U.S. patent application number 13/683504 was filed with the patent office on 2013-05-16 for small molecule printing.
This patent application is currently assigned to President and Fellows of Harvard College. The applicant listed for this patent is President and Fellows of Harvard College. Invention is credited to Kristopher M. Depew, Paul Hergenrother, Angela N. Koehler, Gavin MacBeath, Stuart L. Schreiber.
Application Number | 20130123134 13/683504 |
Document ID | / |
Family ID | 29423026 |
Filed Date | 2013-05-16 |
United States Patent
Application |
20130123134 |
Kind Code |
A1 |
Schreiber; Stuart L. ; et
al. |
May 16, 2013 |
SMALL MOLECULE PRINTING
Abstract
The present invention provides compositions and methods to
facilitate the identification of compounds that are capable of
interacting with a biological macromolecule of interest. In one
aspect, a composition is provided that comprises an array of one or
more types of chemical compounds attached to a solid support,
wherein the density of the array of compounds is at least 1000
spots per cm.sup.2. These compounds are typically attached to the
solid support through a covalent interaction. In another aspect,
the present invention provides methods for utilizing these arrays
to identify small molecule partners for biological macromolecules
of interest.
Inventors: |
Schreiber; Stuart L.;
(Boston, MA) ; MacBeath; Gavin; (Arlington,
MA) ; Koehler; Angela N.; (Cambridge, MA) ;
Hergenrother; Paul; (Champaign, IL) ; Depew;
Kristopher M.; (Acton, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
President and Fellows of Harvard College; |
Cambridge |
MA |
US |
|
|
Assignee: |
President and Fellows of Harvard
College
Cambridge
MA
|
Family ID: |
29423026 |
Appl. No.: |
13/683504 |
Filed: |
November 21, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10998867 |
Nov 29, 2004 |
|
|
|
13683504 |
|
|
|
|
09567910 |
May 10, 2000 |
6824987 |
|
|
10998867 |
|
|
|
|
60133595 |
May 11, 1999 |
|
|
|
Current U.S.
Class: |
506/9 ; 506/15;
506/32 |
Current CPC
Class: |
B01J 2219/00605
20130101; C07B 2200/11 20130101; B01J 2219/0061 20130101; C40B
60/14 20130101; C40B 50/14 20130101; G01N 31/00 20130101; B01J
19/0046 20130101; B01J 2219/00459 20130101; B01J 2219/005 20130101;
B01J 2219/00387 20130101; B01J 2219/00612 20130101; C40B 30/04
20130101; Y10S 436/809 20130101; C40B 40/04 20130101; B01J
2219/00637 20130101; B01J 2219/00533 20130101; C07C 311/49
20130101; B01J 2219/00454 20130101; B01J 2219/0072 20130101; B01J
2219/00626 20130101; G01N 33/54353 20130101 |
Class at
Publication: |
506/9 ; 506/15;
506/32 |
International
Class: |
G01N 31/00 20060101
G01N031/00 |
Claims
1. An array comprising a plurality of more than one type of
chemical compound attached to a solid support through a linker of
the formula: ##STR00010## wherein the density of the array of
chemical compounds is at least 1000 spots per cm.sup.2.
2. An array comprising a plurality of more than one type of
chemical compound attached to a solid support, wherein the density
of the array of chemical compounds is at least 1000 spots per
cm.sup.2, and wherein the chemical compounds are attached to the
solid support as shown below: ##STR00011## wherein: X is O, S, or
NH of the attached chemical compound R; and n is 0, 1, 2, 3, 4, or
5.
3. The array of claim 1, wherein the array of chemical compounds is
an array of small molecules.
4. The array of claim 1, wherein the array of chemical compounds is
an array of non-oligomeric chemical compounds.
5. The array of claim 1, wherein the molecular weight of the
chemical compounds is less than 1500 g/mol.
6. The array of claim 1, wherein the density of the array of the
chemical compounds is at least 5000 spots per cm.sup.2.
7. The array of claim 1, wherein the solid support comprises a
substantially flat surface.
8. The array of claim 1, wherein the solid support is glass.
9. The array of claim 1, wherein the solid support is derivatized
glass.
10. The array of claim 1, wherein the solid support is silylated
glass.
11. The array of claim 1 wherein the solid support is
.gamma.-aminopropylsilylated glass.
12. The array of claim 1, wherein the solid support is a
polymer.
13. The array of claim 1, wherein the solid support is metal.
14. The array of claim 1, wherein the solid support is a
metal-coated surface.
15. The array of claim 1, wherein the attachment of the chemical
compound to the solid support is characterized in that the
attachment is robust enough so that the chemical compounds are (1)
not inadvertently cleaved during subsequent manipulation steps and
(2) inert so that the functionalities employed do not interfere
with subsequent manipulation steps.
16. The array of claim 1, wherein each of the chemical compounds
becomes attached to the solid support through a reaction with an
isothiocyanate moiety.
17. A solid support comprising a solid support derivatized with
isothiocyanate moieties.
18. The solid support of claim 17 comprising the structure:
##STR00012## wherein n is 0, 1, 2, 3, 4, or 5.
19. A method for forming the array of claim 1, the method
comprising: providing a solid support, wherein the solid support is
derivatized with isothiocyanate moieties capable of interacting
with more than one type of chemical compound to form a covalent
linkage; providing one or more solutions of the more than one type
of chemical compound to be attached to the solid support; and
delivering the one or more solutions of the more than one type of
chemical compound to the solid support, wherein each of the
chemical compound is attached to the solid support through a
covalent linkage, and wherein the density of the array of chemical
compounds is at least 1000 spots per cm.sup.2.
20. A method of identifying small molecule partners for biological
macromolecules of interest, the method comprising: providing the
array of claim 1, wherein the array comprises a plurality of more
than one type of chemical compound, and wherein the density of the
array of chemical compounds is at least 1000 spots per cm.sup.2;
contacting the array with one or more types of biological
macromolecules of interest; and determining the binding of specific
chemical compound-biological macromolecule partners.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation of and claims
priority under 35 U.S.C. .sctn.120 to U.S. patent application, U.S.
Ser. No. 10/998,867, filed Nov. 29, 2004, which is a divisional of
and claims priority under 35 U.S.C. .sctn.120 to U.S. patent
application, U.S. Ser. No. 09/567,910, filed May 10, 2000, which
claims priority under 35 U.S.C. .sctn.119(e) to U.S. provisional
application, U.S. Ser. No. 60/133,595, filed May 11, 1999; each of
which is incorporated herein by reference.
BACKGROUND OF INVENTION
[0002] The ability to identify small molecule ligands for any
protein of interest has far-reaching implications, both for the
elucidation of protein function and for the development of novel
pharmaceuticals. With the introduction of split-pool strategies for
synthesis (Furka et al., Int. J. Pept. Protein Res. 1991, 37, 487;
Lam et al., Nature 1991, 354, 82; each of which is incorporated
herein by reference) and the development of appropriate tagging
technologies (Nestler et al., J. Org. Chem. 1994, 59, 4723;
incorporated herein by reference), chemists are now able to prepare
large collections of natural product-like compounds immobilized on
polymeric synthesis beads (Tan et al., J. Am. Chem. Soc. 1998, 120,
8565; incorporated herein by reference). These libraries provide a
rich source of molecules for the discovery of new protein
ligands.
[0003] With such libraries in hand, the availability of efficient
methods for screening these compounds becomes imperative. One
method that has been used extensively is the on-bead binding assay
(Lam et al., Chem. Rev. 1997, 97, 411; incorporated herein by
reference). An appropriately tagged protein of interest is mixed
with the library and beads displayed cognate ligands are
subsequently identified by a chromagenic or florescence-linked
assay (Kapoor et al., J. Am. Chem. Soc. 1998, 120, 23; Morken et
al., J. Am. Chem. Soc. 1998, 120, 30; St. Hilare et al., J. Am.
Chem. Soc. 1998, 120, 13312; incorporated herein by reference).
Despite the proven utility of this approach, it is limited by the
small number of proteins that can be screened efficiently. In
principle, the beads can be stripped of one protein and reprobed
with another; however, this serial process is slow and limited to
only a few iterations. In order to identify a specific small
molecule ligand for every protein in a cell, tissue or organism,
high-throughput assays that enable each compound to be screened
against many different proteins in a parallel fashion are required.
Although Brown et al. (U.S. Pat. No. 5,807,522; incorporated herein
by reference) have developed an apparatus and a method for forming
high density arrays of biological macromolecules for large scale
hybridization assays in numerous genetic applications, including
genetic and physical mapping of genomes, monitoring of gene
expression, DNA sequencing, genetic diagnosis, genotyping of
organisms, and distribution of DNA reagents to researchers, the
development of a high density array of natural product-like
compounds for high-throughput screening has not been achieved.
[0004] Clearly, it would be desirable to develop methods for
generating high density arrays that would enable the screening of
compounds present in increasingly complex natural product-like
combinatorial libraries in a high-throughput fashion to identify
small molecule partners for biological macromolecules of
interest.
SUMMARY OF THE INVENTION
[0005] The present invention provides compositions and methods to
facilitate the high-throughput screening of compounds for the
identification of desirable properties or interactions. In a
preferred embodiment, the present invention provides compositions
and methods to facilitate the identification of compounds that are
capable of interacting with a biological macromolecule of interest.
