U.S. patent application number 13/553002 was filed with the patent office on 2013-04-11 for nitrate reductases from red algae, compositions and methods of use thereof.
This patent application is currently assigned to PIONEER HI BRED INTERNATIONAL INC. The applicant listed for this patent is Dale F. Loussaert, Dennis O'Neill, Carl R. Simmons, Haiyin Wang. Invention is credited to Dale F. Loussaert, Dennis O'Neill, Carl R. Simmons, Haiyin Wang.
Application Number | 20130091605 13/553002 |
Document ID | / |
Family ID | 39731751 |
Filed Date | 2013-04-11 |
United States Patent
Application |
20130091605 |
Kind Code |
A1 |
Loussaert; Dale F. ; et
al. |
April 11, 2013 |
NITRATE REDUCTASES FROM RED ALGAE, COMPOSITIONS AND METHODS OF USE
THEREOF
Abstract
The NR enzymes described herein were discovered in the red algae
of Porphyra perforata (PpNR) and Porphyra yezoensis (PyNR). The
present invention provides methods and compositions relating to
altering NR activity, nitrogen utilization and/or uptake in plants.
The invention relates to a method for the production of plants with
maintained or increased yield under low nitrogen fertility. The
invention provides isolated nitrate reductase (NR) nucleic acids
and their encoded proteins. The invention further provides
recombinant expression cassettes, host cells, and transgenic
plants. Plants transformed with nucleotide sequences encoding the
NR enzyme show improved properties, for example, increased yield
and growth.
Inventors: |
Loussaert; Dale F.; (Clive,
IA) ; O'Neill; Dennis; (Ankeny, IA) ; Simmons;
Carl R.; (Des Moines, IA) ; Wang; Haiyin;
(Johnston, IA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Loussaert; Dale F.
O'Neill; Dennis
Simmons; Carl R.
Wang; Haiyin |
Clive
Ankeny
Des Moines
Johnston |
IA
IA
IA
IA |
US
US
US
US |
|
|
Assignee: |
PIONEER HI BRED INTERNATIONAL
INC
Johnston
IA
|
Family ID: |
39731751 |
Appl. No.: |
13/553002 |
Filed: |
July 19, 2012 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12900600 |
Oct 8, 2010 |
8269066 |
|
|
13553002 |
|
|
|
|
12138477 |
Jun 13, 2008 |
7834245 |
|
|
12900600 |
|
|
|
|
60944343 |
Jun 15, 2007 |
|
|
|
Current U.S.
Class: |
800/290 ;
435/191; 435/320.1; 435/412; 435/415; 435/416; 435/419; 435/468;
536/23.2; 800/278; 800/298; 800/312; 800/314; 800/320; 800/320.1;
800/320.2; 800/320.3; 800/322 |
Current CPC
Class: |
C12N 15/8261 20130101;
C12N 9/0036 20130101; C12N 15/8243 20130101; Y02A 40/146
20180101 |
Class at
Publication: |
800/290 ;
435/191; 435/320.1; 435/419; 800/298; 800/320.1; 800/312; 800/322;
800/320; 800/320.3; 800/314; 800/320.2; 435/412; 435/415; 435/416;
435/468; 800/278; 536/23.2 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Claims
1. An isolated nitrate reductase (NR) polynucleotide comprising a
member selected from the group consisting of: (a) a polynucleotide
that encodes the polypeptide of SEQ ID NO: 7, 8, 9, 10, 11 or 12;
(b) a polynucleotide comprising the sequence set forth in SEQ ID
NO: 1, 2, 3, 4, 5 or 6; and (c) a polynucleotide comprising at
least 30 nucleotides in length which hybridizes under stringent
conditions to a polynucleotide of (a) or (b), wherein the
conditions include hybridization in 40 to 45% formamide, 1 M NaCl,
1% SDS at 37.degree. C. and a wash in 0.5.times. to 1.times.SSC at
55 to 60.degree. C.; and (d) a polynucleotide having at least 70%
sequence identity to SEQ ID NO: 1, 2, 3, 4, 5 or 6, wherein the %
sequence identity is based on the entire encoding region and is
determined by BLAST 2.0 under default parameters wherein the
polynucleotide encodes a polypeptide having nitrate reductase (NR)
activity; and (e) an isolated polynucleotide degenerate from any of
(a) to (e) as a result of the genetic code; (f) a polynucleotide
complimentary to a polynucleotide of any one of (a) to (e).
2. An isolated polynucleotide according to claim 1 that encodes a
NR polypeptide that confers increased yield or nitrogen utilization
efficiency under lower fertility.
3. A vector comprising at least one polynucleotide of claim 1.
4. An expression cassette comprising at least one polynucleotide of
claim 1 operably linked to a promoter, wherein the polynucleotide
is in sense orientation.
5. A host cell into which is introduced at least one expression
cassette of claim 4.
6. The host cell of claim 5 that is a plant cell.
7. A transgenic plant comprising at least one expression cassette
of claim 4.
8. The transgenic plant of claim 7, wherein the plant is selected
from the group consisting of: corn, soybean, sunflower, sorghum,
canola, wheat, alfalfa, cotton, rice, barley and millet.
9. A seed from the transgenic plant of claim 7.
10. The seed of claim 9, wherein the seed is corn, soybean,
sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley or
millet.
11. An isolated polypeptide selected from the group consisting of:
a) an isolated polypeptide comprising any one of SEQ ID NOS: 7, 8,
9, 10, 11 or 12 said polypeptide having NR activity; b) a
polypeptide that is at least 70% identical to the amino acid
sequence of any of SEQ ID NOS: 7, 8, 9, 10, 11 or 12 said
polypeptide having NR activity; c) a polypeptide that is encoded by
a nucleic acid molecule comprising a nucleotide sequence that is at
least 70% identical to any one of SEQ ID NOS: 1, 2, 3, 4, 5 or 6 or
a complement thereof, said polypeptide having NR activity; d) a
polypeptide that is encoded by a nucleic acid molecule that
hybridizes with a nucleic acid probe consisting of the nucleotide
sequence of any of SEQ ID NOS: 1, 2 or 3, or a complement thereof
following at least one wash in 0.2.times.SSC at 55.degree. C. for
20 minutes, said polypeptide having NR activity; e) a fragment
comprising at least 200 consecutive amino acids of any of SEQ ID
NOS: 7, 8, 9, 10, 11, or 12, said polypeptide having NR
activity.
12. A recombinant expression cassette comprising a polynucleotide
operably linked to a promoter, wherein the polynucleotide encodes
the polypeptide of claim 11.
13. A transformed host cell comprising the isolated polypeptide of
claim 11.
14. The host cell of claim 13, wherein the host cell is a
transformed plant cell.
15. The plant cell of claim 14, wherein the plant cell is selected
from the group consisting of sorghum, maize, rice, wheat, soybean,
sunflower, canola, alfalfa, barley and millet.
16. A transformed plant regenerated from the plant cell of claim
14.
17. The plant of claim 16, wherein the plant is sorghum, maize,
rice, wheat, soybean, sunflower, canola, alfalfa, barley or
millet.
18. A transformed seed of the plant of claim 16.
19. An isolated polypeptide encoded by the polynucleotide of SEQ ID
NO: 1, 2, 3, 4, 5 or 6.
20. The isolated polypeptide of claim 11 wherein the expression of
NR in a plant results in an increased yield in the plant as
compared to a control plant, wherein the control plant that does
not contain the polynucleotide encoding the NR.
21. A method of modulating the level of nitrate reductase (NR)
protein in a plant cell, comprising: (a) transforming a plant cell
with a NR polynucleotide operably linked to a promoter, wherein the
polynucleotide is in sense orientation; and (b) expressing the
polynucleotide for a time sufficient to modulate the NR protein in
the plant cell.
22. The method of claim 21, wherein the plant is corn, soybean,
sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley or
millet.
23. The method of claim 21, wherein NR protein is increased.
24. The method of claim 21, wherein NR protein is decreased.
25. A method of modulating the level of nitrate reductase (NR)
protein in a plant, comprising: (a) stably transforming a plant
cell with a NR polynucleotide operably linked to a promoter,
wherein the polynucleotide is in sense orientation; and (b)
regenerating the transformed plant cell into a transformed plant
that expresses the NR polynucleotide in an amount sufficient to
modulate the level of NR protein in the plant.
26. The method of claim 25, wherein the plant is corn, soybean,
sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley or
millet.
27. The method of claim 25, wherein NR protein is increased as
compared to a control plant, wherein the control plant that does
not contain the polynucleotide encoding the NR.
28. The method of claim 25, wherein NR protein is decreased as
compared to a control plant, wherein the control plant that does
not contain the polynucleotide encoding the NR.
29. A method for increasing yield in a plant, said method
comprising the steps of: (a) introducing into plant cells a
construct comprising a polynucleotide encoding a nitrate reductase
(NR), wherein said NR polynucleotide is operably linked to a
promoter functional in plant cells to yield transformed plant
cells, and wherein the NR encoding the NR protein is selected from
the group consisting of: (1) a polynucleotide that encodes the
polypeptide of SEQ ID NO: 7, 8, 9, 10, 11 or 12; (2) a
polynucleotide comprising the sequence set forth in the encoding
region of SEQ ID NO: 7, 8, 9, 10, 11 or 12; and (3) a
polynucleotide comprising at least 30 nucleotides in length which
hybridizes under moderate stringency conditions to a polynucleotide
of (a) or (b), wherein the conditions include hybridization in 40
to 45% formamide, 1 M NaCl, 1% SDS at 37.degree. C. and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C.; and (4) a
polynucleotide having at least 70% sequence identity to SEQ ID NO:
1, 2, 3, 4, 5 or 6, wherein the % sequence identity is based on the
entire encoding region and is determined by BLAST 2.0 under default
parameters; and (5) an isolated polynucleotide degenerate from any
of (1) to (4) as a result of the genetic code; (6) a polynucleotide
complimentary to a polynucleotide of any one of (1) to (5); (b)
regenerating a transgenic plant from said transformed plant cells,
wherein said NR is expressed in the cells of said transgenic plant
at levels sufficient to maintain or increase yield in said
transgenic plant.
30. The method of claim 29, wherein increased yield comprises
enhanced root growth, increased seed size, increased seed weight,
the plant has seed with increased embryo size, increased leaf size,
increased seedling vigor, enhanced silk emergence, increased ear
size or chlorophyll content.
31. The method of claim 29, wherein the plant is grown under
limited nitrogen fertility.
32. The method of claim 31, wherein the nitrogen utilization
efficiency of the plant is increased.
33. The method of claim 31, wherein NR activity of the NR
polynucleotide is increased compared to the activity of a NR
endogenous to the plant.
34. The method of claim 29, wherein the expression of the NR
polynucleotide is driven by a phosphoenopyruvate decarboxylase
(PEPC) promoter.
35. The method of claim 29, wherein said polynucleotide encoding
the NR is constitutively expressed.
36. The method of claim 29, wherein said polynucleotide encoding
the NR is inducibly expressed.
37. The method of claim 29, wherein said polynucleotide encoding
the NR is expressed in a cell-specific, tissue-specific, or
organ-specific manner.
38. The method of claim 29, wherein the plant is a dicotyledonous
plant.
39. The method of claim 29, wherein the plant is a monocotyledonous
plant.
40. The method of claim 29, wherein the yield of the plant is
compared to a control plant, wherein the control plant does not
contain the polynucleotide encoding the NR.
Description
CROSS REFERENCE
[0001] This divisional application claims benefit of U.S. patent
application Ser. No. 12/900,600, filed Oct. 8, 2010 which claims
benefit of U.S. patent application Ser. No. 12/138,477, filed Jun.
13, 2008, now U.S. Pat. No. 7,834,245 issued Nov. 6, 2010, which
claims the benefit U.S. Provisional Application Ser. No.
60/944,343, filed Jun. 15, 2007, all of which are incorporated
herein by reference.
BACKGROUND OF THE INVENTION
[0002] The domestication of many plants has correlated with
dramatic increases in yield. The identification of specific genes
responsible for the dramatic differences in yield, in domesticated
plants, has become an important focus of agricultural research.
[0003] One group of genes effecting yield are the nitrate reductase
genes. These genes have utility for improving the use of nitrogen
in crop plants, especially maize. The genes can be used to alter
the genetic composition of the plants rendering them more
productive with current fertilizer application standards or
maintaining their productive rates with significantly reduced
fertilizer input. Increased nitrogen use efficiency can result from
enhanced uptake and assimilation of nitrogen fertilizer and/or the
subsequent remobilization and reutilization of accumulated nitrogen
reserves. Plants containing these genes can therefore be used for
the enhancement of yield. Improving the nitrogen use efficiency in
corn would increase corn harvestable yield per unit of input
nitrogen fertilizer, both in developing nations where access to
nitrogen fertilizer is limited and in developed nations were the
level of nitrogen use remains high. Nitrogen utilization
improvement also allows decreases in on-farm input costs, decreased
use and dependence on the non-renewable energy sources required for
nitrogen fertilizer production and decreases the environmental
impact of nitrogen fertilizer manufacturing and agricultural
use.
[0004] Many efforts have recently been made to improve nitrogen
efficiency of crop plants through overexpression of nitrate
reductase (NR) in plants. One group has applied expression of the
Nicotiana plumbaginifolia and Arabidopsis thaliana NR cDNA or gene
under control of different promoters such as .sup.35S CaMV
(Nicotiana plumbaginifolia) Ferrario, et al., (1995) Planta
196:288-294 and Lhcb1*3::Nia1*2 (Arabidopsis thaliana) Nejidat, et
al., (1997) Plant Science 130:41-49. (References). Although
increases in NR expression levels up to 2-5-fold were detected with
the .sup.35S CaMV::Nia-2 gene in Nicotiana plumbaginifolia plants
(Foyer, et al., (1994) Plant Physiol. 104:171-178), no improved
nitrogen efficiency was observed. All these attempts to over
express this enzyme have not resulted in improved growth under
lower nitrogen fertility.
[0005] Therefore, despite several attempts to improve NR
efficiency, no satisfactory composition or method has been provided
that leads to an improvement of growth, productivity and/or yield
for agricultural crop plants. For these and other reasons, there is
a need for the present invention.
BRIEF SUMMARY OF THE INVENTION
[0006] The present invention provides polynucleotides, related
polypeptides and all conservatively modified variants of the
present NR sequences. The invention provides sequences for the NR
genes.
[0007] The present invention presents methods to alter the genetic
composition of crop plants, especially maize, so that such crops
can be more productive with current fertilizer applications and/or
as productive with significantly reduced fertilizer input. The
utility of this class of invention is then both yield enhancement
and reduced fertilizer costs with corresponding reduced impact to
the environment.
[0008] Therefore, in one aspect, the present invention relates to
an isolated nucleic acid comprising an isolated polynucleotide
sequence encoding an NR gene. One embodiment of the invention is an
isolated polynucleotide comprising a nucleotide sequence selected
from the group consisting of: (a) the nucleotide sequence
comprising SEQ ID NO: 1, 2, 3, 4, 5 or 6 and (c) the nucleotide
sequence comprising at least 70% sequence identity to SEQ ID NO: 1,
2, 3, 4, 5 or 6, wherein said polynucleotide encodes a polypeptide
having increased NR activity.
[0009] Compositions of the invention include an isolated
polypeptide comprising an amino acid sequence selected from the
group consisting of: (a) the amino acid sequence comprising SEQ ID
NO: 7, 8, 9, 10, 11 or 12 and (b) the amino acid sequence
comprising at least 70% sequence identity to SEQ ID NO: 7, 8, 9,
10, 11 or 12, wherein said polypeptide has increased NR
activity.
[0010] In another aspect, the present invention relates to a
recombinant expression cassette comprising a nucleic acid as
described. Additionally, the present invention relates to a vector
containing the recombinant expression cassette. Further, the vector
containing the recombinant expression cassette can facilitate the
transcription and translation of the nucleic acid in a host cell.
The present invention also relates to the host cells able to
express the polynucleotide of the present invention. A number of
host cells could be used, such as but not limited to, microbial,
mammalian, plant or insect.
[0011] In yet another embodiment, the present invention is directed
to a transgenic plant or plant cells, containing the nucleic acids
of the present invention. Preferred plants containing the
polynucleotides of the present invention include but are not
limited to maize, soybean, sunflower, sorghum, canola, wheat,
alfalfa, cotton, rice, barley, tomato, and millet. In another
embodiment, the transgenic plant is a maize plant or plant cells.
Another embodiment is the transgenic seeds from the transgenic NR
polypeptide of the invention operably linked to a promoter that
drives expression in the plant. The plants of the invention can
have altered NR as compared to a control plant. In some plants, the
NR is altered in a vegetative tissue, a reproductive tissue or a
vegetative tissue and a reproductive tissue. Plants of the
invention can have at least one of the following phenotypes
including but not limited to: increased root mass, increased root
length, increased leaf size, increased ear size, increased seed
size, increased endosperm size and increased biomass
[0012] Another embodiment of the invention would be plants that
have been genetically modified at a genomic locus, wherein the
genomic locus encodes a NR polypeptide of the invention.
[0013] Methods for increasing the activity of a NR polypeptide in a
plant are provided. The method can comprise introducing into the
plant an NR polynucleotide of the invention.
[0014] Methods for reducing or eliminating the level of NR
polypeptide in the plant are provided. The level or activity of the
polypeptide could also be reduced or eliminated in specific
tissues, causing alteration in plant growth, growth rate or
nitrogen utilization efficiency (NUE). Reducing the level and/or
activity of the NR polypeptide may lead to smaller stature or
slower growth of plants.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The invention can be more fully understood from the
following detailed description and the accompanying drawing and
Sequence Listing which form a part of this application.
[0016] FIG. 1. Peptide sequence comparison between Porphyra
perforata (PpNR--SEQ ID NO: 5) and P. yezoensis (PyNR--SEQ ID NO:
10). PpNR and PyNR are approximately 94% identical. The identical
amino acid residues are in bold and similar ones are
underlined.
[0017] FIG. 2. Yeast nitrate transporter YNT1 was cloned from
Pichia angusta based on the published sequence (GenBank Accession
Number Z69783). YNT1 driven by a constitutive promoter
glyceraldehyde-3-phosphate dehydrogenase (GAP) from P. pastoris
with histidine auxotroph selection marker (p3.5GAP-YNT1) was
integrated into His4 locus of P. pastoris strain KM71 (Invitrogen)
using Pichia EasyComp transformation kit (Invitrogen). The
recombinant strains were confirmed to carry the YNT1 expression
cassette by PCR. The KM71-containing YNT1 line was re-transformed
with nitrate reductase gene PPNR from Porphyra perforate driven by
GAP promoter with Zeocin selection marker (pAOXGAP-PPNR) which
integrated into AOX1 locus of P. pastoris genome. Nitrate reductase
enzyme activity was assayed in vivo. Four transformants and KM71
wild type were cultured in rich media (YPD) at 30.degree. C. for
overnight. Yeast cells were collected and washed with water twice
then re-suspended in 20 uM MOPS, pH6.5 and 1% glucose containing 5
mM NaNO.sub.3. After 1 hour incubation at 30.degree. C., the
supernatant was collected for nitrite assay with 1% Sulfanilamide,
0.01% N-(1-Naphthyl) ethylene-diamine dihydrochloride and 15% (v/v)
H.sub.3PO.sub.4. Strong NR activity was detected in transformants
carrying PPNR comparing to KM71 wild type strain.
[0018] FIG. 3. The KM71-containing YNT1 line (see, FIG. 2) was
re-transformed with nitrate reductase gene PYNR from Porphyra
yezoensis driven by GAP promoter with Zeocin selection marker
(pAOXGAP-PYNR) which integrated into AOX1 locus of P. pastoris
genome. In this case, the nitrate reductase enzyme activity from
two transformants and KM71 wild type was assayed in vivo as before.
The NR activity was detected from the transformants carrying PYNR
comparing to KM71 wild type strain. However, the PYNR activity is
much weaker then PPNR in P. pastoris.
[0019] FIG. 4. Yeast nitrate reductase YNR1 was cloned from Pichia
angusta based on the published sequence (GenBank Accession Number
Z49110). The KM71-containing YNT1 line was re-transformed with
nitrate reductase gene YNR1 driven by GAP promoter with Zeocin
selection marker (pAOXGAP-YNR1) which integrated into AOX1 locus of
P. pastoris genome. The transformant with the best Vmax was used
for kinetic study.
[0020] Maize nitrate reductase ZmNR was cloned from maize B73
(assembled from two truncated ESTs) based on the published genomic
sequence (GenBank Accession Number AF153448). The cloned ZmNR has
three different amino acid residues compared to AF153448. The
KM71-containing YNT1 line was re-transformed with nitrate reductase
gene ZMNR driven by GAP promoter with Zeocin selection marker
(pAOXGAP-ZMNR) which integrated into AOX1 locus of P. pastoris
genome. The transformant with the best Vmax was used for kinetic
study.
[0021] The transformants carrying YNT1/YNR1, YNT1/ZMNR or YNT1/PPNR
and KM71 wild type were cultured in rich media (YPD) at 30.degree.
C. for overnight. Yeast cells were collected and washed with water
twice then re-suspended in 20 .mu.M MOPS, pH6.5 or 20 .mu.M MES,
pH5.5 or 20 .mu.M Tris, pH7.5 with 1% glucose containing 24
different concentrations of NaNO.sub.3 from 0 up to 30 mM (0, 0.02,
0.04, 0.06, 0.08, 0.1, 0.12, 0.14, 0.16, 0.18, 0.2, 0.3, 0.4, 0.6,
0.8, 1, 2, 4, 8, 10, 15, 20, 25 and 30 mM). The reduced nitrite was
assayed as mentioned above. The Km was estimated as the substrate
concentration at 1/2 Vmax. The Km and preferred pH (with the best
Vmax) of YNR1, ZMNR and PPNR was summarized in the table. Please
note that although the diagram shows YNR1 as the lowest line on the
chart, only one tenth the volume of YNR1 material was used in the
experiment, therefore the YNR1 had the best Vmax in the
experiment.
[0022] FIG. 5. The constructs of PPNR and PYNR driven by UBI
promoter and/or maize nitrate reductase ZMNR promoter were made.
The resulting constructs, PHP27800, PHP27801, PHP28335 and PHP28334
were used for maize transformation. Transgenic maize segregating
1:1 for UBI:Porphyra perforata NR was grown to anthesis in
hydroponics medium maintained at 1 mM KNO.sub.3 as the sole
nitrogen source. Plants containing the transgene were identified
during growth. All plants were harvested shortly after anthesis.
The ear and the remaining plant were separated, dried in a forced
air oven at 70.degree. C. for 72 hr and weighed. Mean ear dry
weight of each event transgenic plants were compared to the ear dry
weight of the corresponding nulls. Similar comparisons were made
between transgenic mean plant dry weight and the corresponding
event nulls. Comparisons marked with * are statistically
significant (p>t=0.1). This figure is a graphical representation
of the data described in Example 10.
BRIEF DESCRIPTION OF THE SEQUENCES
[0023] The application provides details of NR sequences as shown in
Table 1 below.
TABLE-US-00001 TABLE 1 SEQ ID Polynucleotide (pnt) NO: or
polypeptide (ppt) Length Identification 1 pnt 2865 PpNR. 2 pnt 2865
Codon optimized polynucleotide sequence encoding PpNR S561Ala 3 pnt
2865 Codon optimized polynucleotide sequence encoding PpNR S561Asp
4 pnt 2871 PyNR 5 pnt 2871 Codon optimized polynucleotide sequence
encoding PyNR S563Ala 6 pnt 2871 Codon optimized polynucleotide
sequence encoding PyNR S563Asp 7 ppt 954 PpNR. 8 ppt 954 PpNR
S561Ala - encoded by codon optimized polynucleotide 9 ppt 954 PpNR
S561Asp - encoded by codon optimized polynucleotide 10 ppt 954 PyNR
11 ppt 956 PyNR S563Ala - encoded by codon optimized polynucleotide
12 ppt 956 PyNR S563Asp - encoded by codon optimized polynucleotide
13 pnt 26 PYNR sense primer 14 pnt 20 PYNR anti-sense primer 15 pnt
20 PpNR walking primer 16 pnt 20 PpNR walking primer 17 pnt 20 PpNR
walking primer 18 pnt 25 PpNR walking primer 19 pnt 24 PpNR walking
primer 20 pnt 25 PpNR walking primer 21 pnt 21 ORF PpNR sense
primer 22 pnt 21 ORF PpNR anti-sense primer 23 pnt 19 ORF PyNR
sense primer 24 pnt 22 ORF PyNR anti-sense primer
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0024] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Unless
mentioned otherwise, the techniques employed or contemplated herein
are standard methodologies well known to one of ordinary skill in
the art. The materials, methods and examples are illustrative only
and not limiting. The following is presented by way of illustration
and is not intended to limit the scope of the invention.
[0025] The present inventions now will be described more fully
hereinafter with reference to the accompanying drawings, in which
some, but not all embodiments of the invention are shown. Indeed,
these inventions may be embodied in many different forms and should
not be construed as limited to the embodiments set forth herein;
rather, these embodiments are provided so that this disclosure will
satisfy applicable legal requirements. Like numbers refer to like
elements throughout.
[0026] Many modifications and other embodiments of the inventions
set forth herein will come to mind to one skilled in the art to
which these inventions pertain having the benefit of the teachings
presented in the foregoing descriptions and the associated
drawings. Therefore, it is to be understood that the inventions are
not to be limited to the specific embodiments disclosed and that
modifications and other embodiments are intended to be included
within the scope of the appended claims. Although specific terms
are employed herein, they are used in a generic and descriptive
sense only and not for purposes of limitation.
Overview
[0027] Nitrate is the most important source of nitrogen for higher
plants. Nitrate is absorbed by the roots, transported to various
tissues of the plant and then reduced to aqueous ammonia in two
steps. The first step requires the enzyme nitrate reductase (NR),
which catalyzes the reduction of nitrate to nitrite in the
cytoplasm. In a second step, the nitrite is then reduced in the
chloroplast by nitrite reductase. The reduction of nitrate is
considered to be limiting step in nitrate metabolism in plants.
[0028] Plant nitrate reductases are regulated at both
transcriptional and post-translational levels. Several
environmental factors such as light or nitrate regulate NR gene
expression at transcriptional level. NR activity is also regulated
at post-translational level by light. NR becomes inactive/active in
response to dark/light by phosphorylation/dephosphorylation at
putative Ser residues. The inactive form of NR binds to 14-3-3
protein in the dark. The putative regulation sites include
N-terminal region (Plant Cell (1995) 7:611-621), hinge 1 (Plant J.
(2003) 35:566-573) and other regions.
[0029] The present invention relates to the discovery of novel NRs
from red algae (division of Rhodophyta) of Porphyra perforate
(PpNR) and Porphyra yezoensis (PyNR). As described herein, the
inventors have identified two novel NR cDNAs in red algae that
share approximately 94% amino acid consensus with respect to one
another but only 52% amino acid identity to a maize homolog of NR
from B73 (Genbank Accession Number AF153448). The algal NR
polynucleotides of this invention are 2865 bp (PpNR) and 2871 bp
(PyNR), nucleotides in length encoding polypeptides with calculated
molecular weight of 104.9 KDa (PpNR) and 105.2 KDa (PyNR). Also
contemplated are variants of these sequences. For example, mutating
the serine residue in a putative phosphorylation motif
R/K-S/T-X-pS-X-P (J of Experimental Botany (2004) 55:1275-1282) at
position 561 to an alanine or aspartic acid of the PpNR or an
alanine or aspartic acid at position 563 of the PyNR sequence is
believed to increase and maintain high level of active form of
nitrate reductase in transgenic plants to facilitate nitrate
assimilation.
[0030] Red algae (division of Rhodophyta) of Porphyra perforate
(PpNR) and Porphyra yezoensis (PyNR) grow in concentrations of
nitrate that are approximately one hundred times lower than the
nitrate concentrations in which plants are capable of growing.
These red algae have more efficient nitrate reductase enzymes that
saturate at lower substrate concentrations than higher plant
nitrate reductase. In particular, Porphyra perforate and Porphyra
yezoensis have been reported in the literature to have a NR enzyme
with a low Km for nitrate (30-65 .mu.M). This is in contrast to a
maize NR from B73 which has a Km for nitrate reductase of 300
.mu.M. In vivo kinetic measurements made of PpNR and PyNR expressed
in Pichia pastoris show this enzyme has a Km for nitrate of 30-50
.mu.M compared to maize nitrate reductase Km of 200 .mu.M. Without
wishing to be bound by this theory, it is believed that expressing
more efficient NRs that saturate at lower concentrations of
substrate than the higher plant NR enzymes will be more efficient
in nitrogen reduction. Modulation of the NRs of the present
invention would provide a mechanism for manipulating a plant's
nitrogen utilization efficiency (NUE). Accordingly, the present
invention provides methods, polynucleotides and polypeptides for
the production of plants with improved or maintained yield under
limited nitrogen supply. In one aspect, the methods include
introducing into a plant cell, plant tissue or plant one or more
polynucleotides encoding NR polypeptides having the enzymatic
activity of nitrate reductase. This may be accomplished by
introducing the nitrate reductase polynucleotides driven by a
constitutive promoter or a mesophyll cell preferred promoter into
the plant nuclear genome.
[0031] Advantageously, plants expressing a NR of the present
invention will provide the customer increased revenue by lowering
input costs and/or increasing yields with a significant reduction
in applied nitrogen fertilizer. Furthermore, yields may be
maintained or increased in plants expressing a NR of the present
invention even under non-favorable growth conditions, for example,
where nitrogen is in limited supply.
[0032] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of botany,
microbiology, tissue culture, molecular biology, chemistry,
biochemistry and recombinant DNA technology, which are within the
skill of the art. Such techniques are explained fully in the
literature. See, e.g., Langenheim and Thimann, (1982) Botany: Plant
Biology and Its Relation to Human Affairs, John Wiley; Cell Culture
and Somatic Cell Genetics of Plants, vol. 1, Vasil, ed. (1984);
Stanier, et al., (1986) The Microbial World, 5.sup.th ed.,
Prentice-Hall; Dhringra and Sinclair, (1985) Basic Plant Pathology
Methods, CRC Press; Maniatis, et al., (1982) Molecular Cloning: A
Laboratory Manual; DNA Cloning, vols. I and II, Glover, ed. (1985);
Oligonucleotide Synthesis, Gait, ed. (1984); Nucleic Acid
Hybridization, Hames and Higgins, eds. (1984); and the series
Methods in Enzymology, Colowick and Kaplan, eds, Academic Press,
Inc., San Diego, Calif.
[0033] Units, prefixes and symbols may be denoted in their SI
accepted form. Unless otherwise indicated, nucleic acids are
written left to right in 5' to 3' orientation; amino acid sequences
are written left to right in amino to carboxy orientation,
respectively. Numeric ranges are inclusive of the numbers defining
the range. Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes. The terms defined below are more
fully defined by reference to the specification as a whole.
DEFINITIONS
[0034] In describing the present invention, the following terms
will be employed and are intended to be defined as indicated
below.
[0035] By "microbe" is meant any microorganism (including both
eukaryotic and prokaryotic microorganisms), such as fungi, yeast,
bacteria, actinomycetes, algae and protozoa, as well as other
unicellular structures.
[0036] By "amplified" is meant the construction of multiple copies
of a nucleic acid sequence or multiple copies complementary to the
nucleic acid sequence using at least one of the nucleic acid
sequences as a template. Amplification systems include the
polymerase chain reaction (PCR) system, ligase chain reaction (LCR)
system, nucleic acid sequence based amplification (NASBA, Cangene,
Mississauga, Ontario), Q-Beta Replicase systems,
transcription-based amplification system (TAS) and strand
displacement amplification (SDA). See, e.g., Diagnostic Molecular
Microbiology: Principles and Applications, Persing, et al., eds.,
American Society for Microbiology, Washington, D.C. (1993). The
product of amplification is termed an amplicon.
[0037] The term "conservatively modified variants" applies to both
amino acid and nucleic acid sequences. With respect to particular
nucleic acid sequences, conservatively modified variants refer to
those nucleic acids that encode identical or conservatively
modified variants of the amino acid sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations" and represent one species
of conservatively modified variation. Every nucleic acid sequence
herein that encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of ordinary skill will
recognize that each codon in a nucleic acid (except AUG, which is
ordinarily the only codon for methionine; one exception is
Micrococcus rubens, for which GTG is the methionine codon
(Ishizuka, et al., (1993) J. Gen. Microbiol. 139:425-32) can be
modified to yield a functionally identical molecule. Accordingly,
each silent variation of a nucleic acid, which encodes a
polypeptide of the present invention, is implicit in each described
polypeptide sequence and incorporated herein by reference.
[0038] As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" when
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Thus, any number of amino acid
residues selected from the group of integers consisting of from 1
to 15 can be so altered. Thus, for example, 1, 2, 3, 4, 5, 7 or 10
alterations can be made. Conservatively modified variants typically
provide similar biological activity as the unmodified polypeptide
sequence from which they are derived. For example, substrate
specificity, enzyme activity, or ligand/receptor binding is
generally at least 30%, 40%, 50%, 60%, 70%, 80% or 90%, preferably
60-90% of the native protein for it's native substrate.
Conservative substitution tables providing functionally similar
amino acids are well known in the art.
[0039] The following six groups each contain amino acids that are
conservative substitutions for one another: [0040] 1) Alanine (A),
Serine (S), Threonine (T); [0041] 2) Aspartic acid (D), Glutamic
acid (E); [0042] 3) Asparagine (N), Glutamine (Q); [0043] 4)
Arginine (R), Lysine (K); [0044] 5) Isoleucine (I), Leucine (L),
Methionine (M), Valine (V); and [0045] 6) Phenylalanine (F),
Tyrosine (Y), Tryptophan (W). See also, Creighton, Proteins, W.H.
Freeman and Co. (1984).
[0046] As used herein, "consisting essentially of" means the
inclusion of additional sequences to an object polynucleotide where
the additional sequences do not selectively hybridize, under
stringent hybridization conditions, to the same cDNA as the
polynucleotide and where the hybridization conditions include a
wash step in 0.1.times.SSC and 0.1% sodium dodecyl sulfate at
65.degree. C.
[0047] By "encoding" or "encoded," with respect to a specified
nucleic acid, is meant comprising the information for translation
into the specified protein. A nucleic acid encoding a protein may
comprise non-translated sequences (e.g., introns) within translated
regions of the nucleic acid, or may lack such intervening
non-translated sequences (e.g., as in cDNA). The information by
which a protein is encoded is specified by the use of codons.
Typically, the amino acid sequence is encoded by the nucleic acid
using the "universal" genetic code. However, variants of the
universal code, such as is present in some plant, animal, and
fungal mitochondria, the bacterium Mycoplasma capricolumn (Yamao,
et al., (1985) Proc. Natl. Acad. Sci. USA 82:2306-9) or the ciliate
Macronucleus, may be used when the nucleic acid is expressed using
these organisms.
[0048] When the nucleic acid is prepared or altered synthetically,
advantage can be taken of known codon preferences of the intended
host where the nucleic acid is to be expressed. For example,
although nucleic acid sequences of the present invention may be
expressed in both monocotyledonous and dicotyledonous plant
species, sequences can be modified to account for the specific
codon preferences and GC content preferences of monocotyledonous
plants or dicotyledonous plants as these preferences have been
shown to differ (Murray, et al., (1989) Nucleic Acids Res.
17:477-98 and herein incorporated by reference). Thus, the maize
preferred codon for a particular amino acid might be derived from
known gene sequences from maize. Maize codon usage for 28 genes
from maize plants is listed in Table 4 of Murray, et al.,
supra.
[0049] As used herein, "heterologous" in reference to a nucleic
acid is a nucleic acid that originates from a foreign species, or,
if from the same species, is substantially modified from its native
form in composition and/or genomic locus by deliberate human
intervention. For example, a promoter operably linked to a
heterologous structural gene is from a species different from that
from which the structural gene was derived or, if from the same
species, one or both are substantially modified from their original
form. A heterologous protein may originate from a foreign species
or, if from the same species, is substantially modified from its
original form by deliberate human intervention.
[0050] By "host cell" is meant a cell, which comprises a
heterologous nucleic acid sequence of the invention, which contains
a vector and supports the replication and/or expression of the
expression vector. Host cells may be prokaryotic cells such as E.
coli, or eukaryotic cells such as yeast, insect, plant, amphibian
or mammalian cells. Preferably, host cells are monocotyledonous or
dicotyledonous plant cells, including but not limited to maize,
sorghum, sunflower, soybean, wheat, alfalfa, rice, cotton, canola,
barley, millet and tomato. A particularly preferred
monocotyledonous host cell is a maize host cell.
[0051] The term "hybridization complex" includes reference to a
duplex nucleic acid structure formed by two single-stranded nucleic
acid sequences selectively hybridized with each other.
[0052] The term "introduced" in the context of inserting a nucleic
acid into a cell, means "transfection" or "transformation" or
"transduction" and includes reference to the incorporation of a
nucleic acid into a eukaryotic or prokaryotic cell where the
nucleic acid may be incorporated into the genome of the cell (e.g.,
chromosome, plasmid, plastid or mitochondrial DNA), converted into
an autonomous replicon or transiently expressed (e.g., transfected
mRNA).
[0053] The terms "isolated" refers to material, such as a nucleic
acid or a protein, which is substantially or essentially free from
components which normally accompany or interact with it as found in
its naturally occurring environment. The isolated material
optionally comprises material not found with the material in its
natural environment. Nucleic acids, which are "isolated", as
defined herein, are also referred to as "heterologous" nucleic
acids. Unless otherwise stated, the term "NR nucleic acid" means a
nucleic acid comprising a polynucleotide ("NR polynucleotide")
encoding a full length or partial length NR polypeptide.
[0054] As used herein, "nucleic acid" includes reference to a
deoxyribonucleotide or ribonucleotide polymer in either single- or
double-stranded form and unless otherwise limited, encompasses
known analogues having the essential nature of natural nucleotides
in that they hybridize to single-stranded nucleic acids in a manner
similar to naturally occurring nucleotides (e.g., peptide nucleic
acids).
[0055] By "nucleic acid library" is meant a collection of isolated
DNA or RNA molecules, which comprise and substantially represent
the entire transcribed fraction of a genome of a specified
organism. Construction of exemplary nucleic acid libraries, such as
genomic and cDNA libraries, is taught in standard molecular biology
references such as Berger and Kimmel, (1987) Guide To Molecular
Cloning Techniques, from the series Methods in Enzymology, vol.
152, Academic Press, Inc., San Diego, Calif.; Sambrook, et al.,
(1989) Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., vols.
1-3; and Current Protocols in Molecular Biology, Ausubel, et al.,
eds, Current Protocols, a joint venture between Greene Publishing
Associates, Inc. and John Wiley & Sons, Inc. (1994
Supplement).
[0056] As used herein "operably linked" includes reference to a
functional linkage between a first sequence, such as a promoter,
and a second sequence, wherein the promoter sequence initiates and
mediates transcription of the DNA corresponding to the second
sequence.
[0057] Generally, operably linked means that the nucleic acid
sequences being linked are contiguous and, where necessary to join
two protein coding regions, contiguous and in the same reading
frame.
