U.S. patent application number 13/672437 was filed with the patent office on 2013-04-18 for massive parallel method for decoding dna and rna.
This patent application is currently assigned to The Trustees of Columbia University in the City of New York. The applicant listed for this patent is The Trustees of Columbia University in the City of. Invention is credited to John Robert Edwards, Yasuhiro Itagaki, Jingyue Ju, Zengmin Li.
Application Number | 20130096015 13/672437 |
Document ID | / |
Family ID | 26972030 |
Filed Date | 2013-04-18 |
United States Patent
Application |
20130096015 |
Kind Code |
A1 |
Ju; Jingyue ; et
al. |
April 18, 2013 |
Massive Parallel Method For Decoding DNA And RNA
Abstract
This invention provides methods for attaching a nucleic acid to
a solid surface and for sequencing nucleic acid by detecting the
identity of each nucleotide analogue after the nucleotide analogue
is incorporated into a growing strand of DNA in a polymerase
reaction. The invention also provides nucleotide analogues which
comprise unique labels attached to the nucleotide analogue through
a cleavable linker, and a cleavable chemical group to cap the --OH
group at the 3'-position of the deoxyribose.
Inventors: |
Ju; Jingyue; (Englewood
Cliffs, NJ) ; Li; Zengmin; (New York, NY) ;
Edwards; John Robert; (New York, NY) ; Itagaki;
Yasuhiro; (New York, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Trustees of Columbia University in the City of; |
New York |
NY |
US |
|
|
Assignee: |
The Trustees of Columbia University
in the City of New York
New York
NY
|
Family ID: |
26972030 |
Appl. No.: |
13/672437 |
Filed: |
November 8, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13339089 |
Dec 28, 2011 |
|
|
|
13672437 |
|
|
|
|
12804284 |
Jul 19, 2010 |
8088575 |
|
|
13339089 |
|
|
|
|
11810509 |
Jun 5, 2007 |
7790869 |
|
|
12804284 |
|
|
|
|
10702203 |
Nov 4, 2003 |
7345159 |
|
|
11810509 |
|
|
|
|
09972364 |
Oct 5, 2001 |
6664079 |
|
|
10702203 |
|
|
|
|
09684670 |
Oct 6, 2000 |
|
|
|
09972364 |
|
|
|
|
60300894 |
Jun 26, 2001 |
|
|
|
Current U.S.
Class: |
506/4 ; 435/6.11;
506/32; 506/38; 536/26.26 |
Current CPC
Class: |
C12Q 2525/186 20130101;
C12Q 1/686 20130101; C12Q 2535/122 20130101; C12Q 2535/101
20130101; C40B 40/00 20130101; C12Q 2525/117 20130101; C07B 2200/11
20130101; C12Q 1/68 20130101; C07H 19/10 20130101; C12Q 2563/107
20130101; C12Q 1/6874 20130101; C07H 21/00 20130101; C12Q 1/6876
20130101; C12Q 2565/501 20130101; C12Q 1/6869 20130101; C12Q 1/6872
20130101; C07H 19/14 20130101; C12Q 1/686 20130101; C12Q 2565/501
20130101; C12Q 2563/107 20130101; C12Q 1/6874 20130101; C12Q
2535/101 20130101; C12Q 1/6869 20130101; C12Q 2525/186 20130101;
C12Q 2535/122 20130101 |
Class at
Publication: |
506/4 ; 435/6.11;
506/32; 536/26.26; 506/38 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for sequencing a nucleic acid by detecting the identity
of a nucleotide analogue after the nucleotide analogue is
incorporated into a growing strand of DNA in a polymerase reaction,
which comprises the following steps: (i) attaching a 5' end of the
nucleic acid to a solid surface; (ii) attaching a primer to the
nucleic acid attached to the solid surface; (iii) adding a
polymerase and one or more different nucleotide analogues to the
nucleic acid to thereby incorporate a nucleotide analogue into the
growing strand of DNA, wherein the incorporated nucleotide analogue
terminates the polymerase reaction and wherein each different
nucleotide analogue comprises (a) a base selected from the group
consisting of adenine, guanine, cytosine, thymine, and uracil, and
their analogues; (b) a unique label attached through a cleavable
linker to the base or to an analogue of the base; (c) a
deoxyribose; and (d) a cleavable chemical group to cap an --OH
group at a 3'-position of the deoxyribose; (iv) washing the solid
surface to remove unincorporated nucleotide analogues; (v)
detecting the unique label attached to the nucleotide analogue that
has been incorporated into the growing strand of DNA, so as to
thereby identify the incorporated nucleotide analogue; (vi) adding
one or more chemical compounds to permanently cap any unreacted
--OH group on the primer attached to the nucleic acid or on a
primer extension strand formed by adding one or more nucleotides or
nucleotide analogues to the primer; (vii) cleaving the cleavable
linker between the nucleotide analogue that was incorporated into
the growing strand of DNA and the unique label; (viii) cleaving the
cleavable chemical group capping the --OH group at the 3'-position
of the deoxyribose to uncap the --OH group, and washing the solid
surface to remove cleaved compounds; and (ix) repeating steps (iii)
through (viii) so as to detect the identity of a newly incorporated
nucleotide analogue into the growing strand of DNA; wherein if the
unique label is a dye, the order of steps (v) through (vii) is:
(v), (vi), and (vii); and wherein if the unique label is a mass
tag, the order of steps (v) through (vii) is: (vi), (vii), and
(v).
2. The method of claim 1, wherein the solid surface is glass,
silicon, or gold.
3. The method of claim 1, wherein the solid surface is a magnetic
bead, a chip, a channel in a chip, or a porous channel in a
chip.
4. The method of claim 1, wherein the step of attaching the nucleic
acid to the solid surface comprises: (i) coating the solid surface
with a phosphine moiety, (ii) attaching an azido group to the 5'
end of the nucleic acid, and (iii) immobilizing the 5' end of the
nucleic acid to the solid surface through interaction between the
phosphine moiety on the solid surface and the azido group on the 5'
end of the nucleic acid.
5. The method of claim 4, wherein the step of coating the solid
surface with the phosphine moiety comprises: (i) coating the
surface with a primary amine, and (ii) covalently coupling a
N-hydroxysuccinimidyl ester of triarylphosphine with the primary
amine.
6. The method of claim 1, wherein the nucleic acid that is attached
to the solid surface is a single-stranded DNA.
7. The method of claim 1, wherein the nucleic acid that is attached
to the solid surface in step (i) is a double-stranded DNA, wherein
only one strand is directly attached to the solid surface, and
wherein the strand that is not directly attached to the solid
surface is removed by denaturing before proceeding to step
(ii).
8. The method of claim 1, wherein the nucleic acid that is attached
to the solid surface is a RNA, and the polymerase in step (iii) is
reverse transcriptase.
9. The method of claim 1, wherein the primer is attached to a 3'
end of the nucleic acid in step (ii) and wherein the attached
primer comprises a stable loop and an --OH group at a 3'-position
of a deoxyribose capable of self-priming in the polymerase
reaction.
10. The method of claim 1, wherein the step of attaching the primer
to the nucleic acid comprises hybridizing the primer to the nucleic
acid or ligating the primer to the nucleic acid.
11. The method of claim 1, wherein one or more of four different
nucleotide analogues is added in step (iii), wherein each different
nucleotide analogue comprises a different base selected from the
group consisting of thymine or uracil or an analogue of thymine or
uracil, adenine or an analogue of adenine, cytosine or an analogue
of cytosine, and guanine or an analogue of guanine, and wherein
each of the four different nucleotide analogues comprises a unique
label.
12. The method of claim 1, wherein the cleavable chemical group
that caps the --OH group at the 3'-position of the deoxyribose in
the nucleotide analogue is --CH.sub.2OCH.sub.3 or
--CH.sub.2CH.dbd.CH.sub.2.
13. The method of claim 1, wherein the unique label that is
attached to the nucleotide analogue is a fluorescent moiety or a
fluorescent semiconductor crystal.
14. The method of claim 13, wherein the fluorescent moiety is
selected from the group consisting of 5-carboxyfluorescein,
6-carboxyrhodamine-6G, N,N,N',N'-tetramethyl-6-carboxyrhodamine,
and 6-carboxy-X-rhodamine.
15. The method of claim 1, wherein the unique label that is
attached to the nucleotide analogue is a fluorescence energy
transfer tag which comprises an energy transfer donor and an energy
transfer acceptor.
16. The method of claim 15, wherein the energy transfer donor is
5-carboxyfluorescein or cyanine, and wherein the energy transfer
acceptor is selected from the group consisting of
dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G,
dichloro-N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
dichloro-6-carboxy-X-rhodamine.
17. The method of claim 1, wherein the unique label that is
attached to the nucleotide analogue is a mass tag that can be
detected and differentiated by a mass spectrometer.
18. The method of claim 17, wherein the mass tag is selected from
the group consisting of a 2-nitro-.alpha.-methyl-benzyl group, a
2-nitro-.alpha.-methyl-3-fluorobenzyl group, a
2-nitro-.alpha.-methyl-3,4-difluorobenzyl group, and a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl group.
19. The method of claim 1, wherein the unique label is attached
through a cleavable linker to a 5-position of cytosine or thymine
or to a 7-position of deaza-adenine or deaza-guanine.
20. The method of claim 1, wherein the cleavable linker between the
unique label and the nucleotide analogue is cleaved by a means
selected from the group consisting of one or more of a physical
means, a chemical means, a physical chemical means, heat, and
light.
21. The method of claim 20, wherein the cleavable linker is a
photocleavable linker which comprises a 2-nitrobenzyl moiety.
22. The method of claim 1, wherein the cleavable chemical group
used to cap the --OH group at the 3'-position of the deoxyribose is
cleaved by a means selected from the group consisting of one or
more of a physical means, a chemical means, a physical chemical
means, heat, and light.
23. The method of claim 1, wherein the chemical compounds added in
step (vi) to permanently cap any unreacted --OH group on the primer
attached to the nucleic acid or on the primer extension strand are
a polymerase and one or more different dideoxynucleotides or
analogues of dideoxynucleotides.
24. The method of claim 23, wherein the different
dideoxynucleotides are selected from the group consisting of
2',3'-dideoxyadenosine 5'-triphosphate, 2',3'-dideoxyguanosine
5'-triphosphate, 2',3'-dideoxycytidine 5'-triphosphate,
2',3'-dideoxythymidine 5'-triphosphate, 2',3'-dideoxyuridine
5'-triphosphase, and their analogues.
25. The method of claim 1, wherein a polymerase and one or more of
four different dideoxynucleotides are added in step (vi), and
wherein each different dideoxynucleotide is selected from the group
consisting of 2',3'-dideoxyadenosine 5'-triphosphate or an analogue
of 2',3'-dideoxyadenosine 5'-triphosphate; 2',3'-dideoxyguanosine
5'-triphosphate or an analogue of 2',3'-dideoxyguanosine
5'-triphosphate; 2',3'-dideoxycytidine 5'-triphosphate or an
analogue of 2',3'-dideoxycytidine 5'-triphosphate; and
2',3'-dideoxythymidine 5'-triphosphate or 2',3'-dideoxyuridine
5'-triphosphase or an analogue of 2',3'-dideoxythymidine
5'-triphosphate or an analogue of 2',3'-dideoxyuridine
5'-triphosphase.
26. The method of claim 17, wherein the mass tag is detected using
a parallel mass spectrometry system which comprises a plurality of
atmospheric pressure chemical ionization mass spectrometers for
parallel analysis of a plurality of samples comprising mass
tags.
27. A method of simultaneously sequencing a plurality of different
nucleic acids, which comprises simultaneously applying the method
of claim 1 to the plurality of different nucleic acids.
28. Use of the method of claim 1 or 27 for detection of single
nucleotide polymorphisms, genetic mutation analysis, serial
analysis of gene expression, gene expression analysis,
identification in forensics, genetic disease association studies,
DNA sequencing, genomic sequencing, translational analysis, or
transcriptional analysis.
29. A method of attaching a nucleic acid to a solid surface which
comprises: (i) coating the solid surface with a phosphine moiety,
(ii) attaching an azido group to a 5' end of the nucleic acid, and
(iii) immobilizing the 5' end of the nucleic acid to the solid
surface through interaction between the phosphine moiety on the
solid surface and the azido group on the 5' end of the nucleic
acid.
30. The method of claim 29, wherein the step of coating the solid
surface with the phosphine moiety comprises: (i) coating the
surface with a primary amine, and (ii) covalently coupling a
N-hydroxysuccinimidyl ester of triarylphosphine with the primary
amine.
31. The method of claim 29, wherein the solid surface is glass,
silicon, or gold.
32. The method of claim 29, wherein the solid surface is a magnetic
bead, a chip, a channel in a chip, or a porous channel in a
chip.
33. The method of claim 29, wherein the nucleic acid that is
attached to the solid surface is a single-stranded DNA, a
double-stranded DNA or a RNA.
34. The method of claim 33, wherein the nucleic acid is a
double-stranded DNA and only one strand is attached to the solid
surface.
35. The method of claim 34, wherein the strand of the
double-stranded DNA that is not attached to the solid surface is
removed by denaturing.
36. Use of the method of claim 29 for gene expression analysis,
microarray based gene expression analysis, mutation detection,
translational analysis, or transcriptional analysis.
37. A nucleotide analogue which comprises: (a) a base selected from
the group consisting of adenine or an analogue of adenine, cytosine
or an analogue of cytosine, guanine or an analogue of guanine,
thymine or an analogue of thymine, and uracil or an analogue of
uracil; (b) a unique label attached through a cleavable linker to
the base or to an analogue of the base; (c) a deoxyribose; and (d)
a cleavable chemical group to cap an --OH group at a 3'-position of
the deoxyribose.
38. The nucleotide analogue of claim 37, wherein the cleavable
chemical group that caps the --OH group at the 3'-position of the
deoxyribose is --CH.sub.2OCH.sub.3 or
--CH.sub.2CH.dbd.CH.sub.2.
