Cosmid Vector for Transforming Plant and Use Thereof

Abstract

The present invention provides novel cosmid vectors for plant transformation. The cosmid vectors have a full length of 15 kb or less and contain: 1) an origin of replication of an IncP plasmid, but not any origin of replication of other plasmid groups; 2) the trfA1 gene of an IncP plasmid; 3) an oriT of an IncP plasmid; 4) the incC1 gene of an IncP plasmid; 5) a cos site of lambda phage, which is located outside the T-DNA; 6) a drug resistance gene expressed in E. coli and a bacterium of Agrobacterium; 7) a T-DNA right border sequence of a bacterium of Agrobacterium; 8) a T-DNA left border sequence of a bacterium of Agrobacterium; 9) a selectable marker gene for plant transformation located between 7) and 8) and expressed in a plant; and 10) restriction endonuclease recognition site(s) located between 7) and 8) for cloning a foreign gene.

Description

[0001] This application is a Divisional of co-pending application Ser. No. 12/306,163 filed on Mar. 16, 2009 and for which priority is claimed under 35 U.S.C. .sctn.120. application Ser. No. 12/306,163 is the national phase of PCT International Application No. PCT/JP2007/062720 filed on Jun. 25, 2007 under 35U.S.C. .sctn.371. PCT International Application No. PCT/JP2007/062720 claims the benefit of priority of PCT/JP2006/312633 filed on Jun. 23, 2006. The entire contents of each of the above-identified applications are hereby incorporated by reference.

TECHNICAL FIELD

[0002] The present invention relates to novel cosmid vectors for transforming plant and use thereof.

BACKGROUND ART

[0003] Various vectors have been previously developed for the purpose of plant transformation.

[0004] Recently, the entire genome sequences of Arabidopsis thaliana and rice (Oryza sativa) were elucidated, which moved the focus of plant genome studies from the accumulation of nucleotide sequence information to the elucidation of gene functions. For the elucidation of gene functions, experiments are absolutely necessary in which cloned DNA is transferred into a plant to analyze changes in the phenotype. If large DNA could be transferred in this operation, the study efficiency would be dramatically improved.

[0005] Thus, a number of vectors intended to transfer large DNA fragments into plants were developed. As typical examples, cosmid vectors for plant transformation were prepared, such as pOCA18 (Olszewski et al., 1988, Nucleic Acids Res. 16: 10765-10782) and pLZO3 (Lazo et al., 1991, Bio/Technology 9: 963-967). The use of a cosmid has the advantage that a lambda phage packaging reaction can be used, which allows easy cloning of relatively large genomic fragments (Sambrook J. and Russell D. W. 2001. Molecular Cloning, A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA.). In cloning with a cosmid vector and a packaging reaction, the total size of the vector and the insert fragment is 40 kb-50 kb so that the size of the insert fragment is restricted within a certain range by the size of the vector and the sizes of the vector and the insert fragment inversely correlate with each other.

[0006] Vectors such as pOCA18 and pLZO3 contain elements for plant transformation such as T-DNA border sequences and a selectable marker (kanamycin resistance gene) in pRK290 (Ditta et al., 1980, Proc. Natl. Acad. Sci. USA 77: 7347-7351) which is a typical vector having an origin of replication (oriV) of an IncP plasmid that is functional in both E. coli and Agrobacterium. These vectors per se had a size of 24.3-30.1 kb, and therefore, the size of DNA that can be cloned using a packaging reaction was about 20 kb (pOCA18), or about 13-22 kb (pLZO3) on average. These vectors have an origin of replication (oriV) of an IncP plasmid, but other vectors such as pCIT103 and pCIT104 (Ma et al. 1992 Gene 117: 161-167) have an origin of replication from ColE1 in addition to an origin of replication (oriV) of an IncP plasmid. On the other hand, pC22 (Simoens et al. 1986 Nucleic Acids Res 14: 8073-8090) is a vector having an origin of replication from ColE1 and an origin of replication from an Ri plasmid. Other cosmid vectors capable of plant transformation include pMON565 (Klee et al. 1987 Mol Gen Genet 210: 282-287) and pCLD04541 (Bent et al. 1994 Science 265: 1856-1860), but they are not suitable for cloning DNA fragments of 25 kb or more because their own sizes are 24 kb and 29 kb, respectively. Other examples such as pE4cos(16 kb, Klee et al. 1987 Mol Gen Genet 210: 282-287), pMON565, pLZ03, pOCA18, pCLD04541, pC22 and the like had a structure containing a cos site within the T-DNA.

[0007] Subsequently, the BIBAC vector (binary bacterial artificial chromosome, Hamilton U.S. Pat. No. 5,733,744, Hamilton et al., 1996, Proc. Natl. Acad. Sci. USA 93:9975-9979, Hamilton, 1997, Gene 200:107-116) was developed, which is capable of cloning DNA fragments of up to about 150 kb and transferring them into plants. This vector is based on a BAC vector capable of carrying large DNA fragments and further contains elements for plant transformation such as T-DNA border sequences and a selectable marker as well as an origin of replication for Agrobacterium. The TAC vector (transformation-competent bacterial artificial chromosome) pYLTAC7 (Liu et al., 1999, Proc. Natl. Acad. Sci. USA 96: 6535-6540.) was also developed, which is capable of cloning DNA of up to about 80 kb and transferring it into plants. This vector is based on a high-capacity PAC vector (P1-derived artificial chromosome) using the replication mechanism of P1 phage and contains elements for plant transformation such as T-DNA border sequences and a selectable marker as well as an origin of replication for Agrobacterium. These vectors contain an origin of replication of (ori) from a plasmid existing as a single copy per cell in E. coli and Agrobacterium for the purpose of stably maintaining a large foreign gene. That is, they use an F factor on (BIBAC) or a P1 phage on (TAC) as on for E. coli and an R1 on from Agrobacterium rhizogenes (both BIBAC and TAC) as on for Agrobacterium. However, the use of an origin of replication from a single-copy plasmid is not necessarily essential, and vectors having an origin of replication (oriV) of an IncP plasmid known to exist as a few copies per cell such as pSLJ1711 and pCLD04541 were reported to be capable of stably maintaining plant genomic DNA fragments of more than 100 kb in size (Tao and Zhang (1998) Nucleic Acids Res 26: 4901-4909). In addition, pBIGRZ was also reported, which contains R1 on in the versatile binary plasmid vector pBI121 (JPA Hei-10-155485).

[0008] Such vectors can be used to clone large DNA fragments far exceeding 50 kb, but involve complicated cloning operations. Cloning of large DNA requires skilled techniques and a considerable amount of time and labor. Transformation with BIBAC requires special Agrobacterium cells overexpressing virG or the like and results in a much lower transformation efficiency (the number of selected calli/inoculated leaf section) for fragments of 150 kb as compared with those of normal small vectors (Hamiltin et al., 1996, Proc Natl Acad Sci USA 93: 9975-9979, Shibata and Liu, 2000, Trend Plant Sci 5: 354-357). Thus, transformation of large fragments into plants with BIBAC or TAC is limited to a few specific examples of large fragments (e.g., Hamiltin et al., 1996, Proc Natl Acad Sci USA 93: 9975-9979, Liu et al., 1999, Proc Natl Acad Sci USA 96: 6535-6540, Lin et al., 2003, Proc Natl Acad Sci USA 100: 5962-5967, Nakano et al., 2005, Mol Gen Genomics 273: 123-129).

[0009] As described above, pCLD04541 is a cosmid of 29 kb in size, and therefore, the size of DNA fragments that can be cloned using a lambda phage packaging reaction is 10-20 kb. If cloning of larger DNA fragments is intended, a packaging reaction cannot be used as described above, and thus complicated cloning operations and a considerable amount of time and labor are required.

[0010] Recently, genetic markers based on DNA sequence polymorphisms or so-called DNA markers are used more and more frequently with the advance in genome studies of higher plants. Many attempts have been made to clone unknown genes of higher plants known only by their phenotypes on the basis of genetic map information using DNA markers, i.e., so-called map-based cloning. Generally, the basic protocol of map-based cloning is as follows.

[0011] 1. Examine a relatively small segregating population with a set of DNA markers widely used for rough mapping of a candidate region on a chromosome.

[0012] 2. Screen a large segregating population with a set of DNA markers newly designed for the particular region of the genome to narrow down the candidate region.

[0013] 3. Determine the nucleotide sequence of the genetic region and guess a candidate gene.

[0014] 4. Transfer a DNA fragment containing the candidate gene into a plant and determine the effect/function of the gene on the basis of the phenotype.

[0015] Many previous successful cases often involve narrowing down the genetic region to about 1-3 genes in step 3 and transferring several DNA fragments of several kilobases or less in step 4. However, it is not always easy to narrow down the genetic region. For example, it is often impossible to narrow down the genetic region to 150 kb or less in chromosomal regions near centromeres because of the low frequency of genetic recombination upon cross-hybridization. Even cases where narrowing down is possible often require repeating the operation of step 2 and therefore enormous amounts of time. Even if narrowing down to about 50 kb were possible, it would be very difficult to guess a candidate gene without strong information linking the phenotype to the gene sequence in step 3.

[0016] Thus, map-based cloning is relatively easy until the step of defining a candidate region including one to a few DNA fragments cloned by a BAC vector by narrowing down to some extent (to 50 kb to several hundreds of kilobases), but it is often technically difficult to further pursue the analysis to practically identify a gene, and even if it is possible, enormous amounts of labor and time are often required.

REFERENCES

[0017] Patent Publication No. 1: U.S. Pat. No. 5,733,744 [0018] Patent Publication No. 2: Japanese Patent Laid-open Publication No. H10-155485 [0019] Patent Publication No. 3: WO2005/040374 [0020] Non-patent Publication No. 1: Olszewski et al., 1988, Nucleic Acids Res. 16: 10765-10782 [0021] Non-patent Publication No. 2: Lazo et al., 1991, [0022] Bio/Technology 9: 963-967 [0023] Non-patent Publication No. 3: Ditta et al., 1980, Proc. Natl. Acad. Sci. USA 77: 7347-7351 [0024] Non-patent Publication No. 4: Ma et al. 1992 Gene 117: 161-167 [0025] Non-patent Publication No. 5: Simoens et al. 1986 Nucleic Acids Res 14: 8073-8090 [0026] Non-patent Publication No. 6: Klee et al. 1987 Mol Gen Genet 210: 282-287 [0027] Non-patent Publication No. 7: Bent et al. 1994 Science 265: 1856-1860 [0028] Non-patent Publication No. 8: Hamilton et al., 1996, Proc. Natl. Acad. Sci. USA 93:9975-9979, [0029] Non-patent Publication No. 9: Hamilton, 1997, Gene 200:107-116 [0030] Non-patent Publication No. 10: Liu et al., 1999, Proc. Natl. Acad. Sci. USA 96: 6535-6540 [0031] Non-patent Publication No. 11: Tao and Zhang, 1998, Nucleic Acids Res 26: 4901-4909 [0032] Non-patent Publication No. 12: Shibata and Liu, 2000, Trend Plant Sci 5: 354-357 [0033] Non-patent Publication No. 13: Lin et al., 2003, Proc Natl Acad Sci USA 100: 5962-5967, [0034] Non-patent Publication No. 14: Nakano et al., 2005, Mol Gen Genomics 273: 123-129 [0035] Non-patent Publication No. 15: Pansegrau et al. (1994) J Mol Biol 239: 623-663 [0036] Non-patent Publication No. 16: Knauf and Nester 1982 Plasmid 8: 45-54 [0037] Non-patent Publication No. 17: Komari et al. 1996 Plant J 10:165-174 [0038] Non-patent Publication No. 18: Zambryski et al. 1980 Science 209: 1385-1391 [0039] Non-patent Publication No. 19: Schmidhauser and Helinski, J. Bacteriol. 164:446-455, 1985 [0040] Non-patent Publication No. 20: Winans et al. 1986 Proc. Natl. Acad. Sci. USA 83: 8278-8282 [0041] Non-patent Publication No. 21: Pazour et al. 1992 J. Bac 174:4169-4174 [0042] Non-patent Publication No. 22: Ward et al. (1988) J Biol Chem 263: 5804-5814 [0043] Non-patent Publication No. 23: Frame et al. 2002 Plant Physiol 129: 13-22 [0044] Non-patent Publication No. 24: Hansen et al. 1994 ProNAS 91:7603-7607 [0045] Non-patent Publication No. 25: Ishida et al. 1996 Nat Biotechnol 14:745-50 [0046] Non-patent Publication No. 26: Close et al. 1984 Plasmid 12: 111-118 [0047] Non-patent Publication No. 27: Jin et al. 1987 J Bacteriol 169: 4417-4425 [0048] Non-patent Publication No. 28: Wang et al. 2000 Gene 242: 105-114 [0049] Non-patent Publication No. 29: Okumura and Kado (1992) Mol Gen Genet 235: 55-63 [0050] Non-patent Publication No. 30: Christensen et al. 1992 Plant Mol Biol 18: 675-689 [0051] Non-patent Publication No. 31: Bilang et al. (1991) Gene 100: 247-250 [0052] Non-patent Publication No. 32: Hirsch and Beringer 1984 Plasmid 12: 139-141 [0053] Non-patent Publication No. 33: Konieczny and Ausubel 1993 Plant Journal 4: 403-410 [0054] Non-patent Publication No. 34: Hiei et al. (1994) Plant J 6: 271-282 [0055] Non-patent Publication No. 35: Ishida et al. (2003) Plant Biotechnology 20:57-66 [0056] Non-patent Publication No. 36: Hiei and Komari (2006) Plant Cell, Tissue and Organ Culture 85: 271-283 [0057] Non-patent Publication No. 37: Komori et al. (2004) Plant J 37: 315-325 [0058] Non-patent Publication No. 38: Kazama and Toriyama (2003) FEBS lett 544: 99-102.

DISCLOSURE OF THE INVENTION

Problems to be Solved by the Invention

[0059] WO2005/040374, which is incorporated by reference herein in its entirety, discloses a method for efficiently selecting and preparing a number of genomic DNA fragments capable of improving traits expressed in heterosis or quantitative traits as cloned DNA fragments. We have selected large genomic DNA fragments capable of introducing agriculturally useful mutations by using the method described in WO2005/040374. However, the success rate of transferring clones carried in E. coli into Agrobacterium was about 80%. Moreover, only about 60% of Agrobacterium strains harboring clones was able to transform plants. In view of this result, we examined whether or not the efficiency of the method of WO2005/040374 could be significantly improved by changing the vector used. However, the efficiency of this method could not be improved by any vector ever known.

[0060] Thus, an object of the present invention is to provide a novel vector capable of improving the efficiency of selecting and cloning relatively large genomic DNA fragments, e.g., in the method described in WO2005/040374.

[0061] Another object of the present invention is to provide a vector preferably fulfilling all of the requirements below: [0062] it allows efficient cloning of DNA fragments of about 25-40 kb in size; [0063] it is stably maintained in E. coli and Agrobacterium cells; [0064] it can be efficiently introduced into Agrobacterium; [0065] the copy number per cell in E. coli and Agrobacterium is 4-5; and [0066] it allows efficient transfer of only cloned DNA fragments of interest into plants, preferably monocotyledons.

[0067] Still another object of the present invention is to provide a gene transfer method for transferring a gene into a plant at a very high efficiency using such a vector.

[0068] Still another object of the present invention is to provide a method for rapidly narrowing down a gene region for completing map-based cloning with ease in a short time using such a vector.

[0069] Still another object of the present invention is to provide a plasmid capable of further improving the transformation efficiency by combining it with said vector.

Means for Solving the Problems

[0070] Cosmid Vectors

[0071] The cosmid vectors of the present invention are vectors having a full length of 15 kb or less satisfying all of the following criteria (hereinafter referred to as "pLC vectors"):

[0072] 1) they contain an origin of replication (oriV) of an IncP plasmid, but do not contain any origin of replication of other plasmid groups;

[0073] 2) they contain the trfA1 gene of an IncP plasmid;

[0074] 3) they contain an origin of conjugative transfer (oriT) of an IncP plasmid;

[0075] 4) they contain the incC1 gene of an IncP plasmid;

[0076] 5) they contain a cos site of lambda phage and the cos site is located outside the T-DNA;

[0077] 6) they contain a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium;

[0078] 7) they contain a T-DNA right border sequence of a bacterium of the genus Agrobacterium;

[0079] 8) they contain a T-DNA left border sequence of a bacterium of the genus Agrobacterium;

[0080] 9) they contain a selectable marker gene for plant transformation located between 7) and 8) and expressed in a plant; and

[0081] 10) they contain restriction endonuclease recognition site(s) located between 7) and 8) for cloning a foreign gene.

[0082] The vectors of the present invention are cosmid vector containing a cos site of lambda phage. This allows cloning of relatively large genomic fragments by a packaging reaction (Sambrook J. and Russell D. W. 2001. Molecular Cloning, A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA.). In cloning using a packaging reaction of a cosmid vector, the total size of the vector and the insert fragment is around 40 kb-50 kb so that the size of the insert fragment is restricted within a certain range by the size of the vector. The vectors of the present invention have a full length of 15 kb or less, preferably 12-14 kb because they are intended to clone a DNA fragment of up to about 25-40 kb, preferably 30-40 kb.

[0083] 1) An origin of replication (oriV) of an IncP plasmid: The oriV is functional in both E. coli and Agrobacterium. The nucleotide sequence of the oriV of the present invention is not specifically limited so far as it has the function of oriV, i.e., the function of an origin of replication of an IncP plasmid.

[0084] The oriV has molecular biological properties described in detail in Pansegrau et al. (1994) J Mol Biol 239: 623-663, and it is defined as nucleotides 12200-12750 of the sequence of Genbank/EMBL Accession Number L27758 (full length 60099 bp). This corresponds to nucleotides 3451-4002 of SEQ ID NO: 1 (core sequence of oriV).

[0085] The oriV can be conventionally prepared from an IncP plasmid such as pVK102 (Knauf and Nester 1982 Plasmid 8: 45-54). For example, a 0.9 kb DNA (nucleotides 3345-4247 of SEQ ID NO: 1) amplified by PCR from pVK102 can be used as the oriV.

[0086] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 3451-4002, more preferably 3345-4247 of SEQ ID NO: 1 described above under stringent conditions and having the function of oriV can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 3451-4002, more preferably 3345-4247 of SEQ ID NO: 1 described above and having the function of oriV can also be used.

[0087] It will be recognized by those skilled in the art that a shorter region in nucleotides 3451-4002 of SEQ ID NO: 1 may be selected as a sequence having a similar function. We investigated from various viewpoints the reason why the final transformation efficiency was only about 50% (80% x 60%=48%) when the method described in WO2005/040374 was used, and concluded that this might be ascribable to the use of the cloning vector pSB200.

[0088] A replication origin of pSB200 is from ColE1, and plasmids having an origin of replication from ColE1 exist in a relatively high copy number, i.e., 30-40 copies per E. coli cell. Tao and Zhang (1998, Nucleic Acids Res 26: 4901-4909) assume that E. coli can stably maintain 1200-1500 kb of foreign DNA per cell. If 30-40 kb of DNA is cloned by pSB200, the total DNA amount including the vector size reaches 1200-2000 kb per cell, which may exceed the range assumed above. Another possible reason is that pSB200 is a plasmid that is not replicated alone in Agrobacterium. Thus, a vector having an origin of replication (oriV) of an IncP plasmid called pSB1 is preliminarily introduced into Agrobacterium, and a cointegrate between pSB200 and pSB1 is prepared via homologous recombination between DNA sequences contained in both pSB200 and pSB1, thereby introducing pSB200 into Agrobacterium. It is undeniable that some adverse phenomenon could occur during such an operation to result in the failure in the transfer of pSB200.

[0089] If the copy number in E. coli and Agrobacterium is too low, however, the analysis of DNA or the like will be inefficient.

[0090] Based on the foregoing discussion, we prepared and tested vectors containing an origin of replication (oriV) of an IncP plasmid that is functional in both E. coli and Agrobacterium but not any origin of replication of other plasmid groups and existing in 4-5 copies in these bacteria. As a result, we found that the transformation efficiency is improved by using such vectors in plant transformation, specifically e.g., in the method described in WO2005/040374, and thus achieved the present invention.

[0091] 2) The trfA1 gene of an IncP plasmid: The trfA1 gene is important as a transacting replication factor of IncP plasmids and necessary for an oriV to perform its function. The nucleotide sequence of the trfA1 gene of the present invention is not specifically limited so far as it has the function of trfA1, i.e. the function of a transacting replication factor.

[0092] It has molecular biological properties described in detail in Pansegrau et al. (1994) J Mol Biol 239: 623-663, and it is defined as nucleotides 16521-17669 of the sequence of Genbank/EMBL Accession Number L27758 (full length 60099 bp). This corresponds to nucleotides 6323-7471 of SEQ ID NO: 1 (core sequence of trfA1).

[0093] TrfA1 can be conventionally prepared from an IncP plasmid such as pVK102 (Knauf and Nester 1982 Plasmid 8: 45-54). For example, a 3.2 kb DNA fragment (nucleotides 5341-8507 of SEQ ID NO: 1) amplified by PCR from pVK102 can be used as the trfA1 gene.

[0094] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 6323-7471, more preferably 5341-8507 of SEQ ID NO: 1 described above under stringent conditions and having the function of the trfA1 gene can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 6323-7471, more preferably 5341-8507 of SEQ ID NO: 1 described above and having the function of the trfA1 gene can also be used.

[0095] It will be recognized by those skilled in the art that a shorter region in nucleotides 6323-7471 of SEQ ID NO: 1 may be selected as a sequence having a similar function.

[0096] 3) An origin of conjugative transfer (oriT) of an IncP plasmid: oriT is an element responsible for conjugation (mating). One of the purposes of the vectors of the present invention is to perform large-scale and high-efficient transformation. For that purpose, conjugation (mating) between E. coli and Agrobacterium is necessary, and oriT contributes to the conjugation (mating). The sequence of the oriT of the present invention is not specifically limited so far as it has the function of oriT, i.e. the function of an element responsible for conjugation (mating).

[0097] The oriT has molecular biological properties described in detail in Pansegrau et al. (1994) J Mol Biol 239: 623-663, and it is defined as nucleotides 51097-51463 of the sequence of Genbank/EMBL Accession Number L27758 (full length 60099 bp). The oriT can be conventionally prepared from an IncP plasmid such as pVK102 (Knauf and Nester 1982 Plasmid 8: 45-54). For example, a 0.8 kb DNA fragment (nucleotides 1-816 of SEQ ID NO: 1) amplified by PCR from pVK102 can be used as the oriT.

[0098] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 1-816 of SEQ ID NO: 1 described above under stringent conditions and having the function of oriT can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 1-816 of SEQ ID NO: 1 described above and having the function of oriT can also be used.

[0099] It will be recognized by those skilled in the art that a shorter region in nucleotides 1-816 of SEQ ID NO: 1 may be selected as a sequence having a similar function.

[0100] 4) The incC1 gene of an IncP plasmid: The incC1 gene contributes to the stability of IncP plasmids. The nucleotide sequence of the incC1 gene of the present invention is not specifically limited so far as it has the function of the incC1 gene contributing the stability of IncP plasmids.

[0101] This gene has molecular biological properties described in detail in Pansegrau et al. (1994) J Mol Biol 239: 623-663, and it is defined as nucleotides 58260-59354 of the sequence of Genbank/EMBL Accession Number L27758 (full length 60099 bp). This corresponds to nucleotides 1179-2273 of SEQ ID NO: 1 (core sequence of the incC1 gene).

[0102] IncC1 can be conventionally prepared from an IncP plasmid such as pVK102 (Knauf and Nester 1982 Plasmid 8: 45-54). For example, a 2.1 kb DNA fragment (nucleotides 817-2935 of SEQ ID NO: 1) amplified by PCR from pVK102 can be used as the incC1 gene.

[0103] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 1179-2273, more preferably 817-2935 of SEQ ID NO: 1 described above under stringent conditions and having the function of the incC1 gene can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 1179-2273, more preferably 817-2935 of SEQ ID NO: 1 described above and having the function of the incC1 gene can also be used.

[0104] It will be recognized by those skilled in the art that a shorter region in nucleotides 1179-2273 of SEQ ID NO: 1 may be selected as a sequence having a similar function.

[0105] 5) A cos site of lambda phage: The vectors of the present invention contain a cos site of lambda phage to utilize the packaging reaction of cosmid vectors. The nucleotide sequence of the cos site of lambda phage of the present invention is not specifically limited so far as it has the function of a cos site of lambda phage, i.e. the function contributing to the packaging reaction of cosmid vectors.

[0106] The cos site of lambda phage has molecular biological properties described in detail in Sambrook J. and Russell D. W. (2001), and it has the sequence 5'-aggtcgccgccc-3' (SEQ ID NO: 9) (the core sequence of a cos site of lambda phage). The cos can be conventionally prepared from a plasmid such as pSB11 (Komari et al. 1996 Plant J 10:165-174). For example, a 0.4 kb DNA fragment (nucleotides 2936-3344 of SEQ ID NO: 1) amplified by PCR from pSB11 can be used.

[0107] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of SEQ ID NO: 9 described above, more preferably the nucleotide sequence of nucleotides 2936-3344 of SEQ ID NO: 1 under stringent conditions and having the function of a cos site of lambda phage can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of SEQ ID NO: 9 described above, more preferably the nucleotide sequence of nucleotides 2936-3344 of SEQ ID NO: 1 and having the function of a cos site of lambda phage can also be used.

[0108] The cos site should be located outside the T-DNA because undesired DNA will be introduced into plants if the cos site is located inside the T-DNA.

[0109] 6) The drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium is used as a selectable marker for transformation. This drug resistance gene confers e.g., antibiotic resistance or autotrophy, including, but not limited to, a kanamycin resistance gene, a spectinomycin resistance gene, an ampicillin resistance gene, a tetracycline resistance gene, a gentamycin resistance gene, a hygromycin resistance gene, etc.

[0110] 7), 8) T-DNA right border sequence (RB) and left border sequence (LB) of a bacterium of the genus Agrobacterium are essential for transformation (Zambryski et al. 1980 Science 209: 1385-1391), and a cloning site for a foreign gene is located between them. The nucleotide sequences of the RB and LB of the present invention are not specifically limited so far as they have the function of T-DNA right border sequence (RB) and left border sequence (LB) of a bacterium of the genus Agrobacterium. They can be each conventionally prepared from a plasmid such as pSB11 (Komari et al. 1996 Plant J 10:165-174). For example, nucleotides 13253-13277 and 3479-3503 of SEQ ID NO: 2 can be used, respectively.

[0111] Alternatively, nucleic acids containing nucleotide sequences hybridizing to complementary strands of the nucleotide sequences of nucleotides 13253-13277 and 3479-3503 of SEQ ID NO: 2 described above under stringent conditions and having the functions of the RB and LB, respectively, can also be used. Alternatively, nucleic acids containing nucleotide sequences having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequences of nucleotides 13253-13277 and 3479-3503 of SEQ ID NO: 2 described above and having the functions of the RB and LB, respectively, can also be used.

[0112] It will be recognized by those skilled in the art that shorter regions in nucleotides 13253-13277 and 3479-3503 of SEQ ID NO: 2 may be selected as sequences having similar functions.

[0113] 9) A selectable marker gene for plant transformation expressed in a plant cell and located between 7) and 8) is included. The selectable marker gene for plant transformation is not specifically limited, and known selectable marker genes can be used. Preferably, it is any one of a hygromycin resistance gene, a phosphinotricin resistance gene, and a kanamycin resistance gene. For use in transformation of monocotyledons, a hygromycin resistance gene or a phosphinotricin resistance gene is preferred.

[0114] 10) Restriction endonuclease recognition site(s) located between 7) and 8) for cloning a foreign gene are included. The restriction endonuclease recognition sites for cloning a foreign gene are not specifically limited, and known restriction endonuclease recognition sites can be used, but the same recognition sites are desirably absent elsewhere on the vectors.

[0115] In the cosmid vector constructs of the present invention, the order of all of the seven elements consisting of elements 1)-6) and a unit of 7)-10) is not limited. Moreover, the order of 9) and 10) located between 7) and 8) is not limited.

[0116] The cosmid vectors of the present invention preferably satisfy one or more of the following criteria A-G.

[0117] A. The nucleotide sequence of oriV in 1) comprises the following nucleotide sequence:

[0118] i) the nucleotide sequence of nucleotides 3451-4002, more preferably 3345-4247 of SEQ ID NO: 1;

[0119] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 3451-4002, more preferably 3345-4247 of SEQ ID NO: 1 under stringent conditions and having the function of oriV; or

[0120] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 3451-4002, more preferably 3345-4247 of SEQ ID NO: 1 and having the function of oriV.

[0121] B. The trfA1 gene in 2) comprises the following nucleotide sequence:

[0122] i) the nucleotide sequence of nucleotides 6323-7471, more preferably 5341-8507 of SEQ ID NO: 1;

[0123] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 6323-7471, more preferably 5341-8507 of SEQ ID NO: 1 under stringent conditions and having the function of the trfA1 gene;

[0124] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 6323-7471, more preferably 5341-8507 of SEQ ID NO: 1 and having the function of the trfA1 gene.

[0125] C. The oriT in 3) comprises the following nucleotide sequence:

[0126] i) the nucleotide sequence of nucleotides 1-816 of SEQ ID NO: 1;

[0127] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 1-816 of SEQ ID NO: 1 under stringent conditions and having the function of oriT;

[0128] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 1-816 of SEQ ID NO: 1 and having the function of oriT.

[0129] D. The incC1 gene in 4) comprises the following nucleotide sequence:

[0130] i) the nucleotide sequence of nucleotides 1179-2273, more preferably 817-2935 of SEQ ID NO: 1;

[0131] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 1179-2273, more preferably 817-2935 of SEQ ID NO: 1 under stringent conditions and having the function of the incC1 gene;

[0132] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 1179-2273, more preferably 817-2935 of SEQ ID NO: 1 and having the function of the incC1 gene.

[0133] E. The cos site of lambda phage in 5) comprises the following nucleotide sequence:

[0134] i) the nucleotide sequence of SEQ ID NO: 9, more preferably the nucleotide sequence of nucleotides 2936-3344 of SEQ ID NO: 1;

[0135] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of SEQ ID NO: 9, more preferably the nucleotide sequence of nucleotides 2936-3344 of SEQ ID NO: 1 under stringent conditions and having the function of a cos site of lambda phage;

[0136] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of SEQ ID NO: 9, more preferably the nucleotide sequence of nucleotides 2936-3344 of SEQ ID NO: 1 and having the function of a cos site of lambda phage.

[0137] F. The T-DNA right border sequence (RB) of a bacterium of the genus Agrobacterium in 7) comprises the following nucleotide sequence:

[0138] i) the nucleotide sequence of nucleotides 13253-13277 of SEQ ID NO: 2;

[0139] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 13253-13277 of SEQ ID NO: 2 under stringent conditions and having the function of RB;

[0140] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 13253-13277 of SEQ ID NO: 2 and having the function of RB.

[0141] G. The T-DNA left border sequence (LB) of a bacterium of the genus Agrobacterium in 8) comprises the following nucleotide sequence:

[0142] i) the nucleotide sequence of nucleotides 3479-3503 of SEQ ID NO: 2;

[0143] ii) a nucleotide sequence containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 3479-3503 of SEQ ID NO: 2 under stringent conditions and having the function of LB;

[0144] iii) a nucleotide sequence containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 3479-3503 of SEQ ID NO: 2 and having the function of LB.

[0145] By satisfying all of the criteria 1)-10) above for the cosmid vectors of the present invention, a vector fulfilling all of the requirements below can be prepared: [0146] it allows efficient cloning of DNA fragments of about 25-40 kb in size, preferably 30-40 kb; [0147] it is stably maintained in E. coli and Agrobacterium cells; [0148] it can be efficiently introduced into Agrobacterium; [0149] the copy number per cell in E. coli and Agrobacterium is 4-5; and [0150] it allows efficient transfer of only cloned DNA fragments of interest into plants, preferably monocotyledons.

[0151] However, the development of such a vector was not straightforward even after the requirements above had been defined. This is partially due to the very complex control mechanism of plasmid replication. Specifically, the most suitable vector backbone for the requirements above is a small plasmid (in the order of 12 kb to 15 kb) having an origin of replication (oriV) of an IncP plasmid. However, the backbone 60 kb IncP plasmid has many genes involved in the replication of the plasmid and partitioning during cell division, resulting in a very complex mechanism, though its entire nucleotide sequence has been determined (Pansegrau et al. J. Mol. Biol. 239:623-663, 1994). Thus, it is not easy to prepare a small vector having an origin of replication (oriV) of an IncP plasmid and stably maintained in bacteria. In fact, plasmids of various sizes derived from IncP plasmids have been studied, but small plasmids are generally unstable and widely differ in stability depending on the bacterial species (Schmidhauser and Helinski, J. Bacteriol. 164:446-455, 1985). pE4cos is an example of the plasmid which has lost stability in Agrobacterium by size reduction. The reasons for this have been discussed to a certain extent (Klee et al. 1987 Mol Gen Genet 210: 282-287), but it can be hardly said that they have been clarified.

[0152] Schmidhauser and Helinski (J. Bacteriol. 164:446-455, 1985) say that "there is no universal set of genetic determinants in plasmid RK2 that accounts for stable maintenance in all gram-negative bacteria", indicating great difficulty in the preparation of a small and stable vector. The plasmid RK2 here (also often designated as pRK2) is one of typical IncP plasmids. The procedure for constructing such a vector often uses the step of cloning elements of a backbone plasmid using another vector. However, DNA fragments involved in the replication of bacterial plasmids or chromosomes are sometimes difficult to clone. If such a problem occurs, a means to solve it must be developed, which contributes to the difficulty in the construction of novel vectors.

[0153] Non-limitative examples of the cosmid vectors (pLC series) of the present invention are as follows.

[0154] i) pLC40 (SEQ ID NO: 2, FIG. 6)

[0155] A binary cosmid vector having a full length of 13429 by characterized in that:

[0156] 1) it contains an origin of replication (oriV) of an IncP plasmid, but does not contain any origin of replication of other plasmid groups;

[0157] 2) it contains the trfA1 gene, 3) oriT, and 4) the incC1 gene of an IncP plasmid;

[0158] 5) it contains a cos site of lambda phage and the cos site is located outside the T-DNA;

[0159] 6) it contains the drug resistance gene nptIII (kanamycin resistance gene) expressed in E. coli and a bacterium of the genus Agrobacterium;

[0160] 7) it contains a T-DNA right border sequence of a bacterium of the genus Agrobacterium;

[0161] 8) it contains a T-DNA left border sequence of a bacterium of the genus Agrobacterium;

[0162] 9) it contains the selectable marker gene for plant transformation hpt (hygromycin resistance gene) located between 7) and 8) and expressed in a plant; and

[0163] 10) it contains restriction endonuclease recognition site(s) located between 7) and 8) for cloning a foreign gene, e.g., an NspV site.

[0164] pLC40 was prepared by inserting a region containing the T-DNA region of pSB200PcHm (FIG. 1) into p6FRG. It should be noted that p6FRG is a cosmid vector of 8507 by in full length having the structure shown in FIG. 5 (SEQ ID NO: 1 in the Sequence Listing) characterized in that:

[0165] 1) it contains an origin of replication (oriV) of an IncP plasmid, but does not contain any origin of replication of other plasmid groups;

[0166] 2) it contains the trfA1 gene, oriT and the incC1 gene of an IncP plasmid, and a cos site of lambda phage;

[0167] 3) it contains the drug resistance gene nptIII (kanamycin resistance gene) expressed in E. coli and a bacterium of the genus Agrobacterium.

[0168] ii) pLC40GWH (SEQ ID NO: 3, FIG. 7)

[0169] A binary cosmid vector of 13174 by in full length. It differs from pLC40 by an insertion of attB1, 2 sequences and a deletion of a 317 by SspI-BalI region upstream of the RB. It was prepared by inserting a region containing the T-DNA region of pSB200PcHmGWH (FIG. 3) into p6FRG.

[0170] iii) pLC40 bar (SEQ ID NO: 4, FIG. 8)

[0171] A binary cosmid vector of 12884 by in full length. Principal differences of pLC40 bar from pLC40 are in that the selectable marker gene for plant transformation is bar (phosphinotricin resistance gene), and that the orientation of the selectable marker unit (ubiquitin promoter-ubiquitin intron-selectable marker gene for plant transformation) on the T-DNA is opposite. It was prepared by inserting a region containing the T-DNA region of pSB25UNpHm (FIG. 2) into p6FRG.

[0172] iv) pLC40GWB (SEQ ID NO: 5, FIG. 9)

[0173] A binary cosmid vector of 13026 by in full length. It differs from pLC40 in that the selectable marker gene for plant transformation is bar (phosphinotricin resistance gene) and that attB1, 2 sequences have been inserted. It was prepared by inserting a region containing the T-DNA region of pSB200PcHmGWB (FIG. 4) into p6FRG.

[0174] v) pLC40GWHkorB (SEQ ID NO: 65, FIG. 10)

[0175] A binary cosmid vector of 14120 by in full length. It differs from pLC40GWH in that it contains the nucleotide sequence of the korB gene. The korB gene is located near IncC1 described above, and contributes to the stability of IncP plasmids as IncC1 does. The nucleotide sequence of the korB gene of the present invention is not specifically limited so far as it has the function of the korB gene contributing to the stability of IncP plasmids.

[0176] This sequence has molecular biological properties described in detail in Pansegrau et al. (1994) J Mol Biol 239: 623-663, and it is defined as nucleotides 57187-58263 of the sequence of Genbank/EMBL Accession Number L27758 (full length 60099 bp). This corresponds to nucleotides 6306-7382 of SEQ ID NO: 65.

[0177] The korB can be conventionally prepared from an IncP plasmid such as pVK102 (Knauf and Nester 1982 Plasmid 8: 45-54). For example, a sequence amplified by PCR from pVK102 (nucleotides 6306-7382 of SEQ ID NO: 65) can be used as the korB gene.

[0178] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 6306-7382 of SEQ ID NO: 65 under stringent conditions and having the function of the korB gene can be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 6306-7382 of SEQ ID NO: 65 and having the function of the korB gene can also be used.

[0179] vi) pLCleo (SEQ ID NO: 66, FIG. 11)

[0180] A binary cosmid vector of 14195 by in full length. It differs from pLC40GWHkorB in that it contains a PspOMI site in the multicloning site, a PI-SceI upstream of it, and an attB3 site upstream of the ubiquitin promoter.

[0181] vii) pLC40GWHvG1 (SEQ ID NO: 7, FIG. 13)

[0182] A binary cosmid vector of 14222 by in full length. It differs from pLC40GWH in that the virG gene has been inserted. It was prepared by inserting the virG gene outside the T-DNA of pPLC40GWH.

[0183] Those skilled in the art can readily derive equivalents to the seven cosmid vectors described above, i.e.,

[0184] i) the cosmid vector pLC40 consisting of the nucleotide sequence of SEQ ID NO: 2;

[0185] ii) the cosmid vector pLC40GWH consisting of the nucleotide sequence of SEQ ID NO: 3;

[0186] iii) the cosmid vector pLC40 bar consisting of the nucleotide sequence of SEQ ID NO: 4;

[0187] iv) the cosmid vector pLC40GWB consisting of the nucleotide sequence of SEQ ID NO: 5;

[0188] v) the cosmid vector pLC40GWHKorB consisting of the nucleotide sequence of SEQ ID NO: 65;

[0189] vi) the cosmid vector pLCleo consisting of the nucleotide sequence of SEQ ID NO: 66; and

[0190] vii) the cosmid vector pLC40GWHvG1 consisting of the nucleotide sequence of SEQ ID NO: 7;

[0191] said equivalents having similar functions to those of these vectors even if the nucleotide sequences are not completely identical. Thus, these "equivalents" are also included as preferred embodiments of the cosmid vectors of the present invention.

[0192] For example, it is thought that even if the nucleotide sequences of the cosmid vectors of the present invention i)-vii) above are modified especially in parts other than the elements related to criteria 1)-10) above (e.g., oriV in criterion 1), or the trfA1 gene in criterion 2)), they perform similar functions to those of the original vectors as cosmid vectors. Moreover, more than one genes or restriction endonuclease sites having similar functions to those of the drug resistance gene in 6), the selectable marker gene for plant transformation in 9), and the restriction endonuclease recognition site(s) in 10) among criteria 1)-10) are known even if the nucleotide sequences are not completely identical to the nucleotide sequences in the cosmid vectors i)-vii), and those skilled in the art can modify these parts as appropriate.

[0193] Therefore, an "equivalent" to each of the cosmid vectors of the present invention i)-vii) preferably refers to a nucleotide sequence identical to or having an identity of at least 95% or more, 97% or more, 98% or more or 99% or more, more preferably 99.5% or more to the nucleotide sequence of each cosmid vector in the nucleotide sequences of the elements related to criteria 1)-5) and 7)-8) of the cosmid vectors of the present invention, especially the core sequences in these criteria or refers to a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of each cosmid vector under stringent conditions, said equivalent containing a mutation elsewhere in the nucleotide sequence while having similar function and effect to those of each vector. More preferably, it refers to a nucleotide sequence identical to the nucleotide sequence of each cosmid vector in the nucleotide sequences of the elements related to criteria 1)-10) of the cosmid vectors of the present invention, especially the core sequences in these criteria and containing a mutation elsewhere in the nucleotide sequence while having similar function and effect to those of each vector.

[0194] The degree of mutation is not specifically limited, but the "equivalent" preferably consists of a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of each of cosmid vectors i)-vii) under stringent conditions. The number of nucleotides that can be mutated is more preferably one or more, still more preferably one to a few (e.g., to the extent at which a mutation can be introduced by known site-directed mutagenesis).

[0195] The "equivalent" also preferably consists of a nucleotide sequence having an identity of 95% or more, 97% or more, 98% or more or 99% or more, more preferably 99.5% or more to a nucleotide sequence selected from the nucleotide sequences of cosmid vectors i)-vii).

[0196] The percent identity of two nucleic acid sequences can be determined by visual inspection and mathematical calculation, or more preferably, the comparison is done by comparing sequence information using a computer program. An exemplary, preferred computer program is the Genetics Computer Group (GCG; Madison, Wis.) Wisconsin package version 10.0 program, "GAP" (Devereux et al., 1984, Nucl. Acids Res. 12: 387). This "GAP" program can be used to compare not only two nucleic acid sequences but also two amino acid sequences or a nucleic acid sequence and an amino acid sequence. The preferred default parameters for the "GAP" program include (1) The GCG implementation of a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted amino acid comparison matrix of Gribskov and Burgess, Nucl. Acids Res. 14: 6745, 1986 as described by Schwartz and Dayhoff, eds., "Atlas of Polypeptide Sequence and Structure", National Biomedical Research Foundation, pp. 353-358, 1979; or other comparable comparison matrices; (2) a penalty of 30 for each gap and an additional penalty of 1 for each symbol in each gap for amino acid sequences, or penalty of 50 for each gap and an additional penalty of 3 for each symbol in each gap for nucleotide sequences; (3) no penalty for end gaps; and (4) no maximum penalty for long gaps. Other programs used by those skilled in the art of sequence comparison can also be used, such as, for example, the BLASTN program version 2.2.7, available for use via the National Library of Medicine website: http://www.ncbi.nlm.nih.gov/blast/bl2seq/bls.ht ml, or the UW-BLAST 2.0 algorithm. Standard default parameter settings for UW-BLAST 2.0 are described at the following Internet site: http://blast.wustl.edu. In addition, the BLAST algorithm uses the BLOSUM62 amino acid scoring matrix, and optional parameters that can be used are as follows: (A) inclusion of a filter to mask segments of the query sequence that have low compositional complexity (as determined by the SEG program of Wootton and Federhen (Computers and Chemistry, 1993); also see Wootton and Federhen, 1996, Analysis of compositionally biased regions in sequence databases, Methods Enzymol. 266: 554-71) or segments consisting of short-periodicity internal repeats (as determined by the XNU program of Clayerie and States (Computers and Chemistry, 1993)), and (B) a statistical significance threshold for reporting matches against database sequences, or E-score (the expected probability of matches being found merely by chance, according to the stochastic model of Karlin and Altschul, 1990; if the statistical significance ascribed to a match is greater than this E-score threshold, the match will not be reported.); preferred E-score threshold values are 0.5, or in order of increasing preference, 0.25, 0.1, 0.05, 0.01, 0.001, 0.0001, 1e-5, 1e-10, 1e-15, 1e-20, 1e-25, 1e-30, 1e-40, 1e-50, 1e-75, or 1e-100.

[0197] Plant Transformation Methods

[0198] The present invention also provides a plant transformation method using a cosmid vector of the present invention. Specifically, the plant transformation method of the present invention comprises transforming a plant with a bacterium of the genus Agrobacterium harboring a vector containing a nucleic acid fragment of a plant inserted into a cosmid vector of the present invention.

[0199] The type of the nucleic acid fragment inserted into the cosmid vector is not specifically limited, and any fragment can be used, such as a genomic DNA fragment, a cDNA fragment, etc. The nucleic acid fragment is preferably a genomic DNA fragment, more preferably a genomic DNA fragment derived from a plant. The size of the DNA fragment inserted is preferably 1 kb or more, more preferably 10 kb or more, still more preferably 20 kb or more, still more preferably 25-40 kb, still more preferably 30-40 kb.

[0200] The preparation and introduction of the nucleic acid fragment into the cosmid vector and other operations can be performed by a known method, e.g., the method described in WO2005/040374.

[0201] The source of the nucleic acid fragment are not specifically limited. In the case of plant genomic DNA fragments, preferred examples include plants in which heterosis may occur by cross with recipient plants of genomic DNA fragments. When the recipient plant is Japonica rice, for example, the donor is preferably a wild species of rice Oryza rufipogon or Indica rice. When the recipient plant is a specific variety of maize, preferred examples of donor plants include the other varieties of maize and wild species of teosinte. In general, higher heterosis has been observed between more distantly related plants.

[0202] The recipient plant used for transformation may belong to a different species from that of the donor plant of the genomic DNA or a different variety of the same species or the same variety of the same species. Preferred examples of plants include substantially unrestricted wide range of plants, e.g., cereals such as rice, barley, wheat, maize, sorghum, or millet such as an extremely early maturing variety of Italian millet or pearl millet; industrial crops such as sugar cane; pasture grasses such as Sudan grass or rose grass; plants for producing luxury grocery items such as coffee, cocoa, tea and tobacco; vegetables; fruits; ornamental plants such as flowers; weeds such as Arabidopsis, etc.

[0203] The cosmid vectors of the present invention were obtained especially to improve the efficiency of Agrobacterium-mediated transformation among biological transfer methods. Therefore, the plant transformation method is preferably Agrobacterium-mediated. However, other known plant transformation methods are not excluded. For example, known methods include physical transfer methods such as microinjection, electroporation, particle gun, silicon carbide-mediated method and air injection; and chemical transfer methods such as polyethylene glycol-mediated method.

[0204] The type of Agrobacterium strain is not specifically limited so far as it has an antibiotic resistance other than the antibiotic resistance (gene) for the bacterium used for the construction of the vector, and known strains such as LBA4404, A281, BHA105, PC2760, etc. can be used.

[0205] Map-Based Cloning Method

[0206] The present invention also provides an efficient map-based cloning method using a cosmid vector of the present invention as described above. The map-based cloning method is characterized in that it comprises the steps of:

[0207] 1) partially or completely digesting BAC clones containing candidate genes responsible for a plant phenotype with a restriction endonuclease;

[0208] 2) subcloning DNA fragments obtained in step 1) using a cosmid vector to construct a library; and

[0209] 3) individually transferring clones constituting the library into a plant to evaluate the phenotypes of transformed plants.

[0210] In this map-based cloning method, the DNA fragments obtained in step 1) preferably have a size of, but not limited to, 25-40 kb. More preferably, the cosmid vector in 2) is a cosmid vector as described in the section "Cosmid vectors" above.

[0211] The "candidate genes" refer to a group of genes including genes likely to be responsible for a plant phenotype. The "plant phenotype" is not specifically limited, but includes various agriculturally useful phenotypes such as high vigor of the whole plant, large sizes of the plant and organs, high yield, high growth speed, disease and insect resistance, resistance to various environmental stresses such as drought, high temperature, low temperature, etc., an increase or decrease of a specific component, an increase or decrease of a specific enzyme activity, dwarfness, etc.

[0212] For example, suppose that candidate genes were found to be contained in DNA fragments carried by more than one BAC clones of 100-200 kb. Then, these cloned DNAs are partially or completely digested with an appropriate restriction endonuclease to prepare overlapping fragments of about 40 kb, which are then subcloned using a transformation vector of the present invention. It is not necessary to investigate in detail the relative positions and the overlapping of the subcloned DNA fragments. According to a statistical calculation, any site on original fragments in 200 kb clones is maintained by randomized 21 subclones with a 99% probability (e.g., see [0043]-[0047] in WO2005/040374).

