylene (Alk)
[0065] The Alk group of formulae F, D, C, B, A, and I is a
C.sub.1-C.sub.12alkylene chain, wherein one or more methylene
groups may be substituted by --O-- or --S--. In certain
embodiments, Alk contains one oxygen. In certain embodiments, Alk
is a C.sub.1-C.sub.4 alkylene chain. In some embodiments, Alk is a
C.sub.1, C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.7,
C.sub.8, C.sub.9, C.sub.10, C.sub.11, or C.sub.12 alkylene chain.
In certain embodiments, Alk is a C.sub.2 alkylene chain.
Ligand (X)
[0066] The X group of formulae E, C, B, A, and I is a ligand. A
compound of formula D is an amino-terminal ligand. In certain
embodiments, an X group of formulae E, D, C, B, A, and I is a
ligand that includes a saccharide.
[0067] In certain embodiments, a ligand is capable of competing
with a saccharide (e.g., glucose or mannose) for binding to an
endogenous saccharide-binding molecule (e.g., without limitation
surfactant proteins A and D or members of the selectin family). In
certain embodiments, a ligand is capable of competing with a
saccharide (e.g., glucose or mannose) for binding to cell-surface
sugar receptor (e.g., without limitation macrophage mannose
receptor, glucose transporter ligands, endothelial cell sugar
receptors, or hepatocyte sugar receptors). In certain embodiments,
a ligand is capable of competing with glucose for binding to an
endogenous glucose-binding molecule (e.g., without limitation
surfactant proteins A and D or members of the selectin family). In
certain embodiments, a ligand is capable of competing with a
saccharide for binding to a non-human lectin (e.g., Con A). In
certain embodiments, a ligand is capable of competing with glucose
or mannose for binding to a non-human lectin (e.g., Con A).
Exemplary glucose-binding lectins include calnexin, calreticulin,
N-acetylglucosamine receptor, selectin, asialoglycoprotein
receptor, collectin (mannose-binding lectin), mannose receptor,
aggrecan, versican, pisum sativum agglutinin (PSA), vicia faba
lectin, lens culinaris lectin, soybean lectin, peanut lectin,
lathyrus ochrus lectin, sainfoin lectin, sophora japonica lectin,
bowringia milbraedii lectin, concanavalin A (Con A), and pokeweed
mitogen.
[0068] In certain embodiments, a ligand is of formula (IIIa) or
(IIIb):
##STR00004##
wherein: [0069] each R.sup.1 is independently hydrogen, --OR.sup.y,
--N(R.sup.y).sub.2, --SR.sup.y, --O--Y, --CH.sub.2R.sup.x, or -G-,
wherein one of R.sup.1 is -G-; [0070] each R.sup.x is independently
hydrogen, --OR.sup.y, --N(R.sup.y).sub.2, --SR.sup.y, or --O--Y;
[0071] each R.sup.y is independently --R.sup.2, --SO.sub.2R.sup.2,
--S(O)R.sup.2, --P(O)(OR.sup.2).sub.2, --C(O)R.sup.2,
--CO.sub.2R.sup.2, or --C(O)N(R.sup.2).sub.2; [0072] each Y is
independently a monosaccharide, disaccharide, or trisaccharide;
[0073] each G is independently a covalent bond or an optionally
substituted C.sub.1-9 alkylene, wherein one or more methylene units
of G is optionally replaced by --O--, --S--, --N(R.sup.2)--,
--C(O)--, --OC(O)--, --C(O)O--, --C(O)N(R.sup.2)--,
--N(R.sup.2)C(O)--, --N(R.sup.2)C(O)N(R.sup.2)--, --SO.sub.2--,
--SO.sub.2N(R.sup.2)--, --N(R.sup.2)SO.sub.2--, or
--N(R.sup.2)SO.sub.2N(R.sup.2)--; [0074] each Z is independently
halogen, --N(R.sup.2).sub.2, --OR.sup.2, --SR.sup.2, --N.sub.3,
--C.ident.CR.sup.2, --CO.sub.2R.sup.2, --C(O)R.sup.2, or
--OSO.sub.2R.sup.2; and [0075] each R.sup.2 is independently
hydrogen or an optionally substituted group selected from C.sub.1-6
aliphatic, phenyl, a 4-7 membered heterocyclic ring having 1-2
heteroatoms selected from nitrogen, oxygen, or sulfur, or a 5-6
membered monocyclic heteroaryl ring having 1-4 heteroatoms selected
from nitrogen, oxygen, or sulfur.
[0076] In certain embodiments, a ligand of formula (IIa) or (IIIb)
is a monosaccharide. In certain embodiments, a ligand is a
disaccharide. In certain embodiments, a ligand is a trisaccharide.
In certain embodiments, a ligand is a tetrasaccharide. In certain
embodiments, a ligand comprises no more than a total of four
monosaccharide moieties.
[0077] As defined generally above, each R.sup.1 is independently
hydrogen, --OR.sup.y, --N(R.sup.y).sub.2, --SR.sup.y, --O--Y,
--CH.sub.2R.sup.x, or -G-, wherein one of R.sup.1 is -G-. In
certain embodiments, R.sup.1 is hydrogen. In certain embodiments,
R.sup.1 is --OH. In other embodiments, R.sup.1 is --NHC(O)CH.sub.3.
In certain embodiments, R.sup.1 is --O--Y. In certain other
embodiments, R.sup.1 is -G-. In some embodiments, R.sup.1 is
--CH.sub.2OH. In other embodiments, R.sup.1 is --CH.sub.2--O--Y. In
yet other embodiments, R.sup.1 is --NH.sub.2. One of ordinary skill
in the art will appreciate that each R substituent in formula
(IIIa) or (IIIb) may be of (R) or (S) stereochemistry.
[0078] As defined generally above, each R.sup.x is independently
hydrogen, --OR.sup.y, --N(R.sup.y).sub.2, --SR.sup.y, or --O--Y. In
some embodiments, R.sup.x is hydrogen. In certain embodiments,
R.sup.x is --OH. In other embodiments, R.sup.x is --O--Y.
[0079] As defined generally above, each R.sup.y is independently
--R.sup.2, --SO.sub.2R.sup.2, --S(O)R.sup.2,
--P(O)(OR.sup.2).sub.2, --C(O)R.sup.2, --CO.sub.2R.sup.2, or
--C(O)N(R.sup.2).sub.2. In some embodiments, R.sup.y is hydrogen.
In other embodiments, R.sup.y is --R.sup.2. In some embodiments,
R.sup.y is --C(O)R.sup.2. In certain embodiments, R.sup.y is
acetyl. In other embodiments, R.sup.y is --SO.sub.2R.sup.2,
--S(O)R.sup.2, --P(O)(OR.sup.2).sub.2, --CO.sub.2R.sup.2, or
--C(O)N(R.sup.2).sub.2.
[0080] As defined generally above, Y is a monosaccharide,
disaccharide, or trisaccharide. In certain embodiments, Y is a
monosaccharide. In some embodiments, Y is a disaccharide. In other
embodiments, Y is a trisaccharide. In some embodiments, Y is
mannose, glucose, fructose, galactose, rhamnose, or xylopyranose.
In some embodiments, Y is sucrose, maltose, turanose, trehalose,
cellobiose, or lactose. In certain embodiments, Y is mannose. In
certain embodiments, Y is D-mannose. One of ordinary skill in the
art will appreciate that the saccharide Y is attached to the oxygen
group of --O--Y through anomeric carbon to form a glycosidic bond.
The glycosidic bond may be of an alpha or beta configuration.
[0081] As defined generally above, each G is independently a
covalent bond or an optionally substituted C.sub.3-9 alkylene,
wherein one or more methylene units of G is optionally replaced by
--O--, --S--, --N(R.sup.2)--, --C(O)--, --OC(O)--, --C(O)O--,
--C(O)N(R.sup.2)--, --N(R.sup.2)C(O)--,
--N(R.sup.2)C(O)N(R.sup.2)--, --SO.sub.2--, --SO.sub.2N(R.sup.2)--,
--N(R.sup.2)SO.sub.2--, or --N(R.sup.2)SO.sub.2N(R.sup.2)--. In
some embodiments, G is a covalent bond. In certain embodiments, G
is --O--C.sub.1-8 alkylene. In certain embodiments, G is
--OCH.sub.2CH.sub.2--.
[0082] In some embodiments, the R.sup.1 substituent on the Cl
carbon of formula (IIIa) is -G- to give a compound of formula
(IIIa-i):
##STR00005##
wherein R.sup.1 and G are as defined and described herein.
[0083] In some embodiments, a ligand is of formula (IIIa-ii):
##STR00006##
[0084] wherein R.sup.1, R.sup.x, and G are as defined and described
herein.
[0085] In certain embodiments, a ligand may have the same chemical
structure as glucose or may be a chemically related species of
glucose. In various embodiments it may be advantageous for a ligand
to have a different chemical structure from glucose, e.g., in order
to fine tune the glucose response of the conjugate. For example, in
certain embodiments, one might use a ligand that includes glucose,
mannose, L-fucose or derivatives of these (e.g.,
alpha-L-fucopyranoside, mannosamine, beta-linked N-acetyl
mannosamine, methylglucose, methylmannose, ethylglucose,
ethylmannose, propylglucose, propylmannose, etc.) and/or higher
order combinations of these (e.g., a bimannose, linear and/or
branched trimannose, etc.).
[0086] In certain embodiments, a ligand includes a monosaccharide.
In certain embodiments, a ligand includes a disaccharide. In
certain embodiments, a ligand includes a trisaccharide. In some
embodiments, a ligand precursor H.sub.2N--X (J) comprises a
saccharide and one or more amine groups. In certain embodiments the
saccharide and amine group are separated by a C.sub.1-C.sub.6 alkyl
group, e.g., a C.sub.1-C.sub.3 alkyl group. In some embodiments, J
is aminoethylglucose (AEG). In some embodiments, J is
aminoethylmannose (AEM). In some embodiments, J is
aminoethylbimannose (AEBM). In some embodiments, J is
aminoethyltrimannose (AETM). In some embodiments, J is
.beta.-aminoethyl-N-acetylglucosamine (AEGA). In some embodiments,
J is aminoethylfucose (AEF). In certain embodiments, a saccharide
ligand is of the "D" configuration. In other embodiments, a
saccharide ligand is of the "L" configuration. Below we show the
structures of exemplary J compounds. Other exemplary ligands will
be recognized by those skilled in the art.
##STR00007##
[0087] It will be understood by one of ordinary skill in the art
that the J compounds shown above react in step S-1 to form an amide
bond. Thus, the ligand (X) portions of the compounds shown above
are as follows:
##STR00008##
Drug (W)
[0088] W--NH.sub.2 is an amine-containing drug. It is to be
understood that a conjugate can comprise any drug W. A conjugate is
not limited to any particular drug and may include a small molecule
drug or biomolecular drug. In general, a drug used will depend on
the disease or disorder to be treated. As used herein, the term
"drug" encompasses salt and non-salt forms of the drug. For
example, the term "insulin molecule" encompasses all salt and
non-salt forms of the insulin molecule. It will be appreciated that
the salt form may be anionic or cationic depending on the drug.
[0089] For example, without limitation, in various embodiments W is
selected from any one of the following drugs: diclofenac,
nifedipine, rivastigmine, methylphenidate, fluoroxetine,
rosiglitazone, prednison, prednisolone, codeine, ethylmorphine,
dextromethorphan, noscapine, pentoxiverine, acetylcysteine,
bromhexine, epinephrine, isoprenaline, orciprenaline, ephedrine,
fenoterol, rimiterol, ipratropium, cholinetheophyllinate,
proxiphylline, bechlomethasone, budesonide, deslanoside, digoxine,
digitoxin, disopyramide, proscillaridin, chinidine, procainamide,
mexiletin, flecamide, alprenolol, proproanolol, nadolol, pindolol,
oxprenolol, labetalol, tirnolol, atenolol,
pentaeritrityltetranitrate, isosorbiddinitrate,
isosorbidmononitrate, niphedipin, phenylamine, verapamil,
diltiazem, cyclandelar, nicotinylalcholhol, inositolnicotinate,
alprostatdil, etilephrine, prenalterol, dobutamine, dopamine,
dihydroergotamine, guanetidine, betanidine, methyldopa, reserpine,
guanfacine, trimethaphan, hydralazine, dihydralazine, prazosine,
diazoxid, captopril, nifedipine, enalapril, nitroprusside,
bendroflumethiazide, hydrochlorthiazide, metychlothiazide,
polythiazide, chlorthalidon, cinetazon, clopamide, mefruside,
metholazone, bumetanide, ethacrynacide, spironolactone, amiloride,
chlofibrate, nicotinic acid, nicheritrol, brompheniramine,
cinnarizine, dexchlorpheniramine, clemastine, antazoline,
cyproheptadine, proethazine, cimetidine, ranitidine, sucralfat,
papaverine, moxaverine, atropin, butylscopolamin, emepron,
glucopyrron, hyoscyamine, mepensolar, methylscopolamine,
oxiphencyclimine, probanteline, terodilin, sennaglycosides,
sagradaextract, dantron, bisachodyl, sodiumpicosulfat, etulos,
diphenolxylate, loperamide, salazosulfapyridine, pyrvin,
mebendazol, dimeticon, ferrofumarate, ferrosuccinate,
ferritetrasemisodium, cyanochobalamine, folid acid heparin, heparin
co-factor, diculmarole, warfarin, streptokinase, urokinase, factor
VIII, factor IX, vitamin K, thiopeta, busulfan, chlorambucil,
cyclophosphamid, melfalan, carmustin, mercatopurin, thioguanin,
azathioprin, cytarabin, vinblastin, vinchristin, vindesin,
procarbazine, dacarbazine, lomustin, estramustin, teniposide,
etoposide, cisplatin, amsachrin, aminogluthetimid, phosphestrol,
medroxiprogresterone, hydroxiprogesterone, megesterol,
noretisteron, tamoxiphen, ciclosporin, sulfosomidine,
bensylpenicillin, phenoxymethylpenicillin, dicloxacillin,
cloxacillin, flucoxacillin, ampicillin, amoxicillin, pivampicillin,
bacampicillin, piperacillin, meziocillin, mecillinam,
pivmecillinam, cephalotin, cephalexin, cephradin, cephydroxil,
cephaclor, cefuroxim, cefotaxim, ceftazidim, cefoxitin, aztreonam,
imipenem, cilastatin, tetracycline, lymecycline, demeclocycline,
metacycline, oxitetracycline, doxycycline, chloramphenicol,
spiramycin, fusidic acid, lincomycin, clindamycin, spectinomycin,
rifampicin, amphotericin B, griseofulvin, nystatin, vancomycin,
metronidazole, tinidazole, trimethoprim, norfloxacin,
salazosulfapyridin, aminosalyl, isoniazid, etambutol,
nitrofurantoin, nalidixic acid, metanamine, chloroquin,
hydroxichloroquin, tinidazol, ketokonazol, acyclovir, interferon
idoxuridin, retinal, tiamin, dexpantenol, pyridoxin, folic acid,
ascorbic acid, tokoferol, phytominadion, phenfluramin,
corticotropin, tetracosactid, tyrotropin, somatotoprin, somatrem,
vasopressin, lypressin, desmopressin, oxytocin,
chloriongonadotropin, cortison, hydrocortisone, fluodrocortison,
prednison, prednisolon, fluoximesteron, mesterolon, nandrolon,
stanozolol, oximetolon, cyproteron, levotyroxin, liotyronin,
propylthiouracil, carbimazol, tiamazol, dihydrotachysterol,
alfacalcidol, calcitirol, insulin, tolbutamid, chlorpropamid,
tolazamid, glipizid, glibenclamid, phenobarbital, methyprylon,
pyrityidion, meprobamat, chlordiazepoxid, diazepam, nitrazepam,
baclofen, oxazepam, dikaliumclorazepat, lorazepam, flunitrazepam,
alprazolam, midazolam, hydroxizin, dantrolene, chlomethiazol,
propionmazine, alimemazine, chlorpromazine, levomepromazine,
acetophenazine, fluphenazine, perphenazine, prochiorperazine,
trifluoperazine, dixyrazine, thiodirazine, periciazin,
chloprothixene, tizanidine, zaleplon, zuclopentizol, flupentizol,
thithixen, haloperidol, trimipramin, opipramol, chlomipramin,
desipramin, lofepramin, amitriptylin, nortriptylin, protriptylin,
maptrotilin, caffeine, cinnarizine, cyclizine, dimenhydinate,
meclozine, prometazine, thiethylperazine, metoclopramide,
scopolamine, phenobarbital, phenyloine, ethosuximide, primidone,
carbamazepine, chlonazepam, orphenadrine, atropine, bensatropine,
biperiden, metixene, procylidine, levodopa, bromocriptin,
amantadine, ambenon, pyridostigmine, synstigmine, disulfuram,
morphine, codeine, pentazocine, buprenorphine, pethidine,
phenoperidine, phentanyl, methadone, piritramide,
dextropropoxyphene, ketobemidone, acetylsalicylic acid, celecoxib,
phenazone, phenylbutazone, azapropazone, piroxicam, ergotamine,
dihydroergotamine, cyproheptadine, pizitifen, flumedroxon,
allopurinol, probenecid, sodiummaurothiomalate auronofin,
penicillamine, estradiol, estradiolvalerianate, estriol,
ethinylestradiol, dihydrogesteron, lynestrenol,
medroxiprogresterone, noretisterone, cyclophenile, clomiphene,
levonorgestrel, mestranol, ornidazol, tinidazol, ekonazol,
chlotrimazol, natamycine, miconazole, sulbentin, methylergotamine,
dinoprost, dinoproston, gemeprost, bromocriptine,
phenylpropanolamine, sodiumchromoglicate, azetasolamide,
dichlophenamide, betacarotene, naloxone, calciumfolinate, in
particular clonidine, thephylline, dipyradamol, hydrochlothiazade,
scopolamine, indomethacine, furosemide, potassium chloride,
morphine, ibuprofen, salbutamol, terbutalin, calcitonin, etc. It is
to be understood that this list is intended to be exemplary and
that any drug, whether known or later discovered, may be used in a
conjugate of the present disclosure.
[0090] In various embodiments, W is a hormonal drug which may be
peptidic or non-peptidic, e.g., adrenaline, noradrenaline,
angiotensin, atriopeptin, aldosterone, dehydroepiandrosterone,
androstenedione, testosterone, dihydrotestosterone, calcitonin,
calcitriol, calcidiol, corticotropin, cortisol, dopamine,
estradiol, estrone, estriol, erythropoietin, follicle-stimulating
hormone, gastrin, ghrelin, glucagon, gonadotropin-releasing
hormone, growth hormone, growth hormone-releasing hormone, human
chorionic gonadotropin, histamine, human placental lactogen,
insulin, insulin-like growth factor, inhibin, leptin, a
leukotriene, lipotropin, melatonin, orexin, oxytocin, parathyroid
hormone, progesterone, prolactin, prolactin-releasing hormone, a
prostglandin, renin, serotonin, secretin, somatostatin,
thrombopoietin, thyroid-stimulating hormone, thyrotropin-releasing
hormone (or thyrotropin), thyrotropin-releasing hormone, thyroxine,
triiodothyronine, vasopressin, etc.
[0091] In certain embodiments, the hormone may be selected from
glucagon, insulin, insulin-like growth factor, leptin,
thyroid-stimulating hormone, thyrotropin-releasing hormone (or
thyrotropin), thyrotropin-releasing hormone, thyroxine, and
triiodothyronine.
[0092] In certain embodiments, W is insulin-like growth factor 1
(IGF-1). It is to be understood that this list is intended to be
exemplary and that any hormonal drug, whether known or later
discovered, may be used in a conjugate of the present
disclosure.
[0093] In various embodiments, W is a thyroid hormone.
[0094] In various embodiments, W is an anti-diabetic drug (i.e., a
drug which has a beneficial effect on patients suffering from
diabetes).
[0095] It will be appreciated that in order to carry out step S-5,
a drug must contain an amino group. Thus, in certain embodiments, a
drug of the present disclosure contains one or more amino groups
(e.g., an insulin molecule). In other embodiments, a drug is
modified to form a derivative that contains an amino group.
[0096] In various embodiments, W is an insulin molecule. As used
herein, the term "insulin" or "insulin molecule" encompasses all
salt and non-salt forms of the insulin molecule. It will be
appreciated that the salt form may be anionic or cationic depending
on the insulin molecule. By "insulin" or "an insulin molecule" we
intend to encompass both wild-type and modified forms of insulin as
long as they are bioactive (i.e., capable of causing a detectable
reduction in glucose when administered in vivo). Wild-type insulin
includes insulin from any species whether in purified, synthetic or
recombinant form (e.g., human insulin, porcine insulin, bovine
insulin, rabbit insulin, sheep insulin, etc.). A number of these
are available commercially, e.g., from Sigma-Aldrich (St. Louis,
Mo.).
[0097] The wild-type sequence of human insulin comprises an amino
acid sequence of SEQ ID NO:27 (A-peptide) and an amino acid
sequence of SEQ ID NO:28 (B-peptide) and three disulfide bridges as
shown below:
##STR00009##
[0098] As is well known in the art, the p-cells of the pancreatic
islets in humans secrete a single chain precursor of insulin, known
as proinsulin. In humans, proinsulin has the sequence:
[B-peptide]-[C-peptide]-[A-peptide], wherein the C-peptide is a
connecting peptide with the sequence of SEQ ID NO:29:
Arg-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Val-Gly-Gln-Val-Glu-Leu-Gly-Gly-Gly-Pro-G-
ly-Ala-Gly-Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly-Ser-Leu-Gln-Lys-Arg.
[0099] In humans, prior to secretion of the bioactive insulin
molecule by the .beta.-cells of the pancreatic islets, the
C-peptide is removed from proinsulin by cleavage at the two dibasic
sites, Arg-Arg and Lys-Arg. As shown above, the cleavage releases
the bioactive insulin molecule as separate A- and B-peptides that
are connected by two disulfide bonds with one disulfide bond within
the A-peptide.
[0100] Not all organisms recognize and correctly process the human
proinsulin sequence. For example, in certain embodiments, yeast may
utilize an alternative proinsulin sequence: [Leader
peptide]-[B-peptide]-[C-peptide]-[A-peptide].
[0101] In the yeast proinsulin sequence, the leader peptide is
thought to facilitate appropriate cleavage of the insulin molecule
in yeast and may, for example, comprise the sequence:
Glu-Glu-Ala-Glu-Ala-Glu-Ala-Glu-Pro-Lys (SEQ ID NO:30) or
Asp-Asp-Gly-Asp-Pro-Arg (SEQ ID NO:22). In some embodiments, the
leader peptide has a sequence of Xaa'-Pro-[Lys/Arg], where Xaa':
[0102] a. is at least 4, at least 5, at least 6, at least 7, at
least 8, at least 9, at least 10, at least 11, at least 12, at
least 13, at least 14, at least 15, at least 20, or at least 25
amino acids in length, or [0103] b. is no more than 5, no more than
10, no more than 15, no more than 20, no more than 25, no more than
50 amino acids in length; and [0104] c. comprises at least about
30%, at least about 40%, at least about 50%, at least about 55%, at
least about 60%, at least about 65%, at least about 70%, at least
about 75%, at least about 80%, at least about 5%, at least about
90%, or at least about 95% of acidic amino acids (e.g., Asp and/or
Glu).
[0105] In some embodiments, the leader peptide contains the amino
acids Pro-Lys at its C-terminus. In some embodiments, the leader
peptide contains the amino acids Pro-Arg at its C-terminus.
[0106] Additionally, instead of the long C-peptide connecting
segment found in human proinsulin, engineered yeast proinsulin
sequences may have a much shorter C-peptide sequence, e.g.,
Ala-Ala-Lys (SEQ ID NO:16), Asp-Glu-Arg (SEQ ID NO: 17), or
Thr-Ala-Ala-Lys (SEQ ID NO:31). In some embodiments, the C-peptide
has a sequence of Xaa''-[Lys/Arg], where Xaa'': [0107] a. is
missing, or is at least 1, at least 2, at least 3, at least 4, at
least 5, at least 6, at least 7, at least 8, at least 9, at least
10, at least 15, or at least 20 amino acids in length; [0108] b. is
no more than 2, no more than 3, no more than 4, no more than 5, no
more than 6, no more than 7, no more than 8, no more than 9, no
more than 10, no more than 15, no more than 20, or no more than 25
amino acids in length; or [0109] c. is exactly 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
or 25 amino acids in length.
[0110] In some embodiments, the C-peptide has an amino acid
sequence different from that found in human proinsulin. In general,
the C-peptide refers to any amino acid sequence in proinsulin that
is found between the insulin A-chain and B-chain. In some
embodiments, the C-peptide refers to any amino acid sequence in
proinsulin that is found between the insulin A-chain and B-chain
and that is enzymatically cleaved to produce a bioactive insulin
molecule.
[0111] Without wishing to be limited to any particular theory, it
is thought that the combination of these leader sequences and
C-peptide sequences allows for the production of functional insulin
from yeast.
[0112] The present disclosure is not limited to human insulin
molecules (i.e., human proinsulin or bioactive human insulin
molecules). In general, the present disclosure encompasses any
human or non-human insulin that retains insulin-like bioactivity
(i.e., is capable of causing a detectable reduction in glucose when
administered to a suitable species at an appropriate dose in vivo).
For example, as discussed below, the present disclosure also
encompasses modified porcine insulin, bovine insulin, rabbit
insulin, sheep insulin, etc.
[0113] It is to be understood that an insulin molecule of the
present disclosure may include chemical modifications and/or
mutations that are not present in a wild-type insulin. A variety of
modified insulins are known in the art (e.g., see Crotty and
Reynolds, Pediatr. Emerg. Care. 23:903-905, 2007 and Gerich, Am. J.
Med. 113:308-16, 2002 and references cited therein). Modified forms
of insulin may be chemically modified (e.g., by addition of a
chemical moiety such as a PEG group or a fatty acyl chain as
described below) and/or mutated (i.e., by addition, deletion or
substitution of amino acids).
[0114] In certain embodiments, an insulin molecule of the present
disclosure will differ from a wild-type insulin by 1-10 (e.g., 1-9,
1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4,
2-3, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-9, 4-8, 4-7, 4-6, 4-5, 5-9,
5-8, 5-7, 5-6, 6-9, 6-8, 6-7, 7-9, 7-8, 8-9, 9, 8, 7, 6, 5, 4, 3, 2
or 1) amino acid substitutions, additions and/or deletions. In
certain embodiments, an insulin molecule of the present disclosure
will differ from a wild-type insulin by amino acid substitutions
only. In certain embodiments, an insulin molecule of the present
disclosure will differ from a wild-type insulin by amino acid
additions only. In certain embodiments, an insulin molecule of the
present disclosure will differ from a wild-type insulin by both
amino acid substitutions and additions. In certain embodiments, an
insulin molecule of the present disclosure will differ from a
wild-type insulin by both amino acid substitutions and
deletions.
[0115] In certain embodiments, amino acid substitutions may be made
on the basis of similarity in polarity, charge, solubility,
hydrophobicity, hydrophilicity, and/or the amphipathic nature of
the residues involved. In certain embodiments, a substitution may
be conservative, that is, one amino acid is replaced with one of
similar shape and charge. Conservative substitutions are well known
in the art and typically include substitutions within the following
groups: glycine, alanine; valine, isoleucine, leucine; aspartic
acid, glutamic acid; asparagine, glutamine; serine, threonine;
lysine, arginine; and tyrosine, phenylalanine. In certain
embodiments, the hydrophobic index of amino acids may be considered
in choosing suitable mutations. The importance of the hydrophobic
amino acid index in conferring interactive biological function on a
polypeptide is generally understood in the art. Alternatively, the
substitution of like amino acids can be made effectively on the
basis of hydrophilicity. The importance of hydrophilicity in
conferring interactive biological function of a polypeptide is
generally understood in the art. The use of the hydrophobic index
or hydrophilicity in designing polypeptides is further discussed in
U.S. Pat. No. 5,691,198.
[0116] In certain embodiments, an insulin molecule of the present
disclosure comprises an amino acid sequence of SEQ ID NO: 1
(A-peptide) and an amino acid sequence of SEQ ID NO:2 (B-peptide)
and three disulfide bridges as shown in formula X.sup.1:
##STR00010##
where Xaa at each of positions A0, A22, B0 and B31 is independently
a codable amino acid, a sequence of codable amino acids, or
missing; Xaa at each of positions A8, A9, A10, A18, and A21 is
independently a codable amino acid; and Xaa at each of positions
B3, B28, B29, and B30 is independently a codable amino acid or
missing.
[0117] As used herein, a "codable amino acid" is any one of the 20
amino acids that are directly encoded for polypeptide synthesis by
the standard genetic code.
[0118] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-50
codable amino acids, or missing.
[0119] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-25
codable amino acids, or missing.
[0120] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-10
codable amino acids, or missing.
[0121] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-9
codable amino acids, or missing.
[0122] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-8
codable amino acids, or missing.
[0123] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-7
codable amino acids, or missing.
[0124] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-6
codable amino acids, or missing.
[0125] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-5
codable amino acids, or missing.
[0126] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-4
codable amino acids, or missing.
[0127] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2-3
codable amino acids, or missing.
[0128] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is independently a codable amino acid, a sequence of 2
codable amino acids, or missing.
[0129] In some embodiments, Xaa at each of positions A0, A22, B0
and B31 is missing.
[0130] In some embodiments, Xaa at each of positions A0, A22 and
B31 is missing.
