U.S. patent application number 13/543200 was filed with the patent office on 2013-04-25 for endophytes and related methods.
This patent application is currently assigned to AGRICULTURE VICTORIA SERVICES PTY LTD. The applicant listed for this patent is Piyumi Ekanayake, John White Forster, Kathryn Michaela Guthridge, Jatinder Kaur, Emma Jane Isobel Ludlow, Maia Andrea Rabinovich, Simone Jane Rochfort, Timothy Ivor Sawbridge, German Carlos Spangenberg. Invention is credited to Piyumi Ekanayake, John White Forster, Kathryn Michaela Guthridge, Jatinder Kaur, Emma Jane Isobel Ludlow, Maia Andrea Rabinovich, Simone Jane Rochfort, Timothy Ivor Sawbridge, German Carlos Spangenberg.
Application Number | 20130104263 13/543200 |
Document ID | / |
Family ID | 48137105 |
Filed Date | 2013-04-25 |
United States Patent
Application |
20130104263 |
Kind Code |
A1 |
Spangenberg; German Carlos ;
et al. |
April 25, 2013 |
Endophytes and related methods
Abstract
The present invention relates to a method for identifying and/or
characterising an endophyte strain, said method including providing
a plurality of samples of endophytes, subjecting said endophytes to
genetic analysis, subjecting said endophytes to metabolic analysis
and selecting endophytes having a desired genetic and metabolic
profile. The present invention also relates to novel endophytes
having a desired toxin profile wherein the endophyte produces
significantly less toxic alkaloids compared with a control
endophyte such as standard toxic (ST) endophyte; and/or
significantly more alkaloids conferring beneficial properties
compared with a control endophyte such as ST endophyte. The present
invention also relates to endophyte variants having a desired
genetic and metabolic profile, wherein said endophyte variants
possess genetic and/or metabolic characteristics that result in a
beneficial phenotype in a plant harbouring or otherwise associated
with the endophyte variant. Preferably said endophyte variants are
generated by polyploidisation or induced chromosome doubling.
Inventors: |
Spangenberg; German Carlos;
(Bundoora, AU) ; Guthridge; Kathryn Michaela;
(Hadfield, AU) ; Forster; John White; (Diamond
Creek, AU) ; Sawbridge; Timothy Ivor; (Coburg,
AU) ; Ludlow; Emma Jane Isobel; (Viewbank, AU)
; Kaur; Jatinder; (Taylors Hill, AU) ; Rochfort;
Simone Jane; (Reservoir, AU) ; Rabinovich; Maia
Andrea; (Buenos Aires, AR) ; Ekanayake; Piyumi;
(Bundoora, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Spangenberg; German Carlos
Guthridge; Kathryn Michaela
Forster; John White
Sawbridge; Timothy Ivor
Ludlow; Emma Jane Isobel
Kaur; Jatinder
Rochfort; Simone Jane
Rabinovich; Maia Andrea
Ekanayake; Piyumi |
Bundoora
Hadfield
Diamond Creek
Coburg
Viewbank
Taylors Hill
Reservoir
Buenos Aires
Bundoora |
|
AU
AU
AU
AU
AU
AU
AU
AR
AU |
|
|
Assignee: |
AGRICULTURE VICTORIA SERVICES PTY
LTD
Attwood
AU
|
Family ID: |
48137105 |
Appl. No.: |
13/543200 |
Filed: |
July 6, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/AU2011/000020 |
Jan 7, 2011 |
|
|
|
13543200 |
|
|
|
|
Current U.S.
Class: |
800/298 ;
435/254.1; 435/254.11; 435/29; 435/320.1; 435/6.11; 435/6.12;
536/23.74 |
Current CPC
Class: |
A01H 17/00 20130101;
A01H 5/10 20130101; C12Q 2600/156 20130101; C12N 1/14 20130101;
C12Q 1/6895 20130101; A01H 5/12 20130101 |
Class at
Publication: |
800/298 ;
435/6.11; 435/254.1; 435/29; 435/6.12; 536/23.74; 435/320.1;
435/254.11 |
International
Class: |
C12N 1/14 20060101
C12N001/14; C12Q 1/68 20060101 C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 7, 2010 |
AU |
2010900054 |
Jun 25, 2010 |
AU |
2010902821 |
Jun 1, 2012 |
AU |
2012902275 |
Jun 1, 2012 |
AU |
2012902276 |
Claims
1. A method for identifying and/or characterising an endophyte
strain, said method including: providing a plurality of samples of
endophytes; subjecting said endophytes to genetic analysis;
subjecting said endophytes to metabolic analysis; and selecting
endophytes having a desired genetic and metabolic profile.
2. A method according to claim 1, further including assessing
geographic origin of the endophytes and selecting endophytes having
a desired genetic and metabolic profile and a desired geographic
origin.
3. A method according to claim 1 wherein the plurality of samples
of endophytes are provided by a method including: providing a
plurality of plant samples; and isolating endophytes from said
plant samples.
4. A substantially purified or isolated endophyte having a desired
toxin profile, wherein the endophyte produces significantly less
toxic alkaloids compared with a control endophyte; and/or
significantly more alkaloids conferring beneficial properties
compared with a control endophyte.
5. An endophyte according to claim 4, wherein said beneficial
properties include improved tolerance to water and/or nutrient
stress and/or improved resistance to pests and/or diseases in the
plant with which the endophyte is associated.
6. An endophyte according to claim 5, wherein said alkaloids
conferring beneficial properties are selected from the group
consisting of peramine, N-formylloline, N-acetylloline and
norloline.
7. An endophyte according to claim 4, wherein said toxic alkaloids
include ergovaline.
8. An endophyte according to claim 4, wherein said endophyte is
isolated from a fescue species.
9. An endophyte according to claim 8, wherein said fescue species
is tall fescue.
10. An endophyte according to claim 4, wherein said endophyte is
from the genus Neotyphodium.
11. An endophyte according to claim 4, wherein said toxic alkaloids
are present in an amount less than approximately 1 .mu.g/g dry
weight.
12. An endophyte according to claim 4, wherein said alkaloids
conferring beneficial properties are present in an amount of
between approximately 5 and 100 .mu.g/g dry weight.
13. A substantially purified or isolated endophyte selected from
the group consisting of E1, NEA10, NEA11, NEA12, NEA13, NEA14,
NEA16, NEA17, NEA18, NEA19, NEA20, NEA21 and NEA23.
14. A plant inoculated with an endophyte according to claim 13,
wherein the inoculated plant is otherwise free of endophytes.
15. A plant, plant seed or other plant part derived from a plant
according to claim 14 and stably infected with an endophyte
according to claim 13.
16. A method of producing a modified plant comprising stably
infecting a host plant with an endophyte according to claim 13.
17. A method of analysing metabolites in a plurality of endophytes,
said method including: providing: a plurality of endophytes; and a
plurality of isogenic plants; inoculating each isogenic plant with
an endophyte; culturing the endophyte-infected plants; and
analysing the metabolites produced by the endophyte-infected
plants.
18. A method of quantifying endophyte content of a plant, said
method including measuring copies of a target sequence by
quantitative PCR.
19. A substantially purified or isolated nucleic acid encoding a
polypeptide or transcription factor involved in sexual reproduction
or vegetative hyphal fusion in an endophyte.
20. A genetic construct including a nucleic acid according to claim
10.
21. An endophyte variant having a desired genetic and metabolic
profile, wherein said endophyte variant possesses genetic and/or
metabolic characteristics that result in a beneficial phenotype in
a plant harbouring, or otherwise associated with, the endophyte
variant and wherein said beneficial phenotype is selected from the
group consisting of improved tolerance to water and/or nutrient
stress, improved resistance to pests and/or diseases, enhanced
biotic stress tolerance, enhanced drought tolerance, enhanced water
use efficiency, reduced toxicity and enhanced vigour; in the plant
with which the endophyte is associated, relative to a control
endophyte such as standard toxic (ST) endophyte or to a no
endophyte control plant.
22. An endophyte variant according to claim 21, wherein said
endophyte variant is generated by polyploidisation or induced
chromosome doubling.
23. An endophyte variant according to claim 22, wherein said
endophyte variant is generated by treating an endophyte with
colchicine or a similar compound that induces polyploidisation or
induced chromosome doubling.
24. An endophyte variant according to claim 21, wherein said
endophyte variant is generated by subjecting an endophyte to X-ray
mutagenesis or exposing an endophyte to ionising radiation.
25. An endophyte variant according to claim 21, wherein said
endophyte variant is generated from an endophyte which is isolated
from a Lolium species.
26. An endophyte variant according to claim 25, wherein said Lolium
species is Lolium perenne.
27. An endophyte variant according to claim 21, wherein said
endophyte variant is generated from an endophyte of the genus
Neotyphodium.
28. An endophyte variant according to claim 27, wherein said
endophyte variant is generated from an endophyte of a species
selected from the group consisting of N. uncinatum, N. coenophialum
and N. lolii.
29. An endophyte variant selected from the group consisting of
NEA12dh5, NEA12dh6, NEA12dh13, NEA12dh14, and NEA12dh17.
30. A plant inoculated with an endophyte according to claim 29,
wherein the inoculated plant is otherwise free of endophytes.
31. A plant, plant seed or other plant part derived from a plant
according to claim 30 and stably infected with an endophyte
according to claim 29.
32. A method of producing a modified plant comprising stably
infecting a host plant with an endophyte according to claim 29.
Description
STATEMENT OF RELATED CASES
[0001] This application is a continuation in part of
PCT/AU2011/000020, filed Jan. 7, 2011, which claims priority from
Australian Patent Application filed Jan. 7, 2010, and Australian
Patent Application 2010902821, filed Jun. 25, 2010, and also claims
priority from Australian Patent Application Nos. 2012902275 and
2012902276, filed Jun. 1, 2012. All of these applications are
incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to endophytic fungi
(endophytes), including modified variants thereof, and to nucleic
acids thereof. The present invention also relates to plants
infected with endophytes and to related methods, including methods
of selecting, breeding, characterising and/or modifying
endophytes.
BACKGROUND OF THE INVENTION
[0003] Important forage grasses perennial ryegrass and tall fescue
are commonly found in association with fungal endophytes.
[0004] Both beneficial and detrimental agronomic properties result
from the association, including improved tolerance to water and
nutrient stress and resistance to insect pests.
[0005] Insect resistance is provided by specific metabolites
produced by the endophyte, in particular loline alkaloids and
peramine. Other metabolites produced by the endophyte, lolitrems
and ergot alkaloids, are toxic to grazing animals and reduce
herbivore feeding.
[0006] Considerable variation is known to exist in the metabolite
profile of endophytes. Endophyte strains that lack either or both
of the animal toxins have been introduced into commercial
cultivars.
[0007] Molecular genetic markers such as simple sequence repeat
(SSR) markers have been developed as diagnostic tests to
distinguish between endophyte taxa and detect genetic variation
within taxa. The markers may be used to discriminate endophyte
strains with different toxin profiles.
[0008] However, there remains a need for methods of identifying,
isolating, characterising and/or modifying endophytes and a need
for new endophyte strains having desired properties.
[0009] In the fungal kingdom, there is no differentiation of
individuals into sexes generating different gametes, but instead
mating-type identity is determined by inheritance of alleles at
specific mating-type loci.
[0010] The mating-type (MAT) genes constitute master regulators of
sexual reproduction in filamentous fungi. Although mating-type loci
consist of one to a few linked genes, and are thus limited to a
small genomic region, alternate sequences at MAT, denoted
idiomorphs, lack significant sequence similarity and encode
different transcriptional regulators.
[0011] Fusion events are required during sexual reproduction in
filamentous ascomycete species. Although cell fusion processes
associated with vegetative growth as opposed to sexual development
serve different developmental functions, both require extracellular
communication and chemotropic interactions, followed by cell wall
breakdown, membrane-merger and pore formation.
[0012] A number of genes have been characterised that are required
for both sexual reproduction and vegetative hyphal fusion,
including components of the MAPK pathway which is activated in
response to pheromone perception during mating. The expression of
pheromone precursors and pheromone receptor genes is directly
controlled by transcription factors encoded by the mating-type
genes.
[0013] Hyphal fusion occurs readily within an individual colony
during vegetative growth, maintaining the physiological continuity
of the organism. Hyphal fusion between different endophyte strains
of opposite mating-type may be promoted by treating the mycelia
with a combination of cell wall-degrading enzymes and fusion agents
such as PEG4000.
[0014] However, there remains a need for methods of molecular
breeding of endophytes and for new endophyte strains having desired
properties.
[0015] Neotyphodium endophytes are not only of interest in
agriculture, as they are a potential source for bioactive molecules
such as insecticides, fungicides, other biocides and
bioprotectants, allelochemicals, medicines and nutraceuticals.
[0016] Difficulties in artificially breeding of these endophytes
limit their usefulness. For example, many of the novel endophytes
known to be beneficial to pasture-based agriculture exhibit low
inoculation frequencies and are less stable in elite germplasm.
Thus, there remains a need for methods of generating novel, highly
compatible endophytes.
[0017] There also remains a need for more endophyte strains with
desirable properties and for more detailed characterisation of
their toxin and metabolic profiles, antifungal activity, stable
host associations and their genomes.
[0018] It is an object of the present invention to overcome, or at
least alleviate, one or more of the difficulties or deficiencies
associated with the prior art.
[0019] In a first aspect, the present invention provides a method
for selecting and/or characterising an endophyte strain, said
method including: [0020] providing a plurality of samples of
endophytes; [0021] subjecting said endophytes to genetic analysis;
[0022] subjecting said endophytes to metabolic analysis; and [0023]
selecting endophytes having a desired genetic and metabolic
profile.
[0024] In a preferred embodiment, this aspect of the invention may
include the further step of assessing geographic origin of the
endophytes and selecting endophytes having a desired genetic and
metabolic profile and a desired geographic origin.
[0025] In a preferred embodiment, the plurality of samples of
endophytes may be provided by a method including: [0026] providing
a plurality of plant samples; and [0027] isolating endophytes from
said plant samples.
[0028] In a preferred embodiment, the method may be performed using
an electronic device, such as a computer.
[0029] Applicant has surprisingly found that specific detection of
endophytes in planta with markers such as SSR markers has provided
the tools for efficient assessment of endophyte genetic diversity
in diverse grass populations and the potential discovery of novel
endophyte strains.
[0030] A large scale endophyte discovery program was undertaken to
establish a `library` of novel endophyte strains. A collection of
perennial ryegrass and tall fescue accessions was established.
[0031] Genetic analysis of endophytes in these accessions has lead
to the identification of a number of novel endophyte strains. These
novel endophyte strains are genetically distinct from known
endophyte strains.
[0032] Metabolic profiling was undertaken to determine the toxin
profile of these strains grown in vitro and/or following
inoculation in planta.
[0033] Specific detection of endophytes in planta with SSR markers
may be used to confirm the presence and identity of endophyte
strains artificially inoculated into, for example, grass plants,
varieties and cultivars.
[0034] The endophytes have been genetically characterised to
demonstrate genetic distinction from known endophyte strains and to
confirm the identity of endophyte strains artificially inoculated
into, for example, grass plants, varieties and cultivars.
[0035] By a `plurality` of samples of endophytes or plant samples
is meant a number sufficient to enable a comparison of genetic and
metabolic profiles of individual endophytes. Preferably, between
approximately 10 and 1,000,000 endophytes are provided, more
preferably between approximately 100 and 1,000 endophytes.
[0036] Phenotypic screens were established to select for novel
`designer` grass-endophyte associations. These screens were for
desirable characteristics such as enhanced biotic stress tolerance,
enhance drought tolerance and enhanced water use efficiency, and
enhanced plant vigour.
[0037] Novel `designer` endophytes were generated by targeted
methods including polyploidisation and X-ray mutagenesis.
[0038] These endophytes may be characterised, for example using
antifungal bioassays, in vitro growth rate assays and/or genome
survey sequencing (GSS).
[0039] Metabolic profiling may also be undertaken to determine the
toxin profile of these strains grown in vitro and/or following
inoculation in planta.
[0040] These endophytes may be delivered into plant germplasm to
breed `designer` grass endophyte associations.
[0041] Specific detection of endophytes in planta with SSR markers
may be used to confirm the presence and identity of endophyte
strains artificially inoculated into, for example, grass plants,
varieties and cultivars.
[0042] The endophytes may be subject to genetic analysis
(genetically characterized) to demonstrate genetic distinction from
known endophyte strains and to confirm the identity of endophyte
strains artificially inoculated into, for example, grass plants,
varieties and cultivars.
[0043] By `genetic analysis` is meant analysing the nuclear and/or
mitochondrial DNA of the endophyte.
[0044] This analysis may involve detecting the presence or absence
of polymorphic markers, such as simple sequence repeats (SSRs) or
mating-type markers. SSRs, also called microsatellites, are based
on a 1-7 nucleotide core element, more typically a 1-4 nucleotide
core element, that is tandemly repeated. The SSR array is embedded
in complex flanking DNA sequences. Microsatellites are thought to
arise due to the property of replication slippage, in which the DNA
polymerase enzyme pauses and briefly slips in terms of its
template, so that short adjacent sequences are repeated. Some
sequence motifs are more slip-prone than others, giving rise to
variations in the relative numbers of SSR loci based on different
motif types. Once duplicated, the SSR array may further expand (or
contract) due to further slippage and/or unequal sister chromatid
exchange. The total number of SSR sites is high, such that in
principle such loci are capable of providing tags for any linked
gene.
[0045] SSRs are highly polymorphic due to variation in repeat
number and are co-dominantly inherited. Their detection is based on
the polymerase chain reaction (PCR), requiring only small amounts
of DNA and suitable for automation. They are ubiquitous in
eukaryotic genomes, including fungal and plant genomes, and have
been found to occur every 21 to 65 kb in plant genomes.
Consequently, SSRs are ideal markers for a broad range of
applications such as genetic diversity analysis, genotypic
identification, genome mapping, trait mapping and marker-assisted
selection.
[0046] Known SSR markers which may be used to investigate endophyte
diversity in perennial ryegrass are described in van 41 de Jong et
al (2003).
[0047] Alternatively, or in addition, the genetic analysis may
involve sequencing genomic and/or mitochondrial DNA and performing
sequence comparisons to assess genetic variation between
endophytes.
[0048] The endophytes may be subject to metabolic analysis to
identify the presence of desired metabolic traits.
[0049] By `metabolic analysis` is meant analysing metabolites, in
particular toxins, produced by the endophytes. Preferably, this is
done by generation of inoculated plants for each of the endophytes
and measurement of toxin levels in planta. More preferably, this is
done by generation of isogenically inoculated plants for each of
the endophytes and measurement of toxin levels in planta.
[0050] By a `desired genetic and metabolic profile` is meant that
the endophyte includes genetic and metabolic characteristics that
result in a beneficial phenotype in a plant harbouring, or
otherwise associated with, the endophyte.
[0051] Such beneficial properties include improved tolerance to
water and/or nutrient stress, improved resistance to pests and/or
diseases, enhanced biotic stress tolerance, enhanced drought
tolerance, enhanced water use efficiency, reduced toxicity and
enhanced vigour in the plant with which the endophyte is
associated, relative to a control endophyte such as standard toxic
(ST) endophyte or to a no endophyte control plant.
[0052] For example, tolerance to water and/or nutrient stress may
be increased by at least approximately 5%, more preferably at least
approximately 10%, more preferably at least approximately 25%, more
preferably at least approximately 50%, more preferably at least
approximately 100%, relative to a control endophyte such as
standard toxic (ST) endophyte or to no endophyte control plant.
Preferably, tolerance to water and/or nutrient stress may be
increased by between approximately 5% and approximately 50%, more
preferably between approximately 10% and approximately 25%,
relative to a control endophyte such as ST or to a no endophyte
control plant.
[0053] Such beneficial properties also include reduced toxicity of
the associated plant to grazing animals.
[0054] For example, toxicity may be reduced by at least
approximately 5%, more preferably at least approximately 10%, more
preferably at least approximately 25%, more preferably at least
approximately 50%, more preferably at least approximately 100%,
relative to a control endophyte such as ST endophyte. Preferably,
toxicity may be reduced by between approximately 5% and
approximately 100%, more preferably between approximately 50% and
approximately 100% relative to a control endophyte such as ST
endophyte.
[0055] In a preferred embodiment toxicity may be reduced to a
negligible amount or substantially zero toxicity.
[0056] For example, water use efficiency and/or plant vigour may be
increased by at least approximately 5%, more preferably at least
approximately 10%, more preferably at least approximately 25%, more
preferably at least approximately 50%, more preferably at least
approximately 100%, relative to a control endophyte such as ST or
to a no endophyte control plant. Preferably, tolerance to water
and/or nutrient stress may be increased by between approximately 5%
and approximately 50%, more preferably between approximately 10%
and approximately 25%, relative to a control endophyte such as ST
or to a no endophyte control plant.
[0057] The methods of the present invention may be applied to a
variety of plants. In a preferred embodiment, the methods may be
applied to grasses, preferably forage, turf or bioenergy grasses
such as those of the genera Lolium and Festuca, including L.
perenne (perennial ryegrass) and L. arundinaceum (tall fescue).
[0058] The methods of the present invention may be applied to a
variety of endophytes. In a preferred embodiment, the methods may
be applied to fungi of the genus Neotyphodium, including N. lolii
and N. coenophialum. In another preferred embodiment, the methods
may be applied to fungi of the genus Epichloe, including E.
festucae and E. typhina. However, the methods may also be used to
identify endophytes of previously undescribed taxa.
[0059] Applicants have surprisingly found that endophyte E1 is a
genetically novel, non-Neotyphodium lolii, endophyte. E1 is
representative of an as yet un-named taxon. This finding is
supported by mitochondrial and nuclear genome sequence
analysis.
[0060] While applicants do not wish to be restricted by theory, on
the basis of DNA specific content, the predicted alkaloid profile
of E1 indicates that lolitrem B toxins deleterious to animal health
are not produced by this endophyte. Endophyte E1 has the
mating-type MAT1-1, the opposite mating-type to that carried by the
N. lolii endophytes previously characterized. Endophyte E1 also has
a high inoculation success rate in perennial ryegrass as compared
to other endophytes.
[0061] Accordingly, in a second aspect, the present invention
provides a substantially purified or isolated endophyte selected
from the group consisting of E1, NEA10, NEA11 and NEA12, which were
deposited at The National Measurement Institute on 5 Jan. 2010 with
accession numbers V10/000,001, V10/000,002, V10/000,003 and
V10/000,004, respectively.
[0062] The present invention also provides a substantially purified
or isolated endophyte selected from the group consisting of NEA13
and NEA14, which were deposited at the National Measurement
Institute on 23 Dec. 2010 with accession numbers V10/030,285 and
V10/030,284, respectively.
[0063] In a further aspect the present invention provides a
substantially purified or isolated endophyte having a desired toxin
profile. Preferably the endophyte is isolated from a fescue
species, preferably tall fescue. Preferably, the endophyte is of
the genus Neotyphodium, more preferably it is from a species
selected from the group consisting of N. uncinatum, N. coenophialum
and N. lolii, most preferably N. coenophialum. The endophyte may
also be from the genus Epichloe, including E. typhina, E. baconii
and E. festucae. The endophyte may also be of the non-Epichloe
out-group. The endophyte may also be from a species selected from
the group consisting of FaTG-3 and FaTG-3 like, and FaTG-2 and
FaTG-2 like.
[0064] By a `desired toxin profile` is meant that the endophyte
produces significantly less toxic alkaloids, such as ergovaline,
compared with a plant inoculated with a control endophyte such as
standard toxic (ST) endophyte; and/or significantly more alkaloids
conferring beneficial properties such as improved tolerance to
water and/or nutrient stress and improved resistance to pests
and/or diseases in the plant with which the endophyte is
associated, such as peramine, N-formylloline, N-acetylloline and
norloline, again when compared with a plant inoculated with a
control endophyte such as ST or with a no endophyte control
plant.
[0065] For example, toxic alkaloids may be present in an amount
less than approximately 1 .mu.g/g dry weight, for example between
approximately 1 and 0.001 .mu.g/g dry weight, preferably less than
approximately 0.5 .mu.g/g dry weight, for example between
approximately 0.5 and 0.001 .mu.g/g dry weight, more preferably
less than approximately 0.2 .mu.g/g dry weight, for example between
approximately 0.2 and 0.001 .mu.g/g dry weight.
[0066] For example, said alkaloids conferring beneficial properties
may be present in an amount of between approximately 5 and 100
.mu.g/g dry weight, preferably between approximately 10 and 50
.mu.g/g dry weight, more preferably between approximately 15 and 30
.mu.g/g dry weight.
[0067] In a particularly preferred embodiment, the present
invention provides a substantially purified or isolated endophyte
selected from the group consisting of NEA16, NEA17, NEA18, NEA19,
NEA20, NEA21 and NEA23, which were deposited at The National
Measurement Institute on 3 Apr. 2012 with accession numbers
V12/001413, V12/001414, V12/001415, V12/001416, V12/001417,
V12/001418 and V12/001419, respectively. Such endophytes may have a
desired toxin profile as hereinbefore described.
[0068] In a further aspect the present invention provides an
endophyte variant having a desired genetic and metabolic profile.
Preferably the endophyte variant is generated by polyploidisation
or induced chromosome doubling, for example by treating the
endophyte with colchicine or a similar compound. Alternatively, the
endophyte variant may be generated by X-ray mutagenesis or exposing
the endophyte to ionising radiation, for example from a caesium
source.
[0069] Preferably the endophyte which is treated to generate the
endophyte variant is isolated from a Lolium species, preferably
Lolium perenne. Preferably, the endophyte is of the genus
Neotyphodium, more preferably it is from a species selected from
the group consisting of N. uncinatum, N. coenophialum and N. lolii,
most preferably N. lolii. The endophyte may also be from the genus
Epichloe, including E. typhina, E. baconii and E. festucae. The
endophyte may also be of the non-Epichloe out-group. The endophyte
may also be from a species selected from the group consisting of
FaTG-3 and FaTG-3 like, and FaTG-2 and FaTG-2 like.
[0070] In a preferred embodiment, the endophyte variant may have a
desired toxin profile. By a `desired toxin profile` is meant that
the endophyte produces significantly less toxic alkaloids, such as
ergovaline, compared with a plant inoculated with a control
endophyte such as standard toxic (ST) endophyte; and/or
significantly more alkaloids conferring beneficial properties such
as improved resistance to pests and/or diseases in the plant with
which the endophyte is associated, such as peramine,
N-formylloline, N-acetylloline and norloline, again when compared
with a plant inoculated with a control endophyte such as ST or with
a no endophyte control plant.
[0071] For example, toxic alkaloids may be present in an amount
less than approximately 1 .mu.g/g dry weight, for example between
approximately 1 and 0.001 .mu.g/g dry weight, preferably less than
approximately 0.5 .mu.g/g dry weight, for example between
approximately 0.5 and 0.001 .mu.g/g dry weight, more preferably
less than approximately 0.2 .mu.g/g dry weight, for example between
approximately 0.2 and 0.001 .mu.g/g dry weight.
[0072] For example, said alkaloids conferring beneficial properties
may be present in an amount of between approximately 5 and 100
.mu.g/g dry weight, preferably between approximately 10 and 50
.mu.g/g dry weight, more preferably between approximately 15 and 30
.mu.g/g dry weight.
[0073] In a particularly preferred embodiment, the present
invention provides an endophyte variant selected from the group
consisting of NEA12dh5, NEA12dh6, NEA12dh13, NEA12dh14, and
NEA12dh17, which were deposited at The National Measurement
Institute on 3 Apr. 2012 with accession numbers V12/001408,
V12/001409, V12/001410, V12/001411 and V12/001412, respectively.