[0213] Then, each subclone is transferred into a plant to prepare about 10 independent transformants per subclone, and the effect of the gene is analyzed. According to this operation, the candidate region can be first narrowed down to 40 kb by identifying subclones containing candidate genes, and then the candidate region can be further restricted to a very narrow region by comparing the experimental results between adjacent subclones. Thus, the efficiency of identifying candidate genes greatly improves.

[0214] Transformation Method Additionally Using the virG Gene (and the virB Gene)

[0215] In a preferred embodiment, the plant transformation method of the present invention is characterized in that it uses a bacterium of the genus Agrobacterium harboring the following elements:

[0216] 1a) a vector containing a nucleic acid fragment of a plant and the virG gene of a bacterium of the genus Agrobacterium inserted into the cosmid vector of the present invention; or

[0217] 1b) a vector containing a nucleic acid fragment of a plant inserted into the cosmid vector of the present invention, and a plasmid capable of coexisting with an IncP plasmid in a cell of a bacterium of the genus Agrobacterium and containing the virG gene of a bacterium of the genus Agrobacterium, and

[0218] 2) a Ti plasmid or Ri plasmid of a bacterium of the genus Agrobacterium.

[0219] virG is one of vir genes of Agrobacterium that play a role in the transfer of the T-DNA into plants, and it is regarded as a transcription factor of the virB gene or the like (Winans et al. 1986 Proc. Natl. Acad. Sci. USA 83: 8278-8282). As an example of virG, virGN54D is a variant in which the amino acid at position 54 of the virG protein is changed from asparagine to aspartic acid to increase the expression of the virB gene as compared with the wild-type virG (Pazour et al. 1992 J. Bac 174:4169-4174). In the present transformation method, the virG gene is preferably virGN54D.

[0220] In an embodiment of the present invention 1a), the virG gene may be further inserted into a cosmid vector of the present invention containing a nucleic acid fragment of a plant. In embodiments where a cosmid vector of the present invention already carries the virG gene (e.g., pLC40GWHvG1), the virG gene need not be further inserted.

[0221] Alternatively, the virG gene may exist in an independent plasmid separate from a cosmid vector of the present invention. In this case, Agrobacterium in the method of the present invention harbors a plasmid capable of coexisting with an IncP plasmid in Agrobacterium cells and containing the virG gene of a bacterium of the genus Agrobacterium, in addition to the cosmid vector (embodiment 1b).

[0222] The Ti plasmid or Ri plasmid is not specifically limited, but preferably disarmed by deleting the T-DNA.

[0223] The plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) may contain an origin of replication of an IncW plasmid. Preferably, it is pVGW having the structure shown in FIG. 14. More preferably, it is pVGW2 having the structure shown in FIG. 15.

[0224] The plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) may further contain the virB gene of a bacterium of the genus Agrobacterium. Here again, the plasmid may contain an origin of replication of an IncW plasmid. Such a plasmid is preferably pTOK47.

[0225] The virB gene of a bacterium of the genus Agrobacterium is described in detail in Ward et al. (1988) J Biol Chem 263: 5804-5814. For example, it can be conventionally prepared from a plasmid such as pSB1 (Komari et al. 1996 Plant J 10: 165-174). The nucleotide sequence of virB is defined as, e.g., nucleotides 3416-12851 of the nucleotide sequence of Genbank/EMBL Accession Number: AB027255 (pSB1). As a non-limitative example, a DNA containing a nucleotide sequence hybridizing to this sequence or a complementary strand thereto under stringent conditions can be used as the virB gene.

[0226] These transformation methods are more effective for plants normally associated with low efficiency of Agrobacterium-mediated transformation, e.g., including, but not limited to, maize and soybean. When the nucleic acid fragment to be transferred is large (e.g., 25-40 kb as a non-limitative example) or has a complex structure (e.g., a highly repeated sequence as a non-limitative example), pVGW described below is preferably used as a plasmid containing the virG gene of a bacterium of the genus Agrobacterium.

[0227] Plasmid Vectors

[0228] In plants such as maize, wherein transformation is difficult to occur, the efficiency of Agrobacterium-mediated transformation with standard binary vectors containing the T-DNA is very low except for special cases (Frame et al. 2002 Plant Physiol 129: 13-22). Previous reports show an increase in the efficiency of transient expression in maize by the coexistence of a binary vector with another plasmid containing the virGN54D gene, a variant of the virG gene in Agrobacterium (Hansen et al. 1994 ProNAS 91:7603-7607), and a high efficiency maize transformation system with a binary vector containing virG and virB (Ishida et al. 1996 Nat Biotechnol 14:745-50).

[0229] However, no report has shown that the maize transformation efficiency was increased by the coexistence of a binary vector with a plasmid containing virG or virGN54D in Agrobacterium.

[0230] The cosmid vectors of the present invention (pLC vectors) (IncP plasmids) are also expected to further improve the maize transformation efficiency. Plasmids capable of coexisting with an IncP plasmid include e.g., IncW plasmids (Close et al. 1984 Plasmid 12: 111-118). Previously reported IncW vectors containing virG are large because they contain origins of replication of other plasmids such as pBR322 ori. For example, pTOK47 contains IncW (pSa) on and pBR322 on (as well as not only virG but also virB) and it has a full length of about 28 kb (Jin et al. 1987 J Bacteriol 169: 4417-4425). pYW48 contains IncW (pSa) on and pBR322 on (as well as not only virG but also virA) and it has a full length of 15.5 kb (Wang et al. 2000 Gene 242: 105-114). Such vectors can also be used in the transformation methods of the present invention. However, these vectors are so long that they may cause problems in stability in bacteria when they coexist with a pLC vector containing a large fragment, and therefore, small vectors capable of coexisting with a pLC vector and containing virG are desirable.

[0231] As a means to solve these problems, the present invention provides a small plasmid vector capable of further improving the transformation efficiency by the coexistence with the cosmid vectors of the present invention described above.

[0232] The plasmid vector of the present invention satisfies all of the criteria below.

[0233] 1) it contains an origin of replication of an IncW plasmid, but does not contain any origin of replication of other plasmid groups;

[0234] 2) it contains the repA gene necessary for the replication of an IncW plasmid;

[0235] 3) it contains a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium; and

[0236] 4) it contains the virG gene of a bacterium of the genus Agrobacterium.

[0237] 1) The nucleotide sequence of the origin of replication of an IncW plasmid of the present invention is not specifically limited so far as it has the function as an origin of replication of an IncW plasmid.

[0238] The origin of replication of an IncW plasmid has molecular biological properties described in detail in Okumura and Kado (1992 Mol Gen Genet 235: 55-63), and it is defined as nucleotides 2170-2552 of Genbank/EMBL Accession Number: U30471 (full length 5500 bp). This corresponds to nucleotides 2832-3214 of SEQ ID NO: 8.

[0239] The origin of replication of an IncW plasmid can be conventionally prepared from an IncW plasmid such as pTOK47 (Jin et al. 1987 J Bacteriol 169: 4417-4425). For example, nucleotides 2832-3214 of SEQ ID NO: 8 in a 2.7 kb DNA amplified by PCR from pTOK47 with repA necessary for the replication of an IncW plasmid described below can be used.

[0240] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 2832-3214 of SEQ ID NO: 8 described above under stringent conditions and having the function of an origin of replication of an IncW plasmid can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 2832-3214 of SEQ ID NO: 8 described above and having the function of an origin of replication of an IncW plasmid can also be used.

[0241] It will be recognized by those skilled in the art that a shorter region in nucleotides 2832-3214 of SEQ ID NO: 8 may be selected as a sequence having a similar function.

[0242] 2) The nucleotide sequence of the repA gene of the present invention is not specifically limited so far as it has the function as the repA gene necessary for the replication of an IncW plasmid.

[0243] The repA necessary for the replication of an IncW plasmid has molecular biological properties described in detail in Okumura and Kado (1992 Mol Gen Genet 235: 55-63), and it is defined as nucleotides 1108-2079 of Genbank/EMBL Accession Number:U30471 (full length 5500 bp). This corresponds to nucleotides 1770-2741 of SEQ ID NO: 8.

[0244] The repA necessary for the replication of an IncW plasmid can be conventionally prepared from an IncW plasmid such as pTOK47 (Jin et al. 1987 J Bacteriol 169: 4417-4425). For example, nucleotides 1770-2741 of SEQ ID NO: 8 in a 2.7 kb DNA amplified by PCR from pTOK47 with an origin of replication of an IncW plasmid described above can be used.

[0245] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of nucleotides 1770-2741 of SEQ ID NO: 8 described above under stringent conditions and having the function of the repA gene necessary for the replication of an IncW plasmid can also be used. Alternatively, a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to the nucleotide sequence of nucleotides 1770-2741 of SEQ ID NO: 8 described above and having the function of the repA gene necessary for the replication of an IncW plasmid can also be used.

[0246] It will be recognized by those skilled in the art that a shorter region in nucleotides 1770-2741 of SEQ ID NO: 8 may be selected as a sequence having a similar function.

[0247] 3) The drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium is used as a selectable marker for transformation. This drug resistance gene confers e.g., antibiotic resistance or autotrophy, including, but not limited to, a kanamycin resistance gene, a spectinomycin resistance gene, an ampicillin resistance gene, a tetracycline resistance gene, a gentamycin resistance gene, a hygromycin resistance gene, etc.

[0248] 4) The virG gene of a bacterium of the genus Agrobacterium and virGN54D have molecular biological properties described in detail in Winans et al. (1986) Proc. Natl. Acad. Sci. USA 83: 8278-8282 and Pazour et al. (1992) J. Bacteriol. 174: 4169-4174, Hansen et al. 1994 Proc. Natl. Acad. Sci. USA 91: 7603-7607, respectively. virG is a transcription regulator (activator) of other vir genes such as virB and virE. virG is activated upon regulation (phosphorylation) by virA, whereas virGN54D is a variant in a permanently activated state without this regulation. The virG gene can be prepared by conventional procedure and virGN54D can be prepared by mutagenesis both from a plasmid such as pTOK47 (Jin et al. 1987 J Bacteriol 169: 4417-4425). For example, 1 kb virG DNA (nucleotides 4024-5069 of SEQ ID NO: 7) amplified by PCR from pTOK47 and 1 kb virGN54D DNA (nucleotides 1-1080 of SEQ ID NO: 8) amplified and prepared by PCR mutagenesis can be used.

[0249] Alternatively, a nucleic acid containing a nucleotide sequence hybridizing to a complementary strand of these nucleotide sequences under stringent conditions and having the function of the virG gene of a bacterium of the genus Agrobacterium or a nucleic acid containing a nucleotide sequence having an identity of at least 95%, more preferably 97%, still more preferably 99% to these nucleotide sequences and having the function of the virG gene of a bacterium of the genus Agrobacterium can also be used.

[0250] The plasmid vector of the present invention preferably has a full length of 10 kb or less, more preferably 5 kb or less.

[0251] The plasmid vector of the present invention is preferably the pVGW vector having the structure shown in FIG. 14. More preferably, it is pVGW2 having the structure shown in FIG. 15. pVGW and pVGW2 are vectors satisfying all of criteria 1)-4) above. pVGW shown as SEQ ID NO: 8 has a full length of 4531 bp, and pVGW2 shown as SEQ ID NO: 67 has a full length of 4836 bp, and they are characterized in that:

[0252] 1) they contain an origin of replication of an IncW plasmid, but do not contain any origin of replication of other plasmid groups;

[0253] 2) they contain the repA gene necessary for the replication of an IncW plasmid;

[0254] 3) they contain a gentamycin resistance gene as a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium; and

[0255] 4) they contain the virGN54D gene of a bacterium of the genus Agrobacterium.

[0256] Among these components, the origin of replication of an IncW plasmid and the repA gene necessary for the replication of an IncW plasmid were simultaneously cloned and the gentamycin resistance gene and the virGN54D gene were separately cloned, after which all of the three DNA fragments (four components) were assembled.

[0257] Those skilled in the art can readily derive equivalents to the two plasmid vectors pVGW, pVGW2 of the present invention described above, said equivalents having similar functions to those of these vectors even if the nucleotide sequences are not completely identical. Thus, these "equivalents" are also included as preferred embodiments of the plasmid vectors of the present invention.

[0258] For example, it is thought that even if the nucleotide sequences of the plasmid vectors of the present invention are modified especially in parts other than the elements related to criteria 1)-4) above (e.g., the origin of replication of an IncW plasmid in criterion 1)), they perform similar functions to those of the original vectors as plasmid vectors. Moreover, more than one genes having similar functions to those of the drug resistance gene in 3) among criteria 1)-4) are known even if the nucleotide sequences are not completely identical to the nucleotide sequences in the plasmid vectors, and those skilled in the art can modify these parts as appropriate.

[0259] Therefore, an "equivalent" to each of the plasmid vectors of the present invention preferably refers to a nucleotide sequence identical to or having an identity of at least 95% or more, 97% or more, 98% or more or 99% or more, more preferably 99.5% or more to the nucleotide sequence of each plasmid vector in the nucleotide sequences of the elements related to criteria 1)-2) and 4) of the plasmid vectors of the present invention or refers to a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of each plasmid vector under stringent conditions, said equivalent containing a mutation elsewhere in the nucleotide sequence while having similar function and effect to those of each vector. More preferably, it refers to a nucleotide sequence identical to the nucleotide sequence of each plasmid vector in the nucleotide sequences of the elements related to criteria 1)-4) of the plasmid vectors of the present invention and containing a mutation elsewhere in the nucleotide sequence while having similar function and effect to those of each vector.

[0260] The degree of mutation is not specifically limited, but the "equivalent" preferably consists of a nucleotide sequence hybridizing to a complementary strand of the nucleotide sequence of each plasmid vector under stringent conditions. The number of nucleotides that can be mutated is more preferably one or more, still more preferably one to a few (e.g., to the extent at which a mutation can be introduced by known site-directed mutagenesis).

[0261] The "equivalent" also preferably consists of a nucleotide sequence having an identity of 95% or more, 97% or more, 98% or more or 99% or more, more preferably 99.5% or more to a nucleotide sequence selected from the nucleotide sequences of the plasmid vectors.

[0262] As used herein, the expression "under stringent conditions" refers to hybridization under conditions of moderate or high stringency. Specifically, conditions of moderate stringency can be readily determined by those having ordinary skill in the art based on, for example, the length of the DNA. The basic conditions are set forth by Sambrook et al. Molecular Cloning: A Laboratory Manual, 3rd Ed., Chapters 6-7, Cold Spring Harbor Laboratory Press, 2001, and include use of a prewashing solution for the nitrocellulose filters containing 5.times.SSC, 0.5% SDS, 1.0 raM EDTA (pH 8.0), hybridization conditions of 2.times.SSC to 6.times.SSC with or without about 50% formamide at about 40.degree. C. to 50.degree. C. (or other similar hybridization solution, such as Stark's solution, in about 50% formamide at about 42.degree. C.), and washing conditions of 0.5 to 6.times.SSC, 0.1% SDS at about 40.degree. C. to 60.degree. C. Preferably, conditions of moderate stringency include hybridization conditions (and washing conditions) of 6.times.SSC at about 50.degree. C. Conditions of high stringency can also be readily determined by the skilled artisan based on, for example, the length of the DNA.

[0263] Generally, such conditions include hybridization and/or washing at higher temperatures and/or lower salt concentrations than in the conditions of moderate stringency (e.g., hybridization in 6.times.SSC to 0.2.times.SSC, preferably 6.times.SSC, more preferably 2.times.SSC, most preferably 0.2.times.SSC at about 65.degree. C.), and are defined to involve hybridization conditions as above and washing in 0.2.times.SSC, 0.1% SDS at about 65.degree. C. to 68.degree. C. SSPE (1.times.SSPE=0.15 M NaCl, 10 mM NaH.sub.2PO.sub.4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (1.times.SSC=0.15 M NaCl and 15 mM sodium citrate) for use as hybridization and washing buffers, and washing is continued for 15 minutes after completion of hybridization.

[0264] Commercially available hybridization kits not using radioactive substances as probes can also be used. Specifically, hybridization can be performed by using ECL direct labeling & detection system (from Amersham), etc. Stringent hybridization conditions include hybridization in the hybridization buffer included in the kit containing 5% (w/v) Blocking reagent and 0.5 M NaCl at 42.degree. C. for 4 hours, followed by washing twice in 0.4% SDS, 0.5.times.SSC at 55.degree. C. for 20 minutes, and once in 2.times.SSC at room temperature for 5 minutes.

[0265] pVGW is characterized in that it is small and stable. Specifically, it is effective for improving the transformation efficiency by the coexistence with pLC especially when large fragments are used and/or when maize is used as a host. It is also effective for improving the efficiency of transformation of maize or the like by the coexistence with an ordinary vector other than pLC.

Effects of the Invention

[0266] The vectors (pLC vectors) of the present invention provide the following advantages that could not be achieved by known vectors: [0267] they allow efficient cloning of DNA fragments of about 25-40 kb in size, preferably 30-40 kb; [0268] they are stably maintained in E. coli and Agrobacterium cells; [0269] they can be efficiently introduced in Agrobacterium; [0270] the copy number per cell in E. coli and Agrobacterium is 4-5; and [0271] they allow efficient transfer of only cloned DNA fragments of interest into plants, preferably monocotyledons (the transformation efficiency of pLC vectors is 90%, in contrast to the transformation efficiency of pSB vectors 60%).

[0272] The combined use of the pLC vectors of the present invention and the pVGW vector allows efficient gene transfer into even plants that are relatively difficult to transform such as maize.

[0273] Candidate gene sites can be narrowed down with little expenditure of labor and time by map-based cloning with the pLC vectors of the present invention.

[0274] The present invention is significantly effective even if mapping information is very limited. For example, suppose that nothing is known except for the presence of candidate genes at an end region of a chromosome. If the entire length of one chromosome is 40 Mb, for example, its end region may be assumed to be 2 Mb. This region can be covered by about 20 BAC clones carrying an insert fragment of 150 kb on average by constructing a library of aligned BACs (BAC contig). Therefore, if 20 subclones are prepared from each BAC, almost all candidate genes can be rapidly identified by preparing a total of 400 fragments and 4000 recombinants. Thus, genes can be identified with little expenditure of labor and time unimaginable from conventional techniques by using the technique of the present invention.

EMBODIMENTS OF THE PRESENT INVENTION

[0275] The present invention preferably the following embodiments.

Embodiment 1

[0276] A cosmid vector having a full length of 15 kb or less characterized in that:

[0277] 1) it contains an origin of replication (oriV) of an IncP plasmid, but does not contain any origin of replication of other plasmid groups;

[0278] 2) it contains the trfA1 gene of an IncP plasmid;

[0279] 3) it contains an origin of conjugative transfer (oriT) of an IncP plasmid;

[0280] 4) it contains the incC1 gene of an IncP plasmid;

[0281] 5) it contains a cos site of lambda phage and the cos site is located outside the T-DNA;

[0282] 6) it contains a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium;

[0283] 7) it contains a T-DNA right border sequence of a bacterium of the genus Agrobacterium;

[0284] 8) it contains a T-DNA left border sequence of a bacterium of the genus Agrobacterium;

[0285] 9) it contains a selectable marker gene for plant transformation located between 7) and 8) and expressed in a plant; and

[0286] 10) it contains restriction endonuclease recognition site(s) located between 7) and 8) for cloning a foreign gene.

Embodiment 2

[0287] The cosmid vector of Embodiment 1 wherein the selectable marker gene for plant transformation is selected from the group consisting of a hygromycin resistance gene, a phosphinotricin resistance gene and a kanamycin resistance gene.

Embodiment 3

[0288] The cosmid vector of Embodiment 1 or 2, which contains the korB gene of an IncP plasmid.

Embodiment 4

[0289] The cosmid vector of any one of Embodiments 1 to 3 selected from the group consisting of:

[0290] the cosmid vector pLC40 consisting of the nucleotide sequence of SEQ ID NO: 2 or an equivalent thereof;

[0291] the cosmid vector pLC40GWH consisting of the nucleotide sequence of SEQ ID NO: 3 or an equivalent thereof;

[0292] the cosmid vector pLC40 bar consisting of the nucleotide sequence of SEQ ID NO: 4 or an equivalent thereof;

[0293] the cosmid vector pLC40GWB consisting of the nucleotide sequence of SEQ ID NO: 5 or an equivalent thereof;

[0294] the cosmid vector pLC40GWHKorB consisting of the nucleotide sequence of SEQ ID NO: 65 or an equivalent thereof;

[0295] the cosmid vector pLCleo consisting of the nucleotide sequence of SEQ ID NO: 66 or an equivalent thereof; and

[0296] the cosmid vector pLC40GWHvG1 consisting of the nucleotide sequence of SEQ ID NO: 7 or an equivalent thereof.

Embodiment 5

[0297] The cosmid vector of Embodiment 4 selected from the group consisting of:

[0298] the cosmid vector pLC40 consisting of the nucleotide sequence of SEQ ID NO: 2;

[0299] the cosmid vector pLC40GWH consisting of the nucleotide sequence of SEQ ID NO: 3;

[0300] the cosmid vector pLC40 bar consisting of the nucleotide sequence of SEQ ID NO: 4;

[0301] the cosmid vector pLC40GWB consisting of the nucleotide sequence of SEQ ID NO: 5;

[0302] the cosmid vector pLC40GWHKorB consisting of the nucleotide sequence of SEQ ID NO: 65;

[0303] the cosmid vector pLCleo consisting of the nucleotide sequence of SEQ ID NO: 66; and

[0304] the cosmid vector pLC40GWHvG1 consisting of the nucleotide sequence of SEQ ID NO: 7.

Embodiment 6

[0305] A method for transforming a plant, comprising transforming the plant with a bacterium of the genus Agrobacterium harboring an expression vector containing a nucleic acid fragment of a plant inserted into the cosmid vector of any one of Embodiments 1 to 5.

Embodiment 7

[0306] The method of Embodiment 6 wherein the nucleic acid fragment inserted has a size of 25-40 kb.

Embodiment 8

[0307] The method of Embodiment 6 or 7 characterized in that it uses a bacterium of the genus Agrobacterium harboring the following elements for transforming the plant:

[0308] 1a) a vector containing a nucleic acid fragment of a plant and the virG gene of a bacterium of the genus Agrobacterium inserted into the cosmid vector of any one of Embodiments 1 to 5; or

[0309] 1b) a vector containing a nucleic acid fragment of a plant inserted into the cosmid vector of any one of Embodiments 1 to 5, and a plasmid capable of coexisting with an IncP plasmid in a cell of a bacterium of the genus Agrobacterium and containing the virG gene of a bacterium of the genus Agrobacterium, and

[0310] 2) a Ti plasmid or Ri plasmid of a bacterium of the genus Agrobacterium.

Embodiment 9

[0311] The method of Embodiment 8 wherein the virG gene of a bacterium of the genus Agrobacterium in 1a) or 1b) is virGN54D.

Embodiment 10

[0312] The method of Embodiment 8 wherein the plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) contains an origin of replication of an IncW plasmid.

Embodiment 11

[0313] The method of Embodiment 10 wherein the plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) is pVGW having the structure shown in FIG. 14 or pVGW2 having the structure shown in FIG. 15.

Embodiment 12

[0314] The method of Embodiment 8 wherein the plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) further contains the virB gene of a bacterium of the genus Agrobacterium.

Embodiment 13

[0315] The method of Embodiment 12 wherein the plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) contains an origin of replication of an IncW plasmid.

Embodiment 14

[0316] The method of Embodiment 13 wherein the plasmid containing the virG gene of a bacterium of the genus Agrobacterium in 1b) is pTOK47.

Embodiment 15

[0317] A map-based cloning method comprising the steps of:

[0318] 1) partially or completely digesting BAC clones containing candidate genes responsible for a plant phenotype with a restriction endonuclease;

[0319] 2) subcloning DNA fragments obtained in step 1) using a cosmid vector to construct a library; and 3) individually transferring clones constituting the library into a plant to evaluate the phenotypes of transformed plants.

Embodiment 16

[0320] The map-based cloning method of Embodiment 15 wherein the DNA fragments obtained in step 1) have a size of 25-40 kb.

Embodiment 17

[0321] The map-based cloning method of Embodiment 16 wherein the cosmid vector in 2) is the cosmid vector of any one of Embodiments 1 to 5.

Embodiment 18

[0322] A plasmid vector characterized in that:

[0323] 1) it contains an element necessary for the replication of an IncW plasmid, but does not contain any origin of replication of other plasmid groups;

[0324] 2) it contains the repA gene necessary for the replication of an IncW plasmid;

[0325] 3) it contains a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium; and

[0326] 4) the virG gene of a bacterium of the genus Agrobacterium.

Embodiment 19

[0327] The plasmid vector of Embodiment 18, which has a full length of 10 kb or less.

Embodiment 20

[0328] The plasmid vector of Embodiment 19 wherein the virG gene of a bacterium of the genus Agrobacterium is virGN54D.

Embodiment 21

[0329] The plasmid vector of any one of Embodiments 18 to 20 selected from the group consisting of:

[0330] the plasmid vector pVGW consisting of the nucleotide sequence of SEQ ID NO: 8 or an equivalent thereof; and

[0331] the plasmid vector pVGW2 consisting of the nucleotide sequence of SEQ ID NO: 67 or an equivalent thereof.

Embodiment 22

[0332] The plasmid vector pVGW consisting of the nucleotide sequence of SEQ ID NO: 8.

Embodiment 23

[0333] The plasmid vector pVGW2 consisting of the nucleotide sequence of SEQ ID NO: 67.

Embodiment 24

[0334] A method for transforming a plant, comprising transforming the plant with a bacterium of the genus Agrobacterium harboring the plasmid vector of any one of Embodiments 18 to 23.

BRIEF EXPLANATION OF THE DRAWINGS

[0335] FIG. 1 is a schematic diagram of the vector pSB200PcHm.

[0336] FIG. 2 is a schematic diagram of the vector pSB25UNpHm.

[0337] FIG. 3 is a schematic diagram of the vector pSB200PcHmGWH.

[0338] FIG. 4 is a schematic diagram of the vector pSB200PcHmGWB.

[0339] FIG. 5 is a diagram showing a procedure for constructing the vector pLC40.

[0340] FIG. 6 is a schematic diagram of the vector pLC40.

[0341] FIG. 7 is a schematic diagram of the vector pLC40GWH.

[0342] FIG. 8 is a schematic diagram of the vector pLC40 bar.

[0343] FIG. 9 is a schematic diagram of the vector pLC40GWB.

[0344] FIG. 10 is a schematic diagram of the vector pLC40GWHkorB.

[0345] FIG. 11 is a schematic diagram of the vector pLCleo.

[0346] FIG. 12 is a schematic diagram of the vector pLCSBGWBSWa.

[0347] FIG. 13 is a schematic diagram of the vector pLC40GWHvG1.

[0348] FIG. 14 is a schematic diagram of the vector pVGW.

[0349] FIG. 15 is a schematic diagram of the vector pVGW2.

[0350] FIG. 16 shows the results of cloning of a genomic DNA fragment by a pLC vector. An example of a teosinte genomic DNA fragment is shown. M1: marker (1 kb ladder), M2: marker (X-HindIII); the numbers represent clone numbers, and the arrow indicates the size of the band corresponding to pLC40GWH (13.2 kb). Plasmid DNA of eleven clones from a teosinte library was purified. The DNA was cleaved with the restriction endonucleases HindIII and SacI in the multicloning site at each end of the plasmid insert and separated by agarose gel (0.8%) electrophoresis.

[0351] FIG. 17 shows the results of transformation of a genomic DNA fragment into rice (in the center region of fragment B). M: markers, Yu: Yukihikari, Ru: Oryza rufipogon, Transgenic: transformed rice (two individuals). In the transformed rice, a band derived from Oryza rufipogon was detected in addition to a band derived from Yukihikari.

EXAMPLES

[0352] The following examples further illustrate the present invention but are not intended to limit the technical scope of the invention. Those skilled in the art can readily add modifications/changes to the present invention in the light of the description herein, and those modifications/changes are also included in the technical scope of the present invention.

Example 1

Construction of pLC Series Cosmid Vectors

[0353] In the following procedures, molecular biological experimental methods were performed as described in Sambrook J. and Russell D. W. 2001. Molecular Cloning, A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA., unless otherwise specified.

[0354] 1) Construction of T-DNA Regions

[0355] A PacI linker (gttaattaac) (SEQ ID NO: 10) was inserted into the EcoRV site of pSB200 (WO2005/040374) to construct pSB200Pac. The cauliflower mosaic virus .sup.35S promoter in pSB25 (Ishida et al. 1996) was replaced by the ubiquitin promoter of maize (Christensen et al. 1992 Plant Mol Biol 18: 675-689) to construct pSB25U. The adapters HinNspISceRV and HinNspISceFW (Table 1) having recognition sites for the restriction endonuclease NspV and the homing endonuclease I-SceI were annealed. A part of the annealed adapters were phosphorylated with a polynucleotide kinase (PNK, Amersham). The phosphorylated adapters were cloned into the SacI site of pSB200Pac and the HindIII site of pSB25U. The resulting plasmids were designated as pSB200PacHm1 and pSB25UNpHm1, respectively.

[0356] The adapters SpeICeuRV and SpeICeuFW containing a homing endonuclease I-CeuI site (Table 1) were inserted into the SpeI site of pSB200PacHm1 and pSB25UNpHm1. This operation generated the vector pSB200PcHm containing homing endonuclease sites I-SceI and I-CeuI inserted into the SacI and SpeI sites respectively of pSB200Pac (FIG. 1), and the vector pSB25UNpHm containing homing endonuclease sites I-SceI (+NspV site) and I-CeuI inserted into the HindIII and SpeI sites respectively of pSB25U (FIG. 2). Excision by I-SceI and I-CeuI was verified, and the nucleotide sequences were checked by using ABI PRISM Fluorescent Sequencer (Model 310 Genetic Analyzer, from Perkin Elmer) to confirm that a single adapter had been inserted. In these vectors, the I-SceI-selectable marker unit-LB-1-CeuI can be excised.

TABLE-US-00001 TABLE 1 Primer Name Sequence Length HinNspISceRV 5'-AgC TTT CgA ATA ggg ATA ACA ggg TAA T-3' 28 mer HinNspISceFW 5'-AgC TAT TAC CCT gTT ATC CCT ATT CgA A-3' 28 mer SpeICeuRV 5'-CTA gTA ACT ATA ACg gTC CTA Agg TAg CgA C-3' 31 mer SpeICeuFW 5'-CTA ggT CgC TAC CTT Agg ACC gTT ATA gTT A-3' 31 mer SEQ ID NOs: 23-26 in order from the top.

[0357] Then, pSB200PcHm was digested with BamHI to remove the hygromycin resistance gene (hpt), and then blunt-ended. This was ligated to the aatR1-ccdB-Cm-aatR fragment (Invitrogen), and transferred into E. coli DB3.1 to select a chloramphenicol-resistant colony, thereby generating the destination vector pDEST3342. Then, the following primers containing an aatB sequence were synthesized (aatB sequences are shown in uppercase) in order to introduce a marker gene into the pDONR/Zeo plasmid (Invitrogen) by the BP reaction.

TABLE-US-00002 TABLE 2 Primer Name Sequence Length aatB1-HPT ggg gAC AAG TTT GTA CAA AAA AGC AGG CTc aat gag ata tga aaa agc c 49 mer HPT-aatB2 ggg gAC CAC TTT GTA CAA GAA AGC TGG GTc tat tcc ttt gcc ctc gga cga g 52 mer aatB1-bar ggg gAC AAG TTT GTA CAA AAA AGC AGG CTc cat gga ccc aga acg acg c 49 mer bar-aatB2 ggg gAC CAC TTT GTA CAA GAA AGC TGG GTt cct aga cgc gtg aga tca g 49 mer SEQ ID NOs: 27-30 in order from the top.

[0358] For the amplification of the Hpt gene, the hpt gene described in Bilang et al. (1991) Gene 100: 247-250 was used as a template DNA along with aatB1-HPT and HPT-aatB2 as primers. For the amplification of the phosphinotricin resistance gene (bar), pSB25 (Ishida et al. 1996) was used as a template DNA along with aatB1-bar and bar-aatB2 as primers (Table 2). In 100 .mu.l of a reaction solution containing 10 ng of each template DNA and 25 pmoles of the primers, 35 cycles of PCR was performed. After the completion of the reaction, the products were recovered by ethanol precipitation and used for the BP reaction (25.degree. C., 6 hrs) according to the protocol attached to BP Clonase Enzyme Mix kit (Invitrogen), and then transferred into E. coli DH5a and E. coli cells harboring plasmids of interest were selected on a low salt LA plate containing the antibiotics Zeocin. The nucleotide sequences of the finally obtained plasmids were confirmed by restriction endonuclease analysis, thereby generating pENT-HPTwt and pENT-bar, respectively.

[0359] The destination vector (pDEST3342) prepared before and the entry vectors (pENT-HPTwt and pENT-bar) were used to prepare final plasmids of interest by the LR reaction. After the reaction in 20 .mu.l of a reaction solution (containing 300 ng each of the destination vector and entry vectors) at 25.degree. C. for 4 hours according to the protocol attached to GATEWAY LR Clonase Enzyme Mix, the reaction products were transferred into E. coli DH5a by electroporation. Plasmid DNAs were prepared from colonies grown on an LA plate containing spectinomycin and candidate clones were selected by restriction fragment patterns. They were confirmed by nucleotide sequence analysis to contain an aatB sequence and the sequence of the HPT gene or bar gene and designated as pSB200PcHmGWH (FIG. 3) and pSB200PcHmGWB (FIG. 4), respectively.

[0360] 2) Construction of the Cosmid Vector pLC40

[0361] A PCR reaction was performed using Pyrobest DNA Polymerase (Takara) along with OriV3'ClaFW, OriV5'PvNhEc, OriT5'Bg1RV, OriT3'SpEcFW, InC5'XbRV, InC3'BgEcFW, R5'XhoIRV, R3'BmEcFW, 121KIII5'NspV, 121KIII3'SalI, COS5'BmRV and COS3'MunFW designed as PCR primers for amplifying a DNA fragment containing oriV, a DNA fragment containing oriT, a DNA fragment containing the incC2 gene, a DNA fragment containing the trfA1 gene, all of which are derived from the IncP plasmid pVK102 (Knauf and Nester, Plasmid 8: 45-54, 1982), a DNA fragment containing the nptIII gene from pBI121 and a DNA fragment containing cos from pSB11 (Table 3).

[0362] Each primer contains a restriction endonuclease site for later use. The PCR products other than the trfA1 gene, i.e., the DNA fragment containing oriV from pVK102 (884 bp), the DNA fragment containing oriT (810 bp), the DNA fragment containing the incC1 gene (2118 bp), the DNA fragment containing the nptIII gene from pBI121 (1087 bp), and the DNA fragment containing cos from pSB11 were each cloned into the vector pCR2.1Topo Blunt (from Invitrogen). As a result, the DNA fragment containing oriV was found to contain two nucleotide substitutions and one nucleotide addition as compared with the corresponding nucleotide sequence in a public database (Genbank accession L27758). These mutations were also found in the template plasmid, showing that they were not introduced by PCR but that the template plasmid had a nucleotide sequence different from the sequence in the public database. The nucleotide sequences of oriT, the incC1 gene, and cos were completely identical to those in the database. However, the trfA1 gene could not be cloned alone. Thus, the construction was pursued by the method described below.

[0363] The plasmid into which the DNA fragment containing oriV had been cloned was digested with the restriction endonucleases EcoRI and ClaI, and a 0.9 kb fragment was purified. Similarly, the DNA fragment containing oriT was digested with EcoRI and BglII, and the DNA fragment containing nptIII was digested with NspV and SalI, and the digests were purified. The PCR product of the DNA fragment containing the trfA1 gene was precipitated with ethanol, and then digested with XhoI and BamHI, and purified. These 4 fragments (oriV, the trfA1 gene, nptIII, oriT) were ligated at a time and cloned together. The nucleotide sequence of the resulting plasmid (designated as pVRKT) was analyzed to reveal a frameshift mutation in the DNA fragment containing the trfA1 gene as compared with the corresponding nucleotide sequence in the public database (Genbank accession L27758), but the same mutation was also found in pVK102 used as the template, thereby concluding that the mutation was not introduced by PCR and that pVK102 used as the template contained a nucleotide sequence different from the sequence in the public database.

[0364] The resulting plasmid pVRKT containing the 4 fragments were digested with EcoRI and SpeI, and the DNA fragment containing the incC1 gene recovered by digesting the plasmid containing the incC1 gene with EcoRI and XbaI was inserted into it. The resulting plasmid was further digested with EcoRI and BglII, and the DNA fragment containing cos recovered by digesting the plasmid containing the DNA fragment containing cos with MunI and BamHI was inserted into it to generate the low-copy vector backbone p6FRG (about 8.5 kb) consisting of the 6 fragments, i.e., the DNA fragment containing oriV, the DNA fragment containing the trfA1 gene, the DNA fragment containing nptIII, the DNA fragment containing oriT, the DNA fragment containing the incC1 gene, and the DNA fragment containing cos(SEQ ID NO: 1 in the Sequence Listing). The foregoing cloning procedure was summarized in a schematic diagram shown in FIG. 5. The T-DNA region (SspI-SpeI fragment) of pSB200PcHm was inserted into the PvuII, NheI sites of the p6FRG plasmid to generate the vector pLC40 (FIG. 6, SEQ ID NO: 2 in the Sequence Listing).

TABLE-US-00003 TABLE 3 Primer Name Sequence Target gene Length 121KIII5'NspV 5'-TCg TTC gAA TCg ATA CTA TgT TAT ACg CCA AC-3' nptIII 32 mer 121KIII3'SalI 5'-ATC gTC gAC TgC ACg AAT ACC AgC gAC CC-3' 29 mer COS5'BmRV 5'-ggg ggA TCC TTC CAT TgT TCA TTC CAC ggA C-3' cos 31 mer COS3'MunFW 5'-ggg CAA TTg ACA TgA ggT TgC CCC gTA TTC -3' 30 mer OriV3'ClaFW 5'-gAT ATC gAT AgC gTg gAC TCA Agg CTC TC-3' oriV 29 mer OriV5'PvNhEc 5'-AAA gAA TTC gCT AgC CAg CTg gCg CTg CCA TTT TTg ggg Tg-3' 41 mer R5'XhoIRV 5'-AAA CTC gAg CAg CCg AgA ACA TTg gTT CC-3' trfA1 29 mer R3'BmEcFW 5'-TAg gAA TTC ggA TCC AAA ACA ACT gTC AAA gCg CAC-3' 36 mer OriT5'BglRV 5'-CgT AgA TCT ggC gCT Cgg TCT TgC CTT g-3' oriT 28 mer OriT3'SpEcFW 5'-TgT gAA TTC ACT AgT gAT ATT CCA CAA AAC AgC Agg g-3' 37 mer InC5'XbRV 5'-CCg TCT AgA TTC gAg CCA Cgg Tag Cgg C-3' incC2 28 mer InC3'BgEcFW 5'-CTT gAA TTC AgA TCT TCT Cgg Cgg CgA TCA CgA C-3' 34 mer SEQ ID NOs: 31-42 in order from the top.

[0365] 3) Construction of Other pLC Series Cosmid Vectors pLC40GWH

[0366] Of the two BalI sites in the backbone of pSB200PcHmGWH, the one on the left side of the RB is not cleaved because it is methylated. Thus, pSB200PcHmGWH was used in the experiments below after it was once transferred into the E. coli strain GM48 to demethylate that site. pSB200PcHmGWH was treated with BalI and SpeI to excise a region containing the T-DNA, which was cloned into the PvuII, NheI sites of 6FRG described above to generate pLC40GWH (FIG. 7, SEQ ID NO: 3 in the Sequence Listing). This differs from pLC40 by insertions of attB1, 2 sequences and a deletion of a 317 by SspI-BalI region upstream of the RB.

[0367] pLC40 bar, pLC40GWB, pLC40GWBSW

[0368] pSB25UNpHm and pSB200PcHmGWB were digested with the restriction endonucleases SpeI and SspI, and fragments containing the T-DNA were recovered. These fragments were cloned into the PvuII, NheI sites of p6FRG to generate pLC40 bar (FIG. 8, SEQ ID NO: 4 in the Sequence Listing) and pLC40GWB (FIG. 9, SEQ ID NO: 5 in the Sequence Listing), respectively. pSB200PcHmGWB was treated with NspV, blunt-ended, and dephosphorylated. A pSwaI linker (Table 4) was inserted into this site (pSB200PcHmGWBSW). This plasmid was digested with the restriction endonucleases SpeI and SspI, and a fragment containing the T-DNA was recovered. These fragments were cloned into the PvuII, NheI sites of p6FRG to generate pLC40GWBSW.

[0369] pLC40:35S-IGUS, pLC40GWB:35S-IGUS

[0370] The vector pSB24 (Komari et al. 1996) was treated with the restriction endonucleases HindIII and EcoRI to excise a DNA fragment consisting of .sup.35S promoter-1-GUS gene-NOS terminator. This fragment was further blunt-ended by Klenow treatment, and then a 3.1 kb fragment was purified and recovered. The cosmid vector pLC40 described above was treated with the restriction endonuclease NspV, blunt-ended with Klenow enzyme, and then dephosphorylated and purified. On the other hand, pLC40GWBSW was treated with the restriction endonuclease SwaI, dephosphorylated and then gel-purified. The DNA fragment containing the GUS gene described above was inserted into these vectors to prepare pLC40:35S-IGUS and pLC40GWB:35S-IGUS, respectively.

[0371] pLC40GWHKorB

[0372] The cloned region of IncC1 in the pLC vector was extended, and the vector pLC40GWHKorB containing the korB gene was constructed. IncC3'BgEcFw (described above) and IncC/KorB-Xba#1 (Table 4) were designed as primers for amplifying a DNA fragment containing IncC1-KorB of the IncP-based plasmid pVK102. Each primer contains a restriction endonuclease site for later use. A PCR reaction was performed as follows. In 50 .mu.l of a reaction solution containing 500 ng of the pVK102 plasmid DNA, 5 .mu.l of 10.times. Pyrobest Buffer II, 4 .mu.l of 2.5 mM each dNTP, 50 pmoles of the primers, and 0.5 .mu.l of Pyrobest DNA Polymerase (from Takara), one cycle of 96.degree. C. for 3 minutes, and 10 cycles of 96.degree. C. for 1 minute, 55.degree. C. for 1 minute, and 72.degree. C. for 2 minutes and 30 seconds were performed by using Mastercycler gradient (eppendorf). The resulting amplified PCR product of IncC1-korB (3065 bp) was cloned into the vector pCR2.1Topo Blunt (from Invitrogen). Ligation reactions were performed following the instructions attached to the vector kit. The DNA was transferred into E. coli DH5a by electroporation, and incubated overnight at 37.degree. C. on a 2.times.YT agar plate containing the antibiotic Zeocin (25 .mu.g/ml). Colony direct PCR was performed to select candidate clones by using grown colonies as templates along with the same primer set as used for the amplification of IncC1-KorB. PCR conditions included one cycle of 96.degree. C. for 3 minutes, and 30 cycles of 96.degree. C. for 1 minutes, 55.degree. C. for 1 minute, and 72.degree. C. for 2 minutes and 30 seconds using Wastercycler gradient in a suspension of the colony in 20 .mu.l of a reaction solution containing 2 .mu.l of 10.times. Extaq Buffer, 1.6 .mu.l of 2.5 mM each dNTP, 5 pmoles of the primers, and 0.4 .mu.l of Extaq DNA Polymerase (from Takara). The resulting PCR amplified products of about 3 kb were selected as candidate clones. The nucleotide sequences of these clones were determined by ABI PRISM Fluorescent Sequencer (Model 3100 Genetic Analyzer, from Applied Biosystems). As a result, the nucleotide sequence of IncC1-KorB was completely identical to the sequence in the database.

[0373] Then, the plasmid pVRKT described above was digested with EcoRI and SpeI, and the IncC1-KorB fragment recovered by digesting the plasmid containing IncC1-KorB with EcoRI and XbaI was inserted into it. The resulting plasmid was further digested with EcoRI and BglII, and the cos fragment (MunI-BamHI fragment) described above was inserted into it to generate the plasmid p6FRG2 consisting of the 6 fragments, i.e., oriV, trfA1, nptIII, oriT, IncC1-KorB and cos. The T-DNA region (Ball-SpeI fragment) from pSB3342GWH was inserted into the PvuII, NheI sites of the p6FRG2 plasmid to generate the vector pLC40GWHKorB (FIG. 10, SEQ ID NO: 65).

[0374] pLC40GWHKorBPI

[0375] In order that the cloned large genomic fragment could be excised in its intact form, a recognition site for the homing endonuclease PI-SceI was added upstream of the multicloning site. pLC40GWHKorB was digested with HindIII, and PI-SceI adapters (PI-SceIFw, PI-SceIRv, Table 4) were inserted to generate pLC40GWHKorBPI.

[0376] pLC40GWHKorBPIattB3

[0377] In order that the promoter of the selectable marker of pLC40GWH could be changed by any other one by a Gateway system, an attB3 site was added upstream of the ubiquitin promoter. pLC40GWHKorBPI was digested with I-SceI and attB3 adapters (attB3Fw, attB3Rv, Table 4) were inserted to prepare pLC40GWHKorBPIattB3.

[0378] pLCleo

[0379] In order that an NotI-digested genomic fragment could be cloned, a recognition site for PspOMI (producing the same sticky end as that of NotI) was formed at the multicloning site and simultaneously the recognition site of ApaI (a neoschizomer of PspOMI) in the ubiquitin intron was abolished. pLC40GWHKorBPIattB3 was digested with ApaI and NheI, and ApaIm-NheI adapters (Apalm-NheIFw, Apalm-NheIRv, Table 4) were inserted to prepare pLC40GWHKorBPIattB3ApaIm. This plasmid was digested with HindIII and NspV, and HindIII-PspOMI-NspV adapters (HindIII-PspOMI-NspVFw, HindIII-PspOMI-NspVRv, Table 4) were inserted to finally prepare pLCleo (FIG. 11, SEQ ID NO: 66 in the Sequence Listing).

TABLE-US-00004 TABLE 4 Primer/Adapter name Sequence(5'-3') Length IncC/KorB-Xba#1 CGG TCT AGA GTG CGC AGC AGC TCG TTA TC 29 mer PI-SceIFw AGC TAT CTA TGT CGG GTG CGG AGA AAG AGG TAA TGA AAT GGC A 43 mer PI-SceIRv AGC TTG CCA TTT CAT TAC CTC TTT CTC CGC ACC CGA CAT AGA T 43 mer attB3Fw CAG GGT AAT CAA CTT TGT ATA ATA AAG TTG ATA A 34 mer attB3Rv CAA CTT TAT TAT ACA AAG TTG ATT ACC CTG TTA T 34 mer Apalm-NheIFw GGGTAGTTCTACTTCTGTTCATGTTTGTGTTAGATCCGTGTTTGTGTTAGATCCGTGCTG 60 mer Apalnn-NheIRy CTAGCGCCGGATCTAACACAAACACGGATCTAACACAAACATGAACAGAAGTAGAACTACCCGGCC 66 mer HindIII-PspOMI-NspVFw AGC TTG GGC CCT T 13 mer HindIII-PspOMI-NspVRv AGG GCC CA 8 mer SEQ ID NOs: 68-76 in order from the top.

[0380] p6FRGSwKp

[0381] p6FRG was treated with PvuII and dephosphorylated. The adapter SwaIKpnIRV, SwaIKpnIFW (Table 5) DNAs having recognition sites for SwaI and KpnI were annealed. A part of this was phosphorylated with PNK (Amersham). This SwaI-KpnI linker was inserted into the PvuII site of p6FRG to generate p6FRGSwKp. The KpnI site was designed for cloning a DNA fragment containing the virB gene and the virG gene derived from the Agrobacterium strain A281 in the next step, and the SwaI site was designed for cloning the T-DNA in the step after next.

TABLE-US-00005 TABLE 5 Linker/Adapter name Sequence Length pSwaI linker 5'-cca ttt aaa tgg-3' 12 mer SwaIKpnIRV 5'-cca ttt aaa tgg tac cgg-3' 18 mer SwaIKpnIFW 5'-ccg gta cca ttt aaa tgg-3' 18 mer SEQ ID NOs: 43-45 in order from the top.

[0382] p6FRGSVR, p6FRGSVRF

[0383] The vector pSB1 (Komari et al. 1996) was digested with KpnI, and a 14.8 kb DNA fragment containing the virB gene and the virG gene was recovered. This fragment was inserted into the KpnI-treated and dephosphorylated vector p6FRGSwKp, thereby generating p6FRGSVR and p6FRGSVF.