[0058] As used herein, the term "plant" includes reference to whole
plants, plant organs (e.g., leaves, stems, roots, etc.), seeds and
plant cells and progeny of same. Plant cell, as used herein
includes, without limitation, seeds, suspension cultures, embryos,
meristematic regions, callus tissue, leaves, roots, shoots,
gametophytes, sporophytes, pollen and microspores. The class of
plants, which can be used in the methods of the invention, is
generally as broad as the class of higher plants amenable to
transformation techniques, including both monocotyledonous and
dicotyledonous plants including species from the genera: Cucurbita,
Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis,
Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot,
Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum,
Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia,
Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus,
Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium,
Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis,
Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena,
Hordeum, Secale, Allium and Triticum. A particularly preferred
plant is Zea mays.
[0059] As used herein, "yield" may include reference to bushels per
acre of a grain crop at harvest, as adjusted for grain moisture
(15% typically for maize, for example) and the volume of biomass
generated (for forage crops such as alfalfa and plant root size for
multiple crops). Grain moisture is measured in the grain at
harvest. The adjusted test weight of grain is determined to be the
weight in pounds per bushel, adjusted for grain moisture level at
harvest. Biomass is measured as the weight of harvestable plant
material generated.
[0060] As used herein, "polynucleotide" includes reference to a
deoxyribopolynucleotide, ribopolynucleotide or analogs thereof that
have the essential nature of a natural ribonucleotide in that they
hybridize, under stringent hybridization conditions, to
substantially the same nucleotide sequence as naturally occurring
nucleotides and/or allow translation into the same amino acid(s) as
the naturally occurring nucleotide(s). A polynucleotide can be
full-length or a subsequence of a native or heterologous structural
or regulatory gene. Unless otherwise indicated, the term includes
reference to the specified sequence as well as the complementary
sequence thereof. Thus, DNAs or RNAs with backbones modified for
stability or for other reasons are "polynucleotides" as that term
is intended herein. Moreover, DNAs or RNAs comprising unusual
bases, such as inosine, or modified bases, such as tritylated
bases, to name just two examples, are polynucleotides as the term
is used herein. It will be appreciated that a great variety of
modifications have been made to DNA and RNA that serve many useful
purposes known to those of skill in the art. The term
polynucleotide as it is employed herein embraces such chemically,
enzymatically or metabolically modified forms of polynucleotides,
as well as the chemical forms of DNA and RNA characteristic of
viruses and cells, including inter alia, simple and complex
cells.
[0061] The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical analogue of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers.
[0062] As used herein "promoter" includes reference to a region of
DNA upstream from the start of transcription and involved in
recognition and binding of RNA polymerase and other proteins to
initiate transcription. A "plant promoter" is a promoter capable of
initiating transcription in plant cells. Exemplary plant promoters
include, but are not limited to, those that are obtained from
plants, plant viruses and bacteria which comprise genes expressed
in plant cells such Agrobacterium or Rhizobium. Examples are
promoters that preferentially initiate transcription in certain
tissues, such as leaves, roots, seeds, fibres, xylem vessels,
tracheids or sclerenchyma. Such promoters are referred to as
"tissue preferred." A "cell type" specific promoter primarily
drives expression in certain cell types in one or more organs, for
example, vascular cells in roots or leaves. An "inducible" or
"regulatable" promoter is a promoter, which is under environmental
control. Examples of environmental conditions that may effect
transcription by inducible promoters include anaerobic conditions
or the presence of light. Another type of promoter is a
developmentally regulated promoter, for example, a promoter that
drives expression during pollen development. Tissue preferred, cell
type specific, developmentally regulated and inducible promoters
constitute the class of "non-constitutive" promoters. A
"constitutive" promoter is a promoter, which is active under most
environmental conditions, for example, the ubiquitin gene promoter
UBI (GenBank Accesssion Number S94464).
[0063] As used herein, the term nitrate reductase (NR) includes but
is not limited to the sequences disclosed herein, such as NR, their
conservatively modified variants, regardless of source and any
other variants which retain the biological properties of the NR,
for example, NR activity as disclosed herein. The term "NR
polypeptide" refers to one or more amino acid sequences. The term
is also inclusive of fragments, variants, homologs, alleles or
precursors (e.g., preproproteins or proproteins) thereof. A "NR
protein" comprises a NR polypeptide. Unless otherwise stated, the
term "NR nucleic acid" means a nucleic acid comprising a
polynucleotide ("NR polynucleotide") encoding a NR polypeptide.
[0064] As used interchangeably herein, a "NR activity", "biological
activity of NR" or "functional activity of NR", refers to an
activity exerted by a NR protein, polypeptide or portion thereof as
determined in vivo, or in vitro, according to standard techniques.
In one aspect, a NR activity is the reduction of nitrate to
nitrite. In one aspect, NR activity includes but is not limited to
increased nitrate reduction rate and/or specificity for nitrate,
for example, decreased K.sub.m for nitrate and NADH, increased
velocity (V.sub.max) for nitrate reduction and the like as compared
to NR activity of an endogenous NR of a crop plant of interest. In
another aspect, NR activity includes but is not limited to
increasing NUE and/or plant productivity/yield as compared to a
control plant. NUE may be inferred from amount and/or rate of
nitrogen uptake from the soil or medium as described herein in
Example 11.
[0065] The expression level of the NR polypeptide may be measured
directly, for example, by measuring the level of the NR polypeptide
by Western in the plant, or indirectly, for example, by measuring
the NR activity of the NR polypeptide in the plant. Methods for
determining the NR activity may be determined using standard
techniques such as Hageman, et al., Methods Enzymol. (1971)
23:491-503, Tucker, et al., (2004) Planta 219:277-285 and Scheible,
et al., (1997) Plant J. 11:671-691, including the evaluation of
activity in various expression systems, for example of Xenopus
oocytes (see, Miller, et al., (2000) Biochimica et Biophysica Acta
1465:343-358.) or yeast such as Pichia pastoris (U.S. Provisional
Patent Application Ser. No. 60/944,223 filed Jun. 15, 2007), NR
activity may also include evaluation of phenotypic changes, such as
increased or maintained yield or NUE in a plant grown under nitrate
limiting conditions such as lower nitrogen fertility. Examples of
phenoypic changes include but are not limited to increased ear size
in maize, increased ear growth rate, increased biomass, higher
grain yields, synchronous flowering so that pollen is shed at
approximately the same time as silking, enhanced root growth,
increased seed size, increased seed weight, seed with increased
embryo size, increased leaf size, increased seedling vigor,
enhanced silk emergence and greater chlorophyll content
(greener).
[0066] Maintained or increased yield may be achieved through NRs of
the present invention. Thus, modulation of NR activity of the NRs
of the present invention in a plant cell provides a novel strategy
for maintaining or increasing yield or NUE of a plant grown under
limited nitrogen supply or lower nitrogen fertility
[0067] Accordingly, the present invention further provides plants
having increased yield or a maintained yield when grown under
limited nitrogen fertility. In some embodiments, the plants having
an increased or maintained yield when grown under limited nitrogen
fertility have a modulated level/activity of a NR polypeptide of
the invention.
[0068] A "subject plant or plant cell" is one in which genetic
alteration, such as transformation, has been effected as to a gene
of interest or is a plant or plant cell which is descended from a
plant or cell so altered and which comprises the alteration. A
"control" or "control plant" or "control plant cell" provides a
reference point for measuring changes in phenotype of the subject
plant or plant cell.
[0069] A control plant or plant cell may comprise, for example: (a)
a wild-type plant or cell, i.e., of the same genotype as the
starting material for the genetic alteration which resulted in the
subject plant or cell; (b) a plant or plant cell of the same
genotype as the starting material but which has been transformed
with a null construct (i.e., with a construct which has no known
effect on the trait of interest, such as a construct comprising a
marker gene); (c) a plant or plant cell which is a non-transformed
segregant among progeny of a subject plant or plant cell; (d) a
plant or plant cell genetically identical to the subject plant or
plant cell but which is not exposed to conditions or stimuli that
would induce expression of the gene of interest or (e) the subject
plant or plant cell itself, under conditions in which the gene of
interest is not expressed.
[0070] As used herein "recombinant" includes reference to a cell or
vector, that has been modified by the introduction of a
heterologous nucleic acid or that the cell is derived from a cell
so modified. Thus, for example, recombinant cells express genes
that are not found in identical form within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all as a result of deliberate human intervention; or may have
reduced or eliminated expression of a native gene. The term
"recombinant" as used herein does not encompass the alteration of
the cell or vector by naturally occurring events (e.g., spontaneous
mutation, natural transformation/transduction/transposition) such
as those occurring without deliberate human intervention.
[0071] As used herein, a "recombinant expression cassette" is a
nucleic acid construct, generated recombinantly or synthetically,
with a series of specified nucleic acid elements, which permit
transcription of a particular nucleic acid in a target cell. The
recombinant expression cassette can be incorporated into a plasmid,
chromosome, mitochondrial DNA, plastid DNA, virus or nucleic acid
fragment. Typically, the recombinant expression cassette portion of
an expression vector includes, among other sequences, a nucleic
acid to be transcribed and a promoter.
[0072] The terms "residue" or "amino acid residue" or "amino acid"
are used interchangeably herein to refer to an amino acid that is
incorporated into a protein, polypeptide or peptide (collectively
"protein"). The amino acid may be a naturally occurring amino acid
and, unless otherwise limited, may encompass known analogs of
natural amino acids that can function in a similar manner as
naturally occurring amino acids.
[0073] The term "selectively hybridizes" includes reference to
hybridization, under stringent hybridization conditions, of a
nucleic acid sequence to a specified nucleic acid target sequence
to a detectably greater degree (e.g., at least 2-fold over
background) than its hybridization to non-target nucleic acid
sequences and to the substantial exclusion of non-target nucleic
acids. Selectively hybridizing sequences typically have about at
least 40% sequence identity, preferably 60-90% sequence identity
and most preferably 100% sequence identity (i.e., complementary)
with each other.
[0074] The terms "stringent conditions" or "stringent hybridization
conditions" include reference to conditions under which a probe
will hybridize to its target sequence, to a detectably greater
degree than other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances. By controlling the
stringency of the hybridization and/or washing conditions, target
sequences can be identified which can be up to 100% complementary
to the probe (homologous probing). Alternatively, stringency
conditions can be adjusted to allow some mismatching in sequences
so that lower degrees of similarity are detected (heterologous
probing). Optimally, the probe is approximately 500 nucleotides in
length, but can vary greatly in length from less than 500
nucleotides to equal to the entire length of the target
sequence.
[0075] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide or Denhardt's. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at
37.degree. C. and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at
37.degree. C. and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C. Exemplary high stringency conditions include
hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37.degree. C.
and a wash in 0.1.times.SSC at 60 to 65.degree. C. Specificity is
typically the function of post-hybridization washes, the critical
factors being the ionic strength and temperature of the final wash
solution. For DNA-DNA hybrids, the T.sub.m can be approximated from
the equation of Meinkoth and Wahl, (1984) Anal. Biochem.
138:267-84: T.sub.m=81.5.degree. C.+16.6 (log M)+0.41 (% GC)-0.61
(% form)-500/L; where M is the molarity of monovalent cations, % GC
is the percentage of guanosine and cytosine nucleotides in the DNA,
% form is the percentage of formamide in the hybridization
solution, and L is the length of the hybrid in base pairs. The
T.sub.m is the temperature (under defined ionic strength and pH) at
which 50% of a complementary target sequence hybridizes to a
perfectly matched probe. T.sub.m is reduced by about 1.degree. C.
for each 1% of mismatching; thus, T.sub.m, hybridization and/or
wash conditions can be adjusted to hybridize to sequences of the
desired identity. For example, if sequences with .gtoreq.90%
identity are sought, the T.sub.m can be decreased 10.degree. C.
Generally, stringent conditions are selected to be about 5.degree.
C. lower than the thermal melting point (T.sub.m) for the specific
sequence and its complement at a defined ionic strength and pH.
However, severely stringent conditions can utilize a hybridization
and/or wash at 1, 2, 3 or 4.degree. C. lower than the thermal
melting point (T.sub.m); moderately stringent conditions can
utilize a hybridization and/or wash at 6, 7, 8, 9 or 10.degree. C.
lower than the thermal melting point (T.sub.m); low stringency
conditions can utilize a hybridization and/or wash at 11, 12, 13,
14, 15 or 20.degree. C. lower than the thermal melting point
(T.sub.m). Using the equation, hybridization and wash compositions,
and desired T.sub.m, those of ordinary skill will understand that
variations in the stringency of hybridization and/or wash solutions
are inherently described. If the desired degree of mismatching
results in a T.sub.m of less than 45.degree. C. (aqueous solution)
or 32.degree. C. (formamide solution) it is preferred to increase
the SSC concentration so that a higher temperature can be used. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen, Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes, part I, chapter 2,
"Overview of principles of hybridization and the strategy of
nucleic acid probe assays," Elsevier, New York (1993); and Current
Protocols in Molecular Biology, chapter 2, Ausubel, et al., eds,
Greene Publishing and Wiley-Interscience, New York (1995). Unless
otherwise stated, in the present application high stringency is
defined as hybridization in 4.times.SSC, 5.times.Denhardt's (5 g
Ficoll, 5 g polyvinypyrrolidone, 5 g bovine serum albumin in 500 ml
of water), 0.1 mg/ml boiled salmon sperm DNA and 25 mM Na phosphate
at 65.degree. C. and a wash in 0.1.times.SSC, 0.1% SDS at
65.degree. C.
[0076] As used herein, "transgenic plant" includes reference to a
plant, which comprises within its genome a heterologous
polynucleotide. Generally, the heterologous polynucleotide is
stably integrated within the genome such that the polynucleotide is
passed on to successive generations. The heterologous
polynucleotide may be integrated into the genome alone or as part
of a recombinant expression cassette. "Transgenic" is used herein
to include any cell, cell line, callus, tissue, plant part or
plant, the genotype of which has been altered by the presence of
heterologous nucleic acid including those transgenics initially so
altered as well as those created by sexual crosses or asexual
propagation from the initial transgenic. The term "transgenic" as
used herein does not encompass the alteration of the genome
(chromosomal or extra-chromosomal) by conventional plant breeding
methods or by naturally occurring events such as random
cross-fertilization, non-recombinant viral infection,
non-recombinant bacterial transformation, non-recombinant
transposition or spontaneous mutation.
[0077] As used herein, "vector" includes reference to a nucleic
acid used in transfection of a host cell and into which can be
inserted a polynucleotide. Vectors are often replicons. Expression
vectors permit transcription of a nucleic acid inserted
therein.
[0078] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides
or polypeptides: (a) "reference sequence," (b) "comparison window,"
(c) "sequence identity," (d) "percentage of sequence identity" and
(e) "substantial identity."
[0079] As used herein, "reference sequence" is a defined sequence
used as a basis for sequence comparison. A reference sequence may
be a subset or the entirety of a specified sequence; for example,
as a segment of a full-length cDNA or gene sequence or the complete
cDNA or gene sequence.
[0080] As used herein, "comparison window" means includes reference
to a contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence may be compared to a reference
sequence and wherein the portion of the polynucleotide sequence in
the comparison window may comprise additions or deletions (i.e.,
gaps) compared to the reference sequence (which does not comprise
additions or deletions) for optimal alignment of the two sequences.
Generally, the comparison window is at least 20 contiguous
nucleotides in length, and optionally can be 30, 40, 50, 100 or
longer. Those of skill in the art understand that to avoid a high
similarity to a reference sequence due to inclusion of gaps in the
polynucleotide sequence a gap penalty is typically introduced and
is subtracted from the number of matches.
[0081] Methods of alignment of nucleotide and amino acid sequences
for comparison are well known in the art. The local homology
algorithm (BESTFIT) of Smith and Waterman, (1981) Adv. Appl. Math
2:482, may conduct optimal alignment of sequences for comparison;
by the homology alignment algorithm (GAP) of Needleman and Wunsch,
(1970) J. Mol. Biol. 48:443-53; by the search for similarity method
(Tfasta and Fasta) of Pearson and Lipman, (1988) Proc. Natl. Acad.
Sci. USA 85:2444; by computerized implementations of these
algorithms, including, but not limited to: CLUSTAL in the PC/Gene
program by Intelligenetics, Mountain View, Calif., GAP, BESTFIT,
BLAST, FASTA and TFASTA in the Wisconsin Genetics Software
Package.RTM., Version 8 (available from Genetics Computer Group
(GCG.RTM. programs (Accelrys, Inc., San Diego, Calif.).). The
CLUSTAL program is well described by Higgins and Sharp, (1988) Gene
73:237-44; Higgins and Sharp, (1989) CABIOS 5:151-3; Corpet, et
al., (1988) Nucleic Acids Res. 16:10881-90; Huang, et al., (1992)
Computer Applications in the Biosciences 8:155-65 and Pearson, et
al., (1994) Meth. Mol. Biol. 24:307-31. The preferred program to
use for optimal global alignment of multiple sequences is PileUp
(Feng and Doolittle, (1987) J. Mol. Evol., 25:351-60 which is
similar to the method described by Higgins and Sharp, (1989) CABIOS
5:151-53 and hereby incorporated by reference). The BLAST family of
programs which can be used for database similarity searches
includes: BLASTN for nucleotide query sequences against nucleotide
database sequences; BLASTX for nucleotide query sequences against
protein database sequences; BLASTP for protein query sequences
against protein database sequences; TBLASTN for protein query
sequences against nucleotide database sequences and TBLASTX for
nucleotide query sequences against nucleotide database sequences.
See, Current Protocols in Molecular Biology, Chapter 19, Ausubel et
al., eds., Greene Publishing and Wiley-Interscience, New York
(1995).
[0082] GAP uses the algorithm of Needleman and Wunsch, supra, to
find the alignment of two complete sequences that maximizes the
number of matches and minimizes the number of gaps. GAP considers
all possible alignments and gap positions and creates the alignment
with the largest number of matched bases and the fewest gaps. It
allows for the provision of a gap creation penalty and a gap
extension penalty in units of matched bases. GAP must make a profit
of gap creation penalty number of matches for each gap it inserts.
If a gap extension penalty greater than zero is chosen, GAP must,
in addition, make a profit for each gap inserted of the length of
the gap times the gap extension penalty. Default gap creation
penalty values and gap extension penalty values in Version 10 of
the Wisconsin Genetics Software Package.RTM. are 8 and 2,
respectively. The gap creation and gap extension penalties can be
expressed as an integer selected from the group of integers
consisting of from 0 to 100. Thus, for example, the gap creation
and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 15, 20, 30, 40, 50 or greater.
[0083] GAP presents one member of the family of best alignments.
There may be many members of this family, but no other member has a
better quality. GAP displays four figures of merit for alignments:
Quality, Ratio, Identity and Similarity. The Quality is the metric
maximized in order to align the sequences. Ratio is the quality
divided by the number of bases in the shorter segment. Percent
Identity is the percent of the symbols that actually match. Percent
Similarity is the percent of the symbols that are similar. Symbols
that are across from gaps are ignored. A similarity is scored when
the scoring matrix value for a pair of symbols is greater than or
equal to 0.50, the similarity threshold. The scoring matrix used in
Version 10 of the Wisconsin Genetics Software Package.RTM. is
BLOSUM62 (see, Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci.
USA 89:10915).
[0084] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using the BLAST 2.0
suite of programs using default parameters (Altschul, et al.,
(1997) Nucleic Acids Res. 25:3389-402).
[0085] As those of ordinary skill in the art will understand, BLAST
searches assume that proteins can be modeled as random sequences.
However, many real proteins comprise regions of nonrandom
sequences, which may be homopolymeric tracts, short-period repeats
or regions enriched in one or more amino acids. Such low-complexity
regions may be aligned between unrelated proteins even though other
regions of the protein are entirely dissimilar. A number of
low-complexity filter programs can be employed to reduce such
low-complexity alignments. For example, the SEG (Wooten and
Federhen, (1993) Comput. Chem. 17:149-63) and XNU (Claverie and
States, (1993) Comput. Chem. 17:191-201) low-complexity filters can
be employed alone or in combination.
[0086] As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences includes
reference to the residues in the two sequences, which are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. Where sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences, which differ by such conservative substitutions, are
said to have "sequence similarity" or "similarity." Means for
making this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., according to the algorithm of
Meyers and Miller, (1988) Computer Applic. Biol. Sci. 4:11-17,
e.g., as implemented in the program PC/GENE (Intelligenetics,
Mountain View, Calif., USA).
[0087] As used herein, "percentage of sequence identity" means the
value determined by comparing two optimally aligned sequences over
a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0088] The term "substantial identity" of polynucleotide sequences
means that a polynucleotide comprises a sequence that has between
50-100% sequence identity, preferably at least 50% sequence
identity, preferably at least 60% sequence identity, preferably at
least 70%, more preferably at least 80%, more preferably at least
90% and most preferably at least 95%, compared to a reference
sequence using one of the alignment programs described using
standard parameters. One of skill will recognize that these values
can be appropriately adjusted to determine corresponding identity
of proteins encoded by two nucleotide sequences by taking into
account codon degeneracy, amino acid similarity, reading frame
positioning and the like. Substantial identity of amino acid
sequences for these purposes normally means sequence identity of
between 55-100%, preferably at least 55%, preferably at least 60%,
more preferably at least 70%, 80%, 90% and most preferably at least
95%.
[0089] Another indication that nucleotide sequences are
substantially identical is if two molecules hybridize to each other
under stringent conditions. The degeneracy of the genetic code
allows for many amino acids substitutions that lead to variety in
the nucleotide sequence that code for the same amino acid, hence it
is possible that the DNA sequence could code for the same
polypeptide but not hybridize to each other under stringent
conditions. This may occur, e.g., when a copy of a nucleic acid is
created using the maximum codon degeneracy permitted by the genetic
code. One indication that two nucleic acid sequences are
substantially identical is that the polypeptide, which the first
nucleic acid encodes, is immunologically cross reactive with the
polypeptide encoded by the second nucleic acid.
[0090] The terms "substantial identity" in the context of a peptide
indicates that a peptide comprises a sequence with between 55-100%
sequence identity to a reference sequence preferably at least 55%
sequence identity, preferably 60% preferably 70%, more preferably
80%, most preferably at least 90% or 95% sequence identity to the
reference sequence over a specified comparison window. Preferably,
optimal alignment is conducted using the homology alignment
algorithm of Needleman and Wunsch, supra. An indication that two
peptide sequences are substantially identical is that one peptide
is immunologically reactive with antibodies raised against the
second peptide. Thus, a peptide is substantially identical to a
second peptide, for example, where the two peptides differ only by
a conservative substitution. In addition, a peptide can be
substantially identical to a second peptide when they differ by a
non-conservative change if the epitope that the antibody recognizes
is substantially identical. Peptides, which are "substantially
similar" share sequences as, noted above except that residue
positions, which are not identical, may differ by conservative
amino acid changes.
Nucleic Acids
[0091] The present invention provides, inter alia, isolated nucleic
acids of RNA, DNA and analogs and/or chimeras thereof, comprising a
NR polynucleotide.
[0092] The present invention also includes polynucleotides
optimized for expression in different organisms. For example, for
expression of the polynucleotide in a maize plant, the sequence can
be altered to account for specific codon preferences and to alter
GC content as according to Murray, et al, supra. Maize codon usage
for 28 genes from maize plants is listed in Table 4 of Murray, et
al., supra.
[0093] The NR nucleic acids of the present invention comprise
isolated NR polynucleotides which are inclusive of: [0094] (a) a
polynucleotide encoding a NR polypeptide and conservatively
modified and polymorphic variants thereof; [0095] (b) a
polynucleotide having at least 70% sequence identity with
polynucleotides of (a); [0096] (c) complementary sequences of
polynucleotides of (a) or (b).
Construction of Nucleic Acids
[0097] The isolated nucleic acids of the present invention can be
made using (a) standard recombinant methods, (b) synthetic
techniques or combinations thereof. In some embodiments, the
polynucleotides of the present invention will be cloned, amplified
or otherwise constructed from a fungus or bacteria.
[0098] The nucleic acids may conveniently comprise sequences in
addition to a polynucleotide of the present invention. For example,
a multi-cloning site comprising one or more endonuclease
restriction sites may be inserted into the nucleic acid to aid in
isolation of the polynucleotide. Also, translatable sequences may
be inserted to aid in the isolation of the translated
polynucleotide of the present invention. For example, a
hexa-histidine marker sequence provides a convenient means to
purify the proteins of the present invention. The nucleic acid of
the present invention--excluding the polynucleotide sequence--is
optionally a vector, adapter or linker for cloning and/or
expression of a polynucleotide of the present invention. Additional
sequences may be added to such cloning and/or expression sequences
to optimize their function in cloning and/or expression, to aid in
isolation of the polynucleotide, or to improve the introduction of
the polynucleotide into a cell. Typically, the length of a nucleic
acid of the present invention less the length of its polynucleotide
of the present invention is less than 20 kilobase pairs, often less
than 15 kb and frequently less than 10 kb. Use of cloning vectors,
expression vectors, adapters and linkers is well known in the art.
Exemplary nucleic acids include such vectors as: M13, lambda ZAP
Express, lambda ZAP II, lambda gt10, lambda gt11, pBK-CMV, pBK-RSV,
pBluescript II, lambda DASH II, lambda EMBL 3, lambda EMBL 4,
pWE15, SuperCos 1, SurfZap, Uni-ZAP, pBC, pBS+/-, pSG5, pBK,
pCR-Script, pET, pSPUTK, p3'SS, pGEM, pSK+/-, pGEX, pSPORTI and II,
pOPRSVI CAT, pOPI3 CAT, pXT1, pSG5, pPbac, pMbac, pMC1neo, pOG44,
pOG45, pFRT.beta.GAL, pNEO.beta.GAL, pRS403, pRS404, pRS405,
pRS406, pRS413, pRS414, pRS415, pRS416, lambda MOSSIox and lambda
MOSEIox. Optional vectors for the present invention, include but
are not limited to, lambda ZAP II and pGEX. For a description of
various nucleic acids see, e.g., Stratagene Cloning Systems,
Catalogs 1995, 1996, 1997 (La Jolla, Calif.) and Amersham Life
Sciences, Inc, Catalog '97 (Arlington Heights, Ill.).
Synthetic Methods for Constructing Nucleic Acids
[0099] The isolated nucleic acids of the present invention can also
be prepared by direct chemical synthesis by methods such as the
phosphotriester method of Narang, et al., (1979) Meth. Enzymol.
68:90-9; the phosphodiester method of Brown, et al., (1979) Meth.
Enzymol. 68:109-51; the diethylphosphoramidite method of Beaucage,
et al., (1981) Tetra. Letts. 22(20):1859-62; the solid phase
phosphoramidite triester method described by Beaucage, et al.,
supra, e.g., using an automated synthesizer, e.g., as described in
Needham-VanDevanter, et al., (1984) Nucleic Acids Res. 12:6159-68
and the solid support method of U.S. Pat. No. 4,458,066. Chemical
synthesis generally produces a single stranded oligonucleotide.
This may be converted into double stranded DNA by hybridization
with a complementary sequence or by polymerization with a DNA
polymerase using the single strand as a template. One of skill will
recognize that while chemical synthesis of DNA is limited to
sequences of about 100 bases, longer sequences may be obtained by
the ligation of shorter sequences.
UTRs and Codon Preference
[0100] In general, translational efficiency has been found to be
regulated by specific sequence elements in the 5' non-coding or
untranslated region (5' UTR) of the RNA. Positive sequence motifs
include translational initiation consensus sequences (Kozak, (1987)
Nucleic Acids Res. 15:8125) and the 5<G> 7 methyl GpppG RNA
cap structure (Drummond, et al., (1985) Nucleic Acids Res.
13:7375). Negative elements include stable intramolecular 5' UTR
stem-loop structures (Muesing, et al., (1987) Cell 48:691) and AUG
sequences or short open reading frames preceded by an appropriate
AUG in the 5' UTR (Kozak, supra, Rao, et al., (1988) Mol. and Cell.
Biol. 8:284). Accordingly, the present invention provides 5' and/or
3' UTR regions for modulation of translation of heterologous coding
sequences.
[0101] Further, the polypeptide-encoding segments of the
polynucleotides of the present invention can be modified to alter
codon usage. Altered codon usage can be employed to alter
translational efficiency and/or to optimize the coding sequence for
expression in a desired host or to optimize the codon usage in a
heterologous sequence for expression in maize. Codon usage in the
coding regions of the polynucleotides of the present invention can
be analyzed statistically using commercially available software
packages such as "Codon Preference" available from the University
of Wisconsin Genetics Computer Group. See, Devereaux, et al.,
(1984) Nucleic Acids Res. 12:387-395) or MacVector 4.1 (Eastman
Kodak Co., New Haven, Conn.). Thus, the present invention provides
a codon usage frequency characteristic of the coding region of at
least one of the polynucleotides of the present invention. The
number of polynucleotides (3 nucleotides per amino acid) that can
be used to determine a codon usage frequency can be any integer
from 3 to the number of polynucleotides of the present invention as
provided herein. Optionally, the polynucleotides will be
full-length sequences. An exemplary number of sequences for
statistical analysis can be at least 1, 5, 10, 20, 50 or 100.
Sequence Shuffling
[0102] The present invention provides methods for sequence
shuffling using polynucleotides of the present invention and
compositions resulting therefrom. Sequence shuffling is described
in PCT Publication Number 96/19256. See also, Zhang, et al., (1997)
Proc. Natl. Acad. Sci. USA 94:4504-9 and Zhao, et al., (1998)
Nature Biotech 16:258-61. Generally, sequence shuffling provides a
means for generating libraries of polynucleotides having a desired
characteristic, which can be selected or screened for. Libraries of
recombinant polynucleotides are generated from a population of
related sequence polynucleotides, which comprise sequence regions,
which have substantial sequence identity and can be homologously
recombined in vitro or in vivo. The population of
sequence-recombined polynucleotides comprises a subpopulation of
polynucleotides which possess desired or advantageous
characteristics and which can be selected by a suitable selection
or screening method. The characteristics can be any property or
attribute capable of being selected for or detected in a screening
system and may include properties of: an encoded protein, a
transcriptional element, a sequence controlling transcription, RNA
processing, RNA stability, chromatin conformation, translation or
other expression property of a gene or transgene, a replicative
element, a protein-binding element, or the like, such as any
feature which confers a selectable or detectable property. In some
embodiments, the selected characteristic will be an altered K.sub.m
and/or K.sub.cat over the wild-type protein as provided herein. In
other embodiments, a protein or polynucleotide generated from
sequence shuffling will have a ligand binding affinity greater than
the non-shuffled wild-type polynucleotide. In yet other
embodiments, a protein or polynucleotide generated from sequence
shuffling will have an altered pH optimum as compared to the
non-shuffled wild-type polynucleotide. The increase in such
properties can be at least 110%, 120%, 130%, 140% or greater than
150% of the wild-type value.
Recombinant Expression Cassettes
[0103] The present invention further provides recombinant
expression cassettes comprising a nucleic acid of the present
invention. A nucleic acid sequence coding for the desired
polynucleotide of the present invention, for example a cDNA or a
genomic sequence encoding a polypeptide long enough to code for an
active protein of the present invention, can be used to construct a
recombinant expression cassette which can be introduced into the
desired host cell. A recombinant expression cassette will typically
comprise a polynucleotide of the present invention operably linked
to transcriptional initiation regulatory sequences which will
direct the transcription of the polynucleotide in the intended host
cell, such as tissues of a transformed plant.
[0104] For example, plant expression vectors may include (1) a
cloned plant gene under the transcriptional control of 5' and 3'
regulatory sequences and (2) a dominant selectable marker. Such
plant expression vectors may also contain, if desired, a promoter
regulatory region (e.g., one conferring inducible or constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific/selective expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site and/or a polyadenylation signal.
[0105] A number of promoters can be used in the practice of the
invention, including the native promoter of the endogenous NR
polynucleotide sequence of the crop plant of interest. The
promoters can be selected based on the desired outcome. The nucleic
acids can be combined with constitutive, tissue-preferred,
inducible, or other promoters for expression in plants.
[0106] A plant promoter or promoter fragment can be employed which
will direct expression of a polynucleotide of the present invention
in all tissues of a regenerated plant. Such promoters are referred
to herein as "constitutive" promoters and are active under most
environmental conditions and states of development or cell
differentiation. Examples of constitutive promoters include the 1'-
or 2'-promoter derived from T-DNA of Agrobacterium tumefaciens, the
Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S.
Pat. No. 5,683,439), the Nos promoter, the rubisco promoter, the
GRP1-8 promoter, the 35S promoter from cauliflower mosaic virus
(CaMV), as described in Odell, et al., (1985) Nature 313:810-2;
rice actin (McElroy, et al., (1990) Plant Cell 163-171); ubiquitin
(Christensen, et al., (1992) Plant Mol. Biol. 12:619-632 and
Christensen, et al., (1992) Plant Mol. Biol. 18:675-89); pEMU
(Last, et al., (1991) Theor. Appl. Genet. 81:581-8); MAS (Velten,
et al., (1984) EMBO J. 3:2723-30) and maize H3 histone (Lepetit, et
al., (1992) Mol. Gen. Genet. 231:276-85 and Atanassvoa, et al.,
(1992) Plant Journal 2(3):291-300); ALS promoter, as described in
PCT Application Number WO 1996/30530 and other transcription
initiation regions from various plant genes known to those of
skill. For the present invention ubiquitin is the preferred
promoter for expression in monocot plants.
[0107] Tissue-preferred promoters can be utilized to target
enhanced type A RR expression within a particular plant tissue. By
"tissue-preferred" is intended to mean that expression is
predominately in a particular tissue, albeit not necessarily
exclusively in that tissue. Tissue-preferred promoters include
Yamamoto, et al., (1997) Plant J. 12(2):255-265; Kawamata, et al.,
(1997) Plant Cell Physiol. 38(7):792-803; Hansen, et al., (1997)
Mol. Gen Genet. 255(3):337-353; Russell, et al., (1997) Transgenic
Res. 6(2):157-168; Rinehart, et al., (1996) Plant Physiol.
112(3):1331-1351; Van Camp, et al., (1996) Plant Physiol.
112(2):525-535; Canevascini, et al., (1996) Plant Physiol.
112(2):513-525; Yamamoto, et al., (1995) Plant Cell Physiol.
35(5):773-778; Lam, (1995) Results Probl. Cell Differ. 20:181-196;
Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138; Matsuoka,
et al., (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590 and
Guevara-Garcia, et al., (1993) Plant J. 5(3):595-505. Such
promoters can be modified, if necessary, for weak expression. See,
also, US Patent Application Number 2003/0074698, herein
incorporated by reference.
[0108] A mesophyllic cell preferred promoter includes but is not
limited to promoters such as known phosphoenopyruvate decarboxylase
(PEPC) promoters or putative PEPC promoters from any number of
species, for example, Zea mays, Oryza sativa, Arabidopsis thaliana,
Glycine max or Sorghum bicolor. Examples include Zea mays PEPC of
GenBank Accession Number gi:116268332_HTG AC190686, (SEQ ID NO: 25)
and gCAT GSS composite sequence (SEQ ID NO: 30); Oryza sativa PEPC
of GenBank Accession Number gi|20804452|dbj|AP003052.31 (SEQ ID NO:
26); Arabidopsis thaliana PEPC of GenBank Accession Number
gi|55416531 dbj|AP000370.1|AP000370 (SEQ ID NO: 27); gi:7769847
(SEQ ID NO: 28) or gi|201980701gb|AC007087.7 (SEQ ID NO: 29);
Glycine max (GSS contigs) (SEQ ID NOS: 31-32) or Sorghum bicolor
(JGI assembly scaffold.sub.--832, 89230 bp., JGI assembly
scaffold.sub.--1632, SEQ ID NOS: 33-34) (1997) Plant J.
12(2):255-265; Kwon, et al., (1995) Plant Physiol. 105:357-67;
Yamamoto, et al., (1995) Plant Cell Physiol. 35(5):773-778; Gotor,
et al., (1993) Plant J. 3:509-18; Orozco, et al., (1993) Plant Mol.
Biol. 23(6):1129-1138; Baszczynski, et al., (1988) Nucl. Acid Res.
16:5732; Mitra, et al., (1995) Plant Molecular Biology 26:35-93;
Kayaya, et al., (1995) Molecular and General Genetics 258:668-675
and Matsuoka, et al., (1993) Proc. Natl. Acad. Sci. USA
90(20):9586-9590. Senescence regulated promoters are also of use,
such as, SAM22 (Crowell, et al., (1992) Plant Mol. Biol.
18:559-566). See also, U.S. Pat. No. 5,589,052, herein incorporated
by reference.
[0109] Shoot-preferred promoters include, shoot meristem-preferred
promoters such as promoters disclosed in Weigal, et al., (1992)
Cell 69:853-859; Accession Number AJ131822; Accession Number
Z71981; Accession Number AF059870, the ZAP promoter (U.S. patent
application Ser. No. 10/387,937), the maize tb1 promoter (Wang, et
al., (1999) Nature 398:236-239 and shoot-preferred promoters
disclosed in McAvoy, et al., (2003) Acta Hort. (ISHS)
625:379-385.
[0110] Root-preferred promoters are known and can be selected from
the many available from the literature or isolated de novo from
various compatible species. See, for example, Hire, et al., (1992)
Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine
synthetase gene); Keller and Baumgartner, (1991) Plant Cell
3(10):1051-1061 (root-specific control element in the GRP 1.8 gene
of French bean); Sanger, et al., (1990) Plant Mol. Biol.
15(3):533-553 (root-specific promoter of the mannopine synthase
(MAS) gene of Agrobacterium tumefaciens) and Miao, et al., (1991)
Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic
glutamine synthetase (GS), which is expressed in roots and root
nodules of soybean). See also, Bogusz, et al., (1990) Plant Cell
2(7):633-651, where two root-specific promoters isolated from
hemoglobin genes from the nitrogen-fixing nonlegume Parasponia
andersonii and the related non-nitrogen-fixing nonlegume Trema
tomentosa are described. The promoters of these genes were linked
to a .beta.-glucuronidase reporter gene and introduced into both
the nonlegume Nicotiana tabacum and the legume Lotus corniculatus
and in both instances root-specific promoter activity was
preserved. Leach and Aoyagi, (1991) describe their analysis of the
promoters of the highly expressed roIC and rolD root-inducing genes
of Agrobacterium rhizogenes (see, Plant Science (Limerick)
79(1):69-76). They concluded that enhancer and tissue-preferred DNA
determinants are dissociated in those promoters. Teen, et al.,
(1989) used gene fusion to lacZ to show that the Agrobacterium
T-DNA gene encoding octopine synthase is especially active in the
epidermis of the root tip and that the TR2' gene is root specific
in the intact plant and stimulated by wounding in leaf tissue, an
especially desirable combination of characteristics for use with an
insecticidal or larvicidal gene (see, EMBO J. 8(2):353-350). The
TR1' gene, fused to nptII (neomycin phosphotransferase II) showed
similar characteristics. Additional root-preferred promoters
include the VfENOD-GRP3 gene promoter (Kuster, et al., (1995) Plant
Mol. Biol. 29(5):759-772); rolB promoter (Capana, et al., (1995)
Plant Mol. Biol. 25(5):681-691 and the CRWAQ81 root-preferred
promoter with the ADH first intron (U.S. Provisional Application
No. 60/509,878, filed Oct. 9, 2003, herein incorporated by
reference). See also, U.S. Pat. Nos. 5,837,876; 5,750,386;
5,633,363; 5,559,252; 5,501,836; 5,110,732 and 5,023,179.
