U.S. patent application number 13/699272 was filed with the patent office on 2013-05-02 for compositions for use in treating or diagnosing bone disorders and/or cardiovascular disorders.
This patent application is currently assigned to UNIVERSITAT FUR BODENKULTUR WIEN. The applicant listed for this patent is Klaus Fortschegger, Johannes Grillari, Regina Grillari, Elisabeth Schraml. Invention is credited to Klaus Fortschegger, Johannes Grillari, Regina Grillari, Elisabeth Schraml.
Application Number | 20130108687 13/699272 |
Document ID | / |
Family ID | 44537805 |
Filed Date | 2013-05-02 |
United States Patent
Application |
20130108687 |
Kind Code |
A1 |
Grillari; Johannes ; et
al. |
May 2, 2013 |
COMPOSITIONS FOR USE IN TREATING OR DIAGNOSING BONE DISORDERS
AND/OR CARDIOVASCULAR DISORDERS
Abstract
Compositions of an inhibitor of a polynucleotide for use in
treating or preventing bone disorders such as osteoporosis,
osteopenia, bone fracture, bone cancer, as well as impaired bone
homeostasis. Preferred compounds to be used in these medical
interventions are antagonistic compounds, like nucleic acid
molecules, directed against miR-31 and derivatives thereof. Also,
methods for diagnosing and compositions for use in diagnosing bone
disorders. Compounds to be employed in these diagnostic methods and
uses include compounds such as miR-31.
Inventors: |
Grillari; Johannes;
(Bisamberg, AT) ; Schraml; Elisabeth; (Wien,
AT) ; Fortschegger; Klaus; (Wien, AT) ;
Grillari; Regina; (Bisamberg, AT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Grillari; Johannes
Schraml; Elisabeth
Fortschegger; Klaus
Grillari; Regina |
Bisamberg
Wien
Wien
Bisamberg |
|
AT
AT
AT
AT |
|
|
Assignee: |
UNIVERSITAT FUR BODENKULTUR
WIEN
Wien
AT
|
Family ID: |
44537805 |
Appl. No.: |
13/699272 |
Filed: |
May 23, 2011 |
PCT Filed: |
May 23, 2011 |
PCT NO: |
PCT/EP2011/058379 |
371 Date: |
November 20, 2012 |
Current U.S.
Class: |
424/450 ;
435/6.11; 435/6.12; 514/44A; 536/24.5 |
Current CPC
Class: |
A61P 9/10 20180101; A61P
9/00 20180101; A61K 31/7105 20130101; A61P 13/12 20180101; A61P
25/28 20180101; C12N 15/1138 20130101; C12N 2310/141 20130101; C12Q
1/6881 20130101; A61P 19/08 20180101; A61P 9/04 20180101; A61P
19/10 20180101; C12N 2310/113 20130101; A61P 7/02 20180101; C12N
15/113 20130101; A61P 9/12 20180101; A61P 43/00 20180101; A61K
9/127 20130101 |
Class at
Publication: |
424/450 ;
536/24.5; 514/44.A; 435/6.11; 435/6.12 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; A61K 9/127 20060101 A61K009/127; C12N 15/113 20060101
C12N015/113 |
Foreign Application Data
Date |
Code |
Application Number |
May 21, 2010 |
EP |
10163604.1 |
Claims
1.-23. (canceled)
24. Composition comprising an antagonist/inhibitor of a
polynucleotide, wherein said polynucleotide is capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof; and/or an antagonist/inhibitor of miR-31
or its 5' or 3' isoforms or variants, for use in treating or
preventing bone disorders in a subject or for diagnosing bone
disorders in a subject or for use in monitoring in vitro the
treatment success of a bone disorder.
25. The composition according to claim 24, wherein the
polynucleotide to be antagonized/inhibited is selected from the
group consisting of microRNA, siRNA, mimic microRNA, long
non-coding RNAs, snRNA, stRNA, fRNA, snRNA, snoRNA. piRNA, tasiRNA,
aRNA and a precursor of such polynucleotides.
26. The composition according to claim 24, wherein the
polynucleotide to be antagonized/inhibited is one of about 15 to
about 100, about 18 to about 27 or about 20 to 24 nucleotides in
length.
27. The composition according to claim 24, wherein the
polynucleotide to be antagonized/inhibited or wherein the miR-31 or
its 5' or 3' iso forms or variants are selected from the group
consisting of: (a) a polynucleotide comprising the nucleotide
sequence of SEQ ID NO: 1; (b) a polynucleotide which is at least
80% identical to the polynucleotide of (a); (c) a polynucleotide
comprising the nucleotide sequence of SEQ ID NO: 2; and (d) a
polynucleotide according to (b) comprising the nucleotide sequence
of SEQ ID NO: 2.
28. The composition according to claim 27, wherein the composition
comprises one, two, three or more inhibitors of one, two, three or
more of any one of polynucleotides (a) to (d).
29. The composition according to claim 24, wherein the
polynucleotide to be antagonized/inhibited is miR-31 or its 5' or
3' isoforms or variants.
30. The composition according to claim 24, wherein the composition
contains about 1 ng/kg body weight to about 10 mg/kg body weight of
the antagonist/inhibitor.
31. The composition according to claim 24, wherein the
antagonist/inhibitor of the miR-31 or its 5' or 3' isoforms or
variants is comprised in a lipid composition, an exosome or a
liposome.
32. The composition according to claim 24 further comprising a
pharmaceutically acceptable carrier.
33. The composition according to claim 24, wherein the
antagonist/inhibitor is capable of hybridizing to miR-31 or to its
5' or 3' isoforms or variants.
34. The composition according to claim 24, wherein the
antagonist/inhibitor is selected from the group consisting of
antagomiRs, miRCURY LNA.TM. microRNA inhibitors, in vivo LNA.TM.
miR inhibitors, tiny LNA, or miR-decoys or miR-sponges.
35. The composition of claim 15, wherein the antagomiRs, miRCURY
LNA.TM. microRNA inhibitors, in vivo LNA.TM. miR inhibitors, tiny
LNA, or miR-decoys or miR-sponges comprise a nucleic acid molecule
or include a nucleic acid sequence selected from the group
consisting of: (a) a nucleic acid sequence being or comprising SEQ
ID NO: 5; (b) a nucleic acid sequence being or comprising SEQ ID
NO: 6; (c) a nucleic acid sequence being or comprising SEQ ID NO:
7; (d) a nucleic acid sequence being or comprising SEQ ID NO: 8;
and (e) a nucleic acid sequence which is at least 90% identical to
the nucleic acid sequence of any one of (a) to (d).)
36. A method for diagnosing bone disorders in a subject, which
method comprises: (a) contacting a biological sample from said
subject with a nucleic acid molecule which hybridizes to a
polynucleotide being capable of decreasing or suppressing
expression of FZD3 and/or which hybridizes to miR-31 or its 5' or
3' isoforms or variants, or contacting said biological sample with
an agent that binds to said polynucleotide being capable of
decreasing or suppressing expression of FZD3 and/or that binds to
miR-31 or its 5' or 3' isoforms or variants; (b) detecting and
evaluating the hybridization signal of the nucleic acid molecule of
(a) or detecting and evaluating the binding signal of the agent of
(a) with said polynucleotide and/or said miR-31 or its 5' or 3'
isoforms or variants; and (c) comparing the detected and evaluated
hybridization signal of (b) or comparing the detected and evaluated
binding signal of (b) with a correspondingly detected and evaluated
hybridization or binding signal in a control sample, wherein a
stronger hybridization signal or a stronger binding signal in the
sample of the subject compared to that of said control sample is
indicative for a risk of developing or having a bone disorder.
37. A method for diagnosing bone disorders and/or cardiovascular
disorders in a subject, which method comprises: (a) detecting via a
PCR method the expression level and/or quantity of miR-31 (or of
isoforms and variants thereof) in a biological text sample; and (b)
comparing the detected expression level and/or quantity of the
miR-31 (or of the isoforms and variants) in the biological sample
with a corresponding expression level and/or quantity of the miR-31
in a control sample.
38. The method according to claim 37, wherein the hybridizing
nucleic acid molecule or the binding agent is conjugated with a
marker molecule and/or a tagging molecule.
39. The method according to claim 37, wherein the agent to be
employed is a specific protein or protein fragment.
40. The method according to claim 39, wherein the specific protein
or protein fragment is an antibody or a fragment thereof or is a
modified transcription factor capable of binding to and/or
interacting with polynucleotide that is capable of binding to
and/or interacting with miR-31 or its 5' or 3' isoforms or
variants.)
41. A method for treating or preventing bone disorders and/or
cardiovascular disorders in a subject, the method comprising
administering an effective amount of a composition according to
claim 24 to a subject in need thereof.
42. The method according to claim 41, wherein the bone disorder is
selected from the group consisting of osteoporosis, osteopenia,
bone fracture, and impaired bone homeostasis.
43. The method according to claim 41, wherein the composition is
administered via injection, via inhalation, orally, rectal,
vaginally, topically or locally.
Description
[0001] The present invention relates to compositions comprising an
antagonist/inhibitor of a polynucleotide, said polynucleotide to be
inhibited being capable of decreasing or suppressing expression of
FZD3 (Frizzled-3) or a biologically active derivative thereof for
use in treating or preventing bone disorders and/or cardiovascular
disorders. Such bone disorders comprise, inter alia, osteoporosis,
osteopenia, bone fracture, bone cancer, as well as impaired bone
homeostasis. Cardiovascular diseases to be treated by the compounds
of the present invention may be selected from the group consisting
of infarction, stroke, hypertension, thrombosis, vascular stenosis,
coronary syndromes, vascular dementia, heart failure, renal
failure, stress-related carciovascular disorders, and
atherosclerosis. Preferred compounds to be used in these medical
interventions are antagonistic compounds, like nucleic acid
molecules, directed to polynucleotides that are capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof. An example of such a polynucleotide that
needs to be antagonized is miR-31 or its 5' or 3' isoforms or
variants. Also, the present invention relates to methods for and
compositions for use in diagnosing bone disorders and/or
cardiovascular disorders. Compounds to be used in these diagnostic
methods may be compounds (like primers and probes) that are capable
of detecting such a polynucleotide that is capable of decreasing or
suppressing expression of FZD3 or a biologically active derivative
thereof. miR-31 (or miR-31 or its 5' or 3' isoforms or variants)
is, in accordance with this invention, a polynucleotide that is
capable of decreasing or suppressing expression of FZD3.
[0002] Accumulation of damage in cells and tissues has been
accepted as one of the major driving forces of aging and age
related diseases (Kirkwood, Cell (2005), 120: 437-474). One of the
repair systems on tissue level that counteracts this functional
decline are adult stem and progenitor cells. Their ability to
self-renew and differentiate is essential for homeostasis of
tissues and organs. As adult human stem and progenitor cells with
high differentiation potential have been identified in different
tissues of the human body they would represent a pool of cells that
should maintain high levels of tissue functionality. However, their
function also declines with age (Rando, Nature (2006), 441:
1080-1086). The old systemic environment has been identified to
contain factors that either fail to promote or actively inhibit
successful tissue regeneration when tested in a parabiosis mouse
model (Conboy, Nature (2005), 433: 760-764), while factors
contained in the systemic environment of young animals promote
successful tissue regeneration (Matsumoto, Eur Heart J (2009), 30:
346-355).
[0003] Visceral fat accretion is among the hallmarks of aging in
humans (Huffman, Biochem Biophys Acta (2009), 1790: 1117-1123),
while osteogenic differentiation potential of ASCs decreases with
age. This decrease is not due to a loss of osteogenic precursors
(Zhu, J Tissue Eng Regen Med (2009), 3: 290-301), suggesting that
factors altering the cellular behaviour are involved. Furthermore,
ASCs and endothelial cells are linked in vivo since preadipocytes
within adipose tissue depots and endothelial cells exhibit a close
relationships (Hausman, J Anim Sci (2004), 82: 925-934), supporting
a paracrine relationship between these cell types.
[0004] However, the source of these factors altering the cellular
behaviour was unknown so far and only scarce knowledge is available
on the identity of these factors, where Wnt and TGF-.beta.
signalling seem to be involved (Carlson, Aging Cell (2009), 8:
676-689). Besides various glands, one source of secretion into the
blood stream are endothelial cells per se and during older age,
senescent endothelial cells, since they accumulate during aging in
vivo, especially at sites of atherosclerosis (Erusalimsky, Handb
Exp Pharmacol (2006), 213-248; Erusalimsky, Exp Physiol (2009), 94:
299-304); Minamino, Circ Res (2007), 100: 15-26). Several proteins
that increase with senescence (Chang, Exp Cell Res (2005), 309:
121-136) have been identified, among them interleukin 8 that is
found at up to 50-fold higher levels in the supernatants of
senescent endothelial cells (Hampel, Exp Gerontol (2006), 41:
474-481).
[0005] One of the transport mechanisms in blood has been described:
various factors are packaged into exosomes, membrane-coated
particles that are secreted via exocytosis and play a role in
cell-cell or organ-organ communication by fusion with cells of
target tissues (Caby, Int Immunol (2005), 17: 879-887). Exosomes,
40-100 nm in size, are membrane vesicles of endosomal origin that
are released into the extracellular environment. They can act on
intercellular communication by allowing exchange of proteins,
lipids, and also mRNA and miRNAs between cells (Valadi, Nat Cell
Biol (2007), 9: 654-659; Viaud, PLoS One (2009), 4: e4942). The
contained factors like miRNAs, mRNAs and proteins then influence
the behaviour of the target cells. Examples are endothelial
progenitor cell derived exosomes that induce angiogenesis in
endothelial cells upon uptake (Deregibus, Blood (2007), 110:
2440-2448), endothelial-derived exosomes in patients with pulmonary
arterial hypertension (Bakouboula, Am J Respir Crit Care Med
(2008), 177: 536-543), ovarian carcinoma and glioblasotoma cells
that release exosomes and change the tissue microenvironment in
favour of tumor progression (Keller, Cancer Lett (2009), 278:
73-81; Skog, Nat Cell Biol (2008), 10: 1470-1476). Especially
exosomes released from tumour cells, which carry antigenic
molecules recognized by T cells, has suggested as a cell free
antigen source for anticancer vaccines (Escudier, J Transl Med
(2005), 3: 10; Iero, Cell Death Differ (2008), 15: 80-88; Morse, J
Transl Med (2005), 3: 9; Viaud, Horm Metab Res (2008), 40: 82-88;
Viaud, PLoS One (2009), 4: e49429).
[0006] However, mechanisms and factors involved in tissue
regeneration or in inhibiting the same are still poorly understood
and influencing the impact of such factors on tissue regeneration
is hardly possible.
[0007] This technical problem has been solved by the embodiments
provided herein and the solutions provided in the claims.
[0008] Accordingly, the present invention provides for a
composition comprising an inhibitor of a polynucleotide, said
polynucleotide to be inhibited being capable of decreasing or
suppressing expression of frizzled 3 (FZD3) or a biologically
active derivative thereof for use in treating or preventing bone
disorders and/or cardiovascular disorders in a subject as will be
further detailed and exemplified herein below. Also, the present
invention provides for a method for treating or preventing bone
disorders and/or cardiovascular disorders in a subject comprising
administering an effective amount of a composition comprising an
inhibitor of a polynucleotide, said polynucleotide to be inhibited
being capable of decreasing or suppressing expression of FZD3 or a
biologically active derivative thereof. A polynucleotide to be
inhibited in context of this medical intervention (i.e. the herein
disclosed medical/pharmaceutical uses) and the methods of
treating/preventing a disorder as provided herein may be miR-31 or
its 5' or 3' isoforms or variants. Furthermore, the present
invention provides for a composition for use in and a method for
diagnosing bone disorders and/or cardiovascular disorders in a
subject. In context of the present invention, examples for such
bone disorders are osteoporosis, osteopenia, bone fracture,
impaired bone homeostasis or. Examples for such cardiovascular
disorders are cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart failure and renal failure, as well as
atherosclerosis (Erusalimsky, J Appl Physiol (2009), 106: 326-32).
As described in the appended examples, it could also surprisingly
be shown that miR-31 is specifically elevated in stress-induced
senescent endothelial cells as well as exosomes of stress-induced
premature senescent endothelial cells. Accordingly, an
antagonist/inhibitor of miR-31 is also to be used in context of
this invention for the medical intervention of stress-related
cardiovascular disorders, like cardiovascular disorders due to
oxidative stress or hypoxia/reperfusion damage.
[0009] In accordance with the above and the experimental data
provided herein, the present invention relates to a composition
comprising an antagonist/inhibitor of a polynucleotide that is
capable of decreasing or suppressing expression of FZD3 or a
biologically active derivative thereof and/or an
antagonist/inhibitor of miR-31 or its 5' or 3' isoforms or variants
for use in treating or preventing bone disorders and/or
cardiovascular disorders in a subject. Preferably, said subject is
a human subject. Also provided is a method for treating or
preventing bone disorders and/or cardiovascular disorders in a
subject, said method comprising administering an effective amount
of a composition comprising an antagonist/inhibitor of a
polynucleotide that is capable of decreasing or suppressing
expression of FZD3 or a biologically active derivative thereof
and/or administering an effective amount of a composition
comprising an antagonist/inhibitor of miR-31 or its 5' or 3'
isoforms or variants. Again, also in this method of treatment the
most preferred subject to be treated is a human subject in need of
medical intervention.
[0010] In context of the present invention, it has surprisingly
been found how the senescent secretome and especially senescent
cell derived exosomes influence adult stem cells and, thus, tissue
regeneration. For this purpose, the present inventors investigated
two prime characteristics of such stem cells: self renewal/cell
division as well as differentiation potential. As models for
investigating a possible effect of the senescent endothelial
secretome on adult stem cells, adipose-tissue derived stem cells
(ASCs) were selected.
[0011] Furthermore, in context of the present invention it was
surprisingly found that senescent endothelial cells secrete miRNAs
packaged into exosomes, that these vesicles are taken up by target
cells suggesting a paracrine signalling function and that the
amount of specific miRNAs differs in young versus senescent
endothelial cells in vitro. As has been found in context of the
present invention, a microRNA (miRNA), miR-31, is markedly
increased in the supernatant of senescent cells, protected and
transported by exosomes, as well as in the blood of a subgroup of
elderly donors. Furthermore, in context of the present invention,
it has been found that miR-31 is taken up by ASCs by exposing them
to supernatant or purified exosomes of senescent endothelial cells
as well as by exposure to blood-derived exosomes of elderly
individuals.
[0012] In context with the present invention, the target of miR-31
that is responsible for osteogenic inhibition was identified as
frizzled-3 (FZD3), which so far has only been described as
important for the development of the neuronal system since FZD3
knock-out mice show defects in aconal growth and guidance (Endo,
Mol Cell Biol (2008), 28: 2368-2379; Stuebner, Dev Dyn (2010), 239:
246-260; Wang, J Neurosci (2006), 26: 2147-2156; Wang, J Neurosci
(2002), 22: 8563-8573; Wang, J Neurosci (2006), 26: 366-364).
Furthermore, it has been found herein that miR-31 inhibits
osteogenic differentiation and increases proliferation of ASCs.
