U.S. patent application number 13/575865 was filed with the patent office on 2013-04-25 for probiotic composition for use in the treatment of bowel inflammation.
The applicant listed for this patent is Jordi Cune Castellana, Jordi Espadaler Mazo. Invention is credited to Jordi Cune Castellana, Jordi Espadaler Mazo.
Application Number | 20130101566 13/575865 |
Document ID | / |
Family ID | 42243204 |
Filed Date | 2013-04-25 |
United States Patent
Application |
20130101566 |
Kind Code |
A1 |
Espadaler Mazo; Jordi ; et
al. |
April 25, 2013 |
PROBIOTIC COMPOSITION FOR USE IN THE TREATMENT OF BOWEL
INFLAMMATION
Abstract
The present disclosure is directed to compositions comprising
Lactobacillus plantarum CECT 7484, Lactobacillus plantarum CECT
7485, and Pediococcus acidilactici CECT 7483 or a mutant or variant
thereof. This composition is useful in the treatment of
gastrointestinal diseases or conditions such as Inflammatory Bowel
Disease, Irritable Bowel Syndrome, or abdominal distension and
bloating.
Inventors: |
Espadaler Mazo; Jordi;
(Girona, ES) ; Cune Castellana; Jordi;
(Bellaterra, ES) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Espadaler Mazo; Jordi
Cune Castellana; Jordi |
Girona
Bellaterra |
|
ES
ES |
|
|
Family ID: |
42243204 |
Appl. No.: |
13/575865 |
Filed: |
January 27, 2011 |
PCT Filed: |
January 27, 2011 |
PCT NO: |
PCT/EP2011/051170 |
371 Date: |
July 27, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61299116 |
Jan 28, 2010 |
|
|
|
Current U.S.
Class: |
424/93.21 ;
424/93.45; 435/252.3; 435/252.9 |
Current CPC
Class: |
A61P 1/00 20180101; A23Y
2280/15 20130101; A61P 1/04 20180101; A61P 3/02 20180101; A61P 1/06
20180101; A61K 35/747 20130101; A61K 35/744 20130101; A23V 2002/00
20130101; A61P 37/02 20180101; A23L 33/135 20160801; A23Y 2220/67
20130101; A61K 35/74 20130101 |
Class at
Publication: |
424/93.21 ;
435/252.9; 435/252.3; 424/93.45 |
International
Class: |
A61K 35/74 20060101
A61K035/74 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 28, 2010 |
EP |
10151998.1 |
Claims
1. A composition comprising Lactobacillus plantarum CECT 7484
and/or a mutant thereof, Lactobacillus plantarum CECT 7485 and/or a
mutant thereof, and Pediococcus acidilactici CECT 7483 and/or a
mutant thereof, wherein each mutant has been produced by
mutagenesis.
2. A composition as defined in claim 1, comprising Lactobacillus
plantarum CECT 7484, Lactobacillus plantarum CECT 7485, and
Pediococcus acidilactici CECT 7483.
3. A probiotic product comprising the composition as defined in
claim 1.
4-5. (canceled)
6. A method for the prevention and/or treatment of bowel
inflammation in a subject, comprising administering to a subject in
need thereof an effective amount of the composition as defined in
claim 1.
7. (canceled)
8. A method for the prevention and/or treatment of Inflammatory
Bowel Disease in a subject, comprising administering to a subject
in need thereof an effective amount of the composition as defined
in claim 1.
9. A method for the prevention and/or treatment of Irritable Bowel
Syndrome in a subject, comprising administering to a subject in
need thereof an effective amount of the composition as defined in
claim 1.
10. A method for the prevention and/or treatment of abdominal
distension and bloating in a subject, comprising administering to a
subject in need thereof an effective amount of the composition as
defined in claim 1.
11. A pharmaceutical product comprising the composition as defined
in claim 1 and at least one pharmaceutically acceptable
excipient.
12. A veterinary product comprising the composition as defined in
claim 1 and at least one veterinary acceptable excipient.
13. An edible product comprising the composition as defined in
claim 1 and at least one other edible ingredient.
14. The edible product according to claim 13, which is a dietary
supplement.
15. A strain of Lactobacillus plantarum deposited in the Spanish
Type Culture Collection under the accession number CECT 7484, or a
mutant thereof, wherein the mutant has been produced by
mutagenesis.
16. A strain of Lactobacillus plantarum deposited in the Spanish
Type Culture Collection under the accession number CECT 7485, or a
mutant thereof, wherein the mutant has been produced by
mutagenesis.
17. A strain of Pediococcus acidilactici deposited in the Spanish
Type Culture Collection under the accession number CECT 7483, or a
mutant thereof, wherein the mutant has been produced by
mutagenesis.
18-23. (canceled)
24. A strain of Lactobacillus plantarum as defined in claim 15,
wherein the strain is a strain as deposited in the Spanish Type
Culture Collection under the accession number CECT 7484.
25. A strain of Lactobacillus plantarum as defined in claim 16,
wherein the strain is a strain as deposited in the Spanish Type
Culture Collection under the accession number CECT 7485.
26. A strain of Pediococcus acidilactici as defined in claim 17,
wherein the strain is a strain as deposited in the Spanish Type
Culture Collection under the accession number CECT 7483.
Description
[0001] This application claims the benefit of the U.S. provisional
application No. 61/299,116, and of the European patent application
EP10151998, both filed on 28 Jan. 2010, and which are incorporated
herein by reference.
[0002] The present invention relates to the fields of medicine,
microbiology and nutrition and, particularly, to a novel probiotic
composition. Particularly, new strains of Lactobacillus plantarum
and Pediococcus acidilactici have been isolated and combined in a
formulation useful in the treatment of gastrointestinal diseases,
such as bowel inflammation (e.g., inflammatory bowel disease) and
irritable bowel syndrome.
BACKGROUND OF THE INVENTION
[0003] Ulcerative colitis (UC), Pouchitis, and Crohn's Disease are
examples of Inflammatory Bowel Diseases (IBD) characterized by
chronic inflammation in the intestine. The clinical symptoms are
diarrhea, abdominal pain, occasional rectal bleeding, weight loss,
tiredness and sometimes fever. Although occurring at any age, IBD
is most common in teenagers and young adults, which consequently
may suffer from delayed development and stunted growth. The
frequency of the disease is similar to type 1 diabetes in Europe
and the USA. The clinical course of IBD varies considerably.
Patients with mild to moderate symptoms may be treated without
hospitalization. However, 10-15% of patients experience a severe
course of the disease, which in many cases is followed by
surgery.
[0004] IBD is treated medically by reducing the inflammation and
thereby controlling the gastrointestinal symptoms. However, there
is currently no medical cure for IBD. Coloectomy may eliminate UC
but reduces life quality and increases the risk of complications.
The available medical treatments include the use of
5-aminosalicylic acid (5-ASA), corticosteroids and immunomodulatory
medicaments. Prolonged treatment of mild to moderate IBD symptoms
is usually carried out using 5-ASA while corticosteroids and
immunomodulatory medicaments are used to treat severe symptoms.
Diarrhea or abdominal pain appear as side effects of 5-ASA whereas
long term use of corticosteroids frequently shows serious side
effects including reduction in bone mass, infection, diabetes,
muscle wasting and psychiatric disturbances. Immunomodulatory
medicaments suppress the immune system, which controls the IBD
symptoms. However, the resulting immuno-compromised state leaves
the patient susceptible to many diseases.
[0005] Irritable Bowel Syndrome (IBS) is a condition characterized
by abdominal pain and/or discomfort which is associated to altered
bowel habit or defecation, where symptoms are not explained by
structural or biochemical abnormalities. Urgency, bloating and
feeling of incomplete bowel movements are also common in IBS.
Therefore, it is classified among functional gastrointestinal
disorders which include diseases such as functional bloating,
noncardiac chest pain, non-ulcer dyspepsia, and chronic
constipation or diarrhea (Longstreth G. H. et al., 2006).
Noteworthy, IBS has a substantial impact on morbidity and quality
of life beyond abdominal pain and discomfort, as the associated
symptoms affect both the sufferer's sense of well-being and the
ability to function normally (Dean B. B. et al., 2005).
[0006] There is a tremendous activity in the field of drug
development for the treatment of IBS. In this regard, various
antidepressants have gained popularity although their efficacy in
clinical trials has been modest and their clinical utility is
limited by untoward side effects. Serotonergic agents have
demonstrated efficacy on the global symptoms of IBS. However,
recent concerns about safety have severely limited their use.
Therefore, the development of novel therapies for IBS is of great
interest.
[0007] Probiotics are defined as "living microorganisms, which upon
ingestion in certain numbers, exert health benefits beyond inherent
basic nutrition" (Araya M. et al., 2002; Guarner F. et al., 1998).
Several lactic acid bacteria and species from the genus
Bifidobacterium are probiotic, which implies that they have been
shown to promote a specific health effect. Probiotic bacteria must
fulfil several requirements related to lack of toxicity, viability,
adhesion and beneficial effects. These probiotic features are
strain-dependent, even among bacteria of the same species.
Therefore, it is important to find those strains that have a better
performance in all probiotic requirements. Human clinical trials
using probiotics alone or in combination with antibiotics have been
performed to identify strains and/or formulations for the treatment
of patients with IBD or IBS, or for keeping already treated IBD
patients in remission.
[0008] WO 96/29083 and EP 554418 disclose two intestine colonizing
Lactobacillus strains including Lactobacillus plantarum 299v (DSM
6595) and Lactobacillus casei ssp. rhamnosus 271 (DSM 6594). EP
415941 discloses methods for preparing nutrient composition
comprising treatment of oat gruel with enzymes before mixing with
lactobacilli. U.S. Pat. No. 7,195,906 discloses a strain of
Bifidobacterium isolated from resected and washed human
gastrointestinal tract for the treatment of inflammatory diseases,
especially gastrointestinal inflammatory activity, such as IBD, and
IBS.