[0111] Alternatively, the plant promoter can direct expression of a
polynucleotide of the present invention in a specific tissue or may
be otherwise under more precise environmental or developmental
control. Such promoters are referred to here as "inducible"
promoters. Environmental conditions that may effect transcription
by inducible promoters include pathogen attack, anaerobic
conditions or the presence of light. Examples of inducible
promoters are the Adh1 promoter, which is inducible by hypoxia or
cold stress, the Hsp70 promoter, which is inducible by heat stress,
and the PPDK promoter, which is inducible by light.
[0112] Examples of promoters under developmental control include
promoters that initiate transcription only, or preferentially, in
certain tissues, such as leaves, roots, fruit, seeds or flowers.
The operation of a promoter may also vary depending on its location
in the genome. Thus, an inducible promoter may become fully or
partially constitutive in certain locations.
[0113] If polypeptide expression is desired, it is generally
desirable to include a polyadenylation region at the 3'-end of a
polynucleotide coding region. The polyadenylation region can be
derived from a variety of plant genes or from T-DNA. The 3' end
sequence to be added can be derived from, for example, the nopaline
synthase or octopine synthase genes or alternatively from another
plant gene or less preferably from any other eukaryotic gene.
Examples of such regulatory elements include, but are not limited
to, 3' termination and/or polyadenylation regions such as those of
the Agrobacterium tumefaciens nopaline synthase (nos) gene (Bevan,
et al., (1983) Nucleic Acids Res. 12:369-85); the potato proteinase
inhibitor II (PINII) gene (Keil, et al., (1986) Nucleic Acids Res.
14:5641-50 and An, et al., (1989) Plant Cell 1:115-22) and the CaMV
19S gene (Mogen, et al., (1990) Plant Cell 2:1261-72).
[0114] An intron sequence can be added to the 5' untranslated
region or the coding sequence of the partial coding sequence to
increase the amount of the mature message that accumulates in the
cytosol. Inclusion of a spliceable intron in the transcription unit
in both plant and animal expression constructs has been shown to
increase gene expression at both the mRNA and protein levels up to
1000-fold (Buchman and Berg, (1988) Mol. Cell Biol. 8:4395-4405;
Callis, et al., (1987) Genes Dev. 1:1183-200). Such intron
enhancement of gene expression is typically greatest when placed
near the 5' end of the transcription unit. Use of maize introns
Adh1-S intron 1, 2 and 6, the Bronze-1 intron are known in the art.
See generally, The Maize Handbook, Chapter 116, Freeling and
Walbot, eds., Springer, New York (1994).
[0115] Plant signal sequences, including, but not limited to,
signal-peptide encoding DNA/RNA sequences which target proteins to
the extracellular matrix of the plant cell (Dratewka-Kos, et al.,
(1989) J. Biol. Chem. 264:4896-900), such as the Nicotiana
plumbaginifolia extension gene (DeLoose, et al., (1991) Gene
99:95-100); signal peptides which target proteins to the vacuole,
such as the sweet potato sporamin gene (Matsuka, et al., (1991)
Proc. Natl. Acad. Sci. USA 88:834) and the barley lectin gene
(Wilkins, et al., (1990) Plant Cell, 2:301-13); signal peptides
which cause proteins to be secreted, such as that of PRlb (Lind, et
al., (1992) Plant Mol. Biol. 18:47-53) or the barley alpha amylase
(BAA) (Rahmatullah, et al., (1989) Plant Mol. Biol. 12:119, and
hereby incorporated by reference) or signal peptides which target
proteins to the plastids such as that of rapeseed enoyl-Acp
reductase (Verwaert, et al., (1994) Plant Mol. Biol. 26:189-202)
are useful in the invention.
[0116] The vector comprising the sequences from a polynucleotide of
the present invention will typically comprise a marker gene, which
confers a selectable phenotype on plant cells. Usually, the
selectable marker gene will encode antibiotic resistance, with
suitable genes including genes coding for resistance to the
antibiotic spectinomycin (e.g., the aada gene), the streptomycin
phosphotransferase (SPT) gene coding for streptomycin resistance,
the neomycin phosphotransferase (NPTII) gene encoding kanamycin or
geneticin resistance, the hygromycin phosphotransferase (HPT) gene
coding for hygromycin resistance, genes coding for resistance to
herbicides which act to inhibit the action of acetolactate synthase
(ALS), in particular the sulfonylurea-type herbicides (e.g., the
acetolactate synthase (ALS) gene containing mutations leading to
such resistance in particular the S4 and/or Hra mutations), genes
coding for resistance to herbicides which act to inhibit action of
glutamine synthase, such as phosphinothricin or basta (e.g., the
bar gene) or other such genes known in the art. The bar gene
encodes resistance to the herbicide basta and the ALS gene encodes
resistance to the herbicide chlorsulfuron.
[0117] Typical vectors useful for expression of genes in higher
plants are well known in the art and include vectors derived from
the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens
described by Rogers, et al., (1987), Meth. Enzymol. 153:253-77.
These vectors are plant integrating vectors in that on
transformation, the vectors integrate a portion of vector DNA into
the genome of the host plant. Exemplary A. tumefaciens vectors
useful herein are plasmids pKYLX6 and pKYLX7 of Schardl, et al.,
(1987) Gene 61:1-11 and Berger, et al., (1989) Proc. Natl. Acad.
Sci. USA, 86:8402-6. Another useful vector herein is plasmid
pBI101.2 that is available from CLONTECH Laboratories, Inc. (Palo
Alto, Calif.).
Expression of Proteins in Host Cells
[0118] Using the nucleic acids of the present invention, one may
express a protein of the present invention in a recombinantly
engineered cell such as bacteria, yeast, insect, mammalian or
preferably plant cells. The cells produce the protein in a
non-natural condition (e.g., in quantity, composition, location,
and/or time), because they have been genetically altered through
human intervention to do so.
[0119] It is expected that those of skill in the art are
knowledgeable in the numerous expression systems available for
expression of a nucleic acid encoding a protein of the present
invention. No attempt to describe in detail the various methods
known for the expression of proteins in prokaryotes or eukaryotes
will be made.
[0120] In brief summary, the expression of isolated nucleic acids
encoding a protein of the present invention will typically be
achieved by operably linking, for example, the DNA or cDNA to a
promoter (which is either constitutive or inducible), followed by
incorporation into an expression vector. The vectors can be
suitable for replication and integration in either prokaryotes or
eukaryotes. Typical expression vectors contain transcription and
translation terminators, initiation sequences, and promoters useful
for regulation of the expression of the DNA encoding a protein of
the present invention. To obtain high level expression of a cloned
gene, it is desirable to construct expression vectors which
contain, at the minimum, a strong promoter, such as ubiquitin, to
direct transcription, a ribosome binding site for translational
initiation and a transcription/translation terminator. Constitutive
promoters are classified as providing for a range of constitutive
expression. Thus, some are weak constitutive promoters and others
are strong constitutive promoters. Generally, by "weak promoter" is
intended a promoter that drives expression of a coding sequence at
a low level. By "low level" is intended at levels of about 1/10,000
transcripts to about 1/100,000 transcripts to about 1/500,000
transcripts. Conversely, a "strong promoter" drives expression of a
coding sequence at a "high level" or about 1/10 transcripts to
about 1/100 transcripts to about 1/1,000 transcripts.
[0121] One of skill would recognize that modifications could be
made to a protein of the present invention without diminishing its
biological activity. Some modifications may be made to facilitate
the cloning, expression, or incorporation of the targeting molecule
into a fusion protein. Such modifications are well known to those
of skill in the art and include, for example, a methionine added at
the amino terminus to provide an initiation site, or additional
amino acids (e.g., poly His) placed on either terminus to create
conveniently located restriction sites or termination codons or
purification sequences.
Expression in Prokaryotes
[0122] Prokaryotic cells may be used as hosts for expression.
Prokaryotes most frequently are represented by various strains of
E. coli; however, other microbial strains may also be used.
Commonly used prokaryotic control sequences which are defined
herein to include promoters for transcription initiation,
optionally with an operator, along with ribosome binding site
sequences, include such commonly used promoters as the beta
lactamase (penicillinase) and lactose (lac) promoter systems
(Chang, et al., (1977) Nature 198:1056), the tryptophan (trp)
promoter system (Goeddel, et al., (1980) Nucleic Acids Res. 8:4057)
and the lambda derived P L promoter and N-gene ribosome binding
site (Shimatake, et al., (1981) Nature 292:128). The inclusion of
selection markers in DNA vectors transfected in E. coli is also
useful. Examples of such markers include genes specifying
resistance to ampicillin, tetracycline, or chloramphenicol.
[0123] The vector is selected to allow introduction of the gene of
interest into the appropriate host cell. Bacterial vectors are
typically of plasmid or phage origin. Appropriate bacterial cells
are infected with phage vector particles or transfected with naked
phage vector DNA. If a plasmid vector is used, the bacterial cells
are transfected with the plasmid vector DNA. Expression systems for
expressing a protein of the present invention are available using
Bacillus sp. and Salmonella (Palva, et al., (1983) Gene 22:229-35;
Mosbach, et al., (1983) Nature 302:543-5). The pGEX-4T-1 plasmid
vector from Pharmacia is the preferred E. coli expression vector
for the present invention.
Expression in Eukaryotes
[0124] A variety of eukaryotic expression systems such as yeast,
insect cell lines, plant and mammalian cells, are known to those of
skill in the art. As explained briefly below, the present invention
can be expressed in these eukaryotic systems. In some embodiments,
transformed/transfected plant cells, as discussed infra, are
employed as expression systems for production of the proteins of
the instant invention.
[0125] Synthesis of heterologous proteins in yeast is well known.
Sherman, et al., (1982) Methods in Yeast Genetics, Cold Spring
Harbor Laboratory is a well recognized work describing the various
methods available to produce the protein in yeast. Two widely
utilized yeasts for production of eukaryotic proteins are
Saccharomyces cerevisiae and Pichia pastoris. Vectors, strains and
protocols for expression in Saccharomyces and Pichia are known in
the art and available from commercial suppliers (e.g., Invitrogen).
Suitable vectors usually have expression control sequences, such as
promoters, including 3-phosphoglycerate kinase or alcohol oxidase
and an origin of replication, termination sequences and the like as
desired.
[0126] A protein of the present invention, once expressed, can be
isolated from yeast by lysing the cells and applying standard
protein isolation techniques to the lysates or the pellets. The
monitoring of the purification process can be accomplished by using
Western blot techniques or radioimmunoassay of other standard
immunoassay techniques.
[0127] The sequences encoding proteins of the present invention can
also be ligated to various expression vectors for use in
transfecting cell cultures of, for instance, mammalian, insect or
plant origin. Mammalian cell systems often will be in the form of
monolayers of cells although mammalian cell suspensions may also be
used. A number of suitable host cell lines capable of expressing
intact proteins have been developed in the art, and include the
HEK293, BHK21, and CHO cell lines. Expression vectors for these
cells can include expression control sequences, such as an origin
of replication, a promoter (e.g., the CMV promoter, a HSV tk
promoter or pgk (phosphoglycerate kinase) promoter), an enhancer
(Queen, et al., (1986) Immunol. Rev. 89:49) and necessary
processing information sites, such as ribosome binding sites, RNA
splice sites, polyadenylation sites (e.g., an SV40 large T Ag poly
A addition site) and transcriptional terminator sequences. Other
animal cells useful for production of proteins of the present
invention are available, for instance, from the American Type
Culture Collection Catalogue of Cell Lines and Hybridomas (7.sup.th
ed., 1992).
[0128] Appropriate vectors for expressing proteins of the present
invention in insect cells are usually derived from the SF9
baculovirus. Suitable insect cell lines include mosquito larvae,
silkworm, armyworm, moth and Drosophila cell lines such as a
Schneider cell line (see, e.g., Schneider, (1987) J. Embryol. Exp.
Morphol. 27:353-65).
[0129] As with yeast, when higher animal or plant host cells are
employed, polyadenlyation or transcription terminator sequences are
typically incorporated into the vector. An example of a terminator
sequence is the polyadenlyation sequence from the bovine growth
hormone gene. Other useful terminators for practicing this
invention include, but are not limited to, pinII (see, An, et al.,
(1989) Plant Cell 1(1):115-122), glb1 (see, Genbank Accession
Number L22345), gz (see, gzw64a terminator, Genbank Accession
Number S78780) and the nos terminator from Agrobacterium.
[0130] Sequences for accurate splicing of the transcript may also
be included. An example of a splicing sequence is the VP1 intron
from SV40 (Sprague, et al., (1983) J. Virol. 45:773-81).
Additionally, gene sequences to control replication in the host
cell may be incorporated into the vector such as those found in
bovine papilloma virus type-vectors (Saveria-Campo, "Bovine
Papilloma Virus DNA a Eukaryotic Cloning Vector," in DNA Cloning: A
Practical Approach, vol. II, Glover, ed., IRL Press, Arlington,
Va., pp. 213-38 (1985)).
[0131] In addition, the NR gene placed in the appropriate plant
expression vector can be used to transform plant cells. The
polypeptide can then be isolated from plant callus or the
transformed cells can be used to regenerate transgenic plants. Such
transgenic plants can be harvested, and the appropriate tissues
(seed or leaves, for example) can be subjected to large scale
protein extraction and purification techniques.
Plant Transformation Methods
[0132] Numerous methods for introducing foreign genes into plants
are known and can be used to insert an NR polynucleotide into a
plant host, including biological and physical plant transformation
protocols. See, e.g., Miki, et al., (1993) "Procedure for
Introducing Foreign DNA into Plants," in Methods in Plant Molecular
Biology and Biotechnology, Glick and Thompson, eds., CRC Press,
Inc., Boca Raton, pp. 67-88. The methods chosen vary with the host
plant and include chemical transfection methods such as calcium
phosphate, microorganism-mediated gene transfer such as
Agrobacterium (Horsch, et al., (1985) Science 227:1229-31),
electroporation, micro-injection and biolistic bombardment.
Expression cassettes and vectors and in vitro culture methods for
plant cell or tissue transformation and regeneration of plants are
known and available. See, e.g., Gruber, et al., "Vectors for Plant
Transformation," in Methods in Plant Molecular Biology and
Biotechnology, supra, pp. 89-119.
[0133] The isolated polynucleotides or polypeptides may be
introduced into the plant by one or more techniques typically used
for direct delivery into cells. Such protocols may vary depending
on the type of organism, cell, plant or plant cell, i.e. monocot or
dicot, targeted for gene modification. Suitable methods of
transforming plant cells include microinjection (Crossway, et al.,
(1986) Biotechniques 4:320-334 and U.S. Pat. No. 6,300,543),
electroporation (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA
83:5602-5606, direct gene transfer (Paszkowski, et al., (1984) EMBO
J. 3:2717-2722) and ballistic particle acceleration (see, for
example, Sanford, et al., U.S. Pat. No. 4,945,050; WO 1991/10725
and McCabe, et al., (1988) Biotechnology 6:923-926). Also see,
Tomes, et al., "Direct DNA Transfer into Intact Plant Cells Via
Microprojectile Bombardment". pp. 197-213 in Plant Cell, Tissue and
Organ Culture, Fundamental Methods. eds. Gamborg and Phillips.
Springer-Verlag Berlin Heidelberg New York, 1995; U.S. Pat. No.
5,736,369 (meristem); Weissinger, et al., (1988) Ann. Rev. Genet.
22:421-477; Sanford, et al., (1987) Particulate Science and
Technology 5:27-37 (onion); Christou, et al., (1988) Plant Physiol.
87:671-674 (soybean); Datta, et al., (1990) Biotechnology 8:736-740
(rice); Klein, et al., (1988) Proc. Natl. Acad. Sci. USA
85:4305-4309 (maize); Klein, et al., (1988) Biotechnology 6:559-563
(maize); WO 1991/10725 (maize); Klein, et al., (1988) Plant
Physiol. 91:440-444 (maize); Fromm, et al., (1990) Biotechnology
8:833-839 and Gordon-Kamm, et al., (1990) Plant Cell 2:603-618
(maize); Hooydaas-Van Slogteren and Hooykaas, (1984) Nature
(London) 311:763-764; Bytebierm, et al., (1987) Proc. Natl. Acad.
Sci. USA 84:5345-5349 (Liliaceae); De Wet, et al., (1985) In The
Experimental Manipulation of Ovule Tissues, ed. Chapman, et al.,
pp. 197-209. Longman, N.Y. (pollen); Kaeppler, et al., (1990) Plant
Cell Reports 9:415-418 and Kaeppler, et al., (1992) Theor. Appl.
Genet. 84:560-566 (whisker-mediated transformation); U.S. Pat. No.
5,693,512 (sonication); D'Halluin, et al., (1992) Plant Cell
4:1495-1505 (electroporation); Li, et al., (1993) Plant Cell
Reports 12:250-255 and Christou and Ford, (1995) Annals of Botany
75:407-413 (rice); Osjoda, et al., (1996) Nature Biotech.
14:745-750; Agrobacterium mediated maize transformation (U.S. Pat.
No. 5,981,840); silicon carbide whisker methods (Frame, et al.,
(1994) Plant J. 6:941-948); laser methods (Guo, et al., (1995)
Physiologia Plantarum 93:19-24); sonication methods (Bao, et al.,
(1997) Ultrasound in Medicine & Biology 23:953-959; Finer and
Finer, (2000) Lett Appl Microbiol. 30:406-10; Amoah, et al., (2001)
J Exp Bot 52:1135-42); polyethylene glycol methods (Krens, et al.,
(1982) Nature 296:72-77); protoplasts of monocot and dicot cells
can be transformed using electroporation (Fromm, et al., (1985)
Proc. Natl. Acad. Sci. USA 82:5824-5828) and microinjection
(Crossway, et al., (1986) Mol. Gen. Genet. 202:179-185), all of
which are herein incorporated by reference.
Agrobacterium-Mediated Transformation
[0134] The most widely utilized method for introducing an
expression vector into plants is based on the natural
transformation system of Agrobacterium. A. tumefaciens and A.
rhizogenes are plant pathogenic soil bacteria, which genetically
transform plant cells. The Ti and Ri plasmids of A. tumefaciens and
A. rhizogenes, respectively, carry genes responsible for genetic
transformation of plants. See, e.g., Kado, (1991) Crit. Rev. Plant
Sci. 10:1. Descriptions of the Agrobacterium vector systems and
methods for Agrobacterium-mediated gene transfer are provided in
Gruber, et al., supra; Miki, et al., supra and Moloney, et al.,
(1989) Plant Cell Reports 8:238.
[0135] Similarly, the gene can be inserted into the T-DNA region of
a Ti or Ri plasmid derived from A. tumefaciens or A. rhizogenes,
respectively. Thus, expression cassettes can be constructed as
above, using these plasmids. Many control sequences are known which
when coupled to a heterologous coding sequence and transformed into
a host organism show fidelity in gene expression with respect to
tissue/organ specificity of the original coding sequence. See,
e.g., Benfey and Chua, (1989) Science 244:174-81. Particularly
suitable control sequences for use in these plasmids are promoters
for constitutive leaf-specific expression of the gene in the
various target plants. Other useful control sequences include a
promoter and terminator from the nopaline synthase gene (NOS). The
NOS promoter and terminator are present in the plasmid pARC2,
available from the American Type Culture Collection and designated
ATCC 67238. If such a system is used, the virulence (vir) gene from
either the Ti or Ri plasmid must also be present, either along with
the T-DNA portion, or via a binary system where the vir gene is
present on a separate vector. Such systems, vectors for use
therein, and methods of transforming plant cells are described in
U.S. Pat. No. 4,658,082; U.S. patent application Ser. No.
09/13,914, filed Oct. 1, 1986, as referenced in U.S. Pat. No.
5,262,306, issued Nov. 16, 1993 and Simpson, et al., (1986) Plant
Mol. Biol. 6:403-15 (also referenced in the '306 patent), all
incorporated by reference in their entirety.
[0136] Once constructed, these plasmids can be placed into A.
rhizogenes or A. tumefaciens and these vectors used to transform
cells of plant species, which are ordinarily susceptible to
Fusarium or Alternaria infection. Several other transgenic plants
are also contemplated by the present invention including but not
limited to soybean, corn, sorghum, alfalfa, rice, clover, cabbage,
banana, coffee, celery, tobacco, cowpea, cotton, melon and pepper.
The selection of either A. tumefaciens or A. rhizogenes will depend
on the plant being transformed thereby. In general A. tumefaciens
is the preferred organism for transformation. Most dicotyledonous
plants, some gymnosperms, and a few monocotyledonous plants (e.g.,
certain members of the Liliales and Arales) are susceptible to
infection with A. tumefaciens. A. rhizogenes also has a wide host
range, embracing most dicots and some gymnosperms, which includes
members of the Leguminosae, Compositae and Chenopodiaceae. Monocot
plants can now be transformed with some success. European Patent
Application Number 604 662 A1 discloses a method for transforming
monocots using Agrobacterium. European Application Number 672 752
A1 discloses a method for transforming monocots with Agrobacterium
using the scutellum of immature embryos. Ishida, et al., discuss a
method for transforming maize by exposing immature embryos to A.
tumefaciens (Nature Biotechnology 14:745-50 (1996)).
[0137] Once transformed, these cells can be used to regenerate
transgenic plants. For example, whole plants can be infected with
these vectors by wounding the plant and then introducing the vector
into the wound site. Any part of the plant can be wounded,
including leaves, stems and roots. Alternatively, plant tissue, in
the form of an explant, such as cotyledonary tissue or leaf disks,
can be inoculated with these vectors, and cultured under
conditions, which promote plant regeneration. Roots or shoots
transformed by inoculation of plant tissue with A. rhizogenes or A.
tumefaciens, containing the gene coding for the fumonisin
degradation enzyme, can be used as a source of plant tissue to
regenerate fumonisin-resistant transgenic plants, either via
somatic embryogenesis or organogenesis. Examples of such methods
for regenerating plant tissue are disclosed in Shahin, (1985)
Theor. Appl. Genet. 69:235-40; U.S. Pat. No. 4,658,082; Simpson, et
al., supra and U.S. patent application Ser. Nos. 09/13,913 and
09/13,914, both filed Oct. 1, 1986, as referenced in U.S. Pat. Nos.
5,262,306, issued Nov. 16, 1993, the entire disclosures therein
incorporated herein by reference.
Direct Gene Transfer
[0138] Despite the fact that the host range for
Agrobacterium-mediated transformation is broad, some major cereal
crop species and gymnosperms have generally been recalcitrant to
this mode of gene transfer, even though some success has recently
been achieved in rice (Hiei, et al., (1994) The Plant Journal
6:271-82). Several methods of plant transformation, collectively
referred to as direct gene transfer, have been developed as an
alternative to Agrobacterium-mediated transformation.
[0139] A generally applicable method of plant transformation is
microprojectile-mediated transformation, where DNA is carried on
the surface of microprojectiles measuring about 1 to 4 .mu.m. The
expression vector is introduced into plant tissues with a biolistic
device that accelerates the microprojectiles to speeds of 300 to
600 m/s which is sufficient to penetrate the plant cell walls and
membranes (Sanford, et al., (1987) Part. Sci. Technol. 5:27;
Sanford, (1988) Trends Biotech 6:299; Sanford, (1990) Physiol.
Plant 79:206 and Klein, et al., (1992) Biotechnology 10:268).
[0140] Another method for physical delivery of DNA to plants is
sonication of target cells as described in Zang, et al., (1991)
BioTechnology 9:996. Alternatively, liposome or spheroplast fusions
have been used to introduce expression vectors into plants. See,
e.g., Deshayes, et al., (1985) EMBO J. 4:2731 and Christou, et al.,
(1987) Proc. Natl. Acad. Sci. USA 84:3962. Direct uptake of DNA
into protoplasts using CaCl.sub.2 precipitation, polyvinyl alcohol,
or poly-L-ornithine has also been reported. See, e.g., Hain, et
al., (1985) Mol. Gen. Genet. 199:161 and Draper, et al., (1982)
Plant Cell Physiol. 23:451.
[0141] Electroporation of protoplasts and whole cells and tissues
has also been described. See, e.g., Donn, et al., (1990) Abstracts
of the VIIth Int'l. Congress on Plant Cell and Tissue Culture
IAPTC, A2-38, p. 53; D'Halluin, et al., (1992) Plant Cell
4:1495-505 and Spencer, et al., (1994) Plant Mol. Biol.
24:51-61.
Increasing the Activity and/or Level of a NR Polypeptide
[0142] Methods are provided to increase the activity and/or level
of the NR polypeptide of the invention. An increase in the level
and/or activity of the NR polypeptide of the invention can be
achieved by providing to the plant a NR polypeptide. The NR
polypeptide can be provided by introducing the amino acid sequence
encoding the NR polypeptide into the plant, introducing into the
plant a nucleotide sequence encoding a NR polypeptide or
alternatively by modifying a genomic locus encoding the NR
polypeptide of the invention.
[0143] As discussed elsewhere herein, many methods are known the
art for providing a polypeptide to a plant including, but not
limited to, direct introduction of the polypeptide into the plant,
introducing into the plant (transiently or stably) a polynucleotide
construct encoding a polypeptide having enhanced nitrogen
utilization activity. It is also recognized that the methods of the
invention may employ a polynucleotide that is not capable of
directing, in the transformed plant, the expression of a protein or
an RNA. Thus, the level and/or activity of a NR polypeptide may be
increased by altering the gene encoding the NR polypeptide or its
promoter. See, e.g., Kmiec, U.S. Pat. No. 5,565,350; Zarling, et
al., PCT/US93/03868. Therefore mutagenized plants that carry
mutations in NR genes, where the mutations increase expression of
the NR gene or increase the NR activity of the encoded NR
polypeptide are provided.
Reducing the Activity and/or Level of a NR Polypeptide
[0144] Methods are provided to reduce or eliminate the activity of
a NR polypeptide of the invention by transforming a plant cell with
an expression cassette that expresses a polynucleotide that
inhibits the expression of the NR polypeptide. The polynucleotide
may inhibit the expression of the NR polypeptide directly, by
preventing transcription or translation of the NR messenger RNA, or
indirectly, by encoding a polypeptide that inhibits the
transcription or translation of an NR gene encoding NR polypeptide.
Methods for inhibiting or eliminating the expression of a gene in a
plant are well known in the art, and any such method may be used in
the present invention to inhibit the expression of NR
polypeptide.
[0145] In accordance with the present invention, the expression of
NR polypeptide is inhibited if the protein level of the NR
polypeptide is less than 70% of the protein level of the same NR
polypeptide in a plant that has not been genetically modified or
mutagenized to inhibit the expression of that NR polypeptide. In
particular embodiments of the invention, the protein level of the
NR polypeptide in a modified plant according to the invention is
less than 60%, less than 50%, less than 40%, less than 30%, less
than 20%, less than 10%, less than 5% or less than 2% of the
protein level of the same NR polypeptide in a plant that is not a
mutant or that has not been genetically modified to inhibit the
expression of that NR polypeptide. The expression level of the NR
polypeptide may be measured directly, for example, by assaying for
the level of NR polypeptide expressed in the plant cell or plant,
or indirectly, for example, by measuring the nitrogen uptake
activity of the NR polypeptide in the plant cell or plant or by
measuring the phenotypic changes in the plant. Methods for
performing such assays are described elsewhere herein.
[0146] In other embodiments of the invention, the activity of the
NR polypeptides is reduced or eliminated by transforming a plant
cell with an expression cassette comprising a polynucleotide
encoding a polypeptide that inhibits the activity of a NR
polypeptide. The enhanced nitrogen utilization activity of a NR
polypeptide is inhibited according to the present invention if the
NR activity of the NR polypeptide is less than 70% of the NR
activity of the same NR polypeptide in a plant that has not been
modified to inhibit the NR activity of that NR polypeptide. In
particular embodiments of the invention, the NR activity of the NR
polypeptide in a modified plant according to the invention is less
than 60%, less than 50%, less than 40%, less than 30%, less than
20%, less than 10% or less than 5% of the NR activity of the same
NR polypeptide in a plant that that has not been modified to
inhibit the expression of that NR polypeptide. The NR activity of a
NR polypeptide is "eliminated" according to the invention when it
is not detectable by the assay methods described elsewhere herein.
Methods of determining the alteration of nitrogen utilization
activity of a NR polypeptide are described elsewhere herein.
[0147] In other embodiments, the activity of a NR polypeptide may
be reduced or eliminated by disrupting the gene encoding the NR
polypeptide. The invention encompasses mutagenized plants that
carry mutations in NR genes, where the mutations reduce expression
of the NR gene or inhibit the nitrogen utilization activity of the
encoded NR polypeptide.
[0148] Thus, many methods may be used to reduce or eliminate the
activity of a NR polypeptide. In addition, more than one method may
be used to reduce the activity of a single NR polypeptide.
[0149] 1. Polynucleotide-Based Methods:
[0150] In some embodiments of the present invention, a plant is
transformed with an expression cassette that is capable of
expressing a polynucleotide that inhibits the expression of an NR
polypeptide of the invention. The term "expression" as used herein
refers to the biosynthesis of a gene product, including the
transcription and/or translation of said gene product. For example,
for the purposes of the present invention, an expression cassette
capable of expressing a polynucleotide that inhibits the expression
of at least one NR polypeptide is an expression cassette capable of
producing an RNA molecule that inhibits the transcription and/or
translation of at least one NR polypeptide of the invention. The
"expression" or "production" of a protein or polypeptide from a DNA
molecule refers to the transcription and translation of the coding
sequence to produce the protein or polypeptide, while the
"expression" or "production" of a protein or polypeptide from an
RNA molecule refers to the translation of the RNA coding sequence
to produce the protein or polypeptide.
[0151] Examples of polynucleotides that inhibit the expression of a
NR polypeptide are given below.
[0152] i. Sense Suppression/Cosuppression
[0153] In some embodiments of the invention, inhibition of the
expression of a NR polypeptide may be obtained by sense suppression
or cosuppression. For cosuppression, an expression cassette is
designed to express an RNA molecule corresponding to all or part of
a messenger RNA encoding a NR polypeptide in the "sense"
orientation. Over expression of the RNA molecule can result in
reduced expression of the native gene. Accordingly, multiple plant
lines transformed with the cosuppression expression cassette are
screened to identify those that show the greatest inhibition of NR
polypeptide expression.
[0154] The polynucleotide used for cosuppression may correspond to
all or part of the sequence encoding the NR polypeptide, all or
part of the 5' and/or 3' untranslated region of a NR polypeptide
transcript or all or part of both the coding sequence and the
untranslated regions of a transcript encoding a NR polypeptide. In
some embodiments where the polynucleotide comprises all or part of
the coding region for the NR polypeptide, the expression cassette
is designed to eliminate the start codon of the polynucleotide so
that no protein product will be translated.
[0155] Cosuppression may be used to inhibit the expression of plant
genes to produce plants having undetectable protein levels for the
proteins encoded by these genes. See, for example, Broin, et al.,
(2002) Plant Cell 14:1417-1432. Cosuppression may also be used to
inhibit the expression of multiple proteins in the same plant. See,
for example, U.S. Pat. No. 5,942,657. Methods for using
cosuppression to inhibit the expression of endogenous genes in
plants are described in Flavell, et al., (1994) Proc. Natl. Acad.
Sci. USA 91:3490-3496; Jorgensen, et al., (1996) Plant Mol. Biol.
31:957-973; Johansen and Carrington, (2001) Plant Physiol.
126:930-938; Broin, et al., (2002) Plant Cell 14:1417-1432;
Stoutjesdijk, et al., (2002) Plant Physiol. 129:1723-1731; Yu, et
al., (2003) Phytochemistry 63:753-763 and U.S. Pat. Nos. 5,034,323,
5,283,184 and 5,942,657; each of which is herein incorporated by
reference. The efficiency of cosuppression may be increased by
including a poly-dT region in the expression cassette at a position
3' to the sense sequence and 5' of the polyadenylation signal. See,
US Patent Application Publication Number 2002/0048814, herein
incorporated by reference. Typically, such a nucleotide sequence
has substantial sequence identity to the sequence of the transcript
of the endogenous gene, optimally greater than about 65% sequence
identity, more optimally greater than about 85% sequence identity,
most optimally greater than about 95% sequence identity. See, U.S.
Pat. Nos. 5,283,184 and 5,034,323, herein incorporated by
reference.
[0156] ii. Antisense Suppression
[0157] In some embodiments of the invention, inhibition of the
expression of the NR polypeptide may be obtained by antisense
suppression. For antisense suppression, the expression cassette is
designed to express an RNA molecule complementary to all or part of
a messenger RNA encoding the NR polypeptide. Over expression of the
antisense RNA molecule can result in reduced expression of the
native gene. Accordingly, multiple plant lines transformed with the
antisense suppression expression cassette are screened to identify
those that show the greatest inhibition of NR polypeptide
expression.
[0158] The polynucleotide for use in antisense suppression may
correspond to all or part of the complement of the sequence
encoding the NR polypeptide, all or part of the complement of the
5' and/or 3' untranslated region of the NR transcript or all or
part of the complement of both the coding sequence and the
untranslated regions of a transcript encoding the NR polypeptide.
In addition, the antisense polynucleotide may be fully
complementary (i.e., 100% identical to the complement of the target
sequence) or partially complementary (i.e., less than 100%
identical to the complement of the target sequence) to the target
sequence. Antisense suppression may be used to inhibit the
expression of multiple proteins in the same plant. See, for
example, U.S. Pat. No. 5,942,657. Furthermore, portions of the
antisense nucleotides may be used to disrupt the expression of the
target gene. Generally, sequences of at least 50 nucleotides, 100
nucleotides, 200 nucleotides, 300, 400, 450, 500, 550 or greater
may be used. Methods for using antisense suppression to inhibit the
expression of endogenous genes in plants are described, for
example, in Liu, et al., (2002) Plant Physiol. 129:1732-1743 and
U.S. Pat. Nos. 5,759,829 and 5,942,657, each of which is herein
incorporated by reference.
[0159] Efficiency of antisense suppression may be increased by
including a poly-dT region in the expression cassette at a position
3' to the antisense sequence and 5' of the polyadenylation signal.
See, US Patent Application Publication Number 2002/0048814, herein
incorporated by reference.
[0160] iii. Double-Stranded RNA Interference
[0161] In some embodiments of the invention, inhibition of the
expression of a NR polypeptide may be obtained by double-stranded
RNA (dsRNA) interference. For dsRNA interference, a sense RNA
molecule like that described above for cosuppression and an
antisense RNA molecule that is fully or partially complementary to
the sense RNA molecule are expressed in the same cell, resulting in
inhibition of the expression of the corresponding endogenous
messenger RNA.
[0162] Expression of the sense and antisense molecules can be
accomplished by designing the expression cassette to comprise both
a sense sequence and an antisense sequence. Alternatively, separate
expression cassettes may be used for the sense and antisense
sequences. Multiple plant lines transformed with the dsRNA
interference expression cassette or expression cassettes are then
screened to identify plant lines that show the greatest inhibition
of NR polypeptide expression. Methods for using dsRNA interference
to inhibit the expression of endogenous plant genes are described
in Waterhouse, et al., (1998) Proc. Natl. Acad. Sci. USA
95:13959-13964, Liu, et al., (2002) Plant Physiol. 129:1732-1743,
and WO 1999/49029, WO 1999/53050, WO 1999/61631 and WO 2000/49035,
each of which is herein incorporated by reference.
[0163] iv. Hairpin RNA Interference and Intron-Containing Hairpin
RNA Interference
[0164] In some embodiments of the invention, inhibition of the
expression of a NR polypeptide may be obtained by hairpin RNA
(hpRNA) interference or intron-containing hairpin RNA (ihpRNA)
interference. These methods are highly efficient at inhibiting the
expression of endogenous genes. See, Waterhouse and Helliwell,
(2003) Nat. Rev. Genet. 4:29-38 and the references cited
therein.
[0165] For hpRNA interference, the expression cassette is designed
to express an RNA molecule that hybridizes with itself to form a
hairpin structure that comprises a single-stranded loop region and
a base-paired stem. The base-paired stem region comprises a sense
sequence corresponding to all or part of the endogenous messenger
RNA encoding the gene whose expression is to be inhibited and an
antisense sequence that is fully or partially complementary to the
sense sequence. Alternatively, the base-paired stem region may
correspond to a portion of a promoter sequence controlling
expression of the gene to be inhibited. Thus, the base-paired stem
region of the molecule generally determines the specificity of the
RNA interference. hpRNA molecules are highly efficient at
inhibiting the expression of endogenous genes and the RNA
interference they induce is inherited by subsequent generations of
plants. See, for example, Chuang and Meyerowitz, (2000) Proc. Natl.
Acad. Sci. USA 97:4985-4990; Stoutjesdijk, et al., (2002) Plant
Physiol. 129:1723-1731 and Waterhouse and Helliwell, (2003) Nat.
Rev. Genet. 4:29-38. Methods for using hpRNA interference to
inhibit or silence the expression of genes are described, for
example, in Chuang and Meyerowitz, (2000) Proc. Natl. Acad. Sci.
USA 97:4985-4990; Stoutjesdijk, et al., (2002) Plant Physiol.
129:1723-1731; Waterhouse and Helliwell, (2003) Nat. Rev. Genet.
4:29-38; Pandolfini et al., BMC Biotechnology 3:7 and US Patent
Publication Number 2003/0175965, each of which is herein
incorporated by reference. A transient assay for the efficiency of
hpRNA constructs to silence gene expression in vivo has been
described by Panstruga, et al., (2003) Mol. Biol. Rep. 30:135-140,
herein incorporated by reference.
[0166] For ihpRNA, the interfering molecules have the same general
structure as for hpRNA, but the RNA molecule additionally comprises
an intron that is capable of being spliced in the cell in which the
ihpRNA is expressed. The use of an intron minimizes the size of the
loop in the hairpin RNA molecule following splicing, and this
increases the efficiency of interference. See, for example, Smith,
et al., (2000) Nature 407:319-320. In fact, Smith, et al., show
100% suppression of endogenous gene expression using
ihpRNA-mediated interference. Methods for using ihpRNA interference
to inhibit the expression of endogenous plant genes are described,
for example, in Smith, et al., (2000) Nature 407:319-320; Wesley,
et al., (2001) Plant J. 27:581-590; Wang and Waterhouse, (2001)
Curr. Opin. Plant Biol. 5:146-150; Waterhouse and Helliwell, (2003)
Nat. Rev. Genet. 4:29-38; Helliwell and Waterhouse, (2003) Methods
30:289-295 and US Patent Publication Number 2003/0180945, each of
which is herein incorporated by reference.