Such endophytes may have a desired genetic and metabolic profile as
hereinbefore described.
[0074] In a preferred embodiment, the endlphyte may be
substantially purified.
[0075] By `substantially purified` is meant that the endophyte is
free of other organisms. The term therefore includes, for example,
an endophyte in axenic culture. Preferably, the endophyte is at
least approximately 90% pure, more preferably at least
approximately 95% pure, even more preferably at least approximately
98% pure.
[0076] The term `isolated` means that the endophyte is removed from
its original environment (eg. the natural environment if it is
naturally occurring). For example, a naturally occurring endophyte
present in a living plant is not isolated, but the same endophyte
separated from some or all of the coexisting materials in the
natural system, is isolated.
[0077] On the basis of the deposits referred to above, the entire
genome of an endophyte selected from the group consisting of E1,
NEA10, NEA11, NEA12, NEA13, NEA14, NEA21, NEA23, NEA18, NEA19,
NEA16, NEA20, NEA12dh5, NEA12dh6, NEA12dh13, NEA12dh14 and
NEA12dh17, is incorporated herein by reference.
[0078] Thus, in a further aspect, the present invention includes
identifying and/or cloning nucleic acids including genes encoding
polypeptides or transcription factors, for example transcription
factors that are involved in sexual reproduction or vegetative
hyphal fusion, in an endophyte. For example, the nucleic acids may
encode mating-type genes, such as MAT1-1.
[0079] Methods for identifying and/or cloning nucleic acids
encoding such genes are known to those skilled in the art and
include creating nucleic acid libraries, such as cDNA or genomic
libraries, and screening such libraries, for example using probes
for genes of the desired type, for example mating-type genes; or
mutating the genome of the endophyte of the present invention, for
example using chemical or transposon mutagenesis, identifying
changes in the production of polypeptides or transcription factors
of interest, for example those that are involved in sexual
reproduction or vegetative hyphal fusion, and thus identifying
genes encoding such polypeptides or transcription factors.
[0080] Thus, in a further aspect of the present invention, there is
provided a substantially purified or isolated nucleic acid encoding
a polypeptide or transcription factor from the genome of an
endophyte of the present invention. Preferably, the nucleic acid
may encode a polypeptide or transcription factor that is involved
in sexual reproduction or vegetative hyphal fusion in an
endophyte.
[0081] In a preferred embodiment, the nucleic acid may include a
mating-type gene, such as MAT1-1, or a functionally active fragment
or variant thereof.
[0082] In a particularly preferred embodiment, the nucleic acid may
include a nucleotide sequence selected from the group consisting of
sequences shown in FIG. 1 hereto, and functionally active fragments
and variants thereof.
[0083] By `nucleic acid` is meant a chain of nucleotides capable of
carrying genetic information. The term generally refers to genes or
functionally active fragments or variants thereof and or other
sequences in the genome of the organism that influence its
phenotype. The term `nucleic acid` includes DNA (such as cDNA or
genomic DNA) and RNA (such as mRNA or microRNA) that is single- or
double-stranded, optionally containing synthetic, non-natural or
altered nucleotide bases, synthetic nucleic acids and combinations
thereof.
[0084] By a `nucleic acid encoding a polypeptide or transcription
factor` is meant a nucleic acid encoding an enzyme or transcription
factor normally present in an endophyte of the present
invention.
[0085] By a `nucleic acid encoding a polypeptide or transcription
factor involved sexual reproduction or vegetative hyphal fusion` is
meant a nucleic acid encoding an enzyme or transcription factor
normally present in an endophyte of the present invention, which
catalyses or regulates a step involved in sexual reproduction or
vegetative hyphal fusion in the endophyte, or otherwise regulates
sexual reproduction or vegetative hyphal fusion in the
endophyte.
[0086] The present invention encompasses functionally active
fragments and variants of the nucleic acids of the present
invention. By `functionally active` in relation to the nucleic acid
is meant that the fragment or variant (such as an analogue,
derivative or mutant) is capable of manipulating the function of
the encoded polypeptide, for example by being translated into an
enzyme or transcription factor that is able to catalyse or regulate
a step involved in the relevant pathway, or otherwise regulate the
pathway in the endophyte. For example, the fragment or variant may
be capable of manipulating sexual reproduction or vegetative hyphal
fusion in an endophyte, for example by being translated into an
enzyme or transcription factor that is able to catalyse or regulate
a step involved in sexual reproduction or vegetative hyphal fusion
in the endophyte, or otherwise regulate sexual reproduction or
vegetative hyphal fusion in the endophyte.
[0087] Such variants include naturally occurring allelic variants
and non-naturally occurring variants. Additions, deletions,
substitutions and derivatizations of one or more of the nucleotides
are contemplated so long as the modifications do not result in loss
of functional activity of the fragment or variant. Preferably the
functionally active fragment or variant has at least approximately
80% identity to the relevant part of the above mentioned sequence
to which the fragment or variant corresponds, more preferably at
least approximately 90% identity, even more preferably at least
approximately 95% identity, most preferably at least approximately
98% identity. Such functionally active variants and fragments
include, for example, those having conservative nucleic acid
changes. Examples of suitable nucleic acid changes are also shown
in FIG. 1 hereto.
[0088] Preferably the fragment has a size of at least 20
nucleotides, more preferably at least 50 nucleotides, more
preferably at least 100 nucleotides.
[0089] By `conservative nucleic acid changes` is meant nucleic acid
substitutions that result in conservation of the amino acid in the
encoded protein, due to the degeneracy of the genetic code. Such
functionally active variants and fragments also include, for
example, those having nucleic acid changes which result in
conservative amino acid substitutions of one or more residues in
the corresponding amino acid sequence.
[0090] By `conservative amino acid substitutions` is meant the
substitution of an amino acid by another one of the same class, the
classes being as follows: [0091] Nonpolar: Ala, Val, Leu, Ile, Pro,
Met, Phe, Trp [0092] Uncharged polar: Gly, Ser, Thr, Cys, Tyr, Asn,
Gln [0093] Acidic: Asp, Glu [0094] Basic: Lys, Arg, His
[0095] Other conservative amino acid substitutions may also be made
as follows: [0096] Aromatic: Phe, Tyr, His [0097] Proton Donor:
Asn, Gln, Lys, Arg, His, Trp [0098] Proton Acceptor: Glu, Asp, Thr,
Ser, Tyr, Asn, Gln
[0099] In a further aspect of the present invention, there is
provided a genetic construct including a nucleic acid according to
the present invention.
[0100] By `genetic construct` is meant a recombinant nucleic acid
molecule.
[0101] In a preferred embodiment, the genetic construct according
to the present invention may be a vector.
[0102] By a `vector` is meant a genetic construct used to transfer
genetic material to a target cell.
[0103] The vector may be of any suitable type and may be viral or
non-viral. The vector may be an expression vector. Such vectors
include chromosomal, non-chromosomal and synthetic nucleic acid
sequences, eg. derivatives of plant viruses; bacterial plasmids;
derivatives of the Ti plasmid from Agrobacterium tumefaciens;
derivatives of the Ri plasmid from Agrobacterium rhizogenes; phage
DNA; yeast artificial chromosomes; bacterial artificial
chromosomes; binary bacterial artificial chromosomes; vectors
derived from combinations of plasmids and phage DNA. However, any
other vector may be used as long as it is replicable or integrative
or viable in the target cell.
[0104] In a preferred embodiment of this aspect of the invention,
the genetic construct may further include a promoter and a
terminator; said promoter, gene and terminator being operatively
linked.
[0105] By a `promoter` is meant a nucleic acid sequence sufficient
to direct transcription of an operatively linked nucleic acid
sequence.
[0106] By `operatively linked` is meant that the nucleic acid(s)
and a regulatory sequence, such as a promoter, are linked in such a
way as to permit expression of said nucleic acid under appropriate
conditions, for example when appropriate molecules such as
transcriptional activator proteins are bound to the regulatory
sequence. Preferably an operatively linked promoter is upstream of
the associated nucleic acid.
[0107] By `upstream` is meant in the 3'->5' direction along the
nucleic acid.
[0108] The promoter and terminator may be of any suitable type and
may be endogenous to the target cell or may be exogenous, provided
that they are functional in the target cell.
[0109] A variety of terminators which may be employed in the
genetic constructs of the present invention are also well known to
those skilled in the art. The terminator may be from the same gene
as the promoter sequence or a different gene. Particularly suitable
terminators are polyadenylation signals, such as the (CaMV)35S
polyA and other terminators from the nopaline synthase (nos) and
the octopine synthase (ocs) genes.
[0110] The genetic construct, in addition to the promoter, the gene
and the terminator, may include further elements necessary for
expression of the nucleic acid, in different combinations, for
example vector backbone, origin of replication (ori), multiple
cloning sites, spacer sequences, enhancers, introns (such as the
maize Ubiquitin Ubi intron), antibiotic resistance genes and other
selectable marker genes [such as the neomycin phosphotransferase
(nptII) gene, the hygromycin phosphotransferase (hph) gene, the
phosphinothricin acetyltransferase (bar or pat) gene], and reporter
genes [such as beta-glucuronidase (GUS) gene (gusA) and the green
fluorescent protein (GFP) gene (gfp)]. The genetic construct may
also contain a ribosome binding site for translation initiation.
The genetic construct may also include appropriate sequences for
amplifying expression.
[0111] Those skilled in the art will appreciate that the various
components of the genetic construct are operably linked, so as to
result in expression of said nucleic acid. Techniques for operably
linking the components of the genetic construct of the present
invention are well known to those skilled in the art. Such
techniques include the use of linkers, such as synthetic linkers,
for example including one or more restriction enzyme sites.
[0112] Preferably, the genetic construct is substantially purified
or isolated.
[0113] By `substantially purified` is meant that the genetic
construct is free of the genes, which, in the naturally-occurring
genome of the organism from which the nucleic acid or promoter of
the invention is derived, flank the nucleic acid or promoter. The
term therefore includes, for example, a genetic construct which is
incorporated into a vector; into an autonomously replicating
plasmid or virus; or into the genomic DNA of a prokaryote or
eukaryote; or which exists as a separate molecule (eg. a cDNA or a
genomic or cDNA fragment produced by PCR or restriction
endonuclease digestion) independent of other sequences. It also
includes a genetic construct which is part of a hybrid gene
encoding additional polypeptide sequence.
[0114] Preferably, the substantially purified genetic construct is
at least approximately 90% pure, more preferably at least
approximately 95% pure, even more preferably at least approximately
98% pure.
[0115] The term "isolated" means that the material is removed from
its original environment (eg. the natural environment if it is
naturally occurring). For example, a naturally occurring nucleic
acid present in a living plant is not isolated, but the same
nucleic acid separated from some or all of the coexisting materials
in the natural system, is isolated. Such nucleic acids could be
part of a vector and/or such nucleic acids could be part of a
composition, and still be isolated in that such a vector or
composition is not part of its natural environment.
[0116] As an alternative to use of a selectable marker gene to
provide a phenotypic trait for selection of transformed host cells,
the presence of the genetic construct in transformed cells may be
determined by other techniques well known in the art, such as PCR
(polymerase chain reaction), Southern blot hybridisation analysis,
histochemical assays (e.g. GUS assays), thin layer chromatography
(TLC), northern and western blot hybridisation analyses.
[0117] The genetic constructs of the present invention may be
introduced into plants or fungi by any suitable technique.
Techniques for incorporating the genetic constructs of the present
invention into plant cells or fungal cells (for example by
transduction, transfection, transformation or gene targeting) are
well known to those skilled in the art. Such techniques include
Agrobacterium-mediated introduction, Rhizobium-mediated
introduction, electroporation to tissues, cells and protoplasts,
protoplast fusion, injection into reproductive organs, injection
into immature embryos and high velocity projectile introduction to
cells, tissues, calli, immature and mature embryos, biolistic
transformation, Whiskers transformation, and combinations thereof.
The choice of technique will depend largely on the type of plant or
fungus to be transformed, and may be readily determined by an
appropriately skilled person. For transformation of protoplasts,
PEG-mediated transformation is particularly preferred. For
transformation of fungi PEG-mediated transformation and
electroporation of protoplasts and Agrobacterium-mediated
transformation of hyphal explants are particularly preferred.
[0118] Cells incorporating the genetic constructs of the present
invention may be selected, as described below, and then cultured in
an appropriate medium to regenerate transformed plants or fungi,
using techniques well known in the art. The culture conditions,
such as temperature, pH and the like, will be apparent to the
person skilled in the art. The resulting plants or fungi may be
reproduced, either sexually or asexually, using methods well known
in the art, to produce successive generations of transformed plants
or fungi.
[0119] In a further aspect, the present invention provides a plant
inoculated with an endophyte or endophyte variant as hereinbefore
described, said plant comprising an endophyte-free host plant
stably infected with said endophyte or endophyte variant.
[0120] Preferably, the plant is infected with the endophyte or
endophyte variant by a method selected from the group consisting of
inoculation, breeding, crossing, hybridization and combinations
thereof.
[0121] In a preferred embodiment, the plant may be infected by
isogenic inoculation. This has the advantage that phenotypic
effects of endophytes may be assessed in the absence of
host-specific genetic effects. More particularly, multiple
inoculations of endophytes may be made in plant germplasm, and
plantlets regenerated in culture before transfer to soil.
[0122] The identification of an endophyte of the opposite
mating-type that is highly compatible and stable in planta provides
a means for molecular breeding of endophytes for perennial
ryegrass. Preferably the plant may be infected by
hyper-inoculation.
[0123] Hyphal fusion between endophyte strains of the opposite
mating-type provides a means for delivery of favourable traits into
the host plant, preferably via hyper-inoculation. Such strains are
preferably selected from the group including an endophyte strain
that exhibits the favourable characteristics of high inoculation
frequency and high compatibility with a wide range of germplasm,
preferably elite perennial ryegrass and/or tall fescue host
germplasm and an endophyte that exhibits a low inoculation
frequency and low compatibility, but has a highly favourable
alkaloid toxin profile.
[0124] It has generally been assumed that interactions between
endophyte taxa and host grasses will be species specific.
Applicants have surprisingly found that endophyte from tall fescue
may be used to deliver favourable traits to ryegrasses, such as
perennial ryegrass.
[0125] In a further aspect of the present invention there is
provided a method of analysing metabolites in a plurality of
endophytes, said method including: [0126] providing: [0127] a
plurality of endophytes; and [0128] a plurality of isogenic plants;
[0129] inoculating each isogenic plant with an endophyte; [0130]
culturing the endophyte-infected plants; and [0131] analysing the
metabolites produced by the endophyte-infected plants.
[0132] By `metabolites` is meant chemical compounds, in particular
toxins, produced by the endophyte-infected plant, including, but
not limited to, lolines, peramine, ergovaline, lolitrem, and
janthitrems, such as janthitrem I, janthitrem G and janthitem
F.
[0133] By `isogenic plants` is meant that the plants are
genetically identical.
[0134] The endophyte-infected plants may be cultured by known
techniques. The person skilled in the art can readily determine
appropriate culture conditions depending on the plant to be
cultured.
[0135] The metabolites may be analysed by known techniques such as
chromatographic techniques or mass spectrometry, for example LCMS
or HPLC. In a particularly preferred embodiment, endophyte-infected
plants may be analysed by reverse phase liquid chromatography mass
spectrometry (LCMS). This reverse phase method may allow analysis
of specific metabolites (including lolines, peramine, ergovaline,
lolitrem, and janthitrems, such as janthitrem I, janthitrem G and
janthitem F) in one LCMS chromatographic run from a single
endophyte-infected plant extract.
[0136] In another particularly preferred embodiment, LCMS including
EIC (extracted ion chromatogram) analysis may allow detection of
the alkaloid metabolites from small quantities of
endophyte-infected plant material. Metabolite identity may be
confirmed by comparison of retention time with that of pure toxins
or extracts of endophyte-infected plants with a known toxin profile
analysed under substantially the same conditions and/or by
comparison of mass fragmentation patterns, for example generated by
MS2 analysis in a linear ion trap mass spectrometer.
[0137] In a particularly preferred embodiment, the endophytes may
be selected from the group consisting of E1, NEA10, NEA11, NEA12,
NEA13, NEA14, NEA21, NEA23, NEA18, NEA19, NEA16 and NEA20.
[0138] In a particularly preferred embodiment, the endophyte
variant may be selected from the group consisting of NEA12dh5,
NEA12dh6, NEA12dh13, NEA12dh14, and NEA12dh17.
[0139] In a further aspect, the present invention provides a plant,
plant seed or other plant part derived from a plant of the present
invention and stably infected with an endophyte or endophyte
variant of the present invention.
[0140] Preferably, the plant cell, plant, plant seed or other plant
part is a grass, more preferably a forage, turf or bioenergy grass,
such as those of the genera Lolium and Festuca, including L.
perenne and L. arundinaceum.
[0141] By `plant cell` is meant any self-propagating cell bounded
by a semi-permeable membrane and containing plastid. Such a cell
also required a cell wall if further propagation is desired. Plant
cell, as used herein includes, without limitation, seeds suspension
cultures, embryos, meristematic regions, callus tissue, leaves,
roots, shoots, gametophytes, sporophytes, pollen and
microspores.
[0142] In a further aspect, the present invention provides use of
an endophyte or endophyte variant as hereinbefore described to
produce a plant stably infected with said endophyte or endophyte
variant.
[0143] In a still further aspect, the present invention provides a
method of quantifying endophyte content of a plant, said method
including measuring copies of a target sequence by quantitative
PCR.
[0144] In a preferred embodiment, the method may be performed using
an electronic device, such as a computer.
[0145] Preferably, quantitative PCR may be used to measure
endophyte colonisation in planta, for example using a nucleic acid
dye, such as SYBR Green chemistry, and qPCR-specific primer sets.
The primer sets may be directed to a target sequence such as an
endophyte gene, for example the peramine biosynthesis perA
gene.
[0146] The development of a high-throughput PCR-based assay to
measure endophyte biomass in planta may enable efficient screening
of large numbers of plants to study endophyte-host plant biomass
associations.
[0147] As used herein, except where the context requires otherwise,
the term "comprise" and variations of the term, such as
"comprising", "comprises" and "comprised", are not intended to
exclude further additives, components, integers or steps.
[0148] Reference to any prior art in the specification is not, and
should not be taken as, an acknowledgment or any form of suggestion
that this prior art forms part of the common general knowledge in
Australia or any other jurisdiction or that this prior art could
reasonably be expected to be ascertained, understood and regarded
as relevant by a person skilled in the art.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0149] In the figures:
[0150] FIG. 1 shows sequence alignment analysis of mating-type loci
of endophyte strains E. festucae strain E2368, E1, NEA12 and
ST.
[0151] FIG. 2A shows a UPGMA phenogram of genetic relationships
among endophytes in ryegrass accessions of diverse origins and
reference Neotyphodium and Epichloe species. Genetic identity was
measured across 18 SSR loci using the Dice coefficient. Detailed
annotations for sections A-D are shown in FIGS. 2B to 2E,
respectively. Specifically, accessions analysed in this study are
shaded in grey, the number of genotypes host to that endophyte
strain from the total number of genotypes analysed are indicated in
the round brackets and a representative host genotype is given in
the square brackets. Endophyte isolates from the reference
collection are specified in the square brackets following the
species name. N. lolii Group 1 comprises of isolates Aries 1, Banks
5847, Ellett 5837, Fitzroy 2, Fitzroy 3, KT1-2, North African 6,
Vedette 6645 and Victorian 2.
[0152] FIG. 3 shows isogenic inoculation methodology for endophyte
inoculation. A. Meristem callus induction (4 weeks); B. Embryogenic
callus proliferation (4 weeks); C. Shoot (and root) regeneration (5
days, 16 hours light); D. Endophyte inoculation; E. Plantlet growth
(4 weeks, 16 hours light); F. Growth in soil (3 months); G.
SSR-based analysis.
[0153] FIG. 4 shows the number of hits showing a given percent
identity for 250 bp fragments of the NEA12 genome against the E.
festucae and N. lolii genomes. The X-axis shows the percent
identity, the Y-axis shows the number of hits. Black: N. lolii
strain ST; White: E. festucae strain E2368.
[0154] FIG. 5 shows the number of hits showing a given percent
identity for 250 bp segments of the E1 genome against the genomes
of NEA12, E. festucae and N. lolii. The X-axis shows the percent
identity, the Y-axis shows the number of hits. Black (1st bar in
each group): E. festucae strain E2368; Grey (2nd bar in each
group): Non-N. lolii strain NEA12; White (3rd bar in each group):
N. lolii strain ST.
[0155] FIG. 6 shows the number of hits showing a given percent
identity for 250 bp fragments of E1 against NEA12, E. festucae and
N. lolii. The X-axis shows the percent identity, the Y-axis shows
the number of hits expressed as a fraction of the total matches
seen per comparison. Grey (1st bar in each group): E. festucae
strain E2368; Black (2nd bar in each group): Non-N. lolii strain
NEA12; White (3rd bar in each group): N. lolii strain ST.
[0156] FIG. 7 shows a schematic diagram of the mating-type loci in
Neotyphodium/Epichloe.
[0157] FIG. 8 shows ClustalW analysis trees of the sequence
flanking the mating-type loci (left), and the NoxR gene (cloned
from E. festucae strain FL1 gi117413991; right).
[0158] FIG. 9 shows an alignment between mitochondrial genome of N.
lolii strain Lp19 and a representative of the Clavicipitaceae,
Metarhizium anisopliae (Genbank reference number
NC.sub.--008068.1). While the two mitochondrial genomes vary in
size, the genes are present in the same order and strand sense,
with differences being due to variable insertions in the N. lolii
mitochondrial genome.
[0159] FIG. 10 shows a depiction of part of the block structure of
the mitochondrial genomes for each of the fungal endophytes
sequenced in this study, as well as E. festucae strain E2368 and
Metarhizium anisopliae for comparison. A shared block (e.g. b84) is
present in all 12 mitochondria whereas block 85 is present only in
the mitochondria of E. festucae strain E2368, and Non-N. lolii
strains E1 and NEA12.
[0160] FIG. 11 shows a mitochondrial genome comparison. Parsimony
tree of the relationships between the mitochondrial genomes of the
10 perennial ryegrass endophyte strains sequenced, E. festucae
strain E2368 and Metarhizium anisopliae.
[0161] FIG. 12 shows a mitochondrial genome comparison. Neighbour
joining tree analysis using ClustalW from a DNA alignment of the 40
blocks of sequence (.about.40 kb) that are shared across the 10
perennial ryegrass endophyte strains sequenced, E. festucae strain
E2368 and Metarhizium anisopliae.
[0162] FIG. 13 shows a standard curve for quantitative assessment
of endophyte colonisation (copy number relative to total plant
gDNA). (a) Tight clustering of amplification curves (4 technical
replicates) ranging from 2.times.10.sup.2 to 2.times.10.sup.6
copies of the 73 bp perA amplicon. (b) Dissociation curve analysis
of the amplification curves shown in (a), with the presence of a
single peak indicating primer pair specificity. (c) Assay
performance is determined in terms of efficiency, precision and
sensitivity. For a typical reaction, a slope of -3.1 to -3.6 and
R.sup.2 value.gtoreq.0.985 is acceptable. This assay recorded a
slope of -3.2 and R.sup.2 value of 0.999.
[0163] FIG. 14 shows a quantitative assessment of endophyte
colonisation in diverse ryegrass host panel. (a) Standard curve of
perA target sequence (2.times.10.sup.2 to 2.times.10.sup.6) and
amplification curves of the unknown samples. (b) Dissociation curve
analysis of the amplification curves shown in (a). (c) Standard
curve for perA target (.box-solid.) and unknown samples
(.tangle-solidup.).
[0164] FIG. 15 shows a colchicine kill curve of endophyte strain ST
mycelia grown in potato dextrose broth at 22.degree. C., 150 rpm
for 21 days.
[0165] FIG. 16 shows phenotype of colchicine treated colonies (0.1
and 0.2%) of endophyte strain ST compared to the untreated ST
control. Mycelia were grown on potato dextrose agar at 22.degree.
C. in dark.
[0166] FIG. 17 shows an assessment for changes in ploidy level by
flow cytometry. a) Dot plots and histogram overlay of control
samples, ST, BE9301 and NEA11. b) Dot plots and histogram overlay
of two individual ST colonies (13 and 14), showing a shift in peak
location relative to the controls.
[0167] FIG. 18 shows high throughput PCR screening method for
detection of lolitrem B gene deletion mutants. The lolitrem genes
targeted include: ItmM (480 bp), ItmJ (734 bp) and ItmC (583 bp).
M: EasyLadder1 (100-2000 bp); 1-13: Individual putative lolitrem B
gene deletion mutants; ST: ST DNA (positive control for ItmM, ItmJ
and ItmC); AR1: AR1 DNA (positive control for ItmM and ItmC,
negative control for ItmJ); H.sub.2O PCR control.
[0168] FIG. 19 shows geographical origins represented in the tall
fescue endophyte incidence assessment. This graph shows the 40
different geographic origins represented in the incidence
assessment. The X axis gives geographic origins in the alphabetical
order and the Y axis shows the number of accessions. The number of
negative accessions is shown with black and the number of positive
accessions is shown in grey.
[0169] FIG. 20 shows UPGMA phenogram of genetic relationships among
endophytes in tall fescue accessions of diverse origins and
reference Neotyphodium, Epichloe, FaTG-2 and FaTG-3 species.
[0170] FIG. 21 shows production of the insecticidal alkaloids
loline, loline formate and peramine by tall fescue endophytes in
their endogenous host.
[0171] FIG. 22 shows production of the anti-mammalian alkaloids
ergovaline and lolitrem B by tall fescue endophytes in their
endogenous host.
[0172] FIG. 23 shows an example of antifungal bioassay of
inhibition reactions. Testing for antifungal activity of endophyte
NEA12, ST and AR1 against 8 species of pathogenic fungi.
[0173] FIG. 24 shows endophytes selected for metabolic profiling in
in vitro culture. Shown in the top left hand corner is the
inhibition score.
[0174] FIG. 25 shows a method for sampling material for LCMS
analysis.
[0175] FIG. 26 shows a validation assay. Rhizoctonia cerealis was
grown in the presence of methanol extracts of endophyte mycelia.
Shown is an example using the endophyte strain ST. A. Methanol
extract of ST grown in the absence of R. cerealis; B. Methanol
extract ST grown in presence of R. cerealis; C. Water only control;
D. Methanol only control.
[0176] FIG. 27 shows structures of endophyte metabolites
[0177] 1 peramine (MW 247.3);
[0178] 2 ergovaline (MW 533.6);
[0179] 3 lolitrem B (MW 685.9);
[0180] 4 janthitrem I (MW 645.8);
[0181] 5 janthitrem G (MW 629.8);
[0182] 6 janthitrem F (MW 645.8).
[0183] FIG. 28 shows LCMS analysis of standard materials displaying
extracted ion chromatogram for the toxins:
[0184] A. peramine
[0185] NL: 7.47E4
[0186] Base Peak m/z=47.50-248.50 F: ITMS+c ESI Full ms
[0187] [150.00-2000.00] MS
[0188] B. ergovaline
[0189] NL: 1.64E6
[0190] Base Peak m/z=533.40-534.40 F: ITMS+c ESI Full ms
[0191] [150.00-2000.00] MS
[0192] C. lolitrem B
[0193] NL: 2.25E3
[0194] Base Peak m/z=685.50-687.00 F: ITMS+c ESI Full ms
[0195] [150.00-2000.00] MS
[0196] FIG. 29 shows an LCMS comparison of AR37 inoculated
perennial ryegrass with NEA12 inoculated perennial ryegrass (IMP04
NEA12 20).