In one aspect, a composition is provided that comprises an array of
more than one type of chemical compounds attached to a solid
support, wherein the density of the array of compounds comprises at
least 1000 spots per cm.sup.2, more preferably at least 5000 spots
per cm.sup.2, and most preferably at least 10,000 spots per
cm.sup.2. In another aspect, a composition is provided that
comprises a plurality of one or more types of non-oligomeric
chemical compounds attached to a glass or polymer support, wherein
the density of the array of compounds comprises at least 1000 spots
per cm.sup.2. In a particularly preferred embodiment, the chemical
compounds are non-peptidic and non-oligomeric. In particularly
preferred embodiments, these compounds are attached to the solid
support through a covalent interaction. In another particularly
preferred embodiment, small molecules are attached to the solid
support through a covalent interaction. In a particularly preferred
embodiment, the compounds are attached to the solid support using a
Michael addition reaction. In another preferred embodiment, the
compounds are attached to the solid support using a silylation
reaction. In general, these inventive arrays are generated by: (1)
providing a solid support, wherein said solid support is
functionalized with a selected chemical moiety capable of
interacting with a desired chemical compound to form an attachment;
(2) providing one or more solutions of one or more types of
compounds to be attached to the solid support; and (3) delivering
said one or more types of compounds to the solid support, whereby
an array of compounds is generated and the array comprises a
density of at least 1000 spots per cm.sup.2 (FIG. 1). In other
embodiments, the array comprises a density of at least 5000 spots
per cm.sup.2, and more preferably at least 10,000 spots per
cm.sup.2.
[0006] In another aspect, the present invention provides methods
for utilizing these arrays to identify small molecule partners for
biological macromolecules (e.g., proteins, peptides,
polynucleotides) of interest comprising: (1) providing an array of
one or more types of compounds (e.g., more preferably, small
molecules), wherein the array has a density comprising at least
1000 spots per cm.sup.2; (2) contacting the array with one or more
types of biological macromolecules of interest; and (3) determining
the interaction of specific small molecule-biological macromolecule
partners (FIG. 1). In particularly preferred embodiments, the
biological macromolecules of interest comprise a collection of one
or more recombinant proteins. In another preferred embodiment, the
biological macromolecules of interest comprise a collection of
macromolecules from a cell lysate. In another preferred embodiment,
the biological macromolecules of interest comprise a
polynucleotide.
DEFINITIONS
[0007] Unless indicated otherwise, the terms defined below have the
following meanings:
[0008] "Antiligand": As used herein, the term "antiligand" refers
to the opposite member of a ligand/anti-ligand binding pair. The
anti-ligand may be, for example, a protein or other macromolecule
receptor in an effector/receptor binding pair.
[0009] "Compound": The term "compound" or "chemical compound" as
used herein can include organometallic compounds, organic
compounds, metals, transitional metal complexes, and small
molecules. In certain preferred embodiments, polynucleotides are
excluded from the definition of compounds. In other preferred
embodiments, polynucleotides and peptides are excluded from the
definition of compounds. In a particularly preferred embodiment,
the term compounds refers to small molecules (e.g., preferably,
non-peptidic and non-oligomeric) and excludes peptides,
polynucleotides, transition metal complexes, metals, and
organometallic compounds.
[0010] "Ligand": As used herein, the term "ligand" refers to one
member of a ligand/anti-ligand binding pair, and is referred to
herein also as "small molecule". The ligand or small molecule may
be, for example, an effector molecule in an effector/receptor
binding pair.
[0011] "Michael Addition": The term "Michael addition" refers to
the reaction in which compounds containing electron-rich groups
(e.g., groups containing sulfur, nitrogen, oxygen, or a carbanion)
add, in the presence of base, to olefins of the from C.dbd.C--Z
(including quinones), where Z is an electron-withdrawing group,
such as aldehydes, ketones, esters, amides, nitriles, NO.sub.2,
SOR, SO.sub.2R, etc.
[0012] "Microarray": As used herein, the term "microarray" is a
regular array of regions, preferably spots of small molecule
compounds, having a density of discrete regions of at least about
1000/cm.sup.2.
[0013] "Natural Product-Like Compound": As used herein, the term
"natural product-like compound" refers to compounds that are
similar to complex natural products which nature has selected
through evolution. Typically, these compounds contain one or more
stereocenters, a high density and diversity of functionality, and a
diverse selection of atoms within one structure. In this context,
diversity of functionality can be defined as varying the topology,
charge, size, hydrophilicity, hydrophobicity, and reactivity to
name a few, of the functional groups present in the compounds. The
term, "high density of functionality", as used herein, can
preferably be used to define any molecule that contains preferably
three or more latent or active diversifiable functional moieties.
These structural characteristics may additionally render the
inventive compounds functionally reminiscent of complex natural
products, in that they may interact specifically with a particular
biological receptor, and thus may also be functionally natural
product-like.
[0014] "Peptide": According to the present invention, a "peptide"
comprises a string of at least three amino acids linked together by
peptide bonds. Peptide may refer to an individual peptide or a
collection of peptides. Inventive peptides preferably contain only
natural amino acids, although non-natural amino acids (i.e.,
compounds that do not occur in nature but that can be incorporated
into a polypeptide chain; see, for example,
http://www.cco.caltech.edu/.about.dadgrp/Unnatstruct.gif, which
displays structures of non-natural amino acids that have been
successfully incorporated into functional ion channels) and/or
amino acid analogs as are known in the art may alternatively be
employed. Also, one or more of the amino acids in an inventive
peptide may be modified, for example, by the addition of a chemical
entity such as a carbohydrate group, a phosphate group, a farnesyl
group, an isofarnesyl group, a fatty acid group, a linker for
conjugation, functionalization, or other modification, etc.
[0015] "Polynucleotide" or "oligonucleotide": Polynucleotide or
oligonucleotide refers to a polymer of nucleotides. The polymer may
include natural nucleosides (i.e., adenosine, thymidine, guanosine,
cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine,
and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine,
2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine,
5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine,
2-aminoadenosine, C5-bromouridine, C5-fluorouridine,
C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine,
C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine,
7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine,
O(6)-methylguanine, and 2-thiocytidine), chemically modified bases,
biologically modified bases (e.g., methylated bases), intercalated
bases, modified sugars (e.g., 2'-fluororibose, ribose,
2'-deoxyribose, arabinose, and hexose), or modified phosphate
groups (e.g., phosphorothioates and 5'-N-phosphoramidite
linkages).
[0016] "Small Molecule": As used herein, the term "small molecule"
refers to a non-peptidic, non-oligomeric organic compound either
synthesized in the laboratory or found in nature. Small molecules,
as used herein, can refer to compounds that are "natural
product-like", however, the term "small molecule" is not limited to
"natural product-like" compounds. Rather, a small molecule is
typically characterized in that it contains several carbon-carbon
bonds, and has a molecular weight of less than 1500, although this
characterization is not intended to be limiting for the purposes of
the present invention. Examples of "small molecules" that occur in
nature include, but are not limited to, taxol, dynemicin, and
rapamycin. Examples of "small molecules" that are synthesized in
the laboratory include, but are not limited to, compounds described
in Tan et al., ("Stereoselective Synthesis of over Two Million
Compounds Having Structural Features Both Reminiscent of Natural
Products and Compatible with Miniaturized Cell-Based Assays" J. Am.
Chem. Soc. 1998, 120, 8565) and pending application Ser. No.
08/951,930 "Synthesis of Combinatorial Libraries of Compounds
Reminiscent of Natural Products", the entire contents of which are
incorporated herein by reference. In certain other preferred
embodiments, natural-product-like small molecules are utilized.
DESCRIPTION OF THE DRAWING
[0017] FIG. 1 depicts one preferred embodiment of the complete
process of small printing and assaying for chemical compounds with
desired properties. The process begins with the combinatorial
library. The library is transferred to stock plates which are used
to print the compounds onto glass slides. The slide is then used to
assay for chemical compounds with the desired property.
[0018] FIG. 2 depicts the preparation of maleimide-derivatized
glass slides.
[0019] FIG. 3 shows the attachment of phenolic hydroxyl groups
using a Mitsunobu activation of the glass surface.
[0020] FIG. 4 shows the attachment of compounds having a secondary
alcohol to a silicon tetrachloride-activated glass surface.
[0021] FIG. 5 shows other attachment chemistries which may be used
in small molecule printing.
[0022] FIG. 6 depicts test compounds used to demonstrate the
concept of small molecule printing.
[0023] FIG. 7 depicts small molecules printed on
maleimide-derivatized glass slides and detected with
fluorophore-conjugated proteins. Compounds were printed according
to the pattern illustrated in panel (D). Yellow circles indicate
thiol-derivatized small molecule. (A) indicates a slide detected
with Cy5-streptavidin. (B) indicates a slide detected with DI-22
followed by Cy5-goat-anti-mouse antibody. (C) indicates a slide
detected with RGS (His).sub.6-FKBP12 followed by mouse-anti-RGS
(His).sub.6 antibody followed by Cy5-goat-anti-mouse antibody.
[0024] FIG. 8 depicts small molecules printed on a
maleimide-derivatized glass slide and detected with
FITC-streptavidin (blue), Cy3-DI-22 (green), and Cy5-FKBP12 (red).
The full slide contains 10,800 distinct spots and was prepared
using only one bead for each of the three small molecules printed
(1a, 2a, and 3a as shown in FIG. 6).
[0025] FIG. 9 shows the activation of glass slides for the covalent
attachment of alcohols.
[0026] FIG. 10 shows a) alcohols attached to 500-560 .mu.m
polystyrene resin through a silyl-containing linker; b-e) a nine
spot microarray printed according to the pattern in 6f and
visualized in the following channels: b) Cy5 (false-colored red),
c) Cy3 (false-colored green), d) FITC (false-colored purple), e)
Cy5, Cy3, and FITC. Average distance between spots=400 .mu.m;
average spot diameter=300 .mu.m.
[0027] FIG. 11 shows a microarray of primary, secondary, phenolic,
and methyl ester derivatives of an FKBP ligand. Slides were probed
with Cy5-labeled FKBP (false-colored red).
