U.S. patent application number 13/619362 was filed with the patent office on 2013-05-02 for compositions and their uses directed to aceytl-coa carboxylases.
This patent application is currently assigned to Isis Pharmaceuticals, Inc.. The applicant listed for this patent is Sanjay Bhanot, Kenneth W. Dobie, John G. Geisler, Robert McKay, Brett P. Monia. Invention is credited to Sanjay Bhanot, Kenneth W. Dobie, John G. Geisler, Robert McKay, Brett P. Monia.
Application Number | 20130109849 13/619362 |
Document ID | / |
Family ID | 37087656 |
Filed Date | 2013-05-02 |
United States Patent
Application |
20130109849 |
Kind Code |
A1 |
Bhanot; Sanjay ; et
al. |
May 2, 2013 |
COMPOSITIONS AND THEIR USES DIRECTED TO ACEYTL-COA CARBOXYLASES
Abstract
Disclosed herein are compounds, compositions and methods for
modulating the expression of ACC1 or ACC2 or both in a cell, tissue
or animal. Also provided are uses of disclosed compounds and
compositions in the manufacture of a medicament for treatment of
diseases and disorders.
Inventors: |
Bhanot; Sanjay; (Carlsbad,
CA) ; Monia; Brett P.; (Encinitas, CA) ;
Geisler; John G.; (Blue Bell, PA) ; McKay;
Robert; (Poway, CA) ; Dobie; Kenneth W.; (Del
Mar, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Bhanot; Sanjay
Monia; Brett P.
Geisler; John G.
McKay; Robert
Dobie; Kenneth W. |
Carlsbad
Encinitas
Blue Bell
Poway
Del Mar |
CA
CA
PA
CA
CA |
US
US
US
US
US |
|
|
Assignee: |
Isis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
37087656 |
Appl. No.: |
13/619362 |
Filed: |
September 14, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11910606 |
Aug 18, 2009 |
8299041 |
|
|
PCT/US2006/013536 |
Apr 10, 2006 |
|
|
|
13619362 |
|
|
|
|
Current U.S.
Class: |
536/24.5 |
Current CPC
Class: |
C12N 2310/346 20130101;
C12N 2310/3341 20130101; C12N 2310/321 20130101; A61P 3/06
20180101; A61P 43/00 20180101; C12N 2310/11 20130101; A61P 9/00
20180101; C12N 15/1137 20130101; C12N 2310/315 20130101; A61P 3/10
20180101; A61P 5/48 20180101; C12N 2310/341 20130101; A61K 31/202
20130101; A61P 1/16 20180101; A61P 3/04 20180101; A61P 3/00
20180101; C12N 2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
536/24.5 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1-28. (canceled)
29. A compound comprising a modified oligonucleotide consisting of
12 to 30 linked nucleosides having a nucleobase sequence at least
85% complementary to: a nucleic acid molecule encoding human ACC1;
a nucleic acid molecule encoding human ACC2; or a nucleic acid
molecule encoding human ACC1 and a nucleic acid molecule encoding
ACC2; as measured over the entirety of the nucleobase sequence of
the modified oligonucleotide.
30. The compound of claim 29 wherein the modified oligonucleotide
comprises at least one chemical modification selected from a
modified internucleoside linkage, a modified nucleobase, and a
modified sugar.
31. The compound of claim 29, wherein said modified oligonucleotide
is a chimeric oligonucleotide.
32. The antisense oligonucleotide compound of claim 30, wherein the
modified oligonucleotide comprises at least one modified
internucleoside linkage.
33. The compound of claim 48, wherein the modified nucleobase is a
5 methylcytosine.
34-42. (canceled)
43. The compound of claim 32, wherein the modified internucleoside
linkage is a phosphorothioate linkage.
44. The compound of claim 30, wherein the modified oligonucleotide
comprises a modified sugar moiety.
45. The compound of claim 44, wherein the modified sugar comprises
a 2'-O-(2-methoxyethyl) moiety.
46. The compound of claim 44, wherein the modified sugar comprises
a bicyclic modified sugar moiety.
47. The compound of claim 46, wherein the bicyclic modified sugar
moiety comprises a 4'-(CH2).sub.2-O-2' bridge.
48. The compound of claim 30, wherein the modified oligonucleotide
comprises a modified nucleobase.
49. The compound of claim 31, wherein the chimeric oligonucleotide
comprises a first region comprising 2-deoxynucleotides and a second
and third region flanking said first region, comprising at least
one modified sugar moiety.
50. The compound of claim 29, wherein the modified oligonucleotide
is at least 90% complementary to a nucleic acid molecule encoding
human ACC1 as measured over the entirety of the nucleobase sequence
of the modified oligonucleotide.
51. The compound of claim 29, wherein the modified oligonucleotide
is at least 95% complementary to a nucleic acid molecule encoding
human ACC1 as measured over the entirety of the nucleobase sequence
of the modified oligonucleotide.
52. The compound of claim 29, wherein the modified oligonucleotide
is 100% complementary to a nucleic acid molecule encoding human
ACC1 as measured over the entirety of the nucleobase sequence of
the modified oligonucleotide.
53. The compound of claim 29, wherein the modified oligonucleotide
is at least 90% complementary to a nucleic acid molecule encoding
human ACC2 as measured over the entirety of the nucleobase sequence
of the modified oligonucleotide.
54. The compound of claim 29, wherein the modified oligonucleotide
is at least 95% complementary to a nucleic acid molecule encoding
human ACC2 as measured over the entirety of the nucleobase sequence
of the modified oligonucleotide.
55. The compound of claim 29, wherein the modified oligonucleotide
is 100% complementary to a nucleic acid molecule encoding human
ACC2 as measured over the entirety of the nucleobase sequence of
the modified oligonucleotide.
56. The compound of claim 29, wherein the modified oligonucleotide
is at least 90% complementary to a nucleic acid molecule encoding
human ACC1 and at least 90% complementary to a nucleic acid
molecule encoding human ACC2 measured over the entirety of the
nucleobase sequence of the modified oligonucleotide.
57. The compound of claim 56, wherein the modified oligonucleotide
is at least 95% complementary to a nucleic acid molecule encoding
human ACC1 and at least 95% complementary to a nucleic acid
molecule encoding human ACC2 as measured over the entirety of the
nucleobase sequence of the modified oligonucleotide.
58. The compound of claim 57, wherein the modified oligonucleotide
is 100% complementary to a nucleic acid molecule encoding human
ACC1 and 100% complementary to a nucleic acid molecule encoding
human ACC2 as measured over the entirety of the nucleobase sequence
of the modified oligonucleotide.
59. The compound of claim 29, wherein the modified oligonucleotide
is 100% complementary to a nucleic acid molecule encoding human
ACC1 and at least 85% complementary to a nucleic acid molecule
encoding human ACC2 as measured over the entirety of the nucleobase
sequence of the modified oligonucleotide.
60. The compound of claim 29, wherein the modified oligonucleotide
is at least 85% complementary to a nucleic acid molecule encoding
human ACC1 and 100% complementary to a nucleic acid molecule
encoding human ACC2 as measured over the entirety of the nucleobase
sequence of the modified oligonucleotide.
61. The compound of claim 49, wherein the modified sugar moiety is
a 2'-O-(2-methoxyethyl) moiety.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 11/910,606, filed Aug. 18, 2009, which is a US National
under 35 USC 371 of International Application Serial Number
PCT/US2006/013536, filed Apr. 10, 2006, which claims priority to
U.S. Provisional Patent Application Ser. No. 60/669,530, filed Apr.
8, 2005, each of the above applications is herein incorporated by
reference in its entirety.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0058USD1SEQ.txt, created on Sep. 11, 2012 which
is 792 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0003] Disclosed herein are compounds, compositions and methods
useful for modulating the expression of ACC1 or ACC2 in a cell,
tissue or animal.
BACKGROUND OF THE INVENTION
[0004] Acetyl-CoA carboxylase (ACC) activity is responsible for the
ATP-dependent carboxylation of acetyl-CoA to malonyl-CoA, the
rate-limiting step in fatty acid synthesis. This reaction proceeds
in two half-reactions: a biotin carboxylase reaction and a
carboxyltransferase reaction. Malonyl-CoA is the carbon donor in
the synthesis of long chain fatty acids and in their elongation
into very long chain fatty acids, and is also a regulator of the
palmitoyl-CoA-carnitine shuttle system that is involved in the
mitochondrial oxidation of long chain fatty acids (Harwood, Curr.
Opin. Investig. Drugs, 2004, 5, 283-289; McGarry et al., J. Biol.
Chem., 1978, 253, 8294-8300).
[0005] Malonyl-CoA, the product of ACC activity, is the key
metabolic signal for the control of fatty acid oxidation and
synthesis in response to dietary changes. The carboxylases are
highly regulated by diet, hormones, and other physiological
factors. Food intake induces the synthesis of ACC and increases ACC
activity. Starvation or diabetes mellitus represses the expression
of the genes and decreases the activities of the enzymes. Treating
diabetic animals with insulin increases the activity of the enzyme,
and prolonged insulin treatment stimulates the synthesis of ACC
protein.
[0006] ACC exists as two tissue-specific isozymes: ACC1 (also known
as acetyl-CoA carboxylase alpha; ACAC; ACACA; and tgf) which is
present in lipogenic tissues such as liver and adipose and ACC2
(also known as acetyl-Coenzyme A carboxylase beta, ACACB, ACCB,
HACC275, and acetyl-CoA carboxylase 2) which is present in
oxidative tissues such as liver, heart and skeletal muscle. ACC1
and ACC2 are encoded by separate genes (Harwood, Curr. Opin.
Investig. Drugs, 2004, 5, 283-289).
[0007] Use of antisense oligonucleotides to decrease ACC1 and ACC2
for therapeutics is advantageous over small molecules in that
antisense oligonucleotides will not decrease ACC levels in the
central nervous system or pancreas, thus preventing side effects
observed with small molecule inhibition of ACC1 and ACC2.
SUMMARY OF THE INVENTION
[0008] The present invention is directed to methods of using
compounds, particularly antisense compounds, targeted to a nucleic
acid molecule encoding ACC1 or ACC2 and which modulate the
expression of ACC1, ACC2, or both ACC1 and ACC2 to achieve
particular phenotypic endpoints. Further provided are methods of
reducing ACC1 or ACC2 or both ACC1 and ACC2 concurrently in cells,
tissues or animals comprising contacting said cells, tissues or
animals with one or more of the compounds or compositions of the
present invention.
[0009] The present invention provides methods of lowering blood
glucose, triglycerides, or cholesterol, in a subject in need of
such treatment, by administering to said subject an antisense
compound which reduces ACC1 or ACC2. In a preferred embodiment, the
antisense compound reduces both ACC1 and ACC2. In another
embodiment, the present invention provides methods of lowering
adiposity. In another embodiment, the present invention provides
methods of lowering liver triglyceride levels. Another embodiment
of the present invention is a method of inhibiting fatty acid
synthesis. Other embodiments include methods of stimulating fatty
acid oxidation, improving insulin sensitivity, and inhibiting
hepatic glucose output in a subject in need of such treatment, by
administering to said subject an antisense compound which reduces
ACC1 or ACC2 or both ACC1 and ACC2.
[0010] In other embodiments, the present invention provides methods
of ameliorating or lessening the severity of a condition in an
animal comprising contacting said animal with an effective amount
of an antisense compound which reduces ACC1, ACC2, or both ACC1 and
ACC2 so that measurement of one or more physical indices of said
condition indicates a lessening of the severity of said condition.
In one embodiment, the condition is obesity. In another embodiment,
the obesity is diet-induced. In other embodiments, conditions
include, but are not limited to, diabetes, insulin resistance,
insulin deficiency, hypercholesterolemia, hyperglycemia,
hypertriglyceridemia, hyperfattyacidemia, metabolic syndrome, and
cardiovascular disease. In another embodiment, the condition is
liver steatosis. In another embodiment, the liver steatosis is
steatohepatitis, non-alcoholic fatty liver disease (NAFLD) or
non-alcoholic steatohepatitis (NASH). Also contemplated herein is
the use of a compound of the invention in the preparation of a
medicament for amelioration or treatment of a condition associated
with ACC1 or ACC2 or both.
[0011] In some embodiments, antisense compounds modulate ACC1,
ACC2, or both ACC1 and ACC2. Contemplated and provided herein are
antisense compounds comprising sequences of 13 to 30 nucleotides in
length. Also provided herein are antisense compounds with at least
two modifications selected from a modified internucleoside linkage,
a modified nucleobase, or a modified sugar. Provided herein are
chimeric oligonucleotides comprising a deoxy nucleotide region
flanked on each of the 5' and 3' ends with at least one
2'-O-methoxylethyl nucleotide. Further provided are chimeric
oligonucleotides comprising ten deoxynucleotides and flanked on
both the 5' and 3' ends with five 2'-O-methoxyethyl nucleotides
wherein each internucleoside linkage is a phosphorothioate. In a
further embodiment, the antisense compounds of the present
invention may have at least one 5-methylcytosine.
DETAILED DESCRIPTION OF THE INVENTION
Overview
[0012] Disclosed herein are antisense compounds and methods of
using said antisense compounds, including antisense
oligonucleotides which reduce ACC1 or ACC2 or both ACC1 and ACC2.
Such methods are accomplished by providing antisense compounds
which are complementary to one or more target nucleic acid
molecules encoding ACC1 or ACC2.
[0013] In accordance with the present invention are compositions
and methods for modulating the expression of ACC1 (also known as
acetyl-CoA carboxylase alpha, ACAC, ACACA, and tgf) or ACC2 (also
known as acetyl-Coenzyme A carboxylase beta, ACACB, ACCB, HACC275,
and acetyl-CoA carboxylase 2). Listed in Table 1 are GENBANK.RTM.
accession numbers of sequences useful for design of antisense
compounds targeted to ACC1 or ACC2 or both ACC1 and ACC2. Each
GENBANK.RTM. sequence is herein incorporated by reference. Shown in
Table 1 is the SEQ ID NO of such sequences if assigned. Antisense
compounds of the invention include those which reduce one or more
target nucleic acid molecules shown in Table 1, as well as
antisense compounds which reduce other nucleic acid molecules
encoding ACC1 or ACC2. The antisense compounds may target any
region, segment, or site of nucleic acid molecules which encode
ACC1 or ACC2. Suitable target regions are described herein.