39. The nucleotide analogue of claim 37, wherein the unique label
is a fluorescent moiety or a fluorescent semiconductor crystal.
40. The nucleotide analogue of claim 39, wherein the fluorescent
moiety is selected from the group consisting of
5-carboxyfluorescein, 6-carboxyrhodamine-6G,
N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
6-carboxy-X-rhodamine.
41. The nucleotide analogue of claim 37, wherein the unique label
is a fluorescence energy transfer tag which comprises an energy
transfer donor and an energy transfer acceptor.
42. The nucleotide analogue of claim 41, wherein the energy
transfer donor is 5-carboxyfluorescein or cyanine, and wherein the
energy transfer acceptor is selected from the group consisting of
dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G,
dichloro-N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
dichloro-6-carboxy-X-rhodamine.
43. The nucleotide analogue of claim 37, wherein the unique label
is a mass tag that can be detected and differentiated by a mass
spectrometer.
44. The nucleotide analogue of claim 43, wherein the mass tag is
selected from the group consisting of a
2-nitro-.alpha.-methyl-benzyl group, a
2-nitro-.alpha.-methyl-3-fluorobenzyl group, a
2-nitro-.alpha.-methyl-3,4-difluorobenzyl group, and a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl group.
45. The nucleotide analogue of claim 37, wherein the unique label
is attached through a cleavable linker to a 5-position of cytosine
or thymine or to a 7-position of deaza-adenine or
deaza-guanine.
46. The nucleotide analogue of claim 37, wherein the linker between
the unique label and the nucleotide analogue is cleavable by a
means selected from the group consisting of one or more of a
physical means, a chemical means, a physical chemical means, heat,
and light.
47. The nucleotide analogue of claim 46, wherein the cleavable
linker is a photocleavable linker which comprises a 2-nitrobenzyl
moiety.
48. The nucleotide analogue of claim 37, wherein the cleavable
chemical group used to cap the --OH group at the 3'-position of the
deoxyribose is cleavable by a means selected from the group
consisting of one or more of a physical means, a chemical means, a
physical chemical means, heat, and light.
49. The nucleotide analogue of claim 37, wherein the nucleotide
analogue is selected from the group consisting of: ##STR00005##
wherein Dye.sub.1, Dye.sub.2, Dye.sub.3, and Dye.sub.4 are four
different dye labels; and wherein R is a cleavable chemical group
used to cap the --OH group at the 3'-position of the
deoxyribose.
50. The nucleotide analogue of claim 49, wherein the nucleotide
analogue is selected from the group consisting of: ##STR00006##
wherein R is --CH.sub.2OCH.sub.3 or --CH.sub.2CH.dbd.CH.sub.2.
51. The nucleotide analogue of claim 37, wherein the nucleotide
analogue is selected from the group consisting of: ##STR00007##
wherein Tag.sub.1, Tag.sub.2, Tag.sub.3, and Tag.sub.4 are four
different mass tag labels; and wherein R is a cleavable chemical
group used to cap the --OH group at the 3'-position of the
deoxyribose.
52. The nucleotide analogue of claim 51, wherein the nucleotide
analogue is selected from the group consisting of: ##STR00008##
wherein R is --CH.sub.2OCH.sub.3 or --CH.sub.2CH.dbd.CH.sub.2.
53. Use of the nucleotide analogue of claim 37 for detection of
single nucleotide polymorphisms, genetic mutation analysis, serial
analysis of gene expression, gene expression analysis,
identification in forensics, genetic disease association studies,
DNA sequencing, genomic sequencing, translational analysis, or
transcriptional analysis.
54. A parallel mass spectrometry system, which comprises a
plurality of atmospheric pressure chemical ionization mass
spectrometers for parallel analysis of a plurality of samples
comprising mass tags.
55. The system of claim 54, wherein the mass spectrometers are
quadrupole mass spectrometers or time-of-flight mass
spectrometers.
56. The system of claim 54, wherein the mass spectrometers are
contained in one device.
57. The system of claim 54 which further comprises two turbo-pumps,
wherein one pump is used to generate a vacuum and a second pump is
used to remove undesired elements.
58. The system of claim 54, which comprises at least three mass
spectrometers.
59. The system of claim 54, wherein the mass tags have molecular
weights between 150 daltons and 250 daltons.
60. Use of the system of claim 54 for DNA sequencing analysis,
detection of single nucleotide polymorphisms, genetic mutation
analysis, serial analysis of gene expression, gene expression
analysis, identification in forensics, genetic disease association
studies, DNA sequencing, genomic sequencing, translational
analysis, or transcriptional analysis.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/300,894, filed Jun. 26, 2001, and is a
continuation-in-part of U.S. Ser. No. 09/684,670, filed Oct. 6,
2000, the contents of both of which are hereby incorporated by
reference in their entireties into this application.
BACKGROUND OF THE INVENTION
[0002] Throughout this application, various publications are
referenced in parentheses by author and year. Full citations for
these references may be found at the end of the specification
immediately preceding the claims. The disclosures of these
publications in their entireties are hereby incorporated by
reference into this application to more fully describe the state of
the art to which this invention pertains.
[0003] The ability to sequence deoxyribonucleic acid (DNA)
accurately and rapidly is revolutionizing biology and medicine. The
confluence of the massive Human Genome Project is driving an
exponential growth in the development of high throughput genetic
analysis technologies. This rapid technological development
involving chemistry, engineering, biology, and computer science
makes it possible to move from studying single genes at a time to
analyzing and comparing entire genomes.
[0004] With the completion of the first entire human genome
sequence map, many areas in the genome that are highly polymorphic
in both exons and introns will be known. The pharmacogenomics
challenge is to comprehensively identify the genes and functional
polymorphisms associated with the variability in drug response
(Roses, 2000). Resequencing of polymorphic areas in the genome that
are linked to disease development will contribute greatly to the
understanding of diseases, such as cancer, and therapeutic
development. Thus, high-throughput accurate methods for
resequencing the highly variable intron/exon regions of the genome
are needed in order to explore the full potential of the complete
human genome sequence map. The current state-of-the-art technology
for high throughput DNA sequencing, such as used for the Human
Genome Project (Pennisi 2000), is capillary array DNA sequencers
using laser induced fluorescence detection (Smith et al., 1986; Ju
et al. 1995, 1996; Kheterpal et al. 1996; Salas-Solano et al.
1998). Improvements in the polymerase that lead to uniform
termination efficiency and the introduction of thermostable
polymerases have also significantly improved the quality of
sequencing data (Tabor and Richardson, 1987, 1995). Although
capillary array DNA sequencing technology to some extent addresses
the throughput and read length requirements of large scale DNA
sequencing projects, the throughput and accuracy required for
mutation studies needs to be improved for a wide variety of
applications ranging from disease gene discovery to forensic
identification. For example, electrophoresis based DNA sequencing
methods have difficulty detecting heterozygotes unambiguously and
are not 100% accurate in regions rich in nucleotides comprising
guanine or cytosine due to compressions (Bowling et al. 1991;
Yamakawa et al. 1997). In addition, the first few bases after the
priming site are often masked by the high fluorescence signal from
excess dye-labeled primers or dye-labeled terminators, and are
therefore difficult to identify. Therefore, the requirement of
electrophoresis for DNA sequencing is still the bottleneck for
high-throughput DNA sequencing and mutation detection projects.
[0005] The concept of sequencing DNA by synthesis without using
electrophoresis was first revealed in 1988 (Hyman, 1988) and
involves detecting the identity of each nucleotide as it is
incorporated into the growing strand of DNA in a polymerase
reaction. Such a scheme coupled with the chip format and
laser-induced fluorescent detection has the potential to markedly
increase the throughput of DNA sequencing projects. Consequently,
several groups have investigated such a system with an aim to
construct an ultra high-throughput DNA sequencing procedure
(Cheeseman 1994, Metzker et al. 1994). Thus far, no complete
success of using such a system to unambiguously sequence DNA has
been reported. The pyrosequencing approach that employs four
natural nucleotides (comprising a base of adenine (A), cytosine
(C), guanine (G), or thymine (T)) and several other enzymes for
sequencing DNA by synthesis is now widely used for mutation
detection (Ronaghi 1998). In this approach, the detection is based
on the pyrophosphate (PPi) released during the DNA polymerase
reaction, the quantitative conversion of pyrophosphate to adenosine
triphosphate (ATP) by sulfurylase, and the subsequent production of
visible light by firefly luciferase. This procedure can only
sequence up to 30 base pairs (bps) of nucleotide sequences, and
each of the 4 nucleotides needs to be added separately and detected
separately. Long stretches of the same bases cannot be identified
unambiguously with the pyrosequencing method.
[0006] More recent work in the literature exploring DNA sequencing
by a synthesis method is mostly focused on designing and
synthesizing a photocleavable chemical moiety that is linked to a
fluorescent dye to cap the 3'-OH group of deoxynucleoside
triphosphates (dNTPs) (Welch et al. 1999). Limited success for the
incorporation of the 3'-modified nucleotide by DNA polymerase is
reported. The reason is that the 3-position on the deoxyribose is
very close to the amino acid residues in the active site of the
polymerase, and the polymerase is therefore sensitive to
modification in this area of the deoxyribose ring. On the other
hand, it is known that modified DNA polymerases (Thermo Sequenase
and Taq FS polymerase) are able to recognize nucleotides with
extensive modifications with bulky groups such as energy transfer
dyes at the 5-position of the pyrimidines (T and C) and at the
7-position of purines (G and A) (Rosenblum et al. 1997, Zhu at al.
1994). The ternary complexes of rat DNA polymerase, a DNA
template-primer, and dideoxycytidine triphosphate (ddCTP) have been
determined (Pelletier et al. 1994) which supports this fact. As
shown in FIG. 1, the 3-D structure indicates that the surrounding
area of the 3'-position of the deoxyribose ring in ddCTP is very
crowded, while there is ample space for modification on the
5-position the cytidine base.
[0007] The approach disclosed in the present application is to make
nucleotide analogues by linking a unique label such as a
fluorescent dye or a mass tag through a cleavable linker to the
nucleotide base or an analogue of the nucleotide base, such as to
the 5-position of the pyrimidines (T and C) and to the 7-position
of the purines (G and A), to use a small cleavable chemical moiety
to cap the 3'-OH group of the deoxyribose to make it nonreactive,
and to incorporate the nucleotide analogues into the growing DNA
strand as terminators. Detection of the unique label will yield the
sequence identity of the nucleotide. Upon removing the label and
the 3'-OH capping group, the polymerase reaction will proceed to
incorporate the next nucleotide analogue and detect the next
base.
[0008] It is also desirable to use a photocleavable group to cap
the 3'-OH group. However, a photocleavable group is generally bulky
and thus the DNA polymerase will have difficulty to incorporate the
nucleotide analogues containing a photocleavable moiety capping the
3'-OH group. If small chemical moieties that can be easily cleaved
chemically with high yield can be used to cap the 3'-OH group, such
nucleotide analogues should also be recognized as substrates for
DNA polymerase. It has been reported that
3'-O-methoxy-deoxynucleotides are good substrates for several
polymerases (Axelrod et al. 1978). 3'-O-allyl-dATP was also shown
to be incorporated by Ventr(exo-) DNA polymerase in the growing
strand of DNA (Metzker et al. 1994). However, the procedure to
chemically cleave the methoxy group is stringent and requires
anhydrous conditions. Thus, it is not practical to use a methoxy
group to cap the 3'-OH group for sequencing DNA by synthesis. An
ester group was also explored to cap the 3'-OH group of the
nucleotide, but it was shown to be cleaved by the nucleophiles in
the active site in DNA polymerase (Canard et al. 1995). Chemical
groups with electrophiles such as ketone groups are not suitable
for protecting the 3'-OH of the nucleotide in enzymatic reactions
due to the existence of strong nucleophiles in the polymerase. It
is known that MOM (--CH.sub.2OCH.sub.3) and allyl
(--CH.sub.2CH.dbd.CH.sub.2) groups can be used to cap an --OH
group, and can be cleaved chemically with high yield (Ireland et
al. 1986; Kamal et al. 1999). The approach disclosed in the present
application is to incorporate nucleotide analogues, which are
labeled with cleavable, unique labels such as fluorescent dyes or
mass tags and where the 3'-OH is capped with a cleavable chemical
moiety such as either a MOM group (--CH.sub.2OCH.sub.3) or an allyl
group (--CH.sub.2CH.dbd.CH.sub.2), into the growing strand DNA as
terminators. The optimized nucleotide set
(.sub.3'-RO-A-.sub.LABEL1, .sub.3'-RO-C-.sub.LABEL2,
.sub.3'-RO-G-.sub.LABEL3, .sub.3'-RO-T-.sub.LABEL4, where R denotes
the chemical group used to cap the 3'-OH) can then be used for DNA
sequencing by the synthesis approach.
[0009] There are many advantages of using mass spectrometry (MS) to
detect small and stable molecules. For example, the mass resolution
can be as good as one dalton. Thus, compared to gel electrophoresis
sequencing systems and the laser induced fluorescence detection
approach which have overlapping fluorescence emission spectra,
leading to heterozygote detection difficulty, the MS approach
disclosed in this application produces very high resolution of
sequencing data by detecting the cleaved small mass tags instead of
the long DNA fragment. This method also produces extremely fast
separation in the time scale of microseconds. The high resolution
allows accurate digital mutation and heterozygote detection.
Another advantage of sequencing with mass spectrometry by detecting
the small mass tags is that the compressions associated with gel
based systems are completely eliminated.
[0010] In order to maintain a continuous hybridized primer
extension product with the template DNA, a primer that contains a
stable loop to form an entity capable of self-priming in a
polymerase reaction can be ligated to the 3' end of each single
stranded DNA template that is immobilized on a solid surface such
as a chip. This approach will solve the problem of washing off the
growing extension products in each cycle.
[0011] Saxon and Bertozzi (2000) developed an elegant and highly
specific coupling chemistry linking a specific group that contains
a phosphine moiety to an azido group on the surface of a biological
cell. In the present application, this coupling chemistry is
adopted to create a solid surface which is coated with a covalently
linked phosphine moiety, and to generate polymerase chain reaction
(PCR) products that contain an azido group at the 5' end for
specific coupling of the DNA template with the solid surface. One
example of a solid surface is glass channels which have an inner
wall with an uneven or porous surface to increase the surface area.