[0167] The expression cassette for hpRNA interference may also be
designed such that the sense sequence and the antisense sequence do
not correspond to an endogenous RNA. In this embodiment, the sense
and antisense sequence flank a loop sequence that comprises a
nucleotide sequence corresponding to all or part of the endogenous
messenger RNA of the target gene. Thus, it is the loop region that
determines the specificity of the RNA interference. See, for
example, WO 2002/00904; Mette, et al., (2000) EMBO J. 19:5194-5201;
Matzke, et al., (2001) Curr. Opin. Genet. Devel. 11:221-227;
Scheid, et al., (2002) Proc. Natl. Acad. Sci., USA 99:13659-13662;
Aufsaftz, et al., (2002) Proc. Nat'l. Acad. Sci. 99(4):16499-16506;
Sijen, et al., Curr. Biol. (2001) 11:436-440), herein incorporated
by reference.
[0168] v. Amplicon-Mediated Interference
[0169] Amplicon expression cassettes comprise a plant virus-derived
sequence that contains all or part of the target gene but generally
not all of the genes of the native virus. The viral sequences
present in the transcription product of the expression cassette
allow the transcription product to direct its own replication. The
transcripts produced by the amplicon may be either sense or
antisense relative to the target sequence (i.e., the messenger RNA
for the NR polypeptide). Methods of using amplicons to inhibit the
expression of endogenous plant genes are described, for example, in
Angell and Baulcombe, (1997) EMBO J. 16:3675-3684, Angell and
Baulcombe, (1999) Plant J. 20:357-362 and U.S. Pat. No. 6,646,805,
each of which is herein incorporated by reference.
[0170] vi. Ribozymes
[0171] In some embodiments, the polynucleotide expressed by the
expression cassette of the invention is catalytic RNA or has
ribozyme activity specific for the messenger RNA of the NR
polypeptide. Thus, the polynucleotide causes the degradation of the
endogenous messenger RNA, resulting in reduced expression of the NR
polypeptide. This method is described, for example, in U.S. Pat.
No. 4,987,071, herein incorporated by reference.
[0172] vii. Small Interfering RNA or Micro RNA
[0173] In some embodiments of the invention, inhibition of the
expression of a NR polypeptide may be obtained by RNA interference
by expression of a gene encoding a micro RNA (miRNA). miRNAs are
regulatory agents consisting of about 22 ribonucleotides. miRNA are
highly efficient at inhibiting the expression of endogenous genes.
See, for example Javier, et al., (2003) Nature 425:257-263, herein
incorporated by reference.
[0174] For miRNA interference, the expression cassette is designed
to express an RNA molecule that is modeled on an endogenous miRNA
gene. The miRNA gene encodes an RNA that forms a hairpin structure
containing a 22-nucleotide sequence that is complementary to
another endogenous gene (target sequence). For suppression of NR
expression, the 22-nucleotide sequence is selected from a NR
transcript sequence and contains 22 nucleotides of said NR sequence
in sense orientation and 21 nucleotides of a corresponding
antisense sequence that is complementary to the sense sequence.
miRNA molecules are highly efficient at inhibiting the expression
of endogenous genes, and the RNA interference they induce is
inherited by subsequent generations of plants.
[0175] 2. Polypeptide-Based Inhibition of Gene Expression
[0176] In one embodiment, the polynucleotide encodes a zinc finger
protein that binds to a gene encoding a NR polypeptide, resulting
in reduced expression of the gene. In particular embodiments, the
zinc finger protein binds to a regulatory region of a NR gene. In
other embodiments, the zinc finger protein binds to a messenger RNA
encoding a NR polypeptide and prevents its translation. Methods of
selecting sites for targeting by zinc finger proteins have been
described, for example, in U.S. Pat. No. 6,453,242 and methods for
using zinc finger proteins to inhibit the expression of genes in
plants are described, for example, in US Patent Application
Publication Number 2003/0037355, each of which is herein
incorporated by reference.
[0177] 3. Polypeptide-Based Inhibition of Protein Activity
[0178] In some embodiments of the invention, the polynucleotide
encodes an antibody that binds to at least one NR polypeptide and
reduces the enhanced nitrogen utilization activity of the NR
polypeptide. In another embodiment, the binding of the antibody
results in increased turnover of the antibody-NR complex by
cellular quality control mechanisms. The expression of antibodies
in plant cells and the inhibition of molecular pathways by
expression and binding of antibodies to proteins in plant cells are
well known in the art. See, for example, Conrad and Sonnewald,
(2003) Nature Biotech. 21:35-36, incorporated herein by
reference.
[0179] 4. Gene Disruption
[0180] In some embodiments of the present invention, the activity
of a NR polypeptide is reduced or eliminated by disrupting the gene
encoding the NR polypeptide. The gene encoding the NR polypeptide
may be disrupted by any method known in the art. For example, in
one embodiment, the gene is disrupted by transposon tagging. In
another embodiment, the gene is disrupted by mutagenizing plants
using random or targeted mutagenesis and selecting for plants that
have reduced nitrogen utilization activity.
[0181] i. Transposon Tagging
[0182] In one embodiment of the invention, transposon tagging is
used to reduce or eliminate the NR activity of one or more NR
polypeptide. Transposon tagging comprises inserting a transposon
within an endogenous NR gene to reduce or eliminate expression of
the NR polypeptide. "NR gene" is intended to mean the gene that
encodes a NR polypeptide according to the invention.
[0183] In this embodiment, the expression of one or more NR
polypeptide is reduced or eliminated by inserting a transposon
within a regulatory region or coding region of the gene encoding
the NR polypeptide. A transposon that is within an exon, intron, 5'
or 3' untranslated sequence, a promoter, or any other regulatory
sequence of a NR gene may be used to reduce or eliminate the
expression and/or activity of the encoded NR polypeptide.
[0184] Methods for the transposon tagging of specific genes in
plants are well known in the art. See, for example, Maes, et al.,
(1999) Trends Plant Sci. 4:90-96; Dharmapuri and Sonti, (1999) FEMS
Microbiol. Lett. 179:53-59; Meissner, et al., (2000) Plant J.
22:265-274; Phogat, et al., (2000) J. Biosci. 25:57-63; Walbot,
(2000) Curr. Opin. Plant Biol. 2:103-107; Gai, et al., (2000)
Nucleic Acids Res. 28:94-96; Fitzmaurice, et al., (1999) Genetics
153:1919-1928). In addition, the TUSC process for selecting Mu
insertions in selected genes has been described in Bensen, et al.,
(1995) Plant Cell 7:75-84; Mena, et al., (1996) Science
274:1537-1540 and U.S. Pat. No. 5,962,764, each of which is herein
incorporated by reference.
[0185] ii. Mutant Plants with Reduced Activity
[0186] Additional methods for decreasing or eliminating the
expression of endogenous genes in plants are also known in the art
and can be similarly applied to the instant invention. These
methods include other forms of mutagenesis, such as ethyl
methanesulfonate-induced mutagenesis, deletion mutagenesis and fast
neutron deletion mutagenesis used in a reverse genetics sense (with
PCR) to identify plant lines in which the endogenous gene has been
deleted. For examples of these methods see, Ohshima, et al., (1998)
Virology 243:472-481; Okubara, et al., (1994) Genetics 137:867-874
and Quesada, et al., (2000) Genetics 154:421-436, each of which is
herein incorporated by reference. In addition, a fast and
automatable method for screening for chemically induced mutations,
TILLING (Targeting Induced Local Lesions In Genomes), using
denaturing HPLC or selective endonuclease digestion of selected PCR
products is also applicable to the instant invention. See,
McCallum, et al., (2000) Nat. Biotechnol. 18:455-457, herein
incorporated by reference.
[0187] Mutations that impact gene expression or that interfere with
the function (enhanced nitrogen utilization activity) of the
encoded protein are well known in the art. Insertional mutations in
gene exons usually result in null-mutants. Mutations in conserved
residues are particularly effective in inhibiting the activity of
the encoded protein. Conserved residues of plant NR polypeptides
suitable for mutagenesis with the goal to eliminate NR activity
have been described. Such mutants can be isolated according to
well-known procedures, and mutations in different NR loci can be
stacked by genetic crossing. See, for example, Gruis, et al.,
(2002) Plant Cell 14:2863-2882.
[0188] In another embodiment of this invention, dominant mutants
can be used to trigger RNA silencing due to gene inversion and
recombination of a duplicated gene locus. See, for example, Kusaba,
et al., (2003) Plant Cell 15:1455-1467.
[0189] The invention encompasses additional methods for reducing or
eliminating the activity of one or more NR polypeptide. Examples of
other methods for altering or mutating a genomic nucleotide
sequence in a plant are known in the art and include, but are not
limited to, the use of RNA:DNA vectors, RNA:DNA mutational vectors,
RNA:DNA repair vectors, mixed-duplex oligonucleotides,
self-complementary RNA:DNA oligonucleotides and recombinogenic
oligonucleobases. Such vectors and methods of use are known in the
art. See, for example, U.S. Pat. Nos. 5,565,350; 5,731,181;
5,756,325; 5,760,012; 5,795,972 and 5,871,984, each of which are
herein incorporated by reference. See also, WO 1998/49350, WO
1999/07865, WO 1999/25821 and Beetham, et al., (1999) Proc. Natl.
Acad. Sci. USA 96:8774-8778, each of which is herein incorporated
by reference.
[0190] iii. Modulating Nitrogen Utilization Activity
[0191] In specific methods, the level and/or activity of a NR
regulator in a plant is decreased by increasing the level or
activity of the NR polypeptide in the plant. The increased
expression of a negative regulatory molecule may decrease the level
of expression of downstream one or more genes responsible for an
improved NR phenotype.
[0192] Methods for increasing the level and/or activity of NR
polypeptides in a plant are discussed elsewhere herein. Briefly,
such methods comprise providing a NR polypeptide of the invention
to a plant and thereby increasing the level and/or activity of the
NR polypeptide. In other embodiments, a NR nucleotide sequence
encoding a NR polypeptide can be provided by introducing into the
plant a polynucleotide comprising a NR nucleotide sequence of the
invention, expressing the NR sequence, increasing the activity of
the NR polypeptide and thereby decreasing the number of tissue
cells in the plant or plant part. In other embodiments, the NR
nucleotide construct introduced into the plant is stably
incorporated into the genome of the plant.
[0193] In other methods, the growth of a plant tissue is increased
by decreasing the level and/or activity of the NR polypeptide in
the plant. Such methods are disclosed in detail elsewhere herein.
In one such method, a NR nucleotide sequence is introduced into the
plant and expression of said NR nucleotide sequence decreases the
activity of the NR polypeptide and thereby increasing the tissue
growth in the plant or plant part. In other embodiments, the NR
nucleotide construct introduced into the plant is stably
incorporated into the genome of the plant.
[0194] As discussed above, one of skill will recognize the
appropriate promoter to use to modulate the level/activity of a NR
in the plant. Exemplary promoters for this embodiment have been
disclosed elsewhere herein.
[0195] In other embodiments, such plants have stably incorporated
into their genome a nucleic acid molecule comprising a NR
nucleotide sequence of the invention operably linked to a promoter
that drives expression in the plant cell.
[0196] iv. Modulating Root Development
[0197] Methods for modulating root development in a plant are
provided. By "modulating root development" is intended any
alteration in the development of the plant root when compared to a
control plant. Such alterations in root development include, but
are not limited to, alterations in the growth rate of the primary
root, the fresh root weight, the extent of lateral and adventitious
root formation, the vasculature system, meristem development or
radial expansion.
[0198] Methods for modulating root development in a plant are
provided. The methods comprise modulating the level and/or activity
of the NR polypeptide in the plant. In one method, a NR sequence of
the invention is provided to the plant. In another method, the NR
nucleotide sequence is provided by introducing into the plant a
polynucleotide comprising a NR nucleotide sequence of the
invention, expressing the NR sequence and thereby modifying root
development. In still other methods, the NR nucleotide construct
introduced into the plant is stably incorporated into the genome of
the plant.
[0199] In other methods, root development is modulated by altering
the level or activity of the NR polypeptide in the plant. A change
in NR activity can result in at least one or more of the following
alterations to root development, including, but not limited to,
alterations in root biomass and length.
[0200] As used herein, "root growth" encompasses all aspects of
growth of the different parts that make up the root system at
different stages of its development in both monocotyledonous and
dicotyledonous plants. It is to be understood that enhanced root
growth can result from enhanced growth of one or more of its parts
including the primary root, lateral roots, adventitious roots,
etc.
[0201] Methods of measuring such developmental alterations in the
root system are known in the art. See, for example, US Patent
Application Publication Number 2003/0074698 and Werner, et al.,
(2001) PNAS 18:10487-10492, both of which are herein incorporated
by reference.
[0202] As discussed above, one of skill will recognize the
appropriate promoter to use to modulate root development in the
plant. Exemplary promoters for this embodiment include constitutive
promoters and root-preferred promoters. Exemplary root-preferred
promoters have been disclosed elsewhere herein.
[0203] Stimulating root growth and increasing root mass by
decreasing the activity and/or level of the NR polypeptide also
finds use in improving the standability of a plant. The term
"resistance to lodging" or "standability" refers to the ability of
a plant to fix itself to the soil. For plants with an erect or
semi-erect growth habit, this term also refers to the ability to
maintain an upright position under adverse (environmental)
conditions. This trait relates to the size, depth and morphology of
the root system. In addition, stimulating root growth and
increasing root mass by altering the level and/or activity of the
NR polypeptide also finds use in promoting in vitro propagation of
explants.
[0204] Furthermore, higher root biomass production due to NR
activity has a direct effect on the yield and an indirect effect of
production of compounds produced by root cells or transgenic root
cells or cell cultures of said transgenic root cells. One example
of an interesting compound produced in root cultures is shikonin,
the yield of which can be advantageously enhanced by said
methods.
[0205] Accordingly, the present invention further provides plants
having modulated root development when compared to the root
development of a control plant. In some embodiments, the plant of
the invention has an increased level/activity of the NR polypeptide
of the invention and has enhanced root growth and/or root biomass.
In other embodiments, such plants have stably incorporated into
their genome a nucleic acid molecule comprising a NR nucleotide
sequence of the invention operably linked to a promoter that drives
expression in the plant cell.
[0206] v. Modulating Shoot and Leaf Development
[0207] Methods are also provided for modulating shoot and leaf
development in a plant. By "modulating shoot and/or leaf
development" is intended any alteration in the development of the
plant shoot and/or leaf. Such alterations in shoot and/or leaf
development include, but are not limited to, alterations in shoot
meristem development, in leaf number, leaf size, leaf and stem
vasculature, internode length and leaf senescence. As used herein,
"leaf development" and "shoot development" encompasses all aspects
of growth of the different parts that make up the leaf system and
the shoot system, respectively, at different stages of their
development, both in monocotyledonous and dicotyledonous plants.
Methods for measuring such developmental alterations in the shoot
and leaf system are known in the art. See, for example, Werner, et
al., (2001) PNAS 98:10487-10492 and US Patent Application
Publication Number 2003/0074698, each of which is herein
incorporated by reference.
[0208] The method for modulating shoot and/or leaf development in a
plant comprises modulating the activity and/or level of a NR
polypeptide of the invention. In one embodiment, a NR sequence of
the invention is provided. In other embodiments, the NR nucleotide
sequence can be provided by introducing into the plant a
polynucleotide comprising a NR nucleotide sequence of the
invention, expressing the NR sequence, and thereby modifying shoot
and/or leaf development. In other embodiments, the NR nucleotide
construct introduced into the plant is stably incorporated into the
genome of the plant.
[0209] In specific embodiments, shoot or leaf development is
modulated by altering the level and/or activity of the NR
polypeptide in the plant. A change in NR activity can result in at
least one or more of the following alterations in shoot and/or leaf
development, including, but not limited to, changes in leaf number,
altered leaf surface, altered vasculature, internodes and plant
growth and alterations in leaf senescence, when compared to a
control plant.
[0210] As discussed above, one of skill will recognize the
appropriate promoter to use to modulate shoot and leaf development
of the plant. Exemplary promoters for this embodiment include
constitutive promoters, shoot-preferred promoters, shoot
meristem-preferred promoters and leaf-preferred promoters.
Exemplary promoters have been disclosed elsewhere herein.
[0211] Increasing NR activity and/or level in a plant results in
altered internodes and growth. Thus, the methods of the invention
find use in producing modified plants. In addition, as discussed
above, NR activity in the plant modulates both root and shoot
growth. Thus, the present invention further provides methods for
altering the root/shoot ratio. Shoot or leaf development can
further be modulated by altering the level and/or activity of the
NR polypeptide in the plant.
[0212] Accordingly, the present invention further provides plants
having modulated shoot and/or leaf development when compared to a
control plant. In some embodiments, the plant of the invention has
an increased level/activity of the NR polypeptide of the invention.
In other embodiments, the plant of the invention has a decreased
level/activity of the NR polypeptide of the invention.
[0213] vi. Modulating Reproductive Tissue Development
[0214] Methods for modulating reproductive tissue development are
provided. In one embodiment, methods are provided to modulate
floral development in a plant. By "modulating floral development"
is intended any alteration in a structure of a plant's reproductive
tissue as compared to a control plant in which the activity or
level of the NR polypeptide has not been modulated. "Modulating
floral development" further includes any alteration in the timing
of the development of a plant's reproductive tissue (i.e., a
delayed or a accelerated timing of floral development) when
compared to a control plant in which the activity or level of the
NR polypeptide has not been modulated. Macroscopic alterations may
include changes in size, shape, number or location of reproductive
organs, the developmental time period that these structures form or
the ability to maintain or proceed through the flowering process in
times of environmental stress. Microscopic alterations may include
changes to the types or shapes of cells that make up the
reproductive organs.
[0215] The method for modulating floral development in a plant
comprises modulating NR activity in a plant. In one method, a NR
sequence of the invention is provided. A NR nucleotide sequence can
be provided by introducing into the plant a polynucleotide
comprising a NR nucleotide sequence of the invention, expressing
the NR sequence, and thereby modifying floral development. In other
embodiments, the NR nucleotide construct introduced into the plant
is stably incorporated into the genome of the plant.
[0216] In specific methods, floral development is modulated by
increasing the level or activity of the NR polypeptide in the
plant. A change in NR activity can result in at least one or more
of the following alterations in floral development, including, but
not limited to, altered flowering, changed number of flowers,
modified male sterility and altered seed set, when compared to a
control plant. Inducing delayed flowering or inhibiting flowering
can be used to enhance yield in forage crops such as alfalfa.
Methods for measuring such developmental alterations in floral
development are known in the art. See, for example, Mouradov, et
al., (2002) The Plant Cell S111-S130, herein incorporated by
reference.
[0217] As discussed above, one of skill will recognize the
appropriate promoter to use to modulate floral development of the
plant. Exemplary promoters for this embodiment include constitutive
promoters, inducible promoters, shoot-preferred promoters and
inflorescence-preferred promoters.
[0218] In other methods, floral development is modulated by
altering the level and/or activity of the NR sequence of the
invention. Such methods can comprise introducing a NR nucleotide
sequence into the plant and changing the activity of the NR
polypeptide. In other methods, the NR nucleotide construct
introduced into the plant is stably incorporated into the genome of
the plant. Altering expression of the NR sequence of the invention
can modulate floral development during periods of stress. Such
methods are described elsewhere herein. Accordingly, the present
invention further provides plants having modulated floral
development when compared to the floral development of a control
plant. Compositions include plants having a altered level/activity
of the NR polypeptide of the invention and having an altered floral
development. Compositions also include plants having a modified
level/activity of the NR polypeptide of the invention wherein the
plant maintains or proceeds through the flowering process in times
of stress.
[0219] Methods are also provided for the use of the NR sequences of
the invention to increase seed size and/or weight. The method
comprises increasing the activity of the NR sequences in a plant or
plant part, such as the seed. An increase in seed size and/or
weight comprises an increased size or weight of the seed and/or an
increase in the size or weight of one or more seed part including,
for example, the embryo, endosperm, seed coat, aleurone or
cotyledon.
[0220] As discussed above, one of skill will recognize the
appropriate promoter to use to increase seed size and/or seed
weight. Exemplary promoters of this embodiment include constitutive
promoters, inducible promoters, seed-preferred promoters,
embryo-preferred promoters and endosperm-preferred promoters.
[0221] The method for altering seed size and/or seed weight in a
plant comprises increasing NR activity in the plant. In one
embodiment, the NR nucleotide sequence can be provided by
introducing into the plant a polynucleotide comprising a NR
nucleotide sequence of the invention, expressing the NR sequence
and thereby decreasing seed weight and/or size. In other
embodiments, the NR nucleotide construct introduced into the plant
is stably incorporated into the genome of the plant.
[0222] It is further recognized that increasing seed size and/or
weight can also be accompanied by an increase in the speed of
growth of seedlings or an increase in early vigor. As used herein,
the term "early vigor" refers to the ability of a plant to grow
rapidly during early development, and relates to the successful
establishment, after germination, of a well-developed root system
and a well-developed photosynthetic apparatus. In addition, an
increase in seed size and/or weight can also result in an increase
in plant yield when compared to a control.
[0223] Accordingly, the present invention further provides plants
having an increased seed weight and/or seed size when compared to a
control plant. In other embodiments, plants having an increased
vigor and plant yield are also provided. In some embodiments, the
plant of the invention has a modified level/activity of the NR
polypeptide of the invention and has an increased seed weight
and/or seed size. In other embodiments, such plants have stably
incorporated into their genome a nucleic acid molecule comprising a
NR nucleotide sequence of the invention operably linked to a
promoter that drives expression in the plant cell.
[0224] vii. Method of Use for NR Polynucleotide, Expression
Cassettes, and Additional Polynucleotides
[0225] The nucleotides, expression cassettes and methods disclosed
herein are useful in regulating expression of any heterologous
nucleotide sequence in a host plant in order to vary the phenotype
of a plant. Various changes in phenotype are of interest including
modifying the fatty acid composition in a plant, altering the amino
acid content of a plant, altering a plant's pathogen defense
mechanism and the like. These results can be achieved by providing
expression of heterologous products or increased expression of
endogenous products in plants. Alternatively, the results can be
achieved by providing for a reduction of expression of one or more
endogenous products, particularly enzymes or cofactors in the
plant. These changes result in a change in phenotype of the
transformed plant.
[0226] Genes of interest are reflective of the commercial markets
and interests of those involved in the development of the crop.
Crops and markets of interest change, and as developing nations
open up world markets, new crops and technologies will emerge also.
In addition, as our understanding of agronomic traits and
characteristics such as yield and heterosis increase, the choice of
genes for transformation will change accordingly. General
categories of genes of interest include, for example, those genes
involved in information, such as zinc fingers, those involved in
communication, such as kinases, and those involved in housekeeping,
such as heat shock proteins. More specific categories of
transgenes, for example, include genes encoding important traits
for agronomics, insect resistance, disease resistance, herbicide
resistance, sterility, grain characteristics and commercial
products. Genes of interest include, generally, those involved in
oil, starch, carbohydrate or nutrient metabolism as well as those
affecting kernel size, sucrose loading and the like.
[0227] The polynucleotides of the present invention may be stacked
with any gene or combination of genes to produce plants with a
variety of desired trait combinations, including but not limited to
traits desirable for animal feed such as high oil genes (e.g., U.S.
Pat. No. 6,232,529); balanced amino acids (e.g., hordothionins
(U.S. Pat. Nos. 5,990,389; 5,885,801; 5,885,802 and 5,703,409);
barley high lysine (Williamson, et al., (1987) Eur. J. Biochem.
165:99-106 and WO 1998/20122) and high methionine proteins
(Pedersen, et al., (1986) J. Biol. Chem. 261:6279; Kirihara, et
al., (1988) Gene 71:359 and Musumura, et al., (1989) Plant Mol.
Biol. 12:123)); increased digestibility (e.g., modified storage
proteins (U.S. patent application Ser. No. 10/053,410, filed Nov.
7, 2001) and thioredoxins (U.S. patent application Ser. No.
10/005,429, filed Dec. 3, 2001)), the disclosures of which are
herein incorporated by reference. The polynucleotides of the
present invention can also be stacked with traits desirable for
insect, disease or herbicide resistance (e.g., Bacillus
thuringiensis toxic proteins (U.S. Pat. Nos. 5,366,892; 5,747,450;
5,737,514; 5723,756; 5,593,881; Geiser, et al., (1986) Gene
48:109); lectins (Van Damme, et al., (1994) Plant Mol. Biol.
24:825); fumonisin detoxification genes (U.S. Pat. No. 5,792,931);
avirulence and disease resistance genes (Jones, et al., (1994)
Science 266:789; Martin, et al., (1993) Science 262:1432;
Mindrinos, et al., (1994) Cell 78:1089); acetolactate synthase
(ALS) mutants that lead to herbicide resistance such as the S4
and/or Hra mutations; inhibitors of glutamine synthase such as
phosphinothricin or basta (e.g., bar gene) and glyphosate
resistance (EPSPS gene)) and traits desirable for processing or
process products such as high oil (e.g., U.S. Pat. No. 6,232,529);
modified oils (e.g., fatty acid desaturase genes (U.S. Pat. No.
5,952,544; WO 1994/11516)); modified starches (e.g., ADPG
pyrophosphorylases (AGPase), starch synthases (SS), starch
branching enzymes (SBE) and starch debranching enzymes (SDBE)) and
polymers or bioplastics (e.g., U.S. Pat. No. 5,602,321;
beta-ketothiolase, polyhydroxybutyrate synthase and acetoacetyl-CoA
reductase (Schubert, et al., (1988) J. Bacteriol. 170:5837-5847)
facilitate expression of polyhydroxyalkanoates (PHAs)), the
disclosures of which are herein incorporated by reference. One
could also combine the polynucleotides of the present invention
with polynucleotides affecting agronomic traits such as male
sterility (e.g., see U.S. Pat. No. 5,583,210), stalk strength,
flowering time or transformation technology traits such as cell
cycle regulation or gene targeting (e.g., WO 1999/61619; WO
2000/17364; WO 1999/25821), the disclosures of which are herein
incorporated by reference.
[0228] In one embodiment, sequences of interest improve plant
growth and/or crop yields. For example, sequences of interest
include agronomically important genes that result in improved
primary or lateral root systems. Such genes include, but are not
limited to, nutrient/water transporters and growth induces.
Examples of such genes, include but are not limited to, maize
plasma membrane H.sup.+-ATPase (MHA2) (Frias, et al., (1996) Plant
Cell 8:1533-44); AKT1, a component of the potassium uptake
apparatus in Arabidopsis, (Spalding, et al., (1999) J Gen Physiol
113:909-18); RML genes which activate cell division cycle in the
root apical cells (Cheng, et al., (1995) Plant Physiol 108:881);
maize glutamine synthetase genes (Sukanya, et al., (1994) Plant Mol
Biol 26:1935-46) and hemoglobin (Duff, et al., (1997) J. Biol.
Chem. 27:16749-16752, Arredondo-Peter, et al., (1997) Plant
Physiol. 115:1259-1266; Arredondo-Peter, et al., (1997) Plant
Physiol 114:493-500 and references sited therein). The sequence of
interest may also be useful in expressing antisense nucleotide
sequences of genes that that negatively affects root
development.
[0229] Additional, agronomically important traits such as oil,
starch and protein content can be genetically altered in addition
to using traditional breeding methods. Modifications include
increasing content of oleic acid, saturated and unsaturated oils,
increasing levels of lysine and sulfur, providing essential amino
acids and also modification of starch. Hordothionin protein
modifications are described in U.S. Pat. Nos. 5,703,049, 5,885,801,
5,885,802 and 5,990,389, herein incorporated by reference. Another
example is lysine and/or sulfur rich seed protein encoded by the
soybean 2S albumin described in U.S. Pat. No. 5,850,016 and the
chymotrypsin inhibitor from barley, described in Williamson, et
al., (1987) Eur. J. Biochem. 165:99-106, the disclosures of which
are herein incorporated by reference.
[0230] Derivatives of the coding sequences can be made by
site-directed mutagenesis to increase the level of preselected
amino acids in the encoded polypeptide. For example, the gene
encoding the barley high lysine polypeptide (BHL) is derived from
barley chymotrypsin inhibitor, U.S. patent application Ser. No.
08/740,682, filed Nov. 1, 1996 and WO 1998/20133, the disclosures
of which are herein incorporated by reference. Other proteins
include methionine-rich plant proteins such as from sunflower seed
(Lilley, et al., (1989) Proceedings of the World Congress on
Vegetable Protein Utilization in Human Foods and Animal Feedstuffs,
ed. Applewhite (American Oil Chemists Society, Champaign, Ill.),
pp. 497-502; herein incorporated by reference); corn (Pedersen, et
al., (1986) J. Biol. Chem. 261:6279; Kirihara, et al., (1988) Gene
71:359, both of which are herein incorporated by reference) and
rice (Musumura, et al., (1989) Plant Mol. Biol. 12:123, herein
incorporated by reference). Other agronomically important genes
encode latex, Floury 2, growth factors, seed storage factors and
transcription factors.
[0231] Insect resistance genes may encode resistance to pests that
have great yield drag such as rootworm, cutworm, European Corn
Borer, and the like. Such genes include, for example, Bacillus
thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,736,514; 5,723,756; 5,593,881 and Geiser, et al.,
(1986) Gene 48:109); and the like.
[0232] Genes encoding disease resistance traits include
detoxification genes, such as against fumonosin (U.S. Pat. No.
5,792,931); avirulence (avr) and disease resistance (R) genes
(Jones, et al., (1994) Science 266:789; Martin, et al., (1993)
Science 262:1432 and Mindrinos, et al., (1994) Cell 78:1089), and
the like.
[0233] Herbicide resistance traits may include genes coding for
resistance to herbicides that act to inhibit the action of
acetolactate synthase (ALS), in particular the sulfonylurea-type
herbicides (e.g., the acetolactate synthase (ALS) gene containing
mutations leading to such resistance, in particular the S4 and/or
Hra mutations), genes coding for resistance to herbicides that act
to inhibit action of glutamine synthase, such as phosphinothricin
or basta (e.g., the bar gene) or other such genes known in the art.
The bar gene encodes resistance to the herbicide basta, the nptII
gene encodes resistance to the antibiotics kanamycin and geneticin
and the ALS-gene mutants encode resistance to the herbicide
chlorsulfuron.
[0234] Sterility genes can also be encoded in an expression
cassette and provide an alternative to physical detasseling.
Examples of genes used in such ways include male tissue-preferred
genes and genes with male sterility phenotypes such as QM,
described in U.S. Pat. No. 5,583,210. Other genes include kinases
and those encoding compounds toxic to either male or female
gametophytic development.
[0235] The quality of grain is reflected in traits such as levels
and types of oils, saturated and unsaturated, quality and quantity
of essential amino acids and levels of cellulose. In corn, modified
hordothionin proteins are described in U.S. Pat. Nos. 5,703,049,
5,885,801, 5,885,802 and 5,990,389.
[0236] Commercial traits can also be encoded on a gene or genes
that could increase for example, starch for ethanol production or
provide expression of proteins. Another important commercial use of
transformed plants is the production of polymers and bioplastics
such as described in U.S. Pat. No. 5,602,321. Genes such as
13-Ketothiolase, PHBase (polyhydroxyburyrate synthase) and
acetoacetyl-CoA reductase (see, Schubert, et al., (1988) J.
Bacteriol. 170:5837-5847) facilitate expression of
polyhyroxyalkanoates (PHAs).
[0237] Exogenous products include plant enzymes and products as
well as those from other sources including procaryotes and other
eukaryotes. Such products include enzymes, cofactors, hormones, and
the like. The level of proteins, particularly modified proteins
having improved amino acid distribution to improve the nutrient
value of the plant, can be increased. This is achieved by the
expression of such proteins having enhanced amino acid content.
[0238] This invention can be better understood by reference to the
following non-limiting examples. It will be appreciated by those
skilled in the art that other embodiments of the invention may be
practiced without departing from the spirit and the scope of the
invention as herein disclosed and claimed.
EXAMPLES
Example 1
Isolation of NR Sequences
[0239] 20,778 Porphyra yezoensis ESTs were identified in Genbank
then downloaded. The dataset was converted to fasta, formatted for
BLAST algorithm searching and searched with maize nitrate reductase
as the query.
[0240] Multiple ESTs likely encoding fragments of nitrate reductase
genes were identified, and EST contigs were built, supplemented by
5'- and 3'-directional EST walking and final contig assembly of the
gene transcript region. Prior to this contig assembly the gene and
its coding region existed in the public databases as short EST
sequences representing merely fragments of the gene. The resulting
Porphyra yezoensis nitrate reductase transcript contig represented
a 5'UTR, the N-terminus and all but the last (C-terminal) 167
codons of the peptide.
[0241] Assuming the two strains of Porphyra were closely related
organisms, oligonucleotide primers were designed from the assembled
Porphyra yezoensis nitrate reductase gene with sense:
attgtggtgcacaacaaggtgtatga (SEQ ID NO: 13) and anti-sense primers:
tcggcttccacatgttcctg (SEQ ID NO: 14). These primers were used to
amplify a 448 bp internal region of the gene using Porphyra
perforata genomic DNA. A Genome Walking kit from Bio S&T
(Montreal, Quebec, Canada) was then used to determine both ends of
the gene, walking out from the internal fragment. (Standard
conditions for nested PCR, ligation and digestion as per the
provided SOP from Bio S&T were used). For the Porphyra
perforata gene discovery, the following walking primers were
designed--ccgtgtacctccgcaactct (SEQ ID NO: 15),
gctgcactttgtgcgcaacc (SEQ ID NO: 16), gcatgggacgagggcaacaa (SEQ ID
NO: 17), gcttgcccgtcggcttccacatgtt (SEQ ID NO: 18),
catcgaaggctccatggtcatgcg (SEQ ID NO: 19) and
ctacacgccaacgtcgtctgacgca (SEQ ID NO: 20).
[0242] Again assuming the Porphyra were closely related organisms,
Porphyra perforate primers for full length nitrate reductase were
used to amplify the gene from the closely related Porphyra
yezoensis red algae, but with a lower annealing temperature of
52.degree. C. in the initial PCR set-up for 40 cycles. Regions were
sequence verified as correct, then using the same Genome Walking
kit from Bio S&T ambiguous regions and the remaining ends of
the Porphyra yezoensis along with associated untranslated regions
were determined.
[0243] The entire ORF of the nitrate reductase gene from both
species was cloned as a large PCR product using a high-fidelity Taq
polymerase and a minimal of at least three independent clones was
used to verify the correct internal sequence. The ORF of the
Porphyra perforate nitrate reductase gene was amplified with sense:
catggaggctgcttctggtgc (SEQ ID NO: 21) and anti-sense primers:
tcaacgagctgcttgtgggca (SEQ ID NO: 22). The ORF of the Porphyra
yezoensis nitrate reductase gene was amplified with sense:
cccatcaccgcacagccga (SEQ ID NO: 23) and anti-sense primers:
agagaggcgccccttgcatgtt (SEQ ID NO: 24). For most regions of the
gene, more clones were used to validate the full-length sequence.
Protein and nucleotide alignments confirmed that both genes were
closely associated and had many conserved protein residues when
compared to other nitrate reductase enzymes. There are no introns
for either Nitrate Reductase coding DNA sequence.
Example 2
Pichia pastoris Expression Vectors and Yeast Transformation
[0244] Pichia pastoris is a non-nitrate assimilating yeast and
requires both functional nitrate transporter and nitrate reductase
to uptake nitrate (Unkles, et al., (2004) J. Biol. Chem.
279:28182-28186). P. pastoris has been used as a model system for
identification and characterization of nitrate reductases and/or
plant nitrate transporters. The nitrate reductase activity can be
determined in vitro or in vivo when a nitrate transporter gene was
co-expressed. The wild type nitrate reductase genes from Porphyra
performa (PpNR) and Porphyra yezoensis (PyNR) driven by a yeast
constitutive promoter (GAP promoter, glyceraldehydes-3-phosphate
dehydrogenase) was integrated into AOX1 locus of P. pastoris stain
KM71 carrying a yeast nitrate transporter gene (YNT1).
[0245] Details: YNT1 (nitrate transporter from Pichia angusta)
driven by GAP promoter (vector: p3.5GAP-YNT1) was integrated into
P. pastoris strain KM71 genome at His4 locus to generate
YNT1-containing lines. After the YNT1-containing lines were
confirmed by PCR, PpNR or PyNR driven by GAP promoter was
integrated into the genome at AOX1 locus (vectors: pAOXGAP-PPNR and
PAOXGAP-PYNR). (Pichia transformation kit is from Invitrogen. Both
expression vector backbones were modified based on the versions
from Invitrogen.)
Functional Expression in P. pastoris:
[0246] Recombinant KM71 transformed with p3.5GAP-YNT1 and/or
pAOXGAP-PPNR, pAOXGAP-PYNR were screened for NR activity.
Transformants were cultured in rich media (YPD) at 30.degree. C.
for overnight. Yeast cells were collected and washed with water
twice then re-suspended in 20 uM MOPS, pH6.5 and 1% glucose
containing 1 mM NaNO.sub.3. After 2 hours incubation at 30.degree.
C., the supernatant was collected for nitrite assay with 2% and 2%.
The Vmax of PpNR is 70-80.times. higher than Py-NR. The
transformants containing PpNR showed much stronger nitrate
reductase activity than PyNR in P. pastoris in vivo.
Kinetics in P. pastoris:
[0247] The nitrite concentration of P. pastoris KM71-containing
YNT1 and PpNR line incubated with different nitrate concentration
from 0-30 mM at three pH, pH5.5, 6.5 and 7.5 was assayed in vivo.
PpNR has better Vmax at pH6.5. The Km is about 30-40 .mu.M. This
data match the predicted results (published PyNR with Km 64 .mu.M).
At the same time, maize NR, ZM-NR and yeast NR from P. angusta,
YNR1, were assayed at similar conditions. The Km of ZM-NR is about
300 uM and YNR1 has Km about 200-400 .mu.M. They also have the
better Vmax at pH6.5. The PPNR is an efficient NR with Km 10.times.
lower than others.
Example 3
PpNR and PyNR Mutants
[0248] To maintain high level of active form of PPNR in transgenic
plants, the serine residue in a putative phosphorylation motif
R/K-S/T-X-pS-X-P (J. of Experimental Botany (2004) 55:1275-1282) at
position 561 will be mutated to either alanine (S561A mutant,
sequence provided) or aspartic acid (S561D mutant). The mutated
PPNRs will be generated in P. pastoris and tested in YNT1-carrying
line for NR activity as described before. The functional S561A or
S561D will be expressed in transgenic plants driven by a
constitutive promoter or a mesophyll preferred promoter. The NR
activity will be tested during light/dark transitions. Other
putative post-translational regions such as N-terminal region of
PPNR may be modified or deleted to de-regulate by light at
post-translational level.
Example 4
Transformation and Regeneration of Transgenic Plants
[0249] Immature maize embryos from greenhouse donor plants are
bombarded with a plasmid containing the NR sequence operably linked
to the drought-inducible promoter RAB17 promoter (Vilardell, et
al., (1990) Plant Mol Biol 14:423-432) and the selectable marker
gene PAT, which confers resistance to the herbicide Bialaphos.
(Miller, et al., (2000) Biochimica et Biophysica Acta
1465:343-358). Alternatively, the selectable marker gene is
provided on a separate plasmid. Transformation is performed as
follows. Media recipes follow below.