[0384] pLCSBGWBSW

[0385] pSB200PcHmGWBSW was digested with SpeI and SspI, and a DNA fragment containing the T-DNA region was blunt-ended with Klenow enzyme. This fragment was inserted into the SwaI-digested and dephosphorylated vector p6FRGSVR, thereby generating pLCSBGWBSW (FIG. 12, SEQ ID NO: 6 in the Sequence Listing). This vector is a low-copy vector having a full length of about 28 kb, which contains the virB gene and the virG gene derived from the Agrobacterium strain A281 so that it may be used for transformation of maize. It also contains a cos site, which allows easy cloning of about 10-20 kb of DNA by a packaging reaction.

[0386] 4) A pLC Vector Containing virG

[0387] The vector pLC40GWHvG containing the virG gene in the pLC40GWH vector was constructed by the procedure described below as a means for improving the efficiency of plant transformation with a pLC40 series cosmid vector.

[0388] Preparation of the virG Gene

[0389] The primers virGProSm and virGTerSm for amplifying the virG gene (including its promoter, the structural gene and the 3' region) were designed and synthesized. These primers, and pTOK47 (Jin et al. 1987 J Bacteriol 169: 4417-4425) as a template DNA, were used to amplify the virG gene by PCR. As a result, the PCR product of about 1 kb was amplified. A part of the product was cloned into the vector pCR2.1Topo (from Invitrogen) in the same manner as described above, and the nucleotide sequence was determined. The DNA sequence of the VirG gene contains an NspV site. This restriction site will be used as a cloning site in a future vector. Thus, this site was removed by PCR mutagenesis. The first adenine in the NspV site (ttcgaa) was changed to guanine (ttcgga) to design and synthesize the primer virGonNspVRV and its complementary sequence virGonNspVFW. PCR was performed with two primer sets, i.e., one consisting of VirGonNspVFW and the primer virGProSpe placed upstream of the virG gene promoter and the other consisting of virGonNspVRV and the primer virGTerSpe placed downstream of the virG gene terminator. The virG gene cloned into pCR2.1Topo was used as a template. As a result, the product of about 400 by and the product of about 600 by were amplified by the former and latter sets, respectively. These products were purified and used as templates for the next PCR reaction. A PCR reaction was performed with the purified two PCR products as templates and the previous primers virGProSpe and virGTerSpe. As a result, the PCR product of about 1 kb was amplified. The PCR product was cloned into the pCR2.1Topo vector, and the nucleotide sequence was determined to confirm the mutation (ttcgaa.fwdarw.ttcgga).

[0390] Similarly, the unmutated virG gene was amplified by PCR with virGProSpe and virGTerSpe, and cloned into pCR2.1Topo, and the nucleotide sequence was determined. The primers used in PCR are summarized in Table 6.

TABLE-US-00006 TABLE 6 Designation Sequence 5'-3' Length virGProSm TCA ATA CCC ggg gTA ACC TCg AAg CgT TTC AC 32 mer virGTerSm Tgg TgA CCC ggg ACC TAT Cgg AAC CCC TCA C 31 mer virGProSpe TCA ATA ACT AgT gTA ACC TCg AAg CgT TTC AC 32 mer virGTerSpe Tgg TgA ACT AgT ACC TAT Cgg AAC CCC TCA C 31 mer virGonNspVRV CTT gAg ATC gTT Cgg AAT CTg 21 mer virGonNspVFW CAg ATT CCg AAC gAT CTC AAg 21 mer SEQ ID NOs: 46-51 in order from the top.

[0391] pLC40GWHvG1, pLC40GWHvGC1

[0392] The vector pLC40GWH was digested with the restriction endonuclease PvuII, and dephosphorylated. An SpeI linker (GACTAGTC, from Takara) was inserted to prepare pLC40GWHSpe. This plasmid was digested with the restriction endonuclease SpeI and dephosphorylated. A fragment of about 1 kb of the mutated virG gene excised with SpeI from the vector was inserted into this plasmid to prepare pLC40GWHvG1 (FIG. 13, SEQ ID NO: 7 in the Sequence Listing). Similarly, the unmutated virG gene was inserted into pLC40GWHSpe to prepare pLC40GWHvGC1.

[0393] pLC40GWHvG1:35S-IGUS, pLC40GWHvGC1:35S-IGUS

[0394] In the same manner as described above, the vector pSB24 (Komari et al. 1996) was treated with the restriction endonucleases HindIII and EcoRI to excise a DNA fragment containing the GUS gene, which was cloned into a vector having a multicloning site SgfI-HindIII-EcoRI-SgfI. The resulting plasmid was digested with SgfI to recover the DNA fragment containing the GUS gene. At this point, both ends of the DNA fragment containing the GUS gene are SgfI sites. The cosmid vector pLC40GWHvG1 described above was treated with the restriction endonuclease PacI and dephosphorylated. The 3.1 kb SgfI fragment (the DNA fragment containing the GUS gene) was cloned into it to generate pLC40GWHvG1:35S-IGUS. Similarly, 35S-IGUS-NOS was introduced into pLC40GWHvGC1 to prepare pLC40GWHvGC1:35S-IGUS.

[0395] 5) virG-Containing Vectors Capable of Coexisting with pLC

[0396] pVGW

[0397] pTOK47 is a large IncW plasmid of about 28 kb containing virG and virB (Jin et al. 1987 J Bacteriol 169: 4417-4425). Thus, a smaller vector capable of coexisting with a pLC vector and containing the origin of replication IncW ori, the virG gene, and a selectable marker gene (designated as pVGW) was designed and constructed.

[0398] The primers pSa5'EcT22 and pSa3'BglII for amplifying a fragment containing IncW on from pTOK47 (Jin et al. 1987 J Bacteriol 169: 4417-4425), and the primers Gm5'Bm and Gm3'Xh-2nd for amplifying the gentamycin resistance gene (gentamycin acetyltransferase) from pPH1JI (Hirsch and Beringer 1984 Plasmid 12: 139-141) were designed (Table 7). Each primer contains a restriction endonuclease site for later use. pTOK47 and pPH1JI were used as templates, respectively. Pyrobest DNA Polymerase (from TaKaRa) was used to perform PCR. As a result, a DNA fragment of about 2.7 kb containing IncW on and a DNA fragment of about 0.7 kb corresponding to the gentamycin resistance gene were amplified.

[0399] On the other hand, the primer virGN54DFW for changing the amino acid residue at position 54 of virG derived from pTOK47 from N to D by PCR mutagenesis (virGN54D, Hansen et al. 1994 Proc. Natl. Acad. Sci. USA 91: 7603-7607), and its complementary sequence virGN54DRV were designed. PCR was performed with two primer sets, i.e., one consisting of virGN54DFW and the primer virGProSal placed on the 5' of the virG gene promoter and the other consisting of virGN54DRV and the primer virGTerPst placed on the 3' of the virG gene terminator (Table 7). The pTOK47 plasmid was used as a template. As a result, the product of about 0.4 kb and the product of about 0.7 kb were amplified by the former and latter sets, respectively. These products were purified and used as templates along with the previous primers virGProSal and virGTerPst to further perform a PCR reaction. As a result, the product (virGN54D) of about 1.1 kb was amplified.

[0400] The PCR products of the fragment containing IncW ori, the gentamycin resistance gene, and virGN54D were cloned into the pCR-Blunt II-TOPO vector (Invitrogen). The nucleotide sequence was determined and compared with a publicly available sequence (Genbank/EMBL Accession Number: U30471) to reveal a deletion of 6 nucleotides in the fragment containing IncW ori, which was also found in pTOK47 used as a template. However, the nucleotide sequence of the gentamycin resistance gene was completely identical to the sequence in the database. virGN54D was found to contain the mutation at the desired site.

[0401] The plasmid into which the fragment containing IncW on had been cloned was digested with EcoT22I and BglII, and a 2.7 kb fragment was recovered. Similarly, the gentamycin resistance gene was digested with BamHI and XhoI, and virGN54D was digested with SalI and PstI, and each fragment was purified. These three fragments were ligated together (BglII and BamHI, XhoI and SalI, and PstI and EcoT22I produce the same sticky ends) to generate pVGW (FIG. 14, SEQ ID NO: 8 in the Sequence Listing).

TABLE-US-00007 TABLE 7 Designation Sequence Length pSa5'EcT22 5'-aaa atg cat ggc atg ttt aac aga atc tg-3' 29 mer pSa3'BglII 5'-ttt aga tct act cgt tcg cgg agc tgg-3' 27 mer Gm5'Bm 5'-aaa gga tcc ttc atg get tgt tat gac tg-3' 29 mer Gm3'Xh-2.sup.nd 5'-tgc ctc gag aca att tac cga aca act ccg-3' 30 mer virGN54DFW 5'-cga cct aaa tct aga tca aca ac-3' 23 mer viGN54DRV 5'-gtt gtt gat cta gat tta ggt cg-3' 23 mer virGProSal 5'-ttt gtc gac cat agg cga tct cct taa tc-3' 29 mer virGTerPst 5'-aaa ctg cag gtg aag agg gac cta tcg g-3' 28 mer SEQ ID NOs: 52-59 in order from the top.

[0402] pVGW2

[0403] To further increase the convenience of pVGW, the promoter region of the gentamycin resistance gene was extended and additional cloning sites were added to construct the vector pVGW2. The primers BamSmaGmPro and NheIsiteGmRv for amplifying the gentamycin resistance gene of the plasmid pPH1JI, and the primers `MscIsite-virG5` Fw (for these primers, see Table 8) and pSa3'BglII (described above) for amplifying the virG-IncW region of pVGW were designed. Each primer contains a restriction endonuclease site. A PCR reaction was performed as follows. One cycle of 98.degree. C. for 30 seconds and 35 cycles of 98.degree. C. for 10 seconds, 55.degree. C. for 5 seconds, and 72.degree. C. for 1 minute were performed using Mastercycler gradient (eppendorf) in 50 .mu.l of a reaction solution containing 1 ng of the template plasmid DNA, 25 .mu.l of 2.times. PrimeSTAR Max Premix (from Takara), and 15 pmoles of the primers. As a result, the PCR products of the gentamycin resistance gene (826 bp) and the virG-IncW region (3840 bp) were amplified. The gentamycin resistance gene was cloned into the vector pCR-Blunt II-TOPO (from Invitrogen), and transferred into E. coli TOP10 (Invitrogen) by electroporation. The cells were incubated on an LB agar plate containing the antibiotics kanamycin (50 .mu.g/ml) at 37.degree. C. overnight, and a plasmid was purified from the resulting colony. The nucleotide sequences of these clones (pCR-Gm) were determined by ABI PRISM Fluorescent Sequencer (Model 3100 Genetic Analyzer, from Applied Biosystems) to confirm that no mutation had been introduced by PCR error. The plasmid pCR-Gm was digested with BamHI and PvuII to recover the Gm fragment, which was ligated to the virG-IncW fragment digested with BglII (having a BglII site at one end and a blunt end at the other). The resulting clone was transferred into E. coli TOP10 by electroporation, and selected on an LB agar plate containing the antibiotics gentamycin (30 .mu.g/ml). A plasmid was purified from the resulting colony and confirmed by the sequencer to contain no PCR error, thereby generating pVGW2 (FIG. 15, SEQ ID NO: 67 in the Sequence Listing).

TABLE-US-00008 TABLE 8 Designation Sequence Length BamSmaGmPro 5'-AAA GGA TCC CGG GTT GAC ATA AGC CTG TTC GGT TCG-3' 36 mer NheIsiteGmRv 5'-AAA GCT AGC AAT TTA CCG AAC AAC TCC GCG G-3' 31 mer MscIsite-virG5'Fw 5'-AAA TGG CCA TAG GCG ATC TCC TTA ATC AAT-3' 30 mer SEQ ID NOs: 77-79 in order from the top.

Example 2

Cloning of Large Fragments by pLC Vectors

[0404] The present example describes examples of libraries of Arabidopsis thaliana (ecotype: colombia), wild species of rice (Oryza rufipogon), Sudan grass (Sorghum sudanense), an extremely early maturing variety of Italian millet (Setaria italica), teosinte (Zea diploperennis), pearl millet (Pennisetum typhoideum), Bahia grass (Paspalum notatum Flugge) and sugar cane (Saccharum officinarum) prepared with pLC40, pLC40GWH, pLCleo, pLC40GWHvG1, pSB200, pSB200PcHmGW, or pSB25U.

[0405] 1) Preparation of Genomic DNA

[0406] About 5 g of young leaves of each plant at about one month after seeding grown in a greenhouse was ground in a mortar under liquid nitrogen, and then the genomic DNA was purified by the CTAB method. The yield was about 500-600 .mu.g expressed as DNA. The genomic DNA was partially digested with 0.02-0.06 U/.mu.g of TaqI enzyme. After the partial digestion, fractions containing a genomic DNA fragment of 30-45 kb were recovered by 10-40% sucrose density gradient centrifugation.

[0407] 2) Preparation of the Vectors

[0408] The cosmid vectors pLC40, pLC40GWH, pLCleo, pLC40GWHvG1, pSB200, pSB200PcHmGW, and pSB25U were completely digested with the restriction endonuclease NspV (TOYOBO) and dephosphorylated, and then purified.

[0409] 3) Cloning by a Packaging Reaction

[0410] The vectors prepared as described above were ligated to the genomic DNA fragments, followed by a packaging reaction using GigaPack III XL Packaging extract at room temperature for 2 hours. After the reaction, the clones were incubated with E. coli GeneHogs (Invitrogen). As a result, libraries of 1-100,000 cfu (colony-forming-unit) were prepared from all of the combinations of the plant species and vectors (Table 9), as shown in Table 7.

TABLE-US-00009 TABLE 9 Plant species Vector Library cfu Arabidopsis thaliana pLC40 ca 80000 pSB200PcHmGWH ca 100000 Oryza rufipogon pLC40GWH ca 20000 pSB200 ca 50000 Extremely early pLC40GWH ca 20000 maturing Italian millet pSB200PcHmGWH ca 20000 Sugar cane pLC40GWH ca 50000 pLC40GWHvG1 ca 50000 Sudan grass pLC40GWH ca 50000 pSB200PcHmGWH ca 30000 Pearl millet pLC40GWH ca 20000 Teosinte pLC40GWH ca 100000 pSB25UNpHm ca 20000 Bahia grass pLCleo ca 10000

[0411] 4) Analysis of the Cloned Genomic DNA Fragments

[0412] Plasmids were purified from 12-24 clones of each library and cleaved with the restriction endonucleases HindIII and SacI in the multicloning site at each end of the insert, thereby yielding bands corresponding to the vectors (9.2-9.8 kb) in all of the clones analyzed in the case of pSB200, pSB25UNpHm and pSB200PcHmGW as well as bands corresponding to the vectors (13.2-14.2 kb) in all of the clones analyzed in the case of pLC40, pLC40GWH, pLCleo and pLC40GWHvG1. The length of the cloned large fragment is estimated to be in the range of 25 kb-45 kb from the total length of the restriction fragments of the insert of each clone, with an average of about 40 kb in the case of the pSB vectors and an average of about 35 kb in the case of the pLC vectors. FIG. 16 shows an example of teosinte genomic DNA/pLC40GWH.

[0413] Then, the human genome (Human Genomic DNA, Male, from Promega, Catalog No.: G1471) was partially digested with TaqI to prepare a 30-40 kb fragment, which was then cloned into the vector pLC40GWH. Plasmid DNA was purified from E. coli containing the human genomic fragment from arbitrary 12 clones, and the nucleotide sequences at both ends of the insert were analyzed and searched through a database. Homology searches were performed by BLAST through the database of GenBank at NCBI (http://www.ncbi.nlm.nih.gov/BLAST/). The results showed that 11 of the 12 clones isolated are included in 11 single clones containing the human genomic fragment in the database. Ten clones excluding one containing repeated sequences were analyzed for homology to the human genome sequence in the database, whereby the lengths of the cloned human genomic fragments were estimated to be 28023 bp, 31645 bp, 38265 bp, 39599 bp, 31965 bp, 32631 bp, 34727 bp, 36925 bp, 38794 bp, and 34364 bp. The average length was 34693.8 bp, which agreed well with the value obtained by cloning the plant genomes.

[0414] Then, the nucleotide sequences at both ends of the cloned plant genomic DNA fragments were determined. Homology searches were performed by BLAST on thus obtained sequence data of 300-600 nucleotides through the database of GenBank at NCBI (http://www.ncbi.nlm.nih.gov/BLAST/) and the database of Beijing Genomics Institute (http://btn.genomics.org.cn:8080/rice/). As a result, Oryza rufipogon and Arabidopsis showed a homology of 87-100% to the genome sequence of rice and Arabidopsis, respectively, over the range of at least 100 by or more. The libraries of the other plant species also showed significant homologies to the sequences of rice, Arabidopsis, maize, sorghum, etc.

Example 3

Transfer into Agrobacterium via Triparental Mating

[0415] 1) Transfer into Agrobacterium via triparental mating and its efficiency

[0416] Each vector containing a plant genomic fragment was transferred into Agrobacterium via triparental mating as follows. [0417] i) pLC40 series cosmid vectors

[0418] pLC40 series cosmid vectors are resistant to kanamycin (Km) and hygromycin (Hm). GeneHogs.TM. (Invitrogen) was used as host E. coli. pRK2073 (spectinomycin (Sp)-resistant) was used as a helper plasmid for triparental mating. HB101 was used as host E. coli for the helper plasmid. The Agrobacterium strain LBA4404 (no drug resistance) was used.

[0419] Initially, E. coli GeneHogs.TM. was infected with an appropriate amount of a dilution of a packaging reaction, spread on an LA plate containing Km (50 .mu.g/mL), and incubated at 23.degree. C. for 3 days. E. coli cells in a colony that appeared were streaked with a toothpick on an LA plate containing Km, and incubated at 28.degree. C. for 2 nights. On the other hand, LBA4404 was spread on an AB plate, and incubated at 25.degree. C. for 5 days. HB101/pRK2073 was spread on an LA plate containing Sp (50 .mu.g/mL), and incubated at 37.degree. C. for 2 nights. The cultures of the three strains, i.e., GeneHogs.TM. harboring a pLC40 series cosmid vector containing a cloned genomic fragment, LBA4404 and HB101/pRK2073 were mixed on an NA plate and incubated at 28.degree. C. overnight. The entire amount of the mixture of the three strains was suspended in 250 .mu.l of sterile water, and 5 .mu.l of the suspension was spread on an AB plate containing Km (50 .mu.g/mL) and Hm (25 .mu.g/mL), and incubated at 28.degree. C. for 7 days. The resulting recombinant Agrobacterium was used in plant transformation experiments. This single colony was reincubated on an AB plate containing Km and Hm and a part of the grown colony was spread on an LA with drugs, showing that few E. coli cells have been grown.

[0420] ii) pSB200 series cosmid vectors

[0421] pSB200 series cosmid vectors are Sp- and Hm-resistant. GeneHogs.TM. (Invitrogen) was used as host E. coli. pRK2013 (Km-resistant) was used as a helper plasmid. HB101 was used as host E. coli for the helper plasmid. The Agrobacterium strain LBA4404 harboring pSB1 (tetracycline (Tc) resistance) was used.

[0422] Initially, E. coli GeneHogs was infected with an appropriate amount of a dilution of a packaging reaction, spread on an LA plate containing Sp (50 .mu.g/mL), and incubated at 23.degree. C. for 3 days. A colony was picked with a toothpick and streaked on an LA plate containing Sp, and incubated at 28.degree. C. for further 2 nights. On the other hand, LBA4404/pSB1 was spread on an AB plate containing Tc (15 .mu.g/mL), and incubated at 25.degree. C. for 5 days. HB101/pRK2013 was spread on an LA plate containing Km (50 .mu.g/mL) and incubated at 37.degree. C. for 2 nights. The cultures of the three strains, i.e., GeneHogs.TM. harboring a pSB200 series cosmid vector containing a cloned genomic fragment, LBA4404/pSB1 and HB101/pRK2013 were mixed on an NA plate and incubated at 28.degree. C. overnight. The entire amount of the mixture of the three strains was suspended in 250 .mu.l of sterile water, and 25 .mu.l of the suspension was spread on an AB plate containing Sp (50 .mu.g/mL) and Hm (25 .mu.g/mL), and incubated at 28.degree. C. for 7 days. The resulting recombinant Agrobacterium was used in plant transformation experiments.

[0423] iii) pCLD04541

[0424] Two genome libraries (the genomes of the rice variety CO39 and Arabidopsis ecotype Colombia, both having an average insert length of 110 kb in host E. coli DH10B) prepared with the vector pCLD04541 provided from Dr. Hongbin Zhang of Texas A&M University were used for triparental mating. The pCLD04541 vector is Km- and Tc-resistant. pRK2073 was used as a helper plasmid, and HB101 was used as host E. coli for the helper plasmid. The Agrobacterium strain LBA4404 was used.

[0425] E. coli harboring each clone of the pCLD04541 libraries was spread on an LA containing Tc (10 .mu.g/mL), and incubated at 28.degree. C. for 2 nights. On the other hand, LBA4404 was spread on an AB plate, and incubated at 25.degree. C. for 5 days. HB101/pRK2073 was spread on an LA containing Sp (50 .mu.g/mL) and incubated at 37.degree. C. for 2 nights. The cultures of the three strains, i.e., DH10B harboring pCLD04541 containing a cloned genomic fragment, LBA4404 and HB101/pRK2073 were mixed on an NA plate and incubated at 28.degree. C. overnight. The entire amount of the mixture of the three strains was suspended in 250 .mu.l of sterile water, and a few microliters of the suspension was spread on an AB plate containing Km (25 .mu.g/mL), and incubated at 28.degree. C. for 7 days. The resulting recombinant Agrobacterium was used in plant transformation experiments.

[0426] As described above, genome clones included in the libraries prepared with pLC40 series cosmid vectors, pSB200 series cosmid vectors and the pCLD04541 vector were transferred into Agrobacterium. A summary of these triparental mating systems and the triparental mating efficiencies are shown in Table 7. The triparental mating efficiencies were 97% in pLC series vectors, 79% in pSB series vectors, and 93% in pCLD04541, respectively, showing that the pLC series vectors were the most efficient (Table 10).

TABLE-US-00010 TABLE 10 # of clones giving # of clones recom- Effi- used for binant ciency triparental Agrobact- (%) DNA donor plant Vector mating (a) erium (b) b/a <pLC40 series cosmid vectors> Oryza rufipogon pLC40 GWH 5657 5469 96.7 Arabidopsis thaliana pLC40 1532 1410 92.0 Sudan grass pLC40 GWH 2301 2201 95.7 Italian millet pLC40 GWH 2521 2405 95.4 Teosinte pLC40 GWH 10739 10593 98.6 Bahia grass pLCleo 384 383 99.7 Total 23134 22461 97.1 <pSB200 series cosmid vectors > Oryza rufipogon pSB200 10375 7504 72.3 Arabidopsis thaliana pSB200PcHmGWH 1332 1179 88.5 Sudan grass pSB200PcHmGWH 2096 2031 96.9 Italian millet pSB200PcHmGWH 2336 2032 87.0 Total 16139 12746 79.0 <pCLD04541> Indica riceCO39 pCLD04541 149 127 85.2 Arabidopsis thaliana pCLD04541 192 190 99.0 Total 341 317 93.0

[0427] 2) Stability of Genomic DNA

[0428] To analyze whether or not the genomic DNA fragment carried on each clone has been transferred to Agrobacterium, Southern hybridization was performed using the entire genomic DNA fragment as a probe. Plasmid DNAs were conventionally extracted from E. coli and Agrobacterium, and digested with the restriction endonucleases HindIII and SacI. Then, a part of the digests were fractionated by agarose gel electrophoresis, and transferred to the nylon membrane filter HybondN+. Then, a part of the HindIII and SacI digest (precipitated with ethanol and redissolved in TE) of the E. coli-derived plasmid was labeled with an ECL labelling kit (Amersham) and hybridized to this membrane as a probe. Hybridization, washing and signal detection were performed following the instructions attached to the ECL kit. All of four plasmids containing a rufipogon fragment cloned into pLC40GWH showed the transfer of the genomic DNA fragment from E. coli to Agrobacterium.

Example 4

Transformation of Large Fragments into Rice with pLC Vectors

[0429] 1) Rice Transformation and its Efficiency

[0430] i) Method for Rice Transformation

[0431] Immature embryos of the rice variety Yukihikari were infected with Agrobacterium. Rice transformation was performed by the method described in the Japanese Patent Application No. 2003-293125, except that all of the aseptically dissected immature embryos were centrifuged as a pretreatment before Agrobacterium inoculation. Specifically, the immature embryos were centrifuged in an eppendorf tube containing 1 ml of sterile water at 20000.times.g for 10 minutes (25.degree. C.). Hygromycin B was used as a selective drug and added at 50 mg/l each in the selective medium, regeneration medium and rooting medium. In the case of pLC40 series cosmid vectors and pSB200 series cosmid vectors, one immature embryo was inoculated with one Agrobacterium strain (one type of DNA fragment). In the case of pCLD04541, however, two immature embryos were inoculated with one Agrobacterium strain (one type of DNA fragment). Paromomycin was used as a selective drug and added at a concentration of 400-800 mg/l in the selective medium, regeneration medium and rooting medium.

[0432] ii) Transfer of Plant Genomic Fragments into Rice

[0433] The results of transformation are shown in Table 11. In the case of pSB200 series cosmid vectors, hygromycin-resistant individuals were obtained from 59.1%-62.7% of the strain. In contrast, pLC40 series cosmid vectors gave the transformants from 86.6%-95.4% of the strain. In all of the three donor plants of genomic DNA (Oryza rufipogon, Sudan grass, and an extremely early maturing variety of Italian millet), the efficiency was 24%-36% higher when pLC40 series cosmid vectors were used. In the case of the pCLD04541 vector, however, the efficiency was as low as 41-53.4%. These results suggested that pLC40 series cosmid vectors allow transfer of genomic DNA fragments into rice more efficiently than pSB200 series cosmid vectors and pLCD04541.

[0434] To evaluate the transformation efficiency of normal size gene expression units, vectors were tested by comparison in the transformation with a DNA fragment containing the GUS gene. When 25 Yukihikari immature embryos were used for each vector, pSB134 (WO2005/017169) gave an average of 11.7 hygromycin-resistant regenerated individuals per immature embryo while pLC40:35S-IGUS gave an average of 11.5 regenerated individuals.

TABLE-US-00011 TABLE 11 Results of the transformation of randomized plant genomic fragments into rice using a pSB or pLC vector # of # of genomic genomic fragments fragments used for that regenerated Agrobacterium- hygromycin- mediated resistant Genome donor plant Vector transformation (A) individuals (B) B/A (%) Oryza rufipogon pSB200 2246 1327 59.1 Oryza rufipogon pLC4OGWH 2271 2166 95.4 Sudan grass pSB200PcHmGWH 1997 1252 62.7 Sudan grass pLC4OGWH 1760 1524 86.6 Italian millet pSB200PcHmGWH 1940 1200 61.9 Italian millet pLC4OGWH 2285 1986 86.9 Bahia grass pLCleo 18 16 88.9 Indica rice CO39 pCLD04541 156 64 41.0 Arabidopsis thaliana pCLD04541 189 101 53.4

[0435] 2) Verification of the Transfer of Large Fragments

[0436] i) PCR of Flanking Regions of Fragments

[0437] Genomic DNAs were extracted from 11 transformants and young leaves of Yukihikari by the method described above. PCR was performed on these DNAs with 2 sets of the primers shown in the table below. pSB200-9531F and pSB200-4R are primers for amplifying a 139 by region from the RB to the genomic DNA fragment. HPTinRV and HPTinFW are primers for amplifying an internal region of the hygromycin resistance gene (Table 12). Thirty-five cycles of PCR were performed. As a result, the products were amplified with HPTinRV and HPTinFW in all of the 11 transformants, while no PCR product was obtained with either primer set in the control Yukihikari. When pSB200-9531F and pSB200-4R were used, PCR products were obtained in 10 of the 11 individuals. These results show that the flanking regions of the genomic DNA fragments were transferred into most of the plants transformed with pLC vectors, thus verifying the transfer of the genomic DNA fragments.

TABLE-US-00012 TABLE 12 Designation Sequence Length pSB200-9531F 5'-ctg aag gcg gga aac gac aat ctg-3' 24 mer pSB200-4R 5'-gct tgc tga gtg gct cct tca acg-3' 24 mer pSB200-170R 5'-aac tgc act tca aac aag tgt gac-3' 24 mer HPTinRV 5'-tat gtc ctg cgg gta aat ag-3' 20 mer HPTinFW 5'-ttg ttg gag ccg aaa tcc g-3' 19 mer SEQ ID NOs: 60-64 in order from the top.

[0438] ii) PCR of Both Terminal and Internal Sequences of Fragments

[0439] For each of three Oryza rufipogon fragments (called A, B, and C) used for the transformation into Yukihikari with the pLC40GWH vector, two individuals of TO plant were analyzed by PCR to determine whether or not both ends and the center region of each fragment had been introduced. PCR conditions included a treatment at 94.degree. C. for 2 minutes, followed by 35 cycles of thermal denaturation at 94.degree. C. for 30 seconds, annealing at 60.degree. C. for 30 seconds and extension at 60.degree. C. for 30 seconds, and finally a treatment at 72.degree. C. for 2 minutes.

[0440] To detect the RB side of fragment A, PCR (PCR1) was performed with pSB200-9531F and a primer specific to fragment A (5'-gtt aat ttc ttg tga tcg aag gac-3' (SEQ ID NO: 11)). To detect the center region of fragment A, a PCR assay was performed by the CAPS method (Konieczny and Ausubel 1993 Plant Journal 4: 403-410) using nucleotide sequence polymorphisms found between the sequence of Nipponbare AP004667 corresponding to fragment A (identified by database searches) and the sequence of Oryza rufipogon. Specifically, PCR (PCR2) was performed with two primers (5'-ggg att ctt tat gct ggg ttt agg-3' (SEQ ID NO: 12) and 5'-gca agc aat acc tct gtt atg ctg-3' (SEQ ID NO: 13)), and the product was digested with SspI. To detect the HPT side, PCR (PCR3) was performed with pSB200-170R and a primer specific to fragment A (5'-gtt ttc aga tgg cga cct cag ctt tg-3' (SEQ ID NO: 14)).

[0441] Similar marker assays were performed on fragment B and fragment C. Thus, to detect the RB side of fragment B, PCR was performed with pSB200-9531F and a primer specific to fragment B (5'-cag gtg gct tta ttc ctc ctc tca-3' (SEQ ID NO: 15)). To detect the center region of fragment B, a PCR assay was performed by the CAPS method using nucleotide sequence polymorphisms found between the sequence of Nipponbare AP005967 corresponding to fragment B (identified by database searches) and the sequence of Oryza rufipogon. Specifically, PCR was performed with two primers (5'-ccg aaa gtt cgt ggg caa tgc cta-3' (SEQ ID NO: 16) and 5'-gcc atc ctt agc ata tga gtg gca-3' (SEQ ID NO: 17)), and the product was digested with HaeIII. To detect the HPT side of fragment B, PCR was performed with pSB200-170R and a primer specific to fragment B (5'-ggc tat tta cgt ggc atg tta cgt-3' (SEQ ID NO: 18)). To detect the RB side of fragment C, PCR was performed with pSB200-9531F and a primer specific to fragment C (5'-tcg taa gtc tac ttc cct tta cga-3' (SEQ ID NO: 19)). To detect the center region of fragment C, a PCR assay was performed by the CAPS method using nucleotide sequence polymorphisms found between the sequence of Nipponbare AL713907 corresponding to fragment C (identified by database searches) and the sequence of Oryza rufipogon. Specifically, PCR was performed with two primers (5'-cca aac cac atc ctt ata gtg tgc-3' (SEQ ID NO: 20) and 5'-cct cat tgc atg cgg tca cta c-3' (SEQ ID NO: 21)), and the product was digested with HaeIII. To detect the HPT side of fragment C, PCR was performed with pSB200-170R and a primer specific to fragment C (5'-gca ggg tat taa tcg atc aac acc-3' (SEQ ID NO: 22)).

[0442] Analytical results of fragment B are shown in FIG. 17, and analytical results of fragments A-C are summarized in Table 13. Of the two transformants tested for fragment A, no individual containing the entire large fragment was obtained but an individual containing the center region and one end, or both ends was obtained. However, one of the two individuals tested for fragment B and fragment C was shown to contain the entire Oryza rufipogon fragment, i.e., both ends and the center region. These results verified that plant genomic fragments of 25-40 kb in size can be transferred into plants by pLC vectors.

TABLE-US-00013 TABLE 13 Fragment T0 plant RB side center HPT side A 1 - + + 2 + - + B 1 + + - 2 + + + C 1 - - - 2 + + + +: An oryza rufipogon fragment was detected. -: An oryza rufipogon fragment was not detected.

Example 5

Transformation of Maize with pLC40 Series Cosmid Vectors

[0443] 1) Combination of pLC with pTOK47 or pLC with pVGW

[0444] A vector containing a vir gene is required for maize transformation to increase the transformation efficiency (Ishida et al. 1996 Nat Biotechnol 14:745-50) because the efficiency with ordinary binary vectors is very low except for special methods (Frame et al. (2002) Plant Physiol 129: 13-22). pLC40 series cosmid vectors are ordinary binary vectors so that they should be modified by using a vir gene to improve the transformation efficiency. Thus, the vector pTOK47 capable of coexisting with pLC40 series cosmid vectors (IncP plasmids) in bacteria and expressing a vir gene (Jin et al. 1987 J Bacteriol 169: 4417-4425), and a vector newly constructed by the present invention, pVGW were initially used in combination with pLC. pTOK47 is an IncW plasmid carrying a DNA fragment (KpnI 14.8 kb fragment) containing the virB gene and the virG gene derived from the Agrobacterium strain A281, and capable of coexisting with IncP plasmids. pVGW is a plasmid containing a variant virG (virGN54D) and IncW ori.

[0445] pTOK47 (tetracycline-resistant) was transferred into the Agrobacterium LBA4404 or EHA105 (a kind gift from Dr. Stanton Gelvin of Purdue University) via triparental mating. A plasmid was extracted from this Agrobacterium and confirmed by restriction endonuclease analysis to contain pTOK47. Further, pLC40:35S-IGUS or pLC40GWB:35S-IGUS was introduced into the resulting LBA4404/pTOK47 or EHA105/pTOK47 (Tc-resistant) via triparental mating. These Agrobacteria are described as LBA4404/pTOK47/pLC40:35S-IGUS, LBA4404/pTOK47/pLC40GWB:35S-IGUS, EHA105/pTOK47/pLC40:35S-IGUS, and EHA105/pTOK47/pLC40GWB:35S-IGUS. Plasmid DNAs were extracted from the Agrobacteria and analyzed by PCR to confirm the presence of the VirG, RB, hpt or bar, and GUS genes.

[0446] In the same manner, pVGW was transferred into the Agrobacterium LBA4404 by electroporation, and a colony was selected by gentamycin (Gm 50 .mu.g/mL). pLC40:35S-IGUS or pLC40GWB:35S-IGUS was introduced into the resulting LBA4404/pVGW via triparental mating. These Agrobacteria are described as LBA4404/pVGW/pLC40:35S-IGUS and LBA4404/pVGW/pLC40GWB:35S-IGUS. Agrobacterium colonies (Km- and Gm-resistant) were directly analyzed by PCR to confirm the presence of the VirG, hpt or bar, and GUS genes.

[0447] Moreover, pIG121Hm derived from the IncP plasmid pBI121 (Hiei et al. (1994) Plant J 6: 271-282) was introduced into LB4404/pTOK47 to prepare Agrobacterium LB4404/pTOK47/pIG121Hm, which was used as a control in maize transformation experiments.

[0448] 2) Transformation of Maize

[0449] Maize immature embryos having a size of about 1.2 mm (variety: A188) were aseptically removed from a plant grown in a greenhouse, and immersed in a liquid medium for suspending Agrobacterium (LS-inf, Ishida et al. 1996). After thermal treatment at 46.degree. C. for 3 minutes, the immature embryos were washed with the same liquid medium. After centrifugation at 15,000 rpm, 4.degree. C., for 10 minutes, the immature embryos were then immersed in a suspension of each strain at about 1.times.10.sup.9 cfu/ml in LS-inf medium (containing 100 .mu.M acetosyringon) and then plated on a coculture medium (LS-AS (Ishida et al. 1996 Nat Biotechnol 14:745-50) containing AgNO.sub.3, CuSO.sub.4). After incubation at 25.degree. C. in darkness for 3 days, the immature embryos were partially used for GUS analysis.

[0450] The cocultured immature embryos were plated on a selective medium containing hygromycin or phosphinothricin (Ishida et al. (2003) Plant Biotechnology 20:57-66) and incubated. A callus grown was excised and plated on a regeneration medium containing hygromycin (Hm) or phosphinothricin (PPT) (Ishida et al. 1996 Nat Biotechnol 14:745-50), and incubated under illumination. After two weeks, regenerated plants showing resistance to Hm or PPT were investigated.

[0451] Initially, A188 immature embryos were inoculated with various strains and observed for the transient expression of the GUS gene on day 3 of coculture. Immature embryos inoculated with the control LBA4404/pSB134 showed the expression of the GUS gene over a wide range. However, few immature embryos inoculated with LBA4404/pLC40:35S-IGUS showed the expression except for limited ones showing the expression in very small spots. No increase in expression was found when EHA105 was used as a host. Most of immature embryos inoculated with LBA4404/pTOK47/pLC40:35S-IGUS, LBA4404/pLC40GWHvG1:35S-IGUS, LBA4404/pVGW/pLC40:35S-IGUS and LBA4404/pVGW/pLC40GWB:35S-IGUS showed spots representing the expression of the GUS gene to a lesser extent than with LBA4404/pSB134, thus verifying that the gene transfer efficiency is improved by the coexistence with a plasmid containing the virB gene and virG gene derived from the Agrobacterium strain A281, or the coexistence with a plasmid containing virGN54D, or the addition of the virG gene. On the other hand, there is no difference in the expression of the GUS gene between pLC40GWHvG1:35S-IGUS and pLC40GWHvGC1:35S-IGUS, showing that a single nucleotide substitution for removing an NspV recognition site does not influence the virG activity.

[0452] Then, we tried to create transformed plants by incubating the cocultured immature embryos in a selective medium containing Hm or PPT and a regeneration medium. When EHA105 was used as a host, the pLCSBGWBSW vector gave no PPT-resistant plant. When LBA4404 was used as a host, however, the pLCSBGWBSW vector gave plants showing resistance to PPT at an efficiency comparable to that of the superbinary vector pSB131 (containing the GUS gene and the bar gene in the T-DNA region, Ishida et al. 1996 Nat Biotechnol 14:745-50) using the same strain as a host (Table 14).

[0453] LBA4407/pTOK47/pLC40GWB:35S-IGUS was also shown to give PPT-resistant plants at a high efficiency comparable to that of the superbinary vector pSB131. When the hygromycin resistance gene was used as a selectable marker gene, a pLC40 series cosmid vector (pLC40:35S-IGUS) combined with pTOK47 also gave hygromycin-resistant plants (Table 13). pLC40GWHvG1 containing the virG gene also achieved an efficiency comparable to that of the superbinary vector SB134 (containing the GUS gene and the hygromycin resistance gene in the T-DNA region, Hiei and Komari 2006 Plant Cell, Tissue and Organ Culture 85: 271-283) (Table 14).

TABLE-US-00014 TABLE 14 Results of transformation of maize Rediffer- # of immature embryos entiation Exper- Selective Inoculated rediffer- ratio iment Strain drug (A) entiated (B) (B/A, %) 1 LBA4404 (pLCSBGWBSW) PPT 46 10 21.7 EHA105 (pLCSBGWBSW) PPT 46 0 0 LBA4404 (pSB131) PPT 45 9 20.0 2 LBA4404 (pLC40GWB:35S-IGUS) PPT 56 0 0 LBA4404 (pLC40GWB:35S-IGUS/ PPT 57 14 24.6 pTOK47) LBA4404 (pSB131) PPT 59 19 32.2 3 LBA4404(pLC40:35S-IGUS) Hm 43 0 0 LBA4404(pLC40:35S-IGUS /pTOK47) Hm 44 2 4.5 LBA4404(pIG121Hm) Hm 42 0 0 LBA4404(pIG121Hm/pTOK47) Hm 42 0 0 4 LBA4404(pLC40GWHvG1) Hm 59 5 8.5 LBA4404(pSB134) Hm 57 5 8.8 PPT: phosphinothricin, Hm: hygromicin

[0454] In order to examine the influence of pVGW on maize transformation, maize was then transformed with LBA4404/pLC40:35S-IGUS, LBA4404/pVGW/pLC40:35S-IGUS, LBA4404/pVGW/pLC40GWB:35S-IGUS, and LBA4404/pSB134, and the regenerated individuals were analyzed for GUS expression. As a result, the proportion of the number of GUS-expressing individuals in pLC40:35S-IGUS was 0% (0/16), while the proportion of the number of GUS-expressing individuals per inoculated immature embryo in pLC40:35S-IGUS and pLC40GWB:35S-IGUS both combined with pVGW reached 40% (6/15) and 30% (6/20), respectively, which were comparable to 41.2% (7/17) in the superbinary vector pSB134. Thus, the transformation of maize with pLC vectors could be achieved at high efficiency by using pVGW.

[0455] We further tried to transform plant genomic fragments into maize by combining a pLC vector and the pVGW vector. A genomic fragment (30-35 kb) of Sudan grass was randomly cloned into the NspV site of the vector pLC40GWB. The resulting E. coli plasmid was transferred to Agrobacterium harboring pVGW (LBA4404) via triparental mating. In this manner, Agrobacterium harboring both of the plasmids pLC40GWB containing the genomic fragment of Sudan grass and pVGW was prepared, and inoculated into maize immature embryos (variety: A188). Transformed cells were selected to show that 17 of the 27 fragments inoculated gave redifferentiated plants (Table 15). This showed that plant genomic fragments can be efficiently transformed into maize by the combination of pLC and pVGW.

[0456] These results demonstrated that maize transformation can be efficiently achieved by the combination with a plasmid carrying a DNA fragment containing the virB gene and virG gene derived from the Agrobacterium strain A281 such as pTOK47, or the combination with a plasmid containing the virGN54D gene such as pVGW, or the incorporation of the virG gene into a pLC vector such as pLC40GWHvG1.

TABLE-US-00015 TABLE 15 Results of the transformation of randomized plant genomic fragments into maize using a pLC/pVGW vector system # of genomic # of genomic fragments used for fragments that Agrobacterium- regenerated Genome mediated PPT-resistant B/A donor plant Strain transformation (A) individuals (B) (%) Sudan grass LBA4404(pLC40GWB/pVGW) 27 17 63.0

Example 6

Isolation of a Gene of Interest from BAC Clones Using pLC Vectors

[0457] Komori et al. (2004) (Plant J 37: 315-325) found that a cytoplasmic male sterile strain restores fertility when it is transformed with the PPR791 gene isolated from the rice variety IR24, thus demonstrating that PPR791 is the fertility restorer gene Rf-1. The PRR791 gene was identical with the PPR8-1 gene of the rice variety Milyang 23 that had been previously reported as a candidate for Rf-1 by Kazama and Toriyama (2003) (FEES Lett 544: 99-102). Thus, the BAC clone OSIMBb0046F08 of Milyang 23 from which the PPR8-1 gene had been derived was obtained from Clemson University, and a model experiment was performed for isolating Rf-1 from the BAC.

[0458] Initially, a plasmid was extracted from OSIMBb0046F08 using High Purity Plasmid Midiprep System (Marligen). The plasmid was partially digested with TaqI and a DNA fragment around 30 kb was recovered by sucrose density gradient centrifugation. This DNA fragment was ligated to the BstBI-digested and CIP-treated pLC40GWH vector or the BstBI-digested and CIP-treated pSB200 vector using DNA Ligation Kit <Mighty Mix> (Takara Bio Inc.). The resulting construct was transferred into E. coli by electroporation to give colonies of transformants on an LB plate containing an appropriate antibiotic (50 .mu.g/ml kanamycin or spectinomycin). To determine the presence or absence of the Rf-1 gene in the resulting plasmid, direct PCR (see Examples 1, 3)) was performed by using these colonies as templates along with primers designed for the Rf-1 gene (WSF7T7R1 and IR50226R, Table 16) to select Rf-1 positive clones giving an amplified product of about 2 kb from Rf-1 negative clones showing no amplification of the product. The incidence of positive clones in this PCR screening was 5/39 (12.8%) in the pLC40GWH construct and 6/96 (6.3%) in the pSB200 construct. That is, the cloning efficiency of a gene of interest was about twice higher in the pLC vector than pSB.

[0459] One positive clone and two negative clones selected from the pLC40GWH construct, and one positive clone and two negative clones selected from the pSB200 construct were transferred from E. coli to Agrobacterium via triparental mating. The cytoplasmic male sterile strain MS Koshihikari was infected with the resulting Agrobacterium by the method described in Komori et al. (2004). The resulting transformed rice was acclimated and then grown in a greenhouse. During the maturing stage, an average ear was collected from each individual and evaluated for the fertility rate. The results showed that transformants from constructs containing no Rf-1 (pLC-7, pLC-11, pSB-1, pSB-7) were sterile, while constructs containing Rf-1 (pLC-8, pSB-37) gave fertile transformants (Table 17).

[0460] These results demonstrated that a gene of interest can be efficiently identified by preparing a library from DNA of BAC containing the gene of interest using a cosmid vector for plant transformation and transferring it into a plant and then selecting a plant showing an expected phenotype.

TABLE-US-00016 TABLE 16 Primer Name Sequence Length WSF7T7R1 5'-AGT GTG TGG CAT GGT GCA TTT 24 mer CCG-3' IR50226R 5'-CTC TAC AGG ATA CAC GGT GTA 24 mer AGG-3' SEQ ID NOs: 80-81 in order from the top.

TABLE-US-00017 TABLE 17 Fertility restoration by various constructs Presence(+) or # of # of absence(-) individuals individuals Construct of Rf-1 analyzed fetile pLC-8 + 6 4 pLC-7 - 9 0 pLC-11 - 8 0 pSB-37 + 9 6 pSB-1 - 9 0 pSB-7 - 9 0

[0461] In conclusion, pLC vectors are characterized in that:

1. they allow easy cloning of DNA in the order of 25-40 kb; 2. they are stable in bacteria; and 3. they allow efficient transformation of plants, especially monocotyledons.

[0462] pLC vector series are useful for handling medium-size DNA in the field of functional genomics.