Another example is a chip.
[0012] The present application discloses a novel and advantageous
system for DNA sequencing by the synthesis approach which employs a
stable DNA template, which is able to self prime for the polymerase
reaction, covalently linked to a solid surface such as a chip, and
4 unique nucleotides analogues (.sub.3'-RO-A-.sub.LABEL1,
.sub.3'-RO-C-.sub.LABEL2, .sub.3'-RO-G-.sub.LABEL3,
.sub.3'-RO-T-.sub.LABEL4). The success of this novel system will
allow the development of an ultra high-throughput and high fidelity
DNA sequencing system for polymorphism, pharmacogenetics
applications and for whole genome sequencing. This fast and
accurate DNA resequencing system is needed in such fields as
detection of single nucleotide polymorphisms (SNPs) (Chee et al.
1996), serial analysis of gene expression (SAGE) (Velculescu et al.
1995), identification in forensics, and genetic disease association
studies.
SUMMARY OF THE INVENTION
[0013] This invention is directed to a method for sequencing a
nucleic acid by detecting the identity of a nucleotide analogue
after the nucleotide analogue is incorporated into a growing strand
of DNA in a polymerase reaction, which comprises the following
steps: [0014] (i) attaching a 5' end of the nucleic acid to a solid
surface; [0015] (ii) attaching a primer to the nucleic acid
attached to the solid surface; [0016] (iii) adding a polymerase and
one or more different nucleotide analogues to the nucleic acid to
thereby incorporate a nucleotide analogue into the growing strand
of DNA, wherein the incorporated nucleotide analogue terminates the
polymerase reaction and wherein each different nucleotide analogue
comprises (a) a base selected from the group consisting of adenine,
guanine, cytosine, thymine, and uracil, and their analogues; (b) a
unique label attached through a cleavable linker to the base or to
an analogue of the base; (c) a deoxyribose; and (d) a cleavable
chemical group to cap an --OH group at a 3'-position of the
deoxyribose; [0017] (iv) washing the solid surface to remove
unincorporated nucleotide analogues; [0018] (v) detecting the
unique label attached to the nucleotide analogue that has been
incorporated into the growing strand of DNA, so as to thereby
identify the incorporated nucleotide analogue; [0019] (vi) adding
one or more chemical compounds to permanently cap any unreacted
--OH group on the primer attached to the nucleic acid or on a
primer extension strand formed by adding one or more nucleotides or
nucleotide analogues to the primer; [0020] (vii) cleaving the
cleavable linker between the nucleotide analogue that was
incorporated into the growing strand of DNA and the unique label;
[0021] (viii) cleaving the cleavable chemical group capping the
--OH group at the 3'-position of the deoxyribose to uncap the --OH
group, and washing the solid surface to remove cleaved compounds;
and [0022] (ix) repeating steps (iii) through (viii) so as to
detect the identity of a newly incorporated nucleotide analogue
into the growing strand of DNA; [0023] wherein if the unique label
is a dye, the order of steps (v) through (vii) is: (v), (vi), and
(vii); and [0024] wherein if the unique label is a mass tag, the
order of steps (v) through (vii) is: (vi), (vii), and (v).
[0025] The invention provides a method of attaching a nucleic acid
to a solid surface which comprises: [0026] (i) coating the solid
surface with a phosphine moiety, [0027] (ii) attaching an azido
group to a 5' end of the nucleic acid, and [0028] (iii)
immobilizing the 5' end of the nucleic acid to the solid surface
through interaction between the phosphine moiety on the solid
surface and the azido group on the 5' end of the nucleic acid.
[0029] The invention provides a nucleotide analogue which
comprises: [0030] (a) a base selected from the group consisting of
adenine or an analogue of adenine, cytosine or an analogue of
cytosine, guanine or an analogue of guanine, thymine or an analogue
of thymine, and uracil or an analogue of uracil; [0031] (b) a
unique label attached through a cleavable linker to the base or to
an analogue of the base; [0032] (c) a deoxyribose; and [0033] (d) a
cleavable chemical group to cap an --OH group at a 3'-position of
the deoxyribose.
[0034] The invention provides a parallel mass spectrometry system,
which comprises a plurality of atmospheric pressure chemical
ionization mass spectrometers for parallel analysis of a plurality
of samples comprising mass tags.
BRIEF DESCRIPTION OF THE FIGURES
[0035] FIG. 1: The 3D structure of the ternary complexes of rat DNA
polymerase, a DNA template-primer, and dideoxycytidine triphosphate
(ddCTP). The left side of the illustration shows the mechanism for
the addition of ddCTP and the right side of the illustration shows
the active site of the polymerase. Note that the 3' position of the
dideoxyribose ring is very crowded, while ample space is available
at the 5 position of the cytidine base.
[0036] FIG. 2A-2B: Scheme of sequencing by the synthesis approach.
A: Example where the unique labels are dyes and the solid surface
is a chip. B: Example where the unique labels are mass tags and the
solid surface is channels etched into a glass chip. A, C, G, T;
nucleotide triphosphates comprising bases adenine, cytosine,
guanine, and thymine; d, deoxy; dd, dideoxy; R, cleavable chemical
group used to cap the --OH group; Y, cleavable linker.
[0037] FIG. 3: The synthetic scheme for the immobilization of an
azido (N.sub.3) labeled DNA fragment to a solid surface coated with
a triarylphosphine moiety. Me, methyl group; P, phosphorus; Ph,
phenyl.
[0038] FIG. 4: The synthesis of triarylphosphine
N-hydroxysuccinimide (NHS) ester.
[0039] FIG. 5: The synthetic scheme for attaching an azido
(N.sub.3) group through a linker to the 5' end of a DNA fragment,
which is then used to couple with the triarylphosphine moiety on a
solid surface. DMSO, dimethylsulfonyl oxide.
[0040] FIG. 6A-6B: Ligate the looped primer (B) to the immobilized
single stranded DNA template forming a self primed DNA template
moiety on a solid surface. P (in circle), phosphate.
[0041] FIG. 7: Examples of structures of four nucleotide analogues
for use in the sequencing by synthesis approach. Each nucleotide
analogue has a unique fluorescent dye attached to the base through
a photocleavable linker and the 3'-OH is either exposed or capped
with a MOM group or an allyl group. FAM, 5-carboxyfluorescein; R6G,
6-carboxyrhodamine-6G; TAM,
N,N,N',N'-tetramethyl-6-carboxyrhodamine; ROX,
6-carboxy-X-rhodamine. R.dbd.H, CH.sub.2OCH.sub.3 (MOM) or
CH.sub.2CH.dbd.CH.sub.2 (Allyl).
[0042] FIG. 8: A representative scheme for the synthesis of the
nucleotide analogue .sub.3'-RO-G-.sub.Tam. A similar scheme can be
used to create the other three modified nucleotides:
.sub.3'-RO-A-.sub.Dye1, .sub.3'-RO-C-.sub.Dye2,
.sub.3'-RO-T-.sub.Dye4. (i)
tetrakis(triphenylphosphine)palladium(0); (ii) POCl.sub.3,
Bn.sub.4N.sup.+pyrophosphate; (iii) NH.sub.4OH; (iv)
Na.sub.2CO.sub.3/NaHCO.sub.3 (pH=9.0)/DMSO.
[0043] FIG. 9: A scheme for testing the sequencing by synthesis
approach. Each nucleotide, modified by the attachment of a unique
fluorescent dye, is added one by one, based on the complimentary
template. The dye is detected and cleaved to test the approach.
Dye1=Fam; Dye2=R6G; Dye3=Tam; Dye4=Rox.
[0044] FIG. 10: The expected photocleavage products of DNA
containing a photo-cleavable dye (Tam). Light absorption (300-360
nm) by the aromatic 2-nitrobenzyl moiety causes reduction of the
2-nitro group to a nitroso group and an oxygen insertion into the
carbon-hydrogen bond located in the 2-position followed by cleavage
and decarboxylation (Pillai 1980).
[0045] FIG. 11: Synthesis of PC-LC-Biotin-FAM to evaluate the
photolysis efficiency of the fluorophore coupled with the
photocleavable linker 2-nitrobenzyl group.
[0046] FIG. 12: Fluorescence spectra (.lamda..sub.ex=480 nm) of
PC-LC-Biotin-FAM immobilized on a microscope glass slide coated
with streptavidin (a); after 10 min photolysis (.lamda..sub.irr=350
nm; .about.0.5 mW/cm.sup.2) (b); and after washing with water to
remove the photocleaved dye (c).
[0047] FIG. 13A-13B: Synthetic scheme for capping the 3'-OH of
nucleotide.
[0048] FIG. 14: Chemical cleavage of the MOM group (top row) and
the allyl group (bottom row) to free the 3'-OH in the nucleotide.
CITMS=chlorotrimethylsilane.
[0049] FIG. 15A-15B: Examples of energy transfer coupled dye
systems, where Fam or Cy2 is employed as a light absorber (energy
transfer donor) and Cl.sub.2Fam, Cl.sub.2R6G, Cl.sub.2Tam, or
Cl.sub.2Rox as an energy transfer acceptor. Cy2, cyanine; FAM,
5-carboxyfluorescein; R6G, 6-carboxyrhodamine-6G; TAM,
N,N,N',N'-tetramethyl-6-carboxyrhodamine; ROX,
6-carboxy-X-rhodamine.
[0050] FIG. 16: The synthesis of a photocleavable energy transfer
dye-labeled nucleotide. DMF, dimethylformide.
DEC=1-(3-dimethylaminopropyl)-3-ethylcarbodimide hydrochloride.
R.dbd.H, CH.sub.2OCH.sub.3 (MOM) or CH.sub.2CH.dbd.CH.sub.2
(Allyl).
[0051] FIG. 17: Structures of four mass tag precursors and four
photoactive mass tags. Precursors: a) acetophenone; b)
3-fluoroacetophenone; c) 3,4-difluoroacetophenone; and d)
3,4-dimethoxyacetophenone. Four photoactive mass tags are used to
code for the identity of each of the four nucleotides (A, C, G,
T).
[0052] FIG. 18: Atmospheric. Pressure Chemical Ionization (APCI)
mass spectrum of mass tag precursors shown in FIG. 17.
[0053] FIG. 19: Examples of structures of four nucleotide analogues
for use in the sequencing by synthesis approach. Each nucleotide
analogue has a unique mass tag attached to the base through a
photocleavable linker, and the 3'-OH is either exposed or capped
with a MOM group or an allyl group. The square brackets indicated
that the mass tag is cleavable. R.dbd.H, CH.sub.2OCH.sub.3 (MOM) or
CH.sub.2CH.dbd.CH.sub.2 (Allyl).
[0054] FIG. 20: Example of synthesis of NHS ester of one mass tag
(Tag-3). A similar scheme is used to create other mass tags.
[0055] FIG. 21: A representative scheme for the synthesis of the
nucleotide analogue .sub.3'-RO-G-.sub.Tag3. A similar scheme is
used to create the other three modified bases
.sub.3'-RO-A-.sub.Tag1, .sub.3'-RO-C-.sub.Tag2,
.sub.3'-RO-T-.sub.Tag4. (i)
tetrakis(triphenylphosphine)palladium(0); (ii) POCl.sub.3,
Bn.sub.4N.sup.+pyrophosphate; (iii) NH.sub.4OH; (iv)
Na.sub.2CO.sub.3/NaHCO.sub.3 (pH=9.0)/DMSO.
[0056] FIG. 22: Examples of expected photocleavage products of DNA
containing a photocleavable mass tag.
[0057] FIG. 23: System for DNA sequencing comprising multiple
channels in parallel and multiple mass spectrometers in parallel.
The example shows 96 channels in a silica glass chip.
[0058] FIG. 24: Parallel mass spectrometry system for DNA
sequencing. Example shows three mass spectrometers in parallel.
Samples are injected into the ion source where they are mixed with
a nebulizer gas and ionized. A turbo pump is used to continuously
sweep away free radicals, neutral compounds and other undesirable
elements coming from the ion source. A second turbo pump is used to
generate a continuous vacuum in all three analyzers and detectors
simultaneously. The acquired signal is then converted to a digital
signal by the A/D converter. All three signals are then sent to the
data acquisition processor to convert the signal to identify the
mass tag in the injected sample and thus identify the nucleotide
sequence.
DETAILED DESCRIPTION OF THE INVENTION
[0059] The following definitions are presented as an aid in
understanding this invention.
[0060] As used herein, to cap an --OH group means to replace the
"H" in the --OH group with a chemical group. As disclosed herein,
the --OH group of the nucleotide analogue is capped with a
cleavable chemical group. To uncap an --OH group means to cleave
the chemical group from a capped --OH group and to replace the
chemical group with "H", i.e., to replace the "R" in --OR with "H"
wherein "R" is the chemical group used to cap the --OH group.
[0061] The nucleotide bases are abbreviated as follows: adenine
(A), cytosine (C), guanine (G), thymine (T), and uracil (U).
[0062] An analogue of a nucleotide base refers to a structural and
functional derivative of the base of a nucleotide which can be
recognized by polymerase as a substrate. That is, for example, an
analogue of adenine (A) should form hydrogen bonds with thymine
(T), a C analogue should form hydrogen bonds with G, a G analogue
should form hydrogen bonds with C, and a T analogue should form
hydrogen bonds with A, in a double helix format. Examples of
analogues of nucleotide bases include, but are not limited to,
7-deaza-adenine and 7-deaza-guanine, wherein the nitrogen atom at
the 7-position of adenine or guanine is substituted with a carbon
atom.
[0063] A nucleotide analogue refers to a chemical compound that is
structurally and functionally similar to the nucleotide, i.e. the
nucleotide analogue can be recognized by polymerase as a substrate.