TABLE-US-00001 TABLE 1 Gene Target Names and Sequences Date of SEQ
deposit in ID Target Species GENBANK .RTM. # GENBANK .RTM. NO ACC1
Human NM_000664.3 1 ACC1 Human NM_198834.1 2 ACC1 Human NM_198835.1
Dec. 04, 2003 n/a ACC1 Human NM_198836.1 4 ACC1 Human NM_198837.1 5
ACC1 Human NM_198838.1 6 ACC1 Human the complement 7 of nucleotides
715679 to 1041454 of NT_078100.1 ACC1 Mouse XM_109883.5 8 ACC2
Human AJ575592.3 9 ACC2 Human BC028417.1 10 ACC2 Human N88277.1
Apr. 02, 1996 n/a ACC2 Human NM_001093.1 12 ACC2 Human nucleotides
146320 to 13 274076 of NT_009775.14 ACC2 Human R99037.1 Sep. 15,
2005 n/a ACC2 Human the complement of T27637.1 Jan. 04, 1995 n/a
ACC2 Mouse BC022940.1 Feb. 07, 2002 n/a ACC2 Mouse NM_133904.1 17
ACC2 Mouse nucleotides 628385 to 18 716000 of NT_078458.2 ACC2
Mouse Assembled from BF783883 Jan. 05, 2001 n/a ACC2 Mouse AF290179
Dec. 11, 2001 n/a ACC2 Rat AB004329.1 Apr. 24, 1998 n/a ACC2 Rat
CB699897.1 Apr. 10, 2003 n/a ACC2 Rat the complement of Sep. 22,
2003 n/a nucleotides 22000 to 127000 of NW_047377.1 ACC2 Rat
XM_346441.1 Sep. 22, 2003 n/a
[0014] Embodiments of the present invention include antisense
compounds comprising sequences of 12 to 50 nucleotides in length.
It is understood that sequences of 12 to 50 nucleotides in length
encompass sequences of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 nucleotides in
length. Preferred are antisense oligonucleotides 13 to 30
nucleotides in length. Also preferred are antisense
oligonucleotides 12 to 30 nucleotides in length. One of ordinary
skill will readily appreciate that the nucleotide length range 12
to 50 includes all nucleotide lengths within that range as well any
range falling within the bounds of 12 to 50 nucleotides.
[0015] It is well known by those skilled in the art that it is
possible to increase or decrease the length of an antisense
compound and/or introduce mismatch bases without eliminating
activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA
89:7305-7309, 1992, incorporated herein by reference), a series of
ASOs 13-25 nucleobases in length were tested for their ability to
induce cleavage of a target RNA in an oocyte injection model. ASOs
25 nucleobases in length with 8 or 11 mismatch bases near the ends
of the ASOs were able to direct specific cleavage of the target
mRNA, albeit to a lesser extent than the ASOs that contained no
mismatches. Similarly, target specific cleavage was achieved using
a 13 nucleobase ASOs, including those with 1 or 3 mismatches. Maher
and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988, incorporated
herein by reference) tested a series of tandem 14 nucleobase ASOs,
and a 28 and 42 nucleobase ASOs comprised of the sequence of two or
three of the tandem ASOs, respectively, for their ability to arrest
translation of human DHFR in a rabbit reticulocyte assay. Each of
the three 14 nucleobase ASOs alone were able to inhibit
translation, albeit at a more modest level than the 28 or 42
nucleobase ASOs.
Therapeutics
[0016] Compounds of the invention can be used to modulate ACC1 or
ACC2 in an animal, such as a human. In one non-limiting embodiment,
the methods comprise the step of administering to said animal an
effective amount of an antisense compound that decreases expression
of ACC1 or ACC2 or, preferably, both. In one embodiment, the
antisense compounds of the present invention effectively decrease
the levels or function of ACC1 or ACC2 RNA. Because reduction in
ACC1 or ACC2 mRNA levels can lead to reduction in ACC1 or ACC2
protein products of expression as well, such resultant alterations
can also be measured. Antisense compounds of the present invention
that effectively decrease levels or function of an ACC1 or ACC2 RNA
or protein products of expression are considered active antisense
compounds. In one embodiment, the antisense compounds of the
invention target ACC1 and/or ACC2 causing a reduction of target RNA
by at least 10%, by at least 20%, by at least 25%, by at least 30%,
by at least 40%, by at least 50%, by at least 60%, by at least 70%,
by at least 75%, by at least 80%, by at least 85%, by at least 90%,
by at least 95%, by at least 98%, by at least 99%, or by 100%. It
is understood that the compounds of the invention may reduce the
expression level of ACC1 RNA, ACC2 RNA, or both to such a
degree.
[0017] For example, the reduction of ACC1 or ACC2 expression can be
measured in a tissue or organ of the animal. Tissues or organs
include, but are not limited to, skeletal muscle, liver, kidney,
and adipose (white and brown). Samples of tissues or organs can be
routinely obtained by biopsy.
[0018] The cells contained within said fluids, tissues or organs
being analyzed can contain a nucleic acid molecule encoding ACC1 or
ACC2 protein and/or the ACC1- or ACC2-encoded protein itself. For
example, tissues or organs procured from an animal can be evaluated
for levels of the target mRNA or protein. mRNA levels can be
measured or evaluated by real-time PCR, Northern blot, in situ
hybridization or DNA array analysis. Protein levels can be measured
or evaluated by ELISA, immunoblotting, quantitative protein assays,
protein activity assays (for example, caspase activity assays)
immunohistochemistry or immunocytochemistry. Furthermore, the
effects of treatment can be assessed by measuring biomarkers
associated with the target gene expression in the aforementioned
tissues or organs or bodily fluids such as blood, collected from an
animal contacted with one or more compounds of the invention, by
routine clinical methods known in the art. These biomarkers include
but are not limited to: glucose, cholesterol, lipoproteins,
triglycerides, free fatty acids, and other markers of glucose and
lipid metabolism; liver transaminases, bilirubin, albumin, blood
urea nitrogen, creatine, and other markers of kidney and liver
function.
[0019] The compounds of the present invention can be utilized in
pharmaceutical compositions by adding an effective amount of a
compound to a suitable pharmaceutically acceptable diluent or
carrier. In one aspect, the compounds of the present invention
decrease expression of ACC1 or ACC2. In preferred aspect, the
compounds of the invention decrease expression of both ACC1 and
ACC2. The compounds of the invention can also be used in the
manufacture of a medicament for the treatment of diseases and
disorders treatable by reducing ACC1 or ACC2 expression.
[0020] Another embodiment of the present invention is a method of
decreasing expression of ACC1 or ACC2 or both wherein expression of
ACC1 and ACC2 are not decreased in the central nervous system.
Another embodiment of the present invention is a method of
decreasing expression of ACC1 or ACC2 or both wherein expression of
ACC1 and ACC2 are not decreased in the pancreas. Another embodiment
of the present invention is a method of decreasing expression of
ACC1 or ACC2 or both wherein expression of ACC1 and ACC2 are not
decreased in the islet cells of the pancreas. Other embodiments of
the invention include ameliorating or lessening the severity of a
condition in an animal by administering an antisense compound which
decreases expression of ACC1 or ACC2 or both wherein food intake is
not increased. Other embodiments of the invention include
ameliorating or lessening the severity of a condition in an animal
by administering an antisense compound which decreases expression
of ACC1 or ACC2 or both wherein appetite is not increased. In a
preferred embodiment, expression of both ACC1 and ACC2 are
decreased. Contemplated herein is use of an antisense
oligonucleotide of the invention in the preparation of a medicament
for ameliorating or lessening the severity of a condition in an
animal wherein said condition is treatable by reducing expression
of ACC1, ACC2, or both.
[0021] Other embodiments of the present invention are methods of
lowering plasma lipid levels in an animal by administering an
antisense compound which decreases expression of ACC1 or ACC2 or
both. Plasma lipids include, but are not limited to, fatty acids,
triglycerides, cholesterol, LDL, and VLDL. Contemplated herein is
use of an antisense oligonucleotide of the invention in the
preparation of a medicament to lower plasma lipid levels in an
animal.
[0022] Another embodiment of the present invention is a method of
lowering liver triglyceride levels in an animal by administering an
antisense compound which decreases expression of ACC1 or ACC2 or
both ACC1 and ACC2. Contemplated herein is use of an antisense
oligonucleotide of the invention in the preparation of a medicament
to lower liver triglyceride levels in an animal. NAFLD encompasses
a disease spectrum ranging from simple triglyceride accumulation in
hepatocytes (hepatic steatosis) to hepatic steatosis with
inflammation (steatohepatitis), fibrosis, and cirrhosis. NAFLD can
progress to NASH. Therefore, other embodiments of the present
invention include ameliorating hepatic steatosis in an animal by
administering an antisense compound which decreases expression of
ACC1 or ACC2 or, preferably, both. The hepatic steatosis may be
NAFLD, steatohepatitis, or NASH. Contemplated herein is use of an
antisense oligonucleotide of the invention in the preparation of a
medicament to treat hepatic steatosis in an animal. In some
embodiments, the steatosis is NAFLD, steatohepatitis, or NASH.
[0023] Another embodiment of the present invention is a method of
reducing adiposity in an animal in need thereof by administering an
antisense compound which decreases expression of ACC1 or ACC2 or
both. Indicators of reduction of adiposity of an animal include,
but are not limited to, decreases in body fat.
[0024] Another embodiment of the present invention is a method of
ameliorating or lessening the severity of obesity in an animal by
administering an antisense compound which decreases expression of
ACC1 or ACC2 or both. Another embodiment of the present invention
is a method of ameliorating or lessening the severity of
diet-induced obesity in an animal by administering an antisense
compound which decreases expression of ACC1 or ACC2 or both.
Contemplated herein is use of an antisense oligonucleotide of the
invention in the preparation of a medicament to treat obesity in an
animal. In one embodiment, the medicament is used to reduce body
fat in an animal. In another embodiment, the obesity is
diet-induced.
[0025] Other embodiments of the present invention include, but are
not limited to, methods of lowering plasma glucose and methods of
lowering plasma triglyceride levels in an animal by administering
an antisense compound which decreases expression of ACC1 or ACC2 or
both. Provided herein is use of an antisense oligonucleotide of the
invention in the preparation of a medicament to lower blood glucose
or plasma triglycerides in an animal. Other embodiments include,
but are not limited to, methods of improving insulin or leptin
sensitivity in an animal by administering an antisense compound
which decreases ACC1 or ACC2 expression selectively, or ACC1 and
ACC2 expression concurrently. Provided herein is use of an
antisense oligonucleotide of the invention in the preparation of a
medicament to improve insulin or leptin sensitivity in an animal.
In one embodiment, improved insulin sensitivity results in
consequent reduction in insulin levels. In one embodiment improved
insulin sensitivity is measured by a reduction in insulin. Other
embodiments include, but are not limited to, methods of increasing
fatty acid oxidation, methods of decreasing fatty acid synthesis,
and methods of inhibiting hepatic glucose output in an animal by
administering an antisense compound which decreases expression of
ACC1 or ACC2 or both. Provided herein is use of an antisense
oligonucleotide of the invention in the preparation of a medicament
which increases fatty acid oxidation, decreases fatty acid
synthesis or inhibits hepatic glucose output. Another embodiment
includes methods of reducing hepatic malonyl-CoA levels in an
animal by administering an antisense compound which decreases
expression of ACC1 or ACC2 or both. Another embodiment includes
methods of reducing malonyl-CoA levels in lipogenic or oxidative
tissues in an animal by administering an antisense compound which
decreases expression of ACC1 or ACC2 or both. Another embodiment
includes improvement of hepatic insulin sensitivity in an animal by
administering an antisense compound which decreases expression of
ACC1 or ACC2 or both. Provided herein is use of an antisense
oligonucleotide of the invention in the preparation of a medicament
for improving insulin sensitivity in an animal. Another embodiment
is a method of improving plasma ketone levels in an animal by
administering an antisense compound which decreases expression of
ACC1 or ACC2 or both. Plasma ketones include 3-betahydroxybutarate,
acetone, and acetoacetate. Another embodiment is a method of
increasing hepatic fat oxidation in an animal by administering an
antisense compound which decreases expression of ACC1 or ACC2 or
both.
[0026] Other embodiments of the invention include ameliorating or
lessening the severity of a condition in an animal by administering
an antisense compound which decreases expression of ACC1 or ACC2 or
both. Conditions include, but are not limited to, metabolic and
cardiovascular disorders. Metabolic disorders include, but are not
limited to, obesity, diet-induced obesity, diabetes, insulin
resistance, insulin deficiency, dyslipidemia, hypercholesterolemia,
hyperglycemia, hypertriglyceridemia, hyperfattyacidemia, liver
steatosis and metabolic syndrome. Cardiovascular disorders include,
but are not limited to, coronary heart disease. Provided herein is
use of an antisense oligonucleotide of the invention in the
preparation of a medicament for preventing or treating a metabolic
or cardiovascular disorder. Contemplated herein is use of an
antisense oligonucleotide of the invention for amelioration or
treatment of a condition selected from obesity, diabetes, insulin
resistance, insulin deficiency, hypercholesterolemia,
hyperglycemia, hypertriglyceridemia, hyperfattyacidemia, liver
steatosis, metabolic syndrome, or cardiovascular disease.
[0027] Contemplated herein is use of an antisense oligonucleotide
of the invention for amelioration or treatment of a condition
selected from obesity, diabetes, insulin resistance, insulin
deficiency, hypercholesterolemia, hyperglycemia,
hypertriglyceridemia, hyperfattyacidemia, liver steatosis,
metabolic syndrome, or cardiovascular disease wherein said
condition is treatable by reducing ACC1 and ACC2 expression.
Targets
[0028] As used herein, the terms "target nucleic acid" and "nucleic
acid molecule encoding ACC1 or ACC2" have been used for convenience
to encompass RNA (including pre-mRNA and mRNA or portions thereof)
transcribed from DNA encoding ACC1 or ACC2, and also cDNA derived
from such RNA.
[0029] The locations on the target nucleic acid to which active
antisense compounds are complementary are hereinbelow referred to
as "validated target segments." As used herein the term "validated
target segment" is defined as at least a portion of a target region
to which an active antisense compound is targeted. While not
wishing to be bound by theory, it is presently believed that these
target segments represent portions of the target nucleic acid which
are accessible for hybridization.
Regions, Segments, and Sites
[0030] The targeting process usually also includes determination of
at least one target region, segment, or site within the target
nucleic acid for the antisense interaction to occur such that the
desired effect, e.g., reduction of expression of ACC1 or ACC2 or
both, will result. "Region" is defined as a portion of the target
nucleic acid having at least one identifiable structure, function,
or characteristic. Within regions of target nucleic acids are
segments. "Segments" are defined as smaller or sub-portions of
regions within a target nucleic acid. "Sites," as used in the
present invention, are defined as unique nucleobase positions
within a target nucleic acid.
[0031] Once one or more target regions, segments or sites have been
identified, antisense compounds are designed which are sufficiently
complementary to the target, i.e., hybridize with sufficient
affinity and specificity to give the desired effect.