[0197] A. AR37 no peramine
[0198] NL: 3.14E3
[0199] Base Peak m/z=247.50-248.50 F: ITMS+c ESI
[0200] Full ms [150.00-2000.00] MS
[0201] B. AR37 no ergovaline
[0202] NL: 7.39E4
[0203] Base Peak m/z=533.40-534.40 F: ITMS+c ESI
[0204] Full ms [150.00-2000.00] MS
[0205] C. AR37 no lolitrem B
[0206] NL: 1.32E4
[0207] Base Peak m/z=685.50-687.00 F: ITMS+c ESI
[0208] Full ms [150.00-2000.00] MS
[0209] D. AR37 janthitrem
[0210] NL: 8.68E4
[0211] Base Peak m/z=645.50-646.50 F: ITMS+c ESI
[0212] Full ms [150.00-2000.00] MS
[0213] E. NEA12 no peramine
[0214] NL: 6.18E3
[0215] Base Peak m/z=247.50-248.50 F: ITMS+c ESI
[0216] Full ms [150.00-2000.00] MS
[0217] F. NEA12 no ergovaline
[0218] NL: 4.10E3
[0219] Base Peak m/z=533.40-534.40 F: ITMS+c ESI
[0220] Full ms [150.00-2000.00] MS
[0221] G. NEA12 no lolitrem B
[0222] NL: 1.32E4
[0223] Base Peak rn/z=685.50-687.00 F: ITMS+c ESI
[0224] Full ms [150.00-2000.00] MS
[0225] H. NEA12 janthitrem
[0226] NL: 1.04E4
[0227] Base Peak m/z=645.50-646.50 F: ITMS+c ESI
[0228] Full ms [150.00-2000.00] MS
[0229] FIG. 30 shows an MSMS analysis of NEA12 insulated perennial
ryegrass metabolite 4. Inset is Table 2 from International patent
application WO2004/106487 describing the fragmentations of the
janthitrems found. Data for NEA12 metabolite 4 is in good agreement
with that of component I in the table. (endol5June09-010 #3184 RT:
49.01 AV: 1 NL: 5.02E2, T: ITMS+cESId Full ms2 646.51@cid35.00
[165.00-660.00])
[0230] FIG. 31 shows Reverse phase liquid chromatography mass
spectrometry (LCMS) analysis of A. TOL03 NEA12 and B. TOL03 ST.
Profiles show the presence and absence of specific metabolites
including peramine, ergovaline, lolitrem, and janthitrems.
[0231] FIG. 32 shows genotypic analysis of endophyte content in
accessions from a targeted fescue germplasm collection.
[0232] FIG. 33 shows genetic diversity analysis of tall fescue
endophytes.
[0233] FIG. 34 shows diversity analysis of host and endophyte.
[0234] FIG. 35 shows selection of fescue-endophyte combinations for
metabolic profiling, endophyte isolation and isogenic
inoculation.
[0235] FIG. 36 shows selection of fescue-endophyte combinations for
metabolic profiling, endophyte isolation and isogenic
inoculation.
[0236] FIG. 37 shows a desired toxin profile of tall fescue
endophytes.
[0237] FIG. 38 shows a metabolic profile analysis.
[0238] FIG. 39 shows endophytes selected for semi-quantitative
analysis of metabolites.
[0239] FIGS. 40 and 41 show metabolomics analyses of fescue
endophytes.
[0240] FIG. 42 shows a semi-quantitative analysis of metabolic
profile under temperature/water stress.
[0241] FIG. 43 shows endophytes selected for isogenic
inoculation.
[0242] FIG. 44 shows SSR-based genotyping of isolated endophytes
cultures prior to isogenic inoculation.
[0243] FIG. 45 shows endophyte vegetative stability in tall fescue
and perennial ryegrass host genotypes (stability at 12 months post
inoculation).
[0244] FIG. 46 shows endophytes selected for isogenic
inoculation.
[0245] FIGS. 47-50 show metabolic profiling of isogenic tall
fescue-endophyte associations.
[0246] FIG. 51 shows anti-fungal bioassays of fescue endophytes.
Column 1 Colletotrichum graminicola, Column 2 Drechslera brizae,
Column 3 Rhizoctonia cerealis.
[0247] FIG. 52 shows sequencing of selected novel fescue
endophytes.
[0248] FIG. 53 shows peramine biosynthetic pathway.
[0249] FIGS. 54 A-C show presence of perA gene within non-Epichloe
out-group endophytes (FIG. 54A NEA17; FIG. 54B NEA18; FIG. 54C
NEA19).
[0250] FIG. 55 shows ergovaline biosynthetic pathway.
[0251] FIG. 56 shows genes in the eas gene cluster.
[0252] FIGS. 57 A-D show presence of dmaW gene for ergovaline
biosynthesis in endophyte strains (FIG. 57A NEA17; FIG. 57B NEA16;
FIG. 57C AR542; FIG. 57D NEA20).
[0253] FIGS. 58 A-D show presence of eas gene cluster for
ergovaline biosynthesis. FIG. 58A FaTG-2 NEA17 (287819); FIG. 58B
non-Epichloe out-group NEA18 (FEtc6-75); FIG. 58C FATG-3 NEA21
(231557); FIG. 58D N. coenophialum NEA16 (FEtc7-342).
[0254] FIG. 59 shows the Lolitrem B biosynthetic pathway.
[0255] FIG. 60 shows genes in the Lolitrem B biosynthetic gene
cluster.
[0256] FIGS. 61A-D show presence of Lolitrem B biosynthetic gene
cluster 1 (ItmG, ItmM and ItmK) in endophyte strains. FIG. 61A
FaTG-2 NEA17 (287819); FIG. 61B non-Epichloe out-group NEA18
(FEtc6-75); FIG. 61C FATG-3 NEA21 (231557); FIG. 61D N.
coenophialum NEA16 (FEtc7-342).
[0257] FIGS. 62 A-D show presence of Lolitrem B biosynthetic gene
cluster 2 (ItmB, ItmQ, ItmP, ItmF and ItmC) in endophyte strains.
FIG. 62A FaTG-2 NEA17 (287819); FIG. 62B non-Epichloe out-group
NEA18 (FEtc6-75); FIG. 62C FATG-3 NEA21 (231557); FIG. 62D N.
coenophialum NEA16 (FEtc7-342).
[0258] FIGS. 63 A-D show presence of Lolitrem B biosynthetic gene
cluster 3 (ItmE and ItmJ) in endophyte strains. FIG. 63A FaTG-2
NEA17 (287819); FIG. 63B non-Epichloe out-group NEA18 (FEtc6-75);
FIG. 63C FATG-3 NEA21 (231557); FIG. 63D N. coenophialum NEA16
(FEtc7-342).
[0259] FIG. 64 shows the loline biosynthetic pathway.
[0260] FIG. 65 shows the loline biosynthetic gene cluster.
[0261] FIGS. 66 A-D show presence of Loline biosynthetic gene
cluster in endophyte strains. FIG. 66A FaTG-2 NEA17 (287819); FIG.
66B non-Epichloe out-group NEA18 (FEtc6-75); FIG. 66C FATG-3 NEA21
(231557); FIG. 66D N. coenophialum NEA16 (FEtc7-342).
[0262] FIGS. 67 A-F show alkaloid biosynthetic gene analysis for
endophyte strain NEA23 (269850). FIG. 67A Presence of loline gene
cluster; FIG. 67B Presence of peramine gene; FIG. 67C Analysis of
Lolitrem gene cluster 01; FIG. 67D Analysis of Lolitrem gene
clusters 02 and 03; FIG. 67E Analysis of dmaW gene for ergovaline
production; FIG. 67F Analysis of eas gene cluster for ergovaline
production.
[0263] FIG. 68 shows genotypic analysis of NEA23 and NEA21.
[0264] FIG. 69 shows genotypic analysis of NEA16 and NEA20.
[0265] FIG. 70 shows the structures of Lolitrem B, Erogvaline and
Peramine, with desirable toxin profiles indicated.
[0266] FIG. 71 shows in vitro bioassays to assess antifungal
activity of Neotyphodium endophytes.
[0267] FIG. 72 shows a detached leaf assay to assess resistance to
crown rust (Puccinia coronata f. sp. Lolii) of perennial ryegrass
plants with and without Neotyphodium endophytes.
[0268] FIG. 73 shows glasshouse and field trial screens for drought
tolerance and water use efficiency of perennial ryegrass plants
with and without Neotyphodium endophytes.
[0269] FIG. 74 shows the steps involved in cell division.
[0270] FIG. 75 shows experimental work flow for chromosome doubling
of endophyte cells.
[0271] FIG. 76 shows flow cytometry calibrations for DNA content
assessment in Neotyphodium endophyte strains. Peaks indicate
relative nuclear DNA content.
[0272] FIG. 77 shows flow cytometry analysis of NEA12.sup.dh
Neotyphodium endophyte strains.
[0273] FIG. 78 shows analysis of growth rate in culture after 8
weeks of NEA12.sup.dh Neotyphodium endophyte strains compared to
control endophyte strains.
[0274] FIG. 79 shows analysis of growth rate in culture over 5
weeks of NEA12.sup.dh Neotyphodium endophyte strains compared to
control endophyte strains.
[0275] FIG. 80 shows antifungal bioassays of NEA12.sup.dh
Neotyphodium endophyte strains.
[0276] FIG. 81 shows antifungal bioassays of NEA12.sup.dh
Neotyphodium endophyte strains.
[0277] FIG. 82 shows analysis of genome survey sequencing read
depth of colchicine-treated Neotyphodium endophyte strains.
[0278] FIG. 83 shows analysis of genome survey sequencing reads
mapping to NEA12 genome survey sequence assembly.
[0279] FIG. 84 shows experimental work flow for X-ray
mutagenesis.
[0280] FIG. 85 shows the indole-diterpene biosynthetic pathway of
Neotyphodium endophytes.
[0281] FIG. 86 shows in vitro growth of X-ray irradiated
Neotyphodium endophyte strains.
[0282] FIG. 87 shows Itm gene clusters of Neotyphodium
endophytes.
[0283] FIG. 88 shows determination of genome sequence variation in
X-ray irradiated Neotyphodium endophyte strains.
[0284] FIG. 89 shows single nucleotide polymorphisms (SNPs) in
genome sequences of X-ray irradiated Neotyphodium endophyte
strains.
[0285] FIG. 90 shows small insertions/deletions (INDELs) in genome
sequences of X-ray irradiated Neotyphodium endophyte strains.
[0286] FIG. 91 shows deletions in genome sequences of X-ray
irradiated Neotyphodium endophyte strains.
[0287] FIG. 92 shows numbers of SNPs in genic regions of genome
sequences of X-ray irradiated Neotyphodium endophyte strains.
[0288] FIG. 93 shows numbers of INDELs in genic regions of genome
sequences of X-ray irradiated Neotyphodium endophyte strains.
[0289] FIG. 94 shows the spectrum of genome sequence changes
(deletions) in genome sequences of X-ray irradiated Neotyphodium
endophyte strains.
[0290] FIG. 95 shows mutagenesis index of X-ray irradiated strains
based on number of genome sequence changes observed in genome
sequences of X-ray irradiated Neotyphodium endophyte strains.
[0291] FIG. 96 shows metabolic profiling of NEA12.sup.dh
Neotyphodium endophyte strains.
[0292] FIG. 97 shows metabolic profiling of X-ray irradiated
Neotyphodium endophyte strains.
EXAMPLE 1
Identification of Novel Endophytes
[0293] A collection of 244 perennial grass accessions was assembled
for the discovery of novel endophyte strains. The collection
targeted accessions from the Northern Mediterranean and Eastern
Europe for endophytes that lack lolitrems, as well as accessions
from the Middle East, the proposed centre of origin of perennial
ryegrass and N. lolii.
[0294] Genotypic analysis of endophyte content was performed across
a total of 189 accessions. From each accession 1-5 plant genotypes
were analysed for endophyte. Endophyte incidence was low, with
endophyte detected in 51% of accessions. Endophyte was consistently
detected (with .gtoreq.10 SSR markers) in 77 of the accessions.
[0295] Endophytes representing five different taxa were detected
across the 77 accessions with 18 SSR markers used to investigate
endophyte diversity in perennial ryegrass (FIG. 2). N. lolii was
predominant, occurring in 63 accessions. Also detected, although
less common, were LpTG-2 and putatively new taxa.
[0296] Genetic variation in N. lolii appeared to be low. A total of
22 unique genotypes were detected across the 63 accessions host to
N. lolii.
[0297] The likely toxin profiles of 14 of the 22 genotypes were
established from comparisons with genetic and phenotypic data from
previous studies. Most of these genotypes (12/14) showed genetic
similarity to endophytes known to produce lolitrems.
[0298] There were two genotypes that showed genetic similarity to
genotypes known to lack lolitrems but produce ergovaline. One of
these genotypes was identical to the genotype detected in the
endophyte NEA6. The likely toxin profiles of the remaining eight
genotypes were not known. These genotypes did not show high levels
of genetic similarity to the endophytes AR1, Endosafe, NEA3 or
NEA5.
[0299] Plants carrying candidate endophytes were subjected to
primary metabolic profiling in the endogenous genetic background,
through clonal propagation and measurement of toxin levels. A total
of 42 genotypes representing four of the five taxa were selected
for toxin profiling, including the eight novel genotypes with
unknown toxin profiles. The perennial ryegrass genotype North
African 6 (NA.sub.6), which contains standard toxic (ST) endophyte,
was used as a control.
[0300] For metabolic profiling, a complete randomised block design
was used, with four replicate clones for each plant and using four
hydroponics tubs as blocks. Following three months in hydroponics,
whole shoot (leaf plus basal region) was harvested from each plant.
The fresh and dry weights of each plant were measured and powdered
sample material from 80 (20 genotypes.times.4 replicates) samples
(three tillers per sample) analysed for alkaloid content (lolitrem,
ergovaline and peramine).
EXAMPLE 2
Candidate Endophytes
[0301] Candidate endophytes for further study were chosen on the
basis of their genetic identity and metabolic profile.
Host-endophyte combinations producing significant amounts of
lolitrem B were eliminated, as the ryegrass staggers syndrome
produced by this alkaloid is the most important limitation for
livestock production.
[0302] The candidate endophyte NEA10 (originating from Spain) was
identified as a novel genotype in this analysis with an unknown
toxin profile. Its genetic identity is a unique N. lolii strain.
Following in planta metabolic profiling analysis, candidate
endophyte NEA10 was found to produce ergovaline and peramine, and
not lolitrem B.
[0303] The candidate endophyte NEA11 (originating from France) was
identified as a novel genotype in this analysis with an unknown
toxin profile. Its genetic identity is a unique LpTG-2 strain.
Following in planta metabolic profiling analysis, candidate
endophyte NEA11 was found to produce ergovaline and peramine, and
not lolitrem B.
[0304] The candidate endophyte NEA12 (originating from France) was
identified as a novel genotype in this analysis with an unknown
toxin profile. NEA12 is a genetically novel, non-Neotyphodium
lolii, endophyte representative of an as yet un-named taxon.
Following in planta metabolic profiling analysis, candidate
endophyte NEA12 was found to not produce the three alkaloids
assessed (lolitrem B, ergovaline and peramine).
[0305] The candidate endophyte E1 was identified as a novel
genotype in this analysis with an unknown toxin profile. E1 is a
genetically novel, non-Neotyphodium lolii, endophyte representative
of an as yet un-named taxon. Following in planta metabolic
profiling analysis, candidate endophyte E1 was found to not produce
the three alkaloids assessed (lolitrem B, ergovaline and
peramine).
EXAMPLE 3
Methodologies for Endophyte Characterisation
Endophyte Isolation
[0306] Novel candidate endophytes were isolated from their host
plant to establish an in vitro culture. Following isolation, the
genotype of each endophyte was confirmed by SSR analysis to ensure
a high level of quality control prior to inception of isogenic
inoculations.
Establishment of Meristem Cultures for a Diverse Perennial Ryeqrass
Host Panel
[0307] A set of cultivars representing elite germplasm were
obtained, including forage and turf types. Meristem cultures from
different cultivars were established to evaluate and compare the
phenotypic properties of novel endophyte strains in diverse
isogenic host backgrounds. Embryogenic genotypes were identified
for each of the cultivars through callus induction and
proliferation. Subsequent regeneration of embryogenic genotypes
identified primary tissue culture responsive (pTCR) genotypes for
each of the cultivars. The number of pTCR genotypes with
regeneration frequencies ranging from 80-100% varied from 1-4 per
cultivar. pTCR genotypes were then prepared for meristem-derived
callus induction to identify highly regenerable genotypes for
isogeneic endophyte inoculation. Table 1 shows a selection of
cultivars developed, and the tissue culture responsive (TCR)
genotype, used for isogenic inoculation.
TABLE-US-00001 TABLE 1 Summary information for perennial cultivars
selected for isogenic inoculation. TCR genotype used Cultivar
Characteristics for inoculation Bealey Tetraploid forage type Bea
02 Bronsyn Standard forage type with robust Bro 08 endophyte
performance Impact Late flowering, dense tillering Imp 04 forage
type Barsandra Turf type San 02 Tolosa Distinct forage type Tol
03
Isogenic Inoculation of Novel Perennial Ryegrass Endophytes
[0308] In order to accurately determine the phenotypic effects of
different candidate endophytes in the absence of host-specific
genetic effects, a system for isogenic inoculation was developed
(FIG. 3). The regenerating callus method of inoculation was chosen,
as it results in a relatively high rate of inoculation compared to
other tested techniques, and the achieved isogenic inoculation rate
was similar to the standard inoculation procedure for non-isogenic
seedlings. Novel candidate endophytes NEA10, NEA11, NEA12, E1 and
control endophyte ST were individually inoculated into elite
germplasm. The logistical approach was to inoculate two cultivars
at any given time, with one TCR genotype for each variety chosen
for inoculation in this initial study. For each cultivar-endophyte
combination, 30 replicate inoculations were performed, 25 of these
replicates being transferred to soil. Following inoculation and
plantlet regeneration in culture, plants were transferred to soil
for three months to allow establishment of endophyte and host-plant
associations. After this period, three tillers from each plant were
sampled and tested for endophyte presence using SSR-based
analysis.
[0309] A quantitative score was used to assess endophyte
inoculation frequency (Table 2). Three diagnostic SSR markers were
used to determine endophyte presence and identity and samples were
scored on a scale of 0-3.
[0310] Of the 570 inoculations tested, 195 (34.2%) could be
positively scored with a high degree of confidence (Table 3).
Successful inoculations are listed on Table 3.
TABLE-US-00002 TABLE 2 SSR screening for endophyte presence in
planta. Quantitative Alleles present and of correct score size for
given SSR loci 3 Endophyte present 2 Endophyte present 1 Endophyte
absent 0 Endophyte absent
TABLE-US-00003 TABLE 3 Summary statistics for isogenic inoculation
of selected candidate endophytes into a targeted perennial ryegrass
panel of 5 hosts. A. Number of positive inoculants NEA10 NEA11
NEA12 E1 ST Total Bea02 0 12 3 4 8 27 Bro08 0 14 1 13 13 41 Imp04 3
40 4 10 16 73 San02 0 17 6 6 11 40 Tol03 0 3 2 6 3 14 Total 3 86 16
39 51 195 B. Total number of inoculations tested NEA10 NEA11 NEA12
E1 ST Total Bea02 24 18 20 19 25 106 Bro08 19 15 20 18 25 97 Imp04
31 49 21 12 35 148 San02 47 39 24 7 32 149 Tol03 17 7 18 17 11 70
Total 138 128 103 73 128 570 C. Percent of positive inoculants
NEA10 NEA11 NEA12 E1 ST Average Bea02 0.0 66.7 15.0 21.1 32.0 25.5
Bro08 0.0 93.3 5.0 72.2 52.0 42.3 Imp04 9.7 81.6 19.0 83.3 45.7
49.3 San02 0.0 43.6 25.0 85.7 34.4 26.8 Tol03 0.0 42.9 11.1 35.3
27.3 20.0 Average 2.2 67.2 15.5 53.4 39.8 34.2
[0311] Variation in inoculation success according to candidate
endophyte identity was observed (Table 3). Endophyte NEA10 (2.2%),
for example, exhibited relatively lower success rates as compared
to NEA11 (67.2%), or the commercial endophyte ST (39.8%; Table 4)
and only formed stable associations with one of the five hosts in
the panel (Impact). Endophyte E1 is a highly compatible endophyte,
which obtained a high rate of success of inoculation into perennial
ryegrass (Table 3) compared to other endophytes examined, including
the strain ST.
[0312] Variation was also observed between host plant genotypes for
successful inoculations (Table 3). Tolosa (20.0%) appears to be
more recalcitrant to inoculation compared to host plants such as
Bronsyn (42.3%) and Impact (49.3%).
Vegetative Stability of Isogenic Perennial Ryegrass-Fungal
Endophyte Associations
[0313] Fully confirmed endophyte positive plants from the targeted
host-endophyte panel (host plants Bealey, Bronsyn, Barsandra,
Tolosa and Impact; endophytes ST, NEA10, NEA11, NEA12) were
retested 6-12 months after inoculation and 18-24 months after
inoculation, to confirm the presence of endophyte and to assess
vegetative stability. In this experiment, 3 replicates of 3 tillers
each (total of 9 tillers) were collected for SSR-based
analysis.
[0314] Most of the previously confirmed endophyte positive plants
were again confirmed in this study at 6-12 months post inoculation,
indicating that each of the host--endophyte combinations were
stable (Table 4). Endophyte NEA12 appears to be less stable in
planta, as 7 of the 13 previously confirmed samples could not be
fully confirmed in this experiment (Table 4). ST also showed lower
levels of stability compared to NEA11, with 7/21 samples not
re-confirmed in this study (Table 4). Following this analysis, up
to three independent inoculation events from each host
plant--endophyte combination were retained for further study.
[0315] At 18-24 months post inoculation, plants were further
assessed for long term vegetative stability (Table 4). ST, NEA10
and NEA11 each exhibit stable associations, with most plants
retaining endophyte. NEA12 appears to be less stable in some
associations, however does form stable long term associations with
Tolosa.
TABLE-US-00004 TABLE 4 Endophyte frequency in priority ryegrass
host panel genotypes in re- sampled plants that were previously
fully confirmed. Plants were re- sampled 6-12 months (shown in bold
text) post inoculation and again after 18-24 months post
inoculation (shown in normal text). Plant Endophyte genotype
genotype ST NEA10 NEA11 NEA12 Impact 9/10 2/3 12/12 1/4 (Imp04) 3/3
2/2 3/3 1/1 Barsandra 4/6 7/7 2/4 (San02) 2/3 NA 3/3 1/2 Tolosa 1/2
3/3 2/2 (Tol03) 1/1 NA 2/3 2/2 Bealey 3/3 9/9 0/2 (Bea02) 2/3 NA
3/3 0/1 Bronsyn 3/6 9/9 1/1 (Bro08) 2/2 NA 4/4 0/1 NA = not
applicable, as no fully confirmed plants were previously
identified.
Metabolic Profiling of Isogenic Perennial Ryegrass-Fungal Endophyte
Associations
[0316] Metabolic profiling was conducted to determine the stability
of the predicted endophyte phenotype in a range of different host
genotype backgrounds. Four replicates of three tillers each were
grown under optimal conditions in hydroponics for six weeks prior
to measuring lolitrem B, ergovaline and peramine levels. Each
replicate plant was also tested for the presence/identity of
endophyte using SSR-based genotyping in order to correlate toxin
profile with endophyte presence, in particular for those instances
were toxin profiles were negative for the alkaloids measured.
[0317] Table 5 summarises the outcomes of metabolic profiling in
hydroponics for both the endophyte discovery phase and the isogenic
inoculation phase. Toxin profiles were as predicted from the
cluster assignment of the endophyte in the diversity analysis and
the toxin profiles measured in the endogenous host plant.
TABLE-US-00005 TABLE 5 Metabolic profile of candidate endophytes.
Endophyte Endogenous Isogenic strain toxin profile toxin
profile.sup.b Origin Species NEA10 --/E/n.d.sup.a/-- --/E/P/--
Spain N. lolii NEA11 --/E/n.d/-- --/E/P/-- France LpTG-2 NEA12
--/--/--/n.d --/--/--/J France non-N. lolii E1 n.d --/--/--/--
non-N. lolii ST L/E/P/-- L/E/P/-- N. lolii Toxins are listed in
order: L = Lolitrem B; E = Ergovaline; P = Peramine; J =
Janthitrems .sup.aPeramine not measured in NEA10 and NEA11 samples;
Janthitrems not measured in NEA12 samples .sup.bToxin profile in
isogenic associations
Genome Survey Sequencing of Candidate Fungal Endophytes
Nuclear Genome Assembly
[0318] Genome Survey Sequencing was performed for non-N. lolii
strains NEA12 and E1, LpTG-2 strain NEA11 and Neotyphodium lolii
strains including Standard Toxic (ST) and NEA10 using GSFLX
Titanium (TI-GSFLX) pyrosequencing technology (Roche; as per
manufacturers instructions). A further five N. lolii strains were
sequenced using either GSFLX Standard or GS20 pyrosequencing
technology. Genome assembly for each of the strains was conducted
with GSFLX De Novo Assembler (Table 6).
[0319] A new genome assembly was performed for N. lolii strain ST
(GSFLX De Novo Assembler), combining sequence reads from both GSFLX
and TI-GSFLX runs. Table 7 compares the assembly of single and
multiple strains. This combined assembly of the ST genome achieves
c.12.times. coverage of the c.32 Mbp haploid genome. The genome is
assembled into 7,875 large contigs (0.5 to 47 kb) of which the net
length is 31,750,111 bp.
[0320] Analysis using Augustus gene prediction software trained for
Fusarium graminearum shows that there are 11,517 predicted protein
coding genes in the N. lolii genome.