Sequence CWU 1

1

8118507DNAArtificialp6FRG 1tggcgctcgg tcttgccttg ctcgtcggtg atgtacttca ccagctccgc gaagtcgctc 60ttcttgatgg agcgcatggg gacgtgcttg gcaatcacgc gcaccccccg gccgttttag 120cggctaaaaa agtcatggct ctgccctcgg gcggaccacg cccatcatga ccttgccaag 180ctcgtcctgc ttctcttcga tcttcgccag cagggcgagg atcgtggcat caccgaaccg 240cgccgtgcgc gggtcgtcgg tgagccagag tttcagcagg ccgcccaggc ggcccaggtc 300gccattgatg cgggccagct cgcggacgtg ctcatagtcc acgacgcccg tgattttgta 360gccctggccg acggccagca ggtaggccga caggctcatg ccggccgccg ccgccttttc 420ctcaatcgct cttcgttcgt ctggaaggca gtacaccttg ataggtgggc tgcccttcct 480ggttggcttg gtttcatcag ccatccgctt gccctcatct gttacgccgg cggtagccgg 540ccagcctcgc agagcaggat tcccgttgag caccgccagg tgcgaataag ggacagtgaa 600gaaggaacac ccgctcgcgg gtgggcctac ttcacctatc ctgcccggct gacgccgttg 660gatacaccaa ggaaagtcta cacgaaccct ttggcaaaat cctgtatatc gtgcgaaaaa 720ggatggatat accgaaaaaa tcgctataat gaccccgaag cagggttatg cagcggaaaa 780gcgctgcttc cctgctgttt tgtggaatat cactagattc gagccacggt agcggcgggc 840gccgtgattg atgatatagc ggcccggctg ctcctggttc tcgcgcaccg aaatgggtga 900cttcaccccg cgctctttga tcgtggcacc gatttccgcg atgctctccg gggaaaagcc 960ggggttgtcg gccgtccgcg gctgatgcgg atcttcgtcg atcaggtcca ggtccagctc 1020gatagggccg gaaccgccct gagacgccgc aggagcgtcc aggaggctcg acaggtcgcc 1080gatgctatcc aaccccaggc cggacggctg cgccgcgcct gcggcttcct gagcggccgc 1140agcggtgttt ttcttggtgg tcttggcttg agccgcagtc attgggaaat ctccatcttc 1200gtgaacacgt aatcagccag ggcgcgaacc tctttcgatg ccttgcgcgc ggccgttttc 1260ttgatcttcc agaccggcac accggatgcg agggcatcgg cgatgctgct gcgcaggcca 1320acggtggccg gaatcatcat cttggggtac gcggccagca gctcggcttg gtggcgcgcg 1380tggcgcggat tccgcgcatc gaccttgctg ggcaccatgc caaggaattg cagcttggcg 1440ttcttctggc gcacgttcgc aatggtcgtg accatcttct tgatgccctg gatgctgtac 1500gcctcaagct cgatggggga cagcacatag tcggccgcga agagggcggc cgccaggccg 1560acgccaaggg tcggggccgt gtcgatcagg cacacgtcga agccttggtt cgccagggcc 1620ttgatgttcg ccccgaacag ctcgcgggcg tcgtccagcg acagccgttc ggcgttcgcc 1680agtaccgggt tggactcgat gagggcgagg cgcgcggcct ggccgtcgcc ggctgcgggt 1740gcggtttcgg tccagccgcc ggcagggaca gcgccgaaca gcttgcttgc atgcaggccg 1800gtagcaaagt ccttgagcgt gtaggacgca ttgccctggg ggtccaggtc gatcacggca 1860acccgcaagc cgcgctcgaa aaagtcgaag gcaagatgca caagggtcga agtcttgccg 1920acgccgcctt tctggttggc cgtgaccaaa gttttcatcg tttggtttcc tgttttttct 1980tggcgtccgc ttcccacttc cggacgatgt acgcctgatg ttccggcaga accgccgtta 2040cccgcgcgta cccctcgggc aagttcttgt cctcgaacgc ggcccacacg cgatgcaccg 2100cttgcgacac tgcgcccctg gtcagtccca gcgacgttgc gaacgtcgcc tgtggcttcc 2160catcgactaa gacgccccgc gctatctcga tggtctgctg ccccacttcc agcccctgga 2220tcgcctcctg gaactggctt tcggtaagcc gtttcttcat ggataacacc cataatttgc 2280tccgcgcctt ggttgaacat agcggtgaca gccgccagca catgagagaa gtttagctaa 2340acatttctcg cacgtcaaca cctttagccg ctaaaactcg tccttggcgt aacaaaacaa 2400aagcccggaa accgggcttt cgtctcttgc cgcttatggc tctgcacccg gctccatcac 2460caacaggtcg cgcacgcgct tcactcggtt gcggatcgac actgccagcc caacaaagcc 2520ggttgccgcc gccgccagga tcgcgccgat gatgccggcc acaccggcca tcgcccacca 2580ggtcgccgcc ttccggttcc attcctgctg gtactgcttc gcaatgctgg acctcggctc 2640accataggct gaccgctcga tggcgtatgc cgcttctccc cttggcgtaa aacccagcgc 2700cgcaggcggc attgccatgc tgcccgccgc tttcccgacc acgacgcgcg caccaggctt 2760gcggtccaga ccttcggcca cggcgagctg cgcaaggaca taatcagccg ccgacttggc 2820tccacgcgcc tcgatcagct cttgcactcg cgcgaaatcc ttggcctcca cggccgccat 2880gaatcgcgca cgcggcgaag gctccgcagg gccggcgtcg tgatcgccgc cgagaagatc 2940cttccattgt tcattccacg gacaaaaaca gagaaaggaa acgacagagg ccaaaaagct 3000cgctttcagc acctgtcgtt tcctttcttt tcagagggta ttttaaataa aaacattaag 3060ttatgacgaa gaagaacgga aacgccttaa accggaaaat tttcataaat agcgaaaacc 3120cgcgaggtcg ccgccccgta acctgtcgga tcaccggaaa ggacccgtaa agtgataatg 3180attatcatct acatatcaca acgtgcgtgg aggccatcaa accacgtcaa ataatcaatt 3240atgacgcagg tatcgtatta attgatctgc atcaacttaa cgtaaaaaca acttcagaca 3300atacaaatca gcgacactga atacggggca acctcatgtc aattcgctag ccagctggcg 3360ctgccatttt tggggtgagg ccgttcgcgg ccgaggggcg cagcccctgg ggggatggga 3420ggcccgcgtt agcgggccgg gagggttcga gaaggggggg cacccccctt cggcgtgcgc 3480ggtcacgcgc acagggcgca gccctggtta aaaacaaggt ttataaatat tggtttaaaa 3540gcaggttaaa agacaggtta gcggtggccg aaaaacgggc ggaaaccctt gcaaatgctg 3600gattttctgc ctgtggacag cccctcaaat gtcaataggt gcgcccctca tctgtcagca 3660ctctgcccct caagtgtcaa ggatcgcgcc cctcatctgt cagtagtcgc gcccctcaag 3720tgtcaatacc gcagggcact tatccccagg cttgtccaca tcatctgtgg gaaactcgcg 3780taaaatcagg cgttttcgcc gatttgcgag gctggccagc tccacgtcgc cggccgaaat 3840cgagcctgcc cctcatctgt caacgccgcg ccgggtgagt cggcccctca agtgtcaacg 3900tccgcccctc atctgtcagt gagggccaag ttttccgcga ggtatccaca acgccggcgg 3960ccgcggtgtc tcgcacacgg cttcgacggc gtttctggcg cgtttgcagg gccatagacg 4020gccgccagcc cagcggcgag ggcaaccagc ccggtgagcg tcggaaaggc gctggaagcc 4080ccgtagcgac gcggagaggg gcgagacaag ccaagggcgc aggctcgatg cgcagcacga 4140catagccggt tctcgcaagg acgagaattt ccctgcggtg cccctcaagt gtcaatgaaa 4200gtttccaacg cgagccattc gcgagagcct tgagtccacg ctatcgaatc gatactatgt 4260tatacgccaa ctttgaaaac aactttgaaa aagctgtttt ctggtattta aggttttaga 4320atgcaaggaa cagtgaattg gagttcgtct tgttataatt agcttcttgg ggtatcttta 4380aatactgtag aaaagaggaa ggaaataata aatggctaaa atgagaatat caccggaatt 4440gaaaaaactg atcgaaaaat accgctgcgt aaaagatacg gaaggaatgt ctcctgctaa 4500ggtatataag ctggtgggag aaaatgaaaa cctatattta aaaatgacgg acagccggta 4560taaagggacc acctatgatg tggaacggga aaaggacatg atgctatggc tggaaggaaa 4620gctgcctgtt ccaaaggtcc tgcactttga acggcatgat ggctggagca atctgctcat 4680gagtgaggcc gatggcgtcc tttgctcgga agagtatgaa gatgaacaaa gccctgaaaa 4740gattatcgag ctgtatgcgg agtgcatcag gctctttcac tccatcgaca tatcggattg 4800tccctatacg aatagcttag acagccgctt agccgaattg gattacttac tgaataacga 4860tctggccgat gtggattgcg aaaactggga agaagacact ccatttaaag atccgcgcga 4920gctgtatgat tttttaaaga cggaaaagcc cgaagaggaa cttgtctttt cccacggcga 4980cctgggagac agcaacatct ttgtgaaaga tggcaaagta agtggcttta ttgatcttgg 5040gagaagcggc agggcggaca agtggtatga cattgccttc tgcgtccggt cgatcaggga 5100ggatatcggg gaagaacagt atgtcgagct attttttgac ttactgggga tcaagcctga 5160ttgggagaaa ataaaatatt atattttact ggatgaattg ttttagtacc tagatgtggc 5220gcaacgatgc cggcgacaag caggagcgca ccgacttctt ccgcatcaag tgttttggct 5280ctcaggccga ggcccacggc aagtatttgg gcaaggggtc gctggtattc gtgcagtcga 5340gcagccgaga acattggttc ctgtaggcat cgggattggc ggatcaaaca ctaaagctac 5400tggaacgagc agaagtcctc cggccgccag ttgccaggcg gtaaaggtga gcagaggcac 5460gggaggttgc cacttgcggg tcagcacggt tccgaacgcc atggaaaccg cccccgccag 5520gcccgctgcg acgccgacag gatctagcgc tgcgtttggt gtcaacacca acagcgccac 5580gcccgcagtt ccgcaaatag cccccaggac cgccatcaat cgtatcgggc tacctagcag 5640agcggcagag atgaacacga ccatcagcgg ctgcacagcg cctaccgtcg ccgcgacccg 5700cccggcaggc ggtagaccga aataaacaac aagctccaga atagcgaaat attaagtgcg 5760ccgaggatga agatgcgcat ccaccagatt cccgttggaa tctgtcggac gatcatcacg 5820agcaataaac ccgccggcaa cgcccgcagc agcataccgg cgacccctcg gcctcgctgt 5880tcgggctcca cgaaaacgcc ggacagatgc gccttgtgag cgtccttggg gccgtcctcc 5940tgtttgaaga ccgacagccc aatgatctcg ccgtcgatgt aggcgccgaa tgccacggca 6000tctcgcaacc gttcagcgaa cgcctccatg ggctttttct cctcgtgctc gtaaacggac 6060ccgaacatct ctggagcttt cttcagggcc gacaatcgga tctcgcggaa atcctgcacg 6120tcggccgctc caagccgtcg aatctgagcc ttaatcacaa ttgtcaattt taatcctctg 6180tttatcggca gttcgtagag cgcgccgtgc gtcccgagcg atactgagcg aagcaagtgc 6240gtcgagcagt gcccgcttgt tcctgaaatg ccagtaaagc gctggctgct gaacccccag 6300ccggaactga ccccacaagg ccctagcgtt tgcaatgcac caggtcatca ttgacccagg 6360cgtgttccac caggccgctg cctcgcaact cttcgcaggc ttcgccgacc tgctcgcgcc 6420acttcttcac gcgggtggaa tccgatccgc acatgaggcg gaaggtttcc agcttgagcg 6480ggtacggctc ccggtgcgag ctgaaatagt cgaacatccg tcgggccgtc ggcgacagct 6540tgcggtactt ctcccatatg aatttcgtgt agtggtcgcc agcaaacagc acgacgattt 6600cctcgtcgat caggacctgg caacgggacg ttttcttgcc acggtccagg acgcggaagc 6660ggtgcagcag cgacaccgat tccaggtgcc caacgcggtc ggacgtgaag cccatcgccg 6720tcgcctgtag gcgcgacagg cattcctcgg ccttcgtgta ataccggcca ttgatcgacc 6780agcccaggtc ctggcaaagc tcgtagaacg tgaaggtgat cggctcgccg ataggggtgc 6840gcttcgcgta ctccaacacc tgctgccaca ccagttcgtc atcgtcggcc cgcagctcga 6900cgccggtgta ggtgatcttc acgtccttgt tgacgtggaa aatgaccttg ttttgcagcg 6960cctcgcgcgg gattttcttg ttgcgcgtgg tgaacagggc agagcgggcc gtgtcgtttg 7020gcatcgctcg catcgtgtcc ggccacggcg caatatcgaa caaggaaagc tgcatttcct 7080tgatctgctg cttcgtgtgt ttcagcaacg cggcctgctt ggcctcgctg acctgttttg 7140ccaggtcctc gccggcggtt tttcgcttct tggtcgtcat agttcctcgc gtgtcgatgg 7200tcatcgactt cgccaaacct gccgcctcct gttcgagacg acgcgaacgc tccacggcgg 7260ccgatggcgc gggcagggca gggggagcca gttgcacgct gtcgcgctcg atcttggccg 7320tagcttgctg gaccatcgag ccgacggact ggaaggtttc gcggggcgca cgcatgacgg 7380tgcggcttgc gatggtttcg gcatcctcgg cggaaaaccc cgcgtcgatc agttcttgcc 7440tgtatgcctt ccggtcaaac gtccgattca ttcaccctcc ttgcgggatt gccccgactc 7500acgccggggc aatgtgccct tattcctgat ttgacccgcc tggtgccttg gtgtccagat 7560aatccacctt atcggcaatg aagtcggtcc cgtagaccgt ctggccgtcc ttctcgtact 7620tggtattccg aatcttgccc tgcacgaata ccagcgaccc cttgcccaaa tacttgccgt 7680gggcctcggc ctgagagcca aaacacttga tgcggaagaa gtcggtgcgc tcctgcttgt 7740cgccggcatc gttgcgccac tcttcattaa ccgctatatc gaaaattgct tgcggcttgt 7800tagaattgcc atgacgtacc tcggtgtcac gggtaagatt accgataaac tggaactgat 7860tatggctcat atcgaaagtc tccttgagaa aggagactct agtttagcta aacattggtt 7920ccgctgtcaa gaactttagc ggctaaaatt ttgcgggccg cgaccaaagg tgcgaggggc 7980ggcttccgct gtgtacaacc agatattttt caccaacatc cttcgtctgc tcgatgagcg 8040gggcatgacg aaacatgagc tgtcggagag ggcaggggtt tcaatttcgt ttttatcaga 8100cttaaccaac ggtaaggcca acccctcgtt gaaggtgatg gaggccattg ccgacgccct 8160ggaaactccc ctacctcttc tcctggagtc caccgacctt gaccgcgagg cactcgcgga 8220gattgcgggt catcctttca agagcagcgt gccgcccgga tacgaacgca tcagtgtggt 8280tttgccgtca cataaggcgt ttatcgtaaa gaaatggggc gacgacaccc gaaaaaagct 8340gcgtggaagg ctctgacgcc aagggttagg gcttgcactt ccttctttag ccgctaaaac 8400ggccccttct ctgcgggccg tcggctcgcg catcatatcg acatcctcaa cggaagccgt 8460gccgcgaatg gcatcgggcg ggtgcgcttt gacagttgtt ttggatc 8507213429DNAArtificialpLC40 2aagcttgcgg ccgcttcgaa gatgttaatt aacatcggta ccgagctcta gggataacag 60ggtaatagct cgaattctag cttgcatgcc tgcagtgcag cgtgacccgg tcgtgcccct 120ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 180tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 240gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 300cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 360ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 420catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 480tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 540tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 600taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 660gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 720cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 780ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 840gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 900cggcagctac gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt 960aataaataga caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca 1020cacacacaac cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg 1080ctcgtcctcc cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta 1140gggcccggta gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg 1200tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact 1260tgccagtgtt tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg 1320atttcatgat tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca 1380atatatgccg tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt 1440gatgatgtgg tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac 1500ctggtggatt tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa 1560ttgaagatga tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta 1620ctgatgcata tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg 1680cggtcgttca ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta 1740ttaattttgg aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat 1800ggaaatatcg atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat 1860gatggcatat gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa 1920acaagtatgt tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag 1980ctatatgtgg atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc 2040ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatcc 2100cggggggcaa tgagatatga aaaagcctga actcaccgcg acgtctgtcg agaagtttct 2160gatcgaaaag ttcgacagcg tctccgacct gatgcagctc tcggagggcg aagaatctcg 2220tgctttcagc ttcgatgtag gagggcgtgg atatgtcctg cgggtaaata gctgcgccga 2280tggtttctac aaagatcgtt atgtttatcg gcactttgca tcggccgcgc tcccgattcc 2340ggaagtgctt gacattgggg aattcagcga gagcctgacc tattgcatct cccgccgtgc 2400acagggtgtc acgttgcaag acctgcctga aaccgaactg cccgctgttc tgcagccggt 2460cgcggaggcc atggatgcga tcgctgcggc cgatcttagc cagacgagcg ggttcggccc 2520attcggaccg caaggaatcg gtcaatacac tacatggcgt gatttcatat gcgcgattgc 2580tgatccccat gtgtatcact ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc 2640gcaggctctc gatgagctga tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt 2700gcacgcggat ttcggctcca acaatgtcct gacggacaat ggccgcataa cagcggtcat 2760tgactggagc gaggcgatgt tcggggattc ccaatacgag gtcgccaaca tcttcttctg 2820gaggccgtgg ttggcttgta tggagcagca gacgcgctac ttcgagcgga ggcatccgga 2880gcttgcagga tcgccgcggc tccgggcgta tatgctccgc attggtcttg accaactcta 2940tcagagcttg gttgacggca atttcgatga tgcagcttgg gcgcagggtc gatgcgacgc 3000aatcgtccga tccggagccg ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc 3060cgtctggacc gatggctgtg tagaagtact cgccgatagt ggaaaccgac gccccagcac 3120tcgtccggga tccgtcgacc tgcagatcgt tcaaacattt ggcaataaag tttcttaaga 3180ttgaatcctg ttgccggtct tgcgatgatt atcatataat ttctgttgaa ttacgttaag 3240catgtaataa ttaacatgta atgcatgacg ttatttatga gatgggtttt tatgattaga 3300gtcccgcaat tatacattta atacgcgata gaaaacaaaa tatagcgcgc aaactaggat 3360aaattatcgc gcgcggtgtc atctatgtta ctagatccga tgataagctg tcaaacatga 3420gaattcagta cattaaaaac gtccgcaatg tgttattaag ttgtctaagc gtcaatttgt 3480ttacaccaca atatatcctg ccaccagcca gccaacagct ccccgaccgg cagctcggca 3540caaaatcacc actcgataca ggcagcccat cagtccggga cggcgtcagc gggagagccg 3600ttgtaaggcg gcagactttg ctcatgttac cgatgctatt cggaagaacg gcaactaagc 3660tgccgggttt gaaacacgga tgatctcgcg gagggtagca tgttgattgt aacgatgaca 3720gagcgttgct gcctgtgatc aaatatcatc tccctcgcag agatccgaat tatcagcctt 3780cttattcatt tctcgcttaa ccgtgacagg ctgtcgatct tgagaactat gccgacataa 3840taggaaatcg ctggataaag ccgctgagga agctgagtgg cgctatttct ttagaagtga 3900acgttgacga tcgtcgaccg taccccgatg aattaattcg gacgtacgtt ctgaacacag 3960ctggatactt acttgggcga ttgtcataca tgacatcaac aatgtacccg tttgtgtaac 4020cgtctcttgg aggttcgtat gacactaggt cgctacctta ggaccgttat agttactagc 4080gaattgacat gaggttgccc cgtattcagt gtcgctgatt tgtattgtct gaagttgttt 4140ttacgttaag ttgatgcaga tcaattaata cgatacctgc gtcataattg attatttgac 4200gtggtttgat ggcctccacg cacgttgtga tatgtagatg ataatcatta tcactttacg 4260ggtcctttcc ggtgatccga caggttacgg ggcggcgacc tcgcgggttt tcgctattta 4320tgaaaatttt ccggtttaag gcgtttccgt tcttcttcgt cataacttaa tgtttttatt 4380taaaataccc tctgaaaaga aaggaaacga caggtgctga aagcgagctt tttggcctct 4440gtcgtttcct ttctctgttt ttgtccgtgg aatgaacaat ggaaggatct tctcggcggc 4500gatcacgacg ccggccctgc ggagccttcg ccgcgtgcgc gattcatggc ggccgtggag 4560gccaaggatt tcgcgcgagt gcaagagctg atcgaggcgc gtggagccaa gtcggcggct 4620gattatgtcc ttgcgcagct cgccgtggcc gaaggtctgg accgcaagcc tggtgcgcgc 4680gtcgtggtcg ggaaagcggc gggcagcatg gcaatgccgc ctgcggcgct gggttttacg 4740ccaaggggag aagcggcata cgccatcgag cggtcagcct atggtgagcc gaggtccagc 4800attgcgaagc agtaccagca ggaatggaac cggaaggcgg cgacctggtg ggcgatggcc 4860ggtgtggccg gcatcatcgg cgcgatcctg gcggcggcgg caaccggctt tgttgggctg 4920gcagtgtcga tccgcaaccg agtgaagcgc gtgcgcgacc tgttggtgat ggagccgggt 4980gcagagccat aagcggcaag agacgaaagc ccggtttccg ggcttttgtt ttgttacgcc 5040aaggacgagt tttagcggct aaaggtgttg acgtgcgaga aatgtttagc taaacttctc 5100tcatgtgctg gcggctgtca ccgctatgtt caaccaaggc gcggagcaaa ttatgggtgt 5160tatccatgaa gaaacggctt accgaaagcc agttccagga ggcgatccag gggctggaag 5220tggggcagca gaccatcgag atagcgcggg gcgtcttagt cgatgggaag ccacaggcga 5280cgttcgcaac gtcgctggga ctgaccaggg gcgcagtgtc gcaagcggtg catcgcgtgt 5340gggccgcgtt cgaggacaag aacttgcccg aggggtacgc gcgggtaacg gcggttctgc 5400cggaacatca ggcgtacatc gtccggaagt gggaagcgga cgccaagaaa aaacaggaaa 5460ccaaacgatg aaaactttgg tcacggccaa ccagaaaggc ggcgtcggca agacttcgac 5520ccttgtgcat cttgccttcg actttttcga gcgcggcttg cgggttgccg tgatcgacct 5580ggacccccag ggcaatgcgt cctacacgct caaggacttt gctaccggcc tgcatgcaag 5640caagctgttc ggcgctgtcc ctgccggcgg ctggaccgaa accgcacccg cagccggcga 5700cggccaggcc gcgcgcctcg ccctcatcga gtccaacccg gtactggcga acgccgaacg 5760gctgtcgctg gacgacgccc gcgagctgtt cggggcgaac atcaaggccc tggcgaacca 5820aggcttcgac gtgtgcctga tcgacacggc cccgaccctt ggcgtcggcc tggcggccgc 5880cctcttcgcg gccgactatg tgctgtcccc catcgagctt gaggcgtaca gcatccaggg 5940catcaagaag atggtcacga ccattgcgaa cgtgcgccag aagaacgcca agctgcaatt 6000ccttggcatg gtgcccagca aggtcgatgc gcggaatccg cgccacgcgc gccaccaagc 6060cgagctgctg gccgcgtacc ccaagatgat gattccggcc accgttggcc tgcgcagcag 6120catcgccgat gccctcgcat ccggtgtgcc ggtctggaag atcaagaaaa cggccgcgcg 6180caaggcatcg aaagaggttc gcgccctggc tgattacgtg ttcacgaaga tggagatttc 6240ccaatgactg cggctcaagc caagaccacc aagaaaaaca ccgctgcggc cgctcaggaa 6300gccgcaggcg cggcgcagcc gtccggcctg gggttggata gcatcggcga cctgtcgagc 6360ctcctggacg ctcctgcggc gtctcagggc ggttccggcc ctatcgagct ggacctggac 6420ctgatcgacg aagatccgca tcagccgcgg acggccgaca accccggctt ttccccggag 6480agcatcgcgg

aaatcggtgc cacgatcaaa gagcgcgggg tgaagtcacc catttcggtg 6540cgcgagaacc aggagcagcc gggccgctat atcatcaatc acggcgcccg ccgctaccgt 6600ggctcgaatc tagtgatatt ccacaaaaca gcagggaagc agcgcttttc cgctgcataa 6660ccctgcttcg gggtcattat agcgattttt tcggtatatc catccttttt cgcacgatat 6720acaggatttt gccaaagggt tcgtgtagac tttccttggt gtatccaacg gcgtcagccg 6780ggcaggatag gtgaagtagg cccacccgcg agcgggtgtt ccttcttcac tgtcccttat 6840tcgcacctgg cggtgctcaa cgggaatcct gctctgcgag gctggccggc taccgccggc 6900gtaacagatg agggcaagcg gatggctgat gaaaccaagc caaccaggaa gggcagccca 6960cctatcaagg tgtactgcct tccagacgaa cgaagagcga ttgaggaaaa ggcggcggcg 7020gccggcatga gcctgtcggc ctacctgctg gccgtcggcc agggctacaa aatcacgggc 7080gtcgtggact atgagcacgt ccgcgagctg gcccgcatca atggcgacct gggccgcctg 7140ggcggcctgc tgaaactctg gctcaccgac gacccgcgca cggcgcggtt cggtgatgcc 7200acgatcctcg ccctgctggc gaagatcgaa gagaagcagg acgagcttgg caaggtcatg 7260atgggcgtgg tccgcccgag ggcagagcca tgactttttt agccgctaaa acggccgggg 7320ggtgcgcgtg attgccaagc acgtccccat gcgctccatc aagaagagcg acttcgcgga 7380gctggtgaag tacatcaccg acgagcaagg caagaccgag cgccagatcc aaaacaactg 7440tcaaagcgca cccgcccgat gccattcgcg gcacggcttc cgttgaggat gtcgatatga 7500tgcgcgagcc gacggcccgc agagaagggg ccgttttagc ggctaaagaa ggaagtgcaa 7560gccctaaccc ttggcgtcag agccttccac gcagcttttt tcgggtgtcg tcgccccatt 7620tctttacgat aaacgcctta tgtgacggca aaaccacact gatgcgttcg tatccgggcg 7680gcacgctgct cttgaaagga tgacccgcaa tctccgcgag tgcctcgcgg tcaaggtcgg 7740tggactccag gagaagaggt aggggagttt ccagggcgtc ggcaatggcc tccatcacct 7800tcaacgaggg gttggcctta ccgttggtta agtctgataa aaacgaaatt gaaacccctg 7860ccctctccga cagctcatgt ttcgtcatgc cccgctcatc gagcagacga aggatgttgg 7920tgaaaaatat ctggttgtac acagcggaag ccgcccctcg cacctttggt cgcggcccgc 7980aaaattttag ccgctaaagt tcttgacagc ggaaccaatg tttagctaaa ctagagtctc 8040ctttctcaag gagactttcg atatgagcca taatcagttc cagtttatcg gtaatcttac 8100ccgtgacacc gaggtacgtc atggcaattc taacaagccg caagcaattt tcgatatagc 8160ggttaatgaa gagtggcgca acgatgccgg cgacaagcag gagcgcaccg acttcttccg 8220catcaagtgt tttggctctc aggccgaggc ccacggcaag tatttgggca aggggtcgct 8280ggtattcgtg cagggcaaga ttcggaatac caagtacgag aaggacggcc agacggtcta 8340cgggaccgac ttcattgccg ataaggtgga ttatctggac accaaggcac caggcgggtc 8400aaatcaggaa taagggcaca ttgccccggc gtgagtcggg gcaatcccgc aaggagggtg 8460aatgaatcgg acgtttgacc ggaaggcata caggcaagaa ctgatcgacg cggggttttc 8520cgccgaggat gccgaaacca tcgcaagccg caccgtcatg cgtgcgcccc gcgaaacctt 8580ccagtccgtc ggctcgatgg tccagcaagc tacggccaag atcgagcgcg acagcgtgca 8640actggctccc cctgccctgc ccgcgccatc ggccgccgtg gagcgttcgc gtcgtctcga 8700acaggaggcg gcaggtttgg cgaagtcgat gaccatcgac acgcgaggaa ctatgacgac 8760caagaagcga aaaaccgccg gcgaggacct ggcaaaacag gtcagcgagg ccaagcaggc 8820cgcgttgctg aaacacacga agcagcagat caaggaaatg cagctttcct tgttcgatat 8880tgcgccgtgg ccggacacga tgcgagcgat gccaaacgac acggcccgct ctgccctgtt 8940caccacgcgc aacaagaaaa tcccgcgcga ggcgctgcaa aacaaggtca ttttccacgt 9000caacaaggac gtgaagatca cctacaccgg cgtcgagctg cgggccgacg atgacgaact 9060ggtgtggcag caggtgttgg agtacgcgaa gcgcacccct atcggcgagc cgatcacctt 9120cacgttctac gagctttgcc aggacctggg ctggtcgatc aatggccggt attacacgaa 9180ggccgaggaa tgcctgtcgc gcctacaggc gacggcgatg ggcttcacgt ccgaccgcgt 9240tgggcacctg gaatcggtgt cgctgctgca ccgcttccgc gtcctggacc gtggcaagaa 9300aacgtcccgt tgccaggtcc tgatcgacga ggaaatcgtc gtgctgtttg ctggcgacca 9360ctacacgaaa ttcatatggg agaagtaccg caagctgtcg ccgacggccc gacggatgtt 9420cgactatttc agctcgcacc gggagccgta cccgctcaag ctggaaacct tccgcctcat 9480gtgcggatcg gattccaccc gcgtgaagaa gtggcgcgag caggtcggcg aagcctgcga 9540agagttgcga ggcagcggcc tggtggaaca cgcctgggtc aatgatgacc tggtgcattg 9600caaacgctag ggccttgtgg ggtcagttcc ggctgggggt tcagcagcca gcgctttact 9660ggcatttcag gaacaagcgg gcactgctcg acgcacttgc ttcgctcagt atcgctcggg 9720acgcacggcg cgctctacga actgccgata aacagaggat taaaattgac aattgtgatt 9780aaggctcaga ttcgacggct tggagcggcc gacgtgcagg atttccgcga gatccgattg 9840tcggccctga agaaagctcc agagatgttc gggtccgttt acgagcacga ggagaaaaag 9900cccatggagg cgttcgctga acggttgcga gatgccgtgg cattcggcgc ctacatcgac 9960ggcgagatca ttgggctgtc ggtcttcaaa caggaggacg gccccaagga cgctcacaag 10020gcgcatctgt ccggcgtttt cgtggagccc gaacagcgag gccgaggggt cgccggtatg 10080ctgctgcggg cgttgccggc gggtttattg ctcgtgatga tcgtccgaca gattccaacg 10140ggaatctggt ggatgcgcat cttcatcctc ggcgcactta atatttcgct attctggagc 10200ttgttgttta tttcggtcta ccgcctgccg ggcgggtcgc ggcgacggta ggcgctgtgc 10260agccgctgat ggtcgtgttc atctctgccg ctctgctagg tagcccgata cgattgatgg 10320cggtcctggg ggctatttgc ggaactgcgg gcgtggcgct gttggtgttg acaccaaacg 10380cagcgctaga tcctgtcggc gtcgcagcgg gcctggcggg ggcggtttcc atggcgttcg 10440gaaccgtgct gacccgcaag tggcaacctc ccgtgcctct gctcaccttt accgcctggc 10500aactggcggc cggaggactt ctgctcgttc cagtagcttt agtgtttgat ccgccaatcc 10560cgatgcctac aggaaccaat gttctcggct gctcgactgc acgaatacca gcgacccctt 10620gcccaaatac ttgccgtggg cctcggcctg agagccaaaa cacttgatgc ggaagaagtc 10680ggtgcgctcc tgcttgtcgc cggcatcgtt gcgccacatc taggtactaa aacaattcat 10740ccagtaaaat ataatatttt attttctccc aatcaggctt gatccccagt aagtcaaaaa 10800atagctcgac atactgttct tccccgatat cctccctgat cgaccggacg cagaaggcaa 10860tgtcatacca cttgtccgcc ctgccgcttc tcccaagatc aataaagcca cttactttgc 10920catctttcac aaagatgttg ctgtctccca ggtcgccgtg ggaaaagaca agttcctctt 10980cgggcttttc cgtctttaaa aaatcataca gctcgcgcgg atctttaaat ggagtgtctt 11040cttcccagtt ttcgcaatcc acatcggcca gatcgttatt cagtaagtaa tccaattcgg 11100ctaagcggct gtctaagcta ttcgtatagg gacaatccga tatgtcgatg gagtgaaaga 11160gcctgatgca ctccgcatac agctcgataa tcttttcagg gctttgttca tcttcatact 11220cttccgagca aaggacgcca tcggcctcac tcatgagcag attgctccag ccatcatgcc 11280gttcaaagtg caggaccttt ggaacaggca gctttccttc cagccatagc atcatgtcct 11340tttcccgttc cacatcatag gtggtccctt tataccggct gtccgtcatt tttaaatata 11400ggttttcatt ttctcccacc agcttatata ccttagcagg agacattcct tccgtatctt 11460ttacgcagcg gtatttttcg atcagttttt tcaattccgg tgatattctc attttagcca 11520tttattattt ccttcctctt ttctacagta tttaaagata ccccaagaag ctaattataa 11580caagacgaac tccaattcac tgttccttgc attctaaaac cttaaatacc agaaaacagc 11640tttttcaaag ttgttttcaa agttggcgta taacatagta tcgattcgat agcgtggact 11700caaggctctc gcgaatggct cgcgttggaa actttcattg acacttgagg ggcaccgcag 11760ggaaattctc gtccttgcga gaaccggcta tgtcgtgctg cgcatcgagc ctgcgccctt 11820ggcttgtctc gcccctctcc gcgtcgctac ggggcttcca gcgcctttcc gacgctcacc 11880gggctggttg ccctcgccgc tgggctggcg gccgtctatg gccctgcaaa cgcgccagaa 11940acgccgtcga agccgtgtgc gagacaccgc ggccgccggc gttgtggata cctcgcggaa 12000aacttggccc tcactgacag atgaggggcg gacgttgaca cttgaggggc cgactcaccc 12060ggcgcggcgt tgacagatga ggggcaggct cgatttcggc cggcgacgtg gagctggcca 12120gcctcgcaaa tcggcgaaaa cgcctgattt tacgcgagtt tcccacagat gatgtggaca 12180agcctgggga taagtgccct gcggtattga cacttgaggg gcgcgactac tgacagatga 12240ggggcgcgat ccttgacact tgaggggcag agtgctgaca gatgaggggc gcacctattg 12300acatttgagg ggctgtccac aggcagaaaa tccagcattt gcaagggttt ccgcccgttt 12360ttcggccacc gctaacctgt cttttaacct gcttttaaac caatatttat aaaccttgtt 12420tttaaccagg gctgcgccct gtgcgcgtga ccgcgcacgc cgaagggggg tgccccccct 12480tctcgaaccc tcccggcccg ctaacgcggg cctcccatcc ccccaggggc tgcgcccctc 12540ggccgcgaac ggcctcaccc caaaaatggc agcgccagat tattgaagca tttatcaggg 12600ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt 12660tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac 12720attaacctat aaaaataggc gtatcacgag gccctttcgt cttcaagaat tggtcgacga 12780tcttgctgcg ttcggatatt ttcgtggagt tcccgccaca gacccggatt gaaggcgaga 12840tccagcaact cgcgccagat catcctgtga cggaactttg gcgcgtgatg actggccagg 12900acgtcggccg aaagagcgac aagcagatca cgcttttcga cagcgtcgga tttgcgatcg 12960aggatttttc ggcgctgcgc tacgtccgcg accgcgttga gggatcaagc cacagcagcc 13020cactcgacct tctagccgac ccagacgagc caagggatct ttttggaatg ctgctccgtc 13080gtcaggcttt ccgacgtttg ggtggttgaa cagaagtcat tatcgcacgg aatgccaagc 13140actcccgagg ggaaccctgt ggttggcatg cacatacaaa tggacgaacg gataaacctt 13200ttcacgccct tttaaatatc cgattattct aataaacgct cttttctctt aggtttaccc 13260gccaatatat cctgtcaaac actgatagtt taaactgaag gcgggaaacg acaatctgat 13320catgagcgga gaattaaggg agtcacgtta tgacccccgc cgatgacgcg ggacaagccg 13380ttttacgttt ggaactgaca gaaccgcaac gttgaaggag ccactcagc 13429313174DNAArtificialpLC40GWH 3aagcttgcgg ccgcttcgaa gatgttaatt aacatcggta ccgagctcta gggataacag 60ggtaatagct cgaattctag cttgcatgcc tgcagtgcag cgtgacccgg tcgtgcccct 120ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 180tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 240gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 300cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 360ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 420catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 480tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 540tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 600taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 660gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 720cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 780ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 840gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 900cggcagctac gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt 960aataaataga caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca 1020cacacacaac cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg 1080ctcgtcctcc cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta 1140gggcccggta gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg 1200tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact 1260tgccagtgtt tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg 1320atttcatgat tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca 1380atatatgccg tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt 1440gatgatgtgg tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac 1500ctggtggatt tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa 1560ttgaagatga tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta 1620ctgatgcata tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg 1680cggtcgttca ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta 1740ttaattttgg aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat 1800ggaaatatcg atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat 1860gatggcatat gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa 1920acaagtatgt tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag 1980ctatatgtgg atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc 2040ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatca 2100tcacaagttt gtacaaaaaa gcaggctcaa tgagatatga aaaagcctga actcaccgcg 2160acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg tctccgacct gatgcagctc 2220tcggagggcg aagaatctcg tgctttcagc ttcgatgtag gagggcgtgg atatgtcctg 2280cgggtaaata gctgcgccga tggtttctac aaagatcgtt atgtttatcg gcactttgca 2340tcggccgcgc tcccgattcc ggaagtgctt gacattgggg aattcagcga gagcctgacc 2400tattgcatct cccgccgtgc acagggtgtc acgttgcaag acctgcctga aaccgaactg 2460cccgctgttc tgcagccggt cgcggaggcc atggatgcga tcgctgcggc cgatcttagc 2520cagacgagcg ggttcggccc attcggaccg caaggaatcg gtcaatacac tacatggcgt 2580gatttcatat gcgcgattgc tgatccccat gtgtatcact ggcaaactgt gatggacgac 2640accgtcagtg cgtccgtcgc gcaggctctc gatgagctga tgctttgggc cgaggactgc 2700cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca acaatgtcct gacggacaat 2760ggccgcataa cagcggtcat tgactggagc gaggcgatgt tcggggattc ccaatacgag 2820gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta tggagcagca gacgcgctac 2880ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc tccgggcgta tatgctccgc 2940attggtcttg accaactcta tcagagcttg gttgacggca atttcgatga tgcagcttgg 3000gcgcagggtc gatgcgacgc aatcgtccga tccggagccg ggactgtcgg gcgtacacaa 3060atcgcccgca gaagcgcggc cgtctggacc gatggctgtg tagaagtact cgccgatagt 3120ggaaaccgac gccccagcac tcgtccgagg gcaaaggaat agacccagct ttcttgtaca 3180aagtggtgat gatccgtcga cctgcagatc gttcaaacat ttggcaataa agtttcttaa 3240gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg aattacgtta 3300agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt tttatgatta 3360gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc gcaaactagg 3420ataaattatc gcgcgcggtg tcatctatgt tactagatcc gatgataagc tgtcaaacat 3480gagaattcag tacattaaaa acgtccgcaa tgtgttatta agttgtctaa gcgtcaattt 3540gtttacacca caatatatcc tgccaccagc cagccaacag ctccccgacc ggcagctcgg 3600cacaaaatca ccactcgata caggcagccc atcagtccgg gacggcgtca gcgggagagc 3660cgttgtaagg cggcagactt tgctcatgtt accgatgcta ttcggaagaa cggcaactaa 3720gctgccgggt ttgaaacacg gatgatctcg cggagggtag catgttgatt gtaacgatga 3780cagagcgttg ctgcctgtga tcaaatatca tctccctcgc agagatccga attatcagcc 3840ttcttattca tttctcgctt aaccgtgaca ggctgtcgat cttgagaact atgccgacat 3900aataggaaat cgctggataa agccgctgag gaagctgagt ggcgctattt ctttagaagt 3960gaacgttgac gatcgtcgac cgtaccccga tgaattaatt cggacgtacg ttctgaacac 4020agctggatac ttacttgggc gattgtcata catgacatca acaatgtacc cgtttgtgta 4080accgtctctt ggaggttcgt atgacactag gtcgctacct taggaccgtt atagttacta 4140gcgaattgac atgaggttgc cccgtattca gtgtcgctga tttgtattgt ctgaagttgt 4200ttttacgtta agttgatgca gatcaattaa tacgatacct gcgtcataat tgattatttg 4260acgtggtttg atggcctcca cgcacgttgt gatatgtaga tgataatcat tatcacttta 4320cgggtccttt ccggtgatcc gacaggttac ggggcggcga cctcgcgggt tttcgctatt 4380tatgaaaatt ttccggttta aggcgtttcc gttcttcttc gtcataactt aatgttttta 4440tttaaaatac cctctgaaaa gaaaggaaac gacaggtgct gaaagcgagc tttttggcct 4500ctgtcgtttc ctttctctgt ttttgtccgt ggaatgaaca atggaaggat cttctcggcg 4560gcgatcacga cgccggccct gcggagcctt cgccgcgtgc gcgattcatg gcggccgtgg 4620aggccaagga tttcgcgcga gtgcaagagc tgatcgaggc gcgtggagcc aagtcggcgg 4680ctgattatgt ccttgcgcag ctcgccgtgg ccgaaggtct ggaccgcaag cctggtgcgc 4740gcgtcgtggt cgggaaagcg gcgggcagca tggcaatgcc gcctgcggcg ctgggtttta 4800cgccaagggg agaagcggca tacgccatcg agcggtcagc ctatggtgag ccgaggtcca 4860gcattgcgaa gcagtaccag caggaatgga accggaaggc ggcgacctgg tgggcgatgg 4920ccggtgtggc cggcatcatc ggcgcgatcc tggcggcggc ggcaaccggc tttgttgggc 4980tggcagtgtc gatccgcaac cgagtgaagc gcgtgcgcga cctgttggtg atggagccgg 5040gtgcagagcc ataagcggca agagacgaaa gcccggtttc cgggcttttg ttttgttacg 5100ccaaggacga gttttagcgg ctaaaggtgt tgacgtgcga gaaatgttta gctaaacttc 5160tctcatgtgc tggcggctgt caccgctatg ttcaaccaag gcgcggagca aattatgggt 5220gttatccatg aagaaacggc ttaccgaaag ccagttccag gaggcgatcc aggggctgga 5280agtggggcag cagaccatcg agatagcgcg gggcgtctta gtcgatggga agccacaggc 5340gacgttcgca acgtcgctgg gactgaccag gggcgcagtg tcgcaagcgg tgcatcgcgt 5400gtgggccgcg ttcgaggaca agaacttgcc cgaggggtac gcgcgggtaa cggcggttct 5460gccggaacat caggcgtaca tcgtccggaa gtgggaagcg gacgccaaga aaaaacagga 5520aaccaaacga tgaaaacttt ggtcacggcc aaccagaaag gcggcgtcgg caagacttcg 5580acccttgtgc atcttgcctt cgactttttc gagcgcggct tgcgggttgc cgtgatcgac 5640ctggaccccc agggcaatgc gtcctacacg ctcaaggact ttgctaccgg cctgcatgca 5700agcaagctgt tcggcgctgt ccctgccggc ggctggaccg aaaccgcacc cgcagccggc 5760gacggccagg ccgcgcgcct cgccctcatc gagtccaacc cggtactggc gaacgccgaa 5820cggctgtcgc tggacgacgc ccgcgagctg ttcggggcga acatcaaggc cctggcgaac 5880caaggcttcg acgtgtgcct gatcgacacg gccccgaccc ttggcgtcgg cctggcggcc 5940gccctcttcg cggccgacta tgtgctgtcc cccatcgagc ttgaggcgta cagcatccag 6000ggcatcaaga agatggtcac gaccattgcg aacgtgcgcc agaagaacgc caagctgcaa 6060ttccttggca tggtgcccag caaggtcgat gcgcggaatc cgcgccacgc gcgccaccaa 6120gccgagctgc tggccgcgta ccccaagatg atgattccgg ccaccgttgg cctgcgcagc 6180agcatcgccg atgccctcgc atccggtgtg ccggtctgga agatcaagaa aacggccgcg 6240cgcaaggcat cgaaagaggt tcgcgccctg gctgattacg tgttcacgaa gatggagatt 6300tcccaatgac tgcggctcaa gccaagacca ccaagaaaaa caccgctgcg gccgctcagg 6360aagccgcagg cgcggcgcag ccgtccggcc tggggttgga tagcatcggc gacctgtcga 6420gcctcctgga cgctcctgcg gcgtctcagg gcggttccgg ccctatcgag ctggacctgg 6480acctgatcga cgaagatccg catcagccgc ggacggccga caaccccggc ttttccccgg 6540agagcatcgc ggaaatcggt gccacgatca aagagcgcgg ggtgaagtca cccatttcgg 6600tgcgcgagaa ccaggagcag ccgggccgct atatcatcaa tcacggcgcc cgccgctacc 6660gtggctcgaa tctagtgata ttccacaaaa cagcagggaa gcagcgcttt tccgctgcat 6720aaccctgctt cggggtcatt atagcgattt tttcggtata tccatccttt ttcgcacgat 6780atacaggatt ttgccaaagg gttcgtgtag actttccttg gtgtatccaa cggcgtcagc 6840cgggcaggat aggtgaagta ggcccacccg cgagcgggtg ttccttcttc actgtccctt 6900attcgcacct ggcggtgctc aacgggaatc ctgctctgcg aggctggccg gctaccgccg 6960gcgtaacaga tgagggcaag cggatggctg atgaaaccaa gccaaccagg aagggcagcc 7020cacctatcaa ggtgtactgc cttccagacg aacgaagagc gattgaggaa aaggcggcgg 7080cggccggcat gagcctgtcg gcctacctgc tggccgtcgg ccagggctac aaaatcacgg 7140gcgtcgtgga ctatgagcac gtccgcgagc tggcccgcat caatggcgac ctgggccgcc 7200tgggcggcct gctgaaactc tggctcaccg acgacccgcg cacggcgcgg ttcggtgatg 7260ccacgatcct cgccctgctg gcgaagatcg aagagaagca ggacgagctt ggcaaggtca 7320tgatgggcgt ggtccgcccg agggcagagc catgactttt ttagccgcta aaacggccgg 7380ggggtgcgcg tgattgccaa gcacgtcccc atgcgctcca tcaagaagag cgacttcgcg 7440gagctggtga agtacatcac cgacgagcaa ggcaagaccg agcgccagat ccaaaacaac 7500tgtcaaagcg cacccgcccg atgccattcg cggcacggct tccgttgagg atgtcgatat 7560gatgcgcgag ccgacggccc gcagagaagg ggccgtttta gcggctaaag aaggaagtgc 7620aagccctaac ccttggcgtc agagccttcc acgcagcttt tttcgggtgt cgtcgcccca 7680tttctttacg ataaacgcct tatgtgacgg caaaaccaca ctgatgcgtt cgtatccggg 7740cggcacgctg ctcttgaaag gatgacccgc aatctccgcg agtgcctcgc ggtcaaggtc 7800ggtggactcc aggagaagag gtaggggagt ttccagggcg tcggcaatgg cctccatcac 7860cttcaacgag gggttggcct taccgttggt taagtctgat aaaaacgaaa ttgaaacccc 7920tgccctctcc gacagctcat gtttcgtcat gccccgctca tcgagcagac gaaggatgtt 7980ggtgaaaaat atctggttgt acacagcgga agccgcccct cgcacctttg gtcgcggccc 8040gcaaaatttt agccgctaaa gttcttgaca

