U.S. patent application number 13/722019 was filed with the patent office on 2013-05-09 for fungal peroxygenases and methods of application.
This patent application is currently assigned to NOVOZYMES A/S. The applicant listed for this patent is Novozymes A/S. Invention is credited to Martin Hofrichter, Martin Gunter Kluge, Marek Jan Pecyna, Karin Scheibner, Kirk Matthew Schnorr, Rene Ullrich.
Application Number | 20130115662 13/722019 |
Document ID | / |
Family ID | 39591196 |
Filed Date | 2013-05-09 |
United States Patent
Application |
20130115662 |
Kind Code |
A1 |
Pecyna; Marek Jan ; et
al. |
May 9, 2013 |
FUNGAL PEROXYGENASES AND METHODS OF APPLICATION
Abstract
The invention relates to polypeptides having peroxygenase
activity and compositions comprising such polypeptides, their
encoding polynucleotides, expression vectors and recombinant host
cells comprising such polynucleotides or vectors, methods of
producing the polypeptides, as well as methods of application and
uses thereof, including a process for enzymatic, regioselective
oxygenation of N-heterocycles of the general formula (I) to the
corresponding N-oxides of the formula (II), by converting
N-heterocycles of the formula (I) with a peroxidase polypeptide in
the presence of at least one oxidizing agent in a one-stage
reaction process.
Inventors: |
Pecyna; Marek Jan; (Halle,
DE) ; Ullrich; Rene; (Drebkau, DE) ; Schnorr;
Kirk Matthew; (Holte, DK) ; Scheibner; Karin;
(Jena, DE) ; Kluge; Martin Gunter; (Zittau,
DE) ; Hofrichter; Martin; (Zittau, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novozymes A/S; |
Bagsvaerd |
|
DK |
|
|
Assignee: |
NOVOZYMES A/S
Bagsvaerd
DK
|
Family ID: |
39591196 |
Appl. No.: |
13/722019 |
Filed: |
December 20, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12532870 |
Jul 15, 2010 |
8367387 |
|
|
PCT/EP2008/053798 |
Mar 31, 2008 |
|
|
|
13722019 |
|
|
|
|
Current U.S.
Class: |
435/122 ;
435/192; 435/252.3; 435/252.31; 435/252.33; 435/252.34; 435/252.35;
435/254.11; 435/254.2; 435/254.21; 435/254.22; 435/254.23;
435/254.3; 435/254.4; 435/254.5; 435/254.6; 435/254.7; 435/254.8;
435/320.1 |
Current CPC
Class: |
C12N 9/0065
20130101 |
Class at
Publication: |
435/122 ;
435/192; 435/320.1; 435/252.3; 435/252.31; 435/252.35; 435/252.33;
435/252.34; 435/254.11; 435/254.2; 435/254.22; 435/254.23;
435/254.21; 435/254.3; 435/254.7; 435/254.8; 435/254.4; 435/254.5;
435/254.6 |
International
Class: |
C12P 17/10 20060101
C12P017/10; C12N 9/08 20060101 C12N009/08; C12P 17/12 20060101
C12P017/12; C12N 1/21 20060101 C12N001/21 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 30, 2007 |
DE |
102007016139.7 |
Claims
1. An isolated polypeptide having peroxygenase activity, selected
from the group consisting of: (a) a polypeptide comprising an amino
acid sequence having at least 90% identity to the polypeptide of
SEQ ID NO: 10; and (b) a polypeptide encoded by a polynucleotide
comprising a nucleotide sequence having at least 80% identity to
the mature polypeptide coding sequence of SEQ ID NO:9
2. The isolated polypeptide of claim 1, wherein the polypeptide
comprises an amino acid sequence having at least 90% identity to
the polypeptide of SEQ ID NO: 10.
3. The isolated polypeptide of claim 1, wherein the polypeptide
comprises an amino acid sequence having at least 95% identity to
the polypeptide of SEQ ID NO: 10.
4. The isolated polypeptide of claim 1, wherein the polypeptide
comprises an amino acid sequence having at least 97% identity to
the polypeptide of SEQ ID NO: 10.
5. The isolated polypeptide of claim 1, wherein the polypeptide
comprises an amino acid sequence having at least 98% identity to
the polypeptide of SEQ ID NO: 10.
6. The isolated polypeptide of claim 1, wherein the polypeptide is
encoded by a polynucleotide comprising a nucleotide sequence having
at least 90% identity to the mature polypeptide coding sequence of
SEQ ID NO:9.
7. The isolated polypeptide of claim 1, wherein the polypeptide
consists of an amino acid sequence having the amino acid sequence
of SEQ ID NO: 10.
8. The isolated polypeptide of claim 1, wherein the polypeptide
encoded by a polynucleotide of SEQ ID NO:9.
9. A nucleic acid construct comprising the polynucleotide of claim
1 operably linked to one or several control sequences that direct
the production of the polypeptide in an expression host.
10. An isolated recombinant host cell comprising the nucleic acid
construct of claim 9.
11. A method of producing the polypeptide of 1, comprising: (a)
cultivating a cell, which in its wild-type form produces the
polypeptide of claim 1, under conditions conducive for production
of the polypeptide; and (b) recovering the polypeptide.
12. A method of producing the polypeptide of claim 1, comprising:
(a) cultivating a host cell comprising a nucleic acid construct
comprising a nucleotide sequence encoding the polypeptide of claim
1 under conditions conducive for production of the polypeptide; and
(b) recovering the polypeptide.
13. A process for enzymatic, regioselective oxygenation of N
heterocycles of the formula (I) in FIG. 1 to corresponding N oxides
of the formula (II) in FIG. 1, by converting N hetero.right
brkt-bot.cycles of the formula (I) in FIG. 1 with a peroxygenase
polypeptide as defined in claim 1 in the presence of at least one
oxidizing agent in a one-stage reaction process.
14. The process of claim 13, characterized in that the N
heterocycle used is pyridine.
15. The process of claim 13, wherein further H2O2-generating
enzymes are added to the reaction mixture to further accelerate the
reaction of the compound of the formula (I) with the peroxygenase
polypeptide..
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a division of U.S. application Ser. No.
12/532,870 filed Sep. 24, 2009 (now allowed) which is a 35 U.S.C.
371 national application of PCT/EP2008/053798 filed 31 Mar, 2008,
which claims priority or the benefit under 35 U.S.C. 119 of German
patent application no. 10 2007 016 139.7 filed 30 Mar. 2007, the
contents of which are fully incorporated herein by reference.
SEQUENCE LISTING AND DEPOSITED MICROORGANISMS
Sequence Listing
[0002] The present invention comprises a sequence listing in
computer readable form. The computer readable form is incorporated
herein by reference.
Deposit of Biological Material
[0003] The following biological material has been deposited under
the terms of the Budapest Treaty with the DSMZ (Deutsche Sammlung
von Mikroorganismen and Zellkulturen GmbH) and given the following
accession number. Two Escherichia coli clones, each containing a
standard plasmid comprising the cDNA gene encoding the AaP1 and
AaP2 peroxygenase enzymes of Agrocybe aegerita TM-A1-K shown in SEQ
ID NO's 1/2 and 3/4, respectively.
TABLE-US-00001 Deposit Accession Number Date of Deposit E. coli
NN049991 (AaP1) DSM 21289 14 Mar. 2008 E. coli NN049992 (AaP2) DSM
21290 14 Mar. 2008
The strains have been deposited under conditions that assure that
access to the culture will be available during the pendency of this
patent application to one determined by foreign patent laws to be
entitled thereto. The deposit represents a substantially pure
culture of the deposited strain. The deposit is available as
required by foreign patent laws in countries wherein counterparts
of the subject application, or its progeny are filed. However, it
should be understood that the availability of a deposit does not
constitute a license to practice the subject invention in
derogation of patent rights granted by governmental action.
FIELD OF THE INVENTION
[0004] The invention relates to polypeptides having peroxygenase
activity and compositions comprising such polypeptides, their
encoding polynucleotides, expression vectors and recombinant host
cells comprising such polynucleotides or vectors, methods of
producing the polypeptides, as well as methods of application and
uses thereof, including a process for enzymatic, regioselective
oxygenation of N-heterocycles of the general formula (I) to the
corresponding N-oxides of the formula (II), by converting
N-heterocycles of the formula (I) with a peroxidase polypeptide in
the presence of at least one oxidizing agent in a one-stage
reaction process.
BACKGROUND OF THE INVENTION
[0005] A haloperoxidase peroxygenase denoted AaP from the agaric
basidiomycete strain Agrocybe aegerita (strain TM-A1) was found to
oxidize aryl alcohols and aldehydes. The AaP peroxygenase was
purified from A. aegerita TM A1 by several steps of ion
chromatography and SDS-PAGE, the molecular weight was determined
and the N-terminal 14 amino acid sequence was determined after 2-D
electrophoresis but the encoding gene was not isolated (Ullrich et
al., 2004, Appl. Env. Microbiol. 70(8): 4575-4581).
[0006] WO 2006/034702 A1 discloses methods for the enzymatic
hydroxylation of non-activated hydrocarbons, such as, naphtalene,
toluol and cyclohexane, using the AaP peroxygenase enzyme of
Agrocybe aegerita TM A1. This is also described in Ullrich and
Hofrichter, 2005, FEBS Letters 579: 6247-6250.
[0007] DE 103 32 065 A1 discloses methods for the enzymatic
preparation of acids from alcohols through the intermediary
formation of aldehydes by using the AaP peroxygenase enzyme of
Agrocybe aegerita TM A1.
[0008] A method was reported for the rapid and selective
spectrophotometric direct detection of aromatic hydroxylation by
the AaP peroxygenase (Kluge et al., 2007, Appl Microbiol Biotechnol
75: 1473-1478).
[0009] A second peroxygenase capable of aromatic peroxygenation was
isolated from the coprophilous fungus Coprinus radians and
characterized, the N-terminal 16 amino acids were identified and
aligned with the N-terminal 14 amino acids of the AaP enzyme of the
A.aegerita strain earlier published; but the encoding gene was not
isolated (Anh et al., 2007, Appl Env Microbiol 73(17):
5477-5485).
[0010] It is well-known that a direct regioselective introduction
of oxygen functions (oxygenation) into organic molecules
constitutes a problem in chemical synthesis. It is particularly
difficult to catalyse the selective N-oxygenation of aromatic
heterocycles of the pyridine type. The products, heterocyclic
N-oxides, are important intermediates in a wide variety of
different syntheses and are often biologically active. In addition,
they function as protecting groups, oxidizing agents, ligands in
metal complexes and specific catalysts.
[0011] The chemical oxygenation of pyridine, derivatives thereof
and other N-heterocycles is relatively complex, requires
aggressive/toxic chemicals/catalysts and leads to a series of
undesired by-products (e.g. 2-, 3- and/or 4-hydroxypyridine
derivatives) and low isomer yields. According to the literature,
pyridine N-oxide can be chemically synthesized from pyridine using
the following starting compounds among others: [0012] hydrogen
peroxide (30%), acetic acid and pyridine (80.degree. C. in
pyridine/water) [0013] phosphotungstic acid on silicon dioxide and
pyridine (80.degree. C. in pyridine) [0014] tungstic acid salts,
hydrogen peroxide (30%) and pyridine (80.degree. C. in pyridine)
[0015] organic hydrotrioxides and pyridine (-80 to -60.degree. C.
in pyridine) [0016] hydrogen peroxide, manganese
tetrakis(2,6-chlorophenyl)porphyrin (25.degree. C. in
dichloroethane) [0017] dimethyloxirane and pyridine (0.degree. C.,
in dichloroethane) [0018] perfluoro(cis-2,3-dialkyloxaziridine) and
pyridine (25.degree. C. in pyridine).
[0019] Oxygenation reactions on heterocyclic nitrogen atoms are
usually based on generation, in the presence of electron donors and
molecular oxygen (O.sub.2) or a peroxide/trioxide (R--OOH,
R--OOOH), by a catalyst, of a reactive oxygen species which attacks
the nitrogen directly. These highly reactive oxygen species have
only limited regioselectivity. For this reason, the yields in
chemical N-oxygenations are low, and they lead to undesired
by-products and require a complicated operation.
[0020] It is known that an intracellular enzyme, methane
monooxygenase (MMO, EC 14.13.25), converts pyridine to pyridine
N-oxide in an unspecific side reaction. The MMO enzyme consists of
several protein components and is formed by methylotrophic bacteria
(e.g. Methylococcus capsulatus); it requires complex electron
donors such as NADH or NADPH, auxiliary proteins (flavin
reductases, regulator protein) and molecular oxygen (O.sub.2). The
natural substrate of MMO is methane, which is oxidized to
methanol.
[0021] As a particularly unspecific biocatalyst, MMO
oxygenates/hydroxylates, as well as methane, a series of further
substrates such as n-alkanes and their derivatives, cycloalkanes,
aromatics, carbon monoxide and heterocycles. The latter and
pyridine in particular are, however, converted only with very low
rates; the specific activity with respect to pyridine is 0.029 unit
mg.sup.-1 of protein (Colby et al. 1977: The soluble methane
mono-oxygenase of Methylococcus capsulatus. Biochem. J. 165:
395-402). Utilization of the enzyme in biotechnology is currently
not possible, since it is difficult to isolate, like most
intracellular enzymes, it is of low stability, and the cosubstrates
required are relatively expensive.
[0022] Pyridine-degrading bacteria such as Rhodococcus spp. or
Arthrobacter spp. do not possess any enzyme which generates
pyridine N-oxide, but rather utilize enzymes which hydroxylate the
pyridine ring at the carbon (rare) or reduce particular bonds of
the ring (common) and thus initiate the degradation (Fetzner, S.,
1998: Bacterial degradation of pyridine, indole, quinoline, and
their derivatives under different redox conditions. Appl.
Microbiol. Biotechnol. 49: 237-250).
SUMMARY OF THE INVENTION
[0023] In a first aspect, the invention relates to an isolated
polypeptide, which is preferably recombinantly produced, having
peroxygenase activity, selected from the group consisting of:
[0024] (a) a polypeptide comprising an amino acid sequence having
at least 60% identity, preferably at least 65%, 70%, 75%, 80%, 85%,
90%, 95%, 97%, or 98% identity to the polypeptide of SEQ ID NO: 2,
SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID
NO:12, SEQ ID NO: 14, or SEQ ID NO:19;
[0025] (b) a polypeptide encoded by a polynucleotide that
hybridizes under at least low, medium, medium-high, or high
stringency conditions with (i) the mature polypeptide coding
sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ
ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17;
(ii) the cDNA sequence contained in or the genomic DNA sequence
comprising the mature polypeptide coding sequence of SEQ ID NO: 1,
SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11,
SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17; or (iii) a full-length
complementary strand of (i) or (ii);
[0026] (c) a polypeptide encoded by a polynucleotide comprising a
nucleotide sequence having at least 60% identity, preferably at
least 65%, 70%, 7.sub.5%.sub., 80%.sub., 8.sub.5%.sub., 90%.sub.,
9.sub.5%.sub., 97%.sub., or 98% identity to the mature polypeptide
coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID
NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ
ID NO:17;
[0027] (d) a polypeptide comprising one or more of the following
motifs, preferably comprising two or more, three or more, four or
more, five or six of the following motifs:
TABLE-US-00002 (SEQ ID NO: 40) Motif I:
[FL]XX[YF]S[AN]X[FHY]G[GN]GX[YF]N (SEQ ID NO: 41) Motif II:
G[GN]GX[YF]NXX[VA]AX[EH][LF]R (SEQ ID NO: 42) Motif III:
RXXRI[QE][DEQ]S[IM]ATN (SEQ ID NO: 43) Motif IV:
S[IM]ATN[PG][EQN][FM][SDN][FL] (SEQ ID NO: 44) Motif V:
P[PDK][DG]F[HFW]R[AP] (SEQ ID NO: 45) Motif VI:
[TI]XXXLYPNP[TK][GV];
and
[0028] (e) a variant comprising a substitution, deletion, and/or
insertion of one or several amino acids of the mature polypeptide
of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:
10, SEQ ID NO:12, SEQ ID NO: 14, or SEQ ID NO:19.
[0029] In a second aspect, the invention relates to an isolated
polynucleotide comprising a nucleotide sequence that encodes the
polypeptide of the first aspect.
[0030] A third aspect of the invention relates to a nucleic acid
construct comprising the polynucleotide of the second aspect
operably linked to one or several control sequences that direct the
production of the polypeptide in an expression host.
[0031] In a fourth aspect the invention relates to a recombinant
expression vector comprising the nucleic acid construct of the
third aspect.
[0032] The fifth aspect of the invention relates to a recombinant
host cell comprising the nucleic acid construct of claim the third
aspect or the expression vector of the fourth aspect.
[0033] A sixth aspect of the invention relates to a method of
producing the polypeptide of the first aspect, comprising: (a)
cultivating a cell, which in its wild-type form produces the
polypeptide, under conditions conducive for production of the
polypeptide; and (b) recovering the polypeptide.
[0034] A seventh aspect of the invention relates to a method of
producing the polypeptide of the first aspect, comprising: (a)
cultivating a host cell comprising a nucleic acid construct
comprising a nucleotide sequence encoding the polypeptide under
conditions conducive for production of the polypeptide; and (b)
recovering the polypeptide.
[0035] An eigth aspect of the invention relates to a method of
producing a mutant of a parent cell, comprising disrupting or
deleting a nucleotide sequence encoding the polypeptide of the
first aspect, which results in the mutant producing less of the
polypeptide than the parent cell.
[0036] A ninth aspect of the invention relates to a mutant cell
produced by the method of the eigth aspect.
[0037] In a tenth aspect the invention relates to a method of
producing a protein, comprising: [0038] (a) cultivating the mutant
cell the ninth aspect under conditions conducive for production of
the protein; and (b) recovering the protein.
[0039] An eleventh aspect of the invention relates to a method of
producing a polynucleotide comprising a mutant nucleotide sequence
encoding a polypeptide having peroxygenase activity, comprising:
(a) introducing at least one mutation into the mature polypeptide
coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID
NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ
ID NO:17, wherein the mutant nucleotide sequence encodes a
polypeptide comprising or consisting of the mature polypeptide of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:
10, SEQ ID NO:12, SEQ ID NO: 14 or SEQ ID NO:19; and (b) recovering
the polynucleotide comprising the mutant nucleotide sequence.
[0040] A twelfth aspect of the invention relates to a mutant
polynucleotide produced by the method of the eleventh aspect.
[0041] In a thirteenth aspect the invention relates to a method of
producing a polypeptide, comprising: (a) cultivating a cell
comprising the mutant polynucleotide of the twelfth aspect encoding
the polypeptide under conditions conducive for production of the
polypeptide; and [0042] (b) recovering the polypeptide.
[0043] A fourteenth aspect of the invention relates to a method of
producing the polypeptide of the first aspect, comprising: (a)
cultivating a transgenic plant or a plant cell comprising a
polynucleotide encoding the polypeptide under conditions conducive
for production of the polypeptide; and (b) recovering the
polypeptide.
[0044] A fifteenth aspect of the invention relates to a nucleic
acid construct comprising a gene encoding a protein operably linked
to one or both of a first nucleotide sequence encoding a signal
peptide comprising or consisting of amino acids-43 to -1 of SEQ ID
NO: 2, and a second nucleotide sequence encoding a propeptide
comprising or consisting of amino acids 1 to 330 of SEQ ID NO: 2,
wherein the gene is foreign to the first and second nucleotide
sequences.
[0045] In a sixteenth aspect, the invention relates to a
recombinant expression vector comprising the nucleic acid construct
of the previous aspect.
[0046] A seventeenth aspect relates to a recombinant host cell
comprising the nucleic acid construct of the previous aspect.
[0047] An eighteenth aspect relates to a method of producing a
protein, comprising: (a) cultivating the recombinant host cell of
the previous aspect under conditions conducive for production of
the protein; and (b) recovering the protein.
[0048] It is an object of the present invention to perform a
process for preparing pyridine N-oxide and other N-heterocycles
from the corresponding precursors with a very low level of process
technology and apparatus complexity and at the same time with the
use of inexpensive cosubstrates. The conversion of the starting
compounds shall be effected in very short incubation times, at room
temperature and pressure, in an aqueous medium and without
increased demands for sterile or semisterile reaction conditions.
The reaction products should be isolated with a minimum level of
complexity and a complicated separation of different structural
isomers shall be dispensed with.
[0049] A twentieth aspect of the invention relates to a process for
enzymatic, regioselective oxygenation of N-heterocycles of the
formula (I) in FIG. 1 to corresponding N-oxides of the formula (II)
in FIG. 1, by converting N-heterocycles of the formula (I) in FIG.
1 with a peroxygenase polypeptide as defined in the first aspect in
the presence of at least one oxidizing agent in a one-stage
reaction process.
[0050] In another aspect, the invention relates to a process for
enzymatic, regioselective oxygenation of aromatic N-heterocycles of
the formula (I) to corresponding N-oxides of the formula (II) by
converting an N-heterocycle of the formula (I) with a fungal
aromatic haloperoxidase peroxygenase in the presence of at least
one oxidizing agent in a one-stage reaction process.
[0051] Final aspects of the invention relates to several types of
compositions comprising a polypeptide as defined in the first
aspect, such as, a detergent composition, a dishwasher detergent
composition, a composition for pulp and paper treatment, a
composition for water treatment, and a composition for oil
treatment.
DRAWINGS
[0052] FIG. 1: General formula scheme of the peroxygenase-catalysed
conversion of N-heterocycles
[0053] FIG. 2: Formula scheme according to example 1.
[0054] FIG. 3: HPLC elution profile (256 nm) of the conversion of
pyridine by AaP with the mass spectrum of the only product,
pyridine N-oxide.
[0055] FIG. 4: FIGS. 4A-4D show a multiple alignment of the of the
8 peroxygenase amino acid sequences shown in SEQ ID NO's: 2, 4, 6,
8, 10, 12, 14, and 19, respectively, together with a consensus
indication and six conserved motifs characteristic of fungal
peroxygenases.
DEFINITIONS
[0056] Peroxygenase activity: The term "peroxygenase activity"
(AaP: E.C. 1.11.1.-) is defined herein as the capability to oxidize
a wide variety of compounds including phenols, ABTS
[2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid)], aryl
alcohols, N-heterocycles of the formula I (see FIG. 1), and
aldehydes and inorganic bromide. For purposes of the present
invention, peroxygenase activity is determined according to the
spectrophotometric procedure described by Kluge et al. (2007, Appl
Microbiol Biotechnol 75: 1473-1478).
[0057] The polypeptides of the present invention have at least 20%,
preferably at least 40%, more preferably at least 50%, more
preferably at least 60%, more preferably at least 70%, more
preferably at least 80%, even more preferably at least 90%, most
preferably at least 95%, and even most preferably at least 100% of
the peroxygenase activity of the mature polypeptide of SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, or 19.
[0058] Isolated polypeptide: The term "isolated polypeptide" as
used herein refers to a polypeptide that is isolated from a source.
In a preferred aspect, the polypeptide is at least 1% pure,
preferably at least 5% pure, more preferably at least 10% pure,
more preferably at least 20% pure, more preferably at least 40%
pure, more preferably at least 60% pure, even more preferably at
least 80% pure, and most preferably at least 90% pure, as
determined by SDS-PAGE.
[0059] Substantially pure polypeptide: The term "substantially pure
polypeptide" denotes herein a polypeptide preparation that contains
at most 10%, preferably at most 8%, more preferably at most 6%,
more preferably at most 5%, more preferably at most 4%, more
preferably at most 3%, even more preferably at most 2%, most
preferably at most 1%, and even most preferably at most 0.5% by
weight of other polypeptide material with which it is natively or
recombinantly associated. It is, therefore, preferred that the
substantially pure polypeptide is at least 92% pure, preferably at
least 94% pure, more preferably at least 95% pure, more preferably
at least 96% pure, more preferably at least 96% pure, more
preferably at least 97% pure, more preferably at least 98% pure,
even more preferably at least 99%, most preferably at least 99.5%
pure, and even most preferably 100% pure by weight of the total
polypeptide material present in the preparation. The polypeptides
of the present invention are preferably in a substantially pure
form, i.e., that the polypeptide preparation is essentially free of
other polypeptide material with which it is natively or
recombinantly associated. This can be accomplished, for example, by
preparing the polypeptide by well-known recombinant methods or by
classical purification methods.
[0060] Mature polypeptide: The term "mature polypeptide" is defined
herein as a polypeptide having peroxygenase activity that is in its
final form following translation and any post-translational
modifications, such as N-terminal processing, C-terminal
truncation, glycosylation, phosphorylation, etc. In a preferred
aspect, the mature polypeptide has the amino acid sequence shown in
positions 1 to 330 of SEQ ID NO: 2 based on the N-terminal peptide
sequencing data (Ullrich et al., 2004, Appl. Env. Microbiol. 70(8):
4575-4581), elucidating the start of the mature protein of AaP
peroxygenase enzyme.
[0061] Mature polypeptide coding sequence: The term "mature
polypeptide coding sequence" is defined herein as a nucleotide
sequence that encodes a mature polypeptide having peroxygenase
activity. In a preferred aspect, the mature polypeptide coding
sequence is nucleotides 152 to 1141 of SEQ ID NO: 1.
[0062] Identity: The relatedness between two amino acid sequences
or between two nucleotide sequences is described by the parameter
"identity".
[0063] For purposes of the present invention, the degree of
identity between two amino acid sequences is determined using the
Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol.
Biol. 48: 443-453) as implemented in the Needle program of the
EMBOSS package (EMBOSS: The European Molecular Biology Open
Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277),
preferably version 3.0.0 or later. The optional parameters used are
gap open penalty of 10, gap extension penalty of 0.5, and the
EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The
output of Needle labeled "longest identity" (obtained using
the--nobrief option) is used as the percent identity and is
calculated as follows:
(Identical Residues.times.100)/(Length of Alignment-Total Number of
Gaps in Alignment)
[0064] For purposes of the present invention, the degree of
identity between two deoxyribonucleotide sequences is determined
using the Needleman-Wunsch algorithm
[0065] (Needleman and Wunsch, 1970, supra) as implemented in the
Needle program of the EMBOSS package (EMBOSS: The European
Molecular Biology Open Software Suite, Rice et al., 2000, supra),
preferably version 3.0.0 or later. The optional parameters used are
gap open penalty of 10, gap extension penalty of 0.5, and the
EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The
output of Needle labeled "longest identity" (obtained using
the--nobrief option) is used as the percent identity and is
calculated as follows:
(Identical Deoxyribonucleotides.times.100)/(Length of
Alignment-Total Number of Gaps in Alignment)
[0066] Homologous sequence: The term "homologous sequence" is
defined herein as a predicted protein that gives an E value (or
expectancy score) of less than 0.001 in a tfasty search (Pearson,
W.R., 1999, in Bioinformatics Methods and Protocols, S. Misener and
S. A. Krawetz, ed., pp. 185-219) with the polypeptide shown in SEQ
ID NO: 2, 4, 6, 8, 10, 12, 14, or 19.
[0067] Polypeptide fragment: The term "polypeptide fragment" is
defined herein as a polypeptide having one or more (several) amino
acids deleted from the amino and/or carboxyl terminus of the mature
polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, or 19; or a
homologous sequence thereof; wherein the fragment has peroxygenase
activity.
[0068] Subsequence: The term "subsequence" is defined herein as a
nucleotide sequence having one or more (several) nucleotides
deleted from the 5' and/or 3' end of the mature polypeptide coding
sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17; or a
homologous sequence thereof; wherein the subsequence encodes a
polypeptide fragment having peroxygenase activity.
[0069] Allelic variant: The term "allelic variant" denotes herein
any of two or more alternative forms of a gene occupying the same
chromosomal locus. Allelic variation arises naturally through
mutation, and may result in polymorphism within populations. Gene
mutations can be silent (no change in the encoded polypeptide) or
may encode polypeptides having altered amino acid sequences. An
allelic variant of a polypeptide is a polypeptide encoded by an
allelic variant of a gene.
[0070] Isolated polynucleotide: The term "isolated polynucleotide"
as used herein refers to a polynucleotide that is isolated from a
source. In a preferred aspect, the polynucleotide is at least 1%
pure, preferably at least 5% pure, more preferably at least 10%
pure, more preferably at least 20% pure, more preferably at least
40% pure, more preferably at least 60% pure, even more preferably
at least 80% pure, and most preferably at least 90% pure, as
determined by agarose electrophoresis.
[0071] Substantially pure polynucleotide: The term "substantially
pure polynucleotide" as used herein refers to a polynucleotide
preparation free of other extraneous or unwanted nucleotides and in
a form suitable for use within genetically engineered protein
production systems. Thus, a substantially pure polynucleotide
contains at most 10%, preferably at most 8%, more preferably at
most 6%, more preferably at most 5%, more preferably at most 4%,
more preferably at most 3%, even more preferably at most 2%, most
preferably at most 1%, and even most preferably at most 0.5% by
weight of other polynucleotide material with which it is natively
or recombinantly associated. A substantially pure polynucleotide
may, however, include naturally occurring 5' and 3' untranslated
regions, such as promoters and terminators. It is preferred that
the substantially pure polynucleotide is at least 90% pure,
preferably at least 92% pure, more preferably at least 94% pure,
more preferably at least 95% pure, more preferably at least 96%
pure, more preferably at least 97% pure, even more preferably at
least 98% pure, most preferably at least 99%, and even most
preferably at least 99.5% pure by weight. The polynucleotides of
the present invention are preferably in a substantially pure form,
i.e., that the polynucleotide preparation is essentially free of
other polynucleotide material with which it is natively or
recombinantly associated. The polynucleotides may be of genomic,
cDNA, RNA, semisynthetic, synthetic origin, or any combinations
thereof.