TABLE-US-00006 TABLE 6 Summary statistics for GS-FLX based whole
genome sequencing of candidate endophytes. N. lolii N. lolii N.
lolii N. lolii N. lolii N. lolii N. lolii N. lolii non-N. lolii
non-N. lolii LpTG-2 Lp19 ST NEA3 AR1 E9 G4 NEA10 ST E1 NEA12 NEA11
Genome size (Mb) ~29 ~29 ~29 ~29 ~29 ~29 ~29 ~28 TBD TBD ~55 Toxin
profile.sup.a L + E + P L + E + P E + P P L + P L + P E + P L + E +
P TBD J E + P 454 Sequencer GS20 GSFLX GSFLX GSFLX GSFLX GSFLX
GSFLX GSFLX GSFLX GSFLX GSFLX Standard Standard Standard Standard
Standard Titanium Titanium Titanium Titanium Titanium Number of
sequencing runs 1 1 1 1 1 11/2 1/2 1 1/2 1/2 1/2 Number of high
quality reads 449,408 288,527 361,154 437,465 344,074 631,248
580,060 1,220,036 539,019 399,868 456,111 Number of bases in high
quality reads 47,820,858 71,810,513 84,032,924 97,510,674
85,419,382 146,574,403 221,859,987 451,459,919 202,854,865
165,826,144 177,307,015 Average read length (bases) 106 249 232 223
249 215 383 370 377 415 389 Origin of reads assembled.sup.b nuclear
+ mt nuclear + mt nuclear + mt nuclear + mt nuclear + mt nuclear +
mt nuclear + mt nuclear + mt nuclear + mt nuclear + mt nuclear + mt
Large contigs (>500 bases) Number of contigs 6 2,524 5,251 6,070
6,612 12,663 7,272 4,198 9,139 12,399 14,791 number of bases 99,508
1,834,624 3,911,733 4,650,113 5,208,116 12,393,467 26,931,240
24,382,151 27,150,736 17,300,350 16,306,033 average contig size
16,584 726 744 766 787 978 3703 5,808 2970 1,395 1,102 N50 contig
size 88,709 680 723 751 774 1039 7668 11,026 5845 1,703 1,214
largest contig size (bases) 88,709 65,108 15,473 19,024 81,839
29,071 50,291 90,675 40,456 16,319 59,986 All contigs number of
contigs 29,013 28,137 33,262 33,777 33,136 32,796 11.809 6,962
15,589 20,640 39,791 number of bases 3,532,954 7,999,326 10,842,510
11,755,707 12,022,601 17,790,671 28,155,780 25,104,969 28,916,589
19,862,340 23,307,237 .sup.aL = Lolitrem B, E = Ergovaline, P =
Peramine, J = Janthitrems .sup.bNewbler Assembler
TABLE-US-00007 TABLE 7 Assembly comparison of single and multiple
strains of N. lolli endophyte ST + NEA3 + Lp19 ST NEA3 AR1 E9 G4 ST
combined ST AR1 + E9 + G4 454 GS 20 GS FLX GS FLX GS FLX GS FLX GS
FLX GS FLX GS FLX GS FLX Sequencer (Standard) (Standard) (Standard)
(Standard) (Standard) (Titanium) (Standard + (Standard) Titanium)
Number 1 1.sup.a 1 1 1.sup.a 1.sup.b 1 2 5 of sequencing runs
Number of 282,604 191,848 257,381 311,444 267,445 446,017 913,566
1,105,414 1,474,135 reads Number of 28,628,965 46,613,713
58,666,512 68,947,121 65,192,155 101,770,051 334,946,727
381,560,440 341,189,552 bases in reads Large contigs (.gtoreq.500
bases) number of contigs 109 1,419 3,210 3,519 4,560 11,895 8,825
7,875 11,905 number of bases 124,393 909,187 2,111,227 2,317,893
3,041,084 9,249,140 31,669,111 31,750,111 26,515,831 average contig
size 1,141 640 657 658 666 777 3,588 4,031 2,227 N50 contig
size.sup.c 1,193 606 632 636 644 774 6,142 7,231 3,436 largest
contig size 7,867 8,639 7,382 8,816 8,016 8,226 46,664 46,668
24,527 (bases) Q40 plus bases (%).sup.d 90.62 93.97 93.43 93.90
93.72 94.64 98.03 98.52 98.32 All contigs (.gtoreq.100 bases)
number of contigs 2,183 8,769 12,434 15,324 15,126 28,456 11,324
10,555 21,836 number of bases 500,187 2,911,985 4,778,407 5,584,622
6,123,678 14,307,808 32,350,805 32,482,543 29,165,397
Alkaloid Biosynthetic Gene Content
[0321] The content of genes known to be involved in alkaloid
production in each of the sequenced endophyte genomes was
investigated. Sequence reads for each of the strains were subjected
to a BLAST(N) search against each of the known toxin gene sequences
(downloaded from NCBI) to determine the degree of gene coverage by
sequence reads. Table 8 below shows the correlation between
secondary metabolite production and toxin-related gene content in
endophyte genomes.
[0322] Based on this analysis, endophyte strain E1 is predicted to
produce the alkaloids peramine and ergovaline, but not loline or
lolitrem B. In planta analysis of alkaloid content has shown that
E1 does indeed not produce loline or lolitrem B.
[0323] NEA10 and NEA11 produce ergovaline and peramine, but not
lolitrem B. The NEA11 sequence provides evidence for 2 peramine
biosynthesis genes, as might be expected in a heteroploid
genome.
[0324] NEA12, known to lack production of ergot alkaloids and
lolitrem B, also lacks corresponding biosynthetic genes.
TABLE-US-00008 TABLE 8 Correlation between secondary metabolite
production and toxin-related gene content in fungal endophyte
genomes. ##STR00001## ##STR00002##
Nuclear Genome Comparison
[0325] Comparison of the NEA12 Nuclear Genome to E. festucae E2368
and N. lolii ST
[0326] To compare the nuclear genome of NEA12 to E. festucae and N.
lolii, the contigs derived from NEA12 were split into 250 bp
segments and these segments were used as BLAST(N) queries against
E. festucae strain E2368 (University of Kentucky,
http://www.genome.ou.edu.fungi.html) and N. lolii ST contigs. One
hit was scored for each 250 bp contig if it was greater than 50 bp
long and greater than 80% identity. Summary statistics were taken
for NEA12 250 bp fragments against E. festucae and N. lolii (FIG.
4).
[0327] The number of hits showing a given percent identity shows
there are more 250 bp segments that give 100 percent identity
matches against an E. festucae genome than a N. lolii genome.
[0328] The above statistic is independent of the length of the
overlap. An identical 250 bp region would give a 250 bp overlap
with a percent identity of 100. The number and proportion of these
identical reads is given for the two searches below (Table 9).
TABLE-US-00009 TABLE 9 The number and proportion of identical reads
between NEA12 and an E. festucae genome and a N. lolii genome. ST
E. festucae Total Number of identical reads 16914 28866 89416 (100%
identity between 250 bp segment) Percent of identical reads 18.92
32.28 (100% identity between 250 bp segment)
[0329] There are also segments that have no match to either N.
lolii (6051) or E. festucae (5670). These data suggest that NEA12
is a new endophyte taxon that is genetically closer to E. festucae
than N. lolii. This data supports the earlier observation, using
SSR-based genetic diversity analysis, that NEA12 is genetically
distinct from N. lolii and E. festucae.
Comparison of E1 Nuclear Genome to NEA12, E. festucae E2368 and N.
lolii ST
[0330] For comparison at the whole genome level, the contigs from
endophyte strain E1 were split into 123,258 250 bp segments. Each
250 bp segment was used as a BLAST(N) query against the assembled
whole genome DNA sequences from NEA12, E. festucae E2368 and N.
lolii ST (FIG. 5). A BLAST(N) hit was recorded if there was an
overlap of greater than 49 bp. The number of overlaps at a given
percent identity was counted for each search. The plot of this data
reveals that the genome of endophyte strain E1 is more similar to
that of E. festucae strain E2368 than to either N. lolii strain ST
or NEA12.
[0331] The assembled contigs from NEA12 sum to c.17.3 Mb, so the
level of sequence similarity to that endophyte is probably
underestimated due to limited scope for comparison. If the
similarity is expressed as a fraction of the total matches observed
per comparison, strain E1 is seen to be more similar to strain
NEA12 than to N. lolii strain ST (FIG. 6). The property of enhance
similarity between E1 and E. festucae as compared to N. lolii is
similar to the pattern seen with mitochondrial genome analysis.
LpTG-2 Endophyte NEA11
[0332] The LpTG-2 endophyte strain NEA11 is reported to be a hybrid
of N. lolii and E. typhina.
[0333] Mitochondrial sequence analysis supports the hybridisation
of E. typhina with a N. lolii with only the N. lolii mitochondria
being retained.
[0334] Evidence for the hybrid nuclear genome is seen when nuclear
genes are used as a query against contigs from the NEA11 genome
assembly (FIGS. 7 and 8).
[0335] The panels below show a region of the
`UDP-N-acetylglucosaminyltransferase` gene from E. festucae being
used as a BLAST(N) query against: E. festucae (E2368) genome
contigs; N. lolii (ST) genome contigs; and LpTG-2 (NEA11) genome
contigs. This result clearly shows a second variant of this gene in
the NEA11 genome that has far more SNPs than the first NEA11 contig
hit. This presumably represents the E. typhina copy of this gene
that has been retained in the NEA11 genome. It is unlikely that
this is a localised duplication in NEA11 as neither E. festucae,
nor N. lolii has such a duplication.
TABLE-US-00010 1: E. festucae (E2368) genome contigs 1_0 1141
accagacgatacaatctcgatagtaaccgcctgcctcatagcgggattgattacacccag 1200
contig01260 42150
............................................................ 42091
1_0 1201
gcagctcatgacagtggtatcaatctccaatataagactctacgaacggactctgatata 1260
contig01260 42090
............................................................ 42031
1_0 1261
acgccatcgtccccgactcatgatgcccatgtgaaacctttaccagttgccaacgccgtg 1320
contig01260 42030
............................................................ 41971
1_0 1321
tcctcgttagaggtcctgaacaatctgtgtgaacagagtagttggaaatgggtggaaggt 1380
contig01260 41970
............................................................ 41911
1_0 1381
atgttaattggaggctgtcttcaatacggcctagagcgatacgatgatgcgttcaagtcc 1440
contig01260 41910
............................................................ 41851
1_0 1441
ttctcaaggattgtcgcagttgattccaggtaagttgctcgccacaataccctcactcct 1500
contig01260 41850
............................................................ 41791
1_0 1501
ctgcttgacctcacaatcaccggcttcccagccatgttgaagctatcagtcatatgggcg 1560
contig01260 41790
............................................................ 41731
1_0 1561
cagccttgtattgcctcggacgtcaagatgaagcagagaaaaattggctccgggtgataa 1620
contig01260 41730
............................................................ 41671
1_0 1621
agctacgaccaaattatctcgatgtcatggaacacttggtgggtcatctttataaaaatc 1680
contig01260 41670
............................................................ 41611
2: N. lolii (ST) genome contigs 1_0 1141
accagacgatacaatctcgatagtaaccgcctgccccatagcgggattgattacacccag 1200
contig01260 42150
............................................................ 42091
1_0 1201
gcagctcatgacagtggtatcaatctccaatataagaccctacgaacggactctgatata 1260
contig01260 42090
............................................................ 42031
1_0 1261
acgccatcgtccccgactcatgatgcccatgtgaaacctttaccagttgccaacgccgtg 1320
contig01260 42030
............................................................ 41971
1_0 1321
tcctcgttagaggtcctgaacaatctgtgtgaacagagtagttggaaatgggtggaaggt 1380
contig01260 41970
............................................................ 41911
1_0 1381
atgttaattggaggctgtcttcaatacggcctagagcgatacgatgatgcgttcaagtcc 1440
contig01260 41910
............................................................ 41851
1_0 1441
ttctcaaggattgtcgcagttgattccaggtaagttgctcgccacaataccctcactcct 1500
contig01260 41850
............................................................ 41791
1_0 1501
ctgcttgatctcacaatcaccggcttcccagccatgttgaagctatcagtcatatgggcg 1560
contig01260 41790
............................................................ 41731
1_0 1561
cagccttgtattgcctcggacgtcaagatgaagcagagaaaaattggctccgggtgataa 1620
contig01260 41730
............................................................ 41671
1_0 1621
agctacgaccaaattatctcgatgccacggaacacttggtgggccatctttataaaaatc 1680
contig01260 41670
............................................................ 41611
3: LpTG-2 (NEA11) genome contigs 1_0 1141
accagacgatacaatctcgatagtaaccgcctgccccatagcgggattgattacacccag 1200
contig04703 1281
............................................................ 1340
contig18455 473 .......a..........g.... 451 1_0 1201
gcagctcatgacagtggtatcaatctccaatataagaccctacgaacggactctgatata 1260
contig04703 1341
............................................................ 1400
contig18455 450
....t....t.............................ac................g.. 391
1_0 1261
acgccatcgtccccgactcatgatgcccatgtgaaacctttaccagttgccaacgccgtg 1320
contig04703 1401
............................................................ 1460
contig18455 390
...................................g........c..c............ 331
1_0 1321
tcctcgctagaggtcctgaacaatctgtgtgaacagagtagttggaaatgggtggaaggt 1380
contig04703 1461
............................................................ 1520
contig18455 330
..t...c................c...............g.................... 271
1_0 1381
atgttaattggaggctgtcttcaatacggcctagagcgatacgatgatgcgttcaagtcc 1440
contig04703 1521
............................................................ 1580
contig18455 270
......g................g.....t..............a............... 211
1_0 1441
ttctcaaggattgtcgcagttgattccaggtaagttgctcgccacaataccctcactcct 1500
contig04703 1581
............................................................ 1640
contig18455 210
..........................a.......c...c...........t.c..t...g 151
1_0 1501
ctgcttgatctcacaatcaccggcttcccagccatgttgaagctatcagtcatatgggcg 1560
contig04703 1641
............................................................ 1700
contig18455 150
t.............g...c.t.......t............................... 91 1_0
1581 cagccttgtattgcctcggacgtcaagatgaagcagag-aaaaattggctccgggtgata
1619 contig04703 1701
......................................a..................... 1760
contig18455 90
......................c.....c.........-c.................g.. 32 1_0
1620 aagctacgaccaaattatctcgatgccacggaacacttggtgggccatctttataaaaat
1679 contig04703 1761
............................................................ 1820
contig18455 31 ..............c................
[0336] The panel below shows the N. lolii peramine gene from
GenBank used as a query against NEA11 genome assembly contigs.
BLAST(N) alignment of LpTG-2 endophyte strain NEA11 reads against
the peramine gene (perA) sequence (GenBank accession number:
AB205145). The presence of SNP in one set of contigs indicates the
presence of two copies of the peramine gene sequence in endophyte
strain NEA11.
TABLE-US-00011 PerA_A3205145.1 1596
gcgcgtcacgatttcccatttaacaccctcagtcacgcggctgatagacccagattcaca 1655
FYGH81301D3US2 24
............................................................ 83
FYGH813013FIA9 24
............................................................ 83
FYGH81301AO93L 450 ...... 453 FYGH81301CXOSV 247
.............g.........................a.................... 156
FYGH81301BMMOF 247
.............g.........................a.................... 306
FYGH81301D5HI6 247
.............g.........................a.................... 306
FYGH81301CM2KG 52
.............g.........................a............ 1
FYGH81301AWXAQ 251
.............g.........................a.................... 310
PerA_A3205145.1 1656
accttttctaaagacgatggtgtttaccggcgagcctctgtctgtggacgatgctacccg 1715
FYGH81301D3US2 34
............................................................ 143
FYGH81301BFIA9 34
............................................................ 143
FYGH81301CXOSV 307
...cg.c..c.................................................. 366
FYGH81301BMMOF 307
...cg.c..c.................................................. 366
FYGH81301DBHI6 307
...cg.c..c.................................................. 366
FYGH81301AWXAQ 311 ...cg.c..c............... 335 PerA_A3205145.1
1716 atggtggggaaaggtcgacgtcgtcaacgaatatgggcctgcagagtgcaccatcaacac
1775 FYGH81301D3U82 144
............................................................ 203
FYGH813013FIA9 144
............................................................ 203
FYGH81301CXCSV 367
............................................................ 426
FYGH81301BMMOF 367
............................................................ 426
FYGH81301D3HI6 367
............................................................ 426
PerA_A3205145.1 1776
tgtcaacagccgacctatcagtcctgaagctgctacgaacatagggctgccggttggagt 1835
FYGH81301D3U82 204
............................................................ 263
FYGH813013FIA9 204
............................................................ 263
FYGH81301CXOSV 427
..............................c...g......................... 486
FYGH81301BMMOF 427
..............................c...g......................... 486
FYGH81301D3HI6 427
..............................c...g......................... 486
PerA_AB208145.1 1836
ggccgcttggattaccgacccggaaaaccatcaagtactcgttccgatcggctgtgttgg 1895
FYGH81301D3U82 264
............................................................ 323
FYGH81301BFIA9 264
............................................................ 323
FYGH81301CXOSV 487 ...............a........... 513 FYGH81301BMMOF
487 ...............a........... 513 FYGH81301DBHI6 487
............... 501 FYGH81301EQ6ID 4
............tg................a.............. 47
Mating-Type Analysis
[0337] In heterothallic fungi, such as Epichloe spp, strains must
be of opposite mating-type for sexual reproduction to proceed. In
Epichloe spp, sexual development is regulated by alternative MAT1-1
(comprising MAT1-1-1, MAT1-1-2 and MAT1-1-3) and MAT1-2 (comprising
MAT1-2-1) genes at the MAT locus. Although the flanking regions of
MAT1-1 and MAT1-2 are homologous, the nucleotide sequences of
MAT1-1 and MAT1-2 idiomorphs are highly dissimilar (FIG. 7).
[0338] The mating-type locus of E. festucae E2368 was contained in
contig 5 of the original assembly (University of Kentucky,
http://www.genome.ou.edu.fungi.html). This contig was aligned with
contigs derived from N. lolii endophyte strain ST. The MAT1-1
mating-type locus genes found in E. festucae (MAT1-1-1, MAT1-1-2,
MAT1-1-3) were demonstrated to be absent in the N. lolii consensus
sequence (FIG. 7). In the corresponding location a single gene for
the opposite mating type (MAT1-2) was identified. This opposite
mating type gene (MAT1-2-1) was found in all the N. lolii strains
sequenced as well as NEA12 (Table 10).
TABLE-US-00012 TABLE 10 GS-FLX based sequence analysis of
mating-type loci. Endophyte strain E1 is of the same mating-type as
E. festucae strain E2368. ##STR00003## ##STR00004##
[0339] To assess the mating type of endophyte strain E1, the two
possible mating type contigs were compared to E1 contigs. This
activity proved that E1 contained the same three (MAT1-1-1,
MAT1-1-2, MAT1-1-3) mating-type genes as E. festucae E2368 and is
thus of the MAT1-1 mating-type. This is in contrast to the mating
type gene of non-N. lolii strain NEA12, which is of the MAT1-2, N.
lolii-like, mating-type.
[0340] Cluster analysis based on sequence nucleotide diversity
shows that endophyte strains E1 and NEA12 cluster with E. festucae
strain E2368, with their position in the tree switching between
analysis based on the mating-type loci flanking sequence and the
NoxR gene respectively, and suggesting that recombination has
occurred in these lineages (FIG. 8).
[0341] The identification of an endophyte strain of the opposite
mating-type to previously characterised perennial ryegrass
endophyte strains provides a means for molecular breeding of
endophytes to deliver favourable traits into the plant endophyte
symbiotum through the use of the novel E1 strain endophyte.
Mitochondrial Genome Analysis
[0342] The mitochondrial genome of N. lolii endophyte strain Lp19
was present as a single c.88.7 kb contig. This sequence was used to
identify contigs containing mitochondrial DNA sequences in the
other N. lolii strains sequenced through BLAST(N)-based sequence
similarity. Homology searches identified mitochondrial contigs in
the E. festucae strain E2368 assembly the two non-N. lolii genomes
and the LpTG-2 genome that were sequenced.
[0343] The mitochondrial genome sizes for each of the fungal
endophytes sequenced in this study as well as the E. festucae
strain E2368 are shown on Table 11. A representative of the
Clavicipitaceae, Metarhizium anisopliae (Genbank reference number
NC.sub.--008068.1), is shown for comparison. The N. lolii
mitochondrial genomes are similar in size, ranging from 88,377 bp
for G4 to 88,740 bp for AR1. LpTG-2 representative, NEA11 has a
mitochondrion genome similar in size to N. lolii. The two non-N.
lolii genomes, E1 (63,218 bp) and NEA12 (57,818 bp), have
relatively smaller mitochondrial genomes more similar in size to
that of E. festucae strain E2368 (69,614 bp) than that of N.
lolii.
TABLE-US-00013 TABLE 11 Mitochondrial genome size of the 10 fungal
endophyte strains sequenced in this study, E. festucae strain E2368
and Metarhizium anisopliae. non- non- Epichlo{umlaut over (e)} N.
lolli N. lolli N. lolli N. lolli N. lolli N. lolli N. lolli N.
lolli N. lolli LpTG-2 festucae Metarhizium Lp19 ST NEA3 AR1 E9 G4
NEA10 E1 NEA12 NEA11 2368 anisopliae Approximate Mitochondrial
88709 88711 87526 88740 88738 88377 88734 63219 57818 88692 69614
24674 Genome Lengths (bp)
[0344] The multiple mitochondrial DNA sequences were used to
generate a mitochondrial genome alignment along with the
mitochondrial genome sequence of the Clavicipitaceae fungus
Metarhizium anisopliae. The alignment demonstrated that while the
different mitochondrial genomes vary in size, the genes are present
in the same order and strand sense in all genomes, with differences
being due to variable insertions in each strain (FIGS. 9 and
10).
[0345] Scoring block presence as 1 and absence as 0, a matrix was
created to generate a parsimony tree of the relationships between
the mitochondrial genomes (FIG. 11). This tree places the E1 and
NEA12 mitochondria on a branch with the E. festucae strain E2368
mitochondrial genome, these three genomes showing greater variation
than that of the N. lolii mitochondria. The mitochondrial tree
shows that endophyte strains NEA12 and E1 are neither E. festucae
nor N. lolii, but are more similar to E. festucae than N. Endophyte
LpTG-2 NEA11 has a mitochondrial genome that is genetically a N.
lolii type, being in a Glade with NEA3 and AR1, within the N. lolii
cluster.
[0346] A similar pattern is observed if a neighbour joining tree is
constructed using ClustalW from a DNA alignment of only the 40
blocks of sequence that are shared across all endophyte species (c.
40 kb; FIG. 12). There are still gaps present in the Metarhizium
anisopliae sequence in this alignment.
A Quantitative PCR Method for Assaying Endophyte Biomass in
Planta
[0347] A quantitative PCR (qPCR) method for assaying endophyte
biomass in planta has been developed and successfully implemented.
The development of a high-throughput PCR-based assay to measure
endophyte biomass in planta enables efficient screening of large
numbers of plants to study endophyte-ryegrass biomass associations.
qPCR-specific primer sets have been designed for the peramine
biosynthesis gene (perA). To quantitatively assess in planta
endophyte biomass, a standard curve, ranging from 2.times.10.sup.2
to 2.times.10.sup.6 copies of the target sequence, has been
generated from endophyte DNA template (FIG. 16). The standard curve
is used to quantitatively determine in planta endophyte biomass of
unknown samples (FIG. 17).
[0348] A proof-of-concept study was conducted using a subset of
plants which had been previously analysed using established SSR
methodology. The analysis clearly shows a correlation between the
quantitative SSR allele scoring and the presence of endophyte in
planta (Table 12).
TABLE-US-00014 TABLE 12 Association between SSR-based analysis of
endophyte presence and endophyte colonisation as determined by
qPCR-based analysis. Each host genotype-endophyte combination
represented three independent biological replicates. An SSR-based
quality score was used to assess endophyte presence, a score of 3
indicated 3 out of 3 SSR markers were efficiently amplified and of
the correct size. Host plant- endophyte qPCR results combination
SSR-based assay (copies/ng gDNA) 1 1 Negative 2 3 16.638 3 3 68.98
4 1 Negative/very low 5 3 24.3 6 3 1.48 7 3 14.386 8 2 0.7646
EXAMPLE 4
Molecular Breeding--E1 as a Vehicle for Trait Delivery into
Perennial Ryegrass by Hyper-Inoculation
[0349] Endophyte E1 is a genetically novel, non-Neotyphodium lolii
endophyte. E1 is representative of an as yet un-named taxon [0350]
This supposition is supported by mitochondrial and nuclear genome
sequence analysis [0351] On the basis of DNA specific content, the
predicted alkaloid profile of E1 indicates that the lolitrem B
toxins deleterious to animal health are not produced by this
endophyte. [0352] The E1 endophyte does not produce lolitrem B,
ergovaline, peramine, lolines or janthitrems in planta. [0353]
Endophyte E1 has the mating-type MAT1-1, the opposite mating-type
to that carried by all N. lolii endophytes previously characterised
[0354] Endophyte E1 has a high inoculation success rate in
perennial ryegrass as compared to other endophytes [0355] The
identification of an endophyte of the opposite mating-type that is
highly compatible and stable in planta provides a means for
molecular breeding of endophytes for perennial ryegrass through
hyper-inoculation
[0356] Hyphal fusion between endophyte strains of the opposite
mating-type provides a means for delivery of favourable traits into
the host plant via hyper-inoculation. Such strains would include:
1) an endophyte strain that exhibits the favourable characteristics
of high inoculation frequency and high compatibility with a wide
range of elite perennial ryegrass host germplasm and; 2) an
endophyte that exhibits a low inoculation frequency and low
compatibility, but has a highly favourable alkaloid toxin
profile.
[0357] The E1 endophyte strain is genetically novel and is
compatible with a wide range of elite germplasm as it can be
inoculated with a high degree of success. E1 also is of the
opposite mating-type to all of the previously characterised
perennial ryegrass endophytes. Molecular breeding may therefore be
applied by combining the highly compatible E1 endophyte traits with
the favourable toxin profile traits of endophytes such as
NEA12.
[0358] The process of molecular breeding through vegetative
(hyphal) fusion may occur in planta by co-inoculation of two
endophyte into the same plant. However, molecular breeding may be
more efficiently achieved through vegetative fusion in in vitro
culture of endophytes of the opposite mating-type, followed by
hyper-inoculation of the resultant endophyte.
[0359] The following experimental design is applied for molecular
breeding of fungal endophytes
1. Determine vegetative compatibility of known endophytes using
established co-culturing methodologies. 2. Generation of
auxotrophic mutants (e.g. by gene silencing techniques such as
RNAi) for two strains of endophyte, such as E1 and NEA12,
exhibiting opposite mating-types. 3. Development of vegetative
(hyphal) fusion protocol using a combination of cell well degrading
enzymes and PEG-4000. 4. Screen for regenerated endophytes based on
survival (indicating complementarity of auxotrophic mutations). 5.
Genetic screen using SSR and/or mating-type markers to confirm
presence of the hybrid genome in a single nuclear compartment. 6.
Inoculation and compatibility/stability assessment of endophytes
using established methodologies. 7. Phenotypic assessment of
endophyte-host associations using established methodologies.
EXAMPLE 5
Generation of Artificial Polyploids of Fungal Endophytes
[0360] Colchicine has been widely used for induction of polyploidy
in plant species such as perennial ryegrass, as compared to the
application to fungi, which has been limited to a few species.
[0361] The mitotic spindle inhibitor colchicine is capable of
inducing autopolyploidisation, and may be applicable to the
production of artificial polyploid endophytes.
[0362] Artificial polyploids were generated by colchicine induced
chromosome doubling of the endophyte strains ST and NEA12.
[0363] NEA12, a janthitrem only producing endophyte, with superior
bioprotective properties forms stable associations with a limited
range of perennial ryegrass hosts. An artificial polyploid of NEA12
that is non-toxic to mammals, with enhanced bioprotective
properties, that is broadly compatible and highly stable is highly
desirable to industry.
Generation of Artificial Polyploids
[0364] Experiments were conducted to determine the range of
colchicine concentrations in which the mycelia of the fungal
endophyte N. lolii (strain ST) would grow successfully. Mycelia
were grown in colchicine concentrations ranging from 0% to 1% for
21 days and monitored for growth (FIG. 15). At greater than or
equal to 0.2% colchicine mycelium growth halted whereas at 0.1% or
less colchicine mycelium growth was prolific.
[0365] Artificial polyploids were generated for endophyte strains
ST and NEA12. Endophyte strains ST and NEA12 (n) were grown in 0,
0.1 and 0.2% colchicine and potato dextrose broth for 21 days
followed by a 7-10 day recovery period in potato dextrose broth
only. Protoplasts were generated from all colchicine concentrations
and single colonies isolated (FIG. 16).
[0366] N. coenophialum strain BE9301 and LpTG-2 strain NEA11 which
are natural heteroploids (3n and 2.times.n fused respectively) have
been utilised as control material for assessment of ploidy changes
using flow cytometry. An optimised protocol was established
allowing analysis of fungal protoplasts via flow cytometry. A
number of colonies have been identified with changes in nuclear DNA
content relative to the control samples (FIGS. 20 and 21).