[0009] In spite of a promising potential, a considerably
improvement of the effect of probiotics for use in the treatment of
inflammation bowel diseases (such as IBD) as well as of other
gastrointestinal diseases (such as IBS) is needed.
SUMMARY OF THE INVENTION
[0010] The inventors of the present invention have found that a
composition comprising Lactobacillus and Pediococcus strains is
effective in the treatment of bowel inflammation. Particularly,
three new probiotic strains belonging to Lactobacillus plantarum
genus and Pediococcus acidilactici genus have been isolated, said
strains allowing the efficient treatment of the bowel inflammation
when combined into the form of a single formulation.
[0011] Thus, in a first aspect the present invention provides a
composition comprising an effective amount of Lactobacillus
plantarum CECT 7484, Lactobacillus plantarum CECT 7485, and
Pediococcus acidilactici CECT 7483, or mutants or variants
thereof.
[0012] Lactobacillus plantarum strains CECT 7485 and CECT 7484, and
Pediococcus acidilactici strain CECT 7483 were deposited in the
Spanish Type Culture Collection (Valencia, Spain) on Apr. 2, 2009.
All three deposited strains are viable and keep all their features
related to their deposit.
[0013] The term "effective amount" as used herein, means an amount
of an active agent high enough to deliver the desired benefit, but
low enough to avoid serious side effects within the scope of
medical judgment.
[0014] It is clear that by using the deposited strains as starting
material, the skilled person in the art can routinely, by
conventional mutagenesis or re-isolation techniques, obtain further
mutants or derivatives thereof that retain or enhance the herein
described relevant features and advantages of the strains forming
the composition of the invention. The skilled person in the art
will decide upon the adequate method to be employed for determining
the anti-inflammatory, immunomodulatory or anti-IBS or
anti-abdominal bloating activity of the strains. Examples of
possible methods to measure this activity are shown in the examples
below.
[0015] In one embodiment, the mutant is a genetically modified
mutant.
[0016] In another embodiment of the first aspect of the invention,
the variant is a naturally occurring variant.
[0017] The strains forming part of the composition of the first
aspect of the invention may be in the form of viable cells.
Alternatively, the strain may be in the form of non-viable
cells.
[0018] The general use of strains P. acidilactici CECT 7483, as
well as of L. plantarum CECT 7484 and CECT 7485 are in the form of
viable cells. However, it could also be extended to non-viable
cells such as killed cultures or compositions containing beneficial
factors produced by P. acidilactici CECT 7483, as well as of L.
plantarum CECT 7484 and CECT 7485. This could include thermally
killed micro-organisms or micro-organisms killed by exposure to
altered pH, sonication, radiation or subjection to pressure. With
non-viable cells product preparation is simpler, cells may be
incorporated easily into pharmaceuticals and storage requirements
are much less limited than viable cells.
[0019] When used in the form of the composition of the invention,
the strains are, preferably, in a concentration ratio of 1:1:1.
[0020] Strains CECT 7483, CECT 7484, and CECT 7485 display a
significant inhibitory activity against several pathogenic and
potentially pathogenic bacterial strains, while displaying minimal
antagonism against common commensal strains of the human
gastrointestinal flora. Moreover, these three strains show a lack
of significant inhibitory activity between them, thus allowing
their combined use in a single formula. This is of relevance
because this means that the composition as defined in the first
aspect of the invention exerts a beneficial effect in the intestine
owing to the "intact" effect of each one of the three strains. The
combination of these strains into a single formula (i.e. the
composition of the invention) displays the ability to improve
clinical symptoms (such as weight loss and diarrhoea) in different
animal models of bowel inflammation. In line with these results,
the composition of the invention shows the unique ability to
significantly reduce acute (IL-6) and chronic (IFN.gamma.)
cytokines.
[0021] A wide variety of lactic acid bacterial species have a long
history of apparent safe use. The European Food Safety Authority
has developed a system granting the "Qualified Presumption of
Safety" (QPS) status to taxonomical units with a proven long
history of apparent safe use. Strains CECT 7483, CECT 7484 and CECT
7485 belong to bacterial species that have QPS status (Andreoletti
O. et al., 2008).
[0022] The strains of the present invention have the advantage that
they are particularly useful as probiotics. As mentioned above,
probiotic bacteria must fulfil several requirements related to lack
of toxicity, viability, adhesion and beneficial effects. These
probiotic features are strain-dependent, even among bacteria of the
same species. Therefore, it is important to find those strains that
have a better performance in all probiotic requirements. The
examples bellow provide (by way of example) protocols to determine
each one of the probiotic features and it is also demonstrated that
said strains have excellent probiotic features.
[0023] The emergence and spread of resistance to antimicrobials in
bacteria pose a threat to human and animal health and present a
major financial and societal cost. When resistance to an
antimicrobial is inherent to a bacterial species, it is generally
referred to as `intrinsic resistance` (sometimes called `natural
resistance`). Intrinsic resistance is presumed to present a minimal
potential for horizontal spread, whereas acquired resistance
mediated by added genes is considered as having a high potential
for lateral spread. The inventors of the present invention have
found that the strains forming the composition of the invention do
not display any significant resistance to antibiotics of human
and/or veterinary importance (ampicillin, gentamicin, streptomycin,
erythromycin, tetracycline, clindamycin, and chloramphenicol)
according to the guidelines of the European Food Safety Authority
(Anadon A. et al., 2005; Bories G. et al., 2008), thus precluding
the risk of a potential transfer of antibiotic resistance to
pathogenic species.
[0024] Additionally, the inventors of the present invention have
found that the strains CECT 7483, CECT 7484, and CECT 7485 can be
co-administered with other medicaments used for the treatment of
IBD (such as mesalazine). As it is shown below, the growth of said
strains is not completely inhibited even using saturated
concentrations of mesalazine. In other words, even using high
concentrations of mesalazine the efficacy of composition of the
invention comprising the probiotic strains is not compromise and,
therefore, it can exert both the probiotic and anti-inflammation
functions.
[0025] The strains of the invention have demonstrated to be highly
resistant to the conditions of the gastrointestinal environment of
mammals (acidic environment, bile salts, and high lysozyme, and
oxygen peroxide concentrations), thus being able to survive passage
through the gastrointestinal tract (hereinafter also referred as
"GIT"). The strains also have good adhesion to the intestinal
epithelium, which allows them to remain in the intestinal tract and
to exert their probiotic effects.
[0026] Further, the present strains have several beneficial effects
in the host. In addition to the anti-inflammatory activity in
bowel, they benefit the intestinal microbiota balance due to their
antagonistic activity. The term "antagonistic activity" refers to
the inhibition of growth of gastrointestinal non-beneficial
bacteria by the activity of probiotic bacteria. The condition of
having inadequate gastrointestinal microbial balance is known as
disbiosis and has multiple negative consequences for human
well-being. It will be shown below that the strains have a high
capacity to inhibit the growth of pathogenic strains when compared
to other commercial strains. Additionally, as mentioned above, the
inventors have found that the new strains of the invention do not
display significant inhibitory activity among them.
[0027] Additionally, it has been found that the strains forming the
composition of the first aspect of the invention produce large
quantities of short chain fatty acids (SCFA). Production of SCFA
from non-digestible fibres is an interesting probiotic trait. This
trait is desirable in a probiotic because the produced SCFA shows
several beneficial properties in the host. Among their various
properties, SCFAs, especially butyric acid, are readily absorbed by
intestinal mucosa, stimulate sodium and water absorption in the
colon, and are trophic to the intestinal mucosa (D'Argenio G. et
al., 1999; Tedelind S. et al., 2007). Moreover, butyric acid is
used as fuel by colonocytes. Each strain in the formula is a strong
producer of a different SCFA, either acetic, propionic or butyric,
which are the three major SCFAs found in the intestine. The better
understanding of how short chain fatty acids act on inflammation
process can help in improving the efficacy of current bowel
inflammation treatments. In this regard, it has been reported the
relation between SCFAs and the regulation of inflammatory
conditions through G protein-coupled receptors (Maslowski K. M. et
al., 2009).
[0028] Furthermore, the strains CECT 7483, CECT 7484 and CECT 7485
promote immunomodulatory effects in the host, since they induce an
improved cytokine pattern from the intestinal mucosa. These
immunomodulatory effects are beneficial to the host because they
help to achieve an improved disease resistance and diminished risk
of allergies. It is known that Gram-negative bacteria in the GIT
display the molecule lipopolisaccharide (LPS) in their surface,
which induces the production of pro-inflammatory signals by the
intestinal mucosa cells. Probiotic supplementation can change this
situation to favour one greater presence of Gram positive bacteria
in the GIT (grouped in the lactic acid bacteria group), with better
ecologic fitness or with antagonistic properties against some Gram
negative microorganisms. Nevertheless, some probiotic
microorganisms show the ability to modulate per se the production
of cytokines, which are messenger molecules that regulate the
inflammatory and immune responses in the body. Particularly, some
probiotic bacteria induce a better balanced pattern between
pro/anti-inflammatory signalling in the intestinal mucosa
(regardless of the effect on Gram negative bacteria). As will be
illustrated below, it was found that the composition's strains of
the invention promote a reduction of inflammatory cytokines
(IFN-.gamma. and IL-6) levels, thus inducing an improved cytokine
pattern from the intestinal mucosa. This immunomodulatory effect is
complemented by the strain's antagonistic properties in reducing
the presence of pathogenic Gram negative bacteria in the GIT.
[0029] It is known that non-viable bacteria as well as bacterial
components can have immunomodulatory effects per se. For instance,
cell components of Lactobacilli species have been reported to
induce anti-inflammatory cytokines (Pathmakanthan S. et al., 2004)
or to reduce pro-inflammatory cytokines (Zhang L. et al., 2005).
Upon isolation of these components, pharmaceutical grade
manipulation is anticipated.