[0028] FIG. 12 shows a) the general structure of a small-molecule
library, 78 members of which were placed in the wells of a 96-well
plate; b) the structure of two additional `tagged` library members;
c) alcohol microarray onto which 78 members of the small molecule
library and two tagged members were printed. Protein binding
detected with Cy5-FKBP (false-colored red) and FITC-streptavidin
(false-colored green).
[0029] FIG. 13 shows the master template used to fabricate custom
slide-sized reaction vessels that enable the uniform application of
.about.1.4 mL solution to one face of a 2.5 cm.times.7.5 cm
slide.
[0030] FIG. 14 shows the method of making the slide-sized reaction
vessels.
[0031] FIG. 15 shows the application of reagent to one surface of a
slide.
[0032] FIG. 16 shows the microarraying robot used to create the
small molecule arrays.
[0033] FIG. 17 shows the print head of the robot.
[0034] FIG. 18 shows the array pin of the robot.
DESCRIPTION OF CERTAIN PREFERRED EMBODIMENTS
[0035] As discussed above, the recent advances in the generation of
complex chemical libraries of natural product-like compounds having
as many as, or more than, one million members, has led to the
subsequent need to facilitate the efficient screening of these
compounds for biological activity. Towards this end, the present
invention provides methods and compositions to enable the
high-throughput screening of very large numbers of chemical
compounds to identify those with desirable properties of interest.
In preferred embodiments, methods and compositions are provided to
enable the high-throughput screen of very large numbers of chemical
compounds to identify those compounds capable of interacting with
biological macromolecules.
[0036] In one aspect, the present invention provides compositions
comprising arrays of chemical compounds, attached to a solid
support having a density of at least 1000 spots per cm.sup.2, and
methods for generating these arrays. In particularly preferred
embodiments, the present invention provides arrays of small
molecules, more preferably natural product-like compounds, that are
generated from split-and-pool synthesis techniques, parallel
synthesis techniques, and traditional one-at-a time synthesis
techniques. Additionally, existing collections of compounds may
also be utilized in the present invention, to provide high density
arrays that can be screened for desirable characteristics. In
another aspect, the present invention provides methods for the
identification of ligand (small molecule)-antiligand (biological
macromolecule) binding pairs using the chemical compound arrays. It
is particularly preferred that the antiligands comprise recombinant
protein, and it is more particularly preferred that a library of
recombinant proteins is utilized in the detection method. In
another preferred embodiment, the antiligands comprise
macromolecules from cell lysates.
Small Molecule Printing
[0037] As discussed above, in one aspect, the present invention
provides methods, referred to herein as "small molecule printing",
for the generation of high density arrays and the resulting
compositions. According to the method of the present invention, a
collection of chemical compounds, or one type of compound, can be
"printed" onto a support to generate extremely high density arrays.
In general, this method comprises (1) providing a solid support,
wherein the solid support is functionalized with a selected
chemical moiety capable of interacting with a desired chemical
compound to form an attachment; (2) providing one or more solutions
of the same or different chemical compounds to be attached to the
solid support; and (3) delivering the one or more solutions of the
same or different chemical compounds to the solid support, whereby
an array of compounds is generated and the array has a density of
at least 1000 spots per cm.sup.2.
[0038] As one of ordinary skill in the art will realize, although
any desired chemical compound capable of forming an attachment with
the solid support may be utilized, it is particularly preferred
that natural product-like compounds, preferably small molecules,
generated from split-and-pool library or parallel syntheses are
utilized. Examples of libraries of natural product-like compounds
that can be utilized in the present invention include, but are not
limited to shikimic acid-based libraries, as described in Tan et
al. ("Stereoselective Synthesis of over Two Million Compounds
Having Structural Features Both Reminiscent of Natural Products and
Compatible with Miniaturized Cell-Based Assays", J. Am. Chem. Soc.,
1998, 120, 8565) and incorporated herein by reference. As will be
appreciated by one of ordinary skill in the art, the use of
split-and-pool libraries enables the more efficient generation and
screening of compounds. However, small molecules synthesized by
parallel synthesis methods and by traditional methods
(one-at-a-time synthesis and modifications of these structures) can
also be utilized in the compositions and methods of the present
invention, as can naturally occurring compounds, or other
collections of compounds, preferably non-oligomeric compounds, that
are capable of attaching to a solid support without further
synthetic modification.
[0039] As will be realized by one of ordinary skill in the art, in
split-and-pool techniques (see, for example, Furka et al., Abstr.
14th Int. Congr. Biochem., Prague, Czechoslovakia, 1988, 5, 47;
Furka et al., Int. J. Pept. Protein Res. 1991, 37, 487; Sebestyen
et al., Bioorg. Med. Chem. Lett. 1993, 3, 413; each of which is
incorporated herein by reference), a mixture of related compounds
can be made in the same reaction vessel, thus substantially
reducing the number of containers required for the synthesis of
very large libraries, such as those containing as many as or more
than one million library members. As an example, a solid support
bound scaffold can be divided into n vessels, where n represents
the number of species of reagent A to be reacted with the support
bound scaffold. After reaction, the contents from n vessels are
combined and then split into m vessels, where m represents the
number of species of reagent B to be reacted with the support bound
scaffold. This procedure is repeated until the desired number of
reagents are reacted with the scaffold structures to yield a
desired library of compounds.
[0040] As mentioned above, the use of parallel synthesis methods
are also applicable. Parallel synthesis techniques traditionally
involve the separate assembly of products in their own reaction
vessels. For example, a microtiter plate containing n rows and m
columns of tiny wells which are capable of holding a small volume
of solvent in which the reaction can occur, can be utilized. Thus,
n variants of reactant type A can be reacted with m variants of
reactant type B to obtain a library of n.times.m compounds.
[0041] Subsequently, once the desired compounds have been provided
using an appropriate method, solutions of the desired compounds are
prepared. In a preferred embodiment, compounds are synthesized on a
solid support and the resulting synthesis beads are subsequently
distributed into polypropylene microtiter plates at a density of
one bead per well. In but one example, as discussed below in the
Examples, the attached compounds are then released from their beads
and dissolved in a small volume of suitable solvent. Due to the
minute quantities of compound present on each bead, extreme
miniaturization of the subsequent assay is required. Thus, in a
particularly preferred embodiment, a high-precision transcription
array robot (Schena et al., Science 1995, 270, 467; Shalon et al.,
Genome Research 1996, 6, 639; each of which is incorporated herein
by reference) can be used to pick up a small volume of dissolved
compound from each well and repetitively deliver approximately 1 mL
of solution to defined locations on a series of
chemically-derivatized glass microscope slides. These
chemically-derivatized glass microscope slides are preferably
prepared using custom slide-sized reaction vessels that enable the
uniform application of solution to one face of the slide as shown
and discussed in the Examples. This results in the formation of
microscopic spots of compounds on the slides and in preferred
embodiments these spots are 200-250 .mu.m in diameter. It will be
appreciated by one of ordinary skill in the art, however, that the
current invention is not limited to the delivery of 1 nL volumes of
solution and that alternative means of delivery can be used that
are capable of delivering picoliter or smaller volumes. Hence, in
addition to a high precision transcription array robot, other means
for delivering the compounds can be used, including, but not
limited to, ink jet printers, piezoelectric printers, and small
volume pipetting robots.
[0042] As discussed, each compound contains a common functional
group that mediates attachment to a support surface. It is
preferred that the attachment formed is robust and therefore the
formation of covalent attachments are particularly preferred. A
variety of chemical linkages can be employed to generate the high
density arrays of chemical compounds. In addition to the robustness
of the linkage, other considerations include the solid support to
be utilized and the specific class of compounds to be attached to
the support. Particularly preferred supports include, but are not
limited to glass slides, polymer supports or other solid-material
supports, and flexible membrane supports.
[0043] In but one example, and as discussed in Example 1, a Michael
addition (March, Advanced Organic Chemistry (4th ed.), New York:
John Wiley & Sons, 1992, 795-797; incorporated herein by
reference) can be employed to attach compounds to glass slides. In
one embodiment, as shown in FIG. 2, plain glass slides are
derivatized to give surfaces that are densely functionalized with
maleimide groups. Compounds containing thiol groups can then be
provided. These thiol-containing compounds readily attach to the
surface upon printing via the expected thioether linkage. As one of
ordinary skill in the art will realize, other nucleophilic S-, N-,
and O-containing compounds can be generated to facilitate
attachment of the chemical compound to the solid support via
Michael addition, as described above. Other electrophilic Michael
acceptors can also be utilized; however, maleimides and vinyl
sulfones are particularly preferred because the hydrophilicity of
these groups is believed to play a role in the observed lack of
nonspecific protein binding to the slide surface in aqueous
buffer.
[0044] In another example, and as discussed in Example 2, a
silylation reaction can be employed to attach compounds to a glass
slide. Plain glass slides are derivatized to yield surfaces that
are densely functionalized with silyl halides. Compounds containing
hydroxyl groups can then be provided and contacted with the
functionalized glass surface. The hydroxyl containing compounds
readily attach to the surface through the silicon-oxygen bond
formed by nucleophilic substitution on the silyl halide. In a
preferred embodiment, the silyl halide is silyl chloride, bromide,
or iodide. In other preferred embodiments, leaving groups on the
silicon such as mesylate and tosylate are used rather than halides.
Preferably, the hydroxyl groups of the compounds to be attached are
unhindered (e.g., primary alcohols).
[0045] In another preferred embodiment, compounds with phenolic
hydroxyl groups are attached to a glass surface using Mitsunobu
activation of the surface as shown in FIG. 3 (Derrick et al.,
Tetrahedron Lett. 1991, 32, 7159; incorporated herein by
reference). In yet another preferred embodiment, compounds with
secondary alcohols are attached a glass surface activated with
silicon tetrachloride (FIG. 4).
