U.S. patent application number 13/544454 was filed with the patent office on 2013-05-16 for methods and compositions for prognosing, detecting, and treating age-related macular degeneration.
This patent application is currently assigned to Massachusetts Eye and Ear Infirmary. The applicant listed for this patent is Margaret M. Deangelis. Invention is credited to Margaret M. Deangelis.
Application Number | 20130122016 13/544454 |
Document ID | / |
Family ID | 39495896 |
Filed Date | 2013-05-16 |
United States Patent
Application |
20130122016 |
Kind Code |
A1 |
Deangelis; Margaret M. |
May 16, 2013 |
Methods and Compositions for Prognosing, Detecting, and Treating
Age-Related Macular Degeneration
Abstract
The invention provides methods and compositions for determining
whether a subject is at risk of developing age-related macular
degeneration, for example, the wet or neovascular form of
age-related macular degeneration. The method involves determining
whether the subject has a protective variant and/or a risk variant
at a polymorphic site in the HTRA1 gene. In addition, the invention
provides a method of treating or slowing the progression of
age-related macular degeneration by reducing the expression of the
HTRA1 gene, or reducing the biological activity of the HTRA1 gene
product.
Inventors: |
Deangelis; Margaret M.;
(Salt Lake City, UT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Deangelis; Margaret M. |
Salt Lake City |
UT |
US |
|
|
Assignee: |
Massachusetts Eye and Ear
Infirmary
Boston
MA
|
Family ID: |
39495896 |
Appl. No.: |
13/544454 |
Filed: |
July 9, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13115912 |
May 25, 2011 |
8232056 |
|
|
13544454 |
|
|
|
|
12032154 |
Feb 15, 2008 |
7972787 |
|
|
13115912 |
|
|
|
|
60890339 |
Feb 16, 2007 |
|
|
|
60970828 |
Sep 7, 2007 |
|
|
|
Current U.S.
Class: |
424/158.1 ;
435/6.11; 514/44A |
Current CPC
Class: |
C12Q 2600/172 20130101;
C12Q 1/6883 20130101; A61P 27/00 20180101 |
Class at
Publication: |
424/158.1 ;
514/44.A; 435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
GOVERNMENT FUNDING
[0002] The work described in this application was sponsored, in
part, by the National Eye Institute under Grant No. EY-014458. The
United States Government may have certain rights in the invention.
Claims
1. A method of determining a subject's risk of developing
age-related macular degeneration, the method comprising determining
whether the subject has a protective variant at a polymorphic site
of the HTRA1 gene, wherein, if the subject has at least one
protective variant, the subject is less likely to develop
age-related macular degeneration than a person without the
protective variant.
2. The method of claim 1, further comprising determining the
genotype at the polymorphic site of the subject.
3. The method of claim 2, wherein the subject, if heterozygous for
the protective variant, has a 8-fold lower risk of developing
age-related macular degeneration than a homozygous person without
the protective variant.
4. The method of claim 2, wherein the subject, if homozygous for
the protective variant, has a 33-fold lower risk of developing
age-related macular degeneration than a homozygous person without
the protective variant.
5. The method of claim 1, wherein the polymorphic site is located
in the promoter region of the HTRA1 gene.
6. The method of claim 5, wherein the polymorphic site is
rs2672598.
7. The method of claim 6, wherein for the rs2672598 polymorphic
site, the forward sequence comprises
CTGCCCGGCCCAGTCCGAGCX.sub.1TCCCGGGCGGGCCCCCAGTC (SEQ ID NO. 1)
wherein X.sub.1 is a C to a T substitution and/or the reverse
sequence comprises GACTGGGGGCCCGCCCGGGAX.sub.2GCTCGGACTGGGCCGGGCAG
(SEQ ID NO. 2) wherein X.sub.2 is a G to A substitution.
8. The method of claim 2, wherein the genotype is determined by
direct nucleotide sequencing.
9. The method of claim 2, wherein the genotype is determined by
hybridization using a hybridization probe that selectively anneals
to the protective variant or to the common allele at the
polymorphic site of the HTRA1 gene.
10. The method of claim 2, wherein the genotype is determined by
restriction fragment length polymorphism analysis.
11. The method of claim 8, further comprising the step of
amplifying the polymorphic site prior to determining the
genotype.
12. The method of claim 2, where the genotype is determined by an
amplification reaction using primers capable of amplifying the
polymorphic site.
13. A method of treating a subject at risk of developing, or
having, age-related macular degeneration, the method comprising (i)
reducing the expression of the HTRA1 gene or (ii) reducing the
biological activity of the HTRA1 gene product.
14. A method of slowing the progression of age-related macular
degeneration in a subject, the method comprising (i) reducing the
expression of the HTRA1 gene or (ii) reducing the biological
activity of the HTRA1 gene product.
15. The method of claim 13, wherein the expression of the HTRA1
gene is reduced by administering to the subject an amount of an
anti-sense polynucleotide or a siRNA effective to reduce the
expression of the HTRA1 gene.
16. The method of claim 13, wherein the biological activity of the
HTRA1 gene product is reduced by administering to the subject an
effective amount of a binding protein that binds to the HTRA1 gene
product thereby to reduce the activity of the HTRA1 gene
product.
17. The method of claim 16, wherein the binding protein is an
antibody.
18. The method of claim 1, wherein the subject is a human.
19-43. (canceled)
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S.
Provisional Patent Application Ser. Nos. 60/890,339, filed Feb. 16,
2007, and 60/970,828, filed Sep. 7, 2007, the entire disclosure of
each of which is incorporated by reference herein for all
purposes.
FIELD OF THE INVENTION
[0003] The invention relates generally to methods and compositions
for determining whether an individual is at risk of developing
age-related macular degeneration by detecting whether the
individual has a protective or risk variant of the HTRA1 gene, and
to methods and compositions for treating, or slowing the
progression of, age-related macular degeneration by administering
an agent that reduces the expression of the HTRA1 gene or reduces
the biological activity of the HTRA1 gene product.
BACKGROUND
[0004] There are a variety of chronic intraocular disorders, which,
if untreated, may lead to partial or even complete vision loss. One
prominent chronic intraocular disorder is age-related macular
degeneration, which is the leading cause of blindness amongst
elderly Americans affecting a third of patients aged 75 years and
older (Fine et al. (2000) NEW ENGL. J. MED. 342: 483-492). There
are two forms of age-related macular degeneration, a dry form and a
wet (also known as a neovascular) form.
[0005] The dry form involves a gradual degeneration of a
specialized tissue beneath the retina, called the retinal pigment
epithelium, accompanied by the loss of the overlying photoreceptor
cells. These changes result in a gradual loss of vision. The wet
form is characterized by the growth of new blood vessels beneath
the retina which can bleed and leak fluid, resulting in a rapid,
severe and irreversible loss of central vision in the majority
cases. This loss of central vision adversely affects one's everyday
life by impairing the ability to read, drive and recognize faces.
In some cases, the macular degeneration progresses from the dry
form to the wet form, and there are at least 200,000 newly
diagnosed cases a year of the wet form (Hawkins et al. (1999) MOL.
VISION 5: 26-29). The wet form accounts for approximately 90% of
the severe vision loss associated with age-related macular
degeneration.
[0006] At this time, current diagnostic methods cannot accurately
predict the risk of age-related macular degeneration for an
individual. Unfortunately, the degeneration of the retina has
already begun by the time age-related macular degeneration is
diagnosed in the clinic. Further, most current treatments are
limited in their applicability, and are unable to prevent or
reverse the loss of vision especially in the case of the wet type,
the more severe form of the disease (Miller et al. (1999) ARCH.
OPHTHALMOL. 117(9): 1161-1173).
[0007] Currently, the treatment of the dry form of age-related
macular degeneration includes administration of antioxidant
vitamins and/or zinc. Treatment of the wet form of age-related
macular degeneration, however, has proved to be more difficult.
[0008] Several methods have been approved in the United States of
America for treating the wet form of age-related macular
degeneration. Two are laser based approaches, and include laser
photocoagulation and photodynamic therapy using a benzoporphyrin
derivative photosensitizer known as Visudyne. Two require the
administration of therapeutic molecules that bind and inactivate or
reduce the activity of Vascular Endothelial Growth Factor (VEGF),
one is known as Lucentis (ranibizumab), which is a humanized
anti-VEGF antibody fragment, and the other is known as Macugen
(pegaptanib sodium injection), which is an anti-VEGF aptamer.
[0009] During laser photocoagulation, thermal laser light is used
to heat and photocoagulate the neovasculature of the choroid. A
problem associated with this approach is that the laser light must
pass through the photoreceptor cells of the retina in order to
photocoagulate the blood vessels in the underlying choroid. As a
result, this treatment destroys the photoreceptor cells of the
retina creating blind spots with associated vision loss.
[0010] During photodynamic therapy, a benzoporphyrin derivative
photosensitizer known as Visudyne and available from QLT, Inc.
(Vancouver, Canada) is administered to the individual to be
treated. Once the photosensitizer accumulates in the choroidal
neovasculature, non-thermal light from a laser is applied to the
region to be treated, which activates the photosensitizer in that
region. The activated photosensitizer generates free radicals that
damage the vasculature in the vicinity of the photosensitizer (see,
U.S. Pat. Nos. 5,798,349 and 6,225,303). This approach is more
selective than laser photocoagulation and is less likely to result
in blind spots. Under certain circumstances, this treatment has
been found to restore vision in patients afflicted with the
disorder (see, U.S. Pat. Nos. 5,756,541 and 5,910,510).
[0011] Lucentis, which is available from Genentech, Inc., CA, is a
humanized therapeutic antibody that binds and inhibits or reduces
the activity of VEGF, a protein believed to play a role in
angiogenesis. Pegaptanib sodium, which is available from OSI
Pharmaceuticals, Inc., NY, is a pegylated aptamer that targets
VEGF165, the isoform believed to be responsible for primary
pathological ocular neovascularization.
[0012] Despite these efforts, there is still an ongoing need for
methods of identifying individuals at risk of developing
age-related macular degeneration so that such individuals can be
monitored more closely and then treated to slow, stop or reverse
the onset of age-related macular degeneration. In addition, there
is still an ongoing need for new methods of preventing the onset of
age-related macular degeneration, and, once established, the
treatment of age-related macular degeneration.
SUMMARY
[0013] The invention is based, in part, upon the discovery of
protective and risk variants of the High Temperature Requirement
Serine Peptidase 1 (HTRA1) gene. In one aspect, a protective
variant C>T (rs2672598) in the HTRA1 gene was identified that is
associated with reduced risk of the neovascular form of age-related
macular degeneration (AMD). Individuals homozygous for the
protective allele T (TT) (p<0.0001) have a 33-fold lower risk of
developing neovascular AMD, whereas individuals heterozygous for
the protective allele T (TC) (p<0.001) have a 8-fold lower risk
of developing neovascular AMD when compared to individuals
homozygous for the common allele C(CC).
[0014] In another aspect, a protective variant, a deletion of AT
(rs10664316) in LOC387715, which is upstream from the HTRA1 gene,
was identified that is associated with decreased risk of developing
the neovascular form of AMD. Individuals homozygous for the
deletion of AT (delAT/delAT) (p<0.001) have an 11-fold reduced
risk of developing neovascular AMD, whereas individuals
heterozygous for the deletion of AT (delAT/AT) (p<0.01) have a
3-fold reduced risk of developing neovascular AMD when compared to
individuals homozygous for the common alleles (AT/AT).
[0015] In another aspect, a risk variant C>T (rs1049331) in exon
1 of the HTRA1 gene was identified that is associated with
increased risk of developing the neovascular form of AMD.
Individuals homozygous for the risk allele T (TT) (p<0.00001)
have a 106-fold higher risk of developing neovascular AMD, whereas
individuals heterozygous for the risk allele T (TC) (p<0.001)
have a 6-fold higher risk of developing neovascular AMD when
compared to individuals homozygous for the common allele C(CC).
[0016] Additionally, another risk variant G>C/T (rs2293870) in
exon 1 of the HTRA1 gene was identified that is associated with
increased risk of developing the neovascular form of AMD.
Individuals homozygous for the risk allele T/C (TT, CC, or CT)
(p<0.00001) have a 26-fold higher risk of developing neovascular
AMD, whereas individuals heterozygous for the risk allele T/C (TG
or CG) (p<0.01) have a 6-fold higher risk of developing
neovascular AMD when compared to individuals homozygous for the
common allele G (GG).