TABLE-US-00015 TABLE 13 Summary of individual endophyte colonies,
ST and NEA12, treated with colchicine and subjected to flow
cytometry analysis. Colchicine Number of Number colonies Endophyte
treatment (%) colonies analysed N. lolii ST 0.2 12 12 N. lolii
NEA12 0.1 60 2 N. lolii NEA12 0.2 60 18
EXAMPLE 6
Generation of Novel Endophyte Variation Using Ionising
Radiation
Summary
[0367] Lolitrem B is the major alkaloid leading to ryegrass
staggers in grazing animals. [0368] A method has been developed to
eliminate the production of the detrimental alkaloid lolitrem B,
using X-ray mutagenesis induced deletion of genes in the lolitrem B
biosynthetic gene cluster, in the ST endophyte. [0369] Such an
endophyte would be advantageous over existing commercial
endophytes, as ST is highly stable and broadly compatible.
Introduction
[0370] Ionising radiation is capable of introducing a broad range
of mutagenic lesions and has been found to be very effective in
many species. Published methods are available to readily detect
deletion mutants in targeted plant genes (Li et al, 2002).
Experiments have been performed to determine if N. lolii mycelia
are amenable to production of mutagenic lesions by ionising
radiation, in particular deletion mutations.
Generation of Novel Endophyte Variation Using Ionising
Radiation
[0371] N. lolii strain ST was grown in potato dextrose broth for
different periods of time ranging from 2-14 days before exposure to
ionising radiation. Radiation from a caesium source was applied to
the liquid cultures in doses ranging from 10-30 Gy. Following a
recovery period (10-14 days) the radiation dose was repeated.
Protoplasts were generated and recovery of individual colonies
monitored over a 4-6 week period.
[0372] Lolitrem B is the major alkaloid leading to ryegrass
staggers in grazing animals. Three genes within the lolitrem B gene
cluster, which contains 10 genes all required for synthesis of
lolitrem B, were targeted to identify individual N. lolii colonies
with deletions (Young et al, 2005). A high throughput PCR screening
method was developed to detect for the presence and absence of the
three lolitrem B genes (FIG. 18).
TABLE-US-00016 TABLE 14 Analysis of ionising radiation experiments.
Protoplast regeneration, concentration of recovered protoplasts and
number of PCR analysed colonies. Endophyte Age of Dose Irradiation
Protoplast Colonies PCR screened strain Culture (Gy) events
regeneration Concentration plated colonies ST 2 wks 0 1 1.8 .times.
10.sup.8 pp/ml -- -- ST 2 wks 10 1 5.8 .times. 10.sup.5 pp/ml 700
450 ST 2 wks 15 1 7.5 .times. 10.sup.5 pp/ml 200 200 ST 2 wks 20 1
2.2 .times. 10.sup.6 pp/ml 2950 400 ST 2 wks 30* 1 -- -- -- -- ST 2
wks 30 1 1.94 .times. 10.sup.7 pp/ml 400 350 ST 2 wks 0 2 1.1
.times. 10.sup.8 pp/ml -- -- ST 2 wks 10 2 2.6 .times. 10.sup.5
pp/ml 150 150 ST 2 wks 15 2 slow/reduced 2.2 .times. 10.sup.7 pp/ml
200 200 numbers ST 2 wks 20 2 1.38 .times. 10.sup.7 pp/ml -- -- ST
2 wks 30/25 2 6.38 .times. 10.sup.5 pp/ml 1000 750 ST 2 wks 30 2
1.3 .times. 10.sup.8 pp/ml 900 300 ST 4 Days 0 1 2.5 .times.
10.sup.8 pp/ml -- -- ST 4 Days 10 1 slow/reduced 3.75 .times.
10.sup.8 pp/ml 200 200 numbers ST 4 Days 15 1 slow/reduced 1.38
.times. 10.sup.8 pp/ml 200 200 numbers ST 4 Days 20 1 slow/reduced
2.7 .times. 10.sup.5 pp/ml -- -- numbers ST 4 Days 25 1
slow/reduced 1.38 .times. 10.sup.5 pp/ml 50 50 numbers ST 4 Days 30
1 slow/reduced 1.38 .times. 10.sup.7 pp/ml -- -- numbers Total 6950
3250 *30 Gy dose for first irradiation
EXAMPLE 7
Tall Fescue Endophyte Discovery and Characterisation
Summary
Tall Fescue Endophyte Discovery
[0373] The strategies implemented for perennial ryegrass endophyte
discovery were extended to the resident endophytes of tall fescue
(including the FaTG-2 and FaTG-3 taxonomic groups).
[0374] A targeted collection of tall fescue germplasm was made from
throughout the range of natural growth and domesticated
cultivation.
[0375] A total of 568 tall fescue accessions obtained from 40
different countries were tested for endophyte incidence using
endophyte-specific simple sequence repeat (SSR) genetic markers.
Twelve to twenty seeds from each accession were tested for
endophyte presence. Total genomic DNA was extracted from two
independent seed bulks of 6-10 seeds from each accession and
endophytes were detected by PCR amplification with six
endophyte-specific SSR markers.
[0376] Endophyte was detected in 40% (228/568) of the tall fescue
accessions tested. Furthermore, accessions from 23 out of the 40
countries screened were endophyte positive (FIG. 19) showing the
highest incidence in Morocco and Pyrenees, where the majority of
accessions tested (80%-100%) were endophyte positive. Accessions
originating from Italy, Spain, and United States exhibited a higher
endophyte incidence among the tall fescue accessions tested.
[0377] A subset of selected endophyte positive samples, were
selected for further analysis using 32 endophyte-specific SSR
markers. The selected genotypes represent a broad range of known
geographical origins, hence representing an effective survey of
tall fescue endophyte genotypic variation. A set of 52 reference
isolates representing several endophyte species, including the
resident endophyte of tall fescue and meadow fescue were also
included to the diversity analysis.
[0378] The UPGMA phenogram, constructed using average taxonomic
distance based on SSR polymorphism across 203 endophyte positive
accessions, represented six different known taxa, and two
out-grouped clusters (FIG. 20). The phenogram was supported by
Mantel test statistics showing a high correlation coefficient
(r=0.95) which indicated a high goodness-of-fit for the data.
Endophytes representing six different taxa were detected in the 203
accessions (FIG. 20). The majority of endophytes (60%; 122/203)
appeared to belong to the taxon Neotyphodium coenophialum,
clustering in the phenogram with N. coenophialum isolates from the
reference endophyte collection (FIG. 20). This species occurred in
72% (122/170) of tall fescue collection accessions.
[0379] As defined by the N. coenophialum reference isolates, the N.
coenophialum cluster comprised five main sub-clusters, of which the
fifth sub-cluster is rather out grouped from the other four (FIG.
20).
[0380] The genetic variation observed within N. coenophialum was
high when comparing it with other taxonomic groups. In the
phenogram N. coenophialum strains clustered for the most part
according to their geographical origin (FIG. 20). The first
sub-cluster of N. coenophialum comprised mainly tall fescue
accessions from Spain (28) and few accessions from Pyrenees (3) and
France (4) (FIG. 20). Italian (7) and French (14) accessions were
clustered in the second sub-cluster (FIG. 20). The third
sub-cluster clearly shows the genetic similarity among accessions
collected from geographic area surrounding Russian Federation
[Slovenia (3), Russian Federation (6), Kazakhstan (7), Former
Soviet Union (4) and China (3)] (FIG. 20). Furthermore within the
third sub-cluster a set of accessions from France (11) and Pyrenees
(1) have formed a separate cluster from Russian Federation and its
surrounding geographic origins. The fourth sub-cluster comprises
only five endophytes of which two are Moroccan accessions and two
are AR endophytes (AR542 and AR584) which were initially isolated
from tall fescue originated in Morocco (Latch et al, 2000). The
accessions collected from Portugal (4) have formed a distinct
sub-cluster which is separated from all the other four sub-clusters
(FIG. 20).
[0381] FaTG-2 accessions formed a cluster close, but distinct from
isolates of N. lolii (FIG. 20). There were 20 FaTG-2 endophyte
genotypes tall fescue collection which clustered with the FaTG-2
reference genotype. Among them, a set of six accessions formed
sub-clusters having lesser genetic similarity to the FaTG-2
reference genotype. Therefore, the endophytes of those sub-clusters
were named "FaTG-2 like" endophyte genotypes.
[0382] A set of six endophyte genotypes formed a distinct cluster
with putative FaTG-3 reference isolates as defined by the
previously-analysed AR endophytes. Furthermore, 13 accessions
primarily originating from Morocco (9/13) formed a sub-cluster with
putative FaTG-3 isolates and those unidentified accessions, forming
a cluster distinct to putative FaTG-3 were named "FaTG-3 like"
endophytes (FIG. 20).
[0383] The identities of selected putative FaTG-2 and FaTG-3
accessions are largely consistent with geographical provenance, as
these taxa are known to be characteristic of populations from
southern Europe and North Africa.
[0384] Two out grouped clusters were also identified and they were
named as "out-group I" and "out-group II" (FIG. 20). Accessions of
Mediterranean origin primarily clustered in "out-group I", whereas
one accession from Former Soviet Union formed the second out-group.
Moreover, within "out-group I" Italian accessions clearly group
separately from Moroccan and Algerian accessions.
[0385] A number of candidate novel endophytes have been
identified.
Metabolic Profiling of Tall Fescue--Endophyte Associations
[0386] Representative tall fescue--endophyte associations were
selected for metabolic profiling analysis in order to determine the
endophyte derived alkaloid profile, in particular, lolitrem B,
ergot alkaloids, peramine and lolines.
[0387] Analysis of metabolite production was assessed under
controlled conditions using a growth chamber. Tall
fescue--endophyte associations were each replicated four times by
clonal splitting and arranged in a randomised block design in the
growth chamber. Plants were maintained in soil for six weeks, with
trimming every two weeks to encourage growth. Following 6 weeks
growth, pseudostem tissue was harvested and freeze dried prior to
performing a metabolite extraction and LCMS analysis. The perennial
ryegrass--N. lolii designer association Bronsyn-ST was used as a
control as ST is known to produce lolitrem B, ergovaline and
peramine. For each of the accessions, the presence and identity of
the resident endophyte was confirmed through SSR analysis of the
plant material harvested for metabolic profile analysis and
endophyte negative samples were removed from further analysis.
[0388] The results of the qualitative assessment alkaloid of
production for 20 novel tall fescue endophytes are summarised in
Table 15. Relative quantitation data for Batch three, comprising 13
endophytes assessed in their endogenous hosts, are shown in FIG. 21
and FIG. 22. A number of novel endophytes with favourable toxin
profiles (low/no ergovaline production combined with loline and
peramine production) have been identified.
TABLE-US-00017 TABLE 15 Summary of alkaloid profiles for selected
tall fescue endophytes in their endogenous host. Tall fescue
accession details Batch # Tall for fescue Endophyte alkaloid
Alkaloid profile Confirmed accession species profiling Lolines
Peramine Ergovaline* Lolitrem B profile 1 N. coenophialum 1 & 3
+ + +.sup.M - Y NEA13 N. coenophialum 2 n.d + + n.d n.a 3 N.
coenophialum 3 + + +.sup.L - n.a 4 N. coenophialum 1 n.d + + n.d
n.a 5 N. coenophialum 2 n.d + + n.d n.a 6 N. coenophialum 2 n.d - +
n.d n.a 7 N. coenophialum 2 & 3 + + +.sup.H - Y 8 N.
coenophialum 2 n.d + + n.d n.a 9 N. coenophialum 2 n.d + + n.d n.a
10 N. coenophialum 2 n.d - + n.d n.a NEA14 N. coenophialum 1 &
3 + + +.sup.H - Y 12 N. coenophialum 2 & 3 + - +.sup.H - Y 13
N. coenophialum 1 & 3 + + +.sup.L - Y 14 N. coenophialum 2
& 3 + + +.sup.L - Y 15 N. coenophialum 1 & 3 + + +.sup.M -
Y 16 FaTG-2 3 + + +.sup.M - n.a 17 FaTG-2 2 & 3 - + +.sup.M - N
18 FaTG-3 3 + + - + n.a 19 Out group 1 2 & 3 - - +.sup.L - Y 20
Out group 1 1 & 3 - - +.sup.L - Y ST N. lolii 3 - + + + Y
*Relative quantitation of ergovaline levels: .sup.L= Low; .sup.M=
Medium; .sup.H= High.
Establishment of Meristem Cultures for a Diverse Fescue Host
Panel
[0389] Tissue culture responsive genotypes from selected germplasm
material have been generated (Drover, Dovey, Bariane, Barolex).
Table 16 shows the host cultivars, and their tissue culture
responsive genotype, selected for further study. Each of the
selected genotypes has a regeneration frequency greater than
80%
TABLE-US-00018 TABLE 16 Establishment of meristem cultures for a
diverse tall fescue host panel. TCR genotype used for Cultivar
inoculation Species Characteristics Bariane BARI 27 L. arundinaceum
Soft leaved, later maturing, highly palatable Dovey DOV 24 L.
arundinaceum High yielding, fast establishing Quantum QUAN 17 L.
arundinaceum Soft leaved with improved rust resistance Jesup JESS
01 L. arundinaceum Cool season perennial forage Bronsyn BRO 08 L.
perenne Standard perennial ryegrass forage type
Tall Fescue Endophyte Isolation
[0390] Selected novel endophytes were isolated from tall fescue
accessions (Table 17).
TABLE-US-00019 TABLE 17 Summary of endophytes isolated from tall
fescue accessions Endophyte Accession Origin Taxon 1 Spain N.
coenophialum NEA13 N. coenophialum 4 Pyrenees N. coenophialum 5
Pyrenees N. coenophialum 6 Catalunya (Spain) N. coenophialum 7
Corsica (France) N. coenophialum 8 Corsica (France) N. coenophialum
9 Corsica (France) N. coenophialum 10 Aragon (Spain) N.
coenophialum NEA14 PaySardegna (France) N. coenophialum 12 Aragon
(Spain) N. coenophialum 13 Gaurda (Portugal) N. coenophialum 14
Gaurda (Portugal) N. coenophialum 15 Aragon (Spain) N. coenophialum
17 Spain FaTG-2 18 Tunisia FaTG-3 19 Algeria outgroup1 20 Sardegna
(NW Italy) outgroup1 21 Catalunya (Spain) N. coenophialum
Isogenic Inoculation of Novel Tall Fescue Endophytes
[0391] A set of ten novel tall fescue endophytes were selected for
inoculation based on genetic novelty using SSR-based diversity
analysis and the toxin profile based on qualitative metabolic
profiling (Table 18). Included in the set was the endophyte AR542 a
commercial endophyte in use globally. AR542 was discovered and
isolated by AgResearch NZ and is marketed as MaxP.TM. and
MaxQ.TM..
TABLE-US-00020 TABLE 18 Endophytes selected for isogenic
inoculation based on analysis of genetic diversity and metabolic
profile Tall fescue accession details Tall fescue Endophyte
Alkaloid profile accession species Lolines Peramine Ergovaline
Lolitrem B NEA13 N. coenophialum n.d + + n.d 3 N. coenophialum + +
+.sup.L - 22 N. coenophialum n.d n.d n.d n.d NEA14 N. coenophialum
+ + +.sup.H - 13 N. coenophialum + + +.sup.L - 15 N. coenophialum +
+ +.sup.M - 17 FaTG-2 - + +.sup.M - 19 Out group 1 - - +.sup.L - 20
Out group 1 - - +.sup.L - AR542* N. coenophialum n.d n.d - n.d
*toxin profile from Bouton et al, 2002.
[0392] In order to accurately determine the phenotypic effects of
different candidate endophytes in the absence of host-specific
genetic effects, a system for isogenic inoculation was used. Novel
candidate endophytes were individually inoculated into elite tall
fescue germplasm as well as the perennial ryegrass host genotype
Bronsyn (Bro08). Following inoculation and plantlet regeneration in
culture, plants were transferred to soil for three months to allow
establishment of endophyte and host-plant associations. After this
period, three tillers from each plant were sampled and tested for
endophyte presence using SSR-based analysis.
[0393] Of the 498 isogenic inoculations tested, 109 (21.9%) could
be positively scored with a high degree of confidence. Successful
inoculations are listed on Table 19.
[0394] Variation in inoculation success according to candidate
endophyte identity was observed. Endophyte strain 3 (4.3%), for
example, exhibited relatively lower success rates as compared to
strain 20 (51.1%), or the commercial endophyte AR542 (44.4%; Table
19) and only formed stable associations with one of the five hosts
(Bariane). No successful inoculations were identified for endophyte
strain 15. FaTG-2 endophyte, strain 17, is a highly compatible
endophyte which obtains a high rate of success of inoculation into
tall fescue (Table 19) compared to other endophytes examined, and
is comparable to AR542. Out-group 1 endophyte strain 20 exhibits
the highest level of compatibility as measured by its ability to be
inoculated.
[0395] Both tall fescue endophytes inoculated into perennial
ryegrass host Bro08, strain NEA13 and strain NEA14, were taken up
successfully, establishing that endophyte inoculation across a
range of host species is possible.
TABLE-US-00021 TABLE 19 Summary statistics for isogenic
inoculations of selected candidate endophytes in a targeted
isogenic tall fescue and perennial ryegrass panel of 5 hosts. C.
Percent of successful inoculations Endophyte strain Host plant
genotype 22 3 NEA13 15 NEA14 AR542 13 17 20 19 Total BARI 24 13.0
12.5 22.2 0.0 0.0 42.3 16.7 56.5 54.5 8.3 24.3 BRO 08 TBD TBD 18.2
TBD 11.8 TBD TBD TBD TBD TBD 14.3 DOV 24 30.0 0.0 TBD TBD TBD TBD
TBD TBD TBD TBD 12.5 JESS 01 30.4 0.0 17.9 0.0 35.0 47.4 20.0 10.0
41.7 20.0 22.2 QUAN 17 37.5 0.0 10.0 0.0 TBD TBD TBD TBD TBD TBD
17.5 Total 25.0 4.3 17.9 0.0 13.4 44.4 18.2 41.5 51.1 13.6 21.9
Species N. coenophialum Fa TG-2 Outgroup 1 TBD Be Determined
EXAMPLE 8
Antifungal Activity of Neotyphodium/Epichloe Endophytes
Introduction
[0396] Neotyphodium endophytes at present are largely unexplored in
terms of their production of novel antimicrobials.
[0397] While some Epichloe/Neotyphodium endophytes have been shown
to inhibit the growth of plant-pathogenic fungi in vitro, the
inhibitory substances produced have not been identified.
[0398] Endophytes with anti-fungal properties may benefit host
plants by preventing pathogenic organisms from colonising them and
causing disease. This is of particular interest to the turf grass
industry.
A Bioassay to Assess Antifungal Activity of Neotyphodium
Endophytes
[0399] To determine if endophytes of the species Neotyphodium
produce anti-fungal substances in vitro representative
species/strains from Neotyphodium were tested for the presence of
anti-fungal activity against eight species of fungal plant
pathogens.
[0400] Three types of inhibition reactions were observed. In the
first reaction, pathogenic fungal growth was unaffected. In the
second, growth of the pathogenic fungi was initially unaffected,
but growth ceased when the colony margin approached a "critical"
distance from the central endophyte colony. In the third stronger
reaction type, the overall growth of the colony of the pathogenic
fungi was reduced. Examples of inhibition reactions are shown in
FIG. 23.
[0401] Variation was observed within and between endophyte taxa.
Non-N. lolii strain NEA12 exhibits the strongest and most broad
spectrum antifungal activity. Variation was also observed among
genetically distinct strains of N. lolii. Within N. lolii, strains
with strongest to weakest effects were ST>AR1>NEA3>NEA10.
ST exhibited the broadest spectrum of antifungal activity,
inhibiting the growth of 7/8 fungi strains tested. The bioassay
results showed that endophytes in vitro exhibit variation in
anti-fungal activity that does not correlate with known toxin
production (specifically, lolitrem B, ergovaline and peramine). For
example NEA12 does not produce lolitrem B, ergovaline and peramine
and has strong antifungal activity and ST does produce lolitrem B,
ergovaline and peramine and also has strong antifungal
activity.
TABLE-US-00022 TABLE 20 Antifungal activity exhibited by
representative strains of N. lolii and related endophyte taxa.
Assays were scored visually from 0-5. Fungal species Endophyte
Endophyte Alternaria Colletrichum Rhizoctonia Trichoderma Phoma
Botrytis Bipolaris Drechslera strain species alternata graminicola
cerealis harzianum sorghina cinerea portulaceae brizae AR510 FaTG-3
0 0 5 1 NT NT NT NT NEA11 LpTG-2 0 1 2 0 NT NT NT NT AR1 N. lolii 0
0 3 0 2 0 1 1 NEA10 N. lolii 0 0 0 0 0 0 1 1 NEA3 N. lolii 0 0 1 1
1 0 0 0 ST N. lolii 0 1 3 2 2 2 4 3 NEA12 Non-N. lolii 3 4 4 3 3 3
3 2 NT--not tested. Samples are scored visually from 0-5. 0 is no
antifungal activity, 1 is low antifungal activity, 5 is strong
antifungal activity. NT--not tested
Mass Spectrometry for Identification of Antifungal Metabolites
[0402] Mass spectrometry was used to determine the relationship
between antifungal activity and metabolite expression.
[0403] Endophyte strains representing the full spectrum of
antifungal activity were selected for analysis in order to identify
those alkaloids that may be associated with antifungal activity
(FIG. 24).
[0404] Endophyte strains were grown both in the presence and
absence of the pathogenic fungi Rhizoctonia cerealis (FIG. 25).
Freeze dried endophyte mycelia was then extracted for metabolic
profiling analysis.
[0405] Following extraction, a validation assay was done to ensure
that the alkaloids associated with antifungal activity had been
appropriately extracted (FIG. 26). The antifungal activity of the
extract used for LCMS analysis was confirmed. The expression of
antifungal alkaloids is constitutive as extracts taken from
endophyte in the absence of Rhizoctonia cerealis also exhibit
antifungal activity (FIG. 26).
EXAMPLE 9
Metabolic Profiling
Summary
[0406] Perennial ryegrass cultivars inoculated with the NEA12
endophyte were analysed using LCMS. The toxins peramine, ergovaline
and lolitrem B were not detected in the extract. The AR37
metabolite 11,12-epoxy janthitrem G was detected and its structure
assigned based on retention time and MS analysis of an extract of
the AR37 inoculated perennial ryegrass.
Metabolic Profiling of Endophyte Nea12 in Perennial Ryegrass.
[0407] Perennial ryegrass cultivars inoculated with different
endophytes were analysed for peramine (1), ergovaline (2), lolitrem
B (3) and the AR37 isolated metabolites janthitrem I (4)
(11,12-epoxy janthitrem G (janthitrem G (5)) by LCMS. Janthitrem G
is an isomer of the previously described janthitrem F (6) and its
structure was determined by NMR in the original patent describing
AR37 (Latch et al, 2000; structures shown in FIG. 27).
[0408] Standards were analysed to provide reference for the
perennial ryegrass analyses. The lolitrem B standard had
deteriorated significantly but a peak matching the expected m/z and
approximate retention time could be found (FIG. 28).
[0409] Data for AR37 inoculated endophyte and NEA12-inoculated
ryegrass gave comparable results. Neither contained detectable
levels of peramine, ergovaline or lolitrem B. Both contained
11,12-epoxy-janthitrem G (4) (FIG. 29). MSMS analysis of the ion
m/z 646 (4) is shown in FIG. 30. The data is a good match for that
described in the original patent application.
[0410] Analysis of NEA12 was carried out in a number of perennial
ryegrass cultivars. It was present to a greater or lesser extent in
the majority of those examined (Table 21). No attempt was made to
quantitate the amount found. A standard toxic (ST) endophyte was
analysed in the same perennial ryegrass cultivars. The ST endophyte
produced peramine and ergovaline but not janthitrems (Table 21).
The toxin profiles for ST and NEA12 are shown in FIG. 31.
TABLE-US-00023 TABLE 21 Analysis of endophytes in different
perennial ryegrass cultivars. Perennial ryegrass Endophyte
cultivar/inoculation event alkaloids detected NEA12 IMP04 20
janthitrem NEA12 TOL03 18 janthitrem NEA12 TOL03 16 janthitrem ST
TOL03 01 peramine, ergovaline, lolitrem B ST TOL03 12 peramine,
ergovaline, lolitrem B ST IMP04 44 peramine, ergovaline, lolitrem B
ST IMP04 04 peramine, ergovaline, lolitrem B ST BRO08 02 peramine,
ergovaline, lolitrem B ST BRO08 01 peramine, ergovaline, lolitrem
B
[0411] The NEA12 endophyte appears to have the same alkaloid
profile as AR37 and is distinctly different from the ST
endophyte.
EXAMPLE 10
Tall Fescue Endophyte Discovery
[0412] The objectives of this work on discovery and
characterization of endophytes in tall fescue (Lolium arundinaceum)
were:
1. Identification and characterisation of novel tall fescue
endophytes for evaluation in germplasm. 2. Development and
evaluation of optimised associations between novel endophytes and
elite germplasm.
[0413] The endophyte discovery was based on screening 568
accessions to identify endophyte positive plants followed by
genotyping 210 endophytes to identify novel endophytes in tall
fescue.
[0414] The characterisation in planta of novel endophytes from tall
fescue was based on the following steps: [0415] Meristem cultures
for tall fescue cultivars were established for isogenic host panel
[0416] Endogenous metabolic profiles were determined for 48 samples
[0417] Isolation of 38 endophytes was undertaken [0418] Inoculation
of 15-20 endophytes into isogenic host panel was undertaken [0419]
Isogenic host-endophyte associations were characterised Genotypic
Analysis of Endophyte Content in Accessions from a Targeted Fescue
Germplasm Collection
[0420] Initially, 472 accessions from 30 countries were tested for
endophyte incidence; with 2 replicates of 6-10 seeds in each bulk
per accession used in the analysis and endophyte incidence assessed
with 6 SSRs.
[0421] New accessions were included in the analysis from the
under-represented geographic origins; with a total of 568
accessions from 40 countries tested for endophyte incidence.
TABLE-US-00024 TABLE 22 Genotypic analysis of endophyte content in
accessions from a targeted fescue germplasm collection Number of
Percentage geographic origins positive accessions FEtc GRIN FEtc
GRIN collection collection collection collection Incidence 7 23 96%
30% assessment 01 Incidence -- 10 -- 45% assessment 02
[0422] Genotypic analysis of endophyte content in accessions from a
targeted fescue germplasm collection is shown in Table 22. 233
endophyte positive accessions (41%) were detected. The geographical
origins are represented in the endophyte incidence assessment.
[0423] A genetic diversity analysis of tall fescue endophytes is
shown in FIG. 33. A selected set of 210 accessions were used to
assess genetic diversity of tall fescue endophytes. Genetic
diversity was assessed with 38 SSR markers. Six different taxa were
detected. The majority were N. coenophialum. Twenty were FaTG-2.
Six were putative FaTG-3. Thirteen were FaTG-3 like.
[0424] Diversity of host and endophyte is shown in FIG. 34.
[0425] Selection of fescue-endophyte combinations for metabolic
profiling, endophyte isolation and isogenic inoculation is shown in
FIG. 35. 52 accessions were initially selected for metabolic
profiling and endophyte isolation. Endophyte presence was
consistently detected in 25 accessions (red). An additional 48
accessions from under-represented clusters were established in the
glasshouse and screened for endophyte presence. 20 accessions were
endophyte positive (blue) and were selected for further
analysis.
[0426] Selection of fescue-endophyte combinations for metabolic
profiling, endophyte isolation and isogenic inoculation is shown in
FIG. 36. Initial selections are shown in red. Additional selections
are shown in blue.