Preparation of Target Tissue:
[0250] The ears are husked and surface sterilized in 30%
Clorox.RTM. bleach plus 0.5% Micro detergent for 20 minutes, and
rinsed two times with sterile water. The immature embryos are
excised and placed embryo axis side down (scutellum side up), 25
embryos per plate, on 560Y medium for 4 hours and then aligned
within the 2.5-cm target zone in preparation for bombardment.
Preparation of DNA:
[0251] A plasmid vector comprising the NR sequence operably linked
to an ubiquitin promoter is made. This plasmid DNA plus plasmid DNA
containing a PAT selectable marker is precipitated onto 1.1 .mu.m
(average diameter) tungsten pellets using a CaCl.sub.2
precipitation procedure as follows:
100 .mu.l prepared tungsten particles in water 10 .mu.l (1 .mu.g)
DNA in Tris EDTA buffer (1 .mu.g total DNA)
100 .mu.l 2.5 M CaCl.sub.2
[0252] 10 .mu.l 0.1 M spermidine
[0253] Each reagent is added sequentially to the tungsten particle
suspension, while maintained on the multitube vortexer. The final
mixture is sonicated briefly and allowed to incubate under constant
vortexing for 10 minutes. After the precipitation period, the tubes
are centrifuged briefly, liquid removed, washed with 500 ml 100%
ethanol and centrifuged for 30 seconds. Again the liquid is
removed, and 105 .mu.l 100% ethanol is added to the final tungsten
particle pellet. For particle gun bombardment, the tungsten/DNA
particles are briefly sonicated and 10 .mu.l spotted onto the
center of each macrocarrier and allowed to dry about 2 minutes
before bombardment.
Particle Gun Treatment:
[0254] The sample plates are bombarded at level #4 in a particle
gun. All samples receive a single shot at 650 PSI, with a total of
ten aliquots taken from each tube of prepared particles/DNA.
Subsequent Treatment:
[0255] Following bombardment, the embryos are kept on 560Y medium
for 2 days, then transferred to 560R selection medium containing 3
mg/liter Bialaphos, and subcultured every 2 weeks. After
approximately 10 weeks of selection, selection-resistant callus
clones are transferred to 288J medium to initiate plant
regeneration. Following somatic embryo maturation (2-4 weeks),
well-developed somatic embryos are transferred to medium for
germination and transferred to the lighted culture room.
Approximately 7-10 days later, developing plantlets are transferred
to 272V hormone-free medium in tubes for 7-10 days until plantlets
are well established. Plants are then transferred to inserts in
flats (equivalent to 2.5'' pot) containing potting soil and grown
for 1 week in a growth chamber, subsequently grown an additional
1-2 weeks in the greenhouse, then transferred to classic 600 pots
(1.6 gallon) and grown to maturity. Plants are monitored and scored
for increased drought tolerance. Assays to measure improved drought
tolerance are routine in the art and include, for example,
increased kernel-earring capacity yields under drought conditions
when compared to control maize plants under identical environmental
conditions. Alternatively, the transformed plants can be monitored
for a modulation in meristem development (i.e., a decrease in
spikelet formation on the ear). See, for example, Bruce, et al.,
(2002) Journal of Experimental Botany 53:1-13.
Bombardment and Culture Media:
[0256] Bombardment medium (560Y) comprises 4.0 g/l N6 basal salts
(SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix
(1000.times.SIGMA-1511), 0.5 mg/l thiamine HCl, 120.0 g/l sucrose,
1.0 mg/l 2,4-D and 2.88 g/l L-proline (brought to volume with D-I
H.sub.2O following adjustment to pH 5.8 with KOH); 2.0 g/l
Gelrite.RTM. (added after bringing to volume with D-I H.sub.2O);
and 8.5 mg/l silver nitrate (added after sterilizing the medium and
cooling to room temperature). Selection medium (560R) comprises 4.0
g/l N6 basal salts (SIGMA C-1416), 1.0 ml/I Eriksson's Vitamin Mix
(1000.times.SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose,
and 2.0 mg/l 2,4-D (brought to volume with D-I H.sub.2O following
adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite.RTM. (added after
bringing to volume with D-I H.sub.2O) and 0.85 mg/l silver nitrate
and 3.0 mg/l bialaphos (both added after sterilizing the medium and
cooling to room temperature).
[0257] Plant regeneration medium (288J) comprises 4.3 g/l MS salts
(GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g
nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL and
0.40 g/l glycine brought to volume with polished D-I H.sub.2O)
(Murashige and Skoog, (1962) Physiol. Plant. 15:473), 100 mg/l
myo-inositol, 0.5 mg/l zeatin, 60 g/l sucrose and 1.0 ml/I of 0.1
mM abscisic acid (brought to volume with polished D-I H.sub.2O
after adjusting to pH 5.6); 3.0 g/l Gelrite.RTM. (added after
bringing to volume with D-I H.sub.2O) and 1.0 mg/l indoleacetic
acid and 3.0 mg/l bialaphos (added after sterilizing the medium and
cooling to 60.degree. C.). Hormone-free medium (272V) comprises 4.3
g/l MS salts (GIBCO 11117-074), 5.0 ml/I MS vitamins stock solution
(0.100 g/l nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l
pyridoxine HCL and 0.40 g/l glycine brought to volume with polished
D-I H.sub.2O), 0.1 g/1 myo-inositol and 40.0 g/l sucrose (brought
to volume with polished D-I H.sub.2O after adjusting pH to 5.6) and
6 g/l Bacto.TM.-agar (added after bringing to volume with polished
D-I H.sub.2O), sterilized and cooled to 60.degree. C.
Example 5
Agrobacterium-Mediated Transformation
[0258] For Agrobacterium-mediated transformation of maize with an
antisense sequence of the NR sequence of the present invention,
preferably the method of Zhao is employed (U.S. Pat. No. 5,981,840
and PCT Patent Application Publication WO 1998/32326, the contents
of which are hereby incorporated by reference). Briefly, immature
embryos are isolated from maize and the embryos contacted with a
suspension of Agrobacterium, where the bacteria are capable of
transferring the antisense NR sequences to at least one cell of at
least one of the immature embryos (step 1: the infection step). In
this step the immature embryos are preferably immersed in an
Agrobacterium suspension for the initiation of inoculation. The
embryos are co-cultured for a time with the Agrobacterium (step 2:
the co-cultivation step). Preferably the immature embryos are
cultured on solid medium following the infection step. Following
this co-cultivation period an optional "resting" step is
contemplated. In this resting step, the embryos are incubated in
the presence of at least one antibiotic known to inhibit the growth
of Agrobacterium without the addition of a selective agent for
plant transformants (step 3: resting step). Preferably the immature
embryos are cultured on solid medium with antibiotic, but without a
selecting agent, for elimination of Agrobacterium and for a resting
phase for the infected cells. Next, inoculated embryos are cultured
on medium containing a selective agent and growing transformed
callus is recovered (step 4: the selection step). Preferably, the
immature embryos are cultured on solid medium with a selective
agent resulting in the selective growth of transformed cells. The
callus is then regenerated into plants (step 5: the regeneration
step) and preferably calli grown on selective medium are cultured
on solid medium to regenerate the plants. Plants are monitored and
scored for a modulation in meristem development (for instance,
alterations of size and appearance of the shoot and floral
meristems and/or increased yields of leaves, flowers and/or
fruits).
Example 6
Soybean Embryo Transformation
[0259] Soybean embryos are bombarded with a plasmid containing an
antisense NR sequences operably linked to an ubiquitin promoter as
follows. To induce somatic embryos, cotyledons, 3-5 mm in length
dissected from surface-sterilized, immature seeds of the soybean
cultivar A2872, are cultured in the light or dark at 26.degree. C.
on an appropriate agar medium for six to ten weeks. Somatic embryos
producing secondary embryos are then excised and placed into a
suitable liquid medium. After repeated selection for clusters of
somatic embryos that multiplied as early, globular-staged embryos,
the suspensions are maintained as described below.
[0260] Soybean embryogenic suspension cultures can be maintained in
35 ml liquid media on a rotary shaker, 150 rpm, at 26.degree. C.
with florescent lights on a 16:8 hour day/night schedule. Cultures
are subcultured every two weeks by inoculating approximately 35 mg
of tissue into 35 ml of liquid medium.
[0261] Soybean embryogenic suspension cultures may then be
transformed by the method of particle gun bombardment (Klein, et
al., (1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A
Du Pont Biolistic PDS1000/HE instrument (helium retrofit) can be
used for these transformations.
[0262] A selectable marker gene that can be used to facilitate
soybean transformation is a transgene composed of the .sup.35S
promoter from Cauliflower Mosaic Virus (Odell, et al., (1985)
Nature 313:810-812), the hygromycin phosphotransferase gene from
plasmid pJR225 (from E. coli; Gritz, et al., (1983) Gene
25:179-188) and the 3' region of the nopaline synthase gene from
the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. The
expression cassette comprising an antisense NR sequence operably
linked to the ubiquitin promoter can be isolated as a restriction
fragment. This fragment can then be inserted into a unique
restriction site of the vector carrying the marker gene.
[0263] To 50 .mu.l of a 60 mg/ml 1 .mu.m gold particle suspension
is added (in order): 5 .mu.l DNA (1 .mu.g/.mu.l), 20 .mu.l
spermidine (0.1 M) and 50 .mu.l CaCl.sub.2 (2.5 M). The particle
preparation is then agitated for three minutes, spun in a microfuge
for 10 seconds and the supernatant removed. The DNA-coated
particles are then washed once in 400 .mu.l 70% ethanol and
resuspended in 40 .mu.l of anhydrous ethanol. The DNA/particle
suspension can be sonicated three times for one second each. Five
microliters of the DNA-coated gold particles are then loaded on
each macro carrier disk.
[0264] Approximately 300-400 mg of a two-week-old suspension
culture is placed in an empty 60.times.15 mm petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue are
normally bombarded. Membrane rupture pressure is set at 1100 psi,
and the chamber is evacuated to a vacuum of 28 inches mercury. The
tissue is placed approximately 3.5 inches away from the retaining
screen and bombarded three times. Following bombardment, the tissue
can be divided in half and placed back into liquid and cultured as
described above.
[0265] Five to seven days post bombardment, the liquid media may be
exchanged with fresh media, and eleven to twelve days
post-bombardment with fresh media containing 50 mg/ml hygromycin.
This selective media can be refreshed weekly. Seven to eight weeks
post-bombardment, green, transformed tissue may be observed growing
from untransformed, necrotic embryogenic clusters. Isolated green
tissue is removed and inoculated into individual flasks to generate
new, clonally propagated, transformed embryogenic suspension
cultures. Each new line may be treated as an independent
transformation event. These suspensions can then be subcultured and
maintained as clusters of immature embryos or regenerated into
whole plants by maturation and germination of individual somatic
embryos.
Example 7
Sunflower Meristem Tissue Transformation
[0266] Sunflower meristem tissues are transformed with an
expression cassette containing an antisense NR sequences operably
linked to a ubiquitin promoter as follows (see also, European
Patent Number EP 0 486233, herein incorporated by reference and
Malone-Schoneberg, et al., (1994) Plant Science 103:199-207).
Mature sunflower seed (Helianthus annuus L.) are dehulled using a
single wheat-head thresher. Seeds are surface sterilized for 30
minutes in a 20% Clorox.RTM. bleach solution with the addition of
two drops of Tween.RTM. 20 per 50 ml of solution. The seeds are
rinsed twice with sterile distilled water.
[0267] Split embryonic axis explants are prepared by a modification
of procedures described by Schrammeijer, et al. (Schrammeijer, et
al., (1990) Plant Cell Rep. 9:55-60). Seeds are imbibed in
distilled water for 60 minutes following the surface sterilization
procedure. The cotyledons of each seed are then broken off,
producing a clean fracture at the plane of the embryonic axis.
Following excision of the root tip, the explants are bisected
longitudinally between the primordial leaves. The two halves are
placed, cut surface up, on GBA medium consisting of Murashige and
Skoog mineral elements (Murashige, et al., (1962) Physiol. Plant.,
15:473-497), Shepard's vitamin additions (Shepard, (1980) in
Emergent Techniques for the Genetic Improvement of Crops
(University of Minnesota Press, St. Paul, Minn.), 40 mg/l adenine
sulfate, 30 g/l sucrose, 0.5 mg/l 6-benzyl-aminopurine (BAP), 0.25
mg/l indole-3-acetic acid (IAA), 0.1 mg/l gibberellic acid
(GA.sub.3), pH 5.6, and 8 g/l Phytagar.
[0268] The explants are subjected to microprojectile bombardment
prior to Agrobacterium treatment (Bidney, et al., (1992) Plant Mol.
Biol. 18:301-313). Thirty to forty explants are placed in a circle
at the center of a 60.times.20 mm plate for this treatment.
Approximately 4.7 mg of 1.8 mm tungsten microprojectiles are
resuspended in 25 ml of sterile TE buffer (10 mM Tris HCl, 1 mM
EDTA, pH 8.0) and 1.5 ml aliquots are used per bombardment. Each
plate is bombarded twice through a 150 mm nytex screen placed 2 cm
above the samples in a PDS 1000.RTM. particle acceleration
device.
[0269] Disarmed Agrobacterium tumefaciens strain EHA105 is used in
all transformation experiments. A binary plasmid vector comprising
the expression cassette that contains the NR gene operably linked
to the ubiquitin promoter is introduced into Agrobacterium strain
EHA105 via freeze-thawing as described by Holsters, et al., (1978)
Mol. Gen. Genet. 163:181-187. This plasmid further comprises a
kanamycin selectable marker gene (i.e, nptII). Bacteria for plant
transformation experiments are grown overnight (28.degree. C. and
100 RPM continuous agitation) in liquid YEP medium (10 gm/l yeast
extract, 10 gm/l Bacto.RTM.peptone and 5 gm/l NaCl, pH 7.0) with
the appropriate antibiotics required for bacterial strain and
binary plasmid maintenance. The suspension is used when it reaches
an OD.sub.600 of about 0.4 to 0.8. The Agrobacterium cells are
pelleted and resuspended at a final OD.sub.600 of 0.5 in an
inoculation medium comprised of 12.5 mM MES pH 5.7, 1 gm/l
NH.sub.4Cl and 0.3 gm/l MgSO.sub.4.
[0270] Freshly bombarded explants are placed in an Agrobacterium
suspension, mixed and left undisturbed for 30 minutes. The explants
are then transferred to GBA medium and co-cultivated, cut surface
down, at 26.degree. C. and 18-hour days. After three days of
co-cultivation, the explants are transferred to 374B (GBA medium
lacking growth regulators and a reduced sucrose level of 1%)
supplemented with 250 mg/l cefotaxime and 50 mg/l kanamycin
sulfate. The explants are cultured for two to five weeks on
selection and then transferred to fresh 374B medium lacking
kanamycin for one to two weeks of contiNRd development. Explants
with differentiating, antibiotic-resistant areas of growth that
have not produced shoots suitable for excision are transferred to
GBA medium containing 250 mg/l cefotaxime for a second 3-day
phytohormone treatment. Leaf samples from green,
kanamycin-resistant shoots are assayed for the presence of NPTII by
ELISA and for the presence of transgene expression by assaying for
a modulation in meristem development (i.e., an alteration of size
and appearance of shoot and floral meristems).
[0271] NPTII-positive shoots are grafted to Pioneer.RTM. hybrid
6440 in vitro-grown sunflower seedling rootstock. Surface
sterilized seeds are germinated in 48-0 medium (half-strength
Murashige and Skoog salts, 0.5% sucrose, 0.3% Gelrite.RTM., pH 5.6)
and grown under conditions described for explant culture. The upper
portion of the seedling is removed, a 1 cm vertical slice is made
in the hypocotyl and the transformed shoot inserted into the cut.
The entire area is wrapped with Parafilm.RTM. to secure the shoot.
Grafted plants can be transferred to soil following one week of in
vitro culture. Grafts in soil are maintained under high humidity
conditions followed by a slow acclimatization to the greenhouse
environment. Transformed sectors of T.sub.0 plants (parental
generation) maturing in the greenhouse are identified by NPTII
ELISA and/or by NR activity analysis of leaf extracts while
transgenic seeds harvested from NPTII-positive T.sub.0 plants are
identified by NR activity analysis of small portions of dry seed
cotyledon.
[0272] An alternative sunflower transformation protocol allows the
recovery of transgenic progeny without the use of chemical
selection pressure. Seeds are dehulled and surface-sterilized for
20 minutes in a 20% Clorox.RTM. bleach solution with the addition
of two to three drops of Tween.RTM. 20 per 100 ml of solution, then
rinsed three times with distilled water. Sterilized seeds are
imbibed in the dark at 26.degree. C. for 20 hours on filter paper
moistened with water. The cotyledons and root radical are removed,
and the meristem explants are cultured on 374E (GBA medium
consisting of MS salts, Shepard vitamins, 40 mg/l adenine sulfate,
3% sucrose, 0.5 mg/l 6-BAP, 0.25 mg/l IAA, 0.1 mg/l GA, and 0.8%
Phytagar at pH 5.6) for 24 hours under the dark. The primary leaves
are removed to expose the apical meristem, around 40 explants are
placed with the apical dome facing upward in a 2 cm circle in the
center of 374M (GBA medium with 1.2% Phytagar) and then cultured on
the medium for 24 hours in the dark.
[0273] Approximately 18.8 mg of 1.8 .mu.m tungsten particles are
resuspended in 150 .mu.l absolute ethanol. After sonication, 8
.mu.l of it is dropped on the center of the surface of
macrocarrier. Each plate is bombarded twice with 650 psi rupture
discs in the first shelf at 26 mm of Hg helium gun vacuum.
[0274] The plasmid of interest is introduced into Agrobacterium
tumefaciens strain EHA105 via freeze thawing as described
previously. The pellet of overnight-grown bacteria at 28.degree. C.
in a liquid YEP medium (10 g/l yeast extract, 10 g/l
Bacto.RTM.peptone and 5 g/l NaCl, pH 7.0) in the presence of 50
.mu.g/l kanamycin is resuspended in an inoculation medium (12.5 mM
2-mM 2-(N-morpholino) ethanesulfonic acid, MES, 1 g/l NH.sub.4Cl
and 0.3 g/l MgSO.sub.4 at pH 5.7) to reach a final concentration of
4.0 at OD.sub.600. Particle-bombarded explants are transferred to
GBA medium (374E) and a droplet of bacteria suspension is placed
directly onto the top of the meristem. The explants are
co-cultivated on the medium for 4 days, after which the explants
are transferred to 374C medium (GBA with 1% sucrose and no BAP,
IAA, GA3 and supplemented with 250 .mu.g/ml cefotaxime). The
plantlets are cultured on the medium for about two weeks under
16-hour day and 26.degree. C. incubation conditions.
[0275] Explants (around 2 cm long) from two weeks of culture in
374C medium are screened for a modulation in meristem development
(i.e., an alteration of size and appearance of shoot and floral
meristems). After positive explants are identified, those shoots
that fail to exhibit modified NR activity are discarded, and every
positive explant is subdivided into nodal explants. One nodal
explant contains at least one potential node. The nodal segments
are cultured on GBA medium for three to four days to promote the
formation of auxiliary buds from each node. Then they are
transferred to 374C medium and allowed to develop for an additional
four weeks. Developing buds are separated and cultured for an
additional four weeks on 374C medium. Pooled leaf samples from each
newly recovered shoot are screened again by the appropriate protein
activity assay. At this time, the positive shoots recovered from a
single node will generally have been enriched in the transgenic
sector detected in the initial assay prior to nodal culture.
[0276] Recovered shoots positive for modified NR expression are
grafted to Pioneer hybrid 6440 in vitro-grown sunflower seedling
rootstock. The rootstocks are prepared in the following manner.
Seeds are dehulled and surface-sterilized for 20 minutes in a 20%
Clorox.RTM. bleach solution with the addition of two to three drops
of Tween.RTM. 20 per 100 ml of solution, and are rinsed three times
with distilled water. The sterilized seeds are germinated on the
filter moistened with water for three days, then they are
transferred into 48 medium (half-strength MS salt, 0.5% sucrose,
0.3% Gelrite.RTM. pH 5.0) and grown at 26.degree. C. under the dark
for three days, then incubated at 16-hour-day culture conditions.
The upper portion of selected seedling is removed, a vertical slice
is made in each hypocotyl and a transformed shoot is inserted into
a V-cut. The cut area is wrapped with Parafilm.RTM.. After one week
of culture on the medium, grafted plants are transferred to soil.
In the first two weeks, they are maintained under high humidity
conditions to acclimatize to a greenhouse environment.
Example 8
Rice Tissue Transformation
Genetic Confirmation of the NR Gene
[0277] One method for transforming DNA into cells of higher plants
that is available to those skilled in the art is high-velocity
ballistic bombardment using metal particles coated with the nucleic
acid constructs of interest (see, Klein, et al., Nature (1987)
(London) 327:70-73 and see, U.S. Pat. No. 4,945,050). A Biolistic
PDS-1000/He (BioRAD Laboratories, Hercules, Calif.) is used for
these complementation experiments. The particle bombardment
technique is used to transform the NR mutants and wild type rice
with DNA fragments
[0278] The bacterial hygromycin B phosphotransferase (Hpt II) gene
from Streptomyces hygroscopicus that confers resistance to the
antibiotic is used as the selectable marker for rice
transformation. In the vector, pML18, the Hpt II gene was
engineered with the .sup.35S promoter from Cauliflower Mosaic Virus
and the termination and polyadenylation signals from the octopine
synthase gene of Agrobacterium tumefaciens. pML18 was described in
WO 1997/47731, which was published on Dec. 18, 1997, the disclosure
of which is hereby incorporated by reference.
[0279] Embryogenic callus cultures derived from the scutellum of
germinating rice seeds serve as source material for transformation
experiments. This material is generated by germinating sterile rice
seeds on a callus initiation media (MS salts, Nitsch and Nitsch
vitamins, 1.0 mg/l 2,4-D and 10 .mu.M AgNO.sub.3) in the dark at
27-28.degree. C. Embryogenic callus proliferating from the
scutellum of the embryos is the transferred to CM media (N6 salts,
Nitsch and Nitsch vitamins, 1 mg/l 1 2,4-D, Chu, et al., (1985)
Sci. Sinica 18: 659-668). Callus cultures are maintained on CM by
routine sub-culture at two week intervals and used for
transformation within 10 weeks of initiation.
[0280] Callus is prepared for transformation by subculturing
0.5-1.0 mm pieces approximately 1 mm apart, arranged in a circular
area of about 4 cm in diameter, in the center of a circle of
Whatman.RTM. #541 paper placed on CM media. The plates with callus
are incubated in the dark at 27-28.degree. C. for 3-5 days. Prior
to bombardment, the filters with callus are transferred to CM
supplemented with 0.25 M mannitol and 0.25 M sorbitol for 3 hr in
the dark. The petri dish lids are then left ajar for 20-45 minutes
in a sterile hood to allow moisture on tissue to dissipate.
[0281] Each genomic DNA fragment is co-precipitated with pML18
containing the selectable marker for rice transformation onto the
surface of gold particles. To accomplish this, a total of 10 .mu.g
of DNA at a 2:1 ratio of trait:selectable marker DNAs are added to
50 .mu.l aliquot of gold particles that have been resuspended at a
concentration of 60 mg ml.sup.-1. Calcium chloride (50 .mu.l of a
2.5 M solution) and spermidine (20 .mu.l of a 0.1 M solution) are
then added to the gold-DNA suspension as the tube is vortexing for
3 min. The gold particles are centrifuged in a microfuge for 1 sec
and the supernatant removed. The gold particles are then washed
twice with 1 ml of absolute ethanol and then resuspended in 50
.mu.l of absolute ethanol and sonicated (bath sonicator) for one
second to disperse the gold particles. The gold suspension is
incubated at -70.degree. C. for five minutes and sonicated (bath
sonicator) if needed to disperse the particles. Six .mu.l of the
DNA-coated gold particles are then loaded onto mylar macrocarrier
disks and the ethanol is allowed to evaporate.
[0282] At the end of the drying period, a petri dish containing the
tissue is placed in the chamber of the PDS-1000/He. The air in the
chamber is then evacuated to a vacuum of 28-29 inches Hg. The
macrocarrier is accelerated with a helium shock wave using a
rupture membrane that bursts when the He pressure in the shock tube
reaches 1080-1100 psi. The tissue is placed approximately 8 cm from
the stopping screen and the callus is bombarded two times. Two to
four plates of tissue are bombarded in this way with the DNA-coated
gold particles. Following bombardment, the callus tissue is
transferred to CM media without supplemental sorbitol or
mannitol.
[0283] Within 3-5 days after bombardment the callus tissue is
transferred to SM media (CM medium containing 50 mg/l hygromycin).
To accomplish this, callus tissue is transferred from plates to
sterile 50 ml conical tubes and weighed. Molten top-agar at
40.degree. C. is added using 2.5 ml of top agar/100 mg of callus.
Callus clumps are broken into fragments of less than 2 mm diameter
by repeated dispensing through a 10 ml pipet. Three ml aliquots of
the callus suspension are plated onto fresh SM media and the plates
are incubated in the dark for 4 weeks at 27-28.degree. C. After 4
weeks, transgenic callus events are identified, transferred to
fresh SM plates and grown for an additional 2 weeks in the dark at
27-28.degree. C.
[0284] Growing callus is transferred to RM1 media (MS salts, Nitsch
and Nitsch vitamins, 2% sucrose, 3% sorbitol, 0.4% Gelrite.RTM.+50
ppm hyg B) for 2 weeks in the dark at 25.degree. C. After 2 weeks
the callus is transferred to RM2 media (MS salts, Nitsch and Nitsch
vitamins, 3% sucrose, 0.4% Gelrite.RTM.+50 ppm hyg B) and placed
under cool white light (.about.40 .mu.Em.sup.-2 s.sup.-1) with a 12
hr photoperiod at 25.degree. C. and 30-40% humidity. After 2-4
weeks in the light, callus begin to organize and form shoots.
Shoots are removed from surrounding callus/media and gently
transferred to RM3 media (1/2.times.MS salts, Nitsch and Nitsch
vitamins, 1% sucrose+50 ppm hygromycin B) in Phytatrays.TM. (Sigma
Chemical Co., St. Louis, Mo.) and incubation is contiNRd using the
same conditions as described in the previous step.
[0285] Plants are transferred from RM3 to 4'' pots containing Metro
Mix.RTM. 350 after 2-3 weeks, when sufficient root and shoot growth
have occurred. The seed obtained from the transgenic plants is
examined for genetic complementation of the NR mutation with the
wild-type genomic DNA containing the NR gene.
Example 9
Variants of NR Sequences
[0286] A. Variant Nucleotide Sequences of NR that do not Alter the
Encoded Amino Acid Sequence
[0287] The NR nucleotide sequences are used to generate variant
nucleotide sequences having the nucleotide sequence of the open
reading frame with about 70%, 75%, 80%, 85%, 90% and 95% nucleotide
sequence identity when compared to the starting unaltered ORF
nucleotide sequence of the corresponding SEQ ID NO. These
functional variants are generated using a standard codon table.
While the nucleotide sequences of the variants are altered, the
amino acid sequences encoded by the open reading frames do not
change.
[0288] B. Variant Amino Acid Sequences of NR Polypeptides
[0289] Variant amino acid sequences of the NR polypeptides are
generated. In this example, one amino acid is altered.
Specifically, the open reading frames are reviewed to determine the
appropriate amino acid alteration. The selection of the amino acid
to change is made by consulting the protein alignment (with the
other orthologs and other gene family members from various
species). An amino acid is selected that is deemed not to be under
high selection pressure (not highly conserved) and which is rather
easily substituted by an amino acid with similar chemical
characteristics (i.e., similar functional side-chain). Using the
protein alignment, an appropriate amino acid can be changed. Once
the targeted amino acid is identified, the procedure outlined in
the following section C is followed. Variants having about 70%,
75%, 80%, 85%, 90% and 95% nucleic acid sequence identity are
generated using this method.
[0290] C. Additional Variant Amino Acid Sequences of NR
Polypeptides
[0291] In this example, artificial protein sequences are created
having 80%, 85%, 90% and 95% identity relative to the reference
protein sequence. This latter effort requires identifying conserved
and variable regions from the alignment and then the judicious
application of an amino acid substitutions table. These parts will
be discussed in more detail below.
[0292] Largely, the determination of which amino acid sequences are
altered is made based on the conserved regions among NR protein or
among the other NR polypeptides. Based on the sequence alignment,
the various regions of the NR polypeptide that can likely be
altered are represented in lower case letters, while the conserved
regions are represented by capital letters. It is recognized that
conservative substitutions can be made in the conserved regions
below without altering function. In addition, one of skill will
understand that functional variants of the NR sequence of the
invention can have minor non-conserved amino acid alterations in
the conserved domain.
[0293] Artificial protein sequences are then created that are
different from the original in the intervals of 80-85%, 85-90%,
90-95% and 95-100% identity. Midpoints of these intervals are
targeted, with liberal latitude of plus or minus 1%, for example.
The amino acids substitutions will be effected by a custom Perl
script. The substitution table is provided below in Table 2.
TABLE-US-00002 TABLE 2 Substitution Table Rank of Amino Strongly
Similar and Order to Acid Optimal Substitution Change Comment I L,
V 1 50:50 substitution L I, V 2 50:50 substitution V I, L 3 50:50
substitution A G 4 G A 5 D E 6 E D 7 W Y 8 Y W 9 S T 10 T S 11 K R
12 R K 13 N Q 14 Q N 15 F Y 16 M L 17 First methionine cannot
change H Na No good substitutes C Na No good substitutes P Na No
good substitutes
[0294] First, any conserved amino acids in the protein that should
not be changed is identified and "marked off" for insulation from
the substitution. The start methionine will of course be added to
this list automatically. Next, the changes are made.
[0295] H, C and P are not changed in any circumstance. The changes
will occur with isoleucine first, sweeping N-terminal to
C-terminal. Then leucine, and so on down the list until the desired
target it reached. Interim number substitutions can be made so as
not to cause reversal of changes. The list is ordered 1-17, so
start with as many isoleucine changes as needed before leucine, and
so on down to methionine. Clearly many amino acids will in this
manner not need to be changed. L, I and V will involve a 50:50
substitution of the two alternate optimal substitutions.
[0296] The variant amino acid sequences are written as output. Perl
script is used to calculate the percent identities. Using this
procedure, variants of the NR polypeptides are generating having
about 80%, 85%, 90% and 95% amino acid identity to the starting ORF
nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5 or 6.
Example 10
Transgenic Maize Plants
[0297] T.sub.0 transgenic maize plants containing the NR construct
under the control of a promoter were generated. To improve nitrate
assimilation, PPNR and PYNR driven by constitutive promoter
(ZM-UBI) and tissue-specific promoter (ZM-NR) (4 constructs) were
transformed in transgenic maize plants via Agrobacteria.
[0298] These plants were grown in greenhouse conditions, under the
FASTCORN system, as detailed in US Patent Application Publication
Number 2003/0221212, U.S. patent application Ser. No.
10/367,417.
[0299] Each of the plants was analyzed for measurable alteration in
one or more of the following characteristics in the following
manner:
[0300] T.sub.1 progeny derived from cross fertilization each
T.sub.0 plant containing a single copy of each NR construct that
were found to segregate 1:1 for the transgenic event were analyzed
for improved growth rate in low (1 mM) KNO.sub.3. Growth was
monitored up to anthesis when cumulative plant growth, growth rate
and ear weight were determined for transgene positive, transgene
null and non-transformed controls events. The distribution of the
phenotype of individual plants was compared to the distribution of
a control set and to the distribution of all the remaining
treatments. Transgenic means were compared to the grand mean, the
block mean in which the transgene resides and the corresponding
transgenic null mean and tested for statistical significance using
a Students' t-test. Variances for each set were calculated and used
as the denominator of the Student's t-test after adjustment for the
number of observations in each mean compared ie: Student's t
test=(transgene mean-transgenic null mean)/Sqr(variance*(1/number
of observations of transgene mean+1/number of observations of
transgene null mean)). The probability of obtaining the calculated
Student's t-test at random was calculated based on the magnitude of
the Student's t-test and the number of degrees of freedom
associated with the variance. A probability of 0.1(1 chance in 10
of obtaining the result at random) or lower was used to indicate a
significant response to KNO.sub.3 fertility.
Example 11
Transgenic Event Analysis from Field Plots
[0301] Transgenic events are evaluated in field plots where yield
is limited by reducing fertilizer application by 30% or more.
Transgenic maize will be grown hydroponically. Improvements in
yield, yield components or other agronomic traits between
transgenic and non-transgenic plants in these reduced nitrogen
fertility plots are used to assess improvements in nitrogen
utilization contributed by expression of transgenic events.
[0302] The rate of nitrate removal from hydroponics medium, the
nitrate and total nitrogen level in the plant may be determined
using routine techniques. Nitrate levels in the growth medium will
be monitored and compared to the nitrate levels in the growth
medium of transgenic nulls.
[0303] The rate of nitrate loss from the medium is an indication of
nitrate utilization efficiency. Plant samples will be dried, ground
and nitrate extracted and quantified. Total N will be determined in
the tissue by micro-Kjeldahl. (Yasuhura and Nokihara, (2001) J
Agric Food Chem 49:4581-4583). Comparisons are made in plots
supplemented with recommended nitrogen fertility rates. Effective
transgenic events are those that achieve similar yields in the
nitrogen-limited and normal nitrogen experiments.
Example 12
Maize Backcross Analysis
[0304] Segregating T.sub.4 backcrosses to Gaspe-3 were grown in
nutrient solutions containing 1 or 2 mM KNO.sub.3 as the sole
nitrogen source till anthesis. Leaf color (SPAD), stem diameter,
vegetative and ear dry weight were determined and compared to the
corresponding segregating null plants. There were 9 replicates of
all treatments. Results for the plants containing the PpNR
transgene showed statistically significant (at 0.001 level)
improvement in ear dry weight (at both 1 and 2 mM KNO.sub.3
concentrations) in comparison to non-transgenic control plants. At
2 mM KNO.sub.3, there were also statistically significant
improvements noted in SPAD, ear dry weight and total dry weight, as
compared to non-transgenic control plants. This demonstrates the
gene is stable after 5 cycles of backcrossing.
[0305] All publications and patent applications in this
specification are indicative of the level of ordinary skill in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated by reference.
[0306] The invention has been described with reference to various
specific and preferred embodiments and techniques. However, it
should be understood that many variations and modifications may be
made while remaining within the spirit and scope of the invention.