gcggaaccaa tgtttagcta aactagagtc 8100tcctttctca aggagacttt cgatatgagc cataatcagt tccagtttat cggtaatctt 8160acccgtgaca ccgaggtacg tcatggcaat tctaacaagc cgcaagcaat tttcgatata 8220gcggttaatg aagagtggcg caacgatgcc ggcgacaagc aggagcgcac cgacttcttc 8280cgcatcaagt gttttggctc tcaggccgag gcccacggca agtatttggg caaggggtcg 8340ctggtattcg tgcagggcaa gattcggaat accaagtacg agaaggacgg ccagacggtc 8400tacgggaccg acttcattgc cgataaggtg gattatctgg acaccaaggc accaggcggg 8460tcaaatcagg aataagggca cattgccccg gcgtgagtcg gggcaatccc gcaaggaggg 8520tgaatgaatc ggacgtttga ccggaaggca tacaggcaag aactgatcga cgcggggttt 8580tccgccgagg atgccgaaac catcgcaagc cgcaccgtca tgcgtgcgcc ccgcgaaacc 8640ttccagtccg tcggctcgat ggtccagcaa gctacggcca agatcgagcg cgacagcgtg 8700caactggctc cccctgccct gcccgcgcca tcggccgccg tggagcgttc gcgtcgtctc 8760gaacaggagg cggcaggttt ggcgaagtcg atgaccatcg acacgcgagg aactatgacg 8820accaagaagc gaaaaaccgc cggcgaggac ctggcaaaac aggtcagcga ggccaagcag 8880gccgcgttgc tgaaacacac gaagcagcag atcaaggaaa tgcagctttc cttgttcgat 8940attgcgccgt ggccggacac gatgcgagcg atgccaaacg acacggcccg ctctgccctg 9000ttcaccacgc gcaacaagaa aatcccgcgc gaggcgctgc aaaacaaggt cattttccac 9060gtcaacaagg acgtgaagat cacctacacc ggcgtcgagc tgcgggccga cgatgacgaa 9120ctggtgtggc agcaggtgtt ggagtacgcg aagcgcaccc ctatcggcga gccgatcacc 9180ttcacgttct acgagctttg ccaggacctg ggctggtcga tcaatggccg gtattacacg 9240aaggccgagg aatgcctgtc gcgcctacag gcgacggcga tgggcttcac gtccgaccgc 9300gttgggcacc tggaatcggt gtcgctgctg caccgcttcc gcgtcctgga ccgtggcaag 9360aaaacgtccc gttgccaggt cctgatcgac gaggaaatcg tcgtgctgtt tgctggcgac 9420cactacacga aattcatatg ggagaagtac cgcaagctgt cgccgacggc ccgacggatg 9480ttcgactatt tcagctcgca ccgggagccg tacccgctca agctggaaac cttccgcctc 9540atgtgcggat cggattccac ccgcgtgaag aagtggcgcg agcaggtcgg cgaagcctgc 9600gaagagttgc gaggcagcgg cctggtggaa cacgcctggg tcaatgatga cctggtgcat 9660tgcaaacgct agggccttgt ggggtcagtt ccggctgggg gttcagcagc cagcgcttta 9720ctggcatttc aggaacaagc gggcactgct cgacgcactt gcttcgctca gtatcgctcg 9780ggacgcacgg cgcgctctac gaactgccga taaacagagg attaaaattg acaattgtga 9840ttaaggctca gattcgacgg cttggagcgg ccgacgtgca ggatttccgc gagatccgat 9900tgtcggccct gaagaaagct ccagagatgt tcgggtccgt ttacgagcac gaggagaaaa 9960agcccatgga ggcgttcgct gaacggttgc gagatgccgt ggcattcggc gcctacatcg 10020acggcgagat cattgggctg tcggtcttca aacaggagga cggccccaag gacgctcaca 10080aggcgcatct gtccggcgtt ttcgtggagc ccgaacagcg aggccgaggg gtcgccggta 10140tgctgctgcg ggcgttgccg gcgggtttat tgctcgtgat gatcgtccga cagattccaa 10200cgggaatctg gtggatgcgc atcttcatcc tcggcgcact taatatttcg ctattctgga 10260gcttgttgtt tatttcggtc taccgcctgc cgggcgggtc gcggcgacgg taggcgctgt 10320gcagccgctg atggtcgtgt tcatctctgc cgctctgcta ggtagcccga tacgattgat 10380ggcggtcctg ggggctattt gcggaactgc gggcgtggcg ctgttggtgt tgacaccaaa 10440cgcagcgcta gatcctgtcg gcgtcgcagc gggcctggcg ggggcggttt ccatggcgtt 10500cggaaccgtg ctgacccgca agtggcaacc tcccgtgcct ctgctcacct ttaccgcctg 10560gcaactggcg gccggaggac ttctgctcgt tccagtagct ttagtgtttg atccgccaat 10620cccgatgcct acaggaacca atgttctcgg ctgctcgact gcacgaatac cagcgacccc 10680ttgcccaaat acttgccgtg ggcctcggcc tgagagccaa aacacttgat gcggaagaag 10740tcggtgcgct cctgcttgtc gccggcatcg ttgcgccaca tctaggtact aaaacaattc 10800atccagtaaa atataatatt ttattttctc ccaatcaggc ttgatcccca gtaagtcaaa 10860aaatagctcg acatactgtt cttccccgat atcctccctg atcgaccgga cgcagaaggc 10920aatgtcatac cacttgtccg ccctgccgct tctcccaaga tcaataaagc cacttacttt 10980gccatctttc acaaagatgt tgctgtctcc caggtcgccg tgggaaaaga caagttcctc 11040ttcgggcttt tccgtcttta aaaaatcata cagctcgcgc ggatctttaa atggagtgtc 11100ttcttcccag ttttcgcaat ccacatcggc cagatcgtta ttcagtaagt aatccaattc 11160ggctaagcgg ctgtctaagc tattcgtata gggacaatcc gatatgtcga tggagtgaaa 11220gagcctgatg cactccgcat acagctcgat aatcttttca gggctttgtt catcttcata 11280ctcttccgag caaaggacgc catcggcctc actcatgagc agattgctcc agccatcatg 11340ccgttcaaag tgcaggacct ttggaacagg cagctttcct tccagccata gcatcatgtc 11400cttttcccgt tccacatcat aggtggtccc tttataccgg ctgtccgtca tttttaaata 11460taggttttca ttttctccca ccagcttata taccttagca ggagacattc cttccgtatc 11520ttttacgcag cggtattttt cgatcagttt tttcaattcc ggtgatattc tcattttagc 11580catttattat ttccttcctc ttttctacag tatttaaaga taccccaaga agctaattat 11640aacaagacga actccaattc actgttcctt gcattctaaa accttaaata ccagaaaaca 11700gctttttcaa agttgttttc aaagttggcg tataacatag tatcgattcg atagcgtgga 11760ctcaaggctc tcgcgaatgg ctcgcgttgg aaactttcat tgacacttga ggggcaccgc 11820agggaaattc tcgtccttgc gagaaccggc tatgtcgtgc tgcgcatcga gcctgcgccc 11880ttggcttgtc tcgcccctct ccgcgtcgct acggggcttc cagcgccttt ccgacgctca 11940ccgggctggt tgccctcgcc gctgggctgg cggccgtcta tggccctgca aacgcgccag 12000aaacgccgtc gaagccgtgt gcgagacacc gcggccgccg gcgttgtgga tacctcgcgg 12060aaaacttggc cctcactgac agatgagggg cggacgttga cacttgaggg gccgactcac 12120ccggcgcggc gttgacagat gaggggcagg ctcgatttcg gccggcgacg tggagctggc 12180cagcctcgca aatcggcgaa aacgcctgat tttacgcgag tttcccacag atgatgtgga 12240caagcctggg gataagtgcc ctgcggtatt gacacttgag gggcgcgact actgacagat 12300gaggggcgcg atccttgaca cttgaggggc agagtgctga cagatgaggg gcgcacctat 12360tgacatttga ggggctgtcc acaggcagaa aatccagcat ttgcaagggt ttccgcccgt 12420ttttcggcca ccgctaacct gtcttttaac ctgcttttaa accaatattt ataaaccttg 12480tttttaacca gggctgcgcc ctgtgcgcgt gaccgcgcac gccgaagggg ggtgcccccc 12540cttctcgaac cctcccggcc cgctaacgcg ggcctcccat ccccccaggg gctgcgcccc 12600tcggccgcga acggcctcac cccaaaaatg gcagcgccag ccaggacgtc ggccgaaaga 12660gcgacaagca gatcacgctt ttcgacagcg tcggatttgc gatcgaggat ttttcggcgc 12720tgcgctacgt ccgcgaccgc gttgagggat caagccacag cagcccactc gaccttctag 12780ccgacccaga cgagccaagg gatctttttg gaatgctgct ccgtcgtcag gctttccgac 12840gtttgggtgg ttgaacagaa gtcattatcg cacggaatgc caagcactcc cgaggggaac 12900cctgtggttg gcatgcacat acaaatggac gaacggataa accttttcac gcccttttaa 12960atatccgatt attctaataa acgctctttt ctcttaggtt tacccgccaa tatatcctgt 13020caaacactga tagtttaaac tgaaggcggg aaacgacaat ctgatcatga gcggagaatt 13080aagggagtca cgttatgacc cccgccgatg acgcgggaca agccgtttta cgtttggaac 13140tgacagaacc gcaacgttga aggagccact cagc 13174412884DNAArtificialpLC40bar 4aagctttcga atagggataa cagggtaata gcttgctaga ggatctgcga tctagtaaca 60tagatgacac cgcgcgcgat aatttatcct agtttgcgcg ctatattttg ttttctatcg 120cgtattaaat gtataattgc gggactctaa tcataaaaac ccatctcata aataacgtca 180tgcattacat gttaattatt acatgcttaa cgtaattcaa cagaaattat atgataatca 240tcgcaagacc ggcaacagga ttcaatctta agaaacttta ttgccaaatg tttgaacgat 300ctgcttcgga tcctagacgc gtgagatcag atctcggtga cgggcaggac cggacggggc 360ggtaccggca ggctgaagtc cagctgccag aaacccacgt catgccagtt cccgtgcttg 420aagccggccg cccgcagcat gccgcggggg gcatatccga gcgcctcgtg catgcgcacg 480ctcgggtcgt tgggcagccc gatgacagcg accacgctct tgaagccctg tgcctccagg 540gacttcagca ggtgggtgta gagcgtggag cccagtcccg tccgctggtg gcggggggag 600acgtacacgg tcgactcggc cgtccagtcg taggcgttgc gtgccttcca ggggcccgcg 660taggcgatgc cggcgacctc gccgtccacc tcggcgacga gccagggata gcgctcccgc 720agacggacga ggtcgtccgt ccactcctgc ggttcctgcg gctcggtacg gaagttgacc 780gtgcttgtct cgatgtagtg gttgacgatg gtgcagaccg ccggcatgtc cgcctcggtg 840gcacggcgga tgtcggccgg gcgtcgttct gggtccatgg cgacctgcag aagtaacacc 900aaacaacagg gtgagcatcg acaaaagaaa cagtaccaag caaataaata gcgtatgaag 960gcagggctaa aaaaatccac atatagctgc tgcatatgcc atcatccaag tatatcaaga 1020tcaaaataat tataaaacat acttgtttat tataatagat aggtactcaa ggttagagca 1080tatgaataga tgctgcatat gccatcatgt atatgcatca gtaaaaccca catcaacatg 1140tatacctatc ctagatcgat atttccatcc atcttaaact cgtaactatg aagatgtatg 1200acacacacat acagttccaa aattaataaa tacaccaggt agtttgaaac agtattctac 1260tccgatctag aacgaatgaa cgaccgccca accacaccac atcatcacaa ccaagcgaac 1320aaaaagcatc tctgtatatg catcagtaaa acccgcatca acatgtatac ctatcctaga 1380tcgatatttc catccatcat cttcaattcg taactatgaa tatgtatggc acacacatac 1440agatccaaaa ttaataaatc caccaggtag tttgaaacag aattaattct actccgatct 1500agaacgaccg cccaaccaga ccacatcatc acaaccaaga caaaaaaaag catgaaaaga 1560tgacccgaca aacaagtgca cggcatatat tgaaataaag gaaaagggca aaccaaaccc 1620tatgcaacga aacaaaaaaa atcatgaaat cgatcccgtc tgcggaacgg ctagagccat 1680cccaggattc cccaaagaga aacactggca agttagcaat cagaacgtgt ctgacgtaca 1740ggtcgcatcc gtgtacgaac gctagcagca cggatctaac acaaacacgg atctaacaca 1800aacatgaaca gaagtagaac taccgggccc taaccatgga ccggaacgcc gatctagaga 1860aggtagagag gggggggggg ggaggacgag cggcgtacct tgaagcggag gtgccgacgg 1920gtggatttgg gggagatctg gttgtgtgtg tgtgcgctcc gaacaacacg aggttgggga 1980aagagggtgt ggagggggtg tctatttatt acggcgggcg aggaagggaa agcgaaggag 2040cggtgggaaa ggaatccccc gtagctgccg gtgccgtgag aggaggagga ggccgcctgc 2100cgtgccggct cacgtctgcc gctccgccac gcaatttctg gatgccgaca gcggagcaag 2160tccaacggtg gagcggaact ctcgagaggg gtccagaggc agcgacagag atgccgtgcc 2220gtctgcttcg cttggcccga cgcgacgctg ctggttcgct ggttggtgtc cgttagactc 2280gtcgacggcg tttaacaggc tggcattatc tactcgaaac aagaaaaatg tttccttagt 2340ttttttaatt tcttaaaggg tatttgttta atttttagtc actttatttt attctatttt 2400atatctaaat tattaaataa aaaaactaaa atagagtttt agttttctta atttagaggc 2460taaaatagaa taaaatagat gtactaaaaa aattagtcta taaaaaccat taaccctaaa 2520ccctaaatgg atgtactaat aaaatggatg aagtattata taggtgaagc tatttgcaaa 2580aaaaaaggag aacacatgca cactaaaaag ataaaactgt agagtcctgt tgtcaaaata 2640ctcaattgtc ctttagacca tgtctaactg ttcatttata tgattctcta aaacactgat 2700attattgtag tactatagat tatattattc gtagagtaaa gtttaaatat atgtataaag 2760atagataaac tgcacttcaa acaagtgtga caaaaaaaat atgtggtaat tttttataac 2820ttagacatgc aatgctcatt atctctagag aggggcacga ccgggtcacg ctgcacaatt 2880cagtacatta aaaacgtccg caatgtgtta ttaagttgtc taagcgtcaa tttgtttaca 2940ccacaatata tcctgccacc agccagccaa cagctccccg accggcagct cggcacaaaa 3000tcaccactcg atacaggcag cccatcagtc cgggacggcg tcagcgggag agccgttgta 3060aggcggcaga ctttgctcat gttaccgatg ctattcggaa gaacggcaac taagctgccg 3120ggtttgaaac acggatgatc tcgcggaggg tagcatgttg attgtaacga tgacagagcg 3180ttgctgcctg tgatcaaata tcatctccct cgcagagatc cgaattatca gccttcttat 3240tcatttctcg cttaaccgtg acaggctgtc gatcttgaga actatgccga cataatagga 3300aatcgctgga taaagccgct gaggaagctg agtggcgcta tttctttaga agtgaacgtt 3360gacgatcgtc gaccgtaccc cgatgaatta attcggacgt acgttctgaa cacagctgga 3420tacttacttg ggcgattgtc atacatgaca tcaacaatgt acccgtttgt gtaaccgtct 3480cttggaggtt cgtatgacac taggtcgcta ccttaggacc gttatagtta ctagcgaatt 3540gacatgaggt tgccccgtat tcagtgtcgc tgatttgtat tgtctgaagt tgtttttacg 3600ttaagttgat gcagatcaat taatacgata cctgcgtcat aattgattat ttgacgtggt 3660ttgatggcct ccacgcacgt tgtgatatgt agatgataat cattatcact ttacgggtcc 3720tttccggtga tccgacaggt tacggggcgg cgacctcgcg ggttttcgct atttatgaaa 3780attttccggt ttaaggcgtt tccgttcttc ttcgtcataa cttaatgttt ttatttaaaa 3840taccctctga aaagaaagga aacgacaggt gctgaaagcg agctttttgg cctctgtcgt 3900ttcctttctc tgtttttgtc cgtggaatga acaatggaag gatcttctcg gcggcgatca 3960cgacgccggc cctgcggagc cttcgccgcg tgcgcgattc atggcggccg tggaggccaa 4020ggatttcgcg cgagtgcaag agctgatcga ggcgcgtgga gccaagtcgg cggctgatta 4080tgtccttgcg cagctcgccg tggccgaagg tctggaccgc aagcctggtg cgcgcgtcgt 4140ggtcgggaaa gcggcgggca gcatggcaat gccgcctgcg gcgctgggtt ttacgccaag 4200gggagaagcg gcatacgcca tcgagcggtc agcctatggt gagccgaggt ccagcattgc 4260gaagcagtac cagcaggaat ggaaccggaa ggcggcgacc tggtgggcga tggccggtgt 4320ggccggcatc atcggcgcga tcctggcggc ggcggcaacc ggctttgttg ggctggcagt 4380gtcgatccgc aaccgagtga agcgcgtgcg cgacctgttg gtgatggagc cgggtgcaga 4440gccataagcg gcaagagacg aaagcccggt ttccgggctt ttgttttgtt acgccaagga 4500cgagttttag cggctaaagg tgttgacgtg cgagaaatgt ttagctaaac ttctctcatg 4560tgctggcggc tgtcaccgct atgttcaacc aaggcgcgga gcaaattatg ggtgttatcc 4620atgaagaaac ggcttaccga aagccagttc caggaggcga tccaggggct ggaagtgggg 4680cagcagacca tcgagatagc gcggggcgtc ttagtcgatg ggaagccaca ggcgacgttc 4740gcaacgtcgc tgggactgac caggggcgca gtgtcgcaag cggtgcatcg cgtgtgggcc 4800gcgttcgagg acaagaactt gcccgagggg tacgcgcggg taacggcggt tctgccggaa 4860catcaggcgt acatcgtccg gaagtgggaa gcggacgcca agaaaaaaca ggaaaccaaa 4920cgatgaaaac tttggtcacg gccaaccaga aaggcggcgt cggcaagact tcgacccttg 4980tgcatcttgc cttcgacttt ttcgagcgcg gcttgcgggt tgccgtgatc gacctggacc 5040cccagggcaa tgcgtcctac acgctcaagg actttgctac cggcctgcat gcaagcaagc 5100tgttcggcgc tgtccctgcc ggcggctgga ccgaaaccgc acccgcagcc ggcgacggcc 5160aggccgcgcg cctcgccctc atcgagtcca acccggtact ggcgaacgcc gaacggctgt 5220cgctggacga cgcccgcgag ctgttcgggg cgaacatcaa ggccctggcg aaccaaggct 5280tcgacgtgtg cctgatcgac acggccccga cccttggcgt cggcctggcg gccgccctct 5340tcgcggccga ctatgtgctg tcccccatcg agcttgaggc gtacagcatc cagggcatca 5400agaagatggt cacgaccatt gcgaacgtgc gccagaagaa cgccaagctg caattccttg 5460gcatggtgcc cagcaaggtc gatgcgcgga atccgcgcca cgcgcgccac caagccgagc 5520tgctggccgc gtaccccaag atgatgattc cggccaccgt tggcctgcgc agcagcatcg 5580ccgatgccct cgcatccggt gtgccggtct ggaagatcaa gaaaacggcc gcgcgcaagg 5640catcgaaaga ggttcgcgcc ctggctgatt acgtgttcac gaagatggag atttcccaat 5700gactgcggct caagccaaga ccaccaagaa aaacaccgct gcggccgctc aggaagccgc 5760aggcgcggcg cagccgtccg gcctggggtt ggatagcatc ggcgacctgt cgagcctcct 5820ggacgctcct gcggcgtctc agggcggttc cggccctatc gagctggacc tggacctgat 5880cgacgaagat ccgcatcagc cgcggacggc cgacaacccc ggcttttccc cggagagcat 5940cgcggaaatc ggtgccacga tcaaagagcg cggggtgaag tcacccattt cggtgcgcga 6000gaaccaggag cagccgggcc gctatatcat caatcacggc gcccgccgct accgtggctc 6060gaatctagtg atattccaca aaacagcagg gaagcagcgc ttttccgctg cataaccctg 6120cttcggggtc attatagcga ttttttcggt atatccatcc tttttcgcac gatatacagg 6180attttgccaa agggttcgtg tagactttcc ttggtgtatc caacggcgtc agccgggcag 6240gataggtgaa gtaggcccac ccgcgagcgg gtgttccttc ttcactgtcc cttattcgca 6300cctggcggtg ctcaacggga atcctgctct gcgaggctgg ccggctaccg ccggcgtaac 6360agatgagggc aagcggatgg ctgatgaaac caagccaacc aggaagggca gcccacctat 6420caaggtgtac tgccttccag acgaacgaag agcgattgag gaaaaggcgg cggcggccgg 6480catgagcctg tcggcctacc tgctggccgt cggccagggc tacaaaatca cgggcgtcgt 6540ggactatgag cacgtccgcg agctggcccg catcaatggc gacctgggcc gcctgggcgg 6600cctgctgaaa ctctggctca ccgacgaccc gcgcacggcg cggttcggtg atgccacgat 6660cctcgccctg ctggcgaaga tcgaagagaa gcaggacgag cttggcaagg tcatgatggg 6720cgtggtccgc ccgagggcag agccatgact tttttagccg ctaaaacggc cggggggtgc 6780gcgtgattgc caagcacgtc cccatgcgct ccatcaagaa gagcgacttc gcggagctgg 6840tgaagtacat caccgacgag caaggcaaga ccgagcgcca gatccaaaac aactgtcaaa 6900gcgcacccgc ccgatgccat tcgcggcacg gcttccgttg aggatgtcga tatgatgcgc 6960gagccgacgg cccgcagaga aggggccgtt ttagcggcta aagaaggaag tgcaagccct 7020aacccttggc gtcagagcct tccacgcagc ttttttcggg tgtcgtcgcc ccatttcttt 7080acgataaacg ccttatgtga cggcaaaacc acactgatgc gttcgtatcc gggcggcacg 7140ctgctcttga aaggatgacc cgcaatctcc gcgagtgcct cgcggtcaag gtcggtggac 7200tccaggagaa gaggtagggg agtttccagg gcgtcggcaa tggcctccat caccttcaac 7260gaggggttgg ccttaccgtt ggttaagtct gataaaaacg aaattgaaac ccctgccctc 7320tccgacagct catgtttcgt catgccccgc tcatcgagca gacgaaggat gttggtgaaa 7380aatatctggt tgtacacagc ggaagccgcc cctcgcacct ttggtcgcgg cccgcaaaat 7440tttagccgct aaagttcttg acagcggaac caatgtttag ctaaactaga gtctcctttc 7500tcaaggagac tttcgatatg agccataatc agttccagtt tatcggtaat cttacccgtg 7560acaccgaggt acgtcatggc aattctaaca agccgcaagc aattttcgat atagcggtta 7620atgaagagtg gcgcaacgat gccggcgaca agcaggagcg caccgacttc ttccgcatca 7680agtgttttgg ctctcaggcc gaggcccacg gcaagtattt gggcaagggg tcgctggtat 7740tcgtgcaggg caagattcgg aataccaagt acgagaagga cggccagacg gtctacggga 7800ccgacttcat tgccgataag gtggattatc tggacaccaa ggcaccaggc gggtcaaatc 7860aggaataagg gcacattgcc ccggcgtgag tcggggcaat cccgcaagga gggtgaatga 7920atcggacgtt tgaccggaag gcatacaggc aagaactgat cgacgcgggg ttttccgccg 7980aggatgccga aaccatcgca agccgcaccg tcatgcgtgc gccccgcgaa accttccagt 8040ccgtcggctc gatggtccag caagctacgg ccaagatcga gcgcgacagc gtgcaactgg 8100ctccccctgc cctgcccgcg ccatcggccg ccgtggagcg ttcgcgtcgt ctcgaacagg 8160aggcggcagg tttggcgaag tcgatgacca tcgacacgcg aggaactatg acgaccaaga 8220agcgaaaaac cgccggcgag gacctggcaa aacaggtcag cgaggccaag caggccgcgt 8280tgctgaaaca cacgaagcag cagatcaagg aaatgcagct ttccttgttc gatattgcgc 8340cgtggccgga cacgatgcga gcgatgccaa acgacacggc ccgctctgcc ctgttcacca 8400cgcgcaacaa gaaaatcccg cgcgaggcgc tgcaaaacaa ggtcattttc cacgtcaaca 8460aggacgtgaa gatcacctac accggcgtcg agctgcgggc cgacgatgac gaactggtgt 8520ggcagcaggt gttggagtac gcgaagcgca cccctatcgg cgagccgatc accttcacgt 8580tctacgagct ttgccaggac ctgggctggt cgatcaatgg ccggtattac acgaaggccg 8640aggaatgcct gtcgcgccta caggcgacgg cgatgggctt cacgtccgac cgcgttgggc 8700acctggaatc ggtgtcgctg ctgcaccgct tccgcgtcct ggaccgtggc aagaaaacgt 8760cccgttgcca ggtcctgatc gacgaggaaa tcgtcgtgct gtttgctggc gaccactaca 8820cgaaattcat atgggagaag taccgcaagc tgtcgccgac ggcccgacgg atgttcgact 8880atttcagctc gcaccgggag ccgtacccgc tcaagctgga aaccttccgc ctcatgtgcg 8940gatcggattc cacccgcgtg aagaagtggc gcgagcaggt cggcgaagcc tgcgaagagt 9000tgcgaggcag cggcctggtg gaacacgcct gggtcaatga tgacctggtg cattgcaaac 9060gctagggcct tgtggggtca gttccggctg ggggttcagc agccagcgct ttactggcat 9120ttcaggaaca agcgggcact gctcgacgca cttgcttcgc tcagtatcgc tcgggacgca 9180cggcgcgctc tacgaactgc cgataaacag aggattaaaa ttgacaattg tgattaaggc 9240tcagattcga cggcttggag cggccgacgt gcaggatttc cgcgagatcc gattgtcggc 9300cctgaagaaa gctccagaga tgttcgggtc cgtttacgag cacgaggaga aaaagcccat 9360ggaggcgttc gctgaacggt tgcgagatgc cgtggcattc ggcgcctaca tcgacggcga 9420gatcattggg ctgtcggtct tcaaacagga ggacggcccc aaggacgctc acaaggcgca 9480tctgtccggc gttttcgtgg agcccgaaca gcgaggccga ggggtcgccg gtatgctgct 9540gcgggcgttg ccggcgggtt tattgctcgt gatgatcgtc cgacagattc caacgggaat 9600ctggtggatg cgcatcttca tcctcggcgc acttaatatt tcgctattct ggagcttgtt 9660gtttatttcg gtctaccgcc tgccgggcgg gtcgcggcga cggtaggcgc tgtgcagccg 9720ctgatggtcg tgttcatctc tgccgctctg ctaggtagcc cgatacgatt gatggcggtc 9780ctgggggcta tttgcggaac tgcgggcgtg gcgctgttgg tgttgacacc aaacgcagcg 9840ctagatcctg tcggcgtcgc agcgggcctg gcgggggcgg tttccatggc gttcggaacc

9900gtgctgaccc gcaagtggca acctcccgtg cctctgctca cctttaccgc ctggcaactg 9960gcggccggag gacttctgct cgttccagta gctttagtgt ttgatccgcc aatcccgatg 10020cctacaggaa ccaatgttct cggctgctcg actgcacgaa taccagcgac cccttgccca 10080aatacttgcc gtgggcctcg gcctgagagc caaaacactt gatgcggaag aagtcggtgc 10140gctcctgctt gtcgccggca tcgttgcgcc acatctaggt actaaaacaa ttcatccagt 10200aaaatataat attttatttt ctcccaatca ggcttgatcc ccagtaagtc aaaaaatagc 10260tcgacatact gttcttcccc gatatcctcc ctgatcgacc ggacgcagaa ggcaatgtca 10320taccacttgt ccgccctgcc gcttctccca agatcaataa agccacttac tttgccatct 10380ttcacaaaga tgttgctgtc tcccaggtcg ccgtgggaaa agacaagttc ctcttcgggc 10440ttttccgtct ttaaaaaatc atacagctcg cgcggatctt taaatggagt gtcttcttcc 10500cagttttcgc aatccacatc ggccagatcg ttattcagta agtaatccaa ttcggctaag 10560cggctgtcta agctattcgt atagggacaa tccgatatgt cgatggagtg aaagagcctg 10620atgcactccg catacagctc gataatcttt tcagggcttt gttcatcttc atactcttcc 10680gagcaaagga cgccatcggc ctcactcatg agcagattgc tccagccatc atgccgttca 10740aagtgcagga cctttggaac aggcagcttt ccttccagcc atagcatcat gtccttttcc 10800cgttccacat cataggtggt ccctttatac cggctgtccg tcatttttaa atataggttt 10860tcattttctc ccaccagctt atatacctta gcaggagaca ttccttccgt atcttttacg 10920cagcggtatt tttcgatcag ttttttcaat tccggtgata ttctcatttt agccatttat 10980tatttccttc ctcttttcta cagtatttaa agatacccca agaagctaat tataacaaga 11040cgaactccaa ttcactgttc cttgcattct aaaaccttaa ataccagaaa acagcttttt 11100caaagttgtt ttcaaagttg gcgtataaca tagtatcgat tcgatagcgt ggactcaagg 11160ctctcgcgaa tggctcgcgt tggaaacttt cattgacact tgaggggcac cgcagggaaa 11220ttctcgtcct tgcgagaacc ggctatgtcg tgctgcgcat cgagcctgcg cccttggctt 11280gtctcgcccc tctccgcgtc gctacggggc ttccagcgcc tttccgacgc tcaccgggct 11340ggttgccctc gccgctgggc tggcggccgt ctatggccct gcaaacgcgc cagaaacgcc 11400gtcgaagccg tgtgcgagac accgcggccg ccggcgttgt ggatacctcg cggaaaactt 11460ggccctcact gacagatgag gggcggacgt tgacacttga ggggccgact cacccggcgc 11520ggcgttgaca gatgaggggc aggctcgatt tcggccggcg acgtggagct ggccagcctc 11580gcaaatcggc gaaaacgcct gattttacgc gagtttccca cagatgatgt ggacaagcct 11640ggggataagt gccctgcggt attgacactt gaggggcgcg actactgaca gatgaggggc 11700gcgatccttg acacttgagg ggcagagtgc tgacagatga ggggcgcacc tattgacatt 11760tgaggggctg tccacaggca gaaaatccag catttgcaag ggtttccgcc cgtttttcgg 11820ccaccgctaa cctgtctttt aacctgcttt taaaccaata tttataaacc ttgtttttaa 11880ccagggctgc gccctgtgcg cgtgaccgcg cacgccgaag gggggtgccc ccccttctcg 11940aaccctcccg gcccgctaac gcgggcctcc catcccccca ggggctgcgc ccctcggccg 12000cgaacggcct caccccaaaa atggcagcgc cagattattg aagcatttat cagggttatt 12060gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc 12120gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc atgacattaa 12180cctataaaaa taggcgtatc acgaggccct ttcgtcttca agaattggtc gacgatcttg 12240ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggattgaagg cgagatccag 12300caactcgcgc cagatcatcc tgtgacggaa ctttggcgcg tgatgactgg ccaggacgtc 12360ggccgaaaga gcgacaagca gatcacgctt ttcgacagcg tcggatttgc gatcgaggat 12420ttttcggcgc tgcgctacgt ccgcgaccgc gttgagggat caagccacag cagcccactc 12480gaccttctag ccgacccaga cgagccaagg gatctttttg gaatgctgct ccgtcgtcag 12540gctttccgac gtttgggtgg ttgaacagaa gtcattatcg cacggaatgc caagcactcc 12600cgaggggaac cctgtggttg gcatgcacat acaaatggac gaacggataa accttttcac 12660gcccttttaa atatccgatt attctaataa acgctctttt ctcttaggtt tacccgccaa 12720tatatcctgt caaacactga tagtttaaac tgaaggcggg aaacgacaat ctgatcatga 12780gcggagaatt aagggagtca cgttatgacc cccgccgatg acgcgggaca agccgtttta 12840cgtttggaac tgacagaacc gcaacgttga aggagccact cagc 12884513026DNAArtificialpLC40GWB 5aagcttgcgg ccgcttcgaa gatgttaatt aacatcggta ccgagctcta gggataacag 60ggtaatagct cgaattctag cttgcatgcc tgcagtgcag cgtgacccgg tcgtgcccct 120ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 180tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 240gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 300cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 360ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 420catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 480tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 540tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 600taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 660gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 720cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 780ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 840gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 900cggcagctac gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt 960aataaataga caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca 1020cacacacaac cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg 1080ctcgtcctcc cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta 1140gggcccggta gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg 1200tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact 1260tgccagtgtt tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg 1320atttcatgat tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca 1380atatatgccg tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt 1440gatgatgtgg tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac 1500ctggtggatt tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa 1560ttgaagatga tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta 1620ctgatgcata tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg 1680cggtcgttca ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta 1740ttaattttgg aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat 1800ggaaatatcg atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat 1860gatggcatat gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa 1920acaagtatgt tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag 1980ctatatgtgg atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc 2040ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatca 2100tcacaagttt gtacaaaaaa gcaggctcca tggacccaga acgacgcccg gccgacatcc 2160gccgtgccac cgaggcggac atgccggcgg tctgcaccat cgtcaaccac tacatcgaga 2220caagcacggt caacttccgt accgagccgc aggaaccgca ggagtggacg gacgacctcg 2280tccgtctgcg ggagcgctat ccctggctcg tcgccgaggt ggacggcgag gtcgccggca 2340tcgcctacgc gggcccctgg aaggcacgca acgcctacga ctggacggcc gagtcgaccg 2400tgtacgtctc cccccgccac cagcggacgg gactgggctc cacgctctac acccacctgc 2460tgaagtccct ggaggcacag ggcttcaaga gcgtggtcgc tgtcatcggg ctgcccaacg 2520acccgagcgt gcgcatgcac gaggcgctcg gatatgcccc ccgcggcatg ctgcgggcgg 2580ccggcttcaa gcacgggaac tggcatgacg tgggtttctg gcagctggac ttcagcctgc 2640cggtaccgcc ccgtccggtc ctgcccgtca ccgagatctg atctcacgcg tctaggaacc 2700cagctttctt gtacaaagtg gtgatgatcc gtcgacctgc agatcgttca aacatttggc 2760aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc 2820tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat 2880gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat 2940agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatccgatga 3000taagctgtca aacatgagaa ttcagtacat taaaaacgtc cgcaatgtgt tattaagttg 3060tctaagcgtc aatttgttta caccacaata tatcctgcca ccagccagcc aacagctccc 3120cgaccggcag ctcggcacaa aatcaccact cgatacaggc agcccatcag tccgggacgg 3180cgtcagcggg agagccgttg taaggcggca gactttgctc atgttaccga tgctattcgg 3240aagaacggca actaagctgc cgggtttgaa acacggatga tctcgcggag ggtagcatgt 3300tgattgtaac gatgacagag cgttgctgcc tgtgatcaaa tatcatctcc ctcgcagaga 3360tccgaattat cagccttctt attcatttct cgcttaaccg tgacaggctg tcgatcttga 3420gaactatgcc gacataatag gaaatcgctg gataaagccg ctgaggaagc tgagtggcgc 3480tatttcttta gaagtgaacg ttgacgatcg tcgaccgtac cccgatgaat taattcggac 3540gtacgttctg aacacagctg gatacttact tgggcgattg tcatacatga catcaacaat 3600gtacccgttt gtgtaaccgt ctcttggagg ttcgtatgac actaggtcgc taccttagga 3660ccgttatagt tactagcgaa ttgacatgag gttgccccgt attcagtgtc gctgatttgt 3720attgtctgaa gttgttttta cgttaagttg atgcagatca attaatacga tacctgcgtc 3780ataattgatt atttgacgtg gtttgatggc ctccacgcac gttgtgatat gtagatgata 3840atcattatca ctttacgggt cctttccggt gatccgacag gttacggggc ggcgacctcg 3900cgggttttcg ctatttatga aaattttccg gtttaaggcg tttccgttct tcttcgtcat 3960aacttaatgt ttttatttaa aataccctct gaaaagaaag gaaacgacag gtgctgaaag 4020cgagcttttt ggcctctgtc gtttcctttc tctgtttttg tccgtggaat gaacaatgga 4080aggatcttct cggcggcgat cacgacgccg gccctgcgga gccttcgccg cgtgcgcgat 4140tcatggcggc cgtggaggcc aaggatttcg cgcgagtgca agagctgatc gaggcgcgtg 4200gagccaagtc ggcggctgat tatgtccttg cgcagctcgc cgtggccgaa ggtctggacc 4260gcaagcctgg tgcgcgcgtc gtggtcggga aagcggcggg cagcatggca atgccgcctg 4320cggcgctggg ttttacgcca aggggagaag cggcatacgc catcgagcgg tcagcctatg 4380gtgagccgag gtccagcatt gcgaagcagt accagcagga atggaaccgg aaggcggcga 4440cctggtgggc gatggccggt gtggccggca tcatcggcgc gatcctggcg gcggcggcaa 4500ccggctttgt tgggctggca gtgtcgatcc gcaaccgagt gaagcgcgtg cgcgacctgt 4560tggtgatgga gccgggtgca gagccataag cggcaagaga cgaaagcccg gtttccgggc 4620ttttgttttg ttacgccaag gacgagtttt agcggctaaa ggtgttgacg tgcgagaaat 4680gtttagctaa acttctctca tgtgctggcg gctgtcaccg ctatgttcaa ccaaggcgcg 4740gagcaaatta tgggtgttat ccatgaagaa acggcttacc gaaagccagt tccaggaggc 4800gatccagggg ctggaagtgg ggcagcagac catcgagata gcgcggggcg tcttagtcga 4860tgggaagcca caggcgacgt tcgcaacgtc gctgggactg accaggggcg cagtgtcgca 4920agcggtgcat cgcgtgtggg ccgcgttcga ggacaagaac ttgcccgagg ggtacgcgcg 4980ggtaacggcg gttctgccgg aacatcaggc gtacatcgtc cggaagtggg aagcggacgc 5040caagaaaaaa caggaaacca aacgatgaaa actttggtca cggccaacca gaaaggcggc 5100gtcggcaaga cttcgaccct tgtgcatctt gccttcgact ttttcgagcg cggcttgcgg 5160gttgccgtga tcgacctgga cccccagggc aatgcgtcct acacgctcaa ggactttgct 5220accggcctgc atgcaagcaa gctgttcggc gctgtccctg ccggcggctg gaccgaaacc 5280gcacccgcag ccggcgacgg ccaggccgcg cgcctcgccc tcatcgagtc caacccggta 5340ctggcgaacg ccgaacggct gtcgctggac gacgcccgcg agctgttcgg ggcgaacatc 5400aaggccctgg cgaaccaagg cttcgacgtg tgcctgatcg acacggcccc gacccttggc 5460gtcggcctgg cggccgccct cttcgcggcc gactatgtgc tgtcccccat cgagcttgag 5520gcgtacagca tccagggcat caagaagatg gtcacgacca ttgcgaacgt gcgccagaag 5580aacgccaagc tgcaattcct tggcatggtg cccagcaagg tcgatgcgcg gaatccgcgc 5640cacgcgcgcc accaagccga gctgctggcc gcgtacccca agatgatgat tccggccacc 5700gttggcctgc gcagcagcat cgccgatgcc ctcgcatccg gtgtgccggt ctggaagatc 5760aagaaaacgg ccgcgcgcaa ggcatcgaaa gaggttcgcg ccctggctga ttacgtgttc 5820acgaagatgg agatttccca atgactgcgg ctcaagccaa gaccaccaag aaaaacaccg 5880ctgcggccgc tcaggaagcc gcaggcgcgg cgcagccgtc cggcctgggg ttggatagca 5940tcggcgacct gtcgagcctc ctggacgctc ctgcggcgtc tcagggcggt tccggcccta 6000tcgagctgga cctggacctg atcgacgaag atccgcatca gccgcggacg gccgacaacc 6060ccggcttttc cccggagagc atcgcggaaa tcggtgccac gatcaaagag cgcggggtga 6120agtcacccat ttcggtgcgc gagaaccagg agcagccggg ccgctatatc atcaatcacg 6180gcgcccgccg ctaccgtggc tcgaatctag tgatattcca caaaacagca gggaagcagc 6240gcttttccgc tgcataaccc tgcttcgggg tcattatagc gattttttcg gtatatccat 6300cctttttcgc acgatataca ggattttgcc aaagggttcg tgtagacttt ccttggtgta 6360tccaacggcg tcagccgggc aggataggtg aagtaggccc acccgcgagc gggtgttcct 6420tcttcactgt cccttattcg cacctggcgg tgctcaacgg gaatcctgct ctgcgaggct 6480ggccggctac cgccggcgta acagatgagg gcaagcggat ggctgatgaa accaagccaa 6540ccaggaaggg cagcccacct atcaaggtgt actgccttcc agacgaacga agagcgattg 6600aggaaaaggc ggcggcggcc ggcatgagcc tgtcggccta cctgctggcc gtcggccagg 6660gctacaaaat cacgggcgtc gtggactatg agcacgtccg cgagctggcc cgcatcaatg 6720gcgacctggg ccgcctgggc ggcctgctga aactctggct caccgacgac ccgcgcacgg 6780cgcggttcgg tgatgccacg atcctcgccc tgctggcgaa gatcgaagag aagcaggacg 6840agcttggcaa ggtcatgatg ggcgtggtcc gcccgagggc agagccatga cttttttagc 6900cgctaaaacg gccggggggt gcgcgtgatt gccaagcacg tccccatgcg ctccatcaag 6960aagagcgact tcgcggagct ggtgaagtac atcaccgacg agcaaggcaa gaccgagcgc 7020cagatccaaa acaactgtca aagcgcaccc gcccgatgcc attcgcggca cggcttccgt 7080tgaggatgtc gatatgatgc gcgagccgac ggcccgcaga gaaggggccg ttttagcggc 7140taaagaagga agtgcaagcc ctaacccttg gcgtcagagc cttccacgca gcttttttcg 7200ggtgtcgtcg ccccatttct ttacgataaa cgccttatgt gacggcaaaa ccacactgat 7260gcgttcgtat ccgggcggca cgctgctctt gaaaggatga cccgcaatct ccgcgagtgc 7320ctcgcggtca aggtcggtgg actccaggag aagaggtagg ggagtttcca gggcgtcggc 7380aatggcctcc atcaccttca acgaggggtt ggccttaccg ttggttaagt ctgataaaaa 7440cgaaattgaa acccctgccc tctccgacag ctcatgtttc gtcatgcccc gctcatcgag 7500cagacgaagg atgttggtga aaaatatctg gttgtacaca gcggaagccg cccctcgcac 7560ctttggtcgc ggcccgcaaa attttagccg ctaaagttct tgacagcgga accaatgttt 7620agctaaacta gagtctcctt tctcaaggag actttcgata tgagccataa tcagttccag 7680tttatcggta atcttacccg tgacaccgag gtacgtcatg gcaattctaa caagccgcaa 7740gcaattttcg atatagcggt taatgaagag tggcgcaacg atgccggcga caagcaggag 7800cgcaccgact tcttccgcat caagtgtttt ggctctcagg ccgaggccca cggcaagtat 7860ttgggcaagg ggtcgctggt attcgtgcag ggcaagattc ggaataccaa gtacgagaag 7920gacggccaga cggtctacgg gaccgacttc attgccgata aggtggatta tctggacacc 7980aaggcaccag gcgggtcaaa tcaggaataa gggcacattg ccccggcgtg agtcggggca 8040atcccgcaag gagggtgaat gaatcggacg tttgaccgga aggcatacag gcaagaactg 8100atcgacgcgg ggttttccgc cgaggatgcc gaaaccatcg caagccgcac cgtcatgcgt 8160gcgccccgcg aaaccttcca gtccgtcggc tcgatggtcc agcaagctac ggccaagatc 8220gagcgcgaca gcgtgcaact ggctccccct gccctgcccg cgccatcggc cgccgtggag 8280cgttcgcgtc gtctcgaaca ggaggcggca ggtttggcga agtcgatgac catcgacacg 8340cgaggaacta tgacgaccaa gaagcgaaaa accgccggcg aggacctggc aaaacaggtc 8400agcgaggcca agcaggccgc gttgctgaaa cacacgaagc agcagatcaa ggaaatgcag 8460ctttccttgt tcgatattgc gccgtggccg gacacgatgc gagcgatgcc aaacgacacg 8520gcccgctctg ccctgttcac cacgcgcaac aagaaaatcc cgcgcgaggc gctgcaaaac 8580aaggtcattt tccacgtcaa caaggacgtg aagatcacct acaccggcgt cgagctgcgg 8640gccgacgatg acgaactggt gtggcagcag gtgttggagt acgcgaagcg cacccctatc 8700ggcgagccga tcaccttcac gttctacgag ctttgccagg acctgggctg gtcgatcaat 8760ggccggtatt acacgaaggc cgaggaatgc ctgtcgcgcc tacaggcgac ggcgatgggc 8820ttcacgtccg accgcgttgg gcacctggaa tcggtgtcgc tgctgcaccg cttccgcgtc 8880ctggaccgtg gcaagaaaac gtcccgttgc caggtcctga tcgacgagga aatcgtcgtg 8940ctgtttgctg gcgaccacta cacgaaattc atatgggaga agtaccgcaa gctgtcgccg 9000acggcccgac ggatgttcga ctatttcagc tcgcaccggg agccgtaccc gctcaagctg 9060gaaaccttcc gcctcatgtg cggatcggat tccacccgcg tgaagaagtg gcgcgagcag 9120gtcggcgaag cctgcgaaga gttgcgaggc agcggcctgg tggaacacgc ctgggtcaat 9180gatgacctgg tgcattgcaa acgctagggc cttgtggggt cagttccggc tgggggttca 9240gcagccagcg ctttactggc atttcaggaa caagcgggca ctgctcgacg cacttgcttc 9300gctcagtatc gctcgggacg cacggcgcgc tctacgaact gccgataaac agaggattaa 9360aattgacaat tgtgattaag gctcagattc gacggcttgg agcggccgac gtgcaggatt 9420tccgcgagat ccgattgtcg gccctgaaga aagctccaga gatgttcggg tccgtttacg 9480agcacgagga gaaaaagccc atggaggcgt tcgctgaacg gttgcgagat gccgtggcat 9540tcggcgccta catcgacggc gagatcattg ggctgtcggt cttcaaacag gaggacggcc 9600ccaaggacgc tcacaaggcg catctgtccg gcgttttcgt ggagcccgaa cagcgaggcc 9660gaggggtcgc cggtatgctg ctgcgggcgt tgccggcggg tttattgctc gtgatgatcg 9720tccgacagat tccaacggga atctggtgga tgcgcatctt catcctcggc gcacttaata 9780tttcgctatt ctggagcttg ttgtttattt cggtctaccg cctgccgggc gggtcgcggc 9840gacggtaggc gctgtgcagc cgctgatggt cgtgttcatc tctgccgctc tgctaggtag 9900cccgatacga ttgatggcgg tcctgggggc tatttgcgga actgcgggcg tggcgctgtt 9960ggtgttgaca ccaaacgcag cgctagatcc tgtcggcgtc gcagcgggcc tggcgggggc 10020ggtttccatg gcgttcggaa ccgtgctgac ccgcaagtgg caacctcccg tgcctctgct 10080cacctttacc gcctggcaac tggcggccgg aggacttctg ctcgttccag tagctttagt 10140gtttgatccg ccaatcccga tgcctacagg aaccaatgtt ctcggctgct cgactgcacg 10200aataccagcg accccttgcc caaatacttg ccgtgggcct cggcctgaga gccaaaacac 10260ttgatgcgga agaagtcggt gcgctcctgc ttgtcgccgg catcgttgcg ccacatctag 10320gtactaaaac aattcatcca gtaaaatata atattttatt ttctcccaat caggcttgat 10380ccccagtaag tcaaaaaata gctcgacata ctgttcttcc ccgatatcct ccctgatcga 10440ccggacgcag aaggcaatgt cataccactt gtccgccctg ccgcttctcc caagatcaat 10500aaagccactt actttgccat ctttcacaaa gatgttgctg tctcccaggt cgccgtggga 10560aaagacaagt tcctcttcgg gcttttccgt ctttaaaaaa tcatacagct cgcgcggatc 10620tttaaatgga gtgtcttctt cccagttttc gcaatccaca tcggccagat cgttattcag 10680taagtaatcc aattcggcta agcggctgtc taagctattc gtatagggac aatccgatat 10740gtcgatggag tgaaagagcc tgatgcactc cgcatacagc tcgataatct tttcagggct 10800ttgttcatct tcatactctt ccgagcaaag gacgccatcg gcctcactca tgagcagatt 10860gctccagcca tcatgccgtt caaagtgcag gacctttgga acaggcagct ttccttccag 10920ccatagcatc atgtcctttt cccgttccac atcataggtg gtccctttat accggctgtc 10980cgtcattttt aaatataggt tttcattttc tcccaccagc ttatatacct tagcaggaga 11040cattccttcc gtatctttta cgcagcggta tttttcgatc agttttttca attccggtga 11100tattctcatt ttagccattt attatttcct tcctcttttc tacagtattt aaagataccc 11160caagaagcta attataacaa gacgaactcc aattcactgt tccttgcatt ctaaaacctt 11220aaataccaga aaacagcttt ttcaaagttg ttttcaaagt tggcgtataa catagtatcg 11280attcgatagc gtggactcaa ggctctcgcg aatggctcgc gttggaaact ttcattgaca 11340cttgaggggc accgcaggga aattctcgtc cttgcgagaa ccggctatgt cgtgctgcgc 11400atcgagcctg cgcccttggc ttgtctcgcc cctctccgcg tcgctacggg gcttccagcg 11460cctttccgac gctcaccggg ctggttgccc tcgccgctgg gctggcggcc gtctatggcc 11520ctgcaaacgc gccagaaacg ccgtcgaagc cgtgtgcgag acaccgcggc cgccggcgtt 11580gtggatacct cgcggaaaac ttggccctca ctgacagatg aggggcggac gttgacactt 11640gaggggccga ctcacccggc gcggcgttga cagatgaggg gcaggctcga tttcggccgg 11700cgacgtggag ctggccagcc tcgcaaatcg gcgaaaacgc ctgattttac gcgagtttcc 11760cacagatgat gtggacaagc ctggggataa gtgccctgcg gtattgacac ttgaggggcg 11820cgactactga cagatgaggg gcgcgatcct tgacacttga ggggcagagt gctgacagat 11880gaggggcgca cctattgaca tttgaggggc tgtccacagg cagaaaatcc agcatttgca 11940agggtttccg cccgtttttc ggccaccgct aacctgtctt ttaacctgct tttaaaccaa 12000tatttataaa ccttgttttt aaccagggct