[0017] Accordingly, in one aspect, the invention provides a method
of determining a subject's, for example, a human subject's, risk of
developing age-related macular degeneration. The method comprises
determining whether the subject has a variant at a polymorphic site
of the HTRA1 gene or upstream from the HTRA1 gene (e.g. 5' to the
gene and its regulatory regions, LOC387715), such as a protective
variant or a risk variant. If the subject has at least one
protective variant, the subject is less likely to develop
age-related macular degeneration than a person without the
protective variant. There are two exemplary protective variants.
One is located in the promoter region of the HTRA1 gene, and the
other one is located upstream from the HTRA1 gene. If the subject
has at least one risk variant, the subject is more likely to
develop age-related macular degeneration than a person without the
risk variant. Two exemplary risk variants are both located in exon
1 of the HTRA1 gene.
[0018] The method can further comprise determining the genotypes at
one or more of the polymorphic sites. In certain embodiments, the
method can include determining the genotype at rs2672598. If the
subject is heterozygous for the protective variant T at rs2672598,
the subject has a 8-fold lower risk of developing age-related
macular degeneration. If the subject is homozygous for the
protective variant T at rs2672598, the subject has a 33-fold lower
risk of developing age-related macular degeneration. In certain
embodiments, the method can include determining the genotype at
rs10664316. If the subject is heterozygous for the protective
variant, deletion of AT (delAT) at rs10664316, the subject has a
3-fold lower risk of developing age-related macular degeneration.
If the subject is homozygous for the protective variant, deletion
of AT (delAT) at rs10664316, the subject has an 11-fold lower risk
of developing age-related macular degeneration. In certain
embodiments, the method can include determining the genotype at
rs1049331. If the subject is heterozygous for the risk allele T at
rs1049331, the subject has a 6-fold higher risk of developing AMD.
If the subject is homozygous for the risk allele T at rs1049331,
the subject has a 106-fold higher risk of developing AMD. In
certain embodiments, the method can include determining the
genotype at rs2293870. If the subject is heterozygous for the risk
allele T/C at rs2293870, the subject has a 6-fold higher risk of
developing AMD. If the subject is homozygous for the risk allele
T/C at rs2293870, the subject has a 26-fold higher risk of
developing AMD.
[0019] In certain embodiments, the protective variant is a single
nucleotide polymorphism: rs2672598, located in the upstream region
of the HTRA1 gene.
For example, the forward sequence comprises
CTGCCCGGCCCAGTCCGAGCX.sub.1TCCCGGGCGGGCCCCCAGTC (SEQ ID NO. 1)
wherein X.sub.1 is a C to T substitution. C is the common allele,
and T is the protective variant. Alternatively, the reverse
sequence comprises GACTGGGGGCCCGCCCGGGAX.sub.2GCTCGGACTGGGCCGGGCAG
(SEQ ID NO. 2) wherein X.sub.2 is a G to A substitution. G is the
common allele, and A is the protective variant.
[0020] In another embodiment, the protective variant is a
deletion/insertion polymorphism: rs10664316, located within
LOC387715, which is upstream from the HTRA1 gene.
For example, the forward sequences comprises
TAAAATATCGTCATGTGTCTX.sub.3TTAAAAATGCATATTACTAA (SEQ ID NO. 3)
wherein X.sub.3 is a change of presence of AT to deletion of AT.
The presence of AT is the common allele, and the deletion of AT is
the protective variant. Alternatively, the reverse sequence
comprises TTAGTAATATGCATTTTTAAX.sub.4AGACACATGACGATATTTTA (SEQ ID
NO. 4) wherein X.sub.4 is a change of presence of TA to deletion of
TA. The presence of TA is the common allele, and the deletion of TA
is the protective variant.
[0021] In certain embodiments, the risk variant is a single
nucleotide polymorphism: rs2293870 (HTRA1 Gly36Gly). For example,
the forward sequence comprises
TCGGCGCCTTTGGCCGCCGGX.sub.5TGCCCAGACCGCTGCGAGCC (SEQ ID NO. 5)
wherein X.sub.5 is a G to a C or T substitution. G is the common
allele, and C or T is the risk variant.
Alternatively, the reverse sequence comprises
GGCTCGCAGCGGTCTGGGCAX.sub.6CCGGCGGCCAAAGGCGCCGA (SEQ ID NO. 6)
wherein X.sub.6 is a C to a G or A substitution. C is the common
allele, and G or A is the risk variant. rs2293870 is a synonymous
single nucleotide polymorphism with a G to a C or U substitution in
the forward sequence or a C to a G or A substitution in the reverse
sequence at HTRA1 mRNA position 220, coding for a Gly residue at
corresponding amino acid position 36.
[0022] In certain embodiments, the risk variant is a single
nucleotide polymorphism: rs1049331 (HTRA1 Ala34Ala). For example,
the forward sequence comprises
GGCCGCTCGGCGCCTTTGGCX.sub.7GCCGGGTGCCCAGACCGCTG (SEQ ID NO. 7)
wherein X.sub.7 is a C to T substitution. C is the common allele,
and T is the risk variant. Alternatively, the reverse sequence
comprises CAGCGGTCTGGGCACCCGGCX.sub.8GCCAAAGGCGCCGAGCGGCC (SEQ ID
NO. 8) wherein X.sub.8 is a G to A substitution. G is the common
allele, and A is the risk variant. rs1049331 is a synonymous single
nucleotide polymorphism with a C to a U substitution in the forward
sequence or a G to an A substitution in the reverse sequence at
HTRA1 mRNA position 214, coding for an Ala residue at corresponding
amino acid position 34.
[0023] In certain embodiments, the risk variant is a single
nucleotide polymorphism: rs10490924 (LOC387715 Ala69Ser). For
example, the forward sequence comprises
CACACTCCATGATCCCAGCTX.sub.9CTAAAATCCACACTGAGCTC (SEQ ID NO. 9)
wherein X.sub.9 is a G to T substitution. G is the common allele,
and T is the risk variant. Alternatively, the reverse sequence
comprises GAGCTCAGTGTGGATTTTAGX.sub.10AGCTGGGATCATGGAGTGTG (SEQ ID
NO. 10) wherein X.sub.10 is a C to A substitution. C is the common
allele, and A is the risk variant. rs10490924 is a non-synonymous
single nucleotide polymorphism with a G to a U substitution in the
forward sequence or a C to an A substitution in the reverse
sequence at LOC387715 mRNA position 270, coding for an Ala to a Ser
substitution at corresponding amino acid position 69.
[0024] In certain embodiments, the risk variant is a single
nucleotide polymorphism: rs11200638, located in the upstream region
of HTRA1 gene. For example, the forward sequence comprises
CGCGGACGCTGCCTTCGTCCX.sub.11GCCGCAGAGGCCCCGCGGTC (SEQ ID NO. 11)
wherein X.sub.11 is a G to A substitution. G is the common allele,
and A is the risk variant. Alternatively, the reverse sequence
comprises GACCGCGGGGCCTCTGCGGCX.sub.12GGACGAAGGCAGCGTCCGCG (SEQ ID
NO. 12) wherein X.sub.12 is a C to T substitution. C is the common
allele, and T is the risk variant.
[0025] According to ENSEMBL, the above-identified single nucleotide
polymorphisms appear in the following order from 5' to 3':
rs10490924, rs10664316, rs11200638, rs2672598, rs1049331, rs2293870
(see, for example, the web site at www.ensembl.org).
[0026] The variant (e.g. the genotype at a polymorphic site) can be
determined by standard techniques known in the art, which can
include, for example, direct nucleotide sequencing, hybridization
assays using a probe that anneals to the protective variant, to the
risk variant, or to the common allele at the polymorphic site,
restriction fragment length polymorphism assays, or
amplification-based assays. Furthermore, it is contemplated that
the polymorphic sites may be amplified prior to the detection
steps. In certain embodiments, the genotype may be determined by an
amplification reaction using primers capable of amplifying the
polymorphic site.
[0027] In another aspect, the invention provides a method of
treating, slowing the progression of, or reversing the development
of age-related macular degeneration in a subject, for example, a
human subject. The method comprises (i) reducing the expression of
the HTRA1 gene or (ii) reducing the biological activity of the
HTRA1 gene product.
[0028] The expression of the HTRA1 gene can be reduced by
administering to the subject, for example, a human subject, an
amount of, for example, an anti-sense polynucleotide or an siRNA
effective to reduce the expression of the HTRA1 gene.
Alternatively, the expression of the HTRA1 gene can be reduced by
administering to the subject, an amount of an agent effective to
modulate binding of the transcription factor, ELK-1, to the
promoter of the HTRA1 gene thereby reducing the expression of the
HTRA1 gene. Alternatively, the biological activity of the HTRA1
gene product can be reduced by, for example, administering to the
subject an effective amount of a binding protein that binds to the
HTRA1 gene product to reduce the activity of the HTRA1 gene
product. Exemplary compounds include anti-HTRA1 antibodies.
Alternatively, the proteolytic activity of the HTRA1 gene product
can be reduced by administering to the subject, an amount of an
agent effective to modulate binding of the insulin-like growth
factor, IGF, to the IGF-binding domain at the N-terminal end of the
HTRA1 protein, thereby reducing the biological activity of the
HTRA1 gene product.
[0029] In another aspect, the invention provides a method of
determining a subject's, for example, a human subject's, risk of
developing age-related macular degeneration. The method comprises
determining whether the subject has a haplotype comprising two or
more polymorphic sites selected from the group consisting of
rs10490924, rs10664316, rs11200638, rs2672598, rs2293870, and
rs1049331. If the subject has a risk haplotype, the subject is more
likely to develop AMD than a subject without the haplotype. The
haplotype can include rs10490924 as the risk variant, being T in
its forward sequence, rs10664316 as the common allele, being the
presence of AT in its forward sequence, rs11200638 as the risk
variant, being A in its forward sequence, rs2672598 as the common
allele, being C in its forward sequence, and/or rs1049331 as the
risk variant, being T in its forward sequence. If the subject has
the protective haplotype, the subject is less likely to develop AMD
than a subject without the haplotype. The haplotype can include
rs10490924 as the common allele, being G in its forward sequence,
rs10664316 as the protective variant, being the deletion of AT in
its forward sequence, rs11200638 as the common allele, being G in
its forward sequence, rs2672598 as the protective variant, being T
in its forward sequence, and/or rs1049331 as the common allele,
being C in its forward sequence. Alternatively, or in addition, the
reverse sequence can be used for this analysis. Determination of
the haplotype can be through the use of any of the techniques
described for determining the genotype above or below.
[0030] The foregoing aspects and embodiments of the invention may
be more fully understood by reference to the following detailed
description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 shows a display of linkage disequilibrium (r.sup.2)
between the genotyped SNPs in the genes PLEKHA1, LOC387715 and
HTRA1 ENSEMBL SNPs are shown along the 10q26 region encompassing
PLEKHA1, LOC387715 and HTRA1, illustrating the three distinct
haplotype blocks, which were defined by the confidence intervals
using an algorithm proposed by Gabriel (Gabriel, S. B. et al. The
structure of haplotype blocks in the human genome. Science (2002)
296, 2225-2229) using HAPLOVIEW. The linkage disequilibrium
(r.sup.2) between any two SNPs is listed in the cross cell. The
darker the color in the display, the higher the linkage
disequilibrium between any two SNPs.
[0032] FIG. 2 shows single marker analysis results from a
family-based association test (FBAT), assuming an additive genetic
model. SNP represents single nucleotide polymorphism; **** refers
to the fact that the number of informative families was less than 4
and that no statistics were available; PW p value represents point
wise p values; FW p value represents family wise p values
(Bonferroni correction was applied on 29 tests). .sup.a refers to
the first coding ATG. Minor allele frequency was .gtoreq.5% in both
affected and unaffected siblings.
[0033] FIG. 3 displays the identity by state scores, or the number
(0, 1, or 2) of alleles shared between a set of sibling pairs for
microsatellite markers. # refers to number; na represents
non-applicable; h represents heterozygocity; Chi-sq represents
Chi-squared statistic; p* represents p values that were adjusted by
using the Bonferroni correction on eight tests. Significantly
associated marker D1051656 is located 1.8 Mb from the end of HTRA1
gene.