Sequence CWU 1
1
3412865DNAPorphyra perforata 1atggaggctg cttctggtgc cctcagtgag
ctccggttgg agaagggggt taagggctgg 60gacccggtca aggtgcccgg ccggagctcc
ctcaagagca cgcctatcgc caccccagag 120ggctccctcc gcggtggctc
cctctacacg gcccggtcgc agcacgcggc tggcgccaac 180gacgtcatgg
cggccaatgg ggtgtcggcg tcgagcaccg cgtcggggtt gagctttgct
240ccttcggacg gcagtggcag tggcagtggc cgcgtcgggt ggacggagct
gaacgatgct 300ctgaacgcca agctcgcgtc caagtcgacg atgttggaca
agcagcacgt tgcggacgag 360gtggatgacc gggacgtcaa gacgccagac
aactggatcc cccgccaccc ggccttgatc 420cgtctgacgg gcaagcaccc
gttcaactgt gaggcgccgc tgtcgatgct ggtggatcag 480ggttttatca
cccccccatc tctgcacttt gtgcgcaacc acggggctgc accgcagctg
540tcttttgacg accaccggct ggaggtgacc ggcctcgtcg acactccttt
gacgttgtcc 600atggctgaca tcttggccat gccgagcgtc accatcccgg
tcacgctgac gtgcgcggga 660aaccggcgga aggagcagaa catgacaaag
cagacgattg gcttctcgtg gggcgccgcc 720gccaccagct gcaacttttg
gactggcgtg cgcgtacggg atgtgcttca aaaggcgggc 780atccagatgg
acaaggcgcg ccatgtttgc tttgtgggct gtgacaacct gccggggggc
840aagtacggca cgtcggttga cctggcgacg gccatggacc agttcgggga
ggtgatgctt 900gcgtacgagc agaacggcat ccgcctcacg cccgaccacg
gcgcgcccct gcgggtggta 960attcctgggt ggattggcgg ccgcatggtg
aagtgggtga ccggcctgtc ggtaacgtcg 1020gaagagtcgc aggagcacta
tcactttttt gataaccgca tcctgccacc acacgtggac 1080gcggagctgg
ccaagtctga gggctggtgg tacaagcgcg agtacctgtt caaccagctc
1140aatatcaact ctgccatcag ctctcctgcc aatggcgaac tgatgtccct
gtcgggcgcg 1200ggggtgtaca ccctcaaggg ttacgcctac tctggcggcg
gccgcaaggt cacccgtgtg 1260gaggtgtcgg tggacggcgg caagacttgg
ctgctggcca cgttggacca ccccgaggag 1320cggcactcgc acgctccgtc
gtatggtcgc tattactgct ggtgcttctg ggagtacacc 1380attgataagt
ttgcgctgct caacgcggcg actagttcgg gcgagttgct ggtgcgtgcg
1440tgggatgagg gcaacaatac ccagcccgcc aagctgacct ggaacttgat
gggtatgggc 1500aacaactgct acttccgcgt gacggtggcg cccaagcagt
cgtcgggtga atttgcgctc 1560gagtttctcc acccgacggt ggcgggcccc
gcggagggtg gctggatgcc gccaccgcag 1620gagtcggtag ttgcggctgc
cgccgcggcg gcagtagcag agacactgaa gcggaccaaa 1680tcggcgccgc
agatgaacaa gatggaccag caggactcca agacgattac catggaggag
1740gtggccaagc acgacacgga agaggactcg tggattgtgg tgcacaacaa
ggtgtatgac 1800tgtacgcctt tccttaagga ccaccccggt ggtggcgcca
gcattgtgat gaacgcgggt 1860gcggactgca cggaggagtt tgatgcgatc
cactcaacca aggccaagtc catgctggac 1920gactactata ttggcgaact
ggccgttgag gacattgagg acgagccgga gcaaccagcc 1980ctgcacctgt
ccaagtcgtc ggtgcagctg atgaaggatg acttcaaaga gcagagcgtg
2040cgtaaggctg tggagggtgt ggacgaggag gtcgtgacgc cggtggcact
taaccccaag 2100aagtggattc actttccgct catccagaag gaggagttga
gccatgacac gcggcgcttc 2160cgctttgggc tccccactcc tggccaccgg
ttgggcctgc ctgtgggctt ccacatgttc 2220ttgatggcca ccattgacgg
tgcaatggtc atgcgggcat acacaccgac gtcgtcggac 2280gcagagctgg
gctacttcga cctggtcatc aaggtgtact ttgcaaacgt gcaccccagg
2340ttccctgacg gtggtaagct cacccagtac atggaggaga tgtcgctggg
cgacgagatt 2400cgcgtcaagg gcccgcttgg ccacattgag taccgtagcc
gcggcgagat gaccattgac 2460ggcaagccgc ggacggtaag tgccctgacg
ggcctgatgg cgggcagtgg catcacgccc 2520ttttaccaga ttctccaggc
tgtcatggcc gacccggagg acaagaccga gctgtacctc 2580atctatgcca
accagacacc ggaggatgtg ctgctgcggt cagagctgga caagatggcg
2640gcagagcgcg acaacatcca tgtctggtac acatgcgacc gcgcgccgga
ggactggaag 2700tatgacattg gcttcatgac ggtagacatg atcaaggagc
atggggcgcc ggcaggcccc 2760gatgtgttgg gcctgtcgtg cggaccgccg
ccatttatca agtttgcggc gaccccgagc 2820ttgaccaaga acggctatgc
ggaggagaac cagttcttgt tttag 286522865DNAPorphyra perforata
2atggaagctg ccagcggcgc tctttcggaa ctgcgcttgg agaagggtgt taagggctgg
60gacccggtta aggttcctgg caggtcaagc ttgaagagca cgcccatcgc tactcccgag
120ggctcactcc gcggtggctc tctgtacaca gcgaggtcac aacatgctgc
gggcgctaat 180gacgttatgg ctgccaatgg tgtctctgcg tcttctacgg
ccagcgggct gtctttcgct 240ccttccgatg gttccggtag cggtagcggt
cgcgtgggtt ggaccgaact caatgatgcg 300ctcaacgcta agctggcctc
caagtccacc atgctcgata agcagcacgt ggcggacgag 360gttgatgacc
gggacgtgaa gactccggac aactggattc cgcgccatcc tgccctcatc
420cgcctgaccg ggaagcatcc tttcaactgc gaggctccgc tgtccatgct
ggtggatcaa 480gggttcatca cgccgccgag cctccacttc gttaggaatc
acggcgctgc tccgcagttg 540tccttcgacg accaccgctt ggaggtgact
ggccttgtgg acactccgct gactttgagc 600atggccgata tccttgcgat
gccgagcgtc actattcccg tgactcttac ctgcgctggc 660aaccggcgga
aggagcagaa catgaccaag cagacgatcg gcttctcgtg gggtgccgct
720gcgacctctt gcaacttctg gactggcgtg agggtgcggg atgttcttca
gaaggctggc 780atccagatgg ataaggcccg ccacgtctgc ttcgttggct
gtgacaatct cccgggtggc 840aagtatggga cgtcggtgga cctggctacc
gctatggacc agttcggcga ggtgatgctg 900gcgtacgagc agaatggcat
tcgcctcacg ccagaccacg gtgcccctct tcgcgttgtt 960atccctgggt
ggattggcgg caggatggtt aagtgggtca caggcctcag cgtcactagc
1020gaggagtccc aggagcacta ccacttcttc gacaaccgca tcttgccgcc
tcacgtcgat 1080gctgaacttg ccaagtccga aggctggtgg tacaagcgcg
agtacctctt caaccagctc 1140aacatcaaca gcgccatctc gagccctgcg
aacggcgagc tcatgtcact ctcaggcgct 1200ggcgtgtaca cccttaaggg
ctacgcgtac tcaggtggcg ggaggaaggt tacgagggtt 1260gaggtcagcg
ttgacggcgg taagacttgg cttctggcca ccctcgatca tccggaagag
1320aggcactctc atgctccttc ctatggccgc tactactgct ggtgcttctg
ggagtacacc 1380attgacaagt tcgccctcct caacgcggcc acgtcctctg
gcgaactctt ggttcgcgct 1440tgggacgaag ggaacaatac ccaacccgcg
aagctcacct ggaacctgat gggcatgggc 1500aacaactgct acttccgggt
cacggtggcc ccgaagcagt cttccggcga gtttgcgctt 1560gagtttcttc
atcccaccgt tgctggccct gcagaaggcg ggtggatgcc tcctcctcaa
1620gagtctgtgg ttgctgccgc tgctgctgcg gctgtggctg aaaccctgaa
gcgcactaag 1680gccgcgccgc agatgaacaa gatggaccag caggactcca
agacgatcac gatggaggag 1740gtcgctaagc atgacaccga ggaggactcc
tggatcgtgg tgcacaacaa ggtctacgac 1800tgcactccgt ttctcaagga
ccaccctggc ggcggtgcca gcatcgtcat gaatgctggt 1860gccgactgca
cggaggaatt cgacgctatc cacagcacga aggccaagtc gatgctcgac
1920gactactaca tcggcgagct ggccgttgag gacatagagg atgagcctga
gcagccggct 1980ctccacctct ccaagtcctc tgtgcagctc atgaaggacg
acttcaagga gcagtccgtg 2040cgcaaggctg ttgaaggcgt ggacgaagag
gtcgtgactc ctgtggccct gaaccctaag 2100aagtggattc acttcccgct
catccagaag gaggaactgt cccacgatac gaggcgcttc 2160cggtttggcc
tccctacacc tggtcatcgc cttgggctcc cggtgggctt ccatatgttc
2220ctgatggcga ccatagacgg tgctatggtg atgagggcct acacgccgac
ctcctctgat 2280gcggagctgg gctacttcga tctcgtgatc aaggtctact
tcgccaatgt ccacccgcgc 2340ttcccggacg gcggtaagtt gacgcagtac
atggaggaga tgtcgctggg cgacgagatc 2400agggttaagg gtccgcttgg
ccacatcgag taccgctccc gcggcgagat gaccattgat 2460ggcaagccaa
ggaccgtctc tgctctcact ggtctcatgg ccgggtcagg catcactccc
2520ttctaccaga tcctccaagc cgtcatggct gacccagagg acaagaccga
gctctacctg 2580atctacgcca atcagacgcc cgaggacgtg ctcctgaggt
cagagctgga caagatggcc 2640gccgagcgcg ataacatcca cgtgtggtac
acttgtgaca gggcgcctga ggactggaag 2700tacgacatcg gcttcatgac
ggtggacatg atcaaggagc atggtgctcc ggctggccca 2760gatgttcttg
gcctgtcttg cggtccacca cccttcatca agttcgccgc cactccaagc
2820ctcaccaaga acggctacgc ggaggagaac cagttcctgt tctag
286532865DNAPorphyra perforata 3atggaagctg ccagcggcgc tctttcggaa
ctgcgcttgg agaagggtgt taagggctgg 60gacccggtta aggttcctgg caggtcaagc
ttgaagagca cgcccatcgc tactcccgag 120ggctcactcc gcggtggctc
tctgtacaca gcgaggtcac aacatgctgc gggcgctaat 180gacgttatgg
ctgccaatgg tgtctctgcg tcttctacgg ccagcgggct gtctttcgct
240ccttccgatg gttccggtag cggtagcggt cgcgtgggtt ggaccgaact
caatgatgcg 300ctcaacgcta agctggcctc caagtccacc atgctcgata
agcagcacgt ggcggacgag 360gttgatgacc gggacgtgaa gactccggac
aactggattc cgcgccatcc tgccctcatc 420cgcctgaccg ggaagcatcc
tttcaactgc gaggctccgc tgtccatgct ggtggatcaa 480gggttcatca
cgccgccgag cctccacttc gttaggaatc acggcgctgc tccgcagttg
540tccttcgacg accaccgctt ggaggtgact ggccttgtgg acactccgct
gactttgagc 600atggccgata tccttgcgat gccgagcgtc actattcccg
tgactcttac ctgcgctggc 660aaccggcgga aggagcagaa catgaccaag
cagacgatcg gcttctcgtg gggtgccgct 720gcgacctctt gcaacttctg
gactggcgtg agggtgcggg atgttcttca gaaggctggc 780atccagatgg
ataaggcccg ccacgtctgc ttcgttggct gtgacaatct cccgggtggc
840aagtatggga cgtcggtgga cctggctacc gctatggacc agttcggcga
ggtgatgctg 900gcgtacgagc agaatggcat tcgcctcacg ccagaccacg
gtgcccctct tcgcgttgtt 960atccctgggt ggattggcgg caggatggtt
aagtgggtca caggcctcag cgtcactagc 1020gaggagtccc aggagcacta
ccacttcttc gacaaccgca tcttgccgcc tcacgtcgat 1080gctgaacttg
ccaagtccga aggctggtgg tacaagcgcg agtacctctt caaccagctc
1140aacatcaaca gcgccatctc gagccctgcg aacggcgagc tcatgtcact
ctcaggcgct 1200ggcgtgtaca cccttaaggg ctacgcgtac tcaggtggcg
ggaggaaggt tacgagggtt 1260gaggtcagcg ttgacggcgg taagacttgg
cttctggcca ccctcgatca tccggaagag 1320aggcactctc atgctccttc
ctatggccgc tactactgct ggtgcttctg ggagtacacc 1380attgacaagt
tcgccctcct caacgcggcc acgtcctctg gcgaactctt ggttcgcgct
1440tgggacgaag ggaacaatac ccaacccgcg aagctcacct ggaacctgat
gggcatgggc 1500aacaactgct acttccgggt cacggtggcc ccgaagcagt
cttccggcga gtttgcgctt 1560gagtttcttc atcccaccgt tgctggccct
gcagaaggcg ggtggatgcc tcctcctcaa 1620gagtctgtgg ttgctgccgc
tgctgctgcg gctgtggctg aaaccctgaa gcgcactaag 1680gacgcgccgc
agatgaacaa gatggaccag caggactcca agacgatcac gatggaggag
1740gtcgctaagc atgacaccga ggaggactcc tggatcgtgg tgcacaacaa
ggtctacgac 1800tgcactccgt ttctcaagga ccaccctggc ggcggtgcca
gcatcgtcat gaatgctggt 1860gccgactgca cggaggaatt cgacgctatc
cacagcacga aggccaagtc gatgctcgac 1920gactactaca tcggcgagct
ggccgttgag gacatagagg atgagcctga gcagccggct 1980ctccacctct
ccaagtcctc tgtgcagctc atgaaggacg acttcaagga gcagtccgtg
2040cgcaaggctg ttgaaggcgt ggacgaagag gtcgtgactc ctgtggccct
gaaccctaag 2100aagtggattc acttcccgct catccagaag gaggaactgt
cccacgatac gaggcgcttc 2160cggtttggcc tccctacacc tggtcatcgc
cttgggctcc cggtgggctt ccatatgttc 2220ctgatggcga ccatagacgg
tgctatggtg atgagggcct acacgccgac ctcctctgat 2280gcggagctgg
gctacttcga tctcgtgatc aaggtctact tcgccaatgt ccacccgcgc
2340ttcccggacg gcggtaagtt gacgcagtac atggaggaga tgtcgctggg
cgacgagatc 2400agggttaagg gtccgcttgg ccacatcgag taccgctccc
gcggcgagat gaccattgat 2460ggcaagccaa ggaccgtctc tgctctcact
ggtctcatgg ccgggtcagg catcactccc 2520ttctaccaga tcctccaagc
cgtcatggct gacccagagg acaagaccga gctctacctg 2580atctacgcca
atcagacgcc cgaggacgtg ctcctgaggt cagagctgga caagatggcc
2640gccgagcgcg ataacatcca cgtgtggtac acttgtgaca gggcgcctga
ggactggaag 2700tacgacatcg gcttcatgac ggtggacatg atcaaggagc
atggtgctcc ggctggccca 2760gatgttcttg gcctgtcttg cggtccacca
cccttcatca agttcgccgc cactccaagc 2820ctcaccaaga acggctacgc
ggaggagaac cagttcctgt tctag 286542871DNAPorphyra yezoensis
4atggaggccg cctcgggcgc cctcagcgag ctccggctgg agaagggggt caagggctgg
60gaccccgtca aggtgcccag ccggagctcc ctcaagagca ccccaattgc cacccccgag
120ggctccctcc gcggcggctc tctgtatacg acccgcgcgg cagacggcgg
ggcggcgggc 180gccaacggcg gcatggcggc caatggggtg tccacgtcgt
ccacttcgtc gggactgagc 240tttgccccgt cgggcggcag cggcagcggc
agcggccgcg ttgggtggac ggagctgaac 300aacgcgctca acgccaagct
cctgtccaag tcgacgatgc tggacaagca gcacgttgcg 360gaggaggtgg
acgaccggga cgtgaagacg ccagacaact ggatcccccg ccacccggat
420ttggtccggc tgacgggcaa gcacccgttc aactgtgagg cgccgctgtc
catgctagta 480gaccagggct tcatcacccc cccgtcgctg cactttgtac
gcaaccatgg ggcggcgccg 540cagttgtcgt ttgacgacca ccggctggag
gtgagcggcc tcgtcgacac ccccctgact 600ctttccatgg aagacatttt
ggccatgcca agcgtcacca tcccagtgac gctgacgtgc 660gcaggcaacc
ggcggaagga gcagaatatg acaaagcaga ccattggttt ctcgtggggc
720gccgcggcta ctagctgcaa cttttggacg ggcgtgcgcc tgcgggatgt
gctcgagaag 780gcgggcatcc agatggacaa ggcccgtcat gtgtgctttg
tgggctgtga cgacctgcct 840ggtggcaagt acggcacatc gattgacctg
gcgacggcca tggatcagtt tggggaggtg 900atgctcgcgt acgagcagaa
tggcatccgc ctgacgcccg accatggcgc gcccctgcgg 960gtggtgattc
cagggtggat tggcggccgg atggtcaagt ggctgacggg cgtgtcggtg
1020acagctgagg agtcacagga gcactaccac ttctttgaca accgtatcat
gccgcctcac 1080gttgacgcgg agctggccaa gtcggagggc tggtggtaca
agcgggagta cctgttcaac 1140cagctgaaca ttaactctgc catcagctcc
cctgccaatg gggagctgat gtccctgtcg 1200ggcgcggggg tgtacaccct
gaagggctac gcctactctg gcggtggccg taaggtgacc 1260cgcgtggagg
tgtcggtgga cggcggtaag acgtggttgc tggccacctt ggaccaccct
1320gaggagcgtc actctcacgc tccctcgtat ggccgctatt actgctggtg
cttctgggag 1380tacaccattg acaagtttgc cctgctaaac gcggcaacca
gctcgggcga gctgctagtg 1440cgcgcatggg acgagggcaa caacacccag
cccgccaagc tgacctggaa cctgatgggc 1500atgggcaaca actgctactt
ccgtgtgacg gtggcaccta agcagtcgtc gggtgaattc 1560gtgcttgaat
ttctgcaccc gacggtgccc ggccccgcgg agggtggctg gatgccccca
1620ccacaggagt cggtggtggc ggccgccgct gcggcagtgg tggcggagac
gcttaagcgg 1680gcgaagtcgg cgccgcagat caacaagatg gaccaggagg
acaccaagac ttacaccatg 1740gaggaggtgg ccaagcacga cacggaggag
gactcttgga ttgtggtgca caacaaggtg 1800tatgattgca cacccttcct
caaggaccac cctggtggcg gcgccagtat tgtgatgaac 1860gcgggtgccg
actgcacaga ggagttcgac gcgattcact caaccaaggc caagggcatg
1920ctggacgact attacattgg tgagctggcc atcgaggaca ttgaggacga
gccggagcag 1980ccagctctgc acatgtccaa atcgtctgtg cagctgatga
aggatgactt caaggagcag 2040agcgtccgca aggccgtgga cgatgaggaa
gcagcacccg tggcgcctgt ggctctcaac 2100cccaagaagt gggttcactt
cccgctcatc cagaaggagg agctgagcca cgacacccgg 2160cgcttccgct
ttgggctccc tacagagggt caccggctgg gcttgcccgt cggcttccac
2220atgttcctgg ccgctaccat cgaaggctcc atggtcatgc gggcctacac
gccaacgtcg 2280tcggacgcac agctggggta ctttgacctg gtcatcaagg
tgtactttgc caacgtgcac 2340cccaagttcc ctggcggtgg caagctcacc
cagtacatgg aggagatgtc tcttggcgac 2400gagattcgcg tgaaggaccc
gctcggccac attgagtacc gcggccgcgg tgagatgacg 2460attgacggca
agccgcgcac ggtcagcgcc ctgacaggcc tgatggcggg gagcggcatc
2520accccctttt accagatcct gcaggctgtc atggcggacc cagaggataa
gaccgagctg 2580tacctcatct atgccaacca gacaccggag gacgtgctgc
tgcggtcaga gctggataag 2640atggcagcgg agcgcgacaa catccacgtt
tggtacacgt gcgaccgcgc accagaggac 2700tggcagtttg acattggctt
catgaccgag aagatgatca aggagcatgg ggcgccggcg 2760ggccccgacg
tgctgggcct gtcgtgcgga ccaccgccat ttatcaagtt tgcggcgacc
2820ccaagcctga ccaagaatgg ctacgcggag gaggaccagt tcctgttcta a
287152871DNAPorphyra yezoensis 5atggaggccg cttctggcgc tctcagcgag
ctccgcctcg agaagggtgt gaagggctgg 60gaccctgtga aggtgccgag ccgcagcagc
ctcaagagca ctccgatcgc cacaccggag 120ggtagcctca gaggcggcag
cctctatacc actcgcgctg ccgacggtgg tgccgctggc 180gctaatggcg
gtatggctgc caacggcgtg agcaccagca gcactagcag cggcttgagc
240ttcgccccta gcggcggttc tggtagcggt agcggtagag tgggctggac
cgagctcaac 300aacgccctca acgccaagct cctcagcaag agcaccatgc
tcgacaagca gcacgtggcc 360gaggaggtgg acgaccgcga cgttaagacc
ccggacaact ggattcctcg gcatccggac 420cttgtgcgcc tcacaggcaa
gcacccgttc aactgcgagg ctccgctcag catgctcgtg 480gaccagggct
tcatcacacc gccgagcctc catttcgttc gcaaccacgg cgccgctcct
540cagctcagct tcgacgacca ccggctcgag gtgagcggtc tcgtggacac
tccgctcacc 600ctcagcatgg aggacatcct cgccatgccg agcgtgacca
ttcccgtgac cctcacttgc 660gccggcaacc gccgcaagga gcagaacatg
accaagcaga ccatcggctt cagctggggc 720gctgccgcta ccagctgcaa
cttctggaca ggtgtgcgct tgcgcgacgt tctcgagaag 780gctggcattc
agatggacaa ggcccgccac gtgtgcttcg tgggctgcga cgaccttccg
840ggcggcaagt acggcaccag catcgacctc gccactgcta tggaccagtt
cggcgaggtg 900atgctcgcct acgagcagaa cggcatccgc cttactcctg
atcacggcgc tccgcttcgc 960gtggttatcc ctggttggat tggcggccgc
atggtgaagt ggctcaccgg cgtgagcgtg 1020accgccgagg agagccagga
gcactaccac ttcttcgaca accggatcat gccgccgcac 1080gtggatgccg
agctcgccaa gtctgagggc tggtggtaca agcgcgagta cctcttcaac
1140cagctcaaca tcaacagcgc catcagcagc ccggccaatg gcgagctcat
gagcctcagc 1200ggtgccggcg tgtacaccct caagggctat gcttacagcg
gtggcggcag aaaggtgacg 1260cgcgttgagg tgagcgtgga cggcggtaag
acttggctcc tcgctaccct cgatcacccg 1320gaggagcgcc acagccacgc
tccaagctac ggccgctact actgctggtg cttctgggag 1380tacaccatcg
acaagttcgc cctcctcaac gccgccacat ctagcggcga gctcctcgtt
1440cgggcctggg atgagggtaa caacacccag ccggccaagc tcacctggaa
cttgatgggc 1500atgggcaaca actgctactt ccgcgtgacc gtggctccaa
agcagagcag cggcgagttc 1560gtgcttgagt tcctccaccc gactgtgccg
ggtcctgcag agggtggttg gatgcctccg 1620ccgcaggaga gcgttgtggc
cgctgctgct gccgctgttg tggccgagac cttgaagcgg 1680gccaaggccg
ccccgcagat caacaagatg gaccaggagg acaccaagac ctacactatg
1740gaggaggtgg ctaagcacga caccgaggag gacagctgga tcgtggtgca
caacaaggtg 1800tacgactgca ccccgttcct caaggaccac ccgggtggcg
gcgcctctat tgtgatgaac 1860gccggcgctg actgcactga ggagttcgac
gccatccaca gcaccaaggc caagggcatg 1920ctcgacgact actacatcgg
cgagctcgcc atcgaggaca tcgaggacga gccggagcag 1980ccggccctcc
acatgtctaa gagcagcgtg cagctcatga aggacgactt caaggagcag
2040agcgtgcgca aggccgtgga cgatgaggag gctgccccag tggctccggt
ggccttgaat 2100ccgaagaagt gggtgcactt cccgctcatc cagaaggagg
agctcagcca cgacacacgc 2160cgctttcggt ttggtctccc aaccgagggc
caccgccttg gcctcccggt tggctttcat 2220atgttcctcg ccgccaccat
cgagggcagc atggtgatgc gcgcctacac accgaccagc 2280agcgatgccc
agctcggcta cttcgacctc gtgatcaagg tgtacttcgc caacgtgcac
2340cctaagttcc ctggtggcgg caagctcacc cagtacatgg aggagatgag
cctcggcgac 2400gagatccgcg tgaaggaccc actcggccat atcgagtatc
gcggtcgcgg cgagatgacc 2460attgatggca agccgcgcac tgtgagcgcc
ctcaccggcc tcatggctgg tagcggcatc 2520accccgttct accagatcct
ccaggcggtg atggccgacc cggaggacaa gaccgagctc 2580tacctcatct
acgccaacca gaccccggag gacgtgctcc ttcgcagcga gctcgacaag
2640atggccgccg agcgcgacaa cattcacgtg tggtacacct gcgaccgcgc
tcctgaggac 2700tggcagttcg acatcggctt catgaccgag aagatgatca
aggagcacgg cgctcctgcc 2760ggcccagatg tgcttggtct cagctgcggc
cctccgcctt tcatcaagtt cgccgccact 2820ccgagcctca ccaagaacgg
ctacgccgag gaggaccagt tcctcttcta g 287162871DNAPorphyra yezoensis
6atggaggccg cttctggcgc tctcagcgag ctccgcctcg agaagggtgt gaagggctgg
60gaccctgtga aggtgccgag ccgcagcagc ctcaagagca ctccgatcgc cacaccggag
120ggtagcctca gaggcggcag cctctatacc actcgcgctg ccgacggtgg
tgccgctggc 180gctaatggcg gtatggctgc caacggcgtg agcaccagca
gcactagcag cggcttgagc 240ttcgccccta gcggcggttc tggtagcggt
agcggtagag tgggctggac cgagctcaac 300aacgccctca acgccaagct
cctcagcaag agcaccatgc tcgacaagca gcacgtggcc 360gaggaggtgg
acgaccgcga cgttaagacc ccggacaact ggattcctcg gcatccggac
420cttgtgcgcc tcacaggcaa gcacccgttc aactgcgagg ctccgctcag
catgctcgtg
480gaccagggct tcatcacacc gccgagcctc catttcgttc gcaaccacgg
cgccgctcct 540cagctcagct tcgacgacca ccggctcgag gtgagcggtc
tcgtggacac tccgctcacc 600ctcagcatgg aggacatcct cgccatgccg
agcgtgacca ttcccgtgac cctcacttgc 660gccggcaacc gccgcaagga
gcagaacatg accaagcaga ccatcggctt cagctggggc 720gctgccgcta
ccagctgcaa cttctggaca ggtgtgcgct tgcgcgacgt tctcgagaag
780gctggcattc agatggacaa ggcccgccac gtgtgcttcg tgggctgcga
cgaccttccg 840ggcggcaagt acggcaccag catcgacctc gccactgcta
tggaccagtt cggcgaggtg 900atgctcgcct acgagcagaa cggcatccgc
cttactcctg atcacggcgc tccgcttcgc 960gtggttatcc ctggttggat
tggcggccgc atggtgaagt ggctcaccgg cgtgagcgtg 1020accgccgagg
agagccagga gcactaccac ttcttcgaca accggatcat gccgccgcac
1080gtggatgccg agctcgccaa gtctgagggc tggtggtaca agcgcgagta
cctcttcaac 1140cagctcaaca tcaacagcgc catcagcagc ccggccaatg
gcgagctcat gagcctcagc 1200ggtgccggcg tgtacaccct caagggctat
gcttacagcg gtggcggcag aaaggtgacg 1260cgcgttgagg tgagcgtgga
cggcggtaag acttggctcc tcgctaccct cgatcacccg 1320gaggagcgcc
acagccacgc tccaagctac ggccgctact actgctggtg cttctgggag
1380tacaccatcg acaagttcgc cctcctcaac gccgccacat ctagcggcga
gctcctcgtt 1440cgggcctggg atgagggtaa caacacccag ccggccaagc
tcacctggaa cttgatgggc 1500atgggcaaca actgctactt ccgcgtgacc
gtggctccaa agcagagcag cggcgagttc 1560gtgcttgagt tcctccaccc
gactgtgccg ggtcctgcag agggtggttg gatgcctccg 1620ccgcaggaga
gcgttgtggc cgctgctgct gccgctgttg tggccgagac cttgaagcgg
1680gccaaggacg ccccgcagat caacaagatg gaccaggagg acaccaagac
ctacactatg 1740gaggaggtgg ctaagcacga caccgaggag gacagctgga
tcgtggtgca caacaaggtg 1800tacgactgca ccccgttcct caaggaccac
ccgggtggcg gcgcctctat tgtgatgaac 1860gccggcgctg actgcactga
ggagttcgac gccatccaca gcaccaaggc caagggcatg 1920ctcgacgact
actacatcgg cgagctcgcc atcgaggaca tcgaggacga gccggagcag
1980ccggccctcc acatgtctaa gagcagcgtg cagctcatga aggacgactt
caaggagcag 2040agcgtgcgca aggccgtgga cgatgaggag gctgccccag
tggctccggt ggccttgaat 2100ccgaagaagt gggtgcactt cccgctcatc
cagaaggagg agctcagcca cgacacacgc 2160cgctttcggt ttggtctccc
aaccgagggc caccgccttg gcctcccggt tggctttcat 2220atgttcctcg
ccgccaccat cgagggcagc atggtgatgc gcgcctacac accgaccagc
2280agcgatgccc agctcggcta cttcgacctc gtgatcaagg tgtacttcgc
caacgtgcac 2340cctaagttcc ctggtggcgg caagctcacc cagtacatgg
aggagatgag cctcggcgac 2400gagatccgcg tgaaggaccc actcggccat
atcgagtatc gcggtcgcgg cgagatgacc 2460attgatggca agccgcgcac
tgtgagcgcc ctcaccggcc tcatggctgg tagcggcatc 2520accccgttct
accagatcct ccaggcggtg atggccgacc cggaggacaa gaccgagctc
2580tacctcatct acgccaacca gaccccggag gacgtgctcc ttcgcagcga
gctcgacaag 2640atggccgccg agcgcgacaa cattcacgtg tggtacacct
gcgaccgcgc tcctgaggac 2700tggcagttcg acatcggctt catgaccgag
aagatgatca aggagcacgg cgctcctgcc 2760ggcccagatg tgcttggtct
cagctgcggc cctccgcctt tcatcaagtt cgccgccact 2820ccgagcctca
ccaagaacgg ctacgccgag gaggaccagt tcctcttcta g 28717954PRTPorpyhra
perforata 7Met Glu Ala Ala Ser Gly Ala Leu Ser Glu Leu Arg Leu Glu
Lys Gly1 5 10 15 Val Lys Gly Trp Asp Pro Val Lys Val Pro Gly Arg
Ser Ser Leu Lys 20 25 30 Ser Thr Pro Ile Ala Thr Pro Glu Gly Ser
Leu Arg Gly Gly Ser Leu 35 40 45 Tyr Thr Ala Arg Ser Gln His Ala
Ala Gly Ala Asn Asp Val Met Ala 50 55 60 Ala Asn Gly Val Ser Ala
Ser Ser Thr Ala Ser Gly Leu Ser Phe Ala65 70 75 80 Pro Ser Asp Gly
Ser Gly Ser Gly Ser Gly Arg Val Gly Trp Thr Glu 85 90 95 Leu Asn
Asp Ala Leu Asn Ala Lys Leu Ala Ser Lys Ser Thr Met Leu 100 105 110
Asp Lys Gln His Val Ala Asp Glu Val Asp Asp Arg Asp Val Lys Thr 115
120 125 Pro Asp Asn Trp Ile Pro Arg His Pro Ala Leu Ile Arg Leu Thr
Gly 130 135 140 Lys His Pro Phe Asn Cys Glu Ala Pro Leu Ser Met Leu
Val Asp Gln145 150 155 160 Gly Phe Ile Thr Pro Pro Ser Leu His Phe
Val Arg Asn His Gly Ala 165 170 175 Ala Pro Gln Leu Ser Phe Asp Asp
His Arg Leu Glu Val Thr Gly Leu 180 185 190 Val Asp Thr Pro Leu Thr
Leu Ser Met Ala Asp Ile Leu Ala Met Pro 195 200 205 Ser Val Thr Ile
Pro Val Thr Leu Thr Cys Ala Gly Asn Arg Arg Lys 210 215 220 Glu Gln
Asn Met Thr Lys Gln Thr Ile Gly Phe Ser Trp Gly Ala Ala225 230 235
240 Ala Thr Ser Cys Asn Phe Trp Thr Gly Val Arg Val Arg Asp Val Leu
245 250 255 Gln Lys Ala Gly Ile Gln Met Asp Lys Ala Arg His Val Cys
Phe Val 260 265 270 Gly Cys Asp Asn Leu Pro Gly Gly Lys Tyr Gly Thr
Ser Val Asp Leu 275 280 285 Ala Thr Ala Met Asp Gln Phe Gly Glu Val
Met Leu Ala Tyr Glu Gln 290 295 300 Asn Gly Ile Arg Leu Thr Pro Asp
His Gly Ala Pro Leu Arg Val Val305 310 315 320 Ile Pro Gly Trp Ile
Gly Gly Arg Met Val Lys Trp Val Thr Gly Leu 325 330 335 Ser Val Thr
Ser Glu Glu Ser Gln Glu His Tyr His Phe Phe Asp Asn 340 345 350 Arg
Ile Leu Pro Pro His Val Asp Ala Glu Leu Ala Lys Ser Glu Gly 355 360
365 Trp Trp Tyr Lys Arg Glu Tyr Leu Phe Asn Gln Leu Asn Ile Asn Ser
370 375 380 Ala Ile Ser Ser Pro Ala Asn Gly Glu Leu Met Ser Leu Ser
Gly Ala385 390 395 400 Gly Val Tyr Thr Leu Lys Gly Tyr Ala Tyr Ser
Gly Gly Gly Arg Lys 405 410 415 Val Thr Arg Val Glu Val Ser Val Asp
Gly Gly Lys Thr Trp Leu Leu 420 425 430 Ala Thr Leu Asp His Pro Glu
Glu Arg His Ser His Ala Pro Ser Tyr 435 440 445 Gly Arg Tyr Tyr Cys
Trp Cys Phe Trp Glu Tyr Thr Ile Asp Lys Phe 450 455 460 Ala Leu Leu
Asn Ala Ala Thr Ser Ser Gly Glu Leu Leu Val Arg Ala465 470 475 480
Trp Asp Glu Gly Asn Asn Thr Gln Pro Ala Lys Leu Thr Trp Asn Leu 485
490 495 Met Gly Met Gly Asn Asn Cys Tyr Phe Arg Val Thr Val Ala Pro
Lys 500 505 510 Gln Ser Ser Gly Glu Phe Ala Leu Glu Phe Leu His Pro
Thr Val Ala 515 520 525 Gly Pro Ala Glu Gly Gly Trp Met Pro Pro Pro
Gln Glu Ser Val Val 530 535 540 Ala Ala Ala Ala Ala Ala Ala Val Ala
Glu Thr Leu Lys Arg Thr Lys545 550 555 560 Ser Ala Pro Gln Met Asn
Lys Met Asp Gln Gln Asp Ser Lys Thr Ile 565 570 575 Thr Met Glu Glu
Val Ala Lys His Asp Thr Glu Glu Asp Ser Trp Ile 580 585 590 Val Val
His Asn Lys Val Tyr Asp Cys Thr Pro Phe Leu Lys Asp His 595 600 605
Pro Gly Gly Gly Ala Ser Ile Val Met Asn Ala Gly Ala Asp Cys Thr 610
615 620 Glu Glu Phe Asp Ala Ile His Ser Thr Lys Ala Lys Ser Met Leu
Asp625 630 635 640 Asp Tyr Tyr Ile Gly Glu Leu Ala Val Glu Asp Ile
Glu Asp Glu Pro 645 650 655 Glu Gln Pro Ala Leu His Leu Ser Lys Ser
Ser Val Gln Leu Met Lys 660 665 670 Asp Asp Phe Lys Glu Gln Ser Val
Arg Lys Ala Val Glu Gly Val Asp 675 680 685 Glu Glu Val Val Thr Pro
Val Ala Leu Asn Pro Lys Lys Trp Ile His 690 695 700 Phe Pro Leu Ile
Gln Lys Glu Glu Leu Ser His Asp Thr Arg Arg Phe705 710 715 720 Arg
Phe Gly Leu Pro Thr Pro Gly His Arg Leu Gly Leu Pro Val Gly 725 730
735 Phe His Met Phe Leu Met Ala Thr Ile Asp Gly Ala Met Val Met Arg
740 745 750 Ala Tyr Thr Pro Thr Ser Ser Asp Ala Glu Leu Gly Tyr Phe
Asp Leu 755 760 765 Val Ile Lys Val Tyr Phe Ala Asn Val His Pro Arg
Phe Pro Asp Gly 770 775 780 Gly Lys Leu Thr Gln Tyr Met Glu Glu Met
Ser Leu Gly Asp Glu Ile785 790 795 800 Arg Val Lys Gly Pro Leu Gly
His Ile Glu Tyr Arg Ser Arg Gly Glu 805 810 815 Met Thr Ile Asp Gly
Lys Pro Arg Thr Val Ser Ala Leu Thr Gly Leu 820 825 830 Met Ala Gly
Ser Gly Ile Thr Pro Phe Tyr Gln Ile Leu Gln Ala Val 835 840 845 Met
Ala Asp Pro Glu Asp Lys Thr Glu Leu Tyr Leu Ile Tyr Ala Asn 850 855
860 Gln Thr Pro Glu Asp Val Leu Leu Arg Ser Glu Leu Asp Lys Met
Ala865 870 875 880 Ala Glu Arg Asp Asn Ile His Val Trp Tyr Thr Cys
Asp Arg Ala Pro 885 890 895 Glu Asp Trp Lys Tyr Asp Ile Gly Phe Met
Thr Val Asp Met Ile Lys 900 905 910 Glu His Gly Ala Pro Ala Gly Pro
Asp Val Leu Gly Leu Ser Cys Gly 915 920 925 Pro Pro Pro Phe Ile Lys
Phe Ala Ala Thr Pro Ser Leu Thr Lys Asn 930 935 940 Gly Tyr Ala Glu
Glu Asn Gln Phe Leu Phe945 950 8954PRTPorphyra perforata 8Met Glu
Ala Ala Ser Gly Ala Leu Ser Glu Leu Arg Leu Glu Lys Gly1 5 10 15
Val Lys Gly Trp Asp Pro Val Lys Val Pro Gly Arg Ser Ser Leu Lys 20
25 30 Ser Thr Pro Ile Ala Thr Pro Glu Gly Ser Leu Arg Gly Gly Ser
Leu 35 40 45 Tyr Thr Ala Arg Ser Gln His Ala Ala Gly Ala Asn Asp
Val Met Ala 50 55 60 Ala Asn Gly Val Ser Ala Ser Ser Thr Ala Ser
Gly Leu Ser Phe Ala65 70 75 80 Pro Ser Asp Gly Ser Gly Ser Gly Ser
Gly Arg Val Gly Trp Thr Glu 85 90 95 Leu Asn Asp Ala Leu Asn Ala
Lys Leu Ala Ser Lys Ser Thr Met Leu 100 105 110 Asp Lys Gln His Val
Ala Asp Glu Val Asp Asp Arg Asp Val Lys Thr 115 120 125 Pro Asp Asn
Trp Ile Pro Arg His Pro Ala Leu Ile Arg Leu Thr Gly 130 135 140 Lys
His Pro Phe Asn Cys Glu Ala Pro Leu Ser Met Leu Val Asp Gln145 150