[0032] Target segments can include DNA or RNA sequences that
comprise at least a portion of consecutive nucleobases from the
5'-terminus of a validated target segment (the remaining
nucleobases being a consecutive stretch of the same DNA or RNA
beginning immediately upstream of the 5'-terminus of the target
segment and continuing until the DNA or RNA contains the desired
number of nucleobases). Similarly validated target segments are
represented by DNA or RNA sequences that comprise at least a
portion of consecutive nucleobases from the 3'-terminus of a
validated target segment (the remaining nucleobases being a
consecutive stretch of the same DNA or RNA beginning immediately
downstream of the 3'-terminus of the target segment and continuing
until the DNA or RNA contains the desired number of nucleobases).
It is also understood that a validated oligomeric target segment
can be represented by DNA or RNA sequences that comprise at least a
portion of consecutive nucleobases from an internal portion of the
sequence of a validated target segment, and can extend in either or
both directions until the oligonucleotide contains the desired
number of nucleobases. Alternatively, target segments can include
at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
consecutive nucleobases of a validated target segment, for example,
as counted from the 5' or 3' terminus or from an internal site of a
validated target segment. Therefore, oligonucleotides encompassed
by the invention may comprise at least 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, or 19 consecutive nucleobases of an oligonucleotide
exemplified herein. Preferred are oligonucleotides which comprise
at least a 13 nucleobase portion of an exemplified antisense
oligonucleotide. Also preferred are oligonucleotides which comprise
at least an 8 nucleobase portion of an exemplified antisense
oligonucleotide.
[0033] The validated target segments identified herein can be
employed in a screen for additional compounds that modulate ACC1 or
ACC2. The screening method comprises the steps of contacting a
validated target segment of a nucleic acid molecule encoding ACC1
or ACC2 with one or more candidate modulators, and selecting for
one or more candidate modulators which increase or decrease levels
of a nucleic acid molecule encoding ACC1 or ACC2. Once it is shown
that the candidate modulator or modulators are capable of such
alteration of levels of a nucleic acid molecule encoding ACC1 or
ACC2, the modulator can then be employed in further investigative
studies of the function of ACC1 or ACC2, or for use as a research,
diagnostic, or therapeutic agent.
[0034] The target regions to which the exemplified compounds are
inhibitory are described herein by indicating the 5'-most position
on the target nucleic acid. Coupled with the length of the
exemplified compound, the target region for the exemplified
compound is described. For example, the antisense compound having
SEQ ID NO: 210 targets nucleotides 1932 to 1951 of the ACC2
sequence NM.sub.--133904.1. As shown in the examples herein, the
oligonucleotide reduces ACC2, thus nucleotides 1932 to 1951 is a
validated target segment of NM.sub.--133904.1. Because compounds of
the invention may be, for example, 13 to 30 nucleobases in length,
and may comprise, for example, a 13 nucleobase portion of an
exemplified sequence, it can be appreciated that a compound within
the scope of the invention may target any portion of nucleotides
1915 to 1968 of NM.sub.--133904.1. As a further example, a 30-mer
targeting nucleotides 1915 to 1944 of NM.sub.--133904.1 and
comprising a 13-nucleobase portion of SEQ ID NO: 210 would still
fall within the scope of the invention described herein.
[0035] The start codon and stop codon in mRNA molecules and their
corresponding DNA molecules are readily identifiable to those of
skill in the art. "Start codon region" or "stop codon region" as
used herein refers to the portion of an mRNA or gene that
encompasses from about 25 to about 50 contiguous nucleotides in
either direction (i.e., 5' or 3') from a start or stop codon.
Consequently, the "start codon region" and the "stop codon region"
are all regions which may be targeted effectively with antisense
compounds of the invention.
[0036] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Within the context of the
present invention, one region is the intragenic region encompassing
the translation initiation or termination codon of the open reading
frame (ORF) of a gene.
[0037] Other target regions include the "5' untranslated region"
(5'UTR) and the "3' untranslated region" (3'UTR). The 5' cap region
of an mRNA is considered to include the 5' cap structure itself as
well as the first 50 nucleotides adjacent to the cap site. The 5'
cap region is also a target.
[0038] Suitable target regions thus include, but are not limited
to, the 5'UTR, the start codon, the stop codon, the coding region,
the 3'UTR, the 5' cap region, introns, exons, intron-exon
junctions, exon-intron junctions, and exon-exon junctions. Suitable
target regions encompass from about 25 to about 50 nucleotides in
either direction (i.e. 5' or 3') of a junction site.
Variants
[0039] It is also known in the art that alternative RNA transcripts
can be produced from the same genomic region of DNA. These
alternative transcripts are generally known as "variants." More
specifically, "pre-mRNA variants" are transcripts produced from the
same genomic DNA that differ from other transcripts produced from
the same genomic DNA in either their start or stop position and
contain both intronic and exonic sequence.
[0040] Upon excision of one or more exon or intron regions, or
portions thereof during splicing, pre-mRNA variants produce smaller
"mRNA variants." Consequently, mRNA variants are processed pre-mRNA
variants and each unique pre-mRNA variant must always produce a
unique mRNA variant as a result of splicing. These mRNA variants
are also known as "alternative splice variants." If no splicing of
the pre-mRNA variant occurs then the pre-mRNA variant is identical
to the mRNA variant.
[0041] It is also known in the art that variants can be produced
through the use of alternative signals to start or stop
transcription and that pre-mRNAs and mRNAs can possess more that
one start codon or stop codon. Variants that originate from a
pre-mRNA or mRNA that use alternative start codons are known as
"alternative start variants" of that pre-mRNA or mRNA. Those
transcripts that use an alternative stop codon are known as
"alternative stop variants" of that pre-mRNA or mRNA. One specific
type of alternative stop variant is the "polyA variant" in which
the multiple transcripts produced result from the alternative
selection of one of the "polyA stop signals" by the transcription
machinery, thereby producing transcripts that terminate at unique
polyA sites. Consequently, the types of variants described herein
are also suitable target nucleic acids.
Modulation of Target Expression
[0042] "Modulation" means a perturbation of function, for example,
either an increase (stimulation or induction) or a decrease
(inhibition or reduction) in expression or in level of target RNA.
As another example, modulation of expression can include perturbing
splice site selection of pre-mRNA processing.
[0043] "Expression" includes all the functions by which a gene's
coded information is converted into structures present and
operating in a cell. These structures include the products of
transcription and translation. "Modulation of expression" means the
perturbation of such functions. "Modulators" are those compounds
that modulate the expression of ACC1 or ACC2 and which comprise at
least a portion which is complementary to a validated target
segment.
[0044] Modulation of expression of a target nucleic acid can be
achieved through alteration of any number of nucleic acid
functions. The functions of RNA to be modulated can include
translocation functions, which include, but are not limited to,
translocation of the RNA to a site of protein translation,
translocation of the RNA to sites within the cell which are distant
from the site of RNA synthesis, and translation of protein from the
RNA. RNA processing functions that can be modulated include, but
are not limited to, splicing of the RNA to yield one or more RNA
species, capping of the RNA, 3' maturation of the RNA and catalytic
activity or complex formation involving the RNA which may be
engaged in or facilitated by the RNA. Modulation of expression can
result in the increased level of one or more nucleic acid species
or the decreased level of one or more nucleic acid species, either
temporally or by net steady state level. One result of such
interference with target nucleic acid function is modulation of the
expression of ACC1 or ACC2 or both ACC1 and ACC2. Thus, in one
embodiment modulation of expression can mean increase or decrease
in target RNA or protein levels. In another embodiment modulation
of expression can mean an increase or decrease of one or more RNA
splice products, or a change in the ratio of two or more splice
products.
Hybridization and Complementarity
[0045] "Hybridization" means the pairing of complementary strands
of antisense compounds. While not limited to a particular
mechanism, the most common mechanism of pairing involves hydrogen
bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen
hydrogen bonding, between complementary nucleoside or nucleotide
bases (nucleobases) of the strands of antisense compounds. For
example, adenine and thymine are complementary nucleobases which
pair through the formation of hydrogen bonds. Hybridization can
occur under varying circumstances. An antisense compound is
"specifically hybridizable" when there is a sufficient degree of
complementarity to avoid non-specific binding of the antisense
compound to non-target nucleic acid sequences under conditions in
which specific binding is desired, i.e., under physiological
conditions in the case of in vivo assays or therapeutic treatment,
and under conditions in which assays are performed in the case of
in vitro assays.
[0046] "Complementarity," as used herein, refers to the capacity
for precise pairing between two nucleobases on one or two antisense
compound strands. For example, if a nucleobase at a certain
position of an antisense compound is capable of hydrogen bonding
with a nucleobase at a certain position of a target nucleic acid,
then the position of hydrogen bonding between the oligonucleotide
and the target nucleic acid is considered to be a complementary
position. The antisense compound and the further DNA or RNA are
complementary to each other when a sufficient number of
complementary positions in each molecule are occupied by
nucleobases which can hydrogen bond with each other. Thus,
"specifically hybridizable" and "complementary" are terms which are
used to indicate a sufficient degree of precise pairing or
complementarity over a sufficient number of nucleobases such that
stable and specific binding occurs between the antisense compound
and a target nucleic acid to allow the compound to function.
[0047] It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable or to be
encompassed by the present invention. One of ordinary skill in the
art will appreciate that complementarity less than 100% to a target
nucleic acid or to a validated target segment within such a nucleic
acid renders the compound with mismatches, thus, compounds having
mismatches fall within the scope of the invention. Preferred
oligonucleotides have fewer than about 3 mismatches.
[0048] Moreover, an oligonucleotide may hybridize over one or more
segments such that intervening or adjacent segments are not
involved in the hybridization event (e.g., a loop structure,
mismatch or hairpin structure). The antisense compounds of the
present invention comprise at least 70%, or at least 75%, or at
least 80%, or at least 85%, or at least 90%, or at least 92%, or at
least 95%, or at least 97%, or at least 98%, or at least 99%
sequence complementarity to a target region within the target
nucleic acid sequence to which they are targeted. For example, an
antisense compound in which 18 of 20 nucleobases of the antisense
compound are complementary to a target region, and would therefore
specifically hybridize, would represent 90 percent complementarity.
In this example, the remaining noncomplementary nucleobases may be
clustered or interspersed with complementary nucleobases and need
not be contiguous to each other or to complementary nucleobases. As
such, an antisense compound which is 18 nucleobases in length
having 4 (four) noncomplementary nucleobases which are flanked by
two regions of complete complementarity with the target nucleic
acid would have 77.8% overall complementarity with the target
nucleic acid and would thus fall within the scope of the present
invention. Percent complementarity of an antisense compound with a
region of a target nucleic acid can be determined routinely using
BLAST programs (basic local alignment search tools) and PowerBLAST
programs known in the art (Altschul et al., J. Mol. Biol., 1990,
215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
Percent homology, sequence identity or complementarity, can be
determined by, for example, the Gap program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, Madison Wis.), using default settings,
which uses the algorithm of Smith and Waterman (Adv. Appl. Math.,
1981, 2, 482-489).
[0049] An antisense compound with complementarity to both ACC1 and
ACC2 is considered to fall within the scope of the present
invention. For example, an oligonucleotide which is 100%
complementarity to ACC1 but has 85% complementarity or 3 mismatches
to ACC2 (thus having 17 of 20 nucleotides which are complementary
to the target site) is contemplated herein. Likewise, an
oligonucleotide having 85% complementarity to both ACC1 and ACC2 is
contemplated. Also contemplated are oligonucleotides having 100%
complementarity to both ACC1 and ACC2. Preferred embodiments of the
present invention include oligonucleotides having sufficient
complementarity to ACC1 and ACC2 to cause a reduction in expression
in both ACC1 and ACC2.
[0050] One of ordinary skill in the art will appreciate that a
routine alignment of ACC1 and ACC2 sequences (such as an alignment
performed by BLAST or other readily available programs) will show
regions suitable for design of oligonucleotides targeting ACC1 and
ACC2 independently or simultaneously.
Antisense Mechanisms and Compounds
[0051] "Antisense mechanisms" are all those involving hybridization
of a compound with target nucleic acid, wherein the outcome or
effect of the hybridization is either target degradation or target
occupancy with concomitant stalling of the cellular machinery
involving, for example, transcription or splicing. Such mechanisms
are appreciated in the art and include, for example, RNase-H and
RNAi-based mechanisms.
[0052] The term "antisense compound" refers to a polymeric
structure capable of hybridizing to a region of a nucleic acid
molecule. This term includes oligonucleotides, oligonucleosides,
oligonucleotide analogs, oligonucleotide mimetics and chimeric
combinations of these. Antisense compounds are routinely prepared
linearly but can be joined or otherwise prepared to be circular.
Moreover, branched structures are known in the art. An "antisense
compound" or "oligomeric antisense compound" refers to an antisense
compound that is at least partially complementary to the region of
a nucleic acid molecule to which it hybridizes and which modulates
(increases or decreases) its expression. Consequently, while all
antisense compounds can be said to be oligomeric compounds, not all
oligomeric compounds are antisense compounds. An "antisense
oligonucleotide" is an antisense compound that is a nucleic
acid-based oligomer. An antisense oligonucleotide can be chemically
modified. Nonlimiting examples of antisense compounds include
primers, probes, antisense compounds, antisense oligonucleotides,
external guide sequence (EGS) oligonucleotides, alternate splicers,
and siRNAs. As such, these compounds can be introduced in the form
of single-stranded, double-stranded, circular, branched or hairpins
and can contain structural elements such as internal or terminal
bulges or loops. Double-stranded compounds can be comprised of two
strands hybridized to form double-stranded compounds or a single
strand with sufficient self complementarity to allow for
hybridization and formation of a fully or partially double-stranded
compound. In a preferred embodiment, the compounds of the instant
invention are non-autocatalytic.
[0053] "Chimeric" antisense compounds or "chimeras," in the context
of this invention, are single- or double-stranded antisense
compounds, such as oligonucleotides, which contain two or more
chemically distinct regions, each comprising at least one monomer
unit, i.e., a nucleotide in the case of an oligonucleotide
compound.
[0054] A "gapmer" is defined as an antisense compound, generally an
oligonucleotide, having a 2'-deoxyoligonucleotide region flanked by
non-deoxyoligonucleotide segments. The central region is referred
to as the "gap." The flanking segments are referred to as "wings."
If one of the wings has zero non-deoxyoligonucleotide monomers, a
"hemimer" is described.