gcgccctgtg cgcgtgaccg cgcacgccga 12060aggggggtgc ccccccttct cgaaccctcc cggcccgcta acgcgggcct cccatccccc 12120caggggctgc gcccctcggc cgcgaacggc ctcaccccaa aaatggcagc gccagattat 12180tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 12240aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa 12300accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtctt 12360caagaattgg tcgacgatct tgctgcgttc ggatattttc gtggagttcc cgccacagac 12420ccggattgaa ggcgagatcc agcaactcgc gccagatcat cctgtgacgg aactttggcg 12480cgtgatgact ggccaggacg tcggccgaaa gagcgacaag cagatcacgc ttttcgacag 12540cgtcggattt gcgatcgagg atttttcggc gctgcgctac gtccgcgacc gcgttgaggg 12600atcaagccac agcagcccac tcgaccttct agccgaccca gacgagccaa gggatctttt 12660tggaatgctg ctccgtcgtc aggctttccg acgtttgggt ggttgaacag aagtcattat 12720cgcacggaat gccaagcact cccgagggga accctgtggt tggcatgcac atacaaatgg 12780acgaacggat aaaccttttc acgccctttt aaatatccga ttattctaat aaacgctctt 12840ttctcttagg tttacccgcc aatatatcct gtcaaacact gatagtttaa actgaaggcg 12900ggaaacgaca atctgatcat gagcggagaa ttaagggagt cacgttatga cccccgccga 12960tgacgcggga caagccgttt tacgtttgga actgacagaa ccgcaacgtt gaaggagcca 13020ctcagc 13026627875DNAArtificialpLCSBGWBSW 6aagcttgcgg ccgcttcgcc atttaaatgg cgaagatgtt aattaacatc ggtaccgagc 60tctagggata acagggtaat agctcgaatt ctagcttgca tgcctgcagt gcagcgtgac 120ccggtcgtgc ccctctctag agataatgag cattgcatgt ctaagttata aaaaattacc 180acatattttt tttgtcacac ttgtttgaag tgcagtttat ctatctttat acatatattt 240aaactttact ctacgaataa tataatctat agtactacaa taatatcagt gttttagaga 300atcatataaa tgaacagtta gacatggtct aaaggacaat tgagtatttt gacaacagga 360ctctacagtt ttatcttttt agtgtgcatg tgttctcctt tttttttgca aatagcttca 420cctatataat acttcatcca ttttattagt acatccattt agggtttagg gttaatggtt 480tttatagact aattttttta gtacatctat tttattctat tttagcctct aaattaagaa 540aactaaaact ctattttagt ttttttattt aataatttag atataaaata gaataaaata 600aagtgactaa aaattaaaca aatacccttt aagaaattaa aaaaactaag gaaacatttt 660tcttgtttcg agtagataat gccagcctgt taaacgccgt cgacgagtct aacggacacc 720aaccagcgaa ccagcagcgt cgcgtcgggc caagcgaagc agacggcacg gcatctctgt 780cgctgcctct ggacccctct cgagagttcc gctccaccgt tggacttgct ccgctgtcgg 840catccagaaa ttgcgtggcg gagcggcaga cgtgagccgg cacggcaggc ggcctcctcc 900tcctctcacg gcaccggcag ctacggggga ttcctttccc accgctcctt cgctttccct 960tcctcgcccg ccgtaataaa tagacacccc ctccacaccc tctttcccca acctcgtgtt 1020gttcggagcg cacacacaca caaccagatc tcccccaaat ccacccgtcg gcacctccgc 1080ttcaaggtac gccgctcgtc ctcccccccc ccccctctct accttctcta gatcggcgtt 1140ccggtccatg gttagggccc ggtagttcta cttctgttca tgtttgtgtt agatccgtgt 1200ttgtgttaga tccgtgctgc tagcgttcgt acacggatgc gacctgtacg tcagacacgt 1260tctgattgct aacttgccag tgtttctctt tggggaatcc tgggatggct ctagccgttc 1320cgcagacggg atcgatttca tgattttttt tgtttcgttg catagggttt ggtttgccct 1380tttcctttat ttcaatatat gccgtgcact tgtttgtcgg gtcatctttt catgcttttt 1440tttgtcttgg ttgtgatgat gtggtctggt tgggcggtcg ttctagatcg gagtagaatt 1500ctgtttcaaa ctacctggtg gatttattaa ttttggatct gtatgtgtgt gccatacata 1560ttcatagtta cgaattgaag atgatggatg gaaatatcga tctaggatag gtatacatgt 1620tgatgcgggt tttactgatg catatacaga gatgcttttt gttcgcttgg ttgtgatgat 1680gtggtgtggt tgggcggtcg ttcattcgtt ctagatcgga gtagaatact gtttcaaact 1740acctggtgta tttattaatt ttggaactgt atgtgtgtgt catacatctt catagttacg 1800agtttaagat ggatggaaat atcgatctag gataggtata catgttgatg tgggttttac 1860tgatgcatat acatgatggc atatgcagca tctattcata tgctctaacc ttgagtacct 1920atctattata ataaacaagt atgttttata attattttga tcttgatata cttggatgat 1980ggcatatgca gcagctatat gtggattttt ttagccctgc cttcatacgc tatttatttg 2040cttggtactg tttcttttgt cgatgctcac cctgttgttt ggtgttactt ctgcaggtcg 2100actctagagg atcatcacaa gtttgtacaa aaaagcaggc tccatggacc cagaacgacg 2160cccggccgac atccgccgtg ccaccgaggc ggacatgccg gcggtctgca ccatcgtcaa 2220ccactacatc gagacaagca cggtcaactt ccgtaccgag ccgcaggaac cgcaggagtg 2280gacggacgac ctcgtccgtc tgcgggagcg ctatccctgg ctcgtcgccg aggtggacgg 2340cgaggtcgcc ggcatcgcct acgcgggccc ctggaaggca cgcaacgcct acgactggac 2400ggccgagtcg accgtgtacg tctccccccg ccaccagcgg acgggactgg gctccacgct 2460ctacacccac ctgctgaagt ccctggaggc acagggcttc aagagcgtgg tcgctgtcat 2520cgggctgccc aacgacccga gcgtgcgcat gcacgaggcg ctcggatatg ccccccgcgg 2580catgctgcgg gcggccggct tcaagcacgg gaactggcat gacgtgggtt tctggcagct 2640ggacttcagc ctgccggtac cgccccgtcc ggtcctgccc gtcaccgaga tctgatctca 2700cgcgtctagg aacccagctt tcttgtacaa agtggtgatg atccgtcgac ctgcagatcg 2760ttcaaacatt tggcaataaa gtttcttaag attgaatcct gttgccggtc ttgcgatgat 2820tatcatataa tttctgttga attacgttaa gcatgtaata attaacatgt aatgcatgac 2880gttatttatg agatgggttt ttatgattag agtcccgcaa ttatacattt aatacgcgat 2940agaaaacaaa atatagcgcg caaactagga taaattatcg cgcgcggtgt catctatgtt 3000actagatccg atgataagct gtcaaacatg agaattcagt acattaaaaa cgtccgcaat 3060gtgttattaa gttgtctaag cgtcaatttg tttacaccac aatatatcct gccaccagcc 3120agccaacagc tccccgaccg gcagctcggc acaaaatcac cactcgatac aggcagccca 3180tcagtccggg acggcgtcag cgggagagcc gttgtaaggc ggcagacttt gctcatgtta 3240ccgatgctat tcggaagaac ggcaactaag ctgccgggtt tgaaacacgg atgatctcgc 3300ggagggtagc atgttgattg taacgatgac agagcgttgc tgcctgtgat caaatatcat 3360ctccctcgca gagatccgaa ttatcagcct tcttattcat ttctcgctta accgtgacag 3420gctgtcgatc ttgagaacta tgccgacata ataggaaatc gctggataaa gccgctgagg 3480aagctgagtg gcgctatttc tttagaagtg aacgttgacg atcgtcgacc gtaccccgat 3540gaattaattc ggacgtacgt tctgaacaca gctggatact tacttgggcg attgtcatac 3600atgacatcaa caatgtaccc gtttgtgtaa ccgtctcttg gaggttcgta tgacactagg 3660tcgctacctt aggaccgtta tagttactag aaatggtacc tgcggggaag cttacaataa 3720tgtgtgttgt taagtcttgt tgcctgtcat cgtctgactg actttcgtca taaatcccgg 3780cctccgtaac ccagctttgg gcaagctcac ggatttgatc cggcggaacg ggaatatcga 3840gatgccgggc tgaacgctgc agttccagct ttccctttcg ggacaggtac tccagctgat 3900tgattatctg ctgaagggtc ttggttccac ctcctggcac aatgcgaatg attacttgag 3960cgcgatcggg catccaattt tctcccgtca ggtgcgtggt caagtgctac aaggcacctt 4020tcagtaacga gcgaccgtcg atccgtcgcc gggatacgga caaaatggag cgcagtagtc 4080catcgagggc ggcgaaagcc tcgccaaaag caatacgttc atctcgcaca gcctccagat 4140ccgatcgagg gtcttcggcg taggcagata gaagcatgga tacattgctt gagagtattc 4200cgatggactg aagtatggct tccatctttt ctcgtgtgtc tgcatctatt tcgagaaagc 4260ccccgatgcg gcgcaccgca acgcgaattg ccatactatc cgaaagtccc agcaggcgcg 4320cttgatagga aaaggtttca tactcggccg atcgcagacg ggcactcacg accttgaacc 4380cttcaacttt cagggatcga tgctggttga tggtagtctc actcgacgtg gctctggtgt 4440gttttgacat agcttcctcc aaagaaagcg gaaggtctgg atactccagc acgaaatgtg 4500cccgggtaga cggatggaag tctagccctg ctcaatatga aatcaacagt acatttacag 4560tcaatactga atatacttgc tacatttgca attgtcttat aacgaatgtg aaataaaaat 4620agtgtaacaa cgcttttact catcgataat cacaaaaaca tttatacgaa caaaaataca 4680aatgcactcc ggtttcacag gataggcggg atcagaatat gcaacttttg acgttttgtt 4740ctttcaaagg gggtgctggc aaaaccaccg cactcatggg cctttgcgct gctttggcaa 4800atgacggtaa acgagtggcc ctctttgatg ccgacgaaaa ccggcctctg acgcgatgga 4860gagaaaacgc cttacaaagc agtactggga tcctcgctgt gaagtctatt ccgccgacga 4920aatgcccctt cttgaagcag cctatgaaaa tgccgagctc gaaggatttg attatgcgtt 4980ggccgatacg cgtggcggct cgagcgagct caacaacaca atcatcgcta gctcaaacct 5040gcttctgatc cccaccatgc taacgccgct cgacatcgat gaggcactat ctacctaccg 5100ctacgtcatc gagctgctgt tgagtgaaaa tttggcaatt cctacagctg ttttgcgcca 5160acgcgtcccg gtcggccgat tgacaacatc gcaacgcagg atgtcagaga cgctagagag 5220ccttccagtt gtaccgtctc ccatgcatga aagagatgca tttgccgcga tgaaagaacg 5280cggcatgttg catcttacat tactaaacac gggaactgat ccgacgatgc gcctcataga 5340gaggaatctt cggattgcga tggaggaagt cgtggtcatt tcgaaactga tcagcaaaat 5400cttggaggct tgaagatggc aattcgcaag cccgcattgt cggtcggcga agcacggcgg 5460cttgctggtg ctcgacccga gatccaccat cccaacccga cacttgttcc ccagaagctg 5520gacctccagc acttgcctga aaaagccgac gagaaagacc agcaacgtga gcctctcgtc 5580gccgatcaca tttacagtcc cgatcgacaa cttaagctaa ctgtggatgc ccttagtcca 5640cctccgtccc cgaaaaagct ccaggttttt ctttcagcgc gaccgcccgc gcctcaagtg 5700tcgaaaacat atgacaacct cgttcggcaa tacagtccct cgaagtcgct acaaatgatt 5760ttaaggcgcg cgttggacga tttcgaaagc atgctggcag atggatcatt tcgcgtggcc 5820ccgaaaagtt atccgatccc ttcaactaca gaaaaatccg ttctcgttca gacctcacgc 5880atgttcccgg ttgcgttgct cgaggtcgct cgaagtcatt ttgatccgtt ggggttggag 5940accgctcgag ctttcggcca caagctggct accgccgcgc tcgcgtcatt ctttgctgga 6000gagaagccat cgagcaattg gtgaagaggg acctatcgga acccctcacc aaatattgag 6060tgtaggtttg aggccgctgg ccgcgtcctc agtcaccttt tgagccagat aattaagagc 6120caaatgcaat tggctcaggc tgccatcgtc cccccgtgcg aaacctgcac gtccgcgtca 6180aagaaataac cggcacctct tgctgttttt atcagttgag ggcttgacgg atccgcctca 6240agtttgcggc gcagccgcaa aatgagaaca tctatactcc tgtcgtaaac ctcctcgtcg 6300cgtactcgac tggcaatgag aagttgctcg cgcgatagaa cgtcgcgggg tttctctaaa 6360aacgcgagga gaagattgaa ctcacctgcc gtaagtttca cctcaccgcc agcttcggac 6420atcaagcgac gttgcctgag attaagtgtc cagtcagtaa aacaaaaaga ccgtcggtct 6480ttggagcgga caacgttggg gcgcacgcgc aaggcaaccc gaatgcgtgc aagaaactct 6540ctcgtactaa acggcttagc gataaaatca cttgctccta gctcgagtgc aacaacttta 6600tccgtctcct caaggcggtc gccactgata attatgattg gaatatcaga ctttgccgcc 6660agatttcgaa cgatctcaag cccatcttca cgacctaaat ttagatcaac aaccacgaca 6720tcgaccgtcg cggaagagag tactctagtg aactgggtgc tgtcggctac cgcggtcact 6780ttgaaggcgt ggatcgtaag gtattcgata ataagatgcc gcatagcgac atcgtcatcg 6840ataagaagaa cgtgtttcaa cggctcacct ttcaatctaa aatctgaacc cttgttcaca 6900gcgcttgaga aattttcacg tgaaggatgt acaatcatct ccagctaaat gggcagttcg 6960tcagaattgc ggctgaccgc ggatgacgaa aatgcgaacc aagtatttca attttatgac 7020aaaagttctc aatcgttgtt acaagtgaaa cgcttcgagg ttacagctac tattgattaa 7080ggagatcgcc tatggtctcg ccccggcgtc gtgcgtccgc cgcgagccag atctcgccta 7140cttcataaac gtcctcatag gcacggaatg gaatgatgac atcgatcgcc gtagagagca 7200tgtcaatcag tgtgcgatct tccaagctag caccttgggc gctacttttg acaagggaaa 7260acagtttctt gaatccttgg attggattcg cgccgtgtat tgttgaaatc gatcccggat 7320gtcccgagac gacttcactc agataagccc atgctgcatc gtcgcgcatc tcgccaagca 7380atatccggtc cggccgcata cgcagacttg cttggagcaa gtgctcggcg ctcacagcac 7440ccagcccagc accgttcttg gagtagagta gtctaacatg attatcgtgt ggaatgacga 7500gttcgagcgt atcttctatg gtgattagcc tttcctgggg ggggatggcg ctgatcaagg 7560tcttgctcat tgttgtcttg ccgcttccgg tagggccaca tagcaacatc gtcagtcggc 7620tgacgacgca tgcgtgcaga aacgcttcca aatccccgtt gtcaaaatgc tgaaggatag 7680cttcatcatc ctgattttgg cgtttccttc gtgtctgcca ctggttccac ctcgaagcat 7740cataacggga ggagacttct ttaagaccag aaacacgcga gcttggccgt cgaatggtca 7800agctgacggt gcccgaggga acggtcggcg gcagacagat ttgtagtcgt tcaccaccag 7860gaagttcagt ggcgcagagg gggttacgtg gtccgacatc ctgctttctc agcgcgcccg 7920ctaaaatagc gatatcttca agatcatcat aagagacggg caaaggcatc ttggtaaaaa 7980tgccggcttg gcgcacaaat gcctctccag gtcgattgat cgcaatttct tcagtcttcg 8040ggtcatcgag ccattccaaa atcggcttca gaagaaagcg tagttgcgga tccacttcca 8100tttacaatgt atcctatctc taagcggaaa tttgaattca ttaagagcgg cggttcctcc 8160cccgcgtggc gccgccagtc aggcggagct ggtaaacacc aaagaaatcg aggtcccgtg 8220ctacgaaaat ggaaacggtg tcaccctgat tcttcttcag ggttggcggt atgttgatgg 8280ttgccttaag ggctgtctca gttgtctgct caccgttatt ttgaaagctg ttgaagctca 8340tcccgccacc cgagctgccg gcgtaggtgc tagctgcctg gaaggcgcct tgaacaacac 8400tcaagagcat agctccgcta aaacgctgcc agaagtggct gtcgaccgag cccggcaatc 8460ctgagcgacc gagttcgtcc gcgcttggcg atgttaacga gatcatcgca tggtcaggtg 8520tctcggcgcg atcccacaac acaaaaacgc gcccatctcc ctgttgcaag ccacgctgta 8580tttcgccaac aacggtggtg ccacgatcaa gaagcacgat attgttcgtt gttccacgaa 8640tatcctgagg caagacacac tttacatagc ctgccaaatt tgtgtcgatt gcggtttgca 8700agatgcacgg aattattgtc ccttgcgtta ccataaaatc ggggtgcggc aagagcgtgg 8760cgctgctggg ctgcagctcg gtgggtttca tacgtatcga caaatcgttc tcgccggaca 8820cttcgccatt cggcaaggag ttgtcgtcac gcttgccttc ttgtcttcgg cccgtgtcgc 8880cctgaatggc gcgtttgctg accccttgat cgccgctgct atatgcaaaa atcggtgttt 8940cttccggccg tggctcatgc cgctccggtt cgcccctcgg cggtagagga gcagcaggct 9000gaacagcctc ttgaaccgct ggaggatccg gcggcacctc aatcggagct ggatgaaatg 9060gcttggtgtt tgttgcgatc aaagttgacg gcgatgcgtt ctcattcacc ttcttttggc 9120gcccacctag ccaaatgagg cttaatgata acgcgagaac gacacctccg acgatcaatt 9180tctgagaccc cgaaagacgc cggcgatgtt tgtcggagac cagggatcca gatgcatcaa 9240cctcatgtgc cgcttgctga ctatcgttat tcatcccttc gcccccttca ggacgcgttt 9300cacatcgggc ctcaccgtgc ccgtttgcgg cctttggcca acgggatcgt aagcggtgtt 9360ccagatacat agtactgtgt ggccatccct cagacgccaa cctcgggaaa ccgaagaaat 9420ctcgacatcg ctccctttaa ctgaatagtt ggcaacagct tccttgccat caggattgat 9480ggtgtagatg gagggtatgc gtacattgcc cggaaagtgg aataccgtcg taaatccatt 9540gtcgaagact tcgagtggca acagcgaacg atcgccttgg gcgacgtagt gccaattact 9600gtccgccgca ccaagggctg tgacaggctg atccaataaa ttctcagctt tccgttgata 9660ttgtgcttcc gcgtgtagtc tgtccacaac agccttctgt tgtgcctccc ttcgccgagc 9720cgccgcatcg tcggcggggt aggcgaattg gacgctgtaa tagagatcgg gctgctcttt 9780atcgaggtgg gacagagtct tggaacttat actgaaaaca taacggcgca tcccggagtc 9840gcttgcggtt agcacgatta ctggctgagg cgtgaggacc tggcttgcct tgaaaaatag 9900ataatttccc cgcggtaggg ctgctagatc tttgctattt gaaacggcaa ccgctgtcac 9960cgtttcgttc gtggcgaatg ttacgaccaa agtagctcca accgccgtcg agaggcgcac 10020cacttgatcg ggattgtaag ccaaataacg catgcgcgga tctagcttgc ccgccattgg 10080agtgtcttca gcctccgcac cagtcgcagc ggcaaataaa catgctaaaa tgaaaagtgc 10140ttttctgatc atggttcgct gtggcctacg tttgaaacgg tatcttccga tgtctgatag 10200gaggtgacaa ccagacctgc cgggttggtt agtctcaatc tgccgggcaa gctggtcacc 10260ttttcgtagc gaactgtcgc ggtccacgta ctcaccacag gcattttgcc gtcaacgacg 10320agggtccttt tatagcgaat ttgctgcgtg cttggagtta catcatttga agcgatgtgc 10380tcgacctcca ccctgccgcg tttgccaaga atgacttgag gcgaactggg attgggatag 10440ttgaagaatt gctggtaatc ctggcgcact gttggggcac tgaagttcga taccaggtcg 10500taggcgtact gagcggtgtc ggcatcataa ctctcgcgca ggcgaacgta ctcccacaat 10560gaggcgttaa cgacggcctc ctcttgagtt gcaggcaatc gcgagacaga cacctcgctg 10620tcaacggtgc cgtccggccg tatccataga tatacgggca caagcctgct caacggcacc 10680attgtggcta tagcgaacgc ttgagcaaca tttcccaaaa tcgcgatagc tgcgacagct 10740gcaatgagtt tggagagacg tcgcgccgat ttcgctcgcg cggtttgaaa ggcttctact 10800tccttatagt gctcggcaag gctttcgcgc gccactagca tggcatattc aggccccgtc 10860atagcgtcca cccgaattgc cgagctgaag atctgacgga gtaggctgcc atcgccccac 10920attcagcggg aagatcgggc ctttgcagct cgctaatgtg tcgtttgtct ggcagccgct 10980caaagcgaca actaggcaca gcaggcaata cttcatagaa ttctccattg aggcgaattt 11040ttgcgcgacc tagcctcgct caacctgagc gaagcgacgg tacaagctgc tggcagattg 11100ggttgcgccg ctccagtaac tgcctccaat gttgccggcg atcgccggca aagcgacaat 11160gagcgcatcc cctgtcagaa aaaacatatc gagttcgtaa agaccaatga tcttggccgc 11220ggtcgtaccg gcgaaggtga ttacaccaag cataagggtg agcgcagtcg cttcggttag 11280gatgacgatc gttgccacga ggtttaagag gagaagcaag agaccgtagg tgataagttg 11340cccgatccac ttagctgcga tgtcccgcgt gcgatcaaaa atatatccga cgaggatcag 11400aggcccgatc gcgagaagca ctttcgtgag aattccaacg gcgtcgtaaa ctccgaaggc 11460agaccagagc gtgccgtaaa ggacccactg tgccccttgg aaagcaagga tgtcctggtc 11520gttcatcgga ccgatttcgg atgcgatttt ctgaaaaacg gcctgggtca cggcgaacat 11580tgtatccaac tgtgccggaa cagtctgcag aggcaagccg gttacactaa actgctgaac 11640aaagtttggg accgtctttt cgaagatgga aaccacatag tcttggtagt tagcctgccc 11700aacaattaga gcaacaacga tggtgaccgt gatcacccga gtgataccgc tacgggtatc 11760gacttcgccg cgtatgacta aaataccctg aacaataatc caaagagtga cacaggcgat 11820caatggcgca ctcaccgcct cctggatagt ctcaagcatc gagtccaagc ctgtcgtgaa 11880ggctacatcg aagatcgtat gaatggccgt aaacggcgcc ggaatcgtga aattcatcga 11940ttggacctga acttgactgg tttgtcgcat aatgttggat aaaatgagct cgcattcggc 12000gaggatgcgg gcggatgaac aaatcgccca gccttagggg agggcaccaa agatgacagc 12060ggtcttttga tgctccttgc gttgagcggc cgcctcttcc gcctcgtgaa ggccggcctg 12120cgcggtagtc atcgttaata ggcttgtcgc ctgtacattt tgaatcattg cgtcatggat 12180ctgcttgaga agcaaaccat tggtcacggt tgcctgcatg atattgcgag atcgggaaag 12240ctgagcagac gtatcagcat tcgccgtcaa gcgtttgtcc atcgtttcca gattgtcagc 12300cgcaatgcca gcgctgtttg cggaaccggt gatctgcgat cgcaacaggt ccgcttcagc 12360atcactaccc acgactgcac gatctgtatc gctggtgatc gcacgtgccg tggtcgacat 12420tggcattcgc ggcgaaaaca tttcattgtc taggtccttc gtcgaaggat actgattttt 12480ctggttgagc gaagtcagta gtccagtaac gccgtaggcc gacgtcaaca tcgtaaccat 12540cgctatagtc tgagtgagat tctccgcagt cgcgagcgca gtcgcgagcg tctcagcctc 12600cgttgccggg tcgctaacaa caaactgcgc ccgcgcgggc tgaatatata gaaagctgca 12660ggtcaaaact gttgcaataa gttgcgtcgt cttcatcgtt tcctacctta tcaatcttct 12720gcctcgtggt gacgggccat gaattcgctg agccagccag atgagttgcc ttcttgtgcc 12780tcgcgtagtc gagttgcaaa gcgcaccgtg ttggcacgcc ccgaaagcac ggcgacatat 12840tcacgcatat cccgcagatc aaattcgcag atgacgcttc cactttctcg tttaagaaga 12900aacttacggc tgccgaccgt catgtcttca cggatcgcct gaaattcctt ttcggtacat 12960ttcagtccat cgacataagc cgatcgatct gcggttggtg atggatagaa aatcttcgtc 13020atacattgcg caaccaagct ggctcctagc ggcgattcca gaacatgctc tggttgctgc 13080gttgccagta ttagcatccc gttgtttttt cgaacggtca ggaggaattt gtcgacgaca 13140gtcgaaaatt tagggtttaa caaataggcg cgaaactcat cgcagctcat cacaaaacgg 13200cggccgtcga tcatggctcc aatccgatgc aggagatatg ctgcagcggg agcgcatact 13260tcctcgtatt cgagaagatg cgtcatgtcg aagccggtaa tcgacggatc taactttact 13320tcgtcaactt cgccgtcaaa tgcccagcca agcgcatggc cccggcacca gcgttggagc 13380cgcgctcctg cgccttcggc gggcccatgc aacaaaaatt cacgtaaccc cgcgattgaa 13440cgcatttgtg gatcaaacga gagctgacga tggataccac ggaccagacg gcggttctct 13500tccggagaaa tcccaccccg accatcactc tcgatgagag ccacgatcca ttcgcgcaga 13560aaatcgtgtg aggctgctgt gttttctagg ccacgcaacg gcgccaaccc gctgggtgtg 13620cctctgtgaa gtgccaaata tgttcctcct gtggcgcgaa ccagcaattc gccaccccgg 13680tccttgtcaa agaacacgac cgtacctgca cggtcgacca tgctctgttc gagcatggct 13740agaacaaaca tcatgagcgt cgtcttaccc ctcccgatag gcccgaatat tgccgtcatg 13800ccaacatcgt gctcatgcgg gatatagtcg aaaggcgttc cgccattggt acgaaatcgg 13860gcaatcgcgt tgccccagtg gcctgagctg gcgccctctg gaaagttttc gaaagagaca 13920aaccctgcga aattgcgtga agtgattgcg ccagggcgtg tgcgccactt aaaattcccc

13980ggcaattggg accaataggc cgcttccata ccaatacctt cttggacaac cacggcacct 14040gcatccgcca ttcgtgtccg agcccgcgcg cccctgtccc caagactatt gagatcgtct 14100gcatagacgc aaaggctcaa atgatgtgag cccataacga attcgttgct cgcaagtgcg 14160tcctcagcct cggataattt gccgatttga gtcacggctt tatcgccgga actcagcatc 14220tggctcgatt tgaggctaag tttcgcgtgc gcttgcgggc gagtcaggaa cgaaaaactc 14280tgcgtgagaa caagtggaaa atcgagggat agcagcgcgt tgagcatgcc cggccgtgtt 14340tttgcagggt attcgcgaaa cgaatagatg gatccaacgt aactgtcttt tggcgttctg 14400atctcgagtc ctcgcttgcc gcaaatgact ctgtcggtat aaatcgaagc gccgagtgag 14460ccgctgacga ccggaaccgg tgtgaaccga ccagtcatga tcaaccgtag cgcttcgcca 14520atttcggtga agagcacacc ctgcttctcg cggatgccaa gacgatgcag gccatacgct 14580ttaagagagc cagcgacaac atgccaaaga tcttccatgt tcctgatctg gcccgtgaga 14640tcgttttccc tttttccgct tagcttggtg aacctcctct ttaccttccc taaagccgcc 14700tgtgggtaga caatcaacgt aaggaagtgt tcattgcgga ggagttggcc ggagagcacg 14760cgctgttcaa aagcttcgtt caggctagcg gcgaaaacac tacggaagtg tcgcggcgcc 14820gatgatggca cgtcggcatg acgtacgagg tgagcatata ttgacacatg atcatcagcg 14880atattgcgca acagcgtgtt gaacgcacga caacgcgcat tgcgcatttc agtttcctca 14940agctcgaatg caacgccatc aattctcgca atggtcatga tcgatccgtc ttcaagaagg 15000acgatatggt cgctgaggtg gccaatataa gggagataga tctcaccgga tctttcggtc 15060gttccactcg cgccgagcat cacaccattc ctctccctcg tgggggaacc ctaattggat 15120ttgggctaac agtagcgccc ccccaaactg cactatcaat gcttcttccc gcggtccgca 15180aaaatagcag gacgacgctc gccgcattgt agtctcgctc cacgatgagc cgggctgcaa 15240accataacgg cacgagaacg acttcgtaga gcgggttctg aacgataacg atgacaaagc 15300cggcgaacat catgaataac cctgccaatg tcagtggcac cccaagaaac aatgcgggcc 15360gtgtggctgc gaggtaaagg gtcgattctt ccaaacgatc agccatcaac taccgccagt 15420gagcgtttgg ccgaggaagc tcgccccaaa catgataaca atgccgccga cgacgccggc 15480aaccagccca agcgaagccc gcccgaacat ccaggagatc ccgatagcga caatgccgag 15540aacagcgagt gactggccga acggaccaag gataaacgtg catatattgt taaccattgt 15600ggcggggtca gtgccgccac ccgcagattg cgctgcggcg ggtccggatg aggaaatgct 15660ccatgcaatt gcaccgcaca agcttggggc gcagctcgat atcacgcgca tcatcgcatt 15720cgagagcgag aggcgattta gatgtaaacg gtatctctca aagcatcgca tcaatgcgca 15780cctccttagt ataagtcgaa taagacttga ttgtcgtctg cggatttgcc gttgtcctgg 15840tgtggcggtg gcggagcgat taaaccgcca gcgccatcct cctgcgagcg gcgctgatat 15900gacccccaaa catcccacgt ctcttcggat tttagcgcct cgtgatcgtc ttttggaggc 15960tcgattaacg cgggcaccag cgattgagca gctgtttcaa cttttcgcac gtagccgttt 16020gcaaaaccgc cgatgaaatt accggtgttg taagcggaga tcgcccgacg aagcgcaaat 16080tgcttctcgt caatcgtttc gccgcctgca taacgacttt tcagcatgtt tgcagcggca 16140gataatgatg tgcacgcctg gagcgcaccg tcaggtgtca gaccgagcat agaaaaattt 16200cgagagttta tttgcatgag gccaacatcc agcgaatgcc gtgcatcgag acggtgcctg 16260acgacttggg ttgcttggct gtgatcttgc cagtgaagcg tttcgccggt cgtgttgtca 16320tgaatcgcta aaggatcaaa gcgactctcc accttagcta tcgccgcaag cgtagatgtc 16380gcaactgatg gggcacactt gcgagcaaca tggtcaaact cagcagatga gagtggcgtg 16440gcaaggctcg acgaacagaa ggagaccatc aaggcaagag aaagcgaccc cgatctctta 16500agcatacctt atctccttag ctcgcaacta acaccgcctc tcccgttgga agaagtgcgt 16560tgttttatgt tgaagattat cgggagggtc ggttactcga aaattttcaa ttgcttcttt 16620atgatttcaa ttgaagcgag aaacctcgcc cggcgtcttg gaacgcaaca tggaccgaga 16680accgcgcatc catgactaag caaccggatc gacctattca ggccgcagtt ggtcaggtca 16740ggctcagaac gaaaatgctc ggcgaggtta cgctgtctgt aaacccattc gatgaacggg 16800aagcttcctt ccgattgctc ttggcaggaa tattggccca tgcctgcttg cgctttgcaa 16860atgctcttat cgcgttggta tcatatgcct tgtccgccag cagaaacgca ctctaagcga 16920ttatttgtaa aaatgtttcg gtcatgcggc ggtcatgggc ttgacccgct gtcagcgcaa 16980gacggatcgg tcaaccgtcg gcatcgacaa cagcgtgaat cttggtggtc aaaccgccac 17040gggaacgtcc catacagcca tcgtcttgat cccgctgttt cccgtcgccg catgttggtg 17100gacgcggaca caggaactgt caatcatgac gacattctat cgaaagcctt ggaaatcaca 17160ctcagaatat gatcccagac gtctgcctca cgccatcgta caaagcgatt gtagcaggtt 17220gtacaggaac cgtatcgatc aggaacgtct gcccagggcg ggcccgtccg gaagcgccac 17280aagatgacat tgatcacccg cgtcaacgcg cggcacgcga cgcggcttat ttgggaacaa 17340aggactgaac aacagtccat tcgaaatcgg tgacatcaaa gcggggacgg gttatcagtg 17400gcctccaagt caagcctcaa tgaatcaaaa tcagaccgat ttgcaaacct gatttatgag 17460tgtgcggcct aaatgatgaa atcgtccttc tagatcgcct ccgtggtgta gcaacacctc 17520gcagtatcgc cgtgctgacc ttggccaggg aattgactgg caagggtgct ttcacatgac 17580cgctcttttg gccgcgatag atgatttcgt tgctgctttg ggcacgtaga aggagagaag 17640tcatatcgga gaaattcctc ctggcgcgag agcctgctct atcgcgacgg catcccactg 17700tcgggaacag accggatcat tcacgaggcg aaagtcgtca acacatgcgt tataggcatc 17760ttcccttgaa ggatgatctt gttgctgcca atctggaggt gcggcagccg caggcagatg 17820cgatctcagc gcaacttgcg gcaaaacatc tcactcacct gaaaaccact agcgagtctc 17880gcgatcagac gaaggccttt tacttaacga cacaatatcc gatgtctgca tcacaggcgt 17940cgctatccca gtcaatacta aagcggtgca ggaactaaag attactgatg acttaggcgt 18000gccacgaggc ctgagacgac gcgcgtagac agttttttga aatcattatc aaagtgatgg 18060cctccgctga agcctatcac ctctgcgccg gtctgtcgga gagatgggca agcattatta 18120cggtcttcgc gcccgtacat gcattggacg attgcagggt caatggatct gagatcatcc 18180agaggattgc cgcccttacc ttccgtttcg agttggagcc agcccctaaa tgagacgaca 18240tagtcgactt gatgtgacaa tgccaagaga gagatttgct taacccgatt tttttgctca 18300agcgtaagcc tattgaagct tgccggcatg acgtccgcgc cgaaagaata tcctacaagt 18360aaaacattct gcacaccgaa atgcttggtg tagacatcga ttatgtgacc aagatcctta 18420gcagtttcgc ttggggaccg ctccgaccag aaataccgaa gtgaactgac gccaatgaca 18480ggaatccctt ccgtctgcag ataggtaccg gctggctagc gaattgacat gaggttgccc 18540cgtattcagt gtcgctgatt tgtattgtct gaagttgttt ttacgttaag ttgatgcaga 18600tcaattaata cgatacctgc gtcataattg attatttgac gtggtttgat ggcctccacg 18660cacgttgtga tatgtagatg ataatcatta tcactttacg ggtcctttcc ggtgatccga 18720caggttacgg ggcggcgacc tcgcgggttt tcgctattta tgaaaatttt ccggtttaag 18780gcgtttccgt tcttcttcgt cataacttaa tgtttttatt taaaataccc tctgaaaaga 18840aaggaaacga caggtgctga aagcgagctt tttggcctct gtcgtttcct ttctctgttt 18900ttgtccgtgg aatgaacaat ggaaggatct tctcggcggc gatcacgacg ccggccctgc 18960ggagccttcg ccgcgtgcgc gattcatggc ggccgtggag gccaaggatt tcgcgcgagt 19020gcaagagctg atcgaggcgc gtggagccaa gtcggcggct gattatgtcc ttgcgcagct 19080cgccgtggcc gaaggtctgg accgcaagcc tggtgcgcgc gtcgtggtcg ggaaagcggc 19140gggcagcatg gcaatgccgc ctgcggcgct gggttttacg ccaaggggag aagcggcata 19200cgccatcgag cggtcagcct atggtgagcc gaggtccagc attgcgaagc agtaccagca 19260ggaatggaac cggaaggcgg cgacctggtg ggcgatggcc ggtgtggccg gcatcatcgg 19320cgcgatcctg gcggcggcgg caaccggctt tgttgggctg gcagtgtcga tccgcaaccg 19380agtgaagcgc gtgcgcgacc tgttggtgat ggagccgggt gcagagccat aagcggcaag 19440agacgaaagc ccggtttccg ggcttttgtt ttgttacgcc aaggacgagt tttagcggct 19500aaaggtgttg acgtgcgaga aatgtttagc taaacttctc tcatgtgctg gcggctgtca 19560ccgctatgtt caaccaaggc gcggagcaaa ttatgggtgt tatccatgaa gaaacggctt 19620accgaaagcc agttccagga ggcgatccag gggctggaag tggggcagca gaccatcgag 19680atagcgcggg gcgtcttagt cgatgggaag ccacaggcga cgttcgcaac gtcgctggga 19740ctgaccaggg gcgcagtgtc gcaagcggtg catcgcgtgt gggccgcgtt cgaggacaag 19800aacttgcccg aggggtacgc gcgggtaacg gcggttctgc cggaacatca ggcgtacatc 19860gtccggaagt gggaagcgga cgccaagaaa aaacaggaaa ccaaacgatg aaaactttgg 19920tcacggccaa ccagaaaggc ggcgtcggca agacttcgac ccttgtgcat cttgccttcg 19980actttttcga gcgcggcttg cgggttgccg tgatcgacct ggacccccag ggcaatgcgt 20040cctacacgct caaggacttt gctaccggcc tgcatgcaag caagctgttc ggcgctgtcc 20100ctgccggcgg ctggaccgaa accgcacccg cagccggcga cggccaggcc gcgcgcctcg 20160ccctcatcga gtccaacccg gtactggcga acgccgaacg gctgtcgctg gacgacgccc 20220gcgagctgtt cggggcgaac atcaaggccc tggcgaacca aggcttcgac gtgtgcctga 20280tcgacacggc cccgaccctt ggcgtcggcc tggcggccgc cctcttcgcg gccgactatg 20340tgctgtcccc catcgagctt gaggcgtaca gcatccaggg catcaagaag atggtcacga 20400ccattgcgaa cgtgcgccag aagaacgcca agctgcaatt ccttggcatg gtgcccagca 20460aggtcgatgc gcggaatccg cgccacgcgc gccaccaagc cgagctgctg gccgcgtacc 20520ccaagatgat gattccggcc accgttggcc tgcgcagcag catcgccgat gccctcgcat 20580ccggtgtgcc ggtctggaag atcaagaaaa cggccgcgcg caaggcatcg aaagaggttc 20640gcgccctggc tgattacgtg ttcacgaaga tggagatttc ccaatgactg cggctcaagc 20700caagaccacc aagaaaaaca ccgctgcggc cgctcaggaa gccgcaggcg cggcgcagcc 20760gtccggcctg gggttggata gcatcggcga cctgtcgagc ctcctggacg ctcctgcggc 20820gtctcagggc ggttccggcc ctatcgagct ggacctggac ctgatcgacg aagatccgca 20880tcagccgcgg acggccgaca accccggctt ttccccggag agcatcgcgg aaatcggtgc 20940cacgatcaaa gagcgcgggg tgaagtcacc catttcggtg cgcgagaacc aggagcagcc 21000gggccgctat atcatcaatc acggcgcccg ccgctaccgt ggctcgaatc tagtgatatt 21060ccacaaaaca gcagggaagc agcgcttttc cgctgcataa ccctgcttcg gggtcattat 21120agcgattttt tcggtatatc catccttttt cgcacgatat acaggatttt gccaaagggt 21180tcgtgtagac tttccttggt gtatccaacg gcgtcagccg ggcaggatag gtgaagtagg 21240cccacccgcg agcgggtgtt ccttcttcac tgtcccttat tcgcacctgg cggtgctcaa 21300cgggaatcct gctctgcgag gctggccggc taccgccggc gtaacagatg agggcaagcg 21360gatggctgat gaaaccaagc caaccaggaa gggcagccca cctatcaagg tgtactgcct 21420tccagacgaa cgaagagcga ttgaggaaaa ggcggcggcg gccggcatga gcctgtcggc 21480ctacctgctg gccgtcggcc agggctacaa aatcacgggc gtcgtggact atgagcacgt 21540ccgcgagctg gcccgcatca atggcgacct gggccgcctg ggcggcctgc tgaaactctg 21600gctcaccgac gacccgcgca cggcgcggtt cggtgatgcc acgatcctcg ccctgctggc 21660gaagatcgaa gagaagcagg acgagcttgg caaggtcatg atgggcgtgg tccgcccgag 21720ggcagagcca tgactttttt agccgctaaa acggccgggg ggtgcgcgtg attgccaagc 21780acgtccccat gcgctccatc aagaagagcg acttcgcgga gctggtgaag tacatcaccg 21840acgagcaagg caagaccgag cgccagatcc aaaacaactg tcaaagcgca cccgcccgat 21900gccattcgcg gcacggcttc cgttgaggat gtcgatatga tgcgcgagcc gacggcccgc 21960agagaagggg ccgttttagc ggctaaagaa ggaagtgcaa gccctaaccc ttggcgtcag 22020agccttccac gcagcttttt tcgggtgtcg tcgccccatt tctttacgat aaacgcctta 22080tgtgacggca aaaccacact gatgcgttcg tatccgggcg gcacgctgct cttgaaagga 22140tgacccgcaa tctccgcgag tgcctcgcgg tcaaggtcgg tggactccag gagaagaggt 22200aggggagttt ccagggcgtc ggcaatggcc tccatcacct tcaacgaggg gttggcctta 22260ccgttggtta agtctgataa aaacgaaatt gaaacccctg ccctctccga cagctcatgt 22320ttcgtcatgc cccgctcatc gagcagacga aggatgttgg tgaaaaatat ctggttgtac 22380acagcggaag ccgcccctcg cacctttggt cgcggcccgc aaaattttag ccgctaaagt 22440tcttgacagc ggaaccaatg tttagctaaa ctagagtctc ctttctcaag gagactttcg 22500atatgagcca taatcagttc cagtttatcg gtaatcttac ccgtgacacc gaggtacgtc 22560atggcaattc taacaagccg caagcaattt tcgatatagc ggttaatgaa gagtggcgca 22620acgatgccgg cgacaagcag gagcgcaccg acttcttccg catcaagtgt tttggctctc 22680aggccgaggc ccacggcaag tatttgggca aggggtcgct ggtattcgtg cagggcaaga 22740ttcggaatac caagtacgag aaggacggcc agacggtcta cgggaccgac ttcattgccg 22800ataaggtgga ttatctggac accaaggcac caggcgggtc aaatcaggaa taagggcaca 22860ttgccccggc gtgagtcggg gcaatcccgc aaggagggtg aatgaatcgg acgtttgacc 22920ggaaggcata caggcaagaa ctgatcgacg cggggttttc cgccgaggat gccgaaacca 22980tcgcaagccg caccgtcatg cgtgcgcccc gcgaaacctt ccagtccgtc ggctcgatgg 23040tccagcaagc tacggccaag atcgagcgcg acagcgtgca actggctccc cctgccctgc 23100ccgcgccatc ggccgccgtg gagcgttcgc gtcgtctcga acaggaggcg gcaggtttgg 23160cgaagtcgat gaccatcgac acgcgaggaa ctatgacgac caagaagcga aaaaccgccg 23220gcgaggacct ggcaaaacag gtcagcgagg ccaagcaggc cgcgttgctg aaacacacga 23280agcagcagat caaggaaatg cagctttcct tgttcgatat tgcgccgtgg ccggacacga 23340tgcgagcgat gccaaacgac acggcccgct ctgccctgtt caccacgcgc aacaagaaaa 23400tcccgcgcga ggcgctgcaa aacaaggtca ttttccacgt caacaaggac gtgaagatca 23460cctacaccgg cgtcgagctg cgggccgacg atgacgaact ggtgtggcag caggtgttgg 23520agtacgcgaa gcgcacccct atcggcgagc cgatcacctt cacgttctac gagctttgcc 23580aggacctggg ctggtcgatc aatggccggt attacacgaa ggccgaggaa tgcctgtcgc 23640gcctacaggc gacggcgatg ggcttcacgt ccgaccgcgt tgggcacctg gaatcggtgt 23700cgctgctgca ccgcttccgc gtcctggacc gtggcaagaa aacgtcccgt tgccaggtcc 23760tgatcgacga ggaaatcgtc gtgctgtttg ctggcgacca ctacacgaaa ttcatatggg 23820agaagtaccg caagctgtcg ccgacggccc gacggatgtt cgactatttc agctcgcacc 23880gggagccgta cccgctcaag ctggaaacct tccgcctcat gtgcggatcg gattccaccc 23940gcgtgaagaa gtggcgcgag caggtcggcg aagcctgcga agagttgcga ggcagcggcc 24000tggtggaaca cgcctgggtc aatgatgacc tggtgcattg caaacgctag ggccttgtgg 24060ggtcagttcc ggctgggggt tcagcagcca gcgctttact ggcatttcag gaacaagcgg 24120gcactgctcg acgcacttgc ttcgctcagt atcgctcggg acgcacggcg cgctctacga 24180actgccgata aacagaggat taaaattgac aattgtgatt aaggctcaga ttcgacggct 24240tggagcggcc gacgtgcagg atttccgcga gatccgattg tcggccctga agaaagctcc 24300agagatgttc gggtccgttt acgagcacga ggagaaaaag cccatggagg cgttcgctga 24360acggttgcga gatgccgtgg cattcggcgc ctacatcgac ggcgagatca ttgggctgtc 24420ggtcttcaaa caggaggacg gccccaagga cgctcacaag gcgcatctgt ccggcgtttt 24480cgtggagccc gaacagcgag gccgaggggt cgccggtatg ctgctgcggg cgttgccggc 24540gggtttattg ctcgtgatga tcgtccgaca gattccaacg ggaatctggt ggatgcgcat 24600cttcatcctc ggcgcactta atatttcgct attctggagc ttgttgttta tttcggtcta 24660ccgcctgccg ggcgggtcgc ggcgacggta ggcgctgtgc agccgctgat ggtcgtgttc 24720atctctgccg ctctgctagg tagcccgata cgattgatgg cggtcctggg ggctatttgc 24780ggaactgcgg gcgtggcgct gttggtgttg acaccaaacg cagcgctaga tcctgtcggc 24840gtcgcagcgg gcctggcggg ggcggtttcc atggcgttcg gaaccgtgct gacccgcaag 24900tggcaacctc ccgtgcctct gctcaccttt accgcctggc aactggcggc cggaggactt 24960ctgctcgttc cagtagcttt agtgtttgat ccgccaatcc cgatgcctac aggaaccaat 25020gttctcggct gctcgactgc acgaatacca gcgacccctt gcccaaatac ttgccgtggg 25080cctcggcctg agagccaaaa cacttgatgc ggaagaagtc ggtgcgctcc tgcttgtcgc 25140cggcatcgtt gcgccacatc taggtactaa aacaattcat ccagtaaaat ataatatttt 25200attttctccc aatcaggctt gatccccagt aagtcaaaaa atagctcgac atactgttct 25260tccccgatat cctccctgat cgaccggacg cagaaggcaa tgtcatacca cttgtccgcc 25320ctgccgcttc tcccaagatc aataaagcca cttactttgc catctttcac aaagatgttg 25380ctgtctccca ggtcgccgtg ggaaaagaca agttcctctt cgggcttttc cgtctttaaa 25440aaatcataca gctcgcgcgg atctttaaat ggagtgtctt cttcccagtt ttcgcaatcc 25500acatcggcca gatcgttatt cagtaagtaa tccaattcgg ctaagcggct gtctaagcta 25560ttcgtatagg gacaatccga tatgtcgatg gagtgaaaga gcctgatgca ctccgcatac 25620agctcgataa tcttttcagg gctttgttca tcttcatact cttccgagca aaggacgcca 25680tcggcctcac tcatgagcag attgctccag ccatcatgcc gttcaaagtg caggaccttt 25740ggaacaggca gctttccttc cagccatagc atcatgtcct tttcccgttc cacatcatag 25800gtggtccctt tataccggct gtccgtcatt tttaaatata ggttttcatt ttctcccacc 25860agcttatata ccttagcagg agacattcct tccgtatctt ttacgcagcg gtatttttcg 25920atcagttttt tcaattccgg tgatattctc attttagcca tttattattt ccttcctctt 25980ttctacagta tttaaagata ccccaagaag ctaattataa caagacgaac tccaattcac 26040tgttccttgc attctaaaac cttaaatacc agaaaacagc tttttcaaag ttgttttcaa 26100agttggcgta taacatagta tcgattcgat agcgtggact caaggctctc gcgaatggct 26160cgcgttggaa actttcattg acacttgagg ggcaccgcag ggaaattctc gtccttgcga 26220gaaccggcta tgtcgtgctg cgcatcgagc ctgcgccctt ggcttgtctc gcccctctcc 26280gcgtcgctac ggggcttcca gcgcctttcc gacgctcacc gggctggttg ccctcgccgc 26340tgggctggcg gccgtctatg gccctgcaaa cgcgccagaa acgccgtcga agccgtgtgc 26400gagacaccgc ggccgccggc gttgtggata cctcgcggaa aacttggccc tcactgacag 26460atgaggggcg gacgttgaca cttgaggggc cgactcaccc ggcgcggcgt tgacagatga 26520ggggcaggct cgatttcggc cggcgacgtg gagctggcca gcctcgcaaa tcggcgaaaa 26580cgcctgattt tacgcgagtt tcccacagat gatgtggaca agcctgggga taagtgccct 26640gcggtattga cacttgaggg gcgcgactac tgacagatga ggggcgcgat ccttgacact 26700tgaggggcag agtgctgaca gatgaggggc gcacctattg acatttgagg ggctgtccac 26760aggcagaaaa tccagcattt gcaagggttt ccgcccgttt ttcggccacc gctaacctgt 26820cttttaacct gcttttaaac caatatttat aaaccttgtt tttaaccagg gctgcgccct 26880gtgcgcgtga ccgcgcacgc cgaagggggg tgccccccct tctcgaaccc tcccggcccg 26940ctaacgcggg cctcccatcc ccccaggggc tgcgcccctc ggccgcgaac ggcctcaccc 27000caaaaatggc agcgccagcc atttattatt gaagcattta tcagggttat tgtctcatga 27060gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc 27120cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa 27180ataggcgtat cacgaggccc tttcgtcttc aagaattggt cgacgatctt gctgcgttcg 27240gatattttcg tggagttccc gccacagacc cggattgaag gcgagatcca gcaactcgcg 27300ccagatcatc ctgtgacgga actttggcgc gtgatgactg gccaggacgt cggccgaaag 27360agcgacaagc agatcacgct tttcgacagc gtcggatttg cgatcgagga tttttcggcg 27420ctgcgctacg tccgcgaccg cgttgaggga tcaagccaca gcagcccact cgaccttcta 27480gccgacccag acgagccaag ggatcttttt ggaatgctgc tccgtcgtca ggctttccga 27540cgtttgggtg gttgaacaga agtcattatc gcacggaatg ccaagcactc ccgaggggaa 27600ccctgtggtt ggcatgcaca tacaaatgga cgaacggata aaccttttca cgccctttta 27660aatatccgat tattctaata aacgctcttt tctcttaggt ttacccgcca atatatcctg 27720tcaaacactg atagtttaaa ctgaaggcgg gaaacgacaa tctgatcatg agcggagaat 27780taagggagtc acgttatgac ccccgccgat gacgcgggac aagccgtttt acgtttggaa 27840ctgacagaac cgcaacgttg aaggagccac tcagc 27875714222DNAArtificialpLC40GWHvG1 7aagcttgcgg ccgcttcgaa gatgttaatt aacatcggta ccgagctcta gggataacag 60ggtaatagct cgaattctag cttgcatgcc tgcagtgcag cgtgacccgg tcgtgcccct 120ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 180tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 240gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 300cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 360ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 420catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 480tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 540tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 600taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 660gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 720cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 780ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 840gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 900cggcagctac gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt 960aataaataga caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca 1020cacacacaac cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg 1080ctcgtcctcc cccccccccc ctctctacct