These surprising findings show that polynucleotides decreasing or
suppressing expression of FZD3, like (but not limited to) miR-31,
represent a novel marker of biological age or of age-associated
diseases like osteoporosis, osteopenia, bone fracture or impaired
bone homeostasis or cardiovascular diseases such as stroke,
infarction, hypertension, thrombosis, vascular stenosis, coronary
syndromes, vascular dementia, heart failure and renal failure or
atherosclerosis and the like. Furthermore, antagonists/inhibitors
of polynucleotides that decrease or suppress the expression of
FZD3, like antagonists/inhibitors of miR-31 and/or of miR-31 or its
5' or 3' isoforms or variants represents novel therapeutics.
Accordingly, in particular miR-31 and/or of miR-31 or its 5' or 3'
isoforms or variants represent novel therapeutic targets in all
diseases that require osteogenesis and bone formation, such as
osteoporosis, osteopenia, bone fracture, impaired bone homeostasis,
bone cancer, etc. as well as in cardiovascular diseases such as
stroke, infarction, hypertension, thrombosis, vascular stenosis,
coronary syndromes, vascular dementia, heart and renal failure or
atherosclerosis. Examples of 3' and 5' iso forms of miR-31 are
shown in Table 3.
[0013] In context of the present invention, the functionality of
miR-31 delivery was tested on the proliferation and differentiation
capacity of ASCs. As has been found in context of the present
invention, the cell numbers reached within a batch were higher,
while osteogenic differentiation was partially inhibited by
senescent exosomes or miR-31 alone.
[0014] Furthermore, in context of the present invention it was
surprisingly found that miR-31 is upregulated significantly in sera
of elderly donors. This shows that exosomal delivery of miR-31 is
also found in the blood and not only in vitro during cellular
senescence. Furthermore, in context of the present invention, using
elderly blood-derived exosomes, inhibition of osteogenesis was
again observed. So far, miR-31 was not described to be present in
serum derived exosomes. Accordingly, in context of the present
invention, miR-31 is a valuable tool as a biomarker for aging and
age-associated such as osteoporosis, osteopenia, bone fracture or
impaired bone homeostasis or cardiovascular diseases such as
stroke, infarction, hypertension, thrombosis, vascular stenosis,
coronary syndromes, vascular dementia, heart and renal failure or
atherosclerosis.
[0015] Additionally, in context of the present invention, besides
the upregulation of miR-31 in elderly subjects, miR-31 was found to
be elevated in a first set of experiments in 2 out of 4 osteopenia
patients. In more detailed experiments as provided in the enclosed
examples, 7 out of 10 osteopenia patients either show a stable
disease or progression to osteoporosis where miR-31 was found in
blood serum. Furthermore, as shown in the appended examples,
inhibition of miR-31 improves osteogenic differentiation, while
transient increase of miR-31 results in decreased osteogenic
differentiation. This finding demonstrates that inhibition of
miR-31 improves osteoblast formation. This is very useful in the
medical invention of bone disorders, e.g., osteoporosis.
Furthermore, expression of miR-31 is indicative for such bone
disorders (and also for cardiovascular disorders). Therefore,
specific assays for the detection of miR-31 are also provided
herein. Such detection assays are preferably carried out on
biological samples, like serum and blood plasma and the like.
Osteoporosis is defined as a disease characterized by low bone mass
and structural deterioration of bone tissue, leading to bone
fragility and an increased susceptibility to fractures.
Osteoporosis is an age-related systemic condition that naturally
occurs among mammals, mainly in humans (Xu, Endocr Rev (2010),
31(4): 447-505). Accordingly, the present invention also provides
for a good and reliable biomarker for bone disorders, like
osteoporosis and/or osteopenia. The biomarker provided herein is
also useful in the diagnosis of cardiovascular disorders. The
appended examples also show that miR-31 is elevated in
stress-induced senescent endothelial cells. Furthermore, as shown
herein, miR-31 is elevated in exosomes of stress-induced premature
senescent endothelial cells. Accordingly, miR-31 is also indicative
for cardiovascular disorders.
[0016] Generally, in accordance with the present invention, when
referring to a polynucleotide to be inhibited in context of the
present invention, said polynucleotide is capable of decreasing or
suppressing expression of FZD3 or a biologically active derivative
thereof as described and exemplified in detail herein.
[0017] As could be demonstrated in the present invention, the
expression of FZD3 can be decreased or suppressed by
polynucleotides described herein contained in senescent exosomes,
e.g., by hybridizing to the mRNA of FZD3. Thereby, for instance,
degradation of or prevention of translation of FZD3 mRNA can be
induced, both resulting in suppression or decreasing of expression
of FZD3. Accordingly, inhibition of the polynucleotides described
herein which inhibit or suppress expression of FZD3 would increase
of expression of FZD3. In context of the present invention, ASCs
undergoing osteogenic differentiation were tested for FZD3
transcription. Indeed, it was upregulated after 4 days compared to
cells treated with control medium (FIG. 7A). Moreover, FZD3 levels
were significantly downregulated after treatment with senescent
exosomes compared to treatment with young exosomes and control
treated cells (FIG. 7B). 24 h after miR-31 transfection, FDZ3 was
also downregulated, but did not reach significant levels, which
might be explained due to the very low mRNA levels of FDZ3 when
cells are not differentiating (FIG. 7C). Thus, FZD3 represents not
only a marker but also a necessary factor for osteogenic
differentiation and turns out to be a direct target of
polynucleotides to be inhibited in context of the present invention
also in ASCs.
[0018] As described and exemplified in the present invention,
inhibition of the polynucleotides to be inhibited in context of the
present invention is particularly useful in the treatment or
prevention of osteoporosis, osteopenia, bone fracture or impaired
bone homeostasis or cardiovascular diseases such as stroke,
infarction, hypertension, thrombosis, vascular stenosis, coronary
syndromes, vascular dementia, heart and renal failure or
atherosclerosis in a subject.
[0019] In one embodiment of the present invention, the
polynucleotide to be inhibited in context of the present invention,
i.e. which is capable of decreasing or suppressing expression of
FZD3 or a biologically active derivative thereof (such as miR-31),
may be a microRNA (also abbreviated herein as miRNA or miR) or a
precursor thereof, a mimic microRNA or a precursor thereof, an
siRNA or a precursor thereof, a long non-coding RNA or a precursor
thereof, an snRNA (small/short hairpin RNA) or a precursor thereof,
an stRNA (small temporal RNA) or a precursor thereof, an fRNA
(functional RNA) or a precursor thereof, an snRNA (small nuclear
RNA) or a precursor thereof, a snoRNA (small nucleolar RNA) or a
precursor thereof, a piRNA (piwi-interacting RNA) or a precursor
thereof, a tasiRNA (trans-acting small/short interfering RNA) or a
precursor thereof, an aRNA (antisense RNA) or a precursor thereof,
or a small non-coding RNA or a precursor thereof. In accordance
with the present invention, as artificial polynucleotides mentioned
hereinabove may have the same effect on the expression of FZD3 or
biologically active derivatives thereof (i.e. decreasing or
suppressing said expression) as physiological polynucleotides
mentioned hereinabove, inhibitors of such artificial
polynucleotides may at the same time also be inhibitors of such
physiological polynucleotides. As used herein, "precursors" of a
polynucleotide to be inhibited in context of the present invention,
i.e. which is capable of decreasing or suppressing expression of
FZD3 or a biologically active derivative thereof, may be forms of
the respective polynucleotides as they occur during maturation of
the respective polynucleotides. For example, in context of the
present invention, precursors of a microRNA or a mimic microRNA may
be primary miRNAs (pri-miRNAs) or precursor miRNAs (pre-miRNAs) as
occurring during maturation of miRNAs. Both are single transcripts
(i.e. ssRNA) that fold into a characteristic intramolecular
secondary structure, the so-called "hairpin loop", which contains a
stretch of about 18 to 23 base pairs, which may be interrupted by
mismatches. In context of the present invention, precursors of
siRNAs may be long dsRNA molecules or shorter "hairpin loop" ssRNA
molecules. Both types of these siRNA precursors may contain a
stretch of base pairs without any mismatch. The current model for
maturation of mammalian miRNAs is nuclear cleavage of the primary
miRNA (pri-miRNA) which liberates a 60-70 nt stem loop
intermediate, known as the direct miRNA precursor or pre-miRNA. The
mature about 18-23 nt long miRNA is yielded from one arm of the
stem loop precursor (Bartel, Cell (2004), 116: 281-297; Lee, EMBO J
(2002), 21: 4663-4670; Zeng and Cullen, RNA (2003), 9: 112-123). In
a preferred embodiment of the present invention, the polynucleotide
to be inhibited in accordance with the present invention is a
microRNA or a precursor thereof or a mimic microRNA or a precursor
thereof. The polynucleotides described in and to inhibited in
context of the present invention may be of any length. Preferably,
the polynucleotide is about 15 to about 100 nucleotides in length,
more preferably about 18 to about 27 nucleotides and most
preferably about 20 to about 24 nucleotides.
[0020] In a specific embodiment of the present invention, the
polynucleotide to be antagonized/inhibited in context of the
present invention, i.e. the polynucleotide being capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof and/or the miR-31 miR-31 or its 5' or 3'
isoforms or variants to be antagonized/inhibited, may be selected
from the group consisting of: [0021] (a) a polynucleotide
comprising the nucleotide sequence of SEQ ID NO: 1 (i.e. miR-31);
[0022] (b) a polynucleotide which is at least 80% identical to the
polynucleotide of (a); [0023] (c) a polynucleotide comprising the
nucleotide sequence of SEQ ID NO: 2 (i.e. the seed sequence of
miR-31: GGCAAGAU); and [0024] (d) a polynucleotide according to (b)
comprising the nucleotide sequence of SEQ ID NO: 2 (i.e. the seed
sequence of miR-31: GGCAAGAU).
[0025] According to the present invention, identity levels of
polynucleotides refer to the entire length of the nucleotide
sequence of the referred to SEQ ID NOs. and is assessed pair-wise,
wherein each gap is to be counted as one mismatch. For example, the
term "identity" may be used herein in the context of a
polynucleotide to be inhibited in context of the present invention
which has a nucleic acid sequence with an identity of at least 80%,
85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or
consisting of the nucleotide sequence of any one of SEQ ID NO: 1
(mature miR-31), SEQ ID NO: 2 (seed sequence of miR-31), or SEQ ID
NO: 3 (pre-miR-31) as also shown in Table 1 herein, preferably over
the entire length. Furthermore, in the context of the present
invention, a polynucleotide to be inhibited in context of the
present invention may also have a nucleic acid sequence with an
identity of at least 80%, 85%, 90%, 95%, 97%, 98% or 99% to a
polynucleotide comprising or consisting of a nucleotide sequence
consisting of the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 as shown
in Table 1 herein including one, two or more nucleotide(s) of the
corresponding mature- or pre-miRNA sequence at the 5'-end and/or
the 3'-end of the respective seed sequence. For example, in the
context of the present invention, a polynucleotide to be inhibited
in context of the present invention may have a nucleic acid
sequence with an identity of at least 80%, 85%, 90%, 95%, 97%, 98%
or 99% to a polynucleotide comprising or consisting of the
nucleotide sequence AGGCAAGAUGC (i.e. the seed sequence of SEQ ID
NO: 1 including one nucleotide of the corresponding mature sequence
at the 5'-end and one nucleotide of the corresponding mature
sequence at the 3'-end). If two nucleic acid sequences being
compared by sequence comparisons differ in identity, then the term
"identity" refers to the shorter sequence and to the part of the
longer sequence that matches said shorter sequence. Therefore, when
the sequences which are compared do not have the same length, the
degree of identity preferably either refers to the percentage of
nucleotide residues in the shorter sequence which are identical to
consecutive nucleotide residues contained in the longer sequence or
to the percentage of consecutive nucleotides contained in the
longer sequence which are identical to the nucleotide sequence of
the shorter sequence. Of course, as described above, a gap as "part
of consecutive nucleotides" is to be counted as a mismatch. In this
context, the skilled person is readily in the position to determine
that part of a longer sequence that "matches" the shorter sequence.
Also, these definitions for sequence comparisons (e.g.,
establishment of "identity" values) are to be applied for all
sequences described and disclosed herein.
TABLE-US-00001 TABLE 1 miRNAs, miRBase ID (miRBase:
http://www.mirbase. org, version number 15: released April 2010),
and mature and pre-miR sequences (seed sequences underscored). SEQ
ID miRNA miRBase ID Sequence NO. mature MI0000089
AGGCAAGAUGCUGGCAUAGCU 1 miR-31 seed M10000089 GGCAAGAU 2 miR-31
pre- MI0000089 GGAGAGGAGGCAAGAUGCUGG 3 miR-31 CAUAGCUGUUGAACUGGGAAC
CUGCUAUGCCAACAUAUUGCCA UCUUUCC
TABLE-US-00002 TABLE 2 Examples for nucleic acid molecules that a
capable of hybridizing to the above identified miRNAs, seed
sequences and the like. miRNA Hybidizing Sequence SEQ ID NO. mature
AGCUAUGCCAGCAUCUUGCCU 6 miR-31 seed AUCUUGCC 7 miR-31 pre-
GGAAAGAUGGCAAUAUGUUGGCAUAGCAGG 8 miR-31
UUCCCAGUUCAACAGCUAUGCCAGCAUCUUG CCUCCUCUCC
[0026] As used herein, thymine (T) and uracil (U) may be used
interchangeably depending on the respective type of
polynucleotide.
[0027] Such hybridizing sequences (or functional fragments or
isoforms thereof) may be employed as specific
antagonists/inhibitors polynucleotide that is capable of decreasing
or suppressing expression of FZD3 or a biologically active
derivative thereof, and/or as specific antagonists/inhibitors an
antagonist/inhibitor of miR-31 or its 5' or 3' isoforms or
variants. Such hybridizing sequences (or functional fragments or
isoforms thereof) may hybridize to all kinds of polynucleotides to
be antagonized or inhibited as described herein, including
microRNAs, siRNAs, mimic microRNAs, long non-coding RNAs, snRNAs,
stRNAs, fRNAs, snRNAs, snoRNAs, piRNAs, tasiRNAs, aRNAs as well as
precursors of such RNAs.
TABLE-US-00003 TABLE 3 Examples of 5' and 3' isoforms of miR-31 SEQ
SEQ ID ID 5'-isoform NO. 3'-isoform NO. GAGGCAAGAUGCUGGCAUAG 9
UGCUAUGCCAACAUAUUGCCA 23 CU UC AGGCAAGAUGCUGGCAUAGC 10
UGCUAUGCCAACAUAUUGCCA 24 UG U AGGCAAGAUGCUGGCAUAGC 11
UGCUAUGCCAACAUAUUGCCA 25 UGU AGGCAAGAUGCUGGCAUAGC 12
UGCUAUGCCAACAUAUUGCCA 26 U UCU AGGCAAGAUGCUGGCAUAGC 13
GCUAUGCCAACAUAUUGCCAU 27 C AGGCAAGAUGCUGGCAUAG 14
CUAUGCCAACAUAUUGCCAUC 28 AGGCAAGAUGCUGGCAUAGC 15 UGUU
AGGCAAGAUGCUGGCAU 16 AGGCAAGAUGCUGGCAUA 17 AGGCAAGAUGCUGGCA 18
GGCAAGAUGCUGGCAUAGCU 19 G GGCAAGAUGCUGGCAUAGCU 20
GGCAAGAUGCUGGCAUAGCU 21 GUU GGCAAGAUGCUGGCAUAGCU 22 GU
[0028] As used herein, thymine (T) and uracil (U) may be used
interchangeably depending on the respective type of
polynucleotide.
[0029] Identity, moreover, means that there is preferably a
functional and/or structural equivalence between the corresponding
nucleotide sequences. Nucleic acid sequences having the given
identity levels to the particular nucleic acid sequences of the
polynucleotides to be inhibited in context of the present invention
may represent derivatives/variants of these sequences which,
preferably, have the same biological function. In context of the
present invention, the biological function of a polynucleotide to
be inhibited in context of the present invention is the ability to
decrease or suppress expression of FZD3 or a biologically active
derivative thereof, e.g., by hybridizing to the mRNA of FZD3,
thereby inducing degradation or preventing translation of the FZD3
mRNA. Whether the expression of FZD3 or a biologically active
derivative thereof has been decreased or suppressed can be easily
tested by methods well known in the art and as also described
herein. Examples of such methods suitable to determine whether the
expression of FZD3 or a biologically active derivative is decreased
or suppressed are polyacrylamide gel electrophoresis and related
blotting techniques such as Western Blot paired with chromogenic
dye-based protein detection techniques (such as silver or coomassie
blue staining) or with fluorescence- and luminescence-based
detection methods for proteins in solutions and on gels, blots and
microarrays, such as immunostaining, as well as
immunoprecipitation, ELISA, microarrays, and mass spectrometry. To
determine whether a given polynucleotide hybridizes to the mRNA of
FZD3 can also be tested by methods well known in the art and as
also described herein. Examples of such methods suitable to
determine whether a given polynucleotide hybridizes to another
nucleic acid (e.g., the mRNA of FZD3 or a biologically active
derivative thereof) are reporter gene assays in which commonly used
reporter genes are fluorescent proteins such as GFP, eGFP, YFP,
eYFP, BFP, eBFP, luminescent proteins such as the enzymes Renilla
or firefly luciferase, and .beta.-galactosidase encoded by the lacZ
gene (Inui, Nat Rev Mol Cell Biol (2010), 11: 252-63). Whether the
mRNA of FZD3 is degraded or its translation is prevented can also
be tested by methods known in the art and as also described herein.
Examples for methods suitable to determine whether an mRNA is
degraded are qPCR, RT-PCR, qRT-PCR, RT-qPCR, Light Cycler.RTM.,
TaqMan.RTM. Platform and Assays or quantigene assay (Zhou, Anal
Biochem (2000), 282: 46-53) Northern blot, dot blot, RNAse
protection assays, microarrays, next generation sequencing
(VanGuilder, Biotechniques (2008), 44(5): 619-26; Elvidge,
Pharmacogenomics (2006), 7: 123-134; Metzker, Nat Rev Genet (2010),
11: 31-46; Kafatos, NAR (1979), 7: 1541-1552).
[0030] The polynucleotides described herein, e.g. those to be
inhibited in context of the present invention may be either
naturally occurring variations, for instance sequences from other
varieties, species, etc., or mutations, and said mutations may have
formed naturally or may have been produced by deliberate
mutagenesis. Furthermore, the variations may be synthetically
produced sequences. The allelic variants may be naturally occurring
variants or synthetically produced variants or variants produced by
recombinant DNA, RNA, PNA, GNA, TNA or LNA techniques known in the
art. Deviations from the above-described nucleic acid sequences may
have been produced, e.g., by deletion, substitution, addition,
insertion of nucleotides and/or by recombination. The term
"addition" refers to adding at least one nucleic acid residue to
one or both ends of the given sequence, whereas "insertion" refers
to inserting at least one nucleic acid residue within a given
nucleotide sequence. The term "deletion" refers to deleting or
removal of at least one nucleic acid residue in a given nucleotide
sequence. The term "substitution" refers to the replacement of at
least one nucleic acid residue in a given nucleotide sequence. The
definitions for polynucleotides to be inhibited above and below
apply mutatis mutandis for all nucleic acid molecules and
polynucleotides provided and described herein including those
acting as an antagonist/inhibitor.