[0131] In some embodiments, Xaa at each of positions A22, B0 and
B31 is missing.
[0132] In some embodiments, Xaa at each of positions A22 and B31 is
missing.
[0133] In certain embodiments, Xaa at one or more of the positions
of the A- and B-peptides in formula X.sup.1 is selected from the
choices that are set forth in Table 1 and 2 below.
TABLE-US-00001 TABLE 1 A-peptide Position Amino Acid Identity A0
Any codable amino acid, sequence of codable amino acids, or missing
A8 Thr or Ala A9 Ser or Gly A10 Ile or Val A18 Asn, Asp or Glu A21
Asn, Asp, Glu, Gly or Ala A22 Any codable amino acid, sequence of
codable amino acids, or missing
TABLE-US-00002 TABLE 2 B-peptide Position Amino Acid Identity B0
Any codable amino acid, sequence of codable amino acids, or missing
B3 Asn, Lys, Asp or Glu, or missing B28 Pro, Ala, Lys, Leu, Val, or
Asp, or missing B29 Lys, Pro, or Glu, or missing B30 Thr, Ala, Lys,
Glu, Ser or Arg, or missing B31 Any codable amino acid, sequence of
codable amino acids, Arg-Arg, or missing
[0134] In some embodiments, an insulin molecule of formula X.sup.1
comprises amino acids at positions A8, A9, A10, and B30 selected
from those shown in Table 3 below. In some embodiments, an insulin
molecule of formula X.sup.1 comprises amino acids at positions A8,
A9, A10, and B30 selected from those shown in Table 3 below for a
single species (e.g., from the human sequence or Thr at A8, Ser at
A9, Ile at A10 and Thr at B30).
TABLE-US-00003 TABLE 3 Amino Acid Position Species A8 A9 A10 B30
Human Thr Ser Ile Thr Rabbit Thr Ser Ile Ser Porcine Thr Ser Ile
Ala Bovine Ala Ser Val Ala Sheep Ala Gly Val Ala
[0135] In various embodiments, an insulin molecule of the present
disclosure is mutated at the B28 and/or B29 positions of the
B-peptide sequence. For example, insulin lispro (HUMALOG.RTM.) is a
rapid acting insulin mutant in which the penultimate lysine and
proline residues on the C-terminal end of the B-peptide have been
reversed (Lys.sup.B28Pro.sup.B29-human insulin). This modification
blocks the formation of insulin multimers. Insulin aspart
(NOVOLOG.RTM.) is another rapid acting insulin mutant in which
proline at position B28 has been substituted with aspartic acid
(Asp.sup.B28-human insulin). This mutant also prevents the
formation of multimers. In some embodiments, mutation at positions
B28 and/or B29 is accompanied by one or more mutations elsewhere in
the insulin molecule. For example, insulin glulisine (APIDRA.RTM.)
is yet another rapid acting insulin mutant in which aspartic acid
at position B3 has been replaced by a lysine residue and lysine at
position B29 has been replaced with a glutamic acid residue
(Lys.sup.B3Glu.sup.B29-human insulin).
[0136] In various embodiments, an insulin molecule of the present
disclosure has an isoelectric point that is shifted relative to
human insulin. In some embodiments, the shift in isoelectric point
is achieved by adding one or more arginine residues to the
N-terminus of the insulin A-peptide and/or the C-terminus of the
insulin B-peptide. Examples of such insulin molecules include
Arg.sup.A0-human insulin, Arg.sup.B31Arg.sup.B32-human insulin,
Gly.sup.A21Arg.sup.B31 Arg.sup.B32 human insulin,
Arg.sup.A0Arg.sup.B31Arg.sup.B32-human insulin, and
Arg.sup.A0Gly.sup.A21Arg.sup.B31Arg.sup.B32-human insulin. By way
of further example, insulin glargine (LANTUS.RTM.) is an exemplary
long acting insulin mutant in which Asp.sup.A21 has been replaced
by glycine, and two arginine residues have been added to the
C-terminus of the B-peptide. The effect of these changes is to
shift the isoelectric point, producing a solution that is
completely soluble at pH 4. Thus, in some embodiments, an insulin
molecule of the present disclosure comprises an A-peptide sequence
wherein A21 is Gly and B-peptide sequence wherein B31 is Arg-Arg.
It is to be understood that the present disclosure encompasses all
single and multiple combinations of these mutations and any other
mutations that are described herein (e.g., Gly.sup.A21-human
insulin, Gly.sup.A21Arg.sup.B31-human insulin,
Arg.sup.B31Arg.sup.B32-human insulin, Arg.sup.B31-human
insulin).
[0137] In various embodiments, an insulin molecule of the present
disclosure may include one or more deletions. For example, in
certain embodiments, a B-peptide sequence of an insulin molecule of
the present disclosure is missing B1, B2, B3, B26, B27, B28 and/or
B29.
[0138] In various embodiments, an insulin molecule of the present
disclosure may be truncated. For example, the B-peptide sequence
may be missing residues B(1-2), B(1-3), B30, B(29-30) or B(28-30).
In some embodiments, these deletions and/or truncations apply to
any of the aforementioned insulin molecules (e.g., without
limitation to produce des(B30) insulin lispro, des(B30) insulin
aspart, des(B30) insulin glulisine, des(B30) insulin glargine,
etc.).
[0139] In some embodiments, an insulin molecule contains additional
amino acid residues on the N- or C-terminus of the A or B-peptide
sequences. In some embodiments, one or more amino acid residues are
located at positions A0, A22, B0, and/or B31. In some embodiments,
one or more amino acid residues are located at position A0. In some
embodiments, one or more amino acid residues are located at
position A22. In some embodiments, one or more amino acid residues
are located at position B0. In some embodiments, one or more amino
acid residues are located at position B31. In certain embodiments,
an insulin molecule does not include any additional amino acid
residues at positions A0, A22, B0, or B31.
[0140] In certain embodiments, an insulin molecule of the present
disclosure may have mutations wherein one or more amidated amino
acids are replaced with acidic forms. For example, asparagine may
be replaced with aspartic acid or glutamic acid. Likewise,
glutamine may be replaced with aspartic acid or glutamic acid. In
particular, Asn.sup.A18, Asn.sup.A21, or Asn.sup.B3, or any
combination of those residues, may be replaced by aspartic acid or
glutamic acid. Gln.sup.A15 or Gln.sup.B4, or both, may be replaced
by aspartic acid or glutamic acid. In certain embodiments, an
insulin molecule has aspartic acid at position A21 or aspartic acid
at position B3, or both.
[0141] One skilled in the art will recognize that it is possible to
mutate yet other amino acids in the insulin molecule while
retaining biological activity. For example, without limitation, the
following modifications are also widely accepted in the art:
replacement of the histidine residue of position B10 with aspartic
acid (His.sup.B10.fwdarw.Asp.sup.B10); replacement of the
phenylalanine residue at position B1 with aspartic acid
(Phe.sup.B1.fwdarw.Asp.sup.B1); replacement of the threonine
residue at position B30 with alanine
(Thr.sup.B30.fwdarw.Ala.sup.B30); replacement of the tyrosine
residue at position B26 with alanine
(Tyr.sup.B26.fwdarw.Ala.sup.B26); and replacement of the serine
residue at position B9 with aspartic acid
(Ser.sup.B9.fwdarw.Asp.sup.B9).
[0142] In various embodiments, an insulin molecule of the present
disclosure has a protracted profile of action. Thus, in certain
embodiments, an insulin molecule of the present disclosure may be
acylated with a fatty acid. That is, an amide bond is formed
between an amino group on the insulin molecule and the carboxylic
acid group of the fatty acid. The amino group may be the
alpha-amino group of an N-terminal amino acid of the insulin
molecule, or may be the epsilon-amino group of a lysine residue of
the insulin molecule. An insulin molecule of the present disclosure
may be acylated at one or more of the three amino groups that are
present in wild-type insulin or may be acylated on lysine residue
that has been introduced into the wild-type sequence. In certain
embodiments, an insulin molecule may be acylated at position B1. In
certain embodiments, an insulin molecule may be acylated at
position B29. In certain embodiments, the fatty acid is selected
from myristic acid (C14), pentadecylic acid (C15), palmitic acid
(C16), heptadecylic acid (C17) and stearic acid (C18). For example,
insulin detemir (LEVEMIR.RTM.) is a long acting insulin mutant in
which Thr.sup.B30 has been deleted, and a C14 fatty acid chain
(myristic acid) has been attached to Lys.sup.B29.
[0143] In some embodiments, the N-terminus of the A-peptide, the
N-terminus of the B-peptide, the epsilon-amino group of Lys at
position B29 or any other available amino group in an insulin
molecule of the present disclosure is covalently linked to a fatty
acid moiety of general formula:
##STR00011##
[0144] wherein R.sup.F is hydrogen or a C.sub.1-30 alkyl group. In
some embodiments, R.sup.F is a C.sub.1-20 alkyl group, a C.sub.3-19
alkyl group, a C.sub.5-18 alkyl group, a C.sub.6-17 alkyl group, a
C.sub.8-16 alkyl group, a C.sub.10-15 alkyl group, or a C.sub.12-14
alkyl group. In certain embodiments, the insulin molecule is
conjugated to the moiety at the A1 position. In certain
embodiments, the insulin molecule is conjugated to the moiety at
the B1 position. In certain embodiments, the insulin molecule is
conjugated to the moiety at the epsilon-amino group of Lys at
position B29. In certain embodiments, position B28 of the insulin
molecule is Lys and the epsilon-amino group of Lys.sup.B28 is
conjugated to the fatty acid moiety. In certain embodiments,
position B3 of the insulin molecule is Lys and the epsilon-amino
group of Lys.sup.B3 is conjugated to the fatty acid moiety. In some
embodiments, the fatty acid chain is 8-20 carbons long. In some
embodiments, the fatty acid is octanoic acid (C8), nonanoic acid
(C9), decanoic acid (C10), undecanoic acid (C11), dodecanoic acid
(C12), or tridecanoic acid (C13). In certain embodiments, the fatty
acid is myristic acid (C14), pentadecanoic acid (C15), palmitic
acid (C16), heptadecanoic acid (C17), stearic acid (C18),
nonadecanoic acid (C19), or arachidic acid (C20).
[0145] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
Lys.sup.B28Pro.sup.B29-human insulin (insulin lispro),
Asp.sup.B28-human insulin (insulin aspart),
Lys.sup.B3Glu.sup.B29-human insulin (insulin glulisine),
Arg.sup.31Arg.sup.B32-human insulin (insulin glargine),
N.sup..epsilon.B29-myristoyl-des(B30)-human insulin (insulin
detemir), Ala.sup.B26-human insulin, Asp.sup.B1-human insulin,
Arg.sup.A0-human insulin, Asp.sup.B1Glu.sup.B13-human insulin,
Gly.sup.A21-human insulin, Gly.sup.A21Arg.sup.B31Arg.sup.B32-human
insulin, Arg.sup.A0Arg.sup.B31Arg.sup.B32-human insulin,
Arg.sup.A0Gly.sup.A21Arg.sup.B31Arg.sup.B32-human insulin,
des(B30)-human insulin, des(B27)-human insulin, des(B28-B30)-human
insulin, des(B1)-human insulin, des(B1-B3)-human insulin.
[0146] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-palmitoyl-human insulin,
N.sup..epsilon.B29-myrisotyl-human insulin,
N.sup..epsilon.B28-palmitoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-myristoyl-Lys.sup.B28Pro.sup.B29-human
insulin.
[0147] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-palmitoyl-des(B30)-human insulin,
N.sup..epsilon.B30-myristoyl-Thr.sup.B29Lys.sup.B30-human insulin,
N.sup..epsilon.B30-palmitoyl-Thr.sup.B29Lys.sup.B30-human insulin,
N.sup..epsilon.B29-(N-palmitoyl-.gamma.-glutamyl)-des(B30)-human
insulin,
N.sup..epsilon.B29-(N-lithocolyl-.gamma.-glutamyl)-des(B30)-human
insulin, N.sup.B29-(.omega.-carboxyheptadecanoyl)-des(B30)-human
insulin, N.sup..epsilon.B29-(.omega.-carboxyheptadecanoyl)-human
insulin.
[0148] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-octanoyl-human insulin,
N.sup..epsilon.B29-myristoyl-Gly.sup.A21Arg.sup.B31Arg.sup.B31-h-
uman insulin,
N.sup..epsilon.B29-myristoyl-Gly.sup.A21Gln.sup.B3Arg.sup.B31Arg.sup.B32--
human insulin,
N.sup..epsilon.B29-myristoyl-Arg.sup.A0Gly.sup.A21Arg.sup.B31Arg.sup.B32--
human insulin,
N.sup..epsilon.B29-Arg.sup.A0Gly.sup.A21Gln.sup.B3Arg.sup.B31Arg.sup.B32--
human insulin,
N.sup..epsilon.B29-myristoyl-Arg.sup.A0Gly.sup.A21Asp.sup.B3Arg.sup.B31Ar-
g.sup.B32-human insulin,
N.sup..epsilon.B29-myristoyl-Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B29-myristoyl-Arg.sup.A0Arg.sup.B31
Arg.sup.B32-human insulin, N.sup..epsilon.B29 octanoyl-Gly.sup.A21
Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B29-octanoyl-Gly.sup.A21Gln.sup.B3Arg.sup.B31Arg.sup.B32-h-
uman insulin,
N.sup..epsilon.B29-octanoyl-Arg.sup.A0Gly.sup.A21Arg.sup.B31Arg.sup.B32-h-
uman insulin,
N.sup..epsilon.B29-octanoyl-Arg.sup.A0Gly.sup.A21Gln.sup.B3Arg.sup.B31
Arg.sup.B32-human insulin,
N.sup..epsilon.B29-octanoyl-Arg.sup.B0Gly.sup.A21Asp.sup.B3Arg.sup.B31Arg-
.sup.B32-human insulin,
N.sup..epsilon.B29-octanoyl-Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B29-octanoyl-Arg.sup.A0Arg.sup.B31Arg.sup.B32-human
insulin.
[0149] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-myristoyl-Gly.sup.A21Lys.sup.B28Pro.sup.B29Arg.sup.B31-
Arg.sup.B32-human insulin,
N.sup..epsilon.B28-myristoyl-Gly.sup.A21Gln.sup.B3Lys.sup.B28Pro.sup.B30A-
rg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-myristoyl-Arg.sup.A0Gly.sup.21Lys.sup.B28Pro.sup.B29Ar-
g.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-myristoyl-Arg.sup.A0Gly.sup.A21Gln.sup.B3Lys.sup.B28Pr-
o.sup.B29Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-myristoyl-Arg.sup.A0Gly.sup.A21Asp.sup.B3Lys.sup.B28Pr-
o.sup.B29Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-myristoyl-Lys.sup.B28Pro.sup.B29Arg.sup.B31Arg.sup.B32-
-human insulin,
N.sup..epsilon.B28-myristoyl-arg.sup.A0LyS.sup.B28Pro.sup.B29Arg.sup.B31A-
rg.sup.B32, human insulin,
N.sup..epsilon.B28-octanoyl-Gly.sup.A21Lys.sup.B28Pro.sup.B29Arg.sup.B31A-
rg.sup.B32-human insulin.
[0150] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-octanoyl-Gly.sup.A21Gln.sup.B3Lys.sup.B28Pro.sup.B29Ar-
g.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-octanoyl-Arg.sup.A0Gly.sup.A21Lys.sup.B28Pro.sup.B29Ar-
g.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-octanoyl-Arg.sup.A0Gly.sup.A21Gln.sup.B3Lys.sup.B28Pro-
.sup.B29Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-octanoyl-Arg.sup.A0Gly.sup.A21Asp.sup.B3Lys.sup.B28Pro-
.sup.B29Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B28-octanoyl-Lys.sup.B28Pro.sup.B29Arg.sup.B31Arg.sup.B32--
human insulin,
N.sup..epsilon.B28-octanoyl-Arg.sup.A0Lys.sup.B28Pro.sup.B29Arg.sup.B31Ar-
g.sup.B32 human insulin.
[0151] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-des(B30)-human insulin,
N.sup..epsilon.B29-tetradecanoyl-des(B30)-human insulin,
N.sup..epsilon.B29-decanoyl-des(B30)-human insulin,
N.sup..epsilon.B29-dodecanoyl-des(B30)-human insulin,
N.sup..epsilon.B29-tridecanoyl-Gly.sup.A21-des(B30)-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gly.sup.A21-des(B30)-human
insulin, N.sup..epsilon.B29-decanoyl-Gly.sup.A21-des(B30)-human
insulin, N.sup..epsilon.B29-dodecanoyl-Gly.sup.A21-des(B30)-human
insulin,
N.sup..epsilon.B29-tridecanoyl-Gly.sup.A21Gln.sup.B3-des(B30)-human
insulin,
N.sup..epsilon.B29-tetradecanoyl-Gly.sup.A21Gln.sup.B3-des(B30)--
human insulin,
N.sup..epsilon.B29-decanoyl-Gly.sup.A21-Gln.sup.B3-des(B30)-human
insulin,
N.sup..epsilon.B29-dodecanoyl-Gly.sup.A21-Gln.sup.B3-des(B30)-hu-
man insulin,
N.sup..epsilon.B29-tridecanoyl-Ala.sup.A21-des(B30)-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Ala.sup.A21-des(B30)-human
insulin, N.sup..epsilon.B29-decanoyl-Ala.sup.A21 des(B30)-human
insulin, N.sup..epsilon.B29-dodecanoyl-Ala.sup.A21-des(B30)-human
insulin,
N.sup..epsilon.B29-tridecanoyl-Ala.sup.A21-Gln.sup.B3-des(B30)-human
insulin,
N.sup..epsilon.B29-tetradecanoyl-Ala.sup.A21Gln.sup.B3-des(B30)--
human insulin,
N.sup..epsilon.B29-decanoyl-Ala.sup.A21Gln.sup.B3-des(B30)-human
insulin, N.sup..epsilon.B29-dodecanoyl-Ala.sup.A21
Gln.sup.3-des(B30)-human insulin,
N.sup..epsilon.B29-tridecanoyl-Gln.sup.B3-des(B30)-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gln.sup.B3-des(B30)-human insulin,
N.sup..epsilon.B29-decanoyl-Gln.sup.B3-des(B30)-human insulin,
N.sup..epsilon.B29-dodecanoyl-Gln.sup.B3-des(B30)-human
insulin.
[0152] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29-decanoyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29-dodecanoyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29-tridecanoyl-Ala.sup.A21-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Ala.sup.A21-human insulin,
N.sup..epsilon.B29-decanoyl-Ala.sup.A21-human insulin,
N.sup..epsilon.B29-dodecanoyl-Ala.sup.A21-human insulin.
[0153] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-Gly.sup.A21Gln.sup.B3-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gly.sup.A21Gln.sup.B3-human
insulin, N.sup..epsilon.B29-decanoyl-Gly.sup.A21Gln.sup.B3-human
insulin, N.sup..epsilon.B29-dodecanoyl-Gly.sup.A21Gln.sup.B3-human
insulin, N.sup..epsilon.B29-tridecanoyl-Ala.sup.21Gln.sup.B3-human
insulin,
N.sup..epsilon.B29-tetradecanoyl-Ala.sup.A21Gln.sup.B3-human
insulin, N.sup..epsilon.B29-decanoyl-Ala.sup.A21Gln.sup.B3-human
insulin, N.sup..epsilon.B29-dodecanoyl-Ala.sup.A21Gln.sup.B3-human
insulin.
[0154] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-Gln.sup.B3-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gln.sup.B3-human insulin,
N.sup..epsilon.B29-decanoyl-Gln.sup.B3-human insulin,
N.sup..epsilon.B29-dodecanoyl-Gln.sup.B3-human insulin.
[0155] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-Glu.sup.B30-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Glu.sup.B30-human insulin,
N.sup..epsilon.B29-decanoyl-Glu.sup.30-human insulin,
N.sup..epsilon.B29-dodecanoyl-Glu.sup.B30-human insulin.
[0156] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup.B29-tridecanoyl-Gly.sup.A21Glu.sup.B30-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gly.sup.A21Glu.sup.B30-human
insulin, N.sup..epsilon.B29-decanoyl-Gly.sup.A21Glu.sup.B30-human
insulin, N.sup..epsilon.B29-dodecanoyl-Gly.sup.A21Glu.sup.B30-human
insulin.
[0157] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-Gly.sup.A21Gln.sup.B3Glu.sup.B30-human
insulin,
N.sup..epsilon.B29-tetradecanoyl-Gly.sup.A21Gln.sup.B3Glu.sup.B3-
0-human insulin,
N.sup..epsilon.B29-decanoyl-Gly.sup.A21Gln.sup.B3Glu.sup.30-human
insulin,
N.sup..epsilon.B29-dodecanoyl-Gly.sup.A21Gln.sup.B3Glu.sup.B30-h-
uman insulin,
N.sup..epsilon.B29-tridecanoyl-Ala.sup.A21Glu.sup.B30-human
insulin,
N.sup..epsilon.B29-tetradecanoyl-Ala.sup.A21Glu.sup.B30-human
insulin, N.sup..epsilon.B29-decanoyl-Ala.sup.A21Glu.sup.B30-human
insulin, N.sup..epsilon.B29-dodecanoyl-Ala.sup.A21Glu.sup.30-human
insulin,
N.sup.B29-tridecanoyl-Ala.sup.A21Gln.sup.B3Glu.sup.B30-human
insulin,
N.sup..epsilon.B29-tetradecanoyl-Ala.sup.A21Gln.sup.B3Glu.sup.B3-
0-human insulin,
N.sup..epsilon.B29-decanoyl-Ala.sup.A21Gln.sup.B3Glu.sup.B30-human
insulin,
N.sup..epsilon.B29-dodecanoyl-Ala.sup.A21Gln.sup.B3Glu.sup.B30-h-
uman insulin.
[0158] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-tridecanoyl-Gln.sup.B3Glu.sup.B30-human insulin,
N.sup..epsilon.B29-tetradecanoyl-Gln.sup.B3Glu.sup.B30-human
insulin, N.sup..epsilon.B29-decanoyl-Gln.sup.B3Glu.sup.B30-human
insulin, N.sup..epsilon.B29-dodecanoyl-Gln.sup.B3Glu.sup.B30-human
insulin.
[0159] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-formyl-human insulin,
N.sup..alpha.B1-formyl-human insulin, N.sup..alpha.A1-formyl-human
insulin, N.sup..epsilon.B29-formyl-N.sup..alpha.B1-formyl-human
insulin, N.sup..epsilon.B29-formyl-N.sup..alpha.A1-formyl-human
insulin, N.sup..alpha.A1-formyl-N.sup..alpha.B1-formyl-human
insulin,
N.sup..epsilon.B29-formyl-N.sup..alpha.A1-formyl-N.sup..alpha.B1-formyl-h-
uman insulin.
[0160] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-acetyl-human insulin,
N.sup..alpha.B1-acetyl-human insulin, N.sup..alpha.A1-acetyl-human
insulin, N.sup..epsilon.B29-acetyl-N.sup..alpha.B1-acetyl-human
insulin, N.sup..alpha.B29-acetyl-N.sup..alpha.A1-acetyl-human
insulin, N.sup..alpha.A1-acetyl-N.sup..alpha.B1-acetyl-human
insulin,
N.sup..epsilon.B29-acetyl-N.sup..alpha.A1-acetyl-N.sup..alpha.B1-acetyl-h-
uman insulin.
[0161] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-propionyl-human insulin,
N.sup..alpha.B1-propionyl-human insulin,
N.sup..alpha.A1-propionyl-human insulin,
N.sup..epsilon.B29-acetyl-N.sup..alpha.B1-propionyl-human insulin,
N.sup..epsilon.B29-propionyl-N.sup..alpha.A1-propionyl-human
insulin, N.sup..alpha.A1-propionyl-N.sup..alpha.B1-propionyl-human
insulin,
N.sup..epsilon.B29-propionyl-N.sup..alpha.A1-propionyl-N.sup..alpha.B1-pr-
opionyl-human insulin.
[0162] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-butyryl-human insulin,
N.sup..alpha.B1-butyryl-human insulin,
N.sup..alpha.A1-butyryl-human insulin,
N.sup..epsilon.B29-butyryl-N.sup..alpha.B1-butyryl-human insulin,
N.sup..epsilon.B29-butyryl-N.sup..alpha.A1-butyryl-human insulin,
N.sup..alpha.A1-butyryl-N.sup..alpha.B1-butyryl-human insulin,
N.sup..epsilon.B29-butyryl-N.sup..alpha.A1-butyryl-N.sup..alpha.B1-butyry-
l-human insulin.
[0163] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-pentanoyl-human insulin,
N.sup..alpha.B1-pentanoyl-human insulin,
N.sup..alpha.A1-pentanoyl-human insulin,
N.sup..epsilon.B29-pentanoyl-N.sup..alpha.B1-pentanoyl-human
insulin,
N.sup..epsilon.B29-pentanoyl-N.sup..alpha.A1-pentanoyl-human
insulin, N.sup..alpha.A1-pentanoyl-N.sup..alpha.B1-pentanoyl-human
insulin,
N.sup..epsilon.B29-pentanoyl-N.sup..alpha.A1-pentanoyl-N.sup..alpha.B1-pe-
ntanoyl-human insulin.
[0164] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-hexanoyl-human insulin,
N.sup..alpha.B1-hexanoyl-human insulin,
N.sup..alpha.A1-hexanoyl-human insulin,
N.sup..epsilon.B29-hexanoyl-N.sup..alpha.B1-hexanoyl-human insulin,
N.sup..epsilon.B29-hexanoyl-N.sup..alpha.A1-hexanoyl-human insulin,
N.sup..alpha.A1-hexanoyl-N.sup..alpha.B1-hexanoyl-human insulin,
N.sup..epsilon.B29-hexanoyl-N.sup..alpha.A1-hexanoyl-N.sup..alpha.B1-hexa-
noyl-human insulin.
[0165] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-heptanoyl-human insulin,
N.sup..alpha.B1-heptanoyl-human insulin,
N.sup..alpha.A1-heptanoyl-human insulin,
N.sup..epsilon.B29-heptanoyl-N.sup..alpha.B1-heptanoyl-human
insulin, N.sup..epsilon.B29-heptanoyl-N.sup.aA1-heptanoyl-human
insulin, N.sup..alpha.A1-heptanoyl-N.sup..alpha.B1-heptanoyl-human
insulin,
N.sup..epsilon.B29-heptanoyl-N.sup..alpha.A1-heptanoyl-N.sup..alpha.B1-he-
ptanoyl-human insulin.
[0166] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..alpha.B1-octanoyl-human insulin,
N.sup..alpha.A1-octanoyl-human insulin,
N.sup..epsilon.B29-octanoyl-N.sup..alpha.B1-octanoyl-human insulin,
N.sup..epsilon.B29-octanoyl-N.sup..alpha.A1-octanoyl-human insulin,
N.sup..alpha.A1-octanoyl-N.sup..alpha.B1-octanoyl-human insulin,
N.sup..epsilon.B29-octanoyl-N.sup..alpha.A1-octanoyl-N.sup..alpha.B1-octa-
noyl-human insulin.
[0167] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-nonanoyl-human insulin,
N.sup..alpha.B1-nonanoyl-human insulin,
N.sup..alpha.A1-nonanoyl-human insulin,
N.sup..epsilon.B29-nonanoyl-N.sup..alpha.B1-nonanoyl-human insulin,
N.sup..epsilon.B29-nonanoyl-N.sup..alpha.A1-nonanoyl-human insulin,
N.sup..alpha.A1-nonanoyl-N.sup..alpha.B1-nonanoyl-human insulin,
N.sup..epsilon.B29-nonanoyl-N.sup..alpha.A1-nonanoyl-N.sup..alpha.B1-nona-
noyl-human insulin.
[0168] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-decanoyl-human insulin,
N.sup..alpha.B1-decanoyl-human insulin,
N.sup..alpha.A1-decanoyl-human insulin,
N.sup..epsilon.B29-decanoyl-N.sup..alpha.B1-decanoyl-human insulin,
N.sup..epsilon.B29-decanoyl-N.sup..alpha.A1-decanoyl-human insulin,
N.sup..alpha.A1-decanoyl-N.sup..alpha.B1-decanoyl-human insulin,
N.sup..epsilon.B29-decanoyl-N.sup..alpha.A1-decanoyl-N.sup..alpha.B1-deca-
noyl-human insulin.
[0169] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-formyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-formyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-formyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-formyl-N.sup..alpha.B1-formyl-Lys.sup.B28Pro.sup.B29-h-
uman insulin,
N.sup..epsilon.B28-formyl-N.sup..alpha.A1-formyl-Lys.sup.B28Pro.sup.B29-h-
uman insulin,
N.sup..alpha.A1-formyl-N.sup..alpha.B1-formyl-Lys.sup.B28Pro.sup.B29-huma-
n insulin,
N.sup..epsilon.B28-formyl-N.sup..alpha.A1-formyl-N.sup..alpha.B-
1-formyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B29-acetyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-acetyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-acetyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-acetyl-N.sup..alpha.B1-acetyl-Lys.sup.B28Pro.sup.B29-h-
uman insulin.