That is, for example, a nucleotide analogue comprising adenine or
an analogue of adenine should form hydrogen bonds with thymine, a
nucleotide analogue comprising C or an analogue of C should form
hydrogen bonds with G, a nucleotide analogue comprising G or an
analogue of G should form hydrogen bonds with C, and a nucleotide
analogue comprising T or an analogue of T should form hydrogen
bonds with A, in a double helix format. Examples of nucleotide
analogues disclosed herein include analogues which comprise an
analogue of the nucleotide base such as 7-deaza-adenine or
7-deaza-guanine, wherein the nitrogen atom at the 7-position of
adenine or guanine is substituted with a carbon atom. Further
examples include analogues in which a label is attached through a
cleavable linker to the 5-position of cytosine or thymine or to the
7-position of deaza-adenine or deaza-guanine. Other examples
include analogues in which a small chemical moiety such as
--CH.sub.2OCH.sub.3 or --CH.sub.2CH.dbd.CH.sub.2 is used to cap the
--OH group at the 3'-position of deoxyribose. Analogues of
dideoxynucleotides can similarly be prepared.
[0064] As used herein, a porous surface is a surface which contains
pores or is otherwise uneven, such that the surface area of the
porous surface is increased relative to the surface area when the
surface is smooth.
[0065] The present invention is directed to a method for sequencing
a nucleic acid by detecting the identity of a nucleotide analogue
after the nucleotide analogue is incorporated into a growing strand
of DNA in a polymerase reaction, which comprises the following
steps: [0066] (i) attaching a 5' end of the nucleic acid to a solid
surface; [0067] (ii) attaching a primer to the nucleic acid
attached to the solid surface; [0068] (iii) adding a polymerase and
one or more different nucleotide analogues to the nucleic acid to
thereby incorporate a nucleotide analogue into the growing strand
of DNA, wherein the incorporated nucleotide analogue terminates the
polymerase reaction and wherein each different nucleotide analogue
comprises (a) a base selected from the group consisting of adenine,
guanine, cytosine, thymine, and uracil, and their analogues; (b) a
unique label attached through a cleavable linker to the base or to
an analogue of the base; (c) a deoxyribose; and (d) a cleavable
chemical group to cap an --OH group at a 3'-position of the
deoxyribose; [0069] (iv) washing the solid surface to remove
unincorporated nucleotide analogues; [0070] (v) detecting the
unique label attached to the nucleotide analogue that has been
incorporated into the growing strand of DNA, so as to thereby
identify the incorporated nucleotide analogue; [0071] (vi) adding
one or more chemical compounds to permanently cap any unreacted
--OH group on the primer attached to the nucleic acid or on a
primer extension strand formed by adding one or more nucleotides or
nucleotide analogues to the primer; [0072] (vii) cleaving the
cleavable linker between the nucleotide analogue that was
incorporated into the growing strand of DNA and the unique label;
[0073] (viii) cleaving the cleavable chemical group capping the
--OH group at the 3'-position of the deoxyribose to uncap the --OH
group, and washing the solid surface to remove cleaved compounds;
and [0074] (ix) repeating steps (iii) through (viii) so as to
detect the identity of a newly incorporated nucleotide analogue
into the growing strand of DNA; [0075] wherein if the unique label
is a dye, the order of steps (v) through (vii) is: (v), (vi), and
(vii); and [0076] wherein if the unique label is a mass tag, the
order of steps (v) through (vii) is: (vi), (vii), and (v).
[0077] In one embodiment of any of the nucleotide analogues
described herein, the nucleotide base is adenine. In one
embodiment, the nucleotide base is guanine. In one embodiment, the
nucleotide base is cytosine. In one embodiment, the nucleotide base
is thymine. In one embodiment, the nucleotide base is uracil. In
one embodiment, the nucleotide base is an analogue of adenine. In
one embodiment, the nucleotide base is an analogue of guanine. In
one embodiment, the nucleotide base is an analogue of cytosine. In
one embodiment, the nucleotide base is an analogue of thymine. In
one embodiment, the nucleotide base is an analogue of uracil.
[0078] In different embodiments of any of the inventions described
herein, the solid surface is glass, silicon, or gold. In different
embodiments, the solid surface is a magnetic bead, a chip, a
channel in a chip, or a porous channel in a chip. In one
embodiment, the solid surface is glass. In one embodiment, the
solid surface is silicon. In one embodiment, the solid surface is
gold. In one embodiments, the solid surface is a magnetic bead. In
one embodiment, the solid surface is a chip. In one embodiment, the
solid surface is a channel in a chip. In one embodiment, the solid
surface is a porous channel in a chip. Other materials can also be
used as long as the material does not interfere with the steps of
the method.
[0079] In one embodiment, the step of attaching the nucleic acid to
the solid surface comprises: [0080] (i) coating the solid surface
with a phosphine moiety, [0081] (ii) attaching an azido group to
the 5' end of the nucleic acid, and [0082] (iii) immobilizing the
5' end of the nucleic acid to the solid surface through interaction
between the phosphine moiety on the solid surface and the azido
group on the 5' end of the nucleic acid.
[0083] In one embodiment, the step of coating the solid surface
with the phosphine moiety comprises: [0084] (i) coating the surface
with a primary amine, and [0085] (ii) covalently coupling a
N-hydroxysuccinimidyl ester of triarylphosphine with the primary
amine.
[0086] In one embodiment, the nucleic acid that is attached to the
solid surface is a single-stranded deoxyribonucleic acid (DNA). In
another embodiment, the nucleic acid that is attached to the solid
surface in step (i) is a double-stranded DNA, wherein only one
strand is directly attached to the solid surface, and wherein the
strand that is not directly attached to the solid surface is
removed by denaturing before proceeding to step (ii). In one
embodiment, the nucleic acid that is attached to the solid surface
is a ribonucleic acid (RNA), and the polymerase in step (iii) is
reverse transcriptase.
[0087] In one embodiment, the primer is attached to a 3' end of the
nucleic acid in step (ii), and the attached primer comprises a
stable loop and an --OH group at a 3'-position of a deoxyribose
capable of self-priming in the polymerase reaction. In one
embodiment, the step of attaching the primer to the nucleic acid
comprises hybridizing the primer to the nucleic acid or ligating
the primer to the nucleic acid. In one embodiment, the primer is
attached to the nucleic acid through a ligation reaction which
links the 3' end of the nucleic acid with the 5' end of the
primer.
[0088] In one embodiment, one or more of four different nucleotide
analogs is added in step (iii), wherein each different nucleotide
analogue comprises a different base selected from the group
consisting of thymine or uracil or an analogue of thymine or
uracil, adenine or an analogue of adenine, cytosine or an analogue
of cytosine, and guanine or an analogue of guanine, and wherein
each of the four different nucleotide analogues comprises a unique
label.
[0089] In one embodiment, the cleavable chemical group that caps
the --OH group at the 3'-position of the deoxyribose in the
nucleotide analogue is --CH.sub.2OCH.sub.3 or
--CH.sub.2CH.dbd.CH.sub.2. Any chemical group could be used as long
as the group 1) is stable during the polymerase reaction, 2) does
not interfere with the recognition of the nucleotide analogue by
polymerase as a substrate, and 3) is cleavable:
[0090] In one embodiment, the unique label that is attached to the
nucleotide analogue is a fluorescent moiety or a fluorescent
semiconductor crystal. In further embodiments, the fluorescent
moiety is selected from the group consisting of
5-carboxyfluorescein, 6-carboxyrhodamine-6G,
N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
6-carboxy-X-rhodamine. In one embodiment, the fluorescent moiety is
5-carboxyfluorescein. In one embodiment, the fluorescent moiety is
6-carboxyrhodamine-6G, N,N,N',N'-tetramethyl-6-carboxyrhodamine. In
one embodiment, the fluorescent moiety is
6-carboxy-X-rhodamine.
[0091] In one embodiment, the unique label that is attached to the
nucleotide analogue is a fluorescence energy transfer tag which
comprises an energy transfer donor and an energy transfer acceptor.
In further embodiments, the energy transfer donor is
5-carboxyfluorescein or cyanine, and wherein the energy transfer
acceptor is selected from the group consisting of
dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G,
dichloro-N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
dichloro-6-carboxy-X-rhodamine. In one embodiment, the energy
transfer acceptor is dichlorocarboxyfluorescein. In one embodiment,
the energy transfer acceptor is dichloro-6-carboxyrhodamine-6G. In
one embodiment, the energy transfer acceptor is
dichloro-N,N,N',N'-tetramethyl-6-carboxyrhodamine. In one
embodiment, the energy transfer acceptor is
dichloro-6-carboxy-X-rhodamine.
[0092] In one embodiment, the unique label that is attached to the
nucleotide analogue is a mass tag that can be detected and
differentiated by a mass spectrometer. In further embodiments, the
mass tag is selected from the group consisting of a
2-nitro-.alpha.-methyl-benzyl group, a
2-nitro-.alpha.-methyl-3-fluorobenzyl group, a
2-nitro-.alpha.-methyl-3,4-difluorobenzyl group, and a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl group. In one
embodiment, the mass tag is a 2-nitro-.alpha.-methyl-benzyl group.
In one embodiment, the mass tag is a
2-nitro-.alpha.-methyl-3-fluorobenzyl group. In one embodiment, the
mass tag is a 2-nitro-.alpha.-methyl-3,4-difluorobenzyl group. In
one embodiment, the mass tag is a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl group. In one
embodiment, the mass tag is detected using a parallel mass
spectrometry system which comprises a plurality of atmospheric
pressure chemical ionization mass spectrometers for parallel
analysis of a plurality of samples comprising mass tags.
[0093] In one embodiment, the unique label is attached through a
cleavable linker to a 5-position of cytosine or thymine or to a
7-position of deaza-adenine or deaza-guanine. The unique label
could also be attached through a cleavable linker to another
position in the nucleotide analogue as long as the attachment of
the label is stable during the polymerase reaction and the
nucleotide analog can be recognized by polymerase as a substrate.
For example, the cleavable label could be attached to the
deoxyribose.
[0094] In one embodiment, the linker between the unique label and
the nucleotide analogue is cleaved by a means selected from the
group consisting of one or more of a physical means, a chemical
means, a physical chemical means, heat, and light. In one
embodiment, the linker is cleaved by a physical means. In one
embodiment, the linker is cleaved by a chemical means. In one
embodiment, the linker is cleaved by a physical chemical means. In
one embodiment, the linker is cleaved by heat. In one embodiment,
the linker is cleaved by light. In one embodiment, the linker is
cleaved by ultraviolet light. In a further embodiment, the
cleavable linker is a photocleavable linker which comprises a
2-nitrobenzyl moiety.
[0095] In one embodiment, the cleavable chemical group used to cap
the --OH group at the 3'-position of the deoxyribose is cleaved by
a means selected from the group consisting of one or more of a
physical means, a chemical means, a physical chemical means, heat,
and light. In one embodiment, the linker is cleaved by a physical
chemical means. In one embodiment, the linker is cleaved by heat.
In one embodiment, the linker is cleaved by light. In one
embodiment, the linker is cleaved by ultraviolet light.
[0096] In one embodiment, the chemical compounds added in step (vi)
to permanently cap any unreacted --OH group on the primer attached
to the nucleic acid or on the primer extension strand are a
polymerase and one or more different dideoxynucleotides or
analogues of dideoxynucleotides. In further embodiments, the
different dideoxynucleotides are selected from the group consisting
of 2',3'-dideoxyadenosine 5'-triphosphate, 2',3'-dideoxyguanosine
5'-triphosphate, 2',3'-dideoxycytidine 5'-triphosphate,
2',3'-dideoxythymidine 5'-triphosphate, 2',3'-dideoxyuridine
5'-triphosphase, and their analogues. In one embodiment, the
dideoxynucleotide is 2',3'-dideoxyadenosine 5'-triphosphate. In one
embodiment, the dideoxynucleotide is 2',3'-dideoxyguanosine
5'-triphosphate. In one embodiment, the dideoxynucleotide is
2',3'-dideoxycytidine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is 2',3'-dideoxythymidine 5'-triphosphate. In one
embodiment, the dideoxynucleotide is 2',3'-dideoxyuridine
5'-triphosphase. In one embodiment, the dideoxynucleotide is an
analogue of 2',3'-dideoxyadenosine 5'-triphosphate. In one
embodiment, the dideoxynucleotide is an analogue of
2',3'-dideoxyguanosine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is an analogue of 2',3'-dideoxycytidine
5'-triphosphate. In one embodiment, the dideoxynucleotide is an
analogue of 2',3'-dideoxythymidine 5'-triphosphate. In one
embodiment, the dideoxynucleotide is an analogue of
2',3'-dideoxyuridine 5'-triphosphase.
[0097] In one embodiment, a polymerase and one or more of four
different dideoxynucleotides are added in step (vi), wherein each
different dideoxynucleotide is selected from the group consisting
of 2',3'-dideoxyadenosine 5'-triphosphate or an analogue of
2',3'-dideoxyadenosine 5'-triphosphate; 2',3'-dideoxyguanosine
5'-triphosphate or an analogue of 2',3'-dideoxyguanosine
5'-triphosphate; 2',3'-dideoxycytidine 5'-triphosphate or an
analogue of 2',3'-dideoxycytidine 5'-triphosphate; and
2',3'-dideoxythymidine 5'-triphosphate or 2',3'-dideoxyuridine
5'-triphosphase or an analogue of 2',3'-dideoxythymidine
5'-triphosphate or an analogue of 2',3'-dideoxyuridine
5'-triphosphase. In one embodiment, the dideoxynucleotide is
2',3'-dideoxyadenosine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is an analogue of 2',3'-dideoxyadenosine
5'-triphosphate. In one embodiment, the dideoxynucleotide is
2',3'-dideoxyguanosine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is an analogue of 2',3'-dideoxyguanosine
5'-triphosphate. In one embodiment, the dideoxynucleotide is
2',3'-dideoxycytidine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is an analogue of 2',3'-dideoxycytidine
5'-triphosphate. In one embodiment, the dideoxynucleotide is
2',3'-dideoxythymidine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is 2',3'-dideoxyuridine 5'-triphosphase. In one
embodiment, the dideoxynucleotide is an analogue of
2',3'-dideoxythymidine 5'-triphosphate. In one embodiment, the
dideoxynucleotide is an analogue of 2',3'-dideoxyuridine
5'-triphosphase.