[0046] Other linkages (FIG. 5) that can be employed in the
preparation of the inventive arrays include, but are not limited to
disulfide bonds, amide bonds, ester bonds, ether bonds, hydrazone
linkages, carbon-carbon bonds, metal ion complexes, and noncovalent
linkages mediated by, for example, hydrophobic interactions or
hydrogen bonding. In certain preferred embodiments, coupling of
acids and amines, coupling of aldehydes and hydrazide, coupling of
trichlorocyanuric acid and amines, addition of amines to quinones,
attachment of thiols to mercury, addition of sulfhydryls, amines,
and hydroxyls to open bis-epoxides, photoreactions of azido
compounds to give insertions via a nitrene intermediate, or
coupling of diols to boronate is used in the preparation of the
inventive arrays. It will be appreciated by one of skill in this
art that the specific linkages to be utilized should be selected to
be (1) robust enough so that the small molecules are not
inadvertently cleaved during subsequent assaying steps, and (2)
inert so that the functionalities employed do not interfere with
the subsequent assaying steps.
Methods for Detecting Biological Activity
[0047] It will be appreciated by one of ordinary skill in the art
that the generation of arrays of compounds having extremely high
spatial densities facilitates the detection of binding and/or
activation events occurring between compounds in a specific
chemical library and biological macromolecules. Thus, the present
invention provides, in yet another aspect, a method for identifying
small molecule partners for biological macromolecules of interest.
The partners may be compounds that bind to particular
macromolecules of interest and are capable of activating or
inhibiting the biological macromolecules of interest. In general,
this method involves (1) providing an array of one or more types of
compounds, as described above, wherein the array of small molecules
has a density of at least 1000 spots per cm.sup.2; (2) contacting
the array with one or more types of biological macromolecules of
interest; and (3) determining the interaction of specific small
molecule-biological macromolecule partners.
[0048] It will also be appreciated that the arrays of the present
invention may be utilized in a variety of ways to enable detection
of interactions between small molecules and biological
macromolecules. In one particularly preferred embodiment, an array
of different types of chemical compounds attached to the surface is
utilized and is contacted by one or a few types of biological
macromolecules to determine which compounds are capable of
interacting with the specific biological macromolecule(s). As one
of ordinary skill in the art will realize, if more than one type of
compound is utilized, it is desirable to utilize a method for
encoding each of the specific compounds so that a compound having a
specific interaction can be identified. Specific encoding
techniques have been recently reviewed and these techniques, as
well as other equivalent or improved techniques, can be utilized in
the present invention (see, Czarnik, A. W. Current Opinion in
Chemical Biology 1997, 1, 60; incorporated herein by reference).
Alternatively the arrays of the present invention may comprise one
type of chemical compound and a library of biological
macromolecules may be contacted with this array to determine the
ability of this one type of chemical compound to interact with a
variety of biological macromolecules. As will be appreciated by one
of ordinary skill in the art, this embodiment requires the ability
to separate regions of the support, utilizing paraffin or other
suitable materials, so that the assays are localized.
[0049] As one of ordinary skill in the art will realize, the
biological macromolecule of interest may comprise any biomolecule.
In preferred embodiments, the biological macromolecule of interest
comprises a protein, and more preferably the array is contacted
with a library of recombinant proteins of interest. In yet another
preferred embodiment, the biological molecules of interest are
provided in the form of cell lysates such as those of
tumor-associated cells. As will be appreciated by one of ordinary
skill in the art, these proteins may comprise purified proteins,
pools of purified proteins, and complex mixtures such as cell
lysates, and fractions thereof, to name a few. Examples of
particularly preferred biological macromolecules to study include,
but are not limited to those involved in signal transduction,
dimerization, gene regulation, cell cycle and cell cycle
checkpoints, and DNA damage checkpoints. Furthermore, the ability
to construct libraries of expressed proteins from any organism or
tissue of interest will lead to large arrays of recombinant
proteins. The compounds of interest may be capable of either
inactivating or activating the function of the particular
biomolecule of interest.
[0050] Each of the biological macromolecules may be modified to
enable the facile detection of these macromolecules and the
immobilized compounds. This may be achieved by tagging the
macromolecules with epitopes that are subsequently recognized,
either directly or indirectly, by a different receptor (e.g., an
antibody) that has been labeled for subsequent detection (e.g.,
with radioactive atoms, fluorescent molecules, colored compounds,
or enzymes that enable color formation, or light production, to
name a few). Alternatively, the macromolecules themselves may be
labeled directly using any one or other of these methods or not
labeled at all if an appropriate detection method is used to detect
the bound protein (e.g., mass spectrometry, surface plasmon
resonance, and optical spectroscopy, to name a few).
[0051] In a particularly preferred embodiment, the inventive arrays
are utilized to identify compounds for chemical genetic research.
In classical genetics, either inactivating (e.g., deletion or
"knock-out") or activating (e.g., oncogenic) mutations in DNA
sequences are used to study the function of the proteins that are
encoded by these genes. Chemical genetics instead involves the use
of small molecules that alter the function of proteins to which
they bind, thus either inactivating or activating protein function.
This, of course, is the basis of action of most currently approved
small molecule drugs. The present invention involves the
development of "chip-like" technology to enable the rapid detection
of interactions between small molecules and specific proteins of
interest. The examples presented below demonstrate how the methods
and compositions of the present invention can be used to identify
new small molecule ligands for use in chemical genetic research.
One of ordinary skill in the art will realize that the inventive
compositions and methods can be utilized for other purposes that
require a high density chemical compound format.
[0052] As will also be appreciated by one of ordinary skill in the
art, arrays of chemical compounds may also be useful in detecting
interactions between the compounds and alternate classes of
molecules other than biological macromolecules. For example, the
arrays of the present invention may also be useful in the fields of
catalysis and materials research to name a few.
[0053] These and other aspects of the present invention will be
further appreciated upon consideration of the following Examples,
which are intended to illustrate certain particular embodiments of
the invention but are not intended to limit its scope, as defined
by the claims.
EXAMPLES
Example 1
Small Molecule Printing Using Michael Addition
[0054] In order to demonstrate the utility of small molecule
printing as a technique identifying small molecule-protein
interactions, three unrelated molecules were chosen for which
specific protein receptors are available. Compound 1 (FIG. 6,
R.dbd.OH) is the vitamin biotin, which is recognized by the
bacterial protein streptavidin (Chaiet et al., Arch. Biochem.
Biophys. 1964, 106, 1; incorporated herein by reference). Compound
2 (R.dbd.OH) is a derivative of the steroid digoxigenin and is
recognized by the mouse monoclonal antibody DI-22 (Sigma). Finally,
compound 3 (R.dbd.OH) is a synthetic pipecolyl .alpha.-ketoamide,
which was designed to be recognized by the human immunophilin
FKBP12 (Holt et al., J. Am. Chem. Soc. 1993, 115, 9925;
incorporated herein by reference). Each of these compounds was
attached to 400-450 .mu.m diameter polystyrene beads (estimated
capacity of 20 nmol per bead) via a 6-aminocaproic acid linker and
either 4-methoxytrityl-protected cysteine (FIG. 6, X.dbd.S(Mmt)) or
alanine (FIG. 6, X.dbd.H; negative control). To create reference
points on the slides, beads were also prepared with a thiol-labeled
derivative of the fluorescent dye tetramethylrhodamine (4a).
Individual beads were placed in 28 separate wells of a 96-well
plate and the compounds were deprotected, cleaved, and subsequently
dissolved in 5 .mu.L of DMF. The released compounds were then
arrayed robotically onto a series of maleimide-derivatized glass
slides with a distance of 300 .mu.m between the centers of adjacent
spots. Each slide was printed according to the pattern illustrated
in FIG. 7D. Following a 12 hour room temperature incubation, the
slides were washed extensively and probed with different
proteins.
[0055] The slide in FIG. 7A was probed with Cy5-conjugated
streptavidin, washed, and subsequently scanned using an ArrayWoRx
fluorescence slide scanner. The slide was scanned for both
tetramethylrhodamine fluorescence (false-colored green) and Cy5
fluorescence (false-colored red). As anticipated, only the spots
containing 1a were visible when scanned for Cy5 fluorescence,
indicating that localization of streptavidin on these spots was
both specific for biotin and dependent on the thiol functionality
(compound 1b, which lacks a thiol, does not attach to the slide).
Using a two-step detection method, the slide in FIG. 7B was probed
first with DI-22 and then with a Cy5-conjugated goat-anti-mouse
antibody (which recognizes DI-22). As anticipated, the Cy5
fluorescence localized to the 2a-containing spots. Finally, the
slide in FIG. 7C was probed using a three-step method:
(His).sub.6-FKBP12 followed by mouse-anti-RGS(His).sub.6 antibody
followed by Cy5-conjugated goat-anti-mouse antibody. As before, the
fluorescence localized to the appropriate spots.
[0056] These results clearly illustrate both the high selectivity
and remarkable sensitivity of this slide-based assay. To illustrate
the highly parallel nature of small molecule printing, compound 1a
was released from a single 400-450 .mu.m diameter polystyrene bead
and the released compound was dissolved in 10 .mu.L of DMF. We
repeated this procedure for compounds 2a and 3a. Using the
microarraying robot, these three compounds were repetitively
spotted in an alternating pattern on a single maleimide-derivatized
slide, using the same spatial density as in FIG. 7. Each compound
was spotted 3600 times, using less than half of the compound from
each bead (.about.1 nL per spot) and yielding 10,800 distinct
spots. The slide was then probed in a single step with a solution
containing FITC-conjugated streptavidin, Cy3-conjugated DI-22, and
Cy5-conjugated FKBP12. Following a brief washing step, the slide
was scanned for FITC fluorescence (false colored blue), Cy3
fluorescence (false-colored green), and Cy5 fluorescence
(false-colored red). As shown in FIG. 8, the three differently
labeled proteins localized to the spots containing their cognate
ligands.