[0031] The polynucleotides described herein, e.g., those to be
inhibited in context of the present invention (i.e. polynucleotides
which decreases or suppresses expression of FZD3) or those acting
as antagonists/inhibitors, may be nucleic acid analogues such as
DNA molecules, RNA molecules, oligonucleotide thiophosphates,
substituted ribo-oligonucleotides, LNA molecules, PNA molecules,
GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid)
molecules, morpholino polynucleotides, or antagomir
(cholesterol-conjugated; for antagonists/inhibitors)
polynucleotides. Furthermore, in context of the present invention,
the term "polynucleotide" as well as the term "nucleic acid
molecule" may refer to nucleic acid analogues such as DNA
molecules, RNA molecules, oligonucleotide thiophosphates,
substituted ribo-oligonucleotides, LNA molecules, PNA molecules,
GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid)
molecules, morpholino polynucleotides, or antagomir
(cholesterol-conjugated; for antagonists/inhibitors)
polynucleotides or hybrids thereof or any modification thereof as
known in the art (see, e.g., U.S. Pat. No. 5,525,711, U.S. Pat. No.
4,711,955, U.S. Pat. No. 5,792,608 or EP 302175 for examples of
modifications). Nucleic acid residues comprised by the
polynucleotides may be naturally occurring nucleic acid residues or
artificially produced nucleic acid residues. Examples for nucleic
acid residues are adenine (A), guanine (G), cytosine (C), thymine
(T), uracil (U), xanthine (X), and hypoxanthine (HX). In context of
the present invention, thymine (T) and uracil (U) may be used
interchangeably depending on the respective type of polynucleotide.
For example, as the skilled person is aware of, a thymine (T) as
part of a DNA corresponds to an uracil (U) as part of the
corresponding transcribed mRNA. The polynucleotides may be single-
or double-stranded, linear or circular, natural or synthetic, and,
if not indicated otherwise, without any size limitation. For
instance, the polynucleotide to be inhibited in context of the
present invention may be a microRNA (miRNA) or a precursor thereof,
a mimic microRNA or a precursor thereof, an siRNA or a precursor
thereof, a long non-coding RNA or a precursor thereof, an snRNA
(small/short hairpin RNA) or a precursor thereof, an stRNA (small
temporal RNA) or a precursor thereof, an fRNA (functional RNA) or a
precursor thereof, an snRNA (small nuclear RNA) or a precursor
thereof, a snoRNA (small nucleolar RNA) or a precursor thereof, a
piRNA (piwi-interacting RNA) or a precursor thereof, a tasiRNA
(trans-acting small/short interfering RNA) or a precursor thereof,
an aRNA (antisense RNA) or a precursor thereof, or a small
non-coding RNA or a precursor thereof, genomic DNA, cDNA, mRNA,
ribozymal or a DNA encoding the before mentioned RNAs or
chimeroplasts (Gamper, Nucleic Acids Research (2000), 28,
4332-4339). As already described, as used herein, "precursors" of
the polynucleotides to be inhibited in context of the present
invention may be forms of the respective polynucleotides as they
occur during maturation of the respective polynucleotides. For
example, in context of the present invention, precursors of a
microRNA or a mimic microRNA may be primary miRNAs (pri-miRNAs) or
precursor miRNAs (pre-miRNAs) as occurring during maturation of
miRNAs. Both are single transcripts (i.e. ssRNA) that fold into a
characteristic intramolecular secondary structure, the so-called
"hairpin loop", which contains a stretch of about 18 to 23 base
pairs, which is often interrupted by mismatches. In context of the
present invention, precursors of siRNAs may be long dsRNA molecules
or shorter "hairpin loop" ssRNA molecules. Both types of these
siRNA precursors may contain a stretch of base pairs without any
mismatch. The current model for maturation of mammalian miRNAs is
nuclear cleavage of the primary miRNA (pri-miRNA) which liberates a
60-70 nt stem loop intermediate, known as the miRNA precursor or
pre-miRNA. The mature about 18-23 nt long miRNA is yielded from one
arm of the stem loop precursor (Bartel, Cell (2004), 116: 281-297;
Lee, EMBO J (2002), 21: 4663-4670; Zeng and Cullen, RNA (2003), 9:
112-123). Said polynucleotides may be in the form of a plasmid or
of viral DNA or RNA. Preferably, the polynucleotide to be inhibited
in context of the present invention is a microRNA or a mimic
microRNA.
[0032] In one embodiment, the polynucleotide to be inhibited in
context of the present invention comprises or consists of the
nucleotide sequence of any one of SEQ ID NO: 1 (mature miR-31), SEQ
ID NO: 2 (seed sequence of miR-31), or SEQ ID NO: 3 (pre-miR-31) as
also shown in Table 1 herein. Furthermore, a polynucleotide to be
inhibited in context of the present invention may also have a
nucleic acid sequence comprising or consisting of a nucleotide
sequence consisting of the seed sequence of SEQ ID NO: 1 or SEQ ID
NO: 3 as shown in Table 1 including one, two, three or more
nucleotide(s) of the corresponding mature- or pre-miR sequence at
the 5'-end and/or the 3'-end of the respective seed sequence. For
example, a polynucleotide to be inhibited in context of the present
invention may have a nucleic acid sequence comprising or consisting
of the nucleotide sequence [A] G-G-C-A-A-G-A-U [GC] (i.e. the seed
sequence of SEQ ID NO: 1 plus one nucleotide of the corresponding
mature miRNA sequence at the 5'-end and two nucleotides of the
corresponding mature miRNA sequence at the 3'-end) or [A]
G-G-C-A-A-G-A-U [G] (i.e. the seed sequence of SEQ ID NO: 1 plus
one nucleotide of the corresponding mature sequence at the 5'-end
and one nucleotide of the corresponding mature sequence at the
3'-end). Polynucleotides to be inhibited in context of the present
invention (i.e. polynucleotides which decrease or suppress
expression of FZD3) may also comprise or consist of the nucleotide
sequence shown in any one of SEQ ID NO: 1 (mature miR-31), SEQ ID
NO: 2 (seed sequence of miR-31), or SEQ ID NO: 3 (pre-miR-31) as
also shown in Table 1 herein, wherein one, two, three, four, five
or more nucleotides are added, deleted or substituted. Furthermore,
a polynucleotide to be inhibited in context of the present
invention may also have a nucleic acid sequence comprising or
consisting of the nucleotide a nucleotide sequence consisting of
the seed sequence of SEQ ID NO: 1 or SEQ ID NO: 3 as shown in Table
1 including one, two, three or more nucleotide(s) of the
corresponding mature- or pre-miR sequence at the 5'-end and/or the
3'-end of the respective seed sequence, wherein one, two, three,
four, five or more nucleotides are added, deleted or substituted.
For example, a polynucleotide to be inhibited in context of the
present invention may have a nucleic acid sequence comprising or
consisting of the nucleotide sequence [A] G-G-C-A-A-G-A-U [U] (i.e.
the seed sequence of SEQ ID NO: 1 plus one nucleotide of the
corresponding mature sequence at the 5'-end and one nucleotide of
the corresponding mature sequence at the 3'-end, wherein the
nucleotide at the 3'-end has been substituted by U). Preferably,
said addition, deletion or substitution of one, two, three, four,
five or more nucleotides is not effected within the seed sequence
of a polynucleotide as shown in Table 1 herein. Also, the
polynucleotide to be inhibited in context of the present invention
may comprise or consist of a polynucleotide being at least 80%,
85%, 90%, 95%, 97%, 98% or 99% identical to a polynucleotide
comprising or consisting of the nucleotide sequence of any one of
SEQ ID NO: 1 (mature miR-31), SEQ ID NO: 2 (seed sequence of
miR-31) or SEQ ID NO: 3 (pre-miR-31) as also shown in Table 1
herein. Furthermore, a polynucleotide to be inhibited in context of
the present invention may also comprise or consist of a nucleic
acid sequence with an identity of at least 80%, 85%, 90%, 95%, 97%,
98% or 99% to a polynucleotide comprising or consisting of a
nucleotide sequence consisting of the seed sequence of SEQ ID NO: 1
or SEQ ID NO: 3 as shown in Table 1 including one, two or more
nucleotide(s) of the corresponding mature- or pre-miR sequence at
the 5'-end and/or the 3'-end of the respective seed sequence. For
example, a polynucleotide to be inhibited in context of the present
invention may comprise or consist of a nucleic acid sequence with
an identity of at least 80%, 85%, 90%, 95%, 97%, 98% or 99% to a
polynucleotide comprising or consisting of the nucleotide sequence
G-G-C-A-A-G-A-U [GC] (i.e. the seed sequence of SEQ ID NO: 1 plus
two nucleotides of the corresponding mature sequence at the
3'-end). Additionally, a polynucleotide to be inhibited in context
of the present invention may also comprise or consist of a nucleic
acid sequence with an identity of at least 80%, 85%, 90%, 95%, 97%,
98% or 99% to a polynucleotide comprising or consisting of the
nucleotide sequence of any one of SEQ ID NO: 1 (mature miR-31) or
SEQ ID NO: 3 (pre-miR-31) as also shown in Table 1 herein and
comprise the nucleic acid sequence as shown in SEQ ID NO: 2 (seed
sequence of miR-31) as shown in Table 1 herein.
[0033] Generally, as used herein, a polynucleotide comprising the
nucleic acid sequence of a sequence provided herein may also be a
polynucleotide consisting of said nucleic acid sequence. In one
embodiment, the polynucleotide to be inhibited in context of the
present invention has the nucleic acid sequence as shown in SEQ ID
NO: 1.
[0034] In context of the determination whether two given nucleic
acid molecules are able to hybridize, e.g., whether a
polynucleotide to be inhibited in context of the present invention
hybridizes to an mRNA of FZD3 or a biologically active derivative
thereof, or whether an inhibitor described in and used in
accordance with the present invention hybridizes to a
polynucleotide to be inhibited in context of the present invention,
the hybridization may occur and be detected under physiological or
artificial conditions, under stringent or non-stringent conditions.
Said hybridization conditions may be established according to
conventional protocols described, for example, in Sambrook, Russell
"Molecular Cloning, A Laboratory Manual", Cold Spring Harbor
Laboratory, N.Y. (2001); Ausubel, "Current Protocols in Molecular
Biology", Green Publishing Associates and Wiley Interscience, N.Y.
(1989), or Higgins and Hames (Eds.) "Nucleic acid hybridization, a
practical approach" IRL Press Oxford, Washington D.C., (1985). The
setting of conditions is well within the skill of the artisan and
can be determined according to protocols described in the art.
Thus, the detection of only specifically hybridizing sequences will
usually require stringent hybridization and washing conditions such
as 0.1.times.SSC, 0.1% SDS at 65.degree. C. Non-stringent
hybridization conditions for the detection of homologous or not
exactly complementary sequences may be set at 6.times.SSC, 1% SDS
at 65.degree. C. As is well known in the art, the length of the
probe and the composition of the nucleic acid to be determined
constitute further parameters of the hybridization conditions.
Variations in the above conditions may be accomplished through the
inclusion and/or substitution of alternate blocking reagents used
to suppress background in hybridization experiments. Typical
blocking reagents include Denhardt's reagent, BLOTTO, heparin,
denatured salmon sperm DNA, and commercially available proprietary
formulations. The inclusion of specific blocking reagents may
require modification of the hybridization conditions described
above, due to problems with compatibility. In accordance to the
invention described herein, low stringent hybridization conditions
for the detection of homologous or not exactly complementary
sequences may, for example, be set at 6.times.SSC, 1% SDS at
65.degree. C. As is well known in the art, the length of the probe
and the composition of the nucleic acid to be determined constitute
further parameters of the hybridization conditions. Polynucleotides
to be inhibited in context of the present invention which hybridize
to the mRNA of FZD3 or a biologically active derivative thereof
also comprise fragments of the above described polynucleotides
which are to be inhibited in context of the present invention. Such
fragments preferably are polynucleotides which are able to decrease
or suppress expression of FZD3 or a biologically active derivative
thereof. Such fragments may be, e.g., polynucleotides such as
siRNAs or siRNA pools consisting of 4 siRNAs targeting the mRNA of
FZD3 as can be purchased from Dharmacon (on-target plus smart-pool
L-005502-00-0005, NM.sub.--017412). Furthermore, a hybridization
complex refers to a complex between two nucleic acid sequences by
virtue of the formation of hydrogen bonds between complementary G
and C bases and between complementary A and T (or U, respectively)
bases; these hydrogen bonds may be further stabilized by base
stacking interactions. A hybridization complex may be formed in
solution (e.g., Cot or Rot analysis) or between one nucleic acid
sequence present in solution and another nucleic acid sequence
immobilized on a solid support (e.g., membranes, filters, chips,
pins or glass slides to which, e.g., cells have been fixed). The
terms complementary or complementarity refer to the natural binding
of polynucleotides under permissive salt and temperature conditions
by base-pairing. For example, the sequence "A-G-T (or U,
respectively)" binds to the complementary sequence "T (or U,
respectively)-C-A". Complementarity between two single-stranded
molecules may be "partial", in which only some of the bases of the
nucleic acids bind, or it may be complete when total
complementarity exists between single-stranded molecules. The
degree of complementarity between nucleic acid strands has
significant effects on the efficiency and strength of hybridization
between nucleic acid strands.
[0035] In order to determine whether two nucleic acid molecules
hybridize, e.g., whether a given polynucleotide hybridizes to the
mRNA of FZD3 or a biologically active derivative thereof as
described herein, thereby inducing degradation or preventing
translation of said mRNA of FZD3 or a biologically active
derivative thereof, or whether an inhibitor described in and used
in accordance with the present invention hybridizes to a
polynucleotide to be inhibited in context of the present invention,
various tests known in the art and also described herein may be
applied. In this context, the hybridization may occur and be tested
under physiological conditions or under artificial conditions as
known in the art and also described herein. For example, a test to
determine hybridization between an miRNA and an mRNA may be a
Luciferase Assay as also described herein and in technical
bulletins by Promega (C8021 (psiCHECK-2 Vector), E1960
(Dual-Luciferase.RTM. Reporter Assay System)). In context of the
present invention, general examples of methods suitable to
determine whether a polynucleotide hybridizes to another nucleic
acid (e.g., the 3'UTR of the mRNA of FZD3) are reporter gene assays
in which common reporter genes are used such as fluorescent
proteins (e.g., GFP, eGFP, YFP, eYFP, BFP, or eBFP), or luminescent
proteins (e.g., Renilla or firefly luciferase, or
.beta.-galactosidase encoded by the lacZ gene). Furthermore,
degradation of mRNA or the level of the respective translation
product (to test whether the translation of the mRNA was decreased
or prevented) can easily be examined by methods known in the art.
Examples for methods suitable to examine degradation or
stabilization of mRNA are qPCR, RT-PCR, qRT-PCR, RT-qPCR, Light
Cycler.RTM., TaqMan.RTM. Platform and Assays, Northern blot, dot
blot, microarrays, next generation sequencing (VanGuilder,
Biotechniques (2008), 44: 619-26; Elvidge, Pharmacogenomics (2006),
7: 123-134; Metzker, Nat Rev Genet (2010), 11: 31-46). Examples for
methods suitable to examine whether the translation of a mRNA has
been prevented or decreased are polyacrylamide gel electrophoresis
and related blotting techniques such as Western Blot paired with
chromogenic dye-based protein detection techniques (such as silver
or coomassie blue staining) or with fluorescence- and
luminescence-based detection methods for proteins in solutions and
on gels, blots and microarrays, such as immunostaining, as well as
immunoprecipitation, ELISA, microarrays, and mass spectrometry
(Western Blot (Burnette, Anal Biochem (1981) 112: 195-203) or ELISA
(Crowther, J A. The ELISA Guidebook. Humana Press; Totowa, N.J.:
2001).
[0036] In context of the present invention, in order to determine
whether a given polynucleotide decreases or suppresses expression
of FZD3 or a biologically active derivative thereof (e.g., by
hybridizing to the mRNA of FZD3 and thereby inducing degradation or
preventing translation of FZD3 mRNA), the level of expressed FZD3
can be easily detected. In context of the present invention, a
polynucleotide is to be assessed as decreasing or suppressing
expression of FZD3 or a biologically active derivative thereof if
the detected level of expressed FZD3 in a test sample which was
contacted with a polynucleotide to be tested is at least 1.5 fold,
preferably at least 1.75 fold, more preferably at least 2.0 fold,
and most preferably at least 2.5 fold lower than the FZD3
expression level of a control sample which was not contacted with
the polynucleotide. For example, a Western blot analysis can be
performed for FZD3 protein detection.
[0037] Furthermore, in one embodiment, the polynucleotides to be
inhibited in context of the present invention may hybridize to the
3'UTR (untranslated region) of the mRNA of FZD3 or a biologically
active derivative thereof or to fragments of said 3'UTR.
Hybridization between a polynucleotide to be inhibited in context
of the present invention and the 3'UTR of the mRNA of FZD3 or a
biologically active derivative thereof can easily be tested as
described hereinabove. Preferably, by hybridizing to the 3'UTR of
the mRNA of FZD3 or a biologically active derivative thereof or to
fragments of said 3'UTR, the polynucleotide to be inhibited in
context of the present invention induces degradation of or prevents
translation of said mRNA of FZD3 or a biologically derivative
thereof. Generally, in context of the present invention, when
referring to FZD3, reference is made to GenBank Accession No.
NM.sub.--017412, Version No. 177 (released on Apr. 15, 2010). The
sequence of the 3'UTR of FZD3 mRNA is shown in SEQ ID NO: 4 herein.
In one embodiment, the polynucleotide to be inhibited in context of
the present invention is able to hybridize to a nucleic acid
sequence comprising nucleotides 3419-3426 of SEQ ID NO: 4,
preferably thereby inducing degradation of or prevention of
translation of the mRNA of FZD3 or a biologically derivative
thereof.
[0038] The polynucleotide to be inhibited in context of the present
invention may be comprised in lipid composition, an exosome, a
vesicular body, a liposome, in PEI (polyethylene imine) or
atellocollagen. Also, in accordance with the present invention, the
antagonist/inhibitor of a polynucleotide to be inhibited (i.e. that
is capable of decreasing or suppressing expression of FZD3 or a
biologically derivative thereof) may be comprised in a lipid
composition, an exosome or a liposome. For example, an
antagonist/inhibitor may be an antagonist/inhibitor of miR-31 or
its 3' or 5' isoforms or variants as described herein. Examples for
3' and 5' isoforms of miR-31 are shown in Table 3. The present
invention also relates to such lipid compositions, exosomes and
liposomes for use in the medical interventions described herein,
e.g., for use in treating or preventing bone disorders and/or
cardiovascular disorders such as osteoporosis, osteopenia, bone
fracture, impaired bone homeostasis, or cardiovascular diseases
such as stroke, infarction, hypertension, thrombosis, vascular
stenosis, coronary syndromes, vascular dementia, heart and renal
failure or atherosclerosis in a subject.