155 160 Gly Phe Ile Thr Pro Pro Ser Leu His Phe Val Arg Asn His Gly
Ala 165 170 175 Ala Pro Gln Leu Ser Phe Asp Asp His Arg Leu Glu Val
Thr Gly Leu 180 185 190 Val Asp Thr Pro Leu Thr Leu Ser Met Ala Asp
Ile Leu Ala Met Pro 195 200 205 Ser Val Thr Ile Pro Val Thr Leu Thr
Cys Ala Gly Asn Arg Arg Lys 210 215 220 Glu Gln Asn Met Thr Lys Gln
Thr Ile Gly Phe Ser Trp Gly Ala Ala225 230 235 240 Ala Thr Ser Cys
Asn Phe Trp Thr Gly Val Arg Val Arg Asp Val Leu 245 250 255 Gln Lys
Ala Gly Ile Gln Met Asp Lys Ala Arg His Val Cys Phe Val 260 265 270
Gly Cys Asp Asn Leu Pro Gly Gly Lys Tyr Gly Thr Ser Val Asp Leu 275
280 285 Ala Thr Ala Met Asp Gln Phe Gly Glu Val Met Leu Ala Tyr Glu
Gln 290 295 300 Asn Gly Ile Arg Leu Thr Pro Asp His Gly Ala Pro Leu
Arg Val Val305 310 315 320 Ile Pro Gly Trp Ile Gly Gly Arg Met Val
Lys Trp Val Thr Gly Leu 325 330 335 Ser Val Thr Ser Glu Glu Ser Gln
Glu His Tyr His Phe Phe Asp Asn 340 345 350 Arg Ile Leu Pro Pro His
Val Asp Ala Glu Leu Ala Lys Ser Glu Gly 355 360 365 Trp Trp Tyr Lys
Arg Glu Tyr Leu Phe Asn Gln Leu Asn Ile Asn Ser 370 375 380 Ala Ile
Ser Ser Pro Ala Asn Gly Glu Leu Met Ser Leu Ser Gly Ala385 390 395
400 Gly Val Tyr Thr Leu Lys Gly Tyr Ala Tyr Ser Gly Gly Gly Arg Lys
405 410 415 Val Thr Arg Val Glu Val Ser Val Asp Gly Gly Lys Thr Trp
Leu Leu 420 425 430 Ala Thr Leu Asp His Pro Glu Glu Arg His Ser His
Ala Pro Ser Tyr 435 440 445 Gly Arg Tyr Tyr Cys Trp Cys Phe Trp Glu
Tyr Thr Ile Asp Lys Phe 450 455 460 Ala Leu Leu Asn Ala Ala Thr Ser
Ser Gly Glu Leu Leu Val Arg Ala465 470 475 480 Trp Asp Glu Gly Asn
Asn Thr Gln Pro Ala Lys Leu Thr Trp Asn Leu 485 490 495 Met Gly Met
Gly Asn Asn Cys Tyr Phe Arg Val Thr Val Ala Pro Lys 500 505 510 Gln
Ser Ser Gly Glu Phe Ala Leu Glu Phe Leu His Pro Thr Val Ala 515 520
525 Gly Pro Ala Glu Gly Gly Trp Met Pro Pro Pro Gln Glu Ser Val Val
530 535 540 Ala Ala Ala Ala Ala Ala Ala Val Ala Glu Thr Leu Lys Arg
Thr Lys545 550 555 560 Ala Ala Pro Gln Met Asn Lys Met Asp Gln Gln
Asp Ser Lys Thr Ile 565 570 575 Thr Met Glu Glu Val Ala Lys His Asp
Thr Glu Glu Asp Ser Trp Ile 580 585 590 Val Val His Asn Lys Val Tyr
Asp Cys Thr Pro Phe Leu Lys Asp His 595 600 605 Pro Gly Gly Gly Ala
Ser Ile Val Met Asn Ala Gly Ala Asp Cys Thr 610 615 620 Glu Glu Phe
Asp Ala Ile His Ser Thr Lys Ala Lys Ser Met Leu Asp625 630 635 640
Asp Tyr Tyr Ile Gly Glu Leu Ala Val Glu Asp Ile Glu Asp Glu Pro 645
650 655 Glu Gln Pro Ala Leu His Leu Ser Lys Ser Ser Val Gln Leu Met
Lys 660 665 670 Asp Asp Phe Lys Glu Gln Ser Val Arg Lys Ala Val Glu
Gly Val Asp 675 680 685 Glu Glu Val Val Thr Pro Val Ala Leu Asn Pro
Lys Lys Trp Ile His 690 695 700 Phe Pro Leu Ile Gln Lys Glu Glu Leu
Ser His Asp Thr Arg Arg Phe705 710 715 720 Arg Phe Gly Leu Pro Thr
Pro Gly His Arg Leu Gly Leu Pro Val Gly 725 730 735 Phe His Met Phe
Leu Met Ala Thr Ile Asp Gly Ala Met Val Met Arg 740 745 750 Ala Tyr
Thr Pro Thr Ser Ser Asp Ala Glu Leu Gly Tyr Phe Asp Leu 755 760 765
Val Ile Lys Val Tyr Phe Ala Asn Val His Pro Arg Phe Pro Asp Gly 770
775 780 Gly Lys Leu Thr Gln Tyr Met Glu Glu Met Ser Leu Gly Asp Glu
Ile785 790 795 800 Arg Val Lys Gly Pro Leu Gly His Ile Glu Tyr Arg
Ser Arg Gly Glu 805 810 815 Met Thr Ile Asp Gly Lys Pro Arg Thr Val
Ser Ala Leu Thr Gly Leu 820 825 830 Met Ala Gly Ser Gly Ile Thr Pro
Phe Tyr Gln Ile Leu Gln Ala Val 835 840 845 Met Ala Asp Pro Glu Asp
Lys Thr Glu Leu Tyr Leu Ile Tyr Ala Asn 850 855 860 Gln Thr Pro Glu
Asp Val Leu Leu Arg Ser Glu Leu Asp Lys Met Ala865 870 875 880 Ala
Glu Arg Asp Asn Ile His Val Trp Tyr Thr Cys Asp Arg Ala Pro 885 890
895 Glu Asp Trp Lys Tyr Asp Ile Gly Phe Met Thr Val Asp Met Ile Lys
900 905 910 Glu His Gly Ala Pro Ala Gly Pro Asp Val Leu Gly Leu Ser
Cys Gly 915 920 925 Pro Pro Pro Phe Ile Lys Phe Ala Ala Thr Pro Ser
Leu Thr Lys Asn 930 935 940 Gly Tyr Ala Glu Glu Asn Gln Phe Leu
Phe945 950 9954PRTPorphyra perforata 9Met Glu Ala Ala Ser Gly Ala
Leu Ser Glu Leu Arg Leu Glu Lys Gly1 5 10 15 Val Lys Gly Trp Asp
Pro Val Lys Val Pro Gly Arg Ser Ser Leu Lys 20
25 30 Ser Thr Pro Ile Ala Thr Pro Glu Gly Ser Leu Arg Gly Gly Ser
Leu 35 40 45 Tyr Thr Ala Arg Ser Gln His Ala Ala Gly Ala Asn Asp
Val Met Ala 50 55 60 Ala Asn Gly Val Ser Ala Ser Ser Thr Ala Ser
Gly Leu Ser Phe Ala65 70 75 80 Pro Ser Asp Gly Ser Gly Ser Gly Ser
Gly Arg Val Gly Trp Thr Glu 85 90 95 Leu Asn Asp Ala Leu Asn Ala
Lys Leu Ala Ser Lys Ser Thr Met Leu 100 105 110 Asp Lys Gln His Val
Ala Asp Glu Val Asp Asp Arg Asp Val Lys Thr 115 120 125 Pro Asp Asn
Trp Ile Pro Arg His Pro Ala Leu Ile Arg Leu Thr Gly 130 135 140 Lys
His Pro Phe Asn Cys Glu Ala Pro Leu Ser Met Leu Val Asp Gln145 150
155 160 Gly Phe Ile Thr Pro Pro Ser Leu His Phe Val Arg Asn His Gly
Ala 165 170 175 Ala Pro Gln Leu Ser Phe Asp Asp His Arg Leu Glu Val
Thr Gly Leu 180 185 190 Val Asp Thr Pro Leu Thr Leu Ser Met Ala Asp
Ile Leu Ala Met Pro 195 200 205 Ser Val Thr Ile Pro Val Thr Leu Thr
Cys Ala Gly Asn Arg Arg Lys 210 215 220 Glu Gln Asn Met Thr Lys Gln
Thr Ile Gly Phe Ser Trp Gly Ala Ala225 230 235 240 Ala Thr Ser Cys
Asn Phe Trp Thr Gly Val Arg Val Arg Asp Val Leu 245 250 255 Gln Lys
Ala Gly Ile Gln Met Asp Lys Ala Arg His Val Cys Phe Val 260 265 270
Gly Cys Asp Asn Leu Pro Gly Gly Lys Tyr Gly Thr Ser Val Asp Leu 275
280 285 Ala Thr Ala Met Asp Gln Phe Gly Glu Val Met Leu Ala Tyr Glu
Gln 290 295 300 Asn Gly Ile Arg Leu Thr Pro Asp His Gly Ala Pro Leu
Arg Val Val305 310 315 320 Ile Pro Gly Trp Ile Gly Gly Arg Met Val
Lys Trp Val Thr Gly Leu 325 330 335 Ser Val Thr Ser Glu Glu Ser Gln
Glu His Tyr His Phe Phe Asp Asn 340 345 350 Arg Ile Leu Pro Pro His
Val Asp Ala Glu Leu Ala Lys Ser Glu Gly 355 360 365 Trp Trp Tyr Lys
Arg Glu Tyr Leu Phe Asn Gln Leu Asn Ile Asn Ser 370 375 380 Ala Ile
Ser Ser Pro Ala Asn Gly Glu Leu Met Ser Leu Ser Gly Ala385 390 395
400 Gly Val Tyr Thr Leu Lys Gly Tyr Ala Tyr Ser Gly Gly Gly Arg Lys
405 410 415 Val Thr Arg Val Glu Val Ser Val Asp Gly Gly Lys Thr Trp
Leu Leu 420 425 430 Ala Thr Leu Asp His Pro Glu Glu Arg His Ser His
Ala Pro Ser Tyr 435 440 445 Gly Arg Tyr Tyr Cys Trp Cys Phe Trp Glu
Tyr Thr Ile Asp Lys Phe 450 455 460 Ala Leu Leu Asn Ala Ala Thr Ser
Ser Gly Glu Leu Leu Val Arg Ala465 470 475 480 Trp Asp Glu Gly Asn
Asn Thr Gln Pro Ala Lys Leu Thr Trp Asn Leu 485 490 495 Met Gly Met
Gly Asn Asn Cys Tyr Phe Arg Val Thr Val Ala Pro Lys 500 505 510 Gln
Ser Ser Gly Glu Phe Ala Leu Glu Phe Leu His Pro Thr Val Ala 515 520
525 Gly Pro Ala Glu Gly Gly Trp Met Pro Pro Pro Gln Glu Ser Val Val
530 535 540 Ala Ala Ala Ala Ala Ala Ala Val Ala Glu Thr Leu Lys Arg
Thr Lys545 550 555 560 Asp Ala Pro Gln Met Asn Lys Met Asp Gln Gln
Asp Ser Lys Thr Ile 565 570 575 Thr Met Glu Glu Val Ala Lys His Asp
Thr Glu Glu Asp Ser Trp Ile 580 585 590 Val Val His Asn Lys Val Tyr
Asp Cys Thr Pro Phe Leu Lys Asp His 595 600 605 Pro Gly Gly Gly Ala
Ser Ile Val Met Asn Ala Gly Ala Asp Cys Thr 610 615 620 Glu Glu Phe
Asp Ala Ile His Ser Thr Lys Ala Lys Ser Met Leu Asp625 630 635 640
Asp Tyr Tyr Ile Gly Glu Leu Ala Val Glu Asp Ile Glu Asp Glu Pro 645
650 655 Glu Gln Pro Ala Leu His Leu Ser Lys Ser Ser Val Gln Leu Met
Lys 660 665 670 Asp Asp Phe Lys Glu Gln Ser Val Arg Lys Ala Val Glu
Gly Val Asp 675 680 685 Glu Glu Val Val Thr Pro Val Ala Leu Asn Pro
Lys Lys Trp Ile His 690 695 700 Phe Pro Leu Ile Gln Lys Glu Glu Leu
Ser His Asp Thr Arg Arg Phe705 710 715 720 Arg Phe Gly Leu Pro Thr
Pro Gly His Arg Leu Gly Leu Pro Val Gly 725 730 735 Phe His Met Phe
Leu Met Ala Thr Ile Asp Gly Ala Met Val Met Arg 740 745 750 Ala Tyr
Thr Pro Thr Ser Ser Asp Ala Glu Leu Gly Tyr Phe Asp Leu 755 760 765
Val Ile Lys Val Tyr Phe Ala Asn Val His Pro Arg Phe Pro Asp Gly 770
775 780 Gly Lys Leu Thr Gln Tyr Met Glu Glu Met Ser Leu Gly Asp Glu
Ile785 790 795 800 Arg Val Lys Gly Pro Leu Gly His Ile Glu Tyr Arg
Ser Arg Gly Glu 805 810 815 Met Thr Ile Asp Gly Lys Pro Arg Thr Val
Ser Ala Leu Thr Gly Leu 820 825 830 Met Ala Gly Ser Gly Ile Thr Pro
Phe Tyr Gln Ile Leu Gln Ala Val 835 840 845 Met Ala Asp Pro Glu Asp
Lys Thr Glu Leu Tyr Leu Ile Tyr Ala Asn 850 855 860 Gln Thr Pro Glu
Asp Val Leu Leu Arg Ser Glu Leu Asp Lys Met Ala865 870 875 880 Ala
Glu Arg Asp Asn Ile His Val Trp Tyr Thr Cys Asp Arg Ala Pro 885 890
895 Glu Asp Trp Lys Tyr Asp Ile Gly Phe Met Thr Val Asp Met Ile Lys
900 905 910 Glu His Gly Ala Pro Ala Gly Pro Asp Val Leu Gly Leu Ser
Cys Gly 915 920 925 Pro Pro Pro Phe Ile Lys Phe Ala Ala Thr Pro Ser
Leu Thr Lys Asn 930 935 940 Gly Tyr Ala Glu Glu Asn Gln Phe Leu
Phe945 950 10956PRTPorphyra yezoensis 10Met Glu Ala Ala Ser Gly Ala
Leu Ser Glu Leu Arg Leu Glu Lys Gly1 5 10 15 Val Lys Gly Trp Asp
Pro Val Lys Val Pro Ser Arg Ser Ser Leu Lys 20 25 30 Ser Thr Pro
Ile Ala Thr Pro Glu Gly Ser Leu Arg Gly Gly Ser Leu 35 40 45 Tyr
Thr Thr Arg Ala Ala Asp Gly Gly Ala Ala Gly Ala Asn Gly Gly 50 55
60 Met Ala Ala Asn Gly Val Ser Thr Ser Ser Thr Ser Ser Gly Leu
Ser65 70 75 80 Phe Ala Pro Ser Gly Gly Ser Gly Ser Gly Ser Gly Arg
Val Gly Trp 85 90 95 Thr Glu Leu Asn Asn Ala Leu Asn Ala Lys Leu
Leu Ser Lys Ser Thr 100 105 110 Met Leu Asp Lys Gln His Val Ala Glu
Glu Val Asp Asp Arg Asp Val 115 120 125 Lys Thr Pro Asp Asn Trp Ile
Pro Arg His Pro Asp Leu Val Arg Leu 130 135 140 Thr Gly Lys His Pro
Phe Asn Cys Glu Ala Pro Leu Ser Met Leu Val145 150 155 160 Asp Gln
Gly Phe Ile Thr Pro Pro Ser Leu His Phe Val Arg Asn His 165 170 175
Gly Ala Ala Pro Gln Leu Ser Phe Asp Asp His Arg Leu Glu Val Ser 180
185 190 Gly Leu Val Asp Thr Pro Leu Thr Leu Ser Met Glu Asp Ile Leu
Ala 195 200 205 Met Pro Ser Val Thr Ile Pro Val Thr Leu Thr Cys Ala
Gly Asn Arg 210 215 220 Arg Lys Glu Gln Asn Met Thr Lys Gln Thr Ile
Gly Phe Ser Trp Gly225 230 235 240 Ala Ala Ala Thr Ser Cys Asn Phe
Trp Thr Gly Val Arg Leu Arg Asp 245 250 255 Val Leu Glu Lys Ala Gly
Ile Gln Met Asp Lys Ala Arg His Val Cys 260 265 270 Phe Val Gly Cys
Asp Asp Leu Pro Gly Gly Lys Tyr Gly Thr Ser Ile 275 280 285 Asp Leu
Ala Thr Ala Met Asp Gln Phe Gly Glu Val Met Leu Ala Tyr 290 295 300
Glu Gln Asn Gly Ile Arg Leu Thr Pro Asp His Gly Ala Pro Leu Arg305
310 315 320 Val Val Ile Pro Gly Trp Ile Gly Gly Arg Met Val Lys Trp
Leu Thr 325 330 335 Gly Val Ser Val Thr Ala Glu Glu Ser Gln Glu His
Tyr His Phe Phe 340 345 350 Asp Asn Arg Ile Met Pro Pro His Val Asp
Ala Glu Leu Ala Lys Ser 355 360 365 Glu Gly Trp Trp Tyr Lys Arg Glu
Tyr Leu Phe Asn Gln Leu Asn Ile 370 375 380 Asn Ser Ala Ile Ser Ser
Pro Ala Asn Gly Glu Leu Met Ser Leu Ser385 390 395 400 Gly Ala Gly
Val Tyr Thr Leu Lys Gly Tyr Ala Tyr Ser Gly Gly Gly 405 410 415 Arg
Lys Val Thr Arg Val Glu Val Ser Val Asp Gly Gly Lys Thr Trp 420 425
430 Leu Leu Ala Thr Leu Asp His Pro Glu Glu Arg His Ser His Ala Pro
435 440 445 Ser Tyr Gly Arg Tyr Tyr Cys Trp Cys Phe Trp Glu Tyr Thr
Ile Asp 450 455 460 Lys Phe Ala Leu Leu Asn Ala Ala Thr Ser Ser Gly
Glu Leu Leu Val465 470 475 480 Arg Ala Trp Asp Glu Gly Asn Asn Thr
Gln Pro Ala Lys Leu Thr Trp 485 490 495 Asn Leu Met Gly Met Gly Asn
Asn Cys Tyr Phe Arg Val Thr Val Ala 500 505 510 Pro Lys Gln Ser Ser
Gly Glu Phe Val Leu Glu Phe Leu His Pro Thr 515 520 525 Val Pro Gly
Pro Ala Glu Gly Gly Trp Met Pro Pro Pro Gln Glu Ser 530 535 540 Val
Val Ala Ala Ala Ala Ala Ala Val Val Ala Glu Thr Leu Lys Arg545 550
555 560 Ala Lys Ser Ala Pro Gln Ile Asn Lys Met Asp Gln Glu Asp Thr
Lys 565 570 575 Thr Tyr Thr Met Glu Glu Val Ala Lys His Asp Thr Glu
Glu Asp Ser 580 585 590 Trp Ile Val Val His Asn Lys Val Tyr Asp Cys
Thr Pro Phe Leu Lys 595 600 605 Asp His Pro Gly Gly Gly Ala Ser Ile
Val Met Asn Ala Gly Ala Asp 610 615 620 Cys Thr Glu Glu Phe Asp Ala
Ile His Ser Thr Lys Ala Lys Gly Met625 630 635 640 Leu Asp Asp Tyr
Tyr Ile Gly Glu Leu Ala Ile Glu Asp Ile Glu Asp 645 650 655 Glu Pro
Glu Gln Pro Ala Leu His Met Ser Lys Ser Ser Val Gln Leu 660 665 670
Met Lys Asp Asp Phe Lys Glu Gln Ser Val Arg Lys Ala Val Asp Asp 675
680 685 Glu Glu Ala Ala Pro Val Ala Pro Val Ala Leu Asn Pro Lys Lys
Trp 690 695 700 Val His Phe Pro Leu Ile Gln Lys Glu Glu Leu Ser His
Asp Thr Arg705 710 715 720 Arg Phe Arg Phe Gly Leu Pro Thr Glu Gly
His Arg Leu Gly Leu Pro 725 730 735 Val Gly Phe His Met Phe Leu Ala
Ala Thr Ile Glu Gly Ser Met Val 740 745 750 Met Arg Ala Tyr Thr Pro
Thr Ser Ser Asp Ala Gln Leu Gly Tyr Phe 755 760 765 Asp Leu Val Ile
Lys Val Tyr Phe Ala Asn Val His Pro Lys Phe Pro 770 775 780 Gly Gly
Gly Lys Leu Thr Gln Tyr Met Glu Glu Met Ser Leu Gly Asp785 790 795
800 Glu Ile Arg Val Lys Asp Pro Leu Gly His Ile Glu Tyr Arg Gly Arg
805 810 815 Gly Glu Met Thr Ile Asp Gly Lys Pro Arg Thr Val Ser Ala
Leu Thr 820 825 830 Gly Leu Met Ala Gly Ser Gly Ile Thr Pro Phe Tyr
Gln Ile Leu Gln 835 840 845 Ala Val Met Ala Asp Pro Glu Asp Lys Thr
Glu Leu Tyr Leu Ile Tyr 850 855 860 Ala Asn Gln Thr Pro Glu Asp Val
Leu Leu Arg Ser Glu Leu Asp Lys865 870 875 880 Met Ala Ala Glu Arg
Asp Asn Ile His Val Trp Tyr Thr Cys Asp Arg 885 890 895 Ala Pro Glu
Asp Trp Gln Phe Asp Ile Gly Phe Met Thr Glu Lys Met 900 905 910 Ile
Lys Glu His Gly Ala Pro Ala Gly Pro Asp Val Leu Gly Leu Ser 915 920
925 Cys Gly Pro Pro Pro Phe Ile Lys Phe Ala Ala Thr Pro Ser Leu Thr
930 935 940 Lys Asn Gly Tyr Ala Glu Glu Asp Gln Phe Leu Phe945 950
955 11956PRTPorphyra yezoensis 11Met Glu Ala Ala Ser Gly Ala Leu
Ser Glu Leu Arg Leu Glu Lys Gly1 5 10 15 Val Lys Gly Trp Asp Pro
Val Lys Val Pro Ser Arg Ser Ser Leu Lys 20 25 30 Ser Thr Pro Ile
Ala Thr Pro Glu Gly Ser Leu Arg Gly Gly Ser Leu 35 40 45 Tyr Thr
Thr Arg Ala Ala Asp Gly Gly Ala Ala Gly Ala Asn Gly Gly 50 55 60
Met Ala Ala Asn Gly Val Ser Thr Ser Ser Thr Ser Ser Gly Leu Ser65
70 75 80 Phe Ala Pro Ser Gly Gly Ser Gly Ser Gly Ser Gly Arg Val
Gly Trp 85 90 95 Thr Glu Leu Asn Asn Ala Leu Asn Ala Lys Leu Leu
Ser Lys Ser Thr 100 105 110 Met Leu Asp Lys Gln His Val Ala Glu Glu
Val Asp Asp Arg Asp Val 115 120 125 Lys Thr Pro Asp Asn Trp Ile Pro
Arg His Pro Asp Leu Val Arg Leu 130 135 140 Thr Gly Lys His Pro Phe
Asn Cys Glu Ala Pro Leu Ser Met Leu Val145 150 155 160 Asp Gln Gly
Phe Ile Thr Pro Pro Ser Leu His Phe Val Arg Asn His 165 170 175 Gly
Ala Ala Pro Gln Leu Ser Phe Asp Asp His Arg Leu Glu Val Ser 180 185
190 Gly Leu Val Asp Thr Pro Leu Thr Leu Ser Met Glu Asp Ile Leu Ala
195 200 205 Met Pro Ser Val Thr Ile Pro Val Thr Leu Thr Cys Ala Gly
Asn Arg 210 215 220 Arg Lys Glu Gln Asn Met Thr Lys Gln Thr Ile Gly
Phe Ser Trp Gly225 230 235 240 Ala Ala Ala Thr Ser Cys Asn Phe Trp
Thr Gly Val Arg Leu Arg Asp 245 250 255 Val Leu Glu Lys Ala Gly Ile
Gln Met Asp Lys Ala Arg His Val Cys 260 265 270 Phe Val Gly Cys Asp
Asp Leu Pro Gly Gly Lys Tyr Gly Thr Ser Ile 275 280 285 Asp Leu Ala
Thr Ala Met Asp Gln Phe Gly Glu Val Met Leu Ala Tyr 290 295 300 Glu
Gln Asn Gly Ile Arg Leu Thr Pro Asp His Gly Ala Pro Leu Arg305 310
315 320 Val Val Ile Pro Gly Trp Ile Gly Gly Arg Met Val Lys Trp Leu
Thr 325 330 335 Gly Val Ser Val Thr Ala Glu Glu Ser Gln Glu His Tyr
His Phe Phe 340 345 350 Asp Asn Arg Ile Met Pro Pro His Val Asp Ala
Glu Leu Ala Lys Ser 355 360 365 Glu Gly Trp Trp Tyr Lys Arg Glu Tyr
Leu Phe Asn Gln Leu Asn Ile 370 375 380 Asn Ser Ala Ile Ser Ser Pro
Ala Asn Gly Glu Leu Met Ser Leu Ser385 390 395 400 Gly Ala Gly Val
Tyr Thr Leu Lys Gly Tyr Ala Tyr Ser Gly Gly Gly 405 410 415 Arg Lys
Val Thr Arg Val Glu Val Ser Val
Asp Gly Gly Lys Thr Trp 420 425 430 Leu Leu Ala Thr Leu Asp His Pro
Glu Glu Arg His Ser His Ala Pro 435 440 445 Ser Tyr Gly Arg Tyr Tyr
Cys Trp Cys Phe Trp Glu Tyr Thr Ile Asp 450 455 460 Lys Phe Ala Leu
Leu Asn Ala Ala Thr Ser Ser Gly Glu Leu Leu Val465 470 475 480 Arg
Ala Trp Asp Glu Gly Asn Asn Thr Gln Pro Ala Lys Leu Thr Trp 485 490
495 Asn Leu Met Gly Met Gly Asn Asn Cys Tyr Phe Arg Val Thr Val Ala
500 505 510 Pro Lys Gln Ser Ser Gly Glu Phe Val Leu Glu Phe Leu His
Pro Thr 515 520 525 Val Pro Gly Pro Ala Glu Gly Gly Trp Met Pro Pro
Pro Gln Glu Ser 530 535 540 Val Val Ala Ala Ala Ala Ala Ala Val Val
Ala Glu Thr Leu Lys Arg545 550 555 560 Ala Lys Ala Ala Pro Gln Ile
Asn Lys Met Asp Gln Glu Asp Thr Lys 565 570 575 Thr Tyr Thr Met Glu
Glu Val Ala Lys His Asp Thr Glu Glu Asp Ser 580 585 590 Trp Ile Val
Val His Asn Lys Val Tyr Asp Cys Thr Pro Phe Leu Lys 595 600 605 Asp
His Pro Gly Gly Gly Ala Ser Ile Val Met Asn Ala Gly Ala Asp 610 615
620 Cys Thr Glu Glu Phe Asp Ala Ile His Ser Thr Lys Ala Lys Gly
Met625 630 635 640 Leu Asp Asp Tyr Tyr Ile Gly Glu Leu Ala Ile Glu
Asp Ile Glu Asp 645 650 655 Glu Pro Glu Gln Pro Ala Leu His Met Ser
Lys Ser Ser Val Gln Leu 660 665 670 Met Lys Asp Asp Phe Lys Glu Gln
Ser Val Arg Lys Ala Val Asp Asp 675 680 685 Glu Glu Ala Ala Pro Val
Ala Pro Val Ala Leu Asn Pro Lys Lys Trp 690 695 700 Val His Phe Pro
Leu Ile Gln Lys Glu Glu Leu Ser His Asp Thr Arg705 710 715 720 Arg
Phe Arg Phe Gly Leu Pro Thr Glu Gly His Arg Leu Gly Leu Pro 725 730
735 Val Gly Phe His Met Phe Leu Ala Ala Thr Ile Glu Gly Ser Met Val
740 745 750 Met Arg Ala Tyr Thr Pro Thr Ser Ser Asp Ala Gln Leu Gly
Tyr Phe 755 760 765 Asp Leu Val Ile Lys Val Tyr Phe Ala Asn Val His
Pro Lys Phe Pro 770 775 780 Gly Gly Gly Lys Leu Thr Gln Tyr Met Glu
Glu Met Ser Leu Gly Asp785 790 795 800 Glu Ile Arg Val Lys Asp Pro
Leu Gly His Ile Glu Tyr Arg Gly Arg 805 810 815 Gly Glu Met Thr Ile
Asp Gly Lys Pro Arg Thr Val Ser Ala Leu Thr 820 825 830 Gly Leu Met
Ala Gly Ser Gly Ile Thr Pro Phe Tyr Gln Ile Leu Gln 835 840 845 Ala
Val Met Ala Asp Pro Glu Asp Lys Thr Glu Leu Tyr Leu Ile Tyr 850 855
860 Ala Asn Gln Thr Pro Glu Asp Val Leu Leu Arg Ser Glu Leu Asp
Lys865 870 875 880 Met Ala Ala Glu Arg Asp Asn Ile His Val Trp Tyr
Thr Cys Asp Arg 885 890 895 Ala Pro Glu Asp Trp Gln Phe Asp Ile Gly
Phe Met Thr Glu Lys Met 900 905 910 Ile Lys Glu His Gly Ala Pro Ala
Gly Pro Asp Val Leu Gly Leu Ser 915 920 925 Cys Gly Pro Pro Pro Phe
Ile Lys Phe Ala Ala Thr Pro Ser Leu Thr 930 935 940 Lys Asn Gly Tyr
Ala Glu Glu Asp Gln Phe Leu Phe945 950 955 12956PRTPorphyra
yezoensis 12Met Glu Ala Ala Ser Gly Ala Leu Ser Glu Leu Arg Leu Glu
Lys Gly1 5 10 15 Val Lys Gly Trp Asp Pro Val Lys Val Pro Ser Arg
Ser Ser Leu Lys 20 25 30 Ser Thr Pro Ile Ala Thr Pro Glu Gly Ser
Leu Arg Gly Gly Ser Leu 35 40 45 Tyr Thr Thr Arg Ala Ala Asp Gly
Gly Ala Ala Gly Ala Asn Gly Gly 50 55 60 Met Ala Ala Asn Gly Val
Ser Thr Ser Ser Thr Ser Ser Gly Leu Ser65 70 75 80 Phe Ala Pro Ser
Gly Gly Ser Gly Ser Gly Ser Gly Arg Val Gly Trp 85 90 95 Thr Glu
Leu Asn Asn Ala Leu Asn Ala Lys Leu Leu Ser Lys Ser Thr 100 105 110
Met Leu Asp Lys Gln His Val Ala Glu Glu Val Asp Asp Arg Asp Val 115
120 125 Lys Thr Pro Asp Asn Trp Ile Pro Arg His Pro Asp Leu Val Arg
Leu 130 135 140 Thr Gly Lys His Pro Phe Asn Cys Glu Ala Pro Leu Ser
Met Leu Val145 150 155 160 Asp Gln Gly Phe Ile Thr Pro Pro Ser Leu
His Phe Val Arg Asn His 165 170 175 Gly Ala Ala Pro Gln Leu Ser Phe
Asp Asp His Arg Leu Glu Val Ser 180 185 190 Gly Leu Val Asp Thr Pro
Leu Thr Leu Ser Met Glu Asp Ile Leu Ala 195 200 205 Met Pro Ser Val
Thr Ile Pro Val Thr Leu Thr Cys Ala Gly Asn Arg 210 215 220 Arg Lys
Glu Gln Asn Met Thr Lys Gln Thr Ile Gly Phe Ser Trp Gly225 230 235
240 Ala Ala Ala Thr Ser Cys Asn Phe Trp Thr Gly Val Arg Leu Arg Asp
245 250 255 Val Leu Glu Lys Ala Gly Ile Gln Met Asp Lys Ala Arg His
Val Cys 260 265 270 Phe Val Gly Cys Asp Asp Leu Pro Gly Gly Lys Tyr
Gly Thr Ser Ile 275 280 285 Asp Leu Ala Thr Ala Met Asp Gln Phe Gly
Glu Val Met Leu Ala Tyr 290 295 300 Glu Gln Asn Gly Ile Arg Leu Thr
Pro Asp His Gly Ala Pro Leu Arg305 310 315 320 Val Val Ile Pro Gly
Trp Ile Gly Gly Arg Met Val Lys Trp Leu Thr 325 330 335 Gly Val Ser
Val Thr Ala Glu Glu Ser Gln Glu His Tyr His Phe Phe 340 345 350 Asp
Asn Arg Ile Met Pro Pro His Val Asp Ala Glu Leu Ala Lys Ser 355 360
365 Glu Gly Trp Trp Tyr Lys Arg Glu Tyr Leu Phe Asn Gln Leu Asn Ile
370 375 380 Asn Ser Ala Ile Ser Ser Pro Ala Asn Gly Glu Leu Met Ser
Leu Ser385 390 395 400 Gly Ala Gly Val Tyr Thr Leu Lys Gly Tyr Ala
Tyr Ser Gly Gly Gly 405 410 415 Arg Lys Val Thr Arg Val Glu Val Ser
Val Asp Gly Gly Lys Thr Trp 420 425 430 Leu Leu Ala Thr Leu Asp His
Pro Glu Glu Arg His Ser His Ala Pro 435 440 445 Ser Tyr Gly Arg Tyr
Tyr Cys Trp Cys Phe Trp Glu Tyr Thr Ile Asp 450 455 460 Lys Phe Ala
Leu Leu Asn Ala Ala Thr Ser Ser Gly Glu Leu Leu Val465 470 475 480
Arg Ala Trp Asp Glu Gly Asn Asn Thr Gln Pro Ala Lys Leu Thr Trp 485
490 495 Asn Leu Met Gly Met Gly Asn Asn Cys Tyr Phe Arg Val Thr Val
Ala 500 505 510 Pro Lys Gln Ser Ser Gly Glu Phe Val Leu Glu Phe Leu
His Pro Thr 515 520 525 Val Pro Gly Pro Ala Glu Gly Gly Trp Met Pro
Pro Pro Gln Glu Ser 530 535 540 Val Val Ala Ala Ala Ala Ala Ala Val
Val Ala Glu Thr Leu Lys Arg545 550 555 560 Ala Lys Asp Ala Pro Gln
Ile Asn Lys Met Asp Gln Glu Asp Thr Lys 565 570 575 Thr Tyr Thr Met
Glu Glu Val Ala Lys His Asp Thr Glu Glu Asp Ser 580 585 590 Trp Ile
Val Val His Asn Lys Val Tyr Asp Cys Thr Pro Phe Leu Lys 595 600 605
Asp His Pro Gly Gly Gly Ala Ser Ile Val Met Asn Ala Gly Ala Asp 610
615 620 Cys Thr Glu Glu Phe Asp Ala Ile His Ser Thr Lys Ala Lys Gly
Met625 630 635 640 Leu Asp Asp Tyr Tyr Ile Gly Glu Leu Ala Ile Glu
Asp Ile Glu Asp 645 650 655 Glu Pro Glu Gln Pro Ala Leu His Met Ser
Lys Ser Ser Val Gln Leu 660 665 670 Met Lys Asp Asp Phe Lys Glu Gln
Ser Val Arg Lys Ala Val Asp Asp 675 680 685 Glu Glu Ala Ala Pro Val
Ala Pro Val Ala Leu Asn Pro Lys Lys Trp 690 695 700 Val His Phe Pro
Leu Ile Gln Lys Glu Glu Leu Ser His Asp Thr Arg705 710 715 720 Arg
Phe Arg Phe Gly Leu Pro Thr Glu Gly His Arg Leu Gly Leu Pro 725 730
735 Val Gly Phe His Met Phe Leu Ala Ala Thr Ile Glu Gly Ser Met Val
740 745 750 Met Arg Ala Tyr Thr Pro Thr Ser Ser Asp Ala Gln Leu Gly
Tyr Phe 755 760 765 Asp Leu Val Ile Lys Val Tyr Phe Ala Asn Val His
Pro Lys Phe Pro 770 775 780 Gly Gly Gly Lys Leu Thr Gln Tyr Met Glu
Glu Met Ser Leu Gly Asp785 790 795 800 Glu Ile Arg Val Lys Asp Pro
Leu Gly His Ile Glu Tyr Arg Gly Arg 805 810 815 Gly Glu Met Thr Ile
Asp Gly Lys Pro Arg Thr Val Ser Ala Leu Thr 820 825 830 Gly Leu Met
Ala Gly Ser Gly Ile Thr Pro Phe Tyr Gln Ile Leu Gln 835 840 845 Ala
Val Met Ala Asp Pro Glu Asp Lys Thr Glu Leu Tyr Leu Ile Tyr 850 855
860 Ala Asn Gln Thr Pro Glu Asp Val Leu Leu Arg Ser Glu Leu Asp
Lys865 870 875 880 Met Ala Ala Glu Arg Asp Asn Ile His Val Trp Tyr
Thr Cys Asp Arg 885 890 895 Ala Pro Glu Asp Trp Gln Phe Asp Ile Gly
Phe Met Thr Glu Lys Met 900 905 910 Ile Lys Glu His Gly Ala Pro Ala
Gly Pro Asp Val Leu Gly Leu Ser 915 920 925 Cys Gly Pro Pro Pro Phe
Ile Lys Phe Ala Ala Thr Pro Ser Leu Thr 930 935 940 Lys Asn Gly Tyr
Ala Glu Glu Asp Gln Phe Leu Phe945 950 955 1326DNAPorphyra
yezoensis 13attgtggtgc acaacaaggt gtatga 261420DNAPorphyra
yezoensis 14tcggcttcca catgttcctg 201520DNAPorphyra perforata
15ccgtgtacct ccgcaactct 201620DNAPorphyra perforata 16gctgcacttt
gtgcgcaacc 201720DNAPorphyra perforata 17gcatgggacg agggcaacaa
201825DNAPorphyra perforata 18gcttgcccgt cggcttccac atgtt
251924DNAPorphyra perforata 19catcgaaggc tccatggtca tgcg
242025DNAPorphyra perforata 20ctacacgcca acgtcgtctg acgca
252121DNAPorphyra perforata 21catggaggct gcttctggtg c
212221DNAPorphyra perforata 22tcaacgagct gcttgtgggc a
212319DNAPorphyra yezoensis 23cccatcaccg cacagccga
192422DNAPorphyra yezoensis 24agagaggcgc cccttgcatg tt
22252164DNAZea mays 25ttcgttacca actgggttgc ataggatttc atgattaaga
gtgtgtttgg tttagctgtg 60agttttctcc tatgaaaaaa ctgttgtgag aaaaaatagt
tggaagtcgt ttagttcaaa 120ctgttgtgag ttatccactg taaacaaatt
gtatattgtt tatatacact ctgtttaaat 180atatctctta atcagtatat
ataattaaaa aactaatttc acatttgtgt tcctaatatt 240ttttacaaat
aaatcattgt ttaattccat ttgtaataag tttttattaa aattgctttt
300atttcattta ttataaacat ttaattgttt taatcctatt ttagttttaa
tttattgtat 360ctatttatta atataacgaa cttcgataag aaacaaaagc
aaggtcaagg tgttttttca 420aagtagttgt ggaaaagctg aacccctttt
attcaacttt tagaagcagg aaaacagaac 480caaacagacc ctaaaaatgt
gtgaattttt agcaggttaa ttattcgcat ctctttggtc 540atgtttaaga
ggctggaata gatcaactgc aagaacacat agcagagtgg ataggggggg
600ggggggggag ggtcgtcgtc tccctatctg acctctcttc tgcattggat
tgcctttttc 660ggtactctat ttaaaactta aaagtacaaa tgaggtgccg
gattgatgga gtgatatata 720agtttgatgt gtttttcaca taagtgacaa
gtattattga aagagaacat ttgcattgct 780actgtttgca tatgggaaaa
ttgagaattg tatcatgcca tggccgatca gttctttact 840tagctcgatg
taatgcacaa tgttgatagt atgtcgagga tctagcgatg taatggtgtt
900aggacacgtg gttagctact aatataaatg taaggtcatt cgatggtttt
tctattttca 960attacctagc attatctcat ttctaattgt gataacaaat
gcattagacc ataattctgt 1020aaatatgtac atttaagcac acagtctata
ttttaaaatt cttctttttg tgtggatatc 1080ccaacccaaa tccacctctc
tcttcaatcc gtgcatgttc accgctgcca agtgccaaca 1140acacatcgca
tcgtgcatat ctttgttggc ttgtgcacgg tcggcgccaa tggaggagac
1200acctgtacgg tgcccttggt agaacaacat ccttatccct atatgtatgg
tgcccttcgt 1260agaatgacac cccttatccc tacaatagcc atgtatgcat
accaagaatt aaatatactt 1320tttcttgaac cacaataatt tattatagcg
gcacttcttg ttcaggttga acacttattt 1380ggaacaataa aatgccgagt
tcctaaccac aggttcactt ttttttttcc ttatcctcct 1440aggaaactaa
attttaaaat cataaattta atttaaatgt taatggaaac aaaaaattat
1500ctacaaagac gactcttagc cacagccgcc tcactgcacc ctcaaccaca
tcctgcaaac 1560agacaccctc gccacatccc tccagattct tcactccgat
gcagcctact tgctaacaga 1620cgccctctcc acatcctgca aagcattcct
ccaaattctt gcgatccccc gaatccagca 1680ttaactgcta agggacgccc
tctccacatc ctgctaccca attagccaac ggaataacac 1740aagaaggcag
gtgagcagtg acaaagcacg tcaacagcac cgagccaagc caaaaaggag
1800caaggaggag caagcccaag ccgcagccgc agctctccag gtccccttgc
gattgccgcc 1860agcagtagca gacacccctc tccacatccc ctccggccgc
taacagcagc aagccaagcc 1920aaaaaggagc ctcagccgca gccggttccg
ttgcggttac cgccgatcac atgcccaagg 1980ccgcgccttt ccgaacgccg
agggccgccc gttcccgtgc acagccacac acacacccgc 2040ccgccaacga
ctccccatcc ctatttgaac ccacccgcgc actgcattga tcaccaatcg
2100catcgcagca gcacgagcag cacgccgtgc cgctccaacc atctcgcttc
cgtgcttagc 2160ttcc 2164263906DNAOryza sativa 26agaatctgaa
gacagtgctg aaaatggtgc tgaaatgttc tctaaaactg acatgactgg 60aaggaataac
atgaatcagg tgtctgcatc aagcttttca agcattgcac aaagatttct