[0170] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-acetyl-N.sup..alpha.A1-acetyl-Lys.sup.B28Pro.sup.B29-h-
uman insulin,
N.sup..alpha.A1-acetyl-N.sup..alpha.B1-acetyl-Lys.sup.B28Pro.sup.B29-huma-
n insulin,
N.sup..epsilon.B28-acetyl-N.sup..alpha.A1-acetyl-N.sup..alpha.B-
1-acetyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0171] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-propionyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-propionyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-propionyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-propionyl-N.sup..alpha.B1-propionyl-Lys.sup.B28Pro.sup-
.B29-human insulin,
N.sup..epsilon.B28-propionyl-N.sup..alpha.A1-propionyl-Lys.sup.B28Pro.sup-
.B29-human insulin,
N.sup..alpha.A1-propionyl-N.sup..alpha.B1-propionyl-Lys.sup.B28Pro.sup.B2-
9-human insulin,
N.sup..epsilon.B28-propionyl-N.sup..alpha.A1-propionyl-N.sup..alpha.B1-pr-
opionyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0172] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-butyryl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-butyryl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-butyryl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-butyryl-N.sup..alpha.B1-butyryl-Lys.sup.B28Pro.sup.B29-
-human insulin,
N.sup..epsilon.B28-butyryl-N.sup..alpha.A1-butyryl-Lys.sup.B28Pro.sup.B29-
-human insulin,
N.sup..alpha.A1-butyryl-N.sup..alpha.B1-butyryl-Lys.sup.B28Pro.sup.B29-hu-
man insulin,
N.sup..epsilon.B28-butyryl-N.sup..alpha.A1-butyryl-N.sup..alpha.B1-butyry-
l-Lys.sup.B28Pro.sup.B29-human insulin.
[0173] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-pentanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-pentanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-pentanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-pentanoyl-N.sup..alpha.B1-pentanoyl-Lys.sup.B28Pro.sup-
.B29-human insulin,
N.sup..epsilon.B28-pentanoyl-N.sup..alpha.A1-pentanoyl-Lys.sup.B28Pro.sup-
.B29-human insulin,
N.sup..alpha.A1-pentanoyl-N.sup..alpha.B1-pentanoyl-Lys.sup.B28Pro.sup.B2-
9-human insulin,
N.sup..epsilon.B28-pentanoyl-N.sup..alpha.A1-pentanoyl-N.sup..alpha.B1-pe-
ntanoyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0174] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-hexanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-hexanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-hexanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-hexanoyl-N.sup..alpha.B1-hexanoyl-Lys.sup.B28Pro.sup.B-
29-human insulin,
N.sup..epsilon.B28-hexanoyl-N.sup..alpha.A1-hexanoyl-Lys.sup.B28Pro.sup.B-
29-human insulin,
N.sup..alpha.A1-hexanoyl-N.sup..alpha.B1-hexanoyl-Lys.sup.B28Pro.sup.B29--
human insulin,
N.sup..epsilon.B28-hexanoyl-N.sup..alpha.A1-hexanoyl-N.sup..alpha.B1-hexa-
noyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0175] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-heptanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-heptanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-heptanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28S-heptanoyl-N.sup..alpha.B1-heptanoyl-Lys.sup.B28Pro.su-
p.B29-human insulin,
N.sup..epsilon.B28-heptanoyl-N.sup..alpha.A1-heptanoyl-Lys.sup.B28Pro.sup-
.B29-human insulin,
N.sup..alpha.A1-heptanoyl-N.sup..alpha.B1-heptanoyl-Lys.sup.B28Pro.sup.B2-
9-human insulin,
N.sup..epsilon.B28-heptanoyl-N.sup..alpha.A1-heptanoyl-N.sup..alpha.B1-he-
ptanoyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0176] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-octanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-octanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-octanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-octanoyl-N.sup..alpha.B1-octanoyl-Lys.sup.B28Pro.sup.B-
29-human insulin,
N.sup..epsilon.B28-octanoyl-N.sup..alpha.A1-octanoyl-Lys.sup.B28Pro.sup.B-
29-human insulin,
N.sup..alpha.A1-octanoyl-N.sup..alpha.B1-octanoyl-Lys.sup.B28Pro.sup.B29--
human insulin,
N.sup..epsilon.B28-octanoyl-N.sup..alpha.A1-octanoyl-N.sup..alpha.B1-octa-
noyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0177] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B28-nonanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-nonanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-nonanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..epsilon.B28-nonanoyl-N.sup..alpha.B1-nonanoyl-Lys.sup.B28Pro.sup.B-
29 human insulin,
N.sup..epsilon.B28-nonanoyl-N.sup..alpha.A1-nonanoyl-Lys.sup.B28Pro.sup.B-
29-human insulin,
N.sup..alpha.A1-nonanoyl-N.sup..alpha.B1-nonanoyl-Lys.sup.B28Pro.sup.B29--
human insulin,
N.sup..epsilon.B28-nonanoyl-N.sup..alpha.A1-nonanoyl-N.sup..alpha.B1-nona-
noyl-Lys.sup.B28Pro.sup.B29-human insulin.
[0178] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup.B28-decanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.B1-decanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup..alpha.A1-decanoyl-Lys.sup.B28Pro.sup.B29-human insulin,
N.sup.B28-decanoyl-N.sup..alpha.B1-decanoyl-Lys.sup.B28Pro.sup.B29-human
insulin,
N.sup..epsilon.B28-decanoyl-N.sup..alpha.A1-decanoyl-Lys.sup.B28-
Pro.sup.B29-human insulin,
N.sup..alpha.A1-decanoyl-N.sup..alpha.B1-decanoyl-Lys.sup.B28Pro.sup.B29--
human insulin,
N.sup.B28-decanoyl-N.sup..alpha.A1-decanoyl-N.sup..alpha.B1-decanoyl-Lys.-
sup.B28Pro.sup.B29-human insulin.
[0179] In certain embodiments, an insulin molecule of the present
disclosure comprises the mutations and/or chemical modifications of
one of the following insulin molecules:
N.sup..epsilon.B29-pentanoyl-Gly.sup.A21Arg.sup.B31Arg.sup.B32-human
insulin,
N.sup..alpha.B1-hexanoyl-Gly.sup.A21Arg.sup.B31Arg.sup.B32-human
insulin,
N.sup..alpha.A1-heptanoyl-Gly.sup.A21Arg.sup.B31Arg.sup.B32-huma- n
insulin,
N.sup..epsilon.B29-octanoyl-N.sup..alpha.B1-octanoyl-Gly.sup.A2-
1Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B29-propionyl-N.sup..alpha.A1-propionyl-Gly.sup.A21Arg.sup-
.B31Arg.sup.B32-human insulin,
N.sup..alpha.A1-acetyl-N.sup..alpha.B1-acetyl-Gly.sup.A21Arg.sup.B31Arg.s-
up.B32-human insulin,
N.sup..epsilon.B29-formyl-N.sup..alpha.A1-formyl-N.sup..alpha.B1-formyl-G-
ly.sup.A21Arg.sup.B31Arg.sup.B32-human insulin,
N.sup..epsilon.B29-formyl-des(B26)-human insulin,
N.sup..alpha.B1-acetyl-Asp.sup.B28-human insulin,
N.sup..epsilon.B29-propionyl-N.sup..alpha.A1-propionyl-N.sup..alpha.B1-pr-
opionyl-Asp.sup.B1Asp.sup.B3AspB.sup.21-human insulin,
N.sup..epsilon.B29-pentanoyl-Gly.sup.A21-human insulin,
N.sup..alpha.B1-hexanoyl-Gly.sup.A21-human insulin,
N.sup..alpha.A1-heptanoyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29
octanoyl-N.sup..alpha.B1-octanoyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29-propionyl-N.sup..alpha.A1-propionyl-Gly.sup.A21-human
insulin,
N.sup..alpha.A1-acetyl-N.sup..alpha.B1-acetyl-Gly.sup.A21-human
insulin,
N.sup..epsilon.B29-formyl-N.sup..alpha.A1-formyl-N.sup..alpha.B1-
-formyl-Gly.sup.A21-human insulin,
N.sup..epsilon.B29-butyryl-des(B30)-human insulin,
N.sup..alpha.B1-butyryl-des(B30)-human insulin,
N.sup..alpha.A1-butyryl-des(B30)-human insulin,
N.sup..epsilon.B29-butyryl-N.sup..alpha.B1-butyryl-des(B30)-human
insulin,
N.sup..epsilon.B29-butyryl-N.sup..alpha.A1-butyryl-des(B30)-huma- n
insulin,
N.sup..alpha.A1-butyryl-N.sup..alpha.B1-butyryl-des(B30)-human
insulin,
N.sup..epsilon.B29-butyryl-N.sup..alpha.A1-butyryl-N.sup..alpha.-
B1-butyryl-des(B30)-human insulin.
[0180] The present disclosure also encompasses modified forms of
non-human insulins (e.g., porcine insulin, bovine insulin, rabbit
insulin, sheep insulin, etc.) that comprise any one of the
aforementioned mutations and/or chemical modifications.
[0181] These and other modified insulin molecules are described in
detail in U.S. Pat. Nos. 6,906,028; 6,551,992; 6,465,426;
6,444,641; 6,335,316; 6,268,335; 6,051,551; 6,034,054; 5,952,297;
5,922,675; 5,747,642; 5,693,609; 5,650,486; 5,547,929; 5,504,188;
5,474,978; 5,461,031; and 4,421,685; and in U.S. Pat. Nos.
7,387,996; 6,869,930; 6,174,856; 6,011,007; 5,866,538; and
5,750,497.
[0182] In some embodiments, an insulin molecule is modified and/or
mutated to reduce its affinity for the insulin receptor. Without
wishing to be bound to a particular theory, it is believed that
attenuating the receptor affinity of an insulin molecule through
modification (e.g., acylation) or mutation may decrease the rate at
which the insulin molecule is eliminated from serum. In some
embodiments, a decreased insulin receptor affinity in vitro
translates into a superior in vivo activity for an insulin
conjugate. In certain embodiments, an insulin molecule is mutated
such that the site of mutation is used as a conjugation point, and
conjugation at the mutated site reduces binding to the insulin
receptor (e.g., Lys.sup.A3). In certain other embodiments,
conjugation at an existing wild-type amino acid or terminus reduces
binding to the insulin receptor (e.g., Gly.sup.A1). In some
embodiments, an insulin molecule is conjugated at position A4, A5,
A8, A9, or B30. In certain embodiments, the conjugation at position
A4, A5, A8, A9, or B30 takes place via a wild-type amino acid side
chain (e.g., Glu.sup.A4). In certain other embodiments, an insulin
molecule is mutated at position A4, A5, A8, A9, or B30 to provide a
site for conjugation (e.g., Lys.sup.A4, Lys.sup.A5, Lys.sup.A8,
Lys.sup.A9, or Lys.sup.B30).
[0183] Methods for conjugating drugs including insulin molecules
are described herein. In certain embodiments, an insulin molecule
is conjugated via the A1 amino acid residue. In certain embodiments
the A1 amino acid residue is glycine. It is to be understood
however, that the present disclosure is not limited to N-terminal
conjugation and that in certain embodiments an insulin molecule may
be conjugated via a non-terminal A-chain amino acid residue. In
particular, the present disclosure encompasses conjugation via the
epsilon-amine group of a lysine residue present at any position in
the A-chain (wild-type or introduced by site-directed mutagenesis).
It will be appreciated that different conjugation positions on the
A-chain may lead to different reductions in insulin activity. In
certain embodiments, an insulin molecule is conjugated via the B1
amino acid residue. In certain embodiments the B1 amino acid
residue is phenylalanine. It is to be understood however, that the
present disclosure is not limited to N-terminal conjugation and
that in certain embodiments an insulin molecule may be conjugated
via a non-terminal B-chain amino acid residue. In particular, the
present disclosure encompasses conjugation via the epsilon-amine
group of a lysine residue present at any position in the B-chain
(wild-type or introduced by site-directed mutagenesis). For
example, in certain embodiments an insulin molecule may be
conjugated via the B29 lysine residue. In the case of insulin
glulisine, conjugation to the at least one ligand via the B3 lysine
residue may be employed. It will be appreciated that different
conjugation positions on the B-chain may lead to different
reductions in insulin activity.
[0184] In certain embodiments, the ligands are conjugated to more
than one conjugation point on a drug such as an insulin molecule.
For example, an insulin molecule can be conjugated at both the A1
N-terminus and the B29 lysine. In some embodiments, amide
conjugation takes place in carbonate buffer to conjugate at the B29
and A1 positions, but not at the B1 position. In other embodiments,
an insulin molecule can be conjugated at the A1 N-terminus, the B1
N-terminus, and the B29 lysine. In yet other embodiments,
protecting groups are used such that conjugation takes place at the
B1 and B29 or B1 and A1 positions. It will be appreciated that any
combination of conjugation points on an insulin molecule may be
employed. In some embodiments, at least one of the conjugation
points is a mutated lysine residue, e.g., Lys.sup.A3.
[0185] In various embodiments, W is an insulin sensitizer (i.e., a
drug which potentiates the action of insulin). Drugs which
potentiate the effects of insulin include biguanides (e.g.,
metformin) and glitazones. The first glitazone drug was
troglitazone which turned out to have severe side effects. Second
generation glitazones include pioglitazone and rosiglitazone which
are better tolerated although rosiglitazone has been associated
with adverse cardiovascular events in certain trials.
[0186] In various embodiments, W is an insulin secretagogue (i.e.,
a drug which stimulates insulin secretion by beta cells of the
pancreas). For example, in various embodiments, a conjugate may
include a sulfonylurea. Sulfonylureas stimulate insulin secretion
by beta cells of the pancreas by sensitizing them to the action of
glucose. Sulfonylureas can, moreover, inhibit glucagon secretion
and sensitize target tissues to the action of insulin. First
generation sulfonylureas include tolbutamide, chlorpropamide and
carbutamide. Second generation sulfonylureas which are active at
lower doses include glipizide, glibenclamide, gliclazide,
glibornuride and glimepiride. In various embodiments, a conjugate
may include a meglitinide. Suitable meglitinides include
nateglinide, mitiglinide and repaglinide. Their hypoglycemic action
is faster and shorter than that of sulfonylureas. Other insulin
secretagogues include glucagon-like peptide 1 (GLP-1) and GLP-1
analogs (i.e., a peptide with GLP-1 like bioactivity that differs
from GLP-1 by 1-10 amino acid substitutions, additions or deletions
and/or by a chemical modification). GLP-1 reduces food intake by
inhibiting gastric emptying, increasing satiety through central
actions and by suppressing glucagon release. GLP-1 lowers plasma
glucose levels by increasing pancreas islet cell proliferation and
increases insulin production following food consumption. GLP-1 may
be chemically modified, e.g., by lipid conjugation as in
liraglutide to extend its in vivo half-life. Yet other insulin
secretagogues include exendin-4 and exendin-4 analogs (i.e., a
peptide with exendin-4 like bioactivity that differs from exendin-4
by 1-10 amino acid substitutions, additions or deletions and/or by
a chemical modification). Exendin-4, found in the venom of the Gila
Monster, exhibits GLP-1 like bioactivity. It has a much longer
half-life than GLP-1 and, unlike GLP-1, it can be truncated by 8
amino acid residues at its N-terminus without losing bioactivity.
The N-terminal region of GLP-1 and exendin-4 are almost identical,
a significant difference being the second amino acid residue,
alanine in GLP-1 and glycine in exendin-4, which gives exendin-4
its resistance to in viva digestion. Exendin-4 also has an extra 9
amino acid residues at its C-terminus as compared to GLP-1. Mann et
al. Biochem. Soc. Trans. 35:713-716, 2007 and Runge et al.,
Biochemistry 46:5830-5840, 2007 describe a variety of GLP-1 and
exendin-4 analogs which may be used in a conjugate of the present
disclosure. The short half-life of GLP-1 results from enzymatic
digestion by dipeptidyl peptidase IV (DPP-IV). In certain
embodiments, the effects of endogenous GLP-1 may be enhanced by
administration of a DPP-IV inhibitor (e.g., vildagliptin,
sitagliptin, saxagliptin, linagliptin or alogliptin).
[0187] In various embodiments, W is amylin or an amylin analog
(i.e., a peptide with amylin like bioactivity that differs from
amylin by 1-10 amino acid substitutions, additions or deletions
and/or by a chemical modification). Amylin plays an important role
in glucose regulation (e.g., see Edelman and Weyer, Diabetes
Technol. Ther. 4:175-189, 2002). Amylin is a neuroendocrine hormone
that is co-secreted with insulin by the beta cells of the pancreas
in response to food intake. While insulin works to regulate glucose
disappearance from the bloodstream, amylin works to help regulate
glucose appearance in the bloodstream from the stomach and liver.
Pramlintide acetate (SYMLIN.RTM.) is an exemplary amylin analog.
Since native human amylin is amyloidogenic, the strategy for
designing pramlintide involved substituting certain residues with
those from rat amylin, which is not amyloidogenic. In particular,
proline residues are known to be structure-breaking residues, so
these were directly grafted from the rat sequence into the human
sequence. Glu-10 was also substituted with an asparagine.
Steps of Scheme I
[0188] In one aspect, the present invention provides methods for
preparing a conjugate of formula I from a prefunctionalized ligand
framework (PLF) A according to the steps depicted in Scheme I,
above.
[0189] At step S-1, a compound of formula F is protected with a
carboxylic acid protecting group. In certain embodiments, one
carboxylic acid of four carboxylic acids of formula F is protected
with a carboxylic acid protecting group in step S-1. In certain
embodiments, when PG.sup.1 is benzyl, step S-1 is carried out using
2-benzyloxy-1-methyl pyridinum triflate. In certain embodiments,
step S-1 takes place in a polar aprotic solvent. Polar aprotic
solvents include dichlormethane (DCM), tetrahydrofuran (THF),
acetone, ethyl acetate, dimethylformamide (DMF), acetonitrile,
dimethyl sulfoxide (DMSO), and N-methylpyrrolidinone (NMP). In
certain embodiments, the solvent is DMF. In some embodiments, step
S-1 takes place at a temperature above room temperature. In certain
embodiments, step S-1 is performed at a temperature between about
50.degree. C. and about 100.degree. C. In certain embodiments, step
S-1 is performed at about 80.degree. C.
[0190] At step S-2, a compound of formula E is coupled to a
compound of formula D, via amide bond formation. In some
embodiments, step S-2 is performed under standard peptide coupling
conditions which are known in the art; see, for example, Bailey, An
Introduction to Peptide Chemistry, Wiley, Chichester (1990); Jones,
The Chemical Synthesis of Peptides, OUP, Oxford (1991); Bodansky,
Peptide Chemistry: a Practical Textbook, Springer-Verlag, Berlin
(1993); Bodansky, Principles of Peptide Synthesis, 2.sup.nd ed.,
Springer-Verlag, Berlin (1993); Bodansky et al., Practice of
Peptide Synthesis, 2.sup.nd ed., Springer-Verlag, Berlin (1994);
Albertson, Org. React., 12, 157 (1962); Carpino et al, Acc. Chem.
Res., 29, 268 (1996). In some embodiments, a peptide coupling
reagent is used in the transformation. Exemplary peptide coupling
reagents include, but are not limited to,
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC),
dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC),
O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (HBTU),
O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (HATU),
O-(6-chlorobenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (HCTU),
O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
tetrafluoroborate (TBTU),
(benzotriazol-1-yloxy)tris(dimethylamino)phosphonium
hexafluorophosphate (BOP), bis(2-oxo-3-oxazolidinyl)phosphinic
chloride (BOP-Cl), (benzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PyBOP), bromotripyrrolidinophosphonium
hexafluorophosphate (PyBrOP), and chlorotripyrrolidinophosphonium
hexafluorophosphate (PyClOP). In certain embodiments, a
carbodiimide coupling reagent (e.g., EDC, DCC, DIC) is employed in
step S-2. In certain embodiments, EDC is used. In some embodiments,
an additive is used in the transformation. Exemplary additives
include 1-hydroxybenzotriazole (HOBt), 1-hydroxy-7-azabenzotriazole
(HOAt), and 4-(dimethylamino)pyridine (DMAP). In certain
embodiments, HOBt is employed in step S-2. In some embodiments, a
base is employed in step S-2. In some embodiments, the base is an
organic base. In certain embodiments, the base is a tertiary amine
(e.g., diisopropylethylamine or triethylamine). In certain
embodiments, the base is diisopropylethylamine.
[0191] In some embodiments, step S-2 takes place in a polar aprotic
solvent. Polar aprotic solvents include dichlormethane (DCM),
tetrahydrofuran (THF), acetone, ethyl acetate, dimethylformamide
(DMF), acetonitrile, dimethyl sulfoxide (DMSO), and
N-methylpyrrolidinone (NMP). In certain embodiments, the solvent is
DMF. In some embodiments, step S-2 takes place in a solvent
mixture. In certain embodiments, a solvent mixture includes a polar
aprotic solvent and a polar protic solvent. In certain embodiments,
step S-2 takes place in DMF/H.sub.2O.
[0192] In some embodiments, step S-2 is performed at a temperature
below room temperature. In some embodiments, step S-2 is performed
at room temperature. In certain embodiments, step S-2 begins at a
temperature below room temperature (e.g., about 0 to 5.degree. C.)
and is allowed to warm to room temperature.
[0193] At step S-3, removal of the PG.sup.1 protecting group of a
compound of formula C affords a free acid-containing compound of
formula B. Procedures for the removal of suitable amino protecting
groups are well known in the art; see Green (1999). In certain
embodiments, where the PG.sup.1 moiety of formula C is benzyl,
PG.sup.1 is removed by hydrogenation or other methods known in the
art. In certain embodiments, the benzyl group is removed using
catalytic hydrogenation or transfer hydrogenation. In certain
embodiments, benzyl group is removed using catalytic hydrogenation.
In certain embodiments, the hydrogenation is performed in an
alcoholic solvent. In certain embodiments, the hydrogenation is
performed in methanol. In certain embodiments, the hydrogenation is
performed in the presence of palladium on carbon.
[0194] At step S-4, the free acid group of a compound of formula B
is activated such that it comprises a suitable leaving group
(LG.sup.1) subject to nucleophilic displacement. Suitable LG.sup.1
groups are described herein. In some embodiments, LG.sup.1 is
--OSu. In certain embodiments, step S-4 employs a uronium reagent
for installing LG.sup.1. In certain embodiments, step S-4 employs
N,N,N',N'-Tetramethyl-O--(N-succinimidyl)uronium tetrafluoroborate
(TSTU). In certain embodiments, step S-4 takes place in a polar
aprotic solvent. In certain embodiments, step S-4 takes place in
DMF. In some embodiments, activation takes place in the presence of
a base. In certain embodiments, the base is an organic base. In
certain embodiments, the base is a tertiary amine (e.g.,
triethylamine or diisopropylethylamine). In certain embodiments,
the base is diisopropylethylamine. In certain embodiments, step S-4
takes place in the absence of a base. In some embodiments, step S-4
is performed at a temperature below room temperature. In certain
embodiments, the reaction takes place at a temperature between
about 0.degree. C. and room temperature. In certain embodiments,
the reaction takes place at about 0.degree. C.
Methods of Conjugation
[0195] At step S-5, an amine-containing drug W is reacted with a
compound of formula A to form an amide bond. In various
embodiments, an amine-bearing drug can be coupled to a compound of
formula A that contain a terminal activated ester moiety (e.g., see
Hermanson in Bioconjugate Techniques, 2.sup.nd edition, Academic
Press, 2008 and references cited therein). Briefly, a compound of
formula A having a terminal activated ester (e.g., --OSu, etc.) is
dissolved in an anhydrous organic solvent such as DMSO or DMF. The
desired number of equivalents of drug are then added and mixed for
several hours at room temperature. A drug can also be conjugated to
a free acid compound of formula B to produce a stable amide bond as
described by Baudys et al., Bioconj. Chem. 9:176-183, 1998. This
reaction can be achieved by adding tributylamine (TBA) and
isobutylchloroformate to a solution of a compound of formula B and
drug in dimethylsulfoxide (DMSO) under anhydrous conditions.
[0196] Certain drugs may naturally possess more than one amino
group. In some examples, it is possible to choose the chemical
reaction type and conditions to selectively react the component at
only one of those sites. For example, in the case where an insulin
molecule is conjugated through reactive amines, in certain
embodiments, the A1 and B29 amino groups of the insulin molecule
are BOC-protected as described in the Examples so that each insulin
molecule can only react at the Phe-B1 .alpha.-amino group. In some
embodiments, the B1 and B29 amino groups of the insulin molecule
are BOC-protected as described in the Examples so that each insulin
molecule can only react at the Gly-A1 .alpha.-amino group. In
certain embodiments, approximately one equivalent of BOC2-insulin
as a solution in DMSO is added at room temperature to a solution of
a compound of formula A in DMSO containing excess triethylamine and
allowed to react for an appropriate amount of time. In certain
embodiments, the reaction takes place in approximately one hour. In
some embodiments, the resulting conjugate is purified via reverse
phase HPLC (C8, acetonitrile/water mobile phase containing 0.1%
TFA) to purify the desired product from unreacted BOC2-insulin. In
certain embodiments, the desired elution peak is collected pooled
and rotovapped to remove acetonitrile followed by lyophilization to
obtain a dry powder. Finally, the BOC protecting groups are removed
by dissolving the lyophilized powder in 90% TFA/10% anisole for one
hour at 4 C followed by 100.times. superdilution in HEPES pH 8.2
buffer containing 0.150 M NaCl. The pH is adjusted to between 7.0
and 8.0 using NaOH solution after which the material is passed
through a Biogel P2 column to remove anisole, BOC, and any other
contaminating salts. The deprotected, purified aqueous conjugate
solution is then concentrated to the desired level and stored at 4
C until needed.
[0197] In another aspect, reaction may take place at the B29
epsilon-amino group using an unprotected insulin molecule in
carbonate buffer, since under those conditions the B29 amino group
is the most reactive of the three amino groups present in wild-type
insulin. In an exemplary synthesis, a compound of formula A is
dissolved in anhydrous DMSO followed by the addition of
triethylamine (TEA). The solution is stirred rapidly for a desired
amount of time at room temperature. The unprotected insulin
molecule is then dissolved separately at 17.2 mM in sodium
carbonate buffer (0.1 M, pH 11) and the pH subsequently adjusted to
10.8 with 1.0 N sodium hydroxide. Once dissolved, the A/DMSO/TEA
solution is added dropwise to the drug/carbonate buffer solution.
During the addition, the pH of the resulting mixture is adjusted
periodically to 10.8 if necessary using dilute HCl or NaOH. The
solution is allowed to stir for a desired amount of time after the
dropwise addition to ensure complete reaction.
[0198] In certain embodiments, the resulting conjugate is purified
using preparative reverse phase HPLC. Once collected, the solution
is rotovapped to remove acetonitrile and lyophilized to obtain pure
conjugate.
[0199] Furthermore, under the carbonate buffer conditions, the A1
amino group is the second most reactive amino group of wild-type
insulin. Thus, in certain embodiments, A1,B29-disubstituted
insulin-conjugates are synthesized using the conditions described
above with approximately ten times the amount of prefunctionalized
ligand framework per insulin molecule compared to the
B29-monosubstituted insulin-conjugate synthesis.
[0200] It will be appreciated that these exemplary procedures may
be used to produce other conjugates with different ligands and
drugs.
Conjugation Using N-Terminal Protecting Amino Acid Sequences
[0201] In some embodiments, the conjugation process described above
is performed using recombinant insulin molecules that include
N-terminal protecting amino acid sequences. FIG. 8 illustrates one
embodiment of this process in the context of a recombinant insulin
molecule that includes N-terminal protecting amino acid sequences
on both the A- and B-peptides (the N-terminal protecting amino acid
sequences are shown as A0 and B0, respectively). As described in
more detail below, the N-terminal protecting amino acid sequences
A0 and B0 may include one or more amino acid residues as long as
they include an Arg residue at their C-termini. As shown in FIG. 8A
and as described in Example 23, a proinsulin molecule that includes
these N-terminal protecting amino acid sequences is initially
produced recombinantly in yeast. After purification, the N-terminal
leader peptide (L in FIG. 8) and the internal C-peptide (C in FIG.
8) of the proinsulin molecule are cleaved using a C-terminal lysine
protease (e.g., Achromobacter lyticus protease or ALP). The
N-terminal leader peptide is cleaved because it includes a
C-terminal Lys residue. The internal C-peptide is cleaved because
it is flanked by two Lys residues (the Lys residue at B29 and a Lys
residue at the C-terminus of the C-peptide sequence). Conjugation
then takes place while the N-terminal protecting amino acid
sequences are present on the insulin molecule to produce a mixture
of conjugated insulin intermediates (conjugation will generally
occur preferentially at the more reactive Lys.sup.B29 but may also
occur at the N-termini of A0 and/or B0). In FIG. 8A, the insulin
molecule is conjugated with NHS--R* where R* corresponds to a
prefunctionalized ligand framework and NHS corresponds to an NHS
ester group. It is to be understood that the NHS ester group in
these Figures is exemplary and that here and at any point in this
disclosure the NHS ester group could be replaced with another
suitable activated ester group. As mentioned above, in certain
embodiments, this conjugation step may be performed by dissolving
NHS--R* in an anhydrous organic solvent such as DMSO or DMF and
then adding the desired number of equivalents of the insulin
molecule followed by mixing for several hours at room temperature.
The conjugated insulin intermediates are then treated with trypsin
or a trypsin-like protease that is capable of cleaving on the
C-terminus of Arg residues. As shown in FIG. 8B, this enzymatic
processing step collapses all of the conjugated insulin
intermediates into the desired insulin-conjugate where only
Lys.sup.B29 is conjugated.