[0072] Coding sequence: When used herein the term "coding sequence"
means a nucleotide sequence, which directly specifies the amino
acid sequence of its protein product.
[0073] The boundaries of the coding sequence are generally
determined by an open reading frame, which usually begins with the
ATG start codon or alternative start codons such as GTG and TTG and
ends with a stop codon such as TAA, TAG, and TGA. The coding
sequence may be a DNA, cDNA, synthetic, or recombinant nucleotide
sequence.
[0074] cDNA: The term "cDNA" is defined herein as a DNA molecule
that can be prepared by reverse transcription from a mature,
spliced, mRNA molecule obtained from a eukaryotic cell. cDNA lacks
intron sequences that are usually present in the corresponding
genomic DNA. The initial, primary RNA transcript is a precursor to
mRNA that is processed through a series of steps before appearing
as mature spliced mRNA. These steps include the removal of intron
sequences by a process called splicing. cDNA derived from mRNA
lacks, therefore, any intron sequences.
[0075] Nucleic acid construct: The term "nucleic acid construct" as
used herein refers to a nucleic acid molecule, either single- or
double-stranded, which is isolated from a naturally occurring gene
or which is modified to contain segments of nucleic acids in a
manner that would not otherwise exist in nature or which is
synthetic. The term nucleic acid construct is synonymous with the
term "expression cassette" when the nucleic acid construct contains
the control sequences required for expression of a coding sequence
of the present invention.
[0076] Control sequences: The term "control sequences" is defined
herein to include all components necessary for the expression of a
polynucleotide encoding a polypeptide of the present invention.
Each control sequence may be native or foreign to the nucleotide
sequence encoding the polypeptide or native or foreign to each
other. Such control sequences include, but are not limited to, a
leader, polyadenylation sequence, propeptide sequence, promoter,
signal peptide sequence, and transcription terminator. At a
minimum, the control sequences include a promoter, and
transcriptional and translational stop signals. The control
sequences may be provided with linkers for the purpose of
introducing specific restriction sites facilitating ligation of the
control sequences with the coding region of the nucleotide sequence
encoding a polypeptide.
[0077] Operably linked: The term "operably linked" denotes herein a
configuration in which a control sequence is placed at an
appropriate position relative to the coding sequence of the
polynucleotide sequence such that the control sequence directs the
expression of the coding sequence of a polypeptide.
[0078] Expression: The term "expression" includes any step involved
in the production of the polypeptide including, but not limited to,
transcription, post-transcriptional modification, translation,
post-translational modification, and secretion.
[0079] Expression vector: The term "expression vector" is defined
herein as a linear or circular DNA molecule that comprises a
polynucleotide encoding a polypeptide of the present invention and
is operably linked to additional nucleotides that provide for its
expression.
[0080] Host cell: The term "host cell", as used herein, includes
any cell type that is susceptible to transformation, transfection,
transduction, and the like with a nucleic acid construct or
expression vector comprising a polynucleotide of the present
invention.
[0081] Modification: The term "modification" means herein any
chemical modification of the polypeptide consisting of the mature
polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, or 19; or a
homologous sequence thereof; as well as genetic manipulation of the
DNA encoding such a polypeptide. The modification can be a
substitution, a deletion and/or an insertion of one or more
(several) amino acids as well as replacements of one or more
(several) amino acid side chains.
[0082] Artificial variant: When used herein, the term "artificial
variant" means a polypeptide having peroxygenase activity produced
by an organism expressing a modified polynucleotide sequence of the
mature polypeptide coding sequence of one of SEQ ID NO: 1, 3, 5, 7,
9, 11, 13, 15, or 17; or a homologous sequence thereof. The
modified nucleotide sequence is obtained through human intervention
by modification of the polynucleotide sequence disclosed in SEQ ID
NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17; or a homologous sequence
thereof.
DETAILED DESCRIPTION
[0083] A number of fungal peroxygenase genomic DNA's and cDNA's are
shown along with the encoded amino acid sequences in the sequence
listing of this application: [0084] SEQ ID NO:1 shows a cDNA
polynucleotide sequence encoding the AaP1 enzyme from Agrocybe
aegerita, the amino acid sequence of which is shown in SEQ ID NO:2.
[0085] SEQ ID NO:3 shows a cDNA polynucleotide sequence encoding
the AaP2 enzyme from Agrocybe aegerita, the amino acid sequence of
which is shown in SEQ ID NO:4. [0086] SEQ ID NO:5 shows a genomic
DNA polynucleotide sequence encoding the peroxygenase enzyme from
Laccaria bicolor, the amino acid sequence of which is shown in SEQ
ID NO:6. [0087] SEQ ID NO:7 shows a cDNA polynucleotide sequence
(CC1G.sub.--08427) encoding the peroxygenasel enzyme from
Coprinopsis cinerea okayama strain 7#130, the amino acid sequence
of which is shown in SEQ ID NO:8 (putative protein UNIPROT:A8NAQ8).
[0088] SEQ ID NO:9 shows a cDNA polynucleotide sequence
(CC1G.sub.--10475) encoding the peroxygenase2 enzyme from
Coprinopsis cinerea okayama strain 7#130, the amino acid sequence
of which is shown in SEQ ID NO:10 (putative protein
UNIPROT:A8NL34). [0089] SEQ ID NO:11 shows a cDNA polynucleotide
sequence (CC1G.sub.--08981) encoding the peroxygenase3 enzyme from
Coprinopsis cinerea okayama strain 7#130, the amino acid sequence
of which is shown in SEQ ID NO:12 (putative protein
UNIPROT:A8P4U7). [0090] SEQ ID NO:13 shows a cDNA polynucleotide
sequence (CC1G.sub.--08975) encoding the peroxygenase4 enzyme from
Coprinopsis cinerea okayama strain 7#130, the amino acid sequence
of which is shown in SEQ ID NO:14 (putative protein
UNIPROT:A8P4T7). [0091] SEQ ID NO:15 shows a 5'-end partial cDNA
polynucleotide sequence encoding part of the peroxygenase enzyme
from Coprinus radians DSM888 (publicly available from DSMZ,
Germany), the partial amino acid sequence of which is shown in SEQ
ID NO:16. [0092] SEQ ID NO:17 shows a 3'-end partial cDNA
polynucleotide sequence encoding part of the peroxygenase enzyme
from Coprinus radians DSM888, the partial amino acid sequence of
which is shown in SEQ ID NO:18. [0093] SEQ ID NO:19 shows the
merged amino acid sequence of the partial sequences in SEQ ID NO's
16 and 18 of the peroxygenase enzyme from Coprinus radians
DSM888.
[0094] In a first aspect, the invention relates to an isolated
polypeptide, which is preferably recombinantly produced, having
peroxygenase activity, selected from the group consisting of:
[0095] (a) a polypeptide comprising an amino acid sequence having
at least 60% identity, preferably at least 65%, 70%, 75%, 80%, 85%,
90%, 95%, 97%, or 98% identity to the polypeptide of SEQ ID NO: 2,
SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID
NO:12, SEQ ID NO: 14, or SEQ ID NO:19;
[0096] (b) a polypeptide encoded by a polynucleotide that
hybridizes under at least low, medium, medium-high, or high
stringency conditions with (i) the mature polypeptide coding
sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ
ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17;
(ii) the cDNA sequence contained in or the genomic DNA sequence
comprising the mature polypeptide coding sequence of SEQ ID NO: 1,
SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11,
SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17; or (iii) a full-length
complementary strand of (i) or (ii);
[0097] (c) a polypeptide encoded by a polynucleotide comprising a
nucleotide sequence having at least 60% identity, preferably at
least 65%, 70%.sub., 7.sub.5%.sub., 80%, 8.sub.5%, 90%, 9.sub.5%,
97%.sub., or 98% identity to the mature polypeptide coding sequence
of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID
NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID
NO:17;
[0098] (d) a polypeptide comprising one or more of the following
motifs, preferably comprising two or more, three or more, four or
more, five or six of the following motifs:
TABLE-US-00003 (SEQ ID NO: 40) Motif I:
[FL]XX[YF]S[AN]X[FHY]G[GN]GX[YF]N (SEQ ID NO: 41) Motif II:
G[GN]GX[YF]NXX[VA]AX[EH][LF]R (SEQ ID NO: 42) Motif III:
RXXRI[QE][DEQ]S[IM]ATN (SEQ ID NO: 43) Motif IV:
S[IM]ATN[PG][EQN][FM][SDN][FL] (SEQ ID NO: 44) Motif V:
P[PDK][DG]F[HFW]R[AP] (SEQ ID NO: 45) Motif VI:
[TI]XXXLYPNP[TK][GV];
and [0099] (e) a variant comprising a substitution, deletion,
and/or insertion of one or several amino acids of the mature
polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID
NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, or SEQ ID
NO:19.
[0100] In a preferred embodiment, the polypeptide of the first
aspect comprises or consists of the amino acid sequence of SEQ ID
NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ
ID NO:12, SEQ ID NO: 14, or SEQ ID NO:19; or a fragment thereof
having peroxygenase activity; preferably the polypeptide comprises
or consists of the mature polypeptide of SEQ ID NO: 2, SEQ ID NO:
4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID
NO: 14, or SEQ ID NO:19.
[0101] A preferred embodiment relates to the the polypeptide of the
first aspect, which is encoded by a polynucleotide that hybridizes
under at least medium stringency conditions, preferably under at
least medium-high stringency condition, more preferably under at
least high stringency conditions, with (i) the mature polypeptide
coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID
NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ
ID NO:17; (ii) the cDNA sequence contained in or the genomic DNA
sequence comprising the mature polypeptide coding sequence of SEQ
ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ
ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17; or (iii) a
full-length complementary strand of (i) or (ii).
[0102] Another preferred embodiment relates to the polypeptide of
the first aspect, which is encoded by a polynucleotide comprising a
nucleotide sequence having at least 60% identity, preferably at
least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 98% identity to
the mature polypeptide coding sequence of SEQ ID NO: 1, SEQ ID
NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID
NO:13, SEQ ID NO:15, or SEQ ID NO:17.
[0103] It is also preferred that the polypeptide of the first
aspect is encoded by a polynucleotide comprising or consisting of
the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5,
SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15,
or SEQ ID NO:17; or a subsequence thereof encoding a fragment
having peroxygenase activity; preferably the polypeptide is encoded
by a polynucleotide comprising or consisting of the mature
polypeptide coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID
NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID
NO:15, or SEQ ID NO:17.
[0104] In another preferrred embodiment of the invention, the
polypeptide of the first aspect comprises one or more of the
following motifs, preferably two or more, three or more, four or
more, five or six of the following motifs:
TABLE-US-00004 (SEQ ID NO: 40) Motif I:
[FL]XX[YF]S[AN]X[FHY]G[GN]GX[YF]N (SEQ ID NO: 41) Motif II:
G[GN]GX[YF]NXX[VA]AX[EH][LF]R (SEQ ID NO: 42) Motif III:
RXXRI[QE][DEQ]S[IM]ATN (SEQ ID NO: 43) Motif IV:
S[IM]ATN[PG][EQN][FM][SDN][FL] (SEQ ID NO: 44) Motif V:
P[PDK][DG]F[HFW]R[AP] (SEQ ID NO: 45) Motif VI:
[TI]XXXLYPNP[TK][GV]
[0105] It is preferred that the the polypeptide of the first aspect
is a variant comprising a substitution, deletion, and/or insertion
of one or several amino acids of the mature polypeptide of SEQ ID
NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ
ID NO:12, SEQ ID NO: 14, or SEQ ID NO:19.
[0106] Preferably, amino acid changes are of a minor nature, that
is conservative amino acid substitutions or insertions that do not
significantly affect the folding and/or activity of the protein;
small deletions, typically of one to about 30 amino acids; small
amino- or carboxyl-terminal extensions, such as an amino-terminal
methionine residue; a small linker peptide of up to about 20-25
residues; or a small extension that facilitates purification by
changing net charge or another function, such as a poly-histidine
tract, an antigenic epitope or a binding domain.
[0107] Examples of conservative substitutions are within the group
of basic amino acids (arginine, lysine and histidine), acidic amino
acids (glutamic acid and aspartic acid), polar amino acids
(glutamine and asparagine), hydrophobic amino acids (leucine,
isoleucine and valine), aromatic amino acids (phenylalanine,
tryptophan and tyrosine), and small amino acids (glycine, alanine,
serine, threonine and methionine). Amino acid substitutions that do
not generally alter specific activity are known in the art and are
described, for example, by H. Neurath and R. L. Hill, 1979, In, The
Proteins, Academic Press, New York. The most commonly occurring
exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr,
Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn,
Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.
[0108] In addition to the 20 standard amino acids, non-standard
amino acids (such as 4-hydroxyproline, 6-N-methyl lysine,
2-aminoisobutyric acid, isovaline, and alpha-methyl serine) may be
substituted for amino acid residues of a wild-type polypeptide. A
limited number of non-conservative amino acids, amino acids that
are not encoded by the genetic code, and unnatural amino acids may
be substituted for amino acid residues. "Unnatural amino acids"
have been modified after protein synthesis, and/or have a chemical
structure in their side chain(s) different from that of the
standard amino acids. Unnatural amino acids can be chemically
synthesized, and preferably, are commercially available, and
include pipecolic acid, thiazolidine carboxylic acid,
dehydroproline, 3- and 4-methylproline, and
3,3-dimethylproline.
[0109] Alternatively, the amino acid changes are of such a nature
that the physico-chemical properties of the polypeptides are
altered. For example, amino acid changes may improve the thermal
stability of the polypeptide, alter the substrate specificity,
change the pH optimum, and the like.
[0110] Essential amino acids in the parent polypeptide can be
identified according to procedures known in the art, such as
site-directed mutagenesis or alanine-scanning mutagenesis
(Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter
technique, single alanine mutations are introduced at every residue
in the molecule, and the resultant mutant molecules are tested for
biological activity (i.e., peroxygenase activity) to identify amino
acid residues that are critical to the activity of the molecule.
See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The
active site of the enzyme or other biological interaction can also
be determined by physical analysis of structure, as determined by
such techniques as nuclear magnetic resonance, crystallography,
electron diffraction, or photoaffinity labeling, in conjunction
with mutation of putative contact site amino acids. See, for
example, de Vos et al., 1992, Science 255: 306-312; Smith et al.,
1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett.
309: 59-64. The identities of essential amino acids can also be
inferred from analysis of identities with polypeptides that are
related to a polypeptide according to the invention.
[0111] Single or multiple amino acid substitutions, deletions,
and/or insertions can be made and tested using known methods of
mutagenesis, recombination, and/or shuffling, followed by a
relevant screening procedure, such as those disclosed by
Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and
Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413;
or WO 95/22625. Other methods that can be used include error-prone
PCR, phage display (e.g., Lowman et al., 1991, Biochem. 30:
10832-10837; U.S. Pat. No. 5,223,409; WO 92/06204), and
region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145;
Ner et al., 1988, DNA 7: 127).
[0112] Mutagenesis/shuffling methods can be combined with
high-throughput, automated screening methods to detect activity of
cloned, mutagenized polypeptides expressed by host cells (Ness et
al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA
molecules that encode active polypeptides can be recovered from the
host cells and rapidly sequenced using standard methods in the art.
These methods allow the rapid determination of the importance of
individual amino acid residues in a polypeptide of interest, and
can be applied to polypeptides of unknown structure.
[0113] The total number of amino acid substitutions, deletions
and/or insertions of the mature polypeptide of SEQ ID NO: 2, SEQ ID
NO: 4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ
ID NO: 14 or SEQ ID NO:19 is 10, preferably 9, more preferably 8,
more preferably 7, more preferably at most 6, more preferably 5,
more preferably 4, even more preferably 3, most preferably 2, and
even most preferably 1.
[0114] It is preferable that the the polypeptide of the first
aspect is encoded by the polynucleotide contained in the plasmid
which is contained in E. coli NN049991 deposited 14 Mar. 2008 under
the terms of the Budapest Treaty with the DSMZ under accesion
number DSM 21289; or which is encoded by the polynucleotide
contained in the plasmid which is contained inE. coli NN049992
deposited 14 Mar. 2008 under the terms of the Budapest Treaty with
the DSMZ under accesion number DSM 21290.
[0115] Another preferred embodiment relates to the polypeptide of
the first aspect of the invention, wherein the mature polypeptide
is amino acids 1 to 330 of SEQ ID NO: 2.
[0116] It is also preferred in the first aspect of the invention
that the mature polypeptide coding sequence is nucleotides 152 to
1141 of SEQ ID NO: 1.
Hybridization
[0117] The nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 3; SEQ
ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ
ID NO:15, or SEQ ID NO:17; or a subsequence thereof; as well as the
amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ
ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, or SEQ ID
NO:19; or a fragment thereof; may be used to design nucleic acid
probes to identify and clone DNA encoding polypeptides having
peroxygenase activity from strains of different genera or species
according to methods well known in the art. In particular, such
probes can be used for hybridization with the genomic or cDNA of
the genus or species of interest, following standard Southern
blotting procedures, in order to identify and isolate the
corresponding gene therein. Such probes can be considerably shorter
than the entire sequence, but should be at least 14, preferably at
least 25, more preferably at least 35, and most preferably at least
70 nucleotides in length. It is, however, preferred that the
nucleic acid probe is at least 100 nucleotides in length. For
example, the nucleic acid probe may be at least 200 nucleotides,
preferably at least 300 nucleotides, more preferably at least 400
nucleotides, or most preferably at least 500 nucleotides in length.
Even longer probes may be used, e.g., nucleic acid probes that are
preferably at least 600 nucleotides, more preferably at least 700
nucleotides, even more preferably at least 800 nucleotides, or most
preferably at least 900 nucleotides in length. Both DNA and RNA
probes can be used. The probes are typically labeled for detecting
the corresponding gene (for example, with .sup.32P, .sup.3H,
.sup.355, biotin, or avidin). Such probes are encompassed by the
present invention.
[0118] A genomic DNA or cDNA library prepared from such other
strains may, therefore, be screened for DNA that hybridizes with
the probes described above and encodes a polypeptide having
peroxygenase activity. Genomic or other DNA from such other strains
may be separated by agarose or polyacrylamide gel electrophoresis,
or other separation techniques. DNA from the libraries or the
separated DNA may be transferred to and immobilized on
nitrocellulose or other suitable carrier material. In order to
identify a clone or DNA that is homologous with SEQ ID NO: 1; or a
subsequence thereof; the carrier material is preferably used in a
Southern blot.
[0119] For purposes of the present invention, hybridization
indicates that the nucleotide sequence hybridizes to a labeled
nucleic acid probe corresponding to the mature polypeptide coding
sequence of SEQ ID NO: 1, SEQ ID NO: 3; SEQ ID NO:5, SEQ ID NO:7,
SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID
NO:17; the cDNA sequence contained in or the genomic DNA sequence
comprising the mature polypeptide coding sequence of SEQ ID NO: 1,
SEQ ID NO: 3; SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11,
SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:17; its full-length
complementary strand; or a subsequence thereof; under very low to
very high stringency conditions. Molecules to which the nucleic
acid probe hybridizes under these conditions can be detected using,
for example, X-ray film.
[0120] For long probes of at least 100 nucleotides in length, very
low to very high stringency conditions are defined as
prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 .mu.g/ml sheared and denatured salmon
sperm DNA, and either 25% formamide for very low and low
stringencies, 35% formamide for medium and medium-high
stringencies, or 50% formamide for high and very high stringencies,
following standard Southern blotting procedures for 12 to 24 hours
optimally.
[0121] For long probes of at least 100 nucleotides in length, the
carrier material is finally washed three times each for 15 minutes
using 2.times.SSC, 0.2% SDS preferably at 45.degree. C. (very low
stringency), more preferably at 50.degree. C. (low stringency),
more preferably at 55.degree. C. (medium stringency), more
preferably at 60.degree. C. (medium-high stringency), even more
preferably at 65.degree. C. (high stringency), and most preferably
at 70.degree. C. (very high stringency).
[0122] For short probes that are about 15 nucleotides to about 70
nucleotides in length, stringency conditions are defined as
prehybridization, hybridization, and washing post-hybridization at
about 5.degree. C. to about 10.degree. C. below the calculated
T.sub.m using the calculation according to Bolton and McCarthy
(1962, Proceedings of the National Academy of Sciences USA 48:1390)
in 0.9 M NaCI, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40,
1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM
sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per
ml following standard Southern blotting procedures for 12 to 24
hours optimally.
[0123] For short probes that are about 15 nucleotides to about 70
nucleotides in length, the carrier material is washed once in
6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15
minutes using 6.times.SSC at 5.degree. C. to 10.degree. C. below
the calculated T.sub.m.
Sources of Polypeptides
[0124] A polypeptide of the present invention may be obtained from
microorganisms of any genus. For purposes of the present invention,
the term "obtained from" as used herein in connection with a given
source shall mean that the polypeptide encoded by a nucleotide
sequence is produced by the source or by a strain in which the
nucleotide sequence from the source has been inserted. In a
preferred aspect, the polypeptide obtained from a given source is
secreted extracellularly.
[0125] A polypeptide having peroxygenase activity of the present
invention may be a bacterial polypeptide. For example, the
polypeptide may be a gram positive bacterial polypeptide such as a
Bacillus, Streptococcus, Streptomyces, Staphylococcus,
Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus,
or Oceanobacillus polypeptide having peroxygenase activity, or a
Gram negative bacterial polypeptide such as an E. coli,
Pseudomonas, Salmonella, Campylobacter, Helicobacter,
Flavobacterium, Fusobacterium, Ilyobacter, Neisseria, or Ureaplasma
polypeptide having peroxygenase activity.
[0126] In a preferred aspect, the polypeptide is a Bacillus
alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus
circulans, Bacillus clausii, Bacillus coagulans, Bacillus firm us,
Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus
megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus
subtilis, or Bacillus thuringiensis polypeptide having peroxygenase
activity.
[0127] In another preferred aspect, the polypeptide is a
Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus
uberis, or Streptococcus equi subsp. Zooepidemicus polypeptide
having peroxygenase activity.
[0128] In another preferred aspect, the polypeptide is a
Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces
coelicolor, Streptomyces griseus, or Streptomyces lividans
polypeptide having peroxygenase activity.
[0129] A polypeptide having peroxygenase activity of the present
invention may also be a fungal polypeptide, and more preferably a
yeast polypeptide such as a Candida, Kluyveromyces, Pichia,
Saccharomyces, Schizosaccharomyces, or Yarrowia polypeptide having
peroxygenase activity; or more preferably a filamentous fungal
polypeptide such as an Acremonium, Agaricus, Alternaria,
Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis,
Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis,
Coptotermes, Corynascus, Cryphonectria, Cryptococcus, Diplodia,
Exidia, Filibasidium, Fusarium, Gibberella, Holomastigotoides,
Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe,
Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix,
Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces,
Poitrasia, Pseudoplectania, Pseudotrichonympha, Rhizomucor,
Schizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia,
Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella,
or Xylaria polypeptide having peroxygenase activity.
[0130] In a preferred aspect, the polypeptide is a Saccharomyces
carlsbergensis, Saccharomyces cerevisiae, Saccharomyces
diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri,
Saccharomyces norbensis, or Saccharomyces oviformis polypeptide
having peroxygenase activity.
[0131] In another preferred aspect, the polypeptide is an
Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus
awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus
japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus
oryzae, Chrysosporium keratinophilum, Chrysosporium lucknowense,
Chrysosporium tropicum, Chrysosporium merdarium, Chrysosporium
inops, Chrysosporium pannicola, Chrysosporium queenslandicum,
Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis,
Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum,
Fusarium graminum, Fusarium heterosporum, Fusarium negundi,
Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium
sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides,
Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides,
Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola
lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora
thermophila, Neurospora crassa, Penicillium funiculosum,
Penicillium purpurogenum, Phanerochaete chrysosporium, Thielavia
achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia
australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia
ovispora, Thielavia peruviana, Thielavia spededonium, Thielavia
setosa, Thielavia subthermophila, Thielavia terrestris, Trichoderma
harzianum, Trichoderma koningii, Trichoderma longibrachiatum,
Trichoderma reesei, or Trichoderma viride polypeptide having having
peroxygenase activity.
[0132] In another preferred aspect, the polypeptide is from a
Basidiomycete of the Bolbitiaceae (e.g. Agrocybe spp.) or
Coprinaceae (e.g. Coprinus spp.) families.
[0133] It will be understood that for the aforementioned species
the invention encompasses both the perfect and imperfect states,
and other taxonomic equivalents, e.g., anamorphs, regardless of the
species name by which they are known. Those skilled in the art will
readily recognize the identity of appropriate equivalents.
[0134] Strains of these species are readily accessible to the
public in a number of culture collections, such as the American
Type Culture Collection (ATCC), Deutsche Sammlung von
[0135] Mikroorganismen and Zellkulturen GmbH (DSM), Centraalbureau
Voor Schimmelcultures (CBS), and Agricultural Research Service
Patent Culture Collection, Northern Regional Research Center
(NRRL).
[0136] Furthermore, such polypeptides may be identified and
obtained from other sources including microorganisms isolated from
nature (e.g., soil, composts, water, etc.) using the
above-mentioned probes. Techniques for isolating microorganisms
from natural habitats are well known in the art. The polynucleotide
may then be obtained by similarly screening a genomic or cDNA
library of such a microorganism. Once a polynucleotide sequence
encoding a polypeptide has been detected with the probe(s), the
polynucleotide can be isolated or cloned by utilizing techniques
that are well known to those of ordinary skill in the art (see,
e.g., Sambrook et al., 1989, supra).
[0137] Polypeptides of the present invention also include fused
polypeptides or cleavable fusion polypeptides in which another
polypeptide is fused at the N-terminus or the C-terminus of the
polypeptide or fragment thereof. A fused polypeptide is produced by
fusing a nucleotide sequence (or a portion thereof) encoding
another polypeptide to a nucleotide sequence (or a portion thereof)
of the present invention. Techniques for producing fusion
polypeptides are known in the art, and include ligating the coding
sequences encoding the polypeptides so that they are in frame and
that expression of the fused polypeptide is under control of the
same promoter(s) and terminator.
[0138] A fusion polypeptide can further comprise a cleavage site.
Upon secretion of the fusion protein, the site is cleaved releasing
the polypeptide having peroxygenase activity from the fusion
protein. Examples of cleavage sites include, but are not limited
to, a Kex2 site that encodes the dipeptide Lys-Arg (Martin et al.,
2003, J. Ind. Microbiol. Biotechnol. 3: 568-76; Svetina et al.,
2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997,
Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995,
Biotechnology 13: 498-503; and Contreras et al., 1991,
Biotechnology 9: 378-381), an Ile-(Glu or Asp)-Gly-Arg site, which
is cleaved by a Factor Xa protease after the arginine residue
(Eaton et al., 1986, Biochem. 25:
[0139] 505-512); a Asp-Asp-Asp-Asp-Lys site, which is cleaved by an
enterokinase after the lysine (Collins-Racie et al., 1995,
Biotechnology 13: 982-987); a His-Tyr-Glu site or His-Tyr-Asp site,
which is cleaved by Genenase I (Carter et al., 1989, Proteins:
Structure, Function, and Genetics 6: 240-248); a
Leu-Val-Pro-Arg-Gly-Ser site, which is cleaved by thrombin after
the Arg (Stevens, 2003, Drug Discovery World 4: 35-48); a
Glu-Asn-Leu-Tyr-Phe-Gln-Gly site, which is cleaved by TEV protease
after the Gln (Stevens, 2003, supra); and a
Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro site, which is cleaved by a
genetically engineered form of human rhinovirus 3C protease after
the Gln (Stevens, 2003, supra).
Polynucleotides
[0140] The present invention also relates to isolated
polynucleotides comprising or consisting of nucleotide sequences
that encode polypeptides having peroxygenase activity of the
present invention.
[0141] In a preferred aspect, the nucleotide sequence comprises or
consists of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7,
SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID
NO:17. In another more preferred aspect, the nucleotide sequence
comprises or consists of the sequence contained in the plasmid
which is contained in E. coli NN049991 deposited 14 March 2008
under the terms of the Budapest Treaty with the DSMZ under accesion
number DSM 21289; or which is encoded by the polynucleotide
contained in the plasmid which is contained in E. coli NN049992
deposited 14 March 2008 under the terms of the Budapest Treaty with
the DSMZ under accesion number DSM 21290. In another preferred
aspect, the nucleotide sequence comprises or consists of the mature
polypeptide coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID
NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID
NO:15 or SEQ ID NO:17. In another preferred aspect, the nucleotide
sequence comprises or consists of nucleotides 152 to 1141 of SEQ ID
NO: 1. In another more preferred aspect, the nucleotide sequence
comprises or consists of the mature polypeptide coding sequence
contained in the plasmid which is contained in E. coli NN049991
deposited 14 March 2008 under the terms of the Budapest Treaty with
the DSMZ under accesion number DSM 21289; or which is encoded by
the polynucleotide contained in the plasmid which is contained in
E. coli NN049992 deposited 14 Mar. 2008 under the terms of the
Budapest Treaty with the DSMZ under accesion number DSM 21290.
[0142] The present invention also encompasses nucleotide sequences
that encode polypeptides comprising or consisting of the amino acid
sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID NO:8,
SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14 or SEQ ID NO:19, or the
mature polypeptides thereof, which differ from SEQ ID NO: 1, SEQ ID
NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID
NO:13, SEQ ID NO:15 or SEQ ID NO:17, or the mature polypeptide
coding sequences thereof, by virtue of the degeneracy of the
genetic code. The present invention also relates to subsequences of
SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9,
SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:17, that
encode fragments of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID
NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14 or SEQ ID NO:19
that have peroxygenase activity.