[0098] Another type of chemical compound that reacts specifically
with the --OH group could also be used to permanently cap any
unreacted --OH group on the primer attached to the nucleic acid or
on an extension strand formed by adding one or more nucleotides or
nucleotide analogues to the primer.
[0099] The invention provides a method for simultaneously
sequencing a plurality of different nucleic acids, which comprises
simultaneously applying any of the methods disclosed herein for
sequencing a nucleic acid to the plurality of different nucleic
acids. In different embodiments, the method can be used to sequence
from one to over 100,000 different nucleic acids
simultaneously.
[0100] The invention provides for the use of any of the methods
disclosed herein for detection of single nucleotide polymorphisms,
genetic mutation analysis, serial analysis of gene expression, gene
expression analysis, identification in forensics, genetic disease
association studies, DNA sequencing, genomic sequencing,
translational analysis, or transcriptional analysis.
[0101] The invention provides a method of attaching a nucleic acid
to a solid surface which comprises: [0102] (i) coating the solid
surface with a phosphine moiety, [0103] (ii) attaching an azido
group to a 5' end of the nucleic acid, and [0104] (iii)
immobilizing the 5' end of the nucleic acid to the solid surface
through interaction between the phosphine moiety on the solid
surface and the azido group on the 5' end of the nucleic acid.
[0105] In one embodiment, the step of coating the solid surface
with the phosphine moiety comprises: [0106] (i) coating the surface
with a primary amine, and [0107] (ii) covalently coupling a
N-hydroxysuccinimidyl ester of triarylphosphine with the primary
amine.
[0108] In different embodiments, the solid surface is glass,
silicon, or gold. In different embodiments, the solid surface is a
magnetic bead, a chip, a channel in an chip, or a porous channel in
a chip.
[0109] In different embodiments, the nucleic acid that is attached
to the solid surface is a single-stranded or double-stranded DNA or
a RNA. In one embodiment, the nucleic acid is a double-stranded DNA
and only one strand is attached to the solid surface. In a further
embodiment, the strand of the double-stranded DNA that is not
attached to the solid surface is removed by denaturing.
[0110] The invention provides for the use of any of the methods
disclosed herein for attaching a nucleic acid to a surface for gene
expression analysis, microarray based gene expression analysis, or
mutation detection, translational analysis, transcriptional
analysis, or for other genetic applications.
[0111] The invention provides a nucleotide analogue which
comprises: [0112] (a) a base selected from, the group consisting of
adenine or an analogue of adenine, cytosine or an analogue of
cytosine, guanine or an analogue of guanine, thymine or an analogue
of thymine, and uracil or an analogue of uracil; [0113] (b) a
unique label attached through a cleavable linker to the base or to
an analogue of the base; [0114] (c) a deoxyribose; and [0115] (d) a
cleavable chemical group to cap an --OH group at a 3'-position of
the deoxyribose.
[0116] In one embodiment of the nucleotide analogue, the cleavable
chemical group that caps the --OH group at the 3'-position of the
deoxyribose is --CH.sub.2OCH.sub.3 or
--CH.sub.2CH.dbd.CH.sub.2.
[0117] In one embodiment, the unique label is a fluorescent moiety
or a fluorescent semiconductor crystal. In further embodiments, the
fluorescent moiety is selected from the group consisting of
5-carboxyfluorescein, 6-carboxyrhodamine-6G,
N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
6-carboxy-X-rhodamine.
[0118] In one embodiment, the unique label is a fluorescence energy
transfer tag which comprises an energy transfer donor and an energy
transfer acceptor. In further embodiments, the energy, transfer
donor is 5-carboxyfluorescein or cyanine, and wherein the energy
transfer acceptor is selected from the group consisting of
dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G,
dichloro-N,N,N',N'-tetramethyl-6-carboxyrhodamine, and
dichloro-6-carboxy-X-rhodamine.
[0119] In one embodiment, the unique label is a mass tag that can
be detected and differentiated by a mass spectrometer. In further
embodiments, the mass tag is selected from the group consisting of
a 2-nitro-.alpha.-methyl-benzyl group, a
2-nitro-.alpha.-methyl-3-fluorobenzyl group, a
2-nitro-.alpha.-methyl-3,4-difluorobenzyl group, and a
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl group.
[0120] In one embodiment, the unique label is attached through a
cleavable linker to a 5-position of cytosine or thymine or to a
7-position of deaza-adenine or deaza-guanine. The unique label
could also be attached through a cleavable linker to another
position in the nucleotide analogue as long as the attachment of
the label is stable during the polymerase reaction and the
nucleotide analog can be recognized by polymerase as a substrate.
For example, the cleavable label could be attached to the
deoxyribose.
[0121] In one embodiment, the linker between the unique label and
the nucleotide analogue is cleavable by a means selected from the
group consisting of one or more of a physical means, a chemical
means, a physical chemical means, heat, and light. In a further
embodiment, the cleavable linker is a photocleavable linker which
comprises a 2-nitrobenzyl moiety.
[0122] In one embodiment, the cleavable chemical group used to cap
the --OH group at the 3'-position of the deoxyribose is cleavable
by a means selected from the group consisting of one or more of a
physical means, a chemical means, a physical chemical means, heat,
and light.
[0123] In different embodiments, the nucleotide analogue is
selected from the group consisting of:
##STR00001## [0124] wherein Dye.sub.1, Dye.sub.2, Dye.sub.3, and
Dye.sub.4 are four different unique labels; and [0125] wherein R is
a cleavable chemical group used to cap the --OH group at the
3'-position of the deoxyribose.
[0126] In different embodiments, the nucleotide analogue is
selected from the group consisting of:
##STR00002## [0127] wherein R is --CH.sub.2OCH.sub.3 or
--CH.sub.2CH.dbd.CH.sub.2.
[0128] In different embodiments, the nucleotide analogue is
selected from the group consisting of:
##STR00003## [0129] wherein Tag.sub.1, Tag.sub.2, Tag.sub.3, and
Tag.sub.4 are four different mass tag labels; and [0130] wherein R
is a cleavable chemical group used to cap the --OH group at the
3'-position of the deoxyribose.
[0131] In different embodiments, the nucleotide analogue is
selected from the group consisting of:
##STR00004## [0132] wherein R is --CH.sub.2OCH.sub.3 or
--CH.sub.2CH.dbd.CH.sub.2.
[0133] The invention provides for the use any of the nucleotide
analogues disclosed herein for detection of single nucleotide
polymorphisms, genetic mutation analysis, serial analysis of gene
expression, gene expression analysis, identification in forensics,
genetic disease association studies, DNA sequencing, genomic
sequencing, translational analysis, or transcriptional
analysis.
[0134] The invention provides a parallel mass spectrometry system,
which comprises a plurality of atmospheric pressure chemical
ionization mass spectrometers for parallel analysis of a plurality
of samples comprising mass tags. In one embodiment, the mass
spectrometers are quadrupole mass spectrometers. In one embodiment,
the mass spectrometers are time-of-flight mass spectrometers. In
one embodiment, the mass spectrometers are contained in one device.
In one embodiment, the system further comprises two turbo-pumps,
wherein one pump is used to generate a vacuum and a second pump is
used to remove undesired elements. In one embodiment, the system
comprises at least three mass spectrometers. In one embodiment, the
mass tags have molecular weights between 150 daltons and 250
daltons. The invention provides for the use of the system for DNA
sequencing analysis, detection of single nucleotide polymorphisms,
genetic mutation analysis, serial analysis of gene expression, gene
expression analysis, identification in forensics, genetic disease
association studies, DNA sequencing, genomic sequencing,
translational analysis, or transcriptional analysis.
[0135] This invention will be better understood from the
Experimental Details which follow. However, one skilled in the art
will readily appreciate that the specific methods and results
discussed are merely illustrative of the invention as described
more fully in the claims which follow thereafter.
Experimental Details
1. The Sequencing by Synthesis Approach
[0136] Sequencing DNA by synthesis involves the detection of the
identity of each nucleotide as it is incorporated into the growing
strand of DNA in the polymerase reaction. The fundamental
requirements for such a system to work are: (1) the availability of
4 nucleotide analogues (aA, aC, aG, aT) each labeled with a unique
label and containing a chemical moiety capping the 3'-OH group; (2)
the 4 nucleotide analogues (aA, aC, aG, aT) need to be efficiently
and faithfully incorporated by DNA polymerase as terminators in the
polymerase reaction; (3) the tag and the group capping the 3'-OH
need to be removed with high yield to allow the incorporation and
detection of the next nucleotide; and (4) the growing strand of DNA
should survive the washing, detection and cleavage processes to
remain annealed to the DNA template.
[0137] The sequencing by synthesis approach disclosed herein is
illustrated in FIG. 2A-2B. In FIG. 2A, an example is shown where
the unique labels are fluorescent dyes and the surface is a chip;
in FIG. 2B, the unique labels are mass tags and the surface is
channels etched into a chip. The synthesis approach uses a solid
surface such as a glass chip with an immobilized DNA template that
is able to self prime for initiating the polymerase reaction, and
four nucleotide analogues (.sub.3'-RO-A-.sub.LABEL1,
.sub.3'-RO-C-.sub.LABEL2, .sub.3'-RO-G-.sub.LABEL3,
.sub.3'-RO-T-.sub.LABEL4) each labeled with a unique label, e.g. a
fluorescent dye or a mass tag, at a specific location on the purine
or pyrimidine base, and a small cleavable chemical group (R) to cap
the 3'-OH group. Upon adding the four nucleotide analogues and DNA
polymerase, only one nucleotide analogue that is complementary to
the next nucleotide on the template is incorporated by the
polymerase on each spot of the surface (step 1 in FIGS. 2A and
28).
[0138] As shown in FIG. 2A, where the unique labels are dyes, after
removing the excess reagents and washing away any unincorporated
nucleotide analogues on the chip, a detector is used to detect the
unique label. For example, a four color fluorescence imager is used
to image the surface of the chip, and the unique fluorescence
emission from a specific dye on the nucleotide analogues on each
spot of the chip will reveal the identity of the incorporated
nucleotide (step 2 in FIG. 2A). After imaging, the small amount of
unreacted 3'-OH group on the self-primed template moiety is capped
by excess dideoxynucleoside triphosphates (ddNTPs) (ddATP, ddGTP,
ddTTP, and ddCTP) and DNA polymerase to avoid interference with the
next round of synthesis (step 3 in FIG. 2A), a concept similar to
the capping step in automated solid phase DNA synthesis (Caruthers,
1985). The ddNTPs, which lack a 3'-hydroxyl group, are chosen to
cap the unreacted 3'-OH of the nucleotide due to their small size
compared with the dye-labeled nucleotides, and the excellent
efficiency with which they are incorporated by DNA polymerase. The
dye moiety is then cleaved by light (.about.350 nm), and the R
group protecting the 3'-OH is removed chemically to generate free
3'-OH group with high yield (step 4 in FIG. 2A). A washing step is
applied to wash away the cleaved dyes and the R group. The
self-primed DNA moiety on the chip at this stage is ready for the
next cycle of the reaction to identify the next nucleotide sequence
of the template DNA (step 5 in FIG. 2A).
[0139] It is a routine procedure now to immobilize high density
(>10,000 spots per chip) single stranded DNA on a 4 cm.times.1
cm glass chip (Schena et al. 1995). Thus, in the DNA sequencing
system disclosed herein, more than 10,000 bases can be identified
after each cycle and after 100 cycles, a million base pairs will be
generated from one sequencing chip.
[0140] Possible DNA polymerases include Thermo Sequenase, Taq ES
DNA polymerase, T7 DNA polymerase, and Vent (exo-) DNA polymerase.
The fluorescence emission from each specific dye can be detected
using a fluorimeter that is equipped with an accessory to detect
fluorescence from a glass slide. For large scale evaluation, a
multi-color scanning system capable of detecting multiple different
fluorescent dyes (500 nm-700 nm) (GSI Lumonics ScanArray 5000
Standard Biochip Scanning System) on a glass slide can be used.
[0141] An example of the sequencing by synthesis approach using
mass tags is shown in FIG. 2B. The approach uses a solid surface,
such as a porous silica glass channels in a chip, with immobilized
DNA template that is able to self prime for initiating the
polymerase reaction, and four nucleotide analogues
(.sub.3'-Ro-A-.sub.Tag1, .sub.3'-RO-C-.sub.Tag2,
.sub.3'-RO-G-.sub.Tag3, .sub.3'-RO-T-.sub.Tag4) each labeled with a
unique photocleavable mass tag on the specific location of the
base, and a small cleavable chemical group (R) to cap the 3'-OH
group. Upon adding the four nucleotide analogues and DNA
polymerase, only one nucleotide analogue that is complementary to
the next nucleotide on the template is incorporated by polymerase
in each channel of the glass chip (step 1 in FIG. 2B): After
removing the excess reagents and washing away any unincorporated
nucleotide analogues on the chip, the small amount of unreacted
3'-OH group on the self-primed template moiety is capped by excess
ddNTPs (ddATP, ddGTP, ddTTP and ddCTP) and DNA polymerase to avoid
interference with the next round of synthesis (step 2 in FIG. 28).
The ddNTPs are chosen to cap the unreacted 3'-OH of the nucleotide
due to their small size compared with the labeled nucleotides, and
their excellent efficiency to be incorporated by DNA polymerase.
The mass tags are cleaved by irradiation with light (.about.350 nm)
(step 3 in FIG. 2B) and then detected with a mass spectrometer. The
unique mass of each tag yields the identity of the nucleotide in
each channel (step 4 in FIG. 2B). The R protecting group is then
removed chemically and washed away to generate free 3'-OH group
with high yield (step 5 in FIG. 2B). The self-primed DNA moiety on
the chip at this stage is ready for the next cycle of the reaction
to identify the next nucleotide sequence of the template DNA (step
6 in FIG. 2B).