[0030] Considering the results shown below, it is clear that the
strains CECT 7483, CECT 7484 and CECT 7485, forming the composition
of the first aspect of the invention, are characterized by specific
traits such as: survival to gastrointestinal passage, adherence to
intestinal mucosa, resistance to oxidative stress, production of
metabolites with anti-inflammatory activity (either short chain
fatty acids or other products with said activity) and absence of
antagonism between them. The composition and isolated strains of
the present invention are not obviously derived from the prior art
because they are the result of a complex investigation and the
results which have been obtained regarding the bowel inflammation
activity are surprising. Protocols for determining each one of said
traits are included below. From the content of the present
application, the skilled in the art could find other strains
belonging to Lactobacillus and Pediococcus genus, and more
particularly to Lactobacillus plantarum and Pediococcus
acidilactici species which, when administered separately or
combined into a single composition, show the same probiotic and
therapeutic effects than those described in the present
application.
[0031] In a second aspect, the invention provides a composition
comprising an effective amount of the strains of the invention, or
mutant strains thereof, for use as a medicament.
[0032] Particularly, it has been found that the composition
comprising the strains CECT 7483, CECT 7484 and CECT 7485 has an
anti-inflammatory activity in bowel in IBD models. As explained
above, bowel inflammation is one of the main characteristics of
IBD. Thus, the composition of the first aspect of the invention is
useful in the prevention or treatment of said disease.
[0033] Therefore, in a third aspect, the invention provides the
composition as defined in the first aspect of the invention for use
in the prevention or treatment of bowel inflammation in an animal,
including a human. This aspect can be alternatively formulated as
the use of a composition as defined in the first aspect of the
invention for the manufacture of a medicament for the prevention
and/or treatment of bowel inflammation. This may be alternatively
formulated as a method for the prevention and/or treatment of bowel
inflammation in an animal, including a human, comprising
administering to said animal in need thereof an effective amount of
the composition as defined in the first aspect of the
invention.
[0034] In one embodiment of the third aspect of the invention, the
composition is used for the treatment or prevention of Inflammatory
Bowel Disease.
[0035] From the data obtained using the IBD models reported in the
examples (see below), it is derived that the administration of the
strains of the invention, which are effective in the treatment of
conditions characterized by bowel inflammation and diarrhoea, can
also be useful to treat other conditions characterised by
inflammation of the bowel mucosa or submucosa and where diarrhoea
is prevalent, such as enteritis caused by radiotherapy or
chemotherapy. Enteritis is a common side effect of abdominal and
pelvic radiotherapy, affecting 60-70% of patients. Enteritis can
force schedule changes in the radiotherapy regime to decrease
side-effects, potentially leading to sub-optimal anti-tumoral
efficacy of the treatment. There are currently no preventive
strategies for radiotherapy-induced enteritis. However, some
probiotics have shown to be promising in randomized clinical trials
(RCTs). A probiotic composition, such as the one of the present
invention, combining the health-promoting effects of SCFAs
production, the ability to withstand reactive oxygen and nitrogen
species found in the inflamed mucosa, and the antimicrobial
activity against opportunistic pathogens can be useful to treat
radiotherapy and chemotherapy-induced enteritis.
[0036] On the other hand, the present inventors have found that the
strains of the present invention are efficient in the treatment of
IBS. As it is shown below, the composition of the first aspect of
the invention is useful in treating IBS, as assessed by a
randomized double-blind placebo-controlled intervention trial.
[0037] Therefore, in a fourth aspect the present invention provides
the composition of the first aspect of the invention for use in the
prevention and/or treatment of IBS. This aspect can be
alternatively formulated as the use of a composition as defined in
the first aspect of the invention for the manufacture of a
medicament for the prevention and/or treatment of IBS. This may be
alternatively formulated as a method for the prevention and/or
treatment of IBS in an animal, including a human, comprising
administering to said animal in need thereof an effective amount of
the composition as defined in the first aspect of the
invention.
[0038] Furthermore, the present inventors have found that due to
the features of the strains, the composition of the first aspect of
the invention is useful in the treatment of abdominal bloating and
distension. As it is shown below, when the composition of the
invention is administered to people suffering from abdominal
bloating and distension, it is observed a surprising
improvement.
[0039] Therefore, in a fifth aspect the present invention provides
the composition of the first aspect of the invention for use in the
treatment of abdominal bloating and distension. This aspect can be
alternatively formulated as the use of a composition as defined in
the first aspect of the invention for the manufacture of a
medicament for the treatment of abdominal bloating and distension.
This may be alternatively formulated as a method for the treatment
of abdominal bloating and distension in an animal, including a
human, comprising administering to said animal in need thereof an
effective amount of the composition as defined in the first aspect
of the invention.
[0040] The surprising beneficial effects observed in people
suffering from IBS, and/or abdominal bloating and distension may be
due to the fact that the strains of the invention CECT 7483, CECT
7484 and CECT 7485 have the ability of producing the SCFAs listed
in Table 6 and the antagonistic activity shown in Table 3.
[0041] It is well-known in the state of the art that SCFAs modulate
gut motility. Particularly, SCFAs are known to stimulate serotonin
(5-HT) release in rat colon (Fukumoto S. et al., 2003; Tazoe H. et
al., 2008) which plays a pivotal role in the regulation of both gut
motility and sensation. Similarly, butyric acid has been described
to decrease visceral sensitivity of the intestine in human
volunteers (Vanhoutvin S. A. et al., 2009). From this, it can be
concluded that the strains forming the composition of the invention
can be useful to treat, not only IBS or abdominal pain, but also
other conditions related to gastrointestinal motility and/or
gastrointestinal pain, such as functional constipation or
functional diarrhoea.
[0042] The composition and isolated strains of the present
invention are not obviously derived from the prior art because they
are the result of a complex investigation and the results which
have been obtained regarding the efficiency in the treatment of IBS
and abdominal bloating and distension are surprising.
[0043] Surprisingly, the present inventors have found, for the
first time, a Pediococcus acidilactici strain with the ability of
treating IBD and IBS. Said ability, without being bound the theory,
is believed to be due to the specific properties, pointed out
throughout the specification, of the isolated Pediococcus strain.
In the light of the teachings and protocols provided in the present
specification, the skilled person in the art will be able to find
further P. acidilactici strains with the same probiotic and
therapeutic features than the one object of the present
application.
[0044] The composition according to the invention that comprises an
effective amount of the strains of the invention, or of their
mutants, can be formulated as edible, pharmaceutical or veterinary
products, in which said strains are the only active agents or are
mixed with one or more other active agents and/or are mixed with
pharmaceutically or veterinary acceptable excipients (in the case
of a pharmaceutical or veterinary product) or adequate additives
(in the case of an edible product). In a particular embodiment of
the invention, the products additionally contain one or more
further active agents. Preferably, the additional active agent or
agents are other probiotic bacteria which are not antagonic to the
strains forming the composition of the invention. Depending on the
formulation, the strains may be added as purified bacteria, as a
bacterial culture, as part of a bacterial culture, as a bacterial
culture which has been post-treated, and alone or together with
suitable carriers or ingredients. Prebiotics could be also
added.
[0045] In other aspects the invention provides a pharmaceutical and
veterinary products that contain an effective amount of the
composition of the invention together with adequate amounts of
pharmaceutically or veterinary acceptable excipients. In this
regard, the pharmaceutical product may be prepared in any suitable
form which does not negatively affect to the bioavailability of the
strains forming the composition of the invention. Thus, the
composition of the invention can be formulated to be administered
orally in the form, for instance, of freeze-dried power, capsules,
liquid preparations, etc. Selection of the excipients and the most
appropriate methods for formulation in view of the particular
purpose of the composition is within the scope of ordinary persons
skilled in the art of pharmaceutical technology. Although oral
administration is preferred, other forms are possible, such as
injectable, rectal or topical.
[0046] The term "pharmaceutically acceptable" as used herein
pertains to compounds, materials, compositions, and/or dosage forms
which are, within the scope of sound medical judgment, suitable for
use in contact with the tissues of a subject (e.g. human) without
excessive toxicity, irritation, allergic response, or other problem
or complication, commensurate with a reasonable benefit/risk ratio.
Each carrier, excipient, etc. must also be "acceptable" in the
sense of being compatible with the other ingredients of the
formulation. Suitable carriers, excipients, etc. can be found in
standard pharmaceutical texts. Likewise, the term "veterinary
acceptable" means suitable for use in contact with the tissues of a
non-human animal.
[0047] The strains of the invention can be also included in a
variety of edible products, such as a milk products, a yogurt, a
curd, a cheese (e.g. quark, cream, processed, soft and hard), a
fermented milk, a milk powder, a milk based fermented product, an
ice-cream, a fermented cereal based product, a milk based powder, a
beverage, a dressing, and a pet food. The term "edible product" is
used herein in its broadest meaning, including any type of product,
in any form of presentation, which can be ingested by an animal,
but excluding pharmaceutical and veterinary products. Examples of
other edible products are meat products (e.g. liver paste,
frankfurter and salami sausages or meat spreads), chocolate
spreads, fillings (e.g. truffle, cream) and frostings, chocolate,
confectionery (e.g. caramel, fondants or toffee), baked goods
(cakes, pastries), sauces and soups, fruit juices and coffee
whiteners. Particularly interesting edible products are dietary
supplements and infant formulas. In the sense of the present
invention, dietary supplements also include nutraceuticals, which
are known to be extracts of foods that have a medicinal effect on
human health. Fodders for animal food are also included in the
scope of the invention. The compositions of the invention could be
also used as an ingredient in other food products.
[0048] Accordingly, in another aspect of the invention, an edible
product is provided which contains the composition of the invention
together with appropriate amounts of edible ingredients.
Preferably, the composition of the invention is a dietary
supplement.