tctctagatc ggcgttccgg tccatggtta 1140gggcccggta gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg 1200tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact 1260tgccagtgtt tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg 1320atttcatgat tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca 1380atatatgccg tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt 1440gatgatgtgg tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac 1500ctggtggatt tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa 1560ttgaagatga tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta 1620ctgatgcata tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg 1680cggtcgttca ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta 1740ttaattttgg aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat 1800ggaaatatcg atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat 1860gatggcatat gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa 1920acaagtatgt tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag 1980ctatatgtgg atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc 2040ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatca 2100tcacaagttt gtacaaaaaa gcaggctcaa tgagatatga aaaagcctga actcaccgcg 2160acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg tctccgacct gatgcagctc 2220tcggagggcg aagaatctcg tgctttcagc ttcgatgtag gagggcgtgg atatgtcctg 2280cgggtaaata gctgcgccga tggtttctac aaagatcgtt atgtttatcg gcactttgca 2340tcggccgcgc tcccgattcc ggaagtgctt gacattgggg aattcagcga gagcctgacc 2400tattgcatct cccgccgtgc acagggtgtc acgttgcaag acctgcctga aaccgaactg 2460cccgctgttc tgcagccggt cgcggaggcc atggatgcga tcgctgcggc cgatcttagc 2520cagacgagcg ggttcggccc attcggaccg caaggaatcg gtcaatacac tacatggcgt 2580gatttcatat gcgcgattgc tgatccccat gtgtatcact ggcaaactgt gatggacgac 2640accgtcagtg cgtccgtcgc gcaggctctc gatgagctga tgctttgggc cgaggactgc 2700cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca acaatgtcct gacggacaat 2760ggccgcataa cagcggtcat tgactggagc gaggcgatgt tcggggattc ccaatacgag 2820gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta tggagcagca gacgcgctac 2880ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc tccgggcgta tatgctccgc 2940attggtcttg accaactcta tcagagcttg gttgacggca atttcgatga tgcagcttgg 3000gcgcagggtc gatgcgacgc aatcgtccga tccggagccg ggactgtcgg gcgtacacaa 3060atcgcccgca gaagcgcggc cgtctggacc gatggctgtg tagaagtact cgccgatagt 3120ggaaaccgac gccccagcac tcgtccgagg gcaaaggaat agacccagct ttcttgtaca 3180aagtggtgat gatccgtcga cctgcagatc gttcaaacat ttggcaataa agtttcttaa 3240gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg aattacgtta 3300agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt tttatgatta 3360gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc gcaaactagg 3420ataaattatc gcgcgcggtg tcatctatgt tactagatcc gatgataagc tgtcaaacat 3480gagaattcag tacattaaaa acgtccgcaa tgtgttatta agttgtctaa gcgtcaattt 3540gtttacacca caatatatcc tgccaccagc cagccaacag ctccccgacc ggcagctcgg 3600cacaaaatca ccactcgata caggcagccc atcagtccgg gacggcgtca gcgggagagc 3660cgttgtaagg cggcagactt tgctcatgtt accgatgcta ttcggaagaa cggcaactaa 3720gctgccgggt ttgaaacacg gatgatctcg cggagggtag catgttgatt gtaacgatga 3780cagagcgttg ctgcctgtga tcaaatatca tctccctcgc agagatccga attatcagcc 3840ttcttattca tttctcgctt aaccgtgaca ggctgtcgat cttgagaact atgccgacat 3900aataggaaat cgctggataa agccgctgag gaagctgagt ggcgctattt ctttagaagt 3960gaacgttgac gatcgtcgac cgtaccccga tgaattaatt cggacgtacg ttctgaacac 4020aggactagtg taacctcgaa gcgtttcact tgtaacaacg attgagaact tttgtcataa 4080aattgaaata cttggttcgc attttcgtca tccgcggtca gccgcaattc tgacgaactg 4140cccatttagc tggagatgat tgtacatcct tcacgtgaaa atttctcaag cgctgtgaac 4200aagggttcag attttagatt gaaaggtgag ccgttgaaac acgttcttct tatcgatgac 4260gatgtcgcta tgcggcatct tattatcgaa taccttacga tccacgcctt caaagtgacc 4320gcggtagccg acagcaccca gttcactaga gtactctctt ccgcgacggt cgatgtcgtg 4380gttgttgatc taaatttagg tcgtgaagat gggcttgaga tcgttcgaaa tctggcggca 4440aagtctgata ttccaatcat aattatcagt ggcgaccgcc ttgaggagac ggataaagtt 4500gttgcactcg agctaggagc aagtgatttt atcgctaagc cgtttagtac gagagagttt 4560cttgcacgca ttcgggttgc cttgcgcgtg cgccccaacg ttgtccgctc caaagaccga 4620cggtcttttt gttttactga ctggacactt aatctcaggc aacgtcgctt gatgtccgaa 4680gctggcggtg aggtgaaact tacggcaggt gagttcaatc ttctcctcgc gtttttagag 4740aaaccccgcg acgttctatc gcgcgagcaa cttctcattg ccagtcgagt acgcgacgag 4800gaggtttacg acaggagtat agatgttctc attttgcggc tgcgccgcaa acttgaggcg 4860gatccgtcaa gccctcaact gataaaaaca gcaagaggtg ccggttattt ctttgacgcg 4920gacgtgcagg tttcgcacgg ggggacgatg gcagcctgag ccaattgcat ttggctctta 4980attatctggc tcaaaaggtg actgaggacg cggccagcgg cctcaaacct acactcaata 5040tttggtgagg ggttccgata ggtactagtc ctggatactt acttgggcga ttgtcataca 5100tgacatcaac aatgtacccg tttgtgtaac cgtctcttgg aggttcgtat gacactaggt 5160cgctacctta ggaccgttat agttactagc gaattgacat gaggttgccc cgtattcagt 5220gtcgctgatt tgtattgtct gaagttgttt ttacgttaag ttgatgcaga tcaattaata 5280cgatacctgc gtcataattg attatttgac gtggtttgat ggcctccacg cacgttgtga 5340tatgtagatg ataatcatta tcactttacg ggtcctttcc ggtgatccga caggttacgg 5400ggcggcgacc tcgcgggttt tcgctattta tgaaaatttt ccggtttaag gcgtttccgt 5460tcttcttcgt cataacttaa tgtttttatt taaaataccc tctgaaaaga aaggaaacga 5520caggtgctga aagcgagctt tttggcctct gtcgtttcct ttctctgttt ttgtccgtgg 5580aatgaacaat ggaaggatct tctcggcggc gatcacgacg ccggccctgc ggagccttcg 5640ccgcgtgcgc gattcatggc ggccgtggag gccaaggatt tcgcgcgagt gcaagagctg 5700atcgaggcgc gtggagccaa gtcggcggct gattatgtcc ttgcgcagct cgccgtggcc 5760gaaggtctgg accgcaagcc tggtgcgcgc gtcgtggtcg ggaaagcggc gggcagcatg 5820gcaatgccgc ctgcggcgct gggttttacg ccaaggggag aagcggcata cgccatcgag 5880cggtcagcct atggtgagcc gaggtccagc attgcgaagc agtaccagca ggaatggaac 5940cggaaggcgg cgacctggtg ggcgatggcc ggtgtggccg gcatcatcgg cgcgatcctg 6000gcggcggcgg caaccggctt tgttgggctg gcagtgtcga tccgcaaccg agtgaagcgc 6060gtgcgcgacc tgttggtgat ggagccgggt gcagagccat aagcggcaag agacgaaagc 6120ccggtttccg ggcttttgtt ttgttacgcc aaggacgagt tttagcggct aaaggtgttg 6180acgtgcgaga aatgtttagc taaacttctc tcatgtgctg gcggctgtca ccgctatgtt 6240caaccaaggc gcggagcaaa ttatgggtgt tatccatgaa gaaacggctt accgaaagcc 6300agttccagga ggcgatccag gggctggaag tggggcagca gaccatcgag atagcgcggg 6360gcgtcttagt cgatgggaag ccacaggcga cgttcgcaac gtcgctggga ctgaccaggg 6420gcgcagtgtc gcaagcggtg catcgcgtgt gggccgcgtt cgaggacaag aacttgcccg 6480aggggtacgc gcgggtaacg gcggttctgc cggaacatca ggcgtacatc gtccggaagt 6540gggaagcgga cgccaagaaa aaacaggaaa ccaaacgatg aaaactttgg tcacggccaa 6600ccagaaaggc ggcgtcggca agacttcgac ccttgtgcat cttgccttcg actttttcga 6660gcgcggcttg cgggttgccg tgatcgacct ggacccccag ggcaatgcgt cctacacgct 6720caaggacttt gctaccggcc tgcatgcaag caagctgttc ggcgctgtcc ctgccggcgg 6780ctggaccgaa accgcacccg cagccggcga cggccaggcc gcgcgcctcg ccctcatcga 6840gtccaacccg gtactggcga acgccgaacg gctgtcgctg gacgacgccc gcgagctgtt 6900cggggcgaac atcaaggccc tggcgaacca aggcttcgac gtgtgcctga tcgacacggc 6960cccgaccctt ggcgtcggcc tggcggccgc cctcttcgcg gccgactatg tgctgtcccc 7020catcgagctt gaggcgtaca gcatccaggg catcaagaag atggtcacga ccattgcgaa 7080cgtgcgccag aagaacgcca agctgcaatt ccttggcatg gtgcccagca aggtcgatgc 7140gcggaatccg cgccacgcgc gccaccaagc cgagctgctg gccgcgtacc ccaagatgat 7200gattccggcc accgttggcc tgcgcagcag catcgccgat gccctcgcat ccggtgtgcc 7260ggtctggaag atcaagaaaa cggccgcgcg caaggcatcg aaagaggttc gcgccctggc 7320tgattacgtg ttcacgaaga tggagatttc ccaatgactg cggctcaagc caagaccacc 7380aagaaaaaca ccgctgcggc cgctcaggaa gccgcaggcg cggcgcagcc gtccggcctg 7440gggttggata gcatcggcga cctgtcgagc ctcctggacg ctcctgcggc gtctcagggc 7500ggttccggcc ctatcgagct ggacctggac ctgatcgacg aagatccgca tcagccgcgg 7560acggccgaca accccggctt ttccccggag agcatcgcgg aaatcggtgc cacgatcaaa 7620gagcgcgggg tgaagtcacc catttcggtg cgcgagaacc aggagcagcc gggccgctat 7680atcatcaatc acggcgcccg ccgctaccgt ggctcgaatc tagtgatatt ccacaaaaca 7740gcagggaagc agcgcttttc cgctgcataa ccctgcttcg gggtcattat agcgattttt 7800tcggtatatc catccttttt cgcacgatat acaggatttt gccaaagggt tcgtgtagac 7860tttccttggt gtatccaacg gcgtcagccg ggcaggatag gtgaagtagg cccacccgcg 7920agcgggtgtt ccttcttcac tgtcccttat tcgcacctgg cggtgctcaa cgggaatcct 7980gctctgcgag gctggccggc taccgccggc gtaacagatg agggcaagcg gatggctgat 8040gaaaccaagc caaccaggaa gggcagccca cctatcaagg tgtactgcct tccagacgaa 8100cgaagagcga ttgaggaaaa ggcggcggcg gccggcatga gcctgtcggc ctacctgctg 8160gccgtcggcc agggctacaa aatcacgggc gtcgtggact atgagcacgt ccgcgagctg 8220gcccgcatca atggcgacct gggccgcctg ggcggcctgc tgaaactctg gctcaccgac 8280gacccgcgca cggcgcggtt cggtgatgcc acgatcctcg ccctgctggc gaagatcgaa 8340gagaagcagg acgagcttgg caaggtcatg atgggcgtgg tccgcccgag ggcagagcca 8400tgactttttt agccgctaaa acggccgggg ggtgcgcgtg attgccaagc acgtccccat 8460gcgctccatc aagaagagcg acttcgcgga gctggtgaag tacatcaccg acgagcaagg 8520caagaccgag cgccagatcc aaaacaactg tcaaagcgca cccgcccgat gccattcgcg 8580gcacggcttc cgttgaggat gtcgatatga tgcgcgagcc gacggcccgc agagaagggg 8640ccgttttagc ggctaaagaa ggaagtgcaa gccctaaccc ttggcgtcag agccttccac 8700gcagcttttt tcgggtgtcg tcgccccatt tctttacgat aaacgcctta tgtgacggca 8760aaaccacact gatgcgttcg tatccgggcg gcacgctgct cttgaaagga tgacccgcaa 8820tctccgcgag tgcctcgcgg tcaaggtcgg tggactccag gagaagaggt aggggagttt 8880ccagggcgtc ggcaatggcc tccatcacct tcaacgaggg gttggcctta ccgttggtta 8940agtctgataa aaacgaaatt gaaacccctg ccctctccga cagctcatgt ttcgtcatgc 9000cccgctcatc gagcagacga aggatgttgg tgaaaaatat ctggttgtac acagcggaag 9060ccgcccctcg cacctttggt cgcggcccgc aaaattttag ccgctaaagt tcttgacagc 9120ggaaccaatg tttagctaaa ctagagtctc ctttctcaag gagactttcg atatgagcca 9180taatcagttc cagtttatcg gtaatcttac ccgtgacacc gaggtacgtc atggcaattc 9240taacaagccg caagcaattt tcgatatagc ggttaatgaa gagtggcgca acgatgccgg 9300cgacaagcag gagcgcaccg acttcttccg catcaagtgt tttggctctc aggccgaggc 9360ccacggcaag tatttgggca aggggtcgct ggtattcgtg cagggcaaga ttcggaatac 9420caagtacgag aaggacggcc agacggtcta cgggaccgac ttcattgccg ataaggtgga 9480ttatctggac accaaggcac caggcgggtc aaatcaggaa taagggcaca ttgccccggc 9540gtgagtcggg gcaatcccgc aaggagggtg aatgaatcgg acgtttgacc ggaaggcata 9600caggcaagaa ctgatcgacg cggggttttc cgccgaggat gccgaaacca tcgcaagccg 9660caccgtcatg cgtgcgcccc gcgaaacctt ccagtccgtc ggctcgatgg tccagcaagc 9720tacggccaag atcgagcgcg acagcgtgca actggctccc cctgccctgc ccgcgccatc 9780ggccgccgtg gagcgttcgc gtcgtctcga acaggaggcg gcaggtttgg cgaagtcgat 9840gaccatcgac acgcgaggaa ctatgacgac caagaagcga aaaaccgccg gcgaggacct 9900ggcaaaacag gtcagcgagg ccaagcaggc cgcgttgctg aaacacacga agcagcagat 9960caaggaaatg cagctttcct tgttcgatat tgcgccgtgg ccggacacga tgcgagcgat 10020gccaaacgac acggcccgct ctgccctgtt caccacgcgc aacaagaaaa tcccgcgcga 10080ggcgctgcaa aacaaggtca ttttccacgt caacaaggac gtgaagatca cctacaccgg 10140cgtcgagctg cgggccgacg atgacgaact ggtgtggcag caggtgttgg agtacgcgaa 10200gcgcacccct atcggcgagc cgatcacctt cacgttctac gagctttgcc aggacctggg 10260ctggtcgatc aatggccggt attacacgaa ggccgaggaa tgcctgtcgc gcctacaggc 10320gacggcgatg ggcttcacgt ccgaccgcgt tgggcacctg gaatcggtgt cgctgctgca 10380ccgcttccgc gtcctggacc gtggcaagaa aacgtcccgt tgccaggtcc tgatcgacga 10440ggaaatcgtc gtgctgtttg ctggcgacca ctacacgaaa ttcatatggg agaagtaccg 10500caagctgtcg ccgacggccc gacggatgtt cgactatttc agctcgcacc gggagccgta 10560cccgctcaag ctggaaacct tccgcctcat gtgcggatcg gattccaccc gcgtgaagaa 10620gtggcgcgag caggtcggcg aagcctgcga agagttgcga ggcagcggcc tggtggaaca 10680cgcctgggtc aatgatgacc tggtgcattg caaacgctag ggccttgtgg ggtcagttcc 10740ggctgggggt tcagcagcca gcgctttact ggcatttcag gaacaagcgg gcactgctcg 10800acgcacttgc ttcgctcagt atcgctcggg acgcacggcg cgctctacga actgccgata 10860aacagaggat taaaattgac aattgtgatt aaggctcaga ttcgacggct tggagcggcc 10920gacgtgcagg atttccgcga gatccgattg tcggccctga agaaagctcc agagatgttc 10980gggtccgttt acgagcacga ggagaaaaag cccatggagg cgttcgctga acggttgcga 11040gatgccgtgg cattcggcgc ctacatcgac ggcgagatca ttgggctgtc ggtcttcaaa 11100caggaggacg gccccaagga cgctcacaag gcgcatctgt ccggcgtttt cgtggagccc 11160gaacagcgag gccgaggggt cgccggtatg ctgctgcggg cgttgccggc gggtttattg 11220ctcgtgatga tcgtccgaca gattccaacg ggaatctggt ggatgcgcat cttcatcctc 11280ggcgcactta atatttcgct attctggagc ttgttgttta tttcggtcta ccgcctgccg 11340ggcgggtcgc ggcgacggta ggcgctgtgc agccgctgat ggtcgtgttc atctctgccg 11400ctctgctagg tagcccgata cgattgatgg cggtcctggg ggctatttgc ggaactgcgg 11460gcgtggcgct gttggtgttg acaccaaacg cagcgctaga tcctgtcggc gtcgcagcgg 11520gcctggcggg ggcggtttcc atggcgttcg gaaccgtgct gacccgcaag tggcaacctc 11580ccgtgcctct gctcaccttt accgcctggc aactggcggc cggaggactt ctgctcgttc 11640cagtagcttt agtgtttgat ccgccaatcc cgatgcctac aggaaccaat gttctcggct 11700gctcgactgc acgaatacca gcgacccctt gcccaaatac ttgccgtggg cctcggcctg 11760agagccaaaa cacttgatgc ggaagaagtc ggtgcgctcc tgcttgtcgc cggcatcgtt 11820gcgccacatc taggtactaa aacaattcat ccagtaaaat ataatatttt attttctccc 11880aatcaggctt gatccccagt aagtcaaaaa atagctcgac atactgttct tccccgatat 11940cctccctgat cgaccggacg cagaaggcaa tgtcatacca cttgtccgcc ctgccgcttc 12000tcccaagatc aataaagcca cttactttgc catctttcac aaagatgttg ctgtctccca 12060ggtcgccgtg ggaaaagaca agttcctctt cgggcttttc cgtctttaaa aaatcataca 12120gctcgcgcgg atctttaaat ggagtgtctt cttcccagtt ttcgcaatcc acatcggcca 12180gatcgttatt cagtaagtaa tccaattcgg ctaagcggct gtctaagcta ttcgtatagg 12240gacaatccga tatgtcgatg gagtgaaaga gcctgatgca ctccgcatac agctcgataa 12300tcttttcagg gctttgttca tcttcatact cttccgagca aaggacgcca tcggcctcac 12360tcatgagcag attgctccag ccatcatgcc gttcaaagtg caggaccttt ggaacaggca 12420gctttccttc cagccatagc atcatgtcct tttcccgttc cacatcatag gtggtccctt 12480tataccggct gtccgtcatt tttaaatata ggttttcatt ttctcccacc agcttatata 12540ccttagcagg agacattcct tccgtatctt ttacgcagcg gtatttttcg atcagttttt 12600tcaattccgg tgatattctc attttagcca tttattattt ccttcctctt ttctacagta 12660tttaaagata ccccaagaag ctaattataa caagacgaac tccaattcac tgttccttgc 12720attctaaaac cttaaatacc agaaaacagc tttttcaaag ttgttttcaa agttggcgta 12780taacatagta tcgattcgat agcgtggact caaggctctc gcgaatggct cgcgttggaa 12840actttcattg acacttgagg ggcaccgcag ggaaattctc gtccttgcga gaaccggcta 12900tgtcgtgctg cgcatcgagc ctgcgccctt ggcttgtctc gcccctctcc gcgtcgctac 12960ggggcttcca gcgcctttcc gacgctcacc gggctggttg ccctcgccgc tgggctggcg 13020gccgtctatg gccctgcaaa cgcgccagaa acgccgtcga agccgtgtgc gagacaccgc 13080ggccgccggc gttgtggata cctcgcggaa aacttggccc tcactgacag atgaggggcg 13140gacgttgaca cttgaggggc cgactcaccc ggcgcggcgt tgacagatga ggggcaggct 13200cgatttcggc cggcgacgtg gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt 13260tacgcgagtt tcccacagat gatgtggaca agcctgggga taagtgccct gcggtattga 13320cacttgaggg gcgcgactac tgacagatga ggggcgcgat ccttgacact tgaggggcag 13380agtgctgaca gatgaggggc gcacctattg acatttgagg ggctgtccac aggcagaaaa 13440tccagcattt gcaagggttt ccgcccgttt ttcggccacc gctaacctgt cttttaacct 13500gcttttaaac caatatttat aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga 13560ccgcgcacgc cgaagggggg tgccccccct tctcgaaccc tcccggcccg ctaacgcggg 13620cctcccatcc ccccaggggc tgcgcccctc ggccgcgaac ggcctcaccc caaaaatggc 13680agcgccagcc aggacgtcgg ccgaaagagc gacaagcaga tcacgctttt cgacagcgtc 13740ggatttgcga tcgaggattt ttcggcgctg cgctacgtcc gcgaccgcgt tgagggatca 13800agccacagca gcccactcga ccttctagcc gacccagacg agccaaggga tctttttgga 13860atgctgctcc gtcgtcaggc tttccgacgt ttgggtggtt gaacagaagt cattatcgca 13920cggaatgcca agcactcccg aggggaaccc tgtggttggc atgcacatac aaatggacga 13980acggataaac cttttcacgc ccttttaaat atccgattat tctaataaac gctcttttct 14040cttaggttta cccgccaata tatcctgtca aacactgata gtttaaactg aaggcgggaa 14100acgacaatct gatcatgagc ggagaattaa gggagtcacg ttatgacccc cgccgatgac 14160gcgggacaag ccgttttacg tttggaactg acagaaccgc aacgttgaag gagccactca 14220gc 1422284531DNAArtificialpVGW 8tcgaccatag gcgatctcct taatcaatag tagctgtaac ctcgaagcgt ttcacttgta 60acaacgattg agaacttttg tcataaaatt gaaatacttg gttcgcattt tcgtcatccg 120cggtcagccg caattctgac gaactgccca tttagctgga gatgattgta catccttcac 180gtgaaaattt ctcaagcgct gtgaacaagg gttcagattt tagattgaaa ggtgagccgt 240tgaaacacgt tcttcttatc gatgacgatg tcgctatgcg gcatcttatt atcgaatacc 300ttacgatcca cgccttcaaa gtgaccgcgg tagccgacag cacccagttc actagagtac 360tctcttccgc gacggtcgat gtcgtggttg ttgatctaga tttaggtcgt gaagatgggc 420ttgagatcgt tcgaaatctg gcggcaaagt ctgatattcc aatcataatt atcagtggcg 480accgccttga ggagacggat aaagttgttg cactcgagct aggagcaagt gattttatcg 540ctaagccgtt tagtacgaga gagtttcttg cacgcattcg ggttgccttg cgcgtgcgcc 600ccaacgttgt ccgctccaaa gaccgacggt ctttttgttt tactgactgg acacttaatc 660tcaggcaacg tcgcttgatg tccgaagctg gcggtgaggt gaaacttacg gcaggtgagt 720tcaatcttct cctcgcgttt ttagagaaac cccgcgacgt tctatcgcgc gagcaacttc 780tcattgccag tcgagtacgc gacgaggagg tttacgacag gagtatagat gttctcattt 840tgcggctgcg ccgcaaactt gaggcggatc cgtcaagccc tcaactgata aaaacagcaa 900gaggtgccgg ttatttcttt gacgcggacg tgcaggtttc gcacgggggg acgatggcag 960cctgagccaa ttgcatttgg ctcttaatta tctggctcaa aaggtgactg aggacgcggc 1020cagcggcctc aaacctacac tcaatatttg gtgaggggtt ccgataggtc cctcttcacc 1080tgcatggcat gtttaaccga atctgacgtt ttccctgcaa atgccaaaat actatgccta 1140tctccgggtt tcgcgtgacg gccaagaccc ggaaaaccaa aaatacggtt tgctcgaata 1200cgcgaacgcc aaaggcttcg cgccgctaca gatcgaggaa gaaattgcca gcagagcaaa 1260ggactggcgc aagcgcaagc tcggagcaat catcgaaaag gccgagcgtg gcgacgtgct 1320actgacgccg gagattacgc gcattgccgg ttccgccctc gccgccttgg aaattctcaa 1380agcggcgagc gagcgcggcc taatcgtcca tgtgaccaaa cagaagatca tcatggacgg 1440cagcctacaa agcgacatca tggcaaccgt gcttggcttg gctgcacaga tcgagcggca 1500tttcattcag gcacgtacca ccgaggcgct acaagtcgcc agagagcgcg gcaagacgct 1560cgggcgaccc aagggcagca aatcgagcgc cttgaagctg gacagccgta ttgatgaagt 1620acaggcatac gtgaaccttg gcttgccgca aagtcgcgca gccgagttgt taggcgtcag 1680ccctcacacc ttgcgcctgt tcatcaaacg ccggaacatc aaacccacaa acactagacc 1740aaccatcacc atgccgggga gggaacaaca tgcctaagaa caacaaagcc cccggccatc 1800gtatcaacga gatcatcaag acgagcctcg cgctcgaaat ggaggatgcc cgcgaagctg 1860gcttagtcgg ctacatggcc cgttgccttg tgcaagcgac catgccccac accgacccca

1920agaccagcta ctttgagcgc accaatggca tcgtcacctt gtcgatcatg ggcaagccga 1980gcatcggcct gccctacggt tctatgccgc gcaccttgct tgcttggata tgcaccgagg 2040ccgtgcgaac gaaagacccc gtgttgaacc ttggccggtc gcaatcggaa tttctacaaa 2100ggctcggaat gcacaccgat ggccgttaca cggccaccct tcgcaatcag gcgcaacgcc 2160tgttttcatc catgatttcg cttgccggcg agcaaggcaa tgacttcggc attgagaacg 2220tcgtcattgc caagcgcgct tttctattct ggaatcccaa gcggccagaa gatcgggcgc 2280tatgggatag caccctcacc ctcacaggcg atttcttcga ggaagtcacc cgctcaccgg 2340ttcctatccg aatcgactac ctgcatgcct tgcggcagtc tccgcttgcg atggacattt 2400acacgtggct gacctatcgc gtgttcctgt tgcgggccaa gggccgcccc ttcgtgcaaa 2460tcccttgggt cgccctgcaa gcgcaattcg gctcatccta tggcagccgc gcacgcaact 2520cgcccgaact ggacgataag gcccgagagc gggcagagcg ggcagcactc gccagcttca 2580aatacaactt caaaaagcgc ctacgcgaag tgttgattgt ctatcccgag gcaagcgact 2640gcatcgaaga tgacggcgaa tgcctgcgca tcaaatccac acgcctgcat gtcacccgcg 2700cacccggcaa gggcgctcgc atcggccccc ctccgacttg accaggccaa cgctacgctt 2760ggcttggtca agccttccca tccaacagcc cgccgtcgag cgggcttttt tatccccgga 2820agcctgtgga tagagggtag ttatccacgt gaaaccgcta atgccccgca aagccttgat 2880tcacggggct ttccggcccg ctccaaaaac tatccacgtg aaatcgctaa tcagggtacg 2940tgaaatcgct aatcggagta cgtgaaatcg ctaataaggt cacgtgaaat cgctaatcaa 3000aaaggcacgt gagaacgcta atagcccttt cagatcaaca gcttgcaaac acccctcgct 3060ccggcaagta gttacagcaa gtagtatgtt caattagctt ttcaattatg aatatatata 3120tcaattattg gtcgcccttg gcttgtggac aatgcgctac gcgcaccggc tccgcccgtg 3180gacaaccgca agcggttgcc caccgtcgag cgcctttgcc cacaacccgg cggccgcaac 3240agatcgtttt ataaattttt ttttttgaaa aagaaaaagc ccgaaaggcg gcaacctctc 3300gggcttctgg atttccgatc aacgcaggag tcgttcggaa agtagctgtt ccagaattat 3360aggcgcagag acaccagatt ccaagatggc tctgttaaat tgttgtagta tgtagtatca 3420tacaacatac tacagtacag aggcccgcaa gaatggcaat cactaaacaa gacatttggc 3480gagcagccga cgaactggac gccgaaggca tccggcccac tttggccgcc gtgcgcaaga 3540aactcggaag cggtagcttc acaaccattt ccgatgcaat ggctgaatgg aaaaaccgca 3600agaccgccac cctgccctca tcagacccat tgccggttgc agtcaacgag catcttgccg 3660agcttggcaa tgcgctatgg gctatcgccc tggcgcacgc caacgcccgg tttgacgaag 3720atcggaaaca gatcgaggcc gacaaagcgg ccatcagcca gcagcttgcc gaagcaatcg 3780aactagccga caccttcacc cgcgaaaacg accagctccg cgaacgagta gatccttcat 3840ggcttgttat gactgttttt ttgtacagtc tatgcctcgg gcatccaagc agcaagcgcg 3900ttacgccgtg ggtcgatgtt tgatgttatg gagcagcaac gatgttacgc agcagcaacg 3960atgttacgca gcagggcagt cgccctaaaa caaagttagg tggctcaagt atgggcatca 4020ttcgcacatg taggctcggc cctgaccaag tcaaatccat gcgggctgct cttgatcttt 4080tcggtcgtga gttcggagac gtagccacct actcccaaca tcagccggac tccgattacc 4140tcgggaactt gctccgtagt aagacattca tcgcgcttgc tgccttcgac caagaagcgg 4200ttgttggcgc tctcgcggct tacgttctgc ccaagtttga gcagccgcgt agtgagatct 4260atatctatga tctcgcagtc tccggcgagc accggaggca gggcattgcc accgcgctca 4320tcaatctcct caagcatgag gccaacgcgc ttggtgctta tgtgatctac gtgcaagcag 4380attacggtga cgatcccgca gtggctctct atacaaagtt gggcatacgg gaagaagtga 4440tgcactttga tatcgaccca agtaccgcca cctaacaatt cgttcaagcc gagatcggct 4500tcccggccgc ggagttgttc ggtaaattgt c 4531912DNAArtificialcos sequence 9aggtcgccgc cc 121010DNAArtificialPac linker 10gttaattaac 101124DNAArtificialprimer for amplification 11gttaatttct tgtgatcgaa ggac 241224DNAArtificialprimer for amplification 12gggattcttt atgctgggtt tagg 241324DNAArtificialprimer for amplification 13gcaagcaata cctctgttat gctg 241426DNAArtificialprimer for amplification 14gttttcagat ggcgacctca gctttg 261524DNAArtificialprimer for amplification 15caggtggctt tattcctcct ctca 241624DNAArtificialprimer for amplification 16ccgaaagttc gtgggcaatg ccta 241724DNAArtificialprimer for amplification 17gccatcctta gcatatgagt ggca 241824DNAArtificialprimer for amplification 18ggctatttac gtggcatgtt acgt 241924DNAArtificialprimer for amplification 19tcgtaagtct acttcccttt acga 242024DNAArtificialprimer for amplification 20ccaaaccaca tccttatagt gtgc 242122DNAArtificialprimer for amplification 21cctcattgca tgcggtcact ac 222224DNAArtificialprimer for amplification 22gcagggtatt aatcgatcaa cacc 242328DNAArtificialprimer for amplification 23agctttcgaa tagggataac agggtaat 282428DNAArtificialprimer for amplification 24agctattacc ctgttatccc tattcgaa 282531DNAArtificialprimer for amplification 25ctagtaacta taacggtcct aaggtagcga c 312631DNAArtificialprimer for amplification 26ctaggtcgct accttaggac cgttatagtt a 312749DNAArtificialprimer for amplification 27ggggacaagt ttgtacaaaa aagcaggctc aatgagatat gaaaaagcc 492852DNAArtificialprimer for amplification 28ggggaccact ttgtacaaga aagctgggtc tattcctttg ccctcggacg ag 522949DNAArtificialprimer for amplification 29ggggacaagt ttgtacaaaa aagcaggctc catggaccca gaacgacgc 493049DNAArtificialprimer for amplification 30ggggaccact ttgtacaaga aagctgggtt cctagacgcg tgagatcag 493132DNAArtificialprimer for amplification 31tcgttcgaat cgatactatg ttatacgcca ac 323229DNAArtificialprimer for amplification 32atcgtcgact gcacgaatac cagcgaccc 293331DNAArtificialprimer for amplification 33gggggatcct tccattgttc attccacgga c 303430DNAArtificialprimer for amplification 34gggcaattga catgaggttg ccccgtattc 303529DNAArtificialprimer for amplification 35gatatcgata gcgtggactc aaggctctc 293641DNAArtificialprimer for amplification 36aaagaattcg ctagccagct ggcgctgcca tttttggggt g 413729DNAArtificialprimer for amplification 37aaactcgagc agccgagaac attggttcc 293836DNAArtificialprimer for amplification 38taggaattcg gatccaaaac aactgtcaaa gcgcac 363928DNAArtificialprimer for amplification 39cgtagatctg gcgctcggtc ttgccttg 284037DNAArtificialprimer for amplification 40tgtgaattca ctagtgatat tccacaaaac agcaggg 374128DNAArtificialprimer for amplification 41ccgtctagat tcgagccacg gtagcggc 284234DNAArtificialprimer for amplification 42cttgaattca gatcttctcg gcggcgatca cgac 344312DNAArtificialpSwaI linker 43ccatttaaat gg 124418DNAArtificialSwaIKpnIRV 44ccatttaaat ggtaccgg 184518DNAArtificialSwaIKpnIFW 45ccggtaccat ttaaatgg 184632DNAArtificialprimer for amplification 46tcaatacccg gggtaacctc gaagcgtttc ac 324731DNAArtificialprimer for amplification 47tggtgacccg ggacctatcg gaacccctca c 314832DNAArtificialprimer for amplification 48tcaataacta gtgtaacctc gaagcgtttc ac 324931DNAArtificialprimer for amplification 49tggtgaacta gtacctatcg gaacccctca c 315021DNAArtificialprimer for amplification 50cttgagatcg ttcggaatct g 215121DNAArtificialprimer for amplification 51cagattccga acgatctcaa g 215229DNAArtificialprimer for amplification 52aaaatgcatg gcatgtttaa cagaatctg 295327DNAArtificialprimer for amplification 53tttagatcta ctcgttcgcg gagctgg 275429DNAArtificialprimer for amplification 54aaaggatcct tcatggcttg ttatgactg 295530DNAArtificialprimer for amplification 55tgcctcgaga caatttaccg aacaactccg 305623DNAArtificialprimer for amplification 56cgacctaaat ctagatcaac aac 235723DNAArtificialprimer for amplification 57gttgttgatc tagatttagg tcg 235829DNAArtificialprimer for amplification 58tttgtcgacc ataggcgatc tccttaatc 295928DNAArtificialprimer for amplification 59aaactgcagg tgaagaggga cctatcgg 286024DNAArtificialprimer for amplification 60ctgaaggcgg gaaacgacaa tctg 246124DNAArtificialprimer for amplification 61gcttgctgag tggctccttc aacg 246224DNAArtificialprimer for amplification 62aactgcactt caaacaagtg tgac 246320DNAArtificialprimer for amplification 63tatgtcctgc gggtaaatag 206419DNAArtificialprimer for amplification 64ttgttggagc cgaaatccg 196514120DNAArtificialpLC40GWHkorB 65aagcttgcgg ccgcttcgaa gatgttaatt aacatcggta ccgagctcta gggataacag 60ggtaatagct cgaattctag cttgcatgcc tgcagtgcag cgtgacccgg tcgtgcccct 120ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 180tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 240gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 300cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 360ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 420catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 480tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 540tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 600taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 660gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 720cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 780ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 840gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 900cggcagctac gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt 960aataaataga caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca 1020cacacacaac cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg 1080ctcgtcctcc cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta 1140gggcccggta gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg 1200tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact 1260tgccagtgtt tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg 1320atttcatgat tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca 1380atatatgccg tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt 1440gatgatgtgg tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac 1500ctggtggatt tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa 1560ttgaagatga tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta 1620ctgatgcata tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg 1680cggtcgttca ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta 1740ttaattttgg aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat 1800ggaaatatcg atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat 1860gatggcatat gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa 1920acaagtatgt tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag 1980ctatatgtgg atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc 2040ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatca 2100tcacaagttt gtacaaaaaa gcaggctcaa tgagatatga aaaagcctga actcaccgcg 2160acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg tctccgacct gatgcagctc 2220tcggagggcg aagaatctcg tgctttcagc ttcgatgtag gagggcgtgg atatgtcctg 2280cgggtaaata gctgcgccga tggtttctac aaagatcgtt atgtttatcg gcactttgca 2340tcggccgcgc tcccgattcc ggaagtgctt gacattgggg aattcagcga gagcctgacc 2400tattgcatct cccgccgtgc acagggtgtc acgttgcaag acctgcctga aaccgaactg 2460cccgctgttc tgcagccggt cgcggaggcc atggatgcga tcgctgcggc cgatcttagc 2520cagacgagcg ggttcggccc attcggaccg caaggaatcg gtcaatacac tacatggcgt 2580gatttcatat gcgcgattgc tgatccccat gtgtatcact ggcaaactgt gatggacgac 2640accgtcagtg cgtccgtcgc gcaggctctc gatgagctga tgctttgggc cgaggactgc 2700cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca acaatgtcct gacggacaat 2760ggccgcataa cagcggtcat tgactggagc gaggcgatgt tcggggattc ccaatacgag 2820gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta tggagcagca gacgcgctac 2880ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc tccgggcgta tatgctccgc 2940attggtcttg accaactcta tcagagcttg gttgacggca atttcgatga tgcagcttgg 3000gcgcagggtc gatgcgacgc aatcgtccga tccggagccg ggactgtcgg gcgtacacaa 3060atcgcccgca gaagcgcggc cgtctggacc gatggctgtg tagaagtact cgccgatagt 3120ggaaaccgac gccccagcac tcgtccgagg gcaaaggaat agacccagct ttcttgtaca 3180aagtggtgat gatccgtcga cctgcagatc gttcaaacat ttggcaataa agtttcttaa 3240gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg aattacgtta 3300agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt tttatgatta 3360gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc gcaaactagg 3420ataaattatc gcgcgcggtg tcatctatgt tactagatcc gatgataagc tgtcaaacat 3480gagaattcag tacattaaaa acgtccgcaa tgtgttatta agttgtctaa gcgtcaattt 3540gtttacacca caatatatcc tgccaccagc cagccaacag ctccccgacc ggcagctcgg 3600cacaaaatca ccactcgata caggcagccc atcagtccgg gacggcgtca gcgggagagc 3660cgttgtaagg cggcagactt tgctcatgtt accgatgcta ttcggaagaa cggcaactaa 3720gctgccgggt ttgaaacacg gatgatctcg cggagggtag catgttgatt gtaacgatga 3780cagagcgttg ctgcctgtga tcaaatatca tctccctcgc agagatccga attatcagcc 3840ttcttattca tttctcgctt aaccgtgaca ggctgtcgat cttgagaact atgccgacat 3900aataggaaat cgctggataa agccgctgag gaagctgagt ggcgctattt ctttagaagt 3960gaacgttgac gatcgtcgac cgtaccccga tgaattaatt cggacgtacg ttctgaacac 4020agctggatac ttacttgggc gattgtcata catgacatca acaatgtacc cgtttgtgta 4080accgtctctt ggaggttcgt atgacactag gtcgctacct taggaccgtt atagttacta 4140gcgaattgac atgaggttgc cccgtattca gtgtcgctga tttgtattgt ctgaagttgt 4200ttttacgtta agttgatgca gatcaattaa tacgatacct gcgtcataat tgattatttg 4260acgtggtttg atggcctcca cgcacgttgt gatatgtaga tgataatcat tatcacttta 4320cgggtccttt ccggtgatcc gacaggttac ggggcggcga cctcgcgggt tttcgctatt 4380tatgaaaatt ttccggttta aggcgtttcc gttcttcttc gtcataactt aatgttttta 4440tttaaaatac cctctgaaaa gaaaggaaac gacaggtgct gaaagcgagc tttttggcct 4500ctgtcgtttc ctttctctgt ttttgtccgt ggaatgaaca atggaaggat cttctcggcg 4560gcgatcacga cgccggccct gcggagcctt cgccgcgtgc gcgattcatg gcggccgtgg 4620aggccaagga tttcgcgcga gtgcaagagc tgatcgaggc gcgtggagcc aagtcggcgg 4680ctgattatgt ccttgcgcag ctcgccgtgg ccgaaggtct ggaccgcaag cctggtgcgc 4740gcgtcgtggt cgggaaagcg gcgggcagca tggcaatgcc gcctgcggcg ctgggtttta 4800cgccaagggg agaagcggca tacgccatcg agcggtcagc ctatggtgag ccgaggtcca 4860gcattgcgaa gcagtaccag caggaatgga accggaaggc ggcgacctgg tgggcgatgg 4920ccggtgtggc cggcatcatc ggcgcgatcc tggcggcggc ggcaaccggc tttgttgggc 4980tggcagtgtc gatccgcaac cgagtgaagc gcgtgcgcga cctgttggtg atggagccgg 5040gtgcagagcc ataagcggca agagacgaaa gcccggtttc cgggcttttg ttttgttacg 5100ccaaggacga gttttagcgg ctaaaggtgt tgacgtgcga gaaatgttta gctaaacttc 5160tctcatgtgc tggcggctgt caccgctatg ttcaaccaag gcgcggagca aattatgggt 5220gttatccatg aagaaacggc ttaccgaaag ccagttccag gaggcgatcc aggggctgga 5280agtggggcag cagaccatcg agatagcgcg gggcgtctta gtcgatggga agccacaggc 5340gacgttcgca acgtcgctgg gactgaccag gggcgcagtg tcgcaagcgg tgcatcgcgt 5400gtgggccgcg ttcgaggaca agaacttgcc cgaggggtac gcgcgggtaa cggcggttct 5460gccggaacat caggcgtaca tcgtccggaa gtgggaagcg gacgccaaga aaaaacagga 5520aaccaaacga tgaaaacttt ggtcacggcc aaccagaaag gcggcgtcgg caagacttcg 5580acccttgtgc atcttgcctt cgactttttc gagcgcggct tgcgggttgc cgtgatcgac 5640ctggaccccc agggcaatgc gtcctacacg ctcaaggact ttgctaccgg cctgcatgca 5700agcaagctgt tcggcgctgt ccctgccggc ggctggaccg aaaccgcacc cgcagccggc 5760gacggccagg ccgcgcgcct cgccctcatc gagtccaacc cggtactggc gaacgccgaa 5820cggctgtcgc tggacgacgc ccgcgagctg ttcggggcga acatcaaggc cctggcgaac 5880caaggcttcg acgtgtgcct gatcgacacg gccccgaccc ttggcgtcgg cctggcggcc 5940gccctcttcg cggccgacta tgtgctgtcc cccatcgagc ttgaggcgta cagcatccag 6000ggcatcaaga agatggtcac gaccattgcg aacgtgcgcc agaagaacgc caagctgcaa 6060ttccttggca tggtgcccag caaggtcgat gcgcggaatc cgcgccacgc gcgccaccaa 6120gccgagctgc tggccgcgta ccccaagatg atgattccgg ccaccgttgg cctgcgcagc 6180agcatcgccg atgccctcgc atccggtgtg ccggtctgga agatcaagaa aacggccgcg 6240cgcaaggcat cgaaagaggt tcgcgccctg gctgattacg tgttcacgaa gatggagatt 6300tcccaatgac tgcggctcaa gccaagacca ccaagaaaaa caccgctgcg gccgctcagg 6360aagccgcagg cgcggcgcag ccgtccggcc tggggttgga tagcatcggc gacctgtcga 6420gcctcctgga cgctcctgcg gcgtctcagg gcggttccgg ccctatcgag ctggacctgg 6480acctgatcga cgaagatccg catcagccgc ggacggccga caaccccggc ttttccccgg 6540agagcatcgc ggaaatcggt gccacgatca aagagcgcgg ggtgaagtca cccatttcgg 6600tgcgcgagaa ccaggagcag ccgggccgct atatcatcaa tcacggcgcc cgccgctacc 6660gtggctcgaa gtgggccggc aagaagtcca tcccggcgtt catcgacaac gactacaacg 6720aagccgacca ggttatcgag aacctgcaac gcaacgagct gaccccgcgc gaaattgccg 6780acttcattgg ccgcgagctg gcgaagggca