[0143] The present invention also relates to mutant polynucleotides
comprising or consisting of at least one mutation in the mature
polypeptide coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID
NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID
NO:15 or SEQ ID NO:17, in which the mutant nucleotide sequence
encodes the mature polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14 or
SEQ ID NO:19.
[0144] The techniques used to isolate or clone a polynucleotide
encoding a polypeptide are known in the art and include isolation
from genomic DNA, preparation from cDNA, or a combination thereof.
The cloning of the polynucleotides of the present invention from
such genomic DNA can be effected, e.g., by using the well known
polymerase chain reaction (PCR) or antibody screening of expression
libraries to detect cloned DNA fragments with shared structural
features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods
and Application, Academic Press, New York. Other nucleic acid
amplification procedures such as ligase chain reaction (LCR),
ligated activated transcription (LAT) and nucleotide sequence-based
amplification (NASBA) may be used. The polynucleotides may be
cloned from a strain of Basidiomycete, or another or related
organism and thus, for example, may be an allelic or species
variant of the polypeptide encoding region of the nucleotide
sequence.
[0145] The present invention also relates to isolated
polynucleotides comprising or consisting of nucleotide sequences
that have a degree of identity to the mature polypeptide coding
sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7,
SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID
NO:17 of preferably at least 60%, more preferably at least 65%,
more preferably at least 70%, more preferably at least 75%, more
preferably at least 80%, more preferably at least 85%, even more
preferably at least 90%, most preferably at least 95%, and even
most preferably at least 96%, at least 97%, at least 98%, or at
least 99% identity, which encode an active polypeptide.
[0146] Modification of a nucleotide sequence encoding a polypeptide
of the present invention may be necessary for the synthesis of
polypeptides substantially similar to the polypeptide. The term
"substantially similar" to the polypeptide refers to non-naturally
occurring forms of the polypeptide. These polypeptides may differ
in some engineered way from the polypeptide isolated from its
native source, e.g., artificial variants that differ in specific
activity, thermostability, pH optimum, or the like. The variant
sequence may be constructed on the basis of the nucleotide sequence
presented as the mature polypeptide coding sequence of SEQ ID NO:
1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID
NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:17, e.g., a
subsequence thereof, and/or by introduction of nucleotide
substitutions that do not give rise to another amino acid sequence
of the polypeptide encoded by the nucleotide sequence, but which
correspond to the codon usage of the host organism intended for
production of the enzyme, or by introduction of nucleotide
substitutions that may give rise to a different amino acid
sequence. For a general description of nucleotide substitution,
see, e.g., Ford et al., 1991, Protein Expression and Purification
2: 95-107.
[0147] It will be apparent to those skilled in the art that such
substitutions can be made outside the regions critical to the
function of the molecule and still result in an active polypeptide.
Amino acid residues essential to the activity of the polypeptide
encoded by an isolated polynucleotide of the invention, and
therefore preferably not subject to substitution, may be identified
according to procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham
and Wells, 1989, supra). In the latter technique, mutations are
introduced at every positively charged residue in the molecule, and
the resultant mutant molecules are tested for peroxygenase activity
to identify amino acid residues that are critical to the activity
of the molecule. Sites of substrate-enzyme interaction can also be
determined by analysis of the three-dimensional structure as
determined by such techniques as nuclear magnetic resonance
analysis, crystallography or photoaffinity labeling (see, e.g., de
Vos et al., 1992, supra; Smith et al., 1992, supra; Wlodaver et
al., 1992, supra).
[0148] The present invention also relates to isolated
polynucleotides encoding polypeptides of the present invention,
which hybridize under very low stringency conditions, preferably
low stringency conditions, more preferably medium stringency
conditions, more preferably medium-high stringency conditions, even
more preferably high stringency conditions, and most preferably
very high stringency conditions with (i) the mature polypeptide
coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID
NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ
ID NO:17, (ii) the cDNA sequence contained in or the genomic DNA
sequence comprising the mature polypeptide coding sequence of SEQ
ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ
ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:17, or (iii) a
full-length complementary strand of (i) or (ii); or allelic
variants and subsequences thereof (Sambrook et al., 1989, supra),
as defined herein. In a preferred aspect, the complementary strand
is the full-length complementary strand of the mature polypeptide
coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID
NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ
ID NO:17.
[0149] The present invention also relates to isolated
polynucleotides obtained by (a) hybridizing a population of DNA
under very low, low, medium, medium-high, high, or very high
stringency conditions with (i) the mature polypeptide coding
sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7,
SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID
NO:17, (ii) the cDNA sequence contained in or the genomic DNA
sequence comprising the mature polypeptide coding sequence of SEQ
ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ
ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:17, or (iii) a
full-length complementary strand of (i) or (ii); and (b) isolating
the hybridizing polynucleotide, which encodes a polypeptide having
peroxygenase activity. In a preferred aspect, the complementary
strand is the full-length complementary strand of the mature
polypeptide coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID
NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID
NO:15 or SEQ ID NO:17.
Nucleic Acid Constructs
[0150] The present invention also relates to nucleic acid
constructs comprising an isolated polynucleotide of the present
invention operably linked to one or more (several) control
sequences that direct the expression of the coding sequence in a
suitable host cell under conditions compatible with the control
sequences.
[0151] An isolated polynucleotide encoding a polypeptide of the
present invention may be manipulated in a variety of ways to
provide for expression of the polypeptide. Manipulation of the
polynucleotide's sequence prior to its insertion into a vector may
be desirable or necessary depending on the expression vector. The
techniques for modifying polynucleotide sequences utilizing
recombinant DNA methods are well known in the art.
[0152] The control sequence may be an appropriate promoter
sequence, a nucleotide sequence that is recognized by a host cell
for expression of a polynucleotide encoding a polypeptide of the
present invention. The promoter sequence contains transcriptional
control sequences that mediate the expression of the polypeptide.
The promoter may be any nucleotide sequence that shows
transcriptional activity in the host cell of choice including
mutant, truncated, and hybrid promoters, and may be obtained from
genes encoding extracellular or intracellular polypeptides either
homologous or heterologous to the host cell.
[0153] Examples of suitable promoters for directing the
transcription of the nucleic acid constructs of the present
invention, especially in a bacterial host cell, are the promoters
obtained from the E. coli lac operon, Streptomyces coelicolor
agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB),
Bacillus licheniformis alpha-amylase gene (amyL), Bacillus
stearothermophilus maltogenic amylase gene (amyM), Bacillus
amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis
penicillinase gene (penP), Bacillus subtilis xylA and xylB genes,
and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978,
Proceedings of the National Academy of Sciences USA 75: 3727-3731),
as well as the tac promoter (DeBoer et al., 1983, Proceedings of
the National Academy of Sciences USA 80: 21-25). Further promoters
are described in "Useful proteins from recombinant bacteria" in
Scientific American, 1980, 242: 74-94; and in Sambrook et al.,
1989, supra.
[0154] Examples of suitable promoters for directing the
transcription of the nucleic acid constructs of the present
invention in a filamentous fungal host cell are promoters obtained
from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor
miehei aspartic proteinase, Aspergillus niger neutral
alpha-amylase, Aspergillus niger acid stable alpha-amylase,
Aspergillus niger or Aspergillus awamori glucoamylase (glaA),
Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease,
Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans
acetamidase, Fusarium venenatum amyloglucosidase (WO 00/56900),
Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
(WO 00/56900), Fusarium oxysporum trypsin-like protease (WO
96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei
cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II,
Trichoderma reesei endoglucanase I, Trichoderma reesei
endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma
reesei endoglucanase IV, Trichoderma reesei endoglucanase V,
Trichoderma reesei xylanase I, Trichoderma reesei xylanase II,
Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter
(a hybrid of the promoters from the genes for Aspergillus niger
neutral alpha-amylase and Aspergillus oryzae triose phosphate
isomerase); and mutant, truncated, and hybrid promoters
thereof.
[0155] In a yeast host, useful promoters are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1,
ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase
(TPI), Saccharomyces cerevisiae metallothionein (CUP1), and
Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful
promoters for yeast host cells are described by Romanos et al.,
1992, Yeast 8: 423-488.
[0156] The control sequence may be a suitable transcription
terminator sequence, a sequence recognized by a host cell to
terminate transcription. The terminator sequence is operably linked
to the 3' terminus of the nucleotide sequence encoding the
polypeptide. Any terminator that is functional in the host cell of
choice may be used in the present invention.
[0157] Preferred terminators for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase,
Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate
synthase, Aspergillus niger alpha-glucosidase, and Fusarium
oxysporum trypsin-like protease.
[0158] Preferred terminators for yeast host cells are obtained from
the genes for Saccharomyces cerevisiae enolase, Saccharomyces
cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae
glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators
for yeast host cells are described by Romanos et al., 1992,
supra.
[0159] The control sequence may also be a suitable leader sequence,
a nontranslated region of an mRNA that is important for translation
by the host cell. The leader sequence is operably linked to the 5'
terminus of the nucleotide sequence encoding the polypeptide. Any
leader sequence that is functional in the host cell of choice may
be used in the present invention.
[0160] Preferred leaders for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase and
Aspergillus nidulans triose phosphate isomerase.
[0161] Suitable leaders for yeast host cells are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae
alpha-factor, and Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH2/GAP).
[0162] The control sequence may also be a polyadenylation sequence,
a sequence operably linked to the 3' terminus of the nucleotide
sequence and, when transcribed, is recognized by the host cell as a
signal to add polyadenosine residues to transcribed mRNA. Any
polyadenylation sequence that is functional in the host cell of
choice may be used in the present invention.
[0163] Preferred polyadenylation sequences for filamentous fungal
host cells are obtained from the genes for Aspergillus oryzae TAKA
amylase, Aspergillus niger glucoamylase, Aspergillus nidulans
anthranilate synthase, Fusarium oxysporum trypsin-like protease,
and Aspergillus niger alpha-glucosidase.
[0164] Useful polyadenylation sequences for yeast host cells are
described by Guo and Sherman, 1995, Molecular Cellular Biology 15:
5983-5990.
[0165] The control sequence may also be a signal peptide coding
sequence that codes for an amino acid sequence linked to the amino
terminus of a polypeptide and directs the encoded polypeptide into
the cell's secretory pathway. The 5' end of the coding sequence of
the nucleotide sequence may inherently contain a signal peptide
coding sequence naturally linked in translation reading frame with
the segment of the coding sequence that encodes the secreted
polypeptide. Alternatively, the 5' end of the coding sequence may
contain a signal peptide coding sequence that is foreign to the
coding sequence. The foreign signal peptide coding sequence may be
required where the coding sequence does not naturally contain a
signal peptide coding sequence. Alternatively, the foreign signal
peptide coding sequence may simply replace the natural signal
peptide coding sequence in order to enhance secretion of the
polypeptide. However, any signal peptide coding sequence that
directs the expressed polypeptide into the secretory pathway of a
host cell of choice, i.e., secreted into a culture medium, may be
used in the present invention.
[0166] Effective signal peptide coding sequences for bacterial host
cells are the signal peptide coding sequences obtained from the
genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus
stearothermophilus alpha-amylase, Bacillus licheniformis
subtilisin, Bacillus licheniformis beta-lactamase, Bacillus
stearothermophilus neutral proteases (nprT, nprS, nprM), Bacillus
clausii alcaline protease (aprH) and Bacillus subtilis prsA.
Further signal peptides are described by Simonen and Palva, 1993,
Microbiological Reviews 57: 109-137.
[0167] Effective signal peptide coding sequences for filamentous
fungal host cells are the signal peptide coding sequences obtained
from the genes for Aspergillus oryzae TAKA amylase, Aspergillus
niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor
miehei aspartic proteinase, Humicola insolens cellulase, Humicola
insolens endoglucanase V, and Humicola lanuginosa lipase.
[0168] Useful signal peptides for yeast host cells are obtained
from the genes for Saccharomyces cerevisiae alpha-factor and
Saccharomyces cerevisiae invertase. Other useful signal peptide
coding sequences are described by Romanos et al., 1992, supra.
[0169] In a preferred aspect, the signal peptide comprises or
consists of amino acids -43 to -1 of SEQ ID NO: 2. In another
preferred aspect, the signal peptide coding sequence comprises or
consists of nucleotides 23 to 151 of SEQ ID NO: 1.
[0170] The control sequence may also be a propeptide coding
sequence that codes for an amino acid sequence positioned at the
amino terminus of a polypeptide. The resultant polypeptide is known
as a proenzyme or propolypeptide (or a zymogen in some cases). A
propeptide is generally inactive and can be converted to a mature
active polypeptide by catalytic or autocatalytic cleavage of the
propeptide from the propolypeptide. The propeptide coding sequence
may be obtained from the genes for Bacillus subtilis alkaline
protease (aprE), Bacillus subtilis neutral protease (nprT),
Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic
proteinase, and Myceliophthora thermophila laccase (WO
95/33836).
[0171] Where both signal peptide and propeptide sequences are
present at the amino terminus of a polypeptide, the propeptide
sequence is positioned next to the amino terminus of a polypeptide
and the signal peptide sequence is positioned next to the amino
terminus of the propeptide sequence.
[0172] It may also be desirable to add regulatory sequences that
allow the regulation of the expression of the polypeptide relative
to the growth of the host cell. Examples of regulatory systems are
those that cause the expression of the gene to be turned on or off
in response to a chemical or physical stimulus, including the
presence of a regulatory compound. Regulatory systems in
prokaryotic systems include the lac, tac, xyl and trp operator
systems. In yeast, the ADH2 system or GAL1 system may be used. In
filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus
niger glucoamylase promoter, and Aspergillus oryzae glucoamylase
promoter may be used as regulatory sequences. Other examples of
regulatory sequences are those that allow for gene amplification.
In eukaryotic systems, these regulatory sequences include the
dihydrofolate reductase gene that is amplified in the presence of
methotrexate, and the metallothionein genes that are amplified with
heavy metals. In these cases, the nucleotide sequence encoding the
polypeptide would be operably linked with the regulatory
sequence.
Expression Vectors
[0173] The present invention also relates to recombinant expression
vectors comprising a polynucleotide of the present invention, a
promoter, and transcriptional and translational stop signals. The
various nucleic acids and control sequences described herein may be
joined together to produce a recombinant expression vector that may
include one or more (several) convenient restriction sites to allow
for insertion or substitution of the nucleotide sequence encoding
the polypeptide at such sites. Alternatively, a polynucleotide
sequence of the present invention may be expressed by inserting the
nucleotide sequence or a nucleic acid construct comprising the
sequence into an appropriate vector for expression. In creating the
expression vector, the coding sequence is located in the vector so
that the coding sequence is operably linked with the appropriate
control sequences for expression.
[0174] The recombinant expression vector may be any vector (e.g., a
plasmid or virus) that can be conveniently subjected to recombinant
DNA procedures and can bring about expression of the nucleotide
sequence. The choice of the vector will typically depend on the
compatibility of the vector with the host cell into which the
vector is to be introduced. The vectors may be linear or closed
circular plasmids.
[0175] The vector may be an autonomously replicating vector, i.e.,
a vector that exists as an extrachromosomal entity, the replication
of which is independent of chromosomal replication, e.g., a
plasmid, an extrachromosomal element, a minichromosome, or an
artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
that, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated. Furthermore, a single vector or plasmid or two
or more vectors or plasmids that together contain the total DNA to
be introduced into the genome of the host cell, or a transposon,
may be used.
[0176] The vectors of the present invention preferably contain one
or more (several) selectable markers that permit easy selection of
transformed, transfected, transduced, or the like cells. A
selectable marker is a gene the product of which provides for
biocide or viral resistance, resistance to heavy metals,
prototrophy to auxotrophs, and the like.
[0177] Examples of bacterial selectable markers are the dal genes
from Bacillus subtilis or Bacillus licheniformis, or markers that
confer antibiotic resistance such as ampicillin, kanamycin,
chloramphenicol, or tetracycline resistance. Suitable markers for
yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.
Selectable markers for use in a filamentous fungal host cell
include, but are not limited to, amdS (acetamidase), argB
(ornithine carbamoyltransferase), bar (phosphinothricin
acetyltransferase), hph (hygromycin phosphotransferase), niaD
(nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase),
sC (sulfate adenyltransferase), and trpC (anthranilate synthase),
as well as equivalents thereof. Preferred for use in an Aspergillus
cell are the amdS and pyrG genes of Aspergillus nidulans or
Aspergillus oryzae and the bar gene of Streptomyces
hygroscopicus.
[0178] The vectors of the present invention preferably contain an
element(s) that permits integration of the vector into the host
cell's genome or autonomous replication of the vector in the cell
independent of the genome.
[0179] For integration into the host cell genome, the vector may
rely on the polynucleotide's sequence encoding the polypeptide or
any other element of the vector for integration into the genome by
homologous or nonhomologous recombination. Alternatively, the
vector may contain additional nucleotide sequences for directing
integration by homologous recombination into the genome of the host
cell at a precise location(s) in the chromosome(s). To increase the
likelihood of integration at a precise location, the integrational
elements should preferably contain a sufficient number of nucleic
acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000
base pairs, and most preferably 800 to 10,000 base pairs, which
have a high degree of identity to the corresponding target sequence
to enhance the probability of homologous recombination. The
integrational elements may be any sequence that is homologous with
the target sequence in the genome of the host cell. Furthermore,
the integrational elements may be non-encoding or encoding
nucleotide sequences. On the other hand, the vector may be
integrated into the genome of the host cell by non-homologous
recombination.
[0180] For autonomous replication, the vector may further comprise
an origin of replication enabling the vector to replicate
autonomously in the host cell in question. The origin of
replication may be any plasmid replicator mediating autonomous
replication that functions in a cell. The term "origin of
replication" or "plasmid replicator" is defined herein as a
nucleotide sequence that enables a plasmid or vector to replicate
in vivo.
[0181] Examples of bacterial origins of replication are the origins
of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184
permitting replication in E. coli, and pUB110, pE194, pTA1060, and
pAMR1 permitting replication in Bacillus.
[0182] Examples of origins of replication for use in a yeast host
cell are the 2 micron origin of replication, ARS1, ARS4, the
combination of ARS1 and CEN3, and the combination of ARS4 and
CEN6.
[0183] Examples of origins of replication useful in a filamentous
fungal cell are AMA1 and ANSI (Gems et al., 1991, Gene 98: 61-67;
Cullen et al., 1987, Nucleic Acids Research 15: 9163-9175; WO
00/24883). Isolation of the AMA1 gene and construction of plasmids
or vectors comprising the gene can be accomplished according to the
methods disclosed in WO 00/24883.
[0184] More than one copy of a polynucleotide of the present
invention may be inserted into a host cell to increase production
of the gene product. An increase in the copy number of the
polynucleotide can be obtained by integrating at least one
additional copy of the sequence into the host cell genome or by
including an amplifiable selectable marker gene with the
polynucleotide where cells containing amplified copies of the
selectable marker gene, and thereby additional copies of the
polynucleotide, can be selected for by cultivating the cells in the
presence of the appropriate selectable agent.
[0185] The procedures used to ligate the elements described above
to construct the recombinant expression vectors of the present
invention are well known to one skilled in the art (see, e.g.,
Sambrook et al., 1989, supra).
Host Cells
[0186] The present invention also relates to recombinant host
cells, comprising an isolated polynucleotide of the present
invention, which are advantageously used in the recombinant
production of the polypeptides. A vector comprising a
polynucleotide of the present invention is introduced into a host
cell so that the vector is maintained as a chromosomal integrant or
as a self-replicating extra-chromosomal vector as described
earlier. The term "host cell" encompasses any progeny of a parent
cell that is not identical to the parent cell due to mutations that
occur during replication. The choice of a host cell will to a large
extent depend upon the gene encoding the polypeptide and its
source.
[0187] The host cell may be any cell useful in the recombinant
production of a polypeptide of the present invention, e.g., a
prokaryote or a eukaryote.
[0188] The prokaryotic host cell may be any Gram positive bacterium
or a Gram negative bacterium. Gram positive bacteria include, but
not limited to, Bacillus, Streptococcus, Streptomyces,
Staphylococcus, Enterococcus, Lactobacillus, Lactococcus,
Clostridium, Geobacillus, and Oceanobacillus. Gram negative
bacteria include, but not limited to, E. coli, Pseudomonas,
Salmonella, Campylobacter, Helicobacter, Flavobacterium,
Fusobacterium, Ilyobacter, Neisseria, and Ureaplasma.
[0189] The bacterial host cell may be any Bacillus cell. Bacillus
cells useful in the practice of the present invention include, but
are not limited to, Bacillus alkalophilus, Bacillus
amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus
clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus,
Bacillus lentus, Bacillus licheniformis, Bacillus megaterium,
Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis,
and Bacillus thuringiensis cells.
[0190] In a preferred aspect, the bacterial host cell is a Bacillus
amyloliquefaciens, Bacillus lentus, Bacillus licheniformis,
Bacillus stearothermophilus or Bacillus subtilis cell. In a more
preferred aspect, the bacterial host cell is a Bacillus
amyloliquefaciens cell. In another more preferred aspect, the
bacterial host cell is a Bacillus clausii cell. In another more
preferred aspect, the bacterial host cell is a Bacillus
licheniformis cell. In another more preferred aspect, the bacterial
host cell is a Bacillus subtilis cell.
[0191] The bacterial host cell may also be any Streptococcus cell.
Streptococcus cells useful in the practice of the present invention
include, but are not limited to, Streptococcus equisimilis,
Streptococcus pyogenes, Streptococcus uberis, and Streptococcus
equi subsp. Zooepidemicus cells.
[0192] In a preferred aspect, the bacterial host cell is a
Streptococcus equisimilis cell. In another preferred aspect, the
bacterial host cell is a Streptococcus pyogenes cell. In another
preferred aspect, the bacterial host cell is a Streptococcus uberis
cell. In another preferred aspect, the bacterial host cell is a
Streptococcus equi subsp. Zooepidemicus cell.
[0193] The bacterial host cell may also be any Streptomyces cell.
Streptomyces cells useful in the practice of the present invention
include, but are not limited to, Streptomyces achromogenes,
Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces
griseus, and Streptomyces lividans cells.
[0194] In a preferred aspect, the bacterial host cell is a
Streptomyces achromogenes cell. In another preferred aspect, the
bacterial host cell is a Streptomyces avermitilis cell. In another
preferred aspect, the bacterial host cell is a Streptomyces
coelicolor cell. In another preferred aspect, the bacterial host
cell is a Streptomyces griseus cell. In another preferred aspect,
the bacterial host cell is a Streptomyces lividans cell.
[0195] The introduction of DNA into a Bacillus cell may, for
instance, be effected by protoplast transformation (see, e.g.,
Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), by
using competent cells (see, e.g., Young and Spizizen, 1961, Journal
of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971,
Journal of Molecular Biology 56: 209-221), by electroporation (see,
e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by
conjugation (see, e.g., Koehler and Thorne, 1987, Journal of
Bacteriology 169: 5271-5278). The introduction of DNA into an E
coli cell may, for instance, be effected by protoplast
transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166:
557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic
Acids Res. 16: 6127-6145). The introduction of DNA into a
Streptomyces cell may, for instance, be effected by protoplast
transformation and electroporation (see, e.g., Gong et al., 2004,
Folia Microbiol. (Praha) 49: 399-405), by conjugation (see, e.g.,
Mazodier et al., 1989, J. Bacteriol. 171: 3583-3585), or by
transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci.
USA 98: 6289-6294). The introduction of DNA into a Pseudomonas cell
may, for instance, be effected by electroporation (see, e.g., Choi
et al., 2006, J. Microbiol. Methods 64: 391-397) or by conjugation
(see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71:
51-57). The introduction of DNA into a Streptococcus cell may, for
instance, be effected by natural competence (see, e.g., Perry and
Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), by protoplast
transformation (see, e.g., Catt and Jollick, 1991, Microbios. 68:
189-2070, by electroporation (see, e.g., Buckley et al., 1999,
Appl. Environ. Microbiol. 65: 3800-3804) or by conjugation (see,
e.g., Clewell, 1981, Microbiol. Rev. 45: 409-436). However, any
method known in the art for introducing DNA into a host cell can be
used.
[0196] The host cell may also be a eukaryote, such as a mammalian,
insect, plant, or fungal cell.
[0197] In a preferred aspect, the host cell is a fungal cell.
"Fungi" as used herein includes the phyla Ascomycota,
Basidiomycota, Chytridiomycota, and Zygomycota (as defined by
Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The
Fungi, 8th edition, 1995, CAB International, University Press,
Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et
al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et
al., 1995, supra).
[0198] In a more preferred aspect, the fungal host cell is a yeast
cell. "Yeast" as used herein includes ascosporogenous yeast
(Endomycetales), basidiosporogenous yeast, and yeast belonging to
the Fungi Imperfecti (Blastomycetes). Since the classification of
yeast may change in the future, for the purposes of this invention,
yeast shall be defined as described in Biology and Activities of
Yeast (Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds,
Soc. App. Bacteriol. Symposium Series No. 9, 1980).
[0199] In an even more preferred aspect, the yeast host cell is a
Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces,
Schizosaccharomyces, or Yarrowia cell. In a most preferred aspect,
the yeast host cell is a Saccharomyces carlsbergensis,
Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces
douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or
Saccharomyces oviformis cell. In another most preferred aspect, the
yeast host cell is a Kluyveromyces lactis cell. In another most
preferred aspect, the yeast host cell is a Yarrowia lipolytica
cell. In another more preferred aspect, the fungal host cell is a
filamentous fungal cell.
[0200] "Filamentous fungi" include all filamentous forms of the
subdivision Eumycota and Oomycota (as defined by Hawksworth et al.,
1995, supra). The filamentous fungi are generally characterized by
a mycelial wall composed of chitin, cellulose, glucan, chitosan,
mannan, and other complex polysaccharides. Vegetative growth is by
hyphal elongation and carbon catabolism is obligately aerobic. In
contrast, vegetative growth by yeasts such as Saccharomyces
cerevisiae is by budding of a unicellular thallus and carbon
catabolism may be fermentative.
[0201] In an even more preferred aspect, the filamentous fungal
host cell is an Acremonium, Aspergillus, Aureobasidium,
Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus,
Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor,
Myceliophthora, Neocallimastix, Neurospora, Paecilomyces,
Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus,
Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium,
Trametes, or Trichoderma cell.
[0202] In a most preferred aspect, the filamentous fungal host cell
is an Aspergillus awamori, Aspergillus fumigatus, Aspergillus
foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus
niger or Aspergillus oryzae cell. In another most preferred aspect,
the filamentous fungal host cell is a Fusarium bactridioides,
Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum,
Fusarium graminearum, Fusarium graminum, Fusarium heterosporum,
Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum,
Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum,
Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum,
Fusarium trichothecioides, or Fusarium venenatum cell. In another
most preferred aspect, the filamentous fungal host cell is a
Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina,
Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis
pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa,
Ceriporiopsis subvermispora, Chrysosporium keratinophilum,
Chrysosporium lucknowense, Chrysosporium tropicum, Chrysosporium
merdarium, Chrysosporium inops, Chrysosporium pannicola,
Chrysosporium queenslandicum, Chrysosporium zonatum, Coprinus
cinereus, Coriolus hirsutus, Humicola insolens, Humicola
lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora
crassa, Penicillium purpurogenum, Phanerochaete chrysosporium,
Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes
villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma
koningii, Trichoderma longibrachiatum, Trichoderma reesei, or
Trichoderma viride cell.
[0203] Fungal cells may be transformed by a process involving
protoplast formation, transformation of the protoplasts, and
regeneration of the cell wall in a manner known per se. Suitable
procedures for transformation of Aspergillus and Trichoderma host
cells are described in EP 238 023 and Yelton et al., 1984,
Proceedings of the National Academy of Sciences USA 81: 1470-1474.
Suitable methods for transforming Fusarium species are described by
Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast
may be transformed using the procedures described by Becker and
Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to
Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume
194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983,
Journal of Bacteriology 153: 163; and Hinnen et al., 1978,
Proceedings of the National Academy of Sciences USA 75: 1920.
Methods of Production
[0204] The present invention also relates to methods of producing a
polypeptide of the present invention, comprising: (a) cultivating a
cell, which in its wild-type form produces the polypeptide, under
conditions conducive for production of the polypeptide; and (b)
recovering the polypeptide.
[0205] The present invention also relates to methods of producing a
polypeptide of the present invention, comprising: (a) cultivating a
recombinant host cell, as described herein, under conditions
conducive for production of the polypeptide; and (b) recovering the
polypeptide.
[0206] The present invention also relates to methods of producing a
polypeptide of the present invention, comprising: (a) cultivating a
recombinant host cell under conditions conducive for production of
the polypeptide, wherein the host cell comprises a mutant
nucleotide sequence having at least one mutation in the mature
polypeptide coding sequence of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID
NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID
NO:15, or SEQ ID NO:17, wherein the mutant nucleotide sequence
encodes a polypeptide that comprises or consists of the mature
polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO:6, SEQ ID
NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 14, or SEQ ID NO:19,
and (b) recovering the polypeptide.
[0207] In the production methods of the present invention, the
cells are cultivated in a nutrient medium suitable for production
of the polypeptide using methods well known in the art. For
example, the cell may be cultivated by shake flask cultivation, and
small-scale or large-scale fermentation (including continuous,
batch, fed-batch, or solid state fermentations) in laboratory or
industrial fermentors performed in a suitable medium and under
conditions allowing the polypeptide to be expressed and/or
isolated. The cultivation takes place in a suitable nutrient medium
comprising carbon and nitrogen sources and inorganic salts, using
procedures known in the art. Suitable media are available from
commercial suppliers or may be prepared according to published
compositions (e.g., in catalogues of the American Type Culture
Collection). If the polypeptide is secreted into the nutrient
medium, the polypeptide can be recovered directly from the medium.