[0049] The effective amount of colony forming units (cfu) for each
strain in the composition will be determined by the skilled in the
art and will depend upon the final formulation. For instance, in
edible products, the strain or strains are present in an amount
from about 10.sup.5 cfu/g to about 10.sup.12 cfu/g, preferably in
an amount from about 10.sup.7 cfu/g to about 10.sup.12 cfu/g,
according to the current legislation. The term "colony forming
unit" ("cfu") is defined as number of bacterial cells as revealed
by microbiological counts on agar plates.
[0050] Dietary supplements usually contain probiotic strains in an
amount ranging from 10.sup.7 and 10.sup.12 cfu/g. In a particular
embodiment, the composition of the invention is a dietary
supplement comprising between 10.sup.9-10.sup.11 cfu/g.
[0051] The strains of the invention are produced by cultivating the
bacteria in a suitable medium and under suitable conditions. The
strains can be cultivated alone to form a pure culture, or as a
mixed culture together with other microorganisms, or by cultivating
bacteria of different types separately and then combining them in
the desired proportions. After cultivation, the cell suspension is
recovered and used as such or treated in the desired manner, for
instance, by concentrating or freeze-drying, to be further employed
in the preparation of pharmaceutical or edible products. Sometimes
the probiotic preparation is subjected to an immobilisation or
encapsulation process in order to improve the shelf life. Several
techniques for immobilisation or encapsulation of bacteria are
known in the art.
[0052] If the composition according to the invention is used as a
dietary supplement, it can be administered as such, can be mixed
with a suitable drinkable liquid, such as water, yoghurt, milk or
fruit juice, or can be mixed with solid or liquid food. In this
context the dietary supplement can be in the form of tablets,
pills, capsules, granules, powders, suspensions, sachets,
pastilles, sweets, bars, syrups and corresponding administration
forms, usually in the form of a unit dose. Preferably, the
composition of the invention is administered in the form of
tablets, capsules or powders, manufactured in conventional
processes of preparing pharmaceutical products.
[0053] Throughout the description and claims the word "comprise"
and its variations are not intended to exclude other technical
features, additives, components, or steps. Additional objects,
advantages and features of the invention will become apparent to
those skilled in the art upon examination of the description or may
be learned by practice of the invention. Furthermore, the present
invention covers all possible combinations of particular and
preferred embodiments described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0054] FIG. 1 represents the pulsed field gel electrophoresis
patterns of Not-I or Sfi-I (left) and Sma-I (right) restricted
genomic DNA of: 1, Pediococcus acidilactici CECT 7483; 2,
Lactobacillus plantarum CECT 7484; 3, Lactobacillus plantarum CECT
7485. As controls: 4, commercial strain P. acidilactici Rossell1001
(Institut Rossell, Canada); 5, L. plantarum 299v (Probi AB,
Sweden); and 6, L. plantarum strain isolated from commercial
product VSL#3 (VSL Pharmaceuticals, USA). This Figure refers to the
"strain genotyping" section.
[0055] FIG. 2 represents the Disease Activity Index (Y-axis) in a
group of mice suffering from a DSS-induced intestinal inflammation.
X-axis represents the administration of: a, probiotic formulation
of the invention in a group of mice suffering from a DSS-induced
intestinal inflammation; b, a commercial probiotic formulation
(VSL#3) in a group of mice suffering from a DSS-induced intestinal
inflammation; c, vehicle in a group of mice suffering from a
DSS-induced intestinal inflammation; and d, vehicle in a healthy
control group. This figure refers to the "In Vivo Effect on
Chemically-induced Gut Inflammation" section.
[0056] FIG. 3 represents the levels of IL-6 (Y-axis) in a group of
mice suffering from a DSS-induced intestinal inflammation. X-axis
represents: a, probiotic formulation of the invention administered
to a group of mice suffering from a DSS-induced intestinal
inflammation; b, a commercial probiotic formulation (VSL#3)
administered to a group of mice suffering from a DSS-induced
intestinal inflammation; c, vehicle administered to a group of mice
suffering from a DSS-induced intestinal inflammation; and d,
vehicle in a healthy control group. This figure refers to the "In
Vivo Effect on Chemically-induced Gut Inflammation" section.
[0057] FIG. 4 represents the number of Symptom-free weeks (i.e.
number of weeks before the onset of the first symptom, thus being
the Disease Activity Index equal to zero) (Y-axis) in a IL-10
knock-out mouse model. X-axis represents the administration of: a,
the probiotic composition of the invention to a IL-10 knock-out
mice group; b, the commercial probiotic formulation VSL#3 to a
IL-10 knock-out mice group; c, PBS to a IL-10 knock-out mice group;
and d, vehicle in a healthy control group. This figure refers to
the "In Vivo Effect on Spontaneous Gut Inflammation" section.
[0058] FIG. 5 represents the levels of IFN-.gamma. (Y-axis) in a
IL-10 knock-out mouse model. X-axis represents: a, probiotic
formulation of the invention to a IL-10 knock-out mice group; b, a
commercial probiotic formulation (VSL#3) to a IL-10 knock-out mice
group; c, vehicle to a IL-10 knock-out mice group; and d, vehicle
to a healthy control group. This figure refers to the "In Vivo
Effect on Chemically-induced Gut Inflammation" section.
[0059] FIG. 6 represents the levels of IL-6 (Y-axis) in a IL-10
knock-out mouse model. X-axis represents: a, probiotic formulation
of the invention to a IL-10 knock-out mice group; b, a commercial
probiotic formulation (VSL#3), to a IL-10 knock-out mice group; c,
vehicle administered to a IL-10 knock-out mice group; and d,
vehicle to a healthy control group. This figure refers to the "In
Vivo Effect on Chemically-induced Gut Inflammation" section.
[0060] FIG. 7 represents the variation of the IBSQoL score compared
to baseline (Y-axis) of volunteers treated with capsules including
the composition (black bars) or placebo (white bars). X-axis
represents the variation of the score 21 days and after 42 days of
treatment. This figure refers to the "Improvement of Health-Related
Quality of Life" in the "In Vivo Efficacy on IBS Subjects"
section.
[0061] FIG. 8 represents the variation of the VSI score compared to
baseline (Y-axis) of volunteers treated with capsules including the
composition (black bars) or placebo (white bars). X-axis represents
the variation of the score after three weeks and after six weeks of
treatment. This figure refers to the "Improvement of the Visceral
Sensitivity" in the "In Vivo Efficacy on IBS Subjects" section.
EXAMPLES
[0062] The following sections describe the characterization of the
strains of the invention, their specific probiotic features and
their physiological effects on the gastrointestinal and immune
systems. As used hereinafter, strain F1033 corresponds to
Pediococcus acidilactici CETC 7483, strain F2064 to Lactobacillus
plantarum CECT 7484, and strain F2076 to Lactobacillus plantarum
CECT 7485.
1. Isolation of Microorganisms
A) Methods
[0063] For isolation of microorganisms, fresh stools and saliva
(Daniel C. et al., 2006) were collected from 0-5 year-old children
and dissolved in PBS buffer (pH 7.4), aliquoted and plated on MRS
supplemented with various antibiotic combinations. Strains were
cultured under microaerophilic conditions (5% CO.sub.2) at
37.degree. C. Incubation time depended on the growth rate, but run
normally from 24 h to 3 days. Gram staining was carried out in
order to get a first identification. Once grown, isolated strains
were stored by lyophilisation in PBS 0.1.times. with 15% skim milk
powder.
B) Results
[0064] Novel strains F2064, F2076 and F1033 were grown on MRS agar
supplemented with 10 .mu.g/ml vancomycin. Microscopic examination
revealed that strains F2064 and F2076 are Gram-positive bacilli,
while strain F1033 is a Gram-positive with coccal morphology.
2. Identification
A) Methods
[0065] Genomic DNA was extracted using Wizard genomic DNA
purification kit (Promega). For each isolated strain, the 16S gene
was amplified by PCR, using the universal primers 27f, 357f, 907r
and 1492r (Weisburg W. G. et al., 1991), which generate a nearly
full-length 16S rRNA fragment (1465 bp). DNA was washed using
Quiaquick kit (Quiagene, GmbH, Hilden, Germany) and four sequencing
reactions were performed per sample, using BigDye v.3.1 kit, on a
Genetic Analyzer 3130 (Applied Biosystems). Selected sequencing
primers DNA Sequence Analysis v.5.2 (Applied Biosystems) software
was used to collect data and to build chromatograms, which were
analyzed through Chromas (Technelysium Pty Ltd.) and BioEdit (Ibis
Biosciencies) software. Genus and species identification was
performed by comparison of the obtained sequence with 16S sequences
of known organisms from both RefSeq data base
(http://www.ncbi.nlm.nih.gov/RefSeq/) by means of a BLASTN search
(Altschul S. F. et al., 1990), and from the Ribosomal Database
Project (Wang Q. et al., 2007).
TABLE-US-00001 TABLE 1 Primers used for amplifying and sequencing
the 16S gene. Step Primer Orientation 5' .fwdarw. 3' Sequence
Amplification 27f forward AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) 1492r
reverse GGTTACCTTGTTACGACTT (SEQ ID NO: 2) Sequencing 27f forward
AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) 357f forward
CGCCCGCCGCGCCCCGCGCCCGGCCCGC CGCCCCCGCCCCCCTACGGGAGGCAGCA G (SEQ ID
NO: 3) 907r reverse CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 4) 1492r
reverse GGTTACCTTGTTACGACTT (SEQ ID NO: 2)
B) Results
[0066] Strains F2064 and F2076 were identified as members of the
Lactobacillus plantarum group. Strain F1033 was identified as
Pediococcus acidilactici.
3. Survival to GI Tract
A) Methods
[0067] To assess tolerance to acidic environment, 20-.mu.l aliquots
of each bacterial strain culture were placed in 96-well plates,
together with 200-.mu.l aliquots of MRS medium adjusted with HCl to
pH 2 and 3 (Panreac). Plates were kept at 37.degree. C. for 1 h and
optical density at 620 nm was measured. Finally, viable cells were
determined by plate counting and compared to the number of viable
cells in the inoculum.