[0055] In one embodiment of the invention, double-stranded
antisense compounds encompass short interfering RNAs (siRNAs). As
used herein, the term "siRNA" is defined as a double-stranded
compound having a first and second strand, each strand having a
central portion and two independent terminal portions. The central
portion of the first strand is complementary to the central portion
of the second strand, allowing hybridization of the strands. The
terminal portions are independently, optionally complementary to
the corresponding terminal portion of the complementary strand. The
ends of the strands may be modified by the addition of one or more
natural or modified nucleobases to form an overhang. In one
nonlimiting example, the first strand of the siRNA is antisense to
the target nucleic acid, while the second strand is complementary
to the first strand. Once the antisense strand is designed to
target a particular nucleic acid target, the sense strand of the
siRNA can then be designed and synthesized as the complement of the
antisense strand and either strand may contain modifications or
additions to either terminus. For example, in one embodiment, both
strands of the siRNA duplex would be complementary over the central
nucleobases, each having overhangs at one or both termini. It is
possible for one end of a duplex to be blunt and the other to have
overhanging nucleobases. In one embodiment, the number of
overhanging nucleobases is from 1 to 6 on the 3' end of each strand
of the duplex. In another embodiment, the number of overhanging
nucleobases is from 1 to 6 on the 3' end of only one strand of the
duplex. In a further embodiment, the number of overhanging
nucleobases is from 1 to 6 on one or both 5' ends of the duplexed
strands. In another embodiment, the number of overhanging
nucleobases is zero. In a preferred embodiment, each of the strands
is 19 nucleobases in length, fully hybridizable with the
complementary strand, and includes no overhangs.
[0056] Each strand of the siRNA duplex may be from about 12 to
about 35 nucleobases. In a preferred embodiment, each strand of the
siRNA duplex is about 17 to about 25 nucleobases. The central
complementary portion may be from about 12 to about 35 nucleobases
in length. In a preferred embodiment, the central complimentary
portion is about 17 to about 25 nucleobases in length. It is
understood that each the strand of the siRNA duplex and the central
complementary portion may be about 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35
nucleobases in length. The terminal portions can be from 1 to 6
nucleobases. It is understood that the terminal portions can be
about 1, 2, 3, 4, 5, or 6 nucleobases in length. The siRNAs may
also have no terminal portions. The two strands of an siRNA can be
linked internally leaving free 3' or 5' termini, or can be linked
to form a continuous hairpin structure or loop. The hairpin
structure may contain an overhang on either the 5' or 3' terminus
producing an extension of single-stranded character.
[0057] Double-stranded compounds can be made to include chemical
modifications as discussed herein.
Chemical Modifications
[0058] Embodiments of the present invention include compounds
comprising at least two modifications selected from a modified
internucleoside linkage, a modified nucleobase, or a modified
sugar. In one embodiment, the antisense compounds of the present
invention are chimeric oligonucleotides. In one embodiment, the
antisense compounds of the present invention are chimeric
oligonucleotides comprising a deoxy nucleotide region flanked on
each of the 5' and 3' ends with at least one 2'-O-(2-methoxyethyl)
nucleotide. In another embodiment, the antisense compounds of the
present invention are chimeric oligonucleotides comprising ten
deoxynucleotides and flanked on both the 5' and 3' ends with five
2'-O-(2-methoxyethyl) nucleotides. In a further embodiment, the
antisense compounds of the present invention may have at least one
5-methylcytosine.
[0059] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base (sometimes referred to as a "nucleobase" or
simply a "base"). The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to the 2', 3' or 5' hydroxyl moiety of the
sugar. In forming oligonucleotides, the phosphate groups covalently
link adjacent nucleosides to one another to form a linear polymeric
compound. In turn, the respective ends of this linear polymeric
compound can be further joined to form a circular compound. Within
oligonucleotides, the phosphate groups are commonly referred to as
forming the internucleoside backbone of the oligonucleotide. The
normal linkage or backbone of RNA and DNA is a 3' to 5'
phosphodiester linkage. It is often preferable to include chemical
modifications in oligonucleotides to alter their activity. Chemical
modifications can alter oligonucleotide activity by, for example:
increasing affinity of an antisense oligonucleotide for its target
RNA, increasing nuclease resistance, and/or altering the
pharmacokinetics of the oligonucleotide. The use of chemistries
that increase the affinity of an oligonucleotide for its target can
allow for the use of shorter oligonucleotide compounds.
[0060] The term "nucleobase" or "heterocyclic base moiety" as used
herein, refers to the heterocyclic base portion of a nucleoside. In
general, a nucleobase is any group that contains one or more atom
or groups of atoms capable of hydrogen bonding to a base of another
nucleic acid. In addition to "unmodified" or "natural" nucleobases
such as the purine nucleobases adenine (A) and guanine (G), and the
pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U),
many modified nucleobases or nucleobase mimetics known to the art
skilled are amenable to the present invention. The terms modified
nucleobase and nucleobase mimetic can overlap but generally a
modified nucleobase refers to a nucleobase that is fairly similar
in structure to the parent nucleobase such as for example a 7-deaza
purine or a 5-methylcytosine whereas a nucleobase mimetic would
include more complicated structures such as for example a tricyclic
phenoxazine nucleobase mimetic. Methods for preparation of the
above noted modified nucleobases are well known to those skilled in
the art.
[0061] Antisense compounds of the present invention may also
contain one or more nucleosides having modified sugar moieties. The
furanosyl sugar ring of a nucleoside can be modified in a number of
ways including, but not limited to, addition of a substituent
group, bridging of two non-geminal ring atoms to form a bicyclic
nucleic acid (BNA) and substitution of an atom or group such as
--S--, --N(R)-- or --C(R1)(R2) for the ring oxygen at the
4'-position. Modified sugar moieties are well known and can be used
to alter, typically increase, the affinity of the antisense
compound for its target and/or increase nuclease resistance. A
representative list of preferred modified sugars includes but is
not limited to bicyclic modified sugars (BNA's), including LNA and
ENA (4'-(CH2)2-O-2' bridge); and substituted sugars, especially
2'-substituted sugars having a 2'-F, 2'-OCH2 or a 2'-O(CH2)2--OCH3
substituent group. Sugars can also be replaced with sugar mimetic
groups among others. Methods for the preparations of modified
sugars are well known to those skilled in the art.
[0062] The present invention includes internucleoside linking
groups that link the nucleosides or otherwise modified monomer
units together thereby forming an antisense compound. The two main
classes of internucleoside linking groups are defined by the
presence or absence of a phosphorus atom. Representative phosphorus
containing internucleoside linkages include, but are not limited
to, phosphodiesters, phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates. Representative
non-phosphorus containing internucleoside linking groups include,
but are not limited to, methylenemethylimino
(--CH2-N(CH3)-O--CH2-), thiodiester (--O--C(O)--S--),
thionocarbamate (--O--C(O)(NH)--S--); siloxane (--O--Si(H)2-O--);
and N,N'-dimethylhydrazine (--CH2-N(CH3)-N(CH3)-). Antisense
compounds having non-phosphorus internucleoside linking groups are
referred to as oligonucleosides. Modified internucleoside linkages,
compared to natural phosphodiester linkages, can be used to alter,
typically increase, nuclease resistance of the antisense compound.
Internucleoside linkages having a chiral atom can be prepared
racemic, chiral, or as a mixture. Representative chiral
internucleoside linkages include, but are not limited to,
alkylphosphonates and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing linkages are
well known to those skilled in the art.
[0063] As used herein the term "mimetic" refers to groups that are
substituted for a sugar, a nucleobase, and/or internucleoside
linkage. Mimetics are groups that are structurally quite different
(not simply a modification) but functionally similar to the linked
nucleosides of oligonucleotides. Generally, a mimetic is used in
place of the sugar or sugar-internucleoside linkage combination,
and the nucleobase is maintained for hybridization to a selected
target. Representative examples of a sugar mimetic include, but are
not limited to, cyclohexenyl or morpholino. Representative examples
of a mimetic for a sugar-internucleoside linkage combination
include, but are not limited to, peptide nucleic acids (PNA) and
morpholino groups linked by uncharged achiral linkages. In some
instances a mimetic is used in place of the nucleobase.
Representative nucleobase mimetics are well known in the art and
include, but are not limited to, tricyclic phenoxazine analogs and
universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14,
incorporated herein by reference). Methods of synthesis of sugar,
nucleoside and nucleobase mimetics are well known to those skilled
in the art.
[0064] As used herein the term "nucleoside" includes, nucleosides,
abasic nucleosides, modified nucleosides, and nucleosides having
mimetic bases and/or sugar groups.
[0065] In the context of this invention, the term "oligonucleotide"
refers to an antisense compound which is an oligomer or polymer of
ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term
includes oligonucleotides composed of naturally- and
non-naturally-occurring nucleobases, sugars and covalent
internucleoside linkages, possibly further including non-nucleic
acid conjugates.
[0066] The present invention provides compounds having reactive
phosphorus groups useful for forming internucleoside linkages
including for example phosphodiester and phosphorothioate
internucleoside linkages. Methods of preparation and/or
purification of precursors or olgomeric compounds of the instant
invention are not a limitation of the compositions or methods of
the invention. Methods for synthesis and purification of DNA, RNA,
and the antisense compounds of the instant invention are well known
to those skilled in the art.
[0067] As used herein the term "chimeric antisense compound" refers
to an antisense compound having at least one sugar, nucleobase
and/or internucleoside linkage that is differentially modified as
compared to the other sugars, nucleobases and internucleoside
linkages within the same antisense compound. The remainder of the
sugars, nucleobases and internucleoside linkages can be
independently modified or unmodified provided that they are
distinguishable from the differentially modified moiety or
moieties. In general a chimeric antisense compound will have
modified nucleosides that can be in isolated positions or grouped
together in regions that will define a particular motif. Any
combination of modifications and or mimetic groups can comprise a
chimeric antisense compound of the present invention.
[0068] Chimeric antisense compounds typically contain at least one
region modified so as to confer increased resistance to nuclease
degradation, increased cellular uptake, and/or increased binding
affinity for the target nucleic acid. An additional region of the
antisense compound may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease that cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
inhibition of gene expression. Consequently, comparable results can
often be obtained with shorter antisense compounds when chimeras
are used, compared to for example phosphorothioate
deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0069] Certain chimeric as well as non-chimeric antisense compounds
can be further described as having a particular motif. As used in
the present invention the term "motif" refers to the orientation of
modified sugar moieties and/or sugar mimetic groups in an antisense
compound relative to like or differentially modified or unmodified
nucleosides. As used in the present invention, the terms "sugars",
"sugar moieties" and "sugar mimetic groups` are used
interchangeably. Such motifs include, but are not limited to,
gapped motifs, alternating motifs, fully modified motifs, hemimer
motifs, blockmer motifs, and positionally modified motifs. The
sequence and the structure of the nucleobases and type of
internucleoside linkage is not a factor in determining the motif of
an antisense compound.
[0070] In one aspect of the present invention antisense compounds
are modified by covalent attachment of one or more conjugate
groups. Conjugate groups may be attached by reversible or
irreversible attachments. Conjugate groups may be attached directly
to antisense compounds or by use of a linker. Linkers may be mono-
or bifunctional linkers. Such attachment methods and linkers are
well known to those skilled in the art. In general, conjugate
groups are attached to antisense compounds to modify one or more
properties. Such considerations are well known to those skilled in
the art.
NAFLD and Metabolic Syndrome
[0071] The term "nonalcoholic fatty liver disease" (NAFLD)
encompasses a disease spectrum ranging from simple triglyceride
accumulation in hepatocytes (hepatic steatosis) to hepatic
steatosis with inflammation (steatohepatitis), fibrosis, and
cirrhosis. Nonalcoholic steatohepatitis (NASH) occurs from
progression of NAFLD beyond deposition of triglycerides. A
second-hit capable of inducing necrosis, inflammation, and fibrosis
is required for development of NASH. Candidates for the second-hit
can be grouped into broad categories: factors causing an increase
in oxidative stress and factors promoting expression of
proinflammatory cytokines. It has been suggested that increased
liver triglycerides lead to increased oxidative stress in
hepatocytes of animals and humans, indicating a potential
cause-and-effect relationship between hepatic triglyceride
accumulation, oxidative stress, and the progression of hepatic
steatosis to NASH (Browning and Horton, J. Clin. Invest., 2004,
114, 147-152). Hypertriglyceridemia and hyperfattyacidemia can
cause triglyceride accumulation in peripheral tissues (Shimamura et
al., Biochem. Biophys. Res. Commun., 2004, 322, 1080-1085).
[0072] "Metabolic syndrome" is defined as a clustering of lipid and
non-lipid cardiovascular risk factors of metabolic origin. It is
closely linked to the generalized metabolic disorder known as
insulin resistance. The National Cholesterol Education Program
(NCEP) Adult Treatment Panel III (ATPIII) established citeria for
diagnosis of metabolic syndrome when three or more of five risk
determinants are present. The five risk determinants are abdominal
obesity defined as waist circumference of greater than 102 cm for
men or greater than 88 cm for women, triglyceride levels greater
than or equal to 150 mg/dL, HDL cholesterol levels of less than 40
mg/dL for men and less than 50 mg/dL for women, blood pressure
greater than or equal to 130/85 mm Hg and fasting glucose levels
greater than or equal to 110 mg/dL. These determinants can be
readily measured in clinical practice (JAMA, 2001, 285,
2486-2497).
Combinations
[0073] Compositions of the invention can contain two or more
antisense compounds. In another related embodiment, compositions of
the present invention can contain one or more antisense compounds,
particularly oligonucleotides, targeted to a first nucleic acid and
one or more additional antisense compounds targeted to a second
nucleic acid target. Alternatively, compositions of the present
invention can contain two or more antisense compounds targeted to
different regions of the same nucleic acid target. Two or more
combined compounds may be used together or sequentially.
Combination Therapy
[0074] Compounds of the invention may be used in combination
therapies wherein an additive effect is achieved by administering
one or more compounds of the invention and one or more other
suitable therapeutic/prophylactic compounds to treat a condition.
One or more of the therapeutic/prophylactic compounds may be
combined with one or more of the antisense inhibitors of ACC1 or
ACC2 to achieve an additive therapeutic effect.
Oligomer Synthesis
[0075] Oligomerization of modified and unmodified nucleosides can
be routinely performed according to literature procedures for DNA
(Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993),
Humana Press) and/or RNA (Scaringe, Methods (2001), 23, 206-217.
Gait et al., Applications of Chemically synthesized RNA in RNA:
Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al.,
Tetrahedron (2001), 57, 5707-5713).
[0076] Antisense compounds of the present invention can be
conveniently and routinely made through the well-known technique of
solid phase synthesis. Equipment for such synthesis is sold by
several vendors including, for example, Applied Biosystems (Foster
City, Calif.). Any other means for such synthesis known in the art
may additionally or alternatively be employed. It is well known to
use similar techniques to prepare oligonucleotides such as the
phosphorothioates and alkylated derivatives. The invention is not
limited by the method of oligomer synthesis.
Oligomer Purification and Analysis
[0077] Methods of oligonucleotide purification and analysis are
known to those skilled in the art. Analysis methods include
capillary electrophoresis (CE) and electrospray-mass spectroscopy.
Such synthesis and analysis methods can be performed in multi-well
plates. The method of the invention is not limited by the method of
oligomer purification.
Nonlimiting Disclosure and Incorporation by Reference
[0078] While certain compounds, compositions and methods of the
present invention have been described with specificity in
accordance with certain embodiments, the examples herein serve only
to illustrate the compounds of the invention and are not intended
to limit the same. Each of the references, GENBANK.RTM. accession
numbers, and the like recited in the present application is
incorporated herein by reference in its entirety.