[0057] Experimental details for the above described example can be
found in below. One of ordinary skill in the art will realize that
the inventive compositions and methods are not limited to the
examples described above; rather the present invention is intended
to include all equivalents thereof.
Example 2
Small Molecule Printing Using Silylation Reaction
[0058] Standard glass slides were activated for selective reaction
with alcohols (FIG. 9). Microscopic slides were first treated with
a H.sub.2SO.sub.4/H.sub.2O.sub.2 solution ("piranha") for 16 hours
at room temperature. After extensive washing with water, the slides
were treated with thionyl chloride and a catalytic amount of DMF in
THF for 4 hours at room temperature. Surface characterization by
x-ray photoelectron spectroscopy (XPS) confirmed the presence of
chlorine on the slide (Strother et al., J. Am. Chem. Soc., 2000,
122, 1205-1209; incorporated herein by reference). To test the
ability of these chlorinated slides to capture alcohols released
from synthesis beads, we initially used three alcohol-containing
small molecules and a bead linker reagent developed for chemical
genetic applications of diversity-oriented synthesis.
[0059] Primary alcohol derivatives of a synthetic .alpha.-ketoamide
(Holt et al., J. Am. Chem. Soc. 1993, 115, 9925-9938; incorporated
herein by reference), digoxigenin, and biotin were attached to
silicon linker-modified beads (FIG. 10). These beads are high
capacity 500-560 polystyrene beads equipped with an all hydrocarbon
and silicon linker for the temporary attachment and eventual
fluoride-mediated release of synthetic, alcohol-containing
compounds. The three primary alcohol derivatives have known protein
partners, namely FKBP12 (Harding et al., Nature, 1989, 341,
758-760; Siekierkea et al., Nature, 1989, 341, 755-757; each of
which is incorporated herein by reference), the DI-22 antibody
(Sigma), and streptavidin (Chaiet et al., Arch. Biochem. Biophys.,
1964, 106, 1-5; incorporated herein by reference), respectively.
After HF-pyridine-mediated release from the beads and subsequent
solvent removal, the compounds were dissolved in 5 .mu.L of DMF in
individual wells of 96-well plates to give .about.5 mM solutions. A
microarrayer was used to spot the compounds (in triplicate) 400
.mu.m apart (average spot diameter of 300 .mu.m) onto the thionyl
chloride-activated slides (FIG. 10b-e) and the slides were then
washed extensively with DMF, THF, isopropanol, and an aqueous
buffer. As shown, when binding was detected separately (FIG. 10b-d)
or simultaneously (FIG. 10e), the recognition of the protein for
its ligand was efficient and selective. When the same compounds
were printed onto control slides (i.e., not activated with thionyl
chloride) no protein-ligand interactions were detected.
[0060] Small molecules resulting from diversity-oriented syntheses
can contain a wide array of functional groups, including secondary
and phenolic hydroxyls. To test the ability of such functionalities
to react with the thionyl chloride activated slides, the synthetic
.alpha.-ketoamide derivatives shown in FIG. 11 were synthesized. An
array was then printed (in quadruplicate) containing the primary,
secondary, phenolic, and methyl ether derivatives at .about.5 mM,
and probed with Cy5-FKBP. As shown in FIG. 11, the reaction of the
primary alcohol is favored, and this bias holds even when the
secondary, phenolic, and methyl ether derivatives are arrayed at a
concentration ten times greater than the primary.
[0061] As a demonstration of the compatibility of this alcohol
arraying technique with split-pool synthesis, a collection of 78
small molecules derived from such synthesis having the general
structure, shown in FIG. 12a was printed onto glass slides (Tan et
al., J. Am. Chem. Soc. 1998, 120, 8565-8566; incorporated herein by
reference). To this collection were added two members that had been
acylated with the synthetic .alpha.-ketoamide derivative or biotin
(FIG. 12b). These `tagged` members were then released from their
beads, dissolved in 5 .mu.L of DMF, and placed in known wells of a
96-well plate. After placing the 80 compounds into discrete wells,
the entire plate was arrayed onto thionyl chloride/DMF activated
slides, which were then probed with fluorescently-labeled proteins,
Cy5-FKBP12 and FITC-streptavidin. The results (FIG. 12c) show that
two spots in the array fluoresce in the Cy5 channel (false-colored
red), and another fluoresces in the FITC channel (false-colored
green). The positional encoding confirms the result that the
compound acylated with the .alpha.-ketoamide was spotted in B8, and
the compound acylated with biotin was spotted in F2. The spot
visible in E3 is an apparent serendipitous and reproducible `hit`,
and awaits further analysis. Thus, this experiment demonstrates the
process of split-pool synthesis, release from the solid support,
arraying onto glass slides, and detection/visualization of
protein-small molecule binding events.
Example 3
Fabrication of Custom Slide Reaction Vessels
[0062] In an effort to minimize reagent volume during the chemical
treatment of glass microscope slides, we designed and fabricated
custom slide-sized reaction vessels that enable the uniform
application of .about.1.4 mL solution to one face of a 2.5
cm.times.7.5 cm slide. First, a master template mold was cut from a
block of Delhran plastic according to the blueprint shown in FIG.
13. The slide-sized reaction vessels were prepared by casting
degassed polydimethysiloxane (PDMS, Sylgard Kit 184, Dow coming,
Midland, Mich.) prepolymer around the master template in a
polystyrene OmniTray (Nalge Nunc International, Naperville, Ill.).
After curing for four hours at 65.degree. C., the polymer was
peeled away from the master to give the finished product (FIG.
14).
[0063] To use the vessels, slides were placed face-down as
illustrated below and reagent was injected under the slides with a
P1000 Pipetman (FIG. 15).
Example 4
Chemical Derivatization of Glass Microscope Slides
[0064] Plain glass slides (VWR Scientific Products, USA) were
cleaned in a "piranha" solution (70:30 v/v mixture of concentrated
H.sub.2SO.sub.4 and 30% H.sub.2O.sub.2) for 12 hours at room
temperature. (Caution: "piranha" solution reacts violently with
several organic materials and should be handled with extreme care
(Pintochovski et al., Electrochem. Soc. 1979, 126, 1428; Dobbs et
al., Chem. Eng. News 1990, 68(17), 2; Wnuk, Chem. Eng. News 1990,
68(26), 2; Erickson, Chem. Eng. News 1990, 68(33), 2; each of which
is incorporated herein by reference)). After thorough rinsing with
distilled water, the slides were treated with a 3% solution of
3-aminopropyltriethoxysilane (United Chemical Technologies,
Bristol, Pa.) in 95% ethanol for 1 hour. (Before treating the
slides, the 3% silane solution was stirred for at least 10 minutes
to allow for hydrolysis and silanol formation). The slides were
then briefly dipped in 100% ethanol and centrifuged to remove
excess silanol. The adsorbed silane layer was cured at 115.degree.
C. for one hour. After cooling to room temperature, the slides were
washed several times in 95% ethanol to remove uncoupled
reagent.
[0065] A simple, semi-quantitative method was used to verify the
presence of amino groups on the slide surface (Licitra et al.,
Proc. Natl. Acad. Sci. USA 1996, 93, 12817-12821; incorporated
herein by reference). One glass slide from each batch of
amino-functionalized slides was washed briefly with 5 mL of 50 mM
sodium bicarbonate, pH 8.5. The slide was then dipped in 5 mL of 50
mM sodium bicarbonate, pH 8.5 containing 0.1 mM
sulfo-succinimidyl-4-O-(4,4'-dimethoxytrityl)-butyrate (s-SDTB;
Pierce, Rockford, Ill.) and shaken vigorously for 30 minutes. (The
s-SDTB solution was prepared by dissolving 3.03 mg of s-SDTB in 1
mL of DMF and diluting to 50 mL with 50 mM sodium bicarbonate, pH
8.5). After a 30 minute incubation, the slide was washed three
times with 20 mL of distilled water and subsequently treated with 5
mL of 30% perchloric acid. The development of an orange-colored
solution indicated that the slide had been successfully derivatized
with amines; no color change was seen for untreated glass slides.
Quantitation of the 4,4'-dimethoxytrityl cation
.epsilon..sub.498nm=70,000 M.sup.-1cm.sup.-1) released by the acid
treatment indicated an approximate density of two amino groups per
nm.sup.2.
[0066] The resulting amino-functionalized slides were transferred
to custom slide-sized polydimethylsiloxane (PDMS) reaction vessels
(as described in Example 3). One face of each slide was treated
with 20 mM N-succinimidyl 3-maleimido propionate (Aldrich Chemical
Co., Milwaukee, Wis.) in 50 mM sodium bicarbonate buffer, pH 8.5,
for three hours. (This solution was prepared by dissolving the
N-succinimidyl 3-maleimido propionate in DMF and then diluting
10-fold with buffer). After incubation, the plates were washed
several times with distilled water, dried by centrifugation, and
stored at room temperature under vacuum until further use.
Example 5
Attachment of Small Molecules to Polystyrene Beads Materials
[0067] Fmoc-.epsilon.Ahx-OH and PyBOP.RTM. were from Novabiochem
(San Diego, Calif.).
[0068] Biotin and diisopropylethylamine (DIPEA) were from Aldrich
Chemical Co. (Milwaukee, Wis.). 3-Amino-3-deoxydigoxigenin
hemisuccinamide, succinimidyl ester and 5(6)-TAMRA, SE were from
Molecular Probes (Eugene, Oreg.). Wash solvents were obtained from
Mallinckrodt or E. Merck and used as received. Anhydrous
dimethylformamide (DMF) was obtained from Aldrich Chemical Co. in
SureSeal.TM. bottles.