If the polypeptide is not secreted into the medium, it can be
recovered from cell lysates.
[0208] The polypeptides may be detected using methods known in the
art that are specific for the polypeptides. These detection methods
may include use of specific antibodies, formation of an enzyme
product, or disappearance of an enzyme substrate. For example, an
enzyme assay may be used to determine the activity of the
polypeptide as described herein.
[0209] The resulting polypeptide may be recovered using methods
known in the art. For example, the polypeptide may be recovered
from the nutrient medium by conventional procedures including, but
not limited to, centrifugation, filtration, extraction,
spray-drying, evaporation, or precipitation.
[0210] The polypeptides of the present invention may be purified by
a variety of procedures known in the art including, but not limited
to, chromatography (e.g., ion exchange, affinity, hydrophobic,
chromatofocusing, and size exclusion), electrophoretic procedures
(e.g., preparative isoelectric focusing), differential solubility
(e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction
(see, e.g., Protein Purification, J.-C. Janson and Lars Ryden,
editors, VCH Publishers, New York, 1989) to obtain substantially
pure polypeptides.
Transgenic Plants
[0211] The present invention also relates to plants, e.g., a
transgenic plant, plant part, or plant cell, comprising an isolated
polynucleotide encoding a polypeptide having peroxygenase activity
of the present invention so as to express and produce the
polypeptide in recoverable quantities. The polypeptide may be
recovered from the plant or plant part. Alternatively, the plant or
plant part containing the recombinant polypeptide may be used as
such for improving the quality of a food or feed, e.g., improving
nutritional value, palatability, and rheological properties, or to
destroy an antinutritive factor.
[0212] The transgenic plant can be dicotyledonous (a dicot) or
monocotyledonous (a monocot). Examples of monocot plants are
grasses, such as meadow grass (blue grass, Poa), forage grass such
as Festuca, Lolium, temperate grass, such as Agrostis, and cereals,
e.g., wheat, oats, rye, barley, rice, sorghum, and maize
(corn).
[0213] Examples of dicot plants are tobacco, legumes, such as
lupins, potato, sugar beet, pea, bean and soybean, and cruciferous
plants (family Brassicaceae), such as cauliflower, rape seed, and
the closely related model organism Arabidopsis thaliana.
[0214] Examples of plant parts are stem, callus, leaves, root,
fruits, seeds, and tubers as well as the individual tissues
comprising these parts, e.g., epidermis, mesophyll, parenchyme,
vascular tissues, meristems. Specific plant cell compartments, such
as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and
cytoplasm are also considered to be a plant part. Furthermore, any
plant cell, whatever the tissue origin, is considered to be a plant
part. Likewise, plant parts such as specific tissues and cells
isolated to facilitate the utilisation of the invention are also
considered plant parts, e.g., embryos, endosperms, aleurone and
seeds coats.
[0215] Also included within the scope of the present invention are
the progeny of such plants, plant parts, and plant cells.
[0216] The transgenic plant or plant cell expressing a polypeptide
of the present invention may be constructed in accordance with
methods known in the art. In short, the plant or plant cell is
constructed by incorporating one or more (several) expression
constructs encoding a polypeptide of the present invention into the
plant host genome or chloroplast genome and propagating the
resulting modified plant or plant cell into a transgenic plant or
plant cell.
[0217] The expression construct is conveniently a nucleic acid
construct that comprises a polynucleotide encoding a polypeptide of
the present invention operably linked with appropriate regulatory
sequences required for expression of the nucleotide sequence in the
plant or plant part of choice. Furthermore, the expression
construct may comprise a selectable marker useful for identifying
host cells into which the expression construct has been integrated
and DNA sequences necessary for introduction of the construct into
the plant in question (the latter depends on the DNA introduction
method to be used).
[0218] The choice of regulatory sequences, such as promoter and
terminator sequences and optionally signal or transit sequences is
determined, for example, on the basis of when, where, and how the
polypeptide is desired to be expressed. For instance, the
expression of the gene encoding a polypeptide of the present
invention may be constitutive or inducible, or may be
developmental, stage or tissue specific, and the gene product may
be targeted to a specific tissue or plant part such as seeds or
leaves. Regulatory sequences are, for example, described by Tague
et al., 1988, Plant Physiology 86: 506.
[0219] For constitutive expression, the 35S-CaMV, the maize
ubiquitin 1, and the rice actin 1 promoter may be used (Franck et
al., 1980, Cell 21: 285-294, Christensen et al., 1992, Plant Mo.
Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165).
organ-specific promoters may be, for example, a promoter from
storage sink tissues such as seeds, potato tubers, and fruits
(Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or
from metabolic sink tissues such as meristems (Ito et al., 1994,
Plant Mol. Biol. 24: 863-878), a seed specific promoter such as the
glutelin, prolamin, globulin, or albumin promoter from rice (Wu et
al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba
promoter from the legumin B4 and the unknown seed protein gene from
Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152:
708-711), a promoter from a seed oil body protein (Chen et al.,
1998, Plant and Cell Physiology 39: 935-941), the storage protein
napA promoter from Brassica napus, or any other seed specific
promoter known in the art, e.g., as described in WO 91/14772.
Furthermore, the promoter may be a leaf specific promoter such as
the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant
Physiology 102: 991-1000, the chlorella virus adenine
methyltransferase gene promoter (Mitra and Higgins, 1994, Plant
Molecular Biology 26: 85-93), or the aldP gene promoter from rice
(Kagaya et al., 1995, Molecular and General Genetics 248: 668-674),
or a wound inducible promoter such as the potato pin2 promoter (Xu
et al., 1993, Plant Molecular Biology 22: 573-588). Likewise, the
promoter may inducible by abiotic treatments such as temperature,
drought, or alterations in salinity or induced by exogenously
applied substances that activate the promoter, e.g., ethanol,
oestrogens, plant hormones such as ethylene, abscisic acid, and
gibberellic acid, and heavy metals.
[0220] A promoter enhancer element may also be used to achieve
higher expression of a polypeptide of the present invention in the
plant. For instance, the promoter enhancer element may be an intron
that is placed between the promoter and the nucleotide sequence
encoding a polypeptide of the present invention. For instance, Xu
et al., 1993, supra, disclose the use of the first intron of the
rice actin 1 gene to enhance expression.
[0221] The selectable marker gene and any other parts of the
expression construct may be chosen from those available in the
art.
[0222] The nucleic acid construct is incorporated into the plant
genome according to conventional techniques known in the art,
including Agrobacterium-mediated transformation, virus-mediated
transformation, microinjection, particle bombardment, biolistic
transformation, and electroporation (Gasser et al., 1990, Science
244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al.,
1989, Nature 338: 274).
[0223] Presently, Agrobacterium tumefaciens-mediated gene transfer
is the method of choice for generating transgenic dicots (for a
review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology
19: 15-38) and can also be used for transforming monocots, although
other transformation methods are often used for these plants.
Presently, the method of choice for generating transgenic monocots
is particle bombardment (microscopic gold or tungsten particles
coated with the transforming DNA) of embryonic calli or developing
embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994,
Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992,
Bio/Technology 10: 667-674). An alternative method for
transformation of monocots is based on protoplast transformation as
described by Omirulleh et al., 1993, Plant Molecular Biology 21:
415-428.
[0224] Following transformation, the transformants having
incorporated the expression construct are selected and regenerated
into whole plants according to methods well-known in the art. Often
the transformation procedure is designed for the selective
elimination of selection genes either during regeneration or in the
following generations by using, for example, co-transformation with
two separate T-DNA constructs or site specific excision of the
selection gene by a specific recombinase.
[0225] The present invention also relates to methods of producing a
polypeptide of the present invention comprising: (a) cultivating a
transgenic plant or a plant cell comprising a polynucleotide
encoding the polypeptide having peroxygenase activity of the
present invention under conditions conducive for production of the
polypeptide; and (b) recovering the polypeptide.
Removal or Reduction of Peroxygenase Activity
[0226] The present invention also relates to methods of producing a
mutant of a parent cell, which comprises disrupting or deleting a
polynucleotide sequence, or a portion thereof, encoding a
polypeptide of the present invention, which results in the mutant
cell producing less of the polypeptide than the parent cell when
cultivated under the same conditions.
[0227] The mutant cell may be constructed by reducing or
eliminating expression of a nucleotide sequence encoding a
polypeptide of the present invention using methods well known in
the art, for example, insertions, disruptions, replacements, or
deletions. In a preferred aspect, the nucleotide sequence is
inactivated. The nucleotide sequence to be modified or inactivated
may be, for example, the coding region or a part thereof essential
for activity, or a regulatory element required for the expression
of the coding region. An example of such a regulatory or control
sequence may be a promoter sequence or a functional part thereof,
i.e., a part that is sufficient for affecting expression of the
nucleotide sequence. Other control sequences for possible
modification include, but are not limited to, a leader,
polyadenylation sequence, propeptide sequence, signal peptide
sequence, transcription terminator, and transcriptional
activator.
[0228] Modification or inactivation of the nucleotide sequence may
be performed by subjecting the parent cell to mutagenesis and
selecting for mutant cells in which expression of the nucleotide
sequence has been reduced or eliminated. The mutagenesis, which may
be specific or random, may be performed, for example, by use of a
suitable physical or chemical mutagenizing agent, by use of a
suitable oligonucleotide, or by subjecting the DNA sequence to PCR
generated mutagenesis. Furthermore, the mutagenesis may be
performed by use of any combination of these mutagenizing
agents.
[0229] Examples of a physical or chemical mutagenizing agent
suitable for the present purpose include ultraviolet (UV)
irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine
(MNNG), 0-methyl hydroxylamine, nitrous acid, ethyl methane
sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide
analogues.
[0230] When such agents are used, the mutagenesis is typically
performed by incubating the parent cell to be mutagenized in the
presence of the mutagenizing agent of choice under suitable
conditions, and screening and/or selecting for mutant cells
exhibiting reduced or no expression of the gene.
[0231] Modification or inactivation of the nucleotide sequence may
be accomplished by introduction, substitution, or removal of one or
more (several) nucleotides in the gene or a regulatory element
required for the transcription or translation thereof. For example,
nucleotides may be inserted or removed so as to result in the
introduction of a stop codon, the removal of the start codon, or a
change in the open reading frame. Such modification or inactivation
may be accomplished by site-directed mutagenesis or PCR generated
mutagenesis in accordance with methods known in the art. Although,
in principle, the modification may be performed in vivo, i.e.,
directly on the cell expressing the nucleotide sequence to be
modified, it is preferred that the modification be performed in
vitro as exemplified below.
[0232] An example of a convenient way to eliminate or reduce
expression of a nucleotide sequence by a cell is based on
techniques of gene replacement, gene deletion, or gene disruption.
For example, in the gene disruption method, a nucleic acid sequence
corresponding to the endogenous nucleotide sequence is mutagenized
in vitro to produce a defective nucleic acid sequence that is then
transformed into the parent cell to produce a defective gene. By
homologous recombination, the defective nucleic acid sequence
replaces the endogenous nucleotide sequence. It may be desirable
that the defective nucleotide sequence also encodes a marker that
may be used for selection of transformants in which the nucleotide
sequence has been modified or destroyed. In a particularly
preferred aspect, the nucleotide sequence is disrupted with a
selectable marker such as those described herein.
[0233] Alternatively, modification or inactivation of the
nucleotide sequence may be performed by established anti-sense or
RNAi techniques using a sequence complementary to the nucleotide
sequence. More specifically, expression of the nucleotide sequence
by a cell may be reduced or eliminated by introducing a sequence
complementary to the nucleotide sequence of the gene that may be
transcribed in the cell and is capable of hybridizing to the mRNA
produced in the cell. Under conditions allowing the complementary
anti-sense nucleotide sequence to hybridize to the mRNA, the amount
of protein translated is thus reduced or eliminated.
[0234] The present invention further relates to a mutant cell of a
parent cell that comprises a disruption or deletion of a nucleotide
sequence encoding the polypeptide or a control sequence thereof,
which results in the mutant cell producing less of the polypeptide
or no polypeptide compared to the parent cell.
[0235] The polypeptide-deficient mutant cells so created are
particularly useful as host cells for the expression of native
and/or heterologous polypeptides. Therefore, the present invention
further relates to methods of producing a native or heterologous
polypeptide comprising: (a) cultivating the mutant cell under
conditions conducive for production of the polypeptide; and (b)
recovering the polypeptide. The term "heterologous polypeptides" is
defined herein as polypeptides that are not native to the host
cell, a native protein in which modifications have been made to
alter the native sequence, or a native protein whose expression is
quantitatively altered as a result of a manipulation of the host
cell by recombinant DNA techniques.
[0236] In a further aspect, the present invention relates to a
method of producing a protein product essentially free of
peroxygenase activity by fermentation of a cell that produces both
a polypeptide of the present invention as well as the protein
product of interest by adding an effective amount of an agent
capable of inhibiting peroxygenase activity to the fermentation
broth before, during, or after the fermentation has been completed,
recovering the product of interest from the fermentation broth, and
optionally subjecting the recovered product to further
purification.
[0237] In a further aspect, the present invention relates to a
method of producing a protein product essentially free of
peroxygenase activity by cultivating the cell under conditions
permitting the expression of the product, subjecting the resultant
culture broth to a combined pH and temperature treatment so as to
reduce the peroxygenase activity substantially, and recovering the
product from the culture broth. Alternatively, the combined pH and
temperature treatment may be performed on an enzyme preparation
recovered from the culture broth. The combined pH and temperature
treatment may optionally be used in combination with a treatment
with a peroxygenase inhibitor.
[0238] In accordance with this aspect of the invention, it is
possible to remove at least 60%, preferably at least 75%, more
preferably at least 85%, still more preferably at least 95%, and
most preferably at least 99% of the peroxygenase activity. Complete
removal of peroxygenase activity may be obtained by use of this
method.
[0239] The combined pH and temperature treatment is preferably
carried out at a pH in the range of 2-4 or 9-11 and a temperature
in the range of at least 60-70.degree. C. for a sufficient period
of time to attain the desired effect, where typically, 30 to 60
minutes is sufficient.
[0240] The methods used for cultivation and purification of the
product of interest may be performed by methods known in the
art.
[0241] The methods of the present invention for producing an
essentially peroxygenase-free product is of particular interest in
the production of eukaryotic polypeptides, in particular fungal
proteins such as enzymes. The enzyme may be selected from, e.g., an
amylolytic enzyme, lipolytic enzyme, proteolytic enzyme, cellulytic
enzyme, oxidoreductase, or plant cell-wall degrading enzyme.
Examples of such enzymes include an aminopeptidase, amylase,
amyloglucosidase, carbohydrase, carboxypeptidase, catalase,
cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin
glycosyltransferase, deoxyribonuclease, endoglucanase, esterase,
galactosidase, beta-galactosidase, glucoamylase, glucose oxidase,
glucosidase, haloperoxidase, hemicellulase, invertase, isomerase,
laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinolytic
enzyme, peroxidase, phytase, phenoloxidase, polyphenoloxidase,
proteolytic enzyme, ribonuclease, transferase, transglutaminase, or
xylanase. The peroxygenase-deficient cells may also be used to
express heterologous proteins of pharmaceutical interest such as
hormones, growth factors, receptors, and the like.
[0242] It will be understood that the term "eukaryotic
polypeptides" includes not only native polypeptides, but also those
polypeptides, e.g., enzymes, which have been modified by amino acid
substitutions, deletions or additions, or other such modifications
to enhance activity, thermostability, pH tolerance and the
like.
[0243] In a further aspect, the present invention relates to a
protein product essentially free from peroxygenase activity that is
produced by a method of the present invention.
Compositions
[0244] The present invention also relates to compositions
comprising a polypeptide of the present invention. Preferably, the
compositions are enriched in such a polypeptide. The term
"enriched" indicates that the peroxygenase activity of the
composition has been increased, e.g., with an enrichment factor of
at least 1.1.
[0245] The composition may comprise a polypeptide of the present
invention as the major enzymatic component, e.g., a mono-component
composition. Alternatively, the composition may comprise multiple
enzymatic activities, such as an aminopeptidase, amylase,
carbohydrase, carboxypeptidase, catalase, cellulase, chitinase,
cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease,
esterase, alpha-galactosidase, beta-galactosidase, glucoamylase,
alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase,
laccase, lipase, mannosidase, oxidase, pectinolytic enzyme,
peptidoglutaminase, peroxidase, phytase, polyphenoloxidase,
proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
The additional enzyme(s) may be produced, for example, by a
microorganism belonging to the genus Aspergillus, preferably
Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus,
Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans,
Aspergillus niger, or Aspergillus oryzae; Fusarium, preferably
Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense,
Fusarium culmorum, Fusarium graminearum, Fusarium graminum,
Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum,
Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum,
Fusarium sarcochroum, Fusarium sulphureum, Fusarium toruloseum,
Fusarium trichothecioides, or Fusarium venenatum; Humicola,
preferably Humicola insolens or Humicola lanuginosa; or
Trichoderma, preferably Trichoderma harzianum, Trichoderma
koningii, Trichoderma longibrachiatum, Trichoderma reesei, or
Trichoderma viride.
[0246] The polypeptide compositions may be prepared in accordance
with methods known in the art and may be in the form of a liquid or
a dry composition. For instance, the polypeptide composition may be
in the form of a granulate or a microgranulate. The polypeptide to
be included in the composition may be stabilized in accordance with
methods known in the art.
[0247] Examples are given below of preferred uses of the
polypeptide compositions of the invention. The dosage of the
polypeptide composition of the invention and other conditions under
which the composition is used may be determined on the basis of
methods known in the art. The present invention is also directed to
methods for using the polypeptides having peroxygenase activity, or
compositions thereof.
Enzymatic Oxygenation of Aromatic N-heterocycles to the
Corresponding N-oxides
[0248] The starting compounds of the formula (I) are preferably
reacted with the aromatic haloperoxidase peroxygenase of the fungus
Agrocybe aegerita (Agrocybe aegerita peroxygenase-Agrocybe aegerita
peroxidase=AaP1), which has a particularly high peroxygenase
activity, and at least one oxidizing agent, whereas the
regioselective oxygenation of the heterocyclic nitrogen occurs.
[0249] The oxidizing agents used according to the invention are
preferably H.sub.2O.sub.2, organic peroxides or hydroperoxides, for
example tert-butyl hydroperoxide, air or oxygen (O.sub.2). It is
possible in the present process to dispense with expensive electron
donors, for example NADH or NADPH (concentration of the oxidizing
agent: 0.01 to 10 mmol/l, preferably 0.1 to 2 mmol/l, of
H.sub.2O.sub.2).
[0250] To further accelerate the conversion of the compound of the
formula (I) with the enzyme AaP1, it is additionally possible to
add H.sub.2O.sub.2-generating enzymes, particularly oxidases, for
example glucose oxidase or aryl alcohol oxidase and substrates
thereof (glucose or benzyl alcohol), to the reaction mixture.
[0251] The basis of the enzymatic, cell-free process according to
the invention is a novel extracellular haloperoxidase peroxygenase
(=aromatic peroxygenase) which possesses P450-like catalysis
properties and, in the presence of a suitable oxidizing agent (e.g.
peroxides), particularly in buffered aqueous solutions, oxidizes
aromatic N-heterocycles (e.g. pyridine) to the corresponding
N-oxides, and in doing so achieves a high selectivity (>95%
N-oxide).
[0252] The enzyme used is a specific extracellular heme-thiolate
protein with peroxidase and peroxygenase function. It is formed by
Basidiomycetes of the Bolbitiaceae (e.g. Agrocybe spp.) and
Coprinaceae (e.g. Coprinus spp.) families and is characterized by
specific catalytic properties which distinguish it clearly from
peroxidases and cytochrome P450 enzymes described so far. The
enzyme production is preferably carried out in liquid culture, in
bioreactors and nitrogen-rich media (Ullrich, R., 2005, Thesis, IHI
Zittau; Kluge, M. 2006, Diploma thesis, IHI Zittau).
[0253] The reactions catalysed by the enzyme known as AaP1, in
contrast to chemical syntheses, do not require highly concentrated,
aggressive and environmentally harmful reagents, and, when
recovering the product, it is possible to dispense with
chemical-intensive and time-consuming purification steps to
separate the isomer mixtures. Typically, the enzyme is used in a
concentration of 0.02 U/ml to 10 U/ml of AaP1, especially of 0.09
to 8 U/ml of AaP1. This makes the reaction process described
particularly environmentally friendly.
[0254] A further advantage over purely chemical syntheses consists
in the operation due to the inventive peroxygenase-catalysed
reaction at room temperature and standard air pressure. In a
preferred embodiment, the process is performed in aqueous, buffered
solution. To stabilize the reaction in the aqueous medium, it is
possible to add buffers based on organic acids, preferably citric
acid, and phosphates, preferably potassium hydrogen-phosphate, to
the reaction mixture (buffer concentration: 5 mmol/l to 500 mmol/l,
preferably 20 to 100 mmol/l). Furthermore, it is possible to carry
out the reaction in pH states without buffer with continuous
metered addition of acids or bases.
[0255] To improve the solubility, organic solvents can be added to
the reaction mixture and it is also possible to work in a two-phase
system. Solvents usable according to the invention are protic
solvents, such as methanol or ethanol, or aprotic polar solvents
such as ethers (e.g. diisopropyl ether), acetone, acetonitrile,
DMSO (dimethyl sulphoxide) and DMF (N,N-dimethylformamide).
[0256] The starting compounds of the formula (I) used are
particularly compounds from the following group: pyridine,
substituted pyridines (R.dbd.--X, --NO.sub.2, -alkyl, -phenyl,
--NH.sub.2, --OH), quinoline, isoquinoline and derivatives thereof,
aromatics with several heteroatoms and polycyclic N-heterocycles.
The reaction is performed within a range of from 5.degree. C. to
40.degree. C., preferably at 20-30.degree. C. The reaction times
are typically in the range of from 0.5 to 120 minutes, particularly
in the range of from 5 to 30 minutes. The yields of N-oxides
achieved are within the range of from 10% to 99%, preferably
between 20 and 90%. The advantages of the peroxygenase-catalysed
reaction of N-heterocycles over catalysis with the only other
enzyme capable of oxidizing pyridine to pyridine N-oxide (methane
monooxygenase, MMO) consist of: [0257] i) in the higher specific
activity [0258] ii) in the use of inexpensive peroxides instead of
expensive electron donors [NAD(P)H], [0259] iii) in the
independence of the hydroxylating enzyme from flavin reductases and
regulatory proteins, [0260] iv) in the simple enzyme recovery
without cell disruption and [0261] v) in the high stability of the
extracellular AaP1 and similar peroxygenases compared to the
unstable intracellular and partly membrane-bound MMO.
[0262] With the AaP1-catalysed reactions, it is possible for the
first time to convert nonactivated N-heterocycles such as pyridine
with the aid of a single extracellular biocatalyst which requires
only a peroxide as a cosubstrate in a one-stage process
regioselectively to the corresponding N-oxides (e.g. pyridine
N-oxide). The process can be used in a wide variety of different
sectors of synthesis chemistry, inter alia for the preparation of
active ingredients, pharmaceutical intermediates, specific
catalysts and oxidizing agents, and for the introduction of
protecting groups into unstable molecules. The invention will be
illustrated in more detail below with reference to the example
shown in the drawing, in which the invention is not restricted to
the examples.
Applications of Peroxygenases in the Pulp & Paper Industry.
[0263] The peroxygenase can in a preferred embodiment be used for
different applications within the pulp & paper industry. The
enzyme can be used to increase delignification in bleaching
processes of Kraft pulps, mechanical pulps and chemi-mechanical
pulps. The aim in the bleaching processes is to remove the brown
colored lignin molecules from the cellulose fibers; this is
traditionally typically done in bleaching sequences using oxidative
chemicals as chlorine dioxide, oxygen, ozone or hydrogen peroxide
including as well alkaline extractions in between the oxidative
steps.
[0264] By oxygenation of the aromatic structures in the lignin
molecules the lignin will become more hydrophilic and will when
further degraded by the traditional oxidative chemicals be easier
to extract from the pulp, in that way less traditional bleaching
chemicals are needed to obtain the same brightness level of the
pulp. Also potential side chain hydroxylation of the aromatic
structures, cleavage of alkyl-aryl ethers and oxidation of the
alcohol and aldehyde structures which are present in the complex
lignin structures will improve the bleaching process and save
traditional chemicals.
[0265] In another embodiment also related to delignification of
e.g. Kraft pulps the peroxygenase can be used for in situ
generation of mediators to be used in laccase/mediator or
peroxidase/mediator delignification a process described by e.g.
Call et al, Journal of Biotechnology 53 (1997) p. 163-202. Mediator
species of the so called N--OH type like e.g. hydroxybenzotriazole
are compounds showing high delignification effects in this process.
Hydroxybenzotriazole can be generated in situ in the process by
hydroxylation of the much cheaper compound benzotriazole by the use
of the peroxygenase. Other heterocyclic compounds of the N-OH type
could be generated the same way.
[0266] In another embodiment the peroxygenase enzyme can be used to
improve pitch removal/deresination of both chemical, mechanical and
chemi-mechanical pulps. Pitch and resin are commonly used terms for
the hydrophobic compounds found naturally in the wood. The resin is
removed/degraded in the traditional chemical pulping processes to a
certain extent but some of the compounds are difficult to remove to
the desired extent due to the hydrophobicity of these compounds,
hydroxylation of aromatic structures or oxidation of arylalcohol or
phenolic structures can improve deresination and in that way
improve pulp/paper properties, save downtime for cleaning and
potentially save chemicals otherwise added to keep the hydrophobic
compounds homogeneously suspended in the pulp.
Peroxyqenase within the Water Treatment Industry
[0267] Peroxygenase can be applied for various purposes within the
water treatment industry. Practically all of the envisioned
applications correspond to peroxygenase catalyzed modification of
recalcitrant, toxic persistent and/or bioactive substances.
Modification (i.e. oxidation) of these substances will facilitate
their mitigation by conventional water treatment operations
including but not limited to activated sludges, bioreactors (e.g.
moving bed, upflow sludge blanket, membrane, etc.), aerobic and
anaerobic digesters, clarifiers and lagoons.
[0268] The claimed benefits of specific and catalytic activity of
the peroxygenases within water treatment operations can be grouped
according to the primary deliverable of the modification.
[0269] In the first scenario, peroxygenase-mediated modification of
the substance reduces the hazardous nature of the substance
directly and/or by increasing the bioavailability of the hazardous
substance for subsequent removal by conventional water treatment
operations. Examples include persistent substances such as
herbicides/fungicides (e.g. phenyl urea, phenoxy), atrazine,
phenylhydrocarbons & PAH, insecticides, DDT, PCB, PCDD, PCDF
and surfactants as well as emerging micropollutants (EMPs) such as
endocrine disruptors, pharmaceuticals (e.g.
antibiotics/anti-bacterial agents, estrogenic hormones), personal
care products and the like. For the most part, the substances tend
to be present at low concentration levels which makes the
selectivity and specificity of peroxygenases preferred over more
expensive treatments that tend to be unselective, non-catalytic and
non-regenerative.
[0270] In the second scenario, peroxygenase modification of
substances improves the efficacy/performance of the water treatment
operations. Oxidation of recalcitrant organics (i.e. "non-treated"
and "non-treatable/inert/hard COD") by the peroxygenase lowers the
COD:BOD ratio which may increase the overall removal rate of
conventional water treatment operations without major capital
investment. In a similar fashion, the peroxygenase-mediated
oxidation of potentially toxic substances may improve the health
and efficacy of biological nutrient removal (BNR) systems (e.g.
reactors, digesters, lagoons, sludges, beds, filters and
clarifiers). In addition to improved organic removal rates, the
peroxygenase may enhance methanogenesis by detoxification of
influent and lowering of the COD:BOD ratio.
[0271] In a third scenario, peroxygenase activity may be used to
reduce residual peroxides present in industrial effluents with the
concomitant oxidation of local substances. In a fourth scenario,
peroxygenase activity may be used to improve the flocculating
behaviour of primary and secondary/biological sludges. By
catalyzing the formation of covalent bridges between colloids and
colloids and between colloids and larger flocs, the amount of
chemical used to condition the sludge before conventional
dewatering (e.g. thickener, press, bed, centrifuge, plate and
frame, etc.) may be reduced and/or the dewatering behaviour of the
sludge may be improved with or without added chemistries.
Peroxydenase Applications within Enzymatic Oil Treatment
[0272] Petroleum products are the most important source of energy
and raw materials; however, as the worlds oil reserves become
scarce heavy crude oil and bituminous deposits will have to be
utilized alongside the various developments in renewable energy
sources.
[0273] Heavy crude oil is highly viscous and hard to extract: In
addition heavy crude oil contains high amount of sulfur, nitrogen,
aromatics and heavy metals; compounds which must be reduced prior
to utilization. Different potential applications for utilizing
biotechnology, in particular oxidoreductase based technology, in
refining of petroleum are mentioned by Ayala, M. et al.