Example 1
Assaying Modulation
[0079] Modulation of ACC1 or ACC2 expression can be assayed in a
variety of ways known in the art. ACC1 or ACC2 mRNA levels can be
quantitated by, e.g., Northern blot analysis, competitive
polymerase chain reaction (PCR), or real-time PCR. RNA analysis can
be performed on total cellular RNA or poly(A)+ mRNA by methods
known in the art. Methods of RNA isolation are taught in, for
example, Ausubel, F. M. et al., Current Protocols in Molecular
Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley
& Sons, Inc., 1993.
[0080] Northern blot analysis is routine in the art and is taught
in, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley &
Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently
accomplished using the commercially available ABI PRISM.TM. 7700
Sequence Detection System, available from PE-Applied Biosystems,
Foster City, Calif. and used according to manufacturer's
instructions.
[0081] Levels of proteins encoded by ACC1 or ACC2 can be
quantitated in a variety of ways well known in the art, such as
immunoprecipitation, Western blot analysis (immunoblotting), ELISA
or fluorescence-activated cell sorting (FACS). Antibodies directed
to a protein encoded by ACC1 or ACC2 can be identified and obtained
from a variety of sources, such as the MSRS catalog of antibodies
(Aerie Corporation, Birmingham, Mich.), or can be prepared via
conventional antibody generation methods. Methods for preparation
of polyclonal antisera are taught in, for example, Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Volume 2, pp.
11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of
monoclonal antibodies is taught in, for example, Ausubel, F. M. et
al., Current Protocols in Molecular Biology, Volume 2, pp.
11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
[0082] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
[0083] The effect of antisense compounds of the present invention
on target nucleic acid expression can be tested in any of a variety
of cell types provided that the target nucleic acid is present at
measurable levels. The effect of antisense compounds of the present
invention on target nucleic acid expression can be routinely
determined using, for example, PCR or Northern blot analysis. Cell
lines are derived from both normal tissues and cell types and from
cells associated with various disorders (e.g. hyperproliferative
disorders). Cell lines derived from muliple tissues and species can
be obtained, for example, from American Type Culture Collection
(ATCC, Manassas, Va.) or from the Japanese Cancer Research
Resources Bank (Tokyo, Japan) or the Centre for Applied
Microbiology and Research (Wiltshire, United Kingdom),
respectively.
[0084] Primary cells, or those cells which are isolated from an
animal and not subjected to continuous culture, can be prepared
according to methods known in the art or obtained from various
commercial suppliers. Additionally, primary cells include those
obtained from donor human subjects in a clinical setting (i.e.
blood donors, surgical patients). Primary cells may be prepared by
methods known in the art or can be obtained from commercial
suppliers such as Stem Cell Technologies; Zen-Bio, Inc. (Research
Triangle Park, N.C.); Cambrex Biosciences (Walkersville, Md.); In
Vitro Technologies (Baltimore, Md.); Cascade Biologics (Portland,
Oreg.); Advanced Biotechnologies (Columbia, Md.).
Cell Types
[0085] The effect of antisense compounds on target nucleic acid
expression was tested in the following cell types.
b. END:
[0086] The mouse brain endothelial cell line b.END was obtained
from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim,
Germany). b.END cells were routinely cultured in DMEM, high glucose
(Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with
10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad,
Calif.). Cells were routinely passaged by trypsinization and
dilution when they reached approximately 90% confluence. Cells were
seeded into 96-well plates (Falcon-Primaria #353872, BD
Biosciences, Bedford, Mass.) at a density of approximately 3000
cells/well for use in antisense compound transfection
experiments.
A549:
[0087] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (Manassas, Va.). A549 cells
were routinely cultured in DMEM, high glucose (Invitrogen Life
Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine
serum, 100 units per ml penicillin, and 100 micrograms per ml
streptomycin (Invitrogen Life Technologies, Carlsbad, Calif.).
Cells were routinely passaged by trypsinization and dilution when
they reached approximately 90% confluence. Cells were seeded into
96-well plates (Falcon-Primaria #3872) at a density of
approximately 5000 cells/well for use in antisense compound
transfection experiments.
Primary Mouse Hepatocytes:
[0088] Primary mouse hepatocytes were prepared via routine
procedures from CD-1 mice purchased from Charles River Labs.
Primary mouse hepatocytes were routinely cultured in Hepatocyte
Attachment Media supplemented with 10% fetal bovine serum, 1%
penicillin/streptomycin, 1% antibiotic-antimitotic (Invitrogen Life
Technologies, Carlsbad, Calif.) and 10 nM bovine insulin
(Sigma-Aldrich, St. Louis, Mo.). Cells were seeded into 96-well
plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.)
coated with 0.1 mg/ml collagen at a density of approximately 10,000
cells/well for use in antisense compound transfection
experiments.
Treatment with Antisense Compounds
[0089] When cells reach appropriate confluency, they were treated
with oligonucleotide using a transfection method as described.
Other suitable transfection reagents known in the art include, but
are not limited to, LIPOFECTAMINET.TM., OLIGOFECTAMINE.TM., and
FUGENE.TM.. Other suitable transfection methods known in the art
include, but are not limited to, electroporation.
LIPOFECTIN.TM.
[0090] When cells reached 65-75% confluency, they were treated with
oligonucleotide. Oligonucleotide was mixed with LIPOFECTINT.TM.
Invitrogen Life Technologies, Carlsbad, Calif.) in Opti-MEM.TM.-1
reduced serum medium (Invitrogen Life Technologies, Carlsbad,
Calif.) to achieve the desired concentration of oligonucleotide and
a LIPOFECTIN.TM. concentration of 2.5 or 3 .mu.g/mL per 100 nM
oligonucleotide. This transfection mixture was incubated at room
temperature for approximately 0.5 hours. For cells grown in 96-well
plates, wells were washed once with 100 .mu.L OPTI-MEM.TM.-1 and
then treated with 130 .mu.L of the transfection mixture. Cells
grown in 24-well plates or other standard tissue culture plates are
treated similarly, using appropriate volumes of medium and
oligonucleotide. Cells are treated and data are obtained in
duplicate or triplicate. After approximately 4-7 hours of treatment
at 37.degree. C., the medium containing the transfection mixture
was replaced with fresh culture medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
CYTOFECTIN.TM.
[0091] When cells reached 65-75% confluency, they were treated with
oligonucleotide. Oligonucleotide was mixed with CYTOFECTIN.TM.
(Gene Therapy Systems, San Diego, Calif.) in OPTI-MEM.TM.-1 reduced
serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to
achieve the desired concentration of oligonucleotide and a
CYTOFECTIN.TM. concentration of 2 or 4 .mu.g/mL per 100 nM
oligonucleotide. This transfection mixture was incubated at room
temperature for approximately 0.5 hours. For cells grown in 96-well
plates, wells were washed once with 100 .mu.L OPTI-MEM.TM.-1 and
then treated with 130 .mu.L of the transfection mixture. Cells
grown in 24-well plates or other standard tissue culture plates are
treated similarly, using appropriate volumes of medium and
oligonucleotide. Cells are treated and data are obtained in
duplicate or triplicate. After approximately 4-7 hours of treatment
at 37.degree. C., the medium containing the transfection mixture
was replaced with fresh culture medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
Control Oligonucleotides
[0092] Control oligonucleotides are used to determine the optimal
antisense compound concentration for a particular cell line.
Furthermore, when antisense compounds of the invention are tested
in antisense compound screening experiments or phenotypic assays,
control oligonucleotides are tested in parallel with compounds of
the invention.
[0093] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. The concentration of positive control
oligonucleotide that results in 80% inhibition of the target mRNA
is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
the target mRNA is then utilized as the oligonucleotide screening
concentration in subsequent experiments for that cell line. If 60%
inhibition is not achieved, that particular cell line is deemed as
unsuitable for oligonucleotide transfection experiments. The
control antisense oligonucleotide ISIS18078 (GTGCGCGCGAGCCCGAAATC,
incorporated herein as SEQ ID NO: 19) is a chimeric
oligonucleotide, composed of a central "gap" region consisting of
2'-deoxynucleotides, which is flanked on both sides (5' and 3') by
"wings". The wings are composed of 2'-O-(2-methoxyethyl)
nucleotides, also known as 2'-MOE nucleotides. ISIS 18078 has a
9-nucleotide gap region flanked by 5-nucleotide wing on the 5' side
and a 6-nucleotide wing on the 3' side. It is targeted to human Jun
N-terminal Kinase-2 and may be used as a positive or negative
control in assaying for modulation of expression.
Example 2
Real-Time Quantitative PCR Analysis of ACC1 or ACC2 mRNA Levels
[0094] Quantitation of ACC1 or ACC2 mRNA levels was accomplished by
real-time quantitative PCR using the ABI PRISM.TM. 7600, 7700, or
7900 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions.
[0095] Probes and primers for use in real-time PCR were designed to
hybridize to target-specific sequences. Methods of primer and probe
design are known in the art. Design of primers and probes for use
in real-time PCR can be carried out using commercially available
software, for example Primer Express.RTM., PE Applied Biosystems,
Foster City, Calif.
[0096] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured were evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction.
After isolation the RNA is subjected to sequential reverse
transcriptase (RT) reaction and real-time PCR, both of which are
performed in the same well. RT and PCR reagents were obtained from
Invitrogen Life Technologies (Carlsbad, Calif.). RT, real-time PCR
was carried out in the same by adding 20 .mu.L PCR cocktail
(2.5.times.PCR buffer minus MgCl.sub.2, 6.6 mM MgCl.sub.2, 375
.mu.M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward
primer and reverse primer, 125 nM of probe, 4 Units RNAse
inhibitor, 1.25 Units PLATINUM.RTM. Taq, 5 Units MuLV reverse
transcriptase, and 2.5.times.ROX dye) to 96-well plates containing
30 .mu.L total RNA solution (20-200 ng). The RT reaction was
carried out by incubation for 30 minutes at 48.degree. C. Following
a 10 minute incubation at 95.degree. C. to activate the
PLATINUM.RTM. Taq, 40 cycles of a two-step PCR protocol were
carried out: 95.degree. C. for 15 seconds (denaturation) followed
by 60.degree. C. for 1.5 minutes (annealing/extension).
[0097] Gene target quantities obtained by RT, real-time PCR were
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression was quantified by RT, real-time PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA was quantified using RiboGreen.TM. RNA quantification reagent
(Molecular Probes, Inc. Eugene, Oreg.).
[0098] 170 .mu.L of RiboGreen.TM. working reagent (RiboGreen.TM.
reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was
pipetted into a 96-well plate containing 30 .mu.L purified cellular
RNA. The plate was read in a CytoFluor 4000 (PE Applied Biosystems)
with excitation at 485 nm and emission at 530 nm.
[0099] GAPDH PCR probes have JOE covalently linked to the 5' end
and TAMRA or MGB covalently linked to the 3' end, where JOE is the
fluorescent reporter dye and TAMRA or MGB is the quencher dye. In
some cell types, primers and probe designed to a GAPDH sequence
from a different species are used to measure GAPDH expression. For
example, a human GAPDH primer and probe set may be used to measure
GAPDH expression in monkey-derived cells and cell lines.
Example 3
Antisense Reduction of Human ACC1 Expression
[0100] A series of antisense oligonucleotides was designed to
target different regions of human ACC1, using published sequences
cited in Table 1. The compounds are shown in Table 2. All compounds
in Table 2 are chimeric oligonucleotides ("gapmers") 20 nucleotides
in length, composed of a central "gap" region consisting of 10
2'-deoxynucleotides, which is flanked on both sides (5' and 3') by
five-nucleotide "wings". The wings are composed of
2'-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate throughout the oligonucleotide. All cytidine
residues are 5-methylcytidines. The compounds were analyzed for
their effect on gene target mRNA levels by quantitative real-time
PCR as described in other examples herein, using the following
primer-probe set designed to hybridize to human ACC1:
TABLE-US-00002 Forward primer: GGATGGTGTTCACTCGGTAATAGA
(incorporated herein as SEQ ID NO: 20) Reverse primer:
GGGTGATATGTGCTGCGTCAT (incorporated herein as SEQ ID NO: 21)
And the PCR probe was: FAM-CATCAGCAGAGACTACGTCCTCAAGCAAATC-TAMRA
(incorporated herein as SEQ ID NO: 22), where FAM is the
fluorescent dye and TAMRA is the quencher dye.
[0101] A549 cells were treated with 70 nM of the disclosed
antisense oligonucleotides using LIPOFECTIN.TM.. A reduction in
expression is expressed as percent inhibition in Table 2. If
present, "N.D." indicates "not determined". The control antisense
oligonucleotide used was SEQ ID NO: 19. The target regions to which
these antisense oligonucleotides are inhibitory are herein referred
to as "validated target segments."