[0039] As used herein, a biologically active derivative of FZD3
means that is has the same biological function as FZD3, i.e. it is
able to transduce signals via the PI3K-AKT pathway (Kawasaki, Cell
Signal (2007), 19: 2498-506). In context of the present invention,
in order to validate whether a given compound is a biologically
derivative of FDZ3, the phosphorylation status of its downstream
target AKT can be tested. For this purpose, ASCs, bone marrow
derived stem cells, or any other cell type that has the ability to
undergo osteogenic differentiation, may be treated with compounds
to be tested for FZD3-activity for different times and with
different doses, or the cells may be transfected with plasmids
coding for compounds to be tested for FZD3-activity. Then, cell
lysates may be prepared by methods known in the art. This can be
done, for example, by using cell lysis buffer (20 mM Tris-HCl (pH
7.5)), 12 mM (3-glycerophosphate, 150 mM NaCl, 5 mM EGTA, 10 mM
sodium fluoride, 1% Triton X-100, 1% sodium deoxycholate, 1 mM
dithiothreitol (DTT), 1 mM sodium orthovanadate, protease inhibitor
cocktail (Roche, Switzerland), phosphatase inhibitor cocktail 1 and
2 (Sigma, St. Louis, Mo.). Subsequently, an analysis of
phosphorylated proteins may be performed by methods known in the
art, e.g., by immunoblot analyses. As an illustrative example for
carrying out an immunoblot analysis, 30 .mu.g of total proteins may
be subjected to SDS-PAGE and blotted on polyvinylidene difluoride
membranes (e.g., PVDF). The membranes may then be probed with
anti-phospho-Akt (Ser473) antibody (Cell Signalling, Danvers, 9271)
(1:500), and anti-phospho-Akt (Thr308) antibody (Cell Signalling,
Danvers, 9272) (1:500). As positive control, overexpression of FZD3
can be used. As negative controls, specific PI3K inhibitors like
Wortmannin or LY294002 can be used that are known to prevent AKT
phosphorylation. In context of the present invention, if AKT is
phosphorylated to an extent of more than 40% or more than 50%
compared to untreated cell controls, the compound rested can be
considered a biologically active derivative of FZD3. The nucleic
acid sequence of the 3'UTR of the mRNA of a FZD3 derivative in
context of the present invention may be at least 80%, 85%, 90%, 95%
or 98% identical to SEQ ID NO: 4.
[0040] As already mentioned, the present invention relates to a
composition comprising an inhibitor of a polynucleotide or
polynucleotides to be inhibited, i.e. which are capable of
decreasing or suppressing expression of FZD3 or a biologically
derivative thereof for use in treating or preventing bone disorders
and/or cardiovascular disorders such as osteoporosis, osteopenia,
bone fracture, impaired bone homeostasis, or cardiovascular
diseases such as stroke, infarction, hypertension, thrombosis,
vascular stenosis, coronary syndromes, vascular dementia, heart and
renal failure or atherosclerosis in a subject. The composition may
also comprise an exosome and/or a liposome which contain an
antagonist/inhibitor of a polynucleotide that is capable of
decreasing or suppressing expression of FZD3 or a biologically
derivative thereof and/or which contain an antagonist/inhibitor of
miR-31 or its 3' or 5' isoforms or variants.
[0041] In accordance with the present invention, the subject to be
treated or in which a bone disorder and/or cardiovascular disorder
such as osteoporosis, osteopenia, bone fracture, impaired bone
homeostasis, or cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart and renal failure or atherosclerosis is to
be prevented may be mammalian. In a preferred embodiment of the
present invention, the subject is human.
[0042] Generally, the composition to be used in context of the
present invention may comprise an antagonist/inhibitor or
exosome/liposome containing said antagonist/inhibitor which
inhibits one, two, three or more of the polynucleotides to be
inhibited in context of the present invention. Also, the
composition may comprise two, three or more antagonists/inhibitors
or exosomes/liposomes, wherein each of the antagonist/inhibitors is
capable of inhibiting one, two, three or more of the
polynucleotides to be inhibited in context of the present
invention.
[0043] The composition described herein and to be employed in
context with the present invention may contain the
antagonist/inhibitor or exosome/liposome described herein in an
amount of about 1 ng/kg body weight to about 100 mg/kg body weight
of the subject which is to be treated or in which a bone disorder
and/or cardiovascular disorder such as osteoporosis, osteopenia,
bone fracture, impaired bone homeostasis, or cardiovascular
diseases such as stroke, infarction, hypertension, thrombosis,
vascular stenosis, coronary syndromes, vascular dementia, heart and
renal failure or atherosclerosis is to be prevented. In a preferred
embodiment of the present invention, the composition comprises the
inhibitor in an amount of about 1 .mu.g/kg body weight to about 20
mg/kg body weight, more preferably 1 mg/kg body weight to about 10
mg/kg body weight.
[0044] The composition described herein and to be employed in
context of the present invention may further comprise a
pharmaceutically acceptable carrier. Accordingly, the present
invention also relates to a pharmaceutical composition comprising
an antagonist/inhibitor of a polynucleotide or polynucleotides to
be inhibited in context of the present invention, an
antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or
variants, and/or an exosome or liposome containing said
antagonist/inhibitor and further comprising a pharmaceutically
acceptable carrier, excipient and/or diluent. Generally, examples
of suitable pharmaceutical carriers are well known in the art and
include phosphate buffered saline solutions, water, emulsions, such
as oil/water emulsions, various types of wetting agents, sterile
solutions etc. Compositions comprising such carriers can be
formulated by well known conventional methods. These pharmaceutical
compositions can be administered to the subject at a suitable dose,
i.e. about 1 ng/kg body weight to about 100 mg/kg body weight of
the subject which is to be treated or in which bone disorders
and/or cardiovascular disorders such as osteoporosis, osteopenia,
bone fracture, impaired bone homeostasis, or cardiovascular
diseases such as stroke, infarction, hypertension, thrombosis,
vascular stenosis, coronary syndromes, vascular dementia, heart and
renal failure or atherosclerosis are to be prevented. In a
preferred embodiment of the present invention, the composition
comprising an inhibitor of a polynucleotide or polynucleotides to
be inhibited in context of the present invention comprises the
inhibitor in an amount of about 1 .mu.g/kg body weight to about 20
mg/kg body weight, more preferably 1 mg/kg body weight to about 10
mg/kg body weight. Administration of the composition may be
effected or administered by different ways, e.g., enterally, orally
(e.g., pill, tablet (buccal, sublingual, orally, disintegrating,
capsule, thin film, liquid solution or suspension, powder, solid
crystals or liquid), rectally (e.g., suppository, enema), via
injection (e.g., intravenously, subcutaneously, intramuscularly,
intraperitoneally, intradermally) via inhalation (e.g.,
intrabronchially), topically, vaginally, epicutaneously, or
intranasally. In context of the present invention, compositions
comprising exosomes or liposomes containing an antagonist/inhibitor
of a polynucleotide capable of decreasing or suppressing expression
of FZD3 or a biologically derivative thereof and/or an
antagonist/inhibitor of miR-31 or its 3' or 5' isoforms or variants
may be applied locally or systemically. When applied locally, e.g.
directly at a defect site of a bone, the composition comprising an
exosome/liposome is particularly for use in treating bone disorders
such as osteoporosis, osteopenia, bone fracture or impaired bone
homeostasis. Methods for applying such compositions directly to a
bone are known in the art (Takeshita, Mol Ther (2010), 18:
181-187). When applied systemically (e.g., parenterally, orally or
other routes described herein), said composition may be used for
treating or preventing bone disorders and/or cardiovascular
disorders as described herein. It is understood that also the
antagonists/inhibitors described herein may be administered locally
or systemically by other means, even directly. The dosage regimen
will be determined by the attending physician and clinical factors.
As is well known in the medical arts, dosages for any one patient
depends upon many factors, including the patient's size, body
surface area, age, the particular compound to be administered, sex,
time and route of administration, general health, and other drugs
being administered concurrently. The compositions described herein
may be administered locally or systemically. Systemic
administration will preferably be parenterally, e.g.,
intravenously. The composition may also be administered directly to
the target site, e.g., by biolistic delivery to an internal or
external target site or by catheter to a site in an artery.
Preparations for parenteral administration include sterile aqueous
or non-aqueous solutions, suspensions, and emulsions. Examples of
non-aqueous solvents are propylene glycol, polyethylene glycol,
vegetable oils such as olive oil, polyethylene imine and injectable
organic esters such as ethyl oleate. Aqueous carriers include
water, alcoholic/aqueous solutions, emulsions or suspensions,
including saline and buffered media. Parenteral vehicles include
sodium chloride solution, Ringer's dextrose, dextrose and sodium
chloride, lactated Ringer's, or fixed oils. Intravenous vehicles
include fluid and nutrient replenishers, electrolyte replenishers
(such as those based on Ringer's dextrose), and the like.
Preservatives and other additives may also be present such as, for
example, antimicrobials, anti-oxidants, chelating agents, and inert
gases and the like. Furthermore, also doses below or above of the
exemplary ranges described hereinabove are envisioned, especially
considering the aforementioned factors.
[0045] As already mentioned, the compositions described herein
comprising an antagonist/inhibitor of a polynucleotide or
polynucleotides to be inhibited in context of the present invention
being capable of decreasing or suppressing expression of FZD3 or a
biologically derivative thereof, an antagonist/inhibitor of miR-31
or its 3' or 5' isoforms or variants, and/or an exosome/liposome
containing said antagonist/inhibitor may be used to treat or
prevent bone disorders and/or cardiovascular disorders such as
osteoporosis, osteopenia, bone fracture, impaired bone homeostasis,
or cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart and renal failure or atherosclerosis in a
subject.
[0046] In context of the present invention, an antagonist/inhibitor
of a polynucleotide or polynucleotides to be inhibited in
accordance with the present invention may be a nucleic acid
molecule, a polypeptide or any other compound capable of
antagonizing/inhibiting the polynucleotides to be inhibited in
context of the present invention. For example, the
antagonist/inhibitor to be employed in context of the present
invention is an antagonist/inhibitor of miR-31 or its 5' or 3'
isoforms or variants. An antagonist/inhibitor to be employed in
context of the present invention may be a nucleic acid molecule
capable of hybridizing to the polynucleotide to be inhibited. As
described herein, nucleic acid molecules comprise all kinds of
nucleotide molecules such as DNA molecules, RNA molecules,
oligonucleotide thiophosphates, substituted ribo-oligonucleotides,
LNA molecules (Orom, Gene (2006), 10(372), 137-141), PNA molecules,
GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid)
molecules, morpholino polynucleotides, or antagomir
(cholesterol-conjugated) polynucleotides as well as modifications
thereof. The antagonist/inhibitor may hybridize to said
polynucleotide to be inhibited under stringent or non-stringent
conditions as described herein (for hybridization conditions for
short sequences, see below), preferably under stringent conditions.
Methods for determining and evaluating hybridization between
nucleic acid molecules are well known in the art and are also
described herein above and below. Preferably, in accordance with
the present invention, by hybridizing to a polynucleotide to be
inhibited in context of the present invention, the
antagonist/inhibitor prevents said polynucleotide to be inhibited
from decreasing or suppressing expression of FZD3 or a biologically
derivative thereof, e.g., by hybridization of said polynucleotide
with the mRNA (e.g., the 3'UTR thereof) of FZD3 or a biologically
derivative thereof. Methods for determining and evaluating the
capability of a polynucleotide to decrease or suppress the
expression of FZD3 or a biologically active derivative thereof as
well as methods for determining or evaluating whether the
expression level of FZD3 is decreased or suppressed are described
herein. Accordingly, a given compound can be assessed as an
antagonist/inhibitor to be employed in context of the present
invention if it is able to prevent hybridization of a
polynucleotide to be inhibited in context of the present invention
with the mRNA (e.g., the 3'UTR thereof) of FZD3 or a biologically
derivative thereof. Accordingly, in context of the present
invention, an antagonist/inhibitor may be able to at least
partially reverse the effect of a polynucleotide to be inhibited in
context of the present invention on the expression of FZD3 or a
biologically active derivative thereof. For example, the
antagonist/inhibitor to be employed in context of the present
invention may be capable of reversing the effect of a
polynucleotide to be inhibited on FZD3-expression by 50% or more,
preferably by 60% or more, more preferably by 70% or more, more
preferably by 80% or more, more preferably by 90% or more, more
preferably by 95% or more, more preferably by 98% or more, and most
preferably by 99% or more. That is, e.g., if a polynucleotide to be
inhibited in context of the present invention is capable of
decreasing or suppressing the expression of FZD3 or a biologically
derivative thereof such as it amounts to an expression level of 50%
compared to the normal expression level (i.e. without said
polynucleotide), and the expression level increases by applying an
inhibitor as described herein such that the expression level of
FZD3 or a biologically derivative thereof increases to an amount of
75% compared to the normal expression level (i.e. without said
polynucleotide), the effect of said polynucleotide is reversed by
said inhibitor by 50%.
[0047] In one embodiment of the present invention, the
antagonist/inhibitor of a polynucleotide to be inhibited in context
of the present invention is a nucleic acid molecule which is
capable of hybridizing to said polynucleotides to be inhibited,
preferably under stringent conditions as described herein, thereby
preventing said polynucleotide from hybridizing to the mRNA (e.g.,
the 3'UTR thereof) of FZD3 or a biologically active derivative
thereof. The hybridization of said nucleic acid to be employed as
an antagonist/inhibitor to a polynucleotide to be inhibited in
context of the present invention may be over the entire length of
said polynucleotide to be inhibited or only over a part of the
sequence of said polynucleotide to be inhibited, e.g., over at
least 80%, at least 85%, at least 90%, at least 95%, at least 96%,
at least 97%, at least 98% or at least 99% of the sequence of said
polynucleotide to be inhibited. In one embodiment of the present
invention, the antagonist/inhibitor to be employed in context of
the present invention may be an antisense oligonucleotide which is
complementary to a polynucleotide to be inhibited in context of the
present invention. Preferably, in accordance with the present
invention, an antagonist/inhibitor to be employed in context of the
present invention is an antisense oligonucleotide which comprises
or consists of a nucleic acid molecule having a sequence
complementary to any one of the sequences as shown in Table 1
hereinabove, e.g., to any one of SEQ ID NOs. 1 to 3. For example,
such antisense oligonucleotides may comprise or consist of a
nucleotide sequence of any one of SEQ ID NOs. 5 to 8. Generally,
antagonists/inhibitors of miRNAs or siRNAs are well known in the
art and customized miRNA- or siRNA-inhibitors are commercially
available. For example, antagonists/inhibitors of polynucleotides
to be inhibited in context of the present invention may be nucleic
acid molecules such as antagomiRs (Krutzfeldt, Nature (2005), 438:
685-689) or any other 2'-O-methyl-RNA oligonucleotide having
phosphorothioates bonds and a cholesterol tail, miRCURY LNA.TM.
microRNA inhibitors (Exiqon), in vivo LNA.TM. miR inhibitors
(Exiqon), tiny LNAs (Obad, Nat Genet (2011), 43(4): 371-378),
miR-decoys or miR-sponges (Ebert, Nat Methods (2007), 4: 721-726;
Bonci, Nat Med (2008), 14: 1271-1277) or the like which are capable
of antagonizing/inhibiting a polynucleotide to be inhibited in
context of the present invention as described hereinabove, e.g., by
hybridizing to said polynucleotide. An antagonist/inhibitor might
also be or derive from miRNA degrading enzymes as described in
Chatterjee, Nature (2009), 461: 546-9, hammerhead ribozymes as
described in Tedeschi, Drug Discov Today (2009), 14: 776-783, or
antogomirzymes as described in Jadhav, Angew Chem Int Ed Engl
(2009), 48(14): 2557-2560. An example of an miRCURY LNA.TM.
microRNA inhibitor in context of the present invention is
anti-miR-31 LNA as shown in SEQ ID NO: 5. In context of the present
invention, the antagmoiRs, miCURY LNA.TM. microRNA inhibitors, in
vivo LNA.TM. miR inhibitors, tiny LNAs, miR decoys or miR sponges
may comprise a nucleic acid molecule or include a nucleic acid
sequence selected from the group consisting of [0048] (a) a nucleic
acid sequence being or comprising SEQ ID NO: 5; [0049] (b) a
nucleic acid sequence being or comprising SEQ ID NO: 6; [0050] (c)
a nucleic acid sequence being or comprising SEQ ID NO: 7; [0051]
(d) a nucleic acid sequence being or comprising SEQ ID NO: 8; and
[0052] (e) a nucleic acid sequence which is at least 90% or at
least 95% identical to the nucleic acid sequence of any one of (a)
to (d).
[0053] As mentioned, such antagonists/inhibitors may hybridize or
bind to all kinds of polynucleotides to be inhibited as described
herein, including microRNA, siRNA, mimic microRNA, long non-coding
RNAs, snRNA, stRNA, fRNA, snRNA, snoRNA, piRNA, tasiRNA, aRNA and
precursors of such polynucleotides.
[0054] The present invention relates to a composition comprising a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the sequence shown in SEQ ID
NO: 1, thereby preventing hybridization of said polynucleotide with
the mRNA of FZD3, for use in treating or preventing bone disorder,
like osteoporosis or cardiovascular disease, like atherosclerosis
in a human subject.
[0055] The present invention relates to a composition comprising a
nucleic acid molecule which hybridizes under stringent conditions
to miR-31 or its 3' or 5' isoforms or variants, thereby preventing
hybridization of miR-31 or its 3' or 5' isoforms or variants with
the mRNA of FZD3, for use in treating or preventing osteoporosis or
atherosclerosis in a human subject. Said nucleic acid molecule may
be an antagomiR, a miCURY LNA.TM. microRNA inhibitor, an in vivo
LNA.TM. miR inhibitor, a miR decoy or a miR sponge as described
herein.
[0056] The present invention relates to a composition comprising a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the sequence shown in SEQ ID
NO: 2, thereby preventing hybridization of said polynucleotide with
the mRNA of FZD3, for use in treating or preventing osteoporosis or
cardiovascular diseases such as atherosclerosis in a human
subject.
[0057] The present invention relates to a composition comprising a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the sequence shown in SEQ ID
NO: 3, thereby preventing hybridization of said polynucleotide with
the mRNA of FZD3, for use in treating or preventing osteoporosis or
cardiovascular diseases such as atherosclerosis in a human
subject.
[0058] In context of the composition of the preceding paragraphs, a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the nucleic acid sequence
shown in any one of SEQ ID NOs: 1 to 3 is an antagomiR.
[0059] In context of the composition of the preceding paragraphs, a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the nucleic acid sequence
shown in any one of SEQ ID NOs: 1 to 3 is a 2'-O-methyl-RNA
oligonucleotide having phosphorothioates bonds and a cholesterol
tail.
[0060] In context of the composition of the preceding paragraphs, a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the nucleic acid sequence
shown in any one of SEQ ID NOs: 1 to 3 is a miRCURY LNA.TM.
microRNA inhibitor (Exiqon).
[0061] In context of the composition of the preceding paragraphs, a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the nucleic acid sequence
shown in any one of SEQ ID NOs: 1 to 3 is an in vivo LNA.TM. miR
inhibitors (Exiqon).
[0062] In context of the composition of the preceding paragraphs, a
nucleic acid molecule which hybridizes under stringent conditions
with the polynucleotide consisting of the nucleic acid sequence
shown in any one of SEQ ID NOs: 1 to 3 is a miR-decoy or
sponge.
[0063] Furthermore, in accordance with the present invention, the
antagonist/inhibitor (i.e. in case of a nucleic acid
antagonist/inhibitor) of the polynucleotide to be inhibited in
context of the present invention may be cloned into a vector. The
term "vector" as used herein particularly refers to plasmids,
cosmids, viruses, bacteriophages and other vectors commonly used in
genetic engineering. In a preferred embodiment, these vectors are
suitable for the transformation of cells, like fungal cells, cells
of microorganisms such as yeast or prokaryotic cells. In a
particularly preferred embodiment, such vectors are suitable for
stable transformation of bacterial cells, for example to transcribe
the polynucleotide of the present invention.