[0202] FIG. 7 illustrates how the same process would proceed in the
absence of N-terminal protecting amino acid sequences on the A- and
B-peptides. As shown, the process would result in a mixture of
conjugated products and the desired product (e.g., the
insulin-conjugate where only Lys.sup.B29 is conjugated) would need
to be purified from the mixture (e.g., using preparative reverse
phase HPLC).
[0203] FIG. 9 illustrates another embodiment of this process in the
context of a recombinant insulin molecule that includes an
N-terminal protecting amino acid sequence on the A-peptide only
(the N-terminal protecting amino acid sequences is shown as A0). As
shown in FIG. 9, the reaction is performed under conditions that
promote conjugation at all available positions (i.e., A0, B131 and
B29). For example, this can be achieved by adding an excess of
NHS--R* to the reaction. Alternatively, conditions that promote
conjugation at the B1 and B29 positions could be used. The
conjugated insulin intermediates are then treated with trypsin to
produce the desired insulin-conjugate where both B1 and Lys.sup.B29
are conjugated. In some embodiments, conditions that promote
conjugation at the B29 position or at both the A0 and B29 positions
could be used (e.g., if the desired product is an insulin-conjugate
where only Lys.sup.B29 is conjugated). The present disclosure also
encompasses embodiments where the conjugation reaction produces a
more complex mixture of conjugated insulin intermediates (e.g.,
B29, A0/B29, B1/B29 and A0/B1/B29 conjugated insulin
intermediates). In such embodiments, treatment with trypsin will
produce a mixture of products (e.g., a B29 conjugated insulin
molecule and a B1/B29 conjugated insulin molecule). The desired
product is then purified from this mixture by techniques that are
disclosed herein (e.g., using preparative reverse phase HPLC).
[0204] FIG. 10 illustrates yet another embodiment of this process
in the context of a recombinant insulin molecule that includes an
N-terminal protecting amino acid sequence on the B-peptide only
(the N-terminal protecting amino acid sequences is shown as B0). As
shown in FIG. 10, the reaction is performed under conditions that
promote conjugation at all available positions (i.e., A1, B0 and
B29). For example, this can be achieved by adding an excess of
NHS--R* to the reaction. Alternatively, conditions that promote
conjugation at the A1 and B29 positions could be used (e.g., in
sodium carbonate buffer (0.1 M, pH 11) the A1 position is the
second most reactive position after B29). The conjugated insulin
intermediates are then treated with trypsin to produce the desired
insulin-conjugate where both A1 and Lys.sup.B29 are conjugated. The
present disclosure also encompasses embodiments where the
conjugation reaction produces a more complex mixture of conjugated
insulin intermediates (e.g., B29, A1/B29, B0/B29 and A1/B0/B29
conjugated insulin intermediates). In such embodiments, treatment
with trypsin will produce a mixture of products (e.g., a B29
conjugated insulin molecule and an A1/B29 conjugated insulin
molecule). The desired product is then purified from this mixture
by techniques that are disclosed herein (e.g., using preparative
reverse phase HPLC).
[0205] In certain embodiments, a recombinant insulin molecule that
includes one or more N-terminal protecting amino acid sequences
comprises an amino acid sequence of SEQ ID NO:1 (A-peptide) and an
amino acid sequence of SEQ ID NO:2 (B-peptide) and three disulfide
bridges as shown in formula X.sup.1:
##STR00012##
where Xaa at position A0 includes an N-terminal protecting amino
acid sequence or is missing; and Xaa at position B0 includes an
N-terminal protecting amino acid sequence or is missing, with the
proviso that at least one of A0 or B0 includes an N-terminal
protecting amino acid sequence.
[0206] It is to be understood that Xaa at positions A8, A9, A10,
A18, A21, A22, B3, B28, B29, B30 and B31 of formula XI may be
defined in accordance with any of the insulin molecules of formula
X.sup.1 that are described herein (including those set forth in
Tables 1-3). In certain embodiments, A8, A9, A10, and B30 are
selected from those shown in Table 3. In certain embodiments, A18
is Asn, Asp or Glu. In certain embodiments, A21 is Asn, Asp, Glu,
Gly or Ala. In certain embodiments, A22, B30 and B31 are missing.
In certain embodiments, B3 is Asn, Lys, Asp or Glu. In certain
embodiments, B28 is Pro, Ala, Lys, Leu, Val, or Asp. In certain
embodiments, B29 is Lys, Pro, or Glu. In certain embodiments, B29
is Lys.
[0207] In certain embodiments, A8, A9, A10, and B30 are selected
from those shown in Table 3; A18 is Asn, Asp or Glu; A21 is Asn,
Asp, Glu, Gly or Ala; A22, B30 and B31 are missing; B3 is Asn, Lys,
Asp or Glu; B28 is Pro, Ala, Lys, Leu, Val, or Asp; and B29 is
Lys.
[0208] In certain embodiments A22, B30 and B31 are missing and A8,
A9, A10, A18, A21, B3, B28, and B29 are the same as in wild-type
human insulin.
[0209] In certain embodiments, Xaa at position A0 includes an
N-terminal protecting amino acid sequence and Xaa at position B130
includes an N-terminal protecting amino acid sequence. In certain
embodiments, Xaa at position A0 includes an N-terminal protecting
amino acid sequence and Xaa at position B0 is missing. In certain
embodiments, Xaa at position A0 is missing and Xaa at position B0
includes an N-terminal protecting amino acid sequence.
[0210] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif [Asp/Glu]-Xaa'''-Arg at the C-terminus
where Xaa''' is missing or is a sequence of 1-10 codable amino
acids with the proviso that Xaa''' does not include Arg.
[0211] In certain embodiments, Xaa''' does not include Cys or
Lys.
[0212] In certain embodiments, Xaa''' includes 1-10 occurrences of
Asp. In certain embodiments, Xaa''' includes 1-10 occurrences of
Glu. In certain embodiments, Xaa''' includes 1-5 occurrences of Asp
and 1-5 occurrences of Glu.
[0213] In certain embodiments, Xaa''' is Pro. In certain
embodiments, Xaa''' includes Pro at the C-terminus. In certain
embodiments, Xaa''' includes Pro at the C-terminus and 1-10
occurrences of Asp. In certain embodiments, Xaa''' includes Pro at
the C-terminus and 1-10 occurrences of Glu. In certain embodiments,
Xaa''' includes Pro at the C-terminus, 1-5 occurrences of Asp and
1-5 occurrences of Glu.
[0214] In certain embodiments, Xaa''' is Gly. In certain
embodiments, Xaa''' includes Gly at the C-terminus. In certain
embodiments, Xaa''' includes Gly at the C-terminus and 1-10
occurrences of Asp. In certain embodiments, Xaa''' includes Gly at
the C-terminus and 1-10 occurrences of Glu. In certain embodiments,
Xaa''' includes Gly at the C-terminus, 1-5 occurrences of Asp and
1-5 occurrences of Glu.
[0215] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif [Asp/Glu]-[Asp/Glu]-Arg at the
C-terminus.
[0216] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif [Asp/Glu]-Asp-Arg at the
C-terminus.
[0217] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif [Asp/Glu]-Glu-Arg at the
C-terminus.
[0218] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Asp-[Asp/Glu]-Arg at the
C-terminus.
[0219] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Glu-[Asp/Glu]-Arg at the
C-terminus.
[0220] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif
[Asp/Glu]-[Asp/Glu]-[Asp/Glu]-[Asp/Glu]-Pro-Arg at the C-terminus
(SEQ ID NO:20).
[0221] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif
[Asp/Glu]-[Asp/Glu]-Gly-[Asp/Glu]-Xaa'''-Arg at the C-terminus
where Xaa''' is any codable amino acid (SEQ ID NO:21). In certain
embodiments, Xaa''' is Gly. In certain embodiments, Xaa''' is
Pro.
[0222] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Asp-Asp-Gly-Asp-Pro-Arg at the
C-terminus (SEQ ID NO:22).
[0223] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Glu-Glu-Gly-Glu-Pro-Arg at the
C-terminus (SEQ ID NO:23).
[0224] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Asp-Asp-Gly-Asp-Gly-Arg at the
C-terminus (SEQ ID NO:24).
[0225] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Glu-Glu-Gly-Glu-Gly-Arg at the
C-terminus (SEQ ID NO:25).
[0226] In certain embodiments, the N-terminal protecting amino acid
sequence comprises the motif Asp-Glu-Arg at the C-terminus (SEQ ID
NO:26).
[0227] In certain embodiments, the N-terminal protecting amino acid
sequence consists of one of the aforementioned motifs. In certain
embodiments, Xaa at position A0 and/or B0 consists of one of the
aforementioned motifs.
[0228] In certain embodiments, the present disclosure provides a
method comprising steps of: (a) performing an amide conjugation
between a prefunctionalized ligand framework that includes a
terminal activated ester and an insulin molecule that includes one
or more N-terminal protecting amino acid sequences to produce one
or more conjugated insulin intermediates and (b) cleaving the one
or more N-terminal protecting amino acid sequences from the one or
more conjugated insulin intermediates with a protease that cleaves
on the C-terminal side of Arg. In some embodiments, the protease is
trypsin. In some embodiments, the protease is a trypsin-like
protease. In some embodiments, the desired product is purified
(e.g., using preparative reverse phase HPLC) from a mixture of
conjugated insulin molecules produced in step (b).
[0229] In certain embodiments, the insulin molecule is as shown in
formula X.sup.1 where Xaa at position A0 includes an N-terminal
protecting amino acid sequence and Xaa at position B0 includes an
N-terminal protecting amino acid sequence. In some of these
embodiments, Xaa at position B29 is Lys and the method produces an
insulin molecule of formula X.sup.1 where A0 and B0 are missing and
a prefunctionalized ligand framework is conjugated at
Lys.sup.B29.
[0230] In certain embodiments, the insulin molecule is as shown in
formula X.sup.1 where Xaa at position A0 includes an N-terminal
protecting amino acid sequence and Xaa at position B0 is missing.
In some of these embodiments, Xaa at position B29 is Lys and the
method produces an insulin molecule of formula X.sup.1 where A0 and
B0 are missing and a prefunctionalized ligand framework is
conjugated at position B1 and Lys.sup.B29. In some of these
embodiments, Xaa at position B29 is Lys and the method produces an
insulin molecule of formula X.sup.1 where A0 and B0 are missing and
a prefunctionalized ligand framework is conjugated at Lys.sup.B29.
In certain embodiments, the insulin molecule that is conjugated at
position BI and Lys.sup.B29 is purified (e.g., using preparative
reverse phase HPLC) from a mixture that includes insulin molecules
that are conjugated at position B1 and Lys.sup.B29 and insulin
molecules that are conjugated at Lys.sup.B29. In certain
embodiments, the insulin molecule that is conjugated at Lys.sup.B29
is purified (e.g., using preparative reverse phase HPLC) from a
mixture that includes insulin molecules that are conjugated at
position B1 and Lys.sup.B29 and insulin molecules that are
conjugated at Lys.sup.B29.
[0231] In certain embodiments, the insulin molecule is as shown in
formula X.sup.1 where Xaa at position A0 is missing and Xaa at
position B0 includes an N-terminal protecting amino acid sequence.
In some of these embodiments, Xaa at position B29 is Lys and the
method produces an insulin molecule of formula X.sup.1 where A0 and
B0 are missing and prefunctionalized ligand framework is conjugated
at position A1 and Lys.sup.B29. In some of these embodiments, Xaa
at position B29 is Lys and the method produces an insulin molecule
of formula X.sup.1 where A0 and B0 are missing and a
prefunctionalized ligand framework is conjugated at Lys.sup.B29. In
certain embodiments, the insulin molecule that is conjugated at
position A1 and Lys.sup.B29 is purified (e.g., using preparative
reverse phase HPLC) from a mixture that includes insulin molecules
that are conjugated at position A1 and Lys.sup.B29 and insulin
molecules that are conjugated at Lys.sup.B29. In certain
embodiments, the insulin molecule that is conjugated at Lys.sup.B29
is purified (e.g., using preparative reverse phase HPLC) from a
mixture that includes insulin molecules that are conjugated at
position A1 and Lys.sup.B29 and insulin molecules that are
conjugated at Lys.sup.B29.
Multiple Sites of Conjugation (Scheme II)
[0232] It will be understood that a compound of formula A may react
multiple times with a drug having more than one amino group. Thus
in certain embodiments, the present invention provides a method for
preparing a conjugate of formula I-a from an appropriate number of
equivalents of a compound of formula A as depicted in Scheme II,
below:
##STR00013##
wherein X, Alk, LG.sup.1, and W are as defined above, and in
classes and subclasses described above and herein, and j is 2 or 3.
In general, it is to be understood that any scheme disclosed herein
which shows a single point of conjugation encompasses embodiments
where two or more compounds of formula A are conjugated to the drug
W.
Scheme III
[0233] In some embodiments, W is an insulin molecule and the
present invention provides a method for preparing a conjugate of
formula II from a compound of formula A as depicted in Scheme III,
below:
##STR00014##
wherein X, Alk, and LG.sup.1 are as defined above, and in classes
and subclasses described above and herein.
[0234] As described herein, an insulin molecule may be conjugated
at various amine positions. In certain embodiments, an insulin
conjugate is shown in FIG. 1. In certain embodiments, an insulin
molecule is conjugated at the B1, A1, or Lys.sup.B29 position.
Formula II in Scheme III shows just one point of conjugation for
simplicity but it is to be understood that a compound of formula A
may be conjugated at two or more positions on the insulin molecule
as shown in Scheme II and formula I-a. In certain embodiments, an
insulin molecule is conjugated at the A1 and Lys.sup.B29 positions.
In certain embodiments, an insulin molecule is conjugated at the A1
and B1 positions. In certain embodiments, an insulin molecule is
conjugated at the B1 and Lys.sup.B29 positions. In certain
embodiments, an insulin molecule is conjugated at the A1, B1 and
Lys.sup.B29 positions. In certain embodiments, an insulin molecule
is conjugated via the side chain of a non-terminal lysine residue
which may or may not be present in the wild-type sequence of human
insulin (e.g., at positions B3, B28 or B29).
Scheme IV
[0235] In some embodiments, LG.sup.1 is --OSu, and the present
invention provides a method for preparing a conjugate of formula II
from a compound of formula A-i as depicted in Scheme IV, below:
##STR00015##
wherein X and Alk are as defined above, and in classes and
subclasses described above and herein. Formula II in Scheme IV
shows just one point of conjugation for simplicity but it is to be
understood that a compound of formula A-i may be conjugated at two
or more positions on the insulin molecule as shown in Scheme II and
formula I-a.
[0236] In step S-8, the --OSu group on a compound of formula A-i is
displaced by an insulin amino group as described above.
Synthesis of Conjugate I from Compound A
[0237] According to another aspect, the present invention provides
a method for preparing a conjugate of formula I:
##STR00016##
wherein: [0238] each occurrence of X is independently a ligand;
[0239] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0240] W is a drug; comprising the
steps of: [0241] (a) providing a compound of formula A:
##STR00017##
[0241] wherein: [0242] each occurrence of X is independently a
ligand; [0243] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0244] LG.sup.1
is a suitable leaving group; and [0245] (b) reacting said compound
of formula A with an amine-containing drug to form a conjugate of
formula I.
[0246] Formula I above shows just one point of conjugation for
simplicity but it is to be understood that a compound of formula A
may be conjugated at two or more positions on the drug W as shown
in Scheme II and formula I-a.
Synthesis of Conjugate II from Compound A
[0247] In certain embodiments, the present invention provides a
method for preparing a conjugate of formula II:
##STR00018##
wherein: [0248] each occurrence of X is independently a ligand; and
[0249] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; comprising the steps of: [0250] (a)
providing a compound of formula A:
##STR00019##
[0250] wherein: [0251] each occurrence of X is independently a
ligand; [0252] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0253] LG.sup.1
is a suitable leaving group; and [0254] (b) reacting said compound
of formula A with an insulin molecule to form a conjugate of
formula II.
[0255] As defined above, in compounds of formulae II and A each
occurrence of X is independently a ligand. In certain embodiments,
each occurrence of X is the same ligand. As defined above, in
compounds of formula A, LG.sup.1 is a suitable leaving group. In
certain embodiments, LG.sup.1 is --OSu.
[0256] As defined above, in compounds of formulae II and A each
occurrence of Alk is independently a C.sub.2-C.sub.12 alkylene
chain, wherein one or more methylene units is optionally replaced
by --O-- or --S--. In certain embodiments, each occurrence of Alk
is the same. In certain embodiments, Alk of formulae II and A is
ethylene.
[0257] Formula II above shows just one point of conjugation for
simplicity but it is to be understood that a compound of formula A
may be conjugated at two or more positions on the insulin molecule
as shown in Scheme II and formula I-a.
[0258] In certain embodiments, a conjugate of formula II is
selected from those depicted in FIG. 1.
Synthesis of Compound A from Compound B
[0259] According to another embodiment, the present invention
provides a method for preparing a compound of formula A:
##STR00020##
wherein: [0260] each occurrence of X is independently a ligand;
[0261] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0262] LG.sup.1 is a suitable
leaving group; comprising the steps of: [0263] (a) providing a
compound of formula B:
##STR00021##
[0263] wherein: [0264] each occurrence of X is independently a
ligand; and [0265] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0266] (b)
activating the carboxylic acid of said compound of formula B to
form a compound of formula A. Synthesis of Compound B from Compound
C
[0267] According to another embodiment, the present invention
provides a method for preparing a compound of formula B:
##STR00022##
wherein: [0268] each occurrence of X is independently a ligand; and
[0269] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; comprising the steps of: [0270] (a)
providing a compound of formula C:
##STR00023##
[0270] wherein: [0271] each occurrence of X is independently a
ligand; [0272] each occurrence of Alk is independently a
C.sub.2-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; [0273] PG.sup.1 is
a carboxylic acid protecting group; and [0274] (b) deprotecting the
compound of formula C to form a compound of formula B. Synthesis of
Compound C from Compound D
[0275] Yet another aspect of the present invention provides a
method for preparing a compound of formula C:
##STR00024##
wherein: [0276] each occurrence of X is independently a ligand;
[0277] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0278] PG.sup.1 is a carboxylic
acid protecting group; comprising the steps of: [0279] (a)
providing a compound of formula D:
##STR00025##
[0279] wherein: [0280] PG.sup.1 is a carboxylic acid protecting
group; and [0281] Alk is a C.sub.1-C.sub.12 alkylene chain, wherein
one or more methylene units is optionally replaced by --O-- or
--S--; and [0282] (b) reacting the compound of formula D with an
amine-containing ligand H.sub.2N--X (E) to form a compound of
formula C. Synthesis of Compound D from Compound F
[0283] According to another embodiment, the present invention
provides a method for preparing a compound of formula D:
##STR00026##
wherein: [0284] PG.sup.1 is a carboxylic acid protecting group; and
[0285] Alk is a C.sub.1-C.sub.12 alkylene chain, wherein one or
more methylene units is optionally replaced by --O-- or --S--;
comprising the steps of: [0286] (a) providing a compound of formula
F:
##STR00027##
[0286] wherein: [0287] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; and [0288] (b) protecting a carboxylic acid moiety of
compound F to afford a compound of formula D.
Synthesis of Compound A (Steps S-1 Through S-4)
[0289] According to another embodiment, the present invention
provides a method for preparing a compound of formula A:
##STR00028##
wherein: [0290] each occurrence of X is independently a ligand;
[0291] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0292] LG.sup.1 is a suitable
leaving group; comprising the steps of: [0293] (a) providing a
compound of formula F:
##STR00029##
[0293] wherein: [0294] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; [0295] (b) protecting a carboxylic acid moiety of
compound F to afford a compound of formula D:
##STR00030##
[0295] wherein: [0296] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; and [0297] PG.sup.1 is a carboxylic acid protecting
group; [0298] (c) reacting the compound of formula D with an
amine-containing ligand H.sub.2N--X (E) to form a compound of
formula C:
##STR00031##
[0298] wherein: [0299] each occurrence of X is independently a
ligand; [0300] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0301] PG.sup.1
is a carboxylic acid protecting group; [0302] (d) deprotecting the
compound of formula C to form a compound of formula B:
##STR00032##
[0302] wherein: [0303] each occurrence of X is independently a
ligand; and [0304] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0305] (e)
activating the carboxylic acid of said compound of formula B to
form a compound of formula A.
Synthesis of Conjugate I (Steps S-1 Through S-5)
[0306] According to another embodiment, the present invention
provides a method for preparing a conjugate of formula I:
##STR00033##
wherein: [0307] each occurrence of X is independently a ligand;
[0308] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0309] W is a drug; comprising the
steps of: [0310] (a) providing a compound of formula F:
##STR00034##
[0310] wherein: [0311] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; [0312] (b) protecting a carboxylic acid moiety of
compound F to afford a compound of formula D:
##STR00035##
[0312] wherein: [0313] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; and [0314] PG.sup.1 is a carboxylic acid protecting
group; [0315] (c) reacting the compound of formula D with an
amine-containing ligand H.sub.2N--X (E) to form a compound of
formula C:
##STR00036##
[0315] wherein: [0316] each occurrence of X is independently a
ligand; [0317] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0318] PG.sup.1
is a carboxylic acid protecting group; [0319] (d) deprotecting the
compound of formula C to form a compound of formula B:
##STR00037##
[0319] wherein: [0320] each occurrence of X is independently a
ligand; and [0321] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; [0322] (e)
activating the carboxylic acid of said compound of formula B to
form a compound of formula A:
##STR00038##
[0322] wherein: [0323] each occurrence of X is independently a
ligand; [0324] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0325] LG.sup.1
is a suitable leaving group; and [0326] (f) reacting the compound
of formula A with an amine-containing drug to form a conjugate of
formula I.
[0327] Formula I above shows just one point of conjugation for
simplicity but it is to be understood that a compound of formula A
may be conjugated at two or more positions on the drug W as shown
in Scheme II and formula I-a.
Synthesis of Conjugate II (Steps S-1, S-2, S-3, S-4, and S-7)
[0328] According to another embodiment, the present invention
provides a method for preparing a conjugate of formula II:
##STR00039##
wherein: [0329] each occurrence of X is independently a ligand;
[0330] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene units is optionally
replaced by --O-- or --S--; and [0331] W is a drug; comprising the
steps of: [0332] (a) providing a compound of formula F:
##STR00040##
[0332] wherein: [0333] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; [0334] (b) protecting a carboxylic acid moiety of
compound F to afford a compound of formula D:
##STR00041##
[0334] wherein: [0335] Alk is a C.sub.1-C.sub.12 alkylene chain,
wherein one or more methylene units is optionally replaced by --O--
or --S--; and [0336] PG.sup.1 is a carboxylic acid protecting
group; [0337] (c) reacting the compound of formula D with an
amine-containing ligand H.sub.2N--X (E) to form a compound of
formula C:
##STR00042##
[0337] wherein: [0338] each occurrence of X is independently a
ligand; [0339] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0340] PG.sup.1
is a carboxylic acid protecting group; [0341] (d) deprotecting the
compound of formula C to form a compound of formula B:
##STR00043##
[0341] wherein: [0342] each occurrence of X is independently a
ligand; and [0343] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; [0344] (e)
activating the carboxylic acid of said compound of formula B to
form a compound of formula A:
##STR00044##
[0344] wherein: [0345] each occurrence of X is independently a
ligand; [0346] each occurrence of Alk is independently a
C.sub.1-C.sub.12 alkylene chain, wherein one or more methylene
units is optionally replaced by --O-- or --S--; and [0347] LG.sup.1
is a suitable leaving group; and [0348] (f) reacting the compound
of formula A with an insulin molecule to form a compound of formula
II.
[0349] Formula II above shows just one point of conjugation for
simplicity but it is to be understood that a compound of formula A
may be conjugated at two or more positions on the insulin molecule
as shown in Scheme II and formula I-a.
Intermediate Compound F
[0350] Yet another aspect of the present invention provides a
compound of formula F:
##STR00045##
wherein:
[0351] Alk is a C.sub.1-C.sub.12 alkylene chain, wherein one or
more methylene groups may be substituted by --O-- or --S--.
[0352] For compounds of formula F, Alk is as described in
embodiments herein, In some embodiments, Alk is a C.sub.2 alkylene
chain. According to one aspect of the present invention, the
compound of formula F is
##STR00046##
Intermediate Compound D
[0353] Yet another aspect of the present invention provides a
compound of formula D:
##STR00047##
wherein:
[0354] Alk is a C.sub.1-C.sub.2 alkylene chain, wherein one or more
methylene groups may be substituted by --O-- or --S--; and
[0355] PG.sup.1 is a carboxylic acid protecting group.
[0356] For compounds of formula D, each of Alk and PG.sup.1 are as
described in embodiments herein. In some embodiments, Alk is a
C.sub.2 alkylene chain. According to one aspect of the present
invention, the compound of formula D is
##STR00048##
Intermediate Compound C
[0357] Yet another aspect of the present invention provides a
compound of formula C:
##STR00049##
wherein: [0358] each occurrence of X is independently a ligand;
[0359] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene groups may be
substituted by --O-- or --S--; and [0360] PG.sup.1 is a carboxylic
acid protecting group.
[0361] For compounds of formula C, each of X, Alk, and PG.sup.1 are
as described in embodiments herein. In some embodiments, Alk is a
C.sub.2 alkylene chain. In certain embodiments, X is EG, EM, EBM,
ETM, EGA, or EF as described herein. According to one aspect of the
present invention, the compound of formula C is
##STR00050##
Intermediate Compound B
[0362] Yet another aspect of the present invention provides a
compound of formula B:
##STR00051##
wherein: [0363] each occurrence of X is independently a ligand; and
[0364] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene groups may be
substituted by --O-- or --S--.
[0365] For compounds of formula B, each of X and Alk are as
described in embodiments herein. In some embodiments, Alk is a
C.sub.2 alkylene chain. In certain embodiments, X is EG, EM, EBM,
ETM, EGA, or EF as described herein. According to one aspect of the
present invention, the compound of formula B is
##STR00052##
Intermediate Compound A
[0366] Another aspect of the present invention provides a compound
of formula A:
##STR00053##
wherein: [0367] each occurrence of X is independently a ligand;
[0368] each occurrence of Alk is independently a C.sub.1-C.sub.12
alkylene chain, wherein one or more methylene groups may be
substituted by --O-- or --S--; and [0369] LG.sup.1 is a suitable
leaving group.
[0370] For compounds of formula A, each of X, Alk, and LG.sup.1 are
as described in embodiments herein. In some embodiments, Alk is a
C.sub.2 alkylene chain. In certain embodiments, X is EG, EM, EBM,
ETM, EGA, or EF as described herein. According to one aspect of the
present invention, the compound of formula A is:
##STR00054##
[0371] In any of the aforementioned embodiments, when W is an
insulin molecule, the following may apply:
[0372] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the B1 amino
group of the insulin molecule.
[0373] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the A1 amino
group of the insulin molecule.
[0374] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the
Lys.sup.B29 amino group of the insulin molecule.
[0375] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the A1 and B1
amino groups of the insulin molecule.
[0376] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the B1 and
Lys.sup.B29 amino groups of the insulin molecule.
[0377] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the A1 and
Lys.sup.B29 amino groups of the insulin molecule.
[0378] In certain embodiments, X is any one of ETM, EM, EBM, EG,
EGA, and EF, and intermediate compound A reacts with the A1, B1,
and Lys.sup.B29 amino groups of the insulin molecule.
[0379] In any of the aforementioned embodiments, when W is an
insulin molecule, the following may apply:
[0380] In certain embodiments, X is ETM, and intermediate compound
A reacts with the B1 amino group of the insulin molecule, the A1
amino group of the insulin molecule, the Lys.sup.B29 amino group of
the insulin molecule, the A1 and B1 amino groups of the insulin
molecule, the B1 and Lys.sup.B29 amino groups of the insulin
molecule, the A1 and Lys.sup.B29 amino groups of the insulin
molecule, or the A1, B1, and Lys.sup.B29 amino groups of the
insulin molecule.
[0381] In certain embodiments, X is EM, and intermediate compound A
reacts with the B1 amino group of the insulin molecule, the A1
amino group of the insulin molecule, the Lys.sup.B29 amino group of
the insulin molecule, the A1 and B1 amino groups of the insulin
molecule, the B1 and Lys.sup.B29 amino groups of the insulin
molecule, the A1 and Lys.sup.B29 amino groups of the insulin
molecule, or the A1, B1, and Lys.sup.B29 amino groups of the
insulin molecule.
[0382] In certain embodiments, X is EBM, and intermediate compound
A reacts with the B1 amino group of the insulin molecule, the A1
amino group of the insulin molecule, the Lys.sup.B29 amino group of
the insulin molecule, the A1 and B1 amino groups of the insulin
molecule, the B1 and Lys.sup.B29 amino groups of the insulin
molecule, the A1 and Lys.sup.B29 amino groups of the insulin
molecule, or the A1, B31, and Lys.sup.B29 amino groups of the
insulin molecule.
[0383] In certain embodiments, X is EG, and intermediate compound A
reacts with the B1 amino group of the insulin molecule, the A1
amino group of the insulin molecule, the Lys.sup.B29 amino group of
the insulin molecule, the A1 and B1 amino groups of the insulin
molecule, the B1 and Lys.sup.B29 amino groups of the insulin
molecule, the A1 and Lys.sup.B29 amino groups of the insulin
molecule, or the A1, B1, and Lys.sup.B29 amino groups of the
insulin molecule.
