U.S. patent application number 13/655054 was filed with the patent office on 2013-04-25 for genes encoding key catalyzing mechanisms for ethanol production from syngas fermentation.
The applicant listed for this patent is Rathin Datta, Andrew Reeves. Invention is credited to Rathin Datta, Andrew Reeves.
Application Number | 20130102044 13/655054 |
Document ID | / |
Family ID | 45098350 |
Filed Date | 2013-04-25 |
United States Patent
Application |
20130102044 |
Kind Code |
A1 |
Reeves; Andrew ; et
al. |
April 25, 2013 |
Genes Encoding Key Catalyzing Mechanisms for Ethanol Production
from Syngas Fermentation
Abstract
Gene sequences of key acetogenic clostridial species were
sequenced and isolated. Genes of interest were identified, and
functionality was established. Key genes of interest for metabolic
catalyzing activity in clostridial species include a three-gene
operon coding for CODH activity, a two-gene operon coding for
PTA-ACK, and a novel acetyl coenzyme A reductase. The promoter
regions of the two operons and the acetyl coA reductase are
manipulated to increase ethanol production.
Inventors: |
Reeves; Andrew; (Chicago,
IL) ; Datta; Rathin; (Chicago, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Reeves; Andrew
Datta; Rathin |
Chicago
Chicago |
IL
IL |
US
US |
|
|
Family ID: |
45098350 |
Appl. No.: |
13/655054 |
Filed: |
October 18, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12802560 |
Jun 9, 2010 |
|
|
|
13655054 |
|
|
|
|
12336278 |
Dec 16, 2008 |
8039239 |
|
|
12802560 |
|
|
|
|
Current U.S.
Class: |
435/161 ;
435/252.3; 435/320.1; 435/471; 536/23.2; 536/24.5 |
Current CPC
Class: |
Y02E 50/10 20130101;
C12P 7/065 20130101; Y02E 50/17 20130101; C12N 15/74 20130101; C12N
15/52 20130101 |
Class at
Publication: |
435/161 ;
435/320.1; 435/252.3; 435/471; 536/23.2; 536/24.5 |
International
Class: |
C12N 15/74 20060101
C12N015/74 |
Claims
1-21. (canceled)
22. An isolated polynucleotide comprising a nucleotide sequence
encoding a polypeptide encoding an acetyl coenzyme A reductase and
a promoter, said sequence being at least 98% identical to SEQ ID
NO. 3.
23. A vector comprising the polynucleotide of claim 22.
24. An isolated transformant carrying the polynucleotide of claim
22.
25. An isolated transformant carrying the vector of claim 23.
26. An antisense nucleic acid to the nucleotide sequence encoding
the polynucleotide of claim 22, said antisense nucleic acid
inhibiting the expression of the acetyl coenzyme A reductase.
27. A method of producing ethanol comprising: isolating and
purifying anaerobic, ethanologenic microorganisms carrying the
vector of claim 23; fermenting syngas with said microorganisms in a
fermentation bioreactor; providing sufficient growth conditions to
facilitate the production of ethanol from acetyl CoA via the acetyl
coenzyme A reductase of claim 22.
28. A method of increasing ethanologenesis in a microorganism
containing the nucleotide sequence encoding the polynucleotide of
claim 22, said method comprising: modifying or duplicating a
promoter region of said nucleotide sequence to increase the
activity of the Acetyl Coenzyme A reductase of claim 22 or to cause
overexpression of the nucleotide sequence.
Description
RELATED U.S. APPLICATION DATA
[0001] This application is a divisional of U.S. patent application
Ser. No. 12/802,560 filed Jun. 9, 2010 which claims the benefit of
and priority to U.S. patent application Ser. No. 12/336,278 filed
Dec. 16, 2008 as a continuation-in-part application, the
disclosures of which are incorporated in their entirety.
FIELD OF THE INVENTION
[0002] This invention relates to the cloning and expression of
novel genetic sequences of microorganisms used in the biological
conversion of CO, H2, and mixtures comprising CO and/or H2 to
biofuel products.
BACKGROUND
[0003] Synthetic gas (syngas) is a mixture of carbon monoxide (CO)
gas, carbon dioxide (CO.sub.2) gas, and hydrogen (H.sub.2) gas, and
other volatile gases such as CH.sub.4, N.sub.2, NH.sub.3, H.sub.2S
and other trace gases. Syngas is produced by gasification of
various organic materials including biomass, organic waste, coal,
petroleum, plastics, or other carbon containing materials, or
reformed natural gas.
[0004] Acetogenic Clostridia microorganisms grown in an atmosphere
containing syngas are capable of absorbing the syngas components
CO, CO.sub.2, and H.sub.2 and producing aliphatic C.sub.2-C.sub.6
alcohols and aliphatic C.sub.2-C.sub.6 organic acids. These syngas
components activate Wood-Ljungdahl metabolic pathway 100, shown in
FIG. 1, which leads to the formation of acetyl coenzyme A 102, a
key intermediate in the pathway. The enzymes activating
Wood-Ljungdahl pathway 100 are carbon monoxide dehydrogenase (CODH)
104 and hydrogenase (H.sub.2ase) 106. These enzymes capture the
electrons from the CO and H.sub.2 in the syngas and transfer them
to ferredoxin 108, an iron-sulfur (FeS) electron carrier protein.
Ferredoxin 108 is the main electron carrier in Wood-Ljungdahl
pathway 100 in acetogenic Clostridia, primarily because the redox
potential during syngas fermentation is very low (usually between
-400 and -500 mV). Upon electron transfer, ferredoxin 108 changes
its electronic state from Fe.sup.3+ to Fe.sup.2+. Ferredoxin-bound
electrons are then transferred to cofactors NAD.sup.+ 110 and
NADP.sup.+ 112 through the activity of ferredoxin oxidoreductases
114 (FORs). The reduced nucleotide cofactors (NAD.sup.+ and
NADP.sup.+) are used for the generation of intermediate compounds
in Wood-Ljungdahl pathway 100 leading to acetyl-CoA 102
formation.
[0005] Acetyl-CoA 102 formation through Wood-Ljungdahl pathway 100
is shown in greater detail in FIG. 2. Either CO.sub.2 202 or CO 208
provide substrates for the pathway. The carbon from CO.sub.2 202 is
reduced to a methyl group through successive reductions first to
formate, by formate dehydrogenase (FDH) enzyme 204, and then is
further reduced to methyl tetrahydrofolate intermediate 206. The
carbon from CO 208 is reduced to carbonyl group 210 by carbon
monoxide dehydrogenase (CODH) 104 through a second branch of the
pathway. The two carbon moieties are then condensed to acetylCoA
102 through the action of acetyl-CoA synthase (ACS) 212, which is
part of a carbon monoxide dehydrogenase (CODH/ACS) complex.
Acetyl-CoA 102 is the central metabolite in the production of
C.sub.2-C.sub.6 alcohols and acids in acetogenic Clostridia.
[0006] Ethanol production from Acetyl CoA 102 is achieved via one
of two possible paths. Aldehyde dehydrogenase facilitates the
production of acetaldehyde, which is then reduced to ethanol by the
action of primary alcohol dehydrogenases. In the alternative, in
homoacetogenic microorganisms, an NADPH-dependent acetyl CoA
reductase ("AR") facilitates the production of ethanol directly
from acetyl CoA.
[0007] Wood-Ljungdahl pathway 100 is neutral with respect to ATP
production when acetate 214 is produced (FIG. 2). When ethanol 216
is produced, one ATP is consumed in a step involving the reduction
of methylene tetrahydrafolate to methyl tetrahydrofolate 206 by a
reductase, and the process is therefore net negative by one ATP.
The pathway is balanced when acetyl-PO.sub.4 218 is converted to
acetate 214.
[0008] Acetogenic Clostridia organisms generate cellular energy by
ion gradient-driven phosphorylation. When grown in a CO atmosphere,
a transmembrane electrical potential is generated and used to
synthesize ATP from ADP. Enzymes mediating the process include
hydrogenase, NADH dehydrogenases, carbon monoxide dehydrogenase,
and methylene tetrahydrofolate reductase. Membrane carriers that
have been shown to be likely involved in the ATP generation steps
include quinone, menaquinone, and cytochromes.
[0009] The acetogenic Clostridia produce a mixture of
C.sub.2-C.sub.6 alcohols and acids, such as ethanol, n-butanol,
hexanol, acetic acid, and butyric acid, that are of commercial
interest through Wood-Ljungdahl pathway 100. For example, acetate
and ethanol are produced by C. ragsdalei in variable proportions
depending in part on fermentation conditions. However, the cost of
producing the desired product, an alcohol such as ethanol, for
example, can be lowered significantly if the production is
maximized by reducing or eliminating production of the
corresponding acid, in this example acetate. It is therefore
desirable to metabolically engineer acetogenic Clostridia for
improved production of selected C.sub.2-C.sub.6 alcohols or acids
through Wood-Ljungdahl pathway 100 by modulating enzymatic
activities of key enzymes in the pathway.
SUMMARY OF THE INVENTION
[0010] One aspect of the present invention provides novel sequences
for three key operons which code for enzymes that catalyze the
syngas to ethanol metabolic process: one coding for a carbon
monoxide dehydrogenase, a membrane-associated electron transfer
protein, a ferredoxin oxidoreductase, and a promoter; a second
operon coding for an acetate kinase, phosphotransacetylase, and a
promoter, and a third operon coding for an acetyl CoA reductase and
a promoter.
[0011] Another aspect of the invention provides an isolated vector
or transformant containing the polynucleotide sequence coding for
the operons described above.
[0012] Another aspect of the invention provides a method of
producing ethanol comprising: isolating and purifying anaerobic,
ethanologenic microorganisms carrying the polynucleotides coding
for an operon comprising carbon monoxide dehydrogenase, a
membrane-associated electron transfer protein, a ferredoxin
oxidoreductase, and a promoter; an operon coding for an acetate
kinase, phosphotransacetylase, and a promoter, or an operon coding
for an acetyl CoA reductase and a promoter; fermenting syngas with
said microorganisms in a fermentation bioreactor; providing
sufficient growth conditions for cellular production of NADPH,
including but not limited to sufficient zinc, to facilitate ethanol
production from acetyl CoA.
[0013] Another aspect of the invention provides a method of
producing ethanol by isolating and purifying anaerobic,
ethanologenic microorganisms carrying the polynucleotide coding for
acetyl coenzyme A reductase; fermenting syngas with said
microorganisms in a fermentation bioreactor; and providing
sufficient growth conditions for cellular production of NADPH,
including but not limited to sufficient zinc, to facilitate ethanol
production from acetyl CoA.