[0064] Accordingly, in one aspect of the invention, the vector as
provided is an expression vector. Generally, expression vectors
have been widely described in the literature. As a rule, they may
not only contain a selection marker gene and a replication-origin
ensuring replication in the host selected, but also a promoter, and
in most cases a termination signal for transcription. Between the
promoter and the termination signal there is preferably at least
one restriction site or a polylinker which enables the insertion of
a nucleic acid sequence/molecule desired to be expressed.
[0065] It is to be understood that when the vector provided herein
is generated by taking advantage of an expression vector known in
the prior art that already comprises a promoter suitable to be
employed in context of this invention, for example expression of an
inhibitor (i.e. in case of a nucleic acid inhibitor) of a
polynucleotide as described hereinabove, the nucleic acid construct
is inserted into that vector in a manner the resulting vector
comprises only one promoter suitable to be employed in context of
this invention. The skilled person knows how such insertion can be
put into practice. For example, the promoter can be excised either
from the nucleic acid construct or from the expression vector prior
to ligation.
[0066] As a non-limiting example, the vector into which an
antagonist/inhibitor (i.e. in case of a nucleic acid
antagonist/inhibitor) of a polynucleotide to be inhibited in
context of the present invention (i.e. which decreases or
suppresses FZD3-expression) is cloned is an adenoviral,
adeno-associated viral (AAV), retroviral, or nonviral
minicircle-vector. Further examples of vectors suitable to comprise
the inhibitor (i.e. in case of a nucleic acid inhibitor) of a
polynucleotide to be inhibited in context of the present invention
to form the vector described herein are known in the art. For
example, a vector into which an inhibitor (i.e. in case of a
nucleic acid inhibitor) of a polynucleotide to be inhibited in
context of the present invention has been cloned may be miR-Vec, a
retroviral expression vector (Voorhoeve, Cell (2006), 124:
1169-1181).
[0067] In an additional embodiment, the inhibitor (in case of a
nucleic acid inhibitor or the coding nucleic acid sequence of a
peptide inhibitor) of a polynucleotide to inhibited in context of
the present invention and/or the vector into which the
polynucleotide described herein is cloned may be transduced,
transformed or transfected or otherwise introduced into a host
cell. For example, the host cell is a eukaryotic or a prokaryotic
cell, for example, a bacterial cell. As a non-limiting example, the
host cell is preferably a mammalian cell. The host cell described
herein is intended to be particularly useful for generating the
inhibitor of a polynucleotide to be inhibited in context of the
present invention.
[0068] Generally, the host cell described hereinabove may be a
prokaryotic or eukaryotic cell, comprising an inhibitor of the
polynucleotide to be inhibited in context of the present invention
or the vector described herein or a cell derived from such a cell
and containing the nucleic acid construct or the vector described
herein. In a preferred embodiment, the host cell comprises, i.e. is
genetically modified with nucleic acid sequence of the inhibitor of
the polynucleotide to be inhibited in context of the present
invention or the vector described herein in such a way that it
contains the nucleic acid sequence of the inhibitor of a
polynucleotide to be inhibited in context of the present invention
integrated into the genome. For example, such host cell described
herein may be a bacterial, yeast, or fungus cell. In one particular
aspect, the host cell is capable to transcribe the nucleic acid
sequence of an inhibitor of a polynucleotide which decreases or
suppresses expression of FZD3 or a biologically active derivative
thereof in context of the present invention. An overview of
examples of different corresponding expression systems to be used
for generating the host cell described herein is for instance
contained in Methods in Enzymology 153 (1987), 385-516, in Bitter
(Methods in Enzymology 153 (1987), 516-544), in Sawers (Applied
Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe
(Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends
in Biotechnology 12 (1994), 456-463), and in Griffiths, (Methods in
Molecular Biology 75 (1997), 427-440). The transformation or
genetically engineering of the host cell with a polynucleotide to
be inhibited in context of the present invention or vector
described herein can be carried out by standard methods, as for
instance described in Sambrook and Russell (2001), Molecular
Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y.,
USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold
Spring Harbor Laboratory Press, 1990.
[0069] Furthermore, as already mentioned and in context of the
present invention, it was surprisingly found that miR-31 is a
valuable tool as a biomarker for aging and age-associated diseases
such as osteoporosis, osteopenia, bone fracture, impaired bone
homeostasis or cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart and renal failure or atherosclerosis. That
is, the polynucleotides to be inhibited in context of the present
invention may also serve as diagnostic or prognostic markers
themselves and detection of said polynucleotides, e.g., by using
compounds binding thereto, will be useful in diagnosing or
predicting the progression of diseases or disorders such as
osteoporosis, osteopenia, bone fracture, impaired bone homeostasis
or cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart and renal failure or atherosclerosis in a
subject. Accordingly, the present invention relates to a compound
binding to a polynucleotide to be inhibited in context of the
present invention, i.e. to a polynucleotide which is capable of
decreasing or suppressing expression of FZD3 or a biologically
derivative thereof as described herein, for use in diagnosing or
predicting the progression of bone disorders and/or cardiovascular
disorders such as osteoporosis, osteopenia, bone fracture, impaired
bone homeostasis, or cardiovascular diseases such as stroke,
infarction, hypertension, thrombosis, vascular stenosis, coronary
syndromes, vascular dementia, heart and renal failure or
atherosclerosis in a subject.
[0070] Hence, the present invention further relates to a
composition comprising [0071] (a) a polynucleotide capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof as described hereinabove, and/or [0072]
(b) a nucleic acid molecule which hybridizes to a polynucleotide
capable of decreasing or suppressing expression of FZD3 or a
biologically active derivative thereof as described hereinabove,
and/or [0073] (c) an agent that binds to a polynucleotide capable
of decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof as described hereinabove, [0074] for use
in diagnosing bone disorders and/or cardiovascular disorders such
as osteoporosis, osteopenia, bone fracture, impaired bone
homeostasis, or cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart and renal failure or atherosclerosis in a
subject.
[0075] The present invention also relates to a composition
comprising [0076] (a) an agent capable of specifically interacting
with (e.g., binding to) a polynucleotide being capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof, and/or [0077] (b) a nucleic acid
molecule which hybridizes, preferably under stringent conditions,
to a polynucleotide being capable of decreasing or suppressing
expression of FZD3 or a biologically active derivative thereof,
[0078] for use in diagnosing bone disorders and/or cardiovascular
disorders in a subject or for use in monitoring in vitro the
treatment success of a bone disorder and/or a cardiovascular
disorder as described herein.
[0079] The term "agent" as used herein, particularly in context
with "agent interacting with a polynucleotide being capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof" or "agent that binds to a polynucleotide
capable of decreasing or suppressing expression of FZD3 or a
biologically active derivative thereof" comprises specific proteins
or protein fragments. Such proteins or protein fragments may be,
e.g., antibodies or fragments thereof, small molecule inhibitors or
transcription factors or modified transcription factors. Examples
of such (modified) transcription factors are (modified) zinc finger
proteins. Methods for generating small molecule inhibitors of
polynucleotides are known in the art (Davis, Antivir Chem Chemother
(2011), 21(3): 117-128). The terms "antibody" and "antibody
fragment" are used herein in the broadest sense and includes, but
is not limited to, monoclonal and polyclonal antibodies,
multispecific antibodies (e.g., bispecific antibodies), chimeric
antibodies, CDR grafted antibodies, humanized antibodies, camelized
antibodies, single chain antibodies and antibody fragments and
fragment constructs, e.g., F(ab').sub.2 fragments, Fab-fragments,
Fv-fragments, single chain Fv-fragments (scFvs), bispecific scFvs,
diabodies, single domain antibodies (dAbs) and minibodies which are
capable of specifically interacting with or binding to
polynucleotides to be inhibited as described herein. Methods for
producing antibodies against polynucleotides are well known in the
art (see, e.g., Ye, Proc Nat Acad Sci USA (2008), 105: 82-87).
[0080] Furthermore, the present invention relates to pharmaceutical
compositions comprising a compound, e.g., a nucleic acid molecule
or an antibody, binding to a polynucleotide to be inhibited in
context of the present invention for use in diagnosing bone
disorders and/or cardiovascular disorders such as osteoporosis,
osteopenia, bone fracture, impaired bone homeostasis, or
cardiovascular diseases such as stroke, infarction, hypertension,
thrombosis, vascular stenosis, coronary syndromes, vascular
dementia, heart and renal failure or atherosclerosis in a subject.
In one embodiment of the present invention, the compound binding to
a polynucleotide to be inhibited in context of the present
invention is a nucleic acid molecule as described in context of an
inhibitor capable of hybridizing to said polynucleotide as
described hereinabove. Hybridization of such a binding nucleic acid
molecule with said polynucleotide to be inhibited in context of the
present invention can be easily detected by the skilled person
using methods well known in the art and as also described herein.
In one embodiment, said binding compound is a binding agent such as
an antibody or a fragment thereof (such as F(ab) or F(ab).sub.2
fragments) specifically binding to said polynucleotide to be
inhibited in context of the present invention, i.e. which is
capable of decreasing or suppressing expression of FZD3 or a
biologically derivative thereof. Binding of an antibody or a
fragment thereof to a polynucleotide can be easily detected by the
skilled person using methods well known in the art such as ELISA,
EIA or similar methods.
[0081] Described herein is a method for diagnosing bone disorders
and/or cardiovascular disorders such as osteoporosis, osteopenia,
bone fracture, impaired bone homeostasis, or cardiovascular
diseases such as stroke, infarction, hypertension, thrombosis,
vascular stenosis, coronary syndromes, vascular dementia, heart and
renal failure or atherosclerosis in a subject, said method
comprising the steps of: [0082] (a) obtaining a biological sample
from said subject which comprises a polynucleotide capable of
decreasing or suppressing expression of FZD3 or a biologically
active derivative thereof as described hereinabove; [0083] (b)
contacting said sample with a nucleic acid molecule which
hybridizes to the polynucleotide of (a), or with an agent that
binds to a polynucleotide of (a); [0084] (c) detecting and
evaluating hybridization or binding signal of the nucleic acid
molecule of (b) or the agent of (b) with the polynucleotide of (a);
and [0085] (d) comparing the detected and evaluated hybridization
or binding signal of (c) with that correspondingly detected and
evaluated hybridization or binding signal in a control sample,
wherein a stronger hybridization or a stronger binding signal in
the sample of the subject compared to that of said control sample
is indicative for a risk of developing or having a bone disorder
and/or cardiovascular disorder.
[0086] The present invention relates to a method for diagnosing
bone disorders and/or cardiovascular disorders such as
osteoporosis, osteopenia, bone fracture, impaired bone homeostasis,
or cardiovascular diseases such as stroke, infarction,
hypertension, thrombosis, vascular stenosis, coronary syndromes,
vascular dementia, heart and renal failure or atherosclerosis in a
subject, said method comprising the steps of: [0087] (a) (i)
contacting a biological sample from said subject with a nucleic
acid molecule which hybridizes (preferably under stringent
conditions) to a polynucleotide being capable of decreasing or
suppressing expression of FZD3 and/or which hybridizes (preferably
under stringent conditions) to miR-31 or its 5' or 3' isoforms or
variants, or [0088] (ii) contacting said biological sample with an
agent that binds to said polynucleotide being capable of decreasing
or suppressing expression of FZD3 and/or that binds to miR-31 or
its 5' or 3' isoforms or variants; [0089] (b) detecting and
evaluating the hybridization signal of the nucleic acid molecule of
(a)(i) or detecting and evaluating the binding signal of the agent
of (a)(ii) with said polynucleotide and/or said miR-31 or its 5' or
3' isoforms or variants; and [0090] (c) comparing the detected and
evaluated hybridization signal of (b)(a)(i) or comparing the
detected and evaluated the binding signal of (b)(a)(ii) with a
correspondingly detected and evaluated hybridization or binding
signal in a control sample, wherein a stronger hybridization or a
stronger binding signal in the sample of the subject compared to
that of said control sample is indicative for a risk of developing
or having a bone disorder and/or cardiovascular disorder.
[0091] In one embodiment, the method for diagnosing bone disorders
and/or cardiovascular disorders such as osteoporosis, osteopenia,
bone fracture, impaired bone homeostasis, or cardiovascular
diseases such as stroke, infarction, hypertension, thrombosis,
vascular stenosis, coronary syndromes, vascular dementia, heart and
renal failure or atherosclerosis in a subject, said method
comprising the steps of [0092] (a) contacting a biological sample
from said subject with a nucleic acid molecule which hybridizes
(preferably under stringent conditions) to a polynucleotide being
capable of decreasing or suppressing expression of FZD3 and/or
which hybridizes (preferably under stringent conditions) to miR-31
or its 5' or 3' isoforms or variants; [0093] (b) detecting and
evaluating the hybridization signal of the nucleic acid molecule of
(a) with said polynucleotide and/or said miR-31 or its 5' or 3'
isoforms or variants; and [0094] (c) comparing the detected and
evaluated hybridization signal of (b) with a correspondingly
detected and evaluated hybridization signal in a control sample,
wherein a stronger hybridization signal in the sample of the
subject compared to that of said control sample is indicative for a
risk of developing or having a bone disorder and/or cardiovascular
disorder.
[0095] The nucleic acid molecules to be employed in the diagnosing
methods of the present invention (i.e. hybridizing to a
polynucleotide being capable of decreasing or suppressing
expression of FZD3) may be of any kind of nucleic acid molecules as
described herein. For example, these nucleic acid molecules may be
primers (e.g., for PCR techniques) or probes (e.g., for microarray
or blot assays such as dot blot, southern blot or northern blot).
Primers can be used particularly in PCR techniques as described and
exemplified herein. Preferably, as known in the art, one primer is
complementary to a sequence of the 5'-end of the polynucleotide to
be detected ("forward primer"), while the other primer is
complementary to a sequence of the 3'-end of the polynucleotide to
be detected ("reverse primer"). Primers for PCR techniques and the
like should usually have a length of about 12 to 30 nucleotides,
but they may also comprise more or less nucleotides if appropriate.
The primers may not be 100% complementary to the respective
sequences of the polynucleotide to be detected as long as it is
still capable of hybridising to the polynucleotide, preferably
under stringent conditions or such conditions as may be appropriate
for the given primer as described herein below. Furthermore,
primers may be conjugated to marker molecules or tagging molecules
as described herein such as fluorescent dyes excited and emitting
at UV/VIS or infrared wavelengths like FITC, TRITC, Texas Red,
Cy-dyes, alexa dyes (Bioprobes), or the like. Probes can be
generated as known in the art and usually comprise a nucleotide
sequence which is complementary to a sequence of the polynucleotide
to be detected. Probes are of particular useful for assays such as
microarrays or blot assays (e.g., dot blot, southern blot, northern
blot) as described and exemplified herein. The sequence of the
probe does not have to be 100% complementary to the respective
sequence of the polynucleotide to be detected as long as it is
still capable of hybridising to the polynucleotide, preferably
under stringent conditions. Furthermore, probes may be conjugated
to marker molecules or tagging molecules as described herein such
as fluorescent dyes excited and emitting at UV/VIS or infrared
wavelengths like FITC, TRITC, Texas Red, Cy-dyes, alexa dyes
(Bioprobes), or the like.
[0096] Hybridization conditions in context with the diagnosing
methods provided herein, particularly for PCR techniques as
described above, may be as follows. SSC is 3 M NaCl and 300 mM
Na.sub.3Citrate, adjusted to pH 7.0 with HCl. For stringent
conditions, 0, 1 or 0.2.times.SSC at 65.degree. C. is used,
preferably with addition of SDS at 1%. For intermediate conditions,
1.times. or 2.times.SSC is used, and for non-stringent conditions,
4.times. or 6.times.SSC is used, preferably with 1% SDS. The
temperature is generally 65.degree. C. or less depending on the
melting temperature of the probe-target complex. As mentioned, in
context with the diagnosis methods provided herein, the nucleic
acid molecule may hybridize to the polynucleotide to be detected
(i.e. polynucleotide being capable of decreasing or suppressing
expression of FZD3) under stringent conditions.
[0097] In accordance with the present invention, determining the
melting temperature (T.sub.m) of a nucleic acid duplex is generally
useful for many applications such as PCR, binding assays,
hybridization, and the like. The T.sub.m may be defined as the
temperature where 50% of a given nucleotide (such as a microRNA) is
in duplex with its reverse complementary (i.e. exactly matching for
formation of a double helix) sequence. T.sub.m is influenced by a
number of factors well known to the person of ordinary skill, such
as the length of the polynucleotide, the base composition, the
sequence, the possibility to form secondary structures (such as the
hairpin structures typical for micro RNA precursor molecules), and
environmental conditions, such as salt (generally monovalent
cation) concentration, divalent cation (Mg.sup.2+) concentration,
pH, and the presence of denaturing substances such as e.g.
formamide.
[0098] In order to conduct hybridization in a PCR or any other test
that requires binding of a nucleotide to its target form a double
helix, the T.sub.m of the nucleotide may be determined. A number of
methods for determining T.sub.m are known to the person of ordinary
skill in the art. For instance, the empirical determination could
be carried out by including in a buffer solution the nucleotide to
be tested and its exact reverse complement, and raising the
temperature from a low temperature where annealing is perfect (such
as room temperature or less) to a high temperature (such as
95.degree. C. or more) where annealing cannot take place anymore
and most of the nucleotide will be single and not annealed. The
change from the single to the duplex form of the nucleotide may be
monitored by UV spectrometry. For example, the nucleotide and its
exact fitting reverse complement may be dissolved in a buffer such
as 0.1.times.SSC (15 mM NaCl, 1.5 mM Na.sub.3Citrate, pH 7.0). UV
absorbance (Abs) may be measured at 260 nm and the temperature (t)
gradually changed from low to high to observe denaturation and
optionally, vice versa to observe reannealing. When plotting the
resulting temperature versus absorbance, an S-shaped curve may be
observed, having two absorbance plateaus. The T.sub.m may then be
determined as the temperature exactly halfway between the upper
plateau and the lower plateau, or, alternatively, as the maximum of
the first derivative dAbs/dt. (see, e.g., Thermal Analysis of DNA
by UV/Visible Spectrometry, Moore, GBC application note, GBC
Scientific Equipment Pty, Ltd, Braeside, Australia,
http://www.gbcscientific.com/appnotes/uv_app_note.sub.--002.pdf),
see also "Oligo melting temperature" by Sigma-Aldrich, St. Lois,
MO, USA
(http://www.sigmaaldrich.com/life-science/custom-oligos/custom-dna/learni-
ng-center/oligos-melting-temp.html).
[0099] Of course, as is well known to the person of skill in the
art, the T.sub.m can be experimentally determined by the same
method for non-perfectly matching nucleotides, for RNA/DNA
duplexes, for nucleotides incorporating modified or non-canonical
bases (such as Inosine, generally used as a nucleotide intended to
bind almost equally well any of the four canonical nucleotide bases
A, C, G, T or U), or nucleotide molecules with altered backbones
(e.g., locked nucleic acid--LNA, or phosphorodiamidate morpholino
nucleotides; see, e.g., Summerton, Antisense Nucleic Acid Drug Dev
(1997), 7(3): 187-195).
[0100] The T.sub.m determined experimentally is only valid for the
conditions at which it was measured. For other conditions (e.g.,
salt (monovalent cation) concentration, divalent cation
concentration), formulas may be used that allow an estimation of
the T.sub.m under different conditions (see below).