[0069] The "FKBP Ligand" is shown below and was synthesized as
published (Keenan et al., Bioorg. Med. Chem. 1998, 6, 1309; Amara
et al., Proc. Natl. Acad. Sci. USA 1997, 94, 10618-10623; each of
which is incorporated herein by reference).
##STR00001##
[0070] Polystyrene synthesis beads were obtained by custom
synthesis from Rapp Polymere (Tubingen, Germany). They ranged from
400 .mu.m to 450 .mu.m in diameter, had an estimated capacity of
about 0.4 mmol/g (17 nmol/bead), and came functionalized as
indicated below.
##STR00002##
[0071] Solid Phase Reactions.
[0072] Solid phase reactions were performed in either 2 mL fritted
polypropylene Biospin.RTM. chromatography columns (Pharmacia
Biotech, Uppsala, Sweden) or 10 mL flitted polypropylene PD-10
columns (Pharmacia Biotech). Resin samples were washed on a
Val-Man.RTM. Laboratory Vacuum Manifold (Promega, Madison, Wis.)
using the following procedure: 3.times.DMF, 3.times.THF,
3.times.DMF, 3.times.THF, 3.times.DMF, 3.times.THF, 3.times.DMF,
6.times.CH.sub.2Cl.sub.2, 3.times.THF.
[0073] Polystyrene Beads with Attached Linker (5c, 5d).
##STR00003##
[0074] Either Polystyrene A Trt-Cyc(Mmt) Fmoc or Polystyrene A
Trt-Ala Fmoc (400 mg, 0.4 mmol/g, 0.16 mmol) was placed in a 10 mL
column and swollen with 6 mL DMF for 2 min. The column was drained
and the Fmoc group removed by two 15 min treatments with 6 mL of
20% piperidine in DMF. The resin was washed (as described above),
dried under vacuum, and swollen with 6 mL anhydrous DMF for 2 min.
The column was drained and the resin swollen with 6 mL distilled
CH.sub.2Cl.sub.2 for another 2 min. The column was drained and a
mixture containing anhydrous DMF (5.2 mL), Fmoc-.epsilon.Ahx-OH
(283 mg, 0.80 mmol, 5 eq), PyBOP.RTM. (416 mg, 0.80 mmol, 5 eq),
and DIPEA (279 .mu.L, 160 mmol, 10 eq) was added. After 12 h, the
resin was washed and found to be negative to Kaiser ninhydrin test.
The Fmoc group was then removed (as above) and the resin washed to
give 5c and 5d.
[0075] Polystyrene Beads with Attached Linker and Biotin (1c,
1d).
##STR00004##
[0076] Either resin 5c or resin 5d (100 mg, 0.040 mmol, 1 eq) was
placed in a 2 mL column and swollen with 1.5 mL anhydrous DMF for 2
min. The column was drained and the resin swollen with 1.5 mL
distilled CH.sub.2Cl.sub.2 for another 2 min. The column was
drained and a mixture containing anhydrous DMF (1.3 mL), biotin
(39.1 mg. 0.16 mmol, 4 eq), PyBOP.RTM. (83.3 mg, 0.16 mmol, 4 eq),
and DIPEA (55.7 .mu.L, 0.32 mmol, 8 eq) was added. After 12 h, the
resin was washed and subsequently found to be negative to Kaiser
ninhydrin test.
[0077] Polystyrene Beads with Attached Linker and Digoxigenin
Derivative (2c, 2d).
##STR00005##
[0078] Either resin 5c or resin 5d (10 mg, 0.004 mmol, 1 eq) was
placed in a 2 mL column and swollen with 1.5 mL anhydrous DMF for 2
min. The column was drained and the resin swollen with 1.5 mL
distilled CH.sub.2Cl.sub.2 for another 2 min. The column was
drained and a mixture containing anhydrous DMF (1.0 mL),
3-amino-3-deoxydigoxigenin hemisuccinamide, succinimidyl ester (5.0
mg, 0.0085 mmol, 2.1 eq), and DIPEA (20 .mu.L, 0.115 mmol, 29 eq)
was added. After 12 h, the resin was washed and treated for an
additional 12 h with a fresh preparation of the mixture described
above. The resin was washed again and subsequently found to be
negative to Kaiser ninhydrin test.
[0079] Polystyrene Beads with Attached Linker and FKBP Ligand (3c,
3d).
##STR00006##
[0080] Either resin 5c or resin 5d (100 mg, 0.04 mmol, 1 eq) was
placed in a 2 mL column and swollen with 1.5 mL anhydrous DMF for 2
min. The column was drained and the resin swollen with 1.5 mL
distilled CH.sub.2Cl.sub.2 for another 2 min. The column was
drained and a mixture containing anhydrous DMF (1.3 mL), FKBP
ligand (67.5 mg, 0.116 mmol, 2.9 eq), PyBOP.RTM. (83.3 mg, 0.16
mmol, 4 eq), and DIPEA (55.7 .mu.L, 0.32 mmol, 8 eq) was added.
After 12 h, the resin was washed and subsequently found to be
negative to Kaiser ninhydrin test.
[0081] Polystyrene Beads with Attached Linker and
Tetramethylrhodamine Derivative (4c).
##STR00007##
[0082] Either resin 5c or resin 5d (40 mg. 0.016 mmol, 1 eq) was
placed in a 2 mL column and swollen with 1.5 mL anhydrous DMF for 2
min. The column was drained and the resin swollen with 1.5 mL
distilled CH.sub.2Cl.sub.2 for another 2 min. The column was
drained and a mixture containing anhydrous DMF (1.0 mL),
5(6)-TAMRA, SE (25 mg, 0.047 mmol, 3.0 eq), and DIPEA (20 .mu.L,
0.115 mmol, 7.2 eq) was added. After 12 h, the resin was washed and
treated for an additional 12 h with a fresh preparation of the
mixture described above. The resin was washed again to yield resin
4c.
[0083] Mass Spectrometry.
[0084] As confirmation of this standard coupling chemistry, about
10 beads each of 1c, 1d, 2c, 2d, 3c and 3d were exposed to 100
.mu.L of trifluoroacetic acid/triisopropylsilane/chloroform
(2:1:17) for 2 h at room temperature. The deprotection/cleavage
solution was then removed in vacuo and the liberated compounds
dissolved in 20 .mu.L DMF. FAB.sup.+ MS gave molecular weights that
exactly matched those predicted for compounds 1a, 1b, 2a, 2b, 3a
and 3b, respectively.
Example 6
Small Molecule Printing
[0085] Deprotection and Release of Small Molecules.
[0086] Individual beads (1c, 1d, 2c, 2d, 3c, 3d, 4c) were placed in
separate wells of a polypropylene V-bottom 96-well plate (Costar,
Corning, N.Y.) using an 18-gauge needle and a low power dissecting
microscope. To each well was added 20 .mu.L of trifluoroacetic
acid/triethylsilane/chloroform (2:1:17) and the wells were
immediately sealed with polyethylene strip caps (Nalge Nunc
International, Naperville, Ill.). After 2 h at room temperature,
the caps were discarded and the cleavage solution removed in vacuo.
The released compounds were then dissolved in 5-10 .mu.L of DMF and
printed onto maleimide-derivatized glass slides.
[0087] Robotic Arraying of Small Molecules.
[0088] Small molecules were printed using a microarraying robot
(FIGS. 16, 17, and 18), constructed in this laboratory by Dr. James
S. Hardwick and Jeffrey K. Tong according to directions provided by
Dr. Patrick O. Brown
(http://cmgm.stanford.edu/pbrown/mguide/index.html).
[0089] The robot was instructed to pick up a small amount of
solution (.about.250 nL) from consecutive wells of a 96-well plate
and repetitively deliver approximately 1 nL to defined locations on
a series of maleimide-derivatized glass microscope slides. The pin
used to deliver the compounds was washed with double distilled
water for 8 s and dried under a stream of air for 8 s before
loading each sample (6 s). Following printing, the slides were
incubated at room temperature for 12 h and then immersed in a
solution of 2-mercaptoethanol/DMF (1:99) to block remaining
maleimide functionalities. The slides were subsequently washed for
1 h each with DMF, THF, and iPrOH, followed by a 1 h aqueous wash
with MBST (50 mM MES, 100 mM NaCl, 0.1% Tween.RTM. 20, pH 6.0).
Slides were rinsed with double-distilled water, dried by
centrifugation, and either used immediately or stored at room
temperature for several days without any observed
deterioration.
Example 7
Detection of Protein-Small Molecule Interactions
[0090] Materials.
[0091] Cy5-streptavidin, Cy5-goat-anti-mouse IgG, and
FITC-streptavidin were from Kirkegaard & Perry Laboratories
(Gaithersburg, Md.). Mouse-anti-digoxin IgG (DI-22) was from
Sigma-Aldrich Co. (St. Louis, Mo.). Mouse-anti-(His).sub.6IgG (RGS
His antibody) was from Qiagen (Hilden, Germany).
[0092] Production of (His).sub.6-FKBP12.
[0093] Construction of T5 Expression Plasmid.
[0094] A 355-bp PCR product containing the coding sequence for
human FKBP12 was obtained using primers FKBP-1S
(ACGTACGTGGATCCATGGGAGTGCAGGTGGAAACCA) and FKBP-1N
(ACGTACGTGTCGACTTATTCCAGTTTTAGAAGCTCCACATCGA) on template
pJG-FKBP12 (Licitra et al., Proc. Natl. Acad. Sci. USA 1996, 93,
12817-12821; incorporated herein by reference). The 333-bp Bam
HI-Sal I fragment of this product was then ligated with the 3434-bp
Bam HI-Sal I fragment of pQE-30 (Qiagen) to yield the T5 expression
plasmid pQE-30-FKBP12 (3757 bp).
[0095] Production and Purification of (His).sub.6 FKBP 12.