[0034] FIG. 4 shows the haplotype analysis results from a family
based association test (FBAT). h1 represents haplotype 1; SNP
represents single nucleotide polymorphism; p-value results were
calculated based on 100,000 permutations. .sup.a refers to the
first coding ATG. Estimated haplotypes with allele frequency
greater than 0.05 were listed and tested for association. The
resulting p value from 100,000 permutations was 0.00006 when all
possible haplotypes were considered together. All SNPs were
sequenced in all subjects in the forward direction, and additional
confirmation was obtained by sequencing in the reverse direction in
a small number of subjects carrying the risk alleles.
[0035] FIG. 5 shows the results of multiple conditional logistic
regression analysis for six SNPs considered as risk factors for the
development of AMD (rs10490924, rs10664316, rs11200638, rs2672598,
rs1049331, and rs2293870). The Odds Ratios and p values are
displayed as well. All SNPs were sequenced in all subjects in the
forward direction, and additional confirmation was obtained by
sequencing in the reverse direction in a small number of subjects
carrying the risk alleles.
[0036] FIGS. 6A and 6B show the results of population attributable
risk (PAR) analysis for six SNPs considered as risk factors for the
development of AMD (rs10490924, rs10664316, rs11200638, rs2672598,
rs1049331, and rs2293870). Relative risk was estimated by
conditional logistic regression analysis adjusting for other
factors. The relative risk value was less than the sum of the
adjusted PARs, because these risk factors were not mutually
exclusive, and the relative risk used here was not adjusting for
other factors. All SNPs were sequenced in all subjects in the
forward direction, and additional confirmation was obtained by
sequencing in the reverse direction in a small number of subjects
carrying the risk alleles.
[0037] FIG. 7 shows the location of microsatellite markers and
SNPs. bp represents base pairs. .sup.a refers to the first coding
ATG. The chromosome position of each microsatellite marker was
determined by using a program available at the web site,
compgen.rutgers.edu/mapomat/. The chromosome position of each SNP
was determined by using a program available at the web site,
www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000166033.
[0038] FIG. 8 shows the characteristics of the subjects in the two
analyzed groups: affected siblings and unaffected siblings. The
characteristics include the range of the ages of the subjects, the
mean age, the standard deviation of the distribution of the ages
and the percentage of males in any one of the two groups.
[0039] FIG. 9 shows the primers used in the studies described
herein. Primers are written in the 5'-3' direction and were chosen
using the Primer3 program (available at the web site,
www.primer3.sourceforge.net) to encompass the entire coding region
and flanking intronic sequences.
[0040] FIG. 10 describes the SNPs analyzed in the studies described
herein. bp represents base pairs; MAF represents Minor Allele
Frequency. The chromosome position of each SNP was determined by
using a program available at the web site,
www.ensembLorg/Homo_sapiens/geneview?gene=ENSG00000166033. .sup.a
refers to the most minor allele of the three alleles; .sup.b refers
to variants/SNPs excluded from statistical analysis because Minor
Allele Frequency (MAF) did not meet the criteria of .gtoreq.5% in
both unaffected and affected siblings. All SNPs were sequenced in
all subjects in the forward direction, and additional confirmation
was obtained by sequencing in the reverse direction in a small
number of subjects carrying the risk alleles.
[0041] FIGS. 11A and 11B show the genotypes and allele frequencies
of six SNPs analyzed in the studies described herein for two
groups: affected siblings and unaffected siblings. All SNPs were
sequenced in all subjects in the forward direction, and additional
confirmation was obtained by sequencing in the reverse direction in
a small number of subjects carrying the risk alleles.
DETAILED DESCRIPTION
[0042] As discussed previously, the invention is based, in part,
upon the discovery of two protective and two risk variants at
polymorphic sites of the HTRA1 gene or upstream from the HTRA1 gene
(e.g. 5' to the gene and regulatory regions: LOC387715). Two
protective variants, C>T (rs2672598) in the HTRA1 gene and
presence of AT>deletion of AT (rs10664316) in LOC387715, which
is upstream from the HTRA1 gene, have been found to be associated
with reduced risk of developing the neovascular form of age-related
macular degeneration (AMD). Individuals homozygous for the
protective allele T (TT) of rs2672598 (p<0.0001) have a 33-fold
lower risk of developing neovascular AMD, whereas individuals
heterozygous for the protective allele T (TC) of rs2672598
(p<0.001) have a 8-fold lower risk of developing neovascular AMD
when compared to those homozygous for the common allele C (CC) of
rs2672598. Individuals homozygous for the protective variant,
deletion of AT (delAT) (delAT/delAT) of rs10664316 (p<0.001),
have an 11-fold lower risk of developing neovascular AMD, whereas
individuals heterozygous for the protective variant, deletion of AT
(delAT) (delAT/AT) of rs10664316 (p<0.01), have a 3-fold lower
risk of developing neovascular AMD when compared to those
homozygous for the common alleles (AT/AT) of rs10664316.
[0043] Two risk variants, C>T (rs1049331) and G>C/T
(rs2293870), have been found to be associated with increased risk
of developing the neovascular form of AMD. Individuals homozygous
for the risk allele T (TT) of rs1049331 (p<0.00001) have a
106-fold higher risk of developing neovascular AMD, whereas
individuals heterozygous for the risk allele T (TC) of rs1049331
(p<0.001) have a 6-fold higher risk of developing neovascular
AMD when compared to individuals homozygous for the common allele
C(CC) of rs1049331. Individuals homozygous for the risk allele T/C
(TT, CC, or CT) of rs2293870 (p<0.00001) have a 26-fold higher
risk of developing neovascular AMD, whereas individuals
heterozygous for the risk allele T/C (TB or CG) of rs2293870
(p<0.01) have a 6-fold higher risk of developing neovascular AMD
when compared to individuals homozygous for the common allele G
(GG) of rs2293870.
[0044] Although the Single Nucleotide Polymorphisms (SNPs),
rs2672598, rs10664316, rs2293870 and rs10049331 are known, their
associations with the risk of developing neovascular AMD heretofore
were not known. HTRA1 is a heat shock protein that encodes a serine
protease that is believed to indirectly regulate insulin. One
protective variant at rs2672598 is located in the promoter region
of HTRA1, and the other protective variant at rs10664316 is located
within LOC387715, which is upstream from the HTRA1 gene, both of
which are near two other variants (present in SNPs rs10490924 and
rs11200638) that have recently been reported to be associated with
an increased risk of AMD. The two risk variants at rs2293870 and
rs1049331 are both located in exon 1 of HTRA1 gene. rs1049331 is
located between rs2672598 and rs2293870: 588 bp downstream of
rs2672598 and 6 bp upstream of rs2293870.
[0045] In vivo (DeWan et al. (2006) SCIENCE 314: 989-992) and in
vitro studies (Yang et al. (2006) SCIENCE 314-992-993) of HTRA1
have shown that SNP rs11200638, increases the risk of developing
AMD, most likely doing so by upregulating the expression of the
HTRA1 gene. This SNP appears to reside in the binding sites for
serum response factor. The increased risk of developing AMD is
believed to relate to an increased expression of the HTRA1
gene.
[0046] Using the computer program MapInspector, located on the
world wide web at the web site, www.genomatrix.de/, rs2672598 was
identified as being located in the binding site for the
transcription factor ELK-1. The protective allele of rs2672598
appears to create a binding site for the transcription factor
ELK-1. It is contemplated that the variant at this SNP alters the
binding capacity of ELK-1 to the promoter region of HTRA1 to
decrease or down regulate the expression of the HTRA1 gene.
[0047] In a recent clinical report of a patient with Metageria (an
accelerated form of early aging) and insulin resistance it was
postulated that ELK-1 activity was impaired or non functional
(Knebel B. et al. (2005) EXP. CLIN. ENDOCRINOL. DIABETES,
113(2):94-101). Specifically in vitro assays on cultured
fibroblasts from this patient demonstrated that not only were the
insulin receptors functioning properly but that the pathways
activated by insulin were working properly as well. The authors
concluded that the insulin resistance in this prematurely aging
patient was most likely due to improper phosphorylation of ELK-1,
which resulted in this transcription factor not being able to
function at all. Insulin resistance or the body's inability to
regulate insulin properly underlies diabetes. A 10-year prospective
study year showed that diabetes was associated with increased risk
of neovascular age-related macular degeneration (AREDS Report No.
19, 2005 OPHTHALMOL.). Without wishing to be bound by theory, it is
contemplated that the variant at rs2672598 facilitates the proper
binding of ELK-1 thereby down regulating the expression of the
HTRA1 gene and helping to keep levels of insulin in the body to a
normal level.
[0048] SNP rs2293870 is located in one of the HTRA1 binding domains
for insulin-like growth factors (IGFs). IGF has been implicated in
other ocular conditions characterized by neovascularization such as
diabetic retinopathy and retinopathy of prematurity. Binding of
HTRA1 may directly modulate IGF expression. For example, in studies
of patients who progress from non-proliferative diabetic
retinopathy to neovascularization (proliferative diabetic
retinopathy) patient serum and vitreal IGF levels were found to be
significantly elevated (Shaw and Grant (2004) Reviews in Endocrine
& Metabolic Disorders 5: 199-207).
[0049] Therefore, an effect of rs2293870 on a regulatory pathway
involving HTRA1 and IGFs has biologic plausibility for AMD. For
example, improper regulation or expression of IGF may result in
cell death--apoptosis, such as, death of the photoreceptors (Shaw
and Grant (2004) Reviews in Endocrine & Metabolic Disorders 5:
199-207). Additionally, the nucleotide change at rs2293870 may
generate an alternative splice site in the HTRA1 transcript.
1. Prognosis and Diagnosis of Neovascular AMD
[0050] In one aspect, the invention provides a method of
determining a subject's, for example, a human subject's, risk of
developing age-related macular degeneration. The method comprises
determining whether the subject has a protective variant at a
polymorphic site of the HTRA1 gene or in a region upstream from the
HTRA1 gene wherein, if the subject has at least one protective
variant, the subject is less likely to develop age-related macular
degeneration than a person without the protective variant. One
exemplary protective variant is at a SNP, rs2672598, located in the
promoter region of the HTRA1 gene. For example, the forward
sequence comprises CTGCCCGGCCCAGTCCGAGCX.sub.1TCCCGGGCGGGCCCCCAGTC
(SEQ ID NO. 1) wherein X.sub.1 is a C to T substitution. C is the
common allele and T is the protective variant. Alternatively, the
reverse sequence comprises
GACTGGGGGCCCGCCCGGGAX.sub.2GCTCGGACTGGGCCGGGCAG (SEQ ID NO. 2)
wherein X.sub.2 is a G to A substitution. G is the common allele
and A is the protective variant.
[0051] Another exemplary protective variant is at a SNP,
rs10664316, located within LOC387715, which is upstream from the
HTRA1 gene. For example, the forward sequence comprises
TAAAATATCGTCATGTGTCTX.sub.3AAAAATGCATATTACTAA (SEQ ID NO. 3)
wherein X.sub.3 is a change of presence of AT to deletion of AT.
The presence of AT is the common allele, and the deletion of AT is
the protective variant. Alternatively, the reverse sequence
comprises TTAGTAATATGCATTTTTAAX.sub.4AGACACATGACGATATTTTA (SEQ ID
NO. 4) wherein X.sub.4 is a change of presence of TA to deletion of
TA. The presence of TA is the common allele, and the deletion of
the TA is the protective variant.
[0052] In another aspect, the invention provides a method of
determining a subject's, for example, a human subject's, risk of
developing age-related macular degeneration. The method comprises
determining whether the subject has a risk variant at a polymorphic
site of the HTRA1 gene, wherein, if the subject has at least one
risk variant, the subject is more likely to develop age-related
macular degeneration than a person without the risk variant. One
exemplary risk variant is at a SNP, rs2293870, located in exon 1 of
the HTRA1 gene. For example, the forward sequence comprises
TCGGCGCCTTTGGCCGCCGGX.sub.5TGCCCAGACCGCTGCGAGCC (SEQ ID NO. 5)
wherein X.sub.5 is a G to C or T substitution. G is the common
allele and T or C is the risk variant. Alternatively, the reverse
sequence comprises GGCTCGCAGCGGTCTGGGCAX.sub.6CCGGCGGCCAAAGGCGCCGA
(SEQ ID NO. 6) wherein X.sub.6 is a C to a G or A substitution. C
is the common allele and G or A is the risk variant. rs2293870 is a
synonymous single nucleotide polymorphism with a G to a C or U
substitution in the forward sequence or a C to a G or A
substitution in the reverse sequence at HTRA1 mRNA position 220,
coding for a Gly residue at corresponding amino acid position
36.