[0014] Yet another aspect of the present invention provides a
method of increasing ethanologenesis or the ethanol to acetate
production ratio in a microorganism containing the nucleotide
sequence(s) coding for one of more of the operons described above,
said method comprising: modifying, duplicating, or downregulating a
promoter region of said nucleotide sequence to increase the
activity of the Acetyl Coenzyme A reductase of claim 16, or to
cause overexpression or underexpression of the nucleotide
sequence.
[0015] The present invention is illustrated by the accompanying
figures portraying various embodiments and the detailed description
given below. The figures should not be taken to limit the invention
to the specific embodiments, but are for explanation and
understanding. The detailed description and figures are merely
illustrative of the invention rather than limiting, the scope of
the invention being defined by the appended claims and equivalents
thereof. The drawings are not to scale. The foregoing aspects and
other attendant advantages of the present invention will become
more readily appreciated by the detailed description taken in
conjunction with the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a diagram illustrating the electron flow pathway
during syngas fermentation in acetogenic Clostridia including some
of the key enzymes involved in the process;
[0017] FIG. 2 is a diagram illustrating the Wood-Ljungdahl
(C.sub.1) pathway for acetylCoA production and the enzymatic
conversion of acetyl-CoA to acetate and ethanol;
[0018] FIG. 3 is a diagram illustrating a genetic map containing
the location of one of the carbon monoxide dehydrogenase (CODH)
operons which includes cooS, cooF and a ferredoxin oxidoreductase
(FOR), in accordance with the invention;
[0019] FIG. 4 is a diagram showing the amino acid alignment of the
gene for NADPH dependent secondary alcohol dehydrogenase in C.
ragsdalei [SEQ ID No. 4], C. ljungdahlii [SEQ ID No. 5] and
Thermoanaerobactor ethanolicus [SEQ ID No. 6], in accordance with
the invention;
[0020] FIG. 5 is a diagram illustrating the Wood-Ljungdahl pathway
for ethanol synthesis and showing a strategy for specifically
attenuating or eliminating acetate production in acetogenic
Clostridia by knocking out the genes encoding acetate kinase (ack)
and phosphotransacetylase (pta) or by modulating acetate production
by mutating or replacing the promoter driving phosphotransacetylase
and acetate kinase gene expression, in accordance with the
invention;
[0021] FIG. 6 is a diagram of the Wood-Ljungdahl pathway for
ethanol synthesis, and shows a strategy for specifically increasing
ethanol production in C. ragsdalei by overexpression of an acetyl
CoA reductase in a host knocked out for acetate kinase or
phosphotransacetylase activity, in accordance with the
invention;
[0022] FIG. 7 is a diagram of the Wood-Ljungdahl pathway for
ethanol synthesis, and showing a strategy for increasing ethanol
production in acetogenic Clostridia by aldehyde ferredoxin
oxidoreductase (AOR) in a host strain that is attenuated in its
ability to produce acetate and has increased NADPH-dependent
alcohol dehydrogenase activity, in accordance with the
invention;
[0023] FIG. 8 is a diagram of the butanol and butyrate biosynthesis
pathway in C. carboxidivorans and the corresponding genes
catalyzing the conversion of acetyl-CoA to butanol and butyrate
showing a strategy for increasing butanol production, in accordance
with the invention.
DETAILED DESCRIPTION
[0024] The present invention is directed to novel genetic sequences
coding for acetogenic Clostridia micro-organisms that produce
ethanol and acids from syngas comprising CO, CO2, H2, or mixtures
thereof.
[0025] Several species of acetogenic Clostridia that produce
C.sub.2-C.sub.6 alcohols and acids via the Wood-Ljungdahl pathway
have been characterized: C. ragsdalei, C. ljungdahlii, C.
carboxydivorans, and C. autoethanogenum. The genomes of three of
these microorganisms were sequenced in order to locate and modify
the portions of the genome that code for the enzymes of
interest.
[0026] The genes that code for enzymes in the Wood-Ljungdahl
metabolic pathway and ethanol synthesis identified in the C.
ragsdalei genome are presented in Table 1. The first column
identifies the pathway associated with each gene. The gene
identification numbers indicated in the second column correspond to
the numbers representing the enzymes involved in the metabolic
reactions in the Wood-Ljungdahl pathway shown in FIG. 1 and FIG.
2.
TABLE-US-00001 TABLE 1 Clostridium ragsdalei genes used in
metabolic engineering experiments. Gene EC Pathway ID Gene Name
number ORF ID Copy ID Description Wood- 1 Carbon Monoxide 1.2.2.4
RCCC00183 CODH_1 CO oxidation Ljungdahl 2 Dehydrogenase RCCC01175
CODH_2 CO oxidation 3 RCCC01176 CODH_3 CO oxidation 4 RCCC02026
CODH_4 CO oxidation 5 RCCC03874 CODH_5 CO oxidation 6 Carbon
Monoxide 1.2.99.2 RCCC03862 cooS/acsA bifunctional
Dehydrogenase/Acetyl- CODH/ACS CoA Synthase enzyme, carbon fixation
7 Formate Dehydrogenase 1.2.1.2 RCCC00874 FDH_1 Methyl branch 8
RCCC03324 FDH_2 carbon fixation 9 Formyltetrahydrofolate 6.3.4.3
RCCC03872 FTHFS Methyl branch Synthase carbon fixation 10
Methenyltetrahydrofolate 3.5.4.9 RCCC03870 MEC Methyl branch
cyclohydrolase carbon fixation 11 Methylenetetrahydrofolate 1.5.1.5
RCCC03870 MED Methyl branch dehydrogenase carbon fixation 12
Methylenetetrahydrofolate 1.5.1.20 RCCC03868 MER Methyl branch
reductase carbon fixation 13 Methyltransferase 2.1.1.13 RCCC03863
acsE Methyl branch carbon fixation 14 Corrinoid/Iron-sulfur
1.2.99.2 RCCC03864 acsC Part of protein CODH/ACS complex, Large
subunit 15 Corrinoid/Iron-sulfur 1.2.99.2 RCCC03865 acsD Part of
protein CODH/ACS complex, Small subunit Ethanol and 16 Acetate
Kinase 2.7.2.1 RCCC01717 ACK Acetate acetate production production
17 Phospho-transacetylase 2.3.1.8 RCCC01718 PTA Acetate production
18 Tungsten-containing 1.2.7.5 RCCC00020 AOR_1 Reduction of
aldehyde ferredoxin acetate to oxidoreductase acetaldehyde 19
1.2.7.5 RCCC00030 AOR_2 Reduction of acetate to acetaldehyde 20
1.2.7.5 RCCC01183 AOR_3 Reduction of acetate to Acetaldehyde 21
Acetyl-CoA Reductase 1.1.1.2 RCCC02715 ADH_1 zinc-containing,
NADPH- Dependent Acetyl-CoA reductase 22 Alcohol Dehydrogenase
1.1.1.1 RCCC01356 ADH_2 two pfam domain: FeAHD and ALDH, AdhE 23
1.1.1.1 RCCC01357 ADH_3 two pfam domain: FeADH and ALDH, AdhE 24
1.1.1.1 RCCC01358 ADH_4 two pfam domain: FeADH and ALDH, AdhE,
fragment (76aa) 25 1.1.1.1 RCCC03300 ADH_5 one pfam domain: FeADH
26 1.1.1.1 RCCC03712 ADH_6 one pfam domain: FeADH 27 1.1.1.1
RCCC04095 ADH_7 one pfam domain: FeADH 28 1.--.--.-- RCCC00004
ADH_8 short chain ADH, multiple copy 29 1.--.--.-- RCCC01567 ADH_9
Short chain ADH, multiple copy 30 1.--.--.-- RCCC02765 ADH_10 short
chain ADH, multiple copy 31 1.--.--.-- RCCC02240 ADH_11 short chain
ADH, multiple copy 32 Aldehyde Dehydrogenase 1.2.1.10 RCCC03290
ALDH_1 Acetylating 33 1.2.1.10 RCCC04101 ALDH_2 Acetylating 34
1.2.1.10 RCCC04114 ALDH_3 Acetylating Hydrogenase 35 Hydrogenase
1.12.7.2 RCCC00038 HYD_1 Fe only, H2 production 36 1.12.7.2
RCCC00882 HYD_2 Fe only, large subunit, H2 production 37 1.12.7.2
RCCC01252 HYD_3 Fe only, H2 production 38 1.12.7.2 RCCC01504 HYD_4
Fe only, H2 production 39 1.12.7.2 RCCC02997 HYD_5 Ni--Fe large
subunit, H2 oxidation Electron 40 Ferredoxin RCCC00086 carrier 41
RCCC00301 42 RCCC00336 43 RCCC01168 44 RCCC01415 45 RCCC01825 46
RCCC02435 47 RCCC02890 48 RCCC03063 49 RCCC03726 50 RCCC04003 51
RCCC04147 Electron 52 Pyridine nucleotide- RCCC02615 glutamate
transfer disulphide synthase small oxidoreductases chain, but no
large chain next to it 53 RCCC02028 next to cooF and cooS, probably
important for reduced pyridine cofactor generation 54 RCCC03071
NADH dehydrogenase, not part of an operon 55 Membrane-associated
RCCC02027 cooF Between gene electron transfer FeS number 4 and
protein, cooF gene number 53
[0027] Sequence analysis of the C. ljungdahlii genome was
conducted. Genes coding for enzymes in the Wood-Ljungdahl pathway,
ethanol and acetate production, and electron transfer have been
identified and located within the genome. The results are presented
in Table 2.