[0068] To assess tolerance to bile salts, 20-.mu.l aliquots of each
bacterial strain culture were placed in a 96-well plate together
with 200 .mu.l of MRS medium supplemented with 0.5% Oxgall (Sigma).
Plates were incubated at 37.degree. C. and 5% CO.sub.2 for 3 hours,
and then optical density was measured. Finally, viable cells were
determined by plate counting and compared to the number of viable
cells in the inoculum.
B) Results
[0069] All three strains displayed a good ability to survive acidic
environments, with less than one log reduction in the number of
viable cells after 1 h incubation in MRS at pH=2 or pH=3. Strains
also posses a marked resistance to bile salts, with less than a 50%
reduction in the number of viable cells after 3 h incubation in MRS
supplemented with 0.5% of bile salts.
4. Adherence
A) Methods
[0070] Porcine intestine was washed with PBS pH 7.4, containing
0.01% gelatin and a cocktail of protease inhibitors (Complete.RTM.,
Sigma). The mucosa was scrapped and dissolved in HEPES-Hank's
buffer (10 mM HEPES, pH 7.4) (Collado M. et al., 2007) containing
the aforementioned inhibitors. Then, mucus was centrifuged at 13000
rpm for 10 min using the same buffer. Supernatants were recovered
and protein content was determined by Bradford protocol. 24 h
before the assay, 1 ml of mucus solution 0.5 mg/ml was incubated in
wells of a 24-well ELISA plate.
[0071] Each strain to be tested was grown overnight in MRS medium
supplemented with tritium-labeled thymidine (5 .mu.l in 3 ml of
MRS). Cultures were centrifuged and adjusted to 10.sup.8 cfu/ml in
PBS by counting on a Neubauer chamber and samples of each culture
were taken to determine the amount of tritium-labeled thymidine
incorporated by means of a scintillation reader. Then, 0.5 ml were
added to the mucus-containing wells of the 24-well plate and
incubated at 37.degree. C. for 60 min. Supernatant of each well was
removed, and wells were washed twice with MEM Alpha medium (Gibco)
to remove loosely adherent bacteria. Finally, wells were scrapped
to retrieve the mucus together with the adhering bacteria, and
radioactivity was measured. Specific activity (cpm/CFU) of each
culture was calculated from the total radioactivity incorporated in
the PBS suspension adjusted to 10.sup.8 cfu/ml. Lactobacillus
rhamnosus GG (Valio Ltd, Finland) was used as a positive control,
because of its remarkable high adherence to the intestinal
epithelium (Jacobsen C. N. et al., 1999).
[0072] Caco-2 cells were obtained from ATCC (ECACC N.sup.o:
86010202). Cells were seeded in 24-well plates and allowed to grow
in DMEM until confluence (37.degree. C., 5% CO.sub.2). The
experimental procedure to obtain the number of bacteria that adhere
per unit of caco-2 cells area is essentially the same as the one
explained above for adhesion to mucus.
B) Results
[0073] Adhesion capacity of strains F1033, F2064 and F2076 was
measured from scintillation of tritium-labeled thymidine and
compared to those of the commercial strain L. rhamnosus GG.
Adhesion to epithelial cells using the Caco-2 model is a common
assay for probiotic strains. Compared to L. rhamnosus GG, strains
F2064 and F2076 show an affinity for epithelial cells 60% lower.
However, considering the high affinity of L. rhamnosus GG for
epithelial cells, these values are comparable to other well known
probiotics such as L. plantarum 299v, and superior to many other
probiotic strains (Jacobsen C. N. et al., 1999). On the other hand,
adhesion of strain F1033 to epithelial cells is 2.5 times higher
than L. rhamnosus GG. Besides, strains F2064 and F2076 displayed a
much higher affinity for intestinal mucus than for epithelial
cells, while strain F1033 showed the opposite behavior. Results are
shown in the following table.
TABLE-US-00002 TABLE 2 Mucus adhesion of probiotic bacterial
strains. [* From a total bacteria concentration of 10.sup.8 cfu].
Strain Caco-2 (cfus/cm.sup.2) Mucus (cfus/cm.sup.2) F1033 1.21 .+-.
0.17 10.sup.5 cfu 6.06 .+-. 0.73 10.sup.4 cfu F2064 1.89 .+-. 0.12
10.sup.4 cfu 2.25 .+-. 0.12 10.sup.6 cfu F2076 1.71 .+-. 0.16
10.sup.4 cfu 5.91 .+-. 0.03 10.sup.5 cfu L. rhamnosus GG 4.41 .+-.
0.22 10.sup.4 cfu 3.29 .+-. 0.57 10.sup.6 cfu
5. Antagonism Capacity
A) Methods
[0074] The following indicator strains were used: P. mirabilis CECT
4557, K. oxytoca CIP 103434, C. perfringens ATCC 13124, C. ramosum
ATCC 25582, E. faecalis CETC 795, Y. pseudotuberculosis ATCC29833,
B. vulgatus ATCC 8482 and B. thetaiotaomicron ATCC2079 were
collection strains. C. albicans, S. enterica thyphimurium, S.
enterica cholerasuis, C. jejuni, E. coli and P. aeruginosa were lab
isolates. Indicator strains were swabbed uniformly in plates
containing the appropriate medium (Oxoid) and grown to confluence
at the appropriate temperatures in microaerophilic conditions (5%
CO.sub.2). Then, 6 mm (diameter) cylinder sections of confluent
F1033, F2064 or F2076 agar plates were placed upside-down on the
indicator strain plate and incubated overnight at 37.degree. C. The
next day, inhibition zones were measured by placing the agar plate
over a flat rule. Growth inhibitory activity (GI) was calculated as
follows:
GI = ( IZD - CD ) 2 ##EQU00001##
where IZD is the Inhibition Zone Diameter and CD is the cylinder
diameter, measured in millimeters.
B) Results
TABLE-US-00003 [0075] TABLE 3 Growth inhibitory activity (GI) of
probiotic strains against 12 pathogenic or potentially pathogenic
strains, and against 2 common commensal strains of the
gastrointestinal flora. F2064 F2076 F1033 Pathogens C. albicans 2
0.5 1.25 S. enterica typhimurium 1 1 0.25 S. enterica cholerasuis 1
1 0.5 E. coli 1.75 3.7 1.1 C. jejuni 0 0 4.75 K. oxytoca 0.5 1 2 P.
mirabilis 4 1.5 0.5 P. aeruginosa 3 3.75 4.5 E. faecalis 1.75 1
1.25 C. perfringens 2.25 3.75 1.75 C. ramosum 1.25 1.75 0.5 Y.
pseudotuberculosis 5.5 3.4 4.5 Commensals B. thetaiotaomicron 0.4
0.4 0.5 B. vulgatus 0.3 0.5 0.7
[0076] Strains F2064, F2076 and F1033 displayed significant
inhibitory activity against Candida albicans and several
potentially pathogenic bacteria. On the other hand, the strains
displayed minimal activity against commensal strains commonly found
in the indigenous gastrointestinal flora of the Bacteroides genus.
Also, strains F2064, F2076 and F1033 did not display significant
inhibitory activity among them. It is noteworthy that strain F1033
is the only strain displaying high inhibitory activity against
Campylobacter jejuni, while strain F2076 outstands in inhibiting
Escherichia coli and strain F2064 in inhibiting both Candida
albicans and Proteus mirabilis.
6. Antioxidant Capacity
A) Methods
[0077] 20 .mu.l aliquots of overnight cultures of each strain
(10.sup.9 cfu/ml aprox) were placed in a 96-well plate. 200 .mu.l
of MRS supplemented with 10 mM of paraquat
(C.sub.12H.sub.14Cl.sub.2N.sub.2, a superoxide anion donor) or 10
mM of sodium nitroprusside (Na.sub.2[Fe(CN).sub.5NO], a nitric
oxide donor) were added to wells and plates incubated at 37.degree.
C. and 5% CO.sub.2. Optical densities at 620 nm were read after 6
h. Results are expressed as percent of growth compared to growth in
standard MRS medium. The same protocol was followed with the L.
rhamnosus GG strain and the L. plantarum strain isolated from the
commercial formulation VSL#3 (the isolation was performed using
standard procedures).
B) Results
[0078] Oxidative stress is defined as an imbalance between
generation of reactive oxygen species (ROS) and decreased
antioxidant defence systems. Oxidative stress develops particularly
in inflammatory reactions because the inflammatory cells,
neutrophils, and macrophages produce large amounts of ROS (Rezaie
A. et al., 2007; Roessner A. et al., 2008). Strains F1033, F2064
and F2076 showed a capacity to survive under strong oxidizing
conditions comparable to the well-known probiotic strain L.
rhamnosus GG, as well as to the L. plantarum strain isolated from
the VSL#3 formula. It is worth noting that strain F2076 displayed
the highest resistance both to paraquat (superoxide anion donor)
and sodium nitroprusside (nitric oxide donor). Resistance to
oxidative stress is a desirable trait for probiotic strains that
are expected to survive in the environment of an inflamed
mucosa.
TABLE-US-00004 TABLE 4 Percent of growth in medium containing 10 mM
of paraquat or sodium nitroprusside, compared to standard MRS
medium. % growth in % growth in Strain paraquat nitroprusside L.
rhamnosus GG 70 .+-. 10 99 .+-. 17 L. plantarum VSL#3 61 .+-. 4 88
.+-. 10 F1033 67 .+-. 9 76 .+-. 22 F2064 61 .+-. 18 67 .+-. 8 F2076
72 .+-. 1 104 .+-. 19
7. Strain Genotyping
A) Methods
[0079] Strains F1033, F2064 and F2076 were subjected to a
previously described protocol (Rodas A. M. et al., 2005) with minor
modifications. Strains were grown on MRS agar plates and incubated
at 37.degree. C. 5% CO.sub.2 for 18 h. Cells were harvested and
washed 3 times in 8 ml PET (10 mM Tris pH 7.6, 1M NaCl) then
centrifuged at 6000 rpm 10 min. Pellets were resuspended in 700 ml
lysis buffer (6 mM Tris, 1M NaCl, 0.1M EDTA, 0.5% SLS, 0.2.degree.