[0053] Another exemplary risk variant is at a SNP, rs1049331,
located in exon 1 (6 bp upstream of rs2293870) of the HTRA1 gene.
For example, the forward sequence comprises
GGCCGCTCGGCGCCTTTGGCX.sub.7GCCGGGTGCCCAGACCGCTG (SEQ ID NO. 7)
wherein X.sub.7 is a C to T substitution. C is the common allele
and T is the risk variant. Alternatively, the reverse sequence
comprises CAGCGGTCTGGGCACCCGGCX.sub.8GCCAAAGGCGCCGAGCGGCC (SEQ ID
NO. 8) wherein X.sub.8 is a G to an A substitution. G is the common
allele and A is the risk variant. rs1049331 is a synonymous single
nucleotide polymorphism with a C to a U substitution in the forward
sequence or a G to an A substitution in the reverse sequence at
HTRA1 mRNA position 214, coding for an Ala residue at corresponding
amino acid position 34.
[0054] The presence of a protective and/or risk variant can be
determined by standard nucleic acid detection assays including, for
example, conventional SNP detection assays, which may include, for
example, amplification-based assays, probe hybridization assays,
restriction fragment length polymorphism assays, and/or direct
nucleic acid sequencing. Exemplary protocols for preparing and
analyzing samples of interest are discussed in the following
sections.
[0055] A. Preparation of Samples for Analysis
[0056] Polymorphisms can be detected in a target nucleic acid
samples from an individual under investigation. In general, genomic
DNA can be analyzed, which can be selected from any biological
sample that contains genomic DNA or RNA. For example, genomic DNA
can be obtained from peripheral blood leukocytes using standard
approaches (QIAamp DNA Blood Maxi kit, Qiagen, Valencia, Calif.).
Nucleic acids can be harvested from other samples, for example,
cells in saliva, cheek scrapings, skin or tissue biopsies, amniotic
fluid. Methods for purifying nucleic acids from biological samples
suitable for use in diagnostic or other assays are known in the
art.
[0057] B. Detection of Polymorphisms in Target Nucleic Acids
[0058] The identity of bases present at the polymorphic sites,
rs2672598, rs2293870 and rs1049331, in the HTRA1 gene, and
rs10664316, upstream from the HTRA1 gene, can be determined in an
individual using any of several methods known in the art. The
polymorphisms can be detected by direct sequencing,
amplification-based assays, probe hybridization-based assays,
restriction fragment length polymorphism assays, denaturing
gradient gel electrophoresis, single-strand conformation
polymorphism analyses, and denaturing high performance liquid
chromatography. Other methods to detect nucleic acid polymorphisms
include the use of: Molecular Beacons (see, e.g., Piatek et al.
(1998) NAT. BIOTECHNOL. 16:359-63; Tyagi and Kramer (1996) NAT.
BIOTECHNOL. 14:303-308; and Tyagi et al. (1998) NAT. BIOTECHNOL.
16:49-53), the Invader assay (see, e.g., Neri et al. (2000) ADV.
NUCL. ACID PROTEIN ANALYSIS 3826: 117-125 and U.S. Pat. No.
6,706,471), and the Scorpion assay (Thelwell et al. (2000) NUCL.
ACIDS RES. 28:3752-3761 and Solinas et al. (2001) NUCL. ACIDS RES.
29:20).
[0059] The design and use of allele-specific probes for analyzing
polymorphisms are described, for example, in EP 235,726, and WO
89/11548. Briefly, allele-specific probes are designed to hybridize
to a segment of target DNA from one individual but not to the
corresponding segment from another individual, if the two segments
represent different polymorphic forms. Hybridization conditions are
chosen that are sufficiently stringent so that a given probe
essentially hybridizes to only one of two alleles. Typically,
allele-specific probes are designed to hybridize to a segment of
target DNA such that the polymorphic site aligns with a central
position of the probe.
[0060] The design and use of allele-specific primers for analyzing
polymorphisms are described, for example, in WO 93/22456. Briefly,
allele-specific primers are designed to hybridize to a site on
target DNA overlapping a polymorphism and to prime DNA
amplification according to standard PCR protocols only when the
primer exhibits perfect complementarity to the particular allelic
form. A single-base mismatch prevents DNA amplification and no
detectable PCR product is formed. The method works particularly
well when the polymorphic site is at the extreme 3'-end of the
primer, because this position is most destabilizing to elongation
from the primer.
[0061] The primers, once selected, can be used in standard PCR
protocols in conjunction with another common primer that hybridizes
to the upstream non-coding strand of the HTRA1 gene at a specified
location upstream from the polymorphism (or to the upstream
non-coding strand of LOC387715 at a specific location upstream from
the polymorphism). The common primers are chosen such that the
resulting PCR products can vary from about 100 to about 300 bases
in length, or about 150 to about 250 bases in length, although
smaller (about 50 to about 100 bases in length) or larger (about
300 to about 500 bases in length) PCR products are possible. The
length of the primers can vary from about 10 to 30 bases in length,
or about 15 to 25 bases in length.
[0062] In addition, individuals with the protective variant can
also be identified by restriction fragment length polymorphism
(RFLP) assays. It is understood that in the presence of a
protective variant at rs2672598, the C to T substitution results in
the creation of a site of cleavage for the restriction
endonuclease, AluI. In contrast to the common allele, which is not
recognized by AluI, the protective allele can be detected by
genotyping the individual by RFLP analysis.
[0063] Many of the methods for detecting polymorphisms involve
amplifying DNA or RNA from target samples (e.g., amplifying the
segments of the HTRA1 gene of an individual using HTRA1-specific
primers, or amplifying segments of LOC387715 of an individual using
LOC387715-specific primers) and analyzing the amplified gene
segments. This can be accomplished by standard polymerase chain
reaction (PCR & RT-PCR) protocols or other methods known in the
art. Amplification products generated using PCR can be analyzed by
the use of denaturing gradient gel electrophoresis. Different
alleles can be identified based on sequence-dependent melting
properties and electrophoretic migration in solution. See Erlich,
ed., PCR Technology, Principles and Applications for DNA
Amplification, Chapter 7 (W.H. Freeman and Co, New York, 1992).
[0064] SNP detection can also be accomplished by direct PCR
amplification, for example, via Allele-Specific PCR (AS-PCR) which
is the selective PCR amplification of one of the alleles to detect
Single Nucleotide Polymorphism (SNP). Selective amplification is
usually achieved by designing a primer such that the primer will
match/mismatch one of the alleles at the 3'-end of the primer. The
amplifying may result in the generation of HTRA1 allele-specific
oligonucleotides, which span any of the SNPs, rs2672598, rs2293870
or rs1049331, or in the generation of LOC387715 allele-specific
oligonucleotides, which may span rs10664316. The HTRA1-specific (or
LOC387715-specific) primer sequences and HTRA1 allele-specific (or
LOC387715 allele-specific) oligonucleotides may be derived from the
coding (exons) or non-coding (promoter, 5' untranslated, introns or
3' untranslated) regions of the HTRA1 gene (or of LOC387715).
[0065] Direct sequencing analysis of polymorphisms can be
accomplished using DNA sequencing procedures known in the art. See
Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed.,
CSHP, New York 1989) and Zyskind et al., Recombinant DNA Laboratory
Manual (Acad. Press, 1988).
[0066] A wide variety of other methods are known in the art for
detecting polymorphisms in a biological sample. See, e.g., U.S.
Pat. No. 6,632,606; Shi (2002) AM. J. PHARMACOGENOMICS 2:197-205;
Kwok et al. (2003) CURR. ISSUES BIOL. 5:43-60). Detection of the
single nucleotide polymorphic form (i.e., the presence or absence
of the variant at rs2672598, rs10664316, rs2293870 or rs1049331),
alone and/or in combination with each other and/or in combination
with additional HTRA1 gene polymorphisms and/or LOC387715
polymorphisms, may increase the probability of an accurate
diagnosis. In one embodiment, screening involves determining the
presence or absence of the variant at rs2672598. In another
embodiment, screening involves determining the presence or absence
of the variant at rs2293870. In another embodiment, screening
involves determining the presence or absence of the variant at
rs1049331. In another embodiment, screening involves determining
the presence or absence of the variant at rs10664316.
[0067] In diagnostic methods, the analysis of rs2672598,
rs10664316, rs2293870 and/or rs1049331 can be combined with each
other and/or can be combined with analysis of polymorphisms in
other genes associated with AMD, detection of protein markers of
AMD (see, e.g., U.S. Patent Application Publication Nos.
US2003/0017501 and US2002/0102581 and International Application
Publication Nos. WO0184149 and WO0106262), assessment of other risk
factors of AMD (such as family history), with ophthalmological
examination, and with other assays and procedures.
[0068] Screening also can involve detecting a haplotype which
includes two or more SNPs. Such SNPs include those described herein
and/or additional HTRA1 gene polymorphisms and/or LOC387715
polymorphisms, and/or other gene associated with AMD and/or other
risk factors. The SNPs include, but are not limited to, rs10490924,
rs10664316, rs11200638, rs2672598, rs2293870, and rs1049331. For
the two or more SNPs, one determines if the risk variant is present
or absent (for risk variant SNPs) and/or if the common allele is
present or absent (for protective variant SNPs) in order to
diagnose a subject for being at increased risk of developing AMD.
Conversely, for the two or more SNPs, one can determine if the
common allele is present or absent (for risk variant SNPs) and/or
the protective variant is present or absent (for protective variant
SNPs) in order to diagnose a subject for being at reduced risk of
developing AMD. If the subject has a haplotype in the forward
direction of T(AT)ACT at rs10490924, rs10664316, rs11200638,
rs2672598, and rs1049331, respectively, the subject has an
increased risk of developing AMD relative to a person without the
haplotype (p<10.sup.-4). If the subject has a haplotype in the
forward direction of G(delAT)GTC at rs10490924, rs10664316,
rs11200638, rs2672598, and rs1049331, respectively, the subject has
a reduced risk of developing AMD relative to a person without the
haplotype (p<10.sup.-2).
II. Treatment of Neovascular AMD
[0069] In another aspect, the invention provides a method of
treating, slowing the progression of, or reversing the development
of age-related macular degeneration in a subject, for example, a
human subject. The method comprises (i) reducing the expression of
the HTRA1 gene or (ii) reducing the biological activity of the
HTRA1 gene product.
[0070] The expression of the HTRA1 gene can be reduced by
administering to the subject an amount of an agent effective to
reduce the expression of the HTRA1 gene. Examples include, for
example, an anti-sense polynucleotide or a siRNA effective to
reduce the expression of the HTRA1 gene. Specific examples include,
for example, siRNA (1900si) (Chien et al., (2006), J CLIN INVEST.
116(7):1994-2004), sc-60083 (Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.), and sc-43854 (Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.).
[0071] Alternatively, the expression of the HTRA1 gene can be
reduced by administering to the subject, an amount of an agent
effective to modulate binding of ELK-1 to the promoter of the HTRA1
gene thereby reducing the expression of the HTRA1 gene. Examples
include, for example, short ELK-1 (sELK) (Vanhoutte et al. (2001) J
BIOL CHEM. 276(7):5189-96)
[0072] Alternatively, the expression of the HTRA1 gene product can
be reduced by administering to the subject, an agent effective to
increase the phosphorylation of ELK-1 then increase the activity of
the ELK-1 gene product thereby reducing the expression of the HTRA1
gene. Examples include, for example, Silibinin (Sigma-Aldrich, St.
Louis, Mo.), Dihydrotestosterone (DHT) (Sigma-Aldrich, St. Louis,
Mo.), and/or 17.beta.-estradiol (E.sub.2) (Innovative Research of
America, Sarasota, Fla.).