[0427] The desired toxin profile of tall fescue endophytes is shown
in FIG. 37.
EXAMPLE 11
Metabolic Profiling
[0428] The experimental design used for semi-quantitative metabolic
profile analysis of tall fescue-endophyte associations for the
detection of alkaloid production in the endogenous host background
is described below.
[0429] A metabolic profile analysis for detection of ergovaline and
peramine is shown in FIG. 38.
[0430] Endophytes selected for semi-quantitative analysis of
metabolites are shown in FIG. 39.
Metabolic Profile Analysis for the Detection of Alkaloid Production
of Different Fescue Endophytes
[0431] A metabolic analysis of tall fescue-endophyte associations
for the detection of alkaloid production including loline, loline
formate, peramine, ergovaline and lolitrem B in the endogenous host
background is shown in FIG. 40. The alkaloid profile (i.e. lolines,
peramine, ergovaline and lolitrem B) of tall fescue-endophyte
associations in the endogenous host background for a range of
endophyte strains belonging to different endophyte species is shown
in Table 23.
TABLE-US-00025 TABLE 23 Alkaloid profile (i.e. lolines, peramine,
ergovaline and lolitrem B) of tall fescue-endophyte associations in
the endogenous host background for a range of endophyte strains
belonging to different endophyte species Tall fescue accession
details Tall fescue Endophyte Endophyte Alkaloid profile accession
strain species Lolines Peramine Ergovaline* Lolitrem B BE9301 E34
N. coenophialum + + +.sup.L - 8PC NEA13 N. coenophialum n.d + + n.d
FEtc7-180 NEA14 N. coenophialum + + +.sup.H - FEtc7-58 NEA15 N.
coenophialum + + +.sup.M - FEtc7-342 NEA16 N. coenophialum + + - -
FEtc7-343 NEA20 N. coenophialum + + - - 234746 NEA22 N.
coenophialum + + +.sup.M - FEtc6-83 NEA24 N. coenophialum + +
+.sup.H - FEtc7-289 NEA25 N. coenophialum + - +.sup.H - FEtc6-68
NEA26 N. coenophialum + + + - FEtc6-85 NEA27 N. coenophialum n.d +
+ n.d FEtc6-87 NEA28 N. coenophialum n.d + + n.d FEtc7-127 NEA29 N.
coenophialum + + + - FEtc6-128 NEA30 N. coenophialum + + + -
FEtc6-129 NEA31 N. coenophialum + + + - 287819 NEA17 FaTG-2 - +
+.sup.M - 231557 NEA21 FaTG-2 + + - - 269850 NEA23 FaTG-3 + + - -
231553 NEA19 Out group 1 - - - - FEtc6-75 NEA18 Out group 1 - - - -
ST ST N. lolii - + + + AR542* AR542 N. coenophialum + + - - KY31*
KY31 N. coenophialum + + + - E77* E77 N. coenophialum + + + -
(*Published data; nd = not determined).
[0432] Further metabolic analysis of the fescue endophytes is shown
in FIG. 41.
EXAMPLE 12
Semi-Quantitative Analysis of Metabolic Profile Under
Temperature/Water Stress
[0433] In addition to the metabolic analysis of tall
fescue-endophyte associations grown under standard conditions, for
the detection of alkaloid production conferred by the endopohytes
in the endogenous host background (FIGS. 38-41), a
semi-quantitative analysis of metabolic profiles of tall
fescue-endophyte associations grown under high temperature and
water stress conditions was undertaken. Corresponding tall
fescue-endophyte associations were grown under 16 h Light and
30.degree. C.; 18 h Dark and 20.degree. C., and then sampled for
alkaloid profile analysis as described below: [0434] Harvest
(control).fwdarw.freeze dry.fwdarw.50 mg pseudostem
material.fwdarw.80% methanol extraction.fwdarw.LCMS analysis [0435]
Recovery and water stress [0436] Second harvest
(stress).fwdarw.freeze dry.fwdarw.SSR confirm all of the plant
material again.
[0437] This was performed in a controlled (growth chamber)
environment simulating summer conditions, with light watering as
required. Nine copies per accession were planted in general potting
mix. A Randomized Complete Block with subsampling was used.
[0438] FIG. 42 shows a semi-quantitative analysis of metabolic
profile of tall fescue-endophyte associations grown under high
temperature and water stress conditions.
EXAMPLE 13
In Planta Isogenic Inoculation in Tall Fescue with Novel
Endophytes
Summary
[0439] A total of 36 fescue endophytes have been isolated from a
range of fescue accessions from different geographic origin as
described in Table 24, and found to belong to different taxa as
follows: 19 of them being N. coenophialum; 5 of them being FaTG-2;
3 of them being Outgroup; 3 of them being FaTG-3; 3 of them being
FaTG-3 like; and 3 of them being N. uncinatum
TABLE-US-00026 TABLE 24 Isolation of fungal endophyte cultures from
endophyte-containing fescue accessions Establishment of Meristem
Cultures for Diverse Host Panel for In Planta Inoculation of Fescue
Endophytes Fescue Endophyte Accession Strain Origin Cluster Taxon 1
8PC 8PC C01.1 N. coenophialum 2 BE9301 E34 C01.1 N. coenophialum 3
E77 E77 C01.2 N. coenophialum 4 FEtc6-62 Catalunya (Spain) 4 C01.2
N. coenophialum 5 FEtc6-68 NEA26 Catalunya (Spain) 14 C01.2 N.
coenophialum 6 FEtc7-127 NEA29 Aragon (Spain)14 C01.2 N.
coenophialum 7 FEtc7-289 NEA25 Aragon (Spain)14 C01.2 N.
coenophialum 8 FEtc7-58 NEA15 Aragon (Spain) 1 C01.2 N.
coenophialum 9 234746 NEA22 Spain C01.2 N. coenophialum 10 632582
Italy C02.1 N. coenophialum 11 Kentucky 31 KY31 C02.1 N.
coenophialum 12 FEtc6-128 NEA30 Pyrenees13 C02.2 N. coenophialum 13
FEtc6-129 NEA31 Pyrenees17 C02.2 N. coenophialum 14 FEtc7-180 NEA14
PaySardegna (Basque (Fran C02.2 N. coenophialum 15 440364
Kazakhstan C03 N. coenophialum 16 619005 China C03 N. coenophialum
17 FEtc6-83 NEA24 Corsica (France)7 C04 N. coenophialum 18 FEtc6-85
NEA27 Corsica (France) 15 C04 N. coenophialum 19 FEtc6-87 NEA28
Corsica (France) 17 C04 N. coenophialum 20 AR542 AR542 Morocco C05
N. coenophialum 21 FEtc7-342 NEA16 Gaurda (Portugal) C06 N.
coenophialum 22 FEtc7-343 NEA20 Gaurda (Portugal) C06 N.
coenophialum 23 231557 NEA21 Morocco C09 Fa TG-2 24 287819 NEA17
Spain C09 Fa TG-2 25 598834 Morocco C09 Fa TG-2 26 231559 Morocco
C09 Fa TG-2 27 598852 Morocco C09 Fa TG-2 28 598934 Italy C10
Outgroup 29 231553 NEA19 Algeria C10 Outgroup 30 FEtc6-75 NEA18
Sardegna (NW Italy) 5 C10 Outgroup 31 269850 NEA23 Tunisia C12 Fa
TG-3 32 610918 Tunisia C12 Fa TG-3 33 610919 Tunisia C12 Fa TG-3 34
598829 Morocco C13 Fa TG-3 like 35 598863 Morocco C13 Fa TG-3 like
36 598870 Morocco C13 Fa TG-3 like 37 M311046 Russion Federation
C14 N. uncinatum 38 M595026 United Kingdom C14 N. uncinatum 39
M611046 Russion Federation C14 N. uncinatum indicates data missing
or illegible when filed
[0440] Table 25 shows selected tall fescue and perennial ryegrass
cultivars used to identify representative plant genotypes included
in the diverse host panel for in planta inoculation of fescue
endophytes. All the selected plant genotypes have a high
regeneration frequency of >80%.
TABLE-US-00027 TABLE 25 Selected tall fescue and perennial ryegrass
cultivars used to identify representative plant genotypes included
in the diverse host panel for in planta inoculation of fescue
endophytes Genotype Cultivar code Species Characteristics Bariane
BARI 27 L. arundinaceum Soft leaved, later maturing, highly
palatable Dovey DOV 24 L. arundinaceum High yielding, fast
establishing Quantum QUAN 17 L. arundinaceum Soft leaved with
improved rust resistance Jesup JES 01 L. arundinaceum Cool season
perennial forage Bronsyn BRO 08 L. perenne Standard perennial
ryegrass forage type
[0441] Isolated fungal endophytes from endophyte-containing fescue
accessions selected for in planta isogenic inoculation into the
diverse host panel are shown in FIG. 43. FIG. 44 shows SSR-based
genotyping of isolated endophyte cultures prior to in planta
isogenic inoculation to confirm their identity.
[0442] Results from the SSR genotyping indicating the allele number
and sizes for different SSR markers for the different fescue
endophyte strains are shown in Table 26.
TABLE-US-00028 TABLE 26 Presence of alleles in endophyte strains
NCESTA1DH04 NLESTA1TA10 NCESTA1HA02 NCESTA1CC10 Endophyte Tall
Fescue (FAM) (FAM) (HEX) (HEX) Strain ID Accession ID Allele 1
Allele 2 Allele 3 Allele 1 Allele 2 Allele 3 Allele 1 Allele 2
Allele 3 Allele 1 Allele 2 Allele 3 AR542 -- 212 218 227 165 175
322 327 330 198 201 211 E34 BE_9301 212 218 224 165 175 322 329 330
198 201 211 E77 -- 212 218 224 165 175 308 322 330 197 201 211
NEA13 8PC 212 218 224 165 175 322 330 197 200 210 NEA14 FEtc7-180
215 218 229 165 175 322 329 330 198 201 NEA15 FEtc7-58 212 218 224
165 175 322 329 330 197 201 211 NEA16 FEtc7-342 215 227 165 175 309
322 330 198 201 211 NEA17 287819 215 221 227 171 175 322 201 203
NEA18 FEtc6-75 218 227 171 175 304 322 201 NEA19 231553 221 227 171
175 304 325 201
[0443] Results from the in planta isogenic inoculation into the
diverse host panel of selected isolated fungal endophytes from
endophyte-containing fescue accessions are shown in Table 27. Data
on number of inoculations tested, number of successful inoculations
and % of successful inoculations are provided in Table 6 to
illustrate the inoculation ability of tall fescue endophytes in
tall fescue and perennial ryegrass hosts.
TABLE-US-00029 TABLE 27 Inoculation Ability of Tall Fescue
Endophytes in Tall Fescue and Perennial Ryegrass Hosts E77 E34
NEA13 NEA15 NEA14 AR542 NEA16 NEA17 NEA18 NEA19 E77 BE9301 8PC
Fetc7-58 FEtc7-180 AR542 FEtc7-342 287819 FEtc6-75 231553 Total A.
Number of inoculations tested BARI 27 23 25 30 34 38 38 24 32 40 27
311 BRO 08 39 31 24 27 35 36 30 33 48 22 325 DOV 24 10 14 NI NI NI
17 8 18 14 16 97 JESS 01 23 23 39 27 20 36 33 17 28 14 260 QUAN 17
8 31 20 15 17 21 18 16 15 8 169 Total 103 124 113 103 110 148 113
116 145 87 1162 B. Number of successful inoculations BARI 27 3 3 4
0 1 11 3 17 18 2 62 BRO 08 0 0 2 0 2 0 0 4 2 5 15 DOV 24 3 0 NI NI
NI 1 0 1 4 0 9 JESS 01 7 0 5 0 7 10 3 2 1 2 37 QUAN 17 3 0 1 0 0 0
0 6 5 3 18 Total 16 3 12 0 10 22 6 30 30 12 141 C. Percent of
successful inoculations BARI 27 13.0 12.0 13.3 0.0 2.6 28.9 12.5
53.1 45.0 7.4 18.8 BRO 08 0.0 0.0 8.3 0.0 5.7 0.0 0.0 12.1 4.2 22.7
5.3 DOV 24 30.0 0.0 NI NI NI 5.9 0.0 5.6 28.6 0.0 10.0 JESS 01 30.4
0.0 12.8 0.0 35.0 27.8 9.1 11.8 3.6 14.3 14.5 QUAN 17 37.5 0.0 5.0
0.0 0.0 0.0 0.0 37.5 33.3 37.5 15.1 Total 22.2 2.4 9.9 0.0 10.8
12.5 4.3 24.0 22.9 16.4 12.7 Cluster 1 1 1 1 2 3 3 7 8 8 Species N.
coenophialum Fa TG-2 Outgroup 1 NI Not inoculated
EXAMPLE 14
Endophyte Vegetative Stability in Tall Fescue and Perennial
Ryegrass Host Genotypes
[0444] Following in planta isogenic inoculation with a range of
selected isolated endophytes from fescue accessions, the endophyte
vegetative stability of these endophytes in the different tall
fescue and perennial host genotypes (i.e. BRO 08, BARI 27, DOV 24)
was assessed, showing that: [0445] Several tall fescue endophytes
(e.g. NEA17, NEA18, NEA19) were stable in perennial ryegrass
(BRO08). [0446] BARI27 formed stable associations with all
endophytes except for NEA15. [0447] NEA15 failed to form stable
associations with any of host genotypes tested. [0448] DOV24 formed
few stable associations.
[0449] The stability of these associations of novel tall fescue
endophytes inoculated in different tall fescue and perennial
ryegrass genotypes from the diverse host panel was assessed 12
months post-inoculation. Corresponding results are shown in Table
28.
TABLE-US-00030 TABLE 28 Stability of associations of novel tall
fescue endophytes (e.g. NEA13, NEA14, NEA15, NEA16, NEA17, etc.)
inoculated in different tall fescue and perennial ryegrass
genotypes (BARI 27, BRO 08, DOV 24, JESS 01 and QUAN 17) from the
diverse host panel assessed 12 months post-inoculation. NEA15 NEA14
NEA16 NEA18 Plant E77 E34 NEA13 Fetc7- FEtc7- AR542 FEtc7- NEA17
FEtc6- NEA19 Genotype E77 BE9301 8PC 58 180 AR542 342 287819 75
231553 BARI 27 1/2 2/2 1/4 NA 1/1 7/7 1/1 1/2 8/10 1/1 BRO 08 NA NA
0/1 NA 0/2 NA NA 5/5 2/2 3/5 DOV 24 1/2 NA NI NI NI 0/1 NA 2/2 2/4
NA JESS 01 5/5 NA 4/6 NA 5/6 5/10 2/3 0/1 0/1 3/3 QUAN 17 2/3 NA
0/1 NA NA NA NA 3/6 3/5 1/2 NA--not applicable, NI--not inoculated,
number of stable association/number of associations
[0450] FIG. 45 shows stability at 12 months post inoculation of
selected endophytes in tall fescue and perennial ryegrass host
genotypes from the diverse host panel.
[0451] The range of novel fescue endophytes selected for in planta
isogenic inoculation is shown in FIG. 46.
[0452] Table 29 shows additional novel tall fescue endophytes (e.g.
NEA20, NEA21, NEA22, etc.) selected for in planta isogenic
inoculations in tall fescue genotypes (i.e. BARI 27, JESS01 and
QUAN 17) from the diverse host panel, based on the following
selection criteria: [0453] 1. Produce little or no ergovaline
[0454] 2. Produce no lolitrem B [0455] 3. Produce lolines and/or
peramine
TABLE-US-00031 [0455] TABLE 29 Additional novel tall fescue
endophytes (e.g. NEA20, NEA21, NEA22, etc.) selected for in planta
isogenic inoculations in tall fescue genotypes (i.e. BARI 27, JESS
01 and QUAN 17) from the diverse host panel. NEA20 NEA21 NEA22
NEA23 NEA24 NEA27 NEA30 FEtc7- 231557 234746 269850 FEtc6- FEtc6-
FEtc6- 343 83 85 128 Nco FaTG-3 Nco FaTG-3 Nco Nco Nco Lol/--/P/--
Lol/--/P/-- Lol/E/P/-- Lol/--/P/-- Lol/E/P/-- ?/E/P/? ?/E/P/? BARI
27 28 30 30 TBI 30 25 30 JESS 01 23 20 20 TBI 20 20 30 QUAN 17 30
30 40 TBI 30 35 25 Nco = N. coenophialum; ? = alkaloid profile not
tested; TBI = To Be Inoculated.
EXAMPLE 15
Metabolic Profiling of Endophyte-Tall Fescue Associations
Established Following in Planta Isogenic Inoculations of Novel Tall
Fescue Endophytes in Tall Fescue Genotypes from the Diverse Host
Panel
[0456] Metabolic profiling of endophyte-tall fescue associations
established following in planta isogenic inoculations of novel tall
fescue endophytes in tall fescue genotypes from the diverse host
panel is shown in FIGS. 47, 49 and 50. These figures: [0457]
Compare semi-quantitative alkaloid profiles of selected endophytes
across different isogenic hosts [0458] Compare semi-quantitative
alkaloid profiles for diverse endophytes in an isogenic host [0459]
Compare semi-quantitative alkaloid profiles of tall fescue and
perennial ryegrass endophytes in the perennial ryegrass genotype
Bro08
[0460] FIG. 48 shows the presence of peramine and ergovaline in
endophyte-tall fescue associations established following in planta
isogenic inoculations of novel tall fescue endophytes in tall
fescue genotypes from the diverse host panel.
[0461] Table 30 shows metabolic profiling of endophyte-tall fescue
associations established following in planta isogenic inoculations
of novel tall fescue endophytes in tall fescue genotypes from the
diverse host panel. Confirmed endophyte positive (E+) plants were
split to 5 replicates and regularly trimmed to promote tillering.
Four months later E+ plants were re-potted in 12 replicates. One
month later E+ plants were re-potted if less than 9 positive copies
were available at the time. Endophyte status was tested using SSR
markers after each re-potting.
TABLE-US-00032 TABLE 30 Endophyte-tall fescue associations
established following in planta isogenic inoculations of novel tall
fescue endophytes in tall fescue genotypes from the diverse host
panel used for metabolic profiling. Endophyte genotype NEA19 NEA17
E34 Host genotypes 231553 287819 8PC AR542 BE9301 E77 Bariane
(Bari27) 2/5 2/5 3/3 11/11 3/3 10/11 5/5 10/10 1/4 8/12 NA 9/14
Dovey (DOV 24) NA 2/5 8/8 NA NA NA 3/5 6/12 Jessup (Jess01) 2/4 4/8
NA 3/3 12/12 4/4 12/12 NA 2/3 8/11 Quantum (Quan17) 2/5 8/7 4/5
12/12 NA NA 4/5 12/12 Bronsyn (Bro08) 9/9 10/11 5/5 11/12 1/9 0/8
NA NA Endophyte genotype NEA18 NEA14 NEA16 NEA15 Host genotypes
FEtc6-75 Fetc7-180 Fetc7-342 Fetc7-58 Bariane (Bari27) 5/5 12/12
3/4 5/12 1/4 1/6 16/25 Dovey (DOV 24) 3/5 3/12 NA NA NA Jessup
(Jess01) NA 2/4 7/19 2/3 12/12 NA Quantum (Quan17) 2/4 5/12 NA NA
NA Bronsyn (Bro08) 3/4 7/7 0/5 NA NA
[0462] A range of endophyte-tall fescue associations established
following in planta isogenic inoculations of novel tall fescue
endophytes in tall fescue genotypes from the diverse host panel
were selected for metabolic profiling (Table 30). In total, 29
isogenic host-endophyte associations were subject to LCMS analysis,
following the experimental design described below:
Experimental Design
[0463] Trim and re-pot plants [0464] 16 h Light, 30.degree. C.; 18
h Dark, 20.degree. C. [0465] Harvest (control).fwdarw.freeze
dry.fwdarw.50 mg pseudostem material.fwdarw.80% methanol
extraction.fwdarw.LCMS analysis [0466] Recovery and water stress
[0467] Second harvest (stressed).fwdarw.freeze dry.fwdarw.50 mg
pseudostem material.fwdarw.80% methanol extraction.fwdarw.LCMS
analysis.
[0468] This was performed in a controlled (growth chamber)
environment simulating summer conditions, with light watering as
required. Nine copies per accession were planted in general potting
mix. A Randomized Complete Block with subsampling was used.
EXAMPLE 16
Bio-Protective Properties of Fescue Endophytes
[0469] Three fungal pathogens (i.e. Colletrotrichum graminicola,
Drechslera brizae and Rhizoctonia cerealis)--causing a range of
fungal diseases and infecting a range of different plant
hosts--were included in antifungal bioassays used to analyse the
potential anti-fungal activities of isolated fescue endophytes.
FIG. 51 shows results from anti-fungal bioassays of isolated fescue
endophytes. Results of anti-fungal bioassays are also shown in
Table 31. A range of endophytes were found to have high (H) and
medium (M) antifungal activity (Table 31).
TABLE-US-00033 TABLE 31 Anti-fungal bioassays of isolated novel
fescue endophytes Antifungal activity against Tall Fescue
endophytes Colletotrichum Drechslera Rhizoctonia Strain ID
Accession Taxon graminicola brizae cerealis 1 440364 N.
coenophialum H H H 2 AR542 AR542 N. coenophialum M H H 3 E34 BE9301
N. coenophialum M M H 4 NEA13 8PC N. coenophialum M H H 5 NEA14
FEtc7-180 N. coenophialum M M H 6 NEA15 FEtc7-58 N. coenophialum M
H H 7 NEA16 FEtc7-342 N. coenophialum M H H 8 NEA22 234746 N.
coenophialum H M M 9 NEA27 FEtc6-85 N. coenophialum L M L 10 NEA30
FEtc6-128 N. coenophialum M H H 11 E1 Non-N. lolii L L M 12 NEA18
FEtc6-75 Outgroup 1 M H H 13 598852 FaTG-2 M H H 14 610918 FaTG-3 M
H H 15 NEA21 231557 FaTG-3 M H M 16 598829 FaTG-3 like M L M
Antifungal activity: Low, Medium, High
EXAMPLE 17
Genome Survey Sequencing of Novel Tall Fescue Endophytes
[0470] A range of novel tall fescue endophtyes were subjected to
genome survey sequencing (GSS).
[0471] FIG. 52 shows a strategy for GSS of selected novel fescue
endophytes. The alkaloid profiles of novel fescue endophytes
subjected to GSS analysis are shown in Table 32.
TABLE-US-00034 TABLE 32 Alkaloid profiles of sequenced endophytes.
Tall fescue accession details Endophyte Accession Endophyte
Alkaloid profile in Endogenous Host strain No/isolated ID species
Lolines Peramine Ergovaline Lolitrem B E34 BE9301 N. coenophialum +
+ + - NEA13 8PC N. coenophialum ND + + ND NEA14 FEtc7-180 N.
coenophialum + + + - NEA15 FEtc7-58 N. coenophialum + + + - NEA16
FEtc7-342 N. coenophialum + + - - NEA20 FEtc7-343 N. coenophialum +
+ - - NEA22 234746 N. coenophialum + + + - NEA24 FEtc6-83 N.
coenophialum + + + - NEA17 287819 FaTG-2 - + + - NEA21 231557
FaTG-3 + + - - NEA23 269850 FaTG-3 + + - - NEA19 231553
non-Epichloe out-group - - - - NEA18 FEtc6-75 non-Epichloe
out-group - - - - AR542* AR542* N. coenophialum + + - - E77* E77*
N. coenophialum + + + - 598852 598852 FaTG-2 ND ND ND ND AR501*
AR501* FaTG-3 + + - - 598829 598829 FaTG-3 like ND ND ND ND E81 E81
N. uncinatum ND ND ND ND 9340 9340 E. typhina ND ND ND ND 9707 9707
E. baconii ND ND ND ND + Alkaloid present, - Alkaloid absent, ND:
alkaloid profile not determined *Profiles are taken from published
data
[0472] FIG. 53 shows the peramine biosynthetic pathway. PerA
encodes a single multifunctional enzyme that catalyses all the
biosynthetic steps. GenBank accession Number: AB205145. The
presence of the perA gene in non-Epichloe out-group endophytes is
shown in FIG. 54.
[0473] FIG. 55 shows the ergovaline biosynthetic pathway. Genes in
the eas gene cluster which are involved in ergovaline biosynthesis
are shown in FIG. 56 and Table 33. The dmaW gene encodes DMAT
synthase enzyme, which catalyzes the first committed step in
ergovaline biosynthesis. Presence of the dmaW gene in novel fescue
endophytes is shown in FIG. 57 and presence of the eas gene cluster
in novel fescue endophytes is shown in FIG. 58.
TABLE-US-00035 TABLE 33 Genes in the eas cluster Gene Cluster Gene
GenBank Accession No dmaW AY259838 eas gene easA EF125025 cluster
easE EF125025 easF EF125025 easG EF125025 easH EF125025 lpsA
AF368420 lpsB EF125025
[0474] FIG. 59 shows the Lolitrem B biosynthetic pathway. Genes in
the gene cluster which are involved in Lolitrem B biosynthesis are
shown in FIG. 60 and Table 34. Presence of gene cluster 1 (ItmG,
ItmM and ItmK) in endophytes is shown in FIG. 61, presence of gene
cluster 2 (ItmB, ItmQ, ItmP, ItmF and ItmC) is shown in FIG. 62 and
presence of gene cluster 3 (ItmE and ItmJ) is shown in FIG. 63.
TABLE-US-00036 TABLE 34 Genes in the gene cluster involved in
Lolitrem B biosynthesis Gene Cluster Gene GenBank Accession No gene
cluster 01 ltmG AY742903 ltmM AY742903 ltmK AY742903 gene cluster
02 ltmB DQ443465 ltmQ DQ443465 ltmP DQ443465 ltmF DQ443465 ltmC
DQ443465 gene cluster 03 ltmJ DQ443465 ltmE DQ443465
[0475] FIG. 64 shows the Loline biosynthetic pathway. Genes in the
gene cluster which are involved in Loline biosynthesis are shown in
FIG. 65 and Table 35. Presence of Loline biosynthetic gene cluster
in novel fescue endophytes is shown in FIG. 66.
TABLE-US-00037 TABLE 35 Genes in the Loline biosynthetic gene
cluster Gene Cluster Gene GenBank Accession No LOL gene lolF
EF012269 cluster lolC EF012269 lolD EF012269 lolO EF012269 lolA
EF012269 lolU EF012269 lolP EF012269 lolT EF012269 lolE
EF012269
[0476] FIG. 67 shows an alkaloid biosynthetic gene analysis for
endophyte strain NEA23. Tables 36 and 37 show alkaloid biosynthetic
gene analyses for various endophyte strains. Table 36 shows results
from the assessment of alkaloid biosynthetic gene presence/absence
for different endophytes by mapping genome survey sequence reads
corresponding to the different alkaloid biosynthetic genes/gene
clusters.
TABLE-US-00038 TABLE 36 Assessment of alkaloid biosynthetic gene
presence/absence for different endophytes by mapping genome survey
sequence reads corresponding to the different alkaloid biosynthetic
genes/gene clusters. ##STR00005## ##STR00006## (-) No alkaloid
detected (nd) Not determined
[0477] Table 37 shows results from the assessment of alkaloid
biosynthetic gene presence/absence for different endophytes by
mapping genome survey sequence reads corresponding to the different
alkaloid biosynthetic genes/gene clusters as well as corresponding
alkaloid profile observed for corresponding tall fescue-endophyte
associations.