TABLE-US-00002 TABLE 2 Clostridium ljungdahlii genes used in
metabolic engineering experiments. Gene EC Pathway ID Gene Name
number ORF ID Copy ID Description Wood- 1 Carbon Monoxide 1.2.2.4
RCCD00983 CODH_1 CO oxidation Ljungdahl 2 Dehydrogenase RCCD00984
CODH_2 CO oxidation 3 RCCD01489 CODH_3 CO oxidation 4 RCCD04299
CODH_4 CO oxidation 5 Carbon Monoxide 1.2.99.2 RCCD00972 CODH_ACS
bifunctional Dehydrogenase/Acetyl- CODH/ACS CoA Synthase enzyme,
carbon fixation 6 Formate Dehydrogenase 1.2.1.2 RCCD01275 FDH_1
Methyl branch 7 RCCD01472 FDH_2 carbon fixation 8
Formyltetrahydrofolate 6.3.4.3 RCCD00982 FTHFS Methyl branch
Synthase carbon fixation 9 Methenyltetrahydrofolate 3.5.4.9
RCCD00980 MEC Methyl branch cyclohydrolase carbon fixation 10
Methylenetetrahydrofolate 1.5.1.5 RCCD00980 MED Methyl branch
dehydrogenase carbon fixation 11 Methylenetetrahydrofolate 1.5.1.20
RCCD00978 MER Methyl branch reductase carbon fixation 12
Methyltransferase 2.1.1.13 RCCD00973 MET Methyl branch carbon
fixation 13 Corrinoid/Iron-sulfur 1.2.99.2 RCCD00974 COPL Part of
protein CODH/ACS complex, Large subunit 14 Corrinoid/Iron-sulfur
1.2.99.2 RCCD00975 COPS Part of protein CODH/ACS complex, Small
subunit Ethanol and 15 Acetate Kinase 2.7.2.1 RCCD02720 ACK Acetate
acetate production production 16 Phospho-transacetylase 2.3.1.8
RCCD02719 PTA Acetate Production 17 Tungsten-containing 1.2.7.5
RCCD01679 AOR_1 Reduction of aldehyde ferredoxin acetate to
oxidoreductase acetaldehyde 18 1.2.7.5 RCCD01692 AOR_2 Reduction of
acetate to acetaldehyde 19 Acetyl-CoA Reductase 1.1.1.2 RCCD00257
ADH_1 zinc-containing NADPH- dependent Acetyl-CoA Reductase 20
Alcohol Dehydrogenase 1.1.1.1 RCCD00167 ADH_2 two pfam domain:
FeADh and ALDH, AdhE 21 1.1.1.1 RCCD00168 ADH_3 two pfam domain:
FeADh and ALDH, AdhE 22 1.1.1.1 RCCD02628 ADH_5 one pfam domain:
FeADh 23 1.1.1.1 RCCD03350 ADH_7 one pfam domain: FeADh 24
1.--.--.-- RCCD00470 ADH_8 short chain ADH, multiple copy 25
1.--.--.-- RCCD01665 ADH_9 short chain ADH, multiple copy 26
1.--.--.-- RCCD01767 ADH_10 short chain ADH, multiple copy 27
1.--.--.-- RCCD02864 ADH_11 short chain ADH, multiple copy 28
Aldehyde Dehydrogenase 1.2.1.10 RCCD02636 ALDH_1 Acetylating 29
1.2.1.10 RCCD03356 ALDH_2 Acetylating 30 1.2.1.10 RCCD03368 ALDH_3
Acetylating Hydrogenase 31 Hydrogenase 1.12.7.2 RCCD00346 HYD_1
Ni--Fe large subunit, H2 oxidation 32 1.12.7.2 RCCD00938 HYD_2
Ni--Fe small subunit, H2 oxidation 33 1.12.7.2 RCCD01283 HYD_3 Fe
only, large subunit, H2 production 34 1.12.7.2 RCCD01700 HYD_4 Fe
only, H2 production 35 1.12.7.2 RCCD02918 HYD_5 Fe only, H2
production 36 1.12.7.2 RCCD04233 HYD_6 Fe only, H2 production
Electron 37 Ferredoxin RCCD00424 carrier 38 RCCD01226 39 RCCD01932
40 RCCD02185 41 RCCD02239 42 RCCD02268 43 RCCD02580 44 RCCD03406 45
RCCD03640 46 RCCD03676 47 RCCD04306 Electron 48 Pyridine
nucleotide- RCCD00185 glutamate disulphide synthase small
oxidoreductases chain, but no large chain next to it 49 RCCD01487
next to cooF and cooS, probably important for reduced pyridine
cofactor generation 50 RCCD00433 NADH dehydrogenase, not part of an
operon 51 Membrane-associated RCCD01488 cooF Between gene electron
transfer FeS number 3 and protein, cooF gene number 49
[0028] Similarly, the genome of C. carboxydivorans was sequenced,
and genes coding for the enzymes in the Wood-Ljungdahl pathway and
ethanol and acetate synthesis were identified and located. The
results are presented in Table 3.
TABLE-US-00003 TABLE 3 Clostridium carboxidivorans genes used in
metabolic engineering. Gene EC Pathway ID Gene Name Number ORF ID
Copy ID Description Wood- 1 Carbon Monoxide 1.2.2.4 RCCB04039
CODH_1 CO oxidation Ljungdahl 2 Dehydrogenase RCCB01154 CODH_2 CO
oxidation 3 RCCB02478 CODH_3 CO oxidation Ethanol and 4 RCCB03963
CODH_4 CO oxidation acetate 5 RCCB04038 CODH_5 CO oxidation
production 6 Carbon Monoxide 1.2.99.2 RCCB04293 CODH_ACS
bifunctional Dehydrogenase/Acetyl- CODH/ACS CoA Synthase enzyme,
carbon fixation 7 Formate Dehydrogenase 1.2.1.2 RCCB05406 FDH_1
Methyl branch carbon fixation 8 RCCB01346 FDH_2 Methyl branch
carbon fixation 9 Formyltetrahydrofolate 6.3.4.3 RCCB04040 FTHFS
Methyl branch Synthase carbon fixation 10 Methenyltetrahydrofolate
3.5.4.9 RCCB04042 MEC Methyl branch cyclohydrolase carbon fixation
11 Methylenetetrahydrofolate 1.5.1.5 RCCB04042 MED Methyl branch
dehydrogenase carbon fixation 12 Methylenetetrahydrofolate 1.5.1.20
RCCB04044 MER Methyl branch reductase carbon fixation 13
Methyltransferase 2.1.1.13 RCCB04294 MET Methyl branch carbon
fixation 14 Corrinoid/Iron-sulfur 1.2.99.2 RCCB04049 COPL Part of
protein CODH/ACS complex, Large subunit 15 Corrinoid/Iron-sulfur
1.2.99.2 RCCB04047 COPS Part of protein CODH/ACS complex, Small
subunit 16 Acetate Kinase 2.7.2.1 RCCB05249 ACK Acetate production
17 Phospho-transacetylase 2.3.1.8 RCCB02481 PTA Acetate production
18 Tungsten-containing 1.2.7.5 RCCB00063 AOR_1 Reduction of
aldehyde ferredoxin acetate to oxidoreductase acetaldehyde 19
Alcohol Dehydrogenase 1.1.1.2 RCCB03584 ADH_1 zinc-ADH 20 1.1.1.1
RCCB03870 ADH_2 two pfam domain: FeADH and ALDH, AdhE 21 1.1.1.1
RCCB05675 ADH_3 truncated, AdhE 22 1.1.1.1 RCCB00958 ADH_5 one pfam
domain: FeADH 23 1.1.1.1 RCCB04489 ADH_6 one pfam domain: FeADH 24
1.1.1.1 RCCB04503 ADH_7 one pfam domain: FeADH 25 1.--.--.--
RCCB02465 ADH_9 short chain ADH, multiple copy 26 1.--.--.--
RCCB05551 ADH_10 short chain ADH, multiple copy 27 Aldehyde
Dehydrogenase 1.2.1.10 RCCB02403 ALDH_1 Acetylating 28 1.2.1.10
RCCB02561 ALDH_2 Acetylating 29 1.2.1.10 RCCB04031 ALDH_3
Acetylating Hydrogenase 30 Hydrogenase 1.12.7.2 RCCB02249 HYD_1
Ni--Fe large subunit, H2 oxidation 31 1.12.7.2 RCCB01319 HYD_2 Fe
only, H2 production 32 1.12.7.2 RCCB01405 HYD_3 Fe only, H2
production 33 1.12.7.2 RCCB01516 HYD_4 Fe only, large subunit, H2
oxidation 34 1.12.7.2 RCCB03483 HYD_5 Fe only, H2 production 35
1.12.7.2 RCCB05411 HYD_6 Fe only, large subunit, H2 production
Electron 36 Ferredoxin RCCB00234 carrier 37 RCCB00345 38 RCCB01260
39 RCCB01334 40 RCCB01775 41 RCCB01960 42 RCCB01972 43 RCCB02618 44
RCCB02638 45 RCCB02836 46 RCCB02853 47 RCCB03023 48 RCCB03191 49
RCCB03278 50 RCCB03452 51 RCCB03596 52 RCCB03762 53 RCCB03972 54
RCCB04165 55 RCCB04383 56 RCCB04571 57 RCCB04585 58 RCCB05780 59
RCCB05975 60 RCCB06304 61 RCCB06305 Electron 62 Pyridine
nucleotide- RCCB00442 NADH transfer disulphide dehydrogenase,
oxidoreductases not part of an operon 63 RCCB01674 NADH
dehydrogenase, not part of an operon 64 RCCB03510 next to cooF and
cooS, probably important for reduced pyridine cofactor generation
65 RCCB00586 NADH dehydrogenase, not part of an operon 66 RCCB04795
NADH: ferredoxin oxidoreductasen not part of an operon 67
Membrane-associated RCCB03509 cooF Between gene electron transfer
FeS number 2 and protein, cooF gene number 64
[0029] Genes that code for enzymes in the electron transfer pathway
include carbon monoxide dehydrogenase, Enzyme Commission number (EC
1.2.2.4). Five separate open reading frame (ORF) sequences were
identified in C. ragsdalei and C. ljungdahlii, and six were
identified in the C. carboxidivorans genome for the carbon monoxide
dehydrogenase enzyme.
[0030] FIG. 3 is a diagram of carbon-monoxide dehydrogenase operon
300. The gene order within operon 300 is highly conserved in all
three species of acetogenic Clostridia, and comprises the genes
coding for the carbon monoxide dehydrogenase (cooS) (Gene ID 4,
Tables 1, 2, and 3), followed by the membrane-associated electron
transfer FeS protein (cooF) (Gene ID 55, Table 1; Gene ID 51, Table
2; Gene ID 67, Table 3), in turn, followed by ferredoxin
oxidoreductase (FOR).
[0031] A comparison was conducted of the genetic sequence found in
the operon of FIG. 3 across the three species of acetogenic
Clostridia. The cooS gene had 98% identity between C. ragsdalei and
C. ljungdahlii, 84% identity between C. carboxydivorans and C.
ragsdahlii, and 85% identity between C. carboxydivorans and C.
ljungdahlii. The cooF gene had 98% identity between C. ragsdalei
and C. ljungdahlii, 80% identity between C. carboxydivorans and C.
ragsdalei, and 81% identity between C. carboxydivorans and C.
ljungdahlii. The FOR gene had 97% identity between C. ragsdalei and
C. ljungdahlii, 77% identity between C. carboxydivorans and C.
ragsdalei, and 77% identity between C. carboxydivorans and C.
ljungdahlii.