[0073] Alternatively, the proteolytic activity of the HTRA1 gene
product can be reduced by administering to the subject an amount of
an agent effective to modulate binding of the insulin-like growth
factor, IGF, to the IGF-binding domain at the N-terminal end of the
HTRA1 protein thereby reducing the biological activity of the HTRA1
gene product. Binding of HTRA1 may directly modulate IGF
expression. For example, in studies of patients who progress from
non-proliferative diabetic retinopathy to neovascularization
(proliferative diabetic retinopathy) patient serum and vitreal IGF
levels were found to be significantly elevated (Shaw and Grant
(2004) Reviews in Endocrine & Metabolic Disorders 5:
199-207).
[0074] Alternatively, the expression of IGF can be modulated, for
example, by administering to the subject an effective amount of
agent to increase or reduce the expression level of IGF. For
example, PTEN (phosphatase and tensin homolog) can downregulate IGF
transcription (Kang-Park et al. (2003) FEBS Lett, 545(2-3):
203-208).
[0075] Alternatively, the biological activity of the HTRA1 gene
product can be reduced, for example, by administering to the
subject an effective amount of an agent that binds to the HTRA1
gene product to reduce the activity of the HTRA1 gene product.
Exemplary compounds include proteins, for example, antibodies that
bind to the HTRA1 gene product. Exemplary proteins include, for
example, an anti-HTRA1 antibody. The term antibody is understood to
mean an intact antibody, an antigen binding fragment thereof (for
example, Fab, Fab' and (Fab'), fragments) and single chain antibody
binding sites or sFvs.
[0076] Selective HTRA1 antagonists can also include peptides and
peptide derivatives, which may be administered to systemically or
locally to the mammal. Other useful selective HTRA1 antagonists
include, for example, deoxyribonucleic acids (for example,
antisense oligonucleotides), ribonucleic acids (for example,
antisense oligonucleotides, aptamers, and interfering RNA) and
peptidyl nucleic acids, which once administered reduce or eliminate
the expression of certain genes (such as the HTRA1 gene) or can
bind to and reduce or eliminate the activity of a target protein or
receptor as in the case of aptamers. Other useful selective HTRA1
antagonists include small organic or inorganic molecules that
reduce or eliminate the activity when administered to the mammal.
Examples include, for example, NVP-LBG976, (Novartis, Basel), and
1-{3-cyclohexyl-2-[(naphthalene-2-carbonyl)-amino]-propionyl}-pyrrolidine-
-2-carboxylic acid
[5-(3-cyclohexyl-ureido)-1-dihydroxyboranyl-pentyl]-amide
(Novartis).
[0077] Once appropriate selective HTRA1 antagonists have been
identified, they may be administered to a mammal of interest (such
as a human) in any one of a wide variety of ways. It is
contemplated that a selective HTRA1 antagonist can be administered
either alone or in combination with two, three, four or more
different selective HTRA1 antagonists either together or one after
the other. Although the optimal mode of administration of a
particular selective HTRA1 antagonist or combination of selective
HTRA1 antagonists can be determined empirically, it is contemplated
that selective HTRA1 antagonists may be administered locally or
systemically.
[0078] Systemic modes of administration include both oral and
parenteral routes. Parenteral routes include, for example,
intravenous, intrarterial, intramuscular, intradermal,
subcutaneous, intranasal, and intraperitoneal routes. It is
contemplated that selective HTRA1 antagonists administered
systemically may be modified or formulated to target the selective
HTRA1 antagonist to the eye. Local modes of administration include,
for example, intraocular, intraorbital, subconjuctival,
intravitreal, subretinal or transcleral routes. It is noted,
however, that local routes of administration are preferred over
systemic routes because significantly smaller amounts of the
selective HTRA1 antagonist can exert an effect when administered
locally (for example, intravitreally) versus when administered
systemically (for example, intravenously). Furthermore, the local
modes of administration can reduce or eliminate the incidence of
potentially toxic side effects that may occur when therapeutically
effective amounts of a selective HTRA1 antagonist (i.e., an amount
of a selective HTRA1 antagonist sufficient to reduce (for example,
by 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%) the biological
activity or expression of HTRA1) are administered systemically.
[0079] Administration may be provided as a periodic bolus (for
example, intravenously or intravitreally) or as continuous infusion
from an internal reservoir (for example, from an implant disposed
at an intra- or extra-ocular location (see, U.S. Pat. Nos.
5,443,505 and 5,766,242)) or from an external reservoir (for
example, from an intravenous bag). The selective HTRA1 antagonist
may be administered locally, for example, by continuous release
from a sustained release drug delivery device immobilized to an
inner wall of the eye or via targeted transscleral controlled
release into the choroid (see, for example, PCT/US00/00207,
PCT/US02/14279, Ambati et al. (2000) INVEST. OPHTHALMOL. VIS. SCI.
41:1181-1185, and Ambati et al. (2000) INVEST. OPHTHALMOL. VIS.
SCI. 41:1186-1191). A variety of devices suitable for administering
a selective HTRA1 antagonist locally to the inside of the eye are
known in the art. See, for example, U.S. Pat. Nos. 6,251,090,
6,299,895, 6,416,777, 6,413,540, and 6,375,972, and
PCT/US00/28187.
[0080] The selective HTRA1 antagonist also may be administered in a
pharmaceutically acceptable carrier or vehicle so that
administration does not otherwise adversely affect the recipient's
electrolyte and/or volume balance. The carrier may comprise, for
example, physiologic saline or other buffer system.
[0081] In addition, it is contemplated that the selective HTRA1
antagonist may be formulated so as to permit release of the
selective HTRA1 antagonist over a prolonged period of time. A
release system can include a matrix of a biodegradable material or
a material which releases the incorporated selective HTRA1
antagonist by diffusion. The selective HTRA1 antagonist can be
homogeneously or heterogeneously distributed within the release
system. A variety of release systems may be useful in the practice
of the invention; however, the choice of the appropriate system
will depend upon the rate of release required by a particular drug
regime. Both non-degradable and degradable release systems can be
used. Suitable release systems include polymers and polymeric
matrices, non-polymeric matrices, or inorganic and organic
excipients and diluents such as, but not limited to, calcium
carbonate and sugar (for example, trehalose). Release systems may
be natural or synthetic. However, synthetic release systems are
preferred because generally they are more reliable, more
reproducible and produce more defined release profiles. The release
system material can be selected so that selective HTRA1 antagonists
having different molecular weights are released by diffusion
through or degradation of the material.
[0082] Representative synthetic, biodegradable polymers include,
for example: polyamides such as poly(amino acids) and
poly(peptides); polyesters such as polylactic acid), poly(glycolic
acid). poly(lactic-co-glycolic acid), and poly(caprolactone);
poly(anhydrides); polyorthoesters; polycarbonates; and chemical
derivatives thereof (substitutions, additions of chemical groups,
for example, alkyl, alkylene, hydroxylations, oxidations, and other
modifications routinely made by those skilled in the art),
copolymers and mixtures thereof. Representative synthetic,
non-degradable polymers include, for example: polyethers such as
poly(ethylene oxide), poly(ethylene glycol), and
poly(tetramethylene oxide); vinyl polymers-polyacrylates and
polymethacrylates such as methyl, ethyl, other alkyl, hydroxyethyl
methacrylate, acrylic and methacrylic acids, and others such as
poly(vinyl alcohol), poly(vinyl pyrolidone), and poly(vinyl
acetate); poly(urethanes); cellulose and its derivatives such as
alkyl, hydroxyalkyl, ethers, esters, nitrocellulose, and various
cellulose acetates; polysiloxanes; and any chemical derivatives
thereof (substitutions, additions of chemical groups, for example,
alkyl, alkylene, hydroxylations, oxidations, and other
modifications routinely made by those skilled in the art),
copolymers and mixtures thereof.
[0083] One of the primary vehicles currently being developed for
the delivery of ocular pharmacological agents is the
poly(lactide-co-glycolide) microsphere for intraocular injection.
The microspheres are composed of a polymer of lactic acid and
glycolic acid, which are structured to form hollow spheres. These
spheres can be approximately 15-30 .mu.m in diameter and can be
loaded with a variety of compounds varying in size from simple
molecules to high molecular weight proteins such as antibodies. The
biocompatibility of these microspheres is well established (see,
Sintzel et al. (1996) EUR. J. PHARM. BIOPHARM. 42: 358-372), and
microspheres have been used to deliver a wide variety of
pharmacological agents in numerous biological systems. After
injection, poly(lactide-co-glycolide) microspheres are hydrolyzed
by the surrounding tissues, which cause the release of the contents
of the microspheres (Zhu et al. (2000) NAT. BIOTECH. 18: 52-57). As
will be appreciated, the in vivo half-life of a microsphere can be
adjusted depending on the specific needs of the system.
[0084] The type and amount of selective HTRA1 antagonist
administered may depend upon various factors including, for
example, the age, weight, gender, and health of the individual to
be treated, as well as the type and/or severity of glaucoma to be
treated. As with the modes of administration, it is contemplated
that the optimal selective HTRA1 antagonists and dosages of those
selective HTRA1 antagonists may be determined empirically.
[0085] By way of example, protein-, peptide- or nucleic acid-based
selective HTRA1 antagonists can be administered at doses ranging,
for example, from about 0.001 to about 500 mg/kg, optionally from
about 0.01 to about 250 mg/kg, and optionally from about 0.1 to
about 100 mg/kg. Nucleic acid-based selective HTRA1 antagonists may
be administered at doses ranging from about 1 to about 20 mg/kg
daily. Furthermore, antibodies that are selective HTRA1 antagonists
may be administered intravenously at doses ranging from about 0.1
to about 5 mg/kg once every two to four weeks. With regard to
intravitreal administration, the selective HTRA1 antagonists, for
example, antibodies, may be administered periodically as boluses in
dosages ranging from about 10 .mu.g to about 5 mg/eye, and
optionally from about 100 .mu.g to about 2 mg/eye. With regard to
transcleral administration, the selective HTRA1 antagonists may be
administered periodically as boluses in dosages ranging from about
0.1 .mu.g to about 1 mg/eye, and optionally from about 0.5 .mu.g to
about 0.5 mg/eye.
[0086] The present invention, therefore, includes the use of a
selective HTRA1 antagonists in the preparation of a medicament for
treating neovascular AMD. The selective HTRA1 antagonist or
antagonists may be provided in a kit which optionally may comprise
a package insert with instructions for how to treat the patient
with, or at risk of developing, neovascular AMD. For each
administration, the selective HTRA1 antagonist may be provided in
unit-dosage or multiple-dosage form.
[0087] Throughout the description, where compositions are described
as having, including, or comprising specific components, or where
processes are described as having, including, or comprising
specific process steps, it is contemplated that compositions of the
present invention also consist essentially of, or consist of, the
recited components, and that the processes of the present invention
also consist essentially of, or consist of, the recited processing
steps. Further, it should be understood that the order of steps or
order for performing certain actions are immaterial so long as the
invention remains operable. Moreover, two or more steps or actions
may be conducted simultaneously.
[0088] In light of the foregoing description, the specific
non-limiting examples presented below are for illustrative purposes
and not intended to limit the scope of the invention in any
way.
EXAMPLES
Example 1
Variants in the HTRA1 Gene Alter the Risk of Neovascular AMD
[0089] This Example describes the elucidation of alleles either
conferring protection to, or increasing the risk of, the
development of AMD.
[0090] Reports have not been in agreement as to which common
variants in the chromosome 10q26 region increase risk of developing
AMD, the most common cause of blindness in those over age 50.
Twenty-three SNPs were studied in the PLEKHA1/LOC387715/HTRA1
region in 134 extremely discordant sibpairs (268 subjects) where
one member had neovascular AMD. Data from this cohort identified
several significant variants in this region, including genotypes
that reduced risk of developing AMD. Many SNPs, including the
previously identified variants rs10490924 and rs11200638, defined
two significant haplotypes associated with increased risk of
developing neovascular AMD. The coding HTRA1 SNP rs2293870, not
part of the significant haplotypes containing rs10490924 and
rs11200638, showed a strong association with neovascular AMD
susceptibility. Independent of the complement factor H(CFH) gene
Y402H genotype (a variant of which has been identified as a risk
factor for AMD) or smoking history, an individual's risk of
developing AMD could be increased or decreased depending on their
genotype or haplotype in the 10q26 region.