[0384] In certain embodiments, X is EGA, and intermediate compound
A reacts with the B1 amino group of the insulin molecule, the A1
amino group of the insulin molecule, the Lys.sup.B29 amino group of
the insulin molecule, the A1 and B1 amino groups of the insulin
molecule, the B1 and Lys.sup.B29 amino groups of the insulin
molecule, the A1 and Lys.sup.B29 amino groups of the insulin
molecule, or the A1, B1, and Lys.sup.B29 amino groups of the
insulin molecule.
[0385] In certain embodiments, X is EF, and intermediate compound A
reacts with the B1 amino group of the insulin molecule, the A1
amino group of the insulin molecule, the Lys.sup.B29 amino group of
the insulin molecule, the A1 and B1 amino groups of the insulin
molecule, the BI and Lys.sup.B29 amino groups of the insulin
molecule, the A1 and Lys.sup.B29 amino groups of the insulin
molecule, or the A1, B1, and Lys.sup.B29 amino groups of the
insulin molecule.
[0386] In certain embodiments, X is ETM, Alk is a C.sub.2 alkylene
chain and intermediate compound A reacts with the B1 amino group of
the insulin molecule. In certain embodiments, X is ETM, Alk is a
C.sub.2 alkylene chain and intermediate compound A reacts with the
A1 amino group of the insulin molecule. In certain embodiments, X
is ETM, Alk is a C.sub.2 alkylene chain and intermediate compound A
reacts with the A1 and B1 amino groups of the insulin molecule. In
certain embodiments, X is ETM, Alk is a C.sub.2 alkylene chain and
intermediate compound A reacts with the B and Lys.sup.B29 amino
groups of the insulin molecule. In certain embodiments, X is ETM,
Alk is a C.sub.2 alkylene chain and intermediate compound A reacts
with the A1 and Lys.sup.B29 amino groups of the insulin molecule.
In certain embodiments, X is ETM, Alk is a C.sub.2 alkylene chain
and intermediate compound A reacts with the A1, B1, and Lys.sup.B29
amino groups of the insulin molecule.
[0387] In certain embodiments, X is EM, Alk is a C.sub.2 alkylene
chain and intermediate compound A reacts with the B1 amino group of
the insulin molecule. In certain embodiments, X is EM, Alk is a
C.sub.2 alkylene chain and intermediate compound A reacts with the
A1 amino group of the insulin molecule. In certain embodiments, X
is EM, Alk is a C.sub.2 alkylene chain and intermediate compound A
reacts with the A1 and B1 amino groups of the insulin molecule. In
certain embodiments, X is EM, Alk is a C.sub.2 alkylene chain and
intermediate compound A reacts with the B1 and Lys.sup.B29 amino
groups of the insulin molecule. In certain embodiments, X is EM,
Alk is a C.sub.2 alkylene chain and intermediate compound A reacts
with the A1 and Lys.sup.B29 amino groups of the insulin molecule.
In certain embodiments, X is EM, Alk is a C.sub.2 alkylene chain
and intermediate compound A reacts with the A1, B1, and Lys.sup.B29
amino groups of the insulin molecule.
[0388] In certain embodiments, X is EBM, Alk is a C.sub.2 alkylene
chain and intermediate compound A reacts with the B1 amino group of
the insulin molecule. In certain embodiments, X is EBM, Alk is a
C.sub.2 alkylene chain and intermediate compound A reacts with the
A1 amino group of the insulin molecule. In certain embodiments, X
is EBM, Alk is a C.sub.2 alkylene chain and intermediate compound A
reacts with the A1 and B1 amino groups of the insulin molecule. In
certain embodiments, X is EBM, Alk is a C.sub.2 alkylene chain and
intermediate compound A reacts with the BI and Lys.sup.B29 amino
groups of the insulin molecule. In certain embodiments, X is EBM,
Alk is a C.sub.2 alkylene chain and intermediate compound A reacts
with the A1 and Lys.sup.B29 amino groups of the insulin molecule.
In certain embodiments, X is EBM, Alk is a C.sub.2 alkylene chain
and intermediate compound A reacts with the A1, B1, and Lys.sup.B29
amino groups of the insulin molecule.
[0389] In certain embodiments, X is EG, Alk is a C.sub.2 alkylene
chain and intermediate compound A reacts with the B1 amino group of
the insulin molecule. In certain embodiments, X is EG, Alk is a
C.sub.2 alkylene chain and intermediate compound A reacts with the
A1 amino group of the insulin molecule. In certain embodiments, X
is EG, Alk is a C.sub.2 alkylene chain and intermediate compound A
reacts with the A1 and B1 amino groups of the insulin molecule. In
certain embodiments, X is EG, Alk is a C.sub.2 alkylene chain and
intermediate compound A reacts with the B1 and Lys.sup.B29 amino
groups of the insulin molecule. In certain embodiments, X is EG,
Alk is a C.sub.2 alkylene chain and intermediate compound A reacts
with the A1 and Lys.sup.B29 amino groups of the insulin molecule.
In certain embodiments, X is EG, Alk is a C.sub.2 alkylene chain
and intermediate compound A reacts with the A1, B1, and Lys.sup.B29
amino groups of the insulin molecule.
[0390] In certain embodiments, X is EGA, Alk is a C.sub.2 alkylene
chain and intermediate compound A reacts with the B1 amino group of
the insulin molecule. In certain embodiments, X is EGA, Alk is a
C.sub.2 alkylene chain and intermediate compound A reacts with the
A1 amino group of the insulin molecule. In certain embodiments, X
is EGA, Alk is a C.sub.2 alkylene chain and intermediate compound A
reacts with the A1 and B1 amino groups of the insulin molecule. In
certain embodiments, X is EGA, Alk is a C.sub.2 alkylene chain and
intermediate compound A reacts with the B1 and Lys.sup.B29 amino
groups of the insulin molecule. In certain embodiments, X is EGA,
Alk is a C.sub.2 alkylene chain and intermediate compound A reacts
with the A1 and Lys.sup.B29 amino groups of the insulin molecule.
In certain embodiments, X is EGA, Alk is a C.sub.2 alkylene chain
and intermediate compound A reacts with the A1, B1, and Lys.sup.B29
amino groups of the insulin molecule.
[0391] In certain embodiments, X is EF, Alk is a C.sub.2 alkylene
chain and intermediate compound A reacts with the B amino group of
the insulin molecule. In certain embodiments, X is EF, Alk is a
C.sub.2 alkylene chain and intermediate compound A reacts with the
A1 amino group of the insulin molecule. In certain embodiments, X
is EF, Alk is a C.sub.2 alkylene chain and intermediate compound A
reacts with the A1 and B31 amino groups of the insulin molecule. In
certain embodiments, X is EF, Alk is a C.sub.2 alkylene chain and
intermediate compound A reacts with the BI and Lys.sup.B29 amino
groups of the insulin molecule. In certain embodiments, X is EF,
Alk is a C.sub.2 alkylene chain and intermediate compound A reacts
with the A1 and Lys.sup.B29 amino groups of the insulin molecule.
In certain embodiments, X is EF, Alk is a C.sub.2 alkylene chain
and intermediate compound A reacts with the A1, B1, and Lys.sup.B29
amino groups of the insulin molecule.
[0392] In certain embodiments, the conjugate is conjugate II-1,
II-2, II-3, I-4, II-5 or II-6 as set forth in FIG. 1 where the NH--
groups shown attached to the A1, B1 or B29 residues of the insulin
molecule are from the amino acid residue at that position (alpha
amino group in the case of A1 and B1 and epsilon amino group in the
case of B29). In certain embodiments the
##STR00055##
in these conjugates is wild-type human insulin.
Other Embodiments
[0393] As noted above, in various embodiments, a conjugate may
comprise a detectable label instead of a drug as W. For example, a
detectable label may be included in order to detect the location of
conjugates within an organism, tissue or cell; when the conjugates
are used in a sensor; etc. It is to be understood that a conjugate
can comprise any detectable label known in the art. A conjugate can
comprise more than one copy of the same label and/or can comprise
more than one type of label. In general, the label(s) used will
depend on the end application and the method used for
detection.
[0394] The detectable label may be directly detectable or
indirectly detectable, e.g., through combined action with one or
more additional members of a signal producing system. Examples of
directly detectable labels include radioactive, paramagnetic,
fluorescent, light scattering, absorptive and colorimetric labels.
Fluorescein isothiocyanate, rhodamine, phycoerythrin phycocyanin,
allophycocyanin, -phthalaldehyde, fluorescamine, etc. are all
exemplary fluorescent labels. Chemiluminescent labels, i.e., labels
that are capable of converting a secondary substrate to a
chromogenic product are examples of indirectly detectable labels.
For example, horseradish peroxidase, alkaline phosphatase,
glucose-6-phosphate dehydrogenase, malate dehydrogenase,
staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol
dehydrogenate, -glycerophosphate dehydrogenase, triose phosphate
isomerase, asparaginase, glucose oxidase, -galactosidase,
ribonuclease, urease, catalase, glucoamylase, acetylcholinesterase,
luciferin, luciferase, aequorin and the like are all exemplary
protein based chemiluminescent labels. Luminol, isoluminol,
theromatic acridinium ester, imidazole, acridinium salt, oxalate
ester, etc. are exemplary non-protein based chemiluminescent
labels. Another non-limiting and commonly used example of an
indirectly detectable label is an affinity ligand, i.e., a label
with strong affinity for a secondary binding partner (e.g., an
antibody or aptamer) which may itself be directly or indirectly
detectable.
[0395] In general, a detectable label may be visualized or detected
in a variety of ways, with the particular manner of detection being
chosen based on the particular detectable label, where
representative detection means include, e.g., scintillation
counting, autoradiography, measurement of paramagnetism,
fluorescence measurement, light absorption measurement, measurement
of light scattering and the like.
[0396] In general, the detectable label will contain an amine
group. Specific examples include peptidic labels bearing
alpha-terminal amine and/or epsilon-amine lysine groups. It will be
appreciated that any of these reactive moieties may be artificially
added to a known label if not already present. For example, in the
case of peptidic labels a suitable amino acid (e.g., a lysine) may
be added or substituted into the amino acid sequence. In addition,
as discussed in more detail herein, it will be appreciated that the
conjugation process may be controlled by selectively blocking
certain reactive moieties prior to conjugation.
EXAMPLES
Example 1
Synthesis of Azidoethylglueose (AzEG)
a. Synthesis of Bromoethyleglucose
[0397] DOWEX 50Wx4 resin (Alfa Aesar, Ward Hill, Mass.) was washed
with deionized water to remove color. A mixture of 225 gm D-glucose
(1.25 mol; 1 equiv., Alfa Aesar) and 140 gm DOWEX 50Wx4 was treated
with 2.2 L 2-bromoethanol (30.5 mol, 25 equiv.; 124.97 gm/mol;
1.762 gm/mL; BP=150 C; Alfa Aesar) and the stirred mixture heated
to 80 C for 4 hours. The reaction was monitored by TLC (20%
methanol/dichloromethane (DCM)). Reaction was complete after about
four hours, and it was allowed to cool to room temperature. The
solution was filtered to remove the resin, and the resin washed
with ethyl acetate and DCM. The resulting filtrate was stripped to
an amber oil in a rotary evaporator. A total of 400 gm after
stripping.
[0398] The amber oil was purified on silica gel (4 kg silica packed
in DCM) in the following manner. The crude was dissolved in DCM and
loaded onto the column, and then eluted with 2.times.4 L 10%
methanol/DCM; 2.times.4 L 15% methanol/DCM; and 3.times.4 L 20%
methanol/DCM. Product containing fractions (on the basis of TLC)
were pooled and stripped to dryness to afford 152 gm of
1-.alpha.-bromoethyl-glucose (42%).
b. Conversion of Bromoethylglucose to Azidoethylglucose (AzEM)
[0399] A 5 L round bottom three-necked flask, equipped with a
heating mantle, an overhead stirrer, and a thermometer, was charged
with 150 gm bromoethylglucose (525 mmol). The oil was dissolved in
2 L water and treated with 68.3 gm sodium azide (1.05 mol, 2
equiv.; 65 gm/mol; Alfa-Aesar) followed by 7.9 gm sodium iodide
(52.5 mmol, 0.08 equiv.; 149.89 gm/mol; Alfa-Aesar) and the
solution warmed to 50 C and stirred overnight. The solution was
cooled to room temperature and concentrated to dryness on the
rotovap. The solid residue was digested with 3.times.500 mL of 5:1
vol. CHCl.sub.3:MeOH at 40 C. The combined organic portions were
filtered and evaporated to dryness to afford azidoethylglucose (86
gm) as an off-white solid. TLC (20% MeOH/DCM; char with
H.sub.2SO.sub.4): single spot, indistinguishable from the starting
material.
c. Repurification of Azidoethylglucose
[0400] 32 gm of azidoethylglucose was taken into 100 mL water. The
turbid solution was filtered through a glass microfibre filter
(Whatman GF/B). The golden filtrate was evaporated to a solid on a
rotovapor. The solid was taken into methanol (100 mL) and the
turbid solution was again filtered through a glass microfibre
filter. The resulting pale yellow filtrate was stripped to a solid
under vacuum.
[0401] The solid was taken into a minimum of methanol (50 mL) and
ethyl acetate (150 mL) was added slowly with stirring. The heavy
slurry was cooled and filtered. The solid was air dried
(hygroscopic) and put in a 60 C oven overnight. TLC has very little
origin material. Yield 15.4 gm. The Mother Liquor was evaporated
under vacuum to a yellow gum. No attempt was made to further purify
this material at this time.
Example 2
Synthesis of Azidoethylmannose (AzEM)
a. Synthesis of Bromoethylmannose
[0402] DOWEX 50Wx4 resin (Alfa Aesar, Ward Hill, Mass.) is washed
with deionized water to remove color. A mixture of 225 gm D-mannose
(1.25 mol; 1 equiv., Alfa Aesar) and 140 gm DOWEX 50Wx4 is treated
with 2.2 L 2-bromoethanol (30.5 mol, 25 equiv.; 124.97 gm/mol;
1.762 gm/mL; BP=150 C; Alfa Aesar) and the stirred mixture heated
to 80 C for 4 hours. The reaction is monitored by TLC (20%
methanol/dichloromethane (DCM)). Reaction is complete after about
four hours, and then allowed to cool to room temperature. The
solution is filtered to remove the resin, and the resin washed with
ethyl acetate and DCM. The resulting filtrate is stripped to an
amber oil in a rotary evaporator.
[0403] The amber oil is purified on silica gel (4 kg silica packed
in DCM) in the following manner. The crude is dissolved in DCM and
loaded onto the column, and then eluted with 2.times.4 L 10%
methanol/DCM; 2.times.4 L 15% methanol/DCM; and 3.times.4 L 20%
methanol/DCM. Product containing fractions (on the basis of TLC)
are pooled and stripped to dryness to afford 152 gm of
1-.alpha.-bromoethyl-mannose (42%).
b. Conversion of Bromoethylmannose to Azidoethylmannose (AzEM)
[0404] A 5 L round bottom three-necked flask, equipped with a
heating mantle, an overhead stirrer, and a thermometer, is charged
with 150 gm bromoethylmannose (525 mmol). The oil is dissolved in 2
L water and treated with 68.3 gm sodium azide (1.05 mol, 2 equiv.;
65 gm/mol; Alfa-Aesar) followed by 7.9 gm sodium iodide (52.5 mmol,
0.08 equiv.; 149.89 gm/mol; Alfa-Aesar) and the solution warmed to
50 C and stirred overnight. The solution is cooled to room
temperature and concentrated to dryness on the rotovap. The solid
residue is digested with 3.times.500 mL of 5:1 vol. CHCl.sub.3:MeOH
at 40 C. The combined organic portions are filtered and evaporated
to dryness to afford azidoethylmannose as an off-white solid.
c. Repurfication of Azidoethylmannose
[0405] 32 gm of azidoethylmannose is taken into 100 mL water. The
turbid solution is filtered through a glass microfibre filter
(Whatman GF/B). The filtrate is evaporated to a solid on a
rotovapor. The solid is taken into Methanol (100 mL) and the turbid
solution is again filtered through a glass microfibre filter. The
resulting pale yellow filtrate is stripped to a solid under
vacuum.
[0406] The solid is taken into a minimum of methanol (50 mL) and
ethyl acetate (150 mL) is added slowly with stirring. The heavy
slurry is cooled and filtered. The solid is air dried (hygroscopic)
and put in a 60 C oven overnight. The Mother Liquor is evaporated
under vacuum to a yellow gum.
Example 3
Synthesis of Azidoethylmannobiose (AzEBM)
[0407] The AzEM compound from Example 2 is selectively protected
using benzene dimethyl ether, purified by column chromatography and
subsequently reacted with benzyl bromide to give
1-.alpha.-(2-azidoethyl)-4,6-benzaldehyde
diacetal-3-benzyl-mannopyranoside. The product is subsequently
glycosylated with
1-.alpha.-bromo-2,3,4,6-tetrabenzoylmannopyranoside using silver
triflate chemistry under rigorously anhydrous conditions to give
the protected-azidoethylmannobiose product. The intermediate
product is then deprotected to remove the benzoyl groups to give
AzEBM.
Example 4
Synthesis of Azidoethylmannotriose (AzETM)
a. 1-.alpha.-bromo-2,3,4,6-tetrabenzoyl-mannose
[0408] To a 500 mL 3-neck flask containing a stir bar and nitrogen
inlet was added 40 gm (60.9 mmole) of pentabenzoylmannose and 80 mL
methylene chloride. The resulting solution was cooled in an ice
bath to <5 C, and 80 mL 33% HBr-acetic acid solution was added
via an addition funnel at such a rate to maintain the reaction
temperature <10 C. Upon complete addition (.about.30 min.) the
ice bath was removed and stirring was continued for 3 hours.
[0409] The reaction solution was diluted with an equal volume (160
mL) of DCM and extracted successively with water (2.times.500 mL),
saturated bicarbonate (2.times.50 mL) and Brine (1.times.50 mL),
dried over magnesium sulfate and the solvent evaporated to give 41
gm of solid foam. (Theoretical yield 40.1 gm) and was stored under
N.sub.2 in a freezer. This material was used without further
purification. The reaction was monitored by TLC: silica gel
(Hexane/Ethyl Acetate, 7/3) starting material R.sub.f 0.65, product
R.sub.f 0.8 UV visualization. .sup.1H NMR (CDCl.sub.3) .delta. 8.11
(d, 2H), 8.01 (m, 4H), 7.84 (d, 2H), 7.58 (m, 4H), 7.41 (m, 6H),
7.28 (t, 2H), 6.58 (s, 1H), 6.28 (m, 2H), 5.8 (m, 1H), 4.75 (dd,
1H) 4.68 (dd, 1H) 4.5 (dd, 1H).
b. 1-Azidoethyl-2,4-dibenzoylmannose
[0410] To a 1.0 L, 3-neck flask containing a stir bar, nitrogen
inlet and 300 mL of anhydrous acetonitrile was added 25 gm
1-azidoethylmannose (100.4 mmole), and 50 mL triethyl orthobenzoate
(220 mmole, 2.2 equiv.). The resulting slurry was stirred at room
temperature and 0.8 mL (10 mmole) trifluoroacetic acid (TFA) was
added neat. The solution cleared within 10 minutes and stirring was
continued for an additional two hours, then 25 mL of 10% aqueous
TFA was added and stirring was continued for an additional 2 hours
to hydrolyze the intermediate to the ester isomers. The solvent was
evaporated under vacuum to a viscous oil, which was triturated with
50 mL DCM and again evaporated to a viscous oil.
[0411] Toluene (70 mL) was added to the residue and the viscous
solution was seeded with 2,4-dibenzoylazidoethylmannose. A fine
precipitate formed within 15 minutes and stirring was continued
overnight at room temperature. The resulting heavy suspension was
set in the freezer for 2-4 hours, then filtered and the solid
washed with ice cold toluene (2.times.10 mL). The solid was air
dried to a constant weight to give 21 gm (TY 22.85 gm @ 50%
isomeric purity) of .about.95% isomeric purity. The product was
taken into 40 mL toluene, stirred for 1 hour and then set in the
freezer for an additional 2 hours. The solid was filtered and
washed (2.times.10 mL) with ice cold toluene and air dried to a
constant weight to give 18.5 gm of the single isomer product
2,4-dibenzoylazidoethylmannose in 83% yield. The mother liquors
contained the undesired isomer and a small amount of the desired
isomer. The reaction was monitored by TLC: SG (Hexane/Ethyl Acetate
7/3) Starting Material R.sub.f 0.0, orthoester intermediate R.sub.f
0.9. (Hexane/Ethyl Acetate: 8/2) SM R.sub.f 0.8, desired isomer
R.sub.f 0.4, un-desired isomer R.sub.f 0.2
[0412] .sup.1H NMR 300 MHz (CDCl.sub.3) .delta. 8.12 (t, 4H), 7.66
(t, 2H), 7.5 (m, 4H), 5.56 (t, 1H), 5.48 (m, 1H), 5.14 (m, 1H), 4.5
(dd, 1H), 4.0 (m, 2H), 3.8 (m, 3H), 3.56 (m, 1H), 3.44 (m, 1H).
c.
Perbenzoylated-man(.alpha.-1,3)-man(.alpha.-1.6)-.alpha.-1-azidoethylma-
nnopyranoside
[0413] To a 1.0 L 3-neck flask with a stir bar, nitrogen inlet was
added 41 gm crude 1-bromo-tetrabenzoymannose (60.9 mmole,
.about.2.5 equiv.) in 185 mL DCM. To this was added 11.2 gm
2,4-dibenzoylazidoethylmannose (24.5 mmole) followed by 11.2 gm 4A
sieves. The slurry was stirred a room temperature for 10 minutes
and cooled to -15.degree. C. in a methanol/ice bath.
[0414] In a separate dark vessel was added 190 mL toluene followed
by 15.1 gm silver-trifluoromethanesulfonate (AgOTf) (58.8 mmole,
2.4 equiv.) and was stirred into solution in the dark. This
solution was transferred to a large addition funnel, and added
drop-wise to the stirring suspension while protecting the reaction
from light. The reaction temperature was maintained <-10 C by
adjusting the AgOTf addition rate. Upon complete addition
(.about.30 minutes) the cold bath was removed and the reaction
stirred for an additional 2 hours until a single product remained
by TLC(SG, Hexane/Ethyl Acetate: 7/3, Bromo R.sub.f 0.9, azido
R.sub.f 0.4, trios product R.sub.f 0.5, uv visualization).
[0415] Triethylamine (7 mL, 5.0 equiv.) was added followed by 200
mL DCM. The resulting slurry was filtered through a pad of silica
gel and celite and washed with 2.times.75 mL DCM. The solvent was
evaporated under vacuum and the residue taken into ethyl acetate
and washed sequentially with water (2.times.100 mL), bicarb
(2.times.50 mL), brine (1.times.75 mL) and dried over magnesium
sulfate. The solvent was evaporated under vacuum to give 39 gm of
solid foam (TY 39.5 gm). .sup.1H NMR 300 MHz (CDCl.sub.3) .delta.
8.3 (d, 2H), 8.2 (m, 8H), 7.85 (d, 4H), 7.75 (dd, 4H), 7.3-7.65 (m,
30H), 7.2 (t, 2H), 6.05 (m, 4H), 5.9 (t, 2H), 5.63 (m, 2H), 5.38
(s, 2H), 5.18 (d, 1H), 4.65 (m, 4H), 4.5 (m, 2H), 4.35 (m, 4H), 3.8
(m, 2H), 3.54 (m, 2H).
d.
Man(.alpha.-1,3)-man(.alpha.-1.6)-.alpha.-1-azidoethylmannopyranoside
[0416] To a stirring suspension of 3.0 gm perbenzoylated-man
(.alpha.-1,3)-man(.alpha.-1.6)-.alpha.-1-azidoethylmannopyranoside
(1.86 mmole) in 40 mL methanol was added 0.2 mL 4.28M sodium
methoxide in methanol. The resulting suspension was stirred 20
hours at room temperature giving a clear solution. The completion
of the reaction was monitored by TLC, (SG, hexane/ethyl acetate:
8/2 SM R.sub.f 0.4, product R.sub.f 0.0).
[0417] The methanol was evaporated under vacuum giving an oily
semi-solid. The residue was taken into ethyl acetate (50 mL) and
stirred for 3 hours. The solid was filtered, washed with fresh
ethyl acetate (2.times.20 mL) and air dried to a constant weight to
give 1.09 gm (TY 1.07 gm) of product. The mother liquors contained
residual methyl benzoate, the de-protection by-product.
Example 5
Synthesis of Aminoethyl-Saccharides (AEG, AEM, AEBM, AETM) from
Azidoethyl-Saccharides (AzEG, AzEM, AzEBM, AzETM)
[0418] The azido-terminated compounds from Examples 1-4 are readily
hydrogenated at room temperature by using palladium/carbon
catalyst, a small amount of acetic acid, and ethanol as a solvent
to give the corresponding amine-terminated compounds. The chemical
structures of AEG, AEM, AEBM, and AETM are described herein. The
process is identical to the one described for AETM below, except
that those skilled in the art will understand that the amounts of
reagents, solvents, etc. should be scaled to the number of moles of
saccharide-ligand to be hydrogenated.
a. Man
(.alpha.-1,3)-Man(.alpha.-1.6)-.alpha.-1-aminoethylmannopyranoside
("aminoethyltrimannose", AETM)
[0419] To a solution of 5.3 gm (9.25 mmole)
man(.alpha.-1,3)-man(.alpha.-1.6)-.alpha.-1-azidoethylmannopyranoside
in 100 mL water and 50 mL ethanol was added 0.8 gm 5% Pd/C. The
vigorously stirring suspension was hydrogenated at 30-40 psi for 48
hours or until no starting material was apparent by TLC(SG,
Methanol, SM R.sub.f 0.75, Pdt R.sub.f 0.0, PMA vis.). The
suspension was filtered over celite, which was rinsed with ethanol
(2.times.50 mL) and the filtrate concentrated under vacuum. HPLC of
this material (C18, 3% Acetonitrile/97% 0.1% H.sub.3PO.sub.4, 220
nm, 2 ml/min) gave uv adsorption of the injection column void
material, R.sub.t 2.5 minutes, indicative of benzoate ester.
[0420] The filtrate was diluted with 70 mL water and 12 mL of 1N
NaOH and the solution stirred overnight at room temperature (HPLC:
no uv material at column void R.sub.t 2.5 min., uv material at
R.sub.t 10.5 minutes co-eluting with benzoic acid). 2 gm of
decolorizing charcoal were added and the stirring suspension heated
to 80 C, cooled to room temperature and filtered over celite. The
filtrate pH was adjusted to 8.0 with 2N HCl and the colorless
solution concentrated under vacuum to about 50% volume.
[0421] The solution was loaded onto a resin column (Dowex 50W, 50
gm) and washed with water until eluting fractions were neutral to
pH (6.times.75 mL) removing any residual acid by-products. The
amine product was washed off the column with 0.25N ammonium
hydroxide (6.times.75 mL) and the fractions containing the amine
product-ninhydrin detection were combined and concentrated to 25-30
mL under vacuum. This concentrated solution was added drop-wise to
300 mL stirring ethanol and stirring continued for an additional 2
hours. The product was filtered, washed with fresh ethanol
(2.times.50 mL) and air dried to a constant weight. The resulting
white amorphous solid was dried further in a vacuum oven at 80 C
for 5 hours to give 4.1 gm of a white granular solid (TY 5.1 gm).
The NMR was clean of any aromatic protons. .sup.1H NMR 300 MHz
(D.sub.2O) .delta. 5.08 (s, 1H), 4.87 (s, 1H), 4.81 (s, 1H),
4.8-3.6 (m, 18H), 2.9 (m, 2H).
##STR00056##
Example 6
Synthesis of
3-{3-[3-(benzyloxy)-3-oxopropoxy]-2,2-bis[(2-carboxyethoxy)methyl]propoxy-
}propionic acid (2)
##STR00057##
[0423] The tetra-carboxylic acid 1 (2.025 g, 4.77 mol) was
dissolved in DMF (9.5 mL) and treated sequentially with
triethylamine (665 .mu.L, 4.77 mmol) and
2-benzyloxy-1-methylpyridinium triflate (1.667 g, 4.77 mmol) at
23.degree. C. under an argon atmosphere. The resultant clear
solution was placed in an oil bath and heated at 83.degree. C. for
24 h. During this time the solution underwent a color change from
clear through light yellow to dark orange-brown. After 24 h, the
reaction mixture was concentrated in vacuo to remove volatiles and
the thick, oily residue was applied directly to a silica gel column
[150 mL SiO.sub.2, 4.0.times.12.5 cm] eluting with a step gradient
of ethyl acetate/hexane containing 0.5% AcOH
[50%.fwdarw.60%.fwdarw.70%.fwdarw.80%] to yield 1.136 g (46%) of
the mono-benzyl ester 2 as a clear oil: R.sub.f 0.20
(EtOAc/Hexane/AcOH-1/H.sub.2O, 8:2:0.1:0.1; dark spot by PMA);
.sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.: 12.18 (br s, 3H,
CO.sub.2H), 7.35 (s, 5H, PhH), 5.09 (s, 2H, CH.sub.2Ph), 3.60
(overlapping t, 2H, OCH.sub.2CH.sub.2CO.sub.2Bn), 3.49 (t, J=6.3
Hz, 6H, OCH.sub.2CH.sub.2CO.sub.2H), 3.23 (s, 2H,
C.sub.quatCH.sub.2OCH.sub.2CH.sub.2CO.sub.2Bn), 3.20 (s, 6H,
C.sub.quatCH.sub.2OCH.sub.2CH.sub.2CO.sub.2H), 2.58 (t, J=6.0 Hz,
2H, CH.sub.2CO.sub.2Bn), 2.38 (t, J=6.3 Hz, 6H, CH.sub.2CO.sub.2H).