[0101] Alternatively, the approximate T.sub.m of a given nucleotide
sequence can be calculated. A number of methods are known to the
person of ordinary skill in the arts, such as the GC content
method, the nearest neighbour method and others. Generally, the
nearest neighbour method results in more accurate estimations,
although none of these methods is able to predict the T.sub.m of a
given nucleotide sequence with absolute accuracy, so that a few
.degree. C. deviation (generally assumed to be 5-10.degree. C.)
must be taken into account. Accordingly, in most hybridization,
annealing, primer extension or other methods that rely on the
formation of a nucleotide duplex, the temperature at which the
experiment is performed is chosen about 5-10.degree. C. below the
theoretically calculated T.sub.m, in order to ensure perfect duplex
formation. Of course, as is well known in the art of molecular
biology, hybridization conditions may be optimized, e.g., by
testing the hybridization/primer annealing/PCR or other experiment
that relies on nucleotide duplex formation at various temperature
and other conditions and determining the conditions at which the
best result is obtained.
[0102] A simple way to calculate estimated T.sub.m values is based
on the GC content of the nucleotide sequence (see, e.g., for short
nucleotide sequences, the "Wallace rule", Wallace, Nucleic Acids
Res (1979), 6: 3543; for longer nucleotides, see below). Briefly,
different equations are used for calculating the estimated T.sub.m
of duplexes containing DNA and RNA, as RNA bases tend to pair more
strongly, resulting in higher T.sub.m values for the same sequence
compared to DNA-DNA duplexes (generally, RNA-RNA duplexes are most
stable, RNA-DNA hybrids are of intermediate stability, and DNA-DNA
duplexes are least stable for the same nucleotide sequence). One
simple equation is the "Wallace rule", where the melting
temperature is determined as two .degree. C. for each A/T pair and
4.degree. C. for each G/C pair in the sequence (Td=2(#A/T)+4(#C/G).
This equation would results in an estimate for the melting
temperature at a situation where one nucleotide is membrane-bound
at a salt concentration of 0.9 M. Where both nucleotides forming
the duplex are in solution the T.sub.m would be slightly lower than
calculated by this formula (about 7-8.degree. C. lower). For
nucleotides longer than about 14 to 20 bases, the methods described
in Howley, J Biol Chem (1979), 254: 4876 may be used. Briefly, for
DNA-DNA duplexes, T.sub.m is calculated as T.sub.m=81.5+16.6 log
[Na.sup.+]+41(GC %)-500/L-0.62 F where Na.sup.+ is the molar
concentration of monovalent cations, GC % is the fraction of GC
nucleotides versus the total number of nucleotides (being a value
between 0 and 1), L is the nucleotide length, and F is the
percentage of formamide if present in the solution (being a value
between 0 and 100). When calculating estimated values for RNA-DNA
hybrids or RNA-RNA duplexes, a slightly different formula is used
(T.sub.m=79.8+18.5 log [Na.sup.+]+58.4 (% GC)+11.8 (%
GC).sup.2-820/L-0.35 F), while for DNA-RNA hybrids (the RNA being
the molecule in solution), the formula is T.sub.m=79.8+18.5 log
[Na.sup.+]+58.4 (% GC)+11.8 (% GC).sup.2-820/L-0.50 F.
[0103] An improved method for estimation of a T.sub.m value is the
nearest neighbour method, so called because it takes into account
not only the percentage of G/C interactions in the duplex, but also
the nearest neighbour of each nucleotide, effectively adding up the
binding energies of each dinucleotide in the sequence. This method
results in different estimation of T.sub.m for different nucleotide
sequences having the same G content, yielding a more precise
estimation for T.sub.m than the above-mentioned GC content method
(see for overview, e.g., SantaLucia, Proc Natl Acad Sci USA (1998),
95: 1460-1465; for DNA see, e.g., Breslauer, Proc Natl Acad Sci USA
(1986), 83, 3746-3750; for RNA see, e.g., Freier, Proc Natl Acad
Sci (1986), 83, 9373-9377). By way of example, the formula
T.sub.m=(1000.DELTA.H/A+.DELTA.S+R*ln(C/4))-273.15+16.6 log
[Na.sup.+] may be used, where .DELTA.H (Kcal/mol) is the sum of the
nearest-neighbour enthalpy changes for hybrids, A is a small
constant containing corrections for helix initiation, .DELTA.S is
the sum of the nearest-neighbour entropy changes, R is the Gas
Constant (1.99 cal/(K*mol)), C is the concentration of the
nucleotide, and Na.sup.+ is the concentration of monovalent cations
in the solution. The .DELTA.H and .DELTA.S values to be used this
calculation for DNA and RNA duplexes are shown in the table
(formula example and values from Sigma-.Aldrich, reference see
above).
[0104] Thermodynamic parameters for nearest-neighbour melting
temperature formula.
TABLE-US-00004 DNA RNA Interaction .DELTA.H .DELTA.S .DELTA.H
.DELTA.S AA/TT -9.1 -24.0 -6.6 -18.4 AT/TA -8.6 -23.9 -5.7 -15.5
TA/AT -6.0 -16.9 -8.1 -22.6 CA/GT -5.8 -12.9 -10.5 -27.8 GT/CA -6.5
-17.3 -10.2 -26.2 CT/GA -7.8 -20.8 -7.6 -19.2 GA/CT -5.6 -13.5
-13.3 -35.5 CG/GC -11.9 -27.8 -8.0 -19.4 GC/CG -11.1 -26.7 -14.2
-34.9 GG/CC -11.0 -26.6 -12.2 -29.7 Initiation 0.0 -10.8 0.0
-10.8
[0105] In general, these methods will result in estimates, not
absolutely accurate values. Moreover, conditions like
immobilization (see above), impurities, and nucleotide modification
may all influence the actual T.sub.m value of a given duplex or
hybrid.
[0106] In some cases, an empirical approach must be used, while in
others the empirical determination may be used to improve on the
estimate derived from the calculation. Generally, modifications
like biotin, fluorescent dyes and the like will likely result in a
lower T.sub.m, while some modifications (like the backbone
modification used in LNAs) may results in a higher T.sub.m. For LNA
backbones, the nucleotides containing such backbones can, as an
approximation, be assumed to be RNA nucleotides (resulting in more
stable binding and hence higher T.sub.m values). Therefore, an
LNA-RNA hybrid could be calculated like the corresponding RNA-RNA
hybrid, while a nucleotide containing some LNA nucleotides and some
DNA nucleotides could be calculated on the basis of mixed energy
values (for LNA nucleotides RNA values could be used, for DNA
nucleotides DNA values are used).
[0107] For ease of use in molecular biology, the above methods are
also implemented on a number of servers for public use, such as
http://biophysics.idtdna.com/ or
http://www.biophp.org/minitools/melting_temperature/demo.php.
[0108] Thus, the person of ordinary skill is easily able to
determine an estimate for the melting temperature for a given
nucleotide sequence. For instance, for SEQ ID NO: 1, a T.sub.m of
between 50 and 54.4.degree. C. could be obtained, while for SEQ ID
NO: 3 (the miRNA 31 precursor sequence), between 67.4 and
76.2.degree. C. could be obtained. These values are calculated for
15 mM monovalent cation (salt) concentration, which corresponds
approximately to 0.1.times.SSC buffer, that is, to stringent
hybridization conditions (see further above), with the proviso that
the temperature must be adjusted accordingly (For the precursor, in
this case the 65.degree. C. temperature condition could be tested,
while for the shorter mature miRNA, the temperature must be lowered
to about 45.degree. C., depending on further factors like pH,
divalent cations, target concentration and the like.
Correspondingly, an estimate for variations of a given sequence may
be obtained (providing that the target is matched in sequence).
[0109] The detection of a miRNA can be achieved by various methods.
For instance, miRNA may be detected and quantified by deep
sequencing methods, relying upon the fact that more sequence reads
are obtained from miRNA molecules present more abundantly. Such
methods are well known to the person of skill and described, inter
alia, by Friedlander., Nat Biotechnol (2008), 26(4): 407-415; Koh,
BMC Genomics (2010), 10(11) Suppl 1: S6; Creighton, Brief Bioinform
(2009), 10 (5): 490-497. miRNA abundance may further be determined
by array technology. For instance, the Ncode human miRNA array
available from Invitrogen, Carlsbad, Calif., USA may be used to
determine relative abundance of a large number of human miRNAs in a
sample. Chip arrays for detection and determination of relative
abundance of miRNAs are also available from Affymetrix, Santa
Clara, Calif., USA, e.g., the U133 Plus 2.0. Affymetrix expression
array (see.e. g., Ivanov, J Biol Chem (2010), 285: 22809-22817).
Arrays based upon LNA backbone probes (miRCURY LNA.TM. arrays) are,
e.g., available from Exiqon, Vedbaek Denmark.
[0110] Further, the presence and relative abundance of a miRNA in a
sample can be assayed by in situ detection. Although the detection
of microRNAs (miRNAs) in situ presents several technical challenges
due to their short length, this can be overcome, e.g., by using
digoxygenin-labeled locked nucleic acid (LNA) oligonucleotide
probes for detection (see, e.g., Sweetman, Methods Mol Biol (2011),
732: 1-8). Using this method, the subcellular distribution of
miRNAs can be detected. In situ methods are also useful for
resolution of miRNA distribution on a tissue and organism level
(see, e.g., Diez-Roux, PLoS Biol (2011),18; 9(1): e1000582).
Further works by others have demonstrated the feasibility of in
situ hybridization and fluorescence-based detection for miRNA
detection and relative abundance determination (Lu J, Methods Mol
Biol (2011), 680: 77-88; Mansfield, Methods. (2010), 52(4):
271-280; Gupta, Methods Mol Biol (2011), 676: 73-83; Debernardi,
Methods Mol Biol (2010), 667: 33-45; Silahtaroglu, Methods Mol Biol
(2010), 659: 165-171, also working with LNA nucleotides as probes;
and Nuovo, Methods (2010),52(4): 307-315, demonstrating the method
also for paraffin-embedded samples).
[0111] As mentioned, another example of a method of miRNA detection
and quantification which may be employed in context of the
diagnosis methods provided herein is quantitative PCR (qPCR). As
the miRNA is a relatively short molecule, it is possible to extend
its length by adding Adenosine monomers to the strand (a technique
known as polyadenylation) first before reverse transcription and
amplification. Briefly, the RNA may be extracted from a sample by a
suitable reagent (e.g. Trizol reagent available from the above
mentioned Invitrogen), poyadenylated in the presence of ATP and
poly(A) polymerase, reverse transcribed into DNA using a poly(T)
adapter and 5' RACE sequence, and amplified using a forward primer
derived from the 3' end of the miRNA and a reverse RACE primer (for
details concerning primer design, RACE sequence etc. see.e. g.,
Shi, BioTechniques (2005), 39: 519-525. Improvements of this
technique include designing the RACE primer with a nucleotide at
its 3' end (constituting an A, C, or G, but not a T, so to exclude
priming anywhere on the poly A sequence and enforce priming on the
miRNA sequence; see also Reichenstein., J Virol Methods (2010),
163(2): 323-328).
[0112] As an example, the following primers may be used for
detection and quantification of miR-31 (SEQ ID NO: 1): Forward
primer. 5'-ACGCGGCAAGATGCTGGCA-3' (SEQ ID NO: 29), Reverse primer.
5'-CAGTGCTGGGTCCGAGTGA-3' (SEQ ID NO: 30) (see Wang., Dis Markers
(2009), 26(1): 27-34). Further examples for PCR quantification of
miRNA 31 include Liu, J Clin Invest (2010), 120(4): 1298-1309 (also
detailing microarray assaying of miRNA31). Further, miRNA detection
and quantitation using the Taqman system is readily available from
Applied Biosystems/Life technologies, Carlsbad, Calif., USA (see,
e.g.,
http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/gene-
raldocuments/cms.sub.--042142.pdf) as also described and
exemplified herein in the appended Examples. Another example for
quantitative PCR determination of mir31 uses a stem-loop primer for
reverse transcription and a forward and reverse primers for PCR
amplification of the miR-31 cDNA. Examples of such primers include
for the stem-loop primer:
gtcgtatccagtgcagggtccgaggtattcgcactggatacgacagctatgcctg (SEQ ID NO:
31); for the forward primer: tgaccgaggcaagatgc (SEQ ID NO: 32); and
for the reverse primer: gtgcagggtccgaggt (SEQ ID NO: 33). Forward
and reverse primer overlap by one nucleotide on the miR-31
sequence, this however is not enough to cause a primer dimer (for
PCR conditions and further details see Ivanov, J Biol Chem (2010),
285: 22809-22817).
[0113] In another embodiment, the method for diagnosing bone
disorders and/or cardiovascular disorders such as osteoporosis,
osteopenia, bone fracture, impaired bone homeostasis, or
cardiovascular diseases such as stroke, infarction, hypertension,
thrombosis, vascular stenosis, coronary syndromes, vascular
dementia, heart and renal failure or atherosclerosis in a subject,
said method comprising the steps of [0114] (a) contacting a
biological sample from said subject with an agent that binds to
said polynucleotide being capable of decreasing or suppressing
expression of FZD3 and/or that binds to miR-31 or its 5' or 3'
isoforms or variants; [0115] (b) detecting and evaluating the
binding signal of the agent of (a) with said polynucleotide and/or
said miR-31 or its 5' or 3' isoforms or variants; and [0116] (c)
comparing the detected and evaluated the binding signal of (b) with
a correspondingly detected and evaluated binding signal in a
control sample, wherein a stronger binding signal in the sample of
the subject compared to that of said control sample is indicative
for a risk of developing or having a bone disorder and/or
cardiovascular disorder.
[0117] In one embodiment of the diagnostic method provided herein,
a method is provided that is a method for diagnosing bone disorders
and/or cardiovascular disorders in a subject, said method
comprising the steps of: [0118] (a) detecting via a PCR method the
expression level and/or quantity of miR-31 (and isoforms and
variants thereof as defined herein) in a biological text sample;
and [0119] (b) comparing the detected expression level and/or
quantity of said miR-31 (and isoforms and variants as defined
herein) in said biological sample with a corresponding expression
level and/or quantity of said miR-31 in a control sample.
[0120] Again, a control sample may be a sample derived from a
disease-negative (or healthy) control patient. This would be a
"negative control". However, it is also envisaged, for example as a
second or additional control, that such a control sample is a
sample derived from a patient who suffers from said bone disease
and/or said cardiovascular disorder. This would be a positive
control. The sample may be blood, blood serum, blood plasma or
another biological fluid. As shown in the appended examples, plasma
and serum are very useful. Methods for the assessment of nucleic
acid molecules, also of mino RNAs are well known in the art. Such
methods comprise e.g. PCR, also and in particular quantitative PCR
as well as real-time qPCR; see, e.g. Chen (2011) Methods Mol. Biol.
687, 113-134, or Mestdagh (2008) Nuc. Acid Res. 36(21): e143.
[0121] In one embodiment (and as illustrated in the examples) the
disorder to be assessed or diagnosed in accordance with the
invention is a bone disorder, i.e. an osteopenia or osteoporosis
and the like.
[0122] The invention also provides a method for the detection of a
polynucleotide being capable of decreasing or suppressing
expression of FZD3 and/or which hybridizes to miR-31 or its 5' or
3' isoforms or variants. A convenient method is based upon
polymerase chain reaction (PCR), as this method is rapid, specific
and sensitive. For PCR, a primer is required that hybridizes
specifically to the target nucleic acid. Moreover, a second primer
is required to generate a PCR product by repeated cycles of primer
annealing, primer extension, and denaturing. The primer is chosen
to maximize hybridization to the target nucleic acid while
minimizing cross-hybridization to other nucleic acids present in
the sample. Examples of primer sequences and of calculating the
optimal hybridization temperature and other conditions for any
chosen primer sequence are given hereinbelow.
[0123] Accordingly, the invention provides a method for diagnosing
bone disorders and/or cardiovascular disorders in a subject, said
method comprising the steps of: [0124] (a) contacting a biological
sample from said subject with a first primer molecule which
hybridizes to a polynucleotide being capable of decreasing or
suppressing expression of FZD3 and/or which hybridizes to miR-31 or
its 5' or 3' isoforms or variants, forming a hybridization complex;
[0125] (b) contacting the hybridization complex of step (a) with a
second primer and a polymerase capable of extending the primer;
[0126] (c) repeatedly causing the primers to be extended by
polymerase, the product to denature, and the primers to hybridize
to the denatured product of polymerase extension, [0127] (d)
detecting and evaluating the product of step (c), resulting in a
value reflecting the amount of the polynucleotide being capable of
decreasing or suppressing expression of FZD3 and/or which
hybridizes to miR-31 or its 5' or 3' isoforms or variants to which
the first primer nucleic acid has hybridized; [0128] (e) comparing
the detected and evaluated value of (d) with a correspondingly
detected and evaluated value in a control sample, [0129] wherein a
higher value resulting from the sample of the subject compared to
that of said control sample is indicative for a risk of developing
or having a bone disorder and/or cardiovascular disorder.
[0130] Where the polynucleotide being capable of decreasing or
suppressing expression of FZD3 and/or which hybridizes to miR-31 or
its 5' or 3' isoforms or variants (the target nucleotide) is an RNA
molecule, the method preferably comprises the step of reverse
transcription of the target nucleotide. Reverse transcription may
be carried out by a primer that overlaps a sufficient portion of
the target molecule, preferably at its 3' end. The length of the
target molecule may be extended by the step of polyadenylation
prior to reverse transcription. In this case, the reverse
transcription primer comprises a poly(t) sequence and at least one
nucleotide complementary to the target sequence. Preferably, said
nucleotide is not a T. More preferably, the primer comprises the
complement of two nucleotides of the target sequence, wherein the
first (the penultimate nucleotide at the 3' end of the primer) is
not a T.
[0131] In another preferred embodiment, the reverse primer is a
stem-loop primer which comprises a short overlap with the
(complement of the) target sequence and a stem-loop structure, as
described and exemplified below.
[0132] In principle, the diagnosis methods described herein may
employ a PCR technique (e.g., qPCR, RT-PCR, qRT-PCR, RT-qPCR or
Light Cycler.RTM.) or other methods suitable to detect presence
and/or amounts of polynucleotides. In the diagnosis methods of the
present invention, the presence and/or amount of a polynucleotide
which is capable of decreasing or suppressing expression of FZD3 or
a biologically derivative thereof and/or of miR-31 or its 3' or 5'
isoforms or variants is evaluated in a sample of a subject. PCR
techniques and other methods suitable for this purpose are known in
the art and are also described and exemplified herein. If the
amount of said polynucleotide and/or of miR-31 or its 3' or 5'
isoforms or variants is elevated compared to a control sample, the
risk of developing or having a bone disorder and/or cardiovascular
disorder is increased. For example, for the case of employment of a
qPCR technique, total RNA of a subject's biological sample may be
transcribed into cDNA. Then, specific primers hybridizing to said
polynucleotide and/or of miR-31 or its 3' or 5' isoforms or
variants may be used for detection. The amount of polynucleotide
and/or of miR-31 or its 3' or 5' isoforms or variants detected in
the subject's sample may then be compared to the amount of
polynucleotide and/or of miR-31 or its 3' or 5' isoforms or
variants of a control sample. The higher the amount is in the
subject's sample compared to the control sample, the higher is the
risk of developing or having a bone disorder and/or cardiovascular
disorder.