[0096] The host strain for protein production was M15[pREP4]
(Qiagen). Cells from a single colony were grown in 500 mL of LB
medium supplemented with 100 .mu.g/mL sodium ampicillin and 25
.mu.g/mL kanamycin at 37.degree. C. up to an OD.sub.600 of 0.8. The
culture was cooled to room temperature and isopropyl
1-thio-.beta.-D-galactopyranoside (IPTG) was added to a final
concentration of 1 mM. After 16 h induction at room temperature,
the cells were harvested and resuspended in 20 mL of PBS (10 mM
phosphate, 160 mM NaCl, pH 7.5) supplemented with 100 .mu.M
phenylmethanesulfonyl fluoride (PMSF). Following cell lysis by
passage through a French press, insoluble material was removed by
centrifugation (28000 g, 20 min, 4.degree. C.) and the supernatant
loaded onto a column packed with 5 mL of Ni-NTA agarose (Qiagen)
that had been preequilibrated with PBS. The column was thoroughly
washed with PBS containing 10 mM imidazole, and bound protein was
subsequently eluted with PBS containing 250 mM imidazole. The
sample was dialyzed extensively against PBS and stored at 4.degree.
C.
[0097] Labeling of Proteins with Fluorophores.
[0098] Cy3-labeled DI-22 was prepared from DI-22 mouse ascites
fluid (Sigma-Aldrich Co.) using FluoroLink.TM. Cy3.TM.
bisfunctional reactive dye (Amersham Pharmacia Biotech, Piscataway,
N.J.) according to the recommended protocol. Similarly, Cy5-labeled
(His).sub.6-FKBP12 was prepared from purified (His).sub.6-FKBP12
using FluoroLink.TM. Cy5.TM. monofunctional reactive dye (Amersham
Pharmacia Biotech) according to the recommended protocol.
[0099] Probing Slides with Proteins.
[0100] Reagents were applied to the printed face of the slides
using PDMS slide reaction chambers. Rinsing and washing steps were
performed with the slides face up in the lids of pipet tip
boxes.
[0101] In each experiment, the slides were blocked for 1 h with
MBST supplemented with 3% bovine serum albumin (BSA). Following
each step in the procedure, the slides were rinsed briefly with
MBST before applying the next solution. With the exception of the
blocking step, the slides were exposed to protein solutions for 30
min at room temperature. These solutions were prepared by diluting
stock solutions of the appropriate protein(s) with MBST
supplemented with 1% BSA. After the final incubation, the slides
were rinsed once with MBST and then gently agitated with 4 changes
of MBST over the course of 12 min. The slides were dried by
centrifugation and stored in the dark at room temperature.
[0102] The protein concentrations used in the preparation of FIGS.
7 and 8 were as follows: [0103] FIG. 7A: 1 .mu.g/mL
Cy5-streptavidin [0104] FIG. 7B: 2 .mu.g/mL DI-22 (IgG1) [0105] 1
.mu.g/mL Cy5-goat-anti-mouse IgG [0106] FIG. 7C: 40 .mu.g/mL
(His).sub.6-FKBP12 [0107] 2 .mu.g/mL mouse RGS His IgG [0108] 1
.mu.g/mL Cy5-goat-anti-mouse IgG [0109] FIG. 8: 2 .mu.g/mL
FITC-streptavidin, [0110] +0.2 .mu.g/mL Cy3-DI-22 (IgG1) [0111] +4
.mu.g/mL Cy5-(His).sub.6-FKBP12
[0112] Scanning Slides for Fluorescence.
[0113] Slides were scanned using an ArrayWoRx.TM. slide scanner
(AppliedPrecision, Issaquah, Wash.). Slides were scanned at a
resolution of 5 .mu.m per pixel. Double filters were employed for
both the incident and emitted light. For the images in FIG. 7,
tetramethylrhodamine fluorescence was observed using a Cy3/Cy3
excitation/emission filter set (1 s exposure) and Cy5 fluorescence
was observed using a Cy5/Cy5 excitation/emission filter set (2 s
exposure). For the image in FIG. 8, fluorescein fluorescence was
observed using a FITC/FITC excitation/emission filter set (10 s
exposure), Cy3 fluorescence was observed using a Cy3/Cy3
excitation/emission filter set (2 s exposure), and Cy5 fluorescence
was observed using a Cy5/Cy5 excitation/emission filter set (5 s
exposure). The full slide image (top) was stitched with 4-fold
pixel reduction and the magnified image (bottom) was stitched with
2-fold pixel reduction.
Example 8
Covalent Attachment and Screening of Alcohol-Containing Small
Molecules on Glass Slides
[0114] General Procedures for Synthetic Transformations:
[0115] Methylene chloride, diisopropylethylamine and
dimethylformamide were distilled under nitrogen from calcium
hydride. Tetrahydrofuran (HPLC grade, Fisher, solvent keg) was
dried by passing the solvent through two columns of activated
alumina (A-2) (Panghom et al., Organometallics 1996, 15, 1518;
incorporated herein by reference). All other reagents were obtained
from commercial suppliers. Solution phase reactions were carried
out in 2 dram vials with Teflon screw caps. Reactions were
monitored by thin layer chromatography using 0.25 mm silica gel 60
F.sub.254 plates from EM Science and visualized with ceric ammonium
molybdate (CAM) stain. All compounds were purified using 230-400
mesh silica gel 60 from EM Science. Biotinol was prepared as
previously described (Islam et al., J. Med. Chem. 1994, 37,
293-304; incorporated herein by reference). The digoxigenin
derivative as its N-hydroxysuccinimide ester was obtained from
Molecular Probes Inc. The FKBP ligand (AP1497, an acid) was
obtained from Dr. Kazunori Koide of Harvard University and from
Ariad Pharmaceuticals (Keenan et al., Bioorg. Med. Chem. Lett.
1998, 6, 1309; incorporated herein by reference).
[0116] The solid support, 500-560 .mu.m polystyrene 1%
divinylbenzene (Rapp Polymere) was derivatized with a
3-(p-anisolyldiisopropylsilyl)-propyl linker (Woolard et al., J.
Org. Chem. 1997, 62, 6102; incorporated herein by reference). The
library members were obtained from Dr. Kouji Hattori (Harvard). The
secondary alcohol of this scaffold was derivatized following the
method of Tan et al. (J. Am. Chem. Soc. 1999, 121, 9073-9087;
incorporated herein by reference). Solid phase loading reactions
were run under an inert atmosphere in 2.0 mL polypropylene
Bio-Spin.RTM. chromatography columns (Bio-Rad Laboratories,
Hercules, Calif.; 732-6008) bearing a 3-way nylon stopcock
(Bio-Rad; 732-8107) and mixed by 360.degree. rotation on a
Bamstead-Thermolyne Labquake Shaker.TM. (VWR 56264-306).
##STR00008##
[0117] Representative Procedure for the Synthesis of the FKBP
Ligands.
[0118] To the above mentioned acid (17 mg, 0.029 mmol), in a
solution of DMF (0.30 mL) was added the respective amine or amine
hydrochloride (0.038 mmol), PyBOP (24.4 mg, 0.047 mmol), and
i-Pr.sub.2NEt (0.015 mL, 0.088 mmol, amines; 0.020 mL, 0.12 mmol,
amine hydrochlorides). The solution was stirred at ambient
temperature for 15 h, dissolved in a dilute brine solution and was
extracted with EtOAc (3 times). The organic layers were combined,
washed with a 1/1 water/saturated brine solution, dried over
Na.sub.2SO.sub.4, filtered, concentrated, and chromatographed on
silica gel (0 to 10% in CHCl.sub.3) to give a colorless film.
[0119] primary OH (1) (reaction with ethanolamine); .sup.1H NMR
(500 MHz, CDCl.sub.3) .delta. 7.28 (m, 1H), 7.18 (m, 1H NH),
6.98-6.66 (m, 6 H), 5.75 (dd, J=7.8, 5.4 Hz, 1H), 5.29 (d, J=4.9
Hz, 1H), 4.51 (m, 2 H), 3.85 (s, 3 H), 384 (s, 3 H), 3.72 (m, 2 H),
3.51 (m, 2 H), 3.35 (b d, J=13.2 Hz 1H), 3.16 (td, J=12.3, 2.7 Hz,
1H), 2.56 (m, 2 H), 2.36 (b d, J=13.7 Hz, 1H), 2.23 (m, 1H), 2.05
(m, 1H), 1.77-1.62 (m, 6H), 1.48 (m, 1H), 1.34 (m, 1H), 1.21 (s,
3H), 1.19 (s. 3 H), 0.87 (t, J=7.6 Hz, 3 H); HRMS (TOF-ES.sup.+)
cal. for C.sub.34H.sub.47N.sub.2O.sub.9(M+H).sup.+, 627.3282, obs.
627.3306.
[0120] primary OMe (reaction with 2-methoxyethylamine); .sup.1H NMR
(500 MHz, CDCl.sub.3) .delta. 7.30 (m, 1 H), 7.00-6.67 (m, 7 H),
5.76 (m, 1H), 5.32 (d, J=4.9 Hz, 1H), 4.51 (m, 2 H), 3.86 (s, 3 H),
3.85 (s, 3 H), 3.55 (m, 2 H), 3.49 (m, 2H), 3.37 (d, J=13.0 Hz,
1H), 3.35 (s, 3H), 3.16 (td, J=13.2, 2.9 Hz, 1H), 2.57 (m, 2 H),
2.36 (b d, J=13.7 Hz 1H), 2.24 (m, 1H), 2.06 (m, 1H), 1.79-1.58 (m,
6 H), 1.51-1.30 (m, 2 H), 1.23 (s, 3 H), 1.21 (s, 3H), 0.89 (t,
J=7.6 Hz, 3 H); HRMS (TOF-ES.sup.+) calc. for
C.sub.35H.sub.48N.sub.2O.sub.9Na(M+Na).sup.+, 663.3258, obs.