agaagaaagg cgatatcgcc aaggaaatcg 6840gcaagtcgcc ggcgttcatc acccagcacg tcacgctgct ggacctgccg gagaagatcg 6900ccgatgcgtt caacaccggc cgcgtgcgcg acgtgaccgt ggtgaacgag ctggtgacgg 6960ccttcaagaa gcgcccggag gaagtcgagg cgtggcttga cgacgacacc caggaaatca 7020cgcgcggcac ggtcaagctg ctgcgcgagt tcctggacga gaagggccgc gatcccaaca 7080ccgtcgatgc cttcaacggc cagactgatg ccgagcgtga cgcggaggcc ggcgacggcc 7140aggacggcga ggacggcgac caggacggta aggacgccaa ggaaaagggc gcgaaggagc 7200cggacccgga caagctgaaa aaggccatcg tccaggtcga gcacgacgag cgccctgccc 7260gccttatcct caaccgtcgg ccgccggcgg aaggctatgc ctggttgaag tacgaggacg 7320acggccagga gttcgaggcg aaccttgccg acgtgaaact ggtcgcgctc atcgagggct 7380gatccccaaa gacagcggcg cgggccaccc gcgccgcaca gacaacggtt ccgctacaag 7440gaggaccgaa gaatgaatcc gatgctgttc tacatcgcgg gaggcgtagg cgcggcgttg 7500ctgctggttt ccgcgatcat gctgttcaag ctgcgcgagc cgaagaagga acaccgaccg 7560cagcgcaagg cggcggcccc gacgccgcag ccggtcgata acgagctgct gcgcactcta 7620gtgatattcc acaaaacagc agggaagcag cgcttttccg ctgcataacc ctgcttcggg 7680gtcattatag cgattttttc ggtatatcca tcctttttcg cacgatatac aggattttgc 7740caaagggttc gtgtagactt tccttggtgt atccaacggc gtcagccggg caggataggt 7800gaagtaggcc cacccgcgag cgggtgttcc ttcttcactg tcccttattc gcacctggcg 7860gtgctcaacg ggaatcctgc tctgcgaggc tggccggcta ccgccggcgt aacagatgag 7920ggcaagcgga tggctgatga aaccaagcca accaggaagg gcagcccacc tatcaaggtg 7980tactgccttc cagacgaacg aagagcgatt gaggaaaagg cggcggcggc cggcatgagc 8040ctgtcggcct acctgctggc cgtcggccag ggctacaaaa tcacgggcgt cgtggactat 8100gagcacgtcc gcgagctggc ccgcatcaat ggcgacctgg gccgcctggg cggcctgctg 8160aaactctggc tcaccgacga cccgcgcacg gcgcggttcg gtgatgccac gatcctcgcc 8220ctgctggcga agatcgaaga gaagcaggac gagcttggca aggtcatgat gggcgtggtc 8280cgcccgaggg cagagccatg acttttttag ccgctaaaac ggccgggggg tgcgcgtgat 8340tgccaagcac gtccccatgc gctccatcaa gaagagcgac ttcgcggagc tggtgaagta 8400catcaccgac gagcaaggca agaccgagcg ccagatccaa aacaactgtc aaagcgcacc 8460cgcccgatgc cattcgcggc acggcttccg ttgaggatgt cgatatgatg cgcgagccga 8520cggcccgcag agaaggggcc gttttagcgg ctaaagaagg aagtgcaagc cctaaccctt 8580ggcgtcagag ccttccacgc agcttttttc gggtgtcgtc gccccatttc tttacgataa 8640acgccttatg tgacggcaaa accacactga tgcgttcgta tccgggcggc acgctgctct 8700tgaaaggatg acccgcaatc tccgcgagtg cctcgcggtc aaggtcggtg gactccagga 8760gaagaggtag gggagtttcc agggcgtcgg caatggcctc catcaccttc aacgaggggt 8820tggccttacc gttggttaag tctgataaaa acgaaattga aacccctgcc ctctccgaca 8880gctcatgttt cgtcatgccc cgctcatcga gcagacgaag gatgttggtg aaaaatatct 8940ggttgtacac agcggaagcc gcccctcgca cctttggtcg cggcccgcaa aattttagcc 9000gctaaagttc ttgacagcgg aaccaatgtt tagctaaact agagtctcct ttctcaagga 9060gactttcgat atgagccata atcagttcca gtttatcggt aatcttaccc gtgacaccga 9120ggtacgtcat ggcaattcta acaagccgca agcaattttc gatatagcgg ttaatgaaga 9180gtggcgcaac gatgccggcg acaagcagga gcgcaccgac ttcttccgca tcaagtgttt 9240tggctctcag gccgaggccc acggcaagta tttgggcaag gggtcgctgg tattcgtgca 9300gggcaagatt cggaatacca agtacgagaa ggacggccag acggtctacg ggaccgactt 9360cattgccgat aaggtggatt atctggacac caaggcacca ggcgggtcaa atcaggaata 9420agggcacatt gccccggcgt gagtcggggc aatcccgcaa ggagggtgaa tgaatcggac 9480gtttgaccgg aaggcataca ggcaagaact gatcgacgcg gggttttccg ccgaggatgc 9540cgaaaccatc gcaagccgca ccgtcatgcg tgcgccccgc gaaaccttcc agtccgtcgg 9600ctcgatggtc cagcaagcta cggccaagat cgagcgcgac agcgtgcaac tggctccccc 9660tgccctgccc gcgccatcgg ccgccgtgga gcgttcgcgt cgtctcgaac aggaggcggc 9720aggtttggcg aagtcgatga ccatcgacac gcgaggaact atgacgacca agaagcgaaa 9780aaccgccggc gaggacctgg caaaacaggt cagcgaggcc aagcaggccg cgttgctgaa 9840acacacgaag cagcagatca aggaaatgca gctttccttg ttcgatattg cgccgtggcc 9900ggacacgatg cgagcgatgc caaacgacac ggcccgctct gccctgttca ccacgcgcaa 9960caagaaaatc ccgcgcgagg cgctgcaaaa caaggtcatt ttccacgtca acaaggacgt 10020gaagatcacc tacaccggcg tcgagctgcg ggccgacgat gacgaactgg tgtggcagca 10080ggtgttggag tacgcgaagc gcacccctat cggcgagccg atcaccttca cgttctacga 10140gctttgccag gacctgggct ggtcgatcaa tggccggtat tacacgaagg ccgaggaatg 10200cctgtcgcgc ctacaggcga cggcgatggg cttcacgtcc gaccgcgttg ggcacctgga 10260atcggtgtcg ctgctgcacc gcttccgcgt cctggaccgt ggcaagaaaa cgtcccgttg 10320ccaggtcctg atcgacgagg aaatcgtcgt gctgtttgct ggcgaccact acacgaaatt 10380catatgggag aagtaccgca agctgtcgcc gacggcccga cggatgttcg actatttcag 10440ctcgcaccgg gagccgtacc cgctcaagct ggaaaccttc cgcctcatgt gcggatcgga 10500ttccacccgc gtgaagaagt ggcgcgagca ggtcggcgaa gcctgcgaag agttgcgagg 10560cagcggcctg gtggaacacg cctgggtcaa tgatgacctg gtgcattgca aacgctaggg 10620ccttgtgggg tcagttccgg ctgggggttc agcagccagc gctttactgg catttcagga 10680acaagcgggc actgctcgac gcacttgctt cgctcagtat cgctcgggac gcacggcgcg 10740ctctacgaac tgccgataaa cagaggatta aaattgacaa ttgtgattaa ggctcagatt 10800cgacggcttg gagcggccga cgtgcaggat ttccgcgaga tccgattgtc ggccctgaag 10860aaagctccag agatgttcgg gtccgtttac gagcacgagg agaaaaagcc catggaggcg 10920ttcgctgaac ggttgcgaga tgccgtggca ttcggcgcct acatcgacgg cgagatcatt 10980gggctgtcgg tcttcaaaca ggaggacggc cccaaggacg ctcacaaggc gcatctgtcc 11040ggcgttttcg tggagcccga acagcgaggc cgaggggtcg ccggtatgct gctgcgggcg 11100ttgccggcgg gtttattgct cgtgatgatc gtccgacaga ttccaacggg aatctggtgg 11160atgcgcatct tcatcctcgg cgcacttaat atttcgctat tctggagctt gttgtttatt 11220tcggtctacc gcctgccggg cgggtcgcgg cgacggtagg cgctgtgcag ccgctgatgg 11280tcgtgttcat ctctgccgct ctgctaggta gcccgatacg attgatggcg gtcctggggg 11340ctatttgcgg aactgcgggc gtggcgctgt tggtgttgac accaaacgca gcgctagatc 11400ctgtcggcgt cgcagcgggc ctggcggggg cggtttccat ggcgttcgga accgtgctga 11460cccgcaagtg gcaacctccc gtgcctctgc tcacctttac cgcctggcaa ctggcggccg 11520gaggacttct gctcgttcca gtagctttag tgtttgatcc gccaatcccg atgcctacag 11580gaaccaatgt tctcggctgc tcgactgcac gaataccagc gaccccttgc ccaaatactt 11640gccgtgggcc tcggcctgag agccaaaaca cttgatgcgg aagaagtcgg tgcgctcctg 11700cttgtcgccg gcatcgttgc gccacatcta ggtactaaaa caattcatcc agtaaaatat 11760aatattttat tttctcccaa tcaggcttga tccccagtaa gtcaaaaaat agctcgacat 11820actgttcttc cccgatatcc tccctgatcg accggacgca gaaggcaatg tcataccact 11880tgtccgccct gccgcttctc ccaagatcaa taaagccact tactttgcca tctttcacaa 11940agatgttgct gtctcccagg tcgccgtggg aaaagacaag ttcctcttcg ggcttttccg 12000tctttaaaaa atcatacagc tcgcgcggat ctttaaatgg agtgtcttct tcccagtttt 12060cgcaatccac atcggccaga tcgttattca gtaagtaatc caattcggct aagcggctgt 12120ctaagctatt cgtataggga caatccgata tgtcgatgga gtgaaagagc ctgatgcact 12180ccgcatacag ctcgataatc ttttcagggc tttgttcatc ttcatactct tccgagcaaa 12240ggacgccatc ggcctcactc atgagcagat tgctccagcc atcatgccgt tcaaagtgca 12300ggacctttgg aacaggcagc tttccttcca gccatagcat catgtccttt tcccgttcca 12360catcataggt ggtcccttta taccggctgt ccgtcatttt taaatatagg ttttcatttt 12420ctcccaccag cttatatacc ttagcaggag acattccttc cgtatctttt acgcagcggt 12480atttttcgat cagttttttc aattccggtg atattctcat tttagccatt tattatttcc 12540ttcctctttt ctacagtatt taaagatacc ccaagaagct aattataaca agacgaactc 12600caattcactg ttccttgcat tctaaaacct taaataccag aaaacagctt tttcaaagtt 12660gttttcaaag ttggcgtata acatagtatc gattcgatag cgtggactca aggctctcgc 12720gaatggctcg cgttggaaac tttcattgac acttgagggg caccgcaggg aaattctcgt 12780ccttgcgaga accggctatg tcgtgctgcg catcgagcct gcgcccttgg cttgtctcgc 12840ccctctccgc gtcgctacgg ggcttccagc gcctttccga cgctcaccgg gctggttgcc 12900ctcgccgctg ggctggcggc cgtctatggc cctgcaaacg cgccagaaac gccgtcgaag 12960ccgtgtgcga gacaccgcgg ccgccggcgt tgtggatacc tcgcggaaaa cttggccctc 13020actgacagat gaggggcgga cgttgacact tgaggggccg actcacccgg cgcggcgttg 13080acagatgagg ggcaggctcg atttcggccg gcgacgtgga gctggccagc ctcgcaaatc 13140ggcgaaaacg cctgatttta cgcgagtttc ccacagatga tgtggacaag cctggggata 13200agtgccctgc ggtattgaca cttgaggggc gcgactactg acagatgagg ggcgcgatcc 13260ttgacacttg aggggcagag tgctgacaga tgaggggcgc acctattgac atttgagggg 13320ctgtccacag gcagaaaatc cagcatttgc aagggtttcc gcccgttttt cggccaccgc 13380taacctgtct tttaacctgc ttttaaacca atatttataa accttgtttt taaccagggc 13440tgcgccctgt gcgcgtgacc gcgcacgccg aaggggggtg cccccccttc tcgaaccctc 13500ccggcccgct aacgcgggcc tcccatcccc ccaggggctg cgcccctcgg ccgcgaacgg 13560cctcacccca aaaatggcag cgccagccag gacgtcggcc gaaagagcga caagcagatc 13620acgcttttcg acagcgtcgg atttgcgatc gaggattttt cggcgctgcg ctacgtccgc 13680gaccgcgttg agggatcaag ccacagcagc ccactcgacc ttctagccga cccagacgag 13740ccaagggatc tttttggaat gctgctccgt cgtcaggctt tccgacgttt gggtggttga 13800acagaagtca ttatcgcacg gaatgccaag cactcccgag gggaaccctg tggttggcat 13860gcacatacaa atggacgaac ggataaacct tttcacgccc ttttaaatat ccgattattc 13920taataaacgc tcttttctct taggtttacc cgccaatata tcctgtcaaa cactgatagt 13980ttaaactgaa ggcgggaaac gacaatctga tcatgagcgg agaattaagg gagtcacgtt 14040atgacccccg ccgatgacgc gggacaagcc gttttacgtt tggaactgac agaaccgcaa 14100cgttgaagga gccactcagc 141206614195DNAArtificialpLCleo 66aagcttgggc ccttcgaaga tgttaattaa catcggtacc gagctctagg gataacaggg 60taatcaactt tgtataataa agttgataac agggtaatag ctcgaattct agcttgcatg 120cctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag ataatgagca ttgcatgtct 180aagttataaa aaattaccac atattttttt tgtcacactt gtttgaagtg cagtttatct 240atctttatac atatatttaa actttactct acgaataata taatctatag tactacaata 300atatcagtgt tttagagaat catataaatg aacagttaga catggtctaa aggacaattg 360agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg ttctcctttt 420tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac atccatttag 480ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt tattctattt 540tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa taatttagat 600ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa gaaattaaaa 660aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta aacgccgtcg 720acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca agcgaagcag 780acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc tccaccgttg 840gacttgctcc gctgtcggca tccagaaatt gcgtggcgga gcggcagacg tgagccggca 900cggcaggcgg cctcctcctc ctctcacggc accggcagct acgggggatt cctttcccac 960cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct ccacaccctc 1020tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc ccccaaatcc 1080acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc ccctctctac 1140cttctctaga tcggcgttcc ggtccatggt tagggccggg tagttctact tctgttcatg 1200tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac acggatgcga 1260cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg gggaatcctg 1320ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg tttcgttgca 1380tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg tttgtcgggt 1440catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg ggcggtcgtt 1500ctagatcgga gtagaattct gtttcaaact acctggtgga tttattaatt ttggatctgt 1560atgtgtgtgc catacatatt catagttacg aattgaagat gatggatgga aatatcgatc 1620taggataggt atacatgttg atgcgggttt tactgatgca tatacagaga tgctttttgt 1680tcgcttggtt gtgatgatgt ggtgtggttg ggcggtcgtt cattcgttct agatcggagt 1740agaatactgt ttcaaactac ctggtgtatt tattaatttt ggaactgtat gtgtgtgtca 1800tacatcttca tagttacgag tttaagatgg atggaaatat cgatctagga taggtataca 1860tgttgatgtg ggttttactg atgcatatac atgatggcat atgcagcatc tattcatatg 1920ctctaacctt gagtacctat ctattataat aaacaagtat gttttataat tattttgatc 1980ttgatatact tggatgatgg catatgcagc agctatatgt ggattttttt agccctgcct 2040tcatacgcta tttatttgct tggtactgtt tcttttgtcg atgctcaccc tgttgtttgg 2100tgttacttct gcaggtcgac tctagaggat catcacaagt ttgtacaaaa aagcaggctc 2160aatgagatat gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa 2220agttcgacag cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca 2280gcttcgatgt aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct 2340acaaagatcg ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc 2400ttgacattgg ggaattcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg 2460tcacgttgca agacctgcct gaaaccgaac tgcccgctgt tctgcagccg gtcgcggagg 2520ccatggatgc gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac 2580cgcaaggaat cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc 2640atgtgtatca ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc 2700tcgatgagct gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcacgcgg 2760atttcggctc caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga 2820gcgaggcgat gttcggggat tcccaatacg aggtcgccaa catcttcttc tggaggccgt 2880ggttggcttg tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag 2940gatcgccgcg gctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct 3000tggttgacgg caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc 3060gatccggagc cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga 3120ccgatggctg tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga 3180gggcaaagga atagacccag ctttcttgta caaagtggtg atgatccgtc gacctgcaga 3240tcgttcaaac atttggcaat aaagtttctt aagattgaat cctgttgccg gtcttgcgat 3300gattatcata taatttctgt tgaattacgt taagcatgta ataattaaca tgtaatgcat 3360gacgttattt atgagatggg tttttatgat tagagtcccg caattataca tttaatacgc 3420gatagaaaac aaaatatagc gcgcaaacta ggataaatta tcgcgcgcgg tgtcatctat 3480gttactagat ccgatgataa gctgtcaaac atgagaattc agtacattaa aaacgtccgc 3540aatgtgttat taagttgtct aagcgtcaat ttgtttacac cacaatatat cctgccacca 3600gccagccaac agctccccga ccggcagctc ggcacaaaat caccactcga tacaggcagc 3660ccatcagtcc gggacggcgt cagcgggaga gccgttgtaa ggcggcagac tttgctcatg 3720ttaccgatgc tattcggaag aacggcaact aagctgccgg gtttgaaaca cggatgatct 3780cgcggagggt agcatgttga ttgtaacgat gacagagcgt tgctgcctgt gatcaaatat 3840catctccctc gcagagatcc gaattatcag ccttcttatt catttctcgc ttaaccgtga 3900caggctgtcg atcttgagaa ctatgccgac ataataggaa atcgctggat aaagccgctg 3960aggaagctga gtggcgctat ttctttagaa gtgaacgttg acgatcgtcg accgtacccc 4020gatgaattaa ttcggacgta cgttctgaac acagctggat acttacttgg gcgattgtca 4080tacatgacat caacaatgta cccgtttgtg taaccgtctc ttggaggttc gtatgacact 4140aggtcgctac cttaggaccg ttatagttac tagcgaattg acatgaggtt gccccgtatt 4200cagtgtcgct gatttgtatt gtctgaagtt gtttttacgt taagttgatg cagatcaatt 4260aatacgatac ctgcgtcata attgattatt tgacgtggtt tgatggcctc cacgcacgtt 4320gtgatatgta gatgataatc attatcactt tacgggtcct ttccggtgat ccgacaggtt 4380acggggcggc gacctcgcgg gttttcgcta tttatgaaaa ttttccggtt taaggcgttt 4440ccgttcttct tcgtcataac ttaatgtttt tatttaaaat accctctgaa aagaaaggaa 4500acgacaggtg ctgaaagcga gctttttggc ctctgtcgtt tcctttctct gtttttgtcc 4560gtggaatgaa caatggaagg atcttctcgg cggcgatcac gacgccggcc ctgcggagcc 4620ttcgccgcgt gcgcgattca tggcggccgt ggaggccaag gatttcgcgc gagtgcaaga 4680gctgatcgag gcgcgtggag ccaagtcggc ggctgattat gtccttgcgc agctcgccgt 4740ggccgaaggt ctggaccgca agcctggtgc gcgcgtcgtg gtcgggaaag cggcgggcag 4800catggcaatg ccgcctgcgg cgctgggttt tacgccaagg ggagaagcgg catacgccat 4860cgagcggtca gcctatggtg agccgaggtc cagcattgcg aagcagtacc agcaggaatg 4920gaaccggaag gcggcgacct ggtgggcgat ggccggtgtg gccggcatca tcggcgcgat 4980cctggcggcg gcggcaaccg gctttgttgg gctggcagtg tcgatccgca accgagtgaa 5040gcgcgtgcgc gacctgttgg tgatggagcc gggtgcagag ccataagcgg caagagacga 5100aagcccggtt tccgggcttt tgttttgtta cgccaaggac gagttttagc ggctaaaggt 5160gttgacgtgc gagaaatgtt tagctaaact tctctcatgt gctggcggct gtcaccgcta 5220tgttcaacca aggcgcggag caaattatgg gtgttatcca tgaagaaacg gcttaccgaa 5280agccagttcc aggaggcgat ccaggggctg gaagtggggc agcagaccat cgagatagcg 5340cggggcgtct tagtcgatgg gaagccacag gcgacgttcg caacgtcgct gggactgacc 5400aggggcgcag tgtcgcaagc ggtgcatcgc gtgtgggccg cgttcgagga caagaacttg 5460cccgaggggt acgcgcgggt aacggcggtt ctgccggaac atcaggcgta catcgtccgg 5520aagtgggaag cggacgccaa gaaaaaacag gaaaccaaac gatgaaaact ttggtcacgg 5580ccaaccagaa aggcggcgtc ggcaagactt cgacccttgt gcatcttgcc ttcgactttt 5640tcgagcgcgg cttgcgggtt gccgtgatcg acctggaccc ccagggcaat gcgtcctaca 5700cgctcaagga ctttgctacc ggcctgcatg caagcaagct gttcggcgct gtccctgccg 5760gcggctggac cgaaaccgca cccgcagccg gcgacggcca ggccgcgcgc ctcgccctca 5820tcgagtccaa cccggtactg gcgaacgccg aacggctgtc gctggacgac gcccgcgagc 5880tgttcggggc gaacatcaag gccctggcga accaaggctt cgacgtgtgc ctgatcgaca 5940cggccccgac ccttggcgtc ggcctggcgg ccgccctctt cgcggccgac tatgtgctgt 6000cccccatcga gcttgaggcg tacagcatcc agggcatcaa gaagatggtc acgaccattg 6060cgaacgtgcg ccagaagaac gccaagctgc aattccttgg catggtgccc agcaaggtcg 6120atgcgcggaa tccgcgccac gcgcgccacc aagccgagct gctggccgcg taccccaaga 6180tgatgattcc ggccaccgtt ggcctgcgca gcagcatcgc cgatgccctc gcatccggtg 6240tgccggtctg gaagatcaag aaaacggccg cgcgcaaggc atcgaaagag gttcgcgccc 6300tggctgatta cgtgttcacg aagatggaga tttcccaatg actgcggctc aagccaagac 6360caccaagaaa aacaccgctg cggccgctca ggaagccgca ggcgcggcgc agccgtccgg 6420cctggggttg gatagcatcg gcgacctgtc gagcctcctg gacgctcctg cggcgtctca 6480gggcggttcc ggccctatcg agctggacct ggacctgatc gacgaagatc cgcatcagcc 6540gcggacggcc gacaaccccg gcttttcccc ggagagcatc gcggaaatcg gtgccacgat 6600caaagagcgc ggggtgaagt cacccatttc ggtgcgcgag aaccaggagc agccgggccg 6660ctatatcatc aatcacggcg cccgccgcta ccgtggctcg aagtgggccg gcaagaagtc 6720catcccggcg ttcatcgaca acgactacaa cgaagccgac caggttatcg agaacctgca 6780acgcaacgag ctgaccccgc gcgaaattgc cgacttcatt ggccgcgagc tggcgaaggg 6840caagaagaaa ggcgatatcg ccaaggaaat cggcaagtcg ccggcgttca tcacccagca 6900cgtcacgctg ctggacctgc cggagaagat cgccgatgcg ttcaacaccg gccgcgtgcg 6960cgacgtgacc gtggtgaacg agctggtgac ggccttcaag aagcgcccgg aggaagtcga 7020ggcgtggctt gacgacgaca cccaggaaat cacgcgcggc acggtcaagc tgctgcgcga 7080gttcctggac gagaagggcc gcgatcccaa caccgtcgat gccttcaacg gccagactga 7140tgccgagcgt gacgcggagg ccggcgacgg ccaggacggc gaggacggcg accaggacgg 7200taaggacgcc aaggaaaagg gcgcgaagga gccggacccg gacaagctga aaaaggccat 7260cgtccaggtc gagcacgacg agcgccctgc ccgccttatc ctcaaccgtc ggccgccggc 7320ggaaggctat gcctggttga agtacgagga cgacggccag gagttcgagg cgaaccttgc 7380cgacgtgaaa ctggtcgcgc tcatcgaggg ctgatcccca aagacagcgg cgcgggccac 7440ccgcgccgca cagacaacgg ttccgctaca aggaggaccg aagaatgaat ccgatgctgt 7500tctacatcgc gggaggcgta ggcgcggcgt tgctgctggt ttccgcgatc atgctgttca 7560agctgcgcga gccgaagaag gaacaccgac cgcagcgcaa ggcggcggcc ccgacgccgc 7620agccggtcga taacgagctg ctgcgcactc tagtgatatt ccacaaaaca gcagggaagc

7680agcgcttttc cgctgcataa ccctgcttcg gggtcattat agcgattttt tcggtatatc 7740catccttttt cgcacgatat acaggatttt gccaaagggt tcgtgtagac tttccttggt 7800gtatccaacg gcgtcagccg ggcaggatag gtgaagtagg cccacccgcg agcgggtgtt 7860ccttcttcac tgtcccttat tcgcacctgg cggtgctcaa cgggaatcct gctctgcgag 7920gctggccggc taccgccggc gtaacagatg agggcaagcg gatggctgat gaaaccaagc 7980caaccaggaa gggcagccca cctatcaagg tgtactgcct tccagacgaa cgaagagcga 8040ttgaggaaaa ggcggcggcg gccggcatga gcctgtcggc ctacctgctg gccgtcggcc 8100agggctacaa aatcacgggc gtcgtggact atgagcacgt ccgcgagctg gcccgcatca 8160atggcgacct gggccgcctg ggcggcctgc tgaaactctg gctcaccgac gacccgcgca 8220cggcgcggtt cggtgatgcc acgatcctcg ccctgctggc gaagatcgaa gagaagcagg 8280acgagcttgg caaggtcatg atgggcgtgg tccgcccgag ggcagagcca tgactttttt 8340agccgctaaa acggccgggg ggtgcgcgtg attgccaagc acgtccccat gcgctccatc 8400aagaagagcg acttcgcgga gctggtgaag tacatcaccg acgagcaagg caagaccgag 8460cgccagatcc aaaacaactg tcaaagcgca cccgcccgat gccattcgcg gcacggcttc 8520cgttgaggat gtcgatatga tgcgcgagcc gacggcccgc agagaagggg ccgttttagc 8580ggctaaagaa ggaagtgcaa gccctaaccc ttggcgtcag agccttccac gcagcttttt 8640tcgggtgtcg tcgccccatt tctttacgat aaacgcctta tgtgacggca aaaccacact 8700gatgcgttcg tatccgggcg gcacgctgct cttgaaagga tgacccgcaa tctccgcgag 8760tgcctcgcgg tcaaggtcgg tggactccag gagaagaggt aggggagttt ccagggcgtc 8820ggcaatggcc tccatcacct tcaacgaggg gttggcctta ccgttggtta agtctgataa 8880aaacgaaatt gaaacccctg ccctctccga cagctcatgt ttcgtcatgc cccgctcatc 8940gagcagacga aggatgttgg tgaaaaatat ctggttgtac acagcggaag ccgcccctcg 9000cacctttggt cgcggcccgc aaaattttag ccgctaaagt tcttgacagc ggaaccaatg 9060tttagctaaa ctagagtctc ctttctcaag gagactttcg atatgagcca taatcagttc 9120cagtttatcg gtaatcttac ccgtgacacc gaggtacgtc atggcaattc taacaagccg 9180caagcaattt tcgatatagc ggttaatgaa gagtggcgca acgatgccgg cgacaagcag 9240gagcgcaccg acttcttccg catcaagtgt tttggctctc aggccgaggc ccacggcaag 9300tatttgggca aggggtcgct ggtattcgtg cagggcaaga ttcggaatac caagtacgag 9360aaggacggcc agacggtcta cgggaccgac ttcattgccg ataaggtgga ttatctggac 9420accaaggcac caggcgggtc aaatcaggaa taagggcaca ttgccccggc gtgagtcggg 9480gcaatcccgc aaggagggtg aatgaatcgg acgtttgacc ggaaggcata caggcaagaa 9540ctgatcgacg cggggttttc cgccgaggat gccgaaacca tcgcaagccg caccgtcatg 9600cgtgcgcccc gcgaaacctt ccagtccgtc ggctcgatgg tccagcaagc tacggccaag 9660atcgagcgcg acagcgtgca actggctccc cctgccctgc ccgcgccatc ggccgccgtg 9720gagcgttcgc gtcgtctcga acaggaggcg gcaggtttgg cgaagtcgat gaccatcgac 9780acgcgaggaa ctatgacgac caagaagcga aaaaccgccg gcgaggacct ggcaaaacag 9840gtcagcgagg ccaagcaggc cgcgttgctg aaacacacga agcagcagat caaggaaatg 9900cagctttcct tgttcgatat tgcgccgtgg ccggacacga tgcgagcgat gccaaacgac 9960acggcccgct ctgccctgtt caccacgcgc aacaagaaaa tcccgcgcga ggcgctgcaa 10020aacaaggtca ttttccacgt caacaaggac gtgaagatca cctacaccgg cgtcgagctg 10080cgggccgacg atgacgaact ggtgtggcag caggtgttgg agtacgcgaa gcgcacccct 10140atcggcgagc cgatcacctt cacgttctac gagctttgcc aggacctggg ctggtcgatc 10200aatggccggt attacacgaa ggccgaggaa tgcctgtcgc gcctacaggc gacggcgatg 10260ggcttcacgt ccgaccgcgt tgggcacctg gaatcggtgt cgctgctgca ccgcttccgc 10320gtcctggacc gtggcaagaa aacgtcccgt tgccaggtcc tgatcgacga ggaaatcgtc 10380gtgctgtttg ctggcgacca ctacacgaaa ttcatatggg agaagtaccg caagctgtcg 10440ccgacggccc gacggatgtt cgactatttc agctcgcacc gggagccgta cccgctcaag 10500ctggaaacct tccgcctcat gtgcggatcg gattccaccc gcgtgaagaa gtggcgcgag 10560caggtcggcg aagcctgcga agagttgcga ggcagcggcc tggtggaaca cgcctgggtc 10620aatgatgacc tggtgcattg caaacgctag ggccttgtgg ggtcagttcc ggctgggggt 10680tcagcagcca gcgctttact ggcatttcag gaacaagcgg gcactgctcg acgcacttgc 10740ttcgctcagt atcgctcggg acgcacggcg cgctctacga actgccgata aacagaggat 10800taaaattgac aattgtgatt aaggctcaga ttcgacggct tggagcggcc gacgtgcagg 10860atttccgcga gatccgattg tcggccctga agaaagctcc agagatgttc gggtccgttt 10920acgagcacga ggagaaaaag cccatggagg cgttcgctga acggttgcga gatgccgtgg 10980cattcggcgc ctacatcgac ggcgagatca ttgggctgtc ggtcttcaaa caggaggacg 11040gccccaagga cgctcacaag gcgcatctgt ccggcgtttt cgtggagccc gaacagcgag 11100gccgaggggt cgccggtatg ctgctgcggg cgttgccggc gggtttattg ctcgtgatga 11160tcgtccgaca gattccaacg ggaatctggt ggatgcgcat cttcatcctc ggcgcactta 11220atatttcgct attctggagc ttgttgttta tttcggtcta ccgcctgccg ggcgggtcgc 11280ggcgacggta ggcgctgtgc agccgctgat ggtcgtgttc atctctgccg ctctgctagg 11340tagcccgata cgattgatgg cggtcctggg ggctatttgc ggaactgcgg gcgtggcgct 11400gttggtgttg acaccaaacg cagcgctaga tcctgtcggc gtcgcagcgg gcctggcggg 11460ggcggtttcc atggcgttcg gaaccgtgct gacccgcaag tggcaacctc ccgtgcctct 11520gctcaccttt accgcctggc aactggcggc cggaggactt ctgctcgttc cagtagcttt 11580agtgtttgat ccgccaatcc cgatgcctac aggaaccaat gttctcggct gctcgactgc 11640acgaatacca gcgacccctt gcccaaatac ttgccgtggg cctcggcctg agagccaaaa 11700cacttgatgc ggaagaagtc ggtgcgctcc tgcttgtcgc cggcatcgtt gcgccacatc 11760taggtactaa aacaattcat ccagtaaaat ataatatttt attttctccc aatcaggctt 11820gatccccagt aagtcaaaaa atagctcgac atactgttct tccccgatat cctccctgat 11880cgaccggacg cagaaggcaa tgtcatacca cttgtccgcc ctgccgcttc tcccaagatc 11940aataaagcca cttactttgc catctttcac aaagatgttg ctgtctccca ggtcgccgtg 12000ggaaaagaca agttcctctt cgggcttttc cgtctttaaa aaatcataca gctcgcgcgg 12060atctttaaat ggagtgtctt cttcccagtt ttcgcaatcc acatcggcca gatcgttatt 12120cagtaagtaa tccaattcgg ctaagcggct gtctaagcta ttcgtatagg gacaatccga 12180tatgtcgatg gagtgaaaga gcctgatgca ctccgcatac agctcgataa tcttttcagg 12240gctttgttca tcttcatact cttccgagca aaggacgcca tcggcctcac tcatgagcag 12300attgctccag ccatcatgcc gttcaaagtg caggaccttt ggaacaggca gctttccttc 12360cagccatagc atcatgtcct tttcccgttc cacatcatag gtggtccctt tataccggct 12420gtccgtcatt tttaaatata ggttttcatt ttctcccacc agcttatata ccttagcagg 12480agacattcct tccgtatctt ttacgcagcg gtatttttcg atcagttttt tcaattccgg 12540tgatattctc attttagcca tttattattt ccttcctctt ttctacagta tttaaagata 12600ccccaagaag ctaattataa caagacgaac tccaattcac tgttccttgc attctaaaac 12660cttaaatacc agaaaacagc tttttcaaag ttgttttcaa agttggcgta taacatagta 12720tcgattcgat agcgtggact caaggctctc gcgaatggct cgcgttggaa actttcattg 12780acacttgagg ggcaccgcag ggaaattctc gtccttgcga gaaccggcta tgtcgtgctg 12840cgcatcgagc ctgcgccctt ggcttgtctc gcccctctcc gcgtcgctac ggggcttcca 12900gcgcctttcc gacgctcacc gggctggttg ccctcgccgc tgggctggcg gccgtctatg 12960gccctgcaaa cgcgccagaa acgccgtcga agccgtgtgc gagacaccgc ggccgccggc 13020gttgtggata cctcgcggaa aacttggccc tcactgacag atgaggggcg gacgttgaca 13080cttgaggggc cgactcaccc ggcgcggcgt tgacagatga ggggcaggct cgatttcggc 13140cggcgacgtg gagctggcca gcctcgcaaa tcggcgaaaa cgcctgattt tacgcgagtt 13200tcccacagat gatgtggaca agcctgggga taagtgccct gcggtattga cacttgaggg 13260gcgcgactac tgacagatga ggggcgcgat ccttgacact tgaggggcag agtgctgaca 13320gatgaggggc gcacctattg acatttgagg ggctgtccac aggcagaaaa tccagcattt 13380gcaagggttt ccgcccgttt ttcggccacc gctaacctgt cttttaacct gcttttaaac 13440caatatttat aaaccttgtt tttaaccagg gctgcgccct gtgcgcgtga ccgcgcacgc 13500cgaagggggg tgccccccct tctcgaaccc tcccggcccg ctaacgcggg cctcccatcc 13560ccccaggggc tgcgcccctc ggccgcgaac ggcctcaccc caaaaatggc agcgccagcc 13620aggacgtcgg ccgaaagagc gacaagcaga tcacgctttt cgacagcgtc ggatttgcga 13680tcgaggattt ttcggcgctg cgctacgtcc gcgaccgcgt tgagggatca agccacagca 13740gcccactcga ccttctagcc gacccagacg agccaaggga tctttttgga atgctgctcc 13800gtcgtcaggc tttccgacgt ttgggtggtt gaacagaagt cattatcgca cggaatgcca 13860agcactcccg aggggaaccc tgtggttggc atgcacatac aaatggacga acggataaac 13920cttttcacgc ccttttaaat atccgattat tctaataaac gctcttttct cttaggttta 13980cccgccaata tatcctgtca aacactgata gtttaaactg aaggcgggaa acgacaatct 14040gatcatgagc ggagaattaa gggagtcacg ttatgacccc cgccgatgac gcgggacaag 14100ccgttttacg tttggaactg acagaaccgc aacgttgaag gagccactca gcaagctatc 14160tatgtcgggt gcggagaaag aggtaatgaa atggc 14195674836DNAArtificialpVGW2 67aaatggccat aggcgatctc cttaatcaat agtagctgta acctcgaagc gtttcacttg 60taacaacgat tgagaacttt tgtcataaaa ttgaaatact tggttcgcat tttcgtcatc 120cgcggtcagc cgcaattctg acgaactgcc catttagctg gagatgattg tacatccttc 180acgtgaaaat ttctcaagcg ctgtgaacaa gggttcagat tttagattga aaggtgagcc 240gttgaaacac gttcttctta tcgatgacga tgtcgctatg cggcatctta ttatcgaata 300ccttacgatc cacgccttca aagtgaccgc ggtagccgac agcacccagt tcactagagt 360actctcttcc gcgacggtcg atgtcgtggt tgttgatcta gatttaggtc gtgaagatgg 420gcttgagatc gttcgaaatc tggcggcaaa gtctgatatt ccaatcataa ttatcagtgg 480cgaccgcctt gaggagacgg ataaagttgt tgcactcgag ctaggagcaa gtgattttat 540cgctaagccg tttagtacga gagagtttct tgcacgcatt cgggttgcct tgcgcgtgcg 600ccccaacgtt gtccgctcca aagaccgacg gtctttttgt tttactgact ggacacttaa 660tctcaggcaa cgtcgcttga tgtccgaagc tggcggtgag gtgaaactta cggcaggtga 720gttcaatctt ctcctcgcgt ttttagagaa accccgcgac gttctatcgc gcgagcaact 780tctcattgcc agtcgagtac gcgacgagga ggtttacgac aggagtatag atgttctcat 840tttgcggctg cgccgcaaac ttgaggcgga tccgtcaagc cctcaactga taaaaacagc 900aagaggtgcc ggttatttct ttgacgcgga cgtgcaggtt tcgcacgggg ggacgatggc 960agcctgagcc aattgcattt ggctcttaat tatctggctc aaaaggtgac tgaggacgcg 1020gccagcggcc tcaaacctac actcaatatt tggtgagggg ttccgatagg tccctcttca 1080cctgcatggc atgtttaacc gaatctgacg ttttccctgc aaatgccaaa atactatgcc 1140tatctccggg tttcgcgtga cggccaagac ccggaaaacc aaaaatacgg tttgctcgaa 1200tacgcgaacg ccaaaggctt cgcgccgcta cagatcgagg aagaaattgc cagcagagca 1260aaggactggc gcaagcgcaa gctcggagca atcatcgaaa aggccgagcg tggcgacgtg 1320ctactgacgc cggagattac gcgcattgcc ggttccgccc tcgccgcctt ggaaattctc 1380aaagcggcga gcgagcgcgg cctaatcgtc catgtgacca aacagaagat catcatggac 1440ggcagcctac aaagcgacat catggcaacc gtgcttggct tggctgcaca gatcgagcgg 1500catttcattc aggcacgtac caccgaggcg ctacaagtcg ccagagagcg cggcaagacg 1560ctcgggcgac ccaagggcag caaatcgagc gccttgaagc tggacagccg tattgatgaa 1620gtacaggcat acgtgaacct tggcttgccg caaagtcgcg cagccgagtt gttaggcgtc 1680agccctcaca ccttgcgcct gttcatcaaa cgccggaaca tcaaacccac aaacactaga 1740ccaaccatca ccatgccggg gagggaacaa catgcctaag aacaacaaag cccccggcca 1800tcgtatcaac gagatcatca agacgagcct cgcgctcgaa atggaggatg cccgcgaagc 1860tggcttagtc ggctacatgg cccgttgcct tgtgcaagcg accatgcccc acaccgaccc 1920caagaccagc tactttgagc gcaccaatgg catcgtcacc ttgtcgatca tgggcaagcc 1980gagcatcggc ctgccctacg gttctatgcc gcgcaccttg cttgcttgga tatgcaccga 2040ggccgtgcga acgaaagacc ccgtgttgaa ccttggccgg tcgcaatcgg aatttctaca 2100aaggctcgga atgcacaccg atggccgtta cacggccacc cttcgcaatc aggcgcaacg 2160cctgttttca tccatgattt cgcttgccgg cgagcaaggc aatgacttcg gcattgagaa 2220cgtcgtcatt gccaagcgcg cttttctatt ctggaatccc aagcggccag aagatcgggc 2280gctatgggat agcaccctca ccctcacagg cgatttcttc gaggaagtca cccgctcacc 2340ggttcctatc cgaatcgact acctgcatgc cttgcggcag tctccgcttg cgatggacat 2400ttacacgtgg ctgacctatc gcgtgttcct gttgcgggcc aagggccgcc ccttcgtgca 2460aatcccttgg gtcgccctgc aagcgcaatt cggctcatcc tatggcagcc gcgcacgcaa 2520ctcgcccgaa ctggacgata aggcccgaga gcgggcagag cgggcagcac tcgccagctt 2580caaatacaac ttcaaaaagc gcctacgcga agtgttgatt gtctatcccg aggcaagcga 2640ctgcatcgaa gatgacggcg aatgcctgcg catcaaatcc acacgcctgc atgtcacccg 2700cgcacccggc aagggcgctc gcatcggccc ccctccgact tgaccaggcc aacgctacgc 2760ttggcttggt caagccttcc catccaacag cccgccgtcg agcgggcttt tttatccccg 2820gaagcctgtg gatagagggt agttatccac gtgaaaccgc taatgccccg caaagccttg 2880attcacgggg ctttccggcc cgctccaaaa actatccacg tgaaatcgct aatcagggta 2940cgtgaaatcg ctaatcggag tacgtgaaat cgctaataag gtcacgtgaa atcgctaatc 3000aaaaaggcac gtgagaacgc taatagccct ttcagatcaa cagcttgcaa acacccctcg 3060ctccggcaag tagttacagc aagtagtatg ttcaattagc ttttcaatta tgaatatata 3120tatcaattat tggtcgccct tggcttgtgg acaatgcgct acgcgcaccg gctccgcccg 3180tggacaaccg caagcggttg cccaccgtcg agcgcctttg cccacaaccc ggcggccgca 3240acagatcgtt ttataaattt ttttttttga aaaagaaaaa gcccgaaagg cggcaacctc 3300tcgggcttct ggatttccga tcaacgcagg agtcgttcgg aaagtagctg ttccagaatt 3360ataggcgcag agacaccaga ttccaagatg gctctgttaa attgttgtag tatgtagtat 3420catacaacat actacagtac agaggcccgc aagaatggca atcactaaac aagacatttg 3480gcgagcagcc gacgaactgg acgccgaagg catccggccc actttggccg ccgtgcgcaa 3540gaaactcgga agcggtagct tcacaaccat ttccgatgca atggctgaat ggaaaaaccg 3600caagaccgcc accctgccct catcagaccc attgccggtt gcagtcaacg agcatcttgc 3660cgagcttggc aatgcgctat gggctatcgc cctggcgcac gccaacgccc ggtttgacga 3720agatcggaaa cagatcgagg ccgacaaagc ggccatcagc cagcagcttg ccgaagcaat 3780cgaactagcc gacaccttca cccgcgaaaa cgaccagctc cgcgaacgag tagatcccgg 3840gttgacataa gcctgttcgg ttcgtaaact gtaatgcaag tagcgtatgc gctcacgcaa 3900ctggtccaga accttgaccg aacgcagcgg tggtaacggc gcagtggcgg ttttcatggc 3960ttgttatgac tgtttttttg tacagtctat gcctcgggca tccaagcagc aagcgcgtta 4020cgccgtgggt cgatgtttga tgttatggag cagcaacgat gttacgcagc agcaacgatg 4080ttacgcagca gggcagtcgc cctaaaacaa agttaggtgg ctcaagtatg ggcatcattc 4140gcacatgtag gctcggccct gaccaagtca aatccatgcg ggctgctctt gatcttttcg 4200gtcgtgagtt cggagacgta gccacctact cccaacatca gccggactcc gattacctcg 4260ggaacttgct ccgtagtaag acattcatcg cgcttgctgc cttcgaccaa gaagcggttg 4320ttggcgctct cgcggcttac gttctgccca agtttgagca gccgcgtagt gagatctata 4380tctatgatct cgcagtctcc ggcgagcacc ggaggcaggg cattgccacc gcgctcatca 4440atctcctcaa gcatgaggcc aacgcgcttg gtgcttatgt gatctacgtg caagcagatt 4500acggtgacga tcccgcagtg gctctctata caaagttggg catacgggaa gaagtgatgc 4560actttgatat cgacccaagt accgccacct aacaattcgt tcaagccgag atcggcttcc 4620cggccgcgga gttgttcggt aaattgctag ctttaagggc gaattctgca gatatccatc 4680acactggcgg ccgctcgagc atgcatctag agggcccaat tcgccctata gtgagtcgta 4740ttacaattca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca 4800acttaatcgc cttgcagcac atcccccttt cgccag 48366829DNAArtificialprimer for amplification 68cggtctagag tgcgcagcag ctcgttatc 296943DNAArtificialprimer for amplification 69agctatctat gtcgggtgcg gagaaagagg taatgaaatg gca 437043DNAArtificialprimer for amplification 70agcttgccat ttcattacct ctttctccgc acccgacata gat 437134DNAArtificialprimer for amplification 71cagggtaatc aactttgtat aataaagttg ataa 347234DNAArtificialprimer for amplification 72caactttatt atacaaagtt gattaccctg ttat 347360DNAArtificialprimer for amplification 73gggtagttct acttctgttc atgtttgtgt tagatccgtg tttgtgttag atccgtgctg 607466DNAArtificialprimer for amplification 74ctagcgccgg atctaacaca aacacggatc taacacaaac atgaacagaa gtagaactac 60ccggcc 667513DNAArtificialprimer for amplification 75agcttgggcc ctt 13768DNAArtificialprimer for amplification 76agggccca 87736DNAArtificialprimer for amplification 77aaaggatccc gggttgacat aagcctgttc ggttcg 367831DNAArtificialprimer for amplification 78aaagctagca atttaccgaa caactccgcg g 317930DNAArtificialprimer for amplification 79aaatggccat aggcgatctc cttaatcaat 308024DNAArtificialprimer for amplification 80agtgtgtggc atggtgcatt tccg 248124DNAArtificialprimer for amplification 81ctctacagga tacacggtgt aagg 24

Claims

1. A cosmid vector having a full length of 15 kb or less characterized in that: 1) it contains an origin of replication (oriV) of an IncP plasmid, but does not contain any origin of replication of other plasmid groups; 2) it contains the trfA1 gene of an IncP plasmid; 3) it contains an origin of conjugative transfer (oriT) of an IncP plasmid; 4) it contains the incC1 gene of an IncP plasmid; 5) it contains a cos site of lambda phage and the cos site is located outside the T-DNA; 6) it contains a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium; 7) it contains a T-DNA right border sequence of a bacterium of the genus Agrobacterium; 8) it contains a T-DNA left border sequence of a bacterium of the genus Agrobacterium; 9) it contains a selectable marker gene for plant transformation located between 7) and 8) and expressed in a plant; and 10) it contains restriction endonuclease recognition site(s) located between 7) and 8) for cloning a foreign gene, wherein the cosmid vector is selected from the group consisting of: the cosmid vector pLC40 consisting of the nucleotide sequence of SEQ ID NO: 2 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; the cosmid vector pLC40GWH consisting of the nucleotide sequence of SEQ ID NO: 3 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; the cosmid vector pLC40 bar consisting of the nucleotide sequence of SEQ ID NO: 4 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; the cosmid vector pLC40GWB consisting of the nucleotide sequence of SEQ ID NO: 5 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; the cosmid vector pLC40GWHKorB consisting of the nucleotide sequence of SEQ ID NO: 65 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; the cosmid vector pLCleo consisting of the nucleotide sequence of SEQ ID NO: 66 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; and the cosmid vector pLC40GWHvG1 consisting of the nucleotide sequence of SEQ ID NO: 7 or an equivalent thereof consisting of a nucleotide sequence having at least 95% identity to the nucleotide sequence; wherein the cosmid vector is stably maintained in E. coli and Agrobacterium cells.

2. A method for transforming a plant, comprising transforming the plant with a bacterium of the genus Agrobacterium harboring an expression vector containing a nucleic acid fragment of a plant inserted into the cosmid vector of claim 1.

3. A method for transforming a plant, comprising transforming the plant with a bacterium of the genus Agrobacterium harboring the cosmid vector according to claim 1 and a plasmid vector characterized in that: 1) it contains an element necessary for the replication of an IncW plasmid, but does not contain any origin of replication of other plasmid groups; 2) it contains the repA gene necessary for the replication of an IncW plasmid; 3) it contains a drug resistance gene expressed in E. coli and a bacterium of the genus Agrobacterium; and 4) the virG gene of a bacterium of the genus Agrobacterium.

4. The method for transforming a plant according to claim 2 or 3, wherein the selectable marker gene for plant transformation is selected from the group consisting of a hygromycin resistance gene, a phosphinotricin resistance gene and a kanamycin resistance gene.