TABLE-US-00003 TABLE 2 Reduction of human ACC1 mRNA levels by
chimeric oligonucleotides having 2'-MOE wings and deoxy gap Target
SEQ Target % SEQ ISIS # ID NO Site Sequence (5' to 3') Inhib ID NO
366558 1 848 ACGAGTATTTCAAAGTCTTA 46 23 366491 2 501
ACCACATCCTCTCATCATTG 17 24 366492 2 506 AGACCACCACATCCTCTCAT 8 25
366493 2 542 CCAGAAAGACCTAGCCCTCA 5 26 366494 2 1369
ATACCTGCAGTTTGAGCCAC 80 27 366495 2 1597 GGGAAGTCATCTGCATTGTT 10 28
366496 2 1816 ATGTGTTCAAATACTGCTGG 55 29 366497 2 1821
GTTCCATGTGTTCAAATACT 59 30 366498 2 1970 GACATCAGCCACCATCTCTG 57 31
366499 2 2007 TCCCCATGGCAATCTGGAGC 83 32 366500 2 2053
GATACCCCATACATCATACG 28 33 366501 2 2266 TCAGCAAATTCATGAAGTCC 69 34
366502 2 2271 GAGAATCAGCAAATTCATGA 56 35 366503 2 2362
TCACCCCGAATAGACAGCTC 75 36 366504 2 2367 GAAAGTCACCCCGAATAGAC 50 37
366505 2 2372 AGTTCGAAAGTCACCCCGAA 71 38 366506 2 2593
GCAGGAAGGACTTGACCCCT 64 39 366507 2 2635 TCATAGATAAGTTCAACATC 14 40
366508 2 2830 GTTTTATTGCCAATTGTGAT 71 41 366509 2 2835
CACAGGTTTTATTGCCAATT 83 42 366510 2 3214 GGAAGGCAGTATCCATTCAT 60 43
366511 2 3379 TACTGAGCCATTTCCTTCTT 67 44 366512 2 3384
TAGCATACTGAGCCATTTCC 83 45 366513 2 3575 CAGATCCATCACCACAGCCT 67 46
366514 2 3643 AGGGCGAATACACATTTGTC 64 47 366515 2 3748
AACTGATCAATAAGCATTGT 32 48 366516 2 3908 CTCTACTTGGTTATGGCGAA 71 49
366517 2 3967 TGCAGGTTCTCAATGCAAAA 68 50 366518 2 3972
GTTTCTGCAGGTTCTCAATG 73 51 366519 2 3977 GATGAGTTTCTGCAGGTTCT 67 52
366520 2 4129 GTGTTGTCCTTAAGCTGGCG 66 53 366521 2 4261
TCGCTGACACTAGCTACATG 85 54 366522 2 4492 TCAGTCTTGATAGCCACATT 65 55
366523 2 4662 GGAATTCTCTATGAAATCTC 63 56 366524 2 4699
TCAAACTTATCCCTTGCTCG 75 57 366525 2 4772 AAAATTTCTCATCCGGTTCA 55 58
366526 2 4777 AGGTCAAAATTTCTCATCCG 71 59 366527 2 5069
AATCTITGATGGGTCCATGA 53 60 366528 2 5151 TGATTTTCAGTTCTGCCTGG 61 61
366529 2 5156 AATGTTGATTTTCAGTTCTG 53 62 366530 2 5204
TGTCAGGAAGAGGCGGATGG 51 63 366531 2 5214 CAGACTCGTTTGTCAGGAAG 83 64
366532 2 5317 ATTCCATGCAGTGGTCCCTG 84 65 366533 2 5424
GCCGAAACATCTCTGGGATA 71 66 366534 2 5953 GTTATCTTGTACCTGGATTC 73 67
366535 2 6103 CGGACAAGGTAAGCCCCAAT 75 68 366536 2 6108
CCAGCCGGACAAGGTAAGCC 82 69 366537 2 6133 TTCTCAACCTGGATGGTTCT 69 70
366538 2 6385 GGAACAAACTCGATGATTCT 66 71 366539 2 6390
TTGTGGGAACAAACTCGATG 60 72 366540 2 6440 GGTTGGGTGAGGACGGCCTG 42 73
366541 2 6580 GTTCGGGTTTCTACAGCAAC 82 74 366542 2 7014
TGGTTTTCACCAGATCCTTT 76 75 366543 2 7019 ACGCATGGTTTTCACCAGAT 83 76
366544 2 7175 GTGCAAGTCAGCAAACTGCA 54 77 366545 2 7180
GTGTCGTGCAAGTCAGCAAA 61 78 366546 2 7300 ATTTTCTTCTTGACCAGGTC 39 79
366547 2 7655 AAGCTCTTCCTACGTGGAAG 61 80 366548 2 8964
CTAGTTGTTGAAAGTAAACT 47 81 366549 2 9496 GATTTGATTTATTGCAAAAA 21 82
366550 2 9512 ACTTGTAGATATGTGGGATT 27 83 366551 2 9958
GTAGAGGTTTATTTCAACAA 79 84 366552 4 109 CCAGAAAGACCTCAGGGTGG 79 85
366553 5 252 CTATAGTCTTTTTGTCTAAT 24 86 366554 5 479
CATGCTGGACCTTTGAAGCA 5 87 366555 6 479 ATTTCAAAGTCTTTGAAGCA 6 88
366556 6 592 GACATGCTGGACCTTGAAAA 39 89 366557 6 599
CAAGCCAGACATGCTGGACC 73 90 338246 6 3313 ACCACAGCCTTCATGTGGCC 79 91
366482 7 51352 CTCACCTCACCTCAGGGTGG 48 92 366483 7 109758
AAATGACCTGGAGCATAGAT 48 93 366484 7 111089 TAACACTTACCTTTGAAGCA 0
94 366485 7 120863 ATTTCAAAGTCTGAGGATAC 46 95 366486 7 120974
GTACCCACACCTTGAAAATC 37 96 366487 7 157787 CTTCAGCATCTGGTAGATAC 63
97 366488 7 248329 CCATGCCAATCTGGAAAGGC 77 98 366489 7 275126
GATGGAACCAGGACCTATGT 54 99 366490 7 300424 GCTCTCTCTGCTTCTGCTAG 64
100
[0102] Preferred oligonucleotides and target regions are those
which were sufficiently active to effect at least about a 50%
reduction in ACC1. Particularly preferred are oligonucleotides
which reduced ACC1 by at least about 70%.
[0103] Preferred validated target segments include nucleotides
248329 to 248348 of SEQ ID NO: 7, nucleotides 599 to 618 and
3313-3322 of SEQ ID NO: 6, and nucleotides 109 to 128 of SEQ ID NO:
4. Preferred validated target segments also include nucleotides
1369 to 1388, 2007 to 2026, 2266 to 2285, 2362 to 2381, 2372 to
2391, 2830 to 2849, 2835 to 2854, 3379 to 3398, 3384 to 3403, 3575
to 3594, 3908 to 3927, 3967 to 3986, 3972 to 3991, 3977 to 3996,
4129 to 4148, 4261 to 4280, 4492 to 4511, 4699 to 4718, 4777 to
4796, 5214 to 5233, 5317 to 5336, 5424 to 5443, 5953 to 5972, 6103
to 6122, 6108 to 6127, 6133 to 6152, 6385 to 6404, 6580 to 6599,
7014 to 7033, 7019 to 7038, and 9958 to 9977 of SEQ ID NO: 2.
[0104] It is understood that an "active target segment" can be
bounded by any two active validated target segments in the tables.
A suitable target region is that of nucleotides 5214 to 6152 of SEQ
ID NO: 2. The seven oligonucleotides designed within this region
all caused a reduction of at least about 70%. Also suitable are
target regions defined by the active oligonucleotides falling
within the boundaries of the 5214-6152 target region.
Example 4
Antisense Reduction of Human ACC2 Expression
[0105] A series of antisense oligonucleotides was designed to
target different regions of human ACC2, using published sequences
cited in Table 1. The compounds are shown in Table 3. All compounds
in Table 3 are chimeric oligonucleotides ("gapmers") 20 nucleotides
in length, composed of a central "gap" region consisting of 10
2'-deoxynucleotides, which is flanked on both sides (5' and 3') by
five-nucleotide "wings". The wings are composed of
2'-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate throughout the oligonucleotide. All cytidine
residues are 5-methylcytidines. The compounds were analyzed for
their effect on gene target mRNA levels by quantitative real-time
PCR as described in other examples herein, using the following
primer-probe set designed to hybridize to human ACC2:
TABLE-US-00004 Forward primer: CGTGCCCATCAGCATCAC (incorporated
herein as SEQ ID NO: 105) Reverse primer: GAAGGCTACCATGGCTCCC
(incorporated herein as SEQ ID NO: 106)
And the PCR probe was: FAM-CCCTGACCTGCTGAGGCACAGCA-TAMRA
(incorporated herein as SEQ ID NO: 107), where FAM is the
fluorescent dye and TAMRA is the quencher dye.
[0106] A549 cells were treated with 70 nM of the disclosed
antisense oligonucleotides using LIPOFECTIN.TM.. "Target site"
refers to the 5'-most site on the ACC2 target sequence indicated to
which the antisense compound was designed. A reduction in
expression is expressed as percent inhibition in Table 3. If
present, "N.D." indicates "not determined". The control antisense
oligonucleotide used was SEQ ID NO: 19. The target regions to which
these antisense oligonucleotides are inhibitory are herein referred
to as "validated target segments."
TABLE-US-00005 TABLE 3 Reduction of human ACC2 by chimeric
oligonucleotides having 2'-MOE wings and a deoxy gap Target % Inhib
SEQ Target of ACC2 SEQ ISIS # ID NO Site Sequence (5' to 3') mRNA
ID NO 366437 9 1 AGACAAAGAAGCAAGACCAT 0 108 366438 9 50
CCAGATTTTTAACCAGGAAA 10 109 366439 9 55 TTCCCCCAGATTTTTAACCA 21 110
366440 9 468 TCATCAGCTGCCTCTTGATG 20 111 366441 9 844
CGGAACATCTCATAGGCCCA 59 112 366442 9 1009 GGGATTCTCTTGGCAATGTC 0
113 366443 9 1124 GGCCCACATGGCCTCACTGG 46 114 366444 9 1456
ATGAGAAAGATGGGCGAGCC 42 115 366445 9 1461 GCTTCATGAGAAAGATGGGC 47
116 366446 9 1466 GGCCAGCTTCATGAGAAAGA 26 117 366447 9 1754
GCAGGGATGTTCCACCTGCA 26 118 366448 9 1816 GGCACGCCCATGGCGATCTG 43
119 366449 9 1930 GCAATGACGTGGCCTCGGGC 41 120 366450 9 1958
GTCTGGGTTTTCGCTGGTGA 48 121 366451 9 2036 GCTGAAGTAACCCCACACGT 40
122 366452 9 2041 GCCACGCTGAAGTAACCCCA 46 123 366453 9 2224
TTCTGGAAGCTCTCGGTCTC 51 124 366454 9 2229 CGTTGTTCTGGAAGCTCTCG 59
125 366455 9 2423 ATCTACGAGGTTCAGTAGTG 63 126 366456 9 2474
CTGCCGGGCCACCTTGAGAA 46 127 366457 9 2781 GGGTCATGATCATCTTCATC 56
128 366458 9 2786 GTTCAGGGTCATGATCATCT 68 129 366459 9 2818
TTGATGTACTTCACCCGGCC 68 130 366460 9 3130 GCCACGCTGGTCATGATCTC 43
131 366461 9 3181 TGGGCCATCACCCTGCGGAC 53 132 366462 9 3247
TCCAGGATGGTGGCTATCTG 45 133 366463 9 3252 GGCAGTCCAGGATGGTGGCT 49
134 366464 9 3341 GCTGCGGTATCTCTGGACCA 39 135 366465 9 3421
GCTTGCTGAAAATGGTGCTC 56 136 366466 9 3426 AGTGGGCTTGCTGAAAATGG 29
137 366467 9 3529 AGCTGGTTCTTCTTGGCCAC 63 138 366468 9 3534
TCACCAGCTGGTTCTTCTTG 70 139 366469 9 3565 TCTGGGCCACACAGCTCATC 62
140 366470 9 3754 AACTGGTGGCCGTACATGTC 30 141 366471 9 3759
GGCAGAACTGGTGGCCGTAC 54 142 366472 9 4438 TCTTCTGCAAACTCATCTCT 0
143 366473 9 4481 CAGCTGGAAGGCCAGGGCAG 63 144 366474 9 4534
TGGTTGGCACAGGGCACGGC 67 145 366475 9 4653 AGGAGGCTTCCTTTGTGATC 14
146 366476 9 5083 AGATCCTTGGTGACGTAGGG 29 147 366477 9 5088
GGAGCAGATCCTTGGTGACG 48 148 366478 9 5172 GTTTAAAGAGAGCCTGCCTG 57
149 366479 9 5913 TGTTGGATGTGTAGACCTCT 55 150 366480 9 6933
CCAGGATGTCAGATATGACG 34 151 366481 9 7237 ACCAGGCCTCGGATGGTCTT 8
152 366435 10 87 CACGGTCATCAGTCAACAAC 0 153 366436 10 3680
GCTCGGAACCAGTAGCCCTG 30 154 361119 12 2602 TCAACCTCTTCCTTCATGTA 45
155 189530 12 3579 AGAAGATGCAGTCCAGCACC 35 156 189531 12 3775
TGCCGCAGCTCGTAGGAGGG 64 157 189537 12 3992 CCGGTGCTGCAGGCTGTTTA 48
158 189541 12 5046 AGAGGCTGATGTCCAGGTAG 63 159 189542 12 5242
AAGAGAGCCTGCCTGAACAT 23 160 189543 12 5252 CCACAGTTTAAAGAGAGCCT 49
161 189544 12 5257 GAGCCCCACAGTTTAAAGAG 54 162 189545 12 5338
CGGTTCATCTCCACCAGCTG 63 163 189548 12 5375 GAAGGCCACCATGCCCACCT 45
164 189549 12 5380 ATTTTGAAGGCCACCATGCC 16 165 189550 12 5385
ACCTCATTTTGAAGGCCACC 64 166 189553 12 5614 TCTGGGTCCACCCAAGCCAC 65
167 189557 12 5963 CAGGACCTTGTTGAGAGCAC 37 168 189558 12 5968
CTTCCCAGGACCTTGTTGAG 36 169 189559 12 5973 CCTCTCTTCCCAGGACCTTG 31
170 189560 12 5980 GTGTAGACCTCTCTTCCCAG 49 171 189566 12 6229
TTCAGAGTTGGGTGAGGCCT 26 172 189571 12 6280 ATGATTFCCTTGAAACTGCC 43
173 189572 12 6285 GTGCCATGATTTCCTTGAAA 54 174 189573 12 6290
CCAGGGTGCCATGATTTCCT 52 175 189574 12 6358 GTCTCCACAGCAATCACTCC 25
176 189575 12 6727 CTCTCTTTGTCTGCATACAT 29 177 189576 12 6732
CCCTGCTCTCTTTGTCTGCA 50 178 189589 12 7301 GATGGTCTTGAGGACAGAGT 12
179 366429 13 27846 CATGCTCGGCCTGCAGAATA 14 180 366430 13 62687
AGCCACATACCGGGTGGACT 50 181 366431 13 80821 CACTTGGAGAGTCCTCTCTC 47
182 366432 13 93058 TCAGCACAGCAGGCCCCACA 34 183 366433 13 121050
CCCAGGCACCCTACATGAAA 43 184 366434 13 125943 GGCTCAGGGAGGAGAAGGCA
25 185
[0107] Preferred oligonucleotides and target regions are those
which were sufficiently active to effect at least about a 50%
reduction in ACC2 expression. Particularly preferred are
oligonucleotides which reduced ACC2 by about 60% or greater.
[0108] Preferred validated target segments include nucleotides 844
to 863, 2229 to 2248, 2423 to 2442, 2781 to 2800, 2786 to 2805,
2818 to 2837, 3421 to 3440, 3529 to 3548, 3534 to 3553, 3565 to
3584, 4481 to 4500, 4534 to 4553, 5172 to 5191, and 5913 to 5932 of
SEQ ID NO: 9. Preferred validated target segments also include 3775
to 3794, 5046 to 5065, 5338 to 5357, 5385 to 5404, 5614 to 5633 of
SEQ ID NO: 12.
[0109] It is understood that an active target segment can be
bounded by any two active validated target segments in the tables.
Suitable target segments of SEQ ID NO: 9 include nucleotides 2229
to 2442, nucleotides 2786 to 2837, nucleotides 3529 to 3584 and
nucleotides 4481 to 4553. Also suitable is the region of
nucleotides 5385 to 5633 of SEQ ID NO: 12.