(Biocatalysis and Biotransformation, 2007, 25:2, 114-129. The
different embodiments are further described below:
[0274] Asphaltenes are defined as the part of petroleum that is
insoluble in N-alkanes but soluble in toluene. The asphaltene
fraction is thought to be largely responsible for undesirable oil
properties like high viscosity and the propensity to form
emulsions, polymers and coke. Nitrogen, oxygen and sulfur
heteroatoms are present as non- and heterocyclic groups. In
addition, a significant amount of porphyrins (petroporphyrins) can
be found containing nickel and vanadium. Modification of
asphaltenes using peroxygenase will have a range of beneficial
effects: Increased water solubility, increased boiling point, lower
intermolecular interactions, lower viscosity and improved
biological reactivity. Hence, peroxygenases can be applied prior to
upgrading resulting in lower viscosity and reducing the need for
solvents and formation of coke. Combined or subsequent reaction
with oxidoreductases, in particular laccase, phenoloxidase,
haloperoxidase, and peroxidase, or microorganisms, in particular
Rhodococcus erythropolis or similar bacterial cells, will further
enhance the modification or degradation. The treatment can be
conducted prior to desalting, in combination with desalting or
during or following subsequent processing like vacuum distillation,
hydrotreater, hydrocracker or fluid catalytic cracker. Two phase
systems in water or water miscible solvents can optionally be
applied.
[0275] Presence of aromatic compounds in refined fuels leads to
incomplete combustion and a concomitant formation of particulate
matter. Polycyclic aromatic hydrocarbons are considered a potential
health risk because of their carcinogenic and mutagenic activity.
Treatment of polycyclic aromatic hydrocarbons with peroxygenase
results in products which are more soluble and significantly less
mutagenic than the parent compound.
[0276] Heavy metal ions like vanadium and nickel are naturally
present in Canadian Oil Sands bitumen on the order of 300 ppm or
higher. These ions are known to be held tightly via chelation with
biomarkers called petroporphyrins within bitumen. Metal ions are
deleterious to the upgrading of bitumen in that they act to poison
the downstream catalysts used during cracking and hydrotreating.
Heavy metals in petroleum lead to two other major problems. One is
the formation of ash with high concentration of metal oxides,
resulting in waste disposal issues. Second is poisoning of the
catalysts during catalytic cracking decreasing the selectivity and
activity. Currently, there is no remedy for alleviating these
problems; the current practice is to utilize large volumes of
catalyst.
[0277] There has been research into using biotechnology within the
refining industry, although commercial applications are not yet
known. It was shown in the early 1990's by Fedorak et al that a
heme-peroxidase enzyme called chloroperoxidase (CPO) from C. fumago
was capable of breaking the chelation of metal ions by oxidative
ring-opening of petroporphyrin. The released metal ion was
subsequently extracted from the organic layer into the water layer,
away from the bitumen. In the late 1990's, Torres and
Vazquez-Duhalt showed similar reactivity using cytochrome c (a
small heme protein with peroxidase-like activity).
[0278] Although these enzymes showed interesting activity against
petroporphyrins, they have several drawbacks that will make them
impossible for use for large-scale industrial applications. First
of all, in the presence of their substrate (eg: hydrogen peroxide),
the enzymes themselves get oxidized and lose activity. The heme
active site is known to get oxidized by H.sub.2O.sub.2; the
half-lives of these enzymes are on the order of minutes in 1 mM
H.sub.2O.sub.2. Secondly, enzyme expression levels are very
low.
[0279] Treatment of oil, bitumen, asphaltenes or petroporphyrins
with peroxygenase significantly reduces the content of heavy
metals, especially the content of nickel and vanadium. The
treatment is preferable conducted at any stage prior to the
catalytic cracker.
[0280] Regulations regarding liquid hydrocarbon fuels are
continuously requiring lower sulfur content. Traditionally
desulfurization is performed during hydrotreating, where in
addition nitrogen, oxygen and arsenic compounds are reduces or
removed. Peroxygenase treatment can significantly reduce the sulfur
content, in particular if followed by a distillation step. The
treatment can be conducted prior to desalting, in combination with
desalting or during or following subsequent processing like vacuum
distillation, hydrotreater, hydrocracker or fluid catalytic
cracker.
Applications of Fungal Peroxygenase in Drug/Chemical Synthesis
[0281] Similar to cytochrom P450 enzymes the peroxygenases may be
used in the chemical synthesis of various chemicals, including
active pharmaceutical ingredients and intermediates, and
specifically the peroxygenases may be advantageously used for the
synthesis of optically pure chiral compounds. Examples of such
possible peroxygenase catalysed reactions are: [0282] 11
beta-hydroxylation of Reichstein S to hydrocortisone (U.S. Pat. No.
4,353,985) [0283] Conversion of Progesterone into Cortisone
(steroid modification/production). [0284] Production of Pravastin,
an anti-cholesterol drug, from compactin (Biotechnol. Lett. 2003,
25, 1827). [0285] Hydroxylation of R-2-phenoxy propionic acid at
the 4-position. [0286] Biocatalytic production of anticancer drug
perillyl alcohol from limone using a P450 enzyme (Appl. Environ.
Microbiol. 2005, 71, 1737).
[0287] Of particular relevance are compounds that contain
N-oxidized forms of pyridine, pyrrole, pyrrollidine,piperidine,
imidazole, thiazole, morpholine or pyrimidine (Source Refs: J. B.
van Beilen, et al., Trends Biotechnol., 2003, 21, 170. and V. B.
Urlacher and S. Eiben, Trends Biotechnol., 2006, 24, 324).
Peroxygenase Application in Detergent Compositions
[0288] The peroxygenase enzyme of the invention may be added to and
thus become a component of a detergent composition.
[0289] The detergent composition of the invention may for example
be formulated as a hand or machine laundry detergent composition
including a laundry additive composition suitable for pre-treatment
of stained fabrics and a rinse added fabric softener composition,
or be formulated as a detergent composition for use in general
household hard surface cleaning operations, or be formulated for
hand or machine dishwashing operations.
[0290] In a specific aspect, the invention provides a detergent
additive comprising the enzyme of the invention. The detergent
additive as well as the detergent composition may comprise one or
more other enzymes such as a protease, a lipase, a cutinase, an
amylase, a carbohydrase, a cellulase, a pectinase, a mannanase, an
arabinase, a galactanase, a xylanase, an oxidase, e.g., a laccase,
and/or a peroxidase.
[0291] In general the properties of the chosen enzyme(s) should be
compatible with the selected detergent, (i.e. pH-optimum,
compatibility with other enzymatic and non-enzymatic ingredients,
etc.), and the enzyme(s) should be present in effective amounts.
Proteases: Suitable proteases include those of animal, vegetable or
microbial origin. Microbial origin is preferred. Chemically
modified or protein engineered mutants are included. The protease
may be a serine protease or a metallo protease, preferably an
alkaline microbial protease or a trypsin-like protease. Examples of
alkaline proteases are subtilisins, especially those derived from
Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin
309, subtilisin 147 and subtilisin 168 (described in WO 89/06279).
Examples of trypsin-like proteases are trypsin (e.g. of porcine or
bovine origin) and the Fusarium protease described in WO 89/06270
and WO 94/25583.
[0292] Examples of useful proteases are the variants described in
WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially
the variants with substitutions in one or more of the following
positions: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170,
194, 206, 218, 222, 224, 235 and 274 - make references to specific
sequences and positions.
[0293] Preferred commercially available protease enzymes include
Alcalase.TM., Savinas.TM., Primase.TM., Duralase.TM., Esperase.TM.,
and Kannase.TM. (Novozymes NS), Maxatase.TM., Maxacal.TM.,
Maxapem.TM., Properase.TM., Purafect.TM., Purafect OxP.TM.,
FN2.TM., and FN3.TM. (Genencor International Inc.).
Lipases: Suitable lipases include those of bacterial or fungal
origin. Chemically modified or protein engineered mutants are
included. Examples of useful lipases include lipases from Humicola
(synonym Thermomyces), e.g. from H. lanuginosa (T. lanuginosus) as
described in EP 258 068 and EP 305 216 or from H. insolens as
described in WO 96/13580, a Pseudomonas lipase, e.g. from P.
alcaligenes or P. pseudoalcaligenes (EP 218 272), P. cepacia (EP
331 376), P. stutzeri (GB 1,372,034), P. fluorescens, Pseudomonas
sp. strain SD 705 (WO 95/06720 and WO 96/27002), P. wisconsinensis
(WO 96/12012), a Bacillus lipase, e.g. from B. subtilis (Dartois et
al. (1993), Biochemica et Biophysica Acta, 1131, 253-360), B.
stearothermophilus (JP 64/744992) or B. pumilus (WO 91/16422).
Other examples are lipase variants such as those described in WO
92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381, WO
96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO
97/04079 and WO 97/07202.
[0294] Preferred commercially available lipase enzymes include
Lipolase.TM. and Lipolase Ultra.TM. (Novozymes NS).
[0295] Amylases: Suitable amylases (.alpha. and/or .beta.) include
those of bacterial or fungal origin. Chemically modified or protein
engineered mutants are included. Amylases include, for example,
a-amylases obtained from Bacillus, e.g. a special strain of B.
licheniformis, described in more detail in GB 1,296,839.
[0296] Examples of useful amylases are the variants described in WO
94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the
variants with substitutions in one or more of the following
positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188,
190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408, and 444 -
make references to specific sequences and positions.
[0297] Commercially available amylases are Duramyl.TM.,
Termamyl.TM., Fungamyl.TM. and BAN.TM. (Novozymes NS), Rapidase.TM.
and Purastar.TM. (from Genencor International Inc.). Cellulases:
Suitable cellulases include those of bacterial or fungal origin.
Chemically modified or protein engineered mutants are included.
Suitable cellulases include cellulases from the genera Bacillus,
Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium, e.g. the
fungal cellulases produced from Humicola insolens, Myceliophthora
thermophila and Fusarium oxysporum disclosed in U.S. Pat. No.
4,435,307, U.S. Pat. No. 5,648,263, U.S. Pat. No. 5,691,178, U.S.
Pat. No. 5,776,757 and WO 89/09259.
[0298] Especially suitable cellulases are the alkaline or neutral
cellulases having colour care benefits. Examples of such cellulases
are cellulases described in EP 0 495 257, EP 0 531 372, WO
96/11262, WO 96/29397, WO 98/08940. Other examples are cellulase
variants such as those described in WO 94/07998, EP 0 531 315, US
5,457,046, US 5,686,593, US 5,763,254, WO 95/24471, WO 98/12307 and
WO 1999/001544.
[0299] Commercially available cellulases include Celluzyme.TM., and
Carezyme.TM. (Novozymes NS), Clazinase.TM., and Puradax HA.TM.
(Genencor International Inc.), and KAC-500(B).TM. (Kao
Corporation).
[0300] Peroxidases/Oxidases: Suitable peroxidases/oxidases include
those of plant, bacterial or fungal origin. Chemically modified or
protein engineered mutants are included. Examples of useful
peroxidases include peroxidases from Coprinus, e.g. from C.
cinereus, and variants thereof as those described in WO 93/24618,
WO 95/10602, and WO 98/15257.
[0301] Commercially available peroxidases include Guardzyme.TM.
(Novozymes NS).
[0302] The detergent enzyme(s) may be included in a detergent
composition by adding separate additives containing one or more
enzymes, or by adding a combined additive comprising all of these
enzymes. A detergent additive of the invention, i.e. a separate
additive or a combined additive, can be formulated e.g. as a
granulate, a liquid, a slurry, etc. Preferred detergent additive
formulations are granulates, in particular non-dusting granulates,
liquids, in particular stabilized liquids, or slurries.
[0303] Non-dusting granulates may be produced, e.g., as disclosed
in U.S. Pat. No. 4,106,991 and 4,661,452 and may optionally be
coated by methods known in the art. Examples of waxy coating
materials are poly(ethylene oxide) products (polyethyleneglycol,
PEG) with mean molar weights of 1000 to 20000; ethoxylated
nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated
fatty alcohols in which the alcohol contains from 12 to 20 carbon
atoms and in which there are 15 to 80 ethylene oxide units; fatty
alcohols; fatty acids; and mono- and di- and triglycerides of fatty
acids. Examples of film-forming coating materials suitable for
application by fluid bed techniques are given in GB 1483591. Liquid
enzyme pre-partitions may, for instance, be stabilized by adding a
polyol such as propylene glycol, a sugar or sugar alcohol, lactic
acid or boric acid according to established methods. Protected
enzymes may be prepared according to the method disclosed in EP
238,216.
[0304] The detergent composition of the invention may be in any
convenient form, e.g., a bar, a tablet, a powder, a granule, a
paste or a liquid. A liquid detergent may be aqueous, typically
containing up to 70% water and 0-30% organic solvent, or
non-aqueous.
[0305] The detergent composition comprises one or more surfactants,
which may be non-ionic including semi-polar and/or anionic and/or
cationic and/or zwitterionic. The surfactants are typically present
at a level of from 0.1% to 60% by weight.
[0306] When included therein the detergent will usually contain
from about 1% to about 40% of an anionic surfactant such as linear
alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty
alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate,
alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid
or soap.
[0307] When included therein the detergent will usually contain
from about 0.2% to about 40% of a non-ionic surfactant such as
alcohol ethoxylate, nonylphenol ethoxylate, alkylpolyglycoside,
alkyldimethylamineoxide, ethoxylated fatty acid monoethanolamide,
fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or
N-acyl N-alkyl derivatives of glucosamine ("glucamides").
[0308] The detergent may contain 0-65% of a detergent builder or
complexing agent such as zeolite, diphosphate, triphosphate,
phosphonate, carbonate, citrate, nitrilotriacetic acid,
ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic
acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered
silicates (e.g. SKS-6 from Hoechst).
[0309] The detergent may comprise one or more polymers. Examples
are carboxymethylcellulose, poly(vinylpyrrolidone), poly (ethylene
glycol), poly(vinyl alcohol), poly(vinylpyridine-N-oxide),
poly(vinylimidazole), polycarboxylates such as polyacrylates,
maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid
copolymers.
[0310] The detergent may contain a bleaching system which may
comprise a H.sub.2O.sub.2 source such as perborate or percarbonate
which may be combined with a peracid-forming bleach activator such
as tetraacetylethylenediamine or nonanoyloxybenzenesulfonate.
Alternatively, the bleaching system may comprise peroxyacids of
e.g. the amide, imide, or sulfone type.
[0311] The enzyme(s) of the detergent composition of the invention
may be stabilized using conventional stabilizing agents, e.g., a
polyol such as propylene glycol or glycerol, a sugar or sugar
alcohol, lactic acid, boric acid, or a boric acid derivative, e.g.,
an aromatic borate ester, or a phenyl boronic acid derivative such
as 4-formylphenyl boronic acid, and the composition may be
formulated as described in e.g. WO 92/19709 and WO 92/19708.
[0312] The detergent may also contain other conventional detergent
ingredients such as e.g. fabric conditioners including clays, foam
boosters, suds suppressors, anti-corrosion agents, soil-suspending
agents, anti-soil redeposition agents, dyes, bactericides, optical
brighteners, hydrotropes, tarnish inhibitors, or perfumes.
[0313] It is at present contemplated that in the detergent
compositions any enzyme, in particular the enzyme of the invention,
may be added in an amount corresponding to 0.01-100 mg of enzyme
protein per liter of wash liqour, preferably 0.05-5 mg of enzyme
protein per liter of wash liqour, in particular 0.1-1 mg of enzyme
protein per liter of wash liqour.
[0314] The enzyme of the invention may additionally be incorporated
in the detergent formulations disclosed in WO 97/07202 which is
hereby incorporated as reference.
[0315] The invention described and claimed herein is not to be
limited in scope by the specific aspects herein disclosed, since
these aspects are intended as illustrations of several aspects of
the invention. Any equivalent aspects are intended to be within the
scope of this invention. Indeed, various modifications of the
invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description. Such modifications are also intended to fall within
the scope of the appended claims. In the case of conflict, the
present disclosure including definitions will control.
EXAMPLES
Example 1
Cloning of Peroxygenase Genes from A.aegerita and C.radians
[0316] Culture conditions, activity measurement, and purification
of enzyme were previously described for Agrocybe aegerita
peroxidase (Ullrich et al., 2004, Appl. Env. Microbiol. 70(8):
4575-4581) and for Coprinus radians peroxidase (Anh et al., 2007,
Appl Env Microbiol 73(17): 5477-5485).
Isolation of Nucleic Acids and cDNA Synthesis
[0317] Mycelium of Coprinus radians (strain DSMZ 888, cultivation
day 12) and Agrocybe aegerita (strain TM-A1-K, cultivation day 16)
was obtained by filtration from shaking cultures (particular growth
conditions described above). After subsequent lyophilisation (Alpha
2-4 freeze-dryer, Christ, Osterode, Germany) genomic DNA was
isolated using a protocol previously described (Nikolcheva and
Barlocher, 2002). Trizol reagent (Invitrogen, Karlsruhe, Germany)
was used to isolate total RNA, which was stored at -80.degree.
C.
[0318] For cDNA synthesis, total RNA (1.0 microgram) was primed by
using a polyT-anchor primer (polyT-anchor2-primer in case of
Coprinus radians). Afterwards, the total mRNA was reverse
transcribed to cDNA with the anchor sequence added to the 3' end by
using a "RevertAid.TM. H Minus M-MuLV" reverse transcriptase
(Fermentas, St. Leon-Rot, Germany); furthermore by adding 1
microliter TS-Short-primer (10 micromolar) to the reaction mix an
anchor sequence was added to the 5' end of the cDNA using a
protocol according to Matz et al. (1999).
PCR Conditions
[0319] For PCR (polymerase chain reaction) amplifications a
"MasterCycler EP Gradients" gradient cycler (Eppendorf, Hamburg,
Germany) was applied. All primers were obtained from MWG Biotech
(Ebersberg, Germany). Primers used for cDNA synthesis, 3' RACE
(rapid amplification of cDNA ends) and 5' RACE experiments are
listed in table 1. Degenerate primers are listed in table 2.
Specific primers for AaP genes are listed in table 3. Nested PCRs
were performed with the 1:100 diluted PCR products.
TABLE-US-00005 TABLE 1 Primer for cDNA synthesis, 3' and 5' RACE.
Primer sequences are written according to IUPAC nucleotide codes,
the letters `rg` represent ribonucleotide guanosine. SEQ ID Primer
name Primer sequence (5' .fwdarw. 3') NO: polyT-anchor-primer
tagctcgatgcttgcacgcttttttttttttttttt 20 AP-primer
tagctcgatgcttgcacgc 21 polyT-anchor2-primer
tgtaaccgcgtatcagtgctttttttttttttttttv 22 AP2-primer
tgtaaccgcgtatcagtgc 23 TS-short-primer
aagcagtggtatcaacgcagagtacgcrgrgrg 24 heel-carrier primer
gtaatacgactcactatagggcaagcagtggtatcaacgcagagt 25 heel-specific
primer gtaatacgactcactatagggc 26
TABLE-US-00006 TABLE 2 Degenerate primers written according to
IUPAC nucleotide codes, letter "i" represents inosine wobble base.
SEQ Primer Primer sequence ID name (5' .fwdarw. 3') NO: Cop1-For
cciccnccigartaygt 27 Cop5-For gaycayaaratgcc 28 Cop6-Rev
ccaraartcrtcnggcat 29 Aap1-For garcciggnaarccicciggncc 30 Aap2-Rev
gciarngtrttiariccngg 31 Aap4-For aaygciacnaayccng 32 Aap4-Rev
aartciggrttngtngc 33 Aap6-Rev ariccngtiggrttngg 34
TABLE-US-00007 TABLE 3 Specific primers for AaP genes. Primer names
are underlined to distinguish between degenerate and specific AaP
primers SEQ Primer Primer sequence ID name (5' .fwdarw. 3') NO:
1Aap-For1 cgcaacatgaaatacttcagc 35 1Aap-For2 gagccaacacaacctcctggac
36 1Aap-Rev4 ggcataaggtcactggagtcc 37 2Aap-For1
ttctacatgaaatattttcc 38 2Aap-Rev2 aagcaggttgttggaccg 39
[0320] The PCR reactions (25 microliter) contained 10 microliter
PCR Master Mix (HotMaster Mix.TM., 2.5-fold concentrated; 5Prime,
Hamburg, Germany), 1 microliter of each primer from 10 micromolar
stock solutions in case of specific primers and from 100 micromolar
stock solutions for degenerated primers, 1 microliter of cDNA and
PCR grade water. The PCR started with an initial denaturation at
95.degree. C. for 3 min, followed by 35 cycles of denaturation at
95.degree. C. for 45 s, annealing at 52.7.degree. C. (in case of
degenerated primers) or temperature according to "4+2 rule"
(Rychlik and Rhoads (1989), in case of specific primers) for 45 s
and elongation at 72.degree. C. for 1.5 min. Final elongation took
10 min at 72.degree. C.
[0321] The resulting PCR products were purified (SureClean.TM.,
Bioline, Luckenwalde, Germany) and cloned.
Cloning, Sequencing, and Sequence Analysis
[0322] Plasmids derived from dU/A-cloning of PCR fragments with the
pSTBlue-1 AccepTor.TM. Vector Kit (Merck (Novagen), Darmstadt,
Germany) were verified by colony PCR (Sambrook and Maniatis, 1989)
and several independent clones were used for sequencing.
[0323] Sequencing was performed on ALFexpressII equipment in
combination with AutoRead Sequencing.TM. Kit (both GE Healthcare,
Munich, Germany). Software BioEdit 7.0 was used for sequence
analyses and multiple alignments (Hall, 1999, Nucleic Acids Symp
Ser 41, 95-98).
[0324] Coprinus radians: Based on the knowledge of the peptide
sequence of the N-terminus and one internal peptide fragment
degenerated primers were used on cDNA to partially amplify a
fragment of a haloperoxidase gene in Coprinus radians (strain DMSZ
888). The initial PCR product which was derived from application of
the degenerated primers Cop1-For and Cop6-Rev (size of
approximately 700 bp) was purified, cloned, one clone was sequenced
(SEQ ID NO:15), and identified as homologue to CPO sequence by a
basic local alignment search tool (BLAST) search. In order to
obtain the 3' end of the cDNA, a rapid amplification of cDNA ends
(3' RACE) was performed. The AP2-primer was used in combination
with the degenerated primer CopS-For to amplify a fragment
(approximately 500 bp) from the cDNA, which was cloned and
completely sequenced afterwards (SEQ ID NO:17) (three independent
clones).
[0325] Agrocybe aegerita: Based on the knowledge of the peptide
sequence of the N-terminus and 5 internal peptide fragments
degenerate primers were used on cDNA to amplify fragments of a
haloperoxidase gene in Agrocybe aegerita (strain TM-A1-K). One
initial PCR product which were derived from application of
degenerate primers Aap1-For and Aap6-Rev (size of approximately 880
bp). Two 3' RACE-PCR products were generated by using PCR with
AaP1-For and AP primer (approximately 1200 bp) and by using PCR
with AaP4-For and AP primer (nested PCR, approximately 650 bp),
respectively. All three fragments were purified from agarose gel,
purified and cloned. Several independent clones were fully
sequenced; all sequences were assembled to a synthetic
sequence.
[0326] The synthetic sequence was identified as homologous to CPO
sequence by a basic local alignment search tool (BLAST) search. A
5' RACE were performed with specific primer mix SO-Mix (contain 90%
heel-specific primer and 10% heel-carrier primer, 10 micromolar)
and degenerate primer AaP4-Rev. The diluted PCR product were then
used in a nested PCR with SO-Mix and degenerate primer AaP2-Rev.
The resulting band with approx. 350 by were excised from gel,
purified and cloned. Several independent clones were fully
sequenced.
[0327] Two different, but homologous sequences were discovered. One
sequence overlapped with the already known synthetic sequence and
completed the cDNA sequence of AaP1 gene. Based on this data
specific primers were designed for both the AaP1 gene and AaP2
gene.
[0328] Performing PCR at cDNA level with primer combination
1AaP-For1 and 1AaP-Rev4 resulted in a complete full-length cDNA
sequence fragment of AaP1 gene. This fragment was cloned and one
clone was completely sequenced (SEQ ID NO:1). This clone was
deposited on 14 March 2008 at DSMZ as Escherichia coli NN049991
with accession number DSM 21289.
[0329] For completion of the AaP2 gene at cDNA level a 3' RACE was
performed: A PCR with primer combination 2AaP-For1 and AP primer
resulted in an about 1300bp long fragment. This fragment was also
cloned, two clones were fully sequenced and revealed the whole cDNA
sequence of AaP2 gene (SEQ ID NO:2). This clone was deposited on 14
March 2008 at DSMZ as Escherichia coli NN049992 with accession
number DSM 21290.
[0330] After completion of cDNA sequences specific primers were
used in PCRs to amplify genomic fragments of AaP genes. The primer
combination 1AaP-For2 and 1AaP-Rev4 was used to amplify the gene
region of AaP1 from genomic DNA (about 1400 bp), which encodes the
mature protein without the signal peptide and comprises the whole
3'UTR, too. The primer combination 2AaP-For1 and 2AaP-Rev2 was used
to amplify the complete CDS and 3'UTR of AaP2 gene from genomic DNA
(about 1500 bp). Both PCR products were purified, clone and at
least two independent clones were fully sequenced.
Example 2
Amino Acid Motifs Characteristic of Fungal Peroxygenases
[0331] We analyzed the full-length peroxygenase amino acid
sequences of AaP1 and AaP2 and found that they are unique in that
the mature peptide sequence can be viewed as comprising two
domains.
[0332] The first half of the AaP1 amino acid sequence (SEQ ID NO:2)
aligns convincingly well with chloroperoxidase, CPO. The second, c
terminal half of the AaP1 peptide does not share homology with any
amino acid sequences in the databases, aside from Laccaria and
Coprinus cinereus putative open reading frame sequences identified
through genome-sequencing.
[0333] It is highly probable that the two domain structure in which
the N terminal half shares similarity to known chloroperoxidases
while the C terminal portion does not, is a clear characteristic of
this class of peroxygenases.
[0334] We have aligned the amino-acid sequences deduced herein with
a number of similar sequences in FIG. 4A-D and have identified some
identifying conserved motifs. Patterns for motif searching are
based on the format of pattern used in the PROSITE database, with
the difference that the terminating dot `.` and the hyphens, `-`,
between the characters are optional. The PROSITE pattern definition
from the PROSITE documentation follows: [0335] The standard IUPAC
one-letter codes for the amino acids are used. [0336] The symbol
`x` is used for a position where any amino acid is accepted. [0337]
Ambiguities are indicated by listing the acceptable amino acids for
a given position, between square parentheses `[ ]`. For example:
[ALT] stands for Ala or Leu or Thr. [0338] Ambiguities are also
indicated by listing between a pair of curly brackets `{ ` the
amino acids that are not accepted at a given position. For example:
{AM} stands for any amino acid except Ala and Met. [0339] Each
element in a pattern is separated from its neighbor by a `-`.
(Optional in patmatdb and fuzzpro). [0340] Repetition of an element
of the pattern can be indicated by following that element with a
numerical value or a numerical range between parenthesis. Examples:
x(3) corresponds to x-x-x, x(2,4) corresponds to x-x or x-x-x or
x-x-x-x. [0341] When a pattern is restricted to either the N- or
C-terminal of a sequence, that pattern either starts with a `<`
symbol or respectively ends with a `>` symbol. [0342] A period
ends the pattern. (Optional in patmatdb and fuzzpro).
[0343] In order to exclude classic chloroperoxidases, we limited
our search for conserved motifs to the C-terminal half of the
aligned peroxygenase proteins. We identified the following
conserved motifs as very useful for finding peroxygenases:
TABLE-US-00008 (SEQ ID NO: 40) Motif I:
[FL]XX[YF]S[AN]X[FHY]G[GN]GX[YF]N (SEQ ID NO: 41) Motif II:
G[GN]GX[YF]NXX[VA]AX[EH][LF]R (SEQ ID NO: 42) Motif III:
RXXRI[QE][DEQ]S[IM]ATN (SEQ ID NO: 43) Motif IV:
S[IM]ATN[PG][EQN][FM][SDN][FL] (SEQ ID NO: 44) Motif V:
P[PDK][DG]F[HFW]R[AP] (SEQ ID NO: 45) Motif VI:
[TI]XXXLYPNP[TK][GV]
[0344] Such motifs or profiles can be entered into a search
program, such as Fuzzpro, for the identification of novel fungal
peroxygenases (Fuzzpro was written by Alan Bleasby, European
Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton,
Cambridge CB10 1SD, UK). Fuzzpro is part of the EMBOSS package
(EMBOSS: The European Molecular Biology Open Software Suite (2000),
Rice,P. Longden,l. and Bleasby,A. Trends in Genetics 16, (6)
pp276--277).
[0345] The percent identity matrix shown in table 4 was calculated
based on "all against all" alignments of the peroxygenase amino
acid sequences listed in the sequence listing. The entry in row i
and column j in the matrix is calculated as the number of exact
matches in the alignment between sequence i and sequence j divided
by the total length og the alignment minus the total length of the
gaps in the alignment. Each alignment is done using the Needle
program from the EMBOSS package (http://www.emboss.org) version
2.8.0. The program Needle implements the global alignment algorithm
described in Needleman, S. B. and Wunsch, C. D. (J. Mol. Biol.,
1970, 48: 443-453); and Kruskal, J. B. (1983) An overview of
sequence comparison In D.Sankoff and J. B. Kruskal, (ed.), Time
warps, string edits and macromolecules: the theory and practice of
sequence comparison, pp. 1-44 Addison Wesley. The alignments used
the following parameters:
[0346] Gap opening penalty: 10.00
[0347] Gap extension penalty: 0.50
[0348] Substitution matrix: BLOSUM62
TABLE-US-00009 TABLE 4 Symmetrical %-identity matrix of the
peroxygenase amino acid sequences listed in the sequence listing.