TABLE-US-00039 TABLE 37 Alkaloid biosynthetic gene and alkaloid
production analysis. ##STR00007## A+: alkaloid present, A-:
Alkaloid absent, Grey: alkaloid profile not determined, *Profiles
are taken from published data, G+ = gene/gene cluster present, G- =
gene/gene cluster absent, PG+ = gene/gene cluster partially
present
[0478] Table 38 shows novel fescue endophytes (NEA16, NEA18, NEA19,
NEA20, NEA21 and NEA23) with favourable toxin profiles.
TABLE-US-00040 TABLE 38 Novel fescue endophytes (NEA16, NEA18,
NEA19, NEA20, NEA21 and NEA23) with favourable toxin profiles and
antifungal activities observed in bioassays. Tall fescue Alkaloid
profile accession Taxon (Lol/P/E/L) Antifungal NEA21 FaTG-3 +/+/-/-
High NEA23 FaTG-3 +/+/-/- Not tested AR501* FaTG-3 +/+/-/- -- NEA18
Non-Epichloe -/-/-/- High Outgroup NEA19 Non-Epichloe -/-/-/- Not
tested Outgroup NEA16 N. coenophialum +/+/-/- High NEA20 N.
coenophialum +/+/-/- Not tested AR542* N. coenophialum +/+/-/- --
*Control commercial endophyte
[0479] A genotypic analysis of the novel fescue endophytes NEA23
and NEA21 is shown in FIG. 68.
EXAMPLE 18
Overview of Generation of Novel Designer Neotyphodium Endophyte
Variant Strains Through Mutagenesis
[0480] The objective of this work was to create novel variants of
the perennial ryegrass endophyte, Neotyphodium lolii, through
induced polyploidisation and mutagenesis, with desirable properties
such as enhanced bioactivities (e.g. antifungal acitivity), and/or
altered plant colonization ability and stability of grass
host-endophyte variant associations (e.g. altered in vitro growth),
and/or altered growth performance (e.g. enhanced plant vigour,
enhanced drought tolerance, enhanced water use efficiency) of
corresponding grass host--endophyte variant associations. These
grass host-endophyte variant associations are referred to as novel
`designer` grass-endophyte associations.
Experimental Strategies for the Generation and Characterisation of
Novel Designer Neotyphodium Endophyte Variant Strains Through
Mutagenesis
[0481] The experimental activities thus included:
1. Establishment of phenotypic screens for novel `designer`
grass-endophyte associations such as: [0482] Enhanced biotic stress
tolerance [0483] Enhanced drought tolerance and enhanced water use
efficiency [0484] Enhanced plant vigour 2. Targeted generation
(i.e. polyploidisation and X-ray mutagenesis) and characterisation
(i.e. antifungal bioassays, in vitro growth rate, genome survey
sequencing [GSS]) of novel `designer` endophytes 3. Breeding of
`designer` grass-endophyte associations [0485] Delivery of
`designer` endophytes into grass (e.g. perennial ryegrass)
germplasm development process.
EXAMPLE 19
Establishment of Phenotypic Screens for Novel `Designer`
Grass-Endophyte Associations
[0486] Assessment of enhanced biotic stress tolerance using NEA12
is shown in FIGS. 71 and 72. FIG. 71 shows in vitro bioassays to
assess antifungal activity of Neotyphodium endophytes. FIG. 72
shows a detached leaf assay to assess resistance to crown rust
(Puccinia coronata f.sp. lolii).
[0487] Assessment of enhanced drought tolerance and enhanced water
use efficiency is shown in FIG. 73. This involved glasshouse and
field trial screens for drought tolerance, survival and recovery,
regrowth after drought, metabolic profiling and detailed phenotypic
characterisation including multiple trait dissection (based on
assessments and measurements associated with plant morphology,
plant physiology, plant biochemistry).
EXAMPLE 20
Generation of Designer N. lolii Genotypes by Polyploidisation
[0488] This involved creation of novel variation in Neotyphodium
endophytes without the use of transgenic technology. Colchicine has
been widely and successfully used for chromosome doubling in
plants, e.g. perennial ryegrass. It inhibits chromosome segregation
during mitosis inducing autopolyploidisation (chromosome doubling;
see FIG. 74). This enables the generation of novel endophytes
through induced chromosome doubling and may be applicable to the
production of artificial polyploid endophytes.
[0489] The experimental work flow for chromosome doubling is shown
in FIG. 75.
[0490] Flow cytometry calibrations to assess DNA content in
Neotyphodium endophytes are shown in FIG. 76. Peaks indicate
relative nuclear DNA content.
[0491] Flow cytometry analysis of NEA12.sup.dh strains is shown in
FIG. 77 and Table 39.
[0492] 1. ST endophyte strain is highly stable, broadly compatible
and produces lolitrems, peramine and ergovaline. 2. NEA12 endophyte
strain produces janthitrem only. 3. AR1 produces peramine only.
TABLE-US-00041 TABLE 39 Colchicine treated endophyte strains (ST,
NEA12 and AR1 endophyte strains) subjected to colchicine treatments
(at different colchicine concentrations in %) leading to the
recovery of endophyte colonies (# of colonies) used for flow
cytometry analysis Colchicine # of # colonies Endophyte treatment
(%) colonies analysed N. lolii ST 0.2 12 12 N. lolii NEA12 0.1 60 2
N. lolii NEA12 0.2 60 18 N. lolii AR1 0.1 60 0 N. lolii AR1 0.2 60
0
EXAMPLE 21
Analysis of In Vitro Growth of NEA12.sup.dh Neotyphodium Variant
Endophyte Strains
[0493] Analysis of growth rate of NEA12.sup.dh Neotyphodium variant
endophyte strains in in vitro culture after 8 weeks is shown in
FIG. 78. In an initial screen, analysis of variance identified two
NEA12.sup.dh Neotyphodium variant endophyte strains (NEA12.sup.dh17
and NEA12.sup.dh4) showing significantly different in vitro growth
rate to the control NEA12 endophyte:
NEA12.sup.dh17 grows significantly faster (p<0.01**)
NEA12.sup.dh4 grows significantly slower (p<0.05*)
[0494] Analysis of growth rate of NEA12.sup.dh Neotyphodium variant
endophyte strains in in vitro culture over 5 weeks is shown in FIG.
10. In a validation screen, Student's t-tests identified two
NEA12.sup.dh Neotyphodium variant endophyte strains (NEA12.sup.dh17
and NEA12.sup.dh15) showing significantly different in vitro growth
rate to the control NEA12 endophyte:
NEA12.sup.dh17 grows significantly faster (p<0.01**)
NEA12.sup.dh15 grows significantly slower (p<0.01**)
EXAMPLE 22
Antifungal Bioassays of NEA12.sup.dh Neotyphodium Variant Endophyte
Strains
[0495] A list of fungal pathogens (causing a range of fungal
diseases and infecting a range of different plant hosts) that were
included in antifungal bioassays used to analyse NEA12.sup.dh
Neotyphodium variant endophyte strains to assess their spectrum of
antifungal activities is shown in Table 40.
TABLE-US-00042 TABLE 40 Fungal pathogens (causing a range of fungal
diseases and infecting a range of different plant hosts) included
in antifungal bioassays to analyse NEA12.sup.dh Neotyphodium
variant endophyte strains to assess their spectrum of antifungal
activities Fungus Disease Hosts Alternaria leaf spot, rot, Numerous
(dead plant alternata blight materials) Bipolaris Damping-off
Asteraceae (daisies), portulacae Portulacaceae (purslane) Botrytis
Stem rot, mould, Many dicots, few monocots cinerea seedling wilt
Colletotrichum Leaf spot, stalk rot Poaceae graminicola (especially
Zea mays) Drechslera Leaf blight Poaceae brizae (Briza spp.) Phoma
Spot (leaf, glume, seed), Poaceae (grasses) sorghina Root rot,
Dying-off Rhizoctonia Spot (wheat) Poaceae (grasses) cerealis
Yellow patch (turfgrass) Trichoderma Green mould, Many dicots, few
harzianum Parasite of other fugni monocots, Fungi
[0496] Antifungal bioassays of NEA12.sup.dh Neotyphodium variant
endophyte strains are shown in FIGS. 80 and 81. Twenty NEA12.sup.dh
strains were screened for changes in antifungal activity. Four
NEA12.sup.dh strains (i.e. dh5, dh6, dh13 and dh14) were identified
as having greater antifungal activity compared to NEA12.
EXAMPLE 23
Genome Survey Sequencing and Sequence Analysis of NEA12.sup.dh
Neotyphodium variant endophyte strains
[0497] NEA12.sup.dh Neotyphodium variant endophyte strains with
enhanced antifungal activity, showing faster in vitro growth rate
and higher DNA content were subjected to genome survey sequencing
(GSS). Sequence data was generated for 10 NEA12.sup.dh strains and
control NEA12 strain (highlighted in blue on Table 41).
TABLE-US-00043 TABLE 41 List of NEA12.sup.dh Neotyphodium variant
endophyte strains showing different antifungal activity [higher
than control or equal to control (standard, Std)] and different in
vitro growth [slower than control, faster than conrol or equal to
control (standard, Std)] compared to control NEA12 strain Endophyte
Antifungal Growth NEA12 Std Std NEA12dh1 Std Std NEA12dh2 Std Std
NEA12dh3 Std Std NEA12dh4 Std Slower NEA12dh5 Higher Std NEA12dh6
Higher Std NEA12dh7 Std Std NEA12dh8 Std Std NEA12dh9 Std Std
NEA12dh10 Std Std NEA12dh11 Std Std NEA12dh12 Std Std NEA12dh13
Higher Std NEA12dh14 Higher Std NEA12dh15 Std Slower NEA12dh16 Std
Std NEA12dh17 Std Faster NEA12dh18 Std Std NEA12dh19 Std Std
NEA12dh20 Std Std
[0498] Genome survey sequencing (GSS) data obtained for
NEA12.sup.dh Neotyphodium variant endophyte strains derived from
colchicine treated NEA12 control strain (highlighted in blue on
Table 41) were analysed as follows: [0499] De-novo assembly of the
GSS data from NEA12 control strain--to act as a reference genome
sequence for the analysis of the NEA12.sup.dh Neotyphodium variant
endophyte strains [0500] Map the GSS data sequence reads from the
NEA12.sup.dh Neotyphodium variant endophyte strains to the NEA12
reference genome sequence [0501] Identify potentially duplicated
regions, i.e. regions with higher than expected sequence coverage
[0502] Identify gene sequences that may have been duplicated
[0503] Analysis of GSS read depth of NEA12.sup.dh Neotyphodium
variant endophyte strains is shown in FIG. 82. Analysis of sequence
contigs that appeared to have higher than expected read depth
indicates that no major duplication event has occurred (excepting
whole genome events). The patterns of read depth across these
contigs are not identical between strains. This suggests there are
differences between the NEA12.sup.dh Neotyphodium variant endophyte
strains and the control NEA12 strain.
[0504] Analysis of GSS sequence assemblies for the NEA12.sup.dh
Neotyphodium variant endophyte strains and the control NEA12 strain
is shown in Table 42.
TABLE-US-00044 TABLE 42 Analysis of GSS sequence assemblies for the
NEA12.sup.dh Neotyphodium variant endophyte strains and the control
NEA12 strain Strain # contigs N50 Max contig # bases NEA12 143202
28621 181461 32734984 NEA12dh5 305031 29444 191191 30994592
NEA12dh17 274394 37802 209957 30777017 NEA12dh18 282692 30717
177813 30889903
[0505] Independent de novo sequence assemblies were performed using
parameters identical to those used in assembling the genome
sequence for the control NEA12 endophyte strain. Differences in
sequence assembly statistics may indicate genomic differences
between strains. GSS data obtained for the NEA12.sup.dh
Neotyphodium variant endophyte strains and used in the sequence
assemblies reveal fewer bases incorporated into the sequence
assembly and produce more sequence contigs. Increased numbers of
smaller sequence contigs may be caused by transposon
movement/replication.
[0506] Analysis of sequence reads mapping to the NEA12 genome
sequence assembly is shown in FIG. 83. While we do not wish to be
restricted by theory, if the genomes were the same no difference in
the number of sequence reads mapping to the reference genome
sequence would be expected. NEA12.sup.dh Neotyphodium variant
endophyte strains range from 35-70% sequence reads mapping to NEA12
sequence contigs >5 kb in size. There are differences between
the genome sequences of the NEA12.sup.dh Neotyphodium variant
endophyte strains and the control NEA12 strain.
Summary of Results on Generation and Characterisation of Novel
Designer Neotyphodium Variant Endophyte Strains Through Colchicine
Treatment Based Mutagenesis
[0507] Sequence read depth changes were analysed in NEA12.sup.dh
Neotyphodium variant endophyte strains compared with the control
NEA12 strain. Whilst no large partial genome sequence duplication
events were detected, the occurrence of full genome duplication
events in the NEA12.sup.dh Neotyphodium variant endophyte strains
cannot be excluded based on the GSS sequence analysis.
[0508] De novo sequence assemblies were independently performed on
GSS data obtained from the NEA12.sup.dh Neotyphodium variant
endophyte strains. Differences in sequence assembly statistics
indicate that genomic changes were caused by the
colchicine-treatment in the NEA12.sup.dh Neotyphodium variant
endophyte strains. The number of sequence reads from NEA12.sup.dh
Neotyphodium variant endophyte strains mapping to the NEA12
reference genome sequence varies between strains. All GSS data
analyses performed on the NEA12.sup.dh Neotyphodium variant
endophyte strains indicate genomic differences.
[0509] In summary, the following novel designer endophytes were
generated by colchicine treatment of NEA12 endophytes: [0510] Four
NEA12.sup.dh Neotyphodium variant endophyte strains (dh5, dh6, dh13
and dh14) with enhanced bioprotective properties (i.e. antifungal
bioactivities); [0511] One NEA12.sup.dh Neotyphodium variant
endophyte strain (dh17) with higher in vitro growth rate than
control NEA12 strain (i.e. potentially with enhanced stability/host
colonization ability); [0512] Ten NEA12.sup.dh Neotyphodium variant
endophyte strains (including dh5, dh6, dh13, dh14 and dh17) and
control NEA12 strain subjected to genome survey sequencing; and
[0513] Five NEA12.sup.dh Neotyphodium variant endophyte strains
(including dh5, dh13 and dh17) selected and subjected to isogenic
inoculation in planta.
EXAMPLE 24
In Planta Isogenic Inoculation in Perennial Ryegrass with
NEA12.sup.dh Neotyphodium Variant Endophyte Strains
[0514] The following NEA12.sup.dh Neotyphodium variant endophyte
strains and control NEA12 strain were used for in planta isogenic
inoculation in perennial ryegrass: [0515] NEA12 [0516] NEA12dh5
showing higher antifungal activity than control NEA12 [0517]
NEA12dh13 showing higher antifungal activity than control NEA12
[0518] NEA12dh4 showing slower in vitro growth rate than control
NEA12 [0519] NEA12dh15 showing slower in vitro growth rate than
control NEA12 [0520] NEA12dh17 showing faster in vitro growth rate
than control NEA12
TABLE-US-00045 [0520] TABLE 43 Isogenic inoculation of perennial
ryegrass genotypes (IMP04 and TOL03) with NEA12dh Neotyphodium
variant endophyte strains. Numbers indicate number of perennial
ryegrass plants of the two genotypes subjected to isogenic
inoculation with the different NEA12dh Neotyphodium variant
endophyte strains. Plant Genotype NEA12dh4 NEA12dh5 NEA12dh13
NEA12dh15 NEA12dh17 NEA12 IMP04 30 30 30 30 32 30 TOL03 25 30 30 20
30 20
EXAMPLE 25
Generation of Designer N. lolii Genotypes by X-Ray Mutagenesis
[0521] The generation of designer Neotyphodium endophytes genotypes
by X-ray mutagenesis offers the opportunity to create novel
endophyte variant strains with enhanced properties, such as
enhanced stability in grass hosts, broader host compatibility as
well as improved toxin profiles e.g. following elimination of the
production of the detrimental alkaloid lolitrem B in the highly
stable and broadly compatible ST endophyte.
[0522] Such an novel designer endophyte would be advantageous over
existing commercial endophytes, such as AR1 and AR37, as it would
be highly stable and broadly compatible and with optimal toxin
profile.
[0523] FIG. 84 shows an experimental work flow for X-ray
mutagenesis of endophyte strains.
[0524] FIG. 85 shows the indole-diterpene biosynthetic pathway.
Lolitrem B is the major toxin that causes ryegrass staggers, a
disease of grazing animals. Ten genes in 3 gene clusters are
required for lolitrem biosynthesis. We focused initial analysis on
3 Ltm genes, one from each gene cluster. Optimised multiplex PCR
analysis was designed and implemented.
EXAMPLE 26
Screening of X-Ray Irradiated N. lolii Strains
[0525] In a preliminary primary screen >5,000 colonies of X-ray
irradiated N. lolii--established as an initial resource of novel
variation of N. lolii endoophytes induced through X-ray mutagenesis
and representing a mutagenised N. lolii endophyte strain
collection--of were screened by multiplex PCR analysis for the
presence of targeted Ltm genes leading to a preliminary
identification of .about.140 putative lolitrem B gene cluster
PCR-negative colonies (.about.2.5% of 5,000 colonies screened). In
a secondary screen high quality DNA was extracted (140 liquid
cultures) and PCR analysis conducted. This identified 2 putative
deletion mutants for one of the lolitrem B genes (ltm J).
TABLE-US-00046 TABLE 44 Putative X-ray irradiation-induced ltm gene
deletion mutants of N. lolii derived from irradiation with 30 Gy
dose. ##STR00008## The colony number represents the unique
identifier of the putative X-ray irradiation-induced ltm gene
deletion mutant (i.e. 139-6 and 145-15). Black represents
PCR-negative result for respective ltm gene analysis, white
represents PCR-positive result for respective ltm gene
analysis.
EXAMPLE 27
Antifungal Bioassays of Designer X-Ray Irradiated N. lolii Variant
Strains
[0526] There were eight X-ray irradiated N. lolii variant strains
(i.e. X-ray mutagenesis derived variant strains 1-35, 4-7, 7-22,
7-47, 123-20, 124-6, 139-6, 144-16 and 145-15) and one control N.
lolii strain (i.e. ST endophyte strain).
[0527] Five fungal pathogens (causing a range of fungal diseases
and infecting a range of different plant hosts) were included in
antifungal bioassays used to analyse the X-ray irradiated N. lolii
variant strains, as follows: [0528] Bipolaris portulacae [0529]
Colletotrichum graminicola [0530] Drechslera brizae [0531] Phoma
sorghina [0532] Rhizoctonia cerealis
[0533] No significant difference in antifungal activities of X-ray
irradiated N. lolii variant strains tested was observed compared to
the spectrum of antifungal activities observed for the control ST
endophyte strain.
EXAMPLE 28
In Vitro Growth of Designer X-Ray Irradiated N. lolii Variant
Strains
[0534] Results from the analysis of in vitro growth rate of
designer X-ray irradiated N. lolii variant strains are shown in
FIG. 86, with a statistical analysis of in vitro growth undertaken
at week 5 for the X-irradiated N. lolii variant strains compared to
the control ST strain, revealing significant differences in in
vitro growth rates as follows:
p<0.05* (for X-irradiated N. lolii variant strain 139-6)
p<0.01** (for all other mutants)
EXAMPLE 29
Genome Survey Sequencing of Designer X-Ray Irradiated N. lolii
Variant Strains
[0535] Eight X-ray irradiated N. lolii ST variant strains and
corresponding control ST strain were subjected to genome survey
sequencing (GSS), leading to 46-fold to 79-fold genome sequence
coverage for the different strains as shown in Table 45.
TABLE-US-00047 TABLE 45 Genome sequence coverage obtained in genome
survey sequencing for for 8 X-ray irradiated N. lolii ST variant
strains and corresponding control ST strain Strain Description
Coverage ST ST 23x 139-6 ST irradiated 61x 145-15 ST irradiated 52x
144-16 ST irradiated 46x 1_35 ST irradiated 79x 4_7 ST irradiated
46x 7_22 ST irradiated 53x 7_47 ST irradiated 38x 123-20 ST
irradiated 54x 124-6 ST irradiated 75x
EXAMPLE 30
Detecting Genome Sequence Variation in Designer X-Ray Irradiated N.
lolii Variant Strains
[0536] Results from the analysis to detect genome sequence
variation in X-ray irradiated N. lolii variant strains are shown in
FIG. 88. Corresponding results on the detection of single
nucleotide polymorphisms (SNPs) are shown in FIG. 89 and results on
the detection of small insertions/deletions (INDELs) are shown in
FIG. 90. Differences in sequence read depth and pair insert size in
X-ray irradiated N. lolii variant deletion mutant strains are shown
in FIG. 91.
[0537] Results on sequence analysis for Ltm gene clusters are shown
in FIG. 87. No deletions, large or small, were found in the coding
or regulatory sequences of ltm gene clusters. No SNPs, insertions
or translocations were found in the coding or regulatory sequences
of ltm gene clusters.
EXAMPLE 31
Spectrum of Genome Sequence Changes Detected in the X-Ray
Irradiated N. lolii variant strains
[0538] FIG. 92 shows numbers of SNPs detected in genic regions of
X-ray irradiated N. lolii variant deletion mutant strains. There
are large differences in the number of SNPs detected in the X-ray
irradiated N. lolii variant deletion mutant strains and compared to
the control ST strain. All X-ray irradiated N. lolii variant
deletion mutant strains have over double the number of SNPs per Mb
across genic regions compared to the control ST strain. X-ray
irradiated N. lolii variant deletion mutant strains have on average
6 SNPs per Mb, where the control ST strain has 2 SNPs per Mb.
[0539] FIG. 93 shows numbers of INDELs in genic regions of X-ray
irradiated N. lolii variant deletion mutant strains. All X-ray
irradiated N. lolii variant deletion mutant strains contain more
indels in genic regions than the control ST strain. The difference
in indel numbers between the X-ray irradiated N. lolii variant
deletion mutant strains and the control ST strain is on average 134
indels per Mb. When grouped by irradiation treatment (i.e.
irradiation dose applied and number of repeat irradiations) there
appears to be a peak in number of indels at 10Gy*2 treatment,
consistent with the results obtained in the SNP detection
analysis.
[0540] FIG. 94 shows the spectrum of genome sequence changes in the
form of deletions detected in X-ray irradiated N. lolii variant
deletion mutant strains.
[0541] Table 46 shows examples of some of these genome sequence
deletions detected in X-ray irradiated N. lolii variant deletion
mutant strains.
TABLE-US-00048 TABLE 46 Deletions detected in genome sequences of
X-ray irradiated N. lolii variant deletion mutant strains. Bold
indicates deletions confirmed by changes in sequence read coverage.
The remainder are potential transposon deletions. Radiation Strain
Treatment Deletion 123_20 30Gy*2 Contig00915 (268 bp) 124_6 30Gy*2
Partial duplication 139_6 30Gy Partial duplication 144_16 30Gy
145_15 30Gy Partial duplication 1_35 10Gy Contig00831 (3.6 kb) 4_7
10Gy 7_22 10Gy*2 7_47 10Gy*2 Contig01131 (0.6 kb), contig01082 (4.2
kb), contig02985 (1 kb), contig02725 (83 bp), contig01095 (130
bp)
[0542] The X-ray irradiated N. lolii variant deletion mutant strain
#7.sub.--47, which was generated following two X-irradiation
treatments at 10 Gy dose (10Gy*2) of N. lolii ST endophyte, had the
greatest number of large deletions.
EXAMPLE 32
Annotation of Deleted Sequences in the Genomes of X-Ray Irradiated
N. lolii Variant Deletion Mutant Strains
X-Ray Irradiated N. lolii Variant Mutant Strain 1.sub.--35:
[0543] For the X-ray irradiated N. lolii variant mutant strain
1.sub.--35 the following deleted sequences in ST454Contig00831
contig with a .about.4,400-8,000 bp length was detected, with this
genome sequence region containing the following two predicted
genes:
[0544] ST454contig00831_AUGUSTUS_gene.sub.--3318:6018 (847
letters)
1) ref |XP.sub.--386347.1| hypothetical protein FG06171.1
[Gibberella 660.times.0.0 gb|EAW12630.1| DUF500 domain protein
[Aspergillus NRRL 1]; 253.times.9e-66, and
ST454contig00831_AUGUSTUS_gene.sub.--3958:4728 (183 letters); and
2) gb|EAW13545.1| 2,3-cyclic-nucleotide 2-phosphodiesterase
[Aspergillus 32.times.2.4 X-Ray Irradiated N. lolii Variant Mutant
Strain 747:
[0545] For the X-ray irradiated N. lolii variant mutant strain
7.sub.--47 the following deleted sequences in ST454Contig01082,
ST454Contig01131 and ST454Contig02985, with these genome sequence
regions containing no predicted genes:
Query=ST454contig01082 length=9120 numreads=287 gb|AAA21442.1|
putative pol polyprotein [Magnaporthe grisea] 145 1e-32
Query=ST454contig02985 length=2414 numreads=99 gb|AAA21442.1|
putative pol polyprotein [Magnaporthe grisea] 92 2e-17
EXAMPLE 33
Mutagenesis Index of X-Ray Irradiated N. lolii Variant Deletion
Mutant Strains
[0546] FIG. 95 shows SNPs and Indels per Mb in genic regions of
X-ray irradiated N. lolii variant deletion mutant strains derived
from X-ray irradiation of N. lolii at different levels of
irradiation. Strain 1.sub.--35 has a 3.6 kb deletion; Strain
7.sub.--47 has 3 deletions (4.2 kb, 1 kb, 0.6 kb in length). Strain
124.sub.--6 has a partial duplication. Strains 139.sub.--6 and
145.sub.--15 have partial duplications.
[0547] Given that ST endophyte has approximately 443.5 genes per
Mb, using 10Gy*2 treatment, the expected rate of SNP/INDEL
occurrence is 0.33 per gene in the genome.
Summary
[0548] X-ray irradiated N. lolii variant deletion mutant strains
were analysed for many types of genome sequence variation i.e.
deletions, SNPs, INDELs, inversions and translocations. SNPs,
INDELs, deletions and duplications were identified in the genome
survey sequences of X-ray irradiated N. lolii variant deletion
mutant strains. There was an apparent peak in number of SNPs and
INDELs in X-ray irradiated N. lolii variant deletion mutant strains
recovered from administering 10Gy*2 X-ray irradiation treatment to
N. lolii ST endophyte. The X-ray irradiated N. lolii variant
deletion mutant strain 7.sub.--47 had 3 large deletions. It was
demonstrated that this mutagenesis method based on X-ray
irradiation can be used to create novel designer Neotyphodium
endophyte strains, and enabled: [0549] 5,000 X-ray irradiated N.
lolii variant endophyte strains derived from X-ray irradiation of
ST N. lolii endophyte were screened; [0550] 140 putative X-ray
irradiated N. lolii variant endophyte mutant strains were
identified; [0551] 9 X-ray irradiated N. lolii variant endophyte
mutant strains were subjected to antifungal bioassays; [0552] 9
X-ray X-ray irradiated N. lolii variant endophyte mutant strains
were subjected to in vitro growth assays; [0553] 9 X-ray irradiated
N. lolii variant endophyte mutant strains were subjected to genome
survey sequencing; [0554] 2 X-ray irradiated N. lolii variant
endophyte mutant strains with gene deletions (1.sub.--35 and
7.sub.--47) were identified; and [0555] 3 X-ray irradiated N. lolii
variant endophyte mutant strains with gene duplications
(124.sub.--6, 139.sub.--6 and 145.sub.--15) were identified.