Example 5
Antisense Reduction of ACC1 and ACC2 Expression
In Vivo Studies in C57BL/6 Mice
[0110] In a further embodiment of the present invention, antisense
compounds were designed to target mouse ACC1 or ACC2, using
published sequences, and were screened in vitro in b.END cells or
primary mouse hepatocytes using methods described herein.
Primer-probe sets used were designed to hybridize to mouse ACC1 or
ACC2. The following is a primer-probe set for mouse ACC2:
TABLE-US-00006 Forward primer: AGGTGCTCATCGCCAACAA (incorporated
herein as SEQ ID NO: 269) Reverse primer: CCAGCGGCGGATGGA
(incorporated herein as SEQ ID NO: 270)
PCR probe: FAM-CATCGCTGCGGTCAAGTGTATGCG-TAMRA (incorporated herein
as SEQ ID NO: 271), where FAM is the fluorescent dye and TAMRA is
the quencher dye.
[0111] The following is another primer-probe set for mouse
ACC2:
TABLE-US-00007 Forward primer: GGGCTCCCTGGATGACAAC (incorporated
herein as SEQ ID NO: 272) Reverse primer: TTCCGGGAGGAGTTCTGGA
(incorporated herein as SEQ ID NO: 273)
PCR probe: FAM-CTCTGATGAGGACCCTAGTGCCGGC-TAMRA (incorporated herein
as SEQ ID NO: 274), where FAM is the fluorescent dye and TAMRA is
the quencher dye.
[0112] The following is a primer-probe set for mouse ACC1:
TABLE-US-00008 Forward primer: CTGGCTGCATCCATTATGTCA (incorporated
herein as SEQ ID NO: 275) Reverse primer: GGGTTGTCCAGTTGCATTTTG
(incorporated herein as SEQ ID NO: 276)
PCR probe: FAM-CTGGAGCAGCACTTGACCCTGGC-TAMRA (incorporated herein
as SEQ ID NO: 277), where FAM is the fluorescent dye and TAMRA is
the quencher dye.
[0113] Several active compounds were selected for further
investigation in mice.
[0114] Male C57B1/6 mice were fed a diet with a fat content of
about 4% and were subcutaneously injected with the oligonucleotides
shown in Table 4 at a dose of 100 mg/kg once per week for 2 weeks.
Shown in Table 4 is the nucleotide sequence of each
oligonucleotide, the SEQ ID NO of a nucleic acid which it targets,
and the 5'-most target site on the indicated SEQ ID NO to which the
oligonucleotide is complementary. The sequences of the
oligonucleotides used are shown in Table 4. The antisense
oligonucleotides used are chimeric oligonucleotides ("gapmers") 20
nucleotides in length, composed of a central "gap" region
consisting of 10 2'-deoxynucleotides, which is flanked on both
sides (5' and 3') by five-nucleotide "wings". The wings are
composed of 2'-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate throughout the oligonucleotide. All cytidine
residues are 5-methylcytidines.
TABLE-US-00009 TABLE 4 Target SEQ Target SEQ ID NO Site Sequence
(5' to 3') ID NO 8 5010 TCCATAGCGCATTACCATGC 186 8 5150
TCCTTATACAGGCTGATGTC 187 17 6170 TTCCTTGAAACTGCCATGGT 188 17 223
GAGTTCCTCTGCTGACTGGC 189 8 5132 TCCAAGTAGTAGCCAGACTC 190 8 5648
CGTGGGATGCCTTCTGCTCT 191 12 3579 AGAAGATGCAGTCCAGCACC 192
[0115] Saline-injected animals serve as a control. Each treatment
group was comprised of five animals. After the treatment period,
mice were sacrificed and target levels were evaluated in liver and
fat. RNA isolation and target mRNA expression level quantitation
are performed using RIBOGREEN.TM. as described by other examples
herein. Results for each treatment group are shown in Table 5 as
percent inhibition of target (ACC1 or ACC2) mRNA as compared to
saline treated control.
TABLE-US-00010 TABLE 5 Reduction of ACC1 or ACC2 in tissues of mice
treated with antisense oligonucleotides SEQ % Inhib of ACC1 % Inhib
of ACC2 ID NO Liver Fat Liver Fat 186 83 91 0 9 187 61 88 12 46 188
14 74 42 62 189 0 59 92 83 190 63 87 21 57 191 68 91 28 57 192 1 75
55 76
[0116] As shown in Table 5, oligonucleotides having SEQ ID NO: 186
and 190 caused greater reductions in ACC1 levels than ACC2 levels.
Oligonucleotides having the sequence of SEQ ID NO: 189 and 188
caused greater reductions ACC2 levels than ACC1 levels. SEQ ID NO:
190 and 191 caused reductions in both ACC1 and ACC2 levels, while
SEQ ID NO: 192 caused similar reductions in ACC1 and ACC2 levels in
fat.
[0117] The effects of target inhibition on glucose metabolism were
evaluated in the mice treated with the antisense compounds of the
invention. Plasma glucose was measured at the start of the
treatment and after 2 weeks of treatment. Results are shown in
Table 6 as the average plasma glucose level for each treatment
group. Glucose levels were measured by routine clinical methods,
for example using a YSI glucose analyzer (YSI Scientific, Yellow
Springs, Ohio).
TABLE-US-00011 TABLE 6 Effects of ACC1 or ACC2 reduction on plasma
glucose levels in C57BL/6 mice Plasma glucose SEQ (mg/dL) ID NO
Week 0 Week 2 n/a 196 186 186 209 192 187 221 196 188 215 203 189
212 188 190 200 215 191 213 154 192 196 158
[0118] As shown in Table 6, antisense oligonucleotides of the
invention reduce plasma glucose levels. Another embodiment of the
invention is a method of lowering plasma glucose in an animal by
administering an antisense compound of the invention.
Example 6
Effects of Antisense Oligonucleotides Targeted to ACC2
In Vivo Evaluation in Normal Mice
[0119] A series of antisense oligonucleotides was designed to
target different regions of ACC2, using published sequences cited
in Table 1. The sequences of the oligonucleotides used are shown in
Table 7. All oligonucleotides used in this experiment are chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of 10 2'-deoxynucleotides, which
is flanked on both sides (5' and 3') by five-nucleotide "wings".
The wings are composed of 2'-O-(2-methoxyethyl) nucleotides, also
known as 2'-MOE nucleotides. The internucleoside (backbone)
linkages are phosphorothioate throughout the oligonucleotide. All
cytidine residues are 5-methylcytidines. The compounds were
analyzed for their effect on gene target mRNA levels in C57B1/6
mice maintained on a standard rodent diet.
[0120] C57B1/6 mice were subcutaneously injected weekly with the
oligonucleotides having sequences shown in Table 7 at a dose of 100
mg/kg/week for 3 weeks. Saline injected animals served as the
controls. Each treatment group was comprised of five animals. After
the treatment period, mice were sacrificed and target levels were
evaluated in liver. RNA isolation and target mRNA expression level
quantitation are performed as described by other examples herein.
Results for each treatment group are shown in Table 7 as a
percentage of target (ACC1 or ACC2) mRNA measured from saline
treated controls. "Target site" refers to the 5'-most site on the
ACC2 target sequence indicated to which the antisense compound was
designed. A reduction in expression is expressed as percent
inhibition in Table 7.
TABLE-US-00012 TABLE 7 Reduction of mouse ACC2 or mouse ACC1 by
chimeric oligonucleotides having 2'-MOE wings and deoxy gap-in vivo
screen Target % Inhib % Inhib SEQ Target of ACC2 of ACC1 SEQ ID NO
Site Sequence (5' to 3') mRNA mRNA ID NO 17 223
GAGTTCCTCTGCTGACTGGC 55 91 189 17 1925 TGGGTTTTCGCTGGTGATCC 45 77
193 17 1923 GGTTTTCGCTGGTGATCCTG 25 70 194 17 2091
TGGCCTCTTCACGGTTCTCG 25 64 195 17 2368 GCAGGGAGGACCTGACCCCT 27 43
196 17 2557 TACGTAGTGTAACTGCTGCC 5 41 197 17 2575
TCAACCTCTTCCTTCATGTA 35 31 155 17 3097 ACACTGGTCATGATCTCCTG 38 54
198 17 3277 TGTGTGTTCATGAAGAAGAC 35 69 199 17 3341
CACCACAGCCTTCATGTAGC 44 26 200 17 3921 GGAACTCCACCACACAGGTG 0 0 201
18 54021 GGCAGCATGAACTGGAACTC 7 5 202 17 4726 ATGTGGTTGCAGTCAGTGCG
54 61 203 17 4738 AAGTTGAGGAAGATGTGGTT 7 0 204 17 4747
GTGGGCACAAAGTTGAGGAA 67 71 205 17 4762 GGGTCCATGATGACTGTGGG 0 58
206 17 4927 AGGTAGTAGCCAGACTCGTT 68 75 207 17 5336
GATGTCATTGCCGATGACAA 26 0 208 18 30804 GAAGCTGCCATCCTGGCTGT 70 3
209 17 1932 CCTCATCTGGGTTTTCGCTG 84 88 210 17 2071
CCCCAGGAGAAGCAGTGCCC 80 42 211
[0121] As shown in Table 7, antisense oligonucleotides targeted to
ACC1 or ACC2 can reduce expression of ACC1, ACC2, or both ACC1 and
ACC2. To assess the physiological effects resulting from inhibition
of target mRNA, the mice were further evaluated at the end of the
treatment period for plasma triglycerides, plasma cholesterol, and
plasma transaminase levels. Triglycerides (TRIG) and cholesterol
(CHOL) were measured at the beginning of the experiment (Wk 0) and
at study termination (Wk 3) by routine clinical analyzer
instruments (e.g. Olympus Clinical Analyzer, Melville, N.Y.).
Glucose levels were measured using a glucose analyzer, for example,
a YSI glucose analyzer (YSI Scientific, Yellow Springs, Ohio).
Average plasma glucose levels for each treatment group are
presented in Table 8 in mg/dL. Resulting measurements are presented
in Table 8 as the average level per treatment group. Cholesterol
and triglyceride levels are shown in mg/dL.
TABLE-US-00013 TABLE 8 Effect of antisense oligonucleotides
targeted to ACC2 on plasma triglycerides, cholesterol Plasma
glucose Triglycerides Cholesterol SEQ ID NO Wk 0 Wk 3 Wk 0 Wk 3 Wk
0 Wk 3 n/a 177 176 118 79 89 75 193 194 184 113 113 92 95 194 186
172 129 127 90 89 195 185 176 119 124 97 90 196 189 191 114 155 87
99 197 198 173 90 174 94 89 155 164 176 100 106 97 95 198 171 183
108 116 104 88 199 179 179 143 85 102 108 200 170 181 123 118 98 94
201 192 183 129 121 90 95 202 185 172 97 100 87 67 203 215 174 123
137 91 232 204 195 177 140 115 93 95 205 204 166 106 146 94 105 206
207 165 180 132 101 100 207 197 179 135 119 101 76 208 189 155 81
102 102 92 209 202 167 86 118 98 86 210 213 159 121 142 95 81 211
176 159 101 126 88 100 189 200 159 103 85 80 86
[0122] Body weight was monitored throughout the study. Increases in
body weight through the course of the study were comparable for
animals receiving antisense oligonucleotides and saline-treated
control animals. Also monitored upon termination of the study were
spleen, liver, and adipose tissue weights. For saline-treated
control animals, liver, adipose, and spleen weights averaged about
1 g, about 0.3 g, and about 0.2 g, respectively. For animals
treated with antisense oligonucleotides targeted to ACC2, liver,
fat, and spleen weights ranged from about 1 to 3 g, about 0.1 to
0.4 g, and about 0.1 to 0.2 g, respectively.
Example 7
Effects of Antisense Inhibition of ACC1 and ACC2 Expression
In Vivo Studies in a Mouse Model of Diet-Induced Obesity
[0123] Male C57BL/6 mice received a 60% fat diet for 12 weeks,
after which mice were subcutaneously injected weekly with the
oligonucleotides described in Table 9 at a dose of 50 mg/kg/week
for 6 weeks. High-fat fed saline-injected or animals injected with
the scrambled control oligonucleotide ISIS 141923
(CCTTCCCTGAAGGTTCCTCC, incorporated herein as SEQ ID NO: 212)
served as controls. As another control, animals fed normal chow
were likewise injected with saline. ISIS 141923 and the
oligonucleotides of shown in Table 9 are chimeric oligonucleotides
("gapmers") 20 nucleotides in length, composed of a central "gap"
region consisting of 10 2'-deoxynucleotides, which is flanked on
both sides (5' and 3') by five-nucleotide "wings". The wings are
composed of 2'-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate throughout the oligonucleotide. All cytidine
residues are 5-methylcytidines.
TABLE-US-00014 TABLE 9 Target SEQ Target SEQ ID NO Site Sequence
(5' to 3') ID NO 8 5010 TCCATAGCGCATTACCATGC 186 17 1925
TGGGTTTTCGCTGGTGATCC 193 17 3277 TGTGTGTTCATGAAGAAGAC 199 17 4762
GGGTCCATGATGACTGTGGG 206 17 1932 CCTCATCTGGGTTTTCGCTG 210 17 4927
AGGTAGTAGCCAGACTCGTT 207
[0124] Each treatment group was comprised of seven animals. After
the treatment period, mice were sacrificed and target levels were
evaluated in liver. RNA isolation and target mRNA expression level
quantitation are performed as described by other examples herein.
Results for each treatment group are shown in Table 10 as a
percentage of control (target ACC1 or ACC2 mRNA measured from
saline treated high-fat fed controls).
TABLE-US-00015 TABLE 10 Reduction of ACC1 or ACC2 expression in
high-fat fed mice treated with antisense oligonucleotides targeted
to ACC1 or ACC2 ACC1 ACC2 SEQ ID NO % Control 186 12 70 210 26 11
193 64 35 212 79 64 Saline, 87 114 normal chow 199 46 9 206 68 42
207 31 43
[0125] As shown in Table 10, antisense oligonucleotides targeted to
ACC1 or ACC2 reduce target expression levels in vivo.
[0126] Body weight and food consumption were monitored throughout
the study. Cumulative food consumption for each treatment group was
similar to that of saline-treated high-fat fed mice. Average body
weights measured for each treatment group at the beginning (Wk 0)
and at the end (Wk 6) of the study are presented in Table 11.
TABLE-US-00016 TABLE 11 Body weight of animals treated with
antisense oligonucleotides Body weight (g) SEQ ID NO Wk 0 Wk 6
Saline, high fat fed 41 45 186 42 39 210 42 43 193 43 41 212 42 42
Saline, normal chow 27 28 199 37 37 206 38 36 207 38 37
[0127] Also measured upon termination of the study were spleen,
liver, and epididymal fat pad weights. Fat pad weights were reduced
in the animals treated with antisense compounds targeting ACC1 or
ACC2 as compared to high-fat fed animals treated with saline or
animals treated with the control oligonucleotide ISIS 141923. These
results, taken together, show that antisense inhibition of ACC1 or
both ACC1 and ACC2 cause reductions in fat pad weight without
altering body weight or food consumption in an animal model of
diet-induced obesity. Therefore, other embodiments of the invention
include methods of reducing adiposity, methods of treating obesity,
and methods of treating diet-induced obesity in an animal by
administering an antisense compound of the invention.