[0142] Since the development of new ionization techniques such as
matrix assisted laser desorption ionization (MALDI) and
electrospray ionization (ESI), mass spectrometry has become an
indispensable tool in many areas of biomedical research. Though
these ionization methods are suitable for the analysis of
bioorganic molecules, such as peptides and proteins, improvements
in both detection and sample preparation are required for
implementation of mass spectrometry for DNA sequencing
applications. Since the approach disclosed herein uses small and
stable mass tags, there is no need to detect large DNA sequencing
fragments directly and it is not necessary to use MALDI or ESI
methods for detection. Atmospheric pressure chemical ionization
(APCI) is an ionization method that uses a gas-phase ion-molecular
reaction at atmospheric pressure (Dizidic et al. 1975). In this
method, samples are introduced by either chromatography or flow
injection into a pneumatic nebulizer where they are converted into
small droplets by a high-speed beam of nitrogen gas. When the
heated gas and solution arrive at the reaction area, the excess
amount of solvent is ionized by corona discharge. This ionized
mobile phase acts as the ionizing agent toward the samples and
yields pseudo molecular (M+H).sup.+ and (M-H).sup.- ions. Due to
the corona discharge ionization method, high ionization efficiency
is attainable, maintaining stable ionization conditions with
detection sensitivity lower than femtomole region for small and
stable organic compounds. However, due to the limited detection of
large molecules, ESI and MALDI have replaced APCI for analysis of
peptides and nucleic acids. Since in the approach disclosed the
mass tags to be detected are relatively small and very stable
organic molecules, the ability to detect large biological molecules
gained by using ESI and MALDI is not necessary. APCI has several
advantages over ESI and MALDI because it does not require any
tedious sample preparation such as desalting or mixing with matrix
to prepare crystals on a target plate. In ESI, the sample nature
and sample preparation conditions (i.e. the existence of buffer or
inorganic salts) suppress the ionization efficiency. MALDI requires
the addition of matrix prior to sample introduction into the mass
spectrometer and its speed is often limited by the need to search
for an ideal irradiation spot to obtain interpretable mass spectra.
These limitations are overcome by APCI because the mass tag
solution can be injected directly with no additional sample
purification or preparation into the mass spectrometer. Since the
mass tagged samples are volatile and have small mass numbers, these
compounds are easily detectable by APCI ionization with high
sensitivity. This system can be scaled up into a high throughput
operation.
[0143] Each component of the sequencing by synthesis system is
described in more detail below.
2. Construction of a Surface Containing Immobilized Self-Primed DNA
Moiety
[0144] The single stranded DNA template immobilized on a surface is
prepared according to the scheme shown in FIG. 3. The surface can
be, for example, a glass chip, such as a 4 cm.times.1 cm glass
chip, or channels in a glass chip. The surface is first treated
with 0.5 M NaOH, washed with water, and then coated with high
density 3-aminopropyltrimethoxysilane in aqueous ethanol (Woolley
et al. 1994) forming a primary amine surface. N-Hydroxy
Succinimidyl (NHS) ester of triarylphosphine (1) is covalently
coupled with the primary amine group converting the amine surface
to a novel triarylphosphine surface, which specifically reacts with
DNA containing an azido group (2) forming a chip with immobilized
DNA. Since the azido group is only located at the 5 end of the DNA
and the coupling reaction is through the unique reaction of the
triarylphosphine moiety with the azido group in aqueous solution
(Saxon and Bertozzi 2000), such a DNA surface will provide an
optimal condition for hybridization.
[0145] The NHS ester of triarylphosphine (1) is prepared according
to the scheme shown in FIG. 4.
3-diphenylphosphino-4-methoxycarbonyl-benzoic acid (3) is prepared
according to the procedure described by Bertozzi et al. (Saxon and
Bertozzi 2000). Treatment of (3) with N-Hydroxysuccinimide forms
the corresponding NHS ester (4). Coupling of (4) with an amino
carboxylic acid moiety produces compound (5) that has a long linker
(n=1 to 10) for optimized coupling with DNA on the surface.
Treatment of (5) with N-Hydroxysuccinimide generates the NHS ester
(1) which is ready for coupling with the primary amine coated
surface (FIG. 3).
[0146] The azido labeled DNA (2) is synthesized according to the
scheme shown in FIG. 5. Treatment of ethyl ester of 5-bromovaleric
acid with sodium azide and then hydrolysis produces 5-azidovaleric
acid (Khoukhi et al., 1987), which is subsequently converted to a
NHS ester for coupling with an amino linker modified
oligonucleotide primer. Using the azido-labeled primer to perform
polymerase chain reaction (PCR) reaction generates azido-labeled
DNA template (2) for coupling with the triarylphosphine-modified
surface (FIG. 3).
[0147] The self-primed DNA template moiety on the sequencing chip
is constructed as shown in FIGS. 6 (A & B) using enzymatic
ligation. A 5'-phosphorylated, 3'-OH capped loop oligonucleotide
primer (B) is synthesized by a solid phase DNA synthesizer. Primer
(B) is synthesized using a modified C phosphoramidite whose 3'-OH
is capped with either a MOM (--CH.sub.2OCH.sub.3) group or an allyl
(--OH2CH.dbd.CH.sub.2) group (designated by "R" in FIG. 6) at the
3'-end of the oligonucleotide to prevent the self ligation of the
primer in the ligation reaction. Thus, the looped primer can only
ligate to the 3'-end of the DNA templates that are immobilized on
the sequencing chip using T4 RNA ligase (Mang et al. 1996) to form
the self-primed DNA template moiety (A). The looped primer (B) is
designed to contain a very stable loop (Antao et al. 1991) and a
stem containing the sequence of M13 reverse DNA sequencing primer
for efficient priming in the polymerase reaction once the primer is
ligated to the immobilized DNA on the sequencing chip and the 3'-OH
cap group is chemically cleaved off (Ireland et al. 1986; Kamal et
al. 1999).
3. Sequencing by Synthesis Evaluation Using Nucleotide Analogues
.sub.3'-HO-A-.sub.Dye1, .sub.3'-HO-C-.sub.Dye2,
.sub.3'-HO-G-.sub.Dye3, .sub.3'-HO-T-.sub.Dye4
[0148] A scheme has been developed for evaluating the photocleavage
efficiency using different dyes and testing the sequencing by
synthesis approach. Four nucleotide analogues
.sub.3'-HO-A-.sub.Dye1, .sub.3'-HO-C-.sub.Dye2,
.sub.3'-HO-G-.sub.Dye3, .sub.3'-HO-T-.sub.Dye4 each labeled with a
unique fluorescent dye through a photocleavable linker are
synthesized and used in the sequencing by synthesis approach.
Examples of dyes include, but are not limited to: Dye1=FAM,
5-carboxyfluorescein; Dye2=R6G, 6-carboxyrhodamine-6G; Dye3=TAM,
N,N,N',N'-tetramethyl-6-carboxyrhodamine; and Dye4=ROX,
6-carboxy-X-rhodamine. The structures of the 4 nucleotide analogues
are shown in FIG. 7 (R.dbd.H).
[0149] The photocleavable 2-nitrobenzyl moiety has been used to
link biotin to DNA and protein for efficient removal by UV light
(.about.350 nm) (Olejnik et al. 1995, 1999). In the approach
disclosed herein the 2-nitrobenzyl group is used to bridge the
fluorescent dye and nucleotide together to form the dye labeled
nucleotides as shown in FIG. 7.
[0150] As a representative example, the Synthesis of
.sub.3'-HO-G-.sub.Dye3 (Dye3=Tam) is shown in FIG. 8.
7-deaza-alkynylamino-dGTP is prepared using well-established
procedures (Prober et al. 1987; Lee et al. 1992 and Hobbs et al.
1991). Linker-Tam is synthesized by coupling the Photocleavable
Linker (Rollaf 1982) with NHS-Tam. 7-deaza-alkynylamino-dGTP is
then coupled with the Linker-Tam to produce .sub.3'-HO-G-.sub.TAM.
The nucleotide analogues with a free 3'-OH (i.e., R.dbd.H) are good
substrates for the polymerase. An immobilized DNA template is
synthesized (FIG. 9) that contains a portion of nucleotide sequence
ACGTACGACGT (SEQ ID NO: 1) that has no repeated sequences after the
priming site. .sub.3-HO-A-.sub.Dye1 and DNA polymerase are added to
the self-primed DNA moiety and it is incorporated to the 3' site of
the DNA. Then the steps in FIG. 2A are followed (the chemical
cleavage step is not required here because the 3'-OH is free) to
detect the fluorescent signal from Dye-1 at 520 nm. Next,
.sub.3'-HO-C-.sub.Dye2 is added to image the fluorescent signal
from Dye-2 at 550 nm. Next, is added to image the fluorescent
signal from Dye-3 at 580 nm, and finally .sub.3'-HO-T-.sub.Dye4 is
added to image the fluorescent signal from Dye-4 at 610 nm.
Results on Photochemical Cleavage Efficiency
[0151] The expected photolysis products of DNA containing a
photocleavable fluorescent dye at the 3 end of the DNA are shown in
FIG. 10. The 2-nitrobenzyl moiety has been successfully employed in
a wide range of studies as a photocleavable-protecting group
(Pillai 1980). The efficiency of the photocleavage step depends on
several factors including the efficiency of light absorption by the
2-nitrobenzyl moiety, the efficiency of the primary photochemical
step, and the efficiency of the secondary thermal processes which
lead to the final cleavage process (Turro 1991). Burgess et al.
(1997) have reported the successful photocleavage of a fluorescent
dye attached through a 2-nitrobenzyl linker on a nucleotide moiety,
which shows that the fluorescent dye is not quenching the
photocleavage process. A photoliable protecting group based on the
2-nitrobenzyl chromophore has also been developed for biological
labeling applications that involve photocleavage (Olejnik et al.
1999). The protocol disclosed herein is used to optimize the
photocleavage process shown in FIG. 10. The absorption spectra of
2-nitro benzyl compounds are examined and compared quantitatively
to the absorption spectra of the fluorescent dyes. Since there will
be a one-to-one relationship between the number of 2-nitrobenzyl
moieties and the dye molecules, the ratio of extinction
coefficients of these two species will reflect the competition for
light absorption at specific wavelengths. From this information,
the wavelengths at which the 2-nitrobenzyl moieties absorbed most
competitively can be determined, similar to the approach reported
by Olejnik et al.(1995).
[0152] A photolysis setup can be used which allows a high
throughput of monochromatic light from a 1000 watt high pressure
xenon lamp (LX1000UV, ILC) in conjunction with a monochromator
(Kratos, Schoeffel Instruments). This instrument allows the
evaluation of the photocleavage of model systems as a function of
the intensity and excitation wavelength of the absorbed light.
Standard analytical analysis is used to determine the extent of
photocleavage. From this information, the efficiency of the
photocleavage as a function of wavelength can be determined. The
wavelength at which photocleavage occurs most efficiently can be
selected as for use in the sequencing system.
[0153] Photocleavage results have been obtained using a model
system as shown in FIG. 11. Coupling of PC-LC-Biotin-NHS ester
(Pierce, Rockford Ill.) with 5-(aminoacetamido)-fluorescein
(5-aminoFAM) (Molecular Probes, Eugene Oreg.) in dimethylsulfonyl
oxide (DMSO)/NaHCO.sub.3 (pH=8.2) overnight at room temperature
produces PC-LC-Biotin-FAM which is composed of a biotin at one end,
a photocleavable 2-nitrobenzyl group in the middle, and a dye tag
(FAM) at the other end. This photocleavable moiety closely mimics
the designed photocleavable nucleotide analogues shown in FIG. 10.
Thus the successful photolysis of the PC-LC-Biotin-FAM moiety
provides proof of the principle of high efficiency photolysis as
used in the DNA sequencing system. For photolysis study,
PC-LC-Biotin-FAM is first immobilized on a microscope glass slide
coated with streptavidin (XENOPORE, Hawthorne N.J.). After washing
off the non-immobilized PC-LC-Biotin-FAM, the fluorescence emission
spectrum of the immobilized PC-LC-Biotin-FAM was taken as shown in
FIG. 12 (Spectrum a). The strong fluorescence emission indicates
that PC-LC-Biotin-FAM is successfully immobilized to the
streptavidin coated slide surface. The photocleavability of the
2-nitrobenzyl linker by irradiation at 350 nm was then tested.
After 10 minutes of photolysis (.lamda..sub.irr=350 nm; .about.0.5
mW/cm.sup.2) and before any washing, the fluorescence emission
spectrum of the same spot on the slide was taken that showed no
decrease in intensity (FIG. 12, Spectrum b), indicating that the
dye (FAM) was not bleached during the photolysis process at 350 nm.
After washing the glass slide with HPLC water following photolysis,
the fluorescence emission spectrum of the same spot on the slide
showed significant intensity decrease (FIG. 12, Spectrum c) which
indicates that most of the fluorescence dye (FAM) was cleaved from
the immobilized biotin moiety and was removed by the washing
procedure. This experiment shows that high efficiency cleavage of
the fluorescent dye can be obtained using the 2-nitrobenzyl
photocleavable linker.
4. Sequencing by Synthesis Evaluation Using Nucleotide Analogues
.sub.3'-RO-A-.sub.Dye1, .sub.3'-RO-C-.sub.Dye2,
.sub.3'-RO-G-.sub.Dye3, .sub.3'-RO-T-.sub.Dye4
[0154] Once the steps and conditions in Section 3 are optimized,
the synthesis of nucleotide analogues .sub.3'-RO-A-.sub.Dye1,
.sub.3'-RO-C-.sub.Dye2, .sub.3'-RO-G-.sub.Dye3,
.sub.3'-RO-T-.sub.Dye4 can be pursued for further study of the
system. Here the 3'-OH is capped in all four nucleotide analogues,
which then can be mixed together with DNA polymerase and used to
evaluate the sequencing system using the scheme in FIG. 9. The MOM
(--CH.sub.2OCH.sub.3) or allyl (--CH.sub.2CH.dbd.CH.sub.2) group is
used to cap the 3'-OH group using well-established synthetic
procedures (FIG. 13) (Fuji et al. 1975, Metzker et al. 1994). These
groups can be removed chemically with high yield as shown in FIG.