[0032] Six hydrogenase (EC 1.12.7.2) ORF sequences were identified
in the genome of each of the acetogenic Clostridium species.
[0033] Twelve ferredoxin biosynthesis genes (Gene ID 40-51) were
identified in the C. ragsdalei genome. Eleven ferredoxin
biosynthesis genes (Gene ID 37-47, Table 2) were found in C.
ljungdahlii, and twenty-six (Gene ID 36-61, Table 3) were found in
C. carboxidivorans.
[0034] Three genes coding for ferredoxin oxidoreductase enzymes
were found in the C. ragsdalei genome that contain both a
ferredoxin and nicotinamide cofactor binding domain. The ORF
Sequence ID numbers (Table 1) for these genes are: RCCCO2615;
RCCCO2028; and RCCCO3071. The key gene for metabolic engineering,
RCCCO2028, is part of the cooS/cooF operon, also shown in FIG. 3.
Similarly, three genes coding for ferredoxin oxidoreductase (FOR)
enzymes were found in the C. ljungdahlii genome. Each of these
genes code for both the ferredoxin and cofactor binding domains.
The ORF Sequence ID numbers for these genes are: RCCD00185;
RCCD01847; and RCCD00433 (Table 2). The key gene RCCD01847, is part
of the cooF/cooS operon shown in FIG. 3.
[0035] Five genes were found in the C. carboxidivorans genome that
contain both the ferredoxin and cofactor binding domains. The ORF
Sequence ID numbers (Table 3) for these genes are: RCCB00442;
RCCB01674; RCCB03510; RCCB00586; and RCCB 04795. The potentially
key gene for modulating electron flow is RCCB03510, which is part
of the cooF/cooS operon (FIG. 3).
[0036] The genes encoding AR (Gene ID 21, Table 1; Gene ID 19,
Table 2) were sequenced in C. ragsdalei and C. ljungdahlii. A high
degree of gene conservation is observed for the acetyl CoA
reductase gene in C. ragsdalei and C. ljungdahlii. Furthermore, in
both micro-organisms, the enzyme exhibits a high degree of
homology. The sequence of the acetyl CoA gene in C. ragsdalei and
C. ljungdahlii was compared and found to have a 97.82%
identity.
[0037] Further, the functionality of the gene (including the
promoter) encoding for acetyl CoA reductase was tested. The gene
was amplified by PCR, transferred into shuttle vector pCOS52 and
ligated into the EcoRI site to form pCOS54. The vector contained
the entire acetyl-CoA reductase gene and its promoter on a
high-copy plasmid. pCOS52 contained the same backbone vector as
pCOS54 but lacked the AR gene. pCOS52 was used as the control
plasmid in functional assays to determine expression of the AR gene
in E. coli to confirm the Clostridial gene function. The results
confirmed the function of the acetyl CoA reductase gene.
[0038] The functional assay consisted of adding cells harvested at
the given time points to a reaction buffer containing NADPH and
acetone as the substrate. Spectrophotometric activity (conversion
of NADPH to NADP+) was measured at 378 nm and compared to a
standard curve to determine total activity level. Specific activity
was determined using 317 mg/gram of dry cell weight at an OD
measurement of 1.
[0039] The genes encoding the PTA-ACK operon (Gene IDs 16-17,
Tables 1 and 3; Gene IDs 15-16, Table 2) and its promoter were
sequenced in C. ragsdalei, C. ljungdahlii, and C. carboxydivorans.
The functionality of the operon was confirmed, and it was
demonstrated that downregulation of the operon increases the
ethanol to acetate production ratio. Downregulation involves
decreasing the expression of the transcription of the 2-gene operon
via promoter modification through site-directed mutagenesis. Such
downregulation leads to a decrease in mRNA, leading to a decrease
in protein production and a corresponding decrease in the ability
of the strain to produce acetate. Such downregulation can be
achieved via the method described in Example 2.
[0040] Additionally, a comparison was conducted of the genetic
sequence found in the PTA-ACK operon across three species of
acetogenic Clostridia. The PTA gene had 97% identity between C.
ragsdalei and C. ljungdahlii, 78% identity between C.
carboxydivorans and C. ragsdalei, and 79% identity between C.
ljungdahlii and C. carboxydivorans. The ACK gene had 96% identity
between C. ragsdalei and C. ljungdahlii, 78% between C.
carboxydivorans and C. ragsdalei, and 77% between C.
carboxydivorans and C. ljungdahlii.
[0041] Key genes to promote production of ethanol in C. ragsdalei
include: SEQ ID NO 1 (Gene ID Nos. 4, 55, 53, Table 1) the gene
sequence, including the experimentally determined promoter region,
for carbon monoxide dehydrogenase, coos, electron transfer protein
cooF, and the NADH dependent ferredoxin oxidoreductase (FOR);
SEQ ID NO 2 (Gene ID Nos. 17, 16, Table 1), the gene sequence,
including the experimentally determined promoter region, for ACK
and PTA; SEQ ID NO 3 (Gene ID No. 6, Table 1), the gene sequence,
including the experimentally determined promoter region, for the
acetyl CoA reductase;
TABLE-US-00004 Sequence Listing C. ragsdalei gene sequences (Table
1) >SEQ ID NO. 1: (cooS, cooF, NADH: Ferredoxin Oxidoreductase
operon (includes STOP), Gene ID Nos. 4, 55, 53)
TATTATATCAATATAGAATAATTTTCAATCAAATAAGAATTATTTTATATTTT
ATATTGACAAGGAAACCGAAAAGGTTTATATTATTGTTATTGGATAACAATT
ATTTTTTAGTTAGTTGTACTTGTAAATAAATAGTATTAATTAATACTATTAAA
CTATTACAGTTTTTGATTCTTAGTATAAGTATTCTTAGTATCTTTAGCACTTAG
AATACGTTATCCTTTAGGAGAATAATCCTAATCAGTAATTTTAATAATTTAAT
AGTATACTTAAATAGTATAGTTTGGAGGTTTTATTATGTCAAATAACAAAATT
TGTAAGTCAGCAGATAAGGTACTTGAAAAGTTTATAGGTTCTCTAGATGGTGT
AGAAACTTCTCATCATAGGGTAGAAAGCCAAAGTGTTAAATGTGGTTTTGGT
CAGCTAGGAGTCTGCTGTAGACTCTGTGCAAACGGTCCCTGCAGAATAACAC
CTAAAGCTCCAAGAGGAGTATGTGGTGCTAGTGCTGATACCATGGTTGCAAG
AAACTTTCTTAGAGCTGTAGCTGCCGGCAGTGGATGTTATATCCATATAGTCG
AAAATACAGCTAGAAACGTAAAATCAGTAGGTGAAACCGGCGGAGAGATAA
AAGGAATGAATGCTCTCAACACCCTAGCAGAAAAACTTGGTATAACAGAATC
TGACCCACATAAAAAAGCTGTACTAGTAGCTGTGCCGTATTAAAGGACTTAT
ACAAACCAAAATTCGAAAAAATGGAAGTTATAAATAAATTAGCTTATGCACC