.sup.13C NMR (75 MHz, DMSO-d.sub.6) .delta.: 176.87, 171.92,
136.15, 128.79, 128.45, 128.39, 69.95, 69.77, 66.99, 66.63, 45.38,
35.32, 35.04 ppm; MS calcd for C.sub.24H.sub.34O.sub.12 [M+H].sup.+
515.5, found 515.5.
Example 7
Synthesis of Benzyl
3-{3-(3-{[2-(.alpha.-D-mannopyranosyloxy)ethyl]amino}-3-oxopropoxy)-2,2-b-
is[(3-{[2-(.alpha.-D-mannopyranosyloxy)ethyl]amino)}-3-oxopropoxy)methyl]p-
ropoxy}propionate (3)
##STR00058##
[0425] To a solution of the tri-acid 2 (200 mg, 0.389 mmol) in anh
DMF (2.4 mL) was added a solution of aminoethyl mannose (AEM, 391
mg, 1.75 mmol) in DI water (1.2 mL) generating a clear, colorless
solution. To this solution was added HOBt (239 mg, 1.77 mmol) at
23.degree. C. followed by cooling to 0.degree. C. and addition of
DIPEA (diisopropylethyl amine, 311 .mu.L, 1.79 mmol) and EDC (339
mg, 1.77 mmol). The resultant clear, light yellow solution was
stirred at 0-5.degree. C. for 1.5 h and then at 23.degree. C.
Additional portions of AEM and EDC were made at 20.5 h and 25 h
(1.0 equivalent of both each time). After 40.5 h, the solvent was
removed under reduced pressure at 40.degree. C. and the residual
crude material purified via FCC [mL, 4.0.times.8.5 cm] eluting with
a step gradient of methanol/chloroform/water
[3:7:0.fwdarw.4:6:0.fwdarw.5:5:0.fwdarw.4:5.5:0.5] to yield 489 mg
(>100% due to impurity) of the tri-mannose 3 as a white solid:
R.sub.f 0.30 (MeOH/CHCl.sub.3/H.sub.2O, 5:4.5:0.5; dark spot by
PMA); .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.: 7.93 (C(O)NH),
7.31 (br s, 5H, Ph-H), 5.05 (s, 2H, OCH.sub.2Ph), 3.92 (3H, H-2),
3.89 (3H, H-6), 3.79 (3H, H-3), 3.77 (3H, H-6), 3.67 (3H, H-4),
3.62-3.58 (6H, CH.sub.2N), 3.52-3.37 (m, 6H, OCH.sub.2CH.sub.2NH),
3.39-3.56 (m, 8H, CH.sub.2OCH.sub.2C.sub.quatCH.sub.2OCH.sub.2),
3.16-3.27 (m, 8H, OCH.sub.2C.sub.quatCH.sub.2O), 2.58 (t, 2H,
CH.sub.2CO.sub.2Bn), 2.38 (t, 6H, CH.sub.2C(O)NH). .sup.13C NMR (75
MHz, DMSO-d.sub.6) .delta.: 171.80 (CO.sub.2Bn), 170.99 (C(O)NH),
44.29 (C.sub.quat), 136.88, 129.11, 128.67, 128.56 (phenyl C's),
100.63 (Man C-1), 74.63 (Man C-5), 71.61 (Man C-3), 70.92 (Man
C-2), 68.01 (Man C-4), 69.55
(C.sub.quatCH.sub.2OCH.sub.2CH.sub.2CONH), 67.69
(OCH.sub.2CH.sub.2NH), 66.09 (CH.sub.2CO.sub.2Bn), 61.91 (Man C-6),
39.39 (OCH.sub.2CH.sub.2NH), 35.42 (CH.sub.2CO.sub.2Bn); MS calcd
for C.sub.48H.sub.79N.sub.3O.sub.27 [M+H].sup.+ 1130.1, found
1130.5.
Example 8
Synthesis of
3-{3-(3-{[2-(.alpha.-D-mannopyranosyloxy)ethyl]amino}-3-oxopropoxy)-2,2-b-
is[(3-{[2-(.alpha.-D-mannopyranosyloxy)ethyl]amino}-3-oxopropoxy)methyl]pr-
opoxy}propionic acid (4)
##STR00059##
[0427] The mono-benzyl ester 3 (400 mg, 0.354 mmol) was dissolved
in anh methanol (1.5 mL), generating a clear solution, to which was
added palladium on carbon (Pd/C, 5 wt %, 20 mg). The resultant
black slurry was placed under an atmosphere of hydrogen gas and
stirred at 23.degree. C. After 7 h, an additional portion of Pd/C
(20 mg) was added to the reaction and stirring continued. After
24.5 h, the reaction mixture was filtered through a pad of Celite
and the solids rinsed with methanol (25 mL). Concentration of the
filtrate in vacuo gave the crude product which was purified by FCC
(Flash Column Chromatography) [25 mL SiO.sub.2, 2.0.times.9.0 cm;
dry-loading of the sample: 25 mL MeOH, 5 mL SiO.sub.2] eluting with
a step gradient of methanol/chloroform/water
[4:6:0.fwdarw.5:5:0.fwdarw.6:4:0.fwdarw.4:5.5:0.5] to yield 247 mg
(67%) of the mono-carboxylic acid 4 as a white solid: R.sub.f 0.10
(MeOH/CHCl.sub.3/H.sub.2O, 5:4.5:0.5; dark spot by PMA); MS calcd
for C.sub.41H.sub.73N.sub.3O.sub.27 [M+H].sup.+ 1040.0, found
1040.0.
Example 9
Synthesis of
3-(3-{3-[(2,5-dioxopyrrolidin-1-yl)oxy]-3-oxopropoxy}-2,2-bis[(3-{[2-(.al-
pha.-D-mannopyranosyloxy)ethyl]amino}-3-oxopropoxy)methyl]propoxy)-N-[2-(.-
alpha.-D-mannopyranosyloxy)ethyl]propanamide (5)
##STR00060##
[0429] To a solution of the carboxylic acid 4 (54 mg, 0.052 mmol)
in anh DMF (1.70 mL) under an argon atmosphere at 23.degree. C. was
added TSTU (15.7 mg, 0.052 mmol, 1.0 equiv) as the solid. The
resultant clear, colorless solution was stirred at 23.degree. C.
for 30 min after which the reaction was deemed complete (LC/MS
analysis). The product 3 was isolated via precipitation, as
follows: the reaction solution was transferred, via autopipette, to
a tube containing anh acetone (10 volumes, 17.0 mL). The addition
was made dropwise, in 300 .mu.L portions, followed by gentle
agitation. The resultant white suspension was centrifuged (3000
rpm, 5 min, 15.degree. C.) to generate a clear supernatant and a
white pellet. The supernatant was drawn off and the sticky, white
pellet was washed with acetone (1.0 mL) followed by centrifugation
(as above) and drying under high vacuum to yield 49 mg of a dry,
white solid (P1). The solid was re-dissolved in DMF (600 .mu.L) and
precipitated with acetone (10 volumes, 6.0 mL), as described above,
to give 30 mg of a white solid (P2) after centrifugation and drying
under high vacuum. The white solid was again re-dissolved in DMF
(500 .mu.L), precipitated with acetone (10 vol, 5.0 mL),
centrifuged, washed with acetone (1.0 mL) and dried under high
vacuum to yield 18 mg (31%) of the N-hydroxysuccinimide ester 5 as
a white powder (P3): MS calcd for C.sub.45H.sub.76N.sub.4O.sub.29
[M+H].sup.+ 1137.09, found 1137.1.
[0430] Examples 10 and 11 describe a general method for conjugating
a PLF of the present disclosure with an amine-bearing drug in
organic solvent or aqueous solvent, respectively, and Example 12
describes a general method of purification after conjugation.
Example 10
Amine-Functionalized Drug Conjugation with Prefunctionalized Ligand
Framework in Organic Solvent
[0431] A prefunctionalized ligand framework (PLF) is dissolved at
60 mM in 11.1 mL of anhydrous DMSO and allowed to stir for 10
minutes at room temperature. An amine-bearing drug is then
dissolved separately at a concentration 9.2 mM in 27.6 mL of
anhydrous DMSO containing 70 mM anhydrous triethylamine. Once
dissolved, the PLF solution is added portionwise to the
amine-bearing drug/DMSO/TEA solution followed by room temperature
mixing for .about.1 hr. At this point, the reaction is analyzed by
analytical HPLC to assess the extent of reaction, after which more
PLF solution is added if necessary to achieve the desired extent of
conjugation. When the desired extent of conjugation of the PLF to
the amine-bearing drug is achieved, ethanolamine is added to the
PLF/amine-bearing drug/DMSO/TEA solution to make the final
concentration of ethanolamine 195 mM. The reaction solution is
stirred at RT for an additional 0.5 hr.
[0432] The resulting solution is then superdiluted by 20.times.
into water followed by a pH adjustment with 1N HCl (and 0.1 N NaOH
if needed) to a final pH of 2.0. The resulting aqueous solution is
concentrated by ultrafiltration (Millipore Pellicon Mini TFF
system, 1 KDa MWCO membrane) to approximately 200 mL, followed by
diafiltration (Millipore Pellicon Mini TFF system, 1 KDa MWCO
membrane) using 10-15 diavolumes (DV) of water. If desired, the
solution is further concentrated through the use of Amicon-15 (3
kDa MWCO) to approximately 10 mg/mL. The aqueous solution is stored
overnight at 4.degree. C.
Example 11
Amine-Functionalized Drug Conjugation with Prefunctionalized Ligand
Framework in Aqueous Solvent
[0433] A prefunctionalized ligand framework (PLF) is dissolved at
60 mM in 11.1 mL of anhydrous DMSO and allowed to stir for 10
minutes at room temperature. An amine-bearing drug is then
dissolved separately at 17.2 mM in 14.3 mL of a 0.1M, pH 11.0
sodium carbonate buffer, and the pH subsequently was adjusted to
10.8 with 1.0N sodium hydroxide.
[0434] Once dissolved, the PLF/DMSO solution is added portionwise
to the amine-bearing drug/carbonate solution followed by room
temperature mixing. During the addition, the pH of the resulting
mixture is adjusted every 5 min to keep the pH.gtoreq.10.8 if
necessary using dilute HCl or NaOH. The solution is allowed to stir
for an additional 15 minutes after the dropwise addition to ensure
complete reaction. At this point, the reaction is analyzed by
analytical HPLC to assess the extent of reaction, after which
additional PLF solution is added if necessary to achieve the
desired extent of conjugation.
[0435] The resulting solution is then superdiluted by 20.times.
into water followed by a pH adjustment with 1N HCl (and 0.1 N NaOH
if needed) to a final pH of 2.0. The resulting aqueous solution is
concentrated by ultrafiltration (Millipore Pellicon Mini TFF
system, 1 KDa MWCO membrane) to approximately 200 mL, followed by
diafiltration (Millipore Pellicon Mini TFF system, 1 KDa MWCO
membrane) using 10-15 diavolumes (DV) of water. If desired, the
solution was further concentrated through the use of Amicon-15 (3
kDa MWCO) to approximately 10 mg/mL. The aqueous solution is stored
overnight at 4.degree. C.
Example 12
Amine-Functionalized Drug-PLF Conjugate Purification Via HPLC
[0436] The amine-bearing drug-PLF conjugate solution is further
purified to obtain the desired product using preparative reverse
phase HPLC on a Waters C4, 7 um, 50.times.250 mm column. Buffer A
is deionized water containing 0.1% TFA and Buffer B was
acetonitrile containing 0.1% TFA. Before purification, the column
is equilibrated at 15 ml/minutes with a 80% A/20% B mobile phase
using a Waters DeltraPrep 600 HPLC system. Approximately 16 ml of
the crude solution is injected onto the column over the course of 2
minutes at a flow rate of 50 ml/minute after which a linear
gradient is employed from 80% A/20% B to 75% A125% B (or higher,
depending on the drug conjugate properties) over the next 5 minutes
followed by a slower multi-step gradient from 75% A/25% B to 70%
A/30% B (or higher, depending on the drug conjugate properties)
over the next 70 minutes. The retention time of the desired peak
varies depending on the drug, framework, and ligand used. During
the elution of the peak of interest a fraction collector and LC-MS
(Acquity HPLC, Waters Corp., Milford, Mass.) is employed to further
assess the purity of the peak fractions to decide which fractions
of the desired peak should be combined to obtain the desired level
of drug conjugate purity.
Solvent Removal
[0437] Once collected, the solution is rotovapped (Buchi Model
R-215, New Castle, Del.) to remove acetonitrile and lyophilized to
obtain pure conjugate whose identity is verified by HPLC-MS (HT
Laboratories, San Diego, Calif.).
Alternate Solvent Removal
[0438] Once the desired fractions are collected, they are combined
into a single solution inside a large glass vessel and concentrated
to approximately 200 mL via ultrafiltration (Millipore Pellicon
Mini TFF system, 1 KDa MWCO membrane). The resulting solution is
diafiltered against approximately 15-20 diavolumes of high-purity
water (Millipore Pellicon Mini TFF system, 1 KDa MWCO membrane). If
desired, the solution is further concentrated through the use of
Amicon-15 (3 kDa MWCO) to approximately 10 mg/mL. The aqueous
solution is stored overnight at 4.degree. C.
Example 13
Insulin Conjugation to Give a B1-Substituted Insulin Conjugate
Synthesis of NH.sub.2--B1-BOC2(A1,B29)-insulin
[0439] In a typical synthesis, 4 g of powdered insulin (Sigma
Aldrich, St. Louis, Mo.) is dissolved in 100 ml of anhydrous DMSO
at room temperature followed by the addition of 4 ml of
triethylamine (TEA). The solution is stirred for 30 minutes at room
temperature. Next, 1.79 ml (2.6 equivalents) of
di-tert-butyl-dicarbonate/THF solution (Sigma Aldrich, St. Louis,
Mo.) is slowly added to the insulin-TEA solution and mixed for
approximately one hour. The reaction is quenched via the addition
of 4 ml of a stock solution containing 250 ul of ethanolamine in 5
ml of DMSO followed by mixing for five minutes. After quenching,
the entire solution is poured into 1600 ml of acetone and mixed
briefly with a spatula. Next, 8.times.400 .mu.l aliquots of a 18.9%
HCl:water solution are added dropwise over the surface of the
mixture to precipitate the reacted insulin. The precipitated
material is then centrifuged and the supernatant decanted into a
second beaker while the precipitate cake is set aside. To the
supernatant solution, another 8.times.400 .mu.l aliquots of a 18.9%
HCl:water solution are added dropwise over the surface of the
mixture to obtain a second precipitate of reacted insulin. This
second precipitate is centrifuged and the supernatant is discarded.
The combined centrifuge cakes from the two precipitation steps are
washed once with acetone followed by drying under vacuum at room
temperature to yield the crude powder which typically contains 60%
of the desired BOC2 product and 40% of the BOC3 material.
[0440] A preparative reverse phase HPLC method is used to isolate
the pure BOC2-insulin from the crude powder. Buffer A is deionized
water containing 0.1% TFA and Buffer B is acetonitrile containing
0.1% TFA. The crude powder is dissolved at 25 mg/ml in a 70% A/30%
B mixture and syringe filtered prior to injection on the column.
Before purification, the column (Waters SymmetryPrep C18, 7 um,
19.times.150 mm) is equilibrated at 15 ml/minutes with a 70% A/30%
B mobile phase using a Waters DeltraPrep 600 system. Approximately
5 ml of the crude powder solution is injected onto the column at a
flow rate of 15 ml/minutes over the course of 5 minutes after which
a linear gradient is employed from 70% A/30% B to 62% A/38% B over
the course of the next 3.5 minutes and held there for an additional
2.5 minutes. Using this method, the desired BOC2 peak elutes at
approximately 10.6 minutes followed closely by the BOC3 peak. Once
collected, the solution is rotovapped to remove acetonitrile and
lyophilized to obtain pure BOC2-insulin powder. Identity is
verified by LC-MS (HT Laboratories, San Diego, Calif.) and site of
conjugation determined by N-terminal sequencing (Western
Analytical, St. Louis, Mo.).
Conjugation
[0441] NH.sub.2--B1-BOC2(A1,B29)-insulin is conjugated to a PLF
following Example 10. The resulting conjugate may then be purified
according to Example 12.
Example 14
Insulin Conjugation to Give an al-Substituted Insulin Conjugate
Synthesis of NH.sub.2-A1,B1-BOC(B29)-insulin
[0442] Insulin is dissolved in a 66:37 vol:vol mixture of 100 mM
sodium carbonate buffer (pH 11) and acetonitrile at a concentration
of 14.7 mM. Separately, a monofunctional protecting group-activated
ester (e.g., BOC-NHS) is dissolved at 467 mM in acetonitrile. Once
the insulin is dissolved, small aliquots of the monofunctional
protecting group-activated ester (e.g., BOC-NHS) are added to the
insulin solution. The pH is monitored throughout the process and is
maintained between 10.2-11.0 through the addition of 0.1 M sodium
hydroxide. The reaction is monitored by reverse-phase HPLC.
Aliquots of the monofunctional protecting group-activated ester are
added until the HPLC chromatogram shows that all of the unmodified
insulin has been reacted and that a substantial portion of the
reaction mixture has been converted to B29-protected insulin.
Typically the protecting group will be more hydrophobic in nature
and, once reacted onto the insulin, will elute at an HPLC retention
time that is longer than the unmodified insulin.
Conjugation
[0443] NH.sub.2-A1,B1-BOC(B29)-insulin is conjugated to a PLF
following Example 10. The resulting conjugate may then be purified
according to Example 12.
Example 15
Insulin Conjugation to Give an A1,B29-Substituted Insulin
Conjugate
[0444] An A1,B29 insulin conjugate is obtained by conjugating a PLF
to unprotected insulin following Example 10. The resulting
conjugate may then be purified according to Example 12. In certain
embodiments, the conjugate is a di-substituted (A1,B29) TSPE-AEM-3
(II-6) conjugate as shown in FIGS. 1 and 6.
Example 16
Insulin Conjugation to Give an A1,B1-Substituted Insulin
Conjugate
[0445] NH.sub.2-A1,B1-BOC(B29)-insulin is synthesized as described
in Example 14. An A1, B1-substituted insulin conjugate is
synthesized following Example 10 and using the appropriate
equivalents of PLF and drug. The resulting conjugate may then be
purified according to Example 12.
Example 17
Insulin Conjugation to Give a B1,B29-Substituted Insulin
Conjugate
Synthesis of NH.sub.2--B1,B29-BOC(A1)-insulin
[0446] NH.sub.2--B1,B29-BOC(A1)-insulin can be prepared using the
procedure in Example 13 but reacting with fewer equivalents of the
BOC reagent in order to yield a distribution of
A1,B29-diBOC-insulin, A1-BOC-insulin, and B29-BOC-insulin products.
NH.sub.2--B1,B29-BOC(A1)-insulin can be isolated by RP-HPLC and
confirmed by N-terminal sequencing.
Conjugation
[0447] NH.sub.2--B1,B29-BOC(A1)-insulin is conjugated to a PLF
following Example 10. The resulting conjugate may then be purified
according to Example 12.
Example 18
Insulin Conjugation to Give a B29-Substituted Insulin Conjugate
[0448] A B29 insulin conjugate is obtained by conjugating a PLF to
unprotected insulin following Example 11. The resulting conjugate
may then be purified according to Example 12.
Example 19
Formulation of Insulin Conjugate in Preparation of In Vivo
Testing
[0449] After 1.5 g of recombinant human insulin is conjugated and
purified via the processes described in Examples 11 and 13, the
resulting insulin-conjugate is at a concentration of approximately
760 micromolar in purified water with a total solution volume of
approximately 140 mL. To this solution is added 14 mL of a pH 7.4
formulation buffer concentrate that comprises 1.78 mL glycerin,
0.22 g m-cresol, 0.09 g phenol, and 0.53 g sodium phosphate. The
resulting solution final volume is 154 mL.
Example 20
Effect of a-MM on PK and Bioactivity of Conjugates II-1 and
II-2
[0450] In this example, we set out to determine the pharmacokinetic
and pharmacodynamic behavior of conjugates II-1 and II-2 (see FIG.
1 for conjugate structures). In each case, the same dose of
conjugate (5 U/kg) was injected behind the neck of fasted normal
non-diabetic rats (Male Sprague-Dawley, 400-500 gm, n=3). After a
15 minute delay a 4 g/kg dose of a-MM was injected IP. Blood
samples were collected via tail vein bleeding at 0 minutes and at
30, 60, 90, 120, 150, 180, 210, 240, and 300 minutes after the
initial conjugate injection. Blood glucose values were measured
using commercially available test strips (Precision Xtra, Abbott
Laboratories, Abbott Park, Ill.). In addition, blood from each
timepoint was centrifuged at 4 C to collect the serum. Serum
insulin concentrations were subsequently measured with a
commercially available ELISA kit (ISO Insulin ELISA, Mercodia,
Uppsala, Sweden). A control was performed by injecting saline
instead of a-MM after 15 minutes.
[0451] FIG. 2 shows the results obtained when a-MM was administered
by IP injection 15 minutes after the sub-Q injection of II-1. As
shown, the increase in PK/PD profile that resulted from injection
of a-MM was very significant (p<0.05) for I-1 when compared to
the saline injection control group.
[0452] FIG. 3 shows the results obtained when a-MM was administered
by IP injection 15 minutes after the sub-Q injection of II-2. As
shown, the increase in PK/PD profile that resulted from injection
of a-MM was very significant (p<0.05) for II-2 when compared to
the saline injection control group.
Example 21
In Vivo Half Life/Elimination Rate Comparison
[0453] The results obtained in Example 20 are consistent with the
exemplary conjugates being eliminated from the body via a lectin
dependent mechanism that can be disrupted by the presence of a
competitive saccharide. In order to explore this mechanism in more
detail, we conducted the following experiments on exemplary
conjugates to determine the rate at which they were cleared from
serum in vivo versus unconjugated insulin.
[0454] In each case the soluble conjugate was dosed at 0.4 mg
conjugate/kg body weight into dual jugular vein cannulated male
Sprague-Dawley rats (Taconic, JV/JV, 350-400 g, n=3). A sterile
conjugate solution or control insulin was injected intravenously
via one JV cannula, followed immediately by a chase solution of
heparin-saline to ensure that all of the conjugate dose was
administered into the animal. The second cannula was used to
collect blood samples at t=0 (pre-dose), and at 1, 2, 4, 8, 15, 30,
60, 90, 120, and 180 minutes post-dose.
[0455] Blood glucose values were measured using commercially
available test strips (Precision Xtra, Abbott Laboratories, Abbott
Park, Ill.). In addition, blood from each timepoint was centrifuged
at 4 C to collect the serum. Serum insulin or serum conjugate
concentrations were subsequently measured with a commercially
available ELISA kit (Iso-Insulin ELISA, Mercodia, Uppsala,
Sweden).
[0456] The serum concentration of either RHI or the conjugates were
plotted as a function of time following the intravenous injection.
The data was fit using a two-compartment bi-exponential model with
the following general formula: C(t)=A.sub.oEXP(-at)+B.sub.oEXP(-bt)
where t is time, C(t) is the concentration in serum as a function
of time, A.sub.o is the first compartment concentration constant, a
is the first compartment exponential time constant, B.sub.o is the
second compartment concentration constant, and b is the second
compartment exponential time constant.
[0457] The following table summarizes the t1/2 parameters for RHI
and the conjugates tested:
TABLE-US-00004 Ratio to RHI Ratio to RHI Formulation t1/2 (a) t1/2
(b) t1/2 (a) t1/2 (b) RHI 0.76 11.46 1.00 1.00 II-1: TSPE-AEM-3
0.66 2.62 0.87 0.23 II-2: TSPE-AETM-3 0.22 1.33 0.29 0.12
[0458] This data is consistent with the hypothesis that the
exemplary conjugates are eliminated from serum more rapidly than
unconjugated insulin, the extent of which is governed by the
affinity of the particular conjugate for the endogenous lectin and
the number of ligands substituted per conjugate. Furthermore, the
a-MM induced increase in PK/PD profiles demonstrated in Example 19
correlates well with the reduction in Phase b half-life for each of
the conjugates tested.
Example 22
Performance of Long Acting Conjugates Prepared from Conjugates with
Varying Ligand Affinity and Multivalency
[0459] In this example, we set out to determine the time action and
glucose-responsive PK profile of long-acting formulations of
conjugates II-1 and II-2 (see FIG. 1 for conjugate structures). The
following long-acting formulation was used for each conjugate:
TABLE-US-00005 Component Variable Volume (ml) Conjugate solution at
unmodified insulin = 16.7% 1.000 2.7 mg/ml 250 mM HEPES NaCl
concentration = 1.5M 0.111 buffered saline Zinc acetate solution
Zinc concentration = 4.6 mg/ml 0.124 Cresol solution in water 3%
v/v 0.159 pH 7.2 Protamine Protamine concentration = 4 .times.
0.194 solution in 25 mM 12.5 mg/ml aliquots HEPES buffered
saline
[0460] The four hour IP glucose injection (4 g/kg) experiments were
performed by dosing 15 U/kg (body weight in grams/1.87=microliters
of injection volume) of each of the conjugates described above. As
shown in FIG. 4, all conjugates exhibited a protracted absorption
profile with some element of increase in measured serum insulin
concentration following the 4 hour glucose injection. It appears
that there was some significant conjugate absorption in the first
four hours after injection of the long acting TSPE-AETM-3 conjugate
II-2. The TSPE-AEM-3 conjugate II-1 exhibited a flat absorption
profile. These results correlate well with the fact that the
half-lives of these conjugates are all less than unmodified insulin
as described in Example 21 and that each of them demonstrates an
a-MM-induced increase in PK/PD profile as described in Example
20.
Example 23
Recombinant Insulin Molecules: Production in Yeast, Protein
Purification, and In Vitro Enzyme Processing
[0461] This example demonstrates the recombinant production of
several exemplary insulin molecules in two different yeast strains
(KM71 and GS115) on both small- and large-scales. Some of these
insulin molecules were engineered to include N-terminal protecting
amino acid sequences. The recombinantly-produced insulin molecules
had the expected molecular weight and were recognized by
anti-insulin antibodies. The experiments described in this example
demonstrate that insulin molecules manufactured in yeast generated
commercial scale yields. This example also describes procedures
that were used for in vitro enzyme processing of recombinantly
produced insulin molecules and conjugation with a prefunctionalized
ligand framework.
Materials and Methods
Preparation of Electrocompetent P. Pastoris Strains
[0462] KM71 (Invitrogen, Carlsbad, Calif.) was cultured at
30.degree. C. in YPD broth (per liter: 10 g yeast extract, 20 g
peptone, and 20 g glucose, pH 6.5). After successful revival of the
strain, electrocompetent KM71 was prepared as described by Wu and
Letchworth (Biotechniques 36:152-4). Electrocompetent KM71 were
stored in a -80.degree. C. freezer. Electrocompetent P. pastoris
GS115 (Invitrogen, Carlsbad, Calif.) was prepared by the same
procedure.
Preparation of Insulin Molecule Expressing Gene Constructs
[0463] Gene synthesis of insulin molecule constructs was performed
at GeneArt (Regensburg, Germany). Briefly, genes of interest coding
for the expression of insulin molecules are listed in Table 4. The
genes were synthesized at GeneArt, then cut with BamI (5' site) and
EcoRI (3' site) enzymes and then inserted into the same sites in
the pPIC3.5K vector (Invitrogen, Carlsbad, Calif.). The resulting
plasmid was then amplified in E. coli in culture flasks and then
extracted, purified, giving a .about.1 mg/mL solution of the
plasmid DNA in TE buffer.