14 (Ireland, et al. 1986; Kamal et al. 1999). The chemical cleavage
of the MOM and allyl groups is fairly mild and specific, so as not
to degrade the DNA template moiety. For example, the cleavage of
the allyl group takes 3 minutes with more than 93% yield (Kamal et
al. 1999), while the MOM group is reported to be cleaved with close
to 100% yield (Ireland, et al. 1986).
5. Using Energy Transfer Coupled Dyes to Optimize the Sequencing by
Synthesis System
[0155] The spectral property of the fluorescent tags can be
optimized by using energy transfer (ET) coupled dyes. The ET primer
and ET dideoxynucleotides have been shown to be a superior set of
reagents for 4-color DNA sequencing that allows the use of one
laser to excite multiple sets of fluorescent tags (Ju et al. 1995).
It has been shown that DNA polymerase (Thermo Sequenase and Taq FS)
can efficiently incorporate the ET dye labeled dideoxynucleotides
(Rosenblum et al. 1997). These ET dye-labeled sequencing reagents
are now widely used in large scale DNA sequencing projects, such as
the human genome project. A library of ET dye labeled nucleotide
analogues can be synthesized as shown in FIG. 15 for optimization
of the DNA sequencing system. The ET dye set (FAM-Cl.sub.2FAM,
FAM-Cl.sub.2R6G, FAM-Cl.sub.2TAM, FAM-Cl.sub.2ROX) using FAM as a
donor and dichloro(FAM, R6G, TAM, ROX) as acceptors has been
reported in the literature (Lee et al. 1997) and constitutes a set
of commercially available DNA sequencing reagents. These ET dye
sets have been proven to produce enhanced fluorescence intensity,
and the nucleotides labeled with these ET dyes at the 5-position of
T and C and the 7-position of G and A are excellent substrates of
DNA polymerase. Alternatively, an ET dye set can be constructed
using cyanine (Cy2) as a donor and Cl.sub.2FAM, Cl.sub.2R6G,
Cl.sub.2TAM, or Cl.sub.2ROX as energy acceptors. Since Cy2
possesses higher molar absorbance compared with the rhodamine and
fluorescein derivatives, an ET system using Cy2 as a donor produces
much stronger fluorescence signals than the system using FAM as a
donor (Hung et al. 1996). FIG. 16 shows a synthetic scheme for an
ET dye labeled nucleotide analogue with Cy2 as a donor and
Cl.sub.2FAM as an acceptor using similar coupling chemistry as for
the synthesis of an energy transfer system using FAM as a donor
(Lee et al. 1997). Coupling of Cl.sub.2FAM (I) with spacer
4-aminomethylbenzoic acid (II) produces III, which is then
converted to NHS ester IV. Coupling of IV with amino-Cy2, and then
converting the resulting compound to a NHS ester produces V, which
subsequently couples with amino-photolinker nucleotide VI yields
the ET dye labeled nucleotide VII.
6. Sequencing by Synthesis Evaluation Using Nucleotide Analogues
.sub.3'-HO-A-.sub.Tag1, .sub.3'-HO-C-.sub.Tag2,
.sub.3'-HO-G-.sub.Tag3, .sub.3'-HO-T-.sub.Tag4
[0156] The precursors of four examples of mass tags are shown in
FIG. 17. The precursors are: (a) acetophenone; (b)
3-fluoroacetophenone; (c) 3,4-difluoroacetophenone; and (d)
3,4-dimethoxyacetophenone. Upon nitration and reduction, four
photoactive tags are produced from the four precursors and used to
code for the identity of each of the four nucleotides (A, C, G, T).
Clean APCI mass spectra are obtained for the four mass tag
precursors (a, b, c, d) as shown in FIG. 18. The peak with m/z of
121 is a, 139 is b, 157 is c, and 181 is d. This result shows that
these four mass tags are extremely stable and produce very high
resolution data in an APCI mass spectrometer with no cross talk
between the mass tags. In the examples shown below, each of the
unique m/z from each mass tag translates to the identity of the
nucleotide [Tag-1 (m/z, 150)=A; Tag-2 (m/z, 168)=C; Tag-3 (m/z,
186)=G; Tag-4 (m/z, 210)=T].
[0157] Different combinations of mass tags and nucleotides can be
used, as indicated by the general scheme: .sub.3'-HO-A-.sub.Tag1,
.sub.3'-HO-C-.sub.Tag2, .sub.3'-HO-G-.sub.Tag3,
.sub.3'-HO-T-.sub.Tag4 where Tag1, Tag2, Tag3, and Tag4 are four
different unique cleavable mass tags. Four specific examples of
nucleotide analogues are shown in FIG. 19. In FIG. 19, "R" is H
when the 3'-OH group is not capped. As discussed above, the photo
cleavable 2-nitro benzyl moiety has been used to link biotin to DNA
and protein for efficient removal by UV light (.about.350 nm)
irradiation (Olejnik et al. 1995, 1999). Four different 2-nitro
benzyl groups with different molecular weights as mass tags are
used to form the mass tag labeled nucleotides as shown in FIG. 19:
2-nitro-.alpha.-methyl-benzyl (Tag-1) codes for A;
2-nitro-.alpha.-methyl-3-fluorobenzyl (Tag-2) codes for C;
2-nitro-.alpha.-methyl-3,4-difluorobenzyl (Tag-3) codes for G;
2-nitro-.alpha.-methyl-3,4-dimethoxybenzyl (Tag-4) codes for T.
[0158] As a representative example, the synthesis of the NHS ester
of one mass tag (Tag-3) is shown in FIG. 20. A similar scheme is
used to create the other mass tags. The synthesis of
.sub.3'-HO-G-.sub.Tag3 is shown in FIG. 21 using well-established
procedures (Prober et al. 1987; Lee et al. 1992 and Hobbs et al.
1991). 7-propargylamino-dGTP is first prepared by reacting 7-I-dGTP
with N-trifluoroacetylpropargyl amine, which is then coupled with
the NHS-Tag-3 to produce .sub.3'-HO-G-.sub.Tag3. The nucleotide
analogues with a free 3'-OH are good substrates for the
polymerase.
[0159] The sequencing by synthesis approach can be tested using
mass tags using a scheme similar to that show for dyes in FIG. 9. A
DNA template containing a portion of nucleotide sequence that has
no repeated sequences after the priming site, is synthesized and
immobilized to a glass channel. .sub.3'-HO-A-.sub.Tag1 and DNA
polymerase are added to the self-primed DNA moiety to allow the
incorporation of the nucleotide into the 3' site of the DNA. Then
the steps in FIG. 2B are followed (the chemical cleavage is not
required here because the 3'-OH is free) to detect the mass tag
from Tag-1 (m/z=150). Next, .sub.3'-HO-C-.sub.Tag2 is added and the
resulting mass spectra is measured after cleaving Tag-2 (m/z=168).
Next, .sub.3'-HO-G-.sub.Tag3 and .sub.3'-HO-T-.sub.Tag4 are added
in turn and the mass spectra of the cleavage products Tag-3
(m/z=186) and Tag-4 (m/z=210) are measured. Examples of expected
photocleavage products are shown in FIG. 22. The photocleavage
mechanism is as described above for the case where the unique
labels are dyes. Light absorption (300-360 nm) by the aromatic
2-nitro benzyl moiety causes reduction of the 2-nitro group to a
nitroso group and an oxygen insertion into the carbon-hydrogen bond
located in the 2-position followed by cleavage and decarboxylation
(Pillai 1980).
[0160] The synthesis of nucleotide analogues
.sub.3'-RO-A-.sub.Tag1, .sub.3'-RO-C-.sub.Tag2,
.sub.3'-RO-G-.sub.Tag3, .sub.3'-RO-T-.sub.Tag4 can be pursued for
further study of the system a discussed above for the case where
the unique labels are dyes. Here the 3'-OH is capped in all four
nucleotide analogues, which then can be mixed together with DNA
polymerase and used to evaluate the sequencing system using a
scheme similar to that in FIG. 9. The MOM (--CH.sub.2OCH.sub.3) or
allyl (--CH.sub.2CH.dbd.CH.sub.2) group is used to cap the 3'-OH
group using well-established synthetic procedures (FIG. 13) (Fuji
et al. 1975, Metzker et al. 1994). These groups can be removed
chemically with high yield as shown in FIG. 14 (Ireland, et al.
1986; Kamal et al. 1999). The chemical cleavage of the MOM and
allyl groups is fairly mild and specific, so as not to degrade the
DNA template moiety.
7. Parallel Channel System for Sequencing by Synthesis
[0161] FIG. 23 illustrates an example of a parallel channel system.
The system can be used with mass tag labels as shown and also with
dye labels. A plurality of channels in a silica glass chip are
connected on each end of the channel to a well in a well plate. In
the example shown there are 96 channels each connected to its own
wells. The sequencing system also permits a number of channels
other than 96 to be used. 96 channel devices for separating DNA
sequencing and sizing fragments have been reported (Woolley and
Mathies 1994, Woolley et al. 1997, Simpson et al. 1998). The chip
is made by photolithographic masking and chemical etching
techniques. The photolithographically defined channel patterns are
etched in a silica glass substrate, and then capillary channels (id
.about.100 .mu.m) are formed by thermally bonding the etched
substrate to a second silica glass slide. Channels are porous to
increase surface area. The immobilized single stranded DNA template
chip is prepared according to the scheme shown in FIG. 3. Each
channel is first treated with 0.5 M NaOH, washed with water, and is
then coated with high density 3-aminopropyltrimethoxysilane in
aqueous ethanol (Woolley at al. 1994) forming a primary amine
surface. Succinimidyl (NHS) ester of triarylphosphine (1) is
covalently coupled with the primary amine group converting the
amine surface to a novel triarylphosphine surface, which
specifically reacts with DNA containing an azido group (2) forming
a chip with immobilized DNA. Since the azido group is only located
at the 5' end of the DNA and the coupling reaction is through the
unique reaction of triarylphosphine moiety with azido group in
aqueous solution (Saxon and Bertozzi 2000), such a DNA surface
provides an optimized condition for hybridization. Fluids, such as
sequencing reagents and washing solutions, can be easily pressure
driven between the two 96 well plates to wash and add reagents to
each channel in the chip for carrying out the polymerase reaction
as well as collecting the photocleaved labels. The silica chip is
transparent to ultraviolet light (.lamda..about.350 nm). In the
Figure, photocleaved mass tags are detected by an APCI mass
spectrometer upon irradiation with a UV light source.
8. Parallel Mass Tag Sequencing by Synthesis System
[0162] The approach disclosed herein comprises detecting four
unique photoreleased mass tags, which can have molecular weights
from 150 to 250 daltons, to decode the DNA sequence, thereby
obviating the issue of detecting large DNA fragments using a mass
spectrometer as well as the stringent sample requirement for using
mass spectrometry to directly detect long DNA fragments. It takes
10 seconds or less to analyze each mass tag using the APCI mass
spectrometer. With 8 miniaturized APCI mass spectrometers in a
system, close to 100,000 bp of high quality digital DNA sequencing
data could be generated each day by each instrument using this
approach. Since there is no separation and purification
requirements using this approach, such a system is cost
effective.
[0163] To make mass spectrometry competitive with a 96 capillary
array method for analyzing DNA, a parallel mass spectrometer
approach is needed. Such a complete system has not been reported
mainly due to the fact that most of the mass spectrometers are
designed to achieve adequate resolution for large biomolecules. The
system disclosed herein requires the detection of four mass tags,
with molecular weight range between 150 and 250 daltons, coding for
the identity of the four nucleotides (A, C, G, T). Since a mass
spectrometer dedicated to detection of these mass tags only
requires high resolution for the mass range of 150 to 250 daltons
instead of covering a wide mass range, the mass spectrometer can be
miniaturized and have a simple design. Either quadrupole (including
ion trap detector) or time-of-flight mass spectrometers can be
selected for the ion optics. While modern mass spectrometer
technology has made it possible to produce miniaturized mass
spectrometers, most current research has focused on the design of a
single stand-alone miniaturized mass spectrometer. Individual
components of the mass spectrometer has been miniaturized for
enhancing the mass spectrometer analysis capability (Liu et al.
2000, Zhang et al. 1999). A miniaturized mass spectrometry system
using multiple analyzers (up to 10) in parallel has been reported
(Badman and Cooks 2000). However, the mass spectrometer of Badman
and Cook was designed to measure only single samples rather than
multiple samples in parallel. They also noted that the
miniaturization of the ion trap limited the capability of the mass
spectrometer to scan wide mass ranges. Since the approach disclosed
herein focuses on detecting four small stable mass tags (the mass
range is less than 300 daltons), multiple miniaturized APCI mass
spectrometers are easily constructed and assembled into a single
unit for parallel analysis of the mass tags for DNA sequencing
analysis.
[0164] A complete parallel mass spectrometry system includes
multiple APCI sources interfaced with multiple analyzers, coupled
with appropriate electronics and power supply configuration. A mass
spectrometry system with parallel detection capability will
overcome the throughput bottleneck issue for application in DNA
analysis. A parallel system containing multiple mass spectrometers
in a single device is illustrated in FIGS. 23 and 24. The examples
in the figures show a system with three mass spectrometers in
parallel. Higher throughput is obtained using a greater number of
in parallel mass spectrometers.
[0165] As illustrated in FIG. 24, the three miniature mass
spectrometers are contained in one device with two turbo-pumps.
Samples are injected into the ion source where they are mixed with
a nebulizer gas and ionized. One turbo pump is used as a
differential pumping system to continuously sweep away free
radicals, neutral compounds and other undesirable elements coming
from the ion source at the orifice between the ion source and the
analyzer. The second turbo pump is used to generate a continuous
vacuum in all three analyzers and detectors simultaneously. Since
the corona discharge mode and scanning mode of mass spectrometers
are the same for each miniaturized mass spectrometer, one power
supply for each analyzer and the ionization source can provide the
necessary power for all three instruments. One power supply for
each of the three independent detectors is used for spectrum
collection. The data obtained are transferred to three independent
A/D converters and processed by the data system simultaneously to
identify the mass tag in the injected sample and thus identify the
nucleotide. Despite containing three mass spectrometers, the entire
device is able to fit on a laboratory bench top.