[0133] In context with the diagnosing methods described herein, a
hybridization or binding signal of the subject sample of (a) which
is at least 50%, 60%, 70% or 75% higher than that of the control
sample may be indicative for a risk of developing or having a bone
disorder and/or cardiovascular disorder such as osteoporosis,
osteopenia, bone fracture, impaired bone homeostasis, or
cardiovascular diseases such as stroke, infarction, hypertension,
thrombosis, vascular stenosis, coronary syndromes, vascular
dementia, heart and renal failure or atherosclerosis. The
polynucleotide capable of decreasing or suppressing expression of
FZD3 or a biologically active derivative thereof is preferably a
polynucleotide to be inhibited in context of the present invention.
Examples for biological samples in context of the present invention
are blood, serum, plasma, other blood derived products, saliva,
sperm fluid, vaginal fluid, urine, cerebrospinal fluid, or the
like. In one embodiment, the method is an in vitro method. In
context of the present invention, the nucleic acid molecule
hybridizing to the polynucleotide to be inhibited in context of the
present invention or the agent, e.g., an antibody, binding to the
polynucleotide as described hereinabove may further be conjugated
to a marker or tagging molecule. Examples for such marker molecules
for nucleic acids are fluorescent dyes excited and emitting at
UV/VIS or infrared wavelengths like FITC, TRITC, Texas Red,
Cy-dyes, alexa dyes (Bioprobes), etc. Examples for such
marker/tagging molecules for antibodies are enzymes like horse
radish peroxidase, alkaline phosphatatase or fluorescent dyes
excited and emitting at UV/VIS or infrared wavelengths like FITC,
TRITC, Texas Red, Cy-dyes, alexa dyes, etc.
[0134] The appended sequence listing is part of the
description.
[0135] The Figures show:
[0136] FIG. 1: Characterization of cells and SN used within this
study.
[0137] (A) Pre-senescent (PD13) and senescent (PD53) endothelial
cells were stained for senescence associated .beta.-galactosidase
activity. (B) Apoptotic cell death of HUVECs 48 h after secretion
into ASC or HUVEC medium was measured using Annexin V-FITC and PI
staining (N=3). (C) Representative microscope pictures of two
different ASC lines. (D) ASCs were stained for expression of cell
surface markers using flow cytometry. Abbreviations: ASC,
adipose-derived stem cell.
[0138] FIG. 2: Effects of HUVEC supernatants on proliferation and
differentiation capacity of ASCs.
[0139] (A) ASCs were cultivated in the presence of conditioned
medium from pre-senescent (PD13) and senescent (PD53) cells and in
control medium. Viable cell numbers were analysed using a
hematocytometer and trypan blue staining. Error bars indicate the
standard deviations of 3 independent measurements. (B) Treated
cells were differentiated into the osteogenic lineage detected
using Alizarin Red staining. Representative pictures of 3
independent experiments are shown. Abbreviations: Undiff. ctrl,
undifferentiated control; S, senescent; Y, young; C, control.
[0140] FIG. 3: Exosomes of senescent HUVECs increase proliferation
and reduce differentiation capacity of ASCs.
[0141] (A) Electron microscopy of HUVEC derived exosomes. The image
shows typical cup-shaped vesicles of .about.50 to 100 nm in
diameter. (B) Western blot analysis shows exosome marker protein
CD63. (C) Exosomes were labelled with anti-CD63 antibody and
visualized by electron microscopy. (D) ASCs were cultivated in the
presence of exosomes derived from pre-senescent (PD13) and
senescent (PD53) cells and in control medium. Cell numbers were
detected using a hematocytometer and trypan blue staining. Error
bars indicate the standard deviations of 3 independent
measurements. (E) Treated cells were differentiated into the
osteogenic lineage. Ca deposits as marker for osteogenesis was
detected by Alizarin Red staining. Representative pictures of 3
independent experiments are shown. Abbreviations: Undiff. ctrl,
undifferentiated control; S, senescent; Y, young; C, control.
[0142] FIG. 4: MiR-31 is increasedly secreted by senescent
endothelial cells.
[0143] MiR-31 is upregulated in senescent HUVECs (A) as well as in
SN (B) and exosomes (C) derived from senescent HUVECs. (D)
Localization of miR-31 within exosomes by electron microscopy in
situ hybridization (EM-ISH). Abbreviations: S, senescent; Y, young;
SN, supernatant.
[0144] FIG. 5: ASCs take up exosomes derived from HUVECs.
[0145] (A) Intracellular levels of miR-31 in ASC after treatment
with SN or exosomes derived from pre-senescent and senescent
HUVECs. (B) Representative image of stable transfected senescent
endothelial cell expressing GFP. (C) Representative image of ASCs
after uptake of GFP-positive exosome 48 h after incubation. (D)
ASCs showing decreased levels of intracellular miR-31 levels after
transfection with the negative dominant dynamin construct (K44A)
and treatment with exosomes. Abbreviations: SN, supernatant; S,
senescent; Y, young; C, control; WT, wild type.
[0146] FIG. 6: miR-31 alone reduces osteogenic differentiation of
ASCs.
[0147] (A) Elevated miR-31 levels after transient transfection were
confirmed using TaqMan assay. (B) MiR-31 transfected cells were
differentiated into the osteogenic lineage (N=3). Differentiation
was detected using Alizarin Red staining. Representative images of
3 independent experiments are shown. Abbreviations: Undiff. ctrl,
undifferentiated control; ctrl, control.
[0148] FIG. 7: FDZ3 is a target of miR-31 in ASCs.
[0149] (A) Significant upregulation of FDZ3 mRNA 4 days after
osteogenic differentiation start. (B) Significant downregulation of
FDZ3 mRNA in ASCs treated with senescent versus young exosomes. (C)
Downregulation of FDZ3 mRNA after transient transfection of ASCs
with 10nM miR-31 precursor. Abbreviations: OD, osteogenic
differentiation; S, senescent; Y, young; C, control; ctrl,
control.
[0150] FIG. 8: Exosomes derived from plasma of elderly reduce
osteogenic differentiation of ASCs.
[0151] (A) Electron microscopy of serum derived exosomes. The image
shows typical cup-shaped vesicles of .about.50 to 100 nm in
diameter. (B) Significant upregualtion of miR-31 levels in serum
samples derived form healthy old donors (N=27) compared to young
healthy controls (N=21). (C) ASCs were treated with exosomes
derived from old and young donors and differentiated into the
osteogenic lineage. Differentiation was detected using Alizarin Red
staining. Representative pictures of 2 independent experiments are
shown. (D) MiR-31 levels in plasma derived from osteopenia patients
were significantly increased compared to healthy age matched
controls.
[0152] FIG. 9: Proposed model summarizing the results.
[0153] Supernatant/exosomes derived from senescent endothelial
cells affect proliferation and differentiation potential of ASCs
via miRNA delivery. Thereby, the "senescent" environment hampers
tissue regeneration and promotes cell growth which is one of the
risk factors in the development of cancer.
[0154] FIG. 10: MiR-31 is also induced by H.sub.2O.sub.2 in
exosomes derived from senescent versus untreated HUVECs.
[0155] Exosomes were harvested from H.sub.2O.sub.2 pulsed
endothelial cells after 14 days, when no additional cell
proliferation was observed in the cells treated with 75 .mu.M tBHP.
In contrast, after exposure to 35 .mu.M tBHP the cells completely
recovered and resumed growth.
[0156] FIG. 11: Levels of osteogenic differentiation of ASCs after
transfection with miR-31, anti-miR-31, non-targeting control miRNAs
and non-transfected cells.
[0157] While miR-31 significantly inhibits osteogenesis as analysed
by Alizarin red staining, anti-miR-31 significantly increases
osteogenesis.
[0158] FIG. 12: Plasma levels of miR-31.
[0159] Plasma levels of miR-31 of 10 male patients diagnosed with
osteopenia were compared to age matched healthy controls. 7 out of
10 patients show higher levels of miR-31 normalized to U6B snRNA,
resulting in a highly significant difference as calculated by
Student's t testing.
[0160] The Examples illustrate the invention.
EXAMPLE 1
Cell culture
Human Umbilical Vein Endothelial Cell (HUVEC)
[0161] Endothelial cells were isolated from human umbilical veins
as described (Chang, Exp Cell Res (2005), 309: 121-136; Jaffe, J
Clin Invest (1973), 52: 2745-2756). HUVECs were cultivated in
gelatin precoated flasks in M199 with Earle's salts supplemented
with 4 mM glutamine, 15% fetal calf serum (FCS) and 10% endothelial
cell growth supplement (ECGS) containing 170 U/ml heparin at
37.degree. C. in a humidified atmosphere with 5% CO.sub.2. Cells
were passaged once or twice a week at a split ratio of 1:2 to 1:4
according to the growth rate. HUVECs were cultivated to senescence
and stained for senescence associated .beta.-galactosidase
(SA-.beta.-gal) activity as described previously (Chang, loc cit).
For collection of supernatants, contact inhibited (quiescent, PD19)
and senescent (PD53/95% SA-.beta.-gal positive) cells were allowed
to secrete into ASC or HUVEC medium, depending on the experiment,
for 48 h. Then supernatants were collected, centrifuged at 1900 g,
4.degree. C. and used freshly for exosome preparation or stored at
-80.degree. C. Supernatant volumes were normalized to the number of
secreting HUVECs in one flask at the time of supernatant harvest.
Cell culture medium incubated for 48 h at 37.degree. C. was used as
additional control.
Human Adipose-Derived Stem Cells (ASCS)
[0162] Subcutaneous adipose tissue was obtained during outpatient
tumescence liposuction under local anestesia. ASCs were isolated as
described before (Wolbank, Tissue Eng (2007), 13: 1173-1183;
Wolbank, Tissue Eng Part A (2009)) and cultured in DMEM-low
glucose/HAM's F-12 supplemented with 4 mM L-glutamine, 10% fetal
calf serum (FCS, PAA) and 1 ng/mL recombinant human basic
fibroblast growth factor (rhFGF, R&D Systems) at 37.degree. C.,
5% CO.sub.2 and 95% air humidity. Cells were passaged once or twice
a week at a split ratio of 1:2 according to the growth rate. ASCs
were characterized due to the expression of specific surface
markers (CD13, CD14, CD34, CD45, CD73, CD90, HLA ABC, HLA DR) by
flow cytometry (FACS Calibur, Beckton Dickenson) using standard
procedures.
Differentiation into Osteogenic Lineage
[0163] All differentiation protocols were carried out in 24 well
cell culture plates. For osteogenic differentiation, ASCs were
seeded at a density of 2.times.10.sup.3 cell per well. 72 h after
seeding cells were incubated with osteogenic differentiation medium
(DMEM-low glucose, 10% FCS, 4 mM L-glutamine, 10 nM dexamethasone,
150 .mu.M ascorbate-2-phosphat, 10 mM .beta.-glycerolphosphate and
10 nM vitamine-D3) up to 4 weeks.
Alizarin Red Staining
[0164] For Alizarin Red staining of calcified structures, cells
were fixed for 1 h in 70% ethanol at -20.degree. C. After brief
rinsing, cells were stained for 20 min with 40 mM Alizarin Red
solution (Sigma) and washed with PBS. For quantification, Alizarin
Red was extracted for 30 min using 200 .mu.l M HCl/0.5% SDS
solution. The extracted dye was measured at 425 nm.
EXAMPLE 2
Transfections
[0165] ASCs were transfected using siPORT.TM. NeoFX.TM.
transfection reagent (Applied Biosystems). Cells were transfected
with 10 nM Precursor hsa-miR-31, 100 nM anti-miR-31 or 10 nM
negative control 2# (Ambion) according to the manufacturer's
protocol. Cells were harvested after 24 or 48 h or differentiation
was started as described before three days after transfection.
[0166] Moreover, ASCs were transfected with a 0.5 .mu.g dominant
negative dynamin construct (K44A) or dynamin wild type construct
(provided by Mark A. McNiven Department of Biochemistry and
Molecular Biology & Center for Basic Research in Digestive
Diseases, Mayo Clinic and Graduate School, Rochester, Minn. 55905,
USA) using Metafectene Pro (Biontex Laboratories GmbH) according to
manufactures protocol.
EXAMPLE 3
Assessment of Apoptotic Cell Death
[0167] HUVECs were seeded in 12-well cell culture plates and were
allowed to secrete into ASC medium for 48 h. Thereafter, the cells
were detached using 50 mM EDTA and stained with Annexin V- FITC and
PI (Roche) according to the manufacturer's instructions. Analysis
of the percentage of apoptotic and necrotic/late-apoptotic cells
were performed using a FACS-Calibur and the CellQuest software
(Becton Dickinson).
EXAMPLE 4
Quantitative Real-Time PCR
[0168] Alizarin red stainings were confirmed using different
osteogenic differentiation marker genes. Therefore, total ASCs RNA
was isolated using Trizol (Invitrogen) at different time points
before and during osteogenesis. Reverse transcription was performed
using DyNAmo cDNA Synthesis Kit (Biozym) and qPCR was performed
using the RotorGene2000 (Corbett). For miRNA analysis, specific
TaqMan assays (Applied Biosystems) were used according to
manufactures protocol.
[0169] For isolation of RNA from blood samples, 250-500 .mu.l serum
was used to isolate total RNA using Trizol LS reagent (Invitrogen).
To allow for normalization of sample-to-sample variation in RNA
isolation, 25 fmol synthetic C-elegans miRNAs cel-miR-39 were added
before isolation. Serum samples (27 healthy old donors and 21
healthy young donors) were obtained from R. Westendorp, Department
of Gerontology & Geriatrics C2-R, Leiden University Medical
Center, The Netherlands. Moreover 4 osteopenia serum samples
obtained from P. Pietschmann, Department of Pathophysiology,
General hospital, Vienna. Institutional ethics committees approved
the study, and written, informed consent has been obtained from
each subject.
EXAMPLE 5
Lentiviral Transduction
[0170] Senenscent HUVECs were transduced with a lentiviral vector
containing GFP protein kindly provided by Pidder Jansen-Durr,
Institute for Biomedical Aging Research, Innsbruck, Austria (Muck,
Rejuvenation Res (2008), 11: 449-453). Briefly, lentiviral
transduction was performed using senescent and pre-senescent
HUVECs. Generally, 100000-150000 senescent and 50000 pre-senescent
HUVECs were plated in a 6-well plate and incubated over night. A
multiplicity of infection (MOI) of two to eight with 8 .mu.g/ml
Polybrene, which increases the infection efficiency, was used to
produce stably transduced cells. As selection pressure, 10 .mu.g/ml
Blasticidin was added to the medium. After 6-8 days, clones were
stable and contamination with lentiviral particles was tested by
incubation of HeLa's with SN for 4 days. Thereafter, SN was
harvested and used for exosomes purification as described
before.
EXAMPLE 6
Exosome Purification
[0171] Exosomes were purified by filtration and differential
centrifugation as described previously (Lehmann, Cancer Res (2008),
68: 7864-7871). In brief, supernatants were collected after
incubation of 48 h. This conditioned medium will be centrifuged at
500 g for 10 min to sediment cells and at 14000 g for 15 min to
eliminate cell debris and filtered through a 0.22 .mu.m filter
excluding a fraction of apoptotic bodies. Exosomes are then
sedimented by ultracentifugation at 100000 g for 60 min and the
resultant pellet is washed with PBS. Exosomes will be used as fresh
preparations for electron microscopy or conserved at -80.degree. C.
for further analysis. For differentiation studies, exosomes derived
from 2.times.10.sup.4 HUVECs in 50 .mu.l PBS were added per well
ASCs.
EXAMPLE 7
Electron Microscopy
[0172] Purified exosomes were left to settle on nickel coverslips
(200 mesh, hexagonal, Pioloform-coated Athene copper grids) After
fixation with 4% paraformaldehyd, exosomes were stained with 2%
uranyl acetate for 30 sec, coverslips were left to dry and
visualized using a transmission electron microscopy (TEM), Philips
model CM 12 electron microscope (Philips, Eindhoven, NL).
[0173] For electron microscopy, in-situ hybridization (EM-ISH)
exosome pellets were permeabilized with 0.1% Triton-X for 5 min at
room temperature. After washing with PBS, exosomes were incubated
for at least 4 h with hybridization buffer as described previously
(Obernosterer, Nat Protoc (2007), 2: 1508-1514). For each sample, 1
pM of the LNA DIG-labelled single stranded probe (Exiqon, Denmark)
was denaturated in denaturizing hybridization buffer (containing
50% formamide, 5.times.SSC, 5.times.Denhardt's solution, 0.1%
Tween, 0.25% CHAPS, 200 .mu.g/ml yeast RNA, 500 .mu.g/ml salmon
sperm DNA) by incubation at 80.degree. C. for 5 min. Probes were
placed on ice quickly. Exosomes were mixed with the probe and
hybridized at 50.degree. C. over night. After hybridization,
samples were washed stringently with 0.2.times.SSC at 60.degree. C.
for 1 h. Thereafter, exosomes were incubated with Anti-DIG antibody
(Roche) for 30 min and an additional hour with the second 5 nm gold
particle labelled antibody (Sigma). After washing with PBS,
exosomes were embedded in Epon, sections on average, approximately
80 nm were cut using a Ultramicrotom and were then analysed using
transmission electron microscopy (TEM), Philips model CM 12
electron microscope (Philips, Eindhoven, NL).
EXAMPLE 8
Western Blot
[0174] Total proteins were extracted and separated on
polyacrylamide gels before transfer to a PVDF membrane (Roth,
Germany). The membrane was blocked in 5% skimmed milk, incubated
with the CD63 antibody (H-193, Santa Cruz) followed by horseradish
peroxidase-coupled secondary antibody and subjected to enhanced
chemiluminescence using ECL Western Blotting Substrate (Pierce) on
a Chemidoc (Biorad).
EXAMPLE 9
Effects of HUVEC Supernatants on Proliferation and Differentiation
Apacity of ASCs
[0175] In order to test if senescent endothelial cells might
contribute to the stem cell inhibiting systemic environment
(Conboy, Nature (2005), 433: 760-764), well characterized
pre-senescent and senescent HUVECs (PDL between PD13 and PD53) were
used as established earlier (Chang, Exp Cell Res (2005), 309:
121-136). Senescent cells showed a large flattened morphology and
stained positive for SA-.beta.-gal activity (FIG. 1A). In order to
produce endothelially secreted factors in ASC medium, endothelial
cells were exposed to ASC medium for 48 h. In order to exclude that
excessive cell death influences the "secretome", the basal level of
cell death of endothelial cells during the time of "harvesting"
using Annexin V and PI staining was tested. Their was no
significant difference visible between pre-senescent and senescent
HUVECs (FIG. 1B).
[0176] Furthermore, ASCs showing typical morphology from 6
different donors (examples FIG. 1C) were used and their identity
was confirmed by characterization of their surface marker profile
(FIG. 1D) as described earlier (Wolbank, 2009, loc cit; Yanez, Stem
Cells (2006), 24: 2582-2591).
[0177] In order to test and compare the influence of conditioned
medium from pre-senescent and senescent HUVECs on growth
characteristics of ASCs, cells were incubated with the respective
supernatant for a period of 5 d. Although cell viabilities remained
unaltered in each test setting throughout the whole experiment
(data not shown), ASCs cultivated in the presence of senescent
supernatants reached significantly higher cell numbers than cells
cultivated in the presence of pre-senescent or control medium (FIG.
2A). Additionally, supernatants derived from senescent cells
significantly reduced the osteogenic differentiation potential as
stained by Alizarin Red of ASCs after 21 d of incubation with
differentiation medium (FIG. 2B).