SEQ ID NO: 2 100 73.58 61.89 58.18 54.20 60.43 59.88 58.88 SEQ ID
NO: 4 100 62.23 59.30 58.43 61.41 62.05 62.46 SEQ ID NO: 6 100
60.05 57.39 59.40 59.21 62.89 SEQ ID NO: 8 100 62.14 58.89 58.81
60.99 SEQ ID NO: 10 100 56.77 57.84 63.45 SEQ ID NO: 12 100 82.40
58.82 SEQ ID NO: 14 100 57.89 SEQ ID NO: 19 100
Example 3
Construction of Aspergillus Recombinant Expression Hosts
[0349] The cDNA sequences encoding the entire open reading frames
of AaP1 and AaP2 are listed in SEQ ID NO's:1 and 3, respectively.
PCR primers were designed to amplify the entire open reading frames
from the ATG start codon until the termination codon. The primers
were synthesized with 15 base pair 5' sequences homologous to the
border of the cloning site for Hindlll-BamHl cut pDau109
Aspergillus expression vector. pDau109 is disclosed in WO
2005042735, which is incorporated herein by reference. Thus the
primers consisted of two regions, one region specific to the
peroxygenase and with an approximate annealing temperature of 50
degrees or over, and the 15 base pairs homologous to the expression
plasmid at the restriction enzyme borders.
[0350] Plasmid pDau109 was double digested with BamHl and HindII
and the vector was purified from the stuffer fragment by agarose
gel electrophoresis and use of Illustra.TM. DNA and gel band
purification kit (GE Healthcare). The primers are shown below:
TABLE-US-00010 Primer AaP1F: (SEQ ID NO: 46) 5'
acacaactggggatccaccatgaaatacttcagcctgttc Primer AaP1R: (SEQ ID NO:
47) 5' agatctcgagaagcttaatctcgcccgtacgggaat Primer AaP2F: (SEQ ID
NO: 48) 5' acacaactggggatccaccatgaaatattttcccctgttcc Primer AaP2R:
(SEQ ID NO: 49) 5' agatctcgagaagcttaatctcgcccgtatgggaag
[0351] The underlined portions of the primers are designed to
overlap with the cloning site in the vector and are needed for
InFusion.TM. cloning later.
[0352] The PCR reactions used to generate the expression cassettes
were performed as follows:
[0353] The Phusion Hot Start.TM. high fidelity DNA polymerase
(F-540, New England Biolabs) system was used to amplify the
expression cassettes from the cDNA plasmids. The buffer for GC rich
templates was used instead of the standard buffer. An MJ Research
PTC-200 DNA engine was used to perform the PCR reaction. The
following conditions were used:
TABLE-US-00011 GC 5X buffer 10 microliter 20 mM dNTP 1 microliter
Primer F 1 microliter Primer R 1 microliter DNA template 10 ng 1
microliter dH2O 35.5 microliter Phusion Hot (2u/ul) 0.5
microliter
PCR Program : 95.degree. C. for 30 sec 25 cycles of: [0354]
98.degree. C. for 10 sec [0355] 50.degree. C. for 20 sec [0356]
72.degree. C. for 30 sec
[0357] Final extension at 72.degree. C. for 10 minutes
[0358] The reaction was cooled to 10.degree. C. after the PCR
program ended. 25 microliter of each PCR product were run on a 1%
agarose TBE gel and the single PCR band was purified using Illustra
DNA and gel band purification kit (GE Healthcare). The purified PCR
product was then ready for cloning. The InFusion.TM. system for
cloning was used for cloning the fragments into the prepared vector
(BD Biosciences). The cloning protocol was followed exactly as
described in the InFusion.TM. instruction manual. The treated
plasmid and insert were transformed into InFusion.TM. Blue E. coli
cells according to the protocol and plated on LB with 50 mg/liter
ampicillin.
[0359] After incubating at 37.degree. C. overnight, colonies were
seen growing under selection on the LB ampicillin plates. 10
colonies of the AaP1 construct and 10 colonies of the AaP2
construct were cultivated in LB liquid with 50 mg/ml ampicillin and
plasmid was isolated according to the JETQUICK.TM. Plasmid
Purification Spin Kit procedure (Genomed). Isolated plasmids were
sequenced with vector primers in order to determine a
representative plasmid expression clone that was free of PCR
errors. One error free AaP1 clone and one error free AaP2 clone
were selected for further work:
[0360] NP003506: Aap1 peroxygenase
[0361] NP003507: Aap2 peroxygenase
[0362] Plasmid DNA is then isolated using the JETSTAR 2.0 Plasmid
Mini/Midi/Maxi-Protocol (Genomed). Thus purified plasmid DNA is
transformed into a standard fungal expression host, such as
Aspergillus oryzae, according to the method of WO 2005/042735,
pages 34-35, which are incorporated herein by reference.
Aspergillus transformants able to produce a recombinant AaP protein
as judged by SDS PAGE analysis are then fermented in either small
(200 ml) or very large (over 15m.sup.3 tanks) to produce enough
culture fluid for subsequent filtration, concentration and/or
purification of the recombinant produced enzyme(s).
Example 4
Cloning of Laccaria bicolor Peroxygenase
[0363] A suitable expression cassette is obtained from either
genomic L.bicolor DNA (SEQ ID NO:5) or cDNA therefrom using primers
designed, for example, for InFusion.TM. cloning, as described in
the previous section. A suitable primer set amplifying the entire
open reading frame and suitable for expression in pDau109 is as
follows:
TABLE-US-00012 Forward primer: (SEQ ID NO: 50) 5'
acacaactggggatccaccatggctcgccttactttcct Reverse primer: (SEQ ID NO:
51) 5' agatctcgagaagcttactttccataagggaagatctg
[0364] The underlined sequences represent vector sequence needed
for the InFusion.TM. cloning procedure described in detail above.
The resulting 1167 by fragment will have 15bp overlaps with
BamHl-Hindlll cut pDau109 vector.
[0365] Recombinant expression in, e.g., Aspergillus oryzae is done
as described in the above for the AaP1 and AaP2 enzymes.
Example 5
Cloning of Coprinus cinereus Peroxygenases
[0366] A suitable expression cassette is obtained from either
genomic Coprinus cinereus DNA or cDNA (SEQ ID NO's: 7, 9, 11, 13,
or 15) therefrom using primers designed, for example, for InFusion
.TM. cloning, as described in the previous section. A suitable
primer set amplifying the entire open reading frame of one of the
peroxygenases (SEQ ID NO:8) and suitable for expression in pDau109
is as follows:
TABLE-US-00013 Forward primer: (SEQ ID NO: 52) 5'
acacaactggggatccaccatgatctcgacctcgaagca Reverse primer: (SEQ ID NO:
53) 5' agatctcgagaagcttaatcactcttgccccaggg
[0367] The underlined sequences represent vector sequence needed
for the InFusion.TM. cloning procedure described in detail above.
The resulting fragment will have 15bp overlaps with BamHl-Hindlll
cut pDau109 vector.
[0368] A suitable primer set amplifying the entire open reading
frame of one of the peroxygenases (SEQ ID NO:10) and suitable for
expression in pDau109 is as follows:
TABLE-US-00014 Forward primer: (SEQ ID NO: 54) 5'
acacaactggggatccaccatggtttcgtgcaagctcc Reverse primer: (SEQ ID NO:
55) 5' agatctcgagaagcttacagtgtaccatacggtttca
[0369] The underlined sequences represent vector sequence needed
for the InFusion.TM. cloning procedure described in detail above.
The resulting fragment will have 15bp overlaps with BamHl-Hindlll
cut pDau109 vector.
[0370] A suitable primer set amplifying the entire open reading
frame of one of the peroxygenases (SEQ ID NO:12) and suitable for
expression in pDau109 is as follows:
TABLE-US-00015 Forward primer: (SEQ ID NO: 56) 5'
acacaactggggatccaccatgaacggtotgttcgcca Reverse primer: (SEQ ID NO:
57) 5' agatctcgagaagcttagttacgtccgtaggggaac
[0371] The underlined sequences represent vector sequence needed
for the InFusion.TM. cloning procedure described in detail above.
The resulting fragment will have 15bp overlaps with BamHl-Hindlll
cut pDau109 vector.
[0372] A suitable primer set amplifying the entire open reading
frame of one of the peroxygenases (SEQ ID NO:14) and suitable for
expression in pDau109 is as follows:
TABLE-US-00016 Forward primer: (SEQ ID NO: 58) 5'
acacaactggggatccaccatgctcaaaccgcgtgttc Reverse primer: (SEQ ID NO:
59) 5' agatctcgagaagcttaatcgtgtccgtaagggaaaa
[0373] The underlined sequences represent vector sequence needed
for the InFusion.TM. cloning procedure described in detail above.
The resulting fragment will have 15bp overlaps with BamHl-Hindlll
cut pDau109 vector.
[0374] Recombinant expression in, e.g., Aspergillus oryzae of each
of the Coprinus peroxygenases listed above is done as described in
the previous section for the AaP1 and AaP2 enzymes.
Example 6
Conversion of pyridine to pyridine N-oxide by AaP1 Enzyme
[0375] 2 mM pyridine is dissolved in aqueous potassium phosphate
buffer solution (20 mM, pH=7.0) and stirred in a closed glass
vessel at 24.degree. C. together with 2 mM H.sub.2O.sub.2
(20.times.100 micromolar) and 2 U of Agrocybe aegerita AaP1
peroxidase (units based on the oxidation of veratryl alcohol to
veratrylaldehyde; Ullrich et al., 2004, Appl. Environ. Microbiol:
70, 4575-81) in a total volume of 1 ml. The reaction time was a
total of 120 min (quenching of the reaction with 25 mM NaOH).
[0376] The product detected from this reaction (yield 25%) was
exclusively pyridine N-oxide with reference to an authentic
standard (Fluka) via the retention time and UV and mass spectrum.
The chromatographic separation and product identification were
effected using a specific column (Phenomex synergi 4 microns
Fusion-RP 80A, 150.times.2 mm) and an Agilent LC-MS-DAD system.
Sequence CWU 1
1
5911273DNAAgrocybe
aegeritaCDS(23)..(1141)sig_peptide(23)..(151)mat_peptide(152)..(1141)misc-
_feature(152)..(590)chloroperoxidase similar region 1ggtcacaaca
ccccagcgca ac atg aaa tac ttc agc ctg ttc ccg acc ttg 52 Met Lys
Tyr Phe Ser Leu Phe Pro Thr Leu -40 -35 ata ttt gca gcg ggg gtc atc
gca ttt ccc tca cat gct tca ttg gcc 100Ile Phe Ala Ala Gly Val Ile
Ala Phe Pro Ser His Ala Ser Leu Ala -30 -25 -20 ggc ctc agc gag cag
gaa ctg gat gag atc att cct aca ctc gaa att 148Gly Leu Ser Glu Gln
Glu Leu Asp Glu Ile Ile Pro Thr Leu Glu Ile -15 -10 -5 cga gag cca
aca caa cct cct gga cct ccg gag gac acc tct gcc aaa 196Arg Glu Pro
Thr Gln Pro Pro Gly Pro Pro Glu Asp Thr Ser Ala Lys -1 1 5 10 15
ttg gtg aat gac aag gat cac cca tgg aag cca ctt cga ccg ggc gac
244Leu Val Asn Asp Lys Asp His Pro Trp Lys Pro Leu Arg Pro Gly Asp
20 25 30 atc cgt ggg cct tgt ccc ggt ctc aac acg ttg gcg tct cat
ggg tac 292Ile Arg Gly Pro Cys Pro Gly Leu Asn Thr Leu Ala Ser His
Gly Tyr 35 40 45 ctc ccg aga aac ggg gtt gca act ccg gcg caa att
atc aac gct gtc 340Leu Pro Arg Asn Gly Val Ala Thr Pro Ala Gln Ile
Ile Asn Ala Val 50 55 60 cag gaa gga ttc aac atg gat aat tca gtc
gca ctc ttt gcg acg tat 388Gln Glu Gly Phe Asn Met Asp Asn Ser Val
Ala Leu Phe Ala Thr Tyr 65 70 75 gag gca cac ctt atg gtc ggc aat
ctc ctc acg gac ttg ctg agt atc 436Glu Ala His Leu Met Val Gly Asn
Leu Leu Thr Asp Leu Leu Ser Ile 80 85 90 95 gga cgc aag acg ccg ctc
act ggg cct gat ctc cca ccc cca gct aac 484Gly Arg Lys Thr Pro Leu
Thr Gly Pro Asp Leu Pro Pro Pro Ala Asn 100 105 110 att ggt ggg ctc
agt gag cat ggg ctc ttt gaa ggt gat gct agt atg 532Ile Gly Gly Leu
Ser Glu His Gly Leu Phe Glu Gly Asp Ala Ser Met 115 120 125 act aga
ggt gac gca ttc ttc ggc aac aat gat gag ttc aat gaa gaa 580Thr Arg
Gly Asp Ala Phe Phe Gly Asn Asn Asp Glu Phe Asn Glu Glu 130 135 140
ctc ttc caa cag ttc att gac tac agt aac cga ttc gga gga ggg tac
628Leu Phe Gln Gln Phe Ile Asp Tyr Ser Asn Arg Phe Gly Gly Gly Tyr
145 150 155 tac aac ctt acg gtg gca gtg gaa ctc cgc ttc aag cgt att
cag gac 676Tyr Asn Leu Thr Val Ala Val Glu Leu Arg Phe Lys Arg Ile
Gln Asp 160 165 170 175 tcg att gcg acc aac ccc gaa ttt aac ttt gtc
tcc ccg aga ttc ttt 724Ser Ile Ala Thr Asn Pro Glu Phe Asn Phe Val
Ser Pro Arg Phe Phe 180 185 190 gct gcc tac ggc gaa tct gtc gcc ccc
aat aac ttt ttc gtc gat gga 772Ala Ala Tyr Gly Glu Ser Val Ala Pro
Asn Asn Phe Phe Val Asp Gly 195 200 205 cgc aag gac gac ggg cat ttg
gat atg gac gcc gcc cgt gga ttt ttc 820Arg Lys Asp Asp Gly His Leu
Asp Met Asp Ala Ala Arg Gly Phe Phe 210 215 220 caa ttc ggc cgc atg
cct gac ggc ttc ttc cgc cca aac gga acg aaa 868Gln Phe Gly Arg Met
Pro Asp Gly Phe Phe Arg Pro Asn Gly Thr Lys 225 230 235 ggc aac gca
gga ctc gat gac gtc gta cgg gct cat ccc gta cag cct 916Gly Asn Ala
Gly Leu Asp Asp Val Val Arg Ala His Pro Val Gln Pro 240 245 250 255
gga agg aat ctc ggc cga gtc aac agc tac act cat gat cca aca tcc
964Gly Arg Asn Leu Gly Arg Val Asn Ser Tyr Thr His Asp Pro Thr Ser
260 265 270 gcc gat ttc acc act cct tgc tta ttg tac gag aac ttc gca
aac aaa 1012Ala Asp Phe Thr Thr Pro Cys Leu Leu Tyr Glu Asn Phe Ala
Asn Lys 275 280 285 acc gtc acg gca ctc tac ccg aat ccg aag gga caa
ctc cgc aga gca 1060Thr Val Thr Ala Leu Tyr Pro Asn Pro Lys Gly Gln
Leu Arg Arg Ala 290 295 300 att aaa gcg aat ctc cat ttc ctc ttc ctg
gca ata aac aga acc gtc 1108Ile Lys Ala Asn Leu His Phe Leu Phe Leu
Ala Ile Asn Arg Thr Val 305 310 315 gga tgc gcc gag gta ttc ccg tac
ggg cga gat tgatgaggcg ccacatgaga 1161Gly Cys Ala Glu Val Phe Pro
Tyr Gly Arg Asp 320 325 330 aagagtcggg cagtagtagt ccactttctt
cgtaacagtt tgtagatgtc cgcgtattta 1221aatatggact ccagtgacct
tatgccgctt caaaaaaaaa aaaaaaaaaa aa 12732373PRTAgrocybe aegerita
2Met Lys Tyr Phe Ser Leu Phe Pro Thr Leu Ile Phe Ala Ala Gly Val
-40 -35 -30 Ile Ala Phe Pro Ser His Ala Ser Leu Ala Gly Leu Ser Glu
Gln Glu -25 -20 -15 Leu Asp Glu Ile Ile Pro Thr Leu Glu Ile Arg Glu
Pro Thr Gln Pro -10 -5 -1 1 5 Pro Gly Pro Pro Glu Asp Thr Ser Ala
Lys Leu Val Asn Asp Lys Asp 10 15 20 His Pro Trp Lys Pro Leu Arg
Pro Gly Asp Ile Arg Gly Pro Cys Pro 25 30 35 Gly Leu Asn Thr Leu
Ala Ser His Gly Tyr Leu Pro Arg Asn Gly Val 40 45 50 Ala Thr Pro
Ala Gln Ile Ile Asn Ala Val Gln Glu Gly Phe Asn Met 55 60 65 Asp
Asn Ser Val Ala Leu Phe Ala Thr Tyr Glu Ala His Leu Met Val 70 75
80 85 Gly Asn Leu Leu Thr Asp Leu Leu Ser Ile Gly Arg Lys Thr Pro
Leu 90 95 100 Thr Gly Pro Asp Leu Pro Pro Pro Ala Asn Ile Gly Gly
Leu Ser Glu 105 110 115 His Gly Leu Phe Glu Gly Asp Ala Ser Met Thr
Arg Gly Asp Ala Phe 120 125 130 Phe Gly Asn Asn Asp Glu Phe Asn Glu
Glu Leu Phe Gln Gln Phe Ile 135 140 145 Asp Tyr Ser Asn Arg Phe Gly
Gly Gly Tyr Tyr Asn Leu Thr Val Ala 150 155 160 165 Val Glu Leu Arg
Phe Lys Arg Ile Gln Asp Ser Ile Ala Thr Asn Pro 170 175 180 Glu Phe
Asn Phe Val Ser Pro Arg Phe Phe Ala Ala Tyr Gly Glu Ser 185 190 195
Val Ala Pro Asn Asn Phe Phe Val Asp Gly Arg Lys Asp Asp Gly His 200
205 210 Leu Asp Met Asp Ala Ala Arg Gly Phe Phe Gln Phe Gly Arg Met
Pro 215 220 225 Asp Gly Phe Phe Arg Pro Asn Gly Thr Lys Gly Asn Ala
Gly Leu Asp 230 235 240 245 Asp Val Val Arg Ala His Pro Val Gln Pro
Gly Arg Asn Leu Gly Arg 250 255 260 Val Asn Ser Tyr Thr His Asp Pro
Thr Ser Ala Asp Phe Thr Thr Pro 265 270 275 Cys Leu Leu Tyr Glu Asn
Phe Ala Asn Lys Thr Val Thr Ala Leu Tyr 280 285 290 Pro Asn Pro Lys
Gly Gln Leu Arg Arg Ala Ile Lys Ala Asn Leu His 295 300 305 Phe Leu
Phe Leu Ala Ile Asn Arg Thr Val Gly Cys Ala Glu Val Phe 310 315 320
325 Pro Tyr Gly Arg Asp 330 31284DNAAgrocybe
aegeritaCDS(25)..(1137) 3ggtcagaaca cagcacggtt ctac atg aaa tat ttt
ccc ctg ttc cca acc 51 Met Lys Tyr Phe Pro Leu Phe Pro Thr 1 5 ttg
gtc ttc gca gcg agg gtc gtt gct ttt cct gcc tac gcc tca ttg 99Leu
Val Phe Ala Ala Arg Val Val Ala Phe Pro Ala Tyr Ala Ser Leu 10 15
20 25 gcc ggc ctc agc cag cag gaa ttg gac gct ata atc cca aca ctc
gag 147Ala Gly Leu Ser Gln Gln Glu Leu Asp Ala Ile Ile Pro Thr Leu
Glu 30 35 40 gcc cga gag cca gga tta cct cct ggt cct ctc gag aat
agc tct gca 195Ala Arg Glu Pro Gly Leu Pro Pro Gly Pro Leu Glu Asn
Ser Ser Ala 45 50 55 aag ttg gtg aac gac gag gct cac cca tgg aag
ccg ctt cga cct ggc 243Lys Leu Val Asn Asp Glu Ala His Pro Trp Lys
Pro Leu Arg Pro Gly 60 65 70 gat att cgt gga cct tgc cct ggt ctc
aat act ctg gca tct cac ggg 291Asp Ile Arg Gly Pro Cys Pro Gly Leu
Asn Thr Leu Ala Ser His Gly 75 80 85 tac ctc ccg aga aat ggc gtt
gca acc ccg gtg caa ata ata aac gcg 339Tyr Leu Pro Arg Asn Gly Val
Ala Thr Pro Val Gln Ile Ile Asn Ala 90 95 100 105 gtt cag gaa gga
ctc aat ttc gac aat caa gcc gca gtc ttc gcc aca 387Val Gln Glu Gly
Leu Asn Phe Asp Asn Gln Ala Ala Val Phe Ala Thr 110 115 120 tat gcg
gcc cac ctt gtg gac ggc aat ctc att acg gac ttg ctg agc 435Tyr Ala
Ala His Leu Val Asp Gly Asn Leu Ile Thr Asp Leu Leu Ser 125 130 135
atc gga cgc aag acg cgg ctc act ggg cct gat cca cca ccc ccc gct
483Ile Gly Arg Lys Thr Arg Leu Thr Gly Pro Asp Pro Pro Pro Pro Ala
140 145 150 tcc gtt ggt gga ctc aat gag cat ggc acc ttc gaa ggc gac
gcc agt 531Ser Val Gly Gly Leu Asn Glu His Gly Thr Phe Glu Gly Asp
Ala Ser 155 160 165 atg acc cga ggt gac gca ttc ttt ggc aac aac cac
gat ttc aat gag 579Met Thr Arg Gly Asp Ala Phe Phe Gly Asn Asn His
Asp Phe Asn Glu 170 175 180 185 acg ctc ttc gaa cag ttg gtt gac tac
agc aac cga ttt gga gga gga 627Thr Leu Phe Glu Gln Leu Val Asp Tyr
Ser Asn Arg Phe Gly Gly Gly 190 195 200 aaa tac aat ctt acc gtc gcg
ggg gag ctc cgt ttc aag cgc att caa 675Lys Tyr Asn Leu Thr Val Ala
Gly Glu Leu Arg Phe Lys Arg Ile Gln 205 210 215 gac tcc att gcg acc
aac ccc aat ttc tcc ttt gtt gac ttt agg ttc 723Asp Ser Ile Ala Thr
Asn Pro Asn Phe Ser Phe Val Asp Phe Arg Phe 220 225 230 ttt act gct
tac ggc gag acc acc ttc ccc gcg aat ctt ttt gtg gat 771Phe Thr Ala
Tyr Gly Glu Thr Thr Phe Pro Ala Asn Leu Phe Val Asp 235 240 245 ggg
cgc agg gac gac ggc cag cta gat atg gat gct gca cgg agt ttt 819Gly
Arg Arg Asp Asp Gly Gln Leu Asp Met Asp Ala Ala Arg Ser Phe 250 255
260 265 ttc caa ttc agc cgt atg cct gac gat ttc ttc cgc gca ccc agc
ccg 867Phe Gln Phe Ser Arg Met Pro Asp Asp Phe Phe Arg Ala Pro Ser
Pro 270 275 280 aga agt ggc aca gga gtc gag gta gtt ata cag gct cat
cct atg cag 915Arg Ser Gly Thr Gly Val Glu Val Val Ile Gln Ala His
Pro Met Gln 285 290 295 ccc gga aga aat gtc ggc aag atc aac agc tac
acc gtc gac cca aca 963Pro Gly Arg Asn Val Gly Lys Ile Asn Ser Tyr
Thr Val Asp Pro Thr 300 305 310 tcc tct gac ttt tcc acc ccc tgc ttg
atg tac gag aaa ttc gtc aac 1011Ser Ser Asp Phe Ser Thr Pro Cys Leu
Met Tyr Glu Lys Phe Val Asn 315 320 325 ata acg gtc aag tca ctc tac
ccg aat ccg acg gtg cac gtt cgc aaa 1059Ile Thr Val Lys Ser Leu Tyr
Pro Asn Pro Thr Val His Val Arg Lys 330 335 340 345 gcc ctt aat acg
aat ctc gat ttc ttc ttc cag gga gtc gcc gct gga 1107Ala Leu Asn Thr
Asn Leu Asp Phe Phe Phe Gln Gly Val Ala Ala Gly 350 355 360 tgt acc
cag gtc ttc cca tac ggg cga gat tgatatgata gagacaagag 1157Cys Thr
Gln Val Phe Pro Tyr Gly Arg Asp 365 370 agagtgtttc gacagtagcg
gttctcaatt tgaatagttt gcagacatct gcttgtgtaa 1217atacactctt
gcggtccaac aacctgcttt tctctggcca ccttcaaaaa aaaaaaaaaa 1277aaaaaaa
12844371PRTAgrocybe aegerita 4Met Lys Tyr Phe Pro Leu Phe Pro Thr
Leu Val Phe Ala Ala Arg Val 1 5 10 15 Val Ala Phe Pro Ala Tyr Ala
Ser Leu Ala Gly Leu Ser Gln Gln Glu 20 25 30 Leu Asp Ala Ile Ile
Pro Thr Leu Glu Ala Arg Glu Pro Gly Leu Pro 35 40 45 Pro Gly Pro
Leu Glu Asn Ser Ser Ala Lys Leu Val Asn Asp Glu Ala 50 55 60 His
Pro Trp Lys Pro Leu Arg Pro Gly Asp Ile Arg Gly Pro Cys Pro 65 70
75 80 Gly Leu Asn Thr Leu Ala Ser His Gly Tyr Leu Pro Arg Asn Gly
Val 85 90 95 Ala Thr Pro Val Gln Ile Ile Asn Ala Val Gln Glu Gly
Leu Asn Phe 100 105 110 Asp Asn Gln Ala Ala Val Phe Ala Thr Tyr Ala
Ala His Leu Val Asp 115 120 125 Gly Asn Leu Ile Thr Asp Leu Leu Ser
Ile Gly Arg Lys Thr Arg Leu 130 135 140 Thr Gly Pro Asp Pro Pro Pro