9. Validate the Complete Sequencing by Synthesis System By
Sequencing P53 Genes
[0166] The tumor suppressor gene p53 can be used as a model system
to validate the DNA sequencing system. The p53 gene is one of the
most frequently mutated genes in human cancer (O'Connor et al.
1997). First, a base pair DNA template (shown below) is synthesized
containing an azido group at the 5 end and a portion of the
sequences from exon 7 and exon 8 of the p53 gene:
TABLE-US-00001 (SEQ ID NO: 2)
5'-N.sub.3-TTCCTGCATGGGCGGCATGAACCCGAGGCCCATCCTCACCAT
CATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTT
TGAGGTGCATT-3'.
[0167] This template is chosen to explore the use of the sequencing
system for the detection of clustered hot spot single base
mutations. The potentially mutated bases are underlined (A, G, C
and T) in the synthetic template. The synthetic template is
immobilized on a sequencing chip or glass channels, then the loop
primer is ligated to the immobilized template as described in FIG.
6, and then the steps in FIG. 2 are followed for sequencing
evaluation. DNA templates generated by PCR can be used to further
validate the DNA sequencing system. The sequencing templates can be
generated by PCR using flanking primers (one of the pair is labeled
with an azido group at the 5' end) in the intron region located at
each p53 exon boundary from a pool of genomic DNA (Boehringer,
Indianapolis, Ind.) as described by Fu et al. (1998) and then
immobilized on the DNA chip for sequencing evaluation.
REFERENCES
[0168] Antao V P, Lai S Y, Tinoco I Jr. (1991) A thermodynamic
study of unusually stable RNA and DNA hairpins. Nucleic Acids Res.
19: 5901-5905. [0169] Axelrod V D, Vartikyan R M, Aivazashvili V A,
Beabealashvili R S. (1978) Specific termination of RNA polymerase
synthesis as a method of RNA and DNA sequencing. Nucleic Acids Res.
5(10): 3549-3563. [0170] Badman E R and Cooks R G. (2000)
Cylindrical Ion Trap Array with Mass Selection by Variation in Trap
Dimensions Anal. Chem. 72(20):5079-5086. [0171] Badman E R and
Cooks R G. (2000) A Parallel Miniature Cylindrical Ion Trap Array.
Anal. Chem. 72(14):3291-3297. [0172] Bowling J M, Bruner K L,
Clarik J L, Tibbetts C. (1991) Neighboring nucleotide interactions
during DNA sequencing gel electrophoresis. Nucleic Acids Res. 19:
3089-3097. [0173] Burgess K, Jacutin S E, Lim D, Shitangkoon A.
(1997) An approach to photolabile, fluorescent protecting groups.
J. Org. Chem. 62(15): 5165-5168. [0174] Canard B, Cardona B,
Sarfati R S. (1995) Catalytic editing properties of DNA
polymerases. Proc. Natl. Acad. Sci. USA 92: 10859-10863. [0175]
Caruthers M H. (1985) Gene synthesis machines: DNA chemistry and
its uses. Science 230: 281-285. [0176] Chee M, Yang R, Hubbell E,
Berno, A, Huang, X C., Stern D, Winkler, J, Lockhart D J, Morris M
S, Fodor, S P. (1996) Accessing genetic information with
high-density DNA arrays. Science. 274: 610-614. [0177] Cheeseman P
C. Method For Sequencing Polynucleotides, U.S. Pat. No. 5,302,509,
issued Apr. 12, 1994. [0178] Dizidic I, Carrol, D I, Stillwell, R
N, and Horning, M G. (1975) Atmospheric pressure ionization (API)
mass spectrometry: formation of phenoxide ions from chlorinated
aromatic compounds Anal. Chem., 47:1308-1312. [0179] Fu D J, Tang
K, Braun A, Reuter D, Darnhofer-Demar B, Little D P, O'Donnell M J,
Cantor C R, Koster H. (1998) Sequencing exons 5 to 8 of the p53
gene by MALDI-TOF mass spectrometry. Nat. Biotechnol. 16: 381-384.
[0180] Fuji K, Nakano S, Fujita E. (1975) An improved method for
methoxymethylation of alcohols under mild acidic conditions.
Synthesis 276-277. [0181] Hobbs F W Jr, Cocuzza A J.
Alkynylamino-Nucleotides. U.S. Pat. No. 5,047,519, issued Sep. 10,
1991. [0182] Hung S C; Ju J; Mathies R A; Glazer A N. (1996)
Cyanine dyes with high absorption cross section as donor
chromophores in energy transfer primers. Anal Biochem. 243(1):
15-27. [0183] Hyman E D, (1988) A new method of sequencing DNA.
Analytical Biochemistry 174: 423-436. [0184] Ireland R E, Varney M
D (1986) Approach to the total synthesis of
chlorothricolide-synthesis of
(+/-)-19.20-dihydro-24-O-methylchlorothricolide, methyl-ester,
ethyl carbonate. J. Org. Chem. 51: 635-648. [0185] Ju J, Glazer A
N, Mathies R A. (1996) Cassette labeling for facile construction of
energy transfer fluorescent primers. Nucleic Acids Res. 24:
1144-1148. [0186] Ju J, Ruan C, Fuller C W, Glazer A N Mathies R A.
(1995) Energy transfer fluorescent dye-labeled primers for DNA
sequencing and analysis. Proc. Natl. Acad. Sci. USA 92: 4347-4351.
[0187] Kamal A, Laxman E, Rao N V. (1999) A mild and rapid
regeneration of alcohols from their allylic ethers by
chlorotrimethylsilane/sodium iodide. Tetrahedron letters 40:
371-372. [0188] Kheterpal I, Scherer J, Clark S M, Radhakrishnan A,
Ju J, Ginther C L, Sensabaugh G F, Mathies R A. (1996) DNA
Sequencing Using a Four-Color Confocal Fluorescence Capillary Array
Scanner. Electrophoresis. 17: 1852-1859. [0189] Khoukhi N, Vaultier
M, Carrie R. (1987) Synthesis and reactivity of methyl-azido
butyrates and ethyl-azido valerates and of the corresponding acid
chlorides as useful reagents for the aminoalkylation. Tetrahedron
43: 1811-1822. [0190] Lee L G, Connell C R, Woo S L, Cheng R D,
Mcardle B F, Fuller C W, Halloran N D, Wilson R K. (1992) DNA
sequencing with dye-labeled terminators and T7
DNA-polymerase-effect of dyes and dNTPs on incorporation of
dye-terminators and probability analysis of termination fragments.
Nucleic Acids Res. 20: 2471-2483. [0191] Lee L G, Spurgeon S L,
Heiner C R, Benson S C, Rosenblum B B, Menchen S M, Graham R J,
Constantinescu A, upadhya K G, Cassel J M, (1997) New energy
transfer dyes for DNA sequencing. Nucleic Acids Res. 25: 2816-2822.
[0192] Liu H. H., Felton C., Xue Q. F., Zhang B., Jedrzejewski P.,
Karger B. L. and Foret F. (2000) Development of multichannel
Devices with an Array of Electrospray tips for high-throughput mass
spectrometry. Anal. Chem. 72:3303-3310. [0193] Metzker M L,
Raghavachari R, Richards S, Jacutin S E, Civitello A, Burgess K,
Gibbs R A. (1994) Termination of DNA synthesis by novel
3'-modified-deoxyribonucleoside 5'-triphosphates. Nucleic Acids
Res. 22: 4259-4267. [0194] O'Connor P M, Jackman J, Bae I, Myers T
G, Fan S, Mutoh M, Scudiero D A, Monks A, Sausville E A, Weinstein
J N, Friend S, Formace A J Jr, Kohn K W. (1997) Characterization of
the p53 tumor suppressor pathway in cell lines of the National
Cancer Institute anticancer drug screen and correlations with the
growth-inhibitory potency of 123 anticancer agents. Cancer Res. 57:
4285-4300. [0195] Olejnik J, Ludemann H C, Krzymanska-Olejnik E,
Berkenkamp S, Hillenkamp F, Rothschild K J. (1999) Photocleavable
peptide-DNA conjugates: synthesis and applications to DNA analysis
using MALDI-MS. Nucleic Acids Res. 27: 4626-4631. [0196] Olejnik J,
Sonar S, Krzymanska-Olejnik E, Rothschild K J. (1995)
Photocleavable biotin derivatives: a versatile approach for the
isolation of biomolecules. Proc. Natl. Acad. Sci. USA. 92:
7590-7594. [0197] Pelletier H, Sawaya M R, Kumar A, Wilson S H,
Kraut J. (1994) Structures of ternary complexes of rat DNA
polymerase .beta., a DNA template-primer, and ddCTP. Science 264:
1891-1903. [0198] Pennisi E. (2000) DOE Team Sequences Three
Chromosomes. Science 288: 417-419. [0199] Pillai V N R. (1980)
Photoremovable Protecting Groups in Organic Synthesis. Synthesis
1-62. [0200] Prober J M, Trainor G L, Dam R J, Hobbs F W, Robertson
C W, Zagursky R J, Cocuzza A J, Jensen M A, Baumeister K. (1987) A
system for rapid DNA sequencing with fluorescent chain-terminating
dideoxynucleotides. Science 238: 336-341. [0201] Rollaf F. (1982)
Sodium-borohydride reactions under phase-transfer
conditions--reduction, of azides to amines. J. Org. Chem., 47:
4327-4329. [0202] Ronaghi M, Uhlen M, Nyren P. (1998) A sequencing
Method based on real-time pyrophosphate. Science 281: 364-365.
[0203] Rosenblum B B, Lee L G, Spurgeon S L, Khan S H, Menchen S M,
Heiner C R, Chen S M. (1997) New dye-labeled terminators for
improved DNA sequencing patterns. Nucleic Acids Res. 25: 4500-4504.
[0204] Roses A. (2000) Pharmacogenetics and the practice of
medicie. Nature. 405: 857-865. [0205] Salas-Solano O, Carrilho E,
Kotler L, Miller A W, Goetzinger W, Sosic Z, Karger B L, (1998)
Routine DNA sequencing of 1000 bases in less than one hour by
capillary electrophoresis with replaceable linear polyacrylamide
solutions. Anal. Chem. 70: 3996-4003. [0206] Saxon E and Bertozzi C
R (2000) Cell surface engineering by a modified Staudinger
reaction. Science 287: 2007-2010. [0207] Schena M, Shalon D, Davis,
R. Brown P. O. (1995) Quantitative monitoring of gene expression
patterns with a cDNA microarray. Science 270: 467-470. [0208]
Simpson P C, Adam D R, Woolley T, Thorsen T, Johnston R, Sensabaugh
G F, and Mathies R A. (1998) High-throughput genetic analysis using
microfabricated 96-sample capillary array electrophoresis
microplates. Proc. Natl. Acad. Sci. U.S.A. 95:2256-2261. [0209]
Smith L M, Sanders J Z, Kaiser R J, Hughes P. Dodd C, Connell C R,
Heiner C, Kent S B H, Hood L E. (1986) Fluorescence detection in
automated DNA sequencing analysis. Nature 321: 674-679. [0210]
Tabor S, Richardson C. C. (1987) DNA sequence analysis with a
modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci.
U.S.A. 84: 4767-4771. [0211] Tabor S. & Richardson, C C. (1995)
A single residue in DNA polymerases of the Escherichia coli DNA
polymerase I family is critical for distinguishing between deoxy-
and dideoxyribonucleotides. Proc. Natl. Acad. Sci. U.S.A. 92:
6339-6343. [0212] Turro N J. (19.91) Modern Molecular
Photochemistry; University Science Books, Mill Valley, Calif.
[0213] Velculescu V E, Zhang, I, Vogelstein, B. and Kinzler K W
(1995) Serial Analysis of Gene Expression. Science 270: 484-487.
[0214] Welch M B, Burgess K, (1999) Synthesis of fluorescent,
photolabile 3'-O-protected nucleoside triphosphates for the base
addition sequencing scheme. Nucleosides and Nucleotides 18:197-201.
[0215] Woolley A T, Mathies R A. (1994) Ultra-high-speed DNA
fragment separations using microfabricated capillary array
electrophoresis chips. Proc. Natl. Acad. Sci. USA. 91: 11348-11352.
[0216] Woolley A T, Sensabaugh G F and Mathies R A. (1997)
High-Speed DNA Genotyping Using Microfabricated Capillary Array
Electrophoresis Chips, Anal. Chem. 69(11):2181-2186. [0217]
Yamakawa H, Ohara O. (1997) A DNA cycle sequencing reaction that
minimizes compressions on automated fluorescent sequencers.
Nucleic. Acids. Res. 25: 1311-1312. [0218] Zhang X H, Chiang V L,
(1996) Single-stranded DNA ligation by T4 RNA ligase for PCR
cloning of 5'-noncoding fragments and coding sequence of a specific
gene. Nucleic Acids Res. 24: 990-991. [0219] Zhang B., Liu H.
Karger B L. Foret F. (1999) Microfabricated devices for capillary
electrophoresis-electrospray mass spectrometry. Anal. Chem.
71:3258-3264. [0220] Zhu Z, Chao J, Yu H, Waggoner A S. (1994)
Directly labeled DNA probes using fluorescent nucleotides with
different length linkers. Nucleic Acids Res. 22: 3418-3422.
Sequence CWU 1
1
2111DNAArtificial SequenceChemically Synthesized Template
1acgtacgacg t 112105DNAArtificial SequenceChemically Synthesized
Template 2ttcctgcatg ggcggcatga acccgaggcc catcctcacc atcatcacac
tggaagactc 60cagtggtaat ctactgggac ggacggaaca gctttgaggt gcatt
105
* * * * *