TAGACTAGAAAATTGGAACAAATTAAATATAATGCCTGGCGGTGCAAAATCA
GAAGTTTTTGATGGTGTAGTAAAAACTTCTACAAATCTAAACAGCGACCCTGT
AGATATGCTTCTAAATTGTTTAAAACTTGGAATATCCACTGGGATTTACGGAC
TTACCCTTACAAATTTATTAAATGACATAATTTTAGGTGAACCTGCTATAAGA
CCTGCAAAAGTTGGTTTTAAAGTTGTAGATACGGATTATATAAATTTGATGAT
AACAGGCCACCAGCACTCCATGATTGCCCACCTTCAAGAAGAACTTGTAAAA
CCTGAAGCTGTAAAAAAAGCCCAAGCAGTTGGTGCTAAAGGATTCAAACTAG
TTGGATGTACCTGTGTCGGACAGGATTTACAGTTAAGAGGTAAATACTATACT
GATGTTTTCTCCGGTCATGCAGGAAATAACTTTACAAGTGAAGCCTTAATAGC
AACTGGAGGTATAGATGCAATAGTATCTGAATTTAACTGTACTCTTCCTGGCA
TCGAGCCAATAGCTGATAAGTTCATGGTTAAAATGATATGCCTAGATGACGT
TTCTAAAAAATCAAATGCAGAATATGTAGAATACTCTTTTAAAGATAGAGAA
AAAATAAGCAACCATGTTATAGATACGGCTATTGAAAGTTATAAGGAAAGAA
GATCTAAAGTTACAATGAATATTCCTAAAAACCATGGCTTTGATGACGTCATA
ACAGGTGTAAGTGAAGGTTCCTTAAAATCCTTCTTAGGCGGAAGTTGGAAAC
CTCTTGTAGACTTAATTGCTGCTGGAAAAATTAAAGGTGTTGCTGGAATAGTA
GGTTGTTCAAACTTAACTGCCAAAGGTCACGATGTATTTACAGTAGAACTTAC
AAAAGAACTCATAAAGAGAAATATAATTGTACTTTCTGCAGGTTGTTCAAGT
GGTGGACTTGAAAATGTAGGACTTATGTCTCCAGGAGCTGCTGAACTTGCAG
GAGATAGCTTAAAAGAAGTATGTAAGAGCCTAGGTATACCACCTGTACTAAA
TTTTGGTCCATGTCTTGCTATTGGAAGATTGGAAATTGTAGCAAAAGAACTAG
CAGAATACCTAAAAATAGATATTCCACAGCTTCCACTTGTGCTTTCTGCACCT
CAATGGCTTGAAGAACAAGCATTGGCAGATGGAAGTTTTGGTCTTGCCCTTG
GATTACCACTTCACCTTGCTATATCTCCTTTCATTGGTGGAAGCAAAGTGGTA
ACAAAAGTTTTATGTGAAGATATGGAAAATCTAACAGGCGGCAAGCTTATAA
TAGAAGACGATGTAATAAAAGCTGCAGATAAATTAGAAGAAACCATACTTGC
AAGAAGGAAAAGCTTAGGTCTTAATTAAATGAAAAGAATAATGATAAATAA
GGATTTATGTACCGGATGCTTAAATTGTACTTTAGCTTGTATGGCAGAACACA
ATGAAAATGGGAAATCTTTTTATGATCTGGATCTCAGCAATAAATTTCTTGAA
AGTAGAAATCATATATCTAAAGATGATAATGGAAACAAGCTTCCTATATTTT
GCCGTCACTGTGACGAACCTGAGTGCGTAATGACATGTATGAGCGGTGCCAT
GACTAAAGATCCTGAAACTGGTATAGTATCCTATGATGAGCATAAATGTGCC
AGCTGCTTTATGTGCGTCATGTCCTGTCCTTATGGAGTATTGAAACCAGATAC
TCAGACCAAAAGTAAAGTAGTTAAATGTGACCTGTGTGGTGACAGAGATACA
CCTAGATGCGTTGAAAATTGTCCAACAGAAGCAATTTATATTGAAAAGGAGG
CAGATCTCCTATGAATGAGTGGTTTAACAATAAAAATATTTTTTCACACAAAA
TATGTAATAATAGGAGCCAGTGCTGCTGGAATAAATGCTGCTAAAACTTTAA
GAAAGTTAGATAAATCCTCCAAAATAACTATTATTTCAAAGGATGATGCAGT
TTATTCAAGATGTATACTCCACAAAGTACTTGAGGGAAGTAGAAATTTAGAT
ACCATAAATTTTGTAGATTCTGATTTCTTTGAAAAAAATAATATAGAATGGAT
AAAAGATGCAGATGTAAGCAATATTGATATTGACAAGAAAAAAGTCTTACTT
CAAGACAACAGCAGCTTCAAATTTGACAAGCTCCTTATAGCTTCTGGTGCTTC
CTCCTTTATTCCCCCAGTTAAAAAATTAAGAGAAGCTAAAGGAGTGTACTCCC
TTAGAAATTTTGAAGATGTAACTGCTATACAAGACAAACTTAAAAACGCAAA
ACAAGTGGTAATACTTGGTGCAGGTCTTGTAGGAATTGATGCACTTTTAGGTC
TTATGGTGAAAAATATAAAGATTTCAGTTGTAGAAATGGGAGATAGGATTCT
CCCCCTTCAACTGGACAAAACTGCATCCACTATATATGAAAAGTTGTTAAAA
GAAAAAGGTATAGATGTCTTTACTTCAGTTAAATTGGAAGAGGTAGTTTTAA
ATAAAGACGGAACTGTAAGTAAAGCAGTACTATCAAATTCAACTTCTATAGA
TTGCGATATGATAATAGTTGCTGCTGGTGTTAGACCAAATGTAAGCTTTATAA
AAGACAGCAGGATAAAAGTTGAAAAAGGCATTGTCATAGACAAACATTGTA
AAACCACTGTAGATAATATATATGCTGCAGGAGATGTTACTTTTACTGCTCC
ATATGGCCTATAGCTGTAAAGCAGGGAATAACTGCTGCTTACAACATGGTAG
GTATAAATAGAGAATTACATGACACTTTTGGCATGAAGAACTCAATGAATTT
ATTTAACCTTCCATGCGTATCCCTTGGTAATGTAAATATAGCAGATGAAAGTT
ATGCTGTTGATACATTAGAAGGAGATGGAGTTTATCAAAAAATAGTTCACAA
AGATGGAGTAATCTACGGTGCACTTCTAGTTGGAGATATATCTTACTGCGGCG
TACTAGGATATCTCATAAAAAATAAAGTAAATATAAGCAATATCCATAAAAA
TATTTTTGACATAGATTATTCTGATTTTTACAATGTTGAAGAAGATGGACAAT
ATAGTTATCAATTGAGGTAA SEQ ID NO. 2: (PTA-ACK operon (includes STOP),
Gene ID Nos. 17, 16)
GCATACTGATTGATTATTTATTTGAAAATGCCTAAGTAAAATATATACATATT
ATAACAATAAAATAAGTATTAGTGTAGGATTTTTAAATAGAGTATCTATTTTC
AGATTAAATTTTTACTTATTTGATTTACATTGTATAATATTGAGTAAAGTATTG
ACTAGTAAAATTTTGTGATACTTTAATCTGTGAAATTTCTTAGCAAAAGTTAT
ATTTTTGAATAATTTTTATTGAAAAATACAACTAAAAAGGATTATAGTATAAG
TGTGTGTAATTTTGTGTTAAATTTAAAGGGAGGAAATAAACATGAAATTGAT
GGAAAAAATTTGGAATAAGGCAAAGGAAGACAAAAAAAAGATTGTCTTAGC
TGAAGGAGAAGAAGAAAGAACTCTTCAAGCTTGTGAAAAAATAATTAAAGA
AGGTATTGCAAATTTAATCCTTGTAGGGAATGAAAAGGTAATAGAGGAGAAG
GCATCAAAATTAGGCGTAAGTTTAAATGGAGCAGAAATAGTAGATCCAGAAA
CCTCGGATAAACTAAAAAAATATGCAGATGCTTTTTATGAATTGAGAAAGAA
GAAGGGAATAACACCAGAAAAAGCGGATAAAATAGTAAGAGATCCAATATA
TTTTGCTACGATGATGGTTAAGCTTGGAGATGCAGATGGATTGGTTTCAGGTG
CAGTGCATACTACAGGTGATCTTTTGAGACCAGGACTTCAAATAGTAAAGAC
AGCTCCAGGTACATCAGTAGTTTCCAGCACATTTATAATGGAAGTACCAAATT
GTGAATATGGTGACAATGGTGTACTTCTATTTGCTGATTGTGCTGTAAATCCA
TGCCCAGATAGTGATCAATTGGCTTCAATTGCAATAAGTACAGCAGAAACTG
CAAAGAACTTATGTGGAATGGATCCAAAAGTAGCAATGCTTTCATTTTCTACT
AAGGGAAGTGCAAAACACGAATTAGTAGATAAAGTTAGAAATGCTGTAGAA
ATTGCCAAAAAAGCTAAACCAGATTTAAGTTTGGACGGAGAATTACAATTAG
ATGCCTCTATCGTAGAAAAGGTTGCAAGTTTAAAGGCTCCTGAAAGTGAAGT
AGCAGGAAAAGCAAATGTACTTGTATTTCCAGATCTCCAAGCAGGAAATATA
GGTTATAAACTTGTTCAAAGATTTGCAAAAGCTGATGCTATAGGACCTGTATG
CCAGGGATTTGCAAAACCTATAAATGATTTGTCAAGAGGATGTAACTCCGAT
GATATAGTAAATGTAGTAGCTGTAACAGCAGTTCAGGCACAAGCTCAAAAGT
AAATGAAAATATTAGTAGTAAACTGTGGAAGTTCATCTTTAAAATATCAACTT
ATTGATATGAAAGATGAAAGCGTTGTGGCAAAAGGACTTGTAGAAAGAATA
GGAGCAGAAGGTTCAGTTTTAACACATAAAGTTAACGGAGAAAAGTTTGTTA
CAGAGCAGCCAATGGAAGATCATAAAGTTGCTATACAATTAGTATTAAATGC
TCTTGTAGATAAAAAACATGGTGTAATAAAAGATATGTCAGAAATATCTGCT
GTAGGGCATAGAGTTTTGCATGGTGGAAAAAAATATGCGGCATCCATTCTTA
TTGATGACAATGTAATGAAAGCAATAGAAGAATGTATTCCATTAGGACCATT
ACATAATCCAGCTAATATAATGGGAATAGATGCTTGTAAAAAACTAATGCCA
AATACTCCAATGGTAGCAGTATTTGATACAGCATTTCATCAGACAATGCCAG
ATTATGCTTATACTTATGCAATACCTTATGATATATCTGAAAAGTATGATATC
AGAAAATATGGTTTTCATGGAACTTCTCATAGATTCGTTTCAATTGAAGCAGC
CAAGTTGTTAAAGAAAGATCCAAAAGATCTTAAGCTAATAACTTGTCATTTA
GGAAATGGAGCTAGTATATGTGCAGTAAACCAGGGAAAAGCAGTAGATACA
ACTATGGGACTTACTCCCCTTGCAGGACTTGTAATGGGAACTAGATGTGGTG
ATATAGATCCAGCTATAATACCATTTGTAATGAAAAGAACAGGTATGTCTGT
AGATGAAATGGATACTTTAATGAACAAAAAGTCAGGAATACTTGGAGTATCA
GGAGTAAGCAGCGATTTTAGAGATGTAGAAGAAGCTGCAAATTCAGGAAAT
GATAGAGCAAAACTTGCATTAAATATGTATTATCACAAAGTTAAATCTTTCAT
AGGAGCTTATGTTGCAGTTTTAAATGGAGCAGATGCTATAATATTTACAGCA
GGACTTGGAGAAAATTCAGCTACTAGCAGATCTGCTATATGTAAGGGATTAA
GCTATTTTGGAATTAAAATAGATGAAGAAAAGAATAAGAAAAGGGGAGAAG
CACTAGAAATAAGCACACCTGATTCAAAGATAAAAGTATTAGTAATTCCTAC
AAATGAAGAACTTATGATAGCTAGGGATACAAAAGAAATAGTTGAAAATAA ATAA SEQ ID NO.