A) deoxycholic acid; 1 mg/ml lysozyme; 40 U/ml mutanolysin; 20
mg/ml RNase). An equal volume of 1.6% low melting point agarose
(FMC BioProducts, Rockland, Me., USA) was added to the resuspended
cells and solidification was allowed at 4.degree. C. for 1 h.
Inserts were transferred to 2 ml lysis buffer II (0.5 M EDTA pH
9.2, 1% N-lauryl sarcosine and 1 mg/ml pronase) and incubated at
50.degree. C. for 48 h. Then inserts were washed at room
temperature with TE buffer (10 mM Tris, 1 mM EDTA pH 8.0). Total
DNA digestion was performed separately by Sfi-I and Sma-I
restriction enzymes (Roche Diagnostics).
[0080] Pulse-field electrophoresis was carried out using CHEF DRIII
apparatus (BioRad Laboratories). Inserts were loaded in a 1%
agarose gel (SeaKem ME agarose, FMC BioProducts, ME, USA). DNA MW
markers were Lambda ladder PFG Marker and Low Range PFG Marker (New
England Biolabs). After electrophoresis, gels were stained with
ethidium bromide and UV using GelDoc System (BioRad).
B) Results
[0081] FIG. 1 shows the pulse-field electrophoresis profiles
obtained. Strain F1033 shows a similar genomic restriction profile
to P. acidilactici R1001 after digestion with Sma-I. However, the
genomic profile obtained after digestion with enzyme Not-I is
clearly different. On the other hand, the genomic restriction
profiles of strains F2064 and F2076 are clearly different among
them and also compared both to L. plantarum 299v and to the L.
plantarum strain contained in the VSL#3 formula.
8. Production of Short Chain Fatty Acids
A) Methods
[0082] Strains were incubated overnight in a basal medium (see
TABLE 5) supplemented with different fibers, each one (inulin,
pectin and FOS) in a specific amount, under microaerophilic
conditions (5% CO.sub.2) at 37.degree. C. Next, cells were removed
by centrifugation at 12.000 rpm for 10 min and supernatants were
filtered and frozen in liquid nitrogen and kept at -80.degree. C.
until analyzed by gas chromatography, focusing on the amount of
acetic, propionic and butyric acids.
TABLE-US-00005 TABLE 5 COMPOUND CONCENTRATION Peptone 2 g/L Yeast
extract 2 g/L NaCl 0.1 g/L K.sub.2HPO4 0.04 g/L KH.sub.2PO.sub.4
0.04 g/L MgSO.sub.4.cndot.7H.sub.2O 0.01 g/L
CaCl.sub.2.cndot.6H.sub.2O 0.01 g/L NaHCO.sub.3 2 g/L Hemin 0.05
g/L HCl Cysteine 0.5 g/L Bile Salt 0.5 g/L Tween 80 2 g/L Vitamin
K1 10 .mu.l Inulin 10 g/L Pectin 10 g/L FOS 10 g/L
B) Results
[0083] Short chain fatty acids (SCFAs) are the end products of
anaerobic bacteria break down of carbohydrates in the large bowel.
SCFAs, mainly acetate, propionate and butyrate account for
approximately 80% of the colonic anion concentration and are
produced in nearly constant molar ratio 62:22:15. Among their
various properties, SCFAs, especially butyric acid, but also acetic
and propionic acid, are readily absorbed by intestinal mucosa, are
relatively high in caloric content, are metabolized by colonocytes
and hepatocytes, stimulate sodium and water absorption in the colon
and are trophic to the intestinal mucosa (D'Argenio G. et al.,
1999). On the other hand, high amounts of acetic acid have long
been known to be irritant to the intestinal mucosa (Yamada Y. et
al., 1992). Strains F1033, F2064 and F2076 are strong producers of
either acetic, propionic or butyric acid.
TABLE-US-00006 TABLE 6 Acetic, propionic and butyric acid
production by strains grown on basal medium enriched with inulin,
pectin and FOS. Acetic Propionic Butyric Strain (mg/ml) (mg/ml)
(mg/ml) L. rhamnosus GG n.d n.d 7.7 F1033 n.d n.d 21.4 F2064 n.d
30.2 9.7 F2076 46.5 n.d n.d (n.d.= non-detected)
9. Compatibility with IBD Treatments
A) Method
[0084] Supplemented broth was prepared by dissolving
5-aminosalycilic acid (Pentasa.RTM., Ferring Pharmaceuticals) at
the maximal soluble concentration (0.84 gr/L) and half this
concentration (0.42 gr/L) in MRS liquid broth. The strains of the
invention were grown in standard MRS broth or 5-aminosalicylic
acid-supplemented broth for 4 h at 37.degree. C. in microaerophilic
conditions (5% CO.sub.2), and growth was assessed by measuring
optical density at 620 nm. Results are expressed as percent of
growth in standard MRS medium.
B) Results
[0085] Prolonged treatment of mild to moderate IBD symptoms is
usually carried out using oral aminosalycilates (5-ASA derivatives)
(Katz J. A., 2007). Therefore it is of interest to evaluate if the
probiotic strains of the invention can be co-administered with
5-ASA derivatives. Considering that growth of none of said strains
is completely inhibited despite the high stringency of the
conditions, we can conclude that co-administration of mesalazine is
not likely to compromise the efficacy of the probiotic, even using
saturated concentrations of mesalazine (0.84 g/L) as shown in TABLE
7:
TABLE-US-00007 TABLE 7 4 h (% of growth) 8 h (% of growth) 0.42 g/L
0.84 g/L 0.42 g/L 0.84 g/L VSL#3 56.2 38.1 43.2 35.1 F1033 72.7
60.6 51.8 42.3 F2064 59.7 48.0 62.3 55.1 F2076 51.6 22.1 50.2
22.5
10. In Vivo Effect on Chemically-Induced Gut Inflammation
A) Methods
[0086] The therapeutic effect of the composition of the invention
on mild gut inflammation was investigated with a 5-day repetitive
oral administration of dextran sodium sulfate (DSS) in the mouse
(Okayasu I. et al., 1990). When used in a low dose (2.5-3%) for a
short time (5 days), DSS produces mild colitis, with intestinal
inflammation at the histological level but without significant
macroscopic changes (e.g. colon shortening, mesenteric
adherences).
[0087] External symptoms include weight loss and diarrhea, with
rare occurrence of blood in feces. Therefore this model is
representative of low-grade ulcerative colitis.
[0088] Strains F1033, F2064 and F2076 were lyophilised in sterile
water with 15% skim milk and 4% sucrose as cryoprotectants and
mixed in equal amounts (ratio in concentration 1:1:1).
[0089] Eight-week-old Balb/c mice (Charles River, Barcelona,
Spain), weighing 20-25 g, were kept under specific pathogen-free
(SPF) conditions in an isolator (Harlan Iberica, Barcelona, Spain)
at constant temperature (22.degree. C.) in a 12-hour of light/dark
cycle. Two mice acted as littermates. Mice had free access to
sterilized diets (laboratory's standard diet; Harlan Iberica,
Barcelona, Spain) and to drinking fluid. Mice were kept for 7 days
in the facility before the beginning of the experiments
(quarantine). Mice were allocated to one of four groups: a)
probiotic composition of the invention+DSS (n=8); b) VSL#3 (VSL
Pharmaceuticals, USA)+DSS (n=8); c) vehicle+DSS (n=8); and d)
vehicle+healthy controls (n=6).
[0090] Probiotics (or vehicle) were administered by oral gavage for
ten days before (day -10) starting DSS administration (day 0). Each
mouse received daily 2.5.times.10.sup.8 cfus of probiotic in 0.1 mL
of sterilized water (vehicle) by gavage. Non-probiotic treated mice
received the same volume of vehicle (distilled water with 15% skim
milk and 4% sucrose).
[0091] Mice were fed with 3% (w/v) DSS (mol. Wt 40 kD, Applichem
Lifescience, VWR, Barcelona) in their drinking water for 5 days
(days 0 to 4, followed by three days without DSS) according to a
previously described method with minor modifications (Okayasu I, et
al. Gastroenterol 1990). Healthy controls never received DSS.
[0092] Clinical signs were daily monitored. Disease Activity Index
was calculated according to the following formula and
interpretation table:
DAI=Score.sub.Weight Loss+Score.sub.Stool Blood+Score.sub.Stool
Consistency
[0093] Results are shown in TABLE 8:
TABLE-US-00008 TABLE 8 Weight Loss Score Stool Blood Score Stool
Consistency Score <1% 0 Absence 0 Formed and hard 0 1-5% 1
Formed but soft 1 5-10% 2 Presence 2 Loose stools 2 10-15%.sup. 3
Mild diarrhea (watery) 3 >15% 4 Gross 4 Gross diarrhea 4
bleeding
[0094] The Disease Activity Index score used hereby was first
described by Cooper et al. and combines several clinical symptoms
into one normalized score (Cooper H. S. et al., 1993). Maximum
score is 12 points. This score has been widely used to evaluate the
efficacy of experimental treatments--probiotics among them--in
animal models of IBD (Fitzpatrick L. R. et al., 2007; Grabig A. et
al., 2006; Sasaki M. et al., 2005).