663.3229.
[0121] secondary OH (reaction with trans-4-amino-cyclohexanol
hydrochloride); .sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 7.29 (m,
1H), 6.99-666 (m, 6H), 6.41 (d, J=8.3 Hz, 1H, NH), 5.76 (M, 1H),
5.30 (d, J=5.4 Hz, 1H), 4.46 (m, 2H), 3.85 (s, 3 H), 3.84 (s, 3H),
3.61 (m, 1H), 3.36 (b d, J=12.2 Hz, 1H), 3.20 TD, J=13.2, 2.9 Hz,
1H), 2.56 (m, 2H), 2.36 (b d, J=13.7 Hz, 1H), 2.24 (m, 1H), 2.00
(m, 4H), 1.78-1.61 (m, 6H), 1.50-1.23 (m, 4H), 1.21 (s, 3H), 1.20
(s, 3H), 0.88 (t, J=7.3 Hz, 3 H); HRMS (TOF-ES.sup.+) calc. for
C.sub.38H.sub.53N.sub.2O.sub.9(M+H).sup.+, 681.3751, obs.
681.3778.
[0122] phenolic OH (reaction with tyramine hydrochloride); .sup.1H
NMR (500 MHz, CDCl.sub.3) .delta. 7.31 (m, 1 H), 7.01-66 (m, 10 H),
6.51 (m, 1H, NH), 5.81 (m, 1H), 5.33 (b d, J=5.1 Hz, 1H), 4.60 (m,
2H), 3.86 (s, 6 H), 3.55 (m, 2 H), 3.40 (b d, J=13.0 Hz 1H), 3.27
(td, J=13.2, 2.9 Hz, 1H), 2.72 (t, J=6.4 Hz, 2 H), 2.56 (m, 2 H),
2.40 (b d, J=13.2 Hz, 1H), 2.24 (m, 1 H), 2.06 (m, 1H), 1.87-1.64
(m, 6 H), 1.54 (m, 1H), 1.40 (m, 1H), 1.24 (s, 3 H), 1.21 (s, 3 H),
0.88 (t, J=7.5 Hz, 3H); HRMS (TOF-ES.sup.+) calc. for
C.sub.40H.sub.50N.sub.2O.sub.9Na(M+Na).sup.+, 725.3414, obs.
725.3384.
[0123] Procedure for the Digoxigenin Derivative.
##STR00009##
[0124] To a solution of the NHS ester of the digoxigenin derivative
(5.0 mg, 0.0085 mmol) in DMF (0.3 mL) was added ethanolamine
(0.0008 mL, 0.013 mmol) and 4-methylmorpholine (0.0011 mL, 0.010
mmol). The reaction was stirred at ambient temperature for three
days, concentrated under high vacuum at room temperature, and
chromatographed on silica gel (0 to 20% MeOH in CHCl.sub.3);
.sup.1H NMR (400 MHz, 5/1 CDCl.sub.3/CD.sub.3OD) .delta. 5.84 (s,
1H), 4.81 (AB d, 2 H), 4.00 (b s, 1H) 3.55 (m, 2H) 3.24 (m, 3H),
2.39 (m, 4 H), 2.04 (m, 1H), 1.81 (m, 4 H), 1.70-1.38 (m, 9H), 1.16
(m, 6 H), 0.88 (s, 3H), 0.67 (s, 3H).
[0125] General Procedure for Loading Alcohols Via a Silicon Ether
onto Polystyrene Beads.
[0126] After drying under vacuum for 8 h, the large polystyrene
beads bearing a 3-(p-anisolyldiisopropylsilyl)-propyl linker (13.3
mg, 0.008 mmol, ca. 0.6 mmol silane/g resin) were added to a
Bio-Rad tube, which was capped with a septum and a plastic stopcock
and flushed with an inert gas. The tube was then charged via
syringe with a 2.5% (v/v) solution of TMS-Cl in CH.sub.2Cl.sub.2
The beads were suspended for 15 min, and filtered with inert gas
pressure. The beads were washed with CH.sub.2Cl.sub.2 (0.5 mL, 3
times, 2 min/rinse) and then suspended in a 3% (v/v) solution of
triflic acid in CH.sub.2Cl.sub.2 (0.142 mL, 0.049 mmol) for 15 min
during which time the tube was shaken periodically. The beads turn
a dark brown color. The beads were suspended and rinsed with
CH.sub.2Cl.sub.2 (0.5 mL, 3 times, 2 rain/rinse) under an inert
gas, and left suspended in the fourth volume of CH.sub.2Cl.sub.2
Freshly distilled 2,6-lutidene (0.007 mL, 0.064 mmol) was added
(the brown color disappears) and the azeotropically dried (from
benzene) alcohol (0.020 mmol) was added as a solution in
CH.sub.2Cl.sub.2 via a canula transfer (for .alpha.-ketoamide and
digoxigenin, 3 volumes, 0.3 mL/transfer) or introduced as a neat
solid (e.g., biotinol, when the alcohol is not soluble in
CH.sub.2Cl.sub.2). The tube was capped and tumbled at ambient
temperature for 2-4 h. The beads were then filtered, suspended, and
rinsed, for .alpha.-ketoamide, with CH.sub.2Cl.sub.2 (10 times, 5
min/rinse) and dried under high vacuum; for digoxigenin and biotin,
the beads were rinsed likewise with DMF to remove non-covalently
attached ligand.
[0127] Activation of Slides for Microarraying.
[0128] Slides were activated for covalent attachment of alcohols as
follows. Standard microscope slides (VWR) were immersed in 70/30
(v/v) H.sub.2SO.sub.4/30% H.sub.2O.sub.2 (piranha) for 16 h at
ambient temperature. After removal from the piranha bath, the
slides were washed extensively in ddH.sub.2O, and then kept under
water until use. To convert to the silyl chloride, the slides were
first removed from the water and dried by centrifugation. At this
point, the slides were immersed in a solution of THF containing 1%
SOCl.sub.2 and 0.1% DMF. The slides were incubated in this solution
for 4 h at ambient temperature. The slides were then removed from
the chlorination solution, washed briefly with THF, and placed on
the microarrayer.
[0129] Release of Alcohols from their Solid Supports.
[0130] To liberate alcohols from the polystyrene beads, single
beads were treated with 10 .mu.L of 90/5/5 (v/v)
THF/HF.pyridine/pyridine at ambient temperature for 1 h. 10 .mu.L
of TMSOMe was then added, and allowed to stand at ambient
temperature for an additional 0.5 h. The solvent was then removed
in vacuo, and the liberated compound from a single bead was
dissolved in 5 .mu.L of DMF. These solutions were then robotically
arrayed onto activated glass slides.
[0131] We confirmed the coupling of the .alpha.-ketoamide and
biotin to the secondary alcohol of the library by LC/LRMS
(TOF-ES.sup.+) analysis of material released from a single bead of
each type. The observed ions (M+H).sup.+ of 1064 and 725 matched
the theoretical masses expected for C.sub.59H.sub.75N.sub.4O.sub.14
(.alpha.-ketoamide) and C.sub.37H.sub.50N.sub.5O.sub.8S (biotin),
respectively.
[0132] Robotic Printing.
[0133] Compounds were arrayed onto glass slides using a DNA
microarrayer constructed by Dr. James Hardwick and Jeff Tong
following instructions on the web site of Professor Patrick Brown
(Standard University;
http://cmgm.stanford.edu/pbrown/mguide/index.html; incorporated
herein by reference). The microarrayer typically picks up 250 nL
from the 96-well plate and delivers 1 nL drops onto the slides.
These spots were placed 400 .mu.m apart on the slides.
[0134] Detection of Protein/Ligand Interactions.
[0135] After arraying, the slides were allowed to incubate at
ambient temperature for 12 h. The slides were then washed for 2 h
with DMF, and 1 h each with THF, isopropanol, and MBST (50 mM MES,
100 mM NaCl, 0.1% Tween-20, pH=6.0). The slides were then blocked
for 1 h by incubation with MBST containing 3% BSA. After a brief
rinse with MBST, the fluorescently labeled protein was then added
at a concentration of 1 .mu.g/mL in MBST supplemented with 1% BSA.
The labeled proteins were created as described (Tan et al., J. Am.
Chem. Soc. 1999, 121, 9073-9087; MacBeath et al., J. Am. Chem. Soc.
1999, 121, 7967-7968; each of which is incorporated herein by
reference). The slide was incubated with the labeled protein for
0.5 h at ambient temperature. At this point, the slide was washed
(10 times 1 mL with MBST, then briefly with H.sub.2O) and dried by
centrifugation. The slide was then scanned using an ArrayWoRx slide
scanner (AppliedPrecision, Issaquah, WA) at a resolution of 5 .mu.m
per pixel. The following filter sets were employed: Cy5/Cy5
excitation/emission filter set (2 s exposure); Cy3/Cy3
excitation/emission filter set (1 s exposure); FITC/FITC excitation
emission filter set (10 s exposure).
Other Embodiments
[0136] Those of ordinary skill in the art will readily appreciate
that the foregoing represents merely certain preferred embodiments
of the invention. Various changes and modifications to the
procedures and compositions described above can be made without
departing from the spirit or scope of the present invention, as set
forth in the following claims.
Sequence CWU 1
1
3136DNAArtificial Sequencesynthetic primer FKBP-1S 1acgtacgtgg
atccatggga gtgcaggtgg aaacca 36243DNAArtificial Sequencesynthetic
primer FKBP-1N 2acgtacgtgt cgacttattc cagttttaga agctccacat cga
4339PRTArtificial Sequencerecombinant RGS-(His)6-tag 3Arg Gly Ser
His His His His His His 1 5
* * * * *
References