TABLE-US-00006 TABLE 4 Con- struct ID DNA sequence RHI-1
ATGAGATTCCCATCTATCTTCACTGCTGTTTTGTTCGCTGCTTCT
TCTGCTTTGGCTGCTCCTGTTAACACTACTACTGAAGACGAAACT
GCTCAAATCCCAGCTGAAGCGGTTATCGGTTACTCTGACTTGGAA
GGTGACTTCGACGTTGCTGTTTTGCCTTTCTCTAACTCTACTAAT
AATGGTTTGTTGTTCATCAACACTACTATCGCTTCTATCGCTGCT
AAGGAAGAGGGTGTTTCTATGGCTAAGAGAGAAGAAGCTGAAGCT
GAAGCTGAACCAAAGTTTGTTAACCAACACTTGTGTGGTTCTCAC
TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTC
TACACTCCAAAGGCTGCTAAGGGTATCGTTGAACAATGTTGTACT
TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTAACTAA (SEQ ID NO: 3) RHI-2
ATGAGATTCCCATCTATCTTCACTGCTGTTTTGTTCGCTGCTTCT
TCTGCTTTGGCTGCTCCTGTTAACACTACTACTGAAGACGAAACT
GCTCAAATCCCAGCTGAAGCGGTTATCGGTTACTCTGACTTGGAA
GGTGACTTCGACGTTGCTGTTTTGCCTTTCTCTAACTCTACTAAT
AATGGTTTGTTGTTCATCAACACTACTATCGCTTCTATCGCTGCT
AAGGAAGAGGGTGTTTCTATGGCTAAGAGAGACGACGGTGACCCA
AGATTTGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCT
TTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAG
GACGAAAGAGGTATCGTTGAACAATGTTGTACTTCTATCTGTTCT
TTGTACCAATTGGAAAACTACTGTAACTAA (SEQ ID NO: 4) RHI-3
ATGAGATTCCCATCTATCTTCACTGCTGTTTTGTTCGCTGCTTCT
TCTGCTTTGGCTGCTCCTGTTAACACTACTACTGAAGACGAAACT
GCTCAAATCCCAGCTGAAGCGGTTATCGGTTACTCTGACTTGGAA
GGTGACTTCGACGTTGCTGTTTTGCCTTTCTCTAACTCTACTAAT
AATGGTTTGTTGTTCATCAACACTACTATCGCTTCTATCGCTGCT
AAGGAAGAGGGTGTTTCTATGGCTAAGAGAGAAGAAGCTGAAGCT
GAAGCTGAACCAAAGTTTGTTAACCAACACTTGTGTGGTTCTCAC
TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTC
TACACTCCAAAGGACGAAAGAGGTATCGTTGAACAATGTTGTACT
TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTAACTAA (SEQ ID NO: 5) RAT-1
ATGAGATTCCCATCTATCTTCACTGCTGTTTTGTTCGCTGCTTCT
TCTGCTTTGGCTGCTCCTGTTAACACTACTACTGAAGACGAAACT
GCTCAAATCCCAGCTGAAGCGGTTATCGGTTACTCTGACTTGGAA
GGTGACTTCGACGTTGCTGTTTTGCCTTTCTCTAACTCTACTAAT
AATGGTTTGTTGTTCATCAACACTACTATCGCTTCTATCGCTGCT
AAGGAAGAGGGTGTTTCTATGGCTAAGAGAGAAGAAGCTGAAGCT
GAAGCTGAACCAAAGTTTGTTAAGCAACACTTGTGTGGTCCTCAC
TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTC
TACACTCCAAAGGCTGCTAAGGGTATCGTTGACCAATGTTGTACT
TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTAACTAA (SEQ ID NO: 6) RHI-4
ATGAGATTCCCATCTATCTTCACTGCTGTTTTGTTCGCTGCTTCT
TCTGCTTTGGCTGCTCCTGTTAACACTACTACTGAAGACGAAACT
GCTCAAATCCCAGCTGAAGCGGTTATCGGTTACTCTGACTTGGAA
GGTGACTTCGACGTTGCTGTTTTGCCTTTCTCTAACTCTACTAAT
AATGGTTTGTTGTTCATCAACACTACTATCGCTTCTATCGCTGCT
AAGGAAGAGGGTGTTTCTATGGCTAAGAGAGACGACGGTGACCCA
AGATTTGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCT
TTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAG
GCTGCTAAGGGTATCGTTGAACAATGTTGTACTTCTATCTGTTCT
TTGTACCAATTGGAAAACTACTGTAACTAA (SEQ ID NO: 7)
DNA Preparation for P. pastoris Transformation
[0464] Four genetic constructs were initially used for transforming
GS115 and KM71. Prior to transformation by electroporation, each
construct was linearized by Sail. Complete linearization of each
construct was confirmed by agarose gel electrophoresis. QiaQuick
PCR purification spin columns (Qiagen) were then used to remove
SalI and salts from the linearized plasmids. Linearized plasmids
were eluted from the spin columns using autoclaved, deionized
water.
[0465] Once the DNA has been transformed into the yeast strains,
the resulting gene constructs coded for the amino acid sequences
shown in Table 5. The Pro-leader peptide sequence is designed to be
cleaved by Kex-2 endoprotease within the yeast prior to protein
secretion into the media (Kjeldsen et al., 1999, Biotechnol. Appl.
Biochem. 29:79-86). Thus the resulting insulin molecule secreted
into the media includes only the leader peptide sequence attached
to the [B-peptide]-[C-peptide]-[A-peptide]sequence.
TABLE-US-00007 TABLE 5 Con- struct Pro-leader Leader B-C-A ID
peptide peptide peptides RHI-1 APVNTTTEDETAQIPAEAVI EEAEAEAEPK
FVNQHLCGSHLVEALY GYSDLEGDFDVAVLPFSNST (SEQ ID LVCGERGFFYTPKAAK
NNGLLFINTTIASIAAKEEG NO: 9) GIVEQCCTSICSLYQL VSMAKR ENYCN (SEQ ID
NO: 8) (SEQ ID NO: 11) RHI-2 APVNTTTEDETAQIPAEAVI DDGDPR
FVNQHLCGSHLVEALY GYSDLEGDFDVAVLPFSNST (SEQ ID LVCGERGFFYTPKDER
NNGLLFINTTIASIAAKEEG NO: 10) GIVEQCCTSICSLYQL VSMAKR ENYCN (SEQ ID
NO: 8) (SEQ ID NO: 12) RHI-3 APVNTTTEDETAQIPAEAVI EEAEAEAEPK
FVNQHLCGSHLVEALY GYSDLEGDFDVAVLPFSNST (SEQ ID LVCGERGFFYTPKDER
NNGLLFINTTIASIAAKEEG NO: 9) GIVEQCCTSICSLYQL VSMAKR ENYCN (SEQ ID
NO: 8) (SEQ ID NO: 12) RAT-1 APVNTTTEDETAQIPAEAVI EEAEAEAEPK
FVKQHLCGPHLVEALY GYSDLEGDFDVAVLPFSNST (SEQ ID LVCGERGFFYTPKAAK
NNGLLFINTTIASIAAKEEG NO: 9) GIVDQCCTSICSLYQL VSMAKR ENYCN (SEQ ID
NO: 8) (SEQ ID NO: 12) RHI-4 APVNTTTEDETAQIPAEAVI DDGDPR
FVNQHLCGSHLVEALY GYSDLEGDFDVAVLPFSNST (SEQ ID LVCGERGFFYTPKAAK
NNGLLFINTTIASIAAKEEG NO: 10) GIVEQCCTSICSLYQL VSMAKR ENYCN (SEQ ID
NO: 8) (SEQ ID NO: 11)
P. pastoris Transformation
[0466] The linearized plasmids were individually transformed into
electrocompetent P. pastoris GS115 and KM71 (both are His.sup.-
strains) according to the procedure reported by Wu and Letchworth
(Biotechniques 36:152-4). The electroporated cells were
re-suspended in 1 mL ice-cold, 1 M sorbitol and plated on minimal
dextrose-sorbitol agar (1.34% yeast nitrogen base without ammonium
and amino acids, 4.times.10.sup.-5% biotin, 2% dextrose, 1 M
sorbitol, and 2% agar) plates. The agar plates were incubated at
30.degree. C. for 4-7 days. Expression plasmids integrated into
GS115 and KM71 genomes render a His.sup.+ phenotype to the
transformants and allow the transformants to grow on minimal
dextrose-sorbitol agar without histidine supplementation.
Screening for P. Pastoris Transformants for Clones with High-Copy
Number of Expression Cassettes
[0467] The clones derived in 2 strains of P. pastoris with 4
expression plasmids in the above steps were individually screened
for incorporation of high-copy number of the gene constructs. All
the transformants were selected on minimal dextrose-sorbitol agar
without histidine supplementation. Each transformation generated
over 500 His.sup.+ transformants. Some of these transformants were
expected to contain multiple copies of the expression plasmid since
multiple integration events happen naturally in P. pastoris. These
high-copy number transformants could produce higher levels of
insulin molecule. Therefore, all transformants were screened based
on their resistance to geneticin in order to select for those with
the highest copy number, since all of the expression plasmids are
pPIC3.5K-deriviatives and contain a geneticin-resistant marker
(i.e., higher copy clones should lead to higher incorporation of
geneticin resistance).
[0468] His.sup.+ transformants were grown on minimal
dextrose-sorbitol agar and were pooled together and plated on YPD
agar (1% yeast extract, 2% peptone, 2% dextrose, and 2% agar)
containing geneticin by the following procedure: [0469] 1 to 2 ml
of sterile water was pipetted over the His.sup.+ transformants
(from each expression plasmid-strain combination) on each minimal
dextrose-sorbitol plate. [0470] His.sup.+ transformants were
resuspended into the water by using a sterile spreader and running
it across the top of the agar. [0471] The cell suspension was
transferred and pooled into a sterile, 50 ml conical centrifuge
tube and vortexed briefly. [0472] Cell density of the cell
suspension was determined by using a spectrophotometer (1
OD.sub.600 unit.apprxeq.5.times.10.sup.7 cells/ml). [0473] 10.sup.5
cells were plated on YPD plates containing geneticin at a final
concentration of 0.25, 0.5, 1.0, 1.5, 2.0, 3.0, and 4.0 mg/ml.
[0474] Plates were incubated at 30.degree. C. and checked daily.
Geneticin-resistant colonies took 3 to 5 days to appear.
[0475] Colonies that grew on YPD-geneticin plates were streaked for
purity on YPD agar containing the same concentration of geneticin
to ensure the isolated colonies are resistant to high concentration
of geneticin. Several clones at various genecitin concentration
levels were then selected for insulin molecule expression studies
in shake flasks.
Shake-Flask Studies
[0476] Shake flask studies were conducted on the 40
geneticin-resistant clones (4 expression plasmids.times.2
strains.times.5 transformants) at 2 buffer conditions (buffered vs.
unbuffered media) for a total of 80 shake culture flasks.
[0477] Half of the transformants were KM71 derivatives, which have
Mut.sup.s phenotypes. Isolated KM71 transformant colonies from
streaked plates prepared above were used to inoculate 100 mL
non-buffered MGY broth (1% yeast extract, 2% peptone, 1.34% yeast
nitrogen base, 4.times.10.sup.-5% biotin, and 1% glycerol) or 100
mL BMGY broth (same as MGY, but with 100 mM potassium phosphate, pH
6). These seed cultures were incubated at 30.degree. C. with
orbital shaking at 250 rpm for 16 hours or until OD.sub.600 values
reached 2-6. Then, a small aliquot of each MGY culture was used to
prepare glycerol stocks. The remaining MGY cultures were then
harvested by centrifugation at 4000.times.g for 5 min. Culture
supernatants were discarded and each cell pellet was re-suspended
with 20 mL MMY broth (same as MGY except glycerol was replaced by
0.5% methanol). Similarly, BMGY seed cultures were harvested by
centrifugation at 4000.times.g for 5 min. Culture supernatants were
discarded and each cell pellet was re-suspended with 20 mL BMMY
broth (same as BMGY except glycerol was replaced by 0.5%
methanol).
[0478] Methanol in the MMY and BMMY broths induce protein
expression. The MMY and BMMY cultures were incubated at 30.degree.
C. with orbital shaking at 250 rpm for 96 hours. Every 24 hours,
methanol was added to each culture to a final concentration of
0.5%. A 0.5-mL aliquot of culture was also removed from each shake
flasks every 24 hours after the start of induction. For these
samples, cells were separated from culture supernatants by
micro-centrifugation and both fractions were stored at -80.degree.
C.
[0479] The second half of the transformants were GS115 derivatives,
which were expected to be Mut.sup.+. Isolated GSt 115 transformant
colonies from streaked plates prepared as described previously were
used to inoculate 25 mL MGY broth and 25 mL BMGY broth. These seed
cultures were incubated at 30.degree. C. with orbital shaking at
250 rpm for 16 hours or until OD.sub.600 values reached 2-6. Then,
a small aliquot of each MGY culture was used to prepare glycerol
stocks. Another aliquot of the remaining cells was harvested by
centrifugation for inoculating 20 mL MMY broth, such that the
starting OD.sub.600 value was about 1. Similarly, the BMGY seed
cultures were used to inoculate 20 mL BMMY broth, such that the
starting OD.sub.600 value was about 1. The MMY and BMMY cultures
were incubated at 30.degree. C. with orbital shaking at 250 rpm for
96 hours. Every 24 hours, methanol was added to each culture to a
final concentration of 0.5%. A 0.5-mL aliquot of culture was
removed from each shake flask every 24 hours after the start of
induction. Cells were separated from culture supernatants by
micro-centrifugation and both fractions were stored at -80.degree.
C.
[0480] After 96-hour of induction, all cultures were harvested by
centrifugation. Cell pellets were discarded. The final culture
supernatants plus culture supernatants collected at various time
points during induction were analyzed for insulin molecule
expression yields by denaturing polyacrylamide gel electrophoresis
(SDS-PAGE, BioRad, Hercules, Calif.; Standard Ladder: SeeBluePlus2
Prestain Standard (1.times.); Stain: SimplyBlue SafeStain; Precast
gels: Criterion Precast Gel 16.5% Tris-Tricine/Peptide; Running
buffer: 1.times. Tris/Tricine/SDS Buffer; Loading Buffer: Tricine
Sample Buffer) or enzyme-linked immunosorbent assay (ELISA,
Mercodia Iso-Insulin ELISA, Uppsala, Sweden).
Media for Large-Scale Insulin Molecule Expression in Yeast
[0481] BMY BM_Y Base Medium (Teknova, Cat#B8001)
[0482] BMGY=BM_Y+0.1% Glycerol (v/v)
[0483] BMMY=BM_Y+Methanol
Preparation of MDS Agar Plates for Large-Scale Insulin Molecule
Expression in Yeast
[0484] 319 g of sorbitol and 35 g of agar were dissolved in 1.4 L
of di-H.sub.2O. The mixture was autoclaved for 30 minutes. The
temperature was allowed to drop to 60.degree. C. before proceeding.
Next, 175 mL of sterile 13.4% (w/v) Yeast-Nitrogen Base (YNB)
containing ammonium sulfate in deionized water was added. To this
mixture was added a portion of 175 mL of sterile 20% glucose in
deionized water and 3.5 mL of sterile 0.02% biotin solution in
deionized water. The solution was mixed to homogeneity and then
poured into plates.
Large-Scale Expression and Culture of Insulin Molecule in Yeast
[0485] Using a sterile loop, an aliquot of frozen cells was
transferred to an MDS plate, and streaked in order to obtain single
colonies. The plate was incubated at 30.degree. C. for 2-4 days to
elucidate yeast colonies. One colony was picked at random with a
sterile loop and used to inoculate 25 mL of BMGY medium (24.17 mL
of BM_Y+0.83 mL of 30% glycerol). This medium was incubated for 24
hrs in an incubator/shaker (.about.150 rpm) at 30.degree. C.
[0486] After this time, 75 mL BMGY (72.5 mL of BM_Y+2.5 mL of 30%
glycerol) was added to the culture to give a final volume of
.about.100 mL. The incubation was continued for another 24 hr under
the same conditions. The next day, the Optical Density (OD) was
assayed to determine how much preculture was needed to obtain a
10000D aliquot (e.g., if OD=15, then 10000D/150D*mL.sup.-1=>66.7
mL of preculture were needed to get 10000D).
[0487] Then the calculated volume of preculture was centrifuged
(4000 rpm, 4.degree. C. for 10 min) and the supernatant decanted.
The pellet was resuspended in 990 mL of BM_Y medium. The OD was
rechecked (it should be around 1.0) and the culture volume was
adjusted accordingly if needed. 10 mL of biochemical grade methanol
(Sigma-Aldrich, St. Louis, Mo. #494437) was then added to the
flask, and the flask was incubated at 30.degree. C., in a
incubator/shaker at .about.150 rpm for 24 hr. Methanol was added
every 24 hr for 2-6 days depending on the desired level of protein
expression.
[0488] After the desired level of yeast growth was achieved, the
culture was centrifuged (10,000 rpm, 4.degree. C. for 30 min). The
supernatant was decanted and kept in clean container and frozen at
-80.degree. C. until needed.
Large-Scale Purification of Insulin Molecule
[0489] Cells from the culture flasks were spun down via centrifuge
at 4000.times.g for 10 min at 4.degree. C. The resulting
supernatant was decanted into a clean flask. The pH of supernatant
was adjusted to .about.3.3 using 1 N HCl or 1 N NaOH, followed by a
dilution of the supernatant with an equal volume of deionized water
(Milli-Q, Millipore, Billerica, Mass.).
[0490] The resulting culture supernatant was clarified via
filtration through a 0.2 micron, low binding filter unit
(Millipore, Billerica, Mass.). Separately, an ion-exchange column
(1.42 cm.times.1.42 cm.times.5.0 cm) was prepared SP Sepharose
Fast-Flow media (GE Healthcare) that was prepared in 25 mM Citrate
buffer, pH 3.3 (Wash Buffer). Once the column had been
appropriately packed, the column was connected to a peristaltic
pump to allow for loading of the culture supernatant onto the ion
exchange column (.about.10 ml/minute). Once all of the culture
supernatant had been loaded onto the column, approximately 10
column volumes (CV) of Wash Buffer was passed through the column
using the peristaltic pump. After this was done, the purified
insulin molecule was eluted from the column using approximately 2-5
CVs of elution buffer (50 mM, pH 7.6 and 200 mM NaCl).
[0491] The resulting purified insulin molecule solution was
concentrated and desalted using a diafiltration setup (88 cm.sup.2
and 0.11 m.sup.2 Cassette holder, 5 kDa MWCO Pellicon3 0.11 m.sup.2
Cassette filter, Millipore, Billerica, Mass.) connected to a
MasterFlex Model 7523-80 pump (ColePalmer, Vernon Hills, Illinois).
The solution was first concentrated or diluted to approximately 250
mL of volume and then diafiltered against Milli-Q deionized water
for approximately 8-10 diavolumes.
[0492] The desalted, purified insulin molecule solution was then
either lyophilized or used directly in a subsequent enzymatic
processing step.
In Vitro Enzyme Processing
[0493] Achromobacter lyticus protease (ALP) was prepared by
dissolving 2 U of enzyme in 1 mL of Milli-Q H.sub.2O. A working
solution was prepared by further diluting the enzyme stock solution
1:9 with Milli-Q H.sub.2O for a concentration of 0.2 U/mL.
[0494] Broth from all 10 RHI-1 mutants was used (GS115 RHI-1 A-E
and KM71 RHI-1 A-E). Two 200 .mu.L aliquots of each broth sample
were prepared and adjusted to pH .about.10 by addition of 40 .mu.L
of 2 M Tris. Two aliquots of .about.540 .mu.g/mL human RHI were
prepared in the same manner to act as controls. 2.4 .mu.L working
enzyme solution was added to one of each pair of aliquots. 2.4
.mu.L Milli-Q H.sub.2O was added to the other to serve as a
control. Samples were incubated at room temperature for 4.5 hours
on a rocker and then frozen at -80.degree. C. until analysis.
[0495] Samples were prepared for SDS-PAGE and western blotting by
adding 20 .mu.L Tricine sample buffer (Bio-rad) to 10 .mu.L of
prepared broth and boiling for 5 minutes. Samples, along with
peptide and protein ladders, were resolved on 16.5% Tris-Tricine
gels run at 125 V for 1.75 hours at room temperature. Proteins were
then transferred to nitrocellulose membranes using an iBlot dry
transfer system (Invitrogen), program P3 for 5.5 minutes. Membranes
were fixed for 15 minutes with 0.25% gluteraldehyde in PBS and then
washed 3.times.5 minutes with TBS. Blocking was carried out in 5%
powdered milk in PBS+0.05% Tween-20 (PBST) for 1 hour on a rocker
at room temperature. Blots were then incubated in mouse anti-human
pro-insulin/insulin antibody (Abcam) diluted 1:1000 in 1% powdered
milk in PBST overnight at 4.degree. C. on a shaker. Blots were
washed 2.times.10 minutes with PBST and incubated for two hours at
room temperature in HRP conjugated goat anti-mouse IgG diluted
1:3000 in 1% milk in PBST. Blots were washed 2.times.10 minutes in
PBST followed by a 2 minute wash in dH.sub.2O. Bands were developed
by incubating for 2 hours at room temperature in TMB substrate
(Pierce), followed by extensive washing with dH.sub.2O.
Conjugation with a Prefunctionalized Ligand Framework
[0496] Once the insulin molecules with N-terminal protected amino
acids (on A0/B0, on A0 only or on B0 only) have been treated with
ALP they are conjugated with a prefunctionalized ligand framework
that includes an activated ester (e.g., --OSu, etc.). The reaction
is performed by dissolving the prefunctionalized ligand framework
in an anhydrous organic solvent such as DMSO or DMF and then adding
the desired number of equivalents of ALP digested insulin molecule
followed by mixing for several hours at room temperature.
[0497] A conjugation reaction between a prefunctionalized ligand
framework and ALP digested insulin molecule may also take place in
carbonate buffer to give a B29-conjugated insulin molecule. In an
exemplary synthesis, a prefunctionalized ligand framework (PLF) is
dissolved in anhydrous DMSO followed by the addition of
triethylamine (TEA). The solution is stirred rapidly for a desired
amount of time at room temperature. The ALP digested insulin
molecule is then dissolved separately at 17.2 mM in sodium
carbonate buffer (0.1 M, pH 11) and the pH subsequently adjusted to
10.8 with 1.0 N sodium hydroxide, Once dissolved, the PLF/DMSO/TEA
solution is added dropwise to the drug/carbonate buffer solution.
During the addition, the pH of the resulting mixture is adjusted
periodically to 10.8 if necessary using dilute HCl or NaOH. The
solution is allowed to stir for a desired amount of time after the
dropwise addition to ensure complete reaction.
[0498] Furthermore, under the carbonate buffer conditions, in
certain embodiments where the insulin molecule is protected only at
B0, A1,B29-disubstituted insulin-conjugates are synthesized using
the conditions described above with approximately ten times the
amount of prefunctionalized ligand framework per insulin molecule
compared to the B29-monosubstituted insulin-conjugate
synthesis.
In Vitro Enzyme Cleavage of N-Terminal Amino Acid Protecting Amino
Acid Sequences
[0499] The conjugated insulin intermediates are then treated with
trypsin to cleave the N-terminal protecting amino acid sequences
that are shown underlined in Table 6. Briefly, 0.5% (w/w) trypsin
(e.g., porcine trypsin) is added to the conjugated insulin
intermediates. The trypsin may be provided as an aqueous solution
in a volume amounting to 10% v/v to 30% v/v (e.g., about 20% v/v)
of that of the reaction mixture. After about 1 hour at room
temperature, the reaction is terminated. The reaction may be
terminated by adjusting the pH, e.g., adjusting the pH to an acidic
pH (e.g., to a pH of about 1, about 2, about 3, about 4, about 5,
or about 6). Optionally, the desired product is purified (e.g.,
using preparative reverse phase HPLC).
Results
Production of Insulin Molecules in Yeast
[0500] This Example demonstrates insulin molecule production in
yeast. In particular, this Example demonstrates insulin molecule
(specifically, production of RHI-1, RHI-2, RHI-3, and RAT-1)
production in two different yeast strains. The present disclosure
encompasses the recognition that these procedures can be useful for
expressing and purifying any other recombinant insulin
molecule.
[0501] FIG. 11 presents unpurified culture supernatant yields from
the GS115 strain clones grown under buffered (BMMY) and unbuffered
(MMY) conditions. The left panel of FIG. 11 presents the insulin
molecule yield in mg/L from various clones ("Clone#" refers to
clones obtained from different geneticin plate resistance levels)
using ELISA analysis (ISO-Insulin ELISA, Mercodia, Uppsala,
Sweden). The right panel of FIG. 11 presents SDS-PAGE of the
clones, showing the molecular weights of the produced insulin
molecules. Recombinant human insulin standard (RHI standard) is
shown in lane 14 of the top right gel and in lane 2 of the bottom
right gel at 250 mg/L for yield comparison purposes. As expected,
the insulin molecules have a higher MW than that of the RHI
standard due to the leader peptide and the connecting peptide
("C-peptide").
[0502] FIG. 12 presents unpurified culture supernatant yields from
the KM71 strain clones grown under buffered conditions. The left
panel of FIG. 12 presents the insulin molecule yield in mg/L from
various clones ("Clone#" refers to clones obtained from different
geneticin plate resistance levels) using ELISA analysis
(ISO-Insulin ELISA, Mercodia, Uppsala, Sweden). The right panel of
FIG. 12 presents SDS-PAGE of the clones, showing the molecular
weights of the produced insulin molecules. Recombinant human
insulin standard (RHI standard) is shown in lanes 15-18 of the top
right gel (60-500 mg/L) and in lanes 5-9 of the bottom right gel
(30-500 mg/L) for yield comparison purposes. As expected, the
insulin molecules have a higher MW than that of the RHI standard
due to the leader peptide and the connecting peptide
("C-peptide").
[0503] FIG. 13 presents unpurified culture supernatant yields from
the KM71 strain clones grown under unbuffered conditions. The left
panel of FIG. 13 presents the insulin molecule yield in mg/L from
various clones ("Clone#" refers to clones obtained from different
geneticin plate resistance levels) using ELISA analysis
(ISO-Insulin ELISA, Mercodia, Uppsala, Sweden). The right panel of
FIG. 13 presents SDS-PAGE of the clones, showing the molecular
weights of the produced insulin molecules. Recombinant human
insulin standard (RHI Standard) is shown in lanes 8 and 9 of the
top right gel (250 and 100 mg/L) and in lane 18 of the bottom right
gel (250 mg/L) for yield comparison purposes. As expected, the
insulin molecules have a higher MW than that of the RHI standard
due to the leader peptide and the connecting peptide
("C-peptide").
[0504] The results presented in FIGS. 11-13 demonstrate that the
insulin molecules produced by the various plasmid constructs were
of the correct MW. In addition, these data show that the insulin
molecules are insulin-like, as they were measurable and detectable
by a commercial insulin ELISA kit that uses antibodies that are
specific for human insulin. These data further demonstrate that
insulin molecules could be expressed in yeast at
commercially-useful levels (e.g., >25 mg/L). Finally, these data
demonstrated a good correlation between ELISA-measured yields and
SDS-PAGE-measured yields from crude culture supernatants. In other
words, when SDS-PAGE band intensity increased, ELISA measurements
also tended to increase. This correlation further demonstrates that
the band of interest at the appropriate molecular weight on the
SDS-PAGE gel was indeed the insulin molecule.
In Vitro Enzyme Processing of Purified Insulin Molecules
[0505] This Example also describes procedures that were used for in
vitro enzyme processing of recombinantly produced insulin molecules
(to remove the C-peptide and leader peptide). The present
disclosure encompasses the recognition that these procedures can be
utilized for purification of insulin molecules at any step of the
production process, e.g., from crude cell culture broth, from
clarified supernatant, from purified insulin molecule product,
etc.
[0506] Broth from methanol induced mutants containing gene RHI-1
was digested with Achromobacter lyticus protease (ALP). ALP is a
C-terminal lysine protease, and as such was expected to cleave the
peptide linker between the A- and B-peptides of the insulin
molecule (except for RHI-2 and RHI-3 constructs which include a
C-peptide that lacks a C-terminal Lys) as well as the leader
peptide sequence linked to the N-terminus of the B-peptide. Dried
membranes were scanned and are presented in FIG. 14. Two bands were
present in most lanes containing broth, and both bands were shifted
to a lower molecular weight after enzyme digestion compared to the
controls. The lower MW band in each digested pair is at
approximately the same location as the RHI control. The RHI control
did not change MW following digestion. These results demonstrate
that insulin molecules of the appropriate size were generated after
enzyme processing. Digestion of the insulin molecules RHI-1, RHI-4
and RAT-1 with ALP would be predicted to produce the products
presented in Table 6 (where the A- and B-peptides in the product
are connected via three disulfide bridges as shown in formula
X.sup.1). Since the C-peptides of RHI-2 and RHI-3 do not include a
C-terminal Lys they would be expected to remain connected to the
N-terminus of the A-peptide until they are further processed with
an enzyme that cleaves on the C-terminal side of Arg (e.g., trypsin
or a trypsin-like protease as discussed below).
[0507] RHI-2, RHI-3 and RHI-4 were each designed to include one or
more N-terminal protecting amino acid sequences (underlined in the
sequences of Table 6). As shown, RHI-2 includes an N-terminal
protecting amino acid sequence at positions A0 and B0 (as mentioned
above, the C-peptide of RHI-2 is not cleaved by ALP and is
therefore still attached to the N-terminus of the A-peptide). RHI-3
includes an N-terminal protecting amino acid sequence at position
A0 only (as mentioned above, the C-peptide of RHI-3 is not cleaved
by ALP and is therefore still attached to the N-terminus of the
A-peptide). RHI-4 includes an N-terminal protecting amino acid
sequence at position B0 only.
TABLE-US-00008 TABLE 6 Construct C- ID B-peptide peptide A-peptide
RHI-1 FVNQHLCGSHLVEALYLVCG AAK GIVEQCCTSICSLYQLENY ERGFFYTPK (SEQ
ID CN (SEQ ID NO: 13) NO: 16) (SEQ ID NO: 18) RHI-2
DGGDPRFVNQHLCGSHLVEA DER GIVEQCCTSICSLYQLENY LYLVCGERGFFYTPK (SEQ
ID CN (SEQ ID NO: 14) NO: 17) (SEQ ID NO: 18) RHI-3
FVNQHLCGSHLVEALYLVCG DER GIVEQCCTSICSLYQLENY ERGFFYTPK (SEQ ID CN
(SEQ ID NO: 13) NO: 17) (SEQ ID NO: 18) RHI-4 DGGDPRFVNQHLCGSHLVEA
AAK GIVEQCCTSICSLYQLENY LYLVCGERGFFYTPK (SEQ ID CN (SEQ ID NO: 14)
NO: 16) (SEQ ID NO: 18) RAT-1 FVKQHLCGPHLVEALYLVCG AAK
GIVDQCCTSICSLYQLENY ERGFFYTPK (SEQ ID CN (SEQ ID NO: 15) NO: 16)
(SEQ ID NO: 19)
Conjugation with a Prefunctionalized Ligand Framework
[0508] Once RHI-2, RHI-3 and RHI-4 have been treated with ALP they
are conjugated with a prefunctionalized ligand framework that
includes a terminal activated ester (e.g., --OSu, etc.). The
reaction is performed by dissolving the framework prefunctionalized
ligand framework in an anhydrous organic solvent such as DMSO or
DMF and then adding the desired number of equivalents of ALP
digested insulin molecule followed by mixing for several hours at
room temperature.