3: (ORF RCCCO2715, P11, NADPH-SADH (includes STOP), Gene ID No. 6)
ATGAAAGGTTTTGCAATGTTAGGTATTAACAAGTTAGGATGGATTGAAAAGA
AAAACCCAGTACCAGGTCCTTATGATGCGATTGTACATCCTCTAGCTGTATCC
CCATGTACATCAGATATACATACGGTTTTTGAAGGAGCACTTGGTAATAGGG
AAAATATGATTTTAGGTCACGAAGCTGTAGGTGAAATAGCTGAAGTTGGCAG
TGAAGTTAAAGATTTTAAAGTTGGCGATAGAGTTATCGTACCATGCACAACA
CCTGACTGGAGATCCTTAGAAGTCCAAGCTGGTTTTCAACAGCATTCAAACG
GTATGCTTGCAGGATGGAAGTTTTCCAATTTTAAAGACGGTGTATTTGCAGAT
TACTTTCATGTAAACGATGCAGATATGAATCTTGCAATACTTCCAGATGAAAT
ACCTTTAGAAAGTGCAGTTATGATGACAGACATGATGACTACTGGTTTTCATG
GGGCAGAACTTGCTGACATAAAAATGGGTTCCAGTGTTGTCGTAATTGGTAT
AGGAGCTGTTGGATTAATGGGAATAGCCGGTTCCAAACTTCGAGGAGCAGGT
AGAATTATCGGTGTTGGAAGCAGACCCGTTTGTGTTGAAACAGCTAAATTTTA
TGGAGCAACTGATATTGTAAATTATAAAAATGGTGATATAGTTGAACAAATA
ATGGACTTAACTCATGGTAAAGGTGTAGACCGTGTAATCATGGCAGGCGGTG
GTGCTGAAACACTAGCACAAGCAGTAACTATGGTTAAACCTGGCGGCGTAAT
TTCTAACATCAACTACCATGGAAGCGGTGATACTTTGCCAATACCTCGTGTTC
AATGGGGCTGCGGCATGGCTCACAAAACTATAAGAGGAGGGTTATGTCCCGG
CGGACGTCTTAGAATGGAAATGCTAAGAGACCTTGTTCTATATAAACGTGTT
GATTTGAGCAAACTTGTTACTCATGTATTTGATGGTGCAGAAAATATTGAAAA
GGCCCTTTTGCTTATGAAAAATAAGCCAAAAGATTTAATTAAATCAGTAGTTA CATTCTAA
[0042] Using detailed genomic information, the acetogenic
Clostridia micro-organisms have been metabolically engineered to
increase the carbon and electron flux through the biosynthetic
pathways for ethanol and butanol, while simultaneously reducing or
eliminating carbon and electron flux through the corresponding
acetate and butyrate formation pathways, in accordance with the
present invention. For this purpose, the activities of key genes
encoding for enzymes in the pathway have been modulated. In one
embodiment, gene expression of key alcohol producing enzymes is
increased by increasing the copy number of the gene. For example, a
key carbon monoxide dehydrogenase operon (FIG. 3) and the
associated electron transfer proteins, including acetyl CoA
reductase and aldehyde ferredoxin oxidoreductase are duplicated
within the genome of the modified organism. In one embodiment,
these duplications are introduced into strains having knocked out
or attenuated acetate production to further channel electrons into
the ethanol or butanol production pathway. In another embodiment a
knockout strategy is applied to strains of acetogenic Clostridia
that, when grown on syngas, produce more complex mixtures of
alcohols and acids, such as ethanol, butanol and hexanol and their
corresponding carboxylic acids.
[0043] In one embodiment, vectors to be used for the transfer of
acetogenic Clostridia cloned genes from cloning vehicles to parent
acetogenic Clostridia strains are constructed using standard
methods (Sambrook et al., 1989). All gene targets used in molecular
genetics experiments are amplified using high-fidelity polymerase
chain reaction (PCR) techniques using sequence-specific primers.
The amplified genes are next subcloned into intermediate cloning
vehicles, and later recombined in multi-component ligation
reactions to yield the desired recombinant vector to be used in the
gene transfer experiments. The vectors contain the appropriate
functional features required to carry out the gene transfer
experiments successfully and vary depending on the method used.
[0044] To transfer the recombinant vectors into recipient
acetogenic Clostridia, a variety of methods are used. These include
electroporation, bi-parental or tri-parental conjugation,
liposome-mediated transformation and polyethylene glycol-mediated
transformation. Recombinant acetogenic Clostridia are isolated and
confirmed through molecular biology techniques based on the
acquisition of specific traits gained upon DNA integration.
Example 1
[0045] Acetogenic Clostridia contain operon 300, shown in FIG. 3,
that consists of carbon monoxide dehydrogenase 104 (cooS, Gene ID
4, Table 1, Table 2, Table 3), a membrane-associated electron
transfer protein (cooF), and a ferredoxin oxidoreductase (FOR).
Overexpression of carbon monoxide dehydrogenase 104 within the
acetogenic Clostridia is known to increase electron flow from
syngas components to the oxidizeded nucleotide cofactors NAD.sup.+
and NADP.sup.+ The increased levels of reduced nucleotide cofactors
then stimulate generation of intermediate compounds in
Wood-Ljungdahl pathway 100.
[0046] In one embodiment, operon 300 is amplified using long-PCR
techniques with primers that are designed to anneal to a region 200
nucleotides (nt) upstream of the carbon monoxide dehydrogenase gene
and 200 nt downstream of the ferredoxin oxidoreductase gene. The
total region is about 3.8 kilobase pairs. The amplified DNA is
cloned directly into suitable plasmid vectors specifically designed
to ligate PCR products such as pGEM T easy (Promega, Madison, Wis.)
or pTOPO (Invitrogen, Carlsbad, Calif.). The ends of the PCR
product contain engineered restriction sites to facilitate later
cloning steps. The operon 300 is subcloned into a vector that
already contains cloned chromosomal C. ragsdalei or other
acetogenic Clostridial DNA to allow chromosomal integration at a
neutral site.
Example 2
[0047] Because carboxylic acids compete with alcohols for
electrons, decreasing acid production allows more electrons to flow
down the alcohol-production pathway from the CoA intermediate
directly to the alcohol. Acetogenic Clostridia contain genes for
phospho-transacetylase enzyme (Gene ID 17, Tables 1 and 3; Gene ID
16, Table 2) that converts acetyl-CoA to acetyl-phosphate and
acetate kinase (Gene ID 16, Table 1) that converts acetyl-phosphate
218 to acetate 214. In one embodiment, genetic modifications to
delete all or part of the genes for both enzymes and knock out or
attenuate production of acetate are made as shown in FIG. 5.
[0048] Using PCR and other standard methods, a recombinant vector
containing two large non-contiguous segments of DNA is generated.
Upon replacement of the native gene by the recombinant vector gene,
the Clostridial strain contains no phosphotransacetylase or acetate
kinase activities as shown in FIG. 5 by X 504 and X 502,
respectively.
[0049] Modulation of the common promoter region, P* 506 to
attenuate gene expression of phosphotransacetylase 508 and acetate
kinase 510 and subsequent acetate production are carried out by
generating a series of recombinant vectors with altered promoter
regions. The vector series is constructed by site-directed
mutagenesis.
[0050] Additionally, down-regulation of the 2-gene operon
containing pta/ack genes is performed by site-directed mutagenesis
of the promoter region. A decrease in RNA polymerase binding leads
to a decrease in transcriptional activity off of the pta/ack
promoter and in turn lead to a decrease in protein activity. The
end result is a decrease in acetate production since the
intermediates are produced at a lower rate and more carbon from
acetyl-CoA goes towards ethanol production. A promoter probe assay
using a reporter group that is easily quantitated has been
developed to measure relative promoter strength of the pta/ack
promoter in vivo. After site-directed mutagenesis is performed,
which imparts single and multiple lesions over a 200 base pair
region, strains that have decreased promoter activity are isolated
such that a series of strains with 90%, 80%, 70%, 60%, 50%, 40%,
30%, 20%, 10% and 0% activity of the native promoter in the assay
are isolated and tested in recombinant Clostridia strains.
Example 3
[0051] In vivo, the acetyl CoA enzyme designated in 102 and FIG. 5
converts the Coenzyme A (CoA) form of a carbon moiety, such as
acetyl-CoA 102 or butyrl-CoA directly to its corresponding alcohol.
Thermodynamically, direct conversion from the CoA form to the
alcohol requires transfer of four electrons, and is a more
efficient way to generate the alcohol, compared to the two-step
conversion of the carboxylic acid to the corresponding alcohol. For
example, as shown in FIG. 6, the two step conversion requires that
acetate 214, first be converted to its aldehyde form (acetaldehyde,
604), and then to the corresponding alcohol, ethanol 216. Thus,
increasing AR activity, portrayed by the vertical arrow 602 is
desirable for increasing alcohol production, and increasing the
selectivity of the process by increasing the ratio of alcohol to
acid.
[0052] In one embodiment, AR activity in acetogenic Clostridia is
increased by amplifying the gene in vitro using high-fidelity PCR
and inserting the duplicated copy of the gene into a neutral site
in the chromosome using standard molecular genetic techniques.
After gene replacement of the vector, the chromosome contains two
copies of the AR. Confirmation of genereplacement followed by gene
expression studies of the recombinant strain are performed and
compared to the parent strain.
[0053] In other embodiments a similar strategy is used to increase
the enzymatic activity of adhE-type alcohol dehydrogenases,
short-chain alcohol-dehydrogenases and primary Fe-containing
alcohol dehydrogenases.
Example 4
[0054] Under some conditions, Clostridia need to obtain additional
energy in the form of adenosine triphosphate production (ATP)
causing the cells to temporarily increase the production of acetate
214 from acetyl-CoA 102. The net reaction is 1 ATP from ADP+P,
through acetyl-phosphate. Acetate production is advantageous to the
syngas fermentation process at low to moderate acetic acid
concentrations, because it allows the cells to produce more energy
and remain robust. However, too much free acetic acid causes
dissipation of the transmembrane ion gradient used as the primary
ATP generation source and therefore becomes detrimental to the
cells. For industrial production purposes, it is advantageous to
convert the acetate to ethanol to increase ethanol production and
reduce the probability of accumulating too much free acetic
acid.
[0055] In one embodiment, ethanol production in the double mutant
C. ragsdalei strain is increased by between 10 and 40% as a result
of the increased aldehyde ferredoxin oxidoreductase and AR
activities. In another embodiment, the ratio of ethanol to acetate
produced is increased between 5 and 10 fold, but allows sufficient
acetate formation to support ATP production needed to meet the
energy needs of the microorganism.
[0056] While the invention has been described with reference to
particular embodiments, it will be understood by one skilled in the
art that variations and modifications may be made in form and
detail without departing from the spirit and scope of the
invention.