120tgctaataca cttcagcgaa gaactcccaa atacactgat cttcctatgt
catctgttat 180agttaacact gatgcaaacg ggactgatga atctacccaa
atatcttctc tagcccccaa 240tgaaacaaca ttcgaggcat ctcaatttga
gaagaaaaca gaaaatgaca caaatggact 300gcccaaatcg tcactcttct
ctagtagcca ttactctgag aaatcatctc cgccgcttga 360gtacatgaaa
atatctttcc accctatgag tgcatttgaa atgtcaaaat tggacctaga
420tttctctgat gaaaatcttc atgagaatgc cgatgatatg atgttaccaa
cgtttcagtt 480acttccaggg tcttccgttc cacagcttgg tagtggttct
gaatcggaag atgatacttt 540tggcagatct tatagttatt cttcgtatga
tgatctaagt ccacggttat attcaaactc 600tgagttgtgg gatcaagaag
acgcaaatgg attggaggat catgatatgc ataacaatcc 660aaatcagata
ggatccttcg gagcaccaat ctctagcttt gtggaatttg agcagatgga
720cttatctggt gcgaagtcca ctgtatcact tacagatctt ggggatgata
atggacttgg 780cacgttagat tctcatcctg ctggagaact tcctaacttc
gatactttga tggctcatca 840aaatgaggcc ttcattccgc acaatccagt
aagtttatca ccagatgaag gtcagttgcc 900tccacctcct cctcttcccc
caatgcaatg gaggacaatg agacaagtag cttctgtaga 960agaaggaaga
ggttctgcag ctaaagaaga tatgcttgag agtacctcag atctaccacc
1020agtacacact cctgttcagg aagaacatct tctgcccatc gcaccaccag
atcaacaaaa 1080tcttctgccc atcgcaccac cagatcaaca agggcatgcg
aaggaggtag tatgtctcat 1140ctttaattga ctctattttg aataattctg
tatcaataat cactgtcttt tattaatgat 1200tcattaactt gacttatgca
gaatgacaga aaagttgatg gggtaaaaga gataagcaat 1260cctctcgaca
ttgagatcag agcaagcttg cttcagcaaa tcagggataa ggtttgcttc
1320attctttctt aaaaaaaaaa tctgttgttc tctattgttt catagttttg
ttactctttt 1380gtgttgaaac ctgagcaatt ttagaatttt tagttacgaa
cagatagcac cagagtatca 1440tgtgacaata tatcatggag gctctgtgcc
ttcttctttt gccaatacaa atattttttt 1500ttctgatggt tgttatttga
ttcttgaact tgaaagctag ttagcaaatt tttggcattc 1560aatactgata
tttttgttca ttttaataac ttgcagtcag gtcagcagaa gctgaatgga
1620catgaaaagt caaaagcagt aggcaatgat actaaaaact tggatgaaag
ggaggagttg 1680cttcaacaaa tcaggagcaa ggtatttcca ttatctgccc
tattgtactt gtgtagtata 1740atgctacctg acaggtcttt atgttaagtt
ttcttgatcc atgcctagtc gacagacttg 1800cagttgaaac acgatacact
agaacaccca cattgagggc ccatctctct caaccaaacc 1860ataaacacac
aataagaagg ctaaataact acttagtttg ttactatgct cgtatgatgc
1920atacagtcat ctcagaaaat aactgtagct agtttgctaa tatgttcaca
tgatgcagac 1980attcaattta agacgaacaa atgcatctaa gacaaacacc
tcatcaccaa ccactgccaa 2040ctccagcgtt gtagcaatct tggaaaaggc
aaatgcaatc cgccaggttt gtattgattc 2100tttttttccc cttgatgtta
gtttatgcgc tactttcctt acgttttccc tgattgtttc 2160catgctatca
ggctgtggcc agtgatgagg gaggtgatga tgatagttgg agtgatatat
2220gaatactcaa ctggaacgcg tatgaaactc tttttctgta tattcagcta
gtacaagatg 2280aagtgaaaaa atgtgaataa catccttttc ttcattgtaa
ttagattttc caggtctgtt 2340ttgtacctct ttttagttca cattagtgta
ttctctcata ggcccatgcg gttgtggaaa 2400tggttagatc attttcacat
tatgtaaatt aactttatta tttatttttg atagtgaaat 2460taactggtaa
aataagcatg ttaaactgtt ttttctagca atgtattgaa ataatatctc
2520tttgcattca taataatatg ggggtgtatc tgtgcaacag atttattttt
tcttcccccc 2580ccctaccctt ttgaagtatg ctgttgacct attgtccttc
ccctcaacaa aggcaataat 2640tctgaattgc aaatcattca cattactcta
tcagctttgt ttggttaaca gcattatctg 2700tgctatttac ttcatttgtt
atgttggacc tacggaaaaa tctggtagat acatacttag 2760ttgtgcaaac
ttactgcgta cctggtgtta tttgttaagt taaaaatgct gctaatcagt
2820ttaagtctag gttcttaagc tttgcttcca acttggtata atactattta
tgtttgtccc 2880ttcctgttct tattacaaac aagaaaggca gagtatggta
tgctttttta tcctttgcat 2940gagttgcaca acctgatcct agacaagcga
cttctcatct tgatcctgtg gtctcttact 3000actactgttt tgaacatggg
cagactatgc tacagttata tcacttgtcc atagtaaact 3060gctaagtgtt
ttccttcttt tattagatgt atagcatgca ataataatta gttcagtcac
3120caatttgtta cctcttagga tgcttctaat gccttttatt tttaacatga
gttgtgcttt 3180ctattttata tcattggatg ttcttaaatc tattactgtt
tgtaaacaag ctcttctacg 3240gcaatgcatt tttttatgcc acatatggta
tctatctgtc atcagattga cgtggtacac 3300aattcttgtg gtttgtggga
actgggaaat ggtcatttgc aattgttact aaagcaagtg 3360gccctatttg
caatattttg tttctcacgt tgcaaactgg gctagttgaa tataatttcc
3420ttctgcattt ttccaatgtg aattcctgaa gcaaattgtc ttcctctcct
attcgtttgt 3480tcccagtttt taacagattg ttcctcttac agtgccatgg
tctcatgggc aagattttgc 3540agccaggcct ctctatcggt ccaatgttct
accagctaca gaaaacgaaa gtctcagaat 3600cccagccatg aacccgttgt
gcagctcttc agccctccta agcgccagtt cctgaaagaa 3660aacaaaacaa
aagagccacc tggaacgtaa aatacttcca gggatgcaaa ggctgacttc
3720tcacaaatcc tcacagaaaa atgaaaagac agacaaaaca acacgcataa
gtctcgcaaa 3780ctgggataat tttcggcttc tcgccgtgcc acgggcgagc
cgacgagcag cgtgcgtcac 3840caccgtacgg cgagaattgt atggcacgca
cgggagggtt agccacagcg gagatgagac 3900atcagc
3906273510DNAArabidopsis thaliana 27cgccagatca tacatgctgt
aaagaaaaga tgtccagata cgccgatagt tttctacatc 60aatggaaatg gtggccttct
tgagcgaatg aaaggaactg gagctgatgt tattggactt 120gactggactg
tagatatggc tgatggaagg aggcgattgg gaagcgaggt aagtgtgcag
180ggaaatgttg atccagctta cctattctct ccgcttcctg ctttgaccga
agaaattgaa 240aggtaggtca ctttgttcag ctgaataaaa aagtagtgct
tataattcaa attaagaaac 300tgaaagaaat gtatgttttg tgtcagagtt
gtgaagtgtg ctggaccaaa agggcatatt 360ctcaatctag gacacggtgt
cttggtaggg acaccagagg aagccgtggc tcatttcttt 420gaaaccgcta
gaaacttgga ttaccaaaca cttttccaaa atcatgttcc tgcagaaaaa
480gctgaacctg aattggttgt ctgagaaatg gtgactagac aagtgcctac
gccgaagaat 540ttgctgttta agttttgtga acatatgtct gaatctctta
aacttggtgc aggaatgaga 600gaaaaagttc catgtctgac ccttaatcga
tgctagagtt ggtaacttgc tatgagatat 660atgcgaagct gtccagtttt
tgtttggctt gcttgaggat ttccaatctt ctggaccaag 720ctctgcttaa
cgtttaacaa tgtattgagt tgctcctagg cttcaaatgt tgctgcttct
780tttggagata tgactctggt taaagtttaa ccaaacattc atttatctgg
ttaatctcaa 840acctttgcta tgtttgttat cccacttttt tcatatggtt
ctttctagat ctctgtatct 900ggtgtgtctt ctctcgtgat ctcaacattc
gatgtgaaac caggtagatt gtaatattgt 960atcatagact gcaaaagata
acgcaaaaga gaagtctctg atctcaacct gaatcagact 1020tgttaggagt
ccctcttgtt tggtttaatt caattttccg gttcggattt ctggattata
1080aaccgaatta actacaaacg gaaaaacgta ccgcgttatt gcggtaacca
gcaactttaa 1140ttggcctata gtagaatcaa atgaaaagaa aagagcaatt
tttttttttt ttttttggtt 1200ttttggttaa agaagaaaag agcaaattgg
aaaaacaaat agataagata atttatatga 1260tttaaaagtc aaatgtaatc
acaacatata aattttaact tataaaatat agtcacacca 1320ttgcctcatc
gtatttgctt tcatgaatca tcccaccact tgtaagcttt attttattaa
1380gaatgaaaac ggagaaatat aaattgaaca ctatatacta ttgtcgtcac
cctccccgaa 1440tgtttctgat aaataatgtt aactatcatc taatacgtca
accggattat caccgacact 1500gaccccacac ctaaccactg atgcacaagt
ttatattagt gtaggtatca tccacaatat 1560attatccaat aattgaacct
tgttaatgtc tttggttcat aaagcgatct ataatcaatt 1620cagcattatt
gctaaaattc aaattaagaa gacggcatga tttgttaaaa ccataaagaa
1680atacaaaagg gtcaatgata aaactgttta aacgaatcag tctacccaag
agccgtctct 1740cgaatactag ttttaaattc ataagcgtat agagtttagt
gattccagaa cactttacag 1800gccaaaatct aatatttcga tattttgaaa
cgacattttt agtcctataa ttaaatttgc 1860aacgtattag attactttta
aaatgtgata ctgcgaagaa aatgaatcaa aagattgaat 1920cgaatattcg
aacagacgga caagaaccca cgaagcgata cagatcagaa actctgcttc
1980tttttttaac aagagatcac aaacttggtt gacttgagtt catattataa
tgacgtactc 2040agtgattcga atattccata aatagtcgta agaataaaga
ccttaatgta tacattgttc 2100atttcgtatg ccacattgac gaagatcact
gatataaatt tcaattatat aaatgtaaaa 2160taacaaaaca aaaagttaca
tgttatcaaa tagtgtcatt agctaaataa catgttactt 2220ggccaccaca
tcacttttgt tgagaaattt ctaaaatttg gctatttagt gcatataccc
2280tttaaaactt gttgtaaaag caaggaagag gaaaaaagat tgaacctata
gcaaaggaaa 2340aagaaaagag agtacatatt cttaagtctt gattacaata
ttttgttctt caacatattc 2400tcttagagtt gagataacat aaattataat
atagatgctc tattgggtag cagtagatag 2460aagaacatat gctgaaaatc
atttttatag atctagcaaa tcacctttat aaaggatcca 2520gatttttttt
tttttaactt tttgaaagtc aacttgatca tatgtgaaag ttagagtcag
2580agatttatgc atcttcgtgc atagacaaaa tgcatgcacg agctcacacg
atcctgtttt 2640tttttcttaa tgaggtaatt ttcttgctgt catttttttt
tctaaagtta agattcatat 2700aaaaaccata tcaggtaatt ccttaatttt
gtgtaataat taagaaatca ggatcattag 2760atctttgacc accaaaactc
aaatttgttc ccaaatacac tcagttaaag tactatcttt 2820aatcatttca
tattcgttac tttgtaaatt agtacaaagt aagtaacaaa ttttagttta
2880cccaatgaaa tggaatgaag ttaatgaaaa tattcgttct tttagaatat
tcttctgctc 2940ttgacagtgt ttaattattt aattttctta cttgaaaaaa
taaaattgac caacaattat 3000ttttcttacc tcatgtagat aacttacaaa
ataaaacata tatatatgta tatatatatt 3060tattttcaac tcagaaataa
ataattctaa cgaaaaaata tgaaataata aaaaaatctg 3120acttaaaaag
cgcgcatcgc tcatgccaac acactccctc gtctataaat acttcactct
3180gctttcctca atcacatcca tctctgaatc tgattccaca tcttaaaccc
ttattcccta 3240aacatcgaat ttggttcctt ctcccacaat ccgcagagat
ttcttctttt caggtttgtc 3300aattcatttt ttttttcagt ttgagttttg
ttttgttttt tcgtgatttt cggtcagtct 3360accaaatccc ctgtttttcc
ggcgattcag ttgtcaacag attttgcttt tctttttccc 3420tttttgtgta
aaaaaactca tttccttttt gatctgatga ttacagaaga agtaagaggg
3480tggcgaagaa gatttgattg atcggcgata 3510282997DNAArabidopsis
thaliana 28taagtatacc catgtggttt tcttttattt ttgaatagaa tttgggactt
cacattcctt 60caaagtagga cttcaatggt tttttggaaa catgacttat ttgcaaaata
tatacaaaaa 120caatgaatag caagactttt ttctttttgt cagcaatgaa
tagcaagact taagtaacat 180atttttaatt tttggcttat acacaagaaa
aaagtcgcat atttttggtt tggaacttga 240gccggttcga tgtctgacaa
gtcgatttga aaaacttctt tataattttt tacttttcgg 300ttttatattc
ttttgtattt tacaactgga tcttgtttat atatatcaat atatgtgaaa
360tgagcgtact agtactatta ttggtgtgga atactttcgc atgccctagt
cttaactctt 420aaggataagt aagggcaggt ttctctttgt tttccaaatt
tatcgttcaa tatttcttaa 480attaggatat aatgtacaat taatcgttca
tttcttttaa ttagaaccgt agtttgtaca 540catcactaca tagccacact
atagtaatta agtgaagcct catcagaaaa ggaaaacgat 600ctatagatga
aaaagttaaa tacccaagag aagtgatttt cagttaaaag tatagttttt
660gctaaaaata tttataacgg cattaatcac gatactcgcg taagtagtat
actctaccat 720atactatctt ttagtgagtc ggaaatatgt cataagccat
tacgcgacca tgcaatattg 780cttccgtaag catccgcact agtaaagtgt
ccaaatggat gccgtcaaaa caacaaaagt 840gttttaaaaa agaaccgaaa
caagttttca cacttggtcc ttagcttctc aaactcttct 900tcgtcctgat
aatggacttt aattatcatg ttatacgtca accaagttat cagctaacca
960tcatcacttt attaagtata tgcagccttg tgctcataat attcattata
ttatactaaa 1020agtctaatca tatgaagaaa ggaaaaaaaa aaaaagaggc
ttgtttatga aattaaggag 1080tgcacgtaag gccatattta taattctatt
tcagaaaatg taaattcaaa cacggcaaat 1140atgttagttt catggtgcat
gcatgatgca tttccaactg tttctttttt tggggatgaa 1200aatgtatttc
caccggttaa ttaacgaagc ttctatttca tgtttccgtt ttcttttact
1260tttttttttt gtttttactt catatatatc atttgacaaa gttaaggctt
taaaatggca 1320gtagtttctt aatttgtttt tagattttgg atttatggtg
tttagttctt agtttttttt 1380tgcagtaaat ttttagtttt atataaatgt
atgtacccaa tacatatcac tatatatttt 1440atagtccaaa agaattttat
gtgatggtga aaagaaaaaa atgtgtgatc attcgctgaa 1500attaataaat
tttgcagtat attaaagaaa actagaaaag tgagtaccta atattccaac
1560aattagactg tatcactcat gcctgtcgtc tgtcgactgt tgacttgtgt
tataataaag 1620acatttcaaa ttatccgaat attccattag cacatatgaa
gatatccaat ttttgaataa 1680ttggagtcga ccaatgtaaa atattcataa
cgtgacatca catcacatac atgtacgact 1740ttgtcactta ccaaaaatga
tctagttatg ataataacat catcacatga gtaagaatga 1800taaggcatga
tctaatcagc atcatatacc gctactttat ttactatcac attttcgttc
1860acaagagtaa tattatattt gattttatat atgtctaaaa atttatcgta
gactgccgat 1920tttagatttt gggaggttag aagaactaat aaaaccgaaa
gaaatagatg atggtcggtt 1980aaatacttaa gtcctttata agaaagaaaa
attaaaagtc aactttatcg ctgaaagtga 2040aagttaggtt gaaagttcag
agatttattc atcaacttcc gtgcattgac acatgctctt 2100ctctacattc
gctcacgtga attttagaac aacaaattat tttacaaaca ctataatctt
2160ccggtaattt aaccacaata aagagataaa taatctttat attaaatcga
tcgaattcta 2220attctgtagg tactgtgagt caaacatgaa agtgtaaatt
ttcaaaatat gattggtgtt 2280aacttaggtg aatcaatttt tgatgttttt
ttgttgatta tataaatcaa aattacggaa 2340gaatgcatgt tgtttacata
agtgatataa ttaatttttt actgatatat taaaaataaa 2400aatattttat
gttattgttt tggttatttt tttgttccac aaaaattaat taatcataat
2460atttctttct tgactatcac tagattcaat gaaaatctct cttttataca
taaataaaaa 2520tcttctcaat gcattaataa atatatataa attgaggaaa
aaaagagata gaaatcatgg 2580aaaaaaaggt taaaaattcc aactataagc
gagcatcaca tatagaaata gaataatgta 2640taggaatcca tcatgatctc
actctctata tataggtaag ccaagtatct tatttttggt 2700tatgtatctc
tgaaatctga atctgactga cttcaaagga cacagctttt acttctataa
2760ctggttagct tctccacaca cacacacact tgttagattt acttttcctc
cgcactatca 2820gcagattttt ctcatctggg tctgtttgtt tctgttgact
caaagtttcc gactttctta 2880ttttctgtct ccgatttcat cgccgaaatc
tcagtcaatt ttgtctttag atctttaatt 2940tttggatccc tttaattatt
ttgtttggtc ttacttcaga gcgaagcagg tgaaaaa 2997293367DNAArabidopsis
thaliana 29aaactaaaag aatttaaaac tgatgtcaat atcttatctg ccatattcgg
accttactta 60catccgatcc cactgattta ctaacccaaa tcagattttg atattgggct
gtgattgcgt 120cacatttata tgggctaata tgatatgagc ccaggactat
ctcgctcagg atttattgtg 180tttgactttt caagttctcg tattcgaccc
ccttccccca ccttaaaacg ctccgtttca 240ctttcagttt cattttctat
gactatttat ttattgaaat atattatgat ctctgcatag 300acatatatag
acctcgacgt atctctctct ctctctcggt aacttggacc actcgaaatt
360gagttttgaa gcacggataa cgtttggttt gaccttttgg gtttgtcata
ggtcgtttta 420tttggtcggt acactcgtaa tctctaaaca aaaatatatc
actttagtca caccttttta 480tttggggtca ttgtgcatgt gtgtaataat
aagtgaatac tgaatcatca ttctagtctc 540taatacatca tatacaacta
cataatagtt aactaaatgc taactcgtgt gcgtaaatta 600ctgtattact
atagtgttac tgttatgcat ttttgtctga gacgatgcaa atcttgatca
660tatactatat acagggtaat tttagcatgc acaagtttat atttgcatat
aaatatccga 720agaatatccg tagaacagtt agaatatatt cccactagcc
accactatct caaatttcat 780tttcagatct aaagttatgc ttttattgtt
tcttttctat ataactcaat catataccat 840taatatcaaa catcacccat
cacataagtt acgaatgtcc atttccgcac cggacttaac 900ttgtttggag
aaaatgtaat atcactcatg gcaataatca accatgtatg cacattgatt
960aaaatgtgtt ttcccgatgg agagcaaata tatcttattc gagtgatcaa
gttcataaag 1020agctcgaatt agttatgctt ttattcaaag tagagcaatt
tcataaaact ataatatatc 1080ttaactgtaa taacagatca gctggctaaa
tactatgatg ctactactga agatgagatt 1140gcaaaacata aaacttgtgg
cttgatgagt tcatatagaa gatataataa ttatgcaaac 1200caaaatatgt
atacgtacga atcttctttt accatacgga tcgtcgtcgg atactgcttg
1260tctttttctc tgtttttttc tcctaaatat cacatatata ttcaatgtga
gaaagtatga 1320gaaacaggac aaaatataga tattggttcg taaagttttt
agtggctaga gttaaataag 1380gaattaaatg agagcaaatc tctttgatat
acacctcata tcaatgaaaa aacttaatat 1440tggtgtattt gtttctttcg
tccgactctt gaagaattaa aaggttatat acaaaaaaaa 1500atttgccctt
tcacattttc taaagatcat atcatctttg atataatcgt ttgatgcatg
1560tttactcatt cataaacatt ttataaaatc ttctatatta ttttgattcg
aaatttcaca 1620ctcaaaacat aaaatttcca aggataacca atgaaatgaa
tacacaagat ataatataag 1680ttatcaccat aaattacata atcagtatag
ataaagaaaa tgttctgaat accaatttag 1740tttataaatt tatttttttc
gtttatgatt tatcaatggt tcagttgagt ggtttttaat 1800taaaaaaata
atattttgtt caacaaaaat tcagaacgat ggttggaaaa aataaattaa
1860aacaatgcgt atattggatt aaaaataaat catattatat gattctattt
gtccgggatt 1920tataaattga tatgatacga taaggtcagt gataaaataa
attgataaga taaggacttt 1980atatgattct atttccaccc gttggaatct
ttggttggct atttattctt agattcgaga 2040atcaattagc gaaaacaaat
actagtttaa aaaagaaaaa aactatatga taagagaccg 2100taatagacgt
ggtacgtttt aagtcaaagg tcaaaaagcc gaattatata tttctggctc
2160cttccacaac ttttggaaaa tttccttcgt agttttcact tgaacccatt
ttttaacaac 2220aattcttcta cttggattga taattcaaaa ggaaactaac
tctcccatag ttaaaactga 2280atcactgtta aaaaaaaaaa aaagtaaagt
aaatatacta aatcaatgtt tttttctctg 2340gaagtaaata tacaagttta
aaattaaagg agaagagaag ctatatattg ctttgcctca 2400ccatttagga
gataattcat atgaagcaaa gaaagcatat cctttggcat attcgataat
2460atatggcatc taatcatctg tataagcttt tcatattttt gttagatgct
ttttcgtaca 2520aatgcattaa gataaaatta aacaaaaaaa caagatatga
tattcagttt cgtgaaatat 2580taaaagaagt caaaaaaagg gaaaaatgaa
aagtcgaatt ggtggacagt ggactcattg 2640gtccacttaa aagtcatcag
aaccgtacac atgcaagctt ggtccatttt cgtatgacga 2700cgtacaagtt
acaacattca aaaaacttcc taatttacaa gtttttgctt atgtttatgg
2760gaaatatttt tctgcaacga aaaatcatta agactatatt tttctgttgg
caaagacttg 2820actcagtccc tttttactgc ccattagtaa tctttggagt
gaaaatacga atttaactaa 2880ttttctaaaa tttgattaaa gtctaagaga
gaaaaaaaga tttcggctat aaataagtta 2940caactacaca tcgaatggac
tagaaaattt tcgcttctta tattttttta aaaagaaaaa 3000ccaaaaaatc
ctttgaaact tttttagcct gtcgcttctc tttccatcgt cttcctcgtg
3060aacgaaactt ctcgatcttc ttttcttttt tttcacctgt ttttcggtat
cacgagaata 3120ctacacttcc cactccagta atacgccact ccttcttttt
ttttttgtct cgtttaaatt 3180tttataaact ccataatttt atcttaaagt
gaatcttttt tgtttttttt gttccagctt 3240tatcggatat atttccttga
ttttctccga ttgtggtcaa tctggaaaat tattgagaat 3300ctctccctca
cttaaccaaa agcgttttta atcagataga gagagaggaa aaagcatcaa 3360ccaaacc
3367301353DNAZea maysmisc_feature585n = A,T,C or G 30gtgccttatg
cctgtgtatg cttttgatcc agatatgaga aaagcattat cacaagatgt 60tgagaagaag
tccatcatac cactcaagag gccaattacg cctgatgaac ttgaatatga
120ttgatgttag ctacctggtg cttacgttgg atgctccggt ggggaatttg
acaggctttg 180aaaatctggt agtgagtgta ttgttgtcgt ttttacgcct
gctaggggac aggttttgat 240ggtgaattct gcagtttttg tatttgagaa
tagcaagaac tatgacttgg catggaatca 300aattgctttg ttgtgatgtc
gtatttatcc gtcgctgttt gctctgtagt gtgtttttat 360acagcttgca
taatatataa gttatattcg acccgtgcta agcggtgata ggtagaattt
420aacctactgg caattcagtg cctgagatca tgaatggcac cgtgagcttg
tcaatcaaat 480gataagtgac catcactcat gactcatcgc ccttccacat
gttgtgggcg cgcatagggt 540aatagatcgt gatttaaatg gttcttcata
aaatgtcaag gtccnaaata aattatagtt 600caaaaatgat tagaaataga
gtctaattct aatccaattc gatccttaaa tattatagtg 660taaaatttat
agcccattat tagccctagg cgcgcatgca agtgacctca ttccgaaaaa
720cattactctg cacaatggtg gtaaagtaga agggtgaggc agaggagacc
aaacagggaa 780aatgaggtga aaatcaacac tgattcaagc agcaatacac
ggtgcaacag gtcatgtgct 840tgatatgctg gttctcaggt gcgggaaggc
tgccggtgcc agagttaaat gtatgttaag 900gtcttaggaa ttttcaaaaa
aaaaaaaaaa gttggaccgg cgaggttaat gtgcagactt 960aggtcattga
aacaatgaat agtttcagta cattgtttct aaggttgtca aacagaaggc
1020tatttatata aaactctcat atctctcctc tgtcaccccg tttgcttagg
tgatatgtca 1080tttaataaaa atgaaactcc cactatgaat ggccttagga
gttaggacat caaaaggttc 1140attcagaatt aaaaatgtcg gggtatcgga
tgcttcaact tatttggata cttgaatttc 1200aaacaaattc aaaaattcag
agcattcggt gtttcttttg cttcaaaatt cttgcccatt 1260tttggtctgt
caagtttttg aaatgagatg tttagattag ttggccagta aaaataacaa
1320atgcaaaagg cattttatgg agagatgcag cta 135331795DNAGlycine max
31ggtgatcact ggtccgtaca tttcgatttt ttcacttttg tactgtaaaa tcagtctaaa
60gtgacgagga ttcgaaatga aacaagttgg agaaaatata aaaagcgaaa tgcaggaaaa
120caaaaaatga tagccattaa ttttaaaata agttaatctc acgatttaaa
tgtttacttt 180tgtaccattt caaattttgt cactttagta tcttaaaatg
ggtctaaagt gacgatggtc 240ggaaatgaaa gaaggttttg tagtaggact
ttacttctac tcttttttca caactttctc 300tctctttatt tttttcttta
atttattgga tacgtgtctc ctttttttcc tatataatga 360cactctctgc
agtgctttgg atctgtgact ctagtacttc tctctctctc tgtcattggt
420ttttctctgg ttgacatcat cgtcatctac tacttcttcc tcttatccaa
ttggccccca 480acactggtac tacattagat ccttatgatt gatccatcat
ggttttgtca taaaaaagtt 540acaattgttt tccctttaat tctatacatg
ctgtgtttat aggcactttg ttgttttgcc 600ttctctactt tgtgtcttcc
aaccatacag ttttcattgt caatgtctcc attgtagatg 660atgttgtttt
gattttccta tgttcaagtt ttgtttttct ttttttgttt ttttatgtgg
720gttttggttg ttttcggatc ttttggtgtg accctttcga tgttggcagg
ttttggggta 780ctttgaaaag ttgca 79532761DNAGlycine max 32ccttgtctaa
gttccttaac taattaatgg gtaggagctg atgactagtg ttttcgggtt 60caatcgacat
gtggtcgggc tttgatcagt caagtgtgag ggatgtttta ggaatttaga
120cactggagaa tagtgatata ctacaaactt gaaaagaata tttaggtgat
ccatgtatgg 180aaatagaatg atattgttaa cctgatgtga gagatctatg
ttggtaatgc aaattattca 240atataactat taggagcgtt gttaagtgat
ttagactctc tcactcgagg gatcgtgagt 300agagtaggtt agtaaacgtg
gataataatc atgtttatgt taaaaagaaa aaaratctat 360tataattaca
ttaagagtta gttttgacaa gcggagctta acacgtttca taattcattt
420atttttttat tccttcaagt ttcttgtctt gtagttaatt tacattaatt
tatattaatt 480aataaaccag agatttaagt tagatatata taactctaaa
tataaataaa gttggtagac 540tccatacttt tttagtttta ttattactta
ttggtaggtt tgcgaaagag ttaaggatta 600tcaacctcat tttttttttt
acactctgcc tcactcaccc tctataaatt gaatgtctga 660caagtccttt
ttttcttcac atgacatctc tctttctttc cattctccgt gatctcaggc
720gctagctagt tatcagttat
tattgttgtc gttgaaggtt g 761332008DNASorghum bicolor 33atagtctttt
cctttaatct catccttttg tttttgagat gtctaattga tggagtgaca 60gattagtttg
ctgctttgct catacgtgac aacgaactac tgttagaata gaacattttg
120cagtgctaat atttgcatat gggaattaat taatttggga attatgtctt
gccatggctg 180atccagatct cgacacctgc tcgatctaat gcacacatgc
gtgttgatag ggatgtagag 240atataaggcg ttaggagatg tggtgtggta
gtatatgcaa ggtcaaaatt cgatgctttt 300tccatgtttc tttgaaaacg
caatgccgca tttttcttta aagtaagaat tgaggggtcc 360catgtttctt
tttgcacttt ttcacatcga tgtataactg aaaatctcat gaaacatcat
420tacctcttta tatgcgtcat catcttttca acaaaactca ctgatagcat
tgatgcactt 480acactcatac gtgacaacta ctgctattga aagtggacat
ttgcagtgct actttttgca 540tatatgggaa attgggaatt ctatattgcc
atggttgatc cagatctcga cctactcgac 600taatacatgt tgacagcaag
ctgaggatcg ggacatgtaa taaggagtta ggagatgtgg 660tgtggtacta
aatgcaaggt caaaattcga tgctttttcc gtgctcaact attaactagt
720actcattatt acctaatttt cacttgtgat gacaattaat gcatcgatcc
acaattcagt 780aaatactttc atttaagcat atgtatagta ttatacattt
ccaattcttc ttttttgtgt 840ggagatccac gacgatgcaa gttgctcctc
ccaacccaaa tccacctctc tcttaaatcc 900gcatatcttc accaccacca
gctgctacac atcgtattgt ccaaatctgt gtcggcttga 960cccagtgatg
tgcgcgctag atttggcagc gcctgaatgc tgtgcagcca cctgtatggt
1020gcccttggta gagtaacaac acccttatcc ctacggcagc catgtatgac
ccttatccct 1080acggcagcca tgtataccaa tacctttctt tgaaccacaa
aattatagtc catatcctta 1140accacaagtt cattttttgt ttcccggtct
cctaaggaaa ttaagttctg tttccacaat 1200ttacatggat ataggacatc
tatgttccta acattaacat tactggataa caggcaccct 1260ctcctccaca
ccctgcaaag ccttcctcca gcgccatgca tcctccgttg ctaacagaca
1320cctctctcca catcgcgtgc aagcaaacct ccaaattcta ccgatcccca
gaatccggcc 1380ttgactgcaa acagacaccc ctctccccat cctgcaaacc
catcagccaa ccgaataaca 1440caagaaggca ggtgagcagt gacaaagcac
gtcaacagca gcaaagccaa gccaaaaacg 1500atccaggagc aaggtgcggc
cgcagctctc ccggtcccct ttgcggttac cactagctaa 1560gaatgaagat
ggtactctaa atggatactt gcgcggtttt tctctagtct aacttaataa
1620actaaataaa caatttcttt cttatttttt taatttagtt cgtttagtta
gactagagaa 1680gaaccacgag gagttatttg aagcgtcgtc cccatcctta
ccactagcta gcactagcag 1740acacccctct ccacgtcctg caaacaggca
attagccagc ggaataacac aagcaggcaa 1800gtgcgcagtg acaaagtacg
tccacagcag cgatcccagc caaaagcagc gtagccacag 1860ccgcgcgcag
ctctcggcta cccttaccgc cgatcacatg catgcctttc caatcccgcg
1920tgcacacgcc gaccacacac tcgccaactc cccatcccta tttgaagcca
ccggccggcg 1980ccctgcattg atcaatcaac tcgcagca 2008343188DNASorghum
bicolor 34cctccgcatt agtggattct aaaacctctt tttttttcat gaaattctat
cacggcctag 60tactagtagt cccctcctct tgagaatacc gagagtataa gcattggttg
gggttcaatt 120tgtttagttc gaatgattga tgagaagctt tatttattta
tttactggag atgacaacca 180aatgttgggg caggatacag aaaagaaaaa
caacactctc tttggacggt gccagcttca 240acggccgacc aaaataatac
tactacactt ctagtgcgtg ctgactttga tgaggtgtcc 300caaatagagt
acgtagatga ataggagtat ttgtttcttt ggggggttcc ttttcagaaa
360gccttttctt attcgtccat gtcacggaga ccaaataaaa ttgggtgggc
gtgacaattg 420gcgtcagctt gacacgatag tccaccagag gcggcaatca
gaggccgtgc caaaaagaaa 480tttcatcatc aaggaaattc aagtttctcg
ttccaccaca ttccacgcag tgcaagactc 540cattaatcca aactactgta
gctactagct attcgtccca tcatcttttc ttagatattt 600atttatttac
tttttctata agcaaagttt cttagacaaa atcagtccca acttgactaa
660cgtaggaata taattcgtaa ggtcggagca aaataattct gctcgatgta
atcataccta 720cacgtacatg tggcggcaat cgttgcttga gaaaaaacaa
atacctaact gttttgcaat 780agcagcaatc atttaggttc aaaaaggaaa
tgataataca acggttacat taccccatag 840acaaaatttt ccttatagtt
gttgcaaatt acgatgcgtg agcctctgat taaaaggtaa 900agtattgata
acaaattcat gggtgggagt tagcgcatac gtacaacacc actagtcaag
960cactaatttg tactactaac tcctcaaatt ttaaagcaga taaaacttat
gaaaatcaag 1020agaagtgaaa tgaaaattga cgaattataa ccccatgacc
atttttctct acgtcatcat 1080caaatgacat ttgcatgact ttatcttgat
ttacgatgtg aacaaaccag gaaaatgaga 1140aagaagaaat tgaccaagca
tgtcataata ttcatttttt tctataattt ttcaacagag 1200tctgactttt
gcatggcttt ccttgaagtt gcataaagag atgatcatgc aaaagttgga
1260ctgttgttat tggccaagcc ttttttttcc tttgctttga ccatcaagaa
tagataatcc 1320ctttcctatt acctttggtc tacagtaatg atccataaca
cactatgaac aaaacacaag 1380caagtactga ttttcaagaa attgaaaaat
gattagatga ccttccagag ccctattgaa 1440aaataagcaa gttggaaagg
gagtgggact gagaatatta caatagctac attcttggca 1500gtctcgatag
acaagtgtca catagcattt tattccaaga ctatgtacaa gtatgttgta
1560gaacaaaggg actattgttt aagatagcat atttcataaa tatttgtttt
gaatagaatg 1620ttttcaaaga tatgattcat cgaagtggca tattggaggt
cttatctatt ttcttgtcga 1680ttaataaggg tgcatttagt agggtccttt
ctattttctt gttcacttta caataaatca 1740accaacagta atttcaacca
tgattttagc cagcagtgtt tttcttccca tgtgattaat 1800caaaactcct
ttgtaatatc atttgattag tagactgaat tttggtccac atgaagatat
1860atatatatat atattaaaag tcatataaat aaaaatatgc ttaaaaatta
taaacctttt 1920gtgggtgaag aataatttaa atacaaccca ttttagtttg
ttgtaataaa aaaggattac 1980aaatgaaaaa aaaattaaaa ttggtagctt
gcaagtgcat caaagaatcc agatcagttt 2040tgtgtggaac gaacgtgtcc
taatttctaa ctttgctgaa gaaaacgcag aactgaaacg 2100ttttggatct
agacagaacg acgtttagag ccatttttct agtgattcat gtgagaaatg
2160aacctgattc tcacacatcc aaacggccca caagtatact gcttcgactt
ttttttttca 2220tgagaatgag atgcacgaca atgcacacat cacgcctcac
gcggcactct gatgtcccaa 2280cattcctaat taaagtattc cggtgatgca
atggatggaa gtaaactgaa aaactagatt 2340ggtgtctaat aataatatac
tcctactaaa gactagagat atattcatag atttaaatcc 2400cttacttaca
aagggtcgca caacttgtgt ttagttgaag gagttctcta aaatttgtat
2460ggacaatagg tacacaaatt tttattatct tagaccttgt ttagttcaaa
aaaattttca 2520aggttctctc acgtcaaatc tttggacgca tgcatgaagc
attaaataca gataaaaaat 2580aactaattgc atagtttatc tctaatttgc
aagacaaatc ttttaggctt aattagtcta 2640tggttggaca ataattgtca
atactccctc cgtataggat ttagaatttg tttaggacag 2700cgacacggtc
tccaaaatac aactttaacc tcttattttt tataaaaata tttagaaaaa
2760tgatatatgt atacttttat aaaagtattt ttcaagacaa atctattcat
gtaactttta 2820tatttacaaa ctcaataatt taagagttat taatgattta
tattccaata tttgacacaa 2880actttgtcca aaacgacttc taaatcctat
acgaaaagtg tacaatagtc aaattttaaa 2940aaaaattcag gaactaacaa
agcctccaaa actactagta caacttcaaa taatccccaa 3000gttcacgggg
atcaatctgc aaaagtagga gtacttgtac ttggcatgat gagtcatggg
3060catgagggag acccacggtt gagcaacata aaattctcca aacgggcccc
accaccacac 3120acgatcacca tcacccccgg gctccccgtc cccccgtaca
aataggcacg gcacactccc 3180aactcccc 3188
* * * * *