Pro Ala Ser Val Gly Gly Leu Asn Glu 145 150 155 160 His Gly Thr Phe
Glu Gly Asp Ala Ser Met Thr Arg Gly Asp Ala Phe 165 170 175 Phe Gly
Asn Asn His Asp Phe Asn Glu Thr Leu Phe Glu Gln Leu Val 180 185 190
Asp Tyr Ser Asn Arg Phe Gly Gly Gly Lys Tyr Asn Leu Thr Val Ala 195
200 205 Gly Glu Leu Arg Phe Lys Arg Ile Gln Asp Ser Ile Ala Thr Asn
Pro 210 215 220 Asn Phe Ser Phe Val Asp Phe Arg Phe Phe Thr Ala Tyr
Gly Glu Thr 225 230 235 240 Thr Phe Pro Ala Asn Leu Phe Val Asp Gly
Arg Arg Asp Asp Gly Gln 245 250 255 Leu Asp Met Asp Ala Ala Arg Ser
Phe Phe Gln Phe Ser Arg Met Pro 260 265 270 Asp Asp Phe Phe Arg Ala
Pro Ser Pro Arg Ser Gly Thr Gly Val Glu 275 280 285 Val Val Ile Gln
Ala His Pro Met Gln Pro Gly Arg Asn Val Gly Lys 290 295 300 Ile Asn
Ser Tyr Thr Val Asp Pro Thr Ser Ser Asp Phe Ser Thr Pro 305 310 315
320 Cys Leu Met Tyr Glu Lys Phe Val Asn Ile Thr Val Lys Ser Leu Tyr
325 330 335 Pro Asn Pro Thr Val His Val Arg Lys Ala Leu Asn Thr Asn
Leu Asp 340 345 350 Phe Phe Phe Gln Gly Val Ala Ala Gly Cys Thr Gln
Val Phe Pro Tyr 355 360 365 Gly Arg Asp 370 51947DNALaccaria
bicolorexon(547)..(822)CDS(547)..(822)sig_peptide(547)..(610)Intron(823).-
.(885)exon(886)..(943)CDS(886)..(943)Intron(944)..(991)exon(992)..(1162)CD-
S(992)..(1162)Intron(1163)..(1218)exon(1219)..(1239)CDS(1219)..(1239)Intro-
n(1240)..(1288)exon(1289)..(1341)CDS(1289)..(1341)Intron(1342)..(1392)exon-
(1393)..(1944)CDS(1393)..(1944) 5agacaaagtt ttttgatcga ctggccttct
gatctacaga aatctccgct gtgtccggtt 60aggatatcta ttcgaagata tctcctttca
ttgctgagta atttgctgcg tcggtcaggc 120ttcagcttca taccataccc
aagaacgtgt ctcgcccatt tacaggtgat ctggaggtga 180ggtttataaa
tagaacggac tataagcgga ctaaccttgg acgttatata gtgcaaacct
240ggtacaagct cacggttcac cctcgggttt taaaaattat gacccgaaag
gtcaactgca 300ttttatatct cctgcgtgtt aacttcgctt gtaagtcgtc
gacgctatga aaaaactacg 360gatcgagtca ttgacgggct ggcaagtttc
ctgccactgc ggaagctgaa agcaccgcat 420cgccttttaa agtcgatgtg
accttagccc agctgcccct ggtcattcac agcattctga 480gatcattgtc
acgagtataa gataggtgtg tgtaggcgtc gaattccaac aattcagtcg 540tgcata
atg gct cgc ctt act ttc ctc gca gct att gcc ctg gca tta 588 Met Ala
Arg Leu Thr Phe Leu Ala Ala Ile Ala Leu Ala Leu 1 5 10 tct tcc acc
act gta cta gca ttc cca tca tac ggc tcc ctt gct ggg 636Ser Ser Thr
Thr Val Leu Ala Phe Pro
Ser Tyr Gly Ser Leu Ala Gly 15 20 25 30 ctt tca gag gcg gaa tta gac
cgt att att ccc ttg cta gaa gct cgt 684Leu Ser Glu Ala Glu Leu Asp
Arg Ile Ile Pro Leu Leu Glu Ala Arg 35 40 45 aac gct ggc cct cct
cct gga cca ctg aag aat act tca aca aaa ttg 732Asn Ala Gly Pro Pro
Pro Gly Pro Leu Lys Asn Thr Ser Thr Lys Leu 50 55 60 gtc aac gac
aag aac cac ccc tgg aag cct ctc gga tat ggc gat att 780Val Asn Asp
Lys Asn His Pro Trp Lys Pro Leu Gly Tyr Gly Asp Ile 65 70 75 cga
ggt cct tgc cct ggg tta aac aca ctg gcc tcc cat ggg 822Arg Gly Pro
Cys Pro Gly Leu Asn Thr Leu Ala Ser His Gly 80 85 90 gtgagttcgg
acatttatgg ttacgtttca tcggagttaa ttgtaactgt tttattcgtg 882cag tgg
ctt cct cga aac ggc atc gct act ccg gcg caa att gtc aac 930Trp Leu
Pro Arg Asn Gly Ile Ala Thr Pro Ala Gln Ile Val Asn 95 100 105 gcg
gtg cag gaa g gtctgctgtt cgactaattg ctgacaattg atattgattg 983Ala
Val Gln Glu 110 ttgcttag ga ttc aat atg gga aat gat ttg gcg gtc ttc
gtc aca tac 1032 Gly Phe Asn Met Gly Asn Asp Leu Ala Val Phe Val
Thr Tyr 115 120 125 gct gcg cat ctc gtt gac ggc aat cag gtc acg gac
ttg ctt agc atc 1080Ala Ala His Leu Val Asp Gly Asn Gln Val Thr Asp
Leu Leu Ser Ile 130 135 140 ggt gga aag acg cct caa aca ggc cct gac
ccg ccc gcg cct gcc att 1128Gly Gly Lys Thr Pro Gln Thr Gly Pro Asp
Pro Pro Ala Pro Ala Ile 145 150 155 gtc ggt ggt ctc aat acg cac gcc
gta ttt gaa g gtatgtaatc 1172Val Gly Gly Leu Asn Thr His Ala Val
Phe Glu 160 165 acgatttgtc gactctggag accttctgac atctatttga ttgaag
gt gat gca 1226 Gly Asp Ala 170 agt atg act cga g gtatgatcat
cgccccgata attagatgac aattgaaccg 1279Ser Met Thr Arg 175 agcccttag
ga gac gca ttt ttc gga gat aac cac agc ttt aac gaa aca 1329 Gly Asp
Ala Phe Phe Gly Asp Asn His Ser Phe Asn Glu Thr 180 185 cag ttt gat
gaa gtgagatatt tctacgcttg cagtcagtga aagattaatt 1381Gln Phe Asp Glu
190 tctcctcaca g ttt tct gcc ttc agc aac aaa ttc ggc ggg gga tac
tac 1431 Phe Ser Ala Phe Ser Asn Lys Phe Gly Gly Gly Tyr Tyr 195
200 205 aat ttg agc gta gca gcc gag ttt aga tgg cag cgc att caa gaa
tct 1479Asn Leu Ser Val Ala Ala Glu Phe Arg Trp Gln Arg Ile Gln Glu
Ser 210 215 220 att gcg acg aac cca aac ttt tct ctc atc tcc ccc cgt
tac ttc acg 1527Ile Ala Thr Asn Pro Asn Phe Ser Leu Ile Ser Pro Arg
Tyr Phe Thr 225 230 235 gcg tat gcc gag tcc gtg ttt ccc ctg gta ttc
ttc gtc gac ggc cgc 1575Ala Tyr Ala Glu Ser Val Phe Pro Leu Val Phe
Phe Val Asp Gly Arg 240 245 250 gta tca gac gga cgg ctt agc cta ccg
aac gcg cgt ggg ttc ttc cag 1623Val Ser Asp Gly Arg Leu Ser Leu Pro
Asn Ala Arg Gly Phe Phe Gln 255 260 265 270 aat agc caa atg ccc aaa
gac ttc ttc cgg ccc aat cag tct atc ggc 1671Asn Ser Gln Met Pro Lys
Asp Phe Phe Arg Pro Asn Gln Ser Ile Gly 275 280 285 ctc aac gaa att
ggt gat ggg att agc gct att gct agt gcc cac cct 1719Leu Asn Glu Ile
Gly Asp Gly Ile Ser Ala Ile Ala Ser Ala His Pro 290 295 300 att gcg
ccg gga aag aac gag gga gtt ggg aac tat gtc ctc gac cct 1767Ile Ala
Pro Gly Lys Asn Glu Gly Val Gly Asn Tyr Val Leu Asp Pro 305 310 315
aca tct gcg gat ttc gac cat ttc tgc ttg ctt tac atc aac ttc gtc
1815Thr Ser Ala Asp Phe Asp His Phe Cys Leu Leu Tyr Ile Asn Phe Val
320 325 330 aac cag acc gta aag tca ctc tac ccc aat ccc aaa ggc gtt
ttg ctc 1863Asn Gln Thr Val Lys Ser Leu Tyr Pro Asn Pro Lys Gly Val
Leu Leu 335 340 345 350 gat gcc ttg aag agg aat ctc aac aat ttc tac
ggc cca ctc aac ggg 1911Asp Ala Leu Lys Arg Asn Leu Asn Asn Phe Tyr
Gly Pro Leu Asn Gly 355 360 365 tcg gat tgt gag cag atc ttc cct tat
gga aag tag 1947Ser Asp Cys Glu Gln Ile Phe Pro Tyr Gly Lys 370 375
6377PRTLaccaria bicolor 6Met Ala Arg Leu Thr Phe Leu Ala Ala Ile
Ala Leu Ala Leu Ser Ser 1 5 10 15 Thr Thr Val Leu Ala Phe Pro Ser
Tyr Gly Ser Leu Ala Gly Leu Ser 20 25 30 Glu Ala Glu Leu Asp Arg
Ile Ile Pro Leu Leu Glu Ala Arg Asn Ala 35 40 45 Gly Pro Pro Pro
Gly Pro Leu Lys Asn Thr Ser Thr Lys Leu Val Asn 50 55 60 Asp Lys
Asn His Pro Trp Lys Pro Leu Gly Tyr Gly Asp Ile Arg Gly 65 70 75 80
Pro Cys Pro Gly Leu Asn Thr Leu Ala Ser His Gly Trp Leu Pro Arg 85
90 95 Asn Gly Ile Ala Thr Pro Ala Gln Ile Val Asn Ala Val Gln Glu
Gly 100 105 110 Phe Asn Met Gly Asn Asp Leu Ala Val Phe Val Thr Tyr
Ala Ala His 115 120 125 Leu Val Asp Gly Asn Gln Val Thr Asp Leu Leu
Ser Ile Gly Gly Lys 130 135 140 Thr Pro Gln Thr Gly Pro Asp Pro Pro
Ala Pro Ala Ile Val Gly Gly 145 150 155 160 Leu Asn Thr His Ala Val
Phe Glu Gly Asp Ala Ser Met Thr Arg Gly 165 170 175 Asp Ala Phe Phe
Gly Asp Asn His Ser Phe Asn Glu Thr Gln Phe Asp 180 185 190 Glu Phe
Ser Ala Phe Ser Asn Lys Phe Gly Gly Gly Tyr Tyr Asn Leu 195 200 205
Ser Val Ala Ala Glu Phe Arg Trp Gln Arg Ile Gln Glu Ser Ile Ala 210
215 220 Thr Asn Pro Asn Phe Ser Leu Ile Ser Pro Arg Tyr Phe Thr Ala
Tyr 225 230 235 240 Ala Glu Ser Val Phe Pro Leu Val Phe Phe Val Asp
Gly Arg Val Ser 245 250 255 Asp Gly Arg Leu Ser Leu Pro Asn Ala Arg
Gly Phe Phe Gln Asn Ser 260 265 270 Gln Met Pro Lys Asp Phe Phe Arg
Pro Asn Gln Ser Ile Gly Leu Asn 275 280 285 Glu Ile Gly Asp Gly Ile
Ser Ala Ile Ala Ser Ala His Pro Ile Ala 290 295 300 Pro Gly Lys Asn
Glu Gly Val Gly Asn Tyr Val Leu Asp Pro Thr Ser 305 310 315 320 Ala
Asp Phe Asp His Phe Cys Leu Leu Tyr Ile Asn Phe Val Asn Gln 325 330
335 Thr Val Lys Ser Leu Tyr Pro Asn Pro Lys Gly Val Leu Leu Asp Ala
340 345 350 Leu Lys Arg Asn Leu Asn Asn Phe Tyr Gly Pro Leu Asn Gly
Ser Asp 355 360 365 Cys Glu Gln Ile Phe Pro Tyr Gly Lys 370 375
71164DNACoprinopsis cinerea okayama7#130CDS(1)..(1161) 7atg atc tcg
acc tcg aag cat ctc ttt gtg ctt ctt cct ctt ttc cta 48Met Ile Ser
Thr Ser Lys His Leu Phe Val Leu Leu Pro Leu Phe Leu 1 5 10 15 gtc
tca cat ctc tcc ctc gtt ctc ggt ttc ccg gcg tac gcg tcc ctt 96Val
Ser His Leu Ser Leu Val Leu Gly Phe Pro Ala Tyr Ala Ser Leu 20 25
30 gga ggt tta acc gag cgt caa gtc gaa gag tac acg tcc aag ctc cct
144Gly Gly Leu Thr Glu Arg Gln Val Glu Glu Tyr Thr Ser Lys Leu Pro
35 40 45 atc gtc ttt cca cca ccg ccg cct gaa cct atc aag gac ccg
tgg ctc 192Ile Val Phe Pro Pro Pro Pro Pro Glu Pro Ile Lys Asp Pro
Trp Leu 50 55 60 aag ttg gtc aat gac agg gct cat cca tgg aga ccc
ctt cgg aga gga 240Lys Leu Val Asn Asp Arg Ala His Pro Trp Arg Pro
Leu Arg Arg Gly 65 70 75 80 gat gtc aga gga ccc tgc ccg ggg ttg aat
acg ttg gca tcc cat ggg 288Asp Val Arg Gly Pro Cys Pro Gly Leu Asn
Thr Leu Ala Ser His Gly 85 90 95 tat ctt cct cga gat ggt gtg gcg
act cca gct caa atc atc act gcc 336Tyr Leu Pro Arg Asp Gly Val Ala
Thr Pro Ala Gln Ile Ile Thr Ala 100 105 110 gtc caa gaa ggc ttc aac
atg gag tac ggg atc gcg aca ttc gtc acc 384Val Gln Glu Gly Phe Asn
Met Glu Tyr Gly Ile Ala Thr Phe Val Thr 115 120 125 tac gct gcc cac
ctc gtc gat gga aac cca ctc acc aat ctc atc agc 432Tyr Ala Ala His
Leu Val Asp Gly Asn Pro Leu Thr Asn Leu Ile Ser 130 135 140 att ggt
ggg aag acg cgc aaa act ggc ccc gat cca cca cct ccc gcc 480Ile Gly
Gly Lys Thr Arg Lys Thr Gly Pro Asp Pro Pro Pro Pro Ala 145 150 155
160 atc gtt ggt ggg ttg aac act cac gct gtt ttc gaa ggt gat gcg agt
528Ile Val Gly Gly Leu Asn Thr His Ala Val Phe Glu Gly Asp Ala Ser
165 170 175 atg acc cga ggc gac ttt cac ttg ggg gat aac ttc aac ttc
aac cag 576Met Thr Arg Gly Asp Phe His Leu Gly Asp Asn Phe Asn Phe
Asn Gln 180 185 190 acg ctt tgg gag cag ttc aag gac tac agt aac cgc
tat gga ggt gga 624Thr Leu Trp Glu Gln Phe Lys Asp Tyr Ser Asn Arg
Tyr Gly Gly Gly 195 200 205 cga tac aac cta act gcg gct gct gag ctt
cgc tgg gca cgt atc cag 672Arg Tyr Asn Leu Thr Ala Ala Ala Glu Leu
Arg Trp Ala Arg Ile Gln 210 215 220 caa tcc atg gcc acg aac ggt caa
ttc gac ttc acc tcc cct cgg tac 720Gln Ser Met Ala Thr Asn Gly Gln
Phe Asp Phe Thr Ser Pro Arg Tyr 225 230 235 240 ttc aca gcc tac gcc
gaa tcc gtt ttc cca atc aac ttc ttc acg gac 768Phe Thr Ala Tyr Ala
Glu Ser Val Phe Pro Ile Asn Phe Phe Thr Asp 245 250 255 gga cgg ctc
ttc act tcg aac act acc gca cca ggc ccc gac atg gac 816Gly Arg Leu
Phe Thr Ser Asn Thr Thr Ala Pro Gly Pro Asp Met Asp 260 265 270 tcg
gcg ctc tcc ttc ttc cgg gac cac agg tac ccc aaa gac ttc cat 864Ser
Ala Leu Ser Phe Phe Arg Asp His Arg Tyr Pro Lys Asp Phe His 275 280
285 cgc gca ccc gtt cca agt ggt gct cgt gga ctc gat gta gtc gcc gct
912Arg Ala Pro Val Pro Ser Gly Ala Arg Gly Leu Asp Val Val Ala Ala
290 295 300 gcc tac cct atc cag ccg ggc tac aat gca gat ggg aag gtg
aac aac 960Ala Tyr Pro Ile Gln Pro Gly Tyr Asn Ala Asp Gly Lys Val
Asn Asn 305 310 315 320 tac gtc ctc gac ccg act tcc gcg gat ttc aca
aag ttc tgt ctg ctg 1008Tyr Val Leu Asp Pro Thr Ser Ala Asp Phe Thr
Lys Phe Cys Leu Leu 325 330 335 tac gag aac ttt gtg ttg aag act gtg
aag ggg ctc tat cca aat ccg 1056Tyr Glu Asn Phe Val Leu Lys Thr Val
Lys Gly Leu Tyr Pro Asn Pro 340 345 350 aag ggc ttc ttg agg aag gca
ctg gag aca aac ttg gaa tac ttt tac 1104Lys Gly Phe Leu Arg Lys Ala
Leu Glu Thr Asn Leu Glu Tyr Phe Tyr 355 360 365 cag tcg ttc cct ggg
tcg gga ggc tgc ccg cag gtc ttc ccc tgg ggc 1152Gln Ser Phe Pro Gly
Ser Gly Gly Cys Pro Gln Val Phe Pro Trp Gly 370 375 380 aag agt gat
tag 1164Lys Ser Asp 385 8387PRTCoprinopsis cinerea okayama7#130
8Met Ile Ser Thr Ser Lys His Leu Phe Val Leu Leu Pro Leu Phe Leu 1
5 10 15 Val Ser His Leu Ser Leu Val Leu Gly Phe Pro Ala Tyr Ala Ser
Leu 20 25 30 Gly Gly Leu Thr Glu Arg Gln Val Glu Glu Tyr Thr Ser
Lys Leu Pro 35 40 45 Ile Val Phe Pro Pro Pro Pro Pro Glu Pro Ile
Lys Asp Pro Trp Leu 50 55 60 Lys Leu Val Asn Asp Arg Ala His Pro
Trp Arg Pro Leu Arg Arg Gly 65 70 75 80 Asp Val Arg Gly Pro Cys Pro
Gly Leu Asn Thr Leu Ala Ser His Gly 85 90 95 Tyr Leu Pro Arg Asp
Gly Val Ala Thr Pro Ala Gln Ile Ile Thr Ala 100 105 110 Val Gln Glu
Gly Phe Asn Met Glu Tyr Gly Ile Ala Thr Phe Val Thr 115 120 125 Tyr
Ala Ala His Leu Val Asp Gly Asn Pro Leu Thr Asn Leu Ile Ser 130 135
140 Ile Gly Gly Lys Thr Arg Lys Thr Gly Pro Asp Pro Pro Pro Pro Ala
145 150 155 160 Ile Val Gly Gly Leu Asn Thr His Ala Val Phe Glu Gly
Asp Ala Ser 165 170 175 Met Thr Arg Gly Asp Phe His Leu Gly Asp Asn
Phe Asn Phe Asn Gln 180 185 190 Thr Leu Trp Glu Gln Phe Lys Asp Tyr
Ser Asn Arg Tyr Gly Gly Gly 195 200 205 Arg Tyr Asn Leu Thr Ala Ala
Ala Glu Leu Arg Trp Ala Arg Ile Gln 210 215 220 Gln Ser Met Ala Thr
Asn Gly Gln Phe Asp Phe Thr Ser Pro Arg Tyr 225 230 235 240 Phe Thr
Ala Tyr Ala Glu Ser Val Phe Pro Ile Asn Phe Phe Thr Asp 245 250 255
Gly Arg Leu Phe Thr Ser Asn Thr Thr Ala Pro Gly Pro Asp Met Asp 260
265 270 Ser Ala Leu Ser Phe Phe Arg Asp His Arg Tyr Pro Lys Asp Phe
His 275 280 285 Arg Ala Pro Val Pro Ser Gly Ala Arg Gly Leu Asp Val
Val Ala Ala 290 295 300 Ala Tyr Pro Ile Gln Pro Gly Tyr Asn Ala Asp
Gly Lys Val Asn Asn 305 310 315 320 Tyr Val Leu Asp Pro Thr Ser Ala
Asp Phe Thr Lys Phe Cys Leu Leu 325 330 335 Tyr Glu Asn Phe Val Leu
Lys Thr Val Lys Gly Leu Tyr Pro Asn Pro 340 345 350 Lys Gly Phe Leu
Arg Lys Ala Leu Glu Thr Asn Leu Glu Tyr Phe Tyr 355 360 365 Gln Ser
Phe Pro Gly Ser Gly Gly Cys Pro Gln Val Phe Pro Trp Gly 370 375 380
Lys Ser Asp 385 91056DNACoprinopsis cinerea
okayama7#130CDS(1)..(1053) 9atg gtt tcg tgc aag ctc cca ctc ccc ctc
ctc act ctc gcc atc gct 48Met Val Ser Cys Lys Leu Pro Leu Pro Leu
Leu Thr Leu Ala Ile Ala 1 5 10 15 ttg gca aac gtt aat gcc ttt ccg
gct tat cag tct ctt ggg ggt ctc 96Leu Ala Asn Val Asn Ala Phe Pro
Ala Tyr Gln Ser Leu Gly Gly Leu 20 25 30 tcc aag cgc cag ctc gag
acg att atc ccc gga ctg ccg gtt gtc aac 144Ser Lys Arg Gln Leu Glu
Thr Ile Ile Pro Gly Leu Pro Val Val Asn 35 40 45 cct ggc cct cca
cct ggg ccg tta gcg gat tcc acc ttg aag ttg gtc 192Pro Gly Pro Pro
Pro Gly Pro Leu Ala Asp Ser
Thr Leu Lys Leu Val 50 55 60 aat gat gcg gcg cat ccg tat cag gcg
cct agg ccg cat ttg gat cat 240Asn Asp Ala Ala His Pro Tyr Gln Ala
Pro Arg Pro His Leu Asp His 65 70 75 80 agg gga cct tgt ccg ggt ttg
aat acg ttg gcg aat cat ggg tac ctt 288Arg Gly Pro Cys Pro Gly Leu
Asn Thr Leu Ala Asn His Gly Tyr Leu 85 90 95 ccc agg tcg ggt atc
gcg acg cca gct cag atc gtt cag gct gtt atg 336Pro Arg Ser Gly Ile
Ala Thr Pro Ala Gln Ile Val Gln Ala Val Met 100 105 110 gaa gga ttc
aac atg gag aac acg ttc gcg aaa ttc gtt acc tac gca 384Glu Gly Phe
Asn Met Glu Asn Thr Phe Ala Lys Phe Val Thr Tyr Ala 115 120 125 gcc
ttc ctc gtc gac gga aac ccg att acg aat ttg atg agt att gga 432Ala
Phe Leu Val Asp Gly Asn Pro Ile Thr Asn Leu Met Ser Ile Gly 130 135
140 ggg aag act tgg agg acg ggg att att gaa ccc ccg cct cct gcg att
480Gly Lys Thr Trp Arg Thr Gly Ile Ile Glu Pro Pro Pro Pro Ala Ile
145 150 155 160 gtg ggt ggg ctg aat aca cat gct gtg ttt gaa ggt gat
acg agt atg 528Val Gly Gly Leu Asn Thr His Ala Val Phe Glu Gly Asp
Thr Ser Met 165 170 175 acg cgc gga gac ttc cat ttc ggc gat aat cat
agt ttc aac cag acg 576Thr Arg Gly Asp Phe His Phe Gly Asp Asn His
Ser Phe Asn Gln Thr 180 185 190 ttg ttc gat cag ttc gtg gaa tac agc
aac atc cac gga gga gga ttc 624Leu Phe Asp Gln Phe Val Glu Tyr Ser
Asn Ile His Gly Gly Gly Phe 195 200 205 tac aat ctc aca gct gca act
gaa ctc cga tac cag cgc atc cag cag 672Tyr Asn Leu Thr Ala Ala Thr
Glu Leu Arg Tyr Gln Arg Ile Gln Gln 210 215 220 tcg atc gct acg aac
cca gag atg agt ttc gtc tct cct cgc tgg ttc 720Ser Ile Ala Thr Asn
Pro Glu Met Ser Phe Val Ser Pro Arg Trp Phe 225 230 235 240 aca gca
atc ctt ctt cag gac gag aag ttc cct gat gac ttc cat cgg 768Thr Ala
Ile Leu Leu Gln Asp Glu Lys Phe Pro Asp Asp Phe His Arg 245 250 255
gcg cct ggt ccg ttc agc ttc gaa ggt cta ggg tac ctt gtt acg agg
816Ala Pro Gly Pro Phe Ser Phe Glu Gly Leu Gly Tyr Leu Val Thr Arg
260 265 270 cga cct atg cct cct gga aga aat gtt ggg gga gtg gac aat
tat gtc 864Arg Pro Met Pro Pro Gly Arg Asn Val Gly Gly Val Asp Asn
Tyr Val 275 280 285 cct gat ccc aac tcg gcg gat ttc aac tct ttc tgc
aag atg tac gag 912Pro Asp Pro Asn Ser Ala Asp Phe Asn Ser Phe Cys
Lys Met Tyr Glu 290 295 300 gac ttt gtg aac gat att gtc gtt gca ctc
tat ccg aat ccg acg ggt 960Asp Phe Val Asn Asp Ile Val Val Ala Leu
Tyr Pro Asn Pro Thr Gly 305 310 315 320 ttg ttg agg aga aat ttg atc
aag aat ttg gag tac ttc tgg acg ggg 1008Leu Leu Arg Arg Asn Leu Ile
Lys Asn Leu Glu Tyr Phe Trp Thr Gly 325 330 335 atg ttc gat cct gct
tgc acc gaa gtg aaa ccg tat ggt aca ctg tag 1056Met Phe Asp Pro Ala
Cys Thr Glu Val Lys Pro Tyr Gly Thr Leu 340 345 350
10351PRTCoprinopsis cinerea okayama7#130 10Met Val Ser Cys Lys Leu
Pro Leu Pro Leu Leu Thr Leu Ala Ile Ala 1 5 10 15 Leu Ala Asn Val
Asn Ala Phe Pro Ala Tyr Gln Ser Leu Gly Gly Leu 20 25 30 Ser Lys
Arg Gln Leu Glu Thr Ile Ile Pro Gly Leu Pro Val Val Asn 35 40 45
Pro Gly Pro Pro Pro Gly Pro Leu Ala Asp Ser Thr Leu Lys Leu Val 50
55 60 Asn Asp Ala Ala His Pro Tyr Gln Ala Pro Arg Pro His Leu Asp
His 65 70 75 80 Arg Gly Pro Cys Pro Gly Leu Asn Thr Leu Ala Asn His
Gly Tyr Leu 85 90 95 Pro Arg Ser Gly Ile Ala Thr Pro Ala Gln Ile
Val Gln Ala Val Met 100 105 110 Glu Gly Phe Asn Met Glu Asn Thr Phe
Ala Lys Phe Val Thr Tyr Ala 115 120 125 Ala Phe Leu Val Asp Gly Asn
Pro Ile Thr Asn Leu Met Ser Ile Gly 130 135 140 Gly Lys Thr Trp Arg
Thr Gly Ile Ile Glu Pro Pro Pro Pro Ala Ile 145 150 155 160 Val Gly
Gly Leu Asn Thr His Ala Val Phe Glu Gly Asp Thr Ser Met 165 170 175
Thr Arg Gly Asp Phe His Phe Gly Asp Asn His Ser Phe Asn Gln Thr 180
185 190 Leu Phe Asp Gln Phe Val Glu Tyr Ser Asn Ile His Gly Gly Gly
Phe 195 200 205 Tyr Asn Leu Thr Ala Ala Thr Glu Leu Arg Tyr Gln Arg
Ile Gln Gln 210 215 220 Ser Ile Ala Thr Asn Pro Glu Met Ser Phe Val
Ser Pro Arg Trp Phe 225 230 235 240 Thr Ala Ile Leu Leu Gln Asp Glu
Lys Phe Pro Asp Asp Phe His Arg 245 250 255 Ala Pro Gly Pro Phe Ser
Phe Glu Gly Leu Gly Tyr Leu Val Thr Arg 260 265 270 Arg Pro Met Pro
Pro Gly Arg Asn Val Gly Gly Val Asp Asn Tyr Val 275 280 285 Pro Asp
Pro Asn Ser Ala Asp Phe Asn Ser Phe Cys Lys Met Tyr Glu 290 295 300
Asp Phe Val Asn Asp Ile Val Val Ala Leu Tyr Pro Asn Pro Thr Gly 305
310 315 320 Leu Leu Arg Arg Asn Leu Ile Lys Asn Leu Glu Tyr Phe Trp
Thr Gly 325 330 335 Met Phe Asp Pro Ala Cys Thr Glu Val Lys Pro Tyr
Gly Thr Leu 340 345 350 111161DNACoprinopsis cinerea
okayama7#130CDS(1)..(1158) 11atg aac ggt ctg ttc gcc aca gtc aag
ctt gcc ttg gtc act tta ctg 48Met Asn Gly Leu Phe Ala Thr Val Lys
Leu Ala Leu Val Thr Leu Leu 1 5 10 15 gct tcg caa agt caa ttc gcc
aac gcc ttt ccg gca tgg caa tct ttg 96Ala Ser Gln Ser Gln Phe Ala
Asn Ala Phe Pro Ala Trp Gln Ser Leu 20 25 30 ggc ggg cta tcg gag
cga cag ttg gac gaa gtt atg ccg atg ctg aag 144Gly Gly Leu Ser Glu
Arg Gln Leu Asp Glu Val Met Pro Met Leu Lys 35 40 45 cat cgc gtt
cct cca cct cca cct ggc cct ccg gcc ttt act ggc gct 192His Arg Val
Pro Pro Pro Pro Pro Gly Pro Pro Ala Phe Thr Gly Ala 50 55 60 aag
ctc gtg aac gac aag gcc cat cca ttc aag cct ctc aaa aag ggc 240Lys
Leu Val Asn Asp Lys Ala His Pro Phe Lys Pro Leu Lys Lys Gly 65 70
75 80 gac gtc cgt gga cca tgt cct gga ttg aac acc cta gcc tcc cat
ggg 288Asp Val Arg Gly Pro Cys Pro Gly Leu Asn Thr Leu Ala Ser His
Gly 85 90 95 tac ctc ccc cgc aac ggt gtc gcc agc cca tcc cag atc
att gac gcc 336Tyr Leu Pro Arg Asn Gly Val Ala Ser Pro Ser Gln Ile