[0091] Wet or neovascular AMD is characterized by the growth of
abnormal new blood vessels beneath the retina that can cause severe
and rapid vision loss due to hemorrhage and exudation. It is this
more advanced form that is responsible for the majority of
debilitating vision loss due to AMD. In the U.S., it is predicted
that about three million individuals over the age of 50 years will
have advanced AMD in at least one eye by 2020.
[0092] Methods have yet to be refined that determine which
individuals are at highest risk of vision loss due to advanced AMD
prior to the development of any signs of the disease. The
identification of allelic variants or biomarkers can help to
predict risk of the more advanced stages of AMD. Although the CFH
Y402H variant on 1q32 appears to be the most consistently
associated genetic risk factor with AMD (Klein, R. J. et al.
Complement factor H polymorphism in age-related macular
degeneration. Science (2005) 308, 385-389; Edwards, A. O. et al.
Complement factor H polymorphism and age-related macular
degeneration. Science (2005) 308, 421-424; Haines, J. L. et al.
Complement factor H variant increases the risk of age-related
macular degeneration. Science (2005) 308, 419-421; Zareparsi, S. et
al. Strong Association of the Y402H Variant in Complement Factor H
at 1q32 with Susceptibility to Age-Related Macular Degeneration.
Am. J. Hum. Genet. (2005) 77; Hageman, G. S. et al. A common
haplotype in the complement regulatory gene factor H(HF1/CFH)
predisposes individuals to age-related macular degeneration. Proc.
Natl. Acad. Sci. (2005) U.S.A 102[20], 7227-7232), the 10q26 region
where the genes PLEKHA1, LOC387715, HTRA1 reside adjacent to one
another (FIG. 7), appears to be the most strongly associated
overall with AMD susceptibility (Fisher, S. A. et al. Meta-analysis
of genome scans of age-related macular degeneration. Hum. Mol.
Genet. (2005) 14, 2257-2264). While many reports have demonstrated
that variant rs10490924 in hypothetical LOC387715 is associated
with all types of AMD (Jakobsdottir, J. et al. Susceptibility genes
for age-related maculopathy on chromosome 10q26. Am. J. Hum. Genet.
(2005) 77[389], 407; Rivera, A. et al. Hypothetical LOC387715 is a
second major susceptibility gene for age-related macular
degeneration, contributing independently of complement factor H to
disease risk. Hum. Mol. Genet. (2005) 14, 3227-3236; Schmidt. S. et
al. Cigarette smoking strongly modifies the association of
LOC387715 and age-related macular degeneration. Am. J. Hum. Genet.
(2006) 78, 852-864; Conley, Y. P. et al. CFH, ELOVL4, PLEKHA1 and
LOC387715 genes and susceptibility to age-related maculopathy:
AREDS and CHS cohorts and meta-analyses. Hum. Mol. Genet. (2006)
15, 3206-3218), it was recently shown that SNP rs11200638 in the
HTRA1 promoter region, in linkage disequilibrium (LD) with
rs10490924, was likely the causal variant (Dewan, A. et al. HTRA1
promoter polymorphism in wet age-related macular degeneration.
Science (2006) 314, 989-992; Yang, Z. et al. A variant of the HTRA1
gene increases susceptibility to age-related macular degeneration.
Science (2006) 314, 992-993; Cameron, D. J. et al. HTRA1 variant
confers similar risks to geographic atrophy and neovascular
age-related macular degeneration. Cell Cycle (2007) 6, 1122-1125).
Moreover, data from the Age Related Eye Disease Study (AREDS)
showed a significant association between SNP rs1045216 in PLEKHA1
and increased risk of developing neovascular AMD (Conley, Y. P. et
al. CFH, ELOVL4, PLEKHA1 and LOC387715 genes and susceptibility to
age-related maculopathy: AREDS and CHS cohorts and meta-analyses.
Hum. Mol. Genet. (2006) 15, 3206-3218).
[0093] A phenotypically well defined cohort of extremely discordant
sibpairs was used in the study presented here (Risch, N. &
Zhang, H. Extreme discordant sib pairs for mapping quantitative
trait loci in humans. Science (1995) 268, 1584-1589) to identify
the contribution that allelic risk factors such as those reported
in the 10q26 region make independently, and in combination with,
the factors most consistently associated with AMD susceptibility:
CFH Y402H genotype (Klein, R. J. et al. Complement factor H
polymorphism in age-related macular degeneration. Science (2005)
308, 385-389; Edwards, A. O. et al. Complement factor H
polymorphism and age-related macular degeneration. Science (2005)
308, 421-424; Haines, J. L. et al. Complement factor H variant
increases the risk of age-related macular degeneration. Science
(2005) 308, 419-421; Zareparsi, S. et al. Strong Association of the
Y402H Variant in Complement Factor H at 1q32 with Susceptibility to
Age-Related Macular Degeneration. Am. J. Hum. Genet. (2005) 77;
Hageman, G. S. et al. A common haplotype in the complement
regulatory gene factor H(HF1/CFH) predisposes individuals to
age-related macular degeneration. Proc. Natl. Acad. Sci. (2005)
U.S.A 102[20], 7227-7232) and smoking (Thornton, J. et al. Smoking
and age-related macular degeneration: a review of association. Eye
(2005) 19, 935-944).
[0094] Although the SNPs are known, their associations with risk of
developing any type of age-related macular degeneration heretofore
have not been determined. It is believed that no other protective
variants have been identified in this gene. When smoking history
and Complement Factor H(CFH) were included in the model with any of
these variants, the significance and effect size were not modified
with respect to the risk of developing age-related macular
degeneration.
[0095] HTRA1 is a heat shock protein that encodes a serine protease
that is purported to indirectly regulate insulin. The protective
variant at rs2672598 identified in the study is located in the
promoter region of HTRA1, near two other variants (at rs10490924
and rs11200638) that have recently been reported to be associated
with increased risk of developing AMD. The results from the study
presented here also confirmed these observations. Additionally,
there are two risk variants, at rs2293870 and rs1049331 that are
both located in exon 1 of the HTRA1 gene. rs1049331 is located
between rs2672598 and rs2293870: 588 bp downstream of rs2672598 and
6 bp upstream of rs2293870.
Results
[0096] Thirty-three megabases of the 10q26 region (FIG. 7) were
genotyped in samples from 134 unrelated patients with neovascular
AMD (AREDS Scale, level 4b) who had one sibling with normal maculae
and was past the age at which the affected sibling was diagnosed
with neovascular AMD (AREDS Scale, level 0-1) (FIG. 8 and Methods)
(Davis, M. D. et al. The Age-Related Eye Disease Study severity
scale for age-related macular degeneration: AREDS Report No. 17.
Arch. Ophthalmol. (2005) 123, 1484-1498). A combination of direct
sequencing and analysis of eight highly polymorphic microsatellite
markers tightly linked to the genes of interest (See Methods) was
used to validate previous findings and possibly identify novel
variants in the 10q26 region. For each of the 268 Caucasian
subjects, all over the age of 50 years, exon 12 of PLEKHA1, the
entire putative coding region of LOC387715, and the promoter region
and entire coding region of HTRA1 were directly sequenced. All
primer pairs were designed to encompass exon/intron boundaries
(FIG. 9 and Methods).
[0097] Twenty-three variants were identified including deletions.
Only the SNPs that had a minor allele frequency of .gtoreq.5% in
both affected and unaffected siblings were used for statistical
analysis (n=19) (FIG. 10). Six SNPs showed significant association
with AMD risk after applying a Bonferonni correction from the
results of the family based association test (FBAT) (FIG. 2).
Genotype and allele frequencies for each of these SNPs are given in
FIGS. 11A and 11B. No significant deviations from Hardy-Weinberg
equilibrium for any of the variants studied were observed in either
affected or unaffected siblings, indicating unlikely data
contamination. FBAT demonstrated that the variant most strongly
associated with AMD risk was a synonymous change in exon 1 of
HTRA1, triallelic SNP (rs2293870) (P<10.sup.-4), which, prior to
this study, had not been shown to be associated with the risk of
developing AMD. Additionally, novel significant associations with
AMD susceptibility for an intronic deletion in hypothetical locus
LOC387715, SNP rs10664316 (P<10.sup.-3), the HTRA1 promoter SNP
rs2672598 (P<10.sup.-2), and another synonymous HTRA1 SNP,
rs1049331 (P<10.sup.-3), (FIG. 2) were identified. In agreement
with others, FBAT demonstrated that SNPs rs10490924
(P<10.sup.-3) and rs11200638 (P<10.sup.-3) were significantly
associated with AMD risk while no significant association was
observed between neovascular AMD and PLEKHA1 (Dewan, A. et al.
HTRA1 promoter polymorphism in wet age-related macular
degeneration. Science (2006) 314, 989-992; Yang, Z. et al. A
variant of the HTRA1 gene increases susceptibility to age-related
macular degeneration. Science (2006) 314, 992-993). Except for SNP
rs2293870, all significant SNPs were part of the same haplotype
block as depicted in the linkage disequilibrium (r.sup.2) plot in
FIG. 1. SNP rs10490924 was in high LD with HTRA1 SNPs rs11200638
and rs1049331 (r.sup.2>0.90). Although intronic SNP rs10664316
was not in high linkage disequilibrium with any other SNPs
(r.sup.2<0.50) examined, this did not preclude it from being a
biomarker that in fact could be biologically associated with AMD
susceptibility (Greally, J. M. Genomics: Encyclopaedia of humble
DNA. Nature (2007) 447, 782-783; The ENCODE Project Consortium,
Identification and analysis of functional elements in 1% of the
human genome by the ENCODE pilot project. Nature (2007) 447,
799-816). Linkage analysis supported the findings of SNP
association, as identity-by-state (IBS) scores calculated for each
of the eight highly heterozygous microsatellite markers analyzed in
this region demonstrated that D10S1656 was significantly associated
with neovascular AMD (P<10.sup.-15) (FIG. 3 and Methods).
[0098] FBAT demonstrated that two haplotypes (h2 and h6) in the
10q26 region were significantly associated with AMD risk (FIG. 4).
SNPs rs10490924, rs10664316, rs11200638, rs2672598 and rs1049331
were more strongly associated with increased AMD risk as part of
the most significant haplotype, h2 (P<10.sup.-4), than when
examined individually in FBAT analysis (FIG. 2).
[0099] Multiple conditional logistic regression (CLR) analyses were
conducted to determine how each of the six significant SNPs
contributed to the risk of neovascular AMD while adjusting for CFH
Y402H genotype and smoking and, moreover, to examine if
interactions existed between each SNP, CFH and/or smoking (FIG. 3).
For each significant SNP, models were created to examine the minor
allele in unaffected siblings in both the homozygous and
heterozygous states versus having the common allele in the
homozygous state. When smoking and CFH were included in each model
with any of the significant variants, the significance and effect
size were not modified with respect to AMD risk. Multiple CLR
demonstrated that the most significantly associated variants with
increased AMD risk were HTRA1 SNPs rs1200638 (AA vs. GG: OR: 98.41;
CI: 13.45, 720.08; p<10.sup.-5; AG vs. GG: OR: 6.05; CI: 2.13,
17.21; p<10.sup.3) and rs1049331 (TT vs. CC: OR: 105.52; CI:
14.64, 760.5; p<10.sup.-5; TC vs CC: OR: 5.97; CI: 2.10, 16.99;
p<10.sup.-3). Multiple CLR demonstrated that variants associated
with increased risk of developing AMD were rs10490924 (TT vs. GG:
OR: 61.91; CI: 10.89, 352.01; p<10.sup.-5; TG vs. GG: OR: 5.32;
CI: 1.82, 15.52; p<10.sup.-2) and rs2293870 (CC, CT or TT vs.