[0509] Alternatively, the reaction is performed in carbonate buffer
by dissolving the desired number of equivalents of a
prefunctionalized ligand framework (PLF) in anhydrous DMSO followed
by the addition of triethylamine (TEA). The solution is stirred
rapidly for a desired amount of time at room temperature. The ALP
digested insulin molecule is then dissolved separately at 17.2 mM
in sodium carbonate buffer (0.1 M, pH 11) and the pH subsequently
adjusted to 10.8 with 1.0 N sodium hydroxide. Once dissolved, the
PLF/DMSO/TEA solution is added dropwise to the drug/carbonate
buffer solution. During the addition, the pH of the resulting
mixture is adjusted periodically to 10.8 if necessary using dilute
HCl or NaOH. The solution is allowed to stir for a desired amount
of time after the dropwise addition to ensure complete
reaction.
In Vitro Enzyme Cleavage of N-Terminal Amino Acid Protecting Amino
Acid Sequences
[0510] The conjugated insulin intermediates are then treated with
trypsin to cleave the N-terminal protecting amino acid sequences
that are shown underlined in Table 6. Briefly, 0.5% (w/w) trypsin
(e.g., porcine trypsin) is added to the conjugated insulin
intermediates. The trypsin may be provided as an aqueous solution
in a volume amounting to 10% v/v to 30% v/v (e.g., about 20% v/v)
of that of the reaction mixture. After about 1 hour at room
temperature, the reaction is terminated. The reaction may be
terminated by adjusting the pH, e.g., adjusting the pH to an acidic
pH (e.g., to a pH of about 1, about 2, about 3, about 4, about 5,
or about 6). Optionally, the desired product is purified (e.g.,
using preparative reverse phase HPLC).
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 31 <210> SEQ ID NO 1 <211> LENGTH: 23 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: Insulin analog A-chain
<221> NAME/KEY: VARIANT <222> LOCATION: 1 <223>
OTHER INFORMATION: Xaa= any codable amino acid, a sequence of 2-50,
2-25, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or 2 codable amino
acids, or missing <221> NAME/KEY: VARIANT <222>
LOCATION: 23 <223> OTHER INFORMATION: Xaa= any codable amino
acid, a sequence of 2-50, 2-25, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4,
2-3, or 2 codable amino acids, or missing <221> NAME/KEY:
VARIANT <222> LOCATION: 9 <223> OTHER INFORMATION: Xaa=
any codable amino acid; or T or A <221> NAME/KEY: VARIANT
<222> LOCATION: 10 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or S or G <221> NAME/KEY: VARIANT
<222> LOCATION: 11 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or I or V <221> NAME/KEY: VARIANT
<222> LOCATION: (19)...(19) <223> OTHER INFORMATION:
Xaa= any codable amino acid; or N, D, or E <221> NAME/KEY:
VARIANT <222> LOCATION: (22)...(22) <223> OTHER
INFORMATION: Xaa= any codable amino acid; or N, D, E, G, or A
<400> SEQUENCE: 1 Xaa Gly Ile Val Glu Gln Cys Cys Xaa Xaa Xaa
Cys Ser Leu Tyr Gln 1 5 10 15 Leu Glu Xaa Tyr Cys Xaa Xaa 20
<210> SEQ ID NO 2 <211> LENGTH: 33 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Insulin analog B-chain <221>
NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER
INFORMATION: Xaa= any codable amino acid, a sequence of 2-50, 2-25,
2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or 2 codable amino acids,
or missing <221> NAME/KEY: VARIANT <222> LOCATION: 32
<223> OTHER INFORMATION: Xaa= any codable amino acid, a
sequence of 2-50, 2-25, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or
2 codable amino acids, or missing <221> NAME/KEY: VARIANT
<222> LOCATION: 4 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or N, K, D, or E, or missing <221>
NAME/KEY: VARIANT <222> LOCATION: 29 <223> OTHER
INFORMATION: Xaa= any codable amino acid; or P, A, K, L, V, or D,
or missing <221> NAME/KEY: VARIANT <222> LOCATION: 30
<223> OTHER INFORMATION: Xaa= any codable amino acid; or K,
P, or E, or missing <221> NAME/KEY: VARIANT <222>
LOCATION: (31)...(31) <223> OTHER INFORMATION: Xaa= any
codable amino acid or T, A, K, E, S, or R, or missing <221>
NAME/KEY: VARIANT <222> LOCATION: (3)...(32) <223>
OTHER INFORMATION: Xaa= any codable amino acid, a sequence of
codable amino acids, Arg-Arg, or missing <400> SEQUENCE: 2
Xaa Phe Val Xaa Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu 1 5
10 15 Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Xaa Xaa Xaa
Xaa 20 25 30 Xaa <210> SEQ ID NO 3 <211> LENGTH: 447
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Encodes RHI-1
<400> SEQUENCE: 3 atgagattcc catctatctt cactgctgtt ttgttcgctg
cttcttctgc tttggctgct 60 cctgttaaca ctactactga agacgaaact
gctcaaatcc cagctgaagc ggttatcggt 120 tactctgact tggaaggtga
cttcgacgtt gctgttttgc ctttctctaa ctctactaat 180 aatggtttgt
tgttcatcaa cactactatc gcttctatcg ctgctaagga agagggtgtt 240
tctatggcta agagagaaga agctgaagct gaagctgaac caaagtttgt taaccaacac
300 ttgtgtggtt ctcacttggt tgaagctttg tacttggttt gtggtgaaag
aggtttcttc 360 tacactccaa aggctgctaa gggtatcgtt gaacaatgtt
gtacttctat ctgttctttg 420 taccaattgg aaaactactg taactaa 447
<210> SEQ ID NO 4 <211> LENGTH: 435 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Encodes RHI-2 <400> SEQUENCE:
4 atgagattcc catctatctt cactgctgtt ttgttcgctg cttcttctgc tttggctgct
60 cctgttaaca ctactactga agacgaaact gctcaaatcc cagctgaagc
ggttatcggt 120 tactctgact tggaaggtga cttcgacgtt gctgttttgc
ctttctctaa ctctactaat 180 aatggtttgt tgttcatcaa cactactatc
gcttctatcg ctgctaagga agagggtgtt 240 tctatggcta agagagacga
cggtgaccca agatttgtta accaacactt gtgtggttct 300 cacttggttg
aagctttgta cttggtttgt ggtgaaagag gtttcttcta cactccaaag 360
gacgaaagag gtatcgttga acaatgttgt acttctatct gttctttgta ccaattggaa
420 aactactgta actaa 435 <210> SEQ ID NO 5 <211>
LENGTH: 447 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Encodes RHI-3 <400> SEQUENCE: 5 atgagattcc catctatctt
cactgctgtt ttgttcgctg cttcttctgc tttggctgct 60 cctgttaaca
ctactactga agacgaaact gctcaaatcc cagctgaagc ggttatcggt 120
tactctgact tggaaggtga cttcgacgtt gctgttttgc ctttctctaa ctctactaat
180 aatggtttgt tgttcatcaa cactactatc gcttctatcg ctgctaagga
agagggtgtt 240 tctatggcta agagagaaga agctgaagct gaagctgaac
caaagtttgt taaccaacac 300 ttgtgtggtt ctcacttggt tgaagctttg
tacttggttt gtggtgaaag aggtttcttc 360 tacactccaa aggacgaaag
aggtatcgtt gaacaatgtt gtacttctat ctgttctttg 420 taccaattgg
aaaactactg taactaa 447 <210> SEQ ID NO 6 <211> LENGTH:
447 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Encodes RAT-1
<400> SEQUENCE: 6 atgagattcc catctatctt cactgctgtt ttgttcgctg
cttcttctgc tttggctgct 60 cctgttaaca ctactactga agacgaaact
gctcaaatcc cagctgaagc ggttatcggt 120 tactctgact tggaaggtga
cttcgacgtt gctgttttgc ctttctctaa ctctactaat 180 aatggtttgt
tgttcatcaa cactactatc gcttctatcg ctgctaagga agagggtgtt 240
tctatggcta agagagaaga agctgaagct gaagctgaac caaagtttgt taagcaacac
300 ttgtgtggtc ctcacttggt tgaagctttg tacttggttt gtggtgaaag
aggtttcttc 360 tacactccaa aggctgctaa gggtatcgtt gaccaatgtt
gtacttctat ctgttctttg 420 taccaattgg aaaactactg taactaa 447
<210> SEQ ID NO 7 <211> LENGTH: 435 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Encodes RHI-4 <400> SEQUENCE:
7 atgagattcc catctatctt cactgctgtt ttgttcgctg cttcttctgc tttggctgct
60 cctgttaaca ctactactga agacgaaact gctcaaatcc cagctgaagc
ggttatcggt 120 tactctgact tggaaggtga cttcgacgtt gctgttttgc
ctttctctaa ctctactaat 180 aatggtttgt tgttcatcaa cactactatc
gcttctatcg ctgctaagga agagggtgtt 240 tctatggcta agagagacga
cggtgaccca agatttgtta accaacactt gtgtggttct 300 cacttggttg
aagctttgta cttggtttgt ggtgaaagag gtttcttcta cactccaaag 360
gctgctaagg gtatcgttga acaatgttgt acttctatct gttctttgta ccaattggaa
420 aactactgta actaa 435 <210> SEQ ID NO 8 <211>
LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
pro-leader peptide <400> SEQUENCE: 8 Ala Pro Val Asn Thr Thr
Thr Glu Asp Glu Thr Ala Gln Ile Pro Ala 1 5 10 15 Glu Ala Val Ile
Gly Tyr Ser Asp Leu Glu Gly Asp Phe Asp Val Ala 20 25 30 Val Leu
Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe Ile Asn 35 40 45
Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Met Ala 50
55 60 Lys Arg 65 <210> SEQ ID NO 9 <211> LENGTH: 10
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: leader peptide
<400> SEQUENCE: 9 Glu Glu Ala Glu Ala Glu Ala Glu Pro Lys 1 5
10 <210> SEQ ID NO 10 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: leader peptide <400> SEQUENCE:
10 Asp Asp Gly Asp Pro Arg 1 5 <210> SEQ ID NO 11 <211>
LENGTH: 53 <212> TYPE: PRT <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION: B-C-A
peptides <400> SEQUENCE: 11 Phe Val Asn Gln His Leu Cys Gly
Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg
Gly Phe Phe Tyr Thr Pro Lys Ala Ala Lys 20 25 30 Gly Ile Val Glu
Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 35 40 45 Glu Asn
Tyr Cys Asn 50 <210> SEQ ID NO 12 <211> LENGTH: 53
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: B-C-A peptides
<400> SEQUENCE: 12 Phe Val Asn Gln His Leu Cys Gly Ser His
Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe
Phe Tyr Thr Pro Lys Asp Glu Arg 20 25 30 Gly Ile Val Glu Gln Cys
Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 35 40 45 Glu Asn Tyr Cys
Asn 50 <210> SEQ ID NO 13 <211> LENGTH: 29 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: B peptide <400>
SEQUENCE: 13 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu
Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr
Pro Lys 20 25 <210> SEQ ID NO 14 <211> LENGTH: 35
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: B peptide
<400> SEQUENCE: 14 Asp Gly Gly Asp Pro Arg Phe Val Asn Gln
His Leu Cys Gly Ser His 1 5 10 15 Leu Val Glu Ala Leu Tyr Leu Val
Cys Gly Glu Arg Gly Phe Phe Tyr 20 25 30 Thr Pro Lys 35 <210>
SEQ ID NO 15 <211> LENGTH: 29 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: B peptide <400> SEQUENCE: 15
Phe Val Lys Gln His Leu Cys Gly Pro His Leu Val Glu Ala Leu Tyr 1 5
10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys 20 25
<210> SEQ ID NO 16 <211> LENGTH: 3 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: C peptide <400> SEQUENCE: 16
Ala Ala Lys 1 <210> SEQ ID NO 17 <211> LENGTH: 3
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: C peptide
<400> SEQUENCE: 17 Asp Glu Arg 1 <210> SEQ ID NO 18
<211> LENGTH: 21 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: A peptide <400> SEQUENCE: 18 Gly Ile Val Glu Gln
Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr
Cys Asn 20 <210> SEQ ID NO 19 <211> LENGTH: 21
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: A peptide
<400> SEQUENCE: 19 Gly Ile Val Asp Gln Cys Cys Thr Ser Ile
Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20
<210> SEQ ID NO 20 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<221> NAME/KEY: VARIANT <222> LOCATION: 1 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 2 <223> OTHER INFORMATION: Xaa= Asp/Glu
<221> NAME/KEY: VARIANT <222> LOCATION: 3 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 4 <223> OTHER INFORMATION: Xaa= Asp/Glu
<400> SEQUENCE: 20 Xaa Xaa Xaa Xaa Pro Arg 1 5 <210>
SEQ ID NO 21 <211> LENGTH: 5 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<221> NAME/KEY: VARIANT <222> LOCATION: 1 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 2 <223> OTHER INFORMATION: Xaa= Asp/Glu
<221> NAME/KEY: VARIANT <222> LOCATION: 4 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 5 <223> OTHER INFORMATION: Xaa= any
codable amino acid or Gly or Pro <400> SEQUENCE: 21 Xaa Xaa
Gly Xaa Xaa 1 5 <210> SEQ ID NO 22 <211> LENGTH: 6
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: N-terminal
protecting peptide <400> SEQUENCE: 22 Asp Asp Gly Asp Pro Arg
1 5 <210> SEQ ID NO 23 <211> LENGTH: 6 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: N-terminal protecting
peptide <400> SEQUENCE: 23 Glu Glu Gly Glu Pro Arg 1 5
<210> SEQ ID NO 24 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 24 Asp Asp Gly Asp Gly Arg 1 5 <210>
SEQ ID NO 25 <211> LENGTH: 6 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 25 Glu Glu Gly Glu Gly Arg 1 5 <210>
SEQ ID NO 26 <211> LENGTH: 3 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 26 Asp Glu Arg 1 <210> SEQ ID NO 27
<211> LENGTH: 21 <212> TYPE: PRT <213> ORGANISM:
HOMO SAPIENS <400> SEQUENCE: 27 Gly Ile Val Glu Gln Cys Cys
Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn
20 <210> SEQ ID NO 28 <211> LENGTH: 30 <212>
TYPE: PRT <213> ORGANISM: HOMO SAPIENS <400> SEQUENCE:
28 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr
1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr
20 25 30 <210> SEQ ID NO 29 <211> LENGTH: 35
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: C-peptide
<400> SEQUENCE: 29 Arg Arg Glu Ala Glu Asp Leu Gln Val Gly
Gln Val Glu Leu Gly Gly 1 5 10 15 Gly Pro Gly Ala Gly Ser Leu Gln
Pro Leu Ala Leu Glu Gly Ser Leu 20 25 30 Gln Lys Arg 35 <210>
SEQ ID NO 30 <211> LENGTH: 10 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: C-peptide <400> SEQUENCE: 30
Glu Glu Ala Glu Ala Glu Ala Glu Pro Lys 1 5 10 <210> SEQ ID
NO 31 <211> LENGTH: 4 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: C-peptide <400> SEQUENCE: 31 Thr Ala Ala
Lys 1
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 31 <210>
SEQ ID NO 1 <211> LENGTH: 23 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Insulin analog A-chain <221>
NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER
INFORMATION: Xaa= any codable amino acid, a sequence of 2-50, 2-25,
2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or 2 codable amino acids,
or missing <221> NAME/KEY: VARIANT <222> LOCATION: 23
<223> OTHER INFORMATION: Xaa= any codable amino acid, a
sequence of 2-50, 2-25, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or
2 codable amino acids, or missing <221> NAME/KEY: VARIANT
<222> LOCATION: 9 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or T or A <221> NAME/KEY: VARIANT
<222> LOCATION: 10 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or S or G <221> NAME/KEY: VARIANT
<222> LOCATION: 11 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or I or V <221> NAME/KEY: VARIANT
<222> LOCATION: (19)...(19) <223> OTHER INFORMATION:
Xaa= any codable amino acid; or N, D, or E <221> NAME/KEY:
VARIANT <222> LOCATION: (22)...(22) <223> OTHER
INFORMATION: Xaa= any codable amino acid; or N, D, E, G, or A
<400> SEQUENCE: 1 Xaa Gly Ile Val Glu Gln Cys Cys Xaa Xaa Xaa
Cys Ser Leu Tyr Gln 1 5 10 15 Leu Glu Xaa Tyr Cys Xaa Xaa 20
<210> SEQ ID NO 2 <211> LENGTH: 33 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Insulin analog B-chain <221>
NAME/KEY: VARIANT <222> LOCATION: 1 <223> OTHER
INFORMATION: Xaa= any codable amino acid, a sequence of 2-50, 2-25,
2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or 2 codable amino acids,
or missing <221> NAME/KEY: VARIANT <222> LOCATION: 32
<223> OTHER INFORMATION: Xaa= any codable amino acid, a
sequence of 2-50, 2-25, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, or
2 codable amino acids, or missing <221> NAME/KEY: VARIANT
<222> LOCATION: 4 <223> OTHER INFORMATION: Xaa= any
codable amino acid; or N, K, D, or E, or missing <221>
NAME/KEY: VARIANT <222> LOCATION: 29 <223> OTHER
INFORMATION: Xaa= any codable amino acid; or P, A, K, L, V, or D,
or missing <221> NAME/KEY: VARIANT <222> LOCATION: 30
<223> OTHER INFORMATION: Xaa= any codable amino acid; or K,
P, or E, or missing <221> NAME/KEY: VARIANT <222>
LOCATION: (31)...(31) <223> OTHER INFORMATION: Xaa= any
codable amino acid or T, A, K, E, S, or R, or missing <221>
NAME/KEY: VARIANT <222> LOCATION: (3)...(32) <223>
OTHER INFORMATION: Xaa= any codable amino acid, a sequence of
codable amino acids, Arg-Arg, or missing <400> SEQUENCE: 2
Xaa Phe Val Xaa Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu 1 5
10 15 Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Xaa Xaa Xaa
Xaa 20 25 30 Xaa <210> SEQ ID NO 3 <211> LENGTH: 447
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Encodes RHI-1
<400> SEQUENCE: 3 atgagattcc catctatctt cactgctgtt ttgttcgctg
cttcttctgc tttggctgct 60 cctgttaaca ctactactga agacgaaact
gctcaaatcc cagctgaagc ggttatcggt 120 tactctgact tggaaggtga
cttcgacgtt gctgttttgc ctttctctaa ctctactaat 180 aatggtttgt
tgttcatcaa cactactatc gcttctatcg ctgctaagga agagggtgtt 240
tctatggcta agagagaaga agctgaagct gaagctgaac caaagtttgt taaccaacac
300 ttgtgtggtt ctcacttggt tgaagctttg tacttggttt gtggtgaaag
aggtttcttc 360 tacactccaa aggctgctaa gggtatcgtt gaacaatgtt
gtacttctat ctgttctttg 420 taccaattgg aaaactactg taactaa 447
<210> SEQ ID NO 4 <211> LENGTH: 435 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Encodes RHI-2 <400> SEQUENCE:
4 atgagattcc catctatctt cactgctgtt ttgttcgctg cttcttctgc tttggctgct
60 cctgttaaca ctactactga agacgaaact gctcaaatcc cagctgaagc
ggttatcggt 120 tactctgact tggaaggtga cttcgacgtt gctgttttgc
ctttctctaa ctctactaat 180 aatggtttgt tgttcatcaa cactactatc
gcttctatcg ctgctaagga agagggtgtt 240 tctatggcta agagagacga
cggtgaccca agatttgtta accaacactt gtgtggttct 300 cacttggttg
aagctttgta cttggtttgt ggtgaaagag gtttcttcta cactccaaag 360
gacgaaagag gtatcgttga acaatgttgt acttctatct gttctttgta ccaattggaa
420 aactactgta actaa 435 <210> SEQ ID NO 5 <211>
LENGTH: 447 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
Encodes RHI-3 <400> SEQUENCE: 5 atgagattcc catctatctt
cactgctgtt ttgttcgctg cttcttctgc tttggctgct 60 cctgttaaca
ctactactga agacgaaact gctcaaatcc cagctgaagc ggttatcggt 120
tactctgact tggaaggtga cttcgacgtt gctgttttgc ctttctctaa ctctactaat
180 aatggtttgt tgttcatcaa cactactatc gcttctatcg ctgctaagga
agagggtgtt 240 tctatggcta agagagaaga agctgaagct gaagctgaac
caaagtttgt taaccaacac 300 ttgtgtggtt ctcacttggt tgaagctttg
tacttggttt gtggtgaaag aggtttcttc 360 tacactccaa aggacgaaag
aggtatcgtt gaacaatgtt gtacttctat ctgttctttg 420 taccaattgg
aaaactactg taactaa 447 <210> SEQ ID NO 6 <211> LENGTH:
447 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Encodes RAT-1
<400> SEQUENCE: 6 atgagattcc catctatctt cactgctgtt ttgttcgctg
cttcttctgc tttggctgct 60 cctgttaaca ctactactga agacgaaact
gctcaaatcc cagctgaagc ggttatcggt 120 tactctgact tggaaggtga
cttcgacgtt gctgttttgc ctttctctaa ctctactaat 180 aatggtttgt
tgttcatcaa cactactatc gcttctatcg ctgctaagga agagggtgtt 240
tctatggcta agagagaaga agctgaagct gaagctgaac caaagtttgt taagcaacac
300 ttgtgtggtc ctcacttggt tgaagctttg tacttggttt gtggtgaaag
aggtttcttc 360 tacactccaa aggctgctaa gggtatcgtt gaccaatgtt
gtacttctat ctgttctttg 420 taccaattgg aaaactactg taactaa 447
<210> SEQ ID NO 7 <211> LENGTH: 435 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Encodes RHI-4 <400> SEQUENCE:
7 atgagattcc catctatctt cactgctgtt ttgttcgctg cttcttctgc tttggctgct
60 cctgttaaca ctactactga agacgaaact gctcaaatcc cagctgaagc
ggttatcggt 120 tactctgact tggaaggtga cttcgacgtt gctgttttgc
ctttctctaa ctctactaat 180 aatggtttgt tgttcatcaa cactactatc
gcttctatcg ctgctaagga agagggtgtt 240 tctatggcta agagagacga
cggtgaccca agatttgtta accaacactt gtgtggttct 300 cacttggttg
aagctttgta cttggtttgt ggtgaaagag gtttcttcta cactccaaag 360
gctgctaagg gtatcgttga acaatgttgt acttctatct gttctttgta ccaattggaa
420 aactactgta actaa 435 <210> SEQ ID NO 8 <211>
LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
pro-leader peptide <400> SEQUENCE: 8 Ala Pro Val Asn Thr Thr
Thr Glu Asp Glu Thr Ala Gln Ile Pro Ala 1 5 10 15 Glu Ala Val Ile
Gly Tyr Ser Asp Leu Glu Gly Asp Phe Asp Val Ala 20 25 30 Val Leu
Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe Ile Asn 35 40 45
Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Met Ala
50 55 60 Lys Arg 65 <210> SEQ ID NO 9 <211> LENGTH: 10
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: leader peptide
<400> SEQUENCE: 9 Glu Glu Ala Glu Ala Glu Ala Glu Pro Lys 1 5
10 <210> SEQ ID NO 10 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: leader peptide <400> SEQUENCE:
10 Asp Asp Gly Asp Pro Arg 1 5 <210> SEQ ID NO 11 <211>
LENGTH: 53 <212> TYPE: PRT <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION: B-C-A
peptides <400> SEQUENCE: 11 Phe Val Asn Gln His Leu Cys Gly
Ser His Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg
Gly Phe Phe Tyr Thr Pro Lys Ala Ala Lys 20 25 30 Gly Ile Val Glu
Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 35 40 45 Glu Asn
Tyr Cys Asn 50 <210> SEQ ID NO 12 <211> LENGTH: 53
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: B-C-A peptides
<400> SEQUENCE: 12 Phe Val Asn Gln His Leu Cys Gly Ser His
Leu Val Glu Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe
Phe Tyr Thr Pro Lys Asp Glu Arg 20 25 30 Gly Ile Val Glu Gln Cys
Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 35 40 45 Glu Asn Tyr Cys
Asn 50 <210> SEQ ID NO 13 <211> LENGTH: 29 <212>
TYPE: PRT <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: B peptide <400>
SEQUENCE: 13 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu
Ala Leu Tyr 1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr
Pro Lys 20 25 <210> SEQ ID NO 14 <211> LENGTH: 35
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: B peptide
<400> SEQUENCE: 14 Asp Gly Gly Asp Pro Arg Phe Val Asn Gln
His Leu Cys Gly Ser His 1 5 10 15 Leu Val Glu Ala Leu Tyr Leu Val
Cys Gly Glu Arg Gly Phe Phe Tyr 20 25 30 Thr Pro Lys 35 <210>
SEQ ID NO 15 <211> LENGTH: 29 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: B peptide <400> SEQUENCE: 15
Phe Val Lys Gln His Leu Cys Gly Pro His Leu Val Glu Ala Leu Tyr 1 5
10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys 20 25
<210> SEQ ID NO 16 <211> LENGTH: 3 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: C peptide <400> SEQUENCE: 16
Ala Ala Lys 1 <210> SEQ ID NO 17 <211> LENGTH: 3
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: C peptide
<400> SEQUENCE: 17 Asp Glu Arg 1 <210> SEQ ID NO 18
<211> LENGTH: 21 <212> TYPE: PRT <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: A peptide <400> SEQUENCE: 18 Gly Ile Val Glu Gln
Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr
Cys Asn 20 <210> SEQ ID NO 19 <211> LENGTH: 21
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: A peptide
<400> SEQUENCE: 19 Gly Ile Val Asp Gln Cys Cys Thr Ser Ile
Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn 20
<210> SEQ ID NO 20 <211> LENGTH: 6 <212> TYPE:
PRT <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<221> NAME/KEY: VARIANT <222> LOCATION: 1 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 2 <223> OTHER INFORMATION: Xaa= Asp/Glu
<221> NAME/KEY: VARIANT <222> LOCATION: 3 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 4 <223> OTHER INFORMATION: Xaa= Asp/Glu
<400> SEQUENCE: 20 Xaa Xaa Xaa Xaa Pro Arg 1 5 <210>
SEQ ID NO 21 <211> LENGTH: 5 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<221> NAME/KEY: VARIANT <222> LOCATION: 1 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 2 <223> OTHER INFORMATION: Xaa= Asp/Glu
<221> NAME/KEY: VARIANT <222> LOCATION: 4 <223>
OTHER INFORMATION: Xaa= Asp/Glu <221> NAME/KEY: VARIANT
<222> LOCATION: 5 <223> OTHER INFORMATION: Xaa= any
codable amino acid or Gly or Pro <400> SEQUENCE: 21 Xaa Xaa
Gly Xaa Xaa 1 5 <210> SEQ ID NO 22 <211> LENGTH: 6
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: N-terminal
protecting peptide <400> SEQUENCE: 22 Asp Asp Gly Asp Pro Arg
1 5 <210> SEQ ID NO 23 <211> LENGTH: 6 <212>
TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 23 Glu Glu Gly Glu Pro Arg 1 5 <210>
SEQ ID NO 24 <211> LENGTH: 6 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 24 Asp Asp Gly Asp Gly Arg 1 5 <210>
SEQ ID NO 25 <211> LENGTH: 6 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 25 Glu Glu Gly Glu Gly Arg 1 5 <210>
SEQ ID NO 26 <211> LENGTH: 3 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: N-terminal protecting peptide
<400> SEQUENCE: 26 Asp Glu Arg 1 <210> SEQ ID NO 27
<211> LENGTH: 21 <212> TYPE: PRT <213> ORGANISM:
HOMO SAPIENS <400> SEQUENCE: 27 Gly Ile Val Glu Gln Cys Cys
Thr Ser Ile Cys Ser Leu Tyr Gln Leu 1 5 10 15 Glu Asn Tyr Cys Asn
20 <210> SEQ ID NO 28 <211> LENGTH: 30 <212>
TYPE: PRT <213> ORGANISM: HOMO SAPIENS <400> SEQUENCE:
28 Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr
1 5 10 15 Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr
20 25 30 <210> SEQ ID NO 29 <211> LENGTH: 35
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: C-peptide
<400> SEQUENCE: 29 Arg Arg Glu Ala Glu Asp Leu Gln Val Gly
Gln Val Glu Leu Gly Gly 1 5 10 15 Gly Pro Gly Ala Gly Ser Leu Gln
Pro Leu Ala Leu Glu Gly Ser Leu 20 25 30 Gln Lys Arg 35 <210>
SEQ ID NO 30 <211> LENGTH: 10 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: C-peptide <400> SEQUENCE: 30
Glu Glu Ala Glu Ala Glu Ala Glu Pro Lys 1 5 10 <210> SEQ ID
NO 31 <211> LENGTH: 4 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: C-peptide <400> SEQUENCE: 31 Thr Ala Ala
Lys 1
* * * * *