Ile Asp Ala 100 105 110 gtc caa gaa ggt ttc aac atg gag aac gag ctg
gct agg ttt acg acc 384Val Gln Glu Gly Phe Asn Met Glu Asn Glu Leu
Ala Arg Phe Thr Thr 115 120 125 tat gtc gct cac ctc gtc gac ggc aac
ctt gtc act gac ttg ctc agt 432Tyr Val Ala His Leu Val Asp Gly Asn
Leu Val Thr Asp Leu Leu Ser 130 135 140 atc ggc gag aag acg cgc aag
aca ggc ccc gat cct cct ccc ccg gcc 480Ile Gly Glu Lys Thr Arg Lys
Thr Gly Pro Asp Pro Pro Pro Pro Ala 145 150 155 160 atc gtc gga ggt
ctc aac aac cac ggc acc ttc gaa gga gat gcc agt 528Ile Val Gly Gly
Leu Asn Asn His Gly Thr Phe Glu Gly Asp Ala Ser 165 170 175 ttg acg
cga ggc gac gcc ttc ttc ggc gat aat cac aac ttc aac cag 576Leu Thr
Arg Gly Asp Ala Phe Phe Gly Asp Asn His Asn Phe Asn Gln 180 185 190
gag ctg ttt gac cag ttc aag aat ttc agc gcg gtg tac gga aac ggc
624Glu Leu Phe Asp Gln Phe Lys Asn Phe Ser Ala Val Tyr Gly Asn Gly
195 200 205 ttc ttc aac atg acc gtc gct ggg gag ctt cgc ttc cac cgc
atc caa 672Phe Phe Asn Met Thr Val Ala Gly Glu Leu Arg Phe His Arg
Ile Gln 210 215 220 caa tcc att gca acc aac ccc gag ttc tct ctc gtc
gga ctg cgc cat 720Gln Ser Ile Ala Thr Asn Pro Glu Phe Ser Leu Val
Gly Leu Arg His 225 230 235 240 ctc acc gcc tac gcg gaa gcc tcg ttc
ccg tct ctc ttc ttc gtc gat 768Leu Thr Ala Tyr Ala Glu Ala Ser Phe
Pro Ser Leu Phe Phe Val Asp 245 250 255 ggg cga aag aca ggg gcc gaa
gca ggg cag ctc gac atg gcc aca gcc 816Gly Arg Lys Thr Gly Ala Glu
Ala Gly Gln Leu Asp Met Ala Thr Ala 260 265 270 gaa agc ttc ttc agg
gac atg atg tac cct cct gat ttc ttc agg cct 864Glu Ser Phe Phe Arg
Asp Met Met Tyr Pro Pro Asp Phe Phe Arg Pro 275 280 285 gca gcg cct
gtt gct gga gat gcg gga gcc atc ttc ctc gct cac cct 912Ala Ala Pro
Val Ala Gly Asp Ala Gly Ala Ile Phe Leu Ala His Pro 290 295 300 ttc
caa cca gga agg aac gtc gga ggc gtc aac aac ttc acg gtg gat 960Phe
Gln Pro Gly Arg Asn Val Gly Gly Val Asn Asn Phe Thr Val Asp 305 310
315 320 gac agc ttg ggc agt ctt ctc gat ttc tgc ggg ttc tac gag aac
ttt 1008Asp Ser Leu Gly Ser Leu Leu Asp Phe Cys Gly Phe Tyr Glu Asn
Phe 325 330 335 gtc aac aag acg ctc aag gca ctg tac ccc aac ccc aag
ggc gtg ttg 1056Val Asn Lys Thr Leu Lys Ala Leu Tyr Pro Asn Pro Lys
Gly Val Leu 340 345 350 agg agg aat ctc aat atc aac ctc cag ttc ttc
ttc gag tcc ttg ccc 1104Arg Arg Asn Leu Asn Ile Asn Leu Gln Phe Phe
Phe Glu Ser Leu Pro 355 360 365 aag gac gag agc ggt acc cct gtc tgc
acc cag gtg ttc ccc tac gga 1152Lys Asp Glu Ser Gly Thr Pro Val Cys
Thr Gln Val Phe Pro Tyr Gly 370 375 380 cgt aac tga 1161Arg Asn 385
12386PRTCoprinopsis cinerea okayama7#130 12Met Asn Gly Leu Phe Ala
Thr Val Lys Leu Ala Leu Val Thr Leu Leu 1 5 10 15 Ala Ser Gln Ser
Gln Phe Ala Asn Ala Phe Pro Ala Trp Gln Ser Leu 20 25 30 Gly Gly
Leu Ser Glu Arg Gln Leu Asp Glu Val Met Pro Met Leu Lys 35 40 45
His Arg Val Pro Pro Pro Pro Pro Gly Pro Pro Ala Phe Thr Gly Ala 50
55 60 Lys Leu Val Asn Asp Lys Ala His Pro Phe Lys Pro Leu Lys Lys
Gly 65 70 75 80 Asp Val Arg Gly Pro Cys Pro Gly Leu Asn Thr Leu Ala
Ser His Gly 85 90 95 Tyr Leu Pro Arg Asn Gly Val Ala Ser Pro Ser
Gln Ile Ile Asp Ala 100 105 110 Val Gln Glu Gly Phe Asn Met Glu Asn
Glu Leu Ala Arg Phe Thr Thr 115 120 125 Tyr Val Ala His Leu Val Asp
Gly Asn Leu Val Thr Asp Leu Leu Ser 130 135 140 Ile Gly Glu Lys Thr
Arg Lys Thr Gly Pro Asp Pro Pro Pro Pro Ala 145 150 155 160 Ile Val
Gly Gly Leu Asn Asn His Gly Thr Phe Glu Gly Asp Ala Ser 165 170 175
Leu Thr Arg Gly Asp Ala Phe Phe Gly Asp Asn His Asn Phe Asn Gln 180
185 190 Glu Leu Phe Asp Gln Phe Lys Asn Phe Ser Ala Val Tyr Gly Asn
Gly 195 200 205 Phe Phe Asn Met Thr Val Ala Gly Glu Leu Arg Phe His
Arg Ile Gln 210 215 220 Gln Ser Ile Ala Thr Asn Pro Glu Phe Ser Leu
Val Gly Leu Arg His 225 230 235 240 Leu Thr Ala Tyr Ala Glu Ala Ser
Phe Pro Ser Leu Phe Phe Val Asp 245 250 255 Gly Arg Lys Thr Gly Ala
Glu Ala Gly Gln Leu Asp Met Ala Thr Ala 260 265 270 Glu Ser Phe Phe
Arg Asp Met Met Tyr Pro Pro Asp Phe Phe Arg Pro 275 280 285 Ala Ala
Pro Val Ala Gly Asp Ala Gly Ala Ile Phe Leu Ala His Pro 290 295 300
Phe Gln Pro Gly Arg Asn Val Gly Gly Val Asn Asn Phe Thr Val Asp 305
310 315 320 Asp Ser Leu Gly Ser Leu Leu Asp Phe Cys Gly Phe Tyr Glu
Asn Phe 325 330 335 Val Asn Lys Thr Leu Lys Ala Leu Tyr Pro Asn Pro
Lys Gly Val Leu 340 345 350 Arg Arg Asn Leu Asn Ile Asn Leu Gln Phe
Phe Phe Glu Ser Leu Pro 355 360 365 Lys Asp Glu Ser Gly Thr Pro Val
Cys Thr Gln Val Phe Pro Tyr Gly 370 375 380 Arg Asn 385
131026DNACoprinopsis cinerea okayama7#130CDS(1)..(1023) 13atg ctc
aaa ccg cgt gtt cca ccc cct ccc cct ggc cct ttg gcg ttc 48Met Leu
Lys Pro Arg Val Pro Pro Pro Pro Pro Gly Pro Leu Ala Phe 1 5 10 15
aat gga acc aag ctt gtg aac gac gaa gat cac cct ttc atg cct ccg
96Asn Gly Thr Lys Leu Val Asn Asp Glu Asp His Pro Phe Met Pro Pro
20 25 30 agg aag ggg gat gcc cgt gga ccg tgt cct ggg ttg aat act
ttg gcg 144Arg Lys Gly Asp Ala Arg Gly Pro Cys Pro Gly Leu Asn Thr
Leu Ala 35 40 45 tcg cac ggg tac ctc ccc cgt aat ggc ata gcc act
ccc gct cag atc 192Ser His Gly Tyr Leu Pro Arg Asn Gly Ile Ala Thr
Pro Ala Gln Ile 50 55 60 atc aac gcc gtt caa gaa ggc ttc aat atg
gag aac gag atc gcc agg 240Ile Asn Ala Val Gln Glu Gly Phe Asn Met
Glu Asn Glu Ile Ala Arg 65 70 75 80 ttc acg acc tac acc gcg cat ctc
atg gac ggg aat ctg gtc act gac 288Phe Thr Thr Tyr Thr Ala His Leu
Met Asp Gly Asn Leu Val Thr Asp 85 90 95 ttg ctc agt atc ggg ccg
aag acg ccc aag act gga cct gac cca cct 336Leu Leu Ser Ile Gly Pro
Lys Thr Pro Lys Thr Gly Pro Asp Pro Pro 100 105 110 ccc cct gcc atc
gtt gga gga ttg aac aac cat ggt act ttc gaa ggc 384Pro Pro Ala Ile
Val Gly Gly Leu Asn Asn His Gly Thr Phe Glu Gly 115 120 125 gac gcg
agt ctg tct cgg gca gac gct ttc ttt ggc gat aac cat agc 432Asp Ala
Ser Leu Ser Arg Ala Asp Ala Phe Phe Gly Asp Asn His Ser 130 135 140
ttt gac caa gag ctg ttc gac cag ttc agg aat ttc agc gcg atc tac
480Phe Asp Gln Glu Leu Phe Asp Gln Phe Arg Asn Phe Ser Ala Ile Tyr
145 150 155 160 gga aac ggt ttc ttc aat atg aca gtc gcc gcc gag ctc
agg ttc cac 528Gly Asn Gly Phe Phe Asn Met Thr Val Ala Ala Glu Leu
Arg Phe His 165 170 175 cgt atc caa cag tcc atc gct acc aac ccc gaa
ttc tcc ttc gct gga 576Arg Ile Gln Gln Ser Ile Ala Thr Asn Pro Glu
Phe Ser Phe Ala Gly 180 185 190 ctc cgt cac att acc gcc tac gct gaa
gcc tct ttc cct ccg atc ttc 624Leu Arg His Ile Thr Ala Tyr Ala Glu
Ala Ser Phe Pro Pro Ile Phe 195 200 205
ttc gtc gat ggg cgg aag acc ggt gct gag gcg gga caa ctc gac atg
672Phe Val Asp Gly Arg Lys Thr Gly Ala Glu Ala Gly Gln Leu Asp Met
210 215 220 gcc gcc gcg gag agc ttc ttc aag cac atg atg tac cct ccc
gac ttc 720Ala Ala Ala Glu Ser Phe Phe Lys His Met Met Tyr Pro Pro
Asp Phe 225 230 235 240 cac cgc cct gcg gaa ccc gtc aac agc gat gcg
cag gcc gta ttt gaa 768His Arg Pro Ala Glu Pro Val Asn Ser Asp Ala
Gln Ala Val Phe Glu 245 250 255 gtt cat cct ttc caa ccc ggg agg aac
gtc gga ggg gtc aac aac tat 816Val His Pro Phe Gln Pro Gly Arg Asn
Val Gly Gly Val Asn Asn Tyr 260 265 270 acc gtt gat gag agt ttg ggt
ggt ctg ttg gat ttc tgc ggg ttc tac 864Thr Val Asp Glu Ser Leu Gly
Gly Leu Leu Asp Phe Cys Gly Phe Tyr 275 280 285 gag aac ttt gtg aac
aag acg atc aag ggt ttg tat ccc aac ccc acg 912Glu Asn Phe Val Asn
Lys Thr Ile Lys Gly Leu Tyr Pro Asn Pro Thr 290 295 300 ggc gtt ttg
aag agg aat ttg aat att aat ctc gat ttc ctc ttt gag 960Gly Val Leu
Lys Arg Asn Leu Asn Ile Asn Leu Asp Phe Leu Phe Glu 305 310 315 320
gcg ttg ccg aag gct ggt gac ggg tct caa ccg tgt act caa gtt ttc
1008Ala Leu Pro Lys Ala Gly Asp Gly Ser Gln Pro Cys Thr Gln Val Phe
325 330 335 cct tac gga cac gat tag 1026Pro Tyr Gly His Asp 340
14341PRTCoprinopsis cinerea okayama7#130 14Met Leu Lys Pro Arg Val
Pro Pro Pro Pro Pro Gly Pro Leu Ala Phe 1 5 10 15 Asn Gly Thr Lys
Leu Val Asn Asp Glu Asp His Pro Phe Met Pro Pro 20 25 30 Arg Lys
Gly Asp Ala Arg Gly Pro Cys Pro Gly Leu Asn Thr Leu Ala 35 40 45
Ser His Gly Tyr Leu Pro Arg Asn Gly Ile Ala Thr Pro Ala Gln Ile 50
55 60 Ile Asn Ala Val Gln Glu Gly Phe Asn Met Glu Asn Glu Ile Ala
Arg 65 70 75 80 Phe Thr Thr Tyr Thr Ala His Leu Met Asp Gly Asn Leu
Val Thr Asp 85 90 95 Leu Leu Ser Ile Gly Pro Lys Thr Pro Lys Thr
Gly Pro Asp Pro Pro 100 105 110 Pro Pro Ala Ile Val Gly Gly Leu Asn
Asn His Gly Thr Phe Glu Gly 115 120 125 Asp Ala Ser Leu Ser Arg Ala
Asp Ala Phe Phe Gly Asp Asn His Ser 130 135 140 Phe Asp Gln Glu Leu
Phe Asp Gln Phe Arg Asn Phe Ser Ala Ile Tyr 145 150 155 160 Gly Asn
Gly Phe Phe Asn Met Thr Val Ala Ala Glu Leu Arg Phe His 165 170 175
Arg Ile Gln Gln Ser Ile Ala Thr Asn Pro Glu Phe Ser Phe Ala Gly 180
185 190 Leu Arg His Ile Thr Ala Tyr Ala Glu Ala Ser Phe Pro Pro Ile
Phe 195 200 205 Phe Val Asp Gly Arg Lys Thr Gly Ala Glu Ala Gly Gln
Leu Asp Met 210 215 220 Ala Ala Ala Glu Ser Phe Phe Lys His Met Met
Tyr Pro Pro Asp Phe 225 230 235 240 His Arg Pro Ala Glu Pro Val Asn
Ser Asp Ala Gln Ala Val Phe Glu 245 250 255 Val His Pro Phe Gln Pro
Gly Arg Asn Val Gly Gly Val Asn Asn Tyr 260 265 270 Thr Val Asp Glu
Ser Leu Gly Gly Leu Leu Asp Phe Cys Gly Phe Tyr 275 280 285 Glu Asn
Phe Val Asn Lys Thr Ile Lys Gly Leu Tyr Pro Asn Pro Thr 290 295 300
Gly Val Leu Lys Arg Asn Leu Asn Ile Asn Leu Asp Phe Leu Phe Glu 305
310 315 320 Ala Leu Pro Lys Ala Gly Asp Gly Ser Gln Pro Cys Thr Gln
Val Phe 325 330 335 Pro Tyr Gly His Asp 340 15687DNACoprinus
radiansCDS(1)..(687) 15ccg cct ccg gaa tac gtc gga cca aag ctc gtc
aat gac gca gac cac 48Pro Pro Pro Glu Tyr Val Gly Pro Lys Leu Val
Asn Asp Ala Asp His 1 5 10 15 cct tgg gag cct ctt cga cct gga gat
att cgt ggc ccg tgc cca gga 96Pro Trp Glu Pro Leu Arg Pro Gly Asp
Ile Arg Gly Pro Cys Pro Gly 20 25 30 ctc aat acc ctt gcg tct cat
ggt tat ctg ccg cgc aac gga gtg gcg 144Leu Asn Thr Leu Ala Ser His
Gly Tyr Leu Pro Arg Asn Gly Val Ala 35 40 45 act ccc gct caa atc
att aat gca att gtg gaa ggc ttc aac ttc aac 192Thr Pro Ala Gln Ile
Ile Asn Ala Ile Val Glu Gly Phe Asn Phe Asn 50 55 60 tac gaa ggc
gca gtc ttc gtc acg tac ttc gct cat atc gtc gac gga 240Tyr Glu Gly
Ala Val Phe Val Thr Tyr Phe Ala His Ile Val Asp Gly 65 70 75 80 aac
ctc gtc act gat ctt ctc agt att gga gga aag acc aat ctg act 288Asn
Leu Val Thr Asp Leu Leu Ser Ile Gly Gly Lys Thr Asn Leu Thr 85 90
95 ggc gag gac acc gga gcc cca gcc ata atc gga ggg ttg aac acg cac
336Gly Glu Asp Thr Gly Ala Pro Ala Ile Ile Gly Gly Leu Asn Thr His
100 105 110 tct gtc ttt gaa ggc gac gca agc atg act cgc gat gac ttc
cac ttt 384Ser Val Phe Glu Gly Asp Ala Ser Met Thr Arg Asp Asp Phe
His Phe 115 120 125 ggt gac aac cac agc ttc aac cag acc ttg ttc gac
cag ttc gtc gag 432Gly Asp Asn His Ser Phe Asn Gln Thr Leu Phe Asp
Gln Phe Val Glu 130 135 140 tac agc aac acc tac ggc ggt ggc ttc tat
aac caa gaa gtt gca ggc 480Tyr Ser Asn Thr Tyr Gly Gly Gly Phe Tyr
Asn Gln Glu Val Ala Gly 145 150 155 160 cac ctc cgc cgt cgc cgt atc
gag caa tcc att gcc acc aac ccc gaa 528His Leu Arg Arg Arg Arg Ile
Glu Gln Ser Ile Ala Thr Asn Pro Glu 165 170 175 ttc gac ttc acc tct
ccc cgt ttc ttc aca gcc ttc gcc gag tcc agc 576Phe Asp Phe Thr Ser
Pro Arg Phe Phe Thr Ala Phe Ala Glu Ser Ser 180 185 190 ttc cct tac
tcg ttc ttc gtc gac ggc cgt atc acc gag cgt ccc gga 624Phe Pro Tyr
Ser Phe Phe Val Asp Gly Arg Ile Thr Glu Arg Pro Gly 195 200 205 ggt
ctc agt atg gag aat gcc act ctc ttc ttc agg gac cac aag atg 672Gly
Leu Ser Met Glu Asn Ala Thr Leu Phe Phe Arg Asp His Lys Met 210 215
220 cca gac gac ttc tgg 687Pro Asp Asp Phe Trp 225 16229PRTCoprinus
radians 16Pro Pro Pro Glu Tyr Val Gly Pro Lys Leu Val Asn Asp Ala
Asp His 1 5 10 15 Pro Trp Glu Pro Leu Arg Pro Gly Asp Ile Arg Gly
Pro Cys Pro Gly 20 25 30 Leu Asn Thr Leu Ala Ser His Gly Tyr Leu
Pro Arg Asn Gly Val Ala 35 40 45 Thr Pro Ala Gln Ile Ile Asn Ala
Ile Val Glu Gly Phe Asn Phe Asn 50 55 60 Tyr Glu Gly Ala Val Phe
Val Thr Tyr Phe Ala His Ile Val Asp Gly 65 70 75 80 Asn Leu Val Thr
Asp Leu Leu Ser Ile Gly Gly Lys Thr Asn Leu Thr 85 90 95 Gly Glu
Asp Thr Gly Ala Pro Ala Ile Ile Gly Gly Leu Asn Thr His 100 105 110
Ser Val Phe Glu Gly Asp Ala Ser Met Thr Arg Asp Asp Phe His Phe 115
120 125 Gly Asp Asn His Ser Phe Asn Gln Thr Leu Phe Asp Gln Phe Val
Glu 130 135 140 Tyr Ser Asn Thr Tyr Gly Gly Gly Phe Tyr Asn Gln Glu
Val Ala Gly 145 150 155 160 His Leu Arg Arg Arg Arg Ile Glu Gln Ser
Ile Ala Thr Asn Pro Glu 165 170 175 Phe Asp Phe Thr Ser Pro Arg Phe
Phe Thr Ala Phe Ala Glu Ser Ser 180 185 190 Phe Pro Tyr Ser Phe Phe
Val Asp Gly Arg Ile Thr Glu Arg Pro Gly 195 200 205 Gly Leu Ser Met
Glu Asn Ala Thr Leu Phe Phe Arg Asp His Lys Met 210 215 220 Pro Asp
Asp Phe Trp 225 17489DNACoprinus radiansCDS(1)..(315) 17gac cac aag
atg ccc gac gac ttc tgg cgt gcc ccc gag ccc act ggg 48Asp His Lys
Met Pro Asp Asp Phe Trp Arg Ala Pro Glu Pro Thr Gly 1 5 10 15 gga
ctc aac gtc ctc gac atc tac aga gca tct ggc tct cct cct gcc 96Gly
Leu Asn Val Leu Asp Ile Tyr Arg Ala Ser Gly Ser Pro Pro Ala 20 25
30 gga cgc aac gtc aac ggc acc aac acg ttc acc ccc gat ccc aac agc
144Gly Arg Asn Val Asn Gly Thr Asn Thr Phe Thr Pro Asp Pro Asn Ser
35 40 45 gcg gat ttc gat aat cct tgt gaa ctc tac tac gac tac gtc
aac agg 192Ala Asp Phe Asp Asn Pro Cys Glu Leu Tyr Tyr Asp Tyr Val
Asn Arg 50 55 60 ata gtg aag agt ctt tac ccc aac ccc act ggg atc
ctc agg gac aac 240Ile Val Lys Ser Leu Tyr Pro Asn Pro Thr Gly Ile
Leu Arg Asp Asn 65 70 75 80 ctg aat atc gcc ctc ggg cat gtg ttt gac
tcc atg gac ttc ggc gat 288Leu Asn Ile Ala Leu Gly His Val Phe Asp
Ser Met Asp Phe Gly Asp 85 90 95 tgc gag cag ttg ttc cct tat ggg
cgc taggtccgtg tatatagatt 335Cys Glu Gln Leu Phe Pro Tyr Gly Arg
100 105 tgccgaggtt ctattaccct atccttctgc tgcctccgag cttcatttta
ggctcgtcct 395gtcctttaca tagatgttgt tttggtcgtt gctttgacca
atatacattc ctcagtctaa 455aaaaaaaaaa aaaaagcact gatacgcggt taca
48918105PRTCoprinus radians 18Asp His Lys Met Pro Asp Asp Phe Trp
Arg Ala Pro Glu Pro Thr Gly 1 5 10 15 Gly Leu Asn Val Leu Asp Ile
Tyr Arg Ala Ser Gly Ser Pro Pro Ala 20 25 30 Gly Arg Asn Val Asn
Gly Thr Asn Thr Phe Thr Pro Asp Pro Asn Ser 35 40 45 Ala Asp Phe
Asp Asn Pro Cys Glu Leu Tyr Tyr Asp Tyr Val Asn Arg 50 55 60 Ile
Val Lys Ser Leu Tyr Pro Asn Pro Thr Gly Ile Leu Arg Asp Asn 65 70
75 80 Leu Asn Ile Ala Leu Gly His Val Phe Asp Ser Met Asp Phe Gly
Asp 85 90 95 Cys Glu Gln Leu Phe Pro Tyr Gly Arg 100 105
19325PRTCoprinus radians DSM888 19Pro Pro Pro Glu Tyr Val Gly Pro
Lys Leu Val Asn Asp Ala Asp His 1 5 10 15 Pro Trp Glu Pro Leu Arg
Pro Gly Asp Ile Arg Gly Pro Cys Pro Gly 20 25 30 Leu Asn Thr Leu
Ala Ser His Gly Tyr Leu Pro Arg Asn Gly Val Ala 35 40 45 Thr Pro
Ala Gln Ile Ile Asn Ala Ile Val Glu Gly Phe Asn Phe Asn 50 55 60
Tyr Glu Gly Ala Val Phe Val Thr Tyr Phe Ala His Ile Val Asp Gly 65
70 75 80 Asn Leu Val Thr Asp Leu Leu Ser Ile Gly Gly Lys Thr Asn
Leu Thr 85 90 95 Gly Glu Asp Thr Gly Ala Pro Ala Ile Ile Gly Gly
Leu Asn Thr His 100 105 110 Ser Val Phe Glu Gly Asp Ala Ser Met Thr
Arg Asp Asp Phe His Phe 115 120 125 Gly Asp Asn His Ser Phe Asn Gln
Thr Leu Phe Asp Gln Phe Val Glu 130 135 140 Tyr Ser Asn Thr Tyr Gly
Gly Gly Phe Tyr Asn Gln Glu Val Ala Gly 145 150 155 160 His Leu Arg
Arg Arg Arg Ile Glu Gln Ser Ile Ala Thr Asn Pro Glu 165 170 175 Phe
Asp Phe Thr Ser Pro Arg Phe Phe Thr Ala Phe Ala Glu Ser Ser 180 185
190 Phe Pro Tyr Ser Phe Phe Val Asp Gly Arg Ile Thr Glu Arg Pro Gly
195 200 205 Gly Leu Ser Met Glu Asn Ala Thr Leu Phe Phe Arg Asp His
Lys Met 210 215 220 Pro Asp Asp Phe Trp Arg Ala Pro Glu Pro Thr Gly
Gly Leu Asn Val 225 230 235 240 Leu Asp Ile Tyr Arg Ala Ser Gly Ser
Pro Pro Ala Gly Arg Asn Val 245 250 255 Asn Gly Thr Asn Thr Phe Thr
Pro Asp Pro Asn Ser Ala Asp Phe Asp 260 265 270 Asn Pro Cys Glu Leu
Tyr Tyr Asp Tyr Val Asn Arg Ile Val Lys Ser 275 280 285 Leu Tyr Pro
Asn Pro Thr Gly Ile Leu Arg Asp Asn Leu Asn Ile Ala 290 295 300 Leu
Gly His Val Phe Asp Ser Met Asp Phe Gly Asp Cys Glu Gln Leu 305 310
315 320 Phe Pro Tyr Gly Arg 325 2036DNAArtificial
sequencepolyT-anchor-primer 20tagctcgatg cttgcacgct tttttttttt
tttttt 362119DNAArtificial sequenceAP-primer 21tagctcgatg cttgcacgc
192237DNAArtificial sequencepolyT-anchor2-primer 22tgtaaccgcg
tatcagtgct tttttttttt ttttttv 372319DNAArtificial
sequenceAP2-primer 23tgtaaccgcg tatcagtgc 192430DNAArtificial
sequenceTS-short-primer 24aagcagtggt atcaacgcag agtacgcnnn
302545DNAArtificial sequenceheel-carrier primer 25gtaatacgac
tcactatagg gcaagcagtg gtatcaacgc agagt 452622DNAArtificial
sequenceheel-specific primer 26gtaatacgac tcactatagg gc
222715DNAArtificial sequencePrimer Cop1-For 27ccccnccgar taygt
152814DNAArtificial sequencePrimer Cop5-For 28gaycayaara tgcc
142918DNAArtificial sequencePrimer Cop6-Rev 29ccaraartcr tcnggcat
183020DNAArtificial sequencePrimer Aap1-For 30garccggnaa rccccggncc
203117DNAArtificial sequencePrimer Aap2-Rev 31gcarngtrtt arccngg
173215DNAArtificial sequencePrimer Aap4-For 32aaygcacnaa yccng
153316DNAArtificial sequencePrimer Aap4-Rev 33aartcggrtt ngtngc
163415DNAArtificial sequencePrimer Aap6-Rev 34arccngtggr ttngg
153521DNAArtificial sequenceSpecific primer 1Aap-For1 35cgcaacatga
aatacttcag c 213622DNAArtificial sequenceSpecific primer 1Aap-For2
36gagccaacac aacctcctgg ac 223721DNAArtificial sequenceSpecific
primer 1Aap-Rev4 37ggcataaggt cactggagtc c 213820DNAArtificial
sequenceSpecific primer 2Aap-For1 38ttctacatga aatattttcc
203918DNAArtificial sequenceSpecific primer 2Aap-Rev2 39aagcaggttg
ttggaccg 184014PRTArtificial sequencePeroxygenase motif I 40Xaa Xaa
Xaa Xaa Ser Xaa Xaa Xaa Gly Xaa Gly Xaa Xaa Asn 1 5 10
4114PRTArtificial sequencePeroxygenase motif II 41Gly Xaa Gly Xaa
Xaa Asn Xaa Xaa Xaa Ala Xaa Xaa Xaa Arg 1 5 10 4212PRTArtificial
sequencePeroxygenase motif III 42Arg Xaa Xaa Arg Ile Xaa Xaa Ser
Xaa Ala Thr Asn 1 5 10 4310PRTArtificial sequencePeroxygenase motif
IV 43Ser Xaa Ala Thr Asn Xaa Xaa Xaa Xaa Xaa 1 5 10
447PRTArtificial sequencePeroxygenase motif V 44Pro Xaa
Xaa Phe Xaa Arg Xaa 1 5 4511PRTArtificial sequencePeroxygenase
motif VI 45Xaa Xaa Xaa Xaa Leu Tyr Pro Asn Pro Xaa Xaa 1 5 10
4640DNAArtificial sequencePrimer AaP1F 46acacaactgg ggatccacca
tgaaatactt cagcctgttc 404736DNAArtificial sequencePrimer AaP1R
47agatctcgag aagcttaatc tcgcccgtac gggaat 364841DNAArtificial
sequencePrimer AaP2F 48acacaactgg ggatccacca tgaaatattt tcccctgttc
c 414936DNAArtificial sequencePrimer AaP2R 49agatctcgag aagcttaatc
tcgcccgtat gggaag 365039DNAArtificial sequenceForward Primer
50acacaactgg ggatccacca tggctcgcct tactttcct 395138DNAArtificial
sequenceReverse primer 51agatctcgag aagcttactt tccataaggg aagatctg
385239DNAArtificial sequenceForward primer 52acacaactgg ggatccacca
tgatctcgac ctcgaagca 395335DNAArtificial sequenceReverse primer
53agatctcgag aagcttaatc actcttgccc caggg 355438DNAArtificial
sequenceForward primer 54acacaactgg ggatccacca tggtttcgtg caagctcc
385537DNAArtificial sequenceReverse primer 55agatctcgag aagcttacag
tgtaccatac ggtttca 375638DNAArtificial sequenceForward primer
56acacaactgg ggatccacca tgaacggtct gttcgcca 385736DNAArtificial
sequenceReverse primer 57agatctcgag aagcttagtt acgtccgtag gggaac
365838DNAArtificial sequenceForward primer 58acacaactgg ggatccacca
tgctcaaacc gcgtgttc 385937DNAArtificial sequenceReverse primer
59agatctcgag aagcttaatc gtgtccgtaa gggaaaa 37
* * * * *
References