[0128] To assess the physiological effects resulting from
inhibition of target mRNA, the diet-induced obese mice that receive
treatment were further evaluated at the beginning of the study (Wk
0), during the third week of treatment (Wk 3), and during week 5 of
treatment (Wk 5) for plasma triglycerides, plasma cholesterol, and
plasma HDL and LDL. Plasma triglycerides and cholesterol were
measured by routine clinical analyzer instruments (e.g. Olympus
Clinical Analyzer, Melville, N.Y.). Average plasma triglycerides
(TRIG), cholesterol (CHOL), LDL and HDL levels for each treatment
group are presented in Table 12 in mg/dL.
TABLE-US-00017 TABLE 12 Effects of antisense oligonucleotides on
plasma lipid levels in mice fed a high-fat diet Treatment TRIG CHOL
HDL LDL SEQ ID NO Wk 0 Wk 2 Wk 5 Wk 0 Wk 2 Wk 5 Wk 0 Wk 2 Wk 5 Wk 0
Wk 2 Wk 5 Saline, high fat fed 99 93 86 185 182 181 148 146 152 20
23 26 186 94 101 80 184 162 65 150 130 51 19 18 11 210 112 128 99
198 170 160 157 130 126 21 26 26 193 107 101 83 184 179 178 144 142
146 19 21 24 212 124 83 99 196 192 193 157 158 167 21 21 20 Saline,
normal chow 175 125 112 103 90 98 76 71 78 12 11 11 199 80 59 73
144 149 191 116 122 151 15 20 29 206 77 65 68 121 134 129 97 106
101 13 19 23 207 89 87 76 148 152 136 119 123 113 17 17 15
[0129] As shown in Table 12, oligonucleotides having the sequences
of SEQ ID NO: 186 and 210 caused decreases in plasma cholesterol
levels over the course of the study. Therefore, another embodiment
of the present invention is a method of lowering cholesterol levels
in an animal by administering an antisense compound of the
invention. Treatment with the antisense oligonucleotide having SEQ
ID NO: 186 also resulted in decreased LDL levels over the course of
the study. Therefore, another embodiment of the present invention
is a method of lowering LDL levels in an animal by administering an
antisense compound of the invention.
[0130] Tissue triglyceride levels were measured using a
Triglyceride GPO Assay from Roche Diagnostics (Indianapolis, Ind.).
Liver triglyceride levels are used to assess hepatic steatosis, or
accumulation of lipids in liver. When normalized to liver
triglyceride levels measured for saline treated high-fat fed
control animals, treatment with the control ISIS 141923 reduced
liver triglycerides by 35%, and saline-treated mice fed normal chow
had 82% lower liver triglycerides than the high-fat fed
counterparts. High-fat fed animals treated with oligonucleotides
having SEQ ID NO: 186, 210, or 193 showed decreases of 67%, 70%,
and 46%, respectively. Treatment with SEQ ID NO: 199, 206, or 207
caused reductions of 44%, 46%, or 71%, respectively. Therefore,
treatment with antisense oligonucleotides which reduce ACC1 and
ACC2 decreases liver triglyceride content. Other embodiments of the
invention include a method of lowering liver triglycerides and a
method of ameliorating hepatic steatosis in an animal by
administering an antisense compound of the invention.
[0131] The effects of target inhibition on glucose and insulin
metabolism were also evaluated in the diet-induced obese mice
treated with the antisense compounds of the invention. Plasma
glucose was measured at the start of treatment and after 2 weeks
and 5 weeks of treatment. Plasma insulin was similarly measured at
the beginning of the treatment, and following 2 weeks and 5 weeks
of treatment.
[0132] Glucose tolerance tests were also administered. Mice
received intraperitoneal injections of 1 g/kg dextrose, and the
blood glucose levels were measured before the glucose challenge and
at 30 minute intervals for 2 hours. Glucose levels were measured
using a glucose analyzer, for example a YSI glucose analyzer (YSI
Scientific, Yellow Springs, Ohio) and insulin levels were measured
using an Alpco insulin-specific ELISA kit from (Windham, N.H.).
Changes in glucose metabolism were assayed by plotting the blood
glucose levels at each time point and comparing the area under the
curves created. No substantial alterations in the area under the
curve were observed for the treatment groups as compared to
control, thus glucose tolerance was neither improved nor worsened
by treatment with antisense oligonucleotides targeted to ACC1 or
ACC2. No substantial alterations were observed in fed or fasted
blood glucose levels for animals treated with the antisense
oligonucleotides. Fed insulin levels increased in saline-treated
control high-fat fed mice from about 4 to 6 ng/mL over the course
of the study. In contrast, treatment with antisense
oligonucleotides having sequences of SEQ ID NO: 186, 210, or 193
caused decreases in insulin levels from about 4 to 3 ng/mL over the
course of the study. Treatment with the oligonucleotides having SEQ
ID NO: 199 or 207 likewise caused decreases in insulin levels from
about 3 ng/mL to about 1 ng/mL. Treatment with the oligonucleotide
having the sequence of SEQ ID NO: 206 caused a decrease from about
5 ng/mL to about 1 ng/mL. Therefore, another embodiment of the
present invention is a method of improving insulin sensitivity,
measured as a reduction in plasma insulin levels, in an animal by
administering an antisense compound of the invention.
[0133] Body composition was assayed at the beginning of the study
(Wk 0), during week 3 of treatment (Wk 3), and at the end of the
treatment period (Wk 6) by DEXA scan measurement of fat mass and
lean mass. Results are shown in Table 13 as average percentage body
fat for each treatment group.
TABLE-US-00018 TABLE 13 Body composition of mice fed a high fat
diet Treatment % Body Fat SEQ ID NO Wk 0 Wk 3 Wk 6 Saline, high 39
42 42 fat fed 186 39 38 29 210 39 38 35 193 39 38 33 212 40 39 37
Saline, 17 15 15 normal chow 199 32 32 28 206 32 28 22 207 32 31
28
[0134] As shown in Table 13, oligonucleotides targeted to ACC1 or
ACC2 reduce body weight in high-fat fed animals. Another embodiment
of the present invention is a method of reducing adiposity or body
fat in an animal by administering an antisense compound of the
invention.
Example 8
Effects of Antisense Reduction of ACC1 and ACC2 Expression
In Vivo Studies in ob/ob Mice
[0135] Leptin is a hormone produced by fat that regulates appetite.
Deficiencies in this hormone in both humans and non-human animals
leads to obesity. ob/ob mice have a mutation in the leptin gene
which results in obesity and hyperglycemia. As such, these mice are
a useful model for the investigation of obesity and diabetes and
treatments designed to treat these conditions. In accordance with
the present invention, the antisense compounds of the invention are
tested in the ob/ob model of obesity and diabetes.
[0136] Male C57B1/6J-Lep ob/ob mice (Jackson Laboratory, Bar
Harbor, Me.) were subcutaneously injected weekly with the antisense
oligonucleotides having the sequences indicated in Table 14 at a
dose of 50 mg/kg/week for 6 weeks. The oligonucleotides used are
chimeric oligonucleotides ("gapmers") 20 nucleotides in length,
composed of a central "gap" region consisting of 10
2'-deoxynucleotides, which is flanked on both sides (5' and 3') by
five-nucleotide "wings". The wings are composed of
2-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE nucleotides.
The internucleoside (backbone) linkages are phosphorothioate
throughout the oligonucleotide. All cytidine residues are
5-methylcytidines.
[0137] Saline-injected animals served as controls. Each treatment
group was comprised of six animals.
TABLE-US-00019 TABLE 14 Target SEQ Target SEQ ID NO Site Sequence
(5' to 3') ID NO 8 5010 TCCATAGCGCATTACCATGC 186 17 1925
TGGGTTTTCGCTGGTGATCC 193 17 1932 CCTCATCTGGGTTTTCGCTG 210 17 4927
AGGTAGTAGCCAGACTCGIT 207
[0138] After the treatment period, mice were sacrificed and target
levels were evaluated in liver. RNA isolation and target mRNA
expression level quantitation are performed as described by other
examples herein. Results for each treatment group are shown in
Table 15 as a percentage of saline-treated controls.
TABLE-US-00020 TABLE 15 Inhibition of ACC1 or ACC2 expression in
ob/ob mice treated with antisense oligonucleotides targeted to ACC1
or ACC2 SEQ ID NO % Inhib of ACC1 % Inhib of ACC2 186 92 12 210 79
80 193 52 63 207 83 76
[0139] Liver triglyceride levels, measured as described herein,
were lower than that of saline-treated control animals for all
treatment groups. Treatment with the oligonucleotide having the
nucleobase sequence of SEQ ID NO: 186 reduced plasma cholesterol
and LDL levels as compared to saline-treated controls. Therefore,
these effects of the antisense compounds of the invention occur
independent of leptin signaling. Embodiments of the current
invention include methods of lowering liver triglycerides in an
animal by administering an antisense compound of the invention,
methods of improving hepatic steatosis in an animal by
administering an antisense compound of the invention, and methods
of lowering plasma cholesterol or LDL levels in an animal by
administering an antisense compound of the invention.
Example 9
Chimeric Oligonucleotides Having 2'-MOE Wings and Deoxy Gap
Designed to Human ACC1
[0140] A series of antisense oligonucleotides was designed to
target different regions of human ACC1, using published sequences
cited in Table 1. The oligonucleotides are shown in Table 16. All
compounds in Table 16 are chimeric oligonucleotides ("gapmers") 20
nucleotides in length, composed of a central "gap" region
consisting of 10 2'-deoxynucleotides, which is flanked on both
sides (5' and 3') by five-nucleotide "wings". The wings are
composed of 2'-O-(2-methoxyethyl) nucleotides, also known as 2'-MOE
nucleotides. The internucleoside (backbone) linkages are
phosphorothioate throughout the oligonucleotide. All cytidine
residues are 5-methylcytidines.
TABLE-US-00021 TABLE 16 Chimeric oligonucleotides having 2'-MOE
wings and deoxy gap designed to human ACC1 Target SEQ Target SEQ
ISIS # ID NO Site Sequence (5' to 3') ID NO 381739 2 655
GAGTGCTGGTTCAGCTCCAG 213 381740 2 889 TCTATTTTCTTTCTGTCTCG 214
381741 2 910 ACAGTGAAATCTCGTTGAGA 215 381742 2 958
ATCACTTTATTTCCCCCAAA 216 381743 2 1006 ATGCATTTCACTGCTGCAAT 217
381744 2 1102 GCATTGGCTTTAAGGTCTTC 218 381745 2 1234
CCCCAGCCAGCCCACACTGC 219 381746 2 1549 CCCTCTGAGGCCTTGATCAT 220
381747 2 1621 GCTTGAACCTGTCTGAAGAG 221 381748 2 1963
GCCACCATCTCTGTACAAGG 222 381749 2 1996 ATCTGGAGCTGTGCTGCAGG 223
381750 2 2242 GCAGCAGCAACACTGAAATA 224 381751 2 2357
CCGAATAGACAGCTCCTTCA 225 381752 2 2377 ACTGTAGTTCGAAAGTCACC 226
381753 2 2452 AGTCTGTCCAGCCAGCCAGT 227 381754 2 2567
GGAGTGAAGGAAGTTAGAGA 228 381755 2 2629 ATAAGTTCAACATCTACTGT 229
381756 2 2665 CGAGTCACCTTAAGTACATA 230 381757 2 2840
AAACACACAGGTTTTATTGC 231 381758 2 2845 TTCTCAAACACACAGGTTTT 232
381759 2 2850 TTTCCTTCTCAAACACACAG 233 381760 2 2855
GTCATTTTCCTTCTCAAACA 234 381761 2 2896 TGGATTAACTTCCCAGCAGA 235
381762 2 2965 ATCTTCATTACCTCAATCTC 236 381763 2 3389
GTTGCTAGCATACTGAGCCA 237 381764 2 3394 GTGATGTTGCTAGCATACTG 238
381765 2 3424 TGCTGGCTGGGAAACTGACA 239 381766 2 3541
ATGCCACTTCGGTACCTCTG 240 381767 2 4165 GATGTGGGCAGCATGAACTG 241
381768 2 4186 ATGTTCCCTCTGTTTGGATG 242 381769 2 4516
AGCCTGTCATCCTCAATATC 243 381770 2 4615 CTGAAATCCTTTTGTGCAAC 244
381771 2 4693 TTATCCCTTGCTCGGAATGT 245 381772 2 4741
AAAGCCAGAGCAGGCTCCAG 246 381773 2 4813 AGGTGCATCTTGTGATTAGC 247
381774 2 4876 CGAACAAAGAACCTGTAGTC 248 381775 2 5068
ATCTTTGATGGGTCCATGAT 249 381776 2 5098 CGCATTACCATGCTCCGCAC 250
381777 2 5146 TTCAGTTCTGCCTGGAGGAC 251 381778 2 5200
AGGAAGAGGCGGATGGGAAT 252 381779 2 5265 CTGTCCTGGAGTCAGTCACT 253
381780 2 5270 CTGTGCTGTCCTGGAGTCAG 254 381781 2 5275
ATGATCTGTGCTGTCCTGGA 255 381782 2 5280 GAAACATGATCTGTGCTGTC 256
381783 2 5416 ATCTCTGGGATATCATATAT 257 381784 2 6019
CCAGCAATCATTCCAGAACC 258 381785 2 6439 GTTGGGTGAGGACGGCCTGC 259
381786 2 6631 TTGGCTTCAGAATCCAGGTT 260 381787 2 6636
TTATCTTGGCTTCAGAATCC 261 381788 2 6646 GCCTGCTGGATTATCTTGGC 262
381789 2 6745 CTCCAGTTGGCAAAGACCAT 263 381790 2 6982
ATTTCTACTGTCCCTTCTGG 264 381791 2 7122 CCTCCCGCTCCTTCAACTTG 265
381792 2 7144 TGGTAAATGGGAATTAGGAA 266 381793 2 7174
TGCAAGTCAGCAAACTGCAC 267 381794 2 7201 TTCTCCTGCATCCGGCCTGG 268
[0141] The oligonucleotides in Table 16 may be analyzed for their
effect on gene target mRNA levels by quantitative real-time PCR as
described in other examples herein, using a primer-probe set
designed to hybridize to human ACC1. ISIS 381779, ISIS 381780, ISIS
381781, ISIS 381782, ISIS 381783, and ISIS 381784 fall within the
suitable target region of nucleotides 5214 to 6152 of SEQ ID NO:
2.
TABLE-US-00022 MEGA
* * * * *