[0095] After being sacrificed by anesthetic overdose of inhaled
Halothane (Fluotane.RTM., Zeneca Ltd, UK), colon samples of the
animals were harvested and washed in cold PBS. Colon weight/length
ratio was recorded. Samples for cytokine measurements were frozen
in liquid nitrogen and homogenized in 1 mL of cold PBS with
inhibitor protein cocktail (Sigma-Aldrich Chem., Spain) and
centrifuged (15000.times.g, 10 min). IL-6, IL-10, IL23p19,
IFN-.gamma. and TNF-a concentrations were measured in colonic
supernatants using Cytokine 6-Plex Assay (Procarta.TM. Cytokine
Profiling Kit, PANOMICS, Spain) for the Luminex.RTM. Platform
(Luminex.RTM. Co, Austin, USA). Fluorescent microparticle beads,
pre-spotted with cytokine-specific antibodies, were incubated with
50 .mu.L 1:5 diluted supernatant. Specific-biotinylated secondary
antibodies and streptavidin-phycoerythrin (S-PE) were sequentially
added. Data were expressed as pg of cytokine per mg of protein
(Quick Start Bradford Protein Assay, BIO-RAD, CA, USA). All
measurements were done in duplicate.
B) Results
Disease Activity Index
[0096] As shown in FIG. 2, the group receiving the probiotic
formula of the invention displayed a significant improvement of the
clinical symptoms when compared to DSS-treated controls, as
assessed by the Disease Activity Index (p<0.05, two-tail ANOVA
with Tukey-Kramer post-hoc test). Healthy controls also displayed a
lower Disease Activity Index (p<0.05).
Cytokine Levels
[0097] Analysis of various cytokines in the intestinal mucosa
revealed that probiotic formula of the invention significantly
decreased IL-6 when compared to DSS-treated controls (p<0.01,
two-tail ANOVA with Tukey-Kramer post-hoc test), while the effect
of commercial probiotic formula VSL#3 failed to achieve
significance (p>0.05). IL-6 is a marker of acute inflammation
(FIG. 3). As expected, levels of IL-6 in healthy controls were also
significantly lower than DSS-treated controls (p<0.05). A
statistically significant correlation was found between clinical
symptoms (DAI score) and IL-6 levels in the intestinal mucosa
(p<0.05, Spearman ranks test) (data not shown). On the other
hand, correlation between clinical symptoms and IL-10, IL-23,
TNF.alpha. or IFN.gamma. was not statistically significant, and the
probiotic formula of the invention did not significantly affect the
levels of these cytokines.
11. In Vivo Effect on Spontaneous Gut Inflammation
A) Methods
[0098] The therapeutic effect of probiotic formula of the invention
was also investigated in the IL-10 knock-out mouse model. This
model spontaneously develops bowel inflammation at 8 to 12 weeks of
age, with a penetrance of 80-90% (Scheinin T. et al., 2003).
Interleukin 10 (IL-10) is an important regulatory cytokine that
supresses effector functions of macrophage/monocytes, T helper 1
(Th1) cells, and natural killer cells. In addition, IL-10 augments
proliferation and differentiation of B cells. Murine models lacking
the IL-10 gene spontaneously develop inflammatory bowel disease and
gastrointestinal tumors. The gastrointestinal flora has been
implicated in the pathogenesis of these disease states as germ free
animals do not develop disease. The IL-10 knock-out mouse has been
widely used to evaluate new therapeutic options for IBD.
[0099] Six-week-old C57B6J IL-10-deficient or wild type mice
(Charles River, Barcelona, Spain) were kept under specific
pathogen-free (SPF) conditions in an isolator (Harlan Iberica,
Barcelona, Spain) at constant temperature (22.degree. C.) in a
12-hour of light/dark cycle. Mice had free access to sterilized
diets (diet based in AIN-93 for maintenance of mice was composed by
12% of water, 14.5% of protein, 4% of fat, 4.5% of fibre and 4.7%
of ash; Harlan Interfauna Iberica S.A., Barcelona, Spain) and to
drinking fluid.
[0100] Mice were allocated to one of three groups: a) probiotic
formula I.3.1 (n=12 IL-10-/-; n=5 wild type); b) VSL#3 (n=12
IL-10-/-; n=5 wild type); and c) vehicle (n=12 IL-10-/-; n=5 wild
type). Each mouse in groups "a" and "b" received daily 10.sup.9 CFU
of probiotic in sterilized drinking water (vehicle). Non-probiotic
treated mice (Placebo group) received vehicle alone. Probiotics (or
vehicle) were administered during ten weeks. Clinical signs were
daily monitored. Disease Activity Index (Cooper H. S. et al., 1993)
was calculated as in the model of DSS-induced gut inflammation (see
above).
[0101] Sixteen-weeks-old mice were sacrificed by anaesthetic
overdose of inhaled Halothane (Fluotane.RTM., Zeneca Ltd, UK).
Colon samples of the animals were harvested and washed in cold PBS.
Blood samples were also collected by cardiac puncture to analyze
hematocrit and hemoglobin concentration (Coulter MaxM Analyzer with
autoloader, Izasa, Spain). Colon weight/length ratio was recorded.
Then, colons were frozen in liquid nitrogen and cytokines IL-6, and
IFN.gamma. were measured using the same protocol as in the model of
DSS-induced gut inflammation (see above).
B) Results
Disease Activity Index
[0102] As shown in FIG. 4, a significant delay on the onset of the
clinical symptoms was observed both in the group treated with the
composition of the invention and the VSL#3 commercial formula when
compared to vehicle-treated controls (p<0.01, two-tail ANOVA
with Tukey-Kramer post-hoc test). Additionally, treated groups
tended to display lower Disease Activity Index scores, although the
difference did not reach significance (data not shown).
Cytokine Levels
[0103] Analysis of various cytokines revealed that probiotic
composition of the invention significantly decreased IFN.gamma.
levels in knockout mice when compared both to vehicle-treated
knock-outs (p<0.01, two-tail nonparametric ANOVA with Dunn
post-hoc test) and to commercial formula VLS#3 (p<0.05). In
fact, as it is shown in FIG. 5, the levels of IFN.gamma. attained
the same levels as those of wild-type healthy controls.
Additionally, as it is derived from FIG. 6, there was also a clear
tendency of probiotic formulas to reduce the levels of IL-6,
although results did not reach significance due to the large
standard deviation among vehicle knockout mice.
[0104] A significant correlation was found between the severity of
clinical symptoms (Disease Activity Index) and the levels of
IFN.gamma. at the end of the study in colonic mucosa measured after
the sacrifice (p<0.05, Spearman rank's test) (data not
shown).
Safety of the Probiotic Formula
[0105] Clinical signs (weight loss, altered behavior, fur aspect,
diarrhoea and stool blood) were daily monitored in wild-type mice
receiving daily doses of the probiotic formula of the invention,
the VSL#3 formula or vehicle during 10 weeks. No morbidity signs
were detected during the study. Upon sacrifice, animals were
subjected to gross necropsy. Analysis of all major cavities and
organs did not reveal any pathological alteration (data not
shown).
12. In Vivo Efficacy on IBS Subjects
A) Methods
Study Design
[0106] A multicenter randomized, double-blind, placebo-controlled
clinical trial to study the effect of the composition of the
invention on IBS patients was conducted.
[0107] Hydroxymethyl propyl cellulose capsules were filled with:
(1) 150 mg of maltodextrin, (2) 5 mg of magnesium stearate, (3) 5
mg of silicon dioxide and (4) 200 mg of a 1:1:1 mixture of the
three strains of the invention (at a concentration 510.sup.10
cfus/capsule). In addition a placebo was made with the same list of
excipients and amounts but without including the composition of the
invention. Content of the capsules throughout the study ranged from
510.sup.10 to 110.sup.10 cfus.
[0108] 33 eligible adult patients of both sexes meeting Rome III
criteria for irritable bowel syndrome (Longstreth G. F. et al.,
2006) were enrolled and randomly allocated to one of the following
treatments for 6 weeks: a) the capsule including the composition of
the invention once daily (n=18); and b) the placebo capsule once
daily (n=15). The study was conducted according to the Helsinki
Declaration for Clinical Trials and approved by the appropriate
Ethical Committee.
Efficacy Assessment
[0109] The primary endpoint of this study was the global effect on
health-related quality of life (hereinafter also referred as
"HRQOL"), as assessed using a specific questionnaire for IBS: the
validated Spanish version of the IBSQOL questionnaire (Badia X. et
al., 2000). Following the guidelines from the Spanish
Gastroenterology Association, scores were standardized to a 0-100
scale. The secondary endpoint was the assessment of anxiety related
to gastrointestinal sensations and symptoms by means of the
validated Visceral Sensitivity Index questionnaire (hereinafter
also referred as "VSI") (Labus J. S. et al., 2004). Volunteers were
asked to fill these questionnaires at baseline (day 1), on day 21
and on day 42. Data was assessed per intent to treat analysis. The
results are shown in FIGS. 7 and 8.
B) Results
Baseline Characteristics
[0110] No significant differences were evident between the groups
in terms of baseline characteristics, as can be seen in Table 9,
indicating that subjects in both groups were comparable in terms of
the variables assessed. Groups were also comparable in terms of
baseline standard blood biochemical parameters, anthropometric
parameters, age and sex.
TABLE-US-00009 TABLE 9 Baseline scores for the two treatment groups
Capsule including the Placebo Group composition of the invention (n
= 15) IBSQOL 45.7 .+-. 7.9 48.2 .+-. 19.2 VSI 34.9 .+-. 13.3 41.2
.+-. 11.8
Improvement of Health-Related Quality of Life (FIG. 7)
[0111] The composition of the invention significantly improved
health-related quality of life compared to placebo when assessed
both after 21 days and 42 days of treatment (p<0.05, T-test).
Therefore, it is demonstrated that the composition of the present
invention significantly reduces morbility and improves the quality
of life of IBS subjects well above the placebo effect. The positive
effects of the composition include the food-related distress,
anxiety, interference in daily activities and sleep disturbance
domains of the HRQOL questionnaire. The improvements in these
scales suggest a reduction in abdominal pain, discomfort and
altered bowel habits. To our knowledge, this is the first time that
it is shown a probiotic composition displaying a significant effect
on the global health-related quality of life of IBS patients.