Sequence CWU 1
1
613899DNAClostriduim ragsdalei 1tattatatca atatagaata attttcaatc
aaataagaat tattttatat tttatattga 60caaggaaacc gaaaaggttt atattattgt
tattggataa caattatttt ttagttagtt 120gtacttgtaa ataaatagta
ttaattaata ctattaaact attacagttt ttgattctta 180gtataagtat
tcttagtatc tttagcactt agaatacgtt atcctttagg agaataatcc
240taatcagtaa ttttaataat ttaatagtat acttaaatag tatagtttgg
aggttttatt 300atgtcaaata acaaaatttg taagtcagca gataaggtac
ttgaaaagtt tataggttct 360ctagatggtg tagaaacttc tcatcatagg
gtagaaagcc aaagtgttaa atgtggtttt 420ggtcagctag gagtctgctg
tagactctgt gcaaacggtc cctgcagaat aacacctaaa 480gctccaagag
gagtatgtgg tgctagtgct gataccatgg ttgcaagaaa ctttcttaga
540gctgtagctg ccggcagtgg atgttatatc catatagtcg aaaatacagc
tagaaacgta 600aaatcagtag gtgaaaccgg cggagagata aaaggaatga
atgctctcaa caccctagca 660gaaaaacttg gtataacaga atctgaccca
cataaaaaag ctgtactagt agctgtgccg 720tattaaagga cttatacaaa
ccaaaattcg aaaaaatgga agttataaat aaattagctt 780atgcacctag
actagaaaat tggaacaaat taaatataat gcctggcggt gcaaaatcag
840aagtttttga tggtgtagta aaaacttcta caaatctaaa cagcgaccct
gtagatatgc 900ttctaaattg tttaaaactt ggaatatcca ctgggattta
cggacttacc cttacaaatt 960tattaaatga cataatttta ggtgaacctg
ctataagacc tgcaaaagtt ggttttaaag 1020ttgtagatac ggattatata
aatttgatga taacaggcca ccagcactcc atgattgccc 1080accttcaaga
agaacttgta aaacctgaag ctgtaaaaaa agcccaagca gttggtgcta
1140aaggattcaa actagttgga tgtacctgtg tcggacagga tttacagtta
agaggtaaat 1200actatactga tgttttctcc ggtcatgcag gaaataactt
tacaagtgaa gccttaatag 1260caactggagg tatagatgca atagtatctg
aatttaactg tactcttcct ggcatcgagc 1320caatagctga taagttcatg
gttaaaatga tatgcctaga tgacgtttct aaaaaatcaa 1380atgcagaata
tgtagaatac tcttttaaag atagagaaaa aataagcaac catgttatag
1440atacggctat tgaaagttat aaggaaagaa gatctaaagt tacaatgaat
attcctaaaa 1500accatggctt tgatgacgtc ataacaggtg taagtgaagg
ttccttaaaa tccttcttag 1560gcggaagttg gaaacctctt gtagacttaa
ttgctgctgg aaaaattaaa ggtgttgctg 1620gaatagtagg ttgttcaaac
ttaactgcca aaggtcacga tgtatttaca gtagaactta 1680caaaagaact
cataaagaga aatataattg tactttctgc aggttgttca agtggtggac
1740ttgaaaatgt aggacttatg tctccaggag ctgctgaact tgcaggagat
agcttaaaag 1800aagtatgtaa gagcctaggt ataccacctg tactaaattt
tggtccatgt cttgctattg 1860gaagattgga aattgtagca aaagaactag
cagaatacct aaaaatagat attccacagc 1920ttccacttgt gctttctgca
cctcaatggc ttgaagaaca agcattggca gatggaagtt 1980ttggtcttgc
ccttggatta ccacttcacc ttgctatatc tcctttcatt ggtggaagca
2040aagtggtaac aaaagtttta tgtgaagata tggaaaatct aacaggcggc
aagcttataa 2100tagaagacga tgtaataaaa gctgcagata aattagaaga
aaccatactt gcaagaagga 2160aaagcttagg tcttaattaa atgaaaagaa
taatgataaa taaggattta tgtaccggat 2220gcttaaattg tactttagct
tgtatggcag aacacaatga aaatgggaaa tctttttatg 2280atctggatct
cagcaataaa tttcttgaaa gtagaaatca tatatctaaa gatgataatg
2340gaaacaagct tcctatattt tgccgtcact gtgacgaacc tgagtgcgta
atgacatgta 2400tgagcggtgc catgactaaa gatcctgaaa ctggtatagt
atcctatgat gagcataaat 2460gtgccagctg ctttatgtgc gtcatgtcct
gtccttatgg agtattgaaa ccagatactc 2520agaccaaaag taaagtagtt
aaatgtgacc tgtgtggtga cagagataca cctagatgcg 2580ttgaaaattg
tccaacagaa gcaatttata ttgaaaagga ggcagatctc ctatgaatga
2640gtggtttaac aataaaaata ttttttcaca caaaatatgt aataatagga
gccagtgctg 2700ctggaataaa tgctgctaaa actttaagaa agttagataa
atcctccaaa ataactatta 2760tttcaaagga tgatgcagtt tattcaagat
gtatactcca caaagtactt gagggaagta 2820gaaatttaga taccataaat
tttgtagatt ctgatttctt tgaaaaaaat aatatagaat 2880ggataaaaga
tgcagatgta agcaatattg atattgacaa gaaaaaagtc ttacttcaag
2940acaacagcag cttcaaattt gacaagctcc ttatagcttc tggtgcttcc
tcctttattc 3000ccccagttaa aaaattaaga gaagctaaag gagtgtactc
ccttagaaat tttgaagatg 3060taactgctat acaagacaaa cttaaaaacg
caaaacaagt ggtaatactt ggtgcaggtc 3120ttgtaggaat tgatgcactt
ttaggtctta tggtgaaaaa tataaagatt tcagttgtag 3180aaatgggaga
taggattctc ccccttcaac tggacaaaac tgcatccact atatatgaaa
3240agttgttaaa agaaaaaggt atagatgtct ttacttcagt taaattggaa
gaggtagttt 3300taaataaaga cggaactgta agtaaagcag tactatcaaa
ttcaacttct atagattgcg 3360atatgataat agttgctgct ggtgttagac
caaatgtaag ctttataaaa gacagcagga 3420taaaagttga aaaaggcatt
gtcatagaca aacattgtaa aaccactgta gataatatat 3480atgctgcagg
agatgttact tttactgctc ctatatggcc tatagctgta aagcagggaa
3540taactgctgc ttacaacatg gtaggtataa atagagaatt acatgacact
tttggcatga 3600agaactcaat gaatttattt aaccttccat gcgtatccct
tggtaatgta aatatagcag 3660atgaaagtta tgctgttgat acattagaag
gagatggagt ttatcaaaaa atagttcaca 3720aagatggagt aatctacggt
gcacttctag ttggagatat atcttactgc ggcgtactag 3780gatatctcat
aaaaaataaa gtaaatataa gcaatatcca taaaaatatt tttgacatag
3840attattctga tttttacaat gttgaagaag atggacaata tagttatcaa
ttgaggtaa 389922506DNAClostridium ragsdalei 2gcatactgat tgattattta
tttgaaaatg cctaagtaaa atatatacat attataacaa 60taaaataagt attagtgtag
gatttttaaa tagagtatct attttcagat taaattttta 120cttatttgat
ttacattgta taatattgag taaagtattg actagtaaaa ttttgtgata
180ctttaatctg tgaaatttct tagcaaaagt tatatttttg aataattttt
attgaaaaat 240acaactaaaa aggattatag tataagtgtg tgtaattttg
tgttaaattt aaagggagga 300aataaacatg aaattgatgg aaaaaatttg
gaataaggca aaggaagaca aaaaaaagat 360tgtcttagct gaaggagaag
aagaaagaac tcttcaagct tgtgaaaaaa taattaaaga 420aggtattgca
aatttaatcc ttgtagggaa tgaaaaggta atagaggaga aggcatcaaa
480attaggcgta agtttaaatg gagcagaaat agtagatcca gaaacctcgg
ataaactaaa 540aaaatatgca gatgcttttt atgaattgag aaagaagaag
ggaataacac cagaaaaagc 600ggataaaata gtaagagatc caatatattt
tgctacgatg atggttaagc ttggagatgc 660agatggattg gtttcaggtg
cagtgcatac tacaggtgat cttttgagac caggacttca 720aatagtaaag
acagctccag gtacatcagt agtttccagc acatttataa tggaagtacc
780aaattgtgaa tatggtgaca atggtgtact tctatttgct gattgtgctg
taaatccatg 840cccagatagt gatcaattgg cttcaattgc aataagtaca
gcagaaactg caaagaactt 900atgtggaatg gatccaaaag tagcaatgct
ttcattttct actaagggaa gtgcaaaaca 960cgaattagta gataaagtta
gaaatgctgt agaaattgcc aaaaaagcta aaccagattt 1020aagtttggac
ggagaattac aattagatgc ctctatcgta gaaaaggttg caagtttaaa
1080ggctcctgaa agtgaagtag caggaaaagc aaatgtactt gtatttccag
atctccaagc 1140aggaaatata ggttataaac ttgttcaaag atttgcaaaa
gctgatgcta taggacctgt 1200atgccaggga tttgcaaaac ctataaatga
tttgtcaaga ggatgtaact ccgatgatat 1260agtaaatgta gtagctgtaa
cagcagttca ggcacaagct caaaagtaaa tgaaaatatt 1320agtagtaaac
tgtggaagtt catctttaaa atatcaactt attgatatga aagatgaaag
1380cgttgtggca aaaggacttg tagaaagaat aggagcagaa ggttcagttt
taacacataa 1440agttaacgga gaaaagtttg ttacagagca gccaatggaa
gatcataaag ttgctataca 1500attagtatta aatgctcttg tagataaaaa
acatggtgta ataaaagata tgtcagaaat 1560atctgctgta gggcatagag
ttttgcatgg tggaaaaaaa tatgcggcat ccattcttat 1620tgatgacaat
gtaatgaaag caatagaaga atgtattcca ttaggaccat tacataatcc
1680agctaatata atgggaatag atgcttgtaa aaaactaatg ccaaatactc
caatggtagc 1740agtatttgat acagcatttc atcagacaat gccagattat
gcttatactt atgcaatacc 1800ttatgatata tctgaaaagt atgatatcag
aaaatatggt tttcatggaa cttctcatag 1860attcgtttca attgaagcag
ccaagttgtt aaagaaagat ccaaaagatc ttaagctaat 1920aacttgtcat
ttaggaaatg gagctagtat atgtgcagta aaccagggaa aagcagtaga
1980tacaactatg ggacttactc cccttgcagg acttgtaatg ggaactagat