EXAMPLE 34
In Planta Isogenic Inoculation in Perennial Ryegrass with X-Ray
Irradiated N. lolii Variant Endophyte Mutant Strains
TABLE-US-00049 [0556] TABLE 47 Isogenic inoculation of perennial
ryegrass genotypes (IMP04 and TOL03) with X-ray irradiated N. lolii
variant endophyte mutant strains. Numbers indicate number of
perennial ryegrass plants of the two genotypes subjected to
isogenic inoculation with the different X-ray irradiated N. lolii
variant endophyte mutant strains (i.e. ST-IRM 139-6, ST-IRM 145-15,
ST-IRM 144-16, ST-IRM 1-35 and ST- IRM 7-47) and control ST
endophyte strain. ST-IRM ST-IRM ST-IRM ST-IRM ST-IRM Plant Genotype
139-6 145-15 144-16 1-35 7-47 ST IMP04 30 25 30 30 30 25 TOL03 25 0
25 30 30 20
EXAMPLE 35
Metabolic Profiling of Colchicine Treatment-Derived NEA12dh and
X-Ray Irradiation-Derived Neotyphodium Variant Endophyte
Strains
[0557] Results from metabolic profiling of colchicine treatment
derived NEA12dh endophyte variant strains is shown in FIG. 96.
[0558] Results from metabolic profiling of X-ray irradiation
treatment derived N. lolii ST endophyte variant strains is shown in
FIG. 97.
[0559] The following endophytes were grown on PDB for 3 weeks:
[0560] Control N. lolii ST endophyte strain [0561] X-ray
irradiation treatment derived N. lolii ST endophyte variant strain
4-7 [0562] X-ray irradiation treatment derived N. lolii ST
endophyte variant strain 139-6 [0563] X-ray irradiation treatment
derived N. lolii ST endophyte variant strain 144-16 [0564] X-ray
irradiation treatment derived N. lolii ST endophyte variant strain
145-15 and subjected to metabolic profiling using LCMS on
corresponding [0565] 1. Liquid filtrate [0566] 2. Mycelial
extract
[0567] The X-ray irradiation treatment derived N. lolii ST
endophyte variant strains could be readily distinguished from
control N. lolii ST strain using mycelia extracts or filtrates
alone.
[0568] It will be understood that the invention disclosed and
defined in this specification extends to all alternative
combinations of two or more of the individual features mentioned or
evident from the text or drawings. All of these different
combinations constitute various alternative aspects of the
invention.
REFERENCES
[0569] Bouton, J. H., G. C. M. Latch, N. S. Hill, C. S. Hoveland,
M. A. McCann, R. H. Watson, J. A. Parish, L. L. Hawkins and F. N.
Thompson (2002) Agronomy Journal 94(3): 567 574. [0570] Latch, G.
C. M, Christensen, M. J, Tapper, B. A, Easton, H. S, Hume, D. E,
Fletcher, L. R. (2000) U.S. Pat. No. 6,111,170 and references
therein. [0571] Li, X and Zhang, Y., (2002) Comparative and
Functional Genomics 3: 158-160. [0572] Tapper, B. A, Cooper, B. M,
Easton, H. S, Fletcher, L. R, Hume, D. E, Lane, G. A, Latch, G. C.
M, Pennell, C. G. L, Popay, A. J, Christensen, M. J. (2004)
International Patent Application No. WO 2004/106487 and references
therein. [0573] Van Zijll de Jong E, Guthridge K M, Spangenberg G
C, Forster J W (2003) Genome 46 (2): 277-290 [0574] Young, C. A.,
Bryant, M. K., Christensen, M. J., Tapper, B. A., Bryan, G. T.,
Scott, B. (2005) Molecular Genetics and Genomics, 274: 13-39.
Sequence CWU 1
1
851124DNAEpichloe festucae E2368 1gcaggggaat gaggcgttcg gctgtgatga
cggtggctgt tgaaaccgcc gcatgtttgc 60tactgcgtac gtacttttgg tgtttctcca
acatagtaac tgtttcaata ttagaatgga 120tgta 1242104DNAEndophyte E1
2tgtgatgacg gtggctgttg aatccgccgc atgtttgcta ctgcgtacgt acttttggtg
60tttctccaac atagtaactg tttcaatatt agaatggata tgta
104363DNAEndophyte NEA12 3gcagggggaa tgaggcgttc ggctgtgatg
atggtggctg ttgaaaccgc cgcatgtttg 60cta 63462DNANeotyphodium lolii
4gcaggggaat gaggcgttcg gctgtgatga cggtggctgt tgaaaccgcc gcatgtttgc
60ta 625125DNAEpichloe festucae E2368 5gccatgaaag catttaatgg
tcgcttagct ttttcgcaaa tctgaacttt tgatttcaga 60tgagagttca ttgtcgtttg
gttgaatgtc ggcgtcatag tgggctgaaa tgtagtgtcg 120aaata
1256125DNAEndophyte E1 6gccatgaaag catttaatgg tcgcttagct ttttgcgaag
tctgaacttt tgatttcaga 60tgagagttca ttgtcgtttg gttgaatgtc ggcgtcatag
tgggctgaaa tgtagtgtcg 120aaata 1257106DNAEndophyte NEA12
7ttatggccaa taccgatttg ctgtgcaaga ctctcacgca aatttggagg ctggtctcaa
60atattttaaa tgttcaaatt gatgtttcag ctatgtagcg taaact
1068105DNANeotyphodium lolii 8tatggccaat accgatttgc tgtgcaagac
tctcacgcaa atttggaggc tggtctcaaa 60tattttaaat gttcaaattg atgtttcagc
tatgtagcgt aaact 1059125DNAEpichloe festucae E2368 9gcggagaaaa
ccaaataggt cccgaatacc agagcaacta tggctcctga ctcgaagttg 60atgaattgga
gggcgaaact cacagggttt cagttgctgc atgtctctga attagattct 120ctatt
12510125DNAEndophyte E1 10gcggagaaaa ccaaataggt cccgaatacc
agagcaacta tggctcctga ctcgaagttg 60atgaattgga gggcgaaact cacagggttt
cagttgctgc atgtctctga attagattct 120ctatt 1251130DNAEndophyte NEA12
11gagaattttc tttcaattgt acaaagcgcg 3012125DNANeotyphodium lolii
12gagaattttc tttcaattgt acaaagcgcg gaaacgtagc gacgaccgcc gcggggatca
60atggagttat gggcgcatta cataggctct cacaagttgc atgtctctga attagattct
120ctatt 12513539DNAEpichloe festucae 13accagacgat acaatctcga
tagtaaccgc ctgccccata gcgggattga ttacacccag 60gcagctcatg acagtggtat
caatctccaa tataagaccc tacgaacgga ctctgatata 120acgccatcgt
ccccgactca tgatgcccat gtgaaacctt taccagttgc caacgccgtg
180tcctcgttag aggtcctgaa caatctgtgt gaacagagta gttggaaatg
ggtggaaggt 240atgttaattg gaggctgtct tcaatacggc ctagagcgat
acgatgatgc gttcaagtcc 300ttctcaagga ttgtcgcagt tgattccagg
taagttgctc gccacaatac cctcactcct 360ctgcttgatc tcacaatcac
cggcttccca gccatgttga agctatcagt catatgggcg 420cagccttgta
ttgcctcgga cgtcaagatg aagcagagaa aattggctcc gggtgataaa
480gctacgacca aattatctcg atgccacgga acacttggtg ggccatcttt ataaaaatc
53914540DNAEndophyte NEA11 14accagacgat acaatctcga tagtaaccgc
ctgccccata gcgggattga ttacacccag 60gcagctcatg acagtggtat caatctccaa
tataagaccc tacgaacgga ctctgatata 120acgccatcgt ccccgactca
tgatgcccat gtgaaacctt taccagttgc caacgccgtg 180tcctcgttag
aggtcctgaa caatctgtgt gaacagagta gttggaaatg ggtggaaggt
240atgttaattg gaggctgtct tcaatacggc ctagagcgat acgatgatgc
gttcaagtcc 300ttctcaagga ttgtcgcagt tgattccagg taagttgctc
gccacaatac cctcactcct 360ctgcttgatc tcacaatcac cggcttccca
gccatgttga agctatcagt catatgggcg 420cagccttgta ttgcctcgga
cgtcaagatg aagcagagaa aaaattggct ccgggtgata 480aagctacgac
caaattatct cgatgccacg gaacacttgg tgggccatct ttataaaaat
54015473DNAEndophyte NEA11 15atagcggaat tgattacagc caggcagttc
attacagtgg tatcaatctc caatataaga 60ccacacgaac ggactctgat gtaacgccat
cgtccccgac tcatgatgcc catgtgaagc 120ctttacccgt cgccaacgcc
gtgtcttcgc tagaggtcct gaacaacctg tgtgaacaga 180gtggttggaa
atgggtggaa ggtatgttag ttggaggctg tcttcagtac ggtctagagc
240agtacgaaga tgcgttcaag tccttctcaa ggattgtcgc agttgattca
aggtaagctg 300cccgccacaa tactcccatt ccgttgcttg atctcacgat
ccctggcttc ctagccatgt 360tgaagctatc agtcatatgg gcgcagcctt
gtattgcctc ggacgccaag acgaagcaga 420gcaaaattgg ctccgggtgg
taaagctacg accaaactat ctcgatgcca cgg 47316300DNANeotyphodium lolii
16gcgcgtcacg atttcccatt taacaccctc agtcacgcgg ctgatagacc cagattcaca
60accttttcta aagacgatgg tgtttaccgg cgagcctctg tctgtggacg atgctacccg
120atggtgggga aaggtcgacg tcgtcaacga atatgggcct gacgagtgca
ccatcaacac 180tgtcaacagc cgacctatca gtcctgaagc tgctacgaac
atagggctgc cggttggagt 240ggccgcttgg attaccgacc cggaaaacca
tcaagtactc gttccgatcg gctgtgttgg 30017266DNAEndophyte NEA11
17gcgcgtcacg attgcccatt taacaccctc agtcacgcga ctgatagacc cagattcaca
60acccgtcctc aagacgatgg tgtttaccgg cgagcctctg tctgtggacg atgctacccg
120atggtgggga aaggtcgacg tcgtcaacga atatgggctg cagagtgcac
catcaacact 180gtcaacagcc gacctatcag tcctgaagcc gctgcgaaca
tagggctgcc ggttggagtg 240gccgcttgga ttacagaccc ggaaaa
26618255DNAEndophyte NEA11 18gcgcgtcacg attgcccatt taacaccctc
agtcacgcga ctgatagacc cagattcaca 60acccgtcctc aagacgatgg tgtttaccgg
cgagcctctg tctgtggacg atgctacccg 120atggtgggga aagttcgacg
tcgtcaacga atatgggcct gcagagtgca ccatcaacac 180tgtcaacagc
cgacctatca gtcctgaagc cgctgcgaac atagggctgc cggttggagt
240ggccgcttgg attac 2551953DNAEndophyte NEA11 19gcgcgtcacg
attgcccatt taacaccctc agtcacgcga ctgatagacc cag 532085DNAEndophyte
NEA11 20gcgcgtcacg attgcccatt taacaccctc agtcacgcga ctgatagacc
cagattcaca 60acccgtcctc aagacgatgg tgttt 852144DNAEndophyte NEA11
21gacccggaaa atgatcaagt actcgttcca atcggctgtg ttgg
4422107DNANeotyphodium lolii 22gtacggtgtc cttatcttct ttgccattat
ttgcggaagc gtcgcgggca cattttggac 60caccattgga ccagtgacgg cggaagtcgt
gggcctcaga aatgtac 10723107DNANeotyphodium lolii 23gtacggtgtc
cttatcttct ttgccattat ttgcggaagc gtcgcgggca cattctggac 60caccattgga
ccagtgacgg cggaagtcgt gggcctcaga aatgtac 10724104DNANeotyphodium
lolii 24gtacggtgtc cttatcttct ttgccattat ttgcggaagc gtcgcgggca
cattctggac 60caccattgga ccagtgacgg cggaagtggg cctcagaaat gtac
10425103DNANeotyphodium lolii 25gtacggtgtc cttatcttct ttgccattat
ttgcggaagc gtcgcgggca cattctggac 60caccattgga ccagtgacgg cgtcgtgggc
ctcagaaatg tac 10326101DNANeotyphodium lolii 26ttacggtgtc
cttatcttct ttgccattat ttgcggaagc gtcgcgggca cattctggac 60ctccattgga
ccagtggaag tcgtgggcct cagaaatgta c 1012799DNANeotyphodium lolii
27gtacggtgtc cttatcttct ttgccattat ttgcggaagc gtcgcgggca cattctggac
60caccattgga ccagtgacgc gtgggcctca gaaatgtac 9928104DNANeotyphodium
lolii 28gtacggtgtc cttatcttct ttgccattat ttgcggaagc gtcgcgggca
cattctggac 60caccattgga ccagtgacgg cggaagtcgg cctcagaaat gtac
10429100DNANeotyphodium lolii 29gtacggtgac cttatcttct ttgccattat
ttgcggaagc gtcgcgggca cattctggac 60caccattgga ccagtgacgg cggaagtcgt
gggcctcagc 10030104DNANeotyphodium lolii 30gtacggtgtc cttatcttct
ttgccattat ttgcggaagc gtcgcgggca cattctggac 60caccattgga ccagtgacgg
cggaagtcgt gggcctaaat gtac 10431101DNANeotyphodium lolii
31tacggtgtcc ttatcttctt tgccattatt tgcggaagcg tcgcgggcac attctggacc
60accattggac cagtgacggc ggaagtcgtg ggcctcagaa a
10132101DNANeotyphodium lolii 32ggtgtcctta tcttctttgc cattatttgc
ggaagcgtcg cgggcacatt ctggaccacc 60atttgaccag tgacggcgga agtcgtgggc
ctcagaaatg t 10133101DNANeotyphodium lolii 33tgtccttatc ttctttgcca
ttatttgcgg aagcgtcgcg ggcacattct ggaccaccat 60tggaccagtg acggcggaag
tcgtgggcct cagaaatgta c 10134102DNANeotyphodium lolii 34gtgtccttat
cttctttgcc attatttgcg gaagcgtcgc gggcacattc tggaccacca 60ttggaccagt
gacggcggaa gtcgtgggcc tcagaaatgt ac 1023596DNANeotyphodium lolii
35ttatcttctt tgccattatt tgcggaagcg tcgcgggcac attctggacc accattggac
60cagtgacggc ggaagtcgtg ggcctcagaa atgtac 963695DNANeotyphodium
lolii 36tatcttcttt gccattattt gcggaagcgt cgcgggcaca ttctggacca
ccattggacc 60agtgacggcg gaagtcgtgg gcctcagaaa tgtac
953797DNANeotyphodium lolii 37gtactcttct ttgccattat ttgcggaagc
ggcgcgggca cattctggac caccattgga 60ccagtgacgg cggaagtcgt gggcctcaga
aatgtac 9738100DNANeotyphodium lolii 38gtacggttct tctttgccat
tatttgcgga agcgtcgcgg gcacattctg gaccaccatt 60ggaccagtga cggcggaagt
cgtgggcctc agaaatgtac 1003997DNANeotyphodium lolii 39gtacgcttct
ttgccattat ttgcggaagc gtcgcgggca cattctggac caccattgga 60ccagtgacgg
cggaagtcgt gggcctcaga aatgtac 974089DNANeotyphodium lolii
40ctttgccatt atttgcggaa gcgtcgcggg cacattctgg accaccattg gaccagtgac
60ggcggaagtc gtgggcctca gaaatgtac 894195DNANeotyphodium lolii
41gtacggtgtc gccattattt gcggaagcgt cgcgggcaca ttctggacca ccattggacc
60agtgacggcg gaagtcgtgg gcctcagaaa tgtac 954294DNANeotyphodium
lolii 42gtacggtgtc ccattatttg cggaagcgtc gcgggcacat tctggaccac
cattggacca 60gtgacggcgg aagtcgtggg ccccagaaat gtac
944384DNANeotyphodium lolii 43ccattatttg cggaagcgtc gcgggcacat
tctggaccac cattggacca gtgacggcgg 60aagtcgtggg cctcagaaat gtac
844498DNANeotyphodium lolii 44gtacggtgtc cttatcatta tttgcggaag
cgtcgcgggc acattctgga ccaccattgg 60accagtgacg gcggaagtcg tgggcctcag
aaatgtac 9845102DNANeotyphodium lolii 45gtacggtgtc cttatcttct
attatttgcg gaagcgtcgc gggcacattc tggaccacca 60ttggaccagt gacggcggaa
gtcgtgggcc tcagaaatgt ac 1024693DNANeotyphodium lolii 46gtacggtgtc
cttatcttct ttcattattt gcggaagcgt cgcgggcaca ttctggacca 60ccattggacc
agtgacgggc ctcagaaatg tac 9347103DNANeotyphodium lolii 47gtacggtgtc
cttatcttct ttgcatttgc ggaagcgtcg cgggcacatt ctggaccacc 60attggaccag
tgacggcgga agtcgtgggc ctcagaaatg tac 10348157DNANeotyphodium lolii
48tgccgccgaa attgttatcc cagttgccca cttgactcca cgaccagatt tccaaacaag
60catctctccc aacaaaaaaa agagcaaaaa acagttcgcg cgacgacaac aaactagctc
120ggaaaccccc ggcatgccgc atacataatg gccgaag 15749156DNANeotyphodium
lolii 49tgccgccgaa attgttatcc cagttgccca cttgactcca cgaccagatt
tccaaacaag 60catctctccc aacaaaaaaa agagcaaaaa acagttcgcg cgacgacaac
aaactagctc 120ggaaaccccg gcatgccgca tacataatgg ccgaag
15650150DNANeotyphodium lolii 50tgccgccgaa cttgttatcc cagttgcccc
acttgactcc acgaccagat ttccaaacaa 60gcatctctcc caacaaaaaa aagagcaaaa
aacagttgac aacaaactag ctcggaaacc 120cccggcatgc cgcatacata
atggccgaag 15051153DNANeotyphodium lolii 51cgccgaaatt gttatcccag
ttgccccact tgactccacg accagatttc caaacaagca 60tctctcccaa caaaaaaaag
agcaaaaaac agttcgcgcg acgaacaaac tagctcggaa 120acccccggca
tgccgcatac ataatggccg aag 15352153DNANeotyphodium lolii
52tggccgaaat tgttatccca gttgccccac ttgactccac gaccagattt ccaaacaagc
60atctctccca acaaaaaaaa gagcaaaaaa cagttcgcgc gacaacaaac tagctcggaa
120acccccggca tgccgcatac ataatggccg aag 15353151DNANeotyphodium
lolii 53tcgaaattgt tatcccagtt gccccacttg actccacgac cagatttcca
aacaagcatc 60tctcccaaca aaaaaaagag caaaaaacag ttcgcgcgac gacaaaacta
gctcggaaac 120ccccggcatg ccgcatacat aatggccgaa g
15154138DNANeotyphodium lolii 54tgccggaaat tgttatccca gttgccccac
ttgactccac gaccagattt ccaaacaagc 60atctctccca acaaaaaaaa gagcaaaaaa
cagttcgcgc gacgacaacc cggcatgccg 120catacataat ggccgaag
13855150DNANeotyphodium lolii 55taaattgtta tcccagttgc cccacttgac
tccacgacca gatttccaaa caagcatctc 60tcccaacaaa aaaagagcaa aaaacagttc
gcgcgacgac aacaaactag ctcggaaacc 120cccggcatgc cgcatacata
atggccgaag 15056142DNANeotyphodium lolii 56tgccgccgaa atttatccca
gttgccccac ttgactccac gaccagattt ccaaacaagc 60atctctccca acaaaaaaaa
gagcaaaaaa cagttcgcgc gacgacaaca aacccggcat 120gccgcataca
taatggccga ag 14257149DNANeotyphodium lolii 57tgccgccgaa attgttatcc
cagttcccac tgggctccac gaccagattt ccaaacaagc 60atctctccca acaaaaaaaa
gagcaaaaaa cagttcgcgc gacgacaaca aactagctcg 120gcggcatgcc
gcatacataa tggccgaag 14958150DNANeotyphodium lolii 58tgccgccgaa
attgttatcc cagttgctga ctccacgacc agatttccaa acaagcatct 60ctcccaacaa
aaaaaagagc aaaaaacagt tcgcgcgacg acaacaaact agctcggaaa
120cccggcatgc cgcatacata atggccgaag 15059148DNANeotyphodium lolii
59tgccgccgaa attgttatcc cagttgcgac tccacgacca gatttccaaa caagcatctc
60tcccaacaaa aaaaagagca aaaaacagtt cgcgcgacga caacaaacta gctcggaaac
120ccccatgccg catacataat ggccgaag 14860131DNANeotyphodium lolii
60ttatcccagt tgccccactt gactccacga ccagatttcc aaacaagcat ctctcccaac
60aaaaaaaaga gcaaaaaaca gttcgcgcga cgacaacaaa ctacggcatg ccgcatacat
120aatggccgaa g 13161157DNANeotyphodium lolii 61tgccgcctaa
attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa 60gcatctctcc
caacaaaaaa agagcaaaaa acagttcgcg cgacgacaac aaactagctc
120ggaaaccccc ggcatgccgc atacataatg gccgaag 15762153DNANeotyphodium
lolii 62tgccgccgaa attgttatcc cagttgcccc actactccac gaccagattt
ccaaacaagc 60atctctccca acaaaaaaaa gagcaaaaaa cagttcgcgc gacgacaaca
aactagctcg 120gaaacccccg gcatgcatac ataatggccg aag
15363150DNANeotyphodium lolii 63tgccgccgaa attgttatcc cagttgcccc
acttgactga ccagatttcc aaacaagcat 60ctctcccaac aaaaaaaaga gcaaaaaaca
gttcgcgcga cgacaacaaa ctagctcgga 120aacccccggc atgccgcata
catgccgaag 15064146DNANeotyphodium lolii 64tgccgccgaa attgttatcc
cagttgcccc acttgaccag atttccaaac aagcatctct 60cccaacaaaa aaaagagcaa
aaaacagttc gcgcgacgac aacaaactag ctcggaaacc 120cccggcatgc
cgcatacata ccgaag 14665143DNANeotyphodium lolii 65tgccgccgaa
attgttatcc cagtttccac gaccagattt ccaaacaagc atctctccca 60acaaaaaaaa
gagcaaaaaa cagttcgcgc gacgacaaca aactagctcg gaaacccccg
120gcatgccgcc ataatggccg aag 14366151DNANeotyphodium lolii
66tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat caaacaagca
60tctctcccaa caaaaaaaag agcaaaaaac agttcgcgcg acgacaacaa actagctcgg
120aaacccccgg catgccgcat acataacgaa g 15167137DNANeotyphodium lolii
67tgccgccgaa attgttatcc cagttgcccc actccagatt tccaaacaag catctctccc
60aacaaaaaaa agagcaaaaa acagttcgcg cgacgacaac aaactagctc ggaaaccccc
120ggcatgccgc atacatg 13768154DNANeotyphodium lolii 68tgccgccgaa
attgttatcc cagttgcccc acttgactcc acgaccagat taacaagcat 60ctctcccaac
aaaaaaaaga gcaaaaaaca gttcgcgcga cgacaacaaa ctagctcgga
120aacccccggc atgccgcata cataatggcc gaag 15469155DNANeotyphodium
lolii 69tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat
ttccaaaaag 60catctctccc aacaaaaaaa agagcaaaaa acagttcgcg cgacgacaac
aaactagctc 120ggaaaccccc ggcatgccgc atacataatg gccga
15570153DNANeotyphodium lolii 70tgccgccgaa attgttatcc cagttgcccc
acttgactcc acgaccagat tacaagcatc 60tctcccaaca aaaaaaagag caaaaaacag
ttcgcgcgac gacaacaaac tagctcggaa 120acccccggca tgccgcatac
ataatggccg aag 15371157DNANeotyphodium lolii 71tgccgccgaa
attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa 60gctctctccc
aacaaaaaaa agagcaaaaa acagttcgcg cgacgacaac aaactagctc
120ggaaaccccc ggcatgccgc atacataatg gccgaag 15772152DNANeotyphodium
lolii 72tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat
ttccaaacaa 60gcatctccca acaaaaaaaa gagcaaaaaa cagttcgcgc gacgacaaca
aactagctgg 120gaaacggcat gccgcataca taatggccga ag
15273157DNANeotyphodium lolii 73tgccgccgaa attgttatcc cagttgcccc
acttgactcc acgaccagat ttccaaacaa 60gcatctcccc aacaaaaaaa agagcaaaaa
acagttcgcg cgacgacaac aaactagctc 120ggaaaccccc ggcatgccgc
atacataatg gccgaag 15774157DNANeotyphodium lolii 74tgccgccgaa
attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa 60gcatctctcc
aacaaaaaaa agagcaaaaa acagttcgcg cgacgacaac aaactagctc
120ggaaaccccc ggcatgccgc atacataatg gccgaag 15775154DNANeotyphodium
lolii 75tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat
ttccaaacaa 60gcatctctcc caaaaaaaga gcaaaaaaca gttcgcgcga cgacaacaaa
ctagctcgga 120aacccccggc atgccgcata cataatggcc gaag
15476158DNANeotyphodium lolii 76tgccgccgaa attgttatcc cagttgcccc
acttgactcc acgaccagat ttccaaacaa 60gcatctctcc caacaaaaaa aagagcaaaa
aacagttcgc gcgacgacaa caaactagct 120cggaaacccc cggcatgccg
catacataat ggccgaag 15877151DNANeotyphodium lolii 77tgccgccgaa
attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa 60gcatctctcc
caaaaaaaga gcaaaaaaca
gttcgcgcta cgacaacaaa ctagctcgga 120aacccccggc atgccgcata
cataatggcc g 15178156DNANeotyphodium lolii 78tgccgccgaa attgttatcc
cagttgcccc acttgactcc acgaccagat ttccaaacaa 60gcatctctcc caacaaaaaa
gagcaaaaaa cagttcgcgc gacgacaaca aactagctcg 120gaaacccccg
gcatgccgca tacataatgg ccgaag 15679157DNANeotyphodium lolii
79tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa
60gcatctctcc caacaaaaaa agagcaaaaa acagttcgcg cgacgacaac aaactagctc
120ggaaaccccc ggcatgccgc atacataatg gccgaag 15780148DNANeotyphodium
lolii 80tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat
ttccaaacaa 60gcatctctcc caacaaaaaa aacagttcgc gcgacgacaa caaactagct
cggaaacccc 120cggcatgccg catacataat ggccgaag
14881154DNANeotyphodium lolii 81tgccgccgaa attgttatcc cagttgcccc
acttgactcc acgaccagat ttccaaacaa 60gcatctctcc caacaaaaaa aagagcaaaa
gttcgcgcga cgacaacaaa ctagctcgga 120aacccccggc atgccgcata
cataatggcc gaag 15482153DNANeotyphodium lolii 82tgccgccgaa
attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa 60gcatctctcc
caacaaaaaa aagagcaaaa atcgcgcgac gacaacaaac tagctcggaa
120acccccggca tgccgcatac ataatggccg aag 15383138DNANeotyphodium
lolii 83tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat
ttccaaacaa 60gcatctctcc caacaaaaaa aagagcaaaa aaaactagct cggaaacccc
cggcatgccg 120catacataat ggccgaag 13884120DNANeotyphodium lolii
84tgccgccgaa attgttatcc cagttgcccc acttgactcc acgaccagat ttccaaacaa
60gcatctctcc caacaaaaaa aagagcaaaa aacagcatgc cgcatacata atggccgaag
12085117DNANeotyphodium lolii 85tgccgccgaa attgttatcc cagttgcccc
acttgactcc acgaccagat ttccaaacaa 60gcatctctcc caacaaaaaa aagagcaaaa
aacagttcgc atacataatg gccgaag 117
* * * * *
References