Improvement in the Visceral Sensitivity Index (FIG. 8)
[0112] The composition of the present invention significantly
reduced the gastrointestinal symptom-specific visceral sensitivity
of IBS subjects compared to placebo. The effect was close to
significant after 21 days of treatment, and clearly significant
after 42 days of treatment (p<0.01, T-test), further confirming
the usefulness of the composition of the present invention in
treating IBS. The most pronounced improvement was observed in
abdominal discomfort and bloating-related items of the
questionnaire. Particularly, TABLE 10 shows the numbers of subjects
reporting a significant improvement related to bloating and
distension (as defined by an increase of at least two points
compared to baseline in the 6-point scale of the VSI questionnaire
that measures bloating and distension-related anxiety) at the end
of the treatment. The difference between the two groups is
statistically significant (p<0.05, Fisher's exact test).
TABLE-US-00010 TABLE 10 Effect on abdominal bloating and
distension-related anxiety, according to the VSI questionnaire,
after 42 days of treatment Capsule including the Bloating and
distension- composition of the invention Placebo related anxiety (n
= 18) (n = 15) Subjects reporting an 7 1 improvement compared to
baseline Subjects not reporting 11 14 an improvement compared to
baseline
[0113] From the results obtained, therefore it is concluded that
the composition of the invention is effective in treating abdominal
distension and bloating.
13. Effect on Abdominal Bloating and Reduced Bowel Movements
[0114] A 25 years old woman was suffering from chronic abdominal
bloating and altered intestinal motility, reporting sometimes as
few as on bowel movement per week. Diagnostic revealed a hypotonic
and hypokinetic stomach, without evidence of other structural
alterations in the gastrointestinal tract.
[0115] The patient undertook a treatment of one capsule per day (as
those described in example 12). After one week of treatment the
patient reported a significant reduction of abdominal bloating and
distension and a normalization of bowel habits. Symptoms reappeared
after stopping the treatment for a few days. After restarting of
the treatment in the form of one capsule every two days, the
patient reported again a noticeable and long-lasting positive
effect both on bloating and bowel habits.
[0116] This example further supports the use of the composition of
the invention to treat abdominal bloating and altered intestinal
motility in subjects which are not classified as having Irritable
Bowel Syndrome.
BIBLIOGRAPHIC REFERENCES
[0117] Altschul, S. F., et al. "Basic local alignment search tool",
J. Mol. Biol., 1990, vol. 215, p. 403-410. [0118] Anadon, A., et
al. "Opinion of the Scientific Panel on Additives and Products or
Substances used in Animal Feed on the updating of the criteria used
in the assessment of bacteria for resistance to antibiotics of
human veterinary importance", The EFSA Journal, 2005, vol. 233, p.
1-12. [0119] Andreoletti, O., et al. "The maintenance of the list
of QPS microorganisms intentionally added to food or feed. Question
no: EFSA-Q-2008-006", The EFSA Journal, 2008, vol. 923, p. 1-48.
[0120] Araya, M., et al. (2002) Guidelines for the Evaluation of
Probiotics in Food--Joint FAO/WHO Working Group. FAO/WHO, Ontario,
Canada. [0121] Badia, X., et al. "Adaptacion al espanol del
cuestionario IBSQoL para la medicion de la calidad de vida en
pacientes con sindrome de intestino irritable.", Rev Esp Enferm
Dig, 2000, vol. 92, p. 637-643. [0122] Bories, G., et al. "Update
on the criteria used in the assessment of bacterial resistance to
antibiotics of human or veterinary importance", The EFSA Journal,
2008, vol. 732, p. 1-15. [0123] Collado, M., et al. "Probiotic
Strains and Their Combination Inhibit In Vitro Adhesion of
Pathogens to Pig Intestinal Mucosa", Current Microbiology, 2007,
vol. 55, p. 260-265. [0124] Cooper, H. S., et al.
"Clinicopathologic study of dextran sulfate sodium experimental
murine colitis", Lab Invest., 1993, vol. 69, p. 238-249. [0125]
D'Argenio, G. and Mazzacca, G. "Short-chain fatty acid in the human
colon. Relation to inflammatory bowel diseases and colon cancer",
Adv Exp Med Bbl, 1999, vol. 472, p. 149-158. [0126] Daniel, C., et
al. "Selecting Lactic Acid Bacteria for Their Safety and
Functionality by Use of a Mouse Colitis Model", Appl. Environ.
Microbiol., 2006, vol. 72, p. 5799-5805. [0127] Dean, B. B., et al.
"Impairment in work productivity and health-related quality of life
in patients with IBS", Am J Manag Care., 2005, vol. 11, p. S17-26.
[0128] Fitzpatrick, L. R., et al. "Effects of the probiotic
formulation VSL#3 on colitis in weanling rats", J Pediatr
Gastroenterol Nutr., 2007, vol. 44, p. 561-570. [0129] Fukumoto,
S., et al. "Short-chain fatty acids stimulate colonic transit via
intraluminal 5-HT release in rats", Am J Physiol Regul Integr Comp
Physiol, 2003, vol. 284, p. R1269-1276. [0130] Grabig, A., et al.
"Escherichia coli Strain Nissle 1917 Ameliorates Experimental
Colitis via Toll-Like Receptor 2- and Toll-Like Receptor
4-Dependent Pathways", Infect. Immun., 2006, vol. 74, p. 4075-4082.
[0131] Guarner, F. and Schaafsma, G. J. "Probiotics", Int J Food
Microbiol., 1998, vol. 39, p. 237-238. [0132] Jacobsen, C. N., et
al. "Screening of Probiotic Activities of Forty-Seven Strains of
Lactobacillus spp. by In Vitro Techniques and Evaluation of the
Colonization Ability of Five Selected Strains in Humans", Appl.
Environ. Microbiol., 1999, vol. 65, p. 4949-4956. [0133] Katz, J.,
A. "Management of inflammatory bowel disease in adults", Journal of
Digestive Diseases, 2007, vol. 8, p. 65-71. [0134] Labus, J. S., et
al. "The Visceral Sensitivity Index: development and validation of
a gastrointestinal symptom-specific anxiety scale", Alimentary
Pharmacology & Therapeutics, 2004, vol. 20, p. 89-97. [0135]
Longstreth, G. F., et al. "Functional Bowel Disorders",
Gastroenterology, 2006, vol. 130, p. 1480-1491. [0136] Maslowski,
K. M., et al. "Regulation of inflammatory responses by gut
microbiota and chemoattractant receptor GPR43", Nature, 2009, vol.
461, p. 1282-1286. [0137] Okayasu, I., et al. "A novel method in
the induction of reliable experimental acute and chronic ulcerative
colitis in mic", Gastroenterology., 1990, vol. 98, p. 694-702.
[0138] Pathmakanthan, S., et al. "Lactobacillus plantarum 299:
Beneficial in vitro immunomodulation in cells extracted from
inflamed human colon", Journal of Gastroenterology and Hepatology,
2004, vol. 19, p. 166-173. [0139] Rezaie, A., et al. "Oxidative
Stress and Pathogenesis of Inflammatory Bowel Disease: An
Epiphenomenon or the Cause?", Digestive Diseases and Sciences,
2007, vol. 52, p. 2015-2021. [0140] Rodas, A. M., et al.
"Polyphasic study of wine Lactobacillus strains: taxonomic
implications", Int J Syst Evol Microbiol, 2005, vol. 55, p.
197-207. [0141] Roessner, A., et al. "Oxidative stress in
ulcerative colitis-associated carcinogenesis", Pathol Res Pract.,
2008, vol. 204, p. 511-524. [0142] Sasaki, M., et al. "Reversal of
experimental colitis disease activity in mice following
administration of an adenoviral IL-10 vector", Journal of
Inflammation, 2005, vol. 2, p. 13. [0143] Scheinin, T., et al.
"Validation of the interleukin-10 knockout mouse model of colitis:
antitumour necrosis factor-antibodies suppress the progression of
colitis.", Clin Exp Immunol, 2003, vol. 133, p. 38-43. [0144]
Tazoe, H., et al. "Roles of short-chain fatty acids receptors,
GPR41 and GPR43 on colonic functions", J Physiol Pharmacol., 2008,
vol. 59, p. 251-262. [0145] Tedelind, S., et al. "Anti-inflammatory
properties of the short-chain fatty acids acetate and propionate: a
study with relevance to inflammatory bowel disease", World J
Gastroenterol., 2007, vol. 13, p. 2826-2832. [0146] Vanhoutvin, S.
A., et al. "The effects of butyrate enemas on visceral perception
in healthy volunteers", Neurogastroenterology & Motility, 2009,
vol. 21, p. 952-e976. [0147] Wang, Q., et al. "Naive Bayesian
Classifier for Rapid Assignment of rRNA Sequences into the New
Bacterial Taxonomy", Appl. Environ. Microbiol., 2007, vol. 73, p.
5261-5267. [0148] Weisburg, W. G., et al. "16S ribosomal DNA
amplification for phylogenetic study", J. Bacteriol., 1991, vol.
173, p. 697-703. [0149] Yamada, Y., et al. "A comparative analysis
of two models of colitis in rats", Gastroenterology, 1992, vol.
102, p. 1524-1534. [0150] Zhang, L., et al. "Alive and Dead
Lactobacillus rhamnosus GG Decrease Tumor Necrosis
Factor-alpha-Induced Interleukin-8 Production in Caco-2 Cells", J.
Nutr., 2005, vol. 135, p. 1752-1756. [0151] WO96/29083 [0152] EP
554418 [0153] EP 415941 [0154] U.S. Pat. No. 7,195,906
Sequence CWU 1
1
4120DNAArtificialforward Eub27f primer 1agagtttgat cctggctcag
20219DNAArtificialreverse Eub1492r primer 2ggttaccttg ttacgactt
19357DNAArtificialforward 357f primer 3cgcccgccgc gccccgcgcc
cggcccgccg cccccgcccc cctacgggag gcagcag 57420DNAArtificialreverse
907r primer 4ccgtcaattc ctttgagttt 20
* * * * *
References