gtggtgatat 2040agatccagct ataataccat ttgtaatgaa aagaacaggt
atgtctgtag atgaaatgga 2100tactttaatg aacaaaaagt caggaatact
tggagtatca ggagtaagca gcgattttag 2160agatgtagaa gaagctgcaa
attcaggaaa tgatagagca aaacttgcat taaatatgta 2220ttatcacaaa
gttaaatctt tcataggagc ttatgttgca gttttaaatg gagcagatgc
2280tataatattt acagcaggac ttggagaaaa ttcagctact agcagatctg
ctatatgtaa 2340gggattaagc tattttggaa ttaaaataga tgaagaaaag
aataagaaaa ggggagaagc 2400actagaaata agcacacctg attcaaagat
aaaagtatta gtaattccta caaatgaaga 2460acttatgata gctagggata
caaaagaaat agttgaaaat aaataa 250631056DNAClostridium ragsdalei
3atgaaaggtt ttgcaatgtt aggtattaac aagttaggat ggattgaaaa gaaaaaccca
60gtaccaggtc cttatgatgc gattgtacat cctctagctg tatccccatg tacatcagat
120atacatacgg tttttgaagg agcacttggt aatagggaaa atatgatttt
aggtcacgaa 180gctgtaggtg aaatagctga agttggcagt gaagttaaag
attttaaagt tggcgataga 240gttatcgtac catgcacaac acctgactgg
agatccttag aagtccaagc tggttttcaa 300cagcattcaa acggtatgct
tgcaggatgg aagttttcca attttaaaga cggtgtattt 360gcagattact
ttcatgtaaa cgatgcagat atgaatcttg caatacttcc agatgaaata
420cctttagaaa gtgcagttat gatgacagac atgatgacta ctggttttca
tggggcagaa 480cttgctgaca taaaaatggg ttccagtgtt gtcgtaattg
gtataggagc tgttggatta 540atgggaatag ccggttccaa acttcgagga
gcaggtagaa ttatcggtgt tggaagcaga 600cccgtttgtg ttgaaacagc
taaattttat ggagcaactg atattgtaaa ttataaaaat 660ggtgatatag
ttgaacaaat aatggactta actcatggta aaggtgtaga ccgtgtaatc
720atggcaggcg gtggtgctga aacactagca caagcagtaa ctatggttaa
acctggcggc 780gtaatttcta acatcaacta ccatggaagc ggtgatactt
tgccaatacc tcgtgttcaa 840tggggctgcg gcatggctca caaaactata
agaggagggt tatgtcccgg cggacgtctt 900agaatggaaa tgctaagaga
ccttgttcta tataaacgtg ttgatttgag caaacttgtt 960actcatgtat
ttgatggtgc agaaaatatt gaaaaggccc ttttgcttat gaaaaataag
1020ccaaaagatt taattaaatc agtagttaca ttctaa 10564351PRTClostriduim
ragsdalei 4Met Lys Gly Phe Ala Met Leu Gly Ile Asn Lys Leu Gly Trp
Ile Glu 1 5 10 15 Lys Lys Asn Pro Val Pro Gly Pro Tyr Asp Ala Ile
Val His Pro Leu 20 25 30 Ala Val Ser Pro Cys Thr Ser Asp Ile His
Thr Val Phe Glu Gly Ala 35 40 45 Leu Gly Asn Arg Glu Asn Met Ile
Leu Gly His Glu Ala Val Gly Glu 50 55 60 Ile Ala Glu Val Gly Ser
Glu Val Lys Asp Phe Lys Val Gly Asp Arg 65 70 75 80 Val Ile Val Pro
Cys Thr Thr Pro Asp Trp Arg Ser Leu Glu Val Gln 85 90 95 Ala Gly
Phe Gln Gln His Ser Asn Gly Met Leu Ala Gly Trp Lys Phe 100 105 110
Ser Asn Phe Lys Asp Gly Val Phe Ala Asp Tyr Phe His Val Asn Asp 115
120 125 Ala Asp Met Asn Leu Ala Ile Leu Pro Asp Glu Ile Pro Leu Glu
Ser 130 135 140 Ala Val Met Met Thr Asp Met Met Thr Thr Gly Phe His
Gly Ala Glu 145 150 155 160 Leu Ala Asp Ile Lys Met Gly Ser Ser Val
Val Val Ile Gly Ile Gly 165 170 175 Ala Val Gly Leu Met Gly Ile Ala
Gly Ser Lys Leu Arg Gly Ala Gly 180 185 190 Arg Ile Ile Gly Val Gly
Ser Arg Pro Val Cys Val Glu Thr Ala Lys 195 200 205 Phe Tyr Gly Ala
Thr Asp Ile Val Asn Tyr Lys Asn Gly Asp Ile Val 210 215 220 Glu Gln
Ile Met Asp Leu Thr His Gly Lys Gly Val Asp Arg Val Ile 225 230 235
240 Met Ala Gly Gly Gly Ala Glu Thr Leu Ala Gln Ala Val Thr Met Val
245 250 255 Lys Pro Gly Gly Val Ile Ser Asn Ile Asn Tyr His Gly Ser
Gly Asp 260 265 270 Thr Leu Pro Ile Pro Arg Val Gln Trp Gly Cys Gly
Met Ala His Lys 275 280 285 Thr Ile Arg Gly Gly Leu Cys Pro Gly Gly
Arg Leu Arg Met Glu Met 290 295 300 Leu Arg Asp Leu Val Leu Tyr Lys
Arg Val Asp Leu Ser Lys Leu Val 305 310 315 320 Thr His Val Phe Asp
Gly Ala Glu Asn Ile Glu Lys Ala Leu Leu Leu 325 330 335 Met Lys Asn
Lys Pro Lys Asp Leu Ile Lys Ser Val Val Thr Phe 340 345 350
5351PRTClostridium ljungdahlii 5Met Lys Gly Phe Ala Met Leu Gly Ile
Asn Lys Leu Gly Trp Ile Glu 1 5 10 15 Lys Lys Asn Pro Val Pro Gly
Pro Tyr Asp Ala Ile Val His Pro Leu 20 25 30 Ala Val Ser Pro Cys
Thr Ser Asp Ile His Thr Val Phe Glu Gly Ala 35 40 45 Leu Gly Asn
Arg Glu Asn Met Ile Leu Gly His Glu Ala Val Gly Glu 50 55 60 Ile
Ala Glu Val Gly Ser Glu Val Lys Asp Phe Lys Val Gly Asp Arg 65 70
75 80 Val Ile Val Pro Cys Thr Thr Pro Asp Trp Arg Ser Leu Glu Val
Gln 85 90 95 Ala Gly Phe Gln Gln His Ser Asn Gly Met Leu Ala Gly
Trp Lys Phe 100 105 110 Ser Asn Phe Lys Asp Gly Val Phe Ala Asp Tyr
Phe His Val Asn Asp 115 120 125 Ala Asp Met Asn Leu Ala Ile Leu Pro
Asp Glu Ile Pro Leu Glu Ser 130 135 140 Ala Val Met Met Thr Asp Met
Met Thr Thr Gly Phe His Gly Ala Glu 145 150 155 160 Leu Ala Asp Ile
Lys Met Gly Ser Ser Val Val Val Ile Gly Ile Gly 165 170 175 Ala Val
Gly Leu Met Gly Ile Ala Gly Ser Lys Leu Arg Gly Ala Gly 180 185 190
Arg Ile Ile Gly Val Gly Ser Arg Pro Val Cys Val Glu Thr Ala Lys 195
200 205 Phe Tyr Gly Ala Thr Asp Ile Val Asn Tyr Lys Asn Gly Asp Ile
Val 210 215 220 Glu Gln Ile Met Asp Leu Thr His Gly Lys Gly Val Asp
Arg Val Ile 225 230 235 240 Met Ala Gly Gly Gly Ala Glu Thr Leu Ala
Gln Ala Val Thr Met Val 245 250 255 Lys Pro Gly Gly Val Ile Ser Asn
Ile Asn Tyr His Gly Ser Gly Asp 260 265 270 Thr Leu Pro Ile Pro Arg
Val Gln Trp Gly Cys Gly Met Ala His Lys 275 280 285 Thr Ile Arg Gly
Gly Leu Cys Pro Gly Gly Arg Leu Arg Met Glu Met 290 295 300 Leu Arg
Asp Leu Val Leu Tyr Lys Arg Val Asp Leu Ser Lys Leu Val 305 310 315
320 Thr His Val Phe Asp Gly Ala Glu Asn Ile Glu Lys Ala Leu Leu Leu
325 330 335 Met Lys Asn Lys Pro Lys Asp Leu Ile Lys Ser Val Val Thr
Phe 340 345 350 6352PRTThermoanaerobacter ethanolicus 6Met Lys Gly
Phe Ala Met Leu Ser Ile Gly Lys Val Gly Trp Ile Glu 1 5 10 15 Lys
Glu Lys Pro Ala Pro Gly Pro Phe Asp Ala Ile Val Arg Pro Leu 20 25
30 Ala Val Ala Pro Cys Thr Ser Asp Ile His Thr Val Phe Glu Gly Ala
35 40 45 Ile Gly Glu Arg His Asn Met Ile Leu Gly His Glu Ala Val
Gly Glu 50 55 60 Val Val Glu Val Gly Ser Glu Val Lys Asp Phe Lys
Pro Gly Asp Arg 65 70 75 80 Val Val Val Pro Ala Ile Thr Pro Asp Trp
Trp Thr Ser Glu Val Gln 85 90 95 Arg Gly Tyr His Gln His Ser Gly
Gly Met Leu Ala Gly Trp Lys Phe 100 105 110 Ser Asn Val Lys Asp Gly
Val Phe Gly Glu Phe Phe His Val Asn Asp 115 120 125 Ala Asp Met Asn
Leu Ala His Leu Pro Lys Glu Ile Pro Leu Glu Ala 130 135 140 Ala Val
Met Ile Pro Asp Met Met Thr Thr Gly Phe His Gly Ala Glu 145 150 155
160 Leu Ala Asp Ile Glu Leu Gly Ala Thr Val Ala Val Leu Gly Ile Gly
165 170 175 Pro Val Gly Leu Met Ala Val Ala Gly Ala Lys Leu Arg Gly
Ala Gly 180 185 190 Arg Ile Ile Ala Val Gly Ser Arg Pro Val Cys Val
Asp Ala Ala Lys 195 200 205 Tyr Tyr Gly Ala Thr Asp Ile Val Asn Tyr
Lys Asp Gly Pro Ile Glu 210 215 220 Ser Gln Ile Met Asn Leu Thr Glu
Gly Lys Gly Val Asp Ala Ala Ile 225 230 235 240 Ile Ala Gly Gly Asn
Ala Asp Ile Met Ala Thr Ala Val Lys Ile Val 245 250 255 Lys Pro Gly
Gly Thr Ile Ala Asn Val Asn Tyr Phe Gly Glu Gly Glu 260 265 270 Val
Leu Pro Val Pro Arg Leu Glu Trp Gly Cys Gly Met Ala His Lys 275 280
285 Thr Ile Lys Gly Gly Leu Cys Pro Gly Gly Arg Leu Arg Met Glu Arg
290 295 300 Leu Ile Asp Leu Val Phe Tyr Lys Pro Val Asp Pro Ser Lys
Leu Val 305 310 315 320 Thr His Val Phe Gln Gly Phe Asp Asn Ile Glu
Lys Ala Phe Met Leu 325 330 335 Met Lys Asp Lys Pro Lys Asp Leu Ile
Lys Pro Val Val Ile Leu Ala 340 345 350
* * * * *