GG: OR: 25.97; CI: 6.32, 106.66; p<10.sup.-5; CG or TG vs. GG:
OR: 5.89; CI: 1.96, 17.71; p<10.sup.-2). Multiple CLR also
demonstrated that the variants associated with reduced risk of
developing AMD were rs10664316 (delAT/delAT vs. AT/AT: OR: 0.09;
CI: 0.02, 0.36; p<10.sup.-3; delAT/AT vs. AT/AT: OR: 0.30; CI:
0.13, 0.72; p<10.sup.-2), and rs2672598 (TT vs. CC: OR: 0.03;
CI: 0.01, 0.14; p<10.sup.-4; TC vs. CC: OR: 0.12; CI: 0.04,
0.39; p<10.sup.-3). The HTRA1 SNP rs2672598 conferred a 33-fold
reduced risk of developing AMD homozygously (p<10.sup.-4) and
8-fold heterozygously (p<10.sup.-3). The HTRA1 SNP rs1049331
conferred a 106-fold increased risk of developing AMD homozygously
(p<10.sup.-5) and 6-fold heterozygously (p<10.sup.-3). The
HTRA1 SNP rs2293870 conferred a 26-fold increased risk of
developing AMD homozygously (p<10.sup.-5) and 6-fold
heterozygously (p<10.sup.-2), (FIG. 5). The minor alleles in the
homozygous state when compared to the common alleles in the
homozygous state for SNPs rs10490924, rs11200638, rs1049331,
rs2672598, and rs2293870, more strongly influenced AMD risk than
the CFH Y402H C allele in the homozygous state (vs. TT). As
previously reported (DeAngelis, M. M. et al. Cigarette Smoking,
CFH, APOE, ELOVL4 and Risk of Neovascular Age-Related Macular
Degeneration. Archives of Ophthalmology (2007) January;
125(1):49-54) and as can be seen on the expanded population in FIG.
5, the presence of one C allele for CFH Y402H was not significantly
associated with neovascular AMD risk (P>0.2). Together, the
findings in this study validated that the 10q26 region was more
strongly associated with neovascular AMD than the 1q32 region where
CFH resides (Dewan, A. et al. HTRA1 promoter polymorphism in wet
age-related macular degeneration. Science (2006) 314, 989-992;
Yang, Z. et al. A variant of the HTRA1 gene increases
susceptibility to age-related macular degeneration. Science (2006)
314, 992-993; Shuler, R. K., Jr. et al. Neovascular age-related
macular degeneration and its association with LOC387715 and
complement factor H polymorphism. Arch. Ophthalmol. (2007) 125,
63-67).
[0100] For each of the significant SNPs in the 10q26 region, there
were no interactions between the homozygous or heterozygous
genotypes and smoking, nor between the homozygous and heterozygous
genotypes and CFH CC genotype.
[0101] The population attributable risk (PAR) for not having one
protective minor allele at rs2672598 or being homozygous for CFH
Y402H or smoking .gtoreq.10 pack-years was 75%. The combination of
risk factors including having the risk allele for any of the SNPs
rs10490924, rs11200638, rs1049331, or rs2293870, or being
homozygous for CFH Y402H, or smoking .gtoreq.10 pack-years
explained about 80% of the risk in the total population (FIGS. 6A
and 6B).
[0102] The functional effect of the SNPs newly identified as
significantly associated with AMD susceptibility was assessed.
Given that SNP rs10664316 is located 4,782 bp upstream of the first
HTRA1 coding ATG and is not well conserved (web site at
www.ensembl.org/gene=ENSG00000166033), attention was focused on the
SNPs identified in the promoter and exon 1 of the HTRA1 gene. From
the computer program MapInspector (web site at www.genomatrix.de/),
it appears that the protective allele for SNP rs2672598 creates a
binding site for the transcription factor ELK-1. ELK-1 activity was
reported to be impaired in a patient with a premature form of aging
and insulin resistance (Knebel, B., Avci, H., Bullmann, C., Kotzka,
J., & Muller-Wieland, D. Reduced phosphorylation of
transcription factor Elk-1 in cultured fibroblasts of a patient
with premature aging syndrome and insulin resistance. Exp. Clin.
Endocrinol. Diabetes (2005) 113, 94-101). If the risk allele of the
promoter SNP rs11200638 results in increased expression of HTRA1
(Dewan, A. et al. HTRA1 promoter polymorphism in wet age-related
macular degeneration. Science (2006) 314, 989-992; Yang, Z. et al.
A variant of the HTRA1 gene increases susceptibility to age-related
macular degeneration. Science (2006) 314, 992-993), then it is
contemplated that the minor allele of rs2672598 exerts a protective
effect by enabling the binding of ELK-1, which could downregulate
the expression of HTRA1. SNP rs2293870 is located in one of the
HTRA1 binding domains for insulin like growth factors (IGFs) (web
site at http://smart.embl-heidelberg.de/smart/do) (Clausen, T.,
Southan, C., & Ehrmann, M. The HtrA family of proteases:
implications for protein composition and cell fate. Mol. Cell
(2002) 10, 443-455). IGF has been implicated in other ocular
conditions characterized by neovascularization such as diabetic
retinopathy and retinopathy of prematurity (Chen, J. & Smith,
L. E. Retinopathy of prematurity. Angiogenesis. (2007) 10,
133-140). Therefore, the effect of rs2293870 on a regulatory
pathway involving HTRA1 and IGFs has biologic plausibility for
AMD.
[0103] In summary, in a population of extremely discordant sibling
pairs, variants in the HTRA1 region were newly identified that both
increase and decrease risk of developing neovascular AMD. These
findings validate the fact that HTRA1 is the likely candidate gene
in the 10q26 region. Although other variants in the hypothetical
LOC387715 locus were identified that may ultimately play a role in
AMD susceptibility (Greally, J. M. Genomics: Encyclopaedia of
humble DNA. Nature (2007) 447, 782-783; The ENCODE Project
Consortium, Identification and analysis of functional elements in
1% of the human genome by the ENCODE pilot project. Nature (2007)
447, 799-816), the newly described variants in HTRA1 have
contemplated functional regulatory effects, suggesting etiologic
mechanisms. The study presented here demonstrated that HTRA1
variants influence risk independent of CFH genotype and smoking,
supporting the role for HTRA1 in a distinct pathway underlying AMD
pathogenesis.
Methods
Patient Population
[0104] The protocol was reviewed and approved by the Institutional
Review Board at the Massachusetts Eye & Ear Infirmary (MEEI)
and conforms to the tenets of the Declaration of Helsinki. Eligible
patients were enrolled in this study after they gave informed
consent either in person, over the phone, or through the mail,
before answering questions to a standardized questionnaire and
donating 10 to 50 ml of venous blood.
[0105] Index patients with neovascular AMD were recruited from the
Retina Service of the MEEI and the Associated Retina Consultants at
the Beaumont Hospital (Royal Oak, Mich.). Details of the
recruitment and the clinical description of the patients are
described elsewhere (DeAngelis, M. M. et al. Extremely discordant
sib-pair study design to determine risk factors for neovascular
age-related macular degeneration. Arch. Ophthalmol. (2004) 122,
575-580). In brief, all index patients had the neovascular form of
AMD in at least one eye, defined by subretinal hemorrhage,
fibrosis, or fluorescein angiographic presence of
neovascularization documented at the time of, or prior to,
enrollment in the study (AMD level "4b" on the AREDS scale). The
unaffected siblings had normal maculae at an age older than that at
which the index patient was first diagnosed with neovascular AMD.
Normal maculae (defined as the zone centered at the foveola and
extending 2 disc diameters, or 3000 microns, in radius) fulfilled
the following criteria: 0-5 small drusen, (all less than 63 microns
in diameter), no pigment abnormalities, no geographic atrophy, and
no neovascularization (as defined previously (The Age-Related Eye
Disease Study system for classifying age-related macular
degeneration from stereoscopic color fundus photographs: the
Age-Related Eye Disease Study Report Number 6. Am. J. Ophthalmol.
(2001) 132, 668-681; Davis, M. D. et al. The Age-Related Eye
Disease Study severity scale for age-related macular degeneration:
AREDS Report No. 17. Arch. Ophthalmol. (2005) 123, 1484-1498)) (AMD
levels "0" or "1" on the AREDS scale). Disease status of every
participant was confirmed by at least two investigators by
evaluation of fundus photographs or fluorescein angiograms except
when one of the investigators directly examined an unaffected
sibling during a home visit (n=6 cases).
Smoking Exposure
[0106] A standardized questionnaire was administered to all
eligible participants in person or over the phone to ascertain
smoking exposure, with the age of the index patient at the time of
the fundus photographs as cutoff reference age for smoking exposure
for all members in a sibship. In most cases the diagnosis of AMD
was made simultaneously with the diagnosis of neovascular AMD. If a
participant ever smoked, the age was recorded when they started
smoking, the age when they quit smoking (if they did quit), and the
number of packs of cigarettes smoked per day, on average. Based on
the responses, the number of pack-years of cigarettes smoked was
calculated for each smoker. Participants who smoked less than 100
cigarettes during their lifetime (i.e., less than 1/73 of a
pack-year) were categorized as having never smoked. A pack-year was
defined as one pack of cigarettes per day for one year, with one
pack defined as twenty cigarettes. For statistical analysis (see
below), the reference cutoff for smoking was defined as greater
than or equal to 10 pack-years versus less than 10 pack-years. With
this cutoff, the subjects in this study were divided into two
approximately equal groups (DeAngelis, M. M. et al. Cigarette
Smoking, CFH, APOE, ELOVL4 and Risk of Neovascular Age-Related
Macular Degeneration. Archives of Ophthalmology (2007) January;
125(1):49-54).
Genotyping Analysis
[0107] Leukocyte DNA was either purified by using standard
phenol-chloroform or DNAzol (Invitrogen Corporation, Carlsbad,
Calif.) extraction protocols. Previously reported oligonucleotide
primers were used to amplify the coding region and flanking
intronic sequences of exon 12 for PLEKHA1 (Rivera, A. et al.
Hypothetical LOC387715 is a second major susceptibility gene for
age-related macular degeneration, contributing independently of
complement factor H to disease risk. Hum. Mol. Genet. (2005) 14,
3227-3236), exon 9 of CM (Haines, J. L. et al. Complement factor H
variant increases the risk of age-related macular degeneration.
Science (2005) 308, 419-421) and the promoter sequence for HTRA1
(Dewan, A. et al. HTRA1 promoter polymorphism in wet age-related
macular degeneration. Science (2006) 314, 989-992). For the
putative LOC387715 gene region (including both exons) and the 9
exons of HTRA1, oligonucleotide primers were selected using the
Primer3 program (primer3.sourceforge.net/) to encompass the entire
coding region and flanking intronic sequences (FIG. 9).
[0108] For all four genes, the polymerase chain reaction was used
to amplify genomic DNA fragments from 20 ng of leukocyte DNA in a
solution of 10.times.PCR buffer containing 25 mM of MgCl.sub.2, 0.2
mM each of dATP, dTTP, dGTP, and CTP, and 0.5 units of Taq DNA
polymerase (USB Corporation, Cleveland, Ohio). For the PLEKHA1 and
HTRA1 genes, 5 M Betaine was added to each PCR reaction
(Sigma-Aldrich, St. Louis, Mo.). The temperatures used during the
polymerase chain reaction were as follows: for PLEKHA1 and HTRA1,
95.degree. C. for 5 minutes followed by 35 cycles of 60.degree. C.
for 30 seconds, 72.degree. C. for 30 seconds and 95.degree. C. for
30 seconds, with a final annealing at 60.degree. C. for 1.5 minutes
and extension of 72.degree. C. for 5 minutes; for LOC387715,
95.degree. C. for 5 minutes followed by 35 cycles of 62.degree. C.
for 30 seconds, 72.degree. C. for 30 seconds and 95.degree. C. for
30 seconds, with a final annealing at 62.degree. C. for 1.5 minutes
and extension of 72.degree. C. for 5 minutes; for CFH, 95.degree.
C. for 5 minutes followed by 35 cycles of 56.degree. C. for 30
seconds, 72.degree. C. for 30 seconds and 95.degree. C. for 30
seconds, with a final annealing at 56.degree. C. for 1.5 minutes
and extension of 72.degree. C. for 5 minutes; for sequencing
reactions, PCR products were digested according to manufacturer's
protocol with ExoSAP-IT (USB Corporation, Cleveland, Ohio) then
were subjected to a cycle sequencing reaction using the Big Dye
Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster
City, Calif.) according to manufacturer's protocol. Products were
purified with Performa DTR Ultra 96-well plates (Edge Biosystems,
Gaithersburg, Md.) in order to remove excess dye terminators.
Samples were sequenced on an ABI Prism 3100 DNA sequencer (Applied
Biosystems, Foster City, Calif.). Electropherograms generated from
the ABI Prism 3100 were analyzed using the Lasergene DNA and
protein analysis software (DNASTAR, Inc., Madison, Wis.).