EXAMPLE 10
Exosomes of Senescent HUVECS Increase Proliferation and Reduce
Differentiation Capacity of ASCS
[0178] Exosomes are membrane coated vesicles, which are between 40
and 100 nm in diameter, and originate from intracellular
multivesicular bodies (Pap, Inflamm Res (2009), 58: 1-8). Since
recently exosomes have been described as paracrine signalling
molecules in various settings (Deregibus, Blood (2007), 110:
2440-2448; Hunter, PLoS ONE (2008), 3: e3694; Lehmann, loc cit;
Pap, loc cit), it was tested whether exosomes might contribute to
the changes in ASC behaviour. Therefore, exosomes were isolated
from HUVEC supernatants by sequential centrifugation steps
(Deregibus, loc cit). To confirm the identity of the exosomes
electron microscopy was performed. The size distribution strongly
indicates that no apoptotic vesicles are visible in our exosome
preparations since apoptotic bodies are >500 nm in size (Reich,
Exp Cell Res (2009), 315: 760-768) (FIG. 3A). Furthermore, Western
blot analysis (FIG. 3B) as well as immunogold labelling (FIG. 3C)
using antibodies against CD63 surface protein--a commonly used
marker of exosomes (Valadi, Nat Cell Biol (2007), 9: 654-9). (FIG.
3A-C) suggest that the exosome isolation was successful.
[0179] When ASCs were treated with exosomes derived from senescent
HUVECs, the proliferation rate was again significantly increased
(FIG. 3D) compared to stem cells treated with exosomes derived from
pre-senescent endothelial cells. Moreover, osteogenic
differentiation capacity was significantly decreased by .about.50%
when cells were treated with senescent exosomes (FIG. 3E), whereas
adipogenic differentiation was not influenced (data not shown).
EXAMPLE 11
miR-31 is Secreted by Endothelial Cells
[0180] It was shown that beside different proteins, also miRNAs are
packed into exosomes (Valadi, loc cit). miR-31 was shown to be
upregulated in senescent HUVECs (FIG. 4A). Furthermore, it was
tested whether it is also present in HUVEC culture supernatants
(FIG. 4B) and exosomes derived from senescent versus pre-senescent
endothelial cells (FIG. 4C). Since up to 12-fold changes were
detected by qPCR, the localization of miRNAs within exosomes was
confirmed by electron microscopy in situ hybridization (EM-ISH).
While so far only biochemical assays suggested that miRNAs are
inside of exosomes, in context with the present invention, first
microscopic proof is provided that miRNAs are indeed packaged into
exosomes (FIG. 4D).
EXAMPLE 12
ASCs take Up Exosomes Derived from HUVECS
[0181] In order to test whether endothelial derived miR-31 is taken
up by ASCs, ASCs were incubated with SN and exosomes from HUVECs.
Indeed, after 48 h a 4-5 fold increase of miR-31 inside of ASCs was
observed (FIG. 5A). From these data it was not clear if exosomes
are taken up by ASCs or if other components contained within the
exosome preparations would induce de novo transcription of miR-31
within ASCs. Therefore, stable transfected senescent endothelial
cells expressing GFP (FIG. 5B) were prepared as it was recently
published that GFP is packaged into exosomes (Deregibus, loc cit).
Two days after incubation with GFP positive exosomes, ASCs showed
GFP signals in a punctuate pattern within the cytoplasm while ASCs
treated with the supernatant depleted of GFP-exosomes showed no
signals (FIG. 5C). To further confirm the exosome uptake, ASCs were
transfected with a dominant negative dynamin construct (K44A) and
dynamin wild type construct as control (Cao, Mol Biol Cell (1998),
9: 2595-2609; Cao, J Cell Sci (2000), 113 (Pt 11): 1993-2002).
Dynamin was shown to be responsible for endocytosis in eukaryotic
cells (Cao, 1998, loc cit; Cao, 2000, loc cit) and endocytosis is
responsible for uptake of exosomes (Valadi, loc cit). Indeed, as
shown in FIG. 5D, miR-31 levels were decreased in ASCs transfected
with the dominant negative dynamin construct (K44A).
[0182] These results show that miR-31 is indeed taken up via the
exosomes and not by induction in consequence of signal transduction
through the membrane, it seems that this uptake resembles
transfections in vitro, where lipids containing DNA or RNA deliver
their cargo into the cells.
EXAMPLE 13
miR-31 Alone Reduces Osteogenic Differentiation of ASCs
[0183] In order to investigate the effect of miR-31 alone on
differentiation, ASCs were transiently transfected with miR-31.
Elevated miR-31 levels were confirmed using TaqMan assay (FIG. 6A).
The influence of miR-31 on the differentiation capacity of ASCs was
invesitigated and osteogenic differentiation was significantly
inhibited by around 2-fold when ASCs were transiently transfected
with miR31 (FIG. 6B), a similar range of inhibition as seen with
the exosomes alone. These data indicate that miR-31 is an inhibitor
of osteogenic differentiation that might be secreted by endothelial
cells especially at senescence.
EXAMPLE 14
Target of miR-31
[0184] FZD3 mRNA levels were indicated to be increased in MSCs
under osteogenic conditions (Baksh, J Cell Biochem (2007), 101:
1109-1124). In context of the present invention, it was upregulated
after 4 days compared to cells treated with control medium (FIG.
7A). Moreover, FZD3 levels were significantly downregulated after
treatment with senescent exosomes compared to treatment with young
exosomes and control treated cells (FIG. 7B). 24 h after miR-31
transfection, FDZ3 was also downregulated but did not reach
significant levels, which might be explained due to the very low
mRNA levels of FDZ3 when cells are not differentiating (FIG. 7C).
Thus, FZD3 represents not only a marker but also a necessary factor
for osteogenic differentiation and might be a direct target of
miR-31 also in ASCs.
EXAMPLE 15
Effects of Exosomes Derived from Plasma on ASCS
[0185] It was confirmed that exosomes existed in the blood plasma
using electron microscopy (FIG. 8A). Then, RNA was isolated from
blood serum from 21 healthy young (19-47 years) and 27 old donors
(50-91 years) and miR-31 levels were analyzed. As has been found in
context of the present invention, they were significantly increased
in elderly people and showed larger variations compared to young
donors (FIG. 8B). Furthermore, cells were treated with exosomes
derived from 1 ml plasma/1 ml medium for 72 h, afterwards
differentiation was started. Using 4 different donors, a
significant decrease of around 3-fold in osteogenic differentiation
of ASCs treated with "old" exosomes (FIG. 8C) was found. The very
low differentiation in control samples could be explained by the
extremely fast differentiation of the cells treated with exosomes
derived from serum. Additionally, herein it was shown that miR-31
levels in plasma derived from osteopenia patients were elevated
compared to healthy age matched controls (FIG. 8D).
EXAMPLE 16
Oxidative Stress Induces Senescence
[0186] Oxidative stress is known to be associated with endothelial
senescence and dysfunction (Seals, Clin Sci (Lond) (2011), 120(9):
357-375). To test whether oxidative stress induces secretion of
miR-31, SIPS (stress-induce premature senescence) was induced by
tBHP treatment of HUVECs on 5 consecutive days for 1 h each by
adding tBHP to a final concentration of 75 .mu.M, 50 .mu.M or 35
.mu.M in the medium. Permanent growth arrest was induced by 75
.mu.M tBHP as assessed by microscopic follow up for 14 d according
to the protocols described in Unterluggauer, Exp Gerontol (2003),
38: 1149-1160.
[0187] As a result, miR-31 was found to be elevated in exosomes of
stress-induced premature senescent endothelial cells. Using
increasing doses of H.sub.2O.sub.2 (35 .mu.M, 50 .mu.M and 75 .mu.M
tButylhydroperoxide (tBHP)), up to 5-fold induction of miR-31 was
observed in stress induced senescent HUVECs versus unstressed
controls, similar to the levels in replicatively senescent HUVECs
(FIG. 10).
[0188] Furthermore, the increase of miR-31 in the supernatant of
senescent endothelial cells is not restricted to HUVECs that are
derived from human umbilical vein endothelial cells, but was also
found in senescence of human retinal endothelial cells as well as
in senescent human liver derived endothelial cells versus early
passage control cells (data not shown).
EXAMPLE 17
miR-31 Antagonist Inhibits Osteogenic Differentiation
[0189] In order to test whether miR-31 inhibition improves
osteogenic differentiation, antagonistic locked nucleic acids (LNA)
against miR-31 were analyzed (Ambion, product ID: AM11465; P/N
AM17000). Experimental procedures for transfection of ASCs were
performed analogously as done in Example 2 above.
[0190] As has been found, a significant increase in Ca-deposition
as analysed by Alizarin red staining was observed, while transient
increase in miR-31 resulted in decreased osteogenic differentiation
(FIG. 11). These data show that inhibition or removal of miR-31
systemically or locally will improve osteoblast formation, e.g., in
osteoporosis and after fractures.
EXAMPLE 18
miR-31 Inhibits Osteogenesis in Mouse Model System
[0191] In order to confirm that miR-31 is a general regulator of
osteogenesis not only in the human system, C3Ht101/2 cell line was
used, a mouse mesenchymal mulitpotent cell line that can be induced
to undergo osteogenic differentiation by addition of BMP2 (Richard,
PLoS Genetic (2005), 1(6): e74). As readout, cells were
co-transfected with a reporter construct encoding luciferase under
control of the osteocalcin promoter (Feichtinger, Tissue Eng Part C
Methods (2010), 17(4): 401-410).
[0192] The influence of miRNA-31 transfection on osteogenic
differentiation was furthermore analyzed using the (C2C12) C3Ht10
1/2 cell line in conjunction with an osteocalcin specific reporter
gene assay (Feichtinger, Tissue Eng Part C Methods (2010), 17(4):
401-410). (C2C12) C3Ht10 1/2 cells are capable of differentiating
to the osteogenic lineage upon treatment with recombinant BMPs,
which is observable by the induction of alkaline phosphatase,
osteocalcin and other osteoblast specific genes. The cells, seeded
in a T175 flask, were first transfected with 99 .mu.g of the
osteocalcin reporter system and then 24 h post reverse transfected
with 30 nM miRNA-31 or a scrambled miRNA ctrl #2 as control using
Ambions siPORT NeoFX. Osteogenic differentiation was induced using
300 ng/ml recombinant BMP2 (InductOS, Pfizer), controls were not
induced with growth factor. Osteocalcin reporter activity was
assessed after 6 d of differentiation by determining metridia
luciferase activity in the cell culture supernatants using Clontech
Ready-To-Glow Secreted Luciferase System Kit.
[0193] As a result, inhibition of osteogenesis by transient miR-31
overexpression was confirmed also in the mouse model. Furthermore,
similar to young versus old healthy humans, it was found that the
serum of old mice contains 3-10 fold higher concentrations of
miR-31 than the serum of isogenic young mice as controls (data not
shown).
EXAMPLE 19
Analysis of miR-31 in Plasma of Osteopenia Patients
[0194] Plasma of 10 male patients diagnosed with osteopenia were
compared to age matched controls provided by P. Pietschmann,
Department of Pathophysiology, General hospital, Vienna.
Institutional ethics committees approved the study, and written,
informed consent has been obtained from each subject.
[0195] Plasma was prepared according to standard procedures
clinical procedures as recommended for the analysis of miRNAs
(Taylor, Methods Mol Biol (2011), 728: 235-246; Kroh, Methods
(2010), 50: 298-301). Total RNA was isolated using Trizol LS. The
qPCR was then performed using Taqman.RTM. protocol, where in a
first step a specific reverse transcription and then amplification
is performed. The amplification of specific miR-31 amplicons is
monitored by displacing a fluorescently labelled probe by the
amplification. The assays were run in triplicates and differential
expression of miR-31 was normalized to the small U6 snRNA. In
addition a spike in control of a C. elegans specific miRNA was
performed to normalize for miRNA recovery during the full RNA
isolation-quantification procedure. PCR was performed as detailed
below.
TABLE-US-00005 TaqMan Protokoll (hsa-miR-31) Applied Biosystems
cDNA synthesis: 2 .times. mastermix: containing miR-31 and U6
primers volume [.mu.l]: of reactions: 100 mM dNTPs 0.10 MultiScribe
RT 0.60 10 .times. Buffer 1.00 RNase inhibitor 0.12 Nuclease free
5.18 water + RNA RT-Primer 2.00 Total 9.00 RNA (10 ng/.mu.l) 1.00
Total 10.00 Program: 16.degree. C.: 30 min 42.degree. C.: 60 min
85.degree. C.: 5 min 4.degree. C.: pause TaqMan Primer: Applied
Biosystems Assay Name hsa-miR-31 Part Number 4427975 AB Assay ID
001100 Assay Type Mature miRNA Availability Inventoried Mature
MicroRNA Details Mature miRNA GGCAAGAUGCUGGCAUAGCUG Sequence (SEQ
ID NO: 19) Target Species Gorilla gorilla, Macaca mulatta, Macaca
nemestrina, Pan paniscus, Pongo pygmaeus, Pan troglodytes miRBase
ID ggo-miR-31, mm1-miR-31, mne-miR-31, ppa-miR-31, ppy-miR-31,
ptr-miR-31 miRBase Accession MIMAT0002381, MIMAT0002379, Number
MIMAT0002383, MIMAT0002384, MIMAT0002382, MIMAT0002380 miRBase
Alias hsa-miR-31 v9.2 Gene Family ID MIPF0000064, mir-31 Device and
software: Rotor-Gene 6000; Rotor-GeneSoftware 6000, Series Software
1.7
Sequence CWU 1
1
37121RNAHomo Sapiens 1aggcaagaug cuggcauagc u 2128RNAartificial
sequenceseed sequence of miR-31 2ggcaagau 8371RNAHomo Sapiens
3ggagaggagg caagaugcug gcauagcugu ugaacuggga accugcuaug ccaacauauu
60gccaucuuuc c 7141454DNAHomo Sapiens 4tttgtcttgt ctaaggtgga
aatcttgtgc tgtttaaaaa gcagatttta ttctttgcct 60tttgcatgac tgatagctgt
aactcacagt taacatgctt tcagtcaagt acagattgtg 120tccactggaa
aggtaaatga ttgctttttt atattgcatc aaacttggaa catcaaggca
180tccaaaacac taagaattct atcatcacaa aaataattcg tctttctagg
ttatgaagag 240ataattattt gtctggtaag catttttata aacccactca
ttttatattt agaaaaatcc 300taaatgtgtg gtgactgctt tgtagtgaac
tttcatatac tataaactag ttgtgagata 360acattctggt agctcagtta
ataaaacaat ttcagaatta aagaaatttt ctatgcaagg 420tttacttctc
agatgaacag taggactttg tagttttatt tccactaagt gaaaaaagaa
480ctgtgttttt aaactgtagg agaatttaat aaatcagcaa gggtatttta
gctaatagaa 540taaaagtgca acagaagaat ttgattagtc tatgaaaggt
tctcttaaaa ttctatcgaa 600ataatcttca tgcagagata ttcagggttt
ggattagcag tggaataaag agatgggcat 660tgtttcccct ataattgtgc
tgtttttata acttttgtaa atattacttt ttctggctgt 720gtttttataa
cttatccata tgcatgatgg aaaaatttta atttgtagcc atcttttccc
780atgtaatagt attgattcat agagaactta atgttcaaaa tttgctttgt
ggaggcatgt 840aataagataa acatcataca ttataaggta accacaatta
caaaatggca aaacattttc 900tctgtattca ttgttgtatt tttctacagt
gagatgtgat cttgccaaag ccaccagacc 960ttggcttcca ggccctcctg
tagtgagttg attgtctgca cttgccttgc ccaatagcca 1020gtaggctaca
gcttttgccc cacaccctta ttttcagatt ctggatcatt cttgtttaca
1080actgaaatat atataacctc agtccaaagt ggtgattgat ttgagtattt
gaaaattgtt 1140gtagctaaat gaagcatgat tagtcttagt atgaatatca
tttaatcttt aaaaaatcaa 1200gtaaaaatgt ttatctgata atgtttaaat
aatttacaat ataaactgta aaacttatta 1260ggcatgaaat caatcagaag
agaaagaaaa atgctggaac atgcttgatg tattatgtaa 1320aaagcatatt
taaacaaggg tcctcaaccc tgactgcaga taagaatcac ttgggttact
1380tcagatgcct aacaccttcc tctcatacaa ataagaattg gtagctttct
taaaaaaaaa 1440aaaaaaaaaa aaaa 1454519DNAartificial
sequenceanti-miR-31 (artificial LNA sequence) 5gctatgccag catcttgcc
19621RNAartificial sequencecomplementary sequence 6agcuaugcca
gcaucuugcc u 2178RNAartificial sequencecomplementary sequence
7aucuugcc 8871RNAartificial sequencecomplementary sequence
8ggaaagaugg caauauguug gcauagcagg uucccaguuc aacagcuaug ccagcaucuu
60gccuccucuc c 71922RNAHomo sapiens 9gaggcaagau gcuggcauag cu
221022RNAHomo sapiens 10aggcaagaug cuggcauagc ug 221123RNAHomo
sapiens 11aggcaagaug cuggcauagc ugu 231221RNAHomo sapiens
12aggcaagaug cuggcauagc u 211320RNAHomo sapiens 13aggcaagaug
cuggcauagc 201419RNAHomo sapiens 14aggcaagaug cuggcauag
191524RNAHomo sapiens 15aggcaagaug cuggcauagc uguu 241617RNAHomo
sapiens 16aggcaagaug cuggcau 171718RNAHomo sapiens 17aggcaagaug
cuggcaua 181816RNAHomo sapiens 18aggcaagaug cuggca 161921RNAHomo
sapiens 19ggcaagaugc uggcauagcu g 212020RNAHomo sapiens
20ggcaagaugc uggcauagcu 202123RNAHomo sapiens 21ggcaagaugc
uggcauagcu guu 232222RNAHomo sapiens 22ggcaagaugc uggcauagcu gu
222323RNAHomo sapiens 23ugcuaugcca acauauugcc auc 232422RNAHomo
sapiens 24ugcuaugcca acauauugcc au 222521RNAHomo sapiens
25ugcuaugcca acauauugcc a 212624RNAHomo sapiens 26ugcuaugcca
acauauugcc aucu 242722RNAHomo sapiens 27gcuaugccaa cauauugcca uc
222821RNAHomo sapiens 28cuaugccaac auauugccau c 212919DNAartificial
sequenceforward primer 29acgcggcaag atgctggca 193019DNAartificial
sequencereverse primer 30cagtgctggg tccgagtga 193155DNAartificial
sequenceprimer 31gtcgtatcca gtgcagggtc cgaggtattc gcactggata
cgacagctat gcctg 553217DNAartificial sequenceforward primer
32tgaccgaggc aagatgc 173316DNAartificial sequencereverse primer
33gtgcagggtc cgaggt 163411RNAartificial sequenceseed sequence of
MiR-31 plus one nucleotide at the 5'-end and two nucleotides at the
3' -end 34aggcaagaug c 113510RNAartificial sequenceseed sequence of
MiR-31 plus one nucleotide at the 5'-end and one nucleotide at the
3' -end 35aggcaagaug 103610RNAartificial sequenceseed sequence of
MiR-31 plus one nucleotide at the 5'-end and one nucleotide at the
3' -end which has been substituted by U 36aggcaagauu
103710RNAartificial sequenceseed sequence of MiR-31 plus two
nucleotides at the 3' -end 37ggcaagaugc 10
* * * * *
References