Electropherograms were read by two independent evaluators without
knowledge of the subject's disease status. All patients were
sequenced in the forward direction (5' to 3'), unless variants,
polymorphisms, or mutations were identified, in which case
continuation was obtained in some cases by sequencing in the
reverse direction.
Genotyping of Microsatellite Markers
[0109] Eight highly heterozygous microsatellite markers spanning 33
megabases of the 10q26 region were analyzed (FIG. 3 and FIG. 7),
these markers included several that were tightly linked to PLEKHA1,
LOC387715 and HTRA1 (FIG. 9). All markers were fluorescently
labeled with either HEX or FAM on the 5' end of the reverse primer
and an additional sequence of CTGTCTT was added to the 5' of the
forward primer. The polymerase chain reaction was used to amplify
genomic DNA fragments from 20 ng of leukocyte DNA in a solution of
10.times.PCR buffer containing 25 mM of MgCl.sub.2, 0.2 mM each of
dATP, dTTP, dGTP, and dCTP, and 0.5 units of Taq DNA polymerase
(USB Corporation, Cleveland, Ohio). The temperatures used during
the polymerase chain reaction were as follows: 95.degree. C. for 5
minutes followed by 35 cycles of 54-60.degree. C. (specific to
primer pair) for 30 seconds, 72.degree. C. for 30 seconds and
95.degree. C. for 30 seconds, with a final annealing at
54-60.degree. C. (specific to primer pair) for 1.5 minutes and
extension of 72.degree. C. for 5 minutes. PCR products were diluted
1:20 for markers labeled with FAM and 1:10 for markers labeled with
HEX. Samples were pooled according to product size and denatured
before being genotyped on the ABI 3730.times.1 DNA Analyzer
(Applied Biosystems, Foster City, Calif.). Data was then analyzed
using ABI's Genemapper v3.7 software for analysis, which
interrogated the quality of the size standard and made the
appropriate genotype calls based on size. For quality control
purposes, all genotypes were then evaluated manually.
Statistical Analyses
[0110] The program FBAT (biosun1.harvard.edu/.about.fbat/fbat.htm)
which tests for Family Based Association was used to evaluate the
effect of each SNP individually on risk of AMD (FIG. 2) (Horvath,
S. et al. Family-based tests for associating haplotypes with
general phenotype data: application to asthma genetics. Genet.
Epidemiol. (2004) 26, 61-69). SNPs were only included for analysis
in FBAT if the minor allele frequency (MAF) in the unaffected, and
separately in the affected, siblings was greater than 5% and the
number of informative families was not less than 4 (FIG. 2). A
Bonferroni correction was applied to the point-wise P values that
were calculated for each allele of the fourteen SNPs that met these
criteria.
[0111] Haploview (web site at www.broad.mit.edu/mpg/haploview/) was
used to generate the linkage disequilibrium plot (FIG. 1) among the
nineteen identified SNPs that had a MAF greater than 5% (Barrett,
J. C., Fry, B., Maller, J., & Daly, M. J. Haploview: analysis
and visualization of LD and haplotype maps. Bioinformatics. (2005)
21, 263-265). Linkage disequilibrium (r.sup.2) between each of the
nineteen SNPs is depicted in FIG. 1. The haplotype blocks were
constructed by Haploview by using the method proposed by Gabriel
(Gabriel, S. B. et al. The structure of haplotype blocks in the
human genome. Science (2002) 296, 2225-2229). Individual haplotypes
were inferred and tested for association with AMD using FBAT
(Horvath, S. et al. Family-based tests for associating haplotypes
with general phenotype data: application to asthma genetics. Genet.
Epidemiol. (2004) 26, 61-69).
[0112] Conditional logistic regression (CLR) (SAS 9.1, www.sas.com)
was performed to identify factors associated with wet AMD.
Potential risk factors of interest, as defined above, were
evaluated initially one at a time. A multiple conditional logistic
regression model for each significant SNP in the 10q26 region was
built using those factors from the single factor model which
appeared to be associated with neovascular AMD with a p value less
than or equal to 0.1. CFH Y402H CT genotype was kept in the models,
although its p>0.1, to more precisely adjust the effect of CFH.
For each significant SNP, the minor allele (in unaffected siblings)
in both the homozygous and heterozygous states versus the common
allele in the homozygous state was examined in the model (FIG.
5).
[0113] Genotype and allele frequencies for all SNPs identified as
significant were calculated in the affected and separately in
unaffected siblings (FIGS. 11A and 11B). Deviation from
Hardy-Weinberg Equilibrium (HWE) was tested on each SNP using the
chi square test. Population Attributable Risk was calculated for
the significant SNPs that were identified from the FBAT and CLR
analysis for the 134 matched discordant sibpair data, where the
relative risk (RR) was approximated by the odds ratio (Armitage, P.
& Berry, G. Statistical methods in medical research (Blackwell
Scientific Publications, 1987) and was the proportion of cases
exposed to the factor for each significant SNP in the 10q26
region.
[0114] For linkage analysis of the eight microsatellite markers,
identity-by-state (IBS) scores were calculated from the number of
alleles shared between each pair, the index and the discordant
sibling, for each of the eight markers. Using heterozygosities for
each marker obtained from Map-O-Mat (compgen.rutgers.edu/mapomat/),
the expected IBS (null hypothesis of no linkage) was calculated and
then compared with the observed IBS values. A goodness of fit test
was applied to assess the significance of the difference between
the observed and expected distribution. Bonferonni Correction was
applied to the p values of the association tests on microsatellite
markers and AMD risk.
Example 2
Use of Selective HTRA1 Antagonists
[0115] It is contemplated that a variety of selective HTRA1
antagonists, including but not limited to (1) a substance that
selectively binds to HTRA1 and reduces the activity of HTRA1, and
(2) a substance that reduces the HTRA1 gene expression, will be
useful to slow down, stop, or reverse the progression of
age-related macular degeneration. Examples of these compounds are
listed herein.
[0116] For example, it is contemplated that an anti-HTRA1 antibody
that binds to and reduces the activity of HTRA1 can be administered
to an animal using techniques known to those skilled in the art so
as to slow down, stop, or reverse the progression of age-related
macular degeneration.
INCORPORATION BY REFERENCE
[0117] The entire content of each patent and non-patent document
disclosed herein is expressly incorporated herein by reference for
all purposes.
EQUIVALENTS
[0118] The invention may be embodied in other specific forms
without departing from the spirit or essential characteristics
thereof. The foregoing embodiments are therefore to be considered
in all respects illustrative rather than limiting on the invention
described herein. Scope of the invention is thus indicated by the
appended claims rather than by the foregoing description, and all
changes which come within the meaning and range of equivalency of
the claims are intended to be embraced therein.
Sequence CWU 1
1
42141DNAHomo sapiens 1ctgcccggcc cagtccgagc ytcccgggcg ggcccccagt c
41241DNAHomo sapiens 2gactgggggc ccgcccggga rgctcggact gggccgggca g
41341DNAHomo sapiensmisc_feature(21)..(21)Wherein n is presence of
AT or deletion of AT 3taaaatatcg tcatgtgtct nttaaaaatg catattacta a
41441DNAHomo sapiensmisc_feature(21)..(21)Wherein n is presence of
TA or deletion of TA. 4ttagtaatat gcatttttaa nagacacatg acgatatttt
a 41541DNAHomo sapiens 5tcggcgcctt tggccgccgg btgcccagac cgctgcgagc
c 41641DNAHomo sapiens 6ggctcgcagc ggtctgggca vccggcggcc aaaggcgccg
a 41741DNAHomo sapiens 7ggccgctcgg cgcctttggc ygccgggtgc ccagaccgct
g 41841DNAHomo sapiens 8cagcggtctg ggcacccggc rgccaaaggc gccgagcggc
c 41941DNAHomo sapiens 9cacactccat gatcccagct kctaaaatcc acactgagct
c 411041DNAHomo sapiens 10gagctcagtg tggattttag magctgggat
catggagtgt g 411141DNAHomo sapiens 11cgcggacgct gccttcgtcc
rgccgcagag gccccgcggt c 411241DNAHomo sapiens 12gaccgcgggg
cctctgcggc yggacgaagg cagcgtccgc g 411319DNAArtificial
SequencePLEKHA1 exon 12 Forward Primer Chemically Synthesized
13ctgaccgtgt ctgactgcc 191420DNAArtificial SequencePLEKHA1 exon 12
Reverse Primer Chemically Synthesized 14ccccttatca tctttggcta
201520DNAArtificial SequenceLOC387715 exon 1 Forward Primer
Chemically Synthesized 15ttgtgtgacg ggaaaagaca 201620DNAArtificial
SequenceLOC387715 exon Reverse Sequence Chemically Synthesized
16aagcacctga aggctggtta 201724DNAArtificial SequenceLOC387715 exon
2 Forward Primer Chemically Synthesized 17ttgttacaaa aggaatggaa
tgtc 241821DNAArtificial SequenceLOC387715 exon 2 Reverse Primer
Chemically Synthesized 18ggaatgcagt gacagagagg a
211920DNAArtificial SequenceHTRA1 Promoter a Forward Primer
Chemically Synthesized 19atgccaccca caacaacttt 202020DNAArtificial
SequenceHTRA1 Promoter a Reverse Primer Chemically Synthesized
20ggttctctcg ctgagattcg 202121DNAArtificial SequenceHTRA1 Promoter
b Forward Primer Chemically Synthesized 21cggatgcacc aaagattctc c
212222DNAArtificial SequenceHTRA1 Promoter b Reverse Primer
Chemically Synthesized 22ttcgcgtcct tcaaactaat gg
222318DNAArtificial SequenceHTRA1 exon 1a Forward Primer Chemically
Synthesized 23gaggccctcc tgcactct 182419DNAArtificial SequenceHTRA1
exon 1a Reverse Primer Chemically Synthesized 24caggttggcg
taggtgttg 192518DNAArtificial SequenceHTRA1 exon 1b Forward Primer
Chemically Synthesized 25gagtcgccat gcagatcc 182618DNAArtificial
SequenceHTRA1 exon 1b Reverse Primer Chemically Synthesized
26cgagctggga tggagaga 182720DNAArtificial SequenceHTRA1 exon 2
Forward Primer Chemically Synthesized 27aaacaaactt gggccatcag
202819DNAArtificial SequenceHTRA1 exon 2 Reverse Primer Chemically
Synthesized 28ttgctagtgg cggtgaaag 192920DNAArtificial
SequenceHTRA1 exon 3 Forward Primer Chemically Synthesized
29taggtgtgtg tggctgttgc 203020DNAArtificial SequenceHTRA1 exon 3
Reverse Primer Chemically Synthesized 30aagttttcct gagccccttc
203120DNAArtificial SequenceHTRA1 exon 4 Forward Primer Chemically
Synthesized 31cgcagcaaag ggatgttagt 203220DNAArtificial
SequenceHTRA1 exon 4 Reverse Primer Chemically Synthesized
32gaatccacat ggcttggtct 203320DNAArtificial SequenceHTRA1 exon 5
Forward Primer Chemically Synthesized 33ccaggcaggg acatagattg
203420DNAArtificial SequenceHTRA1 exon 5 Reverse Primer Chemically
Synthesized 34tcagcagccc aggagattta 203520DNAArtificial
SequenceHTRA1 exon 6 Forward Primer Chemically Synthesized
35ggtgtcctga tgcctctctc 203620DNAArtificial SequenceHTRA1 exon 6
Reverse Primer Chemically Synthesized 36tgccatgatc agaggacaaa
203720DNAArtificial SequenceHTRA1 exon 7 Forward Primer Chemically
Synthesized 37gtccagacca ggatttgagc 203820DNAArtificial
SequenceHTRA1 exon 7 Reverse Primer Chemically Synthesized
38ccaaggctaa tgacctgtcc 203920DNAArtificial SequenceHTRA1 exon 8
Forward Primer Chemically Synthesized 39aggagaagac gggaactggt
204020DNAArtificial SequenceHTRA1 exon 8 Reverse Primer Chemically
Synthesized 40ctcgtggagc aaggactttt 204120DNAArtificial
SequenceHTRA1 exon 9/3'-UTR Forward Primer Chemically Synthesized
41ctgacccact gatggtttga 204220DNAArtificial SequenceHTRA1 exon
9/3'-UTR Reverse Primer Chemically Synthesized 42ctattccagc
agcccagagt 20
* * * * *
References